Note: Descriptions are shown in the official language in which they were submitted.
CA 02421078 2003-02-28
WO 02/18659 PCT/USO1/41956
METHOD FOR DETERMINING ALLELES
TECFINICAL FIELD
The present invention relates to methods for separating and
determining the identity of an allele by identifying one or more
heterosequence sites
in a gene. More particularly, the present invention relates to methods which
utilize
one or more primers for separating and determining the identity of an allele.
BACKGROUND
The most frequent form of sequence variations among individuals are
single nucleotide polymorphisms, popularly known as SNPs. With the completion
of the Human Genome Project, SNPs are estimated to occur on an average of 1
out
of every 1000 nucleotides but can occur more frequently in certain DNA
regions.
Efforts are now being focused on the use of SNPs to identify target genes
associated
with disease or drug response. However, due to weak correlations, many
scientists
and researchers challenge the idea of personalizing drugs and diseases based
on an
individual SNP, and so the importance of Haplotype analysis emerges as a
critical
tool to the medical utility of SNPs.
A haplotype is commonly known as the manner in which individual
SNPs are organized along a given stretch of DNA. The classical definition of a
haplotype is a combination of alleles of closely linked loci that are found in
a single
chromosome and tend to be inherited together from one generation to the next
in a
given population. Another aspect of molecular haplotyping is linkage
disequilibrium
mapping which is now recognized as an important tool in the positional cloning
of
CA 02421078 2003-02-28
WO 02/18659 PCT/USO1/41956
_2_
disease genes, and numerous applications will become apparent as complex
phenotypes are dissected genetically.
Since 1989 scientists have investigated various methodologies for
molecular haplotyping using either single molecule dilution (SMD) of genomic
DNA
to separate alleles physically or allele discrimination by allele-specific
primers to
amplify selectively hemizygous DNA segments from a heterozygous template.
However, these methods were developed for short segments only (approx. 500bp),
but more recently molecular haplotyping has been applied on long range PCR for
markers 10-20 times farther apart and used the CD4 locus as a prototype system
for
the development of this assay. Other methods have been attempted to determine
the
haplotype of DNA sequences, however these methods have been largely
unsuccessful, unreliable or expensive. Thus there remains a need for economic
molecular haplotyping that is amenable to high throughput volumes that is
reliable.
SUMMARY OF THE INVENTION
The present invention is drawn to methodologies for determining
alleles by identifying one or more heterosequence sites in a gene. The
methodologies can be used to determine the haplotype of a specific gene, and
has
application in a number of areas, including human leukocyte antigen (HLA)
typing.
The present invention is also drawn to kits for such typing.
The present invention includes a method of separating allele specific
nucleic acid molecules. One or more heterosequence site specific nucleic acid
primers are added to single stranded nucleic acid molecules containing one or
more
heterosequence sites and allowed to hybridize. In one embodiment, the 3' end
of
each primer corresponds to a polymorphic site of the targeted heterosequence
site.
In such embodiment, the 3' end may be subjected to single base extension,
ligation
to a second primer having a 5' end adjacent to the 3' end of the
heterosequence site
specific primer or may be elongated for a number of bases. The elongated or
CA 02421078 2003-02-28
WO 02/18659 PCT/USO1/41956
-3-
ligated heterosequence site specific hybridized primer and nucleic acid
molecules are
then separated, and optionally recovered for further genotyping. In an
alternative
embodiment, each primer contains one or more polymorphic bases located within
the primer such that primers which hybridize with less than 100 %
complementary
bases can be selectively removed, and those primers which have hybridized with
100 % complementary bases be unaffected.
The invention also relates to a method for identifying multiple alleles
in a nucleic acid molecule containing such alleles. A single stranded nucleic
acid
molecule containing multiple heterosequence sites is selected. To this nucleic
acid
molecule two primers are added, a hetero primer and a homo primer. The hetero
primer is capable of hybridizing to a 3' heterosequence site that is located
3' of a 5'
heterosequence site on the same nucleic acid molecule. The 3' base of the
hetero
primer corresponds to a polymorphic base of the heterosequence site, such that
elongation will only occur when the 3' end of the hetero primer is hybridized
to the
single stranded nucleic acid. The homo primer is capable of hybridization to
the
same nucleic acid molecule at a position located 5' of the 5' heterosequence
site.
The primers are hybridized to the nucleic acid molecule, and the hetero primer
is
elongated such the 5' hetereosequence site of the nucleic acid molecule
located
between the primers is replicated, that is the homo primer acts to stop
elongation of
the elongated hetero primer when it reaches the homo primer. The nucleic acid
molecule and elongated hetero primer are denatured, and the hetero primer
separated and analyzed to determine the 5' heterosequence site. This
information is
used to identify a new set of nucleic acid primers containing another hetero
primer
and another homo primer, the hetero primer of the new set capable of
hybridizing to
the 5' hetereosequence site (with the 3' base of the hetero primer
corresponding to a
polymorphic base), the 5' heterosequence site located 3' to a further
hetereosequence site on the same nucleic acid molecule, and the homo primer of
the
new set capable of hybridization to the same nucleic acid molecule at a
position
located 5' of the further heterosequence site. The previous steps are
repeated, with
each new set of primers used in the subsequent round of
hybridization/elongation
CA 02421078 2003-02-28
WO 02/18659 PCT/USO1/41956
-4-
until sufficient heterosequence sites on the nucleic acid molecule have been
identified to identify the allele. The haplotype of the nucleic acid molecule
may be
determined in this manner.
