NUCLEIC ACIDS ENCODING A NOVEL REGULATOR OF A G PROTEIN SIGNALING, RGS18, AND USES THEREOF

ACIDES NUCLEIQUES CODANT UN NOUVEAU REGULATEUR DE LA SIGNALISATION DE LA PROTEINE G, RGS18, ET LEURS UTILISATIONS

English Abstract

The present invention relates to nucleic acids that encode novel Regulator of
G protein Signaling RGS18 polypeptides. RGS18 polypeptides are abundantly
expressed in platelets and comprise a novel RGS domain (RGS18 domain). The
present invention also relates to RGS18 polypeptides. The invention also
relates to means for the detection of RGS18 nucleic acids and RGS18
polypeptides. The invention also relates to methods for the detection of
activators or inhibitors of RGS18 polypeptides. Finally, the present invention
relates to methods of prevention and/or treatment of disorders or conditions
associated with platelet activation dysfunction.

French Abstract

L'invention concerne des acides nucléiques codant un nouveau régulateur des polypeptides RGS18 de signalisation de la protéine G. Ces polypeptides RGS18 sont abondamment exprimés dans les plaquettes et comprennent un nouveau domaine RGS (domaine RGS18). Elle concerne également des polypeptides RGS18. Elle concerne des moyens servant à détecter des acides nucléiques RGS18 et des polypeptides RGS18. Elle concerne des procédés servant à détecter des activateurs ou des inhibiteurs de ces polypeptides RGS18. Elle concerne enfin des procédés de prévention et/ou de traitement de maladies ou de troubles associés au dysfonctionnement de l'activation des plaquettes.

Claims

-97-


CLAIMS:

1. An isolated nucleic acid comprising a polynucleotide sequence of a) any one
of
SEQ ID NOs: 11, 18, or 19, or of a complementary polynucleotide sequence, b)
nucleotides 1-169 of
SEQ ID NO: 11, or of a complementary polynucleotide sequence, c) nucleotides 1-
658 of SEQ ID NO:
19, or of a complementary polynucleotide sequence, d) nucleotides 163-870 of
SEQ ID NO: 19, or of a
complementary polynucleotide sequence, e) nucleotides 163-658 of SEQ ID NO:
19, or of a
complementary polynucleotide sequence, f) nucleotides 418-768 of SEQ ID NO:
19, or of a
complementary polynucleotide sequence, or g) nucleotides 418-658 of SEQ ID NO:
19, or of a
complementary polynucleotide sequence.
2. An isolated nucleic acid comprising at least eight consecutive nucleotides
of a
polynucleotide sequence of a) nucleotides 1-169 of SEQ ID NO: 11, or of a
complementary
polynucleotide sequence, b) nucleotides 1-658 of SEQ ID NO: 19, or of a
complementary
polynucleotide sequence, c) nucleotides 163-658 of SEQ ID NO: 19, or of a
complementary
polynucleotide sequence, or d) nucleotides 418-658 of SEQ ID NO: 19, or of a
complementary
polynucleotide sequence.
3. An isolated nucleic acid comprising at least 80% nucleotide identity with a
nucleic
acid comprising a) any one of SEQ ID NOs: 11, 18, or 19, or a complementary
polynucleotide
sequence, b) nucleotides 1-169 of SEQ ID NO: 11, or a complementary
polynucleotide sequence, c)
nucleotides 1-658 of SEQ ID NO: 19, or a complementary polynucleotide
sequence, d) nucleotides
163-870 of SEQ ID NO: 19, or a complementary polynucleotide sequence, e)
nucleotides 163-658 of
SEQ ID NO: 19, or a complementary polynucleotide sequence, f) nucleotides 418-
768 of SEQ ID NO:
19, or a complementary polynucleotide sequence, or g) nucleotides 418-658 of
SEQ ID NO: 19, or a
complementary polynucleotide sequence.
4. The isolated nucleic acid according to claim 3, wherein the nucleic acid
comprises an
85%, 90%, 95%, or 98% nucleotide identity with the nucleic acid comprising a)
any one of
SEQ ID NOs: 11, 18, or 19, or a complementary polynucleotide sequence, b)
nucleotides 1-169 of
SEQ ID NO: 11, or a complementary polynucleotide sequence, c) nucleotides 1-
658 of SEQ ID NO:
19, or a complementary polynucleotide sequence, d) nucleotides 163-870 of SEQ
ID NO: 19, or a
complementary polynucleotide sequence, e) nucleotides 163-658 of SEQ ID NO:
19, or a
complementary polynucleotide sequence, f) nucleotides 418-768 of SEQ ID NO:
19, or a
complementary polynucleotide sequence, or g) nucleotides 418-658 of SEQ ID NO:
19, or a
complementary polynucleotide sequence.
5. An isolated nucleic acid that hybridizes under high stringency conditions
with a
nucleic acid comprising a) any one of SEQ ID NOs: 11, 18, or 19, or a
complementary polynucleotide
sequence, b) nucleotides 1-169 of SEQ ID NO: 11, or a complementary
polynucleotide sequence, c)
nucleotides 1-658 of SEQ ID NO: 19, or a complementary polynucleotide
sequence, d) nucleotides


-98-


163-870 of SEQ ID NO: 19, or a complementary polynucleotide sequence, e)
nucleotides 163-658 of
SEQ ID NO: 19, or a complementary polynucleotide sequence, f) nucleotides 418-
768 of SEQ ID NO:
19, or a complementary polynucleotide sequence, or g) nucleotides 418-658 of
SEQ ID NO: 19, or a
complementary polynucleotide sequence.
6. An isolated nucleic acid comprising a polynucleotide sequence as depicted
in either
one of SEQ ID NOs: 18 or 19, or of a complementary polynucleotide sequence.
7. A nucleotide probe or primer specific for an RGS18 nucleic acid, wherein
the
nucleotide probe or primer comprises at least 15 consecutive nucleotides of a
polynucleotide sequence
of nucleotides a) 1-169 of SEQ ID NO: 11, or of a complementary polynucleotide
sequence, b) 1-658
of SEQ ID NO: 19, or of a complementary polynucleotide sequence, c) 163-658 of
SEQ ID NO: 19, or
of a complementary polynucleotide sequence, or d) 418-658 of SEQ ID NO: 19, or
of a
complementary polynucleotide sequence.
8. The nucleotide probe or primer according to claim 7, wherein the nucleotide
probe or
primer comprises a marker compound.
9. A nucleotide probe or primer specific for an RGS18 nucleic acid, wherein
the
nucleotide probe or primer comprises a) any one of SEQ ID NOs: 9, 10, 14, 15,
16, 17, 30, 31, 32, 33,
34, 35, or 36, or of a complementary polynucleotide sequence, b) 1-169 of SEQ
ID NO: 11, or of a
complementary polynucleotide sequence, c) 1-658 of SEQ ID NO: 19, or of a
complementary
polynucleotide sequence, d) 163-658 of SEQ ID NO: 19, or of a complementary
polynucleotide
sequence, or e) 418-658 of SEQ ID NO: 19, or of a complementary polynucleotide
sequence.
10. The nucleotide probe or primer according to claim 9, wherein the
nucleotide probe or
primer comprises a marker compound.
11. A method of amplifying a region of the nucleic acid according to claim 1,
wherein the
method comprises:
a) contacting the nucleic acid with two nucleotide primers, wherein the first
nucleotide primer
hybridizes at a position 5' of the region of the nucleic acid, and the second
nucleotide primer
hybridizes at a position 3' of the region of the nucleic acid, in the presence
of reagents necessary for an
amplification reaction; and
b) detecting the amplified nucleic acid region.
12. The method according to claim 11, wherein the two nucleotide primers are
selected
from the group consisting of
A) a nucleotide primer comprising at least 15 consecutive nucleotides of a
polynucleotide sequence of nucleotides a) 1-169 of SEQ ID NO: 11, or of a
complementary
polynucleotide sequence, b) 1-658 of SEQ ID NO: 19, or of a complementary
polynucleotide
sequence, c) 163-658 of SEQ ID NO: 19, or of a complementary polynucleotide
sequence, or d) 418-
658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, and


-99-


B) a nucleotide primer comprising a polynucleotide sequence of a) any one of
SEQ ID NOs: 9,
10, 14, 15, 16, 17, 30, 31, 32, 33, 34, 35, or 36, or of a complementary
polynucleotide sequence, b) 1-
169 of SEQ ID NO: 11, or of a complementary polynucleotide sequence, c) 1-658
of SEQ ID NO: 19,
or of a complementary polynucleotide sequence, d) 163-658 of SEQ ID NO: 19, or
of a
complementary polynucleotide sequence, or e) 418-658 of SEQ ID NO: 19, or of a
complementary
polynucleotide sequence.
13. A kit for amplifying the nucleic acid according to claim 1, wherein the
kit comprises:
a) two nucleotide primers whose hybridization position is located respectively
5' and 3' of the
region of the nucleic acid; and optionally,
b) reagents necessary for an amplification reaction.
14. The kit according to claim 13, wherein the two nucleotide primers are
selected from
the group consisting of
A) a nucleotide primer comprising at least 15 consecutive nucleotides of a
polynucleotide sequence of nucleotides a) 1-169 of SEQ ID NO: 11, or of a
complementary
polynucleotide sequence, b) 1-658 of SEQ ID NO: 19, or of a complementary
polynucleotide
sequence, c) 163-658 of SEQ ID NO: 19, or of a complementary polynucleotide
sequence, or d) 418-
658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, and
B) a nucleotide primer comprising a polynucleotide sequence of a) any one of
SEQ ID NOs: 9,
10, 14, 15, 16, 17, 30, 31, 32, 33, 34, 35, or 36, or of a complementary
polynucleotide sequence, b) 1-
169 of SEQ ID NO: 11, or of a complementary polynucleotide sequence, c) 1-658
of SEQ ID NO: 19,
or of a complementary polynucleotide sequence, d) 163-658 of SEQ ID NO: 19, or
of a
complementary polynucleotide sequence, or e) 418-658 of SEQ ID NO: 19, or of a
complementary
polynucleotide sequence.
15. A method of detecting a nucleic acid according to claim 1, wherein the
method
comprises:
A) contacting the nucleic acid with a nucleotide probe selected from the group
consisting of
1) a nucleotide probe comprising at least 15 consecutive nucleotides of a
polynucleotide sequence of nucleotides a) 1-169 of SEQ ID NO: 11, or of a
complementary
polynucleotide sequence, b) 1-658 of SEQ ID NO: 19, or of a complementary
polynucleotide
sequence, c) 163-658 of SEQ ID NO: 19, or of a complementary polynucleotide
sequence, or d) 418-
658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, and
2) a nucleotide probe comprising a polynucleotide sequence of a) any one
of SEQ ID NOs: 9, 10, 14, 15, 16, 17, 30, 31, 32, 33, 34, 35, or 36, or of a
complementary
polynucleotide sequence, b) 1-169 of SEQ ID NO: 11, or of a complementary
polynucleotide
sequence, c) 1-658 of SEQ ID NO: 19, or of a complementary polynucleotide
sequence, d) 163-658 of


-100-


SEQ ID NO: 19, or of a complementary polynucleotide sequence, or e) 418-658 of
SEQ ID NO: 19, or
of a complementary polynucleotide sequence,
and
B) detecting a complex formed between the nucleic acid and the probe.
16. The method of detection according to claim 15, wherein the probe is
immobilized on a
support.
17. A kit for detecting the nucleic acid according to claim 1, wherein the kit
comprises
A) a nucleotide probe selected from the group consisting of
1) a nucleotide probe comprising at least 15 consecutive nucleotides of a
polynucleotide sequence of nucleotides a) 1-169 of SEQ ID NO: 11, or of a
complementary
polynucleotide sequence, b) 1-658 of SEQ ID NO: 19, or of a complementary
polynucleotide
sequence, c) 163-658 of SEQ ID NO: 19, or of a complementary polynucleotide
sequence, or d) 418-
658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, and
2) a nucleotide primer comprising a polynucleotide sequence of a) any one
of SEQ ID NOs: 9, 10, 14, 15, 16, 17, 30, 31, 32, 33, 34, 35, or 36, or of a
complementary
polynucleotide sequence, b) 1-169 of SEQ ID NO: 11, or of a complementary
polynucleotide
sequence, c) 1-658 of SEQ ID NO: 19, or of a complementary polynucleotide
sequence, d) 163-658 of
SEQ ID NO: 19, or of a complementary polynucleotide sequence, or e) 418-658 of
SEQ ID NO: 19, or
of a complementary polynucleotide sequence,
and optionally,
B) a reagent necessary for a hybridization reaction.
18. The kit according to claim 17, wherein the probe is immobilized on a
support.
19. A recombinant vector comprising the nucleic acid according to claim 1.
20. The recombinant vector according to claim 19, wherein the recombinant
vector is an
adenovirus.
21. A recombinant vector comprising the nucleic acid according to claim 6.
22. The recombinant vector according to claim 21, wherein the recombinant
vector is an
adenovirus.
23. A recombinant host cell comprising the nucleic acid according to claim 1.
24. A recombinant host cell comprising the nucleic acid according to claim 6.
25. A recombinant host cell comprising the recombinant vector according to
claim 19.
26. A recombinant host cell comprising the recombinant vector according to
claim 21.
27. An isolated nucleic acid encoding a polypeptide comprising an amino acid
sequence of
a) either one of SEQ ID NOs: 12 or 20, b) amino acids 1-58 of SEQ ID NO: 12,
c) amino acids 1-166
of SEQ ID NO: 20, d) amino acids 86-202 of SEQ ID NO: 20, or e) amino acids 86-
166 of SEQ ID
NO: 20.
28. A recombinant vector comprising the nucleic acid according to claim 27.


-101-


29. A recombinant host cell comprising the recombinant vector according to
claim 28.
30. A recombinant host cell comprising the nucleic acid according to claim 27.
31. An isolated polypeptide comprising an amino acid sequence of a) either one
of SEQ
ID NOs: 12 or 20, b) amino acids 1-58 of SEQ ID NO: 12, c) amino acids 1-166
of SEQ ID NO: 20, d)
amino acids 86-202 of SEQ ID NO: 20, or e) amino acids 86-166 of SEQ ID NO:
20.
32. An antibody directed against the isolated polypeptide according to claim
31.
33. The antibody according to claim 32, wherein the antibody comprises a
detectable
compound.
34. An isolated polypeptide comprising an amino acid sequence as depicted in
SEQ ID
NO: 20.
35. An antibody directed against the isolated polypeptide according to claim
34.
36. The antibody according to claim 35, wherein the antibody comprises a
detectable
compound.
37. A method of detecting a polypeptide, wherein the method comprises
a) contacting the polypeptide with an antibody according to claim 32; and
b) detecting an antigen/antibody complex formed between the polypeptide and
the antibody.
38. A diagnostic kit for detecting a polypeptide, wherein the kit comprises
a) the antibody according to claim 32; and
b) a reagent allowing detection of an antigen/antibody complex formed between
the
polypeptide and the antibody.
39. A pharmaceutical composition comprising the nucleic acid according to
claim 1 and a
physiologically compatible excipient.
40. A pharmaceutical composition comprising the nucleic acid according to
claim 6 and a
physiologically compatible excipient.
41. A pharmaceutical composition comprising the recombinant vector according
to claim
19 and a physiologically compatible excipient.
42. A pharmaceutical composition comprising the recombinant vector according
to claim
21 and a physiologically compatible excipient.
43. A pharmaceutical composition comprising the nucleic acid according to
claim 27 and
a physiologically compatible excipient.
44. A pharmaceutical composition comprising the recombinant vector according
to claim
28 and a physiologically compatible excipient.
45. A pharmaceutical composition comprising the recombinant host cell
according to
claim 29 and a physiologically compatible excipient.
46. A pharmaceutical composition comprising the recombinant host cell
according to
claim 30 and a physiologically compatible excipient.


-102-


47. A pharmaceutical composition comprising the polypeptide according to claim
31 and a
physiologically compatible excipient.
48. A pharmaceutical composition comprising the polypeptide according to claim
34 and a
physiologically compatible excipient.
49. Use of the nucleic acid according to claim 1 for the manufacture of a
medicament
intended for the prevention or treatment of a platelet activation dysfunction.
50. Use of the nucleic acid according to claim 6 for the manufacture of a
medicament for
the prevention or treatment of a platelet activation dysfunction.
51. Use of the recombinant vector according to claim 19 for the manufacture of
a
medicament for the prevention or treatment of a platelet activation
dysfunction.
52. Use of the recombinant vector according to claim 21 for the manufacture of
a
medicament intended for the prevention or treatment of a platelet activation
dysfunction.
53. Use of the nucleic acid according to claim 27 for the manufacture of a
medicament for
the prevention or treatment of a platelet activation dysfunction.
54. Use of the recombinant vector according to claim 28 for the manufacture of
a
medicament for the prevention or treatment of a platelet activation
dysfunction.
55. Use of the recombinant host cell according to claim 29 for the manufacture
of a
medicament for the prevention or treatment of a platelet activation
dysfunction.
56. Use of the recombinant host cell according to claim 30 for the manufacture
of a
medicament for the prevention or treatment of a platelet activation
dysfunction.
57. Use of the polypeptide according to claim 31 for the manufacture of a
medicament
intended for the prevention or treatment of a platelet activation dysfunction.
58. Use of the polypeptide according to claim 31 for screening an active
ingredient for the
prevention or treatment of a platelet activation dysfunction.
59. Use of a recombinant host cell expressing the polypeptide according to
claim 31 for
screening an active ingredient for the prevention or treatment of a platelet
activation dysfunction.
60. An implant comprising the recombinant host cell according to claim 23.
61. An implant comprising the recombinant host cell according to claim 25.
62. An implant comprising the recombinant host cell according to claim 29.
63. A method of identifying a modulator, agonist, or antagonist of an RGS18
polypeptide
in a sample comprising
a) incubating a labeled GTP-loaded G protein polypeptide with an RGS18
polypeptide with the
sample;
b) measuring the rate or extent of GTP hydrolysis; and
c) comparing the rate or extent of GTP hydrolysis determined in step b) with a
rate or extent of
GTP hydrolysis measured with a reconstituted labeled GTP-loaded G protein
polypeptide/RGS18
poylpeptide mixture that has not been previously incubated in the presence of
the sample.


-103-


64. The method according to claim 63, wherein the labeled GTP-loaded G protein
polypeptide of step a) is loaded with .gamma.-32P-GTP and the rate or extent
of GTP hydrolysis of step b) is
measured by determining the amount of free 32P i released.
65. The method according to claim 63, wherein the RGS18 polypeptide comprises
an
amino acid sequence selected from the group consisting of SEQ ID NO: 12, SEQ
ID NO: 20, amino
acids 1-58 of SEQ ID NO: 12, amino acids 1-166 of SEQ ID NO: 20, amino acids
86-202 of SEQ ID
NO: 20, and amino acids 86-166 of SEQ ID NO: 20.
66. A method of identifying a modulator, agonist, or antagonist of an RGS18
polypeptide
in a sample comprising
a) incubating a cell membrane fraction expressing an RGS18 polypeptide with a
labeled GTP
and the sample;
b) measuring the rate or extent of GTP hydrolysis; and
c) comparing the rate or extent of GTP hydrolysis determined in step b) with a
rate or extent of
GTP hydrolysis measured with a cell membrane fraction expressing an RGS18
polypeptide that has
not been previously incubated in the presence of the sample.
67. The method according to claim 66, wherein the cell membrane fraction is
obtained
from a cell that, either naturally or after transfecting the cell with an
RGS18 encoding nucleic acid,
expresses an RGS18 polypeptide, and isolating the cell's membrane.
68. The method according to claim 66, wherein the labeled GTP of step a) is
labeled with
.gamma.-32P and the rate or extent of GTP hydrolysis of step b) is measured by
determining the amount of free
32P i released.
69. The method according to claim 66, wherein the RGS18 polypeptide comprises
an
amino acid sequence selected from the group consisting of SEQ ID NO: 12, SEQ
ID NO: 20, amino
acids 1-58 of SEQ ID NO: 12, amino acids 1-166 of SEQ ID NO: 20, amino acids
86-202 of SEQ ID
NO: 20, and amino acids 86-166 of SEQ ID NO: 20.
70. A method of identifying a modulator, agonist, or antagonist of an RGS18
polypeptide
in a sample comprising
a) incubating a cell expressing an RGS18 polypeptide with a labeled adenine
and the sample;
b) measuring the amount of labeled cyclic AMP (cAMP) produced; and
c) comparing the amount of labeled cAMP measured in step b) with an amount of
labeled
cAMP measured with a cell expressing an RGS18 polypeptide that has not been
previously incubated
in the presence of the sample.
71. The method according to claim 70, wherein the cell expressing the RGS18
polypeptide
is transfected with an RGS18 encoding nucleic acid.
72. The method according to claim 70, wherein the labeled adenine of step a)
is 3H-
adenine.


-104-


73. The method according to claim 70, wherein the RGS18 polypeptide comprises
an
amino acid sequence selected from the group consisting of SEQ ID NO: 12, SEQ
ID NO: 20, amino
acids 1-58 of SEQ ID NO: 12, amino acids 1-166 of SEQ ID NO: 20, amino acids
86-202 of SEQ ID
NO: 20, and amino acids 86-166 of SEQ ID NO: 20.
74. A method of identifying a modulator, agonist, or antagonist of an RGS18
polypeptide
in a sample comprising
a) incubating a cell expressing an RGS18 polypeptide with a labeled inositol
and the sample;
b) measuring the amount of labeled inositol triphosphate produced; and
c) comparing the amount of labeled inositol triphosphate measured in step b)
with an amount
of labeled inositol triphosphate measured with a cell expressing an RGS18
polypeptide that has not
been previously incubated in the presence of the sample.
75. The method according to claim 74, wherein the cell expressing the RGS18
polypeptide
is transfected with an RGS18 encoding nucleic acid.
76. The method according to claim 74, wherein the labeled inositol of step a)
is 3H-
inositol.
77. The method according to claim 74, wherein the RGS18 polypeptide comprises
an
amino acid sequence selected from the group consisting of SEQ ID NO: 12, SEQ
ID NO: 20, amino
acids 1-58 of SEQ ID NO: 12, amino acids 1-166 of SEQ ID NO: 20, amino acids
86-202 of SEQ ID
NO: 20, and amino acids 86-166 of SEQ ID NO: 20.

Description

CA 02408073 2002-10-28
NUCLEIC ACIDS ENCODING A NOVEL REGULATOR OF G PROTEIN SIGNALING,
RGS18, AND USES THEREOF
FIELD OF THE INVENTION
The present invention relates to nucleic acids encoding a novel Regulator of G
protein
Signaling (RGS) protein, RGS 18. RGS 18 is abundantly expressed in platelets
and comprises a novel
RGS domain (RGS18 domain). The present invention also relates to nucleic acids
encoding a
polypeptide comprising the novel RGS18 domain. The present invention also
relates to a cDNA
encoding the novel full length RGS 18 protein. In addition, the present
invention relates to the RGS 18
protein and polypeptides comprising the novel RGS 18 domain. The invention
also relates to a
recombinant vector comprising a nucleic acid according to the invention. The
invention also relates to
means for the detection of RGS 18 nucleic acids, protein, and RGS 18 domain
comprising polypeptides.
. The invention also relates to methods for the detection of activators or
inhibitors of RGS 18 protein and
RGS 18 domain comprising polypeptides. Finally, the present invention relates
to methods of
prevention and/or treatment of disorders or conditions associated with
platelet activation dysfunction.
BACKGROUND OF THE INVENTION
The evolution of multicellular organisms has been dependent on the capacity of
cells to
communicate with each other and with their immediate environment. Membrane
bound receptors have
been found to play a crucial role in such communication. They can recognize
intercellular messenger
molecule such as hormones, neurotransmitters, growth, and development factors
as well as sensory
messengers, such as odorant, gustative and light. These receptors belong to
about five protein families;
the most common family is the G protein-coupled receptor family (GPCR). GPCRs
are involved in the
recognition of messages as diverse as light, odorant, calcium, small molecules
including amino acid
residues, nucleotides and peptides. Following binding of such messages to
GPCRs, signal transduction
proceeds via recruitment of G-proteins, activated by binding and hydrolyzing
GTP on the intracellular
level. Biological actions of GPCR include controlling the activity of
intracellular enzymes, ion


CA 02408073 2002-10-28
-2-
channels and transport of vesicles via the catalysis of the GDP-GTP exchange
on heterotrimeric G
proteins (Ga -(3y) (1-4).
A main feature in the structure of GPCR is a central core domain that
encompasses seven
transmembrane helices (TMI-VI), spaced by three intracellular loops (IPI-IIIJ
and three extracellular
loops (ECI-III). These three core domains differ in sequence and function
among members of the
GPCR superfamily, in their N-terminal extracellular domain, C-terminal
intracellular domain and their
intracellular loops.
Several platelet agonists act via activation of cell surface GPCR initiating
intracellular
signaling cascades that culminate in platelet aggregation. Signaling through G
protein coupled
receptors, such as thrombin, thromboxane AZ and adenosine diphosphate (ADP) is
in part responsible
for platelet activation events, such as fibrinogen receptor exposure, granule
secretion and aggregation
(5). Multiple intracellular signaling pathways have been implicated in
platelet activation events,
although the exact sequence of events and host of intracellular signaling
molecules remains undefined.
Regulators of G protein Signaling (RGS) represent a family of proteins that
function to
dampen signals generated upon stimulation of cell-surface G protein-coupled
receptors. First identified
in genetic screens of yeast (6, 7) and the nematode Caenorhabditis elegans
(8), RGSs were first
discovered based on their ability to modulate behavioral responses. Mammalian
homologues of these
lower eukaryotic RGSs were quickly identified by several methods including
yeast two-hybrid (9),
homology cloning (10), database searching (8), or subtractive cloning, or
expression methods (11-13).
The hallmark of this family is a highly homologous 120 amino acid region
termed an RGS domain.
Currently there are more than 30 mammalian proteins or partial sequences that
contain a putative RGS
domain (14). Some RGS family members are relatively low molecular weight
proteins composed
primarily of the RGS domain flanked by short amino and carboxy-terminal
regions, and others are
quite large with putative functional domains which implicate them in
scaffolding reactions [e.g.,
pleckstrin homology (PH) domain, Dbl domain that is homologous to the dbl
proto-oncogene domain,
DEP domain that is present in dishevelled, egl-10, and pleckstrin domain, and
G protein y-like (GGL)
subunit domain] (14).
RGS proteins are thought to regulate GPCR signaling by interacting with the
alpha subunits of
heterotrimeric GTP-binding proteins. Heterotrimeric G proteins act as
molecular switches in GPCR-
mediated signal transduction controlling the rate and extent of activation of
the effector (for a review
of heterotrimeric G proteins, see 15). Stimulation of receptors by agonists
leads to rapid dissociation of
GDP from the a subunit and exchange for GTP. While complexed with GTP, the
alpha subunit is held
in its active state and results in interaction with downstream effectors.
Hydrolysis of GTP returns the
alpha subunit to its GDP-bound or inactive state. RGS proteins attenuate
signaling through GPCRs by
acting as GTPase activating proteins (GAPs) (13, 16, 17). By accelerating GTP
hydrolysis, the RGS
protein limits the time the Ga subunit spends in its active state. Structural
studies indicate that RGSs


CA 02408073 2002-10-28
-3-
bind to the transition state of the alpha subunit thereby stabilizing it and
accelerating GTP hydrolysis
(18,19). The transition state of the G« subunit can be mimicked ih vitro via
treatment of the alpha
subunits with aluminum tetrafluoride (AlF4 ). So far RGSs have been identified
which interact with
and activate members of the G«; family (G«;I, G«;z, G«;3, G«Z, G«o, G«r),
G«qim, and G«izn3 but not G«s
(14). In addition to their GAP activity, RGSs may also block signaling by
acting as effector
antagonists (20, 21). RGS proteins have been identified in a variety of cell
types and tissues which
profoundly alter many GPCR-stimulated intracellular effectors, including
regulation of adenylyl
cyclase (22), MAP kinase activity (10, 20), inositol trisphosphate and
Caz+signaling (21-23), K+
channel conductances (24) and visual signal transduction (25, 26).
Since several of these signaling cascades are involved in platelet activation,
it is likely that one
or more members of the RGS superfamily might be present in platelets and be
responsible for
regulating signaling pathways critical for platelet activation. In platelets,
receptors for ADP,
thromboxane Az and thrombin couple to heterotrimeric GTP-binding proteins that
transduce the signals
to intracellular effectors, resulting in inhibition of adenylyl cyclase,
activation of phospholipase C and
mobilization of intracellular calcium (5). All three of these receptors appear
to couple to one or more
alpha subunits in platelets. For ADP there are at least two receptors on the
platelet surface coupled to
heterotrimeric G proteins. The putative P2TA~ is coupled to G«;(27), and the
P2Y1 is coupled to G«q,11,
(28). Thrombin receptors appear to couple to G«;, G«q,n and G«1zi13 family
members (29-31).
Thromboxane Az receptors have been shown to interact with both G«Q,11 (32-35),
G«13 (31, 36) and G«;
(33) isoforms. More recently it has been shown that in platelets, concomitant
activation of both G«;
and G«Q linked pathways are critical for platelet aggregation by ADP (37, 38).
Not surprisingly, G«q
has been implicated as an integral regulator of hemostasis in mice, since G«g
knock-out mice exhibit
profound bleeding tendencies, and die perinatally from hemorrhage (39).
The citation of any reference herein should not be construed as an admission
that such
reference is available as "Prior Art" to the instant application.
SUMMARY OF THE INVENTION
The present invention relates to nucleic acids encoding a novel Regulator of G
protein
Signaling (RGS) protein, RGS18. Thus, a first subject of the invention is a
nucleic acid comprising a
polynucleotide sequence of a) any one of SEQ ID NOs: 11, 18, or 19, or of a
complementary
polynucleotide sequence, b) nucleotides 1-169 of SEQ m NO: 11, or of a
complementary
polynucleotide sequence, c) nucleotides 1-658 of SEQ ID NO: 19, or of a
complementary
polynucleotide sequence, d) nucleotides 163-870 of SEQ ID NO: 19, or of a
complementary
polynucleotide sequence, e) nucleotides 163-658 of SEQ ID NO: 19, or of a
complementary
polynucleotide sequence, f) nucleotides 418-768 of SEQ ID NO: 19, or of a
complementary


CA 02408073 2002-10-28
-4-
polynucleotide sequence, or g) nucleotides 418-658 of SEQ ID NO: 19, or of a
complementary
polynucleotide sequence.
The invention also relates to a nucleic acid comprising at least 8 consecutive
nucleotides of a
nucleic acid according to the invention. Preferably, a nucleic acid according
to the invention will
comprise 10, 12, 15, 18, 20 to 25, 35, 40, 50, 70, 80, 100, 200, 500, 1000, or
1500 consecutive
nucleotides of a nucleic acid according to the invention.
The invention also relates to a nucleic acid having at least 80% nucleotide
identity with a
nucleic acid according to the invention. The invention also relates to a
nucleic acid having at least
85%, preferably 90%, more preferably 95% and still more preferably 98%
nucleotide identity with a
nucleic acid according to the invention.
The invention also relates to a nucleic acid hybridizing, under high
sfiringency conditions, with
a polynucleotide sequence of a nucleic acid of the invention.
The present invention also relates to nucleic acids encoding a polypeptide
comprising the
novel RGS 18 domain. Thus, a second subject of the invention relates to a
nucleic acid comprising a
polynucleotide sequence of a) either of SEQ )D NOs: 18 or 19, or of a
complementary polynucleotide
sequence, b) nucleotides 163-870 of SEQ ID NO: 19, or of a complementary
polynucleotide sequence,
or c) nucleotides 418-768 of SEQ )D NO: 19, or of a complementary
polynucleotide sequence.
The invention also relates to nucleic acids, particularly cDNA molecules,
which encode the
full length human RGS 18 protein. The present invention also relates to a cDNA
molecule that
encodes the novel full length RGS 18 protein. Thus, the invention relates to a
nucleic acid comprising
a polynucleotide sequence of a) either of SEQ ID NOs: 18 or 19, or of a
complementary
polynucleotide sequence, or b) nucleotides 163-870 of SEQ >D NO: 19, or of a
complementary
polynucleotide sequence.
According to the invention, a nucleic acid comprising a polynucleotide
sequence of either
SEQ ID NOs: 18 or 19 encodes a full length RGS18 domain polypeptide of 235
amino acids
comprising the amino acid sequence of SEQ ID NO: 20. The present invention
also relates to a nucleic
acid that encodes a polypeptide comprising an amino acid sequence of amino
acids 86-202 of SEQ ID
NO: 20. In another preferred embodiment, a nucleic acid according to the
invention encodes a
polypeptide comprising an amino acid sequence of SEQ m NO: 20.
The present invention also relates to polypeptides comprising the novel RGS 18
domain
according to the invention. In a preferred embodiment, a polypeptide according
to the invention
comprises an amino acid sequence of amino acids 86-202 of SEQ )D NO: 20. In
another preferred
embodiment, the polypeptide according to the invention comprises an amino acid
sequence of
SEQ )D NO: 20.
The invention also relates to a polypeptide comprising an amino acid sequence
having at least
80% amino acid identity with a polypeptide comprising an amino acid sequence
of a) either SEQ >D


CA 02408073 2002-10-28
-5-
NOs: 12 or 20, b) amino acids 1-58 of SEQ m NO: 12, c) amino acids 1-166 of
SEQ m NO: 20, d)
amino acids 86-202 of SEQ )D NO: 20, or e) amino acids 86-166 of SEQ )D NO:
20.
In a specific embodiment, the invention relates to a polypeptide having at
least 85%,
preferably 90%, more preferably 95% and still more preferably 98% amino acid
identity with a
polypeptide according to the invention.
The present invention also provides nucleotide probes and primers that
hybridize with a
nucleic acid sequence of a nucleic acid according to the invention. The
nucleotide probes or primers
according to the invention comprise at least 8 consecutive nucleotides of a
nucleic acid comprising a
polynucleotide sequence of nucleotides a) 1-169 of SEQ >D NO: 1 l, or of a
complementary
polynucleotide sequence, b) 1-658 of SEQ m NO: 19, or of a complementary
polynucleotide
sequence, c) 163-658 of SEQ )D NO: 19, or of a complementary polynucleotide
sequence, or d) 418-
658 of SEQ m NO: 19, or of a complementary polynucleotide sequence.
Preferably, nucleotide
probes or primers according to the invention will have a length of 10, 12, 15,
18, 20 to 25, 35, 40, 50,
70, 80, 100, 200, 500, 1000, or 1500 consecutive nucleotides of a nucleic acid
according to the
invention.
The present invention also relates to a method of amplifying a nucleic acid
according to the
invention contained in a sample, wherein said method 'comprises the steps of:
a) bringing the sample in which the presence of the target nucleic acid is
suspected into contact
with a pair of nucleotide primers whose hybridization position is located
respectively on the 5' side
and on the 3' side of the region of the target nucleic acid whose
amplification is sought, in the presence
of the reagents necessary for the amplification reaction; and
b) detecting the amplified nucleic acids.
The present invention also relates to a method of detecting the presence of a
nucleic acid
according to the invention in a sample, wherein said method comprises the
steps of:
1) bringing one or more nucleotide probes according to the invention into
contact with the
sample to be tested;
2) detecting the complex which may have formed between the probes) and the
nucleic acid
present in the sample.
Another subject of the invention is a box or kit for amplifying all or part of
a nucleic acid
according to the invention, wherein said box or kit comprises:
1) a pair ofnucleotide primers in accordance with the invention, whose
hybridization position
is located respectively on the 5' side and 3' side of the target nucleic acid
whose amplification is
sought; and optionally,
2) reagents necessary for an amplification reaction.
The invention also relates to a box or kit for detecting the presence of a
nucleic acid according
to the invention in a sample, said box or kit comprising:
a) one or more nucleotide probes according to the invention; and


CA 02408073 2002-10-28
-6-
b) where appropriate, reagents necessary for a hybridization reaction.
The invention also relates to a recombinant vector comprising a nucleic acid
according to the
invention.
The present invention also relates to a defective recombinant virus comprising
a nucleic acid
encoding an RGS 18 polypeptide. In a preferred embodiment, the defective
recombinant virus
comprises a cDNA molecule that encodes an RGS 18 polypeptide. In another
preferred embodiment of
the invention, the defective recombinant virus comprises a gDNA molecule that
encodes an RGS 18
polypeptide. Preferably, the encoded RGS 18 polypeptide comprises amino acids
86-166 of SEQ m
NO: 20. More preferably, the encoded RGS 18 polypeptide comprises amino acids
86-202 of SEQ m
NO: 20. Even more preferably, the encoded RGS 18 polypeptide comprises an
amino acid sequence of
SEQ )D NO: 20.
In another preferred embodiment, the invention relates to a defective
recombinant virus
comprising a nucleic acid encoding an RGS 18 protein under the control of a
promoter chosen from
Rous sarcoma virus-long terminal repeat (RSV-LTR) or the cytomegalovirus (CMV)
early promoter.
The present invention also relates to a composition comprising a nucleic acid
encoding a
polypeptide according to the invention, wherein the nucleic acid is placed
under the control of
appropriate regulatory elements.
The invention also relates to the use of a nucleic acid, polypeptide, or
recombinant vector
according to the invention for the manufacture of a medicament intended for
the treatment andlor
prevention of a disorder or condition associated with platelet activation
dysfunction.
The invention also relates to the use of a nucleic acid, polypeptide, or
recombinant vector
according to the invention for the preparation of a pharmaceutical composition
intended for the
treatment and/or for the prevention of disorders or conditions associated with
platelet activation
dysfunction.
Thus, the present invention also relates to a pharmaceutical composition
comprising a nucleic
acid, polypeptide, or recombinant vector according to the invention, combined
with one or more
physiologically compatible vehicles andlor excipients.
The present invention also relates to the use of cells genetically modified ex
vivo with a nucleic
acid or recombinant vector according to the invention, or of cells producing a
recombinant vector,
wherein the cells are implanted in the body, to allow a prolonged and
effective expression in vivo of a
biologically active RGS 18 polypeptide.
Thus, the invention also relates to the use of a recombinant host cell
according to the
invention, comprising a nucleic acid encoding an RGS 18 polypeptide according
to the invention for
the manufacture of a medicament intended for the prevention of, or more
particularly, for the treatment
of subjects affected by a disorder or condition associated with platelet
activation dysfunction.


CA 02408073 2002-10-28
-7-
The present invention also relates to the use of a recombinant host cell
according to the
invention, for the preparation of a pharmaceutical composition for the
treatment and/or prevention of
pathologies linked to a disorder or condition associated with platelet
activation dysfunction.
The invention relates to the use of a defective recombinant virus according to
the invention
for the preparation of a pharmaceutical composition intended for the treatment
and/or for the
prevention of a disorder or condition associated with platelet activation
dysfunction. Thus, the present
invention also relates to a pharmaceutical composition comprising a defective
recombinant virus
according to the invention, combined with one or more physiologically
compatible vehicles and/or
excipients.
The present invention also relates to the use of cells genetically modified ex
vivo with a
recombinant defective virus according to the invention, or of cells producing
such viruses, implanted
in the body, allowing a prolonged and effective expression in vivo of a
biologically active RSG18
protein. A specific embodiment of the invention is an isolated mammalian cell
infected with one or
more defective recombinant viruses according to the .invention.
Another subject of the invention relates to an implant comprising isolated
mammalian cells
infected with one or more defective recombinant viruses according to the
invention or cells producing
recombinant viruses, and an extracellular matrix. More particularly, in the
implants of the invention,
the extracellular matrix comprises a gelling compound and optionally, a
support allowing the
anchorage of the cells.
The invention also relates to an isolated recombinant host cell comprising a
nucleic acid of
the invention.
According to another aspect, the invention also relates to an isolated
recombinant host cell
comprising a recombinant vector according to the invention. Therefore, the
invention also relates to a
recombinant host cell comprising a recombinant vector comprising a nucleic
acid of the invention.
The invention also relates to a method for the production of a polypeptide
according to the
invention, wherein said method comprises the steps of
a) inserting a nucleic acid encoding said polypeptide into an appropriate
vector;
b) culturing, in an appropriate culture medium, a previously transformed host
cell or
transfecting a host cell with the recombinant vector of step a);
c) recovering the conditioned culture medium or lysing the host cell, for
example by sonication
or by osmotic shock;
d) separating and purifying said polypeptide from said culture medium or
alternatively from
the cell lysates obtained in step c); and
e) where appropriate, characterizing the recombinant polypeptide produced.
The present invention also relates to antibodies directed against a
polypeptide according to
the invention.


