MEANS AND METHODS FOR MONITORING PROTEASE INHIBITOR ANTIRETROVIRAL THERAPY AND GUIDING THERAPEUTIC DECISIONS IN THE TREATMENT OF HIV/AIDS

MOYENS ET METHODES DE SUIVI D'UNE THERAPIE ANTIRETROVIRALE A BASE D'INHIBITEURS DE PROTEASES ET DECISIONS D'ORIENTATION THERAPEUTIQUE DANS LE TRAITEMENT DU VIH ET DU SIDA

English Abstract

This invention relates to antiviral drug susceptibility and resistance tests
to be used in identifying effective drug regimens for the treatment of human
immunodeficiency virus (HIV) infection and acquired immunodeficiency syndrome
(AIDS), particularly treatment regimens including a protease inhibitor. The
invention further relates to the means and methods of monitoring the clinical
progression of HIV infection and its response to antiretroviral therapy using
phenotypic or genotypic susceptibility assays.

French Abstract

L'invention porte sur des essais de susceptibilité et se résistance à des médicaments antiviraux servant à identifier des posologies efficaces pour le traitement d'infections par le VIH, et du SIDA, dont en particulier des posologies incluant un inhibiteur de protéase. L'invention porte également sur des moyens et procédés de suivi de la progression de l'infection par le VIH, et de sa réponse à une thérapie antivirale dans le cadre d'essais de susceptibilité aux phénotypes et génotypes.

Claims

-163-

What is claimed is:

1. A method of assessing the effectiveness of
protease antiretroviral therapy of an HIV-infected
patient comprising:

(a) collecting a plasma sample from the
HIV-infected patient;

(b) evaluating whether the plasma sample
contains nucleic acid encoding HIV protease
having a mutation at codon 88; and
(c) determining increased susceptibility to
amprenavir.

2. The method of claim 1, wherein the mutation at codon
88 codes for a serine (S).

3. The method of claim 1, wherein the HIV-infected
patient is being treated with an antiretroviral
agent.

4. A method of assessing the effectiveness of protease
antiretroviral therapy of an HIV-infected patient
comprising:

(a) collecting a plasma sample from the HIV-infected
patient;

(b) evaluating whether the plasma sample contains
nucleic acid encoding HIV protease having a
mutation at codon 88 and additional mutations at
codons 63 and/or 77 or a combination thereof;
and


-164-

(c) determining decreased susceptibilty to
nelfinavir and indinavir and increased
susceptibility to amprenavir.

5. The method of claim 4, wherein the mutation at codon
63 codes for a proline (P) or a glutamine (Q) and
the mutation at codon 77 codes for an isoleucine (I).

6. The method of claim 4, wherein the HIV-infected
patient is being treated with an antiretroviral
agent.

7. A method of assessing the effectiveness of protease
antiretroviral therapy of an HIV-infected patient
comprising:
(a) collecting a plasma sample from the HIV-infected
patient;
(b) evaluating whether the plasma sample contains
nucleic acid encoding HIV protease having a
mutation at codon 88 and additional mutations at
codons 63, 77 and/or 46 or a combination
thereof; and
(c) determining decreased susceptibilty to
nelfinavir and indinavir and increased
susceptibility to amprenavir.

8. The method of claim 7, wherein the mutation at codon
63 codes for a proline (P) or a glutamine (Q), the
mutation at codon 77 codes for an isoleucine (I).and
the mutation at codon 46 codes for a leucine (L) or


-165-

an isaleucine (I).

9. The method of claim 7, wherein the HIV-infected
patient is being treated with an antiretroviral
agent.

10. A method of assessing the effectiveness of protease
antiretroviral therapy of an HIV-infected patient
comprising:

(a) collecting a plasma sample from the
HIV-infected patient;

(b) evaluating whether the plasma sample
contains nucleic acid encoding HIV protease
having a mutation at codon 88 and
additional mutations at codons 63, 77, 46,
10, 20, and/or 36 or a combination thereof:
and
(c) determining decreased susceptibilty to
nelfinavir and indinavir and increased
susceptibility to amprenavir.

11. The method of claim 10, wherein the mutation at codon
63 codes for a proline (P) or a glutamine (Q), the
mutation at codon 77 codes for an isoleucine (I), the
mutation at codon 46 codes for a leucine (L) or an
isoleucine (I), the mutation at codon 10 codes for a
isoleucine (I) or a phenylalanine (F), the mutation
at 20 codes for a threonine (T) or a methionine (M)
or an arginine (R), and the mutation at 36 codes for
an isoleucine (I) or a valine (V).


-166-

12. The method of claim 10, wherein the HIV-infected
patient is being treated with an antiretroviral
agent.

13. A method for evaluating the biological effectiveness
of a candidate HIV antiretroviral drug compound
comprising:

(a) introducing a resistance test vector comprising
a patient-derived segment further comprising a
mutation at codon 88 and an indicator gene into
a host cell;

(b) culturing the host cell from step (a);

(c) measuring the indicator in a target host cell;
and

(d) comparing the measurement of the indicator from
step (c) with the measurement of the indicator
measured when steps (a) - (c) are carried out in
the absence of the candidate antiretroviral drug
compound;

wherein a test concentration of the candidate
antiretroviral drug compound is present at steps (a)
- (c); at steps (b) - (c); or at step (c).

14. A method for evaluating the biological effectiveness
of a candidate HIV antiretroviral drug compound
comprising:

(a) introducing a resistance test vector comprising
a patient-derived segment further comprising a
mutation at codon 88 and mutation(s) at codons


-167-

63 and/or 77 or a combination thereof and an
indicator gene into a host cell;

(b) culturing the host cell from step (a);

(c) measuring the indicator in a target host cell;
and

(d) comparing the measurement of the indicator from
step (c) with the measurement of the indicator
measured when steps (a) - (c) are carried out in
the absence of the candidate antiretroviral drug
compound;
wherein a test concentration of the candidate
antiretroviral drug copound is present at steps (a) -
(c); at steps (b) - (c); or at step (c).

15. A method for evaluating the biological effectiveness
of a candidate HIV antiretroviral drug compound
comprising:

(a) introducing a resistance test vector comprising
a patient-derived segment further comprising a
mutation at codon 88 and mutation(s) at codons
63, 77, and/or 46 or a combination thereof and
an indicator gene into a host cell;

(b) culturing the host cell from step (a);

(c) measuring the indicator in a target host cell;
and

(d) comparing the measurement of the indicator from
step (c) with the measurement of the indicator
measured when steps (a) - (c) are carried out in
the absence of the candidate antiretroviral drug


-168-

compound;
wherein a test concentration of the candidate
antiretroviral drug compound is present at steps (a) -
(c) ; at steps (b) - (c) ; or at step (c).

16. A method for evaluating the biological effectiveness
of a candidate HIV antiretroviral drug compound
comprising:
(a) introducing a resistance test vector comprising
a patient-derived segment further comprising a
mutation at codon 88 and mutations) at codons
63, 77, 46, 10, 20, and/or 36 or a combination
thereof and an indicator gene into a host cell;
(b) culturing the host cell from step (a);
(c) measuring the indicator in a target host cell;
and
(d) comparing the measurement of the indicator from
step (c) with the measurement of the indicator
measured when steps (a) - (c) are carried out in
the absence of the candidate antiretroviral drug
compound;
wherein a test concentration of the candidate
antiretroviral drug compound is present at steps (a) -
(c); at steps (b) - (c); or at step (c).
17. A resistance test vector comprising an HIV -
patient-derived segment further comprising protease
having a mutation at codon 88 and an indicator gene,
wherein the expression of the indicator gene is
dependent upon the patient derived segment.


-169-

18. The resistance test vector of claim 17, wherein the
patient-derived segment having a mutation at codon 88
further comprises mutations at codons 63 and 77 or a
combination thereof.

19. The resistance test vector of claim 17, wherein the
patient-derived segment having a mutation at codon 88
further comprises mutations at codons 63, 77 and/or
46 or a combination thereof.

20. The resistance test vector of claim 17, wherein the
patient-derived segment having a mutation at codon 88
further comprises mutations at codons 63, 77, 46, 10,
20 and/or 36 or a combination thereof.

21. A method for evaluating the viral fitness of a
patient's virus comprising:

(a) introducing a resistance test vector comprising
a patient-derived segment from a patient's virus
and an indicator gene into a host cell;

(b) culturing the host cell from step (a);
(c) measuring the luciferase activity in a target
host cell in the absence of any antiretroviral
drug; and

(d) comparing the measurement of the indicator from
step (c) with the measurement of the indicator
measured when steps (a)-(c) are carried out for
a reference control in the absence of any
antiretroviral drug;


-170-

wherein a reduction in the luciferase activity measured in
step (c) as compared to step (d) indicates a reduction in
viral fitness.

22. A method of assessing the effectiveness of protease
antiretroviral therapy of an HIV-infected patient
comprising:
(a) collecting a plasma sample from the HIV-infected
patient;
(b) evaluating whether the plasma sample contains
nucleic acid encoding HIV protease having a
mutation at codon 82 and secondary positions;
and
(c) determining changes in susceptibility to
ritonavir, nelfinavir, indinavir, saquinivir and
amprenavir.

23. The method of claim 22, wherein the mutation at codon
82 codes for alanine (A), phenylalanine (F), serine
(S), or threonine (T).

24. The method of claim 22, wherein the HIV-infected
patient is being treated with an antiretroviral
agent.

25. A method of assessing the effectiveness of protease
antiretroviral therapy of an HIV-infected patient
comprising:
(a) collecting a plasma sample from the
HIV-infected patient;


-171-

(b) evaluating whether the plasma sample
contains nucleic acid encoding HIV protease
having a mutation at colon 82 and an
additional mutation at colon 24; and
(c) determining decreased susceptibilty to
indinavir.

26. The method of claim 25, wherein the mutation at colon
24 codes for an isoleucine (I).

27. The method of claim 25, wherein the HIV-infected
patient is being treated with an antiretroviral
agent.

28. A method of assessing the effectiveness of protease
antiretroviral therapy o,f an HIV-infected patient
comprising:
(a) collecting a plasma sample from the HIV-infected
patient;
(b) evaluating whether the plasma sample contains
nucleic acid encoding HIV protease having a
mutation at colon 82 and an additional mutation
at colon 71; and
(c) determining decreased susceptibilty to
indinavir.

29. The method of claim 28, wherein the mutation at colon
71 codes for an amino acid selected from the group
consisting of a threonine, (T) valine, (V) leucine
(L) and isoleucine (I).



-172-

30. The method of claim 28, wherein the HIV-infected
patient is being treated with an antiretroviral
agent.

31. A method of assessing the effectiveness of protease
antiretroviral therapy of an HIV-infected patient
comprising:
(a) collecting a plasma sample from the HIV-infected
patient;
(b) evaluating whether the plasma sample contains
nucleic acid encoding HIV protease having a
mutation at codon 82 and additional mutations at
codons selected from the group consisting of
codon 54, 46, 10, 63, and a combination thereof;
and
(c) determining decreased susceptibilty to
indinavir.

32. The method of claim 31, wherein the mutation at codon
54 codes for an amino acid selected from the group
consisting of a valine (V), alanine (A), leucine (L)
and threonine (T), the mutation at codon 46 codes for
an amino acid selected from the group consisting of a
leucine (Z), isoleucine (I) and valine (V), the
mutation at codon 10 codes for an amino acid selected
from the group consisting of an isoleucine (I),
valine (V), phenylalanine (F), and arginine (R), and
the mutation at codon 63 codes for an amino acid
selected from the group consisting of proline (P),


-173-

alanine (A) , serine (S) , threonine (T) , glutamine (Q) ,
cysteine (C),and valine (V).

33. The method of claim 31, wherein the HIV-infected
patient is being treated with an antiretroviral
agent.

34. A method of assessing the effectiveness of protease
antiretroviral therapy of an HIV-infected patient
comprising:
(a) collecting a plasma sample from the HIV-infected
patient;
(b) evaluating whether the plasma sample contains
nucleic acid encoding HIV protease having a
mutation at codon 82 and an additional mutation
at codon 20; and
(c) determining decreased susceptibilty to
saquinavir.

35. The method of claim 34, wherein the mutation at codon
20 codes for an amino acid selected from the group
consisting of a methionine (M), threonine (T),
isoleucine (I), and arginine (R).

36. The method of claim 34, wherein the HIV-infected
patient is being treated with an antiretroviral
agent.

37. A method of assessing the effectiveness of protease
antiretroviral therapy of an HIV-infected patient


-174-

comprising:
(a) collecting a plasma sample from the HIV-infected
patient;
(b) evaluating whether the plasma sample contains
nucleic acid encoding HIV protease having a
mutation at colon 82 and an additional mutation
at colon 36; and
(c) determining decreased susceptibilty to
saquinavir.

38. The method of claim 37, wherein the mutation at colon
36 for an amino acid selected from the group
consisting of a isoleucine (I), leucine (L), and
valine (V).

39. The method of claim 37, wherein the HIV-infected
patient is being treated with an antiretroviral
agent.

40. A method of assessing the effectiveness of protease
antiretroviral therapy of an HIV-infected patient
comprising:
(a) collecting a plasma sample from the HIV-infected
patient;
(b) evaluating whether the plasma sample contains
nucleic acid encoding HIV protease having a
mutation at colon 82 and additional mutations at
colons 24, 71, 54, and/or 10 or a combination
thereof; and
(c) determining decreased susceptibilty to


-175-

saquinavir.

41. The method of claim 40, wherein the mutation at codon
24 codes for an isoleucine (I), the mutation at codon
71 codes for an amino acid selected from the group
consisting of a threonine (T), valine (V), leucine
(L), and isoleucine (I), the mutation at codon 54
codes for an amino acid selected from the group
consisting of valine (V), alanine (A), leucine (L),
and threonine (T), and the mutation at codon 10 codes
for an amino acid selected from the group consisting
of an isoleucine (I), valine (V), phenylalanine (F),
and arginine (R).

42. The method of claim 40, wherein the HIV-infected
patient is being treated with an antiretroviral
agent.

43. A method of assessing the effectiveness of protease
antiretroviral therapy of an HIV-infected patient
comprising:
(a) collecting a plasma sample from the HIV-infected
patient;
(b) evaluating whether the plasma sample contains
nucleic acid encoding HIV protease having a
mutation at codon 82 and the number of
additional mutations at secondary positions; and
(c) determining decreased susceptibilty to indinavir
and saquinavir.


-176-

44. The method of claim 43, wherein the number of
additional mutations at secondary positions is at
least 3.

45. A method of assessing the effectiveness of protease
antiretroviral therapy of an HIV-infected patient
comprising:
(a) collecting a plasma sample from the HIV-infected
patient;
(b) evaluating whether the plasma sample contains
nucleic acid encoding HIV protease having a
mutation at codon 90 and secondary mutations;
and
(c) determining changes in susceptibility to
ritonavir, nelfinavir, indinavir, saquinivir and
amprenavir.

46. The method of claim 45, wherein the mutation at codon
90 codes for a methionine.

47. The method of claim 45, wherein the HIV-infected
patient is being treated with an antiretroviral
agent.

48. A method of assessing the effectiveness of protease
antiretroviral therapy of an HIV-infected patient
comprising:
(a) collecting a plasma sample from the HIV-infected
patient;


-177-

(b) evaluating whether the plasma sample contains
nucleic acid encoding HIV protease having a
mutation at codon 90 and an additional mutation
at codon 73; and
(c) determining decreased susceptibilty to
indinavir.

49. The method of claim 48, wherein the mutation at codon
73 codes for an amino acid selected from the group
consisting of a serine (S), threonine (T), and
cysteine (C).

50. The method of claim 48, wherein the HIV-infected
patient is being treated with an antiretroviral
agent.

51. A method of assessing the effectiveness of protease
antiretroviral therapy of an HIV-infected patient
comprising:
(a) collecting a plasma sample from the HIV-infected
patient;
(b) evaluating whether the plasma sample contains
nucleic acid encoding HIV protease having a
mutation at codon 90 and an additional mutation
at codon 71; and
(c) determining decreased susceptibilty to
indinavir.

52. The method of claim 51, wherein the mutation at codon
71 codes for an amino acid selected from the group


-178-

consisting of a threonine (T), valine {V), leucine
(L), and isoleucine (I).

53. The method of claim 51, wherein the HIV-infected
patient is being treated with an antiretroviral
agent.

54. A method of assessing the effectiveness of protease
antiretroviral therapy of an HIV-infected patient
comprising:
(a) collecting a plasma sample from the HIV-infected
patient;
(b) evaluating whether the plasma sample contains
nucleic acid encoding HIV protease having a
mutation at codon 90 and an additional mutation
at codon 46,; and
(c) determining decreased susceptibilty to
indinavir.

55. The method of claim 54, wherein the mutation at codon
46 codes for an amino acid selected from the group
consisting of a leucine (L), isoleucine (I) and
valine (V).

56. The method of claim 54, wherein the HIV-infected
patient is being treated with an antiretroviral
agent.

57. A method of assessing the effectiveness of protease
antiretroviral therapy of an HIV-infected patient


-179-

comprising:
(a) collecting a plasma sample from the HIV-infected
patient;
(b) evaluating whether the plasma sample contains
nucleic acid encoding HIV protease having a
mutation at codon 90 and an additional mutation
at codon 73; and
(c) determining decreased susceptibilty to
saquinavir.

58. The method of claim 57, wherein the mutation at codon
73 codes for an amino acid selected from the group
consisting of a serine (S), threonine (T), and
cysteine (C).

59. The method of claim 57, wherein the HIV-infected
patient is being treated with an antiretroviral
agent.

60. A method of assessing the effectiveness of protease
antiretroviral therapy of an HIV-infected patient
comprising:
(a) collecting a plasma sample from the HIV-infected
patient;
(b) evaluating whether the plasma sample contains
nucleic acid encoding HIV protease having a
mutation at codon 90 and an additional mutation
at codon 71; and
(c) determining decreased susceptibilty to
saquinavir.


-180-

61. The method of claim 60, wherein the mutation at codon
71 codes for an amino acid selected from the group
consisting of a threonine (T), valine (V), leucine
(L), and isoleucine (I).

62. The method of claim 60, wherein the HIV-infected
patient is being treated with an antiretroviral
agent.

63. A method of assessing the effectiveness of protease
antiretroviral therapy of an HIV-infected patient
comprising:
(a) collecting a plasma sample from the HIV-infected
patient;
(b) evaluating whether the plasma sample contains
nucleic acid encoding HIV protease having a
mutation at codon 90 and additional mutations at
colons 77 and 10; and
(c) determining decreased susceptibilty to
saquinavir.

64. The method of claim 63, wherein the mutation at colon
77 codes for an amino acid selected from the group
consisting of isoleucine (I) and threonine (T) and
the mutation at colon 10 codes for an amino acid
selected from the group consisting of isoleucine (I),
valine (V), phenylalanine (F), and arginine (R).

65. The method of claim 63, wherein the HIV-infected


-181-

patient is being treated with an antiretroviral
agent.

66. A method of assessing the effectiveness of protease
antiretroviral therapy of an HIV-infected patient
comprising:
(a) collecting a plasma sample from the HIV-infected
patient;
(b) evaluating whether the plasma sample contains
nucleic acid encoding HIV protease having a
mutation at codon 90 and the number of
additional mutations at secondary positions; and
(c) determining decreased susceptibilty to indinavir
and saquinavir.

67. The method of claim 66, wherein the number of
additional mutations at secondary positions is at
least 3.

(ppp) A method of assessing the effectiveness of
protease antiretroviral therapy of an
HIV-infected patient comprising:
(a) collecting a plasma sample from the HIV-infected
patient;
(b) evaluating whether the plasma sample contains
nucleic acid encoding HIV protease having a mutation
at codons 82 and 90 and secondary mutations; and
(c) determining changes in susceptibility to
ritonavir, nelfinavir, indinavir, saquinivir and
amprenavir.


-182-

69. The method of claim 68, wherein the mutation at codon
82 codes for an amino acid selected from the group
consisting of alanine (A), phenylalanine (F), serine
(S), and threonine (T) and the mutation at codon 90
codes for a methionine (M).

70. The method of claim 68, wherein the HIV-infected
patient is being treated with an antiretroviral
agent.

71. A method for evaluating the biological effectiveness
of a candidate HIV protease antiretroviral drug
compound comprising:
(a) introducing a resistance test vector comprising
a patient-derived segment further comprising a
mutation at codon 82 and additional mutations at
one or more secondary positions and an indicator
gene into a host cell;
(b) culturing the host cell from step (a);
(c) measuring the indicator in a target host cell;
and
(d) comparing the measurement of the indicator from
step (c) with the measurement of the indicator
measured when steps (a) - (c) are carried out in
the absence of the candidate antiretroviral drug
compound;

wherein a test concentration of the candidate
antiretroviral drug compound is present at steps (a)


-183-

- (c) ; at steps (b) - (c) ; or at step (c).

72. A method for evaluating the biological effectiveness
of a candidate HIV protease antiretroviral drug
compound comprising:
(a) introducing a resistance test vector comprising
a patient-derived segment further comprising a
mutation at codon 82 and secondary mutation(s)
at codons 20, 24, 71, 54 and/or 10 or a
combination thereof and an indicator gene into a
host cell;
(b) culturing the host cell from step (a);
(c) measuring the indicator in a target host cell;
and
(d) comparing the measurement of the indicator from
step (c) with the measurement of the indicator
measured when steps (a) - (c) are carried out in
the absence of the candidate antiretroviral drug
compound;
wherein a test concentration of the candidate
antiretroviral drug compound is present at steps (a)
- (c) ; at steps (b) - (c) ; or at step (c).

73. A method for evaluating the biological effectiveness
of a candidate HIV protease antiretroviral drug
compound comprising:
(a) introducing a resistance test vector comprising
a patient-derived segment further comprising a
mutation at codon 90 and additional mutations at
one or more secondary positions and an indicator


-184-

gene into a host cell;
(b) culturing the host cell from step (a);
(c) measuring the indicator in a target host cell;
and
(d) comparing the measurement of the indicator from
step (c) with the measurement of the indicator
measured when steps (a) - (c) are carried out in
the absence of the candidate antiretroviral drug
compound;
wherein a test concentration of the candidate
antiretroviral drug compound is present at steps (a)
- (c) ; at steps (b) - (c); or at step (c).

74. A method for evaluating the biological effectiveness
of a candidate HIV protease antiretroviral drug
compound comprising:
(a) introducing a resistance test vector comprising
a patient-derived segment further comprising a
mutation at codon 90 and secondary mutation(s)
at codons 73, 71, 10 and/or 46 or a combination
thereof and an indicator gene into a host cell;
(b) culturing the host cell from step (a);
(c) measuring the indicator in a target host cell;
and
(d) comparing the measurement of the indicator from
step (c) with the measurement of the indicator
measured when steps (a) - (c) are carried out in
the absence of the candidate antiretroviral drug


-185-

compound;
wherein a test concentration of the candidate
antiretroviral drug compound is present at steps (a)
- (c); at steps (b) - (c); or at step (c).

75. A method for evaluating the biological effectiveness
of a candidate HIV protease antiretroviral drug
compound comprising:
(a) introducing a resistance test vector comprising
a patient-derived segment further comprising a
mutation at codons 82 and 90 and additional
mutations at one or more secondary positions and
an indicator gene into a host cell;
(b) culturing the host cell from step (a);
(c) measuring the indicator in a target host cell;
and
(d) comparing the measurement of the indicator from
step (c) with the measurement of the indicator
measured when steps (a) - (c) are carried out in
the absence of the candidate antiretroviral drug
compound;

wherein a test concentration of the candidate
antiretroviral drug compound is present at steps (a)
- (c) ; at steps (b) - (c); or at step (c).

76. A resistance test vector comprising an HIV patient-
derived segment further comprising protease having a
mutation at codon 82 and an indicator gene, wherein


-186-

the expression of the indicator gene is dependent
upon the patient derived segment.

77. The resistance test vector of claim 76, wherein the
patient-derived segment having a mutation at codon 82
further comprises at least one secondary mutation at
a codon selected from the group consisting of 20, 24,
71, 54, 10 and a combination thereof.

78. The resistance test vector of claim 76, wherein the
patient-derived segment having a mutation at codon 90
further comprises at least one secondary mutation at
a codon selected from the group consisting of 73, 71,
46, 10 and a combination thereof.

79. A method for determining replication capacity for a
patient's virus comprising:
(a) introducing a resistance test vector comprising
a patient derived segment and an indicator gene
into a host cell;
(b) culturing the host cell from (a);
(c) harvesting viral particles from step (b) and
infecting target host cells;
(d) measuring expression of the indicator gene in
the target host cell, wherein the expression of
the indicator gene is dependent upon the
patient-derived segment;
(e) comparing the expression of the indicator gene
from (d) with the expression of the indicator
gene measured when steps (a) through (d) are


-187-

carried out in a control resistance test vector;
and
(f) normalizing the expression of the indicator gene
by measuring an amount of virus in step (c).

80. A method of assessing the effectiveness of protease
antiretroviral therapy of an HIV-infected patient
comprising:
(a) collecting a biological sample from the
HIV-infected patient;
(b) evaluating whether the biological sample
contains nucleic acid encoding HIV protease
having a mutation at codon 82 or codon 90; and
(c) determining changes in susceptibility to
protease inhibitors.

81. The method of claim 80, wherein step (c) determines
changes in susceptibility to saquinavir.

82. The method of claim 80, wherein the mutation at codon
82 codes for alanine (A), phenylalanine (F), serine
(S), or threonine (T).

83. The method of claim 82, wherein the mutation at codon
82 is a substitution of alanine (A), phenylalanine
(F), serine (S), or threonine (T) for valine(V).

84. The method of claim 80, wherein the mutation at codon
90 codes for methionine (M).


-188-

85. The method of claim 84, wherein the mutation at codon
90 is a substitution of methionine (M) for leucine
(L).

86. A method for evaluating the biological effectiveness
of a candidate HIV protease antiretroviral drug
compound comprising:
(a) introducing a'resistance test vector comprising
a patient-derived segment having nucleic acid
encoding HIV protease with a mutation at codon
82 or codon 90 and an indicator gene into a host
cell;
(b) culturing the host cell from step (a);
(c) measuring the indicator gene in a target host
cell; and
(d) comparing the measurement of the indicator gene
from step (c) with the measurement of the
indicator gene measured when steps (a) - (c) are
carried out in the absence of the candidate
antiretroviral drug compound;
wherein a test concentration of the candidate
antiretroviral drug compound is present at steps (a)
- (c) ; at steps (b) - (c); or at step (c).

87. A resistance test vector comprising an HIV patient-
derived segment further comprising protease having a
mutation at codon 82 or codon 90 and an indicator
gene, wherein the expression of the indicator gene is
dependent upon the patient-derived segment.


-189-

88. The resistance test vector of claim 87, wherein the
patient-derived segment having a mutation at codon 82
codes for alanine (A), phenylalanine (F), serine (S),
or threonine (T).

89. The resistance test vector of claim 88, wherein the
patient-derived segment having a mutation at codon 82
is a substitution of alanine (A), phenylalanine (F),
serine (S), or threonine (T) for valine(V).

90. The resistance test vector of claim 87, wherein the
patient-derived segment having a mutation at codon 90
codes for methionine (M).

91. The resistance test vector of claim 90, wherein the
patient-derived segment having a mutation at codon 90
is a substitution of methionine (M) for leucine (L).

92. A method for determining replication capacity for a
patient's virus comprising:
(a) introducing a resistance test vector comprising
a patient-derived segment and an indicator gene
into a host cell;
(b) culturing the host cell from (a):
(c) harvesting viral particles from step (b) and


-190-

infecting target host cells;
(d) measuring expression of the indicator gene in
the target host cell, wherein the expression of
the indicator gene is dependent upon the
patient-derived segment; and
(e) comparing the expression of the indicator gene
from (d) with the expression of the indicator
gene measured when steps (a) through (d) are
carried out in a control resistance test vector.

93. The method of claim 92 further comprising
the step of:
(f) normalizing the expression of the indicator gene
by measuring an amount of virus in step (c).

94. The method of claim 92 wherein the patient-derived
segment comprises nucleic acid encoding HIV integrase
having a mutation at codon 66.

95. The method of claim 92 wherein the patient-derived
segment comprises nucleic acid encoding HIV integrase
having a mutation at codon 154.

96. The method of claim 94 wherein the patient-derived
segment comprises nucleic acid encoding HIV integrase
having an additional mutation at codon 153.

97. The method of claim 94 wherein the patient-derived
segment comprises nucleic acid encoding HIV integrase
having an additional mutation at codon 154.