The present invention also relates to a method for identifying multiple
alleles in a nucleic acid molecule that comprises adding a nucleic acid sample
containing multiple alleles to a set of beads, each bead having two distinct
primers
attached, at least one primer on each bead being a primer to a unique allele,
under
conditions such that at least the one primer to a unique allele hybridizes to
a portion
of the nucleic acid sample. The hybridized primer is amplified to extend the
hybridized primer to produce an extended primer nucleic acid. The hybridized
nucleic acid sample and primer are then denatured, and the nucleic acid sample
removed from the beads. The extended primer is then hybridized to the second
primer on the bead and the second primer is amplified. The beads containing
the
dual amplified primers are then analyzed to determine the alleles present in
the
nucleic acid sample.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is a diagram which illustrates allele identification utilizing an
allele specific primer extension methodology according to the present
invention.
FIG. 2 is a diagram which illustrates a method of identifying multiple
alleles using a single base extension with a primer size tag approach.
FIG. 2A is a diagram which illustrates a method of identifying
multiple alleles using a single base extension with a primer size tag
approach.
FIG. 3 is a diagram which illustrates allele identification utilizing
allele specific ligation and primer size tags according to the present
invention.
CA 02421078 2003-02-28
WO 02/18659 PCT/USO1/41956
-S-
FIG. 4 is a diagram which illustrates allele identification utilizing
hybridization and primer size tags according to the present invention.
FIG. 5 is a diagram which illustrates a method of identifying multiple
alleles using sets of homo primers and hetero primers according to the present
invention.
FIGS. 6A - 6F illustrate a method of identifying multiple alleles
using fluorescent beads comprising multiple primers according to the present
invention.
DETAILED DESCRIPTION OF THE INVENTION
The present invention is directed to a method for determining the
identity of alleles, based on United States Provisional Patent Application
No. 60/228,994, the entire content of which is hereby incorporated by
reference.
The following terms are used throughout the application, and are
defined as follows:
Allele: A variant form of a given gene. Such variants include single
nucleotide polymorphisms, insertions, inversions, translocations and
deletions.
Avidin: A family of proteins functionally defined by their ability to
bind biotin with high affinity and specificity. Avidins are fairly small
oligomeric
proteins, made up of four identical subunits, each bearing a single binding
site for
biotin. Avidins can therefore bind up to four moles of biotin per mole of
avidin.
Avidins include proteins (a) produced by amphibians, reptiles and avians,
which is
present in their eggs and known as avidin, and (b) produced by a streptomyces,
StYeptomyces avidinii, and known as streptavidin. As used herein "avidin"
includes
all of the above proteins.
CA 02421078 2003-02-28
WO 02/18659 PCT/USO1/41956
-6-
Biotin: As used herein, "biotin" includes biotin, commercial biotin
products in which the biotin has been modified by the addition of alkyl
groups, and
biotin derivatives such as active esters, amines, hydrazides and thiol groups
with the
complimentary reactive groups on polymers being amines, acyl and alkyl leaving
groups, carbonyl groups and alkyl halides or Michael-type acceptors.
Detection Molecule: A molecule covalently attached to a nucleic
acid that allows for detection and/or removal of the nucleic acid, typically
by an
external source. Such molecules may comprise dyes, variable weight molecules
including poly A and poly T tails, linkers which may be connected to beads
including magnetic beads, biotin, avidin, digoxigenin, digoxigenin antibodies
and
other similar materials well known in the art.
Genotype: The particular alleles carried at a genetic locus.
Haplotype: Denotes the collective, genotype of a number of closely
linked loci and is the complete sequence of alleles along the same chromosome.
Hetero primer: A primer which will hybridize under stringent
conditions to one unique allele.
Heterosequence site: Two alleles that have different sequences at a
defined sequence site are said to have a heterosequence site.
Homo primer: A primer that will hybridize to both parental alleles.
Parental Alleles: Alleles from mammalian diploid cells which
contain one set of chromosomes from the maternal side and one set of
chromosomes
from the paternal side.
Primer: An oligonucleotide which can be hybridized to a
DNA template.
CA 02421078 2003-02-28
WO 02/18659 PCT/USO1/41956
_7_
All patents and references cited herein are hereby incorporated
by reference.
The methods of the present invention have several important
advantages. The methods of the present invention allow for quick, inexpensive,
accurate determination of alleles, including complete genotype and haplotype
determinations. The methods will allow for analysis of nucleic acid fragments
having lengths that prevent complete amplification by standard amplification
means
known in the art, such as the polymerise chain reaction
The present invention is directed to methods of separating and
identifying allele specific nucleic acid molecules. Any nucleic acid molecules
may
be used, with deoxyribonucleic acids being preferred. The allele specific
nucleic
acid molecules that may be identified and separated include alleles of
polyallelic
genes, segments of genes and non-expressed fragments.
The methods and kits of the present invention may be used with all
diploid genetic material which has two or more heterosequence sites, thus
having
multiple types of alleles. Examples of genes with multiple alleles to which
the
invention may be applied are the mammalian MHC genes such as human leukocyte
antigen (HLA) class I and class II genes, the T cell receptor genes in
mammals,
TAP, LMP, ras, non-classical HLA class I genes, the genes for human complement
factors C4 and C2, Bf in the human HLA complex, and genes located in
mitochondria) DNA, bacterial chromosomes and viral DNA.
