Note: Descriptions are shown in the official language in which they were submitted.
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
1
USES OF MONOCLONAL ANTIBODY 8H9
This application claims the benefit of United States provisional application
Serial No. 60/241,344, filed October 18, 2000, the content of which is
incorporated here into this application.
The invention disclosed herein was made with government support under
Department of Energy Grant No. DE-FG-02-93ER61658 (1997-2002) and the
National Cancer Institute Grant No. NCI CA 89936 (12/1/00-11/30/02).
Accordingly, the U.S. Govenunent has certain rights in this invention.
Throughout this application, various references are referred to. Disclosures
of
these publications in their entireties are hereby incorporated by reference
into
this application to more fully describe the state of the art to which this
invention pertains.
BACKGROUND OF THE INVENTION
Tumor-restricted surface antigens may be targets for diagnosis and immune-
based therapies. Monoclonal antibody 8H9 is a murine IgGl hybridoma
derived from the fusion of mouse myeloma SP2/0 cells and splenic
lymphocytes from BALB/c mice immunized with human neuroblastoma. By
immunohistochemistry, 8H9 was highly reactive with human brain tumors,
childhood sarcomas, neuroblastomas and less so with adenocarcinomas.
Among primary brain tumors, 15/17 glioblastomas, 3/4 mixed gliomas, 4/11
oligodendrogliomas, 6/8 astrocytomas, 2l2 meningiomas, 3/3 schwannomas,
2/2 medulloblastomas, 1/1 neurofibroma, 1/2 neuronoglial tumors, 2/3
ependymomas and 1/1 pineoblastoma were tested positive. Among sarcomas,
21/21 Ewing's/PNET, 28/29 rhabdomyosarcoma, 28/29 osteosarcomas, 35/37
desmoplastic small round cell tumors, 2/3 synovial sarcomas, 4/4
leiomyosarcomas, 1/1 malignant fibrous histiocytoma and 2/2 undifferentiated
sarcomas tested positive with 8H9. 87/90 neuroblastomas, 12/16 melanomas,
3/4 hepatoblastomas, 7/8 Wilm's tumors, 3/3 rhabdoid tumors and 12/27
adenocarcinomas also tested positive. In contrast 8H9 was nonreactive with
normal human tissues including bone marrow, colon, stomach, heart, lung,
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
2
muscle, thyroid, testes, pancreas, and human brain (frontal lobe, cerebellum,
pons and spinal cord). Reactivity with normal cynomolgus monkey tissue was
similarly restricted. Indirect immunofluorescence localized the antigen
recognized by 8H9 to the cell membrane. The antigen is proteinase-sensitive
and is not easily modulated off cell surface. 8H9 immuno-precipitated a 58kD
band following N-glycanase treatment, most likely a protein with
heterogeneous degree of glycosylation. This novel antibody-antigen system
may have potential for tumor targeting.
Monoclonal antibodies such as 3F8 (1) and 14.18 (2) against Gp2 in
neuroblastoma, MI95 against CD33 in acute leukemia (3), anti-HER2
antibodies in breast cancer (4) and anti-CD20 antibodies in lymphoma (5)
have shown efficacy in recent clinical trials. The prognosis in glial brain
tumors and metastatic mesenchymal and neuroectodermal tumors remains
dismal despite innovations in chemotherapy and radiation therapy.
Immunotherapy may offer new possibilities for improving the outcome in
these patients.
Tumor antigens expressed on cell membrane are potential targets in
immunotherapy. Examples of tumox antigens expressed on glial tumors
include neural cell adhesion molecules (6), gangliosides such as GDZ and GMz
(7), and neurohematopoeitic antigens (8). Recent investigations have focused
on growth factor receptors as immune targets, in particular type III mutant
epidermal growth factor receptor (EGFRvIII) which has been shown to be
expressed on 50% of glial brain tumors (9). Notwithstanding the universal
expression of NCAM by neuronal cells, two clinical studies have utilized anti
NCAM antibodies in patients. MAb UJ13A was shown to accumulate in
gliomas by virtue of disruption of blood brain barrier locally (10) and
another
antibody, ERIC-1 was used in a therapeutic setting in resected glioma cavities
with some clinical benefit (11)
Recent studies have targeted immunotherapy to extracellular matrix around
tumor cells. Tenascin has been reported to be expressed in 50-95% of glial
brain tumors as well as on mesenchymal tumors, carcinomas and normal
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
3
human glial, liver and kidney cells (12). Anti-tenascin monoclonal antibodies
8IC6 (I3) and BC-2 and BC-4 (14) administered infra-cavity have recently
been reported to show efficacy in the treatment of patients with malignant
gliomas. However, since these antigens are also present to varying degrees on
normal human neural and non-neural cells, their clinical utility would depend
on their overexpression by brain tumors when compared to normal tissues.
With the exception of EGFRvIII, the glial tumors . antigens described to date
are generally found on normal brain tissue, or are restricted to intracellular
compartments, thus with limited clinical utility for antibody targeting.
Membrane antigens that have been targeted on osteosarcoma include GDZ (15),
CD55 (16) and an as yet undefined osteosarcoma-associated antigen
recognized by the MoAbs TP-1 and TP-3 (17). However, these antigens are
present to varying degrees on normal tissues. Similarly the glycoprotein
p30/32 coded by the MIC2 oncogene and recognized by the monoclonal
antibody 013 in the Ewing's family of tumors is expressed on normal tissues
(18). In rhabdomyosarcoma, the MyoD family of oncofetal proteins is nuclear
in localization (19) and therefore inaccessible to antibody-targeted
immunotherapy.
An ideal tumor antigen for targeted immunotherapy should be absent on
normal tissues and abundantly expressed on tumor cell surface. Such tumor-
specific antigens e.g. idiotypes in B cell lymphoma are rare (20). Moreover, a
"generic" tumor-specific antigen expressed on tumor cells of varying lineage
recognized by monoclonal antibodies may have broader utility in antibody-
based strategies. We describe here a novel tumor-associated antigen,
recognized by a murine monoclonal antibody 8H9, expressed on cell
membranes of a broad spectrum of tumors of neuroectodermal, mesenchymal
and epithelial origin, with restricted distribution on normal tissues.
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
SUMMARY OF THE INVENTION'
This invention provides a composition comprising an effective amount of
monoclonal antibody 8H9 or a derivative thereof and a suitable carrier. This
invention provides a pharmaceutical composition comprising an effective
amount of monoclonal antibody 8H9 or a derivative thereof and a
pharmaceutically acceptable carrier.
This invention also provides an antibody other than the monoclonal antibody
8H9 comprising the complementary determining regions of monoclonal
antibody 8H9 or a derivative thereof, capable of binding to the same antigen
as
the monoclonal antibody 8H9.
This invention provides a substance capable of competitively inhibiting the
binding of monoclonal antibody 8H9. In an embodiment of the substance, it is
an antibody.
This invention provides an isolated scFv of monoclonal antibody 8H9 or a
derivative thereof. In an embodiment, the scFv is directly or indirectly
coupled to a cytotoxic agent.
This invention provides a cell comprising 8H9-scFv. In an embodiment, it is a
red cell. This invention also provides a 8H9-scFv-gene modified cell. This
invention provides a liposome modified by 8H9-scFv.
This invention provides a method for dixectly kill, or deliver drug, DNA, RNA
or derivatives thereof to cell bearing the antigen recognized by the
monoclonal
antibody 8H9 or to image cells or tumors bearing said anfiigen using the
isolated 8H9-scFv or cell or liposome comprising the 8H9-scFv.
This invention provides a protein with about 58 kilodaltons in molecular
weight, reacting specifically with the monoclonal antibody 8H9. When this 58
kd protein is glycosylated, the apparent molecular weight is about 90
kilodaltons.
This invention also provides an antibody produced by immunizing the 8H9
antigen or specific portion thereof, which is immunogenic.
This invention also provides a nucleic acid molecule encoding the 8H9
antigen. In addition, this invention provides a nucleic acid molecule capable
of specifically hybridizing the molecule encoding the 8H9 antigen. The
nucleic acid molecule includes but is not limited to synthetic DNA, genomic
DNA, cDNA or RNA.
This invention provides a vector comprising the nucleic acid molecule
encoding 8H9 antigen or a portion thereof. This invention provides a cell
comprising the nucleic acid molecule encoding 8H9 antigen.
This invention provides a method for producing the protein which binds to the
monoclonal antibody 8H9 comprising cloning the nucleic acid molecule
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
encoding the 8H9 antigen in an appropriate vector, expressing said protein in
appropriate cells and recovery of said expressed protein.
This invention also provides a method for production of antibody using the
protein produced by the above method. This invention also provides
antibodies produced by the above method. In an embodiment, the antibody is
a polyclonal antibody. In another embodiment, the antibody is a monoclonal.
This invention provide a method of inhibiting the growth of tumor cells
comprising contacting said tumor cells with an appropriate amount of
monoclonal antibody 8H9 or a derivative thereof, ox the antibody of claim
produced by the expressed 8H9 antigen or a derivative of the pxoduced
antibody thereof.
This invention provides a method of inhibiting the growth of tumor cells in a
subject comprising administering to the subject an appropriate amount of
monoclonal antibody 8H9 or a derivative thereof, or the antibody produced by
the expressed 8H9 antigen or a derivative thereof.
This invention provides a method for imaging a tumor in a subject comprising
administering to the subject a labeled monoclonal antibody 8H9 or labeled
derivatives, or a labeled antibody produced by the expressed 8H9 antigen or a
labeled derivative. In embodiment, the antibodies or derivatives are labeled
by a radioisotope.
This invention provides a method of reducing tumor cells in a subject
comprising administering to the subject monoclonal antibody 8H9 or a
derivative thereof, or a monoclonal antibody produced by the expressed 8H9
antigen or a derivative thereof wherein the antibody or derivative is coupled
to
a cytotoxic agent to the subject.
This invention provides a method to evaluate the tumor bearing potential of a
subject comprising measuring the expression the 8H9 antigen in the subject,
wherein the increased expression of said antigen indicates higher tumor
bearing potential of the subject.
This invention provides a transgenic animal comprising an exogenous gene
encoding the 8H9 antigen. This invention also provides a knock out animal
wherein the gene encoding the 8H9 mouse analogous antigen has been
knocked out.
Finally, this invention provides a method to screening new anti-tumor
compound comprising contacting the above transgenic animal with the tested
compound and measuring the level of expression of the 8H9 antigen in said
transgenic animal, a decrease in the level of expression indicating that the
compound can inhibit the expression of the 8H9 antigen and is a anti-tumor
candidate.
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
6
DETAILED DESCRIPTION OF THE FIGURES
FIRST SERIES OF EXPERllVIENTS
FIGURE 1. (1A) Desmoplastic small round cell tumor (10X) immunostained with
S 8H9 showing strong membrane positivity and typical histology (1B)
Glioblastoma
multiforme stained with 8H9 showing binding to cell membranes and fibrillary
stroma
(1C) Embryonal rhabdomyosarcoma stained with 8H9 showing cell membrane
reactivity (1D) Negative staining of embryonal rhabdomyosarcoma with MOPC21,
an
irrelevant IgGl control antrbody
FIGURE 2. Persistence of 8H9 binding to U20S cells (2A) and NMB7 cells (2B) as
studied by indirect immunofluorescence. X axis: relative immunofiuorescence, y-
axis:
hours of incubation. U20S cells were reacted with 8H9 and HB95, and NMB7 cells
with 8H9 and 3F8. Ailer washing, cells were recultured and persistence of
immunoreactivity of the primary antibodies evaluated by indirect
immunofluorescence
using FITC-conjugated secondary antibody. Relative immunofluorescence of 8H9
on
U20S cells dropped to 80% a$er 48hrs (HB95 to 11%), while that on NMB7 cells
showed no significant drop off at 36 hrs (3F8 dropped to 39%)
FIGURE 3. Effect of Fronase E on 8H9 immunoreactivity with HTB82, U2OS and
NMB7 cells and on 3F8 immunoreactivity with NMB7 cells as studied by indirect
immunofluorescence. X-axis: concentration of Pronase E (mg/ml); y-axis:
relative
immunofluorescence
SECOND SERIES OF EXPERIMENTS
FIGURE 1. (FIGURE 4 in the attached figures) 4 cycles of 3F8 and low level
HAMA response are associated with prolonged survival.
FIGURE 2. (F'IGURE 5 in the attached figures) Improved long term survival
after
MoAb 3F8 in patients with stage 4 NB newly diagnosed > I year of age at
Memorial
Sloan-Fettering Cancer Center. N4 to N7 are sequential protocols over 15
years. N4 and
NS are chemotherapy+ABMT, N6 is chemotherapy+3F8, andN7 is N6 + 1311-3F8.
FIGURE 3. (FIGURE 6 in the attached figures) Antigen modulation following
binding to 8H9.
FIGURE 4. (FIGURE 7 in the attached figures) At 120 h: 12sI8H9 localized to
tumors (N=4) while control antibody 2C9 (mouse IgG1) remained in blood
pool/liver
(N=4).
SUBSTITUTE SHEET (RULE 26)
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
7
FIGURE 5. (FIGURE 8 in the attached figures) High tumor-tissue ratio was
specific for 1~I-8H9 vs control MoAb ~~I-2C9 in RMS xenografts.
FOURTH SERIES OF EXPERIMENTS
FIGURE 1. (FIGURE 9 in the attached figures) Reactivity of 8II9 with Ewing's
sarcoma cell lines.
Flow cytometric analysis of 8H9 binding to nine Ewing's sarcoma cell lines is
shown.
The designation for each line is shown in the upper right corner. FLl
fluorescence of
isotype (dashed black line) CD99 (thin black line) and 8H9 (thick black line)
is shown.
FIGURE 2. (FIGURE 10 in the attached figures) Lack of Reactivity of 8H9 with
T cells or bone marrow progenitor cells. Electronically gated Cd3+ cells from
peripheral blood of a normal donor (top panel) are analyzed for isotype
(dashed line),
CD99 (thin black line) and 8H9 (thick black line). Electronically gated CD34+
cells
from fresh human bone marrow from a normal donor (bottom panel) are analyzed
for
isotype (dashed line) and 8H9 (thick black line) staining.
FIGURE 3. (FIGURE 11 in the attached figures) Real-time PCR analysis of
t(11,22) in artificially contaminated PBMCs accurately quantifies EWS/F1I 1
transcript
over up to five log dilutions of tumor. Crossing time (x axis) is plotted vs.
fluorescence
(y axis) l la: Non-nested PCR of 10 X106 PBMCs contaminated from 1:10 to 1:106
.
In the inset, a linear relationship between crossing time and log cell
concentration over
4 log dilutions of tumor is shown. Samples contaminated at less that 1:104
show no
detectable postivity in this assay. 1 lb: Nested PCR of 10 X 106 PBMCs
contaminated
from 1:10 to 1:10'. A linear relationship is observed over 5 log dilutions of
tumor from
1:100 to 1:106.
FIGURE 4. (FIGURE 12 in the attached figures) Quantitative PCR analyis of
purging demonstrates 2-3 log reduction in peripheral blood and progenitor
cells spikes
with Ewing's Sarcoma cells. Cycle number (x axis) is plotted vs. fluorescence
(y axis).
Experimental samples were run with standard contaminated dilutions shown in
the
inset. 12a: Non-nested PCR analysis of 1X106 pre-purged and post purged non-
CD34
3 0 selected bone marrow from a normal healthy donor contaminated at a level
of 1:100. A
two-log reduction in tumor burden is demonstrated in the post purged sample
which
shows a level of contanvnation at 1:104. 12b: Nested PCR analysis of pre
purged and
post purged CD34 selected cells harvested following G-CSF mobilization from a
patient with Ewing's sarcoma. Since this patient was negative for EWS/FLI,
CD34
SUBSTITUTE SHEET (RULE 26)
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
8
cells were spike with Ewing's sarcoma at a level of 1:103. A three-log
reduction in
tumor burden is demonstrated in the post purged sample which shows a level of
contamination at 1:106. 12c: Nested PCR analysis of pre purged and post purged
PBMCc from a normal healthy donor buffy coat contaminated at a Ievel of 1:100.
A
greater than 3-log reduction in tumor burden is demonstrated in the post
purged sample
which shows a level of contamination of less than 1:106. 12d: Nested PCR
analysis of
pre purged and post purged non PBMCs from a normal healthy donor bufly coat
contaminated at a level of 1:103. A 3 log reduction in tumor burden is
demonstrated in
the post-purged sample which shows a level of contamination at 1:106.
FIGURE 5. (FIGURE 13 in the attached figures) Contamination of patient
elutriated apheresis fractions is demonstrated at at level of 1:105-1:106.
Quantitative
PCR analysis of apheresis fractions from patients presenting with disseminated
Ewing's sarcoma. G~cle number (x axis) is plotted vs. fluorescence (y axis)
Patient
samples are compared to standard contaminated dilutions. Patient a (top panel)
shows
contamination of all fractions at a level of 1:105-1:106. Patient B (middle
panel) shows
contamination in the leukocyte fraction only at a level of approximately
1:106, Patient C
(bottom panel) shows contamination in several fractions at a similar level.
FIGURE 6. (FIGURE I4 in the attached figures) Progenitor CFU capability is not
affected by 8H9 based purging. Colony formy units from CD34 selected cells
from
bone marow from a normal healthy donor (x axis) are plotted for pre- and post
purged
samples.
FIGURE 7. (FIGURE 15 in the attached figures) OKT3 mediated T cell
proliferation is unchmged after purging when compared to pre-purged
proliferation. T
cells from normal healthy donor bully coat were evalauted for [3H] Thymidine
uptake
as a measure of T cell proliferation with a decreasing concentration of OKT3.
Uptake
is measured as counts per million (y axis) and is plotted vs. OKT3
concentration for
pre-purged (solid square), and post purged (solid circle).
STXTH SERIES OF EXPERIMENTS
FIGURE 1. (FIGURE 16 in the attached figures) DSRCT (40~ demonstrating cell
membrane and stromal reactivity with 3F8
FIGURE 2. (FIGURE 17 in the attached figures) DSRCT (40~ showing strong,
homogeneous, cell membrane and stromal reactivity with 8H9
SUBSTITUTE SHEET (RULE 26)
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
9
SEVENTH SERIES OF EXPERIMENTS
FIGURE 1. (FIGURE 18 in the attached figures) Inhibition of 8H9 by anti-
idiotype 2E9 by FRCS analysis. 18A: Staining of LAN 1 neuroblastoma cells with
5
ug/ml of 8H9 (shaded peak) was not inhibited at low concentration of 2E9 (2
ug/ml,
solid line), but almost completely at concentration of IO ug/mI (dotted line)
superimposable with the negative antibody control (solid line). 18B: Staining
of LAN-
1 neuroblastoma cells with 5 uglrnl of 3F8 (anti-GD2, shaded peak) was not
inhibited
by any concentrations (2 ug/ml, solid line, or 200 ug~ml, dotted line) of 2E9.
18C
Staining of HTB-82 rhabdomyosarcoma cells with 5 ug/ml of 8H9 (grey peak) was
not
inhibited at low concentration (2 ug/n~l, solid line), but completely at 10
ug~ml of 2E9
(solid line) superimposable with negafive antibody control (black peak).
FIGURE 2. (FIGURE I9 in the attached figures) SDS-PAGE (lanes a and b)
and Western blot (c and d) of 8I39 scFv Fc. H heavy chain of 8H9, L--light
chain
of 8H9, scFv-Fc= chimeric fusion protein between SH9 scFv and the human 1-CH2-
CH3 domain. With 2 mercaptothanol: lanes a, b and c. Native gel : lane d. SDS-
PAGE was stained with Comassie Blue; western blot with 2E9 anti-idiotypic
antibody.
FIGURE 3. (FIGURE 20 in the attached figures) FRCS analysis of 8h9-scFv-
Fc staining of HTB82 rhabdomyosarcoma cells. 20A Irnmunofluorescence
increased with concentrations of 8H9-scFv-Fc (1, 5, 25, 125 ug/ml), shaded
peak is no
antibody control. 20B: Cell staining (5 ug/ml of 8H9-scFv Fc, thin solid line)
was
completely inhibited (thick solid line) at 1 ug/ml of anti-idiotypic antibody
2E9, shaded
peak is no antibody control.
FIGURE 4. (FIGURE 21 in the attached figures) Immunoscintigraphy of
human tumors using 1~I-labeled 8H9 scFv Fc. Mice xenogra$ed with human
LAN-1 neuroblastoma received retroorbital injections of 25 uCi of I~I-labeled
antibody. 24h, 48h and 7 days after injection, the animals were anesthesized
and
imaged with a gamma camera.
FIGURE 5. (FIGURE 22 in the attached figures) Blood clearance of 1~I
labeled chimeric 8Ii9 and 1~I native 8H9. Mice xenografted with human LAN-1
neuroblastoma received retroorbital injections of 1~I-labeled antibody.
Percent
injected dose/gm of serial blood samples were plotted over time.
SUBSTITUTE SHEET (RULE 26)
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
EIGHTH SERIES OF EXPERIMENTS
FIGURE 1. (FIGURE 23 in the attached figures) A.nfi-idiotype affinity
enrichment of producer lines. Producer lines Were stained with anti-idiotypic
MoAb
2E9 before (shaded peak, A and B), and after first (dotted line peak, A) and
second
5 (thick solid line, A) amity purification, and after first (dotted line, B)
and second (solid
line B) subcloning, showing improved scFv expression. By FACS the indicator
line
K562 showed improved scFv expression after first (dotted line, C) and second
(thick
solid line, C) affinity purification of the producer line, and subsequent
first (dotted line,
C) and second (thick solid line, D) subcloning of the producer line, when
compared to
10 unpurified producer lines (shaded peaks, C and D), consistent with
improvement in
gene transduction efficiency. The thin solid line curves in each figure
represents
nonproducer line (A and B) or uninfected I~562 (C and D).
FIGURE 2. (FIGURE 24 in the attached figures) Flow cytometry analysis of scFv
expression. Cultured 8H9-scFv-CD28-. gene-modified lymphocytes were assayed
for
their scFv expression using anti-idiotypic MoAb 2E9 (solid curves) and control
rat
IgGI MoAb as control (shaded histograms) from day 13 through day 62. Although
a
substantial proportion of cells were positive by day 13, they became
homogeneous by
day 21 and persisted till day 62, when the overall mean fluorescence appeared
to
decrease.
FIGURE 3. (FIGURE 25 in the attached figures) In vitro expansion of 8II9-scFv-
CD28- gene-modified primary human lymphocytes. Clonal expansion was
expressed as a fiuction of the initial viable cell number. IL-2 (100 II/ml)
was added
a$er retroviral infection and was present throughout the entire in vitro
culture period.
Short bars depict the days when soluble anti-idiotypic antibody 2E9 (3-10
ug/ml) was
present in the culture.
FIGURE 4. (FIGURE 26 in the attached figures) Cytotoxicity against tumor cell
lines: 8H9-scFv-CD28- gene-modified lymphocytes from day 56 of culture (scFv-
T)
were assayed by SICr release assay in the presence or absence of 8H9 (50 ug/ml
final
concentration) as an antigen blocking agent. Control lymphocytes (I,AK) from
the
same donor but not gene-modified, were cultured under the same conditions as
the
gene-modified cells. 26A: NMB-7 neuroblastoma. 26B: LAN-1 neuroblastoma. 26C:
HTB-82 rhabdomyosarcoma. 26D: Daudi lymphoma.
SUBSTITUTE SHEET (RULE 26)
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
11
FIGURE 5. (FIGURE 27 in the attached figures) Suppression of
rhabdomyosarcoma tumor growth in SCID mice. Human rhabdomyosarcoma
HTB-82 was strongly reactive with 8H9, but not with 5F11 (anti-GD2)
antibodies.
Experimental group: 8H9-scFv-CD2~- gene-modified human lymphocytes (solid
circles). Control groups: no cells + 2E9 (open circles), cultured unmodified
lymphocytes (LAK) + 2E9 (open triangles), or 5F11scFv-CD28- modified
lymphocytes + 1G8 [rat anti-5F11 anti-idiotype MoAb] (solid triangles).
NINTH SERIES OF EXPERIMENTS
FIGURE 1. (F'IGURE 28 in the attached figures) Sequential imaging of nude
mouse bearing RMS xenograft 24, 48 and 172h after injection with 4.4MBq lzsl-
8H9
as compared to a RMS xenograft bearing mouse imaged 172h after injection with
4.4MBqlzsI-2C9.
FIGURE 2. (FIGURE 29 in the attached figures) Blood kinetics of lzsI-8H9 in
nude
mice with RMS xenografts. Error bars represent SEM.
FIGURE 3. (FIGURE 30 in the attached figures) Comparison of biodisinbution of
lzsl-8H9 at 24, 48 and 172h after injection in xenograft and normal tissues.
FIGURE 4. (FIGURE 31 in the attached figures) Comparison of biodisttibution of
lzsl-8H9 with that of the nonspecific anticytokeratin MoAb lzsl 2C9 (solid
bars) in
xenografts and normal tissues.
FIGURE 5. (FIGURE 32 in the attached figures) Anti tumor effect on RMS
xenografts: 1311-8H9 versus negative control MoAb131I-3F8. Each mouse received
18.5MBq radiolabeled MoAb (5 mice per group).
SUBSTITUTE SHEET (RULE 26)
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
12
DETAILED DESCRIPTION OF THE INVENTION
This invention provides a composition comprising an effective amount of
monoclonal antibody 8H9 or a derivative thereof and a suitable carrier. This
invention provides a pharmaceutical composition comprising an effective
amount of monoclonal antibody 8H9 or a derivative thereof and a
pharmaceutically acceptable carrier. In an embodiment of the above
composition, the derivative is a scFv. In a separate embodiment, the antibody
is an antibody-fusion construct. In another embodiment, the antibody is an
scFvFc.
15
This invention provides an antibody other than the monoclonal antibody 8H9
comprising the complementary determining regions of monoclonal antibody
8H9 or a derivative thereof, capable of binding to the same antigen as the
monoclonal antibody 8H9.
This invention also provides a substance capable of competitively inhibiting
the binding of monoclonal antibody 8H9. In an embodiment, the substance is
an antibody.
This invention provides an isolated scFv of monoclonal antibody 8H9 or a
derivative thereof. In an embodiment, the scFv is directly or indirectly
coupled to a cytotoxic agent. In a further embodiment, the scFv is linked to a
first protein capable of binding to a second protein which is coupled to a
cytotoxic agent. Same rationale applies to the imaging uses of the 8H9
monoclonal antibody or its derivative. In the case of imaging, instead of a
cytotoxic agent, the antibody or its derivative will be coupled to an imaging
agent. Both cytotoxic or imaging agents are known in the art.
This invention provides a cell comprising 8H9-scFv. In an embodiment, the
cell is a red cell. This invention also provides a 8H9-scFv-gene modified
cell.
This invention also provides a liposome modified by 8H9-scFv.
This invention provides a method for directly kill, or deliver drug, DNA, RNA
or derivatives thereof to cell bearing the antigen recognized by the
monoclonal
antibody 8H9 or to image cells or tumors bearing said antigen using the
isolated 8H9-scFv or 8H9-scFv modified cell or liposome.
This invention provides a protein with about 58 kilodaltons in molecular
weight, reacting specifically with the monoclonal antibody 8H9. When this
protein is glycosylated, the apparent molecular weight is about 90
kilodaltons.
This invention provides an antibody produced by immunizing the expressed
8H9 antigen or specific portion thereof.
This invention provides a nucleic acid molecule encoding 8H9 antigen.
This invention provides a nucleic acid molecule capable of specifically
hybridizing the nucleic acid molecule which encodes the 8H9 antigen. The
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
13
nucleic acid molecule includes but is not limited to synthetic DNA, genomic
DNA, cDNA or RNA.
This invention also provides a vector comprising the nucleic acid molecule
encoding the 8H9 antigen or a portion thereof. The portion could be a
functional domain of said antigen. This invention provides a cell comprising
the nucleic acid molecule encoding the 8H9 antigen.
This invention provides a method for producing the protein which binds to the
monoclonal antibody 8H9 comprising cloning the nucleic acid molecule which
encodes the 8H9 antigen in an appropriate vector, expressing said protein in
appropriate cells and recovery of said expressed protein.
This invention provides a method for production of antibody using the
expressed 8H9 antigen or the portion which is immunogenic. This invention
also provides an antibody produced by the above described method. In an
embodiment, the antibody is polyclonal. In another embodiment, the
antibody is a monoclonal.
This invention provides a method of inhibiting the growth of tumor cells
comprising contacting said tumor cells with an appropriate amount of
monoclonal antibody 8H9 or a derivative thereof, or the antibody produced
using the expressed 8H9 antigen or a derivative thereof.
This invention provides a method of inhibiting the growth of tumor cells in a
subject comprising administering to the subject an appropriate amount of
monoclonal antibody 8H9 or a derivative thereof, or the antibody produced
using the expressed 8H9 antigen or a derivative thereof.
This invention provides a method for imaging a tumor in a subject comprising
administering to the subject a labeled monoclonal antibody 8H9 or a labeled
derivatives, or a labeled antibody produced using the expressed 8H9 antigen or
a labeled derivative. In an embodiment, the antibody or the derivative is
labeled with radioisotope.
This invention provides a method of reducing tumor cells in a subject
comprising administering to the subject monoclonal antibody 8H9 or a
derivative thereof, or a monoclonal antibody produced using the expressed
8H9 antigen or a derivative thereof wherein the antibody or derivative is
coupled to a cytotoxic agent to the subject. In an embodiment, the coupling
to a cytotoxic agent is indirect. In another embodiment, the coupling is first
directly linking the antibody or derivative with a first protein which is
capable
of bind to a second protein and the second protein is covalently couple to a
cytotoxic agent. In a further embodiment, the cytotoxic agent is a
radioisotope.
This invention also provides a method to evaluate the tumor bearing potential
of a subject comprising measuring the expression the 8H9 antigen in the
subject, wherein the increased expression of said antigen indicates higher
tumor bearing potential of the subject.
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
14
This invention provides a transgenic animal comprising an exogenous gene
encoding the 8H9 antigen. The transgenic animal may also carried an knock
out gene encoding the 8H9 mouse analogous antigen. In an embodiment, it is
a transgenic mouse.
This invention provides a method to screening new anti-tumor compound
comprising contacting the transgenic animal with the tested compound and
measuring the level of expression of the 8H9 antigen in said transgenic
animal, a decrease in the level of expression indicating that the compound can
inhibit the expression of the 8H9 antigen and is a anti-tumor candidate.
FIRST SERIES OF EXPERIMENTS
MATERIALS AND METHODS
Tumor and normal tissue samples
Frozen tumors from 330 patients with neuroectodermal, mesenchymal and
epithelial neoplasia were analyzed. All diagnoses of tumor samples were
confirmed by hematoxylin and eosin assessment of paraffin-embedded
specimens. 15 normal human tissue samples and 8 normal cynomolgus
monkey tissue samples obtained at autopsy were also analyzed.
Cell lines
Human neuroblastoma cell lines LA-N-1 was provided by Dr. Robert Seeger,
Children's Hospital of Los Angeles, Los Angeles, CA. Human neuroblastoma
cell lines LA-15-N, LA-66-N, LA-SS, LA-19-S and LA-19-N were provided
by Dr. Robert Ross (Fordham University, NY) and IMR 32 and NMB7 by Dr.
Shuen-Kuei Liao (McMaster University, Ontario, Canada). Breast carcinoma
cell lines SW480 and ZR75-1 were provided by Dr. S. Welt (Memorial Sloan-
Kettering Cancer Center, NY) and the melanoma line SKMe128 by Dr. P.
Chapman (Memorial Sloan-Kettering Cancer Center, NY). Neuroblastoma
cell lines SKNHM, SKNHB, SKNJD, SKNLP, SKNER, SKNMM, SKNCH
and SKNSH, rhabdomyosarcoma cell line SKRJC and Ewing's/PNET cell
lines SKPPR, SKPRT and SKNMC were derived from patients with
metastatic disease treated at MSKCC. The following cell lines were purchased
from American Type Culture Collection, Bethesda, MD: melanoma cell lines
HTB63 and HTB67, rhabdomyosarcoma cell line HTB82, small cell lung
cancer cell line HTB 119, acute T-leukemia cell line Jurkat, glioblastoma
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
multiforme cell line Glio72, breast cancer cell line HTB 22, colon carcinoma
cells line SIB Co-l, Hela, embryonal kidney 293, and osteosarcoma cell lines
CRT.;1427, HTB86 and HTB 96. All cell lines were grown at 37 °C in
a 6%
C02 incubator using standard culture medium, which consisted of RPMI 1640
5 medium supplemented with 10% bovine calf serum, 2mM glutamine,
penicillin (100 IU/ml) and streptomycin (100 ~.g/ml). Normal human
hepatocytes were purchased from Clonetics, San Diego, CA and processed
immediately upon delivery. Normal human mononuclear cells were prepared
from heparinized bone marrow samples by centrifugation across a Ficoll-
10 Hypaque density separation gradient. EBV lymphoblastoid cell lines were
derived from human mononuclear cells.
Monoclonal antl'body
Female BALB/c mice were hyperimmunized with human neuroblastoma
15 according to previously outlined methods (21). Lymphocytes derived from
these mice were fused with SP2/0 mouse myeloma cells line. Clones were
selected for specific binding on ELISA. The 8H9 hybridoma secreting an
IgGI monoclonal antibody was selected for further characterization after
subcloning.
Immunohistochemical studies
Eight ~.m cryostat frozen tumor sections were fixed in acetone and washed in
PBS. Immunohistochemical studies were performed as described previously
(22). Endogenous peroxidases were blocked in 0.3% Hz02 in PBS. Sections
were incubated in 10% horse serum (Gibco BRL, Gaithersburg, MD) after
blocking with avidin and biotin. Incubation with purified 8H9 (2~.g/ml) in
PBS was carried out at room temperature for 1 hour. An IgGl myeloma was
used as a control (Sigma Chemical, St Louis MO). Sections were incubated
with a secondary horse anti-mouse biotinylated antibody (Vector Laboratories,
Burlingame, CA) followed by incubation with ABC complex ( Vector ) and
developed with Vector VIP peroxidase substrate or DAB peroxidase substrate
kit (Vector). A 10% hematoxylin counterstain for 4 minutes was used.
Staining was graded as positive or negative and homogeneous or
heterogeneous reactivity noted.
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
16
Indirect immunofluorescence
1 million target cells were washed in PBS and then spun at 180 X g for 5 min.
The pellets were then reacted with 100 ~.1 of 15~g1m1 8H9 at 4° C for
1 hour.
After washing the cells with PBS they were allowed to react with 100,1
FITC-conjugated goat F (ab')Z anti-mouse IgG + IgM, (Biosource
International, Camarillo, CA) at 4° C. Flow cytometric analysis
was
performed using FACSCaIibur Immunocytometer (Becton-Dickinson
Immunocytometry Systems, San Jose, CA).
In order to study loss of antigen after binding to 8H9, 10~ NMB7 and U20S
cell pellets were prepared as above and reacted with 100 ~.1 each of 15~g/ml
of
8H9 or the anti-HLA A,B,C antibody, HB-95 (American Type Culture
Collection, Bethesda, MD) at 4° C for 1 hour. NMB7 cells were also
similarly
reacted with the anti-GDZ monoclonal antibody 3F8. After washing with PBS,
cells were cultured at 37°C in standard culture medium for 0, 1,2, 4,
8, 12, 24,
36 and 48h. They were then reacted with FITC-conjugated secondary
antibody goat F (ab')Z anti-mouse IgG + IgM, (Biosource International,
Camarillo, CA) at 4° C. Flow cytometric analysis was performed.
Geometric
mean immunofluorescence was compared to that of control cells incubated for
similar time intervals in standard culture medium in the absence of MoAbs,
and then immunostained with HB-95 (LT20S) or 3F8 (NMB7).
Antigen sensitivity to proteinase was tested by incubating 0.5 x 106 of HTB82,
U20S and NMB7 cells at 37°C for 30 minutes in RPMI with increasing
concentrations of neutral proteinase, Pronase E from streptomyces griseus
(E.Merck, Darmstadt, Germany) After washing, cells were stained with 8H9
or 3F8 and studied by indirect immunofluorescence.
Immunopxecipitation
Immunoprecipitation was carned out using a modification of the standard
technique. (23) 8H9-positive cell lines (NMB7, LAN-1, HTB82, U20S,
HELA, 293) and 8H9-negative cell lines (Jurkat, HTB119) were used. 2x10
viable cells were washed in TBS (0.05 M Tris-HCl, pH 8, with 0.15 M NaCI)
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
17
and incubated with 10 U lactoperoxidase (Sigma) 100 u1 of 100 U/ml in TBS,
1 mCi lasl (2.7 u1) and 1/6000 dilution of 30% hydrogen peroxide for 5 min at
20°C. Five units of Iactoperoxidase (SOuI) and the same dilution of
hydxogen
peroxide (50 u1) were added every 3 min with mixing for a total of 3 times.
The cells were washed extensively in TBS containing 2 mghnl of NaI. The
iodinated cells were washed three times in TBS, lysed on ice (30 min) in 500
u1 of modified RIPA buffer (0.01 M Tris-HCI, pH 7.2, 0.15 M NaCI, 1
sodium deoxycholate, 1% Nonidet P-40, 0.1% sodium dodecyl sulfate (SDS),
0.01 M EDTA) containing protease inhibitors (1 mM PMSF, 50 ug/ml
IO Bestatin, 2 ug/ml Aprotinin, 0.5 ug/ml Leupeptin, 0.7 ug/ml Pepstatin, 10
ug/ml E-64). The lysates were clarified by centrifugation at 15,000 rpm fox 5
min at 4°C, then incubated with 1 mg of 8H9 or IgGl control antibody
for 16
hr at 4°C with mixing. The antigen-antibody complex was collected by
adsorption onto 100 u1 Protein G-sepharose beads (Sigma) for 6 hr at
4°C.
I S The immune complex immobilized on Protein G was washed three times with
modified RIPA buffer, and then washed once with RIPA buffer containing 1
M NaCI, and then twice with modified TNN buffer (0.05 M Tris-HCI, pH 8,
0.15 M NaCI, 0.05% Nonidet P-40). Bound proteins were removed by
elution with SDS-sample buffer and analyzed by 7.5% SDS-PAGE, followed
20 by autoradiography. Deglycosylation of the radiolabeled antigen was carried
out on the protein G sepharose using N-glycanase (Glyco, Novato, CA) and
O-glycanase (Glyco) according to manufacturers' instructions. Molecular
weight was estimated using Quantity One software from BioRad Inc.
(Hercules, CA).
RESULTS
Immunohistochemical studies
Frozen sections from 330 tumors with histologically confirmed diagnoses of
cancer were analyzed for immunoreactivity with mAb 8H9 (Tables 1, 2). 15
histologically normal human tissues and 8 normal monkey tissues were also
analyzed (Table 3).
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
18
Table 1: 8H9 reactivity:
ueuroectodermal Tumors
Tumors No. 8H9 osp
itive
Neuroblastoma 90 87 97
Brain Tumors
1. Glial Tumors
Glioblastoma multiforme17 15 88
Mixed Glioma 4 3 -
Oligodendroglioma I1 4 36
Astrocytoma 8 6 75
Ependymoma 3 2
2. Primitive PNET
Medulloblastoma 2 2
3. Mixed
Neuronoglial tumor 2 1 -
4. Otlaer
Scliwannoma 3 3 -
Meningioma 2 2 -
Neurofibroma 1 1 -
Pineoblastoma I 1 -
Melanoma 16 12 75
Ewing's Family of tumors21 21 100
TOTAL 181 160 88
Table 2: 8H9 reactivity: mesenchymal, epithelial and other tumors
A. Mesenchymal
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
19
Tumors No. 8H9 Reactive
Rhabdomyosarcorna 29 28 97
Osteosarcoma 29 28 97
Desmoplastic small round37 35 95
cell tumor
Leiomyosarcoma 4 4 -
Synovial sarcoma 3 2 -
Malignant fibrous histiocytoma1 1 -
Undifferentiated sarcoma2 2 -
Fibrosarcoma 1 0
TOTAL 106 100 94
B. Epithelial
Tumors No. 8H9 Reactive
Breast 12 4 33
Bladder 4 1 -
Adrenal 3 1 -
Stomach 1 1 -
Prostate 2 1 -
Colon 1 1 -
Lung 1 1 -
Endometrium 1 1 -
Cervix 1 0 -
Renal 1 1 -
TOTAL 27 12 44
Epithelial tumors summa
No. Slide Date Diagnosis 8H9
1 7251 3/11/98 Breast Ca neg
2 7279 3/13/98 Breast Ca neg
3 7282/7601 3/13/1998;15/98 Breastneg
10 Ca
4 7722 10/21/98 Breast Ca NE(no
cells)
7261 3/11/98 Breast Ca pos
6 6388 8/26/98 Breast Ca pos
7 6493 10/11/98 Breast Ca neg
8 6498 10/11/98 Breast Ca neg
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
9 6499 10/11/98 Breast Ca neg
10 6492 10/11/98 Breast Ca neg
11 6376 8/26/96 Breast Ca pos
12 6488 10/11/98 Bladder Ca neg
13 6489 IO/11/98 Bladder Ca weakly
+
14 6490 10/11/98 Bladder Ca neg
15 6491 10/11/98 Bladder Ca neg
16 6441 9/30/98 Lung Ca pos
17 6503 10/11/98 Prostate Ca neg
18 6504 10/11/98 Prostate Ca pos
I9 6501 10111/98 Cervix Ca neg
20 6502 10/11/98 Uterine Ca pos
21 7717 10/21/98 Adrenal Ca ne (necrotic)
22 7250 3/I I/98 Adrenal Ca neg
23 7207 11/18/97 Renal Ca pos
24 6505 10/11/98 Stomach Ca pos
7886 2/22/99 Adrenal Ca pos
Total Evaluable 8H9 pos.
Breast 11 10 3 of 10
Bladder 4 41 of 4
Prostate 2 21 of 2
Adrenal 3 2 lof 2
Renal 1 1 1 of I
Stomach 1 1 1 of 1
Uterine 1 1 1 of 1
Cervix I 10 of 1
Lung 1 1 1 of 1
TOTAL 25 2310 of 23
C. Other tumors
Tumors No. 8H9 reactive
Hepatoblastoma 4 3 -
Wilm's tumor 8 7 -
Rhabdoid tumor 3 3 -
Paraganglioma 1 1 -
TOTAL 16 14 88
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
21
Table 3: 8H9 reactivity in normal human and cynomolgus monkey
tissues
A. Human
Tissues 8H9 reactivi
Frontal lobe Negative
Pons Negative
Spinal cord Negative
Cerebellum Negative
Lung Negative
Heart Negative
Skeletal muscle Negative
Thyroid Negative
Testes Negative
Pancreas cytoplasmic staining*
Adrenal cortex cytoplasmic staining*
Liver cytoplasmic staining*
Sigmoid colon Negative
Bone Marrow Negative
Kidney Negative
* non-specific background
B. Cynomolgus monkey
Tissues 8H9 Reactivi
Cerebellum Negative
Frontal Lobe Negative
Occipital CortexNegative
Brainstem Negative
Liver cytoplasmic staining
Stomach Negative
Adrenal Cortex cytoplasmic staining
Kidney Negative
Heterogenous, non-specific cytoplasmic staining was noticed in normal human
pancreas, stomach, liver and adrenal cortex which was diminished when 8H9
F(ab')Z fragments were used instead of the whole antibody for immunostaining
(data not shown). None of the other human tissues showed reactivity with
8H9. In particular normal human brain tissue sections including frontal lobe,
spinal cord, pons and cerebellum were completely negative. Normal tissues
from cynomolgus monkey also demonstrated similarly restricted reactivity
with nonspecific staining observed in stomach and liver. (Table 3)
The majority of neuroectodermal and mesenchymal tumors tested showed
positive reactivity with 8H9, epithelial tumors to a lesser extent. 8H9
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
22
immunoreactivity was seen in a characteristic, homogeneous, cell membrane
distribution in 286 of the 330 (87%) tumor samples examined. (Figure 1). 88%
of neuroectodermal tumors, 94% of mesenchymal tumors and 44% of
epithelial tumors tested positive with 8H9. (Tables 2, 3)
Indirect immunofluorescence
0 8H9 immunoreactivity in 35 neuroblastoma, melanoma, rhabdomyosarcoma,
small cell lung cancer, osteosarcoma, glioblastoma, leukemia, breast cancer
and colon cancer cell lines was tested using indirect immunofluorescence.
