Note: Descriptions are shown in the official language in which they were submitted.
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
COMPOSITIONS AND METHODS FOR THE DIAGNOSIS AND TREATMENT OF DISORDERS
INVOLVING ANGIOGENESIS
1. Field of the Invention
The present invention relates to compositions and methods useful for the
modulation (e.g., promotion or
inhibition) of angiogenesis and/or cardiovascularization in mammals in need of
such biological effect. The present
invention further relates to the diagnosis and treatment of disorders
involving angiogenesis (e.g., cardiovascular as
well as oncological disorders).
2. Background of the Invention
2.1. Angiogenesis
Angiogenesis, defined as the growth or sprouting of new blood vessels from
existing vessels, is a complex
process that primarily occurs during embryonic development. Under normal
physiological conditions in adults,
angiogenesis takes place only in very restricted situations such as hair
growth and wounding healing (Auerbach,
W. and Auerbach, R., 1994, Pha~macol Ther 63(3):265-3 11; Ribatti et a1.,1991,
Haematologica 76(4):3 11-20;
Risau,1997, Nature 386(6626):671-4). Unregulated angiogenesis has gradually
been recognized to be responsible
for a wide range of disorders, including, but not limited to cardiovascular
disease, cancer, rheumatoid arthritis,
psoriasis and diabetic retinopathy (Follcman, 1995, NatMed 1(1):27-31; Isner,
1999, Circulatiorx 99(13): 1653-5;
Loch,1998,ArthritisRlaeuf~a41(6):951-
62;Walsh,1999,R1Zeumatology(Oxfo~°d)38(2):103-12; Ware andSimons,
1997, Nat Med 3(2): 158-64).
2.2. Cardiac Disorders and Factors
Heart failure affects approximately five million Americans, and new cases of
heart failure number about
400,000 each year. It is the single most frequent cause of hospitalization for
people age 65 and older in the United
States. Recent advances in the management of acute cardiac diseases, including
acute myocardial infarction, are
resulting in an expanding patient populahion that will eventually develop
chronic heart failure. From 1979 to 1995,
hospitalizations for congestive heart failure (CHF) rose from 377,000 to
872,000 (a 130 percent increase) and CHF
deaths increased 116 percent.
CHF is a syndrome characterized by left ventricular dysfunction, reduced
exercise tolerance, impaired
quality of life, and markedly shortened life expectancy. The sine qua non of
heart failure is an inability of the heart
to pump blood at a rate sufficient to meet the metabolic needs of the body's
tissues (in other words, there is
insufficient cardiac output).
At least four major compensatory mechanisms are activated in the setting of
heart failure to boost cardiac
output, including peripheral vasoconstriction, increased heart rate, increased
cardiac contractility, and increased
plasma volume. These effects are mediated primarily by the sympathetic nervous
system and the renin-angiotensin
system. See, Eichhorn, American Journal of Medicine, 104: 163-169 (1998).
Increased output from the
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
sympathetic nervous system increases vascular tone, heart rate, and
contractility. Angiotensin II elevates blood
pressure by 1) directly stimulating vascular smooth muscle contraction, 2)
promoting plasma volume expansion by
stimulating aldosterone and antidiuretic hormone secretion, 3) stimulating
sympathetic-mediated vascular tone, and
4) catalyzing the degradation of bradykinin, which has vasodilatory and
natriuretic activity. See, review by Brown
and Vauglian, Circulation, 97:1411-1420 ( 1998). As noted below, angiotensin
II may also have directly deleterious
effects on the heart bypromoting myocyte necrosis (impairing systolic
function) and intracardiac fibrosis (impairing
diastolic and in some cases systolic function). ~'ee, Weber, Circulation, 96:
4065-4082 (1998).
A consistent feature of congestive heart failure (CHF) is cardiac hypertrophy,
an enlargement of the heart
that is activated by both mechanical and hormonal stimuli and enables the
heart to adapt to demands for increased
cardiac output. Morgan and Baker, Circulation, 83: 13-25 (1991). This
hypertrophic response is frequently
associated with a variety of distinct pathological conditions such as
hypertension, aortic stenosis, myocardial
infarction, cardiomyopathy, valvular regurgitation, and intracardiac shunt,
all of which result in chronic
hemodynamic overload.
Hypertrophy is generally defined as an increase in size of an organ or
structure independent of natural
growth that does not involve tumor formation. Hypertrophy of the heart is due
either to an increase in the mass of
the individual cells (myocytes), or to an increase in the number of cells
making up the tissue (hyperplasia), or both.
While the enlargement of an embryonic heart is largely dependent on an
increase in myocyte number (which
continues until shortly after birth), post-natal cardiac myocytes lose their
proliferative capacity. Further growth
occurs through hypertrophy of the individual cells.
Adult myocyte hypertrophy is initially beneficial as a short term response to
impaired cardiac function by
permitting a decrease in the load on individual muscle fibers. With severe,
long-standing overload, however, the
hypertrophied cells begin to deteriorate and die. Katz, "Heart Failure", in:
Katz A.M. ed., Phvsiolo~y of the Heart
(New York: Raven Press,1992) pp. 63 8-668. Cardiac hypertrophy is a
significant risk factor for both mortality and
morbidity in the clinical course of heart failure. Katz, Trends Cardiovasc.
Med., 5: 37-44 ( 1995). For further details
~5 of the causes and pathology of cardiac hypertrophy see, e.g., Heart
Disease. A Textbook of Cardiovascular
Medicine, Braunwald, E. ed. (W.B. Saunders Co., 1988), Chapter 14,
"Pathophysiology of Heart Failure."
On a cellular level, the heart is composed of myocytes and surrounding support
cells, generically called
non-myocytes. While non-myocytes are primarily fibroblastlmesenchymal cells,
they also include endothelial and
smooth muscle cells. Indeed, although myocytes make up most of the adult
myocardial mass, they represent only
about 30% of the total cell numbers present in heart. In response to hormonal,
physiological, hemodynamic, and
pathological stimuli, adult ventricular muscle cells can adapt to increased
workloads through the activation of a
hypertrophic process. This response is characterized by an increase in myocyte
cell size and contractile protein
content of individual cardiac muscle cells, without concomitant cell division
and activation of embryonic genes,
including the gene for atrial natriuretic peptide (ANP). Chien et al., FASEB
J., 5: 3037-3046 (1991); Chien et al.,
3 5 Annu. Rev. Physiol., 55: 77-95 ( 1993). An increment in myocardial mass as
a result of an increase in myocyte size
that is associated with an accumulation of interstitial collagen within the
extracellular matrix and around
intramyocardial coronary arteries has been described in left ventricular
hypertrophy secondary to pressure overload
2
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
in humans. Caspari et al., Cardiovasc. Res., 11: 554-558 (1977); Schwarz et
al., Am. J. Cardiol., 42: 895-903
(1978); Hess et al., Circulation, 63: 360-371 (1981); Pearlman et al., Lab.
Invest., 46: 158-164 (1982).
It has also been suggested that paracrine factors produced by non-myocyte
supporting cells may
additionallybe involved in the development of cardiac hypertrophy, and various
non-myocyte derived hypertrophic
factors, such as, leukocyte inhibitory factor (L1F) and endotlielin, have been
identified. Metcalf, Growth Factors,
7: 169-173 (1992); Kurzrock et al., Endocrine Reviews, 12: 208-217 (1991);
moue et al., Proc. Natl. Acad. Sci.
USA, 86: 2863-2867 (1989); Yanagisawa and Masaki, Trends Pharm. Sci., 10: 374-
378 (1989); U.S. Patent No.
5,573,762 (issued November 12, 1996). Further exemplary factors that have been
identified as potential mediators
of cardiac hyperixophy include cardiotrophin-1 (CT-1) (Pennica et al., Proc.
Nat. Acad. Sci. USA, 92: 1142-1146
(1995)), catecholamines, adrenocorticosteroids, angiotensin, and
prostaglandins.
At present, the treatment of cardiac hypertrophy varies depending on the
underlying cardiac disease.
Catecholamines, adrenocorticosteroids, angiotensin, prostaglandins, LIF,
endothelia (including endothelia-1, -2,
and -3 and big endothelia), and CT-1 are among the factors identified as
potential mediators of hypertrophy. For
example, beta-adrenergic receptor blocking drugs (beta-blockers, e.g.,
propranolol, timolol, tertalolol, carteolol,
nadolol, betaxolol, penbutolol, acetobutolol, atenolol, metoprolol,
carvedilol, etc.) and verapamil have been used
extensively in the treatment of hypertrophic cardiomyopathy. The beneficial
effects of beta-blockers on symptoms
(e.g., chestpain) and exercise tolerance are largely due to a decrease in the
heartrate with a consequentprolongation
of diastole and increased passive ventricular filling. Thompson et al., Br:
Heart J., 44: 488-98 (1980); Harrison et
al., Circulation, 29: 84-98 (1964). Verapamil has been described to improve
ventricular filling and probably
reducing myocardial ischemia. Bonow et al., Circulation, 72: 853-64 (1985).
Nifedipine and diltiazem have also been used occasionally in the treatment of
hypertrophic
cardiomyopathy. Lorell et al., Circulation, 65: 499-507 (1982); Betocchi et
al., Am. J. Cardiol., 78: 451-457
(1996). However, because of its potent vasodilating properties, nifedipine may
be harmful, especially in patients
with outflow obstruction. Disopyramide has been used to relieve symptoms by
virtue of its negative inotropic
properties. Pollick, N. En~l. J. Med., 307: 997-999 (1982). In many patients,
however, the initial benefits decrease
with time. Wigle et al., Circulation, 92: 1680-1692 (1995). Antihypertensive
drug therapy has been reported to
have beneficial effects on cardiac hypertrophy associated with elevated blood
pressure. Examples of drugs used
in antiliypertensive therapy, alone or in combination, are calcium
antagonists, e.g., nitrendipine; adrenergic receptor
blocking agents, e.g., those listed above; angiotensin converting enzyme (ACE)
inhibitors such as quinapril,
captopril, enalapril, ramipril, benazepril, fosinopril, and lisinopril;
diuretics, e.g., chlorothiazide,
hydrochlorothiazide, hydroflumethazide, methylchlothiazide, benzthiazide,
dichlorphenamide, acetazolamide, and
indapamide; and calcium channel Mockers, e.g., diltiazem, nifedipine,
verapamil, and nicardipine.
For example, treatment of hypertension with diltiazem and captopril showed a
decrease in left ventricular
muscle mass, but the Doppler indices of diastolic function did not normalize.
Szlachcic et al., Am. J. Cardiol., 63:
198-201 (1989); Shahi et al., Lancet, 336: 458-461 (1990). These findings were
interpreted to indicate that
excessive amounts of interstitial collagen may remain after regression of left
ventricular hypertrophy. Rossi et al.,
Am. Heart J., 124: 700-709 (1992). Rossi et al., supra, investigated the
effect of captopxil on the prevention and
3
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
regression of myocardial cell hypertrophy and interstitial fibrosis in
pressure overload cardiac hyperkrophy, in
experimental rats.
Agents that increase cardiac contractility directly (iontropic agents) were
initially thought to benefit
patients with heart failure because they improved cardiac output in the short
term. However, all positive inotropic
agents except digoxigenin have been found to result in increased long-term
mortality, in spite of short-term
improvements in cardiac performance. Massie, Curr. O~. in Cardiology, 12: 209-
217 (1997); Reddy et al., Curr.
O-pin. Cardiol.,12:233-241 (1997). Beta-adrenergicreceptorblockers
haverecentlybeenadvocatedforuseinheart
failure. Evidence from clinical trials suggests that improvements in cardiac
function can be achieved without
increased mortality, though documented improvements of patient survival have
not yet been demonstrated. See
also, U.S. Pat. Nos. 5,935,924, 5,624,806; 5,661,122; and 5,610,134 and WO
95/28173 regarding the use of
cardiotropin-1 or antagonists thereof, or growth hormone and/or insulin-like
growth factor-I in the treatment of
CHF. Another treatment modality is heart transplantation, but this is limited
by the availability of donor hearts.
Endothelia is a vasoconstricting peptide comprising 21 amino acids, isolated
from swine arterial
endothelial culture supernatant and structurally determined. Yanagisawa et
al., Nature, 332: 411-415 (1988).
Endothelia was later found to exhibit various actions, and endothelia
antibodies as endothelia antagonists have
proven effective in the treatment of myocardial infarction, renal failure, and
other diseases. Since endotlielin is
present in live bodies and exhibits vasoconstricting action, it is expected to
be an endogenous factor involved in the
regulation of the circulatory system, and may be associated with hypertension,
cardiovascular diseases such as
myocardial infarction, and renal diseases such as acute renal failure.
Endothelia antagonists are described, for
example, in U.S. Pat. No. 5,773,414; JP Pat. Publ. 3130299/1991, EP 457,195;
EP 460,679; and EP 552,489. A
new endothelia B receptor for identifying endothelia receptor antagonists is
described in U.S. Pat. No. 5,773,223.
Current therapy for heart failure is primarily directed to using angiotensin-
converting enzyme (ACE)
inhibitors, such as captopril, and diuretics. These drugs improve hemodynamic
profile and exercise tolerance and
reduce the incidence of morbidity and mortality in patients with CHF. Kramer
et al., Circulation, 67 4 : 807-816
(1983); Captopril Multicenter Research Group, J.A.C.C., 2 4 : 755-763 (1983);
The CONSENSUS Trial Study
Group, N. En~l. J. Med., 316 23 :1429-1435 (1987); The SOLVD Investigators, N.
Enal. J. Med., 325 5 : 293-302
(1991). Further, they are useful in treating hypertension, left ventricular
dysfunction, atherosclerotic vascular
disease, and diabetic nephropathy. Brown and Vaughan, supra. However, despite
proven efficacy, response to
ACE inhibitors has been limited. For example, while prolonging survival in the
setting of heart failure, ACE
inhibitors appear to slow the progression towards end-stage heart failure, and
substantial numbers of patients on
ACE inhibitors have functional class III heart failure.
Moreover, improvement of functional capacity and exercise time is only small
and mortality, although
reduced, continues to be high. The CONSENSUS Trial Study Group, N. En~l. J.
Med., 316 23 :1429-1453 (1987);
The SOLVD Investigators, N. En~l. J. Med., 325 5 : 293-302 (1991); Cohn et
al., N. En~l. J. Med., 325 5 : 303-310
(1991); The Captopril-Digoxin Multicenter Research Group, JAMA, 259 4 : 539-
544 (1988). Hence, ACE
inhibitors consistently appear unable to relieve symptoms in more than 60% of
heart failure patients and reduce
mortality of heart failure only by approximately 15-20%. For further adverse
effects, see Brown and Vaughan,
4
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
supra.
An alternative to ACE inhibitors is represented by specific ATl receptor
antagonists. Clinical studies are
planned to compare the efficacy of these two modalities in the treatment of
cardiovascular and renal disease.
However, animal model data suggests that the ACEIAng II pathway, while clearly
involved in cardiac hypertrophy,
is not the only, or even the primary pathway active in this role. Mouse
genetic "knockout" models have been made
to test individual components of the pathway. In one such model, the primary
cardiac xeceptor for Ang II, AT sub
1A, has been genetically deleted; tliese mice do not develop hypertrophy when
Ang II is given experimentally
(confirming the basic success of the model in eliminating hypertrophy
secondary to Ang II). However, when the
aorta is constricted in these animals (a model of hypertensive cardiac
stress), the hearts still become hypertrophic.
This suggests that alternative signaling pathways, not depending on this
receptor (AT sub 1A), are activated in
hypertension. ACE inhibitors would presumably not be able to inhibit these
pathways. See, Harada et al.,
Circulation, 97: 1952-1959 (1998). See also, Homcy, Circulation, 97: 1890-1892
(1998) regarding the enigma
associated with the process and mechanism of cardiac hypertrophy.
About 750,000 patients suffer from acute myocardial infarction (AMI) annually,
and approximately
one-fourth of all deaths in the United States are due to AMI. In recent years,
thrombolytic agents, e.g.,
streptokinase, urokinase, and in particular tissue plasminogen activator (t-
PA) have significantly increased the
survival of patients who suffered myocardial infarction. When administered as
a continuous intravenous infusion
over 1.5 to 4 hours, t-PA produces coronary potency at 90 minutes in
69°!o to 90% of the treated patients. Topol
et al., Am. J. Cardiol., 61: 723-728 (1988}; Neuhaus et al., J. Am. Coll.
Cardiol., 12: 581-587 (1988); Neuhaus et
al., J. Am. Coll. Cardiol., 14: 1566-1569 (1989). The highest potency rates
have been reported with high dose or
accelerated dosing regimens. Topol, J. Am. Coll. Cardiol., 15: 922-924 (1990).
t-PA may also be administered as
a single bolus, although due to its relatively short half life, it is better
suited for infusion therapy. Tebbe et al., Am.
J. Cardiol., 64: 448-453 (1989). A t-PA variant, specifically designed to have
longer half life and very high fibrin
specificity, TNK t-PA (a T103N, N117Q, KHRR(296-299)AAAA t-PA variant, Keyt et
al., Proc. Natl. Acad. Sci.
USA, 91: 3670-3674 (1994)) is particularly suitable for bolus administration.
However, despite all these advances,
the long-term prognosis of patient survival depends greatly on the post-
infarction monitoring and treatment of the
patients, which should include monitoring and treatment of cardiac
hypertrophy.
2.3. Growth Factors
3 0 Various naturally occurring polypeptides reportedly induce the
proliferation of endothelial cells. Among
those polypeptides are the basic and acidic fibroblast growth factors (FGF)
(Burgess and Maciag, Annual Rev.
Biochem., 58: 575 (1989)), platelet-derived endothelial cell growth factor (PD-
ECGF) (Ishikawa et al., Nature, 338:
557 (1989)), and vascular endothelial growth factor (VEGF). Leung et al.,
Science, 246: 1306 (1989); Ferrara and
Henzel, Biochem. Biophvs. Res. Commun., 161: 851 (1989); Tischer et al.,
Biochem. Bio~hys. Res. Commun.,
165: 1198 (1989); EP 471,754B granted July 31, 1996.
Media conditioned by cells transfected with the human VEGF (hVEGF) cDNA
promoted the proliferation
of capillary endothelial cells, whereas control cells did not. Leung et al.,
Science, 246: 1306 (1989). Several
5
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
additional cDNAs were identified in human cDNA libraries that encode 121-, 189-
, and 206-amino acid isoforms
of hVEGF (also collectively referred to as hVEGF-related proteins). The 121-
amino acid protein differs from
hVEGF by virtue of the deletion of the 44 amino acids between residues 116 and
1 S9 in hVEGF. The 189-amino
acid protein diffexs from hVEGF by virtue of the insertion of 24 amino acids
at residue 116 in hVEGF, and
apparently is identical to human vascular permeability factor (hVPF). Tlie 206-
amino acid protein differs from
hVEGF by virtue of an insertion of 41 amino acids at residue 116 in hVEGF.
Houck et al. , Mol. Endocrin., 5: 1806
(1991); Ferrara et al., J. Cell. Biochem., 4?: 211 (1991); Ferrara et al.,
Endacriiie Reviews, 13: 18 (1992); Keck
et al., Science, 246: 1309 (1989); Connolly et al., J. Biol. Chem., 264: 20017
(1989); EP 370,989 published May
30, 1990.
It is now well established that angiogenesis, which involves the formation of
new blood vessels from
preexisting endothelium, is implicated in the pathogenesis of a variety of
disorders. These include solid tumors and
metastasis, atherosclerosis, retrolental fibroplasia, hemangiomas, chronic
inflammation, intraocular neovascular
syndromes such as proliferative retinopathies, e.g., diabetic retinopathy, age-
related macular degeneration (AMD),
neovascular glaucoma, immune rejection of transplanted corneal tissue and
other tissues, rheumatoid arthritis, and
psoriasis. Follcman etal., J. Biol. Chem., 267: 10931-10934 (1992); Klagsbrun
etal., Annu. Rev. Physiol., S3: 217-
239 (1991); and Garner A., "Vascular diseases'; In: Pathobioloey
ofOcularDisease. ADynamic Approach Garner
A., Klintworth GK, eds., 2nd Edition (Marcel Dekker, NY, 1994), pp 1625-1710.
In the case of tumor growth, angiogenesis appears to be crucial for the
transition from hyperplasia to
neoplasia, and for providing nourishment for the growth and metastasis of the
tumor. Follaman et al., Nature, 339:
58 ( 1989). The neovascularization allows the tumor cells to acquire a growth
advantage andproliferative autonomy
compared to the normal cells. A tumor usually begins as a single aberrant cell
which can proliferate only to a size
of a few cubic millimeters due to the distance from available capillary beds,
and it can stay'dormant' without further
growth and dissemination for a long period of time. Some tumor cells then
switch to the angiogenic phenotype to
activate endothelial cells, which proliferate and mature into new capillary
blood vessels. These newly formed blood
vessels not only allow for continued growth of the primary tumor, but also for
the dissemination and recolonization
of metastatic tumor cells. Accordingly, a correlation has been observed
between density of microvessels in tumor
sections and patient survival in breast cancer as well as in several other
tumors. Weidner et al., N. En~l. J. Med,
324: 1-6 (1991); Horak et al., Lancet, 340: 1120-1124 (1992); Macchiarini et
al., Lancet, 340: 14S-146 (1992).
The precise mechanisms that control the angiogenic switch is not well
understood, but it is believed that
neovascularization of tumor mass results from the net balance of a multitude
of angiogenesis stimulators and
inhibitors (Follcman, 1995, NatMed 1(1):27-31).
The search for positive regulators of angiogenesis has yielded many
candidates, including aFGF, bFGF,
TGF-a, TGF-(3, HGF, TNF-a, angiogenin, IL-8, etc. Folkman et al., J.B.C.,
supra, and Klagsbrun et al., supra. The
negative regulators so far identified include thrombospondin (Good et al ,
Proc. Natl. Acad. Sci. USA., 87: 6624-
6628 (1990)), the 16-kilodalton N-terminal fragment ofprolactin (Clapp et al.,
Endocrinolo~y, 133: 1292-1299
(1993)), angiostatin (O'Reilly et al., Cell, 79: 31S-328 (1994}}, and
endostatin. O'Reilly et al., Cell, 88: 277-28S
(1996).
6
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
Work done over the last several years has established the key role of VEGF,
not only in stimulating
vascular endothelial cell proliferation, but also in inducing vascular
permeability and angiogenesis. Ferrara et al.,
Endocr. Rev.,18: 4-25 (1997). The fording that the loss of even a single VEGF
allele results in embryonic lethality
points to an irreplaceable role played by this factor in the development and
differentiation of the vascular system.
Furthermore, VEGF has been shown to be a key mediator of neovascularization
associated with tumors and
intraocular disorders. Ferrara et al., Endocr. Rev., supf-a. The VEGF mRNA is
overexpressed by the majority of
human tumors examined. Berkman et al., J. Clin. Invest., 91: 153-159 (1993);
Brown et al., Human Pathol.. 26:
86-91 (1995); Brown et al., CancerRes., 53: 4727-4735 (1993); Mattern et al.,
Brit. J. Cancer, 73: 931-934 (1996);
Dvorak et al., Am. J. Pathol.. 146: 1029-1039 (1995).
Also, the concentration levels of VEGF in eye fluids are highly correlated to
the presence of active
proliferation of blood vessels in patients with diabetic and other ischemia-
related retinopathies. Aiello et al., N.
En~l. J. Med., 331: 1480-1487 (1994). Furthermore, recent studies have
demonstrated the localization of VEGF
in choroidal neovascular membranes in patients affected by AMD. Lopez et al.,
Invest. Onhthalmol. Vis. Sci., 37:
855-868 (1996).
Anti-VEGF neutralizing antibodies suppress the growth of a variety ofhuman
tumor cell lines in, nude mice
(Kim et al., Nature, 362: 841-844 (1993); Warren et al., J. Clin. Invest., 95:
1789-1797 (1995); Borgstrom et al.,
Cancer Res., 56: 4032-4039 (1996); Melnyk et al., Cancer Res., 56: 921-924
(199b)) and also inhibit intraocular
angiogenesis in models of ischemic retinal disorders. Adamis et al., Arch.
Ophthalinol., 114: 66-71 (1996).
Therefore, anti-VEGF monoclonal antibodies or other inhibitors of VEGF action
are promising candidates for the
treatment of solid tumors and various intraocular neovascular disorders. Such
antibodies are described, for example,
in EP 817,648 published January 14,1998 and in WO98/45331 and WO98/45332
bothpublished October 15,1998.
There exist several other growth factors and mitogens, including transforming
oncogenes, that are capable
of rapidly inducing a complex set of genes to be expressed by certain cells.
Lau and Nathans, Molecular Aspects
of Cellular Reeulation, 6: 165-202 (1991). These genes, which have been named
immediate-early- or early-
response genes, are transcriptionally activated within minutes after contact
with a growth factor or mitogen,
independent ofde navo protein synthesis. A group of these intermediate-early
genes encodes secreted, extracellular
proteins that are needed for coordination of complex biological processes such
as differentiation and proliferation,
regeneration, and wound healing. Ryseck et al., Cell Growth Differ., 2: 235-
233 (1991).
Highly-related proteins that belong to this group include cef 10 (Simmons et
al., Proc. Nat!. Acad. Sci.
USA, 86:1178-1182 ( 1989)), cyr 61, which is rapidly activated by serum- or
platelet-derived growth factor (PDGF)
(O'Brien et al., Mol. Cell Biol., 10: 3569-3577 (1990), human connective
tissue growth factor (CTGF) (Bradham
et al., J. Cell. Biol., 114: 1285-1294 (1991)), which is secreted by human
vascular endothelial cells in high levels
after activation with transforming growth factor beta (TGF-(3), exhibits PDGF-
like biological and immunological
activities, and competes with PDGF for aparticular cell surface receptor, fisp-
12 (Ryseck et al., Cell Growth Differ.,
2: 235-233 (1991)), human vascular IBP-like growth factor (VIGF) (WO
96117931), and nov, normally arrested
in adult kidney cells, which was found to be overexpressed in myeloblastosis-
associated-virus-type-1-uiduced
nephroblastomas. Joloit et al., Mol. Cell. Biol., 12: 10-21 (1992). '
7
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
The expression of these immediate-early genes acts as "third messengers" in
the cascade ofevents triggered
by growth factors. It is also thought that they are needed to integrate and
coordinate complex biological processes,
such as differentiation and wound healing in which cell proliferation is a
common event.
As additional mitogens, insulin-like growth factor binding proteins (IGFBPs)
have been shown, in complex
with insulin-like growth factor (IGF), to stimulate increased binding of IGF
to fibroblast and smooth muscle cell
surface receptors. Clemmons et al., J. Clin. Invest., 77: 1548 (1986).
Inhibitory effects of IGFBP on various IGF
actions in vitro include stimulation of glucose transport by adipocytes,
sulfate incorporation by chondrocytes, and
thymidine incorporation in fibroblast. Zapf et al., J. Clin. Invest., 63: 1077
(1979). In addition, inhibitory effects
of IGFBPs on growth factor-mediated mitogen activity in normal cells have been
shown.
2.4. Need for Further Treatments
In view of the role of vascular endothelial cell growth and angiogenesis in
many diseases and disorders,
it is desirable to have a means of reducing or inhibiting one or more of the
biological effects causing these
processes. It is also desirable to have a means'of assaying for the presence
of pathogenic polypeptides in normal
and diseased conditions, and especially cancer. Further, in a specific aspect,
as there is no generally applicable
therapy for the treatment of cardiac hypertrophy, the identification of
factors that can prevent or reduce cardiac
myocyte hypertrophy is of primary importance in the development of new
therapeutic strategies to inhibit
pathophysiological cardiac growth. While there are several treatment
modalities for various cardiovascular and
oncologic disorders, there is still a need for additional therapeutic
approaches.
Summarv of the Invention
The present invention provides compositions and methods for modulating (e.g.,
promoting or inhibiting)
angiogenesis and/or cardiovascularization in mammals. The present invention is
based on the identification of
compounds (i. e., proteins) that test positive in various cardiovascular
assays that test modulation (e.g., promotion
or inhibition) of certain biological activities. Accordingly, the compounds
are believed to be useful drugs and/or
drug components for the diagnosis and/or treatment (including prevention and
amelioration) ofdisorders where such
effects are desired, such as the promotion or inhibition of angiogenesis,
inhibition or stimulation of vascular
endothelial cell growth, stimulation of growth or proliferation of vascular
endothelial cells, inhibition of tumor
growth, inhibition of angiogenesis-dependent tissue growth, stimulation of
angiogenesis-dependent tissue growth,
inhibition of cardiac hypertrophy and stimulation of cardiac hypertrophy,
e.g., for the treatment of congestive heart
failure. In addition, the compositions and methods of the inventionprovide for
the diagnostic monitoring ofpatients
undergoing clinical evaluation for the treatment of angiogenesis-related
disorders, for monitoring the efficacy of
compounds in clinical trials and for identifying subjects who may be
predisposed to such angiogenic-related
disorders.
In one embodiment, the present invention provides a composition comprising a
PRO polypeptide, an
agonist or antagonist thereof, or an anti-PRO antibody in admixture with a
pharmaceutically acceptable carrier. In
one aspect, the composition comprises a therapeutically effective amount of
the polypeptide, agonist, antagonist
8
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
or antibody. In another aspect, the composition comprises a further active
ingredient, namely, a cardiovascular,
endothelial or angiogenic agent or an angiostatic agent, preferably an
angiogenic or angiostatic agent. Preferably,
the composition is sterile. The PRO polypeptide, agonist, antagonist or
antibody may be administered in the form
of a liquid pharmaceutical formulation, which may be preserved to achieve
extended storage stability. Preserved
liquid pharmaceutical formulations might contain multiple doses of PRO
polypeptide, agonist, antagonist or
antibody, and might, therefore, be suitable for repeated use. In a preferred
embodiment, where the composition
comprises an antibody, the antibody is a monoclonal antibody, an antibody
fragment, a humanized antibody, or a
single-chain antibody.
In a further embodiment, the present invention provides a method for preparing
such a composition useful
for the treatment of a cardiovascular, endothelial or angiogenic disorder
comprising admixing a therapeutically
effective amount of a PRO polypeptide, agonist, antagonist or antibody with a
pharmaceutically acceptable carrier.
In a still further aspect, the present invention provides an article of
manufacture comprising:
(a) a composition of matter comprising a PRO polypeptide or agonist or
antagonist thereof;
(b) a container containing said composition; and
(c) a label affixed to said container, or a package insert included in said
container referring to the use of
said PRO polypeptide or agonist or antagonist thereof in the treatment of a
cardiovascular, endothelial or angiogenic
disorder, wherein the agonist or antagonist may be an antibody which binds to
the PRO polypeptide. The
composition may comprise a therapeutically effective amount of the PRO
polypeptide or the agonist or antagonist
thereof.
In another embodiment, the present invention provides a method for identifying
an agonist of a PRO
polypeptide comprising:
(a) contacting cells and a test compound to be screened under conditions
suitable for the induction of a
cellular response normally induced by a PRO polypeptide; and
(b) determining the induction of said cellular response to determine if the
test compound is an effective
agonist, wherein the induction of said cellular response is indicative of said
test compound being an effective
agonist.
In another embodiment, the present invention provides a method for identifying
an agonist of a PRO
polypeptide comprising:
(a) contacting cells and a test compound to be screened under conditions
suitable for the stimulation of cell
proliferation by a PRO polypeptide; and
(b) measuring the proliferation of said cells to determine if the test
compound is an effective agonist,
wherein the stimulation of cell proliferation is indicative of said test
compound being an effective agonist.
In another embodiment, the invention provides a method for identifying a
compound that inhibits the
activity of a PRO polypeptide comprising contacting a test compound with a PRO
polypeptide under conditions
3 5 and for a time sufficient to allow the test compound and polypeptide to
interact and determining whether the activity
of the PRO polypeptide is inhibited. In a specific preferred aspect, either
the test compound or the PRO polypeptide
is immobilized on a solid support. In another preferred aspect, the non-
immobilized component carries a detectable
9
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
label. In a preferred aspect, this method comprises the steps of
(a) contacting cells and a test compound to be screened in the presence of a
PRO polypeptide under
conditions suitable for the induction of a cellular response normally induced
by a PRO polypeptide; and
(b) determining the induction of said cellular response to determine if the
test compound is an effective
antagonist.
In another preferred aspect, this process comprises the steps of:
(a) contacting cells and a test compound to be screened in the presence of a
PRO polypeptide under
conditions suitable for the stimulation of cell proliferation by a PRO
polypeptide; and
(b) measuring the proliferation of the cells to determine if the test compound
is an effective antagonist.
In another embodiment, the invention provides a method for identifying a
compound that inhibits the
expression of a PRO polypeptide in cells that normally expresses the
polypeptide, wherein the method comprises
contacting the cells with a test compound and determining whether the
expression of the PRO polypeptide is
inhibited. In a preferred aspect, this method comprises the steps of:
(a) contacting cells and a test compound to be screened under conditions
suitable for allowing expression
of the PRO polypeptide; and
(b) determining the inhibition of expression of said polypeptide.
In a still further embodiment, the invention provides a compound that inhibits
the expression of a PRO
polypeptide, such as a compound that is identified by the methods set forth
above.
Another aspect of the present invention is directed to an agonist or an
antagonist of a PRO polypeptide
which may optionally be identified by the methods described above.
One type of antagonist of a PRO polypeptide that inhibits one or more of the
functions or activities of the
PRO polypeptide is an antibody. Hence, in another aspect, the invention
provides an isolated antibody that binds
a PRO polypeptide. In a preferred aspect, the antibody is a monoclonal
antibody, which preferably has non-human
complementarity-determining-region (CDR) residues and human framework-region
(PR) residues. The antibody
may be labeled and may be immobilized on a solid support. In a further aspect,
the antibody is an antibody
fragment, a single-chain antibody, or a humanized antibody. Preferably, the
antibody specifically binds to the
polypeptide.
In a still further aspect, the present invention provides a method for
diagnosing a disease or susceptibility
to a disease which is related to a mutation in a PRO polypeptide-encoding
nucleic acid sequence comprising
3 0 determining the presence or absence of said mutation in the PRO
polypeptide nucleic acid sequence, wherein the
presence or absence of said mutation is indicative of the presence of said
disease or susceptibility to said disease.
In a still further aspect, the invention provides a method of diagnosing a
cardiovascular, endothelial or
angiogenic disorder in a mammal which comprises analyzing the level of
expression of a gene encoding a PRO
polypeptide (a) in a test sample of tissue cells obtained from said mammal,
and (b) in a control sample of known
3 5 normal tissue cells of the same cell type, wherein a higher or lower
expression level in the test sample as compared
to the control sample is indicative of the presence of a cardiovascular,
endothelial or angiogenic disorder in said
mammal. The expression of a gene encoding a PRO polypeptide may optionally be
accomplished by measuring
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
the level of mRNA or the polypeptide in the test sample as compared to the
control sample.
In a still further aspect, the present inventionprovides a method of
diagnosing a cardiovascular, endothelial
or angiogenic disorder in a mammal which comprises detecting the presence or
absence of a PRO polypeptide in
a test sample of tissue cells obtained from said mammal, wherein the presence
or absence of said PRO polypeptide
in said test sample is indicative of the presence of a cardiovascular,
endothelial ox angiogenic disorder in said
mammal.
In a still further embodiment, the invention provides a method of diagnosing a
cardiovascular, endothelial
or angiogenic disorder in a mammal comprising (a) contacting an anti-PRO
antibody with a test sample of tissue
cells obtained from the mammal, and (b) detecting the formation of a complex
between the antibody and the PRO
polypeptide in the test sample, wherein the formation of said complex is
indicative of the presence of a
cardiovascular, endothelial or angiogenic disorder in the mammal. The
detection may be qualitative or quantitative,
and may be performed in comparison with monitoring the complex formation in a
control sample of known normal
tissue cells of the same cell type. A larger or smaller quantity of complexes
formed in the test sample indicates the
presence of a cardiovascular, endothelial or angiogenic dysfunction in the
mammal from which the test tissue cells
were obtained. The antibody preferably carnes a detectable label. Complex
formation can be monitored, for
example, by light microscopy, flow cytometry, fluorimetry, or other techniques
known in the art. The test sample
is usually obtained from an individual suspected to have a cardiovascular,
endothelial or angiogenic disoxder.
In another embodiment, the invention provides a method for determining the
presence of a PRO
polypeptide in a sample comprising exposing a sample suspected of containing
the PRO polypeptide to an anti-PRO
antibody and determining binding of said antibody to a component of said
sample. In a specific aspect, the sample
comprises a cell suspected of containing the PRO polypeptide and the antibody
binds to the cell. The antibody is
preferably detectably labeled and/or bound to a solid support.
In further aspects, the invention provides a cardiovascular, endothelial or
angiogenic disorder diagnostic
kit comprising an anti-PRO antibody and a carrier in suitable packaging.
Preferably, such kit further comprises
instructions for using said antibody to detect the presence of the PRO
polypeptide. Preferably, the carrier is a
buffer, for example. Preferably, the cardiovascular, endothelial or angiogenic
disorder is cancer.
In yet another embodiment, the present invention provides a method for
treating a cardiovascular,
endothelial or angiogenic disorder in a mammal comprising administering to the
mammal an effective amount of
a PRO polypeptide. Preferably, the disorder is cardiac hypertrophy, trauma
such as wounds or burns, or a type of
cancer. In a further aspect, the mammal is further exposed to angioplasty or a
drug that treats cardiovascular,
endothelial or angiogenic disorders such as ACE inhibitors or chemotherapeutic
agents if the cardiovascular,
endothelial or angiogenic disorder is a type of cancer. Preferably, the mammal
is human, preferably one who is at
risk of developing cardiac hypertrophy and more preferably has suffered
myocardial infarction.
In another preferred aspect, the cardiac hypertrophy is characterized by the
presence of an elevated level
3 5 of PGFza. Alternatively, the cardiac hypertrophy may be induced by
myocardial infarction, wherein preferably the
administration of the PRO polypeptide is initiated within 48 hours, more
preferably within 24 hours, following
myocardial infarction.
11
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
In another preferred embodiment, the cardiovascular, endothelial or angiogenic
disorder is cardiac
hypertrophy and said PRO polypeptide is administered together with a
cardiovascular, endothelial or angiogenic
agent. The preferred cardiovascular, endothelial or angiogenic agent for this
purpose is selected from the group
consisting of an antihypertensive drug, an ACE inhibitor, an endothelin
receptor antagonist and a tlirombolytic
agent. If a thrombolytic agent is administered, preferably the PRO polypeptide
is administered following
administration of such agent. More preferably, the thrombolytic agent is
recombinant human tissue plasminogen
activator.
In another preferred aspect, the cardiovascular, endothelial or angiogenic
disorder is cardiac hypertrophy
and the PRO polypeptide is administered following primary angioplasty for the
treatment of acute myocardial
infarction, preferably wherein the mammal is further exposed to angioplasty or
a cardiovascular, endothelial, or
angiogemc agent.
In another preferred embodiment, the cardiovascular, endothelial or angiogenic
disorder is a cancer and
the PRO polypeptide is administered in combination with a chemotherapeutic
agent, a growth inhibitory agent or
a cytotoxic agent.
In a further embodiment, the invention provides a method for treating a
cardiovascular, endothelial or
angiogenic disorder in a mammal comprising administering to the mammal an
effective amount of a PRO
polypeptide agonist, antagonist or anti-PRO antibody. Preferably, the
cardiovascular, endothelial or angiogenic
disorder is cardiac hypertrophy, trauma, a cancer, or age-related macular
degeneration. Also preferred is where the
mammal is human, and where an effective amount of an angiogenic or angiostatic
agent is administered in
conjunction with the agonist, antagonist or anti-PRO antibody.
In still further embodiments, the invention provides a method for treating a
cardiovascular, endothelial or
angiogenic disorder in a mammal that suffers therefrom comprising
administering to the mammal a nucleic acid
molecule that codes for either (a) a PRO polypeptide, (b) an agonist of a PRO
polypeptide or (c) an antagonist of
a PRO polypeptide, wherein said agonist or antagonist may be an anti-PRO
antibody. In a preferred embodiment,
the mammal is human. In another preferred embodiment, the gene is administered
via ex viva gene therapy. In a
further preferred embodiment, the gene is comprised within a vector, more
preferably an adenoviral,
adeno-associated viral, lentiviral, or retroviral vector.
In yet another aspect, the inventionprovides a recombinantretroviralparticle
comprising a retroviral vector
consisting essentially of a promoter, nucleic acid encoding (a) a PRO
polypeptide, (b) an agonist polypeptide of a
PRO polypeptide, or (c) an antagonist polypeptide of a PRO polypeptide, and a
signal sequence for cellular
secretion of the polypeptide, wherein the retroviral vector is in association
with retroviral structural proteins.
Preferably, the signal sequence is from a mammal, such as from a native PRO
polypeptide.
In a still further embodiment, the invention supplies an ex vivo producer cell
comprising a nucleic acid
construct that expresses retroviral structural proteins and also comprises a
retroviral vector consisting essentially
of a promoter, nucleic acid encoding (a) a PRO polypeptide, (b) an agonist
polypeptide of a PRO polypeptide or
(c) an antagonist polypeptide of a PRO polypeptide, and a signal sequence for
cellular secretion of the polypeptide,
wherein said producer cell packages the retroviral vector in association with
the structural proteins to produce
12
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
recombinant retroviral particles.
In yet another embodiment, the invention provides a method for inhibiting
endothelial cell growth in a
mammal comprising administering to the mammal (a) a PRO polypeptide, (b) an
agonist of a PRO polypeptide, or
(c) an antagonist of a PRO polypeptide, wherein endothelial cell growth in
said mammal is inhibited, and wherein
said agonist or antagonist may be an anti-PRO antibody. Preferably, the mammal
is human and the endothelial cell
growth is associated with a tumor or a retinal disorder.
In yet another embodiment, the invention provides a method for stimulating
endothelial cell growth in a
mammal comprising administering to the mammal (a) a PRO polypeptide, (b) an
agonist of a PRO polypeptide,
or (c) an antagonist of a PRO polypeptide, wherein endothelial cell growth in
said mammal is stimulated, and
wherein said agonist or antagonist may be an anti-PRO antibody. Preferably,
the mammal is human.
In yet anotlier embodiment, the invention provides a method for inhibiting
cardiac hypertrophy in a
mammal comprising administering to the mammal (a) a PRO polypeptide, (b) an
agonist of a PRO polypeptide, or
(c) an antagonist of a PRO polypeptide, wherein cardiac hypertrophy in said
mammal is inhibited, and wherein said
agonist or antagonist may be an anti-PRO antibody. Preferably, the mammal is
human and the cardiac hypertrophy
has been induced by myocardial infarction.
In yet another embodiment, the invention provides a method for stimulating
cardiac hypertrophy in a
mammal comprising administering to the mammal (a) a PRO polypeptide, (b) an
agonist of a PRO polypeptide, or
(c) an antagonist of a PRO polypeptide, wherein cardiac hypertrophy in said
mammal is stimulated, and wherein
said agonist or antagonist may be an anti-PRO antibody. Preferably, the mammal
is human who suffers from
congestive heart failure.
In yet another embodiment, the invention provides a method for inhibiting
angiogenesis induced by a PRO
polypeptide in a mammal comprising administering a therapeutically effective
amount of an anti-PRO antibody to
the mammal. Preferably, the mammal is a human, and more preferably the mammal
has a tumor or a retinal
disorder.
In yet another embodiment, the invention provides a method for stimulating
angiogenesis induced by a
PRO polypeptide in a mammal comprising administering a therapeutically
effective amount of a PRO polypeptide
to the mammal. Preferably, the mammal is a human, and more preferably
angiogenesis would promote tissue
regeneration or wound healing.
In yet another embodiment, the inventionprovides a method formodulating (e.g.,
inhibiting or stimulating)
endothelial cell growth in a mammal comprising administering to the mammal a
PR021, PR0181, PR0205,
PR0214, PRO221, PR0229, PR0231, PR0238, PR0241, PR0247, PR0256, PR0258,
PR0263, PR0265,
PR0295, PR0321, PR0322, PR0337, PR0363, PR0365, PRO444, PR0533, PR0697,
PR0720, PR0725,
PR0771, PR0788, PR0791, PR0819, PR0827, PR0828, PR0836, PR0846, PR0865,
PRO1005, PR01006,
PR01007, PR01025, PR01029, PR01054, PR01071, PR01075, PR01079, PR01080,
PR01114, PR01131,
PRO1155, PR01160, PR01184, PR01186, PR01190, PR01192, PR01195, PR01244,
PR01272, PR01273,
PRO1274, PR01279, PR01283, PR01286, PR01306, PR01309, PR01325, PR01329,
PR01347, PR01356,
PR01376, PR01382, PRO1411, PR01412, PR01419, PR01474, PR01477, PR01488,
PR01508, PRO1550,
13
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
PR01556, PR01760, PR01782, PR01787, PR01801, PR01868, PR01887, PR01890,
PR03438, PR03444,
PR04302, PR04324, PR04333, PR04341, PR04342, PR04353, PR04354, PR04356,
PR04371, PR04405,
PR04408, PR04422, PR04425, PR04499, PR05723, PR05725, PR05737, PR05776,
PR06006, PR06029,
PR06071, PR07436, PR09771, PR09821, PR09873, PR010008, PR010096, PR019670,
PR020040,
PR020044, PR021055, PR021384 or PR028631 polypeptide, agonist or antagonist
thereof, wherein endothelial
cell growth in said mammal is modulated.
In yet another embodiment, the inventionprovides a method formodulating (e.g.,
inhibiting or stimulating)
smooth muscle cell growth in a mammal comprising administering to the mammal a
PR0162, PR0181, PR0182,
PR0195, PR0204, PR0221, PR0230, PR0256, PR0258, PR0533, PR0697, PR0725,
PR0738, PR0826,
PR0836, PR0840, PR0846, PR0865, PR0982, PRO 1025, PRO 1029, PRO 1071, PR01080,
PRO 1083, PRO 1134,
PR01160, PR01182, PR01184, PR01186, PR01192, PR01265, PR01274, PR01279,
PR01283, PR01306,
PR01308, PR01309, PR01325, PR01337, PR01338, PR01343, PR01376, PR01387,
PR01411, PR01412,
PR01415, PR01434, PR01474, PR01488, PR01550, PR01556, PR01567, PR01600,
PR01754, PR01758,
PR01760, PR01787, PR01865, PR01868, PR01917, PR01928, PR03438, PR03562,
PR04302, PR04333,
PR04345, PR04353, PR04354, PR04405, PR04408, PR04430, PR04503, PR05725,
PR06714, PR09771,
PR09820, PR09940, PR010096, PR021055, PR021184 or PR021366 polypeptide,
agonist or antagonistthereof,
wherein endothelial cell growth in said mammal is modulated.
In yet another embodiment, the invention provides a method for modulating
(e.g., inducing or reducing)
cardiac hypertrophy in a mammal comprising administering to the mammal a PR021
polypeptide, agonist or
antagonist thereof, wherein cardiac hypertrophy in said mammal is modulated.
In yet another embodiment, the invention provides a method for modulating
(e.g., inducing or reducing)
endothelial cell apoptosis in a mammal comprising administering to the mammal
a PR04302 polypeptide, agonist
or antagonist thereof, wherein cardiac hypertrophy in said mammal is
modulated.
In yet another embodiment, the inventionprovides a method for modulating
(e.g., stimulating or inhibiting)
angiogenesis in a mammal comprising administering a therapeutically effective
amount of a PRO 1376 or PRO 1449
polypeptide, agonist or antagonist thereof to the mammal, wherein said
angiogenesis is modulated.
In yet another embodiment, the invention provides a method for modulating
(e.g., inducing or reducing)
angiogenesis by modulating (e.g., inducing or reducing) endothelial cell tube
formation in a mammal comprising
administering to the mammal a PR0178, PR0195, PR0228, PR0301, PR0302, PR0532,
PR0724, PR0730,
PR0734, PR0793, PR0871, PR0938, PR01012, PRO 1120, PRO 1139, PRO 1198,
PR01287, PR01361, PRO 1864,
PR01873, PR02010, PR03579, PR04313, PR04527, PR04538, PR04553, PR04995,
PR05730, PR06008,
PR07223, PR07248 or PR07261 polypeptide, agonist or antagonist thereof,
wherein endothelial cell tube
formation in said mammal is modulated.
In other embodiments of the present invention, the invention provides an
isolated nucleic acid molecule
comprising a nucleotide sequence that encodes a PRO polypeptide.
In one aspect, the isolated nucleic acid molecule comprises a nucleotide
sequence having at least about
80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%,
95%, 96%, 97% or 98%
14
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
nucleic acid sequence identity and alternatively at least about 99% nucleic
acid sequence identity to (a) a DNA
molecule encoding a PRO polypeptide having a full-length amino acid sequence
as disclosed herein, an amino acid
sequence lacking the signal peptide as disclosed herein, an extracellular
domain of a transmembrane protein, with
or without the signal peptide, as disclosed herein or any other specifically
defined fragment of the full-length amino
acid sequence as disclosed herein, or (b) the complement of the DNA molecule
of (a).
In other aspects, the isolated nucleic acid molecule comprises a nucleotide
sequence having at least about
80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%,
95%, 96%, 97% or 98%
nucleic acid sequence identity and alternatively at least about 99% nucleic
acid sequence identity to (a) a DNA
molecule comprising the coding sequence of a full-length PRO polypeptide cDNA
as disclosed herein, the coding
sequence of a PRO polypeptide lacking the signal peptide as disclosed herein,
the coding sequence of an
extracellular domain of a transmembrane PRO polypeptide, with or without the
signal peptide, as disclosed herein
or the coding sequence of any other specifically defined fragment of the full-
length amino acid sequence as
disclosed herein, or (b) the complement of the DNA molecule of (a).
In a further aspect, the invention provides an isolated nucleic acid molecule
comprising a nucleotide
sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%,
89%, 90%, 91%, 92%, 93%,
94%, 95%, 96%, 97% or 98% nucleic acid sequence identity and alternatively at
least about 99% nucleic acid
sequence identity to (a) a DNA molecule that encodes the same mature
polypeptide encoded by any of the human
protein cDNAs deposited with the ATCC as disclosed herein, or (b) the
complement of the DNA molecule of (a).
Another aspect ofthe present invention provides an isolated nucleic acid
molecule comprising a nucleotide
sequence encoding a PRO polypeptide which is either transmembrane domain-
deleted or transmembrane
domain-inactivated, or is complementary to such encoding nucleotide sequence,
wherein the transmembrane
domains) ofsuchpolypeptide are disclosedherein. Therefore, soluble
extracellulardomains ofthe herein described
PRO polypeptides are contemplated.
Another embodiment is directed to fragments of a PRO polypeptide coding
sequence, or the complement
thereof, that may find use as, for example, hybridization probes, for encoding
fragments of a PRO polypeptide that
may optionally encode a polypeptide comprising a binding site for an anti-PRO
antibody or as antisense
oligonucleotide probes. Such nucleic acid fragments are usually at least about
20, 30, 40, 50, 60, 70, 80, 90, 100,
110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450,
500, 600, 700 or 800 nucleotides in
length and alternatively at least about 1000 nucleotides in length, wherein in
this context the term "about" means
the referenced nucleotide sequence length plus or minus 10% of that referenced
length. It is noted that novel
fragments of a PRO polypeptide-encoding nucleotide sequence may be determined
in a routine manner by aligning
the PRO polypeptide-encoding nucleotide sequence with other known nucleotide
sequences using any of a number
of well known sequence alignment programs and determining which PRO
polypeptide-encoding nucleotide
sequence fragments) are novel. All of such PRO polypeptide-encoding nucleotide
sequences are contemplated
herein. Also contemplated are the PRO polypeptide fragments encoded by these
nucleotide molecule fragments,
preferably those PRO polypeptide fragments that comprise a binding site for an
anti-PRO antibody.
In another embodiment, the invention provides an isolatedPRO polypeptide
encoded by any ofthe isolated
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
nucleic acid sequences hereinabove identified.
In a certain aspect, the inventionprovides an isolatedPRO polypeptide
comprising an amino acid sequence
having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, $9%, 90%,
91%, 92%, 93%, 94%, 95%,
96%, 97% or 98% amino acid sequence identity and alternatively at least about
99% amino acid sequence identity
S to a PRO polypeptide having a full-length amino acid sequence as disclosed
herein, an amino acid sequence lacking
the signal peptide as disclosed herein, an extracellular domain of a
transmembrane protein, with or without the
signal peptide, as disclosed herein or any other specifically defined fragment
of the full-length amino acid sequence
as disclosed herein.
In a further aspect, the inventionprovides an isolated PRO polypeptide
comprising an amino acid sequence
having at least about 80°l0, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%,
89%, 90%, 91°l0, 92%, 93%, 94°l0, 95%,
96%, 97% or 98% amino acid sequence identity and alternatively at least about
99% amino acid sequence identity
to an amino acid sequence encoded by any of the human protein cDNAs deposited
with the ATCC as disclosed
herein.
In a specific aspect, the invention provides an isolated PRO polypeptide
without the N-terminal signal
sequence and/or the initiating methionine and that is encoded by a nucleotide
sequence that encodes such an amino
acid sequence as hereiiibefore described. Processes forproducing the same are
also herein described, wherein those
processes comprise culturing a host cell comprising a vector which comprises
the appropriate encoding nucleic acid
molecule under conditions suitable for expression of the PRO polypeptide and
recovering the PRO polypeptide from
the cell culture.
Another aspect of the invention provides an isolated PRO polypeptide which is
either transmembrane
domain-deleted or transmembrane domain-inactivated. Processes forproducing the
same are also herein described,
wherein those processes comprise culturing a host cell comprising a vector
which comprises the appropriate
encoding nucleic acid molecule under conditions suitable for expression of the
PRO polypeptide and recovering
the PRO polypeptide from the cell culture.
In yet another embodiment, the invention provides agonists and antagonists of
a native PRO polypeptide
as defined herein. In a particular embodiment, the agonist or antagonist is an
anti-PRO antibody or a small
molecule.
In a further embodiment, the invention provides a method of identifying
agonists or antagonists to a PRO
polypeptide which comprise contacting the PRO polypeptide with a candidate
molecule and monitoring a biological
activity mediated by said PRO polypeptide. Preferably, the PRO polypeptide is
a native PRO polypeptide.
In a still further embodiment, the invention provides a composition of matter
comprising a PRO
polypeptide, or an agonist or antagonist of a PRO polypeptide as herein
described, or an anti-PRO antibody, in
combination with a carrier. Optionally, the carrier is a pharmaceutically
acceptable carrier.
Another embodiment of the present invention is directed to the use of a PRO
polypeptide, or an agonist
or antagonistthereofashereinbeforedescribed,orananti-PRO
antibody,forthepreparationofamedicamentuseful
in the treatment of a condition which is responsive to the PRO polypeptide, an
agonist or antagonist thereof or an
anti-PRO antibody.
16
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
In additional embodiments of the present invention, the invention provides
vectors comprising DNA
encoding any of the herein described polypeptides. Host cells comprising any
such vector are also provided. By
way of example, the host cells may be CHO cells, E. coli, yeast, or
Baculovirus-infected insect cells. A process for
producing any of the herein described polypeptides is further provided and
comprises culturing host cells under
conditions suitable for expression of the desired polypeptide and recovering
the desired polypeptide from the cell
culture.
In other embodiments, the invention provides chimeric molecules comprising any
of the herein described
polypeptides fused to a heterologous polypeptide or amino acid sequence.
Example of such chimeric molecules
comprise any of the herein described polypeptides fused to an epitope tag
sequence or a Fc region of an
immunoglobulin.
In yet another embodiment, the invention provides an antibody which
specifically binds to any ofthe above
orbelow describedpolypeptides. Optionally, the antibody is amonoclonal
antibody, humanized antibody, antibody
fragment or single-chain antibody.
In yet other embodiments, the invention provides oligonucleotide probes useful
for isolating genomic and
1 S cDNA nucleotide sequences or as antisense probes, wherein those probes may
be derived from any of the above
or below described nucleotide sequences.
4. Brief Description of the Drawings
Figure 1 shows a nucleotide sequence (SEQ ID NO:1 ) of a native sequence PRO
181 cDNA, wherein SEQ
ID NO:1 is a clone designated hereiiz as "DNA23330-1390".
Figure 2 shows the amino acid sequence (SEQ ID N0:2) derived from the coding
sequence of SEQ ID
NO:1 shown in Figure 1.
Figure 3 shows a nucleotide sequence (SEQ ID N0:3) of a native sequence PRO
178 cDNA, wherein SEQ
ID N0:3 is a clone designated herein as "DNA23339-1130".
Figure 4 shows the amino acid sequence (SEQ ID N0:4) derived from the coding
sequence of SEQ ID
N0:3 shown in Figure 3.
Figure 5 shows a nucleotide sequence (SEQ ID NO:S) of a native sequence PR0444
cDNA, wherein SEQ
ID NO:S is a clone designated herein as "DNA26846-1397".
Figure 6 shows the amino acid sequence (SEQ ID N0:6) derived from the coding
sequence of SEQ ID
NO:S shown in Figure 5.
Figure 7 shows a nucleotide sequence (SEQ ID N0:7) of a native sequence PRO
195 cDNA, wherein SEQ
ID N0:7 is a clone designated herein as "DNA26847-1395".