CA 02408073 2002-10-28
_$_
Thus, another subject of the invention is a method of detecting the presence
of a polypeptide
according to the invention in a sample, wherein said method comprises the
steps of
a) bringing the sample to be tested into contact with an antibody directed
against a polypeptide
according to the invention, and
b) detecting the antigen/antibody complex formed.
The invention also relates to a box or kit for diagnosis or for detecting the
presence of a
polypeptide in accordance with the invention in a sample, said box comprising:
a) an antibody directed against a polypeptide according to the invention, and
b) a reagent allowing the detection of the antigen/antibody complex formed.
The present invention also relates to a new therapeutic approach for the
treatment of
pathologies linked to a disorder or condition associated with platelet
activation dysfunction,
comprising transferring and expressing in vivo a nucleic acid, recombinant
vector, or recombinant
defective virus according to the invention. Specifically, the present
invention provides a new
therapeutic approach for the treatment and/or prevention of a disorder or
condition associated with
platelet activation dysfunction.
According to yet another aspect, the subject of the invention is also a
preventive or curative
therapeutic method of treating diseases caused by abnormal platelet
activation, such a method
comprising a step in which there is administered to a patient a
therapeutically effective quantity of an
RGS 18 polypeptide according to the invention in said patient, said
polypeptide being, where
appropriate, combined with one or more physiologically compatible vehicles
and/or excipients.
The invention also relates to methods for the detection of activators or
inhibitors of RGS 18
protein and RGS 18 domain comprising polypeptides.
The invention also provides methods for screening small molecules and
compounds that act on
the RGS 18 protein to identify agonists and antagonists of RGS 18 polypeptide
that can improve,
reduce, or inhibit platelet activation from a therapeutic point of view. These
methods are useful to
identify small molecules and compounds for therapeutic use in the treatment of
diseases due to a
deficiency in platelet activation.
Therefore, the invention also relates to the use of a polypeptide according to
the invention or a
cell expressing a polypeptide according to the invention, for screening active
ingredients for the
prevention or treatment of a disorder or condition associated with platelet
activation dysfunction. The
invention also relates to a method of screening a compound or small molecule
that functions as an
agonist or antagonist of an RGS 18 polypeptide.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1. Cloning and Sequence information of a Full-length cDNA for a novel
RGS, RGS18.
Panel A, Schematic representation of the full-length cloning of tlae novel
platelet RGS. A schematic of


CA 02408073 2002-10-28
_g_
the cDNA for RGS 18 is depicted on the bottom, with the boxed region
representing the open predicted
reading frame and the single lines the 5' and 3' untranslated regions. The
relative locations of the
initial RT-PCR product, the Incyte EST cDNA (clone 435706H1) and the 5' RACE
amplification
product are shown above. Panel B, Nucleotide and deduced amino acid sequence
of RGS18. The 5'
and 3' untranslated regions are given in lower case letters, the predicted
amino acid sequence in single
letter abbreviations in uppercase letters. The initial RT-PCR product from
platelet RNA is shown in
bold-face type. The 5' and 3' ends of the Incyte EST cDNA are depicted by the
diamonds "~." The
oligonucleotide sequence of the primer in the far 3' untranslated region used
for 5' RACE is
underlined. The putative CAAX motif is noted by the double-underline (O) and
the cAMP/cGMP-
dependent protein kinase consensus site is noted by the triple underline (_).
Figure 2. Aligumeut of RGS18 witla other RGS family n:embers. The predicted
amino acid sequence
of RGS 18 was aligned with six other RGS protein sequences using the PILEUP
program of GCG.
Homology between RGS 18 and these other RGS protein sequences is depicted by
the shading. Amino
acids which are conserved between RGS18 and at least two other RGSs are
shaded. The solid line
above the sequence indicates the conserved RGS domain which was amplified by
PCR. The asterisks
(*) denote the location of the two amino acids which are conserved in members
of Family B. Down
arrows (T), depict amino acids in RGS4 which are predicted to contact Ga
subunits. The boxed
regions indicate the peptide sequences which were synthesized for production
of peptide-directed
antisera.
Figure 3. Tissue distribution of RGS18 by Nortlaeru Blotting. Panel A, a
Northern Blot of 10 mg of
total RNA from human platelets, human leukocytes, DAMI, HEL, and MEG-O1 cells
probed with a 3'
untranslated region probe of RGS 18 as described in Experimental Procedures.
This blot was exposed
to Kodak BioMax MR film for 6 hours at -70 °C. Panel B, Hybridization
of a Human Multiple Tissue
Northern with the same RGS 18 probe. This blot was exposed to Kodak BioMax
film for 6 days at -
70°C. Migration of molecular weight standards on each gel is shown on
the left. After removal of the
probe, each blot was hybridized with a (3-actin probe for normalization, shown
below the
corresponding blot.
Figure 4. Western blotting of platelet, leukocyte and megakaryocyte cell line
lysates. Panel A,
Specificity of anti-RGSl8 antisera. Nitrocellulose strips containing 50 mg of
platelet lysate run on 15%
SDS-PAGE were incubated with a 1:500 dilution of antisera 3NRGS-12 or a 1:1000
dilution of
SNRGS-13. An immunoreactive band that migrates at ~30 kDa is detected by both
antisera (first lane
for each blot). Identical strips were also probed with antisera which had been
preincubated with the
corresponding immunizing peptide or with an unrelated peptide (in these
studies SNRGS-peptide was


CA 02408073 2002-10-28
-10-
used for antisera #12 and 3NRGS-peptide for antisera #13). Migration of the 30
kDa molecular weight
standard is shown on the left, migration of RGS 18 on the right. Panel B,
Detection of RGS18
expression in platelets, leukocytes and the megakaryocytic cell lines. Lysates
(50 mg) from human
platelets, leukocytes, DAMI HEL and MEG-O1 cells were run on 15% SDS-PAGE,
transferred to
nitrocellulose and blotted with antibodies against RGS 18 and RGS 10 (Santa
Cruz Biotechnology,
Santa Cruz, CA). The top blot depicts reactivity of each lysate with the anti-
RGS18 antisera (SNRGS-
#13) and the bottom blot with the anti-RGS10 antisera. As seen above, RGS18 co-
migrates with 30
kDa MW marker. RGS 10, a much smaller protein, migrates close to the 21 kDa MW
marker.
Figure 5. Deterzzzitzatiou of the Ga subuzzit specificity of RGS18. Platelet
lysates were treated with
GDP or GDP+ AlF4 as indicated and incubated with GST-RGS 18 coupled to
Sepharose 4B as
described in Experimental Procedures. Bound proteins were subjected to 12% SDS-
PAGE and
transferred to nitrocellulose and detected with antisera against G«,n«;z,
G«°i;s~ G«qim CT«Z~ G«iz or G«S.
The lane labeled "Lysate" is 35 mg or 7.7% of the input lysate in each of the
reactions run alongside to
show reactivity of each antisera with platelet lysate.
DETAILED DESCRIPTION OF THE INVENTION
GENERAL DEFINITIONS
The present invention contemplates isolation of a gene encoding an RGS 18
polypeptide of the
invention, including a full length, or naturally occurring form of RGS 18, and
any antigenic fragments
thereof from any animal, particularly mammalian or avian, and more
particularly human, source.
In accordance with the present invention there may be employed conventional
molecular
biology, microbiology, and recombinant DNA techniques within the skill of the
art. Such techniques
are explained fully in the literature. See, e.g., references 40-47.
Therefore, if appearing herein, the following terms shall have the definitions
set out below.
As used herein, the term "gene" refers to an assembly of nucleotides that
encode a polypeptide,
and includes cDNA and genomic DNA nucleic acids.
The term "isolated" for the purposes of the present invention designates a
biological material
(nucleic acid or protein) that has been removed from its original environment
(the environment in
which it is naturally present).
For example, a polynucleotide present in the natural state in a plant or an
animal is not
isolated. The same polynucleotide separated, from the adjacent nucleic acids
in which it is naturally
inserted in the genome of the plant or animal is considered as being
"isolated".
Such a polynucleotide may be included in a vector and/or such a polynucleotide
may be
included in a composition and remains nevertheless in the isolated state
because of the fact that the
vector or the composition does not constitute its natural environment.


CA 02408073 2002-10-28
-11-
The term "purified" does not require the material to be present in a form
exhibiting absolute
purity, exclusive of the presence of other compounds. It is rather a relative
definition.
A polynucleotide is in the "purified" state after purification of the starting
material or of the
natural material by at least one order of magnitude, preferably 2 or 3 and
preferably 4 or 5 orders of
magnitude.
For the purposes of the present description, the expression "nucleotide
sequence" may be used
to designate either a polynucleotide or a nucleic acid. The expression
"nucleotide sequence" covers the
genetic material itself and is therefore not restricted to the information
relating to its sequence.
The terms "nucleic acid", "polynucleotide", "oligonucleotide" or "nucleotide
sequence" cover
RNA, DNA, gDNA or cDNA sequences or alternatively RNA/DNA hybrid sequences of
more than
one nucleotide, either in the single-stranded form or in the duplex, double-
stranded form.
A "nucleic acid" is a polymeric compound comprised of covalently linked
subunits called
nucleotides. Nucleic acid includes polyribonucleic acid (RNA) and
polydeoxyribonucleic acid (DNA),
both of which may be single-stranded or double-stranded. DNA includes cDNA,
genomic DNA,
synthetic DNA, and semi-synthetic DNA. The sequence of nucleotides that
encodes a protein is called
the sense sequence or coding sequence.
The term "nucleotide" designates both the natural nucleotides (A, T, G, C) as
well as the
modified nucleotides that comprise at least one modification such as (1) an
analog of a purine, (2) an
analog of a pyrimidine, or (3) an analogous sugar, examples of such modified
nucleotides being
described, for example, in the PCT application No. WO 95/04064.
For the purposes of the present invention, a first polynucleotide is
considered as being
"complementary" to a second polynucleotide when each base of the first
nucleotide is paired with the
complementary base of the second polynucleotide whose orientation is reversed.
The complementary
bases are A and T (or A and U), or C and G.
"Heterologous" DNA refers to DNA not naturally located in the cell, or in a
chromosomal site
of the cell. Preferably, the heterologous DNA includes a gene foreign to the
cell.
As used herein, the term "homologous" in all its grammatical forms and
spelling variations
refers to the relationship between proteins that possess a "common
evolutionary origin," including
proteins from superfamilies (e.g., the immunoglobulin superfamily) and
homologous proteins from
different species (e.g., myosin light chain, etc.) (48). Such proteins (and
their encoding genes) have
sequence homology, as reflected by their high degree of sequence similarity.
Accordingly, the term "sequence similarity" in all its grammatical forms
refers to the degree of
identity or correspondence between nucleic acid or amino acid sequences of
proteins that may or may
not share a common evolutionary origin (see 48). However, in common usage and
in the instant
application, the term "homologous," when modified with an adverb such as
"highly," may refer to
sequence similarity and not a common evolutionary origin.


CA 02408073 2002-10-28
-12-
In a specific embodiment, two DNA sequences are "substantially homologous" or
"substantially similar" when at least about 50% (preferably at least about
75%, and more preferably at
least about 90 or 95%) of the nucleotides match over the defined length of the
DNA sequences.
Sequences that are substantially homologous can be identified by comparing the
sequences using
standard software available in sequence data banks, or in a Southern
hybridization experiment under,
for example, stringent conditions as defined for that particular system.
Defining appropriate
hybridization conditions is within the skill of the art. See, e.g., 41, 43,
and 49.
Similarly, in a particular embodiment, two amino acid sequences are
"substantially
homologous" or "substantially similar" when greater than 30% of the amino
acids are identical, or
greater than about 60% are similar (functionally identical). Preferably, the
similar or homologous
sequences are identified by alignment using, for example, the GCG (Genetics
Computer Group,
Program Manual for the GCG Package, Yersiora 7, Madison, Wisconsin) pileup
program.
The "percentage identity" between two nucleotide or amino acid sequences, for
the purposes
of the present invention, may be determined by comparing two sequences aligned
optimally, through a
window for comparison.
The portion of the nucleotide or polypeptide sequence in the window for
comparison may thus
comprise additions or deletions (for example "gaps") relative to the reference
sequence (which does
not comprise these additions or these deletions) so as to obtain an optimum
alignment of the two
sequences.
The percentage is calculated by determining the number of positions at which
an identical
nucleic base or an identical amino acid residue is observed for the two
sequences (nucleic or peptide)
compared, and then by dividing the number of positions at which there is
identity between the two
bases or amino acid residues by the total number of positions in the window
for comparison, and then
multiplying the result by 100 in order to obtain the percentage sequence
identity.
The optimum sequence alignment for the comparison may be achieved using a
computer with
the aid of known algorithms contained in the package from the company
WISCONSIN GENETICS
SOFTWARE PACKAGE, GENETICS COMPUTER GROUP (GCG), 575 Science Doctor , Madison,
WISCONSIN.
By way of illustration, it will be possible to produce the percentage sequence
identity with the
aid of the BLAST software (versions BLAST 1.4.9 of March 1996, BLAST 2Ø4 of
February 1998
and BLAST 2Ø6 of September 1998), using exclusively the default parameters
(50, 51). Blast
searches for sequences similar/homologous to a reference "request" sequence,
with the aid of the
Altschul et al. algorithm. The request sequence and the databases used may be
of the peptide or nucleic
types, any combination being possible.
The term "corresponding to" is used herein to refer to similar or homologous
sequences,
whether the exact position is identical or different from the molecule to
which the similarity or
homology is measured. A nucleic acid or amino acid sequence alignment may
include spaces. Thus,


CA 02408073 2002-10-28
-13-
the term "corresponding to" refers to the sequence similarity, and not the
numbering of the amino acid
residues or nucleotide bases.
A gene encoding an RGS 18 polypeptide of the invention, whether genomic DNA or
cDNA,
can be isolated from any source, particularly from a human cDNA or genomic
library. Methods for
obtaining genes are well lalown in the art, as described above (see, e.g.,
40).
Accordingly, any animal cell potentially can serve as the nucleic acid source
for the molecular
cloning of an RSG18 gene. The DNA may be obtained by standard procedures
lrnown in the art from
cloned DNA (e.g., a DNA "library"), and preferably is obtained from a cDNA
library prepared from
tissues with high level expression of the protein, by chemical synthesis, by
cDNA cloning, or by the
cloning of genomic DNA, or fragments thereof, purified from the desired cell
(See, for example, 40,
41). Clones derived from genomic DNA may contain regulatory and intron DNA
regions in addition
to coding regions; clones derived from cDNA will not contain intron sequences.
Whatever the source,
the gene should be molecularly cloned into a suitable vector for propagation
of the gene.
In the molecular cloning of the gene from genomic DNA, DNA fragments are
generated, some
of which will encode the desired gene. The DNA may be cleaved at specific
sites using various
restriction enzymes. Alternatively, one may use DNAse in the presence of
manganese to fragment the
DNA, or the DNA can be physically sheared, as for example, by sonication. The
linear DNA
fragments can then be separated according to size by standard techniques,
including but not limited to,
agarose and polyacrylamide gel electrophoresis and column chromatography.
Once the DNA fragments are generated, identification of the specific DNA
fragment
containing the desired RGS 18 gene may be accomplished in a number of ways.
For example, if an
amount of a portion of a RSG18 gene or its specific RNA, or a fragment
thereof, is available and can
be purified and labeled, the generated DNA fragments may be screened by
nucleic acid hybridization
to the labeled probe (52, 53). For example, a set of oligonucleotides
corresponding to the partial
amino acid sequence information obtained for the RGS 18 protein can be
prepared and used as probes
for DNA encoding RGS 18, as was done in a specific example, infra, or as
primers for cDNA or
mRNA (e.g., in combination with a poly-T primer for RT-PCR). Preferably, a
fragment is selected
that is highly unique to an RGS 18 nucleic acid or polypeptide of the
invention. Those DNA fragments
with substantial homology to the probe will hybridize. As noted above, the
greater the degree of
homology, the more stringent hybridization conditions can be used. In a
specific embodiment,
stringency hybridization conditions are used to identify a homologous RGS 18
gene.
Further selection can be carned out on the basis of the properties of the
gene, e.g., if the gene
encodes a protein product having the isoelectric, electrophoretic, amino acid
composition, or partial
amino acid sequence of an RGS 18 protein as disclosed herein. Thus, the
presence of the gene may be
detected by assays based on the physical, chemical, or immunological
properties of its expressed
product. For example, cDNA clones, or DNA clones which hybrid-select the
proper mRNAs, can be
selected which produce a protein that, e.g., has similar or idex~cical
electrophoretic migration,


CA 02408073 2002-10-28
-14-
isoelectric focusing or non-equilibrium pH gel electrophoresis behavior,
proteolytic digestion maps, or
antigenic properties as known for RGS 18.
An RGS 18 gene of the invention can also be identified by mRNA selection,
i.e., by nucleic
acid hybridization followed by irz vitro translation. In this procedure,
nucleotide fragments are used to
isolate complementary mRNAs by hybridization. Such DNA fragments may represent
available,
purified RGS 18 DNA, or may be synthetic oligonucleotides designed from the
partial amino acid
sequence information. Immunoprecipitation analysis or functional assays (e.g.,
tyrosine phosphatase
activity) of the izz vitro translation products of the products of the
isolated mRNAs identifies the
mRNA and, therefore, the complementary DNA fragments, that contain the desired
sequences. In
addition, specific mRNAs may be selected by adsorption of polysomes isolated
from cells to
immobilized antibodies specifically directed against an RGS 18 polypeptide of
the invention.
A radiolabeled RGS 18 cDNA can be synthesized using the selected mRNA (from
the adsorbed
polysomes) as a template. The radiolabeled mRNA or cDNA may then be used as a
probe to identify
homologous RGS 18 DNA fragments from among other genomic DNA fragments.
"Variant" of a nucleic acid according to the invention will be understood to
mean a nucleic
acid that differs by one or more bases relative to the reference
polynucleotide. A variant nucleic acid
may be of natural origin, such as an allelic variant that exists naturally, or
it may also be a non-natural
variant obtained, for example, by mutagenic techniques
In general, the differences between the reference (generally, wild-type)
nucleic acid and the
variant nucleic acid are small such that the nucleotide sequences of the
reference nucleic acid and of
the variant nucleic acid are very similar and, in many regions, identical. The
nucleotide modifications
present in a variant nucleic acid may be silent, which means that they do not
alter the amino acid
sequences encoded by said variant nucleic acid.
However, the changes in nucleotides in a variant nucleic acid may also result
in substitutions,
additions or deletions in the polypeptide encoded by the variant nucleic acid
in relation to the
polypeptides encoded by the reference nucleic acid. In addition, nucleotide
modifications in the coding
regions may produce conservative or non-conservative substitutions in the
amino acid sequence of the
polypeptide.
Preferably, the variant nucleic acids according to the invention encode
polypeptides that
substantially conserve the same function or biological activity as the
polypeptide of the reference
nucleic acid or alternatively the capacity to be recognized by antibodies
directed against the
polypeptides encoded by the initial reference nucleic acid.
Some variant nucleic acids will thus encode mutated forms of the polypeptides
whose
systematic study will make it possible to deduce structure-activity
relationships of the proteins in
question. Knowledge of these variants in relation to the disease studied is
essential since it makes it
possible to understand the molecular cause of the pathology.


CA 02408073 2002-10-28
-15-
"Fragment" will be understood to mean a nucleotide sequence of reduced length
relative to the
reference nucleic acid and comprising, over the common portion, a nucleotide
sequence identical to the
reference nucleic acid. Such a nucleic acid "fragment" according to the
invention may be, where
appropriate, included in a larger polynucleotide of which it is a constituent.
Such fragments comprise,
or alternatively consist of, oligonucleotides ranging in length from at least
8, 10, 12, 15, 18, 20 to 25,
30, 40, 50, 70, 80, 100, 200, 500, 1000 or 1500 consecutive nucleotides of a
nucleic acid according to
the invention.
A "nucleic acid molecule" refers to the phosphate ester polymeric form of
ribonucleosides
(adenosine, guanosine, uridine or cytidine; "RNA molecules") or
deoxyribonucleosides
(deoxyadenosine, deoxyguanosine, deoxythymidine, or deoxycytidine; "DNA
molecules"), or any
phosphoester anologs thereof, such as phosphorothioates and thioesters, in
either single stranded form,
or a double-stranded helix. Double stranded DNA-DNA, DNA-RNA and RNA-RNA
helices are
possible. The term nucleic acid molecule, and in particular DNA or RNA
molecule, refers only to the
primary and secondary structure of the molecule, and does not limit it to any
particular tertiary forms.
Thus, this term includes double-stranded DNA found, inter alia, in linear or
circular DNA molecules
(e.g., restriction fragments), plasmids, and chromosomes. In discussing the
structure of particular
double-stranded DNA molecules, sequences may be described herein according to
the normal '
convention of giving only the sequence in the 5' to 3' direction along the non-
transcribed strand of
DNA (i.e., the strand having a sequence homologous to the mRNA). A
"recombinant DNA molecule"
is a DNA molecule that has undergone a molecular biological manipulation.
A nucleic acid molecule is "hybridizable" to another nucleic acid molecule,
such as a cDNA,
genomic DNA, or RNA, when a single stranded form of the nucleic acid molecule
can anneal to the
other nucleic acid molecule under the appropriate conditions of temperature
and solution ionic strength
(see 40). The conditions of temperature and ionic strength determine the
"stringency" of the
hybridization. For preliminary screening for homologous nucleic acids, low
stringency hybridization
conditions, corresponding to a Tm of 55°, can be used, e.g., Sx SSC,
0.1% SDS, 0.25% milk, and no
formamide; or 30% formamide, Sx SSC, 0.5% SDS). Moderate stringency
hybridization conditions
correspond to a higher Tm, e.g., 40% formamide, with Sx or 6x SCC. High
stringency hybridization
conditions correspond to the highest T"" e.g., 50% formamide, Sx or 6x SCC.
Hybridization requires
that the two nucleic acids contain complementary sequences, although depending
on the stringency of
the hybridization, mismatches between bases are possible. The appropriate
stringency for hybridizing
nucleic acids depends on the length of the nucleic acids and the degree of
complementation, variables
well known in the art. The greater the degree of similarity or homology
between two nucleotide
sequences, the greater the value of Tm for hybrids of nucleic acids having
those sequences. The
relative stability (corresponding to higher T".~ of nucleic acid
hybridizations decreases in the following
order: RNA:RNA, DNA:RNA, DNA:DNA. For hybrids of greater than 100 nucleotides
in length,
equations for calculating Tm have been derived (see 40, 9.50-0.51). For
hybridization with shorter


CA 02408073 2002-10-28
-16-
nucleic acids, i. e., oligonucleotides, the position of mismatches becomes
more important, and the
length of the oligonucleotide determines its specificity (see Sambrook et al.,
supra, 11.7-11.8).
Preferably a minimum length for a hybridizable nucleic acid is at least about
10 nucleotides; preferably
at least about 15 nucleotides; and more preferably the length is at least
about 20 nucleotides.
In a specific embodiment, the term "standard hybridization conditions" refers
to a Tm of 55°C,
and utilizes conditions as set forth above. In a preferred embodiment, the Tm
is 60°C; in a more
preferred embodiment, the Tm is 65°C.
"High stringency hybridization conditions" for the purposes of the present
invention will be
understood to mean the following conditions:
1- Membrane competition and PREHYBRIDIZATION:
- Mix: 40 ~1 salmon sperm DNA (10 mg/ml)
+ 40 ~,l human placental DNA (10 mg/ml)
- Denature for 5 minutes at 96°C, then immerse the mixture in ice.
-vRemove the 2X SSC and pour 4 ml of formamide mix in the hybridization tube
containing the
membranes.
- Add the mixture of the two denatured DNAs.
- Incubation at 42°C for 5 to 6 hours, with rotation.
2- Labeled probe competition:
- Add to the labeled and purified probe 10 to 50 ~,l Cot I DNA, depending on
the quantity of repeats.
- Denature for 7 to 10 minutes at 95°C.
- Incubate at 65°C for 2 to 5 hours.
3- HYBRIDIZATION:
- Remove the prehybridization mix.
- Mix 40 ~.l salmon sperm DNA + 40 ~l human placental DNA; denature for 5 min
at 96°C, then
immerse in ice.
- Add to the hybridization tube 4 ml of formamide mix, the mixture of the two
DNAs and the
denatured labeled probe/Cot I DNA .
- Incubate 15 to 20 hours at 42°C, with rotation.
4- Washes and Exposure:
- One wash at room temperature in 2X SSC, to rinse.
- Twice 5 minutes at room temperature 2X SSC and 0.1% SDS at 65°C.
- Twice 15 minutes at 65°C 1X SSC and 0.1% SDS at 65°C.
- Envelope the membranes in clear plastic wrap and expose.


CA 02408073 2002-10-28
-17-
The hybridization conditions described above are adapted to hybridization,
under high
stringency conditions, of a molecule of nucleic acid of varying length from 20
nucleotides to several
hundreds of nucleotides. It goes without saying that the hybridization
conditions described above may
be adjusted as a function of the length of the nucleic acid whose
hybridization is sought or of the type
of labeling chosen, according to techniques known to one skilled in the art.
Suitable hybridization
conditions may, for example, be adjusted according to the teaching contained
in references 43 or 47.
As used herein, the term "oligonucleotide" refers to a nucleic acid, generally
of at least 15
nucleotides, that is hybridizable to a nucleic acid according to the
invention. Oligonucleotides can be
labeled, e.g., with 3zP-nucleotides or nucleotides to which a label, such as
biotin, has been covalently
conjugated. In one embodiment, a labeled oligonucleotide can be used as a
probe to detect the
presence of a nucleic acid encoding an RGS 18 polypeptide of the invention. In
another embodiment,
oligonucleotides (one or both of which may be labeled) can be used as PCR
primers, either for cloning
full length or a fragment of an RGS 18 nucleic acid, or to detect the presence
of nucleic acids encoding
RGS 18. In a further embodiment, an oligonucleotide of the invention can form
a triple helix with an
RGS 18 DNA molecule. Generally, oligonucleotides are prepared synthetically,
preferably on a nucleic
acid synthesizer. Accordingly, oligonucleotides can be prepared with non-
naturally occurring
phosphoester analog bonds, such as thioester bonds, etc.
"Homologous recombination" refers to the insertion of a foreign DNA sequence
of a vector in
a chromosome. Preferably, the vector targets a specific chromosomal site for
homologous
recombination. For specific homologous recombination, the vector will contain
sufficiently long
regions of homology to sequences of the chromosome to allow complementary
binding and
incorporation of the vector into the chromosome. Longer regions of homology,
and greater degrees of
sequence similarity, may increase the efficiency of homologous recombination.
A DNA "coding sequence" is a double-stranded DNA sequence that is transcribed
and
translated into a polypeptide in a cell in vitro or in vivo when placed under
the control of appropriate
regulatory sequences. The boundaries of the coding sequence are determined by
a start codon at the 5'
(amino) terminus and a translation stop codon at the 3' (carboxyl) terminus. A
coding sequence can
include, but is not limited to, prokaryotic sequences, cDNA from eukaryotic
mRNA, genomic DNA
sequences from eukaryotic (e.g., mammalian) DNA, and even synthetic DNA
sequences. If the coding
sequence is intended for expression in a eukaryotic cell, a polyadenylation
signal and transcription
termination sequence will usually be located 3' to the coding sequence.
Transcriptional and translational control sequences are DNA regulatory
sequences, such as
promoters, enhancers, terminators, and the like, that provide for the
expression of a coding sequence in
a host cell. In eukaryotic cells, polyadenylation signals are control
sequences.
~~Regulatory region" means a nucleic acid sequence that regulates the
expression of a nucleic
acid. A regulatory region may include sequences that are naturally responsible
for expressing a
particular nucleic acid (a homologous region) or may include sequences of a
different origin


CA 02408073 2002-10-28
-18-
(responsible for expressing different proteins or even synthetic proteins). In
particular, the sequences
can be sequences of eukaryotic or viral genes or derived sequences that
stimulate or repress.
transcription of a gene in a specific or non-specific manner and in an
inducible or non-inducible
manner. Regulatory regions include origins of replication, RNA splice sites,
enhancers, transcriptional
termination sequences, signal sequences that direct the polypeptide into the
secretory pathways of the
target cell, and promoters.
A regulatory region from a "heterologous source" is a regulatory region that
is not naturally
associated with the expressed nucleic acid. Included among the heterologous
regulatory regions are
regulatory regions from a different species, regulatory regions from a
different gene, hybrid regulatory
sequences, and regulatory sequences which do not occur in nature, but which
are designed by one
having ordinary skill in the art.
A "cassette" refers to a segment of DNA that can be inserted into a vector at
specific
restriction sites. The segment of DNA encodes a polypeptide of interest, and
the cassette and
restriction sites are designed to ensure insertion of the cassette in the
proper reading frame for
transcription and translation.
A "promoter sequence" is a DNA regulatory region capable of binding RNA
polymerase in a
cell and initiating transcription of a downstream (3' direction) coding
sequence. For purposes of
defining the present invention, the promoter sequence is bounded at its 3'
terminus by the transcription
initiation site and extends upstream (5' direction) to include the minimum
number of bases or elements
necessary to initiate transcription at levels detectable above background.
Within the promoter
sequence will be found a transcription initiation site (conveniently defined
for example, by mapping
with nuclease Sl), as well as protein binding domains (consensus sequences)
responsible for the
binding of RNA polymerase.
A coding sequence is "under the control" of transcriptional and translational
control sequences
in a cell when RNA polymerase transcribes the coding sequence into mRNA, which
is then trans-RNA
spliced and translated into the protein encoded by the coding sequence.
A "signal sequence" is included at the beginning of the coding sequence of a
protein to be
expressed on the surface of a cell. This sequence encodes a signal peptide, N-
terminal to the mature
polypeptide, which directs the host cell to translocate the polypeptide. The
term "translocation signal
sequence" is used herein to refer to this sort of signal sequence.
Translocation signal sequences can be
found associated with a variety of proteins native to eukaryotes and
prokaryotes, and are often
functional in both types of organisms.
A "polypeptide" is a polymeric compound comprised of covalently linked amino
acid residues.
Amino acids have the following general structure:
H


CA 02408073 2002-10-28
-19-
R-C-COOH
NHZ
Amino acids are classified into seven groups on the basis of the side chain R:
(1) aliphatic side chains,
(2) side chains containing a hydroxylic (OH) group, (3) side chains containing
sulfur atoms, (4) side
chains containing an acidic or amide group, (5) side chains containing a basic
group, (6) side chains
containing an aromatic ring, and (7) proline, an imino acid in which the side
chain is fused to the
amino group.
A "protein" is a polypeptide that plays a structural or functional role in a
living cell.
The polypeptides and proteins of the invention may be glycosylated or
unglycosylated.
"Homology" means similarity of sequence reflecting a common evolutionary
origin.
Polypeptides or proteins are said to have homology, or similarity, if a
substantial number of their
amino acids are either (1) identical, or (2) have a chemically similar R side
chain. Nucleic acids are
said to have homology if a substantial number of their nucleotides are
identical.
"Isolated polypeptide" or "isolated protein" is a polypeptide or protein that
is substantially free
of those compounds that are normally associated therewith in its natural state
(e.g., other proteins ar
polypeptides, nucleic acids, carbohydrates, lipids). "Isolated" is not meant
to exclude artificial or
synthetic mixtures with other compounds, or the presence of impurities which
do not interfere with
biological activity, and which may be present, for example, due to incomplete
purification, addition of
stabilizers, or compounding into a pharmaceutically acceptable preparation.
"Fragment" of a polypeptide according to the invention will be understood to
mean a
polypeptide whose amino acid sequence is shorter than that of the reference
polypeptide and which
comprises, over the entire portion with these reference polypeptides, an
identical amino acid sequence.
Such fragments may, where appropriate, be included in a larger polypeptide of
which they are a part.
Such fragments of a polypeptide according to the invention may have a length
of 10, 15, 20, 30 to 40,
50, 100, 200 or 300 amino acids.
"Variant" of a polypeptide according to the invention will be understood to
mean mainly a
polypeptide whose amino acid sequence contains one or more substitutions,
additions or deletions of at
least one amino acid residue, relative to the amino acid sequence of the
reference polypeptide, it being
understood that the amino acid substitutions may be either conservative or non-
conservative.
A "variant" of a polypeptide or protein is any analogue, fragment, derivative,
or mutant which
is derived from a polypeptide or protein and which retains at least one
biological property of the
polypeptide or protein. Different variants of the polypeptide or protein may
exist in nature. These
variants may be allelic variations characterized by differences in the
nucleotide sequences of the
structural gene coding for the protein, or may involve differential splicing
or post-translational


CA 02408073 2002-10-28
-20-
modification. Variants also include a related protein having substantially the
same biological activity,
but obtained from a different species.
The skilled artisan can produce variants having single or multiple amino acid
substitutions,
deletions, additions, or replacements. These variants may include, inter alias
(a) variants in which one
or more amino acid residues are substituted with conservative or non-
conservative amino acids, (b)
variants in which one or more amino acids are added to the polypeptide or
protein, (c) variants in
which one or more of the amino acids includes a substituent group, and (d)
variants in which the
polypeptide or protein is fused with another polypeptide such as serum
albumin. The techniques for
obtaining these variants, including genetic (suppressions, deletions,
mutations, etc.), chemical, and
enzymatic techniques, are known to persons having ordinary skill in the art.
If such allelic variations, analogues, fragments, derivatives, mutants, and
modifications,
including alternative mRNA splicing forms and alternative post-translational
modification forms result
in derivatives of the polypeptide which retain any of the biological
properties of the polypeptide, they
are intended to be included within the scope of this invention.
A "vector" is a replicon, such as plasmid, virus, phage or cosmid, to which
another DNA
segment may be attached so as to bring about the replication of the attached
segment. A "replicon" is
any genetic element (e.g., plasmid, chromosome, virus) that.functions as an
autonomous unit of DNA
replication irr vivo, i.e., capable of replication under its own control.
The present invention also relates to cloning vectors containing genes
encoding analogs and
derivatives of an RGS 18 polypeptide of the invention, that have the same or
homologous functional
activity as that RGS 18 polypeptide, and homologs thereof from other species.
The production and use
of derivatives and analogs related to RGS 18 are within the scope of the
present invention. In a specific
embodiment, the derivative or analog is functionally active, i. e., capable of
exhibiting one or more
functional activities associated with a full-length, wild-type RGS 18
polypeptide of the invention.
RGS 18 derivatives can be made by altering encoding nucleic acid sequences by
substitutions,
additions or deletions that provide for functionally equivalent molecules.
Preferably, derivatives are
made that have enhanced or increased functional activity relative to native
RGS 18.
Due to the degeneracy of nucleotide coding sequences, other DNA sequences
which encode
substantially the same amino acid sequence as an RGS 18 gene may be used in
the practice of the
present invention. These include but are not limited to allelic genes,
homologous genes from other
species, and nucleotide sequences comprising all or portions of RGS 18 genes
that are altered by the
substitution of different codons that encode the same amino acid residue
within the sequence, thus
producing a silent change. Likewise, the RGS18 derivatives of the invention
include, but are not
limited to, those containing, as a primary amino acid sequence, all or part of
the amino acid sequence
of an RGS 18 protein including altered sequences in which functionally
equivalent amino acid residues
are substituted for residues within the sequence resulting in a conservative
amino acid substitution.
For example, one or more amino acid residues within the sequence can be
substituted by another


CA 02408073 2002-10-28
-21-
amino acid of a similar polarity, which acts as a functional equivalent,
resulting in a silent alteration.
Substitutes for an amino acid within the sequence may be selected from other
members of the class to
which the amino acid belongs. For example, the nonpolar (hydrophobic) amino
acids include alanine,
leucine, isoleucine, valine, proline, phenylalanine, tryptophan and
methionine. Amino acids
containing aromatic ring structures are phenylalanine, tryptophan, and
tyrosine. The polar neutral
amino acids include glycine, serine, threonine, cysteine, tyrosine,
asparagine, and glutamine. The
positively charged (basic) amino acids include arginine, lysine and histidine.
The negatively charged
(acidic) amino acids include aspartic acid and glutamic acid. Such alterations
will not be expected to
affect apparent molecular weight as determined by polyacrylamide gel
electrophoresis, or isoelectric
point.
Particularly preferred substitutions are:
- >Jys for Arg and vice versa such that a positive charge may be maintained;
- Glu for Asp and vice versa such that a negative charge may be maintained;
- Ser for Thr such that a free -OH can be maintained; and
- Gln for Asn such that a free CONHZ can be maintained.
Amino acid substitutions may also be introduced to substitute an amino acid
with a
particularly preferable property. For example, a Cys may be introduced a
potential site for disulfide
bridges with another Cys. A His may be introduced as a particularly
"catalytic" site (i.e., His can act
as an acid or base and is the most common amino acid in biochemical
catalysis). Pro may be
introduced because of its particularly planar structure, which induces b-turns
in the protein's structure.
The genes encoding RGS 18 derivatives and analogs of the invention can be
produced by
various methods known in the art. The manipulations which result in their
production can occur at the
gene or protein level. For example, the cloned RGS 18 gene sequence can be
modified by any of
numerous strategies known in the art (40). The sequence can be cleaved at
appropriate sites with
restriction endonuclease(s), followed by further enzymatic modification if
desired, isolated, and ligated
in vitro. In the production of the gene encoding a derivative or analog of RGS
18, care should be taken
to ensure that the modified gene remains within the same translational reading
frame as the RGS 18
gene, uninterrupted by translational stop signals, in the gene region where
the desired activity is
encoded.
Additionally, the RGS 18-encoding nucleic acids can be mutated in vitro or in
vivo, to create
and/or destroy translation, initiation, and/or termination sequences, or to
create variations in coding
regions andlor form new restriction endonuclease sites or destroy preexisting
ones, to facilitate. further
in vitro modification. Preferably, such mutations enhance the functional
activity of the mutated
RGS 18gene product. Any technique for mutagenesis known in the art can be
used, including but not
limited to, in vitf-o site-directed mutagenesis (54-58) use of TAB~ linkers
(Pharmacia), etc. PCR
techniques are preferred for site directed mutagenesis (see 59).


CA 02408073 2002-10-28
-22-
The identified and isolated gene can then be inserted into an appropriate
cloning vector. A
large number of vector-host systems known in the art may be used. Possible
vectors include, but are
not limited to, plasmids or modified viruses, but the vector system must be
compatible with the host
cell used. Examples of vectors include, but are not limited to, Escherichia
coli, bacteriophages such as
lambda derivatives, or plasmids such as pBR322 derivatives or pUC plasmid
derivatives, e.g., pGEX
vectors, pmal-c, pFLAG, etc. The insertion into a cloning vector can, for
example, be accomplished .
by ligating the DNA fragment into a cloning vector that has complementary
cohesive termini.
However, if the complementary restriction sites used to fragment the DNA are
not present in the
cloning vector, the ends of the DNA molecules may be enzymatically modified.
Alternatively, any site
desired may be produced by ligating nucleotide sequences (linkers) onto the
DNA termini; these
ligated linkers rnay comprise specific chemically synthesized oligonucleotides
encoding restriction
endonuclease recognition sequences. Recombinant molecules can be introduced
into host cells via
transformation, transfection, infection, electroporation; etc., so that many
copies of the gene sequence
are generated. Preferably, the cloned gene is contained on a shuttle vector
plasmid, which provides for
expansion in a cloning cell, e.g., Escherichia coli, and facile purification
for subsequent insertion into
an appropriate expression cell line, if such is desired. For example, a
shuttle vector, which is a vector
that can replicate in more than one type of organism, can be prepared for
replication in both
Escherichia coli and Saccharomyces cerevisiae,by linking sequences from an
Escherichia coli plasmid
with sequences from the yeast 2m plasmid.
In an alternative method, the desired gene may be identified and isolated
after insertion into a
suitable cloning vector in a "shot gun" approach. Enrichment for the desired
gene, for example, by
size fractionation, can be done before insertion into the cloning vector.
The nucleotide sequence coding for an RGS18 polypeptide orantigenic fragment,
derivative or
analog thereof, or a functionally active derivative, including a chimeric
protein, thereof, can be
inserted into an appropriate expression vector, i.e., a vector which contains
the necessary elements for
the transcription and translation of the inserted protein-coding sequence.
Such elements are termed
herein a "promoter." Thus, the nucleic acid encoding an RGS 18 polypeptide of
the invention is
operationally associated with a promoter in an expression vector of the
invention. Both cDNA and
genomic sequences can be cloned and expressed under control of such regulatory
sequences. An
expression vector also preferably includes a replication origin.
The necessary transcriptional and translational signals can be provided on a
recombinant
expression vector, or they may be supplied by a native gene encoding RGS 18
and/or its flanking
regions.
Potential host-vector systems include but are not limited to mammalian cell
systems infected
with virus (e.g., vaccinia virus, adenovirus, etc.); insect cell systems
infected with virus (e.g.,
baculovirus); microorganisms such as yeast containing yeast vectors; or
bacteria transformed with
bacteriophage, DNA, plasmid DNA, or cosmid DNA. The expression elements of
vectors vary in


CA 02408073 2002-10-28
-23-
their strengths and specificities. Depending on the host-vector system
utilized, any one of a number of
suitable transcription and translation elements may be used.
A recombinant RGS 18 protein of the invention, or functional fragment,
derivative, chimeric
construct, or analog thereof, may be expressed chromosomally, after
integration of the coding
sequence by recombination. In this regard, any of a number of amplification
systems may be used to
achieve high levels of stable gene expression (40).
The cell into which the recombinant vector comprising the nucleic acid
encoding an RGS 18
polypeptide according to the invention is cultured in an appropriate cell
culture medium under
conditions that provide for expression of the RGS 18 polypeptide by the cell.
Any of the methods previously described for the insertion of DNA fragments
into a cloning
vector may be used to construct expression vectors containing a gene
consisting of appropriate
transcriptional/translational control signals and the protein coding
sequences. These methods may
include in vitro recombinant DNA and synthetic techniques and in vivo
recombination (genetic
recombination).
Expression of an RGS 18 polypeptide may be controlled by any promoter/enhancer
element
known in the art, but these regulatory elements must be functional in the host
selected for expression.
Promoters which may be used to control RGS 18 gene expression include, but are
not limited to, the
SV40 early promoter region (60), the promoter contained in the 3' long
terminal repeat of Rous
sarcoma virus (61), the herpes thymidine kinase promoter (62), the regulatory
sequences of the
metallothionein gene (63); prokaryotic expression vectors such as the b-
lactamase promoter (64), or
the tac promoter (65); see also "Useful proteins from recombinant bacteria" in
Scientific American,
1980, 242:74-94; promoter elements from yeast or other fungi such as the Gal 4
promoter, the ADC
(alcohol dehydrogenase) promoter, PGK (phosphoglycerol kinase) promoter,
alkaline phosphatase
promoter; and the animal transcriptional control regions, which exhibit tissue
specificity and have been
utilized in transgenic animals: elastase I gene control region which is active
in pancreatic acinar cells
(66-68); insulin gene control region which is active in pancreatic beta cells
(69), immunoglobulin gene
control region which is active in lymphoid cells (70-72), mouse mammary tumor
virus control region
which is active in testicular, breast, lymphoid and mast cells (73), albumin
gene control region which
is active in liver (74), alpha-fetoprotein gene control region which is active
in liver (75, 76), alpha 1-
antitrypsin gene control region which is active in the liver (77) beta-globin
gene control region which
is active in myeloid cells (78, 79), myelin basic protein gene control region
which is active in
oligodendrocyte cells in the brain (80), myosin light chain-2 gene control
region which is active in
skeletal muscle (81), and gonadotropic releasing hormone gene control region
which is active in the
hypothalamus (82).
Expression vectors comprising a nucleic acid encoding an RGS 18 polypeptide of
the invention
can be identified by four general approaches: (a) polymerase chain reaction
(PCR) amplification of the
desired plasmid DNA or specific mRNA, (b) nucleic acid hybridization, (c)
presence or absence of


CA 02408073 2002-10-28
-24-
selection marker gene functions, (d) analyses with appropriate restriction
endonucleases, and (e)
expression of inserted sequences. In the first approach, the nucleic acids can
be amplified by PCR to
provide for detection of the amplified product. In the second approach, the
presence of a foreign gene
inserted in an expression vector can be detected by nucleic acid hybridization
using probes comprising
sequences that are homologous to an inserted marker gene. In the third
approach, the recombinant
vector/host system can be identified and selected based upon the presence or
absence of certain
"selection marker" gene functions (e.g., (3-galactosidase activity, thymidine
kinase activity, resistance
to antibiotics, transformation phenotype, occlusion body formation in
baculovirus, etc.) caused by the
insertion of foreign genes in the vector. In another example, if the nucleic
acid encoding an RGS 18
polypeptide is inserted within the "selection marker" gene sequence of the
vector, recombinants
comprising the RGS 18 nucleic acid insert can be identified by the absence of
the "selection marker"
gene function. In the fourth approach, recombinant expression vectors are
identified by digestion with
appropriate restriction enzymes. In the fifth approach, recombinant expression
vectors can be
identified by assaying for the activity, biochemical, or immunological
characteristics of the gene
product expressed by the recombinant, provided that the expressed protein
assumes a functionally
active conformation.
A wide variety of host/expression vector combinations may be employed in
expressing the
nucleic acids of this invention. Useful expression vectors, for example, may
consist of segments of
chromosomal, non-chromosomal and synthetic DNA sequences. Suitable vectors
include derivatives
of SV40 and known bacterial plasmids, e.g., Escherichia coli plasmids col El,
pCRI, pBR322, pMal-
C2, pET, pGEX (83), pMB9 and their derivatives, plasmids such as RP4; phage
DNAs, e.g., the
numerous derivatives of phage 1, e.g., NM989, and other phage DNA, e.g., M13
and filamentous single
stranded phage DNA; yeast plasmids such as the 2m plasmid or derivatives
thereof; vectors useful in
eukaryotic cells, such as vectors useful in insect or mammalian cells; vectors
derived from
combinations of plasmids and phage DNAs, such as plasmids that have been
modified to employ
phage DNA or other expression control sequences; and the like.
For example, in a baculovirus expression systems, both non-fusion transfer
vectors, such as
but not limited to pVL941 (BarnHl cloning site; Summers), pVL1393 (BanaHl,
SnzaI, ~'baI, EcoRl,
NotI, XrnaIII, BgIII, and PstI cloning site; Invitrogen), pVL1392 (Bglll,
PstI, NotI, XmaIII, EcoRI,
XbaI, SmaI, and BarnHl cloning site; Summers and Invitrogen), and pBlueBacIII
(BarnHl, BglII, PstI,
NcoI, and HindIII cloning site, with bluelwhite recombinant screening
possible; Invitrogen), and fusion
transfer vectors, such as but not limited to pAc700 (BanaHl and KpnI cloning
site, in which the
BanaHl recognition site begins with the initiation codon; Summers), pAc701 and
pAc702 (same as
pAc700, with different reading frames), pAc360 (BanaHl cloning site 36 base
pairs downstream of a
polyhedrin initiation codon; Invitrogen(195)), and pBlueBacHisA, B, C (three
different reading
frames, with BarraHl, BgIII, PstI, NcoI, and HindIII cloning site, an N-
terminal peptide for ProBond
purification, and blue/white recombinant screening of plaques; Invitrogen
(220) can be used.