Moderate to strong cell membrane reactivity with 8H9 was detected in 16/16
neuroblastoma cell lines, 3/3 melanoma cell lines, 2/2 rhabdomyosarcoma cell
lines, 1/1 glioblastoma multiforme cell line, 3/3 breast cancer cell lines and
1/1
colon cancer cell lines studied. 2 of 3 Ewing's/PNET cell lines, and 2 of the
3
osteosarcorna cell lines were strongly positive while the others showed weak
positivity. The small cell lung cancer cell line tested negative with 8H9 as
did
Jurkat T-ALL cell line and EBV transformed lymphoblastoid cells. Normal
human bone marrow mononuclear cells and hepatocytes had no reactivity with
8H9. (Table 4) In the neuroblastoma cell lines studied, indirect
irnmunofluorescence with 8H9 was weaker (mean fluorescence: 73.73;
negative control: 3.95) when compared to the anti-GD2 antibody 3F8 (mean
fluorescence: 249.95).
Table 4: 8H9 reactivity with cell lines by indirect immunofluorescence
_Cell line 8H9 Reactivi
1. Neuroblastoma
LA-N-1 positive
NMB7 positive
LA-1-15-N positive
LA-1-66N positive
IMR32 positive
LA-1-19N positive
LA-1-SS positive
LA-1-19S positive
SKNHM positive
SKNSH positive
SKNHB positive
SKNJD positive
SI~NNLP positive
SKNMM positive
SKPCH positive
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
23
SKNER positive
2. Melanoma
HTB63 positive
HTB67 positive
SKMe128 positive
3. Rhabdomyosarcoma
HTB 82 positive
SKRJC positive
4. Small cell lung
cancer
HTB 119 negative
S. Osteosarcoma
CRL 1427 positive
HTB96 positive
HTB86 positive
6. Ewing's/PNET
SKPPR positive
SKPRT positive
SKNMC positive
7. Glioblastoma
Glio72 positive
8. Carcinoma Breast
ZR75-1 positive
S W480 positive
HTB22 positive
9. Carcinoma Colon
SI~Co-1 positive
10. Leukemia
Jurkat negative
11. Normal human cellsnegative
Bone marrow negative
Hepatocytes negative
12. EBV lymphoblastoidnegative
cells
8H9 binding to U20S as detected by indirect immunofluorescence did not
diminish significantly after 48 hr of incubation at 37°C. During the
same
period, binding to the anti-HLA antibody HB-95 diminished by 89%.
Similarly there was no significant loss of 8H9 binding to NMB7 cells. whereas
3F8 binding diminished by 61%. (Figure 2)
There was a pronase dose-dependent reduction in reactivity with 8H9 with 75-
85% loss of immunofluorescence achieved at a final Pronase concentration of
0.3 mg/ml (Figure 3). There was no appreciable loss of reactivity with 3F8 on
NMB7 cells. Furthermore, the 8H9 antigen was not sensitive to neuraminidase
or phosphatidyl-inositol specific phospholipase C (data not shown).
Immunoprecipitation:
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
24
8H9 ixnmunoprecipitated a broad band centered around 90 kD from all the
8H9-positive cell lines (HTB82, NMB7, LANl, U20S, Hela, 293), whether
using native or reducing (2ME) conditions (data not shown). Neither control
IgGI antibody nor 8H9-negative cell lines (Jurkat or HTBII9) showed the
90kD antigen. Following N-glycanase treatment, a single 58kD band was
found. O-glycanase had no effect. We interpreted this to mean a protein with
heterogeneous glycosylation pattern, without disulfide-linked subunits.
T1TC~ ~''T TC~ C~TIITT
We describe a novel 'S8 kD surface tumor antigen, which is detected by the
monoclonal antibody 8H9. This antigen is expressed on a broad spectrum of
human neuroectodermal, mesenchymal and epithelial tumors and appears to be
immunohistochemically tumor specific, namely, it is expressed on cell
membranes of tumor cells with no/low membrane reactivity noted on normal
human tissues. The antigen was present on 88% of neuroectodermal tumors,
96% of mesenchymal tumors and 44% of epithelial cancers tested. The
specific tissue distribution suggests a unique tumor antigen not previously
reported.
The expression of the 8H9 antigen on several glial and nonglial brain tumors
and the complete absence on normal brain tissue is unusual. This property
contrasts with most of the previously described glial tumor antigens with a
cell
membrane distribution (Table 5). Neuroectodennal-oncofetal antigens e.g.
neural cell adhesion molecules are present to varying degrees on normal adult
and fetal tissues (6). Neurohematopoeitic antigens including Thy-1
determinants (24) , CD-44 (8) and its splice variants (25) are present on
normal and neoplastic brain tissue as well as hematopoeitic tissues,
principally
of the lymphoid lineage. Gangliosides, such as GD2 and GM2, although
expressed on tumors of neuroectodermal origin, are also present on normal
brain tissue (7). The Iactotetraose series ganglioside 3'-6"-iso LDl is widely
expressed on brain tumors and on epithelial cancers and germ cell tumors as
well as on normal brain tissue. (26).
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
.
fl
.
0
' .'fl ~ ~
U ~O C
'~
w
w
.fl > ~
o a
o
fn ~ m '-' i~ . U .
:= '~a' ~
~ ~
'F
~ v' ~ ~ fl ~
~ fl
'~
, c . a
O G .
N
O
ic!~ ~ ~ ~ i~ O
~
,~ N a .~ ~ .~
c~G ~ G
N ~ N ~ N ~ ~ O O ~ O
CJ U O N N O ~ v
U ' U U P-i S-' Gi
U U L." U
~ ~'
~ . ~ ~j . -. ~
o 'r 0 0 0 ~ ~~3 ~3 ~ ~3
o ~3 ~ o ~3 0 o
~~3 a
~ ~ a a '~ a~ a~ a~
~ ~ '' a a~ ~ ~
a~
w _
~
~i ~ ~i ~i ~ ~i i, i-.
~ ~ ' i-.
~ Y
~ ~
4~ 4~ L~ f
Lw i-i
it
~
~zz z zz zw zz zzz zz zz~a
O
d
o ~ ~ ~' o
h ~
N ~ U d ~'~
~N C7 ~ '~'
cn ~'o
p O ~ ~ '~ M ~ ?.[W ~ 'r~~f'
~ ~ ~ s
~
pip ;' , ~ N
~ ~ ,~
.~
' d ~~ W O m "7~ d~ o
~~ ~Cd ~
~a
p d A . 0.
" l
O
cd
bA
O
Rw N N CSC Q,
U ~ t
~
b-0 ~
O
.~ ~ ~ U ' Q
U N O QJ ~d
a ~
U
v~ ~ O ~ x -a
~
G.' ~
~ O
w '
~ ~
~
~ , c. ~ .
C7 v
v
io
A
7
'
.~ . w~7~ ~~' ~
c
M
~wa
~
, add ~ N
~,
~ z ~i ~ ~ ~ ~~~~ H ~c
~
H
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
26
Another remarkable property of the 8H9 antigen is its expression on tumors of
diverse
lineage: neuroectodermal, mesenchymal arid to a lesser degree epithelial
tumors. No
monoclonal antibody to date has the binding spectrum described with 8H9. This
broad
distribution provides MoAb 8H9 the potential of being a "generic" tumor
antigen for
targeted therapy. Of particular interest is its expression on 28/29
rhabdomyosarcoma
tumors and the rhabdomyosarcoma cell lines tested by indirect
immunofluorescence.
Disseminated and high risk rhabdomyosarcomas have a very poor prognosis with <
40%
long term survival rate (27). Although the MYOD family of oncofetal proteins
are
specific to rhabdomyosarcoma, they are nuclear antigens and therefore unlikely
candidates for antibody-based therapy (19). In a preliminary report, cross
reactivity of
the monoclonal antibody BW575 raised against small cell lung carcinoma with
rhabdomyosarcoma cell lines and 2/2 rhabdomyosarcoma sections was described.
However, this antibody showed cross-reactivity with normal tissues (28).
Two further groups of tumors studied were the Ewing's family of tumors and
osteosarcoma. The Ewing's family of tumors can be differentiated from other
small blue
round cell tumors of childhood by monoclonal antibodies recognizing
glycoprotein
p30/32 coded by MIC2 oncogene. However, this protein is also expressed on
normal
tissues and on other tumors, severely limiting its utility in radioimaging and
therapy (18).
100% (21/21) of Ewing's family tumors tested showed immunoreactivity with MoAb
8H9. Apart from GDZ (15), the osteosarcoma-associated antigen recognized by
the
MoAbs TP-1 and TP-3 (17), and the decay accelerating factor CD55 (16), few
tumor-
associated antigens have been defined for osteosarcoma. In our study 28/29
(95%)
osteosarcomas tested immunohistochemically positive with MoAb 8H9. The latter
may
therefore have clinical utility in the Ewing's family of tumors and
osteosarcomas.
The 8H9 antigen appears to be a novel, previously undescribed antigen.
Sensitivity to
proteinase suggests that it has a protein component. Conversely, the lack of
sensitivity to
neuraminidase implies absence of sialic acid residues, and the lack of
sensitivity to
phosphatidyl-inositol specific phospholipase C implies that the 8H9 antigen is
not GPI
anchored. It is unlikely to be related to the neural cell adhesion molecule
family due to
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
27
its unique distribution and restriction of expression among normal tissues
(6). Of the
currently described antibodies, which bind to glial tumors, four have been
reported to be
restricted to tumor tissues. The mutated EGFRvIII was found to be expressed on
52% of
gliomas tested and crossreacts with breast and lung carcinomas (29). However,
the broad
distribution of the 8H9 antigen is different from EGFRvIII. Integrin 3, a
140kDa protein
expressed on gliomas and medulloblastomas is targeted by the monoclonal
antibody
ONS-M21 which does not cross react with normal brain (30). However, negative
immunoreactivity with neuroblastoma, melanoma and meningioma has been
reported.
(31). Similar data on glioma-specific antibodies with no cross reactivity with
normal
brain has been published. However, they do not react with other
neuroectodermal or
mesenchymal tumors and data regarding reactivity with other tissues is
unavailable (32).
A 38kDa antigen has been targeted on glioblastoma cells by the antibody 6DS1.
No
crossreactivity with human brain has been reported. Data regarding reactivity
with other
human tissues is unknown, although a high accumulation of the radiolabeled
antibody in
mouse kidney has been reported. (33). An ependymoma-specific protein antigen
of 81
kDa, recognized by monoclonal antibodies which do not crossreact with normal
glial
cells, has also been described. These antibodies do not react with other glial
tumors such
as glioblastoma and crossreactivity with other tumor tissue is not known (34).
The homogeneous expression of the 8H9 antigen on cell membrane makes it an
attractive
candidate for targeted irnmunotherapy. Furthermore, the persistence of the 8H9
antigen
on NMB7 cells after ~ binding to the MoAb suggests that the antigen is not
easily
immunomodulated. In order to explore its potential for radioimaging we used
~~"'Tc
conjugated 8H9 to image neuroblastoma xenografts in athymic nude mice. This
revealed
selective uptake in the xenografts apart from moderate uptake in the liver, %
ID/gm
being 50% of that achieved with the anti-GD2 monoclonal antibody 3F8 (data not
shown).
The hydrazino-derivative of 8H9, therefore, retains the immunoreactive
properties of the
unmodified antibody, and may be useful for radioimaging of tumors. We have
also
demonstrated selective radioimmunolocalization of rhabdomyosarcoma xenografts
in
athymic mice with no significant uptake in normal tissues using lasl-labeled
8H9 (data
not shown).
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
28
In summary, the monoclonal antibody 8H9 recognizes a unique 58kD tumor-
specific
antigen with broad distribution across a spectrum of tumors of varying
lineage:
neuroectodermal, mesenchymal and epithelial, with restricted expression in
normal
tissues. 8H9 may have clinical utility in the targeted therapy of these human
solid tumors
in vitro or in vivo. Further biochemical characterization of the 8H9 antigen
is warranted
and may be of interest in delineating a possible role in the oncogenic
process.
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
29
REFERENCES
1. Cheung, N. K. V., Kushner, B. H., Cheung, I. Y., Canete, A., Gerald, W.,
Liu, C.,
Finn, R., Yeh, S. J., Larson, S. M. Anti-GD2 antibody treatment of minimal
residual
stage 4 neuroblastoma diagnosed at more than 1 year of age. J. Clin. Oncol.,
16:3053
3060, 1998.
2. Yu, A., Uttenreuther-Fischer, M., Huang, C.-S., Tsui, C., Gillies, S.,
Reisfeld, R.,
Kung, F. Phase I trial of a human-mouse chimeric anti-disialoganglioside
monoclonal
antibody ch14.18 in patients with refractory neuroblastoma and osteosarcoma.
J. Clin.
Oncol., 16:2169-2180, 1998.
°3. Jurcic, J. G., Caron, P. C., Miller, W. H., Yao, T. J., Maslak, P.,
Finn, R. D.,
Larson, S. M., Warrell, R. P. J., Scheinberg, D. A. Sequential targeted
therapy for acute
promyelocytic leukemia with all-trans retinoic acid and anti-CD33 monoclonal
antibody
M195. Leuk., 9:244-248, 1995.
4. Pegram, M. D., Slamon, D. J. Combination chemotherapy with trastuzumab
~ (Herceptin) and cisplatin for chemoresistant metastatic breast cancer:
evidence for
receptor-enhanced chemosensitivity. Sem. Oncol., 26:89-95, 1999.
5. Czuczman, M. S., Grilo-Lopez, A. J., White, C. A., Saleh, M., Gordon, L.,
LoBuglio, A. F., Jonas, C., Klippenstein, D., Dallaire, B., Varns, C.
Treatment of
patients with low-grade B-cell lymphoma with the combination of chimeric anti-
CD20
monoclonal antibody and CHOP chemotherapy. J. Clin. Oncol.,17:268-276, 1999.
6. Garin-Chesa, P., Fellinger, E. J., Huvos, A. G., Beresford, H. R., Melamed,
M.
R., Triche, T. J., Rettig, W. J. Imrnunohistochemical analysis of neural cell
adhesion
molecules. Differential expressionin small round cell tumors of childhood and
adolescence. Am. J. Pathol., 139:275-286, 1991.
7. Ritter, G., Livingston, P. O. Ganglioside antigens expressed by human
cancer
cells. Semin. Cancer. Biol., 2:401-409, 1991.
8. Ylagan, Quinn, L. R. B: CD44 expression in astrocytic tumors. Modern
Pathology, 10:1239-1246, 1997.
9. Kuan, C. T., Reist, C. J., Foulon, C. F., Loximer, I. A., Archer, G.,
Pegram, C. N.,
Pastan, L, Zalutsky, M. R., Bigner, D. D. 125I-labeled anti-epidermal growth
factor
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
xeceptor vIII single-chain Fv exhibits specific and high-level targeting of
glioma
xenografts. Clin. Can. Res., 5:1539-1549, 1999.
10. Richardson, R. B., Davies, A. G., Bourne, S. P., Staddon, G. E., Jones, D.
H.,
5 Kemshead, J. T., Coakham, H. B. Radioimmunolocalization of human brain
tumors.
Biodistribution of radiolabelled monoclonal antibody UJ13A. Eur J Nucl Med,
12:313-
320, 1986.
11. Papanastassiou, V., Pfizer, B. L., Coakham, H. B., Bullimore, J.,
Zananiri, A.,
Kemshead, J. T. Treatment of recurrent and cystic malignant gliomas by a
single
10 intracavitary injection of 131I-monoclonal antiobdy: Feasibility,
pharmacokinetics and
dosimetry. Br. J. Cancex, 67:144-151, 1993.
12. Celis, E., Tsai, V., Crimi, C., Demars, R., Wentworth, P. A., Chesnut, R.
W.,
Grey, H. M., Sette, A., Serra, H. M. Induction of anti-tumor cytotoxic T
lymphocytes in
normal humans using primary cultures and synthetic peptide epitopes. Proc.
Natl. Acad.
15 Sci. USA, 91:2105-2109, 1994.
13. Bigner, D. D., Brown, M. T., Friedman, A. H., Coleman, R. E., Akabani, G.,
Friedman, H. S., Thorstad, W. L., Mclendon, R. E., Bigner, S. H., Zhao, X. G.
Iodine-
131-labeled antitenascin monoclonal antibody 81C6 treatment of patients with
recurrent
malignant gliomas:phase I trial results. Journal Clincal Oncology, 16:2202-
2212, 1998.
20 14. Riva, P., Frnceschi, G., Frattarelli, M., Riva, N., Guiduci, G.,
Cremonini, A. M.,
Giulaiani, G., Casi, M., Gentile, R., Jekunen, A., Kairemo, K. J. 131I
radioconjugated
antibodies for the locoregional radioimmunotherapy of high-grade malignant
glioma-
phase I and II study. Acta Oncol, 38:351-359, 1999.
15. Heiner, J., Miraldi, F. D., Kallick, S., Makley, J., Smith-Mensah, W. H.,
Neely,
25 J., Cheung, N. K. V. In vivo targeting of GD2 specific monoclonal antibody
in human
osteogenic sarcoma xenografts. Cancer Res., 47:5377-5381, 1987.
16. Spendlove, L, James, L. L., Carmichael, J., Durrant, L. G. Decay
accelerating
factor (CD55): a target for cancer vaccines? Cancer Res., 59:2282-2286, 1999.
17. Bruland, O., Fodstad, O., Funderud, S., Pihl, A. New monoclonal antibodies
30 specific for human sarcomas. Int J Cancer, 15:27-31, 1986.
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
31
18. Weidner, N., Tjoe, J. Immunohistochemical profile of monoclonal antibody
013
that recognizes glycoprotein 930/32MIG2 and is useful in diagnosing ewing's
sarcoma
and peripheral neuroepithelioma. American Journal of Surgical Pathology,
18:486-494,
1994.
I9. Wang, N. P., Marx, J., McNutt, M. A., Rutledge, J. C., Gown, A. M.
Expression
of myogenic regulatory proteins(myogenin and MyoDl) in small blue round cell
tumors
of childhood. Am. J. Pathol., 147:1799-1810, 1995.
20. Hatzubai, A., Maloney, D. G., Levy, R. The use of a monoclonal anti-
idiotype
antibody to study the biology of human B-cell lymphoma. J. Immunol., 126:2397-
2402,
1981.
21. Cheung, N. K., Saarinen, U., Neely, J., Landmeier, B., Donovan, D.,
Coccia, P.
Monoclonal antibodies to a glycolipid antigen on human neuroblastoma cells.
Cancer
Res., 45:2642-2649, 1985.
22. Kramer, K., Gerald, W., LeSauteur, L., Saragovi, H. U., Cheung, N. K. V.
Prognostic value of TrkA protein detection my monoclonal antibody SC3 in
Neuroblastoma. Clin. Can. Res., 2:1361-1367, 1996.
23. Hecht, T. T., Longo, D. L., Cossman, J., Bolen, J. B., Hsu, S.-M., Israel,
M.,
Fisher, R. I. Production and characterization of a monoclonal antibody that
binds reed-
sternberg cells. J. Immunol., 134:4231-4236, 1985.
24. Seeger, R. C., Danon, Y. L., Rayner, S. A., Hoover, F. Definition of a Thy-
1
determinant on human neuroblastoma, glioma, sarcoma, and teratoma cells with a
monoclonal antibody. J. Immunol., 128:983-989, 1982.
25. Kaaijk, P., Troost, D., Morsink, F., Keehnen, R. M., Leenstra, S., Bosch,
D. A.,
Pals, S. T. Expression of CD44 splice variants in human primary brain tumors.
Journal of
Neuro- Oncology, 26:185-190, 1995.
26. Wikstrand, C. J., Longee, D. C., McLendon, R. E., Fuller, G. N., Friedman,
H. S.,
Fredman, P., Svennerholm, L., Bigner, D. D. Lactotetraose series ganglioside
3',6'-
isoLDl in tumors of central nervous and other systems in vitro and in vivo.
Cancer Res.,
53:120-126, 1993.
27. Pappo, A., Shapiro, D. N., Crist, W. M. Rhabdomyosarcoma: biology and
treatment. Pediatr. Clin. North Am., 44:953-972, 1997.
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
32
28. Fujisawa, T., Xu, Z. J., Reynolds, C. P., Schultz, G., Bosslet, I. V.,
Seeger, R. C.
A monoclonal antibody with selective immunoreactivity for neuroblastoma and
rhabdomyosarcoma. Proc. Am. Assoc. Cancer Res., 30:345, 1989.
29. Wikstrand, C. J., Hale, L. P., Batra, S. K., Hill, M. L., Humphrey, P. A.,
Kurpad,
S. N., McLendon, R. E., Moscatello, D., Pegram, C. N., Reist, C. J., et al.
Monoclonal
Antibodies against EGFRvIII are Tumor Specific and React with Breast and Lung
Carcinomas and Malignant Gliomas. Cancer Res., 55:3140-48, 1995.
30. Kishima, H., Shimizu, K., Tamura, K., Miyao, Y., Mabuchi, E., Tominage,
E.,
Matsuzaki, J., Hayakawa, T. Monoclonal antibody ONS-21 recognizes integrin a3
in
gliomas and gliomas and medulloblastomas. Br. J. Cancer, 79:333-339, 1998.
31. Moriuchi, S., Shimuzu, K., Miyao, Y., Hayakawa, T. Characterization of a
new
mouse monoclonal antibody (ONS-M21) reactive with both medulloblastomas and
gliomas. Br. J. Cancer, 68:831-837, 1993.
32. Kondo, S., Miyatake, S., Iwasaki, K., Oda, Y., Kikuchi, H., Zu, Y.,
Shomoto, M.,
Namba, Y. Human glioma-specific antigens detected by monoclonal antibodies.
Neurosurgery, 30:506-S1I, 1992.
33. Dastidar, S. G., Sharma, S. K. Monoclonal antibody against human
glioblastoma
multiforme (U-87Mg) immunoprecipitates a protein of monoclonal mass 38KDa and
inhibits tumor growth in nude mice. J Neuroimmuno, 56:91-98, 1995.
34. Mihara, Y., Matsukado, Y., Goto, S., Ushio, Y., Tokumitsu, S., Takahashi,
K.
Monoclonal antibody against ependymoma-derived cell line. Journal of Neuro-
Oncology, 12:1-11, 1992.
35. Daghighian, F., Pentlow, K. S., Larson, S. M., Graham, M. C., DiResta, G.
R.,
Yeh, S. D., Macapinlac, H., Finn, R. D., Arbit, E., Cheung, N. K. Development
of a
method to measure kinetics of radiolabeled monoclonal antibody in human tumour
with
applications to microdosimetry: positron emission tomography studies of iodine-
124
labeled 3F8 monoclonal antibody in glioma. Eur J Nucl Med, 20:402-409, 1993.
36. Plate, K. H., Breier, G., Farell, C. L., Risau, W. Platelet derived growth
factor b
is induced during tumor development and upregulated during tumor progressin in
endothelial cells in human gliomas. Lab. Invest., 67:529-534, 1992.
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
33
37. Yang, H. S., Lieska, N., Glick, R., Shao, D., Pappas, G. D. Expression of
300-
kilodalton intermediate filament-associated protein distinguishes human glioma
cells
from normal astrocytes. Proceedings of the National Academy of Sciences of the
United
States of America, 90:8534-8537, 1993.
38. Bigner, D. D., Brown, M., Coleman, E., Friedman, H. A., McClendon, R. E.,
Bigner, S. H., Zhao, X. G., Wikstrand, C. J., Pegram, C. N. Phase I studies of
treatment
of malignant gliomas and neoplastic meningitis with 131 I radiolabeled
monoclonal
antibodies anti-tenascin 81C6 and anti-chondroitin proteoglycan sulfate Mel-14
(ab')2 - a
preliminary report. J Neuro Oncol, 24:109-122, 1995.
39. Mariani, G., Lasku, A., Pau, A., Villa, G., Motta, C., Calcagno, G.,
Taddei, G. Z.,
Castellani, P., Syrigos, I~., Dorcaratto, A., et al. A pilot pharmacokinetic
and
immunoscintigraphic study with the technetium-99m-labeled monoclonal antibody
BC-1
directed against oncofetal fibronectin in patients with brain tumors. Cancer
Supplement,
80:2484-2489, 1997.
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
34
SECOND SERIES OF EXPERIMENTS
Recent clinical trials have shown promising potentials of monoclonal
antibodies
(MoAbs) in the treatment of cancer: anti-CD20 (lymphoma), anti-HER2 (breast
cancer),
anti-tenascin (brain tumors), anti-CD33 (leukemia), and anti-TAG-72 (colon
cancer). In
pediatric oncology, tumor-targeting agents are even more relevant since
minimal residual
disease (MRD) is often the obstacle to cure, and late effects of non-specific
therapy are
significant. Despite high-intensity combination therapy, most metastatic solid
tumors
(Ewing's sarcoma [ES], primitive neuroectodermal tumor [PNET], osteosarcoma
[OS],
desmoplastic small round cell tumor [DSRT], rhabdomyosarcoma [RMS], and brain
tumors) remain incurable. Using metastatic neuroblastoma (NB) for proof of
principle,
our laboratory integrated the murine IgG3 anti-ganglioside GDZ MoAb 3F8 into
multi-
modality therapy. 3F8 has demonstrated high selectivity and sensitivity in
radioimmunodetection of metastatic tumors, and appears to be a safe and
effective
method of eliminating MRD, achieving a >50% progression-free survival (PFS).
For
most pediatric solid tumor therapeutic MoAbs do not exist. Known tumor surface
antigens are often restricted to a specific tumor type, heterogeneous in its
expression, or
found in normal blood cells or organs. We recently described a MoAb , 8H9
which
recognizes a novel cell surface antigen in a wide spectrum of pediatric
tumors, with no
crossreactieity with blood, marrow, brain and normal organs, and minimal
reactivity
with hepatocyte cytoplasm. 1311 or ~~"'Tc-labeled 8H9 can effectively image NB
and
RMS xenografts in SCID mice. Antigen expression was generally homogeneous
within
tumors, and did not modulate on MoAb binding. We propose to test the targeting
potential of 1311-8H9 in a pilot imaging study. Pediatric/adolescent patients
with NB,
RMS, ES, PNET, OS, DSRT and brain tumors are subjects of our investigation. We
have
two specific aims:
Specific aim #1: To measure the level of agreement between conventional
imaging
modality (CT, MRI, and nuclear scans) and antibody 8H9 imaging in known and
occult
sites of disease. Sensitivity analysis of 8H9 for each disease type will be
conducted.
Specific aim #2: To calculate the absorbed dose delivered by 1311-8H9 to tumor
relative
to normal organs.
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
Background and significance
MoAb selective for tumors have therapeutic potential 1'z The introduction of
hybridoma technology by Kohler and Milstein in 19753 and the advances in
molecular
5 biologic techniques have greatly expanded the potential of MoAb in human
cancers.
Optimal targeting of MoAb demands high tumor antigen density with homogeneous
expression, lack of antigen modulation on tumor cell surface, adequate
vascularity of
tumor to allow deep penetration, minimal toxicity on normal tissues, low
reticulo-
endothelial system (RES) uptake, noninterference by circulating free antigens,
and low
10 immunogenicity. In practice, very few MoAb-antigen-tumor model systems have
fulfilled these stringent criteria. Recent clinical trials have shown
promising potentials
of MoAbs. Anti-CEA antibody in colorectal cancer,4, anti-CD20 antibodies in
lymphomas anti-HER2 antibodies in breast cancer,6 anti-tenascin antibodies in
glial
brain tumors, MoAb M195 against CD33 in acute leukemia$ and anti-TAG-72
15 antibodies in colon cancer9 have demonstrated efficacy in clinical trials.
Our laboratory
has developed the MoAb 3F8 which targets the ganglioside GDZ overexpressed on
NB.
3F8 has been shown to have a high specificity and sensitivity in the
radioimmunodetection of minimal residual disease (MRD) in patients with
NB,1° and a
significant impact when used as adjuvant therapy.l l 1311 has been a common
isotope used
20 both for imaging and therapy purposes. Although not widely available, pure -
emitters
such as 9oY,12'13 alpha-emitting particles,la,ls such as ZllAt, ZlzBi and
213Ac have
attractive properties with promising biological effectiveness. Multiple
radioisotopes of
varying path lengths and half lives may be needed to enhance radiocurability
of both
bulk and microscopic diseases. More recent developments in immunocytokines
(e.g. IL-
25 2, IL,-12),16 bispecific antibodies for pretargeting strategies (e.g.
radioisotopes or
drugs),1~'1$ or T-bodies for retargeting immune cellsl~-zl have further
expanded the
potentials of antibody-based immunotherapies.
Brain tumor antigens Examples of tumor antigens expressed on glial tumors
include
30 neuroectodermal- oncofetal antigens eg. neural cell adhesion molecules
(NCAM),Zz
gangliosides (GD2, GM2, 3'-6"-iso LDl)z3,24 and neurohematopoeitic antigens
(Thy-1,
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
36
CD44 and splice variants).25_27 All of these antigens are present to varying
degrees on
normal adult and fetal tissues, and for some hematopoeitic tissues as well.
Notwithstanding the universal expression of NCAM by neuronal cells, anti-NCAM
MoAb UJ13A was shown to accumulate in gliomas by virtue of disruption of blood
brain
barrier loca11y2$ and another MoAb ERIC-1 showed clinical benefit in resected
glioma
cavities.29 Integrin-3, a 140kDa protein expressed on gliomas and
medulloblastomas and
not in normal brain, is a potential target (MoAb ONS-M21)3°, but it is
poorly expressed
among other tumor types.31 The extracellular matrix protein tenascin is
expressed in
50-95% of gliomas as well as on mesenchymal tumors, carcinomas, normal human
glial,
Liver and kidney ce11s.32 Anti-tenascin monoclonal antibodies 81C6,~ BC-2 and
BC-433
administered directly into tumor-cavities have shown efficacy in patients with
malignant
gliomas. More recent investigations have focused on growth factor receptors.
in
particular type III mutant epidermal growth factor receptor (EGFRvIII)
expressed on
52% of gliomas34 as well as breast and lung carcinomas.35 Given the
relationship of these
mutated receptors to their malignant potential, they may be ideal targets for
MoAb.
Although other glioma-specific antibodies with no cross reactivity with
nornlal brain
have been described (e.g. 6DS1, MabEp-C4),36-ss they have limited reactivity
with other
neuroectodermal or mesenchymal tumors, and data regarding cross-reactivity
with
normal tissues are not available. To date, with the exception of EGFRvIII, the
glial
tumor antigens described are either found on normal brain and/or normal
tissues,
restricted to specific tumor types, or found in intracellular
compartments/extracellular
matrix which can limit their clinical utility for targeting to single cells or
spheroids.
Sarcoma antigens Optimal tumor antigens, similarly, have not been defined for
the
large family of sarcomas. Although the MyoD family of oncofetal proteins are
specific
to rhabdomyosarcoma, they are localized to the nucleus and therefore do not
offer targets
for antibody-based therapy.3~ The ES family of tumors can be differentiated
from other
small blue round cell tumoxs of childhood by MoAbs recognizing glycoprotein
p30/32
coded by the MIC2 oncogene. However, this protein is expressed on normal
tissues (e.g.
T-cells)4° greatly limiting the utility of MoAb in marrow purging,
radioimaging or
radiotherapy.41 Membrane targets on OS include GD2,42 glycoprotein p72,43
CD5544
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
37
erB2/neu45 and the antigen recognized by the MoAb TP-3.46 CD55 is decay-
accelerating
factor, a ubiquitous protein on blood cells and most tissues to prevent
complement
activation. Clearly MoAb directed at CD55 would have significant limitations
for in vivo
targeting. The degree of tumor heterogeneity (e.g. erbB2 in OS) may also limit
the
efficacy of MoAb-targeted approach. The presence of GD2 on pain fibers causes
significant pain side effects in clinical trials. Nevertheless, this side
effect is self limited
and this cross-reactivity did not interfere with the biodistribution and
clinical efficacy of
specific MoAb (see preliminary results). Nevertheless, GD2 is generally low or
absent
in RMS, ES, PNET, and many soft-tissue sarcomas. In addition, the presence of
GD2 in
central neurons can limit its application in tumors arising or metastatic to
the brain. Our
laboratory has generated a novel MoAb 8H9 by hyperimmunizing female BALB/c
mice
with human NB 4' 8H9 recognizes a unique surface antigen homogeneously
expressed
on cell membranes of a broad spectrum of tumors of neuroectodermal,
mesenchymal and
epithelial origin , with restricted distribution on normal tissues (see
preliminary
results).4g
The availability of an antibody with broad specificity for pediatric tumors
will
facilitate several lines of clinical investigations. In vitro, such antibodies
will be
extremely useful for (1) detecting lymph node or marrow metastasis,4~ (2)
enrichment/isolation of circulating tumor cells for RT-PCR detection
strategies,s° (3)
purging of bone marrow before autologous bone marrow transplantation,sl (4)
purging of
ex vivo activated T-cells prior to adoptive cell therapy. In vivo its utility
can go beyond
its diagnostic capability. When chimerized with a human- 1Fc tail, it becomes
tumoricidal through complement-mediated, and antibody-dependent cell-mediated
cytotoxicities.52 Through single-chain Fv constructs, new fusion proteins can
now be
delivered to tumor sites (e.g. IL-2, IL-12, toxins, or enzymes). Bivalent scFv
and
tetravalent scFv can be engineered to improve avidity.53 Bispecific scFv can
be
constructed to engage cells and proteins in various targeting strategies (e.g.
pretargeting).~~'18 ScFv can also be used in T-bodies to retarget T-cells, a
powerful
technique to increase clonal frequency and bypassing the HLA requirement of
TCR
functions.l~-Zi Furthermore scFv-fusion proteins (e.g. CD28, zeta chain)
transduced into
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
38
T-cells can greatly enhance their survival following activation.21 Even more
importantly, the ability of such cells to proliferate in contact with tumor
cells can further
amplify the efficiency of T-cell cytotherapy.
Radioimmunoscintigraphy can test if an antibody-antigen system has targeting
potential. Using radioiodines and technetium we have demonstrated the utility
of the
GD2 system for targeting in the last decade. This information has been
translated into
treatment strategies using both unlabeled and 1311 labeled antibody 3F8.
Dosimetry
calculations have allowed quantitative estimates of therapeutic index when
cytotoxic
agents are delivered through antibody-based methods. Uptake (peak dose and
area under
the curve AUC) in specific organs relative to tumor can be measured. These
studies are
resource intensive and to be done well, require laboratory, radiochemistry,
nuclear
medicine, medical physics and clinical resource support, as well as
substantial personnel
effort. In pediatric patients, issues of therapeutic index may be even more
pressing
given the potential of late effects of treatment. In addition, despite the
potential life-
years saved for pediatric cancer, orphan drugs are not economically attractive
for most
industrial sponsors. These circumstances have made the initial stages of
clinical
development even more stringent and relatively more difficult to accomplish.
Patient monitoring and correlative laboratory studies Pharmacokinetic studies
are
crucial in our understanding of antibody targeting, its toxicity and its
efficacy.
Radioimmunoscintigraphy uses the trace label principle and gamma imaging to
define
the distribution of a specific antibody in various human organs. It provides
estimates of
antibody (and radiation) dose .delivered to blood, marrow and major organs.
The
continual development of improved software and hardware for calculating
antibody
deposits in tissues is critical in implementing these studies (see preliminary
results). The
quantitative relationship of free circulating antigens (if present) and
biodistribution of
MoAb needs to be defined. The formation of human-anti-mouse antibody (HAMA)
response will clearly affect the in vivo properties of these antibodies.
However, the
induction of the idiotype network (see preliminary results) may have potential
benefit in
the long run. These parameters need to be monitored. These in vitro assays
will provide
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
39
important information in understanding and 'optimization of future use of 8H9
and other
MoAb in the context of chemo-radiotherapy for a broad category of recalcitrant
tumors
in children, adolescents and young adults.
Memorial Sloan-Kettering has a strong track-record in the development and
clinical applications of monoclonal antibodies. Memorial Sloan-Kettering
Cancer
Center (MSKCC) is devoted to the research and clinical care of cancer
patients. The
Center has an extensive patient referral base, particularly within the tri-
state area. The
center has an established commitment and past record in the use of monoclonal
IO antibodies in the diagnosis and therapy of human cancers, including
melanoma, colon
cancer, and leukemias. Over the past 4 years we have an annual accrual of
around 45
new NB, 27 OSs, 58 brain tumors, 23 Ewing's/PNET, 18 retinoblastoma, 12
rhabdomyosarcomas, 16 sarcomas and 7 DSRT at MSKCC. We are confident that we
can accrue 60 patients within the next 2 years. In this past decade, we tested
the utility
of MoAb in the curative treatment of a lethal tumor (metastatic stage 4 NB in
children).
For this orphan disease, the lack of corporate/pharmaceutical sponsor has made
our
progress slow and difficult. Nevertheless, we made the following observations.
(1)
MoAb can extend the progression-free period in a cancer that was uniformly
lethal two
decades ago. (2) It is feasible to integrate MoAb into standard chemo-
radiotherapy
strategies, in order to derive maximal benefit from all available modalities.
(3) Immune
based therapies can be administered safely in the outpatient setting, thus
reducing
expensive in-patient costs and maximizing time in the home environment. (4)
MoAb can
induce idiotype network, a potential endpoint that underlies the biology in
maintaining
continual clinical remission. (5) GD2 is a useful marker of MRD, and specific
MoAbs
are highly efficacious in monitoring and purging of tumor cells. (6) Novel
bioengineering strategies have been developed for the GD2-3F8 antigen-antibody
system
which axe directly applicable to other MoAbs (single chain Fv,s4 and T-
bodiesss).
During this period, >240 patients have been treated at Memorial Hospital with
the
antibody 3F8. A total of >3500 doses of unlabeled 3F8 have been given, 250
injections
of 1311-3F8 for imaging, and 372 injections of 1311-3F8 for therapy. Although
there were
side effects, there were no lethal sequella during or immediately after
antibody
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
administration. 3F8 treatment is now routinely done in the outpatient clinic.
Extending
these findings to a second antigen-antibody system, especially one that will
target to a
broader spectrum of pediatric solid tumors is a priority. The murine IgGl
antibody 8H9
has obvious potential in monitoring and purging of MRD,
radioimmunoscintigraphy, and
5 radioimmunotherapy (both intravenous or compartmental). If our proposed
study
produces favorable results, i.e. selective tumor uptake at optimal AUC ratios
(Tumor:
tissues/organs), radioimmunotherapy can be explored for some of these solid
tumors.
More importantly, further development of the antibody would involve a major
effort in
humanizing and further genetic engineering to improve effector functions.
Progress report and preliminary results:
GDZ-specific MoAb-based targeted therapy: a curative approacli to a pediatric
solid
tumor: metastatic NB Improved understanding of the biology of NB has reshaped
our clinical approach to this cancer. Non-infant stage 4 NB remains a
therapeutic
challenge despite four decades of combination chemotherapy. Similar to many
cancers,
MRD state can be achieved in patients with NB after intensive induction
therapy.56's~
Unfortunately, the transition from MRD to cure was a formidable hurdle.s~
Targeted
immunotherapy besides being more specific and less toxic, may supplement what
chemoradiotherapy has not accomplished.s$,s9 Disialoganglioside Goz is a tumor
antigen well suited for targeting therapy because (1) it is expressed at a
high density in
human NB, is restricted to neuroectodermal tissues and is genetically stable,
unlike other
tumor antigens such as immunoglobulin idiotypes;~° (2) although it
circulates in patients'
serum, it does not interfere with the biodistribution of specific antibody
(e.g. 3F8),
allowing excellent tumor localization of NBs in patients;l° (3) it is
not modulated from
cell surface upon binding to antibodies; (4) it is expressed homogeneously in
human NB,
with little heterogeneity within tumors and among patients. Several antibodies
against
GD2 antigen has been described (3F8, 14.G2a, 14.18).4~'~1 In vitro they can
target
lymphocytes,6a,s3 granulocytes,sa,sa,6s complement,~~,~~ activated
monocyteslmacrophages,~$'~~, IL2,~°, isotopes,lo,s~,~1,~2 toxins,~3'~4
and superantigen.~s
Phase T and phase II studies have shown only modest efficacy,~6-84 marrow
disease more
likely to respond than bulky tumors.85 The major side effects included pain,
allergic
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
41
reactions and neuropathy.~8,85 With long followup, the role of these anti-GDZ
antibodies at
the time of M1ZD appears promising.
Radiolabeled anti-GDZ antibody 3F8 3F8 is a murine IgG3 MoAb directed at the
ganglioside GD2 expressed on human NB cells. In preclinical studies 1311-3F8
targeted to
human NB xenografts with exceptionally high %ID/gm. Intravenous 131I_labeled
IgG3
MoAb 3F8 produced a substantial dose dependent shrinkage of established NB in
preclinical studies. Dose calculations suggested that tumors that received
more than
4,200 rads were completely ablated. Marrow suppression was the dose limiting
toxicity.
In patient studies, it is not trapped nonspecifically by the
reticuloendothelial system and
penetrates NBs well (0.04 to 0.11% injected dose/gm).lo,a6 Because of the
intact blood
brain barrier, 1311-3F8 does not normally localize to brain, spinal cord or
penetrate the
surrounding CSF.1°,s9
131I_3F8 is more sensitive than conventional modalities, including
metaiodobenzylguanidine (MIBG) in detecting NB in patients. The
biodistribution of
1311-3F8 was studied in 42 patients (2 mCi per patient) with NB.1°
Comparison was made
with 1311-MIBG, ~~mTc-MDP (technetium-labeled methylene diphosphonate) bone
scan,
as well as CT or MRI. 1311-3F8 detected more abnormal sites (283) than ~31I-
MIBG (138)
or ~9mTc-MDP (69), especially in patients with extensive disease. In 20
patients with soft
tissue tumors demonstrated by CT/MRI, 1311-3F8 detected the disease in 18 of
them.
Upon surgical resection, the tyvo lsll_3F8-imaging-negative tumors revealed
ganglioneuroma, one showing microscopic foci of NB. In contrast, 1311-3F8-
imaging-
positive tumors were all confirmed as NBs. In 26 patients with evidence of
marrow
disease by antibody scans, 14/26 had confirmation by iliac crest marrow
aspirate/biopsy
examinations. Agreement between the measured tissue radioactivity and the
estimates
based on planar scintigraphy validated the initial dosimetry calculations. The
tumor
uptake in patients with NB was 0.08%-0.1% ID/gm. The calculated radiation dose
was
36 rads/mCi delivered to NB and 3-5 rad/mCi to blood.
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
42
isil_3F8 differentiated Gliomas from normal brain tissues 8'°88 In 12
patients with
brain tumors, 3F8 immunoscintigraphy was compared with 99mTc-
glucoheptonate/DTPA
planar imaging, Thallium 201 single photon emission tomography (SPECT), and
18FDG
positron emission tomography (PET). 10/11 malignant gliomas and 1/1 metastatic
melanoma showed antibody localization. No nonspecific uptake in normal brain
or CSF
was detected. Average plasma and total body clearance were 20 h and 47 h,
respectively.
Antibody localization was measured on surgical specimens and time activity
curves were
calculated based on modified conjugate views or PET. Radioactivity uptake in
high
grade glioma peaked at 39 h, which then decayed with a half life of 62 h.
Tumor uptake
at time of surgery averaged 3.5 %ID/kg and highest activity by conjugate view
method
averaged 9.2 %ID/kg (3.5 to 17.8).
