Note: Descriptions are shown in the official language in which they were submitted.
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
NUCLEIC ACIDS COMPRISING REGIONS
OF THE RAT PEG-3 PROMOTER AND USES THEREOF
The invention disclosed herein was made with Government
support under National Cancer Institute Grant Nos. CA35675
and CA74468 from the U.S. Department of Health and Human
Services. Accordingly, the U.S. Government has certain
rights in this invention.
Background of the Invention
Throughout this application, various publications are
referenced by author and date within the text. Full
citations for these publications may be found listed
alphabetically at the end of the specification immediately
preceding the claims. All patents, patent applications and
publications cited herein, whether supra or infra, are hereby
incorporated by reference in their entirety. The disclosures
of these publications in their entireties are hereby
incorporated by reference into this application in order to
more fully describe the state of the art as known to those
skilled therein as of the date of the invention described and
claimed herein.
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-2-
Summary of the Invention
This invention provides for an isolated nucleic acid
comprising a PEG-3 promoter comprising the nucleotide
sequence beginning with the guanosine (G) at position -270
and ending with the cytosine (C) at position +194 of SEQ ID
NO: 1. The invention also provides for a method for
identifying an agent which modulates PEG-3 promoter activity
in a cell which comprises: (a) contacting the cell with the
agent wherein the cell comprises a nucleic acid comprising a
PEG-3 promoter operatively linked to a reporter gene; (b)
measuring the level of reporter gene expression in the cell;
and (c) comparing the expression level measured in step (b)
with the reporter gene expression level measured in an
Z5 identical cell in the absence of the agent, wherein a lower
expression level measured in the presence of the agent is
indicative of an agent that inhibits PEG-3 promoter activity
and wherein a higher expression level measured in the
presence of the agent is indicative of an agent that enhances
PEG-3 promoter activity, thereby identifying an agent which
modulates PEG-3 promoter activity in the cell. The invention
provides for a method for treating cancer in a subject which
comprises administering a nucleic acid comprising a PEG-3
promoter operatively linked to a gene-of-interest wherein the
gene of interest is selectively expressed in cancerous cells
in the subject and such expression regulates expression of
PEG-3 resulting in growth suppression or death of the
cancerous cells, thereby treating cancer in the subject.
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-3-
Brief Description of the Figures
Figures 1A-1C: Anchorage independent growth and PEG-3 mRNA
and protein expression in normal, adenovirus-transformed and
somatic cell hybrid rodent cells. (Fig. 1A) Anchorage-
independent growth assays were determined by plating 5 X 103
or 1 X 104 cells in 0.4o agar containing medium on top of a
0.8o agar medium containing base layer. After two weeks
growth, colonies __>0.1 mm were enumerated using an inverted
microscope. The results are the average of 3 independent
experiments using triplicate samples per experiment ~ SD.
(Fig. 1B) PEG3 MRNA levels were determined by
electrophoresing 15 ~.g of total cellular RNA in a 1.2%
agarose gel. RNA was transferred to nylon membranes and
l5 hybridized with a 32P-labeled PEG-3 cDNA probe, the blot was
stripped and then rehybridized with a 32P-labeled GAPDH probe.
(Fig. 1C) PEG-3 and actin protein levels were-determined by
Western blotting. Ten ~g of protein from each cell type was
loaded onto a 10% denatured polyacrylamide gel and
electrophoreised for 3 hr followed by transfer to a
nitrocellulose membrane. PEG-3 protein was detected using
Anti-PEG-3 antibody and actin protein was detected by Ant-
Actin antibody. Lane designation: 1 E11; 2 E11-NMT; 3 E11-
Ha-ras R12; 4 E11-NMT X CREF R1; 5 E11-NMT X CREF R2; 6_ E11-
NMT X CREF F1; 7 E11-NMT X CREF F2; and 8 CREF.
Figure 2: Sequence of the 2.0-kb PEG-3 promoter. (SEQ ID
NO:l) This fragment was identified by 5' DNA walking as
described in Materials and Methods. The location of PEA3 and
AP1 elements and the TATA boxes are indicated.
Ficrure 3: Determination of the transcription start site of
the PEG-3 promoter. A primer complementary to the 5' UTR
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-4-
region of PEG-3 mRNA (see Materials and Methods hereinbelow)
was annealed with 4 ~,g of Poly A+ RNAs from E11-NMT or E11
cells and used as a template for the primer extension assay.
The conditions used for reverse transcription were as
described in Materials and Methods. A DNA sequencing
reaction, using the same primer and PEG-3 promoter as the
template, was electrophoresed in parallel in the same gel
with the primer extension reaction.
Figure 4: Full-length PEG-3 promoter-luciferase activity in
normal, adenovirus transformed and somatic cell hybrid rodent
cells. Different cell types were co-transfected with 5 ~,g of
the FL PEG-Prom and 1 ~,g of a pSV-(3-galactosidase plasmid and
luciferase activity was determined as described in Materials
and Methods 48 hr later. The results are standardised by ~3-
galactosidase activity and represent the average of 3
independent experiments ~ SD. Results are expressed as fold
activation in comparison with activity in E11, which
represents 1 fold activation.
Figures 5A-5B: Mapping the regions of the PEG-3 promoter
necessary for basal and elevated PEG-Prom expression in E11
and E11-NMT cells. (Fig. 5A) Schematic representation of
deletion mutants of the PEG-Prom. Mutants were constructed
as described in Materials and Methods. (Fig. 5B) Fold
activation of the FL-PEG-Prom (lane 1) and the various PEG-
Prom deletion mutants (lanes 2 to 11) in E11 and E11-NMT
cells. Fold activation compares the FL-PEG-Prom and various
deletion mutants of PEG-Prom versus the specific PEG-Prom
deletion construct (deleted at position -40) which contains
the TATA box and AP1 element. This deletion construct is
given the arbitrary value of one. Promoter-luciferase assays
were performed as described in Materials and Methods.
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-5-
Figures 6A-6B: Mutation analysis of the PEAS and AP1 sites
and the TATA box in the PEG-Prom. (Fig. 6A) Schematic
representation of the specific mutations in the PEG-Prom
analyzed for activity in E11 and Ell-NMT cells. Point
mutations were made using a site-specific mutagenesis as
described in Materials and Methods. (Fig. 6B) Fold activation
of the various PEG-Prom mutants in E11 and E11-NMT cells.
Fold activation compares the PEG-Prom mutant (deleted at
position -118) and additional mutants containing point or
deletion mutations effecting the PEA3 and AP1 sites and/or
the TATA box region versus the specific PEG-Prom deletion
construct (deleted at position -40) which contains a wild-
type TATA box and AP1 element. This latter deletion
construct is given the arbitrary value of one. Promoter-
luciferase assays were performed as described in Materials
and Methods.
Figures 7A-7B: Analysis of nuclear protein binding to AP1
and PEA3 elements by EMSA. (Fig. 7A) AP1 and (Fig. 7B) PEA3
nucleoprotein complexes in E11 and E11-NMT cells were
identified using EMSA. Nuclear extracts were prepared from
the two cell types and incubated with an AP1 or PEA3 probe
labeled with 32P using y32P-ATP and T4 DNA kinase. The
reaction mixture was electrophoreised in a 5% non-denatured
polyacrylamide gel as described in Materials and Methods.
Arrow 1 indicates supershifted AP1 (Fig. 7A) or PEA3 (Fig.
7B) DNA-protein-antibody complexes and arrow 2 indicates the
AP1 (Fig. 7A) or PEA3 (Fig. 7B) DNAprotein complexes in E11
and E11-NMT cells. All of the samples contain nuclear
extracts from either E11 or E11-NMT cells. Mut-oligo sample
contains a mutated AP1 (Fig. 7A) or PEAS (Fig. 7B)
oligonucleotide. WT-Oligo sample contains a wild-type AP1
(Fig. 7A) or PEAS (Fig. 7B) oligonucleotide. Competitor
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-6-
refers to the presence of a 10X (10-fold) or 10OX (100-fold)
molar excess of unlabeled competitor oligonucleotides. cJun
Ab (Fig. 7A) and PEA3-Ab (Fig. 7B) samples contain 1 or 5 ~.g
of the respective antibody. Actin-Ab sample contains 5 ~.g of
anti-actin antibody.
Figure 8: Effect of ectopic expression of cJun (AP1) and
PEAS, alone and in combination, on FL-PEG-Prom activity in
E11 cells. Various amounts (50 to 500 ng) of wild-type cJun
(wtcjun), mutant TAM67 cJun (mutcjun), pcDNA3.1 (control
vector), PEA3 (pEA3), pRC/RSV (control vector), a combination
of PEAS and wild-type cJun (pEA3 + wtcjun) or a combination
of control vectors (pRC/RSV + pCDNA3.l) were transfected with
5 ~,g of pGL3/PEG-Prom and 1 ~,g of pSV-(3-galactosidase vector
into E11 cells. The results represent average fold
activation in comparison with vector transfected E11 cells of
2 independent experiments with triplicate samples per
experiment ~ SD.
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
Detailed Description of the Invention
The following several of the abbreviations used herein:
progression elevated gene-3 (PEG-3); rat embryonic cells (RE
cells); PEG-promoter (PEG-Prom); kilobases (kb). Throughout
this application, references to specific nucleotides are to
nucleotides present on the coding strand of the nucleic acid.
The following standard abbreviations are used throughout the
specification to indicate specific nucleotides:
ZO
C=cytosine A=adenosine
T=thymidine G=guanosine
This invention provides for an isolated nucleic acid
comprising a PEG-3 promoter comprising the nucleotide
sequence beginning with the guanosine (G) at position -270
and ending with the cytosine (C) at position +194 of SEQ ID
NO: 1.
The invention also provides for an isolated nucleic acid
comprising a fragment of the nucleotide sequence of claim 1
which is at least 15 nucleotides in length.
In one embodiment, the nucleic acid fragment comprises
(i) a PEA3 protein binding sequence consisting of the
nucleotide sequence beginning with the thymidine (T) at
position -105 and ending with the thymidine (T) at
position -100 of SEQ ID NO: 1,
(ii) a TATA sequence consisting of the nucleotide sequence
beginning with the thymidine (T) at position -29 and
ending with the adenosine (A) at position -24 of SEQ ID
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
_g_
NO: 1, or
(iii) an AP1 protein binding sequence consisting of the
nucleotide sequence beginning with the thymidine
(T) at position +6 and ending with the adenosine
(A) at position +12 of the nucleotide sequence
shown in SEQ ID N0: 1.
In another embodiment, the nucleic acid comprises at least
ZO two of the nucleotide sequences (i) to (iii) listed above.
In another embodiment, the nucleic acid comprises the three
nucleotide sequences (i) to (iii) listed above.
l5 In another embodiment, the fragment has promoter activity.
In another embodiment, the fragment is operably linked to a
gene of interest. In another embodiment, the gene of
interest is a reporter gene.
In another embodiment, the reporter gene encodes beta-
galactosidase, luciferase, Chloramphenicol transferase or
alkaline phosphatase.
In another embodiment, the gene of interest is a tumor
suppressor gene, a gene whose expression causes apoptosis of
a cell, or a CytotoxiC gene.
The invention provides for a vector Comprising at least one
of the nucleic acids described herein. The invention also
provides for a host cell comprising this vector.
In another embodiment, the host cell is a tumor Cell. In
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-9-
another embodiment, the tumor cell is a melanoma cell, a
neuroblastoma cell, a cervical cancer cell, a breast cancer
cell, a lung cancer cell, a prostate cancer cell, a colon
cancer cell or a glioblastoma multiforme cell.
The invention also provides for a method for identifying an
agent which modulates PEG-3 promoter activity in a cell which
comprises:
(a) contacting the cell with the agent wherein the cell
comprises a nucleic acid comprising a PEG-3 promoter
operatively linked to a reporter gene; (b) measuring the
level of reporter gene expression in the cell; and (c)
comparing the expression level measured in step (b) with the
reporter gene expression level measured in an identical cell
l5 in the absence of the agent, wherein a lower expression level
measured in the presence of the agent is indicative of an
agent that inhibits PEG-3 promoter activity and wherein a
higher expression level measured in the presence of the agent
is indicative of an agent that enhances PEG-3 promoter
activity, thereby identifying an agent which modulates PEG-3
promoter activity in the cell.
In another embodiment, the cell is a melanoma cell, a
neuroblastoma cell, a cervical cancer cell, a breast cancer
cell, a lung cancer cell a prostate cancer cell, a colon
cancer cell or a glioblastoma multiforme cell.
In another embodiment, the agent comprises a molecule having
a molecular weight of about 7 kilodaltons or less.
In another embodiment, the agent is an antisense nucleic acid
comprising a nucleotide sequence complementary to at least a
portion of the sequence shown in SEQ ID NO: 1 and is at least
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-10-
15 nucleotides in length.