Description

CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
1
MEANS AND METHODS FOR MONITORING PROTEASE
INHIBITOR ANTIRETROVIRAh THERAPY AND GUIDING
THERAPEUTIC DECISIONS IN THE TREATMENT OF HIV/AIDS
Throughout this application, various references are
referred to within parenthesis. Disclosures of these
publications in their entireties are hereby incorporated
by reference into this application to more fully describe
the state of the art to which this invention pertains.
Technical Field
This invention relates to antiretroviral drug
susceptibility and resistance tests to be used in
identifying effective drug regimens for the treatment of
human immunodeficiency virus (HIV) infection and acquired
immunodeficiency syndrome (AIDS). The invention further
relates to the means and methods of monitoring the
clinical progression of HIV infection and its response to
antiretroviral therapy using phenotypic or genotypic
susceptibility assays. The invention also relates to
novel vectors, host cells and compositions for carrying
out phenotypic susceptibility tests. The invention
further relates to the use of various genotypic
methodologies to identify patients who do not respond to a
particular antiretroviral drug regimen. This invention
also relates to the screening of candidate antiretroviral
drugs for their capacity to inhibit viral replication,


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-2-
selected viral sequences and/or viral proteins. More
particularly, this invention relates to the determination
of protease inhibitor (PRI) susceptibility using
phenotypic or genotypic susceptibility tests. This
invention also relates to a means and method for
accurately and reproducibly measuring viral replication
fitness.
Background of the Invention
HIV infection is characterized by high rates of viral
turnover throughout the disease process, eventually
leading to CD4 depletion and disease progression. Wei X,
Ghosh SK, Taylor ME, et al. (1995) Nature 343, 117-122 and
Ho DD, Naumann AU, Perelson AS, et al. (1995) Nature 373,
123-126. The aim of antiretroviral therapy is to achieve
substantial and prolonged suppression of viral
replication. Achieving sustained viral control is likely
to involve the use of sequential therapies, generally each
therapy comprising combinations of three or more
antiretroviral drugs. Choice of initial and subsequent
therapy should, therefore, be made on a rational basis,
with knowledge of resistance and cross-resistance patterns
being vital to guiding those decisions. The primary
rationale of combination therapy relates to synergistic or
additive activity to achieve greater inhibition of viral
replication. The tolerability of drug regimens will
remain critical, however, as therapy will need to be
maintained over many years.
In an untreated patient, some 101° new viral particles are
produced per day. Coupled with the failure of HIV reverse
transcriptase (RT) to correct transcription errors by
exonucleolytic proofreading, this high level of viral


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-3-
turnover results in 109 to 105 mutations per day at each
position in the HIV genome. The result is the rapid
establishment of extensive genotypic variation. While
some template positions or base pair substitutions may be
more error prone (Mansky LM, Temin HM (1995) J Virol 69,
5087-5094) (Schinazi RF, Lloyd RM, Ramanathan CS, et al.
(1994) Antimicrob Agents Chemother 38, 268-274),
mathematical modeling suggests that, at every possible
single point, mutation may occur up to 10,000 times per
day in infected individuals.
For antiretroviral drug resistance to occur, the target
enzyme must be modified while preserving its function in
the presence of the inhibitor. Point mutations leading to
an amino acid substitution may result in changes in shape,
size or charge of the active site, substrate binding site
or in positions surrounding the active site of the enzyme.
Mutants resistant to antiretroviral agents have been
detected at low levels before the initiation of therapy.
(Mohri H, Singh MK, Ching WTW, et al. (1993) Proc Natl
Acad Sci USA 90, 25-29) (Najera I, Richman DD, Olivares I,
et al. (1994) AIDS Res Hum Retroviruses 10, 1479-1488)
(Najera I, Holguin A, Quinones-Mateu E, et al. (1995) J
Virol 69, 23-31). However, these mutant strains represent
only a small proportion of the total viral load and may
have a replication or competitive disadvantage compared
with wild-type virus. (Coffin JM (1995) Science 267,
483-489). The selective pressure of antiretroviral
therapy provides these drug-resistant mutants with a
competitive advantage and thus they come to represent the
dominant quasi species (Frost SDW, McLean AR (1994) AIDS
8, 323332) (Kellam P, Boucher CAB, Tijnagal JMGH (1994) J


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-4-
Gen Virol 75, 341-351) ultimately leading to a rebound in
viral load in the patient.
Early development of antiretroviral therapy focused on
inhibitors of reverse transcriptase. Both nucleoside and
non-nucleoside inhibitors of this enzyme showed
significant antiviral activity (DeClerq, E. (1992) AIDS
Res. Hum. Retrovir. 8:119-134). However, the clinical
benefit of these drugs had been limited due to drug
resistance, limited potency, and host cellular factors
(Richman, D.D. (1993) Ann. Rev. Pharm. Tox. 32:149-164).
Thus inhibitors targeted against a second essential enzyme
of HIV were urgently needed.
In 1988, the protease enzyme of HIV was crystallized and
its three-dimensional structure was determined, (Navia MA,
Fitzgerald PMD, McKeever BM, Leu CT, Heimbach JC, Herber
WK, Sigal IS, Darke PL, Springer JP (1989) Nature
337:615-620 and Winters MA, Schapiro JM, Lawrence J,
Merigan TC (1997) In Abstracts of the International
Workshop on HIV Drug Resistance, Treatment Strategies and
Eradication, St. Petersburg, Fla.) allowing for the rapid
development of protease inhibitors. Initially, it was
hypothesized that HIV protease, unlike reverse
transcriptase, would be unable to accommodate mutations
leading to drug resistance. This is not the case, and to
date over 20 amino acid substitutions in the HIV protease
have been observed during treatment with the currently
available protease inhibitors. The genetic pattern of
mutations conferring resistance to these protease
inhibitors is complex, and cross-resistance between
structurally different compounds occurs.


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
_$-
PROTEASE INHIBITORS
HIV protease was classified as an aspartic proteinase on
the basis of putative active-site homology (Toh H, Ono M,
Saigo K, Miyata T (1985) Nature 315:691), its inhibition
by peptastin (Richards AD, Roberts R, Dunn BM, Graves MC,
Kay J (1989) FEBS Lett 247:113), and its crystal structure
(Navia MA, Fitzgerald PMD, McKeever BM, Lau CT, Heimbach
JC, Herber WK, Sigal IS, Darke PL, Springer JP (1989)
Nature 337:615-620). The enzyme functions as a homodimer
composed of two identical 99-amino acid chains (Debouck C,
Navia MA, Fitzgerald PMD, McICeever BM, Leu CT, Heimbach
JC, Herber WK, Sigal IS, Darke PL, Springer JP (1988-)
Proc. Natl. Acad. Sci. USA 84:8903-8906), with each chain
containing the characteristic Asp-Thr-Gly active-site
sequence at positions 25 to 27 (Toh H, Ono M, Saigo K,
Miyata T (1985) Nature 315:691).
HIV protease processes gag (p55) and gag-pol (p160)
polyprotein products into functional core proteins and
viral enzymes (Kohl NE, Diehl RE, Rands E, Davis LJ,
Hanobik MG, Wolanski B, Dixon RA (1991) J. Virol.
65:3007-3014 and Kramer RA, Schaber MD, Skalka AM, Ganguly
K, Wong-Staal F, Reddy EP (1986) Science 231:1580-1584).
During or immediately after budding, the polyproteins are
cleaved by the enzyme at nine different cleavage sites to
yield the structural proteins (p17, p24, p7, and p6) as
well as the viral enzymes reverse transcriptase,
integrase, and protease (Pettit SC, Michael SF, Swanstrom
R (1993) Drug Discov. Des. 1:69-83).
An asparagine replacement for aspartic acid at active-site
residue 25 results in the production of noninfectious


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-6-
viral particles with immature, defective cores (Huff JR
(1991) AIDS J. Med. Chem. 34:2305-2314, Kaplan AH, Zack
JA, Knigge M, Paul DA, Kempf DJ, Norbeck DW, Swanstrom R
(1993) J. Virol. 67:4050-4055, Kohl NE, Emini EA, Schleif
WA, Davis LJ, Heimbach JC, Dixon RA, Scolnik EM, Sigal IS
(1988) Proc. Natl. Acad. Sci. USA 85:4686-4690, Peng C, Ho
BK, Chang TW, Chang NT (1989) J. Virol. 63:2550-2556).
Similarly, wild-type virus particles produced by infected
cells treated with protease inhibitors contain unprocessed
precursors and are noninfectious (Crawford S, Goff SP
(1985) J. Virol. 53:899-907, Gottlinger HG, Sodroski JG,
Haseltine WA (1989) Proc. Natl. Acad. Sci. USA
86:5781-5785, Katoh IY, Yoshinaka Y, Rein A, Shibuya M,
Odaka T, Oroszlan S (1985) Virology 145:280-292, Kohl NE,
Emini EA, Schleif WA, Davis LJ, Heimbach JC, Dixon RA,
Scolnik EM, Sigal IS (1988) Proc. Natl. Acad. Sci. USA
85:4686-4690, Peng C, Ho BK, Chang TW, Chang NT (1989) J.
Virol. 63:2550-2556, Stewart L, Schatz G, Wogt VM (1990)
J. Virol. 64:5076-5092). Unlike reverse transcriptase
inhibitors, protease inhibitors block the production of
infectious virus from chronically infected cells (Lambert
DM, Petteway, Jr. SR, McDanal CE, Hart TK, Leary JJ,
Dreyer GB, Meek TD, Bugelski PJ, Bolognesi DP, Metcalf BW,
Matthews TJ (1992) Antibicrob. Agents Chemother.
36:982-988). Although the viral protease is a symmetric
dimer, it binds its natural substrates or inhibitors
asymmetrically (Dreyer, GB, Boehm JC, Chenera B,
DesJarlais RL, Hassell AM, Meek TD, Tomaszek TAJ, Lewis M
(1993) Biochemistry 32:937-947, Miller MJ, Schneider J,
Sathyanarayana BK, Toth MV, Marshall GR, Clawson L, Selk
L, Kent SB, Wlodawer A (1989) Science 246:1149-1152).
These findings together with the knowledge that amide


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
_7_
bonds of proline residues are not susceptible to cleavage
by mammalian endopeptidases gave rise to the first class
of HIV-1 protease inhibitors based on the transition state
mimetic concept, with the phenylalanine-proline cleavage
site being the critical nonscissile bond (Roberts NA,
Martin JA, Kinchington D, Broadhurst AV, Craig JC, Duncan
IB, Galpin SA, Handa BK, Kay J, Krohn A, Lambert RW,
Merett JH, Mills JS, Parkes KEB, Redshaw S, Ritchie AJ,
Taylor DL, Thomas GJ, .Machin PJ (1990) Science
248:358-361).
Amino acids implicated in resistance to protease
inhibitors.
As new protease inhibitors are developed, the ability of
certain amino acid substitutions to confer resistance to
the inhibitor is usually determined by several methods,
including selection of resistant strains in vitro, site-
directed mutagenesis, and determination of amino acid
changes that are selected during early phase clinical
trials in infected patients. While some amino acid
substitutions are specifically correlated with resistance
to certain protease inhibitors (see below), there is
considerable overlap between sets of mutations implicated
in resistance to all approved protease inhibitors. Many
investigators have attempted to classify these mutations
as either being "primary" or "secondary", with varying
definitions. For example, some investigators classify as
primary mutations which are predicted, based on X-ray
crystallographic data, to be in the enzyme active site
with the potential for direct contact with the inhibitor
(e. g. D30N, G48V, I50V, V82A/F/S/T, I84V, N88S, L90M).


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
_$_
Secondary mutations are usually considered as being
compensatory for defects in enzyme activity imposed by
primary mutations, or as having enhancing effects on the
magnitude of resistance imparted by the primary mutations
(e. g. L10I/F/R/V, K20I/M/R/T, L24I, V32I, L33F/V,
M36I/L/V, M46T/L/V, I47V, I54L/V, L63X, A71T/V, G73A/S/T,
V77I, N88D). Lists of mutations and corresponding
inhibitors are maintained by several organizations, for
example: Schinazi et al., Mutations in retroviral genes
associated with drug resistance, Intl. Antiviral News
1999,7:46-69 and Shafer et al., Human Immunodeficiency
Virus Reverse Transcriptase and Protease Sequence
Database, Nucleic Acids Research 1999, 27(1), 348-352
(also accessible via the Internet at http://www.viral
resistance.com/ or http://hivdb.stanford. edu/hiv/)


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-9-
Saauinavir
Saquinavir, developed by Hoffmann-La Roche, was the first
protease inhibitor to undergo clinical evaluation,
demonstrating that HIV-1 protease was a valid target for
the treatment of HIV infection (Jacobsen H, Brun-Vezinet
F, Duncan I, Hanggi M, Ott M, Vella S, Weber J, Mous J
(1994) J. Virol. 68:2016-2020). Saquinavir is a highly
active peptidomimetic protease inhibitor with a 90%
inhibitory concentration (IC90) of 6 nM (id). In vitro,
saquinavir can select for variants with one or both of two
amino acid substitutions in the HIV-1 protease gene, a
valine-for-glycine substitution at position 48 (G48V), a
methionine-for-leucine substitution at residue 90 (L90M),
and the double substitution G48V-L90M (Eberle J, Bechowsky
B, Rose D, Hauser U, vonder Helm K, Guertler L, Nitschko H.
(1995) AIDS Res. Hum. Retroviruses 11:671-676, Jacobsen H,
Yasargil K, Winslow DL, Craig JC, Kroehn A, Duncan IB,
Mous J (1995) Virology 206:527-534, Turriziani O,
Antonelli G, Jacobsen H, Mous J, Riva E, Pistello M,
Dianzani F (1994) Acta Virol. 38:297-298). In most cases,
G48V is the first mutation to appear, and continued
selection results in highly resistant double-mutant
variants. A substitution at either residue results in a
3- to 10-fold decreased susceptibility to the inhibitor,
whereas the simultaneous occurrence of both substitutions
causes a more severe loss of susceptibility of >100-fold
( id) .
In vivo, saquinavir therapy appears to select almost
exclusively for mutations at codons 90 and 48 (id,
Jacobsen H, Hangi M, Ott M, Duncan IB, Owen S, Andreoni M,
Vella S, Mous J (1996) J. Infect. Dis. 173:1379-1387,
Vella S, Galluzzo C, Giannini G, Pirillo MF, Duncan I,


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-10-
Jacobsen H, Andreoni M, Sarmati L, Ercoli L (1996)
Antiviral Res. 29:91-93). Saquinavir-resistant variants
emerge in approximately 450 of patients after 1 year of
monotherapy with 1,800 mg daily (Craig IC, Duncan IB,
Roberts NA, Whittaker L (1993) In Abstracts of the 9th
International Conference on AIDS, Berlin, Germany, Duncan
IB, Jacobsen H, Owen S, Roberts NA (1996) In Abstracts of
the 3rd Conference of Retroviruses and Opportunistic
Infections, Washington, D.D., id, Mous J, Brun-Vezinet F,
Duncan IB, Haenggi M, Jacobsen H, Vella S (1994) In
Abstracts of the 10th International Conference on AIDS,
Yokohama, Japan). The frequency of resistance is lower
(22%) in patients receiving combination therapy with
zidovudine, zalcitabine, and saquinavir (Collier AC,
Coombs R, Schoenfeld DA, Bassett RL, Joseph Timpone MS,
Baruch A, Jones M, Facey K, Whitacre C, McAuliffe VJ,
Friedman HM, Merigan TC, Reichmann RC, Hooper C, Corey L
(1996) N. Engl. J. Med. 334:1011-1017). In contrast to in
vitro-selected virus, where the G48V mutation is the first
step to resistance, the L90M exchange is the predominant
mutation selected in vivo while the G48V (20) or the
double mutant (<20) is rarely found (id). In another
recent study of in vivo resistance during saquinavir
monotherapy no patient was found to harbor a G48V mutant
virus (Ives KJ, Jacobsen H, Galpin SA, Garaev MM, Dorrell
L, Mous J, Bragman K, Weber JN (1997 J. Antimicrob.
Chemother. 39:771-779). Interestingly, Winters et al.
(id) observed a higher frequency of the G48V mutation in
patients receiving higher saquinavir doses as monotherapy.
All patients (six of six) who initially developed G48V
also acquired a V82A mutation either during saquinavir
treatment or after switching to either indinavir or


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-11-
nelfinavir. An identical mutational pattern was found in
another study during saquinavir monotherapy (Eastman PS,
Duncan IB, Gee C, Race E (1997) In Abstracts of the
International Workshop on HIV Drug Resistance, Treatment
Strategies and Eradication, St. Petersburg, Fla.). Some
residues represent sites of natural polymorphism of the
HIV-1 protease (positions 10, 36, 63, and 71) and appear
to be correlated to the L90M mutation (id). Another
substitution, G73S, has been recently identified and may
play a role in saquinavir resistance in vivo. Isolates
from five patients with early saquinavir resistance and
those from two patients with induced saquinavir resistance
after a switch of therapy to indinavir carried the G73S
and the L90M substitutions Dulioust A, Paulous S,
Guillemot L, Boue F, Galanaud P, Clavel F (1997) In
Abstracts of the International Workshop on HIV Drug
Resistance, Treatment Strategies and Eradication, St.
Petersburg, Fla.).
Ritonavir
Ritonavir, developed by Abbott Laboratories, was the
second HIV protease inhibitor to be licensed in the United
States. Ritonavir is a potent and selective inhibitor of
HIV protease that is derived from a C2-symmetric,
peptidomimetic inhibitor (Ho DD, Toyoshima T, Mo H, Kempf
DJ, Norbeck D, Chen CM, Wideburg NE, Burt SK, Erickson JW,
Singh MK (1994) J. Virol. 68:2016-2020). In vitro
activity has been demonstrated against a variety of
laboratory strains and clinical isolates of HIV-1 with
IC90s of 70 to 200 nM (Kuroda MJ, E1-Farrash MA, Cloudhury
S, Harada S (1995) Virology 210:212-216.


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-12-
Resistant virus generated by serial; in vitro passages is
associated with specific mutations at positions 84, 82,
71, 63, and 46 (Markowitz M, Mo H, Kempf DJ, Norbeck DW,
Bhat TN, Erickson JW, Ho DD (1995) J. Virol. 69:701-706).
The I84V substitution appeared to be the major determinant
of resistance, resulting in a 10-fold reduction in
sensitivity to ritonavir. Addition of the V82F mutation
confers an even greater level of resistance, up to
20-fold. The substitutions M46I, L63P, and A71V, when
introduced into the protease coding region of wild-type
NL4-3, did not result in significant changes in drug
susceptibility. Based on replication kinetics
experiments, these changes are likely to be compensatory
for active-site mutations, restoring the impaired
replicative capacity of the combined V82F and I84V
mutations.


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-13-
Indinavir
Indinavir, developed by Merck & Co., is the third HIV
protease inhibitor licensed in the United States.
Indinavir is a potent and selective inhibitor of HIV-1 and
HIV-2 proteases with Ki values of 0.34 and 3.3 nM,
respectively (Vacca Jp, Dorsey BD, Schleif WA, Levin RB,
McDaniel SL, Darke PL, Zugay J, Quintero JC, Blahy OM,
Roth E, Sardana VV, Schlabach AJ, Graham PI, Condra JH,
Gotlib L, Holloway MK, Lin J, Chen L-w, Vastag K, Ostobich
D, Anderson PS, Emini EA, Huff JR (1994) Proc. Natl. Acad.
Sci. USA 91:4096-4100). The drug acts as peptidomimetic
transition state analogue and belongs to the class of
protease inhibitors known as HAPA (hydroxyaminopentane
amide) compounds (ibid). Indinavir provides enhanced
aqueous solubility and oral bioavailability and in cell
culture exhibits an IC95 of 50 to 100 nM (Emini EA,
Schleif WA, Deutsch P, Condra JH (1996) Antiviral
Chemother. 4:327-331.
Despite early reports of a lack of in vitro resistance by
selection with indinavir (id), Tisdale et al. (Tisdale M,
Myers RE, Maschera B, Parry NR, Oliver NM, Blair ED (1995)
Antibicrob. Agents Chemother. 39:1704-1'710) were able to
obtain resistant variants during selection in MT-4 cells
with substitutions at residues 32, 46, 71, and 82. At
least four mutations were required to produce a
significant loss of susceptibility (6.1-fold compared with
the wild type). The mutation at position 71, described as
compensatory (Markowitz M, Mo H, Kempf DJ, Norbeck DW,
Bhat TN, Erickson JW, Ho DD (1995) J. Virol. (id),
appeared to contribute phenotypic resistance and also to
improve virus growth. Emini et al. (id) and Condra et al.


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-14-
(Condra JH, Holder DJ, Schleif WA, Blahy OM, Danovich RM,
Gabryelski ZJ, Graham DJ, Zaird D, Quintero JC, Rhodes A,
Robbins HZ, Roth E, Shivaprakash M, Yang T, Chodakewitz
JA, Deutsch PJ, Leavitt RY, Massari Fe, Mellors JW,
Squires KE, Steigbigel RT, Teppler H, Emini EA (1995)
Nature 374:569-571) found by constructing mutant HIV-1
clones that at least three mutations at residues 46, 63,
and 82 were required for the phenotypic manifestation of
resistance with a fourfold loss of susceptibility.


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-15-
Nelfinavir
Nelfinavir, developed by Agouron Pharmaceuticals, is a
selective, nonpeptidic HIV-1 protease inhibitor that was
designed by protein structure-based techniques using
iterative protein crystallographic analysis (Appelt KR,
Bacquet J, Bartlett C, Booth CLJ, Freer ST, Fuhry MM,
Gehring MR, Herrmann SM, Howland EF, Janson CA, Jones TR,
Kan CC, Kathardekar V, Lewis KK, Marzoni GP, Mathews DA,
Mohr C, Moomaw EW, Morse CA, Oatley SJ, Ogden RC, Reddy
MR, Reich SH, Schoettlin WS, Smith WW, Varney MD,
Villafranca JE, Ward RW, Webber S, Webber SE, Welsh KM,
White J (1991) J. Med. Chem. 34:1925-1928). In vitro,
nelfinavir was found to be a potent inhibitor of HIV-1
protease with a Ki of 2.0 nM (Kaldor SW, Kalish VJ, Davies
JF, Shetty BV, Fritz JE, Appelt K, Burgess JA, Campanile
KM, Chirgadze NY, Clawson DK, Dressman BA, Hatch SD,
Khalil DA, Kosa MB, Lubbehusen PP, Muesing MA, Patrick AK,
Reich SH, Su KS, Tatlock JH (1997) J. Med. Chem.
40:3979-3985).. The drug demonstrated antiviral activity
against several laboratory and clinical HIV-1 and HIV-2
strains with 50o effective concentrations ranging from 9
to 60 nM (Patick AK, Boritzki TJ, Bloom LA (1997)
Antimicrob. Agents Chemother. 41:2159-2164). Nelfinavir
exhibits additive-to-synergistic effects when combined
with other antiretroviral drugs {Partaledis JA, Yamaguchi
AK, Tisdale M, Blair EE, Falcione C, Maschera B, Myers RE,
Pazhanisamy S, Futer O, Bullinan AB, Stuver CM, Byrn RA,
Livingston DJ (1995) J. Virol. 69:5228-5235). Preclinical
data showed high levels of the drug in mesenteric lymph
nodes and the spleen and good oral bioavailability {Shetty
BV, Kosa MB, Khalil DA, Webber S (1996) Antimicrob. Agents
Chemother. 40:110-114).


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-16-
In vitro, following 22 serial passages of HIV-1NL9-3 in the
presence of nelfinavir, a variant (P22) with a sevenfold
reduced susceptibility was isolated. After an additional
six passages a variant (P28) with a 30-fold-decreased
susceptibility to nelfinavir was identified (Patick AK, Ho
H, Markowitz M, Appelt K, Wu B, Musick L, Kaldor S, Reich
S, Ho D, Webber S (1996) Antimicrob. Agents Chemother.
40:292-297). Sequence analysis of the protease gene from
these variants identified in decreasing frequency the
substitutions D30N, A71V, and I84V for the P22 variant and
mutations M46I, I84V/A, L63P, and A71V for the P28
variant. Antiviral susceptibility testing of recombinant
mutant HIV-1NL9-3 containing various mutations resulted in a
fivefold-increased 90% effective concentration for the
I84V and D30N single mutants and the M46I/I84V double
mutant, whereas no change in susceptibility was observed
with M46I, Z63P, or A71V alone (ibid).


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-17-
Amprenavir
Amprenavir is a novel protease inhibitor developed by
Vertex Laboratories and designed from knowledge of the
HIV-1 protease crystal structure (Kim EE, Baker CT, Dyer
MD, Murcko MA, Rao BG, Tung RD, Navia MA (1995) J. Am.
Chem. Soc. 117:1181-1182). The drug belongs to the class
of sulfonamide protease inhibitors and has been shown to
be a potent inhibitor of HIV-1 and HIV-2, with IC50s of 80
and 340 nM, respectively. The mean IC50 for amprenavir
against clinical viral isolates was 12 nM (St. Clair MH,
Millard J, Rooney J, Tisdale M, Parry N, Sadler BM, Blum
MR, Painter G (1996) Antiviral Res. 29:53-56). HIV-1
variants 100-fold resistant to amprenavir have been
selected by in vitro passage experiments (id). DNA
sequence analysis of the protease of these variants
revealed a sequential accumulation of point mutations
resulting in amino acid substitutions L10F, M46I, I47V,
and I50V. The key resistance mutation in the HIV-1
protease substrate binding site is I50V. As a single
mutation it confers a two- to threefold decrease in
susceptibility (ibid). The other substitutions did not
result in reduced susceptibility when introduced as single
mutations into an HIV-1 infectious clone (HXB2). However,
a triple protease mutant clone containing the mutations
M46I, I47V, and I50V was 20-fold less susceptible to
amprenavir than wild-type virus. The I50V mutation has
not been frequently reported in resistance studies with
other HIV protease inhibitors. Kinetic characterization
of these substitutions demonstrated an 80-fold reduction
in the inhibition constant (K;) for the I50V single-mutant
protease and a 270-fold-reduced Ki for the triple mutant
M46IiI47V/I50V, compared to the wild-type enzyme


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-18-
(Pazhanisamy S, St6uvr CM, Cullinan AB, Margolin N, Rao BG
(1996) J. Biol. Chem. 271:17979-17985). The single
mutants L10F, M46I, and I47V did not display reduced
affinity for amprenavir. The catalytic efficiency (k~at~Km)
of the I50V mutant was decreased up to 25-fold, while the
triple mutant M46I/I47V/I50V had a 2-fold-higher
processing efficiency than the I50V single mutant,
confirming the compensatory role of the M46I-and-I47V
mutation. The reduced catalytic efficiency (k~at/Km) for
these mutants in processing peptides appeared to be due to
both increased Km and decreased k~at values .
VIRAL FITNESS
The relative ability of a given virus or virus mutant to
replicate is termed viral fitness. Fitness is dependent
on both viral and host factors, including the genetic
composition of the virus, the host immune response, and
selective pressures such as the presence of anti-viral
compounds. Many drug-resistant variants of HIV-1 are less
fit than the wild-type, i.e. they grow more slowly in the
absence of drug selection. However, since the replication
of the wild-type virus is inhibited in the presence of
drug, the resistant mutant can outgrow it. The reduction
in fitness may be a result of several factors including:
decreased ability of the mutated enzyme (i.e. PR or RT) to
recognize. its natural substrates, decreased stability of
the mutant protein, or decreased kinetics of enzymatic
catalysis. See Back et al., EMBO J. 15: 4040-4049, 1996;
Goudsmit et al., J. Virol. 70: 5662-5664, 2996: Maschera
et al., J. Biol. Chem. 271: 33231-33235, 1996; Croteau et
al., J. Virol. 71: 1089-1096, 1997; Zennou et al., J.
Virol. 72: 300-3306, 1998; Harrigan et al., J. Virol. 72:


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-19-
3773-3778, 1998; Kosalaraksa et al., J. Virol. 73:
5356-5363, 1999; Gerondelis et al., J. Virol. 73:
5803-5813, 1999. Drug resistant viruses that are less fit
than wild type may be less virulent i.e. they may cause
damage to the host immune system more slowly than a wild
type virus. Immunological decline may be delayed after the
emergence of drug resistant mutants, compared to the rate
of immunological decline in an untreated patient. The
defect causing reductions in fitness may be partially or
completely compensated for by the selection of viruses
with additional amino acid substitutions in the same
protein that bears the drug resistance mutations (for
example, see Martinez-Picado et al., J. Virol.
73:3744-3752, 1999), or in other proteins which interact
with the mutated enzyme. Thus, amino acids surrounding the
protease cleavage site in the gag protein may be altered
so that the site is better recognized by a drug-resistant
protease enzyme (Doyon et al., J. Virol. 70: 3763-3769,
1996; Zhang et al., J. Virol. 71: 6662-6670, 1997; Mammano
et al., J, Virol. 72: 7632-7637, 1998).
INTEGRASE
Integration of viral DNA into the host chromosome is a
necessary process in the HIV replication cycle (Brown,
P.O., 1997, in Retroviruses; Coffin, J.M., Hughes, S.H. &
Varmus, H.E., eds., Cold Spring Harbor Zab. Press,
Plainview, NY, 161-203). The key steps of DNA integration
are carried out by the viral integrase protein, which,
along with protease and reverse transcriptase, is one of
three enzymes encoded by HIV. Combination antiviral
therapy with protease and reverse transcriptase inhibitors
has demonstrated the potential therapeutic efficacy of


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-20-
antiviral therapy for treatment for AIDS (Vandamme, A.M.,
Van Vaerenbergh, K. & De Clerq, E., 1998, Antiviral Chem.
Chemother. 9, 187-203). However, the ability of HIV to
rapidly evolve drug resistance, together with toxicity
problems, requires the development of additional classes
of antiviral drugs. Integrase is an attractive target for
antivirals because it is essential for HIV replication
and, unlike protease and reverse transcriptase, there are
no known counterparts in the host cell. Furthermore,
integrase uses a single active site to accommodate two
different configurations of DNA substrates, which may
constrain the ability of HIV to develop drug resistance to
integrase inhibitors. However, unlike protease and
reverse transcriptase, for which several classes of
inhibitors have been developed and cocrystal structures
have been determined, progress with the development of
integrase inhibitors has been slow. A major obstacle has
been the absence of good lead compounds that can serve as
the starting point for structure-based inhibitor
development. Although numerous compounds have been
reported to inhibit integrase activity in vitro, most of
these compounds exhibit little specificity for integrase
and are not useful as lead compounds ( Pommier, Y . , Pilon,
A.A., Bajaj K, K., Mazumder, A. & Neamati, N., 1997,
Antiviral Ch em. Chemother 8 ) .
HIV-1 integrase is a 32-kDa enzyme that carries out DNA
integration in a two-step reaction (Brown, P.O., ibid.).
In the first step, called 3' processing, two nucleotides
are removed from each 3' end of the viral DNA made by
reverse transcription. In the next step, called DNA
strand transfer, a pair of transesterification reactions


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-21-
integrates the ends of the viral DNA into the host genome.
Integrase is comprised of three structurally and
functionally distinct domains, and all three domains are
required for each step of the integration reaction
(Engelman, A. Bushman, F.D. & Craigie, R., 1993, EMBO J.
12, 3269-3275). The isolated domains form homodimers in
solution, and the three-dimensional structures of all
three separate dimers have been determined (Dyda, F.,
Hickman, A.B. Jenkins, T.M., Engelman, A., Craigie, R. &
Davies, D.~R., 1994, Science 226, 1981-1986; Goldgur, Y.
Dyda, Hickman, A.B., Jenkins, T.M., Craigie, R. & Davies,
D.R., 1998, Proc. Natl. Acad.. Sci., USA 95, 9150-9154;
Maignan, S., Guilloteau, J.P., Zhou-Liu, Q., Clement-
Mella, C. & Mikol, V., 1998, J Mol. Biol. 282, 259-368;
Lodi, P.J., Ernst, J.A., Kuszewski, J., Hickman, A.B.,
Engelman, A., Craigie, R., Clore, G.M. & Gronenborn, A.M.
1995 Biochemistry 34, 9826-9833; Eijkelenboom, A.P.,
Lutzke, R.A., Boelens, R., Plasterk, R.H., Kaptein, R. &
Hard, K. 1995 Nat. Struct. Biol. 2, 807-810; Cai, M.L.,
Zheng, R., Caffrey, M., Craigie, R., Clore, G.M. &
Gronenborn, A.M., 1997 Nat. Struct. Biol. 4, 839-840).
Although little is known concerning the organization of
these domains in the active complex with DNA substrates,
integrase is likely to function as at least a tetramer
(Dyda, F., Hickman, A.B. Jenkins, T.M., Engelman, A.,
Craigie, R. & Davies, D.R., 1994, Science 226, 1981-1986).
Extensive mutagenesis studies mapped the catalytic site to
the core domain (residues 50-212), which contains the
catalytic residues D64, D116, and E152 (Engelman, A. &
Craigie R., 1992, J. Virol. 66, 6361-6369; Kulkosky, J.,
Jones, K.S., Katz, R.A., Mack, J.P. & Skalka, A.M., 1992,
Mol. Cell Bio1 12, 2331-2338). The structure of this


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-22-
domain of HIV-1 integrase has been determined in several
crystal forms (Dyda, F., Hickman, A.B. Jenkins, T.M.,
Engelman, A., Craigie, R. & Davies, D.R., 1994, Science
226, 1981-1986; Goldgur, Y. Dyda, Hickman, A.B., Jenkins,
T.M., Craigie, R. & Davies, D.R., 1998, Proc. Natl. Acad.
Sci., USA 95, 9150-9154; Maignan, S., Guilloteau, J.P.,
Zhou-Liu, Q., Clement-Mella, C. & Mikol, V., 1998, J Mol.
Biol. 282, 259-368).
Hazuda et al. (Science 287: 646-650, 2000) have described
compounds (termed L-731, 988 and L-708,906) which
specifically inhibit the strand-transfer activity of HIV-1
integrase and HIV-1 replication in vitro. Viruses grown in
the presence of these inhibitors display reduced inhibitor
susceptibility and bear mutations in the integrase coding
region at amino acid positions 66 (T66I), 153 (S153Y), and
154 (M154I). Site-directed mutants of a laboratory strain
of HIV-1 (HXB2) with these amino acid changes confirmed
their direct role in conferring reduced integrase
inhibitor susceptibility. In addition some of these
mutants displayed delayed growth kinetics, suggesting that
viral fitness was impaired.
It is an object of this invention to provide a drug
susceptibility and resistance test capable of showing
whether a viral population in a patient is either more or
less susceptible to a given prescribed drug. Another
object of this invention is to provide a test that will
enable the physician to substitute one or more drugs in a
therapeutic regimen for viruses that show altered
susceptibility to a given drug or drugs after a course of
therapy. Yet another object of this invention is to


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-23-
provide a test that will enable selection of an effective
drug regimen for the treatment of HIV infections and/or
AIDS. Yet another object of this invention is to provide
the means for identifying alterations in the drug
susceptibility profile of a patient's virus, in particular
identifying changes in susceptibility to protease
inhibitors. Still another object of this invention is to
provide a test and methods for evaluating the biological
effectiveness of candidate drug compounds which act on
specific viruses, viral genes and/or viral proteins
particularly with respect to alterations in viral drug
susceptibility associated with protease inhibitors. It is
also an object of this invention to provide the means and
compositions for evaluating HIV antiretroviral drug
resistance and susceptibility.
It is an object of this invention to provide a method for
measuring replication fitness which can be adapted to
viruses, including, but not limited to human
immunodeficiency virus (HIV), hepadnaviruses (human
hepatitis B virus), flaviviruses (human hepatitis C virus)
and herpesviruses (human cytomegalovirus). This and other
objects of this invention will be apparent from the
specification as a whole.