CA 02408073 2002-10-28
-25-
Mammalian expression vectors contemplated for use in the invention include
vectors with
inducible promoters, such as the dihydrofolate reductase (DHFR) promoter,
e.g., any expression vector
with a DHFR expression vector, or a DHFR/methotrexate co-amplification vector,
such as pED (PstI,
SaII, SbaI, SmaI, and EcoRI cloning site, with the vector expressing both the
cloned gene and DHFR
(84). Alternatively, a glutamine synthetase/methionine sulfoximine co-
amplification vector, such as
pEEl4 (HindIII, XbaI, SrnaI, SbaI, EcoRI, and BcII cloning site, in which the
vector expresses
glutamine synthase and the cloned gene; Celltech). In another embodiment, a
vector that directs
episomal expression under control of Epstein Barr Virus (EBV) can be used,
such as pREP4 (BamHl,
SfiI, ~Y7zoI, NotI, NheI, HindIII, NheI, PvuII, and KpnI cloning site,
constitutive RSV-LTR promoter,
hygromycin selectable marker; Invitrogen), pCEP4 (BamHl, SfiI, XhoI, NotI,
NheI, HindIll, NheI,
PvuII, and KpnI cloning site, constitutive hCMV immediate early gene,
hygromycin selectable marker; .
Invitrogen), pMEP4 (KpnI, PvuI, lVlaeI, HiradIII, NotI, XhoI, SfiI, BamHl
cloning site, inducible
methallothionein IIa gene promoter, hygromycin selectable marker: Invitrogen),
pREP8 (BarnHl,
XhoI, NotI, HindIII, NheI, and KpraI cloning site, RSV-LTR promoter,
histidinol selectable marker;
Invitrogen)pREP9 (KpraI, NheI, HindIII, NotI, XhoI, SfiI, and BamHI cloning
site, RSV-LTR
promoter, 6418 selectable marker; Invitrogen), and pEBVHis (RSV-LTR promoter,
hygromycin
selectable marker, N-terminal peptide purifiable via ProBond resin and cleaved
by enterokinase;
Invitrogen). Selectable mammalian expression vectors for use in the invention
include pRc/CMV
(HinelIII, BstXI, NotI, SbaI, and ApaI cloning site, 6418 selection;
Invitrogen), pRc/RSV (HindlB,
SpeI, BstXI, NotI, lCbaI cloning site, 6418 selection; Invitrogen), and
others. Vaccinia virus
mammalian expression vectors (84) for use according to the invention include
but are not limited to
pSCl l (SmaLcloning site, TK- and b-gal selection), pMJ601 (SaII, SmaI, AfII,
NarI, BspMII, BarnHI,
ApaI, NheI, SacII, KpnI, and HindIII cloning site; TK- and b-gal selection),
and pTKgptF 1 S (EcoRI,
PstI, SalI, AccI, HindII, SbaI, BarnHI, and Hpa cloning site; TK or XPRT
selection).
Yeast expression systems can also be used according to the invention to
express an RGS 18
polypeptide. For example, the non-fusion pYES2 vector (~'baI, SphI, ShoI,
NotI, GstXI, EcoRI, BstXI,
BanaHl, SacI, Kpral, and HiradIII cloning sit; Invitrogen) or the fusion
pYESHisA, B, C (XbaI, SphI,
SlaoI, NotI, BstXI, EcoRI, BarnHl, SacI, KpraI, and Hina'ITI cloning site, N-
terminal peptide purified
with ProBond resin and cleaved with enterokinase; Invitrogen), to mention just
two, can be employed
according to the invention.
Once a particular recombinant DNA molecule is identified and isolated, several
methods
known in the art may be used to propagate it. Once a suitable host system and
growth conditions are
established, recombinant expression vectors can be propagated and prepared in
quantity. As
previously explained, the expression vectors which can be used include, but
are not limited to, the
following vectors or their derivatives: human or animal viruses such as
vaccinia virus or adenovirus;
insect viruses such as baculovirus; yeast vectors; bacteriophage vectors
(e.g., lambda), and plasmid and
cosmid DNA vectors, to name but a few.


CA 02408073 2002-10-28
-26-
In addition, a host cell strain may be chosen which .modulates the expression
of the inserted
sequences, or modifies and processes the gene product in the specific fashion
desired. Different host
cells have characteristic and specific mechanisms for the translational and
post-translational processing
and modification (e.g., glycosylation, cleavage [e.g., of signal sequence]) of
proteins. Appropriate cell
lines or host systems can be chosen to ensure the desired modification and
processing of the foreign
protein expressed. For example, expression in a bacterial system can be used
to produce a non-
glycosylated core protein product. However, the RGS 18 protein expressed in
bacteria may not be
properly folded. Expression in yeast can produce a glycosylated product.
Expression in eukaryotic
cells can increase the likelihood of "native" glycosylation and folding of a
heterologous protein.
Moreover, expression in mammalian cells can provide a tool for reconstituting,
or constituting, RGS 18
activity. Furthermore, different vector/host expression systems may affect
processing reactions, such
as proteolytic cleavages, to a different extent.
Vectors are introduced into the desired host cells by methods known in the
art, e.g.,
transfection, electroporation, microinjection, transduction, cell fusion, DEAF
dextran, calcium
phosphate precipitation, lipofection (lysosome fusion), use of a gene gun, or
a DNA vector transporter
(see, e.g., 85-87).
A cell has been "transfected" by exogenous or heterologous DNA when such DNA
has been
introduced inside the cell. A cell has been "transformed" by exogenous or
heterologous DNA when
the transfected DNA effects a phenotypic change. Preferably, the transforming
DNA should be
integrated (covalently linked) into chromosomal DNA making up the genome of
the cell.
A recombinant marker protein expressed as an integral membrane protein can be
isolated and
purified by standard methods. Generally, the integral membrane protein can be
obtained by lysing the
membrane with detergents, such as but not limited to, sodium dodecyl sulfate
(SDS), Triton X-100
polyoxyethylene ester, Ipagel/nonidet P-40 (NP-40) (octylphenoxy)-
polyethoxyethanol, digoxin,
sodium deoxycholate, and the like, including mixtures thereof. Solubilization
can be enhanced by
sonication of the suspension. Soluble forms of the protein can be obtained by
collecting culture fluid,
or~solubilizing inclusion bodies, e.g., by treatment with detergent, and if
desired sonication or other
mechanical processes, as described above. The solubilized or soluble protein
can be isolated using
various techniques, such as polyacrylamide gel electrophoresis (PAGE),
isoelectric focusing, 2-
dimensional gel electrophoresis, chromatography (e.g., ion exchange, affinity,
immunoaffmity, and
sizing column chromatography), centrifugation, differential solubility,
immunoprecipitation, or by any
other standard technique for the purification of proteins.
Alternatively, a nucleic acid or vector according to the invention can be
introduced in vivo by
lipofection. For the past decade, there has been increasing use. of liposomes
for encapsulation and
transfection of nucleic acids in vitro. Synthetic cationic lipids designed to
limit the difficulties and dangers
encountered with liposome mediated transfection can be used to prepare
liposomes for in vivo transfection
of a gene encoding a marker (88-90). The use of cationic lipids may promote
encapsulation of negatively


CA 02408073 2002-10-28
-27-
charged nucleic acids, and also promote fusion with negatively charged cell
membranes (91). Particularly
useful lipid compounds and compositions for transfer of nucleic acids are
described in International Patent
Publications W095/18863 and W096/17823, and in U.S. Patent No. 5,459,127. The
use of lipofection to
introduce exogenous genes into the specific organs iia vivo has certain
practical advantages. Molecular
targeting of liposomes to specific cells represents one area of benefit. It is
clear that directing transfection
to particular cell types would be particularly preferred in a tissue with
cellular heterogeneity, such as
pancreas, liver, kidney, and the brain. Lipids may be chemically coupled to
other molecules for the
purpose of targeting [~9]. Targeted peptides, e.g., hormones or
neurotransmitters, and proteins such as
antibodies, or non-peptide molecules could be coupled to liposomes chemically.
Other molecules are also useful for facilitating transfection of a nucleic
acid in vivo, such as a
cationic oligopeptide (e.g., International Patent Publication W095/21931),
peptides derived from DNA
binding proteins (e.g., International Patent Publication W096/25508), or a
cationic polymer (e.g.,
International Patent Publication W095/21931).
It is also possible to introduce the vector in vivo as a naked DNA plasmid
(see U.S. Patents
5,693,622, 5,589,466 and 5,580,859): Naked DNA vectors for gene therapy can be
introduced into the
desired host cells by methods known in the art, e.g., transfection,
electroporation, microinjection,
transduction, cell fusion, DEAF dextran, calcium phosphate precipitation, use
of a gene gun, or use of a .
DNA vector transporter (see, 85-87, 92). Receptor-mediated DNA delivery
approaches can also be used
(93, 94).
"Pharmaceutically acceptable vehicle or excipient " includes diluents and
fillers which are
pharmaceutically acceptable for method of administration, are sterile, and may
be aqueous or
oleaginous suspensions formulated using suitable dispersing or wetting agents
and suspending agents.
The particular pharmaceutically acceptable carrier and the ratio of active
compound to carrier are
determined by the solubility and chemical properties of the composition, the
particular mode of
administration, and standard pharmaceutical practice.
Any nucleic acid, polypeptide, vector, or host cell of the invention will
preferably be introduced ira
vivo in a pharmaceutically acceptable vehicle or excipient. The phrase
"pharmaceutically acceptable" refer:
to molecular entities and compositions that are physiologically tolerable and
do not typically produce an
allergic or similar untoward reaction, such as gastric upset, dizziness and
the like, when administered to a
human. Preferably, as used herein, the term "pharmaceutically acceptable"
means approved by a regulator
agency of the Federal or a state government or listed in the U.S. Pharmacopeia
or other generally
recognized pharmacopeia for use in animals, and more particularly in humans.
The term "excipient" refers
to a diluent, adjuvant, excipient, or vehicle with which the compound is
administered. Such pharmaceutics
carriers can be sterile liquids, such as water and oils, including those of
petroleum, animal, vegetable or
synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and
the like. Water or aqueous
solution saline solutions and aqueous dextrose and glycerol solutions are
preferably employed as


CA 02408073 2002-10-28
-28-
excipients, particularly for injectable solutions. Suitable pharmaceutical
excipients are described in
"Remington's Pharmaceutical Sciences" by E.W. Martin.
Naturally, the invention contemplates delivery of a vector that will express a
therapeutically
effective amount of an RGS 18 polypeptide for gene therapy applications. The
phrase "therapeutically
effective amount" is used herein to mean an amount sufficient to reduce by at
least about 15 percent,
preferably by at least 50 percent, more preferably by at least 90 percent, and
still more preferably prevent, a
clinically significant deficit in the activity, function and response of the
host. Alternatively, a
therapeutically effective amount is sufficient to cause an improvement in a
clinically significant condition
in the host.
NUCLEIC ACIDS ENCODING RGS18 POLYPEPTIDES
In an effort to better understand modulation of GPCR-mediated signaling in
platelets,
Applicants sought to identify Regulators of G protein signaling proteins
(RGSs) that are present in
human platelets and several megakaryocytic cell lines. Using degenerate
oligonucleotides based on
conserved regions of the highly homologous RGS domain, RT-PCR was performed
using human
platelet RNA, as well as RNA from several megakaryocytic cell lines. In
addition to confirming the
presence of several known RGS transcripts, a novel RGS domain containing
transcript was found in
platelet RNA. Northern blot analysis of multiple human tissues indicates that
this novel transcript is
most abundantly expressed in platelets compared to other tissues examined.
This RGS transcript is
abundantly expressed in platelets, with significantly lower expression in
other tissues, primarily those
of the hematopoetic system. This transcript is modestly expressed in three
megakaryocyte cell lines
and tissues of hematopoetic origin such as leukocytes, bone marrow and spleen
with low level
expression detected in other tissues as well. Full-length cloning of this
novel RGS, which has been
termed RGS 18, demonstrates that this transcript encodes a 235 amino acid
protein. RGS 18 is most
closely related to RGSS (46% identity) and has ~30-40% identity to other RGS
proteins. Peptide-
directed antisera against RGS 18 detect the expression of ~30 kDa protein in
platelet, leukocyte and
megakaryocyte cell line lysates. In vitro RGS 18 binds to endogenous G«;z,
G«;3 and G«q but not G«Z,
G«S or G«lz from GDP + A1F4 -treated platelet lysates. Since platelet
aggregation requires activation of
a receptor coupled to G«q and/or one or more forms of G«;, RGS18 may be
responsible in part for
regulation of pathways important to platelet activation.
The present invention relates to nucleic acids encoding a novel Regulator of G
protein
Signaling (RGS) protein, RGS 18. Thus, a first subject of the invention is a
nucleic acid comprising a
polynucleotide sequence of a) any one of SEQ m NOs: 11, 18, or 19, or of a
complementary
polynucleotide sequence, b) nucleotides 1-169 of SEQ m NO: 11, or of a
complementary
polynucleotide sequence, c) nucleotides 1-658 of SEQ m NO: 19, or of a
complementary
polynucleotide sequence, d) nucleotides 163-870 of SEQ m NO: 19, or of a
complementary


CA 02408073 2002-10-28
-29-
polynucleotide sequence, e) nucleotides 163-658 of SEQ ID NO: 19, or of a
complementary
polynucleotide sequence, f) nucleotides 418-768 of SEQ ID NO: 19, or of a
complementary
polynucleotide sequence, or g) nucleotides 418-658 of SEQ ID NO: 19, or of a
complementary
polynucleotide sequence.
The invention also relates to a nucleic acid comprising at least 8 consecutive
nucleotides of a
polynucleotide sequence of a) nucleotides 1-169 of SEQ ID NO: 11, or of a
complementary
polynucleotide sequence, b) nucleotides 1-658 of SEQ m NO: 19, or of a
complementary
.polynucleotide sequence, c) nucleotides 163-658 of SEQ ID NO: 19, or of a
complementary
polynucleotide sequence, or d) nucleotides 418-658 of SEQ ID NO: 19, or of a
complementary
polynucleotide sequence.
Preferably, a nucleic acid according to the invention comprises at least 10,
12, 15, 18, 20 to 25,
35, 40, 50, 70, 80, 100, 200, or 500 consecutive nucleotides of a
polynucleotide sequence of a)
nucleotides 1-169 of SEQ ID NO: 11, or of a complementary polynucleotide
sequence, b) nucleotides
1-658 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, c)
nucleotides 163-658 of
SEQ ID NO: 19, or of a complementary polynucleotide sequence, or d)
nucleotides 418-658 of SEQ
ID NO: 19, or of a complementary polynucleotide sequence.
The invention also relates toa nucleic acid having at least 80% nucleotide
identity with a
nucleic acid comprising a polynucleotide sequence of a) any one of SEQ E77
NOs: 11, 18, or 19, or of a
complementary polynucleotide sequence, b) nucleotides 1-169 of SEQ ID NO: 11,
or of a
complementary polynucleotide sequence, c) nucleotides 1-658 of SEQ ID NO: 19,
or of a
complementary polynucleotide sequence, d) nucleotides 163-870 of SEQ ID NO:
19, or of a
complementary polynucleotide sequence, e) nucleotides 163-658 of SEQ ID NO:
19, or of a
complementary polynucleotide sequence, f) nucleotides 418-768 of SEQ ID NO:
19, or of a
complementary polynucleotide sequence, or g) nucleotides 418-658 of SEQ >D NO:
19, or of a
complementary polynucleotide sequence.
The invention also relates to a nucleic acid having at least 85%, preferably
90%, more
preferably 95% and still more preferably 98% nucleotide identity with a
nucleic acid comprising a
polynucleotide sequence of a) any one of SEQ >D NOs: 11, 18, or 19, or of a
complementary
polynucleotide sequence, b) nucleotides 1-169 of SEQ m NO: 11, or of a
complementary
polynucleotide sequence, c) nucleotides 1-658 of SEQ m NO: 19, or of a
complementary
polynucleotide sequence, d) nucleotides 163-870 of SEQ 1D NO: 19, or of a
complementary
polynucleotide sequence, e) nucleotides 163-658 of SEQ ID NO: 19, or of a
complementary
polynucleotide sequence, f) nucleotides 418-768 of SEQ ID NO: 19, or of a
complementary
polynucleotide sequence, or g) nucleotides 418-658 of SEQ ID NO: 19, or of a
complementary
polynucleotide sequence.
The invention also relates to a nucleic acid hybridizing, under high
stringency conditions, with
a polynucleotide sequence of a) any one of SEQ ID NOs: 11, 18, or 19, or of a
complementary


CA 02408073 2002-10-28
-30-
polynucleotide sequence, b) nucleotides 1-169 of SEQ ID NO: 11, or of a
complementary
polynucleotide sequence, c) nucleotides 1-658 of SEQ )D NO: 19, or of a
complementary
polynucleotide sequence, d) nucleotides 163-870 of SEQ >D NO: 19, or of a
complementary
polynucleotide sequence, e) nucleotides 163-658 of SEQ ff~ NO: 19, or of a
complementary
polynucleotide sequence, f) nucleotides 418-768 of SEQ )D NO: 19, or of a
complementary
polynucleotide sequence, or g) nucleotides 418-658 of SEQ ID NO: 19, or of a
complementary
polynucleotide sequence.
The present invention also relates to nucleic acids encoding a polypeptide
comprising the
novel RGS 18 domain. Thus, a second subject of the invention relates to a
nucleic acid comprising a
polynucleotide sequence of a) either of SEQ ID NOs: 18 or 19, or of a
complementary polynucleotide
sequence, b) nucleotides 163-870 of SEQ ID NO: 19, or of a complementary
polynucleotide sequence,
or c) nucleotides 418-768 of SEQ ID NO: 19, or of a complementary
polynucleotide sequence.
The invention also relates to nucleic acids, particularly cDNA molecules,
which encode the
full length human RGS 18 protein. The present invention also relates to a cDNA
molecule that encodes
the novel full length RGS 18 protein. Thus, the invention relates to a nucleic
acid comprising a
polynucleotide sequence of a) either of SEQ ID NOs: 18 or 19, or of a
complementary polynucleotide
sequence, or b) nucleotides 163-870 of SEQ )D NO: 19, or of a complementary
polynucleotide
sequence.
The invention also relates-to a nucleic acid comprising a polynucleotide
sequence as depicted
in a) either one of SEQ )D NOs: 18 or 19, or a complementary polynucleotide
sequence, or b)
nucleotides 163-870 of SEQ >D NO: 19, or a complementary polynucleotide
sequence.
According to the invention, a nucleic acid comprising a polynucleotide
sequence of either
SEQ )D NOs: 18 or 19 encodes a full length RGS18 domain polypeptide of 235
amino acids
comprising the amino acid sequence of SEQ ID NO: 20.
The present invention also relates to a nucleic acid that encodes a
polypeptide comprising the
novel RGS 18 domain. In a preferred embodiment, the nucleic acid encodes a
polypeptide comprising
an amino acid sequence of amino acids 86-202 of SEQ >D NO: 20. In another
preferred embodiment,
the nucleic acid encodes a polypeptide comprising an amino acid sequence of
SEQ >D NO: 20.
RGS18 POLYPEPTIDES
The .present invention also relates to polypeptides comprising the novel RGS18
domain
according to the invention.
Thus, the present invention relates to a nucleic acid that encodes a
polypeptide comprising an
amino acid sequence of amino acids 86-202 of SEQ )D NO: 20.
In addition, the present invention also relates to a polypeptide comprising
the novel RGS18
domain. In a preferred embodiment, a polypeptide according to the invention
comprises an amino acid


CA 02408073 2002-10-28
-31-
sequence of amino acids 86-202 of SEQ ID NO: 20. In another preferred
embodiment, the polypeptide
according to the invention comprises an amino acid sequence of SEQ m NO: 20.
The invention also relates to a polypeptide comprising an amino acid sequence
as depicted in
SEQ )D NO: 20.
The invention also relates to a polypeptide comprising an amino acid sequence
comprising
amino acids 86-202 of SEQ m NO: 20.
The invention also relates to a polypeptide comprising an amino acid sequence
having at least
80% amino acid identity with a polypeptide comprising an amino acid sequence
of a) either SEQ )D
NOs: 12 or 20, b) amino acids 1-58 of SEQ ID NO: 12, c) amino acids 1-166 of
SEQ m NO: 20, d)
amino acids 86-202 of SEQ ID NO: 20, or e) amino acids 86-166 of SEQ ID NO:
20.
The invention also relates to a polypeptide having at least 85%, preferably
90%, more
preferably 95% and still more preferably 98% amino acid identity with a
polypeptide comprising an
amino acid sequence of a) either SEQ ID NOs: 12 or 20, b) amino acids 1-58 of
SEQ ID NO: 12, c)
amino acids 1-166 of SEQ ID NO: 20, d) amino acids 86-202 of SEQ ID NO: 20, or
e) amino acids 86-
166 of SEQ ll~ NO: 20.
Preferably, a polypeptide according to the invention will have a length of 15,
18 or 20 to 25,
35, 40, 50, 70, 80, 100 or 200 consecutive amino acids of a polypeptide
according to the invention, in
particular a polypeptide comprising an amino acid sequence of a) amino acids 1-
58 of SEQ )D NO: 12,
b) amino acids 1-166 of SEQ )D NO: 20, or c) amino acids 86-166 of SEQ ID NO:
20.
Alternatively, a polypeptide according to the invention will comprise a
fragment having a
length of 15, 18, 20, 25, 35, 40, 50, 100 or 200 consecutive amino acids of a
polypeptide according to
the invention, more particularly of a polypeptide comprising an amino acid
sequence of a) amino acids
1-58 of SEQ ID NO: 12, b) amino acids 1-1f6 of SEQ ID NO: 20, or c) amino
acids 86-166 of SEQ >D
NO: 20.
NUCLEOTIDE PROBES AND PRIMERS
Nucleotide probes and primers hybridizing with a nucleic acid (genomic DNA,
messenger
RNA, cDNA) according to the invention also form part of the invention.
The definition of a nucleotide probe or primer according to the invention
therefore covers
oligonucleotides which hybridize, under the high stringency hybridization
conditions defined above,
with a polynucleotide sequence of a nucleic acid according to the invention,
or a complementary
polynucleotide sequence.
According to the invention, nucleic acid fragments derived from a
polynucleotide according to
the invention are useful for the detection of the presence of at least one
copy of a nucleotide sequence
of an RGS18 nucleic acid or of a fragment or of a variant (containing a
mutation or a polymorphism)
thereof in a sample.


CA 02408073 2002-10-28
-32-
According to the invention, nucleic acid fragments derived from a nucleic acid
comprising a
polynucleotide sequence of any one of SEQ )D NOs: 11, 18, and 19, or of a
complementary
polynucleotide sequence, are useful for the detection of the presence of at
least one copy of a
nucleotide sequence of the RGS 18 gene or of a fragment or of a variant
(containing a mutation or a
polymorphism) thereof in a sample. Thus, nucleotide probes and primers
hybridizing with a nucleic
acid sequence of a nucleic acid that encodes an RGS 18 domain (genomic DNA,
messenger RNA,
cDNA), also form part of the invention.
The nucleotide probes or primers according to the invention comprise at least
8 consecutive
nucleotides of a nucleic acid comprising a polynucleotide sequence of
nucleotides a) 1-169 of SEQ )D
NO: 11, or of a complementary polynucleotide sequence, b) 1-658 of SEQ >D NO:
19, or of a
complementary polynucleotide sequence, c) 163-658 of SEQ )D NO: 19, or of a
complementary
polynucleotide sequence, or d) 418-658 of SEQ )D NO: 19, or of a complementary
polynucleotide
sequence.
Preferably, nucleotide probes or primers according to the invention will have
a length of 10,
12, 15, 18, 20 to 25, 35, 40, 50, 70, 80, 100, 200, 500, 1000, or 1500
consecutive nucleotides of a
nucleic acid according to the invention, in particular of a nucleic acid
comprising a polynucleotide
sequence of nucleotides a) 1-169 of SEQ >D NO: 1 l, or of a complementary
polynucleotide sequence,
b) 1-658 of SEQ >D NO: 19, or of a complementary polynucleotide sequence, c)
163-658 of SEQ )D
NO: 19, or of a complementary polynucleotide sequence, or d) 418-658 of SEQ )D
NO: 19, or of a
complementary polynucleotide sequence.
Alternatively, a nucleotide probe or primer according to the invention will
consist of andlor
comprise a fragment having a length of 10, 12, 15, 18, 20, 25, 35, 40, 50,
100, 200, 500, 1000, or 1500
consecutive nucleotides of a nucleic acid according to the invention, more
particularly of a nucleic acid
comprising a polynucleotide sequence of nucleotides a) 1-169 of SEQ )D NO: 11,
or of a
complementary polynucleotide sequence, b) 1-658 of SEQ )D NO: 19, or of a
complementary
polynucleotide sequence, c) 163-658 of SEQ m NO: 19, or of a complementary
polynucleotide
sequence, or d) 418-658 of SEQ )D NO: 19, or of a complementary polynucleotide
sequence.
The preferred probes and primers according to the invention comprise all or
part of a
,polynucleotide sequence comprising a) any one of SEQ )D NOs: 9, 10, 14, 15,
16, 17, 30, 31, 32, 33,
34, 35, or 36, or of a complementary polynucleotide sequence, b) nucleotides 1-
169 of SEQ )D NO:
11, or of a complementary polynucleotide sequence, c) nucleotides 1-658 of SEQ
>D NO: 19, or of a
complementary polynucleotide sequence, d) nucleotides 163-658 of SEQ )D NO:
19, or of a
complementary polynucleotide sequence, or e) nucleotides 418-658 of SEQ ID NO:
19, or of a
complementary polynucleotide sequence.
The nucleotide primers according to the invention may be used to amplify any
one of the
nucleic acids according to the invention, and more particularly a nucleic acid
comprising a
polynucleotide sequence of a) any one of SEQ )D NOs: 11, 18, or 19, or of a
complementary


CA 02408073 2002-10-28
-33-
polynucleotide sequence, b) nucleotides 1-169 of SEQ ID NO: 11, or of a
complementary
polynucleotide sequence, c) nucleotides 1-658 of SEQ )D NO: 19, or of a
complementary
polynucleotide sequence, d) nucleotides 163-870 of SEQ ff~ NO: 19, or of a
complementary
polynucleotide sequence, e) nucleotides 163-658 of SEQ ID NO: 19, or of a
complementary
polynucleotide sequence, f) nucleotides 418-768 of SEQ >D NO: 19, or of a
complementary
polynucleotide sequence, or g) nucleotides 418-658 of SEQ )D NO: 19, or of a
complementary
polynucleotide sequence.
Alternatively, the nucleotide primers according to the invention may be used
to amplify a
nucleic acid fragment or variant of a nucleic acid comprising a polynucleotide
sequence of a) any one
of SEQ )D NOs: 11, 18, or 19, or of a complementary polynucleotide sequence,
b) nucleotides 1-169
of SEQ ID NO: 11, or of a complementary polynucleotide sequence, c)
nucleotides 1-658 of SEQ ID
NO: 19, or of a complementary polynucleotide sequence, d) nucleotides 163-870
of SEQ ID NO: 19,
or of a complementary polynucleotide sequence, e) nucleotides 163-658 of SEQ
>D NO: 19, or of a
complementary polynucleotide sequence, f) nucleotides 418-768 of SEQ ID NO:
19, or of a
complementary polynucleotide sequence, or g) nucleotides 418-658 of SEQ ID NO:
19,. or of a
complementary polynucleotide sequence.
The definition of a nucleotide probe or primer according to the invention
therefore covers
oligonucleotides that hybridize, under the high stringency hybridization
conditions defined above, with
a nucleic acid according to the invention, or a complementary polynucleotide
sequence.
According to a preferred embodiment, a nucleotide primer according to the
invention
comprises a nucleotide sequence of any one of SEQ m NOs: 9, 10, 14, 15, 16,
17, 30, 31, 32, 33, 34,
35, or 36, or of a complementary nucleic acid sequence.
A nucleotide primer or probe according to the invention may be prepared by any
suitable
method well known to persons skilled in the art, including by cloning and
action of restriction enzymes
or by direct chemical synthesis according to techniques such as the
phosphodiester method by
Narang et al. (95) or by Brown et al. (96), the diethylphosphoramidite method
by Beaucage et al. (97)
or the technique on a solid support described in EU patent No. EP 0,707,592.
Each of the nucleic acids according to .the invention, including the
oligonucleotide probes and
primers described above, may be labeled, if desired, by incorporating a marker
which can be detected
by spectroscopic, photochemical, biochemical, immunochemical or chemical
means. For example,
such markers may consist of radioactive isotopes (32P, 33P, sH~ 3sS)~
~uorescent molecules
(5-bromodeoxyuridine, fluorescein, acetylaminofluorene, digoxigenin) or
ligands such as biotin. The
labeling of the probes is preferably carried out by incorporating labeled
molecules into the
polynucleotides by primer extension, or alternatively by addition to the 5' or
3' ends. Examples of
nonradioactive labeling of nucleic acid fragments are described in particular
in French patent
No. 78 109 75 or in the articles by Urdea et al. (98) or Sanchez-Pescador et
al. (99).


CA 02408073 2002-10-28
-34-
Preferably, the nucleotide probes and primers according to the invention may
have structural
characteristics of the type to allow amplification of the signal, such as the
probes described by
Urdea et al. (100) or alternatively in European patent No. EP-0,225,807
(CHIRON).
The oligonucleotide probes according to the invention may be used in
particular in Southern-
type hybridizations with the genomic DNA or alternatively in hybridizations
with the corresponding
messenger RNA when the expression of the corresponding transcript is sought in
a sample.
The probes and primers according to the invention may also be used for the
detection of
products of PCR amplification or alternatively for the detection of
mismatches.
Nucleotide probes or primers according to the invention may be immobilized on
a solid
support. Such solid supports are well known to persons skilled in the art and
comprise surfaces of
wells of microtiter plates, polystyrene beds, magnetic beds, nitrocellulose
bands or microparticles such
as latex particles.
METHODS FOR DETECTING NUCLEIC ACIDS ENCODING RGS18 POLYPEPTIDES AND
15' RGS18 POLYPEPTIDES
The invention also relates to means for the detection of RGS 18 nucleic acids,
protein, and
RGS 18 domain comprising polypeptides.
A preferred embodiment of the present invention relates to a method of
amplifying a nucleic
acid according to the invention, and more particularly a nucleic acid
comprising a polynucleotide
sequence of a) any one of SEQ ID NOs: 11, 18, or 19, or of a complementary
polynucleotide sequence,
b) nucleotides 1-169 of SEQ ID NO: 11, or of a complementary polynucleotide
sequence, c)
nucleotides 1-658 of SEQ.ID NO: 19, or of a complementary polynucleotide
sequence, d) nucleotides
163-870 of SEQ )D NO: 19, or of a complementary polynucleotide sequence, e)
nucleotides 163-658
of SEQ ID NO: 19, or of a complementary polynucleotide sequence, f)
nucleotides 418-768 of SEQ ID
NO: 19, or of a complementary polynucleotide sequence, or g) nucleotides 418-
658 of SEQ )D NO:
19, or of a complementary polynucleotide sequence; or a nucleic acid fragment
or variant thereof
contained in a sample, wherein said method comprising the steps of
a) bringing the sample in which the presence of the target nucleic acid is
suspected into contact
with a pair of nucleotide primers whose hybridization position is located
respectively on the 5' side
and on the 3' side of the region of the target nucleic acid whose
amplification is sought, in the presence
of the reagents necessary for the amplification reaction; and
b) detecting the amplified nucleic acids.
The present invention also relates to a method of detecting the presence of a
nucleic acid in a
sample, wherein the nucleic acid comprises a polynucleotide sequence of a) any
one of
SEQ >D NOs: 1 l, 18, or 19, or of a complementary polynucleotide sequence, b)
nucleotides 1-169 of
SEQ ID NO: 11, or of a complementary polynucleotide sequence, c) nucleotides 1-
658 of SEQ ID NO:
19, or of a complementary polynucleotide sequence, d) nucleotides 163-870 of
SEQ ID NO: 19, or of a


CA 02408073 2002-10-28
-35-
complementary polynucleotide sequence, e) nucleotides 163-658 of SEQ >D NO:
19, or of a
complementary polynucleotide sequence, f) nucleotides 418-768 of SEQ )D NO:
19, or of a
complementary polynucleotide sequence, or g) nucleotides 418-658 of SEQ )D NO:
19, or of a
complementary polynucleotide sequence; or a nucleic acid fragment or variant
thereof, said method
comprising the steps of
1) bringing one or more nucleotide probes according to the invention into
contact with the
sample to be tested;
2) detecting the complex which may have formed between the probes) and the
nucleic acid
present in the sample.
According to a specific embodiment of the method of detection according to the
invention, the
oligonucleotide probes and primers are immobilized on a support.
According to another aspect, the oligonucleotide probes and primers comprise a
detectable
marker.
The invention relates, in addition, to a box or kit for detecting the presence
of a nucleic acid
according to the invention in a sample, said box or kit comprising:
a) one or more nucleotide probes) or primers) as described above;
b) where appropriate, the reagents necessary .for the hybridization reaction.
According to a first aspect, the detection box or kit is characterized in that
the probes) or
primers) are immobilized on a support.
According to a second aspect, the detection box or kit is characterized in
that the
oligonucleotide .probes comprise a detectable marker.
According to a specific embodiment of the detection kit described above, such
a kit will
comprise a plurality of oligonucleotide probes and/or primers in accordance
with the invention which
may be used to detect a target nucleic acid of interest or alternatively to
detect mutations in the coding
regions or the non-coding regions of the nucleic acids according to the
invention.
Another subject of the invention is a box or kit for amplifying all or part of
a nucleic acid
comprising a polynucleotide sequence of a) any one of SEQ )D NOs: 11, 18, or
19, or of a
complementary polynucleotide sequence, b) nucleotides 1-169 of SEQ ID NO: 1 l,
or of a
complementary polynucleotide sequence, c) nucleotides 1-658 of SEQ )D NO: 19,
or of a
complementary polynucleotide sequence, d) nucleotides 163-870 of SEQ ID NO:
19, or of a
complementary polynucleotide sequence, e) nucleotides 163-658 of SEQ )D NO:
19, or of a
complementary polynucleotide sequence, f) nucleotides 418-768 of SEQ )D NO:
19, or of a
complementary polynucleotide sequence, or g) nucleotides 418-658 of SEQ )D NO:
19, or of a
complementary polynucleotide sequence, wherein said box or kit comprises:
1) a pair of nucleotide primers in accordance with the invention, whose
hybridization position
is located respectively on the 5' side and 3' side of the target nucleic acid
whose amplification is
sought; and optionally,


CA 02408073 2002-10-28
-36-
2) reagents necessary for an amplification reaction.
Such an amplification box or kit will preferably comprise at least one pair of
nucleotide
primers as described above.
The invention also relates to a box or kit for detecting the presence of a
nucleic acid according
to the invention in a sample, said box or kit comprising:
a) one or more nucleotide probes according to the invention;
b) where appropriate, reagents necessary for a hybridization reaction.
According to a first aspect, the detection box or kit is characterized in that
the nucleotide
probes) and primer(s)are immobilized on a support.
. According to a second aspect, the detection box or kit is characterized in
that the nucleotide
probes) and primers) comprise a detectable marker.
According to a specific embodiment of the detection kit described above, such
a kit will
comprise a plurality of oligonucleotide probes and/or primers in accordance
with the invention that
may be used to detect target nucleic acids of interest.
According to preferred embodiment of the invention, the target nucleic acid
comprises a
polynucleotide sequence of a) any one of SEQ )D NOs: l l, 18, or 19, or of a
complementary
polynucleotide sequence, b) nucleotides 1-169 of SEQ >D NO: 1 l, or of a
complementary
polynucleotide sequence, c) nucleotides 1-658 of SEQ ID NO: 19, or of a
complementary
polynucleotide sequence, d) nucleotides 163-870 of SEQ )D NO: 19, or of a
complementary
polynucleotide sequence, e) nucleotides 163-658 of SEQ )D NO: 19, .or of a
complementary
polynucleotide sequence, f) nucleotides 418-768 of SEQ >D NO: 19, or of a
complementary
polynucleotide sequence, or g) nucleotides 418-658 of SEQ )D NO: 19, or of a
complementary
polynucleotide sequence.
Alternatively, the target nucleic acid is a nucleic acid fragment or variant
of a nucleic acid
comprising a polynucleotide sequence of a) any one of SEQ >D NOs: 11, 18, or
19, or of a
complementary polynucleotide sequence, b) nucleotides 1-169 of SEQ >D NO: 11,
or of a
complementary polynucleotide sequence, c) nucleotides 1-658 of SEQ )D NO: 19,
or of a
complementary polynucleotide sequence, d) nucleotides 163-870 of SEQ )D NO:
19, or of a
complementary polynucleotide sequence, e) nucleotides 163-658 of SEQ )D NO:
19, or of a
complementary polynucleotide sequence, f) nucleotides 418-768 of SEQ ID NO:
19, or of a
complementary polynucleotide sequence, or g) nucleotides 418-658 of SEQ >D NO:
19, or of a
complementary polynucleotide sequence.
According to a preferred embodiment, two primers according to the invention
comprise all or
part of SEQ >D NOs: 9 and 10, making it possible to amplify the region of
nucleotides 163-870 of SEQ
ID NO: 19, or a nucleic acid having a complementary polynucleotide sequence.