Figure 8 shows the amino acid sequence (SEQ ID N0:8) derived from the coding
sequence of SEQ ID
N0:7 shown in Figure 7.
3 5 Figure 9 shows a nucleotide sequence (SEQ ID N0:9) of a native sequence
PRO 182 cDNA, wherein SEQ
ID N0:9 is a clone designated herein as "DNA27865-1091".
Figure 10 shows the amino acid sequence (SEQ ID NO:10) derived from flee
coding sequence of SEQ ID
17
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
N0:9 shown in Figure 9.
Figure 11 shows a nucleotide sequence (SEQ ID NO:11) of a native sequence
PR0205 cDNA, wherein
SEQ ID NO:11 is a clone designated herein as "DNA30868-1156".
Figure 12 shows the amino acid sequence (SEQ ID N0:12) derived from the coding
sequence of SEQ ID
NO:11 shown in Figure 11.
Figure 13 shows a nucleotide sequence (SEQ )D N0:13) of a native sequence
PR0204 cDNA, wherein
SEQ 1D N0:13 is a clone designated herein as "DNA30871-1157".
Figure 14 shows the amino acid sequence (SEQ ID N0:14) derived from the coding
sequence of SEQ ID
N0:13 shown in Figure 13.
Figure 15 shows a nucleotide sequence (SEQ ID NO:15) of a native sequence
PR01873 cDNA, wherein
SEQ ID N0:15 is a clone designated herein as "DNA30880".
Figure 16 shows the amino acid sequence (SEQ ID N0:16) derived from the coding
sequence of SEQ ID
NO:1 S shown in Figure 15.
Figure 17 shows a nucleotide sequence (SEQ ID N0:17) of a native sequence
PR0214 cDNA, wherein
SEQ ID N0:17 is a clone designated herein as "DNA32286-1191".
Figure 18 shows the amino acid sequence (SEQ ID N0:18) derived from the coding
sequence of SEQ lD
N0:17 shown in Figure 17.
Figure 19 shows a nucleotide sequence (SEQ ID N0:19) of a native sequence
PR0221 cDNA, wherein
SEQ ID N0:19 is a clone designated herein as "DNA33089-1132".
Figure 20 shows the amino acid sequence (SEQ ID N0:20) derived from the coding
sequence of SEQ ID
N0:19 shown in Figure 19.
Figure 21 shows a nucleotide sequence (SEQ ID N0:21) of a native sequence
PR0228 cDNA, wherein
SEQ ID N0:21 is a clone designated herein as "DNA33092-1202".
Figure 22 shows the amino acid sequence (SEQ ID N0:22) derived from the coding
sequence of SEQ ID
N0:21 sliown in Figure 21.
Figure 23 shows a nucleotide sequence (SEQ ID N0:23) of a native sequence
PR0229 cDNA, wherein
SEQ ID N0:23 is a clone designated herein as "DNA33100-1159".
Figure 24 shows the amino acid sequence (SEQ ID N0:24) derived from the coding
sequence of SEQ 117
N0:23 shown in Figure 23.
Figure 25 shows a nucleotide sequence (SEQ ID N0:25) of a native sequence
PR0230 cDNA, wherein
SEQ ID N0:25 is a clone designated herein as "DNA33223-1136".
Figure 26 shows the amino acid sequence (SEQ ID N0:26) derived from the coding
sequence of SEQ ID
N0:25 shown in Figure 25.
Figure 27 shows a nucleotide sequence (SEQ ID N0:27) of a native sequence
PR07223 cDNA, wherein
SEQ ID N0:27 is a clone designated herein as "DNA34385".
Figure 28 shows the amino acid sequence (SEQ ID N0:28) derived from the coding
sequence of SEQ E77
N0:27 shown in Figure 27.
18
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
Figure 29 shows a nucleotide sequence (SEQ ID N0:29) of a native sequence
PR0241 cDNA, wherein
SEQ 117 N0:29 is a clone designated herein as "DNA34392-1170".
Figure 30 shows the amino acid sequence (SEQ ID N0:30) derived from the coding
sequence of SEQ ID
N0:29 shown in Figure 29.
Figure 31 shows a nucleotide sequence (SEQ ID N0:31) of a native sequence
PR0263 cDNA, wherein
SEQ ID N0:31 is a clone designated herein as "DNA34431-1177".
Figure 32 shows the amino acid sequence (SEQ ID N0:32) derived from the coding
sequence of SEQ ID
N0:31 shown in Figure 31.
Figure 33 shows a nucleotide sequence (SEQ ID N0:33) of a native sequence
PR0321 cDNA, wherein
SEQ ID N0:33 is a clone designated herein as "DNA34433-1308".
Figure 34 shows the amino acid sequence (SEQ ID N0:34) derived from the coding
sequence of SEQ ID
N0:33 shown in Figure 33.
Figure 35 shows a nucleotide sequence (SEQ ID N0:35) of a native sequence
PR0231 cDNA, wherein
SEQ ID N0:35 is a clone designated herein as "DNA34434-1139".
Figure 36 shows the amino acid sequence (SEQ ID N0:36) derived from the coding
sequence of SEQ 1D
N0:35 shown in Figure 35.
Figure 37 shows a nucleotide sequence (SEQ ID N0:37) of a native sequence
PR0238 cDNA, wherein
SEQ ID N0:37 is a clone designated herein as "DNA35600-1162".
Figure 38 shows the amino acid sequence (SEQ ID N0:38) derived from the coding
sequence of SEQ ID
N0:37 shown in Figure 37.
Figure 39 shows a nucleotide sequence (SEQ ID N0:39) of a native sequence
PR0247 cDNA, wherein
SEQ ID N0:39 is a clone designated herein as "DNA35673-1201".
Figure 40 shows the amino acid sequence (SEQ ID N0:40) derived from the coding
sequence of SEQ ID
N0:39 shown in Figure 39.
Figure 41 shows a nucleotide sequence (SEQ ID N0:41) of a native sequence
PR0256 cDNA, wherein
SEQ 11? N0:41 is a clone designated herein as "DNA35880-1160".
Figure 42 shows the amino acid sequence (SEQ ID N0:42) derived from the coding
sequence of SEQ ID
N0:41 shown in Figure 41.
Figure 43 shows a nucleotide sequence (SEQ ID N0:43) of a native sequence
PR0258 cDNA, wherein
SEQ ID N0:43 is a clone designated herein as "DNA35918-1174".
Figure 44 shows the amino acid sequence (SEQ ID N0:44) derived from the coding
sequence of SEQ ID
N0:43 shown in Figure 43.
Figure 45 shows a nucleotide sequence (SEQ LD N0:45) of a native sequence
PR0265 cDNA, wherein
SEQ ID N0:45 is a clone designated herein as "DNA36350-1158".
3 5 Figure 46 shows the amino acid sequence (SEQ ID N0:46) derived from the
coding sequence of SEQ ID
N0:45 shown in Figure 45.
Figure 47 shows a nucleotide sequence (SEQ ID N0:47) of a native sequence
PR021 cDNA, wherein SEQ
19
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
m N0:47 is a clone designated herein as "DNA36638-1056".
Figure 48 shows the amino acid sequence (SEQ 1D N0:48) derived from the coding
sequence of SEQ ID
N0:47 shown in Figure 47.
Figure 49 shows a nucleotide sequence (SEQ ID N0:49) of a native sequence
PR0295 cDNA, wherein
SEQ ID N0:49 is a clone designated herein as "DNA38268-1188".
Figure 50 shows the amino acid sequence (SEQ ID NO:50) derived from the coding
sequence of SEQ ID
N0:49 shown in Figure 49.
Figure 51 shows a nucleotide sequence (SEQ 1D NO:51) of a native sequence
PR0302 cDNA, wherein
SEQ ID NO:51 is a clone designated herein as "DNA40370-1217".
Figure 52 shows the amino acid sequence (SEQ ID N0:52) derived from the coding
sequence of SEQ ID
N0:51 shown in Figure 51.
Figure 53 shows a nucleotide sequence (SEQ ID N0:53) of a native sequence
PR0301 cDNA, wherein
SEQ ID N0:53 is a clone designated herein as "DNA40628-1216".
Figure 54 shows the amino acid sequence (SEQ ID N0:54) derived from the coding
sequence of SEQ ID
N0:53 shown in Figure 53.
Figure 55 shows a nucleotide sequence (SEQ ID N0:55) of a native sequence
PRO337 cDNA, wherein
SEQ ID N0:55 is a clone designated herein as "DNA43316-1237".
Figure 56 shows the amino acid sequence (SEQ ID N0:56) derived from the coding
sequence of SEQ ID
N0:55 shown in Figure 55.
Figure 57 shows a nucleotide sequence (SEQ ID N0:57) of a native sequence
PR07248 cDNA, wherein
SEQ ID NO:57 is a clone designated herein as "DNA44195".
Figure 58 shows the amino acid sequence (SEQ ID NO:58) derived from the coding
sequence of SEQ ID
N0:57 shown in Figure 57.
Figure 59 shows a nucleotide sequence (SEQ ID N0:59) of a native sequence
PR0846 cDNA, wherein
SEQ ID N0:59 is a clone designated herein as "DNA44196-1353".
Figure 60 shows the amino acid sequence (SEQ ID N0:60) derived from the coding
sequence of SEQ ID
N0:59 shown in Figure 59.
Figure 61 shows a nucleotide sequence (SEQ ID N0:61) of a native sequence
PRO1864 cDNA, wherein
SEQ ID N0:61 is a clone designated herein as "DNA45409-2511".
Figure 62 shows the amino acid sequence (SEQ ID N0:62) derived from the coding
sequence of SEQ ID
N0:61 shown in Figure 61.
Figure 63 shows a nucleotide sequence (SEQ ID N0:63) of a native sequence
PR0363 cDNA, wherein
SEQ ID N0:63 is a clone designated herein as "DNA45419-1252".
Figure 64 shows the amino acid sequence (SEQ ID N0:64) derived from the coding
sequence of SEQ ID
N0:63 shown in Figure 63.
Figure 65 shows a nucleotide sequence (SEQ ID N0:65) of a native sequence
PR0730 cDNA, wherein
SEQ ID N0:65 is a clone designated herein as "DNA45624-1400".
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
Figure 66 shows the amino acid sequence (SEQ ID N0:66) derived from the coding
sequence of SEQ ID
N0:65 shown in Figure 65.
Figure 67 shows a nucleotide sequence (SEQ ID N0:67) of a native sequence
PR0365 cDNA, wherein
SEQ ID N0:67 is a clone designated herein as "DNA46777-1253".
Figure 68 shows the amino acid sequence (SEQ ID N0:68) derived from the coding
sequence of SEQ II?
N0:67 shown in Figure 67.
Figure 69 shows a nucleotide sequence (SEQ TD N0;69) of a native sequence
PR0532 cDNA, wherein
SEQ DJ N0:69 is a clone designated herein as "DNA48335".
Figure 70 shows the amino acid sequence (SEQ ID N0:70) derived from the coding
sequence of SEQ ID
N0:69 shown in Figure 69.
Figure 71 shows a nucleotide sequence (SEQ ID N0:71) of a native sequence
PR0322 cDNA, wherein
SEQ ID N0:71 is a clone designated herein as "DNA48336-1309".
Figure 72 shows the amino acid sequence (SEQ ID N0:72) derived from the coding
sequence of SEQ ID
N0:71 shown in. Figure 71.
Figure 73 shows a nucleotide sequence (SEQ ID N0:73) of a native sequence PRO
1120 cDNA, wherein
SEQ ID N0:73 is a clone designated herein as "DNA48606-1479".
Figure 74 shows the amino acid sequence (SEQ ID N0:74) derived from the coding
sequence of SEQ ID
N0:73 shown in Figure 73.
Figure 75 shows a nucleotide sequence (SEQ ID N0:75) of a native sequence
PR07261 cDNA, wherein
SEQ ID N0:75 is a clone designated herein as "DNA49149".
Figure 76 shows the amino acid sequence (SEQ ID N0:76) derived from the coding
sequence of SEQ 1D
N0:75 shown in Figure 75.
Figure 77 shows a nucleotide sequence (SEQ ID N0:77) of a native sequence
PR0533 cDNA, wherein
SEQ ID N0:77 is a clone designated herein as "DNA49435-1219".
Figure 78 shows the amino acid sequence (SEQ ID N0:78) derived from the coding
sequence of SEQ ID
N0:77 shown in Figure 77.
Figure 79 shows a nucleotide sequence (SEQ ID N0:79) of a native sequence
PR0724 cDNA, wherein
SEQ ID N0:79 is a clone designated herein as "DNA49631-1328".
Figure 80 shows the amino acid sequence (SEQ ID N0:80) derived from the coding
sequence of SEQ ID
3 0 N0:79 shown in Figure 79.
Figure 81 shows a nucleotide sequence (SEQ ID N0:81) of a native sequence
PR0734 cDNA, wherein
SEQ ID N0:81 is a clone designated herein as "DNA49817".
Figure 82 shows the amino acid sequence (SEQ ID N0:82) derived from the coding
sequence of SEQ ID
N0:81 shown in Figure 81.
3 5 Figure 83 shows a nucleotide sequence (SEQ ID N0:83) of a native sequence
PR0771 cDNA, wherein
SEQ ID N0:83 is a clone designated herein as "DNA49829-1346".
Figure 84 shows the amino acid sequence (SEQ 1D N0:84) derived from the coding
sequence of SEQ ID
21
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
N0:83 shown in Figure 83.
Figure 85 shows a nucleotide sequence (SEQ ID N0:85) of a native sequence
PR02010 cDNA, wherein
SEQ B7 N0:85 is a clone designated herein as "DNA50792".
Figure 86 shows the amino acid sequence (SEQ ID N0:86) derived from the coding
sequence of SEQ ID
N0:85 shown in Figure 85.
Figure 87 shows a nucleotide sequence (SEQ ID N0:87) of a native sequence
PR0871 cDNA, wherein
SEQ ID N0:87 is a clone designated herein as "DNA50919-1361".
Figure 88 shows the amino acid sequence (SEQ ID N0:88) derived from the coding
sequence of SEQ ID
N0:87 shown in Figure 87.
Figure 89 shows a nucleotide sequence (SEQ ff~ N0:89) of a native sequence
PR0697 cDNA, whexein
SEQ ID N0:89 is a clone designated herein as "DNA50920-1325".
Figure 90 shows the amino acid sequence (SEQ ID N0:90) derived from the coding
sequence of SEQ ID
N0:89 shown in Figure 89.
Figure 91 shows a nucleotide sequence (SEQ ID N0:91) of a native sequence
PR01083 cDNA, whexein
SEQ ID N0:91 is a clone designated herein as "DNA50921-1458".
Figure 92 shows the amino acid sequence (SEQ ID N0:22) derived from the coding
sequence of SEQ ID
N0:91 shown in Figure 91.
Figure 93 shows a nucleotide sequence (SEQ ID N0:93) of a native sequence
PR0725 cDNA, wherein
SEQ ID N0:93 is a clone designated herein as "DNA52758-1399".
Figure 94 shows the amino acid sequence (SEQ ID N0:94) derived from the coding
sequence of SEQ ID
N0:93 shown in Figure 93.
Figure 95 shows a nucleotide sequence (SEQ ID N0:95) of a native sequence
PR0720 cDNA, wherein
SEQ ID N0:95 is a clone designated herein as "DNA53517-1366-1".
Figure 96 shows the amino acid sequence (SEQ ID N0:96) derived from the coding
sequence of SEQ ID
N0:95 shown in Figure 95.
Figure 97 shows a nucleotide sequence (SEQ ID N0:97) of a native sequence
PR0738 cDNA, wherein
SEQ ID N0:97 is a clone designated herein as "DNA53915-1258".
Figure 98 shows the amino acid sequence (SEQ ID N0:98) derived from the coding
sequence of SEQ ID
N0:97 shown in Figure 97.
Figure 99 shows a nucleotide sequence (SEQ ID N0:99) of a native sequence
PR0865 cDNA, wherein
SEQ ID N0:99 is a clone designated herein as "DNA53974-1401".
Figure 100 shows the amino acid sequence (SEQ ID NO:100) derived from the
coding sequence of SEQ
ID N0:99 shown in Figure 99.
Figure 101 shows a nucleotide sequence (SEQ ID NO:101 ) of a native sequence
PR0840 cDNA, wherein
SEQ ID NO:101 is a clone designated herein as "DNA53987-1438".
Figure 102 shows the amino acid sequence (SEQ ID N0:102) derived from the
coding sequence of SEQ
m NO:101 shown in Figure 101.
22
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
Figure 103 shows a nucleotide sequence (SEQ ID N0:103) of a native sequence
PRO 1080 cDNA, wherein
SEQ TD N0:103 is a clone designated herein as "DNA56047-1456".
Figure 104 shows the amino acid sequence (SEQ 1D N0:104) derived from the
coding sequence of SEQ
ID NO:103 shown in Figure 103.
Figure 105 shows a nucleotide sequence (SEQ ID N0:105) of a native sequence
PRO 1079 cDNA, wherein
SEQ ID N0:105 is a clone designated herein as "DNA56050-1455".
Figure 106 shows the amino acid sequence (SEQ ID N0:106) derived from the
coding sequence of SEQ
ID N0:105 shown in Figure 105.
Figure 107 shows a nucleotide sequence (SEQ 1D N0:107) of a native sequence
PR0793 cDNA, wherein
SEQ ID N0:107 is a clone designated herein as "DNA56110-1437".
Figure 108 shows the amino acid sequence (SEQ Tl7 N0:108) derived from the
coding sequence of SEQ
ID N0:107 shown in Figure 107.
Figure 109 shows a nucleotide sequence (SEQ ID N0:109) of a native sequence
PR0788 cDNA, wherein
SEQ ID N0:109 is a clone designated herein as "DNA56405-1357".
Figure 110 shows the amino acid sequence (SEQ lD N0:110) derived from the
coding sequence of SEQ
ID N0:109 shown in Figure 109.
Figure 111 shows a nucleotide sequence (SEQ ID N0:111) of a native sequence
PR0938 cDNA, wherein
SEQ ID NO:111 is a clone designated herein as "DNA56433-1406".
Figure 112 shows the amino acid sequence (SEQ )D N0:112) derived from the
coding sequence of SEQ
ID NO:111 shown in Figure 111.
Figure 113 shows anucleotide sequence (SEQ ID N0:113) ofanative sequence
PR01012 cDNA, wherein
SEQ ID N0:113 is a clone designated herein as "DNA56439-1376".
Figure 114 shows the amino acid sequence (SEQ ID N0:114) derived from the
coding sequence of SEQ
ID N0:113 shown in Figure 113.
Figure 115 shows a nucleotide sequence (SEQ ID N0:115) of a native sequence
PRO 1477 cDNA, wherein
SEQ ID N0:115 is a clone designated herein as "DNA56529-1647".
Figure 116 shows the amino acid sequence (SEQ ID N0:116) derived from the
coding sequence of SEQ
ID N0:115 shown in Figure 115.
Figure 117 shows a nucleotide sequence (SEQ ID N0:117) of a native sequence
PRO 1134 cDNA, wherein
SEQ ID N0:117 is a clone designated herein as "DNA56865-1491".
Figure 118 shows the amino acid sequence (SEQ ID N0:118} derived from the
coding sequence of SEQ
ID N0:117 shown in Figure 117.
Figure 119 shows a nucleotide sequence (SEQ ID N0:119) of a native sequence
PR0162 cDNA, wherein
SEQ ID N0:119 is a clone designated lierein as "DNA56965-1356".
3 5 Figure 120 shows the amino acid sequence (SEQ ID N0:120) derived from the
coding sequence of SEQ
1D NO:119 shown in Figure 119.
Figure 121 shows a nucleotide sequence (SEQ ID N0:121 ) of a native sequence
PRO 1114 cDNA, wherein
23
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
SEQ lD N0:121 is a clone designated herein as "DNA57033-1403-1".
Figure 122 shows the amino acid sequence (SEQ ID N0:122) derived from the
coding sequence of SEQ
ID N0:121 shown in Figure 121.
Figure 123 shows a nucleotide sequence (SEQ ID N0:123) of a native sequence
PR0828 cDNA, wherein
SEQ ID N0:123 is a clone designated herein as "DNA57037-1444".
Figure 124 shows the amino acid sequence (SEQ ID N0:124) derived from the
coding sequence of SEQ
ID N0:123 shown in Figure 123.
Figure 125 shows a nucleotide sequence (SEQ ID N0:125) of a native sequence
PR0827 cDNA, wherein
SEQ ID N0:125 is a clone designated herein as "DNA57039-1402".
Figure 126 shows the amino acid sequence (SEQ ID N0:126) derived from the
coding sequence of SEQ
ID N0:125 shown in Figure 125.
Figure 127 shows a nucleotide sequence (SEQ ID NO:127) of a native sequence
PRO 1075 cDNA, wherein
SEQ ID NO:127 is a clone designated herein as "DNA57689-1385".
Figure 128 shows the amino acid sequence (SEQ ID N0:128) derived from the
coding sequence of SEQ
ID N0:127 shown in Figure 127.
Figure 129 shows a nucleotide sequence (SEQ ID N0:129) of a native sequence
PRO 1007 cDNA, wherein
SEQ ID N0:129 is a clone designated herein as "DNA57690-1374".
Figure 130 shows the amino acid sequence (SEQ ID N0:130) derived from the
coding sequence of SEQ
ID N0:129 shown in Figure 129.
Figure 131 shows a nucleotide sequence (SEQ ID N0:131) of a native sequence
PRO826 cDNA, wherein
SEQ ID NO:131 is a clone designated herein as "DNA57694-1341".
Figure 132 shows the amino acid sequence (SEQ ID N0:132) derived from the
coding sequence of SEQ
ID N0:131 shown in Figure 131.
Figure 133 shows a nucleotide sequence (SEQ ID N0:133) of a native sequence
PR0819 cDNA, wherein
SEQ ID NO:132 is a clone designated herein as "DNA57695-1340".
Figure 134 shows the amino acid sequence (SEQ ID N0:134) derived from the
coding sequence of SEQ
ID N0:133 sliown in Figure 133.
Figure 135 shows a nucleotide sequence (SEQ ID N0:135) of a native sequence
PR01006 cDNA, wherein
SEQ ID NO:135 is a clone designated herein as "DNA57699-1412".
' Figure 136 shows the amino acid sequence (SEQ ID NO:136) derived from the
coding sequence of SEQ
ID N0:135 shown in Figure 135.
Figure 137 shows a nucleotide sequence (SEQ ID NO:137) of a native sequence
PR0982 cDNA; wherein
SEQ ID N0:137 is a clone designated herein as "DNA57700-1408".
Figure 138 shows the amino acid sequence (SEQ ID N0:138) derived from the
coding sequence of SEQ
ID NO:137 shown in Figure 137.
Figure 139 shows a nucleotide sequence (SEQ ID N0:139) of a native sequence
FRO 1005 eDNA, wherein
SEQ ID N0:139 is a clone designated herein as "DNA57708-1411",
24
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
Figure 140 shows the amino acid sequence (SEQ ID N0:140) derived from the
coding sequence of SEQ
ID N0:139 shown in Figure 139.
Figure 141 shows a nucleotide sequence (SEQ ff~ N0:141 ) of a native sequence
PR0791 cDNA, wherein
SEQ ID N0:141 is a clone designated herein as "DNA57838-1337".
Figure 142 shows the amino acid sequence (SEQ ID N0:142) derived from the
coding sequence of SEQ
ID N0:141 shown in Figure 141.
Figure 143 shows a nucleotide sequence (SEQ ID N0:143) of a native sequence
PRO 1071 cDNA, wherein
SEQ ID N0:143 is a clone designated herein as "DNA58847-1383".
Figure 144 shows the amino acid sequence (SEQ ID N0:144) derived from the
coding sequence of SEQ
ID N0:143 shown in Figure 43.
Figure 145 shows a nucleotide sequence (SEQ ID N0:145) of a native sequence
PRO 1415 cDNA, wherein
SEQ ID N0:145 is a clone designated herein as "DNA58852-1637".
Figure 146 shows the amino acid sequence (SEQ ID N0:146) derived from the
coding sequence of SEQ
ID N0:145 shown in Figure 145.
Figure 147 shows a nucleotide sequence (SEQ ID N0:147) of a native sequence
PRO 1054 cDNA, wherein
SEQ ID N0:147 is a clone designated herein as "DNA58853-1423".
Figure 148 shows the amino acid sequence (SEQ ID N0:148) derived from the
coding sequence of SEQ
ID N0:147 shown in Figure 147.
Figure 149 shows a nucleotide sequence (SEQ ID N0:149) of a native sequence
PRO 1411 cDNA, wherein
SEQ 117 N0:149 is a clone designated herein as "DNA59212-1627".
Figure 150 shows the amino acid sequence (SEQ ID N0:150) derived from the
coding sequence of SEQ
ID N0:149 shown in Figure 149.
Figure 151 shows a nucleotide sequence (SEQ ID N0:151 ) of a native sequence
PRO 1184 cDNA, wherein
SEQ ID N0:151 is a clone designated herein as "DNA59220-1514".
Figure 152 shows the amino acid sequence (SEQ ID N0:152) derived from the
coding sequence of SEQ
ID N0:151 shown in Figure 151.
Figure 153 shows a nucleotide sequence (SEQ ID N0:153) of a native sequence
PR01029 cDNA, wherein
SEQ m N0:153 is a clone designated herein as "DNA59493-1420".
Figure 154 shows the amino acid sequence (SEQ ID N0:154) derived from the
coding sequence of SEQ
ID N0:153 shown in Figure 153.
Figure 155 shows a nucleotide sequence (SEQ ID N0:155) of a native sequence
PRO 1139 cDNA, wherein
SEQ ID N0:155 is a clone designated herein as "DNA59497-1496".
Figure 156 shows the amino acid sequence (SEQ ID N0:156) derived from the
coding sequence of SEQ
ID N0:155 shown in Figure 155.
3 5 Figure 157 shows a nucleotide sequence (SEQ ID N0:157) of a native
sequence PRO 1190 cDNA, wherein
SEQ ID N0:157 is a clone designated herein as "DNA59586-1520".
Figure 158 shows the amino acid sequence (SEQ ID N0:158) derived from the
coding sequence of SEQ
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
ID N0:157 shown in Figure 157.
Figure 159 shows a nucleotide sequence (SEQ 1DN0:159) of anative
sequencePR01309 cDNA, wherein
SEQ ID N0:159 is a clone designated herein as "DNA59588-1571".
Figure 160 shows the amino acid sequence (SEQ ID N0:160) derived from the
coding sequence of SEQ
ID N0:159 shown in Figure 159.
Figure 161 shows a nucleotide sequence (SEQ B7 N0:161 ) of a native sequence
PR0836 cDNA, wherein
SEQ ID N0:161 is a clone designated herein as "DNA59620-1463 ".
Figure 162 shows the amino acid sequence (SEQ ID N0:162) derived from the
coding sequence of SEQ
ID N0:161 shown in Figure 161.
Figure 163 shows a nucleotide sequence (SEQ ID N0:163) of a native sequence
PRO 1025 cDNA, wherein
SEQ ID N0:163 is a clone designated herein as "DNA59622-1334".
Figure 164 shows the amino acid sequence (SEQ ID NO:164) derived from the
coding sequence of SEQ
ID N0:163 shown in Figure 163.
Figure 165 shows a nucleotide sequence (SEQ m N0:165) of a native sequence PRO
1131 cDNA, wherein
SEQ ID N0:165 is a clone designated herein as "DNA59777-1480".
Figure 166 shows the amino acid sequence (SEQ m N0:166) derived from the
coding sequence of SEQ
ID N0:165 shown in Figure 165.
Figure 167 sliows a nucleotide sequence (SEQ ID N0:167) of a native sequence
PR01182 cDNA, wherein
SEQ ID N0:167 is a clone designated herein as "DNA59$48-1512".
Figure 168 shows the amino acid sequence (SEQ ID N0:168) derived from the
coding sequence of SEQ
ID N0:167 shown in Figure 167.
Figure 169 shows a nucleotide sequence (SEQ ID N0:169) of a native sequence
PROl 155 cDNA, wherein
SEQ ID N0:169 is a clone designated herein as "DNA59849-1504".
Figure 170 shows the amino acid sequence (SEQ ID N0:170) derived from the
coding sequence of SEQ
ID NO:169 shown in Figure 169.
Figure 171 shows a nucleotide sequence (SEQ ID N0:171 ) of a native sequence
PRO 1186 cDNA, wherein
SEQ ID N0:171 is a clone designated herein as "DNA60621-1516".
Figure 172 shows the amino acid sequence (SEQ ID N0:172) derived from the
coding sequence of SEQ
ID N0:171 shown in Figure 171.
3 0 Figure 173 shows a nucleotide sequence (SEQ ID N0:173) of a native
sequence PRO 1198 cDNA, wherein
SEQ ID N0:173 is a clone designated herein as "DNA60622-1525".
Figure 174 shows the amino acid sequence (SEQ ID N0:174) derived from the
coding sequence of SEQ
ID N0:173 shown in Figure 173.
Figure 175 shows a nucleotide sequence (SEQ ID N0:175) of a native sequence
PRO 1265 cDNA, wherein
SEQ ID N0:175 is a clone designated herein as "DNA60764-1533".
Figure 176 shows the amino acid sequence (SEQ T.D N0:176) derived from the
coding sequence of SEQ
1D N0:175 shown in Figure 175.
26
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
Figure 177 shows anucleotide sequence (SEQ ID N0:177) of anative sequence
PR01361 cDNA, wherein
SEQ ID N0:177 is a clone designated herein as "DNA60783-1611".
Figure 178 shows the amino acid sequence (SEQ ID N0:178) derived from the
coding sequence of SEQ
ID N0:177 shown in Figure 177.
Figure 179 shows a nucleotide sequence (SEQ ID N0:179) of a native sequence
PRO 1287 cDNA, wherein
SEQ ID N0:179 is a clone designated herein as "DNA61755-1554".
Figure 180 shows the amino acid sequence (SEQ ID N0:180) derived from the
coding sequence of SEQ
ID N0:179 shown in Figure 179.
Figure 181 shows a nucleotide sequence (SEQ ID N0:181 ) of a native sequence
PR01308 cDNA, wherein
SEQ ID N0:181 is a clone designated herein as "DNA62306-1570".
Figure 182 shows the amino acid sequence (SEQ ID N0:182) derived from the
coding sequence of SEQ
ID N0:181 shown in Figure 181.
Figure 183 shows a nucleotide sequence (SEQ ID N0:183) of a native sequence
PR04313 cDNA, wherein
SEQ ID N0:183 .is a clone designated herein as "DNA62312-2558".
Figure 184 shows the amino acid sequence (SEQ ID N0:184) derived from the
coding sequence of SEQ
ID N0:183 shown in Figure 183.
Figure 185 shows a nucleotide sequence (SEQ )D N0:185) of a native sequence
PRO 1192 cDNA, wherein
SEQ ID N0:185 is a clone designated herein as "DNA62814-1521".
Figure 186 shows the amino acid sequence (SEQ ID N0:186) derived from the
coding sequence of SEQ
ID N0:185 shown in Figure 185.
Figure 187 shows a nucleotide sequence (SEQ ID N0:187) of a native sequence
PRO 1160 cDNA, wherein
SEQ ID N0:187 is a clone designated herein as "DNA62872-1509".
Figure 188 shows the amino acid sequence (SEQ ID N0:188) derived from the
coding sequence of SEQ
ID NO:187 shown in Figure 187.
Figure 189 shows a nucleotide sequence (SEQ ID N0:189) of a native sequence
PRO 1244 cDNA, wherein
SEQ ID N0:189 is a clone designated herein as "DNA64883-1526".
Figure 190 shows the amino acid sequence (SEQ ID N0:190) derived from the
coding sequence of SEQ
ID N0:189 shown in Figure 189.
Figure 191 shows a nucleotide sequence (SEQ ID N0:191) of a native sequence
PR01356 cDNA, wherein
SEQ ID N0:191 is a clone designated herein as "DNA64886-1601".
Figure 192 shows the amino acid sequence (SEQ ID N0:192) derived from the
coding sequence of SEQ
ID N0:191 shown in Figure 191.
Figure 193 shows a nucleotide sequence (SEQ ID N0:193) of a native sequence
PRO 1274 cDNA, wherein
SEQ ID N0:193 is a clone designated herein as "DNA64889-1541 ".
Figure 194 shows the amino acid sequence (SEQ ID N0:194) derived from the
coding sequence of SEQ
DJ N0:193 shown in Figure 193.
Figure 195 shows a nucleotide sequence (SEQ ID N0:195) of a native sequence
PRO 1272 cDNA, wherein
27
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
SEQ ID N0:195 is a clone designated herein as "DNA64896-1539".
Figure 196 shows the amino acid sequence (SEQ ID N0:196) derived from the
coding sequence of SEQ
ID N0:195 shown in Figure 195.
Figure 197 shows a nucleotide sequence (SEQ ID N0:197) of a native sequence
PRO 1412 cDNA, wherein
SEQ ID N0:197 is a clone designated herein as "DNA64897-1628".
Figure 198 shows the amino acid sequence (SEQ ID N0:198) derived from the
coding sequence of SEQ
ID N0:197 shown in Figure 197.
Figure 199 shows a nucleotide sequence (SEQ ID N0:199) of a native sequence
PR01286 cDNA, wherein
SEQ ID N0:199 is a clone designated herein as "DNA64903-1553".
Figure 200 shows the amino acid sequence (SEQ ID N0:200) derived from the
coding sequence of SEQ.
ID N0:199 shown in Figure 199.
Figure 201 shows a nucleotide sequence (SEQ ID NO:201) of a native sequence
PRO1347 cDNA, wherein
SEQ ID N0:201 is a clone designated herein as "DNA64950-1590".
Figure 202 shows the amino acid sequence (SEQ ID N0:202) derived from the
coding sequence of SEQ
ID N0:201 shown in Figure 201.
Figure 203 shows a nucleotide sequence (SEQ ID N0:203) of a native sequence
PRO 1273 cDNA, wherein
SEQ ID N0:203 is a clone designated herein as "DNA65402-1540".
Figure 204 shows the amino acid sequence (SEQ ID N0:204) derived from the
coding sequence of SEQ
ID N0:203 shown in Figure 203.
Figure 205 shows a nucleotide sequence (SEQ ID NO:205) ofanative sequence
PRO1283 cDNA, wherein
SEQ ID N0:205 is a clone designated herein as "DNA65404-1551".
Figure 206 shows the amino acid sequence (SEQ ID N0:206) derived from the
coding sequence of SEQ
ID N0:205 shown in Figure 205.
Figure 207 shows a nucleotide sequence (SEQ ID N0:207) of a native sequence
PRO 1279 cDNA, wherein
SEQ ID N0:207 is a clone designated herein as "DNA65405-1547".
Figure 208 shows the amino acid sequence (SEQ ID N0:208) derived from the
coding sequence of SEQ
ID N0:207 shown in Figure 207.
Figure 209 shows a nucleotide sequence (SEQ LD N0:209) of a native sequence
PRO 1306 cDNA, wherein
SEQ ID N0:209 is a clone designated herein as "DNA65410-1569".
Figure 210 shows the amino acid sequence (SEQ ID N0:210) derived from the
coding sequence of SEQ
ID N0:209 shown in Figure 209.
Figure 211 shows a nucleotide sequence (SEQ ID N0:211 ) of a native sequence
PRO 1195 cDNA, wherein
SEQ ID N0:211 is a clone designated herein as "DNA65412-1523".
Figure 212 shows the amino acid sequence (SEQ 1D N0:212) derived from the
coding sequence of SEQ
ID N0:211 shown in Figure 211.
Figure 213 shows anucleotide sequence (SEQ ID N0:213) ofanative sequence
PR04995 cDNA, wherein
SEQ ID N0:213 is a clone designated lierein as "DNA66307-2661".
28
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
Figure 214 shows the amino acid sequence (SEQ ID N0:214) derived from the
coding sequence of SEQ
ID N0:213 shown in Figure 213.
Figure 215 shows a nucleotide sequence (SEQ ID N0:215) of a native sequence
PRO 1382 cDNA, wherein
SEQ ID N0:215 is a clone designated herein as "DNA66526-1616".
Figure 216 shows the amino acid sequence (SEQ ID N0:216) derived from the
coding sequence of SEQ
ID N0:215 shown in Figure 215.
Figure 217 shows a nucleotide sequence (SEQ ID N0:217) of a native sequence
PRO 1325 cDNA, wherein
SEQ ID N0:217 is a clone designated herein as "DNA66659-1593".
Figure 218 shows the amino acid sequence (SEQ ID N0:218) derived from the
coding sequence of SEQ
ID N0:217 shown in Figure 217.
Figure 219 shows a nucleotide sequence (SEQ ID N0:219) of a native sequence
PRO 1329 cDNA, wherein
SEQ ID N0:219 is a clone designated herein as "DNA66660-1585".
Figure 220 shows the amino acid sequence (SEQ ID N0:220) derived from the
coding sequence of SEQ
ID N0:219 shown in Figure 219.
Figure 221 shows a nucleotide sequence (SEQ ID N0:221 ) of a native sequence
PRO 133 8 cDNA, wherein
SEQ ID N0:221 is a clone designated herein as "DNA66667-1596".
Figure 222 shows the amino acid sequence (SEQ ID N0:222) derived from the
coding sequence of SEQ
ID N0:221 shown in Figure 221.
Figure 223 shows a nucleotide sequence (SEQ ID N0:223) of a native sequence
PR01337 cDNA, wherein
SEQ ID N0:223 is a clone designated herein as "DNA66672-1586".
Figure 224 shows the amino acid sequence (SEQ ID N0:224) derived from the
coding sequence of SEQ
ID N0:223 shown in Figure 223.
Figure 225 shows a nucleotide sequence (SEQ ID N0:225) of a native sequence
PRO 1343 cDNA, wherein
SEQ ID N0:225 is a clone designated herein as "DNA66675-1587".
Figure 226 shows the amino acid sequence (SEQ ID N0:226) derived from the
coding sequence of SEQ
ID N0:225 shown in Figure 225.
Figure 227 shows a nucleotide sequence (SEQ ID N0:227) of a native sequence
PRO 1376 cDNA, wherein
SEQ lD N0:227 is a clone designated herein as "DNA67300-1605".
Figure 228 shows the amino acid sequence (SEQ ID N0:228) derived from the
codvig sequence of SEQ
ID N0:227 shown in Figure 227.
Figure 229 shows a nucleotide sequence (SEQ ID N0:229) of a native sequence
PR01434 cDNA, wherein
SEQ LD N0:229 is a clone designated herein as "DNA68818-2536".
Figure 230 shows the amino acid sequence (SEQ ID N0:230) derived from the
coding sequence of SEQ
ID N0:229 shown in Figure 229.
3 5 Figure 231 shows a nucleotide sequence (SEQ ID N0:231) of a native
sequence PR03579 cDNA, wherein
SEQ ID N0:231 is a clone designated herein as "DNA68862-2546".
Figure 232 shows the amino acid sequence (SEQ m N0:232) derived from the
coding sequence of SEQ
29
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
ID N0:231 shown in Figure 231.
Figure 233 shows a nucleotide sequence (SEQ ID N0:233) of a native sequence
PRO 1387 cDNA, wherein
SEQ ID N0:233 is a clone designated herein as "DNA68872-1620".
Figure 234 shows the amino acid sequence (SEQ ID N0:234) derived from the
coding sequence of SEQ
ID N0:233 shown in Figure 233.
Figure 235 shows a nucleotide sequence (SEQ ID N0:235) of a native sequence
PRO 1419 cDNA, wherein
SEQ ID N0:235 is a clone designated herein as "DNA71290-1630".
Figure 236 shows the amino acid sequence (SEQ ID N0:236) derived from the
coding sequence of SEQ
ID N0:235 shown in Figure 235.
Figure 237 shows a nucleotide sequence (SEQ ID N0:237) of a native sequence
PRO 1488 cDNA, wherein
SEQ ID N0:237 is a clone designated lierein as "DNA73736-1657".
Figure 238 shows the amino acid sequence (SEQ ID N0:238) derived from the
coding sequence of SEQ
ID N0:237 shown in Figure 237.
Figure 239 shows a nucleotide sequence (SEQ ID N0:239) of a native sequence
PRO 1474 cDNA, wherein
SEQ ID N0:239 is a clone designated herein as "DNA73739-1645".
Figure 240 shows the amino acid sequence (SEQ ID N0:240) derived from the
coding sequence of SEQ
ID N0:239 shown in Figure 239.
Figure 241 shows a nucleotide sequence (SEQ B7 N0:241 ) of a native sequence
PRO 1508 cDNA, wherein
SEQ ID N0:241 is a clone designated herein as "DNA73742-1662".
Figure 242 shows the amino acid sequence (SEQ ID N0:242) derived from the
coding sequence of SEQ
ID N0:241 shown in Figure 241.
Figure 243 shows a nucleotide sequence (SEQ ID N0:243) of a native sequence
PRO 1754 cDNA, wherein
SEQ ID N0:243 is a clone designated herein as "DNA76385-1692".
Figure 244 shows the amino acid sequence (SEQ ID N0:244) derived from the
coding sequence of SEQ
ID N0:243 shown in Figure 243.
Figure 245 shows a nucleotide sequence (SEQ ID N0:245) of a native sequence
PRO 1550 cDNA, wherein
SEQ ID N0:245 is a clone designated herein as "DNA76393-1664".
Figure 246 shows the amino acid sequence (SEQ ID N0:246) derived from the
coding sequence of SEQ
ID N0:245 shown in Figure 245.
3 0 Figure 247 shows a nucleotide sequence (SEQ ID N0:247) of a native
sequence PRO 1758 cDNA, wherein
SEQ ID N0:247 is a clone designated herein as "DNA76399-1700".
Figure 248 shows the amino acid sequence (SEQ ID N0:248) derived from the
coding sequence of SEQ
ID N0:247 shown in Figure 247.
Figure 249 shows a nucleotide sequence (SEQ ID N0:249) of a native sequence
PRO 1917 cDNA, wherein
SEQ ID N0:249 is a clone designated herein as "DNA76400-2528".
Figure 250 shows the amino acid sequence (SEQ ID N0:250) derived from the
coding sequence of SEQ
ID N0:249 shown in Figure 249.
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
Figure 251 shows a nucleotide sequence (SEQ ID N0:251 ) of a native sequence
PRO 1787 cDNA, wherein
SEQ ID N0:251 is a clone designated herein as "DNA76510-2504".
Figure 252 shows the amino acid sequence (SEQ ID N0:252) derived from the
coding sequence of SEQ
ID N0:251 shown in Figure 251.
Figure 253 shows a nucleotide sequence (SEQ ID N0:253) of a native sequence
PR01556 cDNA, wherein
SEQ )D N0:253 is a clone designated herein as "DNA76529-1666".
Figure 254 shows the amino acid sequence (SEQ 117 N0:254) derived from the
coding sequence of SEQ
ID N0:253 shown in Figure 253.
Figure 255 shows a nucleotide sequence (SEQ DJ N0:255) of a native sequence
PRO 1760 cDNA, wherein
SEQ ID N0:255 is a clone designated herein as "DNA76532-1702".
Figure 256 shows the amino acid sequence (SEQ ID N0:256) derived from the
coding sequence of SEQ
ID N0:255 shown in Figure 255.
Figure 257 shows a nucleotide sequence (SEQ 1D N0:257) of a native sequence
PR01567 eDNA, wherein
SEQ ID N0:257 is a clone designated herein as "DNA76541-1675".
Figure 258 shows the amino acid sequence (SEQ ID N0:258) derived from the
coding sequence of SEQ
ID N0:257 shown in Figure 257.
Figure 259 shows a nucleotide sequence (SEQ ID N0:259) ofa native sequence PRO
1600 cDNA, wherein
SEQ ID N0:259 is a clone designated herein as "DNA77503-1686".
Figure 260 shows the amino acid sequence (SEQ 117 N0:260) derived from the
coding sequence of SEQ
ID N0:259 shown in Figure 259.
Figure 261 shows a nucleotide sequence (SEQ ID N0:261) of a native sequence
PR0186$ cDNA, wherein
SEQ ff~ NO:261 is a clone designated herein as "DNA77624-2515".
Figure 262 shows the amino acid sequence (SEQ ID N0:262) derived from the
coding sequence of SEQ
ID N0:261 shown in Figure 261.
Figure 263 shows a nucleotide sequence (SEQ 117 N0:263) of a native sequence
PR01890 cDNA, wherein
SEQ ID N0:263 is a clone designated herein as "DNA79230-2525".
Figure 264 shows the amino acid sequence (SEQ ID N0:264) derived from the
coding sequence of SEQ
ID N0:263 shown in Figure 263.
Figure 265 shows a nucleotide sequence (SEQ >D N0:265) of a native sequence
PRO 1887 eDNA, wherein
SEQ 1T7 N0:265 is a clone designated herein as "DNA79862-2522".
Figure 266 shows the amino acid sequence (SEQ ID N0:265) derived from the
coding sequence of SEQ
ID N0:265 shown in Figure 265.
Figure 267 shows a nucleotide sequence (SEQ ID N0:267) of a native sequence
PR04353 cDNA, wherein
SEQ ID N0:267 is a clone designated herein as "DNA80145-2594".
Figure 268 shows the amino acid sequence (SEQ ID N0:268) derived from the
coding sequence of SEQ
ID N0:267 shown in Figure 26?.
Figure 269 shows a nucleotide sequence (SEQ ID N0:269) of a native sequence
PRO 1782 cDNA, wherein
31
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
SEQ ID N0:269 is a clone designated herein as "DNA80899-2501".
Figure 270 shows the amino acid sequence (SEQ ID N0:270) derived from the
coding sequence of SEQ
ID N0:269 shown in Figure 269.
Figure 271 shows a nucleotide sequence (SEQ ID N0:271) of a native sequence
PR01928 cDNA, wherein
SEQ ID N0:2?1 is a clone designated herein as "DNA81754-2532",
Figure 272 shows the amino acid sequence (SEQ ID N0:272) derived from the
coding sequence of SEQ
ID N0:271 shown in Figure 271.
Figure 273 shows a nucleotide sequence (SEQ ID N0:273) of a native sequence
PR01865 cDNA, wherein
SEQ m N0:273 is a clone designated herein as "DNA81757-2512".
Figure 274 shows the amino acid sequence (SEQ ID N0:274) derived from the
coding sequence of SEQ
ID N0:273 shown in. Figure 273.
Figure 275 shows a nucleotide sequence (SEQ ID N0:275) ofa native sequence
PR04341 cDNA, wherein
SEQ ID N0:275 is a clone designated herein as "DNA81761-2583".
Figure 276 shows the amino acid sequence (SEQ ID N0:276) dexived from the
coding sequence of SEQ
ID N0:275 shown in Figure 275.
Figure 277 shows a nucleotide sequence (SEQ ID N0:277) of a native sequence
PR06714 cDNA, wherein
SEQ ID NO:277 is a clone designated herein as "DNA82358-2738".
Figure 278 shows the amino acid sequence (SEQ ID N0:278) derived from the
coding sequence of SEQ
ID N0:277 shown in Figure 277.
Figure 279 shows a nucleotide sequence (SEQ ID N0:279) of a native sequence
PR05723 cDNA, wherein
SEQ ID N0:279 is a clone designated herein as "DNA82361".
Figure 280 shows the amino acid sequence (SEQ ID N0:280) derived from the
coding sequence of SEQ
ID N0:279 shown in Figure 279.
Figure 281 shows a nucleotide sequence (SEQ ID N0:281) ofanative sequence
PR03438 cDNA, wherein
SEQ ID N0:281 is a clone designated lierein as "DNA82364-2538".
Figure 282 shows the amino acid sequence (SEQ ID N0:282) derived from the
coding sequence of SEQ
m N0:281 shown in Figure 281.
Figure 283 shows a nucleotide sequence (SEQ ID N0:283) of a native sequence
PR06071 cDNA, wherein
SEQ m N0:283 is a clone designated herein as "DNA82403-2959".
Figure 284 shows the amino acid sequence (SEQ ID N0:284) derived from the
coding sequence of SEQ
ID N0:283 shown in Figure 283.
Figure 285 shows a nucleotide sequence (SEQ ID N0:285) of a native sequence
PR01801 cDNA, wherein
SEQ ID N0:285 is a clone designated herein as "DNA83500-2506".
Figure 286 shows the amino acid sequence (SEQ ID N0:286) derived from the
coding sequence of SEQ
ID N0:285 shown in Figure 285.
Figure 287 shows a nucleotide sequence (SEQ m N0:287) of a native sequence
PR04324 cDNA, wherein
SEQ m N0:287 is a clone designated herein as "DNA83560-2569".
32
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
Figuxe 288 shows the amino acid sequence (SEQ ID N0:288) derived from the
coding sequence of SEQ
ff~ N0:287 shown in Figure 287.
Figure 289 shows anucleotide sequence (SEQ ID N0:289) of a native sequence
PR04333 cDNA, wherein
SEQ ID N0:289 is a clone designated herein as "DNA84210-2576".
Figure 290 shows the amino acid sequence (SEQ ID N0:290) derived from the
coding sequence of SEQ
ID N0:289 shown in Figuxe 289.
Figure 291 shows a nucleotide sequence (SEQ ID N0:291) of a native sequence
PR04405 cDNA, wherein
SEQ ID N0:291 is a clone designated herein as "DNA84920-2614".
Figure 292 shows the amino acid sequence (SEQ ID N0:292) derived from the
coding sequence of SEQ
ID N0291 shown in Figure 291.
Figure 293 shows a nucleotide sequence (SEQ ID N0:293) of a native sequence
PR04356 cDNA, wherein
SEQ ID N0:293 is a clone designated herein as "DNA86576-2595".
Figure 294 shows the amino acid sequence (SEQ ID N0:294) derived from the
coding sequence of SEQ
ID N0:293 shown in Figure 293.
Figure 295 shows a nucleotide sequence (SEQ ID N0:295) of a native sequence
PR03444 cDNA, wherein
SEQ ID N0:295 is a clone designated herein as "DNA87997".
Figure 296 shows the amino acid sequence (SEQ ID N0:296) derived from the
coding sequence of SEQ
ID N0:295 shown in Figure 295.
Figure 297 shows a nucleotide sequence (SEQ D~ N0:297) of a native sequence
PR04302 cDNA, wherein
SEQ ID N0:297 is a clone designated herein as "DNA92218-2554".
Figure 298 shows the amino acid sequence (SEQ ID N0:298) derived from the
coding sequence of SEQ
ID N0:297 shown in Figure 297.
Figure 299 shows a nucleotide sequence (SEQ ID N0:299) of a native sequence
PR04371 cDNA, wherein
SEQ ID N0:299 is a clone designated herein as "DNA92233-2599".
Figure 300 shows the amino acid sequence (SEQ ID N0:300) derived from the
coding sequence of SEQ
ID N0:299 shown in Figure 299.
Figure 301 shows a nucleotide sequence (SEQ ID N0:301 ) of a native sequence
PR04354 cDNA, wherein
SEQ ID N0:301 is a clone designated herein as "DNA92256-2596".
Figure 302 shows the amino acid sequence (SEQ ID N0:302) derived from the
coding sequence of SEQ
ID N0:301 shown in Figure 301.
Figure 303 shows a nucleotide sequence (SEQ ID N0:303) of a native sequence
PR05725 cDNA, wherein
SEQ ID N0:303 is a clone designated herein as "DNA92265-2669".
Figure 304 shows the amino acid sequence (SEQ ID N0:304) derived from the
coding sequence of SEQ
D7 N0:303 shown in Figure 303.
3 5 Figure 305 shows a nucleotide sequence (SEQ ID N0:305) of a native
sequence PR04408 cDNA, wherein
SEQ ID N0:305 is a clone designated herein as "DNA92274-2617".
Figure 306 shows the amino acid sequence (SEQ ID N0:306) derived from the
coding sequence of SEQ
33
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
ID N0:305 shown in Figure 305.
Figure 307 shows a nucleotide sequence (SEQ ID NO:307) of a native sequence
PR09940 cDNA, wherein
SEQ ID N0:307 is a clone designated herein as "DNA92282".
Figure 308 shows the amino acid sequence (SEQ ID NO:308) derived from the
coding sequence of SEQ
ID NO:307 shown in Figure 307.
Figure 309 shows a nucleotide sequence (SEQ ID N0:309) of a native sequence
PR05737 cDNA, wherein
SEQ ID N0:309 is a clone designated herein as "DNA92929-2534-1".
Figure 310 sliows the amino acid sequence (SEQ ID N0:310) derived from the
coding sequence of SEQ
ID N0:309 shown in Figure 309.
Figure 311 shows a nucleotide sequence (SEQ ID N0:311 ) of a native sequence
PR04425 cDNA, wherein
SEQ ID N0:311 is a clone designated herein as "DNA93011-2637".
Figure 312 shows the amino acid sequence (SEQ ID N0:312) derived from the
coding sequence of SEQ
ID N0:311 shown in Figure 311.
Figure 313 shows a nucleotide sequence (SEQ ID N0:313) of a native sequence
PRO4345 cDNA, wherein
SEQ ID N0:313 is a clone designated herein as "DNA94854-2586".
Figure 314 shows the amino acid sequence (SEQ ID NO:314) derived from the
coding sequence of SEQ
ID N0:313 shown in Figure 313.
Figure 315 shows a nucleotide sequence (SEQ ID N0:315) of a native sequence
PR04342 cDNA, wherein
SEQ ID N0:315 is a clone designated herein as "DNA96787-2534-1".
Figure 316 shows the amino acid sequence (SEQ ID NO:316) derived from the
coding sequence of SEQ
ID N0:315 shown in Figure 315
Figure 317 shows a nucleotide sequence (SEQ ID N0:317) of a native sequence
PR03562 cDNA, wherein
SEQ ID N0:317 is a clone designated herein as "DNA96791".
Figure 318 shows the amino acid sequence (SEQ ID N0:318) derived from the
coding sequence of SEQ
ID N0:317 shown in Figure 317.
Figure 319 shows a nucleotide sequence (SEQ ID N0:319) of a native sequence
PR04422 cDNA, wherein
SEQ ID NO:319 is a clone designated herein as "DNA96867-2620".
Figure 320 shows the amino acid sequence (SEQ ID N0:320) derived from the
coding sequence of SEQ
ID N0:319 shown in Figure 319.
3 0 Figure 321 shows a nucleotide sequence (SEQ ID N0:321 ) of a native
sequence PR05776 cDNA, wherein
SEQ ID N0:321 is a clone designated herein as "DNA96872-2674".
Figure 322 shows the amino acid sequence (SEQ ID N0:322) derived from the
coding sequence of SEQ
JD N0:321 shown in Figure 321.
Figure 323 shows a nucleotide sequence (SEQ ID N0:323) of a native sequence
PR04430 cDNA, wherein
3 S SEQ ID N0:323 is a clone designated herein as "DNA96878-2626".
Figure 324 shows the amino acid sequence (SEQ ID N0:324) derived from the
coding sequence of SEQ
ID N0:323 shown in Figure 323.
34
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
Figuxe 325 shows a nucleotide sequence (SEQ 117 N0:325) of a native sequence
PR04499 cDNA, wherein
SEQ ID N0:325 is a clone designated herein as "DNA96889-2641".
Figure 326 shows the amino acid sequence (SEQ ID N0:326) derived from the
coding sequence of SEQ
ID N0:325 shown in Figure 325.
Figure 327 shows a nucleotide sequence (SEQ ID N0:327) of a native sequence
PR04503 cDNA, wherein
SEQ ID N0:327 is a clone designated herein as "DNA100312-2645".
Figure 328 shows the amino acid sequence (SEQ ID N0:328) derived from the
coding sequence of SEQ
ID N0:327 shown in Figure 327.
Figure 329 shows a nucleotide sequence (SEQ ID N0:329) of a native sequence
PR010008 cDNA,
wherein SEQ ID N0:329 is a clone designated herein as "DNA101921".
Figure 330 shows the amino acid sequence (SEQ ID N0:330) dexived from the
coding sequence of SEQ
ID N0:329 shown in Figure 329.
Figure 331 shows a nucleotide sequence (SEQ ID N0:331) of a native sequence
PR05730 cDNA, wherein
SEQ ID N0:331 is a clone designated herein as "DNA101926".
Figure 332 shows the amino acid sequence (SEQ ID N0:332) derived from the
coding sequence of SEQ
ID N0:331 shown in Figure 331.
Figure 333 shows a nucleotide sequence (SEQ ID N0:333) of a native sequence
PR06008 cDNA, wherein
SEQ D7 N0:333 is a clone designated herein as "DNA102844".
Figure 334 shows the amino acid sequence (SEQ ID N0:334) derived from the
coding sequence of SEQ
117 N0:333 shown in Figure 333.
Figure 335 shows a nucleotide sequence (SEQ ID N0:335) of a native sequence
PR04527 cDNA, wherein
SEQ ID N0:335 is a clone designated herein as "DNA103197".
Figure 336 shows the amino acid sequence (SEQ ID N0:336) derived from the
coding sequence of SEQ
ID N0:335 shown in Figure 335.
Figure 337 shows a nucleotide sequence (SEQ ID N0:337) of a narive sequence
PR04538 cDNA, wherein
SEQ ID N0:337 is a clone designated herein as "DNA103208".
Figure 338 shows the amino acid sequence (SEQ ID N0:338) derived from the
coding sequence of SEQ
m N0:337 shown in Figure 337.
