Note: Descriptions are shown in the official language in which they were submitted.
CA 02410694 2002-12-12
PORCINE REPRODUCTIVE AND RESPIRATORY SYNDROME
VIRUS (PRRSV) DNA VACCINES
FIELD OF THE INVENTION
The present invention relates to swine reproductive and respiratory syndrome.
BACKGROUND OF THE INVENTION
PRRS
Porcine reproductive and respiratory syndrome (PRRS) is a viral disease
characterized by
inappetence and severe reproductive failure, including late term abortions,
increased numbers of still-
born, mummified, and weak-born piglets, and respiratory problems affecting
pigs of all ages (Goyal
(1993) J. Vet. Diagn. Invest. 5:656-664). It is an economically important
viral disease that affects
swine worldwide.
PRRSV
Porcine reproductive and respiratory syndrome virus (PRRSV) has been found to
be the causative
agent of PRRS. The PRRSV is a small enveloped positive-stranded RNA virus and
is presently
classified within the family Arteriviridae, along with lactate dehydrogenase
elevating virus (LDV),
equine arteritis virus (EAV), and simian haemorrhagic fever virus (Meulenberg
et al., (1993)
Virology 192:62-72). Together with members of the family Coronaviridae, these
viruses have been
recently grouped into the order Nidovirales (Cavanagh (1997) Arch. Virol.
142:629-633).
The genome of PRRSV is about 15 kb in length and contains eight open reading
frames (ORFs).
ORF 1 a and ORFIb, situated at the 5' end of the genome, represent nearly 75%
of the viral genome
and code for proteins with apparent replicase and polymerase activities
(Meulenberg et al., (1993)
2
CA 02410694 2002-12-12
Virology 192:62-72; Conzelmann et al., (1993) Virology 193:329-339). Six
putative structural
proteins have been identified and assigned to distinct smaller ORFs, namely,
ORFs 2 to 7, located
at the 3' end of the genome (Mardassi et al., (1995) Arch. Yirol. 140:1405-
1418; Mardassi et al.,
(1996) Virology221:98-112;Meulenbergetal., (1995) Virology206:155-163). The
major structural
proteins consist of a 25 kDa envelope glycoprotein (GPS), an 18-19 kDa
unglycosylated membrane
protein (M), and a 15 kDa nucleocapsid (N) protein, encoded by ORFs S, 6, and
7, respectively
(Mardassi et al., (1995) Arch. Yirol. 140:1405-1418; Mardassi et al., (1996)
Virology 221:98-112;
Meulenberg et al., (1995) Virology 206:155-163). In addition, the expression
products of ORFs 2,
3, and 4, with respective apparent molecular masses of 30, 45, and 31 kDa, are
also incorporated into
virus particles as membrane-associated glycoproteins and are designated as
GPz, GP3, and GP4,
respectively (Meulenberg et al., (1996) Virology 225:44-51; Van Nieuwstadt et
al., (1996) J.
Virology 70:4767-4772).
Strains of PRRSV
Although the clinical syndromes associated with PRRS V infection are similar
in North America and
Europe, strains from the two continents are distinct. North American and
European serogroups have
been established on the basis of reactivities both to polyclonal pig sera
(Wensvoort et al., (1992)
J. Yet. Diagn. Invest. 4:134-138) and to MAbs directed to both the N and M
proteins (Nelson et. al.,
(1993) J. Clin. Microbiol. 31:3184-3189; Drew et al., (1995) J. Gen. Virol.
76:1361-1369; Dea et
al., (1996) J. Clin. Microbiol. 34:1488-1493).
DNA sequence analysis of both North American and European strains revealed
high genomic
variations (Mardassi et al., (1994) J. Gen. Virol. 75:681-685; Mardassi et
al., (1994) .I. Clin.
Microbiol. 32:2197-2203; Meng et al., (1995) Arch. Yirol. 140:745-755;
Murtaugh et al., (1995)
Arch. Yirol. 140:1451-1460).
The prototype European strain of PRRSV is the Lelystad virus (LV). This virus
was described in
EP 0 587 780 B1.
3
CA 02410694 2002-12-12
significant antigenic differences have also been reported among North American
isolates (Nelson
et. al., (1993)J. Clin. Microbiol. 31:3184-3189; Deaetal., (1996).1. Clin.
Microbiol. 34:1488-1493;
Yoon et al., (1995).1. Vet. Diagn. Invest. 7:386-387). Furthermore, genomic
variations have also
been reported among North American virulent and non-virulent isolates, in
spite of limited antigenic
variations (Kapur et al., (1996) .I. Gen. Virol. 77:1271-1276; Meng et al.,
(1995) J. Gen. Virol.
76:3181-3188). As yet, a correlation between genomic and antigenic variations
among North
American isolates remains to be demonstrated.
North American and European strains of PRRS V display a high degree of
variability in their ORF
2, 3, 5, and 7 coding regions with less than 60% amino acid identities
(Mardassi et al., (1995) Arch.
Virol. 140:1405-1418; Meng et al., (1995) J. Gen. Yirol. 76:3181-3188; Meng et
al., (1995) Arch.
Yirol. 140:745-755; Murtaugh et al., ( 1995) Arch. Yirol. 140:1451-1460).
Among North American
isolates, the ORFs 3, 4, and 5 show the highest degrees of diversity (Meng et
al., (1995) .I. Gen.
Virol. 76:3181-3188; Kapur et al., (1996) J. Gen Yirol. 77:1271-1276).
Unique PRRSV strains have been isolated in Quebec (Dea et al., (1992) Can.
Vet. J. 33:801-808;
Mardassi et al., (1994) Can. J. Vet. Res. 58:55-64; Mardassi et al., (1994) J.
Gen. Yirol. 75:681-
685). One such strain was adapted to grow in cell culture and is known as the
Quebec reference
cytopathic strain IAF-Klop (Mardassi et al., (1995) Arch. Virol. 140:1405-
1418).
ORFS
ORES encodes a 25 kDa glycosylated envelope protein (GPs). GPs is present
rather abundantly in
the virion and is partially exposed in association with the lipidic envelope
(Mardassi et al., (1996)
Virology 221:98-112; Meulenberg et al., (1995) Virology 206:155-163). It has
been demonstrated
that GPS is the major viral envelope glycoprotein (Loemba et al., (1996) Arch.
Yirol. 141:751-761;
Nelson et al., ( 1993) J. Clin. Microbiol. 31:3184-3189; Meulenberg et al.,
(1995) Virology 206:155
163). A hypervariable region with antigenic potential has been identified
within the N-terminal half
of GPS of North American field isolates (Meng et al., (1995) Arch. Virol.
140:745-755).
4
CA 02410694 2002-12-12
'The amino acid sequence identity between the Quebec IAF-Klop strain and the
reference US strain
is 89% for the ORFS-encoded glycoprotein, whereas the predicted product of the
Quebec and LV
strains displays only 52% amino acid identity (Mardassi et al., (1995) Arch.
Virol. 140:1405-1418;
Meng et al., (1995) Arch. Virol. 140:745-755).
Recently, it has been demonstrated that the Quebec IAF-Klop strain can be
differentiated from the
US modified live vaccine strain (MLV) derived from the ATCC VR-2332, in two
ways: (1)
serologically using monoclonal antibodies directed towards the N and M major
structural proteins;
and (2) by restriction fragment length polymorphisms of the ORF 6 and 7 genes
(Gagnon and Dea
( 1998) Can. J. Vet. Res. 62:110-116); Pirzadeh et al., ( 1998) Can. J. Yet.
Res. 62:in press; Dea et al.,
(1996).1. Clin. Microbiol. 34:1488-1493).
A hypervariable region with antigenic potential has been identified within the
N-terminal half of the
ORES gene productof North American field isolates (Pirzadeh et al., (1998)
Can. J. Vet. Res. 62:in
press).
Vaccines
A number of commercial vaccines exist against PRRSV infection. Vaccines
comprising inactivated
or attenuated infectious agent ATCC VR-2332 are claimed in the international
patent application
WO 93/03760. One such vaccine, RespPRRSTM (Boehringer Ingelheim Inc., St-
Joseph, MO), a
modified live-attenuated virus vaccine derived from the US reference strain
ATCC VR-2332
following successive passages in monkey kidney cells, is described in Murtaugh
et al., (1995) Arch.
Yirol. 140:1451-1460. This vaccine, also known as IngelvacTMMLV, which is
presently used widely
in pig farms of the U.S. and Canada, protects pigs against respiratory signs
following PRRSV
infection. Unfortunately, many problems have been reported following the use
of this vaccine in
pregnant sows, and it is not approved for use in adult breeding stock. Also,
it is unknown whether
the vaccine strain gains virulence following consecutive passages in pigs.
Vaccines similar to RespPRRSTM have been developed using different strains of
PRRSV. U.S.
5
CA 02410694 2002-12-12
Patent No. 5587164 describes a vaccine formulated using a PRRSV isolate
designated as ISU-P and
having Accession number ATCC VR 2402. Another vaccine, PrimePacrM, (Schering-
Plough Corp.,
New Jersey, USA) has been derived from a North American strain that does not
possess the epitope
of the N protein defined by the SDOW 17 anti-N Mab (Nelson et al., (1993) J.
Clin. Microbiol.
31:3184-3189). These vaccines present the same problems as the RespPRRSTM
vaccine.
The vaccine CyBIueTM (Cyanamid, Spain), is an inactivated vaccine from a
Spanish PRRSV grown
in primary pig alveolar macrophage culture. This vaccine uses macrophage,
which can be a source
of infection by an advantageous agent,. Also, one cannot discriminate between
animals vaccinated
with this vaccine and naturally-infected animals. Furthermore, this vaccine is
only used against
European strains: it does not protect against North American strains.
The use ofbaculovirus-expressed ORF7 and ORF3 proteins of a Spanish strain of
PRRSV have been
reported to induce protective immunity in pregnant sows (Plana-Duran et al., (
1997) Virus Genes
14:19-29). Virus challenge studies have shown that pregnant sows were
partially protected against
reproductive failure without developing a noticeable neutralizing humoral
response. Since, however,
only the protein is given to the animal, the animal does not have a cellular
response, merely a
humoral response.
U.5 Patent No. 5,690,940 describes PRRSV vaccines involving PRRSV strains of
low pathogenicity
that do not cause clinical symptoms of PRRS. One such virus, designated MN-Hs,
has ATCC
Accession No. VR2509.
U.S Patent No. 5,695,766 describes the "Iowa strain" of PRRSV and a vaccine
comprising an
inactivated or attenuated virus of this strain. The use of live attenuated
viral vaccines is generally
quite effective as the viruses mimic a natural infection. A serious
disadvantage of such vaccines,
however, is their pathogenicity in immunosuppressed recipients exposed to
environmental stress,
such as poor housing and over-crowding often prevalent in intensive animal
raising operations. This
can be of great concern in veterinary medicine where clinical outbreaks are
sometimes reported
6
CA 02410694 2002-12-12
shortly after prophylactic immunization. These vaccines also require special
handling to maintain
viability and to avoid tissue culture contaminants.
Inactivated vaccines, however, require additional immunizations,
disadvantageously contain
adjuvants, are expensive to produce, and are labourious to administer.
Furthermore, some infectious
virus particles may survive the inactivation process and may cause disease
after administration to
the animal.
Administration of live modif ed vaccines are also problematic because they may
result in virus
persistence, which in turn contributes to generation of mutants due to the
selective immune pressure
on the resident variants. Persistently-infected animals may eventually shed
newly generated
mutants, particularly in the case of unstable pathogens such as RNA viruses.
Such mutants may be
responsible for new outbreaks.
Also, it is well known that such traditional attenuated live virus vaccines
can revert to virulence
resulting in disease outbreaks in inoculated animals and the possible spread
of the pathogen to other
animals.
Monoclonal antibodies to the ORES product of the Quebec IAF-Klop strain have
been produced and
shown to have virus-neutralizing activity in vitro (Pirzadeh and Dea (1997) J.
Gen. Virol. 78:1867-
1873). Of the five monoclonal antibodies produced, only two reacted with the
modified live
attenuated vaccine strain ATCC VR-2332, while none reacted to the prototype
European strain LV.
This suggests that ORES contains serotype-specific linear neutralizing
epitopes. Immunizing pigs
with recombinant ORFS protein failed to trigger the immune system to produce
neutralizing
antibodies (Loemba et al., ( 1996) Arch. Virol. 141:751-761; Pirzadeh and Dea
(1998) J. Gen. Virol.
79:289-299).
Production and purification of large quantities of viral particles for use in
whole viral inactivated
vaccines or their immunogenic structural proteins is economically unfeasible
for low yield viruses
7
CA 02410694 2002-12-12
such as PRRSV.
Improved vaccines might be constructed based on recombinant DNA technology.
These vaccines
would contain only the necessary and relevant immunogenic material needed to
elicit a protective
immune response against the PRRSV pathogens, or the genetic information
encoding such material,
and would not display the above-mentioned disadvantages of the live or
inactivated vaccines.
DNA Immunization
The term DNA immunization refers to the induction of an immune response to a
protein antigen
expressed in vivo subsequent to the introduction of sequences encoding an
antigenic polypeptide
(Davis and Whalers Use plasmid DNA for direct gene transfer and immunization
G. Dickson, ed.
(London: Chapman & Hall, 1995)368-387). Direct gene transfer by intramuscular
and/or
intradermic injection of DNA encoding an antigenic protein may be used for the
purpose of
immunization. The resulting in situ production of the protein can involve
biosynthetic processing
and post-translational modifications (glycosylation processing, adequate
protein folding).