CA 02408073 2002-10-28
-37-
According to a preferred embodiment, two primers according to the invention
comprise all or
part of SEQ ID NOs: 14 and 15, making it possible to amplify the region of
nucleotides 510-839 of
SEQ ID NO: 19, or a nucleic acid having a complementary polynucleotide
sequence.
According to a preferred embodiment, two primers according to the invention
comprise all or
part of SEQ ID NOs: 14 and 16, making it possible to amplify the region of
nucleotides 510-885 of
SEQ ID NO: 19, or a nucleic acid having a complementary polynucleotide
sequence.
According to a preferred embodiment, two primers according to the invention
comprise all or
part of SEQ ID NOs: 14 and 17, making it possible to amplify the region of
nucleotides 510-923 of
SEQ DJ NO: 19, or a nucleic acid having a complementary polynucleotide
sequence.
According to another preferred embodiment, a primer according to the invention
comprises,
generally, all or part of any one of SEQ ID NOs: 9, 10, 14, 15, 16, 17, 30,
31, 32, 33, 34, 35, or 36, or,a
complementary sequence.
Thus, the probes according to the invention, immobilized on a support, may be
ordered into
matrices such as "DNA chips". Such ordered matrices have in particular been
described in US patent
No. 5,143,854, in published PCT applications WO 90/15070 and WO 92/10092.
Support matrices on which oligonucleotide probes have been immobilized at a
high density are
for example described in US patent No. 5,412,087 and in published PCT
application WO 95/11995
The nucleotide primers according to the invention may be used to amplify any
one of the
nucleic acids according to the invention, or a complementary polynucleotide
sequence. Alternatively,
the nucleotide primers according to the invention may be used to amplify a
nucleic acid fragment or
variant of a nucleic acid according to the invention, or a complementary
polynucleotide sequence.
Another subject of the invention relates to a method of amplifying a nucleic
acid according to
the invention, or a complementary polynucleotide sequence, contained in a
sample, said method
comprising the steps of
a) bringing the sample in which the presence of the target nucleic acid is
suspected into contact
with a pair of nucleotide primers whose hybridization position is located
respectively on the 5' side
and on the 3' side of the region of the target nucleic acid whose
amplification is sought, in the presence
of the reagents necessary for the amplification reaction; and
b) detecting the amplified nucleic acids.
To carry out the amplification method as defined above, use will be preferably
made of any of
the nucleotide primers described above.
The subject of the invention is, in addition, a box or kit for amplifying all
or part of a nucleic
acid according to the invention, or a complementary polynucleotide sequence,
said box or kit
comprising:
a) a pair of nucleotide primers in accordance with the invention, whose
hybridization position
is located respectively on the 5' side and 3' side of the target nucleic acid
whose amplification is
sought; and optionally,


CA 02408073 2002-10-28
-38-
b) reagents necessary for the amplification reaction.
Such an amplification box or kit will preferably comprise at least one pair of
nucleotide
primers as described above.
The invention also relates to a box or kit for detecting the presence of a
nucleic acid according
to the invention in a sample, said box or kit comprising:
a) one or more nucleotide probes according to the invention;
b) where appropriate, reagents necessary for a hybridization reaction.
According to a first aspect, the detection box or kit is characterized in that
the nucleotide
probes) and primer(s)are immobilized on a support.
According to a second aspect, the detection box or kit is characterized in
that the nucleotide
probes) and primers) comprise a detectable marker.
According to a specific embodiment of the detection kit described above, such
a kit will
comprise a plurality of oligonucleotide probes and/or primers in accordance
with the invention which
may be used to detect target nucleic acids of interest or alternatively to
detect mutations in the coding
regions or the non-coding regions of the nucleic acids according to the
invention.
According to preferred embodiment of the invention, the target nucleic acid
comprises a
polynucleotide sequence of a) any one of SEQ ID NOs: 1 l, 18, or 19, or of a
complementary
polynucleotide sequence, b) nucleotides 1-169 of SEQ )D NO: 11, or of a
complementary
polynucleotide sequence, c) nucleotides 1-658 of SEQ )D NO: 19, or of a
complementary
polynucleotide sequence, d) nucleotides 163-870 of SEQ )D NO: 19, or of a
complementary
polynucleotide sequence, e) nucleotides 163-658 of SEQ >D NO: 19, or of a
complementary
polynucleotide sequence, f) nucleotides 418-768 of SEQ )D NO: 19, or of a
complementary
polynucleotide sequence, or g) nucleotides 418-658 of SEQ )D NO: 19, or of a
complementary
polynucleotide sequence.
Alternatively, the target nucleic acid is a nucleic acid fragment or variant
of a nucleic acid
comprising a polynucleotide sequence of a) any one of SEQ >D NOs: 11, 18, or
19, or of a
complementary polynucleotide sequence, b) nucleotides 1-169 of SEQ ID NO: 11,
or of a
complementary polynucleotide sequence, c) nucleotides 1-658 of SEQ ID NO: 19,
or of a
complementary polynucleotide sequence, d) nucleotides 163-870 of SEQ )D NO:
19, or of a
complementary polynucleotide sequence, e) nucleotides 163-658 of SEQ m NO: 19,
or of a
complementary polynucleotide sequence, f) nucleotides 418-768 of SEQ ID NO:
19, or of a
complementary polynucleotide sequence, or g) nucleotides 418-658 of SEQ )D NO:
19, or of a
complementary polynucleotide sequence.
According to a preferred embodiment, a primer according to the invention
comprises,
generally, all or part of any one of SEQ ID NOs: 9, 10, 14, 15, 16, 17, 30,
31, 32, 33, 34, 35, or 36, or a
complementary sequence.


CA 02408073 2002-10-28
-39-
RECOMEINANT VECTORS
The invention also relates to a recombinant vector comprising a nucleic acid
according to the
invention. "Vector" for the purposes of the present invention will be
understood to mean a circular or
linear DNA or RNA molecule that is either in single-stranded or double-
stranded form.
Preferably, such a recombinant vector will comprise a nucleic acid selected
from the group
consisting of
a) a nucleic acid comprising a polynucleotide sequence of 1) any one of SEQ ID
NOs: 1 l, 18,
or 19, or of a complementary polynucleotide sequence, 2) nucleotides 1-169 of
SEQ ID NO: 11, or of a
complementary polynucleotide sequence, 3) nucleotides 1-658 of SEQ ID NO: 19,
or of a
complementary polynucleotide sequence, 4) nucleotides 163-870 of SEQ ID NO:
19, or of a
complementary polynucleotide sequence, 5) nucleotides 163-658 of SEQ ID NO:
19, or of a
complementary polynucleotide sequence, 6) nucleotides 418-768 of SEQ m NO: 19,
or of a
complementary polynucleotide sequence, or 7) nucleotides 418-658 of SEQ )D NO:
19, or of a
complementary polynucleotide sequence,
b) a nucleic acid comprising a polynucleotide sequence as depicted in either
one-of SEQ ID
NOs: 18 or 19, or of a complementary polynucleotide sequence,
c) a nucleic acid having at least eight consecutive nucleotides of a nucleic
acid comprising a
polynucleotide sequence of 1)~nucleotides 1-169 of SEQ ID NO: 11, or of a
complementary
polynucleotide sequence, 2) nucleotides 1-658 of SEQ m NO: 19, or of a
complementary
polynucleotide sequence, 3) nucleotides 163-658 of SEQ ID NO: 19; or of a
complementary
polynucleotide sequence, or 4) nucleotides 418-658 of SEQ >D NO: 19, or of a
complementary
polynucleotide sequence,
e) a nucleic acid having at least 80% nucleotide identity with a nucleic acid
comprising a
polynucleotide sequence of 1) any one of SEQ )D NOs: 11, 18, or 19, or of a
complementary
polynucleotide sequence, 2) nucleotides 1-169 of SEQ >D NO: 11, or of a
complementary
polynucleotide sequence, 3) nucleotides 1-658 of SEQ m NO: 19, or of a
complementary
polynucleotide sequence, 4) nucleotides 163-870 of SEQ m NO: 19, or of a
complementary
polynucleotide sequence, 5) nucleotides 163-658 of SEQ m NO: 19, or of a
complementary
polynucleotide sequence, 6) nucleotides 418-768 of SEQ )D NO: 19, or of a
complementary
polynucleotide sequence, or 7) nucleotides 418-658 of SEQ >D NO: 19, or of a
complementary
polynucleotide sequence,
f) a nucleic acid having 85%, 90%, 95%, or 98% nucleotide identity with a
nucleic acid
comprising a polynucleotide sequence of 1) any one of SEQ )D NOs: 11, 18, or
19, or of a
complementary polynucleotide sequence, 2) nucleotides 1-169 of SEQ ID NO: 1 l,
or of a
complementary polynucleotide sequence, 3) nucleotides 1-658 of SEQ m NO: 19,
or of a
complementary polynucleotide sequence, 4) nucleotides 163-870 of SEQ ID NO:
19, or of a
complementary polynucleotide sequence, 5) nucleotides 163-658 of SEQ )D NO:
19, or of a


CA 02408073 2002-10-28
-40-
complementary polynucleotide sequence, 6) nucleotides 418-768 of SEQ ID NO:
19, or of a
complementary polynucleotide sequence, or 7) nucleotides 418-658 of SEQ )D NO:
19, or of a
complementary polynucleotide sequence,
g) a nucleic acid hybridizing, under high stringency hybridization conditions,
with a nucleic
acid comprising a polynucleotide sequence of 1) any one of SEQ ID NOs: 11, 18,
or 19, or of a
complementary polynucleotide sequence, 2) nucleotides 1-169 of SEQ ID NO: 1 l,
or of a
complementary polynucleotide sequence, 3) nucleotides 1-658 of SEQ >D NO: 19,
or of a
complementary polynucleotide sequence, 4) nucleotides 163-870 of SEQ >D NO:
19, or of a
complementary polynucleotide sequence, 5) nucleotides 163-658 of SEQ ID NO:
19, or of a
complementary polynucleotide sequence, 6) nucleotides 418-768 of SEQ >D NO:
19, or of a.
complementary polynucleotide sequence, or 7) nucleotides 418-658 of SEQ ID NO:
19, or of a
complementary polynucleotide sequence,
h) a nucleic acid encoding a polypeptide comprising an amino acid sequence of
SEQ m NO:
20, and
i) a nucleic acid encoding a polypeptide comprising 1) amino acids 1-58 of SEQ
m NO: 12, 2)
amino acids 1-166 of SEQ )D NO: 20, 3) amino acids 86-202 of SEQ 1I7 N0: 20,
or 4) amino acids
86-166 of SEQ )D NO: 20.
According to a first embodiment, a recombinant vector according to the
invention is used to
amplify a nucleic acid inserted therein, following transformation or
transfection of a desired cellular
2o host.
According to a second embodiment, a recombinant vector according to the
invention
corresponds to an expression vector comprising, in addition to a nucleic acid
in accordance with the
invention, a regulatory signal or nucleotide sequence that directs or controls
transcription and/or
translation of the nucleic acid and its encoded mRNA.
According to a preferred embodiment, a recombinant vector according to the
invention will
comprise in particular the following components:
(1) an element or signal for regulating the expression of the nucleic acid to
be inserted, such as
a promoter and/or enhancer sequence;
(2) a nucleotide coding region comprised within the nucleic acid in accordance
with the
invention to be inserted into such a vector, said coding region being placed
in phase with the
regulatory element or signal described in (1); and
(3) an appropriate nucleic acid for initiation and termination of
transcription of the nucleotide
coding region of the nucleic acid described in (2)
In addition, the recombinant vectors according to the invention may include
one or more
origins for replication in the cellular hosts in which their amplification or
their expression is sought,
markers or selectable markers.


CA 02408073 2002-10-28
41-
By way of example, the bacterial promoters may be the LacI or LacZ promoters,
the T3 or T7
bacteriophage RNA polymerase promoters, the lambda phage PR or PL promoters.
The promoters for eukaryotic cells will comprise the herpes simplex virus
(HSV) virus
thymidine kinase promoter or alternatively the mouse metallothionein-L
promoter.
Generally, for the choice of a suitable promoter, persons skilled in the art
can preferably refer
to the book by Sambrook et al. (40) cited above or to the techniques described
by Fuller et al. (101).
When the expression of the genomic sequence of the RGS 18 gene will be sought,
use will
preferably be made of the vectors capable of containing large insertion
sequences. In a particular
embodiment, bacteriophage vectors such as the Pl bacteriophage vectors such as
the vector p158 or
the vector p158/neo8 described by Sternberg (102, 103) will be preferably
used.
The preferred bacterial vectors according to the invention are for example the
vectors pBR322
(ATCC37017) or alternatively vectors such as pAA223-3 (Pharmacia, Uppsala,
Sweden), and pGEMl
(Promega Biotech, Madison, WI, UNITED STATES).
There may also be cited other commercially available vectors such as the
vectors pQE70,
pQE60, pQE9 (Qiagen), psiX174, pBluescript SA, pNH8A, pNHl6A, pNHl8A, pNH46A,
pWLNEO,
pSV2CAT, pOG44, pXTI, pSG (Stratagene).
They may also be vectors of the baculovirus type such as the vector
pVL1392/1393
(Pharmingen) used to transfect cells of the Sf9. line (ATCC No..CRL 1711)
derived from Spodoptera
frugiperda. .
The present invention also relates to a defective recombinant virus comprising
a nucleic acid
encoding an RGS 18 polypeptide. In a preferred embodiment, the defective
recombinant virus
comprises a cDNA molecule that encodes an RGS 18 polypeptide. In another
preferred embodiment of
the invention, the defective recombinant virus comprises a gDNA molecule that
encodes an RGS 18
polypeptide. Preferably, the encoded RGS 18 polypeptide comprises amino acids
86-166 of SEQ ID
NO: 20. More preferably, the encoded RGS18 polypeptide comprises amino acids
86-202 of SEQ ID
NO: 20. Even more preferably, the encoded RGS 18 polypeptide comprises an
amino acid sequence of
SEQ ID NO: 20.
In another preferred embodiment, the invention relates to a defective
recombinant virus
comprising a nucleic acid encoding an RGS18 protein under the control of a
promoter chosen from
Rous sarcoma virus-long terminal repeat (RSV-LTR) or the cytomegalovirus (CMV)
early promoter.
They may also be adenoviral vectors such as the human adenovirus of type 2 or
5.
A recombinant vector according to the invention may also be a retroviral
vector or an adeno-
associated vector (AAV). Such adeno-associated vectors are for example
described by references 104-
106.
To allow the expression of a polynucleotide according to the invention, the
latter must be
introduced into a host cell. The introduction of a polynucleotide according to
the invention into a host
cell may be carried out in vitro, according to the techniques well known to
persons skilled in the art for


CA 02408073 2002-10-28
-42-
transforming or transfecting cells, either in primer culture, or in the form
of cell lines. It is also
possible to carry out the introduction of a polynucleotide according to the
invention ira vivo or ex vivo,
for the prevention or treatment of diseases linked to a deficiency in the
reverse transport of cholesterol.
To introduce a polynucleotide or vector of the invention into a host cell, a
person skilled in the
art can preferably refer to various techniques, such as the calcium phosphate
precipitation technique
(107, 108), DEAF Dextran (109), electroporation (110, 111), direct
microinjection (112), liposomes
charged with DNA (113, 114).
Once the polynucleotide has been introduced into the host cell, it may be
stably integrated into
the genome of the cell. The intregration may be achieved at a precise site of
the genome, by
homologous recombination, or it may be randomly integrated. In some
embodiments, the
polynucleotide may be stably maintained in the host cell in the form of an
episome fragment, the
episome comprising sequences allowing the retention and the replication of the
latter, either
independently, or in a synchronized manner with the cell cycle.
According to a specific embodiment, a method of introducing a polynucleotide
according to
the invention into a host cell, in particular a host cell obtained from a
mammal, in vivo, comprises a
step during which a preparation comprising a pharmaceutically compatible
vector and a "naked"
polynucleotide according to the invention, placed under the control of
appropriate regulatory
sequences, is introduced by local injection at the level of the chosen tissue,
for example a smooth
muscle tissue, the "naked" polynucleotide being absorbed by the cells of this
tissue.
Compositions for use in vitro and in vivo comprising "naked" polynucleotides
are for example
described in PCT Application No. WO 95/11307 (Institut Pasteur, Inserm,
University of Ottawa) as
well as in the articles by Tacson et al. (115) and Huygen et al. (58).
According to a specific embodiment of the invention, a composition is provided
for the ira vivo
production of the RSG18 protein. This composition comprises a polynucleotide
encoding the RGS18
polypeptide placed under the control of appropriate regulatory sequences, in
solution in a
physiologically acceptable vehicle or excipient.
Consequently, the invention also relates to a pharmaceutical composition
intended for the
prevention of or treatment of a patient or subject affected by a disorder or
condition associated with
platelet activation dysfunction, comprising a nucleic acid encoding the RGS 18
protein, in combination
with one or more physiologically compatible excipients.
Preferably, such a composition will comprise a nucleic acid comprising a
polynucleotide
sequence of a) any one of SEQ ID NOs: 11, 18, or 19, or of a complementary
polynucleotide sequence,
b) nucleotides 1-169 of SEQ ID NO: 11, or of a complementary polynucleotide
sequence, c)
nucleotides 1-658 of SEQ ID NO: 19, or of a complementary polynucleotide
sequence, d) nucleotides
163-870 of SEQ ID NO: 19, or of a complementary polynucleotide sequence, e)
nucleotides 163-658
of SEQ ID NO: 19, or of a complementary polynucleotide sequence, f)
nucleotides 418-768 of SEQ ID
NO: 19, or of a complementary polynucleotide sequence, or g) nucleotides 418-
658 of SEQ ID NO:


CA 02408073 2002-10-28
-43-
19, or of a complementary polynucleotide sequence, wherein the nucleic acid is
placed under the
control of an appropriate regulatory element or signal.
The subject of the invention is, in addition, a pharmaceutical composition
intended for the
prevention of or treatment of a patient or a subject affected by a disorder or
condition associated with
platelet activation dysfunction, comprising a recombinant vector according to
the invention, in
combination with one or more physiologically compatible excipients.
The quantity of vector that is injected into the host organism chosen varies
according to the
site of the injection. As a guide, there may be injected between about 0.1 and
about 100 ~,g of
polynucleotide encoding a RGS 18 polypeptide into the body of an animal,
preferably into a patient
likely to develop a disorder or condition associated with platelet activation
dysfunction or a patient
who has already developed the disorder or condition.
The invention also relates to the use of a nucleic acid according to the
invention, encoding the
RGS 18 protein, for the manufacture of a medicament intended for the
prevention of a disorder or
condition associated with platelet activation dysfunction in various forms or
more particularly for the
treatment of subjects affected by a disorder or condition associated with
platelet activation
dysfunction.
The invention also relates to the use of a recombinant vector according to the
invention,
comprising a nucleic acid encoding .the RGS 18 protein, for the manufacture of
a medicament intended
for the prevention of, or more particularly for the treatment of subjects
affected by a disorder or
condition associated with platelet activation dysfunction.
The subject of the invention is therefore also a recombinant vector comprising
a nucleic acid
according to the invention that encodes an RGS 18 protein or polypeptide
involved in platelet
activation.
'The invention also relates to the use of such a recombinant vector for the
preparation of a
pharmaceutical composition intended for the treatment and/or for the
prevention of a disorder or
condition associated with platelet activation dysfunction.
The present invention also relates to the use of cells genetically modified ex
vivo with such a
recombinant vector according to the invention, or of cells producing a
recombinant vector, wherein the
cells are implanted in the body, to allow a prolonged and effective expression
in vivo of a biologically
active RGS 18 polypeptide.
The invention also relates to the use of a nucleic acid according to the
invention encoding an
RGS 18 protein for the manufacture of a medicament intended for the prevention
or treatment of
subjects affected by a disorder or condition associated with platelet
activation dysfunction.
The invention also relates to the use of a recombinant vector according to the
invention
comprising a nucleic acid encoding an RGS 18 polypeptide according to the
invention for the
manufacture of a medicament intended for the prevention of, or more
particularly, for the treatment of
subjects affected by a disorder or condition associated with platelet
activation dysfunction.


CA 02408073 2002-10-28
-44-
The invention also relates to the use of a recombinant host cell according to
the invention,
comprising a nucleic acid encoding an RGS 18 polypeptide according to the
invention for the
manufacture of a medicament intended for the prevention of, or more
particularly, for the treatment of
subjects affected by a disorder or condition associated with platelet
activation dysfunction.
The present invention also relates to the use of a recombinant vector
according to the
invention, preferably a defective recombinant virus, for the preparation of a
pharmaceutical
composition for the treatment and/or prevention of pathologies linked to
platelet activation
dysfunction.
The invention relates to the use of such a recombinant vector or defective
recombinant virus
for the preparation of a pharmaceutical composition intended for the treatment
and/or for the
prevention of a disorder or condition associated with platelet activation
dysfunction. Thus, the present
invention also relates to a pharmaceutical ,composition comprising one or more
recombinant vectors or
defective recombinant viruses according to the invention.
The present invention also relates to a new therapeutic approach for the
prevention and/or.
treatment of pathologies linked to platelet activation dysfunction. It
provides an advantageous solution
to the disadvantages of the prior art, by demonstrating the possibility of
treating the pathologies linked
to platelet activation dysfunction by gene therapy, by the transfer and
expression in vivo of a nucleic
acid encoding an RGS 18 polypeptide involved in platelet activation. The
invention thus offers a
simple means allowing a specific and effective treatment ofrelated pathologies
such as, for example,
arterial thrombosis, myocardial infarction, coronary artery disease, stroke,
cerebrovascular disease,
unstable angina; deep vein thrombosis, systemic thromboembolism, as well as
its use in invasive
cardiac procedures for anti-coagulant purposes.
Gene therapy consists in correcting a deficiency or an abnormality (mutation,
aberrant
expression and the like) and in bringing about the expression of a protein of
therapeutic interest by
introducing genetic information into the affected cell or organ. This genetic
information may be
introduced either ex vivo into a cell extracted from the organ, the modified
cell then being reintroduced
into the body, or directly in vivo into the appropriate tissue. In this second
case, various techniques
exist, among which various transfection techniques involving complexes of DNA
and DEAF-dextran
(116), of DNA and nuclear proteins (117), of DNA and lipids (87), the use of
liposomes (118), and the
like. More recently, the use of viruses as vectors for the transfer of genes
has appeared as a promising
alternative to these physical transfection techniques. In this regard, various
viruses have been tested for
their capacity to infect certain cell populations. In particular, the
retroviruses (RSV, HMS, MMS, and
the like), the HSV virus, the adeno-associated viruses and the adenoviruses.
The present invention therefore also relates to a new therapeutic approach for
the treatment of
a disorder or condition associated with platelet activation dysfunction,
comprising in transferring and
in expressing in vivo genes encoding RGS 18. Specifically, the present
invention provides a new
therapeutic approach for the treatment and/or prevention of a disorder or
condition associated with


CA 02408073 2002-10-28
-45-
platelet activation dysfunction, such as arterial thrombosis, myocardial
infarction, coronary artery
disease, stroke, cerebrovascular disease, unstable angina, deep vein
thrombosis, systemic
thromboembolism, as well as its use in invasive cardiac procedures for anti-
coagulant purposes. In a
particularly preferred manner, the applicant has now found that it is possible
to construct recombinant
vectors comprising a nucleic acid encoding an RGS 18 polypeptide involved in
the platelet activation,
to administer these recombinant vectors in vivo, and that this administration
allows a stable and
effective expression of a biologically active RGS 18 polypeptide in vivo, with
no cytopathological
effect.
The present invention also results from the demonstration that adenoviruses
constitute
particularly efficient vectors for the transfer and the expression of the RGS
18 nucleic acids of the
invention. In particular, the present invention shows that the use of
recombinant adenoviruses as
vectors makes it possible to obtain sufficiently high levels of expression of
this gene to produce the
desired therapeutic effect. Other viral vectors such as retroviruses or adeno-
associated viruses (AAV)
allowing a stable expression of the gene are. also claimed.
The present invention thus offers a new approach for the treatment and
prevention of a
disorder or condition associated with platelet activation dysfunction.
The subject of the invention is therefore also a defective recombinant virus
comprising a
nucleic acid according to the invention that encodes an RGS 18 protein or
polypeptide involved in
platelet activation. -
The invention also relates to the use of such a defective recombinant virus
for the preparation
of a pharmaceutical composition intended for the treatment and/or for the
prevention of a disorder or
condition associated with platelet activation dysfunction, such as arterial
thrombosis, myocardial
infarction, coronary artery disease, stroke, cerebrovascular disease, unstable
angina, deep vein
thrombosis, systemic thromboembolism, as well as its use in invasive cardiac
procedures for anti-
coagulant purposes.
The present invention also relates to the use of cells genetically modified ex
vivo with such a
defective recombinant virus according to the invention, or of cells producing
a defective recombinant
virus, wherein the cells are implanted in the body, to allow a prolonged and
effective expression
in vivo of a biologically active RGS18 polypeptide.
The present invention shows that it is possible to incorporate a nucleic acid
sequence
encoding RGS 18 into a viral vector, and that these vectors make it possible
to effectively express a
biologically active, mature form. More particularly, the invention shows that
the in vivo expression of
RGS 18 may be obtained by direct administration of an adenovirus or by
implantation of a producing
cell or of a cell genetically modified by an adenovirus or by a retrovirus
incorporating such a nucleic
acid.
The present invention is particularly advantageous because it makes it
possible to induce a
controlled expression, and with no harmful effect, of RGS 18 in organs which
are not normally


CA 02408073 2002-10-28
-46-
involved in the expression of this protein. In particular, a significant
release of the RGS 18 protein is
obtained by implantation of cells producing vectors of the invention, or
infected ex vivo with vectoxs of
the invention.
The nucleic sequence used in the context of the present invention may be a
cDNA, a genomic
DNA (gDNA), an RNA (in the case of retroviruses) or a hybrid construct
consisting, for example, of a
cDNA into which one or more introns (gDNA) would be inserted. It may also
involve synthetic or
semisynthetic sequences. In a particularly advantageous manner, a cDNA or a
gDNA is used. In
particular, the use of a gDNA allows a better expression in human cells. To
allow their incorporation
into a viral vector according to the invention, these sequences are preferably
modified, for example by
site-directed mutagenesis, in particular for the insertion of appropriate
restriction sites.
In the context of the present invention, the use of a nucleic acid encoding a
human RGS 18
protein is preferred. Moreover, it is also possible to use a construct
encoding a derivative of these
RGS 18 proteins. A derivative of these RGS 18 proteins comprises, for example,
any sequence obtained
by mutation, deletion and/or addition relative to the native sequence, and
encoding a product retaining
biological activity. These modifications may be made by techniques known to a
person skilled in the
art (see general molecular biological techniques below). The biological
activity of the derivatives thus
obtained can then be easily determined, as indicated in particular in the
examples. The derivatives for
the purposes of the invention may also be obtained by hybridization from
nucleic acid libraries, using
as probe the native sequence or a fragment thereof.
These derivatives are in particular molecules having a higher affinity for
their binding sites,
molecules exhibiting greater resistance to proteases, molecules having a
higher therapeutic efficacy or
fewer side effects, or optionally new biological properties. The derivatives
also include the modified
DNA sequences allowing improved expression ifa vivo.
Thus, the present invention relates to a defective recombinant virus
comprising a nucleic acid
that encodes an RGS 18 polypeptide. In a first embodiment, the present
invention relates to a defective
recombinant virus comprising a cDNA that encodes an RGS 18 polypeptide. In
another preferred
embodiment of the invention, a defective recombinant virus comprises a genomic
DNA (gDNA) that
encodes an RGS18 polypeptide. Preferably, the encoded RGS18 polypeptide
comprises amino acids a)
1-58 of SEQ ID NO: 12, b) 1-166 of SEQ ID NO: 20, c) 86-202 of SEQ ID NO: 20,
or d) 86-166 of
SEQ ID NO: 20. More preferably, the encoded RGS18 polypeptide an amino acid
sequence of SEQ
ID NO: 20.
The vectors of the invention may be prepared from various types of viruses.
Preferably,
vectors derived from adenoviruses, adeno-associated viruses (AAV),
herpesviruses (HSV) or
retroviruses are used. It is preferable to use an adenovirus, for direct
administration or for the ex vivo
modification of cells intended to be implanted, or a retrovirus, for the
implantation of producing cells.
The viruses according to the invention are defective; that is to say that they
are incapable of
autonomously replicating in the target cell. Generally, the genome of the
defective viruses used in the


CA 02408073 2002-10-28
-47-
context of the present invention therefore lacks at least the sequences
necessary for the replication of
said virus in the infected cell. These regions may be either eliminated
(completely or partially), or
made nonfunctional, or substituted with other sequences and in particular with
the nucleic acid
sequence encoding the RGS 18 polypeptide. Preferably, the defective virus
retains, nevertheless, the
sequences of its genome that are necessary for the encapsidation of the viral
particles.
As regards more particularly adenoviruses, various serotypes, whose structure
and properties
vary somewhat, have been characterized. Among these serotypes, human
adenoviruses of type 2 or 5
(Ad 2 or Ad 5) or adenoviruses of animal origin (see Application WO 94/26914)
are preferably used in
the context of the present invention. Among the adenoviruses of animal origin
that can be used in the
context of the present invention, there may be mentioned adenoviruses of
canine, bovine, marine
(example: Mavl, 119), ovine, porcine, avian or simian (example: SAV) origin.
Preferably, the
adenovirus of animal origin is a canine adenovirus, more preferably a CAV2
adenovirus [Manhattan or
A26/61 strain (ATCC VR-800) for example]. Preferably, adenoviruses of human or
canine or mixed
origin are used in the context of the invention. Preferably, the defective
adenoviruses of the invention
comprise the TTRs, a sequence allowing the encapsidation and the sequence
encoding the RGS 18
polypeptide. Preferably, in the genome of the adenoviruses of the invention,
the E1 region at least is
made nonfunctional. Still more preferably, in the genome of the adenoviruses
of the invention, the El
gene and at least one of the E2, E4 and L1-LS genes are nonfunctional. The
viral gene considered may
be made nonfunctional by any technique known to a person skilled in the art,
and in ,particular by total
suppression, by substitution, by partial deletion or by addition of one or
more bases in the genes)
considered. Such modifications may be obtained in vitro (on the isolated DNA)
or in situ, for example,
by means of genetic engineering techniques, or by treatment by means of
mutagenic agents. Other
regions may also be modified, and in particular the E3 (W095/02697), E2
(W094/28938), E4
(W094/28152, W094/12649, W095/02697) and LS (W095/02697) region. According to
a preferred
embodiment, the adenovirus according to the invention comprises a deletion in
the E1 and E4 regions
and the sequence encoding RGS 18 is inserted at the level of the inactivated
E1 region. According to
another preferred embodiment, it comprises a deletion in the E1 region at the
level of which the E4
region and the sequence encoding RGS18 (French Patent Application FR94 13355)
are inserted.
The defective recombinant adenoviruses according to the invention may be
prepared by any
technique known to persons skilled in the art (EP 185 573; and 120, 121). In
particular, they may be
prepared by homologous recombination between an adenovirus and a plasmid
carrying, inter alia, the
nucleic acid encoding the RGS18 protein. The homologous recombination occurs
after co-transfection
of said adenoviruses and plasmid into an appropriate cell line. The cell line
used must preferably (i) be
transformable by said elements, and (ii), contain the sequences capable of
complementing the part of
the defective adenovirus genome, preferably in integrated form in order to
avoid the risks of
recombination. By way of example of a line, there may be mentioned the human
embryonic kidney
line 293 (122), which contains in particular, integrated into its genome, the
left part of the genome of


CA 02408073 2002-10-28
-48-
an Ad5 adenovirus (12%) or lines capable of complementing the E1 and E4
functions as described in
particular in Applications No. WO 94/26914 and W095/02697.
Next, the adenoviruses that have multiplied are recovered and purified
according to
conventional molecular biological techniques, as illustrated in the examples.
As regards the adeno-associated viruses (AAV), they are DNA viruses of a
relatively small
size, which integrate into the genome of the cells that they infect, in a
stable and site-specific manner.
They are capable of infecting a broad spectrum of cells, without inducing any
effect on cellular
growth, morphology or differentiation. Moreover, they do not appear to be
involved in pathologies in
humans. The genome of AAVs has been cloned, sequenced and characterized. It
comprises about 4700
bases, and contains at each end an inverted repeat region (ITR) of about 145
bases, serving as
replication origin for the virus. The remainder of the genome is divided into
2 essential regions
carrying the encapsidation functions: the left hand part of the genome, which
contains the rep gene,
involved in the viral replication and the expression of the viral genes; the
right hand part of the
genome, which contains the cap gene encoding the virus capsid proteins.
The use of vectors derived from AAVs for the transfer of genes in vitro and in
vivo has been
described in the literature (see in particular WO 91/18088; WO 93/09239; US
4,797,368,
US5,139,941, EP 488 528). These applications describe various constructs
derived from AAVs, in
which the rep and/or cap genes are deleted and replaced by a gene of interest,
and their use for
transferring in vitro (on cells in culture) or in vivo (directly into an
organism) said gene of interest.
However, none of these documents either describes or suggests the use of a
recombinant AAV for the
transfer and expression in vivo or ex vivo of an RGS 18 protein, or the
advantages of such a transfer.
The defective recombinant AAVs according to the invention may be prepared by
co-transfection, into
a cell line infected with a human helper virus (for example an adenovirus), of
a plasmid containing the
sequence encoding the RGS 18 protein bordered by two AAV inverted repeat
regions (ITR), and of a
plasmid carrying the AAV encapsidation genes (rep and cap genes). The
recombinant AAVs produced
are then purified by conventional techniques.
As regards the herpesviruses and the retroviruses, the construction of
recombinant vectors
has been widely described in the literature: see in particular WO 94/21807, WO
92/05263, EP 453242,
EP 178220, and 123-125, and the like.
In particular, the retroviruses are integrating viruses, infecting dividing
cells. The genome of
the retroviruses essentially comprises two long terminal repeats (LTRs), an
encapsidation sequence
and three coding regions (gag, pol and envy. In the recombinant vectors
derived from retroviruses, the
gag, pol and env genes are generally deleted, completely or partially, and
replaced with a heterologous
nucleic acid sequence of interest. These vectors may be produced from various
types of retroviruses
such as in particular MoMuLV ("marine moloney leukemia virus"; also called
MoMLV), MSV
("marine moloney sarcoma virus"), HaSV ("harvey sarcoma virus"); SNV ("spleen
necrosis virus");
RSV ("rous sarcoma virus") or Friend's virus.


CA 02408073 2002-10-28
-49-
To construct recombinant retroviruses containing a sequence encoding the RGS18
protein
according to the invention, a plasmid containing in particular the LTRs, the
encapsidation sequence
and said coding sequence is generally constructed, and then used to transfect
a so-called encapsidation
cell line, capable of providing in trans the retroviral functions deficient in
the plasmid. Generally, the
encapsidation lines are therefore capable of expressing the gag, pol and env
genes. Such encapsidation
lines have been described in the prior art, and in particular the PA317 line
(US 4,861,719), the
PsiCRIP line (WO 90 /02806) and the GP+envAm-12 line (WO 89!07150). Moreover,
the recombinant
retroviruses may contain modifications at the level of the LTRs in order to
suppress the transcriptional
activity, as well as extended encapsidation sequences, containing a portion of
the gag gene (126). The
recombinant retroviruses produced are then purified by conventional
techniques.
To carry out the present invention, it is preferable to use a defective
recombinant adenovirus.
The particularly advantageous properties of adenoviruses are preferred for the
ire vivo expression of a
protein having a cholesterol transport activity. The adenoviral vectors
according to the invention are
particularly preferred for a direct administration in vivo of a purified
suspension, or for the ex vivo
transformation of cells, in particular autologous cells, in view of their
implantation. Furthermore, the
adenoviral vectors according to the invention exhibit, in addition,
considerable advantages, such as in
particular their very high infection efficiency, which makes it possible to
carry out infections using
small volumes of viral suspension.
According to another particularly preferred embodiment of the invention, a
line producing
retroviral vectors containing the sequence encoding the RGS 18 protein is used
for implantation in vivo.
The lines that can be used to this end are in particular the PA317 (CTS
4,861,719), PsiCrip
(WO 90/02806) and GP+envAm-12 (US 5,278,056) cells modified so as to allow the
production of a
retrovirus containing a nucleic sequence encoding an RGS 18 protein according
to the invention.
Preferably, in the vectors of the invention, the nucleic acid encoding the RGS
18 protein is
placed under the control of signals allowing its expression in the infected
cells. These may be
expression signals that are homologous or heterologous, that is to say signals
different from those that
are naturally responsible for the expression of the RGS 18 protein. They may
also be in particular
sequences responsible for the expression of other proteins, or synthetic
sequences. In particular, they
may be sequences of eukaryotic or viral genes or derived sequences,
stimulating or repressing the
transcription of a gene in a specific manner or otherwise and in an inducible
manner or otherwise. By
way of example, they may be promoter sequences derived from the genome of the
cell which it is
desired to infect, or from the genome of a virus, and in particular the
promoters of the ElA or major
late promoter (MLP) genes of adenoviruses, the cytomegalovirus (CMV) promoter,
the RSV-LTR and
the like. Among the eukaryotic promoters, there may also be mentioned the
ubiquitous promoters
(HPRT, vimentin, a-actin, tubulin and the like), the promoters of the
intermediate filaments (desmin,
neurofilaments, keratin, GFAP, and the like), the promoters of therapeutic
genes (of the MDR, CFTR
or factor VIII type, and the like), tissue-specific promoters (pyruvate
kinase, villin, promoter of the


CA 02408073 2002-10-28
-50-
fatty acid binding intestinal protein, promoter of the smooth muscle cell a-
actin, promoters specific for
the liver; Apo AI, Apo AII, human albumin and the like) or promoters
corresponding to a stimulus
(steroid hormone receptor, retinoic acid receptor and the like). In addition,
these expression sequences
may be modified by addition of enhancer or regulatory sequences and the like.
Moreover, when the
inserted gene does not contain expression sequences, it may be inserted into
the genome of the
defective virus downstream of such a sequence.
In a specific embodiment, the invention relates to a defective recombinant
virus comprising a
nucleic acid encoding an RGS 18 protein operatively linked or placed under the
control of a promoter
chosen from RSV-LTR or the CMV early promoter.
As indicated above, the present invention also relates to any use of a virus
as described above
for the preparation of a pharmaceutical composition for the treatment andlor
prevention of a disorder
or condition associated with platelet activation dysfunction.
The present invention also relates to a pharmaceutical composition comprising
one or more
defective recombinant viruses as described above. These pharmaceutical
compositions may be
formulated for administration by the topical, oral, parenteral, intranasal,
intravenous, intramuscular,
subcutaneous, intraocular or transdermal route and the like. Preferably, the
pharmaceutical
compositions of the invention comprise a pharmaceutically acceptable vehicle
or physiologically
compatible excipient for an injectable formulation, in particular for an
intravenous injection, such as
for example into the patient's portal vein. These may relate in particular to
isotonic sterile solutions or
dry, in particular, freeze-dried, compositions, which upon addition depending
on the case of sterilized
water or physiological saline, allow the preparation of injectable solutions.
Direct injection into the
patient's portal vein is preferred because it makes it possible to target the
infection at the level of the
liver and thus to concentrate the therapeutic effect at the level of this
organ.
The doses of defective recombinant virus used for the injection may be
adjusted as a function
of various parameters, and in particular as a function of the viral vector, of
the mode of administration
used, of the relevant pathology or of the desired duration of treatment. In
general, the recombinant
adenoviruses according to the invention are formulated and administered in the
form of doses of
between 104 and 1014 pfu/ml, and preferably 106 to 1010 pfu/ml. The term "pfu"
(plaque forming
unit) corresponds to the infectivity of a virus solution, and is determined by
infecting an appropriate
cell culture and measuring, generally after 48 hours, the number of plaques
that result from infected
cell lysis. The techniques for determining the pfu titer of a viral solution
are well documented in the
literature.
As regards retroviruses, the compositions according to the invention may
directly contain the
producing cells, with a view to their implantation.
In this regard, another subject of the invention relates to any isolated
mammalian cell
infected with one or more defective recombinant viruses according to the
invention. More particularly,


CA 02408073 2002-10-28
-51-
the invention relates to any population of human cells infected with such
viruses. These may be in
particular cells of blood origin (totipotent stem cells or precursors),
fibroblasts, myoblasts,
hepatocytes, keratinocytes, smooth muscle and endothelial cells, glial cells
and the like.
The cells according to the invention may be derived from primary cultures.
These may be
collected by any technique known to persons skilled in the art and then
cultured under conditions
allowing their proliferation. As regards more particularly fibroblasts, these
may be easily obtained
from biopsies, for example according to the technique described by Ham (1980).
These cells may be
used directly for infection with the viruses, or stored, for example by
freezing, for the establishment of
autologous libraries, in view of a subsequent use. The cells according to the
invention may be
secondary cultures, obtained for example from pre-established libraries (see
for example EP 228458,
EP 289034, EP 400047, EP 456640).
The cells in culture are then infected with a recombinant virus according to
the invention, in
order to confer on .them the capacity to produce a biologically active RGS 18
protein. The infection is
carried out in vitro according to techniques known to persons skilled in the
art. In particular, depending
on the type of cells used and the desired number of copies of virus per cell,
persons skilled in the art
can adjust the multiplicity of infection and optionally the number of
infectious cycles produced. It is
clearly understood that these steps must be carned out under appropriate
conditions of sterility when
the cells are intended for administration in vivo. The doses of recombinant
virus used for the infection
of the cells may be adjusted by persons skilled. in the art according to the
desired aim. The conditions
described above for the administration in vivo may be applied to the infection
in vitro. For the infection
with a retrovirus, it is also possible to co-culture a cell to be infected
with a cell producing the
recombinant retrovirus according to the invention. This makes it possible to
eliminate purification of
the retrovirus.
Another subject of the invention relates to an implant comprising isolated
mammalian cells
infected with one or more defective recombinant viruses according to the
invention or cells producing
recombinant viruses, and an extracellular matrix. Preferably, the implants
according to the invention
comprise 105 to 1010 cells. More preferably, they comprise 106 to 108 cells.
More particularly, in the implants of the invention, the extracellular matrix
comprises a
gelling compound and optionally a support allowing the anchorage of the cells.
For the preparation of the implants according to the invention, various types
of gelling agents
may be used. The gelling agents are used for the inclusion of the cells in a
matrix having the
constitution of a gel, and for promoting the anchorage of the cells on the
support, where appropriate.
Various cell adhesion agents can therefore be used as gelling agents, such as
in particular collagen,
gelatin, glycosaminoglycans, fibronectin, lectins and the like. Preferably,
collagen is used in the
context of the present invention. This may be collagen of human, bovine or
marine origin. More
preferably, type I collagen is used.


