Note: Descriptions are shown in the official language in which they were submitted.
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
METHODS FOR REFOLDING PROTEINS CONTAINING
FREE CYSTEINE RESIDUES
Field of the Invention
The present invention relates generally to methods of making proteins and more
specifically to
recombinant proteins containing at least one "free" cysteine residue, i.e., a
cysteine residue that does not
participate in a disulfide bond.
Background of the Invention
Protein therapeutics generally must be administered to patients by injection.
Most protein
therapeutics are cleared rapidly from the body, necessitating frequent, often
daily, injections. There is
considerable interest in the development of methods to prolong the circulating
half-lives of protein
therapeutics in the body so that the proteins do not have to be injected
frequently. Covalent modification of
proteins with polyethylene glycol (PEG) has proven to be a useful method to
extend the circulating half-
lives of proteins in the body (Abuchowski et al., 1984; Hershfield, 1987;
Meyers et al., 1991). Covalent
attachment of PEG to a protein increases the protein's effective size and
reduces its rate of clearance from
the body. PEGs are commercially available in several sizes, allowing the
circulating half-lives of PEG-
modified proteins to be tailored for individual indications through use of
different size PEGs. Other
documented in vivo benefits of PEG modification are an increase in protein
solubility and stability, and a
decrease in protein immunogenicity (Katre et al., 1987; Katre, 1990).
One known method for PEGylating proteins covalently attaches PEG to cysteine
residues using
cysteine-reactive PEGs. A number of highly specific, cysteine-reactive PEGs
with different reactive groups
(e.g., maleimide, vinylsulfone) and different size PEGs (2-40 kDa, single or
branched chain) are
commercially available. At neutral pH, these PEG reagents selectively attach
to "free" cysteine residues,
i.e., cysteine residues not involved in disulfide bonds. Cysteine residues in
most proteins participate in
disulfide bonds and are not available for PEGylation using cysteine-reactive
PEGs. Through in vitro
mutagenesis using recombinant DNA techniques, additional cysteine residues can
be introduced anywhere
into the protein. The newly added "free" or "non-natural" cysteines can serve
as sites for the specific
attachment of a PEG molecule using cysteine-reactive PEGs. The added "free" or
"non-natural" cysteine
residue can be a substitution for an existing amino acid in a protein, added
preceding the amino-terminus of
the mature protein or after the carboxy-terminus of the mature protein, or
inserted between two normally
adjacent amino acids in the protein. Alternatively, one of two cysteines
involved in a native disulfide bond
may be deleted or substituted with another amino acid, leaving a native
cysteine (the cysteine residue in the
protein that normally would form a disulfide bond with the deleted or
substituted cysteine residue) free and
available for chemical modification. Preferably the amino acid substituted for
the cysteine would be a
neutral amino acid such as serine or alanine. For example, human growth
hormone (hGH) has two disulfide
bonds that can be reduced and alkylated with iodoacetamide without impairing
biological activity (Bewley
et al., (1969). Each of the four cysteines would be reasonable targets for
deletion or substitution by another
amino acid.
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
2
Several naturally occurring proteins are known to contain one or more "free"
cysteine residues.
Examples of such naturally occurring proteins include human Interleukin (IL)-2
(Wang et al., 1984), beta
interferon (Mark et al., 1984; 1985), G-CSF (Lu et al., 1989) and basic
fibroblast growth factor (bFGF,
Thompson, 1992). IL-2, Granulocyte Colony-Stimulating Factor (G-CSF) and beta
interferon (IFN-(3)
contain an odd number of cysteine residues, whereas basic fibroblast growth
factor contains an even number
of cysteine residues.
Expression of recombinant proteins containing free cysteine residues has been
problematic due to
reactivity of the free sulfhydryl at physiological conditions. Several
recombinant proteins containing free
cysteines have been expressed cytoplasmically, i.e., as intracellular
proteins, in bacteria such as E. coli.
Examples include natural proteins such as IL-2, beta interferon, G-CSF, and
engineered cysteine muteins of
IL-2 (Goodson and Katre, 1990), IL-3 (Shaw et al., 1992), Tumor Necrosis
Factor Binding Protein (Tuma et
al., 1995), Insulin-like Growth Factor-I (IGF-I, Cox and McDermott, 1994),
Insulin-like Growth Factor
binding protein-1 (IGFBP-1, Van Den Berg et al., 1997) and protease nexin and
related proteins (Braxton,
1998). All of these proteins were predominantly insoluble when expressed
intracellularly in E. coli. The
insoluble proteins were largely inactive and needed to be refolded in order to
regain significant biological
activity. In some cases the reducing agent dithiothreitol (DTT) was used to
aid solubilization and/or
refolding of the insoluble proteins. Purified, refolded IL-2, G-CSF and beta
interferon proteins are unstable
and lose activity at physiological pH, apparently due to disulfide
rearangements involving the free cysteine
residue (Wang et al., 1984; Mark et al., 1984; 1985; Oh-eda et al., 1990;
Arakawa et al., 1992).
Replacement of the free cysteine residue in these proteins with serine,
resulted in a protein that was more
stable at physiological pH (Wang et al., 1984; Market al., 1984; 1985; Arakawa
et al., 1993).
A second known method for expressing recombinant proteins in bacteria is to
secrete them into the
periplasmic space or into the media. It is known that certain recombinant
proteins such as GH are expressed
in a soluble active form when they are secreted into the E. coil periplasm,
whereas they are insoluble when
expressed intracellularly in E. coli. Secretion is achieved by fusing DNA
sequences encoding GH or other
proteins of interest to DNA sequences encoding bacterial signal sequences such
as those derived from the
stll (Fujimoto et al., 1988) and ompA proteins (Ghrayeb et al., 1984).
Secretion of recombinant proteins in
bacteria is desirable because the natural N-terminus of the recombinant
protein can be maintained.
Intracellular expression of recombinant proteins requires that an N-terminal
methionine be present at the
amino-terminus of the recombinant protein. Methionine is not normally present
at the amino-terminus of the
mature forms of many human proteins. For example, the amino-terminal amino
acid of the mature form of
human GH is phenylalanine. An amino-terminal methionine must be added to the
amino-terminus of a
recombinant protein, if a methionine is not present at this position, in order
for the protein to be expressed
efficiently in bacteria. Typically addition of the amino-terminal methionine
is accomplished by adding an
ATG methionine codon preceding the DNA sequence encoding the recombinant
protein. The added N-
terminal methionine often is not removed from the recombinant protein,
particularly if the recombinant
protein is insoluble. Such is the case with hGH, where the N-terminal
methionine is not removed when the
protein is expressed intracellularly in E. coli. The added N-terminal
methionine creates a "non-natural"
protein that potentially can stimulate an immune response in a human. In
contrast, there is no added
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
3
methionine on hGH that is secreted into the periplasmic space using stll
(Chang et al., 1987) or ompA
(Cheah et al., 1994) signal sequences; the recombinant protein begins with the
native amino-terminal amino
acid phenylalanine. The native hGH protein sequence is maintained because
bacterial enzymes cleave the
stII-hGH protein (or ompA-hGH protein) between the stII (or ompA) signal
sequence and the start of the
mature hGH protein.
hGH has four cysteines that form two disulfides. hGH can be secreted into the
E. coli periplasm
using stll or ompA signal sequences. The secreted protein is soluble and
biologically active (Hsiung et al.,
1986). The predominant secreted form of hGH is a monomer with an apparent
molecular weight by sodium
dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) of 22 kDa.
Recombinant hGH can be
isolated from the periplasmic space by using an osmotic shock procedure
(Koshland and Botstein, 1980),
which preferentially releases periplasmic, but not intracellular, proteins
into the osmotic shock buffer. The
released hGH protein is then purified by column chromatography (Hsiung et al.,
1986). A large number of
GH mutants have been secreted into the E. coli periplasm. The secreted mutant
proteins were soluble and
could be purified using procedures similar to those used to purify wild type
GH (Cunningham and Wells,
1989; Fuh et al., 1992). Unexpectedly, when similar procedures were used to
secrete GH variants
containing a free cysteine residue (five cysteines; 2N+1), it was discovered
that certain recombinant GH
variants were insoluble or formed multimers or aggregates when isolated using
standard osmotic shock and
purification procedures developed for GH. Very little of the monomeric GH
variant proteins could be
detected by non-reduced SDS-PAGE in the osmotic shock lysates. Insoluble or
aggregated GH variants
have reduced biological activities compared to soluble, properly folded hGH.
Methods for refolding
insoluble, secreted Growth Hormone variants containing a free cysteine residue
into a biologically active
form have not been described.
Alpha interferon (IFN-a2) also contains four cysteine residues that form two
disulfide bonds. IFN-
a2 can be secreted into the E. coli periplasm using the stll signal sequence
(Voss et al., 1994). A portion of
the secreted protein is soluble and biologically active (Voss et al., 1994).
Secreted, soluble recombinant
IFN-a2 can be purified by column chromatography (Voss et al., 1994). When
similar procedures were
attempted to secrete IFN-a2 variants containing a free cysteine residue (five
cysteines; 2N+1), it was
discovered that certain of the recombinant IFN-a2 variants were predominantly
insoluble or formed
multimers or aggregates when isolated using standard purification procedures
developed for IFN-a2.
Insoluble or aggregated IFN-a2 variants have reduced biological activities
compared to soluble, properly
folded IFN-a2. Methods for refolding insoluble, secreted IFN-a2 variants
containing a free cysteine
residue into a biologically active form have not been described.
Human Granulocyte Colony-Stimulating Factor (G-CSF) contains five cysteine
residues that form
two disulfide bonds. The cysteine residue at position 17 in the mature protein
sequence is free. Perez-Perez
et al. (1995) reported that G-CSF could be secreted into the E. coli periplasm
using a variant form of the
ompA signal sequence. However, very little of the ompA-G-CSF fusion protein
was correctly processed to
yield mature G-CSF. The percentage of correctly processed G-CSF could be
improved by co-expressing the
E. coli dnaK and dnaJ proteins in the host cells expressing the ompA-G-CSF
fusion protein (Perez-Perez et
al., 1995). Correctly processed, secreted G-CSF was largely insoluble in all
E. coli strains examined (Perez-
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
4
Perez et al., 1995). Insoluble G-CSF possesses reduced biological activity
compared to soluble, properly
folded G-CSF. When similar procedures were attempted to secrete wild type G-
CSF, G-CSF variants in
which the free cysteine residue was replaced with serine [G-CSF (C17S)], and G-
CSF (Cl7S) variants
containing a free cysteine residue (five cysteines; 2N+1) using the stlI
signal sequence, it was discovered
that the recombinant G-CSF proteins also were predominantly insoluble. Methods
for refolding insoluble,
secreted G-CSF proteins into a biologically active form have not been
described.
Human Granulocyte Macrophage Colony-Stimulating Factor (GM-CSF) contains four
cysteine
residues that form two disulfide bonds. Libbey et al. (1987) and Greenberg et
al. (1988) reported that GM-
CSF could be secreted into the E. coli periplasm using the ompA signal
sequence. Correctly processed,
secreted GM-CSF was insoluble ( Libbey et al., 1987; Greenberg et al., 1988).
Insoluble GM-CSF
possesses reduced biological activity compared to soluble, properly folded GM-
CSF. When similar
procedures were attempted to secrete GM-CSF variants containing a free
cysteine residue (five cysteines;
2N+1) using the stIl signal sequence, it was discovered that the recombinant
GM-CSF proteins also were
predominantly insoluble. Methods for refolding insoluble, secreted GM-CSF
proteins into a biologically
active form have not been described.
US Patent No. 5,206,344 and Goodson and Katre (1990) describe expression and
purification of a
cysteine substitution mutein of IL-2. The IL-2 cysteine mutein was insoluble
when expressed intracellularly
in E. coli. The protein was solubilized by treatment with a denaturing agent
[either 10% sodium dodecyl
sulfate (SDS) or 8M urea] and a reducing agent [100 mM dithiothreitol (DTT)],
refolded and purified by
size-exclusion chromatography and reversed phase HPLC. Expression and
purification of cysteine muteins
of IL-3 are described in US Patent No. 5,166,322. The IL-3 cysteine muteins
also were insoluble when
expressed intracellularly in E. coli. The proteins were solublilized with a
denaturing agent (guanidine) and a
reducing agent (DTT), refolded and purified by reversed phase HPLC. The
purified IL-3 cysteine muteins
were kept in a partially reduced state by inclusion of DTT in the storage
buffers. When the inventors used
only a denaturing agent agent and a reducing agent (DTT) to denature and
refold insoluble cysteine muteins
of GH and G-CSF, it was discovered that the refolded proteins were
heterogeneous, comprising multiple
molecular weight species. Similarly, when the inventors denatured and refolded
insoluble, secreted IFN-a2
cysteine muteins with only a denaturing agent and a reducing agent (DTT),
undetectable levels of properly
folded IFN-a2 cysteine muteins were obtained.
Malik et al. (1992) and Knusli et al. (1992) described conjugation of wild tpe
GM-CSF with
amine-reactive PEG reagents. The amine-PEGylated GM-CSF comprised a
heterogeneous mixture of
different molecular weight PEG-GM-CSF species modified at multiple amino acid
residues (Malik et al.
1992; Knusli et al. , 1992). The various amine-PEGylated GM-CSF species could
not be purified from each
other or from non-PEGylated GM-CSF by conventional chromatography methods,
which prevented specific
activity measurements of the various isoforms from being determined. Clark et
al. (1996) described
conjugation of GH with amine-reactive PEGs. Amine-PEGylyated GH also was
heterogeneous, comprising
a mixture of mutiple molecular weight species modified at multiple amino acid
residues. The amine-
PEGylated GH proteins displayed significantly reduced biological activity
(Clark et al., 1996). Monkarsh et
al. (1997) described amine-PEGylated alpha interferon, which also comprised
multiple molecular weight
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
species modified at different amino acid residues. Amine-PEGylated alpha
interferon also displayed
reduced biological activity. Tanaka et al. (1991) described amine-PEGylated G-
CSF, which also comprised
a heterogeneous mixture of different molecular weight species modified at
different amino acid residues.
Amine-PEGylated G-CSF displayed reduced biological activity (Tanaka et al.,
1991). Kinstler et al. (1996)
5 described a PEGylated G-CSF protein that is preferentially modifed at the
non-natural N-terminal
methionine residue. This protein also displayed reduced biological activity
(Kinstler et al. 1996).
Therefore, despite considerable effort, a need still exists for methods that
allow an insoluble or
aggregated protein containing one or more free cysteine residues to be
refolded into a soluble, biologically
active form in high yield. The present invention satisfies this need and
provides related advantages as well.
Similarly, a need also exists for methods of generating homogeneous
preparations of long acting
recombinant proteins by enhancement of protein molecular weight, such as by
PEGylation.
Summary of the Invention
The present invention generally relates to methods for obtaining refolded,
soluble forms of proteins
having one or more free cysteine residues and which are expressed by a host
cell in an insoluble or
aggregated form. Such proteins include, but are not limited to, members of the
Growth Hormone supergene
family, such as GH, IFN-a2, G-CSF and GM-CSF proteins, and anti-angiogenesis
factors, such as
endostatin and angiostatin. The methods are generally accomplished by (a)
causing a host cell to express a
protein containing a free cysteine residue in an insoluble or aggregated form;
(b) lysing the cell; (c)
solubilizing the insoluble or aggregated protein in the presence of a
denaturing agent, a reducing agent and a
cysteine blocking agent; and (d) refolding the protein by lowering the
concentrations of the denaturing
agent and reducing agents to levels sufficient to allow the protein to
renature to a biologically active form.
Optionally, the soluble, refolded protein is isolated from other proteins in
the refold mixture.
Suitable host cells include bacteria, yeast, insect or mammalian cells.
Preferably, the host cell is a
bacterial cell, particularly E.coli.
Preferably, the soluble, refolded proteins produced by the methods of the
present invention are
recombinant proteins, especially cysteine variants or cysteine muteins of a
protein. As used herein, the
terms "cysteine variant" and "cysteine mutein" are meant to encompass any of
the following changes in a
protein's amino acid sequence: addition of a non-natural cysteine residue
preceding the amino terminus of
the mature protein or following the carboxy-terminus of the mature protein;
substitution of a non-natural
cysteine residue for an existing amino acid in the protein; introduction of a
non-natural cysteine residue
between two normally adjacent amino acids in the protein; or substitution of
another amino acid for a
naturally occurring cysteine residue that normally form a disulfide bond in
the protein. The methods are
useful for producing proteins including, without limitation, GH, G-CSF, GM-CSF
and interferon, especially
alpha interferon, cysteine variants of these proteins, their derivatives or
antagonists. Other proteins for
which the methods are useful include other members of the GH supergene family,
the Transforming Growth
Factor (TGF)-beta superfamily, platelet derived growth factor-A, platelet
derived growth factor-B, nerve
growth factor, brain derived neurotophic factor, neurotrophin-3, neurotrophin-
4, vascular endothelial growth
factor, chemokines, hormones, endostatin, angiostatin, cysteine muteins of
these proteins, or a derivative or
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
6
an antagonist thereof. Cysteine muteins of heavy or light chains of an
immunoglobulin or a derivative
thereof are also contemplated.
As used herein, the term "cysteine blocking agent" means any reagent or
combination of reagents
that result in the formation of a reversibly blocked free cysteine residue in
a protein. Examples of useful
cysteine blocking agents include, but are not limited to, dithiols such as
cystine, cystamine, oxidized
glutathione, dithioglycolic acid and the like, or thiols such as cysteine,
cysteamine, thioglycolic acid, and
reduced glutathione. Preferably, thiols should be used in the presence of an
oxidizing agent. Useful
oxidizing agents include oxygen, iodine, ferricyanide, hydrogen peroxide,
dihydroascorbic acid,
tetrathionate, and O-iodosobenzoate. Optionally, a metal ion such as copper
(Cum) or cobalt (Co++) can be
added to catalyze the oxidation reaction. Although not wishing to be bound by
any particular theory, the
inventors postulate that the cysteine blocking agent forms a mixed disulfide
with the free cysteine residue in
the protein, thus limiting possible disulfide rearrangments that could occur
involving the free cysteine
residue. The mixed disulfide stabilizes the free cysteine residue,
significantly enhancing the yield of
properly folded, biologically active, soluble protein. As used herein,
reducing agents such as DTT and 2-
mercaptoethanol are not considered cysteine blocking agents because they do
not result in the formation of a
reversibly blocked mixed disulfide with the free cysteine residue in the
protein. DTT typically does not
form mixed disulfides with cysteine residues in proteins due to a
thermodynamically preferred
intramolecular bond that forms upon oxidation.
Higher order dimeric and multimeric proteins formed by the covalent
association of two or more of
the refolded proteins via their free cysteine residues also within the present
invention.
The present methods further include various methods of attaching a cysteine-
reactive moiety to the
refolded protein to form modified protein in which the cysteine-reactive
moiety is attached to the refolded
protein through the free cysteine residue(s). An example of a useful cysteine-
reactive moiety that can be
attached to the refolded protein is a cysteine-reactive PEG, which can be used
to form a PEGylated protein.
Such methods include (a) isolating the refolded protein having a free cysteine
residue from other proteins in
the refold mixture; (b) reducing, at least partially, the isolated, refolded
protein with a disulfide-reducing
agent and (c) exposing the protein to a cysteine-reactive moiety such as a
cysteine-reactive PEG.
Optionally, the modified protein can be isolated from unmodified protein.
Examples of other useful
cysteine-reactive moieties are cysteine-reactive dextrans, cysteine-reactive
carbohydrates, cysteine-reactive
poly (N-vinylpyrrolidone)s, cysteine-reactive peptides, cysteine-reactve
lipids, and cysteine-reactive
polysaccharides.
The present invention further includes the soluble, refolded proteins and
their derivatives, including
PEGylated proteins, made by the methods disclosed herein. Such PEGylated
proteins include
monopegylated, cysteine variants of GH, G-CSF, GM-CSF and alpha interferon
proteins. Such PEGylated
proteins also include cysteine variants of GH, G-CSF, GM-CSF and alpha
interferon proteins modified with
two or more PEG molecules, where at least one of the PEG molecules is attached
to the protein through a
free cysteine residue.
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
7
Detailed Description of the Invention
The present invention provides novel methods of preparing refolded, soluble
forms of GH, IFN-0,
G-CSF and GM-CSF proteins that have at least one free cysteine residue and
which are expressed by a host
cell in an insoluble or aggregated form. The present invention can be used to
prepare refolded, soluble
forms of other members of the GH supergene family that have at least one free
cysteine residue and which
are expressed by a host cell in an insoluble or aggregated form. The present
invention also can be used to
prepare refolded, soluble forms of other types of proteins having at least one
free cysteine residue and which
are expressed by a host cell in an insoluble or aggregated form, including,
but not limited to, anti-
angiogenesis proteins such as endostatin and angiostatin. The invention
further provides novel proteins,
particularly recombinant proteins produced by these novel methods as well as
derivatives of such
recombinant proteins. The novel methods for preparing such proteins are
generally accomplished by:
(a) causing a host cell to express a protein having a free cysteine in an
insoluble or aggregated
form;
(b) lysing the host cell by chemical, enzymatic or physical means;
(c) solubilizing the insoluble or aggregated protein by exposing the protein
to a denaturing
agent, a reducing agent and a cysteine blocking agent; and
(d) refolding the protein by reducing the concentrations of the denaturing
agent and reducing
agent in the solubilization mixture to levels sufficient to allow the protein
to renature into
a soluble, biologically active form.
Optionally, the refolded, soluble protein can be isolated from other proteins
in the refold mixture. The
methods and other embodiments of the present invention were described in
detail in U.S. Provisional
Application Serial No. 60/204,617, filed May 16, 2000. U.S. Provisional
Application Serial No.
60/204,617 is incorporated herein by reference in its entirety.
As identified above, the first step in these methods is to cause a host cell
to express a protein
having a free cysteine residue in an insoluble or aggregated form. Suitable
host cells can be prokaryotic or
eukaryotic. Examples of appropriate host cells that can be used to express
recombinant proteins include
bacteria, yeast, insect and mammalian cells. Bacteria cells are particularly
useful, especially E.coli.
Methods of causing a host cell to express a protein are well known in the art
and examples are provided
herein.
As used herein, the term "protein having a free cysteine residue" means any
natural or recombinant
protein or peptide that contains 2N+1 cysteine residues, where N can be 0 or
any integer, and any natural or
recombinant protein or peptide that contain 2N cysteines, where two or more of
the cysteines do not
normally participate in a disulfide bond. Thus, the methods of the present
invention are useful in enhancing
the expression, recovery and purification of any protein or peptide having a
free cysteine, particularly
cysteine added variant recombinant proteins (referred to herein as "cysteine
muteins" or "cysteine variants")
having one or more free cysteines. Although the expression, recovery and
purification of a natural protein
having a free cysteine expressed by its natural host cell can be enhanced by
the methods of the present
invention, the description herein predominantly refers to recombinant proteins
for illustrative purposes only.
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
8
In addition, the proteins can be derived from any animal species including
human, companion animals and
farm animals. The proteins also can be derived from plant species or microbes.
Accordingly, the present invention encompasses a wide variety of recombinant
proteins, and
cysteine variants of these proteins. These proteins include members of the GH
supergene family, and
cysteine variants of these proteins. The following proteins ("collectively
referred to as the GH supergene
family") are encoded by genes of the GH supergene family (Bazan (1990;1991;
1992); Mott and Campbell
(1995); Silvennoinen and Ihle (1996); Martin et al. (1990); Hannum et al.
(1994); Blumberg et al., 2001):
GH, prolactin, placental lactogen, erythropoietin (EPO), thrombopoietin (TPO),
interleukin-2 (IL-2), IL-3,
IL-4, IL-5, IL-6, IL-7, IL-9, IL-10, IL-11, IL-12 (p35 subunit), IL-13, IL-15,
IL-19, IL-20, IL-TIF, MDA-7,
AK-155, oncostatin M, ciliary neurotrophic factor, leukemia inhibitory factor,
alpha interferon, beta
interferon, gamma interferon, omega interferon, tau interferon, granulocyte-
colony stimulating factor (G-
CSF), granulocyte-macrophage colony stimulating factor (GM-CSF), macrophage
colony stimulating factor
(M-CSF), cardiotrophin-1 (CT-1), Stem Cell Factor and the flt3/flk2 ligand. It
is anticipated that additional
members of the GH supergene family will be identified in the future through
gene cloning and sequencing.
Members of the GH supergene family have similar secondary and tertiary
structures, despite the fact that
they generally have limited amino acid or DNA sequence identity. The shared
structural features of
members of the GH supergene family, which are described in Bazan (1990; 1991;
1992), Mott and
Campbell (1995) and Silvennoinen and Ihle (1996), allow new members of the
gene family to be readily
identified. Variants of these proteins such as the selective IL-2 antagonist
described by Shanafelt et al.
(2000) also are encompassed by this invention
The present methods also can enhance the expression, recovery and purification
of additional
recombinant proteins, including members of the TGF-beta superfamily. Members
of the TGF-beta
superfamily include, but are not limited to, glial-derived neurotrophic factor
(GDNF), transforming growth
factor-betal (TGF-betal), TGF-beta2, TGF-beta3, inhibin A, inhibin B, bone
morphogenetic protein-2
(BMP-2), BMP-4, inhibin alpha, Mullerian inhibiting substance (MIS), and OP-1
(osteogenic protein 1).
The monomer subunits of the TGF-beta superfamily share certain structural
features that allow other
members of this family to be readily identified: they generally contain 8
highly conserved cysteine residues
that form 4 intramolecular disulfides. Typically a ninth conserved cysteine is
free in the monomeric form of
the protein but participates in an intermolecular disulfide bond formed during
the homodimerization or
heterodimerication of the monomer subunits. Other members of the TGF-beta
superfamily are described by
Massague (1990), Daopin et al. (1992), Kingsley (1994), Kutty et al. (1998),
and Lawton et al. (1997),
incorporated herein by reference.
Immunoglobulin (Ig) heavy and light chain monomers also contain cysteine
residues that
participate in intramolecular disulfides as well as free cysteines (Roitt et
al., 1989 and Paul, 1989). These
free cysteines normally only participate in disulfide bonds as a consequence
of multimerization events such
as heavy chain homodimerization, heavy chain - light chain heterodimerization,
homodimerization of the
(heavy chain - light chain) heterodimers, and other higher order assemblies
such as pentamerization of the
(heavy chain - light chain) heterodimers in the case of IgM. Thus, the methods
of the present invention can
be employed to enhance the expression, recovery and purification of heavy
and/or light chains (or various
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
9
domains thereof) of human immunoglobulins such as for example IgGl, IgG2,
IgG3, IgG4, IgM IgAl,
IgA2, secretory IgA, IgD and IgE, and cysteine variants of these proteins or
fragments thereof.
Immunoglobulins from other species could also be similarly expressed,
recovered and purified. Proteins
genetically fused to immunoglobulins or immunoglobulin domains, as described
in Chamow & Ashkenazi
(1996), could also be similarly expressed, recovered and purified.
A group of proteins has been classed as a structural superfamily based on the
shared structural
motif termed the "cystine knot". The cystine knot is defined by six conserved
cysteine residues that form
three intramolecular disulfide bonds that are topologically "knotted"
(McDonald and Hendrickson, 1993).
These proteins also form homo- or heterodimers and in some but not all
instances dimerization involves
intermolecular disulfide formation. Members of this family include the members
of the TGF-beta
superfamily and other proteins such as platelet derived growth factor-A (PDGF-
A), PDGF-B, nerve growth
factor (NGF), brain derived neurotrophic factor (BDNF), neurotrophin-3 (NT-3),
NT-4, and vascular
endothelial growth factor (VEGF). Cysteine blocking reagents also could
enhance expression, recovery and
purification of proteins with this structural motif, and cysteine-added
variants of these proteins.
The present methods also can enhance the expression, recovery and purification
of other
recombinant proteins and/or cysteine added variants of those proteins. Classes
of proteins for which the
present methods would be useful include proteases and other enzymes, protease
inhibitors, cytokines,
cytokine antagonists, cytokine "selective agonists", allergens, chemokines,
gonadotrophins, chemotactins,
lipid-binding proteins, pituitary hormones, growth factors, somatomedins,
immunoglobulins, interleukins,
interferons, soluble receptors, extracellular domains of cell-surface
receptors, vaccines, single chain
antibodies and hemoglobins. Specific examples of proteins include, for
example, leptin, insulin, insulin-
like growth factor I and II (IGF-I and IGF-II), superoxide dismutase,
catalase, asparaginase, uricase,
fibroblast growth factors, arginase, angiostatin, endostatin, Factor VIII,
Factor IX, interleukin 1 receptor
antagonist, parathyroid hormone, growth hormone releasing factor, calcitonin,
extracellular domain of the
VEGF receptor, protease nexin and anti-thrombin III.
Other protein variants that would benefit from PEGylation and would therefore
be reasonable
candidates for cysteine added modifications include proteins or peptides with
poor solubility or a tendency
to aggregate, proteins or peptides that are susceptable to proteolysis,
proteins or peptides needing improved
mechanical stability, proteins or peptides that are cleared rapidly from the
body, or proteins or peptides with
undesirable immunogenic or antigentic properties.
If desired, cysteine and other amino acid muteins of these proteins can be
generally constructed
using site-directed PCR-based mutagenesis as decribed in the Examples below
and in PCT/US98/14497 and
PCT/USOO/0093, each of which is incorporated by reference in its entirety.
Methods for constructing
muteins using PCR based PCR procedures also are described in general in
Methods in Molecular Biology,
Vol. 15: PCR Protocols: Current Methods and Applications edited by White, B.
A. (1993) Humana Press,
Inc., Totowa, NJ and PCR Protocols: A Guide to Methods and Applications edited
by Innis, M. A. et al.
(1990) Academic Press, Inc. San Diego, CA.
Methods known in the art can be used to induce expression of a protein in the
cytoplasm or to
direct secretion of the protein, depending on cell origin, including, for
example, the methods described in
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
the Examples below. A wide variety of signal peptides have been used
successfully to transport proteins to
the periplasmic space of E. coli. Examples of these include prokaryotic signal
sequences such as ompA,
stII, PhoA signal (Denefle et al., 1989), OmpT (Johnson et al., 1996), LamB
and OmpF (Hoffman and
Wright, 1985), beta-lactamase (Kadonaga et al., 1984), enterotoxins LT-A, LT-B
(Morioka-Fujimoto et al.,
5 1991), and protein A from S. aureus (Abrahmsen et al., 1986). A number of
non-natural, synthetic, signal
sequences that facilitate secretion of certain proteins are also known to
those skilled in the art.
Next, the host cell is lysed. Cell lysis can occur prior to, or coincident
with, the solubilization
procedures described below. Cell lysis can be accomplished by, for example,
mechanical sheer such as a
French pressure cell, enzymatic digestion, sonication, homogenization, glass
bead vortexing, detergent
10 treatment, organic solvents, freeze thaw, grinding with alumina or sand,
treatment with a denaturing agent as
defined below, and the like (Bollag et al., 1996). Optionally, the cells can
be lysed in the presence of a
denaturing agent, a disulfide reducing agent, or a cysteine-blocking agent.
Optionally, insoluble or
aggregated material can be separated from soluble proteins by various methods
such as centrifugation,
filtration (including ultrafiltration), precipitation, floculation, or
settling.
Next the insoluble or aggregated material (or whole cells without prior lysis)
is rendered soluble or
monomeric by exposing the insoluble or aggregated material (or whole cells
without prior lysis) to a
denaturing agent, and a disulfide reducing agent that also is a cysteine-
blocking agent. Useful denaturing
agents include urea, guandine, arginine, sodium thiocyanate, extremes in pH
(dilute acids or bases),
detergents (SDS, sarkosyl ), salts (chlorides, nitrates, thiocyanates,
cetylmethylammonium salts,
trichloroacetates) , chemical derivatization (sulfitolysis, reaction with
citraconic anhydride), solvents (2-
amino-2-methyl-l-propanol or other alcohols, DMSO, DMF) or strong anion
exchange resins such as Q-
Sepharose. Useful concentrations of urea are 1-8 M, with 5-8 M being preferred
concentrations. Useful
concentrations of guanidine are 1-8 M, with 4-8 M being prreferred
concentrations. Useful disulfide
reducing agents that also are cysteine blocking agents include, but are not
limited to, thiols such as cysteine,
thioglycolic acid, reduced glutathione and cysteamine. These compounds can be
used in the range of 0.5 to
200 mM, with 1-50 mM being preferred concentrations. Cysteine, reduced
glutathionine, thioglycolic acid
and cysteamine are preferred reducing agents because they also are cysteine
blocking agents, i.e., they
interact with the free cysteine residue in the protein to form a reversibly
blocked free cysteine residue. Use
of a disulfide-reducing agent that also is a cysteine blocking agent during
the solubilization step reduces the
number of compounds and steps required in the overall process for refolding
the insoluble or aggregated
protein to a soluble, active form. Furthermore, use of a cysteine blocking
agent results in a form of the
refolded protein that is suitable for derivatization at the free cysteine
residue using variuos cysteine-reactive
moieties and procedures described below. Preferably, the pH of the
denaturation/reduction mixture is
between pH 6 and pH 10.
The next step in the procedure is to refold the protein to obtain the
protein's native conformation
and native disulfide bonds. Refolding is achieved by reducing the
concentrations of the denaturing agent
and reducing agent to levels sufficient to allow the protein to renature into
a soluble, biologically active
form This can be achieved through dialysis, dilution, gel fitration,
precipitation of the protein, or by
immobilization on a resin followed by buffer washes. Conditions for this step
are chosen to allow for
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
11
regeneration of the protein's native disulfide bond(s). This can be
accomplished through addition of an
oxidizing agent, or a redox mixture of an oxidizing agent and a reducing
agent, to catalyze a disulfide
exchange reaction. Preferably, a reagent or combination of reagents are chosen
that result in native disulfide
bond formation and a reversibly blocked free cysteine residue, i.e., the
reagent or combination of reagents
acts as cysteine blocking agents. Examples of useful oxidizing reagents
include oxygen, cystine, oxidized
glutathione, cystamine, and dithioglycolic acid. Examples of useful redox
mixtures include
cysteine/oxygen, cysteine/cystine, cysteine/cystamine, cysteamine/cystamine,
reduced glutathione/oxidized
glutathione, and the like. Optionally, a reducing agent such as DTT or 2-
mercaptoethanol can be added to
the refold mixture to promote disulfide exchange. Optionally, a metal ion such
as copper (Cu) or cobalt
(Co++) can be added to the refold mixture to promote protein oxidation. Useful
concentrations of metal ions
in the refold mixture are 1 gM to 1 mM, with 40 M being a preferred
concentration. Preferably, the pH of
the refold mixture is between pH 6 and pH 10.
