Note: Descriptions are shown in the official language in which they were submitted.
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
NOVEL MAMMALIAN RECEPTOR GENES AND USES
This invention was made with government support under National Institute of
Health grants DA08562. The government has certain rights to this invention.
BACKGROUND OF THE INVENTION
1. Field of the Invention
This invention relates to biogenic amine receptors from mammalian species
and the genes corresponding to such receptors. Specifically, the invention
relates to
the isolation, cloning and sequencing of complementary DNA (cDNA) copies of
messenger RNA (mRNA) encoding a novel mammalian biogenic amine receptor
gene. The invention also relates to the construction of recombinant expression
constructs comprising cDNA of this novel receptor gene, said recombinant
expression
constructs being capable of expressing receptor protein in cultures of
transformed
prokaryotic and eulcaryotic cells. Production of the receptor protein in such
cultures is
also provided. The invention relates to the use of such cultures of such
transformed
cells to produce homogeneous compositions of the novel biogenic amine receptor
protein. The invention also provides cultures of such cells producing this
receptor
protein for the characterization of novel and useful drugs. Antibodies against
and
epitopes of this novel biogenic amine receptor protein are also provided by
the
invention.
2. Background of the Invention
Biogenic amines are a class of naturally-occurring amino acid derivatives
having a variety of physiological effects in the peripheral and central
nervous systems.
The parent compound is ~-phenylethylamine, and derivatives of this compound
include the biogenic amines. The biogenic amines are a large and diverse class
of
compounds that include dopamine, noradrenaline, epinephrine, norepinephrine,
and
serotonin. The biogenic amines are implicated in a variety of psychiatric and
neurologic disorders.
In the periphery, biogenic amines are released by the sympathetic nervous
system and adrenal medulla and are involved in integrating physiological
responses to
stress, while in the central nervous system the biogenic amines constitute
some of the
most important neurotransmitter systems.
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
The effects of biogenic amines are mediated thr ough their receptors and their
associated cell signaling systems (reviewed in Hoffman & Leflcowitz,1982, Ann.
Rev.
Physiol. 44: 475-484; Civelli et al., 1993, Ann. Rev. Pha~°m. & Tox.
33: 281-307).
These receptors are located in the plasma membr ane of biogenic amine-
sensitive cells.
Structurally, they are characterized by having a pattern of seven
transmembrane
domains (see, for ezanaple, U.S. Patent Nos. 5,422,265, 5,569,601, 5,594,108,
5,883,226, 5,880,260, 5,427,942 and 5,686,573). Functionally, certain of these
receptors interact with adenylate cyclase, either stimulating or inhibiting
the
production of cyclic AMP thereby. These receptors include the adrenergic
receptors
l o (the a-1, a-2, b-1, b-2, and b- 3 adrenergic receptors) and the dopamine
receptors (the
DI-, DZ-, D3-, D_~-, and DS- dopamine receptors).
Fox example, epinephr ine (adrenaline) and norepinephrine, as well as
synthetic
agonists of these biogenic amines which mimic their biological functions, and
antagonists which block these biological functions, exert their effects by
binding to
specific recognition sites, (membrane receptors) situated on the cell
membranes in the
nervous system; Two principal classes of adrenergic receptors have been
defined, the
alpha-adrenergic receptors and the beta-adrenergic receptors: Five subtypes of
adrenergic receptors (a-1, a-2, b-1, b-2, and b-3 adrenergic receptors) have
now been
distinguished. The genes encoding these receptors have been isolated and
identified
(Cotecchia et al., 1988, Proc. Natl. Acad. Sci. USA 85: 715,9-7163; I~obillca
et al.,
1987, Science 238: 650-656; Frielle et al., 1987, Proc. Natl. Acad. Sci. USA
84:
7920-7924; Emorine et al., 1987, Proc. Natl. Acad. Sci. USA 84: 6995-6999;
Emorine
et al., 1989, Scierace 245: 1118-1121). Analysis of these genes has made it
possible to
recognize that they belong to a family of integral membrane receptors
exhibiting some
homology (Dixon et al., 1998, Annual Reports in Medicinal Chemistry, 221-223;
Emorine et al., 1988, Proc. NATO Adv. Res. YForhshop), especially at portions
of the
seven transmembrane regions that are coupled to regulatory proteins, called G
proteins, capable of binding molecules of guanosine triphosphate (GTP).
These membrane receptors, after they have bound the appropriate ligand
(agonist or antagonist), are understood to undergo a conformational change
that
induces an intracellular signal that modifies the behavior of the target cell.
Beta-adrenergic receptors catalyze the activation of a class of G proteins,
which in
turn stimulates the activity of adenylate cyclase when they bind with biogenic
amine
agonists, whereas alpha-adrenergic receptor antagonists act in competition
with the
2
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
agonists for the binding to the receptor and prevent the activation of
adenylate cyclase.
When adenylate cyclase is activated, it catalyses the production of an
intracellular
mediator or second messenger, especially cyclic AMP.
In the central nervous system, dopamine is a biogenic amine neurotransmitter
that modulates neuronal cells involved in movement initiation, appetitive
behavior,
hormone release, and visual darle adaptation. In the periphery dopamine plays
a role
in modulating blood pressure and renal function (see generally Cooper et al.,
1978,
THE BIOCHEMICAL BASIS OF NEUROPHARMACOLOGY, 3d ed., Oxford University Press,
New York, pp, 161-195). The diverse physiological actions of dopamine are in
turn
1 o mediated by its interaction with a family of distinct dopamine receptors
subtypes that
are either "D 1-like" or "D2-like,", which respectively stimulate and inhibit
the enzyme
adenylate cyclase (Kebabian & Calne, 1979, Nature 277: 93-96). Alterations in
the
number or activity of these receptors may be a contributory factor in disease
states
such as Parlcinson's disease (a movement disorder) and schizophrenia (a
behavioral
disorder) and attention deficit hyperactivity disorder (ADHD).
A gr eat deal of information has accumulated regarding the biochemistry of the
D1 and D2 dopamine receptors, and methods have'been developed to solubilize
and
purify these receptor proteins (see Senogles et al., 1986, Biochemistry 25:
749-753;
Sengoles et al., 1988, J. Biol. Chem. 263: 18996-19002; Gingrich et al., 1988,
,
Bioclzemistzy 27: 3907-3912). The D1 dopamine receptor in several tissues
appears to
be a glycosylated membrane protein of about 72 1cD (Amlailcy et al., 1987,
Mol.
Phaz°znacol. 31: 129-134; Ninzik et al., 1988, Bioclzeznistzy 27: 7594-
7599). The D2
receptor can also be glycosylated and has been suggested to have a higher
molecular
weight of about 90-150 1D (Amlaiky & Caron, 1985, J. Biol. Claem. 260: 1983-
1986;
2s Amlailcy & Caron, 1986, J. Neuroclzenz. 47: 196-204; Jarvie et al., 1988,
Mol.
Plzaz°zzzacol. 34: 91-97).
Dopamine receptors are primary targets in the clinical treatment of psycho-
motor disorders such as Parkinson's disease and affective disorders such as
schizophrenia (Seeman et al., 1987, Neuropsych.opharzn. 1: 5-15; Seeman, 1987,
3o Synapse 1: 152-333). Five different dopamine receptor genes (D1, D2, D3, D4
and
DS) and various splice variants of their transcripts have been cloned as a
result of
nucleotide sequence homology which exists between these receptor genes (Bunzow
et
al., 1988, Nature 336: 783-787; Grandy et al., 1989, Pz°oc. Natl. Acad.
~S"ci. USA 86:
9762-9766; Dal Toso et al., 1989, EMBO J. 8: 4025-4034; Zhou et al., 1990,
Nature
3
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
346: 76-80; Sunahara et al., 1990, Nature 346: 80-83; Solcoloff et al., 1990,
Nature
347: 146-151; Civelli et al., 1993, Anrau. Rev. Phar~sraacol. Toxicol. 33: 281-
307; Van
Tol et al., 1991, Nature 350: 610-4).
Biogenic amine receptors are also targets for a host of therapeutic agents for
the treatment of shoclc, hypertension, arrhythmias, asthma, migraine headache,
and
anaphylactic reactions, and include antipsychotic drugs that are used to treat
schizophrenia and (3-bloclcers used to control high blood pressure.
In addition to these compounds, a number of biogenic amines are present in
much lower quantities (less than 1 % of the biogenic amines) and are therefore
known
1o as trace amines. The trace amines include such compounds as para-tyramine
(p
tyramine), yneta-tyramine (rn-tyramine), phenylethylamine, octopamine, and
tryptamine. The trace amines (3-phenethylamine ((3 -PEA), p-tyramine,
tryptamine,
and octopamine are found in peripheral tissues as well as the central nervous
system
(Tallman et al., 1976, JPlaa~°snacol Exp Then 199: 216-221; Paterson et
al., 1990, J
Nem°oclaern 55: 1827-37). In vivo ~3 -PEA andp-tyramine can be
synthesized from
phenylalanine or tyrosine by the enzyme amino acid decarboxylase. (Boulton and
Dyclc, 1974, Life Sci 14: 2497-2506; Tallman et al., 1976, ibid.).
Investigations into the effects of trace amines on smooth muscle and glandular
preparations early in the twentieth century clearly demonstrated that amines
produced
2o by putrefaction and lacking the catechol nucleus were capable of producing
robust
sympathomimetic effects (Barger and Dale, 1910, JPhysiol 41: 19-59). Currently
it is
thought thatp-tyramine and (3 -PEA manifest their peripheral effects by
promoting the
efflux of catecholamines from sympathetic neurons and adrenals (Schonfeld and
Trendelenburg, 1989, Naunyn Schyniedebe~°g's Anch Phas°macol
339: 433-440;
Mundorf et al., 1999, J Neuf°oclaefn 73: 2397-2405) which results in
the indirect
stimulation of adrenergic receptors (Black et al., 1980, Eur JPhanrraacol 65:
1-10).
Sensitive techniques have been developed to detect low concentrations of trace
amines in the central nervous system. Such studies have revealed that trace
amines in
the centxal nervous system have a high turnover rate (Meek et al., 1970, J.
3o Neurochena.17: 1627-1635; Lemberger et al., 1971, J. Pha~°naac. Exp.
Ther. 177:169
176; Wu & Boulton, 1974, Can. J. Biochem. 52: 374-381; Durden & Philips, 1980,
J
Neurocherra. 34: 1725-1732). Trace amines are expressed throughout the brain
in a
heterogenous pattern and at least two of them can pass easily across the blood-
brain-
barrier (Boulton, 1974, Lafacet ii: 7871; Oldendorf, 1971, Afn. J Plzysiol.
221: 1629-
4
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
1639). Trace amines are also lcnown to potentiate caudate neuronal firing in
response
to dopamine application and act as sympathomimetics by stimulating release of
biogenic amines from brain preparations and synaptosomes when applied at high
concentrations. Para-tyramine may act as a "false transmitter" in a manner
similar to
that of amphetamine by triggering release of neurotransmitters such as
dopamine.
The abilities ofp-tyramine and (3-PEA to deplete neurotr ansmitter from
storage
vesicles, compete with neurotransmitters for uptake, and stimulate outward
neurotransmitter flux through the plasma membrane carriers are similar to the
actions
of the [3-PEA analog, a-methyl-(3-phenethylamine, better known as amphetamine
(Amara and Sonders, 1998, Drug Alco7~ol Depend 51:87-96; Seiden et al., 1993).
Amphetamines were originally marketed as stimulants and appetite suppressants,
but
their clinical use is now mostly limited to treating attention deficit
hyperactivity
disorder (Seiden et al., 1993, Annu Rev Plaaj°tnacol Toxicol 33:639-
677): Although
listed as controlled substances, amphetamines are widely consumed because of
their
ability to produce wakefulness and intense euphoria. Some substituted
amphetamines,
such as MDMA ("ecstasy") and DOI, are taken for their "empathogenic" and
hallucinogenic effects. (Eisner, 1994, Ecstasy: The MDMA stofy. Ronin Books,
Berlceley, CA; Shulgin and Shulgin, 1991, PiHKAL: A cl2enaical love stoYy.
Transform
Press, Berkeley, CA). Numerous liabilities are associated with the use of
2o amphetamines including hyperthermia (Byard et al., 1998, Am JForensic Med
Pathol
19: 261-265), neurotoxicity (Ricaurte and McCann, 1992, Ann NYAcad Sci 648:
371-
382), psychosis (Seiden et al., 1993, ibid.), and psychological dependence
(hurray,
1998, J Psychol 132: 227-237). In addition to the actions of amphetamines at
biogenic amine transporters, it is also clear that a subset of amphetamine
analogs,
especially those with hallucinogenic properties, can act directly on 5-HT
receptors as
they have much higher affinities for these sites than for the transporters
(hare1c and
Aghajanian, 1998, Drug Alcohol Depend 51:189-198).
The importance of biogenic amines and their receptors, particularly in the
brain and central nervous system, has created the need for the isolation of
additional
biogenic amine receptors, particularly trace amine receptors, for the
development of
therapeutic agents for the treatment of disorders, including disorders of the
CNS and
most preferably treatment of disorders on mental health such as psychosis, in
which
biogenic amines and their receptors have been implicated. There is also a need
for
developing new tools that will permit identification of new drug lead
compounds for
5
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
developing novel drugs. This is of particular importance for psychoactive and
psychotropic drugs, due to their physiological importance and their potential
to greatly
benefit human patients treated with such drugs. At present, few such
economical
systems exist. Conventional screening methods require the use of animal brain
slices
in binding assays as a first step. This is suboptimal for a number of reasons,
including
interference in the binding assay by non-specific binding of heterologous (i.
e., non-
receptor) cell surface proteins expressed by brain cells in such slices;
differential
binding by cells other than neuronal cells present in the brain slice, such as
glial cells
or blood cells; and the possibility that putative drug binding behavior in
animal brain
1o cells will differ from the binding behavior in human brain cells in subtle
but critical
ways. The ability to synthesize human biogenic amine receptor molecules ifa
vitro
would provide an efficient and economical means for rational drug design and
rapid
screening of potentially useful compounds. For these and other reasons,
development
of ifz vita°o screening methods for psychotropic drugs has numerous
advantages and is
a major research goal in the pharmaceutical industry.
SUMMARY OF THE INVENTION
The present invention relates to the cloning, expression and functional
characterization of a mammalian biogenic amine receptor gene. The invention
2o comprises nucleic acids having anucleotide sequence of a novel mammalian
biogenic
amine receptor gene .that specifically binds to trace amines. The nucleic
acids
provided by the invention comprise a complementary DNA (cDNA) copy of the
corresponding mRNA transcribed ih vivo from the biogenic amine receptor genes
of
the invention. In one preferred embodiment, the marmnalian biogenic amine
receptor '
is a human biogenic amine receptor. In another preferred embodiment, the
mammalian
biogenic amine receptor is a rat (Rattus nonvegicus) biogenic amine receptor.
Also
provided are the deduced,amino acid sequence of the cognate proteins of the
cDNAs
provided by the invention, methods ofmalcing said cognate proteins by
expressing the
cDNAs in cells transformed with recombinant expression constructs comprising
said
3o cDNAs, and said recombinant expression constructs and cells transformed
thereby.