Both primary and metastatic Small Cell Lung Cancer were detected by 131I_3F889
10 Patients with SCLC were imaged with lsil-3F8. Five patients previously
treated with
chemoradiotherapy were imaged with 2 mCi at the time of recurrence, while 5
patients
were studied with 10 mCi/1.73 m2 at the time of diagnosis. No significant
toxicities
were seen. All 10/10 tumors showed localization. Precision of localization was
confirmed by comparing SPECT and CT in the 5 patients injected with the 10 mCi
dose.
Average half lives for plasma and total body clearance were 15 h and 58 h,
respectively.
The tumor to non-tumor ratios appeared favorable based on the %ID/gm (see
below).
Table 3: %ID/kg after 131I_3F8 injection:
TumorDayHeartSmallSpleenLiverSpinalLargeBloodMuscleKidneyLungBoneOvariesAdrenal
BladderStomachTumorliver
sampled Bowel CordBowel mets
NB 4 1.7 1.71.7 2 2.2 2.43.13.1 3.1 3.6 4 4 5.7 6.7 6.7 40 -
ISCLC6 0.4 0.40.9 0.4- - - 0.2 0.9 0.5 - - 1.6 0.5 - 2 15
1 ~ 1 ~
Myeloablative doses of 1311-3F8 are effective for NB with minimal
extramedullary
toxicities. Based on the tracer dose dosimetry, the absorbed doses to liver,
spleen, red
marrow, lung, total body and tumor were 537, 574, 445, 454, 499 and 4926 rads,
respectively. The average rad/mCi were 2.3, 2.5, 2, 2, 1.9, and 13.7,
respectively. The
chemical toxicities of the antibody 3F8 have been studied in phase f
6°" and phase II
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
43
studies.11,9o Acute toxicities included pain, urticaria, fever and hypotension
which were
self limited. The radiological toxicities of 131I_3F8 were recently defined in
a phase I
dose escalation study. (6, 8, 12, 16, 20, 24, and 28 mCi/kg).91 Among 10
patients (pts)
with progressive disease evaluable for response, 2 cleared the marrow and 2
had partial
responses of soft tissue tumors. Average tumor dose was 150 rad/mCi/kg. Acute
toxicities of 1311-3F8 treatment included pain (20/24) during the infusion,
fever (20/24)
and mild diarrhea. All pts developed grade 4 myelosuppression. 22/24 pts were
rescued
with cryopreserved autologous bone marrow; one patient received GM_CSF; one
died of
progressive disease before marrow reinfusion. Hypothyroidism developed in
despite
thyroid blockade with oral SSI~I plus synthroid or cytomel. In the subsequent
phase II
study (N7, IRB94-1 l, figure 1), 1311-3F8 was used to consolidate >50 patients
at the end
of induction chemotherapy for their stage 4 NB diagnosed after 1 year of age.
Except for
hypothyroidism, there were no late effects of 1311-3F8 treatment.
iaaI_3F8 PET imaging was first successfully applied to NB9z Positron Emission
Tomography (PET) can offer advantages over planar or single photon emission
computed tomography (SPELT) imaging in the quantitation of spatial
radioactivity
distribution over time. lzal is a positron emitter with a 4_day half life. We
have studied
the quantitative capability of PET imaging with 124I,~3 and have used it for
scanning of
lza.I-labeled antibodies in animals and humans.~2,94,9s Using a brain PET
scanner
(PC4600, Cyclotron Corp.), with a relatively low resolution (FWHM=1.2 cm), we
demonstrated that quantitation of 1241 is possible (range examined was 0.4 to
4 uCi/ml).
Studies using lz4l in a rat tumor (4 gram) measured with this PET scanner were
within
8% of the ex-vivo measurement. Subsequently, two patients were studied on this
scanner
using lzal_labeled 3F8 antibody.88,~2 A 3-compartment model was used to study
the
kinetics of the antibody to provide an estimate of the binding potential of
3F8 antibody
for glioma. These quantitative studies have also allowed us to estimate the
radiation dose
to the tumor cell nucleus from low energy Auger electrons.$$ More accurate
quantitation of lzal is now possible with the GE body PET scanner with even
higher
resolution.
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
44
1311-3F8 therapy of leptomeningeal cancer96 While overt meningeal disease is
rapidly
fatal, microscopic deposits in the cranio-spinal axis will spread even if the
primary tumor
is eradicated. The potentials of antibody-derived ligands for the diagnosis
and therapy of
LM cancer have not been fully explored. GD2 is present on a broad spectrum of
human
tumors including medulloblastomas, high-grade astrocytomas, PNET, central NBs,
small
cell lung cancer, melanoma, sarcomas, leukemia/lymphomas and peripheral NBs,
many
of which have LM spread. Clinical trials using intravenous injections of anti-
GD2 MoAb
3F8 have not encountered long-term neurotoxicity in patients followed for up
to 13
years. Pharmacokinetic studies in rats showed that at least 50% of
intraventricular 131I-
3F8 was eliminated by bulk flow. When human melanoma leptomeningeal xenografts
were present, CSF radioactivity was retained and AUC (area under curve)
increased by
1.5 fold. AUC ratios of tumor to CSF, tumor to brain and tumor to blood were
14, 86,
and 64, respectively. These ratios improved to 15, 209 and 97, respectively,
if the rats
were pretreated with diuretics. Direct intraventricular administration of 30
mCi of lsll-
3F8 in cynomolgus monkeys did not induce clinical or histological toxicity.
Since GDz
tissue distribution (CNS and peripheral) in the cyllomolgus monkey is
identical to that of
human, the high radiation dose of IT 1311-3F8 (up to 82 Gy) to CSF in contrast
to blood
(<2 Gy) may translate into a meaningful treatment approach. Moreover, serum
antibody
against the MoAb (AMA) was 14-22 fold higher than in the CSF, thereby
accelerating
blood clearance (reducing blood radiation dose) without affecting CSF
pharmacokinetics.
Intra-CSF 1311-3F8 imaged GDZ-positive LM cancers successfully in patients.
The
pilot study included 5 patients who had a histologically confirmed diagnosis
of a
malignancy expressing GDZ with LM disease refractory to conventional therapies
or for
which no conventional therapy exists. Ommaya catheter placement, patency and
CSF
flow was evaluated by 111In DTPA studies. Five patients (ages 1-61 years) with
leptomeningeal or intraventricular melanoma, ependymoma, rhabdoid tumor (n=2)
and
retinoblastoma were evaluated. Active disease was identified by MR scans in 4
of 5 pts,
and by positive CSF cytology in 2. Doses of 0.7-1.9 mCi of 1311-3F8 were
injected by
Ommaya catheter. Acute side effects included fever (n=2), and headache (n=2)
both
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
treated with tylenol, and one episode of vomiting (n=1). One pt had an
elevated opening
CSF pressure that remained increased for 36-48 hours post-injection. There was
no
appreciable change in WBC, platelet counts, liver or kidney functions tests or
CSF cell
counts in all 5 patients.
5
The CSF radioactivity biological half life, distribution of radioactivity in
the craniospinal
axis, and dosimetry at plaques of disease and surrounding normal tissues were
determined by 1311-3F8 Single Photon Emission Tomography (SPELT). Peak CSF
values were achieved generally within the first hour of injection. The CSF
biological
10 half life was 3-12.9 hours, and was in close agreement with the SPELT (7.2-
13.1 hours).
Estimated dose to the CSF was 14.9-56 cGy/mCi by CSF samples and 15-31 cGy/mCi
by SPELT analysis. Focal areas of tumor uptake Were 27-123 cGy/mCi by SPELT
estimates. The radiation dose to the blood was 0.9-1.9 cGy/mCi based on blood
radioactivity measurements. Post-injection 1311-3F8 SPELT scans showed
distribution
15 throughout the subarachnoid space along the spinal cord down to the level
of the cauda
equina by 4 hours, and progressively over the convexity by 24 hours in all
patients.
Focal 1311-3F8 uptake was demonstrated in the ventricles, spine and midbrain
in 4
patients, corresponding to disease seen on MR. In the one patient who had no
MR
evidence of disease, 1311-3F8 clearance was most rapid (3 hours), with no
focal
20 accumulation observed on SPELT. Four patients with focal 1311-3F8 uptake
received 10
mCi of 1311-3F8 through the Ommaya reservoir as part of a treatment protocol
in a phase
I toxicity study. Except for grade 2 toxicities (fever, headache, nausea and
vomiting,
increase in intracranial pressure) and a breakthrough seizure, there were no
adverse side
effects during their initial treatment. One patient had a radiographic and
clinical
25 response. On repeat treatment 2 months later, with the same dose, a xapid
rise of
intracranial pressure necessitated a shunt placement. Although all 4 treated
patients
progressed, 3 are still alive (2+, 3+ and 9+ months from treatment).
Adjuvant anti-GDZ antibody 3F8 3F8 (without radioisotope) has also been tested
in
30 phase I and phase II studies.s$'~6'~~ Responses of metastatic NB in the
bone marrow were
seen. Another mouse antibody 14.G2a and its chimeric form 14.18 have also
induced
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
46
marrow remissions in patients with NB.83 Acute self limited toxicities of 3F8
treatment
were pain, fever, urticaria, hypertension, anaphylactoid reactions, as well as
decreases in
blood counts and serum complement levels, and in rare patients self limited
neuropathy.~'°9-99
Anti-GD2 antibody treatment of MRD in stage 4 NB diagnosed at more than one
year of age.ll Thirty-four patients (pts) were treated with 3F8 at the end of
chemotherapy. Most had either bone marrow (31 pts) or distant bony metastases
(29
pts). Thirteen pts were treated at second or subsequent remission (group I),
and 12 pts in
this group had a history of progressive/persistent disease after ABMT; 21 pts
(all on N6
protocol) were treated in ftrst remission following induction chemotherapy
(group II). At
the time of 3F8 treatment, all 34 patients had stable or minimal NB. Twenty-
three
patients were in CR, 8 in VGPR, 1 PR and 2 with histological evidence of
marrow
disease. Since microscopic occult NB could escape detection by conventional
radiographic studies, three additional sensitive methods were used to document
disease
prior to 3F8 treatment. They were 131I- 3F8 immunoscintigraphy, marrow
immunocytology, and molecular detection of marrow GAGE by RT-PCR. Fourteen of
34 patients were 131I-3F8 scan-positive prior to 3F8 treatment. Nine had
residual
disease in their marrow by immunocytology and 12 had evidence of marrow
disease by
RT-PCR. A total of 25/34 patients were positive for disease by at least one of
these three
methods. Thirteen patients are progression-free (40 to 148+ months from the
initiation
of 3F8 treatment); one other patient is alive with disease 61+ months after
3F8 treatment.
Both group T and group II patients achieved long-term progression-free
probabilities of
38%. Among the 20 patients whose disease progressed after 3F8, 3 in group II
had
isolated relapse in the CNS, a sanctuary site where antibody 3F8 could not
penetrate.86
Although the majority of patients were in CR/VGPR by conventional criteria
right before
3F8 treatment, 74% had evidence of disease by the more sensitive methods
(immunoscintigraphy with 131I-3F8, bone marrow immunocytology and RT-PCR).
When these tests were repeated subsequent to 3F8 treatment, 6/9 patients with
positive
immunocytology reverted to undetectable. Among the 12 GAGE-positive patients,
7
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
47
became negative for GAGE expression. Six patients had post-3F8 treatment 131I-
3F8
scans and a116 showed resolution or improvement.
Human anti-mouse antibody response (LLAMA) and patient outcome: Three
S patterns of HAMA response were identified. In pattern I, HAMA was not
detectable
during the 4-6 month followup period after first cycle of 3F8, 42% had no HAMA
response even after receiving 2-4 cycles of 3F8 over a 4-2S month period. In
pattern II,
HAMA was detected but rapidly became negative during the 4-6 month followup
period.
In pattern III, HAMA titer was high (>5000 U/ml) and persistent during the 4-6
month
followup period. When patients developed HAMA (>1000 U/mI) during a treatment
cycle, pain side effects disappeared. In the absence of HAMA (pattern I) or
when
HAMA became negative (pattern II), patients received repeat 3F8 treatments. In
the
presence of HAMA, subsequent 3F8 treatments had to be delayed. Thus, patients
in
group III did not get repeat 3F8 treatment during the first 4-6 months, and
had fewer
1 S total-cycles and fewer total-days of 3F8 treatment, while pattern I and II
patients were
comparable. Kaplan Meier analysis showed a survival advantage for those with
pattern
II HAMA response, i.e. a low self limiting ,HAMA response (73% for pattern II
versus
33% for pattern I, and 18% for pattern III). The probability of survival among
patients
with pattern II was significantly better than the pattern I and III patients
combined
(p<O.OS). For patients progression-free for at Least I2 months after the last
cycle of
chemotherapy, those receiving four 3F8 cycles had a PFS probability double
those
receiving less than 4 cycles (p = 0.08). When patients with pattern II HAMA
response
andlor four cycles of 3F8 were considered as a group (figure 1), their
survival was
significantly better than the other 20 pts (p < 0.001). We interpret these
findings to mean
a threshold (four 3F8 cycles, each 10-day cycles) plus a pattern II HAMA
response may
be necessary to maintain permanent tumor control.
Idiotype network is a possible mechanism for long term PFS. Since the HAMA
response was primarily anti-idiotypic (Ab2), we postulate that the subsequent
induction
of an idiotype network which included anti-anti-idiotypic (Ab3) and anti-GDZ
Ab3'
responses may be responsible for tumor control in patients. Their serum HAMA,
Ab3,
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
48
and Ab3' titers prior to, at 6, and at 14 months after antibody treatment were
measured by
ELISA. Long term PFS and survival correlated significantly with Ab3' (anti-
GDZ)
response at 6 months, and with Ab3 response at 6 and 14 months. Non-idiotype
antibody responses (anti-mouse-IgG3 or anti-tumor nuclear HCTD antigen) had no
apparent impact on PFS or survival. It appears that the successful induction
of an
idiotype network in patients maybe responsible for long term tumor control and
prevention of late relapse among N6 and N7 patients (figure 2). Even among
patients
treated on NS (with ABMT, figure 2), all of the survivors of bony and marrow
metastases have had imaging studies with 3F8 and had detectable idiotype
network by
ELISAIOO; similarly no late relapses were seen. While NS and N6 groups had no
relapses
after N 3 years from diagnosis or ~2 years from 3F8 therapy (including second
remission
group), among N7 patients, the relapse curve has leveled off even earlier,
around 2 years
from diagnosis.
Integration of 3F8 treatment into multi-modality tlierapy: N5, N6 and N7 for
stage
4 NB >1 year of age: From 1987 to 1999, N5, N6 and N7 protocols were designed
sequentially to test the clinical importance of dose intensity, 3F8, and 1311-
3F8 in
consecutive patients with newly diagnosed stage 4 NB. Most of them had very
high-risk
clinical and biologic markers, almost all were diploid/tetraploid and of
unfavorable
histopathology. Except for 1311-3F8 and autologous marrow transplant (ABMT),
chemotherapy and 3F8 are routine outpatient procedures. Evaluations at
sequential
endpoints compared favorably with predictions: primary tumor resectability,
overall
response, and progression-free survival (PFS). There were no late relapses
after 3.5 years
from diagnosis. For N6 (all survivors past 5 years) 40% axe progression-free;
for N7,
PFS is projected at 55% (p=0.02 when compared to NS). Causes of death included
disease progression, secondary leukemia, and isolated CNS relapse. Although
toxicities
included hearing loss and hypothyroidism which required correction, a curative
strategy
for stage 4 NB appeared to be within reach.
Neuroblastoma, 3F8 and GD2 provided us with the proof of principle that MoAb
may
have potential in the permanent eradication of MRD in the curative treatment
of solid
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
49
tumors in the younger population. Both RIT and idiotype-netowrk induction are
possible
with murine MoAb. We therefore undertook an extensive screening of MoAbs to
identify candidates with a broad reactivity with pediatric/adolescent solid
tumors, that
may have similar targeting potential as the antibody 3F8.
Novel antigen for MoAb targeting to solid tumors in children and young adults
Female BALB/c mice were hyperimmunized with human neuroblastoma according to
previously outlined methods.47 Splenic lymphocytes were fused with SP2/0 mouse
myeloma cells line. Clones were selected for specific binding to neuroblastoma
on
ELISA. The 8H9 hybridoma secreting an IgGl monoclonal antibody was selected
for
further characterization after subcloning.
Normal and tumor tissue reactivity of 8H9 antibody Frozen sections from 315
tumors
with histologically confirmed diagnoses of cancer were analyzed for
immunoreactivity
with MoAb 8H9. (Tables 5 and 6) 15 histologically normal human tissues and 8
nornial
monkey tissues were also analyzed ().
Table 5
Neuroectodermal No. 8H9 positive
Tumors
NB 87 84 97
Brain Tumors
1. Glial Tumors
Glioblastomas 17 15 88
multiforme
Mixed Glioma 4 3
Oligodendroglioma 11 4 36
Astrocytoma 8 6 75
Ependymoma 3 2
2. Primitive
PNET
Medulloblastoma 2 2
3. Mixed
Neuronoglial 2 1
tumor
4. Other
Schwannoma 3 3
Meningioma 2 2
Neurofibroma 1 1
Melanoma 16 12 75
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
Ewing's Family of tumors 21 21 100
TOTAL 177 156 88
Table 6
Mesenchymal Tumors No. 8H9 Reactive
Rhabdomyosarcoma 26 25 9G
Osteosarcoma 2G 25 96
Desmoplastic small 34 32 94
round cell tumor
Malignant fibrous histiocytoma1 1
Synovial sarcoma 2 1
Leiomyosarcoma 4 4
Undifferentiated sarcoma2 2
TOTAL 95 90 95
Table
7
CARCINOMASNo. 8H9 Reactive
Breast 12 4 33
Bladder 4 1
Adrenal 2 1
Stomach 1 1
Prostate2 1
Colon 2 1
Lung 1 1
Endometrium1 1
Cervix 1 0
Renal 1 1
TOTAL 27 IZ 44
Table 8
Other TumorsNo. 8H9 reactive
Hepatoblastoma4 3
Wilm's 8 7
tumor
Rhabdoid 3 3
tumor
Paraganglioma1 1
TOTAL 16 14 88
Heterogenous, non-specific cytoplasmic staining was noticed in normal human
pancreas,
S stomach, liver and adrenal cortex which was diminished when 8H9 F(ab')2
fragments
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
51
were used instead of the whole antibody for immunostaining. None of the other
human
tissues showed reactivity with 8H9. In particular normal human brain tissue
sections
including frontal lobe, spinal cord, pons and cerebellum were completely
negative.
Normal tissues from cynomolgus monkey also demonstrated similarly restricted
reactivity with nonspecific staining observed in stomach and liver (Table 4).
The
majority of neuroectodermal and mesenchymal tumors tested showed positive
reactivity
with 8H9, epithelial tumors to a lesser extent. 8H9 immunoreactivity was seen
in a
characteristic, homogenous, cell membrane distribution in 272 of the 315 (86%)
tumor
samples examined. 88% of neuroectodermal tumors, 95% of mesenchymal tumors and
44% of epithelial tumors tested positive with 8H9 (Tables 4-8)
Table 4
Tissues Human Cynomolaous
Frontal lobeNegative Negative
Pons Negative Negative
Spinal cord Negative
Cerebellum Negative Negative
Lung Negative
Heart Negative
Skeletal Negative
muscle
Thyroid Negative
Testes Negative
Pancreas cytoplasmic
staining
Adrenal cortexcytoplasmiccytoplasmic
staining staining
Liver cytoplasmiccytopiasmic
staining staining
Stomach Negative
Sigmoid colonNegative
Bone Marrow Negative
Kidney ~ Negative Negative
Indirect immunofluorescence 8H9 immunoreactivity in 34 NB, melanoma, RMS,
small
cell lung cancer, OS, glioblastoma, leukemia, breast cancer and colon cancer
cell lines
was tested using indirect immunofluorescence. Moderate to strong cell membrane
reactivity with 8H9 was detected in 16/16 NB, 2/2 melanoma, 2/2 RMS, 1/1
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
52
glioblastoma multiforme, 3/3 breast cancer, and 1/1 colon cancer, 2 of 3
Ewing's/PNET,
and 2 of the 3 OS cell lines. The small cell lung cancer cell line HTB119
tested negative
with 8H9 as did Jurkat T-ALL cell line and EBV transformed lymphoblastoid
cells.
Normal human bone marrow mononuclear cells (n=80) and hepatoc es (n=2) had no
reactivity with 8H9. Hepatocytes were isolated from human cadavers and stained
with
8H9. In contrast to anti-cytokeratin 18 and anti-HLA-class-1 antibodies which
reacted
strongly with surface antigens, 8H9 staining was equivalent to control
antibody.
Antigen modulation 8H9 binding to neuroblastoma line (NMB7), rhabdomysarcoma
(HTB82) and OS (LT2OS) (measured by indirect immunofluorescence) did not
diminish
significantly after 48 hr of incubation at 37°C. During the same
period, binding to HLA
(MoAb HB95) diminished by 85% and to GD2 (3F8) by 55%, respectively (Figure
3).
Electron microscopy using gold-labeled antibodies will be more definitive in
tracking
antibody internalization, a process clearly important for immunotoxins to be
effective.
Enzyme-sensitivity There was a pronase dose-dependent reduction in reactivity
with
8H9 with 75-85% loss of immunofluorescence at a final Pronase concentration of
0.3
mg/ml (Figure 4). There was no appreciable loss of reactivity with 3F8
(specific for the
ganglioside GD2) on NMB7 cells. Furthermore, the 8H9 antigen was not sensitive
to
neuraminidase or phosphatidyl-inositol specific phospholipase C (data not
shown).
Biochemical Characterization of the novel antigen recognized by 8H9 Using a
nonradioactive cell surface labeling technique, the antigen was
immunoprecipitated and
analyzed on a SDS-PAGE.IOi In brief, NB NMB7 or OS U2OS cells were
biotinylated
using biotin-LC-NHS, lysed, precleared with protein-G sepharose, reacted with
antibody
8H9 and then immunoprecipitated in fresh protein G sepharose. Antigen was then
dissociated from the gel and separated by SDS-PAGE. Following transblotting
onto
nitrocellulose membrane, the protein bands were detected with HRP-strepavidin
and
visualized by ECL. A band of 90 kDa under non-denaturing conditions and 96 kDa
in
the presence of 2ME was found.
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
53
Table 9: %ID/gm
TISSUE NB RMS
Time 24 172h
h
S Tumor 8.3 5.3
Brain 0.2 0.1
Heart 2.1 0.8
Lung 0.8 1.4
Kidney 2.3 0.7
IO Liver 7.5 0.6
Spleen 6.7 0.6
Bladder 1.0 1.1
Stomach 0.3 0.5
Sm Intestine0.3 0.3
I Lg Intestine0.4 0.2
S
Muscle 0.2 0.2
Femur 0.7 0.3
Adrenal 1.0 0.3
Skin 0.2 0.4
20 Spine 1.7 0.4
Blood 3.8 3.3
Rat Anti-idiotypic MoAb specific for 8H9 By immunofluorescence the antigen was
sensitive to low temperatures. 'In view of the lability of the antigen, we
chose to
25 synthesize anti-idiotypic antibodies as surrogate antigen-mimics, in order
to allow in
vitro monitoring of the antibody immunoreactivity e.g. after iodination of
antibody 8H9.
LOU/CN rats were immunized with protein-G purified 8H9 precipitated with goat-
anti-
mouse Ig, emulsified in CFA. Following in vitro hybridization to the myelomas
SP2/0
or 8653, 3 IgG2a clones (2E9, 1E12, and 1F11) were selected for their high
binding and
30 specificity. When tested against a panel of 23 other myelomas or hybridoma
antibodies,
no cross-reactivity was found. The anti-idiotypic hybridomas were cloned and
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
54
antibodies produced by high density miniPERM bioreactor from Unisyn
Technologies
(Hopkinton, MA). The anti-idiotypic antibodies are further purified by protein
G
(Pharmacia) affinity chromatography. To further prove that these anti-
idiotypic
antibodies are antigen-mimics, we immuno-enrich phagemids and screen scFv on
solid
phase anti-idiotype, and successfully isolate a number of 8H9-scFv with
similar binding
specificity to tumors as the parent 8H9 (see below).
Tumor localization in xenografted SCm mice SCID mice with NB (NB) xenografts
were injected iv with 100 ug 99mTc labeled 8H9. Blood clearance was studied by
blood
cpm at various intervals after injection. Mice were sacrificed at 24 hours and
tissue
uptake expressed as percent injected dose per gram (Table 9). Significant
uptake in the
reticulo-endothelial system in liver and spleen was seen only with ~~"'Tc-8H9;
none was
evident when 1311-3F8 was used. There was no significant difference between
~~"'Tc-
8H9 and 1311-8H9 biodistribution. When the specific activity of 1311-8H9 was
increased
from 5 to >20 mCi/mg, there was no degradation of tumor imaging or difference
in
biodistribution. In SLID mice xenografted with RMS (RMS) xenograft, following
iv
injection of 100 uCi of l2sl-8H9, selective tumor uptake was evident at 4 to
172 hrs after
injection, with a blood T%2 of 0.8 h and Tl/z of 26 h. Mean tumorltissue
ratios were
optimal at 172 h (for lung 4, kidney 7, liver 9, spleen 10, femur 16, muscle
21, brain 45).
Average tumor/blood ratio were 0.7,1.4 and 1.6, and tumor uptake was 9.53.4,
I3.3~1.5, and 5.30.9 % injected dose per grn at 24, 48 and 172 h,
respectively. Control
IgGl MoAb antibody 2C9 remained in the blood pool without localization to sc
RMS
xenografts. Tumor to normal tissue ratio was favorable [range 5-55]for 8H9
(solid bar,
figure 5) in contrast to control MoAb 2C9.
8H9-ScFv We have synthesized single chain antibody (scFv) from 8H9. Using
polymerase chain reaction splicing by overlap extension, variable regions of
the heavy
(VH) and light chains (VL) of 8H9 were joined by a polylinker (L) (gly4Ser)3
and
selected by phagemid expression. scFv was characterized by DNA sequencing,
western
blots, in vitro ELISA, immunostaining/FACS, and idiotype analysis. Using this
scFv as
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
a targeting unit, we are in the process of synthesizing scFv-h 1-CH2-CH3
chimeric,
scFv-m 3-CH2-CH3 chimeric, and T-bodies for retargeting T-cells.
Cell Populations Using 8H9-Magnetic Bead Immunoselection. ES is a small round
5 blue cell tumor of childhood characterized by a t(11,22) in most patients.
Because
survival remains suboptimal with standard therapy, many patients receive
autologous
stem cell transplant and current trials investigating adoptive transfer of
autologous T
cells in the context of inunune therapy are underway. However, approximately
50% of
patients with advanced disease have PCR detectable ES in peripheral blood
and/or bone
10 marrow and the administration of autologous cell preparations contaminated
with tumor
may contribute to disease relapse. To date, there is no method reported for
purging
contaminated hematopoietic cell populations or bone marrow preparations of ES.
Merino et al in the laboratory of Dr. Mackall at the Pediatric Oncology
Branch, NCI,
Bethesda, MD, successfully optimized 8H9 for immunomagnetic purging of ES. 8H9
15 bound to 9/9 of ES cell lines by flow cytometry. Binding to peripheral
blood
mononuclear T cell and B cell populations, as well as CD34+ cells from bone
marrow
was negative. Utilizing immunomagnetic selection, 8H9 was used to isolate ES
cells
from contaminated blood cell populations. Using real-time quantitative nested
PCR with
the Lightcycler instrument, purging efficiency was monitored by of t(11,22) RT-
PCR.
20 Contaminated specimens were reacted With 8H9 and then incubated with rat
anti-mouse
IgGl magnetic beads. The sample was then run over a Miltenyi Variomax negative
selection column. Recovery was approximately 70% of the total PBMC. RNA was
extracted from 10e7 cells from pre and post purge cell populations. Real time
quantitative PCR was performed with a level of sensitivity to one tumor cell
in 10e5
25 normal cells. A 2-log reduction of tumor cells was achieved at a
contamination of one
tumor cell in 10 normal PBMC and one tumor cell in 10e3 normal PBMC. Further
studies evaluating efficacy in clinical samples are underway. These results
demonstrate
a potential new approach for purging contaminated patient samples to be used
in the
context of autologous bone marrow transplant and/or imrnunotherapy trials for
ES.
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
56
8H9 purging of NB from marrow or blood cells In similar experiments using
Dynal
beads coated with human anti-mouse IgG (Dynal, Lake Success, N~5° EGFP
marked
NMB7 cells could be quantitatively removed in a one-cycle (either 8H9 or 3F8)
or 2-
cycle (8H9 followed by 3F8) immunomagnetic strategies (Table 10).
Research Design and Methods:
In this grant proposal, we will test if intravenous injections of iodine-131
labeled murine
MoAb 8H9 can detect primary and metastatic solid tumors. A total of 60
patients will be
accrued over a period of 2 years.
Specific aim #1: To define the level of agreement between 1311-gH9 and
conventional imaging modalities in the detection of primary and metastatic
solid tumors
in pediatrics.
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
57
1.1 STUDY DESIGN
This is an open-label single arm study of 1311-8H9, injected intravenously at
10 mCi11.73
m2 dose, after which patients will be imaged at approximately day 0 to 1, 2d,
3d and
whenever possible 6 to 7d for dosimetry calculations. Blood samples will also
be
obtained at least 12 times over the ensuing 7 days. Patients are eligible for
the protocol
prior to their surgical resection or biopsy of known or suspected tumor, or at
the time of
recurrent tumor. I3iI-8H9 injection plus imaging can be repeated in each
patient up to a
total of 3 times, but only if he/she has no HAMA and no allergy to mouse
proteins as
evidenced by a negative skin test.
1.2 PATIENT/SUBJECT INCLUSION CRITERTA_
Gender and Minority Inclusion for research involving human subjects:
Memorial Sloan Kettering Cancer Center has filed form HHS 441 (Re: Civil
Rights),
form HHS 641 (Re: Handicapped individuals), and form 639-A (Re: sex
discrimination).
In selecting patients for study in the proposed project, due notice is taken
of the NIH
Policy concerning inclusion of women and minorities in clinical research
populations.
The study population will be fully representative of the whole range of
patients seen at
Memorial Hospital. No exclusions will be made on the basis of gender or
ethnicity.
However, because of the nature of these cancers which tend to present in
children and
young adults, most the human subjects would be of the younger age group.
Based on a December 1998-November 1999 analysis of the patient population
accrued to
therapeutic clinical protocols, the racial distribution of these patients were
16.6% black,
Hispanic, or Asian, 78.2% white and 5.2% other or unknown. The gender was
55.9%
male and 44.1 % female. For the total patient population diagnosed and treated
at
MSKCC in 1996, 26% were black, Hispanic, Asian or Native American, 70% white
and
6% unknown or not responding. Of these patients, 38% were male and 62% female.
Participation of children: Children, adolescents and young adults are the
subjects of
this clinical trial because of the nature of these cancers. There is no age
limit.
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
58
1.3.0 EVALUATION DURING TREATMENT/INTERVENTION
1.3.1 After injection of radiolabeled antibody, 1-2 cc of blood in purple tops
(EDTA)
will be drawn at time 0, and around 15 min, 30 min, 1 h, 2h, 4h, 8h, 18h, 30h,
42h, 66h, and once on day 6 or 7. Samples should be dated and timed. These
samples are for pharmacokinetic and for dosimetry studies. Patients with
delayed
clearance will have one more imaging done between day 9 to 11.
Time Procedure
day -10 start daily oral SSKI, cytomel for thyroid blockade
day 0 5 mCi of iodine-131 on 0.25 to 0.75 mg of 8H9*
blood samples at 0, and approximately 15 min, 30 min, Ih, 2h, 4h,
8h after injection
day 0 Gamma camera scan plus whole body counts
day 1 Gamma camera scan plus whole body counts
day 1 blood samples at approximately 18h and 30h
day 2 Gamma camera scan plus whole body counts
day 2, 3 blood samples at approximately 42h and 66h
day 5(or 6 or 7) Gamma camera scan plus whole body counts and blood sample
day 9(or 10 or I 1) if slow clearance
Gamma camera scan plus whole body counts and blood sample
day 14 Oral SSKI and cytomel discontinued
*Premedication with acetaminophen and diphenhydramine.
1.3.2 Patients will undergo gamma imaging days 0, 1, 2 and 5 or 6 or 7 after
injection.
1.3.3 Blood for HAMA q 1-2 months
1.3.4 Tissue biopsy is recommended for regions of uptake by 8H9 imaging and
negative by conventional radiographic techniques.
1.4.0 BIOSTATISTICS
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
59
To measure the level of agreement between conventional imaging modality (CT,
MRI,
and nuclear scans) and antibody 8H9 imaging in known and occult sites of
disease. Index
lesions will be confirmed either by surgery or by disease-specific imaging
(e.g. MIBG
for NB). For each individual, the proportion of sites found by 8H9 imaging
will be
scored. Given that there will be confirmation by surgery or by disease-
specific imaging,
sensitivity analysis of 8H9 for each disease can be conducted. The probability
of
agreement or positive predictive value will be calculated. The 95% confidence
intervals
can be calculated within -~/- 31% for each disease (NB,~ RMS, ES/PNET, DSRT,
brain
tumors and other sarcomas). The study will be performed on a total of 60
patients (10
with NB, 10 RMS, 10 osteosacrcoma, 10 ES, 10 DSRT and 10 brain tumors plus
other
8H9-positive tumors). Estimates on the level of agreement and the level of
tumor uptake
will be computed separately in each disease group. We are not using Kappa
statistics for
testing the association between 1241-3F8 imaging and other imaging modalities
(CT,
MRI) since only patients with measurable or evaluable tumors will be eligible
for this
protocol. In other words, patients with no evidence of disease by conventional
studies
will be not eligible. Therefore we cannot estimate the probability of negative
8H9
imaging when conventional imaging studies axe negative, i.e. specificity
analysis.
1.5.0 PREPARATION OF 1311-8H9
8H9 is produced under GMP conditions and packaged in glass vials. 1311 is
purchased
from Amersham Inc. 8H9 will be labeled with radioactive iodine using iodogen T
method. The reaction mixture is filtered through an ion exchange (AG1X8)
filter
(Biorad) to remove free iodine. Protein incorporation is measured using TCA
precipitation or thin layer chromatography. Immunoreactivity is measured by 2
separate
methods (1) a solid phase microtiter radioimmunoassay technique previously
described,loa and (2) anti-idiotype peak shift method, where anti-idiotypic
antibody 2E9
is added at 50 to 1 molar ratio to 1311-8H9 for 30 minutes on ice with mixing.
The
percent cpm shifted on HPLC is a measure of immunoreactivity. Radioiodinated
8H9
has a mean trichloroacetic acid precipitability of >90%, and specific activity
of 1311-8H9
averaging 10 mCi per mg protein. Administration of 1311-8H9 is undertaken
within 1-2
hours of iodination to reduce the possibility of radiolysis. Antibody
radiolabeling is
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
carried out in the Central Isotope Laboratory under the supervision of Dr.
Ronald Finn,
according to FDA guidelines on radiolabeled biologics for human use.
1.6.0 Infusion of radiolabeled antibody preparation and monitoring of patient
5 response in immediate post-infusion period, including radiation safety
aftercare.
All radiolabeled MoAb preparations will be injected into patients by a trained
research
nurse or physician. Strict observance of appropriate radiation safety
guidelines will be
undertaken. The procedure will be explained to the patient thoroughly prior to
the
IO infusion by the physician, and appropriate pre-treatment (eg SSKI drops,
perchloracap)
checked. The radiolabeled antibody will be transported from the radiolabeling
facility to
the infusion area loaded into the infusion delivery system by the physician.
The
physician and nurse will be present throughout the infusion and in the post-
infusion
period.
The infusion procedure will consist of the radiolabeled antibody being
administered
intravenously either through a peripheral intravenous catheter or an
indwelling central
catheter over a 20 minute period. All patients will have vital signs monitored
prior to
and following the radiolabeled antibody infusion. Blood samples for
pharmacokinetic
calculation will be obtained immediately following the infusion, and at
various time
points thereafter as outlined above. The patient will be seen by a physician
daily while
hospitalized, and will be available for consultation (with appropriate
radiation safety
personnel) with an oncologist or nurse regarding issues relating to the
radiolabeled
antibody infusion or radiation safety. The patient will also be imaged in the
Nuclear
Medicine Department over the subsequent two week period, and all imaging
procedures
performed will be supervised by the physician to ensure that appropriate
studies are
obtained.
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
61
1.7.0 In vitro Radioimmunoassay, ELISA, and immunostaining
Quantitative in vitro assays on biologic fluids collected during the course of
clinical
research studies in individual patients that employ radiolabeled antibodies
will be carried
out. The methods provided will include gamma counting of blood samples and
HAMA
assays. HAMA titer in blood and serum will be correlated with the clearance of
1311-8H9
1.7.1 General counting procedures Aliquots of whole blood/plasma/serum
obtained
from patients infused with radiolabeled antibodies will be counted in a gamma
counter
with standards of known activity for determination of sample activity. Tissue
samples
obtained by biopsy or surgery will also be counted in a garmna counter fox
determination
of % injected dose/gram tissue. Appropriate quality control procedures will be
observed
for counting instruments and tissue specimens.
1.7.2 Quantitation of HAMA by ELISA The presence of HAMA can modify the
biodistribution of 13~I-8H9. Although in naive patients HAMA is typically
undetectable,
in patients with prior history of exposure to murine antibodies or to 8H9, the
presence of
HAMA before and soon after 8H9 injection will need~to be monitored. In
addition, the
formation of HAMA was highly correlated with patient survival in the GD2-3F8
system,
we plan to measure the serum antibody titer 6 months and 12 months after 8H9
exposure.
The ELISA method has been described previously.ll Using F(ab')2 fragments
derived
from the three anti-idiotypic antibodies (2E9, 1E12, and 1F11), serum Ab3 will
also be
monitored as previously demonstrated for the GD2-3F8 system.'o3,~04
1.7.3 Quantitation of free circulating antigen Since the biodistribution of
8H9 will
be greatly affected by any soluble antigen, patient sera before antibody
injection will be
analyzed for antigenemia using an ELISA inhibition assay using a modification
of
previously described method.los Microtiter wells are coated with anti-idiotype
MoAb
2E9. Serial serum dilutions are used to inhibit the binding of biotinylated
8H9, which
can be detected by peroxidase-streptavidin. Upon washing, color reaction is
performed
at room temperature using hydrogen peroxide as substrate and o-
phenylenediamine
(Sigma, St. Louis, MO) as chromogen. After stopping the reaction with 30 u1 of
SN
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
62
sulfuric acid, optical density of the wells are then read using MRX microplate
reader
(Dynex, Chantilly, VA) and antibody titer calculated in units/ml.
1.7.4 Immunostaining of tumor tissues Tumor tissues will be tested for antigen
expression using methods previously described.~4
Anticipated results and potential pitfalls The injection of 1311-8H9
intravenously or
intrathecally into cynomolgus monkeys were well tolerated. Although we do not
anticipate any untoward side effects, patients will be closely monitored
during the
antibody infusion with oxygen, antihistamines, epinephrine, and hydrocortisone
at the
bed side. After the completion of antibody injection, patients will be
observed for at
least 1 hour before discharge from the clinic. Patients with unexpected grade
3-4 (other
than urticaria, self limited blood pressure/pulse/temperature changes) or any
life-threatening toxicity will be reported immediately to the IRB and FDA.
Given the
lability of the antigen in the cold (whether free or cell-bound),
immunoreactivity and
soluble tumor antigen will be assayed using the anti-idiotype as the antigen-
mimic. The
anti-idiotypic antibodies are rat IgGl MoAb puxified by acid elution from
protein G
affinity columns. They have remained stable despite acid treatment, buffer
changes and
freezing and thawing. Soluble antigens can interfere with tumor targeting. In
vitro,
patient serum did not inhibit binding of 8H9 to its anti-idiotype. Indirect
immunofluorescence of a spectrum of cell lines showed persistence of antigen
and
antibody on the cell surface at 37°C over days. In xenograft
biodistribution studies, there
was no evidence of antigen shedding that interferes with tumor imaging.
Although
interference of 8H9 biodistribution by soluble antigen is unlikely, we will
document the
absence by the ELISA inhibtion assay. HAMA response within the first twa weeks
after
MoAb injection is rarely observed among our patient population, partly because
of the
intensity of the chemotherapy they received. However, some are expected to
mount a
HAMA response when they are imaged a second time. Clearly their HAMA will be
monitored before and after injection in order to intezpret the biodistribution
results.
Because of this sensitization, these patients may not be eligible for
subsequent MoAb
therapies (as stated in the consent form). However, we hypothesize that this
HAMA
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
63
response will help induce the idiotype network, which may have benefit on
patient
survival, analogous to our success with the murine 3F8-GD2 system we described
in
preliminary results and progress report.
Interpretations and implications The ability of 8H9 to detect a broad class of
primary and metastatic solid tumors will be the first step in defining the
clinical utility of
MoAb 8H9 in vivo. Besides being a useful diagnostic tool, its therapeutic
potential will
need to be explored. Clearly the amount of antibody deposited in various
organs need to
be taken into account if these antibodies are used to deliver radioisotopes,
enzymes or
drugs. Chimeric antibodies with improved Fc effector functions and reduced
immunogenicity will also be explored. Immunocytokines and T-bodies axe also
potential
steps in future development of these agents.
Specific aim #2: To Estimate the radiation dose per mCi of 1311-8H9 delivered
to
tumors and to normal organs in patients.
To obtain data necessary for patient dosimetry, patients will be injected,
intravenously,
with 1311-8H9 according to their surface area, i.e. 10 mCi/I.73m2. A total of
three or
four gamma camera images will be obtained within a 1 to 2 week period
following
injection. The following schedule is recommended but may be altered, if
necessary: 1-4
h after injection (day 0) and then again on days 2, day 3, and day 6 or 7. If
warranted,
due to slow clearance kinetics, imaging on days 9, 10 or 11 may also be
performed.
Using this schedule weekend imaging may be avoided regardless of the weekday
injected. Scan types and imaging parameters are listed below:
2.1 Data collection:
SPOT and SPECT images will be collected over pre-selected "index" tumor
lesions, as
identified from previously obtained CT or MR images.
2.1.1 Blood collection Blood samples will be collected as follows: prior to
injection,
and at 0, 15, 30 min, then 1h, 2h, 4h, 8h, 18h or 30 h, 42h, 66h, day 6 or 7
following the
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
64
injection. Plasma or serum will be collected and counted from each sample and
the
results will be expressed as per cent of the injected radioactivity per L
serum or blood
volume.
ctati~0ic~~' view I~PC~TI
HEHR collimation
I O to 20 min acquisition time
dual-window acquisition for scatter correction
128 x 128 x I6 matrix size
CPFC"T
HEHR collimation
6 degrees or 64 views in stop and shoot, elliptical orbit mode
1 to 4 min/view (0.5 to 2 h acquisition time on a dual-headed camera)
dual-window acquisition for scatter correction
64 x 64 x 16 matrix size I
whole-hnelv cween IRWRFPI
high-energy, high-resolution (HEHR) collimation,
8 to 12 cm/min sweep speed (20 to 25 min acquisition time)
dual-window acquisition for scatter correction
256 x 1024 x 16 matrix size
0 X X
1,2 X X X
5, 6 or 7 X X
9,10, or 11 X X
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
2.1.2 Pharmacokinetics Modeling Blood time-activity curves from serial blood
samples and from ROI's around sequential SPECT images of the heart (when
available).
This data will be fitted, together with the whole-body clearance kinetics, to
a
pharmacokinetic model of antibody distribution. Previously developed models
have been
5 used for this type of analysis, further details regarding the approach have
been
published. l 06
2.1.3 Patient-specific dosimetry (3D-ID) The pharmacokinetic data obtained
from
SPECT and planar imaging and blood sampling will be combined with anatomical
10 imaging information (MR or CT) to estimate the absorbed dose to tumor and
selected
normal organs that would be expected from a therapeutic injection of 13II_8H9.