Alternatively, the insoluble or aggregated material (or whole cells without
prior cell lysis) is
rendered soluble or monomeric through the use of a denaturing agent and a
disulfide reducing agent that
may or may not be a cysteine blocking agent. Useful denaturing agents include,
but are not limited to, those
described above. Examples of useful disulfide reducing agents include, but are
not limited to, DTT, 2-
mercaptoethanol, sodium borohydride, tertiary phosphines and thiols such as
cysteine, reduced
glutathionine, thioglycolic acid and cysteamine. DTT and 2-mercaptoethanol can
be used in the range of 0.5
- 200 mM, with 1-50 mM being preferred concentrations. The denatured and
reduced protein is then mixed
with a molar excess (relative to the concentration of the reducing agent) of a
dithiol reagent that, when
reduced, can act as a cysteine blocking agent. Examples of useful dithiol
reagents that can act as cysteine
blocking agents when reduced include compounds containing disulfide linkages
such as cystine, cystamine,
oxidized glutathione, dithioglycolic acid, 5,5'-dithiobis(2-nitrobenzoic acid
(Ellman's reagent), pyridine
disulfides, compounds of the type R-S-S-CO-OCH3,where R is an organic
compound, other derivatives of
cystine such as diformylcystine, diacetylcystine, diglycylcystine,
dialanylcystine diglutaminylcystine,
cystinyldiglycine, cystinyldiglutamine, dialanylcystine dianhydride, cystine
phenylhydantoin, homocystine,
dithiodipropionic acid , dimethylcystine, or any dithiol or chemical capable
of undergoing a disulfide
exchange reaction. Refolding of the protein is initiated by lowering the
concentration of the denaturing
agent (using the methods described above) and promoting disulfide exchange by
addition of a reducing
agent such as cysteine, dithiothreitol, 2-mercaptoethanol, reduced
glutathione, thioglycolic acid or other
thiol. Preferrably, a reagent or combination of reagents are chosen that
result in native disulfide bond
formation and a reversibly blocked free cysteine residue. Optionally, a metal
ion such as copper (Cum) or
cobalt (Co++), can be added to the refold mixture to promote protein
oxidation. Optionally, glycerol can be
added to the refold mixture to increase the yield of refolded protein. Useful
concentrations of glycerol in the
refold mixture are 1-50% (volume/volume), with 10-20% being a preferred range.
Preferably, the pH of the
refold mixture is 6-10.
Although not wishing to be bound by any particular theory, it is believed that
the cysteine blocking
agents used in the present methods covalently attach to the "free" cysteine
residue, forming a mixed
disulfide, thus stabilizing the free cysteine residue and preventing
multimerization and aggregation of the
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
12
protein. A number of thiol-reactive compounds can be used as cysteine blocking
agents to stabilize proteins
containing free cysteines. In addition to cysteine, cysteamine, thioglycolic
acid and reduced glutathionine,
cysteine blocking agents can also include reagents containing disulfide
linkages such as cystine, cystamine,
dithioglycolic acid, oxidized glutathione, 5,5'-dithiobis(2-nitrobenzoic acid
(Ellman's reagent), pyridine
disulfides, compounds of the type R-S-S-CO-OCH3, other derivatives of cystine
such as diformylcystine,
diacetylcystine, diglycylcystine, dialanylcystine diglutaminylcystine,
cystinyldiglycine, cystinyldiglutamine,
dialanylcystine dianhydride, cystine phenylhydantoin, homocystine,
dithiodipropionic acid ,
dimethylcystine, or any dithiol or chemical capable of undergoing a disulfide
exchange reaction. Sulfenyl
halides can also be used to prepare mixed disulfides. Other thiol blocking
agents that may find use in
stabilizing proteins containing free cysteine residues include compounds that
are able to reversibly react
with free thiols. These agents include certain heavy metals salts or organic
derivatives of zinc, mercury, and
silver. Other mercaptide forming agents or reversible thiol reactive compounds
are described by Cecil and
McPhee (1959) and Torchinskii (1971).
Optionally, the refolded, soluble protein containing a free cysteine residue
is recovered and isolated
from other proteins in the soluble fraction of the refold mixture. Such
recovery and purification methods are
known or readily determined by those skilled in the art, including, for
example, centrifugation, filtration,
dialysis, chromatography, including size exclusion, ion-exchange, hydrophobic
interaction and affinity
chromatography procedures and the like. A suitable method for the recovery and
purification of a desired
protein will depend, in part, on the properties of the protein and the
intended use.
The present invention also provides novel methods for producing biologically
active G-CSF
proteins, particularly wild type G-CSF, G-CSF (C17S), and G-CSF and G-CSF
(C17S) variants, including
cysteine variants, (collectively referred to as "G-CSF proteins"), that result
in a significant increase in the
percentage of the recovered G-CSF proteins that has been properly processed
and is biologically active.
These novel methods include secreting the G-CSF proteins into the E. coli
periplasm using the All signal
sequence, denaturing and refolding the insoluble or aggregated G-CSF proteins,
and purifying the soluble,
refolded G-CSF proteins from other proteins in the soluble fraction of the
renaturation/refold mixture. The
recovered G-CSF proteins lack the non-natural N-terminal methionine residue
present when G-CSF proteins
are expressed intracellularly in E. coli. Published reports (Perez-Perez et
al., 1995) describe secretion of G-
CSF into the E. coli periplasm using a modified ompA leader sequence. However,
very little of the
expressed ompA-G-CSF fusion protein was properly processed to yield mature G-
CSF. The percentage of
properly processed G-CSF proteins could be increased to 10-30% of total
expressed G-CSF proteins by co-
expression of the E. coli dnaJ and dnalC proteins. In all cases, the secreted
G-CSF proteins were largely
insoluble and biologically inactive. The methods of the present invention
yield at least 80-100% properly
processed G-CSF proteins and do not require co-expression of the dnaK and dnaJ
proteins. The present
invention also provides, for the first time, methods for denaturing and
refolding the insoluble, secreted G-
CSF proteins into a biologically active form.
The purified proteins obtained according to these methods can be further
processed if desired. For
example, the isolated proteins can be modified at the free cysteine residue
with various cysteine-reactive
moities. For example, the proteins can be PEGylated at the free cysteine
residue with various cysteine-
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
13
reactive PEG reagents, and subsequently purified as monoPEGylated proteins.
The term "monoPEGylated"
is defined to mean a protein modified by covalent attachment of a single PEG
molecule to the protein. Any
method known to those skilled in the art can be used to purify the PEGylated
protein from unmodified
protein and unreacted PEG reagents, including, for example, the methods
described in the Examples below,
and in PCT/US98/14497 and PCT/US00/00931. Examples of other useful cysteine-
reactive moieties are
cysteine-reactive dextrans, cysteine-reactive carbohydrates and cysteine-
reactive poly (N-
vinylpyrrolidone)s.
The present invention also provides methods for PEGylating cysteine muteins of
GH, G-CSF, GM-
CSF, alpha interferon and other proteins containing 2N + 1 cysteine residues,
and other proteins containing
2N cysteine residues where two or more of the cysteine residues are free,
particularly those muteins and
proteins in which the free cysteine residue is blocked by a mixed disulfide.
The present invention further relates to purified, monoPEGylated protein
variants produced by the
methods disclosed herein that are not only biologically active, but also
retain high specific activity in
protein-dependent mammalian cell proliferation assays. Such protein variants
include, for example,
purified, monoPEGylated cysteine muteins of G-CSF, GH, GM-CSF and IFN-a2. For
example, the in vitro
biological activities of certain of the monoPEGylated G-CSF variants described
herein are 3- to 50-fold
greater than the biological activity of G-CSF that has been PEGylated using
amine-reactive NHS-PEG
reagents.
There are over 25 distinct IFN-a genes (Pestka et al., 1987). Members of the
IFN-a family share
varying degrees of amino acid homology and exhibit overlapping sets of
biological activities. Non-natural
recombinant IFN-as, created through joining together regions of different IFN-
a proteins are in various
stages of clinical development (Horisberger and DiMarco, 1995). A non-natural
"consensus" interferon
(Blatt et al., 1996), which incorporates the most common amino acid at each
position of IFN-a, also has
been described. The methods of the present invention also are useful for
refolding other alpha interferon
species and non-natural alpha interferon proteins containing a free cysteine
residue. Useful sites and regions
for PEGylating cysteine muteins of IFN-a2 are directly applicable to other
members of the IFN-a gene
family and to non-natural IFN-as. Kinstler et al. (1996) described
monoPEGylated consensus interferon in
which the protein is preferentially mono PEGylated at the N-terminal, non-
natural methionine residue
through amine or amide linkages. Bioactivity of the PEGylated protein was
reduced approximately 5-fold
relative to non-modified consensus interferon (Kinstler et al., 1996).
In one embodiment of the monoPEGylated G-CSF, the polyethylene glycol is
attached to the region
proximal to Helix A of G-CSF and the resulting monoPEGylated G-CSF has an EC50
less than about 1000
pg/ml (approximately 50 pM), preferably less than about 100 pg/ml
(approximately 5 pM), more preferably
less than about 20 pg/ml (approximately 1 pM) and most preferably less than
about about 15 pg/ml
(approximately 0.7 pM). Alternatively, the polyethylene glycol moiety can be
attached to the C-D loop of
G-CSF and the resulting monoPEGylated G-CSF has an EC50 less than about 1000
pg/ml (approximately 50
pM), preferably less than about 100 pg/ml (approximately 5 pM), more
preferably less than about 20 pg/ml
(approximately 1 pM) and most preferably less than about 15 pg/ml
(approximately 0.7 pM). Alternatively,
the polyethylene glycol moiety can be attached to the region distal to Helix D
of G-CSF and the resulting
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/USO1/16088
14
monoPEGylated G-CSF has an EC50 less than about 1000 pg/ml (approximately 50
pM), preferably less
than about 100 pg/ml (approximately 5 pM), more preferably less than about 20
pg/ml (approximately 1
pM) and most preferably about 15 pg/ml (approximately 0.7 pM). Kinstler et
al., (1996) described
monoPEGylated wild type G-CSF in which the protein is preferentially
monoPEGylated at the N-terminal,
non-natural methionine residue through amine or amide linkages. Bioactivity of
the monoPEGylated G-CSF
protein was reported to be reduced approximately 30% relative to non-modified
G-CSF, although EC50s
were not provided (Kinstler et al., 1996). Kinstler et al. (1996) did not
determine whether modifying other
amino acids in the region proximal to helix A in G-CSF with PEG resulted in
biologically active G-CSF
proteins. One purpose of the present invention is to disclose other amino acid
positions in the region
proximal to Helix A, and other regions, in G-CSF where PEG can be attached,
resulting in biologically
active, monoPEGylated G-CSF proteins.
In one embodiment of the monoPEGylated GM-CSF, the polyethylene glycol is
attached to the
region proximal to Helix A of GM-CSF and the resulting monoPEGylated GM-CSF
has an EC50 less than
about 14000 pg/ml (approximately 1000 pM), preferably less than about 1400
pg/ml (approximately 100
pM), more preferably less than about 280 pg/ml (approximately 20 pM) and most
preferably less than about
140 pg/ml (approximately 10 pM)). Alternatively, the polyethylene glycol
moiety can be attached to the B-
C loop of GM-CSF and the resulting monoPEGylated GM-CSF has an EC50 less than
about 14000 pg/ml
(approximately 1000 pM), preferably less than about 1400 pg/ml (approximately
100 pM), more preferably
less than about 280 pg/ml (approximately 20 pM) and most preferably less than
about 140 pg/ml
(approximately 10 pM)). Alternatively, the polyethylene glycol moiety can be
attached to the C-D loop of
GM-CSF and the resulting monoPEGylated GM-CSF has an EC50 less than about
14000 pg/ml
(approximately 1000 pM), preferably less than about 1400 pg/ml (approximately
100 pM), more preferably
less than about 280 pg/ml (approximately 20 pM) and most preferably less than
about 140 pg/ml
(approximately 10 pM).
In one embodiment of the monoPEGylated GH, the polyethylene glycol is attached
to the region
proximal to Helix A of GH and the resulting monoPEGylated GH has an EC50 less
than about 2000 ng/ml
(approximately 100 nM), preferably less than about 200 ng/ml (approximately 10
nM), more preferably less
than about 20 ng/ml (approximately 1 nM) and most preferably less than about 2
ng/ml (approximately 0.1
nM).
The present invention further provides protein variants that can be covalently
attached or
conjugated to each other or to a chemical group to produce higher order
multimers, such as dimers, trimers
and tetramers. Such higher order multimers can be produced according to
methods known to those skilled
in the art or as described in Examples 2 and 20. For example, such a
conjugation can produce a GH, G-
CSF, GM-CSF or alpha IFN adduct having a greater molecular weight than the
corresponding native
protein. Chemical groups suitable for coupling are preferably non-toxic and
non-immunogenic. These
chemical groups would include carbohydrates or polymers such as polyols.
The "PEG moiety" useful for attaching to the cysteine variants of the present
invention to form
"PEGylated" proteins include any suitable polymer, for example, a linear or
branched chained polyol. A
preferred polyol is polyethylene glycol, which is a synthetic polymer composed
of ethylene oxide units. The
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
ethylene oxide units can vary such that PEGylated-protein variants can be
obtained with apparent molecular
weights by size-exclusion chromatography ranging from approximately 10,000 to
greater than 500,000 kDa.
The size of the PEG moiety directly impacts its circulating half-life (Yamaoka
et al., 1994). Accordingly,
one could engineer protein variants with differing circulating half-lives for
specific therapeutic applications
5 or preferred dosing regimes by varying the size or structure of the PEG
moiety. Thus, the present invention
encompasses GH protein variants having an apparent molecular weight greater
than about 30 kDa, and more
preferably greater than about 70 kDa as determined by size exclusion
chromatography, with an EC50 less
than about 400 ng/ml (18 nM), preferably less than 100 ng/ml (5 nM), more
preferably less than about 10
ng/ml (0.5 nM), and even more preferably less than about 2.2 ng/ml (0.1 nM).
The present invention further
10 encompasses G-CSF protein variants having an apparent molecular weight
greater than about 30 kDa, and
more preferably greater than about 70 kDa as determined by size exclusion
chromatography, with an EC50
less than about 100 ng/ml (5 nM), preferably less than 1000 pg/ml (50 pM),
more preferably less than 100
pg/mi (6 pM), and even more preferably less than about 15 pg/ml (0.7 pM). The
present invention further
encompasses alpha IFN (IFN-a) protein variants having an apparent molecular
weight greater than about 30
15 kDa, and more preferably greater than about 70 kDa as determined by size
exclusion chromatography, with
an IC50 less than about 1900 pg/ml (100 pM), preferably less than 400 pg/ml
(21 pM), more preferably less
than 100 pg/ml (5 pM), and even more preferably less than about 38 pg/ml (2
pM). The present invention
further encompasses GM-CSF protein variants having an apparent molecular
weight greater than about 30
kDa, and more preferably greater than about 70 kDa as determined by size
exclusion chromatography, with
an EC50 less than about 14,000 pg/ml (-1000 pM), preferably less than 1400
pg/ml (-100 pM), more
preferably less than 280 pg/ml (20 pM), and even more preferably less than
about 140 pg/ml (- 1 pM).
The reactive PEG end group for cysteine modification includes but is not
limited to vinylsulfone,
maleimide and iodoacetyl moieties. The PEG end group should be specific for
thiols with the reaction
occurring under conditions that are not detrimental to the protein.
Antagonist hGH variants also can be prepared using a cysteine-added variant GH
as described in
PCTIUS98/14497 and PCT/US/00/00931. Conditions that would benefit from the
administration of a GH
antagonist include acromegaly, vascular eye diseases, diabetic nephropathy,
restenosis following angioplasty
and growth hormone responsive malignancies.
As used herein, the term "derivative" refers to any variant of a protein
expressed and recovered by
the present methods. Such variants include, but are not limited to, PEGylated
versions, dimers and other
higher order variants, amino acid variants, truncated variants, fusion
proteins, changes in carbohydrate,
phosphorylation or other attached groups found on natural proteins, and any
other variants disclosed herein.
The compounds produced by the present methods can be used for a variety of in
vitro and iii vivo
uses. The proteins and their derivatives of the present invention can be used
for research, diagnostic or
therapeutic purposes that are known for their wildtype, natural, or previously
known modified counterparts.
In vitro uses include, for example, the use of the protein for screening,
detecting and/or purifying other
proteins.
For therapeutic uses, one skilled in the art can readily determine the
appropriate dose, frequency of
dosing and route of administration. Factors in making such determinations
include, without limitation, the
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
16
nature of the protein to be administered, the condition to be treated,
potential patient compliance, the age
and weight of the patient, and the like. The compounds of the present
invention can also be used as delivery
vehicles for enhancement of the circulating half-life of the therapeutics that
are attached or for directing
delivery to a specific target within the body.
The following examples are not intended to be limiting, but only exemplary of
specific
embodiments of the invention.
Examples
Example 1
Refolding of the Growth Hormone Mutein T3C
Methods for expressing, purifying and determining the in vitro and in vivo
biological activity of
recombinant human Growth Hormone (hGH) and hGH cysteine muteins are described
in PCT/US98/14497
and PCT/US/00/00931. Methods for constructing cysteine muteins of hGH also are
described in
PCT/US98/14497 and PCT/US/00/00931. One preferred method for expressing hGH in
E. coli is to secrete
the protein into the periplasm using the STII leader sequence. Secreted hGH is
soluble and can be purified
by column chromatography as described in PCT/US00/00931. Certain cysteine
muteins of hGH remain
insoluble when secreted into the E. coli periplasm using the STII leader
sequence. Procedures for refolding
insoluble, secreted hGH proteins have not been described previously. The
following protocols were
developed to refold insoluble hGH cysteine muteins into a biologically active
form.
The insoluble GH T3C mutein (threonine at position 3 changed to cysteine;
described in
PCT/US98/14497 and PCT/US/00/00931) was expressed in E. coli as a protein
secreted to the periplasmic
space using the stll leader sequence as described in PCT/US00/00931. The T3C
protein was solubilized
and refolded using the following two procedures, both of which use cysteine as
a reducing agent and as a
cysteine blocking agent to stabilize the free cysteine residue. Cultures (200
ml) of an E. coli strain
expressing the T3C mutein were grown and expression of T3C was induced as
described in
PCT/US00/00931. The cells were lysed and the insoluble portion was isolated by
centrifugation as
described in Example 14. The insoluble material containing T3C was dissolved
in 20 mL of 8 M urea, 20
mM cysteine, 20 mM Tris pH 9 and mixed by shaking for 1 hour at room
temperature. The solubilization
mixture was next divided into two, with half being diluted into 50 mL of 10%
glycerol, 20 mM Tris, pH 8
and the other half being diluted into 50 mL of 0.5% TWEEN 20, 20 mM Tris, pH
8. The refolds were held
at 4 C for 24 hours before being clarified by centrifugation and loaded onto a
5 mL Q-Sepharose Hi Trap
column previously equilibrated in 20 mM Tris, 0.5% Tween 20, pH 7.6. Refolded,
soluble T3C was eluted
from the column during a 20 column volume gradient of 0-300 mM NaCl in 0.5%
Tween 20, 20 mM Tris
pH 7.6. Recovered column fractions were analyzed by non-reducing SDS-PAGE.
Monomeric T3C eluted
at around 160 mM NaCl. Approximately 790 gg of monomeric T3C were recovered
from the refold
containing glycerol in the renaturation buffer. Approximately 284 g of
monomeric T3C was recovered
from the refold when Tween 20 was present in the renaturation buffer. The
results indicate that soluble,
monomeric T3C protein can be obtained using either refold/renaturation
procedure. Based on the greater
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
17
recovery yields of monomeric T3C protein, glycerol was used as a stabilizing
agent in subsequent refold
experiments.
Example 2
Comparison of reducing agents used to refold the Growth Hormone T3C Mutein
Cultures (200 mL) of an E. coli strain expressing the T3C mutein were grown
and T3C expressed
as described in PCT/US00/00931. Insoluble T3C was isolated by lysing the cells
with detergent/lysozyme
treatment of the cells as described in Examples 5 and 14 . This material was
suspended in 20 mL of 8 M
urea, 20 mM Tris pH 9 and aliquoted into 3 tubes. No reducing agent was added
to the first tube ("Refold
A"), 5 mM DTT was added to the second tube ("Refold B") and 20 mM cysteine was
added to the third tube
("Refold C"). After one hour of mixing at room temperature, the
solubilizations were diluted into 30 mL of
10% glycerol, 20 mM Tris, pH 8. The refolds were held at 4 C overnight. The
next day, the refolds were
clarified by centrifugation and loaded onto 5 mL Q-Sepharose Hi Trap columns
as described in
PCT/US00/00931. Recovered fractions were analyzed by non-reducing SDS-PAGE.
The T3C protein
recovered from "Refold A" (no reducing agent) eluted as several broad peaks
from the Q-Sepharose
column. By SDS-PAGE, the recovered protein product had some monomeric T3C
protein present, but
consisted mostly of aggregated T3C dimers (eluting at 210 mM NaCl) and T3C
multimers (eluting between
300 mM to 1000 mM NaCl). Final recoveries of monomeric and dimeric T3C
proteins are shown in Table
1. The T3C protein recovered from "Refold B" (with 5 mM DTT) eluted as a
single broad peak from the
Q-Sepharose column, but was heterogeneous by non-reducing SDS-PAGE analysis.
The monomeric T3C
band was much broader than the pituitary hGH band and comprised a number of
different molecular weight,
monomeric species, which probably represent different disulfide isoforms of
T3C. A small amount of
dimeric T3C protein was also detected in several of the fractions. "Refold C"
(with cysteine as the reducing
agent) yielded mainly monomeric T3C protein, which appeared to be a single
homogeneous species, as
evidenced by the sharpness of the peak eluting from the Q-Sepharose column at
160 mM NaCl and by the
sharpness of the protein band at the correct molecular weight (relative to the
standard pituitary hGH) when
analyzed by non-reducing SDS PAGE. Final recoveries of monomeric and dimeric
forms of T3C from
each of the refolds are given in Table 1. The data indicate that
solubilizing/refolding the T3C protein in the
presence of cysteine results in greater yields of soluble monomeric T3C
protein than does
solubilizing/refolding the protein in the absence of a reducing agent or in
the presence of DTT. The results
also indicate that solubilizing/refolding the T3C protein in the presence of
cysteine yields a more stable,
homogeneous preparation of soluble, monomeric T3C protein than does
solubilizing/refolding the protein in
the absence of a reducing agent or in the presence of DTT.
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
18
Table 1
Recoveries of T3C Proteins Prepared Using Various Refold Procedures
Refold Reducing Agent Monomeric T3C protein Dimeric T3C protein
a
Yield (,,g) a Yield (gg)
A none 30 120
B 5 mM DTT 370 25
C 20 mM Cysteine 534 225
a Protein recovered per 66 ml of E. coli culture
The monomeric T3C protein recovered from the Refold B, which contained DTT in
the
solubilization mixture, can be converted to stable, disulfide-linked
homodimeric T3C protein by placing the
protein under conditions that allow for disulfide bond formation. These
include conditions where an
oxidizing agent is added to the protein, or by the addition of a second
disulfide-linked reagent that is
capable of undergoing a disulfide rearrangements when the pH is near neutral
or alkali. Examples of
oxidizing agents that could be used include sodium tetrathionate or oxygen.
Optionally, trace amounts of
divalent metal ions such as copper or cobalt can be added to catalyze the
reaction. Useful disulfide-linked
reagents include cystine, cystamine, oxidized glutathione, dithioglycolate, or
other low molecular weight
dithiols. Alternatively, monomeric T3C protein can be held at an acidic pH to
prevent aggregation and
unwanted disulfide rearrangements.
The soluble, refolded GH cysteine muteins prepared according to the procedures
described in
Examples 1 and 2 can be purified by various chromatography procedures known to
those of skill in the art.
These chromatographic procedures include ion exchange, size exclusion,
hydrophobic interaction (HIC),
metal chelation affinity chromatographies (IMAC), Size Exclusion
Chromatography (SEC), Reversed Phase
chromatography or a combination of these techniques. As one example, the GH
muteins can be captured
from the soluble fraction of the refold mixture using a Q-Sepharose fast flow
resin (Pharmacia) equilibrated
in 20 mM Tris-HC1, pH 8Ø The column can be washed with 20 mM Tris-HC1, pH
8.0 and bound proteins
eluted with a linear 10-20 volume increasing salt gradient from 0 to 250 mM
NaCl in 20 mM Tris-HC1, pH
8Ø Optionally, Glycerol (10% final concentration) can be added to the column
buffers. Fractions
containing the hGH muteins can be identified by SDS-PAGE and Western blotting.
Alternative resins that
can be used to capture hGH muteins from the soluble fraction of the
refold/renaturation mixture include
HIC, other ion exchange resins or affinity resins.
The cysteine muteins can be purified further by hydrophobic interaction
chromatography. Q-
Sepharose column fractions containing the GH muteins can be pooled and NaCl
added to a final
concentration of 2 M. The pool can be loaded onto a Butyl- Sepharose fast flow
resin previously
equilibrated in 2 M NaCl, 20 mM sodium phosphate, pH 7.5. GH muteins can be
eluted from the resin
using a reverse salt gradient from 2 M to 0 M NaCl in 20 mM phosphate, pH 7.5.
Fractions containing the
GH muteins can be identified by SDS-PAGE and Western blotting, and pooled.
Alternatively the Q-
sepharose fractions containing the GH muteines can be pooled and ammonium
sulfate added to a final
concentration of 2 M before being loaded onto a Phenyl -Sepharose column. The
GH muteins can be
eluted from the resin using a reverse salt gradient from 2 M to 0 M ammonium
sulfate in 20 mM sodium
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
19
phosphate, pH 7.5. Fractions containing the GH muteins can be identified by
SDS-PAGE and Western
blotting, and pooled.
If further purification is desired, the HIC pool containing the GH muteins can
be loaded directly
onto a nickel chelating resin (Qiagen) equilibrated in 10 mM sodium phosphate,
0.5 M NaCl, pH 7.5.
Following a wash step, the GH muteins can be recovered using a 0 - 30 mM
imidizole gradient in 10 mM
sodium phosphate, 0.5 M NaCl, pH 7.5. GH has a high affinity for nickel,
presumably through the divalent
metal-binding site formed by H18, H21 and E174. As a result, GH can be
obtained in highly pure form
using a metal chelation column (Maisano et al., 1989). The GH muteins will
bind tightly to the nickel
column and elute at similar imidazole concentrations (around 15 mM) as wild-
type GH. Alternatively a
copper chelating column may be used in place of a nickel chelating column.
Biological activities of the purified GH cysteine muteins can be measured
using the cell
proliferation assay described in PCT/US00/00931. Protein concentrations can be
determined using a
Bradford dye binding assay (Bio-Rad Laboratories).
The T3C mutein was purified as follows. A 600 mL culture of E. coli was grown
and T3C protein
expression induced as described above. Insoluble T3C was isolated by treating
the cells with a
detergent/lysozyme mixture (B-PerTM, Pierce) as described in Examples 5 and
14. The insoluble material
was suspended in 40 mL of 8 M urea, 20 mM Tris, 20mM Cysteine, pH 9. After one
hour of mixing at
room temperature, the solubilization mixture was diluted into 200 mL of 15%
glycerol, 20 mM Tris, pH 8,
40 M copper sulfate. The refold was held at 4 C overnight. The next day, the
refold was clarified by
centrifugation and loaded onto a 5 mL Q-Sepharose Hi Trap column equilibrated
in 10% glycerol, 20 mM
Tris, pH 8. T3C was recovered by elution with a 20 column volume gradient from
0-250 mM NaCl in 20
mM Tris, pH 8, 10% glycerol. Recovered fractions were analyzed by non-reducing
SDS-PAGE. Fractions
containing predominantly T3C protein of the correct apparent molecular weight
were pooled. Pooled
fractions yielded 4.6 mg of purified T3C protein. This material was used for
the PEGylation studies
described in Example 3. Biological activity of the purified T3C protein was
measured in the GH-R4 cell
proliferation assay described in Examples 1 and 2 and PCT/US98/14497 and
PCT/US00/00931. The T3C
protein stimulated proliferation of the GH-R4 cells with an EC50 of 1.35
ng/ml.
Other cysteine muteins of GH that were prepared by this procedure include *-
1C, P2C, P5C,
K38C, Q40C, K41C, S55C, S57C, T60C, Q69C, N72C, N99C, L101C, V102C, Y103C,
D130C, S132C,
P133C, R134C, T135C, Q137C, K140C, Q141C, T142C, Y143C, K145C, D147C, N149C,
S150C, H151C,
N152C, D153C, E186C, and G187C. Biological activities of certain of the
purified GH cysteine muteins
were measured in the GH-R4 cell proliferation assay described in
PCT/US00/00931. The observed EC50s
for muteins *-1C, P2C, P5C, K38C, Q40C, S55C, N99C, L101C, V102C, Y103C,
P133C, Q137C, K140C,
Y143C, D147C, N149C, E186C, and G187C ranged from 0.7 ng / ml to 2.2 ng / ml.
These values are all
nearly equivalent to the observed EC50s for wild type GH controls in these
assays which ranged from 0.3 ng
/ml to1.5ng/ml.
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
Example 3
General Methods for PEGylation and Purifying PEGylated Forms of Proteins
Containing Free
Cysteine Residues
Proteins containing free cysteine residues can be PEGylated using a variety of
cysteine-reactive
5 PEG-maleimide (or PEG-vinylsulfone) reagents that are commercially
available. The recombinant proteins
are generally partially reduced with dithiothreitol (DTT), Tris (2-
carboxyethyl) phosphine-HC1 (TCEP) or
some other reducing agent in order to achieve optimal PEGylation of the free
cysteine. The free cysteine is
relatively unreactive to cysteine-reactive PEGs unless this partial reduction
step is performed. The amount
of reducing agent required to partially reduce each mutein can be determined
empirically, using a range of
10 reducing agent concentrations at different pHs and temperatures. Reducing
agent concentrations typically
vary from 0.5 equal molar to 10-fold molar excess. Preferred temperatures are
4 C to 37 C. The pH can
range from 6.5 to 9.0 but is preferrably 7.5 to 8.5. The optimum conditions
will also vary depending on the
reductant and time of exposure. Under the proper conditions, the least stable
disulfides (typically
intermolecular disulfides and mixed disulfides) are disrupted first rather
than the more thermodynamically
15 stable native disulfides. Typically, a 5-10 fold molar excess of DTT for 30
minutes at room temperature is
effective. Partial reduction can be detected by a slight shift in the elution
profile of the protein from a
reversed-phase column. Partial reduction also can be detected by a slight
shift in apparent molecular weight
by non-reducing SDS-PAGE analysis of the protein sample. Care must be taken
not to "over-reduce" the
protein and expose additional cysteine residues. Over-reduction can be
detected by reversed phase-HPLC
20 (the over-reduced protein will have a retention time similar to the fully
reduced and denatured protein) and
by the appearance of protein molecules containing two PEGs following the
PEGylation reaction (detectable
by an apparent molecular weight change on SDS-PAGE). In the case of cysteine
muteins, the corresponding
wild type protein can serve as a control since it should not PEGylate under
conditions that do not reduce the
native intramolecular disulfides. Excess reducing agent can be removed prior
to PEGylation by size
exclusion chromatography or by dialysis. TCEP need not be removed before
addition of the PEGylation
reagent as it is does not contain a free thiol group. The partially reduced
protein can be reacted with various
concentrations of PEG-maleimide or PEG-vinylsulfone (typically PEG: protein
molar ratios of 1:1, 5:1,10:1
and 50:1) to determine the optimum ratio of the two reagents. PEGylation of
the protein can be monitored
by a molecular weight shift for example, using SDS-PAGE. The lowest amount of
PEG that gives
significant quantities of mono-pegylated product without giving di-pegylated
product is typically considered
desirable. In some instances, certain additives can enhance the PEGylation
yield. These additives include,
but are not limited to, EDTA, borate, chaotropes (urea, guanidine, organic
solvents), detergents, osmolytic
stabilizers (polyols, sugars, polymers, amino acids and derivatives thereof),
and other ionic compounds
(citrate, sulfates, phosphates, quaternary amines, chlorides nitrates,
thiocyanates, etc.) Useful
concentrations of EDTA are 0.01 - 10 mM, with 0.5 - 1 mM being preferred
concentrations. Generally,
mono-PEGylated protein can be purified from non-PEGylated protein and
unreacted PEG by size-exclusion,
ion exchange, affinity, reversed phase, or hydrophobic interaction
chromatography. Fractions enriched for
the mono-PEGylated protein ( a single PEG molecule attached to the cysteine
mutein) can be identified by
SDS-PAGE and/or Western blotting. These fractions can be pooled and stored
frozen. The presence of the
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
21
PEG moiety generally alters the protein's affinity for the resin, allowing the
PEGylated protein to be
separated from the non-PEGylated protein. Other purification protocols such as
2-phase organic extraction
or salt precipitation also can be used. The purified, PEGylated protein can be
tested in the cell
proliferation/inhibition assays described in the various Examples described
herein and in PCTIUS98/14497
and PCT/US00/00931 to determine its specific activity. In vivo efficacy of the
PEGylated proteins can be
determined as described in the Examples provided herein and in PCT/US98/14497
and PCT/US00/00931.
Experiments can be performed to confirm that the PEG molecule is attached to
the protein at the proper site.
This can be accomplished by chemical or proteolytic digestion of the protein,
purification of the PEGylated
peptide (which will have a large molecular weight) by size exclusion, ion
exchange or reversed phase
chromatography, followed by amino acid sequencing. The PEG-coupled amino acid
will appear as a blank
in the amino acid sequencing run.
The following conditions were used to PEGylate the GH mutein T3C and to purify
the PEGylated
T3C protein. Initial PEGylation reactions conditions were determined using
aliquots of the refolded T3C
protein prepared as described in Example 2 (using cysteine as the reducing
agent and as the cysteine
blocking agent to solubilize and refold the protein), TCEP [Tris (2-
carboxyethyl) phosphine]-HC1 as the
reducing agent and 5kDa cysteine reactive PEGs from Shearwater Polymers
(Huntsville, Alabama). Two g
aliquots of purified T3 C were incubated with increasing concentrations of
TCEP at room temperature in 100
mM Tris, pH 8.5 in the presence of varying amounts of excess 5 kDa maleimide-
PEG or 5 kDa
vinylsulfone-PEG. After 120 minutes, aliquots of the reactions were
immediately analyzed by non-
reducing SDS-PAGE. At pH 8.5, a 5-fold molar excess of TCEP and 15-fold excess
molar of either 5 kDa
maleimide or 5 kDa vinyl sulfone PEG yielded significant amounts of
monoPEGylated T3C protein after
two hours without detectable di or tri-PEGylated protein. The T3C mutein
needed to be partially reduced
by treatment with a reductant such as TCEP in order to be PEGylated. Wild type
GH did not PEGylate
under identical partial reducing conditions, indicating that the PEG moiety is
attached to the cysteine residue
introduced into the mutein. These conditions were used to scale up the
PEGylation reaction for purification
and evaluation of biological activity. A larger PEGylation reaction (300 g)
was performed for 2 hr at room
temperature, using a 5-fold excess of TCEP and 15-fold of 10 kDa maleimide
PEG. At the end of the
reaction time, the PEGylation mixture was diluted 2X with ice cold 20 mM Tris,
15% glycerol, pH 8.0 and
immediately loaded onto a Q-Sepharose column (1 mL, HiTrap). PEGylated T3C was
eluted from the
column by running a 20 mL gradient from 0-0.2 M NaCl in 20 mM Tris, 15%
glycerol, pH 8. The presence
of the PEG moiety decreases the protein's affinity for the resin, allowing the
PEGylated protein to be
separated from the non-PEGylated protein. Fractions enriched for mono-
PEGylated T3C (a single PEG
molecule attached to the T3C monomer) were identified by SDS-PAGE, pooled and
frozen. The mono-
PEGylated T3C protein eluted at approximately 80 mM NaCI and its apparent
molecular weight by SDS-
PAGE was approximately 30 kDa.