This invention in a first aspect provides nucleic acids, nucleic . acid
hybridization probes, recombinant eulcaryotic expression constructs capable of
expressing the biogenic amine receptors of the invention in cultures of
transformed
cells, and such cultures of transformed eulcaryotic cells that synthesize the
biogenic
6
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
amine receptors of the invention. In another aspect, the invention provides
homogeneous compositions of the biogenic amine receptor proteins of the
invention,
and membrane and cytosolic preparations from cells expressing the biogenic
amine
receptor proteins of the invention, as well as antibodies against and epitopes
of the
biogenic amine receptor proteins of the invention. The invention in another
aspect
provides methods for malting said homogenous preparations and membrane and
cytosolic preparations using cells transformed with the recombinant expression
constructs of the invention and expressing said biogenic amine receptor
proteins
thereby. Methods for characterizing the receptor and biochemical properties of
these
1o receptor proteins and methods for using these proteins in the development
of agents
having pharmacological uses related to these receptors are also provided by
the -
invention.
In a first aspect, the invention provides a nucleic acid having a nucleotide
sequence encoding a mammalian biogenic amine receptor. In a first preferred
embodiment, the nucleic acid encodes a human biogenic amine receptor. In this
embodiment of the invention, the nucleotide sequence comprises 1125
nucleotides of
human biogenic amine receptor cDNA comprising 1040 nucleotides of coding
sequence, 20 nucleotides of 5' untranslated sequence and 85 nucleotides of 3'.
untranslated sequence. In this embodiment of the invention, the nucleotide
sequence
of the biogenic amine receptor is the nucleotide sequence depicted in Figure 1
(SEQ
ID No: l). The sequence shown inFigure 1 will be understood to represent one
specific embodiment of a multiplicity of nucleotide sequences that encode the
human
biogenic amine receptor amino acid sequence (SEQ ID No,.: 2) of the invention
and
that these different nucleotide sequences are functionally equivalent and are
intended.
to be encompassed by the claimed inveritiori. Further, it will be understood
that the.
coding sequence comprising 1040 nucleotides-can be used to express the cognate
protein without inclusion of either the 5' or 3' untranslated sequences. Iri
addition, it
will be understood that different organisms and cells derived therefrom
express
preferentially certain tRNAs corresponding to subsets of the
degenerate.collection of
3o tRNAs capable of encoding certain of the naturally-occurring amino acids,
and that
embodiments of the multiplicity of nucleotide sequences encoding the amino
acid
sequence of the human biogenic amine receptor protein of the invention that
are
optimized for expression in specific prokaryotic and eulcaryotic cells are
also
encompassed by the claimed invention. Isolated nucleic acid derived from human
7
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
genomic DNA and isolated by conventional methods using the human cDNA
provided by the invention is also within the scope of the claimed invention.
Finally, it
will be understood that allelic variations of the human biogenic amine
receptor,
including naturally occurring and irr. vitro modifications thereof are within
the scope of
this invention. Each such variant will be understood to have essentially the
same
amino acid sequence as the sequence of the human biogenic amine receptor
disclosed
herein.
In a second preferred embodiment of this aspect of the invention, the nucleic
acid encodes the rat biogenic amine receptor. In this embodiment of the
invention, the
1o nucleotide sequence includes 999 nucleotides of the rat biogenic amine
receptor
cDNA comprising the coding sequence. In this embodiment of the invention, the
nucleotide sequence of the biogenic amine receptor is the nucleotide sequence
depicted in Figure 2 (SEQ ID No: 3). The sequence shown in Figure 2 will be
understood to represent one specific embodiment of a multiplicity of
nucleotide
sequences that encode the rat biogenic amine receptor amino acid sequence (SEQ
ID
No.: 4) of the invention and that these different nucleotide sequences are
functionally
equivalent and are intended to be encompassed by the claimed invention. In
addition,
it will be understood that different organisms and cells derived therefrom
express
preferentially certain tRNAs corresponding to subsets of the degenerate
collection of
2o tRNAs capable of encoding certain of the naturally-occurring amino acids,
and that
embodiments of the multiplicity of nucleotide sequences encoding the amino
acid
sequence of the rat biogenic amine receptor protein of the invention that are
optimized
for expression in specific prokaryotic and eulcaryotic cells are also
encompassed by
the claimed invention. Isolated nucleic acid derived from rat genomic DNA and
isolated by conventional methods using the rat cDNA provided by the invention
is
also within the scope of the claimed invention. Finally, it will be understood
that
allelic variations of the rat biogenic amine receptor, including naturally
occurring and
iya vitro modifications thereof are within the scope of this invention. Each
such variant
will be understood to have essentially the same amino acid sequence as the
sequence
of the human biogenic amine receptor disclosed herein.
Mammalian biogenic amine receptor proteins corresponding to the human and
rat cDNAs of the invention are a second aspect of the claimed invention. In a
first
embodiment, the mammalian biogenic amine receptor protein is a human biogenic
amine receptor having a deduced amino acid sequence shown in Figure 1 (SEQ ID
8
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
No.: 2). In a second embodiment is provided said human biogenic amine receptor
protein comprising a membrane or cytosolic preparation from a cell, most
preferably a
recombinant cell, expressing a nucleic acid encoding a human biogenic amine of
the
invention. In a thin d embodiment, the mammalian biogenic amine receptor
protein is a
s r at biogenic amine receptor having a deduced amino acid sequence shown in
Figure 2
(SEQ ID No.:4). In a fourth embodiment is provided said rat biogenic amine
receptor
protein comprising a membrane or cytosolic preparation from a cell, most
preferably a
recombinant cell, expressing a nucleic acid encoding a rat biogenic amine of
the
invention.
1 o As provided in this aspect of the invention is a homogeneous composition
of a
mammalian biogenic amine receptor having a molecular weight of about 39kD or
derivative thereof that is a human biogenic amine receptor having an amino
acid
sequence shown in Figure 1 and identified by SEQ ID No.: 2, said size being
understood to be the predicted size of the protein before any post-
translational
15 modifications thereof. Also provided is a homogeneous composition of a
marmnalian
biogenic amine receptor having a molecular weight of about 381cD or derivative
thereof that is a rat biogenic amine receptor having an amino acid sequence
shown in
Figure 2 and identified by SEQ ID No.: 4, said size being understood to be the
predicted size of the protein before any post-translational modifications
thereof.
20 This invention provides both nucleotide and amino acid probes derived from
the sequences herein provided. The invention includes probes isolated from
either
cDNA or genomic DNA, as well as probes made synthetically with the sequence
information derived therefrom. The invention specifically includes but is not
limited
to oligonucleotide, nick-translated, random primed, or in vits°o
amplified probes made
25 using cDNA or genomic clone of the invention encoding a mammalian biogenic
amine receptor or fragment thereof, and oligonucleotide and other synthetic
probes
synthesized chemically using the nucleotide sequence information of cDNA or
genomic clone embodiments of the invention.
It is a further object of this invention to provide such nucleic acid
3o hybridization probes to determine the pattern, amount and extent of
expression of the
biogenic amine receptor gene in various tissues of mammals, including humans.
It is
also an object of the present invention to provide nucleic acid hybridization
probes
derived from the sequences of mammalian biogenic amine receptor genes of the
invention to be used for the detection and diagnosis of genetic diseases. It
is an object
9
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
of this invention to provide nucleic acid hybridization probes derived from
the nucleic
acid sequences of the mammalian biogenic amine receptor genes herein disclosed
to
be used for the detection of novel related receptor genes.
The present invention also includes synthetic peptides made using the
nucleotide sequence information comprising the cDNA embodiments of the
invention.
The invention includes either naturally occurring or synthetic peptides which
may be
used as antigens for the production of biogenic amine receptor-specific
antibodies, or
useful as competitors of biogenic amine receptor molecules for agonist,
antagonist or
drug binding, or to be used for the production of inhibitors of the binding of
agonists
or antagonists or analogues hereof to such biogenic amine receptor molecules.
The present invention also provides antibodies against and epitopes of the
mammalian biogenic amine receptor molecules of the invention. It is an object
of the
present invention to provide antibodies that are imW unologically ieactive to
the
biogenic amine receptors of the invention. It is a particular object to
provide
monoclonal antibodies against these biogenic amine receptors. Ilybridoma cell
lines
producing such antibodies are also objects of the invention. It is envisioned
that such
hybridoma cell lines may be produced as the 'result of fusion between a non-
immunoglobulin producing mouse myeloma cell line and spleen cells derived from
a
mouse immunized with a cell line which expresses antigens or' epitopes of a
2o mammalian biogenic amine receptor of the invention. The present invention
also
provides hybridoma cell lines that produce such antibodies, and can be
injected into a
living mouse to provide an ascites fluid from the mouse that is comprised of
such
antibodies. It is a further object of the invention to provide immunologically-
active
epitopes of the mammalian biogenic amine receptor proteins of the invention.
Chimeric antibodies immunologically reactive against the biogenic amine
receptor
proteins of the invention are also within the scope of this invention.
The present invention provides recombinant expression constructs comprising
a nucleic acid encoding a mammalian biogenic amine receptor of the invention
wherein the construct is capable of expressing the encoded biogenic amine
receptor in
3o cultures of cells transformed with the construct. A preferred embodiment
of'such
constructs comprises a human biogenic amine receptor cDNA depicted in Figure 1
(SEQ ID No.: 1), such constructsbeing capable of expressing the human biogenic
amine receptor encoded therein in cells transformed with the construct.
Another
preferred embodiment of such constructs comprises a rat biogenic amine
receptor
to
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
cDNA depicted in Figure 2 (SEQ ID No.: 3), such constructs being capable of
expressing the rat biogenic amine receptor encoded therein in cells
transformed with
the construct.
The invention also provides prokaryotic and more preferably eulcaryotic cells
transformed with the recombinant expression constructs of the invention, each
such
cells being capable of and indeed expressing the mammalian biogenic amine
receptor
encoded in the transforming construct, as well as methods for preparing
mammalian
biogenic amine receptor proteins using said transformed cells.
The present invention also includes within its scope protein preparations of
to prokaryotic and eulcaryotic cell membranes containing the biogenic amine
receptor
protein of the invention, derived from cultures of prokaryotic or eulcaryotic
cells,
respectively, transformed with the recombinant expression constructs of the
invention.
The present invention also includes within its scope protein preparations of
prolcaryotic and eulcaryotic cytoplasmic fractions containing the biogenic
amine
receptor protein of the invention, derived from cultures of prolcaiyotic or
eulcaryotic
cells, respectively, transformed with the recombinant expression constructs of
the
invention.
The invention also provides methods for screening compounds for their ability
to inhibit, facilitate or modulate the biochemical activity of the mammalian
biogenic
2o amine receptor molecules of the invention, for use in the in vitro
screening of novel
agonist and antagonist compounds. In preferred embodiments, cells transformed
with
a recombinant expression construct of the invention are contacted with such a
compound, and the binding capacity of the compounds, as well as the effect of
the
compound on binding of other, known biogenic amine receptor agonists and
antagonists, is assayed. Additional preferred embodiments comprise
quantitative
analyses of such effects.
The present invention is also useful for the detection of analogues, agonists
or
antagonists, lrnown or unlrnown, of the mammalian biogenic amine receptors of
the
invention, either naturally occurring or embodied as a drug. In preferred
3o embodiments, such analogues, agonists or antagonists may be detected in
blood,
saliva, semen, cerebrospinal fluid, plasma, lymph, or any other bodily fluid.
The biogenic amine receptors of the present invention are directly activated
by
a wide variety of clinically and socially important drugs, including
amphetamines,
ergot derivatives, and adrenergic agents. Thus, the receptors of the invention
are
11
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
useful for developing alternative pharmaceutical agents having the beneficial
properties of these drugs without at least some of the deleterious effects,
for example a
propensity for addiction, as well as compounds that can inhibit or overcome
said
propensity for addition.
Specific preferred embodiments of the present invention will become evident
from the following more detailed description of certain preferred embodiments
and
the claims.
to DESCRIPTION OF THE DRAWINGS
Figure I illustrates the nucleotide (SEQ ID No.: I) and amino acid (SEQ ID
No.:2) sequences of a human trace amine receptor.
Figure 2 illustrates the nucleotide (SEQ ID No.: 3) and amino acid (SEQ ID
No.:4) sequences of a rat trace amine receptor.
Figure 3 presents_ deduced amino acid sequences for the rat and human trace
amine receptors aligned with other homologous G protein-coupled receptors.
Identities are outlined in black. Abbreviations are: rTAR, rat trace amine
receptor;
hTAR, human trace amine receptor; NTR, orphan NeuroTransmitter receptor;
orphan
GPCR57 and 58; D 1R, dopamine D1 receptor; B2aR, B2 adrenergic receptor;
SHT4c,
2o serotonin 5HT4C receptor. Arrowheads indicate positions designated as 5.42
and
5.43.
Figure 4 is a photograph of an autoradiogram of Northern analysis of total
cellular RNA (20~g/lane) from human HEK293 cells expressing the human biogenic
amine.receptor of the invention after transformation with a recombinant
expression
construct.
Figure SA is a photograph of an ethidium bromide-stained and ultraviolet light
irradiated agarose gel containing DNA fragments produced by RT-PCR of RNA from
rat brain tissues. The PCR products resolved on this gel are from the
following rat
brain regions, from which cDNA was synthesized from oligo(dT)-primed total
RNA:
lane 1, pituitary gland; lane 2, hindbrain; lane 3, midbrain; lane 4, locus
coeruleus;
lane 5, hypothalamus; lane 6, striatum; lane 7, olfactory bulb; lane 8,
olfactory
tubercle; lane 9, hippocampus; lane 10, cortex; lane 11, cerebellum; lane,12,
thalamus;
lane 13, 1:100 dilution of human trace amine plasmid DNA.
12
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
Figure SB is an autoradiogram of a nylon membrane containing DNA
fragments transferred from the agarose gel shown in Figure SA and probed with
32P-
labeled nucleic acid prepared from the coding sequence of the rat genomic
clone
encoding the rat trace amine receptor of the invention.
Figure 6 is a photograph of an autoradiogram of Northern analysis of RNA
from various rat cell lines expressing the rat trace amine receptor of the
invention after
transfection with a recombinant expression construct encoding the rat
receptor. RNA
shown in this gel was obtained from the following cell lines: lane 1, LBP;
lane 2, baby
hamster lcidney (BHK) cells; lane 3, rat insulinoma (RIMS) cells; lane 4,
AR42J rat
to pancreatic tumor cell line; lane 5, CHW cells; lane 6, GH4 rat pituitary
cells; lane 7,
GH3 rat pituitary cells; lane 8, AtT20 rat pituitary cells; lane 9, PC 12 rat
adrenal gland
cells; lane 10, SK-N-MC human neuroblastoma cells; lane 11, N4TG1 rat
neuroblastoma cells; lane 12, NB4 cells; lane 13, LCS cells; lane 14, R2C rat
Ledig
cells.
Figure 7 is a photograph of an autoradiogram of Northern analysis of mRNA
expressed in various cell lines expressing a mammalian biogenic amine receptor
ofthe
invention after transfection with a recombinant expression construct encoding
the rat
biogenic amine receptor.
Figure 8A is a photograph of an ethidium bromide-stained and ultraviolet light
irradiated agarose gel containing DNA fragments produced by RT-PCR ofRNA from
rat tissues. The PCR products resolved on this gel are from the following rat
tissues:
lane 1, liver, (oligo(dT) primed); lane 2, brain (dT); lane 3, spleen (dT);
lane 4, lung
(dT); lane 5, heart (dT); lane 6, testis (dT); lane 7, kidney (dT); lane 8,
intestine (dT);
lane 9, GOS-7 cell oligo(dT)-selected mRNA from cells transformed with the RC-
RSV/rat biogenie amine receptor construct of the invention; lane 10, striatum
(dT);
lane 11, midbrain (random primed; rp); lane 12, olfactory tubercle (rp); lane
13, cortex
(ip + dT); lane 14, midbrain (dT); lane 15, olfactory tubercle (rp); lane 16,
olfactory
bulb (dT); lane 17, hippocampus (dT); lane 18, midbrain (dT); lane 19,
thalamus (dT);
lane 20, striatum (dT); lane 21, olfactory bulb (dT); lane 22, water (negative
control).
