Note: Descriptions are shown in the official language in which they were submitted.
CA 02417135 2003-02-14
WO 99/25735 PCTIUS98/24975
CHI RTC E-AC 'V E N C~ P FA TO S
$~c]c~raund of the Inve lion
S Fungal species are the commercial source of many medicinally
useful products, such as antibiotics (e.g., beta-lactam antibiotics such as
penicillin, cephalosporin, and their derivatives), anti-hypercholesterolemic
agents (e.g., lovastatin and compactin), irnrnunosuppressives (e.g.,
cyclosporin), and antifungal drugs (e.g., pneumocandin and echinocandin). All
of these drugs are fungal secondary metabolites, small secreted molecules that
fungi utilize against competitors in their microbial environment. Fungi also
produce commercially important enzymes (e.g., cellulases, proteases, and
lipases) and other products (e.g., citric acid, gibberellic acid, natural
pigments,
and flavorings).
1 S The production of secondary metabolites, enzymes, and other
products is regulated by coordinated gene expression. For example, the
production of penicillin is limited by the activity of twa enzymes, encoded by
the ipnA and acvA genes. PacC, a zinc-finger transcription factor, binds to
sequences upstream of these two genes. Moreover, increased activity of PacC
leads to both increased enzyme activity and penicillin production.
Our understanding of transcriptional regulation of secondary
metabolite production, as exemplified above, has increased greatly over the
past decade. To date, however, the use of genetically-engineered transcription
factors has not been applied to increase production of commercially-important
2S fungal products. In contrast, methods to increase production of penicillin
currently rely upon mutagenesis and selection foe mutants which display
increased secondary metabolite production.
la
CA 02417135 2003-02-14
WO 99/25735 PCT/US98/24975
_7_
Summary of the Invention
The invention provides a means to increase the production of
secondary metabolites in fungi by genetic manipulation of the fungal organism
itself. The ability to increase fungal secondary metabolite production has at
least two important applications. First, it will allow increased production of
existing secondary metabolites which are useful in clinical and experimental
settings. Second, increasing production of secondary metabolites will
facilitate
identification of new compounds in fungi that otherwise make undetectable
levels of these compounds in the laboratory.
Accordingly, in one aspect, the invention features a two-part
chimeric transcription factor including (i) a pre-activated transcription
factor
functional in a fungal strain, and (ii) a transcription activation domain that
is
different from the transcription activation domain naturally associated with
the
transcription factor. In a preferred embodiment, the transcriptionai activity
of
I 5 the chimeric transcription factor is greater than the transcriptional
activity
naturally associated with the pre-activated transcription factor. In another
preferred embodiment, the pre-activated transcription factor is pre-activated
by
truncation. In a related preferred embodiment, the pre-activated transcription
factor includes a substitution of a serine or threanine residue with an
alanine,
aspartic acid, or glutamic acid residue, wherein the substitution pre-
activates
the transcription factor (e.g., by mimicking or otherwise altering
phosphorylation). =In another preferred embodiment, the transcription factor
is
a member of the PacC family (defined below) and can be pre-activated. In a
related preferred embodiment, the pre-activated transcription factor contains
portions of the amino acid sequence shown in Fig. 1 (SECT ID NOs: 1-G).
In another aspect, the invention features a vector including DNA
encoding a chimeric transcription factor including (i) a pre-activated
CA 02417135 2003-02-14
WO 99/25735 PCT/US98/24975
_3_
transcription factor functional in a fungal strain, and (ii) a transcription
activation domain that is different from the transcription activation domain
naturally associated with the transcription factor. The DNA is operably linked
to a promoter capable of directing and regulating expression of the chimeric
transcription factor in a fungal strain.
The transcription factor encoded within the vector described above is
expressed in a fungal cell, such as a filamentous fungal cell, which produces
the secondary metabolite of interest and in which expression of the
transcription factor increases the production of the secondary metabolite by
the
cell. The secondary metabolite can be non-proteinaceous or it can be a protein
or peptide.
In another aspect, the invention features a method of producing a
secondary metabolite of interest, including the steps of (i) introducing into
a
fungal cell, such as a filamentous fungal cell, a vector including a promoter
capable of controlling gene expression in the fungal cell, and a nucleic acid
encoding a two-part transcription factor including a DNA-binding domain and
a transcription activation domain; and (ii) culturing the fungal cell under
secondary metabolite-producing conditions. In a preferred embodiment, the
transcription activation domain is different from the transcription activation
domain naturally associated with the DNA-binding domain. In other preferred
embodiments, the transcription factor is a pre-activated transcription factor
(pre-activated by substitution of a serine ar threoninc residue with an
aianine,
aspartic acid, or glutamic acid residue, or pre-activated by truncation). In
other
preferred embodiments, the DNA binding domain of the transcription factor is
from a fungal transcriptional activator or from a fungal transcriptional
repressor.
By "pre-activated transcription factor" is meant a transcription factor
CA 02417135 2003-02-14
WO 99125735 PCT/US98/24975
_~_
or fragment thereof that, compared to the precursor ~moiecule, is capable of 1
)
increased binding, either direct or indirect, to a specific DNA sequence
located
in a gene regulatory region (e.g., a promoter), or 2) increased transcription
activating properties: Pre-activated transcription factors may be able to
activate
transcription from promoters, but this is not necessarily the case. For
example,
a transcription factor DNA-binding domain with binding properties but no
transactivation activity is considered to be a pre-activated transcription
factor.
"Pre-activation by truncation" or "pre-activated by truncation" means that
removal of a portion of the protein leads to pre-activation. This occurs in
vivo
through proteolytic cleavage. In the invention, pre-activation by truncation
is
achieved with the use of DNA that encodes a pre-activated form of the protein,
excluding portions of the protein that would i~ proteolytically cleaved in
vivo.
By "substantially identical" is meant a polypeptide or nucleic acid
exhibiting at least 50%, preferably 85%, more preferably 90%, and most
1 S preferably 95% identity to a reference amino acid or nucleic acid
sequence.
For polypeptides, the length of comparison sequences will generally be at
Icast
16 amino acids, preferably at least 2() amino acids, more preferably at least
25 amino acids, and most preferably 35 anuno acids. For nucleic acids, the
length of comparison sequences will generally be at least $0 nucleotides,
preferably at least 60 nucleotides, more preferably at least 75 nucleotides,
and
most preferably 110 nucleotides.
By "promoter" is meant a sequence sufficient to direct and/or
regulate transcription. Also included in the invention are those elements
which
are sufficient to render promoter-dependent gene expression controllable for
cell type-specific, tissue-specific, temporal-specific, or inducible by
external
signals or agents; such elements may be located in the ~' or 3' or intron
CA 02417135 2003-02-14
WO 99l2S735 PCT/US98I2497S
_j_
sequence regions of the native gene.
By "operably linked" is meant that a gene and one or more regulatory
sequences are connected in such a way as to permit gene expression when the
appropriate molecules (e.g., transcriptional activator proteins) are bound to
the
regulatory sequences.
Other features and advantages of the invention will be apparent from
the following description of the preferred embodiments thereof, and from the
claims.
~r w~
Fig. 1 is an alignment of the zinc-finger DNA-binding domain of
PacC family members from Aspergillus nidulans (SEQ ID NO: I ), Aspe~gillus
roger (SEQ ID NO: 2), Penicilliunz chrysoger~urrt (SEQ ID NO: 3), Yarrowia
lipolytica (SEQ ID NO: 4), Candida albicans (SEQ ID NO: 5), and
Saccharornyces cerevisiae (SEQ ID NO: G). Identity is represented by shaded
I S regions; similarity is represented by boxed regions.
Detailec,~Des~ril, to ion
The invention features a two-part chimeric protein including a pre-
activated transcription factor and a strong transcription activation domain
for
regulating fungal gene expression. The protein is encoded by nucleic acids
operably linked to°a strong promoter in a vector which allows for
expression in
fungal cells. The effect of the transcription factor is to facilitate
expression of a
protein which itself is a desired product, or which acts as an element (e.g.,
an
enzyme) by which a desired product is made by the host fungal cell. Each of
these components is described below. Experimental examples described herein
2> are intended to illustrate, not linut, the scope of the claimed invention.
CA 02417135 2003-02-14
WO 99/25735 PCTlU598I24975
-fo-
Pre-Activated Trar~scrintion hactor
The vectors of the invention can include DNA encoding any
proteinaceous transcription factor that can be provided in pre-activated form;
i.e., the vector encodes the protein in a form in which it~is already
activated;
S i.e., no post-translational processing is required for the protein to be
active in a
fungal cell to bind to regulatory DNA of the cell to facilitate gene
expression.
Transcription factors regulate the level of gene expression by
affecting the activity of the core transcriptional machinery at the promoter
of
each gene. Several mechanisms have evolved to control the activity of
transcription factors.
Post-translational modification is one mechanism by which
transcription factors are regulated. Proteolytic cleavage is one post-
translational mechanism for regulating the activity of a transcription factor
(e.g., Pah1 and Baeuerle, Curr-. Opin. Cell Biol., I 996, 8:340-347; Goodbourn
1 S and King, Biochem. Soc. Trans., 1997, 25:498-502; Fan and Maniatis,
Nature,
1991, 354:395-398). The fungal PacC family of transcription factors is one
class of proteins that can be activated by proteolysis. Activating mutations
have been described for PacC family members (see below); these mutations
truncate the encoded protein, resulting in the production of a pre-activated
form
of the transcription factor.
Another method for pre-activating a transcription factor is to mimic
the modifications which normally regulate its activity. For example,
phosphorylation has been shown to positively regulate the activity of some
transcription factors and negatively regulate that of others (see review by
2S Hunter and Karin, Cell, 1992, 70:375-387). ~Jther fornzs of post-
translational
modifications that can increase the activity caf transcription factors include
acetylation (Gu and Roeder, C.'ell, 1907, 9():595-(i(1(i) and alkylation
(e.g.,
CA 02417135 2003-02-14
WO 99/25735 PCT/US98/24975
_.~.
methylation)(Chinenov et al., ,l: l3iol. C.'hem., 199$, 2 73:6203-6209;
Sakashita
ct al., J Biochena (Tokyo), 1995, 118:1184-1191 ).
Dephosphorylation of particular residues can increase the activity of
many transcription factors. Phosphorylation most commonly occurs on serine
(Scr), threonine (Thr), and tyrosine (Tyr) residues; in some instance residues
such as aspartate (Asp) and histidine (His) can be phosphorylated. The coding
sequence for the phosphorylated residue can be mutated to encode an amino
acid that cannot be phosphorylated and does not have a negatively charged side
chain (e.g., alanine (Ala)). Sor--~Ala, Thr-~Ala, Tyr-;Ala, and Asp-lAia
1 U substitutions are frequently used in the art to produce a pre-activated
transcription factor (see, for example, Chen et al., Proc. Natl. Acad. Sci.
U.S.A.,
1998, 95:2349-2354; Song et al., Mol. Cell Biol., 1998, 18:4994-4999; O'Reilly
et al., EMI34 .L, 1997, 16:2420-2430; Hao et al., J. Biol. Chefn., 1996,
271:29380-29385).
1 S Phosphorylation can also increase the activity of a transcription
factor. Mutations of Glu or Asp far Ser, Thr, or Tyr are frequently used in
the
art to mimic a phosphorylation event and pre-activate a transcription factor
(see, for example, Hoeffler et al., Nucleic Acids Res~., 1994, 22:1305-12; Hao
et
al., supra). Mutations that result in a substitution of Glu for Asp, at Asp
20 residues which can be phosphorylated, can also cause activation (l~lose et
al., J.
Mol. Biol., 1993, 232:67-78; Krems et al., Cunr~. Genet., 1996, 29:327-34;
Nohaile et al., J. Mol. Biol., 1997, 273:299-316).