In one method of the present invention, a nucleic acid sample
containing multiple alleles is obtained, each allele having a unique set of
heterosequence sites. The nucleic acid sample is amplified by any means well
known in the art, in one embodiment by the polymerise chain reaction (PCR), as
described in Mullis, U.S. Patent No. 4,683,202, issued, July 28, 1988. The
amplified nucleic acid sample is then denatured into single stranded nucleic
acid.
This single stranded nucleic acid may then be analyzed to determine the
alleles
CA 02421078 2003-02-28
WO 02/18659 PCT/USO1/41956
_g_
present by determining the hetereosequence sites present by a number of
approaches
according to the present invention.
The methods according to the present invention utilize one or more
primers. Primers according to the invention comprise a sequence of nucleotides
that
will hybridize with the sequence of interest. In some cases, it is required
that the
primers hybridize under conditions so that the primer will be capable of being
elongated during amplification. In other cases, it is required that primers
that are a
100 % complementary match when hybridized have a higher Tm than primers that
hybridize with less than a 100 % complementary match. In general, the primers
of
the present invention can be any useful length, but will generally contain
from about
12 to 25 nucleotides or at least 18 nucleotides, with a preferred length of
about 18 to
22 nucleotides. In the methods of the present invention, it is necessary to
identify
one or more primer sequences unique for the target DNA within the sample so as
to
identify the polymorphic sites of interest. Such polymorphic identification of
many
multiple allele genes are known in the art. For example, there are about 222
known
alleles of the HLA-A, HLA-B and HLA-C genes and the sequences of such alleles
are well known in the art. See Arnett and Parham, Tissue Anti eg ns ~.5: pp.
217-257, 1995, and Baxter-Lowe et al., U.S. Patent No. 5,702,885, issued
Dec. 30, 1997.
The expression "hybridize under highly stringent conditions" to
describe the hybridization of nucleic acid molecules encompassed within the
scope
of this invention refers to hybridizing under conditions of low ionic strength
and
high temperature for washing. The expression "hybridize under low stringency"
refers to hybridization conditions having high ionic strength and lower
temperature.
Variables affecting stringency include, for example, temperature, salt
concentration, probe/sample homology and wash conditions. Stringency is
increased with a rise in hybridization temperature, all else being equal.
Increased
stringency provides reduced non-specific hybridization. i.e., less background
noise.
CA 02421078 2003-02-28
WO 02/18659 PCT/USO1/41956
-9-
"High stringency conditions" and "moderate stringency conditions" for nucleic
acid
hybridizations are explained in Current Protocols ira Molecular Biology,
Ausubel et
al., 1998, Green Publishing Associates and Wiley Interscience, NY, the
teachings
of which are hereby incorporated by reference. Of course, the artisan will
appreciate that the stringency of the hybridization conditions can be varied
as
desired, in order to include or exclude varying degrees of complementation
between
probe and analyte, in order to achieve the required scope of detection.
Various detection molecules may be used in the present invention.
These molecules may be coupled to one or more primers, or may be coupled
directly to ddNTPs that are incorporated into nucleic acids during elongation
steps.
These molecules may comprise a means for detecting the molecule, such as dyes,
radiolabels, etc. , or they may comprise a means for separating the molecules,
such
as biotin/avidin, magnetic and/or fluorescent beads, etc., or both. For
example
when biotinlavidin are used, one or more of the primers may be labeled with
biotin,
so that when the primers are hybridized to single stranded nucleic acids, the
resultant double stranded DNA is produced in which one strand carries a biotin
label. The double stranded DNA may then be bound to a solid support coated
with
avidin.
The solid support used in the invention may be any such support well
known in the art such as a bead, an affinity chromatography column. A
preferred
support is in the form of a magnetic bead. When the support is in the form of
a
bead, the two strands of the amplified nucleic acid are separated by
attracting the
beads to a magnet and washing the beads under conditions such that the double
stranded nucleic acid dissociates into single strands of nucleic acid. The
dissociation
is typically performed by incubating the beads in several repetitions under
alkaline
conditions, typically 0.1 M or 0.15 M NaOH, at room temperature for about 5 to
10
minutes. Either strand can then be collected and further analyzed.
CA 02421078 2003-02-28
WO 02/18659 PCT/USO1/41956
-10-
Various analysis techniques can be used to identify the isolated
heterosequence sites to determine the alleles. These techniques are well known
in
the art and include, but are not limited to, electrophoresis such as
polyacrylamide
gel electrophoresis, flow cytometery, high pressure liquid chromotography
laser
scanning and mass spectroscopy. These techniques can be done manually or by an
automated system. Such automated systems are well known in the art and include
an automated sequencing machine or capillary electrophoresis machine which are
able to scan multiple-color fluorescence.