3o Figure 8B is an autoradiogram of a nylon membrane containing DNA
fragments transferred from the agarose gel shown in Figure 8A and probed with
3zP-
labeled nucleic acid prepared from the full-length rat genomic clone encoding
the rat
trace amine receptor of the invention.
13
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
Figures 9A through 9D are photographs of fluorescence in. situ hybridization
analysis of human chromosomes probed with a fluorescently-labeled human
artificial
chromosome (BAC) containing the human biogenic amine receptor DNA (BAC
obtained from Research Genetics, Release IV of DNA pools, Catalog #96001;
clone
address: plate 278, Row D, Column 22). Figure 9E is a schematic diagr am of
human
chromosome 6 denoting the location of the human biogenic amine locus at
6q23.2.
Figures 10A is a graph showing the ability of various endogenous compounds
to stimulate the rat trace amine receptor heterologously expressed in HEK 293
cells in
a dose-dependent manner.
to Figure lOB is a graph showing the ability of various synthetic compounds to
stimulate the rat trace amine receptor heterologously expressed in HEK 293
cells in a
dose-dependent manner.
Figures 11A through 11 C .are photographs of immunohistochemical staining of
FiEK 293 cells expressing epitope-tagged rat trace amine receptor. M1 tagged
receptors were bound to anti-FLAG antibodies followed by Cy5 goat anti-mouse
IgG
in the absence (Figure 11A) or presence (Figure 11B) of 0.1% Triton X-100.
Control
cells shown in Figure 11C express dopamine D1 ,receptors and were stained with
antibodies, in the presence of Triton X-100.
Figures 12A through-12G are graphs showing assays of cAMP production in
2o HEK 293 cells stably transfected with the rat receptor of the invention.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
The terms "mammalian biogenic amine receptor" and "trace amine receptor"
as used herein refer to proteins consisting essentially of, and having
substantially the
same biological activity as, the protein encoded by the amino acid depicted in
Figure 1
(SEQ ID No.: 2) and Figure 2 (SEQ ID No.: 4). This definition is intended to
encompass natural allelic variations in the disclosed biogenic, trace amine
receptor.
Cloned nucleic acid provided by the present invention may encode trace amine
receptor protein of any species of origin, including, for example, mouse, rat,
rabbit,
cat, and human, but preferably the nucleic acid provided by the invention
encodes
trace amine receptors of mammalian, most preferably rat and human, origin.
The nucleic acids provided by the invention comprise DNA or RNA having a
nucleotide sequence encoding a mammalian trace amine receptor. Specific
14
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
embodiments of said nucleic acids are depicted in Figure 1 (SEQ ID No.: 1) or
Figure
2 (SEQ ID No.: 3), and include any nucleotide sequence encoding a mammalian
biogenic amine receptor having an amino acid sequence as depicted in Figure 1
(SEQ
ID No.: 2) or Figure 2 (SEQ ID No.: 4). Nucleic hybridization probes as
provided by
the invention comprise any portion of a nucleic acid of the invention
effective in
nucleic acid hybridization under stringency conditions sufficient for specific
hybridization. Mixtures of such nucleic acid hybridization probes are also
within the
scope of this embodiment of the invention. Nucleic acid probes as provided
herein are
useful for isolating mammalian species analogues of the specific embodiments
of the
1 o nucleic acids provided by the invention. Nucleic acid probes as provided
herein are
also useful for detecting mammalian trace amine receptor gene expression in
cells and
tissues using techniques well-known in the art, including but not limited to
Northern
blot hybridization, izz situ hybridization and Southern hybridization to
reverse
transcriptase - polymerase chain reaction product DNAs. The probes provided by
the
present invention, including oligonucleotides probes derived therefrom, are
also useful
for Southern hybridization of mammalian, preferably human, genomic DNA for
screening for restriction fragment length polymorphism (RFLP) associated with
certain genetic disorders.
The pr oduction of proteins such as mammalian biogenic amine receptors from
cloned genes by genetic engineering means is well known in this art. The
discussion
that follows is accordingly intended as an overview of this held, and is not
intended to
reflect the full state of the art.
Nucleic acid encoding a trace amine receptor may be obtained, in view of the
instant disclosure, by chemical synthesis, by screening reverse transcripts of
mRNA
from appropriate cells or cell line cultures, by screening genomic libraries
from
appropriate cells, or by combinations of these procedures, in accordance with
known
procedures as illustrated below. Additionally, sequences of such receptors can
be
obtained from any species in which the contentof the species genomic DNA has
been
determined and assembled in a database or other searchable compilation, using
search
3o programs lrnown in the art and the sequences of the trace amine receptors
disclosed
herein. Screening of mRNA or genomic DNA may be carried out with
oligonucleotide probes generated from the nucleic acid sequence information
from
mammalian trace amine receptor nucleic acid as disclosed herein. Probes may be
labeled with a detectable. group such as a fluorescent group, a radioactive
atom or a
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
chemiluminescent group in accordance with lrnown procedures and used in
conventional hybridization assays, as described in greater detail in the
Examples
below. In the alternative, mammalian biogenic amine receptor nucleic acid
sequences
may be obtained by use of the polymerase chain reaction (PCR) procedur e,
using PCR
oligonucleotide primers corresponding to nucleic acid sequence information
derived
from a biogenic amine receptor as provided herein. See U.S. Patent Nos.
4,683,195 to
Mullis et al. and 4,683,202 to Mullis.
Mammalian trace amine receptor protein may be synthesized in host cells
transformed with a recombinant expression construct comprising a nucleic acid
1o encoding said receptor and comprising genomic DNA or cDNA. Such recombinant
expression constructs can also be comprised of a vector that is a replicable
DNA
construct. Vectors are used herein either to amplify DNA encoding a trace
amine
receptor and/or to express DNA encoding a trace amine receptor gene. For the
purposes of this invention, a recombinant expression construct is a replicable
DNA .
construct in which a nucleic acid encoding a trace amine receptor is operably
linked to
suitable control sequences capable of effecting the expression of the receptor
in a
suitable host.
The need for such control sequences will vary depending upon the host
selected and the transformation method chosen. Generally, control sequences
include
a transcriptional promoter, an optional operator or enhancer sequence to
control
transcription, a sequence encoding suitable mRNA ribosomal binding sites, and
sequences that control the termination of tr anscription and translation.
Amplification
vectors do not require expression control domains. All that is needed is the
ability to
replicate in a host, usually conferred by an origin of replication, and a
selection gene
to facilitate recognition of transformants. See, Sambroolc et al., 1990,
Molecular
Cloning: A Laboratory Manual (Cold Spring Harbor Press: New Yorlc).
Vectors useful for practicing the present invention include plasmids, viruses
(including phage and W ammalian DNA and RNA viruses), retroviruses; and
integratable DNA fragments (i.e., fragments integratable into the host genome
by
3o homologous recombination). The vector can replicate the gene of interest
and
function independently of the host genome, or can, in some instances,
integrate into
the genome itself. Suitable vectors will contain replicon and control
sequences which
are derived from species compatible with the intended expression host. A
preferred
vector is RcRSV (obtained from Invitrogen, San Diego, CA). Another preferred
1G
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
vector is pcDNA3.1/VS/His-TOPO (Invitrogen, San Diego, CA). The
pcDNA3.1/VS/His-TOPO vector expresses a receptor preceded at its amino
terminus
by a cleavable 16 amino acid signal sequence of the influenza hemaglutinin
virus
immediately followed by the 8 amino acid M 1-Flag epitope and then a two amino
acid
linker (MetGly) just before the initiation methionine (Guar et al., 1992,
JBiol Chena,
267:21995-21998).
Transformed host cells are cells that have been transformed or transfected
with
recombinant expression constructs made using recombinant DNA techniques and
comprising nucleic acid encoding a trace amine receptor protein. Cultures of
cells
to derived from multicellular organisms are a desirable host for recombinant
biogenic
amine receptor protein synthesis. In principal, any higher eulcaryotic cell
culture is
useful, whether from vertebrate or invertebrate culture. However, mammalian
cells
are preferred, as illustrated in the Examples. Propagation of such cells in
cell culture
has become a routine procedure. See Tissue Culture, Academic Press, Kruse &
Patterson, editors (1973). Examples of useful host cell lines are human
embryonic
lcidney (HEK) 293 cells, VERO and HeLa cells, Chinese hamster ovary (CHO) cell
lines, mouse Ltlc cell lines and WI138, BHK, COS-7, CV, and MDCK cell lines.
Preferred host cells are HEK293 cells, COS-7 cells (Gluzman, 1981, Cell 23:
175-
182) and Ltlt cells. Transformed host cells may express the trace amine
receptor
protein, but host cells transformed for purposes of cloning or amplifying
nucleic acid
hybridization probe DNA need not express the receptor. The trace amine
receptor of
the invention can be located in the host cell cytosol. Accordingly, the
invention
provides preparations of cell cytosolic fractions comprising the trace amine
receptor
protein of the invention, as well as purified, homogeneous preparations of the
receptor
protein itself. See, Sambroolc et al., ibid. The receptor of the invention may
also be
located in membranes from the host cell. Therefore, the invention provides
preparations of said cell membranes comprising the trace amine receptor
protein of the
invention. See, Sambroolc et al., ibid.
The invention provides homogeneous compositions of mammalian trace amine
3o receptor protein produced by transformed eulcaryotic cells as provided
herein. Each
such homogeneous composition is intended to be comprised of a trace amine
receptor
protein that comprises at least 75%, more preferably at least 80%, and most
preferably
at least 90% of the protein in such a homogenous composition; in said
homogeneous
preparations, individual contaminating protein species are expected to
comprise less
17
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
than 5%, more preferably less than 2% and most preferably less than 1% of the
preparation. The invention also provides membrane and cytosolic preparations
from
cells expressing mammalian trace amine receptor protein as the result of
transformation with a recombinant expression construct, as described herein.
s Mammalian trace amine receptor pr oteins made from cloned genes in
accordance with
the present invention may be used for screening trace amine analogues, or
trace amine
receptor agonists or antagonists of trace amine binding, or for determining
the amount
of such agonists or antagonists are present in a solution of interest (e.g.,
blood plasma,
cerebrospinal fluid or serum). For example, host cells may be transformed with
a
1 o recombinant expression construct of the present invention, a mammalian
trace amine
receptor expressed in those host cells, and the cells, membranes or cytosolic
fractions
thereof used to screen compounds for their effect on trace amine receptor
agonist
binding activity. By selection of host cells that do not ordinarily express a
trace amine
receptor, pure preparations of membranes or cytosolic fractions containing the
15 receptor can be obtained. In a preferred embodiment, agonists (also
referred to herein
as stimulators) of the receptor of the present invention can be endogenous .
neurotransmitters or drugs. Neurotransmitters and drugs that activate the
receptor are
further described in the Examples section herein, and include p-tyramine,
phenylethylaW ine, tryptamine, octopamine, synephrine, dopamine, serotonin, na-
20 tyramine, . amphetamines, methamphetamines, MDMA, p-chloroamphetamine,
betahistine, 1-phenylpiporazine, phemylephritie, apomorphine, metergoline, and
ergot
allcaloids. Agoiiists. fo'r the, trace 'amiye receptor include, bLlt are not
limited to (3-
phenethylamine (PEA), hordenine , L-tyrosinol, S,R-amphetamine (+ and. ), 4-OH-
R(-)-amphetamine, rizethamphetamine (+ and -), (~~DOI, phenelzine,
tranylcypromine,
25 3,4-DiMeO-PEA>Mescaliue, (~)MDMA, 3,4-dihydroxybenzylguanidine, 3-
phenylpropylamine; 1; methyl-3'=phenylpropylamine, N,N-dimethylpropiophenone,
N-
phenylethylenediamine, ' lcyriuramine, 4-phenylbutylamine, tryptamine, 2-
thiopheneethylamine, betahistine, 2>4>3-pyridylethylamine, 1-phenylpiperazine;
1-
(1-napthyl)piperazine, 1;2,3,4-tetrahydroisoquinoline, (~)salsolinol,
hydrocotarnine,
30 nomifensine, R(-)apomorphine, S(+)2-aminotetralin, R(-)2-aminotetralin,
(~)2-amino-
1,2-dihydronapthalene, (~)3A6HC, (~)2-aminoindan, MPTP, 4-phenyl-1,2,3,6-
tetrahydropyridine, tolazoline, naphazoline, phentolamine, agroclavine,
bromocriptine, lisuride, d-LSD, metergoline, (~)fenfluramine, fenspiride, 2-
phenyl-2-
imidazoline, methylphenidate, pargyline, 2,2-diphenylethylamine, trans-
cinnamyl-
18
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
piperazine, 1-benzyl-piperidine, rimantidine, tripelennamine, tryptamine/5-Me0-
DMT, forslcolin, amphetamine/phentermine, cyproheptadine, dopamine,
dihydroergotamine, fenoterol, HVA:D1 receptor, imidazoline/naphazoline,
imidazoline/oxymetazoline, imidazoline/phentolamine, imidazoline/tolazoline,
isoproterenol, metanephrine DL, methamphetamine/2-MeO, octopamine, PEA/2-
amino 4-OH, PEA/3,4 dimethoxy, 4-OH-PEA/3-MeO, 4-amino-PEA, 4-methoxy-
PEA, AEBSF-PEA, phenylephrine, piperazine/mCPP, piperazine/TFMPP,
phenylpiperazine, prenylamine, 2-(2aminoethyl)pyradine, 3-
(2aminoethyl)pyradine, 4-
(2aminoethyl)pyradine, ritodrine, synephrine, tetralin/ADTN/6,7, 5-Fluoro-
l0 tryptamine, N,N-dimethyl-tryptamine, tryptophanol (~), m-tyramine, p-
tyramine, and
most preferably 3-hyrdoxytyramine. Antagonists of the trace amine r eceptor
include,
but are not limited to phenylalanine, (~)N-ethylamphetamine, propylhexedrine,
fenfluramine, deprenyl, norepinephrine, epinephrine, N,N,N-trimethyldopamine,
dopamine-guanidine, dimethylsulfonium-DA, benzylamine, pargyline, tryptophan,
5-
carbooxamidotyptamine, histamine, 2-(2aminoethyl)1,3-dioxolane, iproniazid,
isoniazid, l,l-dimethyl-4-phenylpiperazinium,, trans-1-cinnamylpiperazine, 1-
(4Acetophenone)piperazine, quipazine, SH-I-101, PAPP (LY165,163), 4-OH,4-
phenylpiperidine, HA-1, HA-2, HA-3, HA-4, HA-5, prazosin, 4-phenylpyrimidine,
hydrastinine, boldine, (+)butaclamol, 3-aminocoumarin, MPP+, clonidine~
methysergide, aminorex, norapomorphine, N-butyl-amphetamine, benztropine, cis-
fluphenthixol, diphenylpyraline, flunarizine, fluspirilene, GBR 12909, GBR
12935,
LY (741, 626), nicardipine, reserpine, ritanserin, spiperone, thioridazine,
and
trifluoperazine.