The
methodology for this has been previously described.lo~-i is
2.2 Tumor volume determinations Tumor volumes will be determined from CT or
15 MRI when available. Patients with known disease at other sites are imaged
in additional
areas. All CT images will be transferred for display in 3D-ID; images
collected at
MSKCC will be transferred digitally, film from other institutions will be
scanned using a
Lumisys digital film scanner. Using 3D-ID, the consulting radiologist will
review the
images with the research technician. The reseaxch technician will then draw
contours
20 around the tumor regions; the contours will be reviewed by the consulting
radiologist and
adjusted, as needed. In some cases, disease may be represented by a collection
of very
small positive nodes; in those cases a contour around the group will be drawn
and used
in the volume assessment. Volume determination using 3D-ID is performed by
summing
the areas of regions that have been defined by the user on all slices making
up the tumor.
25 This general approach has been previously validated for CT. Although
potentially
labor-intensive, such a tumor outline-specific method is significantly more
accurate than
techniques based upon greater and minor diameters (i.e., ellipsoidal modals)).
The errors
associated with CT-based volume estimation and the factors influencing these
errors
have been examined and will be considered in the volume determinations
described
30 above. A reliable total-body tumor burden will not be achievable for all
patients, either
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
66
because of the small volume of disease, or for cases in which lesions detected
by SPECT
are not visible by CT.
2.3 Red marrow dosimetry Bone marrow dosimetry will be performed according to
the recommended guidelines, described in the AAPM recommendations,116 i,e.
blood
time-activity curves will be multiplied by the appropriate factor (0.2 - 0.4)
to derive
marrow time-activity curves and absorbed dose to red marrow. S-Factors
provided in
MIRDOSE 3 will be used for the calculations. This data will be compared with
direct
measurement of the marrow activity from ROI's drawn over marrow cavities on
SPECT
images. The quantitative capability of SPECT will allow us to verify the
accuracy of
bone marrow dosimetry determined from activity levels, and the rate of
antibody
clearance from marrow, from the standard analysis of serial blood samples.
2.4 Three-dimensional dosimetry To perform 3D dosimetry, it is first necessary
to
register a set of nuclear medicine images (SPELT), depicting the radiolabeled
antibody
distribution to an anatomical imaging modality (CT or MRI). We have extensive
experience with the clinical implementation of the Pelizzari and Chen
method.ll~ This
technique requires that the user delineate the same surface on both sets of
imaging
modalities. When necessary, a SPELT transmission study is performed to obtain
the
appropriate surface. The program attempts to maximize the correlation of a set
of
several hundred points on the surface as identified on one scan (the "hat"),
with a solid
model of the same surface derived from the other scan (the "head"). A non-
linear
least-squares search is used to minimize the sum of the squares of distances
from each
"hat" point to the nearest point on the "head" surface. The coordinates of the
"hat" are
translated, rotated and scaled to provide the best fit. Users may control
which
parameters are varied during the search. The final set of transformations are
then used to
convert the coordinates of one image into those of the other. Phantom studies
indicate
that the Pelizzari and Chen technique for registration of SPELT to CT is
accurate to
within 3mm. The Nuclear Medicine Service at MSKCC has performed such
registration
for over 100 patient studies. The Pellizari and Chen package has also been
used for
thoracic and abdominal study registration by Chen and his collaborators at the
University
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
67
of Chicago (personal communication). Both the Chicago group and us have also
included
contours for liver and/or spleen along with the body contours. This further
improves
registration by providing more contours for the minimization algorithm. In
some cases, a
radioactive band has also been used as an aid to registration.ll~ We are
currently
comparing this method with alternative algorithms for image registration fox
the whole
images. l m-l zo
Correlated serial SPECT images can be used to , determine cumulative activity
distributions by fitting and integrating an exponential uptake and/or
clearance to the
specific activity within an R~I over the tumor or organ. The variation in
activity within
individual voxels can be taken into account, through a weighted sum of the
counts/activity within the corresponding voxel over time. Given such a
distribution of the
cumulated activity, a software package, 3D-ID, has been developed, to
calculate the dose
distribution. Target contours are drawn on side-by-side enlarged SPECT and
CT/MR
image slices that are selected from a scrollable image display. Contours drawn
in one
modality.simultaneously appear in the other. The user may switch between
modalities
by positioning the cursor in the appropriate window. This provides for the
simultaneous
use of both imaging modalities to define tumor (e.g. using SPECT) and normal
organ
(using CT/MR) contours. The dose to all voxels within the target volume is
obtained by
convolving the activity distribution with a point kernel table of absorbed
dose versus
distance. Patient-specific S-factors may be calculated by defining source
organ contours
and assigning unit activity to all voxels within each source. The "dose" to a
given taxget
is thus the patient-specific S-factor. Dose histograms and patient-specific
organ and
tumor S-factors generated using 3D-ID in combination with SPECT will provide
important information in understanding tumor response and organ toxicity in
radioimmunotherapy.
Photon dose kernels for 14 radionuclides of interest in internal emitter
therapy have been
recently published.lz. Explicit expressions of radionuclide photon dose
kernels,
necessary for three-dimensional dosimetxy, were not previously available. We
recently
described the overall structure and methodologies of a software package for
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
68
three-dimensional internal dosimetry (3D-ID) calculations.to7,ns A series of
software
modules that address the logistical issues of performing patient-specific
three-dimensional dosimetry were detailed. Software tools have been developed
to
combine images from different modalities, define regions-of interest using
available
mufti-modality data and identify source and target volumes for dosimetry. A
point-kernel based dosimetry calculation has been implemented and several
different
approaches for displaying the spatial distribution of absorbed dose in a
biologically
pertinent manner were also described. The dose calculation, itself, was earned
out in a
separate module, so that different calculation schemes including Monte Carlo,
may be
used with 3D-ID.
2.5 Anticipated results and Pitfalls
The major sources of error in carrying out absorbed dose calculations are: 1.
Inaccuracies
in imaging-derived activity concentration estimates. 2. Mismatch between
standard
anatomy (used for dosimetry calculations) and individual patient anatomy. 3.
Assumption of uniformity in the spatial distribution of radioactivity on both
a micro (mm
to mm) and macro (cm) scale. When applying conventional (MIRD Committee)
approaches to estimating absorbed dose it is understood that the estimate is
derived from
a model which includes a certain number of assumptions. This appxoach has been
sufficient in estimating doses for diagnostic applications wherein typical
doses are
already far below toxicity. An objective of radioimmunotherapy, however, is to
treat to
normal organ tolerance. In such a scenario, accurate, patient-specific
dosimetry is
critical. The dosimetry methodologies that will be used in this proposal
address point 2
and a portion of point 3; dose calculations are performed for individual
patient
geometries and the spatial distribution of radioactivity in tumor or normal
organs is
accounted for on a macroscopic (cm) scale. In the past using planar imaging
kinetics to
project the kinetics of the spatial distribution had additional pitfalls.
Although
SPECT-based activity determinations are a step forward, we expect these
inaccuracies in
imaging derived activity to be further reduced when I-124-8H9 Postron emission
tomography is used. This is an area of active development at Memorial Sloan
Kettering
in the last decade.lzi
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
69
Conventional dosimetry yields estimates of the absorbed dose, averaged over a
normal
organ or tumor volume. The methodology implemented in this proposal will yield
the
spatial distribution of absorbed dose as isodose contours, overlayed upon a 3-
D CT
image set. This makes it possible to evaluate the anatomical distribution of
absorbed
dose to tissues and from this, assess the potential impact in terms of
toxicity. For
example, the dose to surrounding tissue from activity that has concentrated in
a tumor
contained within a normal organ can be obtained by this means.
2.6 Interpretations and implications
The average absorbed dose to a tumor may not reflect potential therapeutic
efficacy and
tumor shrinkage. That portion of a tumor volume receiving the lowest absorbed
dose
will lead to treatment failure regardless of the dose delivered to other
regions of the
tumor volume. The 3D-ID software package provides detailed information
regarding the
spatial distribution of absorbed dose within a target volume. This information
is
depicted as dose-volume histograms, wherein the fraction of tumor volume
receiving a
particular absorbed dose is plotted against absorbed dose. Using such
information it will
be possible to better assess the likelihood of tumor control. For example, if
the average
dose over a tumor volume is 2 to 3 Gy and a small region within this volume
receives
only 0.1 Gy, then treatment will be unsuccessful.
E. Human Subjects:
1. Tumor specimens, bone marrow samples, and blood from patients will be
collected
according to the treatment plan. Patients received 1311-8H9 according to the
IRB
protocol.
2. The risks to the subjects are acceptable in relation to the anticipated
benefits to the
subjects and in relation to the importance of knowledge expected to be gained.
The
proposed research project will involve the use of human subjects. The sera
samples
obtained from patients are <5% blood volume, and only after informed consent
under the
guidelines of Memorial Sloan-Kettering Cancer Center IRB approved protocols.
Risks
to the participants are the minimal risk associated with venipuncture and/or
lumbar
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
puncture. For most of the participants in the study they have indwelling
central catheters
as required by their chemotherapy treatment and parenteral nutrition. Blood
drawing
will be performed painlessly through venous catheters. The confidentiality of
all
participants will be protected by the use of code numbers.
5
3. Patients will be primarily children, adolescents and young adults because
of the nature
of these tumors. Patients of both sexes and all ethnic background are eligible
for this
study. However, the ethnic mix among patients treated at MSKCC is dependent on
the
referral pattern in the greater metropolitan area..
4. This is a pilot imaging study in human patients with a rationale built on
encouraging
preclinical studies. Human subjects are required because the MoAb 8H9 targets
to this
class of cancers.
5. This protocol is an initial 1ND-filing study. Date of 1ND submission is
expected to be
4/2000.
6. Protocol: Tumor detection using 131-I labeled monoclonal Antibody 8H9
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
71
REFERENCES
1. DiMaggio JJ, Scheinberg DA, Houghton AN: Monoclonal antibody
therapy of cancer. In: Pinedo HM, Chabner BA, Longo DL, (eds.): Cancer
Chemotherapy and Biological Response Modifiers, Annual 11, Elsevier
Science Publishers B.V., (Biomedical Division), 1990, pp 177-203
2. Schlom J: Monoclonal Antibodies in cancer therapy: Basic principles.
In: DeVita VT, Hellinan S, Rosenberg SA, (eds.): Biologic therapy of cancer,
2nd ed. Philadelphia, J.B.Lippincott Co, 1995, pp 507-520
3. Koehler G, Milstein C: Continuous culture of fused cells secreting
to antibody of pre-defined specificity. Nature 256:495-496, 1975
4. Moffat R, Pinsky CM, Hammershaimb L, et al: Clinical utility of
external immunoscintigraphy with the IMMU-4 technetium-99m Fab'
antibody fragment in patients undergoing surgery for carcinoma of the colon
and rectum:results of a pivotal, phase III trial. The Immunomedics Study
Group. J Clin Oncol 14(8):2295-2305, 1996
S. Maloney DG, Grillo-Lopez AJ, Bodkin DJ, et al: IDEC-C2B8: Results
of a phase I multiple-dose trial in patients with relapsed non-hodgkin's
lymphoma. J Clin Oncol 15:3266-3274, 1997
6. Cobleigh MA, Vogel CL, Tripathy D, et al: Multinational study of the
efficacy and safety of humanized anti-HER2 monoclonal antibody in women
who have HER2-overexpressing metastatic breast cancer that has progressed
after chemotherapy for metastatic disease. J Clin Oncol 17:2639-2648, 1999
7. Bigner DD, Brown MT, Friedman AH: Iodine-131-labeled antitenascin
monoclonal antibody 81C6 treatment of patients with recurrent malignant
gliomas:phase I trial results. Journal Clincal Oncology 16:2202-2212, 1998
8. Jurcic JG, Caron PC, Miller WH: Sequential targeted therapy for acute
promyelocytic leukemia with all-trans retinoic acid and anti-CD33 monoclonal
antibody M195. Leuk 9:244-248, 1995
9. Meredith RF, Khazaeli MB, Plott WE: Phase II study of dual 131I
labeled monoclonal antibody therapy with interferon in patients with
metastatic colorectal cancer. Clin Can Res 2:181 I-1818, 1996
I0. Yeh SD, Larson SM, Burch L, et al: Radioimmunodetection of
neuroblastoma with iodine-13I-3F8: Correlation with biopsy, iodine-I3I-
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
72
Metaiodobenzylguanidine (MIBG) and standard diagnostic modalities. J Nucl
Med 32:769-776, 1991
11. Cheung NKV, Kushner BH, Cheung IY, et al: Anti-GD2 antibody
treatment of minimal residual stage 4 neuroblastoma diagnosed at more than 1
year of age. J Clin Oncol 16:3053-3060, 1998
12. Wheldon TE, O'Donoghue~ JA, Barren A, Michalowski AS: The
curability of tumors of differing size by targeted radiotherapy using 131-I or
90-Y. Radiother Oncol 21:91-99, 1991
13. Wilder RB, DeNardo GL, DeNardo SJ: Radioiinmunotherapy: recent
to results and future directions. J Clin Oncol 14:1383-1400, 1996
14. Zalutsky MR, McLendon RE, Garg PK, et al: Radioimmunotherapy of
neoplastic meningitis in rats using an alpha-particle-emitting
immunoconjugate. Cancer Res 54:4719-4725, 1994
15. McDevin MR, Sgouros G, Finn RD, et al: Radioimmunotherapy with
alpha-emitting nuclides. Eur J Nucl Med 25:1341-1351, 1998
16. Lode HN, Xiang R, Becker JC, et al: Immunocytokines: A promising
approach to cancer immunotherapy. Pharmacology Therapeutics 80:277-292,
1998
17. DeNardo SJ, DeNardo GL, DeNardo DG, et al: Antibody phage
libraries for the next generation of tumor targeting radioimmunotherapeutics.
Clin Can Res 5:3213s-3218s, 1999
18. DeNardo SJ, DeNardo GL, Brush J, Carter P: Phage Library-derived
human anti-TETA anti anti-DOTA ScFv fox pretargeting RIT. Hybridoma
18:13-21, 1999
19. Eshhar Z, Waks T, Gross G, Schindler DG: Specific activation and
targeting of cytotoxic lymphocytes through chimeric single chains consisting
of antibody-binding domains and the or zeta subunits of the immunoglobulin
and T-cell receptors. Proc Natl Acad Sci USA 90:720-24, 1993
20. Altenschmidt U, Kahl R, Moritz D, et al: Cytolysis of tumor cells
3o expressing the Neu/erbB-2, erbB-3, and erbB-4 receptors by genetically
targeted naive T lymphocytes. Clin Can Res 2:1001-1008, 1996
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
73
21. Krause A, Guo HF, Tan C, et al: Antigen-dependent CD-28 signaling
enhances survival and proliferation in genetically modified activated human
primary T lymphocytes. J Exp Med 188:619-626, 1998
22. Garin-Chesa P, Fellinger EJ, Huvos AG: Immunohistochemical
analysis of neural cell adhesion molecules. Am J Pathol 139:275-286, 1991
23. Ritter G, Livingston PO: Ganglioside antigens expressed by human
cancer cells. Semin Cancer Biol 2:401-409, 1991
24. Wikstrand CJ, Longee DC, McLendon RE, et al: Lactotetraose series
ganglioside 3',6'-isoLDl in tumors of central nervous and other systems in
l0 vitro and in vivo. Cancer Res 53:120-126, 1993
25. Seeger RC, Danon YL, Rayner SA, Hoover F: Definition of a Thy-1
determinant on human neuroblastoma, glioma, sarcoma, and teratoma cells
with a monoclonal antibody. J Immunol 128:983-989, 1982
26. Ylagan, Quinn LR: B: CD44 expression in astrocytic tumors. Modern
Pathology 10:1239-1246, 1997
2.7. Kaaijp P, Troost D, Morsink F, et al: Expression of CD44 splice
variants in human primary brain tumors. Journal of Neuro- Oncology 26:185-
190, 1995
28. Richardson RB, Davies AG, Bourne SP, et al:
Radioimmunolocalization of human brain tumors. Biodistribution of
radiolabelled monoclonal antibody UJ13A. Eur J Nucl Med 12:313-320, 1986
29. Papanastassiou V, Pizer BL, Coakham HB, et al: Treatment of
recurrent and cystic malignant gliomas by a single intracavitary injection of
131I-monoclonal antiobdy: Feasibility, pharmacokinetics and dosimetry. Br J
Cancer 67:144-151, 1993
30. Kishima H, Shimizu K, Tamura K, et al: Monoclonal antibody ONS-
21 recognizes integrin a3 in gliomas and gliomas and medulloblastomas. Br J
Cancer 79:333-339, 1998
31. Moriuchi S, Shimuzu K, Miyao Y, Hayakawa T: Characterization of a
new mouse monoclonal antibody (ONS-M21) reactive with both
medulloblastomas and gliomas. Br J Cancer 68:831-837, 1993
32. Erikson HP, Lighter VA: Hexabrachion protein (tenascin, cytotactin,
brachionectin) in connective tissues, embryonic tissues and tumors. Adv Cell
Bio12:55-90, 1988
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
74
33. Riva P, Frnceschi G, Frattarelli M, et al: 131I radioconjugated
antibodies for the locoregional radioimmunotherapy of high-grade malignant
glioma- phase I and II study. Acta Oncol 38:351-359, 1999
34. Kuan CT, Reist CJ, Foulon CF, et al: 125I-labeled anti-epidermal
growth factor receptor vIII single-chain Fv exhibits specific and high-level
targeting of glioma xenografts. Clin Can Res S:I539-1549, 1999
35. Wikstrand CJ, Hale LP, Batra SK, et al: Monoclonal Antibodies
against EGFRvIII are Tumor Specific and React with Breast and Lung
Carcinomas and Malignant Gliomas. Cancer Res 55:3140-48, 1995
l0 36. Kondo S, Miyatake S, Iwasaki K, et al: Human glioma-specific
antigens detected by monoclonal antibodies. Neurosurgery 30:506-51 l, 1992
37. Dastidar SG, Shanna SK: Monoclonal antibody against human
glioblastoma multifonne (U-87Mg) immunoprecipitates a protein of
monoclonal mass 38KDa and inhibits tumor growth in nude mice. J
Neuroimmuno 56:91-98, 1995
38. Mihara Y, Matsukado Y, Goto S, et aI: Monoclonal antibody against
ependymoma-derived cell line. Journal of Neuro- Oncology 12:1-11, 1992
39. Wang NP, Marx J, McNutt MA: Expression of myogenic regulatory
proteins(myogenin and MyoDl) in small blue round cell tumors of childhood.
Am J Pathol 147:1799-1810, 1995
40. Weidner N, Tjoe J: Immunohistochemical profile of monoclonal
antibody 013 that recognizes glycoprotein 930/32MIC2 and is useful in
diagnosing ewing's sarcoma and peripheral neuroepithelioma. American
Journal of Surgical Pathology 18:486494, 1994
41. Wedner N, Tjoe J: Immunohistochemical profile of monoclonal
antibody 013 that recognizes glycoprotein , 930/32MIC2 and is useful in
diagnosing ewing's sarcoma and peripheral neuroepithelioma. Am J Pathol
18:486-494, 1994
42. Heiner J, Miraldi FD, Kallick S, et al: In vivo targeting of GD2
3o specific monoclonal antibody in human osteogenic sarcoma xenografts.
Cancer Res 47:5377-5381, 1987
43. Price MR, Campbell DG, Robyn RA: Characteristics of the cell surface
antigen p72, associated with a variety of human tumors and mitogen-
stimulated T-lymnphoblasts. FEBS Letters 171:31-35, 1984
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
44. Spendlove I, James LL, Carmichael J, Durrant LG: Decay accelerating
factor (CD55): a target for cancer vaccines? Cancer Res 59:2282-2286, 1999
45. Gorlick R, Huvos AG, Heller G, et al: Expression of HER2/erbB-2
correlates with survival in osteosarcoma. J Clin Oncol 17:2781-2788, 1999
5 46. Bruland O, Fodstad O, Funderud S, Pihl A: New monoclonal
antibodies specific for human sarcomas. Int J Cancer 15:27-31, 1986
47. Cheung NK, Saarinen UM, Neely JE, et al: Monoclonal antibodies to a
glycolipid antigen on human neuroblastoma cells. Cancer Res 45:2642-2649,
1985
l0 48. Modak S, Gultekin SH, Kramer K, et al: Novel tumor-associated
surface antigen: broad distribution among neuroectodermal, mesenchymal and
epithelial tumoxs, with restricted distribution in normal tissues. Proceedings
of
ASCO 17:449a, 1998
49. Cheung NK, Heller G, Kushner BH, et aI: Detection of metastatic
15 neuroblastoma in bone marrow: when is routine marrow histology insensitive?
J Clin Oncol 15:2807-2817, 1997
50. Ghossein RA, Osman I, Bhattacharya S, et al: Detection of circulating
prostatic tumor cells using immunobead reverse transcriptase polymerase
chain reaction for prostatic specific membrane antigen mRNA. Diag Mol Path
20 8:59-65, 1999
51. Leung W, Chen AR, Klann RC, et al: Frequent detection of tumor cells
in hematopoietic grafts in neuroblastoma and ewing's sarcoma. Bone Marrow
Transpl 22:971-979, 1998
52. Mueller BM, Romerdahl CA, Gillies SD, Reisfeld RA: Enhancement
25 of antibody-dependent cytotoxicity with a chimeric anti-GD2 antibody. J
Immunol 144:1382-1386, 1990
53. Santos AD, Kashmiri VS, Horan PH, et al: Generation and
characterization of a single gene-encoded single-chain-tetravalent antitumor
antibody. Clin Can Res 5:3118s-3123s, 1999
30 54. Guo HF, Rivlin K, Dubel S, Cheung NKV: Recombinant anti-
ganglioside GD2 scFv-streptavidin fusion protein for tumor pretargeting. Proc
Am Assoc Cancer Res 37:469, 1996 (abstract)
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
76
55. Fagnou C, Michon J, Peter M, et al: Presence of tumor cells in bone
marrow but not in blood is associated with adverse prognosis in patients' with
ewing's tumor. J Clin Oncol 16:1707-1711, 1998
56. Cheung NK, Kushner BH, LaQuaglia M, Lindsley K: Treatment of
advanced stage neuroblastoma. In: Reghavan D, Scher HI, Leibel SA, Lange
P, (eds.): Principles and Practice of Genitourinary Oncology. Philadelphia,
J.B. Lippincott Company, 1997, pp 1101-1111
57. Brodeur GM, Castleberry RP: Neuroblastoma. In: Pizzo PA, Poplack
DG, (eds.): Principles and Practice of Pediatric Oncology, 3rd ed.
to Philadelphia, J.B. Lippincott Company, 1997, pp 761-797 chapter 29
58. Cheung NKV: Biological and molecular approaches to diagnosis and
treatment. section I. Principles of Immunotherapy. In: Pizzo PA, Poplaclc DG,
(eds.): Principles and Practice of Pediatric Oncology, 3rd ed. ed.
Philadelphia,
J.B. Lippincott Company, 1997, pp 323-342
59. Larson SM, Sgouros G, Cheung NK: Antibodies in cancer therapy:
Radioisotope conjugates. In: DeVita VT, Hellman S, Rosenberg SA, (eds.):
Biologic Therapy of Cancer, 2nd ed. Philadelphia, J.B. Lippincott Co., 1995,
pp 534-552
60. Levy R, Miller RA: Antibodies in cancer therapy: B-cell lymphomas.
2o In: DeVita VT, Hellman S, Rosenberg SA, (eds.): Biologic therapy of cancer,
1st ed. Philadelphia, J.B.Lippincott Co, 1991, pp 512-522
61. Reisfeld RA, Mueller BM, Handgretinger R: Potential of genetically
engineered anti-ganglioside GD2 antibodies for cancer immunotherapy. In:
Progress in Brain Search (Svennerhol,L, Asbury,AK, Reisfeld,RA,
Sandhoff,K, Suzuki,K, Tettamani,G, Toffano,G, vol. 101. Cambridge, UK,
Elsevier Trends Journals, 1994, pp 201-212
62. Munn DH, Cheung NK: Interleukin-2 enhancement of monoclonal
antibody-mediated cellular cytotoxicity (ADCC) against human melanoma.
Cancer Res 47:6600-6605, 1987
63. Hank JA, Robinson RR, Surfus J, et al: Augmentation of antibody
dependent cell mediated cytotoxicity following in vivo therapy with
recombinant interleukin-2. Cancer Res 50:5234-5239, 1990
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
77
64. Kushner BH, Cheung NK: GM-CSF enhances 3F8 monoclonal
antibody-dependent cellular cytotoxicity against human melanoma and
neuroblastoma. Blood 73:1936-1941, 1989
65. Kushner BH, Cheung NKV: Absolute requirement of CD11/CD18
adhesion molecules, FcRII and phosphatidylinositol-linked FcRIII for
monoclonal antibody-mediated neutrophil anti-human tumor cytotoxicity.
Blood 79:1484-1490, 1992
66. Cheung NKV, Walter EI, Smith-Mensah WH, et al: Decay
accelerating factor protects human tumor cells from complement-mediated
to cytotoxicity in vitro. J Clin Invest 81:1122-1128, 1988
67. Saarinen UM, Coccia PF, Gerson SL, et al: Eradication of
neuroblastoma cells in vitro by monoclonal antibody and human complement:
method for purging autologous bone marrow. Cancer Res 45:5969-5975, 1985
68. Munn DH, Cheung NK: Antibody-dependent antitumor cytotoxicity by
human monocytes cultured with recombinant macrophage colony-stimulating
factor. Induction of efficient antibody-mediated antitumor cytotoxicity not
detected by isotope release assays. J Exp Med 170:511-526, 1989
69. Munn DH, Cheung NK: Phagocytosis of tumor cells by human
monocytes cultured in recombinant macrophage colony-stimulating factor. J
2o Exp Med 172:231-237, 1990
70. Sabzevari H, Gillies SD, Mueller BM, et al: A recombinant antibody-
interleukin 2 fusion protein suppresses growth of hepatic human
neuroblastoma metastases in severe ' combined immunodeficiency mice.
Proceeds of the National Academy of Science USA 91:9626-9630, 1994
71. Murray JL, Cunningham JE, Brewer HM, et al: Phase I trial of murine
anti-ganglioside (GD2) monoclonal antibody (Mab) 14G2A in cancer patients.
J Biol Resp Modif 1991 (Soc. Biol. Therapy Meeting Abstract 1991.)
72. Ugur O, Kostakoglu L, Hui ET, et al: Comparison of the targeting
characteristics of various radioimmunoconjugates for radioimmunotherapy of
neuroblastoma: Dosimetry calculations incorporating cross-organ beta doses.
Nucl Med Biol 23:1-8, 1996
73. Mujoo K, Reisfeld RA, Cheung L, Rosenblum MG: A potent and
specific immunotoxin for tumor cells expressing disialoganglioside GD2.
Cancer Immunol Immunother 34:198-204, 1991
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
78
74. Gottstein C, Schon G, Tawadros S, et al: Antidisialoganglioside Ricin
A-chain immunotoxins show potent anti-tumor effects in vitro and in a
disseminated human neuroblastoma severe combined immunodeficiency
mouse model. Cancer Res 54:6186-6193, 1994
75. Holzer U, Bethge W, Krull F, et al: Superantigen-staphylococcal-
enterotoxin-A-dependent and antibody-targeted lysis of GD2-positive
neruoblastoma cells. Cancer Immunol Immunother 41:129-136, 1995
76. . Cheung NK, Lazarus H, Miraldi FD, at al: Ganglioside GDZ specific
monoclonal antibody 3F8- a phase I study in patients with neuroblastoma and
to malignant melanoma. J Clin Oncol 5:1430-1440, 1987
77. Cheung NK, Lazarus H, Miraldi FD, et al: Reassessment of patient
response to monoclonal antibody 3F8. J Clin Oncol 10:671-672, 1992
78. Murray JL, Cunningham JE, Brewer H, et al: Phase I trial of murine
monoclonal antibody 14G2a administered by prolonged intravenous infizsion .
in patients with neuroectodermal tumors. J Clin Oncol 12:184-193, 1994
79. Saleh MN, Khazaeli MB, Wheeler RH, et al: Phase I trial of the
chimeric anti-GD2 monoclonal antibody ch 14.18 in patients with malignant
melanoma. Human Antibodies Hybridomas 3:19-24, 1992
80. Handgretinger R, Anderson K, Lang P, et al: A phase I study of
human/mouse chimeric antiganglioside GD2 antibody ch 14.18 in patients
with neuroblastoma. Eur J Cancer 31:261-267, 1995
81. Uttenreuther-Fischer MM, Huang C-S, Reisfeld RA, Yu AL:
Pharmacokinetics of anti-ganglioside GD2 mAb I4G2a in phase. 1 trial in
pediatric cancer patients. Cancer Immunol Immunother 41:29-36, 1995
82. Cheung NKV, Kushner BH, Yeh SJ, Larson SM: 3F8 monoclonal
antibody treatment of patients with stage IV neuroblastoma: a phase II study.
In: Evans AE, Guillio JD, Biedler JL, et al, (eds.): Advances in Neuroblastoma
Research, vol. 4. New York, Wiley Liss, 1994, pp 319-329
83. Yu AL, Gillies SD, Reisfeld RA: Phase I clinical trial of ch14.18 in
3o patients with refractory neuroblastoma. Proc Am Soc Clin Oncol 10:318, 1991
84. Handgretinger R, Baader P, Dopfer R, et al: A phase I study of
neuroblastoma with the anti-ganglioside GD2 antibody 14.G2a. Cancer
Immunol Immunother 35:199-204, 1992
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
79
85. Cheung NK: Biological and Molecular Approaches to Treatment.
Immunotherapy. In: Pizzo PA, Poplack DG, (eds.): Principles and Practice of
Pediatric Oncology, 2nd ed. Philadelphia, J.B.Lippincott Company, 1992, pp
357-370
86. Miraldi FD, Nelson AD, Kraly C, et al: Diagnostic imaging of human
neuroblastoma with radiolabeled antibody. Radiology 161:413-418, 1986
87. Arbit E, Yeh SJ, Cheung NK, Larson SM: Quantitative
Immunoimaging of gliomas in humans with anti-ganglioside monoclonal
antibodies. J Neurosurg 76:399a, 1991
l0 88. Daghighian F, Pentlow KS, Larson SM, et al: Development of a
method to measure kinetics of radiolabeled monoclonal antibody in human
tumors with applications to microdosimetry: Positron emission tomography
studies of iodine-124 labeled 3F8 monoclonal antibody in glioma. Eur J Nucl
Med 20:402-409, 1993
89. Grant SC, Kostacoglu L, Kris MG, et al: Radioimmunodetection of
small-cell lung cancer using the anti-GD2 ganglioside monoclonal antibody
3F8: a pilot trial. Eur J Nucl Med 23:145-149, 1996
90. Cheung NKV, Kushner BH, Yeh SJ, Larson SM: 3F8 monoclonal
antibody treatment of patients with stage IV neuroblastoma: A phase II Study.
2o Int J Oncol 12:1299-1306, 1998
91. Cheung NK, Yeh SD, Kushner BH, et al: Phase I study of
radioimmunotherapy of neuroblastoma using iodine 131 labeled 3F8. In: Prog.
Clin. Biol. Res: Advances in Neuroblastoma Research 4. New York, Wiley
Liss, 1994, pp 329
92. Larson SM, VPentlow KS, Volkow ND, et al: PET scanning of iodine-
124-3F8 as an approach to tumor dosimetry during treatment plamiing for
radioimmunotherapy in a child with neuroblastoma. J Nucl Med 33:2020-
2023, 1992
93. Pentlow KS, Graham MC, Lambrecht RM, et al: Quantitative imaging
of I-124 using positron emission tomography with applications to
radioimmunodiagnosis and radioimmunotherapy. Medical Physics 18:357
366, 1991
94. Pentlow KS, Graham MC, Lambrecht RM: Quantitative imaging of
iodine-124 with PET. J Nucl Med 37:1557-1562, 1996
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
95. Lewellen TK, Kohlmyer SG, Miyaoka RS, Kaplan MS: Investigation
of the performance of the general electric advance positron emission
tomograph in 3D mode. Transplantation Nuclear Science 1996
96. Kramer K, Cheung NKV, DiResta G, et al: Pharmacokinetics and
5 acute toxicology of intraventricular I-monoclonal antibody targeting
disialoganglioside in non-human primates. J Neuro Oncol 1996
97. Dropcho EJ, Saleh MN, Grizzle WE, Oh SJ: Peripheral neuropathy
following treatment of melanoma with a murine anti-GD2 monoclonal
antibody (MoAb). Neurology 1992 (abstract in press)
10 98. Saleh MN, Khazaeli MB, Wheeler RH, et aI: A phase I trial of the
murine monoclonal anti-GD2 antibody 14.G2a in metastatic melanoma.
Cancer Res 52:4342-4347, 1992
99. Saleh MN, Wheeler RH, Khazaeli MB, et al: A phase I trial of
chimeric anti-GD2 monoclonal antibody C 14.18 in patients with metastatic
is melanoma. International Conference on Monoclonal Antibody
Immunoconjugates for cancer 1991 (abstract)
100. Cheung NK, Cheung IY, Canete A, et al: Antibody response to murine
anti-GD2 monoclonal antibodies: Correlation with patient survival. Cancer
Res 54:2228-2233, 1994
20 101. Drengler RL, Kuhn JG, Schaaf LJ, et al: Phase I and pharmacokinetic
trial of oral irinotecan administered daily for 5 days every 3 weeks in
patients
with solid tumors. J Clin Oncol 17:685-696, 1999
102. Cheung NK, Landmeier B, Neely J, et al: Complete tumor ablation
with iodine 131-radiolabeled disialoganglioside GD2 specific monoclonal
25 antibody against human neuroblastoma xenografted in nude mice. J Natl
Cancer Inst 77:739-745, 1986
103. Cheung IY, Cheung NKV, Kuslmer BH: Induction of Ab3' following
anti-GD2 monoclonal antibody 3F8 therapy predicts survival among patients
(pts) with advanced neuroblastoma. Proc Am Assoc Cancer Res 40:574, 1999
30 104. Chen S, Caragine T, Cheung NK, Tomlinson S: Surface antigen
expression and complement susceptibility of differentiated neuroblastoma
clones. Am J Pathol In press:, 1999
105. Cheung NK, Canete A, Cheung IY, et al: Disialoganglioside GD2 anti-
idiotypic monoclonal antibodies. Int J Cancer 54:499-SOS, 1993
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
81
106. Loh A, Sgouros G, O'Donoghue JA, et al: A pharmacokinetic model of
131I-6250 antibody in patients with renal cell carcinoma. J Nucl Med 3:484-
489, 1998
107. Kolbert KS, Sgouros G, Scott AM, et al: Implementation and
evaluation of patient-specific three dimensional internal dosimetry. J Nucl
Med 38:301-308, 1997
108. Sgouros G, Jureidini IM, Scott AM, et al: Bone marrow dosimetry:
Regional variability of marrow-localizing antibody. J Nucl Med 37:695-698,
1996
l0 109. Sgouros G, Divgi CR, Scott AM, et al: Hematologic toxicity in
radioimmunotherapy: An evaluation of different predictive measures. J Nucl
Med 37:43P-44P, 1996
110. Sgouros G, Deland D, Loh AC, et al: Marrow and whole-body
absorbed dose vs marrow toxicity following 131I-6250 antibody therapy in
patients with renal-cell carcinoma. J Nucl Med 38:252P, 1997
111. Sgouros G: Treatment planning for internal emitter therapy: methods,
applications and clinical implications. 1996
112. Furhang EE, Sgouros G, Chui CS: Radionuclide photon dose kernels
for internal emitter dosimetry. Medical Physics 23:759-764, 1996
113. Furhang EE, Chui CS, Sgouros G: A monte carlo approach to patient-
specific dosimetry. Medical Physics 23:1523-1529, 1996
114. Furhang EE, Chui CS, Kolbert KS, et al: Implementation of a monte
carlo dosimetry method for patient-specific internal emitter therapy. Medical
Physics 24:1163-1172, 1997
115. Sgouros G: Yttrium-90 biodisribution by yttrium-87 imaging: a
feasibility analysis. Medical Physics 2000
116. Siegel JA, Wessels BW, Watson EE, et al: Bone marrow dosimetry
and toxicity in radioimmunotheray. Antibody Immunoconjugates
Radiopharmaceuticals 3:213-233, 1990
117. Scott AM, Macapinlac H, Zhang J, et al: Image registration of SPELT
and CT images using an external fiduciary band and three-dimensional surface
fitting in metastatic thyroid cancer. J Nucl Med 36:100-103, 1995
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
82
118. Woods RP, Mazziotta JC, Cherry SR: Quantification of brain function.
Tracer kinetics and image analysis in brain PET. 1993 (ED. Uemura K,
Elseiver Science Publishers)
119. Talairach J, Tournouz P: Co-planar stereotactic atlas of the human
brain. Georg Thieme Verlag 1988
120. Meyer CR, Boes JL, Kim B, et al: Demonstration of accuracy and
clinical versatility of mutual information for automatic multimodality image
fusion using affine and thin-plate spline warped geometric deformations.
Medical Image Analysis 1:195-206, 1997
l0 121. Sgouros G, Chiu S, Pentlow KS, et al: Three-dimensional dosimetry
for radioimmunotherapy treatment planning. J Nucl Med 34:1595-1601, 1993
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
83
THIRD SERIES OF EXPERIMENTS
Metastatic rhabdomyosaxcoma is a chemotherapy-responsive tumor. However,
cure is elusive because of the failure to eradicate minimal residual disease
(MRD). MoAb may have potential for selective targeting of therapy to MRD.
Few MoAb of clinical utility have been described for RMS. We previously
reported the broad tumor reactivity of a rnurine MoAb 8H9 with low/no
staining of normal human tissues. The target antigen was typically expressed
in a homogeneous fashion among neuroectodermal (neuroblastoma, Ewing's
sarcoma, PNET, brain tumors), mesenchymal (RMS, osteosarcoma, DSRT,
l0 STS) and select epithelial tumors. Of 25 RMS tumors, 24 stained positive.
Radioimmunolocalization of subcutaneous RMS xenografts in SCID mice was
studied using radiolabeled 8H9. Following iv injection of 120 uCi of l2sl-8H9,
selective tumor uptake was evident at 4 to 172 hrs after injection, with a
blood
T%2 of 0.8 h and T'/Z of 26 h. Mean tumor/tissue ratios were optimal at 172 h
(for lung 4, kidney 7, liver 9, spleen 10, femur 16, muscle 2I, brain 45).
Average tumor/blood ratio were 0.7,1.4 and 1.6, and tumor uptake was -
9.53.4, 13.31.5, and 5.30.9 % injected dose per gm at 24, 48 and 172 h,
respectively. The selective targeting of 8H9 to RMS xenografts suggests its
potential for radioimmunodetection and MoAb-based targeted therapy of
2o MRD in RMS.
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
84
FOURTH SERIES OF EXPERIMENTS
The propensity for hematogenous spread of Ewing's sarcoma and the resulting
contamination of autologous cell preparations complicates the use of cellular
therapies in this disease. To date, there has been no reported method for
purging marrow and other cellular products of Ewing's sarcoma. In this paper,
we introduce monoclonal antibody 8H9, which showed binding by flow
cytometry to 9/9 Ewing's sarcoma cell lines studied. Binding to lymphocytes
and bone marrow progenitor cells was negative. In order to test whether 8H9
could be used for immunomagnetic based purging, normal PBMCs or bone
marrow cells were artificially ~ contaminated with varying amounts of Ewing's
sarcoma. Quantitative PCR or t(11;22) was shown to accurately measure the
level of contamination with a sensitivity of 1:10. Samples were then purged
using the Miltneyi Variomax negative selection system selecting for
monoclonal antibody 8H9 bound cells. A 2 to 3-log reduction in tumor
burden was consistently observed following immunomagnetic selection. In
clinical non-mobilized apheresis studied, Ewing's contamination ranged
between 1:105-1:106 . Therefore 8H9 based purging of clinical samples is
predicted to result in a contamination level which is below the limit of
detection by sensitive quantitative PCR. These results demonstrate a potential
2o new approach for purging contaminated patient samples to be used in the
context of autologous bone marrow transplant and/or immunotherapy trials for
Ewing's sarcoma. (Mmerino c~r,pol.net)
Current concepts hold that Ewing's sarcoma is a systemic disease from the
time of onset as demonstrated by the observation that over 90% of patients
with clinically localized disease will recur distantly if treated with local
measures alone[Jaffe, 1976 #49]. Indeed, the generally accepted factor
responsible for the recent improvement in survival observed in patients with
clinically localized disease is control of hematogenously disseminated
micrometastasis via neoadjuvant multi-agent chemotherapyl. Recently, the
use of sensitive molecular monitoring to detect circulating Ewing's sarcoma
cells has confirmed hematogenous dissemination in a substantial number of
patients with Ewing's sarcoma. West et al 2 found a 25% incidence of
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
translocation (11;22) positivity in the peripheral blood or bone marrow in
patients with clinically localized disease, and higher rates have been
observed
in other series 3 and in patients with overt metastatic disease. 3 ~ 4
Interestingly, in the reports by de Alava and Toretsky, evidence for
positivity
5 in peripheral blood persisted following initiation of chemotherapy
suggesting
that ongoing dissemination may occur intermittently throughout treatment
protocols.
In an attempt to improve survival in high-risk patients with Ewing's sarcoma,
l0 several groups have studied the use of high dose chemotherapy followed by
bone marrow or peripheral stem cell transplantation. 5-1~. LTp to a 40%
survival in poor risk patients has been reported after high dose therapy
followed by autologous stem cells in contrast to historical survival rates of
0-
20% with chemotherapy/radiation therapy alone 5~ 6. One factor complicating
15 the use of autologous stem call products in therapy of Ewing's sarcoma is
the
propensity for hematogenous dissemination with resultant contamination of
stem cell products. In one report, despite CD34 based positive selection for
progenitor cells, autologous peripheral blood progenitor preparations were
shown to contain EWS/FLI1 translocation positive cells in 54% of samples
2o evaluated 4. While the true clinical impact of contaminating tumor cells in
autologous products remains unclear, genetically marked tumor cells residing
in autologous bone marrow have been shown to be present at disease relapse
in patients with neuroblastoma and AML18~ 19, Similar concern regarding
the potential for autologous cell preparations to contribute to disease
25 recurrence arise in the context of immune based therapy trials which are
currently being undertaken and involve the transfer of autologous T cells
harvested prior to the initiation of therapy20
To date there has been no method reported for purging autologous
30 hematopoietic cells of Ewing's sarcoma. In this report, we introduce a
monoclonal antibody based purging technique which allows us to reduce the
tumor burden in contaminated bone marrow or peripheral blood specimens by
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
86
two to three logs which is predicted to be below the limit of detection of PCR
positivity in the vast majority of clinically contaminated specimens.
Materials and Methods
Monoclonal Antibody Production (Memorial Sloan-Kettering Cancer Center)
Cell Preparations
Peripheral Blood Mononuclear Cells: PBMCs used in tumor spiking
experiments were obtained by ficoll-based density gradient separation of the
fresh buffy coat fraction of normal healthy donor blood units obtained at the
Department of Transfusion Medicine, Clinical Center, NCI according to
approved protocols. For analysis of T cell reactivity to anti-CD3 monoclonal
antibody following purging, PBMCs were T cell enriched using a negative
selection column (R & D Biosystems, Minneapolis) which results in a purity
of approximately 80%. Patient apheresis samples analyzed for contamination
were obtained as part of NCI POB 97-0052 following informed consent.
Leukapheresis procedures were done using the CS3000 Plus (Fenwal Division,
Baxter, Deerfield, IL) which processed 5-15 liters of blood volume.