Consequently, both humoral and cell-mediated immune responses to viral surface
antigen have been
obtained after the expression of a transferred gene, and these are dose
dependent (Tighe et al., ( 1998)
Immunology Today 19: 89-97). Alternatively, DNA may be used to transfect cells
in culture (ex
vivo), which are then reintroduced into the body (indirect gene transfer).
Since genetic immunization
does not require the isolation of proteins, it is especially valuable for
proteins that may lose
conformational epitopes when extracted and purified biochemically.
The use of DNA immunization against viral pathogens has obtained encouraging
results in
laboratory animals such as mice (Davis et al., (1994) Vaccine 12:1503-1509;
Martins et al., (1995)
,l. Virol. 69:2574-2582; Ulmer et al., (1993) Science 259:1745-1748; Yokoyama
et al., (1995) J.
Virol. 69:2684-2688), guinea pigs (Bourne et al., (1996) J: Inf. Dis. 173: 800-
807), and rabbits
(Sundaram et al., (1996) NA. Res. 24:135-137). Recently, the use of DNA
immunization has been
reported in pigs for protection against Aujeszky's disease (Gerdts et al.,
(I997) .l. Gen. Virol.
78:2147-2151 ).
8
CA 02410694 2002-12-12
Diagnostics
The tests presently used for serological diagnosis of PR.RSV infection cannot
discriminate between
vaccinated and naturally-infected pigs. There is a need for serological and
molecular procedures that
would allow for distinction between a vaccine strain and emerging variants
possibly responsible
for new outbreaks or persistence of the disease in vaccinated herds.
Increasing commercial
exchanges between Europe and North America also require that effective
diagnostic tools be made
available to prevent transmission of serotypes that do not exist in the
importing countries.
Considering the increased incidence of PRRSV infection through the world, a
need remains for an
effective vaccine against PRRSV infection. The vaccine should be safe for use
in swine, including
pregnant sows and suckling, unweaning, and growing pigs. As well, a test is
needed for the
serological diagnosis of PRRSV infection that can differentiate between
vaccination and naturally-
occurring strains of PRRSV.
This background information is provided for the purpose of making known
information believed by
the applicant to be of possible relevance to the present invention. No
admission is necessarily
intended, nor should be construed, that any of the preceding information
constitutes prior art against
the present invention. Publications referred to throughout the specification
are hereby incorporated
by reference in their entireties in this application.
SUMMARY OF THE INVENTION
It is therefore an object of the present invention to provide porcine
reproductive and respiratory
syndrome virus (PRRSV) DNA vaccines. In accordance with an aspect of the
present invention
there is provided a DNA vaccine comprising an expression vector and a nucleic
acid sequence
encoding one or more PRRSV ORFs or fragments thereof, wherein upon
administration into a swine
free from PRRSV infection, said swine is protected from infection by PRRSV.
9
CA 02410694 2002-12-12
In accordance with another aspect of the present invention there is provided a
DNA vaccine selected
from the group comprising: pRc/CMV2; pRc/CMV3; pRc/CMV4; pRc/CMVS; pRc/CMV6;
pRc/CMV7; pAdCMVS/ORF2; pAdCMVS/ORF3; pAdCMVS/ORF4; pAdCMVS/ORFS;
pAdCMVS/ORF6; pAdCMVS/ORF7; AdCMVS/ORF2; AdCMVS/ORF3; AdCMVS/ORF4;
AdCMVS/ORFS; AdCMVS/ORF6; and AdCMVS/ORF7.
In accordance with another aspect of the present invention there is provided a
composition
comprising (i) a DNA vaccine comprising an expression vector and a nucleic
acid sequence encoding
one or more PRRSV ORFs or fragments thereof, wherein upon administration into
a swine free
from PRRSV infection, said swine is protected from infection by PRRSV; and
(ii) a
pharmaceutically acceptable carrier, buffer, solvent, or diluent.
In accordance with another aspect of the present invention there is provided a
kit for the
administration of a DNA vaccine, wherein said DNA vaccine comprises an
expression vector and
a nucleic acid sequence encoding one or more PRRSV ORFs or fragments thereof,
wherein upon
administration into a swine free from PRRSV infection, said swine is protected
from infection by
PRRSV, comprising: (i) the DNA vaccine, either lyophilized or in solution;
(ii) contained in a
container, such as a syringe, pipette, eye dropper, vial, nasal spray, or
inhaler; and (iii) instructions
for use.
In accordance with another aspect of the present invention there is provided a
serum suitable for
treatment of swine infected with PRRSV, comprising the semi-purified blood
serum of a mammal
inoculated with a DNA vaccine comprising an expression vector and a nucleic
acid sequence
encoding one ormore PRRSV ORFs or fragments thereof, wherein upon
administration into a swine
free from PRRSV infection, said swine is protected from infection by PRRSV.
In accordance with another aspect of the present invention there is provided a
method of using a
DNA vaccine to protect swine against PRRS, comprising administering to said
swine an effective
amount of a PRRS V DNA vaccine, wherein said DNA vaccine comprises an
expression vector and
CA 02410694 2002-12-12
a nucleic acid encoding one or more PRRSV ORFs or fragments thereof, wherein
upon
administration into a swine free from PRRS infection said swine is protected
from infection.
In one embodiment, the present invention provides DNA vaccines comprising an
expression vector
and a nucleic acid sequence encoding one or more PRRS V ORFs or fragments
thereof, wherein upon
administration into a swine free from PRRSV infection, said swine is protected
from infection by
PRRSV.
In a specific embodiment of the present invention, the expression vector may
be a plasmid. The
expression vector may further comprise transcription regulatory elements
operably linked to the
nucleic acid sequence, including the CMV promoter or bovine growth hormone
terminator. In a
preferred embodiment, the plasmid is pRc/CMV or pAd/CMVS. In specific
preferred embodiments,
the PRRSV DNA vaccine is pRc/CMV2, pRc/CMV3, pRc/CMV4, pRc/CMVS, pRc/CMV6,
pRc/CMV7, pAdCMVS/ORF2, pAdCMVS/ORF3, pAdCMVS/ORF4, pAdCMVS/ORFS,
pAdCMVS/ORF6, or pAdCMVS/ORF7.
In another specific embodiment, the expression vector may be a replication-
defective adenovirus.
Preferably, the adenovirus lacks at least a portion of the E1 region. The
expression vector may
further comprise adenovirus encapsidation and packaging signals, adenovirus
tripartite leader
sequences, and major late enhancer sequences. In a preferred embodiment, the
adenovirus is
Ad/CMVIacZ. In specific preferred embodiments, the PRRSV DNA vaccine is
AdCMVS/ORF2,
AdCMVS/ORF3, AdCMVS/ORF4, AdCMVS/ORFS, AdCMVS/ORF6, or AdCMVS/ORF7
The PRRSV ORFs or fragments thereof may be from any strain of PRRSV. In a
preferred
embodiment, the PRRSV strain is IAF-Klop.
The ORFs may be any ORF or combination of ORFs from a PRRSV virus, including
ORFs 2, 3, 4,
5, 6, and 7, or any combination thereof.
11
CA 02410694 2002-12-12
The nucleic acid may be cDNA, genomic DNA, or a cDNA/genomic DNA hybrid. The
nucleic acid
may further comprise the first ATG colon of the ORF, a Kozak motif , and/or
the C-terminal stop
colon of the ORF. The nucleic acid is under the transcriptional control of a
promoter functional in
eukaryotic cells. In a preferred embodiment, the promoter is the CMV promoter.
S Another embodiment of the present invention provides for a composition
comprising the PRRSV
DNA vaccines of the present invention and a pharmaceutically acceptable
carrier, buffer, solvent,
or diluent.
In a further embodiment, the present invention provides for host cells that
has been transformed by
PRRSV DNA vaccines.
In yet another embodiment, the present invention provides for kits for the
administration of PRRS V
DNA vaccines and for use in the detection of PRRSV in a sample.
In yet a further embodiment, the present invention provides for serum suitable
for treatment of swine
infected with PRRSV, comprising the semi-purified blood serum of a mammal
inoculated with a
DNA vaccine comprising an expression vector and a nucleic acid sequence
encoding one or more
PRRSV ORFs or fragments thereof, wherein upon administration into a swine free
from PRRSV
infection, said swine is protected from infection by PRRSV.
A further embodiment ofthe present invention provides a method of using a DNA
vaccine to protect
swine against PRRS, comprising administering to said swine an effective amount
of a PRRSV DNA
vaccine, wherein said DNA vaccine comprises an expression vector and a nucleic
acid encoding one
or more PRRSV ORFs or fragments thereof, wherein upon administration into a
swine free from
PRRS infection said swine is protected from infection. The DNA vaccine may be
administered by
intramuscular injection, subcutaneous injection, intradennal introduction,
impression through the
skin, inhalation, intraperitoneally, or intravenously. The method may comprise
the additional step
of administering single or multiple booster vaccinations to the swine.
12
CA 02410694 2002-12-12
A further embodiment of the present invention provides a method of using a
serum suitable for
treatment of swine infected with PRRSV to protect swine against PRRS,
comprising administering
to said swine and effective amount of said serum.
Various other objects and advantages of the present invention will become
apparent from the
detailed description of the invention.
BRIEF DESCRIPTION OF THE DRAWINGS
Fig. 1. Ultrathin section of a MARC-145 cell infected with the reference
Quebec IAF-Klop strain
of PRRS virus. Intracellular particles can be observed in the lumen of the
cytoplasmic vesicles, but
not in the nucleus (arrow). Virions consist of empty (electron translucent) or
complete (electron
dense center) enveloped particles, and possess a central isometric core
approximately 25-30nm in
diameter (arrows). Bar represents 100 nm.
Fig. 2. SDS-PAGE analysis of PRRSV-induced polypeptides. The figure represents
radioimmunoprecipitation profiles of extracellular virions of the PRRSV strain
IAF-Klop collected
from supernatants of ['SS] methionine-labelled MARC-145 cells after maximum
cytopathic effect
was achieved. The homologous porcine hyperimmune serum was used for
precipitation of viral
structural proteins after treatment (Lane 3) or no treatment with glyco F
(Lane 2). Positions of
molecular size markers (Lane 1 ) are shown on the left and the viral
structural proteins are indicated
by their molecular mass (in kilodaltons) on the right (GPS: 24.5 kDa; M: 19
kDa; and N: 14 to 15
kDa). Only the GPS protein was sensitive to glyco F treatment and thus
represents a glycosylated
protein. The arrow indicates the possible unglycosylated form of the 24.5 K
protein, regularly
observed after glyco F treatment.
Fig. 3. Identification of proteins encoded by PRRSV ORFs 5, 6, and 7 in
purified viral preparations.
(A) Reactivity of monospecifc antisera a5, a6, and a7 were first analyzed by
western
13
CA 02410694 2002-12-12
immunoblotting assay. Proteins from sucrose-gradient purified virus were
separated in denaturing
12% SDS-polyacrylamide gel and transferred to nitrocellulose membrane. Strips
of nitrocellulose
were probed with either a5, a6, or a7 monospecific antiserum or their
corresponding preserum
collected prior to immunization (pas, pa6, or pal, respectively). As controls,
nitrocellulose strips
were reacted with a hyperimmune porcine anti-PRRSV serum (aV) or its preserum
(paV). (B) Gel
analysis of PRRSV proteins immunoprecipitated from Triton X-100 lysates of
[35S]methionine-
labelled and sucrose gradient-purified virus. Viral proteins were solubilized
with LB-1 lysis buffer
containing 1% Triton X-100 followed by immunoprecipitation with aV, a5, a6, or
a7 antiserum.
The M,s of ['4C]methylated size marker protein bands (lane M) are to the left
of gel B, and positions
of the three PRRSV major structural proteins N, M, and E, are indicated in the
left and right margins
of A and B, respectively.
Fig. 4. Immunofluorescent staining of COS7 cells at 24 h post-transfection
with pRc/CMVS
plasmid. Expression of GPS of PRRSV (IAF-Klop strain) was confirmed by
indirect
immunofluorescence (IIF) following incubation in the presence of the rabbit
anti-ORFS
monospecific serum. A similar fluorescent profile was obtained following
incubation with the
autologous anti-PRRSV porcine hyperimmune serum. Expressed GPS protein mostly
accumulated
in the perinuclear region.
Fig. 5. Reactivity by immunoblotting of the serum of DNA-immunized pigs and
mice towards the
GPS of PRRSV and the recombinant ORFS-pH protein expressed in E. coli. Lane l:
Immunoblot
showing reactivity of a convalescent pig serum towards three major structural
proteins (N, M, and
GPS ) of PRRSV (IAF-Klop strain). Lanes 2 and 3: reactivity towards GPS of pig
and mouse sera
at day S 1 post-immunization with pRe/CMVS. Lanes 4 and S: reactivity of
pRc/CMVS immunized
mouse and pig sera with ORFS-pH recombinant protein expressed in E. coli. Lane
6: reactivity of
porcine convalescent serum with ORFS-pH recombinant protein.