A compound identified in a screen may be useful for treating various
conditions associated with effects of unregulated trace amine activity as a
result of
endogenous or exogenous stimulation. , The present invention provides a
pharmaceutical composition comprising the compound in admixture with a
pharmaceutically acceptable carrier. In a preferred embodiment, a
therapeutically
effective amount of the pharmaceutical composition is administered to a
patient with a
3o condition associated with unregulated trace amine activity. For example,
the
pharmaceutical composition of the present invention can be used to reduce
sympathomimetic effects of enhanced trace amine transmission induced by
elevated
levels of trace amines or certain drugs. Common sympathomimetic effects
include
rapid heart rate, high blood pressure, agitation, cardiac arrythmia, seizures,
and coma.
19
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
The pharmaceutical composition can also be used to treat peripheral effects of
drugs,
such as amphetamine. For example, the pharmaceutical composition of the
present
invention can be used to treat hyperthermia caused by amphetamine action. Some
conditions that can be treated using a pharmaceutical composition of the
present
invention are pathological, such as schizophrenia, depression, etc. In
addition, the
pharmaceutical composition of the present invention can be used to treat drug
addiction in a mammal, preferably a human.
Pharmaceutical compositions of the present invention can be manufactured in
a manner that is itself known, e.g., by means of a conventional mixing,
dissolving,
l0 granulating, dragee-malting, levigating, emulsifying, encapsulating,
entrapping or
lyophilizing processes.
Pharmaceutical compositions of the compounds of the present invention can be
formulated and administered through a variety of means, including systemic,
localized, or topical administration. Techniques for formulation and
administration
can be found in "Remington's Pharmaceutical Sciences," Maclc Publishing Co.,
Easton, PA. Pharmaceutical compositions for use in accordance with the present
invention thus can be formulated in conventional manner using one or more
physiologically acceptable carriers comprising excipients and auxiliaries that
facilitate
processing of the active compounds into preparations that can be used
pharmaceutically. Proper formulation is dependent upon the route of
administration
chosen.
Non-toxic pharmaceutical salts include salts of acids such as hydrochloric,
phosphoric, hydrobromic, sulfuric, sulfinic, formic, toluenesulfonic,
methanesulfonic,
nitic, benzoic, citric, tartaric, malefic, hydroiodic, allcanoic such as
acetic, HOOC-
(CHI)"-CHI where n is 0-4, and the like. Non-toxic pharmaceutical base
addition salts
include salts of bases such as sodium, potassium, calcium, ammonium, and the
like. ,
Those slcilled in the art will recognize a wide variety of non-toxic
pharmaceutically
acceptable addition salts.
For injection, the compounds of the invention can be formulated in appropriate
3o aqueous solutions, such as physiologically compatible buffers such as
Hanlcs's
solution, Ringer's solution, or physiological saline buffer. For transmucosal
and
transcutaneous administration, penetrants appropriate to the barrier to be
permeated
are used in the formulation. Such penetrants are generally known in the art.
For oral administration, the compounds can be formulated readily by
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
combining the active compounds with pharmaceutically acceptable carriers well
lrnown in the art. Such carriers enable the compounds of the invention to be
formulated as tablets, pills, dragees, capsules, liquids, gels, syrups,
slurries,
suspensions and the lilce, for oral ingestion by a patient to be treated.
Pharmaceutical
preparations for oral use can be obtained with solid excipient, optionally
grinding a
resulting mixture, and processing the mixture of granules, after adding
suitable
auxiliaries, if desired, to obtain tablets or dragee cores. Suitable
excipients are, in
particular, fillers such as sugars, including lactose, sucrose, mannitol, or
sorbitol;
cellulose preparations such as, for example, maize starch, wheat starch, rice
starch,
potato starch, gelatin, gum tragacanth, methyl cellulose,
hydroxypropylmethylcellulose, sodium carboxymethylcellulose, and/or
polyvinylpyrrolidone (PVP). If desired, disintegrating agents can be added,
such as
the cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt
thereof such as
sodium alginate.
Dragee cores are provided with suitable coatings. For this purpose,
concentrated sugar solutions can be used, which can optionally contain gum
arabic,
talc, polyvinyl pyn olidone, carbopol gel, polyethylene glycol, andlor
titanium dioxide,
lacquer solutions, and suitable organic solvents or solvent mixtures.
Dyestuffs or
pigments can be added to the tablets or dragee coatings for identification or
to
characterize different combinations of active compound doses.
Pharmaceutical preparations that can be used orally include push-fit capsules
made of gelatin, as well as soft, sealed capsules made of gelatin and a
plasticizer, such
as glycerol or sorbitol. The push-fit capsules can contain the active
compounds in
admixture with filler such as lactose, binders such as starches, and/or
lubricants such
as talc or magnesium stearate and, optionally, stabilizers. In soft capsules,
the active
compounds can be dissolved or suspended in suitable liquids, such as fatty
oils, liquid
paraffin, or liquid polyethylene glycols. In addition, stabilizers can be
added. All
formulations for oral administration should be in dosages suitable for such
administration. For buccal administration, the compositions can take the form
of
3o tablets or lozenges formulated in conventional manner.
For administration by inhalation, the active compounds for use according to
the present invention are conveniently delivered in the form of an aerosol
spray
presentation from pressurized packs or a nebuliser, with the use of a suitable
propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane,
21
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case
of a
pressurized aerosol the dosage unit can be determined by providing a valve to
deliver
a metered amount. Capsules and cartridges of e.g., gelatin for use in an
inhaler or
insufflator can be formulated containing a powder mix of the active compound
and a
suitable powder base 'such as lactose or starch.
The active compounds can be formulated for parenteral administration by
injection, e.g., by bolus injection or continuous infusion. Formulations for
injection
can be presented in unit dosage form, e.g., in ampoules or in multi-dose
containers,
with an added preservative. The compositions can take such forms as
suspensions,
1 o solutions or emulsions in oily or aqueous vehicles, and can contain
formulatory agents
such as suspending, stabilizing andlor dispersing agents.
Pharmaceutical formulations for parenteral administration include aqueous
solutions of the active compounds in water-soluble form. Additionally,
suspensions
of the active compounds can be prepared as appropriate oily injection
suspensions.
1s Suitable lipophilic solvents or vehicles include fatty oils such as sesame
oil, or
synthetic fatty acid esters, such as ethyl oleate or triglycerides, or
liposomes. Aqueous
injection suspensions can contain substances that increase the viscosity of
the
suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran.
Optionally,
the suspension can also contain suitable stabilizers or agents that increase
the
2o solubility of the compounds to allow for the preparation of highly
concentrated
solutions. Alternatively, the active compounds can be in powder form for
constitution
with a suitable vehicle, e.g., sterile pyrogen-free water, before use. The
active
compounds can also be formulated in rectal compositions such as suppositories
or
retention enemas, e.g., containing conventional suppository bases such as
cocoa butter
25 or other glycerides.
In addition to the formulations described previously, the active compounds can
also be formulated as a depot preparation. Such long acting, formulations can
be
administered by implantation (for example subcutaneously or intramuscularly)
or by
intramuscular injection. Tlius, for example, the active compounds can be
formulated
3o with suitable polymeric or hydrophobic materials (for example as an
emulsion in an
acceptable oil) or ion exchange resins, or as sparingly soluble derivatives,
for
example, as a sparingly soluble salt.
The pharmaceutical compositions also can comprise suitable solid or gelphase
carriers°or excipients. Examples of such carriers or excipients include
but are not
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
limited to calcium carbonate, calcium phosphate, various sugars, starches,
cellulose
derivatives, gelatin, and polymers such as polyethylene glycols.
The active compounds of the invention can be provided as salts with
pharmaceutically compatible counterions. Pharmaceutically compatible salts can
be
fomned with many acids, including but not limited to hydrochloric, sulfuric,
acetic,
lactic, tartaric, malic, succinic, phosphoric, hydrobromic, sulfinic, formic,
toluenesulfonic, methanesulfonic, nitic, benzoic, citric, tartaric, malefic,
hydroiodic,
allcanoic such as acetic, HOOC-(CHZ)"-CH3 where n is 0-4, and the like. Salts
tend to
be more soluble in aqueous or other protonic solvents that are the
corresponding free
1 o base forms. Non-toxic pharmaceutical base addition salts include salts of
bases such
as sodium, potassium, calcium, ammonium, and the like. Those skilled in the
art will
recognize a wide variety of non-toxic pharmaceutically acceptable addition
salts.
The mode of administration can be selected to maximize delivery to a desired
target site in the body. Suitable routes of administration can, for example,
include
oral, rectal, transmucosal, transcutaneous, or intestinal administration;
parenteral
delivery, including intramuscular, subcutaneous, intramedullary injections, as
well as
intrathecal, direct intraventricular, intravenous, intraperitoneal,
intrariasal, or
intraocular injections. Alternatively, one can administer the compound in a
local
rather than systemic manner, for example, via injection of the compound
directly into
2o a specific tissue, often in a depot or sustained release formulation.
Pharmaceutical compositions suitable for use in the present invention include
compositions wherein the active ingredients are contained in an effective
amount to
achieve its intended purpose. More specifically, a therapeutically effective
amount
means an amount effective to prevent development of or to alleviate the
existing
symptoms of the subject being treated. Determination of the effective amounts
is well
within the capability of those slcilled in the art, .especially in light of
the detailed
disclosure provided herein. '
For any compound used in the method of the invention, the therapeutically .
effective dose can be estimated initially from cell culture assays, as
disclosed herein.
For example, a dose can be formulated in 'animal models to achieve a
circulating
concentration range that includes the EC50 (effective dose for 50% increase)
as
determined in cell culture, i. e.', the concentration of the test compound
which achieves
a half maximal inhibition of tumor cell growth in vitro. 'Such information can
be used
to more accurately determine useful doses in humans.
23 ,
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
It will be understood, however, that the specific dose level for any
particular
patient will depend upon a variety of factors including the activity of the
specific
compound employed, the age, body weight, general health, sex, diet, time of
administration, route of administration, and rate of excretion, drug
combination, the
severity of the particular disease undergoing therapy and the judgment of the
prescribing physician.
For administration to non-human animals, the drug or a pharmaceutical
composition containing the drug may also be added to the animal feed or
drinking
water. It will be convenient to formulate animal feed and drinking water
products
1o with a predetermined dose of the drug so that the animal takes in an
appropriate
quantity of the drug along with its diet. It will also be convenient to add a
premix
containing the drug to the feed or drinking water approximately immediately
prior to
consumption by the animal.
Toxicity and therapeutic efficacy of such compounds can be determined by
standard pharmaceutical procedures in cell cultures or experimental animals,
e.g., for
determining the LD5,0 (the dose lethal to 50% of the population) and the ED50
(the
dose therapeutically effective in 50% of the population). The dose ratio
between toxic
and therapeutic effects is the therapeutic index and it can be expressed as
the ratio
between LD50 and ED50. Compounds that exhibit high therapeutic indices are
2o preferred. The data obtained from these cell culture assays and animal
studies can be
used in formulating a range of dosage for use in humans. The dosage of, such
compounds lies preferably within a range of circulating concentrations that
include the
ED50 with little or no toxicity. The dosage can vary within this range
depending upon
the dosage form employed and the route of administration utilized. The exact
formulation, route of administration and dosage can be chosen by the
individual
physician in view of the patient's condition. (See, e.g. Fingl et czl., 1975,
in "The
Pharmacological Basis of Therapeutics", Ch.l, p.1).
The recombinant expression constructs of the present invention are useful in
molecular biology to transform cells that do not ordinarily express a trace
amine
3o receptor to thereafter express this receptor. Such cells are useful as
intermediates for
malting cell membrane or cytosolic preparations useful for receptor binding
activity
assays, which are in turn useful for drug screening. The recombinant
expression
constructs of the present invention thus provide a method for screening
potentially
useful drugs at advantageously lower cost than conventional animal screening
24
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
protocols. While not completely eliminating the need for ultimate iu vivo
activity and
toxicology assays, the constructs and cultures of the invention provide an
important
first screening step for the vast number of potentially useful drugs
synthesized,
discovered or extracted from natural sources each year.
The recombinant expression constructs of the present invention are useful in
molecular biology to detect, isolate, characterize and identify novel
endogenous trace
amine receptor agonists and antagonists found in plasma, serum, lymph,
cerebrospinal
fluid, seminal fluid, or other potential sources of such compounds. This
utility thereby
enables rational drug design of novel therapeutically-active drugs using
currently-
to available techniques (see Walters, "Computer-Assisted Modeling of Drugs",
isa
Klegennan & Groves, eds., 1993, Pharmaceutical Biotechnolo~y, Interpharm
Press:
Buffalo Grove,.IL,, pp. 165-174).
The recombinant expression constructs of the present invention may also be
useful in gene therapy. Cloned genes of the present invention, or fragments
thereof,
may also be used in gene therapy carried out homologous recombination or site-
directed mutagenesis. See generally Thomas & Capecchi, 1987, Cell 51: 503-512;
Bertling, 1987, Bioscience Reports 7: 107-112; Smithies et al.; 1985, Nature
317:
230-234.
Nucleic acid and oligonucleotide probes as provided by the present invention
2o are useful as diagnostic tools for probing trace amine receptor gene
expression in
tissues of humans and other animals. For example, tissues are probed ira situ
with
oligonucleotide probes carrying detectable groups by conventional
autoradiographic
or other detection techniques, to investigate native expression of this
receptor or
pathological conditions relating thereto. Further, chromosomes can be probed
to
investigate the presence or absence of the corresponding trace amine receptor
gene,
and potential pathological conditions related thereto.
The invention also provides antibodies that are immunologically reactive to
the
trace amine receptor protein or epitopes thereof provided by the invention.
The
antibodies provided by the invention may be raised, using methods well lrnown
in the
art, in animals by inoculation with cells that express a trace amine receptor
or epitopes
thereof, cell membranes from such cells, whether crude membrane preparations
or
membranes purified using methods well known in the art, cytosolic
preparations, or
purified preparations of proteins, including fusion proteins, particularly
fusion
proteins comprising epitopes of the trace amine receptor protein of the
invention fused
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
to heterologous proteins and expressed using genetic engineering means in
bacterial,
yeast or eulcaryotic cells, said proteins being isolated from such cells to
varying
degrees of homogeneity using conventional biochemical methods. Synthetic
peptides
made using established synthetic methods in vitf~o and optionally conjugated
with
heterologous sequences of amino acids, are also encompassed in these methods
to
produce the antibodies of the invention. Animals that are useful for such
inoculations
include individuals from species comprising cows, sheep, pigs, chiclcens,
mice, rats,
rabbits, hamsters, goats and primates. Preferred animals for inoculation are
rodents
(including mice, rats, hamsters) and rabbits. The most preferred animal is the
mouse.
Cells that can be used for such inoculations, or for any of the other means
used
in the invention, include any cell line which naturally expresses the trace
amine
receptor provided by the invention, or more preferably any cell or cell line
that
expresses the trace amine receptor of the invention, or any epitope thereof,
as a result
of molecular or genetic engineering, or that has been treated to increase the
expression
of an endogenous or heterologous trace amine receptor protein . by physical,
biochemical or genetic means. Preferred cells are mammalian cells, most
preferably
cells syngeneic with a rodent, most preferably a mouse host, that have been
transformed with a recombinant expression construct ofthe invention encoding a
trace
amine receptor protein, and that express the receptor therefrom.
The present invention also provides monoclonal antibodies that are
immunologically reactive with an epitope derived from a trace amine receptor
of the
invention, or fragment thereof, present on the surface of such cells. Such
antibodies
are made using methods and techniques well known to those of slcill in the
art.
Monoclonal antibodies provided by the present invention are produced by
hybridoma
cell lines, that are also provided by the invention and that are made by
methods well
lcnown in the art.