Figure 339 shows a nucleotide sequence (SEQ ID N0:339) ofa native sequence
PR04553 cDNA, wherein
SEQ ID N0:339 is a clone designated herein as "DNA103223".
Figure 340 S110WS the amino acid sequence (SEQ ID N0:340) derived from the
coding sequence of SEQ
ID N0:339 shown in Figure 339.
Figure 341 shows a nucleotide sequence (SEQ ID N0:341 ) of a native sequence
PR06006 cDNA, wlierein
SEQ LD N0:341 is a clone designated herein as "DNA105782-2693".
Figure 342 shows the amino acid sequence (SEQ ID N0:342) derived from the
coding sequence of SEQ
ID N0:341 shown in Figure 341.
Figure 343 shows a nucleotide sequence (SEQ ID N0:343) of a native sequence
PR06029 cDNA, wherein
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
SEQ ID N0:343 is a clone designated herein as "DNA105849-2704".
Figure 344 shows the amino acid sequence (SEQ ID N0:344) derived from the
coding sequence of SEQ
ID N0:343 shown in Figure 343.
Figure 345 shows a nucleotide sequence (SEQ ID N0:345) of a native sequence
PR09821 cDNA, wherein
SEQ ID N0:345 is a clone designated herein as "DNA108725-2766".
Figure 346 shows the amino acid sequence (SEQ ID N0:346) derived from the
coding sequence of SEQ
ID N0:345 shown in Figure 345.
Figure 347 shows a nucleotide sequence (SEQ ID N0:347) of a native sequence
PR09820 cDNA, wherein
SEQ ID N0:347 is a clone designated herein as "DNA108769-2765".
Figure 348 shows the amino acid sequence (SEQ ID N0:348) derived from the
coding sequence of SEQ
ID N0:347 shown in Figure 347.
Figure 349 shows a nucleotide sequence (SEQ ID N0:349) of a native sequence
PR09771 cDNA, wherein
SEQ ID N0:349 is a clone designated herein as "DNA119498-2965".
Figure 350 shows the amino acid sequence (SEQ ID N0:350) derived from the
coding sequence of SEQ
ID N0:349 shown in Figure 349.
Figure 351 shows a nucleotide sequence (SEQ ID N0:351 ) of a native sequence
PR07436 cDNA, wherein
SEQ ID N0:351 is a clone designated herein as "DNA119535-2756".
Figure 352 shows the amino acid sequence (SEQ ID N0:352) derived from the
coding sequence of SEQ
ID N0:351 shown in Figure 351.
Figure 353 shows a nucleotide sequence (SEQ ID N0:353) of a native sequence
PR010096 cDNA,
wherein SEQ ID N0:353 is a clone designated herein as "DNA125185-2806".
Figure 354 shows the amino acid sequence (SEQ ID N0:354) derived from the
coding sequence of SEQ
ID N0:353 shown in Figure 353.
Figure 355 shows a nucleotide sequence (SEQ ID N0:355) of a native sequence
PR019670 cDNA,
wherein SEQ ID N0:355 is a clone designated herein as "DNA131639-2874".
Figure 356 shows the amino acid sequence (SEQ ID N0:356) derived from the
coding sequence of SEQ
ID N0:355 shown in Figure 355.
Figure 357 shows a nucleotide sequence (SEQ ID N0:357) of a native sequence
PR020044 cDNA,
wherein SEQ ID NO:357 is a clone designated herein as "DNA139623-2893".
Figure 358 shows the amino acid sequence (SEQ ID N0:358) derived from the
coding sequence of SEQ
~ N0:357 shown in Figure 357.
Figure 359 shows a nucleotide sequence (SEQ ID N0:359) of anative sequence
PR09873 cDNA, wherein
SEQ ID N0:359 is a clone designated herein as "DNA143076-2787".
Figure 360 shows the amino acid sequence (SEQ ID NO:360) derived from the
coding sequence of SEQ
ID NO:359 shown in Figure 359.
Figure 361 shows a nucleotide sequence (SEQ ID N0:361) of a native sequence
PR021366 cDNA,
wherein SEQ ID N0:361 is a clone designated herein as "DNA143276-2975".
36
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
Figure 362 shows the amino acid sequence (SEQ lD N0:362) derived from the
coding sequence of SEQ
ID N0:361 shown in Figure 361.
Figure 363 shows a nucleotide sequence (SEQ ID N0:363) of a native sequence
PR020040 cDNA,
wherein SEQ ID N0:363 is a clone designated herein as "DNA164625-2890".
Figure 364 shows the amino acid sequence (SEQ ID N0:364) derived from the
coding sequence of SEQ
ID N0:363 shown in Figure 363.
Figure 365 shows a nucleotide sequence (SEQ ID N0:365) of a native sequence
PR021184 cDNA,
wherein SEQ ID N0:365 is a clone designated herein as "DNA167678-2963".
Figure 366 shows the amino acid sequence (SEQ ID N0:366) derived from the
coding sequence of SEQ
ID N0:365 shown in Figure 365.
Figure 367 shows a nucleotide sequence (SEQ ID N0:367) of a native sequence
PR021055 cDNA,
wherein SEQ ID N0:367 is a clone designated herein as "DNA170021-2923".
Figure 368 shows the amino acid sequence (SEQ ID N0:368) derived from the
coding sequence of SEQ
ID N0:367 shown in Figure 367.
Figure 369 shows a nucleotide sequence (SEQ ID N0:369) of a native sequence
PRO28631 cDNA,
wherein SEQ ID N0:369 is a clone designated herein as "DNA170212-3000".
Figure 370 shows the amino acid sequence (SEQ ID N0:370) derived from the
coding sequence of SEQ
ID N0:369 shown in Figure 369.
Figure 371 shows a nucleotide sequence (SEQ ID N0:371) of a native sequence
PR021384 cDNA,
wherein SEQ ID N0:371 is a clone designated herein as "DNA177313-2982".
Figure 372 shows the amino acid sequence (SEQ ID N0:372) derived from the
coding sequence of SEQ
ID N0:371 shown in Figure 371.
Figure 373 shows a nucleotide sequence (SEQ ID N0:373) of a native sequence
PRO 1449 cDNA, wherein
SEQ ID N0:373 is a clone designated herein as "DNA64908-1163-1".
~ Figure 374 shows the amino acid sequence (SEQ 117 N0:374) derived from the
coding sequence of SEQ
ID N0:373 shown in Figure 373.
Figure 375 shows wholemount in situ hybridization results on mouse embryos
using a mouse orthologue
of PR01449 which has about 78% amino acid identity with PR01449. The results
show that PR01449 orthologue
is expressed in the developing vasculature. The cross-section further shows
expression in endothelial cells and
progenitors of endothelial cells.
Figure 376 shows that a PRO1449 orthologue having about 78°lo amino
acid identity with PRO1449 is
expressed in vasculature of many inflamed and diseased tissues, but is very
low, or lacking, in normal adult vessels.
Figure 377 shows that a PR01449 orthologue having about 78% amino acid
identity with PR01449
induces ectopic vessels in the eyes of chicken embryos.
37
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
5. Detailed Description of the Invention
5.1. Definitions
The phrases "cardiovascular, endothelial and angiogenic disorder",
"cardiovascular, endothelial and
angiogenic dysfunction", "cardiovascular, endothelial or angiogenic disorder"
and "cardiovascular, endothelial or
angiogenic dysfunction" are used interchangeably and refer in part to systemic
disorders that affect vessels, such
as diabetes mellitus, as well as diseases of the vessels themselves, such as
of the arteries, capillaries, veins, and/or
lymphatics. This would include indications that stimulate angiogenesis andlor
cardiovascularization, and those that
inhibit angiogenesis andlor cardiovascularization. Such disorders uiclude, for
example, arterial disease, such as
atherosclerosis, hypertension, inflammatory vasculitides, Reynaud's disease
and Reynaud's phenomenon,
aneurysms, and arterial restenosis; venous and lymphatic disorders such as
thrombophlebitis, lymphangitis, and
lymphedema; and other vascular disorders such as peripheral vascular disease,
cancer such as vascular tumors, e.g.,
hemangioma (capillary and cavernous), glomus tumors, telangiectasia, bacillary
angiomatosis,
hemangioendothelioma, angiosarcoma, haemangiopericytoma, Kaposi's sarcoma,
lymphangioma, and
lymphangiosarcoma, tumor angiogenesis, trauma such as wounds, burns, and other
injured tissue, implant fixation,
scarring, ischemia reperfusion injury, rheumatoid arthritis, cerebrovascular
disease, renal diseases such as acute
renal failure, and osteoporosis. This would also include angina, myocardial
infarctions such as acute myocardial
infarctions, cardiac hypertrophy, and heart failure such as CHF.
"Hypertrophy", as used herein, is defined as an increase in mass of an organ
or structure independent of
natural growth that does not involve tumor formation. Hypertrophy of an organ
or tissue is due either to an increase
in the mass of the individual cells (true hypertrophy), or to an increase in
the number of cells making up the tissue
(hyperplasia), or both. Certain organs, such as the heart, lose the ability to
divide shortly after birth. Accordingly,
"cardiac hypertrophy" is defined as an increase in mass of the heart, which,
in adults, is characterized by an increase
im myocyte cell size and contractile protein content without concomitant cell
division. The character of the stress
responsible for inciting the hypertrophy, (e.g., increased preload, increased
afterload, loss of myocytes, as in
myocardial infarction, or primary depression of contractility), appears to
play a critical role in determining the
nature ofthe xesponse. The early stage of cardiac hypertrophy is usually
characterized morphologically by increases
in the size of myofibrils and mitochondria, as well as by enlargement of
mitochondria and nuclei. At this stage,
while muscle cells are larger than normal, cellular organization is largely
preserved. At a more advanced stage of
cardiac hypertrophy, there are preferential increases in the size or number of
specific organelles, such as
mitochondria, and new contractile elements are added in localized areas of the
cells, in an irregular manner. Cells
subjected to long-standing hypertrophy show more obvious disruptions in
cellular organization, including markedly
enlarged nuclei with highly lobulated membranes, which displace adjacent
myofibrils and cause breakdown of
normal Z-band registration. The phrase "cardiac hypertrophy" is used to
include all stages of the progression of this
condition, characterized by various degrees of structural damage of the heart
muscle, regardless of the underlying
3 5 cardiac disorder. Hence, the term also includes physiological conditions
instrumental in the development of cardiac
hypertrophy, such as elevated blood pressure, aortic stenosis, or myocardial
infarction.
"Heart failure" refers to an abnormality of cardiac function where the heart
does notpump blood at the rate
38
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
needed for the requirements of metabolizing tissues. The heart failure can be
caused by a number of factors,
including ischemic, congenital, rheumatic, or idiopathic forms.
"Congestive heart failure" (CHF) is a progressive pathologic state where the
heart is increasingly unable
to supply adequate cardiac output (the volume of blood pumped by the heart
over time) to deliver the oxygenated
blood to peripheral tissues. As CHF progresses, structural and hemodynamic
damages occur. While these damages
have a variety of manifestations, one characteristic symptom is ventricular
hypertrophy. CHF is a common end
result of a number of various cardiac disorders.
"Myocardial infarction" generally results from atherosclerosis of the coronary
arteries, often with
superimposed coronary thrombosis. It may be divided into two major types:
transmural infarcts, in which
myocardial necrosis involves the full thickness of the ventricular wall, and
subendocardial (nontransmural) infarcts,
in which the necrosis involves the subendocardium, the intramural myocardium,
or both, without extending all the
way through the ventricular wall to the epicardium. Myocardial infarction is
known to cause both a change in
hemodynamic effects and an alteration in structure in the damaged and healthy
zones of the heart. Thus, for
example, myocardial infarction reduces the maximum cardiac output and the
stroke volume of the heart. Also
associated with myocardial infarction is a stimulation of the DNA synthesis
occurring W the interstice as well as
an increase in the formation of collagen in the areas of the heart not
affected.
As a result of the increased stress or strain placed on the heart in prolonged
hypertension due, for example,
to the increased total peripheral resistance, cardiac hypertrophy has long
been associated with "hypertension". A
characteristic of the ventricle that becomes hypertrophic as a result of
chronic pressure overload is an impaired
diastolic performance. Fouad et al., J. Am. Coll. Cardiol., 4: 1500-1506
(1984); Smith et al., J. Am. Coll. Cardiol.,
5: 869-874 ( 1985). A prolonged left ventricular relaxation has been detected
in early essential hypertension, in spite
of normal or supranormal systolic function. Hartford et al., Hypertension, 6:
329-338 (1984). However, there is
no close parallelism between blood pressure levels and cardiac hypertrophy.
Although improvement W left
ventricular function in response to antihypertensive therapy has been reported
in humans, patients variously treated
with a diuretic (hydrochlorotliiazide), a (3-blocker (propranolol), or a
calcium channel blocker (diltiazem), have
shown reversal of left ventricular hypertrophy, without improvement in
diastolic function. Inouye et al., Am. J.
Cardiol., 53: 1583-7 (1984).
Another complex cardiac disease associated with cardiac hypertrophy is
"hypertrophic cardiomyopathy".
This condition is characterized by a great diversity of morphologic,
functional, and clinical features (Maron et al.,
N. En~l. J. Med., 316: 780-789 (1987); Spirito et al., N. En~l. J. Med., 320:
749-755 (1989); Louie and Edwards,
Prop. Cardiovasc. Dis., 36: 275-308 (1994); Wigle et al., Circulation, 92:
1680-1692 (1995)), the heterogeneity of
which is accentuated by the fact that it afflicts patients of all ages.
Spirito et al., N. En~l. J. Med., 336: 775-785
(1997). The causative factors of hypertrophic cardiomyopathy are also diverse
and little understood. In general,
mutations in genes encoding sarcomeric proteins are associated with
hypertrophic cardiomyopathy. Recent data
suggest that (3-myosin heavy chain mutations may account for approximately 30
to 40 percent of cases of familial
hypertrophic cardiomyopathy. Watkins et al., N. Enel. J. Med., 326: 1108-1114
( 1992); Schwartz et al, Circulation,
91: 532-540 (1995); Marian and Roberts, Circulation, 92: 1336-1347 (1995);
Thierfelder et al., Cell, 77: 701-712
39
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
(1994); Watkins et al., Nat. Gen., 11: 434-437 (1995). Besides (3-myosin heavy
chain, other locations of genetic
mutations include cardiac troponin T, alpha topomyosin, cardiac myosin binding
protein C, essential myosin light
chain, and regulatory myosin light chain. See, Malik and Watkins, Curr. Olin.
Cardiol., 12: 295-302 (1997).
Supravalvular "aortic stenosis" is an inherited vascular disorder
characterized by narrowing of the
ascending aorta, but other arteries, including the pulmonary arteries, may
also be affected. Untreated aortic stenosis
may lead to increased intracardiac pressure resulting in myocardial
hypertrophy and eventually heart failure and
death. The
pathogenesisofthisdisorderisnotfullyunderstood,buthypertrophyandpossiblyhyperpl
asiaofmedial
smooth muscle are prominent features of this disorder. It has been reported
that molecular variants of the elastin
gene are involved in the development and pathogenesis of aortic stenosis. U.S.
Patent No. 5,650,282 issued July
22, 1997.
"Valvular regurgitation" occurs as a result of heart diseases resulting in
disorders of the cardiac valves.
Various diseases, like rheumatic fever, can cause the shrinking or pulling
apart of the valve orifice, while other
diseases may result in endocarditis, an inflammation of the endocardium or
lining membrane of the atrioventricular
orifices and operation of the heart. Defects such as the narrowing of the
valve stenosis or the defective closing of
the valve result in an accumulation of blood in the heart cavity or
regurgitation of blood past the valve. If
uncorrected, prolonged valvular stenosis or insufficiency may result in
cardiac hypertrophy and associated damage
to the heart muscle, which may eventually necessitate valve replacement.
The treatment of all these, and other cardiovascular, endothelial and
angiogenic disorders, which may or
may not be accompanied by cardiac hypertrophy, is encompassed by the present
invention.
The terms "cancer", "cancerous", and "malignant" refer to or describe the
physiological condition in
mammals that is typically characterized by unregulated cell growth. Examples
of cancer include but are not limited
to, carcinoma including adenocarcinoma, lymphoma, blastoma, melanoma, sarcoma,
and leukemia. More particular
examples of such cancers include squamous cell cancer, small-cell lung cancer,
non-small cell lung cancer,
gastrointestinal cancer, Hodgkin's and non-Hodgkin's lymphoma, pancreatic
cancer, glioblastoma, cervical cancer,
ovarian cancer, liver cancer such as hepatic carcinoma and hepatoma, bladder
cancer, breast cancer, colon cancer,
colorectal cancer, endometrial carcinoma, salivary gland carcinoma, kidney
cancer such as renal cell carcinoma and
Wilins' tumors, basal cell carcinoma, melanoma, prostate cancer, vulval
cancer, thyroid cancer, testicular cancer,
esophageal cancer, and various types of head and neck cancer. The preferred
cancers for treatment herein are
breast, colon, lung, melanoma, ovarian, and others involving vascular tumors
as noted above.
3 0 The term "cytotoxic agent" as used herein refers to a substance that
inhibits or prevents the function of cells
and/or causes destruction of cells. The term is W tended to include
radioactive isotopes (e.g.,'3'I,'ZSI, 9°Y, and
iaeRe), chemotherapeutic agents, and toxins such as enzymatically active
toxins of bacterial, fungal, plant, or animal
origin, or fragments thereof.
A "chemotherapeutic agent" is a chemical compound useful in the treatment of
cancer. Examples of
chemotherapeutic agents include alkylating agents, folic acid antagonists,
anti-metabolites of nucleic acid
metabolism, antibiotics, pyrimidine analogs, 5-fluorouracil, cisplatin, purine
nucleosides, amines, amino acids,
triazol nucleosides, or corticosteroids. Specific examples include Adriamycin,
Doxorubicin, 5-Fluorouracil,
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
Cytosine arabinoside ("Ara-C"), Cyclophosphamide, Thiotepa, Busulfan, Cytoxin,
Taxol, Toxotere, Methotrexate,
Cisplatin, Melphalan, Vinblastine, Bleomycin, Etoposide, Ifosfamide, Mitomycin
C, Mitoxantrone, Vincreistine,
Vinorelbine, Carboplatin, Teniposide, Daunomycin, Carminomycin, Aminopterin,
Dactinomycin, Mitomycins,
Esperamicins (see U.S. Pat. No. 4,675,187), Melphalan, and other related
nitrogen mustards. Also included in this
definition are hormonal agents that act to regulate or inhibit hormone action
on tumors, such as tamoxifen and
onapristone.
A "growth-inhibitory agent" when used herein refers to a compound or
composition that inhibits growth
of a cell, such as an Wnt-overexpressing cancer cell, either in vitro or in
vivo. Thus, the growth-inhibitory agent
is one which significantly reduces the percentage of malignant cells in S
phase. Examples of growth-inhibitory
agents include agents that block cell cycle progression (at a place other than
S phase), such as agents that induce
G1 arrest and M-phase arrest. Classical M-phase blockers include the vincas
(vincristine and viliblastine), taxol,
and topo II inhibitors such as doxorubicin, daunorubicin, etoposide, and
bleomycin. Those agents that arrest G1
also spill over into S-phase arrest, for example, DNA alkylating agents such
as tamoxifen, prednisone, dacarbazine,
mechlorethamine, cisplatin, methotrexate, 5-fluorouracil, and ara-C. Further
information can be found in The
1 S Molecular Basis of Cancer, Mendelsohn and Israel, eds., Chapter 1,
entitled "Cell cycle regulation, oncogenes, and
antineoplastic drugs" by Murakami et al. (WB Saunders: Philadelphia,1995),
especiallyp. 13. Additional examples
include tumor necrosis factor (TNF), an antibody capable of inhibiting or
neutralizing the angiogenic activity of
acidic or basic FGF or hepatocyte growth factor (HGF), an antibody capable of
inhibiting or neutralizing the
coagulant activities of tissue factor, protein C, or protein S (see, WO
91/01753, published 21 February 1991), or
an antibody capable of binding to HER2 receptor (WO 89/06692), such as the 4D5
antibody (and functional
equivalents thereof) (e.g., WO 92/22653).
"Treatment" is an intervention performed with the intention of preventing the
development or altering the
pathology of a cardiovascular, endothelial, and angiogenic disorder. The
concept of treatment is used in the
broadest sense, and specifically includes the prevention (prophylaxis),
moderation, reduction, and curing of
cardiovascular, endothelial, and angiogenic disorders of any stage.
Accordingly, "treatment" refers to both
therapeutic treatment and prophylactic or preventative measures, wherein the
object is to prevent or slow down
(lessen) or ameliorate a cardiovascular, endothelial, and angiogenic disorder
such as hypertrophy. Those in need
of treatment include those already with the disorder as well as those prone to
have the disorder or those in whom
the disorder is to be prevented. The disorder may result from any cause,
including idiopathic, cardiotrophic, or
myotrophic causes, or ischemia or ischemic insults, such as myocardial
infarction.
"Chronic" administration refers to administration of the agents) in a
continuous mode as opposed to an
acute mode, so as to maintain the initial effect, such as an anti-hypertrophic
effect, for an extended period of time.
"Mammal" for purposes of treatment refers to any animal classified as a
mammal, including humans,
domestic and farm animals, and zoo, sports, or pet animals, such as dogs,
horses, cats, cows, sheep, pigs, etc.
Preferably, the mammal is human.
Administration "in combination with" one or more further therapeutic agents
includes simultaneous
(concurrent) and consecutive administration in any order.
41
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
The phrase "cardiovascular, endothelial or angiogenic agents" refers
generically to any drug that acts in
treating cardiovascular, endothelial, and angiogenic disorders. Examples of
cardiovascular agents are those that
promote vascular homeostasis by modulating blood pressure, heart rate, heart
contractility, and endothelial and
smooth muscle biology, all of which factors have a role in cardiovascular
disease. Specific examples of these
include angiotensin-II receptor antagonists; endothelia receptor antagonists
such as, for example, BOSENTAN'rM
and MOXONODINTM; interferon-gamma (IFN-y); des-aspartate-angiotensin I;
thrombolytic agents, e.g.,
streptokinase, urokinase, t-PA, and a t-PA variant specifically designed to
have longer half life and very high fibrin
specificity, TIK t-PA (a T103N, N117Q, KHRR(296-299)AAAA t-PA variant, Keyt et
al., Proc. Natl. Acad. Sci.
USA, 91: 3670-3674 (1994)); inotropic or hypertensive agents such as
digoxigenin and p-adrenergic receptor
blocking agents, e.g., propranolol, timolol, tertalolol, carteolol, nadolol,
betaxolol, penbutolol, acetobutolol,
atenolol, metoprolol, and carvedilol; angiotensin converting enzyme (ACE)
inhibitors, e.g., quinapril, captopril,
enalapril, ramipril, benazepril, fosinopril, and lisinopril; diuretics, e.g.,
chlorothiazide, hydrochlorothiazide,
hydroflumethazide, methylchlothiazide, benzthiazide, dichlorphenamide,
acetazolamide, and indapamide; and
calcium channel Mockers, e.g., diltiazem, nifedipine, verapamil, nicardipine.
One preferred category of this type
is a therapeutic agent used for the treatment of cardiac hypertrophy or of a
physiological condition instrumental in
the development of cardiac hypertrophy, such as elevated blood pressure,
aortic stenosis, or myocardial infarction.
"Angiogenic agents" and "endothelial agents" are active agents that promote
angiogenesis and/or
endothelial cell growth, or, if applicable, vasculogenesis. This would include
factors that accelerate wound healing,
such as growth hormone, insulin-like growth factor-I (IGF-I), VEGF, VIGF,
PDGF, epidermal growth factor (EGF),
CTGF and members of its family, FGF, and TGF-a and TGF-R.
"Angiostatic agents" are active agents that inhibit angiogenesis or
vasculogenesis or otherwise inhibit or
prevent growth of cancer cells. Examples include antibodies or other
antagonists to angiogenic agents as defined
above, such as antibodies to VEGF. They additionally include cytotherapeutic
agents such as cytotoxic agents,
chemotherapeutic agents, growth-inhibitory agents, apoptotic agents, and other
agents to treat cancer, such as anti-
HER-2, anti-CD20, and other bioactive and organic chemical agents.
In a pharmacological sense, in the context of the present invention, a
"therapeutically effective amount"
of an active agent such as a PRO polypeptide or agonist or antagonist thereto
or an anti-PRO antibody, refers to an
amount effective in the treatment of a cardiovascular, endothelial or
angiogenic disorder in a mammal and can be
determined empirically.
As used herein, an "effective amount" of an active agent such as a PRO
polypeptide or agonist or
antagonist thereto or an anti-PRO antibody, refers to an amount effective for
carrying out a stated purpose, wherein
such amounts may be determined empirically for the desired effect.
The terms "PRO polypeptide" and "PRO" as used herein and when immediately
followed by a numerical
designation refer to various polypeptides, wherein the complete designation
(i. e., PRO/number) refers to specific
polypeptide sequences as described herein. The terms "PRO/numberpolypeptide"
and "PRO/number" wherein the
term "number" is provided as an actual numerical designation as used herein
encompass native sequence
polypeptides and polypeptide variants (which are further defined herein). The
PRO polypeptides described herein
42
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
may be isolated from a variety of sources, such as from human tissue types or
from another source, or prepared by
recombinant or synthetic methods.
A "native sequence PRO polypeptide" comprises a polypeptide having the same
amino acid sequence as
the corresponding PRO polypeptide derived from nature. Sueh native sequence
PRO polypeptides can be isolated
from nature or can be produced by recombinant or synthetic means. The term
"native sequence PRO polypeptide"
specifically encompasses naturally-occurring truncated or secreted forms of
the specific PRO polypeptide (e.g., an
extracellular domain sequence), naturally-occurring variant forms (e.g.,
alternatively spliced forms) and
naturally-occurnng allelic variants ofthepolypeptide. Invarious embodiments
ofthe invention, the native sequence
PRO polypeptides disclosed herein are mature or full-length native sequence
polypeptides comprising the full-length
amino acids sequences shown in the accompanying figures. Start and stop codons
are shown in bold font and
underlined in the figures. However, while the PRO polypeptide disclosed in the
accompanying figures are shown
to begin with methionine residues designated herein as amino acid position 1
in the figures, it is conceivable and
possible that other methionine residues located either upstream or downstream
from the amino acid position 1 in
the figures may be employed as the starting amino acid residue for the PRO
polypeptides.
The PRO polypeptide "extracellular domain" or "ECD" refers to a form of the
PRO polypeptide which is
essentially free of the transmembrane and cytoplasmic domains. Ordinarily, a
PRO polypeptide ECD will have less
than 1% of such transmembrane and/or cytoplasmic domains and preferably, will
have less than O.S% of such
domains. It will be understood that any transmembrane domains identified for
the PRO polypeptides of the present
invention are identified pursuant to criteria routinely employed in the art
for identifying that type of hydrophobic
domain. The exact boundaries of a transmembrane domain may vary but most
likely by no more than about S
amino acids at either end of the domain as initially identified herein.
Optionally, therefore, an extracellular domain
of a PRO polypeptide may contain from about S or fewer amino acids on either
side of the transmembrane
domain/extracellular domain boundary as identified in the Examples or
specification and such polypeptides, with
or without the associated signal peptide, and nucleic acid encoding them, are
comtemplated by the present invention.
The approximate location of the "signal peptides" of the various PRO
polypeptides disclosed herein are
shown in the present specification and/or the accompanying figures. It is
noted, however, that the C-terminal
boundary of a signal peptide may vary, but most likely by no more than about S
amino acids on either side of the
signal peptide C-terminal boundary as initially identified herein, wherein the
C-terminal boundary of the signal
peptide may be identified pursuant to criteria routinely employed in the art
for identifying that type of amino acid
sequence element (e.g., Nielsen et al., Prot. En~., 10:1-6 (1997,) and von
Heinje et al., Nucl. Acids Res.,
14:4683-4690 (1986)). Moreover, it is also recognized that, in some cases,
cleavage of a signal sequence from a
secreted polypeptide is not entirely uniform, resulting in more than one
secreted species. These mature
polypeptides, where the signal peptide is cleaved within no more than about S
amino acids on either side of the
C-terminal boundary of the signal peptide as identified herein, and the
polynucleotides encoding them, are
contemplated by the present invention.
"PRO polypeptide variant" means an active PRO polypeptide as defined above or
below having at least
about 80% amino acid sequence identity with a full-length native sequence PRO
polypeptide sequence as disclosed
43
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
herein, a PRO polypeptide sequence lacking the signal peptide as disclosed
herein, an extracellular domain of a PRO
polypeptide, with or without the signal peptide, as disclosed herein or any
other fragment of a full-length PRO
polypeptide sequence as disclosed herein. Such PRO polypeptide variants
include, for instance, PRO polypeptides
wherein one or more amino acid residues are added, or deleted, at the N- or C-
terminus of the full-length native
amino acid sequence. Ordinarily, a PRO polypeptide variant will have at least
about 80%, 81%, 82%, 83%, 84%,
85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% or 98% amino
acid sequence identity
and alternatively at least about 99% amino acid sequence identity to a full-
length native sequence PRO polypeptide
sequence as disclosed herein, a PRO polypeptide sequence lacking the signal
peptide as disclosed herein, an
extracellular domain of a PRO polypeptide, with or without the signal peptide,
as disclosed herein or any other
specifically defined fragment of a full-lengtli PRO polypeptide sequence as
disclosed herein. Ordinarily, PRO
variant polypeptides are at least about 10, 20, 30, 40, 50, 60, 70, 80, 90,
100, 150 or 200 amino acids in length and
alternatively at least about 300 amino acids in length, or more.
"Percent (%) amino acid sequence identity" with respect to the PRO polypeptide
sequences identified
herein is defined as the percentage of amino acid residues in a candidate
sequence that are identical with the amino
acid residues in a PRO sequence, after aligning the sequences and introducing
gaps, if necessary, to achieve the
maximum percent sequence identity, and not considering any conservative
substitutions as part of the sequence
identity. Alignment for purposes of determining percent amino acid sequence
identity can be achieved in various
ways that are within the skill in the art, for instance, using publicly
available computer software such as BLAST,
BLAST-2, ALIGN, ALIGN-2 or Megalign (DNASTAR) software. Those skilled in the
art can determine
appropriate parameters for measuring alignment, including any algorithms
needed to achieve maximal alignment
over the full-length of the sequences being compared. For purposes herein,
however, % amino acid sequence
identity values are obtained as described below by using the sequence
comparison computer program ALIGN-2,
wherein the complete source code for the ALIGN-2 program is provided in Table
1. The ALIGN-2 sequence
comparison computer program was authored by Genentech, Inc., and the source
code shown in Table 1 has been
filed with user documentation in the U.S. Copyright Office, Washington D.C.,
20559, where it is registered under
U.S. Copyright Registration No. TXU510087. The ALIGN-2 program is publicly
available through Genentech,
Inc., South San Francisco, California or may be compiled from the source code
provided in Table 1. The ALIGN-2
program should be compiled for use on a UNIX operating system, preferably
digital UNIX V4.OD. All sequence
comparison parameters are set by the ALIGN-2 program and do not vary.
For purposes herein, the % amino acid sequence identity of a given amino acid
sequence A to, with, or
against a given amino acid sequence B (which can alternatively be phrased as a
given amino acid sequence A that
has or comprises a certain % amino acid sequence identity to, with, or against
a given amino acid sequence B) is
calculated as follows:
3 5 , 100 times the fraction X/Y
where X is the number of amino acid residues scored as identical matches by
the sequence alignment program
44
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
ALIGN-2 in that program's alignment of A and B, and where Y is the total
number of amino acid residues iii B.
It will be appreciated that where the length of amino acid sequence A is not
equal to the length of amino acid
sequence B, the % amino acid sequence identity of A to B will not equal the %
amino acid sequence identity of B
to A. As examples of % amino acid sequence identity calculations, Tables 2-3
demonstrate how to calculate the
% amino acid sequence identity of the amino acid sequence designated
"Comparison Protein" to the amino acid
sequence designated "PRO".
Unless specifically stated otherwise, all % amino acid sequence identity
values used herein are obtained
as described above using the ALIGN-2 sequence comparison computerprogram.
However, % amino acid sequence
identity may also be determined using the sequence comparison program NCBI-
BLAST2 (Altschul et al., Nucleic
Acids Res., 25:3389-3402 (1997)). The NCBI-BLAST2 sequence comparison program
may be downloaded from
htt~://www.ncbi.nlm.nih. ~ov. or otherwise obtained from the National
Institute of Health, Bethesda, MD. NCBI-
BLAST2 uses several search parameters, wherein all of those search parameters
are set to default values including,
for example, unmask= yes, strand = all, expected occurrences =10, minimum low
complexity length=15/5, multi-
pass e-value = 0.01, constant for multi-pass = 25, dropoff for final gapped
alignment = 25 and scoring matrix =
BLOSUM62.
In situations where NCBI-BLAST2 is employed for amino acid sequence
comparisons, the % amino acid
sequence identity of a given amino acid sequence A to, with, or against a
given amino acid sequence B (which can
alternatively be phrased as a given amino acid sequence A that has or
comprises a certain % amino acid sequence
identity to, with, or against a given amino acid sequence B) is calculated as
follows:
100 tunes the fraction X/Y
where X is the number of amino acid residues scored as identical matches by
the sequence alignment program
NCBI-BLAST2 in that program's alignment of A and B, and where Y is the total
number of amino acid residues
in B. It will be appreciated that where the length of amino acid sequence A is
not equal to the length of amino acid
sequence B, the % amino acid sequence identity of A to B will not equal the %
amino acid sequence identity of B
to A.
In addition, % amino acid sequence identity may also be determined using the
WU-BLAST-2 computer
program (Altschul et al., Methods in Enzymology, 266:460-480 (1996)). Most of
the WU-BLAST-2 search
3 0 parameters are set to the default values. Those not set to default values,
i. e. , the adjustable parameters, are set with
the following values: overlap span = 1, overlap fraction = 0.125, word
threshold (T) = 11, and scoring matrix =
BLOSUM62. For purposes herein, a % amino acid sequence identity value is
determined by dividing (a) the
number of matching identical amino acids residues between the amino acid
sequence of the PRO polypeptide of
interest having a sequence derived from the native PRO polypeptide and the
comparison amino acid sequence of
interest (i.e., the sequence against which the PRO polypeptide of interest is
being compared which may be a PRO
variant polypeptide) as determined by WU-BLAST-2 by (b) the total number of
amino acid residues of the PRO
polypeptide of interest. For example, in the statement "a polypeptide
comprising an amino acid sequence A which
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
has or having at least 80% amino acid sequence identity to the amino acid
sequence B", the amino acid sequence
A is the comparison amino acid sequence of interest and the amino acid
sequence B is the amino acid sequence of
the PRO polypeptide of interest.
"PRO variant polynucleotide" or "PRO variant nucleic acid sequence" means a
nucleic acid molecule
which encodes an active PRO polypeptide as defined below and which has at
least about 80% nucleic acid sequence
identity with a nucleotide acid sequence encoding a full-length native
sequence PRO polypeptide sequence as
disclosed herein, a full-length native sequence PRO polypeptide sequence
lacking the signal peptide as disclosed
herein, an extracellular domain of a PRO polypeptide, with or without the
signal peptide, as disclosed herein or any
other fragment of a full-length PRO polypeptide sequence as disclosed herein.
Ordinarily, a PRO variant
polynucleotide will have at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%,
87%, 88%, 89%, 90%, 91%, 92%,
93%, 94%, 95%, 96%, 97% or 98% nucleic acid sequence identity and
alternatively at least about 99% nucleic acid
sequence identity with a nucleic acid sequence encoding a full-length native
sequence PRO polypeptide sequence
as disclosed herein, a full-length native sequence PRO polypeptide sequence
lacking the signal peptide as disclosed
herein, an extracellular domain of a PRO polypeptide, with or without the
signal sequence, as disclosed herein or
any other fragment of a full-length PRO polypeptide sequence as disclosed
herein. Variants do not encompass the
native nucleotide sequence.
Ordinarily, PRO variant polynucleotides are at least about 30, 60, 90, 120,
150, 180, 210, 240, 270, 300,
450, or 600 nucleotides in length and alternatively at least about 900
nucleotides in length, or more.
"Percent (%) nucleic acid sequence identity" with respect to the PRO
polypeptide-encoding nucleic acid
sequences identified herein is defined as the percentage ofnucleotides in a
candidate sequence that are identical with
the nucleotides in a PRO polypeptide-encoding nucleic acid sequence, after
aligning the sequences and introducing
gaps, if necessary, to achieve the maximum percent sequence identity.
Alignment for purposes of determining
percent nucleic acid sequence identity can be achieved in various ways that
are within the skill in the art, for
instance, using publicly available computer software such as BLAST, BLAST-2,
ALIGN, ALIGN-2 or Megalign
(DNASTAR) software. Those skilled in the art can determine appropriate
parameters for measuring alignment,
including any algoritluns needed to achieve maximal alignment over the full-
length of the sequences being
compared. For purposes herein, however, % nucleic acid sequence identity
values are obtained as described below
by using the sequence comparison computer program ALIGN-2, wherein the
complete source code for the ALIGN-
2 program is provided in Table 1. The ALIGN-2 sequence comparison computer
program was authored by
Genentech,Inc.,andthesourcecodeshowninTablelhasbeenfiledwithuserdocumentationin
theU.S.Copyright
Office, Washington D.C., 20559, where it is registered under U.S. Copyright
Registration No. TXU510087. The
ALIGN-2 program is publicly available through Genentech, Inc.; South San
Francisco, California or may be
compiled from the source code provided in Table 1. The ALIGN-2 program should
be compiled for use on a UNIX
operating system, preferably digital UNIX V4.OD. All sequence comparison
parameters are set by the ALIGN-2
program and do not vary.
For purposes herein, the % nucleic acid sequence identity of a given nucleic
acid sequence C to, with, or
against a given nucleic acid sequence D (which can alternatively be phrased as
a given nucleic acid sequence C that
46
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
has or comprises a certain % nucleic acid sequence identity to, with, or
against a given nucleic acid sequence D)
is calculated as follows:
100 times the fraction W/Z
where W is the number of nucleotides scored as identical matches by the
sequence alignment program ALIGN-2
in that program's alignment of C and D, and where Z is the total number of
nucleotides in D. It will be appreciated
that where the length of nucleic acid sequence C is not equal to the length of
nucleic acid sequence D, the % nucleic
acid sequence identity of C to D will not equal the % nucleic acid sequence
identity of D to C. As examples of %
nucleic acid sequence identity calculations, Tables 4-5 demonstrate how to
calculate the % nucleic acid sequence
identity ofthe nucleic acid sequence designated "Comparison DNA" to the
nucleic acid sequence designated "PRO-
DNA".
Unless specifically stated otherwise, all % nucleic acid sequence identity
values used herein are obtained
as described above using the ALIGN-2 sequence comparison computer program.
However, % nucleic acid
sequence identity may also be determined using the sequence comparison program
NCBI-BLAST2 (Altschul et al.,
Nucleic Acids Res., 25:3389-3402 (1997)). The NCBI-BLAST2 sequence comparison
program may be
downloaded from http://www.ncbi.nlin.nih.gov. or otherwise obtained from the
National Institute of Health,
Bethesda, MD. NCBI-BLAST2 uses several search parameters, wherein all of those
search parameters are set to
default values including, for example, unmask = yes, strand = all, expected
occurrences = 10, minimum low
complexity length = 15/5, mufti-pass e-value = 0.01, constant for mufti-pass =
25, dropoff for final gapped
alignment = 25 and scoring matrix = BLOSUM62.
In situations where NCBI-BLAST2 is employed for sequence comparisons, the %
nucleic acid sequence
identity of a given nucleic acid sequence C to, with, or against a given
nucleic acid sequence D (which can
alternatively be phrased as a given nucleic acid sequence C that has or
comprises a certain % nucleic acid sequence
identity to, with, or against a given nucleic acid sequence D) is calculated
as follows:
100 times the fraction W/Z
where W is the number of nucleotides scored as identical matches by the
sequence alignment program NCBI-
BLAST2 in that program's alignment of C and D, and where Z is the total number
of nucleotides in D. It will be
appreciated that where the length of nucleic acid sequence C is not equal to
the length of nucleic acid sequence D,
the % nucleic acid sequence identity of C to D will not equal the % nucleic
acid sequence identity of D to C.
In addition, % nucleic acid sequence identity values may also be generated
using the WU-BLAST-
2 computer program (Altschul et al., Methods in Enzymoloey, 266:460-480
(1996)). Most of the WU-BLAST-2
search parameters are set to the default values. Those not set to default
values, i.e., the adjustable parameters, are
set with the following values: overlap span = 1, overlap fraction = 0.125,
word threshold (T) = 11, and scoring
matrix = BLOSUM62. For purposes herein, a % nucleic acid sequence identity
value is determined by dividing (a)
47
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
the number of matching identical nucleotides between the nucleic acid sequence
of the PRO polypeptide-encoding
nucleic acid molecule of interest having a sequence derived from the native
sequence PRO polypeptide-encoding
nucleic acid and the comparison nucleic acid molecule of interest (i.e., the
sequence against which the PRO
polypeptide-encoding nucleic acid molecule of interest is being compared which
may be a variant PRO
polynucleotide) as determined by WLJ-BLAST-2 by (b) the total number of
nucleotides of the PRO polypeptide-
encoding nucleic acid molecule of interest. For example, in the statement "an
isolated nucleic acid molecule
comprising a nucleic acid sequence A which has or having at least 80% nucleic
acid sequence identity to the nucleic
acid sequence B", the nucleic acid sequence A is the comparison nucleic acid
molecule of interest and the nucleic
acid sequence B is the nucleic acid sequence of the PRO polypeptide-encoding
nucleic acid molecule of interest.
In other embodiments, PRO variant polynucleotides are nucleic acid molecules
that encode an active PRO
polypeptide and which are capable of hybridizing, preferably under stringent
hybridization and wash conditions,
to nucleotide sequences encoding the full-length PRO polypeptide as shown in
the specification herein and
accompanying figures. PRO variant polypeptides may be those that are encoded
by a PRO variant polynucleotide.
"Isolated", when used to describe the various polypeptides disclosed herein,
means a polypeptide that has
been identified and separated and/or recovered from a component of its natural
environment. Preferably, the
isolated polypeptide is free of association with all components with which it
is naturally associated. Contaminant
components of its natural environment are materials that would typically
interfere witli diagnostic or therapeutic
uses for the polypeptide, and may include enzymes, hormones, and other
proteiiiaceous or non-proteinaceous
solutes. In preferred embodiments, the polypeptide will be purified (1) to a
degree sufficient to obtain at least 15
residues of N-terminal or internal amino acid sequence by use of a spinning
cup sequenator, or (2) to homogeneity
by SDS-PAGE under non-reducing or reducing conditions using Coomassie blue or,
preferably, silver stain.
Isolated polypeptide includes polypeptide in situ within recombinant cells,
since at least one component of the PRO
natural environment will not be present. Ordinarily, however, isolated
polypeptide will be prepared by at least one
purification step.
An "isolated" nucleic acid molecule encoding a PRO polypeptide or an
"isolated" nucleic acid molecule
encoding an anti-PRO antibody is a nucleic acid molecule that is identified
and separated from at least one
contaminant nucleic acid molecule with which it is ordinarily associated in
the natural source of the PRO-encoding
nucleic acid or the natural source of the anti-PRO-encoding nucleic acid.
Preferably, the isolated nucleic acid is
free of association with all components with which it is naturally associated.
An isolated PRO-encoding nucleic
acid molecule or an isolated anti-PRO-encoding nucleic acid molecule is other
than in the form or setting in which
it is found in nature. Isolated nucleic acid molecules therefore are
distinguished from the PRO-encoding nucleic
acid molecule or from the anti-PRO-encoding nucleic acid molecule as it exists
in natural cells. However, an
isolated nucleic acid molecule encoding a PRO polypeptide or an isolated
nucleic acid molecule encoding an anti-
PRO antibody includes PRO-nucleic acid molecules or anti-PRO-nucleic acid
molecules contained in cells that
ordinarily express PRO polypeptides or anti-PRO antibodies where, for example,
the nucleic acid molecule is in
a chromosomal location different from that of natural cells.
The term "control sequences" refers to DNA sequences necessary for the
expression of an operably liiilced
48
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
coding sequence in a particular host organism. The control sequences that are
suitable for prokaryotes, for example,
include a promoter, optionally an operator sequence, and a ribosome binding
site. Eukaryotic cells are known to
utilize, for example, promoters, polyadenylation signals, and enhancers.
Nucleic acid is "operably linked" when it is placed into a functional
relationship with another nucleic acid
sequence. For example, DNA for a presequence or secretory leader is operably
linked to DNA for a PRO
polypeptide if it is expressed as a preprotein that participates in the
secretion of the polypeptide; a promoter or
enhancer is operably linked to a coding sequence if it affects the
transcription of the sequence; or a ribosome
binding site is operably linked to a coding sequence if it is positioned so as
to facilitate translation. Generally,
"operably linked" means that the DNA sequences being linked are contiguous,
and, in the case of a secretory leader,
contiguous and in the same reading frame. However, enhancers do not have to be
contiguous. Linking is
accomplished by ligation at convenient restriction sites. If such sites do not
exist, synthetic oligonucleotide adaptors
or liiilcers are used in accordance with conventional practice.
"Stringency" of hybridization reactions is readily determinable by one of
ordinary skill in the art, and
generally is an empirical calculation dependent upon probe length, washing
temperature, and salt concentration.
In general, longer probes require higher temperatures for proper annealing,
while shorter probes need lower
temperatures. Hybridization generally depends on the ability of denatured DNA
to reanneal when complementary
strands are present in an enviromnent below their melting temperature. The
higher the degree of desired homology
between the probe and hybridizable sequence, the higher the relative
temperature that can be used. As a result, it
follows that higher relative temperatures would tend to make the reaction
conditions more stringent, while lower
temperatures less so. For additional details and explanation of stringency of
hybridization reactions, see, Ausubel
et al., Current Protocols in Molecular Biology (Wiley Interscience Publishers,
1995).
"Stringent conditions" or "high-stringency conditions", as defined herein, may
be identified by those that:
(1) employ low ionic strength and high temperature for washing, for example,
0.015 M sodium chloride/0.0015 M
sodium citrate/0.1% sodium dodecyl sulfate at 50°C; (2) employ during
hybridization a denaturing agent, such as
formamide, for example, 50% (v/v) formamide with 0.1% bovine serum
albumin/0.1% Ficoll/0.1%
polyvinylpyrrolidone/SOmM sodium phosphate buffer at pH 6.5 with 750 mM sodium
chloride, 75 mM sodium
citrate at 42°C; or (3) employ 50% formamide, 5 x SSC (0.75 M NaCl,
0.075 M sodium citrate), 50 mM sodium
phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 x Denhardt's solution,
sonicated salmon sperm DNA (50
~g/ml), 0.1% SDS, and 10% dextran sulfate at 42°C, with washes at
42°C in 0.2 x SSC (sodium chloride/sodium
3 0 citrate) and 50% formamide at 55°C, followed by a high-stringency
wash consisting of 0.1 x SSC containing EDTA
at 55°C.
"Moderately-stringent conditions" may be identified as described by Sambrook
et al., Molecular Cloning:
A Laboratory Manual (New York: Cold Spring Harbor Press, 1989), and include
the use of washing solution and
hybridization conditions (e.g., temperature, ionic strength, and % SDS) less
stringent than those described above.
An example of moderately stringent conditions is overnight incubation at
37°C in a solution comprising: 20%
formamide, 5 x SSC (150 mM NaCl,15 mM trisodium citrate), 50 mM sodium
phosphate (pH 7.6), 5 x Denhardt's
solution,10% dextran sulfate, and 20 mg/ml denatured sheared salmon sperm DNA,
followed by washing the filters
49
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
in 1 x SSC at about 37-50°C. The skilled artisan will recognize how to
adjust the temperature, ionic strength, etc.
as necessary to accommodate factors such as probe length and the like.
The modifier "epitope-tagged" when used herein refers to a chimeric
polypeptide comprising a PRO
polypeptide fused to a "tag polypeptide". The tag polypeptide has enough
residues to provide an epitope against
which an antibody can be made, yet is short enough such that it does not
interfere with activity of the polypeptide
to which it is fused. The tag polypeptide preferably also is fairly unique so
that the antibody does not substantially
cross-react with other epitopes. Suitable tag polypeptides generally have at
least six amino acid residues and usually
between about 8 and 50 amino acid residues (preferably, between about 10 and
20 amino acid residues).
"Active" or "activity" in the context of PRO variants refers to forms) of PRO
proteins that retain the
biologic and/or immunologic activities of a native or naturally-occurring PRO
polypeptide.
"Biological activity" in the context of a molecule that antagonizes a PRO
polypeptide that can be identified
by the screening assays disclosed herein (e.g. , an organic or inorganic small
molecule, peptide, etc.) is used to refer
to the ability of such molecules to bind or complex with the PRO polypeptide
identified herein, or otherwise
interfere with the interaction of the PRO polypeptide with other cellular
proteins or otherwise inhibits the
transcription or translation of the PRO polypeptide. Particularly preferred
biological activity includes cardiac
hypertrophy, activity that acts on systemic disorders that affect vessels,
such as diabetes mellitus, as well as diseases
of the arteries, capillaries, veins, and/or lymphatics, and cancer.
The term "antagonist" is used in the broadest sense, and includes any molecule
thatpartially or fully blocks,
inhibits, or neutralizes one or more of the biological activities of a native
PRO polypeptide disclosed herein, for
example, if applicable, its mitogenic or angiogenic activity. Antagonists of a
PRO polypeptide may act by
interfering with the binding of a PRO polypeptide to a cellular receptor, by
incapacitating or killing cells that have
been activated by a PRO polypeptide, or by interfering with vascular
endothelial cell activation after binding of a
PRO polypeptide to a cellular receptor. All such points of intervention by a
PRO polypeptide antagonist shall be
considered equivalent for purposes of this invention. Tlie antagonists inhibit
the mitogenic, angiogenic, or other
biological activity of PRO polypeptides, and thus are useful for the treatment
of diseases or disorders characterized
by undesirable excessive neovascularization, including by way of example
tumors, and especially solid malignant
tumors, rheumatoid arthritis, psoriasis, atherosclerosis, diabetic and other
retinopathies, retrolental fibroplasia, age-
related macular degeneration, neovascular glaucoma, hemangiomas, thyroid
hyperplasias (including Grave's
disease), corneal and other tissue transplantation, and chronic inflammation.
The antagonists also are useful for the
treatment of diseases or disorders characterized by undesirable excessive
vascular permeability, such as edema
associated with brain tumors, ascites associated with malignancies, Meigs'
syndrome, lung inflammation, nephrotic
syndrome, pericardial effusion (such as that associated with pericarditis),
and pleural effusion. In a similar manner,
the term "agonist" is used in the broadest sense and includes any molecule
that mimics a biological activity of a
native PRO polypeptide disclosed herein. Suitable agonist or antagonist
molecules specifically include agonist or
antagonist antibodies or antibody fragments, fragments, or amino acid sequence
variants of native PRO
polypeptides, peptides, small organic molecules, etc.
A "small molecule" is defined herein to have a molecular weight below about
500 daltons.
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
The term "PRO polypeptide receptor" as used herein refers to a cellular
receptor for a PRO polypeptide,
ordinarily a cell-surface receptor found on vascular endothelial cells, as
well as variants thereofthat retain the ability
to bind a PRO polypeptide.
"Antibodies" (Abs) and "immunoglobulins" (Igs) are glycoproteins having the
same structural
characteristics. While antibodies exhibit binding specificity to a specific
antigen, immunoglobulins include both
antibodies and other antibody-like molecules that lack antigen specificity.
Polypeptides of the latter kind are, for
example, produced at low levels by the lymph system and at increased levels by
myelomas. The term "antibody"
is used in the broadest sense and specifically covers, without limitation,
intact monoclonal antibodies, polyclonal
antibodies, multispecific antibodies (e.g., bispecific antibodies) formed from
at least two intact antibodies, and
antibody fragments, so long as they exhibit the desired biological activity.
"Native antibodies" and "native immunoglobulins" are usually heterotetrameric
glycoproteins of about
150,000 daltons, composed of two identical light (L) chains and t~.vo
identical heavy (H) chains. Each light chain
is linked to a heavy chain by one covalent disulfide bond, while the number of
disulfide linkages varies among the
heavy chains of different immunoglobulin isotypes. Eacli heavy and light chain
also has regularly spaced intrachain
disulfide bridges. Each heavy chain has at one end a variable domain (VH)
followed by a number of constant
domains. Each light chain has a variable domain at one end (VL) and a constant
domain at its other end; the constant
domain of the light chain is aligned with the first constant domain of the
heavy chain, and the light-chain variable
domain is aligned with the variable domain of the heavy chain. Particular
amino acid residues are believed to form
an interface between the light- and heavy-chain variable domains.
The term "variable" refers to the fact that certain portions of the variable
domains differ extensively in
sequence among antibodies and are used in the binding and specificity of each
particular antibody to and for its
particular antigen. However, the variability is not evenly distributed
throughout the variable domains of antibodies.
It is concentrated in three segments called complementarity-determining
regions (CDRs) or hypervariable regions
both in the light-chain and the heavy-chain variable domains. The more highly
conserved portions of variable
domains are called the framework regions (FR). The variable domains of native
heavy and light chains each
comprise four FR regions, largely adopting a p-sheet configuration, connected
by three CDRs, which form loops
connecting, and in some cases forming part of, the ~3-sheet structure. The
CDRs in each chain are held together in
close proximity by the FR regions and, with the CDRs from the other chain,
contribute to the formation of the
antigen-binding site of antibodies. See, Kabat et al., NIH Publ. No.91-3242,
Vol. I, pages 647-669 (1991). The
constant domains are not involved directly in binding an antibody to an
antigen, but exhibit various effector
functions, such as participation of the antibody in antibody-dependent
cellular toxicity.
"Antibody fragments" comprise a portion of an intact antibody, preferably the
antigen-binding or variable
region of the intact antibody. Examples of antibody fragments include Fab,
Fab', F(ab')Z, and Fv fragments;
diabodies; linear antibodies (Zapata et al., Protein Ena., 8 10 : 105 7-1062 (
1995)); single-chain antibody molecules;
3 5 and multispecific antibodies formed from antibody fragments.
Papain digestion of antibodies produces two identical antigen-binding
fragments, called "Fab" fragments,
each with a single antigen-binding site, and a residual "Fc" fragment, whose
name reflects its ability to crystallize
51
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
readily. Pepsin treatment yields an F(ab')z fragment that has two antigen-
combining sites and is still capable of
cross-linking antigen.
"Fv" is the minimvun antibody fragment that contains a complete antigen-
recognition and -binding site.
This region consists of a dimer of one heavy- and one light-chain variable
domain in tight, non-covalent association.
It is in this configuration that the three CDRs of each variable domain
interact to define an antigen-binding site on
the surface of the VH-VL dimer. Collectively, the six CDRs confer antigen-
binding specificity to the antibody.
However, even a single variable domain (or half of an Fv comprising ouy three
CDRs specific for an antigen) has
the ability to recognize and bind antigen, although at a lower affinity than
flee entire binding site.
The Fab fragment also contains the constant domain of the light chain and the
first constant domain (CH 1 )
of the heavy chain. Fab' fragments differ from Fab fragments by the addition
of a few residues at the carboxy
terminus of the heavy chain CH 1 domain including one or more cysteines from
the antibody hinge region. Fab'-SH
is the designation herein for Fab' in which the cysteine residues) of the
constant domains bear a free thiol group.
F(ab')2 antibody fragments originally were produced as pairs of Fab' fragments
that have hinge cysteines between
them. Other chemical couplings of antibody fragments are also known.
The "light chains" of antibodies (immunoglobulins) from any vertebrate species
can be assigned to one
of two clearly distinct types, called kappa (x) and lambda (~,), based on the
amino acid sequences of their constant
domains.
Depending on the amino acid sequence of the constant domain of their heavy
chains, iinmunoglobulins
can be assigned to different classes. There are five major classes of
immunoglobulins: IgA, IgD, IgE, IgG, and IgM;
and several of these may be further divided into subclasses (isotypes), e.g.,
IgG 1, IgG2, IgG3, IgG4, IgA, and IgA2.
The heavy-chain constant domains that correspond to the different classes of
immunoglobulins are called a, 8, e,
y, and p., respectively. The subunit structures and three-dimensional
configurations of different classes of
immunoglobulins are well known.
The term "monoclonal antibody" as used herein refers to an antibody obtained
from a population of
substantially homogeneous antibodies, i. e., the individual antibodies
comprising the population are identical except
forpossible naturally-occurring mutations that may be present in minor
amounts. Monoclonal antibodies are highly
specific, being directed against a single antigenic site. Furthermore, in
contrast to conventional (polyclonal)
antibody preparations that typically include different antibodies directed
against different determinants (epitopes),
each monoclonal antibody is directed against a single determinant on the
antigen. In addition to their specificity,
3 0 the monoclonal antibodies are advantageous in that they are synthesized by
the hybridoma culture, uncontaminated
by other ixnmunoglobulins. The modifier "monoclonal" indicates the character
of the antibody as being obtained
from a substantially homogeneous population of antibodies, and is not to be
construed as requiring production of
the antibody by any particular method. For example, the monoclonal antibodies
to be used in accordance with the
present invention may be made by the hybridoma method first described by
Kohler et al., Nature, 256: 495 ( 1975),
ormaybemadebyrecombinantDNAmethods (see, e.g., U.S. PatentNo.4,816,567). The
"monoclonal antibodies"
may also be isolated from phage antibody libraries using the techniques
described in Clackson et al., Nature, 352:
624-628 (1991) and Marks et al., J. Mol. Biol., 222: 581-597 (1991), for
example.