Fig. 6. Ex-vivo blastogenic response of porcine PBMCs following incubation in
the presence of
different concentrations of Concanavaline A or ORFS-pH recombinant protein
antigen at variable
14
CA 02410694 2002-12-12
times post-immunization. (a) PBMCs obtained from both GST-ORFS or pRc/CMVS
immunized
pigs underwent specific blastogenesis in the presence of ORFS-pH, and
stimulation indexes of 7 to
12 were calculated. (b) No significant difference was observed in non-specific
mitogen-induced
blastogenesis response of PBMCs obtained from vaccinated and unvaccinated pigs
at variable times
S post-immunization.
Fig. 7. Histological findings in lungs of control (a) and unvaccinated PRRSV-
challenged (b,c,d)
pigs. (a) Spongiform aspect of the lung of a normal pig showing clear airway
passages (bronchiole
and alveolar duct indicated by arrows) and well delineated interalveolar
septae. (b) General aspect
of interstitial pneumonitis with alveolar septae thickened by
lymphomononuclear cells infiltration.
(c) Free mononuclear cells (arrows), necrotic cell debris, and proteinaceous
exudate within the
bronchioles lumen. (D) Presence of mononuclear cells lining the epithelium of
a large bronchi. Note
also the focal mild hyperplasia of the respiratory epithelium. HPS staining.
Fig. 8. Histopathological findings in lungs of GST-ORES (a, b) and pRc/CMVS
(c, d) immunized
pigs 14 days after challenge with PRRSV (IAF-Klop strain). (a) Localized
region of intensive
1 S interstitial pneumonitis, and accumulation of macrophages and necrotic
cell debris within the lumen
of a bronchiole with apparently no apparent damages to the epithelium. (b)
Normal aspect of the
epithelium of a large branchi with no accumulation of inflammatory exudate
within the lumen. Note
at the left, the presence of significant lesions of interstitial pneumonitis
with alveolar septae
thickened by lymphomononuclear cells infiltration. (c, d) Moderate
interstitial pneumonitis (ip) with
no apparent damages to the epithelium of the bronchioles and alveolar ducts
(arrows). Absence of
mononuclear cells and necrotic cell debris within the alveolar lumen. HPS
staining.
Fig. 9. Genomic map of the shuttle vector pAdCMV S/ORFS used for construction
of recombinant
adenoviruses carrying PRRSV structural protein genes. The pAdCMVS/ORFS
construct contains
the following: an adenovirus encapsidation and packaging signal; an adenovirus
tripartite leader
2S sequence and major late enhancers; the adenovirus major late promoter
enhancer (enh MLP); an
HCMV promoter (pro) and enhancer (enh); a gene that confers resistance to
ampicillin (Amp); an
1S
CA 02410694 2002-12-12
E. coli replicon pML2; a polyadenylation site (pA); SS 1 splicing signal (ss);
inverted terminal
repeats (ITR); tripartite leader (tpl); an origin of replication in E. coli
cells (Ori); and human
adenovirus type 5 portions involved in homologous recombination with genomic
DNA of the wild
type virus (Ad5).
DETAILED DESCRIPTION OF THE INVENTION
The following terms and abbreviations are used throughout the specification
and in the claims:
"expression construct" means any type of genetic construct containing a
nucleic acid coding for a
gene product in which part or all of the nucleic acid encoding sequence is
capable of being
transcribed. The transcript may be translated into a protein, but it need not
be. Thus, in certain
embodiments, expression includes both transcription of an ORF gene and
translation of an ORF
mRNA into an ORF gene product. In other embodiments, expression only includes
transcription of
the nucleic acid encoding an ORF;
"porcine reproductive and respiratory syndrome (PRRS)" refers to the disease
syndromes Mystery
Swine Disease, Mystery Pig Disease, Mystery Disease, Mystery Reproductive
Syndrome, swine
plague, New Pig Disease, Wabash syndrome, abortus blau, Blue Eared Pig
Disease, Porcine
Epidemic Abortion and Respiratory Syndrome (PEARS), swine infertility and
respiratory syndrome
(SIRS), Epidemic Late Abortion of Swine (ELAS), Hyperthermia, Anorexia and
Abortion Syndrome
of the Sow (HAASS), PNP, EMCV, Interstitial Pneumonia, Porcine Arterivirus,
the disease caused
by the Iowa strain of PRRS V, and closely-related variants of these diseases
which have appeared and
which will appear in the future;
"porcine reproductive and respiratory virus (PRRSV)" refers to the causatory
agent of a porcine
reproductive and respiratory syndrome, as described above;
16
CA 02410694 2002-12-12
"vaccine" means an agent that protects a swine against PRRS caused by a PRRSV.
Vaccine can
additionally mean an agent whereby, after administration of the agent to an
unaffected swine, lesions
in the lung or symptoms of the disease do not appear or are not as severe as
in infected, unprotected
swine, and if, after administration of the agent to an affected swine, lesions
in the lung or symptoms
of the disease are eliminated or are not as severe as in infected, unprotected
swine. An unaffected
swine is a swine that has either not been exposed to a PRRSV, or that has been
exposed to a PRRSV
but is not showing symptoms of the disease. An affected swine is a swine that
is showing symptoms
of the disease; and
"nucleic acid sequence" as used herein refers to a polymeric form of
nucleotides of any length, both
to ribonucleic acid sequences and to deoxyribonucleic acid sequences. In
principle, this term refers
to the primary structure of the molecule; thus, this term includes double and
single stranded DNA,
as well as double and single stranded RNA, and modifications thereof.
It is readily apparent to those skilled in the art that variations or
derivatives of the nucleotide
sequence encoding a protein can be produced which alter the amino acid
sequence of the encoded
protein. The altered expressed protein may have an altered amino acid
sequence, yet still elicits
immune responses which react with a PRRSV, and are considered functional
equivalents. In
addition, fragments of the full length genes which encode portions of the full
length protein may also
be constructed. These fragments may encode a protein or peptide which elicits
antibodies which
react with a PRRSV, and are considered functional equivalents.
The present invention resides in the discovery that the expression of a PRRSV
ORF is sufficient to
elicit neutralizing antibodies in swine.
The present invention describes the use of expression constructs encoding
PRRSV ORF nucleic acid
sequences to immunize swine against PRRS. The PRRSV ORF nucleic acid sequences
can also be
used to detect the presence of PRRSV infection in swine.
17
CA 02410694 2002-12-12
ORF Nucleic Acids
Any PRRSV ORF nucleic acid sequence can be used in the present invention,
including ORFs 2,
3, 4, 5, 6, and 7.
The nucleic acid according to the present invention may encode an entire ORF
gene, a functional
ORF protein domain, or any ORF polypeptide, peptide, or fragment that is
sufficient to effect an
immune response against a PRRSV infection. The expression construct may
contain more than one
ORF nucleic acid sequence. The ORF may be derived from genomic DNA. In
preferred
embodiments, however, the nucleic acid encoding an ORF comprises complementary
DNA (cDNA).
The term "cDNA" is intended to refer to DNA prepared using messenger RNA
(mRNA) as template.
The advantage of using a cDNA, as opposed to genomic DNA or DNA polymerized
from a genomic,
non- or partially-processed RNA template, is that the cDNA does not contain
any non-coding
sequences but, rather, contains only the coding region of the corresponding
protein. There may be
times when the full or partial genomic sequence is preferred, such as where
the non-coding regions
are required for optimal expression or where non-coding regions such as
introns are to be targeted.
It is also contemplated that a given ORF nucleic acid may be represented by
natural variants that
have slightly different primary sequences but, nonetheless, are biological
functional equivalents of
each other. As is well known in the art, the degeneracy of the genetic code
permits substitution of
bases in a codon resulting in another codon but still coding fox the same
amino acid, e.g. the codon
for the amino acid glutamic acid is both GAT and GAA. In order to function
according to the
present invention, all that is required is that the expressed ORF cause an
immune response against
PRRSV. Immune reactivity may include both production of antibodies by B-cells
(humoral
immunity) and activation of T-cells (cellular immunity). Humoral immunity may
be demonstrated
by the induction of antibody production by B-cells in vivo or in vitro. Cell-
mediated immunity may
be demonstrated by T-cell activation, for example by increased T-cell protein
synthesis, or by the
stimulation of B-cells by activated T-cells. Assays for both types of immunity
are well known in
18
CA 02410694 2002-12-12
the art.
Furthermore, fragments of the nucleic acid sequences encoding the PRRSV ORFs
or functional
variants thereof as mentioned above are included in the present invention. The
term "fragment" as
used herein means a DNA or amino acid sequence comprising a subsequence of the
nucleic acid
sequence or polypeptide of the invention. Said fragment is or encodes a
polypeptide having one or
more immunogenic determinants of the PRRSV ORF protein, i.e. has one or more
epitopes of the
ORF protein that are capable of eliciting an immune response in swine, as
described above.
Fragments can inter alia be produced by enzymatic cleavage of precursor
molecules, using restriction
endonucleases for the DNA and proteases for the polypeptides. Other methods
include chemical
synthesis of the fragments or the expression of polypeptide fragments by DNA
fragments.
Nucleic acid sequences may be derived from any isolate of a PRRS strain. The
ORF nucleic acid
sequences for numerous PRRS strains have been submitted to GenBank, the NIH
genetic sequence
database. These nucleotide sequences are available at Internet address
http://www.ncbi.nhn.nih.gov/Entrez/nucleotide.html.
Other PR.RSV ORF nucleic acid sequences may be obtained using generally
applied Southern
blotting technique or colony hybridization (Experiments in Molecular Biology,
Slater (ed.), (1986:
Clifton, U.S.A.); Singer-Sam et al., (1983) Proc. Natl. Acad. Sci. U. S. A.
80:802-806; Maniatis et
al., "Molecular Cloning, A laboratory Manual" 2"d ed. (1989: Cold Spring
Harbor Laboratory Press,
USA)). For example, restriction enzyme digested DNA fragments derived from a
specific PRRSV
strain is electrophoresed and transferred, or "blotted" thereafter onto a
piece of nitrocellulose filter.
The nucleic sequences encoding the ORFs can be identified on the filter by
hybridization to a
defined labelled DNA or "probe" of a known ORF sequence, under specific
conditions of salt
concentration and temperature that allow hybridization of the probe to any
homologous DNA
sequences present on the filter. After washing the filter, hybridized material
may be detected by
autoradiography. Once the relevant sequence is identified, DNA fragments can
be recovered after
agarose gel electrophoresis.
19
CA 02410694 2002-12-12
In another way, PRRSV cDNA may be cloned into a ~.gtl 1 phage as described by
Huynh et al., In:
D. Glover (ed.) "DNA Cloning: A Practical Approach" (1985: IRL Press Oxford)
49-78, and
expressed into a bacterial host. Recombinant phages can then be screened with
polyclonal serum
raised against a purified ORF protein, determining the presence of
corresponding immunological
regions of the variant polypeptide.
A nucleic acid sequence according to the invention may be isolated from a
particular PRRSV strain
and multiplied by recombinant DNA techniques including polymerase chain
reaction (PCR)
technology. Alternatively, the nucleic acid sequence may be chemically
synthesized in vitro by
techniques known in the art.
DNA sequences encoding the polypeptides which are functional equivalents of
the said PRRSV
ORFs can readily be prepared using appropriate synthetic oligonucleotides in
primer-directed
site-specific mutagenesis, as described by Morinaga et al. (1984)
Biotechnology 2:636.
In a preferred embodiment, the ORF nucleic acid sequence is derived from the
Quebec reference
cytopathic strain IAF-Klop (Mardassi et al., ( 1994) Can. J. Vet. Res. 58:55-
64). The IAF-Klop ORF
(IAF-exp91) nucleotide sequences are published in (Mardassi et al., (1995)
Arch. Virol. 140:1405-
1418). The nucleotide sequences for ORFs 3-7 of the IAF-Klop strain of PRRSV
are available from
GenBank at accession numbers U64928 (IAF-Klop ORF) and L40898 (IAF-exp91) .
Vectors:
Once identif ed and isolated, the ORF nucleic acid sequences of this invention
can be inserted into
an appropriate expression vector, which contains the elements necessary for
transcription and
translation of the inserted gene sequences, in such a way that the inserted
nucleic acid sequences are
expressed to elicit an immune response in the infected host. Useful cloning
vehicles may consist of
segments of chromosomal, nonchromosomal, and synthetic DNA sequences, such as
various known
bacterial plasmids, virus DNA (such as retroviruses and vaccina virus), phage
DNA, combinations
of plasmids and viral or phage DNA such as plasmids which have been modified
to employ phage
CA 02410694 2002-12-12
DNA or other expression control sequences, or yeast plasmids.
Plasmids
Plasmid DNA offers many potential advantages. First, it is much quicker and
easier to make and
purify plasmid DNA than viral vectors. This fact, combined with easier quality
control, facilitates
technology transfer and reduces cost ofproduction. In addition, some viral
vectors necessarily result
in integration of the DNA into the genome ( e.g. retrovirus); this introduces
important safety
concerns. Plasmid DNA is designed to remain nonintegrated and to be expressed
from an episomal
location.
An equally important consideration is an immune response to the injected
material itself. Since DNA
does not seem to induce an immune response, there is a lack of immunogenicity
of the vector itself.
Vector immunogenicity could preclude the use of the same or similar vector for
subsequent
immunization (Wolff et al. (1993) Journal Cell Sci. 103:1249-1259). Following
DNA
immunization, however, only the expressed protein triggers the immune system
for the production
of a specif c immune response. Also, adverse reactions can be prevented
(antibody dependent
1 S enhancement, hypersensibility, autoimmune racoons) by introducing only
genomic regions encoding
major antigenic determinants. Furthermore, since DNA is stable, it can be
lyophylized to be used
in less developed areas of the world where refrigeration is scarce and
expensive. This is in contrast
to most vaccine preparations.