Other mutations can be made that mimic activating post-translational
modifications. For example, the E. coli Ada transcription factor is activated
by
25 methylation of cysteine (Cys) residue 69. A Cys-lHis substitution was found
to result in activation (Taketomi et al., Mol. Gen. Genet., 1996, 250:523-
532).
This particular substitution was identified by substituting Cys 69 with each
of
CA 02417135 2003-02-14
WO~ 99/25735 PCT/US98/24975
_g_
the other nineteen atninu acids. Alternatively, in instances inhere no obvious
substitution can be made to mimic a modification (e.g., acetylation), a random
mutagenesis is performed to identify constitutively active forms of
transcription
factors (see, for example, Onishi et al., Mol. Cell Biol., 1998, 18:3871-
3879).
This technique can employ simple and rapid phenotypic or reporter selections,
such as those described herein, to identify activated forms. For example, a
Saceharomyces cerevisiae strain containing a reporter construct can be used to
select for activated forms Specifically, the ipnA promoter (P;~",,) from
Aspergillus rzidulaas may be fused to a gene from Saccharomyces cerevisiae
that confers a growth advantage, such as HIS'3, when PacC is pre-activated by
a
mutation. A P;n"A-HIS'3 fusion has tl3e added advantage that expression levels
can be titrated by the compound 3-aminotriazole (3-A'f). 3-AT is a
competitive inhibitor of His3 that, when present in sufficient amounts, will
inhibit the His3 expressed from P;~"A and prevent this strain from growing on
i 5 SC-HIS. In this example, pacC coding sequence can be randomly rnutagenized
and vectors containing the mutated alleles are transformed into the reporter
strain. Growth of a strain containing Pl~"A-HIS3 only occurs on SC-HIS+3-AT
plates when P;p"A-HISS expression is increased to overcome the competitive
inhibition of His3 by 3-AT. This method provides a rapid technique for
screening for mutations which pre-activate a transcription factor.
The PaeC Family of Tran~et~"ption Factors
One group of transcription factors useful in the invention are
members of the PacC family. The PacC transcription factors regulate gene
expression in response to changes in ambient pH. Members of the family have
the following characteristics: I) They display significant (at least 35%)
amino
acid sequence identity to the Aspeyillus nicia~lcJrns PacC' protein (Tilburn
et al.,
CA 02417135 2003-11-10
CR~1B0 J , l 995, 14:779-790). Such proteins have been identified in fcrr-
rova~ia
lipolytica (YIRim101p; Lambent et al., Mol. Cell. Biol., 1997, 17:3966-3976),
Penicillium chrysogenum (Suarez and Penalva, Mol. Microbiol., 1996, 20:529-
540), Aspergillus niger (MacCabe et al., Mol. Gen. Genet., 1996, 250:367-374),
S ~Saccharorrryces cerevisiae (InvB/Rim101/Riml; Su and Mitchell, Nucleic
Acids
Res., 1993, 2 i :3789-3797), and Candida albicans (Table
1 ). 2) They contain a predicted DNA-binding region that includes three zinc
fingers of the Cys~His2 class.
TABLE 1
Species of origin % identity to A. nidularzs % similarity to A. nidulans
of PacC homolo~ PacC in 107-as PacC over entire leneth
A. Niger 94 7S
P. chrysogenunr 84 67
C_ albicarrs 61 18
1 S S. cerevisiae 56. 22
Y. lipolytica S8 30
In addition, several PacC family member either have been shown to
directly bind to or regulate expression of genes that contain a 5'-GCCAAG-3'
or S'
GCCAGG-3' element in upstream regulatory sequence (Tilbum et al., supra;
Suarez
and Penalva, szrpr-a): Furthermore, with the exception of PacC from P.
clTrysogerzum,
mutations that truncate the protein have either been identified or
constructed, and
these mutations result in activation of gene expression by the PacC family of
proteins,
even at low ambient pH (Tilburn et al., supra; van den Hombergh et al., Mol.
Gerz.
Gener., 1996, 2S 1:542-SSO; Lambent et al., supra; Li and Mitchell, Genetics,
1997,
2S 145:63-73). Finally, in both A. nidulans and S. cerevisicze, it has been
demonstrated
CA 02417135 2003-02-14
WO 99/25735 PCTlUS98/2497~
- l 0-
that specific proteoiytic cleavage results ir~r activation of sic;nalin~; in
aivo (Orejas et
al., Genes Dev.. 1995, 9. I 622-32; Li and Mitchell, supra).
Trans~r_intion A~tivatior~omains
Transcription activation domains (TADS) are discrete regions of proteins
which promote gene expression by a variety of mechanisms that ultimately
result in
the activation of RNA polymerase. A TAD generally is defined as the minimal
motif
that activates transcription when fused to a DNA-binding domain {DBD) (Webster
et
al., Cell, 1988, 52:169-178; Fischer et al., Nature, 1988, 332:853-856; Hope
et al.,
Nature, 1988, 333:635-640). The invention can employ any TAD that can
transactivate expression from a fungal gene promoter when the TAD is fused to
an
appropriate DBD. TADS are classified based on similarities in protein sequence
and/or composition properties. These classes include the acidic-rich (e.g.,
Gal4,
Gcn4, VP1G, and Jun; Webster et al., supra; Fischer et al., supra; Hope et
al., supra;
Cress and Triezenberg, Science, 1991, 251:87-90; Struhl, Nature, 19$8, 332:649-
650),
glutamine-rich (Spl, Octl, and Oct2; Courey and Tjian, Cell, 1988, 55:887-898;
Tanaka et al., Mol. Cell Biol., 1994, 14:6046-6055; Tanaka and Herr, Mol. Cell
Biol.,
1994, 14:6056-d0G7), and proline-rich TADS (CTF, NF-I, and EKLF; Mern~od et
al.,
Cell, 1989, 58:741-753; Tanese et al., Genes Dev., 1991, 5:2212-2224; Chen and
Bieker, EMBO J., 1996, 15:5888-5896). Any of these classes of TADs may be used
in the present invention. The ability of any particular TAD to transactivate
from a
particular promoter can be determined using simple, known selection screens.
It is also possible to artificially create either a T'AD or a site-specific
DBD.
In one example, protein sequences which transactivate a reporter gene from a
promoter of interest are selected from an expression library. In another
example,
2S protein sequences which specifically bind particular DNA sequences are
selected. In
each case, these sequences can then be mutated in a reiterative process to
obtain either
the optimal TAD sequence for the particular promoter, or the optimal DBD
sequence
for a particular DNA sequence. Transcription factors containing artificial
elements
CA 02417135 2003-02-14
WO 99/25735 PCT/US98/24975
produced by this or any other method are useful in the invention.
In the chimeric transcription factor of the featured invention, TADs may
be used alone or in combination. For example, Spl contains multiple glutamine-
rich
TADs, and these domains act synergistically to promote gene expression (Courey
and
S Tjian, supra; Courey et al., Cell, 1989, 59:827-836). Oct-2 contains both
glutamine-
rich and proline-rich TADs, and both are required for maximal expression when
fused
to either the Oct-2 or a heterologous DBD (Tanaka et al., supra). Thus, the
use of two
or more classes of TADS in one construct may amplify the induction of
expression.
Furthermore, homopolymeric stretches of proline or glutamine function as TADs
(Gerber et al., Science, 1994, 263:808-811 ). In one example, a strong
transcription
factor has been created by fusion of the Gal4 DBD to a homopolymeric glutamine
stretch linked to reiterated VP16 TADs (Schwechheimer et al., Plant Mol.
Biol., 1998,
36:195-204).
Fun~a3 Promoters
1 S The chimeric, pre-activated transcription factor is operably linked to a
S1C011g promoter, allowing for expression of the transcription factor in a
fungal cell.
Expression systems utilizing a wide variety of promoters in many fungi are
known,
including, but not limited to, Aspergillus nidulans (gpd: Punt et al., Gene,
1987,
56:117-124; Hunter et al., Curr. Genet., 1992, 22:377-383; Glumoff et al.,
Gene,
1989, 84:311-318, alcA; Fernandez-Abalos et al., Mol. Microbiol., 1998, 27:121-
130.
glaA: Carrez et al., Gene, 1990, 94:147-1 S4. arrrdS: Turnbull et al., Appl.
Environ.
Microbiol., 1990, 56:2847-2852), Aspergillus niger (gpd: Punt et al., supra;
Hunter et
al., supra; Glumoff et al., supra. glaA: Tang et al., Chin. J. Biotechnol.,
1996, 12:131-
136. amdS promoter: Turnbull et al., supra), Pichia pastoris (alcohol oxidase
I
2S promoter: Payne et ai., Gene, 1988, 62:127-134), Pleurotus ostreatus
(Lentinus
edodes ras promoter: Yanai et al., Biosci. Bioteclrnol. L3iochem., 1996,
60:472-475),
Plavtophtl2ora irrfcstans (I3rcrrrict lactucczc flsr~7l): Judelson et al.,
Mol. Plant Micrnhc
Interact., 1991, 4:602-607), Ncrcrospara crcrssa (Itis3 promoter: Avalos et
al., Cur-r-.
CA 02417135 2003-02-14
WO 99/25735 PCTlUS98/24975
_12_
Genet., 1989, 10:369-372), Y'ar~roivia lipalvtica (:kf'li' promoter: Nicaud et
al., Ctrrm
Genet., 1989, 16:253-260. TEF: Mulier et al., Yeast, 1998, 14:1267-1283.),
Penicillium chrysogenum (phaA promoter: Graessle et al., Appl. Environ_
Micrahiol.,
1997, 63:753-756), Rhizapus delemar (pyr9 promoter: Horiuchi et al., Curr.
Genet.,
1995, 27:472-478), Gliocladium vireos (proml: Dave et al., Appl. A~icro6iof.
Biotechnol., 1994, 41:352-358), and Cochliobolzrs Irc~terostrophus (Monke and
Shafer,
Mol. Gen. Genet., 1993, 241:73-80),
There are also simpie techniques for isolating promoters in organisms with
relatively unstudied genetics. One of these is a system based on selection of
sequences with promoter activity (see, for example, Turgeon et al., Mol. Cell
Biol.,
1987, 7:3297-3305; Weltring, C'urr. Genet., 1995, 28:190-190). This approach
provides an easy method for isolating promoter fragments from a wide variety
of
fungi.
The constructs of the invention also preferably include a terminator
sequence located 3' to the chimeric transcription factor coding sequence.
Terminator
sequences which function in numerous fungi are known in the ari. These include
those from Aspergillus nidulata trpC (Punt et al., sicpra; I~lunter et al.,
supra; Glumoff
et al., supra), Lentinus edodes priA (Yanai et al., supra), Bremia lactucae
Ham34
(Judelson et al., supra), and Aspergillus nidulans argB (Carrez et al.,
supra).
onstruction of Chimer-ic Transcrintion Factors
The pre-activated transcription factors of the invention display 1 )
increased binding, either direct or indirect, to a specific DNA sequence
located
in a gene regulatory region (e.g., a promoter) in vivo, ~ind/or 2) increased
transcription activating properties, relative to the precursor molecule. To
this
end, it is preferable that part or all of~th~. DBD, the domain of the parental
transcription factor which recognizes acid binds to the DNA sequences, remain
intact. Additional sequences from the parental transcription factor may also
remain in tire ehimeric construct, or thev may be removed. The TAD of the
CA 02417135 2003-02-14
WO 99/25735 PCT/US9$/24975
-1 ;-
parental transcription factor may be removed, as the chimcric transcription
factor will contain a TAD from another protein, such as the herpesvirus
transactivator VP i G, as described herein. The TAD' from the parental
transcription factor may also remain in the chimeric construct.