CA 02408073 2002-10-28
-52-
As indicated above, the compositions according to the invention preferably
comprise a
support allowing the anchorage of the cells. The term anchorage designates any
form of biological
and/or chemical and/or physical interaction causing the adhesion and/or the
attachment of the cells to
the support: Moreover, the cells may either cover the support used, or
penetrate inside this support, or
both. It is preferable to use in the context of the invention a solid,
nontoxic and/or biocompatible
support. In particular, it is possible to use polytetrafluoroethylene (PTFE)
fibers or a support of
biological origin.
The present invention thus offers a very effective means for the treatment or
prevention of a
disorder or condition associated with platelet activation dysfunction.
In addition, this treatment may be applied to both humans and any animals such
as ovines,
bovines, domestic animals (dogs, cats and the like), horses, fish and the
like.
RECOMBINANT HOST CELLS
The present invention also relates to the use of cells genetically modified ex
vivo with a virus
according to the invention, or of cells producing such viruses, implanted in
the body, allowing a
prolonged and effective expression in vivo of a biologically active RSG18
protein.
The present invention shows that it is possible to incorporate a nucleic acid
encoding an
RGS 18 polypeptide according to the invention into a viral vector, and that
these vectors make it
possible to effectively express a biologically active, mature polypeptide.
More particularly, the
invention shows that the in vivo expression of RSG18 may be obtained by direct
administration of an
adenovirus or by implantation of a producing cell or of a cell genetically
modified by an adenovirus or
by a retrovirus incorporating such a nucleic acid.
In this regard, another subject of the invention relates to any isolated
mammalian cell
infected with' one or more defective recombinant viruses according to the
invention. More particularly,
the invention relates to any population of human cells infected with these
viruses. These may be in
particular cells of blood origin (totipotent stem cells or precursors),
fibroblasts, myoblasts,
hepatocytes, keratinocytes, smooth muscle and endothelial cells, glial cells
and the like.
Another subject of the invention relates to an implant comprising isolated
mammalian cells
infected with one or more defective recombinant viruses according to the
invention or cells producing
recombinant viruses, and an extracellular matrix. Preferably, the implants
according to the invention
comprise 105 to 1010 cells. More preferably, they comprise 106 to 108 cells.
More particularly, in the implants of the invention, the extracellular matrix
comprises a
gelling compound and optionally, a support allowing the anchorage of the
cells.
The invention also relates to an isolated recombinant host cell comprising a
nucleic acid of
the invention, and more particularly, a nucleic acid comprising a) any one of
SEQ ID NOs: 11, 18, or
19, or of a complementary polynucleotide sequence, b) nucleotides 1-169 of SEQ
ID NO: 11, or of a


CA 02408073 2002-10-28
-53-
complementary polynucleotide sequence, c) nucleotides 1-658 of SEQ ID NO: 19,
or of a
complementary polynucleotide sequence, d) nucleotides 163-870 of SEQ ID NO:
19, or of a
complementary polynucleotide sequence, e) nucleotides 163-658 of SEQ ID NO:
19, or of a
complementary polynucleotide sequence, f) nucleotides 418-768 of SEQ ID NO:
19, or of a
complementary polynucleotide sequence, or g) nucleotides 418-658 of SEQ ID NO:
19, or of a
complementary polynucleotide sequence.
The invention also relates to an isolated recombinant host cell comprising a
nucleic acid of the
invention, and more particularly a nucleic acid comprising a nucleotide
sequence as depicted in either
SEQ ZD NOs: 18 or 19, or of a complementary polynucleotide sequence.
The invention also relates to an isolated recombinant host cell comprising a
nucleic acid
encoding a polypeptide comprising an amino acid sequence of SEQ ID NO: 20.
The invention also relates to a recombinant host cell comprising a nucleic
acid encoding a polypeptide
comprising a) amino acids 1-58 of SEQ ID NO: 12, b) amino acids 1-166 of SEQ
ID NO: 20, c) amino
acids 86-202 of SEQ ID NO: 20, or d) amino acids 86-166 of SEQ ID NO: 20.
According to another aspect, the invention also relates to an isolated
recombinant host cell
comprising a recombinant vector according to the invention. Therefore, the
invention also relates to a
recombinant host cell comprising a recombinant vector comprising any of the
nucleic acids of the
invention.
Specifically, the invention relates to an isolated recombinant host cell
comprising a
recombinant vector comprising a nucleic acid comprising a) any one of SEQ ID
NOs: 11, 18, or 19, or
of a complementary polynucleotide sequence, b) nucleotides 1-169 of SEQ )D NO:
1 l, or of a
complementary polynucleotide sequence, c) nucleotides 1-658 of SEQ JD NO: 19,
or of a
complementary polynucleotide sequence, d) nucleotides 163-870 of SEQ ID NO:
19, or of a
complementary polynucleotide sequence, e) nucleotides 163-658 of SEQ ID NO:
19, or of a
complementary polynucleotide sequence, f) nucleotides 418-768 of SEQ ID NO:
19, or of a
complementary polynucleotide sequence, or g) nucleotides 418-658 of SEQ ID NO:
19, or of a
complementary polynucleotide sequence.
The invention also relates to an isolated recombinant host cell comprising a
recombinant
vector comprising a nucleic acid comprising a polynucleotide sequence as
depicted in either one of
SEQ ID NOs: 18 or 19, or of a complementary polynucleotide sequence.
The invention also relates to an isolated recombinant host cell comprising a
recombinant
vector comprising a nucleic acid encoding a polypeptide comprising an amino
acid sequence of SEQ
>D NO: 20.
The invention also relates to an isolated recombinant host cell comprising a
recombinant vector
comprising a nucleic acid encoding a polypeptide comprising amino acids a) 1-
58 of SEQ >D NO: 12,
b) 1-166 of SEQ m NO: 20, c) 86-202 of SEQ )D NO: 20, or d) 86-166 of SEQ >D
NO: 20.
The preferred host cells according to the invention are for example the
following:


CA 02408073 2002-10-28
-54-
a) prokaryotic host cells: strains of Escherichia coli (strain DHS-a), of
Bacillus subtilis, of
Salmonella typlzimuriurn, or strains of genera such as Pseudomonas,
Streptomyces and Staphylococus ;
b) eukaryotic host cells: HeLa cells (ATCC No. CCL2), Cv 1 cells (ATCC No.
CCL70), COS
cells (ATCC No. CRL 1650), Sf 9 cells (ATCC No. CRL 1711), CHO cells (ATCC No.
CCL-61) or
3T3 cells (ATCC No. CRL-6361).
METHODS FOR PRODUCING RGS18 POLYPEPTIDES
The invention also relates to a method for the production of a polypeptide
comprising an
amino acid sequence of either one of SEQ ID NOs: 12 or 20, or of a polypeptide
or a variant thereof,
wherein the polypeptide or variant comprises amino acids a) 1-58 of SEQ )D NO:
12, b) 1-166 of SEQ
ID NO: 20, c) 86-202 of SEQ ID NO: 20, or d) 86-166 of SEQ )D NO: 20, wherein
said method
comprising the steps of:
a) inserting a nucleic acid encoding said polypeptide into an appropriate
vector;
b) culturing, in an appropriate culture medium, a previously transformed host
cell or
' transfecting a host cell with the recombinant vector of step a);
c) recovering the conditioned culture medium or lysing the host cell, for
example by sonication
or by osmotic shock;
d) separating and purifying said polypeptide from said culture medium or
alternatively from
the cell lysates obtained in step c); and
e) where appropriate, characterizing the recombinant polypeptide produced.
A specific embodiment of the invention relates to a method for producing a
polypeptide
comprising an amino acid sequence of amino acids 86-202 of SEQ ID NO: 20.
A polypeptide termed "homologous" to a polypeptide having an amino acid
sequence
comprising a) either one of SEQ )D NOs: 12 or 20, b) amino acids 1-58 of SEQ
)D NO: 12, c) amino
acids 1-166 of SEQ ID NO: 20, d) amino acids 86-202 of SEQ ID NO: 20, or e)
amino acids 86-166 of
SEQ ID NO: 20, also forms part of the invention. Such a homologous polypeptide
comprises an amino
acid sequence possessing one or more substitutions of an amino acid by an
equivalent amino acid,
relative to a) either one of SEQ )D NOs: 12 or 20, b) amino acids 1-58 of SEQ
>D NO: 12, c) amino
acids 1-166 of SEQ )D NO: 20, d) amino acids 86-202 of SEQ ID NO: 20, or e)
amino acids 86-166 of
SEQ ID NO: 20, respectively.
The RGS 18 polypeptides according to the invention, in particular comprise:
1) a polypeptide comprising an amino acid sequence of either one of SEQ ID
NOs: 12 or 20,
2) a polypeptide comprising amino acids a) 1-58 of SEQ >D NO: 12, b) 1-166 of
SEQ ID NO: 20, c) 86-202 of SEQ m NO: 20, or d) 86-166 of SEQ ID NO: 20,
3) a polypeptide fragment or variant of a polypeptide comprising an amino acid


CA 02408073 2002-10-28
=55-
sequence of either one of SEQ ID NOs: 12 or 20, wherein the polypeptide
fragment or variant
comprises amino acids a) 1-58 of SEQ ID NO: 12, b) 1-166 of SEQ ID NO: 20, c)
86-202 of SEQ TD
NO: 20, or d) 86-166 of SEQ ll~ NO: 20, or
4) a polypeptide termed "homologous" to a polypeptide comprising a) either one
of SEQ ID
NOs: 12 or 20, b) amino acids 1-58 of SEQ ID NO: 12, c) amino acids 1-166 of
SEQ ID NO: 20, d)
amino acids 86-202 of SEQ ID NO: 20, or e) amino acids 86-166 of SEQ ID NO:
20.
The polypeptides according to the invention may be characterized by binding to
an
immunoaffmity chromatography column on which the antibodies directed against
this polypeptide or
against a fragment or a variant thereof have been previously immobilized.
According to another aspect, a recombinant polypeptide according to the
invention may be
purified by passing it over an appropriate series of chromatography columns,
according to methods
known to persons skilled in the art and described for example in F. Ausubel et
al. (47).
A polypeptide according to the invention may also be prepared by conventional
chemical
synthesis techniques either in homogeneous solution or in solid phase. By way
of illustration, a
polypeptide according to the invention may be prepared by the technique either
in homogeneous
solution described by Houben Weyl (127) or the solid phase synthesis technique
described by
Merrifield (128, 129).
An "equivalent amino acid" according to the present invention will be
understood to mean for
example replacement of a residue in the L form by a residue in the D form or
the replacement of a
glutamic acid (E) by a pyro-glutamic acid according to techniques well known
to persons skilled in the
art. By way of illustration, the synthesis of peptide containing at least one
residue in the D form is
described by Koch (130). According to another aspect, two amino acids
belonging to the same class,
that is to say two uncharged polar, nonpolar, basic or acidic amino acids, are
also considered as,
equivalent amino acids.
Polypeptides comprising at least one nonpeptide bond such as a retro-inverse
bond (NHCO), a
carba bond (CHZCHZ) or a ketomethylene bond (CO-CHZ) also form part of the
invention.
Preferably, the polypeptides according to the invention comprising one or more
additions,
deletions, substitutions of at least one amino acid will retain their capacity
to be recognized by
antibodies directed against the nonmodified polypeptides.


CA 02408073 2002-10-28
-56-
ANTIBODIES
The RGS 18 polypeptides according to the invention may be used for the
preparation of an
antibody, in particular for detecting the production of a normal or altered
form of an RGS 18
polypeptide in a patient.
Thus, the present invention also relates to antibodies directed against an RGS
18 polypeptide.
In a specific embodiment, an antibody according to the invention is directed
against
1) a polypeptide comprising an amino acid sequence of any one of SEQ )D NOs:
7, 8, 12 or
20,
2) a polypeptide comprising amino acids a) 1-58 of SEQ )D NO: 12, b) 1-166 of
SEQ m
NO: 20, c) 86-202 of SEQ )D NO: 20, or d) 86-166 of SEQ 117 NO: 20,
3) a polypeptide fragment or variant of a polypeptide comprising an amino acid
sequence of
either one of SEQ )D NOs: 12 or 20, wherein the polypeptide fragment or
variant comprises amino
acids a) 1-58 of SEQ )D NO: 12, b) 1-166 of SEQ ID NO: 20, c) 86-202 of SEQ ID
NO: 20, or d) 86-
166 of SEQ )D NO: 20, or
4) a polypeptide termed "homologous" to a polypeptide comprising a) either
one. of SEQ )D
NOs: 12 or 20, b) amino acids 1-58 of SEQ )D NO: 12, c) amino acids 1-166 of
SEQ )D NO: 20, d)
amino acids 86-202 of SEQ ID NO: 20, or e) amino acids 86-166 of SEQ ID NO:
20.
The present.invention relates to an antibody directed against an RGS 18
polypeptide, as
produced in the trioma technique or the hybridoma technique described by
Kozbor et al. (131).
An antibody directed against a polypeptide termed "homologous" to a
polypeptide according
to the invention also forms part of the invention. Such an antibody is
directed against a homologous .
polypeptide comprising an amino acid sequence that has one or more
substitutions of an amino acid by
an equivalent amino acid, relative to a polypeptide according to the
invention, 'wherein the polypeptide
according to the invention comprises a) either one of SEQ ID NOs: 12 or 20, b)
amino acids 1-58 of
SEQ ID NO: 12, c) amino acids 1-166 of SEQ )T7 NO: 20, d) amino acids 86-202
of SEQ )D NO: 20,
or e) amino acids 86-166 of SEQ ID NO: 20.
"Antibody" for the purposes of the present invention will be understood to
mean in particular
polyclonal or monoclonal antibodies or fragments (for example the F(ab)'2 and
Fab fragments) or any
polypeptide comprising a domain of the initial antibody recognizing the target
polypeptide or
polypeptide fragment according to the invention.
Monoclonal antibodies maybe prepared from hybridomas according to the
technique
described by Kohler and Milstein (132).
According to the invention, a polypeptide produced recombinantly or by
chemical synthesis,
and fragments or other derivatives or analogs thereof, including fusion
proteins, may be used as an
immunogen to generate antibodies that recognize a polypeptide according to the
invention. Such
antibodies include but are not limited to polyclonal, monoclonal, chimeric,
single chain, Fab
fragments, and an Fab expression library. The anti-RGS 18 antibodies of the
invention may be cross


CA 02408073 2002-10-28
-57-
reactive, e.g., they may recognize an RGS 18 polypeptide from different
species. Polyclonal antibodies
have greater likelihood of cross reactivity. Alternatively, an antibody of the
invention may be specific
for a single form of RGS 18. Preferably, such an antibody is specific for
human RGS 18.
Various procedures known in the art may be used for the production of
polyclonal antibodies
to an RGS 18 polypeptide or derivative or analog thereof. For the production
of antibody, various host
animals can be immunized by injection with an RGS18 polypeptide, or a
derivative (e.g., fragment or
fusion protein) thereof, including but not limited to rabbits, mice, rats,
sheep, goats, etc. In one
embodiment, the RGS18 polypeptide or fragment thereof can be conjugated to an
immunogenic
Garner, e.g., bovine serum albumin (BSA) or keyhole limpet hernocyanin (KLH).
Various adjuvants
may be used to increase the immunological response, depending on the host
species, including but not
limited to Freund's (complete and incomplete), mineral gels such as aluminum
hydroxide, surface
active substances such as lysolecithin, pluronic polyols, polyanions,
peptides, oil emulsions, keyhole
limpet hemocyanins, dinitrophenol, and potentially useful human adjuvants such
as BCG (bacille
Calrnette-Guerin) and Coryraebacteriurn parvurn.
For preparation of monoclonal antibodies directed toward the RGS 18
polypeptide, or
fragment, analog, or derivative thereof, any technique that provides for the
production of antibody
molecules by continuous cell lines in culture may be used. These include but
are not limited to the
hybridoma technique originally developed by Kohler and Milstein (132), as well
as the trioma
technique, the human B-cell hybridoma technique (133); Cote et al. .(134), and
the EBV-hybridoma
technique to produce. human monoclonal antibodies (135). In an additional
embodiment of the
invention, monoclonal antibodies can be produced in germ-free animals
[International Patent
Publication No. WO 89/12690, published 28 December 1989]. In fact, according
to the invention,
techniques developed for the production of "chimeric antibodies" (136-138) by
splicing the genes from
a mouse antibody molecule specific for an RGS18 polypeptide together with
genes from a human
antibody molecule of appropriate biological activity can be used; such
antibodies are within the scope
of this invention. Such human or humanized chimeric antibodies are preferred
for use in therapy of
human diseases or disorders (described infra), since the human or humanized
antibodies are much less
likely than xenogenic antibodies to induce an immune response, in particular
an allergic response,
themselves.
According to the invention, techniques described for the production of single
chain antibodies
[U.S. Patent Nos. 5,476,786 and 5,132,405 to Huston; U.S. Patent 4,946,778]
can be adapted to
produce RGS 18 polypeptide-specific single chain antibodies. An additional
embodiment of the
invention utilizes the techniques described for the construction of Fab
expression libraries (139) to
allow rapid and easy identification of monoclonal Fab fragments with the
desired specificity for an
RGS 18 polypeptide, or its derivatives, or analogs.
Antibody fragments that contain the idiotype of the antibody molecule can be
generated by
known techniques. For example, such fragments include but are not limited to:
the F(ab')z fragment


CA 02408073 2002-10-28
-58-
which can be produced by pepsin digestion of the antibody molecule; the Fab'
fragments which can be
generated by reducing the disulfide bridges of the F(ab')2 fragment, and the
Fab fragments which can
be generated by treating the antibody molecule with papain and a reducing
agent.
In the production of antibodies, screening for the desired antibody can be
accomplished by
techniques known in the art, e.g., radioimmunoassay, ELISA (enzyme-linked
immunosorbant assay),
"sandwich" immunoassays, immunoradiometric assays, gel diffusion precipitin
reactions,
immunodiffusion assays, irz situ immunoassays (using colloidal gold, enzyme or
radioisotope labels,
for example), western blots, precipitation reactions, agglutination assays
(e.g., gel agglutination assays,
hemagglutination assays), complement fixation assays, immunofluorescence
assays, protein A assays,
and immunoelectrophoresis assays, etc. In one embodiment, antibody binding is
detected by detecting
a label on the primary antibody. In another embodiment, the primary antibody
is detected by detecting
binding of a secondary antibody or reagent to the primary antibody. In a
further embodiment, the
secondary antibody is labeled. Many means are known in the art for detecting
binding in an
immunoassay and are within the scope of the present invention. For example, to
select antibodies that
recognize a specific epitope of an RGS 18 polypeptide, one may assay generated
hybridomas for a
product that binds to an RGS 18 polypeptide fragment containing such epitope.
For selection of an
antibody specific to an RGS 18 polypeptide from a particular species of
animal, one can select on the
basis of positive binding with an RGS 18 polypeptide expressed by or isolated
from cells of that species
of animal.
The foregoing antibodies can be used in methods known in the art relating to
the localization
and activity of an RGS 18 polypeptide, e.g., for Western blotting, RGS 18
polypeptide in situ,
measuring levels thereof in appropriate physiological samples, etc. using any
of the detection
techniques mentioned above or known in the art.
In a specific embodiment, antibodies that agonize or antagonize the activity
of an RGS 18
polypeptide can be generated. Such antibodies can be tested using the assays
described infra for
identifying ligands.
The present invention relates to an antibody directed against a polypeptide
comprising an
amino acid sequence of
1) any one of SEQ ID NOs: 7, 8, 12, or 20,
2) a polypeptide comprising amino acids a) 1-58 of SEQ ID NO: 12, b) 1-166 of
SEQ ID NO:
20, c) 86-202 of SEQ ID NO: 20, or d) 86-166 of SEQ ID NO: 20,
3) a polypeptide fragment or variant of a polypeptide comprising an amino acid
sequence of either one of SEQ ID NOs: 12 or 20, wherein the polypeptide
fragment or variant
comprises amino acids a) 1-58 of SEQ ID NO: 12, b) 1-166 of SEQ ID NO: 20, c)
86-202 of SEQ ID
NO: 20, or d) 86-166 of SEQ ID NO: 20, or
4) a polypeptide termed "homologous" to a polypeptide comprising an amino acid


CA 02408073 2002-10-28
-59-
sequence of a) either one of SEQ )D NOs: 12 or 20, b) amino acids 1-58 of SEQ
)D NO: 12, c) amino
acids 1-166 of SEQ )D NO: 20, d) amino acids 86-202 of SEQ JD NO: 20, or e)
amino acids 86-166 of
SEQ >D NO: 20,
as produced in the trioma technique or the hybridoma technique described by
Kozbor et al. (131) also
forms part of the invention.
The invention also relates to single-chain Fv antibody fragments (ScFv) as
described in US
patent No. 4,946,778 or by Martineau et al. (1998).
The antibodies according to the invention also comprise antibody fragments
obtained with the
aid of phage libraries (140) or humanized antibodies (142, 143).
The antibody preparations according to the invention are useful in
immunological detection
tests intended for the identification of the presence and/or of the quantity
of antigens present in a
sample.
An antibody according to the invention may comprise, in addition, a detectable
marker that is
isotopic or nonisotopic, for example fluorescent, or may be coupled to a
molecule such as biotin,
according to techniques well known to persons skilled in the art.
Thus another subj ect of the invention is a method of detecting the presence
of a polypeptide
according to the invention in a sample, said method comprising the steps of:
a) bringing the sample to be tested into contact with an antibody directed
against
1) a polypeptide comprising an amino acid sequence of any one of SEQ )D NOs:
7, 8,
12, or 20,
2) a polypeptide comprising amino acids a) 1-58 of SEQ )D NO: 12, b) 1-166 of
SEQ
m NO: 20, c) 86-202 of SEQ )D NO: 20, or d) 86-166 of SEQ m NO: 20,
3) a polypeptide fragment or variant of a polypeptide comprising an amino acid
sequence of either one of SEQ )D NOs: 12 or 20, wherein the polypeptide
fragment or variant
comprises amino acids a) 1-58 of SEQ )D NO: 12, b) 1-166 of SEQ >D NO: 20, c)
86-202 of
SEQ )D NO: 20, or d) 86-166 of SEQ )D NO: 20, or
4) a polypeptide termed "homologous" to a polypeptide comprising an amino acid
sequence of a) either one of SEQ m NOs: 12 or 20, b) amino acids 1-58 of SEQ
)D NO: 12, c)
amino acids 1-166 of SEQ )D NO: 20, d) amino acids 86-202 of SEQ )D NO: 20, or
e) amino
acids 86-166 of SEQ )D NO: 20, and
b) detecting the antigen/antibody complex formed.
The invention also relates to a box or kit for diagnosis or for detecting the
presence of a
polypeptide in accordance with the invention in a sample, said box comprising:
a) an antibody directed against
1) a polypeptide comprising an amino acid sequence of any one of SEQ )D NOs:
7, 8,
12 or 20,


CA 02408073 2002-10-28
-60-
2) a polypeptide comprising amino acids a) 1-58 of SEQ ID NO: 12, b) 1-166 of
SEQ
ID NO: 20, c) 86-202 of SEQ ID NO: 20, or d) 86-166 of SEQ >D NO: 20,
3) a polypeptide fragment or variant of a polypeptide comprising an amino acid
sequence of either one of SEQ >D NOs: 12 or 20, wherein the polypeptide
fragment or variant
comprises amino acids a) 1-58 of SEQ ID NO: 12, b) 1-166 of SEQ ID NO: 20, c)
86-202 of
SEQ )D NO: 20, or d) 86-166 of SEQ )D NO: 20, or
4) a polypeptide termed "homologous" to a polypeptide comprising a) either one
of
SEQ >D NOs: 12 or 20, b) amino acids 1-58 of SEQ >D NO: 12, c) amino acids 1-
166 of SEQ
ID NO: 20, d) amino acids 86-202 of SEQ )D NO: 20, or e) amino acids 86-166 of
SEQ ll~
l0 NO: 20,
and
b) a reagent allowing the detection of the antigen/antibody complex formed.
PHARMACEUTICAL COMPOSITIONS AND THERAPEUTIC METHODS OF
15 TREATMENT
The invention also relates to a pharmaceutical composition comprising a
nucleic acid
according to the invention.
The invention also provides pharmaceutical compositions comprising a nucleic
acid encoding
an RGS 18 polypeptide according to the invention and pharmaceutical
compositions comprising an
20 RGS18 polypeptide according to the invention intended for the treatment of
a disorder or condition
associated with platelet activation dysfunction.
The present invention also relates to a new therapeutic approach for the
treatment of a disorder
or condition associated with platelet activation dysfunction, comprising
transferring and expressing in
vivo nucleic acids encoding an RGS 18 protein according to the invention.
Specifically, the present
25 invention provides a new therapeutic approach for the treatment and/or
prevention of a disorder or
condition associated with platelet activation dysfunction.
Thus, the present invention offers a new approach for the treatment and
prevention of a
disorder or condition associated with platelet activation dysfunction.
Specifically, the present
invention provides methods to restore or promote improved platelet activation
within a patient or
30 subject.
The subj ect of the invention is, in addition, a pharmaceutical composition
intended for the
prevention or treatment of a disorder or condition associated with platelet
activation dysfunction,
characterized in that the composition comprises a therapeutically effective
quantity of the normal
RGS18 polypeptide, in particular a polypeptide comprising an amino acid
sequence of a polypeptide
35 comprising amino acids a) 1-58 of SEQ >D NO: 12, b) 1-166 of SEQ ID NO: 20,
c) 86-202 of SEQ >D
NO: 20, or d) 86-166 of SEQ 1D NO: 20. In a preferred embodiment, the RGS18
polypeptide
comprises an amino acid sequence of SEQ ID NO: 20.


CA 02408073 2002-10-28
-61-
The invention also relates to the use of the RSG18 polypeptide having an amino
acid sequence
of a) either one of SEQ ID NOs: 12 or 20, b) amino acids 1-58 of SEQ ID NO:
12, c) amino acids 1-
166 of SEQ )D NO: 20, d) amino acids 86-202 of SEQ ID NO: 20, or e) amino
acids 86-166 of SEQ
m NO: 20 for the manufacture of a medicament intended for the prevention of a
disorder or condition
associated with platelet activation dysfunction.
The invention relates to a pharmaceutical composition for the prevention or
treatment of
subjects affected by a disorder or condition associated with platelet
activation dysfunction, comprising
a therapeutically effective quantity of the polypeptide having an amino acid
sequence of a) either one
of SEQ >D NOs: 12 or 20, b) amino acids 1-58 of SEQ )D NO: 12, c) amino acids
1-166 of SEQ )D
NO: 20, d) amino acids 86-202 of SEQ ID NO: 20, or e) amino acids 86-166 of
SEQ )D NO: 20.
According to yet another aspect, the subject of the invention is also a
preventive or curative
therapeutic method of treating a disorder or condition associated with
platelet activation dysfunction,
wherein such a method comprises a step in which there is administered to a
patient a therapeutically
effective quantity of the RGS 18 polypeptide in said patient, said polypeptide
being, where appropriate,
combined with one or more physiologically compatible vehicles and/or
excipients.
Preferably, a pharmaceutical composition comprising a polypeptide according to
the invention
will be administered to the patient. Thus, the invention also relates to
pharmaceutical compositions
intended for the prevention or treatment of a disorder or condition associated
with platelet activation
dysfunction, characterized in that they comprise a therapeutically effective
quantity of a polynucleotide
capable of giving rise to the production of an effective quantity of a normal
RGS 18 polypeptide, in
particular of a polypeptide having an amino acid sequence of a) either one of
SEQ ID NOs: 12 or 20,
b) amino acids 1-58 of SEQ >D NO: 12, c) amino acids 1-166 of SEQ >D NO: 20,
d) amino acids 86-
202 of SEQ )D NO: 20, or e) amino acids 86-166 of SEQ )D NO: 20.
The subj ect of the invention is, in addition, pharmaceutical compositions
intended for the
prevention or treatment of a disorder or condition associated with platelet
activation dysfunction,
characterized in that they comprise a therapeutically effective quantity of a
normal RGS 18
polypeptide, in particular of a polypeptide having an amino acid sequence of
a) either one of SEQ m
NOs: 12 or 20, b) amino acids 1-58 of SEQ )D NO: 12, c) amino acids 1-166 of
SEQ >D NO: 20, d)
amino acids 86-202 of SEQ )D NO: 20, or e) amino acids 86-166 of SEQ >D NO:
20.
Such pharmaceutical compositions will be preferably suitable for the
administration, for
example by the parenteral route, of a quantity of the RGS 18 polypeptide
ranging from 1 ~g/kg/day to
10 mg/leg/day, preferably at least 0.01 mg/kg/day and more preferably between
0.01 and 1 mg/kg/day.
The invention also provides pharmaceutical compositions comprising a nucleic
acid encoding
an RGS 18 polypeptide according to the invention and pharmaceutical
compositions comprising an
RGS18 polypeptide according to the invention intended for the treatment or
prevention of a disorder or
condition associated with platelet activation dysfunction, such as arterial
thrombosis, myocardial
infarction, coronary artery disease, stroke, cerebrovascular disease, unstable
angina, deep vein


CA 02408073 2002-10-28
-62-
thrombosis, systemic thromboembolism, as well as its use in invasive cardiac
procedures for anti-
coagulant purposes.
The present invention also relates to a new therapeutic approach for the
treatment of a disorder
or condition associated with platelet activation dysfunction, comprising
transfernng and expressing in
vivo nucleic acids encoding an RGS 18 protein according to the invention.
Specifically, the present
invention provides a new therapeutic approach for the treatment and/or
prevention of a disorder or
condition associated with platelet activation dysfunction, such as arterial
thrombosis, myocardial
infarction, coronary artery disease, stroke, cerebrovascular disease, unstable
angina, deep vein
thrombosis, systemic thromboembolism, as well as its use in invasive cardiac
procedures for anti-
coagulant purposes.
Thus, the present invention offers a new approach for the treatment and
prevention of a
disorder or condition associated linked to the abnormalities of platelet
activation. Specifically, the
present invention provides methods to increase, reduce, or inhibit platelet
activation within a patient or
subj ect.
Consequently, the invention also relates to a pharmaceutical composition
intended for the
prevention of or treatment of subjects affected by a disorder or condition
associated with platelet
activation dysfunction, comprising a nucleic acid encoding the RGS 18 protein,
in combination with
one or more physiologically compatible vehicle and/or excipient.
According to a specific embodiment of the invention, a composition is provided
for the in vivo
production of the RGS 18 protein. This composition comprises a nucleic acid
encoding the RGS 18
polypeptide placed under the control of appropriate regulatory sequences, in
solution in a
physiologically acceptable vehicle and/or excipient.
Therefore, the present invention also relates to a composition comprising a
nucleic acid
encoding a polypeptide comprising an amino acid sequence of either one of SEQ
ID NOs: 12 or 20,
wherein the nucleic acid is placed under the control of appropriate regulatory
elements.
The present invention also relates to a composition comprising a nucleic acid
encoding a
polypeptide comprising amino acids a) 1-58 of SEQ ID NO: 12, b) 1-166 of SEQ
ID NO: 20, c) 86-
202 of SEQ ID NO: 20, or d) 86-166 of SEQ m NO: 20, wherein the nucleic acid
is placed under the
control of appropriate regulatory elements.
Preferably, such a composition will comprise a nucleic acid comprising a
polynucleotide
sequence of SEQ ID NO: 18 or SEQ >D NO: 19, placed under the control of
appropriate regulatory
elements. More preferably, such a composition will comprise a nucleic acid
comprising a
polynucleotide sequence of nucleotides 163-870 of SEQ ID NO: 19, wherein the
nucleic acid is placed
under the control of appropriate regulatory elements.
According to another aspect, the subject of the invention is also a preventive
or curative
therapeutic method of treating a disorder or condition associated with
platelet activation dysfunction,
wherein such method comprises a step in which there is administered to a
patient a nucleic acid


CA 02408073 2002-10-28
-63-
encoding an RGS 18 polypeptide according to the invention in said patient,
said nucleic acid being,
where appropriate, combined with one or more physiologically compatible
vehicles or excipients.
The invention also relates to a pharmaceutical composition intended for the
prevention of or
treatment of subjects affected by a disorder or condition associated with
platelet activation
dysfunction, comprising a recombinant vector according to the invention, in
combination with one or
more physiologically compatible vehicles or excipients.
According to a specific embodiment, a method of introducing a nucleic acid
according to the
invention into a host cell, in particular a host cell obtained from a mammal,
in vivo, comprises a step
during which a preparation comprising a pharmaceutically compatible vector and
a "naked" nucleic
acid according to the invention, placed under the control of appropriate
regulatory sequences, is
introduced by local injection at the level of the chosen tissue, for example a
smooth muscle tissue, the
"naked" nucleic acid being absorbed by the cells of this tissue.
The invention also relates to the use of a nucleic acid according to the
invention, encoding the
RGS 18 protein, for the manufacture of a medicament intended for the
prevention or treatment of, or
more particularly for the treatment of subj ects affected by a disorder or
condition associated with
platelet activation dysfunction.
The invention also relates to the use of a recombinant vector according to the
invention,
comprising a nucleic acid encoding the RGS 18 protein, for the manufacture of
a medicament intended
for the prevention of, or more particularly for the treatment of subjects
affected by a disorder or.
condition associated with platelet activation dysfunction.
As indicated above, the present invention also relates to the use of a
defective recombinant
virus according to the invention for the preparation of a pharmaceutical
composition for the treatment
and/or prevention of a disorder or condition associated with platelet
activation dysfunction.
The invention relates to the use of such a defective recombinant virus for the
preparation of a
pharmaceutical composition intended for the treatment and/or for the
prevention of a disorder or
condition associated with platelet activation dysfunction. Thus, the present
invention also relates to a
pharmaceutical composition comprising one or more defective recombinant
viruses according to the
invention.
The present invention also relates to the use of cells genetically modified ex
vivo with a virus
according to the invention, or of producing cells such as viruses, implanted
in the body, allowing a
prolonged and effective expression in vivo of a biologically active RGS18
protein.
The present invention shows that it is possible to incorporate a nucleic acid
encoding an
RGS 18 polypeptide into a viral vector, and that these vectors make it
possible to effectively express a
biologically active, mature form. More particularly, the invention shows that
the in vivo expression of
RGS 18 may be obtained by direct administration of an adenovirus or by
implantation of a producing
cell or of a cell genetically modified by an adenovirus or by a retrovirus
incorporating such a nucleic
acid.


CA 02408073 2002-10-28
-64-
Preferably, the pharmaceutical compositions of the invention comprise a
pharmaceutically
acceptable vehicle or physiologically compatible excipient for an injectable
formulation, in particular
for an intravenous injection, such as for example into the patient's portal
vein. These may relate in
particular to isotonic sterile solutions or dry, in particular, freeze-dried,
compositions, which upon
addition depending on the case of sterilized water or physiological saline,
allow the preparation of
injectable solutions. Direct injection into'the patient's portal vein is
preferred because it makes it
possible to target the infection at the level of the liver and thus to
concentrate the therapeutic effect at
the level of this organ.
A "pharmaceutically acceptable vehicle or excipient " includes diluents and
fillers that are
pharmaceutically acceptable for method of administration, are sterile, and may
be aqueous or
oleaginous suspensions formulated using suitable dispersing or wetting agents
and suspending agents.
The particular pharmaceutically acceptable carrier and the ratio of active
compound to tamer are
determined by the solubility and chemical properties of the composition, the
particular mode of
administration, and standard pharmaceutical practice.
~ Any nucleic acid, polypeptide, vector, or host cell of the invention will
preferably be introduced in
vivo in a pharmaceutically acceptable vehicle or excipient. The phrase
"pharmaceutically acceptable" refers
to molecular entities and compositions that are physiologically tolerable and
do not typically produce an
allergic or similar untoward reaction, such as gastric upset, dizziness and
the like, when administered to a
human. Preferably, as used herein, the term "pharmaceutically acceptable"
means approved by a regulatory
agency of the Federal or a state government or listed in the U.S. Pharmacopeia
or other generally
recognized pharmacopeia for use in animals, and more particularly in humans.
The term "excipient" refers
to a diluent~ adjuvant, excipient, or vehicle with which the compound is
administered. Such pharmaceutics
carriers can be sterile liquids, such as water and oils, including those of
petroleum, animal, vegetable or
synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and
the like. Water or aqueous
solution saline solutions and aqueous dextrose and glycerol solutions are
preferably employed as
excipients, particularly for injectable solutions. Suitable pharmaceutical
excipients are described in
"Remington's Pharmaceutical Sciences" by E.W. Martin.
The pharmaceutical compositions according to the invention may be equally well
administered
by the oral, rectal, vaginal, parenteral, intravenous, subcutaneous or
intradermal route.
The invention also relates to the use of the RGS 18 polypeptide having an
amino acid sequence
of a) either one of SEQ >D NOs: 12 or 20, b) amino acids 1-58 of SEQ m NO: 12,
c) amino acids 1-
166 of SEQ )D NO: 20, d) amino acids 86-202 of SEQ >D NO: 20, or e) amino
acids 86-166 of SEQ
)D NO: 20 for the manufacture of a medicament intended for the prevention of,
or more particularly
for the treatment of a patient or subject affected by a disorder or condition
associated with platelet
activation dysfunction.
The invention finally relates to a pharmaceutical composition for the
prevention or treatment
of a patient or subject affected by a disorder or condition associated with
platelet activation


CA 02408073 2002-10-28
-65-
dysfunction, comprising a therapeutically effective quantity of a polypeptide
having an amino acid
sequence of a) either one of SEQ ID NOs: 12 or 20, b) amino acids 1-58 of SEQ
ID NO: 12, c) amino
acids 1-166 of SEQ ID NO: 20, d) amino acids 86-202 of SEQ m NO: 20, or e)
amino acids 86-166 of
SEQ ID NO: 20, combined with one or more physiologically compatible vehicles
and/or excipients.
According to another aspect, the subject of the invention is also a preventive
or curative
therapeutic method of treating a disorder or condition associated with
platelet activation dysfunction,
wherein such method comprises a step in which there is administered to a
patient or subj ect a nucleic
acid encoding an RGS 18 polypeptide in said patient, said nucleic acid being,
where appropriate,
combined with one or more physiologically compatible vehicles and/or
excipients.
According to yet another aspect, the subject of the invention is also a
preventive or curative
therapeutic method of treating a disorder or condition associated with
platelet activation dysfunction,
wherein such method comprises a step in which there is administered to a
patient or subject a
therapeutically effective quantity of an RGS18 polypeptide according to the
invention in said patient or
subject, said polypeptide being, where appropriate, combined with one or more
physiologically
compatible vehicles and/or excipients.
The invention relates to a pharmaceutical composition fox the prevention or
treatment of a
patient or subject affected by a dysfunction in platelet activation,
comprising a therapeutically effective
quantity of a polypeptide having an amino acid sequence of either on of SEQ m
NOs: 12 or 20, or a
polypeptide comprising amino acids a) 1-58 of SEQ ID NO: 12, b) 1-166 of SEQ
ID NO: 20, c) 86-
202 of SEQ m NO: 20, or d) 86-166 of SEQ ID NO: 20, combined with one or more
physiologically
compatible vehicles and/or excipients.
According to a specific embodiment, a method of introducing a nucleic acid
according to the
invention into a host cell, in particular a host cell obtained from a mammal,
ira vivo, comprises a step
during which a preparation comprising a pharmaceutically compatible vector and
a "naked" nucleic
acid according to the invention, placed under the control of appropriate
regulatory sequences, is
introduced by local injection at the level of the chosen tissue, for example a
smooth muscle tissue, the
"naked" nucleic acid being absorbed by the cells of this tissue.
According to yet another aspect, the subj ect of the invention is also a
preventive or curative
therapeutic method of treating a disorder or condition associated with
platelet activation dysfunction,
wherein such method comprises a step in which there is administered to a
patient a therapeutically
effective quantity of an RGS 18 polypeptide according to the invention in said
patient, said polypeptide
being, where appropriate, combined with one or more physiologically compatible
vehicles and/or
excipients.
Preferably, a pharmaceutical composition comprising an RGS 18 polypeptide
according to the
invention will be administered to the patient. Thus, the invention also
relates to pharmaceutical
compositions intended for the prevention or treatment of a disorder or
condition associated with
platelet activation dysfunction, characterized in that they comprise a
therapeutically effective quantity


CA 02408073 2002-10-28
-66-
of a nucleic acid encoding an RGS 18 polypeptide, in particular an RGS 18
polypeptide having an
amino acid sequence of either one of SEQ ID NOs: 12 or 20. In a specific
embodiment, the RGS 18
polypeptide comprises amino acids a) 1-58 of SEQ ID NO: 12, b) 1-166 of SEQ >D
NO: 20, c) 86-202
of SEQ ID NO: 20, or d) 86-166 of SEQ ID NO: 20.
The subject of the invention is, in addition, pharmaceutical compositions
intended for the
prevention or treatment of a disorder or condition associated with platelet
activation dysfunction,
characterized in that they comprise a therapeutically effective quantity of an
RGS18 polypeptide, in
particular of a polypeptide comprising an amino acid sequence of either one of
SEQ ID NOs: 12 or 20.
In a specific embodiment, the RGS18 polypeptide comprises amino acids a) 1-58
of SEQ >D NO: 12,
b) 1-166 of SEQ >D NO: 20, c) 86-202 of SEQ )D NO: 20, or d) 86-166 of SEQ ID
NO: 20.
In another embodiment, the nucleic acids, polypeptides, recombinant vectors,
and
compositions according to the invention can be delivered in a vesicle, in
particular a liposome (see
144-146).
In yet another embodiment, the nucleic acids, polypeptides, recombinant
vectors, recombinant
cells, and compositions according to the invention can be delivered in a
controlled release system. For
example, the polypeptide may be administered using intravenous infusion, an
implantable osmotic
pump, a transdermal patch, liposomes, or other modes of administration. In one
embodiment, a pump
may be used (see 144 and 147-149). In another embodiment, polymeric materials
can be used (150-
155). In yet another embodiment, a controlled release system can be placed in
proximity of the target
tissue or organ, i.e., the cardiovascular system, thus requiring only a
fraction of the systemic dose (see
156). Other controlled release systems that may be employed are discussed in
the review by Langer
(144).
In a further aspect, recombinant cells that have been transformed with a
nucleic acid according
to the invention and that express high levels of an RGS 18 polypeptide
according to the invention can
be transplanted in a subject in need of RGS18 polypeptide. Preferably
autologous cells transformed
with an RGS 18 encoding nucleic acid according to the invention are
transplanted to avoid rejection;
alternatively, technology is available to shield non-autologous cells that
produce soluble factors within
a polymer matrix that prevents immune recognition and rejection.
Thus, the RGS 18 polypeptide can be delivered by intravenous, intraarterial,
intraperitoneal,
intramuscular, or subcutaneous routes of administration. Alternatively, the
RGS 18 polypeptide,
properly formulated, can be administered by nasal or oral administration. A
constant supply of RGS 18
can be ensured by providing a therapeutically effective dose (i.e., a dose
effective to induce metabolic
changes in a subject) at the necessary intervals, e.g., daily, every 12 hours,
etc. These parameters will
depend on the severity of the disease condition being treated, other actions,
such as diet modification,
that are implemented, the weight, age, and sex of the subject, and other
criteria, which can be readily
determined according to standard .good medical practice by those of skill in
the art.