Plasmids that can be used in the present invention include, but are not
limited to, those derived from
Escherishia coli (eg., pBR322, pBR325, pUC 12, pUC 13, and the like) or those
derived from
Bacillus subtilis (eg., pUB 110, pTPS, pC194 and the like). Specific plasmids
that can be used in the
present invention include, but are not limited to, pRc/CMV (In Vitrogen),
pCDNA-3 (InVitrogen),
pAdCMVS, and pAdTRS (Massie et al., (1998) J. Virol. 72:2289-2296). In a
preferred embodiment
of the present invention, the eukaryotic expression vectors pRc/CMV
(Invitrogen) and pAdCMVS
(Pirzadeh and Dea (1998) Journal of General Virology 79: 989-999) are used.
21
CA 02410694 2002-12-12
Adenoviruses
In certain embodiments of the invention, the expression construct comprises a
virus or engineered
construct derived from a viral genome. The ability of certain viruses to enter
cells via
receptor-mediated endocytosis and to integrate into host cell genome and
express viral genes stably
and efficiently have made them attractive candidates for the transfer of
foreign genes into
mammalian cells. The first viruses used as gene vectors were DNA viruses
including the
papovaviruses (simian virus 40, bovine papilloma virus, and polyoma and
adenoviruses (Ridgway,
"Mammalian Expression Vectors" in Rodriguez & Denhardt eds, Vectors: A Survey
ofMolecular
Cloning Vectors and Their Uses (Stoneham: Butterworth, 1988) 467-492; Baichwal
and Sugden,
"Vectors For Gene Transfer Derived From Animal DNA Viruses: Transient and
Stable Expression
of Transferred Genes" in R. Kucherlapati, ed., Gene Transfer (New York: Plenum
Press, 1986)
117-148). They can accommodate up to 8 kilobases of foreign genetic material
and can be readily
introduced in a variety of cell lines and laboratory animals.
Knowledge of the genetic organization of adenovirus, a 36 kb, linear and
double-stranded DNA
virus, allows substitution of a large piece of adenoviral DNA with foreign
sequences up to 8 kb
(Grunhaus and Horwitz (1992) Virology 3:237-252). The infection of adenoviral
DNA into host
cells does not result in chromosomal integration because adenoviral DNA can
replicate in an
episomal manner without potential genotoxicity. Also, adenoviruses are
structurally stable, and no
genome rearrangement has been detected after extensive amplification.
Adenovirus can infect
virtually all epithelial cells regardless of their cell cycle stage.
Adenovirus is particularly suitable for use as a gene transfer vector because
of its mid-sized genome,
ease of manipulation, high titer, wide target-cell range, and high
infectivity. Both ends of the viral
genome contain 100-200 base pair inverted terminal repeats (ITR), which are
cis elements necessary
for viral DNA replication and packaging. The early (E) and late (L) regions of
the genome contain
different transcription units that are divided by the onset of viral DNA
replication. The E1 region
(E 1 A and E 1 B) encodes proteins responsible for the regulation of
transcription of the viral genome
and a few cellular genes. The expression of the E2 region (E2A and E2B)
results in the synthesis of
22
CA 02410694 2002-12-12
the proteins for viral DNA replication. These proteins are involved in DNA
replication, late gene
expression, and host cell shut off (Prevec et al., (1989) Journal of General
Virology 70 (Pt2):429-
434; Ascadi et al., (1995) J. Mol. Med. 73:165-180; Graham and Prevec (1991),
"Manipulation of
AdenovirusVector" in E.J. Murray, ed., Methods in Molecular Biology: Gene
Transfer and
Expression Protocols (Clifton, NJ: Humana Press) 7:109-128). The products of
the late genes,
including the majority of the viral capsid proteins, are expressed only after
significant processing
of a single primary transcript issued by the major late promoter (MLP). The
MLP (located at 16.8
m.u.) is particularly efficient during the late phase of infection, and all
the mRNAs issued from this
promoter possess a 5' tripartite leader (tpl) sequence which makes them
preferred mRNAs for
translation.
In the current system, recombinant adenovirus is generated by homologous
recombination between
a shuttle vector and provirus vector. Due to the possible recombination
between two proviral vectors,
wild-type adenovirus may be generated from this process; therefore, it is
critical to isolate a single
clone of virus from an individual plaque and examine its genomic structure.
Use of the VAC system
is an alternative approach for the production of recombinant adenovirus.
Generation and propagation of the current adenovirus vectors, which are
replication deficient,
depend on a unique helper cell line, designated 293, which was transformed
from human embryonic
kidney cells by Ad5 DNA fragments and constitutively expresses E 1 proteins
(Graham et al., ( 1977)
J. Gen. Virol. 36:59-72). Since the E3 region is dispensable from the
adenovirus genome, the current
adenovirus vectors, with the help of 293 cells, carry foreign DNA in either
the E1, the E3 or both
regions (Graham and Prevec (1991) Meth. Mol. Biol. 7:109-128).
Helper cell lines may be derived from human cells such as human embryonic
kidney cells, muscle
cells, hematopoietic cells or other human embryonic mesenchymal or epithelial
cells. Alternatively,
the helper cells may be derived from the cells of other mammalian species that
are permissive for
human adenovirus. Such cells include, e.g. , Vero cells or other monkey
embryonic mesenchymal
or epithelial cells. As stated above, the preferred helper cell line is 293
(Graham et al., (1977),1. Gen.
23
CA 02410694 2002-12-12
Virol. 36:59-72).
Other than the requirement that the adenovirus vector be replication
defective, or at least
conditionally defective, the nature of the adenovirus vector is not believed
to be crucial to the
successful practice of the invention. The adenovirus may be of any of the 42
different known
serotypes or subgroups A-F. Adenovirus type 5 of subgroup C is the preferred
starting material in
order to obtain the conditional replication-defective adenovirus vector for
use in the method of the
present invention.
As stated above, the typical vector according to the present invention is
replication defective and will
not have an adenovirus E1 region; thus, it will be most convenient to
introduce the nucleic acid
encoding an ORF at the position from which the E 1 coding sequences have been
removed. The
position of insertion of the ORF coding region within the adenovirus
sequences, however, is not
critical to the present invention. The nucleic acid encoding an ORF
transcription unit may also be
inserted in lieu of the deleted E3 region in E3 replacement vectors or in the
E4 region where a helper
cell line or helper virus complements the E4 defect.
Adenovirus is easy to grow and manipulate and exhibits broad host range in
vitro and in vivo. This
group of viruses can be obtained in high titers, e.g.,109 -10" plaque-forming
unit (PFII)/ml, and they
are highly infective. The life cycle of adenovirus does not require
integration into the host cell
genome (Graham and Prevec (1991) Meth. Mol. Biol. 7:109-128). The foreign
genes delivered by
adenovirus vectors are episomal, and therefore, have low genotoxicity to host
cells. No side effects
have been reported in studies of vaccination with wild-type adenovirus (Top et
al., (1971) J. Infect.
Diseases 124:148-154; Prevec et al., (1989) J. Gen. Virol. 70:429-434),
demonstrating their safety
and therapeutic potential as in vivo gene transfer vectors.
Adenovirus vectors have been used in eukaryotic gene expression and vaccine
development
(Grunhaus and Horwitz (1992) Virology 3:237-252; Graham and Prevec (1992)
Biotechnology
20:363-390), particularly in farm animals (Tones et al., (1995) Virology
213:503-516; Ebata et al.,
24
CA 02410694 2002-12-12
(1992) Virus Res 24:21-33; Breker-Klassen et al., (1995) J. Virology 69:4308-
4315).
The preferred adenovirus vectors for use in the present invention are pAdBMI,
pAdBMS,
pAdCMVS, and pAdTRS (Ascadi et al., (1994) Human Mol. Genet. 3:578-584; Jani
et al., (1997)
J. Virol. Meth. 64:111-124; Massie etal., (1998)J. Virol. 72:2289-2296; U.S.
Patent No. 5,518,913).
Vector Elements
In preferred embodiments, the nucleic acid encoding an ORF is under the
transcriptional control of
a promoter. A "promoter" refers to a DNA sequence recognized by the synthetic
machinery of the
cell, or introduced synthetic machinery, required to initiate the specific
transcription of a gene. The
phrase "under transcriptional control" means that the promoter is in the
correct location and
orientation in relation to the nucleic acid to control RNA polymerase
initiation and expression ofthe
gene.
The term promoter will be used to refer to a group of transcriptional control
modules that are
clustered around the initiation site for RNA polyrnerase II. Much of the
thinking about how
promoters are organized derives from analyses of several viral promoters,
including those for the
HSV thymidine kinase (tk) and SV40 early transcription units. These studies,
augmented by more
recent work, have shown that promoters are composed of discrete functional
modules, each
consisting of approximately 7-20 by of DNA, and containing one or more
recognition sites for
transcriptional activator or repressor proteins.
At least one module in each promoter functions to position the start site for
RNA synthesis. The best
known example of this is the TATA box, but in some promoters lacking a TATA
box, such as the
promoter for the mammalian terminal deoxynucleotidyl transferase gene and the
promoter for the
SV40 late genes, a discrete element overlying the start site itself helps to
fix the place of initiation.
Additional promoter elements regulate the frequency of transcriptional
initiation. Typically, these
are located in the region 30-110 by upstream of the start site, although a
number of promoters have
CA 02410694 2002-12-12
recently been shown to contain functional elements downstream of the start
site as well. The spacing
between promoter elements can be flexible, so that promoter function is
preserved when elements
are inverted or moved relative to one another. In the tk promoter, the spacing
between promoter
elements can be increased to 50 by apart before activity begins to decline.
Depending on the
promoter, it appears that individual elements can function either co-
operatively or independently to
activate transcription.
The particular promoter that is employed to control the expression of a
nucleic acid encoding an
ORF is not believed to be important, so long as it is capable of expressing
the nucleic acid in the
targeted cell; thus, where a swine cell is targeted, it is preferable to
position the nucleic acid coding
region adjacent to and under the control of a promoter that is capable of
being expressed in a swine
cell. Generally speaking, such a promoter might include either a mammalian or
viral promoter.
In various embodiments, the human cytomegalovirus (CMV) immediate early gene
promoter, the
SV40 early promoter, or the Rous sarcoma virus long terminal repeat can be
used to obtain
high-level expression of an ORF. The use of other viral or mammalian cellular
or bacterial phage
1 S promoters to achieve expression of an ORF is contemplated as well,
provided that the levels of
expression are suff cient for a given purpose.
Enhancers were originally detected as genetic elements that increased
transcription from a promoter
located at a distant position on the same molecule of DNA. This ability to act
over a large distance
had little precedent in classic studies of prokaryotic transcriptional
regulation. Subsequent work
showed that regions ofDNA with enhancer activity are organized much like
promoters. That is, they
are composed of many individual elements, each of which binds to one or more
transcriptional
proteins.
The basic distinction between enhancers and promoters is operational. An
enhancer region as a
whole must be able to stimulate transcription at a distance; this need not be
true of a promoter region
or its component elements. On the other hand, a promoter must have one or more
elements that direct
26
CA 02410694 2002-12-12
initiation of RNA synthesis at a particular site and in a particular
orientation, whereas enhancers lack
these specificities. Promoters and enhancers are often overlapping and
contiguous, often seeming
to have a very similar modular organization.
The following are examples of enhancers that could be used in combination with
a nucleic acid
encoding an ORF in an expression construct: BHK enh, CMV enh, and AdMLP enh.
Where a cDNA insert is employed, one will typically desire to include a
polyadenylation signal to
effect proper polyadenylation of the ORF transcript. The nature of the
polyadenylation signal is not
believed to be crucial to the successful practice of the invention, and any
such sequence may be
employed. The inventors have employed the SV40L polyadenylation signal in the
pRc/CMV vector,
and the rabbit globin poly A signal in the adenovirus shuttle vectors, because
they are convenient
and known to function well in the target cells employed. Also contemplated as
an element of the
expression cassette is a terminator. These elements can serve to enhance
message levels and to
minimize read through from the cassette into other sequences.
There are many embodiments of the instant invention which those skilled in the
art can appreciate
from the specification; thus, different transcriptional promoters,
terminators, carrier vectors, or
specific gene sequences may be used successfully.
Construction
The insertion of the ORF nucleic acids into a cloning vector is easily
accomplished when both the
genes and the desired cloning vehicle have been cut with the same restriction
enzyme or enzymes,
since complementary DNA termini are thereby produced. If this cannot be
accomplished, it may be
necessary to modify the cut ends that are produced by digesting back single-
stranded DNA to
produce blunt ends, or by achieving the same result by filling in the single-
stranded termini with an
appropriate DNA polymerase. In this way, blunt-end ligation with an enzyme
such as T4 DNA ligase
may be carried out. Alternatively, any site desired may be produced by
ligating nucleotide sequences
(linkers) onto the DNA termini. Such linkers may comprise specific
oligonucleotide sequences that
27
CA 02410694 2002-12-12
encode restriction site recognition sequences. The cleaved vector and the ORF
nucleic acid
sequences may also be modified by homopolymeric tailing, as described by
Morrow ( 1979) Methods
in Enzymology 68:3.