The first approach of the present is diagrammed in FIGS. 1 and 2 and
relies on elongation of hybridized heterosequence site specific primers. This
approach is particularly useful to determine allele or haplotype-specific
genotype
information in a highly polymorphic chromosome region. As shown in FIG. 1,
following amplification and denaturing of a DNA sample to produce single
stranded
DNA fragments, one or more heterosequence site specific primers) which is
labeled
with a detection molecule at the 5' end is added. The heterosequence site
specific
primer is added to the single stranded nucleic acid molecule and allowed to
hybridize. In a preferred embodiment, the 3' end of each primer is
complementary
to a polymorphic base of a heterosequence site. Therefore, if the primer
hybridizes
to a heterosequence site wherein the 3' base is not complementary, the primer
will
not undergo elongation when subjected to conditions for elongation. Preferably
an
enzyme that is capable of distinguishing single nucleotide differences is
utilized. As
shown in FIG. 1, the hybridized primers are then subjected to elongation, with
only
the primers which have hybridized with complementary 3' base matches being
elongated. The primers are then removed via the detection molecule,
exemplified as
biotin in FIG. 1. Magnetic beads coated with avidin are used to remove the
primers
via the biotin on the primers. The hybridized primer/DNA fragments are then
washed under conditions such that the DNA fragments bound to those primers
that
have not undergone elongation are removed. The elongated double stranded
nucleic
acids are then denatured. The strands not bound to the bead may then be
analyzed
to determine the heterosequence site(s). °
CA 02421078 2003-02-28
WO 02/18659 PCT/USO1/41956
-11-
Alternatively, the primers used in the invention may not be coupled
to a detection molecule at their 5' ends. Rather, the primers will be allowed
to
hybridized as previously described, and those that hybridize with
complementary 3'
ends will be subjected to single base extension using ddNTPs that are coupled
to
detection molecules as shown in FIG 2. The detection molecules on the extended
primers will be used to separate the primers, and the primers can then be
denatured
and analyzed to determine the heterosequence sites) present.
The present invention is also useful for high-throughput single
nucleotide polymorphism typing using an automated sequencing machine or
capillary electrophoresis machine which are able to scan four-color
fluorescence
when using the following method. The same method can also modified to typing
other genetic variations other than single nucleotide polymorphisms, including
multibase polymorphisms, insertions, inversions, translocations and deletions.
Another approach of the present invention relies on allele specific
ligation. This approach is illustrated in FIG. 3. As shown in FIG. 3,
heterosequence site specific primers are added to single stranded DNA
fragments
containing one or more heterosequence sites. The heterosequence specific
primers
have the 3' end of each primer complementary to a polymorphic base of a
heterosequence site and are allowed to hybridize to the DNA fragments.
Ligation
primers are then added, and allowed to hybridize to the DNA fragments. Each
ligation primer has a sequence that is complementary to a portion of one of
the
DNA fragments, such that the 5' end of the ligation primer is directly
adjacent to
the 3' end of the heterosequence site specific primer. If the heterosequence
site
specific primer does not hybridize to the DNA fragment, the ligation primer
will be
unable to ligate to the heterosequence site specific primer when subjected to
conditions for ligation. The primers are ligated, if possible, and then
subjected to
temperature conditions sufficient to denature the primers that have not
ligated, but
insufficient to denature ligated primers that have hybridized to the DNA
fragments.
Typically, such temperature will be approximately 60°C when 20 mer
primers are
CA 02421078 2003-02-28
WO 02/18659 PCT/USO1/41956
-12-
used. The ligated primers that have hybridized may then be removed by any
means
known in the art. As shown in FIG. 3, one set of the primers may have a
detection
molecule attached, illustrated as biotin. The detection molecule may be
attached to
the heterosequence specific primers or the ligation primers. Moreover, the
methodologies as described may be combined, as shown in FIG. 3, and
polymorphism at one heterosequence site detected by one method, and the other
sites determined by other methodologies described herein. Also as shown in
FIG. 3, one or more of the primers may have a variable weight molecule coupled
to
the 5' end of each primer, such that no two primers have the same molecular
weight. Such variable weight molecules can be any appropriate materials that
are
unreactive in the hybridization/amplification steps, and include poly
homonucleic
acid tails, such as poly A tails. Such poly A tails generally differ in length
from 2
to 4 bases, but may be of any different length that is sufficient to separate
such
primers with poly A tails on standard separating equipment, such as gel
electrophoresis.
Another method of the present invention is illustrated in FIG. 4.
According to such methodology, a set of heterosequence specific primers are
added
to DNA fragments containing multiple heterosequence sites. Each primer has at
least one polymorphic base, located within each primer such that following
hybridization of the primers to the DNA fragments, those primers that
hybridize
with base mismatches will have a lower Tm than those primers that hybridize
without
base mismatches. This difference in Tm is then used to a to remove those
primers
which have less than 100 % complementary hybridization. Such base mismatches
typically occur near the center of the primer sequence. After removal of the
less
than 100 % complementary hybridization primer/DNA fragment conjugates, the
remaining conjugates are analyzed to determine the specific heterosequence
sites to
determine the specific allele. This may be done in a variety of ways. As
illustrated
in FIG. 4, all primers may have a variable weight molecule attached. All
primers
for each specific heterosequence site may have a specific variable weight
molecule
attached. Each primer for each individual polymorphism at one or more specific
CA 02421078 2003-02-28
WO 02/18659 PCT/USO1/41956
-13-
heterosequence site will have a different detection molecule attached. By
separating
the hybridized primers into individual groups by the detection molecules, and
by
further determining which variable weight molecules are present in each group
of
primers, the allele specificity is determined. .
Another method of the present invention allows for the determination
of multiple heterosequence sites on long segments of nucleic acid that may be
too
long to be fully amplified by traditional means such as PCR. As shown in FIG.
5, a
single stranded nucleic acid molecule containing multiple heterosequence sites
is
selected. To this nucleic acid molecule two primers are added, a hetero primer
and
a homo primer. The hetero primer is capable of hybridizing to a 3'
heterosequence
site that is located 3' of a 5' heterosequence site on the same nucleic acid
molecule.