In another embodiment, the agent is a DNA molecule, a
carbohydrate, a glycoprotein, a transcription factor protein
or a double-stranded RNA molecule.
In another embodiment, the agent is a synthetic nucleotide
sequence, a peptidomimetiC, or an organic molecule having a
molecular weight from 0.1 kilodaltons to 10 kilodaltons.
l0
In another embodiment, the reporter gene encodes beta-
galactosidase, luciferase, Chloramphenicol transferase or
alkaline phosphatase.
In another embodiment, expression of PEG-3 promoter activity
measured is equal to or greater than a 2.5 to 3.5 fold
increase or decrease.
The invention provides for a method for treating cancer in a
subject which comprises administering a nucleic acid
comprising a PEG-3 promoter operatively linked to a gene-of-
interest wherein the gene of interest is selectively
expressed in cancerous cells in the subject and such
expression regulates expression of PEG-3 resulting in growth
suppression or death of the cancerous cells, thereby treating
cancer in the subject.
In one embodiment of this invention, the nucleic acid
consists essentially of (i) a PEA3 protein binding sequence
consisting of the nucleotide sequence beginning with the
thymidine (T) at position -105 and ending with the thymidine
(T) at position -100 of SEQ ID NO: l, (ii) a TATA sequence
consisting of the nucleotide sequence beginning with the
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-11-
thymidine (T) at position -29 and ending with the adenosine
(A) at position -24 of SEQ ID NO: l, and (iii) an AP1 protein
binding sequence consisting of the nucleotide sequence
beginning with the thymidine (T) at position +6 and ending
with the adenosine (A) at position +12 of the nucleotide
sequence shown in SEQ ID NO: 1.
In another embodiment, the nucleic acid has a sequence
complementary to at least a portion of SEQ ID N0: 1 of at
least 25 nucleotides in length,
In another embodiment, the cancer is melanoma, neuroblastoma,
astrocytoma, glioblastoma multiforme, cervical Cancer, breast
cancer, colon cancer, prostate cancer, osteoscarcoma or
chrondosarCOma.
In another embodiment, the administering is carried out via
injection, oral administration, topical administration,
adenovirus infection, liposome-mediated transfer, topical
application to the Cells of the subject, or microinjection.
In another embodiment, the subject is a mammal. In another
embodiment, the mammal is a human. In another embodiment,
the gene of interest is an gene whose expression causes
apoptosis of a cell.
In another embodiment, the gene comprises an Mda-7 gene or a
p53 gene. In another embodiment, the gene of interest is a
tumor suppressor gene. In another embodiment, the suppressor
gene is mda-7. In another embodiment, the gene of interest
is a Cytotoxic gene. In another embodiment, expression of
the Cytotoxic gene causes cell death.
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-12-
In another embodiment, the cytotoxic gene is selected from
the group consisting of HSV-TK, p21, p27, and p10.
The practice of the present invention will employ, unless
otherwise indicated, conventional techniques of molecular
biology, microbiology, virology, recombinant DNA technology,
and immunology, which are within the skill of the art. Such
techniques are explained fully in the literature. See, e.g.,
Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory
Manual, Second Edition (1989); DNA Cloning, Vols. I and II
(D. N. Glover ed. 1985); Oligonucleotide Synthesis (M. J.
Gait ed. 1984); Nucleic Acid Hybridization (B. D. Hames & S.
J. Higgins eds. 1984); Animal Cell Culture (R. K. Freshney
ed. 1986); Immobilized Cells and Enzymes (IRL press, 1986);
Perbal, B., A Practical Guide to Molecular Cloning (1984);
the series, Methods In Enzymology (S. Colowick and N. Kaplan
eds., Academic Press, Inc.); and Handbook of Experimental
Immunology, Vols. I-IV (D. M. Weir and C. C. Blackwell eds.,
1986, Blackwell Scientific Publications).
As used in this specification and the appended claims, the
singular forms "a," "an" and "the" include plural references
unless the content clearly dictates otherwise.
The invention provides for a host cell comprising the
recombinant expression construct as described herein.
In another embodiment of the invention, the host cell is
stably transformed with the recombinant expression construct
described herein. In another embodiment of the invention,
the host cell is a tumor cell.
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-13-
In another embodiment of the invention, the host cell is a
melanocyte. In another embodiment of the invention, the cell
is an immortalized cell.
In another embodiment of the invention, the tumor cell is a
melanoma cell, a neuroblastoma cell, an astrocytoma cell, a
glioblastomoa multifore cell, a Cerival cancer cell, a breast
cancer cell, a lung cancer cell or a prostate cancer cell.
The invention provides for a method for expressing foreign
DNA in a host cell comprising: introducing into the host cell
a gene transfer vector comprising a PEG-3 promoter nucleotide
sequence operably linked to a foreign DNA encoding a desired
polypeptide or RNA, wherein said foreign DNA is expressed.
In another embodiment of the invention, the gene transfer
vector encodes and expresses a reporter molecule.
In another embodiment of the invention, the reporter molecule
is selected from the group consisting of beta-galactosidase,
luciferase and chloramphenicol acetyltransferase.
In another embodiment of the invention, the "introducing" is
carried out by a means selected from the group consisting of
adenovirus infection, liposome-mediated transfer, topical
application to the cell, and microinjection.
In another embodiment of the invention, the cancer is
melanoma, neuroblastoma, astrocytoma, glioblastoma
multiforme, cervical cancer, breast cancer, colon cancer,
prostate cancer, osteoscarcoma, or Chrondosarcoma.
In another embodiment of the invention, the cancer is a
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-14-
cancer of the central nervous system of the subject.
Tn another embodiment of the invention, the administering is
carried out via injection, oral administration, or topical
administration.
In another embodiment of the invention, the carrier is an
aqueous carrier, a liposome, or a lipid carrier.
l0 Definitions
As used herein "therapeutic gene" means DNA encoding an amino
acid sequence corresponding to a functional protein capable
of exerting a therapeutic effect on cancer cells or having a
regulatory effect on the expression of a gene which functions
in cells.
As used herein "nucleic acid molecule" includes both DNA and
RNA and, unless otherwise specified, includes both double-
stranded and single-stranded nucleic acids. Also included are
hybrids such as DNA-RNA hybrids. Reference to a nucleic acid
sequence can also include modified bases as long as the
modification does not significantly interfere either with
binding of a ligand such as a protein by the nucleic acid or
Watson-Crick base pairing.
As used herein "enhancer element" is a nucleotide sequence
that increases the rate of transcription of the therapeutic
genes or genes of interest but does not have promoter
activity. An enhancer can be moved upstream, downstream, and
to the other side of a promoter without significant loss of
activity.
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-15-
Two DNA or polypeptide sequences are "substantially
homologous" when at least about 80% (preferably at least
about 90o, and most preferably at least about 950-99%) of the
nucleotides or amino acids match over a defined length of the
molecule. As used herein, "substantially homologous" also
refers to sequences showing identity (100% identical
sequence) to the specified DNA or polypeptide sequence. DNA
sequences that are substantially homologous can be identified
in a Southern hybridization, experiment under, for example,
stringent conditions, as defined for that particular system.
Defining appropriate hybridization conditions is within the
skill of the art. See, e.g., Sambrook et al., supra; DNA
Cloning, vols I & II, supra; Nucleic Acid Hybridization,
supra.
A sequence "functionally equivalent" to a PEG-3 promoter
sequence is one which functions in the same manner as the
PEG-3 promoter sequence. Thus, a promoter sequence
"functionally equivalent" to the PEG-3 promoter described
20 herein is one which is capable of directing transcription of
a downstream coding sequence in substantially similar time-
frames of expression and in substantially similar amounts and
with substantially similar tissue specificity as the PEG-3
promoter sequence.
A DNA "coding sequence" or a "nucleotide sequence encoding"
a particular protein, is a DNA sequence which is transcribed
and translated into a polypeptide in vivo or in vitro when
placed under the control of appropriate regulatory sequences.
The boundaries of the coding sequence are determined by a
start codon at the 5'-(amino) terminus and a translation stop
codon at the 3'-(carboxy) terminus. A coding sequence can
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-16-
include, but is not limited to, procaryotic sequences, cDNA
from eucaryotic mRNA, genomic DNA sequences from eucaryotic
(e. g., mammalian) sources, viral RNA or DNA, and even
synthetic nucleotide sequences. A transcription termination
sequence will usually be located 3' to the coding sequence.
DNA "control sequences" refers collectively to promoter
sequences, polyadenylation signals, transcription termination
sequences, upstream regulatory domains, enhancers, and the
like, untranslated regions, including 5'-UTRs (untranslated
regions) and 3'-UTRs, which collectively provide for the
transcription and translation of a coding sequence in a host
cell.
"Operably linked" refers to an arrangement of nucleotide
sequence elements wherein the components so described are
configured so as to perform their usual function. Thus,
control sequences operably linked to a coding sequence are
capable of effecting the expression of the coding sequence.
The control sequences need not be contiguous with the coding
sequence, so long as they function to direct the expression
thereof. Thus, for example, intervening untranslated yet
transcribed sequences can be present between a promoter
sequence and the coding sequence and the promoter sequence
can still be considered "operably linked" to the coding
sequence.
A control sequence "directs the transcription" of a coding
sequence in a cell when RNA polymerase will bind the promoter
sequence and transcribe the coding sequence into mRNA, which
is then translated into the polypeptide encoded by the coding
sequence.
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-17-
A cell has been "transformed" by exogenous DNA when such
exogenous DNA has been introduced inside the cell membrane.
Exogenous DNA may or may not be integrated (covalently
linked) into chromosomal DNA making up the genome of the
cell. In procaryotes and yeasts, for example, the exogenous
DNA may be maintained on an episomal element, such as a
plasmid. In eucaryotic cells, a stably transformed cell is
generally one in which the exogenous DNA has become
integrated into the chromosome so that it is inherited by
daughter cells through chromosome replication, or one which
includes stably maintained extrachromosomal plasmids. This
stability is demonstrated by the ability of the eucaryotic
cell to establish cell lines or clones comprised of a
population of daughter cells containing the exogenous DNA.
A "heterologous" region of a DNA construct is an identifiable
segment of DNA within or attached to another DNA molecule
that is not found in association with the other molecule in
nature. For example, a sequence encoding a protein other
than a PEG-3 protein is considered a heterologous sequence
when linked to a PEG-3 promoter. Another example of a
heterologous coding sequence is a construct where the coding
sequence itself is not found in nature (e. g., synthetic
sequences having codons different from the native gene).
Likewise, a chimeric sequence, comprising a heterologous gene
linked to a PEG-3 promoter, will be considered heterologous
since such chimeric constructs are not normally found in
nature. Allelic variation or naturally occurring mutational
events do not give rise to a heterologous region of DNA, as
used herein.
ZTectors
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-18-
Especially preferred are virus based vectors. In the case of
eukaryotic cells, retrovirus or adenovirus based vectors are
preferred. Such vectors contain all or a part of a viral
genome, such as long term repeats ("LTRs"), promoters (e. g.,
CMV promoters, SV40 promoter, RSV promoter), enhancers, anal
so forth. When the host cell is a prokaryote, bacterial
viruses, or phages, are preferred. Exemplary of such vectors
are vectors based upon, e.g., lambda phage. In any case, the
vector may comprise elements of more than one virus.
l0
The resulting vectors are transfected or transformed into a
host cell, which may be eukaryotic or prokaryotic.
The gene transfer vector of the present invention may
l5 additionally comprise a gene encoding a marker or reporter
molecule to more easily trace expression of the vector.
The particular reporter molecule which can be employed in the
present invention is not critical thereto. Examples of such
20 reporter molecules which can be employed in the present
invention are well-known in the art and include beta-
galactosidase (Fowler et al, Proc. Natl. Acad. Sci., USA,
74:1507 (1977)), luciferase (Tu et al, Biochem., 14:1970
(1975)), and chloramphenicol acetyltransferase (Gorman et al,
25 Mol. Cell Biol., 2:1044-1051 (1982)).
The gene transfer vector may contain more than one gene
encoding the same or different foreign polypeptides or RNAs.
30 The gene transfer vector may be any construct which is able
to replicate within a host cell and includes plasmids, DNA
viruses, retroviruses, as well as isolated nucleotide
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-19-
molecules. Liposome-mediated transfer of the gene transfer
vector may also be carried out in the present invention.
Examples of such plasmids which can be employed in the
present invention include pGL3-based plasmids (PromegaTm).
An example of such DNA viruses which can be employed in the
present invention are adenoviruses.
Adenoviruses have attracted increasing attention as
expression vectors, especially for human gene therapy
(Berkner, Curr. Top. Microbiol. Immunol., 158:39-66 (1992)).