10K PEG-T3C, 20K PEG-T3C, and 40 K PEG-T3C were also prepared by the method
described
above. Bioactivity of the purified PEG-T3C proteins were measured in the cell
proliferation assay
described in Examples 1 and 2 and PCT/US98/14497 and PCT/US/00/00931 to
determine its specific
activity. The PEG-T3C proteins stimulated proliferation of GH-R4 cells similar
to wild type GH and non-
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
22
PEGylated T3C protein. The EC50 for the 5K PEG-T3C protein was 1.2 ng/ml, the
EC50 for the 10K PEG-
T3C was 1.2 ng/ml, and the EC50 for the 20K PEG-T3C was 3-4 ng/ml. The EC50
for the 40K- PEG-T3C
can be determined using the cell proliferation assay described in Examples 1
and 2 and PCT/US98/14497
and PCT/US/00/00931. In vivo efficacy of PEG-T3C and other PEGylated GH
cysteine muteins can be
determined as described in PCTIUS98/14497 and PCT/US00/00931 and Example 4.
Other cysteine mutants of GH that were PEGylated and purified according to the
procedures
outlined above include P2C, P5C, S132C, P133C, and R134C. The biological
activities of these muteins
that were modified with 20 kDa- PEG moieties were measured using the cell
proliferation assay described in
Examples 1 and 2 and PCT/US98/14497 and PCT/US/00/0093 1. The observed EC50s
for these PEGylated
muteins muteins ranged from 1.7 ng / ml to 6.0 ng / ml. These values are all
similar to, but slightly greater
than, the observed EC50s for wild type GH control assays that were performed
in parallel. The EC50s for
these wild type GH controls ranged from 0.6 ng / ml to 1.2 ng / ml .
Example 4
PEG-T3C Growth Hormone Stimulates Somatic Growth in Growth Hormone-Deficient
Rats
A. The ability of PEG-T3C to stimulate somatic growth was determined in
hypophysectomized
(HYPOX) rats, which are unable to synthesize growth hormone due to removal of
their pituitaries. HYPOX
male Sprague-Dawley rats were purchased from a commercial vendor and weighed
about 90 g. The rats
were acclimated for 13 days. Animals gaining more than 4 g during acclimation
were culled from the study.
Body weight measurements were taken at the same time every day (9:30 AM). Rats
were randomized by
weight to the various test groups. There were 5 rats per group except for the
group receiving every day
doses of 20 kDa-PEG-T3C, in which there were only four rats. Rats were weighed
daily and were given
daily or every other day subcutaneous injections of placebo (Phosphate
Buffered Saline (PBS) containing
200 g/ml rat serum albumin (Sigma Chemical Company)), a commercial
recombinant human growth
hormone, Nutropin , or various doses of 20 kDa-PEG-T3C prepared as described
in Example 3. All
protein solutions were prepared in PBS containing 200 g/ml rat serum albumin.
Animals were treated for
9 consecutive days. On day 10, the animals were sacrificed and their tibias
were harvested. The tibias were
fixed in 10% neutral buffered formalin. The fixed tibias were decalcified in
5% formic acid and split at the
proximal end in the frontal plane. The tibias were processed for paraffin
embedding and sectioned at 8
microns and stained with toluidine blue. The width of the tibial physis was
measured on the left tibia (5
measurements per tibia). Cumulative body weight gain and tibial epiphyses
measurements for the different
test groups are shown in Table2. The results show that 20 kDa-PEG-T3C
stimulates body weight gain and
bone growth in growth hormone deficient rats.
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
23
Table 2
Effects of every day or every other day administration of placebo, Nutropin or
20 kDA-PEG-T3C on
body weight gain and tibial epiphyses width in hypophysectomized rats
Cumulative Body Tibial Epiphyses Width
Compound Dose Injection Weight Gain (mean +/- SE)
Frequency (grams) (Vin)
Placebo - Every day -1.0 +/- 0.707 206.8 +/- 9.2
Nutropin 10 ~Lghrjection Every day 11.2 +/- 0.97 a 348.8 +/- 8.6 a
20 kDa-PEG-T3C 10 ~ighrjection Every day 14.3 +/- 0.75 a 333.0 +/- 9.8 a
Placebo - Every other day 0.6+/-1.03 204.4 +/- 8.6
Nutropin 10 injection Every other day 8.6 +/- 1.12 298.8 +/- 10.1
20 kDa-PEG-T3C 10 ~Lg/injection Every other day 15.4 +/- 0.68 ba c 357.2 +/-
7.7 b
20 kDa-PEG-T3C 2 /injection Every other day 5.6+1-0.5 l274.8 +/- 9.0
20 kDa-PEG-T3C 0.4 ~tg/irjection Every other day -0.2 +/- 0.66 225.2+/- 10.0
a p< 0.05 versus every day placebo using a two-tailed T test
b p< 0.05 versus every other day placebo using a two-tailed T test
p< 0.05 versus every other day Nutropin using a two-tailed T test
B. A second experiment was performed as described for Example 4.A. except that
the test
compounds were administered by subcutaneous injection every day or every third
day. In addition, one
dose of T3C modified with a 40 kDa-PEG was tested. HYPOX male Sprague-Dawley
rats were purchased
froma commercial vendor and weighed about 100 g. Body weight measurements were
taken at the same
time every day. Rats were randomized by weight to the various test groups.
There were 5 rats per group
except for the group, except for the test group receiving 40 kDa-PEG-T3C. Rats
were weighed daily and
were given daily or every third day subcutaneous injections of placebo
(Phosphate Buffered Saline (PBS)
containing 200 g/ml rat serum albumin (Sigma Chemical Company)), a commercial
recombinant human
growth hormone, Nutropin , various doses of 20 kDa-PEG-T3C or 40 kDa-PEG-T3C.
The PEG-T3C
proteins were prepared as described in Example 3. All protein solutions were
prepared in PBS containing
200 g/ml rat serum albumin. Animals were treated for 9 consecutive days. On
day 10, the animals were
sacrificed and their tibias were harvested and prepared for sectioning as
described in Example 4.A..
Cumulative body weight gain and tibia epiphyses widths for the different test
groups are shown in Table 3.
The results show that 20 kDa-PEG-T3C and 40 kDa-PEG-T3C stimulate body weight
gain and bone growth
in growth hormone deficient rats.
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/USO1/16088
24
Table3
Effects of every day or every third day administration of placebo, Nutropin,
20 kDA-PEG-T3C or 40
kDa-PEG-T3C on body weight gain and tibial epiphyses width in
hypophysectomized rats
Injection Cumulative Body Tibial Epiphyses Width
Compound Dose Frequency Weight Gain (mean +/- SE)
(grams) (m)
Placebo - Every Day 0.8 +/- 0.685 223+/-15.1
Nutropin 30 injection Every day 21.3 +/- 1.432 408.4 +/- 14.2
Nutropin 10 gg/injection Every Day 16.2 +/- 1.232 399.6 +/- 15.6
20 kDa-PEG-T3C 10 [tg/injection Every Day 18.6 +/- 2.215 384.4 +/- 13.0
Placebo - Every third day 1.5 +/- 1.370 231.6 +/- 17.4
Nutropin 30 ~Lghnjection Every third day 6.8 +/- 1.385 315.2 +/- 15.6
Nutropin 10 /injection Every third day 8.0 +/- 1.614 284.0 +/- 6.9
20 kDa-PEG-T3C 30 [Lg/injection Every third day 17.5 +/- 1.162 428.4 +/- 18.3
20 kDa-PEG-T3C 10 injection Every third day 12.3 +/- 0.792 329.2 +/- 15.6
20 kDa-PEG-T3C 2 /injection Every third day 8.0 +/- 1.379 263.2 +/- 7.1
40 kDa-PEG-T3C 10 gg/injection Every third day 17.2 +/- 0.868 360.5 +/- 21.9
Example 5
Refolding and Purification of IFN-a2 Cysteine Muteins
Methods for expressing, purifying and determining the in vitro and in vivo
biological activity of
recombinant human alpha interferon 2 (IFN-0) and IFN-a2 cysteine muteins are
described in
PCT/US00/00931. Methods for constructing cysteine muteins of IFN-a2 and
preferred sites within the
IFN-a2 protein for the locations of added cysteine residues also are described
in PCT/US98/14497 and
PCT/US00/00931. The following muteins have been constructed in E coli using
those methods: C1S, Q5C,
43C44, N45C, Q46C, F47C, Q48C, A50C, D77C, C98S, Q101C, T106C, E107C, T108C,
S163C, E165C,
*166C, D2C, L3C, T6C, S8C, T52C, G102C, V103C, G104C, V105C, P109C, L11OC,
M111C, S160C,
L161C, R162C and K164C. One preferred method for expressing IFN-a2 in E. coli
is to secrete the protein
into the periplasm using the STII leader sequence. A fraction of the secreted
IFN-a2 is soluble and can be
purified by column chromatography as described in PCT/US00/00931. Certain
cysteine muteins of IFN-a2
remain insoluble when secreted into the E. coli periplasm using the STII
leader sequence. SDS-PAGE
analysis of the osmotic shock supernatants of the muteins showed most to have
reduced (as compared to
wild type) levels of the 19 kDa rIFN-a2 band. SDS-PAGE analyses of whole cell
lysates and the insoluble
material from the osmotic shocks revealed that these muteins were expressed at
relatively high levels but
accumulated primarily in an insoluble form, presumably in the periplasm. These
proteins comigrated with
wild type rIFN-a2 standards under reducing conditions indicating that the STII
leader had been removed.
Qualitative assessments of relative expression levels of the muteins are
summarized in Table 4. Procedures
for refolding insoluble, secreted IFN-0 proteins have not been described
previously. The following
protocol (here referred to as "Protocol I") was developed to express and
refold IFN-a2 cysteine muteins
into a biologically active form.
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
For expression of IFN-a2 cysteine muteins and IFN-a2, typically, a 325 ml
culture in a 2 liter
shake flask, or a 500 ml culture in a 2 liter baffled shake flask, were grown
at 37 C in a gyrotory shaker
water bath at -170-220 rpm. Cultures were grown, induced, harvested, and
subjected to osmotic shock as
described in PCT/US00/00931. Resulting supernatants and pellets were processed
immediately or stored at
5 -80 C.
IFN-a2 cysteine muteins that were recovered as insoluble proteins in the
osmotic shock pellets
were denatured, reduced and refolded into their proper conformations using the
following refold procedure.
The pellet from the osmotic shock lysate was first treated with B-PER TM
bacterial protein extraction
reagent as described by the manufacturer (Pierce). B-PER is a mild detergent
mixture that disrupts the E.
10 coli membranes and releases the cytoplasmic contents of the cells.
Insoluble material was recovered by
centrifugation, resuspended in water, and recentrifuged. The resulting pellet
was solubilized in 5 mL of 6 M
guanidine, 50 mM cysteine in 20 mM Tris Base. The mixture was allowed to stir
for 30 minutes before
being dialyzed overnight at 4 C against 400 mL of 40mM sodium phosphate, 150
mM NaCl, pH 8Ø The
next day the pH of the refold mixture was adjusted to 3.0 and the mixture was
centrifuged before being
15 loaded onto an S-Sepharose column, followed by a Cu++ IMAC column as
described for the purification of
rIFN-a2 from the osmotic shock supernatant in PCT/US00/00931. Six IFN-a2
cysteine muteins: Q5C,
C98S, Q101C, T106C, E107C and *166C have been refolded and purified using
these procedures. Similar
procedures can be used to refold and purify insoluble wild type IFN-a2.
Non-reducing SDS-PAGE analysis of purified Q5C, C98S, Q101C, T106C, E107C, and
*166C
20 cysteine muteins showed that the muteins were recovered predominantly as
monomers, migrating at the
expected molecular weight of - 19 kDa. C98S migrated with a slightly higher
molecular weight than the
other rINF-a2 muteins due to the absence of the native Cysl-Cys-98 disulfide
bond. Some of the purified
muteins contained small amounts of disulfide-linked rIFN-a2 dimers. The
molecular weights of the dimer
species were approximately 37-38 kDa.
25 When processing a number of cyteine muteins of IFN-a2, it was discovered
that certain cysteine
muteins appeared to be present in both the soluble and insoluble fractions
following cell lysis. Ratios of
soluble verus insoluble IFN-a2 protein varied from mutant to mutant.
Therefore, an alternative
solubilzation/refolding procedure (here referred to as "Protocol II") that
involves a whole cell solublization
step was developed to enhance recovery of the IFN-a cysteine muteins. A
modification of the culture
methods was found to improve the efficiency of processing of the STII leader
sequence and was employed
to express IFN-a cysteine muteins for refolding and purification, as detailed
below. In the modified
method, 325 - 400 ml cultures were grown in LB media containing 100 mM MES, pH
5.0 and 100 g/nil
ampicillin at 37 C with vigorous shaking, e.g., 220-250 rpm in a New Brunswick
C25KC environmental
shaker, to a cell density of 0.5 - 0.7 OD at 600 nm. Cultures were then
induced by addition of IPTG
(isopropyl-(3-D-thiogalactopyranoside) to a final concentration of 0.5 mM and
upon induction the
temperature was reduced to 28 C and the shaker speed was reduced to 140 rpm.
Induced cultures were
incubated overnight (14-18 hours) and harvested by centrifugation. Cell
pellets were processed immediately
or stored at -20 C or -80 C until processing. The cell pellets derived from a
325-400 mL induced culture
are first suspended in 10 mL of 8 M Guanidine, 20 mM Cysteine, 20 mM Mes, 2%
Tween 20, pH 3 and
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
26
mixed until a homogeneous suspension is present. The pH is then increased to
between pH 8-9 and the
solubilization mixture is stirred for 3 hours. The cell lysate is next diluted
1:20 with ice cold renaturation
buffer (20 mM Tris, pH 0.3 M guanidine, 1 M urea, 40 m copper sulfate, pH 8).
The cloudy suspension
is allowed to sit 1-2 days at 4 C. The refold is clarified by centrifugation
followd by a pH adjustment to 3
and second round of centrifugation. The supernatant is diluted 1:4 with cold
water and load onto a 5 mL S-
Seph Hi Trap. The ion exchange column is eluted with a 100 mL gradient of 0-
70% Buffer B, with Buffer
A being 20 mM Mes, pH 5 and Buffer B being 10% Ethylene glycol 500 mM NaCl, 20
mM Mes pH 5.
Alternatively, refolded IFN-a cysteine muteins can be captured from the refold
mixture using a HIC
column, such as a Phenyl-Sepharose column. The refold mixture is first
centrifuged, ammonium sulfate is
added to the supernatant to a final concentration of 10%, the mixture is
recentrifuged, and the supernatant
loaded onto a 10 mL Phenyl Sepharose column equilibrated in 10% ammonium
sulfate, 20 mM Tris, pH8.
IFN-a cysteine muteins are eluted from the column using a 100 mL linear
gradient from 10% ammonium
sulfate, 20 mM Tris pH 8 to 30% ethylene glycol, 20 mM Tris, pH 8. The
interferon pool from a Phenyl-
Sepharose column can be further purified using a copper chelating column, S-
Sepharose column or both.
Interferon cysteine muteins also can be solubilized and refolded using other
reducing agents that
also act as cysteine blocking agents. Substitution of reduced glutathione,
thioglycolic acid or cysteamine for
cysteine in the solubilization/refold mixtures yielded refolded, soluble IFN
cysteine variants that could be
purified and PEGylated following the procedures described in Example 7. When
no reducing agent or 20
mM DTT was substituted for cysteine in the solubilization/refold mixtures,
yields of refolded, soluble IFN
cysteine muteins were reduced to non-detectable levels when the refold mixture
was analyzed by Reversed
Phase HPLC. Additionally, no refolded, soluble IFN cysteine mutein was
recovered following S-Sepharose
chromatography of the refold mixture when no reducing agent or 20 mM DTT was
substituted for cysteine
in the solubilization/refold mixtures.
The following muteins were expressed in E coli, refolded and purified using
Protocol II: C1S,
Q5C, 43C44, N45C, F47C, Q48C, A50C, C98S, Q101C, T106C, E107C, S163C, E165C,
*166C, D2C,
L3C, T6C, S8C, T52C, G102C, V103C, G104C, V105C, P109C, L11OC, M111C, S160C,
L161C, R162C
and K164C. These refolds were performed at pH 8 or in some instances 7.5.
Example 6
Bioactivities of IFN-a2 Cysteine Muteins
Biological activities of the purified Q5C, C98S, Q101C, T106C, E107C, and
*166C IFN-a2
cysteine muteins that were purified using Protocol I of Example 5 were
measured in the Daudi growth
inhibition assay described in PCT/US00/00931. Protein concentrations were
determined using Bradford or
BCA protein assay kits (Bio-Rad Laboratories and Pierce). Commercial wild type
rIFN-a2 and rIFN-a2
prepared as described in PCT/US00/00931 were analyzed in parallel on the same
days to control for
interday variability in the assays. The muteins inhibited proliferation of
Daudi cells to the same extent as
the wild type rIFN-a2 control proteins, within the error of the assay. Mean
IC50s for five of the muteins
(Q5C, Q101C, T106C, E107C and *166C) were similar to the mean IC50 s of the
wild type rIFN-a proteins,
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
27
ranging from 15-18 pg/ml. The mean IC50 for the C98S protein was 28 pg/ml.
These data are summarized
in Table 4.
Table 4.
Expression and in vitro Bioactivities of IFN-a2 Cysteine Muteins
Relative Expression
IFN-a2 Mutation Total Percent Form Mean IC50 IC50 Range3
luble 2 Assayed (pg/ml) (pg/ml)
Protein Location Cellular 1 Soluble
rIFN-a2 4 - - - 16 +/- 7 8-29 (n=10)
rIFN-a2 5 - ++++ - 33 Soluble 13 +/- 4 7-19 (n=10)
cis N-terminal region6 +/- 0
Q5C N-terminal region ++++ - 20 Refolded 17 15, 17, 20
43C44 A-B loop ++ 0
N45C A-B loop ++ 0
46C A-B loop +/- 0
F47C A-B loop ++++ -5
Q48C A-B loop +/- 0
A50C A-B loop +/- 0
D77C B-C loop +/- 0
C98S C-helix 7 +++++ -5-10 Refolded 28 22,30,32
101C C-D loop +++++ -5-10 Refolded 18 10,22,23
T106C C-D loop +++++ -5-10 Refolded 18 18,18
E107C C-D loop +++++ -5-10 Refolded 18 8,22,24
T108C C-D loop +/- 0
S163C C-terminal region ++++ - 33
E165C C-terminal region +++ - 20
*166C C-terminus +++ - 20 Refolded 15 8,16,20
1 Relative accumulation of the IFN-a2 protein in whole cell extracts
2 Portion of the IFN-a2 protein in the osmotic shock supernatant, determined
from
SDS-PAGE gels
3 IC50 values from individual experiments. A range is shown when N > 5.
4 Commercial wild type rIFN-a2 (Endogen, Inc.)
5 Wild type rIFN-a2 prepared by Bolder BioTechnology, Inc.
6 Mutation creates a free cysteine (C98) in the C-helix
7 Mutation creates a free cysteine (Cl) in the N-terminal region
Biological activities of the following muteins, purified using Protocol II of
Example 5, were
measured in the Daudi growth inhibition assay described in PCT/US00/00931:
C1S, D2C, L3C, S8C,
N45C, F47C, C98S, V103C, V105C, E107C, M111C, R162C, S163C, K164C, E165C and
*166C. The
observed IC50s are listed in Table 5 along with IC50s for wild type rIFN-a
protein controls used in the same
experiments.
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
28
Table 5.
In vitro Bioactivities of IFN-a2 Cysteine Muteins Purified by Protocol II with
and without
PEGylation
Mutant Mutation location IC501 (pg/ml) IC50 (pg/ml), 20K PEG-Protein 1
RIFN-a2 2 - 15 to 55 -
RIFN-a2 3 - 16 to 109 -
C1S4 N-terminal region 120, 130 100, 160
D2C N-terminal region 39 300
L3C N-terminal region 24, 75 105, 270
S8C N-terminal region 37 220
N45C A-B loop 52 104
F47C A-B loop 66, 56, 58 120, 72, 240
C98S5 C-helix 105, 110,100 500, 720, 900
G104C C-D loop 110 600
V105C C-D Loop 38 33
E107C C-D loop 90,98, 110 160, 220, 180
M111C C-D Loop 40 190
R162C C-terminal region 600 4000
S163C C-terminal region 70,50, 88 310, 125,360
K164C C-ter 100 600
E165C C-ter 43,60,51 160, 220, 300
*166C C-terminus 48,78, 96 120,300
1 IC50 values from individual experiments. A range is shown when N > 5.
2 Commercial wild type rIFN-a2 (Endogen, Inc.)
3 Wild type rIFN-a2 prepared by Bolder BioTechnology, Inc.
4 Mutation creates a free cysteine (C98) in the C-helix
5 Mutation creates a free cysteine (Cl) in the N-terminal region
Example 7
PEGylation of IFN-a2 Cysteine Muteins
The purified IFN-a2 cysteine muteins can be PEGylated using the procedures
described in
Example 3 and PCT/US98/14497 and PCT/US00/00931. A small-scale PEGylation
experiment was
performed with two of the purified rIFN-a2 cysteine muteins to identify
conditions that allowed the proteins
to be monoPEGylated at the free cysteine residue. Over-reduction of the
proteins was monitored by non-
reducing SDS-PAGE, looking for a shift to a higher than expected apparent
molecular weight as a result of
protein unfolding, or for the appearance of multiple PEGylated species
generated as the result of native
disulfide reduction. One g aliquots of purified wild type and the rIFN-a2
muteins T106C and E107C were
incubated for 1 hour with a 10-fold molar excess TCEP and a 20-fold molar
excess of 5 kDA maleimide
PEG at pH 8.5 at room temperature. After 60 min, the reactions were stopped
and immediately analyzed by
non-reducing SDS-PAGE. Both muteins yielded monoPEGylated protein under these
conditions, based on
SDS-PAGE analysis of the reaction mixtures. The apparent molecular weights of
the monoPEGylated
proteins were approximately 28 kDa by non-reducing SDS-PAGE. Wild-type rIFN-a2
showed no
detectable PEGylation under these conditions. Control experiments indicated
that the T106C and E107C
cysteine muteins needed to be partially reduced with a reductant such as TCEP
to be PEGylated. These data
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
29
indicate that the PEG molecule is attached to the cysteine residue introduced
into the T106C and E107C
proteins.
Larger quantities of the IFN-a2 cysteine muteins can be modified with cysteine-
reactive PEGs of
various sizes and purified to obtain sufficient material for bioactivity
measurements. For purification of the
PEGylated proteins, the larger PEGylation reactions should be performed as
described above for 1 hr at
room temperature, diluted IOX with 20 mM MES, pH 5.0, adjusted to pH 3.0, and
then loaded quickly onto
an S-Sepharose column using conditions similar to those described for initial
purification of the rIFN-a2
muteins. The presence of the PEG moiety decreases the protein's affinity for
the resin, allowing the
PEGylated protein to be separated from the non-PEGylated protein. The
chromatogram from the S-
Sepharose column should show two major protein peaks. The early eluting major
peak (eluting at an NaCl
concentration less than 230 inM) should be the mono-PEGylated IFN-a protein,
which can be confirmed by
non-reducing SDS-PAGE analysis. The apparent molecular weight of monoPEGylated
IFN-a2 that has
been modified with a 5 kDa cysteine-reactive PEG is approximately 28 kDa by
SDS-PAGE. The later
eluting major peak (eluting at approximately 230 mM NaCl) should be the
unreacted IFN-a2 protein.
Fractions from the early eluting peaks containing predominantly PEG-IFN-a2 can
be pooled and used for
bioactivity measurements. Biological activity of the purified PEG-IFN-a2
proteins can be measured in the
Daudi cell assay described in PCT/US00/00931. Concentrations of the proteins
can be determined using a
Bradford dye binding assay. In vivo biological activities of the PEGylated IFN-
a2 cysteine muteins can be
determined as described in PCT/US98/14497 and PCT/US/US00/00931.
For PEGylation of the Q5C mutein, the purified protein was diluted to 100
g/ml protein with 100
mM Tris, pH 8. A 15-fold excess of 5 kDa- maleimide PEG is added followed by
10-15-fold molar excess
of TCEP. EDTA was also added (0.5 mM final concentration) to inhibit disulfide
formation once the
protein is partially reduced. The mixture was held at room temperature, 2
hours. An alternative method
that also gave good PEGylation efficiency involved repeated additions of the
PEG and TCEP reagents. We
have found that 3 rounds of adding iOX molar excess PEG reagent and 1OX molar
excess TCEP over a
period of 2 hours gave greater than 80% PEGylation efficiency. This latter
procedure of repeated additions
of the PEG and TCEP reagents was used successfully to prepare Q5C modified
with lOkDa-, 20kDa- and
40kDa-PEGs. The PEGylated proteins were separated from unreacted Q5C starting
material and
PEGylation reagents by ion-exchange chromatography using the S-Sepharose
protocol described in
Example 5. Alternative methods such as other ion exhangers (Q, DEAF, CM), HIC
resins (Phenyl, Butyl) ,
affinity columns , size exclusion columns, or chelating resins may be used to
purify the PEGylated protein.
Biological activity of the purified 10 kDa-, 20 kDa- and 40 kDa-PEG-Q5C
proteins were measured
in the Daudi cell assay described in PCT/US00/00931. Concentrations of the
proteins were determined
using a Bradford dye binding assay. Mean IC50s for the 10 kDa-PEG-Q5C, 20 kDa-
PEG-Q5C, and 40 kDa-
PEG-Q5C proteins were determined to be 70 pg/ml (N=2 assays), 100 pg/ml (N=8
assays), and 108 pg/ml
(N=8 assays), respectively.
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
Example 8
Cloning, Expression and Purification of Wild Type G-CSF and G-CSF (C17S)
A. Cloning DNA sequences encoding G-CSF. A cDNA encoding G-CSF was amplified
by PCR
from total RNA isolated from the human bladder carcinoma cell line 5637
(American Type Culture
5 Collection). The cells were grown in RPMI 1640 media supplemented with 10%
FBS, 50 units/ml penicillin
and 50 gg/ml streptomycin. RNA was isolated from the cells using an RNeasy
Mini RNA isolation kit
purchased from Qiagen, Inc. (Santa Clarita, CA) following the manufacturer's
directions. First strand
synthesis of single-stranded cDNA was accomplished using a 1st Strand cDNA
Synthesis Kit for RT-PCR
(AMV) from Boehringer Mannheim Corp and random hexamers were used as the
primer. Subsequent PCR
10 reactions using the products of the first strand synthesis as template were
carried out with forward primer
BB91 (5>CGCAAGCTTGCCACCATGGCTGGACC TGCCACCCAG>3; SEQ ID NO:1) and reverse
primer BB92 (5>CGCGGATCCTCCGGAGGGCTGGGCAAGGT GGCGTAG >3; SEQ ID NO:2). Primer
BB91 anneals to the 5' end of the coding sequence for the G-CSF secretion
signal and the reverse primer,
BB92, anneals to the 3' end of the G-CSF coding sequence. The resulting - 640
bp PCR product was
15 digested with Hind III and Bain HI, gel purified and cloned into
pCDNA3.1(+) vector that had been
digested with Hind III and Bain HI, alkaline phosphatase treated, and gel
purified. A clone with the correct
DNA sequence (Souza et al., 1986; Nagata et al., 1986a,b) was designated
pCDNA3.1(+)::G-CSFfus or
pBBT165.
PCR was used to modify this G-CSF clone for periplasmic and cytoplasmic
expression in E. coli of
20 wild type G-CSF (wild type) and a variant in which the naturally occurring
free cysteine at position 17 was
replaced by serine (C17S). The wild type G-CSF protein contains 5 cysteines,
two of which participate in
critical disulfide bonds and one free cysteine (C17) that is partially buried
and not required for activity
(Ishikawa et al., 1992, Kuga et al., 1989, Lu et al., 1992, Wingfield et al.,
1988). To avoid potential
difficulties caused by the unpaired cysteine, we constructed a variant
containing the Cys to Ser substitution
25 at position 17 (C17S) as our platform molecule. All subsequent cysteine
muteins were prepared with the
C17S substitution present. G-CSF (C17S) has been reported to possess
biological activity identical to wild
type G-CSF (Ishikawa et al., 1992, Lu et al., 1992).
Secreted G-CSF does not contain an added N-terminal methionine and has an
amino acid sequence
identical to naturally occurring G-CSF (Souza et al., 1986). In order to
express a secreted form of G-CSF,
30 PCR was used to fuse the leader sequence of the E. coli heat-stable
enterotoxin (STII) gene (Picken et al.,
1983) to the coding sequence for mature G-CSF and a TAA stop codon was added
following the carboxy-
terminal residue, P174. At the same time, the aminoterminal portion of the G-
CSF coding sequence was
also modified. Codons for prolines at positions 2, 5, and 10 were all changed
to CCG, and an Xlzo I
restriction site was introduced by changing the L18 codon from TTA to CTC in
order to facilitate
subsequent mutagenesis procedures.
These constructions were carried out in parallel for the wild type and C17S
genes and employed
three sequential PCR reactions. For the C17S construct, the first reaction
used forward primer BB116 (5>
GGCCCGGCCAGCTCCCTGCCGCAGAGCTTCCTGCTGAAGAGCCTCGAG
CAAGTGCGTAAGATCCAG>3; SEQ ID NO:3) and reverse primer BB 114
(5>CGCGAATTCTTAGGG
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
31
CTGGGCAAGGTGGCG >3; SEQ ID NO:4) and the cloned G-CSF cDNA as template. BB116
anneals to
the 5' end of the coding sequence of mature G-CSF and introduces the codon
changes noted above at P2,
P5, P10, and L18 which do not change the amino acids encoded. It also
introduces the C17S mutation
(TGC =>AGC) and changes the leucine codon at position 15 to the preferred CTG
triplet. BB 114 anneals
to the 3' end (18 bp) of the G-CSF coding sequence and introduces a TAA
translational stop codon
immediately following the the carboxy-terminal residue, P174. BB114 also
contains an Eco RI site for
cloning purposes. For the wild type construct, the first reaction used forward
primer BB 117 (5>
GGCCCGGCCAGCTCCCTGCCGCAGAGCTTCCTGCTTAAGTGCCTCGAGCAAGTGCGTAAGATC
CAG >3; SEQ ID NO:5) and reverse primer 1313 114 (sequence above) with the
cloned G-CSF cDNA as
template. BB 117 is identical to BB 116 with two exceptions; the naturally
occurring C 17 codon, TGC, is
present and the L15 codon used is CTT. This CTT creates an Aft II restriction
site in order to provide a
rapid and convenient method for distinguishing wild type C17 clones from the
C17S variant. The C17S
clones carry the CTG codon at position 15 and therefore lack the Aft II
rsetriction site. The -530 bp PCR
product from each of these reactions was gel purified and used as template for
the second PCR reaction.
For the second reaction each of the -530 bp gel purified products was
amplified with forward
primer BB115 (5> ATGTTCGTTTTCTCTATCGCTACCAACGCGTACGCAACCCCGCTG
GGCCCGGCCAGCTCCCTG >3; SEQ ID NO:6) and reverse primer BB 114 (described
above). The 3'
portion (27 nucleotides) of BB 115 anneals to the 5' end of the modified
coding sequence of mature G-CSF
which is identical in both the wild type and C 17S PCR products. The 5'
segment (36 nucleotides) of BB 115
encodes a portion of the STII leader peptide. The -550 bp PCR products of each
of these secondary
reactions were gel purified and used as template for the third and final round
of PCR.
In the third reaction each of the -550 bp gel purified products was amplified
with forward primer
BB11 (5>CCCCCTCTAGACATATGAAGAAGAACATCGCATTCCTGCTGGCATCTATGTTCGT
TTTCTCTATCG > 3; SEQ ID NO:7) and reverse primer BB 114 (described above). 131
311 adds the
remainder of the STII leader peptide and contains an Nde I site overlapping
the initiator ATG of the STII
leader as well as an Xba I site for cloning purposes. The -620 bp products of
the these reactions were
digested with Eco RI and Xba I and cloned into similarly digested plasmid
vector pBC-SK(+) (Stratagene)
for sequencing.
For the wild type construct, one clone, designated pBBT187, was found to
contain the correct
sequence for the 620 bp Nde I - Eco RI segment containing the STII-G-CSF
coding sequence. This
fragment was then subcloned into (Nde I + Eco RI) cut expression vector pCYB 1
(New England BioLabs).
The resulting plasmid was termed pBBT188. For the C17S construct, none of
three clones sequenced was
found to contain the correct sequence; all had one or more errors. One clone
contained a single missense
mutation at the A10 position of the STII leader; the rest of the sequence of
the 620 bp Nde I - Eco RI
segment was correct. In vitro recombination between this clone and plasmid
pBBT188 was used to generate
a STII-G-CSF(C17S) construct of the correct sequence in pCYB1. pBBT188 and the
C17S clone
containing the single missense mutation at the A10 position of the STII
leader, were both digested with Bsi
WI and Eco RI. The only Eco RI site present in either plasmid is that which
follows the G-CSF translational
stop codon. Bsi WI also cuts only once at a site within the coding sequence of
the STII leader peptide, 7 bp
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
32
from the beginning of the mature G-CSF coding sequence. Therefore by replacing
the -535 bp Bsi WI -
Eco RI fragment of pBBT188 with the -535 bp Bsi WI - Eco RI fragment having
the correct C17S construct
sequence, we generated a pCYB1 derivate to that expressed the STII-G-CSF(C17S)
coding sequence. This
plasmid was designated pBBT223
For cytoplasmic expression in E. coli the cloned STII-G-CSF wild type and STII-
G-CSF(C17S)
genes were modified by PCR to eliminate the STII leader sequences and add an
initiator methionine codon
(ATG) immediately preceding the codon of the amino-terminal amino acid (Ti) of
mature G-CSF. The
sequence-verified STII-G-CSF wild type and STII-G-CSF(C17S) clones were
amplified with primers BB166
(5> CGCCATATGACCCCGCTGGGCCCGGCCAG>3; SEQ ID NO:8) and BB 114 (described
above).
BB166 anneals to the 5' end of the coding sequence of mature G-CSF and encodes
an initiator methionine
preceding the first amino acid of mature G-CSF. An Nde I site, which overlaps
the ATG was included for
cloning purposes. The -540 bp products of these PCR reactions were digested
with Nde I plus Aat II, which
cuts -400 bp downstream of the Nde I site. These -400 bp fragments were gel
purified and cloned into
pBBT187, the pBC-SK(+)::STII-G-CSF construct described above, which had been
cut with Nde I plus Aat
II, treated with alkaline phosphatase and gel purified. One Met-G-CSF wild
type and one Met-G-CSF(C17S)
clone were sequenced and both were found to contain the correct sequences.
These Met-G-CSF wild type
and Met-G-CSF(C17S) genes were subcloned as Nde I - Eco RI fragments into Nde
I - Eco RI cut expression
vector pCYB 1, which is described above. The resulting plasmids were
designated: pBBT225 =
pCYB1::Met-G-CSF and pBBT226 = pCYB1::Met-G-CSF(C17S).
B. Expression of Wild Type G-CSF and G-CSF (C17S) in E. coll. pBBT225, which
encodes
Met-G-CSF wild type, pBBT226 which encodes Met-G-CSF(C17S) and the pCYB1
parent vector, were
transformed into E. coli JM109. Experiments with these strains resulted in
expression of the G-CSF
proteins. Secreted G-CSF, both wild type and C17S forms, are preferable
because they lack the non-natural
methionine residue at the N-terminus of cytoplasmically-expressed Met-G-CSF
proteins.