Countercurrent centrifugal elutriation of the apheresis product was performed
using a Beckman J-6M centrifuge equipped with a JE 5.0 rotor (Beckman
Instruments, Palo Alto, CA) in HBSS without magnesium, calcium and phenol
red (BioWhittaker, Walkersville, MD) at a centrifuge speed of 3000 rpm
(1725 x g)21. Cell fractions (450-550 ml each) were collected at flow rates of
120, 140, and 190 m1/min. during centrifugation and at 190 ml/min. with the
rotor off (R0). The first two fractions are typically enriched for lymphocytes
while the last two fractions are enriched for monocytes. All fractions were
cryopreserved in 10% DMSO (Cryoserv, Research Industries, Salt Lake City,
UT), RPMI with penicillin, streptomycin and L-glutamine and 25% fetal calf
serum.
Progenitor Cells: CD34+ cells used for purging experiments were selected
using the Miltenyi Variomax~ direct isolation system (Milteriyi, Auburn,
CA) from cryopreserved peripheral stem cells from a Ewing's sarcoma
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
87
patient obtained for therapeutic use at Children's National Medical Center,
Washington, DC according to approved protocols and following informed
consent. Stem cells were used for research purposes after the patient's death.
These cells were not positive by RT-PCR for Ewing's sarcoma and were
therefore artificially contaminated for the purging experiments. Non-CD34
selected bone marrow used for purging experiments and enriched CD34+
populations used in the CFU assay were obtained from fresh human marrow
harvested from normal volunteers according to approved protocols and
following informed consent (Poietics Laboratories, Gaithersburg, MD). The
1o mononuclear fraction was obtained by ficoll-based density gradient
separation,
and subsequently enriched for CD 34+ cells by the Miltenyi Variomax~
(Miltenyi, Auburn, CA) direct CD34 selection system.
Tumor Cell Lines: Ewing's sarcoma cell lines used for screening included
TC71, 5838, RD-ES, CHP100, A4573 which have been previously reported 2~
and JR and SB which are cell lines derived from patients treated at the
National Cancer Institute which have also been previously reported ~2. LG
was a cell line derived from a patient with isolated intrarenal recurrence of
Ewing's sarcoma treated with resection at the University of Maxyland.
Flow Cytometry Analysis
Flow cytometric analysis was performed using the Becton-Dickinson
FacsCalibur machine. Briefly, fluorescence data were collected using a 3-
decade log ampliftcation on 10,000 viable gated cells as determined by
forward and side light scatter intensity. Monoclonal antibodies used for
immunofluorescence were: MoAb 8H9, murine IgGl isotype, goat anti-mouse
IgGl-FITC, CD3 - PE (54.1), CD34 - PE (581) Caltag (Burlingame, CA),
CD99-FITC (T'LT12) (Pharmingen, San Diego, CA). For immunofluorescence
analysis, cells were incubated with antibody at a concentration of lug/10~
cells
for 20 minutes at 4°, followed by washing with PBS with 0.2% human
serum
albumin and 0:1% Sodium Azide. For 8H9 and isotype staining, this was
followed by incubation with goat anti-mouse FITC for 10 minutes at 4°C
followed by washing prior to analysis.
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
88
Immunomagnetic Purging
All cell products were spiked with tumor cells from the Ewing's sarcoma cell
line TC71 at the levels of contamination indicated for individual experiments.
For purging of CD34+ peripheral stem cells, a total of l OX10~ were spiked. 1
X 106 cells were analyzed for pre-purged and post-purged PCR. For PBMC
and non-CD34 selected bone marrow specimens, 30-80 X10 cells were
spiked with TC71 with 1OX10~ cells analyzed for pre-purged and post-purged
PCR. For purging, cells were incubated at 4°C with monoclonal
antibody 8H9
l0 at a concentration of lug/106 total cells for 20 minutes and washed with
buffer
(PBS, 0.5% BSA, 2mM EDTA). Cells were then incubated with rat anti-
mouse IgGl magnetic beads (Miltneyi, Auburn, CA) at a ratio of 1:l for 20
minutes at 4°C. Purging was accomplished using the Miltenyi Variomax
system wherein the sample is run over the Miltenyi (Auburn, CA) AS
depletion column with a flower resistor of 24G. Cells from the depleted
fraction were then washed with 3cc buffer. The positively selected fractions
of
cells was removed by releasing the column from the magnet and washing with
3cc buffer, and analyzed by PCR where indicated. In cases where
clonogenicity of the positive fraction was evaluated, the positive fraction
was
2o pelleted and resuspended in RPMI with 10% FCS, L-glutamine (4uM),
penicillin (100u/ml) , and streptomycin (100ug/ml), and placed in an incubator
at 37 °C with 5% COz for 5 days.
Conventionial PCR
For analysis of contamination of patient apheresis fractions, RNA was
extracted from 20-50 X 10~ cells using TRIzoI Reagent (Life Technologies,
Rockville, MD) or guanidinium isothiocynate/CsCI method 23. After cDNA
was generated from 250ng RNA using a random hexamer, PCR was
performed with Perkin Elmer GeneAmp PCR system 2400 using ESPB 1 and
ESBP2 primers and the following conditions: 40 cycles 95°C 30s,
60°C 30s,
72°C 30s followed by 72°C for 7 minutes. To assess the integrity
and quantity
RNA, a PCR reaction with GAPDH primers was performed for each patient
sample. 10u1 of each PCR product were run on 1.3% TBE agarose gel and
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
89
transferred to a nylon membrane. A [32P]y-ATP 20-mer oligonucleatide probe
was generated using T4 polynucleotide kinase. The membrane was hybridized
using ExpressHyb Hybridization Solution (Clontech, Palo Alto, CA)
according to the manufacturer's instructions. The membrane was then
exposed to Kodak Xomat film (Kodak, Rochester, N~ for 24-144 hours.
Real -Time Quantitative PCR
Real-time quantitative PCR was performed using the Lightcycler~ Instrument
(Roche Molecular Biochemicals, Indianapolis, III. RNA was extracted from
10X106 cells from all samples except for the CD34+ population in which
1X10 ~ cells were used. The Trizol~ phenol/chloroform extraction or RNA-
easy columns (Qiagen, Valencia, CA) were used. The 1st Strand Synthesis kit
(Roche, Indianapolis, 1N) was used to generate cDNA from lug of RNA from
each sample. PCR was then run on Sul of cDNA on the Lightcycler~
instrument with primers ESBP1 and ESBP2 for 40 cycles. In cases where
nested PCR was performed, an initial 20 cycles of PCR were carried out with
the primer pair ESBPI -ESBP2 followed by 40 additional cycles using 2u1 of
the product of the first reaction using the primer pair EWS 696 - Fll 1041 By
conventional PCR, primer pair ESBPl-ESBP2, and EWS 696-FLI 1041
generate fragments of 310bp and 205bp respectively. Both sets of primers
are outside the breakpoint of the EWS/FLI 1 translocation. In the initial
evaluation of the quantitative PCR, both nested and non-nested Lightcycler~
PCR products were confirmed by size using 1 % TAE agarose gel with .
ethidium bromide (data not shown). Hybridization probes spanning the
EWS/FLI 1 breakpoint were used to detect target template in the Lightcyler
reaction. To provide a positive control and to quantitate total amplified RNA,
G6PD was amplified from 5u1 of cDNA and analyzed using sequence specific
hybridization probes G6PDHP 1 and G6PDHP2. On all hybridization probes,
the 5' probe (HP1) was labeled at the 3'end with Fluorescein, the 3' probe
(HP2) was labeled at the 5' end with Lightcycler Red 640 and phosphorylated
at the 3' end. Cycle crossing number was ascertained at the point in which all
samples had entered the log linear phase. Cycle crossing number was used to
determine log cell concentration according to a standard curve. The standard
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
curve was generated by amplifying 5u1 of cDNA derived from lug of RNA
from 10 X 10~ normal PBMCs spiked with TC71 tumor cells at decreasing
concentrations from 1:10 to 1:10.
5 Sequences
[saP],~ probe 5'TACTCTCAGCAGAACACCTATG
Primers
ESBP 1 5' CGA CTA GTT ATG ATC AGA GCA 3'
io ESBP2 5' CCG TTG CTC TGT ATT CTT ACT GA 3'
EWS 696 5' AGC AGC TAT GGA CAG CAG 3'
FLI 1 1041 5' TTG AGG CCA GAA TTC ATG TT 3'
is G6PD1 5' CCG GAT CGA CCA CTA CCT GGG CAA G 3'
G6PD 2 5' GTT CCC CAC GTA CTG GCC CAG GAC CA 3'
Lightcycler Hybridization Probes
EWSHP1 5' TAT AGC CAA CAG AGC AGC AGC TAC - F 3'
20 EWSHP2 5' LC RED 640 - GGC AGC AGA ACC CTT CTT - P 3'
G6PDHP 1 5' GTT CCA GAT GGG GCC GAA GAT CCT GTT G - F 3'
G6PDHP2 5' LC RED 640 - CAA ATC TCA GCA CCA TGA GGT TCT
GCA C - P 3'
25 OKT3 Mediated Proliferation of Purged T Cell Specimens
1 x 10$ CD3 enriched cells were contaminated with Ewing's sarcoma at a level
of 1:103. Cells from pre-purged and post-purged samples were added in
triplicate to a 96 well plate at a concentration of 2 X 105 cells/well
containing
decreasing concentrations of plate bound anti-CD3 antibody OKT3 (Ortho
3o Biotech Inc., Raritan, NJ) from 100ug/ml to 3ug/ml. Cells were incubated
with 200u1 of RPMI with 10%FCS, L-glutamine, penicillin, and streptomycin
for a 48 hours and then pulsed with luCi of [3H] thymidine per well. Cells
were harvested after 18 hours of pulsing and 3H incorporation was enumerated
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
91
using the TopCount NXT (Packard, Meriden CT). Subtracting background
activity with media alone generated net counts.
CFU Assay
CD34+ cells were enriched from pre- and post-purged samples from fresh
human bone marrow using the Miltenyi~ direct CD34+ progenitor isolation
kit. 35 x 10~ bone marrow mononuclear cells from each sample were run over
a positive selection (MS) column yielding a CD34+ enriched population with
estimated purifies of >70% 24. 1000 cells were plated in triplicate in
1o methylcellulose media supplemented with recombinant cytokines
(MethoCultGF+H4435, Stem cell Technologies, Vancouver, BC). CFUs were
counted after 14 days of culture.
Results
Monoclonal Antibody 8H9 binds all Ewing's Sarcoma Cell Lines tested
but not normal lymphocytes or hematopoietic progenitors.
In order to identify a potential reagent that could be used to target
contaminating Ewing's sarcoma cells, monoclonal antibodies induced via
immunization with neuroblastoma were screened for cross reactivity with
2o Ewing's sarcoma. Monoclonal antibody 8H9 was observed to bind to 9/9
Ewing's sarcoma cell lines evaluated (Figure 1). The level of reactivity was
variable with some lines showing diminished levels of reactivity compared to
CD99 whereas two lines (SB and RD-ES), showed increased reactivity
compared to CD99. Importantly, lymphoid and hematopoietic populations
showed no reactivity with 8H9 as shown in Figure 2a (CD3 gated PBMC), and
Figure 2b (CD34 gated bone marrow cells), whereas CD99 showed significant
binding to T cell populations.
Quantification of Ewing's Sarcoma Contamination using real-time PCR
of artificially contaminated specimens accurately quantitates tumor
contamination with sensitivity to 1:106.
To study whether immunomagnetic purging of marrow and peripheral blood
populations contaminated with Ewing's sarcoma could be quantitatively
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
92
monitored, we sought to devise an approach wherein variable levels of
contamination could be quantified using RT-PCR. We began by artificially
contaminating PBMC populations with a log based titration of Ewing's
contamination (e.g. 1:10 - 1:100. The degree of contamination was evaluated
using real-time PCR. Using a non-nested PCR, we observed linear
relationships across four log levels of contamination, (Figure 3a). However,
the limit of detection for a non-nested PCR was 1 tumor cell in 104
background cells. In an effort to increase the sensitivity, we also evaluated
nested PCR, using an initial 20 cycles of amplification followed by 40 cycles
to amplification with internal primers. With this approach, quantitative
accuracy
was lost for only the highest level of contamination, which likely began to
plateau with the initial 20 cycles (3b). However, quantitative accuracy was
observed for levels of contamination between 1:100 to 1:10 was observed
(Figure 3c). Because 1OX10~ starting cells were used in these experiments,
we can estimate that using the nested approach, amplification was
accomplished from 10 contaminating cells. This confirmed the utility of
quantitative PCR to provide an accurate quantitative assessment of tumor
contamination with a level of sensitivity of one tumor in 10~ background
cells,
thus allowing measurements of the efficacy of 8H9 based approaches for
2o purging of Ewing's sarcoma cells.
MoAb 8H9 based immunomagnetic purging yields a 2 to 3-log reduction
in artificially contaminated peripheral blood and bone marrow
populations.
In order to purge hematopoietic progenitor populations of Ewing's sarcoma,
variably contaminated 8H9 incubated bone marrow or peripheral blood stem
cell populations were run over a Variomax~ negative selection column as
described in methods. Non-nested PCR evaluation of non-CD34 selected
bone marrow from a healthy donor spiked with Ewing's sarcoma cells at a
level of 1:100 is shown in figure 4a. These results demonstrate a 2-log
reduction in tumor following 8H9 based purging. To evaluate the efficiency
of 8H9 based purging with progenitor contamination at lower levels and to
assess the ability to purge CD34+ selected cells, CD34+ selected cells from G-
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
93
CSF mobilized peripheral blood were spiked at a level of 1:103 and purged as
shown in figure 4b. Using the quantitative PCR, we observed a 3-log reduction
in the level of contamination following one run over the column.
In the next experiments, evaluation of the ability to purge contaminated
PBMC populations was undertaken. Similar to the results observed with
CD34+ enriched peripheral blood stem cells, at least a 3-log reduction in
contamination following 8H9 based purging of PBMCs contaminated at 1:100
was attained as shovv~i in figure 4c. Evaluation of purging of PBMCs
1o contaminated at a lower level (1:103) is shown in figure 4d where a 3-log
reduction is again observed. In each of these experiments analysis of the
positive fraction demonstrated PCR positivity confirming selection of
contaminating Ewing's cells (data not shown). To account for any variation
from the expected uniform amounts of starting RNA or cDNA, G6PD
amplification was performed from each sample in a quantitative fashion. We
observed a variation in crossing time (reflective of starting template) of
less
than 2% in all of the samples indicating a low degree of variation in starting
template between samples and confirming viable RNA and cDNA in the
negative samples (data not shown). These results suggested that monoclonal
2o antibody 8H9 may be a suitable candidate for immunomagnetic based purging
of contaminated blood, bone marrow, and CD 34+ enriched progenitor
populations specimens with the likelihood for purging to PCR negativity being
high if the level of contamination present in clinical samples is less than
1:104.
Contamination of non-mobilized patient apheresis fractions with Ewing's
Sarcoma is between 1:105 -1:10.
In order to evaluate the degree of contamination typically observed in
clinical
specimens, we studied non-mobilized peripheral blood apheresis specimens
derived from patients treated on immunotherapy trials for Ewing's sarcoma at
our institution. We observed a 66 % (8/12) incidence of t(11,22) PCR
positivity in non-mobilized apheresis specimens acquired for use in
immunotherapy protocols as analyzed by conventional PCR (Table 1). As
shown in Table 1, all elutriated apheresis fractions were observed to contain
tumor with variability across individual patients. When elutriated apheresis
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
94
specimens from several patients at presentation of metastatic Ewing's
sarcoma were analyzed using quantitative PCR, this level of contamination
was estimated to be between 1:10$ and 1:106 with similar levels of
contamination sometimes observed in multiple apheresis fractions. (Figure 5).
Patient A (top panel) showed positivity of all fractions at levels of
approximately 1:106. Patient B (middle panel) showed a level of
contamination of approximately 1:106 in the 120m1/min (lymphocyte) fraction
with no evidence for positivity in the 190m1/min or rotor off (monocyte)
fractions. Patient C (bottom panel) showed a level of contamination between
l0 1:105 and 1:106 in multiple fractions. In no instance have we observed
levels
of contamination greater than 1:104. Therefore, because clinical specimens
contaminated with Ewing's sarcoma appears to be in the range of 1:105-1:106,
it is anticipated that reduction in contamination to at least 1:10' following
8H9
based purging will be achievable in the vast majority of patients.
Is
Table 1: Contamination of non-
mobilized apheresis fractions with
Ewing's sarcoma as analyzed by
conventional PCR.
Patient Number Lvmohocvte Fractions MonocVte Fractions
120m1/minl4oml/min190m1/minRotor
Off
20 1 N/A PositiveNegativePositive
2 PositivePositivePositivePositive
3 PositiveNegativePositiveNIA
4 NegativeNegativeN/A Positive
5 NegativeNegativeNegativeNegative
6 N/A NegativeNegativePositive
7 NegativeNegativeNegativeNegative
8 NegativeNegativeNegativeNegative
9 NegativePositivePositiveNegative
PositivePositiveNIA Positive
11 NegativeNegativeNegativeNegative
12 NegativeNegativeNegativePositive
25
Positive indicates band hybridized with the
EWS/FLI radiolabeled probe. Negative indicated
no band was noted. N/A indicated that no RNA
was obtained for that fraction.
30 8H9 based purging does not adversely affect stem cell or T cell function.
To further evaluate the clinical feasibility of this technique for purging of
bone
marrow or PBSC autografts, we sought to confirm retained proliferative and
differentiating capacity in 8H9 purged bone marrow populations. We studied
CFU formation following purging as an assay of CD34 function. We
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
compared CFU formation before and after purging in CD34 selected bone
marrow cells cultured in methycellulose media with recombinant cytokines
before and after purging (Figure 6). We observed normal colony numbers and
morphology in both samples with no significant difference between samples
5 indicating that CD34+ progenitors remain functional following 8H9 based
purging.
T cell proliferation is unchanged before and after purging.
Because T cells can contribute to post chemotherapy immune reconstitution25,
1o we are currently utilizing autologous T cell infusions harvested prior to
initiation of chemotherapy in order to study effects on immune reconstitution.
In order to study T cell function following 8H9 based purging, we evaluated T
cell proliferation following anti-CD3 cross linking as a measure of T cell
function. We compared T cell proliferation unmanipulated T cells and 8H9
15 based purged T cells. As shown in figure 7, there was no difference in T
cell
proliferation elicited by plate bound OKT3 antibody at concentrations ranging
from 100ug/ml to 3ug/nl as measured by [3H] thymidine uptake indicating that
T cell proliferative capacity is retained following 8H9 based purging (Figure
7).
Discussion
The contribution of contaminated autologous preparations to disease relapse
following autologous SCT in solid tumor patients is not fully known. Rill and
Brenner et al. have shown than in certain solid tumors, tumors contaminating
autologous grafts are tumorigenic and present at relapsel8, 19, In a disease
such as Ewing's sarcoma, which has been shown to have a high degree of
hematogenous spread, this becomes an important issue in the context of
therapies which utilize autologous cells. In high-risk patients, survival
after
high dose chemotherapy followed by stem cell rescue continues to be
3o suboptimal with the most common cause of death due to disease relapse.
Contamination of autografts with subsequent survival and clonogenic growth
of tumor post-infusion cannot be excluded as contributing to this poor
prognosis. In addition to the medical consequences of the administration of
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
96
contaminated products to patients, psychologically there is reluctance on the
part of patients and their families to receive contaminated products. It
follows,
therefore, that if a purging method was available, its evaluation for use in
patients receiving autologous products is warranted.
An ideal purging method should target only tumor cells and show no binding
to normal cell populations. The identification of such a tumor specific
antigen
has historically posed a challenge in Ewing's sarcoma. While CD99 typically
shows high expression on Ewing's sarcoma cells, it is also expressed on T
IO cells (figure 2a) and CD 34 stem cells 26, making it unsuitable for purging
hematologic products. Monoclonal antibody 8H9 was initially developed due
to its reactivity with neuroblastoma and was subsequently reported to react
with 19/19 fresh Ewing's sarcoma/PNET tumor confirming that 8H9 reactivity
is not limited to established cell lines. ~~. Our results (Figure 1) confirmed
this reactivity in all Ewing's cell lines evaluated. Since this antibody
showed
no reactivity with T cells and CD34+ cells, it was ideally suited for purging.
Indeed, we demonstrated a 2-3 log reduction in all experiments following one
run over the negative selection column. In the clinical setting of autologous
stem cell transplant, the combination of positive selection for CD34+ cells,
which results in an approximate 2-log passive depletion of tumor ~8~ 29,
followed by 8H9 purging of tumor cells would be expected to result in up to 5
logs of depletion, which is predicted to be well below the limit of detection
using currently available techniques. Further, even in the setting of
autologous T cell transplantation, as potentially used in the context of
immune
reconstitutive therapies2o, the use of 8H9 based purging with its 2-3 log
reduction will substantially diminish the tumor burden contained in autologous
cellular products.
This is the first published report of 8H9 as a Ewing's reactive monoclonal
antibody. Interestingly, 8H9 also shows reactivity with several
rhabdomyosarcoma and osteosarcoma cell lines (data not shown). This
introduces the exciting possibility of a sarcoma specific antibody with
potential applications in immune directed therapy. In addition, identification
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
97
and characterization of the tumor specific epitope which binds to 8H9 could
offer important insight into the biology of these tumors. These studies are
currently underway. Further, during the course of the studies reported here,
we sought to evaluate in a general sense, the function of sarcoma cells
selected
with 8H9. We observed that Ewing's sarcoma cells positively selected using
8H9 retain their clonogenic properties and are able to be maintained in cell
culture. This property has the potential aid in the generation and study of
tumor cell lines derived from patients with pediatric sarcomas, which is
currently difficult in these tumors due to limitations of tumor size and
surgical
l0 accessibility of primary tumors. We are currently investigating whether
Ewing's sarcoma cells derived from apheresis or bone marrow samples in
patients with metastatic disease which are positively selected and grown in
culture could provide a ready source of tumor samples for further biologic
study.
RT-PCR is a powerfully sensitive tool for use in monitoring minimal residual
disease MRD30. It remains unclear, however, whether evidence of small
amounts of residual tumor by molecular analysis is predictive for relapse in
solid tumors and data in the literature is conflicting. de Alava et al.
evaluated
MRD in Ewing's sarcoma patients and showed a correlation between PCR
positivity and disease relapse. In this report however, some patients remained
PCR positive without disease relapse 3. Using real-time PCR, it is now
possible to quantitate starting template and compare starting template amount
between samples obtained at different timepoints. Real- time quantitative PCR
has been used as a tool to monitor MRD in leukemia patients 31, 32and may
be useful in evaluation of disease response 33 and in predicting relapse in
patients by the detection of increasing levels of tumor specific transcript.
This is the first report of the use of real-time quantitative PCR used to
detect
and quantify Ewing's sarcoma transcript. It is possible that quantitative PCR
3o could allow for further identification of patients with a high risk of
relapse by
detection of increasing amounts of Ewing's transcripts over time. However,
because contamination of peripheral blood by solid tumors is likely to be
relatively low (in the range of 1:105-1:10 in this series), the sensitivity of
this
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
98
analysis must be very high in order to allow for the detection of very low
levels of circulating tumor in patients with solid tumors. The level of
sensitivity of our technique reached 1 Ewing's sarcoma cell in 10 ~ normal
cells with nested PCR from 10 X10 cells. It is possible that the level of
sensitivity would be even higher if higher cell numbers were evaluated since
this method appears capable in our hands of amplifying product from 10
contaminating cells. Tumor enrichment using positive selection is another
method to increase sensitivity of tumor detection. The positive
immunomagnetic selection procedure described in this paper for purging could
1o also provide a suitable approach for tumor enrichment in for monitoring MRD
or even in contributing to making the correct diagnosis at the time of initial
presentation with metastatic disease. Indeed, cells eluted from the column
were positive by PCR analysis, demonstrating the feasibility of this technique
for tumor enriclnnent which would be predicted to increase the sensitivity of
PCR detection of contaminating Ewing's sarcoma in patient samples. One
caveat which should be noted is that the quantitative technique, relies on the
assumption that the level of expression of t (11;22) is consistent among cell
lines and patient samples. This, may not be the case, however, and may lead
to under or over estimation of the absolute level of tumor burden when
2o comparing patient samples to a standard curve. Such limitations would not
preclude evaluation of changes in the level of PCR positivity of an individual
patient over time, wherein substantial changes in the level of expression of
t(11;22) may be less likely.
In this report we have demonstrated a purging technique that reduces tumor
burden in artificially contaminated products by at least 2-3 logs. This
approach is predicted to substantially reduce the tumor burden contained in
autologous cellular products which are administered in the context of
innovative therapies for Ewing's sarcoma. The demonstration that CFU
assays on progenitor cells as well as CD3 induced T cell proliferation are
normal after purging demonstrates no detrimental effects on normal progenitor
cell and T cell function, making this a potentially feasible addition to
autologous protocols. We conclude that imrnunomagnetic purging via
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
99
negative selection using MoAb 8H9 warrants evaluation in clinical trials for
Ewing's sarcoma involving the use of autologous products.
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
100
REFERENCES
1. Arndt CA, Crist WM. Common musculoskeletal tumors of childhood
and adolescence. N Engl J Med. 1999;341:342-S2.
2. West DC, Grier HE, Swallow MM, Demetri GD, Granowetter L, Sklar
J. Detection of circulating tumor cells in patients with Ewing's sarcoma and
peripheral primitive neuroectodermal tumor. J Clin Oncol. 1997;15:583-8.
3. de Alava E, Lozano MD, Patino A, Sierrasesumaga L, Pardo-Mindan
FJ. Ewing family tumors: potential prognostic value of reverse- transcriptase
polymerase chain reaction detection of minimal residual disease in peripheral
to blood samples. Diagn Mol Pathol. 1998;7:152-7.
4. Toretsky JA, Neckers L, Wexler LH. Detection of (11;22)(q24;q12)
translocation-bearing cells in peripheral blood progenitor cells of patients
with
Ewing's sarcoma family of tumors. J Natl Cancer Inst. 1995;87:385-6.
S. Burdach S, Jurgens H, Peters C, et al. Myeloablative
radiochemotherapy and hematopoietic stem-cell rescue in poor-prognosis
Ewing's sarcoma. J Clin Oncol. 1993;11:1482-8.
6. Burdach S, Nurnberger W, Laws HJ, et al. Myeloablative therapy,
stem cell rescue and gene transfer in advanced Ewing tumors. Bone Marrow
Transplant. 1996;18 Suppl 1:567-8.
7. Chars KW, Fetropoulos D, Choroszy M, et al. High-dose sequential
chemotherapy and autologous stem cell reinfusion in advanced pediatric solid
tumors. Bone Marrow Transplant. 1997;20:1039-43.
8. Fischmeister G, Zoubek A, Jugovic D, et al. Low incidence of
molecular evidence for tumour in PBPC harvests from patients with high risk
Ewing tumours. Bone Marrow Transplant. 1999;24:405-9.
9. Frohlich B, Ahrens S, Burdach S, et al. [High-dosage chemotherapy in
primary metastasized and relapsed Ewing's sarcoma. (EI)CESS]. Klin Padiatr.
1999;211:284-90.
10. Horowitz ME, Kinsella TJ, Wexler LH, et al. Total-body irradiation
3o and autologous bone marrow transplant in the treatment of high-risk Ewing's
sarcoma and rhabdomyosarcoma. J Clin Oncol. 1993;11:1911-8.
11. Ladenstein R, Lasset C, Pinkerton R, et al. Impact of megatherapy in
children with high-risk Ewing's tumours in complete remission: a report from
the EBMT Solid Tumour Registry [published erratum appears in Bone
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
101
Marrow Transplant 1996 Sep;IB(3):675]. Bone Marrow Transplant.
1995;15:697-705.
12. Ladenstein R, Philip T, Gardner H. Autologous stem cell
transplantation for solid tumors in children. Curr Opin Pediatr. 1997;9:55-69.
13. Laws HJ, Burdach S, van Kaick B, et al. Multimodality diagnostics
and megatherapy in poor prognosis Ewing's tumor patients. A single-center
report. Strahlenther Onkol. 1999;175:488-94.
14. Pape H, Laws HJ, Burdach S, et al. Radiotherapy and high-dose
chemotherapy in advanced Ewing's tumors. Strahlenther Onkol.
l0 1999;175:484-7.
15. Perentesis J, Katsanis E, DeFor T, Neglia J, Ramsay N. Autologous
stem cell transplantation for high-risk pediatric solid tumors. Bone Marrow
Transplant. 1999;24:609-15.
16. Pession A, Prete A, Locatelli F, et al. Phase I study of high-dose
thiotepa with busulfan, etoposide, and autologous stem cell support in
children
with disseminated solid tumors. Med Pediatr Oncol. 1999;33:450-4.
17. Stewart DA, Gyonyor E, Paterson AH, et al. High-dose melphalan +/
total body irradiation and autologous hematopoietic stem cell rescue for adult
patients with Ewing's sarcoma or peripheral neuroectodermal tumor. Bone
2o Marrow Transplant. 1996;18:315-8.
I8. Rill DR, Santana VM, Roberts WM, et al. Direct demonstration that
autologous bone marrow transplantation for solid tumors can return a
multiplicity of tumorigenic cells. Blood. 1994;84:380-3.
I9. Brenner MK, Rill DR, Moen RC, et al. Gene-marking to trace origin of
relapse after autologous bone-marrow transplantation. Lancet. 1993;341:85-6.
20. Mackall C, Long L, Dagher R, et al. Combined Immune
Reconstitution/Tumor Vaccination to induce anti-tumor immune responses in
the setting of minimal residual neoplastic disease [abstract]. Blood.
1999;94:133a.
21. Quinones RR, Gutierrez RH, Dinndorf PA, et al. Extended-cycle
elutriation to adjust T-cell content in HLA-disparate bone marrow
transplantation. Blood. 1993;82:307-17.
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
102
22. Kontny HU, Lehrnbecher TM, Chanock SJ, Mackall CL. Simultaneous
expression of Fas and nonfunctional Fas ligand in Ewing's sarcoma. Cancer
Res. 1998;58:5842-9.
23. Chirgwin JM, Przybyla AE, MacDonald RJ, Rutter WJ. Isolation of
biologically active ribonucleic acid from sources enriched in ribonuclease.
Biochemistry. 1979;18:5294-9.
24. de Wynter EA, Coutinho LH, Pei X, et al. Comparison of purity and
enrichment of CD34+ cells from bone marrow, umbilical cord and peripheral
blood (primed for apheresis) using five separation systems. Stem Cells.
1995;13:524-32.
25. Mackall CL, Gress RE. Pathways of T-cell regeneration in mice and
humans: implications for bone marrow transplantation and immunotherapy.
Immunol Rev. 1997;157:61-72.
26. Dworzak MN, Fritsch G, Buchinger P, et al. Flow cytometric
assessment of human MIC2 expression in bone marrow, thymus, and
peripheral blood. Blood. 1994;83:415-25.
27. Modak S, Gultekin S, Kramer K, et al. Novel Tumor-Associated
Antigen: Broad distrubution among neuroectodermal, mesenchymal and
epiethelial tumors, with restricted distribution in normal tissues. Abstract:
2o Proceedings at ASCO. 1998.
28. Vogel W, Scheding S, Kanz L, Brugger W. Clinical applications of
CD34(+) peripheral blood progenitor cells (PBPC). Stem Cells. 2000;18:87-
92.
29. Dyson PG, Horvath N, Joshua D, et al. CD34+ selection of autologous
peripheral blood stem cells for transplantation following sequential cycles of
high-dose therapy and mobilisation in multiple myeloma [In Process Citation].
Bone Marrow Transplant. 2000;25:1175-84.
30. Emig M, Saussele S, Wittor H, et al. Accurate and rapid analysis of
residual disease in patients with CML using specific fluorescent hybridization
probes for real time quantitative RT-PCR. Leukemia. 1999;13:1825-32.
31. Mensink E, van de Locht A, Schattenberg A, et al. Quantitation of
minimal residual disease in Philadelphia chromosome positive chronic
myeloid leukaemia patients using real-time quantitative RT-PCR. Br J
Haematol. 1998;102:768-74.
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
103
32. Pongers-Willemse' MJ, Verhagen OJ, Tibbe GJ, et al. Real-time
quantitative PCR for the detection of minimal residual disease in acute
lymphoblastic leukemia using functional region specific TaqMan probes.
Leukemia. 1998;12:2006-14.
33. Branford S, Hughes TP, Rudzki Z. Monitoring chronic myeloid
Ieukaemia therapy by real-time quantitative PCR in blood is a xeliable
alternative to bone marrow cytogenetics. Br J Haematol. 1999;107:587-99.
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
104
FIFTH SERIES OF EXPERIMENTS
Ewing's sarcoma is a childhood tumor characterized by a t(11,22) in most
patients Because survival remains suboptimal with standard thexapy, many
patients receive autologous stem cell transplant and trials investigating
adoptive transfer of autologous T cells in the context of immune therapy are
underway. However, approximately 50% of patiens with advanced disease
have PCR detectable disease in peripheral blood and/or bone marrow and
administration of contaminated auologous cell preparations may contribute to
disease relapse. To date, there is no reported method for purging contaminated
l0 hematopoietic cell populations of Ewing's Sarcoma. 8H9 is a mouse
monoclonal IgGI antibody previously reported to react with 21/21 Ewing's
sarcoma/PNET tumors (Proc ASCO 17:44a, 1998). Peripheral blood T cell
and B cell populations and CD34+ cells from bone marrow analyzed by flow
cytometry for binding of 8H9 were negative. We shought to use magnetic
1s bead immunoselection of 8H9 labeled cells to purge peripheral blood cell
populations contaminated with Ewing's sarcoma. Using real-time quantitative
nested PCR with Lightcycler, we monitored purging efficiency by evaluation
of t(11,22) by RT-PCR. Contaminated specimens were labeled with 8H9 and
incubated with rat anti-mouse IgGI magnetic beads. The sample was then run
20 over a Miltenyi Variomax negative slection column. Recovery was
approximately 70%. RNA was extracted from 10e7 cells from pre and post
purge cell populations. Real-time quantitative PCR was performed with a level
of sensitivity to one tumor call in 10e5 normal cells. We demonstrated at
least
a two-log reduction of tumor in preparations contaminated at a ratio of 1:10
25 normal PBMC and 1:10e3 normal PBMC. Further studies evaluating efficacy
in clinical samples are underway. These results demonstrate a potential new
approach for purging contaminated patient samples to be used in the context of
autologous bone marrow transplant and/or immunotherapy trials for Ewing's
sarcoma.
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
105
SIXTH SERIES OF EXPERIMENTS
Desmoplastic small round cell tumor (DSRCT) is an aggressive, often
misdiagnosed neoplasm of children and young adults. It is chemotherapy-
sensitive, yet patients often relapse off therapy because of residual
microscopic disease at distant sites: peritoneum, liver, lymph node and lung.
Strategies directed at minimal residual disease (MRD) may be necessary for
cure. Monoclonal antibodies selective for cell surface tumor-associated
antigens may have utility for diagnosis and therapy of MRD, as recently
demonstrated in advanced-stage neuroblastoma (JCO 16: 3053, 1998). Using
1o immunohistochemistry, we studied the expression of two antigens: (1) GD2
using antibody 3F8 and (2) a novel antigen using antibody 8H9, in a panel of
36 freshly frozen DSRCT. GDZ is a disialoganglioside which is widely
expressed among neuroectodermal tumors as well as adult sarcomas. 8H9
recognizes a surface 58kD antigen expressed among neuroectodennal,
mesenchymal and epithelial tumors with restricted expression on normal
tissues. 27 of 37 tumors (73%) were reactive with 3F8, and 35 of 37 (95%)
with 8H9. Both GDZ and the 58kD antigen were found on tumor cell
membrane and in stroma. In general, iznmunoreactivity was stronger and more
homogeneous with 8H9 than with 3F8. These antigens are potential targets
2o for imrnunodiagnosis and antibody-based therapy of DSRCT.
Desmoplastic small round cell tumor (DSRCT) is an aggressive, ill-understood
tumor affecting children and young adults. It is characterized clinically by
widespread abdominal serosal involvement, metastasizes to peritoneum, liver,
lungs and lymph nodes, and is associated with a poor prognosis (Gerald et al.,
1991). Histologically, it consists of small, undifferentiated round cells
surrounded by an abundant desmoplastic stroma. Immunohistochemically, the
coexpression of epithelial, neural and muscle markers is typical (Ordonez et
al., 1993). DSRCT is associated with a specific chromosomal translocation,
t(11;22)(p13;q12). The fused gene product aligns the NH2 terminal domain of
the EWS gene to the zinc forger DNA-binding domain of the WTl gene and is
diagnostic of DSRCT (Ladanyi et al., 1994). This fusion results in the
induction of endogenous platelet derived growth factor-A which stimulates
fibroblast growth and may contribute to the unique fibrosis observed with this
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
106
tumor (Lee et al, 1997). Further evidence of upregulation of growth factors
includes the reported expression of IGF-II, PDGF-a receptor and IL-11 in
DSRCT (Froberg et al., 1999).
Although dramatic response to aggressive multimodality therapy has been
demonstrated in the patients with DSRCT (Kushner et al., 1996), many
patients relapse with recurrent local disease or distant metastases.
Strategies
aimed at eradication of MRD are, therefore, warranted in the management of
patients with DSRCT. Monoclonal antibodies selective for cell surface tumor-
1o associated antigens are potential candidates as recently demonstrated in
neuroblastoma where immune targeting of the diasialoganglioside GDZ has
significantly improved long-term survival in patients with stage 4 disease
(Cheung et al., 1998). Few such tumor-associated targets have been defined
for DSRCT. We describe here two possible targets for such immunotherapy:
GDZ targeted by the monoclonal antibody 3F8 and a novel tumor antigen
recognized by the monoclonal antibody 8H9.
Materials and Methods
Tumor and normal tissue samples
2o Frozen tumors from 37 patients with DSRCT were analyzed. Diagnosis was
confirmed by hematoxylin and eosin assessment of paraffin-fixed specimens.
Monoclonal antibodies
The murine IgG3 monoclonal antibody 3F8 was purified from ascites as
previously described (Cheung et al., 1985). Using a similar technique, female
BALB/c mice were hyperimmunized with human neuroblastoma.
Lymphocytes derived from these mice were fused with SP2/0 mouse myeloma
cells line. Clones were selected for specific binding on ELISA. The 8H9
hybridoma secreting an IgGI monoclonal antibody was selected. 8H9 was
produced in vitro and purified by protein G (Pharmacia, Piscataway, NJ)
3o affinity chromatography.
Immunohistochemical studies
Eight ~.m cryostat frozen tumor sections were fixed in acetone and washed in
PBS. Immunohistochemical studies were performed as previously described
(Kramer et al. 1996) Endogenous peroxidases were blocked in 0.3% H202 in
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
107
PBS. Sections were incubated in 10% horse serum (Gibco BRL Gaithersburg,
MD) after blocking with avidin and biotin. Incubation with purified 8H9
diluted in PBS to 2~,g/ml was carried out at room temperature for 1 hour. An
IgGl myeloma was used as a control (Sigma Chemical, St Louis MO).
Sections were incubated with a secondary horse anti-mouse biotinylated
antibody (Vector Laboratories, Burlingame, CA) followed by incubation with
ABC complex (Vector Laboratories, Burlingame, CA) and stained with Vector
VIP peroxidase substrate (Vector Laboratories, Burlingame, CA) or DAB
peroxidase substrate kit (Vector Laboratories, Burlingame, CA). A 10%
l0 hematoxylin counterstain for 2 minutes was used. Staining was graded as
positive or negative and homogenous or heterogenous reactivity noted.
RESULTS
Clinical profile
Of the 37 patients studied, 32 were male and five female. Age at diagnosis
ranged from 13 to 46 years (median 18 years). All received treatment with an
aggressive multimodality regimen including dose-intensive chemotherapy.
Immunoreactivity
Tumor sections from 37 patients were tested for the expression of GDZ and the
2o antigen recognized by 8H9 by immunohistochemistry. 27 of 37 (73%) tested
positive for GD2, (Table 1). Most tumors had strong immunoreactivity (>1+),
Immunoreactivity was seen homogeneously in most tumors and was localized
to the cell membrane (Figure 1). Intense stromal staining was marked in all
tumors studied.
Table 1. Immunoreactivity of 3F8 and 8H9 with DSRCT
Marker No. Reactivi No. Homogeneous Heterogene
tested 0 1+ 2+ 3+ pos. (%)
GDZ 36 IO 10 12 4 26 (72) 19 7
Antigen 8H9 36 2 9 17 ,8 34 (94) 32 2
of 37 (95%) tumors tested positive for 8H9. Immunoreactivity had a
characteristic cell membrane localization and was homogeneous in almost all
tumors (Figure 2). Immunoreactivity was more strongly marked than that with
30 3F8. Equally strong stromal staining was seen.
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
108
Clinicopatholo~ic correlation
In this group of highly aggressive disseminated tumors, there was no
correlation between outcome and the expression of either GD2 or the 8H9
antigen (Table 2)
Table 2: GDZ and Antigen 8H9: Correlation with outcome
Goz positive 8H9 positive
Expired* 10/17 16/17
Survivors <18 mo since diagnosis 11/14 13/14
Survivors > 18 mo since diagnosis 5/5 5/5
* 1 patient died of treatment-related toxicity
Discussion
The clinicopathological spectrum of DSRCT continues to be further defined
1o since the initial series was reported in 1991 (Gerald et al., 1991).
Chemosensitivity to doxorubicin and alkylator-based chemotherapy has been
reported (Gonzalez-Crussi et al., 1990). Prolonged survival in response to an
aggressive multimodality regimen including high-dose chemotherapy,
radiation and surgery has also been reported (I~ushner et al., 1996). However,
most patients succumb to recurrent local disease or metastases to peritoneum,
liver, lymph nodes, or lung. Relapses can be largely attributed to the failure
of
eradication of MRD. Alternative therapeutic strategies to target MRD are
therefore warranted. One such strategy could be directed at the upregulated
growth factors particularly PDGFA and related factors expressed on DSRCT
(Froberg et al., 1999). Targeted immunotherapy utilizing monoclonal
antibodies, which does not add to the toxicity of chemotherapy, is another
approach.