Examples of such adenovirus serotypes which can be employed
in the present invention are well-known in the art and
include more than 40 different human adenoviruses, e.g., Adl2
(subgenus A), Ad3 and Ad7 (Subgenus B), Ad2 and Ad5 (Subgenus
C), Ad8 (Subgenus D), Ad4 (Subgenus E), Ad40 (Subgenus F)
(Wigand et al, In: Adenovirus DNA, Doerfler, Ed., Martinus
Nijhoff Publishing, Boston, pp. 408-441 (1986)). Ad5 of
subgroup C is the preferred adenovirus employed in the
present invention. This is because Ad5 is a human adenovirus
about which a great deal of biochemical and genetic
information is known, and it has historically been used for
most constructions employing adenovirus as a vector. Also,
adenoviral vectors are commercially available, e.g., pCA3
(Microbix Biosystems InC.).
Methods for producing adenovirus vectors are well-known in
the art (Berkner et al, Nucleic Acids Res., 11:6003-6020
(1983); van Doren et al, Mol. Cell. Biol., 4:1653-1656
(1984); Ghosh-Choudhury et al, Biochem. Biophys. Res.
Commun., 147:964-973 (1987); MCGrory et al, Virol., 163:614-
617 (1988); and Gluzman et al, In: EurkaryotiC Viral Vectors,
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-20-
Ed. Gluzman, Y, pages 187-192, Cold Spring Harbor Laboratory
(1982) ) .
Derivative nucleic acid molecules
Derivative molecules would retain the functional property of
the PEG-3 promoter, namely, the molecule having such
substitutions will still permit the tissue specific
expression of the gene of interest. Modification is
permitted so long as the derivative molecules retain its
increased potency compared to PEG-3 promoter alone and its
tissue specificity.
Examples of therapeutic genes include suicide genes. These
are genes sequences the expression of which produces a
protein or agent that inhibits melanoma tumor cell growth or
induces melanoma tumor cell death. Suicide genes include
genes encoding enzymes, oncogenes, tumor suppressor genes,
genes encoding toxins, genes encoding cytokines, or a gene
encoding oncostatin. The purpose of the therapeutic gene is
to inhibit the growth of or kill skin cancer cells or produce
cytokines or other cytotoxic agents which directly or
indirectly inhibit the growth of or kill the cancer cell.
Suitable enzymes include thymidine kinase (TK), xanthine-
guanine phosphoribosyltransferase (GPT) gene from E. coli or
E. coli cytosine deaminase (CD), or hypoxanthine
phosphoribosyl transferase (HPRT).
Suitable oncogenes and tumor suppressor genes include neu,
EGF, ras (including H, K, and N ras), p53, Retinoblastoma
tumor suppressor gene (Rb), Wilm's Tumor Gene Product,
Phosphotyrosine Phosphatase (PTPase), and nm23. Suitable
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-21-
toxins include Pseudomonas exotoxin A and S; diphtheria toxin
(DT); E. coli LT toxins, Shiga toxin, Shiga-like toxins (SLT-
1, -2), ricin, abrin, supporin, and gelonin.
Suitable cytokines include interferons, GM-CSF interleukins,
tumor necrosis factor (TNF) (Wong G, et al., Human GM-CSF:
Molecular cloning of the complementary DNA and purification
of the natural and recombinant proteins. Science 1985;
228:810); W09323034 (1993); Horisberger M. A., et al.,
Cloning and sequence analyses of cDNAs for interferon-beta
and virus-induced human Mx proteins reveal that they contain
putative guanine nucleotide-binding sites: functional study
of the corresponding gene promoter. Journal of Virology, 1990
Mar, 64(3):1171-81; Li YP et al., Proinflammatory cytokines
tumor necrosis factor-alpha and IL-6, but not IL-1, down-
regulate the osteocalcin gene promoter. Journal of
Immunology, Feb. l, 1992, 148 (3) :788-94; Pizarro T. T. , et
al. Induction of TNF alpha and TNF beta gene expression in
rat cardiac transplants during allograft rejection.
Transplantation, 1993 Aug., 56(2):399-404). (Breviario F., et
al., Interleukin-1-inducible genes in endothelial cells.
Cloning of a new gene related to C-reactive protein and serum
amyloid P component. Journal of Biological Chemistry, Nov. 5,
1992, 267(31):22190-7; Espinoza-Delgado I., et al.,
Regulation of IL-2 receptor subunit genes in human monocytes.
Differential effects of IL-2 and IFN-gamma. Journal of
Immunology, Nov. 1, 1992, 149(9):2961-8; Algate P. A., et
al., Regulation of the interleukin-3 (IL-3) receptor by IL-3
in the fetal liver-derived FL5.12 cell line. Blood, 1994 May
l, 83(9):2459-68; Cluitmans F. H., et al., IL-4 down-
regulates IL-2-, IL-3-, and GM-CSF-induced cytokine gene
expression in peripheral blood monocytes. Annals of
Hematology, 1994 Jun., 68(6):293-8; Lagoo, A. S., et al., IL-
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-22-
2, IL-4, and IFN-gamma gene expression versus secretion in
superantigen-activated T cells. Distinct requirement for
costimulatory signals through adhesion molecules. Journal of
Immunology, Feb. 15, 1994, 152(4):1641-52; Martinez O. M., et
al., IL-2 and IL-5 gene expression in response to alloantigen
in liver allograft recipients and in vitro. Transplantation,
1993 May, 55(5):1159-66; Pang G, et al., GM-CSF, IL-1 alpha,
IL-1 beta, IL-6, IL-8, IL-10, ICAM-1 and VCAM-1 gene
expression and cytokine production in human duodenal
fibroblasts stimulated with lipopolysaccharide, IL-1 alpha
and TNF-alpha. Clinical and Experimental Immunology, 1994
Jun. , 96 (3) :437-43; Ulich T. R. , et al . , Endotoxin-induced
cytokine gene expression in vivo. III. IL-6 mRNA and serum
protein expression and the in vivo hematologic effects of IL-
6. Journal of Immunology, Apr. 1, 1991, 146(7):2316-23;
Mauviel A., et al., Leukoregulin, a T cell-derived cytokine,
induces IL-8 gene expression and secretion in human skin
fibroblasts. Demonstration and secretion in human skin
fibroblasts. Demonstration of enhanced NF-kappa B binding and
NF-kappa B-driven promoter activity. Journal of Immunology,
Nov. l, 1992, 149(9):2969-76).
Growth factors include Transforming Growth Factor-.alpha.
(TGF-alpha) and beta (TGF-beta), cytokine colony stimulating
factors (Shimane M., et al., Molecular cloning and
characterization of G-CSF induced gene cDNA. Biochemical and
Biophysical Research Communications, Feb. 28, 1994,
199(1):26-32; Kay A. B., et al., Messenger RNA expression of
the cytokine gene cluster, interleukin 3 (IL-3), IL-4, IL-5,
and granulocyte/macrophage colony-stimulating factor, in
allergen-induced late-phase Cutaneous reactions in atopic
subjects. Journal of Experimental Medicine, Mar. 1, 1991,
173(3):775-8; de Wit H, et al., Differential regulation of M-
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-23-
CSF and IL-6 gene expression in monocytic cells. British
Journal of Haematology, 1994 Feb., 86(2):259-64; Sprecher E.,
et al., Detection of TL-1 beta, TNF-alpha, and IL-6 gene
transcription by the polymerase chain reaction in
keratinocytes, Langerhans cells and peritoneal exudate cells
during infection with herpes simplex virus-1. Archives of
Virology, 1992, 126(1-4):253-69).
Preferred vectors for use in the methods of the present
invention are viral including adenoviruses, retroviral,
vectors, adeno-associated viral (AAV) vectors.
The viral vector selected should meet the following criteria:
1) the vector must be able to infect the tumor cells and thus
viral vectors having an appropriate host range must be
selected; 2) the transferred gene should be capable of
persisting and being expressed in a cell for an extended
period of time; and 3) the vector should be safe to the host
and cause minimal cell transformation. Retroviral vectors and
adenoviruses offer an efficient, useful, and presently the
best-characterized means of introducing and expressing
foreign genes efficiently in mammalian cells. These vectors
have very broad host and cell type ranges, express genes
stably and efficiently. The safety of these vectors has been
proved by many research groups. In fact many are in clinical
trials.
Other virus vectors that may be used for gene transfer into
cells for correction of disorders include retroviruses such
as Moloney murine leukemia virus (MoMuLV); papovaviruses such
as JC, SV40, polyoma, adenoviruses; Epstein-Barr Virus (EBV);
papilloma viruses, e.g. bovine papilloma virus type I (BPV);
vaccinia and poliovirus and other human and animal viruses.
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-24-
Adenoviruses have several properties that make them
attractive as cloning vehicles (Bachettis et al.: Transfer of
gene for thymidine kinase-deficient human cells by purified
herpes simplex viral DNA. PNAS USA, 1977 74:1590; Berkner, K.
L.: Development of adenovirus vectors for expression of
heterologous genes. Biotechniques, 1988 6:616; Ghosh-
Choudhury G., et al., Human adenovirus cloning vectors based
on infectious bacterial plasmids. Gene 1986; 50:161; Hag-
Ahmand Y., et al., Development of a helper-independent human
adenovirus vector and its use in the transfer of the herpes
simplex virus thymidine kinase gene. J Virol 1986; 57:257;
Rosenfeld M., et al., Adenovirus-mediated transfer of a
recombinant .alpha.1 -antitrypsin gene to the lung
epithelium in vivo. Science 1991; 252:431).
For example, adenoviruses possess an intermediate sized
genome that replicates in cellular nuclei; many serotypes are
clinically innocuous; adenovirus genomes appear to be stable
despite insertion of foreign genes; foreign genes appear to
be maintained without loss or rearrangement; and adenoviruses
can be used as high level transient expression vectors with
an expression period up to 4 weeks to several months.
Extensive biochemical and genetic studies suggest that it is
possible to substitute up to 7-7.5 kb of heterologous
sequences for native adenovirus sequences generating viable,
conditional, helper-independent vectors (Kaufman R. J.;
identification of the component necessary for adenovirus
translational control and their utilisation in cDNA
expression vectors. PNAS USA, 1985 82:689).
AAV is a small human parvovirus with a single stranded DNA
genome of approximately 5 kb. This virus can be propagated as
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-25-
an integrated provirus in several human cell types. AAV
vectors have several advantage for human gene therapy. For
example, they are trophic for human cells but can also infect
other mammalian. cells; (2) no disease has been associated
with AAV in humans or other animals; (3) integrated AAV
genomes appear stable in their host cells; (4) there is no
evidence that integration of AAV alters expression of host
genes or promoters or promotes their rearrangement; (5)
introduced genes can be rescued from the host cell by
infection with a helper virus such as adenovirus.
HSV-1 vector system facilitates introduction of virtually any
gene into non-mitotic cells (teller et al. an efficient
deletion mutant packaging system for a defective herpes
simplex virus vectors: Potential applications to human gene
therapy and neuronal physiology. PNAS USA, 1990 87:8950).
Another vector for mammalian gene transfer is the bovine
papilloma virus-based vector (Sarver N, et al., Bovine
papilloma virus DNA: A novel eukaryotic cloning vector. Mol
Cell Biol 1981; 1:486).
Vaccinia and other poxvirus-based vectors provide a mammalian
gene transfer system. Vaccinia virus is a large double-
stranded DNA virus of 120 kilodaltons (kd) genomic size
(Panicali D, et al., Construction of poxvirus as cloning
vectors: Insertion of the thymidine kinase gene from herpes
simplex virus into the DNA of infectious vaccine virus. Proc
Natl Acad Sci USA 1982; 79:4927; Smith et al. infectious
vaccinia virus recombinants that express hepatitis B virus
surface antigens. Nature, 1983 302:490.)
Retroviruses are packages designed to insert viral genes into
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-26-
host cells (Guild B, et al., Development of retrovirus
vectors useful for expressing genes in cultured murine
embryonic cells and hematopoietic cells in vivo. J Virol
1988; 62:795; Hock R. A., et al., Retrovirus mediated
transfer and expression of drug resistance genes in human
hemopoietic progenitor cells. Nature 1986; 320:275).
The basic retrovirus consists of two identical strands of RNA
packaged in a proviral protein. The core surrounded by a
protective coat called the envelope, which is derived from
the membrane of the previous host but modified with
glycoproteins contributed by the virus.
Markers and amplifiers can also be employed in the subject
expression systems. A variety of markers are known which are
useful in selecting for transformed cell lines and generally
comprise a gene whose expression confers a selectable
phenotype on transformed cells when the cells are grown in an
appropriate selective medium. Such markers for mammalian cell
lines include, for example, the bacterial xanthine-guanine
phosporibosyl transferase gene, which can be selected for in
medium containing mycophenolic acid and xanthine (Mulligan et
al. (1981) Proc. Natl. Acad. Sci. USA 78:2072-2076), and the
aminoglycoside phosphotransferase gene (specifying a protein
that inactivates the antibacterial action of
neomycin/kanamycin derivatives), which can be selected for
using medium containing neomycin derivatives such as 6418
which are normally toxic to mammalian cells (Colbere-Garapin
et al. (1981) J. Mol. Biol. 150:1-14). Useful markers for
other eucaryotic expression systems, are well known to those
of skill in the art.