As described above, TADs can be acidic, glutamine-rich, or proline-
rich. The ability of each of these TADS to function in any given fungal strain
will vary. The acidic TADs have been shown to function in a wide variety of
organisms, from C. elegans to humans, including fungi. Glutamine-rich and
proline-rich TADs have also been shown to function in disparate organisms,
including fungi. As described above, increased transactivation activity may be
achieved by using multiple TADS from one category (Tanaka and Herr, supra).
Furthermore, TADs from more than one class may be used in one chimeric
protein (Schwechheimer et al., supra; Tanaka et al., supra). In the example
described below, 4 VP 1 G TADs and a proline-rich TAD are placed in series.
The production of chimeric transcription factors which activate
transcription is not limited to the use of parental transcription factors that
themselves are transcriptional activators. Using this method, transcription
factors which are transcriptional repressors may be converted to
transcriptional
activators by the addition of a TAD. An example is the Saccharomyces
cerevisiae Migl, which is a repressor of SUC2 expression. Deletion of migl
derepresses SUC2 expression. A chimeric protein in which the DBD of Migl
is fused to the VPiG TAD can activate transcription from promoters containing
Migl-binding sites and leads to increased expression of SUC2 (Ostling et al.,
Mvl Cell Biol., 1996, 16:753-G 1 ). Thus, the formation of a chimeric
2S transcriptional activator may be performed for any transcription factor,
whether
it be an activator or a repressor.
The choice of parental transcription factor for use in the present
CA 02417135 2003-02-14
WO 99/25735 PCT1US98/2497a
- I 4-
invention depends upon the desired product one wishes to produce. 'The
transcription factor must recognize a sequence in the promoter of a gene of
interest. This gene may encode a protein which itself is a desired product, or
one which acts as an element (e.g., an enzyme) in the pathway by which a
desired product is made by the host fungal cell. For example, a chimeric
transcription factor including PacC may be used if the desire is to increase
the
production of beta-lactam antibiotics. This is achieved by increasing the
expression of at least two genes, iprzA and acvA, which encode enzymes in the
penicillin production process.
One skilled in the art will recognize that there are standard
techniques, including the ones described herein, which allow for rapid
selection
and screening of chirneric transcription factor constmcts in order to
ascertain
which transcription factors are the strongest transcriptional activators.
('onstruction of Fungal Exp~es~i,o~n Vectors
To achieve high expression of the chimeric transcription factor,
several types of expression vectors are known in the art (e.g., those
described
herein). The choice of expression vectors may depend on the type of fungus to
be used. For example, expression of a chimeric transcription factor in
Aspergillus nidulans may be achieved using the amdS' promoter system
(Turnbull et al., supra). The promoter element may be modified such that it
also contains a DNA sequence recognized by the chimeric transcription factor.
The expression of the chimeric transcription factor will induce increased
activation from its own promoter', thus amplifying its own production. The
expression vector may also include terminator sequences, as described above.
For example, a suitable terminator for Aspergillus rzidularzs is the argl3
terminator.
CA 02417135 2003-02-14
WO 9912573 PC:T/US9$/Z4975
_IS_
T'he vector, once tI<111SfOi'211eC1 into a firngaf cell as described herein,
may remain episomal, in which case the vector may also have an origin of
replication. The vector may also integrate into the chromosomal DNA of the
host cell. The expression of the integrated expression construct may depend on
positional effects, and, thus, it may be necessary to screen through or select
for
transformants to isolate those with suitably high expression. Methods for
screening and selection are described herein. The integrated expression
construct may also alter the expression of endogenous genes of the fungal
cell.
This altered expression may be beneficial or detrimental to the survival of
the
IO cell or to the purpose of the production of the fungal cell. For example,
if the
purpose is to increase production of a beta-iactam antibiotic, then loss of
expression of ip~2A (which encodes isopenicillin N-synthasc and is required
for
beta-lactam production) following integration of the expression construct
would negate any benefits resulting from expression of the chimeric
transcription factor. Thus, a secondary screen of transformants displaying
characteristics suitably for the designed purpose may be performed. Methods
for determining metabolite production are described herein.
In some cases, it may be beneficial to use a transcription factor
which is not chimeric. Overexpression of a parental transcription factor may
lead to an increase in secondary metabolites. This overexpressed protein may
be constitutively active, due to overexpression or genetic mutation, or it may
be
regulated in a mariner similar to the endogenous transcription factor. The
fungal cell may be a wild-type strain, or it may contain one or more mutations
(which may also increase production of secondary metabolites). Example
mutations include those which result in duplication or rearrangement of
biosynthetic genes (e.g., the penicillin gene cluster of iprZA, acvA, and
aatA).
Reporter genes, such as those described herein, or other exogenous genes may
CA 02417135 2003-02-14
WO 99/25735 PCT/US98/24975
.. [ (>-
also be present in the fungal cells, either episomally or chromoson~ally.
Tr~nsfQrmation
In order to introduce the construct into a fungal cell, one may utilize
any of numerous transformation protocols (for review, see Punt and van den
Hondel, Methods Enzymol., 1.992, 216;447-457; Timberlake and Marshall,
Science, 1989, 244:1313-1317; Fincham, Microbiol. Rev., 1989, 53:148-170).
Suitable DNA transformation techniques include electroporation, polyethylene
glycol-mediated, lithium acetate-mediated, and biolistic transformation (Brown
et al., Mvl. Gen. Genet., 1998, 259:32?-335; Zapanta et al., Appl. Environ.
lU Microbiol., 1998; 64:21124-2629; Thompson et al., Yeast, 1998, 14:565-571;
Barreto et al., FEMS Microbiol. Lett., 1997, 156:95-99; Nicolaisen and Geisen,
Microbiol. Res., 1996, 151:281-284; Wada et al., Appl. Rlicrobiol.
Biotechnol.,
1996, 45:652-657; Ozeki et aL, Biosci. Biotechnol. Biochem., 1994, 58:2224-
222?; Lorito et al., Curr-. Genet., 1993, 24:349-356; Oda and Tonomura, Curr.
Genet., 1995, 27:131-134). if desired, one may target the DNA construct to a
particular locus. Targeting homologous recombination techniques are currently
practiced in many fungi, including, but not limited to, Candida albicans
(Fonzi
and Irwin, Genetics, 1993, 134: 717-728), Llstilago maydis (Fotheringham and
Hollman, Mol. Cell Biol., 1989, 9:4052-4055; Bolker et al., Mol. Gen. Genet.,
1995, 248:547-552), Yarrowia lipolytica (Neuveglise et al., GerZe 1998, 213:37-
4C; Chen et al., Appl. Microbiol. Biotechnol., 1997, 48:232-235; Cordero et
ai.,
Appl. Micr°obiol. Bivtechnol., 1996, 46:143-148), Acrerrtorciurn
chrysogerrum
(Skatrud et al., Curn. Genet., 1987, 12:337-348; Walz and Kuck, Curr-. Genet.,
1993, 24:421-427), Magnaporthe grisea (Sweigard et al., Mol. Gen. Genet.,
1992, 232:183-190); Kershaw et al., EMBt),1., 1908, 17:3838-3849),
Jlistoplasrrra capsttlutt.crrt ( Woods et al., .l- l3actcr°iol_, 1998,
180:5135-~ 143)
CA 02417135 2003-02-14
WO 99/25735 PC1'/US98/24975
_ 17_
and .9 spergilh.ts sh. (Miller et al., A~lol. C'cll Biol. , 1985, 5:1714- i 72
i ; de
Ruiter-Jacobs et al., Curr-. Genet., 1989, 16:159-163; Gouka et al., Curr-.
Genet., 1995, 27:536-540; van den l3ornbergh et al., Mol. Gen. Genet., 1996,
251:542-550; D'Enfert, C.,urr-. Genet., 1996, 30:76-82; Weidner et al., Curr.
Ger~et., 1998, 33:378-385).
Methods for Selection arid Screen~_ng Traosfr~,~,~~~s
Reporter genes are useful for isolating transformants expressing
functional chimeric transcription factors. The reporter genes may be operably
linked to promoter sequence which is regulated by the chimeric transcription
factor. Reporter genes include, but are not limited to, genes encoding (3-
galactosidase (lack ~i-glucoronidase (GUS'), (3-glucosidase, and invertase,
amino acid biosynthetic genes, c.g., the yeast LEU2, ~iIS3, L 3'S2, TRPI genes
(or homologous genes from other fungi, such as filamentous fungi, that encode
proteins with the similar functional activities), nucleic acid biosynthetic
genes,
e.g., the yeast URA3 and ADE2 genes (or homologous genes from other fungi,
such as filamentous fungi, that encode proteins with the similar functional
activities), the mammalian chloramphenicol transacetylase (CAT) gene, or any
surface antigen gene for which specific antibodies are available. A reporter
gene may encode a protein detectable by luminescence or fluorescence, such as
green fluorescent protein (GFP). Reporter genes may encode also any protein
that provides a phenotypic marker, for example, a protein that is necessary
for
cell growth or viability, or a toxic protein leading to cell death, or the
reporter
gene may encode a protein detectable by a color assay leading to the presence
or absence of color.
The choice of reporter gene will depend on the type of fungal cell to
be transformed. It is preferable to have rivo reporter genes within the fungal
CA 02417135 2003-02-14
WO' 99J2573~ PCTlUS98/24975
cell. One reporter gene, wJhen expressed, may provide a growth advantage to
transforn~ed cells which are expressing the chimeric transcription factor.
This
allows for isolation of such transformants though selective pressures. The
other
reporter gene may provide a colorimetric marker, such as the lacZ gene and its
encoded protein, ~i-galactosidase. Alternatively, the second reporter may
provide a fluorescent or luminescent marker, such as GFP. These reporters
provide a method of quantifying expression levels from expression constructs
comprising chimeric transcription factors. Screens and selections similar to
the
ones described may be used to optimize construction of chimeric transcription
factors or expression constructs.
xa ~e
The following example describes a method for increasing the level of
PacC activity over that caused by proteolysis or specific truncations. This
invention may facilitate the increased production of fungal secondary
1 S metabolites including, but not limited to, penicillins and cephalosporins.
Similar genetic engineering can be perfarmed to alter the function of other
transcription factors.
A constr<tct that encodes a chimeric transcription factor is described
below. In this example, a proline-rich TAD followed lay multiple copies of the
acidic-rich TAD from the herpes simplex virus VP16 protein are fused to a
truncated, pre-activated PacC from Aspcrgillus nidulans (SEQ ID NO: 7). This
construct may be integrated at the pyre locus in .~sper~illus nidulans, as
described below. Expression of this chimeric polypeptide is regulated by the
strong PGK promoter from Aspergillus nidulans and terminator sequences from
the crmA gene ofAspcrgillus nida~larT.s.
CA 02417135 2003-02-14
w0 99/25735 PCT/US98J24975
_ 1 c) _
Several DNA closing steps <~r~, required to create this chimeric
construct. Bluescript KS {Stratagene, L.aJolla,C~.) is be used as a cloning
vector. The primers S'- aactc TAG'I'TGACCGTGTGATTGGGTTCT -3'
(SEQ ID NO: 8){lowercase letters denote sequences introduced for cloning and
restriction sites are underlined] and S'-
ccggaattcTTTGTAAACTGGCTTGAAGAT -3' {SEQ ID NO: 9) are used to
amplify 347bp of crnA terminator sequence from genomic DNA template. The
PCR product is PstIlEcoRI digested and then cloned into the KS polylinker to
produce p I . Subsequently, complementary oligonucleotides S' -
gatccCCCCCCCCTCCTCCAC(:CC:CACCCCCTCCC -3' (SEQ ID NO: 10)
and S'- GGGAGGGGGTGGGGGTGGAGGAGGGGGGGGg-3' (SEQ ID NO:
1 I ) are annealed (this double-stranded oligonuclcotide encodes a proline-
rich
motif) and the double-stranded product is tigated into Snralll3amHI digested
pl,
yielding p2.