The 3' base of the hetero primer corresponds to a polymorphic base of the
heterosequence site, such that elongation will only occur when the 3' end of
the
hetero primer is hybridized to the single stranded nucleic acid. The homo
primer is
capable of hybridization to the same nucleic acid molecule at a position
located 5' of
the 5' heterosequence site. The primers are hybridized to the nucleic acid
molecule,
and hetero primer is elongated such that the 5' hetereosequence site of the
nucleic
acid molecule located between the primers is replicated. The nucleic acid
molecule
and elongated hetero primer are denatured, and the hetero primer separated and
analyzed to determine the 5' heterosequence site. This information is used to
identify a new set of nucleic acid primers containing a hetero primer and a
homo
primer, the hetero primer of the new set capable of hybridizing to the 5'
hetereosequence site (with the 3' base of the hetero primer corresponding to a
polymorphic base), the 5' heterosequence site located 3' to a further
hetereosequence site on the same nucleic acid molecule, and the homo primer of
the
new set capable of hybridization to the same nucleic acid molecule at a
position
located 5' of the further heterosequence site. The previous steps are
repeated, with
each new set of primers used in for the subsequent round of
hybridization/elongation
until sufficient heterosequence sites on the nucleic acid molecule have been
CA 02421078 2003-02-28
WO 02/18659 PCT/USO1/41956
-14-
identified to identify the allele. The haplotype of the nucleic acid molecule
may be
determined in this manner.
As shown in FIGS. 6A-6F, the present invention also relates to a
method for identifying multiple alleles in a nucleic acid molecule. As shown
in 6A,
the method comprises adding a nucleic acid sample containing multiple alleles
to a
set of beads, each bead having two distinct primers attached, at least one
primer on
each bead being a primer to a unique allele. The nucleic acid is then reacted
under
conditions such that the at least one primer to a unique allele hybridizes to
a portion
of the nucleic acid sample as shown in 6B. The hybridized primer is amplified
to
extend the hybridized primer to produce an extended primer nucleic acid as in
6C.
Moving to 6D, the hybridized nucleic acid sample and primer are then
denatured,
and the nucleic acid sample removed from the beads. The extended primer is
then
hybridized to the second primer on the bead (6E) and the second primer is
amplified
(6F). The beads containing the dual amplified primers are then analyzed to
determine the alleles present in the nucleic acid sample. For easy removal of
the
primers from the beads the primers can have a cleavage site.
The present invention also embodies kits for carrying out the methods
described herein. In their most basic embodiment the kits of the present
invention
comprise instructions for carrying out the methods discussed above.
Additionally,
the kits can contain at least one or more of the required reagents utilized in
the
present methods, such as one or more sets of locus specific amplification
primers,
polymerase chain reaction buffer, dideoxynucleotides, wherein one or more is
optionally labeled, reagents for nucleic acid amplification, reagents for
generation of
single stranded nucleic acid fragments, one or more heterosequence site
specific
primers, optionally conjugated to at least one detection molecule, one or more
ligation primers, reagents for ligatian of adjacent hybridized primers, beads
containing one or more detection molecules, and one or more sterile
microtubes.
CA 02421078 2003-02-28
WO 02/18659 PCT/USO1/41956
-1S-
This invention will be better understood from the Examples which
follow. However, one skilled in the art will readily appreciate that the
specific
methods and results discussed are merely illustrative of the invention and no
limitation of the invention is implied.
EXAMPLES
The present examples involved the use of three strategies to verify the
capture of different alleles pertaining to a specific polymorphism in the HLA
Gene:
i) Hybridization; ii) Single Base Extension; and iii) Ligation
Each of these conditions were used as a test to develop an assay that
would be helpful in identifying the appropriate allele and hence the specific
polymorphism pertaining to that allele. The last two methods were enzyme based
assays and required the use of a Taq Ligase, and a Thermus Sequenase that
exploits
the ability of these enzymes to distinguish single nucleotide differences at
specific
positions on a single stranded DNA. These methods have been noted to be
sensitive
enough to distinguish single nucleotide polymorphisms or mutations within
specific
alleles under investigation.
1.A. Hybridization
One method of detection was hybridization of a specific captured
target to oligo coupled microspheres and assaying the complex. The reactions
were
set up as described below. Any allele to be captured was subject to 2 rounds
of
Hybridization. The first round of Hybridization used different homo and
heterozygous DNA and specific oligo coupled bead that recognized a particular
sequence. The second round of Hybridization used another set of beads that
recognized a specific sequence within that target which confirmed the presence
of
the captured allele. However, a single round of hybridization was initially
done as a
CA 02421078 2003-02-28
WO 02/18659 PCT/USO1/41956
-16-
control experiment to test the specificity of the oligo coupled microspheres
to
different alleles within a target.
A 158 by DNA fragment of HLA-A locus was amplified using sense
primer 5' A200A and antisense primer 3'A322-1 with various genomic DNA
samples obtained from UCLA registries (UCLA 210, UCLA 230 and UCLA 243).
The 158 by fragment was produced for this example using standard amplification
methods. Primers used to amplify both Homo and Heterozygous DNAs in this
example were:
5'A200A 5' -ACA GCG ACG CCG CGA GCC A- 3' position 182 - 200, sense primer
3'A322-1 5' -CCTCGCTCTGGTTGTAGTA- 3' position 322 - 340, antisense primer
Single stranded DNA (ss) for use in ligation, single base extension or
hybridization was generated by Asymmetric PCR. The conditions for the
asymmetric PCR were as above, except the sense primer was added at 50 times
lower concentration than the antisense primer. The antisense primer was
biotinylated
to generate a 5' biotin-labeled single stranded PCR fragment.