Infection can be carried out in vitro or in vivo. In vitro
infection of cells is performed by adding the gene transfer
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-27-
vectors to the cell culture medium. When infection is carried
out in vivo, the solution containing the gene transfer
vectors may be administered by a variety of modes, depending
on the tissue which is to be infected. Examples of such
mode s of administration include injection of gene transfer
vectors into the skin, topical application onto the skin,
direct application to a surface of epithelium, or
instillation into an organ (e.g., time release patch or
capsule below the skin or into a tumor).
to
Expression can be amplified by placing an amplifiable gene,
such as the mouse dihydrofolate reductase (dhfr) gene
adjacent to the coding sequence. Cells can then be selected
for methotrexate resistance in dhfr-deficient cells. See,
e.g. Urlaub et al. (1980) Proc. Natl. Acad. Sci. USA 77:4216-
4220; Rungold et al. (1981) J. Mol. and Appl. Genet. 1:165-
175.
The above-described system can be used to direct the
expression of a wide variety of procaryotic, eucaryotic and
viral proteins, including, for example, viral glycoproteins
suitable for use as vaccine antigens, immunomodulators for
regulation of the immune response, hormones, cytokines and
growth factors, as well as proteins useful in the production
of other biopharmaceuticals.
It may also be desirable to produce mutants or analogs of the
proteins of interest. Mutants or analogs may be prepared by
the deletion of a portion of the sequence encoding the
protein, by insertion of a sequence, and/or by substitution
of one or more nucleotides within the sequence. Techniques
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-28-
for modifying nucleotide sequences, such as site-directed
mutagenesis, are well known to those skilled in the art. See,
e.g., Sambrook et al., supra; DNA Cloning, Vols. I and II,
supra; Nucleic Acid Hybridization, supra.
For purposes of the present invention, it is particularly
desirable to further engineer the coding sequence to effect
secretion of the polypeptide from the host organism. This
enhances clone stability and prevents the toxic build up of
ZO proteins in the host cell so that expression can proceed more
efficiently. Homologous signal sequences can be used for this
purpose with proteins normally found in association with a
signal sequence. Additionally, heterologous leader sequences
which provide for secretion of the protein can be added to
l5 the constructs. Preferably, processing sites will be included
such that the leader fragment can be cleaved from the protein
expressed therewith. (See, e.g., U.S. Pat. No. 4,336,246 for
a discussion of how such cleavage sites can be introduced).
The leader sequence fragment typically encodes a signal
20 peptide comprised of hydrophobic amino acids.
In one embodiment of the invention, a heterologous gene
sequence, i.e., a therapeutic gene, is inserted into the
nucleic acid molecule of the invention. Other embodiments of
25 the isolated nucleic acid molecule of the invention include
the addition of a single enhancer element or multiple
enhancer elements which amplify the expression of the
heterologous therapeutic gene without compromising tissue
specificity.
The transformation procedure used depends upon the host to be
transformed. Mammalian cells can conveniently be transformed
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-29-
using, for example, DEAF-dextran based procedures, calcium
phosphate precipitation (Graham, F. L. and Van der Eb, A. J.
(1973) Virology 52:456-467), protoplast fusion, liposome-
mediated transfer, polybrene-mediated transfection and direct
microinjection of the DNA into nuclei. Bacterial cells will
generally be transformed using calcium chloride, either alone
or in combination with other divalent rations and DMSO
(Sambrook, Fritsch & Maniatis, Molecular Cloning: A
Laboratory Manual, Second Edition (1989)). DNA can also be
introduced into bacterial cells by electroporation. Methods
of introducing exogenous DNA into yeast hosts typically
include either the transformation of spheroplasts or
transformation of intact yeast cells treated with alkali
rations.
The constructs can also be used in gene therapy or nucleic
acid immunization, to direct the production of the desired
gene product in vivo, by administering the expression
constructs directly to a subject for the in vivo translation
thereof. See, e.g. EPA Publication No. 336,523 (Dreano et
al., published Oct. 11, 1989). Alternatively, gene transfer
can be accomplished by transfecting the subject's cells or
tissues with the expression constructs ex vivo and
reintroducing the transformed material into the host. The
constructs can be directly introduced into the host organism,
i.e., by injection (see International Publication No.
WO/90/11092; and Wolff et al., (1990) Science 247:1465-1468).
Liposome-mediated gene transfer can also be accomplished
using known methods. See, e.g., Hazinski et al., (1991) Am.
J. Respir. Cell Mol. Biol. 4:206-209; Brigham et al. (1989)
Am. J. Med. Sci. 298:278-281; Canonico et al. (1991) Clin.
Res. 39:219A; and Nabel et al. (1990) Science 249:1285-1288.
Targeting agents, such as antibodies directed against surface
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-30-
antigens expressed on specific cell types, can be covalently
conjugated to the liposomal surface so that the nucleic acid
can be delivered to specific tissues and cells for local
administration.
Human Gene Therapy and Diagnostic Use of Vector
There are several protocols for human gene therapy which have
been approved for use by the Recombinant DNA Advisory
Committee (RAC) which conform to a general protocol of target
cell infection and administration of transfected cells (see
for example, Blaese, R.M., et al., 1990; Anderson, W. F.,
1992; Culver, K.W. et al., 1991). In addition, U.S. Patent
No. 5,399,346 (Anderson, W. F. et al., March 21, 1995, U.S.
Serial No. 220,175) describes procedures for retroviral gene
transfer. The contents of these support references are
incorporated in their entirety into the subject application.
Retroviral-mediated gene transfer requires target cells which
are undergoing cell division in order to achieve stable
integration hence, Cells are collected from a subject often
by removing blood or bone marrow. It may be necessary to
select for a particular subpopulation of the originally
harvested cells for use in the infection protocol. Then, a
retroviral vector containing the genes) of interest would be
mixed into the culture medium. The vector binds to the
surface of the subject's cells, enters the cells and inserts
the gene of interest randomly into a chromosome. The gene of
interest is now stably integrated and will remain in place
and be passed to all of the daughter cells as the cells grow
in number. The cells may be expanded in culture for a total
of 9-10 days before reinfusion (Culver et al., 1991). As the
length of time the target cells are left in culture
increases, the possibility of contamination also increases,
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-31-
therefore a shorter protocol would be more beneficial.
This invention provides for the construction of retrovirus
vectors containing the PEG-3 promoter or a functional
equivalent thereof linked to a gene of interest for use in
gene therapy or for diagnostic uses. The efficiency of
transduction of these vectors can be tested in cell culture
systems.
Uses of the Compositions of the Invention
This invention involves targeting a gene-of-interest to the
a cancer cell so that the protein encoded by the gene is
expressed and directly or indirectly ameliorate the diseased
state. Since the PEG-3 promoter is specifically active in a
cancer cell which is undergoing cancer progression, it will
act as a tissue specific promoter (specific for cancer
cells) .
After infecting a susceptible cell, the transgene driven by
a specific promoter in the vector expresses the protein
encoded by the gene. The use of the highly specific gene
vector will allow selective expression of the specific genes
in cancer cells.
The basic tasks in the present method of the invention are
isolating the gene of interest, selecting the proper vector
vehicle to deliver the gene of interest to the body,
administering the vector having the gene of interest into the
body, and achieving appropriate expression of the gene of
interest. The present invention provides packaging the cloned
genes, i.e. the genes of interest, in such a way that they
can be inj ected directly into the bloodstream or relevant
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-32-
organs of patients who need them. The packaging will protect
the foreign DNA from elimination by the immune system and
direct it to appropriate tissues or cells.
In one embodiment of the invention, the gene of interest
(desired coding sequence) is a tumor suppressor gene. The
tumor suppressor gene may be p21, RB (retinoblastoma) or p53.
~ne of skill in the art would know of other tumor suppressor
genes. Recent U.S. Patent Nos. 6,025,127 and 5,912,236 are
hereby incorporated by reference to more explicitly describe
the state of the art as to tumor suppressor genes.
Along with the human or animal gene of interest another gene,
e.g., a selectable marker, can be inserted that will allow
1S easy identification of cells that have incorporated the
modified retrovirus. The critical focus on the process of
gene therapy is that the new gene must be expressed in target
cells at an appropriate level with a satisfactory duration of
expression.
The methods described below to modify vectors and
administering such modified vectors into the skin are merely
for purposes of illustration and are typical of those that
might be used. However, other procedures may also be
employed, as is understood in the art.
Most of the techniques used to construct vectors and the like
are widely practiced in the art, and most practitioners are
familiar with the standard resource materials which describe
specific conditions and procedures. However, for convenience,
the following paragraphs may serve as a guideline.
General Methods for Vector Construction
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-33-
Construction of suitable vectors containing the desired
therapeutic gene coding and control sequences employs
standard legation and restriction techniques, which are well
understood in the art (see Maniatis et al., in Molecular
Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory,
New York (1982)). Isolated plasmids, DNA sequences, or
synthesized oligonucleotides are cleaved, tailored, and
relegated in the form desired.
Site-specific DNA cleavage is performed by treating with the
suitable restriction enzyme (or enzymes) under conditions
which are generally understood in the art, and the
particulars of which are specified by the manufacturer of
these commercially available restriction enzymes (See, e.g.
New England Biolabs Product Catalog). In general, about 1 ~.g
of plasmid or DNA sequences is cleaved by one unit of enzyme
in about 20 ~,1 of buffer solution. Typically, an excess of
restriction enzyme is used to insure complete digestion of
the DNA substrate.
Incubation times of about one hour to two hours at about 37
degree. C. are workable, although variations can be
tolerated. After each incubation, protein is removed by
extraction with phenol/chloroform, and may be followed by
ether extraction, and the nucleic acid recovered from aqueous
fractions by precipitation with ethanol. If desired, size
separation of the cleaved fragments may be performed by
polyacrylamide gel or agarose gel electrophoresis using
standard techniques. A general description of size
separations is found in Methods in Enzymology 65:499-560
(1980) .
Restriction cleaved fragments may be blunt ended by treating
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-34-
with the large fragment of E. Cole DNA polymerase I (Klenow)
in the presence of the four deoxynucleotide triphosphates
(dNTPs) using incubation times of about 15 to 25 min at
20° C. to 25° C. in 50 mM Tris (pH 7.6) 50 mM
NaCl , 6 mM MgCl . sub . 2 , 6 mM DTT and 5 -10 . mu . M dNTPs . The
Kl enow fragment f i 11 s in at 5 ' sticky ends but chews back
protruding 3' single strands, even though the four dNTPs are
present. If desired, selective repair can be performed by
supplying only one of the dNTPs, or with selected dNTPs,
within the limitations dictated by the nature of the sticky
ends. After treatment with Klenow, the mixture is extracted
with phenol/chloroform and ethanol precipitated. Treatment
under appropriate conditions with S1 nuclease or Bal-31
results in hydrolysis of any single-stranded portion.
Legations are performed in 10-50 ~.l volumes under the
following standard conditions and temperatures using T4 DNA
lipase. Legation protocols are standard (D. Goeddel (ed.)
Gene Expression Technology: Methods in Enzymology (1991)). In
vector construction employing "vector fragments", the vector
fragment is commonly treated with bacterial alkaline
phosphatase (BAP) or Calf intestinal alkaline phosphatase
(CIP) in order to remove the 5' phosphate and prevent
relegation of the vector. Alternatively, relegation Can be
prevented in vectors which have been double digested by
additional restriction enzyme digestion of the unwanted
fragments.
Suitable vectors include viral vector systems e.g. ADV, RV,
and AAV (R. J. Kaufman "Vectors used for expression in
mammalian Cells" in Gene Expression Technology, edited by D.
V. Goeddel (1991) .
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-35-
Many methods for inserting functional DNA transgenes into
cells are known in the art. For example, non-vector methods
include nonviral physical transfection of DNA into cells; for
example, microinjection (DePamphilis et al., BioTechnique
6:662-680 (1988)); liposomal mediated transfection (Felgner
et al., Proc. Natl. Acad. Sci. USA, 84:7413-7417 (1987),
Felgner and Holm, Focus 11:21-25 (1989) and Felgner et al.,
Proc. West. Pharmacol. Soc. 32: 115-121 (1989)) and other
methods known in the art.