1 S Ncxt, the oligonucleotide primers S°-
cgc ata cAAAGTCGCCCCCCCGAGCGAT -3' (SEQ ID NO: 12) and S'-
cgc ag, tatcCCCACCGTACTCGTCAATTCC -3' {SEQ ID NO: i 3) are used in
PCR reactions to amplify a 2S8bp fragment using pVP 16 (Clontech, Palo Aito,
CA) as template. This product encodes the acidic-rich domain of VP 1 G. The
product is digested with EcoRV, and ligation reaction is performed with >20
fold excess of EcoRV insert relative to Smal-digested calf=alkaline
phosphatase
treated p2. Bacterial transformants are screened for plasmids that contain
multiple tandem insertions of VP16 sequence. S'r~aaI sites within the VP16
coding sequence allow for determination of the orientation of the insertion.
2S Plasmids are selected that contain four insertions of the VP 16 acidic-rich
domain (p3). p3, then, encodes a proline-rich domain in-frame with four
CA 02417135 2003-02-14
WO 99/25735 PCT'/US98/24975
_7()_
reiterations of the VPIO domain, and ti~esc 'I',ADs arc linked to the rnn,~
terminator.
In the next cloning step a truncated form of pacC is fused to the
coding sequence for the TADS. Primers 5 '-
tgctcta~aGGCGCCATGGCCGAAGAAGCG -3' (SEQ ID NO: 14) and 5'-
cgcQEatccGTAACCAGAAGTCAT"ACCGTC -3' (SEQ ID NO: 15) are used to
amplify a 1419bp product (SEQ ID NO: 16) from an Aspergillus rZidulahs
cDNA library. This product is XhaIIBamHI digested and ligated into digested
p3 to produce p4. This cloning reaction introduces a form of pacC that lacks
the carboxy-terminal 209 amino acids in-frame with the described TADs.
An additional cloning step is required in order to place the coding
sequence for this chimera under the control of a strong promoter. Primers 5'-
ataagaat~c~uccecCCTCTGCATTATTCUTCTTA'TC -B' {SEQ ID NO: 17) and
5'- tgctcta~aAGACATTGTTGCTA'rAGC1'GT -3' (SEQ ID NO: 18) are used
I 5 to amplify ~89bp of PGK promoter sequence {SEQ ID NO: 19) from
Aspergillus nidulans genomic DNA. This fragment is NotIlXbaI digested and
cloned into digested p4 in order to yield p5. Thus, p5 contains coding
sequence
for an 815 amino acid chimeric transcription factor to be expressed from the
PGK promoter.
To decrease the extent of position effects, the p5 construct is targeted
to the pyre locus. Oligonucleotides S'-
tcc~cgcggATGGAAGCTTCCiTTAAGGA'fAATT-3' (SEQ ID NO: 20) and 5'-
ataagaatgc~cegcCTACCAGAT'TAGGGAGCA'TAT-3' (SEQ ID NO: 2 i ) are
used to amplify a 2240bp product (SEQ ID NO: 22) from Aspergillus nidulans
genomic DNA; this product contains coding and regulatory sequence for the
pyre gene that encodes orotidine-5'- phosphate decarboxylase. T'he 2240bp
fragment is SacIIINotI digested, and then cloned into p5 to produce p(i; this
CA 02417135 2003-02-14
W(O 99J2573~ PCT/US98/24975
_~a_
fragment is also cloned into KS to yield p7 (a control construct, containing
regulatory sequence for the pyr(~ gene, but no PGK promoter or transcription
factor). pG and p7 are vector that can complement uridine auxotrophy,
allowing for selectian, and target the chimeric transcription factor to the
pyre
S locus. In addition, primers 5'- tgctcta GGCGCCATGGCCGAAGAAGCG -3
(SEQ ID NO: 23) and 5' tccccgGTAACCAGAAGTCATACCGTC -3'
(SEQ ID NO: 24) are used to amplify the truncated form of PacC from an
Aspergillus r:idulans cDNA library . This fragment can be cloned into
XballSmaI digested pG to produce p8. p8 is a control construct, used to
monitor
the activity of pre-activated PacC expressed from the PGK promoter,
independent of the presence of heterologous TADs.
PEG-CaClz (or other methods, described herein) may be used to
transform protoplasts of a uridine auxotroph carrying a pyre mutation
(Ballance and Turner, Gene, Ly85, 36:321-331). pG, p7, and p8 plasmid DNA
I S are used to transform to uridine prototrophy. PCR and Southern analysis
are
performed to confirm single-copy integration at py°G.
Several methods may be employed to assess the activity of wild-
type, pre-activated, and chimeric PacC-TAD factors. Samples of mycelia may
be taken from parallel fermentation of strains containing pG, p7, and p8.
Northern blot analysis may be performed on RNA prepared from extracts of
these mycelia. Probes are prepared from coding sequence for the ipnA and
acvA genes of Aspeyillus raidulans. Keporter constructs are valuable tools for
examining the level of PacC activation. For example, ipnA and acvA are
divergently transcribed from a common regulatory sequence. One may use
constructs (e.g., pAXB4A; Brakhage et al., supra) that contain ipnA-lacZ and
acvA-uidA reporters within the same plasmid; this paa-ticular plasmid can be
targeted to the argl3 locus to ensure integration at a specific genomic locus.
A
CA 02417135 2003-02-14
WO 99/25735 PCT/US98/Z4975
-22-
strain carrying both argB and py~G mutations can be sequentially transformed
with the pyre and reporter vectors, and enzyme assays can be performed on
extracts from mycelia (van Gorcom et al., Gene, 1985, 40:99-IOG; Pobjecky et
al., Mol. Gen. Genet., 1990, 220:314-31 G). In addition,-bioassays can be done
to deternZine whether chimeric transcription factors increase the production
of
fungal secondary metabolites such as penicillin. Supernatant fluid from
fermentations can be centrifuged and applied to wells containing indicator
organisms such as Bacillus calidolactis (Smith el al., Jhlol. Gen. Genet.,
1989,
216:492-497). The application of all of these methods will promote a rapid and
I 0 quantitative analysis of the efficacy of chirneric transcription factors.
Enhancement of Secondary Met~ol~te 1P,,~oduction
The constructs and methods described herein may be used to increase
the yields of currently marketed pharmaceuticals whose production, in whole or
in part, is dependent upon a fungal fermentation. For example, in Aspergillus
nidulans, penicillin biosynthesis is catalyzed by three enzymes encoded by
ipnA, acvA, and aatA. Two of these genes, ipnA and acvA, are regulated
directly by PacC. For example, PrP",q COntalns at least three PacC binding
sites
(ipnA2, ipnA3, and ipnA4AB)(Espeso and Penalva, J. Biol. Ghem., 1996,
271:28825-28830). Expression of a truncated form of PacC has been shown to
increase both expression of ipnA and acvA as well as production of penicillin.
Activation (i.e., proteolytoc cleavage) of PacC requires the proteins encoded
by
the palA, palB, palC, palF, pales, and pall genes. It is possible that
increased
expression of at least some of these genes would result in increased
production
of penicillin. In the example described herein, ipnA and acvA expression are
targeted for increase by formation of a chimeric transcription factor
including
the Dh.IA-binding domain of fac(', and 4 VP 1 G acic:lic 'I~AUs and a proline-
rich
CA 02417135 2003-02-14
WO 99125735 PCT/US98124975
..73_
TAD. LTsin~ tlne methods of floe invention, !o-odu~;tion of other secondary
metabolites can also be increased.
Examples of marketed secondary metabolites whose yields during
fermentation could be increased by the methods of the invention include,
without limitation, cyclosporin, penicillin, cephalosporin, ergot alkaloids,
lovastatin, mevastatin, and the biosynthetic intermediates thereof. In
addition,
such methods can also be used to increase the likelihood of identifying new
secondary metabolites with medicinal or agricultural value by increasing the
concentration of such metabolites (and hence, the likelihood of detection by
chemical or bioassay) in a fermentation broth.
Pro uct' a d etect'o r ,u 1 S o a tab lite
Methods for fermentation and production of beta-laetam antibiotics,
statins, ergot alkaloids, cyclosporin, and other fungal metabolites are
described
in Masurekar (Bioteclanolo~y, 1992, 21: 241-301), and references therein. The
I 5 detection of secondary metabolites is specific for each metabolite and
well-
known to those practiced in the art. General methods to assess production and
integrity of compounds in fermentation broths include, but are not limited to,
bioassays for antimicrobial activity, high-performance liquid chromatography
(HPLC) analysis, nuclear magnetic resonance, thin-layer chromatography, and
absorbance spectrometry. Purification of metabolites from a fermentation broth
can include removal of fungal cells or hyphae by centrifugation or filtration,
adjustment of pH and/or salt concentrations after fermentation (to enhance
solubility and/or subsequent extraction efficiency), and extraction of broths
with appropriate organic solvents.
CA 02417135 2003-02-14
1
SEQUENCE LISTING
<110> Microbia, Inc.
