Note: Descriptions are shown in the official language in which they were submitted.
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
PHOSPHORYLATED POLYPEPTIDES AND USES RELATED THERETO
CROSS-REFERENCE TO RELATED APPLICATIONS
This application is based, at least in part, on Provisional Application No.
601208,24060, filed May 31, 2000, and Provisional Application No.
60/255,29660,
filed December 13, 2000, the respective disclosures of which are incorporated
by
reference herein.
BACKGROUND OF THE INVENTION
This invention relates to improved methods for generating phosphorylatable
polypeptides, polypeptides generated using those methods, DNA sequences
encoding
those polypeptides, and their use in diagnosis and treatment of cancer and
other
diseases.
Labeled polypeptides are used in a variety of applications. For instance,
labeled monoclonal antibodies (MAbs) have been widely used in radio-
immunotherapy, diagnostic imaging and staging of tumors.
Labeled monoclonal antibodies (MAbs) have great applicability for the
diagnosis and treatment of cancer for several reasons. First, most tumor
populations
express tumor antigens in a heterogeneous pattern. Some of the cells in the
population
will not be expressing the target tumor antigen and therefore will not be
recognized by
the monoclonal antibody. With the use of MAbs to deliver drugs or toxins to
tumor
cells, the cells which lack the tumor antigen remain untouched. In contrast,
radio
labeled MAbs provide the advantage of destroying cells within a radius of a
few cell
diameters around the tumor cell to which the MAb binds. It has been shown that
an
isil-labeled MAb can deliver a therapeutic dose of radiation to antigen
negative cells.
Second, in the case of carcinomas, the tumor antigens are stable on the cell
surface
and are not internalized. For a drug or toxin to be effective, it is necessary
to have it
enter the cell. In contrast, radio labeled MAbs kill the tumor cells after
binding to the
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
surface and do not require entry into the cell. Therefore, this technique has
applicability to great variety of cancers. Furthermore, the use of interferons
and other
cytokines can be used to enhance the expression of tumor associated antigens
on cells
providing a better target for monoclonal antibodies and minimize or even
eliminate
tumor cells previously not expressing the tumor antigen.
In radio-immunotherapy, 1311 has been commonly used for cancer therapy.
However since iodine labeling is not site specific, it results in a
heterogeneous
population of labeled MAbs with various affinities for antigen and significant
inactivation of the Mab. Iodine-labeled polypeptides can also undergo
dehalogenation, which can eliminate 1311 from tumors before it starts to
function.
Another disadvantage of iodine labeling is that iodine can concentrate in the
thyroid,
salivary glands and stomach, which can pose health problems for patients and
health
care personnel.
Compared to 1311, 3aP has been considered to be a better option for radio-
immunotherapy. Being a pure (3-emitter, it has high energy (Emax 1700 lceV,
compared to 1311, 182 keV) which is strong enough for cancer therapy. However
the
utilization of this radioisotope was greatly limited due to the difficulties
in 3zP
labeling of MAbs. A 32P labeled peptide can also be chemically coupled to the
polypeptide via lysine residues. However, the peptide-Ab conjugation is not
site
specific, which, like iodine labeling, can also compromise the Ag binding
ability of
the MAb.
This 3aP labeling problem was not satisfactorily solved until the development
of a simple and rapid labeling procedure and the construction of a
phosphorylatable
fusion polypeptide by the introduction of a peptide lcinase recognition site
into the
polypeptide. See, for example, US Patent 5,986,061, the disclosure of which is
incorporated by reference herein in its entirety. This is a simple, efficient
way to label
polypeptides using radio-nucleotides, and is applicable to virtually any
polypeptide.
Many polypeptide kinase recognition sites can be introduced into polypeptides
and
serve as useful tags for a variety of purposes. The introduction of
polypeptide kinase
recognition sites into polypeptides can be achieved without modifying the
essential
structure or function of the polypeptides. Because polypeptides modified by
these
2
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
procedures retain their activity after phosphorylation, they can be used in
many
applications.
Phosphorylatable MAbs (MAb-chB72.3-P, MAb-chCC49K1, MAb-
chCC49CKI, MAb-chCC49CKII and MAb-chCC49Tyr) can be created by inserting
the predicted consensus sequences for phosphorylation by the cAMP-dependent
polypeptide l~inase and other polypeptide kinases, such as casein lcinase I,
casein
lcinase II and the Src tyrosine kinase, at the carboxyl terminus of the heavy
chain
constant region of MAb-chB72.3-P or MAb-chCC49. These MAbs are purified and
phosphorylated by the appropriate polypeptide kinase with [y 32P]ATP to high
specific activity. These [3aP]MAbs bind to cells expressing TAG-72 antigens
with
high specificity. In all these cases, the phosphate is stable ih vitro in
various sera so
that less than 8% of the phosphate is hydrolyzed in 24 hours.
However, it has been found that the attached 32P in the above phosphorylatable
antibodies is not sufficiently stable in buffer or serum to be useful for in
vivo
applications in animals and humans. Several methods have been suggested to
improve
the stabilities of the phosphorylatable MAbs. Since RRX(S/T) is a PKA
recognition
site, changing the amino acid residue X or the amino acid residues downstream
of this
site changes the stability of the phosphorylatable MAbs. It has also been
found that
using threonine, instead of serine, in the PKA recognition site increases the
stability
of the phosphorylatable Mabs, although this would compromise the efficiency of
the
phosphorylation dramatically. Alternatively, the stability of the
phosphorylatable
MAbs might also be changed if other phosphorylation enzymes are used. There is
no
assurance that these approaches would be satisfactory.
The choice of putative phosphorylation sites can at times be tricky since many
point mutations, insertions or deletions may dramatically change the
conformation of
the entire molecule or at least render the polypeptide less functional. In
addition, those
sites might be potentially unaccessible to the intended lcinases due to steric
hinderance. In the past, these problems were dealt with using such inefficient
and
time-consuming methods as trial-and-error.
Accordingly, what is needed is a reasonably accurate yet highly efficient
means to carry out this process, not only for labeling phosphorylatable
monoclonal
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
antibodies, but also as a general method for generating any phosphorylatable
polypeptides.
SUMMARY OF THE INVENTION
The instant invention provides improved methods, such as computer-aided
molecular modeling, to locate phosphorylation sites in polypeptide of interest
(i.e.
MAb such as MAb-chCC49). An advantage of these methods is that a myriad of
potential phosphorylation sites in the target polypeptide can be quickly
surveyed and
the optimum choices identified by predicting potential intramoleculax
stabilizing
interactions. Hydrogen bonding between the attached phosphate groups and their
neighboring groups provides a simple method to locate regions where
surrounding
residues protect the phosphate from hydrolysis. Therefore, stability of the
attached
phosphate groups can be reliably predicted within a short period of time, thus
representing a vast improvement over the time-consuming and rather inefficient
trial-
and-error approach.
In a broad sense, the invention contemplates computer-aided molecular
modeling to generate phosphorylatable polypeptides, e.g. to radio-label
polypeptides,
especially monoclonal antibodies (MAbs), and polynucleotide molecules encoding
the
radio-labellable polypeptides.
In one aspect, the invention provides improved methods to generate radio-
labeled polypeptides. In one embodiment, the instant invention provides
methods to
generate, inter alia, MAbs and Ag binding polypeptides which can be stably
phosphorylated to high radio-specific activity with retention of biological
activity
(affinity for their intended antigens); MAbs modified with various isotopes of
phosphorus~(e.g., 32P~ 33p)~ or with sulfur (e.g., 355, 38S); and MAbs
labelled with
phosphorus or analogs. In accordance with the invention, the MAbs and modified
polypeptides may have single or multiple radioactive labels.
The invention also provides a method to generate polypeptides other than
MAbs, which are modified by the addition of phosphorylation sites which allow
for
and are labeled to higher radio-specific activities than the corresponding
unmodified
4
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
polypeptide with a single phosphorylation site. By the "addition" of
phosphorylation
sites, there is also intended in accordance with the invention, to include
polypeptides
in which a phosphorylation site heretofore unavailable or inaccessible, has
been
modified to make the phosphorylation site available.
The invention further provides a method to generate polypeptides, especially
MAbs and Ag binding polypeptides, phosphorylated by appropriate lcinases on
amino
acid residues other than on the serine residue, like on threonine and/or
tyrosine
residues, and the DNA sequences which code for one or more putative
phosphorylation sites, which sequences code for these polypeptides.
The invention additionally provides a method to generate polypeptides, such
as interferons, cytokines, growth factors, receptor binding proteins and
peptides with
phosphorylation sites to bind to receptors or other cellular targets.
In accordance with the invention, it is sufficient that a portion of the
phosphorylation recognition sequence, as opposed to the entire sequence, be
added
when the natural polypeptide sequence contains the remaining (or other
complementary) amino acids of said recognition sequence (e.g., Arg-Arg-Ala-
Ser,
(SEQUENCE ID NO. 1)). In such embodiment of the invention, from 1 through 4
amino acids of the sequence (in the case of Arg-Arg-Ala-Ser-Val, (SEQUENCE ID
NO. 2)) can be supplied to the polypeptide, thereby constituting the Ser-
containing
recognition sequence. This illustrates the versatility of the invention for
positioning
the nucleotide sequence which encodes the amino acid recognition sequence
containing a putative phosphorylation site.
Further, the availability of the 3-dimentional structure of a template
molecule
for computer-aided modeling 'can precisely predict the consequences of
altering
natural amino acid sequences in generating putative phosphorylation sites in
the test
polypeptide, the consequences of introducing phosphate groups, and the
possibility of
forming stabilizing intramolecular interactions loacted by identifying regions
where
the phosphate is protected by neighboring residues (i.e. hydrogen-bonding
serves as a
surrogate marker for the facile location of such regions). This will
significantly speed
up the trial-and-error engineering process, thus achieving more accurate and
predictable results.
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
The phosphorylated MAbs generated using the methods provided by the
instant invention are unexpectedly stable. In one preferred embodiment of the
invention, monoclonal antibodies are generated to posess optimized
phosphorylation
sites, so that phosphate groups attached to those sites are unusually
resistant to
hydrolysis, either in vitro or in vivo. In a preferred embodiment, at least
80%, more
preferably 95%, and most preferably 99% of the phosphate groups remain
attached
after at least 5 days, more preferably 10 days, and most preferably 18 days in
sera or
buffer. In a most preferred embodiment, 95% of the phosphate groups remain
attached
after 18 days in bufffer.
In addition, it was unexpectedly found that those stable monoclonal antibodies
had much more improved plasma clearance and biodistribution properties when
compared with other phosphorylated MAbs generated by conventional methods. In
a
preferred embodiment, only 70% (as compared to 90% of control phosphorylated
Mabs) of phosphorylated Mabs were cleared from blood in a plasma clearance
assay.
In another preferred embodiment, phosphorylated Mabs were accumulated in
significantly higher amounts in tumor than those in all of the other organs.
The kinase recognition sequence may be positioned at either termini or other
positions of the DNA coding sequence, irrespective of the specific
phosphorylated
amino acid.
The invention also provides labellable and labeled polypeptides, such as
hormones and modified streptavidin. The modified streptavidin can be bound to
individual biotinylated antibodies, each streptavidin being modified by single
or
multiple phosphorylated groups, which results in greatly enhanced radiation
and
therefore diagnostic and therapeutic potential.
The invention also provides phosphorylatable polypeptides which contain at
least one phosphorylation recognition site for protein lcinase(s), and which,
upon
phosphorylation at the said site by kinase(s), contain a particularly stable
phosphate
group by virtue of its ability to form intramolecular stabilizing interactions
with
neighboring groups (i.e. amino acids side chains). The intramolecular
stabilizing
interaction can be charge, hydrophobic and/or other covalent interactions that
prevent
hydroxy groups from attacking or reaching the phosphate residues. Evaluation
of
6
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
regions of hydrogen bonding serves as a way to locate such regions where
phosphates
are protected from hydrolysis.
The invention also provides phosphorylated polypeptides which contains at
least one phosphate group attached to engineered phosphorylation recognition
sites)
for protein lcinase(s), and which phosphate group is particularly stable by
virtue of its
ability to form intramolecular stabilizing interactions with neighboring
groups (i.e.
amino acids side chains). The intramolecular stabilizing interaction can be
charge,
hydrophobic, and/or other non-covalent interactions that prevent hydroxy
groups from
attacking or reaching the phosphate residues. Evaluation of regions of
hydrogen
bonding serves as a way to locate such regions where phosphates are protected
from
hydrolysis.
The invention also encompasses recombinant DNA sequences which encode
functional polypeptides having one or more putative phosphorylation sites;
expression
vectors for expressing the functional polypeptide; transformed host cells;
methods of
expressing the modified polypeptides; and the modified polypeptides.
The invention also provides such MAbs and polypeptides made by
recombinant DNA techniques, including MAbs radio-labeled with phosphorus or
with
sulfur, and recombinant DNA-produced radio-labeled polypeptides and
polypeptides.
The invention further provides DNA sequences encoding a functional MAb
which possesses one or more labelling sites and is sufficiently duplicative of
the
unmodified MAb to possess substantially similar affinity for its intended Ag.
Further,
there is provided a recombinant-DNA containing a coding sequence for a
putative
recognition site for a kinase; the recombinant expression vector; the host
organisms
transformed with the expression vector that includes the DNA sequence; and an
expressed modified polypeptide. A method involving site-specific mutagenesis
for
constructing the appropriate expression vector, a host transformed with the
vector and
expressing the modified polypeptides, in particular the modified human
interferons, is
also provided.
The invention provides in one of its several embodiments DNA sequences
which encode one or more putative phosphorylation sites, which sequences
encode
functional MAbs each of which possesses at least one putative phosphorylation
site
7
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
and each of which possesses at least substantially similar affinity for its
intended Ag;
expression vectors for expression of the functional modified MAb under the
control of
a suitable promoter such as the lambda PL promoter or others described
hereinafter;
and the biologically active phosphorylated MAb.
The invention also provides a lcit comprising at least one phosphorylatable
polypeptide with at least one engineered phosphorylation site, or
polynucleotide
sequence encoding the said phosphorylatable polypeptide; at least one protein
lcinase,
or polynucleotide sequence encoding the protein kinase, capable of
phosphorylating
the polypeptide at the engineered phosphorylation site; and at least one kind
of
nucleic acid or its derivative that is capable of being used as a substrate by
the protein
kinase to label the phosphorylatable polypeptide.
Thus, in accordance with the invention, a nucleotide sequence is constructed
that codes for the necessary number and specific amino acids required for
creating the
putative phosphorylation site.
The invention also provides phosphorylatable or phosphorylated polypeptides,
either as separate products or as one of the components of certain kits.
The invention also provides a method to analyse biochemical properties of
molecules by using molecular modeling tools.
An "internal sequence" of a polypeptide, as used herein, generally denotes
that
there is at least one amino acid N-terminal corresponding to the first amino
acid of
said internal polypeptide sequence, and that there is at least one amino acid
C-
terminal corresponding to the last amino acid of said internal polypeptide
sequence.
By "biological activity" is generally meant the intrinsic biochemical and/or
biological activities of any given polypeptide, including, but not limited to,
such
properties as the catalytic activity of enzymes, the ability to bind certain
molecules
(i.e. other polypeptides, polynucleic acids, metal ions, steroid hormones,
lipids,
polysaccharides, etc), and ability to activate or inhibit the function of
other molecules.
By "engineered" is generally meant that a moleucle is purposefully changed
according to certain predetermined criteria, usually by way of site-directed
mutagenesis of the polynucleotide sequence encoding the taxget amino acid
sequence,
using conventional molecular biology techniques such as PCR and/or subcloning.
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
The foregoing is not intended to have identified all of the aspects or
embodiments of the invention nor in any way to limit the invention. The
accompanying drawings and examples, which are incorporated and constitute part
of
the specification, illustrate various embodiments of the invention, and
together with
the specification and claims, serve to explain the principles of the
invention.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 depicts a model of the MAb-chCC49 antibody. The light chains are
shown in yellow, and the heavy chains in green. The violet regions represent
the sites
where the polypeptide kinase recognition site can be introduced. Altogether,
nine sites
on the heavy chains and three potential sites on the light chains are shown.
FIG. 2 depcits a comparison of the modeled MAb-chCC49 and MAb231
antidobies. The light chains of MAb-chCC49 are shown in yellow, the heavy
chains
in green. MAb231 is shown in white.
FIG. 3 despicts the nucleotide and amino acid sequences of the synthetic
fragment K2. The two phosphorylation sites recognized by the cAMP-dependent
protein kinase is underlined. The cloning site, XxnaI, is shown in italics.
FIG. 4 illustrates a model of the MAb-chCC49 antibody. This figure shows the
complete 3D model of MAb-chCC49. The light chains are shown in yellow, while
the
heavy chain on the left is in cyan, and the one on the right in royal-blue.
The red
orange regions shown in space-filling models represent the sites where protein
lcinase
recognition sites were considered: nine sites on the heavy chains and three on
the light
chains.
FIG. 5 depicts a comparison of the structures of the MAb-chCC49 and
MAb231 antibodies. MAb-chCC49 is shown in magenta, and MAb231 is shown in
green.
FIG. 6 illustrates models of mutant MAbs. The light chains of the MAbs are
shown in yellow, while the heavy chain on the left is in cyan, and the one on
the right
in royal-blue. The red-orange regions shown in the space-filling models
represent the
region where the protein kinase recognition sites are introduced. A: the model
of
9
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
MAb-chCC49K1; B: the model of MAb-CC49CKI; C: the model of MAb-CC49CKII;
D: the model of MAb-CC49Tyr.
FIG. 7 also illustrates models of mutant MAbs. The light chains of the MAbs
are shown in yellow, while the heavy chain on the left is in cyan, and the one
on the
right in royal-blue. The red-orange regions shown in the space-filling models
represent the regions where the protein kinase recognition sites were
introduced. A:
the model of MAb-chCC49-6P; B: the model of MAb-WWl; C: the model of MAb-
WW2; D: the model of MAb-WW3; E: the model of MAb-WW4; F: the model of
MAb-WWS; G: the model of MAb-WW6; H: the model of MAb-WW7; I: the model
of MAb-WWB.
FIG. 8 illustrates models of mutant [32P]MAbs. The light chains of the MAbs
are shown in yellow, while the heavy chains are in royal-blue. The white
regions
shown in the space-filling models represent the regions where the protein
kinase
recognition sites are introduced. The green regions that represent the
phosphates
attached to the serine or tyrosine residues axe barely visible. The oxygens
attached to
the phosphates are in red. A: the model of [32P]MAb-chCC49K1; B: the model of
[3aP]MAb-CC49CKI; C: the model of [32P]MAb-CC49CKII; D : the model of
[3ZP]MAb-Tyr.
FIG. 9 depicts models of mutant [32P]MAbs. The light chains of the MAbs are
shown in yellow, while the heavy chains are in royal-blue. The white regions
shown
in the space-filling models represent the regions where the protein kinase
recognition
sites were introduced. The green regions that represent the phosphates
attached to the
serine or threonine residues are barely visible. The oxygens attached to the
phosphates
are in red. A: the model of [32P]MAb-chCC49-6P; B: the model of [32P]MAb-WW1;
C: the model of [3aP]MAb-WW2; D : the model of [32P]MAb-WW3; E: the model of
[3aP]MAb-WW4; F: the model of [32P]MAb-WWS; G: the model of [32P]MAb-WW6;
H: the model of [3aP]MAb-WW7; I: the model of [32P]MAb-WWB.
FIG. 10 is a comparison of the structures of MAb-chCC49 and MAb-WWS.
MAb-WWS is shown in cyan, while MAb-chCC49 is in magenta. The magenta is not
visible because the two structures are virtually identical. The inset (lower
left) shows
a magnification of the hinge region with side chains between the CHl and CH2
domains where the protein kinase recognition site was introduced (boxed area).
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
FIG. 11 shows the hydrogen bond of the serine phosphate group with the
adjacent amino acid in MAb-chCC49K1. The serine carbons are: C, carbonyl
carbon;
CA, alpha carbon; CB, beta carbon to which the phosphate (P) is attached
through the
serine oxygen (0G). Other symbols are: OXT, first oxygen of the phosphate in
hydrogen bond on the right; OlP, second oxygen on phosphate; 02P, third oxygen
on
phosphate; H, hydrogen in a hydrogen bond from amino acid nitrogen (N) to
phosphate oxygen OXT. All four serine residues shown in this figure are
modified
with phosphate groups. Only one of the phosphates forms a hydrogen bond.
FIG. 12 depicts the hydrogen bond of the phosphate group with the adjacent
amino acid. A. Hydrogen bond of the Thr-phosphate group with the adjacent
amino
acid in MAb-WW2. B. Hydrogen bond of the Ser-phosphate group with the adjacent
amino acid in MAb-WW3. The Ser/Thr carbons are: C, carboxyl carbon; CA, alpha
carbon; CB, beta carbon to which the phosphate (P) is attached through the
serine
oxygen (0G). Other symbols are: OXT, one oxygen of the phosphate; O1P, second
oxygen of phosphate; 02P, third oxygen on phosphate. The figure is a ball and
stick
model as described herein.
FIG. 13 shows the stabilization of the phosphate moiety on serine 224 in
MAb-WWS. A. The side chain of Ser224 stabilized the phosphate moiety through
hydrogen bonding either between the phosphate and main chain nitrogen on
cysteine
225 (on the left), or between the phosphate and main chain nitrogen on serine
224 (on
the right). B. The side chain of Ser224 stabilized the phosphate moiety
through
hydrogen bonding between the phosphate and main chain nitrogen. The serine
carbons are: C, main chain carbonyl carbon; CA, alpha carbon; CB, beta carbon
to
which the phosphate (P) is attached through the serine oxygen (0G). Other
symbols
are: OXT, first oxygen of the phosphate; O1P, second oxygen of phosphate that
forms
a hydrogen bond; 02P, third oxygen on phosphate; H, hydrogen in hydrogen bonds
from amino acid nitrogens (N) to phosphate oxygens.
FIG 14 shows the stabilization of the phosphate moiety on serine 224 in MAb
WW6. A. The side chain of Ser224 stabilized the phosphate moiety through
hydrogen
bonding between the phosphate and main chain nitrogen on cysteine 225. B. The
side
chain of Ser224 stabilized the phosphate moiety through hydrogen bonding
between
the phosphate and main chain nitrogen on cysteine 225 on the left, and
hydrogen
11
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
bonding between the phosphate and main chain nitrogen on cysteine 225 on the
right.
Serine 224 are shown in magenta, and cysteine 225 in green. The serine carbons
are:
C, main chain carbonyl carbon; CA, alpha carbon; CB, beta carbon to which the
phosphate (P) is attached through the serine oxygen (0G). Other symbols are:
OXT,
first oxygen of the phosphate; O1P, second oxygen of phosphate; 02P, third
oxygen
on phosphate; H, hydrogen in hydrogen bonds from amino acid nitrogens (N) to
phosphate oxygens.
FIG. 15 depicts the stabilization of the phosphate moiety on serine 224 in
MAb-WW7. A. The side chain of Ser224 stabilized the phosphate moiety through
hydrogen bonding between the phosphate and main chain nitrogen on cysteine
225. B.
The side chain of Ser224 stabilized the phosphate moiety through hydrogen
bonding
between the phosphate and main chain nitrogen on cysteine 225 on the left, and
hydrogen bonding between the phosphate and main chain nitrogen on cysteine 225
on
the right. Serine 224 are shown in magenta, and cysteine 225 in green. The
serine
carbons are: C, main chain carbonyl carbon; CA, alpha caxbon; CB, beta carbon
to
which the phosphate (P) is attached through the serine oxygen (0G). Other
symbols
are: OXT, first oxygen of the phosphate; OlP, second oxygen of phosphate; 02P,
third oxygen on phosphate; H, hydrogen in hydrogen bonds from amino acid
nitrogens (N) to phosphate oxygens.
FIG. 16 depicts the stabilization of phosphate moiety on serine 224 in MAb-
WWB. A. The side chain of Ser224 stabilized the phosphate moiety through
hydrogen
bonding either between the phosphate and main chain nitrogen on cysteine 225
(on
the left), or between the phosphate and main chain nitrogen on both histidine
223 and
arginine 221 (on the right). B. The side chain of Ser224 stabilized the
phosphate
moiety through hydrogen bonding either between the phosphate and main chain
nitrogen on serine 224 (on the left), or between the phosphate and main chain
nitrogen
on both histidine 223 and axginine 221 (on the right). The serine carbons are:
C, main
chain carbonyl caxbon; CA, alpha carbon; CB, beta carbon to which the
phosphate (P)
is attached through the serine oxygen (0G). Other symbols are: OXT, first
oxygen of
the phosphate; O1P, second oxygen of phosphate; 02P, third oxygen on
phosphate;
H; hydrogen in hydrogen bonds from amino acid nitrogens (N) to phosphate
oxygens.
12
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
FIG. 17 depicts the expression vector, pdHL7-CC49-6P, constructed for the
expression of MAb-CC49-6P.
FIG. 18 illustrates the construction of pWW 1. Because the construction is
extensive, the figure provides the details in sequential parts (FIGS. 18A and
18B).
FIG. 19 shows the construction of pWW2. Because the construction is
extensive, the figure provides the details in sequential parts (FIGS. 19A and
19B).
FIG. 20 shows the construction of pWW3. Because the construction is
extensive, the figure provides the details in three sequential parts (FIGS.
20A, 20B
and 20C).
FIG. 21 shows the construction of pWW4. Because the construction is
extensive, the figure provides the details in sequential parts (FIG. 21A and
FIG. 21B).
FIG. 22 shows the construction of pWWS. Because the construction is
extensive, the figure provides the details in sequential parts (FIGS. 22A and
22B).
FIG. 23 shows the construction of pLgpCXIIHuWWS. Because the
construction is extensive, the figure provides the details in sequential parts
(FIGS.
23A and 23B).
FIG. 24 shows the construction of pLNCXIIHuCC49HuI~VS. The construct
pLNCXIIHuCC49HuKV5 expresses the light chain of the MAb-WW7.
FIG. 25 shows the construction of pLgpCXIIHuWW5V80CH2. The final
construct pLgpCXIIHuWW5V80CH2 expresses the heavy chain of the MAb-WW7
with the CH2-domain deleted and amino acid substitutions K221R, T222R and
T224S
in the humanized MAb-CC49.
FIG. 26 shows the construction of pWWB. Because the construction is
extensive, the figure provides the details in sequential parts (FIGS. 26A,
26B, 26C
and 26D).
FIG. 27 illustrates an SDS-polyacrylamide gel electrophoresis of the modified
MAbs. A: MAb-chCC49-6P represents the gel of unlabeled MAb-chCC49-6P.
[32P]MAb-CC49-6P represents the autoradiograph of the phosphorylated MAb-
chCC49-6P. STDS represents the molecular weight markers (SDS-PAGE standards,
broad range, Bio-Rad, Cat. No. 161-0317). The lcDa of the markers is shown to
the
left of panels A and G. Arrows point to the places where the phosphorylated
mutant
MAbs migrated as seen on the autoradiograph (right lane of each panel).
Similar
13
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
labels are used to represent the SDS-polyacrylamide gel electrophoresis of the
other
mutant MAbs in B-H.
FIG. 28 depicts the stability of (32P]MAb-chCC49-6P in various sera over a
24-hour period. The percentage of ==P remaining on the [3aP]MAb-chCC49-6P in
sera
and buffer over a 24-hour period at 37°C is shown.
FIG. 29 depicts the stability of [3~P]MAb-WWS in various sera over a 24-hour
period . The percentage of 32P remaining on the [32P]MAb-WWS in sera and
buffer
over a 24-hour period at 37°C is shown.