CA 02408073 2002-10-28
-67-
A subj ect in whom administration of the nucleic acids, polypeptides,
recombinant vectors,
recombinant host cells, and compositions according to the invention is
performed is preferably a
human, but can be any animal. Thus, as can be readily appreciated by one of
ordinary skill in the art,
the methods and pharmaceutical compositions of the present invention are
particularly suited to
administration to any animal, particularly a mammal, and including, but by no
means limited to,
domestic animals, such as feline or canine subjects, farm animals, such as but
not limited to bovine,
equine, caprine, ovine, and porcine subjects, wild animals (whether in the
wild or in a zoological
garden), research animals, such as mice, rats, rabbits, goats, sheep, pigs,
dogs, cats, etc., avian species,
such as chickens, turkeys, songbirds, etc., i.e., for veterinary medical use.
Preferably, a pharmaceutical composition comprising a nucleic acid, a
recombinant vector, a
polypeptide, or a recombinant host cell, as defined above, will be
administered to the patient or
subj ect.
METHODS OF SCREENING AN AGONIST OR ANTAGONIST COMPOUND FOR THE
RGS18 POLYPEPTIDE
The invention also relates to methods for the detection of activators or
inhibitors of RGS 18
protein and RGS 18 domain comprising polypeptides.
The invention also provides methods for screening small molecules and
compounds that act on
the RGS 18 protein to identify agonists and antagonists of RGS 18 polypeptide
that can increase,
reduce, or inhibit platelet activation from a therapeutic point of view. These
methods are useful to
identify small molecules and compounds for therapeutic use in the treatment of
a disorder or condition
associated with platelet activation dysfunction.
According to another aspect, the invention also relates to various methods of
screening
compounds or small molecules for therapeutic use that are useful in the
treatment of a disorder or
condition associated with platelet activation dysfunction, such as arterial
thrombosis, myocardial
infarction, coronary artery disease, stroke, cerebrovascular disease, unstable
angina, deep vein
thrombosis, systemic thrornboembolism, as well as its use in invasive cardiac
procedures for anti-
coagulant purposes.
Therefore, the invention also relates to the use of an RGS 18 polypeptide or a
cell expressing an
RGS18 polypeptide according to the invention, for screening active ingredients
for the prevention or
treatment of a disorder or condition associated with platelet activation
dysfunction. The catalytic sites
and oligopeptide or immunogenic fragments of an RGS 18 polypeptide can serve
for screening product
libraries by a whole range of existing techniques. The polypeptide fragment
used in this type of
screening may be free in solution, bound to a solid support, at the cell
surface or in the cell. The
formation of the binding complexes between the RGS 18 polypeptide fragments
and the tested agent
can then be measured.


CA 02408073 2002-10-28
-68-
Another product screening technique that may be used in high-flux screenings
giving access to
products having affinity for the protein of interest is described in
application W084/03564. In this
method, applied to an RGS 18 protein, various products are synthesized on a
solid surface. These
products react with the RGS 18 protein or fragments thereof and the complex is
washed. The products
binding the RGS18 protein are then detected by methods known to persons
skilled in the art. Non-
neutralizing antibodies can also be used to capture a peptide and immobilize
it on a support.
Another possibility is to perform a product screening method using an RGS 18
neutralizing
antibody competition, an RGS 18 protein and a product potentially binding the
RGS 18 protein. In this
manner, the antibodies may be used to detect the presence of a peptide having
a common antigenic unit
with an RGS 18 polypeptide or protein.
Accordingly, this invention relates to the use of any method of screening
products, i. e.,
compounds, small molecules, and the like, this being in all synthetic or
cellular types, that is to say of
mammals, insects, bacteria, or yeasts expressing constitutively or having
incorporated a human RGS 18
encoding nucleic acid.
The present invention also relates to the use of such a system for screening
molecules that
modulate the activity of the RGS 18 protein. Thus, the invention relates to
methods of screening and
identifying a modulator, agonist, or antagonist of an RGS 18 polypeptide in a
sample.
The present invention relates to methods of identifying a modulator, agonist,
or antagonist of
an RGS 18 polypeptide in a sample comprising
a) incubating a labeled GTP-loaded G protein polypeptide with an RGS 18
polypeptide with the
sample;
b) measuring the rate or extent of GTP hydrolysis; and
c) comparing the rate or extent of GTP hydrolysis determined in step b) with a
rate or extent of
GTP hydrolysis measured with a reconstituted labeled GTP-loaded G protein
polypeptide/RGS 18
poylpeptide mixture that has not been previously incubated in the presence of
the sample.
1n a specific embodiment, the labeled GTP-loaded G protein polypeptide of step
a) is loaded
with y-3zP-GTP and the rate or extent of GTP hydrolysis of step b) is measured
by determining the
amount of free 3zP; released.
In another specific embodiment, the RGS 18 polypeptide comprises an amino acid
sequence
selected from the group consisting of SEQ >D NO: 12, SEQ )D NO: 20, amino
acids 1-58 of SEQ ID
NO: 12, amino acids 1-166 of SEQ m NO: 20, amino acids 86-202 of SEQ m NO: 20,
and amino
acids 86-166 of SEQ 117 NO: 20.
In particular, the invention relates to a method of identifying a modulator,
agonist, or
antagonist of an RGS 18 polypeptide in a sample, wherein the method comprises
a) loading a purified G protein polypeptide with y 3zP-GTP;


CA 02408073 2002-10-28
-69-
b) incubating the y 32P-GTP-loaded G protein polypeptide of step a) with a
purified RGS 18
poylpeptide and a candidate modulator, agonist, or antagonist compound for the
RSGl8 polypeptide;
c) measuring the rate or extent of GTP hydrolysis by determining the amount of
free 32P;
released; and
d) comparing the rate or extent of GTP hydrolysis determined in step c) with a
rate or extent of
GTP hydrolysis measured with a reconstituted y 3zP-GTP-loaded G protein
polypeptide/purified
RGS 18 poylpeptide mixture that has not been previously incubated in the
presence of the candidate
modulator, agonist, or antagonist compound for the RGS 18 polypeptide.
Reconstitution of purified RGS 18 polypeptide with purified G protein
polypeptides within the
methods of the invention may be performed according to any technique, in
particular, according to the
technique described by Berman et al. (157).
In a first specific embodiment, the RGS 18 polypeptide comprises either one of
SEQ ID NOs: 12 or 20.
In a second specific embodiment, the RSG18 polypeptide comprises amino acids
a) 1-58 of
SEQ ID NO: 12, b) 1-166 of SEQ >D NO: 20, c) 86-202 of SEQ ID NO: 20, or d) 86-
166 of SEQ ID
NO: 20.
An RGS 18 modulator compound identified by the methods of the invention may
reduce or
increase the rate or extent of GTP hydrolysis by an RGS 18 polypeptide
according to the invention.
The present invention relates to methods of identifying a modulator, agonist,
or antagonist of
an RGS 18 polypeptide in a sample comprising
a) incubating a cell membrane fraction expressing an RGS 18 polypeptide with a
labeled GTP
and the sample;
b) measuring the rate or extent of GTP hydrolysis; and
c) comparing the rate or extent of GTP hydrolysis determined in step b) with a
rate or extent of
GTP hydrolysis measured with a cell membrane fraction expressing an RGS 18
polypeptide that has
not been previously incubated in the presence of the sample.
In a specific embodiment, the cell membrane fraction is obtained from a cell
that, either
naturally or after transfecting the cell with an RGS 18 encoding nucleic acid,
expresses an RGS 18
polypeptide, and isolating the cell's membrane.
In another specific embodiment, the labeled GTP of step a) is labeled with y-
32P and the rate or
extent of GTP hydrolysis of step b) is measured by determining the amount of
free 32P; released.
In another specific embodiment, the RGS18 polypeptide comprises an amino acid
sequence
selected from the group consisting of SEQ >D NO: 12, SEQ ID NO: 20, amino
acids 1-58 of SEQ )D
NO: 12, amino acids 1-166 of SEQ )D NO: 20, amino acids 86-202 of SEQ )D NO:
20, and amino
acids 86-166 of SEQ 1D NO: 20.


CA 02408073 2002-10-28
-70-
The present invention also relates to a method of identifying a modulator,
agonist, or
antagonist of an RGS 18 polypeptide in a sample, wherein the method comprises
a) obtaining a cell, for example a cell line, that, either naturally or after
transfecting the cell
with an RGS 18 encoding nucleic acid, expresses an RGS 18 polypeptide, and
isolating the cell's
membrane;
b) incubating the cell membrane of step a) with y-3zP-GTP and a candidate
modulator, agonist,
or antagonist compound for the RSG18 polypeptide;
c) measuring the rate or extent of GTP hydrolysis by determining the amount of
free 3zP;
released; and
d) comparing the rate or extent of GTP hydrolysis determined in step c) with a
rate or extent of
GTP hydrolysis measured with a cell membrane that has not been previously
incubated in the presence
of the candidate modulator, agonist, or antagonist compound for the RGS 18
polypeptide.
The cell membrane fractions within the methods of the invention may be
prepared according to
any technique, in particular, according to the technique described by Denecke
et al. (158).
In a first specific embodiment, the RGS 18 polypeptide comprises either one of
SEQ )D NOs: 12 or 20.
In a second specific embodiment, the RSG18 polypeptide comprises amino acids
a) 1-58 of
SEQ )D N0;12, b) 1-166 of SEQ )D NO: 20, c) 86-202 of SEQ )D NO: 20, or d) 86-
166 of SEQ )D
NO: 20.
An RGS 18 modulator compound identified by the methods of the invention may
reduce
(inhibitor) or increase (activator) the rate or extent of GTP hydrolysis by an
RGS 18 polypeptide
according to the invention.
The present invention also relates to a method of identifying a modulator,
agonist, or
antagonist of an RGS18 polypeptide, wherein the method comprises determining
the effects of the
modulator, agonist, or antagonist on downstream effects or effector molecules
of the RGS 18
polypeptide.
Therefore, the present invention relates to methods of identifying a
modulator, agonist, or
antagonist of an RGS 18 polypeptide in a sample comprising
a) incubating a cell expressing an RGS 18 polypeptide with a labeled adenine
and the sample;
b) measuring the amount of labeled cyclic AMP (CAMP) produced; and
c) comparing the amount of labeled CAMP measured in step b) with an amount of
labeled
cAMP measured with a cell expressing an RGS 18 polypeptide that has not been
previously incubated
in the presence of the sample.
In a specific embodiment, the cell expressing the RGS 18 polypeptide is
transfected with an
RGS 18 encoding nucleic acid.
In another specific embodiment, the labeled adenine of step a) is 3H-adenine.


CA 02408073 2002-10-28
-71-
In another specific embodiment, the RGS 18 polypeptide comprises an amino acid
sequence
selected from the group consisting of SEQ ID NO: 12, SEQ ID NO: 20, amino
acids 1-58 of SEQ m
NO: 12, amino acids 1-166 of SEQ ID NO: 20, amino acids 86-202 of SEQ ID NO:
20, and amino
acids 86-166 of SEQ ID NO: 20.
In particular, the present invention relates to a method of identifying a
modulator, agonist, or
antagonist of an RGS 18 polypeptide, wherein the method comprises
a) obtaining a cell, for example a cell line, that, either naturally or after
transfecting the cell
with an RGS 18 encoding nucleic acid, expresses an RGS 18 polypeptide,
b) incubating the cell of step a) with 3H-adenine and a candidate modulator
compound for the
RSG18 polypeptide;
c) measuring the amount of radioactively labeled cyclic AMP (CAMP) produced;
and
d) comparing the amount of radiactively labeled cAMP measured in step c) with
an amount of
radiactively labeled CAMP measured with a cell that has not been previously
incubated in the presence
of the candidate modulator, agonist, or antagonist compound for the RGS 18
polypeptide.
The amount of radiactively labeled CAMP may be determined according to any
technique, in
particular, according to the technique described by Huang et al. (159).
In a first specific embodiment, the RGS 18 polypeptide comprises either one of
SEQ m NOs: I2 or 20.
In a second specific embodiment, the RSG18 polypeptide comprises amino acids
a) 1-58 of
SEQ ID NO: 12, b) 1-166 of SEQ ID NO: 20, c) 86-202 of SEQ m NO: 20, or d) 86-
166 of SEQ m
NO: 20.
An RGS 18 modulator compound identified by the methods of the invention may
reduce or
increase the amount of cAMP produced by an RGS18 polypeptide according to the
invention. .
The present invention also relates to methods of identifying a modulator,
agonist, or antagonist
of an RGS l8 polypeptide in a sample comprising
a) incubating a cell expressing an RGS18 polypeptide with a labeled inositol
and the sample;
b) measuring the amount of labeled inositol triphosphate produced; and
c) comparing the amount of labeled inositol triphosphate measured in step b)
with an amount
of labeled inositol triphosphate measured with a cell expressing an RGS 18
polypeptide that has not
been previously incubated in the presence of the sample.
In a specific embodiment, the cell expressing the RGS18 polypeptide is
transfected with an
RGS 18 encoding nucleic acid.
In another specific embodiment, the labeled inositol of step a) is 3H-
inositol.
In another specific embodiment, the RGS18 polypeptide comprises an amino acid
sequence
selected from the group consisting of SEQ m NO: 12, SEQ m NO: 20, amino acids
1-58 of SEQ ID
NO: 12, amino acids 1-166 of SEQ ID NO: 20, amino acids 86-202 of SEQ ID NO:
20, and amino
acids 86-166 of SEQ m NO: 20.


CA 02408073 2002-10-28
-72-
In particular, the present invention also relates to a method of identifying a
modulator, agonist,
or antagonist of an RGS18 polypeptide in a sample, wherein the method
comprises
a) obtaining a cell, for example a cell line, that, either naturally or after
transfecting the cell
with an RGS18 encoding nucleic acid, expresses an RGS18 polypeptide,
b) incubating the cell of step a) with 3H-inositol and a candidate modulator
compound for the
RSG18 polypeptide;
c) measuring the amount of radioactively labeled inositol triphosphate
produced; and
d) comparing the amount of radiactively labeled inositol triphosphate measured
in step c) with
an amount of radiactively labeled inositol triphosphate measured with a cell
that has not been
previously incubated in the presence of the candidate modulator, agonist, or
antagonist compound for
the RGS 18 polypeptide.
The amount of radiactively labeled inositol triphosphate may be determined
according to any
technique, in particular, according to the technique described by Huang et al.
(159).
In a ftrst specific embodiment, the RGS 18 polypeptide comprises either one of
SEQ m NOs: 12 or 20.
In a second specific embodiment, the RSG18 polypeptide comprises amino acids
a) 1-58 of
SEQ )D NO: 12, b) 1-166 of SEQ >D NO: 20, c) 86-202 of SEQ 1D NO: 20, or d) 86-
166 of SEQ )D
NO: 20.
An RGS 18 modulator compound identified by the methods of the invention may
reduce or
increase the amount of inositol triphosphate produced by an RGS 18 polypeptide
according to the
invention.
According to a first aspect of the above screening methods, the cells used are
cells naturally
expressing an RGS 18 polypeptide. They may be human platelets in primary
culture, purified from a
population of human blood mononuclear cells. They may also be human
megakaryocytic cell lines,
such as HEL cells, Meg-O 1 cells, and Dami cells.
According to a second aspect, the cells used in the screening methods
described above may be
cells not naturally expressing, or alternatively expressing at a low level, an
RGS 18 polypeptide, said
cells being transfected with a recombinant vector according to the invention
capable of directing the
expression of a nucleic acid encoding an RGS 18 polypeptide.
According to a third aspect of the above screening methods, the RGS 18
polypeptide may be a
recombinant RGS 18 polypeptide.
The present invention may be better understood by reference to the following
non-limiting
Examples, which are provided as exemplary of the invention.
EXAMPLES


CA 02408073 2002-10-28
-73-
In an effort to better understand modulation of GPCR-mediated signaling in
platelets, Applicants
sought to identify Regulators of G protein signaling proteins (RGSs) that are
present in human platelets
and several megakaryocytic cell lines. Using degenerate oligonucleotides based
on conserved regions
of the highly homologous RGS domain, RT-PCR was performed using human platelet
RNA, as well as
RNA from several megakaryocytic cell lines. In addition to confirming the
presence of several known
RGS transcripts, a novel RGS domain containing transcript was found in
platelet RNA. Northern blot
analysis of multiple human tissues indicates that this novel transcript is
most abundantly expressed in
platelets compared to other tissues examined. This RGS transcript is
abundantly expressed in platelets,
with significantly lower expression in other tissues, primarily those of the
hematopoetic system. This
transcript is modestly expressed in three megakaryocyte cell lines and tissues
of hematopoetic origin
such as leukocytes, bone marrow and spleen with low level expression detected
in other tissues as
well. Full-length cloning of this novel RGS, which has been termed RGS18,
demonstrates that this
transcript encodes a 235 amino acid protein. RGS 18 is most closely related to
RGSS (46% identity)
and has ~30-40% identity to other RGS proteins. Peptide-directed antisera
against RGS 18 detect the
expression of ~30 kDa protein in platelet, leukocyte and megakaryocyte cell
line lysates. In vitro
RGS 18 binds to endogenous G«iz~ G«ss and G«q but not G«~, G«S or G«ia from
GDP + AlF4 -treated
platelet lysates. Since platelet aggregation requires activation of a receptor
coupled to G«q and/or one
or more forms of G«;, RGS 18 may be responsible in part for regulation of
pathways important to
platelet activation.
Reagents were obtained from Sigma (St. Louis, MO) unless otherwise noted.
Reagents for
GST fusion protein expression and purification including pGEX-SX-1 and
glutathione-Sepharose 4B
were obtained from Amersham/Pharmacia (Piscataway, NJJ. Oligonucleotides and
peptides were
produced by the Core Biotechnologies Department at Rhone-Poulenc Rorer. Double-
stranded cDNA
from human leukocytes and human bone marrow was obtained from Clontech (Palo
Alto, CA).
Marathon cDNA from human peripheral blood leukocytes and bone marrow, and the
Advantage PCR
kit for 5' Race were from Clontech (Palo Alto, CA). All reagents for cell
culture were obtained from
GibcoBRL (Rockville, MD). Reagents for Western blotting including goat anti-
rabbit IgG-coupled to
HRP were purchased from BioRad (Hercules, CA). SuperSignal Pico Reagent was
purchased from
Pierce (Rockford, IL). Complete EDTA-free protease inhibitor cocktail was from
Roche Biochemicals
(Indianapolis, III. Cell lines were obtained from the ATCC (Manassas, VA).
EXAMPLE 1: RT PCR Arnplificatiora and Cloning of Nucleic Acids Encoding ara
RGS Domain.
Preparation of Platelets, Leukocytes and Cell Lines: HEL cells and Meg-O1
cells were maintained in
RPMI supplemented with 10% fetal bovine serum, 0.3 mg/ml L-glutamine and 100
U/ml penicillin


CA 02408073 2002-10-28
-74-
61100 mg/ml streptomycin sulfate. Dami cells were grown in Iscove's Modified
Dulbecco's Medium
supplemented with 10% heat-inactivated horse serum, 0.3 mg/ml L-glutamine and
100 U/ml penicillin
6/100 mg/ml streptomycin sulfate. Human platelets were obtained from
Interstate Blood Bank
(Memphis, TIC in concentrate form and were used on the day after collection
(Day 2). When
necessary for functional studies fresh platelets were drawn from consenting
donors using 0.38% citrate
as the anti-coagulant. For both, platelets were spun at 120 X g for 15 minutes
to pellet the red cells and
retrieve the platelet rich plasma (PRP). Prostaglandin El (0.5 mg/ml) was
added to the PRP to prevent
activation, and the platelets were pelleted at 800 X g for 15 minutes. The
platelet pellet was washed
once in Tyrodes buffer (137 mM NaCI, 2.7 mM KCI, 1 mM MgCl2 6Ha0, 5.5 mM
glucose, 11.9 mM
NaHC03, 0.36 mM NaHzP04H20, 10 mM HEPES pH, 7.35) plus 0.35% human serum
albumin (HSA;
this was reduced to 0.1% HSA for protein lysates to reduce albumin protein
carry over) plus 0.25
mglml prostaglandin El. Platelets were pelleted at 800 X g and resuspended in
the appropriate buffer
(Trizol for RNA, Lysis buffer for protein lysates). White blood cells were
obtained fresh from
consenting donors and isolated during platelet preparation. Briefly, after
removal of the PRP for
platelet isolation, the buffy coat, which is the white layer of cells that
forms an interface between the
platelet rich plasma and the pelleted red blood cells, was removed and brought
up to 15 mls with
platelet-poor plasma and diluted 1:1 with PBS. Fifteen mls of this was
carefully layered on top of 15
ml of Hipaque. This was spun at 400 X g for 30 minutes at room temperature. A
band containing the
human leukocytes was isolated, diluted 1:l in PBS and spun at 400 X g for 10
minutes to isolate the
cells. The cell pellet was then resuspended in the appropriate lysis buffer
(Trizol or protein lysis
buffer).
RT PCR cloning Strategy: Four degenerate oligonucleotides were synthesized
which have been used
previously for isolating RGS transcripts and are designed in regions of high
homology flanking the
RGS domain of several members of the RGS superfamily (8). These four
oligonucleotides given in
IUB code are RGS1: GRIGAR.A.AYHTIGARTTYTGG (SEQ ID No: 1), RGS2:
GRIGARAAYHTIMGITTYTGG (SEQ ID No: 2), RGS3: GRTAIGARTYITTYTYCAT (SEQ ID No:
3), and RGS4: GRTARCTRTYITTYTYCAT (SEQ ID No: 4). Total RNA was prepared from
human
platelets, HEL cells, DAMI cells and MEG-O 1 cells using Trizol Reagent
(GibcoBRL, Rockville,
MD) according to the manufacturer's instructions. Human platelets obtained
from Day 2 platelet
concentrate (Interstate Blood Bank, Memphis, TN) were prepared as above,
pelleted and lysed in 5 ml
Trizol reagent. Platelet counts varied in the cell pellet but typical values
ranged between 0.9-5 X 10'0
platelets and the yield of total RNA was between 25-100 mg. Single strand cDNA
was prepared by
reverse transcription of total RNA using Superscript II (Gibco/BRL, Rockville,
MD), 2-5 mg of total
RNA and 160 ng of random hexamer (Roche Biochemicals, Indianapolis, IN)
following the
manufacturer's instructions. PCR was performed using 1/8 of the cDNA reaction,
typically 5 ~,l in a 50


CA 02408073 2002-10-28
-75-
~,1 reaction volume containing 300 ng of each of the oligonucleotides RGS l,
RGS2, RGS3 and RGS4,
400 mM dNTPs, 1 X PCR buffer with 1.5 mM MgClz and 1 p.1 of Taq polymerase
(GibcoBRL,
Rockville, MD). In some studies, 1 p1 of human bone marrow human peripheral
blood leukocyte
cDNA was used for amplification. Amplification was performed in a PCRSprint
Thermocycler
(Hybaid, Franklin, MA) with the following cycling conditions, 94 °C for
2 minutes for 1 cycle, 94 °C
for 30 seconds, 42 °C for 1 minute, 72 °C for 2 minutes for 35
cycles followed by an extension at 72
°C for 7 minutes. In order to increase the yield of colonies, a second
round of amplification was
performed using 1-5 ~l of the initial PCR reaction product. Reaction products
(~-230 bp) were
separated by agarose gel electrophoresis and purified using the Qiaquick gel
extraction kit (Qiagen,
Chatsworth, CA). The resulting purified PCR reactions were subcloned'into
pCR2. l using the TA
cloning kit (Invitrogen, Carlsbad, CA) and transformed to INVaF- cells. Single
colonies were
replicated to fresh plates and numbered for reference and grown for DNA
purification. Automated
plasmid purification and sequencing was performed on all the colonies (50
colonies when two rounds
of amplification were performed, 25 for one) using universal primers
complementary to the cloning
vector sequence (M13 Forward Primer, SEQ >D NO: 37 and M13 Reverse Primer, SEQ
)D NO: 38).
Sequence analysis was performed using an automated sequencing system (ABI).
The identity of each
PCR product was determined by comparing sequence data to that of known RGSs
using Seqman and
Megalign programs of the Lasergene software and BESTFIT, GAP and PILEUP of the
GCG program.
Results of RT PCR of RGSs frorn hmnan platelets and naegalzaryocytic cell
lines.
A Reverse Transcription-Polymerase Chain Reaction (RT-PCR) strategy was
employed to
identify RGS family members expressed in human platelets and several
megokaryocytic cell lines.
Degenerate primers were designed and synthesized based on regions that are
highly homologous in
several of the previously identified RGS proteins (8). These primers were used
to amplify total RNA
from human platelets (Plt), and three megakaryocytic cell lines, DAMI, HEL,
and MEG-O1 cells.
Amplification of RNA from all four tissues resulted in a band of 240 base
pairs, which was purified
and subcloned into pCR2.l and transformed to competent Eschericlria coli.
Fifty colonies from each
PCR reaction were picked, grown and plasmid was isolated from each and
sequenced. Analysis of the
resulting sequence data by comparison to known RGS proteins was performed and
the results are
summarized in Table 1. The most predominate amplification product in all three
megakaryocytic cell lines is RGS16, an RGS first identified in mouse retina
(160) but also present in
lymphocytes and many other tissues (161, 162). In contrast to the cell lines
however, the most
predominate PCR product (SEQ ID NO: 11) from platelet RNA encodes a novel
partial RGS domain
(SEQ ID NO: 12 encoded by nucleotides 1-241 of SEQ ID NO: 11), which is not
present in the public
domain databases. A single colony out of the 50 examined in DAMI cells also
encoded this novel
RGS domain. This novel partial RGS domain comprises amino acids 1 to 81 of SEQ
ID NO: 12 and is


CA 02408073 2002-10-28
-76-
shown in Figure 1, slightly smaller due to position of degenerate
oligonucleotide probes. This novel
RGS domain displays 30-46% homology to the known RGSs, with the highest degree
of homology to
RGSS. Additionally, platelets contain transcript for RGS10, and MEG-O1 cells
contain RGS4. Not
surprisingly all tissues tested contain the ubiquitously expressed RGS2.
Table 1. Identification of RGS isoforms by degenerate RT-PCR of total RNA from
human
platelets and three megakaryocytic cell lines.
Plt DAMI HEL MEG


RNA RNA RNA RNA


RGS2 3 1 1 3


RGS 10 1


RGS 16 4 33 37 20


RGS4 3


novel RGS 17 1
18


vector / 12/2 4/4 7/2 14/0
?


ND 11 7 3 10


Degenerate oligonucleotide primers designed against conserved regions of the
RGS domain were used
to amplify RNA from human platelets, DAMI, HEL and MEG-O 1 cells as described
above. The
amplification products were blunt-legated to pCR2.l and transformed into
competent ESCherichia coli.
Fifty colonies were picked and plasmid DNA was isolated and subjected to
sequence analysis. The
resultant sequence data from each colony was compared to the coding regions of
known RGSs and
tabulated. In some cases the plasmid relegated to itself resulting in no
insert, these are noted as
"vector". Plasmids which contained inserts but had no apparent homology to a
known gene are labeled
"?", and probably are artifacts of the PCR reaction. Sequencing reactions that
resulted in poor quality
data (numerous unknown nucleotides) are noted as "ND" for not determined.
EXAMPLE 2: Full-Lehgth Cloraing of RGSl8 cDNA.
The novel PCR product was compared to the LIFESEQ proprietary Incyte database
of ESTs..
Only one match was found. This EST was from a human thyroid library and the 5'
most end of the
EST was virtually identical to the last 72 base pairs of our clone. This EST
clone was purchased from
Incyte, grown, and analyzed to determine whether these two transcripts were
indeed related. Complete
sequence analysis using M13 Forward and M13 Reverse Primers (SEQ ID NOs: 37
and 38,
respectively) confirmed the presence of the 72 by overlap and provided us with
sequence information
for the carboxy-terminal portion of the protein and a 1274 by 3' untranslated
region.
Full-length sequence information was obtained using 5' RACE. Marathon cDNA
from human
bone marrow and peripheral blood leukocyte (Clontech, Palo Alto, CA) was used
for the 5' RACE
strategy. 5' Race was carried out with the antisense primer [5'-
cgctagggccttagactccttgcttcttcc-3', SEQ
ID NO: 5] from the 3' untranslated region, using Marathon Ready cDNAs coupled
with the Advantage
cDNA polymerase (Clontech, Palo Alto, CA) following the manufacturer's
instructions for 5' RACE.
The reaction products from the RACE procedure were subcloned into pCR2.l and
transformed to
competent INVaF- Escherichia coli and 20 colonies were analyzed by restriction
analysis and


CA 02408073 2002-10-28
-77-
sequencing using nRGSl l-nRGSl9 sequencing primers (SEQ ID NOs: 30-36,
respectively) and M13
Forward and M13 Reverse Primers (SEQ ID NOs: 37 and 38, respectively). Table 2
describes the
nRGS 11-nRGS 19 sequencing primers used to determine the nucleic acid sequence
of the 5' RACE
clones and the location of these primers within SEQ ZD NO: 19, a cDNA encoding
the full length
RGS 18 polypeptide.
Table 2: 5' RACE RGS18-Specific Seguencing Primers
PRI1VVIER SEQUENCE (5'-~3') SEQ ID LOCATION
NO: IN
SEQ ID NO:
19


nRGS 11 CTACTATGTATATGTATGGAATAG 30 77-100


nRGS 12 GAATTTTGGATAGCCTGTGAAG 31 502-523


nRGSl3 CGATCACGCTCATTTACCTGCAAT 32 805-828


nRGSl4 CTGAAATATGTCATGTGAAATTAT 33 964-987


nRGSl7 CATAAACATGCGATATGTTAG 34 918-938


nRGSl8 TGGGGCATCAGTCTGTATAAA 35 586-606


nRGS 19 CCTGAACCATGTATTAACTTG 36 228-248


Results of the Full-lera~th Clohin~ of the Novel Platelet RGS.
In order to identify the full-length sequence of this partial clone,
electronic searches of EST
databases were performed. No identical hits were found in the public domain
EST databases. The
novel PCR product was also compared to the LIFESEQ proprietary Incyte database
of ESTs. Only one
hit was found, an EST (SEQ ID NO: 6) from a human thyroid library. Nucleotides
1-59 of SEQ ID
NO: 6 display complete identity to nucleotides 170-228 of SEQ )D NO: 11, and
nucleotides 60-72 of
SEQ ID NO: 6 display partial identity to nucleotides 229-241 of SEQ m NO: 11.
Since the library was
primed with Oligo(dT), it is likely that this EST comprises the carboxy-
terminal region and 3'
untranslated domain of the novel RGS 18 transcript. This clone was purchased
from Incyte and
analyzed by restriction analysis and sequencing. The Incyte clone contains a
cDNA insert of 1486 by
(SEQ >D NO: 6) which has identity to the novel PCR product (nucleotides 170-
228 of SEQ ID NO:
11) at the 5' end (nucleotides 1-59 of SEQ ZD NO: 6) and a stretch of poly(A)+
residues at the 3' end
(nucleotides 1471-1486 of SEQ ID NO: 6). When translated, this EST comprises a
partial open reading
frame (nucleotides 3-209 of SEQ )D NO: 6) encoding a 69 amino acid polypeptide
(SEQ )D NO: 13).
The partial open reading frame of this EST is contiguous with that of the
novel PCR product (SEQ >D
NO: 11), wherein amino acids 1-23 of SEQ 1D NO: 13 are identical to amino
acids 59-81 of SEQ )D
NO: 12, except for amino acid 20 of SEQ ID NO: 13 (amino acid 78 of SEQ >D NO:
12). Based upon
homology to other known RGS domain-containing proteins that extends beyond the
72 by overlap of


CA 02408073 2002-10-28
-78-
the EST and PCR product nucleic acids lends support that the EST represents
the 3' end of the novel
RGS18 PCR product. To further confirm that these two cDNAs are in fact from
the same transcript,
RT-PCR analysis of platelet RNA was performed with a sense primer (5'-
ATAGCCTGTGAAGATTTCAAG-3 ; SEQ ID NO: 14) designed against near 5' sequence
information from our platelet PCR product and three antisense primers (5'-
TGGCAACATCTGATTGTACAT-3', SEQ ID NO: 15; 5'-AAGTTTGTCATAAAAATGAGC-3',
SEQ ID NO: 16; and 5'-TTAACATAAACATGCGATATG-3', SEQ ID NO: 17) chosen at three
different sites within the Incyte EST beyond the region of overlap with the
initial PCR clone. PCR
products of the expected size were obtained from each of these reactions
confirming that the novel
PCR clone and the Incyte EST cDNA are in fact part of a contiguous transcript
in platelet RNA (data
not shown).
Using sequence information from the 3' untranslated region of the Incyte clone
(SEQ ID NO:
6), 5' RACE was performed to isolate the entire coding region of the novel RGS
18. Since platelets do
not contain abundant levels of high quality RNA, cDNAs from human bone marrow
and peripheral
blood leukocytes were used specifically designed for 5' RACE. Preliminary
Northern blot data
demonstrated that the novel RGS 18 transcript is present at low levels in both
these tissues. A primer
(SEQ ID NO: 5) was designed within the far 3' untranslated region, the
location of this primer is
depicted by the underlined sequence information in Figure 1, panel B. 5' RACE
was performed using
the Advantage PCR kit according to the manufacturer's instructions with this
3' untranslated region
primer (SEQ ID NO: 5) and both bone marrow and peripheral blood leukocyte
cDNA. The 5' RACE
PCR reaction products were subcloned into pCR2. l and analyzed by restriction
mapping. The longest
inserts (~2 kB) were chosen for sequence analysis. Sequence analysis as
described above determined
that these 5' RACE PCR products comprised 1840 nucleotides (SEQ ID NO: 18).
The 5' RACE PCR
products comprised the entire predicted open reading frame (nucleotides 163-
870 of SEQ ID NO: 18)
that encodes the novel full length RGS 18 polypeptide (SEQ ID NO: 20) and a
short stretch of the 5'
untranslated region (nucleotides 1-162 of SEQ ID NO: 18). Sequence data were
compiled from the 5'
RACE clone (SEQ ID NO: 18), the Incyte EST cDNA (SEQ ID NO: 6) and the initial
PCR clone
(SEQ ID NO: 11) and assembled, and a schematic of the relative positions of
each of these overlapping
clones is shown in Figure 1, panel A. Figure l, Panel B shows the nucleotide
sequence of this
compiled nucleic acid (SEQ ID NO: 19) and the predicted amino acid sequence of
the novel full length
RGS 18 polypeptide it encodes (SEQ ID NO: 20). Nucleotides 163-870 of SEQ ID
NO: 19 represent
the full length open reading frame encoding the full length RGS 18 polypeptide
(SEQ ID NO: 20).
The RGS18 cDNA (SEQ ID NO: 19) is 2144 base pairs in length and encodes a
protein of 235
amino acids (SEQ ID NO: 20). The theoretical pI of this protein is 7.73 with a
molecular weight of 27,
582.22 daltons. Scanning for protein sequence motifs, using the Prosite
database, confirms that this
protein contains a RGS domain (residues 86 through 202 of SEQ ID No: 20), as
well as putative
consensus sites for phosphorylation by several protein kinases. Residues 213
to 216 of SEQ ID No: 20


CA 02408073 2002-10-28
-79-
form a consensus site for phosphorylation by cAMP and cGMP-dependent protein
kinase (shown
underlined in Fig l, Panel B). Four potential sites for protein kinase C
phosphorylation and five for
casein kinase II (CK II) phosphorylation are present (SEQ ID NO: 20 residues
28-30, 33-35, 63-65 and
92-94 for PKC and SEQ ID NO: 20 residues 28-31, 33-36, 76-79, 92-95 and 220-
223 for CK I17.
Amino acids 221-224 of SEQ ID NO: 20 in the carboxy-terminus of the protein
encode a putative
CAAX motif that may act as a site of modification by fatty acylation and serve
to regulate the activity
of RGS18.
EXAMPLE 3: Tissue Distribution of RGS18 Nucleic Acids and Polypeptides.
Total RNA Isolation arad Northern Blot Analysis: Preparation of total RNA from
human platelets,
white blood cells, HEL cells, Dami cells and Meg-O1 cells was carried out as
described above. A
multiple human tissue Northern Blot was purchased from Clontech (Palo Alto,
CA). For Northern
blots of human platelets, human leukocytes and.the megakaryocytic cells lines,
10 mg of total RNA
was run on a 1.5% agarose/5.8% formaldehyde gel in 1 X MOPS buffer (20 mM 3-N-
Morpholinopropanesulfonic acid, pH 7.0, 5 mM sodium acetate, 1 mM EDTA). RNA
was transferred
in 20 X SSC (0.3 mM NaCl, 0.3 mM sodium citrate) to nylon membrane using the
Turboblotter
System (Schleicher and Schull, Keene, NH) and UV crosslinked to the membrane
using a Stratalinker .
(Stratagene, La Jolla, CA). A multiple tissue Northern blot with 1 mg of
poly(A+) RNA from each of
12 different tissues was purchased from Clontech (Palo Alto, CA). Both of
these blots were
prehybridized in 10 ml ExpressHyb solution (Clontech, Palo Alto, CA) at 68
°C for 1 hour. For each
blot, approximately 25 ng of the 1486 base pair Incyte clone EST (SEQ m NO: 6)
encoding the 3' end
of the coding region and the 3 ' untranslated region was radiolabeled with 32P-
oc[dCTP] and the High
Prime Kit (Roche Biochemicals, Indianapolis, IN) and purified on a microspin S-
200 column
(Amersham/Pharmacia, Piscataway, NJ). Two labeled probe batches were mixed and
added to 20 ml
of ExpressHyb. Each blot was hybridized with 10 ml of this probe mix for 2
hours at 68 °C. This
process ensured that the blots were each hybridized with probes of the same
specific activities and
would facilitate comparison of the results. The blots were washed for 40
minutes in 2 X SSC/0.05%
SDS at room temperature followed by a high stringency wash in O.1X SSC/0.1%
SDS at 50 °C for 40
minutes and exposed to Kodak BioMax MR film at -70 °C. Following
removal of the probe with 0.5%
SDS at 100 °C, normalization of the blots was performed using a labeled
(3-actin probe (Clontech, Palo
Alto, CA; catalog #50130) and performed as above.
Production of Polycloraal Antisera, Western Blot Analysis, and Cell Lysate
Preparatiofa: Two peptides
were selected to make polyclonal antisera, KLIHGSGEETSKEAKIR (SEQ ID NO: 7)
from the amino-
terminal portion of RGS 18 and QRPTNLRRRSRSFTCNEFQ (SEQ ID NO: 8), from the
carboxy-