52
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
The monoclonal antibodies herein specifically include "chimeric" antibodies
(immunoglobulins) in which
a portion of the heavy and/or light chain is identical with or homologous to
corresponding sequences in antibodies
derived from a particular species or belonging to a particular antibody class
or subclass, while the remainder of the
chains) is identical with or homologous to corresponding sequences in
antibodies derived from another species or
belonging to another antibody class or subclass, as well as fragments of such
antibodies, so long as they exhibit the
desired biological activity. U.S. PatentNo. 4,816,567; Morrison etal., Proc.
Natl. Acad. Sci. USA, 81: 6851-6855
(1984).
"Humanized" forms of non-human (e.g., murine) antibodies are chimeric
immunoglobulins,
ixnmunoglobulin chains, or fragments thereof (such as Fv, Fab, Fab', F(ab')2,
or other antigen-binding subsequences
of antibodies) that contain minimal sequence derived from non-human
immunoglobulin. For the most part,
humanized antibodies are human immunoglobulins (recipient antibody) in which
residues from a CDR of the
recipient are replaced by residues from a CDR of a non-human species (donor
antibody) such as mouse, rat or rabbit
having the desired specificity, affinity, and capacity. In some instances, Fv
FR residues of the human
immunoglobulin are replaced by corresponding non-human residues. Furthermore,
humanized antibodies may
comprise residues that are found neither in the recipient antibody nor in the
imported CDR or framework sequences.
These modifications are made to further refine and maximize antibody
performance. In general, the humanized
antibody will comprise substantially all of at least one, and typically two,
variable domains, in which all or
substantially all of the CDR regions correspond to those of a non-human
immunoglobulin and all or substantially
all of the FR regions are those of a human immunoglobulin sequence. The
humanized antibody preferably also will
comprise at least a portion of an immunoglobulin constant region (Fc),
typically that of a human ixnxnunoglobulin.
For further details, see Jones et al., Nature, 321: 522-525 (1986); Reichmann
et al., Nature, 332: 323-329 (1988);
and Presta, Curr. 0b. Struct. Biol., 2: 593-596 (1992). The humanized antibody
includes a PRIMATIZEDTM
antibody wherein the antigen-binding region of the antibody is derived from an
antibody produced by immunizing
macaque monkeys with the antigen of interest.
"Single-chain Fv" or "sFv" antibody fragments comprise the VH and VL domains
of an antibody, wherein
these domains are present in a single polypeptide chain. Preferably, the Fv
polypeptide further comprises a
polypeptide linker between the VH and VL domains that enables the sFv to form
the desired structure for antigen
binding. For a review of sFv see, Pluckthun in The Pharmacology of Monoclonal
Antibodies, Vol. 113, Rosenburg
and Moore, eds. (Springer-Verlag: New York, 1994), pp. 269-315.
The term "diabodies" refers to small antibody fragments with two antigen-
binding sites, which fragments
comprise a heavy-chain variable domain (V~ connected to a light-chain variable
domain (VL) in the same
polypeptide chain (VH - VL). By using a linker that is too short to allow
pairing between the two domains on the
same chain, the domains are forced to pair with the complementary domains of
another chain and create two
antigen-binding sites. Diabodies are described more fully iii, for example, EP
404,097; WO 93/11161; and
Hollinger et al., Proc. Natl. Acad. Sci. USA, 90: 6444-6448 (1993).
An "isolated" antibody is one that has been identified and separated and/or
recovered from a component
of its natural environment. Contaminant components of its natural environment
are materials that would interfere
53
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
with diagnostic or therapeutic uses for the antibody, and may include enzymes,
hormones, and otherproteinaceous
or nonproteinaceous solutes. In preferred embodiments, the antibody will be
purified (1) to greater than 95% by
weight of antibody as determined by the Lowry method, and most preferably more
than 99% by weight, (2) to a
degree sufficient to obtain at least 15 residues of N-terminal or internal
amino acid sequence by use of a spinning
cup sequenator, or (3) to homogeneity by SDS-PAGE under reducing or
nonreducing conditions using Coomassie
blue or, preferably, silver stain. Isolated antibody includes the antibody in
situ within recombinant cells, since at
least one component of the antibody's natural environment will not be present.
Ordinarily, however, isolated
antibody will be prepared by at least one purification step.
An antibody that "specifically binds to" or is "specific for" a particular
polypeptide or an epitope on a
particular polypeptide is one that binds to that particular polypeptide or
epitope on a particular polypeptide without
substantially binding to any other polypeptide or polypeptide epitope.
The word "label" when used herein refers to a detectable compound or other
composition that is conjugated
directly or indirectly to the antibody so as to generate a "labeled" antibody.
The label may be detectable by itself
(e.g., radioisotope labels or fluorescent labels) or, in the case of an
enzymatic label, may catalyze chemical alteration
of a substrate compound or composition that is detectable. Radionuclides that
can serve as detectable labels include,
for example, I-131, I-123, I-125, Y-90, Re-188, At-211, Cu-67, Bi-212, and Pd-
109. The label may also be a non-
detectable entity such as a toxin.
By "solid phase" is meant a non-aqueous matrix to which an antibody of the
present invention can adhere.
Examples of solid phases encompassed herein include those formed partially or
entirely of glass (e.g., controlled
pore glass), polysaccharides (e.g., agarose), polyacrylamides, polystyrene,
polyvinyl alcohol and silicones. In
certain embodiments, depending on the context, the solid phase can comprise
the well of an assay plate; in others
it is a purification column (e.g., an affinity chromatography column). This
term also includes a discontinuous solid
phase of discrete particles, such as those described in U.S. Patent No.
4,275,149.
A "liposome" is a small vesicle composed of various types of lipids,
phospholipids and/or surfactant that
is useful for delivery of a drug (such as the PRO polypeptide or antibodies
thereto disclosed herein) to a mammal.
The components of the liposome are commonly arranged in a bilayer formation,
similar to the lipid arrangement
of biological membranes.
As used herein, the term "immunoadhesin" designates antibody-like molecules
that combine the binding
specificity ofa heterologous protein (an "adhesin") with the effector
functions ofimmunoglobulin constant domains.
3 0 Structurally, the immunoadhesins comprise a fusion of an amino acid
sequence with the desired binding specificity
that is other than the antigen recognition and binding site of an antibody
(i.e., is "heterologous"), and an
immunoglobulin constant domain sequence. The adhesin part of an immunoadhesin
molecule typically is a
contiguous amino acid sequence comprising at least the binding site of a
receptor or a ligand. The immunoglobulin
constant domain sequence in the immunoadhesin may be obtained from any
immunoglobulin, such as IgG-1, IgG-
2, IgG-3, or IgG-4 subtypes, IgA (including IgA-1 and IgA-2), IgE, IgD, or
IgM.
As shown below, Table 1 provides the complete source code for the ALIGN-2
sequence comparison
computer program. This source code may be routinely compiled for use on a UNIX
operating system to provide
54
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
the ALIGN-2 sequence comparison computer program.
In addition, Tables 2-5 show hypothetical exemplifications for using the below
described method to
determine % amino acid sequence identity (Tables 2-3) and % nucleic acid
sequence identity (Tables 4-5) using
the ALIGN-2 sequence comparison computer program, wherein "PRO" represents the
amino acid sequence of a
hypothetical PRO polypeptide of interest, "Comparison Protein" represents the
amino acid sequence of a
polypeptide against which the "PRO" polypeptide of interest is being compared,
"PRO-DNA" represents a
hypothetical PRO-encoding nucleic acid sequence of interest, "Comparison DNA"
represents the nucleotide
sequence of a nucleic acid molecule against which the "PRO-DNA" nucleic acid
molecule of interest is being
compared, "X", "Y", and "Z" each represent different hypothetical amino acid
residues and "N", "L" and "V" each
represent different hypothetical nucleotides.
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
Table 1
/*
* C-C increased from 12 to 15
* Z is average of EQ
* B is average of ND
* match with stop is M; stop-stop = 0; J (joker) match = 0
*!
#define M -8 /* value of a match with a stop */
int day[26][26] _ {
/* A B C D E F G H I J K L M N O P Q R S T U V W X Y Z */
/* A */ { 2, 0,-2, 0, 0,-4, 1,-1,-1, 0,-1,-2,-1, 0, M, 1, 0,-2, 1, 1, 0, 0,-6,
0,-3; 0~,
/* B */ { 0, 3,-4, 3, 2,-5, 0, 1,-2, 0, 0,-3,-2, 2, M,-1, 1, 0, 0, 0, 0,-2,-5,
0,-3, 1},
/* C */ {-2,-4,15,-5,-5,-4,-3,-3,-2, 0,-5,-6,-5,-4, M,-3,-5,-4, 0,-2, 0,-2,-8,
0, 0,-5~,
l* D */ { 0, 3,-5, 4, 3,-6, 1, 1,-2, 0, 0,-4,-3, 2, M,-1, 2,-1, 0, 0, 0,-2,-7,
0,-4, 2},
/* E *! { 0, 2,-5, 3, 4,-5, 0, 1,-2, 0, 0,-3,-2, 1, M,-1, 2,-1, 0, 0, 0,-2,-7,
0,-4, 3~,
/* F */ {-4,-5,-4,-6,-5, 9,-5,-2, 1, 0,-5, 2, 0,-4, M,-5,-5,-4,-3,-3, 0,-1, 0,
0, 7,-5~,
/* G */ { 1, 0,-3, 1, 0,-5, 5,-2,-3, 0,-2,-4,-3, O, M,-1,-1,-3, 1, 0, 0,-1,-7,
0,-5, 0~,
/* H */ {-1, 1,-3, 1, 1,-2,-2, 6,-2, 0, 0,-2,-2, 2, M, 0, 3, 2,-1,-1, 0,-2,-3,
0, 0, 2~,
/* I */ {-1,-2,-2,-2,-2, 1,-3,-2, 5, 0,-2, 2, 2,-2, M,-2,-2,-2,-1, 0, 0, 4,-5,
0,-1,-2~,
/* J */ { 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, M, 0, 0, 0, 0, 0, 0, 0, 0,
0, 0, 0~,
/* K */ {-1, 0,-5, 0, 0,-5,-2, 0,-2, 0, 5,-3, 0, 1, M,-1, 1, 3, 0, 0, 0,-2,-3,
0,-4, 0},
l* L */ {-2,-3,-6,-4,-3, 2,-4,-2, 2, 0,-3, 6, 4,-3, M,-3,-2,-3,-3,-1, 0, 2,-2,
0,-1,-2~,
l* M */ {-1,-2,-5,-3,-2, 0,-3,-2, 2, 0, 0, 4, 6,-2, 1VI,-2,-1, 0,-2,-1, 0, 2,-
4, 0,-2,-1~,
/* N */ { 0, 2,-4, 2, 1,-4, 0, 2,-2, 0, 1,-3,-2, 2, 1VI,-1, 1, 0, 1, 0, 0,-2,-
4, 0,-2, 1~,
l* O *l { M, M, M, M, M, M,_M, M, M, M, M, M, M,_M, 0, M, M, M, M,
M,_M,_M,_M,_M,_M,_M~,
/* P */ ~ 1,-1,-3,-1,-1,-5,-1, 0,-2, 0,-1,-3,-2,-1, M, 6, 0, 0, 1, 0, 0,-1,-6,
0,-5, 0~,
/* Q */ { 0, 1,-5, 2, 2,-5,-1, 3,-2, 0, 1,-2,-1, 1, M, 0, 4, 1,-1,-1, 0,-2,-5,
0,-4, 3~,
l* R */ {-2, 0,-4,-1,-1,-4,-3, 2,-2, 0, 3,-3, 0, 0, M, 0, 1, 6, 0,-1, 0,-2, 2,
0,-4, 0~,
/* S */ { 1, 0, 0, 0, 0,-3, 1,-1,-1, 0, 0,-3,-2, 1, 1VI, 1,-1, 0, 2, 1, 0,-1,-
2, 0,-3, 0},
/* T */ { 1, 0,-2, 0, 0,-3, 0,-1, 0, 0, 0,-1,-1, 0, M, 0,-1,-1, 1, 3, 0, 0,-5,
0,-3, 0~,
/* U */ { o, o, o, o, o, o, o, o, o, o, o, o, o, o, M, o, o, o, o, o, o, o, o,
o, o, off,
/* V */ { 0,-2,-2,-2,-2,-1,-1,-2, 4, 0,-2, 2, 2,-2, M,-1,-2,-2,-1, 0, 0, 4,-6,
0,-2,-2~,
/* W */ {-6,-5,-8,-7,-7, 0,-7,-3,-5, 0,-3,-2 -4,-4, M,-6,-5, 2,-2,-5, 0,-6,17,
0, 0,-6~,
/* X *l { 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, ~0, 0 =IVI, 0, 0, 0, 0, 0, 0, 0,
0, 0, 0, 0~,
/* Y *! {-3,-3, 0,-4,-4, 7,-5, 0,-1, 0,-4,-1,-2,-2,_M,-5,-4,-4,-3,-3, 0,-2, 0,
0,10,-4~,
/* Z */ { 0, 1,-5, 2, 3,-5, 0, 2,-2, 0, 0,-2,-1, 1, M, 0, 3, 0, 0, 0, 0,-2,-6,
0,-4, 4~
56
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
Table 1 (cony)
/*
*/
#include
<stdio.h>
#include h>
<ctype.
#deF'meMAXJMP /* max jumps in a diag *l
16
#defineMAXGAP /* don't continue to penalize
24 gaps larger than this */
#def'meJMPS1024 /* max jmps in an path */
#defineMX 4 /* save if there's at least
MX-1 bases since last jmp
*/
#defineDMAT3 !* value of matching bases
*/
#defineDMIS0 /* penalty for mismatched
bases */
#defineDINSO8 1* penalty for a gap *l
#defineDINS11 /* penalty per base */
#definePINSO8 /* penalty for a gap */
#definePINS14 /* penalty per residue */
struct
jmp
{
shortn[MAXJ MP]; /* size of jmp (neg for
defy) */
unsigned
short
x[MAXJMP];
/*
base
no.
of
jmp
in
seq
x
*/
!* limits seq to 2" 16 -1
*/
structag
di {
int score; /* score at lastjmp */
longoffset; /* offset of prev block *l
shortijmp; l* current jmp index *!
struct /* list of jmps */
jmp
jp;
struct
path
~
int spc; /* number of leading spaces
*/
shortn[JMPS]; /* size of jmp (gap) *!
int x[JMPS]; /* loc of jmp (last elem before
gap) */
char *ofile; /* output file name */
char *namex[2];/* seq names: getseqs( ) */
char *prog; /* prog name for err msgs
*/
char *seqx[2]; /* seqs: getseqs( ) */
int dmax; /* best diag: nw( ) */
int dmax0; /* final diag */
int dna; /* set if dna: main( ) *l
int endgaps; /* set if penalizing end gaps
*/
int gapx, gapy;/* total gaps in seqs */
int len0, lent;/* seq lens */
int ngapx, /* total size of gaps */
ngapy;
int smax; /* max score: nw( ) */
int *xbm; /* bitmap for matching */
long offset; /* current offset in jmp file
*/
structdiag*dx; /* holds diagonals */
structpathpp[2]; /* holds path for seqs */
char *calloc( ( ), *index( ), *strcpy( );
), *malloc
char *getseq(
), *g
calloc(
);
57
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
Table 1 (cony)
/* Needleman-Wunsch alignment program
*
* usage: progs filel filet
* where Elel and filet are two dna or two protein sequences.
* The sequences can be in upper- or lower-case an may contain ambiguity
* Any lines beginning with ';' ' >' or ' <' are ignored
* Max file length is 65535 (limited by unsigned short x in the jmp struct)
* A sequence with 1/3 or more of its elements ACGTU is assumed to be DNA
* Output is in the file "align.out"
*
* The program may create a tmp file in /tmp to hold info about traceback.
* Original version developed under BSD 4.3 on a vax 8650
*/
#include "nw.h"
#include "day.h"
static dbval[26] _ ~
1,14,2,13,0,0,4,11,0,0,12,0,3,15,0,0,0,5,6,8,8,7,9,0,10,0
static -pbval[26] _ {
1, 2~(1< <('D'-'A'))~(1< <('N'-'A')), 4, 8, 16, 32, 64,
128, 256, OxFFFFFFF, 1 < < 10, 1 < < 11, 1 < < 12, 1 < < 13, 1 < < 14,
1«15, 1«16, 1«17, 1«18, 1«19, 1«20, 1«21, 1«22,
1«23, 1«24, 1«25(1«('E'-'A'))~(1«('Q'-'A'))
main(ac, av) main
int ac;
char *av[];
prog = av[0];
if (ac ! = 3) {
fprintf(stderr,"usage: %s filet filet\n", prog);
fprintf(stderr, "where filet and filet are two dna or two protein
sequences.\n");
fprintf(stderr, "The sequences can be in upper- or lower-case\n");
fprintf(stderr,"Any lines beginning with ';' or ' <' are ignored\n");
fprintf(stderr,"Output is in the file \"align.out\"\n");
exit(1);
namex[0] = av[1];
namex[1] = av[2];
seqx[0] = getseq(namex[0], &len0);
seqx[1] = getseq(namex[1], &lenl);
xbm = (dna)? dbval : ,pbval;
endgaps = 0; /* 1 to penalize endgaps */
ofile = "align.out"; /* output file */
nw( ); !* fill in the matrix, get the possible jmps */
readjmps( ); /* get the actual jmps */
print( ); /* print stats, alignment */
cleanup(0); /* unlink any tmp files */
58
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
Table 1 (cony)
/* do the alignment, return best score: main( )
* dna: values in Fitch and Smith, PNAS, 80, 1382-1386, 1983
* pro: PAM 250 values
* When scores are equal, we prefer mismatches to any gap, prefer
* a new gap to extending an ongoing gap, and prefer a gap in seqx
* to a gap in seq y.
*/
nw( > nw
(
char *px, *py; /* seqs and ptrs */
int *ndely, *dely;/* keep track of defy */
int ndelx, delx;/* keep track of delx */
int *tmp; /* for swapping row0, rowl */
int mis; /* score for each type */
int ins0, insl; /* insertion penalties */
register id; /* diagonal index */
register ij; /* jmp index */
register *col0, *coll;/* score for curr, last row */
register xx, yy; !* index into seqs */
dx = (struct diag *)g calloc("to get diags", len0+lenl+1, sizeof(struct
diag));
ndely = (int *)g calloc("to get ndely", lenl+1, sizeof(int));
defy = (int *)g calloc("to get dely", lenl+1, sizeof(int));
col0 = (int *)g calloc("to get col0", lenl+1, sizeof(int));
coll = (int *)g calloc("to get colt", lent+1, sizeof(int));
ins0 = (dna)? DINSO : PINSO;
ins 1 = (dna)? DINS 1 : PINS 1;
smax = -10000;
if (endgaps) ~
for (col0[0] = defy[0] _ -ins0, yy = 1; yy < = lenl; yy++) f
col0[yy] = dely[yy] = col0[yy-1] - insl;
ndely[yy] = yy;
col0[0] = 0; /* Waterman Bull Math Biol 84 */
else
for (yy = 1; yy <= lent; yy-I-+)
defy[yy] _ -ins0;
/* fill in match matrix
*/
for (px = seqx[0], xx = 1; xx G = len0; px++, xx++) {
/* initialize first entry in col
*/
if (endgaps) ~
if (xx == 1)
coil[0] = delx = -(ins0+insl);
else
coll[0] = delx = col0[0] - insl;
ndelx = xx;
else ~
col l [0] = 0;
delx = -ins0;
ndelx = 0;
59
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
Table 1 (cony)
for (py = seqx[1], yy = 1; yy <= lenl; py++, yy++) f
mis = col0[yy-1];
if (dna)
mis +_ (xbm[*px-'A']&xbm[*py-'A'])? DMAT : DMIS;
else
mis += day[*px-'A'][*py-'A'];
/* update penalty for del in x seq;
* favor new del over ongong del
* ignore MAXGAP if weighting endgaps
*/
if (endgaps ~ ~ ndely[yy] < MAXGAP) ~
if (col0[yy] - ins0 > = dely[yy]) {
defy[yy] = col0[yy] - (ins0+insl);
' ndely[yy] = 1;
} else {
defy[yy] -= ins 1;
ndely[yy]++;
~ else {
if (col0[yy] - (ins0+insl) > = defy[yy]) {
defy[yy] = col0[yy] - (ins0+insl);
ndely[yy] = 1;
} else
ndely[yy] + +;
/* update penalty for del in y seq;
* favor new del over ongong del
*/
if (endgaps ~ ~ ndelx < MAXGAP) {
if (toll[yy-1] - ins0 > = delx) f
delx = coil[yy-1] - (ins0+insl);
ndelx = 1;
~ else f
deli -= insl;
ndelx++;
} else ~
if (coil[yy-1] - (ins0+insl) > = delx) {
delx = toll[yy-1] - (ins0+insl);
ndelx = 1;
~ else
ndelx+ +;
/* pick the maximum score; we're favoring
* mis over any del and delx over dely
*l
...nw
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
Table 1 (cony)
id=xx-yy+lenl-1;
if (mis > = delx && mis > = dely[yy])
colt[yy] = mis;
else if (delx > = dely[yy]) {
col l [yy] = delx;
ij = dx[id].ijmp;
if (dx[id].jp.n[0] && (!dna ~ ~ (ndelx > = MAXJMP
&& xx > dx[id].jp.x[ij]+MX) ~ ~ mis > dx[id].score+DINSO)) {
dx[id].ijmp++;
if (++ij > = MAXJMP) {
writejmps(id);
ij = dx[id].ijmp = 0;
dx[id].offset = offset;
offset += sizeof(struct jmp) + sizeof(offset);
dx[id].jp.n[ij] = ndelx;
dx[id].jp.x[ij] = xx;
dx[id].score = delx;
else ~
toll[yy] = defy[yy];
ij = dx[id].ijmp;
if (dx[id].jp.n[0] && (!dna ~ ~ (ndely[yy] > = MAXJMP
&& xx > dx[id].jp.x[ij]+MX) ~ ~ mis > dx[id].score+DINSO)) ~
dx[id].ijmp++;
if (++ij > = MAXJMP) f
writejmps(id);
ij = dx[id].ijmp = 0;
dx[id].offset = offset;
offset += sizeof(struct jmp) + sizeof(offset);
dx[id].jp.n[ij] _ -ndely[yy];
dx[id].jp.x[ij] = xx;
dx[id].score = defy[yy];
if (xx == len0 && yy < lenl) {
!* last col
*/
if (endgaps)
toll[yy] -= ins0+insl*(lenl-yy);
if (toll [yy] > smax) {
smax = toll[yy];
dmax = id;
if (endgaps && xx < len0)
coil[yy-1] -= ins0+insl*(len0-xx);
if (toll[yy-1] > smax) f
smax = coil[yy-1];
dmax = id;
tmp = col0; col0 = toll; coil = tmp;
(void) free((char *)ndely);
(void) free((char *)dely);
(void) free((char *)col0);
(void) free((char *)coll);
...nw
61
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
/*
Table 1 (cony)
* print( ) -- only routine visible outside this module
*
* static:
* getmat( ) -- trace back best path, count matches: print( )
* pr align( ) -- print alignment of described in array p[]: print( )
* dumpblock( ) -- dump a block of lines with numbers, stars: pr align( )
* nums( ) -- put out a number line: dumpblock( )
* putline( ) -- put out a line (name, [num], seq, [num]): dumpblock( )
* stars( ) - -put a line of stars: dumpblock( )
* stripname( ) -- strip any path and prefix from a seqname
*/
#include "nw.h"
#define SPC 3
#define P LINE 256 /* maximum output line */
#define P SPC 3 /* space between name or num and seq */
extern day[26][26];
int glen; /* set output line length */
FILE *fx; l* output file */
Print( )
print
int lx, 1y, firstgap, lastgap; /* overlap *l
if ((fx = fopen(ofile, "w")) _ = 0) {
fprintf(stderr," % s: can't write % s\n", prog, ofile);
cleanup(1);
fprintf(fx, " < first sequence: % s (length = % d)\n", namex[0], len0);
fprintf(fx, "<second sequence: %s (length = %d)\n", namex[1], lenl);
olen = 60;
lx = len0;
1y = lent;
firstgap = lastgap = 0; '
if (dmax < lenl - 1) f /* leading gap in x */
pp[0].spc = firstgap = lenl - dmax - 1;
1y -= pp[0].spc;
else if (dmax > lenl - 1) f /* leading gap in y */
pp[1].spc = hrstgap = dmax - (lent - 1);
lx -= pp[1].spc;
if (dmax0 < len0 - 1) { /* trailing gap in x */
lastgap = len0 - dmax0 -1;
lx -= lastgap;
else if (dmax0 > len0 - 1) { /* trailing gap in y */
lastgap = dmax0 - (len0 - 1);
1y -= lastgap;
getmat(lx, 1y, firstgap, lastgap);
pr align( );
62
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
Table 1 (cony)
/*
* trace back the best path, count matches
*!
static
getmat(lx, 1y, firstgap, lastgap) getlriat
int lx, 1y; /* "core" (minus endgaps) */
int firstgap, lastgap; /* leading trailing overlap */
f
int nm, i0, i1,
siz0, sizl;
char outx[32];
double pct;
register n0, n1;
register *p0, *pl;
char
/* get total matches, score
*/
i0 = i1 = siz0 = sizl = 0;
p0 = seqx[0] + pp[1].spc;
p1 = seqx[1] + pp[0].spc;
n0 = pp[1].spc + 1;
n1 = pp[0].spc + 1;
nm=0;
while ( *p0 && *pl ) f
if (siz0) {
p1++;
n1++;
siz0--;
else if (sizl) f
p0++;
n0++;
sizl--;
else ~
if (xbm[*p0-'A']&xbm[*pl-'A'])
nm++;
if (n0++ _= pp[0].x[i0])
siz0 = pp[O].n[i0++];
if (n1++ _= gg[1].x[il])
sizl = pp[1].n[il++];
p0++;
p1++;
/* pct homology:
* if penalizing endgaps, base is the shorter seq
* else, knock off overhangs and take shorter core
*/
if (endgaps)
lx = (len0 < lenl)? len0 : lent;
else
lx = (lx < 1y)? lx : 1y;
pct = 100. *(double)nm/(double)lx;
fprintf(fx, "\n");
fprintf(fx, " < % d match% s in an overlap of % d: % .2f percent
similarity\n",
~ (~ _= 1)? .,.. ; ~~es~~ lx, pct); .
63
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
Table 1 (cony)
fprintf(fx " < gaps in first sequence: % d", gapx); ... getlTlat
if (gapx) {
(void) sprintf(outx, " ( % d % s % s)",
ngapx, (dna)? "base":"residue", (ngapx == 1)? "":"s");
fprintf(fx," % s", outx);
fprintf(fx ", gaps in second sequence: %d", gapy);
if (gapY) f
(void) sprintf(outx, " ( % d % s % s)",
ngapy, (dna)? "base":"residue", (ngapy = = 1)? "":"s");
fprintf(fx,"%s", outx);
if (dna)
fprintf(fx,
"\n < score: % d (match = % d, mismatch = % d, gap penalty = % d + % d per
base)\n",
smax, DMAT, DMIS, DINSO, DINSl);
else
fprintf(fx,
"\n < score: % d (Dayhoff PAM 250 matrix, gap penalty = % d + % d per
residue)\n" ,
smax, PINSO, PINS1);
if (endgaps)
fprintf(fx,
" < endgaps penalized. left endgap: % d % s % s, right endgap: % d % s % s\n"
,
firstgap, (dna)? "base" : "residue", (firstgap == 1)? "" : "s",
lastgap, (dna)? "base" : "residue", (lastgap == 1)? "" : "s");
else
fprintf(fx, " < endgaps not penalized\n");
static nm; /* matches in core
-- for checking *!
static lmax; /* lengths of stripped
file names */
static ij[2]; /* jmp index for a
path *!
static nc[2]; /* number at start
of current line *!
static ni[2]; /* current elem number
-- for gapping */
static siz[2];
static *ps[2]; /* ptr to current
char element */
static *po[2]; /* ptr to next output
char char slot */
static out[2][P /* output line */
char LINE];
static star[P LINE];/* set by stars( )
char */
/*
* print alignment of described in struct path pp[]
*/
static
pr align( ) pP ahgri
f
int nn; /* char count */
int more;
register i;
for (i = 0, lmax = 0; i < 2; i++) {
nn = stripname(namex[i]);
if (nn > lmax)
lmax = nn;
nc[i] = 1;
ni[i] = 1;
siz[i] = ij[i] = 0;
ps[i] = seqx[i];
po[i] = out[i];
64
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
Table 1 (cont'1
for (nn = nm = 0, more = 1; more; ) f .~.pr align
for (i = more = 0; i < 2; i++) f
/*
* do we have more of this sequence?
*/
if (!*ps[i])
continue;
more+ +;
if (pp[i].spc) { /* leading space */
*po[i]++ _ ' ';
pp[i]. spc--;
else if (siz[i]) { /* in a gap */
*po[i]++ _ ' ';
siz[i]--;
else f /* we're putting a seq element
*/
*po[i] _ *ps[i];
if (islower(*ps[i]))
*ps[i] = toupper(*ps[i]);
po[i] + +;
ps[i] + +;
/*
* are we at next gap for this seq?
*/
if (ni[i] _= pp[i].x[ij[i]]) {
/*
* we need to merge all gaps
* at this location
*/
siz[i] = pp[i].n[ij[i]++];
while (ni[i] _= pp[i].x[ij[i]])
siz[i] += pp[i].n[ij[i]++];
ni[i] + +;
if (++nn == olen ~ ~ !more && nn) f
dumpblock( );
for (i = 0; i < 2; i++)
po[i] = out[i];
nn = 0;
/*
* dump a block of lines, including numbers, stars: pr align( )
*/ _
static
dumpblock( )
dumpblock
f
register i;
for (i = 0; i < 2; i++)
*po[i]__ _ '\0';
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
Table 1 (cony)
.. . dumpblocli
(void) putt('\n', fx);
for (i = 0; i < 2; i++) ~
if (*out[i] && (*out[i] ! _ ' ' ~ ~ *(po[i]) ! _ ' ')) {
if (i = = 0)
nums(i);
if (i == 0 && *out[1])
stars( );
putline(i);
if (i == 0 && *out[1])
fprintf(fx, star);
if (i == 1)
nums(i);
/*
* put out a number line: dumpblock( )
*/
static
nums(ix) nums
int ix; /* index in out[] holding seq line */
char mine[P LINE];
register i, j;
register char *pn, *px, *py;
for (pn = mine, i = 0; i < lmax+P SPC; i++, pn++)
*pn = . .; -
for (i = nc[ix], py = out[ix]; *py; py++, pn++) f
if (*py =_ ' ' ~ ~ *PY =_ '-')
*Pn = ,
else {
if (i% 10 == 0 ~ ~ (i == 1 && nc[ix] != 1)) {
j = (i < 0)? -i : i;
for (px = pn; j; j /= 10, px--)
*px = j % 10 + '0' ;
if (i < 0)
*Px =
else
*Pn = ,
i++;
*Pn = '~0'~
nc[ix] = i;
for (pn = mine; *pn; pn+ +)
(void) putt(*pn, fx);
(void) putt('\n', fx);
/*
* put out a line (name, [num], seq, [num]): dumpblock( )
*/
static
putline(ix) putline
int ix; {
66
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
Table 1 (cony)
...putline
int i;
register char *px;
for (px = namex[ix], i = 0; *px && *px ! _ ':'; px++, i++)
(void) putc(*px, fx);
for (; i < lmax+P SPC; i++)
(void) putc(' ', fx);
/* these count from 1:
* ni[] is current element (from 1)
* nc[] is number at start of current line
*/
for (px = out[ix]; *px; px++)
(void) putc(*px&Ox7F, fx);
(void) putc('\n', fx);
/*
* put a line of stars (seqs always in out[0], out[1]): dumpblock( )
*/
static
stars( ) Stars
int i;
register char *p0, *pl, cx, *px;
if (!*out[0] ~ ~ (*out[0] __ _ ' ' && *(po[0]) _ _ ' ') ~ ~
!*out[1] ~ ~ (*out[1] _- ' && *(po[1]) __ ' '))
return;
px = star;
for (i = lmax+P SPC; i; i--)
*px++ _ ' ';
for (p0 = out[0], p1 = out[1]; *p0 && *pl; p0++, p1++) f
if (isalpha(*p0) && isalpha(*pl)) {
if (xbm[*p0-'A']&xbm[*pl-'A']) {
cx ='*'~
nm++; ~ ,
else if (!dna && day[*p0-'A'][*pl-'A'] > 0)
cx = ";
else
else
cx = ";
*px++ = cx;
*px++ _ '\n';
*px = ~\0~;
cx = ";
67
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
Table 1 (cony)
/*
* strip path or prefix from pn, return len: pr align( )
*%
static
stripname(pn) stripname
char *pn; /* file name (may be path) */
register char *px, *py;
PY=~~
for (px = pn; *px; px++)
~(*Px =_ ~/~)
py = px + 1;
(PY)
(void) strcpy(pn, py);
return(strlen(pn));
68
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
Table 1 (cont'1
/*
* cleanup( ) -- cleanup any tmp file
* getseq( ) -- read in seq, set dna, len, maxlen
* g calloc( ) -- calloc( ) with error checkin
* readjmps( ) -- get the good jmps, from tmp file if necessary
* writejmps( ) -- write a filled array of jmps to a tmp file: nw( )
*/
#include "nw.h"
#include <sys/file.h>
char *jname = "/tmp/homgXXXXXX"; !* tmp file for jmps */
FILE *fj;
int cleanup( ); /* cleanup tmp file */
long lseek( );
/*
* remove any tmp file if we blow
*/
cleanup(i) cleanup
int i;
if (fj)
(void) unlink(jname);
exit(i);
/*
* read, return ptr to seq, set dna, len, maxlen
* skip lines starting with ';' ' <', or ' >'
* seq in upper or lower case
*/
char *
getseq(file, len) getSetl
char *file; /* file name */
int *len; /* seq len */
f
char line[1024], *pseq;
register char *px, *py;
int natgc, tlen;
FILE *fp;
if ((fp = fopen(file,"r°)) _= 0) ~
fprintf(stderr, " % s: can't read % s\n", prog, file);
exit(1);
tlen = natgc = 0;
while (fgets(line, 1024, fp)) ~
if (*line =_ ''' ~ ~ *line =_ ' <' ~ ~ *line =_ ' >')
continue;
for (px = line; *px ! _ '\n'; px++)
if (isupper(*px) ~ ~ islower(*px))
tlen++;
if ((pseq = malloc((unsigned)(tlen+6))) _ = 0) {
fprintf(stderr,"%s: malloc( ) failed to get %d bytes for %s\n", prog, tlen+6,
file);
exit(1);
pseq[0] = pseq[1] = pseq[2] = pseq[3] _ '\0';
69
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
Table 1 (cony)
.. . getseq
py = pseq + 4;
*len = tlen;
rewind(fp);
while (fgets(line, 1024, fp)) {
if (*line =_ ''' ~ ~ *line =_ ' <' ~ ~ *line =- ' >')
continue;
for (px = line; *px ! _ '\n'; px++) {
if (isupper(*px))
*py++ _ *px;
else if (islower(*px))
*py++ = toupper(*px);
if (index("ATGCU",*(py-1)))
natgc++;
*py++ _ '\0';
*PY = ~\0~;
(void) fclose(fp);
dna = natgc > (tlen/3);
return(pseq+4);
char
g calloc(msg, nx, sz) g_Ca110C
char *msg; /* program, calling routine */
int nx, sz; l* number and size of elements */
{
char *px, *calloc( );
if ((px = calloc((unsigned)nx, (unsigned)sz)) _ = 0) {
if (*msg) {
fprintf(stderr, " % s: g calloc( ) failed % s (n= % d, sz= % d)\n", prog, msg,
nx, sz);
exit(1);
0
return(px);
/*
* get final jmps from dx[] or tmp file, set pp[], reset dmax: main( )
*/
readjmps( ) readjmps
{
int fd = -1;
int siz, i0, i1;
register i, j, xx;
(~J) {
(void) fclose(fj);
if ((fd = open(jname, O RDONLY, 0)) < 0) {
fprintf(stderr, "% s: can't open( ) % s\n", prog, jname);
cleanup(1);
for (i = i0 = i1 = 0, dmax0 = dmax, xx = len0; ; i++) {
while (1) {
for (j = dx[dmax].ijmp; j > = 0 && dx[dmax].jp.x[j] > = xx; j--)
7
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
Table 1 (cony)
...readjmps
if (j < 0 && dx[dmax].offset && fj) {
(void) lseek(fd, dx[dmax].offset, 0);
(void) read(fd, (char *)&dx[dmax].jp, sizeof(struct jmp));
(void) read(fd, (char *)&dx[dmax].offset, sizeof(dx[dmax].offset));
dx[dmax].ijmp = MAXJMP-1;
else
break;
if (i > = JMPS) {
fprintf(stderr, "%s: too many gaps in alignment\n", prog);
cleanup(1);
siz = dx[dmax].jp.n[j];
xx = dx[dmax].jp.x[j];
dmax += siz;
if (siz < 0) ~ /* gap in second seq *!
pp[1].n[il] _ -siz;
xx + = siz;
/*id=xx-yy+lenl-1
*/
pp[1].x[il] = xx - dmax + lenl - 1;
gapy++;
ngapy -= siz;
/* ignore MAXGAP when doing endgaps */
siz = (-siz < MAXGAP ~ ~ endgaps)? -siz : MAXGAP;
i1++;
else if (siz > 0) f /* gap in first seq */
pp[0].n[i0] = siz;
pp[0].x[i0] = xx;
gapx++;
ngapx + = siz;
/* ignore MAXGAP when doing endgaps */
siz = (siz < MAXGAP ~ ~ endgaps)? siz : MAXGAP;
i0++;
else
break;
l* reverse the order of jmps
*/
for (j = 0, i0--; j < i0; j++, i0--) ~
i = pp[O].n[j]; pp[0].n[j] = pp[0].n[i0]; pp[0].n[i0] = i;
i = pp[0].x[j]; pp[0].x[j] = pp[0].x[i0]; pp[0].x[i0] = i;
for (j = 0, i1--; j < i1; j++, i1--) f
i = pp[1].n[j]; pp[1].n[j] = pp[1].n[il]; pp[1].n[il] = i;
i = pp[1].x[j]; pp[1].x[j] = pp[1].x[il]; pp[1].x[il] = i;
if (fd > = 0)
(void) close(fd);
if (fj) f
(void) unlink(jname);
fj = 0;
offset = 0;
~1
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
Table 1 (cony)
/*
* write a filled jmp struct offset of the prev one (if any): nw( )
*/
writejmps(ix) WPltejmpS
int ix;
f
char *mktemp( );
if (!fj) ~
if (mktemp(jname) < 0) ~
fprintf(stderr, " % s: can't mktemp( ) % s\n", prog, jname);
cleanup(1);
if ((fj = fopen(jname, "w")) _ = 0) ~
fprintf(stderr, " % s: can't write % s\n", prog, jname);
exit(1);
(void) fwrite((char *)&dx[ix].jp, sizeof(struct jmp), 1, fj);
(void) fwrite((char *)&dx[ix].offset, sizeof(dx[ix].offset), 1, fj);
72
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
Table 2
PRO XXXX~~XXXXXXXXXX (Length = 15 amino acids)
Comparison Protein XXXXXYYYYYYY (Length = 12 amino acids)
S % amino acid sequence identity =
(the number of identically matching amino acid residues between the two
polypeptide sequences as determined by
ALIGN-2) divided by (the total number of amino acid residues of the PRO
polypeptide) _
divided by 15 = 33.3%
Table 3
PRO XXXXXXXXXX (Length = 10 amino acids)
Comparison Protein XXXXXYYYYYYZZYZ (Length = 15 amino acids)
amino acid sequence identity =
L 5 (the number of identically matching amino acid residues between the two
polypeptide sequences as determined by
ALIGN-2) divided by (the total number of amino acid residues of the PRO
polypeptide) _
5 divided by 10 = 50%
Table 4
;0 PRO-DNA (Length= 14 nucleotides)
Comparison DNA T~~tNNNNLLLLLLLLLL (Length = 16 nucleotides)
nucleic acid sequence identity =
(the number of identically matching nucleotides between the two nucleic acid
sequences as determined by ALIGN-
,5 2) divided by (the total number of nucleotides of the PRO-DNA nucleic acid
sequence) _
6 divided by 14 = 42.9%
Table 5
PRO-DNA (Length = 12 nucleotides)
0 Comparison DNA NNNNLLLW (Length = 9 nucleotides)
nucleic acid sequence identity =
(the number of identically matching nucleotides between the two nucleic acid
sequences as determined by ALIGN-
2) divided by (the total number of nucleotides of the PRO-DNA nucleic acid
sequence) _
5 4 divided by 12 = 33.3%
73
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
5.2. Compositions and Methods of the Invention
5.2.1. PRO Variants
In addition to the full-length native sequence PRO polypeptides described
herein, it is contemplated that
PRO variants can be prepared. PRO variants can be prepared by introducing
appropriate nucleotide changes into
the PRO DNA, and/or by synthesis of the desired PRO polypeptide. Those skilled
in the art will appreciate that
amino acid changes may alter post-translational processes of the PRO
polypeptide such as changing the number
or position of glycosylation sites or altering the membrane anchoring
characteristics.
Variations in the native full-length sequence PRO polypeptide or in various
domains of the PRO
polypeptide described herein, can be made, for example, using any of the
techniques and guidelines for conservative
and non-conservative mutations set forth, for instance, in U.S. Patent No.
5,364,934. Variations may be a
substitution, deletion or insertion of one or more codons encoding the PRO
polypeptide that results in a change in
the amino acid sequence ofthe PRO polypeptide as compared with the native
sequence PRO polypetide. Optionally
the variation is by substitution of at least one amino acid with any other
amino acid in one or more of the domains
of the PRO polypeptide. Guidance in determining which amino acid residue may
be inserted, substituted or deleted
without adversely affecting the desired activity may be found by comparing the
sequence of the PRO polypeptide
with that of homologous known protein molecules and minimizing the number of
amino acid sequence changes
made in regions of high homology. Amino acid substitutions can be the result
of replacing one amino acid with
another amino acid having similar structural and/or chemical properties, such
as the replacement of a leucine with
a serine, i. e., conservative amino acid replacements. Insertions or deletions
may optionally be in the range of about
1 to 5 amino acids. The variation allowed may be determined by systematically
making insertions, deletions or
substitutions of amino acids in the sequence and testing the resulting
variants for activity exhibited by the full-length
or mature native sequence.
In particular embodiments, conservative substitutions of interest are shown in
Table 6 under the heading
of preferred substitutions. If such substitutions result in a change in
biological activity, then more substantial
changes, denominated exemplary substitutions in Table 6, or as further
described below in reference to amino acid
classes, are introduced and the products screened.
74
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
Table 6
Original Exemplary Preferred
Residue Substitutions Substitutions
Ala (A) val; leu; ile val
Arg (R) lys; gln; asn lys
Asn (I~ gln; his; lys; arg gln
Asp (D) glu glu
Cys (C) ser ser
Gln (Q) asn asn
Glu (E) asp asp
Gly (G) pro; ala ala
His (H) asn; gln; lys; arg arg
Ile (I) leu; val; met; ala; phe;
norleucine leu
Leu (L) norleucine; ile; val;
met; ala; phe ile
Lys (K) arg; gln; asn arg
Met (M) leu; phe; ile leu
Phe (F) leu; val; ile; ala; tyr leu
Pro (P) ala ala
Ser (S) thr thr
Thr(T) ser ser
Trp (W) tyr; phe tyr
Tyr (V) trp; phe; thr; ser phe
Val (V) ile; leu; met; phe;
ala; norleucine leu
Substantial modifications in function or immunological identity of the PRO
polypeptide are accomplished
by selecting substitutions that differ significantly in their effect on
maintaining (a) the structure of the polypeptide
backbone in the area of the substitution, for example, as a sheet or helical
conformation, (b) the charge or
hydrophobicity of the molecule at the target site, or (c) the bulk of the side
chain. Naturally occurring residues are
divided into groups based on common side-chain properties:
(1) hydrophobic: norleucine, met, ala, val, leu, ile;
(2) neutral hydrophilic: cys, ser, thr;
(3) acidic: asp, glu;
(4) basic: asn, gln, his, lys, arg;
(5) residues that influence chain orientation: gly, pro; and
(6) aromatic: trp, tyr, phe.
Non-conservative substitutions will entail exchanging a member of one of these
classes for another class.
Such substituted residues also may be introduced into the conservative
substitution sites or, more preferably, into
the remaining (non-conserved) sites.
The variations can be made using methods known in the art such as
oligonucleotide-mediated (site-
directed) mutagenesis, alanine scanning, and PCR mutagenesis. Site-directed
mutagenesis [Carter et al., Nucl.
Acids Res., 13:4331 (1986); Zoller et al., Nucl. Acids Res., 10:6487 (1987)],
cassette mutagenesis [Wells et al.,
Gene, 34:315 (1985)], restriction selection mutagenesis [Wells et al., Philos.
Trans. R. Soc. London SerA, 317:415
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
(1986)] or otlier known techniques can be performed on the cloned DNA to
produce the PRO variant DNA.
Scanning amino acid analysis can also be employed to identify one or more
amino acids along a contiguous
sequence. Among the preferred scanning amino acids are relatively small,
neutral amino acids. Such amino acids
include alanine, glycine, serine, and cysteine. Alanine is typically a
preferred scanning amino acid among this
group because it eliminates the side-chain beyond the beta-carbon and is less
likely to alter the main-chain
conformation of the variant [Cunningham and Wells, Science, 244: 1081-1085
(1989)]. Alanine is also typically
preferred because it is the most common amino acid. Further, it is frequently
found in both buried and exposed
positions [Creighton, The Proteins, (W.H. Freeman & Co., N.Y.); Chothia, J.
Mol. Biol., 150:1 (1976)]. If alanine
substitution does not yield adequate amounts of variant, an isoteric amino
acid can be used.
5.2.2. Modifications of PRO Polypeptides
Covalent modifications of PRO polypeptides are included within the scope of
this invention. One type
of covalent modification includes reacting targeted amino acid residues of a
PRO polypeptide with an organic
derivatizing agent that is capable of reacting with selected side chains or
the N- or C- terminal residues of the PRO
polypeptide. Derivatization with bifunctional agents is useful, for instance,
for crosslinking the PRO polypeptide
to a water-insoluble support matrix or surface for use in the method for
purifying anti-PRO antibodies, and vice-
versa. Commonly used crosslinking agents include, e.g., 1,1-bis(diazoacetyl)-2-
phenylethane, glutaraldehyde, N-
hydroxysuccinimide esters, for example, esters with 4-azidosalicylic acid,
homobifunctional imidoesters, including
disuccinimidyl esters such as 3,3'-dithiobis(succinimidylpropionate),
bifunctional maleimides such as bis-N-
maleimido-1,8-octane and agents such as methyl-3-[(p-
azidophenyl)dithio]propioimidate.
Other modifications include deamidation of glutaminyl and asparaginyl residues
to the corresponding
glutamyl and aspartyl residues, respectively, hydroxylation of proliiie and
lysine, phosphorylation of hydroxyl
groups of Beryl or threonyl residues, methylation of the a-amino groups of
lysine, arginine, and histidine side chains
[T.E. Creighton, Proteins: Structure and Molecular Properties, W.H. Freeman &
Co., San Francisco, pp. 79-86
(1983)], acetylation of the N-terminal amine, and amidation of any C-terminal
carboxyl group.
Another type of covalent modification of the PRO polypeptide included within
the scope of this invention
comprises altering the native glycosylation pattern of the polypeptide.
"Altering the native glycosylation pattern"
is intended for purposes herein to mean deleting one or more carbohydrate
moieties found in the native sequence
PRO polypeptide (eitherby removing the underlying glycosylation site or by
deleting the glycosylation by chemical
and/or enzymatic means), and/or adding one or more glycosylation sites that
are not present in the native sequence
PRO polypeptide. In addition, the phrase includes qualitative changes in the
glycosylation of the native proteins,
involving a change in the nature and proportions of the various carbohydrate
moieties present.
Addition of glycosylation sites to the PRO polypeptide may be accomplished by
altering the amino acid
sequence. The alteration may be made, for example, by the addition of, or
substitution by, one or more serine or
threonine residues to the native sequence PRO polypeptide (for O-linked
glycosylation sites). The PRO amino acid
3 5 sequence may optionally be altered through changes at the DNA level,
particularly by mutating the DNA encoding
the PRO polypeptide at preselected bases such that codons axe generated that
will translate into the desired amino
76
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
acids.
Another means of increasing the number of carbohydrate moieties on the PRO
polypeptide is by chemical
or enzymatic coupling of glycosides to the polypeptide. Such methods are
described in the art, e.g., in WO
87/05330 published 11 September 1987, and in Aplin and Wriston, CRC Crit. Rey.
Biochem., pp. 259-306 (1981).
Removal of carbohydrate moieties present on the PRO polypeptide may be
accomplished chemically or
enzymatically or by mutational substitution of codons encoding for amino acid
residues that serve as targets for
glycosylation. Chemical deglycosylation techniques are known in the art and
described, for instance, by
Hakimuddin, et al., Arch. Biochem. BiophyS., 259:52 (1987) and by Edge et al.,
Anal. Biochem., 118:131 (1981).
Enzymatic cleavage of carbohydrate moieties on polypeptides can be achieved by
the use of a variety of endo- and
exo-glycosidases as described by Thotakura et al., Meth. Enzymol., 138:350
(1987).
Another type of covalent modification of the PRO polypeptide comprises linking
the PRO polypeptide to
one of a variety of nonproteinaceous polymers, e.g., polyethylene glycol
(PEG), polypropylene glycol, or
polyoxyalkylenes, in the manner set forth in U.S. Patent Nos. 4,640,835;
4,496,689; 4,301,144; 4,670,417;
4,791,192 or 4,179,337.
The PRO polypeptide of the present invention may also be modified in a way to
form a chimeric molecule
comprising the PRO polypeptide fused to another, heterologous polypeptide or
amino acid sequence.
In one embodiment, such a chimeric molecule comprises a fusion of the PRO
polypeptide with a protein
transduction domain which targets the PRO polypeptide for delivery to various
tissues and more particularly across
the brain blood barrier, using, for example, the protein transduction domain
ofhuman immunodeficiency virus TAT
protein (Schwarze et al., 1999, Science 285: 1569-72).
In another embodiment, such a chimeric molecule comprises a fusion of the PRO
polypeptide with a tag
polypeptide which provides an epitope to which an anti-tag antibody can
selectively bind. The epitope tag is
generally placed at the amino- or carboxyl- terminus of the PRO polypeptide.
Tlie presence of such epitope-tagged
forms of the PRO polypeptide can be detected using an antibody against the tag
polypeptide. Also, provision of
the epitope tag enables the PRO polypeptide to be readily purified by affinity
purification using an anti-tag antibody
or another type of affinity matrix that binds to the epitope tag. Various tag
polypeptides and their respective
antibodies are well known in the art. Examples include poly-histidine (poly-
His) or poly-histidine-glycine (poly-
His-gly) tags; the flu HA tag polypeptide and its antibody 12CA5 [Field et
al., Mol. Cell. Biol., 8:2159-2165
(1988)]; the c-myc tag and the 8F9, 3C7, 6E10, G4, B7 and 9E10 antibodies
thereto [Evan et al., Molecular and
Cellular Biolo~y, 5:3610-3616 (1985)]; and the Herpes Simplex virus
glycoprotein D (gD) tag and its antibody
[Paborskyetal.,ProteinEneineerine,3 6 :547-553(1990)].
OthertagpolypeptidesincludetheFlag-peptide[Hopp
et al., BioTeclmoloey, 6:1204-1210 (1988)]; the KT3 epitopepeptide [Martin et
al., Science, 255:192-194 (1992)];
an a-tubulin epitope peptide [Skinner et al., J. Biol. Chem., 266:15163-15166
(1991)]; and the T7 gene 10 protein
peptide tag [Lutz-Freyermuth et al., Proc. Natl. Acad. Sci. USA, 87:6393-6397
(1990)].
3 5 In an alternative embodiment, the chimeric molecule may comprise a fusion
of the PRO polypeptide with
an immunoglobulin or a particular region of an immunoglobulin. For a bivalent
form ofthe chimeric molecule (also
referred to as an "immunoadhesin"), such a fusion could be to the Fc region of
an IgG molecule. The Ig fusions
77
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
preferably include the substitution of a soluble (transmembrane domain deleted
or inactivated) form of a PRO
polypeptide in place of at least one variable region within an Ig molecule. In
a particularly preferred embodiment,
the immunoglobulin fusion includes the hinge, CH2 and CH3, or the hinge, CH1,
CH2 and CH3 regions of an IgGl
molecule. For the production of immunoglobulin fusions see also, U. S. Patent
No. 5,428,130 issued June 27,1995.
5.2.3. Preparation of the PRO Polypeptide
The present invention provides newly identified and isolated nucleotide
sequences encoding polypeptides
referred to in the present application as PRO polypeptides. In particular,
cDNAs encoding PRO polypeptides have
been identified and isolated, as disclosed in further detail in the Examples
below. It is noted that proteins produced
in separate expression rounds may be given different PRO numbers but the UNQ
number is unique for any given
DNA and the encoded protein, and will not be changed. However, for sake of
simplicity, in the present
specification the protein encoded by the PRO DNA as well as all further native
homologues and variants included
in the foregoing definition of PRO polypeptides, will be referred to as "PRO"
regardless of their origin or mode
of preparation.
The description below relates primarily to production of PRO polypeptides by
culturing cells transformed
or transfected with a vector containing nucleic acid encoding PRO
polypeptides. It is, of course, contemplated that
alternative methods that are well known in the art may be employed to prepare
the PRO polypeptide. For instance,
the PRO polypeptide sequence, or portions thereof, may be produced by direct
peptide synthesis using solid-phase
techniques. See, e.g., Stewart et al., Solid-Phase Peptide Synthesis (W.H.
Freeman Co.: San Francisco, CA,1969);
Merrifield, J. Am. Chem. Soc., 85: 2149-2154 ( 1963). In uitro protein
synthesis may be performed using manual
techniques or by automation. Automated synthesis may be accomplished, for
instance, with an Applied Biosystems
Peptide Synthesizer (Foster City, CA) using manufacturer's instructions.
Various portions of the PRO polypeptide
may be chemically synthesized separately and combined using chemical or
enzymatic methods to produce the full-
length PRO polypeptide.
5.2.3.1. Isolation of DNA Encoding PRO Polvaeptides
DNA encoding the PRO polypeptide may be obtained from a cDNA library prepared
from tissue believed
to possess the mRNA encoding the PRO polypeptide and to express it at a
detectable level. Accordingly, DNAs
encoding the human PRO polypeptide can be conveniently obtained from cDNA
libraries prepared from human
tissues, such as described in the Examples. The gene encoding the PRO
polypeptide may also be obtained from
a genomic library or by oligonucleotide synthesis.
Libraries can be screened with probes (such as antibodies to the PRO
polypeptide or oligonucleotides of
at least about 20-80 bases) designed to identify the gene of interest or the
protein encoded by it. Screening the
cDNA or genomic library with the selected probe may be conducted using
standard procedures, such as described
in Sambrook et al., supra. An alternative means to isolate the gene encoding
the PRO polypeptide is to use PCR
methodology. Sambrook et al., szspf°a; Dieffenbach et al., PCR Primer:
A Laboratory Manual (New York: Cold
78
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
Spring Harbor Laboratory Press, 1995).
The Examples below describe techniques for screening a cDNA library. The
oligonucleotide sequences
selected as probes should be of sufficient length and sufficiently unambiguous
that false positives are minimized.
The oligonucleotide is preferably labeled such that it can be detected upon
hybridization to DNA in the library being
screened. Methods of labeling are well known in the art, and include the use
of radiolabels like 32P-labeled ATP,
biotinylation, or enzyme labeling. Hybridization conditions, including
moderate stringency and high stringency,
are provided in Sambrook et al., supra.
Sequences identified in such library screening methods can be compared and
aligned to other known
sequences deposited and available in public databases such as GenBank or other
private sequence databases.
Sequence identity (at either the amino acid or nucleotide level) within
defined regions of the molecule or across the
full-length sequence can be determined through sequence alignment using
computer software programs such as
ALIGN, DNAstar, and INHERIT, which employ various algorithms to measure
homology.
Nucleic acid having protein coding sequence may be obtained by Screening
selected cDNA or genomic
libraries using the deduced amino acid sequence disclosed herein for the first
time, and, if necessary, using
conventional primer extension procedures as described in Sambrook et al.,
supra, to detect precursors and
processing intermediates of mRNA that may not have been reverse-transcribed
into cDNA.