Alternatively, the use of a 5'-3' exonuclease, T7 gene 6 exonuclease,
could be used to produce ssDNA. In this case, the strand of interest is
protected
through the introduction of 4 phoshothioate bonds at the 5' end of the PCR
primer
during oligonucleotide synthesis. T7 exonuclease degrades the strand that does
not
contain the phoshothioate bases at the 5' end of the primer.
1.B. Single Base Extension Reaction (SBER)
The Single Base Extension Reaction (SBER) of the present example
utilized an extension primer which was designed so that the 3' end annealed
adjacent
to the polymorphic base. The extension protocol of this example used either
Thermosequenase, or the Klenow large Fragment polymerase to incorporate the
polymorphic base in a cycling or a non-cycling reaction, respectively.
CA 02421078 2003-02-28
WO 02/18659 PCT/USO1/41956
-17-
Using the single base extension reaction in an attempt to capture a
specific allele; Allele Specific PCR was performed using Primer Mixes (PM),
H001
and H002. These two primer mixes were used for the incorporation of specific
bases at the site of the polymorphism. Both PM used a common 5'
primer(agcgacgccgcgagcca), but used an allele specific 3' primer. PM H001
specifically incorporated the "C" (ccaagagcgcaggtcctcg) base whereas PM H002
was specific for "A" (ccaagagcgcaggtcctct) at the respective sites of
polymorphism,
when a heterozygous DNA was used.
The extension reaction was done as described above. The product
from the extension reaction was purified and bound to streptavidin magnetic
beads.
The high binding affinity of streptavidin for biotin allowed for the rapid and
efficient isolation of biotin-labeled target molecules. The complex was washed
a
number of times to eliminate the possibility of any unbound label that could
be a
factor which might influence the next step of experimentation.
A number of different samples were tested for verification of the
captured allele by ASPCR. ASPCR using PMH001 and H002 were done in sets
of 5. Experimental and negative controls of a typical extension reaction
protocol
were as follows: The experimental sample used either biotinylated A or C in
the
extension reaction. It was assumed that Sequenase would correctly incorporate
the
specific base and hence a correct signal from the specific allele caught,
would be
detected based on the primer mix used. The two negative controls had the same
components in the SBER as the experimental samples except the ddNTPs A or C
was eliminated from the reaction. Another negative control used only unlabeled
ddNTPs A, C, G and T. The supernatants of the following sets of reactions were
verified by ASPCR using primer mixes H001, and H002. The supernatants tested
were in sets of 5 and were as follows: After extension, after binding of the
extension product to the magnetic beads, after a number of washes, and after
the
product was eluted from the magnetic beads at high temperature.
CA 02421078 2003-02-28
WO 02/18659 PCT/USO1/41956
-1~-
Cyclin~ Reaction
Each 20 ~.1 reaction used 100 ng of a single stranded (ss) DNA of the
HLA A locus which was obtained after PCR amplification of Genomic DNA as
described above; 2~,M of an extension primer, 125 nM each of the unlabeled
dideoxy terminators (ddG, T, A or C), and 500 nM of a biotin-labeled ddNTP
(either A or C), depending on the specific base to be incorporated at the site
of the
polymorphism, 10X Enzyme reaction buffer (diluted to 1X final concentration)
and
5 units of the Sequenase enzyme were added to the reaction mixture. The
reaction
was cycled at 94°C for 1 min, followed by 40 cycles of 94°C for
10 sec; and 60°C
for 30 sec. A final extension cycle at 72°C for 10 min with a hold at
4°C was used
as the extension profile in this example.
Non-Cyclin~ Reaction
When the Klenow Large fragment polymerase reaction was used for
extension, the first step required hybridization of the extension primer to
the single
stranded DNA. 100 ng of ssDNA was annealed to 20 ~.M of an extension primer.
The primer and DNA were mixed together at 90°C for 5 min and then
cooled to
room temperature slowly, so that a hybrid formed. This process took about 1
hour.
The next step involved the addition of specific unlabeled and labeled biotin
ddNTPs
(1.5 ~,M), with SU of the Klenow Large Fragment, and incubated at 37°C
for 30
min. 1.5 ~,1 of 0.5 M EDTA was added to the reaction mixture at the end of
extension.
The extension product (cycling or non-cycling), was purified using a
QIAQUICK~ column (Qiagen), to remove the unincorporated biotin. 10 ~,1 of
Streptavidin coated Magnetic beads (in a 2X binding buffer 10 mM Tris pH 7.5,
1 rnM EDTA, 2.0 mM NaCI) was mixed for 20 min at room temp with 20 ~.1 of the
purified extension product. A magnetic field was applied to the beads and the
unbound extension product was discarded. The beads were washed at least twice
CA 02421078 2003-02-28
WO 02/18659 PCT/USO1/41956
-19-
with 1 ml of the same binding buffer, and the strand of interest was eluted
from the
beads by applying heat at 95°C for 2 min.
The eluted strand was then subjected to Allelic specific PCR
(ASPCR) using specific primers to confirm the polymorphism of that specific
allele.
Appropriate controls were implemented to confirm the result.
1.C. Li~tion Method
This example involved the use of a ligation event between two
primers before annealing to a single stranded DNA template. This example was
performed with the understanding that ligation of the two primers with the
ssDNA
when perfectly matched would form a strong duplex and thus sustain a higher
temperature washing (greater than the Tm of the primers). The mismatched
template
would find it difficult to withstand washing at temperatures higher than the
Tm of the
primers and would free itself form the duplex and ultimately wash off.