CA 02408073 2002-10-28
-80-
terminal region. These peptides were synthesized in-house by RPR Core
Biotechnologies Department
and conjugated to Keyhole Limpet hemacyanin (KLH) for injection into rabbits.
Custom polyclonal
antisera were produced from the conjugated peptides by Rockland
Immunochemicals (Gilbertsville,
PA) according standard procedures. The specificity of the antisera was
characterized using platelet
lysates and recombinant RGS18 produced by coupled in vitro
transcription/translation (TNT
reticulolysate system, Promega, Madison, WI). Typically, antisera was used in
Western blotting at
1:500 (3NRGS-12) or 1:1,000 (SNRGS-13) dilutions in 5% non-fat dry milk in
TBST (20 mM Tris-
HCl, pH 7.5, 150 mM NaCI and 0.05% Tween-20). To ensure that the observed
immunoreactivity was
specific to RGS 18, peptide inhibition studies were performed. For the peptide
inhibition studies,
antisera was incubated in 100 mM Tris, pH 7.5 plus 1X EDTA-free CompleteTM
mini protease
inhibitor cocktail (Roche Biochernicals, catalog # 183-6170) in the absence or
presence of 100 mg/ml
of the immunizing peptide or an unrelated peptide for 2 hours or overnight at
4°C. This was then
diluted to the working concentration (1:500 or 1:1000) in blocking buffer (5%
non-fat dry milk in
TBST) and incubated with the nitrocellulose strips for 1 hour at room
temperature (RT) and developed
as described above. Whole cell lysates for western blotting were made from
platelets, leukocytes and
the three megakaryocyte cell lines by lysing cells in 50 mM HEPES, pH 8.0, 6
mM MgClz, 300 mM
NaCl, 1 mM DTT, 1% Triton X-100 and 1X EDTA-free CompleteTM mini protease
inhibitor cocktail
(Roche Biochemicals, catalog # 183-6170): Cells were lysed on ice, spun for 10
minutes at 13,000 X g
at 4 °C to pellet insoluble material, and the supernatants were
transferred to fresh tubes. Protein
determinations were performed using Bradford assay using BSA to generate the
standard curve. Fifty
micrograms of each lysate was run on 15% reducing SDS-PAGE, transferred to 0.2
mM nitrocellulose
and blotted as above. For detection of RGS 10 in cell lysates, SDS-PAGE was
carned out as above and
the resulting nitrocellulose strips were blocked in 2% BSA/TBST and incubated
with 1:500 dilution of
anti-RGS 10 antibody (Santa Cruz Biotechnology, Santa Cruz, CA) in blocking
buffer at RT for 2
hours or overnight at 4°C. Bound antibody was detected with mouse anti-
goat IgG-coupled to
horseradish peroxidase (HRP; Pierce, Rockford, IL,) and Supersignal West Pico
ECL reagent (Pierce,
Rockford, IL).
Results of Tissue Distribution of RGSl8 Nucleic Acids arad Polypeptides ira
Hurnan Tissues.
In order to determine the relative tissue distribution of RGS18, two Northern
blots were
hybridized with a 3' untranslated region probe (SEQ ID NO: 6) from RGS 18. The
first blot contained
10 mg/lane of total RNA from human platelets, human leukocytes, DAMI cells,
HEL cells and MEG-
O 1 cells. The second blot was a commercially-available Human Multiple Tissue
Northern (Clontech;
Palo Alto, CA) containing 1 ug of poly(A)+ mRNA from 12 human tissues, one
lane of which
contained RNA from polymorphonuclear leukocytes. In order to ensure a fair
comparison, the labeled
probe was divided in half and used to probe both blots simultaneously. The RGS
18 probe hybridizes to


CA 02408073 2002-10-28
-81-
a major species at 2.75 Kb and minor species at ~ 4.2 K.b in platelet RNA and
to a lesser extent in
DAMI, HEL, and MEG-O1 cells (Figure 3, panel A). Human leukocyte RNA also
expresses both of
these transcripts at levels equal to or slightly less than that in MEG-O1
cells. Since complete separation
of platelets and leukocytes is difficult, whenever expression levels of
transcripts in platelet RNA are
evaluated, one must be concerned with the level of contamination of the
platelet RNA by the more
abundant leukocyte RNA. The fact that leukocytes have such a low expression
level of RGS 18
compared to platelet RNA indicates that this is not a concern for this
transcript. Therefore, platelets
express significantly greater quantities of message for RGS 18 in comparison
to leukocytes, with the
intermediate levels expressed in the megakaryocytic cell lines.
Results from the Human Multiple Tissue Northern Blot are shown in Figure 3,
panel B.
Overall the hybridization signal was much lower than that seen with the
platelet Northern blot above
and required much longer exposures. For example, when both blots were
hybridized with the same
probe and same specific activity, the platelet Northern blot required only 6
hours of autoradiographic
exposure versus the 6 days required for the Human Multiple Tissue Northern. On
the Multiple Tissue
blot, the most intense band was consistently in the leukocyte lane, followed
by spleen, then heart and
liver, and very low levels in skeletal muscle, colon, kidney, small intestine,
placenta and lung.
Hybridization of a Multiple tissue Northern containing RNA from other human
tissues demonstrated
moderate levels of expression of RGS 18 in human bone marrow also, levels
comparable to that seen in
spleen (data not shown). These Northern blots were repeated at least twice on
fresh blots to ensure that
results were consistent. Using these data for comparison of the expression
levels of RGS18, it appears
that the level of expression of this message in platelets greatly exceeds that
in leukocytes, which
express RGS 18 in excess of the other tissues examined. In support of this
conclusion, we used
leukocyte and bone marrow cDNA in the degenerate RT-PCR strategy for mining
RGS transcripts, as
was done for platelets, and none of the colonies sequenced contained RGS 18.
As would be predicted
based on previous studies, the most abundant amplification products in
leukocytes and bone marrow in
these studies were hRGS2 and hRGSl6 (data not shown).
Results of WesteYn Blot Analysis of RGS18 Expression ira Hurnara Platelets.
Polyclonal anti-RGS 18 antisera were generated against two peptides, one in
the amino-
terminus (SEQ )D NO: 7) and the second in the carboxy-terminus (SEQ )D NO: 8)
of RGS 18. The
location and sequences of these peptides is shown in the boxed regions of
Figure 2. These regions were
selected due to their divergence from similar regions of the other known RGSs.
The resulting sera were
tested in western blots with platelet lysates for reactivity and specificity.
Prior studies show that these
polyclonal antibodies also react with recombinant RGS18 synthesized by coupled
transcription/translation (data not shown). Antisera directed against both
carboxy-terminal and amino-
terminal peptides reacted with an ~ 30 kDa band in platelet lysates.
Preincubation of each antiserum
with its corresponding immunizing peptide but not the other peptide ablates
antibody reactivity with


CA 02408073 2002-10-28
-82-
the 30 kDa protein, indicating that each antibody is indeed specific for RGS
18 (Figure 4, Panel A) .
. Antisera SNRGS-13 (directed against an amino-terminal peptide comprising SEQ
ID NO: 7) has a
higher titer than antisera 3NRGS-12 (directed against a carboxy-terminal
peptide comprising SEQ ID
NO: 8) and was used for further evaluation of protein expression levels.
Western analysis was
performed on lysates prepared from platelets, leukocytes and DAMI, HEL and MEG-
O1 cells to
compare the relative protein expression levels of RGS 18. Figure 4, Panel B
shows the results of a
representative experiment using antisera against the amino terminal peptide,
SNRGS-13. Consistent
with the northern expression data, RGS 18 protein is significantly more
abundant in platelets than in
leukocytes, DAMI cells, HEL cells, or MEG-O1 cells. Although an immunoreactive
band in the MEG-
O1 lane is not visible in Figure 4, panel B, longer exposures do indeed
demonstrate the expression of
RGS 18 in these cells. Northern expression data suggested that the levels of
expression of RGS 18 in
MEG-O 1 cells may be similar to leukocytes, yet this was not observed in the
western blot analysis.
This may be due to the presence of contaminating platelets in the leukocytes
preparation, which would
lead to an overestimation of RGS 18 expression in leukocytes. Indeed, western
blots using an antibody
' 15 against a platelet specific protein a2b (GPIIb, CD41) demonstrate
reactivity with leukocyte lysates,
indicating the presence of some contaminating platelets in the leukocyte
preparation (data not shown).
Since the presence of hRGS 10 was detected by RT-PCR and an hRGS 10 antibody
was
available, hRGS 10 expression levels were examined by western blotting.
Western blotting of platelet,
leukocyte and megakaryocyte cell line lysates was performed as described
above, using this anti-
hRGS 10 antibody, and indicated that hRGS 10 is almost equivalently expressed
in platelets, leukocytes
and DAMI cells, with lower levels of expression in the other two
megakaryocytic cell lines (Figure 4,
Panel B). hRGS 10 has also been reported to be expressed in brain (163). Taken
together, these data
indicate that hRGS 18 and hRGS 10 are both expressed in platelets, and that
hRGS 18 but not hRGS 10 is
preferentially expressed in platelets versus leukocytes. Based on northern
blotting data, the expression
of hRGS 18 in other human tissues would be predicted to be equal to or less
than that seen in
leukocytes, suggesting that hRGS 18 likely has a restricted tissue
distribution, with preferential
expression in platelets.
EXAMPLE 4: Expression and Purification of GST Fusion Proteins.
In order to create an in-frame GST fusion protein using the Bam HI and Xho I
sites of the
plasmid pGEX-SX-1, oligonucleotides were synthesized from the 5' most and 3'
most coding regions
with an in-frame Bam HI site on the 5' primer and a Xho I site after the
termination codon in the 3'
primer. These oligonucleotides, sense (5'-
gttcggatccgagagaagatggaaacaacattgcttttc-3'; SEQ ID NO: 9)
and antisense (5'-gtgctcgagttaacataaacatgcgatatg-3'; SEQ ID NO: 10), were used
in RT-PCR to
amplify platelet RNA. The resultant PCR amplification product was fully
sequenced for fidelity of the
PCR reaction, subcloned into pGEX-SX-1 and transformed into competent BL-21
(DE3) (Novagen,


CA 02408073 2002-10-28
-83-
San Diego, CA). Expression and purification of the resultant fusion protein
was carned out as
described in the manufacturer's directions. Essentially, an overnight culture
was diluted 1:100 in Luria
Broth containing 100 mg/ml ampicillin (typically 500 ml to 1 liter) and grown,
shaking at 30 °C until it
reached an OD6oo=0.6. The culture was then induced with 0.5 mM IPTG for 2
hours at 30 °C. Cells
were pelleted, washed one time in cold PBS and resuspended in PBS containing
100 mg/ml of
lysozyme (ICN, Costa Mesa, CA), 50 mg/ml of DNAase (Gibco/BRL, Rockville, MD)
and 1X EDTA-
free CompleteTM mini protease inhibitor cocktail (Roche Biochemicals, catalog
# 183-6170). The
suspended cells were sonicated on ice and Triton X-100 was added to a final
concentration of 1%. The
cell lysate was mixed for 30 minutes at 4 °C followed by centrifugation
at 12,000 X g for 10 minutes at
4°C. The supernatant was transferred to a fresh tube and 2 ml of a 50 %
slurry of washed glutathione-
Sepharose 4B Was added and incubated at 4°C for 1 hour. The matrix was
then washed batch-wise 5-8
times in ice-cold PBS and resuspended to a 50% slurry in 50 mM HEPES, pH7.4,
150 mM NaCI, 5
mM DTT, 10% glycerol and protease inhibitors and aliquot and stored frozen at -
70 °C. Prior to use
the matrix was thawed, washed 2-3 times in PBS or lysis buffer and resuspended
to a 50% slurry.
When necessary, elution of GST-RGS 18 was carried out by loading the Sepharose
4 B bound fusion
protein into a column and eluting with 20 mM reduced glutathione in 100 mM
Tris pH 8.0, 120 mM
NaCI.


CA 02408073 2002-10-28
-84-
EXAMPLE 5: G Protein Alplaa Subunit Binding Assays.
Determination of G protein alpha subunit binding specificity of RGS 18 was
carried out as
described in Beadling et al. (164), with minor modifications. Washed platelets
from Day 2 concentrate
were lysed in 50 mM HEPES, pH 8.0, 300 mM NaCI, 1 mM DTT, 6 mM MgCl2, 1%
Triton X-100,
and 1X EDTA-free CompleteTM mini protease inhibitor cocktail (Roche
Biochemicals, catalog # 183-
6170). Protein determination was done using Bradford Assay (BioRad, Hercules,
CA) using BSA as a
standard and lysates were adjusted to 1 mg/ml in lysis buffer prior to use.
Cell lysates (450 ml) were
activated with 30 mM GDP or 30 mM GDP plus 30 mM A1C13 and 100 mM NaF for 30
minutes at 30
°C. Following the incubation, lysates were quickly spun in a microfuge
to pellet actin which became
insoluble upon activation of the platelet lysates. Lysates were transferred to
fresh tubes and incubated
with 20 ml of a 50% slurry of GST-RGS18 coupled to glutathione-sepharose 4B
beads (typically ~10
mg RGS 18 protein) for 1 hour at 4 °C. The beads were washed twice in 1
ml of wash buffer (50 mM
HEPES, pH 8.0, 300 mM NaCI, 1 mM DTT, 6 mM MgCl2, 0.025% ClzE~o, and 1X EDTA-
free
CompleteTM mini protease inhibitor cocktail (Roche Biochemicals, catalog # 183-
6170). Bound
protein was eluted in two rounds of boiling in reducing Laemmli buffer (50 mM
Tris-HCL pH 6.8, 1
SDS, 0.008% bromophenol blue, 5% glycerol) and subjected to SDS-PAGE on 12%
gels, transferred
to 0.45 mM nitrocellulose and blotted with antisera against Ga;li2
(Calbiochem, San Diego, CA), Gai3io
(Calbiochem, San Diego, CA), G~ (Santa Cruz Biotechnology, Santa Cruz, CA),
Gaq,l (Santa Cruz
Biotechnology, Santa Cruz, CA), Gaiz (Santa Cruz Biotechnology, Santa Cruz,
CA) or Gas
(Calbiochem, San Diego, CA and Santa Cruz Biotechnology, Santa Cruz, CA).
Bound antibody was
detected using goat anti-rabbit-HRP (BioRad, Hercules, CA) and Supersignal
West Pico ECL reagent
(Pierce, Rockford, IL).
Results of BindingAnalysis of RGS18 to Endogenous G Proteifa Alpha Subunits in
Hurnan Platelets.
In order to determine the target alpha subunits of RGS 18, binding experiments
were performed
using GST-RGS 18 as prepared in Example 4 and lysates of human platelets. A
similar method has
been used to determine the binding specificity of hRGS 16 using lysates from
Jurkat cells (164).
Previous work has demonstrated that RGS proteins studied to date bind G
protein alpha subunits only
when the alpha subunit is in its transition state or "activated state" (165).
For these experiments,
platelets were lysed in a Triton X-100 containing buffer and resuspended to 1
mg/ml. The lysate was
then treated with GDP, which holds the alpha subunit in the GDP-bound "in-
activated" state, or
GDP+A1F4 that mimics the transition state of the Ga subunit. Recombinant GST-
RGS 18 bound to
Sepharose-4 beads was added to the treated lysates, incubated and washed
several times. Bound
protein was eluted in Laemmli buffer and subjected to SDS-PAGE followed by
western blot analysis.


CA 02408073 2002-10-28
-85-
A panel of G protein alpha subunit specific antibodies was used to determine
which alpha subunits
bind to RGS18. Figure 5 shows the results of a representative experiment.
RGS18 binds little if any
alpha subunit in the inactive GDP-bound state (middle lane of each panel). In
contrast, in lysates that
have been treated with GDP+A1F4 , RGS 18 binds a significant amount of alpha
subunit detected by
antibodies directed against Ga;liz, G«ors and Gaq,ll. This interaction appears
to be specific since RGS18
did not bind G~, Ga;z, or Gas. Neither GST nor Sepharose 4B alone binds to any
of these alpha
subunits in either GDP or GDP+A1F4 treated platelet lysates (data not shown).
The binding selectivity
of RGS 18 is consistent' with that found for other RGS proteins which
selectively bind to members of
the Ga; family and/or Gaq family (14).
EXAMPLE 6: Homology comparison of RGS18 With Other RGS Proteins.
The predicted amino acid sequence of RGS 18 (SEQ m NO: 20) was compared to
that of
several other of the more closely related RGS proteins. Figure 2 depicts an
alignment of human RGS 18
protein (SEQ ID NO: 20) with human (h) RGS4 (SEQ ID NO: 21), hRGSS (SEQ 1D NO:
22), hRGSl6
(SEQ m NO: 23), hRGS2 (SEQ m NO: 24), hRGSl (SEQ ID NO: 25), and hRGSlO (SEQ m
NO:
26), which was generated using the Pileup program from GCG. Shaded areas
represent amino acids
that are conserved between RGS 18 and at least two other RGSs. The region of
the RGS 18 domain that
was initially isolated by RT-PCR i.e., amino acids 1-77 and 79-81 of SEQ )D
NO: 12, which
correspond to amino acids 109-185 and 187-189 of SEQ m NO: 20 is shown by a
line above the
amino acids in Figure 2. Human RGS18 is most homologous to human RGSS (47%
identity), followed
by rat RGS8 (SEQ 1D NO: 27; 44%), hRGS2 (41%), hRGS4 and hRGSl6 (40%), hRGSl
(37%),
hRGSlO and hRGS3 (SEQ 1D NO: 28; 36%) and hRGSl3 (SEQ 1D NO: 29; 34%). Human
RGS18
displays between 20 to 30% identity to other known RGS proteins. Recent
phylogenetic analysis of the
RGS superfamily indicates the presence of at least six distinct subfamilies
(166). RGS18 is most
closely related to members of Family B. RGS proteins in Family B contain
characteristic short amino
and carboxy terminal domains (except RGS3) and two conserved amino acids
(locations depicted by
asterisks above residues in Figure 2). The first is an asparagine (ASN)
residue at position 128 in
hRGS4 (SEQ 1D NO: 21) found in families B, C and D and is conserved in hRGSl8
(amino acid 152
of SEQ m NO: 20). Family B is the most divergent of the group and contains
only one subfamily-
specific residue. A serine (Ser) is conserved between the known RGS family
members [Ser 103 in
hRGS4 (SEQ ID NO: 21)] however, this residue is not conserved in hRGSl8
(glycine at amino acid
127 of SEQ 1D NO: 20). All but one the residues in hRGS4 that have been shown
to contact the Ga
subunit (18) are conserved between hRGSl8 and hRGS4 (depicted by T in Figure
2).
Discussion


CA 02408073 2002-10-28
-86-
Classically, the G protein signal transduction cascade consists of the
integral membrane
receptor, the heterotrimeric GTP-binding protein and the downstream effector.
More recently, the
complexity of these signaling pathways has become apparent by the
identification of additional
signaling molecules that regulate distinct aspects of these pathways. Several
families of molecules
have been identified which serve to attenuate receptor-mediated signaling at
the receptor andlor G
protein level (167). Regulators of G protein Signaling (RGS) are a new family
of proteins which were
identified in genetic studies of yeast and worms (nemaotodes) as negative
regulators of G protein
signaling, and many mammalian homologues have since been characterized (14).
RGSs appear to
regulate signaling via interaction with one or more Ga subunits, stabilizing
the transition state of the
Ga subunits, thereby accelerating GTP hydrolysis (19). In an effort to better
understand GPCR-
mediated signaling in human platelets, studies to examine which isoforms of
the RGS family exist in
platelets were conducted. Applicants describe herein the identification of
nucleic acids encoding a
novel Regulator of G protein Signaling, RGS 18 which is abundantly expressed
in human platelets.
Although platelets are enucleate cells, they contain small amounts of residual
cytoplasmic
RNA presumably carried over from their precursor cell, the megakaryocyte.
Several groups have taken
advantage of the presence of this residual RNA to do molecular biological
identification of platelet
proteins (168). Degenerate RT-PCR analysis is well suited to study transcript
expression in platelets,
due to the minimal requirement of RNA of this technique. Using degenerate
primers (SEQ ID NOs: 1-
4) that were designed based upon conserved amino acids of the amino and
carboxy-terminal regions of
the RGS domain, RGS transcripts expressed in platelet RNA were identified.
Surprisingly, the
majority of amplification products encoded a novel partial RGS domain (amino
acids 1-81 of SEQ ID
NO: 12 corresponding to amino acids 109-189 of SEQ ID NO: 20, with the
exception of amino acid 78
of SEQ ID NO: 12). Platelets also appear to contain transcripts for other
previously known RGS
proteins including hRGS2, hRGS 16 and hRGS 10. Additionally, RNA from three
megakaryocytic cell
lines, Dami, HEL, and MEG-O1 cells were analyzed using the same method, and in
contrast to what
was found in platelet RNA, the most abundant amplification product in each of
these cells was
hRGS 16. One colony out of 50 analyzed in DAMI cells contained a PCR product
comprising the novel
partial RGS domain, indicating that these cells also express the novel RGS.
These cells likely differ
from platelets in their expression of RGSs due to the fact that they are
undifferentiated, and leukemic
in nature. This is not unexpected since several studies have demonstrated
modulation of RGS
expression in several different cell types. The expression levels of hRGS 1
and hRGS2 can both be
regulated by mitogens in lymphocytes (11, 12), and hRGSl6 can regulated by IL-
1 in lymphocytes
(164) and the tumor suppressor, p53 in a colon carcinoma cell line (161).
Although these cell lines
have many features of the megakaryocytic lineage (i. e., expression of
GPIIb/IIIa and other platelet
specific genes) (169-171) and have proved useful for identification of
platelet-specific genes, they are


CA 02408073 2002-10-28
-87-
not perfect models of platelet signal transduction. Most importantly these
cells do not appear to have
intact signaling pathways which stimulate binding of soluble fibrinogen to
GPIIb/Illa, indicating that
their signal transduction pathways or complement of signaling proteins differs
from platelets (172).
The most abundant RGS isoform in human bone marrow and peripheral blood
leukocyte RNA
detected by degenerate RT-PCR was hRGS2 (data not shown) that further points
out the distinction
between platelets and other hematopoetic cells. The fact that each tissue
displays a different transcript
profile is a good indication that the primers are not biased for one RGS
isoform over others, and that
the proportional expression we see with this method likely reflects relative
RNA expression levels.
Although RGS 18 was not detected in human peripheral blood leukocyte RNA by
this
degenerate RT-PCR method, it may be that this transcript was not in fact
amplified from platelet RNA
but from contaminating white blood cell RNA. Since platelets contain so little
RNA, a small amount of
white blood cell contamination could lead to a disproportionate contamination
of the platelet RNA by
leukocyte RNA. Northern blot analysis of human platelet and leukocyte RNA
indicates that this is not
he case, since platelet RNA expresses significantly higher levels of RGS 18
than leukocytes. The
1 S megakaryocytic cell lines express levels of RGS 18 intermediate to those
of platelets and leukocytes.
Examination of the expression of RGS 18 by northern blotting in a wide variety
of human tissues
,indicates that'RGS18 appears to be most abundantly expressed in platelets,
followed by leukocytes and
then other tissues of the hematopoetic system, namely spleen and bone marrow,
as well as heart and
liver. Very low level expression can be detected in other tissues as well,
including skeletal muscle,
colon, kidney, small intestine, placenta and lung, but whether these levels
translate to significant
expression of the protein in these tissues remains to be determined. Two
transcripts for RGS 18, a
major species of 2.75 Kb and a minor species of 4.2 Kb, are expressed in
platelet RNA, as well as all
other tissues examined. The presence of two mRNA species on the northern blot
indicates that this
transcript, like many others, is subject to alternative splicing and/or
differential polyadenylation.
2S Full-length cloning of RGS 18 was achieved by combining the sequence
information from the
initial PCR product (SEQ ID NO: 11) of the RGS domain, an overlapping Incyte
EST cDNA (SEQ ID
NO: 6) comprising the 3' untranslated region and S' RACE cDNA (SEQ ID NO: 18)
to obtain the
entire coding region and some S' untranslated region of RGS 18 (SEQ ID NO:
19). The open reading
frame of the RGS 18 cDNA (SEQ ID NO: 19) encodes a 23S amino acid protein (SEQ
ID NO: 20) with
a putative RGS domain (amino acids 86-202 of SEQ ID NO: 20). RGS 18 has very
short carboxy- and
amino-terminal domains flanking the internal RGS domain and does not appear to
contain functional
domains for scaffolding (i.e., PH, Dbl, GGL or DEP). It does however have one
putative CAAX motif
that might serve as a site of acylation, and permit membrane anchoring. RGS18
also contains several
consensus sites for phosphorylation by the enzymes cAMP/cGMP dependent protein
kinase, protein
3S kinase C and casein kinase II. This indicates the potential for regulation
of RGS 18 by other signaling
cascades.


CA 02408073 2002-10-28
_88_
Recently a phylogenetic analysis of this family has been performed and
demonstrates that the
RGS superfamily can be divided into at least 6 subfamilies (A through F)
(166). RGS18 would most
probably be a member of subfamily B, since it is most closely related to these
RGSs, and like RGS 18,
subfamily B members characteristically contain short amino and carboxy-
terminal domains. RGS 18
does contain a highly conserved asparagine residue at position 152 of SEQ ID
NO: 20 (relative
position 128 in hRGS4; SEQ ID NO: 21) that is conserved in three of the six
families. Structural
studies of RGS4 indicate that this residue is critical for GAP activity and
stabilization of the transition
state of G« (18, 173). Unlike some of the other subfamilies, subfamily B is a
diverse group, and only.
one amino acid, a Ser residue (position 103 in hRGS4; SEQ ID NO: 21), is
conserved between all the
members of Family B. However, the corresponding residue in RGS 18 (position
127 of SEQ ID NO:
20) is a glycine, which calls into question whether RGS 18 is in fact a member
of subfamily B.
Interestingly, hRGS 10 cannot be placed into one of the subfamilies due to its
divergence from the
other known RGSs. Recently, the sequence of a novel RGS that has been termed
RGS17, isolated from
a chicken dorsal root ganglion cDNA library was reported and is distinct from
the platelet hRGS 18
(31% amino 'acid identity), and in fact appears to be a member of subfamily A
(174). Whether RGS18
belongs to Family B is as yet uncertain, and waits further functional and
structural characterization.
Seven of eight human RGSs of Family B appear to be clustered on chromosome 1,
perhaps due to gene
duplication events (166). It will be interesting to determine if RGS 18 is
also localized on this
chromosome. As additional members of the RGS superfamily are identified, and
as more information
is gained about the functionality of each RGS, the defining characteristics of
the various RGS
subfamilies will become more distinct.
Since RNA expression levels do not always reflect protein expression levels,
we thought it
important to look at the expression of RGS 18 in western blots using specific
antisera. Two peptide-
directed antisera were generated against peptides, one located in the amino
terminus and a second in
the carboxy-terminus of RGS 18. RGS 18 migrates on SDS-PAGE with an apparent
molecular weight
of 30 kDa and is abundantly expressed in platelets and to a significantly
lesser extent in leukocytes and
the three megakaryocytic cell lines. This reactivity can be neutralized by pre-
incubating the antisera
with the immunizing peptide, demonstrating that the reactivity of this 30 kDa
band is specific for
RGS 18. The presence of RGS 18 in commercially prepared lysates (Clontech,
Palo Alto ,CA) was not
detected from human brain, liver or lung (data not shown). If RGS 18 is
expressed at all in these
tissues, its level of expression is probably too low to detect with the
currently available tools.
Platelets are known to express a variety of G« subunits. Previous work has
shown that platelets
contain members of the G«; family, G«;I, G«;Z, G«~3~ CT«~~ Gatzns~ G«i6 ~ G«s
(5) and G«q but not G«m
( 175, 176). Since a source of recombinant G protein alpha subunits was
unavailable, the G protein
alpha subunit selectivity of RGS 18 was analyzed using endogenous platelet G
proteins. This strategy
was used by Beadling et al., using Jurkat cell lysates and recombinant hRGS
16, to determine the


CA 02408073 2002-10-28
_89_
binding specificity of hRGS 16 (164). A GST-tagged fusion protein of RGS 18
binds G« subunits
detected by antibodies to G«;liz, G«ssio and G«q,l l in platelet lysates that
are activated by treatment with
GDP+A1F4 . In these same experiments, RGS18 failed to interact with G«z, G«lz
or G«S. Although the
antisera have somewhat overlapping specificity for the G«; subunits, platelets
contain immunologically
undetectable levels of G«;1(177), so that the majority of G« subunit detected
by the first antisera is
likely G«;z. G«o has not been reported in platelets, and therefore this
antibody is most likely detecting
interaction with G«;3. G«ll is not expressed in platelets (175, 176), so the
G«q,ll antibody is detecting
the presence of G«q. Taken together, these data indicate that RGS 18 interacts
with G«q , G«;z and/or
G«;3 and likely regulates one or more pathways mediated by these G« subunits
in platelets.
This G« subunit specificity is in line with what has been demonstrated for
other RGSs which
typically interact with members of the G«; and/or G«q family. No RGS has been
identified which
interacts with G«S. The, RGS protein, p115 RhoGEF, from the subfamily F appear
to be the only
members identified which interact with G«lzn3 subunits (178, 179). Despite the
fact that G«~ is
abundantly expressed in platelets (180), RGS18 does not appear to interact
with this alpha subunit.
, Interestingly, hRGS 10 is expressed in platelets at both the RNA and protein
levels. hRGS 10 has been
reported to interact with G«Z as well as G«;3 (181). It is likely that due to
their somewhat distinct G«
preference, that RGS 10 and RGS 18 might serve to regulate different signaling
pathways in platelets.
The exact function of RGS 18 in platelet signal transduction is not clear. In
vitro G« subunit
binding specificity indicates that RGS 18 likely regulates pathways mediated
via activation of both G«;
and G«q linked pathways. In platelets, aggregation appears to be dependent
upon concomitant
activation of both G«; and G«q coupled receptors (37). The platelet agonists,
thrombin, thromboxane
Az and ADP are all linked to signaling pathways via these G« subunits.
Blockade of signaling through
G«g in mice, leads to a .phenotype in which platelets are not responsive to a
variety of agonists and as a
result are susceptible to hemorrhage (39). Due to the ubiquitous expression of
G«q, these mice also
display other deleterious phenotypes, including ataxia, making G«q a poor
target for anti-platelet
therapy. Because of its potential to regulate the G protein-mediated pathways
in platelets that are
critical for platelet activation, and the fact that it is enriched in
platelets over tissues, RGS 18 or an as
yet unknown protein which regulates RGS 18, might make a good target for
therapies aimed at
regulating platelet activation. Future studies addressing the regulation of
individual GPCRs and their
signal transduction pathways by RGS 18, and other RGSs which are present in
platelets, will give us a
better understanding of the role that RGSs play in platelet activation events.
The present invention is not to be limited in scope by the specific
embodiments described
herein. Indeed, various modifications of the invention in addition to those
described herein will


CA 02408073 2002-10-28
-90-
become apparent to those skilled in the art from the foregoing description and
the accompanying
figures. Such modifications are intended to fall within the scope of the
appended claims.
It is further to be understood that all base sizes or amino acid sizes, and
all molecular weight or
molecular mass values, given for nucleic acids or polypeptides are
approximate, and are provided for
description.
Various publications are cited herein, the disclosures of which are
incorporated by reference in
their entireties.


CA 02408073 2002-10-28
-91-
REFERENCES CITED
1. Bourne (1997) Curr. Opin. Cell Biol., 9:134-142.
2. Wess (1997) FASEB. J., 11: 346-354.
3. Bockaert and Pin (1999) Embo J., 18:1723-1729.
4. Hamm (1998) J.Biol Chem., 273: 669-672.
5. Brass, L. F., Manning, D. R., Cichowski, K., and Abrams, C. S. (1997)
Thromb. Haemost.
78, 581-9
6. Dohlman H. G., Song J., Ma D., Courchesne W. E., Thorner J. (1996) Mol.
Cell. Biol. 16,
l0 5194-209
7. Yu J. H., Wieser J., Adams T. H. (1996) EMBO. J. 15:5184-90
8. Koelle M. R. and Horvitz H. R.(1996) Cell 84:115-25
9. De Vries .L, Mousli M., Wurmser A., Farquhar M. G. (1995) Proc. Natl. Acad.
Sc.i U. S.
A. 92: 11916-20
10. Druey K. M., Blumer K. J., Kang V. H., Kehrl J. H. (1996) Nature 379: 742-
6
11. Newton J. S., Deed R. W., Mitchell E. L., Murphy J. J., Norton J. D. (1993
Biochim. Biophys.
Acta. 1216: 314-6.
12. Wu H. K., Heng H. H., Shi X. M., Forsdyke D. R., Tsui L. C., Mak T. W.,
Minden M. D.,
Siderovski D. P. (1.995) Leukemia 9: 1291-8
13. Hong J. X., Wilson G. L., Fox C. H., Kehrl J. H. (1993) J. Immunol. 150:
3895-904
14. Hepler J. R. (1999) Pharmacol. Sci. 20: 376-82
15. Gilman A. G. (1987) Annu. Rev. Biochem. 56:615-49
16. Berman D. M., Wilkie T. M., Gilman A. G. (1996) Cell 86: 445-52
17. Watson N., Linder M.E., Druey K.M., Kehrl J.H., Blumer K.J. (1996) Nature
383:172-5
18. Tesmer JJ, Berman DM, Gilman AG, Sprang SR (1997) Cell 89:251-61
19.. Berman D. M., Kozasa T., Gilman A. G. (1996) J. Biol. Chem. 271: 27209-
12.
20. Hepler J. R., Berman D. M., Gilman A. G., Kozasa T. (1997 Proc. Natl.
Acad. Sci. U. S. A. 94:
428-32)
21. Yan Y., Chi P. P., Bourne H. R. (1997) J. Biol. Chem. 272:11924-7
22. Huang C., Hepler J. R. , Gilman A. G. , Mumby S. M. (1997) Proc. Natl.
Acad. Sci.
U.S.A.94:6159-63
23. Neill J. D., Duck L. W., Sellers J. C., Musgrove L. C., Scheschonka A,
Druey K. M.,
Kehrl J. H. (1997) Endocrinology 138: 843-6
24. Saugstad J. A., Marino M. J., Folk J. A., Hepler J. R., Conn P. J. (1998)
J. Neurosci.
18:.905-13
25. Makino E. R., Handy J. W., Li T., Arshavsky V. Y. (1999) Proc. Natl. Acad.
Sci. U. S. A.
96:1947-52
26. Nekrasova E. R., Berman D. M., Rustandi R. R., Hamm H. E., Gilman A. G.,
Arshavsky
V. Y. (1997) Biochemistry 36: 7638-43
27. Daniel J. L., Dangelmaier C., Jin J., Ashby B., Smith J. B., Kunapuli S.
P. (1998)
Molecular basis for ADP-induced platelet activation. J. Biol. Chem. 273: 2024-
9
28. Jin J., Daniel J. L., Kunapuli S. P. (1998 J. Biol. Chem. 273: 2030-4
29. Benka M. L., Lee M., Wang G. R., Buckman S., Burlacu A., Cole L., DePina
A., Dias P.,
Granger A., Grant B., et al (1995) FEBS Lett. 363: 49-52
30. Brass L. F., Laposata M., Banga H. S., Rittenhouse S. E. (1986) J. Biol.
Chem. 261:
1683 8-47
31. Offermanns S., Laugwitz K. L., Spicher K., Schultz G. (1994) Proc. Natl.
Acad. Sci. U. S. A. 91:
504-8
32. Kinsella B. T., O'Mahony D. J., Fitzgerald G. A. (1997) J. Pharmacol. Exp.
Ther. 281:
957-64
33. Ushikubi F., Nakamura K., Narurniya S. (1994) Functional reconstitution of
platelet
thromboxane A2 receptors with Gq and Gi2 in phospholipid vesicles. Mol.
Pharmacol. 46:
808-16
34. Baldassare J. J., Tarver A. P., Henderson P. A., Mackin W. M., Sahagan B.,
Fisher G. J.
(1993) Biochem. J. 291: 235-40


CA 02408073 2002-10-28
35. Knezevic L, Borg C., Le Breton G. C. (1993) J. Biol. Chem. 268: 26011-7
36. Djellas Y., Manganello J. M., Antonakis K., Le Breton G.C. (1999).J. Biol.
Chem. 274:
14325-30
37. Jin J., Kunapuli S. P. (1998) Proc. Natl. Acad. Sci. U. S. A. 95: 8070-4
38. Jantzen H. M., Gousset L., Bhaskar V., Vincent D., Tai A., Reynolds E.E.,
Conley P.B. (1999)
Thromb. Haemost. 81: 111-7
39. Offermanns S, Toombs CF, Hu YH, Simon MI (1997) Nature 389:183-6.
40. Sambrook, J. Fritsch, E. F., and T. Maniatis, 1989. Molecular cloning: a
laboratory manual. Zed.
Cold Spring Harbor Laboratory, Cold spring Harbor, New York.
41. Glover (ed.), 1985. DNA Cloning: A Practical Approach, Volumes I and II
Oligonucleotide
Synthesis, MRL Press, Ltd., Oxford, U.K.
42. Gait (ed.), I984. Nucleic Acid Hybridization.
43. Hames BD and Higgins SJ, 1985. Nucleic acid hybridization : a practical
approach, Hames and
Higgins Ed., IRL Press, Oxford.
44. Hames and Higgins (eds.), 1984. Animal Cell Culture.
45. Freshney (ed.), 1986. Immobilized Cells And Enzymes, IRL, Press.
46. Perbal, 1984. A Practical Guide To Molecular Cloning.
47. Ausubel et al., 1989. Current Protocols in Molecular Biology, Green
Publishing Associates and
Wiley Interscience, N.Y.
48. Reeck et al., 1987, Cell 50:667.
49. Maniatis et al., 1982. Molecular cloning : A Laboratory Manual, Cold
Spring Harbor Press, Cold
Spring, NY.
50. Altschul et al, 1990. J. Mol. Biol., 215:403-410.
51. Altschul et al, 1997. Nucleic Acids Res., 25:3389-3402.
52. Benton and Davis, 1977, Science 196:180.
53. Grunstein and Hogness, 1975, Proc.Natl. Acad. Sci. U.S.A. 72:3961.
54. Hutchinson, C., et al., 1978, J. Biol. Chem. 253:6551.
55. Zoller and Smith, 1984, DNA 3:479-4.88.
56. Oliphant et al., 1986, Gene 44:177.
57. Hutchinson et al., 1986, Proc. Natl. Acad. Sci. U.S.A. 83:710.
58. Huygen et al., 1996. Nature Medicine, 2(8):893-898.
59. Higuchi, 1989, "Using PCR to Engineer DNA", in PCR Technology: Principles
and Applications
for DNA Aznplification, H. Erlich, ed., Stockton Press, Chapter 6, pp. 61-70.
60. Benoist and Chambon, 1981, Nature 290:304-310.
61. Yamamoto, et al., 1980, Cell 22:787-797.
62. Wagner et al., 1981, Proc. Natl. Acad. Sci. U.S.A. 78:1441-1445.
63. Brinster et al., 1982, Nature 296:39-42.
64. Villa-Kamaroff, et al., 1978, Proc. Natl. Acad. Sci. U.S.A. 75:3727-3731.
65. DeBoer, et al., 1983, Proc. Natl. Acad. Sci. U.S.A. 80:21-25.
66. Swift et al., 1984, Cell 38:639-646.
67. Ornitz et al., 1986, Cold Spring Harbor Symp. Quart. Biol. 50:399-409.
68. MacDonald, 1987, Hepatology 7:425-515.


CA 02408073 2002-10-28
-93-
69. Hanahan, 1985, Nature 315:115-122.
70. Grosschedl et al., 1984, Cell 38:647-658.
71. Adames et al., 1985, Nature 318:533-538.
72. Alexander et al., 1987, Mol. Cell: Biol. 7:1436-1444.
73. Leder et al., 1986, Cell 45:485-495.
74. Pinkert et al., 1987, Genes and Devel. 1:268-276.
75. Krumlauf et al., 1985, Mol. Cell. Biol. 5:1639-1648.
76. Hammer et al., 1987, Science 235:53-58.
77. Kelsey et al., 1987, Genes and Devel. 1:161-171.
78. Mogram et al., 1985, Nature 315:338-340.
79. Kollias et al., 1986, Cell 46:89-94.
80. Readhead et al., 1987, Cell 48:703-712.
81. Sani, 1985, Nature 314:283-286.
82. Mason et al., 1986, Science 234:1372-1378.
83. Smith et al., 1988, Gene 67:31-40.
84. Kaufman, 1991. Current Protocols in Molecular Biology, 16.12.
85. Wu et al., 1992, J. Biol. Chem. 267:963-967.
86. Wu and Wu, 1988, J. Biol. Chem. 263:14621-14624.
87. Hartmut et al., Canadian Patent Application No. 2,012,311, filed March 15,
1990.
88. Felgner et al., 1987. PNAS 84:7413.
89. Mackey, et al., 1988. Proc. Natl. Acad. Sci. U.S.A. 85:8027-8031.
90. Ulmei et al., 1993. Science 259:1745-1748.
91. Felgner and Ringold, 1989. Science 337:387-388.
92. Williams et al., 1991. Proc. Natl. Acad. Sci. USA 88:2726-2730.
93. Curiel et al., 1992. Hum. Gene Ther. 3:147-154.
94. Wu and Wu, 1987. J. Biol. Chem. 262:4429-4432.
95. Narang SA, Hsiung HM, Brousseau R, 1979. Methods Enzymol, 68:90-98.
96. Brown EL, Belagaje R, Ryan MJ, Khorana HG, 1979. Methods Enzymol, 68:109-
151.
97. Beaucage et al., 1981. Tetrahedron Lett, 22: 1859-1862.
98. Urdea M.S., 1988. Nucleic Acids Research, 11:4937-4957.
99. Sanchez-Pescador R., 1988. J. Clin. Microbiol., 26(10):1934-1938.
100. Urdea MS et al., 1991. Nucleic Acids Symp Ser., 24:197-200.
101. Fuller S.A. et al., 1996. Ifnrraunology, In: Current Protocols in
Molecular Biology, Ausubel et
al.(eds.).
102. Sternberg N.L., 1992. Trends Genet., 8:1-16.
103. Sternberg N.L., 1994. Mamm. Genome, 5:397-404.
104. Flotte et al., 1992. Am. J. Respir. Cell Mol. Biol., 7:349-356.
105. Samulski et al., 1989. J. Virol., 63:3822-3828.
106. McLaughlin BA et al., 1996. Am. J. Hum. Genet., 59:561-569.