5.2.3.2. Selection and Transformation of Host Cells
Host cells are transfected or transformed with expression or cloning vectors
described herein for PRO
polypeptide production and cultured in conventional nutrientmedia modified as
appropriate for inducing promoters,
selecting transformants~ or amplifying the genes encoding the desired
sequences. The culture conditions, such as
media, temperature, pH, and the like, can be selected by the skilled artisan
without undue experimentation. In
general, principles, protocols, andpractical techniques for maximizing the
productivity of cell cultures can be found
in Mammalian Cell Biotechnology: A Practical Approach, M. Butler, ed. (IRL
Press, 1991) and Sambrook et al.,
supra.
Methods of transfection are laiown to the ordinarily skilled artisan, for
example, CaP04 treatment and
electroporation. Depending on the host cell used, transformation is performed
using standard teclmiques appropriate
to such cells. The calcium treatment employing calcium chloride, as described
in Sambrook et al., supra, or
electroporation is generally used for prokaryotes or other cells that contain
substantial cell-wall barriers. Infection
withAgrobacteriuna tumefaciens is used for transformation of certain plant
cells, as described by Shaw et al., Gene,
23: 315 (1983) and WO 89/05859 published 29 June 1989. Por mammalian cells
without such cell walls, the
calcium phosphate precipitation method of Graham and van der Eb, Virolo~y,
52:456-457 ( 1978) can be employed.
General aspects of mammalian cell host system transformations have been
described in U.S. Patent No. 4,399,216.
Transformations into yeast are typically carried out according to the method
of Van Solingen et al., J. Bact., 130:
946 (1977) and Hsiao et al., Proc. Natl. Acad. Sci. (LJSAI, 76: 3829 (1979).
However, other methods for
introducing DNA into cells, such as by nuclear microinjection,
electroporation, bacterial protoplast fusion with
intact cells, or polycations, e.g., polybrene or polyornithine, may also be
used. For various techniques for
79
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
transforming mammalian cells, see, Keown et al, Methods in Enzymolo~y, 185:
527-537 (1990) and Mansour et
al., Nature, 336: 348-352 (1988).
Suitable host cells for cloning or expressing the DNA in the vectors herein
include prokaryote, yeast, or
higher eukaryote cells. Suitable prokaryotes include, but are not limited to,
eubacteria, such as Gram-negative or
Gram-positive organisms, for example, Enterobacteriaceae such as E. coli.
Various E. coli strains are publicly
available, such as E. coli Kl2 strain MM294 (ATCC 31,446); E. coli X1776 (ATCC
31,537); E. coli strain W3110
(ATCC 27,325); and KS 772 (ATCC 53,635). Other suitable prokaryotic host cells
include Enterobacteriaceae
such as Esclzerichia, e.g., E. coli, Enterobacter, Erwinia, Klebsiella,
Proteus, Salmonella, e.g., Salmonella
typhimurium, Serratia, e.g., Serratia marcescans, and Shigella, as well as
Baeilli such as B. subtilis and B.
licheniformis (e.g., B. liclZeniforrnis 41P disclosed in DD 266,710 published
12 April 1989), Pseudonaonas such as
P. aeruginosa, and Streptomyces. These examples are illustrative rather than
limiting. Strain W3110 is one
particularly preferred host or parent host because it is a common host strain
for recombinant DNA product
fermentations. Preferably, the host cell secretes minimal amounts of
proteolytic enzymes. For example, strain
W3110 may be modified to effect a genetic mutation in the genes encoding
proteins endogenous to the host, with
examples of such hosts including E. coli W3110 strain 1A2, which lias the
complete genotype tonA ; E. coli W3110
strain 9E4, which has the complete genotype tonA ptr3; E. coli W3110 strain
27C7 (ATCC 55,244), which has the
complete genotype tonA ptr3 plaoA EI S (argF lac)169 degP ompT kan''; E. coli
W3110 strain 37D6, which has
the complete genotype toraAptr3 phoA EI S (argF lac)169 degP ompT rbs7 ilvG
kan''; E. coli W3110 strain 40B4,
which is strain 37D6 with a non-kanamycin resistant degP deletion mutation;
and an E. coli strain having mutant
periplasmic protease disclosed in U.S. Patent No. 4,946,783 issued 7 August
1990. Alternatively, in vitro methods
of cloning, e.g., PCR or other nucleic acid polymerase reactions, are
suitable.
In addition to prokaryotes, eukaryotic microbes such as filamentous fungi or
yeast are suitable cloning or
expression hosts for vectors encoding the PRO polypeptide. Saccharomyces
cerevisiae is a commonly used lower
eukaryotic host microorganism. Others include Sclaizosaccharonayces pombe
(Beach and Nurse, Nature, 290: 140
[1981]; EP 139,383 published 2 May 1985); Kluyveronayces hosts (IJ.S. Patent
No. 4,943,529; Fleer et al.,
Bio/Technoloay, 9: 968-975 (1991)) such as, e.g., K. lactis (MW98-8C, CBS683,
CBS4574; Louvencourt et al.,
J. Bacteriol., 737 [1983]), K. fragilis (ATCC 12,424), K. bulgaricus (ATCC
16,045), K. wickeramii (ATCC
24,178), K. waltii (ATCC 56,500), K. drosoplailaruna (ATCC 36,906; Van den
Berg et al., Bio/Technolo~y, 8: 135
(1990)), K. theimotolerans, and K. ma~xianus; yarrowia (EP 402,226); Piclzia
pastoris (EP 183,070; Sreekrishna
et al., J. Basic Microbiol., 28: 265-278 [1988]); Candida;
Trichodes°rna reesia (EP 244,234); Neurospora crassa
(Case et al., Proc. Natl. Acad. Sci. USA, 76: 5259-5263 [1979]);
Schwanniornyces such as Sclawanniomyces
occidentalis (EP 394,538 published 31 October 1990); and filamentous fungi
such as, e.g., Neurospora, Penicilliuna,
Tohpocladium (WO 91/00357 published 10 January 1991), and Aspergillus hosts
such as A. nidulans (Ballance
et al., Biochem. Bionhys. Res. Commun., 112: 284-289 [1983]; Tilburn et al.,
Gene, 26: 205-221 [1983]; Yelton
et al., Proc. Natl. Acad. Sci. USA, 81: 1470-1474 [1984]) and A. niger (Kelly
and Hynes, EMBO J., 4: 475-479
[1985]). Methylotropic yeasts are suitable herein and include, but are not
limited to, yeast capable of growth on
methanol selected from the genera consisting of Hansenula, Candida, Kloeckera,
Pichia, Sacclaaromyces,
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
Torulopsis, and Rlaodotorula. A list of specific species that are exemplary of
this class of yeasts may be found in
C. Anthony, The Biochemistry of Methylotrophs, 269 (1982).
Suitable host cells for the expression of nucleic acid encoding glycosylated
PRO polypeptides are derived
from multicellular organisms. Examples of invertebrate cells include insect
cells such as Drosophila S2 and
Spodoptera Sf9, as well as plant cells. Examples ofuseful mammalian host cell
lines include Chinese hamster ovary
(CHO) and COS cells. More specific examples include monkey kidney CVl line
transformed by SV40 (COS-7,
ATCC CRL 1651); human embryonic kidney line (293 or 293 cells subcloned for
growth in suspension culture,
Graham et al., r. Gen. Virol., 36: 59 (1977)); Chinese hamster ovary cells!-
DHFR (CHO, Urlaub and Chasin, Proc.
Natl. Acad. Sci. USA, 77:4216 (1980)); mouse sertoli cells (TM4, Mather, Biol.
Reprod., 23:243-251 (1980));
human lung cells (W138, ATCC CCL 75); human liver cells (Hep G2, HB 8065); and
mouse mammary tumor
(MMT 060562, ATCC CCL51). The selection of the appropriate host cell is deemed
to be within the skill in the
art.
5.2.3.3. Selection and Use of a Replicable Vector
The nucleic acid (e.g., cDNA or genomic DNA) encoding the PRO polypeptide may
be inserted into a
replicable vector for cloning (amplification of the DNA) or for expression.
Various vectors are publicly available.
The vector may, for example, be in the form of a plasmid, cosmid, viral
particle, or phage. The appropriate nucleic
acid sequence may be inserted into the vector by a variety of procedures. In
general, DNA is inserted into an
appropriate restriction endonuclease sites) using techniques known in the art.
Vector components generally
include, but are not limited to, one or more of a signal sequence if the
sequence is to be secreted, an origin of
replication, one or more marker genes, an enhancer element, a promoter, and a
transcription termination sequence.
Construction of suitable vectors containing one or more of these components
employs standard ligation techniques
that are known to the skilled artisan.
The PRO polypeptide may be produced recombinantly not only directly, but also
as a fusion polypeptide
with a heterologous polypeptide, which may be a signal sequence or other
polypeptide having a specific cleavage
site at the N-terminus of the mature protein or polypeptide. In general, the
signal sequence may be a component
of the vector, or it may be a part of the DNA encoding the PRO polypeptide
that is inserted into the vector. The
signal sequence may be a prokaryotic signal sequence selected, for example,
from the group of the alkaline
phosphatase, penicillinase, lpp, or heat-stable enterotoxin II leaders. For
yeast secretion the signal sequence may
be, e.g., the yeast invertase leader, alpha factor leader (including
Saccharomyces and Kluyveromyces a-factor
leaders, the latter described inU.S. PatentNo. 5,010,182), or acidphosphatase
leader, the C. albica~zs glucoamylase
leader (EP 362,179 published 4 April 1990), or the signal described in WO
90/13646 published 15 November 1990.
In mammalian cell expression, mammalian signal sequences may be used to direct
secretion of the protein, such
as signal sequences from secreted polypeptides of the same or related species,
as well as viral secretory leaders.
Both expression and cloning vectors contain a nucleic acid sequence that
enables the vector to replicate
3 5 in one or more selected host cells. Such sequences are well known for a
variety of bacteria, yeast, and viruses. The
origin of replication from the plasmid pBR322 is suitable for most Gram-
negative bacteria, the 2~ plasmid origin
81
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
is suitable for yeast, and various viral origins (SV40, polyoma, adenovirus,
VSV, or BPV) are useful for cloning
vectors in mammalian cells.
Expression and cloning vectors will typically contain a selection gene, also
termed a selectable marker.
Typical selection genes encode proteins that (a) confer resistance to
antibiotics or other toxins, e.g., ampicillin~
neomycin, methotrexate, or tetracycline, (b) complement auxotrophic
deficiencies, or (c) supply critical nutrients
not available from complex media, e.g., the gene encoding D-alanine racemase
for Bacilli.
An example of suitable selectable markers for mammalian cells are those that
enable the identification of
cells competent to take up the nucleic acid encoding the PRO polypeptide such
as DHFR or thymidine kinase. An
appropriate host cell when wild-type DHFR is employed is the CHO cell line
deficient in DHFR activity, prepared
and propagated as described by Urlaub et al., Proc. Natl. Acad. Sci. USA, 77:
4216 (1980). A suitable selection
gene for use in yeast is the t~pl gene present in the yeastplasmid YRp7.
Stinchcomb et al., Nature, 282: 39 (1979);
Kingsman et al., Gene, 7: 141 (1979); Tschemper et al., Gene, 10: 157 (1980).
The t~pl gene provides a selection
marker for a mutant strain of yeast lacking the ability to grow in tryptophan,
for example, ATCC No. 44076 or
PEP4-1. Jones, Genetics, 85: 12 (1977). .
Expression and cloning vectors usually contain a promoter operably linked to
the nucleic acid sequence
encoding the PRO polypeptide to direct mRNA synthesis. Promoters recognized by
a variety ofpotential host cells
are well known. Promoters suitable for use with prokaryotic hosts include the
p-lactamase and lactose promoter
systems (Chang et al., Nature, 275: 615 (1978); Goeddel et al., Nature, 281:
544 (1979)), alkaline phosphatase, a
tryptophan (trp) promoter system (Goeddel, Nucleic Acids Res., 8: 4057 (1980);
EP 36,776), and hybrid promoters
such as the tac promoter (deBoer et al., Proc. Natl. Acad. Sci. USA, 80: 21-25
(1983)). Promoters for use in
bacterial systems also will contain a Shine-Dalgarno (S.D.) sequence operably
linked to the DNA encoding the PRO
polypeptide.
Examples of suitable promoting sequences for use with yeast hosts include the
promoters for 3-
phosphoglycerate kinase (Hitzeman et al., J. Biol. Chem., 255: 2073 (1980)) or
other glycolytic enzymes (Hess et
al., J. Adv. Enzvme Red, 7: 149 (1968); Holland, Biochemistry,17: 4900
(1978)), such as enolase, glyceraldehyde-
3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase,
phosphofructokinase, glucose-6-phosphate
isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosephosphate
isomerase, phosphoglucose isomerase, and
glucokinase.
Other yeast promoters that are inducible promoters having the additional
advantage of transcription
controlled by growth conditions are the promoter regions for alcohol
dehydrogenase 2, isocytochrome C, acid
phosphatase, degradative enzymes associated with nitrogen metabolism,
metallothionein, glyceraldehyde-3-phos-
phate dehydrogenase, and enzymes responsible for maltose and galactose
utilization. Suitable vectors and
promoters for use in yeast expression are further described in EP 73,657.
PRO nucleic acid transcription from vectors in mammalian host cells is
controlled, for example, by
promoters obtained from the genomes of viruses such as polyoma virus, fowlpox
virus (UK 2,211,504 published
5 July 1989), adenovirus (such as Adenovirus 2), bovine papilloma virus, avian
sarcoma virus, cytomegalovirus,
a retrovirus, hepatitis-B virus, and Simian Virus 40 (SV40); by heterologous
mammalian promoters, e.g., the actin
82
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
promoter or an immunoglobulin promoter; and by heat-shock promoters, provided
such promoters are compatible
with the host cell systems.
Transcription of a DNA encoding the PRO polypeptide by higher eukaryotes may
be increased by inserting
an enhancer sequence into the vector. Enhancers are cis-acting elements of
DNA, usually about from 10 to 300 bp,
that act on a promoter to increase its transcription. Many enhancer sequences
are now known from mammalian
genes (globin, elastase, albumin, a-fetoprotein, and insulin). Typically,
however, one will use an enliancer from
a eukaryotic cell virus. Examples include the SV40 enhancer on the late side
ofthe replication origin (bp 100-270),
the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late
side of the replication origin, and
adenovirus enhancers. The enhancer may be spliced into the vector at a
position 5' or 3' to the sequence coding for
PRO polypeptides, but is preferably located at a site 5' from the promoter.
Expression vectors used in eukaryotic host cells (yeast, fungi, insect, plant,
animal, human, or nucleated
cells from other multicellular organisms) will also contain sequences
necessary for the termination of transcription
and for stabilizing the mRNA. Such sequences are commonly available from the
5' and, occasionally 3',
untranslated regions of eukaryotic or viral DNAs or cDNAs. These regions
contain nucleotide segments transcribed
as polyadenylated fragments in the untranslated portion of the mRNA encoding
the PRO polypeptide.
Still other methods, vectors, and host cells suitable for adaptation to the
synthesis of the PRO polypeptide
in recombinant vertebrate cell culture are described in Gething et al.,
Nature, 293: 620-625 (1981); Mantei et al.,
Nature, 281: 40-46 (1979); EP 117,060; and EP 117,058.
5.2.3.4. Detecting Gene Amplification/Expression
Gene amplification and/or expression may be measured in a sample directly, for
example, by conventional
Southern blotting, Northern blotting to quantitate the transcription of mRNA
(Thomas, Proc. Natl. Acad. Sci. USA,
77:5201-5205 (1980)), dot blotting (DNA analysis), or in situ hybridization,
using an appropriately labeled probe,
based on the sequences provided herein. Alternatively, antibodies may be
employed that can recognize specific
duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or
DNA-protein duplexes.
The antibodies in turn may be labeled and the assay may be carried out where
the duplex is bound to a surface, so
that upon the formation of duplex on the surface, the presence of antibody
bound to the duplex can be detected.
Gene expression, alternatively, may be measured by immunological methods, such
as
iinmunohistochemical staining of cells or tissue sections and assay of cell
culture or body fluids, to quantitate
directly the expression of gene product. Antibodies useful for
immunohistochemical staining and/or assay of
sample fluids may be either monoclonal or polyclonal, and may be prepared iii
any mammal. Conveniently, the
antibodies may be prepared against a native-sequence PRO polypeptide or
against a synthetic peptide based on the
DNA sequences provided herein or against exogenous sequence fused to DNA
encoding the PRO polypeptide and
encoding a specific antibody epitope.
5.2.3.5. Purification of PRO Polypeptides
Forms of PRO polypeptides may be recovered from culture medium or from host
cell lysates. If
83
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
membrane-bound, it can be released from the membrane using a suitable
detergent solution (e.g., TRITON-XTM
100) or by enzymatic cleavage. Cells employed in expression of nucleic acid
encoding the PRO polypeptide can
be disrupted by various physical or chemical means, such as freeze-thaw
cycling, sonication, mechanical disruption,
or cell-lysing agents. It may be desired to purify the PRO polypeptide from
recombinant cell proteins or
polypeptides. The following procedures are exemplary of suitable purification
procedures: by fractionation on an
ion-exchange column; ethanolprecipitation; reverse phase HPLC; chromatography
on silica or on a cation-exchange
resin such as DEAF; chromatofocusing; SDS-PAGE; ammonium sulfate
precipitation; gel filtration using, for
example, Sephadex G-75; protein A Sepharose columns to remove contaminants
such as IgG; and metal chelating
columns to bind epitope-tagged forms of the PRO polypeptide. Various methods
of protein purification may be
employed and such methods are known in the art and described, for example, in
Deutscher, Methods in
Enzymolo~y,182 (1990); Scopes, ProteinPurification: Principles- - andPractice
(Springer-Verlag: NewYork,1982).
The purification steps) selected will depend, for example, on the nature of
the production process used and the
particular PRO polypeptide produced.
5.2.4. Uses of PRO Polyneptides
5.2.4.1. Assavs for Cardiovascular Endothelial and An~io~enic Activity
Various assays can be used to test the polypeptide hereW for cardiovascular,
endothelial, and angiogenic
activity. Such assays include those provided in the Examples below.
Assays for testing for endothelia antagonist activity, as disclosed in U.S.
Pat. No. 5,773,414, include a rat
heart ventricle binding assay where the polypeptide is tested for its ability
to inhibit iodinized endothelia-1 binding
in a receptor assay, an endothelia receptor binding assay testing for intact
cell binding of radiolabeled endothelia-1
using rabbit renal artery vascular smooth muscle cells, an inositol phosphate
accumulation assay where functional
activity is determined in Rat-I cells by measuring infra-cellular levels of
second messengers, an arachidonic acid
release assay that measures the ability of added compounds to reduce
endothelia-stimulated arachidonic acid release
in cultured vascular smooth muscles, in vitro (isolated vessel) studies using
endothelium from male New Zealand
rabbits, and in vivo studies using male Sprague-Dawley rats.
Assays for tissue generation activity include, without limitation, those
described in WO 95/16035 (bone,
cartilage, tendon); WO 95/05846 (nerve, neuronal), and WO 91/07491 (skin,
endothelium).
Assays for wound-healing activity include, for example, those described in
Winter, Epidermal Wound
He- alin~, Maibach, HI and Rovee, DT, eds. (Year Book Medical Publishers,
Inc., Chicago), pp. 71-112, as modified
by the article of Eaglstein and Mertz, J. Invest. Dermatol., 71: 382-384
(I978).
An assay to screen for a test molecule relating to a PRO polypeptide that
binds an endothelia B, (ETB,)
receptor polypeptide and modulates signal transduction activity involves
providing a host cell transformed with a
DNA encoding endothelia B1 receptor polypeptide, exposing the cells to the
test candidate, and measuring
endothelia B, receptor signal transduction activity, as described, e.g., in
U.S. Pat. No. 5,773,223.
3 5 There are several cardiac hypertrophy assays. Izz vitz-o assays include
induction of spreading of adult rat
cardiac myocytes. In this assay, ventricular myocytes are isolated from a
single (male Sprague-Dawley) rat,
84
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
essentially following a modification of the procedure described in detail by
Piper et al., "Adult ventricular rat heart
muscle cells" in Cell Culture Techniques in Heart and Vessel Research, H.M.
Piper, ed. (Berlin: Springer-Verlag,
1990), pp. 36-60. This procedure permits the isolation of adult ventricular
myocytes and the long-term culture of
these cells in the rod-shaped phenotype. Phenylephrine and Prostaglandin FZa
(PGFZa) have been shown to induce
a spreading response in these adult cells. The inhibition of myocyte spreading
induced by PGFza or PGFZa analogs
(e.g., fluprostenol) and phenylephrine by various potential inhibitors of
cardiac hypertrophy is then tested.
One example of an in vivo assay is a test for inhibiting cardiac hypertrophy
induced by fluprostenol ifZ vivo.
This pharmacological model tests the ability of the PRO polypeptide to inhibit
cardiac hypertrophy induced in rats
(e.g., male Wistar or Sprague-Dawley) by subcutaneous injection of
fluprostenol (an agonist analog of PGFZa). It
is known that rats with pathologic cardiac hypertrophy induced by myocardial
infarction have chronically elevated
levels of extractable PGFZa in their myocardium. Lai et al., Am. J. Phvsiol.
(Heart Circ. Physiol.), 271: H2197-
H2208 (1996). Accordingly, factors that can inhibit the effects of
fluprostenol on myocardial growth in vivo are
potentially useful for treating cardiac hypertrophy. The effects of the PRO
polypeptide on cardiac hypertrophy are
determined by measuring the weight of heart, ventricles, and left ventricle
(normalized by body weight) relative
to fluprostenol-treated rats not receiving the PRO polypeptide.
Another example of an in vivo assay is the pressure-overload cardiac
hypertrophy assay. For ifa vivo testing
it is common to inducepressure-overload cardiac hypertrophy by constriction
ofthe abdominal aorta of test animals.
In a typical protocol, rats (e.g., male Wistar or Sprague-Dawley) are treated
under anesthesia, and the abdominal
aorta of each rat is narrowed down just below the diaphragm. Beznak M., Can.
J. Biochem. Phvsiol., 33: 985-94
(1955). The aorta is exposed through a surgical incision, and a blunted needle
is placed next to the vessel. The
aorta is constricted with a ligature of sills thread around the needle, which
is immediately removed and which
reduces the lumen of the aorta to the diameter of the needle. This approach is
described, for example, in Rossi et
al., Am. Heart J., 124: 700-709 (1992) and O'Rourke and Reibel, P.S.E.M.B.,
200: 95-100 (1992).
In yet another in vivo assay, the effect on cardiac hypertrophy following
experimentally induced
myocardial infarction (MI) is measured. Acute MI is induced in rats by left
coronary artery ligation and confirmed
by electrocardiographic examination. A sham-operated group of animals is also
prepared as control animals.
Earlier data have shown that cardiac hypertrophy is present in the group of
animals with MI, as evidenced by an
18% increase in heart weight-to-body weight ratio. Lai et al., supra.
Treatment of these animals with candidate
blockers of cardiac hypertrophy, e.g., the PRO polypeptide, provides valuable
information about the therapeutic
potential of the candidates tested. One further such assay test for induction
of cardiac hypertrophy is disclosed in
U.S. Pat. No. 5,773,415, using Sprague-Dawley rats.
For cancer, a variety of well-known animal models can be used to further
understand the role of the genes
identified herein in the development and pathogenesis of tumors, and to test
the efficacy of candidate therapeutic
agents, including antibodies and other antagonists of native PRO polypeptides,
such as small-molecule antagonists.
The i~z vivo nature of such models makes them particularly predictive of
responses in human patients. Animal
models of tumors and cancers (e.g., breast cancer, colon cancer, prostate
cancer, lung cancer, etc.) include both
non-recombinant and recombinant (transgenic) animals. Non-recombinant animal
models include, for example,
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
rodent, e.g., murine models. Such models can be generated by introducing tumor
cells into syngeneic mice using
standard techniques, e.g., subcutaneous injection, tail vein injection, spleen
implantation, intraperitoneal
implantation, implantation under the renal capsule, or orthopin implantation,
e.g., colon cancer cells implanted in
colonic tissue. See, e.g., PCT publication No. WO 97/33551, published
September 18, 1997. Probably the most
often used animal species in oncological studies are ixnxnunodeficient mice
and, in particular, nude mice. The
observation that the nude mouse with thymic hypo/aplasia could successfully
act as a host for human tumor
xenografts has lead to its widespread use for this purpose. The autosomal
recessive nu gene has been introduced
into a very large number of distinct congenic strains of nude mouse,
including, for example, ASW, A/He, AKR,
BALB/c, B 10.LP, C 17, C3H, C57BL, C57, CBA, DBA, DDD, I/st, NC, NFR, NFS,
NFS/N, NZB, NZC, NZW,
P, RIII, and SJL. In addition, a wide variety of other animals with inherited
immunological defects other than the
nude mouse have been bred and used as recipients of tumor xenografts. For
further details see, e.g., The Nude
Mouse in Oncolo~y Research, E. Boven and B. Winograd, eds. (CRC Press, Inc.,
1991).
The cells introduced into such animals can be derived from known tumor/cancer
cell lines, such as any
of the above-listed tumor cell lines, and, for example, the B 104-1-1 cell
line (stable NIH-3T3 cell line transfected
with the neu protooncogene); ras-transfected NIH-3T3 cells; Caco-2 (ATCC HTB-
37); or a moderately well-
differentiated grade II human colon adenocarcinoma cell line, HT-29 (ATCC HTB-
38); or from tumors and cancers.
Samples of tumor or cancer cells can be obtained from patients undergoing
surgery, using standard conditions
involving freezing and storing in liquid nitrogen. I~armali et al., Br. J.
Cancer, 48: 689-696 (1983).
Tumor cells can be introduced into animals such as nude mice by a variety of
procedures. The
subcutaneous (s.c.) space in mice is very suitable for tumor implantation.
Tumors can be transplanted s.c. as solid
blocks, as needle biopsies by use of a trochar, or as cell suspensions. For
solid-block or trochar implantation, tumor
tissue fragments of suitable size are introduced into the s.c. space. Cell
suspensions are freshly prepared from
primary tumors or stable tumor cell lines, and injected subcutaneously. Tumor
cells can also be injected as
subdermal implants. In this location, the inoculum is deposited between the
lower part of the dermal connective
tissue and the s.c. tissue.
Animal models ofbreast cancer can be generated, for example, by implanting rat
neuroblastoma cells (from
which the neu oncogene was initially isolated), or neu-transformed NIH-3T3
cells into nude mice, essentially as
described by Drebin et al. Proc. Nat. Acad. Sci. USA, 83: 9129-9133 (1986).
Similarly, animal models of colon cancer can be generated by passaging colon
cancer cells in animals, e.g. ,
nude mice, leading to the appearance of tumors in these animals. An orthotopic
transplant model of human colon
cancer in nude mice has been described, for example, by Wang et al., Cancer
Research, 54: 4726-4728 (1994) and
Too et al., Cancer Research, 55: 681-684 (1995). This model is based on the so-
called "METAMOUSETM" sold
by Anticancer, Inc., (San Diego, California).
Tumors that arise in animals can be removed and cultured in vitro. Cells from
the in vitro cultures can then
be passaged to animals. Such tumors can serve as targets for further testing
or drug screening. Alternatively, the
tumors resulting from the passage can be isolated and RNA from pre-passage
cells and cells isolated after one or
more rounds of passage analyzed for differential expression of genes of
interest. Such passaging techniques can
86
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
be performed with any known tumor or cancer cell lines.
For example, Meth A, CMS4, CMSS, CMS21, and WEHI-164 are chemically induced
fibrosarcomas of
BALB/c female mice (DeLeo et al., J. Exp. Med., 146: 720 (1977)), which
provide a highly controllable model
system for studying the anti-tumor activities of various agents. Palladino et
al., J. Immunol., 138: 4023-4032
(1987). Briefly, tumor cells are propagated in vitf~o in cell culture. Prior
to injection into the animals, the cell lines
are washed and suspended in buffer, at a cell density of about 10x106 to 10x10
cells/ml. The animals are then
infected subcutaneously with 10 to 100 ~,1 of the cell suspension, allowing
one to three weeks for a tumor to appear.
In addition, the Lewis lung (3LL) carcinoma of mice, which is one of the most
thoroughly studied
experimental tumors, can be used as an investigational tumor model. Efficacy
in this tumor model has been
correlated with beneficial effects in the treatment ofhuman patients diagnosed
with small-cell carcinoma of the lung
(SCCL). This tumor can be introduced in normal mice upon injection of tumor
fragments from an affected mouse
or of cells maintained in culture. Zupi et al., Br. J. Cancer, 41: suppl. 4,
30 (1980). Evidence indicates that tumors
can be started from injection of even a single cell and that a very high
proportion of infected tumor cells survive.
For further information about this tumor model see, Zacharski, Haemostasis,
16: 300-320 (1986).
One way of evaluating the efficacy of a test compound in an animal model with
an implanted tumor is to
measure the size of the tumor before and after treatment. Traditionally, the
size of implanted tumors has been
measured with a slide caliper in two or three dimensions. The measure limited
to two dimensions does not
accurately reflect the size of the tumor; therefore, it is usually converted
into the corresponding volume by using
a mathematical formula. However, the measurement of tumor size is very
inaccurate. The therapeutic effects of
a drug candidate can be better described as treatment-induced growth delay and
specific growth delay. Another
important variable in the description of tumor growth is the tumor volume
doubling time. Computer programs for
the calculation and description of tumor growth are also available, such as
the program reported by Rygaard and
Spang-Thomsen, Proc. 6th Int. Workshop on Immune-Deficient Animals Wu and
Sheng eds. (Basel,1989), p. 301.
It is noted, however, that necrosis and inflammatory responses following
treatment may actually result in an
increase in tumor size, at least initially. Therefore, these changes need to
be carefully monitored, by a combination
of a morphometric method and flow cytometric analysis.
Further, recombinant (transgenic) animal models can be engineered by
introducing the coding portion of
the PRO gene identified herein into the genome of animals of interest, using
standard techniques for producing
transgenic animals. Animals that can serve as a target for transgenic
manipulation include, without limitation,
mice, rats, rabbits, guinea pigs, sheep, goats, pigs, and non-human primates,
e.g., baboons, chimpanzees and
monkeys. Techniques known inthe art to introduce a transgene into such animals
include pronucleic microinjection
(U.S. Patent No. 4,873,191); retrovirus-mediated gene transfer into germ lines
(e.g., Van der Putten et al., Proc.
Natl. Acad. Sci. USA, 82: 6148-615 (1985)); gene targeting in embryonic stem
cells (Thompson et al., Cell, 56:
313-321 (1989)); electroporation ofembryos (Lo, Mol. Cell. Biol., 3: 1803-1814
(1983)); and sperm-mediated gene
transfer. Lavitrano et al., Cell, 57: 717-73 (1989). For a review, see for
example, U.S. Patent No. 4,736,866.
For the purpose of the present invention, transgenic animals include those
that carry the transgene only
in part of their cells ("mosaic animals"). The transgene can be integrated
either as a single transgene, or in
87
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
concatamers, e.g., head-to-head or head-to-tail tandems. Selective
introduction of a transgene into a particular cell
type is also possible by following, for example, the technique ofLasko et al.,
Proc. Natl. Acad. Sci. USA, 89: 6232-
636 (1992). The expression of the transgene in transgenic animals can be
monitored by standard techniques. For
example, Southern blot analysis or PCR amplification can be used to verify the
integration of the transgene. The
level of mRNA expression can then be analyzed using techniques such as in situ
hybridization, Northern blot
analysis, PCR, or immunocytochemistry. The animals are further examined for
signs of tumor or cancer
development.
Alternatively, "knock-out" animals can be constructed that have a defective or
altered gene encoding a
PRO polypeptide identified herein, as a result ofhomologous recombination
between the endogenous gene encoding
the PRO polypeptide and altered genomic DNA encoding the same polypeptide
introduced into an embryonic cell
of the animal. For example, cDNA encoding a particular PRO polypeptide can be
used to clone genomic DNA
encoding that polypeptide in accordance with established techniques. A portion
of the genomic DNA encoding a
particular PRO polypeptide can be deleted or replaced with another gene, such
as a gene encoding a selectable
marker that can be used to monitor integration. Typically, several kilobases
of unaltered Flanking DNA (both at
the 5' and 3' ends) are included in the vector. See, e.g., Thomas and
Capecchi, Cell, 51: 503 (1987) for a description
of homologous recombination vectors. The vector is introduced into an
embryonic stem cell line (e.g., by
electroporation) and cells in which the introduced DNA has homologously
recombW ed with the endogenous DNA
are selected. See, e.g., Li et al., Cell, 69: 915 (1992). The selected cells
are then injected into a blastocyst of an
animal (e.g. , a mouse or rat) to form aggregation chimeras. See, e.g. ,
Bradley, in Teratocarcinomas and Embryonic
Stem Cells: A Practical Approach, E. J. Robertson, ed. (IRL: Oxford, 1987),
pp. 113-152. A chimeric embryo can
then be implanted into a suitable pseudopregnant female foster animal and the
embryo brought to term to create a
"knock-out" animal. Progeny harboring the homologously recombined DNA in their
germ cells can be identified
by standard techniques and used to breed animals in which all cells of the
animal contain the homologously
recombined DNA. Knockout animals can be characterized, for instance, by their
ability to defend against certain
pathological conditions and by their development ofpathological conditions due
to absence of the PRO polypeptide.
The efficacy of antibodies specifically binding the PRO polypeptides
identified herein, and other drug
candidates, can be tested also in the treatment of spontaneous animal tumors.
A suitable target for such studies is
the feline oral squamous cell carcinoma (SCC). Feline oral SCC is a highly
invasive, malignant tumor that is the
most common oral malignancy of cats, accounting for over 60% of the oral
tumors reported in this species. It rarely
metastasizes to distant sites, although this low incidence of metastasis may
merely be a reflection of the short
survival times for cats with this tumor. These tumors are usually not amenable
to surgery, primarily because of the
anatomy of the feline oral cavity. At present, there is no effective treatment
for this tumor. Prior to entry into the
study, each cat undergoes complete clinical examination and biopsy, and is
scanned by computed tomography (CT).
Cats diagnosed with sublingual oral squamous cell tumors are excluded from the
study. The tongue can become
3 5 paralyzed as a result of such tumor, and even if the treatment kills the
tumor, the animals may not be able to feed
themselves. Each cat is treated repeatedly, over a longer period of time.
Photographs of the tumors will be taken
daily during the treatment period, and at each subsequent recheck. After
treatment, each cat undergoes another CT
88
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
scan. CT scans and thoracic radiograms are evaluated every 8 weeks thereafter.
The data are evaluated for
differences in survival, response, and toxicity as compared to control groups.
Positive response may require
evidence of tumor regression, preferably with improvement of quality of life
andlor increased life span.
In addition, other spontaneous animal tumors, such as fibrosarcoma,
adenocarcinoma, lymphoma,
chondroma, or leiomyosarcoma of dogs, cats, and baboons can also be tested. Of
these, mammary adenocarcinoma
in dogs and cats is a preferred model as its appearance and behavior are very
similar to those in humans. However,
the use of this model is limited by the rare occurrence of this .type of tumor
in animals.
Other in vitro and isa vivo cardiovascular, endothelial, and angiogenic tests
known iii the art are also
suitable herein.
5.2.4.2. Tissue Distribution
The results of the cardiovascular, endothelial, and angiogenic assays herein
can be verified by further
studies, such as by determining mRNA expression in various human tissues.
As noted before, gene amplification and/or gene expression in various tissues
may be measured by
conventional Southern blotting, Northern blotting to quantitate the
transcription of mRNA (Thomas, Proc. Natl.
Acad. Sci. USA, 77:5201-5205 ( 1980)), dotblotting (DNA analysis), or iri situ
hybridization, using an appropriately
labeled probe, based on the sequences provided herein. Alternatively,
antibodies may be employed that can
recognize specific duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA
hybrid duplexes or
DNA-protein duplexes.
Gene expression in various tissues, alternatively, may be measured by
immunological methods, such as
immunohistochemical staining of tissue sections and assay of cell culture or
body fluids, to quantitate directly the
expression of gene product. Antibodies usefixl for immunohistochemical
staining and/or assay of sample fluids may
be either monoclonal or polyclonal, and may be prepared in any mammal.
Conveniently, the antibodies may be
prepared against a native-sequence PRO polypeptide or against a synthetic
peptide based on the DNA sequences
provided herein or against exogenous sequence fused to PRO DNA and encoding a
specific antibody epitope.
General techniques for generating antibodies, and special protocols for in
situ hybridization are provided
hereinbelow.
5.2.4.3. Antibody Bindinil Studies
The results of the cardiovascular, endothelial, and angiogenic study can be
further verified by antibody
binding studies, in which the ability of anti-PRO antibodies to inhibit the
effect of the PRO polypeptides on
3 0 endothelial cells or other cells used in the cardiovascular, endothelial,
and angiogenic assays is tested. Exemplary
antibodies include polyclonal, monoclonal, humanized, bispecific, and
heteroconjugate antibodies, the preparation
of which will be described hereinbelow.
Antibody binding studies may be carried out in any known assay method, such as
competitive binding
assays, direct and indirect sandwich assays, and immunoprecipitation assays.
Zola, Monoclonal Antibodies: A
Manual of Techniques (CRC Press, Inc., I987), pp.147-158.
89
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
Competitive binding assays rely on the ability of a labeled standard to
compete with the test sample analyte
for binding with a limited amount of antibody. The amount of target protein in
the test sample is inversely
proportional to the amount of standard that becomes bound to the antibodies.
To facilitate determining the amount
of standard that becomes bound, the antibodies preferably are insolubilized
before or after the competition, so that
the standard and analyte that are bound to the antibodies may conveniently be
separated from the standard and
analyte that remain unbound.
Sandwich assays involve the use of two antibodies, each capable of binding to
a different unmunogenic
portion, or epitope, of the protein to be detected. In a sandwich assay, the
test sample analyte is bound by a first
antibody that is immobilized on a solid support, and thereafter a second
antibody binds to the analyte, thus forming
an insoluble three-part complex. See, e.g., U.S. Pat. No. 4,376,110. The
second antibody may itself be labeled
with a detectable moiety (direct sandwich assays) or may be measured using an
anti-immunoglobulin antibody that
is labeled with a detectable moiety (indirect sandwich assay). For example,
one type of sandwich assay is an ELISA
assay, in which case the detectable moiety is an enzyme.
For immunohistochemistry, the tissue sample may be fresh or frozen or may be
embedded in paraffin and
fixed with a preservative such as formalin, for example.
5.2.4.4. Cell-Based Tumor Assays
Cell-based assays and animal models for cardiovascular, endothelial, and
angiogenic disorders, such as
tumors, can be used to verify the findings of a cardiovascular, endothelial,
and angiogenic assay herein, and further
to understand the relationship between the genes identified herein and the
development and pathogenesis of
undesirable cardiovascular, endothelial, and angiogenic cell growth. The role
of gene products identified herein
in the development and pathology of undesirable cardiovascular, endothelial,
and angiogenic cell growth, e.g.,
tumor cells, can be tested by using cells or cells lines that have been
identified as being stimulated or inhibited by
the PRO polypeptide herein. Such cells include, for example, those set forth
in the Examples below.
In a different approach, cells of a cell type known to be involved in a
particular cardiovascular, endothelial,
and angiogenic disorder are transfected with the cDNAs herein, and the ability
of these cDNAs to induce excessive
growth or inhibit growth is analyzed. If the cardiovascular, endothelial, and
angiogenic disorder is cancer, suitable
tumor cells include, for example, stable tumor cell lines such as the B104-1-1
cell line (stable NIH-3T3 cell line
transfected with the ~aeu protooncogene) and ras-transfected NIH-3T3 cells,
which can be transfected with the
desired gene and monitored for tumorigenic growth. Such transfected cell lines
can then be used to test the ability
ofpoly- ormonoclonal antibodies orantibody compositions to inhibittumorigenic
cell growth by exerting cytostatic
or cytotoxic activity on the growth of the transformed cells, or by mediating
antibody-dependent cellular
cytotoxicity (ADCC). Cells transfected with the coding sequences of the genes
identified herein can further be used
to identify drug candidates for the treatment of cardiovascular, endothelial,
and angiogenic disorders such as cancer.
In addition, primary cultures derived from tumors in transgenic animals (as
described above) can be used
in the cell-based assays herein, although stable cell lines are preferred.
Techniques to derive continuous cell lines
from transgenic animals are well known in the art. See, e.g., Small et al.,
Mol. Cell. Biol., 5: 642-648 (1985).
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
5.2.4.5. Gene Therany
Described below are methods and compositions whereby disease symptoms may be
ameliorated. Certain
diseases are brought about, at least in part, by an excessive level of gene
product, or by the presence of a gene
product exhibiting an abnormal or excessive activity. As such, the reduction
in the level and/or activity of such
gene products would bring about the amelioration of such disease symptoms.
Alternatively, certain other diseases are brought about, at least iii part, by
the absence or reduction of the
level of gene expression, or a reduction in the level of a gene product's
activity. As such, an increase in the level
of gene expression and/or the activity of such gene products would bring about
the amelioration of such disease
symptoms.
In some cases, the up-regulation of a gene in a disease state reflects a
protective role for that gene product
in responding to the disease condition. Enhancement of such a target gene's
expression, or the activity of the target
gene product, will reinforce the protective effect it exerts. Some disease
states may result from an abnormally low
level of activity of such a protective gene. In these cases also, an increase
in the level of gene expression and/or
the activity of such gene products would bring about the amelioration of such
disease symptoms.
The PRO polypeptides described herein and polypeptidyl agonists and
antagonists may be employed in
accordance with the present invention by expression of such polypeptides in
vivo, which is often referred to as gene
therapy. '
There are two major approaches to getting the nucleic acid (optionally
contained in a vector) into the
patient's cells: in vivo and ex vivo. For itZ vivo delivery the nucleic acid
is injected directly into the patient, usually
at the sites where the PRO polypeptide is required, i. e., the site of
synthesis of the PRO polypeptide, if known, and
the site (e.g., wound) where biological activity of the PRO polypeptide is
needed. For ex vivo treatment, the
patient's cells are removed, the nucleic acid is introduced into these
isolated cells, and the modified cells are
administered to the patient either directly or, for example, encapsulated
withinporous membranes that are implanted
into the patient (see, e.g., U.S. Pat. Nos. 4,892,538 and 5,283,187). There
are a variety of techniques available for
introducing nucleic acids into viable cells. The techniques vary depending
upon whether the nucleic acid is
transferred into cultured cells in vitro, or transferred in vivo in the cells
of the intended host. Techniques suitable
for the transfer of nucleic acid into mammalian cells in vitro include the use
of liposomes, electroporation,
microinjection, transduction, cell fusion, DEAF-dextran, the calcium
pliospliate precipitation method, etc.
Transduction involves the association of a replication-defective, recombinant
viral (preferably retroviral) particle
with a cellular receptor, followed by introduction of the nucleic acids
contained by the particle into the cell. A
commonly used vector for ex vivo delivery of the gene is a retrovirus.
The currently preferred iiz vivo nucleic acid transfer techniques include
transfection with viral or non-viral
vectors (such as adenovirus, lentivirus, Herpes simplex I virus, or adeno-
associated virus (AAV)) and lipid-based
systems (useful lipids for lipid-mediated transfer of the gene are, for
example, DOTMA, DOPE, and DC-Chol; see,
e.g., Tonkinson et al., Cancer Investigation, 14 1 : 54-65 (1996)). The most
preferred vectors for use in gene
therapy are viruses, most preferably adenoviruses, AAV, lentiviruses, or
retroviruses. A viral vector such as a
retroviral vector includes at least one transcriptional promoter/enhancer or
locus-defining element(s), or other
91
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
elements that control gene expression by other means such as alternate
splicing, nuclear RNA export, or
post-translational modification ofmessenger. In addition, a viral vector such
as a retroviral vector includes a nucleic
acid molecule that, when transcribed in the presence of a gene encoding the
PRO polypeptide, is operably linked
thereto and acts as a translation initiation sequence. Such vector constructs
also include a packaging signal, long
ternlinal repeats (LTRs) or portions thereof, and positive and negative strand
primer binding sites appropriate to
the virus used (if these are not already present in the viral vector). In
addition, such vector typically includes a
signal sequence for secretion of the PRO polypeptide from a host cell in which
it is placed. Preferably the signal
sequence for this purpose is a mammalian signal sequence, most preferably the
native signal sequence for the PRO
polypeptide. Optionally, the vector construct may also include a signal that
directs polyadenylation, as well as one
or more restriction sites and a translation termination sequence. By way of
example, such vectors will typically
include a 5' LTR, a tRNA binding site, a packaging signal, an origin of second-
strand DNA synthesis, and a 3' LTR
or a portion thereof. Other vectors can be used that are non-viral, such as
cationic lipids, polylysine, and
dendrimers.
In some situations, it is desirable to provide the nucleic acid source with an
agent that targets the target
cells, such as an antibody specific for a cell-surface membrane protein or the
target cell, a ligand for a receptor on
the target cell, etc. Where liposomes are employed, proteins that bind to a
cell-surface membrane protein associated
with endocytosis may be used for targeting and/or to facilitate uptake, e.g.,
capsid proteins or fragments thereof
tropic for a particular cell type, antibodies for proteins that undergo
internalization in cycling, and proteins that
target intracellular localization and enhance intracellular half life. The
technique of receptor-mediated endocytosis
is described, for example, by Wu et al., J. Biol. Chem., 262: 4429-4432
(1987); and Wagner et al., Proc. Natl. Acad.
Sci. USA, 87: 3410-3414 (1990). For a review of the currently known gene
marking and gene therapy protocols,
see, Anderson et al., Science, 256: 808-813 (1992). See also WO 93/25673 and
the references cited therein.
Suitable gene therapy and methods for making retroviral particles and
structural proteins can be found in,
e.g., U.S. Pat. No. 5,681,746.
5.2.4.6. Use of Gene as a Diaunostic
This invention is also related to the use of the gene encoding the PRO
polypeptide as a diagnostic.
Detection of a mutated form of the PRO polypeptide will allow a diagnosis of a
cardiovascular, endothelial, and
angiogenic disease or a susceptibility to a cardiovascular, endothelial, and
angiogenic disease, such as a tumor, since
mutations in the PRO polypeptide may cause tumors.
Individuals carrying mutations in the genes encoding a human PRO polypeptide
may be detected at the
' DNA level by a variety of techniques. Nucleic acids for diagnosis may be
obtained from a patient's cells, such as
from blood, urine, saliva, tissue biopsy, and autopsy material. The genomic
DNA may be used directly for detection
or may be amplified enzymatically by using PCR (Saiki et al., Nature, 324: 163-
166 ( 1986)) prior to analysis. RNA
or cDNA may also be used for the same purpose. As an example, PCR primers
complementary to the nucleic acid
encoding the PRO polypeptide can be used to identify and analyze the PRO
polypeptide mutations. For example,
deletions and insertions can be detected by a change in size of the amplified
product in comparison to the normal
92
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
genotype. Point mutations can be identified by hybridizing amplified DNA to
radiolabeled RNA encoding the PRO
polypeptide, or alternatively, radiolabeled antisense DNA sequences encoding
the PRO polypeptide. Perfectly
matched sequences can be distinguished from mismatched duplexes by RNase A
digestion or by differences in
melting temperatures.
Genetic testing based on DNA sequence differences may be achieved by detection
of alteration in
electrophoretic mobility of DNA fragments in gels with or without denaturing
agents. Small sequence deletions
and insertions can be visualized by higli resolution gel electrophoresis. DNA
fragments of different sequences may
be distinguished on denaturing formamidine gradient gels in which the
mobilities of different DNA fragments are
retarded in the gel at different positions according to their specific melting
or partial melting temperatures. See,
e.g., Myers et al., Science, 230: 1242 (1985).
Sequence changes at specific locations may also be revealed by nuclease
protection assays, such as RNase
and S1 protection or the chemical cleavage method, for example, Cotton et al.,
Proc. Natl. Acad. Sci. USA, 85:
4397-4401(1985).
Thus, the detection of a specific DNA sequence may be achieved by methods such
as hybridization, RNase
protection, chemical cleavage, direct DNA sequencing, or the use of
restriction enzymes, e.g., restriction fragment
length polymorphisms (RFLP), and Southern blotting of genomic DNA.
5.2.4.7. Use to Detect PRO Polypeptide Levels
In addition to more conventional gel-electrophoresis and DNA sequencing,
mutations can also be detected
by in situ analysis.
Expression of nucleic acid encoding the PRO polypeptide may be linked to
vascular disease or
neovascularization associated with tumor formation. If the PRO polypeptide has
a signal sequence and the mRNA
is highly expressed in endothelial cells and to a lesser extent in smooth
muscle cells, this indicates that the PRO
polypeptide is present in serum. Accordingly, an anti-PRO polypeptide antibody
could be used to diagnose vascular
disease or neovascularization associated with tumor formation, since an
altered level of this PRO polypeptide may
be indicative of such disorders.
A competition assay may be employed wherein antibodies specific to the PRO
polypeptide are attached
to a solid support and the labeled PRO polypeptide and a sample derived from
the host are passed over the solid
support and the amount of label detected attached to the solid support can be
correlated to a quantity of the PRO
polypeptide in the sample.
5.2.4.8. Chromosome Mapp'm~
The sequences of the present invention are also valuable for chromosome
identification. The sequence
is specifically targeted to and can hybridize with a particular location on an
individual human chromosome.
Moreover, there is a current need for identifying particular sites on the
chromosome. Few chromosome marking
reagents based on actual sequence data (repeat polymorphisms) are presently
available for marking chromosomal
3 5 location. The mapping of DNAs to chromosomes according to the present
invention is an important first step in
93
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
correlating those sequences with genes associated with disease.
Briefly, sequences can be mapped to chromosomes by preparing PCR primers
(preferably 15-25 bp) from
the cDNA. Computer analysis for the 3'- untranslated region is used to rapidly
select primers that do not span more
than one exon in the genomic DNA, thus complicating the amplification process.
These primers are then used for
PCR screening of somatic cell hybrids containing individual h~unan
chromosomes. Only those hybrids containing
the human gene corresponding to the primer will yield an amplified fragment.
PCR mapping of somatic cell hybrids is a rapid procedure for assigning a
particular DNA to a particular
chromosome. Using the present invention with the same oligonucleotide primers,
sublocalization can be achieved
with panels of fragments from specific chromosomes or pools of large genomic
clones in an analogous manner.
Other mapping strategies that can similarly be used to map to its chromosome
include in situ hybridization,
prescreening with labeled flow-sorted chromosomes, and preselection by
hybridization to construct chromosome-
specific cDNA libraries.
Fluorescence in situ hybridization (FISH) of a cDNA clone to a metaphase
chromosomal spread can be
used to provide a precise chromosomal location in one step. This technique can
be used with cDNA as short as 500
or 600 bases; however, clones larger than 2,000 by have a higher likelihood of
binding to a unique chromosomal
location with sufficient signal intensity for simple detection. FISH requires
use of the clones from which the gene
encoding the PRO polypeptide was derived, and the longer the better. For
example, 2,000 by is good, 4,000 by is
better, and more than 4,000 is probably not necessary to get good results a
reasonable percentage of the time. For
a review of this technique, see, Verma et al., Human Chromosomes: a Manual of
Basic Techniques (Pergamon
Press, New York, 1988).
Once a sequence has beenmapped to aprecise chromosomal location,
thephysicalposition ofthe sequence
on the chromosome can be correlated with genetic map data. Such data are
found, for example, in V. McKusick,
Mendelian Inheritance in Man (available online through Johns Hopkins
University Welch Medical Library). The
relationship between genes and diseases that have been mapped to the same
chromosomal region is then identified
through linkage analysis (coinheritance ofphysically adjacent genes).
Next, it is necessary to determine the differences in the cDNA or genomic
sequence between affected and
unaffected individuals. If a mutation is observed in some or all of the
affected individuals but not in any normal
individuals, then the mutation is likely to be the causative agent of the
disease.
With current resolution ofphysical mapping and genetic mapping techniques, a
cDNA precisely localized
to a chromosomal region associated with the disease could be one of between 50
and 500 potential causative genes.
(This assumes 1 megabase mapping resolution and one gene per 20 kb).
5.2.4.9. Screening Assays for Drue Candidates
This invention encompasses methods of screening compounds to identify those
that mimic the PRO
polypeptide (agonists) or prevent the effect of the PRO polypeptide
(antagonists). Screening assays for antagonist
drug candidates are designed to identify compounds that bind or complex with
the PRO polypeptide encoded by
the genes identified herein, or otherwise interfere with the interaction of
the encoded polypeptides with other
94
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
cellular proteins. Such screening assays will include assays amenable to high-
throughput screening of chemical
libraries, making them particularly suitable for identifying small molecule
drug candidates.
The assays can be performed in a variety of formats, including protein-
proteinbinding assays, biochemical
screening assays, immunoassays, and cell-based assays, which are well
characterized in the art.
All assays for antagonists are common in that they call for contacting the
drug candidate with a PRO
polypeptide encoded by a nucleic acid identified herein under conditions and
for a time sufficient to allow these
two components to interact.
In binding assays, the interaction is binding and the complex formed can be
isolated or detected in the
reaction mixture. In a particular embodiment, the PRO polypeptide encoded by
the gene identified herein or the
drug candidate is immobilized on a solid phase, e.g., on a microtiter plate,
by covalent or non-covalent attachments.
Non-covalent attachment generally is accomplished by coating the solid surface
with a solution of the PRO
polypeptide and drying. Alternatively, an immobilized antibody, e.g., a
monoclonal antibody, specific for the PRO
polypeptide to be immobilized can be used to anchor it to a solid surface. The
assay is performed by adding the
non-immobilized component, which may be labeled by a detectable label, to the
immobilized component, e.g., the
coated surface containing the anchored component. When the reaction is
complete, the non-reacted components
are removed, e.g., by washing, and complexes anchored on the solid surface are
detected. When the originally non-
immobilized component carries a detectable label, the detection of label
immobilized on the surface indicates that
complexing occurred. Where the originally non-immobilized component does not
carry a label, complexing can
be detected, for example, by using a labeled antibody specifically binding the
immobilized complex.
If the candidate compound interacts with but does not bind to a particular PRO
polypeptide encoded by
a gene identified herein, its interaction with that polypeptide can be assayed
by methods well known for detecting
protein-protein interactions. Such assays include traditional approaches, such
as, e.g., cross-linking, co-
immunoprecipitation, and co-purification through gradients or chromatographic
columns. In addition, protein-
protein interactions can be monitored by using a yeast-based genetic system
described by Fields and co-workers
(Fields and Song, Nature (London, 340: 245-246 (1989); Chien et al., Proc.
Natl. Acad. Sci. USA, 88: 9578-9582
(1991)) as disclosed by Chevray and Nathans, Proc. Natl. Acad. Sci. USA, 89:
5789-5793 (1991). Many
transcriptional activators, such as yeast GAL4, consist of two physically
discrete modular domains, one acting as
the DNA-binding domain, the other one functioning as the transcription-
activation domain. The yeast expression
system described in the foregoing publications (generally referred to as the
"two-hybrid system") takes advantage
of this property, and employs two hybrid proteins, one in which the target
protein is fused to the DNA-binding
domain of GAL4, and another, in which candidate activating proteins are fused
to the activation domain. The
expression of a GAL1-ZacZ reporter gene under control of a GAL4-activated
promoter depends on reconstitution
of GAL4 activity via protein-protein interaction. Colonies containing
interacting polypeptides are detected with
a chromogenic substrate for p-galactosidase. A complete kit (MATCHMAKERTM) for
identifying protein-protein
interactionsbetweentwospecificproteinsusingthetwo-hybrid technique is
commercially available fromClontech.
This system can also be extended to map protein domains involved in specific
protein interactions as well as to
pinpoint amino acid residues that are crucial for these interactions.
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
Compounds that interfere with the interaction of a gene encoding a PRO
polypeptide identified herein and
other infra- or extracellular components can be tested as follows: usually a
reaction mixture is prepared containing
the product of the gene and the infra- or extracellular component under
conditions and for a time allowing for the
interaction and binding of the two products. To test the ability of a
candidate compound to inhibit binding, the
reaction is run in the absence and in the presence of the test compound. In
addition, a placebo may be added to a
third reaction mixture, to serve as positive control. The binding (complex
formation) between the test compound
and the infra- or extracellular component present in the mixture is monitored
as described hereinabove. The
formation of a complex in the control reactions) but not in the reaction
mixture containing the test compound
indicates that the test compound interferes with the interaction of the test
compound and its reaction partner.
If the PRO polypeptide has the ability to stimulate the proliferation of
endothelial cells in the presence of
the co-mitogen ConA, then one example of a screening method takes advantage of
this ability. Specifically, in the
proliferation assay, human umbilical vein endothelial cells are obtained and
cultured iii 96-well flat-bottomed
culture plates (Costar, Cambridge, MA) and supplemented with a reaction
mixture appropriate for facilitating
proliferation of the cells, the mixture containing Con-A (Calbiochem, La
Jolla, CA). Con-A and the compound to
be screened are added and after incubation at 37°C, cultures are pulsed
with 3-H-thymidine and harvested onto glass
fiber filters (phD; Cambridge Technology, Watertown, MA). Mean 3-H- thymidine
incorporation (cpm) oftriplicate
cultures is determined using a liquid scintillation counter (Beckman
Instruments, Irvine, CA). Significant 3-(H)-
thymidine incorporation indicates stimulation of endothelial cell
proliferation.