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-24-
Summary of the Invention
The present invention relates to methods of monitoring,
via phenotypic and genotypic methods the clinical
progression of human immunodeficiency virus infection and
its response to antiviral therapy. The invention is also
based, in part, on the discovery that genetic changes in
HIV protease (PR) which confer changes in susceptibility
to antiretroviral therapy may be rapidly determined
directly from patient plasma HIV RNA using phenotypic or
genotypic methods. The methods utilize nucleic acid
amplification based assays; such as polymerase chain
reaction (PCR). Herein-after, such nucleic acid
amplification based assays will be referred to as PCR
based assays. This invention is based in part on the
discovery of mutations at colons 10, 20, 36, 46, 63, 77
and 88 of HIV protease in PRI treated patients in which
the presence of certain combinations of these mutations
correlate with changes in certain PRI susceptibilities.
This invention is also based on the discovery that
susceptibility to HIV protease antivirals may not be
altered even if primary mutations are present. Additional
mutations at secondary positions in HIV protease are
required for a reduction in virus susceptibility. This
invention established for the first time that a mutation
at position 82 of protease (V82A, F, S, or T) in the
absence of another primary mutation was not correlated
with a reduction in drug susceptibility. Decreased
susceptibility to protease inhibitors, such as indinavir
and saquinavir, in viruses containing V82A, F, S or T was
observed in viruses with additional mutations at secondary
positions, such as, 24, 71, 54, 46, 10 and/or 63 as
described herein. Decreased susceptibility to protease


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-25-
inhibitors, such as indinavir and saquinavir, in viruses
containing V82A, F, S or T was also observed in viruses
with at least 3 or more additional mutations at secondary
positions. This inventions also established for the first
time that a mutation at position 90 of protease (L90M) in
the absence of another primary mutation was not correlated
with a reduction in drug susceptibility. Decreased
susceptibility to protease inhibitors, such as indinavir
and saquinavir, in viruses containing L90M was observed in
viruses with additional mutations at secondary positions,
such as, 73, 71, 77, and/or 10 as described herein.
Decreased susceptibility to protease inhibitors, such as
indinavir and saquinavir, in viruses containing L90M was
also observed in viruses with at least 3 or more
additional mutations at secondary positions. The mutations
were found in plasma HIV nucleic acid after a period of
time following the initiation of therapy. The development
of these mutations, or combinations of these mutations, in
HIV PR was found to be an indicator of the development of
alterations in phenotypic susceptibility/resistance, which
can be associated with virologic failure and subsequent
immunological response.
In one embodiment of the invention, a method of assessing
the effectiveness of protease antiretroviral therapy of an
HIV-infected patient is provided comprising:(a)collecting
a plasma sample from the HIV-infected patient; (b)
evaluating whether the plasma sample contains nucleic acid
encoding HIV protease having a mutation at primary and
secondary positions; and ( c) d a t a r m i n i n g c h a n g a s i n
susceptibility to a protease inhibitor.


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-26-
In a further embodiment of the invention, PCR based
assays, including phenotypic and genotypic assays, may be
used to detect a substitution at codon 88 from asparagine
to a serine residue either alone or in combination with
one or more mutations at other codons selected from the
group consisting of 10, 20, 36, 46, 63 and/or 77 or a
combination thereof of HIV PR. A mutation at codon 88
from an asparagine residue to a serine residue (N88S)
alone correlates with an increase in susceptibility to
amprenavir and a mutation at codon 88 from an asparagine
residue to a serine residue in combination with mutations
at codons 63 and/or 77 or a combination thereof correlates
with an increase in susceptibility to amprenavir and a
decrease in nelfinavir and indinavir susceptibility.
In a further embodiment of the invention, PCR based
assays, including phenotypic and genotypic assays, may be
used to detect mutations at codons l0, 20, 36, 46, 63, 77,
and 88 of HIV PR which correlate with changes in
susceptibility to antiretroviral therapy and immunologic
response. Once mutations at these loci have been detected
in a patient undergoing PRI antiretroviral therapy, an
alteration in the therapeutic regimen should be
considered. The timing at which a modification of the
therapeutic regimen should be made, following the
assessment of antiretroviral therapy using PCR based
assays, may depend on several factors including the
patient's viral load, CD4 count, and prior treatment
history.
In a further embodiment of the invention, PCR based
assays, including phenotypic and genotypic assays, may be


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-27-
used to detect a substitution at codon 82 from valine to
an alanine (V82A), phenylalanine (V82F), serine (V82S), or
threonine (V82T) residue either alone or in combination
with one or more mutations at other codons, referred to
herein as secondary mutations, selected from the group
consisting of 20, 24, 36, 71, 54, 46, 63 and/or 10 or a
combination thereof of HIV PR. A mutation at codon 82
from a valine residue to a alanine, phenylalanine, serine
or threonine alone correlates with susceptibility to
certain protease inhibitors including indinavir and
saquinavir. A mutation at codon 82 from a valine residue
to a alanine, phenylalanine, serine or threonine in
combination with secondary mutations at codons 24 and/or
71 or 20 and/or 36 correlates with a reduction in
susceptibility to indinavir and saquinavir, respectively.
A mutation at codon 82 from a valine residue to a alanine,
phenylalanine, serine or threonine in combination with at
least 3 secondary mutations correlates with a reduction in
susceptibility to indinavir and saquinavir.
In a further embodiment of the invention, PCR based
assays, including phenotypic and genotypic assays, may be
used to detect a substitution at codon 90 from leucine to
a methionine (h90M) residue either alone or in combination
with one or more mutations at other codons, referred to
herein as secondary mutations, selected from the group
consisting of 73, 71, 46 and/or 10 or a combination
thereof of HIV PR. A mutation at codon 90 from a leucine
residue to a methionine alone correlates with
susceptibility to certain protease inhibitors including
indinavir and saquinavir. A mutation at codon 90 from a
leucine residue to a methionine in combination with


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
secondary mutations at codons 73 and/or 71 or 73, 71
and/or 77 correlates with a reduction in susceptibility to
indinavir and saquinavir, respectively. A mutation at
codon 90 from a leucine residue to a methionine in
combination with at least 3 secondary mutations correlates
with a reduction in susceptibility to indinavir and
saquinavir.
In another aspect of the invention there is provided a
method for assessing the effectiveness of a protease
inhibitor antiretroviral drug comprising: (a) introducing
a resistance test vector comprising a patient-derived
segment and an indicator gene into a host cell; (b)
culturing the host cell from step (a); (c) measuring
expression of the indicator gene in a target host cell
wherein expression of the indicator gene is dependent upon
the patient derived segment; and (d) comparing the
expression of the indicator gene from step (c) with the
expression of the indicator gene measured when steps (a) -
(c) are carried out in the absence of the PRI anti-HIV
drug, wherein a test concentration of the PRI, anti-HIV
drug is presented at steps (a) - (c) ; at steps (b) - (c) ;
or at step (c).
This invention also provides a method for assessing the
effectiveness of protease inhibitor antiretroviral therapy
in a patient comprising: (a) developing a standard curve
of drug susceptibility for an PRI anti-HIV drug; (b)
determining PRI anti-HIV drug susceptibility in the
patient using the susceptibility test described above; and
(c) comparing the PRI anti-HIV drug susceptibility in step
(b) with the standard curve determined in step (a),
wherein a decrease in PRI anti-HIV susceptibility


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-29-
indicates development of anti-HIV drug resistance in the
patient's virus and an increase in PRI anti-HIV
susceptibility indicates drug hypersensitivity in the
patient's virus.
This invention also provides a method for evaluating the
biological effectiveness of a candidate PRI HIV
antiretroviral drug compound comprising: (a) introducing a
resistance test vector comprising a patient-derived
segment and an indicator gene into a host cell; (b)
culturing the host cell from step (a); (c) measuring
expression of the indicator gene in a target host cell
wherein expression of the indicator gene is dependent upon
the patient derived segment; and (d) comparing the
expression of the indicator gene from step (c) with the
expression of the indicator gene measured when steps (a)
(c) are carried out in the absence of the candidate PRI
anti-viral drug compound, wherein a test concentration of
the candidate PRI anti-viral drug compound is present at
30 steps (a) - (c) ; at steps (b) - (c) ; or at step (c) .
The expression of the indicator gene in the resistance
test vector in the target cell is ultimately dependent
upon the action of the HIV enzymes (PR and RT) encoded by
the patient-derived segment DNA sequences. The indicator
gene may be functional or non-functional.
In another aspect this invention is directed to
antiretroviral drug susceptibility and resistance tests
for HIVlAIDS. Particular resi tance test vectors of the
invention for use in the HIV/AIDS antiretroviral drug
susceptibility and resistance test are identified.


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-3 0-
Yet another aspect of this invention provides for the
identification and assessment of the biological
effectiveness of potential therapeutic antiretroviral
compounds for the treatment of HIV and/or AIDS. In
another aspect, the invention is directed to a novel
resistance test vector comprising a patient-derived
segment further comprising one or more mutations on the PR
gene and an indicator gene.
Still another aspect of this invention provides for the
identification and assessment of the fitness of a virus
infecting a patient. In another aspect, the invention is
directed to a novel resistance test vector comprising a
patient-derived segment further comprising one or more
mutations on the PR gene and an indicator gene, enabling
the measurement of viral fitness.


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-31-
Brief Description of the Drawings
Fig. 1
Resistance Test Vector. A diagrammatic representation of
the resistance test vector comprising a patient derived
segment and an indicator gene.
Fig. 2
Two Cell Assay. Schematic Representation of the Assay. A
resistance test vector is generated by cloning the
patient-derived segment into an indicator gene viral
vector. The resistance test vector is then co-transfected
with an expression vector that produces amphotropic murine
leukemia virus (MLV) envelope protein or other viral or
cellular proteins which enable infection. Pseudotyped
viral particles are produced containing the protease (PR)
and the reverse transcriptase (RT) gene products encoded
by the patient-derived DNA sequences. The particles are
then harvested and used to infect fresh cells. Using
defective PR and RT sequences it was shown that luciferase
activity is dependent on functional PR and RT. PR
inhibitors are added to the cells following transfection
and are thus present during particle maturation. RT
inhibitors, on the other hand, are added to the cells at
the time of or prior to viral particle infection. The
assay is performed in the absence of drug and in the
presence of drug over a wide range of concentrations.
Luciferase activity is determined and the percentage (o)
inhibition is calculated at the different drug
concentrations tested.


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-32-
Fig . 3
Examples of phenotypic drug susceptibility profiles. Data
are analyzed by plotting the percent inhibition of
luciferase activity vs. 1og10 concentration. This plot is
used to calculate the drug concentration that is required
to inhibit virus replication by 500 (IC50) or by 950
(IC95). Shifts in the inhibition curves towards higher
drug concentrations are interpreted as evidence of drug
resistance. Three typical curves for a nucleoside reverse
transcriptase inhibitor (AZT), a non-nucleoside reverse
transcriptase inhibitor (efavirenz), and a protease
inhibitor (indinavir) are shown. A reduction in drug
susceptibility (resistance) is reflected in a shift in the
drug susceptibility curve toward higher drug
concentrations (to the right) as compared to a baseline
(pre-treatment) sample or a drug susceptible virus
reference control, such as pNZ4-3 or HXB-2, when a
baseline sample is not available.
Fig. 4
Phenotypic PRI susceptibility profile: patient 0732. A
PCR-based phenotypic susceptibility assay was carried out
giving the phenotypic drug susceptibility profile showing
decreased susceptibility to nelfinavir and indinavir, and
increased susceptibility to amprenavir.
Fig. 5
Phenotypic PRI susceptibility profile of a protease mutant
generated by site-specific oligonucleotide-directed
mutagenesis. A PCR-based phenotypic susceptibility assay
was carried out giving the phenotypic drug susceptibility
profile of a virus having substitutions at codons 63, 77


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-33-
and 88 (Z63P, V77I and N88S). The profile demonstrates
resistance to both nelfinavir and indinavir, and increased
susceptibility to amprenavir.
Figure 6. Distribution of saquinavir hyper-susceptibility
by amino acid change at position 82.
Figure 7. Relative luciferase activity of integrase
inhibitor-resistant site-directed mutants.
Fig. A
Two Cell Fitness Assay. Schematic Representation of the
Fitness Assay. A fitness test vector is generated by
cloning the patient-derived segment into an indicator gene
viral vector. The fitness test vector is then co-
transfected with an expression vector that produces
amphotropic murine leukemia virus (MLV) envelope protein
or other viral or cellular proteins which enable
infection. Pseudotyped viral particles are produced
containing the protease (PR) and the reverse transcriptase
(RT) gene products encoded by the patient-derived DNA
sequences. The particles are then harvested and used to
infect fresh cells. Using defective PR and RT sequences
it was shown that luciferase activity is dependent on
functional PR and RT. The fitness assay is typically
performed in the absence of drug. If desired, the assay
can also be performed at defined drug concentrations.
Zuciferase activity produced by patient derived viruses is
compared to the luciferase activity produced by well-
characterized reference viruses. Replication fitness is
expressed as a percent of the reference.


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-34-
Figure B.
Determining the replication fitness of patient viruses.
Virus stocks produced from fitness test vectors derived
from patient samples were used to infect cells.
Zuciferase activity was measured at various times after
infection. Patient derived viruses may produce more,
approximately the same, or less luciferase activity
than the reference virus (Ref) and are said to have
greater, equivalent, or reduced replication fitness,
respectively. The drug susceptibility profiles of three
representative patient derived viruses are shown (P1, P2,
P3 ) .
Figure. C.
Identifying alterations in protease or reverse
transcriptase function associated with differences in
replication fitness of patient viruses. Replication
fitness is expressed as a percent of the reference virus
(top). Fitness measurements are compared to protease
processing of the p55 gag polyprotein (middle) and reverse
transcriptase activity (bottom). Protease processing is
measured by Western blot analysis using an antibody that
reacts with the mature capsid protein (p24). The
detection of unprocessed p55 or incompletely processed p41
polyproteins are indicators of reduced cleavage. Reverse
transcriptase activity is measured using a quantitative
RT-PCR assay and is expressed as a percent of the
reference virus.
Figure D.
Correlating reduced replication fitness with reduced
reverse transcriptase activity. Viruses containing


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-3 5-
various amino acid substitutions at position 190 (A, S, C,
Q, E, T, V) of reverse transcriptase were constructed
using site directed mutagenesis. The reference virus
contains G at this position. Replication fitness and
reverse transcriptase activities were compared.
Figure E.
Correlating reduced replication fitness with reduced
protease processing of p55 gag. Viruses containing
various amino acid substitutions in protease (D30N, Z90M,
etc) were constructed using site directed mutagenesis.
Replication fitness and p55 gag processing were compared.
Figure F.
Correlating reduced replication fitness with reduced drug
susceptibility. A large collection (n=134)of patient
samples were evaluated for phenotypic drug susceptibility
and replication fitness. Replication fitness and drug
susceptibility were compared.
Figure G.
Relationship between protease inhibitor susceptibility and
replication fitness. Patient samples were sorted based on
their replication fitness (<25o of reference, 26-75% of
reference, and >750 of reference). Mean values for
protease inhibitor susceptibility were determined for each
fitness group and plotted for each drug and all drugs
combined.
Figure H.
Relationship between reverse transcriptase inhibitor


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-36-
susceptibility and replication fitness. Patient samples
were sorted based on their replication fitness (<250 of
reference, 26-750 of reference, and >750 of reference).
Mean values for reverse transcriptase susceptibility were
determined for each fitness group and plotted for each
drug and all drugs combined.
Figure T.
Reduced replication fitness is associated with high
numbers of protease mutations, and the L90M mutation.
Patient viruses were sorted based on the number of
protease mutations. Viruses with large numbers of
protease mutations or the L90M protease mutation generally
exhibit reduced replication fitness.
Figure J.
Low replication capacity is associated with specific
protease mutations. Patient viruses were sorted based on
replication capacity. Specific protease mutations either
alone (D30N) or in combination (L90M plus others) were
observed with high frequency in viruses with reduced
replication fitness.
Figure K.
Relationship between nelfinavir susceptibility, protease
processing and replication fitness. Patient viruses were
sorted based on nelfinavir susceptibility (<10 or >10 of
reference). Protease processing and replication fitness
were plotted for all patient viruses. Viruses with
reduced nelfinavir susceptibility generally exhibited
reduced protease processing and reduced replication
fitness .


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-37-
Figure Z. Protease mutations associated with reduced
protease processing. Patient viruses were sorted based on
protease processing. Specific protease mutations were
observed at high frequency in viruses with reduced
protease processing.
Figure M.
Representative patient sample exhibiting reversion to drug
susceptibility during a period of drug treatment
interruption. Virus samples were collected weekly during
a period of treatment interruption and evaluated for
phenotypic drug susceptibility. Values shown represent
fold change in susceptibility compared to the reference
virus.
Figure N .
Representative patient sample exhibiting increased
replication fitness during a period of drug treatment
interruption. Virus samples were collected weekly during
a period of treatment interruption and evaluated for
phenotypic drug susceptibility. Fitness values shown
represent percent of the reference virus. The increase in
fitness between week 9 and week 10 corresponds to improved
protease processing (bottom) and reversion of the drug
resistant phenotype to a drug sensitive phenotype (Figure
M) .
Figure O.
Increased replication fitness during treatment
interruption. Replication fitness was measured at the
time of treatment interruption and various times during


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-3 8-
the period of treatment interruption. Generally,
replication fitness was significantly higher in samples
that corresponded to timepoints after the virus had
reverted from a drug resistant phenotype to a drug
sensitive phenotype.
Detailed Description of the Invention
The present invention relates to methods of monitoring the
clinical progression of HIV infection in patients
receiving antiretroviral therapy, particularly protease
inhibitor antiretroviral~therapy.
In one embodiment, the present invention provides for a
method of evaluating the effectiveness of antiretroviral
therapy of a patient comprising (i) collecting a
biological sample from an HIV-infected patient; and (ii)
determining whether the biological sample comprises
nucleic acid encoding HIV PR having a mutation at one or
more positions in the PR. The mutations) correlate
positively with alterations in phenotypic susceptibility.
In a specific embodiment, the invention provides for a
method of evaluating the effectiveness of PRI
antiretroviral therapy of a patient comprising (i)
collecting a biological sample from an HIV-infected
patient; and (ii) determining whether the biological
sample comprises nucleic acid encoding HIV PR having a
mutation at codon 88 from an asparagine residue to a
serine residue (N88S). This invention established, using
a phenotypic susceptibility assay, that a mutation at


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-39-
colon 88 to a serine residue of HIV protease is correlated
with an increase in amprenavir susceptibility.
In a specific embodiment, the invention provides for a
method of evaluating the effectiveness of PRI
antiretroviral therapy of a patient comprising (i)
collecting a biological sample from an HIV-infected
patient; and (ii) determining whether the biological
sample comprises nucleic acid encoding HIV PR having a
mutation at colon 88 from an asparagine residue to a
serine residue (N88S) either alone or in combination with
mutations at colons 63 and/or 77 or a combination thereof.
This invention established, using a phenotypic
susceptibility assay, that a mutation at colon 88 to a
serine residue of HIV protease is correlated with an
increase in amprenavir susceptibility and a mutation at
colon 88 to a serine residue in combination with mutations
at colons 63 and/or 77 or a combination thereof of HIV
protease are correlated with an increase in amprenavir
susceptibility and a decrease in nelfinavir and indinavir
susceptibility.
In a specific embodiment, the invention provides for a
method of evaluating the effectiveness of PRI
antiretroviral therapy of a patient comprising (i)
collecting a biological sample from an HIV-infected
patient; and (ii) determining whether the biological
sample comprises nucleic acid encoding HIV PR having a
mutation at colon 88 from an asparagine residue to a
serine residue (N88S) either alone or in combination with
mutations at colons 46, 63 and/or 77 or a~ combination
thereof. This invention established, using a phenotypic


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-40-
susceptibility assay, that a mutation at codon 88 to a
serine residue of HIV protease is correlated with an
increase in amprenavir susceptibility and a mutation at
codon 88 to a serine residue in combination with mutations
at codons 46, 63 and/or 77 or a combination thereof of HIV
protease are correlated with an increase in amprenavir
susceptibility and a decrease in nelfinavir and indinavir
susceptibility.
In a specific embodiment, the invention provides for a
method of evaluating the effectiveness of PRI
antiretroviral therapy of a patient comprising (i)
collecting a biological sample from an HIV-infected
patient; and (ii) determining whether the biological
sample comprises nucleic acid encoding HIV PR having a
mutation at codon 88 from an asparagine residue to a
serine residue (N88S) either alone or in combination with
mutations at codons 10, 20, 36, 46, 63 and/or 77 or a
combination thereof. This invention established, using a
phenotypic susceptibility assay, that a mutation at codon
88 to a serine residue of HIV protease is correlated with
an increase in amprenavir susceptibility and a mutation at
codon 88 to a serine residue in combination with mutations
at codons 10, 20, 36, 46, 63 and/or 77 or a combination
thereof of HIV protease are correlated with an increase in
amprenavir susceptibility and a decrease in nelfinavir and
indinavir susceptibility.
Under the foregoing circumstances, the phenotypic
susceptibility profile and genotypic profile of the HIV
virus infecting the patient has been altered reflecting a
change in response to the antiretroviral agent. In the


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-41-
case of PRI antiretroviral therapy, the HIV virus
infecting the patient may be resistant to one or more PRIs
but hypersensitive to another of the PRIs as described
herein. It therefore may be desirable after detecting the
mutation(s), to either increase the dosage of the
antiretroviral agent, change to another antiretroviral
agent, or add one or more additional antiretroviral agents
to the patient's therapeutic regimen. For example, if the
patient was being treated with nelfinavir when the N88S
mutation arose, the patient's therapeutic regimen may
desirably be altered by either (i) changing to a different
PRI antiretroviral agent, such as saquinavir, ritonavir or
amprenavir and stopping nelfinavir treatment; or (ii)
increasing the dosage of nelfinavir; or (iii) adding
another antiretroviral agent to the patient's therapeutic
regimen. The effectiveness of the modification in therapy
may be further evaluated by monitoring viral burden such
as by HIV RNA copy number. A decrease in HIV RNA copy
number correlates positively with the effectiveness of a
treatment regimen.
The phrase "correlates positively," as used herein,
indicates that a particular result renders a particular
conclusion more likely than other conclusions.
~5
When reference is made to a particular codon number, it is
understood that the codon number.refers to the position of
the amino acid that the codon codes for. Therefore a codon
referencing a particular number is equivalent to a
"postion" referencing a particular number, such as for
example, "codon 88" or "position 88" .


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-42-
Another preferred, non-limiting, specific embodiment of
the invention is as follows: A method of evaluating the
effectiveness of PRI therapy of a patient comprising (i)
collecting a biological sample from an HIV-infected
patient; (ii) purifying and converting the viral RNA to
cDNA and amplifying HIV sequences using HIV primers that
result in a PCR product that comprises the PR gene; (iii)
performing PCR using primers that result in PCR products
comprising wild type or serine at codon 88; and (iv)
determining, via the products of PCR, the presence or
absence of a serine residue at codon 88.
Another preferred, non-limiting, specific embodiment of
the invention is as follows: A method of evaluating the
effectiveness of PRI therapy of a patient comprising (i)
collecting a biological sample from an HIV-infected
patient; (ii) purifying and converting the viral RNA to
cDNA and amplifying HIV sequences using HIV primers that
result in a PCR product that comprises the PR gene; (iii)
performing PCR using primers that result in PCR products
comprising wild type or serine at codon 88 and mutations
at codons 63 and/or 77; and (iv) determining, via the
products of PCR, the presence or absence of a serine
residue at codon 88 and the presence or absence of
mutations at codons 63 and/or 77.
Another preferred, non-limiting, specific embodiment of
the invention is as follows: A method of evaluating the
effectiveness of PRI therapy of a patient comprising (i)
collecting a biological sample from an HIV-infected
patient; (ii) purifying and converting the viral RNA to
cDNA and amplifying HIV sequences using HIV primers that


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-43-
result in a PCR product that comprises the PR gene; (iii)
performing PCR using primers that result in PCR products
comprising wild type or serine at codon 88 and mutations
at codons 63, 77 and/or 46 or a combination thereof; and
(iv) determining, via the products of PCR, the presence or
absence of a serine residue at codon 88 and the presence
or absence of mutations at codons 63, 77 andlor 46 or a
combination thereof.
Another preferred, non-limiting, specific embodiment of
the invention is as follows: A method of evaluating the
effectiveness of PRI therapy of a patient comprising (i)
collecting a biological sample from an HIV-infected
patient; (ii) purifying and converting the viral RNA to
cDNA and amplifying HIV sequences using HIV primers that
result in a PCR product that comprises the PR gene; (iii)
performing PCR using primers that result in PCR products
comprising wild type or serine at codon 88 and mutations
at codons 63, 77, 46, 10, 20, and/or 36 or a combination
thereof; and (iv) determining, via the products of PCR,
the presence or absence of a serine residue at codon 88
and the presence or absence of mutations at codons 63, 77,
46, 10, 20, and/or 36 or a combination thereof.
The presence of the mutation at codon 88 to a serine of
HIV PR indicates that the effectiveness of the current or
prospective PRI therapy may require alteration, since as
shown by this invention mutation at codon 88 to a serine
residue increases the susceptibility to amprenavir. Using
the methods of this invention, changes in the PRI therapy
would be indicated.