For expression of secreted G-CSF, pBBT188 [pCYB1::STII-G-CSF], pBBT223
[pCYB1::STII-G-
CSF(C17S)] and the parental vector pCYB1 were transformed into E. coli W3110.
The resulting strains
were designated as BOB130: W3110(pCYB1), BOB213: W3110(pBBT188), and BOB268:
W3110(pBBT223). In preliminary screening experiments, strains were grown
overnight in Luria Broth (LB
media) containing 100 pg/ml ampicillin at 37 C in roll tubes. Saturated
overnight cultures were diluted to
0.025 O.D. at A600 in LB containing 100 g/ml ampicillin and incubated at 28,
37 or 42 C in shake flasks.
Typically a 25 ml culture was grown in a 250 ml shake flask. When culture
O.D.s reached -0.3 - 0.5, IPTG
was added to a final concentration of 0.5 mM to induce expression of G-CSF.
For initial experiments,
cultures were sampled at 0, 1, 3, 5 and -16 h post-induction. Samples of
induced and uninduced cultures
were analyzed by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) on precast
14% Tris-glycine
polyacrylamide gels and stained with Coomassie Blue. Induced cultures of both
BOB213 (wild type) and
BOB268 (C17S) showed a band at approximately 19 kDA, which is consistent with
the mature G-CSF
molecular weight. This band was not detected in the uninduced cultures of
BOB213 and BOB268 or in
induced or uninduced cultures of BOB 130, the vector-only control. Western
blot analyses showed that this
-19 kDa band in BOB213 and BOB268 lysates reacted strongly with an anti-human
G-CSF antiserum
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
33
(R&D Systems). This antibody did not recognize proteins in uninduced cultures
of BOB213 and BOB 268
or in induced or uniduced cultures of BOB130, the vector only control. These
Western blots also showed
that this -19 kDa band co-migrated with a commercial human G-CSF standard
purchased from R & D
Systems. This result suggests that the STII leader peptide has been removed,
which is consistent with the
protein having been secreted to the periplasm. N-terminal sequencing studies
presented in Example 10
indicate the STII signal sequence was properly processed.
The 16 hour post-induction samples from 28 C and 37 C cultures also were
subjected to osmotic
shock based on the procedure of Koshland and Botstein (1980). This procedure
ruptures the E. coli outer
membrane and releases the contents of the periplasm into the surrounding
medium. Subsequent
centrifugation separates the soluble periplasmic components (recovered in the
supernatant) from
cytoplasmic, insoluble periplasmic, and cell-associated components (recovered
in the pellet). At both
temperatures, some of the G-CSF protein synthesized, for both wild type, by
BOB213, and C17S by
BOB268 was recovered in the supernatant, but the bulk of the G-CSF proteins
remained associated with the
pellet. This indicates that while the protein appears to be processed and
secreted to the periplasm, it is
accumulated there primarily in an insoluble form.
The preliminary screen of expression conditions for G-CSF wild type and the
C17S variant showed
that both proteins were relatively well expressed under a variety of
conditions. For large scale expression
and purification cultures were grown at 28 C and induced for -16 hours.
C. Purification of Wild Type G-CSF and G-CSF (C17S). Wild type and G-CSF
(C17S) were
expressed and purified at a larger scale using identical protocols. Fresh
saturated overnight cultures of
BOB213 (wild type) and BOB268 (C17S) were inoculated at - 0.05 OD @ A600 in LB
containing 100 g /
ml ampicillin. Typically, 400 ml cultures were grown in a 2L baffled shake
flask at 28 C in a gyrotory
shaker water bath at 250 rpm. When cultures reached a density of - 0.5 - 0.7
OD, IPTG was added to a
final concentration of 0.5 mM. The induced cultures were then incubated
overnight for -16 h. The cells
were pelleted by centrifugation and frozen at -80 C. Cell pellets were thawed
and treated with 5 mL of B-
PER TM bacterial protein extraction reagent according to the manufacturer's
(Pierce) protocols. The
insoluble material, which contained the bulk of the G-CSF protein, was
recovered by centrifugation and
resuspended in B-PER. This mixture was treated with lysozyme (200 gg/mL) for
10 min to further disrupt
the cell walls, and MgCl2 (10 mM final concentration) and protease-free DNAse
(2 g/ml) were added.
Insoluble G-CSF was collected by centrifugation and washed, by resuspension in
water and recentrifugation,
to remove most of the solubilized cell debris. The resulting pellet containing
insoluble G-CSF was dissolved
in 20 ml of 8 M urea, 25 mM cysteine in 20 mM Tris Base. This mixture was
stirred for 30 min at room
temperature then diluted into 100 ml of 40 mM sodium phosphate, 40 M copper
sulfate, 15% glycerol, pH
8Ø This refold mixture was held at 4 C for 2 days. The pH of the refold
mixture was then adjusted to 4.0
with dilute HC1 and the mixture was centrifuged before being loaded onto a 5
ml S-Sepharose column
(Pharmacia HiTrap) equilibrated in 40 mM sodium phosphate pH 4.0 (Buffer A).
The bound proteins were
eluted with a linear salt gradient from 0-100% Buffer B (500 mM NaCl, 40 mM
sodium phosphate, pH 4.0).
Wild type G-CSF and G-CSF (C17S) eluted from the S-Sepharose column as single
major peaks at a salt
concentration of approximately 300-325 mM NaCl. Column fractions were analyzed
by non-reducing SDS-
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
34
PAGE. Fractions containing G-CSF and no visible impurities were pooled. The
final yields of G-CSF wild
type and G-CSF (C17S), as determined by Bradford analysis, were about 1.1 mg
and 3.3 mg, respectively
from 400 ml of culture. Purified wild type G-CSF and G-CSF (C17S) comigrated
under reducing and non-
reducing conditions of SDS-PAGE. The apparent molecular weights of reduced and
non-reduced G-CSF
and G-CSF (C17S) are approximately 19 and 17 kDa, respectively.
D. In Vitro Bioactivities of Wild Type G-CSF and G-CSF (C17S). A cell
proliferation assay
using the murine NFS60 cell line was developed to measure bioactivities of
wild type G-CSF and G-CSF
(C17S). The NFS60 cell line was obtained from Dr. J. Ihle of the University of
Tennessee Medical School,
Memphis Tennessee. This cell line proliferates in response to human or mouse G-
CSF or IL-3 (Weinstein et
al., 1986). The cells were maintained in RPMI 1640 media supplemented with 10%
FBS, 50 units/ml
penicillin, 50 gg/ml streptomycin and 17-170 units/ml mouse IL-3 (R&D
Systems). Bioassays were
performed in cell maintenance media minus IL-3. In general, the bioassays were
set up by washing the
NFS60 cells three times with RPMI media (no additives) and resuspending the
cells at a concentration of
0.5-1x105/ml in cell maintenance media minus IL-3. Fifty l (2.5-5x103 cells)
of the cell suspension was
aliquotted per test well of a flat bottom 96 well tissue culture plate. Serial
dilutions of the protein samples to
be tested were prepared in maintenance media minus IL-3. Serial dilutions of
recombinant human G-CSF
(E. coli-expressed; R&D Systems) were analyzed in parallel. Fifty l of the
diluted protein samples were
added to the test wells and the plates incubated at 37 C in a humidified 5%
CO2 tissue culture incubator.
Protein samples were assayed in triplicate wells. After approximately 48-72 h,
20 l of CellTiter 96
AQueous One Solution (Promega Corporation) was added to each well and the
plates incubated at 37 C in
the tissue culture incubator for 1-4 h. Absorbance of the wells was read at
490 nm using a microplate reader.
Control wells contained media but no cells. Mean absorbance values for the
triplicate control wells were
subtracted from mean values obtained for the test wells. EC50s, the
concentration at half maximal
stimulation, were calculated for each sample.
The NFS60 cell line shows a strong proliferative response to G-CSF, as
evidenced by a dose-
dependent increase in cell number and absorbance values. Commercial G-CSF and
G-CSF prepared by us
had mean EC50s of 19 and 10 pg/ml, respectively, in the bioassay (Table 6).
Unexpectedly, G-CSF (C17S)
had a mean EC50 of 7 pg/ml and was reproducibly 1.5-to 2-fold more potent than
our wild type G-CSF
standard and '3-fold more potent than the commercial wild type G-CSF standard
in the bioassay (Table 3).
The superior activity of G-CSF (C17S) was surprising because others have
reported that wild type G-CSF
and G-CSF (C17S) have identical activities (Lu et al., 1992).
Example 9
Construction, Expression, Purification and Bioactivity of G-CSF (C17S)
Cysteine Muteins
A. Construction of G-CSF Cysteine Muteins.
Fifteen mutant G-CSF genes were constructed using site-directed PCR-based
mutagenesis
procedures similar to those described in PCT/US00/00931 and Innis et al.
(1990) and White (1993). We
constructed five muteins in the amino-terminal region proximal to Helix A [*-
1C (the addition of a cysteine
residue onto the natural amino terminus), TIC, L3C, A6C and S7C]; two muteins
in the B-C loop [E93C
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
and S96C]; six muteins in the C-D loop [A129C, T133C, A136, A139C, A141C and
S142C]; and two
muteins in the carboxy-terminal region distal to Helix D [Q173C and *175C (the
addition of a cysteine
residue to the natural carboxy-terminus)]. The G-CSF cysteine muteins were all
constructed in the C17S
background to avoid potential difficulties and/or ambiguities that might be
caused by the unpaired cysteine
5 normally present at position 17 in wild type G-CSF. G-CSF (C17S) had
previously been reported to possess
full biological activity (Ishikawa et al., 1992; Lu et al., 1992) and in our
E. coli secretion system we find that
the yields of purified C17S are higher than that of purified wild type G-CSF.
In addition, in the in vitro
assay our recombinant C17S is more active than wild type G-CSF produced by us
and a second E. coli-
produced recombinant wild type G-CSF obtained from a commercial vendor (R&D
Systems, Inc.).
10 The template used for the mutagenic PCR reactions was plasm id pBBT227 in
which the STII-G-
CSF (C17S) gene from pBBT223 (described in Example 8) was cloned as an Nde I -
Eco RI fragment into
Nde I - Eco RI cut pUC18. PCR products were digested with appropriate
restriction endonucleases, gel-
purified and ligated with pBBT227 vector DNA that had been cut with those same
restriction enzymes,
alkaline phosphatase treated, and gel-purified. Transformants from these
ligations were grown up and
15 plasmid DNAs isolated and sequenced. The sequence of the entire cloned
mutagenized PCR fragment was
determined to verify the presence of the mutation of interest, and the absence
of any additional mutations
that potentially could be introduced by the PCR reaction or by the synthetic
oligonucleotide primers.
The cysteine substitution mutation L3C was constructed as follows. The
mutagenic forward
oligonucleotide BB 172 (5> ACCAACGCGTACGCAACCCCGTGTGGCCCGGCCAGC >3; SEQ ID
20 NO:9) was designed to change the codon CTG for leucine at position 3 of
mature G-CSF to a TGT
encoding cysteine and to span the nearby Mlu I site. This oligo was used in
PCR with the reverse, non-
mutagenic, primer BB188 (5> GCCATCGCCCTGGATCTTACG >3; SEQ ID NO:10) which
anneals to
DNA sequences encoding amino acid residues 21 -27 of mature G-CSF in pBBT227.
A 100 l PCR
reaction was performed in 1X Promega PCR buffer containing 1.5 mM MgCl2, each
primer at 0.4 M, each
25 of dATP, dGTP, dTTP and dCTP at 200 M, 3 ng of template plasmid pBBT227
(described above), 2.5
units of Taq Polymerase (Promega), and 0.5 units of Pfu Polymerase
(Stratagene). The reaction was
performed in a Perkin-Elmer GeneAmp PCR System 2400 thermal cycler. The
reaction program entailed:
96 C for 3 minutes, 25 cycles of [95 C for 60 seconds, 60 C for 30 seconds,
72 C for 45 seconds] and a
hold at 4 C. A 10 l aliquot of the PCR reaction was analyzed by agarose gel
electrophoresis and found to
30 produce a single fragment of the expected size - 100 bp. The remainder of
the reaction was "cleaned up"
using the QlAquick PCR Purification Kit (Qiagen) according to the vendor
protocol and digested with Mu I
and Xho I (New England BioLabs) according to the vendor protocols. Following
an additional clean up step
using the QlAquick PCR Purification Kit, the digestion products were ligated
with pBBT227 that had been
cut with Mlu I and Xho I, treated with calf intestinal alkaline phosphatase
(New England BioLabs) and gel
35 purified. The ligation reaction was used to transform E. coli and plasmids
from resulting transformants were
sequenced. A clone having the L3C mutation and the correct sequence throughout
the -70 bp Mu I - Xho I
segment was identified.
The substitution mutation T1C was constructed and sequence verified using the
protocols detailed
above for L3C with the following difference. The mutagenic oligonucleotide
BB171 (5> ACCAACGCG
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
36
TACGCATGCCCGCTGGGCCCGGCCAGC >3; SEQ ID NO:11), which changes the ACC codon for
Ti
to a TGC codon for cysteine and spans the nearby Mlu I site, was used in the
PCR reaction in place of
BB 172.
The substitution mutation Q173C was constructed and sequence verified using
the protocols
detailed above for L3C with the following differences. The mutagenic reverse
oligonucleotide BB185 (5>
CGCGA ATTC TTAGGGACAGGCAAGGTGGCG >3; SEQ ID NO: 12), which changes the CAG
codon
for Q173 to a TGT codon for cysteine and spans the nearby Eco RI site, was
used in the PCR reaction in
place of BB 172. The forward, non-mutagenic, primer BB 187 (5>
GCCATCGCCCTGGATCTTACG >3;
SEQ ID NO: 13) which anneals to the DNA sequence encoding amino acid residues
78 - 84 of mature G-
CSF in pBBT227 was used in place of BB188. A 10 l aliquot of the PCR reaction
was analyzed by
agarose gel electrophoresis and found to produce a single fragment of the
expected size - 300 bp. The
remainder of the reaction was "cleaned up" using the QlAquick PCR Purification
(Qiagen) according to the
vendor protocol and digested with Sty I and Eco RI (New England BioLabs)
according to the vendor
protocols. Following an additional clean up step using the QlAquick PCR
Purification Kit, the digestion
products were run out on a 1.5 % agarose gel and the -220 bp Sty I - Eco RI
fragment of interest was gel
purified using a QlAquick Gel Extraction Kit (Qiagen) according to the vendor
protocol. The gel purified
fragment was ligated with pBBT227 that had been cut with Sty I and Eco RI,
treated with calf intestinal
alkaline phosphatase (New England BioLabs) and gel purified. The ligation
reaction was used to transform
E. coli and plasmids from resulting transformants were sequenced. A clone
having the Q173C mutation and
the correct sequence throughout the -220 bp Sty I - Eco RI segment was
identified.
A mutation was also constructed that added a cysteine following the
carboxyterminal amino acid of
the G-CSF coding sequence. This mutant, termed *175C was constructed using the
protocols described
above for the construction of the Q173C mutant with the following differences.
The mutagenic
oligonucleotide BB 186 (5> CGCGAATTCTTAACAGGGCTGGGCAAGGTGGCGTAG >3; SEQ ID
NO: 14), which inserts the a TGT codon for cysteine between the CCC codon for
P174 and a TAA stop
codon and spans the nearby Eco RI site, was used in the PCR reaction in place
of BB 185.
The substitution mutation A6C was constructed using the technique of
"mutagenesis by overlap
extension" as described in Horton et al. (1993) and PCT/US00/00931. The
initial, or "primary" PCR
reactions for the A6C construction were performed in a 50 l reaction volume
in 1X Promega PCR buffer
containing 1.5 mM MgC12 , each primer at 0.4 M, each of dATP, dGTP, dTTP and
dCTP at 200 M, 1 ng
of template plasmid pBBT227, 1.5 units of Taq Polymerase (Promega), and 0.25
units of Pfu Polymerase
(Stratagene). The reactions were performed in a Perkin-Elmer GeneAmp PCR
System 2400 thermal
cycler. The reaction program entailed: 96 C for 3 minutes, 25 cycles of [95 C
for 60 seconds, 60 C for 30
seconds, 72 C for 45 seconds] and a hold at 4 C. The primer pairs used were
[BB173 x BB188] and
[BB174 x BB125]. BB188 (5> GCCATCGCCCTGGATCTT ACG >3; SEQ ID NO:10) anneals to
DNA
sequences encoding amino acid residues 21 -27 of mature G-CSF in pBBT227.
BB125 (5> CTATGC
GGCATCAGAGCAGATA >3; SEQ ID NO: 17) anneals to the pUC18 vector sequence -20
bp upstream
of the cloned G-CSF sequence. BB 173 and BB 174 are complementary mutagenic
oligonucleotides that
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
37
change the GCC codon for A6 to a TGC codon for cysteine. The sequence of BB
173 is (5>
CCGCTGGGCCCGTGCAGCTCCCTGCCG >3; SEQ ID NO:15) and the sequence of BB174 is (5>
CGGCAGGGAGCTGCACGGGCCCAGCGG >3; SEQ ID NO: 16). The PCR products were run out
on a
2% agarose gel, which showed that the [BB173 x BB188] and [BB174 x BB125] PCR
reactions gave
products of the expected sizes: -80 bp for [BB 173 x BB 188] and -140 bp for
[BB 174 x BB 125]. These
fragments were excised from the gel, pooled, and eluted together from the
agarose gel slices using a
QIAquick Gel Extraction Kit (Qiagen) according to the vendor protocol and
recovered in 30 l 10 mM Tris-
HC1 (pH 8.5). These two mutagenized fragments were then "spliced" together in
the subsequent, or
"secondary" PCR reaction. In this reaction 3 gl of of the gel-purified PCR
products of the primary reactions
were used as template and BB 125 and BB 188 were used as primers. The reaction
volume was 100 l and
2.5 units of Taq Polymerase and 0.5 units of Pfu Polymerase were employed.
Otherwise, the reaction
conditions were identical to those used in the primary reactions. An aliquot
of the secondary PCR was
analyzed by agarose gel electrophoresis and the expected band of -190 bp was
observed. The bulk of the
secondary PCR reaction was "cleaned up" using the QIAquick PCR Purification
(Qiagen), digested with
Nde I and Xho I (New England BioLabs) according to the vendor protocols.
Following an additional clean
up using the QlAquick PCR Purification Kit, the digestion products were
ligated with pBBT227 that had
been cut with Nde I and Xho I, treated with calf intestinal alkaline
phosphatase (New England BioLabs) and
gel purified. The ligation reaction was used to transform E. coli and plasmids
from resulting transformants
were sequenced to identify a clone containing the A6C mutation and having the
correct sequence throughout
the -130 bp Nde I - Xho I segment.
The substitution mutation S7C was constructed and sequence verified using the
protocols detailed
above for A6C with the following differences. Complementary mutagenic primers
BB 175 (5>
CTGGGCCCGGCCTGCTCCCTGCCGCAG >3; SEQ ID NO:18) and BB176 (5>
CTGCGGCAGGGAGCAGGCCGGGCCCAG >3; SEQ ID NO:19), which change the AGC codon for
S7
to a TGC codon for cysteine, replaced BB 173 and BB 174 respectively in the
primary PCR reactions.
A mutation that added a cysteine codon prior to the codon for the amino-
terminal residue, T1, of
mature G-CSF was constructed and sequence-verified. This mutation, termed *-1C
was constructed using
the protocol described above for construction of A6C with the following
differences. Complementary
mutagenic primers BB206 (5> AACCCGTACGCATGTACCCCGCTGGGC >3; SEQ ID NO:20) and
BB207 (5> GCC CAGCGGGGTACATGCGTACGCGTT >3; SEQ ID NO:21), which insert a TGC
codon
for cysteine between the GCA codon for the carboxyterminal residue of the STII
leader sequence and the
ACC codon for the amino-terminal residue of mature G-CSF in pBBT227, replaced
BB173 and BB174
respectively in the primary PCR reactions. The primary PCR reactions were
performed in a 20 l reaction
volume. Each primer was present at 0.5 M. The reaction included 0.5 ng of
template plasmid pBBT227, 2
units of Taq Polymerase, and 0.25 units of Pfu Polymerase. The reaction
program entailed: 95 C for 3
minutes, 25 cycles of [94 C for 60 seconds, 60 C for 30 seconds, 72 C for
45 seconds] and a hold at 4 C.
The products of the primary reactions were loaded directly onto a preparative
2 % agarose gel. The primary
reactions gave products of the expected sizes: -100 bp for [BB206 x BB188] and
-125 bp for [BB207 x
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
38
BB 125]. In the secondary PCR, the reaction volume was 100 l, 5 pd of the gel-
purified PCR products of
the primary reactions used as template, BB187 and BB126 were used as primers,
and 4 units of Taq
Polymerase and 0.25 units of Pfu Polymerase were employed. Otherwise, the
reaction conditions were
identical to those used in the primary reactions.
The substitution mutation A129C was constructed and sequence verified using
the protocols
detailed above for A6C with the following differences. The primary PCR
reactions employed primer pairs
[B13177 x BB 126] and [BB 178 x 131 3187]. The reverse, non-mutagenic primer
BB 126 (5>
TGTGGAATTGTGAGCGGATAAC >3; SEQ ID NO:22) anneals to the pUC18 vector sequence -
40 bp
downstream of the cloned G-CSF sequence. The forward, non-mutagenic, primer BB
187 (5>
GCCATCGCCCTGGATCTTACG >3; SEQ ID NO: 13) anneals to the DNA sequence encoding
amino acid
residues 78 - 84 of mature G-CSF in pBBT227. BB177 and BB178 are complementary
mutagenic
oligonucleotides that change the GCC codon for A129C to a TGC codon for
cysteine. The sequence of
BB177 is (5> GGAATGGCCCCTTGCCTGCAGCCCACC >3; SEQ ID NO:23) and the sequence of
BB 178 is (5> GGTGGGCTGCAGGCAAGGGGCCATTCC >3; SEQ ID NO:24). The products of
the
primary reactions gave products of the expected sizes: -220 bp for [BB 177 x
1313126] and -170 bp for
[BB 178 x BB 187]. The secondary PCR employed BB 187 and BB 126 as primers and
produced a product of
the expected size: -360 bp. This product was digested with Sty I and Eco RI
(New England BioLabs)
according to the vendor protocols. Following an additional clean up using the
QlAquick PCR Purification
Kit, the digestion products were ligated with pBBT227 that had been cut with
Sty I and Eco RI, treated with
calf intestinal alkaline phosphatase (New England BioLabs) and gel purified.
The ligation reaction was
used to transform E. coli and plasmids from resulting transformants were
sequenced to identify a clone
containing the A129C mutation and having the correct sequence throughout the -
230 bp Sty I - Eco RI
segment.
The substitution mutation T133C was constructed and sequence verified using
the protocols
detailed above for A129C with the following differences. Complementary
mutagenic primers BB 179 (5>
GCCCTGCAGCCCTGCCAGGGTGCCATG >3; SEQ ID NO:25) and BB180 (5>
CATGGCACCCTGGCAGGGCTGCAG GGC >3; SEQ ID NO:26), which change the ACC codon for
T133 to a TGC codon for cysteine, replaced BB 173 and BB 174 respectively in
the primary PCR reactions.
The products of the primary reactions gave products of the expected sizes: -
205 bp for [BB 179 x 1313126]
and -180 bp for [1313 180 x 1313 187].
The substitution mutation A139C was constructed and sequence verified using
the protocols
detailed above for A129C with the following differences. Complementary
mutagenic primers BB 181 (5>
GGTGCCATGCCGTGCTTCGCCTCTGCT >3; SEQ ID NO:27) and BB 182 (5>
AGCAGAGGCGAAGCACGGCATGGCACC >3; SEQ ID NO:28), which change the GCC codon for
A139 to a TGC codon for cysteine, replaced BB173 and BB174 respectively in the
primary PCR reactions.
The products of the primary reactions gave products of the expected sizes: -
185 bp for [BB 181 x BB 126]
and -200 bp for [1313 182 x BB 187].
The substitution mutation S142C was constructed and sequence verified using
the protocols
detailed above for A129C with the following differences. Complementary
mutagenic primers BB183 (5>
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
39
CCGGCCTTCGCCTGTGCTTTCCAGCGC >3; SEQ ID NO:29) and BB 184 (5>
GCGCTGGAAAGCACAGGCGAAGGCCGG >3; SEQ ID NO:30), which change the TCT codon for
S 142 to a TGT codon for cysteine, replaced BB 173 and BB 174 respectively in
the primary PCR reactions.
The products of the primary reactions gave products of the expected sizes: -
180 bp for [BB183 x BB126]
and -210 bp for [BB 184 x BB 187].
The substitution mutation A136C was constructed and sequence verified using
the protocols
detailed above for A129C with the following differences. Complementary
mutagenic primers BB224 (5>
CCCACCCAGGGTTGCATGCCGGCCTTC >3; SEQ ID NO:3 1) and BB225 (5>
GAAGGCCGGCATGCAACCCTGGGTGGG >3; SEQ ID NO:32), which change the GCC codon for
A136 to a TGC codon for cysteine, replaced BB 173 and BB 174 respectively in
the primary PCR reactions.
The primary PCR reactions were performed in a 20 gl reaction volume. Each
primer was present at 0.5 M.
The reaction included 0.5 ng of template plasmid pBBT227, 2 units of Taq
Polymerase, and 0.25 units of
Pfu Polymerase. The reactions were performed a Perkin-Elmer GeneAmp PCR
System 2400 thermal
cycler. The reaction program entailed: 95 C for 3 minutes, 25 cycles of [94 C
for 60 seconds, 60 C for 30
seconds, 72 C for 45 seconds] and a hold at 4 C. The products of the primary
reactions were loaded
directly onto a preparative 2 % agarose gel. The primary reactions gave
products of the expected sizes: -195
bp for [BB224 x BB126] and -190 bp for [BB225 x BB187]. In the secondary PCR,
the reaction volume
was 100 l, 5 l of the gel-purified PCR products of the primary reactions
were used as template, BB187
and BB 126 were used as primers, and 4 units of Taq Polymerase and 0.25 units
of Pfu Polymerase were
employed. Otherwise, the reaction conditions were identical to those used in
the primary reactions.
The substitution mutation A141C was constructed and sequence verified using
the protocols
detailed above for A136C with the following differences. Complementary
mutagenic primers BB226 (5>
ATGCCGGCCTTCTGCTCTGCTTTCCAG >3; SEQ ID NO:33) and BB227
(5>CTGGAAAGCAGAGCAGAAGGCCGGCAT >3; SEQ ID NO:34), which change the GCC codon
for
A141 to a TGC codon for cysteine, replaced BB224 and BB225 respectively in the
primary PCR reactions.
The products of the primary reactions gave products of the expected sizes: -
180 bp for [BB226 x BB126]
and -205 bp for [BB227 x BB 187].
The substitution mutation E93C was constructed using the technique of
"mutagenesis by overlap
extension". The primary PCR reactions for the E93C construction were performed
in a 20 l reaction
volume in 1X Promega PCR buffer containing 1.5 mM MgCl2, each primer at 0.5
M, each of dATP,
dGTP, dTTP and dCTP at 200 M, 0.5 ng of template plasmid pBBT227, 2 units of
Taq Polymerase
(Promega), and 0.25 units of Pfu Polymerase (Stratagene). The reactions were
performed in a Perkin-Elmer
GeneAmp PCR System 2400 thermal cycler. The reaction program entailed: 95 C
for 3 minutes, 25
cycles of [94 C for 60 seconds, 60 C for 30 seconds, 72 C for 45 in
seconds] and a hold at 4 C. The
primer pairs used were [BB218 x BB211] and [BB219 x BB210]. The reverse, non-
mutagenic primer
BB211 (5> GGCCATTCCCAGTTCTTCCAT >3; SEQ ID NO:35) anneals to DNA sequences
encoding
amino acid residues 121 - 127 of mature G-CSF in pBBT227. The forward, non-
mutagenic primer BB210
(5> TTC GTTTTCTCTATCGCTACCAAC >3; SEQ ID NO:36) anneals to DNA sequences
encoding
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
amino acid residues 13 - 20 of the STII leader peptide in pBBT227. BB218 and
BB219 are
complementary mutagenic oligonucleotides that change the GAA codon for E93 to
a TGT codon for
cysteine. The sequence of BB218 is (5> CTGCAGGCCCTGTGTGGGATCTCCCCC >3; SEQ ID
NO:37) and the sequence of BB219 is (5> GGGGGAGATCCCACACAGGGCCTGCAG >3; SEQ ID
5 NO:38). The products of the primary reactions were loaded directly onto a
preparative 2 % agarose gel
which showed that PCR reactions gave products of the expected sizes: -115 bp
for [BB218 x BB211] and
-325 bp for [BB219 x BB210]. These fragments were excised from the gel,
pooled, and eluted together
from the agarose gel slices using a QIAquick Gel Extraction Kit (Qiagen)
according to the vendor protocol
and recovered in 30 l 10 mM Tris-HCl (pH 8.5). In the secondary PCR reaction,
5 l of the pool of gel-
10 purified PCR products of the primary reactions was used as template and
BB211 and BB210 were used as
primers. The reaction volume was 100 l and 4 units of Taq Polymerase and 0.25
units of Pfu Polymerase
were employed. Otherwise, the reaction conditions were identical to those used
in the primary reactions.
An aliquot of the secondary PCR was analyzed by agarose gel electrophoresis,
and the expected band of
-415 bp was observed. The bulk of the secondary PCR reaction was "cleaned up"
using the QlAquick PCR
15 Purification (Qiagen) and digested with Sty I and Xho I (New England
BioLabs) according to the vendor
protocols. Following an additional clean up using the QlAquick PCR
Purification Kit, the digestion
products were ligated with pBBT227 that had been cut with Sty I and Xho I,
treated with calf intestinal
alkaline phosphatase (New England BioLabs) and gel purified. The ligation
reaction was used to transform
E. coli and plasmids from resulting transformants were sequenced to identify a
clone containing the E93C
20 mutation and having the correct sequence throughout the -260 bp Sty I - Xho
I segment.
The substitution mutation S96C was constructed and sequence verified using the
protocols detailed
above for E93C with the following differences. Complementary mutagenic primers
BB220 (5>CTG GAA
GGG ATC TGC CCC GAG TTG GGT >3; SEQ ID NO:39) and BB221 (5> ACC CAA CTC GGG
GCA
GAT CCC TTC CAG >3; SEQ ID NO:40), which change the TCC codon for S96 to a TGC
codon for
25 cysteine, replaced BB218 and BB219 respectively in the primary PCR
reactions. The products of the
primary reactions gave products of the expected sizes: -110 bp for [BB220 x
BB211] and -330 bp for
[BB221 x BB210].
For expression in E. coli as proteins secreted to the periplasmic space, the
STII-G-CSF (C17S)
genes encoding the muteins were excised from the pUC18-based pBBT227
derivatives as Nde I - Eco RI
30 fragments of -600 bp, subcloned into the pCYB 1 expression vector, and
transformed into E. coli W3110.
Using procedures similar to those described here, one can construct other
cysteine muteins of G-
CSF and G-CSF (C17S). The cysteine muteins can be substitution mutations that
substitute cysteine for a
natural amino residue in the G-CSF coding sequence, insertion mutations that
insert a cysteine residue
between two naturally occurring amino acids in the G-CSF coding sequence, or
addition mutations that add
35 a cysteine residue preceding the first amino acid, Ti, of the G-CSF coding
sequence or add a cysteine
residue following the terminal amino acid residue, P174, of the G-CSF coding
sequence. The cysteine
residues can be substituted for any amino acid, or inserted between any two
amino acids, anywhere in the G-
CSF coding sequence. Preferred sites for substituting or inserting cysteine
residues in G-CSF are in the
region preceding Helix A, the A-B loop, the B-C loop, the C-D loop, and the
region distal to Helix D. Other
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/USO1/16088
41
preferred sites are the first or last three amino acids of the A, B, C, and D
Helices. In addition to the
mutations described above, other preferred residues in these regions for
creating cysteine substitutions are
P2, G4, P5, S8, L9, P10, Qll, S12, T38, K40, S53, G55,156, W58, A59, P60, L61,
S62, S63, P65, S66,
Q67, A68, Q70, A72, Q90, A91, L92, G94, 195, S96, E98, G100, G125, M126, A127,
Q131, Q134, G135,
S142, A143, Q145, and P174. All of the variants described in this Example are
provided in the context of
the natural protein sequence or a variant protein in which the naturally
occurring "free" cysteine residue
(cysteine-17) has been changed to another amino acid, preferably serine or
alanine.
One also can construct G-CSF and G-CSF (C17S) muteins containing a free
cysteine by
substituting another amino acid for one of the naturally occurring cysteine
residues in G-CSF that normally
forms a disulfide bond. The naturally occurring cysteine residue that normally
forms a disulfide bond with
the substituted cysteine residue is now free. The cysteine residue can be
replaced with any of the other 19
amino acids, but preferably with a serine or alanine residue. These variants
are provided in the context of the
natural protein sequence or a variant protein in which the naturally occurring
"free" cysteine residue
(cysteine-17) has been changed to another amino acid, preferably serine or
alanine. A free cysteine residue
also can be introduced into G-CSF by chemical modification of a naturally
occurring amino acid using
procedures such as those described by Sytkowski et al. (1998).
Using procedures similar to those described in Examples 8, 9, 10, 11 and 13 ,
one can express the
proteins in E. coli, purify the proteins, PEGylate the proteins and measure
their bioactivities in in vitro and
in vivo bioassays. The proteins can be expressed cytoplasmically in E. coli or
as proteins secreted to the
periplasmic space. The muteins also can be expressed in eukaryotic cells such
as insect or mammalian
cells, using procedures similar to those described in PCT/US00/00931, or
related procedures well known to
those skilled in the art. If secretion from eukaryotic cells is desired, the
natural G-CSF signal sequence, or
another signal sequence, can be used to secrete the proteins from eukaryotic
cells.
B. Expression and Purification of G-CSF (C17S) Cysteine Muteins. E. coli
strains expressing
13 G-CSF (C17S) muteins (*-1C, T1C, L3C, A6C, S7C, E93C, A129C, T133C, A136C,
A139C, A141C,
Q173C, and *175C) were grown, induced and harvested using the protocols
described in Example 8 that
were employed for BOB213 (wild type) and BOB268 (C17S). All of the muteins
were largely insoluble.
The muteins were refolded and purified using the protocols described in
Example 8 for G-CSF wild type
and G-CSF (C17S). Non-reducing SDS-PAGE analysis revealed that the 13 purified
cysteine muteins were
recovered predominantly as monomers, migrating at approximately 17 kDa. The
purified muteins
comigrated with wild type G-CSF and G-CSF (C17S), with the exception of the *-
1C mutein, which
migrated slightly slower than wild type G-CSF. All but one of the muteins
eluted from the ion-exchange
column at a salt concentration similar to wild type G-CSF and G-CSF (C17S).
The one exception, E93C,
eluted later during the gradient (NaC1 concentration of approximately 400 mM),
possibly due to the
substitution of cysteine for the charged amino acid, glutamic acid.