Administration of Modified Vectors Into Subject
One way to get DNA into a target cell is to put it inside a
membrane bound sac or vesicle such as a spheroplast or
liposome, or by calcium phosphate precipitation (CaPO4)
(Graham F. and Van der Eb, A., Virology 52:456 1973;
Schaefer-Ridder M., et al., Liposomes as gene carriers:
Efficient transduction of mouse L cells by thymidine kinase
gene. Science 1982; 215:166; Stavridis J. C., et al.,
Construction of transferrin-coated liposomes for in vivo
transport of exogenous DNA to bone marrow erythroblasts in
rabbits. Exp Cell Res 1986; 164:568-572).
A vesicle can be constructed in such a way that its membrane
will fuse with the outer membrane of a target cell. The
vector of the invention in vesicles can home into the cancer
cells.
The spheroplasts are maintained in high ionic strength buffer
until they can be fused through the mammalian target cell
using fusogens such as polyethylene glycol.
Liposomes are artificial phospholipid vesicles. Vesicles
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-36-
range in size from 0.2 to 4.0 micrometers and can entrap 100
to 400 of an aqueous buffer containing macromolecules. The
liposomes protect the DNA from nucleases and facilitate its
introduction into target cells. Transfection can also occur
through electroporation.
Before administration, the modified vectors are suspended in
complete PBS at a selected density for injection, In addition
to PBS, any osmotically balanced solution which is
physiologically compatible with the subject may be used to
suspend and inject the modified vectors into the host.
For injection, the cell suspension is drawn up into the
syringe and administered to anesthetized recipients. Multiple
injections may be made using this procedure. The viral
suspension procedure thus permits administration of
genetically modified vectors to any predetermined site in the
skin, is relatively non-traumatic, allows multiple
administrations simultaneously in several different sites or
the same site using the same viral suspension. Multiple
injections may consist of a mixture of therapeutic genes.
Survival of the Modified Vectors So Administered
Expression of a gene is controlled at the transcription,
translation or post-translation levels. Transcription
initiation is an early and critical event in gene expression.
This depends on the promoter and enhancer sequences and is
influenced by specific cellular factors that interact with
these sequences. The transcriptional unit of many prokaryotic
genes consists of the promoter and in some cases enhancer or
regulator elements (Banerji et al., Cell 27:299 (1981);
Corden et al., Science 209:1406 (1980); and Breathnach and
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-37-
Chambon, Ann. Rev. Biochem. 50:349 (1981)).
For retroviruses, control elements involved in the
replication of the retroviral genome reside in the long
terminal repeat (LTR) (Weirs et al., eds., In: The molecular
biology of tumor viruses: RNA tumor viruses, Cold Spring
Harbor Laboratory, Cold Spring Harbor, N.Y. (1982)).
Moloney murine leukemia virus (MLV) and Rous sarcoma virus
(RSV) LTRs contain promoter and enhancer sequences (Jolly et
al., Nucleic Acids Res. 11:1855 (1983); Capecchi et al., In:
Enhancer and eukaryotic gene expression, Gulzman and Shenk,
eds., pp. 101-102, Cold Spring Harbor Laboratories, Cold
Spring Harbor, N.Y.).
Promoter and enhancer regions of a number of non-viral
promoters have also been described (Schmidt et al., Nature
314:285 (1985); Rossi and de Crombrugghe, Proc. Natl. Acad.
Sci. USA 84:5590-5594 (1987)).
In addition to using viral and non-viral promoters to drive
therapeutic gene expression, an enhancer sequence may be used
to increase the level of therapeutic gene expression.
Enhancers can increase the transcriptional activity not only
of their native gene but also of some foreign genes (Armelor,
Proc. Natl. Acad. Sci. USA 70:2702 (1973)).
Therapeutic gene expression may also be increased for long
term stable expression after injection using cytokines to
modulate promoter activity.
The methods of the invention are exemplified by preferred
embodiments in which modified vectors carrying a therapeutic
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-38-
gene are injected intracerebrally into a subject.
The most effective mode of administration and dosage regimen
for the molecules of the present invention depends upon the
exact location of the cancer being treated, the severity and
course of the cancer, the subject's health and response to
treatment and the judgment of the treating physician.
Accordingly, the dosages of the molecules should be titrated
to the individual subject. The molecules may be delivered
directly or indirectly via another cell, autologous cells are
preferred, but heterologous cells are encompassed within the
scope of the invention.
The interrelationship of dosages for animals of various sizes
and species and humans based on mg/m2 of surface area is
described by Freireich, E. J., et al. Cancer Chemother., Rep.
50 (4):219-244 (1966). Adjustments in the dosage regimen may
be made to optimize the tumor cell growth inhibiting and
killing response, e.g., doses may be divided and administered
on a daily basis or the dose reduced proportionally depending
upon the situation (e.g., several divided dose may be
administered daily or proportionally reduced depending on the
specific therapeutic situation).
It would be clear that the dose of the molecules of the
invention required to achieve cures may be further reduced
with schedule optimization.
Use of PEG-promoter to direct high expression of a
heterloaous Gene in cancer cells
One embodiment of the invention provides for methods for
expressing a gene of interest which gene is not endogenously
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-39-
expressed in cancer cells which comprises a) constructing a
nucleic acid which comprises the PEG-3 promoter operatively
linked to the gene-of-interest; b) introducing this nucleic
acid into a cancer cell which cell expresses PEG-3, thereby
causing the PEG-3 promoter to direct expression of the gene-
of-interest in the cancer cell. In one embodiment, the gene-
of-interest encodes a protein which is cytotoxic to the
cancer cell, causes apoptosis of the cancer cell, slows the
growth of the cancer cell, or causes the cancer cell to stop
dividing. The gene-of-interest can be any gene whose
expression would cause a desired biochemical or physiological
effect in the cancer cell, such as the decrease of growth or
the decrease or inhibition of cancer phenotype progression.
One advantage of using the nucleic acid construct described
above in such a method to treat cancer in a subject, is that
the nucleic acid can be administered to both cancerous and
normal cells. However, since the PEG-3 promoter is only
active in cancerous cells, there will be no expression of the
gene-of-interest in normal cells, while there will be high
expression of the gene-of-interest in the cancerous cells.
This nucleic acid construct thus allows one to target
specifically expression of a gene-of-interest to specifically
cancerous cells.
Liposomes could be used as a delivery agent to introduce the
nucleic acid construct to the cells of the subject to be
treated. Of course, there are many ways to deliver such a
nucleic acid construct which would be known to one of skill
in the art (e.g. microinjection; topical application; use of
a chemical vehicle; direct injection into the tumor; etc.).
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-40-
This invention is illustrated in the Experimental Details
section which follows. These sections are set forth to aid
in an understanding of the invention but are not intended to,
and should not be construed to, limit in any way the
invention as set forth in the claims which follow thereafter.
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-41-
EXPERIMENTAL DETAILS
Example 1: Defininq~ the req~ions within the promoter of
progression elevated aene-3 responsible for differential
expression during transformation progression
Cancer is a progressive disease in which a tumor cell
temporally develops qualitatively new transformation related
phenotypes or a further elaboration of existing
transformation associated properties. A rodent cell culture
model system is being used to define the genes that associate
with and control cancer progression. Subtraction
hybridization identified a novel gene that is functionally
v
involved in the induction of transformation progression in
mutant adenovirus type 5, H5ts125, transformed rat embryo
cells, referred to as progression elevated gene-3 (PEG-3).
A 5'-flanking promoter region of ~2.1 kilobases, PEG-
promoter, has been isolated, cloned and characterized. The
full-length and various mutated regions of the PEG-promoter
have been linked to a luciferase reporter construct and
evaluated for promoter activity during cancer progression
using transient transfection assays. These experiments
demonstrate a requirement for AP-1 and PEA-3 sites adjacent
to the TATA box region of PEG-3 in mediating enhanced
expression of PEG-3 in progressed versus un-progressed H5-
ts125-transformed rat embryo cells. An involvement of AP-1
and PEA-3 in PEG-3 regulation was also demonstrated by
protein blotting, electrophoretic mobility shift (EMSA)
assays and transfection studies with PEA-3 and c-Jun
expression vectors. Our findings document the importance of
the AP-1 and PEA-3 transcription factors in mediating
elevated expression of PEG-3 in H5ts125-transformed rat
embryo cells displaying an aggressive and progressed cancer
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-42-
phenotype.
Example 2: Cooperation between AP-1 and PEA-3 sites within
the t~rogression elevated gene-3 (PEG-3) promoter regulate
basal and differential expression of PEG-3 during progression
of the oncogenic phenotype in transformed rat embryo cells
The carcinogenic process involves a series of sequential
changes in the phenotype of a cell, resulting in new
properties or a further elaboration of transformation-
associated traits by the evolving tumor cell (Fisher, 1984;
Bishop, 1991; Knudson, 1993; Vogelstein and Kinzler, 1993).
Although extensively studied, the precise genetic mechanisms
underlying tumor cell progression during the development of
most human cancers remain unknown.. Experimental evidence
indicates that a number of diverse acting genetic elements
can contribute to cancer development and transformation
progression (Fisher, 1984; Bishop, 1991; Liotta et al., 1991;
Knudson, 1993; Levine, 1993; Hartwell and Kastan, 1994; Kang
et al., 1998a; Vogelstein and Kind er, 1993; Su et al., 1997;
1999). Important target genes involved in these processes
include, oncogenes, tumor supressor genes and genes
regulating genomic stability, cancer agressiveness and
angiogenesis (Fisher, 1984; Bishop, 1991; Liotta et al.,
1991; Knudson, 1993; Levine, 1993; Hartwell and Kastan, 1994;
Kang et al., 1998a; Vogelstein and Kinzler, 1993; Su et al.,
1997, 1999). Recently, several novel genetic elements have
been identified that associate with or in specific instances
directly regulate cancer agressiveness, i.e. progression
elevated (PEGen) and progression suppressed (PSGen) genes
(Kang, et al., 1998a; Su et al., 1997, 1999). The precise
mechanism by which these different genes orchestrate the
complex process of cancer progression represent an important
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-43-
area of investigation with potential for defining novel
pathways and target molecules that could lead to new
diagnostic and therapeutic approaches for cancer.
A useful model for defining the genetic and biochemical
changes mediating tumor progression is the Ad5/early passage
RE cell culture system (Fisher, 1984; Babiss et al., 1985;
Duigou et al., 1989, 1990, 1991; Fisher et al, 1979a,b,c;
Reddy et al., 1993; Su et al., 1994, 1997; Kang et al.,
1998a). Transformation of secondary rat embryo (RE) cells by
Ad5 is often a sequential process resulting in the
acquisition of an further elaboration of specific phenotypes
by the untransformed cell (Fisher et al., 1979 a,b,c; Babiss
et al, 1985). Progression in the Ad5-transformation model is
characterized by the development of enhanced anchorage-
independence and tumorigenic capacity (as formation in nude
mice) (Fisher, 1984; Babiss et al., 1985). The progression
phenotype in Ad5-transformed RE cells can be induced by
selection for growth in agar or tumor formation in nude mice
(Fisher et al., 1979 a,b,c; Babiss et al., 1985) by
transfection with oncogenes,such as Ha-ras, v-src, v-raf or
the E6/E7 region of human papilloma virus type 18 (Duigou et
al., 1989; Reddy et al., 1993) or by transfection with
specific signal transducing genes, such as protein kinase C
(Su et al., 1994).
Progression induced spontaneously or after gene transfer, is
a stable cellular trait that remains undiminished in Ad5-
transformed RE cells even after extensive passage (>100) in
monolayer culture (Fisher, 1984; Babiss et al., 1985; Reddy
et al., 1993). However, a single-treatment with the
demethylating agent 5-azacytidine (AAA) results in a stable
reversion in transformation progression in >950 of cellular
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-44-
clones (Fisher, 1984; Babiss et al., 1985; Duigou et al.,
1989; Reddy et al., 1993; Su et al., 1994). The progression
phenotype is also suppressed in somatic cell hybrids formed
between normal or un-progressed transformed cells and
progressed cells (Duigou et al., 1990, 1991; Reddy et al.,
1993). These findings suggest that progression may result
from the activation of specific progression-promoting
(progression elevated) genes or the selective inhibition of
progression-suppression (progression suppressed) genes, or
possibly a combination of both processes (Fisher, 1984;
Babiss et al., 1985; Su et al., 1997; Kang et al., 1998a).
To identify potential progression inducing genes with
elevated expression in progressed versus un-progressed Ad5
transformed cells, we are using subtraction hybridization and
reciprocal subtraction differential RNA display (RSDD)
approaches (Jiang and Fisher, 1993; Reddy et al., 1993; Su et
al., 1997; Kang et al., 1998a). The subtraction
hybridization approach resulted in cloning of PEG-3 which
displays elevated expression in progressed cells
(spontaneous, oncogene-induced or growth-factor related gene-
induced) than in un-progressed cells (parental Ad5-
transformed, AZA-suppressed, and suppressed somatic cell
hybrids) (Su et al, 1997). These findings document a direct
correlation between expression of PEG-3 and the progression
phenotype in this rat embryo model system.