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-44-
The presence of the mutation at codon 88 to a serine of
alone or in combination with mutations at condons 63, 77,
46, 10, 20, and/or 36 or a combination thereof of HIV PR
indicates that the effectiveness of the current or
prospective PRI therapy may require alteration, since as
shown by this invention a mutation at codon 88 to a serine
residue alone increases the susceptibility to amprenavir
and a mutation at codon 88 to a serine residue in
combination with mutations at condons 63, 77, 46, 10, 20,
and/or 36 or a combination increases the susceptibility to
amprenavir but also reduces the susceptibility to
nelfinavir and indinavir. Using the methods of this
invention, changes in the PRI therapy would be indicated.
Another preferred, non-limiting, specific embodiment of
the invention is as follows: a method of evaluating the
effectiveness of antiretroviral therapy of an HIV-infected
patient comprising: (a) collecting a biological sample
from an HIV-infected patient; and (b) determining whether
the biological sample comprises nucleic acid encoding HIV
protease having a mutation at codon 88 to serine. Using
the phenotypic susceptibility assay, it was observed that
the presence of the mutation at codon 88 to serine of HIV
PR causes a an increase in amprenavir susceptibility.
Another preferred, non-limiting, specific embodiment of
the invention is as follows: a method of evaluating the
effectiveness of antiretroviral therapy of an HIV-infected
patient comprising: (a) collecting a biological sample
from an HIV-infected patient; and (b) determining whether
the biological sample comprises nucleic acid encoding HIV
protease having a mutation at codon 88 to serine and


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-45-
additional mutations) at codons 63 and/or 77 or a
combination thereof. Using the phenotypic susceptibility
assay, it was observed that the presence of the mutation
at codon 88 to serine of HIV PR causes an increase in
amprenavir susceptibility and the presence of the
mutations at codon 88 to serine in combination with a
mutation at codon(s) 63 and/or 77 or a combination thereof
of HIV PR causes a decrease in nelfinavir and indinavir
susceptibility while increasing amprenavir susceptibility.
Another preferred, non-limiting, specific embodiment of
the invention is as follows: a method of evaluating the
effectiveness of antiretroviral therapy of an HIV-infected
patient comprising: (a) collecting a biological sample
from an HIV-infected patient; and (b) determining whether
the biological sample comprises nucleic acid encoding HIV
protease having a mutation at codon 88 to serine and
additional mutations) at codons 63, 77 and/or 46 or a
combination thereof. Using the phenotypic susceptibility
assay, it was observed that the presence of the mutation
at codon 88 to serine of HIV PR causes an increase in
amprenavir susceptibility and the presence of the
mutations at codon 88 to serine in combination with a
mutation at codon(s) 46, 63 and/or 77 or a combination
thereof of HIV PR causes a decrease in nelfinavir and
indinavir susceptibility while increasing amprenavir
susceptibility.
Another preferred, non-limiting, specific embodiment of
the invention is as follows: a method of evaluating the
effectiveness of antiretroviral therapy of an HIV-infected
patient comprising: (a) collecting a biological sample


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-46-
from an HIV-infected patient; and (b) determining whether
the biological sample comprises nucleic acid encoding HIV
protease having a mutation at codon 88 to serine and
additional mutations) at codons 63, 77, 46, 10, 20 and/or
36 or a combination thereof. Using the phenotypic
susceptibility assay, it was observed that the presence of
the mutation at codon 88 to serine of HIV PR causes an
increase in amprenavir susceptibility and the presence of
the mutations at codon 88 to serine in combination with a
mutation at codon(s) 63, 77, 46, 10, 20 and/or 36 or a
combination thereof of HIV PR causes a decrease in
nelfinavir and indinavir susceptibility while increasing
amprenavir susceptibility.
This invention also provides the means and methods to use
the resistance test vector comprising an HIV gene and
further comprising a PR mutation for drug screening. More
particularly, the invention describes the resistance test
vector comprising the HIV protease having a mutation at
codon 88 to a serine alone or in combination with
mutations at codons 10, 20, 36., 46, 63 and/or 77 or a
combination thereof for drug screening. The invention
further relates to novel vectors, host cells and
compositions for isolation and identification of the HIV-1
protease inhibitor resistant mutant and using such
vectors, host cells and compositions to carry out
anti-viral drug screening. This invention also relates to
the screening of candidate drugs for their capacity to
inhibit said mutant.
This invention provides a method for identifying a
compound which is capable of affecting the function of the


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-47-
protease of HIV-1 comprising contacting the compound with
the polypeptide(s) comprising all or part of the HIV-1
protease, wherein codon 88 is changed to a serine residue,
wherein a positive binding indicates that the compound is
capable of affecting the function of said protease.
This invention also provides a method for assessing the
viral fitness of patient's virus comprising: (a)
determining the luciferase activity in the absence of drug
for the reference control using the susceptibility test
described above; (b) determining the luciferase activity
in the absence of drug for the patient virus sample using
the susceptibility test described above: and (c) comparing
the luciferase activity determined in step (b) with the
luciferase activity determined in step (a), wherein a
decrease in luciferase activity indicates a reduction in
viral fitness of the patient's virus.
If a resistance test vector is constructed using a patient
derived segment from a patient virus which is unfit, and
the fitness defect is due to genetic alterations in the
patient derived segment, then the virus produced from
cells transfected with the resistance test vector will
produce luciferase more slowly. This defect will be
manifested as reduced luciferase activity (in the absence
of drug) compared to the drug sensitive reference control,
and may be expressed as a percentage of the control.
In a further embodiment of the invention, PCR based
assays, including phenotypic and genotypic assays, may be
used to detect mutations at positions 20 and 88 of HIV PR,
which correlate with a reduction in viral fitness and


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-48-
immunological response.
It is a further embodiment of this invention to provide a
means and method for measuring replication fitness for
viruses, including, but not limited to human
immunodeficiency virus (HIV), hepadnaviruses (human
hepatitis B virus), flaviviruses (human hepatitis C virus)
and herpesviruses (human cytomegalovirus).
This invention further relates to a means and method for
measuring the replication fitness of HIV-1 that exhibits
reduced drug susceptibility to reverse transcriptase
inhibitors and protease inhibitors.
In a further embodiment of the invention , a means and
methods are provided for measuring replication fitness for
other classes of inhibitors of HIV-1 replication,
including, but not limited to integration, virus assembly,
and virus attachment and entry.
This invention relates to a means and method for
identifying mutations in protease or reverse transcriptase
that alter replication fitness.
In a further embodiment of the invention , a means and
methods are provided for identifying mutations that alter
replication fitness for other components of HIV-1
replication, including, but not limited to integration,
virus assembly, and virus attachment and entry.


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-49-
This invention also relates to a means and method for
quantifying the affect that specific mutations in protease
or reverse transcriptase have on replication fitness.
In a further embodiment of the invention , a means and
method are provided for quantifying the affect that
specific protease and reverse transcriptase mutations have
on replication fitness in other viral genes involved in
HIV-1 replication, including, but not limited to the gag,
pol, and envelope genes.
This invention also relates to the high incidence of
patient samples with reduced replication fitness.
This invention relates to the correlation between reduced
drug susceptibility and reduced replication fitness.
This invention further relates to the occurrence of
viruses with reduced fitness in patients receiving
protease inhibitor and/or reverse transcriptase inhibitor
treatment.
This invention further relates to the incidence of patient
samples with reduced replication fitness in which the
reduction in fitness is due to altered protease processing
of the gag polyprotein (p55).
This invention further relates to the incidence of
protease mutations in patient samples that exhibit low,
moderate or normal (wildtype) replication fitness.


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
This invention further relates to protease mutations that
are frequently observed, either alone or in combination,
in viruses that exhibit reduced replication capacity.
This invention also relates to the incidence of patient
samples with reduced replication fitness in which the
reduction in fitness is due to altered reverse
transcriptase activity. This invention relates to the
occurrence of viruses with reduced replication fitness in
patients failing antiretroviral drug treatment. This
invention further relates to a means and method for using
replication fitness measurements to guide the treatment of
HIV-1. This invention further relates to a means and
method for using replication fitness measurements to guide
the treatment of patients failing antiretroviral drug
treatment. This invention further relates to the means and
methods for using replication fitness measurements to
guide the treatment of patients newly infected with HIV-1.
This invention, provides the means and methods for using
replication fitness measurements to guide the treatment of
viral diseases, including, but not limited to HIV-1,
hepadnaviruses (human hepatitis B virus), flaviviruses
(human hepatitis C virus) and herpesviruses (human
cytomegalovirus).
In a further embodiment, the invention provides a method
for determining replication capacity for a patient's virus
comprising:
(a) introducing a resistance test vector comprising
a patient derived segment and an indicator gene
into a host cell;


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-51-
(b) culturing the host cell from (a);
(c) harvesting viral particles from step (b) and
infecting target host cells;
(d) measuring expression of the indicator gene in
the target host cell, wherein the expression of
the indicator gene is dependent upon the
patient-derived segment;
(e) comparing the expression of the indicator gene
from (d) with the expression of the indicator
gene measured when steps (a) through (d) are
carried out in a control resistance test vector;
and
(f) normalizing the expression of the indicator gene
by measuring an amount of virus in step (c).
As used herein, "patient-derived segment" encompasses
segments derived from human and various animal species.
Such species include, but are not limited to chimpanzees,
horses, cattles, cats and dogs.
Patient-derived segments can also be incorporated into
resistance test vectors using any of several alternative
cloning techniques as set forth in detail in US Patent
Number 5,837,464 (International Publication Number WO
97/27319) which is hereby incorporated by reference. For
example, cloning via the introduction of class II
restriction sites into both the plasmid backbone and the
patient-derived segments or by uracil DNA glycosylase
primer cloning.


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-52-
The patient-derived segment may be obtained by any method
of molecular cloning or ~ gene amplification, or
modifications thereof, by introducing patient sequence
acceptor sites, as described below, at the ends of the
patient-derived segment to be introduced into the
resistance test vector. For example, in a gene
amplification method such as PCR, restriction sites
corresponding to the patient-sequence acceptor sites can
be incorporated at the ends of the primers used in the PCR
reaction. Similarly, in a molecular cloning method such
as cDNA cloning, said restriction sites can be
incorporated at the ends of the primers used for first or
second~ strand cDNA synthesis, or in a method such as
primer-repair of DNA, whether cloned or uncloned DNA, said
restriction sites can be incorporated into the primers
used for the repair reaction. The patient sequence
acceptor sites and primers are designed to improve the
representation of patient-derived segments. Sets of
resistance test vectors having designed patient sequence
acceptor sites provide representation of patient-derived
segments that may be underrepresented in one resistance
test vector alone.
"Resistance test vector" means one or more vectors which
taken together contain DNA comprising a patient-derived
segment and an indicator gene. Resistance test vectors
are prepared as described in US Patent Number 5,837,464
(International Publication Number WO 97/27319), which is
hereby incorporated by reference, by introducing patient
sequence acceptor sites, amplifying or cloning
patient-derived segments and inserting the amplified or
cloned sequences precisely into indicator gene viral


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-53-
vectors at the patient sequence acceptor sites.
Alternatively, a resistance test vector (also referred to
as a resistance test vector system) is prepared by
introducing patient sequence acceptor sites into a
packaging vector, amplifying or cloning patient-derived
segments and inserting the amplified or cloned sequences
precisely into the packaging vector at the patient
sequence acceptor sites and co-transfecting this packaging
vector with an indicator gene viral vector.
"Indicator or indicator gene," as described in US Patent
Number 5,837,464 (International Publication Number WO
97/27319) refers to a nucleic acid encoding a protein, DNA
or RNA structure that either directly or through a
reaction gives rise to a measurable or noticeable aspect,
e.g. a color or light of a measurable wavelength or in the
case of DNA or RNA used as an indicator a change or
generation of a specific DNA or RNA structure. Preferred
examples of an indicator gene is the E. coli lacZ gene
which encodes beta-galactosidase, the luc gene which
encodes luciferase either from, for example, Photonis
pyralis (the firefly) or Renilla reniformis (the sea
pansy), the E. coli phoA gene which encodes alkaline
phosphatase, green fluorescent protein and the bacterial
CAT gene which encodes chloramphenicol acetyltransferase.
The indicator or indicator gene may be functional or
non-functional as described in US Patent Number 5,837,464
(International Publication Number WO 97/27319).
The phenotypic drug susceptibility and resistance tests of
this invention may be carried out in one or more host
cells as described in US Patent Number 5,837,464


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-54-
(International Publication Number WO 97J27319) which is
incorporated herein by reference. Viral drug
susceptibility is determined as the concentration of the
anti-viral agent at which a given percentage of indicator
gene expression is inhibited (e.g. the IC50 for an
anti-viral agent is the concentration at which 500 of
indicator gene expression is inhibited). A standard curve
for drug susceptibility of a given anti-viral drug can be
developed for a viral segment that is either a standard
laboratory viral segment or from a drug-naive patient
(i.e. a patient who has not received any anti-viral drug)
using the method described in the aforementioned patent.
Correspondingly, viral drug resistance is a decrease in
viral drug susceptibility for a given patient compared to
such a given standard or when making one or more
sequential measurements in the same patient over time, as
determined by decreased susceptibility in virus from later
time points compared to that from earlier time points.
The antiviral drugs being added to the test system are
added at selected times depending upon the target of the
antiviral drug. For example, in the case of HIV protease
inhibitors, including saquinavir, ritonavir, indinavir,
nelfinavir and amprenavir, they are added to packaging
host cells at the time of or shortly after their
transfection with a resistance test vector, at an
appropriate range of concentrations. HIV reverse
transcriptase inhibitors, including A2T, ddI, ddC, d4T,
3TC, abacavir, nevirapine, delavirdine and efavirenz are
added to target host cells at the time of or prior to
infection by the resistance test vector viral particles,
at an appropriate range of concentration. Alternatively,


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-55-
the antiviral drugs may be present throughout the assay.
The test concentration is selected from a range of
concentrations which is typically between about 8 X 10'6 ~.1.M
and about 2mM and more specifically for each of the
following drugs: saquinavir, indinavir, nelfinavir and
amprenavir, from about 2.3 X 10-5 ~.~M to about 1.5 uM and
ritonavir, from about 4.5 X 10-5 uM to about 3 uM.
In another embodiment of this invention, a candidate PRT
antiretroviral compound is tested in the phenotypic drug
susceptibility and resistance test using the resistance
test vector comprising PR having a mutation at codon 88 to
a serine. The candidate antiviral compound is added to the
test system at an appropriate range of concentrations and
at the transfection step. Alternatively, more than one
candidate antiviral compound may be tested or a candidate
antiviral compound may be tested in combination with an
approved antiviral drug such as AZT, ddI, ddC, d4T, 3TC,
abacavir, delavirdine, nevirapine, efavirenz, saquinavir,
ritonavir, indinavir, nelfinavir, amprenavir, or a
compound which is undergoing clinical trials such as
adefovir and ABT-378. The effectiveness of the candidate
antiviral will be evaluated by measuring the expression or
inhibition of the indicator gene. In another aspect of
this embodiment, the drug susceptibility and resistance
test may be used to screen for viral mutants. Following
the identification of mutants resistant to either known
antiretrovirals or candidate antiretrovirals the resistant
mutants are isolated and the DNA is analyzed. A library
of viral resistant mutants can thus be assembled enabling
the screening of candidate PRI antiretrovirals, alone or
in combination. This will enable one of ordinary skill to


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-56-
identify effective PRI antiretrovirals and design
effective therapeutic regimens.
In another embodiment of this invention, a method of
assessing the effectiveness of protease antiretroviral
therapy of an HTV-infected patient is provided comprising:
(a) collecting a biological sample from the HIV-infected
patient;
(b) evaluating whether the biological sample contains
nucleic acid encoding HIV protease having a mutation at
codon 82 or codon 90; and
(c) determining changes in susceptibility to protease
inhibitors.
In another embodiment of this invention, the method is
provided, wherein step (c) determines changes in
susceptibility to saquinavir.
In another embodiment of this invention, the method is
provided , wherein the mutation at codon 82 codes for
alanine (A), phenylalanine (F), serine (S), or threonine
(T) -
In another embodiment of this invention, the method is
provided , wherein the mutation at codon 82 is a
substitution of alanine (A), phenylalanine (F), serine
(S), or threonine (T) for valine(V).
In another embodiment of this invention, the method is
provided, wherein the mutation at codon 90 codes for
methionine (M).


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-57-
In another embodiment of this invention, the method is
provided , wherein the mutation at codon 90 is a
substitution of methionine (M) for leucine (L).
In another embodiment of this invention, a method for
evaluating the biological effectiveness of a candidate HIV
protease antiretroviral drug compound is provided
comprising:
(a) introducing a resistance test vector comprising
a patient-derived segment having nucleic acid encoding HIV
protease with a mutation at codon 82 or codon 90 and an
indicator gene into a host cell;
(b) culturing the host cell from step (a);
(c) measuring the indicator gene in a target host
cell; and
(d) comparing the measurement of the indicator gene
from step (c) with the measurement of the indicator gene
measured when steps (a) - (c) are carried out in the
absence of the candidate antiretroviral drug compound;
wherein a test concentration of the candidate
antiretroviral drug compound is present at steps (a) -
(c) ; at steps (b) - (c) ; or at step (c) .
In another embodiment of this invention, a resistance test
vector comprising an HIV patient-derived segment further
comprising protease having a mutation at codon 82 or codon
90 and an indicator gene, wherein the expression of the
indicator gene is dependent upon the patient-derived
segment.
In another embodiment of this invention, the resistance
test vector is provided , wherein the patient-derived


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-58_
segment having a mutation at codon 82 codes for alanine
(A), phenylalanine (F), serine (S), or threonine (T).
In another embodiment of this invention, the resistance
test vector of is provided , wherein the patient-derived
segment having a mutation at codon 82 is a substitution of
alanine (A), phenylalanine (F), serine (S), or threonine
(T) for valine(V).
In another embodiment of this invention, the resistance
test vector is provided , wherein the patient-derived
segment having a mutation at codon 90 codes for methionine
(M) .
In yet another embodiment of this invention, the
resistance test vector is provided, wherein the patient-
derived segment having a mutation at codon 90 is a
substitution of methionine (M) for leucine (L).
In another embodiment of this invention, a method for
determining replication capacity for a patient's virus is
provided comprising:
(a)introducing a resistance test vector comprising a
patient-derived segment and an indicator gene into a host
cell;
(b) culturing the host cell from (a);
(c) harvesting viral particles from step (b) and
infecting target host cells;
(d) measuring expression of the indicator gene in the
target host cell, wherein the expression of the indicator
gene is dependent upon the patient-derived segment; and


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-59-
(e) comparing the expression of the indicator gene from
(d) with the expression of the indicator gene measured
when steps (a) through (d) are carried out in a control
resistance test vector.
In another embodiment of this invention, the method
further comprises the step of:
(f) normalizing the expression of the indicator gene by
measuring an amount of virus in step (c).
In another embodiment of this invention, the method is
provided wherein the patient-derived segment comprises
nucleic acid encoding HIV integrase having a mutation at
colon 66.
In another embodiment of this invention, the method is
provided wherein the patient-derived segment comprises
nucleic acid encoding HIV integrase having a mutation at
colon 154.
In another embodiment of this invention, the method is
provided wherein the patient-derived segment comprises
nucleic acid encoding HIV integrase having mutations at
colon 66 and colon 153.
30


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-60-
In another embodiment of this invention, the method is provided
wherein the patient-derived segment comprises nucleic acid
encoding HIV integrase having mutations at codon 66 and
codon 154.


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-61-
The structure, life cycle and genetic elements of the
viruses which could be tested in the drug susceptibility
and resistance test of this invention would be known to
one of ordinary skill in the art. It is useful to the
practice of this invention, for example, to understand the
life cycle of a retrovirus, as well as the viral genes
required for retrovirus rescue and infectivity.
Retrovirally infected cells shed a membrane virus
containing a diploid RNA genome. The virus, studded with
an envelope glycoprotein (which serves to determine the
host range of infectivity), attaches to a cellular
receptor in the plasma membrane of the cell to be
infected. After receptor binding, the virus is
internalized and uncoated as it passes through the
cytoplasm of the host cell. Either on its way to the
nucleus or in the nucleus, the reverse transcriptase
molecules resident in the viral core drive the synthesis
of the double-stranded DNA provirus, a synthesis that is
primed by the binding of a tRNA molecule to the genomic
viral RNA. The double-stranded DNA provirus is
subsequently integrated in the genome of the host cell,
where it can serve as a transcriptional template for both
mRNAs encoding viral proteins and virion genomic RNA,
which will be packaged into viral core particles. On
their way out of the infected cell, core particles move
through the cytoplasm, attach to the inside of the plasma
membrane of the newly infected cell, and bud, taking with
them tracts of membrane containing the virally encoded
envelope glycoprotein gene product. This cycle of
infection - reverse transcription, transcription,
translation, virion assembly, and budding - repeats itself


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-62-
over and over again as infection spreads.
The viral RNA and, as a result, the proviral DNA encode
several cis-acting elements that are vital to the
successful completion of the viral li.fecycle. The virion
RNA carries the viral promoter at its 3' end. Replicative
acrobatics place the viral promoter at the 5' end of the
proviral genome as the genome is reverse transcribed.
Just 3' to the 5' retroviral ZTR lies the viral packaging
site. The retroviral lifecycle requires the presence of
virally encoded transacting factors. The
viral-RNA-dependent DNA polymerase (po1)-reverse
transcriptase is also contained within the viral core and
is vital to the viral life cycle in that it is responsible
for the conversion of the genomic RNA to the integrative
intermediate proviral DNA. The viral envelope
glycoprotein, env, is required for viral attachment to the
uninfected cell and for viral spread. There are also
transcriptional traps-activating factors, so called
transactivators, that can serve to modulate the level of
transcription of the integrated parental provirus.
Typically, replication-competent (non-defective) viruses
are self-contained in that they encode all of these
traps-acting factors. Their defective counterparts are
not self-contained.
'
In the case of a DNA virus, such as a hepadnavirus,
understanding the life cycle and viral genes required for
infection is useful to the practice of this invention.
The process of HBV entry has not been well defined.
Replication of HBV uses an RNA intermediate template. In
the infected cell the first step in replication is the


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-63-
conversion of the asymmmmetric relaxed circle DNA (rc-DNA)
to covalently closed circle DNA (cccDNA). This process,
which occurs within the nucleus of infected liver cells,
involves completion of the DNA positive-strand synthesis
and ligation of the DNA ends. In the second step, the
cccDNA is transcribed by the host RNA polymerase to
generate a 3.5 kB RNA template (the pregenome). This
pregenome is complexed with protein in the viral core.
The third step involves the synthesis of the first
negative-sense DNA strand by copying the pregenomic RNA
using the virally encoded P protein reverse transcriptase.
The P protein also serves as the minus strand DNA primer.
Finally, the synthesis of the second positive-sense DNA
strand occurs by copying the first DNA strand, using the P
protein DNA polymerase activity and an oligomer of viral
RNA as primer. The pregenome also transcribes mRNA for
the major structural core proteins.


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-64-
The following flow chart illustrates certain of the
various vectors and host cells which may be used in this
invention. It is not intended to be all inclusive.
Vectors Indicator gene cassette+Viral
vector(functional/nonfunctional (genomic or subgenomic)
indicator gene)
Indicator Gene Viral Vector (functional/nonfunctional
indicator gene)
+ Patient sequence
acceptor sites
+ Patient-derived
segments
Resistance Test Vector
(patient-derived segments + indicator gene)
Host Cells
Packaging Host Cell - transfected with packaging
expression vectors
Resistance Test Vector Host Cell - a packaging host cell
transfected with a resistance test vector
Target Host Cell - a host cell to be infected 'by a


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-65-
resistance test vector viral particle produced by the
resistance test vector host cell
Resistance Test Vector
"Resistance test vector" means one or more vectors which
taken together contain DNA or RNA comprising a
patient-derived segment and an indicator gene. In the
case where the resistance test vector comprises more than
one vector the patient-derived segment may be contained in
one vector and the indicator gene in a different vector.
Such a resistance test vector comprising more than one
vector is referred to herein as a resistance test vector
system for purposes of clarity but is nevertheless
understood to be a resistance test vector. The DNA or RNA
of a resistance test vector may thus be contained in one
or more DNA or RNA molecules. In one embodiment, the
resistance test vector is made by insertion of a
patient-derived segment into an indicator gene viral
vector. In another embodiment, the resistance test vector
is made by insertion of a patient-derived segment into a
packaging vector while the indicator gene is contained in
a second vector, for example an indicator gene viral
vector. As used herein, "patient-derived segment" refers
to one or more viral segments obtained directly from a
patient using various means, for example, molecular
cloning or polymerase chain reaction (PCR) amplification
of a population of patient-derived segments using viral
DNA or complementary DNA (cDNA) prepared from viral RNA,
present in the cells (e. g. peripheral blood mononuclear
cells, PBMC), serum or other bodily fluids of infected
patients. When a viral segment is "obtained directly"
from a patient it is obtained without passage of the virus


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-66-
through culture, or if the virus is cultured, then by a
minimum number of passages to essentially eliminate the
selection of mutations in culture. The term "viral
segment" refers to any functional viral sequence or viral
gene encoding a gene product (e.g., a protein) that is the
target of an anti-viral drug. The term "functional viral
sequence" as used herein refers to any nucleic acid
sequence (DNA or RNA) with functional activity such as
enhancers, promoters, polyadenylation sites, sites of
action of trans-acting factors, such as tai and RRE,
packaging sequences, integration sequences, or splicing
sequences. If a drug were to target more than one
functional viral sequence or viral gene product then
patient-derived segments corresponding to each said viral
gene would be inserted in the resistance test vector. In
the case. of combination therapy where two or more
anti-virals targeting two different functional viral
sequences or viral gene products are being evaluated,
patient-derived segments corresponding to each functional
viral sequence or viral gene product would be inserted in
the resistance test vector. The patient-derived segments
are inserted into unique restriction sites or specified
locations, called patient sequence acceptor sites, in the
indicator gene viral vector or for example, a packaging
vector depending on the particular construction being used
as described herein.
As used herein, "patient-derived segment" encompasses
segments derived from human and various animal species.
Such species include, but are not limited to chimpanzees,
horses, cattles, cats and dogs.


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-67-
Patient-derived segments can also be incorporated into
resistance test vectors using any of several alternative
cloning techniques. For example, cloning via the
introduction of class II restrict.~on sites into both the
plasmid backbone and the patient-derived segments or by
uracil DNA glycosylase primer cloning (refs).
The patient-derived segment may be obtained by any method
of molecular cloning or gene amplification, or
modifications thereof, by introducing patient sequence
acceptor sites, as described below, at the ends of the
patient-derived segment to be introduced into the
resistance test vector. For example, in a gene
amplification method such as PCR, restriction sites
corresponding to the patient-sequence acceptor sites can
be incorporated at the ends of the primers used in the PCR
reaction. Similarly, in a molecular cloning method such
as cDNA cloning, said restriction sites can be
incorporated at the ends of the primers used for first or
second strand cDNA synthesis, or in a method such as
primer-repair of DNA, whether cloned or uncloned DNA, said
restriction sites can be incorporated into the primers
used fox the repair reaction. The patient sequence
acceptor sites and primers are designed to improve the
representation of patient-derived segments. Sets of
resistance test vectors having designed patient sequence
acceptor sites provide representation of patient-derived
segments that would be underrepresented in one resistance
test vector alone.
Resistance test vectors are prepared by modifying an
indicator gene viral vector (described below) by


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-68-
introducing patient sequence acceptor sites, amplifying or
cloning patient-derived segments and inserting the
amplified or cloned sequences precisely into indicator
gene viral vectors at the patient sequence acceptor sites.
The resistance test vectors are constructed from
indicator gene viral vectors which are in turn derived
from genomic viral vectors or subgenomic viral vectors and
an indicator gene cassette, each of which is described
below. Resistance test vectors are then introduced into a
host cell. Alternatively, a resistance test vector (also
referred to as a resistance test vector system) is
prepared by introducing patient sequence acceptor sites
into a packaging vector, amplifying or cloning
patient-derived segments and inserting the amplified or
cloned sequences precisely into the packaging vector at
the patient sequence acceptor sites and co-transfecting
this packaging vector with an indicator gene viral vector.
In one preferred embodiment, the resistance test vector
may be introduced into packaging host cells together with
packaging expression vectors, as defined below, to produce
resistance test vector viral particles that are used in
drug resistance and susceptibility tests that are referred
to herein as a "particle-based test." In an alternative
preferred embodiment, the resistance test vector may be
introduced into a host cell in the absence of packaging
expression vectors to carry out a drug resistance and
susceptibility test that is referred to herein as a
"non-particle-based test." As used herein a "packaging
expression vector" provides the factors, such as packaging
proteins (e.g. structural proteins such as core and
envelope polypeptides), transacting factors, or genes


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-69-
required by replication-defective retrovirus or
hepadnavirus. In such a situation, a
replication-competent viral genome is enfeebled in a
manner such that it cannot replicate on its own. This
means that, although the packaging expression vector can
produce the trans-acting or missing genes required to
rescue a defective viral genome present in a cell
containing the enfeebled genome, the enfeebled genome
cannot rescue itself.
Indicator or Indicator Gene
"Indicator or indicator gene" refers to a nucleic acid
encoding a protein, DNA or RNA structure that either
directly or through a reaction gives rise to a measurable
or noticeable aspect, e.g. a color or light of a
measurable wavelength or in the case of DNA or RNA used as
an indicator a change or generation of a specific DNA or
RNA structure. Preferred examples of an indicator gene is
the E. coli lacZ gene which encodes beta-galactosidase,
the 1uc gene which encodes luciferase either from, for
example, Photonis pyral.is (the firefly) or Renilla
reniform.is (the sea pansy), the E. coli phoA gene which
encodes alkaline phosphatase, _green fluorescent protein
and the bacterial CAT gene which encodes chloramphenicol
acetyltransferase. Additional preferred examples of an
indicator gene are secreted proteins or cell surface
proteins that are readily measured by assay, such as
radioimmunoassay (RIA), or fluorescent activated cell
sorting (FACS), including, for example, growth factors,
cytokines and cell surface antigens (e. g. growth hormone,
Il-2 or CD4, respectively). "Indicator gene" is
understood to also include a selection gene, also referred


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-70-
to as a selectable marker. Examples of suitable
selectable markers for mammalian cells are dihydrofolate
reductase (DHFR), thymidine kinase, hygromycin, neomycin,
zeocin or E. coli gpt. In the case of the foregoing
examples of indicator genes, the indicator gene and the
patient-derived segment are discrete, i.e. distinct and
separate genes. In some cases a patient-derived segment
may also be used as an indicator gene. In one such
embodiment in which the patient-derived segment
corresponds to more than one viral gene which is the
target of an anti-viral, one of said viral genes may also
serve as the indicator gene. For example, a viral
protease gene may serve as an indicator gene by virtue of
its ability to cleave a chromogenic substrate or its
ability to activate an inactive zymogen which in turn
cleaves a chromogenic substrate, giving rise in each case
to a color reaction. In all of the above examples of
indicator genes, the indicator gene may be either
"functional" or "non-functional" but in each case the
expression of the indicator gene in the target cell is
ultimately dependent upon the action of the
patient-derived segment.
Functional Indicator Gene
In the case of a "functional indicator gene" the indicator
gene may be capable of being expressed in a "packaging
host celllresistance test vector host cell" as defined
below, independent of the patient-derived segment,
however the functional indicator gene could not be
expressed in the target host cell, as defined below,
without the production of functional resistance test
vector particles and their effective infection of the