Hybridoma cell lines are made by fusing individual cells of a myeloma cell
line with spleen cells derived from animals immunized with cells expressing a
trace
amine receptor of the invention, as described above. The myeloma cell lines
used in
3o the invention include lines derived from myelomas of mice, rats, hamsters,
primates
and humans. Preferred myeloma cell lines are from mouse, and the most
preferred
mouse myeloma cell line is P3X63-Ag8.653. The animals from which spleens are
obtained after immunization are rats, mice and hamsters, preferably mice, most
preferably Balb/c mice. Spleen cells and myeloma cells are fused using a
number of
2G
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
methods well lrnown in the art, including but not limited to incubation with
inactivated
Sendai virus and incubation in the presence of polyethylene glycol (PEG). The
most
preferred method for cell fusion is incubation in the presence of a solution
of 45%
(w/v) PEG-1450. Monoclonal antibodies produced by hybridoma cell lines can be
s harvested from cell culture supernatant fluids :from in vitro cell growth;
alternatively,
hybridoma cells can be inj ected subcutaneously and/or into the peritoneal
cavity of an
animal, most preferably a mouse, and the monoclonal antibodies obtained from
blood
and/or ascites fluid.
Monoclonal antibodies provided by the.present invention are also produced by
1o recombinant genetic methods well lrnown to those of skill in the art, and
the present
invention encompasses antibodies made by such methods that are immunologically
reactive with an epitope of a trace amine receptor of the invention. , The
present
invention also encompasses fragments, including but not limited to Flab) and
F(ab)~Z
fragments, of such antibody. Fragments are produced by any number of methods,
1 s including but not limited to proteolytic; or chemical cleavage, chemical
synthesis or
preparation of such fragments by means of genetic engineering technology. The
present invention also encompasses single-chain antibodies that are
immunologically
reactive with an epitope of a trace amine receptor; made by methods known to
those
of skill in the art.
20 The present invention also encompasses an epitope of a trace amine receptor
of
the invention, comprised of sequences and/or a conformation of sequences
present in
the receptor molecule. This epitope may be naturally occurring, or may be the
result .
of chemical or proteolytic cleavage of a receptor molecule and isolation of an
epitope-
containing peptide or may be obtained by chemical or isi vitro synthesis of an
epitope-
25 containing peptide using methods well lrnown to those skilled in the art.
The present,
invention also encompasses epitope peptides produced as a result of genetic
engineering technology and synthesized by genetically engineered prokaryotic
or
eulcaryotic cells.
The invention also includes chimeric antibodies, comprised of light chain and
30 heavy chain peptides immunologically reactive to a biogenic amine receptor-
derived
epitope. The chimeric antibodies embodied in the present invention include
those that
are derived from naturally occurring antibodies as well as chimeric antibodies
made
by means of genetic engineering technology well known to those of skill in the
art.
27
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
The Examples that follow are illustrative of specific embodiments of the
invention, and various uses thereof. They set forth for explanatory purposes
only, and
are not to be taken as limiting the invention.
EXAMPLE 1
Isolation of a Mammalian Biogenic Amine Receptor Probe by Random
PCR Amplification of Rat Insulinoma cDNA Using
Degenerate Oligonucleotide Primers
In order to clone novel mammalian G-protein coupled receptors, cDNA
prepared from total cellular RNA obtained from a rat pancreatic tumor cell
line AR42J
(ATCC Accession No. CRL-1492) was used as template for a polymerase chain
reaction (PCR)-based random cloning experiment. PCR was performed using a pair
of degenerate oligonucleotide primers corresponding to a consensus sequence of
the
third and sixth tr ansmembrane regions of known G-coupled receptors. PCR
products
obtained in this experiment were characterized by nucleotide sequencing. A
full
length clone was obtained by screening a rat genomic library using a cloned
PCR
product encoding a novel G-protein coupled receptor as deduced by nucleotide
sequencing and comparison with a sequence database (GenBanlc).
The PCR amplification experiments were performed as follows. Total RNA
2o was isolated from AR42J cells by the guanidinium thiocyanate method
(Chirgwin et
al., 1979, Biochemistry 18: 5294-5299). First-strand cDNA was prepared from
this
RNA using- standard techniques (see Sambrook et al., 1990, Molecular Cloning:
A
Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor Laboratory,
N.Y.)
using murine reverse transcriptase (BRL, Gaithersburg, MD) and oligo-dT
priming
(Sambroolc et al., ibid.). The rat cDNA preparation was then subjected to 35
cycles of
PCR amplification using 500 picomoles of degenerate oligonucleotide primers
having
the following sequence:
Primer III (sense):
GAGTCGACCTGTG(C/T)G(C/T)(C/G)AT(C/T)(A/G)CIIT(G/T)GAC(C/A)G(C/G)T
3o AC
(SEQ ID NO: 5)
and
Primer VI (antisense):
CAGAATTCAG(T/A)AGGGCAICCAGCAGAI(G/C)(G/A)(T/C)GAA
(SEQ 1D NO: G)
28
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
in 30 ~L of a solution containing 50 mM Tris-HGl (pH 8.3), 2.5 mM MgCl2, 0.01%
gelatin, 250 ~M each dNTP, and 2.5 units of Taq polymerase (Sailci et al.,
1988,
Science 239: 487-491). Each PCR amplification cycle consisted of incubations
at
94°C for 90 sec (denaturation), 50°C for 90 sec (annealing), and
72°C for 120 sec
(extension) for 35 dycles.
Amplified products of the PCR reaction were separated on a 1.0% agarose gel
(see Sambroolc et al., ibid.), and fragments ranging in size from 400
basepairs (bps) to
750 by were subcloned in the plasmid vector pBluescript (Stratagene, LaJolla,
CA).
1 o Plasmid DNA from these clones was purified and the nucleotide sequence of
the insert
cDNA determined by the dideoxynucleotide chain termination method (Sanger et
al.,
1977, Proc. Natl. Acad. Sci. USA 74: 5463-5467) using Sequenase~ (U.S.
Biochemical Corp., Cleveland, OH). PCR products were identified by screening
the
GenBanlc database and identified a cloned fragment having a high degr ee of
homology
. to known biogenic amine receptors, as well as containing sequence motifs
that are
common to the G-protein coupled family of receptors, but that was not
identical to any
previously-identified biogenic amine receptor sequence.
EXAMPLE 2
20. Isolation of a Novel Mammalian Trace Amine Receptor cDNA
The cloned PCR product obtained in Example 1 was used to isolate a full-
length clone from a rat genomic DNA library (obtained from Clonetech, Palo
Alto,
CA) as follows.
The 0.4 kb DNA fragment generated by PCR having high homology to known
biogenic amine receptors was 32P-labeled using the random priming technique
(Stratagene, San Diego CA). This probe was used to screen a rat genomic
library that
had been transferred to nylon membranes (Gene Screen Plus, NEN, Boston MA).
Hybridization was performed in 50% formamide, 5X SSC, 1% SDS, 5X Denhardt'
solution, and salmon sperm DNA (50 ~g/mL) with the radioactive probe at 2x10
3o cpm/mL at 37°C for overnight. The nylon filters were then washed as
follows: at
room temperature in a solution of 2X SSC/ 0.1% SDS for 10 minutes, followed by
a
wash at 55°C in a solution of 2X SSC/ 0.1% SDS for 15 minutes, and
finally a wash at
55°C in a solution of 0.5X SSC/ 0.1% SDS for 5 minutes. Filters were
then exposed
to XOMAT X-ray film (I~odalc) overnight. Filter hybridization was performed in
29
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
duplicate to confine positive signals. Secondary and tertiary screens were
performed
until single homogenous clones were isolated.
This isolated genomic clone was then subjected to nucleotide sequence
analysis. Nucleotide sequence analysis was performed essentially as described
in
Example l, and revealed the sequence of the rat biogenic amine receptor shown
in
Figure 2 (SEQ ID No.: 3). The putative protein product of the gene is also
shown in
Figure 2 (SEQ ID No: 4). The sequence was found to have an open reading frame
comprising 996 nucleotides encoding a protein 332 amino acids in length, and
having
a predicted molecular weight of about 381cD lcilodaltons prior to post-
translational
modification. The sequence immediately 5' to the proposed initiation codon was
found to contain several translation termination codons in-frame with the open
reading
frame, supporting the assignment of the translation start site. Predicted
transmembrane domains ,(using the algorithm of Eisenberg et al. (1984, J.
Molec.
Biol. 179: 125-142)) are boxed and identified by Roman numerals (I-VII), and
two
sites of possible N-linlced glycosylation are identified in the amino-terminal
portion of
the protein with solid triangles. A potential protein lcinase C site was also
found in the
C-terminal tail.
The predicted amino acid sequences of the transmembrane domains of the
novel biogenic amine receptor were compared with the corresponding sequences
in
the orphan NeuroTransmitter receptor, orphan GPCR57 and 5 8, human dopamine D
1
receptor, B2~ adrenergic receptor, and serotonin SHT4C receptor; the results
of these
comparisons are shown in Figure 3: Amino acid residues that are found in
common
between the different mammalian biogenic amine receptors are outlined in
black. The
predicted amino acid sequences of the transmembrane domains were also compared
with corresponding sequences in human D 1 dopamine receptor, human D2 dopamine
receptor, rat serotonin =lc receptor, rat al-b adrenergic receptor, rat
serotonin 4
receptor, rat serotonin. la~receptor, human a-2 adrenergic receptor, and human
H-2
histamine receptor (Probst et al., 1992, DNA Cell Biology 11: 1-20). A more
detailed
comparison of these amino acid sequences are quantified in Table I, showing
the
3o percentage extent of homology in pairwise fashion between the different
biogenic
amine receptors.
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
TABLE I
Receptor % Identity
human D 1 dopamine 40
human D2 dopamine 37
rat al-b adrenergic37
rat serotonin lc 35
rat a1 adrenergic 35
rat serotonin 4 35
rat serotonin la 34
human a2 adrenergic33
human H-2 histamine33
Comparisons are made individually at each transmembrane domain (TMI-
TMVII), as an average over all transmembrane domains (TM avg) and as the
average
degree of amino acid sequence homology for each protein as a whole (avg/all).
These
results support the conclusion that the novel mammalian receptor disclosed
herein is a
biogenic amine receptor. In addition, the certain amino acid residues in other
G-'
protein coupled receptors (such as Asp'°3 in TM III) were also found in
the novel
cloned receptor described herein. These data are consistent with the fact that
the
l0 biogenic amine receptors have a significantly higher homology to the novel
receptor
disclosed herein that' any other members of the G-protein coupled receptor
family.
The sequence DRY (amino acids 120-123 in the human sequence and amino acids
119-122 in the rat sequence) is conserved in the majority of G-protein coupled
receptors. Expression of this receptor in a rat insulinoma 'suggests that
biogenic
amines may play a role in pancreatic cell function.
The Asp in TMIII is thought to be a counterion to the positively charged amino
group present in biogenic amines. In addition, the deduced amino acid sequence
predicts a Ser in TMV, which would be able to form a hydrogen bond with the
para-
hydroxyl group of molecules such as the dopamine, norepinephrine, and
epinephrine,
31
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
as well as the trace amines para-tyramine, octopamine, and synephrine. One Ser
was
found in the receptor compared with the adrenergic and dopamine receptors,
which
contain an additional one or two Ser residues N-terniinal to the
"SerPheTyrXaaPro"
(where "Xaa" is any residue) motif in TMV. However, an additional Thr is found
directly N-terminal to the Ser that might hydrogen bond with ligands. In TMIV,
there
is a Trp that is found in the rhodopsin family of G-protein coupled receptors.
Distal
and two residues proximal to this Trp, the receptor displays significant
homology to
members of the biogenic amine receptor family. In the C-terminal portion
of,the
deduced TMIV sequence there is a Pro residue G amino acids N-terminal of the
1 o generally conserved Pro residue found in TMIV of biogenie amine receptors.
Also,
the two Ser residues in TMIV that are conserved among GPCRs activated by
biogenic
amines are not present in the novel receptor of the invention.
These results support the conclusion that the novel G-protein coupled receptor
genes of the invention are biogenic amine receptors.
EXAMPLE 3
Construction of a Recombinant Expression Constructs, DNA Transfection
and Functional Expression of the Novel Mammalian Biogenic Amine Receptor
W order to biochemically characterize the novel mammalian (rat) biogenic
amine receptor described in Example 2, and to confirm that it encodes a novel
biogenic amine receptor, the rat cDNA was cloned into a mammalian expression
construct (pRcRSVneo, obtained from Invitrogen, San Diego, CA), the resulting
recombinant expression constl-uct transfected into COS-7 cells (for transient
expression assays) and human embryonic lcidney cells (HEK293) for stable
expression
assays, and cell membranes (COS-7) or cell lines (HEK293) were generated that
expressed the receptor protein in cellular membranes at the cell surface. Such
cells
and membranes isolated from such cells were used for biochemical
characterization
3o experiments described below.
The entire coding region of the receptor DNA insert was amplified using PCR
as described above with primers specific for flanlcing sequences; such PCR
primers
advantageously contained restriction enzyme digestion recognition sites at the
5'
termini such that digestion with said restriction enzymes allowed facile
cloning of the
receptor cDNA into the RcRSVneo mammalian expression construct. PCR products
generated in this way were subcloned in to the RcRSV vector using conventional
32
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
techniques (see Sambroolc et al., ibid.) and the orientation of the inserted
cDNA
confirnzed by restriction enzyme digestion analysis of insert-containing
subclones.
Such recombinant expression constructs were introduced into COS-7 cells using
the
calcium-phosphate precipitation technique (Chen & Olcayama, 1987, Molec. Cell.
Biol. 7: 2745-2752), the transfected cells allowed to express the receptor for
between
24-96 hours, and then cell membranes containing the receptor were isolated.
Such
membranes were harvested fiom cells grown on l5cm plates by pelleting the
cells at
20,000 rpm in a solution of 50mM Tris-HCl (pH 7.4). The protein concentration
was
adjusted to 15-80 ~g/sample for each of the binding studies described below.
to These recombinant expression constructs were also introduced into HEK293
cells using the calcium-phosphate precipitation technique, and stably-
transfected
clones were selected by growth in the mammalian neomycin analog 6418 (Grand
Island Biological Co., Long Island, NY), as the vector RcRSV contains a
functional
copy of a bacterial neomycin resistance gene. Stable cell lines were then
selected for
membrane binding studies based on mRNA expression levels of individual
neomycin-
resistant transfected clones determined by Northern analysis (see Sambrook et
al.,
ibid.). Cell membranes were prepared and used as described above for COS-7
cell
transfectants.
Expression of the biogenic amine receptor gene in transfected cells was
2o verified by Northern blot analysis of individual transfectants, performed
using
conventional techniques. Total cellular was extracted from transfected cells
using and
RNA Easy lcit (obtained from Qiagen, Valencia, CA). For Northern
hybridization,10
~g of total cellular RNA was subjected to electrophoresis in a 1.2% agarose
gel using
HEPES/ EDTA buffer (pH 7.8) overnight. The electrophoresed RNA was then
transferred to a GeneScreen Plus membrane (New England Nuclear, Boston, MA) by
capillary transfer, and fixed to the membrane by balcing at 85°C for
1h. The
membrane was then prehybridized overnight at 37°C in the following
buffer: 50%
formamide, 1% sodium dodecyl sulfate (SDS), SX SSC (where 1X SSC is O.15M
NaCl/ O.O15M sodium citrate, pH 7), SO~g/mL denatured salmon sperm DNA, and SX
3o P-buffer (comprising 0.25M Tris, pH 7.5, 0.5% sodium pyrophosphate, 0.5%
SDS,
1% bovine serum albumin, 1% polyvinylpyrrolidone and 1% Ficoll (400,000 MW)).