FIG. 30 depicts the stability of [32P]MAb-WWS in various sera over a 5-day
period . The percentage of 3~'P xemaining on the [32P]MAb-WWS in sera and
buffer
over a 5-day period at 37°C is shown.
FIG. 31 depicts the stability of [32P]MAb-WWS in buffer over a 21-day period
The percentage of 3~P remaining on the [32P]MAb-WWS in buffer over a 21-day
period at 37°C is shown.
FIG. 32 depicts the stability of [32P]MAb-WW6 in various sera over a 24-hour
period . The percentage of 32P remaining on the [32P]MAb-WW6 in sera and
buffer
over a 24-hour period at 37°C is shown.
FIG. 33 depicts the stability of [3aP]MAb-WW6 in various sera over a 5-day
period . The percentage of 32P remaining on the [32P]MAb-WW6 in sera and
buffer
over a 5-day period at 37°C is shown.
FIG. 34 depicts the stability of [32P]MAb-WW6 in buffer over a 21-day period
. The percentage of 32P remaining on the [3aP]MAb-WW6 in buffer over a 21-day
period at 37°C is shown.
FIG. 35 depcuts the stability of [32P]MAb-WW7 in various sera over a 24-
hour period . The percentage of 3aP remaining on the [3~'P]MAb-WW7 in sera and
buffer over a 24-hour period at 37°C is shown.
FIG. 36 depicts the stability of [32P]MAb-WW7 in various sera over a 5-day
period . The percentage of 32P remaining on the [32P]MAb-WW7 in sera and
buffer
over a 5-day period at 37°C is shown.
14
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
FIG. 37 depicts the stability of [32P]MAb-WW7 in buffer over a 21-day period
. The percentage of 32P remaining on the [32P]MAb-WW7 in buffer.over a 21-day
period at 37°C is shown.
FIG. 38 is a comparison of primary sequences of MAb-chCC49, MAb231 and
MAb6l.1.3 in the hinge region. A: Primary sequences of MAb-chCC49, MAb231 and
MAb61.1.3 in the hinge region are aligned. B: Bestfit of primary sequence of
MAb-
chCC49 to that of MAb231 in the hinge region. C: Bestfit of primary sequence
MAb-
chCC49 to that of MAb61. l .3 in the hinge region.
FIG. 39 is a comparison of stabilities of [3aP]MAb-WWS, [32P]MAb-WW6,
[32P]MAb-WW7 and [32P]MAb-chCC49K1 in mouse serum. The percentage of 32P
remaining on [3aP]MAb-WWS, -WW6, -WW7 and [==P]MAb-chCC49Kl in mouse
serum over a 24-hour period at 37~C is shown. In the figure, blue symbols
represent
[saP]MAb-WWS; green symbols represent [32P]MAb-WW6; pinlc symbols represent
[saP]MAb-WW7; black line represents [32P]MAb-chCC49K1.
FIG. 40 is a comparison of plasma clearance of [3aP]MAb-WW5 and
[3ap]MAb-chCC49K1 in mice. The plasma clearance was performed by collecting 10
~,l of blood (by tail bleed) at various timepoints. The values are normalized
to the
bleed taken at about 2-5 minutes after the injection.
FIG. 41 depicts the crystal structure of the catalytic subunit of the cAMP-
dependent protein kinase from Bos Taurus with its inhibitor. The catalytic
subunit of
the PKA is shown in cyan, while its inhibitor is in magenta. Thr197 and Ser338
are
shown in white. The green regions that represent the phosphates attached to
the serine
or threonine residues are also shown. The oxygens attached to the phosphates
axe in
red.
FIG. 42 depicts the stabilization of phosphate moiety on threonine 197 in the
catalytic subunit of the CAMP-dependent protein lcinase from Bos Taurus. The
threonine carbons are: C, main chain carbonyl carbon; CA, alpha carbon; CB,
beta
carbon to which the phosphate (P) is attached through the serine oxygen (0G).
Other
symbols are: O 1P, first oxygen of phosphate; 02P, second oxygen on phosphate;
03P, third oxygen of the phosphate; NZ3, nitrogen on the side chain pf Lys189.
HZ3,
hydrogen in hydrogen bonds from side chain nitrogen (NZ3) of Lys189 to O1P of
Thr197. NH1, first nitrogen on the side chain of Argl65. HH12, hydrogen in
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
hydrogen bonds from side chain nitrogen (NH1) of Arg165 to 02P of Thr197. NH2,
second nitrogen on the side chain of Arg165. HH22, hydrogen in hydrogen bonds
from side chain nitrogen (NH2) of Arg165 to both O1P and O2P of Thr197.
FIG. 43 depicts the stabilization of phosphate moiety on serine 338 in the
catalytic subunit of the cAMP-dependent protein kinase from Bos Taurus. The
side
chain of Ser338 stabilized the phosphate moiety through hydrogen bondings
between
O1P and side chain nitrogens on both Asn189 and Lys342, and also between 03P
and
main chain nitrogen on I1e339. In addition the side chain OG of Ser338 could
also
form hydrogen bonds with both main chain nitrogen and the first side chain
nitrogen
on Asn340, and with third side chain nitrogen on Lys342. Other labels are the
same as
those in the legend to Figure 42.
DETAILED DESCRIPTION OF THE INVENTION
Polypeptides which are normally not phosphorylatable can be modified to
render them phosphorylatable (see U.S. patent 5,986,061, the dislcosure of
which is
incorporated herein in its entirety). The methodology to achieve this result
(especially
without loss of the biological activity of the polypeptide of interest) has
provided the
potential to modify other polypeptides, such as monoclonal antibodies, and
render
them phosphorylatable. However, selection of ideal putative phosphorylation
sites can
be tricky, largely due to uncertainties such as unpredictability of the
effects of
mutagenesis on overall polypeptide structure. Therefore, the improvement
described
in the instant invention not only helps to alleviate this problem but also has
the
unexpected advantage of predicting intramolecular interactions between the
added
phosphate group and its neighbouring groups so that the overall stability of
the
phosphate group can be predicted. The stability of the attached phosphate
group is a
critically important parameter for many utilities of the phosphorylatable
polypeptide.
One aspect of the present invention concerns three-dimensional molecular
models of template polypeptides, and their use for computer-aided modeling of
polypeptides of interest. An integral step to this approach to designing
phosphorylation sites involves the construction of computer graphics models of
the
polypeptides of interest and their mutants, which can be used to determine the
16
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
consequences of introducing those mutations on the overall conformation (and
thus,
biological activities) of those polypeptides; the effects of phosphate groups
on
neighbouring groups; and the stability of the attached phosphate groups based
on their
potential to form intramolecular interactions with neighbouring groups. For
instance,
for a putative phosphorylation site to be effective, it will generally be
desirable that it
is exposed on the surface of the polypeptide rather than buried deep witlun
other
structures so that there is no steric hindrance and polypeptide lcinases can
easily have
access to the phosphorylation site. Additionally, other factors, including
electrostatic
interactions, hydrogen bonding, hydrophobic interactions, and desolvation
effects, all
influence the stability of the attached phosphate group, which is a critical
parameter
for many utilities of the instant invention. Therefore, all of these factors
should be
taken into account in attempts to design the ideal putative phosphorylation
sites.
As described in the following examples, a computer-generated molecular
model of the subject polypeptide can be created. In preferred embodiments, at
least
the C"-carbon positions of the MAbs are mapped to a particular coordinate
pattern,
such as the coordinates for MAb231 shown in FIG. 2, by homology modeling.
Typically, such a protocol involves primarily the prediction of side-chain
conformations in the modeled polypeptide, while assuming a main-chain trace
taken
from a tertiary structure such as provided in FIGS. l and 2. Computer programs
for
~,0 performing energy minimization routines axe commonly used to generate
molecular
models. For example, both the CHARMM (Brooks et al. (1983) JComput Chem
4:187-217) and AMBER (Weiner et al (1981) J. Comput. Chem. 106: 765)
algoritluns
handle all of the molecular system setup, force field calculation, and
analysis (see
also, Eisenfield et al. (1991) Am JPhysiol 261:C376-386; Lybrand (1991) JPha~m
Belg 46:49-54; Froimowitz (1990) Biotechhiques 8:640-644; Burbam et al. (1990)
Polypeptides 7:99-111; Pedersen (1985) Etwiron Flealth Pe~spect 61:185-190;
and
Mini et al. (1991) JBiomol St~uct Dyh 9:475-488). The disclosure of these
references
are incorporated herein in their entireties.
At the heart of these programs is a set of subroutines that, given the
position of
every atom in the model, calculate the total potential energy of the system
and the
force on each atom. These programs may utilize a starting set of atomic
coordinates,
17
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
such as the model coordinates provided in FIGS. 1 or 2, the parameters for the
various
terms of the potential energy function, and a description of the molecular
topology
(the covalent structure). Common features of such molecular modeling methods
include: provisions for handling hydrogen bonds and other constraint forces;
the use
of periodic boundary conditions; and provisions for occasionally adjusting
positions,
velocities, or other parameters in order to maintain or change temperature,
pressure,
volume, forces of constraint, or other externally controlled conditions.
Most conventional energy minimization methods use the input data described
above and the fact that the potential energy function is an explicit,
differentiable
function of Cartesian coordinates, to calculate the potential energy and its
gradient
(which gives the force on each atom) for any set of atomic positions. This
information
can be used to generate a new set of coordinates in an effort to reduce the
total
potential energy and, by repeating this process over and over, to optimize the
molecular structure under a given set of external conditions. These energy
minimization methods are routinely applied to molecules similar to the subject
polypeptides as well as nucleic acids, polymers and zeolites.
In general, energy minimization methods can be carried out for a given
temperature, Ti, which may be different than the docking simulation
temperature, To.
Upon energy minimization of the molecule at Ti, coordinates and velocities of
all the
atoms in the system are computed. Additionally, the normal modes of the system
axe
calculated. It will be appreciated by those skilled in the art that each
normal mode is a
collective, periodic motion, with all parts of the system moving in phase with
each
other, and that the motion of the molecule is the superposition of all normal
modes.
For a given temperature, the mean square amplitude of motion in a particular
mode is
inversely proportional to the effective force constant for that mode, so that
the motion
of the molecule will often be dominated by the low frequency vibrations.
After the molecular model has been energy minimized at T;, the system is
"heated" or "cooled" to the simulation temperature, To, by carrying out an
equilibration run where the velocities of the atoms axe scaled in a step-wise
manner
until the desired temperature To is reached. The system is further
equilibrated for a
specified period of time until certain properties of the system, such as
average kinetic
18
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
energy, remain constant. The coordinates and velocities of each atom are then
obtained from the equilibrated system.
Further energy minimization routines can also be carried out. For example, a
second class of methods involves calculating approximate solutions to the
constrained
EOM for the polypeptide. These methods use an iterative approach to solve for
the
Lagrange multipliers and, typically, only need a few iterations if the
corrections
required are small. The most popular method of this type, SHAKE (Ryclcaert et
al.
(1977) JComput Phys 23:327; and Van Gunsteren et al. (1977) Mol Phys 34:1311)
is
easy to implement and scales as O(N) as the number of constraints increases.
Therefore, the method is applicable to macromolecules such as the polypeptides
of the
present invention. An alternative method, RATTLE (Anderson (1983) J Comput
Phys
52:24) is based on the velocity version of the Verlet algorithm. Lilce SHAKE,
RATTLE is an iterative algorithm and can be used to energy minimize the model
of
the subject polypeptide. These references are incorporated herein in their
entireties.
From the above observation, the same-principles are applicable to construct
:.,
any amino acid sequences other than the particular amino acid recognition
sequence
illustrated above.
In the situations where the phosphorylation site is other than serine (as
illustrated above), the DNA sequence codes for paa.-t or all of the
appropriate amino
acid sequence containing the putative recognition site containing threonine,
tyrosine,
etc. Thus, where in any particular polypeptide one or more amino acids (at any
position of the amino acid sequence) are the same as that of an amino acid
recognition
sequence for a kinase, it is sufficient to add (or modify) those complementary
amino
acids of the amino acid recognition sequence to complete that sequence. This
is
accomplished by constructing a DNA sequence which codes for the desired amino
acid sequence. There may indeed be situations where such addition (or
modification)
is a more desirable procedure as where it is important to retain the integrity
of the
polypeptide molecule to be modified (for instance, to minimize rislcs of
affecting a
particular activity, e.g., biological), or for simplicity of the genetic
manipulations, or
because either or both termini or other positions are more accessible.
In accordance with the invention, phosphorylation of the phosphorylatable site
19
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
of the polypeptide can be performed by any suitable phosphorylation means.
Phosphorylation and dephosphorylation of polypeptides catalyzed by polypeptide
lcinases and polypeptide phosphatases is known to affect a vast array of
polypeptides.
A large number of polypeptide lcinases have been described and are available
to one
skilled in the art for use in the invention. Such polypeptide lcinases may be
divided
into two major groups: those that catalyze the phosphorylation of serine
and/or
threonine residues in polypeptides and peptides and those that catalyze the
phosphorylation of tyrosine residues. These two major categories can be
subdivided
into additional groups. For example, the serine/threonine polypeptide kinases
can be
subdivided into cyclic AMP (cAMP)-dependent polypeptide kinases, cyclic GMP
(cGMP)-dependent kinases, and cyclic nucleotide-independent polypeptide
kinases.
The recognition sites for many of the polypeptide kinases have been deduced.
W short synthetic peptides cAMP-dependent polypeptide lcinase recognize the
sequence Arg-Arg-Xxx-Ser-Xxx, where Xxx represents an amino acid. As noted
above, the CAMP-dependent polypeptide kinase recognizes the amino acid
sequence
Arg-Arg-Xxx-Ser-xxx, but also can recognize some other specific sequences such
as
Arg-Thr-Lys-Arg-Ser-Gly-Ser-Val, (SEQUENCE ID NO. 3). Many other polypeptide
serine/threonine kinases have been reported such as glycogen synthase lcinase,
phosphorylase kinase, casein kinases I and TI, pyruvate dehydrogenase lcinase,
polypeptide kinase C, and myosin light chain kinase.
Polypeptide kinases which phosphorylate and exhibit specificity for tyrosine
(rather than for serine, threonine, or hydroxyproline) in peptide substrates
are the
polypeptide tyrosine kinases (PTK). Such PTKs are described in the literature.
The
PTI~s are another class of kinases available for use in the invention.
Another available class of kinases are the cyclic GMP-dependent (cGMP-
dependent) polypeptide kinases. The cGMP-dependent polypeptide lcinases
exhibit
substrate specificity similar to, but not identical to the specificity
exhibited by cAMP-
dependent polypeptide kinases. The peptide Arg-Lys-Arg-Ser-Arg-Lys-Glu,
(SEQUENCE ID NO. 4) is phosphorylated at serine by the cGMP-dependent
polypeptide kinase better than by the cAMP-dependent polypeptide kinase. It
has also
been shown that the CAMP-dependent polypeptide lcinase can phosphorylate
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
hydroxyproline in the synthetic peptide Leu-Arg-Arg-Ala-Hyp-Leu-Gly,
(SEQUENCE ID NO. 5).
Casein kinases, widely distributed among eulcaryotic organisms and
preferentially utilizing acidic polypeptides such as casein as substrates,
have been
classified into two groups, casein lcinases I and II. Casein lcinase II
phosphorylated the
synthetic peptide Ser-Glu-Glu-Glu-Glu-Glu, (SEQUENCE ID NO. 6). Evaluation of
results with synthetic peptides and natural polypeptide substrates reveals
that a
relatively short sequence of amino acids surrounding the phosphate acceptor
site
provides the basis for the specificity of casein lcinase II. Accordingly, the
acidic
residues at positions 3 and 5 to the carboxyl-terminal side of the serine seem
to be the
most important. Serine is preferentially phosphorylated compared to threonine.
In
another study, the peptide Arg-Arg-Arg-Glu-Glu-Glu-Thr-Glu-Glu-Glu,
(SEQUENCE ID NO. 7) is found to be a specific substrate for casein kinase II;
however, Arg-Arg-Arg-Glu-Glu-Glu-Ser-Glu-Glu-Glu, (SEQUENCE ID NO. 8) is a
better substrate; and Arg-Arg-Arg-Asp-Asp-Asp-Ser-Asp-Asp-Asp, is a better
substrate than Arg-Arg-Arg-Glu-Glu-Glu-Ser-Glu-Glu-Glu, (SEQUENCE ID NO. 9).
Thus, aspartate is preferred over glutamate. Acidic residues on the COOH-
terminal
side of the serine (threonine) are as far as known today absolutely required;
acidic
residues on the amino-terminal side of the serine (threonine) enhance
phosphorylation, but are not absolutely required: thus, Ala-Ala-Ala-Ala-Ala-
Ala-
Ser(Thr)-Glu-Glu-Glu, (SEQUENCE ID NO. 10) served as a substrate for casein
kinase II, but is less effective than Ala-Ala-Ala-Glu-Glu-Glu-Ser(Thr)-Glu-Glu-
Glu,
(SEQUENCE ID NO. 11) (the designation Ser(Thr) means serine or threonine).
Casein kinases I and II phosphorylate many of the same substrates although
casein
kinase I does not phosphorylate any of the decamer peptide substrates noted
here. It is
concluded from studies with a variety of synthetic peptides that the sequence
Ser-
Xxx-Xxx-Glu (and by inference Ser-Xxx-Xxx-Asp) may represent one class of
sequences that fulfill the minimal requirements for recognition by casein
kinase II
although some other peptides and sequences may also suffice.
As noted above, other kinases are described. The mitogen-activated S6 kinase
phosphorylates the synthetic peptide Arg-Arg-Leu-Ser-Ser-Leu-Arg-Ala,
(SEQUENCE ID NO. 12) as does a protease-activated lcinase from liver. The
21
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
rhodopsin kinase catalyzes the phosphorylation of the peptide Thr-Glu-Thr-Ser-
Gln-
Val-Ala-Pro-Ala, (SEQUENCE ID NO. I3). Other polypeptide serine/threonine
lcinases axe described and their sites of phosphorylation elucidated.
Thus, one skilled in the art has quite an adequate selection of available
lcinases
for use in the invention, which have relatively high specificity with respect
to the
recognition process, but some flexibility to the specific sequence of the
amino acid
recognition site. Such kinases provide means for phosphorylation of putative
phosphorylation sites in the desired polypeptides.
The selection of the position of the molecule best suited for the modification
depends on the particular polypeptide (and its configuration). Where multiple
putative
phosphorylation sites (and phosphorylatable sites) are to be included in the
modified
polypeptide, one would consider the potential availability of either or both
ends and
other positions of the molecule for providing the amino acid recognition
sequence.
Thus, in accordance with the invention, phosphorylation recognition sequences
can be
introduced at any point in a naturally occurring palypeptide sequence
providing such
introduced sequences do not adversely affect biological activity where such
activity is
desired.
Once the recognition site for a particular polypeptide kinase is identified,
the
invention provides a method for making by recombinant-DNA techniques the DNA
sequence which encodes the recognition site for that kinase within, fused or
linked to
the DNA sequence encoding the functional polypeptide which is to contain the
corresponding putative labelling site. Due to the intrinsic advantage of the
instant
invention, molecular modeling can be used to quickly scan through a number of
potential sites so that only those sites, with or without the attached
phosphate group,
that will not adversely affect the three-dimentional structure and/or
biological activity
of the target polypeptide will be selected for further consideration.
The invention contemplates and includes any polypeptide which is radio-
labellable by the methods of this invention and which possesses at least one
of the
properties of the corresponding unlabeled (or unlabellable) polypeptide. In
accordance
with the invention, the non-phosphorylated (or non-phosphorylatable)
polypeptide is
modified to introduce into the amino acid sequence the putative
phosphorylatable site;
22
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
this is performed after having modified the DNA sequence encoding the amino
acid
sequence of the polypeptide with the DNA sequence (part or all) which codes
for the
putative phosphorylated site. In the case of MAb, the invention embraces all
MAbs,
including such structurally modified MAb species which have been reported in
the
literature (such as humanized MAbs, hybrid antibodies, chimeric antibodies,
and
modified MAb Fab or Fc fragments) as discussed above, and other modified MAbs
which will be developed in the future.
In a preferred embodiment of the instant invention, recognition sites for the
cAMP-dependent polypeptide kinase is introduced into the MAb-chCC49 by site-
directed mutation of the coding sequence to make variants of MAb-chCC49 to be
able
to contain highly stable phosphate groups. To design those MAbs without
changing
their immunoreactivity or biological properties, molecular modeling is used to
locate
appropriate regions for introduction of the cAMP-dependent phosphorylation
site with
desirable properties. With the use of molecular modeling, we chose positions
on the
heavy chain to mutate. Vectors expressing the mutants are constructed and
transfected
into mouse myeloma NSO cells that expressed a high level of the resultant M.Ab
WWS, -WW6 and -WW7. Those variants contain the CAMP-dependent
phosphorylation site at the hinge region of the heavy chain, and can be
phosphorylated by the catalytic subunit of cAMP-dependent polypeptide kinase
with
[y-32P]ATP to high specific activity and retains the phosphate stably.
Compared to
MAb-chCC49I~1 (Lin et al., Ivct. J. oncology, 13, 115-120, 1998), another
phosphorylatable variant of MAb-chCC49, the phosphate attached to MAb-WWS, -
WW6 and -WW7 show much improved stability: about a ten-fold increase in
resistance to hydrolysis. They also exhibit the same binding specificity to
the TAG-72
antigen on MCF-7 4C10 breast cancer cells observed with MAb-chCC49I~1. The
improved stability of the attached phosphate provides a MAb with potential to
be used
in diagnosis and therapy of adenocarcinomas.
Radio labeled monoclonal antibodies (MAbs) against tumor-associated
antigens (TAA) are used clinically for the early detection and staging of the
disease as
well as for therapy. Chimeric MAb-chCC49 is one of these MAbs which reacts
with
the TAA expressed on the surface of a wide range of human adenocarcinomas. It
23
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
consists of the variable region from mouse MAb-CC49 (GenBanlc Accession No:
M95575) and the constant region from the human IgGl heavy chain (GenBank
Accession No: J00228) and the human chain (GenBank Accession No: J00241).
Since molecular modeling is a powerful tool to build 3-D models of
polypeptides, an alternative way to obtain structural information about MAb-
chCC49
is to build a 3-D model by using the crystal structures of the known MAbs as a
template. This report provides a summary of the development of a 3-D model of
MAb-chCC49. and its variants, and the use of the 3-D model to design a
phosphorylatable MAb-chCC49 mutant where the phosphate exhibits increased
resistance to hydrolysis. The phosphorylatable MAb-chCC49 designated MAb-WWS
can be phosphorylated easily and the attached phosphate is resistant to
hydrolysis,
making it a suitable candidate for use ivy vivo as well as in animal models
and in
patients.
Accordingly, to develop a more effective radio labeled MAb, a recognition
site for the cAMP-dependent polypeptide lcinase is introduced into the MAb-
chCC49
by site-directed mutation of the coding sequence with the goal of developing
stable
and effective radio labeled MAbs for ih vivo utilization.
To make variants of MAb-chCC49 without changing their immunoreactivity
or biological properties, it was useful to know the structures of these mutant
antibodies. However, due to the intrinsic mobility and segmental flexibility
of
antibodies, it is extremely difficult to obtain the crystal structure of an
intact antibody.
The original crystal structures of two myeloma polypeptides, Dob and Mcg are
solved
by deletion of the hinge region. Conformationally constrained, the structures
show a
compact T shape. In addition, the structure of the MAb Kol is determined.
Although,
it has the complete hinge region, the Fc portion of the MAb is too distorted
to be
oriented with respect to the Fab component. So far crystal structures of only
two
MAbs have been solved. One is MAb231, a mouse IgG2a MAb against canine
lymphoma cells. The other is MAb61.1.3, a murine IgGl MAb against
Phenobarbital.
The crystal structures of both of these MAbs resolve the structure of the Fab,
hinge,
and Fc regions and their spatial orientation. In addition, both show an
overall
asymmetry, which might manifest a considerable degree of intrinsic mobility
and
24
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
segmental flexibility of the antibodies. Other structural features of the two
MAbs are
quite different.
The following examples illustrate two preferred embodiments of the instant
invention.
EXAMPLE 1
Example 1 is intended to show the generation of WW-series of phosphorylated
monoclonal antibodies that are much more stable than other phosphorylated
monoclonal antibodies.
I. MATERIALS and METHODS
A. Enzymes, Reagents and Chemicals
1. Enzymes
All restriction endonucleases, the Klenow fragment of DNA polymerise I
were purchased from New England Biolabs, GibcoBRL Life Technologies, or
Boehringer-Mannheim Biochemicals. The catalytic subunit of the CAMP-dependent
protein kinase from bovine heart (Cat. No. P-2645) was purchased from Sigma
Chemical Co.
2. Reagents
Goat anti-human IgG (Fc specific) antibody (Cat. No. I-2136) was purchased
from Sigma Chemical Co. Mouse serum (Cat. No. 015-000-120) was purchased from
Jackson ImmunoResearch Laboratories, Inc. The Geneclean kit (Cat. No. 3106)
was
purchased from Bio 101. PFHM-II protein-free hybridoma medium was purchased
from GibcoBRL (Cat. No. 12040-077). Iscove's Modified Dulbecco's Medium was
purchased from Gibco BRL (Cat. No.1057861).
3. Chemicals
Sodium Pyruvate (Cat. No. 11360-013), L-Glutamine (Cat. No. 25030-016)
and Nonessential amino acids (Cat. No. 11140-019) were purchased from
Gibco/BRL. Insulin (Cat. No. I-5500) and methotrexate (Cat. No. A-6770) were
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
purchased from Sigma Chemical Co. Uridine (Cat. No. U288-1) was purchased from
Aldrich Chemical Company. Radionucleotide [y 32P]ATP, 6000 Ci/mmol, was
purchased from DuPont/NEN. All other analytical grade chemicals were purchased
from Fisher or United States Biochemical Co.
B. Cell lines and bacterial strains
1. Cell lines
The designations in parenthesis after each of the cell names represent the
American Type Culture Collection (ATCC) number where applicable.
a. NSO cells: A mouse myeloma cell line. The cells are grown in
Dulbecco's Modified Eagle Medium (DMEM), 10% Fetal Bovine Serum (FBS) and 2
mg/ml L-glutamine.
b. WISH cells (CCL-25): Description taken from the ATCC catalog:
"This line was originally thought to be derived from normal amnion, but was
subsequently found, based on isoenzyme analysis, HeLa marker chromosomes, and
DNA fingerprinting, to have been established via HeLa cell contamination. The
cells
are positive for keratin by irninunoperoxidase staining." The cells are grown
in
DMEM with 10% FBS. WISH cells are susceptible to VSV, poliovirus type 1, 2,
and
adenovirus type 2.
c. FS7 cells: Human foreskin cells with a finite life of about twenty
passages. The cells are grown in DMEM with 10% FBS.
d. HeLa S3 cells (CCL-2.2): A human cervical epithelial adenocarcinoma
cell line. The cells are grown in DMEM with 5% FBS. HeLa S3 cells are
susceptible
to VSV, poliovirus type 1, 2 and 3, adenovirus type 5, and interferon.
e. HEp-2 cells (CCL-23): Description taken from the ATCC catalog:
"This line was originally thought to be derived from an epidermoid carcinoma
of the
larynx, but was subsequently found, based on isoenzyme analysis, HeLa marker
chromosomes, and DNA fingerprinting, to have been established via HeLa cell
contamination. The cells axe positive for keratin by immunoperoxidase
staining." The
cells are grown in DMEM with 10% FBS. HEp-2 cells are susceptible to VSV,
poliovirus type 1, and adenovirus type 3.