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
_71-
target host cell. In one embodiment of a functional
indicator gene, the indicator gene cassette, comprising
control elements and a gene encoding an indicator protein,
is inserted into the indicator gene viral vector with the
same or opposite transcriptional orientation as the native
or foreign enhancer/promoter of the viral vector. One
example of a functional indicator gene in the case of HIV
or HBV, places the indicator gene and its promoter (a CMV
IE enhancer/promoter) in the same or opposite
transcriptional orientation as the HIV-LTR or HBV
enhances-promoter, respectively, or the CMV IE
enhancer/promoter associated with the viral vector.
Non-Functional Indicator Gene
Alternatively the indicator gene, may be "non-functional"
in that the indicator gene is not efficiently expressed in
a packaging host cell transfected with the resistance test
vector, which is then referred to a resistance test vector
host cell, until it is converted into a functional
indicator gene through the action of one or more of the
patient-derived segment products. An indicator gene is
rendered non-functional through genetic manipulation
according to this invention.
1. Permuted Promoter In one embodiment an indicator gene
is rendered non-functional due to the location of the
promoter, in that, although the promoter is in the same
transcriptional orientation as the indicator gene, it
follows rather than precedes the indicator gene coding
sequence. This misplaced promoter is referred to as a
"permuted promoter." In addition to the permuted promoter
the orientation of the non-functional indicator gene is


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
_72-
opposite to that of the native or foreign
promoter/enhancer of the viral vector. Thus the coding
sequence of the non-functional indicator gene can neither
be transcribed by the permuted promoter nor by the viral
promoters. The non-functional indicator gene and its
permuted promoter is rendered functional by the action of
one or more of the viral proteins. One example of a
non-functional indicator gene with a permuted promoter in
the case of HIV, places a T7 phage RNA polymerase promoter
(herein referred to as T7 promoter) promoter in the 5' ZTR
in the same transcriptional orientation as the indicator
gene . The indicator gene cannot be transcribed by the T7
promoter as the indicator gene cassette is positioned
upstream of the T7 promoter. The non-functional indicator
gene in the resistance test vector is converted into a
functional indicator gene by reverse transcriptase upon
infection of the target cells, resulting from the
repositioning of the T7 promoter, by copying from the 5'
LTR to the 3' ZTR, relative to the indicator gene coding
region. Following the integration of the repaired
indicator gene into the target cell chromosome by HIV
integrase, a nuclear T7 RNA polymerase expressed by the
target cell transcribes the indicator gene. One example
of a non-functional indicator gene with a permuted
promoter in the case of HBV, places an enhancer-promoter
region downstream or 3' of the indicator gene both having
the same transcriptional orientation. The indicator gene
cannot be transcribed by the enhancer-promoter as the
indicator gene cassette is positioned upstream. The
non-functional indicator gene in the resistance test
vector is converted into a functional indicator gene by
reverse transcription and circularization of the HBV


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-73-
' indicator gene viral vector by the repositioning of the
enhancer-promoter upstream relative to the indicator gene
coding region.
A permuted promoter may be any eukaryotic or prokaryotic
promoter which can be transcribed in the target host cell.
Preferably the promoter will be small in size to enable
insertion in the viral genome without disturbing viral
replication. More preferably, a promoter that is small in
size and is capable of transcription by a single subunit
RNA polymerise introduced into the target host cell, such
as a bacteriophage promoter, will be used. Examples of
such bacteriophage promoters and their cognate RNA
polymerises include those of phages T7, T3 and Sp6. A
nuclear localization sequence (NLS) may be attached to the
RNA polymerise to localize expression of the RNA
polymerise to the nucleus where they may be needed to
transcribed the repaired indicator gene. Such an NLS may
be obtained from any nuclear-transported protein such as
the SV40 T antigen. If a phage RNA polymerise is
employed, an internal ribosome entry site (IRES) such as
the EMC virus 5' untranslated region (UTR) may be added in
front of the indicator gene, for translation of the
transcripts which are generally uncapped. In the case of
HIV, the permuted promoter itself can be introduced at any
position within the 5' LTR that is copied to the 3' LTR
during reverse transcription so long as LTR function is
not disrupted, preferably within the U5 and R portions of
the LTR, and most preferably outside of functionally
important and highly conserved regions of U5 and R. In
the case of HBV, the permuted promoter can be placed at
any position that does not disrupt the cis acting elements


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-74-
that are necessary for HBV DNA replication. Blocking
sequences may be added at the ends of the resistance test
vector should there be inappropriate expression of the
non-functional indicator gene due to transfection
artifacts (DNA concatenation). In the HIV example of the
permuted T7 promoter given above, such a blocking sequence
may consist of a T7 transcriptional terminator, positioned
to block readthrough transcription resulting from DNA
concatenation, but not transcription resulting from
repositioning of the permuted T7 promoter from the 5' ZTR
to the 3' ZTR during reverse transcription.
2. Permuted Codine~ Region In a second embodiment, an
indicator gene is rendered non-functional due to the
relative location of the 5' and 3' coding regions of the
indicator gene, in that, the 3' coding region precedes
rather than follows the 5' coding region. This misplaced
coding region is referred to as a "permuted coding
region." The orientation of the non-functional indicator
gene may be the same or opposite to that of the native or
foreign promoter/enhancer of the viral vector, as mRNA
coding for a functional indicator gene will be produced in
the event of eithex orientation. The non-functional
indicator gene and its permuted coding region is rendered
functional by the action of one or more of the
patient-derived segment products. A second example of a
non-functional indicator gene with a permuted coding
region in the case of HIV, places a 5' indicator gene
coding region with an associated promoter in the 3' ZTR U3
region and a 3' indicator gene coding region in an
upstream location of the HIV genome, with each coding
region having the same transcriptional orientation as the


CA 02422815 2003-03-14 -
WO 02/22076 PCT/USO1/28754
-75-
viral LTRs. In both examples, the 5' and 3' coding
regions may also have associated splice donor and acceptor
sequences, respectively, which may be heterologous or
artificial splicing signals. The indicator gene cannot be
functionally transcribed either by the associated promoter
1.0 or viral promoters, as the permuted coding region prevents
the formation of functionally spliced transcripts. The
non-functional indicator gene in the resistance test
vector is converted into a functional indicator gene by
reverse transcriptase upon infection of the target cells,
resulting from the repositioning of the 5' and 3'
indicator gene coding regions relative to one another, by
copying of the 3' LTR to the 5' LTR. Following
transcription by the promoter associated with the 5'
coding region, RNA splicing can join the 5' and 3' coding
regions to produce a functional indicator gene product.
One example of a non-functional indicator gene with a
permuted coding region in the case of HBV, places a 3'
indicator gene coding region upstream or 5' of the
enhancer-promoter and the 5' coding region of the
indicator gene. The transcriptional orientation of the
indicator gene 5' and 3' coding regions are identical to
one another, and the same as that of the indicator gene
viral vector. However, as the indicator gene 5' and 3'
coding regions are permuted in the resistance test vectors
(i.e., the 5' coding region is downstream of the 3' coding
region), no mRNA is transcribed which can be spliced to
generate a functional indicator gene coding region.
Following reverse transcription and circularization of the
indicator gene viral vector, the indicator gene 3' coding
35' region is positioned downstream or 3' to the
enhancer-promoter and 5' coding regions thus permitting


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-7 6-
the transcription of mRNA which can be spliced to generate
a functional indicator gene coding region.
3. Inverted Intron In a third embodiment, the indicator
gene is rendered non-functional through use of an
"inverted intron," i.e. an intron inserted into the coding
sequence of the indicator gene with a transcriptional
orientation opposite to that of the indicator. gene. The
overall transcriptional orientation of the indicator gene
cassette including its own, linked promoter, is opposite
to that of the viral control elements, while the
orientation of the artificial intron is the same as the
viral control elements. Transcription of the indicator
gene by its own linked promoter does not lead to the
production of functional transcripts as the inverted
intron cannot be spliced in this orientation.
Transcription of the indicator gene by the viral control
elements does, however, lead to the removal of the
inverted intron by RNA splicing, although the indicator
gene is still not functionally expressed as the resulting
transcript has an antisense orientation. Following the
reverse transcription of this transcript and integration
of the resultant retroviral DNA, or the circulari~ation of
hepadnavirus DNA, the indicator gene can be functionally
transcribed using its own linked promoter as the inverted
intron has been previously removed. In this case, the
indicator gene itself may contain its own functional
promoter with the entire transcriptional unit oriented
opposite to the viral control elements. Thus the
non-functional indicator gene is in the wrong orientation
to be transcribed by the viral control elements and it
cannot be functionally transcribed by its own promoter, as


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-77-
the inverted intron cannot be properly excised by
splicing. However, in the case of a retrovirus and HIV
specifically and hepadnaviruses, and HBV specifically,
transcription by the viral promoters (HIV LTR or HBV
enhancer-promoter) results in the removal of the inverted
intron by splicing. As a consequence of reverse
transcription of the resulting spliced transcript and the
integration of the resulting provirus into the host cell
chromosome or circularization of the HBV vector, the
indicator gene can now be functionally transcribed by its
own promoter. The inverted intron, consisting of a splice
donor and acceptor site to remove the intron, is
preferably located in the coding region of the indicator
gene in order to disrupt translation of the indicator
gene. The splice donor and acceptor may be any splice
donor and acceptor. A preferred splice donor-receptor is
the CMV IE splice donor and the splice acceptor of the
second exon of the human alpha globin gene ("intron A").
Indicator Gene Viral Vector - Construction
35 As used herein, "indicator gene viral vector" refers to a
vectors) comprising an indicator gene and its control
elements and one or more viral genes. The indicator gene
viral vector is assembled from an indicator gene cassette
and a "viral vector," defined below. The indicator gene
viral vector may additionally include an enhancer,
splicing signals, polyadenylation sequences,
transcriptional terminators, or other regulatory
sequences. Additionally the indicator gene viral vector
may be functional or nonfunctional. In the event that the
viral segments which are the target of the anti-viral drug
are not included in the indicator gene viral vector they


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
_78_
are provided in a second vector. An "indicator gene
cassette" comprises an indicator gene and control
elements. "Viral vector" refers to a vector comprising
some or all of the following: viral genes encoding a gene
product, control sequences, viral packaging sequences, and
in the case of a retrovirus, integration sequences. The
viral vector may additionally include one or more viral
segments one or more of which may be the target of an
anti-viral drug. Two examples of a viral vector which
contain viral genes are referred to herein as an "genomic
viral vector" and a "subgenomic viral vector." A "genomic
viral vector" is a vector which may comprise a deletion of
a one or more viral genes to render the virus replication
incompetent, but which otherwise preserves the mRNA
expression and processing characteristics of the complete
virus. In one embodiment for an HIV drug susceptibility
and resistance test, the genomic viral vector comprises
the HIV gag-pol, vif, vpr, tat, rev, vpu, and nef genes
(some, most or all of env may be deleted) . A "subgenomic
viral vector" refers to a vector comprising the coding
region of one or more viral genes which may encode the
proteins that are the targets) of the anti-viral drug.
In the case of HIV, a preferred embodiment is a subgenomic
viral vector comprising the HIV gag pot gene. In the case
of HBV a preferred embodiment is a subgenomic viral vector
comprising the HBV P gene. In the case of HIV, two
examples of proviral clones used for viral vector
construction are: HXB2 (Fisher et al., (1986) Nature, 320,
367-371) and NZ4-3, (Adachi et al., (1986) J. Virol., 59,
284-291). In the case of HBV, a large number of full
length genomic sequences have been characterized and could
ba used for construction of HBV viral vectors: GenBank


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-7 9-
Nos. M54923, M38636, J02203 and X59795. The viral coding
genes may be under the control of a native
enhancer/promoter or a foreign viral or cellular
enhancer/promoter. A preferred embodiment for an HIV drug
susceptibility and resistance test, is to place the
genomic or subgenomic viral coding regions under the
control of the native enhancer/promoter of the HIV-LTR U3
region or the CMV immediate-early (IE) enhancer/promoter.
A preferred embodiment for an HBV drug susceptibility and
resistance test, is to place the genomic or subgenomic
viral coding regions under the control of the CMV
immediate-early (IE) enhancer/promoter. In the case of an
indicator gene viral vector that contains one or more
viral genes which are the targets or encode proteins which
are the targets of an anti-viral drugs) then said vector
contains the patient sequence acceptor sites. The
patient-derived segments are inserted in the patient
sequence acceptor site in the indicator gene viral vector
which is then referred to as the resistance test vector,
as described above.
"Patient sequence acceptor sites" are sites in a vector
for insertion of patient-derived segments and said sites
may be: 1) unique restriction sites introduced by
site-directed mutagenesis into a vector; 2) naturally
occurring unique restriction sites in the vector; or 3)
selected sites into which a patient-derived segment may be
inserted using alternative cloning methods (e.g. UDG
cloning). In one embodiment the patient sequence acceptor
site is introduced into the indicator gene viral vector.
The patient sequence acceptor sites are preferably located
within or near the coding region of the viral protein


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
_80-
which is the target of the anti-viral drug. The viral
sequences used for the introduction of patient sequence
acceptor sites are preferably chosen so that no change, or
a conservative change, is made in the amino acid coding
sequence found at that position. Preferably the patient
sequence acceptor sites are located within a relatively
conserved region of the viral genome to facilitate
introduction of the patient-derived . segments.
Alternatively, the patient sequence acceptor sites are
located between functionally important genes or regulatory
sequences. Patient-sequence acceptor sites may be located
at or near regions in the viral genome that are relatively
conserved to permit priming by the primer used to
introduce the corresponding restriction site into the
patient-derived segment. To improve the representation of
patient-derived segments further, such primers may be
designed as degenerate pools to accommodate viral sequence
heterogeneity, or may incorporate residues such as
deoxyinosine (I) which have multiple base-pairing
capabilities. Sets of resistance test vectors having
patient sequence acceptor sites that define the same or
overlapping restriction site intervals may be used
together in the drug resistance and susceptibility tests
to provide representation of patient-derived segments that
contain internal restriction sites identical to a given
patient sequence acceptor site, and would thus be
underrepresented in either resistance test vector alone.
Xost Cells '
The resistance test vector is introduced into a host cell.
Suitable host cells are mammalian cells. Preferred host
cells are derived from human tissues and cells which are


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-81-
the principle targets of viral infection. In the case of
HIV these include human cells such as human T cells,
monocytes, macrophage, dendritic cells, Langerhans cells,
hematopoeitic stem cells or precursor cells, and other
cells. In the case of HBV, suitable host cells include
hepatoma cell lines (HepG2, Huh 7), primary human
hepatocytes, mammalian cells which can be- infected by
pseudotyped HBV, and other cells. Human derived host
cells will assure that the anti-viral drug will enter the
cell efficiently and be converted by the cellular
enzymatic machinery into the metabolically relevant form
of the anti-viral inhibitor. Host cells are referred to
herein as a "packaging host cells," "resistance test
vector host cells," or "target host cells." A "packaging
host cell" refers to a host cell that provides the
trans-acting factors and viral packaging proteins required
by the replication defective viral vectors used herein,
such as the resistance test vectors, to produce resistance
test vector viral particles. The packaging proteins may
be provided for by the expression of viral genes contained
within the resistance test vector itself, a packaging
expression vector(s), or both. A packaging host cell is a
host cell which is transfected with one or more packaging
expression vectors and when transfected with a resistance
test vector is then referred to herein as a "resistance
test vector host cell" and is sometimes referred to as a
packaging host cell/resistance test vector host cell.
Preferred host cells for use as packaging host cells for
HIV include 293 human embryonic kidney cells (293, Graham,
F.L. et al., J. Gen Virol. 36: 59, 1977), BOSC23 (Pear et
al., Proc. Natl. Acad. Sci. 90, 8392, 1993), tsa54 and
tsa201 cell lines (Heinzel et al., J.Virol. 62,


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-82-
3738,1988), for HBV HepG2 (Galle and Theilmann, h.
Arzheim.-Forschy Drug Res. (1990) 40, 1380-1382). (Huh,
Ueda, K et al. Virology *1989) 169, 213-216). A "target
host cell" refers to a cell to be infected by resistance
test vector viral particles produced by the resistance
test vector host cell in which expression or inhibition of
the indicator gene takes place. Preferred host cells for
use as target host cells include human T cell leukemia
cell lines including Jurkat (ATCC T1B-152), H9 (ATCC
HTB-176), CEM (ATCC CCL-119), HUT78 (ATCC T1B-161), and
derivatives thereof.
This invention is illustrated in the Experimental Detais
section which follows. These sections are set forth to
aid in an understanding of the invention but are not
intended to, and should not be construed to, limit in any
way the invention as set forth in the claims which follow
thereafter.
Experimental Details
General Materials and Methods
Most of the techniques used to construct vectors, and
transfect and infect cells, are widely practiced in the
art, and most practitioners are familiar with the standard
resource materials that describe specific conditions and
procedures. However, for convenience, the following
paragraphs may serve as a guideline.
As used herein, "replication capacity" is defined herein
is a measure of how well the virus replicates. This may
also be referred to as viral fitness. In one embodiment,
replication capacity can be measured by evaluating the


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-83-
ability of the virus to replicate in a single round of
replication.
As used herein, " control resistance test vector" is
defined as a resistance test vector comprising a standard
viral sequence (for example, HXB2, PNL4-3) and an
indicator gene.
As used herein, "normalizing" is defined as standardizing
the amount of the expression of indicator gene measured
relative to the number of viral particles giving rise to
the expression of the indicator gene. For example,
normalization is measured by dividing the amount of
luciferase activity measured by the number of viral
particles measured at the time of infection.
"Plasmids" and "vectors" are designated by a lower case p
followed by letters and/or numbers. The starting plasmids
herein are either commercially available, publicly
available on an unrestricted basis, or can be constructed
from available plasmids in accord with published
procedures. In addition, equivalent plasmids to those
described are known in the art and will be apparent to the
ordinarily skilled artisan.
Construction of the vectors of the invention employs
standard ligation and restriction techniques which are
well understood in the art (see Ausubel et al., (1987)
Current Protocols in Molecular Biology, Wiley -
Interscience or Maniatis et al., (1992) in Molecular
Cloning: A laboratory Manual, Cold Spring Harbor
Laboratory, N.Y.). Isolated plasmids, DNA sequences, or


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-84-
synthesized oligonucleotides are cleaved, tailored, and
relegated in the form desired. The sequences of all DNA
constructs incorporating synthetic DNA were confirmed by
DNA sequence analysis (Sanger et al. (1977) Proc. Natl.
Acad. Sci. 74, 5463-5467).
"Digestion" of DNA refers to catalytic cleavage of the DNA
with a restriction enzyme that acts only at certain
sequences, restriction sites, in the DNA. The various
restriction enzymes used herein are commercially available
and their reaction conditions, cofactors and other
requirements are known to the ordinarily skilled artisan.
For analytical purposes, typically 1 ~.Zg of plasmid or DNA
fragment is used with about 2 units of enzyme in about 20
~.l of buffer solution. Alternatively, an excess of
restriction enzyme is used to insure complete digestion of
the DNA substrate. Incubation times of about one hour to
two hours at about 37°C are workable, although variations
can be tolerated. After each incubation, protein is
removed by extraction with phenol/chloroform and the
nucleic acid recovered from aqueous fractions by
precipitation with ethanol. If desired, size separation
of , the cleaved fragments may be performed by
polyacrylamide gel or agarose gel electrophoresis using
standard techniques. A general description of size
separations is found in Methods of Enzymology 65:499-560
(1980) .
Restriction cleaved fragments may be blunt ended by
treating with the large fragment of E. coli DNA polymerase
I (Klenow) in the presence of the four deoxynucleotide
triphosphates (dNTPs) using incubation times of about 15


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-85-
to 25 minutes at 20°C in 50 mM Tris (pH 7.6) 50 mM NaCl, 6
mM MgCl2, 6 mM DTT and 5-10 mM dNTPs. The Klenow fragment
fills in at 5' sticky ends but chews back protruding 3'
single strands, even though the four dNTPs are present.
If desired, selective repair can be performed by supplying
only one of the dNTPs, or with selected dNTPs, within the
limitations dictated by the nature of the sticky ends.
After treatment with Klenow, the mixture is extracted with
phenol/chloroform and ethanol precipitated. Treatment
under appropriate conditions with S1 nuclease or Bal-31
results in hydrolysis of any single-stranded portion.
Legations are performed in 15-50 ~.zl volumes under the
following standard conditions and temperatures: 20 mM
Tris-Cl pH 7.5, 10 mM MgCl2, 10 mM DTT, 33 mg/ml BSA, 10
mM- 50 mM NaCl, and either 40 ~.a.M ATP, 0.01-0.02 (Weiss)
units T4 DNA lipase at 0°C (for "sticky end" legation) or
1mM ATP, 0.3 - 0.6 (Weiss) units T4 DNA lipase at 14°C (for
"blunt end" legation). Intermolecular "sticky end"
legations are usually performed at 33-100 ~.lg/ml total DNA
concentrations (5-100 mM total end concentration).
Intermolecular blunt end legations (usually employing a
10-30 fold molar excess of linkers) are performed at 1~.ZM
total ends concentration.
"Transient expression" refers to unamplified expression
within about one day to two weeks of transfection. The
optimal time for transient expression of a particular
desired heterologous gene may vary depending on several
factors including, for example, any transacting factors
which may be employed, translational control mechanisms
and the host cell. Transient expression occurs when the


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-86-
particular plasmid that has been transfected functions,
i.e., is transcribed and translated. During this time the
plasmid DNA which has entered the cell is transferred to
the nucleus. The DNA is in a nonintegrated state, free
within the nucleus. Transcription of the plasmid taken up
by the cell occurs during this period. Following
transfection the plasmid DNA may become degraded or
diluted by cell division. Random integration within the
cell chromatin occurs.
In general, vectors containing promoters and control
sequences which are derived from species compatible with
the host cell are used with the particular host cell.
Promoters suitable for use with prokaryotic hosts
illustratively include the beta-lactamase and lactose
promoter systems, alkaline phosphatase, the tryptophan
(trp) promoter system and hybrid promoters such as tac
promoter. However, other functional bacterial promoters
are suitable. In addition to prokaryotes, eukaryotic
microbes such as yeast cultures may also be used.
Saccharomyces cerevisiae, or common baker's yeast is the
most commonly used eukaryotic microorganism, although a
number of other strains are commonly available. Promoters
controlling transcription from vectors in mammalian host
cells may be obtained from various sources, for example,
the genomes of viruses such as: polyoma, simian virus 40
(SV40), adenovirus, retroviruses, hepatitis B virus and
preferably cytomegalovirus, or from heterologous mammalian
promoters, e.g. (3-actin promoter. The early and late
promoters of the SV 40 virus are conveniently obtained as
an SV40 restriction fragment that also contains the SV40
viral origin of replication. The immediate early promoter


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
_87-
of the human cytomegalovirus is conveniently obtained as a
HindIII E restriction fragment. Of course, promoters from
the host cell or related species also are useful herein.
The vectors used herein may contain a selection gene, also
termed a selectable marker. A selection gene encodes a
protein, necessary for the survival or growth of a host
cell transformed with the vector. Examples of suitable
selectable markers for mammalian cells include the
dihydrofolate reductase gene (DHFR), the ornithine
decarboxylase gene, the multi-drug resistance gene (mdr),
the adenosine deaminase gene, and the glutamine synthase
gene. When such selectable markers are successfully
transferred into a mammalian host cell, the transformed
mammalian host cell can survive if placed under selective
pressure. There are two widely used distinct categories
of selective regimes. The first category is based on a
cell's metabolism and the use of a mutant cell line which
lacks the ability to grow independent of a supplemented
media. The second category is referred to as dominant
selection which refers to a selection scheme used in any
cell type and does not require the use of a mutant cell
line. These schemes typically use a drug to arrest growth
of a host cell. Those cells which have a novel gene would
express a protein conveying drug resistance and would
survive the selection. Examples of such dominant
selection use the drugs neomycin (Southern and Berg (1982)
Molec. Appl. Genet. 1, 327), mycophenolic acid
(Mulligan and Berg (1980) Science 209, 1422), or
hygromycin (Sugden et al. (1985) Mol. Cell. Biol. 5,
410-413). The three examples given above employ bacterial
genes under eukaryotic control to convey resistance to the


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-88-
appropriate drug neomycin (G418 or genticin), xgpt
(mycophenolic acid) or hygromycin, respectively.
"Transfection" means introducing DNA into a host cell so
that the DNA is expressed, whether functionally expressed
or otherwise; the DNA may also replicate either as an
extrachromosomal element or by chromosomal integration.
Unless otherwise provided, the method used herein for
transfection of the host cells is the calcium phosphate
co-precipitation method of Graham and van der Eb (1973)
Virology 52, 456-457. Alternative methods for
transfection are electroporation, the DEAE-dextran method,
lipofection and biolistics (Kriegler (1990) Gene Transfer
and Expression: A Laboratory Manual, Stockton Press).
Host cells may be transfected with the expression vectors
of the present invention and cultured in conventional
nutrient media modified as is appropriate for inducing
promoters, selecting transformants or amplifying genes.
Host cells are cultured in F12:DMEM (Gibco) 50:50 with
added glutamine. The culture conditions, such as
temperature, pH and the like, are those previously used
with the host cell selected for expression, and will be
apparent to the ordinarily skilled artisan.
The following examples merely illustrate the best mode now
known for practicing the invention, but should not be
construed to limit the invention. All publications and
patent applications cited in this specification are herein
incorporated by reference in their entirety as if each
individual publication or patent application were
specifically and individually indicated to be incorporated


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-89-
by reference .
EXAMPhE 1
Phenotypic Drug Susceptibility and Resistance Test Using
Resistance Test Vectors
Phenotypic drug susceptibility and resistance tests are
carried out using the means and methods described in US
Patent Number 5,837,464 (International Publication Number
WO 97127319) which is hereby incorporated by reference.
In these experiments patient-derived segments)
corresponding to the HIV protease and reverse
transcriptase coding regions were either patient-derived
segments amplified by the reverse transcription-polymerase
chain reaction method (RT-PCR) using viral RNA isolated
from viral particles present in the serum of HIV-infected
individuals or were mutants of wild type HTV-1 made by
site directed mutagenesis of a parental clone of
resistance test vector DNA. Isolation of viral RNA was
performed using standard procedures (e. g. RNAgents Total
RNA Isolation System, Promega, Madison WI or RNAzol,
Tel-Test, Friendswood, TX). The RT-PCR protocol was
divided into two steps. A retroviral reverse
transcriptase [e. g. Moloney MuLV reverse transcriptase
(Roche Molecular Systems, Inc., Branchburg, NJ), or avian
myeloblastosis virus (AMV) reverse transcriptase,
(Boehringer Mannheim, Indianapolis, IN)] was used to copy
viral RNA into cDNA. The cDNA was then amplified using a
thermostable DNA polymerase [e. g. Taq (Roche Molecular
Systems, Inc., Branchburg, NJ), Tth (Roche Molecular
Systems, Inc., Branchburg, NJ), PrimeZyme (isolated from
Thermus brockianus, Biometra, Gottingen, Germany)] or a


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-90-
combination of thermostable polymerases as described for
the performance of "long PCR" (Barnes, W.M., (1994) Proc.
Natl. Acad. Sci, USA 91, 2216-2220) [e. g. Expand High
Fidelity PCR System (Taq + Pwo), (Boehringer Mannheim.
Indianapolis, IN) OR GeneAmp XZ PCR kit (Tth + Vent),
(Roche Molecular Systems, Inc., Branchburg, NJ)].
PCR6 (Table 5, #1) is used for reverse transcription of
viral RNA into cDNA. The primers, ApaI primer (PDSApa,
Table 5, #2) and AgeI primer (PDSAge, Table 5, #3) used to
amplify the "test" patient-derived segments contained
sequences resulting in ApaI and AgeI recognition sites
being introduced into both ends of the PCR product,
respectively.
Resistance test vectors incorporating the "test"
patient-derived segments were constructed as described in
US Patent Number 5,837,464 (International Publication
Number WO 97/27319) (see Fig. 1) using an amplified DNA
product of 1.5 kB prepared by RT-PCR using viral RNA as a
template and oligonucleotides PCR6 (#1), PDSApa (#2) and
PDSAge (#3) as primers, followed by digestion with ApaI
and Agel or the isoschizomer PinAl. To ensure that the
plasmid DNA corresponding to the resultant resistance test
vector comprises a representative sample of the HIV viral
quasi-species present in the serum of a given patient,
many (>100) independent E. coli transformants obtained in
the construction of a given resistance test vector were
pooled and used for the preparation of plasmid DNA.
A packaging expression vector encoding an amphotrophic
MuLV 4070A env gene product enables production in a
resistance test vector host cell of resistance test vector


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-91-
viral particles which can efficiently infect human target
cells. Resistance test vectors encoding all HIV genes
with the exception of env were used to transfect a
packaging host cell (once transfected the host cell is
referred to as a resistance test vector host cell). The
packaging expression vector which encodes the amphotrophic
MuLV 4070A env gene product is used with the resistance
test vector to enable production in the resistance test
vector host cell of infectious pseudotyped resistance test
vector viral particles.
Resistance tests performed with resistance test vectors
were carried out using packaging host and target host
cells consisting of the human embryonic kidney cell line
293 (Cell Culture Facility, UC San Francisco, SF, CA) or
the Jurkat leukemic T-cell line (Arthur Weiss, UC San
Francisco, SF, CA).
Resistance tests were carried out with resistance test
vectors~using two host cell types. Resistance test vector
viral particles were produced by a first host cell (the
resistance test vector host cell) that was prepared by
transfecting a packaging host cell with the resistance
test vector and the packaging expression vector. The
resistance test vector viral particles were then used to
infect a second host cell (the target host cell) in which
the expression of the indicator gene is measured (see Fig.
2) .
The resistance test vectors containing a functional
luciferase gene cassette were constructed and host cells
were transfected with the resistance test vector DNA. The


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-92-
resistant test vectors contained patient-derived reverse
transcriptase and protease DNA sequences that encode
proteins which were either susceptible or resistant to the
antiretroviral agents, such as nucleoside reverse
transcriptase inhibitors, non-nucleoside reverse
transcriptase inhibitors and protease inhibitors. The
resistance test vector viral particles produced by
transfecting the resistance test vector DNA into host
cells, either in the presence or absence of protease
inhibitors, were used to infect target host cells grown
either in the absence of NRTI or NNRTI or in the presence
of increasing concentrations of the drug. Luciferase
activity in infected target host cells in the presence of
drug was compared to the luciferase activity in infected
target host cells in the absence of drug. Drug resistance
was measured as the concentration of drug required to
inhibit by 50% the luciferase activity detected in the
absence of drug (inhibitory concentration 50o, IC50 ).
The IC50 values were determined by plotting percent drug
inhibition vs. logl° drug concentration.
Host cells were seeded in 10-cm-diameter dishes and were
transfected one day after plating with resistance test
vector plasmid DNA and the envelope expression vector.
Transfections were performed using a calcium-phosphate
co-precipitation procedure. The cell culture media
containing the DNA precipitate was replaced with fresh
medium, from one to 24 hours, after transfection. Cell
culture media containing resistance test vector viral
particles was harvested one to four days after
transfection and was passed through a 0.45-mm filter
before being stored at -80°C. HIV capsid protein (p24)


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-93-
levels in the harvested cell culture media were determined
by an EIA method as described by the manufacturer (SIAC;
Frederick, MD). Before infection, target cells (293 and
293/T) were plated in cell culture media. Control
infections were performed using cell culture media from
mock transfections (no DNA) or transfections containing
the resistance test vector plasmid DNA without the
envelope expression plasmid. One to three or more days
after infection the media was removed and cell lysis
buffer (Promega) was added to each well. Cell lysates
were assayed for luciferase activity. The inhibitory
effect of the drug was determined using the following
equation:
o luciferase inhibition = [1 - (RLUluc [drug] RLUluc)] x
100
where RLUluc [drug] is the relative light unit of
luciferase activity in infected cells in the presence of
drug and RLUluc is the Relative Light Unit of luciferase
activity in infected cells in the absence of drug. IC50
values were obtained from the sigmoidal curves that were
generated from the data by plotting the percent 'inhibition
of luciferase activity vs. the loglo drug concentration.
Examples of drug inhibition curves are shown in (Fig. 3).
EXAMPhE 2
An in vitro Assay Using Resistance Test Veetors And Site
Directed Mutants To Correlate Phenotypes And Genotypes
Associated With HIV Drug Susceptibility And Resistance
Phenotypic susceptibility analysis of patient HIV samples
Resistance test vectors are constructed as described in


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-94-
example 1. Resistance test vectors, or clones derived from
the resistance test vector pools, are tested in a
phenotypic assay to determine accurately and
quantitatively the level of susceptibility to a panel of
anti-retroviral drugs. This panel of anti-retroviral
drugs may comprise members of the classes known as
nucleoside-analog reverse transcriptase inhibitors
(NRTIs), non-nucleoside reverse transcriptase inhibitors
(NNRTIs), and protease inhibitors (PRIs). The panel of
drugs can be expanded as new drugs or new drug targets
become available. An IC50 is determined for each
resistance test vector pool for each drug tested. The
pattern of susceptibility to all of the drugs tested is
examined and compared to known patterns of susceptibility.
A patient sample can be further examined for genotypic
changes correlated with the pattern of susceptibility
observed.
Genotypic analysis of patient HIV samples
Resistance test vector DNAs, either pools or clones, are
analyzed by any of the genotyping methods described in
Example 1. In one embodiment of the invention, patient
HIV sample sequences are determined using viral RNA
purification, RT/PCR and ABI chain terminator automated
sequencing. The sequence that is determined is compared
to control sequences present in the database or is
compared to a sample from the patient prior to initiation
of therapy, if available. The genotype is examined for
sequences that are different from the control or
pre-treatment sequence and correlated to the observed
phenotype.