After prehybridization, 32P-labeled DNA prepared from the full-length genomic
receptor clone described above was added at a concentration of 3 x 106 cpm/mL
and
the membrane hybridized overnight at 37°C. The hybridized membrane was
then
33
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
washed using the following high-stringency washing conditions: 10 min at room
temperature in a wash solution of 2X SSC/ 1% SDS; 10 min at 60°C in 2X
SSC/ 1%
SDS; and finally 5 min at 60°G in 0.5X SC/ 1% SDS, where the washing
solutions
were changed between each washing step. The washed membrane was then exposed
overnight to X-ray film (X-omat, I~odalc, Rochester, NY).
The results of these experiments are shown in Figure 4. As shown in the
photograph, the transfected biogenic amine receptor is expressed in
transfected
HEK293 cells.
Specific binding assays using a variety of biogenic amine receptor agonists
1 o and antagonists were performed on membranes from both transient and stable
transfectants. Ligand binding experiments were performed essentially as
described in
Bunzow et al. (1988; Nature 336: 783-787). In binding experiments, increasing
amounts of membrane protein (from 15-80~g) was incubated with each of the
radioactively-labeled biogenic amine agonist or antagonist to be tested for
120 min at
22°C in a total volume of l mL.
EXAMPLE 4
Distribution of Biogenic Amine Receptor Expression
in Mammalian Cell Lines, Rat Brain and Peripheral Tissues
The distribution of mRNA corresponding to expression of the biogenic amine
receptor gene in various regions of the rat brain was determined by reverse
transcription/polymerase chain reaction (RT-PCR) performed as follows. Total
RNA
from various rat brain sections was isolated using the
RNA Easy lcit (Qiagen) described in Example 3 and converted to single-stranded
cDNA using reverse transcriptase (BRL, Gaithersburg, MD) primed by oligo dT or
random primers or a combination of both these primers. PCR was then performed
using the 5' sense primer (TCT CTG AGT GAT GCA TCT TTG; SEQ ID No. 7)
corresponding to the 5"extent of the receptor coding sequence and either an
antisense
3o primer (AGC AGT GCT CAA'CTG TTC TCA CCA TGC; SEQ ID No.: 8) having its
3' end at nucleotide residue 243 of the SEQ ID No. 3 (resulting in a PCR
product of
about 250bp in length) or an antisense primer (GCA CGA TTA ATT GAC CTC GCT
TG; SEQ ID No.: 9) having its 3' end'at nucleotide residue 650 of the SEQ ID
No. 3
(resulting in a PCR product of about 650bp in length). Using either primer
pair, PCR
34
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
was performed for 35 cycles, wherein one cycle consisted of incubations at
94°C for
90 sec (denaturation), 55°C.for 90 sec (annealing), and 72°C for
120 sec (extension).
The resulting fragments were resolved from 30~IL reaction mixture using 1%
agarose
gel electrophoresis and visualized by ethidium bromide staining and UV
illumination.
The fragments were then transferred onto a nylon membrane (GeneScreen Plus,
NEN) by capillary transfer and hybridized under' high stringency conditions as
described above with a 3zP-labeled probe prepared from the full-length rat
genomic
clone encoding the novel biogenic amine receptor of the invention as described
herein.
Hybridized fragments were detected using a phosphoimager (Molecular Devices,
l0 Mountain View, CA).
The results of these experiments are shown in Figures SA and 5B. Figure 5A
shows a photograph of an ethidium bromide stained 1% agarose gel viewed under
ultraviolet light illumination. PCR product (10~L of a 30~L reaction mixture)
was
electrophoresed as described above, and bands specific for the predicted
fragments of
the rat biogenic amine receptor of the invention (250 or 650bp) were detected.
Figure
5B shows the results of the hybridization assay, which results in greater
sensitivity of
detection of PCR-amplified fragments.' These results indicated that the
biogenic
amine receptor was expressed strongly in midbrain and olfactory tubercle, less
strongly in the olfactory bulb, moderately in the striatum and weakly in the
2o hypothalamus.
Northern analysis of total RNA was performed as described in Example 2
above to detect biogenic amine receptor expression in various established
mammalian
cell lines. These results are shown in Figure 6. Expression of the biogenic
amine
receptor gene of the invention was detected only in rat insulinoma cell line
RIMS,
while the AR42J cell line from which the cloned cDNA was obtained did not show
a
signal in this experiment, indicating it was present only at low levels and
could not be
detected in a Northern blot prepared from total cellular RNA (i.e., not having
been
enriched for mRNA, for exarfaple, by selection with oligo(dT)).
The results of RT-PCR analysis performed on mRNA obtained from various
rat tissues as described above are shown in Figure 8A, and hybridization
analysis of
these results is shown in Figure 8B to increase detection of PCR-amplified
fragments.
The transcript was widely distributed throughout the brain, with the highest
levels of
expression detected in the olfactory bulb, nucleus accumbens/olfactory
tubercle,
prefrontal cortex and other cortical regions, midbrain regions consisting of
substantia
, '
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
nigra and ventral tegmentum, cerebellum, and pons/medulla. Among peripheral
tissues, the highest level was observed in the liver, with lesser expression
detected in
kidney, gastrointestinal tract, spleen, pancreas, and heart.
These results indicated the following pattern of biogenic amine receptor
expression in these tissues:
olfactory tubercle > intestine ~midbrain, cortex, spleen > heart, kidney
The receptor was also expressed at detectable levels in lung, transfected COS
cells,
1 o and olfactory bulb. These results are consistent with known patterns of
trace amine
receptor expression in olfactory tubercle and midbrain.
EXAMPLE 5
Cloning the Human Trace Amine Receptor Gene
The novel mammalian trace amine receptor cDNA obtained in Example 2 was
used to isolate a partial genomic clone from a libr ary of human genomic DNA
cloned
in lambda EMBL3 (obtained from Clontech, Palo Alto, CA) as follows. The full-
length rat receptor cDNA (~1 kb in length) was 32P-labeled by the random
priming
technique a lcit obtained from Stratagene (San Diego, CA) according to the
manufacturer's instructions. This probe was then used to screen the human
genomic
libraryx which had been plated and then transferred to nylon membranes (Gene
Screen
Plus, NEN, Boston, MA). Hybridization was performed in a solution of 50%
formamide, SXSSC, 1% SDS, SX Denhardt solution, and salmon sperm DNA (50
micrograms/mL) with the radioactive probe at 2 x 10~ cprri/mL and at a
temperature of
37°C overnight. The nylon filters were then washed at room temperature
in a solution
of 2X SSC/ 0.1 % SDS for 10 minutes, followed by a wash at 55°C in a
solution of 2X
SSC/ 0.1% SDS for 15 minutes, and finally a wash at 55°C in a solution
of 0.5X SSC/
3o 0.1% SDS for 5 minutes. Filters were then exposed to XOMAT X-ray film
(Kodalc)
overnight at -80°C. Filter hybridization was performed in duplicate to
confirm
positive signals. Secondary and tertiary screens were performed until single
homogenous clones were identified.
Individual genomic clones were then isolated and the nucleotide sequence
determined. The nucleotide sequence analysis, performed essentially as
described in
36
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
Example 1, revealed that the longest insert contained a partial N-terminal
sequence of
the human homologue of the rat trace amine receptor. Based on this information
a set
of oligonucleotide primers were synthesized having the following sequence:
Primer VII (sense):
5' TTGACAGCCCTCAGGAATGATG 3' (SEQ. ID: NO:10)
and
Primer VIII (antisense):
5' ATGGAAAATGGAGGCTGAGCTCAG 3' (SEQ. ID NO:11 )
These primers were then used to identify a bacterial artificial chromosome
(BAC) clone encoding the entire human trace amine receptor gene. Pools of BAC
DNA obtained from. Research Genetics (Release IV, Catalogue #96011) were
subjected to PCR in a 30 micoliter solution that contained primers VII and
VIII in
addition to 50 mM Tris-HCl (pH 8.3), 2.5 mM MgCl2, 0.01% gelatin, 250 ~M each
dNTP, and 2.5 units of Taq polymerase (Sailci et al., 1988, Science 239: 487-
491).
Each PCR amplification cycle consisted of incubations at 94°C for
90 sec
(denaturation), 50°C for 90 sec (annealing), and 72°C for 120
sec (extension) for 35
cycles.
Amplified products of the PCR reaction were separated on a 1.0% agarose gel
(see Sambroolc et al., ibid.). Fragments of the expected size (630 bp) were
subcloned
into the plasmid vector pBluescript (Stratagene, LaJolla, CA) and sequence
analysis of
the inserts confirmed that the BAC contained the human trace amine receptor
gene of
interest. To obtain' the complete DNA sequence of the novel human trace amine
receptor gene sense oligonucleotide primers were designed based on the
sequence
information obtained from the BAC and EMBL3 clones. The resulting sequence
information was then used in the design of additional primers. This process
was
repeated until the end of the coding region was reached.
Consistent with its rat homologue the novel human trace amine receptor is
3o encoded by a single coding exon. The sequence of the human receptor is
presented in
Figure 1. Interestingly, the open reading frame of the human homologue of the
trace
amine receptor gene is 21 bases longer than the rat (1017 vs 996,
respectively) which
translates into a human receptor that is 339 amino acids long compared to a
receptor
of 332 amino acids in the rat (shown in Figure 2). A comparison between the
primary
37
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
amino acid sequences of the human and rat receptors is presented in Figure 3.
EXAMPLE 6
Chromosomal Mapping of the Genomic Locus
of the Human Bioaenic amine Receptor Gene
The chromosomal locus of the human trace amine receptor gene of the
to invention was mapped by fluorescence itt situ hybridization as follows.
BAC DNA encoding the human trace amine receptor described in Example 5
was niclc-translated using digoxigenin-11-UTP for use as a probe for irr situ
chromosomal mapping-to localize the gene. This fluorescently labeled DNA was
hybridized ira situ to denatured human metaphase chromosomes for 16 hours.
Signal
was detected in the presence of DAPI (4,6-diamidino-2-phenylindole) counter
staining
and the chromosome was identified by sequential G-banding. The hybridization
signal appeared to be consistent with a chromosomal location on the distal
long arm of
chromosome 6. By alignment of the hybridized metaphases with an ideogram of
chromosome 6 (at the 400 band stage), the human trace amine receptor gene was
assigned to the locus 6q23.
The results of these experiments are shown in Figures 9A through 9D, and a
schematic representation of these results is shown in Figure 9E. As can be
seen in
these Figures, the human trace amine receptor gene corresponding to the cDNA
provided by the invention was mapped to human chromosome 6, specifically at
6q23.2.
This chromosomal localization is particularly noteworthy because it is one of
the
few regions that have been reproducibly associated with schizophrenia in
linkage
studies (Cao et al., 1997, Gertotrtics 43: 1-8; Martinez et al., 1999, Am
JHurta Ge>zet
88: 337-343; Levinson, et al. 2000, Arst J Hurya Gertet 67: 652-663; Mowry and
Nancarrow, 2001, Clin Exp Phat~traacol Physiol 28: 66-69), suggesting the
possibility
that hTARl may be involved in the mechanism of psychosis. The relevance of
this
receptor to the etiology ofpsychosis is enhanced by the evidence that 3-MT is
apotent
and efficacious agonist. 3-MT is the major metabolite of dopamine produced by
the
enzyme COMT, a variant of which was recently found to be transmitted with
greater
frequency to schizophrenic offspring in a family based association study (Egan
et al.,
2001, Pr~oc Natl Acad Sci USA 98: 6917-6922).
38
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
EXAMPLE 7
Detection of MAP Kinase Pathway Stimulation
by the Human Trace Amine Receptor Gene
It has been determined that G-protein coupled receptors are capable of
stimulating the MAP (microtubule-associated protein) lcinase assay in
mammalian
cells. The recognition of this role of G-protein coupled receptors has
facilitated the
to development of an assay for testing the response of G-protein coupled
receptors to
potential ligands in vity~o, thereby simplifying characterization of said
receptors.
In this assay, activation of the pathway by ligand binding to receptor results
in
increased phosphorylation of mammalian transcription factor Ellc by the MK
kinase.
The phosphorylated Ellc transcription factor then binds to promoters
containing cis-
sequences responsive to this transcription factor. Transcription factor
binding results
in increase transcription of sequences operatively linlced and under the
transcriptional
control of such Ellc-responsive promoters. Most advantageously, reporter
genes, such
as (3-galactosid'ase or firefly luciferase are operatively linked to such Ellc-
responsive
promoters, thereby permitting ligand binding to a receptor to be linlced with
2o expression of the reporter gene.
HEIR 293 cells were transfected with the full-length human clone encoding the
trace amine receptor of the invention contained ilnthe pcDNA 3.1 expression
vector
(Invitrogen), wherein the first 22 nucleotides of the 5' untranslated region
is followed
by an initiation codon (ATG, Met), followed by nucleotides encoding an 8-amino
acid
FLAG sequence (Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys; SEQ ID No.: 12), followed by
a nucleotide sequence encoding the 21 amino acids of the human D2 receptor (as
disclosed in co-owned U.S. PatentNo. 5,880,260, issued March 9, 1999,
incorporated
by reference in its entirety herein) that follow the Met initiation codon in
the native
D2 sequence, which is followed by the complete sequence of the human trace
amine
3o receptor; this construct was termed H2-3pcDNA3.1.
Control cells were transfected with pcDNA3.1 without the rat trace amine
receptor sequences. All cells were also co-transfected with 2 additional
constructs:
one (ells-gal) that encoded the yeast transcription factor gal under the
transcriptional
control of an Ellc-responsive promoter; and another encoding firefly
luciferase under
the transcriptional control of a gal-responsive promoter. In cells containing
the rat
trace amine-encoding construct, ligand binding to the receptor expressed
thereby
39
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
activated the map lcinase (MK) pathway, which results in phosphorylation of
the
endogenous Ellc transcription factor. In its phosphorylated state, Ellc
interacts with the
ells DNA binding site and leads to activation of transcription of the gal gene
contained
in the ells-gal plasmid. In turn, transcription of the luciferase gene is
activated in the
co-transfected luciferase construct. Luciferase transciption was quantified
using a
luminometer, and gave an indirect measure of MK activation by each ligand. The
results of these experiments as shown in Table II, showing the fold
stimulation for
each potential ligand compared with cells incubated in the absence of the
ligand.
1 o TABLE II
L~ H2-3 pcDNA3.1pcDNA3.l
Dopamine 1.21 1.04
Serotonin 1.22 1
Norepinephrine 1.69 1.3
Clonidine' 1.47 1.07
SKF82958z 2.52 0.79
ADTN673. 1.93 0.78
Quinpirole3 2.14 0.6
i
az-adrenergic and imidazoline receptor agonist
D 1 dopamine receptor agonist
a-2 adrenergic receptor agonist
IS
These results indicate that the cloned rat genomic DNA disclosed herein
encodes a receptor that is specifically activated by drugs that target certain
biogenic
amine receptors. However, the profile for this activation.does not con-espond
to that
for any of the known biogenic amine receptors, indicating that this is a
novel, brain-
2o specific, biogenic amine-binding receptor having a unique pharmacology
useful
thereby as a therapeutic target.
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
EXAMPLE 8
Cellular Localization of the Novel Trace Amine Receptor
Enhanced expression of the receptor was achieved by cloning the full-length
rat cDNA into the mammalian expression vector pcDNA3.11V5/His-TOPO
(Invitrogen). A PCR product was generated that upon expression produced the
rat
receptor sequence preceded at its amino terminus by a cleavable 16 amino acid
signal
sequence of the influenza hemaglutinin virus immediately followed by the 8
amino
acid M1-Flag epitope and then a two amino acid linker (MetGly) just before the
to initiation methionine (Guan et al., 1992, JBiol Chezzz. 267: 21995-21998).