<120> CHIMERIC PRE-ACTIVATED TRANSCRIPTION
FACTORS
<130> 198b-114div
<140> N/A
<141> 1998-11-20
<150> 60/066,129
<151> 1997-11-19
<150> 60/066,308
<151> 1997-11-21
<150> 60/066,462
<151> 1997-11-24
<160> 24
<170> FastSEQ for Windows Version 3.0
<210> 1
<211> 678
<212> PRT
<213> Aspergillus nidulans
<400> 1
Met Leu Gly Ala Met Ala Glu Glu Ala Val Ala Pro Val Ala Val Pro
1 5 10 15
Thr Thr Gln Glu Gln Pro Thr Ser Gln Pro Ala Ala Ala Gln Val Thr
20 25 30
Thr Val Thr Ser Pro Ser Val Thr Ala Thr Ala A1a Ala Ala Thr Ala
35 40 45
Ala Val Ala Ser Pro Gln Ala Asn Gly Asn Ala Ala Ser Pro Val Aia
50 55 60
Pro Ala Ser Ser Thr Ser Arg Pro Ala Glu Glu Leu Thr Cys Met Trp
65 70 75 80
Gln Gly Cys Ser Glu Lys Leu Pro Thr Pro Glu Ser Leu Tyr Glu His
85 90 95
Val Cys Glu Arg His Val Gly Arg Lys Ser Thr Asn Asn Leu Asn Leu
100 105 110
Thr Cys Gln Trp Gly Ser Cys Arg Thr Thr Thr Val Lys Arg Asp His
115 120 125
Ile Thr Ser His Ile Arg Val His Val Pro Leu Lys Pro His Lys Cys
130 135 140
Asp Phe Cys Gly Lys Ala Phe Lys Arg Pro Gln Asp Leu Lys Lys His
145 150 155 160
Val Lys Thr His Ala Asp Asp Ser Val Leu Val Arg Ser Pro Glu Pro
165 170 175
Gly Ser Arg Asn Pro Asp Met Met Phe Gly Gly Asn Gly Lys Gly Tyr
180 185 3 90
Ala Ala Ala His Tyr Phe Glu Pro Ala Leu Asn Pro Val Faro Ser Gln
CA 02417135 2003-02-14
2
195 200 205
Gly Tyr Ala His Gly Pro Pro Gln Tyr Tyr Gln Aia His His Ala Pro
210 215 220
Gln Pro Ser Asn Pro Ser Tyr Gly Asn Val Tyr Tyr Ala Leu Asn Thr
225 230 235 240
Gly Pro Glu Pro His Gln Ala Ser Tyr Glu Ser Lys Lys Arg Gly Tyr
245 250 255
Asp Ala Leu Asn Glu Phe Phe Gly Asp Leu Lys Arg Arg Gln Phe Asp
260 265 270
Pro Asn Ser Tyr Ala Ala Val Gly Gln Arg Leu Leu Ser Leu Gln Asn
275 280 285
Leu Ser Leu Pro Val Leu Thr Ala Ala Pro Leu Pro Glu ~'yr Gln Ala
290 295 300
Met Pro Ala Pro Val Ala Val Ala Ser Gly Pro Tyr Gly Gly Gly Pro
305 310 315 320
His Pro Ala Pro Ala Tyr His Leu Pro Pro Met Ser Asn Val Arg Thr
325 330 335
Lys Asn Asp Leu Ile Asn Ile Asp Gln Phe Leu Gln Gln Met Gln Asp
340 345 350
Thr Ile Tyr Glu Asn Asp Asp Asn Val Ala Ala Ala Gly Val Ala Gln
355 360 365
Pro Gly Ala His Tyr Ile His Asn Gly Ile Ser Tyr Arg Thr Thr His
370 375 380
Ser Pro Pro Thr Gln Leu Pro Ser Ala His Ala Thr Thr Gln Thr Thr
385 390 395 400
Ala Gly Pro Ile Ile Ser Asn Thr Ser Ala His Ser Pro Ser Ser Ser
405 4i0 415
Thr Pro Ala Leu Thr Pro Pro Ser Ser Ala Gln Ser Tyr Thr Ser Gly
420 425 430
Arg Ser Pro Ile Ser Leu Pro Ser Ala His Arg Val Ser Pro Pro His
435 440 495
Glu Ser Gly Ser Ser Met Tyr Pro Arg Leu Pro Ser Ala Thr Asp Gly
450 455 460
Met Thr Ser Gly Tyr Thr Ala Ala Ser Ser Ala Ala Pro Pro Ser Thr
465 470 475 480
Leu Gly Gly Ile Phe Asp Asn Asp Glu Arg Arg Arg Tyr Thr Gly Gly
485 490 495
Thr Leu Gln Arg Ala Arg Pro Ala Ser Arg Ala Ala Ser G1u Ser Met
500 505 510
Asp Leu Ser Ser Asp Asp Lys Glu Ser Gly Glu Arg Thr Pro Lys Gln
515 520 525
Ile Ser Ala Ser Leu Ile Asp Pro Ala Leu His Ser Gly Ser Pro Gly
530 535 540
Glu Asp Asp Val Thr Arg Thr Ala Lys Ala Ala Thr Glu Val Ala Glu
545 550 555 560
Arg Ser Asp Val Gln Ser Glu Trp Val Glu Lys Val Arg Leu Ile Glu
565 570 575
Tyr Leu Arg Asn Tyr Ile Ala Asn Arg Leu Glu Arg Gly Glu Phe Ser
580 585 590
Asp Asp Ser Glu Gln Glu Gln Asp Gln Glu Gln Glu Gln Asp Gln Glu
595 600 605
Gln Glu Gln Asp Gln Glu Gln Gly Gln Asp Arg Val Ser Arg Ser Pro
610 615 620
Val Ser Lys Ala Asp Val Asp Met Glu Gly Val Glu Arg Asp Ser Leu
625 630 635 640
Pro Arg Ser Pro Arg Thr Val Pro Ile Lys Thr Asp Gly Glu Ser Ala
645 650 655
CA 02417135 2003-02-14
3
Glu Asp Ser Val Met Tyr Pro Thr Leu Arg Gly Leu Asp Glu Asp Gly
660 665 670
Asp Ser Lys Met Pro Ser
675
<210> 2
<211> 667
<212> PRT
<213> Aspergillus niger
<400> 2
Met Ser Glu Pro Gln Asp Thr Thr Thr Ala Pro Ser Thr Thr Ala Ala
1 5 10 15
Pro Met Pro Thr Ser Thr Ser Gln Asp Ser Pro Ser Ala Gln Gln Pro
20 25 30
Ala Gln Val Ser Ser Ala Thr Ala Ala Ser Ala Ala Ala Thr Ala Ala
35 40 45
Ala Ala Ser Ala Ala Val Ala Asn Pro Pro Met Asn Gly Thr Thr Thr
50 55 60
Arg Pro Ser Glu Glu Leu Ser Cys Leu Trp Gln Gly Cys Ser Glu Lys
65 70 75 80
Cys Pro Ser Pro Glu Ala Leu Tyr Glu His Val Cys Glu Arg His Val
85 90 95
Gly Arg Lys Ser Thr Asn Asn Leu Asn Leu Thr Cys Gln Trp Gly Ser
100 105 110
Cys Arg Thr Thr Thr Val Lys Arg Asp His Ile Thr Ser His Ile Arg
115 120 125
Val His Val Pro Leu Lys Pro His Lys Cys Asp Phe Cys Gly Lys Ala
130 135 140
Phe Lys Arg Pro Gln Asp Leu Lys Lys His Val Lys Thr His Ala Asp
145 150 155 160
Asp Ser Val Leu Val Arg Ser Pro Glu Pro Gly Ala Arg Asn Pro Asp
165 170 175
Met Met Phe Gly Gly Gly Ala Lys Gly Tyr Ala Thr Ala Ala His Tyr
180 185 190
Phe Glu Pro Ala Leu Asn Ala Val Pro Ser G1n Gly Tyr Ala His Gly
195 200 205
Ala Pro Gln Tyr Tyr Gln Ser His Pro Pro Pro Gln Pro Ala Asn Pro
210 215 220
Ser Tyr Gly Asn Val Tyr Tyr Ala Leu Asn His Gly Pro Glu Ala Gly
225 230 235 240
His Ala Ser Tyr Glu Ser Lys Lys Arg Gly Tyr Asp Ala Leu Asn Glu
245 250 255
Phe Phe Gly Asp Leu Lys Arg Arg Gln Phe Asp Pro Asn Ser Tyr Ala
260 265 270
Ala Val Gly Gln Arg Leu Leu Gly Leu Gln Ser Leu Ser Leu Pro Val
275 280 285
Leu Ser Ser Gly Pro Leu Pro Glu Tyr Gln Pro Met Pro Ala Pro Val
290 295 300
Ala Val Gly Gly Gly Gly Tyr Ser Pro Gly Gly Ala Pro Ser Ala Pro
305 310 31S 320
Ala Tyr His Leu Pro Pro Met Ser Asn Val Arg Thr Lys Asn Asp Leu
325 330 335
Ile Asn Ile Asp Gln Phe Leu Gln Gln Met Gln Asp Thr Ile Tyr Glu
340 345 350
Asn Asp Asp Asn Val Ala Ala Ala Gly Val Ala Gln Pro Gly Ala His
355 360 365
CA 02417135 2003-02-14
4
Tyr Val His Gly Gly Met Ser Tyr Arg Thr Thr His Ser Pro Pro Thr
370 375 380
Gln Leu Pro Pro Ser His Ala Thr Ala Thr Ser Ser Ala Ser Met Met
385 390 395 400
Pro Asn Pro Ala Thr His Ser Pro Sex Thr Gl.y Thr Pro Ala Leu Thr
405 410 415
Pro Pro Ser Ser Ala Gln Ser Tyr Thr Ser Gly Arg Ser Pro Val Ser
420 425 430
Leu Pro Ser Ala Thr Arg Val Ser Pro Pro His His Gl.u Gly Gly Ser
435 440 445
Met Tyr Pro Arg Leu Pro Ser Ala Thr Met Ala Asp Ser Met Ala Ala
450 455 460
Gly Tyr Pro Thr Ala Ser Ser Thr Ala Pro Pro Ser Thr Leu Gly Gly
465 470 475 480
Ile Phe Asp His Asp Asp Arg Arg Arg Tyr Thr Gly Gly Thr Leu Gln
485 490 495
Arg Ala Arg Pro Glu Thr Arg Gln Leu Ser Glu Glu Met Asp Leu Thr
500 505 510
Gln Asp Ser Lys Asp Glu Gly Glu Arg Thr Pro Lys Ala Lys Glu His
515 520 52S
Ser Ser Pro Ser Ser Pro Glu Arg Ile Ser A1a Ser Leu Ile Asp Pro
530 535 540
Ala Leu Ser Gly Thr Ala Ala Glu Ala Glu Ala Thr Leu Arg Thr Ala
545 550 555 560
Gln Ala Ala Thr Glu Val Ala Glu Arg Ala Asp Val Gln Trp Val Glu
565 570 575
Lys Val Arg Leu Ile Glu Tyr Leu Arg Asn Tyr Ile Ala Ser Arg Leu
580 585 590
Glu Arg Gly Glu Phe Glu Asn Asn Glu Ser Gly Gly Gly Asn Ser Ser
595 600 605
Ser Asn Gly Ser Ser His Glu Gln Thr Pro Glu Ala Ser Pro Asp Thr
610 615 620
His Met Glu Gly Val Glu Ser Glu Val Pro Ser Lys Ala Glu Glu Pro
625 630 635 640
Ala Val Lys Pro Glu Ala Gly Asp Val Val Met Tyr Pro Thr Leu Arg
645 650 655
Ala Val Asp Glu Asp Giy Asp Ser Lys Met Pro
660 665
<210> 3
<211> 643
<212> PRT
<213> Penicillium chrysogenum
<400> 3
Met Thr Glu Asn His Thr Pro Ser Thr Thr Gln Pro Thr Leu Pro Ala
1 5 10 15
Pro Val Ala Glu Ala Ala Pro Ile Gln Ala Asn Pro Ala Pro Ser Ala
20 25 30
Ser Val Thr Ala Thr Ala Ala Ala Ala Thr Ala Ala Val Asn Asn Ala
35 40 45
Pro Ser Met Asn Gly Ala Gly Glu Gin Leu Pro Cys Gln Trp Val Gly
50 55 60
Cys Thr Glu Lys Ser Pro Thr Ala Glu Ser Leu Tyr Glu His Val Cys
65 70 75 80
Glu Arg His Val Gly Arg Lys Ser Thr Asn Asn Leu Asn Leu Thr Cys
85 90 95
CA 02417135 2003-02-14
Gln Trp Gly Thr Cys Asn Thr Thr Thr Val Lys Arg Asp His Ile Thr
100 105 110
Ser His Ile Arg Val His Val Pro Leu Lys Pro His Lys Cys Asp Phe
115 120 125
Cys Gly Lys Ala Phe Lys Arg Pro Gln Asp Leu Lys Lys His Val Lys
130 135 140