DSRCT is characterized by the coexpression of epithelial, mesenchymal and
neuroectodermal markers. Recent publications have defined the
immunohistochemical and molecular make-up of DSRCT (Ordonez, 1998;
Gerald, 1999). However, most of the markers identified cannot be used as
targets for antibody mediated immunotherapy either due to crossreactivity
with normal tissues or inaccessibility to monoclonal antibodies due to
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
109
localization in the nucleus or cytoplasm. (Table 3). The most commonly
expressed markers on DSRCT including desmin, cytokeratin, vimentin,
epithelial membrane antigen and neuron-specific enolase are also widely
expressed on normal tissues. The MIC2 antigen has been reported to be
expressed on 20-35% of DSRCT. However, unlike Ewing's sarcoma family of
tumors, which have membrane localization, immunoreactivity in DSRCT is
primarily cytoplasmic (Gerald et al, 1998). MOC31, a monoclonal antibody
that recognizes epithelial glycoprotein 2 (EGP-2) has been shown to be
reactive with most DSRCT tested (Ordonez, 1998). EGP-2 is overexpressed
to on epithelial tumors, but is also present on normal epithelial cells (de
Leij et
al, 1994). Antibodies directed against the WTl protein have strong, specific,
nuclear immunoreactivity with almost all DSRCT tested (Gerald et al, 1998)
Table 3: Previously reported antigens on DSRCT
Antigen Localization Crossreactivity
Intermediate filaments
Desmin cytoplasm skeletal, cardiac & smooth
muscle
Vimentin cytoplasm mesenchymal tissues
Keratin cytoplasm epithelial cells
Epithelial antigens
Epithelial membranecytoplasm epithelial cells
antigen
Epithelial glycoprotein-2cytoplasm epithelial cells
Ber-Ep4 antigen cytoplasm epithelial cells
Neural antigens
CD57 cytoplasm neural tissues
Neuron-specific cytoplasm neural tissues
enolase
MIC-2 cytoplasm & cell lymph nodes, epithelial
membrane cells
WTl protein Nucleus None
PDGFA Cell membrane Endothelial cells,
PDGF-areceptor Cell membrane hematopoeitic cells
Endothelial cells,
hematopoeitic cells
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
110
The reported expression of neuroectodermal antigens on DSRCT led us to
study these tumors for the expression of GD2: a disialoganglioside which is
expressed on other small blue round cell tumors such as neuroblastoma , small
cell lung cancer , melanoma and osteosarcoma (Heiner et al., 1987) as well as
on adult soft tissue sarcomas (Chang et al., 1992). GD2 is a safe target for
immunotherapy based on clinical trials of the anti-GDZ antibody 3F8 in
patients with neuroblastoma. tissues of the nervous system (Cheung et al.,
1998). Serum GD2 does not interfere with the biodistribution of specific
antibodies and the antigen is not modulated from the cell surface upon binding
1o by antibodies. Successful targeting of the monoclonal antibody 3F8 to GDz
was previously demonstrated in neuroblastoma (Yeh et al., 1991) and small
cell lung cancer (Grant et al., 1996). 3F8 has also shown efficacy in clinical
trials in patients with neuroblastoma (Cheung et al., 1998b) and melanoma
(Cheung et al., 1987). Furthermore, 3F8 appeared to induce long-term
remissions in patients with Stage 4 neuroblastoma. Reported side effects are
short-lived and manageable (Cheung et al., 1998). In our study 72% of
DSRCT tested were immunoreactive with the anti-GD2 antibody 3F8. Most
tumors snowed strong, homogeneous reactivity localized to the cell
membrane. (Table 1) (Figure 1) DSRCT may be a putative tumor for in vivo
2o antibody targeting with 3F8. Alternatively, an anti-idiotypic vaccine
approach
can be utilized as has been suggested for neuroblastoma. (Cheung et al, 1994)
The monoclonal antibody 8H9 is a murine IgGI derived from mice immunized
with neuroblastoma. It has been shown to have a broad expression on
neuroectodermal, rnesenchymal and epithelial tumors with limited expression
on normal tissues. (data not shown). Its immunoreactive profile led us to use
it
for testing DSRCT. 95% of tumors tested positive with DSRCT.
Immunoreactivity with DSRCT was localized to the stroma and cell
membrane (Figure 2) and for most tumors was intense and homogeneous, and
3o in general, stronger than that observed for GD2 (Table 2).
The target antigen for 8H9 appears to be a novel 58kD glycoprotein with a
unique distribution on cell membranes of tumors of varying lineage, but
restricted expression in normal tissues. This tissue distribution makes it
likely
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
111
to be a unique antigen not previously described on DSRCT. The cell
membrane localization of 8H9 allows it to be targeted by monoclonal
antibodies. 8H9 conjugated with 1131 has been shown to radioimmunolocalize
neuroblastoma and rhabdomyosarcoma xenografts in mice without significant
crossreactivity with other organs. (data not shown).
In the therapy of DSRCT, strategies to eliminate minimal residual disease are
necessary to produce cures. Monoclonal antibody based therapy may augment
aggressive multimodality therapy by targeting minimal residual disease
to without adding to toxicity. Our study has identified GDZ and antigen 8H9 as
two hitherto undescribed markers for DSRCT, which can potentially be targets
for differential diagnosis and immunotherapy.
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
112
REFERENCES
Chang H.R., Cordon-Cardo C., Houghton A.N., Cheung N.K., and Brennan
M.F., Expression of disialogangliosides GDZ and GD3 on human soft tissue
sarcomas. Cancer 70: 633-8, (1992)
Cheung N.K., Saarinen, U., Neely, J., Landmeier, B., Donovan D., and
Coccia, P. Monoclonal antibodies to a glycolipid antigen on human
neuroblastoma cells. Cancer Res., 45: 2642-2649, (1985)
Cheung N.K., Lazarus, H., Miraldi F.D., Abramowsky, C.R., Kallick S.,
Saarinen, U.M., Spitzer, T., Strandjord, S.E., Coccia, P.F., and Bergen N.A.
to Ganglioside GDZ specific monoclonal antibody 3F8: a phase I study in
patients
with neuroblastoma and malignant melanoma. J. Clin.Oncol. 5: 1430-40,
(1987)
Cheung, N.K., Cheung, LY., Canete, A., Yeh, S.J., Kushner, B., Bonilla,
M.A., Heller, G., and Larson, S.M. Antibody response to murine anti GDZ
is monoclonal antibodies: correlation with patient survival. Cancer Res. 54:
2228-33 (1994)
Cheung NK., Kushner B.H., Yeh S.D.J., and Larson S.M., 3F8 monoclonal
antibody treatment of patients with stage 4 neuroblastoma: a phase II study.
Int. J. Oncol 12: 1299-306, (1998b)
20 Cheung, N.K., Kushner, B.H., Cheung, LY., Kramer, K., Canete, A., Gerald,
W., Bonilla, M.A., Fiim, R., Yeh, S., and Larson, S.M., Anti GDZ antibody
treatment of minimal residual stage 4 neuroblastoma diagnosed at more than 1
year of age. J. Clin. Oncol., 16: 3053-60, (1998)
De Leij, L., Helrich, W., Stein, R., and Mattes M.J. SCLC-cluster-2 antibodies
25 detect the pancarcinomalepithelial glycoprotein E GP-2 (supplement) Int. J.
Cancer 8: 60-3, 1994
Froberg, K., Brown, R.E." Gaylord, H." Manivel, C., Intra-abdominal
desmoplastic small round cell tumor: immunohistochemical evidence for up
regulation of autocrine and paracrine growth factors. Ann Clin Lab Sci 29: 78
30 85, 1999
Gonzalez-Crussi, F., Crawford, S.E., and Sun, C.J. Intraabdominal
desmoplastic small-cell tumors with divergent differentiation. Observation on
three cases of childhood. Am. J. Surg. Pathol: 15: 499-513, (1991)
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
113
Grant, S.C., Kostakoglu, L., Kris, M.G., Yeh, S.D., Larson, S.M., Finn, R.D,,
Oettgen, H.F., and Cheung, N.K. targeting of small-cell lung cancer using the
anti-GD2 ganglioside monoclonal antibody 3F8: a pilot trial. Eur.J.Nucl. Med.
23: 145-9 (1996)
Heiner, J.P., Miraldi, F., Kallick, S., Makley J., Neely, J., Smith-Mensah,
W.H., and Cheung N.K. Localization of GDZ- specific monoclonal antibody
3F8 in human osteosarcoma. Cancer Res. 47: 5377-81 (1987)
Kramer, K., Gerald, W., Le Sauteur, L., LTriSaragovi, H., and Cheung, N.K.
Prognostic Value of TrkA Protein Detection by Monoclonal Antibody SC3 in
to Neuroblastoma. Clin. Cancer Res. 2: 1361-1367, 1996
Kushner, B.H., LaQuaglia M.P., Wollner, N., Meyers, P.A., Lindsley, K.L.,
Ghavimi, F., Merchant, T.E., Boulad, F., Cheung, N.K., Bonilla, M.A.,
Crouch, G., Kelleher, J.F., Steinherz, P.G., and Gerald, W.L., Desmoplastic
small round-cell tumor: prolonged progression-free survival with aggressive
multimodality therapy. J.Clin. Oncol. 14: 1526-31, (1996)
Ladanyi, M., and Gerald, W., Fusion of the EWS and WT1 genes in the
desmoplastic small round cell tumor. Cancer Res. 54: 2837-40, (1994)
Lee, S.B., Kolquist, K.A., Nichols, K.., Englert, C,, Maheshwaran, S.,
Ladanyi, M., et al., The EWS-WTl translocation product induces PDGFA in
desmoplastic small round- cell tumour. Nat Genet 17, 309-13, 1997
Gerald, W.L., Miller, H.K., Battifora,H., Miettenen, M., Silva, E.G., and
Rosai, J.,Intrabdominal desmoplastic small round cell tumor. Report of I9
cases of a distinctive type of high-grade polyphenotypic malignancy affecting
young individuals. Am. L. Surg. Pathol. 15, 499-513, (1991)
Gerald, W.L., Ladanyi, M.L., De Alava, E., Cuatrecasas, M., Kushner, B.H.,
LaQuaglia, M.P., and Rosai, J. Clinical pathologic, and molecular spectrum of
tumors associated with t(11;22)(p13;q12): desmoplastic small round-cell
tumor and its variants. J. Clin. Oncol., 16: 3028-36, (1998)
Ordonez, N.G., El-Naggar, A.K., Ro, J.Y., Silva, E.G., Mackay B., Intra
abdominal desmoplastic small cell tumor: a light microscopic,
immunocytochemical, ultrastructural, and flow cytometric study. Hum. Pathol.
24, 850-65, (1993)
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
114
Ordonez, N.G. Desmoplastic small round cell tumor: II: an ultrastructural and
immunohistochemical study with emphasis on new immunohistochemical
markers. Am. J. Surg. Pathol. 22: 1314-27, (1998)
Yeh S.D., Larson, S.M., Burch, L., Kushner, B.H., LaQuaglia, M, Finn, R.,
and Cheung, N.K. Radioimmunodetection of neuroblastoma with iodine-131
3F8: correlation with biopsy, iodine-131-metaiodobenzylguanidine and
standard diagnostic modalities. J.Nucl.Med. 32: 769-76 (1991)
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
115
SEVENTH SERIES OF EXPERIMENTS
ScFv provides a versatile homing unit for novel antibody-fusion constructs.
However, a reliable screening and binding assay is often the limiting step for
antigens that are difficult to clone or purify. We demonstrate that anti-
s idiotypic antibodies can be used as surrogate antigens for cloning scFv and
their fusion proteins. 8H9 is a murine IgGl monoclonal antibody specific for
a novel antigen expressed on the cell surface of a wide spectrum of human
solid tumors but not in normal tissues (Cancer Res 61:4048,2001) Rat anti-
8H9-idiotypic hybridomas (clones 2E9, 1E12 and 1F11) were produced by
l0 somatic cell fusion between rat lymphocytes and mouse SP2/0 myeloma. In
direct binding assays (ELISA) they were specific for the 8H9 idiotope. Using
2E9 as the surrogate antigen, 8H9-scFv was cloned from hybridoma cDNA by
phage display. 8H9scFv was then fused to human-1-CH2-CH3 cDNA for
transduction into CHO and NSO cells. High expressors of mouse scFv-human
15 Fc chimeric antibody were selected. The secreted homodimer reacted
specifically with antigen-positive tumor cells by ELISA and by flow
cytometry, inhibitable by the anti-idiotypic antibody. The reduced size
resulted in a shorter half life in vivo, while achieving comparable tumor to
nontumor ratio as the native antibody 8H9. However, it could not mediate
2o antibody-dependent cell-mediated or complement-mediated cytotoxicities in
vitro.
1. Introduction
The ability to condense the binding site by genetic fusion of variable region
immunoglobulin genes to form scFv has greatly expanded the potential and
25 development of antibody-based targeted therapies (Bird et al., 1988; Huston
et
al., 1988; Winter and Milstein, 1991; George et al., 1994). Using phage
display libraries, scFv can now be cloned from cDNA libraries derived from
rodents, immunized volunteers, or patients (Burton and Barbas III, 1994;
Winter et al., 1994; Cai and Garen, 1995; Raag and Whitlow, 1995). The
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
116
availability of hIg-transgenic and transchromosomal mice will allow
immunization schema or pathogens not feasible or safe in humans.
Construction of the scFv is the critical first step in the synthesis of
various
fusion proteins, including scFv-cytokine (Shu et al., 1993), scFv-streptavidin
(Kipriyanov et al., 1995), scFv-enzyme (Michael et al., 1996), scFv-toxins
(Wikstrand et al., 1995), bispecific scFv (diabodies) (Alt et al., 1999),
bispecific chelating scFv (DeNardo et al., 1999), scFv-Ig (Shu et al., 1993),
tetravalent scFv (Alt et al., 1999; Santos et al., 1999) and scFv-retargeted T-
cells (Eshhar et al., 1993). ScFv-Ig constructs mimic natural IgG molecules in
to their homodimerization through the Fc region, as well as their ability to
activate complement (CMC) and mediate antibody dependent cell-mediated
cytotoxicites (ADCC).
The construction of scFv requires a reliable antigen preparation both for
panning phages and for binding assays. They often become a rate-limiting
step (Lu and Sloan, 1999), particularly for antigens that are difficult to
clone
or purify. Cell-based phage display (Watters et al., 1997), and enzyme linked
immunosorbent assays (ELISA) when optimized, have been successfully
applied as alternatives. However, subtle differences in the panning step can
2o determine the success or failure of phage display (Tur et al., 2001). For
example, a reduction in wash pH is needed for scFv directed at ganglioside
GD2 in order to reduce nonspecific adherence of phage particles
(Tur et al., 2001). Moreover, phage binding assay may require membrane
preparations to withstand the vigorous washing procedure.
Anti-idiotypic antibodies are frequently used as antigen mimics of infectious
agents and tumor antigens (Thanavala et al., 1986; Wagner et al., 1997).
When made as MoAb, they are ideal surrogates when the target antigen is not
readily available. The physico-chemical behavior of immunoglobulins as
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
117
antigens in panning and binding assays is generally known and can be easily
standardized. We recently described a novel tumor antigen reactive with a
murine MoAb 8H9 (Modak et aL, 2001). Given its lability and glycosylation,
this antigen is difficult to purify. Here we describe the use of an anti-
idiotypic
s antibody as a surrogate antigen for cloning a scFv derived from the 8H9
hybridoma cDNA library, and for the selection of chimeric mouse scFv-
human Fc fusion constructs.
2. Materials and Methods
2,1 Ataimals
1o BALBIc mice were purchased from Jackson Laboratories, Bar Harbor, ME.
Lou/CN rats were obtained from the National Cancer Institute-Frederick
Cancer Center (Bethesda, MD) and maintained in ventilated cages.
Experiments were carried out under a protocol approved by the Institutional
Animal Care and Use Committee, and guidelines for the proper and humane
15 use of animals in research were followed.
2,2 Cellli~aes
Human neuroblastoma cell lines LAN-1 was provided by Dr. Robert Seeger
(Children's Hospital of Los Angeles, Los Angeles, CA), and NMB7 by Dr.
Shuen-Kuei Liao (McMaster University, Ontario, Canada). Cell lines were
2o cultured in 10% defined calf serum (Hyclone, Logan, UT) in RPMI with 2
mM L-glutamine, 100 U/ml of penicillin (Sigma-Aldrich, St. Louis, MO), 100
ug/ml of streptomycin (Sigma-Aldrich), 5% COZ in a 37°C humidified
incubator. Normal human mononuclear cells were prepared from heparinized
bone marrow samples by centrifugation across a Ficoll-Hypaque density
25 separation gradient. Human AB serum (Gemini Bioproducts, Woodland, CA)
was used as the source of human complement.
2.3 Mofioclonal Arxtibodies
Cells were cultured in RPMI 1640 with 10% newborn calf serum (Hyclone,
Logan, UT) supplemented with 2mM glutamine, I00 U/ml of penicillin and
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
118
100 ug/ml of streptomycin (Sigma-Aldrich). 3F8, an IgG3 MoAb raised in a
Balblc mouse against human neuroblastoma, specifically recognizes the
ganglioside GD2. The BALB/c myeloma proteins MOPC-104E, TEPC-183,
MOPC-351, TEPC-15, MOPC-21, UPC-10, MOPC-I4I, FLOPC-21, and
Y5606 were purchased from Sigma-Aldrich. MoAb R24 (anti-GD3), V1-R24,
and K9 (anti-GD3) were gifts from Dr. A. Houghton, OKB7 and M195 (anti-
CD33) from Dr. D. Scheinberg, and 10-11 (anti-GM2) from Dr. P. Livingston
of Memorial Sloan Kettering Cancer Center, New York; and 528 (EGF-R)
from Dr. J. Mendelsohn of MD Anderson, Houston, TX. 2E6 (rat anti-mouse
1o IgG3) was obtained from hybridomas purchased from American Type Culture
Collection [ATCC] (Rockville, MD). NR-Co-04 was provided by Genetics
Institute (Cambridge, MA). In our laboratory, SF9, 8H9, 3A5, 3E7, 1D7, 1A7
were produced against human neuroblastoma; 2C9, 2E10 and 3E6 against
human breast carcinoma, and 4B6 against glioblastoma multiforme. They
were all purified by protein A or protein G (Pharmacia, Piscataway, NJ)
affinity chromatography.
2.4 Anti-8H9 anti-idiotypic antibodies
LOU/CN rats were immunized intraperitoneally (ip) with 8H9 (400 ug per rat)
complexed with rabbit anti-rat serum (in 0.15 ml), and emulsified with an
2o equal volume (0.15 ml) of Complete Freund's Adjuvant (CFA) (Gibco-BRL,
Gaithersburg, MD). The 8H9-rabbit-IgG complex was prepared by mixing 2
ml (8 mg) of purified 8H9 with 4 ml of a high titer rabbit anti-rat
precipitating
serum (Jackson Immunoresearch Laboratories, West Grove, PA). After
incubation at 4°C for 3 hours, the precipitate was isolated by
centrifugation at
2500 rpm for 10 minutes, and resuspended in PBS. Three months after
primacy immunization, the rats Were boosted ip with the same antigen in CFA.
One month later, a 400 ug boost of 8H9-rabbit-anti-mouse complex was
injected intravenously. Three days afterwards, the rat spleen was removed
aseptically, and purified lymphocytes were hybridized with SP2/0-Agl4
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
119
(ATCC). Clones selection was based on specific binding to 8H9 and not to
control antibody SF9, a murine IgGl. Repeated subcloning using limiting
dilution was done. Isotypes of the rat monoclonal antibodies were determined
by Monoclonal Typing Kit (Sigma-Aldrich). Rat anti-idiotypic antibody
clones (2E9, 1E12, 1F11) were chosen and produced by high density
miniPERM bioreactor (Unisyn technologies, Hopkinton, MA), and purified by
protein G affinity chromatography (Hitrap G, Pharmacia). The IgG fraction
was eluted with pH 2.7 glycine-HCl buffer and neutralized with 1 M Tris
buffer pH 9. After dialysis in PBS at 4°C for 18 hours, the purified
antibody
1o was filtered through a 0.2 um millipore filter (Millipore, Bedford, MA),
and
stored frozen at -70°C. Purity was determined by SDS-PAGE
electrophoresis
using 7.5% acrylamide gel.
The "standard" ELISA to detect rat anti-idiotypic antibodies (Ab2) was as
follows: Purified 8H9, or irrelevant IgGl myeloma, were diluted to 5 ug/ml in
PBS and 50 u1 per well was added to 96-well flat-bottomed polyvinylchloride
(PVC) microtiter plates and incubated for 1 hour at 37°C. Rows with no
antigen were used for background subtraction. Filler protein was 0.5% BSA
in PBS and was added at 100 u1 per well, and incubated for 30 minutes at
4°C.
2o After washing, 50 u1 duplicates of hybridoma supernatant was added to the
antigen-coated wells and incubated for 3 hours at 37°C. The plates were
washed and a peroxidase-conjugated mouse anti-rat IgG + IgM (Jackson
Immunoresearch Laboratory) at 100 u1 per well was allowed to react for 1
hour at 4°C. The plate was developed using the substrate o-
phenylenediamine
(Sigma-Aldrich) (0.5 mg/ml) and hydrogen peroxide (0.03%) in 0.1 M citrate
phosphate buffer at pH 5. After 30 minutes in the dark, the reaction was
quenched with 30 u1 of 5 N sulfuric acid and read using an ELISA plate
reader.
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
120
2. S Specificity by divect bi~adiyag assay
Fifty u1 per well of purified mouse monoclonal antibodies or myelomas were
coated onto 96-well PVC rnicrotiter plates at 5 ug/ml for 60 minutes at
37°C,
aspirated and then blocked with 100 u1 of 0.5% BSA filler protein per well.
After washing and air-drying, the wells were allowed to react with
anti-idiotypic antibodies. The rest of the procedure was identical to that
described in the "standard" assay.
2.6 Specificity by inhibition assay
To further examine the specificity of these anti-idiotypic antibodies,
inhibition
of 8H9 immunofluorescent staining of tumor cells by anti-idiotypic antibodies
was tested. Purified 8H9 and anti-GD2 MoAb 3F8, (all 10 ug/ml in 0.5%
BSA) were preincubated with various concentrations of anti-idiotypic
antibodies for 30 minutes on ice before reacting with 10~ cells of either GD2
positive/8H9 positive LAN-1 (neuroblastoma) or GD2-negative/8H9-positive
HTB-82 (rhabdomyosarcoma). The cells were then washed twice in PBS
with 0.1 % sodium azide and reacted with FITC-conjugated rat anti-mouse IgG
(Biosource, Burlingame, CA) on ice for 30 minutes in the dark. The cells
were washed in PBS with azide, fixed in 1% paraformaldehyde and analyzed
by FACScan (Becton-Dickinson, CA). The mean fluorescence was calculated
2o and the inhibition curve computed.
2. 7 Corzsts~uctio~a of scFv gefae
mRNA was isolated from 8H9 hybridoma cells using a commercially available
kit (Quick Prep Micro mRNA Purification, Pharmacia Biotech) following the
procedures outlined by the manufacturer. 5 x10 hybridoma cells cultured in
RPMI-1640 medium supplemented 10% calf serum, L-glutamine (2mmo1/L),
penicillin (100 u/L) and streptomycin sulphate (100 ug/ml) were pelleted by
centrifugation at 800xg and washed once in RNase-free phosphate buffered
saline (pH 7.4). The recentrifuged cells were lysed directly in the extraction
buffer. Poly(A)-RNA was purified by a single fractionation over oligo
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
121
(dT)-cellulose and eluted from oligo (dT) cellulose in the elution buffer. The
mRNA sample was precipitated for 1 hour with 100 ug glycogen, 40 u1 of ZM
potassium acetate solution and 1 ml of absolute ethanol at -20°C. The
nucleic
acid was recovered by centrifugation at 10,000 xg for 30 min. The sample was
evaporated until dry, and dissolved in 20u1 RNase-free water.
ScFv gene was constructed by recombinant phage display. 5u1 of mRNA was
reversely transcribed in a total volume of 11 u1 reaction mixture and lul
dithiothreitol (DTT) solution for 1 hour at 37°C. For the PCR
amplification of
8H9 immunoglobulin variable regions, light chain primer mix and the heavy
chain primer set (Fharnzacia) were added respectively to generate suitable
quantities of the heavy (340bp) and light (325bp) chain. Following an initial
10 min dwell at 95°C, 5U AmpliTaq Gold DNA polymerase (Applied
Biosystems, Foster City, CA) was added. The PCR cycle consisted of a 1 min
denaturation step at 94°C, a 2 min annealing step at 55°C and a
2 min
extension step at 72°C. After 30 cycles of amplification, PCR derived
fragment was purified by the glassmilk beads (Bio101, Vista, CA) and then
separated by 1.5% agarose gel electrophoresis in TAE buffer and detected by
ethidium bromide staining.
For the assembly and fill-in reaction, both purified heavy chain and light
chain
fragments were added to an appropriate PCR mixture containing a 15 amino
acid linker-primer for 8H9, dNTPs, PCR buffer and Ampli Taq Gold DNA
polymerase. PCR reactions were performed at 94°C for 1 min, followed by
a
4 min annealing reaction at 63°C. The heavy and light chain DNA of 8H9
were joined by the linker (GGGS)3 (Pharmacia) into scFv in a VH-VL
orientation after 7 therniocycles.
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
122
Using an assembled scFv DNA of 8H9 as template, a secondary PCR
amplification (30 standard PCR cycles) was carried out using primers
containing either Sfi I or Not I restriction sites. Thus, the Sfi I and Not I
restriction sites were introduced to the 5' end of heavy chain and the 3' end
of
light chain, respectively. Amplified ScFv DNAs were purified by glassmilk
beads and digested with Sfi I and Not I restriction endonucleases. The
purified ScFv of 8H9 was inserted into the pHENl vector (kindly provided by
Dr. G. Winter, Medical Research Council Centre, Cambridge, UK) containing
Sfi I/ Nco I and Not I restriction sites. Competent E.coli XL 1-Blue cells
l0 (Stratagene, La Jolla, CA) were transformed with the pHENl phagemid.
Helper phage M13 K07 (Pharmacia) was added to rescue the recombinant
phagemid.
2.8 Eszriclzmetzt of recofzzbizzazzt phageyzzid by pazzfzifzg
50u1 of anti-8H9 idiotypic antibody 2E9 (50ug/ml) in PBS was coated on the
96-well PVC microtiter plates and incubated at 37°C for 1 hour. 100 u1
of the
supernatant from phage library was added to each well and incubated for 2
hours. The plate was washed 10 times with PBS containing 0.05% BSA.
Antigen-positive recombinant phage captured by the anti-idiotype MoAb 2E9
was eluted with O.1M glycine-HCl (pH 2.2 containing 0.1% BSA) and
neutralized with 2M Tris solution. This panning procedure was repeated
three times. The phagemid 8HpHM9F7-1 was chosen for the rest of the
experiments.
2.9 ELISA
The selected phage was used to reinfect E.coli XL 1-Blue cells. Colonies were
grown in 2xYT medium containing ampicillin (100ug/ml) and 1% glucose at
30°C until the optical density of 0.5 unit at 600 nm was obtained.
Expression
of scFv antibody was induced by changing to the medium containing 100uM
IPTG (Sigma-Aldrich) and incubating at 30°C overnight. The
supernatant
obtained from the medium by centrifugation was directly added to the plate
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
123
coated with anti-idiotype 2E9. The pellet was resuspended in the PBS
containing 1mM EDTA and incubated on ice for 10 min. The periplasmic
soluble antibody was collected by centrifugation again and added to the plate.
After a 2-hour incubation at 37°C, plates were washed and anti-
MycTag
antibody (clone 9E10 from ATCC) was added for 1 hour at 37°C. After
washing, affinity purified goat anti-mouse antibody (Jackson
Immunoresearch) was allowed to react for 1 hour at 37°C and the
plates were
developed with the substrate o-phenylenediamine (Sigma-Aldrich) as
previously described.
2.10 Coustructiosz of ScFv-Izunza>z-1-CH2-CH3 szzouse lzufzza>z-clzimeric
gene
A single gene encoding scFv8H9 ~ was generated by PCR method using
phagemid 8HpHM9F7-1 as the template. Secondary PCR amplification (30
PCR cycles) was carried out to insert the human IgGl leader sequence at the
5'end of the scFv8H9 DNA plus the restriction sites at the two opposite ends,
i.e. Hind III and Not I, at the 5' end of human IgGl leader and at the 3' end
of
scFv8H9, respectively. Amplified human IgGl leader - scFv8H9 DNA was
purified by glassmilk beads and digested with Hind III and Not I restriction
endonucleases according to manufacturer's instructions. The Hind III - Not I
2o fragment of human IgGl leader-scFv8H9 cDNA was purified on agarose gel
. and ligated into pLNCS23 vector carrying the human-~yl-CH2-CH3 gene
(kindly provided by Dr. J. Schlom, National Cancer Institute, NIH, Bethesda,
MD) (Shu et al., 1993). Competent E.coli XL 1-Blue cells were transformed
with pLNCS23 containing the scFv phagemid. The scFv-CH2-CH3 DNA was
primed with appropriate primers and sequenced using the Automated
Nucleotide Sequencing System Model 373 (Applied Biosystems). The
sequences agreed with the cDNA sequences of the light and heavy chains of
8H9 as well as the human; 1-CH2-CH3 available from GenBank, including the
ASN 297 of the CH2 domain. In this construct, Cys220 of the genetic hinge
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
124
was replaced by a proline residue, while Cys226 and Cys229 were retained in
the functional hinge (Shu et al., 1993)
2.11 Cell Culture and Tf~aszsfection
CHO cell or NSO myelomas cells (Lonza Biologics PLC, Bershire, UK) were
cultured in RPMI 1640 (Gibco-BRL) supplemented with glutamine, penicillin,
streptomycin (Gibco-BRL) and 10% fetal bovine serum (Gibco-BRL). Using
effectene transfection reagent (Qiagen, Valencia, CA), recombinant
ScFv8H9-human; 1-CH2-CH3 was introduced via the pLNCS23 into CHO cell
or NSO myelomas cells. Cells were fed every 3 days, and 6418 (1 mg/ml;
to Gibco-BRL) resistant clones were selected. After subcloning by limiting
dilution, chimeric antibodies were produced by high density miniPERM
bioreactor from Unisyn Technologies using 0.5% ULG-FBS in
Hydridoma-SFM (Invitrogen Corporation, Carlsbad, CA). The chimeric
antibodies were purified by protein G (Pharmacia) affinity chromatography.
2.12 SDS-PAGE aszd Wester~z BlotAnalysis
The supernatant, the periplasmic extract and cell extract from the positive
clones were separated by reducing and nonreducing SDS-PAGE. 10%
SDS-polyacrylamide slab gel and buffers were prepared according to Laemmli
(Laemmli, 1970). Electrophoresis was performed at 100V for 45 min. After
2o completion of the run, western blot was carried out as described by Towbin
(Towbin et al., 1979). The nitrocellulose membrane was blocked by 5% nonfat
milk in TBS solution for 1 hour and incubated with anti-idiotype 2E9 antibody
overnight at 4°C. After incubating with HRP-conjugated goat anti-rat Ig
(Fisher Scientific Co., Pittsburgh, PA), the signal was detected by ECL system
(Amersham-Pharmacia Biotech).
2.13 Cytotoxicity Assay
Target NMB7 or LAN-1 tumor cells were labeled with Na2siCr04 (Amersham
Pharmacia) at 100 uCi/10~ cells at 37°C for 1 hour. After the
cells were
washed, loosely bound slCr was leaked for 1 hour at 37°C. After further
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
125
washing, 5000 target cells/well were admixed with lymphocytes to a final
volume of 200 ~.1/well. Antibody dependent cell-mediated cytotoxicity
(ADCC) was assayed in the presence of increasing concentrations of chimeric
antibody. In complement mediated cytotoxicity (CMC), human complement
(at 1:5, 1:15 and 1:45 final dilution) was used instead of lymphocytes. The
plates were incubated at 37°C for 4 hours. Supernatant was harvested
using
harvesting frames (Skatron, Lier, Norway). The released SICr in the
supernatant was counted in a universal gamma-counter (Packard Bioscience,
Meriden, CT). Percentage of specific release was calculated using the formula
100% x (experimental cpm - background cpm)/(10% SDS releasable cpm -
background cpm), where cpm were counts per minute of SICr released. Total
release was assessed by lysis with 10% SDS (Sigma-Aldrich), and background
release was measured in the absence of cells. The background was usually <
30% of total for either NMB7 or LAN-1 cells. Antibody 3F8 was used as the
positive control (Cheung et al., 1985).
2.14 Iodifaatio~a
MoAb was reacted for 5 min with lzsl (NEN Life Sciences,Boston, MA ) and
chloramine T (1 mg/ml in 0.3M Phosphate buffer, pH 7.2) at room
temperature. The reaction was terminated by adding sodium metabisulfite (1
mg/ml in 0.3M Phosphate buffer, pH 7.2) for 2 min. Free iodine was removed
with Al GX8 resin (BioRad, Riclunond, CA) saturated with 1 % HSA (New
York Blood Center Inc., New York, NY) in PBS, pH 7.4. Radioactive peak
was collected and radioactivity (mCi/ml) was measured using a radioisotope
calibrator (Squibb, Princeton, N~. Iodine incorporation and specific
activities
were calculated. Trichloroacetic acid (TCA) (Fisher Scientific) precipitable
activity was generally >90%.
2.15 Isa vitso imfrzrshoyeactivity of iodi~aated afatibody.
Immunoreactivity of radioiodine labeled antibody was assayed using purified
anti-idiotype antibody 2E9 as the antigen. Appropriate dilutions of lasl
labeled
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
126
antibodies were added to plates in duplicates, and then transferred to freshly
prepared antigen plates after 1 h and 4 h of binding at 4°C,
respectively. The
final binding step was allowed to proceed overnight at 4°C. The total
percent
radioactivity bound was a summation of 3 time points for each antibody
dilution. For native 8H9, maximum immunoreactivity averaged ~65%, while
8H9 scFv-Fc chimeric antibody was N48%.
2.16 Animal studies
Athymic nude mice (nu/nu) were purchased from NCI, Frederick MD. They
were xenografted subcutaneously with LAN-1 neuroblastoma cell line (2x10
to cells/mouse) suspended in 100 u1 of Matrigel (Beckton-Dickinson
BioSciences, Bedford, MA) on the flank. After 3 weeks, mice bearing tumors
of 1-l.5cm in longest dimension were selected. Animals were injected
intravenously (retrorbital plexus) with 20~Ci of lzsl labeled antibody. They
were anesthesized with ketamine (Fort Dodge Animal Health, Fort Dodge,
PA) intraperitoneally and imaged at various time intervals with a gamma
camera (ADAC, Milpitas, CA) equipped with grid collimators. Serial blood
samples were collected at 5 min, l, 2, 4,8,18,24,48,72, 120h from mice
injected with 10-11 uCi lasl labeled antibody. Groups of mice were sacrificed
at 24h, 48h, and 120h and samples of blood (cardiac sampling), heart, lung,
liver, kidney, spleen, stomach, adrenal, small bowel, large bowel, spine,
femur, muscle, skin, brain and tumor were weighed and radioactivity
measured by a gamma counter. Results were expressed as percent injected
dose per gram. Animal experiments were carried out under an IACLTC
approved protocol, and institutional guidelines for the proper and humane use
of animals in research were followed.
3. Results
3.1 Anti-8H9-idiotypic antibodies
Rat hybridomas specific for 8H9 and nomeactive with control murine IgGl
were selected. After subcloning by limiting dilution, rat antibodies were
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
127
produced by bulk culture in roller bottles and purified by protein G affinity
column. By ELISA, 2E9, 1E12, and 1F11, all of rat subclass IgG2a, were
specific for 8H9, while nonreactive with a large panel of purified monoclonal
antibodies (Table I). In contrast, the antibodies 3C2, 4C2 SC7, 7D6 and 8E12
from the same fusions were not specific for SH9. The rest of the experiments
in this study was carried out using antibody 2E9. 2E9 specifically inhibited
the binding of 8H9 to LAN-1 neuroblastoma (Figure 1A) and HTB82
rhabdomyosarcoma (Figure 1B) while control rat IgGl (A1G4) had no effect
(Figure 1C).
l0 Table I: Anti-8H9-idiotypic antibodies: Specificity by ELISA
MoAb 1E12 1F11 3C2 4C2 5C7 7D6 8E12
Class y2a y2a y2b ~r N y1
MOPC a - - +++ - - -
315
20.4 y1 - - +++ +++ ++ +++
2C9 y1 - - +++ +++ +++ +++ ++
2E10 y1 - - +++ - - + -
3E6 y1 - - +++ +++ +++ +++ +++
3E7 y1 - - +++ - - + -
4B6 y1 - - +++ +++ ++ +++
5F9 y1 - - +++ +++ +++ +++ +
8H9 y1 +++ ++ +++ +++ ++ +++
MOPC y1 - - +++ +++ +++ +++ -
21
UJ13A y1 - - +++ ++ + - -
3A5 y2a - - +++ - - -
HOPC-1 y2a - - +++ + - - -
3F8 y3 - - +++ _ _ _ _
FCOPC21y3 - - +++ ++ - ++ -
NRCO-04y3 - - +++ - - - -
R24 y3 - - +++ _ _ _ _
TIB114 y3 - - +++ + - ++ -
Y5606 y3 - - +++ - - -
3A7 N - - + - _ -
3G6 N - - +++ - - -
5F11 ~r _ _ + _ _ _ _
If9 N - - +++ - -
MOPC N - - +++
104E
Note: OD <0. 5 = -, 0.5~ 1 = +, 1 ~2 = ++, >2 = +++
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
128
3.2 Coustt~uctiou atad Expression of 8H9 ScFv
After three rounds of panning on 2E9, the eluted phage was used to infect
E.coli HB2151 cells and scFv expression was induced by IPTG. ScFv from
periplasmic soluble protein fraction was tested for binding to 2E9 on ELISA.
Three 8H9 scFv clones when compared with the MoAb 8H9 showed similar
titers. The clone 8HpHM9F7-1 was selected for subcloning. The DNA
sequence of 8HpHM9F7-1 agreed with those of the 8H9VH and 8H9VL as
well as the CH2-CH3 region of human gamma chain. The supernatant,
periplasmic soluble and cells pellet lysates of 8HpHM9F7-1 were separated by
1o nonreducing SDS-PAGE, and analysed by western blotting. A protein band
with molecular weight of 31I~D was found in the supernatant, the periplasmic
and cell pellet extracts using anti-MycTag antibody which recognized the
sequence GAPVPDPLEPR. No such band was detected in control cells or
8HpHM9F7-1 cells without IPTG treatment.
3.3 Coustr~rsctiou of chimeric mouse scFv-hurrzau Fc
Chimeric clones from CHO and NSO were screened by ELISA binding on
2E9. Clone 1C5 from NSO and clone 1G1 from CHO were chosen for scale-
up production. By SDS-PAGE and by western blot analysis, a single chain of
54 kD under reducing conditions, and a homodimer of 102 kD under
nonreducing conditions were found (Figure 2). Antigen specificity was
demonstrated by its binding to tumor cells (Figure 3A, dose titration), and
its
inhibition by anti-idiotypic antibody 2E9 (Figure 3B) on FACS analysis.
3.4 Iu vitr~o and in vivo properties of scFv-human Fc
The scFv-Fc chimeric antibody was inefficient in mediating ADCC in the
.presence of human lymphocytes or human neutrophils (17% maximum
cytotoxicity at 50:1 E:T ratio compared to >50% by the murine IgG3 MoAb
3F8). It was also ineffective in CMC (data not shown). In biodistribution
studies, it localized well to HTB82 and LAN-1 xenografts (Figure 4). Blood
clearance studies showed that chimeric 8H9 (102 kD MW) had T-1/2 of 5.3 h,
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
129
and T-1/2 of 43 h when compared to averages of 4.5 h and 71 h, respectively,
fox native 8H9 (160 kD MW), a result of the smaller molecular size of the
construct (Figure 5). Similarly, although the percent injected dose per gram
of the chimeric construct was lower for all tissues (average of 44% at 48 h,
and 75% at 120 h), the tumor-non tumor ratios were similar to those of native
8H9 (98% at 48 h and 85% at 120 h) (Table II).
Table II: Percent Injected Dose per gram and Tumor-non-tumor ratios
Percent
Injected
dose/gm
over
time
(h)
chimeric nafive
Organs 24 48 120 48 120
Skin 1.4 0.7 0.2 1.8 0.7
Heart . 1.3 0.9 0.4 2.6 0.7
Lung 2.9 1.9 0.5 4.0 1.1
Liver 1.2 0.8 0.2 1.4 0.5
~
Spleen 0.9 0.5 0.2 1.4 0.4
Kidney 1.5 0.9 0.5 1.9 0.5
Adrenal 0.9 0.5 0.5 1.8 0.3
Stomach 1.3 0.6 0.3 1.3 0.5
Small intestine0.6 0.3 0.2 0.7 0.2
Large intestine0.6 0.3 0.2 0.6 0.2
Bladder 1.2 0.6 0.4 1.0 0.6
Muscle 0.5 0.3 0.2 0.5 0.2
Femur 0.6 0.3 0.2 0.8 0.2
Spine 0.6 0.4 0.2 0.8 0.3
Tumor 4.0 3.6 2.1 9.4 4.0
Brain 0.2 0.1 0.1 0.2 0.1
Blood 5.3 3.1 1.2 8.3 2.3
Tumor:Nontumor over time
ratios (h)
chimeric native
Organs 24 48 120 48 120
Skin 3.0 6.0 10.7 5.2 7.2
Heart 3.3 4.0 5.6 3.6 7.7
Lung 1.6 2.2 4.5 2.3 5.0
Liver 3.5 5.2 8.7 6.5 10.1
Spleen 5.1 8.1 12.8 6.7 15.1
Kidney 2.8 4.3 5.9 5.1 8.9
Adrenal 4.8 8.7 10.0 5.8 11.6
Stomach 3.6 6.7 13.8 7.5 14.5
Small intestine6.6 11.8 16.0 13.3 21.7
Large intestine7.1 12.7 25.9 15.7 28.5
Bladder 3.5 14.3 10.2 12.4 12.3
Muscle 7.9 13.6 21.3 18.2 26.8
Femur 6.7 11.8 20.5 11.8 27.9
Spine 6.7 6.8 14.2 11.1 19.6
Tumor 1.0 1.0 1.0 1.0 1.0
Brain 22.7 40.9 38.7 44.6 68.2
Blood 0.8 1.2 1.8 1.1 2.3
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
130
Hind III B~l II Not 1 I-find III
VH ~~~t~~~:'' '' VL r--~ h~y 1-CH2CH3
4. Discussion
We demonstrated that by using rat anti-idiotypic antibody as antigen
surrogate, scFv and scFv-fusion proteins can be conveniently produced. As
proof of principle we utilized the anti-idiotypic antibody to clone scFv from
the murine hybridoma cDNA library. The anti-idiotypic antibody was then
1o used to select for scFv-Fc chimeric antibodies. Both the scFv and scFv-Fc
fusion protein derived by our method were specific for the natural antigen,
comparable to the native antibody 8H9. However, the scFv-Fc fusion protein
could only mediate ADCC poorly and not CMC at all.
While scrv provides the building block for scFv-fusion proteins, it is not the
ideal targeting agent by itself. Being a small protein, its clearance is
rapid.
Moreover, it is often retained by the kidney, delivering undesirable side
effects
if the scFv construct is cytotoxic. Since avidity is a lcey parameter in
ttunor
targeting in vivo, its biggest limitation is its uni-valency and often
suboptimal
2o affinity for the antigen. By using VH-VL linkers of decreasing length,
spontaneous dimeric, trimeric and polymeric scrv have been produced.
However, these oligomers are not bonded by covalent linkage, and may
dissociate in vivo. An alternative approach is to take advantage of the human
Fc, which has the nattual ability to homodimerize through disulfide-bonds,
thereby allowing the juxtaposition of two binding domains. Fc functions such
as CMC and ADCC could also be achieved achieved (Shu et al., 1993; Nato et
al., 1995; Broclcs et al., 1997; Wang et al., 1999; Powers et al., 2001).
Unlike
standard 2-chain chimeric antibodies, only one polypeptide is needed for the
scFv-Fc chimeric; unbalanced synthesis of heavy and light chains is not an
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
131
issue. Larger dimeric fragments are also likely to have increased serum-half
life compared to scFv and thus improved tumor targeting
(Adams et al., 1993; Wu et al., 1996). Homodimerization of tumor cell-surface
antigens by soluble antibody may also trigger apoptosis of tumor cells
(Ghetie et al., 1997). No less important is the availability of validated
purification techniques using protein A or protein G through their binding to
the Fc portion (Powers et al., 2001). Tetravalent scFv (monospecific or
bispecific) are natural extensions of the diabody approach to scFv-Fc fusion
strategy (Alt et al., 1999; Santos et al., 1999), where a significant increase
in
to avidity can be achieved. More recently, scFv-streptavidin fusion protein
has
been produced for pretargeted lymphoma therapy (Schultz et al., 2000). Here
scFv-streptavidin forms natural tetramers, to which biotinyated ligands can
bind with high affinity.
Anti-idiotypic antibodies have greatly facilitated clone selection in the
construction of soluble scFv-fusion proteins or cell bound surface scFv. We
have successfully applied similar technology to anti-GD2 monoclonal
antibodies (Cheung et al., 1993). Being immunoglobulins, their structure,
stability, biochemistry, are generally known. Unlike natural antigens where
2o each individual system has its unique and difficult to predict properties.