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-95-
Phenotypic susceptibility analysis of site directed
mutants
Genotypic changes that are observed to correlate with
changes in phenotypic patterns of drug susceptibility are
evaluated by construction of resistance test vectors
containing the specific mutation on a defined, wild-type
(drug susceptible) genetic background. Mutations may be
incorporated alone and/or in combination with other
mutations that are thought to modulate the susceptibility
of HIV to a certain drug or class of drugs. Mutations are
introduced into the resistance test vector through any of
the widely known methods for site-directed mutagenesis.
In one embodiment of this invention the mega-primer PCR
method for site-directed mutagenesis is used. A
resistance test vector containing the specific mutation or
group of mutations are then tested using the phenotypic
susceptibility assay described above and the
susceptibility profile is compared to that of a
genetically defined wild-type (drug susceptible)
resistance test vector which lacks the specific mutations.
Qbserved changes in the pattern of phenotypic
susceptibility to the antiretroviral drugs tested are
attributed to the specific mutations introduced into the
resistance test vector.
EXAMPLE 3
Using Resistance Test Vectors To Correlate Genotypes And
Phenotypes Associated With Changes in PRI Drug
Susceptibility in HIV.
Phenotypic analysis of Patient 0732
A resistance test vector was constructed as described in
example 1 from a patient sample designated as 0732. This


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-96-
patient had been previously treated with nelfinavir.
Isolation of viral RNA and RT/PCR was used to generate a
patient derived segment that comprised viral sequences
coding for all of PR and as 1 - 313 of RT. The patient
derived segment was inserted into an indicator gene viral
vector to generate a resistance test vector designated
RTV-0732. RTV-0732 was tested using a phenotypic
susceptibility assay to determine accurately and
quantitatively the level of susceptibility to a panel of
anti-retroviral drugs. This panel of anti-retroviral
drugs comprised members of the classes known as NRTIs
(AZT, 3TC, d4T, ddI, ddC, and abacavir), NNRTIs
(delavirdine, nevirapine and efavirenz), and PRIs
(indinavir, nelfinavir, ritonavir, saquinavir and
amprenavir). An IC50 was determined for each drug tested.
Susceptibility of the patient virus to each drug was
examined and compared to known patterns of susceptibility.
A pattern of susceptibility to the PRIs was observed for
patient sample RTV-0732 in which there was a decrease in
both nelfinavir and indinavir susceptibility (increased
resistance) and an increase in amprenavir susceptibility
(see Fig. 4 and Table 1). Patient sample 0732 was examined
further for genotypic changes associated with the pattern
of susceptibility.
Determa.nation of genotype of patient 0732
RTV-0732 DNA was analyzed by ABI chain terminator
automated sequencing. The nucleotide sequence was
compared to the consensus sequence of a wild type Glade B
HIV-1 (HIV Sequence Database Los Alamos, NM). The
nucleotide sequence was examined for sequences that are
different from the control sequence. PR mutations were


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-97-
noted at positions K14R, I15V, K20T, E35D, M36I, R91K,
I62V, Z63Q and N88S. K14R, I15V, E35D, R41K and I62V are
naturally occurring polymorphisms in HIV-1 PR and axe not
associated with reduced susceptibility to any drug. M36I
has previously been described to be associated with
resistance to ritonavir and nelfinavir (Shihazi, 1998).
N88S has previously been described to be associated with
resistance to nelfinavir (Patick AAC, 42: 2637 (1998) and
an investigational PRI, SC55389A (Smidt, 1997).
Phenotypic analysis of Patient 627
A resistance test vector was constructed as described in
example 1 from a patient sample designated as 627. This
patient had been treated with indinavir. Isolation of
viral RNA and RT/PCR was used to generate a patient
derived segment that comprised viral sequences coding for
all of PR and as 1 - 313 of RT. The patient derived
segment was inserted into an indicator gene viral vector
to generate a resistance test vector designated RTV-627.
RTV-627 was tested using a phenotypic susceptibility assay
to determine accurately and quantitatively the level of
susceptibility to a panel of anti-retroviral drugs. This
panel of anti-retroviral drugs comprised members of the
classes known as NRTIs (AZT, 3TC, d4T, ddI, ddC, and
abacavir), NNRTIs (delavirdine, nevirapine and efavirenz),
and PRIs (indinavir, nelfinavir, ritonavir, saquinavir and
amprenavir). An IC50 was determined for each drug tested.
Susceptibility of the patient virus to each drug was
examined and compared to known patterns of susceptibility.
A pattern of susceptibility to the PRIs was observed for
patient sample RTV-627 in which there was a decrease in
indinavir and nelfinavir susceptibility (increased


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
_98_
resistance) and an increase in amprenavir and saquinavir
susceptibility. Patient sample 627 was examined further
for genotypic changes associated with the pattern of
susceptibility.
Determination of genotype of patient 627
RTV-627 DNA was analyzed by ABI chain terminator automated
sequencing. The nucleotide sequence was compared to the
consensus sequence of a wild type Glade B HIV-1 (HIV
Sequence Database Los Alamos, NM). The nucleotide
sequence was examined for sequences that are different
from the control sequence. PR mutations were noted at
positions 13I/V, E35D, M46L, L63P, I64V, I73V and N88S.
I13V, E35D and I64V are naturally occurring polymorphisms
in HIV-1 PR and are not associated with reduced
susceptibility to any drug. M46L has previously been
described to be associated with resistance to indinavir
and amprenavir. L63P has previously been described to be
associated with resistance to indinavir and nelfinavir.
N88S has previously been described to be~ associated with.
resistance to nelfinavir (Patick, 1998) and an
investigational PRI, SC55389A (Smidt, 1997).
Phenotypic analysis of Patient 1208
A resistance test vector was constructed as described in
example 1 from a patient sample designated as 1208. This
patient had, been previously treated with nelfinavir.
Isolation of viral RNA and RT/PCR was used to generate a
patient derived segment that comprised viral sequences
coding for all of PR and as 1 - 313 of RT. The patient
derived segment was inserted into an indicator gene viral
vector to generate a resistance test vector designated


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-99-
RTV-1208. RTV-1208 was tested using a phenotypic
susceptibility assay to determine accurately and
quantitatively the level of susceptibility to a panel of
anti-retroviral drugs. This panel of anti-retroviral drugs
comprised members of the classes known as 1VRTIs (A2T, 3TC,
d4T, ddI, ddC, and abacavir), NNRTIs (delavirdine,
nevirapine and efavirenz), and PRTs (indinavir,
nelfinavir, ritonavir, saquinavir and amprenavir). An IC50
was determined for each drug tested. Susceptibility of
the patient virus to each drug was examined and compared
to known patterns of susceptibility. A pattern of
susceptibility to the PRIs was observed for patient sample
RTV-1208 in which there was a decrease in indinavir and
nelfinavir susceptibility (increased resistance) and an
increase in amprenavir susceptibility. Patient sample
1208 was examined further for genotypic changes associated
with the pattern of susceptibility.
Determination of genotype of patient 1208
RTV-1208 DNA was analyzed by ABI chain terminator
automated sequencing. The nucleotide sequence was
compared to the consensus sequence of a wild type Glade B
HIV-1 (HIV Sequence Database Los Alamos, NM). The
nucleotide sequence was examined for sequences that are
different from the control sequence. PR mutations were
noted at positions I62V, L63P, V77I, and N88S. I62V is a
naturally occurring polymorphism in HIV-1 PR and is not
associated with reduced susceptibility to any drug. L63P
has previously been described to be associated with
resistance to indinavir and nelfinavir. V77I has
previously been described to be associated with resistance
to nelfinavir. N88S has previously been described to be


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-100-
associated with resistance to nelfinavir (Patick, 1998)
and an investigational PRI, SC55389A (Smidt, 1997).
Phenotypic analysis of Patient 360
A resistance test vector was constructed as described in
example 1 from a patient sample designated as 360. This
patient had been previously treated with indinavir.
Isolation of viral RNA and RT/PCR was used to generate a
patient derived segment that comprised viral sequences
coding for all of PR and as 1 - 313 of RT. The patient
derived segment was inserted into an indicator gene viral
vector to generate a resistance test vector designated
RTV-360. RTV-360 was tested using a phenotypic
susceptibility assay to determine accurately and
quantitatively the level of susceptibility to a panel of
anti-retroviral drugs. This panel of anti-retroviral drugs
comprised members of the classes known as NRTIs (AZT, 3TC,
d4T, ddI, ddC, and abacavir), NNRTIs (delavirdine,
nevirapine and efavirenz), and PRIs (indinavir,
nelfinavir, ritonavir, saquinavir and amprenavir). An IC50
was determined for each drug tested. Susceptibility of
the patient virus to each drug was examined and compared
to known patterns of susceptibility. A pattern of
susceptibility to the PRIs was observed for patient sample
RTV-360 in which there was a decrease in indinavir and
nelfinavir susceptibility (increased resistance) and an
increase in amprenavir susceptibility. Patient sample 360
was examined further for genotypic changes associated with
the pattern of susceptibility.


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-101-
Determination of genotype of patient 360
RTV-360 DNA was analyzed by ABI chain terminator automated
sequencing. The nucleotide sequence was compared to the
consensus sequence of a wild type Glade B HIV-1 (HIV
Sequence Database Los Alamos, NM). The nucleotide
sequence was examined for sequences that are different
from the control sequence. PR mutations were noted at
positions I13V, K20M, M36V, N37A, M46I, I62V, L63P, N88S,
and I93L. I13V, N37A and I62V are naturally occurring
polymorphisms in HIV-1 PR and are not associated with
reduced susceptibility to any drug. K20M has previously
been described to be associated with resistance to
indinavir. M46I has previously been described to be
associated with resistance to indinavir, ritonavir,
nelfinavir and amprenavir. L63P has previously been
described to be associated with resistance to indinavir
and nelfinavir. N88S has previously been described to be
associated with resistance to nelfinavir (Patick,, 1998)
and an investigational PRI, SC55389A (Smidt, 1997).
Phenotypic analysis of Patient 0910
A resistance test vector was constructed as described in
example 1 from a patient sample designated as 0910. This
patient had been previously treated with nelfinavir.
Isolation of viral RNA and RT/PCR was used to generate a
patient derived segment that comprised viral sequences
coding for all of PR and as 1 - 313 of RT. The patient
derived segment was inserted into an indicator gene viral
vector to generate a resistance test vector designated
RTV-0910. RTV-0910 was tested using a phenotypic
susceptibility assay to determine accurately and
quantitatively the level of susceptibility to ~a panel of


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-102-
anti-retroviral drugs. This panel of anti-retroviral drugs
comprised members of the classes known as NRTIs (AZT, 3TC,
d4T, ddI, ddC, and abacavir), NNRTIs (delavirdine,
nevirapine and efavirenz), and PRIs (indinavir,
nelfinavir, ritonavir, saquinavir and amprenavir). An IC50
was determined for each drug tested. Susceptibility of
the patient virus to each drug was examined and compared
to known patterns of susceptibility. A pattern of
susceptibility to the PRIs was observed for patient sample
RTV-0910 in which there was a decrease in indinavir and
nelfinavir susceptibility (increased resistance) and an
increase in amprenavir susceptibility. Patient sample
0910 was examined further for genotypic changes associated
with the pattern of susceptibility.
Determination of genotype of patient 0910
RTV-0910 DNA was analyzed by ABI chain terminator
automated sequencing. The nucleotide sequence was
compared to the consensus sequence of a wild type Glade B
HIV-1 (HIV Sequence Database Los Alamos, NM). The
nucleotide sequence was examined for sequences that are
different from the control sequence. PR mutations were
noted at positions M46I, L63P, V77I, N88S and I93I/L.
I13V, K14R, N37D and I193L are naturally occuring
polymorphism in HIV-1 PR and is not associated with
reduced susceptibility to any drug. V77I has previously
been described to be associated with resistance to
nelfinavir. M46I has previously been described to be
associated with resistance to indinavir, ritonavir,
nelfinavir and amprenavir. L63P has previously been
described to be associated with resistance to indinavir
and nelfinavir. N88S has previously been described to be


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-103-
associated with resistance to nelfinavir (Patick, 1998)
and an investigational PRI, SC55389A (Smidt, 1997).
Phenotypic analysis of Patient 3542
A resistance test vector was constructed as described in
example 1 from a patient sample designated as 3542. This
patient had been treated with indinavir. Isolation of
viral RNA and RT/PCR was used to generate a patient
derived segment that comprised viral sequences coding for
all of PR and as 1 - 313 of RT. The patient derived
segment was inserted into an indicator gene viral vector
to generate a resistance test vector designated RTV-3542.
RTV-3542 was tested using a phenotypic -susceptibility
assay to determine accurately and quantitatively the level
of susceptibility to a panel of anti-retroviral drugs.
This panel of anti-retroviral drugs comprised members of
the classes known as NRTIs (AZT, 3TC, d4T, ddI, ddC, and
abacavir), NNRTIs (delavirdine, nevirapine and efavirenz),
and PRIs (indinavir, nelfinavir, ritonavir, saquinavir and
amprenavir). An IC50 was determined for each drug tested.
Susceptibility of the patient virus to each drug was
examined and compared to known patterns of susceptibility.
A pattern of susceptibility to the PRIs was observed for
patient sample RTV-3542 in which there was a decrease in
indinavir, nelfinavir and ritonavir susceptibility
(increased resistance) and an increase in amprenavir
susceptibility. Patient sample 3542 was examined further
for genotypic changes associated with the pattern of
susceptibility.
Determination of genotype of patient 3542
RTV-3542 DNA was analyzed by ABI chain terminator


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-104-
automated sequencing. The nucleotide sequence was
compared to the consensus sequence of a wild type Glade B
HIV-1 (HIV Sequence Database Los Alamos, NM). The
nucleotide sequence was examined for sequences that are
different from the control sequence. PR mutations were
noted at positions I13V, K14R, N37D, M46I, Z63P, N88S and
I93L. K14R and N37A/D are naturally occurring
polymorphisms in HIV-1 PR and are not associated with
reduced susceptibility to any drug. M46I has previously
been described to be associated with resistance to
indinavir, ritonavir, nelfinavir and amprenavir. L63P has
previously been described to be associated with resistance
to indinavir and nelfinavir. N88S has previously been
described to be associated with resistance to nelfinavir
(Patick, 1998) and an investigational PRI, SC55389A
(Smidt, 1997).
Phenotypic analysis of Patient 3654
A resistance test vector was constructed as described in
example 1 from a patient sample designated as 3654. This
patient had been previously treated with ritonavir.
Isolation of viral RNA and RT/PCR was used to generate a
patient derived segment that comprised viral sequences
coding for all of PR and as 1 - 313 of RT. The patient
derived segment, was inserted into an indicator gene viral
vector to generate a resistance test nectar designated
RTV-3654. RTV-3654 was tested using a phenotypic
susceptibility assay to determine accurately and
quantitatively the level of susceptibility to a panel of
anti-retroviral drugs. This panel of anti-retroviral drugs
comprised members of the classes known as NRTIs (AZT, 3TC,
d4T, ddI, ddC, and abacavir), NNRTIs (delavirdine,


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-105-
nevirapine and efavirenz), and PRIs (indinavir,
nelfinavir, ritonavir, saquinavir and amprenavir). An IC50
was determined for each drug tested. Susceptibility of
the patient virus to each drug was examined and compared
to known patterns of susceptibility. A pattern of
susceptibility to the PRIs was observed for patient sample
RTV-3654 in which there was a decrease in indinavir and
nelfinavir susceptibility (increased resistance) and an
increase in amprenavir susceptibility. Patient sample
3654 was examined further for genotypic changes associated
with the pattern of susceptibility.
Determination of genotype of patient 3654
RTV-3654 DNA was analyzed ~ by ABI chain terminator
automated sequencing. The nucleotide sequence was
compared to the consensus sequence of a wild type Glade B
HIV-1 (HIV Sequence Database Los Alamos, NM). The
nucleotide sequence was examined for sequences that are
different from the control sequence. PR mutations were
noted at positions I13V, R41K, M46I, L63P, V77I, N88S and
I93L. I13V, R41K and I93L are naturally occurring
polymorphism in HIV-1 PR and is not associated with
reduced susceptibility to any drug. M46I has previously
been described to be associated with resistance to
indinavir, ritonavir, nelfinavir and amprenavir. L63P has
previously been described to be associated with resistance
to indinavir and nelfinavir. V77I has previously been
described to be associated with resistance to nelfinavir.
N88S has previously been described to be associated with
resistance to an investigational PRI, SC55389A (Smidt,
1997).


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-106-
EXAMPLE 4
Using Site Directed Mutants To Correlate Genotypes And
Phenotypes Associated With Changes in PRI Drug
Susceptibility in HIV.
Site directed mutagenesis
Resistance test vectors were constructed containing the
N88S mutation alone and in combination with other
substitutions in PR {L63P, V77I and M46L) known to
modulate the HIV susceptibility to PRIs. Mutations were
introduced into the resistance test vector using the
mega-primer PCR method for site-directed mutagenesis.
(Sakar G and Sommar SS (1994) Siotechniques 8{4),
404-407). First, a resistance test vector was constructed
that harbors a unique RsrIT restriction site 590 by
downstream of the ApaI restriction site. The 590 by ApaI
- RsrII fragment thus contains the entire protease region.
This site was introduced by site-specific
oligonucleotide-directed mutagenesis using primer #4. All
subsequent mutants were constructed by fragment-exchange
of the wild-type ApaI - RsrII fragment in the parent
vector with the equivalent fragment carrying the
respective mutations.
A resistance test vector containing the N88S mutation
(N88S-RTV) was tested using the phenotypic susceptibility
assay described above and the results were compared to
that of a genetically defined resistance test vector that
was wild type at position 88. The pattern of phenotypic
susceptibility to the PRIs in the N88S-RTV was altered as
compared to wild type. In the context of an otherwise
wild type background (i.e. N88S mutation alone) the
N88S-RTV was more susceptible to both amprenavir and


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-107-
ritonavir and slightly less susceptible to nelfinavir
compared to the wild type control RTV ( ee Table 2).
A resistance test vector containing the N88S mutation
along with the L63P mutation (L63P-N88S-RTV) was tested
using the phenotypic susceptibility assay described above
and the results were compared to that of a genetically
defined resistance test vector that was wild type at
positions 63 and 88. The L63P-N88S-RTV showed decreased
susceptibility to both indinavir and nelfinavir and an
increase in the susceptibility to amprenavir compared the
wild-type control RTV (see Table 2). Thus it appears that
the introduction of a second mutation, L63P, in addition
to N88S, results in a reduction in susceptibility to
nelfinavir and indinavir while the increased
susceptibility to amprenavir is maintained.
A resistance test vector containing the N88S mutation
along with the L63P mutation and the V77I mutation
(L63P-V77I-N88S-RTV) was tested using the phenotypic
susceptibility assay described above and the results were
compared to that of a genetically defined resistance test
vector that was wild type at positions 63 and 77 and 88.
The RTV containing mutations at these positions,
L63P-V77I-N88S-RTV, showed a decrease in susceptibility to
both indinavir and nelfinavir and an increase in the
susceptibility to amprenavir compared to the wild-type
control RTV (see Fig. 5 and Table 2). Thus it appears
that the introduction of a third mutation, V77I, in
addition to L63P and N88S, results in a reduction in
susceptibility to nelfinavir and indinavir while the
increased susceptibility to amprenavir is maintained.


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-108-
The N88S mutation was also introduced into an RTV
containing additional mutations at positions L63P and M46L
(M46L + L63P + N88S). The RTV containing mutations at
these positions, M46L-L63P-N88S-RTV showed a decrease in
susceptibility to nelfinavir and a slight decrease in
susceptibility to indinavir and an increase in the
susceptibility to amprenavir compared to the wild-type
control RTV (see Fig. 5 and Table 2). Thus it appears
that the introduction of a third mutation, M46L, in
addition to L63P and N88S, results in a reduction in
susceptibility to nelfinavir and indinavir while the
increased susceptibility to amprenavir is maintained.
A resistance test vector containing the N88S mutation
along with the M46L mutation, the L63P mutation, and the
V77I mutation (M46L-L63P-V77I-N88S-RTV) was tested using
the phenotypic susceptibility assay described above and
the results were compared to that of a genetically defined
resistance test vector that was wild type at positions 46,
63, 77 and 88. The RTV containing mutations at these four
positions, M46L-L63P-V77I-N88S-RTV showed a decrease in
susceptibility to nelfinavir and indinavir and an increase
in the susceptibility to amprenavir compared to the
wild-type control RTV (see Fig. 5 and Table 2). Thus it
appears that the introduction of a fourth mutation, V77I,
in addition to L63P, M46L and N88S results in a reduction
in susceptibility to nelfinavir and indinavir while the
increased susceptibility to amprenavir is maintained.
A resistance test vector containing the L63P mutation
(L63P-RTV) was tested using the phenotypic susceptibility
assay described above and the results were compared to


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-109-
that of a genetically defined resistance test vector that
was wild type at position 63. The pattern of phenotypic
susceptibility to the PRIs in the L63P-RTV was similar to
wild type with no significant changes in susceptibility to
the PRIs observed.
The L63P mutation was also introduced into an RTV
containing an additional mutation at position V77I. The
L63P-V77I-RTV showed a slight decrease in susceptibility
to nelfinavir compared to the wild-type control RTV (see
Fig. 5 and Table 2).
EXAMPhE 5
Predicting Response to Protease Inhibitors by
Characterization of Amino Acid 88 of HIV-1 Protease.
In one embodiment of this invention, changes in the amino
acid at position 88 of the protease protein of HIV-1 is
evaluated using the following method comprising: (i)
collecting a biological sample from an HIV-1 infected
subject; (ii) evaluating whether the biological sample
contains nucleic acid encoding HIV-1 protease having an
asparagine to serine mutation at codon 88 (N88S); and
(iii) determining susceptibility to protease inhibitors
(PRI) .
The biological sample comprises whole blood, blood
components including peripheral mononuclear cells (PBMC),
serum, plasma (prepared using various anticoagulants such
as EDTA, acid citrate-dextrose, heparin), tissue biopsies,
cerebral spinal fluid (CSF), or other cell, tissue or body
fluids. In another embodiment, the HIV-1 nucleic acid


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-110-
(genomic RNA) or reverse transcriptase protein can be
isolated directly from the biological sample or after
purification of virus particles from the biological
sample. Evaluating whether the amino acid at position 88
of the HIV-1 protease is mutated to serine, can be
performed using various methods, such as direct
characterization of the viral nucleic acid encoding
protease or direct characterization of the protease
protein itself. Defining the amino acid at position 88 of
protease can be performed by direct characterization of
the protease protein by conventional or novel amino acid
sequencing methodologies, epitope recognition by
antibodies or other specific binding proteins or
compounds. Alternatively, the amino acid at position 88
of the HIV-1 protease protein can be defined by
characterizing amplified copies of HIV-1 nucleic acid
encoding the protease protein. Amplification of the HIV-1
nucleic acid can be performed using a variety of
methodologies including reverse transcription-polymerase
chain reaction (RT-PCR), NASBA, SDA, RCR, or 3SR. The
nucleic acid sequence encoding HIV protease at codon 88
can be determined by direct nucleic acid sequencing using
various primer extension-chain termination (Sanger, ABI/PE
and Visible Genetics) or chain cleavage (Maxam and
Gilbert) methodologies or more recently developed
sequencing methods such as matrix assisted laser
desorption-ionization time of flight (MALDI-TOF) or mass
spectrometry (Sequenom, Gene Trace Systems).
Alternatively, the nucleic acid sequence encoding amino
acid position 88 can be evaluated using a variety of probe
hybridization methodologies, such as genechip
hybridization sequencing (Affymetrix), line probe assay


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-111-
(LiPA; Murex), and differential hybridization (Chiron).
In a preferred embodiment of this invention, evaluation of
protease inhibitor susceptibility and of whether amino
acid position 88 of HIV-1 protease was wild type or serine
was carried out using a phenotypic susceptibility assay or
genotypic assay, respectively, using resistance test
vector DNA prepared from the biological sample. In one
embodiment, the plasma sample was collected, viral RNA was
purified and an RT-PCR methodology was used to amplify a
patient derived segment encoding the HIV-1 protease and
reverse transcriptase regions. The amplified patient
derived segments were then incorporated, via DNA ligation
and bacterial transformation, into an indicator gene viral
vector thereby generating a resistance test vector.
Resistance test vector DNA was isolated from the bacterial
culture and the phenotypic susceptibility assay was
carried out as described in Example 1. The results of the
phenotypic susceptibility assay with a patient sample
having an N88S mutation in PR is shown in Figure 4. The
nucleic acid (DNA) sequence of the patient derived HIV-1
protease and reverse transcriptase regions from patient
sample 0732 was determined using a fluorescence detection
chain termination cycle sequencing methodology (ABI/PE).
The method was used to determine a consensus nucleic acid
sequence representing the combination of sequences of the
mixture of HIV-1 variants existing in the subject sample
(representing the quasispecies), and to determine the
nucleic acid sequences of individual variants.
Phenotypic and genotypic correlation of mutations at amino
acid 88 of HIV-1 Protease.