Nuclear run-on assays confirm a direct correlation between
PEG-3 expression and an increase in the rate of RNA
transcription of this gene (Su et al., 1997). To elucidate
the mechanism underlying the differential expression of PEG-3
during transformation progression the 5'-flanking region of
this gene which contains the promoter (PEG-Prom) has been
isolated and characterized. The full-length ~2.0 kb PEG-Prom
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-45-
and various mutations (including deletions and point
mutations) in PEGProm were constructed and analysed. The
results of this inquiry demonstrate that APl and PEA3
transcription factors are the primary determinants of the
elevated expression of PEG-3 in progressed Ad5-transformed RE
cells. This Conclusion is verified by electrophoretiC
mobility shift assays (EMSA) and transfection studies with C-
Jun and PEAS expression vectors.
Results
Expression of PEG3 directly correlates with transformation
progression
To evaluate the relationship between PEG-3 expression and
transformation progression we have used a series of rodent
cell lines that span the gamut from normal to highly
progressed (Fisher et al. 1987; Babiss et al., 1985; Duigou
et al . , 1989; Reddy, et al . , 1993; Su et al . , 1997, 1999) .
A hallmark of the progression phenotype in this rodent model
is the ability to grow with enhanced efficiency in an
anchorage-independent manner and to induce tumors in nude
mice with a reduced tumor latency time (18-21 days as opposed
to 38-44 days, respectively) (Babiss et al., 1985; Su et al,
1999). A specific H5ts125-transformed secondary Sprague-
Dawley RE clone, E11, grows in agar with low efficiency (~2-
40) (progression negative), whereas a highly progressed nude
mouse tumor-derived E11 subclone, E11-NMT, grows with high
efficiency in agar (~30-45o) (Figure lA). Forced expression
of the Ha-ras oncogene in E11 cells, E11-ras R12 as a
representative clone, results in acquisition of the
progression phenotype as indicated by both anchorage-
independent growth (Figure 1A) and tumor latency time in nude
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-46-
mice (Reddy et al., 1993). Quantifying PEG-3 mRNA levels by
Northern hybridization (Figure 1B) and PEG-3 protein levels
by Western blotting (Figure 1C) indicates a direct
correlation between PEG-3 expression, elevated in Ell-NMT and
Ell-ras R12 and reduced in E11, and expression of the
progression phenotype (as indicated by anchorage independent
growth) .
To explore further the relationship between PEG-3 expression
and progression, the same three parameters as measured for
E11, E11-NMT and E11-ras R12 cells were used to compare a
series of somatic cell hybrids formed between Ell-NMT and
CREF cells (Figure 1). CREF cells are immortal rat embryo
cells that do not form colonies when grown in agar and are
devoid of tumorigenic potential when inoculated
subcutaneously into athymic nude mice (Fisher et al., 1982;
Duigou et al., 1990). Similarly, somatic cell hybrids formed
between E11-NMT and CREF cells that display a fat morphology
such as F1 and F2, also fail to form tumors in nude mice
(Duigou et al., 1990), although they grow with a low
efficiency in agar similar to E11 cells (Figure 1A). In
contrast, specific E11-NMT x CREF somatic cell hybrids that
display round morphology such as R1 and R2, grown with high
efficiency in agar, even exceeding that of E11-NMT (Figure
lA) and they rapidly form tumors in nude mice (Duigou et al.,
1990). As observed with Ell cells, the levels of PEG-3 mRNA
and protein are reduced in F1 and F2 cells, whereas R1 and R2
display elevated expression of PEG-3 akin to that of E11-NMT
and E11-ras R12 cells (Figures 1B, 1C). In the case of CREF
cells, PEG-3 mRNA is detected at very low levels by Northern
blotting (Figure 1B) and PEG-3 protein is barely detectable
by Western blotting (Figure 1C). These results indicate a
direct concordance between PEG-3 expression and the
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-47-
progression phenotype in H5ts125-transformed RE cells.
Isolation of the PEG-3 promoter and Identification of the
transcription start si to
Based on the sequence of the PEG-3 cDNA, a genomic walking
approach from the 5' region of the PEG-3 CDNA was used to
identify a 2.0-kb rat genomic fragment that represents the 5'
flanking region of the PEG-3 gene. The sequence of the
putative FL-PEG-Prom, is shown in Fig. 2. The transcription
start site of the PEG-3 gene was mapped by primer extension
with RNAs isolated from E11 and E11-NMT cells (Fig. 3).
Computer analysis with GCG software of the PEG-Prom indicates
the presence of two TATA boxes located at positions -1071 and
-24 upstream of the RNA cap site, respectively. The sequence
at -1071 is probably non-functional because of its large
distance from the RNA cap-site. Two PEAS-binding sites,
AGGAAA and TTTCCT, are located at positions -1644 and -101.
The PEA3 site at position -101 is 76 nt upstream of the TATA
box. An AP1 site is present at position +8. Additional
potential DNA binding elements are also apparent in the PEG-
Prom, including Spl, acute phase reaction element, NFKB1,
E2F, E2A, GRE, THE and CREB.
AP1 and PEAS sites adjacent to the TATA box in the PEG-3
promoter are involved in basal and enhanced promoter activit~r
in progressed and un-progressed H5ts125transformed RE cells
Transfection of the FL-PEG-Prom luciferase construct into the
different cell types demonstrated a direct relationship
between expression of the progression phenotype and elevated
promoter activity (Fig. 4). Progressed cells displayed a
2.5- to 3.5-fold increase in luciferase activity, a value
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-48-
that compares well with PEG-3 Northern and Western blotting
data (Fig. 1B and 1C). The level of luciferase activity in
E11 cells was similar to that observed in the F1 and F2 CREF
X Ell -NMT somatic cell hybrids . In the case of actively
proliferating CREF cells, the PEG-prom exhibited negligible
activity.
To define the regions) of the FL-PEG-Prom involved in the
differential expression of the PEG-3 gene during progression
of the transformed phenotype in H5ts125-transformed cells, a
series of PEG-Prom deletion constructs were engineered and
placed in front of the luciferase gene (Fig. 5 and 6).
Deletion of the PEA3 site at position -1645 and the TATA box
at position -1072 did not effect PEG promoter activity in
either E11 or E11-NMT suggesting that these regions of the
promoter do not contribute to basal or enhanced expression of
the PEG-Prom in Ell or Ell-NMT cells (Fig. 5). A further
deletion at position -270 minimally inhibited promoter
activity in Ell-NMT cells (~19% reduction versus activity of
the FL-PEG-Prom) without significantly altering activity of
the PEG-Prom in E11 cells. In contrast, removal of the PEA3
site at -104 nt with retention of the TATA box at position -
24 and the AP1 site at +8 by resulted in a reduction in basal
promoter activity in both E11 and E11-NMT cells. The
activity of this mutant PEG-Prom was 15- and 4-fold lower,
respectively, than the activity of the FL-PEG-Prom in E11-NMT
and Ell cells (Fig. 5). In effect, this promoter deletion
eliminated the enhanced expression of the PEG-Prom in E11-NMT
versus E11 cells, indicating that the PEA3 site at -104 is a
primary determinant of the enhanced activity of PEG-3 in
progressed H5ts125transformed RE cells. Internal deletions
at position -1167 to -536 and -1267 to -536 resulted in
similar levels of luciferase activity in E11-NMT and E11
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-49-
cells as observed with the deletion mutant containing a
deletion at position -270. Internal deletions engineered
between -1167 to -142 and -1590 to -142 resulted in a further
decrease in promoter activity in both E11 and E11-NMT cells,
with the most profound effect apparent in Ell-NMT cells 0410
reduction in activity in comparison with the FL-PEG-Prom).
In contrast, deletion of the promoter regions from -142, -536
or -1287 with retention of the remainder of the PEG-Prom
completely abolished PEG promoter activity (Fig. 5). These
results implicate the PEAS transcription site (at position -
104), the AP1 transcription site (at position +8) and the
TATA box (at position -24) as primary determinants of basal
PEG-Prom activity in Ell and E11-NMT cells.
To examine further the role of the PEA3 site at position
-104, the TATA box at position -24 and the AP1 site at
position +8 in the regulation of PEG-3 promoter activity in
E11 and E11-NMT cells an additional series of mutant PEG-3
promoter luciferase constructs were generated (Fig. 6).
Mutation in the AP1 site, with retention of the wt PEA3 and
TATA sites, resulted in equivalent promoter activity in E11
and E11-NMT cells. This observation emphasizes the
importance of the AP1 site at position +8 in the PEG promoter
in regulating elevated PEG-3 transcriptional activity in E11-
NMT versus E11 cells. An involvement of the PEA3 site at
position -104 in defining PEG promoter activity was also
demonstrated by analysis of a construct containing a mutated
PEAS site at -104 with wild-type TATA (at position -24) and
AP1 (at position +8) sites (Fig. 6). In this mutant, the
level of activity of the promoter was at a basal level and
the activity was similar in E11 and E11-NMT cells. A similar
basal promoter activity was also observed with two additional
mutants, one containing mutant AP1 and PEA3 sites and a wild-
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-50-
type TATA box and a mutant lacking the PEA3 site at position
-104 with wild-type TATA and AP1 sites. In contrast, a
mutant lacking the PEAS site at position -104 with a mutated
TATA site and a wild-type APl site at position +8 displayed
no promoter activity. These results confirm that both the
AP1 site located at +8 and the PEAS site at position -104 are
involved in the differential expression of the PEG-Prom in
E11-NMT versus E11 cells. APl and PEAS are major
determinants of the differential expression of the PEG-Prom
in E11-NMT versus E11 cells and basal PEG-Prom activity in
E11 and E11-NMT cells.
Progressed E1 1 -NMT cells display enhanced nuclear
transcription factor binding
Western blotting analysis was performed to determine the
levels of AP1/cJun and PEA3 protein in E11 and Ell-NMT cells.
With both proteins the de novo level of expression was ~1.5
to 2fold higher in Ell-NMT versus E11 cells (data not shown).
EMSA were performed to determine the DNA binding potential of
the AP1 and PEA3 proteins and if different levels of binding
complexes are~present in E11-NMT versus E11 cells (Fig. 7A
and 7B, respectively). Using a wild-type AP1
oligonucleotide, the level of binding to APl was higher in
Ell-NMT versus E11 (Fig. 7A). The specificity of this
binding to APl was demonstrated by competition with a 10- and
a 100-fold molar excess of unlabeled competitor and the
absence of a DNA-protein complex when using a mutant APl
oligonucleotide (Fig. 7A). Direct confirmation of binding of
nuclear extracts to AP1 was provided by supershift assays
using cJun (AP1) antibody (Fig. 7A). In contrast, no
supershifted DNA-protein complexes were observed when an
anti-actin antibody was used in place of the cJun (AP1)
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-51-
antibody. Similar results were obtained when a PEA3
oligonucleotide was used in gel retardation assays (Fig. 7B).
Enhanced binding to PEA3 was observed with extracts from E11-
NMT versus E11 cells. No binding was observed with a mutated
PEA3 oligonucleotide, unlabelled PEA3 competitor effectively
inhibited binding to PEA3 and antibodies specific for PEA3,
but not anti-actin antibodies, resulted in supershifted DNA-
protein complexes in the EMSA (Fig. 7B). These experiments
demonstrate that E11-NMT cells contain elevated levels of AP1
and PEA3 with the capacity to bind to their respective sites
in the promoter of PEG-3.
Ectopic expression of cJun (AP1) and PEA3 in E11 cells
independently and cooperatively enhance PEG-Prom activity
The studies described above suggested that APl and PEAS sites
in the PEG-Prom were responsible for the differential
activity of this promoter in E11-NMT versus Ell cells. To
directly determine if the proteins encoded by these
transcription factors can alter the expression of the FL-PEG-
Prom in Ell cells transient transfection and promoter-
luciferase assays were performed (Fig. 8). Transfection of
E11 cells with an expression vector producing cJun resulted
in a dose-dependent increase in FL-PEG-Prom activity in E11
cells. The maximum effect obtained was small, equaling only
an ~1.5-fold increase in cells not expressing the cJun
expression plasmid. This stimulatory effect was not evident
in cells transfected with a control vector (pcDNA3.1) or a
vector encoding a mutant cJun protein (TAM67). Forced
expression of PEA3 in E11 cells also resulted in a dose-
dependent increase in FL-PEG-Prom activity, again reaching a
maximum of ~1.5-fold. No enhancement in promoter activity was
observed in E11 cells transfected with the control pRC/RSV
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-52-
vector. When E11 cells were co-transfected with a
combination of expression vectors producing cJun and PEA3,
FL-PEG-Prom activity was comparable to that observed in Ell-
NMT cells. This effect was not apparent when the combination
of control vectors were transfected into Ell cells (Fig. 8).