C. Bioactivities of G-CSF (C17S) Cysteine Muteins. The 13 purified G-CSF
(C17S) cysteine
muteins were assayed in the NFS60 cell proliferation assay described in
Example 8. Protein concentrations
were determined using a Bradford protein assay kit (Bio-Rad Laboratories).
Commercial wild type G-CSF
and wild type G-CSF and G-CSF (C17S) prepared by us were analyzed in parallel
on the same days to
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
42
control for interday variability in the assays. All 13 muteins stimulated
proliferation of the NFS60 cells to
the same extent as the wild type G-CSF control proteins, within the error of
the assay. Mean EC50s for the
13 muteins ranged from 5-9 pg/ml. Mean EC50s for the cysteine muteins were
similar to the mean EC50 of
the G-CSF (C17S) control protein and 1.5 to 2- fold lower , i.e., more potent,
than the mean EC50 for our
wild type G-CSF control protein and - 3-fold lower than the mean EC50 for the
commercial wild type G-
CSF protein. These data are summarized in Table 6.
Table 6
Bioactivities of Wild Type G-CSF, G-CSF (C17S) and G-CSF (C17S) Cysteine
Muteins
G-CSF Mutation Location Mean EC50 EC50 Range 1
Protein (pg/ml) (pg/ml)
R&D G-CSF 2 - 18.6+/-6.6 12-35 =12)
BBT G-CSF 3 - 10.2+/-1.6 8.5-13 (N=8)
G-CSF (C17S) - 7.2+/-2.0 5-12 (N=18)
*-1C / C17S N-terminus 7.0 5.8, 6.0, 7.5, 8.5
T 1 C / " N-terminus 7.8 4.5, 5.0, 9.0, 10
L3C/ " Proximal to A Helix 8.0 4.5, 7.5, 9.0, 9.0, 10
A6C / " Proximal to A Helix 8.2 4.5, 9.0, 11
S7C/ " Proximal to A Helix 7.3 3.8,8.0,10
E93C / " B-Cloop 7.6 6.5, 7.5, 8.0, 8.5
A129C C-D loop 6.0 6.0, 6.0, 6.0
T133C / " C-D loop 6.6 5.0, 6.0, 6.5, 7.5, 8.0
A136C / " C-D loop 8.3 7.0, 7.5, 8.5, 10
A139C / " C-D loop 5.2 5.0, 5.0, 5.5
A141C / " C-D loop 8.9 7.5, 8.5, 9.5, 10
Q173C / " Distal to D Helix 6.2+/-1.3 5.2-9.0 (N=7)
*175C/ " C-terminus 5.6 5.0, 5.5, 5.5, 6.0, 6.0
'EC50 values from individual experiments; a range is shown when N > 5
2 Commercial wild type G-CSF (R&D Systems)
3 Wild type G-CSF prepared by Bolder BioTechnology, Inc.
D. Construction of G-CSF double cysteine mutants
Multiple mutants containing two or more added free cysteine residues can be
constructed either by
sequential rounds of mutagenesis using the procedures described in Examples 9,
14 and 15, or alternatively
by in vitro recombination of individual mutants to construct recombinant
expression plasmids encoding
muteins containing two or more free cysteine residues. The preferred multiple
mutants would be those that
combined two or more cysteine muteins that each retained high activity when
PEGylated. Examples would
be L3C plus T133C, L3C plus *175C, and T133C and *175C. Other preferred
multiple mutants can be
deduced based on the data from Table 3 and Table 4, and would include
combinations containing two or
more mutations selected from the group consisting of L3C, T133C, A141C and
*175C.
We constructed the following G-CSF double cysteine mutants: L3C/T133C,
L3C/*175C, and
T133C/*175C. To produce L3C/T133C, the L3C derivative of pBBT227 (G-CSF C17S
in pUC18) was
digested with Xho I and EcoR I, and treated with Calf Intestine Alkaline
Phosphatase. The DNA was
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
43
extracted using the Qiagen PCR cleanup kit, and is called G-CSF L3C X-Rl-Cip
vector. Next, the T133C
derivative of pBBT227 was digested with Xho I and EcoR I, and the -480bp
fragment was gel purified and
ligated with the G-CSF L3C X-Rl-Cip vector. E. coli JM109 was transformed with
the ligation reaction
and clones having the correct sequence were identified.
To produce L3C/*175C, the *175C derivative of pBBT227 was digested with Xho I
and EcoR I,
and the -480bp fragment was gel purified and ligated with the G-CSF L3C X-Rl-
Cip vector (see above). E.
coli JM109 was transformed with the ligation reaction and clones having the
correct sequence were
identified.
To produce T133C/*175C, the T133C derivative of pBBT227 served as template in
a PCR
reaction using the reverse mutagenic oligonucleotide primer BB 186 (5 > CGC
GAA TTC TTA ACA GGG
CTG GGC AAG GTG GCG TAG > 3; SEQ ID NO:14) and the forward non-mutagenic
oligonucleotide
BB125, which anneals to pUC18 vector sequences upstream of the G-CSF insert.
The PCR was a 50 l
reaction performed in 1X Promega PCR buffer containing 1.5 mM MgCl2, each
primer at 0.4 M, each of
dATP, dGTP, dTTP and dCTP at 200 M, 0.5 ng of template fragment, 1 unit of
Taq Polymerase
(Promega), and 0.1 unit of Pfu Polymerase (Stratagene). The reaction was
performed in a Perkin-Elmer
GeneAmp PCR System 2400 thermal cycler. The reaction program entailed: 95 C
for 5 minutes, 22
cycles of [94 C for 30 seconds, 55 C for 30 seconds, 72 C for 45 seconds], a
7 min hold at 72 C and a
hold at 4 C. Twenty l of the PCR were analyzed by agarose gel
electrophoresis, and the -630bp fragment
was isolated from the gel. This fragment was digested with Xho I and EcoR I,
extracted using the Qiagen
PCR cleanup kit. This DNA was ligated to a vector prepared by digesting the
T133C derivative of
pBBT227 with Xho I and EcoR I, treating with Calf Intestine Alkaline
Phosphatase and extracting using the
Qiagen PCR cleanup kit. E. coli JM109 was transformed with the ligation
reaction and clones having the
correct sequence were identified.
Example 10
PEGylation, Purification and Bioactivity of G-CSF Cysteine Muteins
A. Preliminary PEGylation studies. Initial PEGylation reaction conditions were
determined
using TIC as the test protein, TCEP [Tris (2-carboxyethyl) phosphine]-HC1 as
the reducing agent and 5kDa
cysteine reactive PEGs from Shearwater Polymers, Inc. Over-reduction of the
protein was monitored by
non-reducing SDS-PAGE, looking for a shift to a higher than expected apparent
molecular weight as a result
of protein unfolding, or for the appearance of multiple PEGylated species
generated as the result of native
disulfide reduction. One g aliquots of purified TIC were incubated with
increasing concentrations of
TCEP at room temperature in 100 mM Tris, pH 8.5 in the presence of varying
amounts of excess 5 1cDa
maleimide-PEG or 5kDa vinylsulfone-PEG. After 60 min, the reactions were
immediately analyzed by non-
reducing SDS-PAGE. The amounts of TCEP and particular PEG reagent that yielded
significant amounts of
monoPEGylated TIC protein, without modifying wild type G-CSF, were used for
further experiments. The
titration experiments indicated that at pH 8.5, a 10-fold molar excess of TCEP
and 20-fold excess of 5 kDa
maleimide PEG yielded significant amounts of monoPEGylated TIC protein
(apparent molecular weight of
28 kDa by SDS-PAGE) without detectable di- or tri-PEGylated protein. Wild type
G-CSF and G-CSF
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
44
(Cl7S) were not modified under identical PEGylation conditions. These reaction
conditions were used to
scale up the PEGylation of the other G-CSF muteins. Control experiments
indicated that the TIC protein
needed to be partially reduced by treatment with a reductant such as TCEP in
order to be PEGylated.
B. Preparation and Purification of PEGylated G-CSF Cysteine Muteins: Aliquots
of 200 to
300 g of the 13 purified G-CSF cysteine muteins were PEGylated with a 5 kDa
maleimide PEG to provide
sufficient material for purification and characterization. The larger
PEGylation reactions also were
performed for 1 hr at room temperature, using the conditions described above.
These reaction conditions
yielded monoPEGylated protein for all of the muteins. Eleven of the
monoPEGylated muteins have been
purified using the procedure described below. At the end of the reaction time,
the PEGylation mixture was
diluted lOX with 40 mM sodium phosphate (monobasic) and the pH adjusted to 4.0
before being loaded
quickly onto an S-Sepharose column (1 mL, HiTrap) using conditions similar to
those described for the
initial purification of the G-CSF muteins (20 mL gradient, 0-0.5 M NaCl in 40
mM sodium phosphate pH
4). The presence of the PEG moiety decreased the protein's affinity for the
resin, allowing the PEGylated
protein to be separated from the non-PEGylated protein. The chromatograms from
the S-Sepharose
columns showed two major protein peaks eluting at approximately 275 mM NaCl
and 300-325 mM NaCI
for most muteins. The early eluting major peak was determined to be the mono-
PEGylated G-CSF (C17S)
mutein by SDS-PAGE. The later eluting major peak was determined to be the
unreacted G-CSF (C17S)
mutein. The PEG-E93C mutein eluted at about 325 mM NaCl versus about 400 mM
NaCI for unreacted
E93C protein. Fractions from the early eluting peak containing predominantly
the monoPEGylated G-CSF
(C17S) mutein were pooled and used for bioactivity measurements. Five cysteine
muteins (L3C, T133C,
A141C, Q173C and *175C) also were PEGylated using a 20 kDa PEG-maleimide and
the PEGylation and
purification procedures described above. The 20 kDa-PEGylated proteins eluted
from the S-Sepharose
column at approximately 250 mM NaCl. SDS-PAGE analyses indicated that the
purified PEGylated
proteins contained less than 10%, and probably less than 5%, unPEGylated
protein. The cysteine muteins
needed to be partially reduced by treatment with a reductant such as TCEP in
order to be PEGylated. Wild
type G-CSF and G-CSF (C17S) did not PEGylate under identical partial reducing
conditions, indicating that
the PEG moiety is attached to the cysteine residue introduced into the
muteins.
C. Purification and PEGylation of the L3C G-CSF Cysteine Mutein: Time courses
of the
refold and the PEGylation reactions for L3C were performed. The refold for
this particular mutein was
found to be complete by 4 hours. The refold reaction progression was monitored
by reverse phase HPLC
(C4 column). Yields were -10 mg/400 mL of culture grown as described in
Example 8. Time courses were
performed for the PEGylation of the L3C mutein with 10 kDa, 20 kDa and 40 kDa
PEGS. PEGylation
reaction conditions were as described above in Example 10, with the exeception
that 0.5 mM EDTA was
included in the PEGylation buffers. For 0.5 - 1 mg reactions, longer reactions
times of 2-4 h at room
temperature yielded greater amounts of PEGylated product. The efficiencies of
PEGylation was -80% with
the extended time. Larger (up to 5 mg) PEGylation reactions were performed
with equal efficiency.
PEGylated protein was purified from non-PEGylated protein on a 5 mL S-
Sepharose column using the
purification methodology previously described in Example 10. The 20 kDa
PEGylated
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/USO1/16088
protein eluted at -200 mM NaCl, while the 40 kDa-PEG protein and 10 kDa-PEG
protein eluted at -150
mM and --220 mM, respectively. The unPEGylated G-CSF L3C mutein eluted at -260
mM. The presence
of EDTA significantly reduced the formation of protein dimers in the
PEGylation reaction.
D. N-terminal sequencing of 20 kDa-PEG-L3C. The N-terminal amino acid of
natural G-CSF is
5 threonine (Souza et al., 1986). N-terminal sequencing of the purified 20 kDa-
PEG-L3C protein using
automated Edman degradation chemistry yielded the sequence TPXGPAS, which
indicates that the N-
terminus is correctly processed and is consistent with the third residue being
PEGylated; PEGylated amino
acids show up as blanks in sequencing runs, as indicated by the X..
E. Structural Determination of PEGylated G-CSF Cysteine Muteins by Circular
Dichroism
10 (CD) Analysis: CD analysis was performed on a Jasco 720 CD
spectropolarimeter in a 1 cm pathlength
300 L cell at ambient temperature. Data were collected from 260 nm-200 run at
a sensitivity of 50m and
32 accumulations. Initial experimentation was performed with the L3C mutein
and 10K PEG-L3C protein.
Both had CD spectra very similar to that found in the literature for wild-type
G-CSF. Similar analyses can
be performed on other G-CSF cysteine muteins and their PEGylated derivatives.
15 F. Bioactivities of PEGylated G-CSF (C17S) Cysteine Muteins: Biological
activities of the 11
purified 5 kDa- PEG-G-CSF (C17S) cysteine muteins and 5 purified 20 kDa-PEG-G-
CSF (C17S) cysteine
muteins were measured in the NFS60 cell proliferation assay described in
Example 8. Concentrations of
the proteins were determined using a Bradford dye binding assay. All of the
PEGylated G-CSF (C17S)
cysteine muteins showed similar dose-response curves and reached the same
level of maximal growth
20 stimulation as G-CSF (C17S), within the error of the assay. Mean EC50s for
the 5 kDa-PEG modified
cysteine muteins ranged from 2-11 pg/ml. These PEGylated muteins were 1.5- to
2-fold more potent than
our wild type G-CSF and - 3-fold more potent than the commercial wild type G-
CSF in the bioassay. Mean
EC50s for the 20 kDa-modified cysteine muteins ranged from 9 to 14 pg/ml.
Biological activities of the
PEGylated G-CSF (C17S) cysteine muteins were equal to, or superior to, that of
wild type G-CSF. All of the
25 NFS60 cell stimulatory activity of 5 kDa-PEG-L3C could be abolished by a
neutralizing monoclonal
antibody to G-CSF (R & D Systems, Inc.), indicating that the growth promoting
activity is due to the PEG-
L3C G-CSF protein and not to a contaminant in the protein preparation. The
bioactivity data are
summarized in Table 7. The EC50 of L3C modified with a 40 kDa-PEG was
determined to be 30-50 pg/ml
using the NFS60 cell proliferation assay.
30 Biological activities of the PEGylated G-CSF (C17S) cysteine muteins
described here are superior
to the activities of previously described PEGylated G-CSF proteins, all of
which have biological activities
that are reduced relative to wild type G-CSF (Tanaka et al., 1991; Kinstler et
al., 1996a; Bowen et al.,
1999). Tanaka et al. (1991) reported that G-CSF modified with an amine-
reactive 10 kDa NHS-PEG
consisted of multiple molecular weight species and multiple isoforms modified
at different lysine groups or
35 the N-terminal amino acid. Biological activity of this NHS-PEG mixture was
determined to be reduced
approximately 3-fold relative to unmodified G-CSF (Tanaka et al., 1991; Satake-
Ishikawa et al., 1992).
Bowen et al. (1999) reported that a G-CSF variant modified with 5 kDa-, 10 kDa-
and 20 kDa-amine-
reactive PEGs were reduced approximately 6-fold, 10-fold and 20-fold relative
to unmodified G-CSF.
Bowen et al. (1999) purified a single molecular weight species of the
PEGylated G-CSF variant modified
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
46
with a 20 kDa-amine-reactive-PEG and found that its biological activity was
reduced approximately 4-fold
relative to unmodified G-CSF. Although the single molecular weight species
isolated by Bowen et al.
(1999) corresponded to the G-CSF variant modified with a single PEG molecule,
the PEG-protein
preparation was heterogeneous due to the PEG molecule being attached to the
protein at multiple sites.
Kinstler et al. (1996) purified a PEGylated Met-G-CSF species that is modified
preferentially at the non-
natural amino-terminal methionine residue of E. coli-expressed Met-G-CSF
(cytoplasmically expressed) via
amine or amide linkages. This PEGylated Met-G-CSF protein possessed only 68%
of the in vitro
bioactivity of wild type Met-G-CSF (Kinstler et al., 1996).
Table 7
Bioactivities of PEGylated G-CSF Cysteine Muteins
EC50s ( /ml)
G-CSF Protein 5 kDa PEG 20 kDa PEG
a
Mean Range 1 Mean Range
*-IC /C17S 5.6 5.5,5.5, 5.5, 6.0
TiC/ " 7.0 6.0, 7.0, 8.0
L3C/ " 5.5 5.0,5.3, 6.2 8.8 8.0, 8.0, 9.0, 10
A6C / " 6.9 6.0, 6.0, 7.5, 8.0
S7C/ " 2.4 1.7, 3.0
E93C/ " 1.9 1.6,2.0,2.0,2.0
A129C / " 7.1 5.0, 5.2, 11
T133C/ " 7.4 5.2,6.0,11 9.0 6.0,7.0,11,12
A136C / " 6.9 6.0, 6.5, 6.5, 8.5
A139C / " 6.8 5.0, 5.5, 10
A141C/ " 7.1 6.5, 7.0, 7.0, 8.0 9.3 6.0,6.0,12,13
173C/ " 7.0 5.5,5.5,10 11 9.0,10,12, 13
*175C/ " 11 10,11,12 14 12,12,16,16
aEC50 values from individual experiments
Example 11
Use of A Cysteine Blocking Agent Improves Recovery of Properly Folded G-CSF
Cysteine Muteins
Insoluble, E. coli-expressed wild type G-CSF and G-CSF (C17S/Q173C) were
refolded by
procedures that varied the amount and type of reducing agent and the presence
or absence of catalytic
amounts of copper sulfate. 5 mM dithiothreitol (DTT) was chosen as the
standard reducing agent based on a
literature reference that describes its use in an optimized refold protocol
for G-CSF (Kuga et al., 1989). Lu
et al. (1992) describes a protocol for refolding/renaturing insoluble G-CSF
that has no reducing agent
present during the solubilization step but does contain 40 M copper sulfate
in the renaturation buffers.
E. coli cultures (400 mL) were grown and expression of each G-CSF protein was
induced as
described in Example 8. The cells were lysed and the insoluble portion was
isolated by centrifugation as
described in Example 8. The insoluble material, which contained a majority of
the insoluble G-CSF
proteins, was suspended in 20 mL of 8 M urea, 20 mM Tris, pH 8 and stirred
until homogeneous. The
mixture was aliquotted into 6 tubes. 5 mM DTT or 25 mM cysteine were added to
certain of the tubes as
described in Table 6. After one hour the solublization mixtures were diluted
into 25 mL of 40 mM sodium
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
47
phosphate, 15% glycerol, pH 8 with and without 40 M copper sulfate The
refolds were allowed to sit at
4 C for two days. At this time the pH of each was adjusted to 4. The refolds
were centrifuged, the
supernatants loaded onto an S-Sepharose column and the G-CSF wild type and
Q173C proteins purified as
described in Example 8. Column fractions were pooled based on non-reducing SDS-
PAGE analysis, as
described in Example 8. The amount of each protein recovered after
chromatography is shown in Table 5.
Table 8
Recoveries of G-CSF Proteins Refolded/Renatured in the Presence
And Absence of Different Reducing Agents
Refold Reducing Agent Copper G-CSF (WT) G-CSF (C17S/Q173C)
Protocol Sulfate Yield ( g) a Yield (,g) a
A None None 49 161
B None 40 M 24 73
C 5 mM DTT None 17 23
D 5mM DTT 40 M 47 53
E 25 mM cysteine None 60 243
F 25 mM cysteine 40 M 80 275
a Protein recovered from 67 ml of E. coli culture
As shown in Table 8 the greatest yields of G-CSF wild type and the G-CSF
cysteine mutein were
achieved when cysteine was used as the reducing agent during the
solubilization step. The presence of
copper sulfate (40 M) appeared to marginally enhance recoveries when used in
conjunction with a
reducing agent. Non-reducing SDS-PAGE analysis of wild type G-CSF proteins
recovered using Refold
protocols A-F showed that each contained predominantly a single molecular
weight species of the size
expected for monomeric G-CSF (approximately 17 kDa under non-reducing
conditions). In contrast, when
the S-Sepharose column pools from G-CSF (C17S/Q173C) Refolds A-D were analyzed
by non-reducing
SDS-PAGE, the final product band was broad and contained a number of different
apparent molecular
weight species in the monomeric range. Presumably the different molecular
weight, monomeric species
represent different disulfide isoforms of the G-CSF (C17S/Q173C) protein. The
G-CSF (C17S/Q173C)
protein recovered from refolds E and F ran as a single sharp band that
comigrated with wild type G-CSF,
indicating that a single, predominant folded species had been recovered. The
data show that addition of
cysteine during the solubilization and refolding steps significantly enhances
the yield of properly folded G-
CSF (C17S/Q173C) protein. Although not wishing to be bound by any particular
theory, we postulate that
the added cysteine forms a mixed disulfide with the free cysteine residue in
the mutein. The mixed disulfide
limits possible disulfide rearrangments that could occur involving the free
cysteine residue. Cysteine may
be more effective than DTT because DTT typically does not form mixed
disulfides due to a
thermodynamically preferred intramolecular bond that forms upon oxidation.
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
48
Example 12
Comparison of G-CSF Protein Stabilities Prepared in the Presence and Absence
of Cysteine
Wild type G-CSF and G-CSF (C17S/Q173C) proteins prepared as described in
Example 11 using
Refold procedure A (no reducing agent, no copper sulfate) and Refold procedure
F (25 mM cysteine, 40 gM
copper sulfate) were placed at 50 C at pH 4 and pH 8. At times 0, 5 minutes,
30 minutes, 1, 2, 3, 4, 5, and
20 hours, the protein samples were centrifuged to remove any denatured protein
precipitates. Aliquots were
removed from the supernatants and frozen. At the end of the experiment, all
aliquots were analyzed by non-
reducing SDS-PAGE to determine what portion of the original G-CSF protein
sample remained in solution
and was monomeric. Each protein's soluble half-life was determined based on
relative band intensities as
visualized on the gel. The results are shown in Table 9.
Table 9
Stabilities of G-CSF Proteins Prepared Using Different Refold/Renaturation
Procedures
Protein Sample H Estimated Half-life
G-CSF WT Refold A 4 3-4 hours
G-CSF WT Refold F 4 3-4 hours
G-CSF WT Refold A 8 -1 hour
G-CSF WT Refold F 8 -4 hour
G-CSF (C17S/Q173C) Refold A 4 -30 minutes
G-CSF (C17S/ 173C) Refold F 4 > 20 hours
G-CSF (C17S/Q173C) Refold A 8 < 15 minutes
G-CSF (C17S/ 173C) Refold F 8 >20 hours
The results show that wild type G-CSF has a longer soluble half-life at pH 4
than at pH 8, which is
consistent with results previously reported by Arakawa et al.(1993). The
soluble half-life of wild type G-
CSF was not substantially different whether the protein was refolded using
Refold Procedure A or F. In
contrast, G-CSF (C17S/Q173C) had a much longer soluble half-life when the
protein was refolded using
Procedure F (> 20 hours) rather than Procedure A (<30 minutes). Thus, in
addition to increasing the
recovery of properly folded G-CSF cysteine muteins, use of cysteine in the
solubilization/refolding process
increases the thermal stability of the final product.
Additional studies can be performed to compare the stabilities of G-CSF
cysteine muteins to wild
type G-CSF. For example, a matrix of experiments can be performed by exposing
the proteins to various
pHs, temperatures and serum concentrations. At various time points, the
intregrity of the proteins can be
moniotered by assays such as, but not limited to, the NFS60 in vitro cell
proliferation bioactivity assay
described in Example 8, size exclusion chromatography, Circular Dichroism,
ELISA assays and Western
blot analysis.
Example 13
In Vivo Efficacy of PEG-G-CSF Cysteine Muteins
Groups of three male Sprague Dawley rats, weighing - 320g each, received a
single intravenous
injection (lateral tail vein) of wild type recombinant G-CSF (prepared by
Bolder BioTechnology),
Neupogen (a recombinant G-CSF sold by Amgen, Inc.) or PEG-L3C at a dose of
100 g/kg. Protein
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/USO1/16088
49
concentrations were determined using a Bradford dye binding assay. At selected
time points blood samples
(0.3 to 0.4 ml) were drawn from the rats into EDTA anti-coagulant tubes.
Aliquots of the blood samples
were sent to a commercial firm for a complete blood cell (CBC) count. The
remainder of the blood sample
was centrifuged and the plasma frozen at -80 C. Blood samples were drawn at
0.25 , 1.5, 4, 8, 12, 16, 24,
48, 72, 96, 120 and 144h post-injection. A 0 h baseline sample was obtained -
24 h prior to injection of the
test compounds. Tables 10 and 11 show the mean blood neutrophil and total
white blood cell counts for the
different test groups over time. All three test compounds stimulated an
increase in peripheral white blood
cells and neutrophils over baseline values. White blood cell and neutrophil
counts for the test groups
receiving wild type recombinant G-CSF and Neupogen peaked - 24 h post-
injection and returned to
baseline values by - 48 h. In contrast, white blood cell and neutrophil counts
for the rats receiving PEG-
L3C peaked -48-72 h post-injection and did not return to baseline values until
- 120 h post-injection. Peak
white blood cell and neutrophil levels observed in the rats receiving PEG-L3C
were significantly higher than
for the groups receiving wild type recombinant G-CSF or Neupogen (p<0.05).
The data indicate that
PEG-L3C is capable of stimulating an increase in circulating neutrophil and
white blood cells, and that the
absolute increase in peripheral white blood cell counts and neutrophils is
greater and longer lasting than that
seen with wild type G-CSF or Neupogen . Similar experiments can be performed
to demonstrate efficacy
of other PEGylated G-CSF cysteine muteins (C17 or C17S versions). Similar
studies also can be performed
using the subcutaneous route for administration of the proteins.
Table 10
Effects of G-CSF, Neupogen and PEG-L3C on Neutrophil Blood Cell Counts
Following Single
Intravenous Administration of the Proteins (100 g/kg)
Neutrophils
Time (Hr) Mean +/- SE
(cells/ 1 blood
G-CSF a Neu o en PEG-L3C
0 1,147 +/- 167 1,906 +/- 564 1,596 +/- 462
4 6,752 +/- 923 4,504+/- 549 4,237 +/- 624
8 8,437 +/- 546 5,525+/- 894 5,939 +/- 664
12 10,744 +/- 549 11,891 +/- 1,545 b 8,470 +/- 833
24 11,035 +/- 788 11,148 +/- 977 14,849 +/- 1,398
48 2,355 +/- 218 2,610 +/- 245 b,c 18,488 +/- 2,954
72 2,113 +/- 438 3,077+/- 590 17,353 +/- 2,515
96 2,086 +/- 496 2,675+/- 673 5,467 +/- 914
120 2,179 +/- 373 2,063+/- 469 2,390 +/- 238
a Wild type G-CSF prepared by Bolder BioTechnology, Inc.
b p< 0.05 versus 0 hour neutrophil levels
p< 0.05 versus G-CSF and Neupogen at same time point
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/USO1/16088
Table 11
Effects of G-CSF, Neupogen and PEG-L3C on White Blood Cell Counts Following
Single
Intravenous Administration of the Proteins (100 /k
White Blood Cells
Time (Hr) Mean +/- SE
(cells/ l blood)
G-CSF a Neu o en PEG-L3C
0 11,100 +/- 252 11,100+/- 829 12,900 +/- 1,320
4 16,000 +/- 1,059 13,600+/- 570 13,700 +/- 1,923
8 15,200 +/- 371 14,900+/- 260 13,800 +/- 1,044
12 18,400 +/- 240 20,100+/- 674 16,700 +/- 586
24 23,900 +/- 1,110 25,500 +/- 1,734 29,200 +/- 2,321
48 14,700 +/- 426 15,300 +/- 1,715 b` 37,400 +/- 4,971
72 15,300 +/- 426 14,800+/- 764 c 37,800 +/- 4,715
96 14,200 +/- 1,000 14,700 +/- 689 18100 +/- 2,550
120 11,000 +/- 2,651 11,300 +/- 1,477 13,800 +/- 1,189
a Wild type G-CSF prepared by Bolder BioTechnology, Inc.
5 b p< 0.05 versus 0 hour white blood cell levels
p< 0.05 versus G-CSF and Neupogen at same time point
Plasma G-CSF and PEGylated G-CSF cysteine mutein protein levels can be
quantitated using
commercially available G-CSF ELISA kits (R & D Systems, Inc.). Titration
experiments can be performed
10 to determine the relative sensitivity of the ELISA for detecting wild type
G-CSF, unmodified G-CSF
cysteine muteins and PEGylated G-CSF cysteine muteins. Similar studies can be
performed using the
subcutaneous route of administration of the proteins.
Plasma concentrations of the proteins from the efficacy experiment outlined
above in Example 13
were measured using human G-CSF ELISA kits purchased from R & D Systems, Inc.
Results are shown in
15 Table 12. The results indicate that 20 kDa-PEG-L3C has a significantly
longer circulating half-life than
wild type G-CSF or Neupogen following intravenous administration of the
proteins to rats.
Table 12
Plasma concentrations of G-CSF, Neupogen and 20 kDa-PEG-L3C Following a
Single Intravenous
Administration of the Proteins (dose of 100 g/kg)
Time Post-injection G-CSF a Neupogen 20 kDa-PEG-L3C
(hour) (ng/ml) (ng/ml) (ng/ml)
Mean +/- S.D. Mean +/- S.D. Mean +/- S.D.
0 0+/-0 0+/-0 0+/-0
0.25 6,974 +/- 1,809 7,546 +/- 486 9,667 +/- 1,382
1.5 1,866 +/- 292 2,083 +/- 461 8,368 +/- 1,215
4 399 +/- 73 534 +/- 131 7,150 +/- 892
8 101+/-21 167 +/- 26 5,692 +/- 1,094
12 14 +/- 5 26+/-1.1 4,165 +/- 783
16 2 +/- 3 2.9+/-0.5 3,669 +/- 513
24 0.9+/-0.3 0.08 +/- 0.03 2,416 +/- 462
48 0.16 +/- 0.01 0 +/- 0 773 +/- 137
72 0.08 +/- 0.02 0 +/- 0 36 +/- 36
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
51
Time Post-injection G-CSF a Neupogen 20 kDa-PEG-L3C
(hour) (ng/ml) (ng/ml) (ng/ml)
Mean +/- S.D. Mean +/- S.D. Mean +/- S.D.
96 0.11+/- 0.02 0+/_0 0.62 +/- 0.13
120 0.05 +/- 0.02 0+/_0 0.15 +/- 0.02
144 0.03+/-0.02 0+/-0 0.03+/-0.01
a Wild type G-CSF prepared by Bolder BioTechnology, Inc.
In vivo efficacy of the PEGylated G-CSF cysteine muteins (C17 or C17S
versions) can be
measured in normal or neutropenic rodents such as mice or rats by
demonstrating that the proteins stimulate
increases in circulating neutrophil levels and granulopoiesis compared to
vehicle-treated animals. G-CSF
stimulates neutrophil levels in normal and neutropenic rodents at a dose of
100 gg/kg (Kubota et al., 1990;
Kang et al., 1995). For demonstrating efficacy in normal mice, groups of 5
mice (weighing - 20 g each)
can receive subcutaneous injections of G-CSF, PEG-G-CSF cysteine muteins or
placebo (vehicle solution)
at specified intervals for up to five days. Normal mice such as ICR mice can
be purchased from a
commercial vendor. On day 6 the animals can be sacrificed and blood samples
collected for complete blood
cell count (CBC) analysis. Hematopoietic tissues (liver and spleen) can be
collected, weighed and fixed in
formalin for histopathologic analyses to look for evidence of increased
granulopoiesis. Bone marrow can be
removed from various long bones and the sternum for unit particle preps and
histopathologic analysis to
look for evidence of increased granulopoiesis. Comparisons between groups
should be made using a
Students T test for single comparisons and one-way analysis of variance for
multiple comparisons. P< 0.05
should be considered significant. The PEGylated G-CSF cysteine muteins should
stimulate greater
increases in circulating neutrophil levels and granulopoiesis in the mice
compared to the vehicle-treated
mice. Efficacy of the PEGylated G-CSF cysteine muteins modified with 5 kDa, 10
kDa, 20 kDa or 40 kDa
PEGs can be tested when administered once, once per day, every other day, or
every third day. In initial
experiments, different groups of mice can receive subcutaneous injections of
0.0032, 0.016, 0.08, 0.4 and 2
gg per injection of the PEGylated G-CSF cysteine muteins. Control mice can
receive vehicle solution only.
Additional control groups can receive wild type G-CSF (2 jig/ every day (ED)
for 5 days) and 2 g wild type
G-CSF using the same dosing regimen as the PEGylated G-CSF cysteine muteins.
Efficacy of the PEGylated G-CSF cysteine muteins also can be demonstrated in
neutropenic mice.
Neutropenia can be induced by treatment with cyclophosphamide (CPA; 100
mg/kg), which is a commonly
used myelosuppressive chemotherapeutic agent and relevant to the human
clinical setting. G-CSF
accelerates recovery of normal neutrophil levels in cyclophosphamide-treated
animals (Kubota et al., 1990;
Kang et al., 1995; Matsuzaki et al., 1996). Mice (-20g) can receive an
intraperitoneal injection of
cyclophosphamide on day 0 to induce neutropenia. The animals should be divided
into different groups,
which should receive subcutaneous injections of G-CSF, PEGylated G-CSF
cysteine muteins or placebo at
specified intervals for up to five days. One control group should not receive
cyclophosphamide but should
receive placebo injections. Efficacy of the PEGylated G-CSF cysteine muteins
modified with 5 kDa, 10
kDa, 20 kDa or 40 kDa PEGS can be tested when administered once, every other
day, or every third day. In
initial experiments, different groups of mice can receive subcutaneous
injections of 0.0032, 0.016, 0.08, 0.4
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
52
and 2 gg per injection of the PEGylated G-CSF cysteine muteins. Control mice
can receive vehicle solution
only. Additional control groups can receive wild type G-CSF (2 g/ every day
(ED) for 5 days) and
2 g/injection of wild type G-CSF using the same dosing regimen as the
PEGylated G-CSF cysteine muteins.
On days 0-10, five mice per group can be sacrificed and blood and tissue
samples analyzed as described for
the normal mouse experiments above. The PEGylated G-CSF cysteine muteins
should stimulate an
accelerated increase in circulating neutrophil levels and granulopoiesis in
the mice compared to the vehicle-
injected, CPA-injected control group.
Alternatively, efficacy of PEGylated G-CSF cysteine muteins can be
demonstrated in neutropenia
studies using a rat model. G-CSF accelerates the recovery of normal neutrophil
levels in rats treated with
myleosuppressive chemotherapeutic agents. In this case, groups of Spague
Dawley rats (weighing -300g
each) can receive an intraperitoneal dose of CPA (100 mg/kg) at Day 0 to
induce neutropenia. The animals
can then be divided into three groups, those who receive subcutaneous
injections of G-CSF, PEGylated G-
CSF cysteine muteins or placebo at specified intervals for up to 10 days. One
control group can receive
placebo injections rather than cyclophosphamide. In initial experiments,
efficacy of the PEGylated G-CSF
cysteine muteins modified with 10 kDa, 20 kDa and 40 kDa PEGS can be measured
by performing
subcutaneous doses of -0.1 g-500 g/kg (with the preferential range being 1-
100 gg/kg) when doses are
administered once, every day, every other day or every third day. An
additional control group can receive
commercially available wild type G-CSF (100 gg/kg) every day for 5 days and
another control group can
receive wild type G-CSF with the same dose and dosing regimen as with the
PEGylated G-SCF cysteine
mutants. Control rats can receive vehicle solution only. On days 0-6, 8, 10,
12, and 14 blood samples can
be collected for CBC analysis. At the completion of the time course, the rats
can be sacrificed for collection
of the hematopietic tissues and bone marrow to investigate evidence of
increased granulopoiesis. The
PEGylated G-CSF cysteine mutants should stimulate an accelerated increase in
circulating neutrophil levels
and granulopoiesis in the rats compared to the vehicle-injected, CPA injected
control group.