Once the ORF nucleic acid is inserted into the expression vector, the
expression construct may be
replicated in and isolated from an appropriate host organism. The selection of
an appropriate host
organism is affected by a number of factors known in the art. These factors
include, for example,
compatibility with the chosen vector, toxicity of proteins encoded by the
hybrid plasmid, ease of
recovery of the desired protein, expression characteristics, biosafety, and
costs. A balance of these
factors must be considered, and it must be understood that not all hosts will
be equally effective for
expression of a particular recombinant DNA molecule.
Suitable host microorganisms that can be used in this invention include but
are not limited to plant,
mammalian, or yeast cells, or bacteria such as Escherichia coli, Bacillus
subtilis, Bacillus
stearothermophilus and Actinomyces. Transfer of the recombinant cloning vector
into the host cell
may be carried out in a variety of ways. Depending upon the particular
vector/host cell system
chosen, such transfer may be effected by transformation, transduction,
transfection or
electroporation. Once such a modified host cell is produced, the cell can be
cultured and the
expression construct may be isolated from the culture.
In one embodiment of the present invention, the LAF-Klop PRRSV ORFS is
incorporated into the
pAdCMVS expression vector. Briefly, viral genomic RNA was extracted from PRRSV
IAF-Klop
infected MARC-145 cells by the guanidinium isothiocyanate-acid phenol method
(Chomczynski &
Sacchi ( 1987) Analytical Biochem. 162:156-159). The ORES gene was then
reverse-transcribed and
amplified by polymerase chain reaction (PCR) using the following primers: ETS
5 (forward
primer) 5'- AAGCTT GCC GCC GCC ATG TTG GGG AAA TGC TTG ACC- 3' , which
comprises the first
ATG codon of the ORES gene downstream of a Kozak motif for initiation of
translation in
vertebrates (Kozaic (1987) Molecular Biology 196:947-950), and ETRS (reverse
primer) 5'-
TCTAGAGGCAAAAGTCATCTAGGG-3', which comprises the C-terminal stop codon of the
viral
28
CA 02410694 2002-12-12
gene. The nucleotide sequence accession number (EMBL/GenBankIDDBJ libraries)
of IAF-Klop
strain is U64928.
For directional cloning, Hind III and Xba I restriction sites were added at
the 5' ends of the sense
and antisense oligonucleotide primers, respectively (Pirzadeh and Dea (1987)
J. Gen. Virol.
79:989-999). The ORES encoding region was further cloned into the Hind III and
Xba I cloning
sites of the eukaryotic expression vector pRc/CMV (Invitrogen), down-stream of
the human
cytomegalovirus (CMV) promoter, producing the plasmid pRc/CMVS.
In another embodiment of the present invention, the PCR amplified ORFS gene
was inserted into
the unique BamHl site of the adenovirus transfer vector pAdCMVS to generate
pAdCMVS/ORFS,
I O which was used for eukaryotic transient expression assays, DNA
immunization experiments, and
recombinant adenovirus construction. In this shuttle vector, the gene is
driven by an optimized
human cytomegalovirus (CMV) promoter. The expression cassette is flanked on
one end by the
encapsidation and packaging signals of the human adenovirus type 5 and on the
other end by an
adenovirus sequence allowing recombination and generation of replication-
defective recombinant
virus in which El gene is replaced by the expression cassette. In this
cassette, which was derived
from pAdBMS (IJS Patent No. 5, 518,913), expression of heterologous genes is
optimized by the
presence of the Adenovirus tripartite leader sequence and the Adenovirus major
late enhancer
flanked by splice donor and acceptor sites.
The generation of recombinant adenovirus was done as detailed in Jani et al.
(1997) J. virological
Methods 64:1 I 1-124. Briefly, AdCMVIacZ DNA was rendered non-infectious by
CIaI digestion
and co-transfected in 293 cells with the same amount of pAdCMVS/ORFS (or
pAdTRS/ORFS) DNA
that was linearized by digestion of the unique CIaI site. Transfected cells
were cultivated and viral
plaques were picked and expanded. Recombinant AdCMV/ORFS viruses were
identified by PCR
and by indirect immunofluorescence in 293 cells using the rabbit a5
monospecific antiserum
(Mardassi et al., (1996) virology 221:98-112). These expression constructs
were subsequently
subcloned twice to ensure their purity.
29
CA 02410694 2002-12-12
Ex-vivo expression of pRc/CMVS and pAdCMVS/ORFS constructs was tested in
transient
expression experiments in COS7 and 293 cells maintained as confluent
monolayers. Cells were
transfected with plasmid DNA by calcium phosphate coprecipitation (Graham &
van der Eb,
(1973) Virology 52:456-467). For indirect immunofluorescence (IIF), cells were
reacted with anti-
s ORFS rabbit monospecific hyperimmune serum (Mardassi et al., (1996) Virology
221:98-112)
and the immune reaction was revealed following incubation with fluorescein-
conjugated goat anti-
rabbit Ig (Boehringer Mannheim), as previously described (Loemba et al.,
(1996) Archives of
Virology 141:751-761).
The pRc/CMVS vector (In Vitrogen) or pcDNA3 (In Vitrogen) eukaryotic vectors
used for genetic
immunization both offer the following features: promoter sequences from the
immediate early gene
of the human cytomegalovirus (CMV) for high-level transcription;
polyadenylation signal and
transcription termination sequences from the bovine growth hormone (BHG) gene
to enhance RNA
stability; SV40 origin for episomal replication and simple vector rescue in
cell lines expressing S V40
large T antigen (e.g. COS1, COS7, NIH3T3 and human 293 cells); T7 and SP6 RNA
promoters
flanking the multiple cloning site for in vitro transcription of sense and
antisense RNA; the fl origin
for rescue of the sense strand for mutagenesis and single-stranded sequencing;
and the ampicillin
resistance gene and ColEl origin for selection and maintenance in E. coli.
The pAdCMVS/ORFS construct contains the following: an adenovirus encapsidation
and packaging
signal; an adenovirus tripartite leader sequence and major late enhancers; the
adenovirus major late
promoter enhancer (enh MLP); an HCMV promoter (pro) and enhancer (enh); a gene
that confers
resistance to ampicillin (Amp); an E. coli replicon pML2; a polyadenylation
site (pA); SS 1 splicing
signal (ss); inverted terminal repeats (ITR); tripartite leader (tpl); an
origin of replication in E. coli
cells (Ori); and human adenovirus type 5 portions involved in homologous
recombination with
genomic DNA of the wild type virus (Ads) (see Figure 9).
Gene Transfer
In order to effect expression of ORF constructs, the expression construct must
be delivered into a
CA 02410694 2002-12-12
cell. This delivery may be accomplished in vitro, as in laboratory procedures
for transforming cells
lines, in vivo, or ex vivo (see below). As described above, the preferred
mechanism for delivery is
via viral infection where the expression construct is encapsidated in an
infectious viral particle.
Experiments in administering recombinant adenoviruses to different tissues
include trachea
instillation ( Rosenfeld et al., (1992) Cell 68:143-155), muscle injection
(Ragot et al., (1993)
Nature 361:647-650), peripheral intravenous injection (Herz and Gerard (1993)
Proc. Natl. Acad.
Sci. USA 90:2812-2816), and stereotactic inoculation into the brain (Le Gal La
Salle et al., (1993)
Science 259:988-990).
In a preferred embodiment, adenovirus constructs would be delivered to swine
via intradermal
I O and/or intramuscular injection using the GenGun transfection system
(Johnston and De-chu (1994)
"Gene Gun Transfection of Animal Cells and Genetic Immunization" In Methods in
Cell Biology,
43:353-366), or using a 26 gauge needle and tuberculin syringe. The
intramuscular inj ection is given
into the tibialis cranalis muscle, whereas the intradermal injection is given
into the dorsal surface of
the ear.
Several non-viral methods for the transfer of expression constructs into
cultured mammalian cells
also are contemplated by the present invention. These include calcium
phosphate co-precipitation
technique, DEAF-dextran, electroporation, direct microinjection, DNA-loaded
liposomes,
lipofectamine-DNA complexes, cell sonication, gene bombardment using high
velocity
microprojectiles, and receptor-mediated transfection, aII of which are known
in the art. Some of
these techniques may be successfully adapted for in vivo or ex vivo use.
Once the expression construct has been delivered into the cell, the nucleic
acid encoding ORF may
be positioned and expressed at different sites. The nucleic acid encoding ORF
may be stably
maintained in the cell as a separate, episomal segment of DNA. Such nucleic
acid segments or
"episomes" encode sequences sufficient to permit maintenance and replication
independent of or in
synchronization with the host cell cycle. How the expression construct is
delivered to a cell and
31
CA 02410694 2002-12-12
where in the cell the nucleic acid remains is dependent on the type of
expression construct employed.
In one embodiment of the invention, the expression construct may consist of
DNA plasmids.
Transfer of the construct may be performed by any of the methods mentioned
above that physically
or chemically permeabilize the cell membrane. This is particularly applicable
for transfer in vitro,
but it may be applied to in vivo use as well. Dubensky et al. (1984) Proc.
Natl. Acad. Sci. USA
81:7529-7533 successfully injected polyomavirus DNA in the form of CaP04
precipitates into liver
and spleen of adult and newborn mice demonstrating active viral replication
and acute infection.
Benvenisty and Neshif (1986) Proc. Natl. Acad. Sci. USA 83:9551-9555 also
demonstrated that
direct intraperitoneal injection of CaP04 precipitatedplasmids results in
expression ofthe transfected
genes. It is envisioned that DNA encoding an ORF could also be transferred in
vivo in a similar
manner to express ORF.
Another embodiment of the invention for transferring DNA expression constructs
into cells could
involve particle bombardment (Johnston and De-chu (1994) Methods in Cell
Biology 43:353-366).
This method depends on the ability to accelerate DNA coated microprojectiles
to a high velocity
allowing them to pierce cell membranes and enter cells without killing them.
Several devices for
accelerating small particles have been developed. One such device relies on a
high voltage discharge
to generate an electrical current, which in turn provides the motive force.
The microprojectiles used
have consisted of biologically inert substances such as tungsten or gold
beads. Selected organs,
including the liver, skin, and muscle tissue of rats and mice, have been
bombarded in vivo. This rnay
require surgical exposure of the tissue or cells, to eliminate any intervening
tissue between the gun
and the target organ, i.e., ex vivo treatment. Again, DNA encoding an ORF may
be delivered via this
method within the scope of the present invention.
In a further embodiment of the invention, the expression construct may be
entrapped in a liposome.
Liposomes are vesicular structures characterized by a phospholipid bilayer
membrane and an inner
aqueous medium. Multilamellar liposomes have multiple lipid layers separated
by aqueous medium.
They form spontaneously when phospholipids are suspended in an excess of
aqueous solution. The
32
CA 02410694 2002-12-12
lipid components undergo self rearrangement before the formation of closed
structures and entrap
water and dissolved solutes between the lipid bilayers. Also contemplated are
lipofectamine-DNA
complexes. Liposome-mediated nucleic acid delivery and expression of foreign
DNA in vitro has
been very successful in cultured chick embryo, HeLa and hepatoma cells.
Nicolau et al., (1987)
Methods in Enzymology 149:157-176 accomplished successful Iiposome-mediated
gene transfer in
rats after intravenous injection.
In certain embodiments, gene transfer may more easily be performed under ex
vivo conditions. Ex
vivo gene therapy refers to the isolation of cells from an animal, the
delivery of a nucleic acid into
the cells in vitro, and then the return of the modified cells back into the
animal. This may involve
the surgical removal of tissue or organs from an animal or the primary culture
of cells and tissues.
U.5. Pat. No. 5,399,346 disclose ex vivo therapeutic methods.
Primary mammalian cell cultures may be prepared in various ways. In order for
the cells to be kept
viable while in vitro and in contact with the expression construct, it is
necessary to ensure that the
cells maintain contact with the correct ratio of oxygen and carbon dioxide and
nutrients but are
protected from microbial contamination. Cell culture techniques are well
documented. During in
vitro culture, the expression construct may deliver and express a nucleic acid
encoding an ORF into
the cells. The cells may then be reintroduced into the original animal, or
administered into a different
animal, in a pharmaceutically acceptable form by any of the means described
below.
Administration
The vaccines of the present invention can be administered in a conventional
active immunization
scheme: single or repeated administration in a manner compatible with the
dosage formulation and
in such amount as will be prophylactically and/or therapeutically effective
and immunogenic, i.e.
the amount of expression construct capable of expressing an ORF that will
induce immunity in an
animal against challenge by a virulent PRRSV. Immunity is defined as the
induction of a higher
level of protection in a population of animals after vaccination compared to
an unvaccinated group.
33
CA 02410694 2002-12-12
The amount of expression construct to be introduced into a vaccine recipient
will have a very broad
dosage range and will depend on the strength of the transcriptional and
translational promoters used.
In addition, the magnitude of the immune response will depend on the level of
protein expression
and on the immunogenicity of the expressed ORF gene product. In general, an
effective dose ranges
of about SO to 500 pg, and preferably about 50 to 100 p.g of plasmid DNA is
administered.
Intramuscular injection, subcutaneous injection, intradermal introduction,
impression through the
skin, and other modes of administration such as intraperitoneal, intravenous,
or inhalation delivery
are also suitable. The preferable modes of administration are intramuscular
and intradermal.
It is also contemplated that booster vaccinations may be provided.