26
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
f. , MDBK cells (CCL-22): A bovine lcidney epithelial cell line. The cells
are grown in DMEM with 10% FBS. MDBK cells are susceptible to VSV, and several
other bovine viruses.
g. Vero cells (CCL-81): A monkey kidney epithelial cell line. The cells
are grown in DMEM with 10% FBS. Vero cells are susceptible to VSV, poliovirus
type 1, 2 and 3, simian adenoviruses.
h. Daudi cells (CCL-213): A human peripheral blood cell line. The cells
are grown in RPMI with 10% FBS. The cells express Fc receptors on the surface.
i. MCF-7 4C10 cells (HTB-22): A subclone of the human breast
epithelial adenocarcinoma cell line MCF-7. The cells are grown in DMEM, 10%
FBS,
0.05 mg/ml insulin, 0.5 x nonessential amino acids and 0.05 mg/ml sodimn
pyruvate.
The cells express TAG-72 tumor antigen on the surface.
2. Bacterial stains
DHSaF': It has genotype of F' ~80dlacZOMl S 0(lacXYA-ar~gF)U169 deoR
r~ecAl endAl hsdR 17 (rK ,mK+) supE44 ~.- thi-1 gy~A96 relAl. DHSaF' was used
as a
host for the Ml3mp cloning vectors and also for the growth of the plasmids.
C. Homology modeling of MAb-chCC49
1. Software and Hardware
In the present study we used the SYBYL molecular modeling package
(version 6.5; Tripos Association, St. Louis, MO, 1999) for structural analysis
and
geometry refinement. Most of the homology and mutant modeling was performed
with the LOOK 3.5 program (Molecular Application Group, Palo Alto, CA). For
the
geometry optimization we used Kollman united charges, molecular mechanics
force
field and the MAXIMIN2 minimizer of SYBYL. All these visualization analyses
and
simulations were performed on Silicon Graphics Octane workstations.
2. Template
The crystal structure of the intact MAb231, the coordinates of which were
generously provided by Dr. Alexander McPherson and Dr. Lisa J. Haxris, was
used as
template to model MAb-chCC49. These coordinates are now available from the
27
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
Protein Data Bank (PDB) as ID lIGT. Because the crystal structure of MAb231
was
the only one available for an intact antibody at the time we started this
project, we
used MAb231 as the template for modeling in this study. In addition, aftex the
crystal
structure of MAb61.1.3 was reported, we noted that the length and sequence of
the
hinge region of MAb231 was more similar to the hinge region of MAb-chCC49 than
that of MAb61.1.3, so we used the hinge region of MAb231 to model MAb-chCC49.
The resulting model of MAb-chCC49 was then used as template to model the MAb-
chCC49 mutants.
3. Overall procedure
The model of MAb-chCC49 was built with the homology modeling module of
the LOOI~3.5 program. After the coordinates of IgG2a MAb231 were obtained, the
structure of MAb231 was used as template to develop a molecular model of MAb-
chCC49. First, the four chains of MAb231 were separated individually and
designated
as L1, L2, H1, and H2 (L for light chain and H for heavy chain). The
coordinates of
each chain were extracted and saved separately. The strategy we used to build
a
model of MAb-chCC49 was to do homology modeling on each chain of MAb-
chCC49, separately. We first displayed the 3-D structure of chain Ll of
MAb231,
then the sequence of the light chain of MAb-chCC49 was introduced into the
program
and the automatic alignment mode was set up to align the sequence of the MAb-
chCC49 light chain with that of the sequence of MAb231 light chain (FIG. 1).
The
model was built with the program module SEGMOD under the automated method
with full refinement. The coordinates of chain L1 of MAb-chCC49 were
thereafter
generated and saved as a PDB file. The models and coordinates of chains L2,
H1, and
H2 of MAb-chCC49 were generated by the same procedure as described above.
4. Geometry refinement and energy minimization.
Further geometry refinement and optimization was done with SYBYL
molecular modeling software. The 3-D structure of chain L1 of MAb-chCC49, the
coordinates of which were generated as described above, was displayed. We
added
the essential hydrogen atoms (hydrogen atoms attached to nitrogen, oxygen,
and/or
sulfur atoms that could potentially be involved in hydrogen binding with
surrounding
28
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
atoms/residues). In the first step, we scanned the side chain to minimize
conformational strains, if any, within side chain groups and surrounding
residues.
Proline is the only residue that contains a ring in its backbone and it adopts
a phi
angle close to 70°. Therefore, we used the "fix-proline" command in
SYBYL to
maintain proline geometry. We also scanned the orientations of the amide
groups of
Asn and Gln to favor potential hydrogen bonding with surrounding residues.
Finally,
the Kollman united charges were loaded on chain L1 so that the electrostatic
contribution in the energy calculation could be included. The 3-D structures
of chain
L2, H1, H2 were geometrically refined and optimized by the same procedure as
used
for chain L1. Then the refined models of chains L1, L2, H1, and H2 of MAb-
chCC49
were merged into a single molecule. Afterwards, the side chains, as well as
the amide
groups of Asn and Gln, were fixed to relax the strain in the composite
molecule.
Since MAb-chCC49 is a large protein, the energy minimization step was
broken into two parts. Before energy minimization of the whole molecule, we
cazTied
out minimization of the side chains first. We fixed the backbone by making it
an
aggregate set. Then energy minimization of the side chains was achieved with
the
Kollman united force field option for 100 iterations. In the next step, the
aggregate
was deleted, and energy minimization of the whole molecule was done by the
Powell
method in the SYBYL program.
D. Construction of phosphorylatable chimeric monoclonal antibodies of MAb-
chCC49-6P, MAb-WWl, MAb-WW2, MAb-WW3, MAb-WW4, MAb-WWS, MAb-
WW6 and MAb-WW7
1. Homology modeling of MAb-chCC49K1, MAb-CC49CKI, MAb-CC49CKII,
MAb-CC49Tyr, MAb-chCC49-6P, MAb-WW1, MAb-WW2, MAb-WW3, MAb-
WW4, MAb-WWS, MAb-WW6, MAb-WW7 and MAb-WW8
This procedure was similar to modeling of MAb-chCC49 as discussed earlier
in Section C. Both chains of MAb-chCC49K1, MAb-CC49CKI, MAb-CC49CKII,
MAb-CC49Tyr, MAb-chCC49-6P, MAb-WW1, -WW2, -WW3, -WW4, -WWS, -
WW6, -WW7 and -WW8 were modeled using the corresponding chain of MAb-
chCC49 as template. Geometry refinement and energy minimization of the modeled
modified MAbs were carried out in the same way as we did to obtain the refined
29
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
model of MAb-chCC49.
2. Systematic search and modeling of phosphorylated MAb-chCC49K1, MAb-
CC49CKI, MAb-CC49CKII, MAb-CC49Tyr, MAb-chCC49-6P, MAb- WW1, MAb-
WW2, MAb-WW3, MAb-WW4, MAb-WWS, MAb-WW6, MAb-WW7 and MAb-
WW8
After the model of each modified MAb was obtained, a phosphate group was
generated and attached to the hydroxyl group of serine or threonine in the PKA
recognition site with the 'builder' module of the SYBYL modeling paclcage. For
MAb-chCC49K1, the phosphate groups were attached to Ser449 and Ser455; for
MAb-chCC49-6P, to Ser449, Ser455, Ser464, Ser470, Ser479 and Ser485; for MAb-
CC49CKI, to Ser450 and Ser457; for MAb-CC49CKII, to Ser436; for MAb-
CC49Tyr, to Tyr455; for MAb-WWl, to Ser123; for MAb-WW2, to Thr224; for
MAb-WW3, to Ser2l; for MAb-WW4, to Thr20; for MAb-WWS, to Ser224; for
MAb-WW6, to Ser224; for MAb-WW7, to Ser224; for MAb-WWB, to Ser224. To
obtain the optimal position and to generate favorable interaction with
surrounding
residues of the phosphate moiety, we performed a systematic conformational
search
along Ca-C[3 and C(3-C~y of Ser/Thr of the PKA recognition site. For each
allowed
conformation of the Ser or Thr side chain, we analyzed for optimal hydrogen
bonding
geometry with the surrounding residues. Then among these conformations, we
chose
the one in which the entire molecule has the lowest inherent energy to do
further
refinement. First we defined a subset of amino acid residues falling within a
7 A
sphere around the residues RRXS/T of each protein kinase recognition site.
Then the
minimization subset for these four amino acid residues (RRXS/T) was done for
100
iterations by the Powell method.
3. Construction of MAb-chCC49-6P, MAb-WW1, MAb-WW2, MAb-WW3,
MAb-WW4, MAb-WWS, MAb-WW6, MAb-WW7 and MAb-WW8
a. Construction of MAb-chCC49-6P
The plasmid pdHL7-CC49K1 made previously was used to make
plasmid pdHL7-CC49-6P. The MAb-chCC49K1 contains two phosphorylation sites
on each heavy chain. To construct a heavy chain with a cassette of six
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
phosphorylation sites, the synthetic fragment K2 was synthesized (FIG. 3).
This
fragment contained two phosphorylation sites as did fragment Kl, but contained
overhangs that were compatible with ~maI sites at each end. The Xmal site on
the
right was modified by replacing the terminal C to A. Thus, when the right end
was
ligated to an overhang with an XmaI site, the religated product could not be
cleaved
with endonuclease XmaI. This double-stranded fragment was ligated into the
XmaI
site of the plasmid pdHL7-CC49K1. Clones containing the insert were screened
by
digesting the resultant plasmids with XhoI. Clones with ~'hoI fragments that
appeared
to contain two K2 fragments were chosen for further screening by PCR. The
resultant
plasmid pdHL7-CC49-6P contained two intact K2 fragments and the original Kl
fragment to generate a sequence encoding six phosphorylation sites on each
heavy
chain.
The vector pdHL7-CC49K1 for expression of the phosphorylatable
monoclonal antibody (MAb-chCC49Kl) with two CAMP-dependent protein kinase
recognition sites on each heavy chain was modified as follows to construct
site-
specific mutations to introduce phosphorylation sites in various positions of
MAb-
CC49. To construct the expression vector for MAb-chCC49 without the
phosphokinase recognition site, an intermediate vector pdHL7-BH was made so
that
one of two XhoI restriction sites in pdHL7-CC49K1 could be removed. To
construct
pdHL7-BH, the vector pdHL7-CC49K1 was digested with BamHI and Hi~dIII
restriction endonucleases. The resultant 6854 by fragment was isolated by
agarose gel
electrophoresis, then purified, blunt-ended, and self ligated to generate
intermediate
vector pdHL7-BH. To construct pdHL7-CC49, a 358 by fragment was amplified from
pdHL7-CC49K1 by PCR with the 5' and 3' primers
GTGACCGCTGTACCAACCTCTGTCC, (SEQUENCE ID NO. 14) and
CCCTCGAGTCACTTGCCCGGGGACAGGGAGAGG, (SEQUENCE ID NO. 15)
respectively. This PCR fragment was then digested with BsrGI and XhoI
restriction
endonucleases, and purified. The vector pdHL7-BH was digested with the same
restriction endonucleases and a 6463 by fragment was released, purified and
ligated to
' the digested and purified 358 by PCR fragment. The resultant plasmid pdHL7-
CC49BH was then digested with XmaI and EcoRI restriction endonucleases, and
yielded two bands. The smaller band, which was 2726 bp, was isolated and
purified,
31
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
then further ligated to the 6667 by fragment which was isolated and purified
after
pdHL7-CC49K1 was digested with the same restriction endonucleases. The
resultant
construct pdHL7-CC49 was characterized by Bs~GI and XhaI restriction
endonuclease
digestion and DNA sequencing.
b. Construction of MAb-WWl
To construct plasmid pWWl, the vector pdHL7-CC49 was digested with
Hiv~dIII and PstI restriction endonucleases to isolate a 890 by fragment. The
fragment
was isolated by agarose gel electrophoresis, then purified. The replicative
form (RF)
DNA of phage M13mp18 was digested with HindIII and Pstl restriction
endonucleases and the large DNA fragment isolated. The 890 by fragment was
then
inserted into the Hi~dIII and PstI site of the M13mp18 DNA to yield phage M13-
W21. Then site-directed mutagenesis was performed as described. Phage M13-W21
was introduced into the Escherichia coli CJ236 strain, which is a dut, ung
strain and
lacks the enzyme uracil N-glycosylase which normally removes uracil from DNA.
This results in incorporation of uridine in the DNA. Then single-stranded (SS)-
DNA
containing uridine from phage M13-W21 was used as template for site-directed
mutagenesis to prepare the mutant M13-WW1. The oligodeoxynucleotide m120, 5'-
GCAGCCTCCACCAGGCGCCCATCGGTC-3', (SEQUENCE ID NO. 16) was used
for site-directed mutagenesis. Oligonucleotide m120 contains a phosphokinase
recognition site RRPS and also a Na~I recognition site. Oligonucleotide m120
was
annealed to uridine-containing SS-DNA of phage M13-WW21, followed by the in
vitro synthesis of the complementary strand. Afterwards, the resultant double-
stranded (DS)-DNA was transformed into E. coli DHSaF' strain with a functional
uracil N-glycosylase to remove the parental strand. The desired mutant was
characterized by NarI restriction endonuclease digestion and DNA sequencing.
Thus
we obtained the construct M13-WW1. Then RF-DNA of phage M13-WW1 was
digested with Hiv~dIII and BstEII restriction endonucleases, and the resultant
410 by
fragment was inserted into the vector pCC49 that was digested with the same
endonucleases to yield plasmid pWWl. The vector pWWI expresses the MAb-WWl
with amino acid substitutions K120R and G121R in the MAb-chCC49 heavy chain.
c. Construction of MAb-WW2
32
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
To construct plasmid pWW2, the vector pCC49 was digested with HifadIII and
NaeI restriction endonucleases to isolate a 1424 by fragment. The fragment was
isolated by agaxose gel electrophoresis, then purified. The replicative form
(RF) DNA
of phage M13mp19 was first digested withXbaI restriction endonuclease, then
blunt-
s ended by Klenow fragment of DNA polymerase. Afterwards, this DNA was further
digested with HihdIII restriction endonuclease, and the large DNA fragment was
isolated. The 1424 by fragment was then inserted into the ~~baI blunt-ended
and
HindIII site of the M13mp19 DNA to yield phage M13-W22. Then site-directed
mutagenesis was performed as described. Phage M13-W22 was introduced into the
E.
coli CJ236 strain and SS-DNA containing uridine from phage Ml3-W22 was used as
template for site-directed mutagenesis to prepare the mutant M13-WW2. The
oligodeoxynucleotide m221rev, 5'-
GGGCATGTGTGACGTCTGTCACAAGATTTG-3', SEQUENCE ID NO. 17 was
used for site-directed mutagenesis. Oligonucleotide m221rev contains a
phospholcinase recognition site RRHT and also an AatII recognition site.
Oligonucleotide m221rev was annealed to uridine-containing SS-DNA of phage M13-
WW22, followed by the in vitro synthesis of the complementary strand.
Afterwards,
the resultant DS-DNA was transformed into E. coli DHSaF' strain with a
functional
uracil N-glycosylase to remove the parental strand. The desired mutant was
characterized by AatII restriction endonuclease digestion and DNA sequencing.
Thus
we obtained the construct M13-WW2. Then RF-DNA of phage M13-WW2 was
digested with SacII restriction endonuclease, and the resultant 410 by
fragment was
inserted into the vector pCC49 that was digested with the same endonuclease to
yield
plasmid pWW2. The vector pWW2 expresses the MAb-WW2 with amino acid
substitutions K221R and T222R in the MAb-chCC49 heavy chain.
d. Construction of MAb-WW3
To construct plasmid pWW3, the vector pCC49 was digested with Hi~dIII and
S~aBI restriction endonucleases to isolate a 708 by fragment. The fragment was
isolated by agarose gel electrophoresis, then purified. The replicative form
(RF) DNA
of phage M13mp19 was first digested withXbaI restriction endonuclease, then
blunt-
ended by Klenow fragment of DNA polymerase. Afterwards, this DNA was further
33
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
digested with HihdIII restriction endonuclease, and the large DNA fragment was
isolated. The 708 by fragment was then inserted into the .~baI blunt-ended and
HindIII site of the Ml3mpl9 DNA to yield phage M13-W23. Then site-directed
mutagenesis was performed as described. Phage M13-W23 was introduced into the
E.
coli CJ236 strain and SS-DNA containing uridine from phage M13-W23 was used as
template for site-directed mutagenesis to prepare the mutant M13-WW3. The
oligodeoxynucleotide ml8rev, 5'-
CCTGGGGCTTCGCGAAGGATTTCCTGCAAGG-3', (SEQUENCE ID NO. 18)
was used for site-directed mutagenesis. Oligonucleotide ml8rev contains a
phosphokinase recognition site RRIS and also a NruI recognition site.
Oligonucleotide ml8rev was annealed to uridine-containing SS-DNA of phage M13-
WW23, followed by the in vitro synthesis of the complementary strand.
Afterwards,
the resultant DS-DNA was transformed into E. coli DHSaF' strain with a
functional
uracil N-glycosylase to remove the parental strand. The desired mutant was
characterized by N~uI restriction endonuclease digestion and DNA sequencing.
Thus
we obtained the construct M13-WW3. Then RF-DNA of phage M13-WW3 was
digested with oI and HindlII restriction endonucleases, and the resultant 420
by
fragment was first inserted into the intermediate vector pdHL7-BB that was
digested
with the same endonucleases to yield plasmid pCC49t-WW3. Then pCC49t-WW3
was digested with ~'baI, and Hiv~dIII restriction endonucleases, and the
resultant 2983
by fragment was isolated. The vector pCC49 was digested with the same
endonucleases and large fragment of 6440 by was isolated. The 2983 by fragment
was
ligated to this 6440 by of the vector fragment to yield plasmid pWW3. The
vector
pWW3 expresses the MAb-WW3 with amino acid substitutions V18R and K19R in
the MAb-chCC49 heavy chain.
e. Construction of MAb-WW4
To construct plasmid pWW4, the vector pCC49 was digested withXbaI and
BamHI restriction endonucleases to isolate a 415 by fragment. The fragment was
isolated by agarose gel electrophoresis, then purified. The replicative form
(RF) DNA
of phage M13mp18 was digested with~YbaI and BanaHI restriction endonucleases
and
the large DNA fragment isolated. The 415 by fragment was then inserted into
the
34
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
~'baI and BamHI site of the M13mp18 DNA to yield phage M13-W24. Then site-
directed mutagenesis was performed as described. Phage M13-W24 was introduced
into the E. coli CJ236 strain and SS-DNA containing uridine from phage M13-W24
was used as template for site-directed mutagenesis to prepare the mutant M13-
WW4.
The oligodeoxynucleotide mLl7-2, 5'-
GTGTCAGTTGGCCGGAGGGTTACTTTGAGC-3', (SEQUENCE ID NO. 19) was
used for site-directed mutagenesis. Oligonucleotide mLl7-2 contains a
phospholcinase
recognition site RRVT and also a EaeI recognition site. Oligonucleotide mLl7-2
was
annealed to uridine-containing SS-DNA of phage M13-WW24, followed by the ivy
vitro synthesis of the complementary strand. Afterwards, the resultant DS-DNA
was
transformed into E. coli DHSaF' strain with a functional uracil N-glycosylase
to
remove the parental strand. The desired mutant was characterized by EaeI
restriction
endonuclease digestion and DNA sequencing. Thus we obtained the construct M13-
WW4. Then RF-DNA of phage M13-WW4 was digested with XbaI and BamHI
restriction endonucleases, and the resultant 410 by fragment was inserted into
vector
pCC49 that was digested with the same endonucleases to yield plasmid pWW4. The
vector pWW4 expresses the MAb-WW4 with amino acid substitutions E17R and
K18R in the MAb-chCC49 light chain.
f. Construction of MAb-WWS
To construct WWS, SS-DNA containing uridine from phage M13-W22 was
used as template for site-directed mutagenesis to prepare the mutant M13-WWS.
The
oligodeoxynucleotide, m221mlrev, 5'-
CGGTGGGCATGAGTGACGTCTGTCACAAGATTTG-3', (SEQUENCE ID NO.
20) was used for site-directed mutagenesis. Oligonucleotide m221mlrev contains
the
phosphokinase recognition site RRHS and also an AatII recognition site.
Oligonucleotide m221mlrev was annealed to uridine-containing SS-DNA of M13-
WW22, followed by the ih vitro synthesis of the complementary strand.
Afterwards,
the resultant DS-DNA was transformed into E coli DHSaF' strain with a
functional
uracil N-glycosylase to remove the parental strand. The desired mutant was
characterized by AatII restriction endonuclease digestion and DNA sequencing.
Thus
we obtained the construct M13-WWS. Then RF-DNA of M13-WWS was digested
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
with SacII restriction endonuclease, and the resultant 410 by fragment was
inserted
into the vector pdHL7-CC49 that was digested with the same endonuclease to
yield
plasmid pWWS. The vector pWWS expresses the MAb-WWS with amino acid
substitutions K221R, T222R and T224S in the MAb-chCC49 heavy chain.
g. Construction of MAb-WW6
To make the plasmid pLgpCXIIHuWW5~CH2 for expression of the heavy
chain of the MAb-WW6, the plasmid pLgpCXIIHuCC49~CH2 was digested with
ApaI and..KhhoI restriction endonucleases. to isolate a 340 by fragment. The
fragment
was isolated by agarose gel electrophoresis, purified and cloned into
pBluescript,
which was digested with the same restriction endonucleases. The resultant
plasmid
pBSI~S-huHdCH2 was then digested with EcoRI and KpnI restriction
endonucleases.
The smaller DNA fragment was isolated. The 370 by fragment was then inserted
into
the EcoRI and Kp~I site of the M13mp19 DNA to yield phage M13-huHdCH2. Then
site-directed mutagenesis was performed as described in Section D.3.b. Phage
M13-
huHdCH2 was introduced into the E. coli CJ236 strain and SS-DNA containing
uridine from phage M13-huHdCH2 was used as template for site-directed
mutagenesis to prepare the mutant M13-huWWS. The oligodeoxynucleotide,
m221mlrev, 5'-CGGTGGGCATGAGTGACGTCTGTCACAAGATTTG-3',
(SEQUENCE ID NO. 21) was used for site-directed mutagenesis. Oligonucleotide
m221mlrev contains the phosphokinase recognition site RRHS and also anAatII
recognition site. Oligonucleotide m221mlrev was annealed to uridine-containing
SS-
DNA of M13-huHdCH2, followed by the ih viti o synthesis of the complementary
strand. Afterwards, the resultant DS-DNA was transformed into E. coli DHSaF'
strain
with a functional uracil N-glycosylase to remove the parental strand. The
desired
mutant was characterized by AatII restriction endonuclease digestion and DNA
sequencing. Thus we obtained the construct M13-huWWS. Then RF-DNA of M13-
huWWS was digested with ApaI and ~'hoI restriction endonucleases, and the
resultant
340 by fragment was inserted into the vector pLgpCXIIHuCC490CH2 that was
digested with the same endonuclease to yield plasmid pLgpCXIIHuWW50CH2. The
vector pLgpCXIIHuWW50CH2 expresses the heavy chain of MAb-WW6 with
amino acid substitutions I~221R, T222R and T224S in the MAb-huCC49 heavy
chain.
36
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
h. Construction of MAb-WW7
Two plasmids pLNCXIIHuCC49HuI~VS and pLgpCXIIHuWW5V8~CH2
were made for the expression of the light chain and the heavy chain of MAb-
WW7,
respectively.
To make pLNCXIIHuCC49HuI~VS, the plasmid pBScHuCC49V5 was first
digested with HihdIII and ApaI restriction endonucleases, then blunt-ended by
Klenow fragment of DNA polymerase to yield a 1.1 kb fragment. Another plasmid
pLNCXIIHuCC49HuK was digested with HindIII restriction endonuclease, blunt-
ended, and the resultant 6.5 kb large fragment was isolated. Then the 1.1 kb
fragment
was ligated to this 6.5 kb fragment to yield plamid pLNCXIIHuCC49HuI~VS. The
plasmid pLNCXIIHuCC49HuKV5 was characterized by NheI restriction
endonuclease digestion and DNA sequencing.
To make pLgpCXIIHuWW5V80CH2, the plasmid pBScHuCC49V80CH2
was first digested with Hi~dIII and CZaI restriction endonucleases, and the
resultant
1.1 kb fragment was isolated and purified. The plasmid pLgpCXIIHuWW5~CH2 was
digested with same restriction endonucleases. The 6.5 kb fragment was isolated
from
the two fragments obtained. The 1.1 kb fragment was then ligated to this 6.5
lcb
fragment to yield plasmid pLgpCXIIHuCC49V80CH2. Afterwards, the
pLgpCXIIHuCC49V8G1CH2 was digested with ApaI and XhoI restriction
endonucleases. The large 7269 by fragment was isolated. Then the
pLgpCXIIHuWW50CH2 was digested with same restriction endonucleases to isolate
a 340 by fragment. This 340 by fragment was finally ligated to the 7269 by
fragment
to yield the plamid pLgpCXIIHuWW5V8~CH2.
i. Construction of MAb-WW8
To construct the expression vector for MAb-WW8, an intermediate vector
pWWSt-BB was made so that one of two XhoI restriction sites in pWWS could be
removed. To construct pWWSt-BB, the pWWS was digested with BstEI and BgIII
restriction endonucleases. The resultant 7800 by fragment was isolated, blunt-
ended,
and then self ligated to generate intermediate vector pWWSt-BB. Then a 420 by
fragment was amplified from the plasmid pLgpCXIIHuCC49~CH2 by PCR with the
37
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
5' primer, 5'-kashH-7, CCCCTCGAGCCACCATGGAGTGGTCCTGGGTC,
(SEQUENCE ID NO. 22) and 3' primer, 3'-kashH-420,
CCCAAGCTTTTTGGCGCTGGAGACGGTGACCAG, (SEQUENCE ID NO. 23)
respectively. This PCR fragment was then digested with Xhol and HindIII
restriction
endonucleases, isolated by agarose gel electrophoresis, purified, and
subcloned into
pWWSt-BB, which was digested with the same restriction endonucleases to obtain
pWWSt-huVH-BB. Then pWWSt-huVH-BB was digested with BamHI andXbal
restriction endonucleases to isolate a 7400 by fragment. Then a 400 by
fragment was
amplified from the plasmid pLNCXIIHuCC49HuK by PCR with the 5' primer, 5'-
kashL-11, CCTCTAGACCACCATGGATAGCCAGGCCCAG, (SEQUENCE ID
NO. 24) and 3' primer, 3'-kashL-425,
GCCGCGGCCCGTGGATCCTTCAGTTCCAGCTT, (SEQUENCE ID NO. 25)
respectively. This PCR fragment was then digested with BamHI and XbaI
restriction
endonucleases, purified, and ligated to the 7400 by fragment to yield pWW8-BB.
Finally, pWWB-BB was digested with HihdIII and XbaI restriction endonucleases,
and yielded two fragments. The smaller fragment, 3000 bp, was isolated and
purified.
Then the plasmid pWWS was digested with the same restriction endonucleases.
The
large fragment, which was 6400 bp, was also isolated, purified, and ligated
into the
purified 3000 by fragment. The resultant construct pWW8 was characterized by
EaeI
restriction endonuclease digestion and DNA sequencing. The vector pWWB
expresses
the humanized MAb-WWS with amino acid substitutions K221R, T222R and T224S
in the MAb-chCC49 heavy chain.