These results provide support for the hypothesis that the
differential expression of the PEG-Prom in EIl-NMT versus Ell
cells is a consequence of elevated expression of cJun (APl)
and PEAS transcription factors in the progressed E11-NMT
cells.
Discussion
Acquisition of enhanced expression of the transformed
phenotype, i.e., transformation progression, represents a
critical component in the cancer paradigm. A novel CDNA,
PEG-3, that displays differential expression as a function of
progression of the transformed phenotype, oncogenic
transformation and DNA damage in rodent cells was identified
by subtraction hybridization (Su et al., 1997). Recent
studies document that PEG-3 is causally related to cancer
progression, since ectopic expression of this gene in
transformed rodent or human tumor cells results in an
aggressive tumor phenotype when cells are injected
subcutaneously into athymic nude mice (Su et al., 1999).
These observations suggest that PEG-3 is an important
contributor to transformation progression. To define the
mechanism mediating differential expression of PEG-3 in
progressed (E11-NMT) versus unprogressed (E11) Ad5-
transformed rat embryo cells the promoter region of this gene
was identified, isolated and examined. By using promoter
analyses, EMSA and transient transfection assays we presently
demonstrate that a combination of the AP1 and PEA3
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-53-
transcription factor sites in the PEG-Prom adjacent to the
TATA, region contribute to basal and enhanced promoter
activity in H5ts125-transformed RE cells.
Promoter deletion analysis indicates that a region of the
PEG-Prom containing -270/+194 of the PEG-3 gene is essential
for PEG-3 transcriptional activity in Ell and E11-NMT cells
(Fig. 5 and 6) . Moreover, this region of the PEG-Prom is
also responsible for the differential promoter activity of
the PEG-Prom in Ell-NMT versus E11 cells. Sequence analysis
indicates that this part of the PEG-Prom contains APl (+8),
TATA (-24) and PEAS (-104) elements (Fig. 2). A mutation of
the APl site at +8, while retaining a wild-type TATA and PEAS
sequence, reduces the activity of the PEG-Prom deletion
construct (-270/+194) in E11-NMT to that of E11 cells (Fig.
6B) . This finding suggests that the AP1 site at +8 is a
primary determinant of the differential expression of the
PEG-Prom in E11-NMT versus E11 cells. The importance of the
TATA and PEA3 sites in PEG-Prom activity is also documented
using additional mutants (Fig. 6B). A mutation in the PEA3
site (-104) in the presence of wild type TATA (-24) and AP1
(+8) sites reduces promoter activity in E11 and E11-NMT and
effectively eliminates the enhanced activity of the PEG-Prom
in E11-NMT cells. Similar levels of reduced PEG-Prom
activity are apparent in both E11 and E11-NMT cells when the
AP1 (+8) site is mutated singly or in combination with a
mutated PEAS (+8) site. In these contexts, altering the AP1
(+8) and PEA3 (104) sites, singly or in combination, effects
both basal and enhanced PEG-Prom activity. Moreover, a
mutation in the TATA region (-24), even in the presence of a
wild-type AP1 (+8) site, results in an extinction of promoter
activity. These results demonstrate that both AP1 and PEAS
sites adjacent to an intact TATA region within the PEG-Prom
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-54-
contribute to both basal promoter activity in E11 and E11-NMT
cells and elevated promoter activity in Ell-NMT cells.
A functional interaction between the AP1 and PEAS sites and
binding of nuclear proteins in the FL-PEG-Prom was confirmed
by EMSA using appropriate oligonucleotide probes and
monoclonal antibodies (Fig. 7). EMSA using nuclear extracts
from E11 and E11-NMT cells resulted in slower-migrating DNA-
protein complexes when incubated with APl or PEAS
oligonucleotides (Fig. 7A and 7B). The amount of these
complexes were reduced or eliminated when a 10-or 100-fold
molar excess, respectively, of unlabelled oligonucleotides
were incorporated in the assay. No DNA-protein complexes
were observed when a mutated AP1 or PEA3 oligonucleotide was
used in the binding assay. The specificity of the nuclear
protein binding was demonstrated using antibody specific for
cJun (AP1) or PEAS in the EMSA. In these experiments
supershifted slow-migrating DNA-protein complexes were
apparent resulting from antibody interactions with the DNA-
protein complexes. The amount of AP1 and PEAS complexes
present in E11-NMT cells exceed that found in E11 cells (Fig.
7A and 7B). Moreover, a small but significant increase (~1.5
to 2-fold) in the levels of AP1/cJun and PEA3 protein was
also detected by Western blotting in Ell-NMT versus Ell cells
(unpublished data), The functional significance of the
elevated AP1 and PEA3 proteins in E11-NMT versus E11 cells in
regulating elevated PEG-3 promoter activity in the progressed
cells was documented by transient transfection of cJun and
PEA3 expression vectors (Fig. 8). These experiments
demonstrated that transient ectopic cJun (AP1) and PEAS
expression can individually elevate PEG-Prom activity in Ell
cells and the combination of both transcription factors
results in an additive effect culminating in a similar PEG-
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-55-
Prom activity as observed in E11-NMT cells (Fig. 8). Based on
increased binding activity in EMSA, increased levels of
protein in Western blots and cotransfection assays there
appears to be a strong correlation between PEG-3 expression
and AP1/PEA3 activity.
APl transcription factors are immediate early response genes
that regulate expression of a subset of target gene promoters
l0 containing defined sequence motifs (TPA-response elements,
TRE) (Angel and Karin, 1991). The AP1 complex comprises a
heterodimer of a member of the Fos family and a member of the
Jun family or homodimers of members of the Jun family (Angel
and Karin, 1991, Karin et al., 1997). AP1 contributes to
many important and diverse biological processes including
cell proliferation, transformation, onocogenesis,
differentiation and apoptosis (Angel and Karin, 1991; Karin
et al., 1997; Olive et al., 1997; Kang et al., 1998b). The
transcription factor PEA3 a member of the ets gene family is
also a major contributor to cell transformation and
oncogenesis (Brown and MCKnight, 1992). PEA3 proteins
interact with an ~10 base pair DNA sequence in the promoters
of target genes resulting in regulation of transcription
(MaCleod et al., 1992; Seth et al., 1992; V~lasylyk et al.,
1993). Putative candidate PEAS target genes include
proteinases required for degradation of the extracellular
matrix, including the serine urokinase-type plasminogen
activator (Nerlov et al., 1992) and matrix metalloproteinases
gelatinase B, interstitial Collagenase, stromelysin-3 and
matrilysin (Matrisian and Bowden, 1990; Matrisian, 1994;
Higashino et al., 1995), which represent important factors
contributing to cancer metastasis (Liotta et al., 1991; Kohn
and Liotta, 1995). Many of these extracellular matrix
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-56-
degrading genes also contain AP1 sites in their promoters
(Angel and Karin, 1991; Karin et al., 1997). Cooperation
between AP1 and PEA3 sites in regulating several cellular
promoters have been documented. These include, serum growth
faotor response of the tissue inhibitor of
metalloproteinases-1 (TIMP-1) gene (Edwards et al., 1992) and
12-Otetradecanoylphorbol 13-acetate (TPA), fibroblast growth
factor-2 (FGF-2) and macrophage colony-stimulating factor
induction of the urokinase-type plasminogen activator gene
(Neriov et al., 1992; Stacey et al., 1995; De Cesare et al.,
1996; D'Ora~io et al., 1997). Moreover, PEAS and APl
elements are also present in the promoters of the stromelysin
and collagenase genes (Gutman and Wasylyk, 1990; Sirum-
Conolly and Brinckerhoff, 1991) and these elements provide
targets for transcriptional activation by specific
transforming oncogenes (Wasylyk et al., 1989, 1993). In
these contexts, the increased AP1 and PEA3 activity in E11-
NMT cells versus Ell can result in elevated PEG-Prom activity
and thereby increased PEG-3 protein which can directly
contribute to cancer aggressiveness, resulting in enhanced
tumor growth in vivo in nude mice, in the progressed tumor
cells. The increased activity of AP1 and PEA3 in E11-NMT
cells will also likely activate additional down-stream genes
that can facilitate the cancer phenotype.
The mechanism by which PEG-3 facilitates expression of the
transformed phenotype is not currently known. Forced
expression of the rat PEG-3 gene in both rodent and human
cancer cells results in an increase in anchorage independent
growth and an augmentation in oncogenic potential (Su et al.,
1997, 1999). One putative target for PEG-3 is the
angiogenesis-inducing molecule, vascular endothelial growth
f actor (VEGF) (Su et al., 1999). Stable elevated expression
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-57-
of PEG-3 results in increased VEGF RNA transcription, steady-
state mRNA and secreted protein in E11 cells. Moreover, a
VEGF-luciferase reporter construct displays enhanced activity
in cells expressing PEG-3. A functional role for PEG-3 in
regulating VEGF expression is demonstrated further by
inhibiting PEG-3 expression in E11-NMT cells using a stable
antisense PEG-3 expression vector which results in a decrease
in VEGF mRNA anal secreted protein. The requirement for PEG-3
protein in inducing VEGF expression was demonstrated by
simultaneous treatment of PEG-3 transfected cells with the
protein synthesis inhibitor cycloheximide (Su et al., 1999).
In this experiment, the transtected PEG-3 gene was expressed
as PEG-3 mRNA, whereas VEGF mRNA was only present in cells
not exposed to cycloheximide. Although it is not presently
known if PEG-3 binds directly to the VEGF promoter or
activation ~f VEGF transcription occurs by means of
additional molecules, these 'studies suggest an association
between PEG-3 expression, induction of angiogenesis and
facilitation of expression of the cancer state.
Further studies are necessary to identify and characterize
the repertoire of down-stream genes modulated as a
consequence of PEG-3 expression and to determine their roles
in facilitating cancer aggressiveness and angiogenesis.
These investigations are important and offer potential for
defining the genetic elements which are critical determinants
of the cancer phenotype. With this information it will be
possible to distinguish potential targets and define
appropriate reagents, such as antisense or small molecule
antagonists, for inhibiting or preventing cancer development
and progression.
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-58-
Materials and Methods
Cell cultures
E11 is a single cell clone of H5ts125-transformed Sprague-
Dawley secondary RE cells (Fisher et al., 1978). E11-NMT is
a subclone of E11 cells derived from a nude mouse tumor
induced by the E11 cell line (Babiss et al., 1985). R12 is
a Ha-ras oncogene transformed E11 clone (Duigou et al.,
1989). F1 and F2 are suppressed somatic cell hybrids with a
flat morphology that were formed between Ell-NMT and CREF
cells (Duigou et al., 1990). R1 and R2 are progressed
somatic cell hybrids with a round morphology that were
created by fusing E11-NMT and CREF cells (Duigou et al.,
1990). CREF is a specific immortal non-transformed and non-
tumorigenic clone of Fischer rat embryo fibroblast cells
(Fisher et al., 1982). All cultures were grown in Dulbecco's
modified Eagle's medium (DMEM) supplemented with 5o FBS
(DMEM-5) at 37°C in a humidified 5% COZ 95% air incubator.
Northern and Western blotting assays.
Total cellular RNA was isolated by the guanidinium/phenol
extraction method and Northern blotting was performed as
described (Su et al. , 1994, 1997) . Fifteen ~.g of RNA were
denatured and electrophoresed in 1.2% agarose gels with 3%
formaldehyde, transferred to nylon membranes and hybridized
sequentially with 32P-labeled cDNA probes as described
previously (Su et al., 1994, 1997). Following hybridization,
the filters were washed and exposed for autoradiography.
Western blotting analyses (Su et al., 1995) detected cJun
(AP1), PEAS, PEG-3 and actin proteins. Five million cells
were seeded into 100-mm plates and incubated for 24 h at
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-59-
37°C. The medium (DMEM-5) was removed, the cells were washed
3 X with cold PBS and then lysed in RIPC buffer (0.5 M NaCl,
0.5% NP40, 20 mM Tris-HCI, pH 8, 1 mM PMSF) . The protein
levels were determined using an ECL kit (Amersham) and the
respective antibodies (Santa Cruz). Cell lysates were also
analyzed using rabbit anti-PEG-3 polyclonal antibodies
against C-terminal peptides.