The therapeutic compositions of the present invention are advantageously
administered in the form
of injectable compositions either as liquid solutions or suspensions; solid
forms suitable for solution
in, or suspension in, liquid prior to inj ection may also be prepared. These
preparations (recombinant
adenoviruses) may also be emulsified. A typical composition for such purpose
comprises a
pharmaceutically acceptable carrier. For instance, the composition may contain
10 mg, 25 mg, 50
mg or up to about 100 mg of human serum albumin per millilitre of phosphate
buffered saline. Other
pharmaceutically acceptable carriers include aqueous solutions, non-toxic
excipients including salts,
preservatives, buffers, stabilizers (such as skimmed milk or casein
hydrolysate), and the like.
Examples of non-aqueous solvents are propylene glycol, polyethylene glycol,
vegetable oil, and
injectable organic esters such as ethyloleate. Aqueous carriers include water,
alcoholic/aqueous
solutions, saline solutions, parenteral vehicles such as sodium chloride,
Ringer's dextrose, etc.
Intravenous vehicles include fluid and nutrient replenishers. Preservatives
include antimicrobial
agents, anti-oxidants, chelating agents, and inert gases. The pH and exact
concentration of the
various components of the pharmaceutical composition are adjusted according to
well known
parameters.
Kits
34
CA 02410694 2002-12-12
All the essential materials and reagents required for vaccinating swine,
transforming cells, or
detecting PRRSV infection, may be assembled together in a kit. This generally
will comprise
selected expression constructs. Also included may be various media for
replication of the expression
constructs and host cells for such replication. Such kits will comprise
distinct containers for each
individual reagent.
When the components of the kit are provided in one or more liquid solutions,
the liquid solution
preferably is an aqueous solution, with a sterile aqueous solution being
particularly preferred. For
in vivo use, the expression construct may be formulated into a
pharmaceutically acceptable
syringeable composition. In this case, the container means may itself be an
inhalant, syringe, pipette,
eye dropper, or other such like apparatus, from which the formulation may be
applied to an infected
area of the animal, such as the lungs, injected into an animal, or even
applied to and mixed with the
other components of the kit.
The components of the kit may also be provided in dried or lyophilized forms.
When reagents or
components are provided as a dried form, reconstitution generally is by the
addition of a suitable
solvent. It is envisioned that the solvent also may be provided in another
container means.
Irrespective of the number or type of containers, the kits of the invention
also may comprise, or be
packaged with, an instrument for assisting with the injection/administration
or placement of the
ultimate complex composition within the body of an animal. Such an instrument
may be an inhalant,
syringe, pipette, forceps, measured spoon, eye dropper or any such medically
approved delivery
vehicle.
Use
The vaccines of the present invention can be used for the immunization of
swine against porcine
reproductive and respiratory syndrome (PRRS). The expressed recombinant
proteins can also be
used as antigens for the development of diagnostic procedures.
The plasmid expression constructs of the present invention can be used as
transfer vectors to
CA 02410694 2002-12-12
construct other expression vectors, such as adenovirus expression constructs
described previously.
The plasmid expression constructs of the present invention can also be used to
inoculate swine,
following which PRRSV-neutralizing serum is obtained from these swine. This
serum can then be
used for the passive immunization of other swine. Indeed, vaccinated pregnant
sows could secrete
large amounts of specific anti-PRRSV antibodies via their colostrum and milk
which would protect
suckling piglets. Also, serum from vaccinated animals, or purif ed
gammaglobulin preparations, can
be injected parenterally (intramuscular, intraveinous or intraperitoneal
injection) to naive or
immunodeprived pigs in order to protect them temporarily from natural PRRSV
infection.
The expression constructs of the present invention can also be used for
diagnostic purposes.
Recombinant adenoviruses or recombinant plasmid DNA vectors carrying the
foreign PRRSV viral
genes (e.g. PRRSV structural protein) may be used to infect or transfect cell
cultures (e.g. COS7,
293, A549, MARC-145, or KB cells). The foreign PRRSV ORF proteins carrying
major antigenic
determinants are then effectively expressed or synthesized in the cell
cultures. These cells cultures
may be used for diagnostic purposes; for example, one can determine whether an
animal contains
specific antibodies in its serum that are directed to the expressed PRRSV
proteins using
immunochemieal techniques such as indirect immunolluorescence,
immunoperoxydase,
immunogold silver staining, or enzyme linked immunosorbant assay (ELISA). The
recombinant
PRRSV proteins may also be recovered from the supernatant fluids of
homogenates of the
adenovirus-infected cell cultures and used as a source of antigens for ELISA,
radioimmuno assay
(RIA), and agglutination assays.
Advantages
The present invention describes vaccines for nucleic acid immunization against
PRRSV. There are
several advantages to immunization with nucleic acids, rather than with
viruses or proteins. The first
is the relative sirnplieity with which native or nearly native antigen can be
presented to the immune
system. Mammalian proteins expressed recombinantly in bacteria, yeast, or even
mammalian cells
often require extensive treatment to ensure appropriate antigenicity. A second
advantage of DNA
36
CA 02410694 2002-12-12
immunization is that it can evoke both humoral and cell-mediated immune
responses; the
immunogen can enter the MHC class I pathway and evoke a cytotoxic T cell
response.
The use of live attenuated viral vaccines is generally quite effective as the
viruses mimic a natural
infection. A serious disadvantage of such vaccines, however, is their
pathogenicity in
immunosuppressed recipients exposed to environmental stress, such as poor
housing and over-
crowding often prevalent in intensive animal raising operations. This can be
of great concern in
veterinary medicine where clinical outbreaks are sometimes reported shortly
after prophylactic
immunization. These vaccines also require special handling to maintain
viability and to avoid tissue
culture contaminants.
Administration of live modified vaccines are also problematic because they may
result in virus
persistence, which in turn contributes to generation of mutants due to the
selective immune pressure
on the resident variants. Persistently-infected animals may eventually shed
newly generated
mutants, particularly in the case of unstable pathogens such as RNA viruses.
These mutants may
be responsible for new outbreaks.
Production and purification of large quantities of viral particles for use in
whole viral inactivated
vaccines or their immunogenic structural proteins is economically unfeasible
for low yield viruses
such as PRRSV.
A further advantage of the vaccines of the present invention is that the
animals immunized with these
vaccines can be differentiated from naturally-infected swine. Animals infected
naturally by a virus
or other pathogen produce antibodies to the major antigenic determinants of
the various proteins of
these pathogens; for example, in the case of PRRSV, infected pigs usually
produce antibodies
directed to the three major structural proteins N, M, and GPS. In the case of
animals vaccinated by
genetic immunization or with recombinant virus vectors, the animals produce
antibodies directed
only to the proteins expressed in the cells by the recombinant DNA plasmids or
recombinant viruses.
The use of diagnostic tests that permit detection of antibodies specific to
the targeted proteins,
37
CA 02410694 2002-12-12
together with tests that permit detection of antibodies to the various
proteins of the pathogens (e.g.
Western imunoblotting, indirect immunofluorescence using cells infected with
the recombinant
virus, or ELISA using recombinant proteins), allows for the differentiation
between vaccinated and
naturally-infected animals.
The present invention is described in further detail in the following non-
limiting examples. It is to
be understood that the examples described below are not meant to limit the
scope of the present
invention. It is expected that numerous variants will be obvious to a person
skilled in the art to
which the present invention pertains, without any departure from the spirit of
the present invention.
The appended claims, properly construed, form the only (imitation upon the
scope of the present
invention.
EXAMPLES
Materials and Methods:
Experimental animals:
Twelve crossbred Fl (Landrace X Yorkshire) SPF piglets weaned at 3 weeks of
age were obtained
I S from a breeding farm in the province of Quebec. The breeding stock and
piglets were tested and
proven to be seronegative for PRRSV, encephalomyocarditis virus (EMCV),
porcine parvovirus
(PPV), haemagglutinating encephalomyelitis virus (HEV), transmissible
gastroenteritis virus
(TGEV) and Mycoplasma hyopneumoniae. The piglets used in this study were from
two different
litters and randomly divided into 4 experimental groups. Each group of three
piglets were allocated
to separate isolation rooms in facilities equipped with microorganism free
filtered in-flowing and
out-flowing air system. They were fed commercial food and water ad libitum.
Six week-old female BALB/c and CD-1 mice were purchased from Charles River
Laboratories and
separated in groups of 5 mice per cage which were equipped with individual
filtered air channels.
38
CA 02410694 2002-12-12
YIYIIS SLYaIn:
The Quebec cytopathic strain IAF-Klop (Mardassi et al., ( 1994) Can. J. Vet.
Res. 58:55-64) used in
this study was initially isolated from an acute case of PRRS and propagated in
MARC-145 cells, a
clone of MA-104 cells highly permissive to PRRSV (Kim et al., (1993) Archives
of Virology
S 133:477-483), graciously provided to us by J. Kwang (US Meat Animal Research
Centre, USDA,
Agricultural Research Service, Clay Centre, Nebraska). Virus titration was
done by end-point
dilution using immunoperoxydase on monolayer assay (IPMA) (Wensvoort et al., (
1991 ) Veterinary
Quarterly 13:121-130) and virus titres were expressed in tissue culture
infective dose 50 (TCIDso)
per ml, as previously described (Dea et al., (1992) Canadian Veterinary
Journal 33:801-808). In
order to verify the virulence of the virus strain and eliminate MARC-145
cellular proteins that are
copurified with the virus, IAF-Klop strain of PRRSV was subjected to one
passage on primary
culture of porcine alveolar macrophages (PAMs) followed by two successive in
vivo passages in
pigs. The animals used for providing PAMs and for virus adaptation were
obtained from the same
farm, treated and reared under the same conditions, as mentioned above.
Piglets used for in vivo
passages received via intratracheal inoculation 10 ml of cell culture
supernatant, adjusted to 106
TCIDso of virus/ml. On the seventh day post-inoculation, when respiratory
distress became evident,
the piglets were euthanised and their lungs were aseptically collected and
homogenized in RPMI
medium supplemented with 200 U/ml of penicillin, 200 ~g/ml of streptomycin and
50 pg/ml
gentamycin. Each challenged piglet received via intratracheal injection, 10 ml
of clarified 5% lung
homogenate in sterile RPMI corresponding to m infectious dose of 5 X 105
TCIDso of virus, as
established by back titration. The inoculum was further tested for the
presence of the above indicated
porcine pathogens and no organism other than PRRSV could be isolated.
ORF Nucleic Acids:
Viral RNA was extracted from PRRSV-infected MARC-145 cells, as previously
described (Mardassi
et al., (1996) Virology 221:98-112). The ORF encoding regions were amplified
by RT-PCRTM using
the oligonucleotide primers listed in Table 1.
39
CA 02410694 2002-12-12
Table 1. Sequences of the Oligonucleotide Primers used for
RT-PCR and
Size of the Expected Amplified Products
ORF genes Sense
Sequence (5'
to 3') Genome
locationz Product
(bases) Size (bp)
ORF2-S + ATGAAATGGGGTCTATGC 28 - 45 783 768
ORF2-AS - CACACCGTGTAATTCACCG 793 - 811
ORF3-S + ATGGCTAATAGCCGTACA 651 - 668 765 762
ORF3-AS - CTATCGCCGTGCGGCACT 1398 - 1415
ORF4-S + ATGGCTGCGTCCCTTCTT 1196 - 1213 537 534
ORF4-AS - TCAAATTGCCAACAGAATGG 1713 - 1732
ORFS-S + ATGTTGGGGAAATGCTTGACC 1743 - 1763 612 600
ORFS-AS - GGCAAAAGTCATCTAGGG 2339 - 2356
ORF6-S + ATGGTGTCGTCCCTAGATGAC 2337 - 2357 579 522
ORF6-AS - CAGCTGATTGCATGGCTGGC 2897 - 2916
ORF7-S + CTAAATATGCCAAATAACAAC 2845 - 2865 396 369
ORF7-AS - CTCAAGAATGCCAGCTCA 3223 - 3240
1 Sizes of individualgenes refer to those deduced from the nucleotide
viral sequences of the tissue culture-adapted
Quebec IAF-Klop
strain of PRRSV
(EMBL/GenBank
accession numbers
are given in
the text).
z Nucleotide
location on
the PRRSV genome
was given in
reference to
the sequences
of the prototype
North American
strains ATCC
VR-2385 (EMBL/GenBank
accession numbers
U20788 and U03040)
and ATCC VR-2332
(EMBL/GenBank
accession number
U00153).
Plasmid Constructs:
The amplified ORF encoding regions were cloned into pGEX-4T1 plasmid
(Pharmacia).
Recombinant fusion proteins, consisting of glutathion sulfotransferase (GST)
joined to the 1~1
terminal of the ORF7, ORF6, ORFS, ORF4, and ORF3 proteins (GST-ORF7, GST-ORF6,
GST
ORFS, GST-ORF4, and GST-ORF3, respectively), were expressed inE. coli and
purified by affinity
chromatography on glutathion sepharose columns, as previously described
(Mardassi et al., (1996)
Virology 221:98-112; Pirzadeh & Dea (1997) Journal of General Virology 78:1867-
1873).
CA 02410694 2002-12-12
Subsequent SDS-PAGE analysis of the purified proteins confirmed that no
contaminants from
bacterial proteins were present in the purified recombinant fusion proteins
(data not shown).
Plasmidic DNAs were purified from bacterial lysates by anion exchange
chromatography on
hydroxyapatite columns {QTAGEN Inc, Chatsworth, CA) and then precipitated by
isopropanol,
effectively eliminating bacterial protein contaminants.