4. Expression of monoclonal antibodies
a. Expression of MAb-chCC49-6P, MAb-WWl, MAb-WW2, MAb-
WW3, MAb-WW4 and MAb-WWS
Electroporation was used to introduce the plasmids pMAb-chCC49-6P,
pMAb-WWl, -WW2, -WW3, -WW4 and-WWS into mouse myelomaNSO cells.
First, 2 x 107 cells in 450 ~,1 of ice cold PBS was mixed with 12 ~,g of
purified
plasmid in an electroporation cuvette. The cells were incubated on ice for 10
min. The
electroporator was adjusted to the following settings: 0.24 KV and 950 ~,F.
After
38
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
electroporation of cells for 30 msec (time constant), the cells were allowed
to recover
on ice for 10 min, then were transferred from the cuvette into 30 ml of medium
containing DMEM, 10% fetal bovine serum and 1 % glutamine, and then were
dispensed into 96-well plates with 100 ~1 in each well. After 48 hours,
selection
medium containing DMEM, 10% fetal bovine serum, 1 % glutamine, and 0.15 ~.M of
methotrexate replaced the medium. Subsequently, selection medium was used
every
3-4 days to replace the medium until stable transformants were obtained. The
expression of the mutant protein in the cell culture supernatants was
determined by
ELISA. Clones with the highest expression of modified MAbs were chosen for
expansion. First, cells from a 96-well plate were placed in a 24 well plate
and then
gradually expanded to 150 cm2 flasks. In 150 cm2 flaslcs, 5 x 106 cells were
grown in
50 ml medium until the medium was yellow and most of the cells were dead, then
supernatant was collected.
b. Expression of MAb-WW6
To express MAb-WW6, electroporation was used to introduce the plasmids
pLNCXIIHuCC49HuK and pLgpCXIIHuWW50CH2 into mouse myeloma NSO
cells. The procedure was the same as described in Section D.4.a except that
the
medium containing DMEM, 10% fetal bovine serum, 1 % glutamine, 700 ~.g/ml of
6418, 1 p,g/ml of mycophenolic acid, 250 ~,g/ml of xanthine, and 15 ~,g/ml of
hypoxanthine was used as selection medium.
After cells were expanded to 150 cm2 flasks, 5 x 106 cells were grown in 50
ml protein-free hybridoma medium PFHM-II (Gibco BRL). The supernatant was then
collected after most of the cells were dead.
c. Expression of MAb-WW7
To express MAb-WW7, electroporation was used to introduce the plasmids
pLNCXIIHuCC49HuI~VS and pLgpCXIIHuWW5V8~CH2 into mouse myeloma
NSO cells. The procedure was the same as described in Section D.4.a except
that the
medium containing DMEM, 10% fetal bovine serum, 1% glutamine, 700 ~g/ml of
6418, 1 ~g/ml of mycophenolic acid, 250 ~,g/ml of xanthine, and 15 ~g/ml of
hypoxanthine was used as selection medium.
39
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
After cells were expanded ~to 150 cm2 flasks, 5 x 106 cells were grown in 50
ml protein-free hybridoma medium PFHM-II (Gibco BRL). The supernatant was then
collected after most of the cells were dead.
5. Furification of monoclonal antibodies
a. Purification of MAb-chCC49-6P, MAb-WWl, MAb-WW2, MAb-
WW3, MAb-WW4 and MAb-WWS
Before purification of MAb-chCC49-6P, MAb-WW1, -WW2, -WW3, -WW4
and -WWS, supernatants from several 150 cm2 flasks were pooled. Then the cell
culture supernatants containing the modified MAbs were purified as described
with
some minor modifications. Briefly, a 1 ml protein A column was equilibrated
with
three column volumes of buffer A (3 M NaCI, 1 M glycine, pH 8.8). Solid NaCl
was
added to the cell culture supernatants to a concentration of 3 M. Then the pH
of the
cell supernatants was adjusted to pH 8.0 with 1 M glycine (pH 8.8).
Supernatants
(about 300 ml) were centrifuged at 7268 x g for 10 min. Then after passage
through
0.2 ~,m filter units, the supernatants were loaded onto the protein A column
at a flow
rate of 1 mllmin. The columns were washed with buffer A for five column
volumes.
Afterwards, the columns were eluted with two column volumes of buffer B (0.2 M
glycine~HCI, pH 2.5). Eluates were neutralized with 1 ml of buffer C (10 mM
boric
acid, 2.5 mM borax and 7.5 mM of NaCI, pH 8.5) with the neutralized solution
having
a pH of 7Ø The purified MAbs were dialyzed against 1000 volumes of PBS
overnight at 4°C. The dialyzed MAbs were then concentrated with a
Centricon
concentrator. The protein concentrations of purified MAbs were determined by
ELISA, and the parities of IgG were checked by SDS polyacrylamide gel
electrophoresis. The purified MAbs were then aliquoted into 0.5 ml tubes and
stored
frozen at -20 ° C or below until use.
b. Purification of MAb-WW6 and MAb-WW7
Since CH2 domain deleted MAbs could not bind to Protein A, Protein G-
Sepharose (Pharmacia) was used to purify MAb-WW6 and MAb-WW7. Before
purification of MAb-WW6 and MAb-WW7, supernatants from several 150 cma flasks
were pooled. Then the cell culture supernatants containing the modified MAbs
were
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
purified. Briefly, a 1 ml protein G column was equilibrated with three column
volumes of Buffer A (3 M NaCI, 1 M glycine, pH 8.8). Solid NaCI was added to
the
cell culture supernatants to a concentration of 3 M. Then the pH of the cell
supernatants was adjusted to pH 8.0 with 1 M glycine (pH 8.8). Supernatants
(about
300 ml) were centrifuged at 7268 x g for 10 min. Then after passage through
0.2 ~,m
filter units, the supernatants were loaded onto the protein G column at a flow
rate.of 1
ml/min. The columns were washed with Buffer A for five column volumes.
Afterwards, the columns were eluted with two column volumes of 0.1 M
glycine~NaOH, pH 10). Eluates were neutralized with 80 ~1 of 2 M NaH2P04 to
adjust the pH to 7Ø The purified MAbs were dialyzed against 1000 volumes of
PBS
overnight at 4°C. The dialyzed MAbs were then concentrated with a
Centricon
concentrator. The protein concentrations of purified MAbs were determined by
ELISA, and the parities of IgG were checked by SDS polyacrylamide gel
electrophoresis. The purified MAbs were then aliquoted into 0.5 ml tubes and
stored
frozen at -20 ° C or below until use.
6. Phosphorylation of MAb-chCC49-6P, MAb-WW1, MAb-WW2, MAb-WW3,
MAb-WW4, MAb-WWS, MAb-WW6 and MAb-WW7
Each mutant MAb was labeled with ['y 32P]ATP and the cAMP-dependent
protein kinase as described previously. Approximately 10 ~,g of MAb was
incubated
at 30°C for 60 min with 0.5 mCi of [y 32P]ATP and 15 units of the
catalytic subunit of
CAMP-dependent protein kinase from bovine heart muscle (6 mg/ml DTT) in 25 ~1
of
20 mM Tris ~ HCI, pH 7.4, 100 mM NaCl, and 12 mM MgCl2, then cooled on ice to
stop the reaction. After addition of 300 ~,l containing 5 mg/ml bovine serum
albumin
in 10 mM sodium pyrophosphate, pH 6.7, at 4°C, the 0.325 ml reaction
mixture was
dialyzed against 10 mM sodium pyrophosphate, pH 6.7, overnight at 4°C.
Dialysis
buffer was changed twice. Incorporation of radioactivity into the monoclonal
antibodies was measured with a liquid scintillation spectrometer after
precipitation of
the protein with trichloroacetic acid (Pestka, 1972). To remove any labile
32P, the final
product in 0.325 ml was adjusted to pH 7.4 with 1 M Tris base, then incubated
at
37°C overnight.
41
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
7. Determination of immunoreactivities of [32P]MAbs
Direct binding assays were carried out as follows. The 96-well plates were
coated with 100 ~,1 of TAG-72 positive bovine submaxillary mucin (BSM) or TAG-
negative porcine submaxillary mucin (PSM) at a concentration of 10 ~,glml in
PBS
overnight at 4°C. Then the plates were blocked with 5% BSA in PBS. The
[32P]MAbs
were serially diluted in 1% BSA in PBS, starting with 2 x 105 cpm in 100 ~1.
The
plates were incubated overnight at 4°C, then washed four times with 1%
BSA in PBS.
Finally, 150 ~,l of 0.2 N NaOH was added into each well, then collected and
placed
into a scintillation vial. The process was repeated with another 150 ~.l of
0.2 N NaOH
that was added to the same scintillation vial and counted.
Direct binding assays were also carried out by passing [32P]MAbs over beads
coated either with BSM or PSM. The BSM was immobilized onto beads (Reacti-Gel
HW65F; Pierce, Rockford, IL) as described (Johnson et al., 1986; Kashmiri et
al.,
1995) at a ratio of 2 mg BSM to 1 ml of wet-packed beads. The BSM beads (50
~,1
wet-packed volume) were placed in a 1.5 ml Eppendorf tube in duplicate. Then 2
x
105 cpm of [3aP]MAbs in 1 ml of 1% bovine serum albumin (BSA) in PBS was added
to each tube in duplicate. After incubation for 2 hours at room temperature
with end-
over-end mixing, the BSM beads were then pelleted at 1000 x g for 5 minutes.
The
supernatant was removed by aspiration and discarded. The beads were then
washed
three times with 1 ml of 1% BSA in PBS by centrifugation followed by
aspiration of
the supernatant as described. The radioactivity remaining on the beads in each
tube
was measured and the total percent of [3zP]MAbs bound to the BSM beads was
calculated as (counts bound)/(total counts loaded) x 100 where total counts
represents
2 x 105 cpm and counts bound represents the counts on the beads.
8. Determination of stability of 32P-labeled MAbs in sera
The stability of 32P-labeled MAbs were determined as described previously
with minor modification. Briefly, each reaction contained 0.5 ml of human
serum,
mouse serum, fetal bovine serum or a solution of bovine serum albumin (5 mg/ml
in
PBS), 125 ~,1 of 1 M Tris~HCI, pH 7.4, and 3 ~,1 of the [32P]MAb (2.4 x 106
cpm) for a
total volume of 628 ~1 and was incubated at 37°C. Portions of 20 ~,1
were taken in
42
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
duplicate over a 24-hour, 5-day, or 21-day period to determine the stability
of
[32P]phosphate attached to the MAb by TCA precipitation.
II. RESULTS
Construction of phosphorylatable chimeric monoclonal antibodies of MAb-chCC49
1. Model of MAb-chCC49
The 3-D model of MAb-chCC49 was built by using the crystal structure of
MAb231 as template as described herein (see also FIG. 4). The modeled MAb-
chCC49 showed overall structural similarity to the template molecule MAb231.
Again, the asymmetrical T shape and the extended hinge region were seen in the
MAb-chCC49 model, which was consistent with its overall sequence similarities
to
MAb231. However, when MAb-chCC49 was superimposed on MAb231 (FIG. 5), the
local structural differences were noticed, especially in the CDR regions of
the two
MAbs. This is consistent with the differences in the primary amino acid
sequences of
two molecules in this region.
2. Overview of the models of the phosphorylatable chimeric monoclonal
antibodies of MAb-chCC49 and phosphorylated modified MAbs
The models of the phosphorylatable chimeric monoclonal antibodies of MAb-
chCC49 and phosphorylated modified MAbs are shown in FIGS. 6 - 9. The modeled
modified MAbs all showed, the asymmetrical T shape and extended hinge region
as
noted above for MAb231 (FIG. 5). A close look at the site where we introduced
the
cAMP-dependent phosphorylation site revealed that almost all the amino acid
residues which are essential to the phosphorylation were exposed on the
surface,
suggesting that this site would be accessible for the binding of PKA and
thereby
facilitating the phosphorylation. Not surprisingly, when MAb-chCC49 and
modified
MAbs were superimposed, they exhibited identical structures in most of the
regions
except for the area where the phosphorylation site was introduced in the
mutant MAbs
(FIG. 10, where only superimposion of models of MAb-WWS and MAb-chCC49 axe
shown.). No significant structural differences in the backbone geometry were
noticeable in the CDR regions of MAb-chCC49 or modified MAbs, which suggested
that after introduction of a phosphorylation site in MAb-chCC49, the binding
ability
43
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
of the modified MAbs would not be changed significantly.
The systematic search results for each lcinase recognition site are summarized
in Table 1. It can be seen that on some constructs (MAb-chCC49K1, MAb-CC49CKI,
MAb-CC49CKII, MAb-CC49Tyr, MAb-chCC49-6P, MAb-WWS, -WW6, -WW7
and -WW8), the attached phosphates have more allowed conformations than those
on
other constructs (MAb-WW1, -WW2, -WW3 and -WW4).
a. Models of MAb-chCC49K1 and phosphorylated MAb-chCC49K1
The models of MAb-chCC49Kl and phosphorylated MAb-chCC49Kl are
shown in FIG. 6A and FIG. 8A. It can be seen that the phosphorylation site in
MAb-
chCC49Kl is more extended than those in MAb-WW1, -WW2, -WW3, -WW4, and
WW5 and is highly accessible to the enzyme. Phosphate groups were attached to
serine residues (Ser449 and Ser455) on the PKA sites of MAb-chCC49K1 and the
systematic conformational searches (Table 1) were done as described herein to
determine the conformation of the phosphate groups. As seen from Table 1, the
searches corresponding to Ser455 and Ser449 of heavy chains 1 and 2,
respectively,
yielded 43 and 54 conformations, more than for the other mutant MAbs in Table
1,
suggesting the easy accessibility of the PKA recognition site in these sites
of the
MAb. However, the searches corresponding to Ser449 and Ser455 of heavy chains
1
and 2, respectively, only yielded 18 and 15 conformations. But since the PKA
recognition sites on MAb-chCC49K1 are on the flexible C-terminus of the MAb,
additional searches along the main chain of the MAb was allowed in performing
searches to see if more conformations were allowed for the attached
phosphates.
Therefore, we searched along C~-Ct~r of Ser449 as well as Ca-C[3 and C~3-Oy of
Ser449, chain 1. The results are shown in Table 1. This search yielded 655
allowed
conformations for the attached phosphates, reflecting the flexible nature of
the site.
Similar results were obtained for the search corresponding to Ser455 (chain
2). We
searched along C~-Cdr of A1a454, Ser455, Met456 as well as Ca-C(3 and C(3-O~y
of
Ser455 (chain 2), and it was found that 2298 conformations were allowed for
the
attached phosphates.
One interesting phenomenon we noticed when we did first-round systematic
searches was that on some sites, the phosphates had potential to form hydrogen
bonds
44
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
with the surrounding amino acids in some of the allowed conformations (Table
1).
However on the other sites, the phosphates had no potential at all to form
hydrogen
bonds in any of the allowed conformations. As to MAb-chCC49K1, one of the four
phosphates attached to MAb-chCC49K1 could be stabilized through a hydrogen
bond
(FIG. 11). The hydrogen bond was formed with the NH group of Ser449 of the
same
heavy chain. Overall these data clearly demonstrate that the two heavy chains
are not
symmetrical and exhibit significant differences in their structures.
b. Models of MAb-chCC49CI~I and phosphorylated MAb-chCC49CKI
The models of MAb-chCC49CKI and phosphorylated MAb-chCC49CKI are
shown in FIG. 6B and Fig. 8B, respectively. Phosphate groups were attached to
serine
residues (Ser450 and Ser457) on the PKA sites of MAb-chCC49CI~I and the
systematic conformational searches (Table 1) were done as described herein to
determine the conformation of the phosphate groups. As seen in Table 1, the
search
corresponding to Ser450 of heavy chain 1 yielded 40 conformations, more than
for
some other mutant MAbs in Table 1. However, the other three searches yielded
28, 6,
and 30 conformations. But since the PKA recognition sites on MAb-chCC49CI~I
are
also on the flexible C-terminus of the MAb; we did additional searches along
the main
chain of the MAb to see if more conformations were allowed for the attached
phosphates. The results are shown in Table 1. For the search corresponding to
Ser457
(chain 1), we searched along C~-Cdr of Ser457 as well as Ca-C(3 and C~3-Oy of
Ser457 (chain 1). This search yielded 618 allowed conformations. Similar
results
were obtained for the searches corresponding to Ser450 and Ser457 (chain 2)
evaluated as shown in Table 1.
Before we did additional conformational searches, we also performed searches
to see if the attached phosphates have potential to form hydrogen bonds with
the
surrounding amino acids. Three of the four serine phosphates on MAb-chCC49CKI
showed this potential (Table 1). Here again the asymmetry of the antibody
structure is
evident.
Models of MAb-chCC49CKII and phosphorylated MAb-chCC49CKII
The models of MAb-chCC49CKII and phosphorylated MAb-chCC49CKII are
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
shown in FIG. 6C and FIG. 8C, respectively. Phosphate groups were attached to
serine residues (Ser436) on the PKA sites of MAb-chCC49CKII and the systematic
conformational searches (Table 1 ) were done as described herein to determine
the
conformations of the phosphate groups. As seen from Table l, two searches
yielded
56 and 48 conformations, respectively.
We also performed specific searches to see if the attached phosphates have
potential to form hydrogen bonds with the surrounding amino acids. One of the
two
serine phosphates on MAb-chCC49CKII showed the potential to form a hydrogen
bond (Table 1).
d. Models of MAb-chCC49Tyr and phosphorylated MAb-chCC49Tyr
The models of MAb-chCC49Tyr and phosphorylated MAb-chCC49Tyr are
shown in FIG. 6D and FIG. 8D, respectively. After phosphate groups were
attached to
tyrosine residues (Tyr455) on the PKA sites of MAb-chCC49Tyr, the systematic
conformational searches were performed as described herein to determine the
conformations of the phosphate groups. As seen from Table 1, two searches
yielded
60 and 213 conformations, respectively.
We performed specific searches to see if the attached phosphates have
potential to form hydrogen bonds with the surrounding amino acids. One of the
two
tyrosine phosphates on MAb-chCC49Tyr showed the potential to form a hydrogen
bond (Table 1).
Models of MAb-chCC49-6P and phosphorylated MAb-chCC49-6P
The models of MAb-chCC49-6P and phosphorylated MAb-chCC49-6P are
shown in FIG. 7A and FIG. 9A, respectively. The systematic conformational
search
results are shown in Table 1. It could be seen that the searches corresponding
to
Ser470 (chain 1), Ser485 (chain 1) and Ser449 (chain 2) yielded about 50
conformations, much more than other searches on the same MAbs. But since the
PISA
recognition sites on MAb-chCC49-6P are also on the flexible C-terminus of the
MAb,
we did additional searches along the main chain of the MAb to see if more
conformations were allowed for the other attached phosphates. As seen from
Table 1,
all of the additional searches for MAb-chCC49-6P yielded much more
conformations
46
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
than the first-round searches.
We performed specific searches to see if the attached phosphates have
potential to form hydrogen bonds with the surrounding amino acids. Seven of
the
twelve serine phosphates on MAb-chCC49-6P showed the potential to form
hydrogen
bonds (Table 1 ).
f. Models of MAb-WW1 and phosphorylated MAb-WW1
The models of MAb-WWl and phosphorylated MAb-WW1 are shown in FIG.
7B and FIG. 9B. After phosphate groups were attached to serine residues
(Ser21) on
the PKA sites of MAb-WW1, the systematic conformational searches were done as
described herein to determine the conformations of the phosphate groups.
Search
results revealed that for MAb-WW l, phosphate groups attached to Ser21 of
heavy
chain 1 had thirteen conformations, but only one allowed conformation on heavy
chain 2 (Table 1). However since the PKA recognition sites on MAb-WWl are in
the
CHl region of the MAb, rather than in any of the flexible termini, no
additional
searches along the main chain of the MAb were allowed for the attached
phosphates.
We performed specific searches to see if the attached phosphates have
potential to form hydrogen bonds with the surrounding amino acids. None of the
serine phosphates on MAb-WW1 showed the potential to form a hydrogen bond
(Table 1).
g. Models of MAb-WW2 and phosphorylated MAb-WW2
The models of MAb-WW2 and phosphorylated MAb-WW2 are shown in FIG.
7C and FIG. 9C, respectively. After phosphate groups were attached to
threonine
residues (Thr224) on the PKA sites of MAb-WW2, the systematic conformational
searches were done as described herein. Similar results were obtained after
two
systematic searches. Twenty one and thirteen conformations were revealed after
two
searches. However, similar to MAb-WW1, since the PKA recognition sites on MAb-
WW2 are in the hinge region of the MAb, rather than in any of the flexible
termini, no
additional searches along the main chain of the MAb were allowed for the
attached
phosphates.
We performed specific searches to see if the attached phosphates have
47
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
potential to form hydrogen bonds with the surrounding amino acids. Several
conformations from both searches showed that the phosphate groups had the
potential
to form a hydrogen bond with the NH group of Thr224 (Table l, FIG. 12A).
h. Models of MAb-WW3 and phosphorylated MAb-WW3
The models of MAb-WW3 and phosphorylated MAb-WW3 are shown in FIG.
7D and FIG. 9D, respectively. After phosphate groups were attached to serine
residues (Ser21) on the PKA sites of MAb-WW3, the systematic conformational
searches were done as described herein. For MAb-WW3, after the search
corresponding to Ser21 (chain 1) was performed, nine conformations were
obtained.
Potential for hydrogen bond formation was observed (Table 1). Among these
conformations, we chose the one with the lowest energy (4127 lccal/mol), where
phosphate group can form a hydrogen bond with hydroxyl group on the side chain
of
Tyr80 (FIG. 12B) to do the conformational search corresponding to Ser21 (chain
2).
Results were similar to those obtained on the previous search. Similar to MAb-
WWl,
since the PKA recognition sites on MAb-WW3 are in the variable region of the
heavy
chain of the MAb, rather than in any of the flexible termini, no additional
searches
along the main chain of the MAb were allowed for the attached phosphates.
i. Models of MAb-WW4 and phosphorylated MAb-WW4
The models of MAb-WW4 and phosphorylated MAb-WW4 are shown in FIG.
7E and FIG. 9E, respectively. After phosphate groups were attached to
threonine
residues (Thrl7) on the PKA sites of MAb-WW4, the systematic conformational
searches were done as described herein. For MAb-WW4, the results obtained from
two systematic searches were very similar. Only two conformations were
obtained
from each search. Similax to MAb-WW1, since the PKA recognition sites on MAb-
WW4 are in the variable region of the light chain of the MAb, rather than in
any of
the flexible termini, no additional searches along the main chain of the MAb
were
allowed for the attached phosphates.
No hydrogen bond formation was observed between the phosphates on MAb
WW4 and any surrounding amino acid residues after two systematic searches
(Table
1).
48
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
j. Models of MAb-WWS and phosphorylated MAb-WWS
The models of MAb-WWS and phosphorylated MAb-WWS are shown in FIG.
7F and FIG. 9F. After phosphate groups were attached to serine residues
(Ser224) on
the PKA sites of MAb-WWS, the systematic conformational searches were
performed
as described herein. For MAb-WWS, similar results were obtained after two
systematic searches. Sixty-one conformations were revealed after the search
corresponding to Ser224 (heavy chain 1). The search corresponding to Ser224
(heavy
chain 2) yielded similar results as the previous one with fifty-seven
conformations
possible. Analysis of the conformations showed that the phosphate group of the
Ser224 of chain 1 had the potential to form a hydrogen bond with either NH
group on
Cys225 or Ser224 (Table l, FIG. 13A). In contrast, the phosphate group of the
Ser224
of chain 2 could only form a hydrogen bond with Ser224 (Table 1, FIG. 13B).
k. Models of MAb-WW6 and phosphorylated MAb-WW6
The models of MAb-WW6 and phosphorylated MAb-WW6 are shown in FIG.
7G and FIG. 9G. After phosphate groups were attached to serine residues
(Ser224) on
the PI~AA sites of MAb-WW6, the systematic conformational searches were
performed
as described herein. For MAb-WW6, similar results were obtained after two
systematic searches. Sixty-five conformations were revealed after the search
corresponding to Ser224 (heavy chain 1). The seaxch corresponding to Ser224
(heavy
chain 2) yielded fifty-four conformations. Analysis of the conformations
showed that
the phosphate group of the Ser224 of chain 1 had the potential to fornz a
hydrogen
bond with either NH group on Cys225 or Ser224 (Table 1, FIG. 14A). In
contrast, the
phosphate group of the Ser224 of chain 2 could only form a hydrogen bond with
Cys225 (Table 1, FIG. 14B).
1. Models of MAb-WW7 and phosphorylated MAb-WW7
The models of MAb-WW7 and phosphorylated MAb-WW7 are shown in FIG.
7H and FIG. 9H. After phosphate groups were attached to serine residues
(Ser224) on
the PISA sites of MAb-WW7, the systematic conformational searches were
performed
as described herein. For MAb-WW7, similar results were obtained after two
systematic searches. Sixty-four conformations were revealed after the search
49
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
corresponding to Ser224 (heavy chain 1). The search corresponding to Ser224
(heavy
chain 2) yielded fifty-six conformations. Analysis of the conformations showed
that
the phosphate group of the Ser224 of chain 1 had the potential to form a
hydrogen
bond with either NH group on Cys225 or Ser224 (Table 1, FIG. 15A). In
contrast, the
phosphate group of the Ser224 of chain 2 could only form a hydrogen bond with
Cys225 (Table 1, FIG. 15B).
m. Models of MAb-WW8 and phosphorylated MAb-WW8
The models of MAb-WW8 and phosphorylated MAb-WW8 are shown in FIG.
7I and FIG. 9I. After phosphate groups were attached to serine residues
(Ser224) on
the PKA sites of MAb-WW8, the systematic conformational searches were
performed
as described herein. For MAb-WWB, sixty-two conformations were revealed after
the
search corresponding to Ser224 (heavy chain 1). The search corresponding to
Ser224
(heavy chain 2) yielded thirty-nine conformations. Analysis of the
conformations
showed that the phosphate group of the Ser224 of chain 1 had the potential to
form a
hydrogen bond with either NH group on Cys225 or Ser224 (Table 1, FIG. 16A). In
contrast, the phosphate group of the Ser224 of chain 2 could form hydrogen
bonds
with NH groups on both Arg221 and His223 (Table 1, FIG. 16B).
3. Hypotheses
According to the systematic searches shown in Table 1, we observed that on
some constructs (MAb-chCC49I~1, MAb-CC49CKI, MAb-CC49CKII, MAb-
CC49Tyr, MAb-chCC49-6P, MAb-WWS, -WW6, -WW7 and -WW8), the attached
phosphate groups had much more allowed conformations than the others (MAb-
WW1, -WW2, -WW3 and -WW4). Since the more allowed conformations might
suggest easier accessibility of the enzymes to the recognition site, we
therefore
hypothesized that the greater the number of allowed conformations, the easier
accessibility of the enzymes to the recognition site, the more efficient the
phosphorylation. According to this hypothesis, we predicted that MAb-chCC49-
6P,
MAb-WWS, -WW6, -WW7 and -WW8 would be radiolabeled by PISA to a much
higher specific activity than the other mutant MAbs, MAb-WW1, -WW2, -WW3 and
-WW4.