To assay for antagonists, the assay described above is performed; however, in
this assay the PRO
polypeptide is added along with the compound to be screened and the ability of
the compound to inhibit
3-(H)tlrymidine incorporation in the presence of the PRO polypeptide indicates
that the compound is an antagonist
to the PRO polypeptide. Alternatively, antagonists may be detected by
combining the PRO polypeptide and a
potential antagonist with membrane-bound PRO polypeptide receptors or
recombinant receptors under appropriate
conditions for a competitive inhibition assay. The PRO polypeptide can be
labeled, such as by radioactivity, such
that the number of PRO polypeptide molecules bound to the receptor can be used
to determine the effectiveness
of the potential antagonist. The gene encoding the receptor can be identified
by numerous methods known to those
of skill in the art, for example, ligand panning and FAGS sorting. Coligan et
al., Current Protocols in Immun., 1 2
Chapter 5 ( 1991). Preferably, expression cloning is employed wherein
polyadenylated RNA is prepared from a cell
responsive to the PRO polypeptide and a cDNA library created from this RNA is
divided into pools and used to
transfect COS cells or other cells that are not responsive to the PRO
polypeptide. Transfected cells that are grown
on glass slides are exposed to the labeled PRO polypeptide. The PRO
polypeptide can be labeled by a variety of
means including iodination or inclusion of a recognition site for a site-
specific protein kinase. Following fixation
and incubation, the slides are subjected to autoradiographic analysis.
Positive pools are identified and sub-pools
are prepared and re-transfected using an interactive sub-pooling and re-
screening process, eventually yielding a
3 5 single clone that encodes the putative receptor.
As an alternative approach for receptor identification, the labeled PRO
polypeptide can be photoaffmity-
linked with cell membrane or extract preparations that express the receptor
molecule. Cross-linked material is
96
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
resolved by PAGE and exposed to X-ray film. The labeled complex containing the
receptor can be excised,
resolved into peptide fragments, and subjected to protein micro-sequencing.
The amino acid sequence obtained
from micro-sequencing would be used to design a set of degenerate
oligonucleotide probes to screen a cDNA library
to identify the gene encoding the putative receptor.
In another assay for antagonists, mammalian cells or a membrane preparation
expressing the receptor
would be incubated with the labeled PRO polypeptide in the presence of the
candidate compound. The ability of
the compound to enhance or block this interaction could then be measured.
The compositions useful in the treatment of cardiovascular, endothelial, and
angiogenic disorders include,
without limitation, antibodies, small organic and inorganic molecules,
peptides, phosphopeptides, antisense and
ribozyme molecules, triple-helix molecules, etc., that inhibit the expression
and/or activity of the target gene
product.
More specific examples of potential antagonists include an oligonucleotide
that binds to the fusions of
immunoglobulin with a PRO polypeptide, and, in particular, antibodies
including, without limitation, poly- and
monoclonal antibodies and antibody fragments, single-chain antibodies, anti-
idiotypic antibodies, and chimeric or
humanized versions of such antibodies or fragments, as well as human
antibodies and antibody fragments.
Alternatively, a potential antagonist may be a closely related protein, for
example, a mutated form of the PRO
polypeptide that recognizes the receptor but imparts no effect, thereby
competitively iiW ibiting the action of the
PRO polypeptide.
Another potential PRO polypeptide antagonist is an antisense RNA or DNA
construct prepared using
antisense technology, where, e.g., an antisense RNA or DNA molecule acts to
block directly the translation of
mRNA by hybridizing to targeted mRNA and preventing protein translation.
Antisense technology can be used
to control gene expression through triple-helix formation or antisense DNA or
RNA, both of which methods are
based on binding of a polynucleotide to DNA or RNA. For example, the 5' coding
portion of the polynucleotide
sequence, which encodes the mature PRO polypeptides herein, is used to design
an antisense RNA oligonucleotide
of from about 10 to 40 base pairs in length. A DNA oligonucleotide is designed
to be complementary to a region
of the gene involved in transcription (triple helix - see, Lee et al., Nucl.
Acids Res., 6:3073 (1979); Cooney et al.,
Science, 241: 456 (1988);' Dervan et al., Science, 251:1360 (1991)), thereby
preventing transcription and the
production of the PRO polypeptide. A sequence "complementary" to a portion of
an RNA, as referred to herein,
means a sequence having sufficient complementarity to be able to hybridize
with the RNA, forming a stable duplex;
in the case of double-stranded antisense nucleic acids, a single strand of the
duplex DNA may thus be tested, or
triplex helix formation may be assayed. The ability to hybridize will depend
on both the degree of complementarity
and the length of the antisense nucleic acid. Generally, the longer the
hybridizing nucleic acid, the more base
mismatches with an RNA it may contain and still form a stable duplex (or
triplex, as the case may be). One skilled
in the art can ascertain a tolerable degree,of mismatch by use of standard
procedures to determine the melting point
of the hybridized complex. The antisense RNA oligonucleotide hybridizes to the
mRNA ifa vivo and blocks
translation of the mRNA molecule into the PRO polypeptide (antisense - Okano,
Neurochem., 56:560 (1991);
Ol~odeoxynucleotides as Antisense Inhibitors of Gene Expression (CRC Press:
Boca Raton, FL, 1988).
97
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
The antisense oligonucleotides can be DNA or RNA or chimeric mixtures or
derivatives or modified
versions thereof, single-stranded or double-stranded. The oligonucleotide
canbe modified at the base moiety, sugar
moiety, or phosphate backbone, for example, to improve stability of the
molecule, hybridization, etc. The
oligonucleotide may include other appended groups such as peptides (e.g., for
targeting host cell receptors in vivo),
or agents facilitating transport across the cell membrane (see, e.g.,
Letsinger, et al., 1989, Proc. Natl. Acad. Sci.
U.S.A. 86:6553-6556; Lemaitre, et al., 1987, Proc. Natl. Acad. Sci. U.S.A.
84:648-652; PCT Publication No.
W088/09810, published December 15, 1988) or the blood-brain barrier (see,
e.g., PCT Publication No.
W089/10134, published April 25, 1988), hybridization-triggered cleavage agents
(see, e.g., I~rol et al., 1988,
BioTechniques 6:958-976) or intercalating agents (see, e.g., Zon, 1988,
Plaarm. Res. 5:539-549). To this end, the
oligonucleotide may be conjugated to another molecule, e.g., a peptide,
hybridization triggered cross-linking agent,
transport agent, hybridization-triggered cleavage agent, etc.
The antisense oligonucleotide may comprise at least one modified base moiety
which is selected from the
group including but not limited to 5-fluorouracil, 5-bromouracil, 5-
chlorouracil, 5-iodouracil, hypoxanthine,
xanthine, 4-acetylcytosine, 5-(carboxyhydroxylinethyl) uracil, 5-
carboxymethylaminometlryl-2-thiouridine,
5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine,
inosine, N6-isopentenyladenine,
1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-
methylguanine, 3-methylcytosine,
5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-
methoxyaminomethyl-2-thiouracil,
beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-
methylthio-N6-isopentenyladenine,
uracil-5-oxyacetic acid (v), wybutoxosiiie, pseudouracil, queosiiie, 2-
thiocytosine, 5-metlryl-2-thiouracil,
2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid
methylester, uracil-5-oxyacetic acid (v), 5-methyl-
2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and 2,6-
diaminopurine.
The antisense oligonucleotide may also comprise at least one modified sugar
moiety selected from the
group including but not limited to arabinose, 2-fluoroarabinose, xylulose, and
hexose.
In yet another embodiment, the antisense oligonucleotide comprises at least
one modified phosphate
backbone selected from the group consisting ofaphosphorothioate,
aphosphorodithioate, aphosphoramidothioate,
a phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl
phosphotriester, and a formacetal or
analog thereof.
In yet another embodiment, the antisense oligonucleotide is an a-anomeric
oligonucleotide. An a,-
anomeric oligonucleotide forms specific double-stranded hybrids with
complementary RNA in which, contrary to
the usual [3-units, the strands run parallel to each other (Gautier, et al.,
1987, Nucl. Acids Res. 15:6625-6641). The
oligonucleotide is a 2'-0-methylribonucleotide (moue, et al., 1987, Nucl.
Acids Res. 15:6131-6148), or a chimeric
RNA-DNA analogue (moue, et al., 1987, FEBSLett. 215:327-330).
Oligonucleotides of the invention may be synthesized by standard methods known
in the art, e.g., by use
of an automated DNA synthesizer (such as are commercially available from
Biosearch, Applied Biosystems, etc.).
As examples, phosphorothioate oligonucleotides may be synthesized by the
method of Stein, et al. (1988, Nucl.
Acids Res. 16:3209), methylphosphonate oligonucleotides can be prepared by use
of controlled pore glass polymer
supports (Sarin, et al., 1988, Proc. Natl. Acad. Sci. U.S.A. 85:7448-7451),
etc.
98
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
The oligonucleotides described above can also be delivered to cells such that
the antisense RNA or DNA
may be expressed in vivo to inhibit production of the PRO polypeptide. When
antisense DNA is used,
oligodeoxyribonucleotides derived from the translation-initiation site, e.g.,
between about -10 and +10 positions
of the target gene nucleotide sequence, are preferred.
Antisense RNA or DNA molecules are generally at least about 5 bases in length,
about 10 bases in length,
about 15 bases in length, about 20 bases in length, about 25 bases in length,
about 30 bases in length, about 35 bases
in length, about 40 bases in length, about 45 bases in length, about 50 bases
in length, about 55 bases in length,
about 60 bases in length, about 65 bases in length, about 70 bases in length,
about 75 bases in length, about 80 bases
in length, about 85 bases in length, about 90 bases in length, about 95 bases
in length, about 100 bases ui length,
or more.
Potential antagonists further include small molecules that bind to the active
site, the receptor binding site,
or growth factor or other relevant binding site of the PRO polypeptide,
thereby blocking the normal biological
activity of the PRO polypeptide. Examples of small molecules include, but are
not limited to, small peptides or
peptide-like molecules, preferably soluble peptides, and synthetic non-
peptidyl organic or inorganic compounds.
Additionalpotential antagonists are ribozymes, which are enzymatic
RNAmolecules capable ofcatalyzing
the specific cleavage ofRNA. Ribozymes act by sequence-specific hybridization
to the complementary target RNA,
followed by endonucleolytic cleavage. Specific ribozyme cleavage sites within
a potential RNA target can be
identified by known techniques. For further details see, e.g., Rossi, Current
Biolo~y, 4: 469-471 (1994), and PCT
publication No. WO 97/33551 (published September 18, 1997).
While ribozymes that cleave mRNA at site specific recognition sequences can be
used to destroy target
gene mRNAs, the use of hammerhead ribozymes is preferred. Hammerhead ribozymes
cleave mRNAs at locations
dictated by flanking regions which form complementary base pairs with the
target mRNA. The sole requirement
is that the target mRNA have the following sequence of two bases: 5'-UG-3'.
The construction and production of
hammerhead ribozymes is well known W the art and is described more fully in
Myers, 1995, Molecular Biology
and Biotechnology: A Comprehensive DeskReference, VCH Publishers, New York,
(see especially Figure 4, page
833) and in Haseloff and Gerlach, 1988, Nature, 334:585-591, which is
incorporated herein by reference in its
entirety.
Preferably the ribozyme is engineered so that the cleavage recognition site is
located near the 5' end of the
target gene mRNA, i. e., to increase efficiency and minimize the intracellular
accumulation ofnon-functional mRNA
transcripts.
The ribozymes of the present uivention also include RNA endoribonucleases
(hereinafter "Cech-type
ribozymes") such as the one which occurs naturally in Tetrahymena the~mophila
(known as the IVS, or L-19 IVS
RNA) and which has been extensively described by Thomas Cech and collaborators
(Zaug, et al., 1984, Science,
224:574-578; Zaug and Cech, 1986, Science, 231:470-475; Zaug, et al., 1986,
Nature, 324:429-433; published
International patent application No. WO 88104300 by University Patents Inc.;
Been and Cech,1986, Cell, 47:207-
216). The Cech-type ribozymes have an eight base pair active site that
hybridizes to a target RNA sequence
99
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
whereafter cleavage of the target RNA takes place. The invention encompasses
those Cech-type ribozymes that
target eight base-pair active site sequences that are present in the target
gene.
As iii the antisense approach, the ribozymes can be composed of modified
oligonucleotides (e.g., for
improved stability, targeting, etc. ) and should be delivered to cells that
express the target gene i~a vivo. A preferred
method of delivery involves using a DNA construct "encoding" the ribozyme
under the control of a strong
constitutive pot III or pot II promoter, so that transfected cells will
produce sufficient quantities of the ribozyme
to destroy endogenous target gene messages and inhibit translation. Because
ribozyrnes, unlike antisense molecules,
are catalytic, a lower intracellular concentration is required for efficiency.
Nucleic acid molecules in triple-helix formation used to inhibit transcription
should be single-stranded and
composed of deoxynucleotides. The base composition of these oligonucleotides
is designed such that it promotes
triple-helix formation via Hoogsteen base-pairing rules, which generally
require sizeable stretches of purines or
pyrimidines on one strand of a duplex. For further details see, e.g., PCT
publication No. WO 97/33551, supra.
These small molecules can be identified by any one or more of the screening
assays discussed hereinabove
and/or by any other screening techniques well known for those skilled in the
art.
5.2.4.10. Types of Cardiovascular. Endothelial, and An~io~enic Disorders to be
Treated
The PRO polypeptides, or agonists or antagonists thereto, that have activity
in the cardiovascular,
angiogenic, and endothelial assays described herein, and/or whose gene product
has been found to be localized to
the cardiovascular system, are likely to have therapeutic uses in a variety of
cardiovascular, endothelial, and
angiogenic disorders, including systemic disorders that affect vessels, such
as diabetes mellitus. Their therapeutic
utility could include diseases ofthe arteries, capillaries, veins, and/or
lymphatics. Examples oftreatments hereunder
include treating muscle wasting disease, treating osteoporosis, aiding in
implant fixation to stimulate the growth
of cells around the implant and therefore facilitate its attachment to its
intended site, increasing IGF stability in
tissues or in serum, if applicable, and increasing binding to the IGF receptor
(since IGF has been shown in vitro to
enhance human marrow erythroid and granulocytic progenitor cell growth).
The PRO polypeptides or agonists or antagonists thereto may also be employed
to stimulate erythropoiesis
or granulopoiesis, to stimulate wound healing or tissue regeneration and
associated therapies concerned with re-
growth of tissue, such as connective tissue, skin, bone, cartilage, muscle,
lung, or kidney, to promote angiogenesis,
to stimulate or inhibit migration of endothelial cells, and to proliferate the
growth of vascular smooth muscle and
endothelial cell production. The increase in angiogenesis mediated by the PRO
polypeptide or agonist would be
beneficial to ischemic tissues and to collateral coronary development in the
heart subsequent to coronary stenosis.
Antagonists are used to inhibit the action of such polypeptides, for example,
to limit the production of excess
connective tissue during wound healing or pulmonary fibrosis if the PRO
polypeptide promotes such production.
This would include treatment of acute myocardial infarction and heart failure.
Moreover, the present inventionprovides the treatment of cardiac hypertrophy,
regardless ofthe underlying
3 5 cause, by administering a therapeutically effective dose of the PRO
polypeptide, or agonist or antagonist thereto.
If the objective is the treatment of human patients, the PRO polypeptide
preferably is recombinant human PRO
100
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
polypeptide (rhPRO polypeptide). The treatment for cardiac hypertrophy can be
performed at any of its various
stages, which may result from a variety of diverse pathologic conditions,
including myocardial infarction,
hypertension, hypertrophic cardiomyopathy, and valvular regurgitation. The
treatment extends to all stages of the
progression of cardiac hypertrophy, with or without structural damage of the
heart muscle, regardless of the
underlying cardiac disorder.
The decision of whether to use the molecule itself or an agonist thereof for
any particular indication, as
opposed to an antagonist to the molecule, would depend mainly on whether the
molecule herein promotes
cardiovascularization, genesis of endothelial cells, or angiogenesis or
inhibits these conditions. For example, if the
molecule promotes angiogenesis, an antagonist thereofwould be useful for
treatment of disorders where it is desired
to limit or prevent angiogenesis. Examples of such disorders include vascular
tumors such as haemangioma, tumor
angiogenesis, neovascularization in the retina, choroid, or cornea, associated
with diabetic retinopathy or premature
infant retinopathy or macular degeneration and proliferative
vitreoretinopathy, rheumatoid arthritis, Crohn's
disease, atherosclerosis, ovarian hyperstimulation, psoriasis, endometriosis
associated with neovascularization,
restenosis subsequent to balloon angioplasty, scar tissue overproduction, for
example, that seen in a keloid that
forms after surgery, fibrosis after myocardial infarction, or fibrotic lesions
associated with pulmonary fibrosis.
If, however, the molecule inhibits angiogenesis, it would be expected to be
used directly for treatment of
the above conditions.
On the other hand, if the molecule stimulates angiogenesis it would be used
itself (or an agonist thereof)
for indications where angiogenesis is desired such as peripheral vascular
disease, hypertension, inflammatory
vasculitides, Reynaud's disease and Reynaud's phenomenon, aneurysms, arterial
restenosis, thrombophlebitis,
lymphangitis, lymphedema, wound healing and tissue repair, ischemia
reperfusion injury, angina, myocardial
infarctions such as acute myocardial infarctions, chronic heart conditions,
heart failure such as congestive heart
failure, and osteoporosis.
If, however, the molecule inhibits angiogenesis, an antagonist thereof would
be used for treatment of those
conditions where angiogenesis is desired.
Specific types of diseases are described below, where the PRO polypeptide
herein or agonists or
antagonists thereof may serve as useful for vascular-related drug targeting or
as therapeutic targets for the treatment
or prevention of the disorders. Atherosclerosis is a disease characterized by
accumulation of plaques of intimal
thickening in arteries, due to accumulation of lipids, proliferation of smooth
muscle cells, and formation of fibrous
tissue within the arterial wall. The disease can affect large, medium, and
small arteries in any organ. Changes in
endothelial and vascular smooth muscle cell function are known to play an
important role in modulating the
accumulation and regression of these plaques.
Hypertension is characterized by raised vascular pressure in the systemic
arterial, pulmonary arterial, or
portal venous systems. Elevated pressure may result from or result in impaired
endothelial function andlor vascular
disease.
Inflammatory vasculitides include giant cell arteritis, Takayasu's arteritis,
polyarteritis nodosa (including
the microangiopathic form), Kawasaki's disease, microscopic polyangiitis,
Wegener's granulomatosis, and a variety
101
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
of infectious-related vascular disorders (including Henoch-Schonlein prupura).
Altered endothelial cell function
has been shown to be important in these diseases.
Reynaud's disease and Reynaud's phenomenon are characterized by intermittent
abnormal impairment of
the circulation through the extremities on exposure to cold. Altered
endothelial cell function has been shown to be
important in this disease.
Aneurysms are saccular or fusifonn dilatations of the arterial or venous tree
that are associated with altered
endothelial cell and/or vascular smooth muscle cells.
Arterial restenosis (restenosis of the arterial wall) may occur following
angioplasty as a result of alteration
in the function and proliferation of endothelial and vascular smooth muscle
cells.
Tlirombophlebitis and lymphangitis are inflammatory disorders ofveins and
lymphatics, respectively, that
may result from, and/or in, altered endothelial cell function. Similarly,
lymphedema is a condition involving
impaired lymphatic vessels resulting from endothelial cell function.
The family of benign and malignant vascular tumors are characterized by
abnormal proliferation and
growth of cellular elements of the vascular system. For example, lymphangiomas
are benign tumors of the
lymphatic system that are congenital, often cystic, malformations of the
lymphatics that usually occur in newborns.
Cystic tumors tend to grow into the adjacent tissue. Cystic tumors usually
occur in the cervical and axillary region.
They can also occur in the soft tissue of the extremities. The main symptoms
are dilated, sometimes reticular,
structured lymphatics and lymphocysts surroundedby connective tissue.
Lymphangiomas are assumed to be caused
by improperly connected embryonic lymphatics or their deficiency. The result
is impaired local lymph drainage.
Griener et al., Lvmnholo~y, 4: 140-144 (1971).
Another use for the PRO polypeptides herein or agonists or antagonists thereto
is in the prevention of
tumor angiogenesis, which involves vascularization of a tumor to enable it to
growth and/or metastasize. This
process is dependent on the growth of new blood vessels. Examples of neoplasms
and related conditions that
involve tumor angiogenesis include breast carcinomas, lung carcinomas, gastric
carcinomas, esophageal carcinomas,
colorectal carcinomas, liver carcinomas, ovarian carcinomas, thecomas,
arrhenoblastomas, cervical carcinomas,
endometrial carcinoma, endometrial hyperplasia, endometriosis, fibrosarcomas,
choriocarcinoma, head and neck
cancer, nasopharyngeal carcinoma, laryngeal carcinomas, hepatoblastoma,
Kaposi's sarcoma, melanoma, skin
carcinomas, hemangioma, cavernous hemangioma, hemangioblastoma, pancreas
carcinomas, retinoblastoma,
astrocytoma, glioblastoma, Schwannoma, oligodendroglioma, medulloblastoma,
neuroblastomas,
rhabdomyosarcoma, osteogenic sarcoma, leiomyosarcomas, urinary tract
carcinomas, thyroid carcinomas, Wilin's
tumor, renal cell carcinoma, prostate carcinoma, abnormal vascular
proliferation associated with phakomatoses,
edema (such as that associated with brain tumors), and Meigs' syndrome.
Age-related macular degeneration (AMD) is a leading cause of severe visual
loss in the elderly population.
The exudative form of AMD is characterized by choroidal neovascularization and
retinal pigment epithelial cell
detachment. Because choroidal neovascularization is associated with a dramatic
worsening in prognosis, the PRO
polypeptide or agonist or antagonist thereto is expected to be useful in
reducing the severity of AMD.
102
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
Healing of trauma such as wound healing and tissue repair is also a targeted
use for the PRO polypeptides
herein or their agonists or antagonists. Formation and regression of new blood
vessels is essential for tissue healing
and repair. This category includes bone, cartilage, tendon, ligament, and/or
nerve tissue growth or regeneration,
as well as wound healing and tissue repair and replacement, and in the
treatment of burns, incisions, and ulcers.
A PRO polypeptide or agonist or antagonist thereof that induces cartilage
and/or bone growth in circumstances
where bone is not normally formed has application in the healing of bone
fractures and cartilage damage or defects
in humans and other animals. Such a preparation employing a PRO polypeptide or
agonist or antagonist thereof
may have prophylactic use in closed as well as open fracture reduction and
also in the improved fvcation of artificial
joints. De novo bone formation induced by an osteogenic agent contributes to
the repair of congenital, trauma-
induced, or oncologic, resection-induced craniofacial defects, and also is
useful in cosmetic plastic surgery.
PRO polypeptides or agonists or antagonists thereto may also be useful to
promote better or faster closure
of non-healing wounds, including without limitation pressure ulcers, ulcers
associated with vascular insufficiency,
surgical and traumatic wounds, and the like.
It is expected that a PRO polypeptide or agonist or antagonist thereto may
also exhibit activity for
generation or regeneration of other tissues, such as organs (including, for
example, pancreas, liver, intestine, kidney,
skin, or endothelium), muscle (smooth, skeletal, or cardiac), and vascular
(including vascular endothelium) tissue,
or for promoting the growth of cells comprising such tissues. Part of the
desired effects may be by inhibition or
modulation of fibrotic scarring to allow normal tissue to regenerate.
A PRO polypeptide herein or agonist or antagonist thereto may also be useful
for gut protection or
regeneration and treatment of lung or liver fibrosis, reperfusion injury in
various tissues, and conditions resulting
from systemic cytokine damage. Also, the PRO polypeptide or agonist or
antagonist thereto may be useful for
promoting or inhibiting differentiation of tissues described above from
precursor tissues or cells, or for inhibiting
the growth of tissues described above.
A PRO polypeptide or agonist or antagonist thereto may also be used in the
treatment of periodontal
diseases and in other tooth-repair processes. Such agents may provide an
environment to attractbone-forming cells,
stimulate growth of bone-forming cells, or induce differentiation of
progenitors of bone-forming cells. A PRO
polypeptide herein or an agonist or an antagonist thereto may also be useful
in the treatment of osteoporosis or
osteoarthritis, such as through stimulation of bone and/or cartilage repair or
by blocking inflammation or processes
oftissue destruction (collagenase activity, osteoclast activity, etc.)
mediatedby inflammatoryprocesses, sinceblood
vessels play an important role in the regulation of bone turnover and growth.
Another category of tissue regeneration activity that may be attributable to
the PRO polypeptide herein
or agonist or antagonist thereto is tendon/ligament formation. A protein that
induces tendon/ligament-like tissue
or other tissue formation in circumstances where such tissue is not normally
formed has application in the healing
of tendon or ligament tears, deformities, and other tendon or ligament defects
in humans and other animals. Such
a preparation may have propliylactic use in preventing damage to tendon or
ligament tissue, as well as use in the
improved fixation of tendon or ligament to bone or other tissues, and in
repairing defects to tendon or ligament
tissue. De novo tendon/ligament-like tissue formation induced by a composition
of the PRO polypeptide herein or
103
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
agonist or antagonist thereto contributes to the repair of congenital, trauma-
induced, or other tendon or ligament
defects of other origin, and is also useful in cosmetic plastic surgery fox
attachment or repair of tendons or
ligaments. The compositions herein may provide an environment to attract
tendon- or ligament-forming cells,
stimulate growth of tendon- or ligament-forming cells, induce differentiation
ofprogenitors of tendon- or ligament-
s forming cells, or induce growth of tendon/ligament cells or progenitors ex
vivo for return in vivo to effect tissue
repair. The compositions herein may also be useful in the treatment of
tendinitis, carpal tunnel syndrome, and other
tendon or ligament defects. The compositions may also include an appropriate
matrix and/or sequestering agent
as a carrier as is well known in the art.
The PRO polypeptide or its agonist or antagonist may also be useful for
proliferation of neural cells and
for regeneration of nerve and brain tissue, i. e., for the treatment of
central and peripheral nervous system disease
and neuropathies, as well as mechanical and traumatic disorders, that involve
degeneration, death, or trauma to
neural cells or nerve tissue. More specifically, a PRO polypeptide or its
agonist or antagonist may be used in the
treatment of diseases of the peripheral nervous system, such as peripheral
nerve injuries, peripheral neuropathy and
localized neuropathies, and central nervous system diseases, such as
Alzheimer's, Parkinson's disease, Huntington's
disease, amyotrophic lateral sclerosis, and Shy-Drager syndrome. Further
conditions that may be treated in
accordance with the present invention include mechanical and traumatic
disorders, such as spinal cord disorders,
head trauma, and cerebrovascular diseases such as stroke. Peripheral
neuropathies resulting from chemotherapy
or other medical therapies may also be treatable using a PRO polypeptide
herein or agonist or antagonist thereto.
Ischemia-reperfusion injury is another indication. Endothelial cell
dysfunction may be important in both
the initiation of, and in regulation of the sequelae of events that occur
following ischemia-reperfusion injury.
Rheumatoid arthritis is a further indication. Blood vessel growth and
targeting of inflammatory cells
through the vasculature is an important component in the pathogenesis of
rheumatoid and sero-negative forms of
arthritis.
A PRO polypeptide or its agonist or antagonist may also be administered
prophylactically to patients with
cardiac hypertrophy, to prevent the progression of the condition, and avoid
sudden death, including death of
asymptomatic patients. Such preventative therapy is particularly warranted in
the case of patients diagnosed with
massive left ventricular cardiac hypertrophy (a maximal wall thickness of 35
mm or more in adults, or a comparable
value in children), or in instances when the hemodynamic burden on the heart
is particularly strong.
A PRO polypeptide or its agonist or antagonist may also be useful in the
management of atrial fibrillation,
which develops in a substantial portion of patients diagnosed with
hypertrophic cardiomyopathy.
Further indications include angina, myocardial infarctions such as acute
myocardial infarctions, and heart
failure such as congestive heart failure. Additional non-neoplastic conditions
include psoriasis, diabetic and other
proliferative retinopathies including retinopathy of prematurity, retrolental
fibroplasia, neovascular glaucoma,
thyroid hyperplasias (including Grave's disease), corneal and other tissue
transplantation, chronic inflammation,
lung inflammation, nephrotic syndrome, preeclampsia, ascites, pericardial
effusion (such as that associated with
pericarditis), and pleural effusion.
104
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
In view of the above, the PRO polypeptides or agonists ox antagonists thereof
described herein, which are
shown to alter or impact endothelial cell function, proliferation, and/or
form, are likely to play an important role
in the etiology and pathogenesis of many or all of the disorders noted above,
and as such can serve as therapeutic
targets to augment or inhibit these processes or for vascular-related drug
targeting in these disorders.
5.2.4.11. Administration Protocols, Schedules Doses and Formulations
The molecules herein and agonists and antagonists thereto are pharmaceutically
useful as a prophylactic
and therapeutic agent for various disorders and diseases as set forth above.
Therapeutic compositions of the PRO polypeptides or agonists or antagonists
are prepared for storage by
mixing the desired molecule having the appropriate degree of purity with
optional pharmaceutically acceptable
carriers, excipients, or stabilizers (Remington's Pharmaceutical Sciences,
16th edition, Osol, A. ed. (1980)), in the
form of lyophilized formulations or aqueous solutions. Acceptable carriers,
excipients, or stabilizers are nontoxic
to recipients at the dosages and concentrations employed, and include buffers
such as phosphate, citrate, and other
organic acids; antioxidants including ascorbic acid and methionine;
preservatives (such as octadecyldimethylbenzyl
ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium
chloride; phenol, butyl or
benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol;
resorcinol; cyclohexanol; 3-pentanol;
and m-cresol); low molecular weight (less than about 10 residues)
polypeptides; proteins, such as serum albumin,
gelatin, or iinmunoglobulins; hydrophilic polymers such as
polyvinylpyrrolidone; amino acids such as glycine,
glutamine, asparagine, histidine, arginine, or lysine; monosaccharides,
disaccharides, and other carbohydrates
including glucose, mannose, or dextrins; chelating agents such as EDTA; sugars
sucli as sucrose, mannitol, trehalose
or sorbitol; salt-forming counter-ions such as sodium; metal complexes (e.g.,
Zn-protein complexes); and/or non-
ionic surfactants such as TWEEI~'~M, PLUROIVICSTM or polyethylene glycol
(PEG).
Additional examples of such carriers include ion exchangers, alumina, aluminum
stearate, lecithin, serum
proteins, such as human serum albumin, buffer substances such as phosphates,
glycine, sorbic acid, potassium
sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water,
salts, or electrolytes such as protamine
sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium
chloride, zinc salts, colloidal silica,
magnesium trisilicate, polyvinyl pyrrolidone, cellulose-based substances, and
polyethylene glycol. Carriers for
topical or gel-based forms of agonist or antagonist include polysaccharides
such as sodium carboxymethylcellulose
or methylcellulose, polyvinylpyrrolidone, polyacrylates, polyoxyethylene-
polyoxypropylene-block polymers,
polyethylene glycol, and wood wax alcohols. For all administrations,
conventional depot forms are suitably used.
3 0 Such forms include, for example, microcapsules, nano-capsules, liposomes,
plasters, inhalation forms, nose sprays,
sublingual tablets, and sustained-release preparations. The PRO polypeptides
or agonists or antagonists will
typically be formulated in such vehicles at a concentration of about 0.1 mg/ml
to 100 mg/ml.
Another formulation comprises incorporating a PRO polypeptide or agonist or
antagonist thereof into
formed articles. Such articles can be used in modulating endothelial cell
growth and angiogenesis. In addition,
3 5 tumor invasion and metastasis may be modulated with these articles.
105
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
PRO polypeptides or agonists or antagonists to be used for in vivo
administration must be sterile. This is
readily accomplished by filtration through sterile filtration membranes, prior
to or following lyophilization and
reconstitution. PRO polypeptides ordinarily will be stored in lyophilized form
or in solution if administered
systemically. If in lyophilized form, the PRO polypeptide or agonist or
antagonist thereto is typically formulated
in combination with other ingredients for reconstitution with an appropriate
diluent at the time for use. An example
of a liquid formulation of a PRO polypeptide or agonist or antagonist is a
sterile, clear, colorless unpreserved
solution filled in a single-dose vial for subcutaneous injection.
Preservedpharmaceutical compositions suitable for
repeated use may contain, for example, depending mainly on the indication and
type of polypeptide:
a) PRO polypeptide or agonist or antagonist thereto;
b) a buffer capable of maintaining the pH in a range of maximum stability of
the polypeptide or
other molecule in solution, preferably about 4-8;
c) a detergent/surfactant primarily to stabilize thepolypeptide ormolecule
against agitation-induced
aggregation;
d) an isotonifier;
e) a preservative selected from the group ofphenol, benzyl alcohol and a
benzethonium halide, e.g.,
chloride; and
f) water.
If the detergent employed is non-ionic, it may, for example, be polysorbates
(e.g., POLYSORBATETM
(TWEEI~M) 20, 80, etc.) or poloxamers (e.g., POLOXAMERTM 188). The use of non-
ionic surfactants permits the
formulation to be exposed to shear surface stresses without causing
denaturation of the polypeptide. Further, such
surfactant-containing formulations may be employed in aerosol devices such as
those used in a pulmonary dosing,
and needleless jet injector guns (see, e.g., EP 257,956).
An isotonifier may be present to ensure isotonicity of a liquid composition of
the PRO polypeptide or
agonist or antagonist thereto, and includes polyhydric sugar alcohols,
preferably trihydric or higher sugar alcohols,
such as glycerin, erythritol, arabitol, xylitol, sorbitol, and mannitol. These
sugar alcohols can be used alone or in
combination. Alternatively, sodium chloride or other appropriate inorganic
salts may be used to render the solutions
isotonic.
The buffer may, for example, be an acetate, citrate, succinate, or phosphate
buffer depending on the pH
desired. The pH of one type of liquid formulation of this invention is
buffered in the range of about 4 to 8,
preferably about physiological pH.
The preservatives phenol, benzyl alcohol and benzethonium halides, e.g.,
chloride, are known antimicrobial
agents that may be employed.
Therapeutic PRO polypeptide compositions generally are placed into a container
having a sterile access
port, for example, an intravenous solution bag or vial having a stopper
pierceable by a hypodermic inj ection needle.
The formulations are preferably administered as repeated intravenous (i.v.),
subcutaneous (s.c.), or intramuscular
(i.m.) injections, or as aerosol formulations suitable for intranasal or
intrapulinonary delivery (for intrapulmonary
delivery see, e.g., EP 257,956).
106
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
PRO polypeptides can also be administered in the form of sustained-released
preparations. Suitable
examples of sustained-release preparations include semipermeable matrices of
solid hydrophobic polymers
containing the protein, which matrices are in the form of shaped articles,
e.g., films, or microcapsules. Examples
of sustained-release matrices include polyesters, hydrogels (e.g., poly(2-
hydroxyethyl-methacrylate) as described
by Langer et al., J. Biomed. Mater. Res., 15: 167-277 (1981) and Langer, Chem.
Tech., 12: 98-105 (1982) or
poly(vinylalcohol)), polylactides (U.S. Patent No. 3,773,919, EP 58,481),
copolymers of L-glutamic acid and
gamma etlryl-L-glutamate (Sidman etal., Biopolymers, 22: 547-556 (1983)), non-
degradable ethylene-vinyl acetate
(Langer et al., sups°a), degradable lactic acid-glycolic acid
copolymers such as the Lupron DepotTM (injectable
microspheres composed of lactic acid-glycolic acid copolymer and Leuprolide
acetate), and poly-D-
(-)-3-hydroxybutyric acid (EP 133,988).
While polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid
enable release of molecules
for over 100 days, certain hydrogels release proteins for shorter time
periods. When encapsulated proteins remain
in the body for a long time, they may denature or aggregate as a result of
exposure to moisture at 37°C, resulting
in a loss of biological activity and possible changes in immunogenicity.
Rational strategies can be devised for
protein stabilization depending on the mechanism involved. For example, if the
aggregation mechanism is
discovered to be intermolecular S-S bond formation through thio-disulfide
interchange, stabilization may be
achieved by modifying sulffiydryl residues, Lyophilizing from acidic
solutions, controlling moisture content, using
appropriate additives, and developing specific polymer matrix compositions.
Sustained-release PRO polypeptide compositions also include liposomally
entrapped PRO polypeptides.
Liposomes containing the PRO polypeptide are prepared by methods known per se:
DE 3,218,121; Epstein et al.,
Proc. Natl. Acad. Sci. USA, 82: 3688-3692 (1985); Hwang et al., Proc. Natl.
Acad. Sci. USA, 77: 4030-4034
(1980); EP 52,322; EP 36,676; EP 88,046; EP 143,949; EP 142,641; Japanese
patent application 83-118008; U.S.
Patent Nos. 4,485,045 and 4,544,545; and EP 102,324. Ordinarily the liposomes
are of the small (about 200-800
Angstroms) unilamellar type in which the lipid content is greater than about
30 mol. % cholesterol, the selected
proportion being adjusted for the optimal therapy.
The therapeutically effective dose of a PRO polypeptide or agonist or
antagonist thereto will, of course,
vary depending on such factors as the pathological condition to be treated
(including prevention), the method of
administration, the type of compound being used for treatment, any co-therapy
involved, the patient's age, weight,
general medical condition, medical history, etc., and its determination is
well within the skill of a practicing
physician. AccordW gly, it will be necessary for the therapist to titer the
dosage and modify the route of
administration as required to obtain the maximal therapeutic effect. If the
PRO polypeptide has a narrow host range,
for the treatment of human patients formulations comprising human PRO
polypeptide, more preferably native-
sequence human PRO polypeptide, are preferred. The clinician will administer
the PRO polypeptide until a dosage
is reached that achieves the desired effect for treatment of the condition in
question. For example, if the objective
is the treatment of CHF, the amount would be one that inhibits the progressive
cardiac hypertrophy associated with
this condition. The progress of this therapy is easily monitored by echo
cardiography. Similarly, in patients with
hypertrophic cardiomyopathy, the PRO polypeptide can be achninistered on an
empirical basis.
107
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
With the above guidelines, the effective dose generally is within the range of
from about 0.001 to about
1.0 mg/lcg, more preferably about 0.01-1.0 mg/kg, most preferably about 0.01-
0.1 mg/kg.
For non-oral use in treating human adult hypertension, it is advantageous to
administer the PRO
polypeptide in the form of an injection at about 0.01 to 50 mg, preferably
about 0.05 to 20 mg, most preferably 1
to 20 mg, per kg body weight, 1 to 3 times daily by intravenous inj ection.
For oral administration, a molecule based
on the PRO polypeptide is preferably administered at about 5 mg to 1 g,
preferably about 10 to 100 mg, per kg body
weight, l to 3 tunes daily. It should be appreciated that endotoxin
contamination should be kept minimally at a safe
level, for example, less than 0.5 ng/mg protein. Moreover, for human
administration, the formulations preferably
meet sterility, pyrogenicity, general safety, and purity as required by FDA
Office and Biologics standards.
The dosage regimen of a pharmaceutical composition containing the PRO
polypeptide to be used in tissue
regeneration will be determined by the attending physician considering various
factors that modify the action of
the polypeptides, e.g., amount of tissue weight desired to be formed, the site
of damage, the condition of the
damaged tissue, the size of a wound, type of damaged tissue (e.g., bone), the
patient's age, sex, and diet, the severity
of any infection, time of administration, and other clinical factors. The
dosage may vary with the type of matrix
used in the reconstitution and with inclusion of other proteins in the
pharmaceutical composition. For example, the
addition of other known growth factors, such as IGF-I, to the final
composition may also affect the dosage. Progress
can be monitored by periodic assessment of tissue/bone growth and/or repair,
for example, X-rays,
histomorphometric determinations, and tetracycline labeling.
The route of PRO polypeptide or antagonist or agonist administration is in
accord with known methods,
e.g., by injection or infusion by intravenous, intramuscular, intracerebral,
intraperitoneal, intracerobrospinal,
subcutaneous, intraocular, intraarticular, intrasynovial, intrathecal, oral,
topical, or inhalation routes, or by
sustained-release systems as noted below. The PRO polypeptide or agonist or
antagonists thereof also are suitably
administered by intratumoral, peritumoral, intralesional, or perilesional
routes, to exert local as well as systemic
therapeutic effects. The intraperitoneal route is expected to be particularly
useful, for example, in the treatment of
ovarian tumors.
If a peptide or small molecule is employed as au antagonist or agonist, it is
preferably administered orally
or non-orally in the form of a liquid or solid to mammals.
Examples of pharmacologically acceptable salts of molecules that form salts
and are useful hereunder
include alkali metal salts (e.g., sodium salt, potassium salt), allcaline
earth metal salts (e.g., calcium salt, magnesium
salt), ammonium salts, organic base salts (e.g., pyridine salt, triethylamine
salt), inorganic acid salts (e.g.,
hydrochloride, sulfate, nitrate), and salts of organic acid (e.g., acetate,
oxalate, p-toluenesulfonate).
For compositions herein that are useful for bone, cartilage, tendon, or
ligament regeneration, the
therapeutic method includes administering the composition topically,
systemically, or locally as an implant or
device. When administered, the therapeutic composition for use is in a pyrogen-
free, physiologically acceptable
form. Further, the composition may desirably be encapsulated or injected in a
viscous form for delivery to the site
of bone, cartilage, or tissue damage. Topical administration may be suitable
for wound healing and tissue repair.
Preferably, for bone and/or cartilage formation, the composition would include
a matrix capable of delivering the
10~
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
protein-containing composition to the site ofbone and/or cartilage damage,
providing a structure for the developing
bone and cartilage and preferably capable of being resorbed into the body.
Such matrices may be formed of
materials presently in use for other implanted medical applications.
The choice of matrix material is based on biocompatibility, biodegradability,
mechanical properties,
cosmetic appearance, and interface properties. The particular application of
the compositions will define the
appropriate formulation. Potential matrices for the compositions may be
biodegradable and chemically defined
calcium sulfate, tricalciumphosphate, hydroxyapatite, polylactic acid,
polyglycolic acid, andpolyanhydrides. Other
potential materials are biodegradable and biologically well-defined, such as
bone or dermal collagen. Fux-ther
matrices are comprised of pure proteins or extracellular matrix components.
Other potential matrices are
nonbiodegradable and chemically defined, such as sintered hydroxyapatite,
bioglass, aluminates, or other ceramics.
Matrices may be comprised of combinations of any of the above-mentioned types
of material, such as polylactic
acid andhydroxyapatiteorcollagenandtricalciumphosphate.
Thebioceramicsmaybealteredincomposition,such
as in calcium-aluminate-pliosphate and processing to alter pore size, particle
size, particle shape, and
biodegradability.
One specific embodiment is a 50:50 (mole weight) copolymer of lactic acid and
glycolic acid in the form
of porous particles having diameters ranging from 150 to 800 microns. In some
applications, it will be useful to
utilize a sequestering agent, such as carboxymethyl cellulose or autologous
blood clot, to prevent the polypeptide
compositions from disassociating from the matrix.
One suitable family of sequestering agents is cellulosic materials such as
alkylcelluloses (including
hydroxyallcylcelluloses), including methylcellulose, ethylcellulose,
hydoxyethylcellulose, hydroxypropylcellulose,
hydroxypropylinethylcellulose, and carboxymethylcellulose, one preferred being
cationic salts of
carboxymethylcellulose (CMC). Other preferred sequestering agents include
hyaluronic acid, sodium alginate,
~poly(ethylene glycol), polyoxyethylene oxide, carboxyvinyl polymer, and
polyvinyl alcohol). The amount of
sequestering agent useful herein is 0.5-20 wt%, preferably 1-IO wt%, based on
total formulation weight, which
represents the amount necessary to prevent desorption of the polypeptide (or
its antagonist) from the polymer matrix
and to provide appropriate handling of the composition, yet not so much that
the progenitor cells are prevented from
infiltrating the matrix, thereby providing the polypeptide (or its antagonist)
the opportunity to assist the osteogenic
activity of the progenitor cells.
5.2.4.12. Combination Therapies
The effectiveness of the PRO polypeptide or an agonist or antagonist thereof
in preventing or treating the
disorder in question may be improved by administering the active agent
serially or in combination with another
agent that is effective for those purposes, either in the same composition or
as separate compositions.
For example, for treatment of cardiac hypertrophy, PRO polypeptide therapy can
be combined with the
administration of inhibitors of known cardiac myocyte hypertrophy factors,
e.g., inhibitors of rx-adrenergic agonists
such as phenylephrine; endothelin-1 inhibitors such as BOSENTAI~'~M and
MOXONODII~M; inhibitors to CT-1
109
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
(U.S. Pat. No. 5,679,545); inhibitors to LIF; ACE inhibitors; des-aspartate-
angiotensin I inhibitors (U.S. Pat. No.
5,773,415), and angiotensin II inhibitors.
For treatment of cardiac hypertrophy associated with hypertension, the PRO
polypeptide can be
administered in combination with ~i-adrenergic receptor blocking agents, e.g.,
propranolol, timolol, tertalolol,
carteolol, nadolol, betaxolol, penbutolol, acetobutolol, atenolol, metoprolol,
or carvedilol; ACE inhibitors, e.g.,
quinapril, captopril, enalapril, ramipril, benazepril, fosinopril, or
lisinopril; diuretics, e.g., chlorothiazide,
hydrochlorothiazide, hydroflumethazide, metlrylchlothiazide, benzthiazide,
dichlorphenamide, acetazolamide, or
indapamide; and/or calcium channel blockers, e.g., diltiazem, nifedipine,
verapamil, ornicardipiiie. Pharmaceutical
compositions comprising the therapeutic agents identified hereinby their
generic names are commercially available,
and are to be administered following the manufacturers' instructions for
dosage, administration, adverse effects,
contraindications, etc. See, e.g., Phvsicians' Desk Reference (Medical
Economics Data Production Co.: Montvale,
N.J., 1997), SlthEdition.
Preferred candidates for combination therapy in the treatment of hypertrophic
cardiomyopathy are p-
adrenergic-blocking drugs (e.g., propranolol, timolol, tertalolol, carteolol,
nadolol, betaxolol, penbutolol,
acetobutolol, atenolol, metoprolol, or carvedilol), verapamil, difedipine, or
diltiazem. Treatment of hypertrophy
associated with high blood pressure may require the use of antihypertensive
drug therapy, using calcium channel
Mockers, e.g., diltiazem, nifedipine, verapamil, or nicardipine; p-adrenergic
blocking agents; diuretics, e.g.,
chlorothiazide, hydrochlorothiazide, hydroflumethazide, methylchlothiazide,
benzthiazide, dichlorphenamide,
acetazolamide, or indapamide; and/or ACE-inhibitors, e.g., quinapril,
captopril, enalapril, ramipril, benazepril,
fosinopril, or lisinopril.
For other indications, PRO polypeptides or their agonists or antagonists may
be combined with other
agents beneficial to the treatment of the bone and/or cartilage defect, wound,
or tissue in question. These agents
include various growth factors such as EGF, PDGF, TGF-a or TGF-(3, IGF, FGF,
and CTGF.
In addition, PRO polypeptides or their agouists or antagonists used to treat
cancer may be combined with
cytotoxic, chemotherapeutic, or growth-inhibitory agents as identified above.
Also, for cancer treatment, the PRO
polypeptide or agonist or antagonist thereof is suitably administered serially
or in combination with radiological
treatments, whether involving irradiation or administration of radioactive
substances.
The effective amounts of the therapeutic agents administered in combination
with the PRO polypeptide
or agonist or antagonist thereof will be at the physician's or veterinarian's
discretion. Dosage administration and
adjustment is done to achieve maximal management of the conditions to be
treated. For example, for treating
hypertension, these amounts ideally take into account use of diuretics or
digitalis, and conditions such as hyper- or
hypotension, renal impairment, etc. The dose will additionally depend on such
factors as the type of the therapeutic
agent to be used and the specific patient being treated. Typically, the amount
employed will be the same dose as
that used, if the given therapeutic agent is administered without the PRO
polypeptide.
110
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
5.2.4.13. Articles of Manufacture
An article of manufacture such as a kit containing the PRO polypeptide or
agonists or antagonists thereof
useful for the diagnosis or treatment of the disorders described above
comprises at least a container and a label.
Suitable containers include, for example, bottles, vials, syringes, and test
tubes. The containers may be formed from
a variety of materials such as glass or plastic. The container holds a
composition that is effective for diagnosing
or treating the condition and may have a sterile access port (for example, the
container may be an intravenous
solution bag or a vial having a stopper pierceable by a hypodermic injection
needle). The active agent in the
composition is the PRO polypeptide or an agonist or antagonist thereto. The
label on, or associated with, the
container indicates that the composition is used for diagnosing or treating
the condition of choice. The article of
manufacture may further comprise a second container comprising a
pharmaceutically-acceptable buffer, such as
phosphate-buffered saline, Ringer's solution, and dextrose solution. It may
further include other materials desirable
from a commercial and user standpoint, including other buffers, diluents,
filters, needles, syringes, and package
inserts with instructions for use. The article of manufacture may also
comprise a second or third container with
another active agent as described above.
5.2.5. Antibodies
Some of the mostpromising drug candidates according to the present invention
are antibodies and antibody
fragments that may inhibit the production or the gene product of the genes
identified herein and/or reduce the
activity of the gene products.
5.2.5.1. Polvclonal Antibodies
Methods of preparing polyclonal antibodies are known to the skilled artisan.
Polyclonal antibodies can
be raised in a mammal, for example, by one or more injections of an immunizing
agent and, if desired, an adjuvant.
Typically, the immunizing agent and/or adjuvant will be injected in the mammal
by multiple subcutaneous or
intraperitoneal injections. The immunizing agent may include the PRO
polypeptide or a fusion protein thereof.
It may be useful to conjugate the immunizing agent to a protein known to be
ixmnunogenic in the mammal being
immunized. Examples of such immunogenic proteins include, but are not limited
to, keyhole limpet hemocyanin,
serum albumin, bovine thyroglobulin, and soybean trypsin inhibitor. Examples
of adjuvants that may be employed
include Freund's complete adjuvant and MPL-TDM adjuvant (monophosphoryl Lipid
A or synthetic trehalose
dicorynomycolate). The immunization protocol may be selected by one skilled in
the art without undue
experimentation.
5.2.5.2. Monoclonal Antibodies
The anti-PRO antibodies may, alternatively, be monoclonal antibodies.
Monoclonal antibodies may be
prepared using hybridoma methods, such as those described by I~ohler and
Milstein, Nature, 256:495 (1975). In
a hybridoma method, a mouse, hamster, or other appropriate host animal is
typically immunized with an
111
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
immunizing agent to elicit lymphocytes that produce or are capable of
producing antibodies that will specifically
bind to the immunizing agent. Alternatively, the lymphocytes may be immunized
in vitro.
The immunizing agent will typically include the PRO polypeptide or a fusion
protein thereof. Generally,
either peripheral blood lymphocytes ("PBLs") are used if cells of human origin
are desired, or spleen cells or lymph
node cells are used if non-human mammalian sources are desired. The
lymphocytes are then fused with an
immortalized cell line using a suitable fusing agent, such as polyethylene
glycol, to form a hybridoma cell. Godiiig,
Monoclonal Antibodies: Principles and Practice (New York: Academic
Press,1986), pp. 59-103. Immortalized cell
lines are usually transformed mammalian cells, particularly myeloma cells of
rodent, bovine, and human origin.
Usually, rat or mouse myeloma cell lines are employed. The hybridoma cells may
be cultured in a suitable culture
medium that preferably contains one or more substances that inhibit the growth
or survival of the unfused,
immortalized cells. For example, if the parental cells lack the enzyme
hypoxanthine guanine phosphoribosyl
transferase (HGPRT or HPRT), the culture medium for the hybridomas typically
will include hypoxanthine,
aminopterin, and thymidine ("HAT medium"), which substances prevent the growth
of HGPRT-deficient cells.
Preferred immortalized cell lines are those that fuse efficiently, support
stable high-level expression of
antibody by the selected antibody-producing cells, and are sensitive to a
medium such as HAT medium. More
preferred immortalized cell lines are murine myeloma lines, which can be
obtained, for instance, from the Salk
Institute Cell Distribution Center, San Diego, California and the American
Type Culture Collection, Manassas,
Virginia. Humanmyelomaandmouse-
humanheteromyelomacelllinesalsohavebeendescribedfortheproduction
of human monoclonal antibodies. Kozbor, J. Immunol., 133:3001 (1984); Brodeur
et al., Monoclonal Antibody
Production Techniques and Applications (Marcel Dekker, Inc.: New York, 1987)
pp. 51-63.
The culture medium in which the hybridoma cells are cultured can then be
assayed for the presence of
monoclonal antibodies directed against the PRO polypeptide. Preferably, the
binding specificity of monoclonal
antibodies produced by the hybridoma cells is determined by
immunoprecipitation or by an i~z vitro binding assay,
such as radioimmunoassay (RIA) or enzyme-linked immunoabsorbent assay (ELISA).
Such techniques and assays
are known in the art. The binding affinity of the monoclonal antibody can, for
example, be determined by the
Scatchard analysis of Munson and Pollard, Anal. Biochem., 107:220 (1980).
After the desired hybridoma cells are identified, the clones may be subcloned
by limiting dilution
procedures and grown by standard methods. Goding, supra. Suitable culture
media for this purpose include, for
example, Dulbecco's Modified Eagle's Medium and RPMI-1640 medium.
Alternatively, the hybridoma cells may
be grown in vivo as ascites in a mammal.
The monoclonal antibodies secreted by the subclones may be isolated or
purified from the culture medium
or ascites fluid by conventional immunoglobulin purification procedures such
as, for example, protein A-Sepharose,
hydroxylapatite chromatography, gel electrophoresis, dialysis, or affinity
chromatography.
The monoclonal antibodies may also be made by recombinant DNA methods, such as
those described in
3 5 U.S. Patent No. 4,816,567. DNA encoding the monoclonal antibodies of the
invention can be readily isolated and
sequenced using conventional procedures (e.g., by using oligonucleotide probes
that are capable of binding
specifically to genes encoding the heavy and light chains of murine
antibodies). The hybridoma cells of the
112
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
invention serve as a preferred source of such DNA. Once isolated, the DNA may
be placed into expression vectors,
which are then transfected into host cells such as simian COS cells, Chinese
hamster ovary (CHO) cells, or myeloma
cells that do not otherwise produce immunoglobulin protein, to obtain the
synthesis of monoclonal antibodies in
the recombinant host cells. The DNA also may be modified, for example, by
substituting the coding sequence for
human heavy- and light-chain constant domains in place of the homologous
murine sequences (U.S. Patent No.
4,816,567; Morrison et al., supra) or by covalently joining to the
ixmnunoglobulin coding sequence all or part of
the coding sequence for a non-immunoglobulin polypeptide. Such a non-
immunoglobulin polypeptide can be
substituted for the constant domains of an antibody of the invention, or can
be substituted for the variable domains
of one antigen-combining site of an antibody of the invention to create a
chimeric bivalent antibody.
The antibodies may be monovalent antibodies. Methods for preparing monovalent
antibodies are well
known in the art. For example, one method involves recombinant expression of
immunoglobulin light chain and
modified heavy chain. The heavy chain is truncated generally at any point in
the Fc region so as to prevent heavy-
chain crosslinking. Alternatively, the relevant cysteine residues are
substituted with another amino acid residue or
are deleted so as to prevent crosslinking.
Izz vitro methods are also suitable for preparing monovalent antibodies.
Digestion ~of antibodies to produce
fragments thereof, particularly Fab fragments, can be accomplished using
routine techniques known in the art.
5.2.5.3. Human and Humanized Antibodies
The anti-PRO antibodies may further comprise humanized antibodies or human
antibodies. Humanized
forms ofnon-human (e.g., murine) antibodies are chimeric immunoglobulins,
immunoglobulin chains, or fragments
thereof (such as Fv, Fab, Fab', F(ab')Z, or other antigen-binding subsequences
of antibodies) that contain minimal
sequence derived from non-human immunoglobulin. Humanized antibodies include
human immunoglobulins
(recipient antibody) in which residues from a CDR of the recipient are
replaced by residues from a CDR of a non-
human species (donor antibody) such as mouse, rat, or rabbit having the
desired specificity, affinity, and capacity.
In some instances, Fv framework residues ofthe human immunoglobulin are
replaced by corresponding non-human
residues. Humanized antibodies may also comprise residues that are found
neither in the recipient antibody nor in
the imported CDR or framework sequences. In general, the humanized antibody
will comprise substantially all of
at least one, and typically two, variable domains, in which all or
substantially all of the CDR regions correspond
to those of a non-human immunoglobulin, and all or substantially all of the FR
regions are those of a human
immunoglobulin consensus sequence. The humanized antibody preferably also will
comprise at least a portion of
3 0 an immunoglobulin constant region (Fc), typically that of a human
iinmunoglobulin. Jones et al., Nature, 321: 522-
525 (1986); Riechxnann et al., Nature, 332: 323-329 (1988); Presta, Curr. Op.
Struct. Biol., 2:593-596 (1992).
Methods for humanizing non-human antibodies are well known in the art.