HEI~293 cells were transfected using the Lipofectamine transfection reagent
and cells stably expressing the construct were selected in 6418. The flag-
tagged
receptor was analyzed by immunofluorescence to determine cellular
localization. For
comparison, localization of the Dl receptor in HEI~293 cells stably expressing
the
cloned flag-tagged human D 1 receptor was also examined. Cells were maintained
in
DMEM media containing 10% fetal calf serum and 700 ~Ig/mL 6418 (Life
Technologies, Bethesda, MD). Confluent cells were detached with PBS solution
containing 0.05% trypsin and 0.53 mM EDTA, harvested, diluted 1:10, and plated
on
glass microscope coverslips coated with poly-D-lysine and grown at 37°C
for 48
2o hours. Cells were washed twice with PBS and fixed with 2.5%
paraformaldehyde in
PBS for 20 minutes. Cells were then incubated for 30 minutes with anti-FLAG
monoclonal antibody (1:500; Sigma) in blocking buffer solution (3% dry mills,
1 mM
CaCl2, 50 mM Tris HCl Ph 7.5) with or without 0.1% Triton X-100. After 3
washes
with Tris-buffered saline containing 1 mM CaCh, cells were incubated for 30
minutes
with goat anti-mouse IgG conjugated to Cy5 (Jackson Immuno Research
Laboratories,
Ins., West Grove, PA) diluted 1:200 in blocking solution. Cells were washed
three
times and mounted onto microscope slides with Mowiol0 (Aldrich, Milwaukee, WI)
and analyzed by confocal microscopy using an MRC-1000 laser scanning confocal
imaging system (Bio-Rad Laboratories, Richmond, CA) equipped with an Optiphot
II
Nikon microscope and a Plan Apo 60 x 1.4 oil immersion objective. In the
absence of
Triton X-100, little staining was observed in the cells for the receptor. In
the presence
of Triton X-100, which permeablizes the cell membrane, the receptor showed
pronounced staining in the cytoplasm accompanied by some staining in the
plasma
membrane. As expected, the D1 receptors were found primarily on the plasma
3s membrane.
41
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
EXAMPLE 9
Stimulation of the Novel Receptor in Stably Transfected HEK293 Cells in
Response to Various Endogenous and Synthetic Compounds
HEK293 cells stably transfected with the pcDNA3.1/VS/His-TOPO expression
vector containing the full-length rat cDNA clone described above were assayed
for
cAMP production in response to various ligands.
In the performance of these assays, HEK293 cells were harvested in Krebs-
l0 Ringer buffer (KRH; Sigma) and preincubated in KRH with 200 p,M IBMX. For
drug
treatments, cells were incubated in KRH with 100 wM IBMX with the test
compound
(or 10 pM forslcolin) for 1 hour at 37°C. The cells were then boiled
for 20 min after
adding an equal volume of 0.5 mM sodium acetate buffer, centrifuged to remove
cell
debris, and the resulting extract was analyzed for cAMP content using
competitive
binding of 3H-cAMP to a CAMP binding protein (Diagnostic Products Corp., Los
Angeles, CA). Data were normalized according to protein content as determined
using the Bradford reagent (Bio-Rad, Richmond, CA). Concentration-response
curves
were plotted and ECso's calculated with, GraphPad Prism software (San Diego,
CA).
Using this assay, levels of cAMP stimulation in response to 1 p,M
2o concenhations of test.compounds were measured and levels were normalized to
the
levels of cAMP elicited by 1 ~M p-tyramine. The results of the CAMP assays are
shown in Figures 12A through 12G and are summarized in the following Tables.
Table III shows the potencies and efficacies of compounds stimulating the
receptor.
Drugs that are strong, medium, and wealc stimulators of the receptor are
listed in Table
IV and neurotrarisrriitters that are stimulators of the receptor are listed in
Table V.
Compounds that demonstrate strong responses have affinities and/or efficacies
that are -
comparable or higher than those of p-tyramine. Compounds that display weak
stimulation of cAMP are either inactive or antagonists. Medium stimulators
illicit a
response less than the strong stimulators but greater than the weak
stimulators.
TABLE III
nM+SEM Maximal Stimulation
NeurotransmittersECso (
)
_ (~~o+SEM)
p-tyramine G9_+9 100
Phenethylamine 237_+71 7G+1 G
Tryptamine 309_+7G 90+G
Syne hrine 584+100 90+2
42
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
Octo amine 1298+_350 102_+3
m-tyramine 5375_+1184 74+3
Do amine 5920_+2639 48+5
5-hydroxytryptamine12800+4181 47+9
Drugs ECso (nMSEM)Maximal Stimulation
(/"+SEM)
4-h droxyam 51+12 79+2
hetamine
MPTP 99+11 93+7
R-amphetamine 209_+44 48+7
S-amphetamine 440_+10 84+3
MDMA 1749+1152 GS+13
'rValues are expressed as percent of stimulation by p-tyramine
NEUROTRANSMITTERS DRUGS
EC50 (nM) EC50
(nM)
P-tyramine 44.9 82 R-OH am hetamine11.3
Phenylethylamine218 124 -tyramine 20.2
Tryptamine 248.4 519 S-am hetamine 64.2
'
Octo amine 873.5 1400 R-am hetamine 108
Do amine 4818.0 4000 MDMA 179
Serotonin 1913.0 8000 S-methamphetamine188
m-tyramine 7189.0 5800 R-methamphetamine236
Syne brine ND - p-methoxy PEA 346
Noradrenaline0 -
TABLE IV
DRUGS
STRONG MEDIUM WEAK
STIMULATOR STIMULATOR STIMULATOR.
4-OH am' hetaminePhentolamineN- henyle
brine
S-am hetamine 3-hen 1 ro Clonidine ,
ylamine
R-am hetamine ErgotmetrineQuinpirole'
.
S-methamphetamineR-ephedrine Quipazine
R-methamphetamineTolazoline 4-benzylpipeYidine
~
MDMA Pren lamine
-chloroam hetamineMescaline
Betahistine -methoX -PEA
4-NH-PEA , 3,4 dimethoicy
PEA
2-thiophenylethylamineReboxetine
1-phenylpiporazineAEBSF
Phenyle urine Hydrocotarnomine
A omor hine Bromocry
~ tine
meter oline 6,7 ADTN
43
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
TABLE V
NEUROTRANSMITTERS
STRONG MEDIUM NO
STIMULATORSTIMULATOR STIMULATION
-tyramine Do amine pore ine
brine
PhenylethylamineSerotonin
Try taminem-tyramine
Octo amine
Synephrine
In summary, these molecules had ECsos in the following rank order (lowest to
highest):
p-tyramine < (3-PEA < tryptamine < synephrine < octopamine < naeta-tyramine
(na-
tyramine) < dopamine < 5-HT « norepinephrine, epinephrine.
The ranlc order of potencies observed for the human trace amine receptor
1o indicates that a hydroxyl group at the meta position on ~i-PEA analogs or
at the 5-
position on tryptamine has deleterious effects on agonist potency, ,a trend
that is
contrary to that observed for catecholamine receptors. Comparison of the amino
acid
sequence of the trace amine receptor with those of catecholamine and 5-HT
receptors
suggests a structural basis for this change in selectivity. It has been
proposed from
rnutagenesis studies of the (32-AR and the 5-HT1A receptor (Ho et al., 1992,
FEBSLett
301: 303-306) that serine residues in transmembrane domain V contribute to the
binding affinity of agonists, and that Sersv2 and/or Ser5~43 form a hydrogen
bond
networlc with the catecholamine rneta-hydroxyl groups (Liapalcis, et al. 2000,
J Biol
Chern 275: 37779-37788). The Ser residue in position 5.42 is conserved in
every
2o catecholamine receptor. Curiously, the corresponding residues in the
mammalian
trace amine receptor of the invention are instead A1a5~4' and Phe5~a3 (Fig. 1)
whereas
the more deeply positioned SerSV', proposed to interact with thepar~a-hydroxyl
group,
is found in the instant receptors and in the catecholamine receptors alike
(Liapalcis et
al., ibicl.). The absence of Ser residues in positions 5.42 and 5.43 of rTARl
diminishes the potencies of phenethylamine agonists that have rneta-hydroxyl
groups
(e.g. catecholaniines, na-tyramine) as compared to those that do not.
Another trend observed in the pharmacological survey also differentiates the
instant trace amine receptor from known biogenic amine receptors and,
furthermore,
may hint at a physiological role of the receptor. The rneta-O-methyl
metabolites of
3o the catecholamines-3-methoxytyramine (3-methyldopamine), 3-methoxy-(3-4-
44
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
dihydroxy-(3-phenethylamine (normetanephrine); and 3-methoxy-(3-4-dihydroxy-N-
methyl-/3-phenethylamine (metanephrine) - are efficacious activators of the
trace
amine receptor of the invention, and are significantly more potent than their
precursors dopamine, norepinephrine, and epinephrine (Fig. 3B). This finding
is
unusual because at other known catecholamine receptors, these meta-O-methyl
metabolites generated by catechol-O-methyltransferase have vastly diminished
affinities andlor intrinsic efficacies as compared with their parent
catecholamines
(Langer and Rubio, 1973, Naunyr~ Schmiedeberg's Ar~cla Pha~°macol 276:
71-88;
Seeman, 1980, Plaarsraacol Rev 32: 230-313). The data disclosed herein
indicated that
1 o increasing lipophilicity of catecholamine meta-substituents by O-
methylation actually
increases their affinity for the trace amine receptors of the invention. These
data are
consistent with the finding of Liapalcis et al. (ibid.) that replacement of
Ser5v2 in the
(32-AR with Ala or Val residues decreased the affinities of (3-PEA analogs
containing
meta-hydroxyl groups but increased the potencies of analogs Iaclcing them.
Accordingly, endogenous agonists of the trace amine receptors of the invention
may
include some "inactive" catecholamine metabolites such as 3-methoxytyramine,
the
principal extracellular metabolite of dopamine (Wood and Altar, 1988,
Pharnaacol
Rev 40: 163-187). It is important to note that 3-methoxy-4-hydroxyphenylacetic
acid
(homovanillic acid), the oxidized metabolite of 3-methoxytyramine lacking the
amine
2o group, displayed no detectible activity towards the trace amine receptors
of the
invention. The tissues that contain the highest levels of mRNA encoding a
trace
amine receptor of the invention were the same tissues known to express high
levels of
catechol-O-methyltransferase -liver, lcidney, gastrointestinal tract and brain
(reviewed in Mannisto and Kaalclcola, 1999, Plaa~°rnaeol Rev 51: 593-
628).
Surprisingly, the trance amine receptor is more potently activated by the
presumably "inactive" catecholamine metabolites 3-methoxytyramine (3-MT),
normetanephrine and metanephrine than by the neurotransmitters dopamine,
norepinephrine, and epinephrine themselves.
Given the structural similarity of amphetamine to [3-PEA and p-tyramine, it
3o was of obvious interest to determine whether amphetamine analogs including
methamphetamine and its congener MDMA (" ecstasy") could activate the trace
amine
receptors of the invention. These and several other amphetamine analogs
potently
- stimulated cAMP production in recombinant cells expressing this receptor.
Amphetamines act directly on the receptor, since these drugs (at 1 ~.M
concentrations)
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
produced no cAMP stimulation in control cells transfected either with an empty
vector
or with the human D I receptor. Amphetamine analogs that activate the receptor
include both classic neurotransmitter transporter substrates as well as a
prototypical
hallucinogenic amphetamine, 2-amino,(1-[2,5-dimethoxy-4-iodophenyl]propane,
which has poor affinity for transporters but high affinity for 5-HTz receptors
(Marelc
and Aghajanian, 1998, ibid:). Some structural modifications of amphetamine
significantly changed their potencies at the receptor: p-OH-amphetamine (a-
methyl-
p-tyramine), the major amphetamine metabolite (Cho and I~umagai, 1994, in
Anaphetar~zi~e a~ad Its Analogs: PsychoplzaYnaacology, Toxicology, anal Abuse
(Cha
l0 AK and Segal DS eds), Academic Press: San Diego, pp 43-77), proved to be
the most
potent agonist of the trace amine receptor of the invention yet identified. In
contrast,
two N-ethyl analogs, (~)fenfluramine and (~)N-ethylamphetamine, had
substantially
lower activities than the N-methyl congeners, methamphetamine and MDMA or than
the primary amine congeners.
The ability of tryptamine to activate the rTARl suggested that some ergot
alkaloids might act as agonists. A variety of widely used ergot alkaloids and
ergoline
derivatives, including ergometrine, dihydroergotamine, D-LSD, and the
antiparlcinsonian agents bromocriptine and lisuride, potently activate the
trace amine
receptor. Recognition that this receptor is involved in the biological
response to these
2o compounds increases the ability to elucidate their complex iya vivo
pharmacology.
Antagonists of biogenic amine receptors and transporters were also found to
stimulate camp production in recombinant cells expressing the trace amine
receptors
of the invention. Such compounds include the adrenergic antagonists
phentolamine
and tolazoline, the serotonergic antagonists cyproheptadine,
dihydroergotamine, and
metergoline, and the nonsubstrate inhibitors of dopamine transporter protein
nomifensine and 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine. The
antipsychotic
drug chlorpromazine, typically considered to be a dopamine receptor
antagonist, also
acted as a wealc agonist with the trace amine receptors of this invention.
None of the
biogenic amine receptor antagonists tested were able to antagonize trace amine
receptor binding or activity when coincubated (at 1 or 10 p,M concentrations)
with
ECSO concentrations of (3-PEA or p-tyramine (data not shown). Although the
trace
amine receptor of this invention displayed a broad ligand selectivity when
expressed
in HEK293 cells, it is not activated by many compounds including
acetylcholine,
nicotine, GABA, glutamate, morphine (data not shown) and histamine.
46
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
It should be understood that the foregoing disclosure emphasizes certain
specific embodiments of the invention and that all modifications or
alternatives
equivalent thereto are within the spirit and scope of the invention as set
forth in the
appended claims.