As
surrogate antigens, anti-idiotypic antibodies are ideal for standardization
and
quality control, especially for initial clinical investigations where the
nature of
the antigen is not fully understood. Potential limitations exist for the anti-
idiotype approach. Only those anti-ids (Ab2) that recognize the antigen-
binding site of the immunizing MoAb can mimic the original antigen. A
reliable test for Ab2 is its ability to induce an antigen-specific immune
response. Alternatively, antigen specificity of the scFv selected by the anti-
idiotype must be validated by binding to cells or membrane preparations.
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
132
Once validated, the anti-idiotype can be used as antigen surrogate for cloning
and assay of other scFv-fusion proteins.
Our scFv-Fc fusion protein lacks CMC and' ADCC activity. This finding
differs from previous scFv-Fc fusion proteins
(Shu et al., 1993; Wang et al., 1999; Powers et al., 2001). This is unlikely
to
be due to the p58 antigen recognized by this scFv, since anti-GD2 scFv-Fc
made with the same cassette were also deficient in CMC and ADCC activity
(data not shown). One possible explanation might be due to the
to oligosaccharide structures in the Fc region (Wright and Morrison, 1997). In
normal IgG, these oligosaccharides are generally of complex biantennary type,
with low levels of terminal sialic acid and bisecting N-acetylglucosamine
(GIcNAc), the latter being critical for ADCC. ADCC function is often
inefficient among chimcric antibodies expressed in cell lines which lack the
enzyme ,(1,4)-N-acetylglucosaminyltransferase III (GnIII)
(Umana et al., 1999), that catalyzes the formation of bissecting
oligosaccharides. This enzyme can be transfected into producer lines to
increase the level of bisecting GIcNAc and to increase the ADCC function of
secreted chimeric antibodies (Umana et al., 1999). Since our chimeric
2o antibodies from both CHO and NSO expression systems were inefficient in
CMC and ADCC, both cell lines may be lacking in the GnIII enzyme. It is
also possible that the absence of the CH1 domain in the Fc may modify the
accessability of the ASN297 residue to glycosyltransferases in some scFv-Fc
constructs such as ours (Wright and Morrison, 1997). On the other hand, an
scFv-Fc that lacks binding to Fc receptor may have less nonspecific binding to
white cells, thereby decreasing blood pooling in targeted therapy. These
findings may have implications in scFv-Fc strategies to improve effector
functions.
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
133
REFERENCES
Adams, G.P., McGartney, J.E., Tai, M.-S., Oppermann, H., Huston, J.S.,
Stafford, W.F., Bookman, M.A., Fand, L, Houston, L.L. and Weiner, L.W.
(1993) Highly specific in vivo tumor targeting by monovalent and divalent
forms of 741F8 anti-c-erbB-2 single-chain Fv. Cancer Research 53, 4026-
4034.
Alt, M., Muller, R. and Kontermann, R.E. (1999) Novel tetravalent and
bispecific IgG-like antibody molecules combining single-chain diabodies with
the immunoglobulin y1 Fc or CH3 region. FEBS Letters 454, 90-94.
l0 Bird, R.E., Hardman, K.D., Jacobson, J.W., Johnson, S., Kaufrnan, B.M.,
Lee,
S.M., Lee, T., Pope, S.H., Riordan, G.S. and Whitlow, M. (1988) Single-chain
antigen-binding proteins. Science 242, 423-426.
Brocks, B., Rode, H.J., Klein, M., Gerlach, E., Dubel, S., Little, M.,
Pfizenmaier, K. and Moosmayer, D. (1997) A TNF receptor antagonistic scFv,
which is not secreted in mammalian cells, is expressed as a soluble mono- and
bivalent scFv derivative in insect cells. Immunotechnology 3, 173-84.
Burton, D.R, and Barbas III, C.G. (1994) Human antibodies from
combinatorial libraries. Advances in Immunology 57, 191-280.
Cai, X. and Garen, A. (I995) Anti-melanoma antibodies from melanoma
patients immunized with genetically modified autologous tumor cells:
selection of specific antibodies from single-chain Fv fusion phage libraries.
Proceedings of the National Academy of Sciences of the United States of
America 92, 6537-41.
Cheung, N.K., Canete, A., Cheung, LY., Ye, J.N. and Liu, C. (1993)
Disialoganglioside GD2 anti-idiotypic monoclonal antibodies. International
Journal of Cancer 54, 499-505.
Cheung, N.K., Saarinen, U., Neely, J., Landmeier, B., Donovan, D. and
Coccia, P. (1985) Monoclonal antibodies to a glycolipid antigen on human
neuroblastoma cells. Cancer Research 45, 2642-2649.
3o DeNardo, S.J., DeNardo, G.L., DeNardo, D.G., Xiong, C.Y., Shi, X.B.,
Winthrop, M.D., Kroger, L.A. and Carter, P. (1999) Antibody phage libraries
for the next generation of tumor targeting radioimmunotherapeutics. Clinical
Cancer Research 5, 3213s-3218s.
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
134
Eshhar, Z., Waks, T., Gross, G. and Schindler, D.G. (1993) Specific activation
and targeting of cytotoxic lymphocytes through chimeric single chains
consisting of antibody-binding domains and the gamma or zeta subunits of the
immunoglobulin and T-cell receptors. Proceedings of the National Academy
of Sciences of the United States of America 90, 720-4.
George, A.J.T., Spooner, R.A. and Epenetos, A.A. (1994) Applications of
Monoclonal Antibodies in Clinical Oncology. Immunology Today 15, 559-
561.
Ghetie, M.A., Podar, E.M., Ilgen, A., Gordon, B.E., Uhr, J.W. and Vitetta,
to E.S. (1997) Homodimerization of tumor-reactive monoclonal antibodies
markedly increases their ability to induce growth arrest or apoptosis of tumor
cells. Proceedings of the National Academy of Sciences of the.United States
of America 94, 7509-14.
Huston, J.S., Levinson, D., Mudgett-Hunter, M., Tai, M.S., Novotny, J.,
Margolies, M.N., Ridge, R.J., Bruccoleri, R.E., Haber, E. and Crea, R. (1988)
Protein engineering of antibody binding sites: recovery of specific activity
in
an anti-digoxin single-chain Fv analogue produced in Escherichia coli.
Proceedings of the National Academy of Sciences of the United States of
America 85, 5879-83.
2o Kato, T., Sato, K., Suzuki, S., Sasakawa, H., Kurokawa, M., Nishioka, K.
and
Yamamoto, K. (1995) Mammalian expression of single chain variable region
fragments dimerized by Fc regions. Molecular Biology Reports 21, 141-146.
Kipriyanov, S.M., Bretling, F., Little, M. and Dubel, S. (1995) Single-chain
antibody streptavidin fusions: tetrameric bifunctional scFv-complexes with
biotin binding activity and enhanced affinity to antigen. Human Antibodies
Hybridomas 6, 93-101.
Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of
the head of bacteriophage T4. Nature 227, 680-85.
Lu, J. and Sloan, S.R. (1999) An alternating selection strategy for cloniilg
3o phage display antibodies. Journal of Immunological Methods 228, 109-119.
Michael, N.P., Chester, K.A., Melton, R.G., Robson, L., Nicholas, W., Boden,
J.A., Pedley, R.B., Begent, R.H., Sherwood, R.F. and Minton, N.P. (1996) In
vitro and in vivo characterisation of a recombinant carboxypeptidase G2::anti-
CEA scFv fusion protein. Immunotechnology 2, 47-57.
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
135
Modak, S., Kramer, K., Humayun, G., Guo, H.F. and Cheung, N.K.V. (2001)
Monoclonal antibody 8H9 targets a novel cell surface antigen expressed by a
wide spectrum of human solid tumors. Cancer Research 61, 4048-4054.
Powers, D.B., Amersdorfer, P., Poul, M.A., Nielsen, U.B., Shalaby, R.,
Adams, G.P., Weiner, L.M. and Marks, J.D. (2001) Expression of single-chain
Fv-Fc fusions in pinchia pastoris. Journal of Immunological Methods 251,
123-135.
Raag, R. and Whitlow, M. (1995) Single-chain Fvs. FASEB Journal 9, 73-80.
Santos, A.D., Kashmiri, S.V., Hand, P.H., Schlom, J. and Padlan, E.A. (1999)
1o Generation and characterization of a single gene-encoded single-chain-
tetravalent antitumor antibody. Clinical Cancer Research 5, 3118s-3123s.
Schultz, J., Lin, Y., Sanderson, J., Zuo, Y., Stone, D., Mallett, R., Wilbert,
S.
and Axworthy, D. (2000) A tetravalent single-chain antibody-streptavidin
fusion protein for pretargeted lymphoma therapy. Cancer Research 60, 6663
6669.
Shu, L., Qi, C.F., Schlom, J. and Kashmiri, S.V. (1993) Secretion of a single-
gene-encoded immunoglobulin from myeloma cells. Proceedings of the
National Academy of Sciences of the United States of America 90, 7995-9.
Thanavala, Y.M., Brown, S.E., Howard, C.R., Roitt, LM. and Steward, M.W.
(1986) A surrogate hepatitis B virus antigenic epitope represented by a
synthetic peptide and an internal image antiidiotype antibody. Journal of
Experimental Medicine 164, 227-236.
Towbin, H., Staehelin, T. and Gordon, J. (1979) Electrophoretic transfer of
proteins from polyacrylamide gels to nitrocellulose sheets: procedure and
some applications. Proceedings of the National Academy of Sciences of the
United States of America 76, 4350-4.
Tur, M.K., Huhn, M., Sasse, S., Engert, A. and Barth, S. (2001) Selection of
scFv phages on intact cells under low pH conditions leads to a significant
loss
of insert-free phages. Biotechniques 30, 404-413.
3o Umana, P., Jean-Mairet, J., Moudry, R., Amstutz, H. and Bailey, J.E. (1999)
Engineered glycoforms of an antineuroblastoma IgGl with optimized
antibody-dependent cellular cytotoxic activity. Nature Biotechnology 17, 176-
180.
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
136
Wagner, U., Schlebusch, H., Kohler, S., Schmolling, J., Grunn, U. and Krebs,
D. (1997) Immunological responses to the tumor-associated antigen CA125 in
patients with advanced ovarian cancer induced by the murine monoclonal anti-
idiotype vaccine ACA125. Hybridoma 16, 33-40.
Wang, B., .Chen, Y.B., Ayalon, O., Bender, J. and Garen, A. (I999) Human
single-chain Fv immunoconjugates targeted to a melanoma-associated
chondroitin sulfate proteoglycan mediate specific lysis of human melanoma
cells by natural killer cells and complement. Proceedings of the National
Academy of Sciences of the United States of America 96, 1627-32.
to Watters, J.M., Telleman, P. and Junghans, R.P. (1997) An optimized method
for cell-based phage display panning. Immunotechnology 3, 21-9.
Wikstrand, C.J., Hale, L.P., Batra, S.K., Hill, M.L., Humphrey, P.A., Kurpad,
S.N., McLendon, R.E., Moscatello, D., Pegram, C.N. and Reist, C.J. (1995)
Monoclonal antibodies against EGFRvIII are tumor specific and react with
breast and lung carcinomas and malignant gliomas. Cancer Research 55, 3140-
8.
Winter, G., Griffiths, A.D., Hawkins, R.E, and Hoogenboom, H.R. (1994)
Making antibodies by phage display technology. Annual Review of
Immunology 12, 433-55.
Winter, G. and Milstein, C. (1991) Man-made antibodies. Nature 349, 293-
299.
Wright, A. and Morrison, S.L. (1997) Effect of glycosylation on antibody
function: implications for genetic engineering. Trends in Biotechnology 15,
26-31.
Wu, A.M., Chen, W., Raubitschek, A., Williams, L.E., Neumaier, M., Fischer,
R., Hu, S.Z., Odom-Maryon, T., Wong, J.Y. and Shively, J.E. (1996) Tumor
localization of anti-CEA single-chain Fvs: improved targeting by non-covalent
dimers. Immunotechnology 2, 21-36.
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
137
EIGHTH SERIES' OF EXPERIMENTS
Background: Chirneric immune receptors (CIR) transduced into lymphocytes
link target recognition by single chain antibody Fv (scFv) to activation
through CD28/TCR~ signaling. The murine monoclonal antibody (MoAb)
8H9 reacts with a novel antigen widely expressed on solid tumors (Cancer
Research 61:4048, 2001). We want to test if its anti-idiotypic MoAb 2E9 can
optimize the CIR technology.
Methods: Rat anti-idiotypic MoAb 2E9 (IgG2a) was used as an antigen
surrogate for initial cloning of 8H9scFv from the hybridoma cDNA library.
l0 A CIR consisting of human CD8-leader sequence, 8H9scFv, CD28
(transmembrane and cytoplasmic domains), and TCR-zeta chain was
constructed, ligated into the pMSCVneo vector, and used to transfect the
packaging line GP+envAMl2 bearing an amphotropic envelope.
Results: Three sequential afftnity enrichments with MoAb 2E9 signiftcantly
improved the percentage of producer clones positive for surface 8H9-scFv and
the efficiency of their supernatant in transducing the indicator cell line
I~562.
By three weeks of in vitro culture, >95% of transduced primary human
lymphocytes were CIR-positive. With periodic stimulation with soluble 2E9,
these lymphocytes underwent "monoclonal" expansion, reaching 50-100 fold
2o increase by 2 months. They mediated antigen-specific non-MHC restricted
cytotoxicity efftciently. When injected intravenously, they inhibited tumor
growth in SCID mice xenografted with rhabdomyosarcoma.
Conclusion: Anti-idiotypic antibody may provide a useful tool, especially for
carbohydrate or unstable antigens, in facilitating the cloning of scFv and
their
CIR fusion constructs, as well as their transduction into human lymphocytes.
Intro duction
Adoptive cell therapy using ex vivo expanded tumor-selective T-cells can
effect dramatic remissions of virally induced malignancies, a process
critically
3o dependent on clonal frequency, where rapid exponential expansion of
specific
cytolytic T-lymphocytes (CTL) is required. T-cells proliferate when activated
(e.g. anti-CD3) but apoptose unless a costimulatory signal (e.g. anti-CD28) is
provided (1). However, human tumor targets often lack costimulatory
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
138
molecules (e.g. CD80), or overstimulate inhibitory receptors (e.g. CTL4) such
that the CD28 pathway is derailed. In addition, many tumors downregulate
major histocompatibility complex (MHC) molecules to escape engagement by
the T-cell receptor (TCR). Through genetic engineering, chimeric immune
receptors (CIR) linking tumor-selective scFv to T-cell signal transduction
molecules (e.g. TCR-zeta chain and CD28) will activate lymphocytes
following tumor recognition, triggering the production of cytokines and tumor
lysis (2-7). T-cell can also be genetically engineered to secrete cytotoxic
cytokines (8), toxins (9) or to metabolize prodrugs (10, 11). However,
l0 significant technologic gaps remain: (1) Gene transduction into human
lymphocytes is inefficient, (2) antigen specific T-cells cannot be easily
enriched and expanded, and (3) optimal T-cell activation may require multiple
signals. Furthermore, although CIR redirected T-cells can recycle their lytic
activity (12), a costimulatory signal, either through CD28 or 4-1BB
engagement, may help reduce activation-induced apoptotic death. CIR with
multidomains was recently described, where the intracellular domain of CD28
was ligated to the 5' end of TCR zeta chain and introduced into Jurkat cells,
with the expected "two birds with one stone effect" when scFv binds to tumor
cells (13). IL-2 production was 20 times more than CIR with zeta'chain only.
Whether this same effect can be achieved with primary human T-cells is not
known.
To monitor scFv gene expression, anti-linker antibody may be useful, although
its efficiency depends on the accessibility of the scFv-linker portion.
Although purified antigens can also be used to monitor scFv expression,
certain classes (complex carbohydrates or unstable antigens) can be difficult
to
prepare and their chemistry highly variable. Without a standardized reagent
for affinity purification or enrichment of virus producer cells, monitoring
and
sorting of transduced lymphocytes, CIR technology remains inefficient.
Recently Eshhar et al described a dicistronic construct consisting of scFv-
CD28-'y and green fluorescent protein (GFP), where the latter was used to
monitor gene transduction and to enrich producer lines (7). Although GFP can
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
139
validate the gene transfer process, its added immunogenicity and its safety in
clinical applications remain uncertain.
Anti-idiotypic antibodies are frequently used as antigen-mimics for infectious
diseases and cancer (14, 15). Internal image rat anti-idiotypic antibodies can
be conveniently produced against mouse MoAb. Since large scale production
of clinical grade MoAb is now routine, anti-idiotypic antibodies may be ideal
surrogates especially if the antigen is not easily available. In addition, the
biochemistry of immunoglobulins in positive selection (panning, affinity
to chromatography, sorting) and binding assays is well-known and is easy to
standardize. We recently described a novel tumor antigen reactive with a
murine MoAb 8H9 (16). The antigen was difficult to purify given its lability
and glycosylation, Here we demonstrate that anti-idiotypic MoAb can be used
as surrogate antigens for cloning CIR into lymphocytes, i.e. a CIR of
8H9scFv, human CD28 and human TCR-zeta chain. Anti-idiotypic MoAb
allows rapid affinity enrichment of producer cell line, monitoring of scFv
expression on cells, and in vitro clonal expansion of transduced lymphocytes.
Highly cytotoxic lymphocytes, both in vitro and in vivo, can be produced in
bulk. Besides providing an antigen surrogate, anti-idiotypic MoAb appears to
2o have utility for the optimization and quality control of scFv-based gene
therapies.
Materials and Methods
Materials. Cells were cultured in RPMI 1640 with 10% newborn calf serum
(Hyclone, Logan, UT) supplemented with 2mM glutamine, 100 U/ml of
penicillin and 100 ug/ml of streptomycin. The BALB/c myeloma proteins,
MOPC-104E, TEPC-183, MOPC-351, TEPC-15, MOPC-21, UPC-10,
MOPC-141, FLOPC-21, Y5606, were purchased from Sigma-Aldrich Co., St.
Louis, MO. MoAb R24, V1-R24, and K9 were gifts from Dr. A. Houghton,
3o OKB7 and M195 from Dr. D. Scheinberg , and 10-11 (anti-GM2) from Dr. P.
Livingston of Memorial Sloan-Kettering Cancer Center, New York; 528 from
Dr. J. Mendelsohn (MD Anderson Cancer Center, Houston, TX). 2E6 (rat
anti-mouse IgG3) was obtained from hybridomas purchased from ATCC
(Rockville, MD). NR-Co-04 was provided by Genetics Institute (Cambridge,
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
140
MA). LS2D173 (anti-GM2) was provided by Dr. L. Grauer (Hybritech, CA).
From our laboratory, 3F8 was an IgG3 MoAb specific for ganglioside GD2
(17); SF9, 8H9, 3A5, 3E7, 1D7, 1A7 were produced against human
neuroblastoma, 2C9, 2E10 and 3E6 against human breast carcinoma: 4B6
against glioblastoma multiforme. They were all purified by protein A or
protein G (Pharmacia, Piscataway, NJ) affinity chromatography.
Anti-8H9-idiotypic MoAb. Anti-idiotypic antibodies were produced from
LOU/CN rats as previously described (18). Clones were selected based on
selective binding to SF11 antibody and not to other myelomas. Repeated
l0 subcloning was done using limiting dilution until the cell lines became
stable.
Among the three specific rat IgG2a clones (2E9, 1E12, 1F11), 2E9 was chosen
for scaled up production using high density miniPERM bioreactor (Unisyn
technologies, Hopkinton, MA), and purified by protein G affinity
chromatography (Hitrap G, Amersham-Pharmacia, Piscataway, NJ). The IgG
fraction was eluted with pH 2.7 glycine-HCl buffer and neutralized with 1 M
Tris buffer pH 9. After dialysis in PBS at 4°C for 18 hours, the
purified
antibody was filtered through a 0.2 um Millipore filter (Millipore Inc.
Bedford
MA), and stored frozen at -70°C. Purity was determined by SDS-PAGE
electrophoresis using 7.5% acrylamide gel. ELISA was used to detect rat
2o anti-idiotypic antibodies (Ab2) as previously described (18). Rat IgGl anti-
SF 11 anti-idiotypic MoAb was similarly produced.
Construction of ScFv Gene scFv was constructed from 8H9 hybridoma
cDNA by recombinant phage display using a scFv construction kit according
to manufacturer's instructions with modifications (Amersham-Pharmacia).
Amplified ScFv DNA was purified by glassmilk beads and digested with Sfi I
and Not I restriction endonucleases. The purified scFv of 8H9 was inserted
into the pHENl vector (kindly provided by Dr. G. Winter, Medical Research
Council Centre, Carmbridge, UK) containing SfiIlNcoI and Not I restriction
sites. Competent El Coli XL lOBlue cells (Stratagene, La Jolla, CA) were
3o transformed with the pHENl phagemid. Helper phage M13 K07
(Pharmacia) was added to rescue the recombinant phagemid. The phagemid
BHpHM9F7-1 was chosen for the rest of the experiments. The supernatant, the
periplasmic extract and cell extract from the positive clones separated by
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
141
nonreducing SDS-PAGE and western blotting (19) using anti-Myc Tag
antibody demonstrated a 3lkD band.
Enrichment of Recombinant Phagemid by Panning 50 u1 of anti-8H9
idiotype antibody 2E9 (50 ug/ml) in PBS were coated on the 96-well polyvinyl
microtiter plates and incubated at 37°C for 1 hour. 100 u1 of the
supernatant
from phage library were added to each well and incubated for 2 hours. The
plate was washed 10 times with PBS containing 0.05% BSA.
Antigen-positive recombinant phage captured by the idiotype 2E9 was eluted
with O.1M HCl (pH 2.2 with solid glycine and 0.1% BSA) and neutralized
l0 with 2M Tris solution. This panning procedure was repeated three times.
ELISA The selected phage was used to reinfect E.coli XL 1-Blue cells.
Colonies were grown in 2xYT medium containing ampicillin (100ug1m1) and
1% glucose at 30°C until the optical density at 600 nm of 0.5 was
obtained.
Expression of scFv antibody was induced by change of the medium containing
100uM IPTG (Sigma-Aldrich) and incubating at 30°C overnight. The
supernatant obtained from the medium by centrifugation was directly added to
the plate coated with idiotype 2E9. The pellet was resuspended in the PBS
containing 1mM EDTA and incubated on ice for 10 min. The periplasmic
soluble antibody was collected by centrifugation again and added to the plate.
After incubating 2 hours at 37°C, plates were washed and anti-
MycTag
antibody (clone 9E10 from ATCC) was added to react for 1 hour at 37°C.
After 'washing, affinity purified goat anti-mouse antibody (Jackson
Immunoresearch, West Grove, PA) was allowed to react for 1 hour at
37°C
and the plates were developed with the substrate o-phenylenediamine (Sigma
Aldrich).
Construction of sc8H9-hCD28TM-hCD28~Yta hTCRzeta-pMSCVneo Using
the assembled gene sequences, secondary PCR amplifications using synthetic
oligodeoxynucleotide primers (see below) were performed. Briefly, a 50.1
reaction mixture containing 200 ~M of each deoxynucleotide triphosphate, 0.2
~M of each primer, 2 units of AmpliTag Gold DNA polymerase (Appled
Biosystems, Foster City, CA), and 50 ng of template DNA was subjected to a
10 min denaturation and activation step at 95°C, followed by 30 cycles
of
denaturation (1 min at 95°C), annealing (2, min at 55°C), and
extension (2 min
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
142
at 72°C). This was followed by a final extension for 8 min at
72°C. Each of the
amplified products was purified with Geneclean I~it (Bio 101, Vista, CA).
Synthetic Oligodeoxynucleotide Primers for DNA Amplification
hCDBa leader - scFv - CD28:
355 S Sense Primer (Hpa I - Human CDBa Leader ) 5' - TTA TTA CGA
GTT/AAC ATG GCC TTA CCA GTG ACC - 3';
355 A Antisense Primer (Xho I - Human CD28 ) 5' - CTT GGT C/TCGAG
TGT CAG GAG CGA TAG GCT GC - 3 ;
scFv8H9:
to 365 S Sense Primer (Cla I - 8H9 heavy chain) 5' - TTA TTA CGA
AT/CGAT T GCC CAG GTC AAA CTG - 3 ;
365 A Antisense Primer (Not I- 8H9 light chain ) 5' - CTT GGT
G/CGGCCGC CTG TTT CAG CTC CAG - 3 ;
hTCR-zeta chain
3795 Sense primer (Bst U I- CD28 end - Xho I - hTCR zeta
[cytoplasmic domain]) 5'- CG/C GAC TTA GCA GCC TAT CGC TCC TGg
CAC/ TCG AGa AGA GTG AAG TTC - 3 ;
379A Antisense Primer (BgIII - hTCR z) 5'-CTT GGT A/GA TCT TCA
GCG AGG GGG CAG GGC - 3'.
2o Templates for DNA Amplification and Construction The single gene
encoding hCDBa-leader-sc3G6-CD28 was previously described (20). Its
cDNA was generated by PCR using the Hpa I , Xho I fragment of hCDBa-
leader-scFv-CD28 cDNA, and ligated into pMSCVneo vector (Clontech, Palo
Alto, CA). ScFv-8H9 was amplified from the 8HpHM9F7-1 phagemid.
Excised 8H9 scFv gene was then swapped into the hCDBa-
leader-scFv3G6-CD28 cassette of pMSCVneo using the Cla I - Not I
restriction enzymes. Human TCR-zeta-chain was amplified from the plasmid
pcDNA3.1/VJABLZH (kindly provided by Dr. Ira Bergman, University of
Pittsburgh, PA), and ligated dov~mstream of CD28 gene, using Xho I and Bgl
3o II restriction sites. Using the method supplied by manufacturer
(Stratagene),
competent E.coli XL 1-Blue cells were transformed with the vector
pMSCVneo containing the insert. All gene constructs were checked by DNA
sequencing.
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
143
Cell Culture and Transfection The amphotropic packaging cell line
GP+envAMl2 and all retroviral producer lines were maintained in Dulbecco's
modified Eagle's medium (Gibco-BRL, Gaithersburg, MD) supplemented with
glutamine, penicillin, streptomycin (Gibco-BRL), and 10% fetal bovine serum
(Gibco-BRL). Using effectene transfection Reagent (Qiagen, Valencia, CA),
recombinant retrovirus was produced by the transfection of vector DNA into
GP+envAMl2 packaging cells (kindly provided by Genetix Pharmaceuticals,
Cambridge, MA). Cells were fed every 3 days with 6418 (400ug/ml;
Gibco-BRL). Resistant clones were selected after a 10-day period.
to Enrichment and Cloning of Packing Lines by Affinity Column The
retroviral producer lines were affinity enriched using MACS goat anti-rat IgG
MicroBeads on the MiniMACS system (Miltenyi, Auburn, CA). In brief, the
transduced packing lines were reacted with purified rat anti-idiotypic
antibodies (10 ug per 106 packing cells) on ice for 30 minutes, washed and
then applied to the anti-rat column. Cell were eluted according to
manufacturer's instructions and recultured at 37°C for 24 hours.
Following
staining with anti-idiotypic antibody 2E9 or 1E12, immunofluorescence was
detected with FITC conjugated mouse anti-rat IgG antibody and analyzed by a
FACSCalibur flow cytometer (Becton Dickinson Immunocytometry systems,
2o San Jose, CA). A series of three affinity purifications is performed on the
retroviral producer line before subcloning by limiting dilution.
Virus-containing supernatant from each clone was used to infect K562 cells,
and gene transduction was measured by surface expression of scFv on K562
using FACS. One of the scFv-transduced K562 cell lines was further enriched
2s by MACS system before cloning by limiting dilution.
Peripheral Blood Mononuclear cells (PBMCs) PBMCs were isolated by
centrifugation on Ficoll (density, 1.077g/ml) for 30 min at 25 °C and
washed
twice with PBS. They were activated with soluble anti-CD3 ( 1 ~g/ml; clone
OKT3; PharMingen, San Diego, CA) and anti-CD28 (1 ug/ml; clone CD28.2;
30 PharMingen) MoAbs for 3 days at 37°C. In some experiments,
immobilized
anti-CD3 and anti-CD28 MoAbs were used, where 12-well non-tissue
culture-treated plates were incubated with the antibody (l~g/ml in PBS) at
lml/well for 4 hours at 37°C. The coated plates were blocked with 1%
HSA in
PBS for 30 min at room temperature, washed once with PBS, and then used
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
144
for PBMC activation. PBMCs (lOG/ml) were cultured in RPMI 1640
supplemented with 10% human AB serum (Gemini Bio-Products, Woodland,
CA), SO~M 2-mercaptoethanol, 2 pM L-glutamine, and 1%
penicillin-streptomycin (Gibco-BRL), for a total of 3 days before retroviral
transfection.
Retroviral Transduction Protocol The target cells ( e.g. K562 or cultured .
PBMCs ) were resuspended at a concentration of 1-5x105 cells/ml of freshly
harvested supernatant from retroviral producer cells, containing 8-10 ug/ml
hexadimethrine bromide (polybrene, Sigma), centrifuged at 1000 x g at room
1o temperature for 60 minutes, and then cultured in 12-well tissue culture
plates
overnight. The viral supernatant was then aspirated and fresh IMDM (Gibco)
medium containing 100 U/ml of IL2 and changed approximately every 5 days
to maintain a cell count between 1-2 x 10~ cells/ml (21). After 2 weeks in
culture, soluble anti-idiotypic antibody 2E9 was added at 3-10 ug/ml to the
transfected lymphocytes for 3 days out of every 2-week culture period, to
ensure clonal expansion of the scFv-positive transfected lymphocytes.
Cytotoxicity Assay Neuroblastoma targets NMB-7 and LAN-1 or
rhabdomyosarcoma HTB-82 tumor cells were labeled with NaZSiCr04
(Amersham Pharmacia Biotechnology Inc., Piscataway, N3) at 100 uCillO~
2o cells at 37°C for l ,hour. After the cells were washed, loosely
bound SICr was
removed by washing. 5000 target cells/well were admixed with lymphocytes
to a final volume of 200 pl/well. Following a 3 minute centrifugation at 200 x
g, the plates were incubated at 37°C for 4 hours. Supernatant was
harvested
using harvesting frames (Skatron, Lier, Norway). The released SICr in the
supernatant was counted in a universal gamma-counter (Packard Bioscience,
Meriden, CT). Percentage of specific release was calculated using the formula
100% x (experimental cpm - background cpm)/(10% SDS releasable cpm -
background cpm), where cpm are counts per minute of SICr released. Total
release was assessed by lysis with 10% SDS (Sigma-Aldrich), and background
~ release was measured in the absence of cells. The background was usually <
30% of total for these cell lines.
Mice and Treatment CB-17 SCID-Beige mice were purchased from
Taconic (Germantown, NY). Tumor cells were planted (2 x10 cells) in
100u1 of Matrigel (BD BioSciences, Bedford, MA) subcutaneously,
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
145
Following implantation, tumor sizes (maximal orthogonal diameters) were
measured. Tumor volume was calculated as 4~r3/3 where r is the mean tumor
radius. Treatment studies started in groups of 5 mice per cage when tumor
diameter reached 0.8 cm, usually by one week of tumor implantation. Mice
received 5 weekly intravenous lymphocyte injections by retroorbital route, 2 x
10~ per injection together with 500 U of IL-2 ip. 50 ug of anti-idiotypic
antibody was administered ip 3 days after each lymphocyte injection. Tumor
sizes were measured twice a week. Experiments were carried out under an
IACUC approved protocol and institutional guidelines for the proper, and
1o humane use of animals in research were followed.
Statistical Analysis Tumor growth was calculated by fitting a regression
slope for each individual mouse to log transformed values of tumor size. Mean
slope scores were back-transformed to give an estimate of the percent increase
in tumor size per day. Slopes were compared between groups.
Results
Anti-8H9-idiotypic antibodies Rat hybridomas specific for 8H9 and
nonreactive with control murine MoAb (IgM, IgGI and other subclasses) were
selected. By ELISA, 2E9, 1E12, and 1F11 were all of rat subclass IgG2a.
The antibody 2E9 was chosen for the rest of the experiments.
Construction and expression of 8H9 scFv After secondary PCR
amplification, the PCR product of scFv fitted with Sfi I and Not I restriction
sites were inserted into pHENl vectors. Three rounds of panning were
conducted to enrich for 2E9-binding recombinant phages. The phages eluted
from the third round panning were used to infect E.coli HB2151 cells and
induced by IPTG for expression. ScFv periplasmic soluble protein was
allowed to react in plates coated with 2.Sug 2E9/well and assayed by ELISA
as described in Material and Methods. The clone 8HpHM9F7-1 was selected
for subcloning. The scFv DNA sequence of 8HpHM9F7-1 agreed with those
of the VH and VL regions of the MoAb 8H9. The supernatant, periplasmic
soluble and cells pellet lysates of 8HpHM9F7-1 were separated by
nonreducing SDS-PAGE, and analyzed by western blotting. A protein band
with the apparent molecular weight of 31KD was found in the supernatant, the
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
146
periplasmic and cell pellet extracts using anti-MycTag antibody which
recognized the sequence GAPVPDPLEPR. No such band was detected in
control cells or 8HpHM9F7-1 cells without IPTG treatment.
Construction of sc8H9-CD28-hTCRzeta-pMSCVneo Using the assembled
gene sequences, secondary PCR amplifications using synthetic
oligodeoxynucleotide primers were performed using synthetic
oligodeoxynucleotide primers 3555, 355A for the laCDBa leader - scFv
CD28 , 3655, 365A for scFv8FI9, and 3795, 379A for IaTCR-zeta chain. The
final gene construction hCD8 leader-8H9scFv-hCD28TM-hCD28~yt°-TCR~
l0 was transfected into the amphotropic packaging line GP+envAMl2 , and
selected in 6418.
Enrichment and cloning of packing lines by affinity column The retroviral
producer lines were affinity-enriched using MACS goat anti-rat IgG
MicroBeads on the MiniMACS system. Following each enrichment, viral
supernatant from the producer line was used to infect the erythroleukemia line
K562. Surface 8H9-scFv expression on both the producer lines and the
transfected K562 (3-5 days after infection) were measured by
immunofluorescence using anti-idiotypic antibody 2E9. With each successive
affinity enrichment (Figure 1A and 1C) of producer line and subsequent
2o successive subcloning (Figure 1B and 1D), the surface expression (mean
fluorescence) of 8H9-scFv increased and became more homogeneous for the
producer clones (Figure 1A and 1B) and for the indicator line I~562 (Figure
1C and 1D).
Retroviral transduction of primary human peripheral blood mononuclear
cells Following activation in vitro with soluble anti-CD3 and anti-CD28,
primary human peripheral blood mononuclear cells were infected with the
virus from producer line supernatant by centrifugation at 1000 xg for 60
minutes at room temperature. By 21 days of in vitro culture, close to 100% of
cells were scFv-positive by FACS (Figure 2). This clonal evolution to
homogeneity was found in CD4+, CD8+ and the small CD56+ populations.
Soluble anti-idiotypic MoAb 2E9 was added at 3-10 ug/ml to the transfected
lymphocytes for 3 days out of every 2 weeks, to stimulate clonal expansion of
the scFv-positive transfected lymphocytes (Figure 3). ScFv expression was
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
147
constant throughout until at least day 62 (Figure 2), while the cells
underwent
active clonal expansion of 100-fold. The proportion of CD8+ cells increased
steadily from an initial 20-60% to 90% by day 40 of culture.
Transduced lymphocytes carried out efficient non MHC-restricted
cytotoxicity in vitro against neuroblastoma and rhabdomyosarcoma In
vitro cytotoxicity against NMB-7 (Figure 4A) and LAN-1 (Figure 4B)
neuroblastoma, or rhabdomyosarcoma HTB-82 (Figure 4C) were efficient, all
inhibitable by 8H9 antibody demonstrating antigen specificity. Daudi cell line
(Figure 4D) was not killed because it was antigen-negative. This cytotoxicity
to was independent of target HLA expression or HLA types. Unmodified
lymphocytes from the same donor, cultured under the same conditions (100
U/ml of IL2), did not show antigen-specific killing (LAK, Figures 4).
Inhibition of rhabdomyosarcoma tumor xenografted in SCID mice.
Human rhabdomyosarcoma was strongly reactive with 8H9, but not with 5F11
(anti-GD2) antibodies. To study the in vivo effects of 8H9scFv-CIR gene-
modified lymphocytes, we used 5F 11 scFv-CIR as control. 5F 11 scFv-CIR
modified lymphocytes could kill tumors in vitro, but only if they were GD2-
positive (data not shown). When subcutaneous tamer implants grew to 0.8 cm
diameter, mice were treated with 2 x 10~ gene-modified human lymphocytes
intravenously plus 500 U of IL2 intraperitoneally once a week for a total of 5
weeks. 50 ug of anti-idiotypic antibody 2E9 was given ip 3 days after each
lymphocyte infusion. All groups received IL2. Control groups received
either no cells + 2E9, cultured unmodified lymphocytes + 2E9 (LAK), or
5F11scFv-CIR modified lymphocytes + anti-idiatype 1G8 (specific for 5F11
idiotype). Suppression of tumor growth was most significant with
lymphocytes transduced with the 8H9scFv-CIR gene (p=0.066, Figure 5).
Although 5F11scFv-CIR modified lymphocytes also delayed tumor growth,
they were not different from unmodified lymphocytes.
Discussion
The use of retroviral vectors to transduce chimeric immune receptors into
primary human lymphocytes has been limited by the low gene transfer
efficiency when viral supernatant infections were carried out. Transfer rates
into primary human T cells using amphatropic virus ranged from 1 to 12%
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
148
(22). Several strategies were explored to increase the transduction rates to
20-
50%. These include: (1) using gibbon ape leukemia virus (GaLV strain
SEATO) pseudotyped virions (20, 23, 24), (2) coculturing producer and target
cells (25) where the clinical safety was of some concern, (3) using phosphate
depletion followed by centrifugation and incubation at 32°C (22), (4)
adding
fibronectin CH296 to enhance virus/lymphocyte interactions (26). More
recently, Eshhar et al described a dicistronic construct consisting of scFv-
CD28-'y and green fluorescent protein (GFP), where the latter was used to
monitor gene transduction and to enrich producer line (7). In our study, we
to used anti-idiotypic antibody to select for high surface scFv-expressing
producer lines with improved efficiency of gene transduction. More
importantly, lymphocytes transduced by CD-28-~ chimeric fusion receptors
proliferated in the presence of the anti-idiotypic MoAb to become
"monoclonal" with respect to scFv expression, in both the CD4+ and CD8+
populations. These lymphocytes possessed antigen-specific tumorcidal activity
both in vitro and in vivo that was non-MHC restricted. Whether CD56-
positive cells (presumably NK cells) acquire similar abilities will need
further
studies, although activation of NK cells through CD28 signaling has been
reported previously (27).
We have shown that anti-idiotypic antibodies can facilitate clone selection in
the construction of soluble scFv-fusion proteins or cell bound surface scFv.
We have successfully applied similar technology to the GD2 antigen system
(unpublished data). Being immunoglobulins, their structure, stability,
biochemistry are generally known. This is in contrast to natural antigens
where each individual system has its unique and often difficult-to=predict
properties. As surrogate antigens, anti-idiotypic MoAb are ideal for
standardization and quality control, especially for initial clinical
investigations
of carbohydrate antigens or when the nature of the antigen is not fully
understood.
The advantage of using anti-idiotypic antibody for affinity purification and
for
clonal expansion of gene-modified lymphocytes are many fold. To prepare
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
149
polyclonal CTLs specific for a tumor target, lymphocytes have to be pulsed
periodically in vitro with the tumor cells (21). Clearly this can create
safety
(tumor contamination) and quality control issues. In contrast, anti-idiotypic
MoAb can be manufactured under standard good manufacturing practice
(GMP) conditions, with ease of manipulation both in vitro or in vivo. Another
advantage of anti-idiotypic MoAb is its ability to mark the clonal population
of target-specific lymphocytes. Although tetramers can mark TCR and T-cell
clones, identity of the peptide antigen is required and this technology is not
easily available. Furthermore, anti-idiotypic MoAb can mark T-cell clones in
to vivo when radiolabeled, an option not yet possible with tetramers. Finally,
the
potential of anti-idiotypic MoAb to activate the transduced lymphocytes in
vivo is appealing, especially when tumor cells are poorly immunogenic, or
when they are scarcely distributed. Although we used anti-idiotypic MoAb in
our SLID mice experiments, this strategy clearly requires further optimization
after a better understanding of in vivo biology of these transduced cells
become available.
Despite these encouraging results, other structural issues of CIR technology
will have to be considered for future optimization. The choice of the
appropriate spacer (between scFv and signaling molecule), transmembrane
domain and the signaling molecules may be important (28). That 8H9scFv-
modified T-cells proliferate with anti-idiotype and kill antigen-positive
tumor
cells argue strongly that the CD28 trans-membrane domain in this CIR design
does not require a CD8 hinge, permitting effective interaction with soluble as
well as cell-bound antigens. This interaction effects positive lymphocyte
signaling, for both survival and activation, as previously reported for
similar
chimeric fusion protein containing both CD28 and TCR-chains (13). It is
possible that the level of activation could be improved by the addition of a
hinge or the adoption of other trans-membrane domains, as previously
suggested (29). Previous reports have suggested that a human IgG
hinge-CH2-Ch3 spacer can optimize T-cell activity, surface expression, and
target affinity (28, 30). Moreover, using domains or molecules further
downstream in the T-cell activation pathway could potentially overcome the
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
150
T-cell defects commonly found in cancer patients (31). Another variable in T-
cell activation is the affinity of interaction between TCR and MHC peptide
complex (32). Whether a chimeric receptor of low affinity scFv may better
mimic naive TCR interaction needs to be further tested. An optimal density of
CIR for T-cell activation is probably important (33), since excessive TCR
signaling may trigger premature death. In addition, since most target antigens
are not tumor-specific, it may be useful to standardize the level of
expression
of CIR such that an engineered T-cell is optimally activated only by a narrow
threshold of antigen.
1o
The choice of tumor system and antigen target will likely determine the
clinical success of CIR strategy. Primary lymphoid tumors e.g. B-cell
lymphomas have distinct attributes. Because of their innate tropism, T-cells
home to these lymphomas. In addition, these tumors have unique tumor
antigens with homogeneous expression that do not modulate from the cell
surface (e.g. CD20). Furthermore, these B-cell tumors express costimulatory
molecules (30). Most solid tumors lack these attributes. However, metastatic
cancers in lymph nodes, blood and bone marrow are unique compartments
where CIR technology may be applicable. Depending on the compartment,
2o targeting of T-cells may require different chemokine receptors or adhesion
molecules. For example, while L-selectin is required for homing to lymphoid
organs, its role for trafficking to other metastatic organs such as marrow is
less
well defined.
In adoptive cell therapies, the precise evaluation of the quantity and
persistence of these cells in vivo, as well as their distribution and function
within tissues is critical (34). In studies of T-cell therapy, this is of
particular
importance since many infused cells will undergo activation-induced death in
vivo (35), or immune elimination of gene-modified cells may occur, especially
3o following repeated injections (36). The development of sensitive, accurate
and
reproducible methods to quantify gene-marked cells in peripheral blood and
tissues are essential for defining the long-term fate of adoptively-
transferred
cells. While PCR and quantitative RT-PCR methods are ideal for studying
tissues extracts, anti-idiotypic MoAb will provide useful tools to enumerate
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
151
individual scFv-positive cells in blood, marrow and tumor. In addition,
noninvasive imaging methods using radiolabeled anti-idiotypic MoAb may
also be possible. Similar to the marker gene HSV-tk that allows cells to be
tracked and quantified by the substrate lsll-FIAU or 1Z4I-FIAU, anti-idiotypic
MoAb labeled with either 1311 or 1241 can also take advantage of
instrumentation and software developed for SPECT and PET/micro-PET
imaging, respectively. These tools can provide unprecedented precision and
dynamic information on cell traffic in patient trials.