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-112-
Phenotypic susceptibility profiles of patient samples and
site directed mutants showed that amprenavir
susceptibility correlated with the presence of the N88S
mutation in HIV-1 protease. Phenotypic susceptibility
profiles of patient samples and site directed mutants
showed that a significant increase in amprenavir
susceptibility (decreased resistance) correlated with a
mutation in the nucleic acid sequence encoding the amino
acid serine (S) at position 88 of HIV-1 protease.
Phenotypic susceptibility profiles of patient samples and
site directed mutants showed reduction in amprenavir
susceptibility (decreased resistance) and a decrease in
susceptibility to nelfinavir and indinavir with the amino
acid serine at position 88 when the PR mutations at
positions 63, 77 or 46 were also present (h63P, V77I, or
M4 6Z ) .
EXAMPhE
Using Resistance test vectors and site directed mutants to
correlate genotypes associated with alterations in PRI
susceptibility with viral fitness.
Zuciferase activity measured in the absence of drug for
the seven resistance test vectors constructed from the
patient viruses containing the N88S PR mutation ranged
from 0.7 to 160 of control (Table 3). Although these
viruses also contain multiple mutations in reverse
transcriptase, which could also contribute to a reduction
in viral fitness, the data suggest that viruses containing
the N88S mutation are less fit than wild type. To confirm


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-113-
this observation, the luciferase expression level for the
site-directed mutant resistance test vectors was also
examined.
Viruses containing N88S as the only substitution produced
only 1.0o of the luciferase activity in the absence of
drug (Table 4). This reduction was , substantially
alleviated by the addition of the L63P substitution
(20.70) or by addition of the combinations of L63P/V77I
(29.30) or M46L/L63P (28.0o). The L63P or L63P/V77I
mutants had equivalent or increased relative luciferase
activity compared to wild type (163.9 and 75.60,
respectively).
When the K20T substitution was added to the N88S
background, either alone or in combination with L63P, only
background levels of luciferase activity was detected.
Sequence analysis confirmed the absence of additional
mutations, which might render the vector inactive. Thus
the combination of the K20T and N88S substitutions
correlates with a severe defect in fitness.
EXAMPhE 7
Predicting Response to Protease Inhibitors by
Characterization of Amino Acid 82 of HIV-1
Protease.
In one embodiment of this invention, changes in the amino
acid at position 82 of the protease protein of HIV-1 are
evaluated using the following method comprising: (i)
collecting a biological sample from an HIV-1 infected
subjecti (ii) evaluating whether the biological sample


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-114-
contains nucleic acid encoding HIV-1 protease having a
valine to alanine (V82A), phenylalanine (V82F), serine
(V82S), or threonine (V82T) substitution at codon 82; and
(iii) determining susceptibility to protease inhibitors
( PRI ) .
The biological sample comprises whole blood, blood
components including peripheral mononuclear cells (PBMC),
serum, plasma (prepared using various anticoagulants such
as EDTA, acid citrate-dextrose, heparin), tissue biopsies,
cerebral spinal fluid (CSF), or other cell, tissue or body
fluids. In another embodiment, the HIV-1 nucleic acid
(genomic RNA) or reverse transcriptase protein can be
isolated directly from the biological sample or after
purification of virus particles from the biological
sample. Evaluating whether the amino acid at position 82
of the HIV-1 protease is mutated to alanine,
phenylalanine, serine, or threonine, can be performed
using various methods, such as direct characterization of
the viral nucleic acid encoding protease or direct
characterization of the protease protein itself. Defining
the amino acid at position 82 of protease can be performed
by direct characterization of the protease protein by
conventional or novel amino acid sequencing methodologies,
epitope recognition by antibodies or other specific
binding proteins or compounds. Alternatively, the amino
acid at position 82 of the HIV-1 protease protein can be
defined by characterizing amplified copies of HIV-1
nucleic acid encoding the protease protein. Amplification
of the HIV-1 nucleic acid can be performed using a variety
of methodologies including reverse
transcription-polymerase chain reaction (RT-PCR), NASBA,


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-115-
SDA, RCR, or 3SR. The nucleic acid sequence encoding HIV
protease at codon 82 can be determined by direct nucleic
acid sequencing using various primer extension-chain
termination (Sanger, ABI/PE and Visible Genetics) or chain
cleavage (Maxam and Gilbert) methodologies or more
recently developed sequencing methods such as matrix
assisted laser desorption-ionization time of flight
(MALDI-TOF) or mass spectrometry (Sequenom, Gene Trace
Systems). Alternatively, the nucleic acid sequence
encoding amino acid position 82 can be evaluated using a
variety of probe hybridization methodologies, such as
genechip hybridization sequencing (Affymetrix), line probe
assay (LiPA; Murex), and differential hybridization
(Chiron).
In a preferred embodiment of this invention, evaluation of
protease inhibitor susceptibility and of whether amino
acid position 82 of HIV-1 protease was wild type or
alanine, phenylalanine, serine, or threonine, was carried
out using a phenotypic susceptibility assay or genotypic
assay, respectively, using resistance test vector DNA
prepared from the biological sample. In one embodiment,
the plasma sample was collected, viral RNA was purified
and an RT-PCR methodology was used to amplify a patient
derived segment encoding the HIV-1 protease and reverse
transcriptase regions. The amplified patient derived
segments were then incorporated, via DNA ligation and
bacterial transformation, into an indicator gene viral
vector thereby generating a resistance test vector.
Resistance test vector DNA was isolated from the bacterial
culture and the phenotypic susceptibility assay was
carried out and analyzed as described in Example 1.


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-116-
The nucleic acid (DNA) sequence of the patient derived
HIV-1 protease and reverse transcriptase regions was
determined using a fluorescence detection chain
termination cycle sequencing methodology (ABI/PE). The
method was used to determine a consensus nucleic acid
sequence representing the combination of sequences of the
mixture of HIV-1 variants existing in the subject sample
(representing the quasispecies), and to determine the
nucleic acid sequences of individual variants. Genotypes
are analyzed as lists of amino acid differences between
virus in the patient sample and a reference laboratory
strain of HIV-l, NL4-3. Genotypes and corresponding
phenotypes (fold-change in IC50 values) are entered in a
relational database linking these two results with patient
information. Large datasets can then be assembled from
patient virus samples sharing particular characteristics,
such as the presence of any given mutation, or combination
of mutations or reduced susceptibility to any drug or
combination of drugs.
(a) Protease inhibitor susceptibility of viruses
containing mutations at amino acid 82 of HIV-Z Protease.
Phenotypic susceptibility profiles of 75 patient virus
samples which contained a mutation at position 82 (V82A,
F, S, or T), but no other primary mutations, were
analyzed. According to most published guidelines, such
viruses are expected to be resistant to ritonavir,
nelfinavir, indinavir, and saquinavir. However, 80, 200,
23%, and 73o of these samples were phenotypically
susceptible to these four protease inhibitors,


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-117-
respectively (see Table 6). Thus, particularly for
indinavir and saquinavir, there was poor correlation
between the presence of mutations at position 82 and drug
susceptibility.
(b) Indinavir susceptibility of viruses containing
combinations of mutations at amino acid 82 and one
secondary mutation in HIV-Z Protease.
Indinavir resistance in viruses containing mutations at
position 82 was evaluated with respect to the presence of
1.5 other specific mutations. Decreased indinavir
susceptibility (fold-change in ICso greater than 2.5) in
viruses containing V82A, F, S, or T but no other primary
mutations was correlated with the presence of mutations at
secondary positions. Reduced indinavir susceptibility was
observed in 20 samples containing mutations at both
positions 24 and 82 (1000) and in 27 samples with both 71
and 82 ( 100% ) ( See Table 7 ) . The combination of mutations
at position 82 with mutations at other positions (e.g. 54,
46, 10, and 63) also significantly increased the
proportion of samples that had reduced indinavir
susceptibility (Table 7).
(c) Saquinavir susceptibility of viruses containing
combinations of mutations at amino acid 82 and one
secondary mutation in HIV-1 Protease.
Saquinavir resistance in viruses containing mutations at
position 82 was evaluated with respect to the presence of
other specific mutations. Decreased saquinavir
susceptibility (fold-change in ICso greater than 2.5) in
viruses containing V82A, F, S, or T but no other primary
mutations was correlated with the presence of mutations at


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-11s-
secondary positions. Reduced saquinavir susceptibility was
observed in 4 of 5 samples containing mutations at both
positions 20 and 82 (800) and in 8 of 11 samples with both
36 and 82 (73o) (See Table 8). The combination of
mutations at position 82 with mutations at other positions
(e.g. 24, 71, 54, and 10) also significantly increased the
proportion of samples that had reduced saquinavir
susceptibility (Table 8).
(d) Indinavir susceptibility of viruses containing
combinations of mutations at amino acid 82 and many
secondary mutations in HIV-Z Protease.
Indinavir resistance in viruses containing mutations at
position 82 was evaluated with respect to the presence of
a defined number of other mutations. Decreased indinavir
susceptibility (fold-change in ICso greater than 2.5) in
viruses containing V82A, F, S, or T but no other primary
mutations was correlated with the number of mutations at
secondary positions. Reduced indinavir susceptibility was
observed in 100% of samples with V82A, F, S, or T and at
least 6 other secondary mutations (See Table 9). The
proportion of samples that had reduced indinavir
susceptibility increased significantly in samples with
V82A, F, S, or T combined with 3 to 5 other secondary
mutations (Table 9).
(e) Saguinavir susceptibility of viruses containing
combinations of mutations at amino acid 82 and many
secondary mutations in HIV-1 Protease.
Saquinavir resistance in viruses containing mutations at
position 82 was evaluated with respect to the presence of
a defined number of other mutations. Decreased saquinavir


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-119-
susceptibility (fold-change in ICSO greater than 2.5) in
viruses containing V82A, F, S, or T but no other primary
mutations was correlated with the number of mutations at
secondary positions. Reduced saquinavir susceptibility
was observed in 60 to 760 of samples with V82A, F, S, or T
and at least 5 other secondary mutations (See Table 9).
The proportion of samples that had reduced saquinivir
susceptibility increased significantly in samples with
V82A, F, S, or T combined with 3 or 4 other secondary
mutations (Table 9).
EXAMPLE 8
Predicting Response to Protease Inhibitors by
Characterization of Amino Acid 90 of HIV-1
Protease.
In one embodiment of this invention, changes in the amino
acid at position 90 of the protease protein of HIV-1 are
evaluated using the following method comprising: (i)
collecting a biological sample from an HIV-1 infected
subject; (ii) evaluating whether the biological sample
contains nucleic acid encoding HIV-1 protease having a
leucine to methionine (Z90M) substitution at codon 90; and
(iii) determining susceptibility to protease inhibitors
( PRI ) .
The biological sample comprises whole. blood, blood
components including peripheral mononuclear cells (PBMC),
serum, plasma (prepared using various anticoagulants such
as EDTA, acid citrate-dextrose, heparin), tissue biopsies,
cerebral spinal fluid (CSF), or other cell, tissue or body
fluids. In another embodiment, the HIV-1 nucleic acid


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-120-
(genomic RNA) or reverse transcriptase protein can be
isolated directly from the biological sample or after
purification of virus particles from the biological
sample. Evaluating whether the amino acid at position 90
of the HIV-1 protease is mutated to methionine, can be
performed using various methods, such as direct
characterization of the viral nucleic acid encoding
protease or direct characterization of the protease
protein itself. Defining the amino acid at position 90 of
protease can be performed by direct characterization of
the protease protein by conventional or novel amino acid
sequencing methodologies, epitope recognition by
antibodies or other specific binding proteins or
compounds. Alternatively, the amino acid at position 90
of the HIV-1 protease protein can be defined by
characterizing amplified copies of HIV-1 nucleic acid
encoding the protease protein. Amplification of the HIV-1
nucleic acid can be performed using a variety of
methodologies including reverse transcription-polymerase
chain reaction (RT-PCR), NASBA, SDA, RCR, or 3SR. The
nucleic acid sequence encoding HIV protease at codon 90
can be determined by direct nucleic acid sequencing using
various primer extension-chain termination (Sanger, ABI/PE
and Visible Genetics) or chain cleavage (Maxam and
Gilbert) methodologies or more recently developed
sequencing methods such as matrix assisted laser
desorption-ionization time of flight (MALDI-TOF) or mass
spectrometry (Sequenom, Gene Trace Systems).
Alternatively, the nucleic acid sequence encoding amino
acid position 90 can be evaluated using a variety of probe
hybridization methodologies, such as genechip
hybridization sequencing (Affymetrix), line probe assay


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-121-
(LiPA; Murex), and differential hybridization (Chiron).
In a preferred embodiment of this invention, evaluation of
protease inhibitor susceptibility and of whether amino
acid position 90 of HIV-1 protease was wild type or
methionine, was carried out using a phenotypic
susceptibility assay or genotypic assay, respectively,
using resistance test vector DNA prepared from the
biological sample. In one embodiment, the plasma sample
was collected, viral RNA was purified and an RT-PCR
methodology was used to amplify a patient derived segment
encoding the HIV-1 protease and reverse transcriptase
regions. The amplified patient derived segments were then
incorporated, via DNA ligation and bacterial
transformation, into an indicator gene viral vector
thereby generating a resistance test vector. Resistance
test vector DNA was isolated from the bacterial culture
and the phenotypic susceptibility assay was carried out
and analyzed as described in Example 1.
The nucleic acid (DNA) sequence of the patient derived
HIV-1 protease and reverse transcriptase regions was
determined using a fluorescence detection chain
termination cycle sequencing methodology (ABIjPE). The
method was used to determine a consensus nucleic acid
sequence representing the combination of sequences of the
mixture of HIV-1 variants existing in the subject sample
(representing the quasispecies), and to determine the
nucleic acid sequences of individual variants. Genotypes
are analyzed as lists of amino acid differences between
virus in the patient sample and a reference laboratory
strain of HIV-1, NL4-3. Genotypes and corresponding


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-122-
phenotypes (fold-change in IC50 values) are entered in a
relational database linking these two results with patient
information. Large datasets can then be assembled from
patient virus samples sharing particular characteristics,
such as the presence of any given mutation, or combination
of mutants, or reduced susceptibility to any drug or
combination of drugs.
(a) Protease inhibitor susceptibility of viruses
containing mutations at amino acid 90 of HIV-1 Protease.
Phenotypic susceptibility profiles, of 58 patient virus
samples which contained a mutation at position 90 (L90M),
but no other primary mutations, were analyzed. According
to most published guidelines, such viruses are expected to
be resistant to ritonavir, nelfinavir, indinavir, and
saquinavir. However, 280, 90, 310, and 47% of these
samples were phenotypically susceptible to these four
protease inhibitors, respectively (see Table 6). Thus,
particularly for indinavir and saquinavir, there was poor
correlation between the presence of mutations at position
90 and drug susceptibility.
(b) Indinavir susceptibility of viruses containing
combinations of mutations at amino acid 90 and one
secondary mutation in HIV-1 Protease.
Indinavir resistance in viruses containing mutations at
position 90 was evaluated with respect to the presence of
other specific mutations. Decreased indinavir
susceptibility (fold-change in ICso greater than 2.5) in
viruses containing L90M but no other primary mutations was
correlated with the presence of mutations at secondary


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-123-
positions. Reduced indinavir susceptibility was observed
in 17 of 19 samples containing mutations at both positions
7 3 and 90 ( 8 9 0 ) and in 16 of 18 samples with both 71 and
90 (890) (See Table 10). The combination of mutations at
position 90 with mutation at position 46 also
significantly increased the proportion of samples that had
reduced indinavir susceptibility (Table 10).
(c) Saquinavir susceptibility of viruses containing
combinations of mutations at amino acid 90 and one
secondary mutation in HIV-1 Protease.
Saquinavir resistance in viruses containing mutations at
position 90 was evaluated with respect to the presence of
other specific mutations. Decreased saquinavir
susceptibility (fold-change in ICSO greater than 2.5) in
viruses containing Z90M but no other primary mutations was
correlated with the presence of mutations at secondary
positions. Reduced saquinavir susceptibility was observed
in 15 of 19 samples containing mutations at both positions
73 and 90 (79 0 ) and in 14 of 18 samples with both 71 and
90 ( 7 8 0 ) ( See Table 11 ) . The combination of mutations at
position 90 with mutations at other positions (e.g. 77 and
10) also significantly increased the proportion of samples
that had reduced saquinavir susceptibility (Table 1).
(d) Indinavir susceptibility of viruses containing
combinations of mutations at amino acid 90 and many
secondary mutations in HIV-1 Protease.
Indinavir resistance in viruses containing mutations at


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-124-
position 90 was evaluated with respect to the presence of
a defined number of other mutations. Decreased indinavir
susceptibility (fold-change in ICSO greater than 2.5) in
viruses containing L90M but no other primary mutations was
correlated with the number of mutations at secondary
positions. Reduced indinavir susceptibility was observed
in 1000 of~ samples with L90M and at least S other
secondary mutations had (See Table 12). The proportion of
samples that had reduced indinavir susceptibility
increased significantly in samples with L90M combined with
3 or 4 other secondary mutations (Table 12).
(e) Saquinavir susceptibility of viruses containing
combinations of mutations at amino acid 90 and many
secondary mutations in HIV-1 Protease.
Saquinavir resistance in viruses containing mutations at
position 90 was evaluated with respect to the presence of
a defined number of other mutations. Decreased saquinavir
susceptibility (fold-change in ICso greater than 2.5) in
viruses containing L90M but no other primary mutations was
correlated with the number of mutations at secondary
positions. Reduced saquinavir susceptibility was observed
in 100% of samples with L90M and at least 5 other
secondary mutations (See Table 12). The proportion of
samples that had reduced saquinivir susceptibility
increased significantly in samples with L90M combined with
3 or 4 other secondary mutations (Table 12).
EXAMPhE 9
Predicting Response to Protease Inhibitors by
Characterization of Amino Acids 82 arid 90 of HIV-1
Protease.


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-125-
In one embodiment of this invention, changes in the amino
acid at position 82 and 90 of the protease protein of
HIV-1 are evaluated using the following method comprising:
(i) collecting a biological sample from an HTV-1 infected
subject; (ii) evaluating whether the biological sample
contains nucleic acid encoding HIV-1 protease having a
valine to alanine (V82A), phenylalanine (V82F), serine
(V82S), or threonine (V82T) substitution at codon 82 or a
leucine to methionine at position 90 (Z90M); and (iii)
determining susceptibility to protease inhibitors (PRI).
The biological sample comprises whole blood, blood
components including peripheral mononuclear cells (PBMC),
serum, plasma (prepared using various anticoagulants such
as EDTA, acid citrate-dextrose, heparin), tissue biopsies,
cerebral spinal fluid (CSF), or other cell, tissue or body
fluids. In another embodiment, the HIV-1 nucleic acid
(genomic RNA) or reverse transcriptase protein can be
isolated directly from the biological sample or after
purification of virus particles from the biological
sample. Evaluating whether the amino acid at position 82
of the HIV-1 protease is mutated to alanine,
phenylalanine, serine, or threonine or at position 90 to
methionine, can be performed using various methods, such
as direct characterization of the viral nucleic acid
encoding protease or direct characterization of the
protease protein itself. Defining the amino acid at
positions 82 and 90 of protease can be performed by direct
characterization of the protease protein by conventional
or novel amino acid sequencing methodologies, epitope
recognition by antibodies or other specific binding


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-126-
proteins or compounds. Alternatively, the amino acid at
positions 82 and 90 of the HIV-1 protease protein can be
defined by characterizing amplified copies of HTV-1
nucleic acid encoding the protease protein. Amplification
of the HIV-1 nucleic acid can be performed using a variety
of methodologies including reverse
transcription-polymerase chain reaction (RT-PCR), NASBA,
SDA, RCR, or 3SR. The nucleic acid sequence encoding HIV
protease at codons 82 and 90 can be determined by direct
nucleic acid sequencing using various primer
extension-chain termination (Sanger, ABIIPE and Visible
Genetics) or chain cleavage (Maxam and Gilbert)
methodologies or more recently developed sequencing
methods such as matrix assisted laser
desorption-ionization time of flight (MALDI-TOF) or mass
spectrometry (Sequenom, Gene Trace Systems).
Alternatively, the nucleic acid sequence encoding amino
acid positions 82 and 90 can be evaluated using a variety
of probe hybridization methodologies, such as genechip
hybridization sequencing (Affymetrix), line probe assay
(LiPA~ Murex), and differential hybridization (Chiron).
In a preferred embodiment of this invention, evaluation of
protease inhibitor susceptibility and of whether amino
acid positions 82 and 90 of HIV-1 protease was wild type
or alanine, phenylalanine, serine, or threonine in the
case of position 82 and methionine at position 90, was
carried out using a phenotypic susceptibility assay or
genotypic assay, respectively, using resistance test
vector DNA prepared from the biological sample. In one
embodiment, plasma sample was collected, viral RNA was
purified and an RT-PCR methodology was used to amplify a


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-12'7-
patient derived segment encoding the HIV-1 protease and
reverse transcriptase regions. The amplified patient
derived segments were then incorporated, via DNA ligation
and bacterial transformation, into an indicator gene viral
vector thereby generating a resistance test vector.
Resistance test vector DNA was isolated from the bacterial
culture and the phenotypic susceptibility assay was
carried out and analyzed as described in Example 1.
The nucleic acid (DNA) sequence of the patient derived
HIV-1 protease and reverse transcriptase regions was
determined using a fluorescence detection chain
termination cycle sequencing methodology (ABIIPE). The
method was used to determine a consensus nucleic acid
sequence representing the combination of sequences of the
20. mixture of HIV-1 variants existing in the subject sample
(representing the quasispecies), and to determine the
nucleic acid sequences of individual variants. Genotypes
are analyzed as lists of amino acid differences between
virus in the patient sample and a reference laboratory
strain of HIV-1, NL4-3. Genotypes and corresponding
phenotypes (fold-change in IC50 values) are entered in a
relational database linking these two results with patient
information. Large datasets can then be assembled from
patient virus samples sharing particular characteristics,
such as the presence of any given mutation or reduced
susceptibility to any drug or combination of drugs.
Protease inhibitor susceptibility of viruses containing
mutations at amino acids 82 and 90 of HIV-1 Protease.
Phenotypic susceptibility profiles of 33 patient virus
samples which contained mutations at positions 82 (V82A,


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-128-
F, S, or T) and 90 (L90M), but no other primary mutations,
were analyzed. According to most published guidelines,
such viruses are expected to be resistant to ritonavir,
nelfinavir, indinavir, and saquinavir. However, 9o and
210 of these samples were phenotypically susceptible to
indinavir and saquinavir, respectively (see Table 6).
Thus, particularly for saquinavir, there was poor
correlation between the presence of mutations at positions
82 and 90 and drug susceptibility.
EXAMPLE 10
Measuring Replication Fitness Using Resistance Test
Vectors
A means and method is provided for accurately measuring
and reproducing the replication fitness of HIV-1. This
method for measuring replication fitness is applicable to
other viruses, including, but not limited to
hepadnaviruses (human hepatitis B virus), flaviviruses
(human hepatitis C virus) and herpesviruses (human
cytomegalovirus). This example further provides a means
and method for measuring the replication fitness of HIV-1
that exhibits reduced drug susceptibility to reverse
transcriptas~e inhibitors and protease inhibitors. This
method can be used for measuring replication fitness for
other classes of inhibitors of HIV-1 replication,
including, but not limited to integration, virus assembly,
and virus attachment and entry.


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-129-
Replication fitness tests are carried out using the means
and methods for phenotypic drug susceptibility and
resistance tests described in US Patent Number 5,837,464
(International Publication Number WO 97/27319) which is
hereby incorporated by reference.
In these experiments patient-derived segments)
corresponding to the HIV protease and reverse
transcriptase coding regions were either patient-derived
segments amplified by the reverse transcription-polymerase
chain reaction method (RT-PCR) using viral RNA isolated
from viral particles present in the serum of HIV-infected
individuals or were mutants of wild type HIV-1 made by
site directed mutagenesis of a parental clone of
resistance test vector DNA. Resistance test vectors are
also referred to as "fitness test vectors" when used to
evaluate replication fitness. Isolation of viral RNA was
performed using standard procedures (e. g. RNAgents Total
RNA Isolation System, Promega, Madison WI or RNAzol,
Tel-Test, Friendswood, TX). The RT-PCR protocol was
divided into two steps. A retroviral reverse
transcriptase [e. g. Moloney MuLV reverse transcriptase
(Roche Molecular Systems, Inc., Branchburg, NJ), or avian
myeloblastosis virus (AMV) reverse transcriptase,
(Boehringer Mannheim, Indianapolis, IN)] was used to copy
viral RNA into cDNA. The cDNA was then amplified using a
thermostable DNA polymerase [e. g. Taq (Roche Molecular
Systems, Inc., Branchburg, NJ), Tth (Roche Molecular
Systems, Inc., Branchburg, NJ), PrimeZyme (isolated from
Thermus brockianus, Biometra, Gottingen, Germany)] or a
combination of thermostable polymerases as described for
the performance of "long PCR" (Barnes, W.M., (1994) Proc.


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-130-
Natl. Acad. Sci, USA 91, 2216-2220) [e. g. Expand High
Fidelity PCR System (Taq + Pwo), (Boehringer Mannheim.
Indianapolis, TN) OR GeneAmp XL PCR kit (Tth + Vent),
(Roche Molecular Systems, Inc., Branchburg, NJ)].
PCR6 (Table 5, #1) is used for reverse transcription of
viral RNA into cDNA. The primers, ApaI primer (PDSApa,
Table 5, #2) and Agel primer (PDSAge, Table 5, #3) used to
amplify the "test" patient-derived segments contained
sequences resulting in ApaI and AgeI recognition sites
being introduced into both ends of the PCR product,
respectively.
Fitness test vectors incorporating the "test"
patient-derived segments were constructed as described in
US Patent Number 5,837,464 (International Publication
Number WO 97!27319) (see Fig. 1) using an amplified DNA
product of 1.5 kB prepared by RT-PCR using viral RNA as a
template and oligonucleotides PCR6 (#1), PDSApa (#2) and
PDSAge (#3) as primers, followed by digestion with ApaI
and AgeI or the isoschizomer PinAl. To ensure that the
plasmid DNA corresponding to the resultant fitness test
vector comprises a representative sample of the HIV viral
quasi-species present in the serum of a given patient,
many (>100) independent E. coli transformants obtained in
the construction of a given fitness test vector were
pooled and used for the preparation of plasmid DNA.
A packaging expression vector encoding an amphotrophic
MuLV 4070A env gene product enables production in a
fitness test vector host cell of fitness test vector viral


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-131-
particles which can efficiently infect human target cells.
Fitness test vectors encoding all HIV genes with the
exception of env were used to transfect a packaging host
cell (once transfected the host cell is referred to as a
fitness test vector host cell). The packaging expression
vector which encodes the amphotrophic MuZV 4070A env gene
product is used with the resistance test vector to enable
production in the fitness test vector host cell of
infectious pseudotyped fitness test vector viral
particles.
Fitness tests performed with fitness test vectors were
carried out using packaging host and target host cells
consisting of the human embryonic kidney cell line 293
(Cell Culture Facility, UC San Francisco, SF, CA)..
Fitness tests were carried out with fitness test vectors
using two host cell types. Fitness test vector viral
particles were produced by a first host cell (the fitness
test vector host cell) that was prepared by transfecting a
packaging host cell with the fitness test vector and the
packaging expression vector. The fitness test vector
viral particles were then used to infect a second host
cell (the target host cell) in which the expression of the
indicator gene is measured (see Fig. A).
The fitness test vectors containing a functional
luciferase gene cassette were constructed and host cells
were transfected with the fitness test vector DNA. The
fitness test vectors contained patient-derived reverse
transcriptase and protease DNA sequences that encode
proteins which were either susceptible or resistant to the


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-132-
antiretroviral agents, such as nucleoside reverse
transcriptase inhibitors, non-nucleoside reverse
transcriptase inhibitors and protease inhibitors._
The amount of luciferase activity detected in the infected
cells is used as a direct measure of "infectivity",
"replication capacity" or "fitness", i.e. the ability of
the virus to complete a single round of replication.
Relative fitness is assessed by comparing the amount of
luciferase activity produced by patient derived viruses to
the amount of luciferase activity produced by a well
characterized reference virus (wildtype) derived from a
molecular clone of HIV-1, for example NL4-3 or HXB2.
Fitness measurements are expressed as a percent of the
reference, for example 250, 500, 750, 1000 or 1250 of
reference (Figure B, C).
Host cells were seeded in 10-cm-diameter dishes and were
transfected one day after plating with fitness test vector
plasmid DNA and the envelope expression vector.
Transfections were performed using a calcium-phosphate
co-precipitation procedure. The cell culture media
containing the DNA precipitate was replaced with fresh
medium, from one to 24 hours, after transfection. Cell
culture media containing fitness test vector viral
particles was harvested one to four days after
transfection and was passed through a 0.45-mm filter
before being stored at -80°C. HIV capsid protein (p24)
levels in the harvested cell culture media were determined
by an EIA method as described by the manufacturer (SIAC;
Frederick, MD). Before infection, target cells (293 and
293/T) were plated in cell culture media. Control


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-133-
infections were performed using cell culture media from
mock transfections (no DNA) or transfections containing
the fitness test vector plasmid DNA without the envelope
expression plasmid. One to three or more days after
infection the media was removed and cell lysis buffer
(Promega) was added to each well. Cell lysates were
assayed for luciferase activity. Alternatively, cells
were lysed and luciferase was measured by adding Steady-
Glo (Promega) reagent directly to each well without
aspirating the culture media from the well.
Example 11
Measuring Replication Fitness of Viruses with
Deficiencies in Reverse Transcriptase Activity
A means and method is provided for identifying mutations
in reverse transcriptase that alter replication fitness.
A means and method is provided for identifying mutations
that alter replication fitness and can be used to identify
mutations associated with other aspects of HIV-1
replication, including, but not limited to integration,
virus assembly, and virus attachment and entry. This
example also provides a means and method for quantifying
the affect that specific mutations reverse transcriptase
have on replication fitness. A means and method for
quantifying the affect that specfic protease and reverse
transcriptase mutations have on replication fitness to
mutations in other viral genes involved in HIV-1
replication, including, but not limited to the gag, pol,
and envelope genes is also provided.
Fitness test vectors were constructed as described in


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-134-
example 10. Fitness test vectors derived from patient
samples or clones derived from the fitness test vector
pools, or fitness test vectors were engineered by site
dixected mutagenesis to contain specific mutations, and
were tested in a fitness assay to determine accurately and
quantitatively the relative fitness compared to a well-
characterized reference standard. A patient sample was
examined for increased or decreased reverse transcriptase
activity and correlated with the relative fitness observed
(Figure C).
Reverse transcriptase activity of patient HIV samples
Reverse transcriptase activity can be measured by any
number of widely used assay procedures, including but not
limited to homopolymeric extension using (e. g. oligo
dT:poly rC) or real time PCR based on molecular beacons
(reference ICramer) or 5'exonuclease activity (Lie and
Petropoulos, 1996). In one embodiment, virion associated
reverse transcriptase activity was measured using a
quantitative PCR assay that detects the 5' exonuclease
activity associated with thermo-stable DNA polymerases
(Figure C). In one embodiment of the invention, the
fitness of the patient virus was compared to a reference
virus to determine the relative fitness compared to
"wildtype" viruses that have not been exposed to reverse
transcriptase inhibitor drugs. In another embodiment, the
fitness of the patient virus was compared to viruses
collected from the same patient at different timepaints,
for example prior to initiating therapy, before or after
changes in drug treatment, or before or after changes in
virologic (RNA copy number), immunologic (CD4 T-cells), or
clinical (opportunistic infection) markers of disease
progression.