The amplified ORF encoding regions were also cloned into pET 21, a prokaryotic
plasmid
(Novagen), to produce recombinant proteins in E. coli consisting of the ORFS,
ORF4, and ORF3
encoded proteins, each fused at their C-terminal to 6 histidine residues (ORFS-
pH, ORF4-pH, and
ORF3-pH, respectively).
The ORFS encoding region was further cloned into the Hind III and Xba I
cloning sites of the
eukaryotic expression vector pRc/CMV (Invitrogen), down-stream of the human
cytomegalovirus
(HCMV) promoter to produce pRc/CMVS. The sequence of the oligonucleotide
primers used for
this amplification were as follows:
ETS 5 (forward primer) : 5'- AAGCTT GCC GCC GCC ATG TTG GGG AAA TGC TTG ACC-
3' (SEQ ID
NO: ), which comprises the first ATG codon of the ORFS gene downstream of a
Kozak motif for
initiation of translation in vertebrates (Kozak (1987) Nucleic Acids Research
15:8125-8132), and
ETRS (reverse primers): 5'- TCTAGAGGCAAAAGTCATCTAGGG-3' (SEQ ID NO: ), which
comprises
the C-terminal stop codon of the viral gene.
The nucleotide sequence accession number (EMBL/GenBank/DDBJ libraries) of IAF-
Klop strain
is U64928. For directional cloning, Hind III and Xba I restriction sites were
added at the S' ends of
the sense and antisense oligonucleotide primers, respectively. Both strands of
pRe/CMVS were
sequenced in an Automated Laser Fluorescent DNA sequencer (Pharmacia LKB) in
order to confirm
that no error has occurred as a result of PCR amplif canon.
The PCR amplified ORFS gene was also inserted into the unique BamHl site of
the adenovirus
transfer vector pAdCMVS (Massie et al., (1998) J. Virology 72:2289-2296) to
generate
41
CA 02410694 2002-12-12
pAdCMVS/ORFS, which was used for eukaryotic transient expression assays, DNA
immunization
experiments, and recombinant adenovirus construction. In this shuttle vector,
the gene is driven by
an optimized human cytomegalovirus (CMV) promoter. The expression cassette is
flanked on one
end by the encapsidation and packaging signals of the human adenovirus type 5,
and on the other
end by an adenovirus sequence allowing recombination and generation of
replication-defective
recombinant virus in which the E 1 gene is replaced by the expression
cassette. This cassette was
derived from pAdBMS (Ascadi et al., (1994) Human Mol. Genet. 3:578-584).
Expression of
heterologous genes is optimized in this cassette by the presence of the
adenovirus tripartite leader
sequence and the adenovirus major late enhancer Clanked by splice donor and
acceptor sites (Jani et
al., (1997) J. VirologicaT Methods 64:11 I-124).
Similar strategies were used for cloning PCR amplified ORFs 2, 3, 4, 6, and 7
into the pAdCMVS
transfer vector to create shuttle vectors for the construction of recombinant
replication defective
adenoviruses.
Adenovirus Constructs:
The generation ofrecombinant adenovirus was done, as described in Jani et al.,
( 1997) J. Yirological
Methods 64:I 11-I24. Briefly, Ad/CMVIacZ DNA was rendered non-infectious by
Clal digestion
and co-transfected in 293 cells with the same amount of pAdCMVS/ORF2, ORF3,
ORF4, ORFS,
ORF6, or ORF7 DNA that was linearized by digestion of the unique CIaI site.
Transfected cells
were cultivated in 6 cm tissue culture plates in DMEM medium containing 1% Sea-
Plaque agar
(FMC Products). Viral plaques were picked 10 to 20 days later and expanded.
Recombinant
AdCMVS/ORF2, AdCMVS/ORF3, AdCMVS/ORF4, AdCMVS/ORFS, AdCMVS/ORF6, and
AdCMVS/ORF7 viruses were identified by PCR and by IIF in 293 cells using the
rabbit S
monospecific antiserum for each ORF oncoprotein (Mardassi et al., (1996)
Virology 221:98-112;
Mardassi et al., (1998) J. Virology (in press); Gonin et al., (1998) Archives
of Virology (in press))
and were subsequently subcloned twice to ensure purity.
Transient Expression of ORES:
Ex vivo expression of pRc/CMVS and pAdCMVS/ORF2 to 7 constructs were tested in
transient
expression experiments in COS7 and 293 cells maintained as confluent
monolayers. Cells in 6 cm
42
CA 02410694 2002-12-12
tissue culture plates were transfected with 15 ug plasmid DNA by calcium
phosphate coprecipitation
(Graham and van der Eb ( 1973) Virology 52:456-467). For indirect
immunofluorescence (IIF), cells
were incubated at 37 ° C and fixed with 80% cold acetone for 20 minutes
at 4 °C at variable times ( 18
to 72h) post-transfection. The monolayers were then reacted for 30 minutes
with rabbit
S monospecific hyperimmune sera (Mardassi et al., ( 1996) Virology 221:98-112;
Gonin et al., (1998)
Archives of Virology (in press)). The immune reactions were revealed following
incubation with
fluorescein-conjugated goat anti-rabbit Ig (Boehringer Mannheim) as previously
described (Loemba
et al., (1996) Archives of Virology 141:751-761).
Immunization:
In vivo expression of pRc/CMVS was verified by immunizing groups of 5 CD-1 or
BALB/c mice
with SO~cg of pRc/CMVS diluted in 50 p1 of phosphate buffered saline (PBS),
and injected in the
tibialis cranialis muscle with a 27 gauge-needle. The mice were boosted twice
with the same
quantities of DNA at 2 week-intervals. Control mice received the same amounts
of parental
pRc/CMV vector via an identical route and frequency, or three doses
intraperitoneally of SOpg of
GST-ORFS in Freund's complete or incomplete adjuvant.
Groups of 3 piglets were injected three times at two week intervals with 100
pg of pRc/CMVS
diluted in 0.5 ml of PBS. Two thirds of the volume was injected using a 26-
gauge needle in the
tibialis cranialis muscle of the right leg and one third was administered
intradermally into the dorsal
surface of the ear. Control piglets received either 100 pg of the parental
vector via an identical route
and frequency, or 300gg of GST-ORFS.
Virus neutralization and serological tests:
Mice and pig sera were tested for the presence of specific anti-GPS antibodies
by virus neutralization
(VN), IIF, ELISA and Western immunoblotting (WB) tests. The VN test was
performed in triplicates
with 100 p1 of serial dilutions of heat-inactivated (56° C, 45 min)
test sera, incubated for 60 min at
37 °C in the presence of I00 TCIDso of the virus in DMEM. The mixtures
were then put in contact
with confluent monolayers of MARC-145 cells seeded in 96 well-microtitration
plates 48-72 h
earlier. Cell monolayers were incubated at 37°C in a humidified
atmosphere containing 5% CO2,
and observed daily for up to 5 days for the appearance of cytopathic effects
(CPE). The monolayers
43
CA 02410694 2002-12-12
were then fixed with a solution of 80% methanol containing 0.05% HzOz , and
tested for expression
of the PRRSV nucleocapsid protein by IPMA (Wensvoort et al., (1991) Veterinary
Quarterly
13:121-130), using N protein specific MAb IAF-ICS (Pirzadeh & Dea (1997)
Journal of General
Virology 78:1867-1873). The immune reaction was revealed following subsequent
incubation with
peroxydase-labelled goat anti-mouse IgG (Boehringer Mannheim). Neutralizing
titres were
expressed as the reciprocal of the highest dilution that completely inhibited
the expression of viral
N protein. The IIF was performed on PRRSV-infected and acetone-fixed MARC-145
cells, as
previously described (Loemba et al., (1996) Archives of Virology 141:751-761).
Indirect ELISA
was essentially performed as previously described (Pirzadeh & Dea (1997)
Journal of General
IO Virology 78:1867-1873) with minor modifications. Gel-purified ORES-pH
protein (0.1 ug of
protein/well) in O.OSM-sodium carbonate buffer, pH 9.6, was used to coat flat-
bottomed
microtitration plates; peroxydase labelled-goat anti-porcine IgG was used to
detect the captured
antibodies. The substrate solution consisted of 0.1% urea peroxide and 0.02%
3,3',5,5'-tetramethyl
benzidine in 10 mM citrate buffer, pH 5.0, mixed in equal volumes. The
absorbance values were
IS determined at 450 nm. WB was also performed as previously described
(Pirzadeh & Dea (1997)
Journal of General Virology 78:1867-1873) using either ORFS-pH protein or
sucrose gradient
purified-PRRSV as antigen.
Blastogenic transformation test:
At regular post-immunization intervals, pigs were medicated with Xylazine
(Bayers) at a dose of
20 lmg/Kg and blood samples were collected from the anterior vena cava in
vacuum tubes containing
1/10 volume 150 mM sodium citrate in PBS, and then diluted 1:3 in sterile
RPMI. Peripheral blood
mononuclear cells (PBMC) were separated by Ficoll-Paque (density 1.077;
Pharmacia)
centrifugation at 1,200 g for 20 min. The mononuclear cells were collected
from the buffy coat and
pelleted. The residual red blood cells were lysed by incubating cells with
0.53% ammonium
25 chloride for 10 min at 37°C. After Z washes in RPMI, the leukocytes
were adjusted to a suspension
of 2 X 106 cells per ml in RPMI containing 20% homologous heat inactivated
PRRSV negative
porcine serum, 50 U/ml of penicillin, and 50 ~eg/ml of streptomycin. The
antigen-specific
proliferation was determined by incubating PBMC in microtitration plates (4 X
105 cells in
200p1/weil in triplicates) during 72 h in the presence of variable
concentrations (0, 0.1, 10, and
30 25p.g/ml) of ORES-pH protein. Blastogenic capacity of the PBMC under test
conditions was
44
CA 02410694 2002-12-12
confirmed by including control triplicates containing 2. S, 5, or 10 pg/ml of
Concanavaline A (ConA,
Sigma Chemicals). After a 72 h stimulation period, the cells were labelled for
18 h with 0.1 ~eCi of
[jH]thymidine (Amersham) per well, harvested with a semiautomatic cell
harvester (Skatron
Instruments). The incorporated radiolabelled nucleotide was measured by
scintillation counting after
addition of a fluorescent liquid scintillator (Cytoscint, ICN). The level
ofproliferation was expressed
as the mean of counts per minute (CPM) of the test wells minus the mean of the
background CPM
in control wells. Control for background levels consisted of PBMC cultures in
media alone.
Virus isolation:
After collection of blood samples, pigs were euthanised by rapid intravenous
injection of sodium
pentobarbital (MTC Pharmaceuticals). Specimens were aseptically collected from
lungs, spleen,
liver, kidneys, and mediastinal and mesenteric lymph nodes. Tissue homogenates
were prepared in
DMEM to final concentrations of 1:20 and 1:100. Following clarification by
centrifugation at
10,000 g for 10 min, tissue homogenates were inoculated onto monolayers of
MARC-14S cells in
24 well-culture plates or PAMs seeded in 96 well-microtitration plates. Cells
were harvested by 2
1 S freeze-thaw cycles at 4-S days post-inoculation. Tissue culture
supernatants were clarified and used
for a second passage. Cultures were observed daily for CPE until day S post-
inoculation, at which
time infected monolayers were fixed with cold acetone for IIF.
RT PCR:.
Total RNA was extracted from tissues collected from challenged animals and
from MARC-14S cells
inoculated with tissue homogenates. RT-PCR was performed using oligonucleotide
primers
1006PS+1007PR and 1008PS+1009PR to amplify ORF6 and ORF7 genomic regions of
PRRSV
respectively, as previously described (Mardassi et al., (1995) Archives of
Virology 140:1405-1418).
Histopathological examination:
Thin sections (S pm thick) of formaline fixed, paraffin embedded tissues from
the lungs, spleen,
liver, kidneys, and thoracic and mesenteric lymph nodes of all pigs were
routinely processed for the
hematoxylin-phloxin-safran (HPS) staining, as described previously (Dea et
al., (1991) Journal of
Veterinary Diagnostic Investigation 3:275-282).
4S
CA 02410694 2002-12-12
Results
Transient expression of cloned ORFS gene:
Expression of the ORFS product was demonstrated in both COS7 and 293 cells
lines at 24 and 36
h post-transfection. The identification of GPS was confirmed by IIF using
monospecific anti-ORFS
rabbit antiserum or the porcine anti-PRRSV serum. As shown in Fig. 4, an
intense cytoplasmic
fluorescence could be observed in approximately 10 to 15% of the cells, and
the expressed GPS
tended to accumulate near the perinuclear region. Similar findings were
observed for the expressed
products of ORFs 3, 4, and 7 (Gonin et al., (1988) Archives of Virology (in
press); Gagnon et al.,
( 1997) 781" Annual Meeting of the CRWAD Chicago, Nov.B-12).
Antibody response of mice and pigs:
Sera collected at various times post-immunization (Table 2) were positive for
the presence of anti-
PRRSV antibodies by IIF. The protein specificity of mice and pigs sera to GPS
was established by
immunoblotting with purified whole virus and E. coli- expressed recombinant
ORFS-pH fusion
protein (Fig. 5) and by ELISA (Table 2). BALB/c mice inoculated with the GST-
ORFS or
pRc/CMVS developed neutralizing antibodies which could be first detected two
weeks after the
second booster injection. The VN titres of BALB/c mice sera were estimated
between 32 and 64 by
the 8th week post-immunization and persisted through the end of the 12 week-
observation period.