Two primers were placed adjacent to each other in which one primer,
an allele specific or heterosequence primer, had a polymorphic site at the 3'
end and
a biotin label at the 5' end. The second primer was a ligation primer that had
a
phosphate group on the 5' end to mediate ligation. It was assumed that both
primers
would ligate together before hybridizing to the ssDNA template although the
present
method does not depend on this assumption. The 20 ~,1 reaction mixture
contained
10 ~.1 (100 ng) of a specific ssDNA, 1 p,1 of each of the primers (1 ~M), 2
~.l of a
10X Ligation Buffer and 10U of Taq Ligase.
The mixture was heated in a thermocyler at 90°C for 2 min,
followed
by a 30 min incubation at 37°C at which time the reaction was stopped
by the
addition of EDTA. The mixture was purified using a QIAQUICK~ column to
eliminate all unincorporated primer and biotin that can account for the non-
specificity in an allele specific PCR reaction.
CA 02421078 2003-02-28
WO 02/18659 PCT/USO1/41956
-20-
The purified complex was bound to streptavidin coated magnetic
beads as described above. The complex was washed under high stringency washing
conditions. Stringency of the wash was controlled by elevated temperatures of
the
wash buffer (55-95°C), so a threshold temperature was be reached for
the separation
of the allele-specific DNA fragment. The eluted template was further verified
by
Allele specific PCR using primers that recognized the site of polymorphism of
the
captured allele.
2. Hybridization Assay for Haplotyping
Different oligonucleotides for specific polymorphisms of the HLA A
Locus were coupled to different bead sets (Luminex) to be used in the
hybridization
assay. The template that hybridized to the oligo coupled beads was selected to
provide perfect sequence homology. Coupling beads to specific oligos was
performed according to the manufacturer's instructions (Luminex Corp.). The
Luminex bead-probe conjugate were hybridized with PCR fragments produced
above. The sequence of the probes used for separation of allele specific PCR
fragments was
LS'A107A lAGGTATTTCTACACCTCCGTG
LS'A107C lAGGTATTTCTCCACATCCGTG
The non-hybridized PCR templates were washed away and the PCR
fragment specific hybridized to 5'A107A or 5'A107C were eluted from the
Luminex
beads. Oligos of different sizes, with and without a spacer (i.e. which
contained an
additional 20 random bases in the middle of an oligo sequence), were coupled
to
various bead sets and hybridized to different templates to assay for
specificity of
different alleles. The numbers in the primer identification correlate to
different
oligonucleotides coupled to beads and indicate the site of the polymorphism
for a
specific allele. For example, 107 A or C signifies the site of polymorphism at
base
107 where each allele either has an A or a C at position 107.
CA 02421078 2003-02-28
WO 02/18659 PCT/USO1/41956
-21-
The reaction protocol for hybridization was as follows: 17 p1 of
ssDNA was denatured at 95°C for 5 min, followed by the addition of 33
~,1 of a
specific oligo coupled bead (5000 beads/oligo), complementary to the template
and
incubated at 55 C for 30 min. When the oligo with the spacer was used the
hybridization temperature was increased to 65°C to ensure specificity.
The bead
mixture was thoroughly vortexed and sonicated and brought up to the required
hybridization temperature, before addition of the ssDNA. Following
hybridization
the mixture was centrifuged at 2000 x g; washed twice with 1 ml each of 1. 5X
TMAC (3M TMAC, 0.1 % SDS, 50 mM Tris-Cl, pH 8.0, 4 mM EDTA pH 8.0)
and the supernatant was discarded.
~,1 of Hz0 was added to the complex and the captured template
which was bound to the oligo coupled bead was eluted at 95°C for 5 min.
1 ~,1 of
the eluted template was subjected to asymmetric PCR to obtain a greater
abundance
of the eluted template for a second round of hybridization.
15 A second round of Hybridization was performed with a second bead
set that was complementary to the captured template as a test to confirm the
accuracy of the template. The samples were measured on a Luminex 100 flow
cytometry instrument after the addition of 120 ng of Streptavidin-
Phycoerythrin
(SA-PE) to each tube and incubated at the hybridization temperature for
another 5
20 minutes. The amount of fluorescent signal obtained was a true
representation of the
interaction of the biotin with the SA-PE. This assay was a quantitative one
and the
amount of positive signal was expressed as the highest number obtained for a
given
reaction.
The second round of hybridization used other allele-specific Luminex
bead-probes as follows:
CA 02421078 2003-02-28
WO 02/18659 PCT/USO1/41956
-22-
Luminex bead-probes used to confirm allele specific separation
LS'A107A lAGGTATTTCTACACCTCCGTG
LS'A107C 1AGGTATTTCTCCACATCCGTG
LS'A153A 1CTTCATCGCAGTGGGCTAC
LS'A153C 1CTTCATCGCCGTGGGCTAC
LS'A249T 1GCAGGAGGGTCCGGAGTAT
LS'A249G 1GCAGGAGGGGCCGGAGTAT
LS'A291C 1GAAGGCCCACTCACAGACT
LS'A291G 1GAAGGCCCAGTCACAGACT
Table 1. Expected allele-specific reaction pattern after hybridization
Luminex
bead-probe
reaction
pattern
Template
DNA Name ~A_A AlleleL5'A107AL5'A107CL5'A249GL5'A249TLS'A291CL5'A291G
UCLA 210 ~,*p206, - - -
- + + +
(homozygote)
UCLA 230 ~,*2402101- + + - + -
(heterozygote)
A*3401 + - + - - +
UCLA 243 A*2402101- + + - + -
-
(homozygotes),
Table 2. Observed allele-specific reaction pattern hybridization.