Isolation and analysis of the PEG-3 promoter
Based on the 5' sequence of the PEG-3 cDNA, two nested
primers with the sequences GATCTAGGGTGTTGTGAGAGGATCGGAG (SEQ
ID N0:2) and TCGGTTTGCCAAAAGCGATCGTGGG (SEQ ID N0:3) were
used with a Genome Walker Kit (Clontech) to obtain a genomic
sequence containing the putative promoter of PEG-3. Three
DNA fragments of 2.0-, 1.6- and 1.0-kb, respectively, with
identical and overlapping nucleotide sequences were obtained
using this approach. The 2.0-kb PEG-3 fragment (designated
FL-PEG-Prom) was cloned into the pGL3-basic Vector (Promega)
for promoter activity analysis. 5'-Deletion mutations in the
FL-PEG-Prom were made with exonuclease III digestion using
the Erase-A-Base System (Promega). 3'-Deletion mutations of
the FL-PEG-Prom were made by digestion with BstEll/Xhol,
Sacll/Xhol and Ndel/Xhol, respectively. BstEll, Sacll and
Ndel are 20 single-cut restriction endonucleases recognizing
DNA sequences in the FL-PEG-Prom, Xhol restriction site is
located in the MCS of pGL3 vector near the 3' end of the FL-
PEG-Prom. The internal deletions were performed by digesting
the FL-PEG-Prom with Ndel/Sacll, Ndel/BstEll, Stul/BstEll and
BstXl, respectively. Mutations in the APl-binding site,
PEA3-binding site, and TATA box were made using a site-
specific mutagenesis method with the Altered Sites 11 In
Vitro Mutagenesis System (Promega). The PEG-Prom deletion
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-60-
mutants were cloned into the pGL3-basic Luciferase Reporter
Vector (Promega,). To evaluate the activity of the various
PEG-Prom-luciferase constructs, cells were seeded at 2 X
105/35-mm tissue culture plate and ~24 h later transfected
with 5 ~,g of the various PEG-Prom-luciferase constructs plus
1 ~,g of SV40-(3-gal Vector (Promega) mixed with 10 ~,l of
Lipofectamine Reagent (Gibco) in 200 ~l of serum-free media.
After 20 min at RT, 800 ~.l of serum-free media were added
resulting in a final volume of 1 ml. The transfection
mixture was removed after 14 hr and the cells were washed 3X
with serum-free media and incubated at 37°C for an additional
48 hr in complete growth media. Cells were harvested and
lysed to make extracts (Gopalkrishnan et al., 1999) utilized
in (3-gal and Luciferase reporter assays. LuminometriC
determinations of Luciferase and Pgal activity was performed
using commercial kits (Promega and Tropix, respectively).
For Luciferase assays, 10 ~,1 of cell lysate were mixed with
40 ~.1 of Luciferase Assay substrate (Promega) . For (3-gal
assays, 10 ~l of the Cell lysate were mixed with 100 ~.1 of
diluted Galecton-Plus with 150 ~,I of Accelerator (Tropix).
Promoter analysis data were collected a minimum of three
times using triplicate samples for each experimental point
and the data was standardized with the (3-gal data.
Primer extension of E11 and E11-NMT mRNA
A primer with the sequence 5'
GGCAAAGGGATGCGGAGTCGCGCGGGTCTCGCATG 3' (SEQ ID N0:4)
complementary to the 5' UTR sequence of the PEG-3 CDNA was
annealed to 4 ~.g of PolyA+ RNAs from E-11 or Ell-NMT cells,
which were used as template for primer extension with reverse
transcriptase. In brief, 20 pmol of dephosphorylated oligo-
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-61-
DNA was end-labeled with y_32p ATP (Amersham) and T4
polynuCleotide kinase. The labeled oligonuCleotides (5 X 105
Cpm) were incubated with 4 ~,g of polyA+ RNA and the
precipitate was resuspended in DEPC-treated H20. The reverse
transcription reaction contained 200 a / ~.1 of Superscript
Reverse Transcriptase II (Gibco), 50 mM of Tris-HCI (pH 8.3),
40 mM KCI, 6 mM MgC'21 1 mM DTT, 1 mM dNTP, and 0.1 mg / ml
BSA. The mixture was incubated at 42°C for 1 hr followed by
the addition of 1 ml of 0.5 M EDTA (pH 8) to stop the
reaction. After DNase-free RNase treatment, the reaction
mixture was loaded onto a 5o urea polyacrylamide sequencing
gel in parallel with a DNA sequencing reaction using the same
primer and template.
Electrophoretic mobility shift assays (EMSA)
Nuclear extracts were prepared from 2 to 5 X 10$ cells as
described by Dignam et al. (1983). The sequence of probes
were as follows: wild-type AP1, 5'CGCAGATTGACTCAGTTCGC3° (SEQ
ID N0:5) / 5'GC GTCTAACTGAGTCAAGCG3'(SEQ ID N0:6); mutant
AP1, 5'CGCAGATAAACTACGTTCGC3' (SEQ ID N0:7) / 5'
GCGTCTATTTGATGCAAGCG3' (SEQ ID N0:8); wild-type PEA3, 5'
GTGTTGTTTTCCTCTCTCCA3' (SEQ ID N0:9) / 5'
CACAACAAAAGGAGAGAGGT3' (SEQ ID NO:10); and mutant PEA3',
5'GTGTTGTTCCCATCTCTCCA3' (SEQ ID N0:11) / 5' CACAACA
AGGGTAGAGAGGT3' (SEQ ID N0:12). The double-stranded
oligonucleotides were labeled with 32P-ATP (Amersham) and T4
polynucleotide kinase. The labeled probes were then
incubated with nuclear extract at RT for 30 min. The
reaction mixture consisted of 32P-labeled
deoxyoligonuCleotides (> 5000 cpm), 2 ~,g of poly(dl-dc) and
10 ~.g of nuclear protein extract with 10 mM HEPES (pH 7.5),
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-62-
50 mM KCI, 5 mM MgCI2, 0.5 mM EDTA, 1 mM DTT and 12.5%
glycerol. After incubation for 30 min at RT, the reaction
mixtures were electrophoresed on a 5% polyacrylamide gel with
0.5 X TBE (160V for 3 h). The gel was dried and
autoradiographed. Nuclear extracts were also incubated with
a 10- or 100-fold molar excess of cold competitor
oligonucleotide or cJun (AP1), PEA3 or actin antibody (1 or
5 ~.g) together with the 32 P-labeled probe .
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-63-
References
1. Angel, P. & Karin, M. (1991). Biochim. Biophys. Acta,
1072,129-157.
2. Babiss, L. E., Zimmer, S.G. & Fisher, P.B. (1985).
Science, 228,1099-1101.
3. Bishop, J.M. (1991). Cell, 64,235-248.
4. Brown, T. A. & MCKnight, S. L, (1992). Genes &
Develop., 6, 2502-2512.
5. De Cesare, D., Palazzolo, M. & Blasi F. (1996).
Oncogene, 13, 2551-2562.
6. Dignam, J. M., Lebovitz, R.M. & Roeder, R.G. (1983).
Nucl. Acids Res., 11,1475-1489.
7. D'Orazio D., Besser, D., Marksitzer, R., Kunz, C.,
Hume, D.A., Kiefer, B. & Nagamine, Y. (1997).
Gene, 201,179-187.
8. Duigou, G.J., Babiss, L.E. & Fisher, P.B. (1989). NY
Acad. Sci., 567,302-306.
9. Duigou, G.J., Babiss,L.E., Iman,D.S., Shay, J.W. &
Fisher, P.B. (1990). Mol. Cell. Biol., 10, 2027
2034.
10. Duigou, G.J., Su, Z.-z., Babiss, L.E., Driscoll, B.,
Fung, Y.-K. T. & Fisher, P.B. (1991). Oncogene, 6, 1813-
1824.
11. Edwards, D.R., Rocheleau, H., Sharma, R.S., Wils, A.J.,
Cowie, A., Hassell, J.A. & Heath, J.K.
(1992).Biochem. Biophys. Acta, 1171, 41-55.
12. Fisher, P.B. (1984). In: Tumor Promotion and
Cocarcinogenesis In Vitro, Mechanisms of Tumor
Promotion. Slaga T. J. (ed). CRC Press, Inc., Boca
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-64-
Raton, FL, pp. 57-123.
13. Fisher, P.B., Weinstein, I.B., Eisenberg, D. & Ginsberg,
H.S. (1978). Proc. Natl.Acad. Sci. USA,
75,2311-2314.
l~. Fisher, P.B., Goldstein, N.I. & Weinstein, I.B. (1979a).
Cancer Res., 39, 30513057.
15. Fisher, P.B., Dorsch-Hasler, K., Weinstein, I.B. &
Ginsberg, H.S. (1979b).Nature, 281, 591-594.
16. Fisher, P.B., Bozzone, J.H. & Weinstein, I.B. (1979c).
Cell, 18, 695-705.
17. Fisher, P.B., Babiss, L.E., Weinstein, I.B. & Ginsburg,
H.S. (1982) . Proc. Natl. Acad. Sci. USA,
79,3527-3531.
18. Gopalkrishnan, R.V., Christiansen, K., Goldstein, N.I.,
DePinho, R.A. & Fisher, P. B. (1 999). Nucl. Acids
Res., in press.
19. Gutman, A. & Wasylyk, B. (1 990) . EMBO J. , 9, 2241-
2246.
20. Hartwell, L.H. & Kastan, M.B. (1 994) . Science, 266,
1821- 1828.
21. Higashino, F., Yoshida, K., Noumi, T., Seiki, M.
Fujinaga, K. (1995). Oncogene, 10,1461-
1463.
22. Jiang, H. & Fisher, P.B. (1993). MoL Cell. Different,
1, 285-299.
23. Kang, D.-c., LaFrance, R., Su, Z.-z. & Fisher, P.B.
(1998a). Proc. Natl. Acad. Sci. USA, 95,13788-13793.
24. Kang, D.-c., Motwani, M. & Fisher, P.B. (1998b). Intl.
J. Oncology, 13,1117-1126.
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-65-
25. Karin, M., Liu, Z. & Zandi, E. (1 997) . Curr. Opin.
Cell Biol., 9, 240-246.
26. Kohn, E. C. & Liotta, L.A. (1 995). Cancer Res., 55,
1856-1862.
27. Knudson, A.G. (1 993). Proc. Natl. Acad. Sci. USA,
90, 10914-10921.
28. Levine. A.J. (1 993). Annu. Rev. Biochem., 62, 623-
651.
29. Liofta, L.A., Steeg, P.G. & Stetier-Stevenson, W.G.
(1991). Cell, 64, 327-336.
30. Matrisian, L. M. & Bowden, G.T. (1 990). Sem. Cancer
Biol . , 1, 107-115 .
31. Matrisian, L. M. (1994). Ann. NY Acad. Sci.,
91,10129-10133.
12. Macleod, K., Leprince, D. & Stehelin, D. (1 992).
Trends Biochem. Sci., 17, 251 256.
33. Nerlov, C., De Cesare, D., Pergola, F., Caracciolo, A.,
Blasi, F. , Johnsen, M. & Verde, P. (1 992) . EMBO J. ,
11, 4573-4582.
34. Olive, M., Krylov, D., Echlin, D.R., Gardner, K.,
Taparowsky, E. & Vinson, C.(1 997). J. BioL Chem., 272,
18586-18594
35. Reddy, P.G., Su, Z.-z. & Fisher, P.B. (1993). In:
Chromosome and Genetic Analysis, Methods in
Molecular Genetics. Adolph K. W. (ed). Vol
l.Academic Press, Inc., Orlando, FL, pp. 68-102.
36. Seth, A., Ascione, R., Fisher, R.J., Mavrothalassitis,
G.J., Bhat, N.K. & Papas,T.S. (1 992). Cell Growth &
Different., 3, 327-334.
CA 02416676 2003-O1-21
WO 02/08242 PCT/USO1/23099
-66-
37. Sirum-Conolly, K. & Brinckerhoff , C.E. (1 991). Nucl.
Acids Res., 19, 335-341.
38. Stacey, K.J., Fowles, L.F., Colman, M.S., Ostrowski,
M.C. & Hume, S.A. (1995).Mol. Cell. BioL, 15,3430-
3441.
39. Su, 2.-z., Shen, R., O'Brian, C.A. & Fisher, P.B.
(1994). Oncogene, 9, 1123-1132.
40. Su, Z.-z., Yemul, S., Estabrook, A., Zimmer, S.G.,
Friedman, R.M. & Fisher, P.B. (1 995). Intl. J.
Oncology, 7, 1279-1284.
41. Su, Z.-z., Shi, Y. & Fisher, P.B. (1997). Proc. Natl.
Acad. Sci. USA, 94,9125-9130.
42. Su, Z.-z., Goldstein, N.I,, Jiang, H., Wang, M.-N.,
Duigou,
13. G.J., Young, C.S.H. & Fisher, P.B. (1999). Proc.
Natl.Acad. Sci. USA, 96,15115-15120.
44. Vogelstein, B. & Kinzier, K.W. (1 .993). Trends Genet.,
9, 138-141.
45. Wasylyk, C., Flores, P., Gutman, A. & Wasylyk, B. (i
989). EMBO J., 8, 3371 3378.
46. Wasylyk, B., Hahn, S.L. & Giovane, A. (1993). Eur. J.
BioChem., 211, 7-18.