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
Another phenomenon we noticed from Table 1 was that the phosphates on the
modified MAbs had different potentials to form hydrogen bonds with the
neighboring
amino acid residues. On some constructs (MAb-WW2, -WW3, -WWS, -WW6, -
WW7 and -WW8), all of the attached phosphates could form hydrogen bonds with
the
surrounding amino acid residues. However, on the other constructs, none or
only
some of the attached phosphates could form hydrogen bonds (MAb-chCC49Kl,
MAb-CC49CKI, MAb-CC49CKII, MAb-CC49Tyr, MAb-chCC49-6P, MAb-WW1
and MAb-WW4). Since formation of hydrogen bonds physically stabilizes the
phosphate moiety, we hypothesized that the greater the potential for hydrogen
bond
formation, the greater the resistance of the phosphate to hydrolysis. That is,
the
stronger the potential to form hydrogen bonds, the more stable the attached
32P would
be. In other words, the stability of the attached phosphate is compromised if
it camiot
form hydrogen bonds) with the neighboring amino acids. According to this
hypothesis, the stabilities of the phosphates on MAb-WW2, -WW3, -WWS, -WW6, -
WW7 and -WW8 would be greater than those on MAb-chCC49Kl, MAb-CC49CKI,
MAb-CC49CKII, MAb-CC49Tyr, MAb-chCC49-6P, MAb-WWl and MAb-WW4.
4. Construction of MAb-chCC49-6P, MAb-WWl, MAb-WW2, MAb-WW3,
MAb-WW4, MAb-WWS, MAb-WW6, MAb-WW7 and MAb-WW8
a. Construction of MAb-chCC49-6P
The plasmid pdHL7-CC49-6P (FIG. 17) that expresses MAb-chCC49-6P was
constructed by cloning two synthetic fragments K2 (FIG. 3) into the XmaI site
of the
expression vector pdHL7-CC49Kl . The details of the construction are described
herein.
b. Construction of MAb-WW 1
The plasmid pWWl that expresses MAb-WWl was constructed as shown in
FIGS. 18A and B. The details of the construction are described herein.
c. Construction of MAb-WW2
The plasmid pWW2 that expresses MAb-WW2 was constructed as shown in
FIGS. 19A and B. The details of the construction are described herein.
51
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
d. Construction of MAb-WW3
The plasmid pWW3 that expresses MAb-WW3 was constructed as shown in
FIGS. A, B and C. The details of the construction are described herein.
e. Construction of MAb-WW4
The plasmid pWW4 that expresses MAb-WW4 was constructed as shown in
FIGS. 21A and B. The details of the construction are described herein.
f. Construction of MAb-WWS
The plasmid pWWS that expresses MAb-WWS was constructed as shown in
FIGS. 22A and B. The details of the construction are described herien.
g. Construction of MAb-WW6
The plasmid pLgpCXIIHuWWS that expresses the heavy chain of the MAb-
WW6 was constructed as shown in FIGS. 23A and B. The details of the
construction
are described herein.
h. Construction of MAb-WW7
The plasmid pLNCXIIHuCC49HuKV5 that expresses the light chain of the
MAb-WW7 was constructed as shown in FIG. 24, and the plasmid
pLgpCXIIHuWW5V80CH2 that expresses the heavy chain of the MAb-WW7 in
FIG. 25. The details of the construction are described herein.
i. Construction of MAb-WW8
The plasmid pWWB that expresses the humanized MAb-WWS was
constructed as shown in FIG. 26A, B, C and D. The details of the construction
are
described herein.
5. Expression and purification of monoclonal antibodies
a. Expression and purification of MAb-chCC49-6P
Stable transfection of mouse myeloma NSO cells with expression vectors
pMAb-chCC49-6P was performed as described herein. The concentration of IgG
52
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
produced by the clone with highest expression was about 2 ~,g/ml as determined
by a
sandwich ELISA. The mutant MAb secreted in the 90 ml of supernatant was
purified
and concentrated as described herein. The final concentration of purified MAb
was
0.9 mg/ml as determined by ELISA.
b. Expression and purification of MAb-WW1
Stable transfection of mouse myeloma NSO cells with expression vectors
pMAb-WW 1 was performed as described herien. The concentration of IgG produced
by the clone with highest expression was about 40 ~,g/ml as determined by a
sandwich
ELISA. The mutant MAb secreted in the 500 ml of supernatant was purified and
concentrated as described herein. The final concentration of purified MAb was
5.3
mg/ml as determined by ELISA.
Expression and purification of MAb-WW2
Stable transfection of mouse myeloma NSO cells with expression vectors
pMAb-WW2 was performed as described herein. The concentration of IgG produced
by the clone with highest expression was about 18 ~,g/ml as determined by a
sandwich
ELISA. The mutant MAb secreted in the 150 ml of supernatant was purified arid
concentrated as described herein. The final concentration of purified MAb was
4.5
mg/ml as determined by ELISA.
d. Expression and purification of MAb-WW3
Stable transfection of mouse myeloma NSO cells with expression vectors
pMAb-WW3 was performed as described herein. The concentration of IgG produced
by the clone with highest expression was about 22 ~.glml as determined by a
sandwich
ELISA. The mutant MAb secreted in the 430 ml of supernatant was purified and
concentrated as described herein The final concentration of purified MAb was
0.9
mg/ml as determined by ELISA.
Expression and purification of MAb-WW4
Stable transfection of mouse myeloma NSO cells with expression vectoxs
pMAb-WW4 was performed as described herein. The concentration of IgG produced
by the clone with highest expression was about 7 ~,g/ml as determined by a
sandwich
53
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
ELISA. The mutant MAb secreted in the 290 ml of supernatant was purified and
concentrated as described herein. The final concentration of purified MAb was
35.2
mg/ml as determined by ELISA.
f. Expression and purification of MAb-WWS
The stable transfection of mouse myeloma NSO cells with expression vector
pMAb-WWS was performed as described herein. Clone #24, which expressed the
highest concentration of IgG, 10 ~.g/ml as determined by a sandwich ELISA, was
chosen for expansion and collection of supernatants. Before purification of
MAb-
WWS, supernatants from six 150 cm2 flasks were pooled. Purification of MAb-WWS
was performed as described herein. The concentration of purified MAb-WWS was
3.3
mg/ml as determined by ELISA. Then 10 ~,1 aliquots of purified MAb-WWS were
placed in 0.5 ml tubes and stored frozen at -20°C or below until use.
g. Expression and purification of MAb-WW6
The stable transfection of mouse myeloma NSO cells with expression vectors
pLNCXIIHuCC49HuK and pLgpCXIIHuWW50CH2 was performed as described
herein. Clone #24, which expressed the highest concentration of IgG, 2 ~,g/ml
as
determined by a sandwich ELISA, was chosen for expansion and collection of
supernatants. Before purification of MAb-WW6, supernatants from three 150 cm2
flasks were pooled. Purification of MAb-WW6 was performed as described herein.
The concentration of purified MAb-WW6 was 3.0 mg/ml as determined by ELISA.
Then 10 ~,l aliquots of purified MAb-WW6 were placed in 0.5 ml tubes and
stored
frozen at -20°C or below until use.
h. Expression and purification of MAb-WW7
The stable transfection of mouse myeloma NSO cells with expression vectors
pLNCXIIHuCC49HuKV5 and pLgpCXIIHuWW5V80CH2 was performed as
described herein. Clone #14, which expressed the highest concentration of IgG,
8
~g/ml as determined by a sandwich ELISA, was chosen for expansion and
collection
of supernatants. Before purification of MAb-WW7, supernatants from three 150
cm2
flasks were pooled. Purification of MAb-WW7 was perforned as described herein.
54
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
The concentration of purified MAb-WW7 was 2.0 mg/ml as determined by ELISA.
Then 10 ~,1 aliquots of purified MAb-WW7 were placed in 0.5 ml tubes and
stored
frozen at -20°C or below until use.
6. Characterazation of MAb-chCC49-6P, MAb-WWl, MAb-WW2, MAb-WW3,
MAb-WW4, MAb-WWS, MAb-WW6 and MAb-WW7, and 32P labeled MAbs
The purified modified MAbs were analyzed by SDS polyacrylamide gel
electrophoresis (SDS-PAGE). In the presence of mercaptoethanol, two bands, one
of
50 kDa (in the case of MAb-chCC49-6P, MAb-WW1, -WW2, -WW3, -WW4 and -
WW5), or 40 kDa (in the case of MAb-WW6 and MAb-WW7) and the other of 25
kDa were seen on the Coomassie brilliant-blue stained gel (Fig. 27 A-H). These
bands
corresponded to the heavy chain and the light chain of the modified MAbs,
respectively. The modified MAbs, MAb-chCC49-6P, MAb-WW1, -WW2, -WW3, -
WW4, -WWS, -WW6 and -WW7, were phosphorylated by the cAMP-dependent
protein kinase with [y-32P]ATP to specific radioactivities of 11126 Ci/mmol,
49
Ci/mmol, 35 Ci/mmol, 30 Ci/mmol, 7 Ci/mmol, 2895 Ci/mmol, 2380 Ci/mmol and
2837 Ci/mmol, respectively. After reduction with 2-mercaptoethanol followed by
SDS-PAGE, it was seen that the [3aP]MAb-chCC49-6P, [3~P]MAb-WWS, [32P]MAb-
WW6 and [32P]MAb-WW7 migrated as strong single bands at either 50 kDa, or 25
kDa shown by autoradiography, corresponding to the positions of the heavy
chains of
the MAbs on a Coomassie blue stained gel. However, the MAb-WW1, -WW2, -WW3
and -WW4 were barely labeled when compared to MAb-chCC49-6P, -WWS, -WW6
and -WW7. This confirmed our prediction in Section A.3 (Results, page 96) that
the
specific radioacitivities of MAb-chCC49-6P, -WWS, -WW6 and -WW7
phosphorylated by PISA would be much higher than those of the other mutant
MAbs
because of the fewer potential conformations available for the serine or
threonine of
their protein kinase recognition sites. Furthermore, it can be seen on the
autoradiographs that were overexposed for MAb-WW1, -WW2, -WW3 and -WW4
that the major band labeled was PI~AA, not the MAb.
7. Determination of immunoreactivities of [32P]MAb-chCC49-6P, [32P]MAb-
WWS, [32P]MAb-WW6 and [32P]MAb-WW7
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
a. Determination of immunoreactivity of [32P]MAb-chCC49-6P
The immunoreactivity of [32P]MAb-chCC49-6P was determined by direct
binding assay (Table 2). The binding result using BSM-coated plates for
[32P]MAb-
chCC49-6P was 66%. The nonspecific binding measured with the plates coated
with
PSM was less than 1%. The binding result using BSM-coated beads for [32P]MAb-
chCC49-6P was 95%. The nonspecific binding measured with the beads coated with
PSM was 4%.
b. Determination of immunoreactivity of [32P]MAb-WWS
The binding result using BSM-coated plates for [32P]MAb-WWS was 68%
(Table 2). The nonspecific binding measured with the plates coated with PSM
was
less than 1%. The binding result using BSM-coated beads for [32P]MAb-WWS was
94%. The nonspecific binding measured with the beads coated with PSM was 4%.
Determination of immunoreactivity of [32P]MAb-WW6
The immunoreactivity of [32P]MAb-WW6 was determined by direct binding
assay (Table 2). The binding result using BSM-coated plates for [32P]MAb-WW6
was
68%. The nonspecific binding measured with the plates coated with PSM was less
than 1%. The binding result using BSM-coated beads for [32P]MAb-WW6 was 95%.
The nonspecific binding measured with the beads coated with PSM was 3%.
d. Determination of immunoreactivity of [32P]MAb-WW7
The immunoreactivity of [32P]MAb-WW7 was determined by direct binding
assay (Table 2). The binding result using BSM-coated plates for [32P]MAb-WW7
was
68%. The nonspecific binding measured with the plates coated with PSM was less
than 1%. The binding result using BSM-coated beads for [32P]MAb-WW7 was 95%.
The nonspecific binding measured with the beads coated with PSM was 2%.
8. Determination of stabilities of [32P]MAb-chCC49-6P, [32P]MAb-WWS,
[3ap]MAb-WW6 and [32P]MAb-WW7 in sera
Stabilities of [32P]MAb-chCC49-6P, [32P]MAb-WWS, [32P]MAb-WW6 and
[3aP]MAb_WW7 in sera were determined. The stabilities of other mutant MAbs
56
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
(MAb-WW1, -WW2, -WW3 and -WW4) could not be determined since none of these
MAbs could be phosphorylated to high specificity. The consequence of this poor
phosphorylation of the MAbs was that PKA in the phosphorylation assays got
radiolabeled substantially (FIGS. 27B-E) so stability assays of these
reactions
reflected mostly the stability of the labeled PKA.
a. Determination of stability of [32P]MAb-chCC49-6P in sera
The percentage of [32P]phosphate remaining on the [32P]MAb-chCC49-6P was
determined by comparing the radioactivity at different time points to that of
the initial
value in buffer and various sera (Table 3 and FIG. 28). It can be seen that
about 91-
93% of the phosphate remained stably attached to the MAb after 24-hour
incubation
in buffer, fetal bovine, human and mouse serum.
b. Determination of stability of [32P]MAb-WWS in sera
The percentages of 32P radioactivity remaining on the MAb at different time
points were determined by comparing it with that of the initial values of the
[32P]MAb. It showed that aftex 24 hr incubation in buffer, fetal bovine, human
and
mouse serum, at least 99% of the phosphate remained stably attached to the
MAbs
(Table 4, FIG. 29). Even after a five-day incubation in the above buffer and
sera,
more than 95% of the radioactivity remained attached to the MAb (Table 4, FIG.
30).
We also measured a 21-day incubation of [3aP]MAb-WWS in the buffer. More than
93% of the radioactivity remained attached to the MAb after 21 days at
37°C (Table 5,
FIG. 31).
This was consistent with our prediction in Section A.3 (Results, page 96) that
the stabilities of the phosphates on MAb-WWS would be greater than those on
MAb-
chCC49K1, MAb-CC49CKI, MAb-CC49CHII, MAb-CC49Tyr and MAb-chCC49-
6P.
c. Determination of stability of [32P]MAb-WW6 in sera
The percentages of 32P radioactivity remaining on the MAb at different time
points were determined by comparing it with that of the initial values of the
[3aP]MAb. It showed that after 24 hr incubation in buffer, fetal bovine, human
and
57
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
mouse serum, at least 99% of the phosphate remained stably attached to the
MAbs
(Table 6, FIG. 32). Even after a five-day incubation in the above buffer and
sera,
more than 95% of the radioactivity remained attached to the MAb (Table 6, FIG.
33).
We also measured a 21-day incubation of [32P]MAb-WW6 in the buffer. More than
94% of the radioactivity remained attached to the MAb after 21 days at
37°C (Table 5,
FIG. 34).
d. Determination of stability of [32P]MAb-WW7 in sera
The percentages of 32P radioactivity remaining on the MAb at different time
points were determined by comparing it with that of the initial values of the
[32P]MAb. It showed that after 24 hr incubation in buffer, fetal bovine, human
and
mouse serum, at least 99% of the phosphate remained stably attached to the
MAbs
(Table 7, FIG. 35). Even after a five-day incubation in the above buffer and
sera,
more than 95% of the radioactivity remained attached to the MAb (Table 7, FIG.
36).
We also measured a 21-day incubation of [32P]MAb-WW7 in the buffer. More than
93% of the radioactivity remained attached to the MAb after 21 days at
37°C (Table 5,
FIG. 37).
III. DISSCUSSION
Design and construction of phosphorylatable monoclonal antibodies with
highly stable phosphates with the aid of molecular modeling
Although 3aP has been considered a useful radioisotope for
radioimmunotherapy with several ideal characteristics, its utilization for
labeling of
MAbs was limited because there were no simple labeling procedures applicable.
However, this problem has been overcome, and a labeling procedure which proved
to
be simple, efficient and applicable to virtually any protein has been
developed. The
phosphorylatable MAbs (MAb-chB72.3-P, MAb-chCC49I~1, MAb-chCC49CKI,
MAb-chCC49CKII and MAb-chCC49Tyr) were created by inserting the predicted
consensus sequences for phosphorylation by the cAMP-dependent protein lcinase
and
other protein kinases at the carboxyl terminus of the heavy chain constant
region of
MAb-chB72.3-P or MAb-chCC49. These MAbs were purified and could be
phosphorylated by the appropriate protein lcinase with ['y 32P]ATP to high
specific
58
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
activity. These [32P]MAbs bound to cells expressing TAG-72 antigens with high
specificity.
However, it was found that in the first generation of phosphorylatable
antibodies, the attached 32P was not sufficiently stable in buffer or serum to
be useful
for in vivo application in animals and humans. Several methods were suggested
to
improve the stabilities of the phosphorylatable MAbs. Since RRX(S/T) is a PKA
recognition site, it was believed that by changing the amino acid residue X or
the
amino acid residues downstream of this site, the stability of the
phosphorylatable
MAbs could be changed. It was also believed that using threonine, instead of
serine,
in the PKA recognition site could increase the stability of the
phosphorylatable Mabs,
although this would compromise the efficiency of the phosphorylation
dramatically.
Alternatively, the stability of the phosphorylatable MAbs might also be
changed if
other phosphorylation enzymes were used. In this thesis, molecular modeling is
used
to locate phosphorylation sites in MAb-chCC49 that would be more resistant to
hydrolysis. Because molecular modeling is a powerful tool for the prediction
of the
three dimensional structure of proteins, it was applied to make precise
predictions to
optimize the choice of the position of the protein kinase recognition site and
improve
the stability of the attached phosphates.
1. Design of phosphorylatable monoclonal antibodies with highly stable
phosphates with the aid of molecular modeling
a. Choice of Site for Introduction into MAb-chCC49
The sites for introduction of the cAMP-dependent protein lcinase recognition
sites were chosen using following criteria: (1) Since the consensus sequence
for
cAMP-dependent protein kinase is Arg-Arg-X-Ser/Thr, the sites with a maximum
number of these four residues were investigated and chosen so that minimal
modification of the original MAb structure would occur. (2) The sites in the
complementarity-determining regions (CDR) were avoided. The CDR region on
MAb-chCC49 is defined. This region is the portion of the MAb variable domain
which binds to antigen, so any modification of these sites might change the
binding
affinity or specificity of the MAb. (3) The site would be accessible to the
protein
59
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
kinase. This was accomplished by visual analysis of the 3D molecular structure
of
MAb-chCC49.
By following the first criterium, twelve sites in the whole MAb-chCC49
molecule were found for introduction of PKA site. Evaluation of 3D models of
these
putative mutant Abs and model of MAb-chCC49 suggested that not all these sites
were good for site-directed mutagenesis (Table 8). First, analysis of the MAb-
chCC49
model revealed that four out of twelve potential sites (site 5, 6, 8, 9) were
buried.
Furthermore, it was showed by molecular modeling that introduction of arginine
residues into these sites would cause severe steric problems in the structure
of the
MAb-chCC49 molecule (Table 8). These sites, therefore, were excluded for
further
consideration. The rest of the sites were examined to see if the mutations of
the sites
would change the CDR regions of MAb-chCC49 as described. Site 11 was excluded
since all four amino acid residues in the PKA recognition site are in the CDR2
region
of the light chains of MAb-chCC49. Mutations of some amino acid residues (e.g.
Cys320 in site 6, and Pro117 in site 12) were also avoided since these
residues might
play critical roles in maintaining proper structure of the MAb. Those possible
mutants, which did not show the obvious problems of the above lcinds, were
eventually chosen (three sites on the heavy chain and one site on the light
chain) for
the further work.
b. Choice of template for modeling MAb-chCC49
Before MAb-chCC49 was modeled, questions arose as to which structure
could be used as template. Although the structures of intact MAbs have been a
subject
of great interest for many years, due to the intrinsic mobility and segmental
flexibility
of antibodies, it is extremely difficult to get the crystal structure of an
intact antibody.
So far crystal structures of only two intact MAbs have been solved. One is
MAb231, a
mouse IgG2a MAb against canine lymphoma cells. While the other is MAb61.1.3, a
marine IgGl MAb against phenobarbital. Since one site chosen to introduce
mutations was in the hinge region of the MAb, it was decided to use the
crystal
structure of the intact MAb as template. Evaluation of the crystal structures
of these
two intact MAbs revealed the relative position of the Fab, hinge and Fc
regions. In
addition, both showed an overall asymmetry, which might manifest a
considerable
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
degree of intrinsic mobility and segmental flexibility of the antibodies.
Other
structural features of the two MAbs though, were quite different. The IgGl has
a
distorted yet compact Y shape, whereas IgG2a has a more extended T shape. This
difference may well reflect different amino acid residues in their hinge
regions. The
hinge of IgG2a which has 23 amino acids is longer than that of IgG1 by six
amino
acids, three in the upper hinge region and three in the lower hinge region.
The overall
sequence comparisons performed with the Bestfit Program in the GCG package
(Wisconsin Package Version 10, Genetics Computer Group (GCG), Madison, Wisc.)
indicated that IgGl shares a little more sequence homology with MAb-chCC49
than
does IgG2a. The results demonstrated that the light chain sequences of
MAb61.1.3
(IgGl) and MAb-chCC49 share 65% identity and 72% similarity, whereas that of
MAb231 (IgG2a) and MAb-chCC49 share 63% identity and 70% similarity; and that
the heavy chain sequences of IgGl and MAb-chCC49 show 64% identity and 74%
similarity, whereas IgG2a and MAb-chCC49 show 60% identity and 68% similarity.
However, when sequences of the hinge regions were used to do the comparison,
it
was found that the hinge of MAb-chCC49 resembles more that of MAb231 in terms
of both length and amino acid sequence than that of MAb61.1.3 (FIG. 38). Lilce
MAb231, MAb-chCC49 also has a long hinge, only one amino acid less than that
of
MAb231, suggesting that it might take on a similar extended structure as
MAb231.
MAb231 and MAb-chCC49 also share substantial sequence identity (about 90%), in
both core and lower hinge regions. On the other hand, MAb-chCC49 and MAb61.1.3
do not resemble each other in this region. Compared to MAb-chCC49, MAb61.1.3
has a much shorter hinge. Sequence alignment also showed that they have
relatively
very low homology in this region. Since two of the mutant MAbs would have a
phosphorylation site in the hinge region, it was decided to continue to use
MAb231 as
template to model the entire MAb-chCC49 molecule.
c. Molecular modeling protocol
A protocol was developed to build the models of the modified MAbs. Since
the phosphate group is a large group, structural distortion may result from
its
attachment to serine or threonine residues of the MAb. To verify this
possibility, the
phosphate groups were attached to the serine or threonine residues at the PKA
61
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
recognition sites of the MAb after the models of the mutant Mabs were built.
In
addition, systematic conformational searches were conducted to analyze all
possible
confornlations the MAb would adopt after the attaclnnent of the phosphate
groups.
The results showed that introduction of phosphate groups would not change the
structures of the mutant MAbs significantly.
2. Construction of phosphorylatable monoclonal antibodies with highly stable
phosphates
a. In vitro work
Since the goal was to make stable radiolabeled MAbs for in vivo utilization,
the stability profiles of the phosphorylatable Mabs was examined. Some of the
modified MAbs (MAb-WWS, MAb-WW6, and MAb-WW7) showed superior
stability in all the sera and the buffer tested. Compared to [32P]MAb-chCC49K1
and
[3aP]MAb-chCC49-6P, where about 93%-96% of the phosphates remained stably
attached to the MAbs after 24 hours incubation in buffer and different sera,
the
stabilities of the phosphate of [32P]MAb-WWS, [32P]MAb-WW6 and [32P]MAb-
WW7 showed significant improvement (FIG. 39). After 24-hour incubation in the
same buffer or sera as [32P]MAb-chCC49K1 and [32P]MAb-chCC49-6P, more than
99% of the phosphates remained stably attached to MAb-WWS, MAb-WW6 and
MAb-WW7 whereas there was significant hydrolysis of the phosphate from
[32P]MAb-chCC49K1 where the protein lcinase recognition site was fused to the
C-
terminus. Even after a 21-day incubation in buffer or sera, there was still
more than
93% of the radioactivity attached to the MAbs. Thus, the phosphoserine
(Ser224) in
these new constructs is highly resistant to hydrolysis.
b. In vivo work
The in vivo studies, plasma clearance (FIG. 40) and biodistribution (Table 9),
of both [3aP]MAb-WWS and [32P]MAb-chCC49Kl were performed. As seen from
FIG. 38, more than 90% of [32P]MAb-chCC49K1 was cleared from blood by six
hours, however only about 70% of [32P]MAb-WWS was cleared from the blood by
the same time. This data demonstrated that [32P]MAb-WWS showed much more
improved stability over [32P]MAb-chCC49Kl in plasma clearance assay.
62
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
Compared to [32P]MAb-chCC49K1, [32P]MAb-WWS also showed much
improved tumor localization. At all time points, [32P]MAb-WWS accumulated in
significantly higher amount in tumor than those in all the other organs. The
amount of
[saP]MAb-chCC49K1 accumulated in tumor was no significantly higher than those
in
other organs. [32P]MAb-WWS even showed comparable, ifnot better, tumor
localization than [lasl]MAb-chCC49 and [I3iI]MAb-chCC49, which has already
undergone a phase II clinical trial in patients with breast cancer. It can be
seen in
Table 8 that at 24 hour time point, about two times of [l2sI]MAb-chCC49 and .
[i3ll]MAb-chCC49 were accumulated in spleen than in tumor, however, for
[32P]MAb-WWS, the ratio was the opposite.
These ih vivo studies demonstrated that MAb-WWS has great potential to be
used in diagnosis and therapy of adenocarcinomas.
3. Hypotheses of the relationship between the models, stabilities of the
phosphates on the MAbs and phosphorylation efficiencies of the phosphorylation
sites.
After generating the models of the phosphorylatable MAbs with and without
attached phosphates, two interesting phenomena were observed. First, the
attached
phosphates on some constructs (MAb-chCC49Kl, MAb-CC49CKI, MAb-CC49CKII,
MAb-CC49Tyr, MAb-chCC49-6P, MAb-WWS, MAb-WW6 and MAb-WW7) had
much mare allowed conformations than those on some other mutant MAbs (MAb-
WW1, -WW2, -WW3 and -WW4). Thus, it was hypothesized that the greater the
number of allowed conformations, the easier accessibility of the enzymes to
the
recognition site, the more efficient the phosphorylation of the MAb. According
to this
hypothesis, it was predicted that MAb-chCC49-6P, MAb-WWS, -WW6 and -WW7
would be radiolabeled by PKA to much higher specific activities than the other
mutant MAbs (MAb-WW 1, -WW2, -WW3 and -WW4). This prediction was
confirmed by phosphorylation assays of the modified MAbs. The MAb-chCC49-6P,
MAb-WWS, -WW6 and -WW7 were phosphorylated by PKA with [~ 3aP]ATP to
specific radioactivities of 11,126 Ci/mmol, 2895 Ci/mmol, 2380 Ci/mmol and
2837
Ci/mmol, respectively. However, the mutant MAbs, MAb-WW1, -WW2, -WW3 and -
WW4, were barely phosphorylated by PKA to specific radioactivities less than
49
63
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
Ci/mmol, 35 Ci/mmol, 30 Ci/mmol and 7 Ci/mmol, respectively.
Second, the phosphates on the modified MAbs constructed had different
potentials to form hydrogen bonds with the neighboring amino acid residues. On
some constructs (MAb-WW2, -WW3, -WWS, -WW6 and -WW7) (Table 1), all of the
attached phosphates could form hydrogen bonds with the surrounding amino acid
residues. However on the other constructs, none or only some of the attached
phosphates could form hydrogen bonds, the others could not (MAb-WW1, MAb-
WW4, MAb-chCC49K1, MAb-CC49CKI, MAb-CC49CKII, MAb-CC49Tyr and
MAb-chCC49-6P). Since formation of hydrogen bonds physically defines where
surrounding residues can ineract with the phosphate moiety, it was
hypothesized that
hydrogen bonds could serve as surrogate markers for regions where the
phosphate
could be protected from hydrolysis. The hydrogen bond itself, other factors
being
identical, should make the phosphate residue more susceptible to hydrolysis.