Example 14
Cloning, Expression, Purification and Bioactivity of Wild Type GM-CSF
A. Cloning DNA sequences encoding GM-CSF. We cloned and sequenced a cDNA
encoding
human GM-CSF by RT-PCR of total RNA isolated from the human bladder carcinoma
cell line 5637
(obtained from the American Type Culture Collection). A cDNA encoding G-CSF
was amplified by PCR
from total RNA isolated from the human bladder carcinoma cell line 5637
(American Type Culture
Collection). The cells were grown in RPMI 1640 media supplemented with 10%
FBS, 50 units/ml penicillin
and 50 g/ml streptomycin. RNA was isolated from the cells using an RNeasy
Mini RNA isolation kit
purchased from Qiagen, Inc. (Santa Clarita, CA) following the manufacturer's
directions. First strand
synthesis of single-stranded cDNA was accomplished using a 1st Strand cDNA
Synthesis Kit for RT-PCR
(AMV) from Boehringer Mannheim Corp and random hexamers were used as the
primer. Subsequent PCR
reactions using the products of the first strand synthesis as template were
carried out with forward primer
BB267 (5 > GAC ACT GCT GCT GAG ATG AAT G > 3; SEQ ID NO:75) and reverse primer
BB268 (5 >
CTT GTA GTG GCT GGC CAT CAT G > 3; SEQ ID NO:76). Primer BB268 anneals to the
5' end of the
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
53
coding sequence for the GM-CSF secretion signal and the reverse primer, BB268,
anneals to the 3' end of
the GM-CSF coding sequence. The resulting - 450 bp PCR product was digested
with Hind III and Bain
HI, gel purified and cloned into pCDNA3.1(+) vector that had been digested
with Hind III and Bain HI,
alkaline phosphatase treated, and gel purified. A clone with the correct DNA
sequence was designated
pCDNA3.1(+)::GM-CSFfus or pBBT267. We used PCR to modify this GM-CSF clone for
periplasmic
expression in E. coli. When expressed in E. coli, via secretion to the
periplasm, GM-CSF does not contain
an added N-terminal methionine and has an amino acid sequence identical to
naturally occurring GM-CSF
(Lee et al., 1985). In order to express a secreted form of GM-CSF, PCR was
used to fuse the leader
sequence of the E. coli heat-stable enterotoxin (STII) gene (Picken et al.,
1983), preceeded by an Nde I
restiction site, to the amino-terminal coding sequence of mature GM-CSF. In
addition, a TAA stop codon,
followed immediately by an Eco RI restriction site, was added following the
carboxy-terminal residue,
E127. At the same time, codons for prolines at positions 2, 6, 8, 12, 117 and
124 were all changed to CCG,
and the codon for leucine at position 114 was changed to CTG. The PCR reaction
used forward primer
BB300 (5> CGC AAC GCG TAC GCA GCA CCG GCC CGC TCG CCG AGC CCG AGC ACG CAG
CCG TGG GAG >3; SEQ ID NO:77) and reverse primer BB301 (5> CGC GAA TTC TTA CTC
CTG
GAC CGG CTC CCA GCA GTC AAA CGG GAT GAC CAG CAG AAA >3; SEQ ID NO:78) with
pBBT267 as template. The resulting - 400 bp PCR product was digested with Mlu
I and Eco RI, gel
purified, and cloned into pBBT227 which is described in Example 9 above.
pBBT227 DNA was digested
with Mlu I and Eco RI, alkaline phosphatase treated, and run out on a 1%
agarose gel. The - 2.4 kb vector
fragment was purified and used in ligation. The resulting recombinants carry a
complete stIl leader fused to
GM-CSF and this "stll-GM-CSF" construct can be excised as an Nde I - Eco RI
fragment of - 450 bp. One
clone with the correct sequence was designated pUC18::stII-GM-CSF. For
expression studies the Nde I -
Eco RI fragment of this plasmid was subcloned into the expression vector
pBBT257, which is described in
below. The resulting plasmid, pBBT257; stII-muGM-CSF, or pBBT271 was
introduced into E coli W3110
for expression.
The plasmid pBBT257 was derived from the expression vector pCYB 1 (New England
BioLabs) by
deleting the ampicillin resistance gene of pCYB 1 and replacing it with the
gene for tetracycline resistance
derived from the classic cloning vector pBR322 (Bolivar et al, 1977) In both
pBBT257 and pCYB1,
expression of the cloned gene is under the control of the tac promoter, which
is regulated by the product of
the plasmid-borne lacla gene' These vectors allow genes to be expressed as
unfused proteins or as fusions to
a chitin binding domain; our constructs were created so that the proteins are
expressed as unfused proteins.
Plasmid pBBT257 was constructed as follows. The tetracycline resistance gene
(TCR gene) of plasmid
pBR322 (purchased from New England bioLabs) was amplified by PCR using primers
BB228 (5> CGC
GCT GCA GTT CTC ATG TTT GAC AGC TTA TCA TC >3; SEQ ID NO:41) and BB229 (5 >
CGC
GCT GCA G AT TTA AAT TAG CGA GGT GCC GCC GGC TTC CAT > 3; SEQ ID NO:42).
Forward
primer BB228 anneals to nucleotides 1 through 25 of the pBR322 sequence
(GenBank Accession #
J01749), which are located upstream of the TcR gene and include the "-35"
portion of the TcR gene
promoter. Oligo BB228 contains an added Pst I site for cloning purposes. The
reverse primer BB229
anneals to nucleotides 1277 through 1300, which are located immediately
downstream of the translational
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
54
stop codon that follows the coding sequence of the TcR gene. BB229 contains an
added Dra I site for
cloning purposes. The 40 1 PCR reaction was performed in 50 mM KCl, 10 mM
Tris-HC1(pH 9.0 @ 25
C), 0.1% Triton X-100, 1.5 mM MgC12 and included dNTPs at 200 M each, 20
pmole of each primer,
0.5 ng of pBR322 DNA, 2.5 units of Taq polymerase (Promega), and 0.5 units of
PFU polymerase
(Stratagene). The PCR reaction consisted of 95 C for 3 minutes, 25 cycles of
[94 C for 30 seconds, 60 C
for 30 seconds, 72 C for 90 seconds] followed by a 4 C hold. The resulting
1300 bp product was gel
purified, digested with Pst I and Dra I and used in a ligation reaction as
described below. Purified pCYB 1
DNA was digested with Pst I and SwaI and treated with calf intestine alkaline
phosphatase according to the
vendor (New England BioLabs) protocols. Pst I and Swa I each cut the vector
once and flank the ampicillin
resistance (ApR) gene. The digestion products were cleaned up using a Qiaquick
PCR Cleanup Kit
(Qiagen) according to the vendor protocol and subsequently run out on a 1 %
agarose gel. The -5.3 kb
vector fragment, deleted for the APR gene, was gel purified and ligated with
the Pst I - Dra I cut PCR
product containing the TcR gene. Both Dra I and Swa I generate blunt-ended
digestion products that can be
ligated together. The ligation reaction was used to transform E. coli DH5a and
tetracycline-resistant
transformants were selected. Three isolates were subsequently analyzed and all
were found to be sensitive
to ampicillin. Restriction endonuclease digestion products obtained from these
isolates were also consistent
with deletion of the -1500 bp Pst I and Swa I fragment containing the APR gene
and its replacement by the
1300 bp Pst I - Dra I fragment that carries the TcR gene. One isolate,
designated pBBT257, was chosen
for use in expression of recombinant proteins.
B. Expression of Wild Type GM-CSF in E. coli. For expression of secreted GM-
CSF, pBBT271
[pBBT257:: STII-GM-CSF] and the pBBT257 parent vector, were transformed into
E. coli W3110. The
resulting strains were designated as BOB340: W3110(pBBT257) and BOB350:
W3110(pBBT271). Fresh
saturated overnight cultures were inoculated at - 0.05 OD @ A600 in LB
containing 10 g / ml tetracycline.
These 100 ml cultures were grown in a 500 mL baffled shake flask at 28 C in a
gyrotory shaker water bath
at -250 rpm. When the culture reached a density of - 0.6 OD, IPTG was added to
a final concentration of
0.5 mM and the induced culture was then incubated overnight for -16 h. Samples
of induced and uninduced
cultures were analyzed by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) on
precast 16% Tris-
glycine polyacrylamide gels and stained with Coomassie Blue. The induced
culture of BOB350 (GM-CSF)
gave a band at approximately 14 kDA, which is consistent with the mature GM-
CSF molecular weight. This
band was not detected in an uninduced culture of BOB350 or in induced or
uninduced cultures of BOB340,
the vector-only control. Western blot analyses showed that this -14 kDa band
reacted strongly with an anti-
human GM-CSF antiserum (R&D Systems). This antiserum did not recognize
proteins in uninduced
cultures of BOB340 and BOB 350 or in the induced culture BOB340, the vector
only control. These
Western blots also showed that this -14 kDa band co-migrated with a
commercial, E. coli-derived human
GM-CSF standard purchased from R & D Systems. This result suggests that the
STII leader peptide has
been removed, which is consistent with the protein having been secreted to the
periplasm. N-terminal
sequencing studies presented below indicate the STII signal sequence was
properly processed.
The 16 hour post-induction samples from these cultures also were subjected to
osmotic shock
based on the procedure of Koshland and Botstein (1980). This procedure
ruptures the E. coli outer
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
membrane and releases the contents of the periplasm into the surrounding
medium. Subsequent
centrifugation separates the soluble periplasmic components (recovered in the
supernatant) from
cytoplasmic, insoluble periplasmic, and cell-associated components (recovered
in the pellet). Little of the
GM-CSF protein synthesized was recovered in the supernatant. The bulk of the
GM-CSF remained
5 associated with the pellet. This indicates that while the protein appears to
be processed and secreted to the
periplasm, it accumulates there primarily in an insoluble form. Similar
results have been reported by others
for GM-CSF secreted to the E coli periplasm (Libby et al., 1987; Greenberg et
al., 1988).
C. Purification of Wild Type GM-CSF. Wild type GM-CSF was expressed and
purified at a
larger scale using the following protocols. A fresh saturated overnight
culture of BOB350 (wild type) was
10 inoculated at - 0.05 OD @ A600 in LB containing 10 g / ml tetracycline.
The 400 ml culture was grown in
a 2L baffled shake flask at 28 C in a gyrotory shaker water bath at -250 rpm.
When the culture reached a
density of - 0.6 OD, IPTG was added to a final concentration of 0.5 mM. The
induced culture was then
incubated overnight for -16 h. The cells were pelleted by centrifugation and
frozen at -80 C. The cell
pellet was thawed and treated with 5 mL of B-PER TM bacterial protein
extraction reagent according to the
15 manufacturer's (Pierce) protocols. The insoluble portion, and the bulk of
the GM-CSF protein, was
recovered by centrifugation and resuspended in B-PER. This mixture was treated
with lysozyme (200
g/mL) for 10 min to further disrupt the cell walls, and MgCl2 (10 mM final)
and protease-free DNAse (2
gg/ml) were added. Insoluble GM-CSF was collected by centrifugation and
washed, by resuspension in
water and recentrifugation, to remove most of the solubilized cell debris. For
refolding, the resulting pellet
20 containing insoluble GM-CSF was dissolved in 10 ml of 8 M urea, 25 mM
cysteine in 20 mM Tris Base.
This mixture was stirred for 30 min at room temperature then diluted into 100
ml of 20 mM Tris, 40 M
copper sulfate, 15% glycerol, pH 8Ø This refold mixture was held at 4 C for
2 days and then centrifuged
and loaded onto a 5 ml Q-Sepharose column (Pharmacia HiTrap) equilibrated in
20 mM Tris, pH 8.0
(Buffer A). The bound proteins were eluted with a linear salt gradient from 0-
35% Buffer B (IM NaCl, 20
25 mM Tris, pH 8). Column fractions were analyzed by non-reducing SDS-PAGE. GM-
CSF eluted at
approximately 230 mM NaCl. Fractions containing primarily GM-CSF were pooled.
The Q-Sepharose pool was diluted with an equal volume of 30% ammonium sulfate
and warmed to
room temperature before being loaded onto a 1 mL Phenyl HP column (Pharmacia
HiTrap) previously
equilibrated with 15% ammonium sulfate in 20 mM sodium phosphate, pH 7.5.
Purified GM-CSF was
30 recovered from the column by elution with a reverse salt gradient (15%
ammonium sulfate to 0%
ammonium sulfate in 20 mM sodium phosphate, pH 7.5). The Phenyl HP column
elution profile for GM-
CSF showed a single major peak, eluting at approximately 6.5% ammonium
sulfate. Column fractions
across the peak were analyzed by non-reducing SDS-PAGE. Fractions containing
GM-CSF and no visible
contaminants were pooled. The final yield of wild type GM-CSF as determined by
Bradford analysis, was
35 about 2.6 mg from 400 ml of culture. N-terminal sequencing of wild type GM-
CSF using automated Edman
degradation chemistry yielded the sequence APARSPS, which identically matches
the first seven amino
acids of mature human GM-CSF, and indicates that the N-terminus is correctly
processed (Lee et al., 1985).
Purified wild type GM-CSF and commercially available GM-CSF (E. coli-
expressed; R&D Systems) co-
migrated under reducing and non-reducing conditions as shown by Western blot
analysis. Both proteins
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
56
exhibited the expected mobility shift to a higher apparent molecular weight
under reducing conditions
because of the disruption of the intramolecular disulfide bonds.
D. In Vitro Bioactivities of Wild Type GM-CSF. A cell proliferation assay
using the human TF-1
erythroleukemic cell line (Kitamura et al., 1989) was developed to measure
bioactivity of wild type GM-
CSF. The human TF-1 cell line was obtained from the American Type Culture
Collection. The cells were
maintained in RPMI 1640 media supplemented with 10% FBS, 50 units/ml
penicillin, 50 g/ml
streptomycin and 2 ng/ml recombinant human GM-CSF (E. coli-derived; R&D
Systems). In general, the
bioassays were set up by washing the TF-1 cells three times with RPMI 1640
media (no additives) and
resuspending the cells at a concentration of 1x105/ml in RPMI 1640 media
containing 10% FBS, 50 units/ml
penicillin and 50 gg/ml streptomycin (assay media). Fifty 1d (5x103 cells) of
the cell suspension was
aliquotted per test well of a flat bottom 96 well tissue culture plate. Serial
dilutions of the protein samples to
be tested were prepared in assay media . Serial dilutions of commercial
recombinant human GM-CSF (E.
coil-expressed; R&D Systems) were analyzed in parallel. Fifty l of the
diluted protein samples were added
to the test wells and the plates incubated at 37 C in a humidified 5% CO2
tissue culture incubator. Protein
samples were assayed in triplicate wells. After - 3 days, 20 l of an MTS/PMS
mixture (CellTiter 96
AQueous One Solution, Promega) was added to each well and the plates incubated
at 37 C in the tissue
culture incubator for 1-4 h. Absorbance of the wells was read at 490 urn using
a microplate reader. Control
wells contained media but no cells. Mean absorbance values for the triplicate
control wells were subtracted
from mean values obtained for the test wells. EC50s, the concentration at half
maximal stimulation, were
calculated for each sample to compare bioactivities of the proteins.
The TF-1 cell line shows a strong proliferative response to GM-CSF, as
evidenced by a dose-
dependent increase in cell number and absorbance values. Commercial GM-CSF and
GM-CSF prepared by
us had mean EC50s of 97 and 105 pg/ml, respectively, in the bioassay (Table
13).
Example 15
Construction, Expression, Purification and Bioactivity of GM-CSF Cysteine
Muteins
A. Construction of GM-CSF Cysteine Muteins. Thirteen mutant GM-CSF genes were
constructed using site-directed PCR-based mutagenesis as described in general
by Innis et al., 1990) and
Horton et all, (1993) and in the Example 9. We constructed five muteins in the
amino-terminal region
proximal to Helix A [*-1C (the addition of a cysteine residue onto the natural
amino terminus), A1C, A3C,
S5C and S7C]; one mutein in the B-C loop [S69C]; three muteins in the C-D loop
[1393C, T94C, and
T102C]; and three muteins in the carboxy-terminal region distal to Helix D
[V125C, Q126C and *128C (the
addition of a cysteine residue to the natural carboxy-terminus)]. We also
constructed one mutein at a
putative N-linked glycosylation site [N27C], which is located at the distal
end of Helix A. The template
used for the mutagenic PCR reactions was plasmid pBBT268 in which the STII-GM-
CSF gene is cloned as
an Nde I - Eco RI fragment in pUC18. PCR products were digested with
appropriate restriction
endonucleases, gel-purified and ligated with pBBT268 vector DNA that had been
cut with those same
restriction enzymes, alkaline phosphatase treated, and gel-purified.
Transformants from these ligations were
grown up and plasmid DNAs isolated and sequenced. The sequence of the entire
cloned mutagenized PCR
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
57
fragment was determined to verify the presence of the mutation of interest,
and the absence of any additional
mutations that potentially could be introduced by the PCR reaction or by the
synthetic oligonucleotide
primers.
For expression in E. coli as proteins secreted to the periplasmic space, the
STII-GM-CSF genes
encoding the 13 muteins were excised from the pUC18-based pBBT268 derivatives
as Nde I - Eco RI
fragments of -450 bp, subcloned into the pBBT257 expression vector, and
transformed into E. coli W3 110.
Using procedures similar to those described here, one can construct other
cysteine muteins of GM-
CSF. The cysteine muteins can be substitution mutations that substitute
cysteine for a natural amino residue
in the GM-CSF coding sequence, insertion mutations that insert a cysteine
residue between two naturally
occurring amino acids in the GM-CSF coding sequence, or addition mutations
that add a cysteine residue
preceding the first amino acid, Al, of the GM-CSF coding sequence or add a
cysteine residue following the
terminal amino acid residue, E127 , of the GM-CSF coding sequence. The
cysteine residues can be
substituted for any amino acid, or inserted between any two amino acids,
anywhere in the GM-CSF coding
sequence. Preferred sites for substituting or inserting cysteine residues in
GM-CSF are in the region
preceding Helix A, the A-B loop, the B-C loop, the C-D loop, and the region
distal to Helix D. Other
preferred sites are the first or last three amino acids of the A, B, C, and D
Helices. Some preferred positions
for cysteine mutations are described in Table 13. Other preferred positions
include R67C, G68C, L70C,
R30C, T32C, A33C, E35C, N37C, T39C, E45C, D48C, Q50C, E5 1C, Q99C, T98C, El
13C and E127C. In
addition to the mutations described above, other preferred residues in these
regions for creating cysteine
substitutions are described in PCT/US98/14497.
One also can construct GM-CSF muteins containing a free cysteine by
substituting another amino
acid for one of the naturally occurring cysteine residues in GM-CSF that
normally forms a disulfide bond.
The naturally occurring cysteine residue that normally forms a disulfide bond
with the substituted cysteine
residue is now free. The cysteine residue can be replaced with any of the
other 19 amino acids, but
preferably with a serine or alanine residue. A free cysteine residue also can
be introduced into GM-CSF by
chemical modification of a naturally occurring amino acid using procedures
such as those described by
Sytkowski et al. (1998).
Multiple mutants containing two or more added free cysteine residues can also
be constructed
either by sequential rounds of mutagenesis using the procedures described in
Examples 8, 9, 14 and 15 or
alternatively by in vitro recombination of individual mutants to construct
recombinant expression plasmids
encoding muteins containing two or more free cysteines. The preferred multiple
mutants would be those
that combined two or more cysteine muteins that each retain high activity when
PEGylated for example A3C
plus S69C, S69C plus E93C, and A3C plus E93C. Other preferred multiple mutants
can be deduced based
on the data from Table 9 and Table 10 and would include combinations
containing two or more mutations
from the group including *-1C, A1C, A3C, SSC, S7C, S69C and E93C.
Using procedures similar to those described in Examples 14 - 16, one can
express the proteins in
E. coli, purify the proteins, PEGylate the proteins and measure their
bioactivities in an in vitro bioassay.
The proteins can be expressed cytoplasmically in E. coli or as proteins
secreted to the periplasmic space.
The muteins also can be expressed in eukaryotic cells such as insect or
mammalian cells, using procedures
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
58
similar to those described in PCT/US00/00931, or related procedures well known
to those skilled in the art.
If secretion from eukaryotic cells is desired, the natural GM-CSF signal
sequence, or another signal
sequence, can be used to secrete the proteins from eukaryotic cells.
B. Expression and Purification of GM-CSF Cysteine Muteins. E. coli strains
expressing the 13
GM-CSF cysteine muteins were grown, induced and harvested using the protocols
described for wild type
GM-CSF in Example 14. The muteins were refolded and purified using the
protocols described for wild
type GM-CSF in Example 14. The muteine eluted from the Q-Sepharose column at
approximately 200-230
mM NaCl and from from the Phenyl HP column at approximately 6-8% ammonium
sulfate. The muteins
were recovered predominantly as monomers, with apparent molecular weights of -
14 kDa by non-reducing
SDS-PAGE.
C. Bioactivities of GM-CSF Cysteine Muteins. The 13 purified GM-CSF cysteine
muteins were
assayed in the TF-1 cell proliferation assay. Protein concentrations were
determined using a Bradford
protein assay kit (Bio-Rad Laboratories). Commercial wild type GM-CSF and wild
type GM-CSF prepared
by us were analyzed in parallel on the same days to control for interday
variability in the assays. All 13
muteins stimulated proliferation of the TF-1 cells to the same extent as the
wild type GM-CSF control
proteins. Mean EC50s for the 13 muteins ranged from 80 to 134 pg/ml (Table
13).
Table 13
Properties of GM-CSF Cysteine Muteins
GM-CSF Mutation Mean EC50 EC50 Range
Protein Location SD ( /ml) (pg/ml)
R&D wt - 97 5 90-100(6)
BBTwt - 105 8 90-115(14)
*-1C N-terminus 111 5 105-115(4)
A1C N-terminus 80 0 80-80(4)
A3C Proximal to A Helix 108 3 105-110(4)
S5C Proximal to A Helix 125 6 120-130(4)
S7C Proximal to A Helix 106 6 100-110(4)
N27C A Helix 134 30 105-160(4)
S69C B-C loop 103 10 90-110(4)
E93C C-D loop 103 14 90-115(4)
T94C C-D loop 120 4 115-125(4)
T102C C-D loop 114 3 110-115(4)
V 125C Distal to D Helix 110 0 110-110(4)
Q126C Distal to D Helix 126 9 120-140(4)
*128C C-terminus 124 3 120-125(4)
Observed range of EC50 values; number of assays in parentheses.
b Commercial wild type GM-CSF (R&D Systems)
'Wild type GM-CSF prepared by Bolder BioTechnology
Example 16
PEGylation, Purification and Bioactivity of GM-CSF Cysteine Muteins
A. Preliminary PEGylation studies. Initial PEGylation reaction conditions were
determined
using A1C, S7C and S69C as the test proteins, TCEP [Tris (2-carboxyethyl)
phosphine]-HCI as the reducing
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
59
agent and 5kDa cysteine reactive PEGs from Shearwater Polymers. Three g
aliquots of the purified
cysteine muteins or wild type GM-CSF were incubated with increasing
concentrations of TCEP at room
temperature in 100 mM Tris, pH 8.5 in the presence of excess 5 kDa maleimide-
PEG or 5 kDa vinylsulfone-
PEG (linear forms of a polyethylene glycol polymer composed of a molecular
weight average of 5 kDa with
a reactive maleimide or vinylsulfone group at one of the polymer ends). The
maleimide and vinyl sulfone
groups react with Michael nucleophiles, with a high selectivity for mercaptan
groups such as those
contained on cysteine side chains. After 90 min, the reactions were
immediately analyzed by non-reducing
SDS-PAGE. The amounts of TCEP and particular PEG reagent that yielded
significant amounts of
monoPEGylated cysteine protein, without modifying wild type GM-CSF, were
chosen for use in subsequent
experiments. The titration experiments indicated that at pH 8.5, a 15-fold
molar excess of TCEP and 20-
fold excess of 5 kDa maleimide-PEG yielded significant amounts of
monoPEGylated AlC protein and
monoPEGylated S7C protein without detectable di- or tri-PEGylated protein. In
the case of GM-CSF S69C,
5 kDa vinylsulfone-PEG was preferred over 5 kDa maleimide-PEG, and yielded
significant amounts of
monoPEGylated S69C protein. Recombinant wild type GM-CSF was unreactive to the
PEGs, even in the
presence of a 50-fold molar excess of TCEP. Control experiments indicated that
the muteins needed to be
partially reduced to be PEGylated.
B. Preparation and Purification of PEGylated GM-CSF Cysteine Muteins: Aliquots
of 200 to
300 .tg of 10 purified GM-CSF cysteine muteins were PEGylated to provide
sufficient material for
purification and characterization. The larger PEGylation reactions also were
performed for 1.5 hr at room
temperature. For each of the mutants, a 15-fold excess of TCEP and 20-fold
excess of 5 kDa maleimide-
PEG was used. The only exception was S69C where 5 kDa vinylsulfone-PEG was
used. These reaction
conditions yielded monoPEGylated protein for all ten muteins. At the end of
the reaction time, the
PEGylation mixture was diluted 20X with ice cold 20 mM Tris, pH 8.0 before
being loaded quickly onto an
Q-Sepharose column (1 mL, HiTrap) using conditions similar to those described
for the initial purification
of the GM-CSF muteins (25 mL gradient, 0-0.35 M NaCl in 20 mM Tris pH 8). The
presence of the PEG
moiety decreases the protein's affinity for the resin, allowing the PEGylated
protein to be separated from the
non-PEGylated protein. Non-reducing SDS-PAGE analyses of the PEGylation
reactions showed that only
detectable PEGylated species was the PEG-GM-CSF cysteine mutein monomer, which
migrates with an
apparent molecular weight - 26 kDa. The chromatogram from the Q-Sepharose
column showed two major
protein peaks. The early eluting major peak (160-200 mM NaCl) was determined
to be mono-PEGylated
GM-CSF protein by SDS-PAGE. The second major peak (200-230 mM NaCl) was
determined to be
unreacted GM-CSF protein. Fractions from the early eluting peak containing
predominantly
monoPEGylated GM-CSF cysteine mutein were pooled and used for bioactivity
measurements. All the
GM-CSF muteins were PEGylated and purified by the identical protocol. The
PEGylated proteins displayed
similar apparent molecular weights by SDS-PAGE, except for the PEG-E93C and
PEG-T94C muteins,
which displayed slightly smaller apparent molecular weights. Four of the
cysteine muteins in the N-terminal
region (*-1C, A1C, A3C, and S7C) also have been PEGylated on a small scale
using 10- and 20 kDa
maleimide PEGs. These reactions were performed with 3 g of each mutein using
the conditions described
above, and analyzed by SDS-PAGE. Each of these proteins reacted readily with
the 10 kDa and 20 kDa
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/USO1/16088
PEG reagents, yielding monoPEGylated protein. 40 kDa-PEG-A3C was also prepared
following the
protocol described above. This protocol was scaled up to provide larger
quantities of the 10 kDa-, 20 kDa-
and 40-kDa-PEG-A3C protein.
C. Bioactivities of PEGylated GM-CSF Cysteine Muteins: We purified sufficient
quantities of 7
5 muteins (*-1C, A1C, A3C, S5C, S7C, S69C and E93C) modified with a 5 kDa PEG
for accurate protein
concentration and specific bioactivity measurements. Biological activities of
the 7 purified 5 kDa- PEG-
GM-CSF cysteine muteins were measured in the TF-1 cell proliferation assay.
Concentrations of the
proteins were determined using a Bradford dye binding assay. All of the
PEGylated GM-CSF cysteine
muteins showed similar dose-response curves and reached the same level of
maximal growth stimulation as
10 wild type GM-CSF. Mean EC50s for the PEG-GM-CSF cysteine muteins ranged
from 80 - 123 pg / ml
(Table 14).
Table 14
Bioactivities of PEGylated GM-CSF Cysteine Muteins
5 kDa PEG Protein 5 kDa PEG Protein
GM-CSF Mean EC50 EC50 Range a
Protein SD (pg/ml) (pg/mi)
*-1C 96 5 90-100(4)
AIC 115 4 110-120(4)
A3C 106 3 105-110(4)
S5C 80 11 70-100(6)
S7C 123 15 110-140(4)
S69C 88 6 80-95 (4)
E93C 86 5 80-90(4)
a Observed range ofEC50 values, number of assays in parentheses.
Biological activities of the A3C mutein modified with 10 kDa-, 20 kDa- and 40
kDa-PEG
molecules were measured in the TF-1 cell proliferation assay. Concentrations
of the proteins were
determined using a Bradford dye binding assay. Each of the PEG-A3C proteins
stimulated proliferation of
TF-1 cells. Mean EC50s for the 10 kDa-, 20 kDa- and 40 kDa-PEG A3C cysteine
muteins were 78 +/- 3
pg/ml, 113 +/- 5 pg/ml, and 300 +/- 50 pg / ml, respectively (N= 4 assays for
each protein).
D. Apparent Molecular weights A3C modified with 5kDa-, 10kDa-, 20 kDa- and 40
kDa-K
PEGs: The apparent molecular weights of the PEGylated GM-CSF A3C proteins were
determined by size
exclusion HPLC (SEC) using a Biorad Bio-Sil SEC-400-5 column on a Beckman
System Gold HPLC. An
isocratic gradient consisting of Phosphate Buffered Saline was used as the
eluant. Retention times for each
protein were used to calculate molecular weights based on a standard curve
generated with gel filtration
protein standards (BioRad Laboraories, Richmond, CA). The PEG ylated proteins
displayed dramatically
increased apparent molecular weights relative to the non-PEGylated GM-CSF
(Table 15). Larger PEGs
increased the apparent molecular weightof the protein more than smaller PEGs.
Similar data were recorded
for PEGylated cysteine muteins of GH, IFN-a2, and G-CSF.
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
61
Table 15
Apparent Molecular Weights of PEGylated GM-CSF Cysteine Muteins
by size Exclusion Chromatography
Protein Apparent SEC Molecular
Weight (daltons)
GM-CSF 20,000
5kDa-PEG A3C 80,000
l0kDa-PEG A3C 200,000
20kDa-PEG A3C 470,000
40kDa-PEG A3C 680,000
Example 17
Cloning, Expression, Purification and Bioactivity of Wild Type Murine GM-CSF
and Cysteine
Muteins of Murine GM-CSF
We cloned and sequenced a cDNA encoding the mature mouse GM-CSF by RT-PCR of
total RNA
isolated from the mouse EL4.IL-2 cell line (catalogue # TIB-181) obtained from
the American Type Culture
Collection (Rockville, MD). The cells were grown in DMEM media supplemented
with 10% FBS, 50
units/ml penicillin and 50 g/ml streptomycin. The cells were induced for 6 or
24 h with 1 g/ml PHA-L
(Sigma-Aldrich Chemical Company, catalogue # L-4144) and 10 ng/ml PMA (Sigma-
Aldrich Chemical
Company, catalogue # P-1585) in DMEM medium, 10% FBS, 50 units/ml penicillin,
50 gg/ml streptomycin
at 37 C prior to RNA isolation. RNA was isolated from the cells using an
RNeasy Mini RNA isolation kit
purchased from Qiagen, Inc. (Santa Clarita, CA) following the manufacturer's
directions. First strand
synthesis of single-stranded cDNA was accomplished using a 1st Strand cDNA
Synthesis Kit for RT-PCR
(AMV) from Boehringer Mannheim Corp and random hexamers were used as the
primer. A subsequent
PCR reaction using the products of the first strand synthesis as template was
carried out with forward primer
BB481 [5> GCG AC GCG TAC GCA GCA CCC ACC CGC TCA CCC ATC ACT >3; SEQ ID NO:43]
and reverse primer BB482 . BB481 anneals to the 24 nucleotides encoding the
first eight amino acids of
mature mouse GM-CSF. BB481 also adds, immediately 5' to this sequence,
nucleotides that overlap the
sequences encoding the carboxyterminal 4 amino acids of the E. coli stll
signal sequence described above in
Example 7 and by Picken et al. (1983). These 11 nucleotides include an Mlu I
restriction site. BB482 [5>
GCG GAA TTC TTA TTT TTG GAC TGG TTT TTT GCA TTC AAA GGG >3; SEQ ID NO:44]
anneals
to the nucleotides encoding the carboxyterminal ten amino acids of mouse GM-
CSF and adds a TAA
translational stop codon and an Eco RI restriction site immediately following
the coding sequence. Both the
6h and 24h RNA samples yielded a GM-CSF RT-PCR product. The resulting - 400 bp
PCR product from
the 6h RNA sample was digested with Mlu I and Eco RI, gel purified, and cloned
into pBBT227
[pUC18::stII-G-CSF(C17S)] which is described in Example 8 above. pBBT227 DNA
was digested with
Mlu I and Eco RI, alkaline phosphatase treated, and run out on a 1% agarose
gel. The - 2.4 kb vector
fragment was purified and used in ligation. The resulting recombinants carry a
complete stll leader fused to
murine GM-CSF and this "stlI-muGM-CSF" construct can be excised as an Nde I -
Eco RI fragment of -
450 bp. One clone with the correct sequence (Gough et al, 1984) was designated
pUC18::stII-muGM-CSF
or pBBT435. For expression studies the Nde I - Eco RI fragment of pBBT435 was
subcloned into the
expression vector pBBT257, which is described in Example 14 above. The
resulting plasmid,
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2003-02-17
62
pBBT257::stII-muGM-CSF, or pBBT456 was introduced into E coli W3110 for
expression. Wild type
mouse GM-CSF was expressed and purified using the protocols for expression and
purification of human
GM-CSF described in Example 14 above.
Mutant mouse GM-CSF genes can be constructed using site-directed PCR-based
mutagenesis as
described in general by Innis et al., 1990) and Horton et all, (1993) and in
the other Examples above. One
mutein, T3C, was constructed in the amino-terminal region proximal to Helix A.
The mutagenic PCR
reaction was carried out using plasmid pBBT435 (described in Example 17) as
template and forward
primer BB504 [5> GCG AC GCG TAC GCA GCA CCC TGC CGC TCA CCC ATC ACT >3; SEQ ID
NO:45] and reverse primer BB482 [5> GCG GAA TTC TTA TTT TTG GAC TGG TTT M GCA
TTC
AAA GGG >3; SEQ ID NO:44]. BB504 Changes the ACC codon for threonine at
position 3 of mature
mouse GM-CSF to a TGC codon for cysteine. The resulting - 400 bp PCR product
was digested with Mu I
and Eco RI, gel purified, and cloned into pBBT435 that was digested with Mu I
and Eco RI, alkaline
phosphatase treated, and gel-purified. One clone with the correct sequence was
designated pUC18::stII-
muGM-CSF(T3C). For expression studies the Nde I - Eco RI fragment of this
plasmid was subcloned into
the expression vector pBBT257, which is described in Example 14 above. The
resulting plasmid,
pBBT257::stII-muGM-CSF(T3C), or pBBT469 was introduced into E coli JM109 for
expression. The T3C
mutein of mouse GM-CSF was expressed and purified using the protocols for
expression and purification of
human GM-CSF described in Example 14 above.