Thr His Ala Asp Asp Ser Glu Ile Arg Ser Pro G1u Pro Gly Met Lys
145 150 155 160
His Pro Asp Met Met Phe Pro Gln Asn Pro Arg Gly Ser Pro Ala Ala
165 170 175
Thr His Tyr Phe Glu Ser Pro Ile Asn Gly Ile Asn Gly Gln Tyr Ser
180 185 190
His Ala Pro Pro Pro Gln Tyr Tyr Gln Pro His Pro Pro Pro Gln Ala
195 200 205
Pro Asn Pro His Ser Tyr Gly Asn Leu Tyr Tyr Ala Leu Ser Gln Gly
210 215 220
Gln Glu Gly Gly His Pro Tyr Asp Arg Lys Arg Gly Tyr Asp Ala Leu
225 230 235 240
Asn Glu Phe Phe Gly Asp Leu Lys Arg Arg Gln Phe Asp Pro Asn Ser
245 250 255
Tyr Ala Ala Val Gly Gln Arg Leu Leu Gly Leu Gln Ala Leu Gln Leu
260 265 270
Pro Phe Leu Sex Gly Pro Ala Pro Glu Tyr Gln Gln Met Pro Ala Pro
275 280 285
Val Ala Val Gly Gly Gly Gly Gly Gly Tyr Gly Gly Gly Ala Pro Gln
290 295 300
Pro Pro Gly Tyr His Leu Pro Pro Met Ser Asn Val Arg Thr Lys Asn
305 310 315 320
Asp Leu Ile Asn Ile Asp G1n Phe Leu Glu Gln Met Gln Asn Thr Ile
325 330 335
Tyr Glu Ser Asp Glu Asn Val Ala Ala Ala Gly Va:1 Ala Gln Pro Gly
340 345 350
Ala His Tyr Val His Gly Gly Met Asn His Arg Thr Thr His Ser Pro
355 360 365
Pro Thr His Ser Arg Gln Ala Thr Leu Leu Gln Leu Pro Ser Ala Pro
370 375 380
Met Ala Ala Ala Thr Ala His Ser Pro Ser Val Gly Thr Pro Ala Leu
385 390 395 400
Thr Pro Pro Ser Ser Ala Gln Ser Tyr Thr Ser Asn Arg Ser Pro Ile
405 410 415
Ser Leu His Ser Ser Arg Val Ser Pro Pro His Glu Glu Ala Ala Pro
420 425 430
Gly Met Tyr Pro Arg Leu Pro Ala Ala Ile Cys Ala Asp Ser Met Thr
435 440 445
Ala Gly Tyr Pro Thr Ala Ser Gly Ala Ala Pro Pro Ser Thr Leu Ser
450 455 460
Gly Ala Tyr Asp His Asp Asp Arg Arg Arg Tyr Thr G1y Gly Thr Leu
465 470 475 480
Gln Arg Ala Arg Pro Ala Glu Arg Ala Ala Thr Glu Asp Arg Met Asp
485 490 495
Ile Ser Gln Asp Ser Lys His Asp Gly Glu Arg Thr Pro Lys Ala Met
500 505 510
His Ile Ser Ala Ser Leu Ile Asp Pro Ala Leu Ser Gly Thr Ser Ser
515 520 525
Asp Pro Glu Gln Glu Ser Ala Lys Arg Thr Ala Ala Thr A.la Thr Glu
530 535 540
Val Ala Glu Arg Asp Val Asn Val Ala Trp Val Glu Lys Val Arg Leu
CA 02417135 2003-02-14
6
545 550 555 560
Leu Glu Asn Leu Arg Arg Leu Val Ser Giy Leu Leu Glu Ala Gly Ser
565 570 575
Leu Thr Pro Glu Tyr Gly Val Gln Thr Ser Ser Ala Ser Pro Thr Pro
580 585 590
Gly Leu Asp Ala Met Glu Gly Val Glu Thr Ala Ser Val Arg Ala Ala
595 600 60S
Ser Glu Gln Ala Arg Glu Glu Pro Lys Ser Glu Ser G1u Gly Val Phe
610 615 620
Tyr Pro Thr Leu Arg Gly Val Asp Glu Asp Glu Asp Gly Asp Ser Lys
625 630 635 640
Met Pro Glu
<210> 4
<211> 585
<212> PRT
<213> Yarrowia lipolytica
<400> 4
Met Ala Ser Tyr Pro Tyr Leu Ala Gln Ser Gln Pro Pro Gln Gln Gln
1 5 10 15
Gln Gln Gln Gln Gln Gln Pro Gln Gln G1n Ser Gln Gln Leu Pro Thr
20 25 30
Thr Ala Pro Ser Ala Ala Pro Gln Val Asn Asn Thr Thr Ala Asn Lys
35 40 45
Pro Leu Tyr Pro Ala Ser Pro Asn Ser Pro Tle Ser Pro Ser Asp Tyr
50 55 60
Ser Ala Asn Met Asn Val Gly Gly Asp Ser 'Val Asp Met Leu Leu Ser
65 70 75 80
Ser Val Ser Ala His His Arg Ser Ser Asp Ala Gly Gln Ser Asp Met
85 90 95
Gly Ser Ile Ser Pro Ser Thr Ala His Thr Thr Pro Asp Ala Thr Thr
100 105 110
Tyr Lys Thr Ser Asp Glu Glu Asp Ala Thr Gly Lys Ile Thr Thr Pro
115 120 125
Arg Ser Glu Gly Ser Pro Asn Thr Asn Gly Ser Gly Ser Asp Gly Glu
130 135 140
Asn Leu Val Cys Lys Trp Gly Pro Cys Gly Lys Thr Phe Gly Ser Ala
145 150 155 160
Glu Lys Leu Tyr Ala His Leu Cys Asp Ala His Val Giy Arg Lys Cys
165 170 175
Thr His Asn Leu Ser Leu Val Cys Asn Trp Asp Asn Cys Gly Ile Val
180 185 190
Thr Val Lys Arg Asp His Ile Thr Ser His Ile Arg Val His Val Pro
195 200 205
Leu Lys Pro Tyr Lys Cys Asp Phe Cys Thr Lys Ser Phe Lys Arg Pro
210 215 220
Gln Asp Leu Lys Lys His Val Lys Thr His Ala Asp Asp Asn Glu Gln
225 230 235 240
Ala His Asn Ala Tyr Ala Lys Pro His Met Gln His Thr His Gln Gln
245 250 255
Gln Gln Gln Gln Gln Arg Tyr Met Gln Tyr Pro Thr Tyr Ala Ser Gly
260 265 270
Tyr Glu Tyr Pro Tyr Tyr Arg Tyr Ser Gln Pro Gln Val Gln Val Pro
275 280 285
Met Val Pro Ser Tyr Ala Ala Val Gly His Met Pro Thr Pro Pro Met
CA 02417135 2003-02-14
7
290 295 300
His Pro His Ala Pro Ile Asp Arg Lys Arg Gln Trp Asp Thr Thr Ser
305 310 315 320
Asp Phe Phe Asp Asp Ile Lys Arg Ala Arg Val Thr Pro Asn Tyr Ser
325 330 335
Ser Asp Ile Ala Ser Arg Leu Ser Thr Ile Glu Gln Tyr Ile Gly Ile
340 345 350
Gln Gly Gln Gln Gln Gln Ala Ser Pro Thr Pro Gln Thr Ala Thr Thr
355 360 365
Thr Ser Ala Thr Pro Ala Pra Ala Ala Pro His Gln Ala Thr Pro Pro
370 375 380
Gln Gln Gln Leu Pro Ser Phe Lys Gln Gly Asp Tyr GIn Glu Thr Asp
385 390 395 400
Gln Phe Leu Asn Gln Leu Gly Ser Asn Ile Tyr Gly Asn Ile Lys Ser
405 410 415
Vai Asp Pro Gln Tyr Glu Ala Pro Ala Glu Phe His Leu Pro His Pro
420 425 430
Met Gly Tyr Arg Tyr Ala Phe Ser His Ala Pro Ala Pro His Gly Ala
435 440 445
Ala Pro Val Ala Pro Gln Val Ala Pro Pro Ala His Pro Gly Val His
450 455 460
Gly Val Ser Ala Pro His Tyr Pro Asp Leu Ser Tyr Ser Arg Ser Thr
465 470 475 480
Val Pro Gln Leu Ser Ser Arg Phe Glu Asp Val Arg Gln Met Ser Val
485 490 495
Gly Val Thr Gln Arg Ala Ala Arg Thr Thr Aan Val Gl.u Glu Ser Asp
500 505 510
Asp Asp Asp Giu Leu Val Glu Gly Phe Gly Lys Met Ala Ile Ala Asp
515 520 525
Ser Lys Ala Met Gln Val Ala Gln Met Lys Lys His Leu Glu Val Val
530 535 540
Ser Tyr Leu Arg Arg Val Leu Gln Glu A1a Arg Glu Thr Glu Ser Gly
545 550 555 560
Glu Ala Glu Asp Thr Ala Ala Asn Lys Asp Thr Ser Ala Ser Lys Ser
565 570 575
Ser Leu Tyr Pro Thr Ile Lys Ala Cys
580 585
<210> 5
<211> 659
<212> PRT
<213> Candida albicans
<400> 5
Met Asn Tyr Asn Ile His Pro Val Thr Tyr Leu Asn Ala Asp Ser Asn
1 5 10 15
Thr Gly Ala Ser Glu Ser Thr Ala Ser His His Gly Ser Lys Lys Ser
20 25 30
Pro Ser Ser Asp Ile Asp Val Asp Asn Ala Xaa Ser Pro Ser Ser Phe
35 40 45
Thr Ser Ser Gln Ser Pro His Ile Asn Ala Met Gly Asn Ser Pro Hia
50 55 60
Ser Ser Phe Thr Ser Gln Ser Ala Ala Asn Ser Pro Ile Thr Asp Ala
65 70 75 80
Lys Gln His Leu Val Lys Pro Thr Thr Thr Lys Pro Aia Ala Phe Ala
85 90 95
Pro Ser Ala Asn Gln Ser Asn Thr Thr Ala Pro Gln Ser Tyr Thr Gln
CA 02417135 2003-02-14
8
100 105 110
_ Pro Ala Gln Gln Leu Pro Thr Gln Leu His Pro Ser Leu Asn Gln Ala
115 120 125
Tyr Asn Asn Gln Pro Ser Tyr Tyr Leu His Gln Pro Thr Tyr Gly Tyr
130 135 140
Gln Gln Gln Gln Gln Gln Gln Gln His Gln Glu Phe Asn Gln Pro Ser
145 150 155 160
Gln Gln Tyr His Asp His His Gly Tyr Tyr Ser Asn Asn Asn Ile Leu
165 170 175
Asn Gln Asn Gln Pro Ala Pro Gln Gln Asn Pro Val Lys Pro Phe Lys
180 185 190
Lys Thr Tyr Lys Lys Ile Arg Asp Glu Asp Leu Lys Gly Pro Phe Lys
195 200 205
Cys Leu Trp Ser Asn Cys Ser Ile Ile Phe Glu Thr Pro Glu Ile Leu
210 215 220
Tyr Asp His Leu Cys Asp Asp His Val Gly Arg Lys Ser Ser Asn Asn
225 230 235 240
Leu Ser Leu Thr Cys Leu Trp Glu Asn Cys Gly Thr Thr Thr Val Lys
245 250 255
Arg Asp His Ile Thr Ser His Leu Arg Val His Val Pro Leu Lys Pro
260 26S 270
Phe His Cys Asp Leu Cys Pro Lys Sex Phe Lys Arg Pro Gln Asp Leu
275 280 28S
Lys Lys His Ser Lys Thr His Ala Glu Asp His Pro Lys Lys Leu Lys
290 295 300
Lys Ala Gln Arg Glu Leu Met Lys Gln Gln Gln Lys Glu Ala Lys Gln
305 310 315 320
Gln Gln Lys Leu Ala Asn Lys Arg Ala Asn Set Met Asn Ala Thr Thr
325 330 335
Ala Ser Asp Leu Gln Leu Asn Tyr Tyr Ser Gly Asn Pro Ala Asp Gly
340 345 350
Leu Asn Tyr Asp Asp Thr Ser Lys Lys Arg Arg Tyr Glu Asn Asn Ser
355 360 365
Gln His Asn Met Tyr Val Val Asn Ser Ile Leu Asn Asp Phe Asn Phe
370 375 380
Gln Gln Met Ala Gln Ala Pro Gln Gln Pro Gly Val Val Gly Thr Ala
385 390 395 400
Gly Ser Ala Glu Phe Thr Thr Lys Arg Met Lys Ala G1y Thr Glu Tyr
405 410 415
Asn Ile Asp Val Phe Asn Lys Leu Asn His Leu Asp Asp His Leu His
420 425 430
His His His Pro Gln Gln Gln His Pro Gln Gln Gln Tyr Gly Gly Asn
435 440 445
Ile Tyr Glu Aia Glu Lys Phe Phe Asn Ser Leu Ser Asn Ser Ile Asp
450 455 460