However, as a surrogate marker for protected regions, the greater the
potential for
hydrogen bond formation, the greater the resistance of the phosphate to
hydrolysis.
That is, the stability of the attached phosphate is enhanced if the phosphate
is
protected by surrounding residues from attack by hydroxyl groups by charge
interactions ox by a hydrophobic environment, for example. According to this
hypothesis, the stabilities of the phosphates on MAb-WW2, -WW3, -WWS, -WW6
and -WW7 would be greater than those on MAb-WW1, MAb-WW4, MAb-
chCC49K1, MAb-CC49CKI, MAb-CC49CKII, MAb-CC49Tyr and MAb-chCC49-
6P. This prediction was confirmed by comparing the stabilities of
phosphorylated
MAb-WWS, -WW6 and -WW7 with those of MAb-chCC49K1, MAb-CC49CKI,
MAb-CC49CKII, MAb-CC49Tyr and MAb-chCC49-6P. [3aP]MAb-WWS,
[32P]MAb-WW6 and [3aP]MAb-WW7 were very stable in all the sera and the buffer
tested.
The hypothesis could not be tested with other phosphorylated mutant MAbs
(MAb-WW1, -WW2, -WW3 and -WW4), since none of these MAbs could be
phosphorylated significantly. In these cases, there was low phosphorylation of
the
MAbs but PKA became radiolabeled substantially.
Another line of evidence that supports the hypothesis was the study of the
64
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
structure of PKA. PKA has endogenous phosphates attached to Thr197 and Ser338
of
the enzyme (FIG. 41). The phosphates on Thr197 and Ser338 form six and four
hydrogen bonds, respectively (FIG. 42 and FIG. 43). Both Thr197 and Ser338
containing the recognition motifs RTWT and RVS, respectively, are not readily
phosphorylated. The phosphates are highly stable because they remain attached
after
extensive purification of the protein and during the entire crystallation
process. Such a
phosphate recognition site internal to the protein would not be convenient for
labeling
a MAb efficiently. Thus, for labeling Mabs, a site has been judicially sought
that is
readily accessible to the enzyme, but still has sufficient opportunity for
hydrogen
bonding to be in a protected region. Alternatively, if a protein could be
unfolded, then
phosphorylated and refolded efficiently, this could be a useful strategy.
However, this
would not be practical for MAbs or other proteins. The data describing the
stability of
the phosphates on Thrl97 and Ser338 together with our data describing the
stability
of the phosphates on MAb-WWS, -WW6 and -WW7 supports the hypothesis that
hydrogen bond interaction of the phosphates with the surrounding amino acids
defines
regions of protection that contribute to the stabilities of the attached
phosphates on the
proteins.
4. Summary
The results demonstrate that molecular modeling can be used effectively to
design phosphorylation sites with optimal characteristics to enable excellent
phosphorylation and to minimize hydrolysis of the phosphate. Such monoclonal
antibodies should prove to be very useful in diagnosis and therapy of cancer.
IV. CONCLUDING SUMMARY
Radiolabelled monoclononal antibodies against tumor-associated antigens
(TAA) are used clinically for detection, staging and therapy of cancers. To
develop
more effective radiolabeled monoclonal antibodies, recognition sites were
introduced'
for the cAMP-dependent protein kinase into MAb-chCC49 by site-directed
mutagenesis of the coding sequence. Molecular modeling was used to locate
appropriate regions for introduction of the cAMP-dependent phosphorylation
sites, to
construct variants of MAb-chCC49 without changing their immunoreactivity or
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
biological properties, and to define sites where the attached phosphates would
be
particularly stable and the phosphorylation site would be accessible to the
enzyme.
Four sites on the heavy chain and one on the light chain were chosen. Vectors
expressing the mutant MAbs were constructed and transfected into mouse myeloma
NSO cells that expressed a high level of the resultant mutant MAbs. Some of
the
mutant MAbs, MAb-WWS, MAb-WW6 and MAb-WW7, which contained the
cAMP-dependent phosphorylation site at the hinge region of the heavy chain,
can be
phosphorylated by the catalytic subunit of cAMP-dependent protein kinase with
['y-
3aP]ATP to high specific activity and retains the phosphate stably. Compared
to MAb-
chCC49I~1, another phosphorylatable variant of MAb-chCC49, the phosphate
attached to lVIAb-WWS, -WW6 and -WW7 showed much improved stability: about a
ten-fold increase in resistance to hydrolysis. This was proved by both ih
vitro and i~
vivo studies. MAb-WWS, -WW6 and -WW7 exhibited high binding specificity to the
TAG-72 antigen.
1 S The models of the mutant monoclonal antibodies with or without attached
phosphates demonstrated that the resistance of the phosphate to hydrolysis
correlated
with the potential for hydrogen bonding interaction of the phosphorylated
serine or
threonine sites. The more the potential for the hydrogen bond formation, the
more
stable was the phosphate on the phosphorylated monoclonal antibodies due to
the
environment surrounding the phosphate. In addition, the more conformations
allowed
for the attached phosphate groups on the MAb, the more accessible was the PISA
recognition site to the enzyme, making radiolabeling of the MAb by the PKA
more
efficient. These general theses provide a foundation to construct
phosphorylation sites
on monoclonal antibodies and other proteins where the MAbs and proteins could
be
radiolabeled to high specific activity and the attached phosphates would be
resistant to
hydrolysis. Monoclonal antibodies with such sites labeled with [32P]phosphate
would
be excellent candidates for therapy of various malignancies.
EXAMPLE 2
Example 2 is intended to compare the stabilities of phosphorylated
monoclonal antibodies with engineered phosphorylated sites.
66
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
I. MATERIALS and METHODS
In the present study, the SYBYL molecular modeling package (version 6.5;
Tripos Association, St. Louis, MO, 1999) was used for structural analysis and
geometry refinement. Most of the homology and mutant modeling was performed
with the LOOK 3.5 program (Molecular Application Group, Palo Alto, CA). For
the
geometry optimization, Kollman united charges, molecular mechanics force field
and
the MAXIMIN2 minimizer of SYBYL were used. All these visualization analyses
and
simulations were performed on Silicon Graphics Octane workstations.
1. Template
The crystal structure of the intact MAb231, was used as template to model
MAb-chCC49. These coordinates are now available from the Polypeptide Data Bank
(PDB) as ID l IGT. Because the crystal structure of MAb231 was previously the
only
one available for an intact antibody, MAb231 was used as the template for
modeling
in this study. In addition, after the crystal structure of MAb61.1.3 was
reported, the
length and sequence of the hinge region of MAb231 was noted as being more
similar
to the hinge region of MAb-chCC49 than that of MAb61. l .3. The resulting
model of
MAb-chCC49 was then used as template to model the MAb-chCC49 mutant.
2. Modeling MAb-chCC49
Overall procedure. The model of MAb-chCC49 was built with the homology
modeling module of the LOOK3.5 program. After the coordinates of IgG2a MAb231
were obtained, the structure of MAb231 was used as template to develop a
molecular
model of MAb-chCC49. First of all, the four chains of MAb231 were separated
individually and designated as L1, L2, H1, and H2 (L for light chain and H for
heavy
chain). The coordinates of each chain were extracted and saved separately. The
strategy used to build a model of MAb-chCC49 was to do homology modeling on
each chain of MAb-chCC49, separately. The 3-D structure of chain Ll of MAb231
was first displayed, then the sequence of the light chain of MAb-chCC49 was
introduced into the program and the automatic alignment mode was set up to
align the
sequence of the MAb-chCC49 light chain with that of the sequence of MAb231
light
chain. The model was built with the program module SEGMOD under the automated
method with full refinement. The coordinates of chain L1 of MAb-chCC49 were
67
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
thereafter generated and saved as a PDB file. The models and coordinates of
chains
L2, H1, and H2 of MAb-chCC49 were generated by the same procedure as described
above.
Geometry refinement and ev~ergy mihimization. Further geometry refinement
and optimization was done with SYBYL molecular modeling software. The 3-D
structure of chain L1 of MAb-chCC49, the coordinates of which were generated
as
described above, was displayed. Essential hydrogen atoms (hydrogen atoms
attached
to nitrogen, oxygen, and/or sulfur atoms that could potentially be involved in
hydrogen binding with surrounding atomslresidues) were added. In the first
step, the
side chain was scanned to minimize conformational strains, if any, within side
chain
groups and surrounding residues. Proline is the only residue that contains a
ring in its
backbone and it adopts a phi angle close to 70 . Therefore, the "fix-proline"
conunand
in SYBYL was used to maintain proline geometry. The orientations of the amide
groups of Asn and Gln were scanned to favor potential hydrogen bonding with
surrounding residues. Finally, the Kollman united charges were loaded on chain
Ll so
that the electrostatic contribution in the energy calculation could be
included. The 3-D
structures of chain L2, H1, H2 were geometrically refined and optimized by the
same
procedure as used for chain Ll. Then the refined models of chains L1, L2, Hl,
and H2
of MAb-chCC49 were merged into a single molecule. Afterwards, the side chains,
as
well as the amide groups of Asn and Gln, were fixed to relax the strain in the
composite molecule.
Since MAb-chCC49 is a large polypeptide, the energy minimization step was
broken into two parts. Before energy minimization of the whole molecule, the
minimization of the side chains ws caxried out first. The backbone was used by
making it an aggregate set. Then energy minimization of the side chains was
achieved
with the Kollman united force field option for 100 iterations. In the next
step, the
aggregate was deleted, and energy minimization of the whole molecule was done
by
the Powell method in the SYBYL program.
3. Choice of Site for Introduction into MAb-chCC49
The site for introduction of the cAMP-dependent polypeptide kinase
recognition site was chosen to have several properties. It would not be in the
CDR
68
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
region of the MAbs; introduction of the kinase recognition site would require
no more
than three amino acid changes; the site would be accessible to the polypeptide
kinase.
This was accomplished by the programs above as described in detail in
"Results"
section.
4. Modeling mutant MAbs and mutant [32P]MAbs
This procedure was similar to modeling of MAb-chCC49. Briefly, each chain
of the mutant MAb was homology modeled by using the corresponding chain of
MAb-chCC49 as template. Geometry refinement and optimization, and energy
minimization of the modeled mutant MAbs was carried out in the same way to
obtain
the refined model of MAb-chCC49.
After the model of the mutant MAb was obtained, a phosphate group was
generated and attached to the hydroxyl group of SerlThr in the PKA recognition
site
by using 'builder' module of the SYBYL modeling paclcage. For WW1, the
phosphate
group was attached to Ser 123; for WW2, to Thr 224; for WW3, to Ser 21; for
WW4,
to Thr 20. To obtain the optimal position and to generate favorable
interaction with
surrounding residues by the phosphate moiety, the systematic conformational
search
along C -C and C -C of Ser/Thr in the PKA recognition site was performed. The
conformation of the Ser/Thr side chain in which phosphate moiety was
stabilized
through hydrogen bonding was chosen. Then minimization subset (only four amino
acid residues in the PKA recognition site, RRXS/T were chosen) was done for
100
iterations by the Powell method.
5. Construction of vectors for expression of mutant polypeptides
The vector pdHL7-CC49K1 for expression of the phosphorylatable
monoclonal antibody (MAb-chCC49Kl) with two CAMP-lcinase recognition sites on
each heavy chain was modified as follows to construct site-specific mutations
to
introduce phosphorylation sites in various positions of MAb-CC49. To construct
the
expression vector for MAb-chCC49 without the phospholcinase recognition site,
first
of all, an intermediate vector pdHL7-BH was made so that one of two XhoI
restriction
sites in pdHL7-CC49K1 could be removed. To construct pdHL7-BH, the vector
pdHL7-CC49K1 was digested with BamHI and HindIII restriction endonucleases.
The
resultant 6854 by fragment was isolated by agarose gel electrophoresis, then
purified,
69
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
blunt-ended, and self ligated to generate intermediate vector pdHL7-BH. To
construct
pdHL7-CC49, a 358 by fragment was amplified from pdHL7-CC49K1 by PCR with
the 5' and 3' primers GTGACCGCTGTACCAACCTCTGTCC, SEQUENCE ID NO.
26 and CCCTCGAGTCA-CTTGCCCGGGGACAGGGAGAGG, (SEQUENCE ID
NO. 27) respectively. This PCR fragment was then digested with Bs~GI and XhoI
restriction endonucleases, and purified. The vector pdHL7-BH was digested with
the
same restriction endonucleases and a 6463 by fragment was released, purified
and
ligated to the digested and purified 358 by PCR fragment. The resultant
plasmid
pdHL7-CC49BH was then digested with XmaI and EcoRI restriction endonucleases,
and yielded two bands. The smaller band, which was 2726 bp, was isolated and
purified, then further ligated to the 6667 by fragment which was isolated and
purified
after pdHL7-CC49K1 was digested with the same restriction endonucleases. The
resultant construct pdHL7-CC49 was characterized by Bs~GI and XhoI restriction
endonuclease digestion and DNA sequencing.
To construct plasmid pWW 1, the vector pdHL7-CC49 was digested with
HihdIII and PstI restriction endonucleases to isolate a 890 by fragment. The
fragment
was isolated by agarose gel electrophoresis, then purified. The replicative
form (RF)
DNA of phage M13mp18 was digested with HindIII and PstI restriction
endonucleases and the laxge DNA fragment isolated. The 890 by fragment was
then
inserted into the HindIII and PstI site of the Ml3mpl8 DNA to yield plasmid
pMl3-
W21. Then site-directed mutagenesis was performed as described. Briefly, pMl3-
W21 was introduced into the Escherichia coli CJ236 strain, which is a dut, ung
strain
and lacks the enzyme uracil N-glycosylase which normally removes uracil from
DNA. This results in incorporation of uridine in the DNA. Then single-stranded
(SS)-
DNA containing uridine from phage M13-W21 was used as template for site-
directed
mutagenesis to prepare the mutant M13-WW1. The oligodeoxynucleotide m120, 5'-
GCAGCCTCCACCAGGCGCCCA-TCGGTC-3', (SEQUENCE ID NO. 28) was
used for site-directed mutagenesis. Oligonucleotide m120 contains a
phosphokinase
recognition site RRPS and also a Na~I recognition site. Oligonucleotide m120
was
annealed to uridine-containing SS-DNA of Ml3-WW21, followed by the ih vit~~o
synthesis of the complementary strand. Afterwards, the resultant double-
stranded
(DS) DNA was transformed into E. coli DHS F' strain with a functional uracil N-
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
glycosylase to remove the parental strand. The desired mutant was
characterized by
Na~I restriction endonuclease digestion and DNA sequencing. Thus we obtained
the
construct M13-WWl. Then RF-DNA of M13-WW1 was digested with HindIII and
BstEII restriction endonucleases, and the resultant 410 by fragmeht was
inserted into
the vector pCC49 that was digested with the same endonucleases to yield
plasmid
pWWl. The vector pWWl expresses the MAb-WW1 with amino acid substitutions
K120R and G121R in the MAb-CC49 heavy chain.
To construct plasmid pWW2, the vector pCC49 was digested with HindIII and
NaeI restriction endonucleases to isolate a 1424 by fragment. The fragment was
isolated by agarose gel electrophoresis, then purified. The replicative form
(RF) DNA
of phage Ml3mpl9 was first digested withXbal restriction endonuclease, then
blunt-
ended by Klenow fragment of DNA polymerase. Afterwards, this DNA was further
digested with HihdIII restriction endonuclease, and the large DNA fragment was
isolated. The 1424 by fragment was then inserted into the XbaI blunt-ended and
HindIII site of the M13mp19 DNA to yield phage M13-W22. Then site-directed
mutagenesis was performed as described. Briefly, pMl3-W22 was introduced into
the
E. coli CJ236 strain, which is a dut, ung strain and lacks the enzyme uracil N-
glycosylase which normally removes uracil from DNA. This results in
incorporation
of uridine in the DNA. Then single-stranded (SS)-DNA containing uridine from
phage M13-W22 was used as template for site-directed mutagenesis to prepare
the
mutant M13-WW2. The oligodeoxynucleotide m221rev, 5'-
GGGCATGTGTGACGTCTGTCACAAGATTTG-3', (SEQUENCE ID NO. 29) was
used for site-directed mutagenesis. Oligonucleotide m221rev contains a
phosphokinase recognition site RRHT and also a AatII recognition site.
Oligonucleotide m221rev was annealed to uridine-containing SS-DNA of M13-
WW22, followed by the in vitro synthesis of the complementary strand.
Afterwards,
the resultant double-stranded (DS) DNA was transformed into E. coli DH5 F'
strain
with a functional uracil N-glycosylase to remove the parental strand. The
desired
mutant was characterized by AatII restriction endonuclease digestion and DNA
sequencing. Thus the construct M13-WW2 was obtained. Then RF-DNA of M13-
WW2 was digested with SacII restriction endonuclease, and the resultant 410 by
fragment was inserted into the vector pCC49 that was digested with the same
71
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
endonuclease to yield plasmid pWW2. The vector pWW2 expresses the MAb-WW2
with amino acid substitutions K221 R and T222R in the MAb-CC49 heavy chain.
To construct plasmid pWW3, the vector pCC49 was digested with Hiv~dIII and
SnaBI restriction endonucleases to isolate a 708 by fragment. The fragment was
isolated by agarose gel electrophoresis, then purified. The replicative form
(RF) DNA
of phage M13mp19 was first digested withXbaI restriction endonuclease, then
blunt-
ended by Klenow fragment of DNA polymerase. Afterwards, this DNA was further
digested with HindIII restriction endonuclease, and the large DNA fragment was
isolated. The 708 by fragment was then inserted into the XbbaI blunt-ended and
HihdIII site of the M13mp19 DNA to yield phage M13-W23. Then site-directed
mutagenesis was performed as described. Briefly, pMl3-W23 was introduced into
the
E. coli CJ236 strain, which is a dut, uhg strain and lacks the enzyme uracil N-
glycosylase which normally removes uracil from DNA. This results in
incorporation
of uridine in the DNA. Then single-stranded (SS)-DNA containing uridine from
phage M13-W23 was used as template for site-directed mutagenesis to prepare
the
mutant M13-WW3. The oligodeoxynucleotide ml8rev, 5'-
CCTGGGGCTTCGCGAAGGATTTCCTGCAAGG-3', (SEQUENCE ID NO. 30)
was used for site-directed mutagenesis. Oligonucleotide ml8rev contains a
phosphokinase recognition site RRIS and also a N~uI recognition site.
Oligonucleotide ml8rev was annealed to uridine-containing SS-DNA of M13-WW23,
followed by the in vitro synthesis of the complementary strand. Afterwards,
the
resultant double-stranded (DS) DNA was transformed into E. coli DHS F' strain
with
a functional uracil N-glycosylase to remove the parental strand. The desired
mutant
was characterized by N~uI restriction endonuclease digestion and DNA
sequencing.
Thus the construct M13-WW3 was obtained. Then RF-DNA of M13-WW3 was
digested with XhoI and HindIII restriction endonucleases, and the resultant
420 by
fragment was first inserted into the intermediate vector pCC49t-BgIII-BstEII
that was
digested with the same endonucleases to yield plasmid pCC49t-WW3. Then pCC49t-
WW3 was digested with ~I'baI, and HindIII restriction endonucleases, and the
resultant 2983 by fragment was isolated. The vector pCC49 was digested with
the
same endonucleases and large fragment of 6440bp was isolated. The 2983 by
fragment was ligated to this 6440 by of the vector fragment to yield plasmid
pWW3.
72
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
The vector pWW3 expresses the MAb-WW3 with amino acid substitutions V18R and
K19R in the MAb-CC49 heavy chain.
To construct plasmid pWW4, the vector pCC49 was digested withXbaI and
BamHI restriction endonucleases to isolate a 415 by fragment. The fragment was
isolated by agarose gel electrophoresis, then purified. The replicative form
(RF) DNA
of phage M13mp18 was digested with~.'baI and BamHI restriction endonucleases
and
the large DNA fragment isolated. The 415 by fragment was then inserted into
the
~baI and BamHI site of the M13mp18 DNA to yield phage M13-W24. Then site-
directed mutagenesis was performed as described. Briefly, pMl3-W24 was
introduced into the E. coli CJ236 strain, which is a dut, uhg strain and
laclcs the
enzyme uracil N-glycosylase which normally removes uracil from DNA. This
results
in incorporation of uridine in the DNA. Then single-stranded (SS)-DNA
containing
uridine from phage M13-W24 was used as template for site-directed mutagenesis
to
prepare the mutant M13-WW4. The oligodeoxynucleotide mLl7-2, 5'-
GTGTCAGTTGGCCGGAGGGTTACTTTGAGC-3', (SEQUENCE ID NO. 31) was
used for site-directed mutagenesis. Oligonucleotide mLl7-2 contains a
phosphokinase
recognition site RRVT and also a EaeI recognition site. Oligonucleotide mLl7-2
was
annealed to uridine-containing SS-DNA of M13-WW24, followed by the in vita
synthesis of the complementary strand. Afterwards, the resultant double-
stranded
(DS) DNA was transformed into E. coli DH5 F' strain with a functional uracil N-
glycosylase to remove the parental strand. The desired mutant was
characterized by
EaeI restriction endonuclease digestion and DNA sequencing. Thus, the
construct
M13-WW4 was obtained. Then RF-DNA of M13-WW4 was digested withXbaI and
BamHI restriction endonucleases, and the resultant 410 by fragment was
inserted into
vector pCC49 that was digested with the same endonucleases to yield plasmid
pWW4. The vector pWW4 expresses the MAb-WW4 with amino acid substitutions
E17R and K18R in the MAb-CC49 heavy chain.
6. Expression of mutant MAbs
Electroporation was used to introduce the plasmid pWWl-pWW4 into mouse
myeloma NSO cells. First, 2 x 107 cells in 450 ~1 of ice cold PBS was mixed
with 12
~,g of purified plasmid in an electroporation cuvette. The cells were
incubated on ice
73
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
for 10 min. The electroporator was adjusted to the following settings: 0.24 KV
and
950 ~,F. After electroporation of cells for 30 msec (time constant), the cells
were
allowed to recover on ice for 10 min, then were transferred from the cuvette
into 30
ml of medium containing DMEM, 10% fetal bovine serum and 1 % glutamine, and
then were dispensed into 96-well plates with 100 ~l in each well. After 48
hours,
selection medium containing DMEM, 10% fetal bovine serum, 1 % glutamine, and
0.15 ~.M of methotrexate replaced the medium. Subsequently, selection medium
was
used every 3-4 days to replace the medium until stable transformants were
obtained.
The expression of the mutant polypeptide in the cell culture supernatants was
determined by ELISA. Clones with the highest expression of mutant polypeptides
were selected, grown in flasks and the supernatants were collected from these
clones.
7. Purification of mutant MAbs
The cell culture supernatant containing the mutant MAb was purified as
described with some minor modifications. Briefly, a 1 ml polypeptide A column
was
equilibrated with three column volumes of Buffer A (3 M NaCI, 1 M glycine, pH
8.8).
Solid NaCI was added to the cell culture supernatant to a concentration of 3
M. Then
the pH of the cell supernatant was adjusted to pH 8.0 with 1 M glycine (pH
8.8).
Supernatants (about 300 ml) were centrifuged at 7268 x g for 10 min. Then
after
passage through 0.2 ~m filter units, the supernatants were loaded onto the
polypeptide
A column at a flow rate of 1 ml/min. The columns were washed with Buffer A for
five column volumes. Afterwards, the columns were eluted with two column
volumes
- of Buffer B (0.2 M glycine~HCI, pH 2.5). Eluates were neutralized with 1 ml
of
Buffer C (0.1 M boric acid, 25 mM borax and 75 mM of NaCI). The purified MAb
was dialyzed against 1000 volumes of PBS overnight at 4°C. The
polypeptide
concentration of IgG was determined by ELISA, and the purity of IgG was
checked
by SDS polyacrylamide gel electrophoresis. The purified MAb was stored in a
liquid
nitrogen freezer until use.
8. Phosphorylation of mutant MAbs
The mutant MAb was labeled with [y-3aP]ATP and the cAMP-dependent
polypeptide kinase as described previously. Approximately 10 ~g of MAb was
incubated at 30°C for 60 min with 0.5 mCi of [y-3aP]ATP and 15 units of
the catalytic
74
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
subunit of cAMP-dependent polypeptide lcinase from bovine heart muscle (6
mg/ml
DTT) in 25 p1 of 20 mM Tris~HCl, pH 7.4, 100 mM NaCI, and 12 mM MgCl2 , then
cooled on ice to stop the reaction. After addition of 300 ~,1 containing 5
mg/ml bovine
serum albumin in 10 mM sodium pyrophosphate, pH 6.7, at 4°C, the 0.325
ml
reaction mixture was dialyzed against 10 mM sodium pyrophosphate, pH 6.7,
overnight at 4°C. Dialysis buffer was changed twice. Incorporation of
radioactivity
into the monoclonal antibodies was measured with a liquid scintillation
spectrometer
after precipitation of the polypeptide with trichloroacetic acid. To remove
the labile
3aP, the final product in 0.325 ml was adjusted to pH 7.4 with 1 M Tris base,
then
incubated at 37 C overnight.
9. Determination of stability of mutant [32P]MAbs in sera
The stability of 32P-labeled mutant MAb, was determined as described
previously with minor modification. Briefly, each reaction contained 0.25 ml
of a
solution of bovine serum albumin (5 mg/ml in PBS), 62.5 ~l of 1 M Tris~HCI, pH
7.4,
and 10 ~.1 of the [32P]MAb (2.4 x 106 cpm) for a total volume of 322.5 ~1 and
incubated at 37°C. Portions of 20 ~1 were taken in duplicate over a 24-
hour period to
determine the stability of [32P]phosphate attached to the MAb by TCA
precipitation.
II. RESULTS
1. Model of MAb-chCC49
The 3-D model of MAb-chCC49 was built by using the crystal structure of
MAb231 as template as described under "Materials and Methods". The modeled
MAb-chCC49 showed overall structural similarity to the template molecule
MAb231.
Again, the asymmetrical T shape and the extended hinge region were seen in the
MAb-chCC49 model, which was consistent with its overall sequence similarities
to
MAb231. However, when either MAb-chCC49 was superimposed over MAb231, the
structural differences in the overall molecules were noticeable, especially in
the CDR
regions of the two MAbs. This results from the sequence differences of two
molecules
in this region.
2. Choosing the sites
After generating the model of MAb-chCC49, the next step was to choose the
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
sites on MAb-chCC49 where an optimal phosphorylation site could be created.
The
criteria used were as follows. Since the consensus sequence for cAMP-dependent
polypeptide kinase is Arg-Arg-X-Ser/Thr, the sites with maximum number of
these
four residues were investigated and chosen so that minimal modification of the
original MAb structure would occur. Secondly, the sites in the complementarity-
determining regions (CDR) were avoided. The CDR region is the portion of the
MAb
variable domain which binds to antigen, so any modification of these sites
might
change the binding affinity or specificity of the MAb. By following these
criteria,
twelve sites were located, nine on the heavy chain and three on the light
chain. The
further evaluation of these sites led to pinpointing four sites on the MAb,
three on the
heavy chain and one on the light chain.
The first site chosen to incorporate a phosphorylation site started at amino
acid
residue 120 on the heavy chain CH1 region. The mutations which needed to be
introduced here were K120R and G121R. Together with P122 and 5123, these four
amino acid residues formed the pattern RRXS which is recognizable by cAMP-
dependent polypeptide kinase. This mutant was called WW1. The second site
started
at amino acid residue 221 on the hinge region of the heavy chain. The
mutations
required were K221R and T222R. Together with H223 and T225, these four amino
acid residues would be a phosphorylation site as well. This mutant was called
WW2.