47
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
SEQUENCE LISTING
<1l0> Grandy, David IC
Bunzow, James R
Sonders, Mark
<120> Mammalian Receptor Genes and Uses
<130> Biogenic amine receptor genes
<140>
<141>
<160> 8
<170> PatentIn Ver. 2.0
<2l0> 1
<211> 1125
<212> DNA
<213> Homo Sapiens
<220>
<221> CDS
<222> (21)..(1037)
<400> l
ctaattgaca gccctcagga atg atg ccc ttt tgc cac aat ata att aat att 53
Met Met Pro Phe Cys His Asn Ile I1e Asn Ile
1 5 10
tcc tgt gtg aaa aac aac tgg tca aat gat gtc cgt get tcc ctg tac 101
Sex Cys Val Lys Asn Asn Trp Ser Asn Asp Val Arg Ala Ser Leu Tyr
15 20 25
agtttaatggtgctcata attctgaccacactcgttggcaatctgata 149
SerLeuMetValLeuIle I1eLeuThrThrLeuValGlyAsnLeuIle
30 35 40
gttattgtttctatatca cacttcaaacaacttcataccccaacaaat 197
ValIleValSerIleSer HisPheLysGlnLeuHisThrProThrAsn
45 50 55
tggctcattcattccatg gccactgtggactttcttctggggtgtctg 245
TrpLeuIleHisSerMet AlaThrValAspPheLeuLeuGlyCysLeu
60 65 70 75
gtcatgccttacagtatg gtgagatctgetgagcactgttggtatttt 293
ValMetProTyrSerMet ValArgSerAlaG1uHisCysTrpTyrPhe
80 85 90
ggagaagtcttctgtaaa attcacacaagcaccgacattatgctgagc 341
GlyGluValPheCysLys IleHisThrSerThrAspIleMetLeuSer
95 100 105
tcagcctccattttccat ttgtctttcatctccattgaccgctactat 389
SerAlaSerIlePheHis LeuSerPheIleSerIleAspArgTyrTyr
110 115 120
getgtgtgtgatccactg agatataaagccaagatgaatatcttggtt 437
AlaValCysAspProLeu ArgTyrLysAlaLysMetAsnIleLeuVal
1
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
125 130 135
att tgt gtg atg atc ttc att agt tgg agt gtc cct get gtt ttt gca
Ile Cys Val Met Ile Phe Ile Ser Trp Ser Val Pro Ala Val Phe Ala
140 145 l50 155
ttt gga atg atc ttt ctg gag cta aac ttc aaa ggc get gaa gag ata
Phe Gly Met Ile Phe Leu Glu Leu Asn Phe Lys Gly A1a Glu Glu Ile
160 165 170
tat tac aaa cat gtt cac tgc aga gga ggt tgc ctc gtc ttc ttt agc
Tyr Tyr Lys His Val His Cys Arg Gly Gly Cys Leu Val Phe Phe Ser
l75 180 185
aaa ata tct ggg gta ctg acc ttt atg act tct ttt tat ata cct gga
Lys Tle Ser Gly Val Leu Thr Phe Met Thr Ser Phe Tyr Ile Pro Gly
190 195 200
tct att atg tta tgt gtc tat tac aga ata tat ctt atc get aaa gaa
Ser Ile Met Leu Cys Val Tyr Tyr Arg Tle Tyr Leu Tle Ala Lys Glu
205 210 215
cag gca aga tta att agt gat gcc aat cag aag ctc caa att gga ttg
Gln Ala Arg Leu Tle Ser Asp Ala Asn Gln Lys Leu Gln Ile Gly Leu
220 225 230 235
gaa atg aaa aat gga att tca caa agc aaa gaa agg aaa get gtg aag
Glu Met Lys Asn Gly Tle Ser Gln Ser Lys Glu Arg Lys Ala Val Lys
240 245 250
aca ttg ggg att gtg atg gga gtt ttc cta ata tgc tgg tgc cct ttc
Thr Leu Gly Ile Val Met Gly Val Phe Leu Ile Cys Trp Cys Pro Phe
255 260 265
ttt atc tgt aca gtc atg gac cct ttt ctt cac tca att att cca cct
Phe Tle Cys Thr Val Met Asp Pro Phe Leu His Ser Ile Ile Pro Pro
270 275 280
act ttg aat gat gta ttg att tgg ttt ggc tac ttg aac tet aca ttt
Thr Leu Asn Asp Val Leu Ile Trp Phe Gly Tyr Leu Asn Ser Thr Phe
285 290 295
aat cca atg gtt tat gca ttt ttc tat cct tgg ttt aga aaa gca ctg
Asn Pro Met Val Tyr Ala Phe Phe Tyr Pro Trp Phe Arg Lys Ala Leu
300 305 3l0 315
aag atg atg ctg ttt ggt aaa att ttc caa aaa gat tca tcc agg tgt
Lys Met Met Leu Phe Gly Lys Ile Phe G1n Lys Asp Ser Ser Arg Cys
320 325 330
aaa tta ttt ttg gaa ttg agt tca tagaattatt atattttact gttttgcaaa
Lys Leu Phe Leu Glu Leu Ser Ser
335
tcggttgatg atcatattta tgaacacaac ataacgaacc acatgcacca accacatg
<210> 2
<211> 339
<212> PRT
<213> Homo sapiens
2
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
<400> 2
Met Met Pro Phe Cys His Asn Tle Ile Asn Ile Ser Cys Val Lys Asn
1 5 ~ 10 15
Asn Trp Ser Asn Asp Val Arg Ala Ser Leu Tyr Ser Leu Met Val Leu
20 25 30
Ile Ile Leu Thr Thr Leu Val Gly Asn Leu Ile Val Ile Val Ser Ile
35 40 45
Ser His Phe Lys Gln Leu His Thr Pro Thr Asn Trp Leu Tle His Ser
50 55 60
Met Ala Thr Val Asp Phe Leu.Leu Gly Cys Leu Val Met Pro Tyr Ser
65 70 75 $0
Met Val Arg Ser Ala Glu His Cys Trp Tyr Phe Gly Glu Val Phe Cys
85 90 95
Lys Tle His Thr Ser Thr Asp Ile Met Leu Ser Ser A1a Ser Ile Phe
100 105 110
His Leu Ser Phe Ile Ser Ile Asp Arg Tyr Tyr Ala Val Cys Asp Pro
115 120 125
Leu Arg Tyr Lys Ala Lys Met Asn Tle Leu Val Ile Cys Val Met Ile
130 135 140
Phe Ile Ser Trp Ser Val Pro Ala Val Phe Ala Phe Gly Met Ile Phe
145 150 155 160
Leu Glu Leu Asn Phe Lys Gly Ala Glu Glu Ile Tyr Tyr Lys His Val
165 l70 175
His Cys Arg Gly Gly Cys Leu Val Phe Phe 5er Lys Ile Ser Gly Val
180 185 190
Leu Thr Phe Met Thr Ser Phe Tyr Ile Pro Gly Ser Tle Met Leu Cys
195 200 205
Val Tyr Tyr Arg Ile Tyr Leu Ile A1a Lys Glu Gln Ala Arg Leu Ile
210 215 220
Ser Asp Ala Asn Gln Lys Leu Gln Ile Gly Leu Glu Met Lys Asn Gly
225 230 235 240
Ile Ser Gln Ser Lys Glu Arg Lys Ala Val Lys Thr Leu Gly Ile Val
245 250 255
Met Gly Val Phe Leu Ile Cys Trp Cys Pro Phe Phe Tle Cys Thr Val
260 265 270
Met Asp Pro Phe Leu His Ser,Ile Ile Pro Pro Thr Leu Asn Asp Val
275 280 2S5
Leu Ile Trp Phe Gly.Tyr Leu Asn,Ser Thr Phe Asn Pro Met Val Tyr
290 295 300
Ala Phe Phe Tyr Pro Trp Phe Arg Lys Ala Leu Lys Met Met.Leu Phe
305 310 315 320
3
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
Gly Lys Ile Phe,Gln Lys Asp Ser Ser Arg Cys Lys Leu Phe Leu Glu
325 330 335
Leu Ser Ser
<210> 3
<211> 999
<212> DNA
<213> Rattus norvegicus
<220>
<221> CDS
<222> (1)..(996)
<400> 3
atg cat ctt tgc cac aat agc gcg aat att tcc cac acg aac agg aac
Met His Leu Cys His Asn Ser Ala Asn Ile Ser His Thr Asn Arg Asn
l 5 l0 15
tgg tca agg gat gtc cgt get tca ctg tac agc tta ata tca ctc ata
Trp Ser Arg Asp Val Arg Ala Ser Leu Tyr Ser Leu Tle Ser Leu Tle
20 25 30
att cta acc act ctg gtt ggc aac tta ata gta atc att tcg ata tcc
Ile Leu Thr Thr Leu Val Gly Asn Leu Ile Va1 Ile 21e Ser Ile Ser
35 40 45
cac ttc aag caa att cac acg ccc aca aat tgg ctc ctt cat tcc atg
His Phe Lys Gln Ile His Thr Pro Thr Asn Trp Leu Leu His Ser Met
50 55 60
gcc gtt gtc gac ttt ctg ctg ggc tgt ctg gtc atg cec tac agc atg
Ala Val Val Asp Phe Leu Leu Gly Cys Leu Val Met Pro Tyr Ser Met
65 70 75 80
gtg aga aca gtt gag cac tgc tgg tac ttt ggg gaa ctc ttc tgc aaa
Val Arg Thr Va1 Glu His Cys Trp Tyr Phe Gly Glu Leu Phe Cys Lys
85 90 95
ctt cac acc agc act gat atc atg ctg agc tcg gca tcc att ctc cac
Leu His Thr Ser Thr Asp Ile Met Leu Ser Ser Ala Ser Ile Leu His
100 105 110
cta gcc ttc att tcc att gac cgc tac tat get gtg tgc gac cct tta
Leu Ala Phe Tle Ser Ile Asp Arg Tyr Tyr A1a Val Cys Asp Pro Leu
115 120 125
aga tac aaa gcc aag atc aat ctc gcc gcc att ttt gtg,atg atc ctc
Arg Tyr Lys Ala Lys Ile Asn Leu Ala Ala Ile Phe Val Met Ile Leu
130 135 140
att agc tgg agc ctt cct get gtt ttt gca ttt ggg atg atc ttc ctg
Ile Ser Trp Ser Leu Pro Ala Val Phe Ala Phe Gly Met Ile Phe Leu
145 150 155 160
gag ctg aac tta gaa gga gtt gag gag cag tat cac aat cag gtc ttc
Glu Leu Asn Leu Glu Gly Val Glu Glu Gln Tyr His Asn Gln Val Phe
165 170 175
4
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
tgc ctg cgc ggc tgt ttt cta ttc ttc agt aaa gta tct ggg gta ctg
Cys Leu Arg Gly Cys Phe Leu Phe Phe 5er Lys Val Ser G1y Val Leu
180 185 190
gca ttc atg acg tct ttc tat ata cct ggg tct gtt atg tta ttt gtt
Ala Phe Met Thr Ser Phe Tyr Ile Pro Gly Ser Val Met Leu Phe Val
195 200 205
tac tat gag ata tat ttc ata get aaa gga caa gcg agg tca att aat
Tyr Tyr Glu Ile Tyr Phe Tle Ala Lys Gly Gln Ala Arg Ser Ile Asn
210 215 220
cgt gca aac ctt caa gtt gga ttg gaa ggg gaa agc aga gcg cca caa
Arg Ala Asn Leu Gln Val Gly Leu Glu Gly Glu Ser Arg Ala Pro Gln
225 230 235 240
agc aag gaa aca aaa gcc gcg aaa acc tta ggg atc atg gtg ggc gtt
Ser Lys Glu Thr Lys Ala Ala Lys Thr Leu Gly Ile Met Val Gly Val
245 250 255
ttc ctc ctg tgc tgg tgc ccg ttc ttt ttc tgc atg gtc ctg gac cct
Phe Leu Leu Cys Trp Cys Pro Phe Phe Phe Cys Met Val Leu Asp Pro
260 265 270
ttc ctg ggc tat gtt atc cea ccc act ctg aat gac aca ctg aat tgg
Phe Leu G1y Tyr Val Ile Pro Pro Thr Leu Asn Asp Thr Leu Asn Trp
275 280 285
ttc ggg tac ctg aac tct gcc ttc aac ccg atg gtt tat gcc ttt ttc
Phe Gly Tyr Leu Asn Ser Ala Phe Asn Pro Met Val Tyr Ala Phe Phe
290 295 300
tat ccc tgg ttc aga aga gcg ttg aag atg gtt ctc ttc ggt aaa att
Tyr Pro Trp Phe Arg Arg Ala Leu Lys Met Val Leu Phe Gly Lys Ile
305 310 315 320
ttc caa aaa gat tca tct agg tct aag tta ttt ttg taa
Phe Gln Lys Asp Ser Ser Arg Ser Lys Leu Phe Leu
325 330
<210> 4
<2l1> 332
<212> PRT
<213> Rattus norvegicus
<400> 4
Met His Leu Cys His Asn Ser Ala Asn Ile Ser His Thr Asn Arg Asn
1 5 l0 15
Trp Ser Arg Asp Val Arg Ala Ser Leu Tyr Ser Leu Ile Ser Leu Ile
20 25 30
Ile Leu Thr Thr Leu Val Gly Asn Leu Ile Val Ile Ile Ser Ile Ser
35 40 45
His Phe Lys Gln Ile His Thr Pro Thr Asn Trp Leu Leu His Ser Met
50 55 60
Ala Val Val Asp Phe Leu Leu Gly Cys Leu Val Met Pro Tyr Ser Met
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
65 70 75 80
Val Arg Thr Val Glu His Cys Trp Tyr Phe Gly Glu Leu Phe Cys Lys
85 90 95
Leu His Thr Ser Thr Asp Ile Met Leu Ser Ser Ala Ser Ile Leu His
100 105 l10
Leu Ala Phe Tle Ser Ile Asp Arg Tyr Tyr Ala Val Cys Asp Pro Leu
115 120 125
Arg Tyr Lys Ala Lys Ile Asn Leu Ala Ala Ile Phe Val Met I1e Leu
130 135 140
Ile Ser Trp Ser Leu Pro Ala Val Phe Ala Phe Gly Met Ile Phe Leu
145 150 155 160
Glu Leu Asn Leu Glu Gly Va1 Glu Glu Gln Tyr His Asn Gln Val Phe
165 170 175
Cys Leu Arg Gly Cys Phe Leu Phe Phe Ser Lys Val Ser Gly Val Leu
l80 185 190
Ala Phe Met Thr Ser Phe Tyr Ile Pro Gly Ser Val Met Leu Phe Val
195 200 205
Tyr Tyr Glu Tle Tyr Phe Ile Ala Lys Gly Gln Ala Arg Ser Ile Asn
210 215 220
Arg Ala Asn Leu Gln Val Gly Leu Glu Gly Glu Ser Arg Ala Pro Gln
225 230 235 240
Ser Lys Glu Thr Lys Ala Ala Lys Thr Leu Gly Ile Met Val Gly Val
245 250 255
Phe Leu Leu Cys Trp Cys Pro Phe Phe Phe Cys Met Val Leu Asp Pro
260 265 270
Phe Leu Gly Tyr Va1 Ile Pro Pro Thr Leu Asn Asp Thr Leu Asn Trp
275 280 285
Phe Gly Tyr Leu Asn Ser Ala Phe Asn Pro Met Val Tyr Ala Phe Phe
290 295 300
Tyr Pro Trp Phe Arg Arg Ala Leu Lys Met Val Leu Phe Gly Lys Ile
305 310 315 320
Phe Gln Lys Asp Ser Ser Arg Ser Lys Leu Phe Leu
325 330
<210> 5
<211> 35
<2l2> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: 0ligonucleotide primer.
6
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
<400> 5
gagtcgacct gtgygysaty rciitkgac mgstac
<210> 6
<211> 33
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Oligonucleotide primer.
<400> 6
cagaattcag wagggcaicc agcagaisr ygaa
<210> 7
<211> 21
<212> DNA y
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Oligonucleotide primer.
<400> 7
tctctgagtg atgcatcttt g
<210> 8 ,
<211> 27
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Oligonucleotide primer.
<400> 8
agcagtgctc aactgttctc accatgc
<210> 9
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Oligonucleotide primer.
<400> 9
gcacgattaa ttgacctcgc ttg
<210> 10
<21l> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Oligonucleotide primer.
<400> 10
7
CA 02422288 2003-03-12
WO 02/22801 PCT/USO1/28455
ttgacagccc tcaggaatga tg
<210> 11
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> DeSCription of Artificial Sequence: Oligonucleotide primer.
<400> 11
atggaaaatg gaggctgagc tcag
<210> 12
<211> 8
<212> peptide
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: FLAG sequence
<400> 12
Asp Tyr Lys Asp Asp Asp Asp Lys
8