Using procedures similar to those described here, and in Examples 9 and 15
above, one can
construct other cysteine muteins of mouse GM-CSF. The cysteine muteins can be
substitution mutations
that substitute cysteine for a natural amino residue in the GM-CSF coding
sequence, insertion mutations that
insert a cysteine residue between two naturally occurring amino acids in the
mouse GM-CSF coding
sequence, or addition mutations that add a cysteine residue preceding the
first amino acid of the mouse GM-
CSF coding sequence or add a cysteine residue following the terminal amino
acid residue of the mouse GM-
CSF coding sequence. The cysteine residues can be substituted for any amino
acid, or inserted between any
two amino acids, anywhere in the mouse GM-CSF coding sequence. Preferred sites
for substituting or
inserting cysteine residues are in the region preceding Helix A, the A-B loop,
the B-C loop, the C-D loop,
and the region distal to Helix D. Other preferred sites are the first or last
three amino acids of the A, B, C,
and D Helices: One also can construct muteins containing a free cysteine by
substituting another amino acid
for one of the naturally occurring cysteine residues in GM-CSF that normally
forms a disulfide bond. The
naturally occurring cysteme residue that normally forms a disulfide bond with
the substituted cysteine
residue is now free. The cysteine.residue can be replaced with any of the
other 19 amino acids, but
preferably with a serine or alanine residue. A free cysteine residue also can
be introduced into GM-CSF by
chemical modification of a naturally occurring amino acid using procedures
such as those described by
Sytkowsld et al. (1998).
Multiple mutants containing two or more added free cysteine residues can also
be constructed
either by sequential rounds of mutagenesis using the procedures described in
Examples 9 and.15 above or
alternatively by in vitro recombination of individual mutants to construct
recombinant expression plasmids
encoding muteins containing two or more free cysteines. The preferred myltiple
mutants would be those
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
63
that combined two or more cysteine muteins that each retain high, or complete,
specific activity when
PEGylated.
Using procedures similar to those described in Examples 12-14, 15 and 16, one
can express
purify, and PEGylate mouse GM-CSF muteins and measure biological activities of
these proteins in an in
vitro bioassay and in vivo efficacy models. The proteins can be expressed
cytoplasmically in E. coli or as
proteins secreted to the periplasmic space. The muteins also can be expressed
in eukaryotic cells such as
insect or mammalian cells, using procedures similar to those described in
PCT/US00/00931, or related
procedures well known to those skilled in the art. If secretion from
eukaryotic cells is desired, the natural
GM-CSF signal sequence, or another signal sequence, can be used to secrete the
proteins from eukaryotic
cells.
The purified mouse GM-CSF wild type protein, cysteine muteins, and PEGylated
forms of the
cysteine muteins can be assayed for biological activity with a cell
proliferation assay using the NFS60 cell
line as described in Examples 8 and 9 above.
Murine wild type GM-CSF and the murine T3C GM-CSF cysteine mutein were
isolated from E.
coli following the procedure described for human WT-GM-CSF (Examples 14-16)
with the exception that
30% ammonium sulfate was used to bind the murine proteins to a Phenyl-
Sepharose column rather than 15%
as described for human GM-CSF. The murine T3C cysteine mutant readily
PEGylated with lOkDa, 20 kDa
and 40 kDa PEG maleimide reagents using the protocols described above for
human GM-CSF A3C cysteine
mutein. Bioactivities of these PEGylated proteins can be measured in the NFS60
cell proliferation assay as
described in Examples 8 and 9.
Example 18
E. cols Expression and Purification of Wild Type human Erythropoietin
A. Expressing Erythropoietin by secretion in E. coll. The DNA encoding wild
type human
Erythropoietin (Epo) was amplified by PCR from the plasmid pBBT358 (see
below), which contains a gene
for Epo in the vector pBlueBac 4.5 (Invitrogen), which has been used for
expression of Epo in insect cells.
The gene for Epo in pBBT358 is similar to the natural cDNA, except for three
silent mutations at codons for
amino acids 84 and 85 (of mature Epo) that create an XhoI restriction site to
facilitate the mutagenesis
process.
The three mutations that created the Xho I site were incorporated using the
technique of
"mutagenesis by overlap extension" as described in Horton et al. (1993) and
PCT/USOO/00931. The initial,
or "primary" PCR reactions for the Xho I construction were performed in a 50
l reaction volume in 1X
Promega PCR buffer containing 1.5 mM MgC12 , each primer at 0.4 M, each of
dATP, dGTP, dTTP and
dCTP at 200 gM, 1 ng of template plasmid pBBT132 (the wild type Epo-Flag gene
cloned as a BannH I -
EcoR I fragment in pUC19, (described in PCT/US00/00931), 2 units of Taq
Platinum (BRL), and 0.25 units
of Pfu Polymerase (Stratagene). The reactions were performed in a Perkin-Elmer
GeneAmp PCR System
2400 thermal cycler. The reaction program entailed: 95 C for 5 minutes, 25
cycles of [94 C for 30 seconds,
56 C for 30 seconds, 72 C for 45 seconds], a 7 min hold at 72 C and a hold
at 4 C. The primer pairs used
were [BB361 x BB125] and [BB362 x BB126]. BB361 (5>GTTGGTCAAC TCGAGCCAGC
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
64
CGTGGGAG>3; SEQ ID NO:79] anneals to DNA sequences encoding amino acid
residues 81-89 of mature
Epo. BB125 (5> CTATGC GGCATCAGAGCAGATA >3; SEQ ID NO:17) anneals to the pUC19
vector
sequence -20 bp downstream of the cloned Epo sequence. The PCR products were
run out on a 1.5%
agarose gel, excised from the gel, and isolated using a QlAquick Gel
Extraction Kit (Qiagen) according to
the vendor protocol. These two mutagenized fragments were then "spliced"
together in the subsequent, or
"secondary" PCR reaction. In this reaction 0.3 l of each of the gel-purified
PCR products of the primary
reactions were used as template and BB125 and BB126 were used as primers. The
reaction volume was 50
gl and 2.5 units of Taq Polymerase and 0.5 units of Pfu Polymerase were
employed. Otherwise, the reaction
conditions were identical to those used in the primary reactions. An aliquot
of the secondary PCR was
analyzed by agarose gel electrophoresis and the expected band of -190 bp was
observed. The bulk of the
secondary PCR reaction was "cleaned up" using the QlAquick PCR Purification
(Qiagen), digested with Kpn
I and Stu I (New England BioLabs) according to the vendor protocols. Following
an additional clean up
using the QlAquick PCR Purification Kit, the digestion products were ligated
with pBBT138 (the wild type
Epo-Flag gene cloned as a BarnH I - EcoR I fragment in pBlueBac 4.5,
(PCT/US00/00931)), that had been
cut with with Kpn I and Stu I, treated with calf intestinal alkaline
phosphatase (New England BioLabs) and
gel purified. The ligation reaction was used to transform E. coli and plasmids
from resulting transformants
were sequenced to identify a clone containing the Xho I site and having the
correct sequence throughout the
433 bp Kpn I - Stu I segment. This clone is designated pBBT358.
For expression of Epo fused to the STII signal peptide, (a peptide sequence
which directs secretion
of the mature protein into the E. coli periplasm, the oligonucleotides used in
the PCR reaction were BB583
(5>CCAACGCGTA CGCAGCCCCA CCACGCCTCATC3>; SEQ ID NO:46), which anneals to the N-
terminal coding region of the gene, and either BB585 (5>CCGGAATTCT TAACGGTCAC
CTGTGCGGCA
GGC>3; SEQ ID NO:47) or BB586 (5>CCGGAATTCT TAGTCACCTG TGCGGCAGGC >3; SEQ ID
NO:48), which anneal to the C-terminal coding region of the gene. BB585
includes the codon for Arg166,
the C-terminal amino acid predicted by the cDNA sequence, whereas BB586
deletes the Arg166 codon and
codes for Asp165 as the C-terminal amino acid. The resulting - 600 bp PCR
products were digested with
MIuI and Eco RI and cloned into a similarly digested pBBT227 (Example 9)
vector to create fusions
between the STII leader sequence and the amino terminal coding sequence of
wild type Epo. The gene
formed by PCR using BB583 and BB585 is termed STII-Epo-full length (STII-Epo-
FL), and the gene formed
by PCR using BB583 and BB586 is termed STII-Epo-des Arg (STII-Epo-dR). STII-
Epo-FL and STII-Epo-
dR clones with the correct sequence were then subcloned as Nde I-Eco RI
fragments into pBBT257
(described in Example 14) to create pBBT477 and pBBT478, respectively.
pBBT477 and pBBT478 were transformed into JM109 to create strains BOB578 and
BOB579.
These strains, along with BOB490 (pBBT257/JM109) were grown overnight in Luria
Broth (LB media)
containing 10 gg/ml tetracycline at 37 C in roll tubes. Saturated overnight
cultures were diluted to - 0.025
O.D. at A600 in LB media containing 10 g/ml tetracycline and incubated at 37
C in shake flasks. Typically a
25 ml culture was grown in a 250 ml shake flask. When culture O.D.s reached -
0.3 - 0.5, IPTG was added
to a final concentration of 0.5 mM to induce expression either Epo wild type
or Epo des Arg166. For initial
experiments, cultures were sampled at 4 and -19 h post-induction. Samples were
analyzed by SDS-
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
polyacrylamide gel electrophoresis (SDS-PAGE) on precast 14% Tris-glycine
polyacrylamide gels and
stained with Coomassie Blue. Induced cultures of both BOB578 and BOB579 showed
a band at
approximately 20 kDA, which is consistent with the molecular weight of wild
type Epo. This band was not
detected in the induced culture of BOB490, the vector-only control.
5 B. Expressing Met-Erythropoietin in the cytoplasm of E. coli. As described
in Example 18. A.
, the DNA encoding wild type human Erythropoietin (Epo) was amplified by PCR
from the plasmid
pBBT358, which contains a gene for wild type Epo. For expression of met-Epo in
the cytoplasm of E. coli,
the oligonucleotides used in the PCR reaction were BB584 (5> TTC GCT AGC ATG
CAT GAC CTG CAG
GAG GAA ATT TAA ATG GCC CCA CCA CGC CTC ATC 3>; SEQ ID NO:49), which anneals
to the N-
10 terminal coding region of the gene, and either BB585 (5>CCGGAATTCT
TAACGGTCAC CTGTGCGGCA
GGC>3; SEQ ID NO:47) or BB586 (5>CCGGAATTCT TAGTCACCTG TGCGGCAGGC >3; SEQ ID
NO:48), which are described above. The resulting - 600 bp PCR products were
digested with MinI and Eco
RI and cloned into a similarly digested pBBT227 (Example 9) vector to create
genes encoding methionyl-
Epo. The gene formed by PCR using BB583 and BB585 is termed met-Epo-full
length (met-Epo-FL), and
15 the gene formed by PCR using BB583 and BB586 is termed met-Epo-des Arg (met-
Epo-dR). Met-Epo-FL
and met-Epo-dR clones with the correct sequence were then subcloned as Nde I-
Eco RI fragments into
pBBT257 (described in Example 14) to create pBBT479 and pBBT480, respectively.
pBBT479 and pBBT480 were transformed into JM109 to create strains BOB580 and
BOB581.
Expression experiments with these strains, along with BOB490 (pBBT257/JM109)
were the same as those
20 described above for the STII-Epo constructs. Induced cultures of both
BOB580 and BOB581 showed a band
at approximately 20 kDA, which is consistent with the molecular weight of wild
type Epo. This band was not
detected in the induced culture of BOB490, the vector-only control.
Example 19
25 Construction, E. coil Expression, Purification and Bioactivity of
Erythropoietin Cysteine Muteins
A. Construction of Epo Cysteine Muteins. Methods for constructing Epo cysteine
muteins using
site-directed PCR-based mutagenesis procedures and preferred sites for
locations of cysteine muteins in
EPO are described in PCTIUSOO/00931, PCT/US98/14497, and Innis et al. (1990)
and White (1993) and
the various Examples provided herein. In addition, L80 is another preferred
site for a cysteine substitution
30 mutein.
Recombinant erythropoietin and cysteine muteins of erythropoietin can be
expressed in E. coli
using the procedures described in Example 18 for wild type EPO. The cells are
lysed using B-per (Pierce)
following the manufacture's instructions and the insoluble portion is isolated
by centrifugation. The pellet is
solubilized using 20 mM cysteine, 6 M guanidine, 20mM Tris. The mixture is
stirred for 1-2 hours at room
35 temperature before being diluted 1:20 (v/v) with 20 in Tris, pH 8, 40 m
copper sulfate, 2% lauroyl
sarcosine.. The renaturation is allowed to sit at 4 C for 24-48 hours. The
refolded EPO and EPO cysteine
muteins are purified using an S -Sepharose column equilibrated in 20 mM Mes,
pH 5, 0.01% Tween and
20% glycerol (Buffer A) . EPO can be eluted from the S-Sepharose column using
a linear gradient of 0 -1M
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
66
NaCl in Buffer A. Secondary columns for further purification of the
recombinant EPO, if necessary, include
SEC, Blue-sepharose, hydroxyapitite, or HIC resins (phenyl, butyl).
Example 20
Construction of Disulfide-linked Trimers and
Disulfide-linked Higher Order Multimers of Cysteine Muteins
GH variants having more than one "free" cysteine could be constructed and used
to create higher
order disulfide-linked multimers of hGH as described in PCT/US00/00931. Such a
variant could be
expressed in E. coli , refolded and purified as disclosed in Examples 1 and 2
and PCT/US/00/00931.
Subsequent processing steps could then be employed to induce disulfide bond
formation as described in
Example 2 and PCTIUS00/00931. Under such conditions some hGH variants having
one free cysteine,
such as T3C, are converted virtually quantitatively to disulfide-linked
dimers. Under the same or similar
conditions intermolecular disulfide formation by an hGH variant having two
free cysteines, e. g. a double
mutant that combined T3C and another cysteine mutein, would result in a
polymerization of hGH molecules
and the chain length of such polymers would in principle be unlimited. The
chain length could be limited
and to some extent controlled by addition to the polymerization reaction of
hGH molecules having only one
free cysteine such as the T3C variant and / or other cysteine muteins.
Disulfide bond formation between the
growing polymer and a molecule having only one free cysteine will "cap" or
prevent further extension of
one of the two polymerization sites in the nascent polymer. A subsequent
reaction of a second hGH
molecule that has only one free cysteine with the other polymerization site of
that nascent polymer
terminates polymerization and fixes the length of that polymeric molecule. The
average polymer length
could be controlled by the stoichiometry of the reactants, i.e. the ratio of
hGH molecules with two free
cysteines to hGH molecules with one free cysteine. Average shorter polymers
would be favored by lower
ratios and average longer polymers would be favored by higher ratios. More
complex "branched" polymers
could be constructed from reactions involving hGH variants with 3 or more free
cysteines with hGH variants
having only one free cysteine.
Discrete size classes of certain polymers could subsequently be purified by
chromatographic
methods such as size exclusion chromatography, ion exchange chromatography,
hydrophobic interaction
chromatography, and the like. Similar procedures to those described for GH
could be used to create
disulfide-linked dimers and higher order multimers of G-CSF, alpha interferon,
GM-CSF and other proteins.
Example 21
Cloning, Expression and Purification of Wild Type human Endostatin
A.Cloning DNA sequences encoding Endostatin. A cDNA encoding Endostatin was
amplified
by PCR from a human fetal liver cDNA library (Clontech). PCR reactions were
carried out with forward
primer BB383 (5>GCTAACGCGTACGCACACAGCCACCGCGACTTCCAGCCG>3; SEQ ID NO:50)
and reverse primer BB384 (5>CGGAATTCCTCGAGCTACTTGGAGGCAGTCATGAAGCT>3; SEQ ID
NO:51). Primer BB383 anneals to the 5' end of the coding sequence of human
Endostatin and the reverse
primer, BB92, anneals to the 3' end of the Endostatin coding sequence. The
resulting - 600 bp PCR product
was digested with Mlul and Eco RI and cloned into a similarly digested pBBT227
(Example 9) vector to
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
67
create a fusion between the STII leader sequence and the amino terminal coding
sequence of human
Endostatin. After confirming its sequence, the gene was modified for
intracellular expression by PCR
amplification with forward primer BB434 (5'>GTGCACCATA TGAAGAAGAA CATCGCATTC
CTGCTGGCTA GCATGCATGA CCTGCAGGAG GAAATTTAAA TGCACAGCCA CCGCGACTTC>3';
SEQ ID NO:52) and BB384 (SEQ ID NO:51). BB434 fuses a methionine (met) codon
to the amino
terminus of Endostatin. The resulting 630 bp fragment was digested with NdeI
and SacII and cloned into a
similarly digested STII-Endostatin-pUC18 plasmid described above. A met-
Endostatin clone with the correct
sequence (pBBT370) was then subcloned as a Nde I-Eco RI fragment into pBBT257
(described in Example
14) to create pBBT371.
B. Expression of Wild Type met-Endostatin in E. coli. pBBT371, which encodes
Met-
Endostatin wild type, and pBBT257, the parent vector, were transformed into E.
coli JM109 to create
strains BOB460 and BOB490, and into W3110 to create strains BOB461 and BOB340.
These strains were
grown overnight in Luria Broth (LB media) containing 10 g/nil tetracycline at
37 C in roll tubes. Saturated
overnight cultures were diluted to - 0.025 O.D. at A600 in LB 10 g/ml
tetracycline and incubated at 37 C in
shake flasks. Typically a 25 ml culture was grown in a 250 ml shake flask.
When culture O.D.s reached.
-0.3 - 0.5, IPTG was added to a final concentration of 0.5 mM to induce
expression of human met-
Endostatin. For initial experiments, cultures were sampled at 0, 4 and -19 h
post-induction. Samples were
analyzed by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) on precast 14%
Tris-glycine
polyacrylamide gels and stained with Coomassie Blue. Induced cultures of both
BOB460 and BOB461
showed a band at approximately 20 kDA, which is consistent with the mature
human Endostatin. This band
was not detected in the uninduced cultures of BOB460 and BOB461 or in induced
or uninduced cultures of
BOB490 and BOB340, the vector-only controls. The -20 kDa band co-migrated with
commercially
prepared human Endostatin purchased from Calbiochem.
Example 22
Construction, Expression, Purification and Bioactivity of human Endostatin
Cysteine Muteins
A. Construction of Endostatin Cysteine Muteins. Eleven mutant human Endostatin
genes were
constructed using site-directed PCR-based mutagenesis procedures similar to
those described in
PCT/US00/00931 and Innis et al. (1990) and White (1993). Four muteins [*-1C,
H2C, RSC, and F7C] were
constructed in the amino-terminal region (the amino acid residues are numbered
by subtracting 130 from the
numbered residues in Hohenester et al. (1998)); three muteins were at residues
encoded by sequences
around the center of the gene [G90C, G98C, and Hl 12C]; and three muteins were
in the carboxy-terminal
region [L154C, R157C and S162C]. One additional mutein [R28C] was constructed
at a residue within the
active site of Endostatin. This could serve as a control protein in the
bioassay.
The source of template fragments used for the mutagenic PCR reactions was
plasmid pBBT370.
PCR products were digested with appropriate restriction endonucleases,
extracted using the Qiagen PCR
cleanup kit and ligated with pBBT370 vector DNA that had been cut with those
same restriction enzymes,
alkaline phosphatase treated, and extracted using the Qiagen PCR cleanup kit.
Transformants from these
ligations were grown up and plasmid DNAs isolated and sequenced. The sequence
of the entire cloned
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2003-02-17
68
mutagenized PCR fragment was determined to verify both the presence of the
mutation of interest and the
absence of any additional mutations that potentially could be introduced by
the PCR reaction or by the
synthetic oligonucleotide primers.
The cysteine substitution mutation *-1C was constructed using three PCR
amplifications as
follows. The mutagenic forward oligonucleotide BB531 (5>GAGGAAATTT AAATGTGCCA
CAGCCATCGC-GACTTCC>3; SEQ ID NO:53) was designed to insert a TGC cysteine
codon between
the N-terminal ATG methionine codon and the first CAC histidine codon. This
oligo was used in PCR#1
with the reverse, non-mutagenic, primer BB 126 (5>TGTGGAATTG TGAGCGGATA AC >3;
SEQ ID
NO:54) which anneals. to pUC18 vector sequences within 60bp downstream of the
Endostatin coding
sequence. The template for this PCR was a purified 1264bp Nhe I-ApaL I
fragment derived from pBBT370.
This fragment contains the entire Endostatin coding sequence and 670bp of pUC
18 sequence downstream of
the Endostatin gene, including the sequence to which BB 126 anneals. PCR #1
was a 25 l reaction
performed in IX Promega PCR buffer containing 1.5 mM MgCI2, each primer at 0.4
pM, each of dATP,
dGTP, dTTP and dCTP at 200 M, 0.5 ng of template fragment, 1 unit of Taq
Polymerase (Promega), and
0.1 unit of Pfu Polymerase (Stratagene). The reaction was performed in a
Perkin-Elmer GeneAmp PCR
System 2400 thermal cycler. The reaction program entailed: 95 C for 5 minutes,
22 cycles of [94 C for 30 .
seconds, 55 C for. 30 seconds, 72 C for 45 seconds], a 7 min hold at 72 C and
a hold at 4 C.
PCR #2 was performed using the mutagenic reverse oligonucleotide BB532
(5>GGAAGTCGCG
ATGGCTGTGG CACATTTAAA TTTCCTC>3; SEQ ID NO:55), which is the inverse
complement of
BBB53 1, and the non-mutagenic primer BB 125 (5>CTATGCGGCA TCAGAGCAGATA>3; SEQ
ID
NO: 17), which anneals to pUC 18 sequences 40bp upstream of the Nde I site.
The template for PCR#2 was
a purified 990bp Ssp I -EcoR I fragment from pBBT370. containing the entire
Endostatin coding sequence
and 367bp of pUCI8 sequence upstream of the Nde I site at the 5' end of the
Endostatin gene fragment,
including the sequence to which BB125 anneals. The components and program for
PCR#2 are the same as
PCR#l. Ten 0 aliquots of PCR#land #2 were analyzed by agarose gel
electrophoresis and each found to
have produced a single fragment of the expected size.
PCR #3 was a 50p1 reaction performed using non-mutagenic primers BB125 and
BB126. The
template for this PCR was 1 pl of PCR #1 and 0.3 l of PCR #2. The components
of PCR #3 were the same
as reactions I and 2. The reaction program entailed: 95 C for 5 minutes, 23
cycles of [94 C for 30
seconds, 56 C for 30 seconds, 72 C for 1 min], a 7 min hold at 72 C and a hold
at 4 C. A 10 l aliquot of
PCR #3 was analyzed by agarose gel electrophoresis and found to have generated
a 740 bp fragment, as
expected. The remainder of the reaction was "cleaned up" using the QiAquick
PCR. Purification Kit
(Qiagen) according to the vendor protocol and digested with Nhe I and BsrG I
(New England BioLabs)
according to the vendor protocols. Following an additional clean up step using
the QIAquick PCR
Purification Kit, the digestion products were ligated with pBBT370 that had
been cut with Nhe I and BsrG It
treated with calf intestinal alkaline phosphatase (New England BioLabs) and
"cleaned up" using the
QlAquick PCR Purification Kit. The ligation reaction was used to transform E.
coli JM109 and plasmids
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
69
from resulting transformants were sequenced. A clone having the *-1C mutation
and the correct sequence
throughout the 205 bp Nhe I - BsrG I segment was identified.
The substitution mutations H2C, R5C, F7C, and R28C (i.e. changing histidine at
position 2 to
cysteine, etc.) were constructed and sequence verified using the protocols
detailed above for *-1C, except
that different mutagenic oligonucleotides were used (Table 16). The forward
mutagenic oligonucleotides
were always used in conjunction with the reverse, non-mutagenic, primer BB126
and the purified 1264bp
Nhe I-ApaL I fragment as template, and the reverse mutagenic oligonucleotides
were always used in
conjunction with forward, non-mutagenic, primer BB 125 and the purified 990bp
Ssp I -EcoR I fragment as
template.
Table 16
Oligonucleotides used to construct Endostatin cysteine muteins
Mutation Oligonucleotide Direction Sequence (5' > 3'); Cys codon shown in bold
H2C BB533 Forward GAGGAAATTTAAATTGCAGCCATCGCGACTTCCAG
SEQ ID NO:56
H2C BB534 Reverse CTGGAAGTCGCGATGGCTGCACATTTAAATTTCCTC
SEQ ID NO:57
R5C BB535 Forward ATGCACAGCCACTGCGACTTCCAGCCG
SEQ ID NO: 58
R5C BB536 Reverse CGGCTGGAAGTCGCAGTGGCTGTGCAT
SEQ ID NO:59
F7C BB537 Forward GCCACCGCGACTGTCAACCGGTGCTCCAC
SEQ ID NO:60
F7C BB538 Reverse GTGGAGCACCGGTTGACAGTCGCGGTGGC
SEQ ID NO:61
R28C BB539 Forward CATGCGGGGCATCTGCGGCGCCGACTTCCAG
SEQ ID NO: 62
R28C BB540 Reverse CTGGAAGTCGGCGCCGCAGATGCCCCGCATG
SEQ ID NO:63
G90C BB543 Forward GGCTCTGTTCTCGTGCTCTGAGGGTCC
SEQ ID NO:64
G90C BB544 Reverse GGACCCTCAGAGCACGAGAACAGAGCC
SEQ ID NO:65
G98C BB545 Forward CCGCTGAAGCCCTGCGCACGCATCTTC
SEQ ID NO:66
G98C BB546 Reverse GAAGATGCGTGCGCAGGGCTTCAGCGG
SEQ ID NO:67
H112C BB547 Forward GACGTCCTGAGGTGCCCGACCTGGCCCCAG
SEQ ID NO:68
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
L154C BB548 Forward GGCCAGGCCTCCAGCCTCTGCGGGGGCAGGCTC
SEQ ID NO: 69
L154C BB549 Reverse GAGCCTGCCCCCGCAGAGGCTGGAGGCCTGGCC
5 SEQ ID NO:70
R157C BB550 Forward CTGCTGGGGGGCTGCCTCCTGGGCCAGAGTGCCGCG
SEQ ID NO:71
10 R157C BB551 Reverse CGCGGCACTCTGGCCCAGGAGGCAGCCCCCCAGCAG
SEQ ID NO:72
S162C BB552 Forward CTCCTGGGGCAGTGCGCAGCGAGCTGCCATC
SEQ ID NO:73
S162C BB553 Reverse GATGGCAGCTCGCTGCGCACTGCCCCAGGAG
SEQ ID NO:74
Muteins G90C and G98C were constructed by methods similar to those described
for *-1 C, except
the mutagenic oligonucleotides were different (Table 16) and the template for
PCR #3 was 0.5 l of PCR #1
and 0.5 gl of PCR #2. In addition, after "clean up," PCR #3 was digested with
BsrG I and Bsu36 I (New
England BioLabs) and following an additional clean up step, the digestion
products were ligated with
pBBT370 that had been cut with BsrG I and Bsu36 I, treated with calf
intestinal alkaline phosphatase (New
England BioLabs) and "cleaned up" using the QlAquick PCR Purification Kit.
Muteins L154C, R157C, and S162C were constructed by methods similar to those
described for *-
1C, except the mutagenic oligonucleotides were different (Table 16) and the
template for PCR #3 was 0.3 1
of PCR #1 and 1 l of PCR #2. In addition, after "clean up," PCR #3 was
digested with Bsu36 I and Eco RI
and following an additional clean up step, the digestion products were ligated
with pBBT370 that had been
cut with Bsu36 I and Eco RI, treated with calf intestinal alkaline phosphatase
(New England BioLabs) and
"cleaned up" using the QlAquick PCR Purification Kit.
Mutein H112C was constructed by methods different in several respects from
those described for
*-1 C. First, the sequence of the mutagenic forward oligonucleotide used in
PCR #1 was different (Table 16)
and the volume of the reaction was 50 l instead of 25 l. PCR #2 and PCR #3
were not performed,
because they were not necessary. Instead, after a 10 l aliquot was analyzed
by gel electrophoresis, this
reaction was treated much the same as PCR #3 is normally treated. That is, the
remainder of the reaction
was "cleaned up" using the QIAquick PCR Purification and digested with Bsu36 I
and EcoR I (New
England BioLabs) according to the vendor protocols. Following an additional
clean up step using the
QIAquick PCR Purification Kit, the digestion products were ligated with
pBBT370 that had been cut with
Bsu36 I and EcoR I, treated with calf intestinal alkaline phosphatase (New
England BioLabs) and "cleaned
up" using the QIAquick PCR Purification Kit. The ligation reaction was used to
transform E. coli JM109
and plasmids from resulting transformants were sequenced.
B. Expression of Cysteine muteins of met-Endostatin in E. coli: Each met-
Endostatin
Cysteine mutein clone with the correct sequence was subcloned as a Nde I-Eco
RI
fragment into pBBT257 (described in Example 14) to generate a set of
expression
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
71
plasmids which were transformed in JM109 to create the strains used in
expression
studies.
These strains were grown overnight in Luria Broth (LB media) containing 10
.ig/ml tetracycline at
37 C in roll tubes. Saturated overnight cultures were diluted to - 0.025 O.D.
at A600 in LB 10 g/ml
tetracycline and incubated at 37 C in shake flasks. Typically a 25 nil culture
was grown in a 250 ml shake
flask. When a culture O.D. reached -0.3 - 0.5, IPTG was added to a final
concentration of 0.5 mM to
induce expression of the Endostatin Cysteine mutein specific for that stain.
Preinduction, 4 hour post-
induction, and 16 hr post-induction samples were collected. Samples were
analyzed by SDS-
polyacrylamide gel electrophoresis (SDS-PAGE) on precast 14% Tris-glycine
polyacrylamide gels and
stained with Coomassie Blue. Induced cultures of each of the Endostatin
cysteine mutein strains showed a
band at approximately 20 kDA, which is consistent with the mature human
Endostatin. This band was not
detected in the uninduced cultures or in induced or uninduced cultures of
BOB490, the vector-only control.
The -20 kDa band co-migrated with commercially prepared human Endostatin
purchased from
Calbiochem.
C. Expression and purification of endostatin and endostatin cysteine muteins:
E.coli
containing expressed wild type endostatin or endostatin cysteine mutein R5C
were pelleted by centrifugation
and frozen at -80 C. Cell pellets were thawed and treated with 5 mL of B-PER
TM bacterial protein
extraction reagent according to the manufacturer's (Pierce) protocols. The
insoluble material, which
contained the bulk of the endostatin protein, was recovered by centrifugation
and resuspended in B-PER.
This mixture was treated with lysozyme (200 pg/mL) for 10 min to further
disrupt the cell walls, and MgC12
(10 mM final concentration) and protease-free DNAse (2 g/ml) were added.
Insoluble endostatin was
collected by centrifugation and washed, by resuspension in water and
recentrifugation, to remove most of
the solubilized cell debris. For refolding, the resulting pellet containing
insoluble endostatin was dissolved
in 20 ml of 8 M urea, 10 mM cysteine in 20 mM Tris Base. This mixture was
stirred for 120 min at room
temperature. Cystine was added to a final concentration of 10 mM before the
solublization was diluted into
200 ml of ice cold 3 M urea, 40 M copper sulfate, 20 mM Tris, pH 7.5. This
refold mixture was slowly
stirred at 4 C for 3days. The pH of the refold mixture was then adjusted to
5.0 with dilute HCI and the
mixture was centrifuged before being loaded onto a 5 ml S-Sepharose column
(Pharmacia HiTrap)
equilibrated in 40 mM sodium phosphate pH 5.0 (Buffer A). The bound proteins
were eluted with a linear
salt gradient from 0-100% Buffer B (500 mM NaCl, 20 mM sodium phosphate, pH
5.0). The S-Sepharose
fractions containing predominantly endostatin were pooled with their pH being
adjusted to 7.4 before being
loaded onto Heparin-Sepharose (Hi trap) column, previously equilibrated in 20
mM Tris, pH 7.4. The
column was eluted with a 0-1 M NaCl salt gradient. Heparin column fractions
with pure endostatin were
pooled and frozen. Endostatin cysteine mutants G90C, G98C, H112C, and R157C
have also been partially
purified using the above protocol, with the heparin column step omitted.
R5C endostatin cysteine mutein was PEGylated using a 15X excess of 5 kDa PEG
maleimide and
10-15-fold excess of TCEP. The reaction yielded monoPEGylated R5C protein.
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
72
D. Endostatin Bioassay: Refolded wild type recombinant endostatin and the
refolded R5C
endostatin cysteine mutein were shown to be biologically active using the MMP-
2 inhibition assay described
by Kim, et al. (2000).
Bioactivity of the proteins also can be measured in an endothelial cell
proliferation inhibition
assay. In vitro inhibition of endothelial cell proliferation can be performed
as follows. Five thousand
HMVEC-L cells (Clonetics) can be plated onto gelatinized 96-well culture
plates and incubated (37 C, 5%
CO2) for 24 hr in 100 p1 HMVEC-L medium containing bFGF. The medium is then
replaced with 20 l of
medium containing serial dilutions of endostatin, endostatin cysteine muteins
or PEGylated endostatin
cysteine muteins, and incubated for 20 min. Eighty l of fresh HMVEC-L medium
containing bFGF is then
added to the well. After 72 hr, cell numbers can be determined. The various
Endostatin proteins iwill nhibit
proliferation of the endothelial cells, as demonstrated by dose-dependent
decreases in endothelial cell
numbers at the end of the assay.
Example 23
Refolding of Recombinant Angiostatin Cysteine Muteins
Angiostatin is fully active when non-glycosylated and thus, does not require a
eukaryotic
expression system for production. The coding sequence for human angiostatin,
consisting of the first four
kringle subunits of human plasminogen, can be PCR-amplified from a human
plasminogen cDNA template
(available from the American Type Culture Collection, Rockville, MD). Wild
type angiostatin and
angiostatin cysteine muteins can be secreted from E. coli by fusing bacterial
signal sequences such as those
from the STII or ompA proteins onto the N-terminus of mature angiostatin for
the purpose of transporting
the protein into the periplasmic space. This method has also been used
successfully for fragments of
angiostatin (Kringle(K)1, K2, K3, and K2-3, (Cao et al., (1996)).
Alternatively, angiostatin and angiostatin
cysteine muteins can be expressed cytoplasmically in E. coli. or other host
cell. Angiostatin has 26
cysteines that form 13 disulfides. Therefore, conventional refold protocols
without an added cysteine
blocking would likely be unsuccessful with a cysteine rich protein like
angiostatin. Preferred sites for
introducing cysteine residues into angiostatin include K97C ( a cysteine
residue added onto the N-terminus
of mature angiostatin), T365C, 371C, S460C, A463C, and *466C (a cysteine
residue added onto the C-
terminus of the mature angiostatin protein.
Bacterial cells expressing recombinant angiostatin or the angiostatin cysteine
muteins can be lysed
using B-per as described by the manufacturer's protocol (Pierce). The
insoluble portion can be isolated by
centrifugation. The pellet can be solublized using a mixture of 20 mM
cysteine, 6 M guanidine, 20 mM
Tpl6 base. The mixture can be stirred for 2 hours at room temperature before
being diluted 10 fold into 20
mM Tris, The refold can be held at 4 C for 1-2 days. At the end of this time,
the refold can be centrifuged
and the angiostatin protein (or cysteine muyteins) can be purified by using a
lysine-sepharose column The
refold mixture can be loaded directly onto the column which is previously
equilibrated in 20 mM Hepes,
0,15 M NaCl, pH 7.4 Angiostatin (or an angiostatin cystine mutein) can be
released from the resin using a
gradient of 0-12 mM E-aminocaprioic acid. Further purification, if necessary,
can be accomplished using
various ion exchange or HIC resins.