The third site was V 18R, K18R, I20, and 521, Which was on the variable region
of the
heavy chain. The fourth site was on the variable region of the light chain.
The site
would have the pattern E17R, K18R, V 19, and T20 after the mutation.
3. Models of mutant MAbs
The modeled mutant MAbs all showed the asymmetrical T shape and
extended hinge region as noted above for MAb231. A close look at the site
where the
cAMP-dependent phosphorylation site was introduced revealed that almost all
the
amino acid residues which are essential to the phosphorylation were exposed on
the
surface, suggesting that this site would be readily accessible for
phosphorylation. Not
surprisingly, when MAb-chCC49 and mutant MAbs were superimposed, they
exhibited identical structures in most of the regions except for the area
where the
phosphorylation site was introduced in the mutant MAbs. No structural
differences
76
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
were noticeable in the CDR regions of both MAb-chCC49 and mutant MAbs, which
suggested that after introduction of a phosphorylation site in the hinge
region, the
binding ability of the mutant MAbs would not be changed significantly.
According to the modeling data obtained so far, it is hypothesized that the
low
energy and hydrogen bond formation potential of the phoephorylated
polypeptiodes
might contribute to the defined regions of stability of the phosphate groups
attached to
the polypeptides. Accordingly, it is proposed that the lower the energy and
the more
the potential to form hydrogen bonds) with surroundnig amino acids residues,
the
more stable the phosphate group is attahced on the poypeptides. According to
this
hypothesis, it is predicted that the stability of the phosphorylated mutant
Mabs would
be: [32P]MAb-WW2 = [3aP]MAb-WW3 > [3aP]MAb-WW4 > [32P]MAb-WW1.
4. Systematic search and models of mutant [32P]MAbs
After phosphate groups were attached to Ser or Thr residues on the PKA sites
of each mutant MAb, the first systematic conformational search (Table 1) was
done to
determine the conformation of the phosphate groups. Search results revealed
that for
MAb-WWl, a phosphate group attached to Ser 21 had about thirteen allowed
conformations. However the energies of these conformations were above 1.1 x
105
kcal/mol, much higher than those of other mutant MAbs whose energies were
around
3400 kcal/mol(Table 1). The conformation with the lowest energy was chosen,
and
the second systematic search for the other phosphate attached to the Mab was
performed. This time, only one conformation was given, although the energy,
7.7 x
104 kcal/mol, was a bit lower than those from the first search, it was still
much higher
than those of other mutant MAbs. This conformation of MAb-WW1 was chosen to do
further energy minimization.
For MAb-WW2, similar results were obtained after two systematic searches.
Sixty one conformations were revealed, much more than the same index for other
mutant MAbs in Table l, suggesting the easy accessibility of the PKA
recognition site
in this MAb. The energy ranged from 3904-3906 kcal/mol. Interestingly, several
conformations from both searches showed that the phosphate group had the
potential
to form a hydrogen bond with either the SH group of Cys 225, or the NH group
of Thr
224. Therefore after first systematic search, conformations with the lowest
energy
77
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
were chosen, whose phosphate group can form a hydrogen bond with SH group on
Cys 225, to do the second systematic search. Results were similar to those
obtained on
the first search. The conformation with the lowest energy from the second
systematic
search was chosen to do further energy minimization.
For MAb-WW3, after the first systematic search, nine conformations were
obtained, the energy ranged from 4127-4129 kcal/mol. Again, the hydrogen bond
formation potential was observed (Table 1). Among these conformations, the one
with
the lowest energy (4127 kcal/mol) was chosen, whose phosphate group can form a
hydrogen bond with hydroxyl group on the side chain of Tyr 80, to do the
second
conformational search. Results were similar to those obtained on the first
search. The
conformation with the lowest energy from the second systematic search was
chosen to
do further energy minimization.
For MAb-WW4, the results got from two systematic searches were very
similar . Only two conformations were obtained from each search. However,
different
from MAb-WW1, which after phosphates were attached had few allowed
conformations with high energy, the energy for phosphorylated MAb-WW4, 3778
kcal/mol, was quite low. No hydrogen bond formation was observed between the
phosphate on MAb-WW4 and any surrounding amino acid residues. Again, the
conformation with the lowest energy from the second systematic search was
chosen to
do further energy minimization.
According to the modeling data we obtained so far, it is hypothesized that low
energy and hydrogen bond formation potential of the phosphorylated
polypeptides
might contribute to the stabilities of the phosphate groups attached to the
polypeptides. It is proposed that the lower the energy and the stronger the
potential to
form hydrogen bonds) with surrounding amino acid residues, the more stable the
phosphate group is attached on the polypeptides. According to this hypothesis,
it is
predicted that the stability of the phosphorylated mutant MAbs would be as
such:
[3'P]MAb-WW2 = [32P]MAb-WW3 > [32P]MAb-WW4 > [32P]MAb-WW1.
5. Expression and purification of mutant MAbs
Stable transfection of mouse myeloma NSO cells with expression vector
pMAb-WW1 - pMAb-WW4 was performed as described under "Materials and
78
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
Methods". The concentration of IgG produced by the clones with highest
expression
was about 30 wg/ml as determined by a sandwich ELISA. The mutant MAb secreted
in the supernatant was purified and concentrated as described under "Materials
and
Methods". The final concentration of purified MAb was determined by ELISA.
6. Characterization of mutant MAbs and mutant [32P]MAbs
The purified MAbs were analyzed by SDS polyacrylamide gel electrophoresis.
In the presence of mercaptoethanol, two bands, one of 50 lcDa and the other of
25 kDa
were seen on the Coomassie brilliant-blue stained gel. These corresponded to
the
heavy chain and the light chain of the MAb, respectively. The mutant MAb was
phosphorylated by cAMP-dependent polypeptide kinase with [y- 32P]ATP to a
specific
radioactivity of 500 Cilmmol. After reduction with 2-mercaptoethanol, the
phosphorylated mutant MAb migrated as a single band at 50 kDa shown by
autoradiography, corresponding to the position of the heavy chain of the MAb
on a
Coomassie blue stained gel. The result was consistent with the fact that the
phosphorylation site was on the heavy chain of the mutant MAbs.
7. Stability assays
Stability assays of these mutant MAbs were carried out in the buffer (5 mg/ml
BSA in PBS). The percentages of 3~'P radioactivity remaining on the MAb at
different
time points were determined by comparing it with that of the initial values of
the
[32P]MAb. After 24 hr incubation in buffer, about 93%, 99%, 98%, and 97% of
the
phosphate remained stably attached to MAb-WW1, MAb-WW2, MAb-WW3, and
MAb-WW4. This confirmed our prediction that the stabilities of the phosphates
to
hydrolysis was [3~P]MAb-WW2 = [32P]MAb-WW3 > [32P]MAb-WW4 > [32P]MAb-
WW1. That is, the lower the energy and the more the potential to form hydrogen
bonds, the more stable the attached 32P was on the Mab due to the protective
environment surrounding the phosphate.
III. DISCUSSION
Although 32P has been considered as an ideal radioisotope in radio-
immunotherapy for many years, its utilization was limited for two reasons.
Firstly,
there were no easy labeling procedure applicable to all polypeptides. This
problem
79
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
was solved when a labeling procedure which proved to be simple, efficient and
applicable to virtually any polypeptide was developed.
The second problem is that the attached 32P was not stable when the labeled
polypeptide was incubated in buffer. Several methods were suggested to improve
the
stabilities of the phosphorylatable MAbs. However, no satisfactory results
were
reported by these attempts. In this report, the problem was taclcled from a
different
angle. First, instead of randomly choosing a site, molecular modeling was used
to
locate sites where PKA recognition sites could be introduced. By following the
criteria described in "Results", three sites on the heavy chain and one site
on the light
chain were chosed. Then, a protocol was devekoped to build the models of the
mutant
MAbs. Since the phosphate group is a quite big group, structural distortion
may result
from its attachment to Ser/Thr residues of the MAb. To verify this
possibility,
phosphate groups were introduced to the Ser/Thr residues at the PKA
recognition sites
of the MAb after the models of the mutant Mabs were built. In addition,
conformational searches were done to see which conformation the MAb would take
after the attachment of the phosphate group. The results showed that, in this
case,
phosphate groups would not change the structures of the mutant MAbs
significantly.
There were two interesting phenomena. First, after addition of the phosphate
group,
the energy within the whole molecule became very high for some of the
constructs
(MAb-WW1), while for other constructs the energy was quite low (MAb-WW2,
MAb-WW3, MAb-WW4). Second, the phosphates on some constructs had the
potential to form hydrogen bonds with adjacent amino acid residues (MAb-WW2,
MAb-WW3), while those on other constructs did not (MAb-WW1, MAb-WW4).
Since both of these two factors (the energy and potential of hydrogen bond
formation)
can affect the interactions of the molecules, it is hypothesized that the
energy and
potential of hydrogen bond formation can reflect the stability of the
[32P]MAb. That
is, the lower the energy and the stronger potential to form hydrogen bonds,
the more
stable the attached 32P was on the MAb. According to this hypothesis, it is
predicted
the stabilities of the mutant MAbs, that is: [32P]MAb-WW2 = [32P]MAb-WW3 >
[32P]MAb-WW4 > [3aP]MAb-WW1. This prediction was confirmed by stability
assays of mutant [32P]MAbs in BSA. Although the correctness of the hypothesis
is
still subject to additional testing, the study showed a new way to analysis
the
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
biochemical property of the polypeptides by using molecular modeling tools.
It is noteworthy that before we modeled MAb-chCC49, questions arose as to
which structure could be used as template. Although the structures of intact
MAbs
have been a subject of great interest for many years, due to the intrinsic
mobility and
segmental flexibility of antibodies, it is extremely difficult to get the
crystal structure
of an intact antibody. So far crystal structures of only two intact MAbs have
been
solved. One is MAb231, a mouse IgG2a MAb against canine lymphoma cells. While
the other is MAb61.1.3, a marine IgGl MAb against Phenobarbital. Since one
site on
which mutations were inroduced was in the hinge region of the MAb, it was
decided
to use the crystal structure of the intact MAb as template. Evaluation of the
crystal
structures of these two intact MAbs revealed the relative position of the Fab,
hinge
and Fc regions. In addition, both showed an overall asymmetry, which might
manifest
a considerable degree of intrinsic mobility and segmental flexibility of the
antibodies.
Other structural features of the two MAbs though, were quite different. The
IgGl has
a distorted yet compact Y shape, whereas IgG2a has a more extended T shape.
This
difference may well reflect differences in their hinge regions. The hinge of
IgG2a
which has 23 amino acids is longer than that of IgGl by six amino acids, three
in the
upper hinge region and three in the lower hinge region. The overall sequence
comparisons performed with the Bestfit Program in the GCG package (Wisconsin
Package Version 10, Genetics Computer Group (GCG), Madison, Wisconsin.)
indicated that IgGI shares a little more sequence homology with MAb-chCC49
than
does IgG2a. The results demonstrated that the light chain sequences of
MAb61.1.3
(IgGl) and MAb-chCC49 share 65% identity and 72% similarity, whereas that of
MAb231 (IgG2a) and MAb-chCC49 share 63% identity and 70% similarity; and that
the heavy chain sequences of IgGl and MAb-chCC49 show 64% identity and 74%
similarity, whereas IgG2a and MAb-chCC49 show 60% identity and 68% similarity.
However, when sequences of the hinge regions were used to do the comparison,
it
was found that the hinge of MAb-chCC49 resembles more that of MAb231 in terms
of both length and amino acid sequence than that of MAb61.1.3. Like MAb231,
MAb-chCC49 also has a long hinge, only one amino acid less than that of
MAb231,
suggesting that it might take on a similar extended structure as MAb231.
MAb231
and MAb-chCC49 also share substantial sequence identity (about 90%), in both
core
81
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
and lower hinge regions. On the other hand, MAb-chCC49 and MAb61.1.3 do not
resemble each other in this region. Compared to MAb-chCC49, MAb61.1.3 has a
much shorter hinge. Sequence alignment also showed that they have very low
homology in this region. Since our mutant MAb would have a phosphorylation
site in
the hinge region, it was decided to continue to use MAb231 as our template to
model
the whole molecule of MAb-chCC49.
This work also showed that molecular modeling can save time and also malce
precise predictions for the structures of the desired polypeptides. For
instance,
according to the two criteria we mentioned under the "Results", more than ten
sites in
the whole Ab of MAb-chCC49 were found. Evaluation of models of these putative
mutant Abs suggested that not all these sites were good for site-directed
mutagenesis.
Some models of the putative mutant Abs showed that after mutation, the side
chains
of the mutated amino acids would severely interfere those of residues in the
neighborhood, especially the residues in the CDR regions, as in the case of
mutations
in the variable region of MAb. Some other models showed that after mutation,
the
phosphorylation site would be buried deeply inside of the MAb as it could
happen if
the mutation was introduced in the Fc portion of the mutant Ab. This would
pose a
problem for phosphorylation as it was suggested that it is better to have an
exposed
phosphorylation site to get good phosphorylation. Those mutants, models of
which
did not show the problems of the above kinds, were eventually chosen for the
further
work.
The teachings of US Patent 5,986,061 are hereby incorporated by reference
herein in their entirety.
The polypeptides modified in accordance with the invention by the presence
of one or more phosphorylated groups - or analogs thereof , i.e. sulfur - have
numerous applications and uses in the biological, medical, biomedical
(including
therapeutic and diagnostic), and other sciences.
It is contemplated that polypeptides modified by the methods disclosed in the
instant invention can have additional specific uses. A few illustrations of
such uses are
described below. However, it is understood that these specific described uses
are not
intended to limit the scope of the invention.
~2
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
Pharmacokinetics of Polypeptides
It is often useful to follow the fate of injected polypeptides in animals and
patients. It is shown below that the phosphorus attached to some of these
polypeptides
is relatively stable in mouse serum; thus the pharmacokinetics ofpolypeptides
can be
conveniently studied. The instant invention provides a method to generate more
stably
attached phosphate groups using computer modeling, thus, polypeptides
phosphorylated that way are especially well-suited for such applications.
For uses of the phosphorylated polypeptides or analogs of the invention where
the polypeptide is expected to be in contact with human or animal serum, it is
necessary that the polypeptide derivative be stable in human or animal serum.
The
derivative polypeptide should be stable in the serum of the species in which
the
pharmacokinetic studies (or application) are to be ca~.-ried out, or in a
serum
equivalent, i.e., from the biological point of view, to the serum of the
species on
which the work is to be performed.
For instance, in the work described above, the phosphate linked to MAb-WWS
is much more stable than that of MAb-chCC49I~1 in mouse serum at 37°C.
After 24
hours at 37°C, approximately 99% and 92% of the phosphate groups were
still
attached to MAb-WWS and MAb-chCC49I~1, respectively. Thus, for applications
where the stability of the phosphorylated derivative is critical, a serum-
stable
derivative generated using the instant invention will be used.
The applications described herein are not limited to polypeptides
phosphorylated at the serine residue; it has been described above how kinases
phosphorylate other amino acids such as threonine or tyrosine. Thus,
polypeptides
modified at these amino acids are within the contemplation of the invention.
Because
of the configuration of such derivatized labeled polypeptides, it is not to be
excluded
that their stability in serum may be improved if the corresponding serine-
phosphorylated derivative is not adequately serum-stable.
General Diagnostic Reagents
Additional specific applications of the modified polypeptides of the invention
are noteworthy. As referred to herein, virtually all polypeptides can be
engineered to
introduce single or multiple phosphorylation (or analog) sites. Such
polypeptides can
83
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
be used for a wide variety of scientific purposes: to study the fate of these
polypeptides in animals or humans; to study their stabilities; or for use as
any
laboratory reagent where a radioactive polypeptide is useful.
For example, molecular weight standards are commonly used for
polyacrylamide gel electrophoresis. Polypeptides with phosphorylation sites
would
make convenient autoradiographic markers such as molecular weight markers,
isolectric focusing markers or other markers. For such applications the serum
stability
is generally not critical, nor is the retention of the biological activity of
the
polypeptide, e.g., Ag binding. Thus, for certain uses or applications it is
not essential
that a phosphorylatable polypeptide in accordance with the invention have
biological
activity.
Anticancer Therapeutic "Bomb"
A particularly noteworthy and interesting application made possible by the
invention is what has been called here in the vernacular, a therapeutic or
more
specifically an antitumor "therapeutic radiation bomb". Such a biologically-
active
composition uses biotin coupled to a tumor-specific monoclonal antibody (MAb)
(or
to Fab or Fab' fragments if more appropriate), and a multiple "modified"
streptavidin
bound to each MAb-bound biotin, each streptavidin being modified in that it
has
multiple phosphorylated groups. Since streptavidin is itself a tetramer,
multiple
radioactive groups are thus provided. These multiple radioactive groups expose
the
tumor with radiation which is greatly amplified and hence more readily
detectable and
would produce greater tumor destruction. In the case where it is highly
phosphorylatable it is much more easily detectable. Thus, each one of the
biotins
which is bound to each tumor-specific MAb binds tightly to the multiple
streptavidin
molecules which in turn contain multiple labeled phosphorus atoms, or their
equivalent isotopes.
It is evident that depending on the therapeutic or diagnostic objectives, all
streptavidins may be radioactive-phosphorus labeled or partially or totally
radioactive-thiophosphorus labeled, or labeled with different phosphorus or
sulfur
isotopes, which have different decay modes or levels of radiation energy. Such
isotopes are discussed below.
84
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
Because antibody molecules are themselves multichain molecules, many sites
can be introduced into the antibodies or Fab fragments directly by the
procedures of
this invention.
Hormones, Cytolcines, Lymphokines, Growth Factors
Hormones labeled with radioactive phosphorus or sulfur are another class of
biological materials within the scope of this invention. For instance,
phosphorylated
(e.g,~ 33P~ sap) hormones can be bound to specific cell types differentially
over other
tissues. Cancerous tissues containing increased number of receptors for such
hormones can be treated with appropriately phosphorylated hormones which will
then
specifically bind to these cells; thus therapy will be significantly improved.
Further, labeled hormones are commonly used for receptor studies to examine
their binding to cell surface receptors, to soluble receptors or other
reagents and
materials.
Typical of the labeled hormones (33P, Sap) contemplated by the invention are
growth hormone, insulin, FSH; LH, and others. It is evident such hormones
genetically constructed lend themselves to the introduction of one or more
putative
phosphorylatable or thiophosphorylatable groups.
As noted above for hormones, the same considerations apply to cytokines,
lymphokines, growth factors (i.e., IL-1, IL-2, IL-3, TNF-alpha, TNF-beta, the
various
CSF molecules, erythropoietin EGF, NGF and others) and any polypeptides with
cell
and/or tissue specificity to one degree or another.
Antibodies
Streptavidin labeled by means of phosphorylation may be used directly to
enhance immunoassays as a substitute for unlabeled streptavidin or enzyme-
linked
unlabeled streptavidin. The invention also contemplates introducing phosphorus
or
analog labels into genetically engineered antibodies, more particularly MAbs,
or in
the Fab or Fab' fragment. Such MAbs are useful for diagnostic and therapeutic
purposes. The phosphorylated MAbs can be made to target specific tumor-
associated
antigens or a variety of tumors, like breast and colon cancer cells, malignant
melanoma cells, ovarian carcinoma cells, and other malignant tumors.
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
Further Therapeutic Uses
Other uses contemplated in accordance with the invention are as follows:
Monoclonal or appropriate cocktails of antibodies and/or antibody fragments
(such as
the Fab or Fab' fragments) are fruitful molecules in which in accordance with
the
invention phosphorylation or other labellable sites can be introduced. The use
of 3zP
in therapy has been demonstrated for polycythemia vera and other malignancies.
Thus, it is clear that the high energy .beta. particle is effective as an
anticellular agent.
The attachment of 3aP through the introduction of phosphorylation sites) in
MAbs or
their appropriate fragments (Fab and Fab') would also be effective for the
therapy of
tumors to which these monoclonal antibodies are specific. A large number of
monoclonal antibodies have been developed to tumor-associated antigens from
breast,
colon, ovarian, and other adenocarcinomas, malignant melanoma, and many other
tumors. Thus, MAbs directed to the tumor associated antigens of these tumors
are
expected to be highly effective when labeled with 3aP. The labelling can be
increased
by use of cassettes of phosphorylation sites or directly by introduction of
multiple
phosphorylation sites into the intact polypeptide or the appropriate fragments
through
genetic engineering. By "cassette" is meant a multifunctional moiety. A
distinct
advantage of the instant invention is that multiple labeled phosphorylation
sites, when
introduced in accordance with the instant invention in MAbs, will not reduce
the
binding specificity andlor affinity of the modified MAbs for the specific
epitope
targeted.
The invention also has implications for the preparation of therapeutic agents
to
which patients are likely to develop an adverse antigenic response. Thus, the
monoclonal antibodies can be engineered successively in accordance with the
invention with different phosphorylation sites. When introduced into patients
who
have become sensitive to or who are producing antibodies to the injected
antibody
because of the phosphorylation site, then by changing to a different
phosphorylation
site, the antigenic character of the polypeptide can be modified. Thus, it may
be
possible to use such antibodies in multiple successive therapeutic regimens in
patients
who are reacting with the antibody of the previous type. For this purpose a
series of
antibodies with a variety of phosphorylation sites can be developed. Each
series
would be designed to have a different epitopic structure and be used
sequentially.
86
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
Alternatively a cocktail of such different antibodies can be used initially so
that any
one is present at a fraction of the total. This would minimize antibody
formation to
any one of the new sites. Due to the relative easiness of designing potential
phosphorylation sites using the instant invention, such effort can be greatly
simplified
within a short period of time.
Various Isotopes
In accordance with the invention, as discussed above, phosphorylated
derivatives should be serum-stable for certain applications. Various isotopes
can be
employed that are more effective than others for a specific therapeutic
purpose. For
example, 33P may be substituted for 32P in the phosphorylation reaction. It is
less
likely that 35S with a half life of about 89 days would be normally as useful
as an
anticellular reagent because it is a low energy beta emitter. Nevertheless,
conceivably
there may be specific uses for 35S labeled MAbs in therapy andlor diagnosis.
Table I below shows various isotopes (and other pertinent particulars) which
are especially useful for introduction into polypeptides in accordance with
the
invention.
TABLE I Isotopes for Labellable Groups
Isotope Half Life Type of Decay Energy of Radiation
s2p 14.2 days beta 1.707 MeV
ssp 24.4 days beta 0.25 MeV
s5S 87.0 days alpha 0.167 MeV
38S 2.87 hours alpha 1.1 MeV
Accordingly, the invention provides tailored-designed polypeptides for
specific biological purposes.
An important implication of this invention is the greater safety of the
labeled
MAbs due to lower energy emission levels and the nature of the radio emission.
Specifically, MAbs labeled with 3aP or 33P have significantly lower energy
emission
87
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
levels than conventional radio-labels for polypeptide such as lash moreover,
the decay
emission of the phosphorus and sulfur isotopes (32P, 33P, 3sS and 38S) is beta
or alpha
particles, as compared to gamma rays of Iasl as are common in existing
labelling
protocols.
The safety feature of the beta-labeled polypeptides, e.g., MAbs or
streptavidins in accordance with the invention, is very significant for
diagnostic and
therapeutic uses of the invention. Beta emitters penetrate the tumor but are
not emitted
as readily as gamma ray emitters from the patient to surrounding medical staff
and
non-medical attending individuals.
By selecting 35S (which has a half life of 87 days) and the 35S phosphate ATP
analog to 3~P, one can significantly increase the effective radioactive life
of the
therapeutic agent.
Thus, the polypeptides labeled in accordance with the invention have a
spectrum of meaningful advantageous properties heretofore not readily
available.
The invention is not limited to the use of unstable isotopes. In the future it
may
be advantageous to label a polypeptide with a stable isotope that would be
suitable for
detection by NMR, nuclear activation, or future developed procedures. Nor is
it
necessary that the label be a "radio" label providing it is an identifiable
label.
Radioimmunoassays with Labeled Antigens
In accordance with the invention the phosphorylated polypeptides can be
generally used as the radio-labeled component. These radioimmunoassays can be
used
with polyclonal as well as with monoclonal antibodies. If the introduction of
a new
phosphorylation site into a polypeptide changes the antigenic structure of the
polypeptide in the area of the phosphorylation site, or even at distant linear
positions
of the polypeptide, and alters the antigenic behavior, the polypeptide in
accordance
with the invention, can be modified to introduce a phosphorylation site at a
different
position so that the antigenic behavior will remain stable and for the
polypeptide to
bind with the polyclonal or monoclonal antibody of interest. Again, the
instant
invention employing computer modeling will greatly speed up the whole process.
Furthermore, because of its high energy, 32P secondary Bremsstrahlung
radiation can
be used for imaging.
88
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
Thus, the invention provides considerable versatility regarding the position
where the label can be introduced. Generally the phosphorus (or other radio-
label)
introduced will not disrupt the antigen-antibody binding in accordance with
the
instant invention.
Sandwich Radioimmunoassays
In sandwich radioimmunoassays with monoclonal antibodies, the introduction
of phosphorylation sites into an antibody in accordance with the invention is
a
sensitive method to follow the binding of the second antibody. Thus, the
sensitivity of
such sandwich radioimmunoassays can be increased substantially. Particularly,
when
multiple phosphorylation sites are introduced in accordance with the invention
into
the polypeptide directly or by the addition of a fusion phosphorylation
cassette, the
sensitivity of such assays will be increased many-fold. Again, the instant
invention
has the unique advantage of simultaneously modeling several introduced
phosphate
groups and predict their potential effects on the overall stability and
conformation of
the phosphorylated polypeptide.
Another advantage of the invention is to be noted. Because the
phosphorylation reaction is gentle, unlike the iodination or other chemical
modifications necessary to radio-label polypeptides with iodine or other
reagents,
monoclonal antibodies that are inactivated by the chemical or iodination
procedures
are not likely to be inactivated by the phosphorylation procedure. Thus, the
process of
the invention allows for the phosphorylation of polypeptides normally too
sensitive
for labelling with iodine. The introduction of a phosphate analog with 3sS
provides a
radio-labeled polypeptide derivative with a long half life (1.5 times longer
than lasl
and 6 times longer than 3aP). Thus, when MAbs are labeled with 3sS, they will
have a
substantially longer shelf life compared to the 32P or lasl radio-labeled
derivatives.
As discussed above, the invention allows for the selection of the most
appropriate labelling isotope, as compared to lash for instance.
Imaging
Generally for imaging of tumors or tissues in an animal or a patient, a high
energy gamma emitter is generally preferable to a relatively low energy beta
emitter,
which by and large would be absorbed by the tissues. However, in certain
imaging
89
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
studies in animals or in patients, MAbs to which 3zP, s3P or 3sS are attached
through
introduced phosphorylation sites in accordance with the invention may be
useful.
For example, it can be seen that MAbs labeled with 32P, 3sP or 3sS could be
useful in in vivo studies in which biopsy specimens are to be examined. The
spread of
a tumor during surgery could be followed by utilizing a radioisotope detector
probe to
follow the local spread of the tumor and guide the extent of the surgery. In
addition,
tissue specimens which are fixed or frozen can be taken to which these
polypeptides
will remain bound (that is, antibodies to the tumor-associated antigens or
other
ligands). Thus, autoradiographs of tissue sections can provide information
about the
extent of tumor spread and the extent of binding of specific monoclonal
antibodies to
tumor-associated antigens can be thoroughly evaluated. Furthermore, as an in
vitro
reagent with cells or tissue slices, such labeled antibodies would be highly
sensitive
reagents to detect tumor-associated antigens or other antigens by the usual
types of
assays employed.