Template probe L5'A107AL5'A107CL5'A249GLS'A249TL5'A291CL5'A291G
DNA Name
UCLA 210 LS'A107A(+) (-) (-) (+) (+) (-)
166 50 124 279 234 21
(homozygote)LS'A107C(-) (-) (-) (-) (-) (-)
152 60 137 330 223 29
UCLA 230 LS'A107A(+) (+) (+) (-) (+) (-)
63 111 90 56 94 27
(heterozygote)LS'A107C(-) (+) (+) (-) (+) (-)
52 87 70 55 57 13
UCLA 243 LS'A107A(-) (-) (-) (-) (+) (-)
13 57 37 23 96 14
(homozygotes)LS'A107C(-) (+) (+) (-) (+) (-)
15 83 60 36 124 13
Negative 7 9 14 19 6 9
Control
CA 02421078 2003-02-28
WO 02/18659 PCT/USO1/41956
-23-
Table 3. Observed allele-specific reaction pattern after hybridization using
negative control.
Template No ProbeL5'A107AL5'A107CLS'A249GL5'A249TLS'A291CL5'A291G
DNA Name (Control)
UCLA 210
(+) (-) (-) (+) (+) (-)
65 29 65 124 97 19
(homozygote)
UCLA 230
(+) (+) (+) (-) (+) (-)
63 111 90 56 30 68
(heterozygote)
UCLA 243
(-) (-) (-) (-) (+) (-)
12 216 100 23 213 10
(homozygotes)
Negative 7 9 14 19 6 9
Control
The results in the tables above demonstrate successful allele-specific
hybridization as the allele-specific numbers are higher than the non-allelic
specific
reactions.
As will be understood by one skilled in the art, for any and all
purposes, particularly in terms of providing a written description, all ranges
disclosed herein also encompass any and all possible subranges and
combinations of
subranges thereof. Any listed range can be easily recognized as sufficiently
describing and enabling the same range being broken down into at least equal
halves, thirds, quarters, fifths, tenths, etc. As a non-limiting example, each
range
discussed herein can be readily broken down into a lower third, middle third
and
upper third, etc. As will also be understood by one skilled in the art all
language
such as "up to," "at least," "greater than," "less than," and the like refer
to ranges
which can be subsequently broken down into subranges as discussed above.
While only a few, preferred embodiments of the invention have been
described, those of ordinary skill in the art will recognize that the
embodiment may
be modified and altered without departing from the central spirit and scope of
the
invention. Thus, the preferred embodiments described above are to be
considered
in all respects as illustrative and not restrictive, the scope of the
invention being
indicated by the following claims, rather than by the foregoing description,
and all
CA 02421078 2003-02-28
WO 02/18659 PCT/USO1/41956
-24-
changes which come within the meaning and range of equivalents of the claims
are
intended to be embraced.
The following references are hereby incorporated into the patent
application in their entirety:
Jorde, L.B.: Am. J. Hum. Genet. 56, pp. 11-14, 1995;
Thomson, G.: Am. J. Hum. Genet. 57, pp. 474-486, 1995;
Ruano, G., Kidd, K.K. and Stephens, J.C.: Proc. Natl. Acad. Sci.
USA 87, pp. 6296-6300, 1990;
Ruano, G. and Kidd, K.K.: Nucleic Acids Res. 19, pp. 6877-
6882, 1991;
Beloin, S.M., Tishkoff, S.A., Bentley, K.L., Kidd, K.K. and
Ruano, G.: Nucleic Acids Res. 24, pp. 4841-4843, 1996;
Gilles, P.N., Wu, D.J., Foster, C.B., Dillon, P.J. and Chanock, S.J.:
Single nucleotide polymorphic discrimination by an electronic dot blot assay
on
semiconductor microchips. Nature Biotechnol. 17, pp. 365-370, 1999;
Little, D.P., Braun, A., O'Donnell, M.J. and Koster, H.: Mass
spectrometry from miniaturized arrays for full comparative DNA analysis.
Nature
Med. 3, pp. 357-362, 1997;
Marshal, R.D., Koonts, J. and Sklar, J.: Detection of mutations by
cleavage of DNA heteroduplexes with bacteriophage resolvases. Nature Genet. 9,
pp. 177-183, 1995;
Nauck, M.S., Gierens, H., Nauck, M.A., Marz, W. and
Wieland, H.: Rapid genotypifzg of human platelet antigen 1 (HPA-1) with
fluorophore-labelled hybridization probes on tlae Lightcycler. Brit. J.
Haematol.
105, pp. 803-810, 1999;
CA 02421078 2003-02-28
WO 02/18659 PCT/USO1/41956
-2S-
Pease, A.C., Solas, D., Sullivan, E.J., Cronin, M.T., Holmes, C.P.
and Fodor, S.P.A.: Light-generated oligonucleotide arrays for rapid DNA
sequence
analysis. Proc. Natl. Acad. Sci. USA, 1994;
Southern, E.M.: DNA chips: Analysis sequence by hybridization to
oligonucleotides on a large scale. Trends Genet. 12, pp. 110-115, 1996;
Syvanen, A.C., Aalto-Setala, K., Harju, L., Kontula, K. and
Soderlund, H.: A primer-guided rtucleotide incorporation assay in the
genotyping of
apolipoprotein E. Genomics 8, pp. 684-692, 1990;
Tyagi, S. and Kramer, F.R.: Molecular beacons: Probes that
fluoresce upon hybridization. Nature Biotechnol. 14, pp. 303-308, 1996.