Met Gln Tyr Gln Asn Met Ser Thr Gln Tyr Gln Gln Gln His Ala Gly
465 470 475 480
Ser Thr Phe Ala Gln Gln Lys Pro Thr Gln Gln Ala Ser Gly Gln Leu
485 490 495
Tyr Pro Ser Leu Pro Thr Ile Gly Asn Gly Ser Tyr Thr Ser Gly Ser
500 505 510
Ser His Lys Glu Gly Leu Val Asn Asn His Asn Gly Tyr Leu Pro Ser
515 520 525
Tyr Pro Gln I1e Asn Arg Ser Leu Pro Tyr Ser Ser Gly Val Ala Gln
530 535 540
Gln Pro Pro Ser Ala Leu Glu Phe Gly Gly Val Ser Thr Tyr Gln Lys
545 550 5S5 560
CA 02417135 2003-02-14
9
Ser Ala Gln Ser Tyr Glu Glu Asp Ser Ser Asp Ser Ser Glu Glu Asp
565 570 575
Asp Tyr Ser Thr Ser Ser Glu Asp Glu Leu Asp Thr Leu Phe Asp Lys
580 585 590
Leu Asn Ile Asp Asp Asn Lys Val Glu Glu Va1 Thr Ile Asp Gly Phe
595 600 605
Asn Leu Lys Asp Val Ala Lys His Arg Glu Met Ile His Ala Val Leu
610 615 620
Gly Tyr Leu Arg Asn Gln Tle Glu Gln Gln Glu Lys Glu Lys Ser Lys
625 630 635 640
Glu Gln Lys Glu Val Asp Val Asn Glu Thr Lys Leu Tyr Pro Thr Ile
645 650 655
Thr Ala Phe
<210> 6
<211> 625
<212> PRT
<213> Saccharomyces cerevisiae
<400> 6
Met Val Pro Leu Glu Asp Leu Leu Asn Lys Glu Asn G1y Thr Ala Aia
1 5 10 15
Pro Gln His Ser Arg Glu Ser Ile Val Glu Asn Gly Thr Asp Val Ser
20 25 30
Asn Val Thr Lys Lys Asp Gly Leu Pro Ser Pro Asn Leu Ser Lys Arg
35 40 45
Ser Ser Asp Cys Ser Lys Arg Pro Arg Ile Arg Cys Thr Thr Glu Ala
50 55 60
Ile Gly Leu Asn Gly Gln Glu Asp Glu Arg Met Ser Pro Gly Ser Thr
65 70 75 B0
Ser Ser Ser Cys Leu Pro Tyr His Ser Thr Ser His Leu Asn Thr Pro
85 90 95
Pro Tyr Asp Leu Leu Gly Ala Ser Ala Val Ser Pro Thr Thr Ser Ser
100 105 110
Ser Ser Asp Sex Ser Ser Ser Ser Pro Leu A1a Gln Ala His Asn Pro
115 120 125
Ala Gly Asp Asp Asp Asp Ala Asp Asn Asp Gly Asp Ser Glu Asp Ile
130 135 140
Thr Leu Tyr Cys Lys Trp Asp Asn Cys Gly Met Ile Phe Asn Gln Pro
145 150 155 160
Glu Leu Leu Tyr Asn His Leu Cys His Asp His Val Gly Arg Lys Ser
165 170 175
His Lys Asn Leu Gln Leu Asn Cys His Trp Gly Asp Cys Thr Thr Lys
180 185 190
Thr Glu Lys Arg Asp His Ile Thr Ser His Leu Arg Val His Val Pro
195 200 205
Leu Lys Pro Phe Gly Cys Ser Thr Cys Ser 'Lys Lys Phe Lys Arg Pro
210 215 220
Gln Asp Leu Lys Lys His Leu Lys Ile His Leu Glu Ser Gly Gly Ile
225 230 235 240
Leu Lys Arg Lys Arg Gly Pro Lys Trp G1y Ser Lys Arg Thr Ser Lys
245 250 255
Lys Asn Lys Ser Cys Ala Ser Asp Ala Val Ser Ser Cys Ser Ala Ser
260 265 270
Val Pro Ser Ala Ile Ala Gly Ser Phe Lys Ser His Ser Thr Ser Pro
275 280 285
CA 02417135 2003-02-14
Gln Ile Leu Pro Pro Leu Pro Val Gly Ile Ser Gln His Leu Pro Ser
290 295 300
Gln Gln Gln Gln Arg Ala Ile Ser Leu Asn Gln Leu Cys Ser Asp Glu
305 310 315 320
Leu Ser Gln Tyr Lys Pro Val Tyr Ser Pro Gln Leu Ser Ala Arg Leu
325 330 335
Gln Thr Ile Leu Pro Pro Leu Tyr Tyr Asn Asn Gly Ser Thr Val Ser
340 345 350
Gln Gly Ala Asn Ser Arg Ser Met Asri Val Tyr Glu Asp Gly Cys Ser
355 360 365
Asn Lys Thr Ile Ala Asn Ala Thr Gln Phe Phe Thr Lys Leu Ser Arg
370 375 380
Asn Met Thr Asn Asn Tyr Ile Leu Glri Gln Ser Gly Gly Ser Thr Glu
385 390 395 400
Ser Ser Ser Ser Ser Gly Arg Ile Pro Val Ala Gln Thr Ser Tyr Val
405 4i0 415
Gln Pro Pro Asn Ala Pro Ser Tyr Gln Ser Val Gln Gly Gly Ser Ser
420 425 430
Ile Ser Ala Thr Ala Asn Thr Ala Thr Tyr Val Pro Val Arg Leu Ala
435 440 445
Lys Tyr Pro Thr Gly Pro Ser Leu Thr Glu His Leu Pro Pro Leu His
450 455 460
Ser Asn Thr Ala Gly Gly Val Phe Asn Arg Gln Sex Gln Tyr Ala Met
465 470 475 480
Pro His Tyr Pro Ser Val Arg Ala Ala Pro Ser Tyr Ser Ser Ser Gly
485 490 495
Cys Ser Ile Leu Pro Pro Leu Gln Ser Lys Ile Pro Met Leu Pro Ser
500 505 510
Arg Arg Thr Met Ala Gly Gly Thr Ser Leu Lys Pro Asn Trp Glu Phe
515 520 525
Ser Leu Asn Gln Lys Ser Cys Thr Asn Asp Ile Ile Met Ser Lys Leu
530 535 540
Ala Ile Glu Glu Val Asp Asp Glu Ser Glu Ile Glu Asp Asp Phe Val
545 550 555 560
Glu Met Leu Gly Ile Val Asn Ile Ile Lys Asp Tyr Leu Leu Cys Cys
565 570 575
Val Met Glu Asp Leu Asp Asp Glu Glu Ser Glu Asp Lys Asp Glu Glu
580 585 S90
Asn Ala Phe Leu Gln Glu Ser Leu Glu Lys Leu Ser Leu Gln Asn Gln
595 600 605
Met Gly Thr Asn Ser Val Arg Ile Leu Thr Lys Tyr Pro Lys Ile Leu
610 615 620
Val
625
<210> 7
<211> 815
<212> PRT
<213> Artificial Sequence
<220>
<223> Synthetic primer based on Aspergillus nidulans and
herpes virus
<400> 7
Met Ser Ser Arg Gly Ala Met Ala Glu Glu Ala Vai Ala Pro Val Ala
1 5 10 15
CA 02417135 2003-02-14
11
Val Pro Thr Thr Gln Glu Gln Pro Thr Ser Gln Pro Ala Ala Ala Gln
20 25 30
Val Thr Thr Val Thr Ser Pro Ser Val Thr Ala Thr Ala Ala Ala Ala
35 40 45
Thr Ala Ala Val Ala Ser Pro Gln Ala Asn Gly Asn AIa Ala Ser Pro
50 55 60
Val Ala Pro Ala Ser Ser Thr Ser Arg Pro Ala G1u Glu Leu Thr Cys
65 70 75 80
Met Trp Gln Gly Cys Ser Glu Lys Leu Pro Thr Pro Glu Ser Leu Tyr
85 90 95
Glu His Val Cys Glu Arg His Val Gly Arg Lys Ser Thr Asn Asn Leu
100 105 310
Asn Leu Thr Cys Gln Trp Gly Ser Cys Arg Thr Thr Thr Val Lys Arg
115 120 1.25
Asp His Ile Thr Ser His Ile Arg Val His Val Pro Leu Lys Pro His
130 135 140
Lys Cys Asp Phe Cys Gly Lys Ala Phe Lys Arg Pro Gln Asp Leu Lys
145 150 155 160
Lys His Val Lys Thr His Ala Asp Asp Ser Val Leu Va.l Arg Ser Pro
165 170 175
Glu Pro Gly Ser Arg Asn Pro Asp Met Met Phe Gly Gly Asn Gly Lys
180 185 190
Gly Tyr Ala Ala Ala His Tyr Phe Glu Pro Ala Leu Asn Pro Val Pro
195 200 205
Ser Gln Gly Tyr Ala His Gly Pro Pro Gln Tyr Tyr Gln Ala His His
210 215 220
Ala Pro Gln Pro Ser Asn Pro Ser Tyr Gly Asn Va1 Tyr Tyr Ala Leu
225 230 235 240
Asn Thr Gly Pro Glu Pro His Gln Ala Ser Tyr Glu Ser Lys Lys Arg
245 250 255
Gly Tyr Asp Ala Leu Asn Glu Phe Phe GIy Asp Leu Lys Arg Arg Gln
260 265 270
Phe Asp Pro Asn Ser Tyr Ala Ala Val Gly Gln Arg Leu Leu Ser Leu
275 280 285
Gln Asn Leu Ser Leu Pro Val Leu Thr Ala Ala Pro Leu Pro Glu Tyr
290 295 300
Gln Ala Met Pro Ala Pro Val Ala Val Ala Ser Gly Pro Tyr Gly Gly
305 310 315 320
Gly Pro His Pro Ala Pro Ala Tyr His Leu Pro Pro Met Ser Asn Val
325 330 335
Arg Thr Lys Asn Asp Leu Ile Asn Ile Asp Gln Phe Leu Gln Gln Met
340 345 350
Gln Asp Thr Ile Tyr Glu Asn Asp Asp Asn Val Ala Ala Ala Gly Val
355 360 365
Ala Gln Pro Gly Ala His Tyr Ile His Asn Gly Ile Ser Tyr Arg Thr
370 375 380
Thr His Ser Pro Pro Thr Gln Leu Pro Ser Ala His Ala Thr Thr Gln
385 390 395 400
Thr Thr Ala Gly Pro Ile I1e Ser Asn Thr Ser Ala His Ser Pro Ser
405 410 415
Ser Ser Thr Pro Ala Leu Thr Pro Pro Ser Ser Ala Gln Ser Tyr Thr
420 425 430
Ser Gly Arg Ser Pro Ile Ser Leu Pro Ser Ala His Arg Val Ser.Pro
435 440 445
Pro His Glu Ser Gly Ser Ser Met Tyr Pro Arg Leu Pro Ser Ala Thr
450 455 460
Asp Gly Met Thr Ser Gly Tyr Gly Ser Pro Pro Pro Pro Pro Pro Pro
CA 02417135 2003-02-14
12
465 470 475 480
Pro Pro Pro Pro Ile Lys Val Ala Pro Pro Thr Asp Val Ser Leu Gly
485 490 495
Asp Glu Leu His Leu Asp Gly Glu Asp Val Ala Met Ala His Ala Asp
500 505 510
Ala Leu Asp Asp Phe Asp Leu Asp Met Leu Gly Asp Gly Asp Ser Pro
515 520 525
Gly Pro Gly Phe Thr Pro His Asp Ser Ala Pro Tyr Gly Ala Leu Asp
530 535 540
Met Ala Asp Phe Glu Phe Glu Gln Met Phe Thr Asp Ala Leu Gly Ile
545 550 555 560
Asp Glu Tyr Gly Gly Asp Ile Lys Val Ala Pro Pro Thr Asp Val Ser
565 570 575
Leu Gly Asp Glu Leu His Leu Asp Gly G1u Asp Val Ala Met Ala His
580 585 590
Ala Asp Ala Leu Asp Asp Phe Asp Leu Asp Met Leu Gly Asp Gly Asp
595 600 605
Ser Pro Gly Pro Gly Phe Thr Pro His Asp Ser Ala Pro Tyr Gly Ala
610 615 620
Leu Asp Met Ala Asp Phe Glu Phe Glu Gln Met Phe Thr Aap Ala Leu
625 630 635 640
Gly Ile Asp Glu Tyr Gly Gly Asp Ile Lys Val Ala Pro Pro Thr Asp
645 650 655
Val Ser Leu Gly Asp Glu Leu His Leu Asp Gly Glu Asp Val Ala Met
660 665 670
Ala His Ala Asp Ala Leu Asp Asp Phe Asp Leu Asp Met Leu Gly Asp
675 680 685
Gly Asp Ser Pro Gly Pro Gly Phe Thr Pro His Asp Ser A1a Pro Tyr
690 695 700
Gly Ala Leu Asp Met Ala Asp Phe Glu Phe Glu Gln Met Phe Thr Asp