Generally, a humanized
antibody has one or more amino acid residues introduced into it from a source
that is non-human. These non-human
amino acid residues are often referred to as "import" residues, which are
typically taken from an "import" variable
domain. Humanization can be essentially performed following the method of
Winter and co-workers (Jones et al.,
Nature, 321: 522-525 (1986); Riechmann et al., Nature, 332: 323-327 (1988);
Verhoeyen etal., Science, 239: 1534-
113
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
1536 (1988)), by substituting rodent CDRs or CDR sequences for the
corresponding sequences of a human
antibody. Accordingly, such "humanized" antibodies are chimeric antibodies
(U.S. Patent No. 4,816,567), wherein
substantially less than an intact human variable domain has been substituted
by the corresponding sequence from
a non-human species. In practice, humanized antibodies are typically human
antibodies in which some CDR
residues and possibly some FR residues are substituted by residues from
analogous sites in rodent antibodies.
Human antibodies can also be produced using various techniques known in the
art, including phage display
libraries. Hoogenboom and Winter, J. Mol. Biol., 227: 381 (1991); Marks et
al., J. Mol. Biol., 222: 581 (1991).
The techniques of Cole et al. and Boerner et al. are also available for the
preparation of human monoclonal
antibodies. Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R.
Liss, p. 77 (1985) and Boerner et al.,
J. Immunol., 147 1 : 86-95 (1991). Similarly, human antibodies can be made by
introducing human
immunoglobulin loci into transgenic animals, e.g., mice in which the
endogenous immunoglobulin genes have been
partially or completely inactivated. Upon challenge, human antibody production
is observed that closely resembles
that seen in humans in all respects, including gene rearrangement, assembly,
and antibody repertoire. This approach
is described, for example, in U.S. Patent Nos. 5,545,807; 5,545,806;
5,569,825; 5,625,126; 5,633,425; and
5,661,016,andinthefollowingscientificpublications: Marks
etal.,Bio/Technolo~y,10:779-783 (1992);Lonberg
etal., Nature, 368: 856-859 (1994); Morrison,Nature, 368: 812-813 (1994);
Fishwildetal., NatureBiotechnoloev,
14: 845-851 (1996); Neuberger, Nature Biotechnolo~y, 14: 826 (1996); Lonberg
and Huszar, Intern. Rev.
Immunol., I3: 65-93 (1995).
5.2.5.4. Bispecific Antibodies
Bispecific antibodies are monoclonal, preferably human or humanized,
antibodies that have binding
specificities for at least two different antigens. In the present case, one of
the binding specificities is for the PRO
polypeptide, the other one is for any other antigen, and preferably for a cell-
surface protein or receptor or receptor
subunit.
Methods for making bispecific antibodies are known in the art. Traditionally,
the recombinant production
ofbispecific antibodies is based on the co-expression of two immunoglobulin
heavy-chain/light-chainpairs, where
the two heavy chains have different specificities. Milstein and Cuello,
Nature, 305: 537-539 (1983). Because of
the random assortment of immunoglobulin heavy and light chains, these
hybridomas (quadromas) produce a
potential mixture of ten different antibody molecules, of which only one has
the correct bispecific structure. The
purification of the correct molecule is usually accomplished by affinity
chromatography steps. Similarprocedures
are disclosed in WO 93108829, published 13 May 1993, and in Traunecker et al.,
EMBO J., 10: 3655-3659 (I99I).
Antibody variable domains with the desired binding specificities (antibody-
antigen combining sites) can
be fused to immunoglobulin constant-domain sequences. The fusion preferably is
with an immunoglobulin heavy-
chain constant domain, comprising at least part of the hinge, CH2, and CH3
regions. It is preferred to have the first
heavy-chain constant region (CHl) containing the site necessary for light-
chain binding present in at least one of
the fusions. DNAs encoding the iinmunoglobulin heavy-chain fusions and, if
desired, the immunoglobulin light
chain, are inserted into separate expression vectors, and are co-transfected
into a suitable host organism. For further
114
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
details of generating bispecific antibodies, see, for example, Suresh et al.,
Methods in E molo y, 121: 210
(1986).
5.2.5.5. Heteroconiugate Antibodies
Heteroconjugate antibodies are composed of two covalently joined antibodies.
Such antibodies have, for
example, been proposed to target immune-system cells to unwanted cells (U.S.
Patent No. 4,676,980), and for
treatment of HIV infection. WO 91/00360; WO 92/200373; EP 03089. It is
contemplated that the antibodies may
be prepared iu vitr°o using known methods in synthetic protein
chemistry, including those involving crosslinking
agents. For example, immunotoxins may be constructed using a disulfide-
exchange reaction or by forming a
thioether bond. Examples of suitable reagents for this purpose include
iminothiolate and methyl-4-
mercaptobutyrimidate and those disclosed, for example, in U.S. Patent No.
4,676,980.
5.2.5.6. Effector Function Eneineerin~
It may be desirable to modify the antibody of the invention with respect to
effector function, so as to
enhance, e.g., the effectiveness of the antibody in treating cancer. For
example, cysteine residues) may be
introduced into the Fc region, thereby allowing interchain disulfide bond
formation in this region. The
homodimeric antibody thus generated may have improved internalization
capability and/or increased complement-
mediated cell killing and antibody-dependent cellular cytotoxicity (ADCC).
See, Caron et al., J. Exp. Med., 176:
1191-1195 (1992) and Shopes, J. Immunol.,148: 2918-2922 (1992). Homodimeric
antibodies with enhanced anti-
tumor activity may also be prepared using heterobifunctional cross-linkers as
described in Wolff et al., Cancer
Research, 53: 2560-2565 (1993). Alternatively, an antibody can be engineered
that has dual Fc regions and may
thereby have enhanced complement lysis and ADCC capabilities. See, Stevenson
et al., Anti-Cancer Drug Design,
3: 219-230 (1989).
5.2.5.7. Immunoconiugates
The invention also pertains to immunoconjugates comprising an antibody
conjugated to a cytotoxic agent
such as a chemotherapeutic agent, toxin (e.g., an enzymatically active toxin
of bacterial, fungal, plant, or animal
origin, or fragments thereof), or a radioactive isotope (i.e., a
radioconjugate).
Chemotherapeutic agents useful in the generation of such immunoconjugates have
been described above.
Enzymatically active toxins and fragments thereof that can be used include
diphtheria A chain, nonbinding active
fragments of diphtheria toxin, exotoxili A chain (from Pseudomonas
aet°uginosa), ricin A chain, abrin A chain,
modeccin A chain, alpha-sarcin, Aleurites fordii proteins, dianthin proteins,
Playtolaca americafZa proteins (PAPI,
PAPII, and PAP-S), momordica charantia inhibitor, curcin, crotin, sapaonaria
officinalis inhibitor, gelonin,
mitogellin, restrictocin, phenomycin, enomycin, and the tricothecenes. A
variety ofradionuclides are available for
the production of radioconjugated antibodies. Examples include
2'ZBi,'3'I,'3'In, 9°Y, and'86Re.
Conjugates of the antibody and cytotoxic agent are made using a variety of
bifunctional protein-coupling
agents such as N-succinimidyl-3-(2-pyridyldithiol) propionate (SPDP),
iminothiolane (IT), bifunctional derivatives
115
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
of imidoesters (such as dimethyl adipimidate HCl), active esters (such as
disuccinimidyl suberate), aldehydes (such
as glutaraldehyde), bis-azido compounds (such as bis (p-azidobenzoyl)
hexanediamine), bis-diazonium derivatives
(such as bis-(p-diazoniumbenzoyl)-ethylenediamine), diisocyanates (such as
tolyene 2,6-diisocyanate), and bis-
active fluorine compounds (such as 1,5-difluoro-2,4-dinitrobenzene). For
example, a ricin immunotoxin can be
prepared as described in Vitetta et al., Science, 238: 1098 (1987). Carbon-14-
labeled 1-isothiocyanatobenzyl-3-
methyldiethylene triaminepentaacetic acid (MX-DTPA) is an exemplary chelating
agent for conjugation of
radionucleotide to the antibody. See, W094/11026.
In another embodiment, the antibody may be conjugated to a "receptor" (such as
streptavidin) for
utilization in tumor pretargeting wherein the antibody-receptor conjugate is
administered to the patient, followed
by removal of unbound conjugate from the circulation using a clearing agent
and then administration of a "ligand"
(e.g., avidin) that is conjugated to a cytotoxic agent (e.g., a
radionucleotide).
5.2.5.8. Immunoli~osomes
The antibodies disclosed herein may also be formulated as immunoliposomes.
Liposomes containing the
antibody are prepared by methods known in the art, such as described in
Epstein et al., Proc. Natl. Acad. Sci. USA,
82: 3688 (1985); Hwang et al., Proc. Natl. Acad. Sci. USA, 77: 4030 (1980);
and U.S. Pat. Nos. 4,485,045 and
4,544,545. Liposomes with enhanced circulation time are disclosed in U.S.
Patent No. 5,013,556.
Particularly useful liposomes can be generated by the reverse-phase
evaporation method with a lipid
composition comprising phosphatidylcholine, cholesterol, and PEG-derivatized
phosphatidylethanolamine (PEG-
PE). Liposomes are extruded through filters of defined pore size to yield
liposomes with the desired diameter. Fab'
2,0 fragments of the antibody of the present invention can be conjugated to
the liposomes as described in Martin et al.,
J. Biol. Chem., 257: 286-288 (1982) via a disulfide-interchange reaction. A
chemotherapeutic agent (such as
Doxorubicin) is optionally contained within the liposome. See, Gabizon et al.,
J. National Cancer Inst., 81 19
1484 (1989).
5.2.5.9. Pharmaceutical Compositions of Antibodies
Antibodies specifically binding a PRO polypeptide identified herein, as well
as other molecules identified
by the screening assays disclosed hereinbefore, can be administered for the
treatment of various disorders as noted
above and below in the form of pharmaceutical compositions.
Ifthe PRO polypeptide is intracellular and whole antibodies are used as
inhibitors, internalizing antibodies
are preferred. However, lipofections or liposomes can also be used to deliver
the antibody, or an antibody fragment,
3 0 into cells. Where antibody fragments are used, the smallest inhibitory
fragment that specifically binds to the binding
domain of the target protein is preferred. For example, based upon the
variable-region sequences of an antibody,
peptide molecules can be designed that retain the ability to bind the target
protein sequence. Such peptides can be
synthesized chemically and/or produced by recombinant DNA technology. See,
e.g., Marasco et al., Proc. Natl.
Acad. Sci. USA, 90: 7889-7893 (1993).
116
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
The formulation herein may also contain more than one active compound as
necessary for the particular
indication being treated, preferably those with complementary activities that
do not adversely affect each other.
Alternatively, or in addition, the composition may comprise an agent that
enhances its function, such as, for
example, a cytotoxic agent, cytokine, chemotherapeutic agent, or growth-
inhibitory agent. Such molecules are
suitably present in combination in amounts that are effective for the purpose
intended.
The active ingredients may also be entrapped in microcapsules prepared, for
example, by coacervation
techniques or by interfacial polymerization, for example,
hydroxymethylcellulose or gelatin-microcapsules and
poly-(methylinethacylate) microcapsules, respectively, in colloidal drug
delivery systems (for example, liposomes,
albuminmicrospheres,microemulsions,nano-
particles,andnanocapsules)orinmacroemulsions. Such techniques
are disclosed in Remiiigton's Pharmaceutical Sciences, supra.
The formulations to be used for in vivo administration must be sterile. This
is readily accomplished by
filtration through sterile filtration membranes.
Sustained-release preparations may be prepared. Suitable examples of sustained-
release preparations
include semipermeable matrices of solid hydrophobic polymers containing the
antibody, which matrices are in the
form of shaped articles, e.g., films, or microcapsules. Examples of sustained-
release matrices include polyesters,
hydrogels (for example, poly(2-hydroxyethyl-methacrylate), or
poly(vinylalcohol)), polylactides (U.S. Pat. No.
3,773,919), copolymers of L-glutamic acid and y ethyl-L-glutamate, non-
degradable ethylene-vinyl acetate,
degradable lactic acid-glycolic acid copolymers such as the LUPRON DEPOT TM
(injectable microspheres
composed of lactic acid-glycolic acid copolymer and leuprolide acetate), and
poly-D-(-)-3-hydroxybutyric acid.
While polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid
enable release of molecules for over
100 days, certain hydrogels release proteins for shorter time periods. When
encapsulated antibodies remain in the
body for a long time, they may denature or aggregate as a result of exposure
to moisture at 37°C, resulting in a loss
of biological activity and possible changes in immunogenicity. Rational
strategies can be devised for stabilization
depending on the mechanism involved. For example, if the aggregation mechanism
is discovered to be
intermolecular S-S bond formation through thio-disulfide interchange,
stabilization may be achieved by modifying
sulfhydryl residues, lyophilizing from acidic solutions, controlling moisture
content, using appropriate additives,
and developing specific polymer matrix compositions.
5.2.5.10. Methods of Treatment using the Antibody
It is contemplated that the antibodies to a PRO polypeptide may be used to
treat various cardiovascular,
endothelial, and angiogenic conditions as noted above.
The antibodies are administered to a mammal, preferably a human, in accord
with known methods, such
as intravenous administration as a bolus or by continuous infusion over a
period of time, by intramuscular,
intraperitoneal, intracerobrospinal, subcutaneous, infra-articular,
intrasynovial, intrathecal, oral, topical, or
inhalation routes. Intravenous administration of the antibody is preferred.
Other therapeutic regimens may be combined with the administration of the
antibodies of the instant
invention as noted above. For example, if the antibodies are to treat cancer,
the patient to be treated with such
117
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
antibodies may also receive radiation therapy. Alternatively, or in addition,
a chemotherapeutic agent may be
administered to the patient. Preparation and dosing schedules for such
chemotherapeutic agents may be used
according to manufacturers' instructions or as determined empirically by the
skilled practitioner. Preparation and
dosing schedules for such chemotherapy are also described in Chemotherapy
Service, Ed., M.C. Perry (Williams
& Willcins: Baltimore, MD, 1992). The chemotherapeutic agent may precede, or
follow administration of the
antibody, or may be given simultaneously therewith. The antibody may be
combined with an anti-estrogen
compound such as tamoxifen or EVISTA~M or an anti-progesterone such as
onapristone (see, EP 616812) in dosages
known for such molecules.
If the antibodies are used for treating cancer, it may be desirable also to
administer antibodies against other
tumor-associated antigens, such as antibodies that bind to one or more of the
ErbB2, EGFR, ErbB3, ErbB4, or
VEGF receptor(s). These also include the agents set forth above. Also, the
antibody is suitably administered
serially or in combination with radiological treatments, whether involving
irradiation or administration of
radioactive substances. Alternatively, or in addition, two or more antibodies
binding the same or two or more
different antigens disclosed herein may be co-administered to the patient.
Sometimes, it may be beneficial also to
administer one or more cytokines to the patient. In a preferred embodiment,
the antibodies herein are co-
administered with a growth-inhibitory agent. For example, the growth-
inhibitory agent may be administered first,
followed by an antibody of the present invention. However, simultaneous
administration or administration of the
antibody of the present invention first is also contemplated. Suitable dosages
for the growth-inhibitory agent are
those presently used and may be lowered due to the combined action (synergy)
of the growth-inhibitory agent and
the antibody herein.
In one embodiment, vascularization of tumors is attacked in combination
therapy. The anti-PRO
polypeptide antibody and another antibody (e.g., anti-VEGF) are administered
to tumor-bearing patients at
therapeutically effective doses as determined, for example, by observing
necrosis of the tumor or its metastatic foci,
if any. This therapy is continued until such time as no further beneficial
effect is observed or clinical examination
shows no trace of the tumor or any metastatic foci. Then TNF is administered,
alone or in combination with an
auxiliary agent such as alpha-, beta-, or gamma-interferon, anti-HER2
antibody, heregulin, anti-heregulin antibody,
D-factor, interleukin-1 (IL-1), interleukin-2 (IIr2), granulocyte-macrophage
colony stimulating factor (GM-CSF),
or agents that promote microvascular coagulation in tumors, such as anti-
protein C antibody, anti-protein S
antibody, or C4b binding protein (see, WO 91/01753, published 21 February
1991), or heat or radiation.
Since the auxiliary agents will vary in their effectiveness, it is desirable
to compare their impact on the
tumor by matrix screening in conventional fashion. The administration of anti-
PRO polypeptide antibody and TNF
is repeated until the desired clinical effect is achieved. Alternatively, the
anti-PRO polypeptide antibody is
administered together with TNF and, optionally, auxiliary agent(s). In
instances where solid tumors are found in
the limbs or in other locations susceptible to isolation from the general
circulation, the therapeutic agents described
herein are administered to the isolated tumor or organ. In other embodiments,
a FGF or PDGF antagonist, such as
an anti-FGF or an anti-PDGF neutralizing antibody, is administered to the
patient in conjunction with the anti-PRO
118
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
polypeptide antibody. Treatment with anti-PRO polypeptide antibodies
preferably may be suspended during
periods of wound healing or desirable neovascularization.
For the prevention or treatment of cardiovascular, endothelial, and angiogenic
disorder, the appropriate
dosage of an antibody herein will depend on the type of disorder to be
treated, as defined above, the severity and
course ofthe disease, whether the antibody is administered for preventive or
therapeutic purposes, previous therapy,
the patient's clinical history and response to the antibody, and the
discretion of the attending physician. The
antibody is suitably administered to the patient at one time or over a series
of treatments.
For example, depending on the type and severity of the disorder, about 1
~,g/kg to 50 mg/kg (e.g., 0.1-20
mg/kg) of antibody is an initial candidate dosage for administration to the
patient, whether, for example, by one or
more separate administrations, or by continuous infusion. A typical daily or
weekly dosage might range from about
1 ~g/kg to 100 mg/kg or more, depending on the factors mentioned above. For
repeated administrations over
several days or longer, depending on the condition, the treatment is repeated
or sustained until a desired suppression
of disorder symptoms occurs. However, other dosage regimens may be useful. The
progress of this therapy is
easily monitored by conventional techniques and assays, including, for
example, radiographic tumor imaging.
5.2.5.11. Articles of Manufacture with Antibodies
An article of manufacture containing a container with the antibody and a label
is also provided. Such
articles are described above, wherein the active agent is an anti-PRO
antibody.
5.2.5.12. Diagnosis and Prognosis of Tumors using Antibodies
If the indication for which the antibodies are used is cancer, while cell-
surface proteins, such as growth
receptors over expressed in certain tumors, are excellent targets for drug
candidates or tumor (e.g., cancer)
treatment, the same proteins along with PRO polypeptides find additional use
in the diagnosis and prognosis of
tumors. For example, antibodies directed against the PRO polypeptides may be
used as tumor diagnostics or
prognostics.
For example, antibodies, including antibody fragments, can be used
qualitatively or quantitatively to detect
the expression of genes including the gene encoding the PRO polypeptide. The
antibody preferably is equipped
with a detectable, e.g., fluorescent label, and binding can be monitored by
light microscopy, flow cytometry,
fluorimetry, or other techniques known in the art. Such binding assays are
performed essentially as described
above.
In situ detection of antibody binding to the marker gene products can be
performed, for example, by
immunofluorescence or immunoelectron microscopy. For this purpose, a
histological specimen is removed from
the patient, and a labeled antibody is applied to it, preferably by overlaying
the antibody on a biological sample.
This procedure also allows for determining the distribution of the marker gene
product in the tissue examined. It
will be apparent to those skilled in the art that a wide variety of
histological methods are readily available for ira situ
detection.
119
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
The following Examples are offered for illustrative purposes only, and are not
intended to limit the scope
of the present invention in any way.
The disclosures of all patent and literature references cited in the present
specification are hereby
incorporated by reference iii their entirety.
6. EXAMPLES
Commercially available reagents referred to in the Examples were used
according to manufacturer's
instructions unless otherwise indicated. The source of those cells identified
in the following Examples, and
throughoutthe specification, by ATCC accessionnumbers is theAmerican Type
Culture Collection, Manassas, VA.
Unless otherwise noted, the present invention uses standard procedures of
recombinant DNA technology, such as
those described hereinabove and in the following textbooks: Sambrook et al.,
supra; Ausubel et al., Current
Protocols in Molecular Biolo ey (Green Publishing Associates and Wiley
Interscience, N.Y.,1989); Innis et al., PCR
Protocols: A Guide to Methods and Applications (Academic Press, Inc.: N.Y.,
1990); Harlow et al., Antibodies:
A Laboratory Manual (Cold Spring HarborPress: Cold Spring Harbor,1988); Gait,
Oli~onucleotide Synthesis (IRL
Press: Oxford,1984); Fresliney, Animal Cell Culture,1987; Coligan et al.,
Current Protocols in Immunoloey,1991.
6.1. EXAMPLE1:
ExtracellularDomainHomoloayScreenin~toIdentifvNovelPolyueptidesand
cDNA Encodins Therefor
The extracellular domain (ECD) sequences (including the secretion signal
sequence, if any) from about
950 known secreted proteins from the Swiss-Prot public database were used to
search EST databases. The EST
databases included public databases (e.g., Dayhoff, GenBank), and proprietary
databases (e.g. LIFESEQ~', Incyte
Pharmaceuticals, Palo Alto, CA). The search was performed using the computer
program BLAST or BLAST-2
(Altschul et al., Methods in Enzvmoloey, 266:460-480 (1996)) as a comparison
of the ECD protein sequences to
a 6 frame translation of the EST sequences. Those comparisons with a BLAST
score of 70 (or in some cases, 90)
or greater that did not encode known proteins were clustered and assembled
into consensus DNA sequences with
the program "phrap" (Phil Green, University of Washington, Seattle, WA).
Using this extracellular domain homology screen, consensus DNA sequences were
assembled relative to
the other identified EST sequences using phrap. In addition, the consensus DNA
sequences obtained were often
(but not always) extended using repeated cycles of BLAST or BLAST-2 and plirap
to extend the consensus
sequence as far as possible using the sources of EST sequences discussed
above.
Based upon the consensus sequences obtained as described above,
oligonucleotides were then synthesized
3 0 and used to identify by PCR a cDNA library that contained the sequence of
interest and for use as probes to isolate
a clone of the full-length coding sequence for a PRO polypeptide. Forward and
reverse PCR primers generally
range from 20 to 30 nucleotides and are often designed to give a PCR product
of about 100-1000 by in length. The
probe sequences are typically 40-55 by in length. In some cases, additional
oligonucleotides are synthesized when
the consensus sequence is greater than about 1-1.5 kbp. In order to screen
several libraries for a full-length clone,
3 5 DNA from the libraries was screened by PCR amplification, as per Ausubel
et al., Current Protocols in Molecular
120
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
Biology, with the PCR primer pair. A positive library was then used to isolate
clones encoding the gene of interest
using the probe oligonucleotide and one of the primer pairs.
The cDNA libraries used to isolate the cDNA clones were constructed by
standard methods using
commercially available reagents such as those from Invitrogen, San Diego, CA.
The cDNA was primed with oligo
dT containing a NotI site, linked with blunt to SaII hemikinased adaptors,
cleaved with NotI, sized appropriately
by gel electrophoresis, and cloned in a defined orientation into a suitable
cloning vector (such as pRKB or pRI~D;
pRKSB is a precursor of pRI~SD that does not contain the SfiI site; see,
Holmes et al., Science, 253:1278-1280
(1991)) in the unique XhoI and NotI sites.
6.2. EXAMPLE 2: Isolation of cDNA Clones by Amylase Screening
6.2.1. Preparation of oligo dT primed cDNA library
mRNA was isolated from a human tissue of interest using reagents and protocols
from Invitrogen, San
Diego, CA (Fast Track 2). This RNA was used to generate an oligo dT primed
cDNA library in the vector pRKSD
using reagents and protocols from Life Technologies, Gaithersburg, MD (Super
Script Plasmid System). In this
procedure, the double stranded cDNA was sized to greater than 1000 by and the
SaII/NotI tinkered cDNA was
cloned into XhoI/NotI cleaved vector. pRKSD is a cloning vector that has an
sp6 transcription initiation site
followed by an SfiI restriction enzyme site preceding the XhoI/NotI cDNA
cloning sites.
6.2.2. Preparation of random primed cDNA library
A secondary cDNA library was generated in order to preferentially represent
the 5' ends of the primary
cDNA clones. Sp6 RNA was generated from the primary library (described above),
and this RNA was used to
generate a random primed cDNA library in the vector pSST-AMY.O using reagents
and protocols from Life
Technologies (Super Script Plasmid System, referenced above). In this
procedure the double stranded cDNA was
sized to 500-1000 bp, tinkered with blunt to NotI adaptors, cleaved with SfiI,
and cloned into SfiI/NotI cleaved
vector. pSST-AMY.O is a cloning vector that has a yeast alcohol dehydrogenase
promoter preceding the cDNA
cloning sites and the mouse amylase sequence (the mature sequence without the
secretion signal) followed by the
yeast alcohol dehydrogenase terminator, after the cloning sites. Thus, cDNAs
cloned into this vector that are fused
in frame with amylase sequence will lead to the secretion of amylase from
appropriately transfected yeast colonies.
6.2.3. Transformation and Detection
DNA from the library described in paragraph 2 above was chilled on ice to
which was added
electrocompetent DH10B bacteria (Life Technologies, 20 ml). The bacteria and
vector mixture was then
electroporated as recommended by the manufacturer. Subsequently, SOC media
(Life Technologies, 1 ml) was
added and the mixture was incubated at 37°C for 30 minutes. The
transformants were then plated onto 20 standard
150 mm LB plates containing ampicillin and incubated for 16 hours
(37°C). Positive colonies were scraped off the
plates and
theDNAwasisolatedfromthebacterialpelletusingstandardprotocols,e.g.,CsCl-
gradient. The purified
DNA was then carried on to the yeast protocols below.
121
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
The yeast methods were divided into three categories: (1) Transformation of
yeast with the plasmid/cDNA
combined vector; (2) Detection and isolation of yeast clones secreting
amylase; and (3) PCR amplification of the
insert directly from the yeast colony and purification of the DNA for
sequencing and further analysis.
The yeast strain used was HD56-SA (ATCC-90785). This strain has the following
genotype: MAT alpha,
ura3-52, leu2-3, leu2-112, his3-11, his3-15, MAL+, SUC+, GAL+. Preferably,
yeast mutants can be employed that
have deficient post-translational pathways. Such mutants may have
translocation deficient alleles in sec7l, sec72,
sec62, with truncated sec71 being most preferred. Alternatively, antagonists
(including antisense nucleotides
and/or ligands) which interfere with the normal operation of these genes,
other proteins implicated in this post
translation pathway (e.g., SEC6lp, SEC72p, SEC62p, SEC63p, TDJlp or SSAlp-4p)
or the complex formation
of these proteins may also be preferably employed in combination with the
amylase-expressing yeast.
Transformation was performed based on the protocol outlined by Gietz et al.,
Nucl. Acid. Res., 20:1425
(1992). Transformed cells were then inoculated from agar into YEPD complex
media broth (100 ml) and grown
overnight at 30°C. The YEPD broth was prepared as described in Kaiser
et al., Methods in Yeast Genetics, Cold
Spring Harbor Press, Cold Spring Harbor, NY, p. 207 (1994). The overnight
culture was then diluted to about 2
x 106 cells/ml (approx. OD6oo 0.1) into fresh YEPD broth (500 ml) and regrown
to 1 x 10' cells/ml (approx.
OD6oo 0.4-0.5).
The cells were then harvested and prepared for transformation by transfer into
GS3 rotor bottles in a Sorval
GS3 rotor at 5,000 rpm for 5 minutes, the supernatant discarded, and then
resuspended into sterile water, and
centrifuged again in 50 ml falcon tubes at 3,500 rpm in a Beckman GS-6KR
centrifuge. The supernatant was
discarded and the cells were subsequently washed with LiAc/TE (10 ml, 10 mM
Tris-HCl, 1 mM EDTA pH 7.5,
100 mM Li200CCH3), and resuspended into LiAc/TE (2.5 ml).
Transformation took place by mixing the prepared cells (100 ~,1) with freshly
denatured single stranded
salinon testes DNA (Lofstrand Labs, Gaithersburg, MD) and transforming DNA (1
~,g, vol. < 10 w1) in microfuge
tubes. The mixture was mixed briefly by vortexing, then 40% PEG/TE (600 ~1,
40% polyethylene glycol-4000,
10 mM Tris-HCI, 1 xnM EDTA, 100 mM Li200CCH3, pH 7.5) was added. This mixture
was gently mixed and
incubated at 30°C while agitating for 30 minutes. The cells were then
heat shocked at 42°C for 15 minutes, and
the reaction vessel centrifuged in a microfuge at 12,000 rpm for 5-10 seconds,
decanted and resuspended into TE
(500 ~,1, 10 xnM Tris-HCl, 1 mM EDTA pH 7.5) followed by recentrifugation. The
cells were then diluted into TE
(1 ml) and aliquots (200 ~.1) were spread onto the selective media previously
prepared in 150 mm growth plates
(wvR).
Alternatively, instead of multiple small reactions, the transformation was
performed using a single, large
scale reaction, wherein reagent amounts were scaled up accordingly.
The selective media used was a synthetic complete dextrose agar lacking uracil
(SCD-Ura) prepared as
described in Kaiser et al., Methods in Yeast Genetics, Cold Spring Harbor
Press, Cold Spring Harbor, NY, p. 208-
210 (1994). Transformants were grown at 30°C for 2-3 days.
The detection of colonies secreting amylase was performed by including red
starch in the selective growth
media. Starch was coupled to the red dye (Reactive Red-120, Sigma) as per the
procedure described by Biely et
122
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
al., Anal. Bioohem., 172:176-179 (1988). The coupled starch was incorporated
into the SCD-Ura agar plates at a
final concentration of 0.15% (w/v), and was buffered with potassium phosphate
to a pH of 7.0 (50-100 mM final
concentration).
The positive colonies were picked and streaked across fresh selective media
(onto 150 mm plates) in order
to obtain well isolated and identifiable single colonies. Well isolated single
colonies positive for amylase secretion
were detected by direct incorporation of red starch into buffered SCD-Ura
agar. Positive colonies were determined
by their ability to break down starch resulting in a clear halo around the
positive colony visualized directly.
6.2.4. Isolation of DNA by PCR Amplification
When a positive colony was isolated, a portion of it was picked by a toothpick
and diluted into sterile water
(30 ~,1) in a 96 well plate. At this time, the positive colonies were either
frozen and stored for subsequent analysis
or immediately amplified. An aliquot of cells (5 ~,1) was used as a template
for the PCR reaction in a 25 ~.l volume
containing: 0.5 ~.1 Klentaq (Clontech, Palo Alto, CA); 4.0 ~.l 10 mM dNTP's
(Perkin Eliner-Cetus); 2.5 ~,l Kentaq
buffer (Clontech); 0.25 ~.1 forward oligo 1; 0.25 ~1 reverse oligo 2; 12.5 ~,1
distilled water. The sequence of the
forward oligonucleotide 1 was:
5'-TGTAAAACGACGGCCAGTTAAATAGACCTGCAATTATTAATCT-3' (SEQ ID N0:382)
The sequence of reverse oligonucleotide 2 was:
5'-CAGGAAACAGCTATGACCACCTGCACACCTGCAAATCCATT-3' (SEQ ID N0:383)
PCR was then performed as follows:
a. Denature 92°C, 5 minutes
b. 3 cycles of Denature 92°C, 30 seconds
Anneal 59°C, 30 seconds
Extend 72°C, 60 seconds
c. 3 cycles of Denature 92°C, 30 seconds
Anneal 57°C, 30 seconds
Extend 72°C, 60 seconds
d. 25 cycles of .Denature 92°C, 30 seconds
Anneal 55°C, 30 seconds
Extend 72°C, 60 seconds
e. Hold 4°C
The underlined regions of the oligonucleotides annealed to the ADH promoter
region and the amylase
region, respectively, and amplified a 307 by region from vector pSST-AMY.O
when no insert was present.
Typically, the Erst 18 nucleotides of the 5' end of these oligonucleotides
contained annealing sites for the
sequencing primers. Thus, the total product of the PCR reaction from an empty
vector was 343 bp. However,
signal sequence-fused cDNA resulted in considerably longer nucleotide
sequences.
123
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
Following the PCR, an aliquot of the reaction (5 ~,1) was examined by agarose
gel electrophoresis in a 1%
agarose gel using a Tris-Borate-EDTA (TBE) buffering system as described by
Sambrook et al., supra. Clones
resulting in a single strong PCR product larger than 400 by were further
analyzed by DNA sequencing after
purification with a 96 Qiaquick PCR clean-up column (Qiagen Inc., Chatsworth,
CA).
6.3. EXAMPLE 3: Isolation of cDNA Clones Usine Si na~~orithm Analysis
Various polypeptide-encoding nucleic acid sequences were identified by
applying a proprietary signal
sequence fording algorithm developed by Genentech, Inc., (South San Francisco,
CA) upon ESTs as well as
clustered and assembled EST fragments from public (e.g., GenBank) and/or
private (LIFESEQ~, Incyte
Pharmaceuticals, Inc., Palo Alto, CA) databases. The signal sequence algorithm
computes a secretion signal score
based on the character of the DNA nucleotides surrounding the first and
optionally the second methionine codon(s)
(ATG) at the 5'-end of the sequence or sequence fragment under consideration.
The nucleotides following the first
ATG must code for at least 35 unambiguous amino acids without any stop codons.
If the first ATG has the required
amino acids, the second is not examined. If neither meets the requirement, the
candidate sequence is not scored.
In order to determine whether the EST sequence contains an authentic signal
sequence, the DNA and corresponding
amino acid sequences surrounding the ATG codon are scored using a set of seven
sensors (evaluation parameters)
known to be associated with secretion signals. Use of this algorithm resulted
in the identification of numerous
polypeptide-encoding nucleic acid sequences.
6.4. EXAMPLE 4: Isolation of cDNA clones Encoding Human PRO Polyp~tides
Using the techniques described in Examples 1 to 3 above, numerous full-length
cDNA clones were
identified as encoding PRO polypeptides as disclosed herein. These cDNAs were
then deposited under the terms
of the Budapest Treaty with the American Type Culture Collection, 10801
University Blvd., Manassas, VA
20110-2209, USA (ATCC) as shown in Table 7 below.
Table 7
Material ATCC Dep. No. Deposit Date
23330-1390 209775 4/14/1998
23339-1130 209282 9/18/1997
26846-1397 203406 10/27/1998
26847-1395 209772 4/1411998
27865-1091 209296 9/23/1997
30868-1156 1437-PTA 3/2/2000
30871-1157 209380 10/16/1997
32286-1191 209385 10/16/1997
33089-1132 209262
9/16/1997
33092-1202 209420
10/28/1997
124
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
33100-1159 209377 10/16/1997
33223-1136 209264 9/16!1997
34392-1170 209526 12/10/1997
34431-1177 209399 10/17/1997
34433-1308 209719 3/31/1998
34434-1139 209252 9/16/1997
35600-1162 209370 10/1611997
35673-1201 209418 10/28/1997
35880-1160 209379 10/16/1997
35918-1174 209402 10/17/1997
36350-1158 209378 10/16/1997
36638-1056 209456 11/12/1997
38268-1188 209421 10/28!1997
40370-1217 209485 11/21/1997
40628-1216 209432 11/7!1997
43316-1237 209487 11/21/1997
44196-1353 209847 5/6/1998
45409-2511 203579 1/12/1999
45419-1252 209616 2!5/1998
46777-1253 209619 2/5/1998
48336-1309 209669 3/11/1998
48606-1479 203040 7/1/1998
49435-1219 209480 11/21/1997
49631-1328 209806 4/28/1998
50919-1361 209848 5/6/1998
50920-1325 209700 3/26/1998
50921-1458 209859 5/12/1998
52758-1399 . 209773 4/14/1998
53517-1366-1 209802 4/23/1998
53915-1258 209593 1/21/1998
53974-1401 209774 4/14/1998
53987-1438 209858 5/12/1998
56047-1456 209948 6/9/1998
56050-1455 203011 '6/23/1998
56110-1437 203113 8/11/1998
56405-1357 209849 5/6/1998
56433-1406 209857 5/12/1998
125
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
56439-1376 209864 5/14/1998
56529-1647 203293 9129/1998
56865-1491 203022 6/23/1998
56965-1356 209842 5/6/1998
57033-1403-1 209905 5/27/1998
57037-1444 209903 5127/1998
57039-1402 209777 4/1411998
57689-1385 209869 5/14/1998
57690-1374 209950 6/9/1998
57694-1341 203017 6/23/1998
57695-1340 203006 . 6/23/1998
57699-1412 203020 6/23/1998
57700-1408 203583 1/12/1999
57708-1411 203021 6/23/1998
57838-1337 203014 6/23/1998
58847-1383 209879 5/20/1998
58852-1637 203271 9/22/1998
58853-1423 203016 6/23/1998
59212-1627 203245 9/9/1998
59220-1514 209962 6/911998
59493-1420 203050 7/1/1998
59497-1496 209941 6/411998
59586-1520 203288 9/29/1998
59588-1571 203106 8/11/1998
59620-1463 209989 6/16/1998
59622-1334 209984 6/16/1998
59777-1480 203111 8/11/1998
59848-1512 203088 8/4/1998
59849-1504 209986 6/16/1998
3 60621-1516 203091 8/4/1998
0
60622-1525 203090 ~ 8!4/1998
60764-1533 203452 11/10/1998
60783-1611 203130 8/18/1998
61755-1554 203112 8/11/1998
62306-1570 203254 9/9/1998
62312-2558 203836 3/9/1999
62814-1521 203093 8/4/1998
126
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
62872-1509 203100 8/4/1998
64883-1526 203253 9/9/1998
64886-1601 203241 9/9/1998
64889-1541 203250 9/9/1998
64896-1539 203238 9/9/1998
64897-1628 203216 9/15/1998
64903-1553 203223 9/15/1998
64908-1163-1 203243 9/9/1998
64950-1590 203224 9115/1998
65402-1540 203252 9/9/1998
65404-1551 203244 9/9/1998
65405-1547 203476 11/17/1998
65410-1569 203231 9/15/1998
65412-1523 203094 8/4/1998
66307-2661 431-PTA 7/27/1999
66526-1616 203246 9/9/1998
66659-1593 203269 9/22/1998
66660-1585 203279 9/22/1998
66667-1596 203267 9/22/1998
66672-1586 203265 9/22/1998
66675-1587 203282 9/22/1998
67300-1605 203163 8/25/1998
68818-2536 203657 2!9/1999
68862-2546 203652 2/9/1999
68872-1620 203160 8/2511998
71290-1630 203275 9/22/1998
73736-1657 203466 11/17/1998
73739-1645 203270 9/22/1998
73742-1662 203316 10/6/1998
3 76385-1692 203664 2/9/1999
0
76393-1664 203323 10/6/1998
76399-1700 203472 11/17/1998
76400-2528 203573 1/12/1999
76510-2504 203477 11/17/1998
3 76529-1666 203315 10/6/1998
5
76532-1702 203473 11/17/1998
76541-1675 203409 10/27/1998
127
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
77503-1686 203362 10/20/1998
77624-2515 203553 12/22/1998
79230-2525 203549 12/22/1998
79862-2522 203550 12/2211998
80145-2594 204-PTA 6/8/1999
80899-2501 , 203539 12/15/1998
81754-2532 203542 12/15/1998
81757-2512 203543 12/15/1998
81761-2583 203862 3/23/1999
82358-2738 510-PTA 8/10/1999
82364-2538 203603 1/20/1999
82403-2959 2317-PTA 8/112000
83500-2506 203391 10/29/1998
83560-2569 203816 3/2/1999
1 84210-2576 203818 3/2/1999
5
84920-2614 203966 4/27/1999
86576-2595 203868 3/2311999
92218-2554 203834 3/9/1999
92233-2599 ~ 134-PTA 5/25/1999
92256-2596 ~ 203891 3/30/1999
92265-2669 256-PTA 6/2211999
92274-2617 203971 4/27/1999
92929-2534-1 203586 1/12/1999
93011-2637 20-PTA 5/4/1999
94854-2586 203864 3/23/1999
96787-2534-1 203589 1/12/1999
96867-2620 203972 4/27/1999
96872-2674 550-PTA 8/17/1999
96878-2626 23-PTA 5/4/1999
3 96889-2641 119-PTA 5/25/1999
0
100312-2645 44-PTA 5/11/1999
105782-2693 387-PTA 7/20/1999
105849-2704 473-PTA 8/3/1999
108725-2766 863-PTA 10/19/1999
3 108769-2765 861-PTA 1011911999
5
119498-2965 2298-PTA 7/25/2000
119535-2756 613-PTA 8/31/1999
128
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
125185-2806 1031-PTA 12/7/1999
131639-2874 1784-PTA 4/25/2000
139623-2893 1670-PTA 4/11/2000
143076-2787 1028-PTA 12/7/1999
143276-2975 2387-PTA 8/8/2000
164625-2890 1535-PTA 3/21/2000
167678-2963 2302-PTA 7/25/2000
170021-2923 1906-PTA 5/23/2000
170212-3000 2583-PTA 10/10/2000
1 0 177313-2982 2251-PTA 7/19/2000
These deposits were made under the provisions of the Budapest Treaty on the
International Recognition
of the Deposit of Microorganisms for the Purpose of Patent Procedure and the
Regulations thereunder (Budapest
Treaty). This assures maintenance of a viable culture of the deposit for 30
years from the date of deposit. The
deposits will be made available by ATCC under the terms of the Budapest
Treaty, and subject to an agreement
between Genentech, Inc. and ATCC, which assures permanent and unrestricted
availability of the progeny of the
culture of the deposit to the public upon issuance of the pertinent U.S.
patent or upon laying open to the public
of any U.S. or foreign patent application, whichever comes first, and assures
availability of the progeny to one
determined by the U.S. Commissioner of Patents and Trademarks to be entitled
thereto according to 35 USC ~
122 and the Commissioner's rules pursuant thereto (including 37 CFR ~ 1.14
with particular reference to 886 OG
638).
The assignee of the present application has agreed that if a culture of the
materials on deposit should die
or be lost or destroyed when cultivated under suitable conditions, the
materials will be promptly replaced on
notification with another of the same. Availability of the deposited material
is not to be construed as a license
to practice the invention in contravention of the rights granted under the
authority of any government in
accordance with its patent laws.
6-55 EXAMPLE 5: Isolation of cDNA clones Encoding Human PR01873, PR07223.
PR07248,
PR0730. PR0532, PR07261. PR0734, PR0771, PR02010, PR05723,
PR03444, PR09940, PR03562, PR010008, PR05730, PR06008,
PR04527. PR04538 and PR04553
DNA molecules encoding the PR01873, PR07223, PR07248, PR0730, PR0532, PR07261,
PR0734,
PR0771, PR02010, PR05723, PR03444, PR09940, PR03562, PR010008, PR05730,
PR06008, PR04527,
PR04538 and PR04553 polypeptides shown in the accompanying figures were
obtained through GenBank.
6.6. EXAMPLE 6: Use of PRO as a Hybridization Probe
The following method describes use of a nucleotide sequence encoding PRO as a
hybridization probe.
129
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
DNA comprising the coding sequence of full-length or mature PRO (as shown in
accompanying figures)
or a fragment thereof is employed as a probe to screen for homologous DNAs
(such as those encoding naturally-
occurring variants of PRO) in human tissue cDNA libraries or human tissue
genomic libraries.
Hybridization and washing of filters containing either library DNAs is
performed under the following high-
stringency conditions. Hybridization of radiolabeled probe derived from the
gene encoding PRO polypeptide to
the filters is performed in a solution of 50% fonnamide, Sx SSC, 0.1 % SDS,
0.1 % sodium pyrophosphate, 50 mM
sodium phosphate, pH 6.8, 2x Denhardt's solution, and 10% dextran sulfate at
42°C for 20 hours. Washing of the
filters is performed in an aqueous solution of O. lx SSC and 0.1% SDS at
42°C.
DNAs having a desired sequence identity with the DNA encoding full-length
native sequence can then be
identified using standard techniques known in the art.
6.7. EXAMPLE 7: Expression of PRO in E. coli
This example illustrates preparation of an unglycosylated form of PRO by
recombinant expression in E.
coli.
The DNA sequence encoding PRO is initialhy amplified using selected PCR
primers. The primers should
contain restriction enzyme sites which correspond to the restriction enzyme
sites on the selected expression vector.
A variety of expression vectors may be employed. An example of a suitable
vector is pBR322 (derived from E.
coli; see, Bolivar et al., Gene, 2:95 (1977)) which contains genes for
ampicillin and tetracycline resistance. The
vector is digested with restriction enzyme and dephosphorylated. The PCR
amplified sequences are then ligated
into the vector. The vector will preferably include sequences which encode for
an antibiotic resistance gene, a trp
promoter, apoly-His leader (including the first six STII codons, poly-His
sequence, and enterokinase cleavage site),
the PRO coding region, lambda transcriptional terminator, and an argU gene.
The ligation mixture is then used to transform a selected E. eoli strain using
the methods described in
Sambrook et al., supra. Transformants are identified by their ability to grow
on LB plates and antibiotic resistant
colonies are then selected. Plasmid DNA can be isolated and confirmed by
restriction analysis and DNA
sequencing.
Selected clones can be grown overnight in liquid culture medium such as LB
broth supplemented with
antibiotics. The overnight culture may subsequently be used to inoculate a
larger scale culture. The cells are then
grown to a desired optical density, during which the expression promoter is
turned on.
After culturing the cells for several more hours, the cells can be harvested
by centrifugation. The cell pellet
obtained by the centrifugation can be solubilized using various agents known
in the art, and the sohubilized PRO
protein can then be purified using a metal chelating column under conditions
that allow tight binding of the protein.
PRO may be expressed in E. coli in a poly-His tagged form, using the following
procedure. The DNA
encoding PRO is initially amplified using selected PCR primers. The primers
will contain restriction enzyme sites
which correspond to the restriction enzyme sites on the selected expression
vector, and other useful sequences
providing for efficient and reliable translation initiation, rapid
purification on a metal chelation column, and
proteolytic removal with enterokinase. The PCR-amplified, poly-His tagged
sequences are then ligated into an
130
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
expression vector, which is used to transform an E. coli host based on strain
52 (W3110 fuhA(tonA) lon galE
rpoHts(htpRts) clpP(lacIq). Transformants are first grown in LB containing 50
mg/ml carbenicillin at 30°C with
shaking until an ODboo of 3-5 is reached. Cultures are then diluted 50-100
fold into CRAP media (prepared by
mixing 3.57 g (NH4)2SO4, 0.71 g sodium citrate~2H20, 1.07 g KCI, 5.36 g Difco
yeast extract, 5.36 g Sheffield
hycase SF in 500 ml water, as well as 110 mM MPOS, pH 7.3, 0.55% (w/v) glucose
and 7 mM MgSO~) and grown
for approximately 20-30 hours at 30°C with shaking. Samples are removed
to verify expression by SDS-PAGE
analysis, and the bulk culture is centrifuged to pellet the cells. Cell
pellets are frozen until purification and
refolding.
E. coli paste from 0.5 to 1 L fermentations (6-10 g pellets) is resuspended in
10 volumes (w/v) in 7 M
guanidine, 20 mM Tris, pH 8 buffer. Solid sodium sulfite and sodium
tetrathionate is added to make final
concentrations of O.1M and 0.02 M, respectively, and the solution is stirred
overnight at 4°C. This step results in
a denatured protein with all cysteine residues blocked by sulfitolization. The
solution is centrifuged at 40,000 rpm
in a Beckman Ultracentifuge for 30 min. The supernatant is diluted with 3-5
volumes of metal chelate column
buffer (6 M guanidine, 20 xnM Tris, pH 7.4) and filtered through 0.22 micron
filters to clarify. The clarified extract
is loaded onto a S ml Qiagen Ni 2+-NTA metal chelate column equilibrated in
the metal chelate column buffer. The
column is washed with additional buffer containing 50 mM imidazole
(Calbiochem, Utrol grade), pH 7.4. The
protein is eluted with buffer containing 250 mM imidazole. Fractions
containing the desired protein are pooled and
stored at 4°C. Protein concentration is estimated by its absorbance at
280 nm using the calculated extinction
coefficient based on its amino acid sequence.
The proteins are refolded by diluting the sample slowly into freshly prepared
refolding buffer consisting
of 20 mM Tris, pH 8.6, 0.3 M NaCl, 2.5 M urea, 5 mM cysteine, 20 mM glycine
and 1 mM EDTA. Refolding
volumes are chosen so that the final protein concentration is between 50 to
100 micrograms/ml. The refolding
solution is stirred gently at 4°C for 12-36 hours. The refolding
reaction is quenched by the addition of TFA to a
final concentration of 0.4% (pH of approximately 3). Before further
purification of the protein, the solution is
filtered through a 0.22 micron filter and acetonitrile is added to 2-10% final
concentration. The refolded protein
is chromatographed on a Poros Rl/H reversed phase column using a mobile buffer
of 0.1 % TFA with elution with
a gradient of acetonitrile from 10 to 80%. Aliquots of fractions with AZBO
absorbance are analyzed on SDS
polyacrylamide gels and fractions containing homogeneous refolded protein are
pooled. Generally, the properly
refolded species of most proteins are eluted at the lowest concentrations of
acetonitrile since those species are the
most compact with their hydrophobic interiors shielded from interaction with
the reversed phase resin. Aggregated
species are usually eluted at higher acetonitrile concentrations. In addition
to resolving misfolded forms ofproteins
from the desired form, the reversed phase step also removes endotoxin from the
samples.
Fractions containing the desired folded PRO polypeptide are pooled and the
acetonitrile removed using
a gentle stream of nitrogen directed at the solution. Proteins are formulated
into 20 mM Hepes, pH 6.8 with 0.14
M sodium chloride and 4% mannitol by dialysis or by gel filtration using G25
Superfine (Pharmacia) resins
equilibrated in the formulation buffer and sterile filtered.
Many of the PRO polypeptides disclosed herein were successfully expressed as
descibed above.
131
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
6.8. . EXAMPLE 8: Expression of PRO in mammalian cells
This example illustrates preparation of a potentially glycosylated form of PRO
by recombinant expression
in mammalian cells.
The vector, pRKS (see EP 307,247, published March 15, 1989), is employed as
the expression vector.
Optionally, the PRO DNA is ligated into pRKS with selected restriction enzymes
to allow insertion of the PRO
DNA using ligation methods such as described in Sambrook et al., supt~a. The
resulting vector is called pRKS-PRO.
In one embodiment, the selected host cells may be 293 cells. Human 293 cells
(ATCC CCL 1573) are
grown to confluence in tissue culture plates in medium such as DMEM
supplemented with fetal calf serum and
optionally, nutrient components andfor antibiotics. About 10 ~,g pRKS-PRO DNA
is mixed with about 1 ~,g DNA
encoding the VA RNA gene [Thimmappaya et al., Cell, 31:543 (1982)] and
dissolved in 500 ~.1 of 1 mM Tris-HCl,
0.1 mM EDTA, 0.227 M CaCl2. To this mixture is added, dropwise, 500 w1 of 50
mM HEPES (pH 7.35), 280 mM
NaCl, 1.5 mM NaP04, and a precipitate is allowed to form for 10 minutes at
25°C. The precipitate is suspended
and added to the 293 cells and allowed to settle for about four hours at
37°C. The culture medium is aspirated off
and 2 ml of 20% glycerol in PBS is added for 30 seconds. The 293 cells are
then washed with serum free medium,
fresh medium is added and the cells are incubated for about 5 days.
Approximately 24 hours after the transfections, the culture medium is removed
and replaced with culture
medium (alone) or culture medium containing 200 ~.Ci/ml 35S-cysteine and 200
~Ci/ml 35S-methionine. After a 12
hour incubation, the conditioned medium is collected, concentrated on a spin
filter, and loaded onto a 15% SDS
gel. The processed gel may be dried and exposed to film for a selected period
of time to reveal the presence of the
PRO polypeptide. The cultures containing transfected cells may undergo further
incubation (in serum free medium)
and the medium is tested in selected bioassays.
In an alternative technique, PRO may be introduced into 293 cells transiently
using the dextran sulfate
method described by Somparyrac et al., Proc. Natl. Acad. Sci., 12:7575 (1981).
293 cells are grown to maximal
density in a spinner flask and 700 ~,g pRKS-PRO DNA is added. The cells are
first concentrated from the spinner
flask by centrifugation and washed with PB S. The DNA-dextran precipitate is
incubated on the cell pellet for four
hours. The cells are treated with 20% glycerol for 90 seconds, washed with
tissue culture medium, and re-
introduced into the spinner flask containing tissue culture medium, 5 ~g/ml
bovine insulin and 0.1 ~g/ml bovine
transferrin. After about four days, the conditioned media is centrifuged and
filtered to remove cells and debris. The
sample containing expressed PRO can then be concentrated and purified by any
selected method, such as dialysis
and/or column chromatography.
In another embodiment, PRO can be expressed in CHO cells. The pRI~S-PRO can be
transfected into CHO
cells using known reagents such as CaP04 or DEAF-dextran. As described above,
the cell cultures can be
incubated, and the medium replaced with culture medium (alone) or medium
containing a radiolabel such as 35S-
methionine. After determining the presence of a PRO polypeptide, the culture
medium may be replaced with serum
3 5 free medium. Preferably, the cultures are incubated for about 6 days, and
then the conditioned medium is harvested.
132
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
The medium containing the expressed PRO polypeptide can then be concentrated
and purified by any selected
method.
Epitope-tagged PRO may also be expressed in host CHO cells. The PRO may be
subcloned out of the
pRKS vector. The subclone insert can undergo PCR to fuse in frame with a
selected epitope tag such as a poly-His
tag into a Baculovirus expression vector. The poly-His tagged PRO insert can
then be subcloned into a SV40 driven
vector containing a selection marker such as DHFR for selection of stable
clones. Finally, the CHO cells can be
transfected (as described above) with the SV40 driven vector. Labeling may be
performed, as described above, to
verify expression. The culture medium containing the expressed poly-His tagged
PRO can then be concentrated
and purified by any selected method, such as by Niz+-chelate affinity
chromatography.
PRO may also be expressed in CHO and/or COS cells by a transient expression
procedure or in GHO cells
by another stable expression procedure.
Stable expression in CHO cells is performed using the following procedure. The
proteins are expressed
as an IgG construct (immunoadhesin), in which the coding sequences for the
soluble forms (e.g., extracellular
domains) of the respective proteins are fused to an IgGl constant region
sequence containing the hinge, CH2 and
CH2 domains and/or as a poly-His tagged form.
Following PCR amplification, the respective DNAs are subcloned in a CHO
expression vector using
standard techniques as described in Ausubel et al., Current Protocols of
Molecular Biolo~y, Unit 3.16, John Wiley
and Sons (1997). CHO expression vectors are constructed to have compatible
restriction sites 5' and 3' of the DNA
of interest to allow the convenient shuttling of cDNA's. The vector used in
expression in CHO cells is as described
in Lucas et al., Nucl. Acids Res., 24:9 (1774-1779 (1996), and uses the SV40
early promoter/enhancer to drive
expression of the cDNA of interest and dihydrofolate reductase (DHFR). DHFR
expression permits selection for
stable maintenance of the plasmid following transfection.
Twelve micrograms of the desired plasmid DNA is introduced into approximately
10 million CHO cells
using commercially available transfection reagents Superfect° (Qiagen),
Dosper° or Fugene° (Boehringer
Mannheim). The cells are grown as described iii Lucas et al., supra.
Approximately 3 x 10' cells are frozen in an
ampule for further growth and production as described below.
The ampules containing the plasmid DNA are thawed by placement into a water
bath and mixed by
vortexing. The contents are pipetted into a centrifuge tube containing,l0 ml
of media and centrifuged at 1000 rpm
for 5 minutes. The supernatant is aspirated and the cells are resuspended in
10 ml of selective media (0.2 ~,m
filtered PS20 with 5% 0.2 ~,m diafiltered fetal bovine serum). The cells are
then aliquoted into a 100 ml spinner
containing 90 ml of selective media. After 1-2 days, the cells are transferred
into a 250 ml spinner filled with 150
ml selective growth medium and incubated at 37°C. After another 2-3
days, 250 ml, 500 ml and 2000 ml spinners
are seeded with 3 x 105 cells/ml. The cell media is exchanged with fresh media
by centrifugation and resuspension
in production medium. Although any suitable CHO media may be employed, a
production medium described in
U.S. Patent No. 5,122,469, issued June 16, 1992 may actually be used. A 3L
production spinner is seeded at 1.2
x 106 cells/ml. On day 0, the cell number and pH is determined. On day 1, the
spinner is sampled and sparging with
filtered air is commenced. On day 2, the spinner is sampled, the temperature
shifted to 33°C, and 30 ml of 500 g/L
133
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
glucose and 0.6 ml of 10% antifoam (e.g., 35% polydimetlrylsiloxane emulsion,
Dow Corning 365 Medical Grade
Emulsion) taken. Throughout the production, the pH is adjusted as necessary to
keep it at around 7.2. After 10
days, or until the viability drops below 70%, the cell culture is harvested by
centrifugation and filtering through a
0.22 ~m filter. The filtrate is either stored at 4°C or immediately
loaded onto columns for purification.