Anti-antibodies
There are many known uses for anti-antibodies such as anti-mouse, anti-
human, anti-sheep, and anti-goat antibodies, etc. or monoclonal antibodies as
single
entities or as a cocktail. Such antibodies can be engineered in accordance
with the
invention to introduce single or multiple phosphorylation sites and,
accordingly
labeled with a variety of isotopes as described above. These provide general
reagents
where anti-antibodies are necessary, particularly in radioimmunoassays,
autoradiography, or any other reactions in which anti-antibodies axe useful.
Rapid Purification of Phosphorylated Polypeptides
The invention has also applications in separating and purifying polypeptides.
Polypeptides which are phosphorylated can be separated from those which axe
not;
polypeptides which are more phosphorylated than others can be separated.
For instance, where polypeptides can be phosphorylated, it is common for
only a percentage of the molecules to be phosphorylated. The total
phosphorylation,
of course, can be enhanced by the introduction of multiple phosphorylation
sites in the
polypeptide in accordance with the invention so that few molecules escape
phosphorylation. To be able to separate the phosphorylated from the non-
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
phosphorylated polypeptides is especially useful for molecules with a single
phosphorylation site where there may be phosphorylated and non-phosphorylated
molecules in the population. In this manner, the effectiveness of any
phosphorylated
derivatives is increased. Separation of phosphorylated from non-phosphorylated
molecules can be accomplished by developing polyclonal or monoclonal
antibodies to
the phosphorylation sites with andlor without derivatized phosphate groups.
Such
polyclonal and monoclonal antibodies are expected to have considerable value
in
purifying the polypeptides and have been described.
Dephosphorylation of Polypeptides
Considerable emphasis has been placed herein on aspects of phosphorylation.
It is a consequence of the phosphorylation (with phosphate or thiophosphate
groups)
that the removal of the label is also facilitated in that dephosphorylation is
a milder
procedure which tends to be less disruptive of the polypeptide molecule than
procedures in the prior art for removal of lasl from polypeptides. Thus, in
cases where
it is useful to remove the radioisotope, this can be achieved relatively
easily and
gently by an enzyme reaction. A variety of phosphatases can be used for this
purpose.
Most phosphatases have comparatively low specificity although a few have very
high
specificity such as those acting on sugar phosphates and the enzyme that
dephosphorylates glycogen synthetase b and phosphorylase b. Furthernzore,
specific
dephosphorylation of phosphorylated polypeptides can be achieved by reversal
of the
reaction of polypeptide-serine and -tyrosine lcinases. If it is necessary to
determine
whether in fact the phosphate addition causes a change in the activity of the
polypeptide, rather than aging, denaturation, or other manipulations, the
phosphate
can be removed and the activity of the polypeptide again determined. In such a
manner, a definitive understanding of the effect of phosphorylation on the
activity of
the polypeptide can be assessed. Tlus may be useful in determining the
activities of
various phosphorylated interferons.
The concept of "dephosphorylation" has an interesting application which is
essentially the "converse" of that taught herein. Wherever a site in a
polypeptide in the
native state is naturally phosphorylatable the removal of that site would be
particularly desirable when it is known that the naturally phosphorylatable
91
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
polypeptide causes some undesired results. An illustration would be
polypeptides
associated with oncogenic viruses such as Rous sarcoma virus (RSV) and
cellular
oncogenes.
Phosphorylation Cassettes
The invention also contemplates an alternative method for labelling
polypeptides without inserting the coding sequence for the phosphorylation
site (or
cassette) into the nucleotide coding sequence of the polypeptide, and yet
still use the
invention. This procedure would be particularly useful for large polypeptides
like
immunoglobulins for use in various assays. Such alternative method calls for a
polypeptide which is phosphorylated to be chemically linked to the large
polypeptide.
The linking would be by any bifunctional reagent or an activated derivative
(like N-
hydroxy-succinimide), as is known in the art.
This technique could use a polypeptide with multiple phosphorylation sites in
tandem or "cassette" that can be introduced within or at either end of a
polypeptide.
The DNA coding for the tandem phosphorylation sites would be flanked by
restriction
sites for easy cleaving and insertion into the DNA containing the coding
sequence for
the polypeptide to be linked to the larger polypeptide. Such a phosphorylation
cassette
could be expressed as a small polypeptide then phosphorylated and then
chemically
linked to the larger polypeptide.
Phosphorylatable Human or Animal Donor Genes
Further, it is within the contemplation of the invention to provide DNA
sequences engineered into appropriate vectors or cell lines or even into
animals by
transgenic techniques. Thus cells or animals could produce phosphory-latable
(and/or
phosphorylated) polypeptides such as immunoglobulins after phsphorylation
sites are
introduced into the polypeptides by the methods of this invention.
Phosphorylatable
chimeric antibodies with a mouse variable region and human constant region
could be
developed. The human antibodies used as the donor molecule would be engineered
to
contain single or multiple phosphorylation sites. By analogy, this could be
applied to
polypeptides other than immunoglobulins.
Other Applications
92
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
There are other applications for the labeled polypeptides of the invention. In
general virtually any polypeptide that contains a label (radio-label,
fluorescent-label,
chemical-label, enzyme-label, etc.) can alternatively be labeled with
phosphate by the
introduction of phosphorylation sites) in accordance with the invention. The
purification of such polypeptides can be followed in a sensitive assay by
simply
measuring the ability to accept a phosphate group rather than to follow enzyme
activity. Such polypeptides engineered in accordance with the invention,
therefore,
can be purified easily and themselves be used as a tracer to follow the
purification of
other polypeptides to which they are similar. For example, it is likely that a
polypeptide with a single phosphorylation site engineered with very little
modification
of the polypeptide structure itself would be purified similarly to the
unmodified
polypeptide.
In practice, by having a stock of phosphorylatable polypeptides or series of
markers, the labeled derivatives can be prepared conveniently by the simple
phosphorylation reaction when desired. Thus, the polypeptides of the invention
which
are phosphorylatable provide a useful inventory of the corresponding labeled
polypeptides.
Pharmaceutical and Biologically Active Compositions
The modified polypeptides of the invention can be formulated according to
known methods to prepare pharmaceutically useful compositions. For instance,
the
MAb hereof is combined in a mixture with a pharmaceutically acceptable carrier
vehicle. Suitable vehicles and their formulation are described in Remington's
Pharmaceutical Sciences by E. W. Martin, which is hereby incorporated herein
by
reference in its entirety. Such compositions will contain an effective amount
of the
MAb or other polypeptides hereof together with a suitable amount of vehicle in
order
to prepare pharmaceutically acceptable compositions suitable for effective
administration to the host. The host may or may not be a mammal. The carrier
may be
liquid, solid, or gaseous. Of course, therapeutic applications for humans and
veterinary applications are intended for the biologically active compositions
of the
invention. The biologically active composition of the invention is to be
administered
in a biologically or therapeutically effective amount which can be readily
determined
93
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
by one spilled in the art. Generally it is the smallest amount for which a
desired
response will be obtained to an amount which is excessive for practical or
other
purposes.
The biologically active compositions of the invention can also include any
other biologically active substance which does not adversely affect the
desired
activity, particularly the activity or use of the modified polypeptide of the
invention.
It is understood that the modified polypeptides of the invention can be
obtained by chemical and/or enzymatic synthesis rather than by recombinant DNA
technology.
While reference has been made to particular preferred embodiments and to
several uses and applications made possible by the invention, it will be
understood
that the present invention is not to be construed as limited to such, but
rather to the
lawful scope of the appended claims and subject matter covered by the doctrine
of
equivalents.
94
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
Table 1 Systematic search result of mutant MAbs
First Second round
round systematic
systematic
search
search
Bonds Chai No. of H-bondingEnergy Bonds searchedNo. of
searchedn allowed with (l~cal/molin addition allowed
no. to Ca-
(Ca-C(3, conform surroundin) C(3, C(3-Oy conform
C(3-Oy) a-tions g amino a-tions
acids
CC4 5449 1 18 no 6574- 5449 (Ccp,CW) 655
9K1 6576
5455 1 43 no 6574- 5455 (Ccp,CW) 186
6577
5449 2 54 yes 3951- 5449 (Ccp,CW) 496
3953
5455 2 15 no 3952- A454,S455,M4562298
3954 (Ccp,Cyr)
CC4 5450 1 40 yes 3841- 5450 (Ccp,Cyr)47
9CK 3843
I
5457 1 28 no 3841- 5457 (Ccp,Cy~)618
3844
5450 2 6 yes 3841- D449, 5450 312
3842 (Ccp,C~r)
5457 2 30 yes 3847- 5457 (Ccp,CW) 1189
3849
CC4 5436 1 56 yes 3811- --- ---
9CI~ 3813
II
5436 2 48 no 3816- --- ---
3817
CC4 Y455 1 60 no 3900- --- ---
9Tyr 3 902
Y455 2 213 yes 3899- --- ---
3904
5449 1 11 yes 5449 (Ccp,Cyr)125
9 6p ~ ( ~ ~ 4368 ~
( ~
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
S4S5 1 13 yes 4375- S4SS (Ccp,C~r)8S
4377
5464 1 1S yes 4382- A463,S464,L46S679
4385 (Ccp,Cyr)
5470 1 SO no 4392- --- ---
4396
5479 1 20 yes 4395-
4398
S48S 1 49 no 4400- --- ---
4404
' 5449 2 S8 yes 4406- --- ---
4408
S4SS 2 1S yes 4411- A4S4,S4SS,M4S68389
4413 (Ccp,CW)
5464 2 0 --- --- A463,S464,L46S325606
(C~P~CW)
. 5470 2 0 --- --- R468,A469,S470,S x 105
M471,
K472 (Ccp,CW)
5479 2 0 --- --- A478,S479,L480263
(C~P~CW)
S48S 2 23 yes 4420- A484,S48S,M48621508
4423 (Ccp,Cyr)
MAb S 123 1 13 no 1.1 x --- ---
1 OS
WW S 123 2 1 no 770SS --- ---
MAb T224 1 21 yes 3939- --- ---
- 3942
WW
2 T224 2 13 yes 3908- --- ---
3940
MAb S21 1 9 yes 4127- --- ---
- 4130
WW
3 S21 2 22 yes 3840- ---
3842
MAb T20 1 2 no 3778- --- ---
- 3779
96
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
WW T20 2 2 no 3776- --- ---
4 3777
MAb 5224 1 61 --- ---
yes 3905-
- 3907
WW
5224 2 57 yes 3905- --- ---
3907
MAb 5224 1 65 yes 3215- --- ---
3217
WW
5224 2 54 yes 3224- --- ---
3226
MAb 5224 1 64 yes 4518- --- ---
- 4520
WW
7 5224 2 56 yes 9805- --- ---
9808
MAb 5224 1 62 yes 3820- --- ---
3823
WW
8 5224 2 39 yes 3824- --- ---
3827
Systematic conformational searches along Ca-C(3 and C(3-Cy of the Ser/Thr of
the PKA recognition site were performed so that allowed conformations could be
obtained for each phosphorylated mutant MAb. In the column "bonds searched,"
the
amino acid residues on which the systematic search was performed are shown.
Corresponding to the figures, the column designated "chain number" refers to
the left
model as chain l and the model on the right of each figure as chain 2. The
column
"H-bonding with surrounding amino acids" shows whether the attached phosphate
to
each mutant MAb has potential to form one or more hydrogen bonds with the
surrounding amino acids. In the energy column, the first number represents the
conformation with the lowest energy and the second number represents the
97
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
conformation with the highest energy, all calculated without energy
minimization.
Additional details are given under "Materials and Methods."
98
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
Table 2 Determination of immunoreactivities of [32P]MAbs
Plate Assay Bead Assay
BSM PSM BSM PSM
Bound [32P]MAb- 66% <1% 95% 4%
chCC49-6P
Bound [3aP]MAb- 68% <1% 94% 4%
WWS
Bound [3aP]MAb- 68% <1% 95% 3%
WW6
Bound [32P]MAb- 68% <1% 95% 2%
WW7
Immunoreactivities of [32P]MAbs were measured by direct binding assays.
The assays were carried out either by plate assay with BSM or PSM coated on
the
plates, or by bead assays with BSM or PSM bound to the beads. The percentages
of
[3aP]MAbs bound to the plates or beads were determined as described in details
in
"Materials and Methods." The assay carried out with excess antigen BSM bound
to
the beads is more reliable than the plate assay where BSM was not in
sufficient
excess.
99
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
Table 3
Stability of [32P]MAb-chCC49-6P in serum
Serum or 1 4 8 12 24 36
Buffer Hour Hours Hours Hours Hours Hours
Human 100 100 99 96 95 93
Mouse 97 96 96 95 93 91
Fetal Bovine99 97 97 96 95 92
Buffer 98 97 96 96 96 93
The percentage of 32P retained on the [32P]MAb-chCC49I~1 in sera or buffer at
various times at 37°C was determined by TCA precipitation (Pestka,
1972). For
determination of stability, 1.3 x 106 cpm was added to each reaction mixture
as
described under "Materials and Methods." Portions of 20 ~1 were taken in
duplicate
at the times shown for TCA precipitation. The values in the table are the
average of
duplicate determinations. Additional details are given under "Materials and
Methods."
100
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
Table 4
Stability of [32P]MAb-WW5 in serum over 5 days
Serum or Human Mouse Fetal Buffer
Buffer Bovine
1 Hour 100 100 100 100
4 Hours 99.9 100 99.9 99.4
8 Hours 99.7 99.6 99.8 100
12 Hours 99.7 99.5 99.7 99.5
24 Hours 99.0 99.6 99.5 99.2
(1 Day)
2 Days 98.3 100 98.3 99.4
3 Days 97.4 100 97.6 99.4
4 Days 96.7 100 96.8 99.1
5 Days 96.1 98.4 95.5 99.3
The percentage of 32P retained on the [ 32P]MAb-WWS was determined as
described in the legend to Table 3.
101
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
Table 5
Stability of [32P]MAb-WWS, -WW6 and -WW7 in buffer over 21 days
MAbs [32P]MAb-[32P]MAb-[32P]MAb-
Days WWS WW6 WW7
1 Day 99 100 100
2 Days 98 100 99
3 Days 98 99 99
4 Days 97 99 99
Days 97 99 99
6 Days 97 98 98
9 Days 96 97 98
12 Days 96 96 97
14 Days 95 96 96
16 Days 94 95 96
18 Days 94 95 95
21 Days 93 94 94
The percentage of 3aP retained on the [ 32P]MAbs was determined as described
in the legend to Table 3.
102
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
Table 6
Stability of [32P]MAb-WW6 in serum over 5 days
Serum or Human Mouse Fetal Buffer
Buffer Bovine
1 Hour 99.7 99.9 99.9 100
4 Hours 99.5 99.9 99.7 100
8 Hours 99.7 99.6 99.4 100
12 Hours 99.7 99.5 99.2 99.9
24 Hours 99.5 99.6 99.2 99.5
(1 Day)
2 Days 98.2 99.2 98.4 99.4
3 Days 98.0 98.9 96.6 99.4
4 Days 96.6 98.3 96.0 99.1
Days 96.0 97.6 96.0 99.0
The percentage of 32P retained on the [ 3~'P]MAb-WW6 was determined as
described
in the legend to Table 3.
103
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
Table 7
Stability of [32P]MAb-WW7 in serum over 5 days
Serum or Human Mouse Fetal Buffer
Buffer Bovine
1 Hour 100 100.0 100 100
4 Hours 99.8 99.7 99.8 100
8 Hours 99.8 99.5 99.5 100
12 Hours 99.7 99.5 99.3 100
24 Hours 99.5 99.4 99.3 99.6
(1 Day)
2 Days 97.9 99.2 98.7 99.4
3 Days 97.1 97.7 97.9 99.2
4 Days 96.4 96.3 97.4 98.9
5 Days 95.9 96.1 96.1 98.8
The percentage of 32P retained on the [ 32P]MAb-WW7 was determined as
described
in the legend to Table 3.
104
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
Table 8. Summary of potential cAMP-dependent protein kinase recognition sites
on MAb-chCC49
PotentialStartingSite Characteri-Buried Mutant Change Interference
or in
sites amino stirs exposedto be CDR with other
acid made region
1 18 VKIS VH regionexposedR*R*IS not
significantly
2 74 KSSS VH regionexposedR*R*SS
3 120 KGPS CHI regionexposedR*R*PS no
4 221 KTHT heavy exposedR*R*HT no
chain,
hinge
region
300 RWS CHa regionburied RR*VS no
6 320 CKVS CHZ regionburied R*R*VS no severe
sterical
forbidden
is
reported
for
8320
7 333 KTIS CHZ regionexposedR*R*IS no
8 390 YKTT CH3 regionburied R*R*TT no
9 407 SKLT CH3 regionburied R*R*LT no severe
sterical
forbidden
is
reported
for
8407
17 EKVT VL regionexposedR*R*VT no
11 59 ARES VL regionexposedR*RES yes
12 114 RKDP CLI regionexposedRR*DS* no
105
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
Table 9. Biodistribution of [32P]MAb-WWS, [32P]MAb-CC49K1, [131 I] MAb-CC49
and [lzsI]MAb-CC49. [32P]MAb-WWS, [32P]MAb-CC49K1, ['31 I] MAb-CC49 and
[izsl]fib-CC49 were injected into athymic mice bearing human colon carcinoma
xenografts (LS-174T). The mice were sacrificed at the indicated times
(5/group) and the
percentage of injected dose per gram (%ID/g) of the tumor and various normal
tissues
were determined.
Time post-i.v.
injection
(h)
MAb Tissue
24 48 72 168
[szp]Mpb_Blood 7.50 2.54 2.70 2.52
WWS Tumor 22.2613.90 18.20 17.83
Liver 11.275.04 4.59 2.94
Spleen 11.105.92 5.49 3.42
Kidney 3.77 3.09 3.14 2.31
Lung 4.17 2.68 2.86 1.91
Tail 3.37 2.08 1.94 1.96
Carcass3.03 2.19 2.13 1.76
[3zp~MAb_Blood 1.08 0.62 0.4 0.19
CC49K1 Tumor 5.31 4.16 2.71 1.58
Liver 5.35 , 3.66 2.79 1.27
Spleen 6.53 4.75 3.66 1.63
Kidney 3.50 2.78 2.29 1.35
Lung 2.85 2.42 1.54 1.03
Tail 2.01 1.94 1.88 1.82
Carcass2.18 1.91 1.65 1.28
Blood 2.63 2.19 1.5 0.22
~b_ Tumor 7.73 9.14 12.40 7.98
CC49 Liver 5.97 2.69 1.56 0.21
Spleen 13.533.81 2.99 2.15
Kidney 1.26 0.89 0.60 0.60
Lung 1.65 1.14 0.76 0.14
Tail 2.85 1.62 0.64 0.29
Carcass0.82 0.56 0.39 0.07
[~zsl]fib-Blood 3.80 3.37 2.78 0.96
CC49 Tumor 8.15 9.62 12.44 9.29
Liver 7.31 3.56 2.10 0.39
Spleen 16.874.59 3.61 2.67
Kidney 1.81 1.36 0.95 1.00
Lung 2.48 1.84 1.36 0.49
Tail 4.34 2.29 0.96 0.55
Carcass0.91 0.69 0.55 0.19
106
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
SEQUENCE LISTING
<110> PBL Biomedical Laboratories
<120> PHOSPHORYLATED PROTEINS AND USES RELATED THERETO
<130> PBLI-PWO-007
<140>
<141>
<150> 60/208,240
<151> 2000-05-31
<l50> 60/255,296
<151> 2000-12-13
<160> 46
<170> PatentIn Ver. 2.1
<210> 1
<211> 4
<212> PRT
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: phosphorylated
peptide
<400> 1
Arg Arg Ala Ser
1
<210> 2
<211> 5
<212> PRT
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: phosphorylated
peptide
<400> 2
Arg Arg Ala Ser Val
1 5
<210> 3 ,
<211> 8
<212> PRT
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: phosphorylated
peptide
1 of 12
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
~ <400> 3
Arg Thr Lys Arg Ser Gly Ser Val
1 5
<210> 4
<211> 7
<212> PRT
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: phosphorylated
peptide
<400> 4
Arg Lys Arg Ser Arg Lys Glu
1 5
<210> 5
<211> 7
<212> PRT
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: phosphorylated
peptide
<400> 5
Leu Arg Arg Ala His Leu Gly
1 5
<210> 6
<211> 6
<212> PRT
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: phosphorylated
peptide
<400> 6
Ser Glu Glu Glu Glu G1u
1 5
<210> 7
<211> 10 ,
<212> PRT
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: phosphorylated
peptide
2of12
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
<400> 7
Arg Arg Arg Gl~u Glu Glu Thr Glu Glu Glu
1 5 10
<210> 8
<211> 10
<212> PRT
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: phosphorylated
peptide
<400> 8 '
Arg Arg Arg Glu Glu Glu Ser Glu Glu Glu
1 5 10
<210> 9
<211> 10
<212> PRT
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: phosphorylated
peptide
<400> 9
Arg Arg Arg Asp Asp Asp Ser Asp Asp Asp
1 5 10
<210> 10
<211> 10
<212> PRT
<213> Artificial Sequence
<220>
<221> SITE
<222> ( 7 ) .
<223> Xaa=Ser or Thr
<220>
<223> Description of Artificial Sequence: phosphorylated
peptide
<400> 10
Ala Ala Ala Ala Ala Ala Xaa Glu Glu Glu
1 5 , 10
<210> 11
<2l1> 10
<212> PRT
<213> Artificial Sequence
3of12
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
<220>
~ <221> SITE
<222> (7)
<223> Xaa=Ser or Thr
<220>
<223> Description of Artificial Sequence: p~osphorylated
peptide
<400> 11
Ala Ala Ala Glu Glu Glu Xaa Glu Glu Glu
1 5 10
<210> 12
<211> 8
<212> PRT
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: phosphorylated
peptide
<400> 12
Arg Arg Leu Ser 5er Leu Arg Ala
1 5
<210> 13
<211> 9
<212> PRT
<213> Artificial Sequence ,
<220>
<223> Description of Artificial Sequence: phosphorylated
peptide
<400> 13
Thr Glu Thr Ser Gln Val Ala Pro Ala
1 5
<210> 14
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 14
gtgaccgctg taccaacctc tgtcc 25
<210> 15
<211> 33
<212> DNA
4of12
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 15
ccctcgagtc acttgcccgg ggacagggag agg 33
<210> 16
<211> 27 ..
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:
oligodeoxynucleotide
<400> 16
gcagcctcca ccaggcgccc atcggtc 27
<210> 17
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:
oligodeoxynucleotide
<400> 17
gggcatgtgt gacgtctgtc acaagatttg 30
<210> 18
<211> 31
<212> DNA
<213> Artificial Sequence ,
<220>
<223> Description of Artificial Sequence:
oligodeoxynucleotide
<400> 18
cctggggctt cgcgaaggat ttcctgcaag g 31
<210> 19
<211> 30 ,
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:
oligodeoxynucleotide
Sofl2
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
<400> 19
~ gtgtcagttg gccggagggt tactttgagc 30
<210> 20
<211> 34
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of. Artificial Sequence:
oligodeoxynucleotide
<400> 20
cggtgggcat gagtgacgtc tgtcacaaga tttg 34
<210> 21
<211> 34
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:
oligodeoxynucleotide
<400> 21
cggtgggcat gagtgacgtc tgtcacaaga tttg 34
<210> 22
<211> 32
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 22
cccctcgagc caccatggag tggtcctggg tc 32
<210> 23
<211> 33
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 23
cccaagcttt ttggcgctgg agacggtgac cag 33
<210> 24
<211> 31
<212> DNA
6of12
y
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 24
cctctagacc accatggata gccaggccca g 31
<210> 25
<211> 32
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 25
gccgcggccc gtggatcctt cagttccagc tt 32
<210> 26
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 26
gtgacogctg taccaacctc tgtcc 25
<210> 27
<211> 33
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 27
ccctcgagtc acttgcccgg ggacagggag agg 33
<210> 28
<211> 27
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:
oligodeoxynucleotide
<400> 28
gcagcctcca ccaggcgccc atcggtc 27
7of12
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
~ <210> 29
<211> 30
<212> DNA
<2l3> Artificial Sequence
<220>
<223> Description of Artificial Sequence:
oligodeoxynucleotide
<400> 29
gggcatgtgt gacgtctgtc acaagatttg 30
<210> 30 '
<211> 31
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:
oligodeoxynucleotide
<400> 30
cctggggctt cgcgaaggat ttcctgcaag g 31
<210> 31
<211> 30 _
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:
oligodeoxynucleotide
<400> 31
gtgtcagttg gccggagggt tactttgagc 30
<210> 32
<211> 45
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: K2 fragment
<400> 32
ccgggcagaa gggcaagtct gcatagaagg gcaagtatga aggca 45
<210> 33
<211> 45
<212> DNA
<213> Artificial Sequence
8of12
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
<220>
' <223> Description of Artificial Sequence: K2 fragment
<400> 33
ccggtgcctt catacttcgc cttctatgga ctcatgctcc tctgc 45
<210> 34
<211> 13
<212> PRT
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: K2 fragment
<400> 34
Arg Arg Ala Ser Leu His Arg Arg Ala Ser Met Lys Ala
1 5 10
<2l0> 35
<211> 10
<212> PRT
<2l3> Artificial Sequence
<220>
<223> Description of Artificial Sequence: MAb-chCC49
upper
<400> 35
Glu Pro Lys Ser Cys Asp Lys Thr His Thr
Z 5 10
<210> 36
<211> 5
<212> PRT
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: MAb-chCC49
core
<400> 36
Cys Pro Pro Cys Pro
1 5
<210> 37
<21l> 8
<212> PRT
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: MAb-chCC49
lower
9of12
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
<400> 37
~ Ala Pro Glu Leu Leu Gly Gly Pro
l 5
<210> 38 ,
<211> 9
<212> PRT
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: MAb231 upper
<400> 38
Glu Pro Arg Gly Pro Thr Ile Lys Pro
1 5
<210> 39
<211> 7
<212> PRT
r213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: MAb231 core
<400> 39
Cys Pro Pro Cys Lys Cys Pro
1 5
<2l0> 40
<211> 8
<212> PRT
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: MAb231 lower
<400> 40
Ala Pro Asn Leu Leu Gly Gly Pro ,
1 5
<210> 41
<211> 6
<212> PRT
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: MAb61.1.3
upper
<400> 41
Val Pro Arg Asp Cys Gly
1 5
of 12
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
~ <210> 42
<211> 7
<212> PRT
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: MAb61.1.3 core
<400> 42
Cys Lys Pro Cys Ile Cys Thr
1 5
<210> 43
<211> 4
<212> PRT
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: MAb61.1.3
lower
<400> 43
Val Pro Glu Val
1
<210> 44
<211> 23
<212> PRT
<213> Artificial Sequence
<220>
<223> De cription of Artificial Sequence: MAb-chCC49
<400> 44
Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala
1 5 10 15
Pro Glu Leu Leu Gly Gly Pro
<210> 45
<211> 24
<212> PRT
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: MAb231
<400> 45
Glu Pro Arg Gly Pro Thr Ile Lys Pro Cys Pro Pro Cys Lys Cys Pro
1 5 10 15
11 of 12
CA 02410754 2002-11-28
WO 01/92469 PCT/USO1/17935
Ala Pro Asn Leu Leu Gly Gly Pro
<2l0> 46
<211> 17
<212> PRT
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: MAb61.1.3
<400> 46
Val Pro Arg Asp Cys Gly Cys T~ys Pro Cys Ile Cys Thr Val Pro Glu
1 5 10 15
Val
12 of 12