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-135-
Genotypic analysis of patient HIV samples
Fitness test vector DNAs, either pools or clones, are
analyzed by any of the genotyping methods described in
Example 1. In one embodiment of the invention, patient
HIV sample sequences were determined using viral RNA
purification, RT/PCR and ABI chain terminator automated
sequencing. The sequence was determined and compared to
reference sequences present in the database or compared to
a sample from the patient prior to initiation of therapy.
The genotype was examined for sequences that are different
from the reference or pre-treatment sequence and
correlated to the observed fitness.
Fitness analysis of site directed mutants
Genotypic changes that are observed to correlate with
changes in fitness were evaluated by construction of
fitness vectors containing the specific mutation on a
defined, wild-type (drug susceptible) genetic background.
Mutations may be incorporated alone and/or in combination
with other mutations that are thought to modulate the
fitness of a virus. Mutations were introduced into the
fitness test vector through any of the widely known
methods for site-directed mutagenesis. Tn one embodiment
of this invention the mega-primer PCR method for
site-directed mutagenesis is used. A fitness test vector
containing the specific mutation or group of mutations
were then tested using the fitness assay described in
Example 10 and the fitness was compared to that of a
genetically defined wild-type (drug susceptible) fitness
test vector which lacks the specific mutations. Observed


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-136-
changes in fitness are attributed to the specific
mutations introduced into the resistance test vector. In
several related embodiments of the invention, fitness test
vectors containing site directed mutations in reverse
transcriptase that result in amino acid substitutions at
position 190 (G190A, G190S, G190C, G190E, G190V, G190T)
and that display different amounts of reverse
transcriptase activity were constructed and tested for
fitness (Figure D). The fitness results were correlated
with specific reverse transcriptase amino acid
substituions and fitness.
Example 12
Measuring Replication Fitness of Viruses with
Deficiencies in Protease Activity
A means and method for identifying mutations in protease
that alter replication fitness is provided.
This example provides the means and methods for
identifying mutations that alter replication fitness for
various components of HIV-1 replication, including, but
not limited to integration, virus assembly, and virus
attachment and entry. This example also provides a means
and method for quantifying the affect that specific
mutations in protease or reverse transcriptase have on
replication fitness. This method can be used for
quantifying the effect that specific protease mutations
have on replication fitness and can be used to quantify
the effect of other mutations in other viral genes
involved in HIV-1 replication, including, but not limited
to the gag, pol, and envelope genes.


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-137-
Fitness test vectors were constructed as described in
example 10. Fitness test vectors derived from patient
samples or clones derived from the fitness test vector
pools, or fitness test vectors engineered by site directed
mutagenesis to contain specific mutations, were tested in
a fitness assay to determine accurately and quantitatively
the relative fitness compared to a well-characterized
reference standard. A patient sample was examined further
for increased or decreased protease activity correlated
with the relative fitness observed (Figure C).
Protease acti~rity of patient HIV samples
Protease activity can be measured by any number of widely
used assay procedures, including but not limited to in
vitro reactions that measure protease cleavage activity
(reference Erickson ). In one embodiment, protease
cleavage of the gag polyprotein (p55) was measured by
Western blot analyis using an anti-capsid (p24) antibody
(Figure C). In one embodiment of the invention, the
fitness of the patient virus was compared to a reference
virus to determine the relative fitness compared to
"wildtype" viruses that have not been exposed to protease
inhibitor drugs. In another embodiment, the fitness of
the patient virus was compared to viruses collected from
the same patient at different timepoints, for example
prior to initiating therapy, before or after changes in
drug treatment, or before or after changes in virologic
(RNA copy number), immunologic (CD4 T-cells), or clinical
(opportunistic infection) markers of disease progression.
Genotypic analysa.s of patient HIV samples


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-138-
Fitness test vector DNAs, either pools or clones, are
analyzed by any of the genotyping methods described in
Example 1. In one embodiment of the invention, patient
HIV sample sequences were determined using viral RNA
purification, RT/PCR and ABI chain terminator automated
sequencing. The sequence was determined and compared to
reference sequences present in the database or compared to
a sample from the patient prior to initiation of therapy,
if available. The genotype was examined for sequences
that are different from the reference or pre-treatment
sequence and correlated to the observed fitness.
Fitness analysis of site directed mutants
Genotypic changes that are observed to correlate with
changes in fitness are evaluated by construction of
fitness vectors containing the specific mutation on a
defined, wild-type (drug susceptible) genetic background.
Mutations may be incorporated alone andJor in combination
with other mutations that are thought to modulate the
fitness of a virus. Mutations are introduced into the
fitness test vector through any of the widely known
methods for site-directed mutagenesis. In one embodiment
of this invention the mega-primer PCR method for
site-directed mutagenesis is used. A fitness test vector
containing the specific mutation or group of mutations are
then tested using the fitness assay described in Example
10 and the fitness is compared to that of a genetically
defined wild-type (drug susceptible) fitness test vector
which lacks the specific mutations. Observed changes in
fitness are attributed to the specific mutations
introduced into the fitness test vector. In several


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-139-
related embodiments of the invention, fitness test vectors
containing site directed mutations in reverse protease
that result in amino acid substitutions at positions 30,
63, 77, 90 (list from Figure E) and that display. different
amounts of protease activity are constructed and tested
for fitness (Figure E). The fitness results enable the
correlation between specific protease amino acid
substitutions and changes in viral fitness.
Example 13
Measuring Replication Fitness and Drug Susceptibility in a
barge Patient Population
This example describes the high incidence of patient
samples with reduced replication fitness. This example
also describes the general correlation between reduced
drug susceptibility and reduced replication fitness. This
example further describes the occurrence of viruses with
reduced fitness in patients receiving protease inhibitor
and/or reverse transcriptase inhibitor treatment. This
example furthex describes the incidence of patient samples
with reduced replication fitness in which the reduction in
fitness is due to altered protease processing of the gag
polyprotein (p55). This example further describes the
incidence of protease mutations in patient samples that
exhibit low, moderate or normal (wildtype) replication
fitness. This example further describes protease mutations
that are frequently observed, either alone or in
combination, in viruses that exhibit reduced replication
capacity. This example also describes the incidence of
patient samples with reduced replication fitness in which
the reduction in fitness is due to altered reverse


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-140-
transcriptase activity. This example describes the
occurrence of viruses with reduced replication fitness in
patients failing antiretroviral drug treatment..
Fitness/resistance test vectors were constructed as
described in example 10. Fitness and drug susceptibility
was measured in 134 random patient samples that were
received for routing phenotypic testing by the ViroLogic
Clinical Reference Laboratory. Fitness assays were
performed as described in Example 10. Drug susceptibility
testing and genotyping of the protease region was
performed as described in Example 1. Reverse
transcriptase activity was measured as described in
Example 11. Protease processing was measured as described
in Example 12.
Drug susceptibility of patient viruses
Reduced drug susceptibility was observed for a majority of
the patient virus samples (Table A). 66 percent of the
viruses exhibited large (define as >10X of the reference)
reductions in susceptibility to one or more NRTI drugs.
52 percent of the viruses exhibited large reductions in
susceptibility to one or more NNRTI drugs. 45 percent of
the viruses exhibited large reductions in susceptibility
to one or more PRI drugs.
Fitness of patient viruses
Reduced replication fitness was observed for a majority of
the patient virus samples (Table A). Forty one percent of
the viruses exhibited large reductions in replication
fitness (<25% of the reference). Another 45% had moderate
reductions (between 25-750 of the reference) in


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-141-
replication fitness. A minority of the patient samples
(140) displayed replication fitness that approached or
exceeded "wildtype" levels (>75a of the reference).
Viruses with reduced drug susceptibility, were much more
likely to display reduced replication fitness (Figures F,
G, H, and I).
Protease Mutations in patient viruses
Greater than 10 mutations in protease were observed in a
majority of the patient virus samples (Table A). Viruses
with reduced fitness were much more likely to contain 10
or more protease mutations (Figure I). Sixty two percent
of the viruses that exhibited large reductions in
replication fitness (<25% of the reference) contained 10
or more protease mutations. Twenty two percent of the
viruses with moderate reductions (between 25-75a of the
reference) in fitness contained 10 or more protease
mutations. Only 50 of the viruses that displayed
replication fitness that approached or exceeded "wildtype"
levels (>750 of the reference) contained 10 or more
protease mutations (Table A). Certain protease mutations
either alone (D30N) or in combination (L90M plus K20T, or
M46I, or 73, or N88D) were observed at high incidences in
viruses with reduced fitness (Figures I and J).
Protease processing of patient va.ruses
Reduced protease processing of the p55 gag polyprotein was
observed in a majority of the patient virus samples (Table
A). Viruses with reduced fitness were much more likely to
display reduced protease processing; defined as having


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-142-
detectable amounts of the p41 intermediate cleavage
. product (Figures F, I and K). Seventy one percent of the
viruses that exhibited large reductions in replication
fitness (<250 of the reference) displayed reduced protease
processing. Eighteen percent of the viruses with moderate
fitness reductions (between 25-750 of the reference)
displayed reduced protease processing. Only 100 of the
viruses that displayed replication fitness that approached
or exceeded "wildtype" levels (>750 of the reference)
exhibited reduced protease processing (Table A). Certain
protease mutations (D30N, M46I/L, G48V, I54L/A/S/T/V, and
I84V) were observed at high incidences in viruses with
reduced protease processing of the p55 gag polyprotein
(Figure L).
Reverse transcriptase of patsent viruses
Reduced reverse transcriptase activity processing was
observed in a minority of the patient virus samples (Table
A). Viruses with reduced fitness were much more likely to
display reduced reverse transcriptase activity. Fourteen
percent of the viruses that exhibited large reductions in
replication fitness (<25a of the reference) displayed
reduced reverse transcriptase activity. Only 20 of the
viruses with moderate fitness reductions (between 25-750
of the reference) displayed reduced reverse transcriptase
activity. None of the viruses that displayed replication
fitness that approached or exceeded "wildtype" levels
(>75% of the reference) exhibited reduced reverse
transcriptase activity.


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-143-
Example 14
Measuring Replication Fitness to Guide Treatment Decisions
A means and method for using replication fitness
measurements to guide the treatment of HIV-1 is provided.
This example further provides a means and method for using
replication fitness measurements to guide the treatment of
patients failing antiretroviral drug treatment. This
example further provides the means and methods for using
replication fitness measurements to guide the treatment of
patients newly infected with HIV-1.
Guiding treatment of patients with multi-drug resistant
virus: Fitness/resistance test vectors were constructed as
described in example 10. Fitness and drug susceptibility
were measured on serial longitudinal samples collected
weekly fox 12 weeks from 18 patients. These patients were
considered failing a protease inhibitor (typically
indinavir) containing regimen and had incomplete
suppression of virus replication based on routine viral
load testing (>2,500 copies/mZ). Phenotypic drug
susceptibility testing indicated that these patient
viruses were multi-drug resistant. Each patient agreed to
interrupt therapy for a period of at least 12 weeks.
Phenotypic drug susceptibility assays were performed as
described in Example 1 on serial samples collected just
prior to interrupting .therapy and weekly during the period
of interruption. Fitness assays were performed as
described in Example 10 on serial samples collected just
prior to interrupting therapy and weekly during the period


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-144-
of interruption. Protease processing was measured as
described in Example 12.
Of the 18 patients that interrupted therapy, 16 patients
had resistant viruses that regained susceptibility to
antiretroviral drugs during the period of treatment
interruption. The phenotypic test results of a
representative patient are shown in Figure M. Typically,
susceptibility returned to all drug classes
simultaneously, consistent with the re-emergence of a
minor population of drug sensitive virus. In the
representative example shown in Figure M, drug sensitivity
was abruptly restored between weeks 9 and 10. Genotypic
analysis (DNA sequence of protease and reverse
transcriptase) are also consistent with the re-emergence
of a drug sensitive virus. These data show the loss of
most or all drug resistance mutation simultaneously (data
not shown) . The data are not consistent with random back
mutations. Back mutations would predict that restored
susceptibility to drugs would occur unevenly for different
drug classes and/or within a drugs within the same class.
Generally, the re-emergence of the drug susceptible virus
was also accompanied by a simultaneous increase in
replication fitness. This relationship is clearly evident
for the representative virus {Figure N). Several other
examples with less frequent timepoints are shown in Figure
O. Virus from patients that did not revert to drug
susceptibility after interruption generally did not
exhibit an increase in replication fitness, nor did


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-145-
viruses from patients that did not interrupt treatment
(Figures 0). The data indicate that the drug sensitive
virus that re-emerged after treatment interruption is able
to replicate better than the drug resistant virus that was
present before treatment was interrupted. The re-
emergence of drug susceptible virus in this group of
patients was also accompanied by an increase in viral load
and a decrease in DC4 T-cells, indicators of disease
progression. Thus, fitness information can be used to
guide treatment of patients that harbor multi-drug
resistant virus and are considering treatment
interruption. If the patient virus is drug resistant but
has low replication capacity, the patient and the
physician should consider continuing drug treatment to
prevent the re-emergence of a drug sensitive virus with
higher replication capacity and greater pathogenecity.
Alternatively, if the patient virus is drug resistant and
has high replication capacity, the patient and the
physician may consider interrupting treatment to spare the
patient from the harmful and unpleasant side effects of
antiretroviral drugs that are not providing clinical
benefit.
Furthermore, physicians may choose to perform routine
replication fitness assays for patients that have multi-
drug resistant virus. This assay could be used to monitor
the replication fitness of patient viruses when complete
suppression of virus replication is not possible due to
mufti-drug resistance. The assay would be used to guide
treatment decisions that prevent the drug resistant virus


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-14 6-
with low replication fitness from increasing its
replication fitness. In this way, physicians may prolong
the usefulness of antiretroviral drugs despite the
presence of drug resistant virus in the patient.
Guiding treatment of newly infected patients:
Patients that maintain high virus loads (setpoint) after
acute infection are more likely to exhibit accelerated
disease progression. Therefore, it is advantageous for
this class of patient to initiate antiretroviral drug,
treatment as soon as possible after diagnosis with HIV-1
infection. In conjunction with viral load, fitness
measurements of viruses in newly infected patients may
provide a useful measurement to identify those individuals
that will develop elevated setpoints after primary
infection and consequently are likely to exhibit
accelerated disease progression. Fitness measurements may
guide the decision to treat immediately after diagnosis or
a some later time point.
Example 15
Measuring Saquinavir Susceptibility of Viruses
Containing Various Amino Acid Substitutions in
Protease at Position 82
This example provides a means and method for identifying
mutations in protease that affect susceptibility
(increased or decreased) to saquinavir.


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-147-
In one embodiment of this invention, the effects of
combination of mutations at position 82 {for example,
V82A, V82F, V82S, or V82T are evaluated using the
following method comprising: (i)collecting a biological
sample from an HIV-1 infected subject; (ii) evaluating
whether the HTV-1 in the sample contains nucleic acid
encoding protease having a valine to alanine (V82A),
phenylalanine (V82F), serine (V82S), or threonine (V82T)
substitution at position 82 or a leucine to methionine
substitution at position 90 {L90M); and {iii) determining
susceptibility to protease inhibitors (PRIs).
The biological sample comprises whole blood, blood
components including peripheral mononuclear cells (PBMC),
serum, plasma (prepared using various anticoagulants such
as EDTA, acid citrate-dextrose, heparin), tissue biopsies,
cerebral spinal fluid (CSF), or other cell, tissue or body
fluids. In another embodiment, the HIV-1 nucleic acid
(genomic RNA) or reverse transcriptase protein can be
isolated directly from the biological sample or after
purification of virus particles from the biological
sample. Evaluating whether the amino acid at position 82
of the HIV-1 protease is mutated to alanine,
phenylalanine, or threonine, can be performed using
various methods, such as direct characterization of the
viral nucleic acid encoding protease or direct
characterization of the protease protein itself. Defining
the amino acid at position 82 of protease can be performed
by direct characterization of the protease protein by
conventional or novel amino acid sequencing methodologies,


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-148-
epitope recognition by antibodies or other specific
binding proteins or compounds. Alternatively, the amino
acid at position 82 of the HIV-1 protease protein can be
defined by characterizing amplified copies of HIV-1
nucleic acid encoding the protease protein. Amplification
of the HIV-1 nucleic acid can be performed using a variety
of methodologies including reverse
transcription-polymerase chain reaction (RT-PCR), NASBA,
SDA, RCR, or 3SR. The nucleic acid sequence encoding HIV
protease at codon 82 can be determined by direct nucleic
acid sequencing using various primer extension-chain
termination (Sanger, ABI/PE and Visible Genetics) or chain
cleavage (Maxam and Gilbert) methodologies or more
recently developed sequencing methods such as matrix
assisted laser desorption-ionization time of flight
(MALDI-TOF) or mass spectrometry (Sequenom, Gene Trace
Systems). Alternatively, the nucleic acid sequence
encoding amino acid position 82 can be evaluated using a
variety of probe hybridization methodologies,- such as
genechip hybridization sequencing (Affymetrix), line probe
assay (LiPA; Murex), and differential hybridization
(Chiron).
In a preferred embodiment of this invention, evaluation of
the effects of mutations at amino acid position 82 of
HIV-1 protease on protease inhibitor susceptibility, was
carried out using a phenotypic susceptibility assay using
resistance test vector DNA prepared from the biological
sample. In one embodiment, plasma samples were collected,


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-149-
viral RNA was purified and an RT-PCR methodology was used
to amplify a patient derived segment encoding the HIV-1
protease and reverse transcriptase regions. The amplified
patient derived segments were then incorporated, via DNA
ligation and bacterial transformation, into an indicator
gene viral vector thereby generating a resistance test
vector. Resistance test vector DNA was isolated from the
bacterial culture and the phenotypic susceptibility assay
was carried out as described in Example 1. The genotype of
the protease region was determined by dideoxy chain-
termination sequencing of the resistance test vector DNA.
The results are summarized for saquinavir (SQV) in Figure
6. Samples were categorized as having mutations in
protease encoding alanine (A), phenylalanine (F), or
threonine (T) at position 82, instead of the wild-type
valine (V), and the percentage of samples in each category
displaying hyper-sensitivity to saquinavir (i.e., fold-
change vs. reference of 0.4 or less) was determined.
Surprisingly, the percentage of saquinavir hyper-
susceptible viruses was much higher amongst viruses
containing V82F than those containing V82A or V82T. This
observation implies that the detection of V82F in protease
predicts a positive virologica2 response to saquinavir
treatment.


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
~150-
Example 16
Measuring Replication Fitness of Viruses with
Mutations in Integrase
This example provides a means and method for identifying
mutations in integrase that alter replication fitness.
This example provides the means and methods for
identifying mutations that alter replication fitness for
various components of HIV-1 replication, including, but
not limited to integration, virus assembly, and virus
attachment and entry. This example also provides a means
and method for quantifying the affect that specific
mutations in protease, reverse transcriptase, or integrase
have on replication fitness. This method can be used for
quantifying the effect that specific integrase mutations
have on replication fitness and can be used to quantify
the effect of other mutations in other viral genes
involved in HIV-1 replication, including, but not limited
to the gag, pol, and envelope genes.
Fitness test vectors engineered by site directed
mutagenesis to contain specific mutations in integrase
were tested in a fitness assay to determine accurately and
quantitatively the relative fitness compared to a well-
characterized reference standard.
Genotypic changes that are observed to correlate with
resistance to integrase inhibitors are evaluated by


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-151-
construction of fitness vectors containing the specific
mutation on a defined, wild-type (drug susceptible)
genetic background. Mutations may be incorporated alone
andjor in combination with other mutations that are
thought to modulate the fitness of a virus. Mutations
are introduced into the fitness test vector through any of
the widely known methods for site-directed mutagenesis. In
one embodiment of this invention the mega-primer PCR
method for site-directed mutagenesis is used (Sarkar, G.
and Sommar, S.S., 1994, Biotechniques 8, 404-407). A
fitness test vector containing the specific mutation or
group of mutations are then tested using the fitness assay
described in Example 10 and the fitness is compared to
that of a genetically defined wild-type (drug susceptible)
fitness test vector which lacks the specific mutations.
Observed changes in fitness are attributed to the specific
mutations introduced into the fitness test vector. In
several related embodiments of the invention, fitness test
vectors containing site directed mutations in integrase
that result in amino acid substitutions at positions 66,
154, 66 and 153, and 66 and 154 are constructed and tested
for fitness (Figure 7). As controls, mutants with
multiple changes conferring resistance to reverse
transcriptase and protease inhibitors (MDRC4) and with a
mutation in the integrase active site (D64V) were also
tested. The fitness results enable the correlation
between specific integrase amino acid substitutions and
changes in viral fitness.


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-152-
Figure 6. Distribution of saquinavir hyper-susceptibility
by amino acid change at position 82.
so
so
U
a
t_ 40
~3
c
coo 20
0
0 10
0
A (n=54) F (n=7) T (n=9) A, F, or T
(n=70)


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-153-
Figure 7. Relative luciferase activity of integrase
inhibitor-resistant site-directed mutants.
120
100
c
d
0
20
0
NL4-3 IMDRC41 D64V I T661 I M1541 I 66!1531 6B/154
~ avg. RLU I 100 I 21 I 0.03 I 5 I 42 I 31 I 86
15


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
159-
10
20
Table 1: PRI susceptibility of selected patient samples.
Viruses displaying increased susceptibility to amprenavir
(5-fold or greater) were genotyped and found to contain
the N88S mutation in PR. Samples were listed in order of
decreasing amprenavir susceptibility.
Table 1
Prior Fold
PRl Chan~ee
vs.
Reference


Sample SQV1DV NFV PR Mutations
m RTY AMP
Experience


0732 NFV 0.732.11 . K 14R, IISV, K20T, E35D, M361,
l.72 'p.pg R41K, !62V, Lti3Q, N88S
.
L~


627 1DY ~ 1.50 ;. 113W,135D, M46L,163P,164V,
U.26 ~'.~i09:i73V, N88S


1208 NF 1.55V ~'0.~0;162V, L63P, V771, N88S
1.22 .
,
..


.,
350 IDV 1.881.a9 .: 113V, K20M, M36V, N37A, M461,162V,
''0:15:L63P, N88S,193L


0910 NFV 1.411.85 ~D:16 M46I, L63P, V77I, N88S,19311L


3542 IDV 1.28 ' I13V, KI4R, N37D, M46I, Lti3P,
30:16 N885,193L
~


3654 1.801.95 ~ 113V, R4lK, M461, ib3P, V77I,
0.20' N88S.193L


..~x .:, .
Fold Change Limits: ~ <0.1


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-155-
Table 2: PRI susceptibility of site-directed mutants in
PR. Mutations were introduced into the drug sensitive
reference resistance test Vector and the susceptibility to
PRIs was determined.
Table Z
Fold ge
Chan vs.
reference


Site-Directed MutationsSQV 117V RTV NFV AMP


L63P 1.04 1.12 1.271.43 1.06


L63P, V77I 1.21 1.72 1.732.49 0.91


N88S O.a7 1.56 0 2.39 0.04
:36
~


_
L63P, r'88S 1.44 .. .; 0:'~
0.77l.:


L63P, V77I,1f88S 1.24 1.39~.~'0:08~
~


M46L, L63P, N88S 1.15 .2.30 0.85~~'Q.12~
_.
,


M46L, L63P, V77I, 1.45 1.33~ '0:14
T'88S


FOLD CHANGE LIMITS: . <0:4~.~


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-156-
Table 3: Relative luciferase activity levels for patient
sample virus-derived resistance test vector pools. The
luciferase activity (relative light units, RZU) measured
in the absence of drug for the patient sample was compared
to that of the drug sensitive reference control from the
same assay run, and expressed as a percentage of control.
These values are from one assay each. All the samples
that contain the N88S mutations in PR were found to have
reduced luciferase activity compared to control.
Tsble 3
- Relative Luciferase
Activity


Sample
ID i~ of control)
PR
Mutations


0732 K14R, IISV, K20T, E35D, M36I, R41K,162V,1.63Q,8.5
N88S


627 I13W, F35D, M46L. L63P,164V, I73V, 0.7
N88S


1208 162V, lb3P. V77I, N88S 14.Z


360 113V, K20M. M36V, N37A, M461,162V, 2.2
L63P, N88S,193L


0910 M46I, L63P, V77I, N88S, I93I/L 16.0


3542 II3V, K14R. N37D, M46I, L63P, N88S,4.6
I93L


3654 113V, R41 K, M46I, L63P, V771, N88S~,12.8
I93L




CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-157-
Table 4: Relative luciferase activity levels for
resistance test vectors containing site-directed
mutations. The luciferase activity (relative light units,
RZU) measured in the absence of drug for the mutant was
compared to that of the drug sensitive reference control
from the same assay run, and expressed as a percentage of
control. These values are from one to five assays each,
and each value was obtained using an independent clone for
mutants which were tested multiple times. All the
constructs that contain the N88S mutations in PR were
found to have reduced luciferase activity compared to
control. All the constructs with the K20T mutation were
essentially inactive in the assay.
Table 4
Average Lucifcrasc
Activity


Site-Directed Mutations(% of control) number of clones
tested


L63P 163.9 I


L63P, V77I 75.6


N88S 1.0
3


L63P, N88S 20.7 2


L63P, V77I, N88S ~ 29.3


M46L, L63P, N88S ~ 2g.0 2


M46L, L63P, V771, 53_2
N88S


K20T,1f88S <0.01 5 . ..


K20T, L63P, N88S ~0.p1 1




CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-158-
Table 5: Oligonucleotide primers used for PCR
amplification and for generating site-directed mutants.
Table
*): PCR6 5' CCAAT)'RYTG?GATAT1'1'CTCATGNTCH1'CTTGGG
3' (35-mer)


*2: PDS/Apa 5' CATGTTGCAGGGCCCC'TAGG~~AAMGGGCTGTTGGAAATGTG
3' (42-mer)


*3: PDSiAge 5' CACTCCATGTACCGGTTCTTn'AGAATYTC!'C'TG 3'
(34-ma)


*4: RsrIl 5' ACTTTCGGACCGTCCATTCCTGGCTITAATITIACTGGTACAG
3' (43-ma)


*5: K20T 5' GGGGGGCMTTAACGGAAGCTCTATTAG 3' (28-ma)


a6: Ma6L 5' GATGGAAACCAAAATTGATAGGGGGAATTG 3' (30-ma)


*7: L63P 5' GTATGATCAGATACCCATAGAAATCTGC 3' (28-ma)


~?8: N88S 5' CTGAGTCAACAGACTTCTTCCA.ATTATG 3' (28-mer)


2~ R=Aorta
Y=CorT
N=A. C, G.orT
H = A. C. or T
30
Table 6. PRI Susceptibility (Fold Change <2.5) of Viruses
with Mutations at 82 and/or 90
Percent of viruses with indicated primary
mutations) which are drug sensitive (fold
change in IC50 < 2.5)
V82A/F/S/T and
drug V82A/F/S/T L90M L90M


RTV 8.0 27.6 3.0


NFV 20.0 8.6 3.0


IDV 22.7 31.0 9.1


AMP 53.3 65.5 33.3


SQV 73.3 46.6 21.2




CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-159-
Table 7. Correlation Between 82A/FjSjT, Secondary
Mutations, and IDV Susceptibility.
position n % FC > 2.5 chi square p


24 20 1000 <0.005


71 27 1000 <0.0001


54 38 95% <0.0001


46 35 890 <0.01


10 47 830 <0.05


63 72 790 <0.05


82 75 77 0


all virus with V82A/F/S/T and no other primary mutations.


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-160-
Table 8. Correlation Between 82A/F/S/T, Secondary
Mutations, and SQV Susceptibility.
position n o FC > 2.5 chi


square p


20 5 800 <0.001


36 11 730 <0.001


24 20 65% <0.0001


71 27 520 <0.0001


54 38 470 <0.0001


10 47 400 <0.001


82 75 270


all virus
Table 9. Association Between SQV and IDV Susceptibility,
V82A/F/S/T, and Number of Resistance Associated Mutations
Number of Number of a with IDV FC o with SQV FC
secondary samples > 2.5 > 2.5
mutations
1 75 77 27


2 67 82 30


3 51 88 39


4 38 95 50


5 25 96 60


6 17 100 76


7 5 100 60




CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-161-
Table 10. Correlation Between I~90M, Secondary
Mutations, and IDV Susceptibility.
position n o FC > 2.5 chi square p
73 19 890 <0.01
71 18 890 <0.001
46 25 88a <0.05
90 58 690
all viruses with L90M and
Table 11. Correlation Between Ia90M, Secondary
Mutations, and SQV Susceptibility.
position n o FC > 2.5 chi square p


73 19 79a <0.01


71 18 780 <0.001


77 25 760 <0.05


10 34 650 <0.05


90 58 550



all viruses


CA 02422815 2003-03-14
WO 02/22076 PCT/USO1/28754
-162-
Table 12. Association Between SQV and IDV
Susceptibility, I~90M, and Number of Resistance Associated
Mutations.
Number of Number of o w with IDV o w with SQV
secondary samples FC > 2.5 FC > 2.5
mutations
0 58 69 53
1 57 70 47
2 56 70 48
3 41 80 68
4 31 87 77
5 14 100 100
6 ~ 6 100 100
25
35


CA 02422815 2003-03-14
WO 02/22076 ~ 9~ PCT/US01/28754
n
!D n V _ V N~ ~ o
~D Z7 O '~ O \ ~~ o n
-o ~ p a -a ~ .-i
_~ ~~ ~ ° ~ ~ v v
Z ~n y ~: ~ o. y
c ~ N ~ ~ .
wr
c.~ .s v~ .a
w \ ~,N~o ~ o cvoc yo -Ow ~ ~~.,
A n ~ _~
'.
~rn
~v .
.-. t~ .., N ..,, h1 ~ N v, '~ ~ C
p P o
'"1
V
..a th O -i '"
w 07 ~ o o N ~ ~ o O
v ~ ~ ~ ~ v ~ X11
!If