For the poly-His tagged constructs, the proteins are purified using a Ni 2~'-
NTA column (Qiagen). Before
purification, imidazole is added to the conditioned media to a concentration
of 5 mM. The conaitioned media is
pumped onto a 6 ml Ni 2+-NTA column equilibrated in 20 mM Hepes, pH 7.4,
buffer containing 0.3 M NaCI and
5 mM imidazole at a flow rate of 4-5 ml/min. at 4°C. After loading, the
column is washed with 'additional
equilibration buffer and the protein eluted with equilibration buffer
containing 0.25 M imidazole. The lughly
purified protein is subsequently desalted into a storage buffer containing 10
mM Hepes, 0.14 M NaCl and 4%
mannitol, pH 6.8, with a 25 ml G25 Superfine (Pharmacia) column and stored at -
80°C.
Immunoadhesin (Fc-containing) constructs are purified from the conditioned
media as follows. The
conditioned medium is pumped onto a 5 ml Protein A column (Pharmacia) which
has been equilibrated in 20 mM
Na phosphate buffer, pH 6.8. After loading, the column is washed extensively
with equilibration buffer before
elution with 100 xnM citric acid, pH 3.5. The eluted protein is immediately
neutralized by collecting 1 ml fractions
into tubes containing 275 ~.1 of 1 M Tris buffer, pH 9. The highly purified
protein is subsequently desalted into
storage buffer as described above for the poly-His tagged proteins. The
homogeneity is assessed by SDS
polyacrylamide gels and by N-terminal amino acid sequencing by Edman
degradation.
Many of the PRO polypeptides disclosed herein were successfully expressed as
descibed above.
6.9. EXAMPLE 9: Expression of PRO in Yeast
The following method describes recombinant expression of PRO in yeast.
First, yeast expression vectors are constructed for intracellular production
or secretion of PRO from the
ADH2/GAPDH promoter. DNA encoding PRO and the promoter is inserted into
suitable restriction enzyme sites
in the selected plasmid to direct intracellular expression of PRO. For
secretion, DNA encoding PRO can be cloned
into the selected plasmid, together witli DNA encoding the ADH2/GAPDH
promoter, a native PRO signal peptide
or other mammalian signal peptide, or, for example, a yeast alpha-factor or
invertase secretory signal/leader
sequence, and linker sequences (if needed) for expression of PRO.
Yeast cells, such as yeast strain AB 110, can then be transformed with the
expression plasmids described
above and cultured in selected fermentation media. The transformed yeast
supernatants can be analyzed by
precipitation with 10% trichloroacetic acid and separation by SDS-PAGE,
followed by staining of the gels with
Coomassie Blue stain.
Recombinant PRO can subsequently be isolated and purified by removing the
yeast cells from the
fermentation medium by centrifugation and then concentrating the medium using
selected cartridge filters. The
concentrate containing PRO may further be purified using selected column
chromatography resins.
Many of the PRO polypeptides disclosed herein were successfully expressed as
described above.
134
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
6.10. EXAMPLE 10: Expression of PRO in Baculovirus-Infected Insect Cells
The following method describes recombinant expression in Baculovirus-infected
insect cells.
The sequence coding for PRO is fused upstream of an epitope tag contained
within a baculovirus
expression vector. Such epitope tags include poly-His tags and immunoglobulin
tags (like Fc regions of IgG). A
variety of plasmids may be employed, including plasmids derived from
commercially available plasmids such as
pVL1393 (Novagen). Briefly, the sequence encoding PRO or the desired portion
of the coding sequence of PRO
(such as the sequence encoding the extracellular domain of a transmembrane
protein or the sequence encoding the
mature protein if the protein is extracellular) is amplified by PCR with
primers complementary to the 5' and 3'
regions. The 5' primer may incorporate flanking (selected) restriction enzyme
sites. The product is then digested
with those selected restriction enzymes and subcloned into the expression
vector.
Recombinant baculovirus is generated by co-transfecting the above plasmid and
BaculoGoldTM virus DNA
(Pharmingen) into Spodoptera fr-ugipenda ("Sf~") cells (ATCC CRL 1711 ) using
lipofectin (commercially available
from GIBCO-BRL). After 4 - 5 days of incubation at 28°C, the released
viruses are harvested and used for further
amplifications. Viral infection and protein expression are performed as
described by O'Reilley et al., Baculovirus
expression vectors: A Laboratory Manual, Oxford: Oxford University Press
(1994).
Expressedpoly-His tagged PRO can then be purified, for example, by NiZ+-
chelate affinity chromatography
as follows. Extracts are prepared from recombinant virus-infected S~ cells as
described by Rupert et al., Nature,
362:175-179 (1993). Briefly, Sf~ cells are washed, resuspended in sonication
buffer (25 ml Hepes, pH 7.9; 12.5
mM MgClz; 0.1 mM EDTA; 10% glycerol; 0.1% NP-40; 0.4 M ICI), and sonicated
twice for 20 seconds on ice.
The sonicates are cleared by centrifugation, and the supernatant is diluted 50-
fold in loading buffer (50 mM
phosphate, 300 mM NaCl, 10% glycerol, pH 7.8) and filtered through a 0.45 win
filter. A Ni2~-NTA agarose
column (commercially available from Qiagen) is prepared with a bed volume of 5
ml, washed with 25 ml of water
and equilibrated with 25 ml of loading buffer. The filtered cell extract is
loaded onto the column at 0.5 ml per
minute. The column is washed to baseline AZ$o with loading buffer, at which
point fraction collection is started.
Next, the column is washed with a secondary wash buffer (50 mM phosphate; 300
mM NaCI, 10% glycerol, pH
6.0), which elutes nonspecifically bound protein. After reaching AZ$obaseline
again, the column is developed with
a 0 to 500 mM imidazole gradient in the secondary wash buffer. One ml
fractions are collected and analyzed by
SDS-PAGE and silver staining or Western blot with NiZ~-NTA-conjugated to
alkaline phosphatase (Qiagen).
Fractions containing the eluted His,o-tagged PRO are pooled and dialyzed
against loading buffer.
Alternatively, purification of the IgG tagged (or Fc tagged) PRO can be
performed using known
chromatography techniques, including for instance, Protein A or protein G
column chromatography.
Following PCR amplification, the respective coding sequences are subcloned
into a baculovirus expression
vector (pb.PH.IgG for IgG fusions and pb.PH.His.c for poly-His tagged
proteins), and the vector and Baculogold~
baculovirus DNA (Pharmingen) are co-transfected into 105 Spodoptera frugiperda
("Sf~") cells (ATCC CRL
1711), using Lipofectin (Gibco BRL). pb.PH.IgG and pb.PH.His are modifications
of the commercially available
baculovirus expression vector pVL1393 (Pharmingen), with modified polylinker
regions to include the His or Fc
tag sequences. The cells are grown in Hink's TNM-FH medium supplemented with
10% FBS (Hyclone). Cells are
135
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
incubated for 5 days at 28°C. The supernatant is harvested and
subsequently used for the first viral amplification
by infecting Sf~3 cells in Hhik's TNM-FH medium supplemented with 10% FBS at
an approximate multiplicity of
infection (MOI) of 10. Cells are incubated for 3 days at 28°C. The
supernatant is harvested and the expression of
the constructs in the baculovirus expression vector is determined by batch
binding of 1 ml of supernatant to 25 ml
of Ni z+-NTA beads (QIAGEN) for histidine tagged proteins or Protein-A
Sepharose CL-4B beads (Pharmacia) for
IgG tagged proteins followed by SDS-PAGE analysis comparing to a known
concentration of protein standard by
Coomassie blue staining.
The first viral amplification supernatant is used to infect a spinner culture
(500 ml) of Sf~ cells grown in
ESF-921 medium (Expression Systems LLC) at an approximate MOI of 0.1. Cells
are incubated for 3 days at 28°C.
The supernatant is harvested and filtered. Batch binding and SDS-PAGE analysis
is repeated, as necessary, until
expression of the spinner culture is confirmed.
The conditioned medium from the transfected cells (0.5 to 3 L) is harvested by
centrifugation to remove
the cells and filtered through 0.22 micron filters. For the poly-His tagged
constructs, the protein construct is
purified using a Ni 2~-NTA column (Qiagen). Before purification, imidazole is
added to the conditioned media to
a concentration of 5 mM. The conditioned media is pumped onto a 6 ml Ni 2+-NTA
column equilibrated in 20 mM
Hepes, pH 7.4, buffer containing 0.3 M NaCI and 5 mM imidazole at a flow rate
of 4-5 ml/min. at 4°C. After
loading, the column is washed with additional equilibration buffer and the
protein eluted with equilibration buffer
containing 0.25 M imidazole. The highly purified protein is subsequently
desalted into a storage buffer containing
10 mM Hepes, 0.14 M NaCl and 4% mannitol, pH 6.8, with a 25 ml G25 Superfine
(Pharmacia) column and stored
at -80°C.
Immunoadhesin (Fc containing) constructs ofproteins are purified from the
conditioned media as follows.
The conditioned media is pumped onto a 5 ml Protein A column (Pharmacia) which
has been equilibrated in 20 mM
Na phosphate buffer, pH 6.8. After loading, the column is washed extensively
with equilibration buffer before
elution with 100 mM citric acid, pH 3.5. The eluted protein is immediately
neutralized by collecting 1 ml fractions
into tubes containing 275 ml of 1 M Tris buffer, pH 9. The highly purified
protein is subsequently desalted into
storage buffer as described above for the poly-His tagged proteins. The
homogeneity of the proteins is verified by
SDS polyacrylamide gel (PEG) electrophoresis and N-terminal amino acid
sequencing by Edman degradation.
Alternatively, a modified baculovirus procedure may be used incorporating high-
5 cells. In this procedure,
the DNA encoding the desired sequence is amplified with suitable systems, such
as Pfu (Stratagene), or fused
upstream (5'-of) of an epitope tag contained with a baculovirus expression
vector. Such epitope tags include poly-
His tags and immunoglobulin tags (like Fc regions of IgG). A variety of
plasmids may be employed, including
plasmids derived from commercially availableplasmids such aspIEl-1 (Novagen).
ThepIEl-1 andpIEl-2 vectors
are designed for constitutive expression of recombinant proteins from the
baculovirus iel promoter in stably-
transformed insect cells (1). The plasmids differ only W the orientation of
the multiple cloning sites and contain all
promoter sequences known to be important for iel-mediated gene expression in
uninfected insect cells as well as
the hr5 enhancer element. pIE 1-1 and pIE 1-2 include the translation
initiation site and can be used to produce fusion
proteins. Briefly, the desired sequence or the desired portion of the sequence
(such as the sequence encoding the
136
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
extracellular domain of a transmembrane protein) is amplified by PCR with
primers complementary to the S' and
3' regions. The S' primer may incorporate flanking (selected) restriction
enzyme sites. The product is then digested
with those selected restriction enzymes and subcloned into the expression
vector. For example, derivatives ofpIEl-
1 can include the Fc region of human IgG (pb.PH.IgG) or an 8 histidine
(pb.PH.His) tag downstream (3'-of) the
desired sequence. Preferably, the vector construct is sequenced for
confirmation.
High-5 cells are grown to a confluency of SO% under the conditions of,
27°C, no COZ, NO pen/strep. For
each 1 SO mm plate, 30 ~.g ofpIE based vector containing the sequence is mixed
with 1 ml Ex-Cell medium (Media:
Ex-Cell 401 + 1/100 L-Glu JRH Biosciences #14401-78P (note: this media is
light sensitive)), and in a separate
tube,100 ~,1 of CellFectin (CelIFECTIN (GibcoBRL #10362-010) (vortexed to
mix)) is mixed with 1 ml of Ex-Cell
medium. The two solutions are combined and allowed to incubate at room
temperature for 1 S minutes. 8 ml of
Ex-Cell media is added to the 2 ml of DNA/CeIIFECTIN mix and this is layered
on high-S cells that have been
washed once with Ex-Cell media. The plate is then incubated in darkness for 1
hour at room temperature. The
DNA/CelIFECTIN mix is then aspirated, and the cells are washed once with Ex-
Cell to remove excess
CeIIFECTIN, 30 ml of fresh Ex-Cell media is added and the cells are incubated
for 3 days at 28°C. The supernatant
is harvested and the expression of the sequence in the baculovirus expression
vector is determined by batch binding
of 1 ml of supernatent to 2S ml ofNi z+-NTA beads (QIAGEI~ for histidine
tagged proteins or Protein-A Sepharose
CL-4B beads (Pharmacia) for IgG tagged proteins followed by SDS-PAGE analysis
comparing to a known
concentration of protein standard by Coomassie blue staining.
The conditioned media from the transfected cells (0.S to 3 L) is harvested by
centrifugation to remove the
cells and filtered through 0.22 micron filters. For the poly-His tagged
constructs, the protein comprising the
sequence is purified using a Ni Z+-NTA column (Qiagen). Before purification,
imidazole is added to the conditioned
media to a concentration of S mM. The conditioned media is pumped onto a 6 ml
Ni 2+-NTA column equilibrated
in 20 xnM Hepes, pH 7.4, buffer containing 0.3 M NaCI and S mM imidazole at a
flow rate of 4-S ml/min. at 48°C.
After loading, the column is washed with additional equilibration buffer and
the protein eluted with equilibration
buffer containing 0.25 M imidazole. The highly purified protein is then
subsequently desalted into a storage buffer
containing 10 mM Hepes, 0.14 M NaCl and 4% mannitol, pH 6.8, with a 2S ml G2S
Superfine (Pharmacia) column
and stored at -80°C.
Immunoadhesin (Fc containing) constructs ofproteins are purified from the
conditioned media as follows.
The conditioned media is pumped onto a S ml Protein A column (Pharmacia) which
had been equilibrated in 20
3 0 mM Na phosphate buffer, pH 6.8. After loading, the column is washed
extensively witli equilibration buffer before
elution with 100 mM citric acid, pH 3.5. The eluted protein is immediately
neutralized by collecting 1 ml fractions
into tubes containW g 27S ml of 1 M Tris buffer, pH 9. The highly purified
protein is subsequently desalted into
storage buffer as described above for the poly-His tagged proteins. The
homogeneity of the sequence is assessed
by SDS polyacrylamide gels and by N-terminal amino acid sequencing by Edman
degradation and other analytical
procedures as desired or necessary.
Many of the PRO polypeptides disclosed herein were successfully expressed as
described above.
X37
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
6.11. EXAMPLE 11: Preparation of Antibodies that Bind PRO
This example illustrates preparation of monoclonal antibodies which can
specifically bind the PRO
polypeptide or an epitope on the PRO polypeptide without substantially binding
to any other polypeptide or
polypeptide epitope.
Techniques for producing the monoclonal antibodies are known in the art and
are described, for instance,
in Goding, supra. Immunogens that may be employed include purified PRO, fusion
proteins containing PRO, and
cells expressing recombinant PRO on the cell surface. Selection of the
immunogen can be made by the skilled
artisan without undue experimentation.
Mice, such as Balb/c, are immunized with the PRO immunogen emulsified in
complete Freund's adjuvant
and injected subcutaneously or intraperitoneally in an amount from 1-100
micrograms. Alternatively, the
immunogen is emulsified in MPIrTDM adjuvant (Ribi Immunochemical Research,
Hamilton, MT) and injected
into the animal's liind foot pads. The immunized mice are then boosted 10 to
12 days later with additional
immunogen emulsified in the selected adjuvant. Thereafter, for several weeks,
the mice may also be boosted with
additional immunization injections. Serum samples may be periodically obtained
from the mice by retro-orbital
bleeding for testing in ELISA assays to detect anti-PRO antibodies.
After a suitable antibody titer has been detected, the animals "positive" for
antibodies can be injected with
a final intravenous injection of PRO. Three to four days later, the mice are
sacrificed and the spleen cells are
harvested. The spleen cells are then fused (using 35% polyethylene glycol) to
a selected murine myeloma cell line
such as P3X63AgU.1, available from ATCC, No. CRL 1597. The fusions generate
hybridoma cells which can then
be plated in 96 well tissue culture plates containing HAT (hypoxanthine,
aminopterin, and thymidine) medium to
inhibit proliferation of non-fused cells, myeloma hybrids, and spleen cell
hybrids.
The hybridoma cells will be screened in an ELISA for reactivity against PRO.
Determination of"positive"
hybridoma cells secreting the desired monoclonal antibodies against PRO is
within the skill in the art.
The positive hybridoma cells can be injected intraperitoneally into syngeneic
Balb/c mice to produce
ascites containing the anti-PRO monoclonal antibodies. Alternatively, the
hybridoma cells can be grown in tissue
culture flasks or roller bottles. Purification of the monoclonal antibodies
produced in the ascites can be
accomplished using ammonium sulfate precipitation, followed by gel exclusion
chromatography. Alternatively,
affinity chromatography based upon binding of antibody to protein A or protein
G can be employed.
6.12. EXAMPLE 12: Purification of PRO Polypeptides Usina Specific Antibodies
Native or recombinant PRO polypeptides may be purified by a variety of
standard techniques in the art
of protein purification. For example, pro-PRO polypeptide, mature PRO
polypeptide, or pre-PRO polypeptide
is purified by immunoaffinity chromatography using antibodies specific for the
PRO polypeptide of interest. In
general, an immunoaffinity column is constructed by covalently coupling the
anti-PRO polypeptide antibody to
an activated chromatographic resin.
Polyclonal immunoglobulins are prepared from immune sera either by
precipitation with ammonium
sulfate or by purification on immobilized Protein A (Pharmacia LKB
Biotechnology, Piscataway, N.J.). Likewise,
138
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
monoclonal antibodies are prepared from mouse ascites fluid by ammonium
sulfate precipitation or
chromatography on immobilized Protein A. Partially purified immunoglobulin is
covalently attached to a
chromatographic resin such as CnBr-activated SEPHAROSET"' (Pharmacia LKB
Biotechnology). The antibody
is coupled to the resin, the resin is blocked, and the derivative resin is
washed according to the manufacturer's
instructions.
Such an immunoaffinity column is utilized in the purification of PRO
polypeptide by preparing a fraction
from cells containing PRO polypeptide in a soluble form. This preparation is
derived by solubilization of the
whole cell or of a subcellular fraction obtained via differential
centrifugation by the addition of detergent or by
other methods well known in the art. Alternatively, soluble PRO polypeptide
containing a signal sequence may
be secreted in useful quantity into the medium in which the cells are grown.
A soluble PRO polypeptide-containing preparation is passed over the
immunoaffinity column, and the
column is washed under conditions that allow the preferential absorbance of
PRO polypeptide (e.g., high ionic
strength buffers in the presence of detergent). Then, the column is eluted
under conditions that disrupt
antibody/PRO polypeptide binding (e.g., a low pH buffer such as approximately
pH 2-3, or a high concentration
of a chaotrope such as urea or thiocyanate ion), and PRO polypeptide is
collected.
6.13. EXAMPLE 13: Drug Screening
This invention is particularly useful for screening compounds by using PRO
polypeptides or binding
fragment thereof in any of a variety of drug screening techniques. The PRO
polypeptide or fragment employed
in such a test may either be free in solution, affixed to a solid support,
borne on a cell surface, or located
intracellularly. One method of drug screening utilizes eukaryotic or
prokaryotic host cells which are stably
transformed with recombinant nucleic acids expressing the PRO polypeptide or
fragment. Drugs are screened
against such transformed cells in competitive binding assays. Such cells,
either in viable or fixed form, can be
used for standard binding assays. One may measure, for example, the formation
of complexes between PRO
polypeptide or a fragment and the agent being tested. Alternatively, one can
examine the diminution in complex
formation between the PRO polypeptide and its target cell or target receptors
caused by the agent being tested.
Thus, the present invention provides methods of screening for drugs or any
other agents which can affect
a PRO polypeptide-associated disease or disorder. These methods comprise
contacting such an agent with an PRO
polypeptide or fragment thereof and assaying (I) for the presence of a complex
between the agent and the PRO
polypeptide or fragment, or (ii) for the presence of a complex between the PRO
polypeptide or fragment and the
cell, by methods well known in the art. In such competitive binding assays,
the PRO polypeptide or fragment
is typically labeled. After suitable incubation, free PRO polypeptide or
fragment is separated from that present
in bound form, and the amount of free or uncomplexed label is a measure of the
ability of the particular agent
to bind to PRO polypeptide or to interfere with the PRO polypeptide/cell
complex.
Another technique for drug screening provides high throughput screening for
compounds having suitable
. binding affinity to a polypeptide and is described in detail in WO 84103564,
published on September 13, 1984.
Briefly stated, large numbers of different small peptide test compounds are
synthesized on a solid substrate, such
139
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
as plastic pins or some other surface. As applied to a PRO polypeptide, the
peptide test compounds are reacted
with PRO polypeptide and washed. Bound PRO polypeptide is detected by methods
well known in the art.
Purified PRO polypeptide can also be coated directly onto plates for use in
the aforementioned drug screening
techniques. In addition, non-neutralizing antibodies can be used to capture
the peptide and immobilize it on the
solid support.
This invention also contemplates the use of competitive drug screening assays
in which neutralizing
antibodies capable of binding PRO polypeptide specifically compete with a test
compound for binding to PRO
polypeptide ~or fragments thereof. In this manner, the antibodies can be used
to detect the presence of any peptide
which shares one or more antigenic determinants with PRO polypeptide.
6.14. EXAMPLE 14: Rational Dru D~ esi~n
The goal of rational drug design is to produce structural analogs of
biologically active polypeptide of
interest (i. e. , a PRO polypeptide) or of small molecules with which they
interact, e. g. , agonists, antagonists, or
inhibitors. Any of these examples can be used to fashion drugs which are more
active or stable forms of the PRO
polypeptide or which enhance or interfere with the function of the PRO
polypeptide in vivo (cf., Hodgson,
Bio/Technoloey, 9: 19-21 (1991)).
In one approach, the three-dimensional structure of the PRO polypeptide, or of
an PRO
polypeptide-inhibitor complex, is determined by x-ray crystallography, by
computer modeling or, most typically,
by a combination of the two approaches. Both the shape and charges of the PRO
polypeptide must be ascertained
to elucidate the structure and to determine active sites) of the molecule.
Less often, useful information regarding
the structure of the PRO polypeptide may be gained by modeling based on the
structure of homologous proteins.
In both cases, relevant structural information is used to design analogous PRO
polypeptide-like molecules or to
identify efficient inhibitors. Useful examples of rational drug design may
include molecules which have improved
activity or stability as shown by Braxton and Wells, Biochemistry,
31:7796=7801 ( 1992) or which act as inhibitors,
agonists, or antagonists of native peptides as shown by Athauda et al., J.
Biochem., 113:742-746 (1993).
It is also possible to isolate a target-specific antibody, selected by
functional assay, as described above,
and then to solve its crystal structure. This approach, in principle, yields a
pharmacore upon which subsequent
drug design can be based. It is possible to bypass protein crystallography
altogether by generating anti-idiotypic
antibodies (anti-ids) to a functional, pharmacologically active antibody. As a
mirror image of a mirror image, the
binding site of the anti-ids would be expected to be an analog of the original
receptor. The anti-id could then be
used to identify and isolate peptides from banks of chemically or biologically
produced peptides. The isolated
peptides would then act as the pharmacore.
By virtue of the present invention, sufficient amounts of the PRO polypeptide
may be made available to
perform such analytical studies as X-ray crystallography. In addition,
knowledge of the PRO polypeptide amino
acid sequence provided herein will provide guidance to those employing
computer modeling techniques in place
of or in addition to x-ray crystallography.
140
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
6.15. EXAMPLE 15: Stimulation of Endothelial Cell Proliferation (Assay 8)
This assay is designed to determine whether PRO polypeptides of the present
invention show the ability
to stimulate adrenal cortical capillary endothelial cell (ACE) growth. PRO
polypeptides testing positive in this
assay would be expected to be useful for the therapeutic treatment of
conditions or disorders where angiogenesis
would be beneficial including, for example, wound healing, and the like (as
would agonists of these PRO
polypeptides). Antagonists of the PRO polypeptides testing positive in this
assay would be expected to be useful
for the therapeutic treatment of cancerous tumors.
Bovine adrenal cortical capillary endothelial (ACE) cells (from primary
culture, maximum of 12-14
passages) were plated in 96-well plates at 500 cells/well per 100 microliter.
Assay media included low glucose
DMEM, 10% calf serum, 2 mM glutamine, and 1X
penicillin/streptomycin/fungizone. Control wells included the
following: (1) no ACE cells added; (2) ACE cells alone; (3) ACE cells plus
VEGF (5 ng/ml); and (4) ACE cells
plus FGF (5ng/ml). The control or test sample, (in 100 microliter volumes),
was then added to the wells (at
dilutions of 1%, 0.1% and 0.01%, respectively). The cell cultures were
incubated for 6-7 days at 37°C/5% COZ.
After the incubation, the media in the wells was aspirated, and the cells were
washed 1X with PBS. An acid
phosphatase reaction mixture (100 microliter; O.1M sodium acetate, pH 5.5,
0.1% Triton X-100, 10 mM p-
nitrophenyl phosphate) was then added to each well. After a 2 hour incubation
at 37°C, the reaction was stopped
by addition of 10 microliters 1N NaOH. Optical density (OD) was measured on a
microplate reader at 405 nm.
The activity of a PRO polypeptide was calculated as the fold increase in
proliferation (as determined by
the acid phosphatase activity, OD 405 nm) relative to (1) cell only
background, and (2) relative to maximum
stimulation by VEGF. VEGF (at 3-10 ng/ml) and FGF (at 1-5 ng/ml) were employed
as an activity reference for
maximum stimulation. Results of the assay were considered "positive" if the
observed stimulation was z 50%
increase over background. VEGF (5 ng/ml) control at 1% dilution gave 1.24 fold
stimulation; FGF (5 nghnl)
control at 1% dilution gave 1.46 fold stimulation.
PR021 tested positive in this assay.
6.16. EXAMPLE 16: Inhibition of Vascular Endothelial Growth Factor (VEGF)
Stimulated
Proliferation of Endothelial Cell Growth (Assay 9)
The ability of various PRO polypeptides to inhibit VEGF stimulated
proliferation of endothelial cells was
tested. Polypeptides testing positive in this assay axe useful for inhibiting
endothelial cell growth in mammals
where such an effect would be beneficial, e.g., for inhibiting tumor growth.
3 0 Specifically, bovine adrenal cortical capillary endothelial cells (ACE)
(from primary culture, maximum
of 12-14 passages) were plated in 96-well plates at 500 cells/well per 100
microliter. Assay media included low
glucose DMEM, 10% calf serum, 2 mM glutamine, and 1X
penicillin/streptomycin/fungizone. Control wells
included the following: (1) no ACE cells added; (2) ACE cells alone; (3) ACE
cells plus 5 ng/ml FGF; (4) ACE
cells plus 3 ng/ml VEGF; (5) ACE cells plus 3 ng/ml VEGF plus 1 ng/ml TGF-
beta; and (6) ACE cells plus 3
ng/ml VEGF plus 5 ng/ml LIF. The test samples, poly-his tagged PRO
polypeptides (in 100 microliter volumes),
were then added to the wells (at dilutions of 1 % , 0.1 % and 0.01 % ,
respectively). The cell cultures were
141
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
incubated for 6-7 days at 37°C/5 % COZ. After the incubation, the media
in the wells was aspirated, and the cells
were washed 1X with PBS. An acid phosphatase reaction mixture (100 microliter;
O.1M sodium acetate, pH 5.5,
0.1 % Triton X-100, 10 mM p-nitrophenyl phosphate) was then added to each
well. After a 2 hour incubation
at 37°C, the reaction was stopped by addition of 10 microliters 1N
NaOH. Optical density (OD) was measured
on a microplate reader at 405 nm.
The activity of PRO polypeptides was calculated as the percent inhibition of
VEGF (3 ng/ml) stimulated
proliferation (as determined by measuring acid phosphatase activity at OD 405
nm) relative to the cells without
stimulation. TGF-beta was employed as an activity reference at 1 ng/ml, since
TGF-beta blocks 70-90% of
VEGF-stimulated ACE cell proliferation. The results are indicative of the
utility of the PRO polypeptides in
cancer therapy and specifically in inhibiting tumor angiogenesis. Numerical
values (relative inhibition) are
determined by calculating the percent inhibition of VEGF stimulated
proliferation by the PRO polypeptides
relative to cells without stimulation and then dividing that percentage into
the percent inhibition obtained by TGF-(3
at 1 ng/ml which is known to block 70-90% of VEGF stimulated cell
proliferation. The results are considered
positive if the PRO polypeptide exhibits 30 % or greater inhibition of VEGF
stimulation of endothelial cell growth
(relative inhibition 30% or greater).
PR0247, PRO720 and PR04302 tested positive in this assay.
6.17. EXAMPLE 17: Enhancement of Heart Neonatal Hypertrophy Induced bYLIF+ET-1
(Assa_y
This assay is designed to determine whether PRO polypeptides of the present
invention show the ability
to enhance neonatal heart hypertrophy induced by LIF and endothelin-1 (ET-1).
A test compound that provides
a positive response in the present assay would be useful for the therapeutic
treatment of cardiac insufficiency
diseases or disorders characterized or associated with an undesired level of
hypertrophy of the cardiac muscle.
Cardiac myocytes from 1-day old Harlan Sprague Dawley rats (180 ~,1 at 7.5 x
10ø/m1, serum < 0.1,
freshly isolated) are introduced on day 1 to 96-well plates previously coated
with DMEM/F12 + 4%FCS. Test
PRO polypeptide samples or growth medium alone (negative control) are then
added directly to the wells on day
2 in 20 ~1 volume. LIF + ET-1 are then added to the wells on day 3. The cells
are stained after an additional
2 days in culture and are then scored visually the next day. A positive in the
assay occurs when the PRO
polypeptide treated myocytes obtain a score greater than zero. A score of zero
represents non-responsive cells
whereas scores of 1 or 2 represent enhancement (i. e. they are visually larger
on the average or more numerous
than the untreated myocytes).
PR021 polypeptides tested positive in this assay.
6.18. EXAMPLE 18: Detection of Endothelial Cell Apoptosis (FACSI (Assay 961
The ability of PRO polypeptides of the present invention to induce apoptosis
in endothelial cells was
tested in human venous umbilical vein endothelial cells (HUVEC, Cell Systems)
in gelatinized T175 flasks using
HUVEC cells below passage 10. PRO polypeptides testing positive in this assay
are expected to be useful for
142
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
therapeutically treating conditions where apoptosis of endothelial cells would
be beneficial including, for example,
the therapeutic treatment of tumors.
On day one, the cells were split [420,000 cells per gelatinized 6 cm dishes -
(11 x 103 cells/cmz Falcon,
Primaria)] and grown in media containing serum (CS-C, Cell System) overnight
or for 16 hours to 24 hours.
On day 2, the cells were washed lx with 5 ml PBS ; 3 ml of 0 % serum medium
was added with VEGF
(100 ng/ml); and 30 w1 of the PRO test compound (final dilution 1 %) or 0%
serum medium (negative control)
was added. The mixtures were incubated for 48 hours before harvesting.
The cells were then harvested for FRCS analysis. The medium was aspirated and
the cells washed once
with PBS. 5 ml of 1 x trypsin was added to the cells in a T-175 flask, and the
cells were allowed to stand until
they were released from the plate (about 5-10 minutes). Trypsinization was
stopped by adding 5 ml of growth
media. The cells were spun at 1000 rpm for 5 minutes at 4°C. The media
was aspirated and the cells were
resuspended in 10 ml of 10% serum complemented medium (Cell Systems), 5 ~.1 of
Annexin-FITC (BioVison)
added and chilled tubes were submitted for FAGS. A positive result was
determined to be enhanced apoptosis
in the PRO polypeptide treated samples as compared to the negative control.
PR04302 polypeptide tested positive in this assay.
6.19. EXAMPLE 19: Induction of c-fos in HUVEC Cells (Assay 123)
This assay is designed to determine whether PRO polypeptides show the ability
to induce c-fos in
HUVEC cells. PRO polypeptides testing positive in this assay would be expected
to be useful for the therapeutic
treatment of conditions or disorders where angiogenesis would be beneficial
including, for example, wound
healing, and the like (as would agonists of these PRO polypeptides).
Antagonists of the PRO polypeptides testing
positive in this assay would be expected to be useful for the therapeutic
treatment of cancerous tumors.
Human venous umbilical vein endothelial cells (HUVEC, Cell Systems) in growth
media (50% Ham's
F12 w/o GHT: low glucose, and 50% DMEM without glycine: with NaHC03, 1 %
glutamine, 10 mM HEPES,
10% FBS, 10 ng/ml bFGF) were plated on 96-well microtiter plates at a cell
density of Sx103cells/well. The day
after plating (day 2), the cells were starved for 24 hours by removing the
growth media and replacing with serum
free media. On day 3, the cells are treated with 100 ~.1/well test samples and
controls (positive control = growth
media; negative control = Protein 32 buffer = 10 mM HEPES, 140 mM NaCI, 4%
(w/v) mannitol, pH 6.8).
One plate of cells was incubated for 30 minutes at 37°C, in 5 % COZ.
Another plate of cells was incubated for
60 minutes at 37°C, in 5% COZ. The samples were removed, and RNA was
harvested using the RNeasy 96 kit
(Qiagen). Next, the RNA was assayed for c-fos, egr-1 and GAPDH induction using
Taqman.
The measure of activity of the fold increase over the negative control
(Protein 32/HEPES buffer
described above) value was by obtained by calculating the fold increase of the
ratio of c-fos to GAPDH in test
samples as compared to the negative control. The results are considered
positive if the PRO polypeptide exhibits
at least a two-fold value over the negative buffer control.
PR01376 polypeptide tested positive in this assay.
143
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
6.20. EXAMPLE 20: Normal Human Iliac Artery Endothelial Cell Proliferation
(Assay 138)
This assay is designed to determine whether PRO polypeptides of the present
invention show the ability
to modulate proliferation of human iliac artery endothelial cells in culture
and, therefore, function as useful
growth or inhibitory factors.
On day 0, human iliac artery endothelial cells (from cell lines, maximum of 12-
14 passages) were plated
in 96-well plates at 1000 cells/well per 100 microliter and incubated
overnight in complete media [epithelial cell
growth media (EGM, Clonetics), plus supplements: human epithelial growth
factor (hEGF), bovine brain extract
(BBE), hydrocortisone, GA-1000, and fetal bovine serum (FBS, Clonetics)]. On
day 1, complete media was
replaced by basal media [EGM plus 1 % FBS] and addition of PRO polypeptides at
1 % , 0.1 % and 0.01 % . On
day 7, an assessment of cell proliferation was performed by Alamar Blue assay
followed by Crystal Violet.
Results are expressed as % of the cell growth observed with control buffer.
The following PRO polypeptides stimulated proliferation in this assay: PR0214,
PR0256, PR0363,
PR0365, PR0791, PR0836, PR01025, PR01186, PR01192, PR01272, PR01306, PR01325,
PR01329,
PR01376, PR01411, PR01508, PR01787, PR01868, PR04324, PR04333, PR04408,
PR04499, PR09821,
PR09873, PR010008, PR010096, PR019670, PR020040, PR020044 and PR021384.
The following PRO polypeptides inhibited proliferation in this assay: PR0238,
PR01029, PR01274,
PR01279, PR01419, PRO 1890, PR06006 and PR028631.
6.21. EXAMPLE 21: Pooled Human Umbilical Vein Endothelial Cell Proliferation
(Assay 139)
This assay is designed to determine whether PRO polypeptides of the present
invention show the ability
to modulate proliferation of pooled human umbilical vein endothelial cells in
culture and, therefore, function as
useful growth or inhibitory factors.
On day 0, pooled human umbilical vein endothelial cells (from cell lines,
maximum of 12-14 passages)
were plated in 96-well plates at 1000 cells/well per 100 microliter and
incubated overnight in complete media
[epithelial cell growth media (EGM, Clonetics), plus supplements: human
epithelial growth factor (hEGF), bovine
brain extract (BBE), hydrocortisone, GA-1000, and fetal bovine serum (FBS,
Clonetics)]. On day 1, complete
media was replaced by basal media [EGM plus 1 % FBS] and addition of PRO
polypeptides at 1 % , 0.1 % and
0.01 % . On day 7, an assessment of cell proliferation was performed by Alamar
Blue assay followed by Crystal
Violet. Results are expresses as % of the cell growth observed with control
buffer.
The following PRO polypeptides stimulated proliferation in this assay: PR0181,
PR0205, PR0221,
PR0231, PR0238, PR0241, PR0247, PR0256, PR0258, PR0263, PR0265, PR0295,
PR0321, PR0322,
PR0337, PR0363, PR0533, PR0697, PR0725, PR0771, PR0788, PR0819, PR0828,
PR0846, PR0865,
PRO1005, PRG1006, PR01025, PR01054, PR01071, PR01079, PR01080, PR01114,
PR01131, PRO1155,
PR01160, PR01192, PR01244, PR01272, PR01273, PR01279, PR01283, PR01286,
PR01306, PR01309,
PR01325, PR01329, PR01347, PR01356, PR01376, PR01382, PR01412, PRO1550,
PR01556, PR01760,
PR01787, PR01801, PR01868, PR01887, PR03438, PR03444, PR04324, PR04341,
PR04342, PR04353,
144
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
PR04354, PR04356, PR04371, PR04422, PR04425, PR05723, PR05737, PR06029,
PR06071, PR010096 and
PR021055.
The following PRO polypeptides inhibited proliferation in this assay: PR0229,
PR0444, PR0827,
PR01007, PR01075, PR01184, PRO1190, PR01195, PRO1419, PR01474, PR01477,
PR01488, PR01782,
PR04302, PRO4405, PRO5725, PRO5776, PR07436, PR09771, PR010008 and PR021384.
6.22. EXAMPLE 22: Human Coronary Artery Smooth Muscle Cell Proliferation
(Assay 140)
This assay is designed to determine whether PRO polypeptides of the present
invention show the ability
to modulate proliferation of human coronary artery smooth muscle cells in
culture and, therefore, function as
useful growth or inhibitory factors.
On day 0, human coronary artery smooth muscle cells (from cell lines, maximum
of 12-14 passages)
were plated in 96-well plates at 1000 cells/well per 100 microliter and
incubated overnight in complete media
[smooth muscle growth media (SmGM, Clonetics), plus supplements: insulin,
human epithelial growth factor
(hEGF), human fibroblast growth factor (hFGF), GA-1000, and fetal bovine serum
(FBS, Clonetics)]. On day
1, complete media was replaced by basal media [SmGM plus 1 % FBS] and addition
of PRO polypeptides at 1 % ,
0.1 % and 0.01 % . On day 7, an assessment of cell proliferation was performed
by Alamar Blue assay followed
by Crystal Violet. Results are expresses as % of the cell growth observed with
control buffer.
The following PRO polypeptides stimulated proliferation in this assay: PR0162,
PR0182, PR0204,
PRO221, PR0230, PR0256, PR0258, PR0533, PRO697, PR0725, PR0738, PRO826,
PRO836, PR0840,
PR0846, PR0865, PR0982, PR01025, PR01029, PR01071, PR01083, PR01134, PRO1160,
PR01182,
PR01184, PR01186, PR01192, PR01274, PR01279, PR01283, PR01306, PRO1308,
PRO1325, PR01337,
PR01338, PR01343, PR01376, PR01387, PR01411, PR01412, PR01415, PR01434,
PR01474, PRO1550,
PRO1556, PR01567, PR01600, PRO1754, PRO1758, PRO1760, PR01787, PR01865,
PR01868, PR01917,
PR01928, PR03438, PRO3562, PR04333, PRO4345, PRO4353, PRO4354, PR04408,
PRO4430, PRO4503,
PR06714, PR09771, PR09820, PRO9940, PR010096, PR021055, PR021184 and PR021366.
The following PRO polypeptides inhibited proliferation in this assay: PR0181,
PR0195, PRO1080,
PR01265, PR01309, PRO1488, PR04302, PRO4405 and PR05725.
6.23. EXAMPLE 23: Microarray Analysis to Detect Overexpression of PRO
Pol~ueytides in
HUVEC Cells Treated with Growth Factors
This assay is designed to determine whether PRO polypeptides of the present
invention show the ability
to induce angiogenesis by stimulating endothelial cell tube formation in HUVEC
cells.
Nucleic acid microarrays, often containing thousands of gene sequences, are
useful for identifying
differentially expressed genes in tissues exposed to various stimuli (e. g.,
growth factors) as compared to their
normal, unexposed counterparts. Using nucleic acid microarrays, test and
control mRNA samples from test and
control tissue samples are reverse transcribed and labeled to generate cDNA
probes. The cDNA probes are then
hybridized to an array of nucleic acids immobilized on a solid support. The
array is configured such that the
145
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
sequence and position of each member of the array is known. Hybridization of a
labeled probe with a particular
array member indicates that the sample from which the probe was derived
expresses that gene. If the hybridization
signal of a probe from a test (exposed tissue) sample is greater than
hybridization signal of a probe from a control
(normal, unexposed tissue) sample, the gene or genes overexpressed in the
exposed tissue are identified. The
implication of this result is that an overexpressed protein in an exposed
tissue may be involved in the functional
changes within the tissue following exposure to the stimuli (e. g. , tube
formation).
The methodology of hybridization of nucleic acids and microarray technology is
well known in the art.
In the present example, the specific preparation of nucleic acids for
hybridization and probes, slides, and
hybridization conditions are all detailed in U.S. Provisional Patent
Application Serial No. 601193,767, filed on
March 31, 2000 and which is herein incorporated by reference.
In the present example, HUVEC cells grown in either collagen gels or fibrin
gels were induced to form
tubes by the addition of various growth factors. Specifically, collagen gels
were prepared as described previously
in Yang et ad. , Americaf2 J. Pathology, 1999, 155(3):887-895 and Xin et al.
,America~z J. Pathology, 2001,
158(3):1111-1120. Following gelation of the HUVEC cells, 1X basal medium
containing M199 supplemented
with 1 % FBS, 1X ITS, 2 mM L-glutamine, 50 wg/ml ascorbic acid, 26.5 mM
NaHC03, 100U/ml penicillin and
100 U/ml streptomycin was added. Tube formation was elicited by the inclusion
in the culture media of either
a mixture of phorbol myrsitate acetate (50 nM), vascular endothelial cell
growth factor (40 ng/ml) and basic
fibroblast growth factor (40 ng/ml) ("PMA growth factor mix") or hepatocyte
growth factor (40 ng/ml) and
vascular endothelial cell growth factor (40 ng/xnl) (HGF/VEGF mix) for the
indicated period of time. Fibrin Gels
were prepared by suspending Huvec (4 x 105 cells/ml) in M199 containing 1 %
fetal bovine serum (Hyclone) and
human fibrinogen (2.5mg/ml). Thrombin (50U/ml) was then added to the
fibrinogen suspension at a ratio of 1
part thrombin solution:30 parts fibrinogen suspension. The solution was then
layered onto 10 cm tissue culture
plates (total volume: 15 ml/plate) and allowed to solidify at 37°C for
20 min. Tissue culture media (10 ml of BM
containing PMA (50 nM), bFGF (40ng/ml) and VEGF (40 ng/ml)) was then added and
the cells incubated at 37°C
in 5%COZ in air for the indicated period of time.
Total RNA was extracted from the HUVEC cells incubated for 0, 4, 8, 24, 40 and
50 hours in the
different matrix and media combinations using a TRIzol extraction followed by
a second purification using
RNAeasy Mini I~it (Qiagen). The total RNA was used to prepare cRNA which was
then hybridized to the
microarrays.
In the present experiments, nucleic acid probes derived from the herein
described PRO polypeptide-
encoding nucleic acid sequences were used in the creation of the microarray
and RNA from the HUVEC cells
described above were used for the hybridization thereto. Pairwise comparisons
were made using time 0 chips
as a baseline. Three replicate samples were analyzed for each experimental
condition and time. Hence there
were 3 time 0 samples for each treatment and 3 replicates of each successive
time point. Therefore, a 3 by 3
3 5 comparison was performed for each time point compared against each time 0
point. This resulted in 9
comparisons per time point. Only those genes that had increased expression in
all three non-time-0 replicates in
each of the different matrix and media combinations as compared to any of the
three time zero replicates were
146
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
considered positive. Although this stringent method of data analysis does
allow for false negatives, it minimizes
false positives.
PR0178, PR0195, PR0228, PR0301, PR0302, PR0532, PR0724, PR0730, PR0734,
PR0793,
PR0871, PR0938, PR01012, PR01120, PR01139, PR01198, PR01287, PR01361, PR01864,
PR01873,
PR02010, PR03579, PR04313, PR04527, PR04538, PR04553, PR04995, PR05730,
PR06008, PR07223,
PR07248 and PR07261 tested positive in this assay.
6.24. EXAMPLE 24: In situ Hybridization
In situ hybridization is a powerful and versatile technique for the detection
and localization of nucleic
acid sequences within cell or tissue preparations. It may be useful, for
example, to identify sites of gene
expression, analyze the tissue distribution of transcription, identify and
localize viral infection, follow changes
in specific mRNA synthesis, and aid in chromosome mapping.
In situ hybridization was performed following an optimized version of the
protocol by Lu and Gillett,
Cell Vision. 1: 169-176 (1994), using PCR-generated 33P-labeled riboprobes.
Briefly, formalin-fixed, paraffin-
embedded human tissues were sectioned, deparaffinized, deproteinated in
proteinase K (20 g/ml) for 15 minutes
at 37°C, and further processed for in situ hybridization as described
by Lu and Gillett, supra. A (33-P)UTP-
labeled antisense riboprobe was generated from a PCR product and hybridized at
55°C overnight. The slides
were dipped in Kodak NTB2TM nuclear track emulsion and exposed for 4 weeks.
6.24.1. 33P-Ribonrobe synthesis
6.0 ~d (125 mCi) of 33P-UTP (Amersham BF 1002, SA < 2000 Cilmmol) were speed-
vacuum dried. To
each tube containing dried 33P-UTP, the. following ingredients were added:
2.0 ,u1 5x transcription buffer
1.0 ~cl DTT (100 mM)
2.0 ~1 NTP mix (2.5 mM: 10 ~1 each of 10 mM GTP, CTP & ATP + 10 ~,1 H20)
1.0 ~,1 UTP (50 ~,M)
1.0 ~.1 RNAsin
1.0 ~1 DNA template (1 ~,g)
1.0 p,1 H20
1.0 p1 RNA polymerase (for PCR products T3 = AS, T7 = S, usually)
The tubes were incubated at 37°C for one hour. A total of 1.0 p,1 RQl
DNase was added, followed by
incubation at 37°C for 15 minutes. A total of 90 /d TE (10 mM Tris pH
7.611 mM EDTA pH 8.0) was added,
and the mixture was pipetted onto DE81 paper. The remaining solution was
loaded in a MICROCON-50TM
ultrafiltration unit, and spun using program 10 (6 minutes). The filtration
unit was inverted over a second tube
and spun using program 2 (3 minutes). After the final recovery spin, a total
of 100 ~cl TE was added, then 1 ~,1
of the final product was pipetted on DE81 paper and counted in 6 ml of
BIOFLUOR IITM.
147
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
The probe was run on a TBE/urea gel. A total of 1-3 p,1 of the probe or 5 ,u1
of RNA Mrk III was added
to 3 p1 of loading buffer. After heating on a 95°C heat block for three
minutes, the gel was immediately placed
on ice. The wells of gel were flushed, and the sample was loaded and run at
180-250 volts for 45 minutes. The
gel was wrapped in plastic wrap (SARANTn'' brand) and exposed to XAR film with
an intensifying screen in a
70°C freezer one hour to overnight.
6.24.2. 33P-H~rbridization
6.24.2.1. Pretreatment of frozen sections
The slides were removed from the freezer, placed on aluminum trays, and thawed
at room temperature
for 5 minutes. The trays were placed in a 55°C incubator for five
minutes to reduce condensation. The slides
were fixed for 10 minutes in 4% paraformaldehyde on ice in the fume hood, and
washed in 0.5 x SSC for 5
minutes, at room temperature (25 ml 20 x SSC + 975 ml SQ HZO). After
deproteination in 0.5 p.g/ml proteinase
K for 10 minutes at 37°C (12.5 ~,1 of 10 mg/ml stock in 250 ml
prewarmed RNAse-free RNAse buffer), the
sections were washed in 0.5 x SSC for 10 minutes at room temperature. The
sections were dehydrated in 70 % ,
95 % , and 100 % ethanol, 2 minutes each.
6.24.2.2. Pretreatment of paraffin-embedded sections
The slides were deparaffinized, placed in SQ HZO, and rinsed twice in 2 x SSC
at room temperature,
for 5 minutes each time. The sections were deproteinated in 20 p,g/ml
proteinase K (500 p1 of 10 mg/ml in 250
ml RNase-free RNase buffer; 37°C, 15 minutes) for human embryo tissue,
or 8 x proteinase K (100 p1 in 250
ml Rnase buffer, 37°C, 30 minutes) for formalin tissues. Subsequent
rinsing in 0.5 x SSC and dehydration were
performed as described above.
6.24.2.3. Prehybridization
The slides were laid out in a plastic box lined with Box buffer (4 x SSC, 50%
formamide) - saturated
filter paper. The tissue was covered with 50 ~zl of hybridization buffer (3.75
g dextran sulfate + 6 ml SQ H~O),
vortexed, and heated in the microwave for 2 minutes with the cap loosened.
After cooling on ice, 18.75 znl
formamide, 3.75 ml 20 x SSC, and 9 ml SQ HZO were added, and the tissue was
vortexed well and incubated
at 42°C for 1-4 hours.
6.24.2.4. Hybridization
1.0 x 106 cpm probe and 1.0 p1 tRNA (50 mg/ml stock) per slide were heated at
95°C for 3 minutes.
The slides were cooled on ice, and 48 ~,1 hybridization buffer was added per
slide. After vortexing, 50 p1 33P mix
was added to 50 w1 prehybridization on the slide. The slides were incubated
overnight at 55°C.
14~
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
6.24.2.5. Washes
Washing was done for 2x10 minutes with 2xSSC, EDTA at room temperature (400 ml
20 x SSC + 16
ml 0.25 M EDTA, Vf=4L), followed by RNAseA treatment at 37°C for 30
minutes (500 w1 of 10 mg/ml in 250
ml Rnase buffer = 20 p,g/ml), The slides were washed 2 x10 minutes with 2 x
SSC, EDTA at room temperature.
The stringency wash conditions were as follows: 2 hours at 55°C, 0.1 x
SSC, EDTA (20 ml 20 x SSC + 16 ml
EDTA, Vf=4L).
6.24.2.6. Oligorzucleotides
Irz situ analysis was performed on three of the DNA sequences disclosed
herein. The primers used to
generate the probes and/or the probes employed for these analyses are as
follows:
DNA33100-p 1: 5' GGA TTC TAA TAC GAC TCA CTA TAG GGC CGG GTG GAG GTG GAA CAG
AAA
3' (SEQ ID N0:375)
DNA33100-p2: 5' CTA TGA AAT TAA CCC TCA CTA AAG GGA CAC AGA CAG AGC CCC ATA
CGC
3' (SEQ ID N0:376)
DNA34431-pl: 5'GGA TTC TAA TAC GAC TCA CTA TAG GGC CAG GGA AAT CCG GAT GTC TC
3' (SEQ ID N0:377)
DNA34431-p2: 5' CTA TGA AAT TAA CCC TCA CTA AAG GGA GTA AGG GGA TGC CAC CGA
GTA
3' (SEQ ID N0:378)
DNA38268-pl: 5'GGA TTC TAA TAC GAC TCA CTA TAG GGC CAG CTA CCC GCA GGA GGA GG
3' (SEQ ID N0:379)
DNA38268-p2: 5'CTA TGA AAT TAA CCC TCA CTA AAG GGA TCC CAG GTG-ATG AGG TCC AGA
3' (SEQ ID N0:380)
DNA64908 probe: 5'CCATCTCGGAGACCTTTGTGCAGCGTGTATACCAGCCTTACCTCACCA
CTTGCGACGGACACAGAGCCTGCAGCACCTACCGAACCATCTACCGGAC
TGCCTATCGCCGTAGCCCTGGGGTGACTCCCGCAAGCCTCGCTATGCTTG
CTGCCCTGGTTGGAAGAGGACCAGTGGGCTCCCTGGGGCTTGTGGAGCA
GCAATATGCCAGCCTCCATGTGGGAATGGAGGGAGTTGCATCCGCCCAG
GACACTGCCGCTGCCCTGTGGGATGGCAGGGAGATACTTGCCAGACAGA
TGTTGATGAATGCAGTACAGGAGAGGCCAGTTGTCCCCAGCGCTGTGTC
AATACTGTGGGAAGTTACTGGTGCCAGGGATGGGAGGGACAAAGCCCAT
149
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
CTGCAGATGGGACGCGCTGCCTGTCTAAGGAGGGGCCCTCCCGGTGGCC
CCAACCCCACAGCAGGAGTGGACAGCA3' (SEQ ID N0:381)
6.24.2.7. Results
In situ analysis was performed and the results from these analyses are as
follows:
6.24.2.7.1. DNA33100-1159 (PR0229) (Scavenger-R/CD6
homolo~TNF motif)
A specific positive signal was observed in mononuclear phagocytes
(macrophages) of fetal and adult
spleen, liver, lymph node and thymus. All other tissues were negative.
6.24.2.7.2. DNA34431-1177 (PR0263) (CD44)
A specific positive signal was observed in human fetal tissues and placenta
over mononuclear cells, with
strong expression in epithelial cells of the adrenal cortex. All adult tissues
were negative.
6.24.2.7.3. DNA38268-1188 (PR0295) (Inte~rin)
A specific positive signal was observed in human fetal ganglion cells, fetal
neurons, adult adrenal medulla
and adult neurons. All other tissues were negative.
6.24.2.7.4. DNA64908-1163-1 (PR01449)
A specific positive signal was observed in the developing vasculature (from E7-
Ell), in endothelial cells
and in progenitors of endothelial cells in wholemount in situ hybridizations
of mouse embryos (Figure 375).
Specific expression was also observed in a subset of blood vessels and
epidermis from E12 onward. A mouse
orthologue of PR01449 which has about 78 % amino acid identity with PR01449
was used as the probe.
In normal adult tissues, expression was low to absent. When present,
expression was confined to the
vasculature (Figure 376). Figure 376 further shows that highest expression in
adult tissues was observed regionally
in vessels rmming within the white matter of the brain. Elevated expression
was also observed in vasculature of
many inflamed and diseased tissues, including, but not limited to, tumor
vasculature.
Following electroporation of the mouse orthologue of PR01449 into the choroid
layer in the eyes of
chicken embryos, new vessel formation was observed in the electroporated eye
(top right), but not in the control
side from the same embryo (top left), or an embryo that was electroporated
with a control cDNA (bottom right)
(Figure 377).
150
CA 02416538 2003-O1-16
WO 02/08284 PCT/USO1/21735
6.25. EXAMPLE 25: Inhibition of basic Fibroblast Growth Factor ~bFGF)
Stimulated Proliferation
of Endothelial Cell Growth
The ability of various PRO polypeptides to inhibit bFGF stimulated
proliferation of endothelial cells was
tested. Polypeptides testing positive in this assay are useful for inhibiting
endothelial cell growth in mammals where
such an effect would be beneficial, e.g., for inhibiting tumor growth.
Specifically, human venous umbilical vein endothelial cells (HUVEC, Cell
Systems) in epithelial cell
growth media (EGM, Clonetics) were plated on 96-well microtiter plates at a
cell density of 5x103 cells/well in
a volume of 100~1/well. The day after plating (day 2), the cells were starved
for 24 hours by removing the
growth media and replacing with starving media (M199 supplemented with 1 %
FBS, 2 mM L-glutamine, 100U/ml
penicillin and 100 U/ml streptomycin). On day 5, the cells are treated with
either: (1) M199 with 10% FBS; (2)
M199 with 1 % FBS; (3) M199 with 1 % FBS and 20 nglml bFGF; (4) M199 with 1 %
FBS and 20 ng/ml bFGF
and PRO polypeptide (500 nM); (5) M199 with 1 % FBS and 20 ng/ml bFGF and PRO
polypeptide (50 nM); or
(6) M199 with 1 % FBS and 20 ng/ml bFGF and PRO polypeptide (5 nM). On day 8,
an assessment of cell
proliferation was performed by Alamar Blue assay. Optical density (OD) was
measured on a microplate reader
at excitation 530 and emission at 590 nm.
The activity ofPRO polypeptides was calculated as the percent inhibition of
bFGF stimulated proliferation
relative to the cells without stimulation. The results are indicative of the
utility of the PRO polypeptides in cancer
therapy and specifically in inhibiting tumor angiogenesis. Numerical values
(relative inhibition) are determined
by calculating the percent inhibition of bFGF stimulated proliferation by the
PRO polypeptides relative to cells
without stimulation. The results are considered positive if the PRO
polypeptide exhibits 30% or greater inhibition
of bFEGF stimulation of endothelial cell growth.
PR05725 tested positive in this assay.
The foregoing written specification is considered to be sufficient to enable
one skilled in the art to practice
the invention. The present invention is not to be limited in scope by the
constructs) deposited, since the deposited
embodiments) is/are intended as single illustrations) of certain aspects of
the invention and any constructs that are
functionally equivalent are within the scope of this invention. The deposit of
materials) herein does not constitute
an admission that the written description herein contained is inadequate to
enable the practice of any aspect of the
invention, including the best mode thereof, nor is it to be construed as
limiting the scope of the claims to the specific
illustrations that it represents. Indeed, various modifications of the
invention in addition to those shown and
described herein will become apparent to those skilled in the art from the
foregoing description and fall within the
scope of the appended claims.
151