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
73
Example 24
Peptide mapping of PEGylated proteins
In many instances, peptide maps can be used to verify the site of PEGylation.
Typically the
PEGylated protein is specifically digested such that the cysteine mutein is
present in a peptide with no other
cysteine residues. The presense of a PEG covalently attached to the peptide
will dramatically change the
retention time when the digestion mix is assayed by Reversed Phase HPLC. When
GH is digested with
trypsin using conditions from the literature (Clark et al., 1996), 21 possible
tryptic peptides (T1-T21,
numbered consecutively) can be isolated. T1, representing residues 1-8 which
includes the mutation T3C,
shifts to a slightly earlier retention time for the cysteine mutant (61
minutes) versus wild type ( 64 minutes)
or pituitary growth hormone. When PEGylated with a 5 K PEG, the Ti peptide
moves to the end of the
chromatogram with a retention time greater than 100 minutes. When GH is
digested with endoprotease Lys-
C, 10 peptides (L1-10, numbered consecutively) L1 representing residues 1-38
elutes at around 59 minutes
for wild type GH and around 61 minutes for the mutein T3C. When PEGylated with
a 20 K PEG, L1 is
missing from the chromatogram. These data confirm that indeed the PEG moiety
is attached to the cysteine
residue at postion 3 as predicted rather than at a native cysteine. Enzymatic
digestion and RP HPLC
analysis of cysteine mutiens of IFN (trypsin and endoprotease Glu-C), GM-CSF
(endoprotease Glu-C), and
G-CSF (endoprotease Lys-C) before and after PEGylation also showed data that
was consistent with a
single site of PEGylation at the newly introduced cysteine residue.
Example 25
Peripheral Blood Progenitor Cell Mobilization Initiated by PEG-G-CSF and
PEG-GM-CSF Cysteine Muteins
Treatment with recombinant G-CSF and recombinant GM-CSF has been shown to
mobilize
peripheral blood progenitor cells (PBPC) that give rise to more rapid
production and engraftment of
neutrophils and platelets following chemotherapay. The enhancement of PBPC
mobilization (and potentially
engraftinent rates) can be evaluated in the presence of the PEGylated G-CSF
and PEGylated GM-CSF
cysteine muteins. Spleenectomized mice strains known to have well defined
marrow cell profiles and
proliferation kinectics can be given a single or daily (up to 7 days)
intravenous or subcutaneous dose(s) of
G-CSF (wild-type or Neupogen ) or PEGylated G-CSF cysteine muteins. Each
experiment can also
contain a group of mice treated only with a carrier, consisting of mouse serum
albumin suspended in
isotonic saline. Following treatment, peripheral blood can be harvested by
cardiac puncture and collected in
EDTA-containing tubes. CBC analysis can be performed. Bone marrow cells can be
harvested by flushing
the contents of the femur and marrow. White cell count numbers can be
determined by staining with crystal
violet and hemacytometer enumeration. Low density cells can be isolated using
blood density gradient
fractionation and used in progenitor cell assays. The protocol for the
progenitor cell assays is outlined in
Briddell, et al (1993). Basically, a double-layer agar based system (Bradley
et al, 1978) can be used to
evaluate both primitive (high proliferative potential-colony-forming cells)
and mature (granulocyte-
macrophage colony forming cells) progenitor cells. A methylcellulose-based
assay system developed by
Iscove et al (1974 ) can be used to evaluate erythroid colony formation.
PEGylated G-CSF cysteine
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
74
muteins will increase mobilization of progenitor and stem cells. Similar
studies can be performed with
PEGylated GM-CSF cysteine muteins and wild type GM-CSF. Ultimately, the
efficiency of transplantation
in lethally irradiated miceand the ability to expedite the engraftment process
in the presence of PEGylated
G-CSF and PEGylated GM-CSF cysteine muteins can be investigated.
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
References
Abrahmsen, L., Moks, T., Nilsson, B. and Uhlen, M. (1986) Nucleic Acids
Res.14:7487-7500.
Abuchowski, A., Kazo, G.M., Verhoest, C.R., van Es, T., Kafkewitz, D., Nucci,
M.L., Viau, A.T. and
5 Davis, F.F. (1984) Cancer Biochem. Biophys. 7: 175-186.
Alt, F.W., Kellems, R.E., Bertino, J.R., and Schimke, R.T. (1978) J. Biol.
Chem. 253:1357-1370.
Arakawa, T., Prestrelski, S.J., Narhi, L.O., boone, T.C. and Kenney, W.C.
(1993) J. Protein Chem. 12:
525-531.
Balkwill, F.R., Goldstein, L. and Stebbing, N. (1985) Int. J. Cancer 35: 613-
617.
10 Balkwill, F.R. (1986) Methods Enzymology 119: 649-657.
Barik, S. (1993) in "Methods in Molecular Biology", White, B.A., ed. (Humana
Press, Totawa, NJ), 15:
277-286.
Bazan, F. (1990) Immunology Today 11: 350-354.
Bazan, J.F. (1991) Cell 65: 9-10.
15 Bazan, J.F. (1992) Science 257: 410-411.
Becker, G.W. and Hsiung, H.M. (1986) FEBS Lett. 204: 145-150.
Bewley et al., (1969) Biochem. 8: 4701-4708.
Blatt, L.M., Davis, J.M., Klein, S.B. and Taylor, M.W. (1996) J. Interferon
and Cytokine Research 16:
489-499.
20 Blezinger, P., Wang, J., Gondo, M., Quezada, A., Mehrens, D., French, M.,
Singhal, A., Sullivan, S.,
Rolland, A., Ralston, R., and Min, W. (1999) Nature Biotechnology 17: 343
Blumberg, H., Conklin, D., xu, W., Grossman, A., Brender, T., Carollo, S.,
Eagen, M., foster, D.,
Haldeman, B.A., Hammond, A., Haugen, H., Jelinek, L., Kelley, J.d., madden,
K., Maurer,
M.F., Parrish-novak, j., Prunkard, D., sexson, S., Sprecher, C., Waggie, K.,
west, J.,
25 Whitmore, T.E., Yao, L., Kuechle, M.k., Dale, B. and chandrasekher, Y.A.
(2001) Cell 104: 9-19.
Bolivar, F., Rodriguez, R.L., Greene, P.J., Betlach, M.C., Heyneker, H.L.,
Boyer, H.W., Crosa, J.H.
and Falkow, S. (1977) Gene 2:95-113.
Bollag, D.M., Rozycki, M..D. and Edelstein, S.J. (1996) Protein Methods, 415
pages, Wiley-Liss, NY,
NY.
30 Bowen, S., Tare, N., Inoue, T., Yamasaki, M., Okabe, M., Horii, I. And
Eliason, J. (1999) Exp. Hematol.
27, 425-432.
Bradley, T., Hodgson, G. and Rosendaal, M. (1978) J. Cell Physiol. 94: 517
Braxton, S.M. (1998) U.S. Patent 5,766,897.
Briddell, R.A., Hartley, C.A., Smith, K.A. and McNiece, I.K. (1993) Blood 82
(6), 1720-1723.
35 Cantrell, M.A., Anderson, D. and Cerretti, D.P (1985) Proc. Natl. Acad.
Sci. USA 82: 6250-6254.
Cao Y., Ji RW., Davidson D., Schaller J., Marti D., Solmdel S., McCance SG.,
O'Reilly MS., Llinas
M. and Folkman J. (1996) 271:29461-29467.
Cecil, R. and McPhee, J.R. (1959). Advances in Protein Chemistry 14, 255-389.
Chamow & Ashkenazi (1996), Trends in Biotech 14:52-60.
40 Chang, C.N., Rey, B., Bochner, B., Heyneker, H. and Gray, G. (1987) Gene:
189-196.
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
76
Cheah, K-C., Harrison, S., King, R., Crocker, L., Wells, J.R.E. and Robins, A.
(1994) Gene, 138: 9-15.
Clark, R., Olson, K., Fuh, G., Marian, M., Mortensen, D., Teshima, G., Chang,
S., Chu, H., Mukku,
V., Canova-Davis, E., Somers, T., Cronin, M., Winkler, M. and Wells, J. A.
(1996) J. Biol.
Chem. 271: 21969-21977.
Cox, G.N. and McDennott, M.J. (1994) WO 9412219.
Cox, G.N., McDermott, M.J., Merkel, E., Stroh, C.A., Ko, S.C., Squires, C.H.,
Gleason, T.M. and Russell,
D. (1994) Endocrinology 135: 1913-1920.
Crouse, G.F., McEwan, R.N., and Pearson, M.L. (1983) Mol. Cell. Biol. 3:257-
266.
Cunningham, B.C. and Wells, J.A. (1989) Science 244: 1081-1085.
Daopin, S., Piez, K.A., Ogawa, Y., and Davies, D.R. (1992) Science 257: 369-
373.
Denefle, P., Kovarik, S., Ciora, T. Gosselet, M., Benichou, J.-C., Latta, M.
Guinet, F., Ryter, A. and
Mayaux, J.-F. (1989) Gene 85, 499-510.
Donahue, R.E., Wang E.A., Stone, D.K., Kamen, R., Wong, G.G., Sehgal, P.K.,
Nathan, D.G. and Clark,
S.C. (1986a) Nature 321:872-5
Donahue, R.E., Wang, E.A., Kaufaman, R.J., Foutch,L., Leary, A.C. and Witek-
Giannetti, J.S.
(1986b) Cold Spring Harbor Symp. Quant. Biol. 51: 685-692.
Evinger, M. and Pestka, S. (1981) Methods Enzymol. 79:362-368.
Fuh, G., Cunnungham, B.C., Fukanaga, R., Nagata, S., Goeddel, D.V. and Wells,
J.A. (1992) Science
256: 1677-1680.
Fujimoto, K., Fukuda., T., and Marumoto., R. (1988) J. Biotechnol. 8:77-86.
Gamba-Vitalo, C., DiGiovanna, M.P., and Sartorelli, A.C. (1991) Blood Cells
17:193-205.
Geisse, S., Gram, H., Kleuser, B. and Kocher, H.P. (1996) Prot. Express.
Purif. 8:271-282.
Goffin, V., Bernichtein, S., Carriere, 0., Bennett, W.F., Kopchick, J.J. and
Kelley, P.A. (1999)
Endocrinology 140: 3853-3856.
Goodson, R.J. and Katre, N.V. (1990) Biotechnology 8: 343-346.
Gough, N.M., Metcalf, D., Gough, J., Grail, D. and Dunn, A.R. (1985) EMBO J.
4:645-53.
Gough, N.M., Gough, J., Metcalf, D., Kelso, A., Grail, D., Nicola, N.A.,
Burgess, A.W. and Dunn,
A.R. (1984) Nature 309:763-7.
Greenberg, R., Lundell, D., Alroy, Y. and Bonitz, S. (1988) Curr. Microbiol.
17:321-332.
Greenspan, F.S., Li., C.H., Simpson, M.E. and Evans, H.M. (1949) Endocrinology
45:455-463.
Ghrayeb, J., Kimura, H.., Takahara, M., Hsiung, H., Masui, Y. and Inouye, M.
(1984) EMBO J. 3:2437-
2442.
Hannum, C., Culpepper, J., Campbell, D., McClanahan, T., Zurawski, S. et al.
(1994) Nature 368: 643-
648.
Henco, K., Brosius, J., et al., (1985) J. Mol. Biol. 185: 227-260.
Hershfield, M.S., Buckley, R.H., Greenberg, M.L. et al., (1987) N.Engl. J.
Medicine 316: 589-596.
Hoffman, C.S. and Wright, A. (1985) Proc. Natl. Acad. Sci. USA 82: 5107-5111.
Hohenester, E., Sasaki, T., Olsen, B.R. and Timpl, R. (1998) EMBO J. 17:1656-
1664.
Horisberger, M.A. and Di Marco, S. (1995) Pharmac. Ther. 66: 507-534.
Horoszewicz, J.S., Leong, S.S. and Carter, W.A. (1979) Science 206:1091-1093.
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
77
Horton, R.M. (1993) in "Methods in Molecular Biology", White, B.A., ed.
(Humana Press, Totawa,
NJ), v.15, 214- 250.
Hsiung, H.M., Mayne, N.G. and Becker, G.W. (1986) Biotechnology 4: 991-995.
Innis, M.A., Gelfand, D.H, Sninsky, J.J. and White, T.J. eds. (1998) "PCR
Protocols: A Guide to Methods
and Applications" (Academic Press, San Diego, CA).
Iscove, N. N., Sieber, F. and Winterhalter, K.H. (1974) J. Cell Physiol. 83:
309
Ishikawa, M., Iijima, H., Satake-Ishikawa, R., Tsumura, H., et al., (1992)
Cell Struct. Function 17, 61-
65.
Johns, T.G., Mackay, I.R., Callister, K.A., Hertzog, P.J., Devenish, R.J. and
Linnane, A.W. (1992) J.
Natl. Cancer Institute 84: 1185-1190.
Johnson, D.L., Middleton, S.A., McMahon, F. Barbone, F.P., Kroon, D., Tsao,
E., Lee, W.H.,
Mulcahy, L.S. and Jolliffe, L.K. (1996) Protein Expression Purif. 7:104-113.
Kadonaga, J., Gautier, A. Straus, D.R., Charles, A.D., Edge, M.D. and Knowles,
J.R. (1984) J. Biol.
Chem. 259: 2149-2154.
Kajigaya, S., Suda, T., Suda, J., Saito, M., Miura, Y., Iizuka, M., Kobayashi,
S., Minato, N. and Sudo,
T. (1986) J Exp Med 164:1102-13
Kang, S.-H., Na, K.-H., Park, J.-H. Park C-I, Lee, S.-Y. and Lee, Y-I. (1995)
Biotech. Left. 17, 687-
692.
Katre, N.V. (1990) J. Immunology 144: 209-213.
Katre, N.V., Knauf, M.J. and Laird, W.J. (1987) Proc. Natl. Acad. Sci. USA 84:
1487-1491.
Kaufman, R.J. (1990) Meth. Enzymol. 185:537-566.
Khan, F.R. and Rai, V.R. (1990) Bioprocess Technology 7:161-169.
Kim, Y.M., Jang, J., Lee, 0., Yeon, J., Choi, E., Kim, K., Lee, S. and Kwon,
Y. (2000) Cancer Research
60, 5410-5413.
Kingsley, D.M. (1994) Genes Dev. 8: 133-146.
Kinstler, O.B., Gabriel, N.E., Farrar, C.E. and DePrince, R.B. (1996)
International Patent Application
Number WO 96/11953.
Kitamura, T., Tange, T., Terasawa, T., Chiba, S., Kuwaki, T., Miyagawa, K.,
Piao, Y.F., Miyazono, K.,
Urabe, A. and Takaku, F. (1989) J.Cell. Physiol. 140:323-334.
Knusli, C., Delgado, C., Malik, F., Domine, M., Tejedor, M.C., Irvine, A.E.,
Fisher, D. and Francis,
G.E. (1992) Brit. J Haematol. (1992) 82:654-663.
Koshland, D. and Botstein, D. (1980) Cell 20: 749-760.
Kubota, N., Orita, T., Hattori, K., Oh-eda, M., Ochi, N. and Yamazaki, T.
(1990) J. Biochem. 107:
486- 492.
Kuga, T., Komatsu, Y., Yamasaki, M., De4kine, S., Miyaji, H., Nishi, T., Sato,
M., Yokoo, Y., Asano,
M., Okabe, M., Morimoto, M. and Itoh, S. (1989) Bioch.. Biophys. Res. Comm.
159: 103-
111
Kutty G., Kutty, R.K., Samuel, W., Duncan, T., Jaworski, C., and Wiggert, B.
(1998) Biochem. Biophys.
Res. Commun. 246: 644-649.
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
78
Lawton, L.N., Bonaldo, M.F., Jelenc, P.C., Qiu, L., Baumes, S.A., Marcelino,
R.A., de Jesus, G.M.,
Wellington, S., Knowles, J.A., Warburton, D., Brown, S., and Soares, M.B.
(1997) Gene 203:
17-26.
Lee, F., Yokota, T., Otsuka, T., Giemmell, L., Larson, N., Luh, J., Arai, K.-
I. And Rennick, D. (985)
Proc. Natl. Acad. Sci. USA 82:4360-64.
Libby, R.T., Braedt, G., Kronheim, S.R., March, C.J., Urdal, D.L.,
Chiaverotti, T.A., Tushinski, R.J.,
Mochizuki, D.Y., Hopp, T.P., and Cosman, D. (1987) DNA 6:221-229.
Lindner, D.J. and Borden, E.C. (1997) J. Interferon and Cytokine Research
17:681-693.
Lu, H.S., Boone, T.C., Souza, L.M., and Lai, P.H. (1989) Arch.
Biochem.Biophys. 268: 81-92.
Lu, H.S., Clogston, C.L., Narhi, L.O., Merewether, L.A., Pearl, W.R. and
Boone, T.C. (1992) J. Biol.
Chem. 267: 8770-8777.
Lucas, B.K., Giere, L.M., DeMarco, M.A., Shen, A., Chisolm, V., and Crowley,
C.W. (1996) Nucleic
Acids Res. 24:1774-1779.
Lydon, N.B., Favre, C., Bove, S., Neyret, 0., Benureau, S., Levine, A.M.,
Seelig, G.F., Nagabhushan, T.
L. and Trotta, P.P. (1985) Biochemistry 24: 4131-4141.
Maisano, F., Testori, S.A., and Grandi, G. (1989) J. Chromatograph. 472: 422-
427.
Malik, F., Delgado,C., Knusli, C., Fisher, D. and Francis, G.E.(1992) Exp.
Hematol. 20: 1028-1035.
Mark, D.F., Lin, L.S. and Lu, S-D.Y. (1985) U.S. Patent 4,518,584.
Mark, D.F., Lu, S.d., Creasey, A.a., Yamamoto, R. and Lin, L.S. (1984) Proc.
Natl. Acad. Sci. USA 81:
5662-5666.
Martin, F.H., Suggs, S.V., Langley, K.E., Lu, H.S., Ting, J., Okino, K.H.,
Morris, F.C., McNiece, I.K.,
Jacobsen, F.W., Mendiaz, E.A., Birkett, N.C. et at., (1990) Cell 63: 203-211.
Massague, J. (1990) Annu. Rev. Cell Biol. 6: 597-641.
Matsuzaki, G., Li, X.-Y., Ohyama, Y. and Nomoto, K. (1996) Int. J.
Immunopharmac. 18: 363-369.
Mayer, P., Lam, C., Obenaus, H., Liehl, E., and Besemer, J. (1987a) Ann N Y
Acad Sci 511:17-29.
Mayer, P., Lam, C., Obenaus, H., Liehl, E., and Besemer, J. (1987b) Blood
70:206-13.
Mayer, P., Schutz, E., Lam,C., Kricek, F., and Liehl, E. (1991) J. Infect.
Dis.163:584-590.
Mayer, P., Werner, F., Lam, C., and Besemer, J. (1990) Exp. Hematol. 18:1026-
1033,
McDonald, N.Q. and Hendrickson, W.A. (1993) Cell 73: 421-424.
McKay, D.B. (1992) Science 257: 412.
Meyers, F.J., Paradise, C., Scudder, S.A., Goodman, G. and Konrad, M. (1991)
Clin.Phannacol. Ther.
49:307-313.
Monkarsh, S.P., Ma, Y., Aglione, A., Bailon, P. et al. (1997) Anal. Biochem.
247: 434-440.
Morehead, H., Johnson, P.D. and Wetzel, R. (1984) Biochemistry 23: 2500-2507.
Morioka-Fujimoto, K., Marumoto, R. and Fukuda, T. (1991) J. Biol. Chem. 266:
1728-1732.
Moschera, J.A., Woehle, D., Tsai, K.P., Chen, C.-H. and Tarnowski, S.J. (1986)
Methods in
Enzymology 119: 177-183.
Mott, H.R. and Campbell, T.D. (1995) Current Opinion in Structural Biology 5:
114-121.
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
79
Nagata, S., Tsuchiya, M., Asano, S., Kziro, Y., Yamazaki, T., Yamamoto, 0.,
Hirata, Y., Kubota, N.,
Oh-eda, M., Nomura, H. and Ono, M. (1986a) Nature 319: 415-418.
Nagata, S., Tsuchiya, M., Asano, S., Yamamoto, 0., Hirata, Y., Kubota, N., Oh-
eda, M., Nomura, H.
and Yamazaki, T. (1986b) EMBO J. 5: 575-581.
Oh-eda, M., Hasegawa, M., Hattori, K., Kuboniwa, H., Kojima, T., Orita, T.,
Tomonou, K., Yamazaki,
T., and Ochi, N. (1990) J. Biol. Chem. 265: 575-11435.
Ostermeier, M., De Sutter., K., Georgiou, G. (1996) J. Biol. Chem. 271: 10616-
10622.
Paul, W.E. ed. (1989) "Fundamental Immunology" (Raven Press, New York, NY).
Perez-Perez, J., Martinez-Caja, C., Barbero, J.L. and Gutierrez, J. (1995)
Biochem. Biophys. Res. Comm.
210: 524-529.
Pestka, S., Langer, J.A., Zoon, K.C. and Samuel, C.E. (1987) Ann. Rev.
Biochem. 56: 727-777.
Picken, R.N., Mazaitis, A.J., Maas, W.K., Rey, M. and Heyneker, H. (1983)
Infect. and Immun. 42:
269-275.
Roitt, I.M., Brostoff, J., and Male, D.K. eds. (1989) "Immumology" (Gower
Medical Publishers, New
York, NY and London, UK)
Rowlinson, S.W. Barnard, R., Bastiras, S., Robins, A.J., Brinkworth, R. and
Waters, M.J. (1995) J.
Biol. Chem. 270: 16833-16839.
Satake-Ishikawa, R., Ishikawa, W., Okada, Y., Kakitani, M., Kawagishi, M.,
Matsuki, S. and Asanao,
K. (1992) Cell Structure and Function 17: 157-160.
Schuening, F.G., Storb, R., Goehle, S., Nash, R., Graham, T.C., Appelbaum,
F.R., Hackman, R.,
Sandmaier, B.M., and Urdal, D.L. (1989) Exp. Hematol. 17:889-894.
Shanafelt, A.B., Lin, Y., Shanafelt, M.-C., Forte, C.P. et al. (2000) Nature
Biotechnology 18: 1197-
1202.
Shaw, G., Veldman., G. and Wooters, J.L. (1992) U.S. Patent 5,166,322.
Silvennoinen, O. and Ihle, J.N. (1996) Signalling by the Hematopoietic
Cytokine Receptors, R.G. Landes,
Company, Austin, TX.
Souza, L.M., Boone, T.C., Gabrilove, J., Lai, P.H., Zsebo, K.M., Murdock,
D.C., Chazin, V.R.,
Bruszewski, J., Lu, H., Chen, K.K., Barendt, J., Platzer, E., Moore, M.A.S.,
Mertelsmann, R.
and Welte, K. (1986) Science 232: 61-65.
Sytkowski, A.J., Lunn, E.D., Davis, K.L., Feldman, L. and Siekman, S. (1998)
Proc. Natl. Acad. Sci.
USA 95: 1184-1188.
Tanaka, H., Satake-Ishikawa, R., Ishikawa, M., Matsuki, S. and Asano, K.
(1991) Cancer Research 51:
3710-3714.
Thompson, S.A. (1992) J. Biol. Chem. 267: 2269-2273.
Torchinskii, Y.M. (1971) in "Sulfhydryl and Disulfide Groups of Proteins" in
Studies of Soviet S cience
(1971) Nauka Press, Moscow.
Trill, J.J., Shatzman, A.R., and Ganguly, S. (1995) Curr. Opin. Biotechnol.
6:553-560.
Trotta, P.B. (1986) Seminars in Oncology XIII Supplement 2: 3-12.
Tuma, R., Rosendahl, M. and Thomas, G. (1995) Biochem. 34: 15150-15156.
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
Urlaub, G. and Chasin, L.A. (1980) Proc. Natl. Acad. Sci. USA 77:4216-4220.
Van Den Berg, C.L., Stroh, C., Hilsenbeck, S.G., Weng, C.-N., McDermott, M.J.,
Cox, G.N. and Yee,
D. (1997) Eur. J. Cancer 33: 1108-1113.
Voss, T., Falkner, E., Ahorn, H. Krystek, E. Maurer-Fogy, I. Bodo, G.,
Hauptmann, R. (1994)
5 Biochem. J. 298, 719-725.
Wang, A., Lu, S.-d. and Mark, D.F. (1984) Science 224: 1431-1433.
Weinstein, Y., Ihle, J.N., Lavu, S. and Reddy, E.P. (1986) Proc. Natl. Acad.
Sci. USA 83: 5010-5014.
White, B. A. (1993) in Methods in Molecular Biology, Vol. 15: PCR Protocols:
Current Methods and
Applications edited by Humana Press, Inc. , Totowa,NJ.
10 Wingfield, P., Benedict, R., Turcatti, G., Allet, B., Mermod, J.-J.,
DeLamarter, J., Simana, M. and Rose, K.
(1988) Biochem. J. 256, 213-218.
Yamaoka, T., Tabata, Y. and Ikada, Y. (1994) J. Pharm. Sci. 83: 601-606.
While various embodiments of the present invention have been described in
detail, it is apparent
15 that modifications and adaptations of those embodiments will occur to those
skilled in the art. It is to be
expressly understood, however, that such modifications and adaptations are
within the scope of the present
invention.
SUBSTITUTE SHEET (RULE 26)
CA 02408851 2003-02-17
1
SEQUENCE LISTING
<110> Bolder Biotechnology, Inc.
<120> Methods for Refolding Proteins Containing Free Cysteine Residues
<130> 08-896458CA
<140> 2,408,851
<141> 2001-05-16
<150> 60/204,617
<151> 2000-05-16
<160> 79
<170> Patentln version 3.0
<210> 1
<211> 36
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 1
cgcaagcttg ccaccatggc tggacctgcc acccag 36
<210> 2
<211> 36
<212> DNA
<213> Artificial
<220>
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
2
<223> primer
<400> 2
cgcgaatcct ccggagggct gggcaaggtg gcgtag 36
<210> 3
<211> 66
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 3
ggcccggcca gctccctgcc gcagagcttc ctgctgaaga gcctcgagca agtgcgtaag 60
atccag 66
<210> 4
<211> 30
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 4
cgcgaattct tagggctggg caaggtggcg 30
<210> 5
<211> 66
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 5
ggcccggcca gctccctgcc gcagagcttc ctgcttaagt gcctcgagca agtgcgtaag 60
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
3
atccag 66
<210> 6
<211> 63
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 6
atgttcgttt tctctatcgc taccaacgcg tacgcaaccc cgctgggccc ggccagctcc 60
ctg 63
<210> 7
<211> 66
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 7
ccccctctag acatatgaag aagaacatcg cattcctgct ggcatctatg ttcgttttct 60
ctatcg 66
<210> 8
<211> 29
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 8
cgccatatga ccccgctggg cccggccag 29
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
4
<210> 9
<211> 36
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 9
accaacgcgt acgcaacccc gtgtggcccg gccagc 36
<210> 10
<211> 21
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 10
gccatcgccc tggatcttac g 21
<210> 11
<211> 36
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 11
accaacgcgt acgcatgccc gctgggcccg gccagc 36
<210> 12
<211> 30
<212> DNA
<213> Artificial
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
<220>
<223> primer
<400> 12
cgcgaattct tagggacagg caaggtggcg 30
<210> 13
<211> 21
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 13
gccatcgccc tggatcttac g 21
<210> 14
<211> 36
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 14
cgcgaattct taacagggct gggcaaggtg gcgtag 36
<210> 15
<211> 27
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 15
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
6
ccgctgggcc cgtgcagctc cctgccg 27
<210> 16
<211> 27
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 16
cggcagggag ctgcacgggc ccagcgg 27
<210> 17
<211> 22
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 17
ctatgcggca tcagagcaga to 22
<210> 18
<211> 27
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 18
ctgggcccgg cctgctccct gccgcag 27
<210> 19
<211> 27
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
7
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 19
ctgcggcagg gagcaggccg ggcccag 27
<210> 20
<211> 27
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 20
aacccgtacg catgtacccc gctgggc 27
<210> 21
<211> 27
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 21
gcccagcggg gtacatgcgt acgcgtt 27
<210> 22
<211> 22
<212> DNA
<213> Artificial
<220>
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
8
<223> primer
<400> 22
tgtggaattg tgagcggata ac 22
<210> 23
<211> 27
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 23
ggaatggccc cttgcctgca gcccacc 27
<210> 24
<211> 27
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 24
ggtgggctgc aggcaagggg ccattcc 27
<210> 25
<211> 27
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 25
gccctgcagc cctgccaggg tgccatg 27
<210> 26
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
9
<211> 27
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 26
catggcaccc tggcagggct gcagggc 27
<210> 27
<211> 27
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 27
ggtgccatgc cgtgcttcgc ctctgct 27
<210> 28
<211> 27
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 28
agcagaggcg aagcacggca tggcacc 27
<210> 29
<211> 27
<212> DNA
<213> Artificial
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
<220>
<223> primer
<400> 29
ccggccttcg cctgtgcttt ccagcgc 27
<210> 30
<211> 27
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 30
gcgctggaaa gcacaggcga aggccgg 27
<210>> 31
<211> 27
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 31
cccacccagg gttgcatgcc ggccttc 27
<210> 32
<211> 27
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 32
gaaggccggc atgcaaccct gggtggg 27
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
11
<210> 33
<211> 27
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 33
atgccggcct tctgctctgc tttccag 27
<210> 34
<211> 27
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 34
ctggaaagca gagcagaagg ccggcat 27
<210> 35
<211> 21
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 35
ggccattccc agttcttcca t 21
<210> 36
<211> 24
<212> DNA
<213> Artificial
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
12
<220>
<223> primer
<400> 36
ttcgttttct ctatcgctac caac 24
<210> 37
<211> 27
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 37
ctgcaggccc tgtgtgggat ctccccc 27
<210> 38
<211> 27
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 38
gggggagatc ccacacaggg cctgcag 27
<210> 39
<211> 27
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 39
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
13
ctggaaggga tctgccccga gttgggt 27
<210> 40
<211> 27
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 40
acccaactcg gggcagatcc cttccag 27
<210> 41
<211> 35
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 41
cgcgctgcag ttctcatgtt tgacagctta tcatc 35
<210> 42
<211> 42
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 42
cgcgctgcag atttaaatta gcgaggtgcc gccggcttcc at 42
<210> 43
<211> 38
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
14
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 43
gcgacgcgta cgcagcaccc acccgctcac ccatcact 38
<210> 44
<211> 42
<212> DNA
<213> Artificial.
<220>
<223> primer
<400> 44
gcggaattct tatttttgga ctggtttttt gcattcaaag gg 42
<210> 45
<211> 38
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 45
gcgacgcgta cgcagcaccc tgccgctcac ccatcact 38
<210> 46
<211> 32
<212> DNA
<213> Artificial
<220>
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
<223> primer
<400> 46
ccaacgcgta cgcagcccca ccacgcctca tc 32
<210> 47
<211> 33
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 47
ccggaattct taacggtcac ctgtgcggca ggc 33
<210> 48
<211> 30
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 48
ccggaattct tagtcacctg tgcggcaggc 30
<210> 49
<211> 57
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 49
ttcgctagca tgcatgacct gcaggaggaa atttaaatgg ccccaccacg cctcatc 57
<210> 50
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
16
<211> 39
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 50
gctaacgcgt acgcacacag ccaccgcgac ttccagccg 39
<210> 51
<211> 38
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 51
cggaattcct cgagctactt ggaggcagtc atgaagct 38
<210> 52
<211> 90
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 52
gtgcaccata tgaagaagaa catcgcattc ctgctggcta gcatgcatga cctgcaggag 60
gaaatttaaa tgcacagcca ccgcgacttc 90
<210> 53
<211> 37
<212> DNA
<213> Artificial
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
17
<220>
<223> primer
<400> 53
gaggaaattt aaatgtgcca cagccatcgc gacttcc 37
<210> 54
<211> 22
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 54
tgtggaattg tgagcggata ac 22
<210> 55
<211> 37
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 55
ggaagtcgcg atggctgtgg cacatttaaa tttcctc 37
<210> 56
<211> 35
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 56
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
18
gaggaaattt aaattgcagc catcgcgact tccag 35
<210> 57
<211> 36
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 57
ctggaagtcg cgatggctgc acatttaaat ttcctc 36
<210> 58
<211> 27
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 58
atgcacagcc actgcgactt ccagccg 27
<210> 59
<211> 27
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 59
cggctggaag tcgcagtggc tgtgcat 27
<210> 60
<211> 29
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
19
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 60
gccaccgcga ctgtcaaccg gtgctccac 29
<210> 61
<211> 29
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 61
gtggagcacc ggttgacagt cgcggtggc 29
<210> 62
<211> 31
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 62
catgcggggc atctgcggcg ccgacttcca g 31
<210> 63
<211> 31
<212> DNA
<213> Artificial
<220>
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
<223> primer
<400> 63
ctggaagtcg gcgccgcaga tgccccgcat g 31
<210> 64
<211> 27
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 64
ggctctgttc tcgtgctctg agggtcc 27
<210> 65
<211> 27
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 65
ggaccctcag agcacgagaa cagagcc 27
<210> 66
<211> 27
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 66
ccgctgaagc cctgcgcacg catcttc 27
<210> 67 ,
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
21
<211> 27
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 67
gaagatgcgt gcgcagggct tcagcgg 27
<210> 68
<211> 30
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 68
gacgtcctga ggtgcccgac ctggccccag 30
<210> 69
<211> 33
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 69
ggccaggcct ccagcctctg cgggggcagg ctc 33
<210> 70
<211> 33
<212> DNA
<213> Artificial
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
22
<220>
<223> primer
<400> 70
gagcctgccc ccgcagaggc tggaggcctg gcc 33
<210> 71
<211> 36
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 71
ctgctggggg gctgcctcct gggccagagt gccgcg 36
<210> 72
<211> 36
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 72
cgcggcactc tggcccagga ggcagccccc cagcag 36
<210> 73
<211> 31
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 73
ctcctggggc agtgcgcagc gagctgccat c 31
CA 02408851 2003-02-17
23
<210> 74
<211> 31
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 74
gatggcagct cgctgcgcac tgccccagga g 31
<210> 75
<211> 22
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 75
gacactgctg ctgagatgaa tg 22
<210> 76
<211> 22
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 76
cttgtagtgg ctggccatca tg 22
<210> 77
<211> 57
<212> DNA
<213> Artificial
CA 02408851 2002-11-12
WO 01/87925 PCT/US01/16088
24
<220>
<223> primer
<400> 77
cgcaacgcgt acgcagcacc ggcccgctcg ccgagcccga gcacgcagcc gtgggag 57
<210> 78
<211> 57
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 78
cgcgaattct tactcctgga ccggctccca gcagtcaaac gggatgacca gcagaaa 57
<210> 79
<211> 28
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 79
gttggtcaac tcgagccagc cgtgggag 28