705 710 715 720
Ala Leu Gly Ile Asp Glu Tyr Gly Gly Asp Ile Lye Val Ala Pro Pro
725 730 735
Thr Asp Val Ser Leu Gly Asp Glu Leu His Leu Asp Gly Glu Asp Val
740 745 750
Ala Met Ala His Ala Asp Ala Leu Asp Asp Phe Asp Leu Asp Met Leu
755 760 765
Gly Asp Gly Asp Ser Pro Gly Pro Gly Phe Thr Pro His Asp Ser Ala
770 775 780
Pro Tyr Gly Ala Leu Asp Met Ala Asp Phe Glu Phe Glu Gln Met Phe
785 790 '795 800
Thr Asp Ala Leu Gly Ile Asp Glu Tyr Gly Gly Asp Gly Leu Gln
805 810 815
<210> B
<211> 32
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic primer based on Aspergillus nidulans
<400> 8
aactgcagta gttgaccgtg tgattgggtt ct 32
<210> 9
CA 02417135 2003-02-14
13
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic primer based on Aspergil.lus nidulans
<400> 9
ccggaattct ttgtaaactg gcttgaagat 30
<210> 10
<211> 35
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic oligonucleotide encoding praline rich
motif
<400> 10
gatCCCCCCC CCCtCCtCCa CGGCCaCCCC CtCCC 35
<210> 11
<211> 31
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic oligonucleotide encoding groline rich
motif
<400> 11
gggagggggt gggggtggag gag9gggggg g 31
<210> 12
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic primer based on herpes simplex virus
<400> 12
cgcgatatca aagtcgcccc cccgaccgat 30
<210> 13
<211> 30
<212> DNA
<213> Synthetic primer based on Aspergillus nidulans
<400> 13
cgcgatatcc ccaccgtact cgtcaattcc 30
<210> 14
<211> 30
<212> DNA
<213> Artificial Sequence
CA 02417135 2003-02-14
ja
<2zo>
<223> Synthetic primer based on Aspergillus nidulans
<400> 14
tgctctagag gcgccatggc cgaagaagcg 30
<210> 15
<211> 30
<212> DNA
<213> Aspergillus nidulans
<400> 15
cgcggatccg taaccagaag tcataccgtc 30
<210> 16
<211> 1413
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic primer based on Aspergillus nidulans
<400>
16
tctagaggcgccatggccgaagaagcggtcgctcctgtagctgtgcctacgacccaagaa60
caaccaacctctcaacccgccgctgcgcaggttaeaactgtcacttcgccctctgtgact120
gcaacagcggcggctgcgacagctgctgtggccagtccccaagctaatggcaatgctgcc180
tctcctgtcgcccctgcgtcgtcaacatctcgtceagcggaagaactcacttgcatgtgg240
caaggctgctctgagaagctccctactccagaatccttatacgaacatgtctgcgagcgt300
cacgttggccgaaagagcacgaacaacctcaacctgaettgtcaatggggtagctgtcgt360
actactactgtgaaacgcgaccatatcacctctcatatccgggtgcacgttcctctcaag420
ccgcacaagtgtgatttctgtggaaaagcgttcaagcgtccccaggatttgaagaagcat480
gttaagacgcacgctgatgactcggtcctggtacggtcgccagagcctggatctcgcaac540
ccagatatgatgttcggaggaaatggcaagggctatgctgctgcgcactattttgagcct600
gctctcaaccctgttcccagccaaggctacgctcatggtcctccccagtattaccaggcc660
catcacgctccccagccatcgaacccgtcttacggcaacgtctactacgctctgaatacc720
ggcccagagcctcaccaagcgtcgtatgaatccaagaagcggggttatgatgcgcttaat780
gagttctttggtgacctcaagcgccgacaatttgaccctaattcctacgctgccgtgggc840
cagcgcctgctcagtttgcagaacttgtccctgcctgttttaacggctgcgcctctgccc900
gagtaccaggcaatgcctgctcctgtggctgttgctagtggtccatatggtggcggccct960
caccctgcgccggcatatcatcttccaccaatgagcaacgtccgaaccaagaacgacttg1020
atcaacatcgaccagttcctgcagcaaatgcaggacacaatatatgagaacgatgataat1080
gtcgctgcggctggtgtcgctcaacctggagcccattacattcataacggcataagctac1140
cgcactacacactcgcctccgacacaacttccctcggcacatgccacaacccagacgact1200
gctggtcctattatctcaaacacatctgcgcactccccttcgtctagcactccggctttg1260
acaccgccctcaagtgcgcagtcgtacacttcaggtcgctctcccatttcacttccgtct1320
gctcatcgcgtttctccgcctcatgaaagcggctccagcatgtaccctcgtctcccttcg1380
gcgactgacggtatgacttctggttacggatcc 1413
<210> 17
<211> 37
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic primer based on Aspergillus nidulans
CA 02417135 2003-02-14
1S
<400> 17
ataagaatgc ggccgccctc tgcattattg tcttatc 37
<210> 18
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic primer based on Aspergillus nidulans
<400> 18
tgctctagaa gacattgttg ctatagctgt 30
<210> 19
<211> 678
<212> DNA
<213> Aspergillus nidulans
<400> 19
gcggccgccctctgcattattgtcttatccgctattcctggtgtttttgttgtcttacta 60
ctttttgtgtcgttgaaattcttactaggcgttgtgaatct9gatcggatcatgctattt 120
tgaggtgtaatgcatgggtcaaattttctcgagtttcaaacgaggcagaagagagatgca 180
gataaatcttgagttttatcatgcagcgaacgttaccacttatagtttccggcagagcac 240
gtaggtcggcccggcgtcatgtgtagcgggggagctccaggaccttgaggacgaaaatgg 300
gacggcgatgtataactccatggaggaacggagcgtgattttgtactgtctgatccgagg 360
ctaatgagaaagcggaggttcaatgttcccccggttgatgtcctgaagcagcgaggcccg 420
aagtatcccgtcgtggacatgacatcagtggtccgactcccgccgaaccctcctccttca 480
ccggcagccccaccatgtcgccaaagcaaatggtagctctgcgattctggataccccgcc 540
actcaccgtgatacaatttcagcatttgcgaggtggtctggtctcctgacgcgctttatt 600
tatccctggtctctccccactagctgttcctgcccgtccatctctctccgtacagctata 660
gcaacaatgtcttctaga 678
<210> 20
<211> 33
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic primer based on Aspergillus nidulans
<400> 20
tccccgcgga tggaagcttc gttaaggata att 33
<210> 21
<211> 37
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic primer based on Aspergillus nidulans
<400> 21
ataagaatgc ggccgcctac cagattaggg agcatat 37
<210> 22
CA 02417135 2003-02-14
1 f~
<211> 2229
<212> DNA
<213> Aspergillus nidulans
<400> 22
ccgcggatggaagcttcgttaaggataattgcctcttttcgaacacctattcatgttgat60
tagcgatcattagttatccggctcggtaacagaactatggcatactgaacgtcaacttcg120
gaacacgggtctctcctagttccggatggactaactgcccgtcttccgagaacgtcagct180
atataagtatctttcccccttcaacgctatcacgccataccttaaagaaaacgcgcagct240
caagcattcagatccacataattaagctactgacgtgaactatcaaattccatccaccaa300
ttgcccacgatggtcgagatctccatccccgcaaactacgggtacgtccgccacggtgtt360
accaaacattactagccagctagctcagtcttaccccggtcatgagaccaccccatgcta420
atcatataacgatctttattatagatatgccatcgccgtttcgctaggcgcaatccctgt480
cctgggattcatccatggtgtcctcgtcggctcttttcgcaaggccgctggcgtgccgta540
cccccacgcctatgccagcattgagcaatgtaaagctaacgtgcgtgagcccaagaaact600
aaatacctatagcaaaacagattgtgttccaagagagagtactaaatgacgtttgtgaac660
agcccaaagcctacaaattcaactgcgcacaacgcgcccacggcaacttcctcgagaacg'720
cgccgcagacaatgctctctatcctggtggcaggcgtcaagtacccagaggcagcagcgg780
gcttaggagcggcctgggttgttctccgcaccctctacatgctgggctatatttatagcg840
acaagccgaacggcaccggcaggtacaatggttcgctgtacttgcttgcgcaagcgggtc900
tttggggattgagcgcatttggtgttgcaaaggatttgatgtaaatgtagtcgacatctt960
agcacagaggggagagttgataaaatgtggtctgtttgaatgatagtcgggttcgtgacc1020
tatattcgtgatagtggagataggtctgcgcctatcttatcgggccggagcaaaaattcc1080
accgcagcggggtgagttttcgttatacagccatcccacttccagcttcaaattgtcagt1140
ttaatccagcccaattcaatcattggagaaccgccatcatgtcttcgaagtcccacctcc1200
cctacgcaattcgcgcaaccaaccatcccaaccctttaacatctaaactcttctccatcg1260
ccgaggagaagaaaaccaacgtcaccgtctccgcagacgttactacttccgccgagctcc1320
tcgatcttgctgaccgtacatcctgcaccaatgcccctccaggataacaaatagctgatg1380
cgtagtgagtacaggcctaggcccctatatcgcagttctgaaaacccacatcgacatcct1440
caccgatctcaccccgtcgaccctttcctcgctccaatccctcgcgacaaagcacaactt1500
cctcatctttgaggaccgcaagttcatcgacatcggcaacaccgtgcaaaagcagtacca1560
cggtggcgctctccgcatctccgaatgggcacacatcatcaactgcgccatcctgccggg1620
cgaagggatcgtcgaggccctcgcacagacaaccaagtctcctgactttaaagacgcgaa1680
tcaacgaggtctcctgattcttgccgagatgacgagtaagggatctcttgcgacagggga1740
gtcacaggcacgctcggttgagtacgcgcggaagtataaggggtttgtgatgggattcgt1800
gagtacaagggcgttgagtgaggtgctgcccgaacagaaagaggagagcgaggattttgt1860
cgtctttacgactggggtgaatctgtcggataagggggataagctggggcagcagtatca1920
gacacctgggtcggcggttgggcgaggtgcggactttatcattgcgggtaggggcatcta1980
taaggcggacgatccagtcgaggcggttcagaggtaccgggaggaaggctggaaagctta2040
cgagaaaagagttggactttgagtgtgagtggaaatgtgtaacggtattgactaaaaggg2100
atccatatgtttattgcagccagcatagtattaccagaaagagcctcactgacggctcta2160
gtagtattcgaacagatattattgtgaccagctctgaacgatatgctccctaatctggta2220
ggcggccgc 2229
<210> 23
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic primer based on Aspergillus nidulans
<400> 23
tgctctagag gcgccatggc cgaagaagcg 30
<210> 24
<211> 30
CA 02417135 2003-02-14
17
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic primer based on Aspergillus nidulans
<400> 24
tcccccgggg taaccagaag tcataccgtc 30