In contrast, the CD-1 mice did not develop neutralizing antibodies to PRRSV
despite a significant
anti-ORFS specific antibody response detected by ELISA and IIF. Seroconversion
was also
demonstrated by IIF and ELISA in both groups of vaccinated pigs (Table 2) 15
days after first
injection of either GST-ORFS or pRc/CMVS. Neutralizing antibodies were
detected in sera of the
DNA-immunized pigs only 2 to 3 weeks after the second booster injection (8 to
9 weeks after first
inoculation of plasmidic DNA), and 2 weeks after PRRSV challenge, with
estimated titres close to
128. None of the virus challenged animals in the unvaccinated or GST-ORES
immunized group
developed detectable neutralizing antibodies (VN titres <8) to PRRSV 2 weeks
after infection
(Table 2). Control animals tested negative to PRRSV and ORFS-pH protein in IIF
and ELISA
throughout the observation period.
Specific blastogenic response to ORES pH:
PBMCs obtained from both groups of immunized pigs underwent specific
blastogenic
46
CA 02410694 2002-12-12
transformation ex-vivo in a dose dependent way in the presence of ORFS-pH
protein, whereas [3H]-
thymidine incorporation of the PBMCs obtained from unvaccinated animals
remained at basal level
(Fig. 6A). Blastogenic transformation indexes of 7-12 and 10-12 were
calculated 2 weeks after the
second booster injection of GST-ORFS and pRc/CMVS, respectively.
Concentrations higher than
10 ~tg of the ORES-pH protein per ml of culture medium did not increase [3H]-
thymidine
incorporation levels of PBMCs from both groups of pigs. No significant
variations were observed
in blastogenic response to ConA of vaccinated pigs compared to unvaccinated
controls (Fig. 6B).
Table 2.
Antibody
Response
of DNA and
GST-ORFS
Immunized
Mice and
Pigs
Animal Immunogen SerologicalImmunization
a.nd Sample
Collection
Schedule
(days)
Group and Dose Tests 1 151 371 5123 652
G1:50~.g ELISA - 140149 5601196 640f196 6401196
pRc/CMVS IIF - 3516 S1t16 51116 51116
CD-1 VN - - - - -
mice' G2:50~g ELISA - 320198 8960131351024013135>12800
GST-ORFS IIF - 296 4516 102131 102131
_ _ _ -
Gl:SOgg ELISA - 2601120 5601196 5601196 960196
pRc/CMVS IIF - 2218 45116 10231 102131
BALB/c VN - - <8 51137 58f31
mice" G2:50pg ELISA - 6401196 256017844800f202425601784
GST-ORFS IIF - 102131 32098 6401196 4801160
VN - - <g 45116 102131
G1:100pg ELISA - 133147 5331189 6671189 6671189
pRc/CMVS IIF - 64f0 10730 5331189 6671189
Pigs VN - - <8 <g 107f30
G2:300pg ELISA - 40010 42671508 >12800 >12800
GST-ORFS IIF - 107130 13331377 6771189 6771189
VT( _ _ <g <g <g
47
CA 02410694 2002-12-12
~ Groups of 5 mice or 3 piglets were immunized by pRc/CMVS plasmid or GST-ORFS
expressed in E. Coli on the
mentioned days. Blood samples were collected from the retro-orbital vein of
mice or the anterior vena cava
of pigs prior to each immunization.
Z Sample collection only.
3 Pigs were challenged with 5 x lOs TCID50 by infra-tracheal inoculation.
' Control animals consisted of 5 BALB/c mice, 5 CD-1 mice and 3 F1 piglets.
Each control animal was injected with
corresponding quantities of parental pRc/CMV plasmid via identical route and
frequency. Control animals
remained seronegative throughout the observation period.
ELISA: Reciprocal of highest serum dilution reacting with the recombinant ORFS-
pH expressed in E. Coli.
IIF: Reciprocal of highest serum dilution at which specific cytoplasmic
fluorescence was observed in PRRSV-infected
MARC- 145 cells.
VN: Reciprocal of highest serum dilution which inhibited 100% of CPE and
expression of N viral protein in PRRSV
(IAF-Klop strain) infected MARC 145 cells stained by IPMA.
Antibody titres correspond to the average titres t standard deviation.
Clinical observations:
Unvaccinated pigs developed clinical signs of respiratory disease, beginning 2
to 3 days after virus
challenge and persisting through the end of the 2 week observation period. The
principal signs
included a marked drop in feed consumption, hyperthermia (40.2 to
41.7°C) that persisted for 10 to
14 days, eyelids oedema, laboured breathing (abdominal respiration) in two
pigs accompanied by
rasping and crowing sounds heard during inspiration. Apart from a transitory
mild fever {39.8-
40.4 °C) that lasted not more than 2 to 3 days, all vaccinated pigs
remained clinically healthy during
the 2 week-observation period following virus challenge. The average feed
consumption and growth
rate of vaccinated pigs remained identical to those of unvaccinated
unchallenged controls.
Yirus isolation:
As summarized in Table 3, after a single passage on MARC-145 cells, virus was
recovered from
tissue homogenates (dilutions 1/20 and 1/100) of several organs (lungs,
spleen, kidneys, liver,
lymph nodes) of unvaccinated animals two weeks a8er virus challenge. In
contrast, apart from
lungs and mediastinal lymph nodes, no virus was isolated from other organs of
DNA immunized
pigs after two successive passages. This is indicative of the generalized
viremia of unvaccinated
pigs compared to respiratory tract localization of virus in DNA immunized
animals. PRRSV was
48
CA 02410694 2002-12-12
also recovered from the spleen and kidneys of one of the 3 GST-ORFS immunized
pigs. Presence
of the viral genome in the lungs of all three groups of animals was
demonstrated by RT-PCR;
however, RT-PCR revealed the presence of the viral genome in the spleens of
only unvaccinated
challenged pigs and those pigs that had been immunized with GST-ORFS, not in
the spleens of
DNA immunized animals. Furthermore, PRRSV burden was lower in lungs and
mediastinal lymph
nodes of DNA vaccinated pigs since it could not be recovered after two
passages on MARC-145
cells from the 1/100 dilution of tissue homogenate. The presence of viral
antigen could only be
detected in the 1/20 dilution of lung and mediastinal lymph nodes homogenates,
with delayed
appearance of CPEs suggestive of low virus titres.
Necropsy findings:
Unvaccinated virus challenged pigs euthanised at day 14 post-inoculation had
gross lesions that were
confined to the respiratory tract and thoracic cavity. Portions of the lungs
were tan and partly
collapsed, with occasional anteroventral areas of congestion and
consolidation. The mediastinal
lymph nodes were enlarged and congested. Adherence of the pleura to the
thoracic cage was
observed in one pig, with slight accumulation of non-suppurative exudate
within the thoracic cavity
(hydrothorax) and pericardium (hydropericardium). No significant gross lesions
were observed in
the other organs. Pulmonary hepatisation and glandular aspect at lung section
was remarkable in one
of the GST-ORFS vaccinated animals. Apart from mild tumefaction of mediastinal
lymph nodes in
one of the DNA vaccinated pigs, no significant gross abnormalities were
observed in this group of
animals. Microscopic lesions observed in unvaccinated-virus challenged pigs
were confined to the
lungs and consisted of macrophage infiltration, pyknotic cell debris and
protein rich exudate in the
lumen of large bronchi and bronchioli, a peribronchiolar and perivascular
lymphomononuclear cells
infiltration, the presence of lymphomononuclear cells within the alveolar
lumen with hyperplasia
of type 2 pneumocytes, mononuclear cells invasion, and presence of pyknotic
cells in alveolar
septae (Fig. 7 b, c, and d). The GST-ORFS immunized pigs developed intense
interstitial
pneumonitis, characterized by hyperplasia of bronchiolar epithelium and
pneumocytes type II of the
alveolar endothelium, perivascular cuffing, lymphomononuclear cells
infiltration, and thickening of
alveolar septae (Fig. 8a and b). A remarkably milder interstitial pneumonitis
was observed in the
DNA vaccinated pigs. In those pigs, large airways (bronchi and bronchioli), as
well as alveolar ducts,
were normal in appearance with an absence of cells and cellular debris within
the lumen (Fig. 8c and
d).
49
CA 02410694 2002-12-12
Our results show that DNA immunization with a plasmid encoding the ORFS of
PRRSV protected
pigs from developing intensive PRRSV-induced lesions observed in unvaccinated
virus challenged
controls. Virus dissemination to organs other than the lungs and the accessory
lymph nodes was not
observed in DNA-vaccinated animals after a massive virus challenge, and these
animals had
remarkably lower virus burden in their respiratory system as compared to the
GST-ORFS vaccinated
animals or unvaccinated controls. These results show that an expression vector
encoding PRRSV
ORFS is an effective DNA vaccine against PRRSV infection.
Results have also been obtained using other ORFs. Balb/c mice immunized
genetically with
pAdCMVS/ORF3 and pAdCMVS/ORF4 had specific humoral immune responses triggered
as
demonstrated by indirect immunofluorescence and Western immunoblotting (Gonin
et al., (1997)
16'" Annual Meeting of the American Society for Virology (ASV), Montana State
University,
Bozeman, MT, July 19-23; Gagnon et al., (1997) 78'" Annual Meeting of the
CRWAD, Chicago, IL,
November 8-12). Accordingly, expression vectors encoding a PRRSV ORF provide
DNA vaccines
against PRRSV infection.
1 S The foregoing has outlined some of the more pertinent objects of the
present invention. These
objects should be construed as being merely illustrative of some of the more
prominent features and
applications of the invention. Many other beneficial results can be obtained
by applying the
disclosed invention in a different manner or modifying the invention within
the scope of the
invention. Accordingly other objects and a full understanding of the invention
may be had by
refernng to the summary of the invention, the detailed description describing
the preferred
embodiments in addition to the scope of the invention defined by the claims
taken in conjunction
with the accompanying drawings.
CA 02410694 2002-12-12
M M
G.
+ n +
V
GL
H
...
DD M ~ ~
C M M M
v .. .,
+ + +
. .
. . .~ ~. ..
0 0 0 0 0 0
v v v ~r v v
H
~1 H y
~
"V O
, , , , , r
z
,,~ ..~ .. ...
r-IC v v v ~ ~ v
M O M M M
i
n v v v v v v
c0
v
n , ~ + +
b
n n r~ n n
M M M M M M
N O O v O _
O
.-, >
v~ U "~
, , + . ,
0
~r o
_ .. ,. ..
o M M M M M M
v _ _ M - O M
O O
v v v w r
'D
+
C~ ~ ~ r , + + , + H
pp H r
y . ~ t0
Q ~ t6 d
y OD vi
pp OC v
~ O
~~ ,
N ...O M ' O M .
~. ~. ~. .~ .. ~.p
..
n~
ue + + o n
a
c + , + , .
., .
e
u
+ + o , _c
w. o
o ~ r,
d a~ c0 O '~ c
1
_ .
'
H
v v v ~ m M M r :~y .Ca"
G (d ~ ~ ~ p'~ a ~ b ~ v
o a b o
a
. ~ o
u + v + +
. ~.~ + ~ + + + o '
o
w .b C3.
v
~ v v
H
H H
V
~
. tip
t
'
'
'
0 0 v
~
o,
a a p '~' o
~
ro
rnv~ ,n .n ' ~ 0 0
~'
~ ~ ~ '~ ~ Q
~
O U ~ O U v ~ '~ a.
_ V ~
V
N C VI C . CL
' '.
~
a. O CL ~. C7 A. ,.~ + ao
,.
+ +
CA 02410694 2002-12-12
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i)APPLICANT: Institut National de la Recherche Scientifique
(ii) TITLE OF INVENTION: Porcine Reproductive and Respiratory
Syndrome Virus (PRRSV) DNA Vaccines
(iii) NUMBER OF SEQUENCES: 2
(iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: MBM & CO.
(B) STREET: P.O. BOX 809, STATION B
(C) CITY: OTTAWA
(D) PROVINCE: ONTARIO
(E) COUNTRY: CANADA
(F) POSTAL CODE: K1P 5P9
(v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk
(B) COMPUTER: IBM PC compatible
(C) OPERATING SYSTEM: Windows
(D) SOFTWARE: WordPerfect 9.0
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: n/a
(B) FILING DATE: 06-16-1998
(C) CLASSIFICATION:
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: SWAIN, Margaret
(B) REGISTRATION NUMBER: 10926
(C) REFERENCE/DOCKET NUMBER: 255-118DIV
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 613/567-0762
(B) TELEFAX: 613/563-7671
(2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 36 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Artificial Sequence
CA 02410694 2002-12-12
2
(ix) FEATURE:
(A) NAME/KEY:
(B) LOCATION:
(C) IDENTIFICATION METHOD:
(D) OTHER INFORMATION: ETS 5 forward primer
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: l:
AAGCTTGCCG CCGCCATGTT GGGGAAATGC TTGACC
(2) INFORMATION FOR SEQ ID N0:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Artificial Sequence
(ix) FEATURE:
(A) NAME/KEY:
(B) LOCATION:
(C) IDENTIFICATION METHOD:
(D) OTHER INFORMATION: ETR 5 reverse primer
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:2:
36
TCTAGAGGCA AAAGTCATCT AGGG 24