CA 02408073 2002-10-28
-94-
107. Graham et al., 1973. Virology, 52:456-457.
108. Chen et al., 1987. Mol. Cell. Biol., 7 : 2745-2752.
109. Gopal, 1985. Mol. Cell. Biol., 5:1188-1190.
1 I0. Tur-Kaspa et aI, 1986. Mol. Cell. Biol., 6:716-718.
111. Potter et al., 1984. Proc Natl Acad Sci U S A., 81(22):7161-5.
112. Harland et al., 1985. J. Cell. Biol., 101:1094-1095.
113. Nicolau C. et al., 1987. Methods Enzymol., 149:157-76.
114. Fraley et al., 1979. Proc. Natl. Acad. Sci. USA, 76:3348-3352.
115. Tacson et al., 1996. Nature Medicine, 2(8):888-892.
116. Pagano et al., 1967. J.Virol., 1:891.
117. Kaneda et al., 1989. Science 243:375.
118. Fraley et al., 1980. J.Biol.Chem., 255:10431.
119. Beard et al., 1990. Virology, 75:81.
120. Levrero et al., 1991. Gene 101.
121. Graham, 1984. EMBO J., 3:2917.
122. Graham et al., 1977. J. Gen. Virol., 36:59.
123. Breakfield et al., 1991. New Biologist, 3:203.
124. Bernstein et al., 1985. Genet. Eng., 7:235.
125. McCormicle, 1985. BioTechnology, 3:689.
126. Bender et al., 1987. J. Virol., 61:1639.
127. Houben Weyl, 1974. In: Meuthode der Organischen Chemie, E. Wunsch Ed., 15-
I:15-II.
128. Merrifield RB, 1965a. Nature, 207(996):522-523.
129. Mernfield RB., 1965b. Science, 150(693):178-185.
130. Koch Y., 1977. Biochem. Biophys. Res. Commun., 74:488-491.
131. Kozbor et al., 1983. Hybridoma, 2(1):7-16.
132. Kohler G. and Milstein C., 1975. Nature, 256:495-497.
133. Kozbor et al., 1983. hnmunology Today, 4:72.
134. Cote et al., 1983. Proc. Natl. Acad. Sci. U.S.A. 80:2026-2030.
135. Cole et al., .1985. In: Monoclonal Antibodies and Cancer Therapy, Alan R.
Liss, Inc., pp. 77-96.
136. Morrison et al., EP 173494.
137. Neuberger et al., 1984. Nature, 312:604-608.
138. Takeda et al., 1985. Nature 314:452-4.54.
139. Huse et al., 1989. Science 246:1275-1281. ,
140. Martineau P, Jones P, Winter G, 1998. J Mol Biol, 280(1):117-127.
141. Ridder R, Schmitz R, Legay F, Gram H, 1995. Biotechnology (NY), 13(3):255-
260.
142. Reimann KA, et al., 1997. AIDS Res Hum Retroviruses, 13(11):933-943.
143. Leger OJ, et al., 1997. Hum Antibodies, 8(1):3-16.


CA 02408073 2002-10-28
-95-
144. Langer, 1990. Science, 249:1527-1533.
145. Treat et al., 1989. In: Liposomes in the Therapy of Infectious Disease
and Cancer, Lopez-
Berestein and Fidler (eds.), Liss: New York, pp. 353-365.
146. Lopez-Berestein, 1989. In: Liposomes in the Therapy of Infectious Disease
and Cancer, Lopez-
Berestein and Fidler (eds.), Liss: New York, pp. 317-327.
147. Sefton, 1987. CRC Crit. Ref. Biomed. Eng. 14:201.
148. Buchwald et al., 1980. Surgery 88:507.
149. Saudek et al., 1989 N. Engl. J. Med. 321:574.
150. Langer and Wise (eds.), 1974. In: Medical Applications of Controlled
Release, CRC Press: Boca
Raton, Florida.
151. Smolen and Ball (eds.), 1984. Controlled Drug Bioavailability, Drug
Product Design and
Performance, Wiley: New York .
152. Ranger and Peppas, 1983. J. Macromol. Sci. Rev. Macromol. Chem. 23:61.
153. Levy et al., 1985. Science 228:190.
154. During et al., 1989. Ann. Neurol. 25:351.
155. Howard et al., 1989. J. Neurosurg. 71:105.
156. Goodson, 1984. In: Controlled Drug Bioavailability, Drug Product Design
and Performance,
Smolen and Ball (eds.), Wiley: New York , vol. 2, pp. 115-138.
157. Berman, et al., 1996. Cell 86:445-452.
158. Denecke et al., 1999. J. Biol. Chem. 274:26860-26868.
159. Huang et al., 1997. Proc. Natl. Acad. Sci. 94:6159-6163.
160. Chen C., Zheng B., Han J., Lin S. C. (1997) J. Biol. Chem. 272: 8679-85.
161. Buckbinder .L, Velasco-Miguel S., Chen Y., Xu N., Talbott R., Gelbert L.,
Gao J.,
Seizinger B. R., Gutkind J. S., Kley N. (1997) Proc Natl. Acad. Sci. U. S. A.
94: 7868-72.
162. Snow B. E., Antonio L., Suggs S., Siderovski D. P. (1998) Gene 206: 247-
53.
163. Gold S. J., Ni Y. G., Dohlman H. G., Nestler E. J. (1997) J. Neurosci.
17: 8024-37.
164. Beadling, C., Druey, K.M., Richter, G., Kerh; J.H., and Smith, K.A.
(1999) J. Immunol. 162,
2677-2682.
165. Dohlman H. G., Thorner J. (1997)RGS proteins and signaling by
heterotrimeric G
proteins. J. Biol. Chem. 272: 3871-4.
166. Zheng B., De Vries L., Farquhar M. G. (1999) Trends. Biochem. Sci. 24:
411-4.
167. Bunemann M, Lee KB, Pals-Rylaarsdam R, Roseberry AG, Hosey MM (1999)
Annu. Rev.
Physiol. 61:169-92.
168. Newman P. J., Gorski J., White G. C. 2d, Gidwitz S., Cretney C. J., Aster
R. H. (1988)
J. Clin Invest. 82: 739-43.
169. Tabilio A., Rosa J. P., Testa U., Kieffer N., Nurden A. T., Del Canizo M.
C., Breton-
Gorius J, Vainchenker W. (1984) EMBO J. 3: 453-9.
170. Ogura M., Morishima Y., Ohno R., Kato Y, Hirabayashi N., Nagura H., Saito
H. (1995)
Blood 66: 1384-92.
171. Greenberg S. M., Rosenthal D. S., Greeley T. A., Tantravahi R., Handin R.
I. (1988)
Blood 72: 1968-77.
172. Boudignon-Proudhon C., Patel P. M., Parise L. V. (1996) Blood 87: 968-76.
173. Srinivasa S. P., Watson N., Overton M. C., Blumer, K. J. (1998) J Biol.
Chem. 273:
1529-1533.
174. Jordan J. D., Carey K. D., Stork P. J., Iyengar R. ( 1999) J. Biol. Chem
274: 21507-
21510.
175. Milligan G., Mullaney L, McCallum J. F. (1993) Biochim. Biophys.
Acta.;1179: 208-
212. ,


CA 02408073 2002-10-28
-96-
176. Johnson G. J., Leis L. A., Dunlop P. C. (1996) Biochem. J. 318 :1023-31.
177. Williams A. G., Woolkalis M. J., Poncz M., Manning D. R., Gewirtz A. M.,
Brass L. F. (1990)
Blood 76: 721-30.
178. Kozasa T., Jiang X., Hart M. J. , Sternweis P. M. , Singer W. D., Gilman
A. G., Bollag
G., Sternweis P. C. (1998) Science 280: 2109-11.
179. Hart M. J., Jiang X., Kozasa T., Roscoe W., Singer W. D., Gilman A. G.,
Sternweis P.
C., Bollag G. (1998) Science 280: 2112-4.
180. Gagnon A. W., Manning D. R., Catani L., Gewirtz A., Poncz M., Brass L. F.
(1991)
Blood 78: 1247-53.
181. Hunt T. W., Fields T. A., Casey P. J., Peralta (1996) Nature, 383: 175-7.


CA 02408073 2002-10-28
SEQUENCE LISTING
<l10>MURRAY, David L.


GAGNON, Alison W.



<l20>NUCLEIC ACIDS ENCODING A NOVEL REGULATOR OF G PROTEIN


SIGNALING, RGS18, AND USES THEREOF


<130>A3656-US



<140>


<141>


<160>38



<170>PatentIn Ver. 2.1


<210>1


<211>21


<212>DNA


<213>Artificial Sequence


<220>


<223>Description of Artificial Sequence:PCR Primer



<220>


<221>modified
base


<222>_
(3)


<223>n = Inosine



<220>


<221>modified
base


<222>_
(12)


<223>n= Inosine



<400>1


grngaraayh
tngarttytg
g
21


<210>2


<211>21


<212>DNA


<213>Artificial Sequence


<220>


<223>Description of Artificial Sequence:PCR Primer


<220>


<221>modified
base


<222>_
(3)


<223>n= Inosine


<220>


<221>modified
base


<222>_
(12)


<223>n = Tnosine


<220>


<221>modified
base


<222>_
(15)


<223>n = Inosine


<400>2


grngaraayh
tnmgnttytg
g
21



1


CA 02408073 2002-10-28
<210> 3
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:PCR Primer
<220>
<221> modified base
<222> (5) _
<223> n = Inosine
<220>
25 <221> modified_base
<222> (1l)
<223> n = Inosine
<400> 3
grtangarty nttytycat 19
<210> 4
<211> 19
<212> DNA
<213> Artificial Sequence
35
<220>
<223> Description of Artificial Sequence:PCR Primer
<220>
<221> modified_base
<222> (11)
<223> n = Inosine
<400> 4
grtarctrty nttytycat 19
<210> 5
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:PCR Primer
<400> 5
cgctagggcc ttagactcct tgcttcttcc 30
<210> 6
<211> 1486
<212> DNA
<213> Homo Sapiens
<400> 6
ctcaacctac cctccacagt tttgatgctg cacaaagcag agtgtatcag ctcatggaac 60
aagacagtta tacacgtttt ctgaaatctg acatctattt agacttgatg gaaggaagac 120
ctcagagacc aacaaatctt aggagacgat cacgctcatt tacctgcaat gaattccaag 180
atgtacaatc agatgttgcc atttggttat aaagaaaatt gattttgctc atttttatga 240
caaacttata catctgcttc taacatatcg catgtttatg ttaagatttg gtcccatcct 300
ttaaactgaa atatgtcatg tgaaattatt ttaaaaatgt aaaaacaaaa ctttctgcta 360
acaaaataca tacagtatct gccagtatat tctgtaaaac cttctatttg atgtcattcc 420
atttataatc agaaaaaaaa cttatttctt aatcaaaagg cagtacaaaa aaagtaataa 480
tgttttataa gattgtagag ttaagtaaaa gttaagcttt tgcaaagttg tcaaaagttc 540
2


CA 02408073 2002-10-28
aaacaaaagt ctagttggga ttttttacca aagcagcata atatgtgtta tataaacata 600
ataatactca gatatccaaa tgttcagata gcatttttca taatgaatgt tctctttttt 660
ttggtaatag tgtagaagtg atctggttct tacaatggga gatgaagaac atttattatt 720
gggttactac taaccctgtc ccaagaatag taatatcacc tctagttata agccagcaac 780
aggaactttt gtgaagacac attcatctct acagaacttc agattaaata taatctagat 840
taatgactga gaataagatc cacatttgaa ctcattccta agtgaacatg gacgtaccca 900
gttatacaaa gtacttctgt tggtcacaga aacatgacca gattttgcat atctccaggt 960
agggaactaa gtagactacc ttatcaccgg ctaagaaaac ttgctactaa actattaggc 1020
catcaatggg ctggaataaa aaccgagaag tttttcccag gacgtctcat gtttggccct 1080
ttagaattgg ggtagaaatc agaaatgaga tgaggggaag aagcaaggag tctaaggccc 1140
tagcgatttg ggcatctgcc acattggttc atattcagaa agtgttatct cattgattat 1200
attcttgtta agcaaatctc cttaagtaat tattattcaa ataagattat actcatacat 1260
ctatatgtca ctgttttaaa gagatattta atttttaatg tgtgttacat ggtctgtaaa 1320
tatttgtatt taaaaatgcc atgcattagg ctttggaaat ttaatgttag ttgaaatgta 1380
aaatgtgaaa actttagatc atttgtagta ataaatattt ttaacttcat tcatacaatt 1440
aagtttatct gacaataaaa gctctgactg aaaaaaaaaa aaaaaa 1486
<210> 7
<211> 17
<212> PRT
<213> Homo Sapiens
<400> 7
Lys Leu Ile His Gly Ser Gly Glu Glu Thr Ser Lys Glu Ala Lys Tle
1 5 10 15
Arg
<210> 8
<211> 19
<212> PRT
<2l3> Homo Sapiens
<400> 8
Gln Arg Pro Thr Asn Leu Arg Arg Arg Ser Arg Ser Phe Thr Cys Asn
1 5 10 15
Glu Phe Gln
<210> 9
<21l> 39
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:PCR Primer
<400> 9
gttcggatcc gagagaagat ggaaacaaca ttgcttttc 39
<210> 10
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:PCR Primer
<400> 10
gtgctcgagt taacataaac atgcgatatg 30
3


CA 02408073 2002-10-28
<210> l1
<211> 241
<212> DNA
<213> Homo sapiens
<400> 11
gaggaaaatc tggagttctg gatagcctgt gaagatttca agaaaagcaa gggacctcaa 60
l0 caaattcacc ttaaagcaaa agcaatatat gagaaattta tacagactga tgccccaaaa 120
gaggttaacc ttgattttca cacaaaagaa gtcattacaa acagcatcac tcaacctacc 180
ctccacagtt ttgatgctgc acaaagcaga gtgtatcagc tcatggaaaa cgacagctat 240
c 241
<210> 12
<211> 81
<212> PRT
<213> Homo sapiens
<400> 12
Leu Glu Glu Asn Leu Glu Phe Trp Ile A1a Cys Glu Asp Phe Lys Lys
1 5 10 Z5
Ser Lys Gly Pro Gln Gln Ile His Leu Lys Ala Lys Ala Ile Tyr Glu
20 25 30
Lys Phe Ile Gln Thr Asp Ala Pro Lys Glu Val Asn Leu Asp Phe His
40 45
Thr Lys Glu Val Ile Thr Asn Ser Ile Thr Gln Pro Thr Leu His Ser
50 55 60
Phe Asp Ala Ala Gln Ser Arg Val Tyr Gln Leu Met Glu Asn Asp Ser
65 70 75 80
Tyr
<210> 13


<211> 69


<212> PRT


<213> Homo Sapiens



<400> 13


Gln Pro Leu HisSer AspAla AlaGlnSer ArgVal Tyr
Thr Phe Gln


1 5 10 15


50Leu Met Gln AspSer ThrArg PheLeuLys SerAsp Ile
Glu Tyr Tyr


20 25 30


Leu Asp Met GluGly ProGln ArgProThr AsnLeu Arg
Leu Arg Arg


35 40 45



Arg Ser Ser PheThr AsnGlu PheGlnAsp ValGln Ser
Arg Cys Asp


50 55 60


Val Ala Trp Leu
Ile


6065


<210> 14
<211> 21
<212> DNA
<213> Artificial Sequence
4


CA 02408073 2002-10-28
<220>
<223> Description of Artificial Sequence:PCR Primer
<400> 14
atagcctgtg aagatttcaa g 21
<210> 15
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:PCR Primer
25
<400> 15
tggcaacatc tgattgtaca t 21
<210> 16
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:PCR Primer
<400> 16
aagtttgtca taaaaatgag c 21
<210> 17
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:PCR Primer
<400> 17
ttaacataaa catgcgatat g 21
<210> 18
<211> 1840
<212> DNA
<213> Homo sapiens
<400> 18
gcagagacag aaagaaacgc agctcttgac tgcttttttg taaacattac tgtaagagtt 60
gtgataactt tttattctac tatgtatatg tatggaatag tattaataaa tgaactaggg 120.
aaggatgtaa taaattagac atctcttcat tttagagaga agatggaaac aacattgctt 180
ttcttttctc aaataaatat gtgtgaatca aaagaaaaaa cttttttcaa gttaatacat 240
ggttcaggaa aagaagaaac aagcaaagaa gccaaaatca gagctaagga aaaaagaaat 300
agactaagtc ttcttgtgca gaaacctgag tttcatgaag acacccgctc cagtagatct 360
gggcacttgg ccaaagaaac aagagtctcc cctgaagagg cagtgaaatg gggtgaatca 420
tttgacaaac tgctttccca tagagatgga ctagaggctt ttaccagatt tcttaaaact 480
gaattcagtg aagaaaatat tgaattttgg atagcctgtg aagatttcaa gaaaagcaag 540
ggacctcaac aaattcacct taaagcaaaa gcaatatatg agaaatttat acagactgat 600
gccccaaaag aggttaacct cgattttcac acaaaagaag tcattacaaa cagcatcact 660
caacctaccc tccacagttt tgatgctgca caaagcagag tgtatcagct catggaacaa 720
gacagttata cacgttttct gaaatctgac atctatttag acttgatgga aggaagacct 780
cagagaccaa caaatcttag gagacgatca cgctcattta cctgcaatga attccaagat 840
gtacaatcag atgttgccat ttggttataa agaaaattga ttttgctcat ttttatgaca 900
aacttataca tctgcttcta acatatcgca tgtttatgtt aagatttggt cccatccttt 960
5


CA 02408073 2002-10-28
aaactgaaat atgtcatgtg aaattatttt aaaaatgtaa aaacaaaact ttctgctaac 1020
aaaatacata cagtatctgc cagtatattc tgtaaaacct tctatttgat gtcattccat 1080
ttataatcag aaaaaaaact tatttcttaa tcaaaaggca gtacaaaaaa agtaataatg 1140
ttttataaga ttgtagagtt aagtaaaagt taagcttttg caaagttgtc aaaagttcaa 1200
acaaaagtct agttgggatt ttttaccaaa gcagcataat atgtgttata taaacataat 1260
aatactcaga tatccaaatg ttcagatagc atttttcata atgaatgttc tctttttttt 1320
ggtaatagtg tagaagtgat ctggttctta caatgggaga tgaagaacat ttattattgg 1380
gttactacta accctgtccc aagaatagta atatcacctc tagttataag ccagcaacag 1440
gaacttttgt gaagacacat tcatctctac agaacttcag attaaatata atctagatta 1500
atgactgaga ataagatcca catttgaact cattcctaag tgaacatgga cgtacccagt 1560
tatacaaagt acttctgttg gtcacagaaa catgaccaga ttttgcatat ctccaggtag 1620
ggaactaagt agactacctt atcaccggct aagaaaactt gctactaaac tattaggcca 1680
tcaatgggct ggaataaaaa ccgagaagtt tttcccagga cgtctcatgt ttggcccttt 1740
agaattgggg tagaaatcag aaatgagatg aggggaagaa gcaaggagtc taaggcccta 1800
gcgatttggg catctgccac attggttcat attcagaaag 1840
<210> 19
<211> 2144
<212> DNA
<213> Homo sapiens
<400> 19
gcagagacagaaagaaacgcagctcttgactgcttttttgtaaacattactgtaagagtt60


gtgataactttttattctactatgtatatgtatggaatagtattaataaatgaactaggg120


aaggatgtaataaattagacatctcttcattttagagagaagatggaaacaacattgctt180


ttcttttctcaaataaatatgtgtgaatcaaaagaaaaaacttttttcaagttaatacat240


ggttcaggaaaagaagaaacaagcaaagaagccaaaatcagagctaaggaaaaaagaaat300


agactaagtcttcttgtgcagaaacctgagtttcatgaagacacccgctccagtagatct360


gggcacttggccaaagaaacaagagtctcccctgaagaggcagtgaaatggggtgaatca420


tttgacaaactgctttcccatagagatggactagaggcttttaccagatttcttaaaact480


gaattcagtgaagaaaatattgaattttggatagcctgtgaagatttcaagaaaagcaag540


ggacctcaacaaattcaccttaaagcaaaagcaatatatgagaaatttatacagactgat600


gccccaaaagaggttaacctcgattttcacacaaaagaagtcattacaaacagcatcact660


caacctaccctccacagttttgatgctgcacaaagcagagtgtatcagctcatggaacaa720


gacagttatacacgttttctgaaatctgacatctatttagacttgatggaaggaagacct780


cagagaccaacaaatcttaggagacgatcacgctcatttacctgcaatgaattccaagat840


gtacaatcagatgttgccatttggttataaagaaaattgattttgctcatttttatgaca900


aacttatacatctgcttctaacatatcgcatgtttatgttaagatttggtcccatccttt960


aaactgaaatatgtcatgtgaaattattttaaaaatgtaaaaacaaaactttctgctaac1020


aaaatacatacagtatctgccagtatattctgtaaaaccttctatttgatgtcattccat1080


ttataatcagaaaaaaaacttatttcttaatcaaaaggcagtacaaaaaaagtaataatg1140


ttttataagattgtagagttaagtaaaagttaagcttttgcaaagttgtcaaaagttcaa1200


acaaaagtctagttgggattttttaccaaagcagcataatatgtgttatataaacataat1260


aatactcagatatccaaatgttcagatagcatttttcataatgaatgttctctttttttt1320


ggtaatagtgtagaagtgatctggttcttacaatgggagatgaagaacatttattattgg1380


gttactactaaccctgtcccaagaatagtaatatcacctctagttataagccagcaacag1440


gaacttttgtgaagacacattcatctctacagaacttcagattaaatataatctagatta1500


atgactgagaataagatccacatttgaactcattcctaagtgaacatggacgtacccagt1560


tatacaaagtacttctgttggtcacagaaacatgaccagattttgcatatctccaggtag1620


ggaactaagtagactaccttatcaccggctaagaaaacttgctactaaactattaggcca1680


tcaatgggctggaataaaaaccgagaagtttttcccaggacgtctcatgtttggcccttt1740


agaattggggtagaaatcagaaatgagatgaggggaagaagcaaggagtctaaggcccta1800


gcgatttgggcatctgccacattggttcatattcagaaagtgttatctcattgattatat1860


tcttgttaagcaaatctccttaagtaattattattcaaataagattatactcatacatct1920


atatgtcactgttttaaagagatatttaatttttaatgtgtgttacatggtctgtaaata1980


tttgtatttaaaaatgccatgcattaggctttggaaatttaatgttagttgaaatgtaaa2040


atgtgaaaactttagatcatttgtagtaataaatatttttaacttcattcatacaattaa2100


gtttatctgacaataaaagctctgactgaaaaaaaaaaaaaaaa 2144



<2l0> 20


<211> 235


<212> PRT


<213> HomoSapiens




CA 02408073 2002-10-28
<400> 20
Met Glu Thr Thr Leu Leu Phe Phe Ser Gln Ile Asn Met Cys Glu Ser
1 5 10 15
Lys Glu Lys Thr Phe Phe Lys Leu Ile His Gly Ser Gly Lys Glu Glu
20 25 30
Thr Ser Lys Glu Ala Lys Ile Arg Ala Lys Glu Lys Arg Asn Arg Leu
35 40 45
Ser Leu Leu Val Gln Lys Pro Glu Phe His Glu Asp Thr Arg Ser Ser
50 55 60
Arg Ser Gly His Leu Ala Lys Glu Thr Arg Val Ser Pro Glu Glu Ala
65 70 75 80


Val LysTrp GlyGluSer PheAspLys LeuLeuSer HisArgAsp Gly


85 90 95


Leu GluAla PheThrArg PheLeuLys ThrGluPhe SerGluGlu Asn


100 105 110


Ile GluPhe TrpIleAla CysGluAsp PheLysLys SerLysGly Pro


115 120 125



Gln GlnIle HisLeuLys AlaLysAla IleTyrGlu LysPheIle Gln


130 135 140


Thr AspAla ProLysGlu ValAsnLeu AspPheHis ThrLysGlu Val


l45 150 155 160


Ile ThrAsn SerIleThr GlnProThr LeuHisSer PheAspAla Ala


165 170 175


Gln SerArg ValTyrGln LeuMetGlu GlnAspSer TyrThrArg Phe


180 185 l90


Leu Lys Ser Asp Ile Tyr Leu Asp Leu Met Glu Gly Arg Pro Gln Arg
195 200 205
Pro Thr Asn Leu Arg Arg Arg Ser Arg Ser Phe Thr Cys Asn Glu Phe
210 215 220
Gln Asp Val Gln Ser Asp Val Ala Ile Trp Leu
225 230 235
<210> 21
<211> 205
<212> PRT
<213> Homo Sapiens
<400> 21
Met Cys Lys Gly Leu Ala Gly Leu Pro Ala Ser Cys Leu Arg Ser Ala
1 5 10 15
Lys Asp Met Lys His Arg Leu Gly Phe Leu Leu Gln Lys Ser Asp Ser
20 25 30
Cys Glu His Asn Ser Ser His Asn Lys Lys Asp Lys Val Val Tle Cys
35 40 45
Gln Arg Val.Ser Gln Glu Glu Val Lys Lys Trp Ala Glu Ser Leu Glu
50 55 60
Asn Leu Ile Ser His Glu Cys Gly Leu Ala Ala Phe Lys Ala Phe Leu
7


CA 02408073 2002-10-28
65 70 75 80


Lys SerGluTyr SerGluGlu AsnIle AspPheTrp IleSerCys Glu


85 90 95



Glu TyrLysLys IleLysSer ProSer LysLeuSer ProLysAla Lys


100 105 110


Lys IleTyrAsn GluPheIle SerVal GlnAlaThr LysGluVal Asn


115 120 125


Leu AspSerCys ThrArgGlu GluThr SerArgAsn MetLeuGlu Pro


130 135 140


15Thr IleThrCys PheAspGlu AlaGln LysLysIle PheAsnLeu Met


145 150 155 160


Glu LysAspSer TyrArgArg PheLeu LysSerArg PheTyrLeu Asp


165 l70 175



Leu ValAsnPro SerSerCys GlyAla GluLysGln LysGlyAla Lys


180 185 190


Ser Ser Ala Asp Cys Ala Ser Leu Val Pro Gln Cys Ala
195 200 205
<210> 22
<211> 181
<212> PRT
<213> Homo Sapiens
<400> 22
Met Cys Lys Gly Leu Ala Ala Leu Pro His Ser Cys Leu Glu Arg Ala
1 5 10 15
Lys Glu Ile Lys Ile Lys Leu Gly Ile Leu Leu Gln Lys Pro Asp Ser
20 25 30
40Val Gly Leu ValIlePro Tyr G1uLysPro GluLysPro Ala
Asp Asn


35 40 45


Lys ThrGlnLys ThrSerLeu AspGlu AlaLeuGln TrpArgAsp Ser


50 55 60



Leu AspLysLeu LeuGlnAsn AsnTyr GlyLeuAla SerPheLys Ser


65 70 75 80


Phe LeuLysSer GluPheSer GluGlu AsnLeuGlu PheTrpIle Ala


85 90 95


Cys GluAspTyr LysLysIle~LysSer ProAlaLys MetAlaGlu Lys


100 105 110


55Ala LysGlnTle TyrGluGlu PheIle GlnThrGlu AlaProLys Glu


115 120 125


Val Asn Ile Asp His Phe Thr Lys Asp Ile Thr Met Lys Asn Leu Val
130 135 140
Glu Pro Ser Leu Ser Ser Phe Asp Met Ala Gln Lys Arg Ile His Ala
145 150 155 160
Leu Met Glu Lys Asp Ser Leu Pro Arg Phe Val Arg Ser Glu Phe Tyr
165 170 175
8


CA 02408073 2002-10-28
Gln Glu Leu I1e Lys
180
<210> 23
<211> 204
<212> PRT
<213> Homo sapiens
<400> 23
Met Cys Arg Thr Leu Ala Ala Phe Pro Thr Thr Cys Leu Glu Arg Ala
1 5 10 15
Lys Glu Phe Lys Thr Arg Leu Gly Ile Phe Leu His Lys Ser Glu Leu
20 25 30
Gly CysAspThr GlySer ThrGlyLys PheGluTrp GlySer LysHis


35 40 45


Ser LysGluAsn ArgAsn PheSerGlu AspValLeu GlyTrp ArgGlu


50 55 60


Ser PheAspLeu LeuLeu SerSerLys AsnGlyVal AlaAla PheHis


65 70 75 80



Ala PheLeuLys ThrGlu PheSerGlu GluAsnLeu GluPhe TrpLeu


85 90 95


Ala CysGluGlu PheLys LysIleArg SerAlaThr LysLeu AlaSer


100 105 110


Arg AlaHisG1n IlePhe GluGluPhe IleCysSer GluAla ProLys


l15 120 125


Glu ValAsnIle AspHis GluThrArg GluLeuThr ArgMet AsnLeu


130 135 140


Gln ThrAlaThr AlaThr CysPheAsp AlaAlaGln GlyLys ThrArg


145 150 155 l60



Thr LeuMetGlu LysAsp SerTyrPro ArgPheLeu LysSer ProAla


165 170 175


Tyr ArgAspLeu AlaAla GlnAlaSer AlaAlaSer AlaThr LeuSer


180 185 190


Ser CysSerLeu AspGlu ProSerHis ThrAlaThr


195 200



<210>
24


<211>
211


<212>
PRT


<2I3> Sapiens
Homo



<400>
24


Met GlnSerAla MetPhe LeuAlaVal GlnHisAsp CysArg ProMet


1 5 10 15


Asp LysSerAla GlySer GlyHisLys SerGluGlu LysArg GluLys


20 25 30


Met Lys Arg Thr Leu Leu Lys Asp Trp Lys Thr Arg Leu Ser Tyr Phe
35 40 45
Leu Gln Asn Ser Ser Thr Pro Gly Lys Pro Lys Thr G1y Lys Lys Ser
9


CA 02408073 2002-10-28
50 55 60


Lys GlnGlnAla PheIle LysProSer ProGluGlu AlaGln LeuTrp


65 70 75 80



Ser GluAlaPhe AspGlu LeuLeuAla SerLysTyr GlyLeu AlaAla


85 90 95


Phe ArgAlaPhe LeuLys SerGluPhe CysGluGlu AsnIle G1uPhe


100 105 110


Trp LeuA1aCys GluAsp PheLysLys ThrLysSer ProGln LysLeu


115 120 125


15Ser SerLysAla ArgLys IleTyrThr AspPheIle GluLys GluAla


I30 l35 140


Pro LysGluTle AsnI1e AspPheGln ThrLysThr LeuIle AlaGln


145 l50 155 160



Asn IleGlnGlu AlaThr SerGlyCys PheThrThr AlaGln LysArg


165 170 l75


Val Tyr Ser Leu Met Glu Asn Asn Ser Tyr Pro Arg Phe Leu Glu Ser
180 185 190
Glu Phe Tyr Gln Asp Leu Cys Lys Lys Pro Gln Ile Thr Thr Glu Pro
l95 200 205
His Ala Thr
210
<210> 25


35<2ll> 199


<212> PRT


<213> Homo sapiens


<400> 25


40Met Pro Met PhePhe SerAlaAsn ProLysGlu LeuLysGly Thr
Gly


1 5 10 l5


Thr His Leu LeuAsp AspLysMet GlnLysArg ArgProLys Thr
Ser


20 25 30


45


Phe Gly Asp MetLys AlaTyrLeu ArgSerMet IleProHis Leu
Met


40 45


Glu Ser Met LysSer SerLysSer LysAspVal LeuSerAla Ala
Gly


5050 55 60


Glu Val Met Gln Trp Ser Gln Ser Leu Glu Lys Leu Leu Ala Asn Gln
65 70 75 80
55 Thr Gly Gln Asn Val Phe Gly Ser Phe Leu Lys Ser Glu Phe Ser Glu
85 90 95
Glu Asn Ile Glu Phe Trp Leu Ala Cys Glu Asp Tyr Lys Lys Thr Glu
100 105 110
Ser Asp Leu Leu Pro Cys Lys A1a Glu Glu Ile Tyr Lys Ala Phe Val
115 120 125
His Ser Asp Ala Ala Lys Gln Ile Asn Ile Asp Phe Arg Thr Arg Glu
130 135 140


CA 02408073 2002-10-28
Ser Thr Ala Lys Lys Ile Lys Ala Pro Thr Pro Thr Cys Phe Asp Glu
145 150 155 160
Ala Gln Lys Val Ile Tyr Thr Leu Met Glu Lys Asp Ser Tyr Pro Arg
165 170 175
Phe Leu Lys Ser His Ile Tyr Leu Asn Leu Leu Asn Asp Leu Gln Ala
180 185 190
Asn Ser Leu Lys Leu Val Pro
195
<210> 26
<211> 167
<212> PRT
<213> Homo sapiens
<400> 26
Met Glu His Ile His Asp Ser Asp Gly Ser Ser Ser Ser Ser His Gln
1 5 IO 15
Ser Leu Lys Ser Thr Ala Lys Trp Ala Ala Ser Leu Glu Asn Leu Leu
20 25 30
Glu Asp Pro Glu Gly Val Lys Arg Phe Arg Glu Phe Leu Lys Lys Glu
40 45
Phe Ser Glu Glu Asn Val Leu Phe Trp Leu Ala Cys Glu Asp Phe Lys
30 50 55 60
Lys Met Gln Asp Lys Thr Gln Met G1n Glu Lys Ala Lys Glu Ile Tyr
65 70 75 80
35 Met Thr Phe Leu Ser Ser Lys Ala Ser Ser Gln Val Asn Val Glu G1y
85 90 95
Gln Ser Arg Leu Asn Glu Lys Ile Leu Glu Glu Pro His Pro Leu Met
100 105 110
Phe Gln Lys Leu Gln Asp Gln Ile Phe Asn Leu Met Lys Tyr Asp Ser
115 120 125
Tyr Ser Arg Phe Leu Lys Ser Asp Leu Phe Leu Lys His Lys Arg Thr
130 135 140
Glu Glu Glu Glu Glu Asp Leu Pro Asp Ala Gln Thr Ala Ala Lys Arg
145 150 155 160
Ala Ser Arg Ile Tyr Asn Thr
165
<210> 27
<211> 180
<212> PRT
<213> Rattus norvegicus
<400> 27
Met Ala Ala Leu Leu Met Pro Arg Arg Asn Lys Gly Met Arg Thr Arg
I 5 10 15
Leu Gly Cys Leu Ser His Lys Ser Asp Ser Cys Ser Asp Phe Thr Ala
20 25 30
Ile Leu Pro Asp Lys Pro Asn Arg Ala Leu Lys Arg Leu Ser Thr Glu
11


CA 02408073 2002-10-28
35 40 45
Glu Ala Thr Arg Trp Ala Asp Ser Phe Asp Val Leu Leu Ser His Lys
50 55 60
Tyr Gly Val Ala Ala Phe Arg A1a Phe Leu Lys Thr Glu Phe Ser Glu
65 70 75 80
Glu Asn Leu Glu Phe Trp Leu Ala Cys Glu Glu Phe Lys Lys Thr Arg
85 90 95
Ser Thr Ala Lys Leu Val Thr Lys Ala His Arg Ile Phe Glu Glu Phe
100 105 110
Val Asp Val Gln Ala Pro Arg Glu Val Asn Ile Asp Phe Gln Thr Arg
115 120 125
Glu Ala Thr Arg Lys Asn Met Gln Glu Pro Ser Leu Thr Cys Phe Asp
130 135 140
Gln Ala Gln Gly Lys Val His Ser Leu Met Glu Lys Asp Ser Tyr Pro
145 150 155 160
Arg Phe Leu Arg Ser Lys Met Tyr Leu Asp Leu Leu Ser Gln Ser Gln
165 170 175
Arg Arg Leu Ser
180
<210> 28
<211> 519
<212> PRT
<213> Homo sapiens
<400> 28
Met Phe Glu Thr Glu Ala Asp Glu Lys Arg Glu Met Ala Leu Glu Glu
1 5 10 15
Gly Lys Gly Pro Gly Ala Glu Asp Ser Pro Pro Ser Lys Glu Pro Ser
20 25 30
Pro Gly Gln Glu Leu Pro Pro Gly Gln Asp Leu Pro Pro Asn Lys Asp
35 40 45
Ser Pro Ser Gly Gln Glu Pro Ala Pro Ser Gln Glu Pro Leu Ser Ser
55 60
Lys Asp Ser Ala Thr Ser Glu Gly Ser Pro Pro Gly Pro Asp Ala Pro
50 65 70 75 80
Pro Ser Lys Asp Val Pro Pro Cys Gln Glu Pro Pro Pro Ala Gln Asp
85 90 95
Leu Ser Pro Cys Gln Asp Leu Pro Ala Gly Gln Glu Pro Leu Pro His
100 105 110
Gln Asp Pro Leu Leu Thr Lys Asp Leu Pro Ala Ile Gln Glu Ser Pro
115 120 125
Thr Arg Asp Leu Pro Pro Cys Gln Asp Leu Pro Pro Ser Gln Val Ser
130 135 140
Leu Pro Ala Lys Ala Leu Thr Glu Asp Thr Met Ser Ser Gly Asp Leu
145 150 155 160
12


CA 02408073 2002-10-28
Leu Ala Ala Thr Gly Asp P.ro Pro Ala Ala Pro Arg Pro Ala Phe Val
165 170 l75
Ile Pro Glu Val Arg Leu Asp Ser Thr Tyr Ser Gln Lys Ala Gly Ala
180 185 190
Glu Gln Gly Cys Ser Gly Asp Glu Glu Asp Ala Glu Glu Ala Glu Glu
195 200 205
Val Glu Glu Gly Glu Glu Gly Glu Glu Asp Glu Asp Glu Asp Thr Ser
210 215 220
Asp Asp Asn Tyr Gly Glu Arg Ser Glu Ala Lys Arg Ser Ser Met Ile
225 230 235 240
Glu Thr Gly Gln Gly Ala Glu Gly Gly Leu Ser Leu Arg Val Gln Asn
245 250 255
Ser Leu Arg Arg Arg Thr His Ser Glu Gly Ser Leu Leu Gln G1u Pro
260 265 270
Arg Gly Pro Cys Phe Ala Ser Asp Thr Thr Leu His Cys Ser Asp Gly
275 280 285
Glu Gly A1a Ala Ser Thr Trp Gly Met Pro Ser Pro Ser Thr Leu Lys
290 295 300
Lys Glu Leu Gly Arg Asn Gly Gly Ser Met His His Leu Ser Leu Phe
305 310 315 320
Phe Thr Gly His Arg Lys Met Ser Gly A1a Asp Thr Val Gly Asp Asp
325 330 335
Asp Glu Ala Ser Arg Lys Arg Lys Ser Lys Asn Leu Ala Lys Asp Met
340 345 350
Lys Asn Lys Leu Gly Ile Phe Arg Arg Arg Asn Glu Ser Pro Gly Ala
355 360 365
Pro Pro A1a Gly Lys Ala Asp Lys Met Met Lys Ser Phe Lys Pro Thr
370 375 380
Ser Glu Glu Ala Leu Lys Trp Gly Glu Ser Leu Glu Lys Leu Leu Val
385 390 395 400
His Lys Tyr Gly Leu Ala Val Phe Gln Ala Phe Leu Arg Thr Glu Phe
405 410 415
Ser G1u Glu Asn Leu Glu Phe Trp Leu Ala Cys Glu Asp Phe Lys Lys
420 425 430
Val Lys Ser Gln Ser Lys Met Ala Ser Lys Ala Lys Lys Ile Phe Ala
435 440 445
Glu Tyr Ile Ala Ile Gln Ala Cys Lys Glu Val Asn Leu Asp Ser Tyr
450 455 460
Thr Arg Glu His Thr Lys Asp Asn Leu Gln Ser Val Thr Arg Gly Cys
465 470 475 480
Phe Asp Leu Ala Gln Lys Arg Ile Phe Gly Leu Met Glu Lys Asp Ser
485 490 495
Tyr Pro Arg Phe Leu Arg Ser Asp Leu Tyr Leu Asp Leu Ile Asn Gln
500 505 510
13


CA 02408073 2002-10-28
Lys Lys Met Ser Pro Pro Leu
515
<210> 29


<211> 159


<212> PRT


<213> Homo sapiens


10<400> 29


Met Ser Arg AsnCysTrp IleCys LysMetCys ArgAspGlu Ser
Arg


1 5 10 15


Lys Arg Pro SerAsnLeu ThrLeu GluGluVal LeuGlnTrp Ala
Pro


20 25 30


Gln Ser Glu AsnLeuMet AlaThr LysTyrGly ProValVal Tyr
Phe


35 40 45


20Ala Ala Leu LysMetGlu HisSer AspGluAsn IleGlnPhe Trp
Tyr


50 55 60


Met Ala Glu ThrTyrLys LysIle AlaSerArg TrpSerArg Ile
Cys


65 70 75 80



Ser Arg Lys LysLeuTyr LysIle TyrIleGln ProGlnSer Pro
Ala


85 90 95


Arg Glu Asn IleAspSer SerThr ArgGluThr IleIleArg Asn
Ile


100 105 110


Ile Gln Pro ThrGluThr CysPhe GluGluAla GlnLysIle Val
Glu


115 120 125


35Tyr Met Met GluArgAsp SerTyr ProArgPhe LeuLysSer Glu
His


130 135 140


Met Tyr Lys LeuLeuLys ThrMet GlnSerAsn AsnSerPhe
Gln


145 150 155



<210> 30


<211> 24


<212> DNA


45<213> Artificial Sequence


<220>


<223> Descriptio n Sequence:
of Sequencing
Artificial


Primer



<400> 30


ctactatgta atgga 24
tatgt atag


<210> 31
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Sequencing
Primer
<400> 31
gaattttgga tagcctgtga ag 22
14


CA 02408073 2002-10-28
<210> 32
<211> 24 .
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Sequencing
Primer
<400> 32
cgatcacgct catttacctg caat 24
<210> 33
<2l1> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Sequencing
Primer
<400> 33
ctgaaatatg tcatgtgaaa ttat 24
<210> 34
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Sequencing
Primer
<400> 34
cataaacatg cgatatgtta g 21
<210> 35
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Sequencing
Primer
<400> 35
tggggcatca gtctgtataa a 21
<210> 36
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Sequencing
Primer
<400> 36
cctgaaccat gtattaactt g 21
15


CA 02408073 2002-10-28
<210> 37
<211> 17
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Sequencing
Primer
<400> 37
gttttcccag tcacgac 17
<210> 38
<211> 17
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Sequencing
Primer
<400> 38
caggaaacag ctatgac 17
16