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
152
REFERENCES
1. Daniel, P. T., I~roidl, A., Cayeux, S., Bargou, R., Blankenstein, T., and
Dorken, B. Costimulatory signals through B7.1/CD28 prevent T cell apoptosis
during target cell lysis. J Immunol,159: 3808-3815, 1997.
2. Eshhar, Z., Waks, T., Gross, G., and Schindler, D. G. Specific
activation and targeting of cytotoxic lymphocytes through chimeric single
chains consisting of antibody-binding domains and the gamma or zeta subunits
of the immunoglobulin and T-cell receptors. Proceedings of the National
Academy of Sciences of the United States of America, 90: 720-724, 1993.
3. Stancovski, L, Schindler, D. G., Waks, T., Yarden, Y., Sela, M., and
Eshhar, Z. Targeting of T lymphocytes to Neu/HERe-expressing cells using
chimeric single chain Fv receptors. J Immunol, 151: 6577-6582, 1993.
4. Moritz, D., Wels, W., Mattern, J., and Groner, B. Cytotoxic T
lymphocytes with a grafted recognition specificity for ERBB2-expressing
1s tumor cells. Proc. Natl Acad Sci, USA, 91: 4318-4322, 1994.
5. Wels, W., Moritz, D., Schmidt, M., Jeschke, M., Hynes, N. E., and
Groner, B. Biotechnological and gene therapeutic strategies in cancer
treatment. Gene, 159: 73-80, 1995.
6. Hwu, P., Shafer, G. E., Treisman, J., Schindler, D. G., Gross, G.,
Cowherd, R., Rosenberg, S. A., and Eshhar, Z. Lysis of ovarian cancer cells
by human lymphocytes redirected with a chimeric gene comosed of an
antibody variable region and the Fc-receptor gamma-chain. J. Exp. Med.,
178: 361-369, 1993.
7. Eshhar, Z., Waks, T., Bendavid, A., and Schindler, D. G. Functional
expression of chimeric receptor genes in human T cells. J Immunol Methods,
248: 67-76, 2001.
8. Rosenberg, S. A. Cell transfer therapy: clinical applications. Ira: V. T.
J. DeVita, S. Hellman, and S. A. Rosenberg (eds.), Biologic therapy of cancer,
second edition, pp. 487-506. Philadelphia: J.B.Lippincott Company, 1995.
9. Yang, A.-G. and Chen, S.-Y. A new class of antigen-specific killer
cells. Nat Biotechnol, 15: 46-51, 1997.
10. Culver, I~. W., Ram, Z., Wallbridge, S., Ishii, H., Oldfield, E. H., and
Blaese, R. M. In vivo gene transfer with retroviral vector-producer cells for
treatment of experimental brain tumors. Science, 256: 1550, 1992.
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
153
11. Wei, M. X., Tamiya, T., and Chase, M. Experimental tumor therapy in
mice using the cyclophosphamide-activating cytochrome P450 2B1 gene.
Hum Gene Ther, 5: 969, 1994.
12. Weijtens, M. E., Willemsen, R. A., Valerio, D., Stam, K., and Bolhuis,
R. L. Single chain Ig/gamma gene-redirected human T lymphocytes produce
cytokines, specifically lyse tumor cells, and recycle Iytic capacity. J
Immunol,
157. 836-843, 1996.
13. Finney, H. M., Lawson; A. D. G., Bebbington, C. R., and Weir, N. C.
Chimeric receptors providing both primary and costimulatory signaling in T
1o cells from a single gene product. J Immunol, 161: 2791-2797, 1998.
14. Thanavala, Y. M., Brown, S. E., Howard, C. R., Roitt, I. M., and
Steward, M. W. A surrogate hepatitis B virus antigenic epitope represented by
a synthetic peptide and an internal image antiidiotype antibody. Journal of
Experimental Medicine, 164: 227-236, 1986.
15. Wagner, U., Schlebusch, H., Kohler, S., Schmolling, J., Grunn, U., and
Krebs, D. Immunological responses to the tumor-associated antigen CA125 in
patients with advanced ovarian cancer induced by the murine monoclonal anti-
idiotype vaccine ACA125. Hybridoma, 16.' 33-40, 1997.
16. Modak, S., Kramer, K., Humayun, G., Guo, H. F., and Cheung, N. K.
2o V. Monoclonal antibody 8H9 targets a novel cell surface antigen expressed
by
a wide spectrum of human solid tumors. Cancer Research, 61: 4048-4054,
2001.
17. Cheung, N. K., Saarinen, U., Neely, J., Landmeier, B., Donovan, D.,
and Coccia, P. Monoclonal antibodies to a glycolipid antigen on human
neuroblastoma cells. Cancer Research, 45: 2642-2649, 1985.
18. Cheung, N. K., Canete, A., Cheung, I. Y., Ye, J. N., and Liu, C.
Disialoganglioside GD2 anti-idiotypic monoclonal antibodies. International
Jounial of Cancer, 54: 499-505, 1993.
19. Towbin, H., Staehelin, T., and Gordon, J. Electrophoretic transfer of
3o proteins from polyacrylamide gels to nitrocellulose sheets: procedure and
some applications. Proceedings of the National Academy of Sciences of the
United States of America, 76.' 4350-4354, 1979.
20. Krause, A., Guo, H. F., Tan, C., Cheung, N. K. V., and Sadelain, M.
Antigen-dependent CD-28 signaling enhances survival and proliferation in
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
154
genetically modified activated human primary T lymphocytes. J. Exp. Med.,
188: 619-626, 1998.
21. Koehne, G., Gallardo, H. F., Sadelain, M., and O'Reilly, R. J. Rapid
selection of antigen-specific T lymphocytes by retroviral transduction. Blood,
96: 109-117, 2000.
22. Bunnell, B. A., Muul, L. M., Donahue, R. E., Blaese, R. M., and
Morgan, R. A. High-efficiency retroviral-mediated gene transfer into human
nonhuman primate peripheral blood lymphocytes. Proceeds of the National
Academy of Science,USA, 92: 7739-7743, 1995.
23. Miller, A. D., Garcia, J. V., von Suhr, N., Lynch, C. M., Wilson, C.,
and Eiden, M. V. Construction and properties of retrovirus packaging cells
based on gibbon ape leukemia virus. J Virol, 1991: 2220-2224, 1991.
24. Lam, J. S., Reeves, M. E., Cowherd, R., Rosenberg, S. A., and Hwu, P.
Improved gene transfer into human lymphocytes using retroviruses with
gibbon ape leukemia virus envelope. Hum Gene Ther, 7.' 1415-1422, 1996.
25. Bonini, C., Ferrari, G., Verzeletti, S., Servida, P., Zappone, E.,
Ruggieri, L., Ponzoni, M., Rossini, S., Mavilio, F., Traversari, C., and
Bordignon, C. HSV-TK gene transfer into donor lymphocytes for control of
allogeneic graft-versus-leukemia. Science, 276: 1719-1723, 1997.
26. Pollok, K. E., Hanenberg, H., Noblitt, T. W., Schroeder, W. L., Kato,
L, Emanuel, D., and Williams, D. A. High-efficiency gene transfer into narmal
and adenosine deaminase-deficient T lymphocytes is mediated by transduction
on recombinant ~bronectin fragments. J Virol, 72: 4882-4892, 1998.
27. Galea-Lauri, J., Darling, D., Gan, S.-U., Krivochtchapov, L., Kuiper,
M., Gaken, J., Souberbielle, B., and Farzaneh, F. Expression of a variant of
CD28 on a subpopulation of human NK cells: implications for B7-mediated
stimulation of NK cells. J Immunol, 163: 62-70, 1999.
28. Patel, S. D., Moskalenlco, M., Smith, D., Maske, B., Finer, M. H., and
McArther, J. G. Impact of chimeric immune receptor extracellular protein
domains on T cell function. Gene Therapy, 6: 412-419, 1999.
29. Fitter-Attas, C. J., Schindler, D. G., Waks, T., and Eshhar, Z.
Harnessing Syk familytyrosine kinases as signaling domains for chimeric
single chain of the variable domain receptors: optional design for T cell
activation. J Immunol, 160. 145-154, 1998.
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
155
30. Jensen, M., Tan, G., Forman, S., Wu, A. M., and Raubitschek, A.
CD20 is a molecular target for scFvFc: receptor redirected T cells:
implications for cellular immunotherapy of CD20+ malignancy. Biol Blood
Marrow Transplant, 4: 75-83, 1998.
31. Eshhar, Z. and Fitzer-Attas, C. J. Tyrosine kinase chimeras for antigen-
selective T-body therapy. Adv Drug Deliv Rev, 31: 171-182, 1998.
32. Valitut~i, S. and Lanzavecchia, A. Serial triggering of TCRs: a basis
for the sensitivity and specificity of antigen recognition. Immunology Today,
I8: 299-304, 1997.
l0 33. Varez-Vallina, L. and Russell, S. J. Efficient discrimination between
different densities of target antigen by tetracycline-regulatable T bodies.
Hum
Gene Ther, 10: 559-563, 1999.
34. Yee, C., Riddell, S. R., and Greenberg, P. D. In vivo tracking of tumor-
specific T cells. Curr Opin Immunol, 13: 141-146, 2001.
35. Xiaoning, R. T., Ogg, G. S., Hansasuta, P., Dong, T., Rostron, T.,
Luzzi, G., Conlon, C. P., Screaton, G. R., McMichael, A. J., and Rowland-
Jones, S. Rapid death of adoptively transferred T cells in acquired
immunodeficiency syndrome. Blood, 93: 1506-1510, 1999.
36. Riddell, S. R., Elliott, M., Lewinsohn, D. A., Gilbert, M. J., Wilson, L.,
2o Manley, S. A., Lupton, S. D., Overell, R. W., Reynolds, T. C., Corey, L.,
and
Greenberg, P. D. T-cell mediated rejection of gene-modified HIV-specific
cytotoxic T lymphocytes in HIV-infected patients. Nat Med, 2: 216-223, 1996.
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
156
Acknowledgement:
We want to thank Dr. Andrew Vickers of Biostatistics at Memorial Sloan-
Kettering Cancer Center for his statistical input in the analysis of in vivo
tumor growth.
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
157
NINTH SERIES OF EXPERIMENTS
ABSTRACT
Purpose: Although metastatic rhabdomyosarcoma (RMS) is chemotherapy
and radiotherapy -responsive, few patients are cured. 8H9, a marine IgGI
monoclonal antibody (MoAb), recognizes a unique cell surface antigen that
has restricted expression on normal tissues but is broadly distributed on
neuroectodermal, epithelial and mesenchymal tumors including RMS. In this
report we test its immunotaxgeting potential in mice with subcutaneous human
RMS.
l0 Experimental design: Athymic nude mice with established RMS xenografts
were injected intravenously with lzsl-8H9 or l2sl- control MoAb. lzsl-8H9
immunoreactivity was tested on solid-phase anti-8H9-idiotypic rat MoAb 2E9.
Mice were imaged using a gamma camera and biodistribution of radiolabeled
antibodies determined. The anti-tumor effect was studied following
intravenous (IV) administration of 18.5MBq 1311-8H9.
Results: Following IV injection of 4.44MBq of lzsl-8H9, selective tumor
uptake was evident 4 to 172 h after injection. Average tumor uptake was
11.53.9, 15.13.7, and 5.41.2% injected dose per gm at 24, 48 and 172 h,
respectively. Mean tumor/tissue ratios were optimal at 172 h (for lung, 4,
kidney 6, liver 7, spleen 11, femur 14, muscle 18, brain 48). Tumor/tissue
ratios were improved when a lower dose (0.74MBq) of lzsl-8H9 was injected.
No hematological or histological abnormalities were observed. Mice injected
with 1251- negative control did not demonstrate specific tumor uptake. In
contrast to 1311-control treated mice, which showed unabated tumor
progression, mice treated with 18.5MBq of 1311-8H9 showed tumor
suppression of >50%.
Conclusions: Radiolabeled 8H9 effectively targeted RMS xenografts and may
have a potential clinical role in immunodetection and immunotherapy.
INTRODUCTION
Metastatic rhabdomyosarcoma (RMS) is associated with a dismal prognosis
with reported cure rates of no greater than 25% despite demonstrated
chemosensitivity and radiosensitivity (1',2,3). Myeloablative chemotherapy
with autologous stem cell rescue has failed to impact survival (4,5). The
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
158
failure to eradicate minimal residual disease (MRD) leads to local and distant
relapses for both alveolar and embryonal RMS. Alternative strategies to target
MRD are therefore warranted. Monoclonal antibodies (MoAbs) have recently
been reported to be of clinical benefit in the treatment of solid tumors. In
children with high-risk neuroblastoma (NB), the addition of the anti-
ganglioside GDZ antibody 3F8 to a multimodality. approach has significantly
improved prognosis (6) without increasing long-term toxicity (7).
Radiolabeled antibodies can selectively deliver radiation to human tumors.
Demonstration of specific binding to NB xenografts by 1311- 3F8 was initially
1o demonstrated in xenograft models (8). Indeed, 1311- 3F8 completely ablated
NB xenografts in athymic nude mice with reversible toxicity (9). Based on
the pharmacokinetics and dosimetry calculations to tumors and normal tissues
radioimmunodetection and radioimmunotherapy, clinical protocols utilizing
1311- 3F8 were initiated in patients with NB. Subsequently, effective and
specific targeting of NB in humans was demonstrated (10,11), and later
utilized both for detection and therapy.
The adoption of a similar strategy to RMS has been limited by the paucity of
antigens that can be targeted by MoAbs. Most antigens expressed on RMS
either have a nuclear or cytoplasmic localization which makes them
inaccessible to MoAbs, or are coexpressed on normal tissues thus limiting
their clinical utility (Table 1). The PAX-FIKHR fusion transcript is specific
for
alveolar RMS. It has been used in the detection of micrometastases in alveolar
RMS by RT-PCR (12, 13) and as a tumor antigen for the generation of
cytotoxic T-cells (14). However, its nuclear localization shields the intact
protein from antibody-based targeting approaches. Furthermore, for the more
frequent embryonal variant, such specific markers are not yet available. We
recently described a novel tumor antigen with an apparent molecular weight of
58kD (15) recognized by the MoAb 8H9. This glycoprotein is expressed on
3o cell surface of a broad spectrum of solid tumors in childhood and adults,
including both alveolar and ernbryonal RMS and has restricted distribution on
normal tissues. We now report the in vivo targeting of lasl and 1311 labeled
8H9 in human RMS xenografts.
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
159
Table 1: Previously reported antigens on rhabdomyosarcoma
Antigen Localization Crossreactivity
Desmin (22) cytoplasm Skeletal, Cardiac
and
Smooth Muscle
Cytokeratin (23) cytoplasm Epithelial cells
EMA (23) cytoplasm Epithelial cells
Vimentin (23) cytoplasm All mesenchymal
tissues
NSE (23) cytoplasm Brain and neural
tissue
MYOD1 (17) nucleus Restricted toRMS
Ag BW575 (18) cell membrane Neural cells
Myosin (19) cell membrane Muscle cells
5.1 H11 (25) cytoplasm Neural cells
IGFI receptor (21) cell membrane Nonnal cells
Fetal acetylcholine cell membrane Extraocular muscles,
receptor (20)
thymus, denervated
skeletal muscle
Table 2: % injected dose/gram of lzsI_8H9 distributed in HTB82
xenografts and normal tissues 24, 48 and 172 hours after injection
24h (n=9 48h (n=9 172h (n=8
mice) mice) mice)
MeaWSD Mean~SD Mear~SD
Adrenal 1.41.6 1.40.5 0.40.3
Bladder 2.61.2 2.90.8 0.90.6
Blood 14.13.0 10.72.1 3.20.9
Brain 0.30.1 0.30.1 0.10.0
Femur 1.40.5 1.10.5 0.40.1
Heart 4.31.9 2.90.5 0.90.2
Kidney 3.91.6 3.00.7 0.80.3 10
Large Intestine1.70.6 1.20.3 0.2f0.1
Liver 4.01.7 2.20.3 0.70.3
Lung 5.73.5 5.31.1 1.40.5
Muscle 1.20.6 1.10.4 0.30.1
Skin 2.31.6 2.51.5 0.60.4
Small Intestine1.50.4 1.10.2 0.30.1
Spine 2.1f0.8 1.70.7 0.50.2
Spleen 5.8f2.4 3.30.8 0.510.2
Stomach 2.42.1 1.60.7 0.50.4
Tumor 11.53.9 15.13.7 5.41.2 15
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
160
Table 3: Tumor:non-tumor ratios in mice injected with 0.74MBq
compared to 4.44MBq of lasI-8H9 172 h post injection (5 mice per
group)
0.74MBq 4.44MBq
Mean~SD Mean~SD
Adrenal 26.320.4 12.53.6
Bladder 35.031.4 7.91.5
Blood 2.6 X1.7 1.70.3
Brain 150.936.1 51.920.1
Femur 26.720.6 13.72.0
Heart 11.5 X8.5 5.71.0
Kidney 8.43.5 6.5~ 1.4
Large Intestine 32.3 X18.623.05.0
Liver. 13.0 X6.7 7.00.9
Lung 7.7 X6.0 4.10.6
Muscle 33.0 X22.318.94.4
Skin 13.0 X8.9 7.213.1
Small Intestine 29.417.0 20.86.4
Spine 20.411.1 10.33.7
Spleen 16.4 X11.311.92.0
Stomach 23.415.9 14.54.3
Tumor 1.00 1.00
Table 4: Biodistribution of l2sI-8H9 and lzsI-2C9 in mice with HTB82
xenografts 120h after injection (values represent %injected dose/gram).
I-8H9 I-2C9
Mean~SDMeaaWSD
Adrenal 0.50.2 0.70.4
Bladder 1.50.8 1.50.4
Blood 4.60.7 8.41.4
Brain 0.10.1 0.20.1
Femur 0.60.1 0.90.2
Heart 1.00.2 1.70.4
Kidney 1.20.3 1.40.4
Large intestine0.40.3 0.50.1
Liver 0.90.1 1.40.1
Lung 2.90.7 5.31.5
Muscle 0.40.1 0.50.1
Skin 0.80.1 1.00.3
Skin 0.80.1 1.00.3
Small intestine0.40.1 0.60.1
Spine 0.60.1 1.30.5
Spleen 1.30.6 2.20.5
Stomach 0.50.2 1.10.2
Stomach contents0.30.1 0.30.2
Tumor 7.20.9 2.50.9
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
161
Table 5: Mean hematological
and liver function
parameters in mice
(5 per
group) injected with
l3il-8H9
Day 15 Day 30 Reported normal
values
CBC
Hb (g/dl) 11.20.3 13.13.2 11.0-14.0
WBC (103) 4.430.7 6.22.7 2.8-9.2
Platelets (103) 1309371 130017981523218
Segmented (%) 46.89.9 42.511.442-45.5
Lymphocytes (%) 49.611.6 51.216.254.5-58
Liver function tests (pooled serum)
Alk. Phosphatase 96 174 66-258
(ILT/L)
ALT (IU/L) 36 33 62-121
AST (ICT/L) 169 93 87-318
GGT (IU/L) 0 0
Albumin (g/dl) 3.1 4.8 2.5-4.8
Total protein (g/dl)5.5 5.1 3.5-7.2
Total bilirubin 0.1 0.3 0.1-0.9 .
(mg/dl)
MATERIALS AND METHODS
Monoclonal antibodies
MoAb 8H9 The murine MoAb 8H9 was produced by hyperimmunizing
BALB/c mice with human neuroblastoma as previously described. (15).
MoAb 2C9 Using similar methods, mice were immunized with human breast
cancer and the hybridoma demonstrating specificity against cytokeratin 8 was
to isolated.
Anti-idiotypic MoAbs Rat anti-8H9-idiotype MoAbs were produced by
immunizing LOU/CN rats with purified 8H9. Following in vitro hybridization
with the myelomas SP2/0 or 8653, three IgG2a clones (2E9, 1E12 and 1F11)
were selected for their high binding and specificity by ELISA. When tested
against a panel of 23 other myelomas, no crossreactivity was found. The anti
idiotypic hybridomas were cloned and the antibody 2E9 chosen for scaled up
production using high-density MiniPERM bioreactor (LTnisyn technologies,
Hopkinton, MA). Anti-idiotypic antibodies were further purified by protein G
affinity (Hitrap G, Pharmacia, Piscataway, NJ) chromatography and filtered
through a 0.2p,m Millipore filter (Millipore Inc., Bedford, MA).
Cell lines
RMS cell line HTB82 and small cell lung cancer cell line HTB119 (8H9
negative control) were purchased from American Type Culture Collection,
Bethesda, MD. Cell lines were grown in RPMI (Gibco BRL, Gaithersburg,
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
162
MD) supplemented with 10% newborn calf serum (Hyclone, Logan, PA),
2mM glutamine, 100U/ml penicillin and 100ug/ml streptomycin (Gibco-BRL,
Gaithersburg, MD). Cells were cultured in a 37°C incubator and
harvested
using 2mM EDTA.
Iodination
MoAb 8H9 was allowed to react for 5 min with lzsl or 1311 (NEN Life
Sciences, Boston, MA) and chloramine T (lmg/ml in 0.3M Phosphate buffer,
pH 7.2) at room temperature. The reaction was stopped by adding sodium
metabisulfite (lmg/ml in 0.3M Phosphate buffer, pH 7.2) for 2 min.
to Radiolabeled MoAb was separated from free iodine using A1GX8 resin
column (BioRad, Richmond, CA) saturated with 1% HSA (New York Blood
Center Inc., Melville Biologics Division, New York, NY) in PBS, pH 7.4.
Peak radioactive fractions were pooled and the radioactivity (MBq/ml) was
measured using a radioisotope calibrator (Squibb, Princeton, NJ). Iodine
incorporation and specific activities were calculated. Trichloroacetic acid
(TCA) (Fisher Scientific, Pittsburgh, PA) precipitation was used to assess the
percentage of protein bound lzsl or 131I. Thin layer chromatography was
performed by running 1 ~.1 of lzsl-8H9on a silicaegel on glass TLC plate
(Sigma
Chemieal, St. Louis, MO) and scanning it with System 200 Imaging Scanner
(Bioscan, Washington, DC).
In vitro immunoreactivity of iodinated 8H9
Immunoreactivity of labeled antibody was determined by a specific microtiter
solid phase radioimmunoassay developed using the anti-8H9-idiotypic
antibody 2E9 as the antigen. Briefly, microtiter plates were precoated with
diminishing concentrations of 2E9. Appropriate dilutions of lzsl-8H9 were
added in duplicate. Binding was maximized by serial incubations at 4 °
C in 3
separate antigen plates for periods of 1h, 4 h and overnight respectively. The
percent of bound activity was summed for each dilution to obtain the
3o maximum percent binding. Similar assay was carried out to assess
immunoreactivity of 131I-8H9.
Immunoreactivity was also measured by specific binding to cell pellets.
HTB82 cells were suspended in Eppendorff tubes at concentrations of 108, 107
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
163
and 106/m1 in 100,1 medium. 100p.1 of appropriate .dilution of lzsl-SH9 was
added and allowed to react at 37 ° C for 60 mins. Tubes were
subsequently
centrifuged at 1400rpm x lOmins. Radioactivity in 100.1 of supernatant was
counted using Minaxi gamma counter (Packard BioScience, Downer's Grove,
IL) and compared with total counts in a control sample consisting of medium
without cells. Percent binding was calculated as (Experimental cpm /control
cpm) x 100%. The 8H9-negative cell line HTB 119 was used as control.
Animal studies
l0 Biodistribution and pliarmacokinetics
All animal experiments were carried out under an IACUC approved protocol
and institutional guidelines for the proper and humane use of animals in
research were followed. Athymic nude mice (Ncr nu/nu) were purchased from
NCI, Frederick MD. They were xenografted subcutaneously with HTB82 cell
line (2X106 cells/mouse) suspended in 100u1 of Matrigel (Beckton-Dickinson
BioSciences, Bedford, MA) on the right flank. After 3-4 weeks, mice bearing
tumors of 1 to l.5cm in longest dimension were selected. Mice were injected
intravenously (retrorbital plexus) with 0.74MBq or 4.44MBq of lzsl-8H9, or
with 4.44MBq lzsl-2C9. They were anesthesized with ketamine (Fort Dodge
2o Animal Health, Fort Dodge, IA) intraperitoneally and imaged at various time
intervals with a gamma camera (ADAC, Milpitas, CA) equipped with a high-
resolution general-purpose collimator for 1311 and thyroid X-ray grids for
lzsl.
Serial blood samples were collected at 5 min, 1, 2, 4,8,18,24,48,72, 120, 144
and 172 h to determine blood clearance of l2sl-8H9. Groups of mice injected
with l2sl-gH9 were sacrificed at 24h, 48h, 120h or 172h immediately after
imaging. Mice injected with l2sl-2C9 were imaged either at 120h (and then
sacrificed) or at 172h. Samples of blood (cardiac sampling), heart, lung,
liver,
kidney, spleen, stomach, adrenal, small bowel, large bowel, spine, femur,
muscle, skin, brain and tumor were weighed and radioactivity measured with a
Minaxi-gamma counter. Results were expressed as percent injected dose per
gram and biodistribution determined.
Toxicity
Athymic nude mice without xenografts were each injected with 4.44MBq of
is lI-8H9. Groups of mice were euthanized at 1 S and 30 days. Complete blood
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
164
counts were carried out in each mouse via terminal bleed and liver function
tests were performed on pooled sera. Complete necropsies including gross and
histological examinations were carried out to evaluate possible toxicity of
~31I-
8H9.
Evaluation of anti-tumor activity
RMS xenografts were established as described above. Their maximal
perpendicular axes were measured using calipers in control and tumor groups.
After 3 weeks, mice bearing tumors of approximately 0.7 cm3 (tumor volume
was calculated using the formula V=4~r3/3 where r=mean radius) were
l0 selected and injected with 18.5 MBq of lsil_8H9 or lsil_3F8 (3F8 was used
as
a negative control antibody). Average serial tumor volumes and body weights
were monitored in the two groups and compared over time. Mica were
euthanized as per guidelines published in NIH Publication No.~ 85-23
('Principles of Laboratory Animal Care'). Data are expressed as % increase or
decrease in tumor volume when compared to initial measurement on day 0 of
treatment.
RESULTS
Immunoreactivity
Protein bound l2sl and 1311 as assessed by TCA precipitation averaged
964.2% and 982.2 %, respectively for 8H9, and >95% for control
antibodies 2C9 and 3F8. TLC demonstrated free iodine peak of 1 %, 99%
being protein bound. Average maximum imrnunoreactivity as measured by
solid-phase RIA using the anti-8H9-idiotype 2E9 as antigen was 67~ 26% for
8H9 and 11 % for 2C9. Maximum immunoreactivity measured by cell pellet
binding assay was 83% for 8H9, maximum binding to the negative control cell
line HTB 119 being 9%. 2C9 demonstrated maximum binding of 6% on the
HTB82 cell pellet.
Imaging
3o Animals tolerated intravenous injection without apparent ill effects. Tumor
localization could be detected in animals imaged with l2sl_8H9 as early as 4
hours after injection. At 24 h, tumor localization was obvious along with some
blood pool, liver and spleen uptake. At 48 h, blood pooling had significantly
diminished and almost disappeared at 172 h. In contrast, mice injected with
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
165
the control IgGl lzsl-2C9 demonstrated no specif"xc uptake in RMS xenografts
(Figure 1).
Blood kinetics '
Average blood clearance in groups of 5 mice with and without RMS
xenografts injected with lzsl-8H9 is depicted in Figure 2. Blood activity of
l2sl-8H9 at 24 h was14.3% and 17.3% injected dose per gm (%ID/g)
respectively and dropped off to 3.3% and 5.3% ID/g, respectively at 172 h. (3
half life of lzsl-8H9 was 70.9h.
Biodistribution
l0 Table 2 lists the biodistribution of 4.44MBq lasl-8H9 in three groups of
mice
with RMS xenografts studied at 24,48 and 172 h, respectively. Blood-pooling
effect was observed at 24 h, which had diminished at 48 h and had almost
completely subsided at 172h after injection. There was no significant activity
in normal organs apart from blood at 172h. Average tumor uptake was
11.53.9, 15.13.7, and 5.41.2 % injected dose per gm at 24, 48 and 172 h,
respectively. Blood to tumor ratio was 1.24, 0.71 and 0.59 at 24, 48 and 172 h
respectively. Mean tumor/tissue ratios (Figure 3) increased from 24 to 48h
and were optimal at 172 h (for lung, 4, kidney 7, liver 8, spleen 1 l, femur
15,
muscle 20, brain 47). In mice injected with 0.74MBq l2sl-8H9, there was a
further increase in tumoraissue ratios particularly marked at 172h post
injection (for lung, 6, kidney 8, liver I2, spleen 14, femur 21, muscle 28,
brain
56) (Table 3). Table 4 summarizes the biodistribution of lasl-8H9 compared
to l2sl-2C9 at 120h post injection. Average tumor uptake was 7.3~ 0.9%
injected dose per gram for lasl-8H9 as compared to 2.50.9% for lasl-2C9.
Tumor to tissue ratios (Figure 4) were <1 for almost all tissues for lasl-2C9,
as
compared to 2.6-56.0 for l2sl-8H9.
Anti-tumor activity
Mice injected with 18.5MBq 1311-8H9 showed a significant suppression in
3o tumor volume (Figure 5). 'Average tumor volume had diminished to <50% of
initial volume 2I days after injection. None of the tumors showed any
evidence of regrowth. In contrast, in the control group, mice injected with
18.5MBq of 1311-3F8, an anti-GD2 MoAb that does not react with HTB82,
there was progressive and rapid tumor growth.
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
166
Toxici
No significant weight loss was noted in mice injected with 4.44MBq of lsil-
8H9, 15 and 30 days post injection (data not shown). Complete blood count
and liver function studies did not reveal any abnormalities (Table 5).
Complete necropsy evaluations did not reveal any gross or histological lesions
(data not shown). In the groups of mice treated with 1311 labeled MoAbs, there
was no significant weight loss 21 days after the initial dose for both the 3F8
and 8H9 groups (+11.78.8% for the 3F8 group and -21.8% for the 8H9
group). The increase in weight in the control group could be attributed to
increasing tumor mass.
DISCUSSION
Few tumor specific antigens that can be targeted by MoAbs have been
described for RMS. (Table 1) Myogenin, a myogenic regulatory protein
specific for rhabdomyoblasts is nuclear in localization (16) and therefore not
amenable for targeting by MoAbs. Similarly, the MyoD family of oncofetal
proteins is expressed in nuclei (17). Conversely, the cell membrane-expressed
antigens, BW475 (18) and myosin (19), are also expressed on normal neuxal
and muscle tissue respectively. The fetal form of the acetylcholine receptor,
2o a2(3y~, a possible target for antibody-based immunotherapy, although not
present on most normal muscles tissue, is expressed in extraocular muscles,
thymic myoid cells and in denervated skeletal muscle. (20.) Blockade of the
insulin-like growth factor I (IGFI) receptor, which has been implicated in an
autocrine pathway in the growth of RMS by murine monoclonals has been
demonstrated to inhibit the growth of established RMS xenografts in nude
mice (21). However, IGF receptors are ubiquitously expressed in normal
tissues.
MoAb 8H9 recognizes a unique cell membrane antigen which is expressed on
3o a wide range of pediatric and adult solid tumors (15). Furthermore, this
novel
antigen has restricted expression on normal tissues. In particular skeletal
muscle and hematopoietic tissues are negative. Indeed 8H9 has been utilized
to purge Ewing's sarcoma from blood and bone marrow (26). In RMS, the 8H9
antigen is expressed on both alveolar and embryonal variants. 96% (29/30)
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
167
RMS studied expressed the 8H9 antigen. Expression in most cases was strong
and homogeneous. RMS cell lines including the HTB82 cell line have been
shown to express this antigen on cell membranes. It therefore has the
potential
to be utilized as a tumor target in RMS.
RMS is a chemosensitive and radiosensitive tumor, yet in patients with
metastatic disease, MRD often leads to relapse and prevents cure.
Immunotherapy using radiolabeled and unlabeled 8H9 may provide a valuable
adjunct in the eradication of MRD. A similar approach has led to successful
1o cures being achieved in high-risk neuroblastoma (6). In this study we
evaluated the in vivo targeting of RMS by radiolabeled 8H9. We have
demonstrated that radiolabeled 8H9 can be effectively used in the
radioimmunodetection and radioimmunotherapy of RMS xenografts in mice.
Our results showed that l2sl or I3 II labeled 8H9 retained immunoreactivity
after radiolabeling. A relatively high specific activity of > 370MBq/mg of
1251
was obtained without loss of immunoreactivity. Hence, 8H9 has the potential
to be labeled with relatively large doses of iodine radioisotopes for
radioimmunotherapy approaches.
2o Our imaging results show that 8H9 can specifically and selectively bind to
human RMS xenografted in nude mice. Uptake in xenografts could be
detected as early as 4h after injection. Excellent selectivity for tumor over
normal tissue was demonstrated. There was no focal uptake in any normal
organs including reticuloendothelial tissues. This is in keeping with the
specific distribution of the antigen recognized by 8H9 as demonstrated by
immunohistochemistry in human tissues and tumors (15). Specificity of 8H9
binding was demonstrated by comparing the binding of l2sl-8H9 to that of Izsl-
2C9. 2C9, an IgGI MoAb specific for cytokeratin8, an antigen not expressed
by the RMS cell line HTB82, was used as a negative control. As expected,
radiolabeled 2C9 remained in the bloodstream and did not show any specific
binding for RMS xenografts with tumor: tissue ratios of 0.1-1. In
comparison, radiation dose to tumor xelative to normal tissues for lzsl-8H9
ranged from 2.6 to 25.3 fold. Specificity of l2sl-8H9 was also demonstrated in
vitro by studying the binding of l2sl-8H9 to the 8H9 negative cell line
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
168
HTB119 in comparison to the 8H9 positive line HTB82. Maximum binding
of l2sl-8H9 was 83% in comparison to 9% for HTB119 indicating that lasl-
8H9 binding was antigen specific.
Biodistribution studies provided us with preclinical data in consideration of
a
possible use for 8H9 in human trials. (3 half life of a single dose of 4.4MBq
of
i2sl-8H9 was 70.9h. There was, in general, an excellent radiation dose
differential between RMS and normal tissues. Optimum tumor to non-tumor
ratios were reached at 172h after intravenous 8H9 injection. Bloodaumor
1o ratios were relatively high at 24h indicative of blood pooling. Blood
pooling
diminished 48h after injection and was further greatly reduced by 172 h.
Probable uptake by cells of the reticuloendothelial system resulted in
relatively
high levels for liver and spleen in the first 24h. There was increased uptake
in
the tumors at 48h compared to 24h suggesting further selective targeting of
8H9 between 24 to 48h. Persistence of lzsl-8H9 in the blood during the ftrst
48h of administration implies that there is no appreciable neutralization of
antibody by circulating 8H9 antigen. When lower doses of lasl-8H9 for
imaging (0.74MBq compared to 4.44MBq), tumor: non-tumor ratios were
improved, consistent with reduced blood pooling (Table 4). The persistence
of binding of lasl-8H9 to tumor implies that the 8H9 antigen is not
immunomodulated off the cell after antibody binding. Similar findings were
demonstrated in vitro, where the antigen-antibody binding on cell surface as
detected by immunofluorescence persisted > 60h (15). This persistence
should permit a steady delivery of radiation to tumor cells by xadiolabeled
8H9. At doses of 6.66MBq/m2, there were no clinical (body weights),
chemical (CBC and LFTs) or gross or histologic organ toxicities at necropsies.
In an effort to develop systems to study antigen-antibody reactions pending
the definitive identification of the glycosylated S8kDa protein antigen
recognized by 8H9, we used anti-8H9-idiotypic MoAbs to serve as surrogate
antigens. These have enabled us to study the binding of radiolabeled
(radioimmunoassay) and unlabeled (ELISA) 8H9 in vitro. Our data indicate
that there was good correlation between the binding of l2sl-8H9 to anti-8H9
anti-idiotypes and to native antigen on cell pellets.
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
169
The observed radioimmunotherapeutic effect of 131I-8H9 was remarkable, with
>50% reduction in tumor volume of well-established RMS xenografts being
achieved with a dose of 18.SMBq of lsiI-SH9 without any adverse effects.
The antigen specific nature of this response was confirmed when RMS
xenografts treated with equivalent doses of nonspecific antibody demonstrated
unabated tumor growth. Radiolabeled 8H9 therefore, may have a possible
clinical role in the therapy of RMS.
to Given the broad reactivity of MoAb 8H9 with human solid tumors including
sarcomas, neuroblastoma and brain tumors, these studies provide the proof of
principle for exploring antibody-based targeting strategies directed at this
antigen.
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
170
REFERENCES
Crist W, Gehan EA, Ragab AH, Dickman PS, Donaldson SS, Fryer C,
Harnmond D, Hays DM, Herrmann J and Heyn R. The Third Intergroup
Rhabdomyosarcoma Study J Clin Oncol 13:610-30, 1995
Maurer HM, Gehan EA, Beltangady M, Crist W, Dickman PS, Donaldson SS,
Fryer C, Hammond D, Hays DM and Herrmann J. The Intergroup
Rhabdomyosarcoma Study-II. Cancer 71:1904-22, 1993
Okamura J, Sutow WW, and Moon TE. Prognosis in children with metastatic
l0 rhabdomyosarcoma. Med Pediatr Oncol 3:243-51, 1977
Weigel BJ, Breitfeld PP, Hawkins D, Crist WM, and Baker KS.. Role of high-
dose chemotherapy with hematopoietic stem cell rescue in the treatment of
metastatic or recurrent rhabdomyosarcoma. J Pediatr Hematol Oncol 23:272-
276, 2001
Ruymann FB and Grovas AC. Progress in the diagnosis and treatment of
rhabdomyosarcoma and related soft tissue sarcomas. Cancer Invest 18:223-
241, 2000
Cheung NK, Kushner BH, Cheung IY, Kramer K, Canete A, Gerald W,
Bonilla MA, Finn R, Yeh SJ, and Larson SM. Anti GD2 antibody treatment of
2o minimal residual stage 4 neuroblastoma diagnosed at more than 1 year of
age.
J. Clin. Oncol., 16: 3053-60, 1998
Cheung NK, Kushner BH, Yeh SDJ, and Larson SM. 3F8 monoclonal
antibody treatment of patients with stage 4 neuroblastoma: a phase II study.
Int. J. Oncol 12: 1299-306, 1998
Cheung NK, Neely JE, Landmeier B, Nelson D and Miraldi F. Targeting of
ganglioside GD2 monoclonal antibody to neuroblastoma J Nuc Med 28:1577-
83, 1987
Cheung NK, Landmeier B, Neely J, Nelson AD, Abramowsky C, Ellery S,
Adams RB and Miraldi F. Complete tumor ablation with iodine 131
radiolabeled disialoganglioside GD2-specific monoclonal antibody against
human neuroblastoma xenografted in nude mice. J Natl Cancer Inst . 77:739-
745, 1986
Yeh SD, Larson SM, Burch L, Kushner BH, LaQuaglia M, Finn R and
Cheung NK. Radioimmunodetection of neuroblastoma with iodine-131-3F8:
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
171
correlation with biopsy, iodine-131-metaiodobenzylguanidine and standard
diagnostic modalities. J.Nucl.Med. 32: 769-76, 1991
Kramer K, Cheung NK, Humm JL, Dantis E, Finn R, Yeh SJ, Antunes NL,
Dunkel IJ, Souwedaine M and Larson SM. Targeted radioimmunotherapy for
leptomeningeal cancer using (131)I-3F8. Med Pediatr Oncol 35:716-8, 2000
Thomson B, Hawkins D, Felgenhauer J, and Radich J. RT-PCR evaluation of
peripheral blood, bone marrow and peripheral blood stem cells in children and
adolescents undergoing VACIME chemotherapy for Ewing's sarcoma and
alveolar rhabdomyosarcoma. Bone Marrow Transplant 24:527-33, 1999
to Athale UH, Shurtleff SA, Jenkins JJ, Poquette CA, Tan M, Downing JR and
Pappo AS. Use of Reverse Transcriptase Polymerase Chain Reaction for
Diagnosis and Staging of Alveolar Rhabdomyosarcoma, Ewing Sarcoma
Family of Tumors, and Desrnoplastic Small Round Cell Tumor. Am J Pediatr
Hematol Oncol 23(2):99-104, 2001
Mackall C, Berzofsky J and Helman LJ. Targeting tumor specific
translocations in sarcomas in pediatric patients for immunotherapy. Clin
Orthop. 373:25-31, 2000
Modak S, Kramer K, Gultekin SH, Guo HF and Cheung NK. Monoclonal
antibody 8H9 targets a novel cell surface antigen expressed by a wide
2o spectrum of human solid tumors. Cancer Res. 61:4048-54, 2001.
Kumar S, Perlaman, E, Harris CA, Raffeld M and Tsokos M. Myogenin is a
specific marker for rhabdomyosarcoma: an immunohistochemical study in
paraffin embedded tissues. Mod Pathol 13: 988-93, 2000
Wang N.P., Marx J., McNutt M.A., Rutledge J.C., and Gown A.M.,
Expression of myogenic regulatory proteins (myogenin and MyoDl) in small
blue round cell tumors of childhood. Am J Pathol 147: 1799-1810, 1995
Fujisawa T, Xu Z.J., Reynolds C.P Schultz G., Bosslet LV., and. Seeger R.C.,
A monoclonal antibody with selective immunoreactivity for neuroblastoma
and rhabdomyosarcoma. (abs) Proc. AACR 30: 345, 1989
3o Gruchala A, Niezabitowski A, Wasilewska A, Sikora K, Rys J, Szklarski W,
Jaszcz A, Lackowska B and Herman K. Rhabdomyosarcoma. Morphologic,
immunohistochemical, and DNA study. Gen Diagn Pathol 1142:175-84, 1997.
Gattenloehner S, Vincent A, Leuschner I, Tzartos S, Muller-Hermelink HK,
Kirchner T and Marx A. The fetal form of the acetylcholine receptor
CA 02423843 2003-03-26
WO 02/032375 PCT/USO1/32565
172
distinguishes rhabdomyosarcomas from other childhood tumors. Am J Pathol.
152:437-44, 1998
Kalebic T, Tsokos M, Helman LJ. In vivo treatment with antibody against
IGF-1 receptor. suppresses growth of human rhabdomyosarcoma and down
s regulates p34cdc2. Cancer Res 54:5531-4, 1994
Truong LD, Rangdaeng S, Cagle P, Ro JY, Hawkins H, Font RL. The
diagnostic utility of desmin. A study of 584 cases and review of the
literature
Am J Clin Pathol 93:305-14, 1990
Qualman SJ, Coffin CM, Newton WA, Hojo H, Triche TJ, Parham DM, and
to Crist WM. Intergroup Rhabdomyosarcoma Study: update for pathologists
Pediatr Dev Pathol 1:550-61, 1998
Garin-Chesa P., Fellinger E.J., Huvos A.G., Beresford H.R., Melamed M.R.,
Triche T.J., and Rettig W.J., Immunohistochemical analysis of neural cell
adhesion molecules. Differential expression in small round cell tumors of
15 childhood and adolescence. Am. J. Pathol. 139: 275-286, 1991
Strother DR, Parham DM and Houghton PJ. Expression of the 5.1 H11
antigen, a fetal muscle surface antigen, in normal and neoplastic tissue. Areh
Pathol Lab Med 114:593-596, 1990
Merino ME, Navid F, Christensen BL, Toretsky JA, Helman LJ, Cheung NK
20 and Mackall CL. Immunomagnetic purging of ewing's sarcoma from blood
and bone marrow: quantitation by real-time polymerase chain reaction. J Clin
Oncol 19:3649-3659, 2001
