Note: Descriptions are shown in the official language in which they were submitted.
CA 02424575 2011-06-07
Method of detecting epigenetic biomarkers by quantitative
MethylSNP analysis
Background of the invention
Methylation of nucleotides such as CpG dinucleotides or methylated adenine or
guanine residues on the DNA but also on the RNA level is a key element of the
epigenetic control of genomic information in mammals [1]. It plays a crucial
role in.
chromatin structure and gene expression, and aberrant DNA methylation,
including
hypo- as well as hypermethylation, is often associated with pathogenesis, such
as
tumorigenesis [2]. Multilocus methylation profiles can make tumor types
distinguishable [3] or can elucidate a distinct subgroup within a
histologically
indistinguishable tumor panel [4]. Differences in methylation profiles can be
of
prognostic value [5]. Minimal traces of aberrant methylated DNA fragments in
blood
serum could serve as early diagnostic markers [6]. Although a variety of
methods are
available to assess the methylation Status in biological material, studying
methylation
is still limited by the low sensitivity and/or the high consumption of time
and labor of
current protocols. Restriction enzyme-based techniques often require large
amounts
of DNA and the loci, which can be investigated, are restricted to recognition
sites of
the enzymes [3,41. Sodium bisulfite-treatment of DNA converts unmethylated
cytosine into uracil, which is subsequently amplificated as thyn-iine in a
PCR.
Methylated cytosine, however, is non-reactive and remains detectable as a
cytosine.
On bisulfite-converted DNA several techniques have been applied to assess the
methylation status. These either suffer from a low throughput [7,8] or a labor
CA 02424575 2003-04-14
2
intensive experimental set up [9,10] and/or very low sensitivity and
inaccurate
quantitation [7, 8, 9, 10], and/or are limited to the detection of only one
distinct
nucleotide in one reaction [8, 9]. What is needed in the art is a method that
overcomes the limitations mentioned above.
Summary of the Invention
The present invention relates to a method for the detection of the methylation
status
of a nucleotide at a predetermined position in a nucleic acid molecule
comprising the
steps of (a) treating a sample comprising said nucleic acid molecule or
consisting of
said nucleic acid molecule in an aqueous solution with an agent suitable for
the
conversion of said nucleotide if present in (i) methylated form; or (ii) non-
methylated
form to pair with a nucleotide normally not pairing with said nucleotide prior
to
conversion; (b) amplifying said nucleic acid molecule treated with said agent;
(c)
real-time sequencing said amplified nucleic acid molecule; and (d) detecting
whether
said nucleotide is formerly methylated or not methylated in said predetermined
position in the sample. The invention further relates to a method for the
diagnosis of a
pathological condition or the predisposition for a pathological condition
comprising
detection of a methylation status nucleotide at a predetermined position in a
nucleic
acid molecule comprising the steps of (a) treating a sample comprising said
nucleic
acid molecule or consisting of said nucleic acid molecule in an aqueous
solution with
an agent suitable for the conversion of said nucleotide if present in (i)
methylated
form; or (ii) non-methylated form to pair with a nucleotide normally not
pairing with
said nucleotide prior to conversion; (b) amplifying said nucleic acid molecule
treated
with said agent; (c) real-time sequencing said amplified nucleic acid
molecule; and
(d) detecting whether said nucleotide is methylated or not methylated in said
predetermined position in the sample wherein a methylated or not methylated
nucleotide is indicative of a pathological condition or the predisposition for
said
pathological condition. The term "methylated" in step (d) refers to the state
of the
nucleotide before step (a); therefore, in step (d), the nucleotide may no
longer be
methylated. However, the detection of step (d) allows a conclusion as to
whether the
nucleotide in a given position was methylated before the application of step
(a). The
description of step (d) may thus also refer to "detecting whether said
nucleotide is
CA 02424575 2011-06-07
*1
3
formerly methylated". The inclusion of the adjective "formerly" merely relates
to the
fact that the nucleotide may change its methylation status in step (a).
In an aspect, the present invention relates to a method for detecting the
methylation
status of a nucleotide at a predetermined position in a nucleic acid molecule,
said
method comprising:
(a) treating a sample comprising said nucleic acid molecule or consisting of
said nucleic acid molecule in an aqueous solution with an agent suitable
for the conversion of said nucleotide if present in:
(i) methylated form; or
(ii) non-methylated form
to pair with a nucleotide normally not pairing with said nucleotide prior to
conversion;
(b) amplifying said nucleic acid molecule treated with said agent;
(c) real-time sequencing said amplified nucleic acid molecule; and
(d) detecting whether said nucleotide is methylated or not methylated at said
predetermined position in the sample.
In another aspect, the present invention relates to a method for the diagnosis
of a
pathological condition or the predisposition for a pathological condition
comprising
detection of the methylation status of a nucleotide at a predetermined
position in a
nucleic acid molecule, said method comprising:
(a) treating a sample comprising said nucleic acid molecule or consisting of
said nucleic acid molecule in an aqueous solution with an agent suitable
for the conversion of said nucleotide if present in:
(i) methylated form; or
(ii) non-methylated form
to pair with a nucleotide normally not pairing with said nucleotide prior to
conversion;
(b) amplifying said nucleic acid molecule treated with said agent;
(c) real-time sequencing said amplified nucleic acid molecule; and
(d) detecting whether said nucleotide is methylated or not methylated in said
predetermined position in the sample wherein a methylated or a not
CA 02424575 2012-04-26
3a
methylated nucleotide is indicative of a pathological condition or the
predisposition for said pathological condition.
In another aspect, the present invention relates to a method for generating
new
nucleotide pairing partners upon amplification of at least one nucleic acid
molecule for
the detection of the methylation status of nucleotides of the nucleic acid
molecule, the
method comprising:
(a) providing the at least one nucleic acid molecule;
(b) treating the nucleic acid molecule with an agent suitable for conversion
of a
nucleotide if present in:
(i) methylated form; or
(ii) non-methylated form
to pair with nucleotide pairing partners normally not pairing with the
nucleotide prior to conversion;
(c) amplifying the nucleic acid molecule to produce an amplification product
comprising the nucleotide pairing partners normally not pairing with the
nucleotide prior to conversion;
(d) real-time sequencing the amplification product;
determining the amount of the nucleotide pairing partner in the amplification
product to
detect the methylation status of nucleotides of the nucleic acid molecule.
In another aspect, the present invention relates to a method for detecting the
methylation status of a nucleotide at a predetermined position in a nucleic
acid
molecule, the method comprising:
(a) treating a sample comprising the nucleic acid molecule or consisting of
the
nucleic acid molecule in an aqueous solution with an agent suitable for the
conversion of the nucleotide if present in:
(i) methylated form; or
(ii) non-methylated form
to pair with a nucleotide normally not pairing with the nucleotide prior to
conversion;
(b) amplifying the nucleic acid molecule treated with the agent via at least
one
amplification primer to produce an amplification product and converting the
amplification product into single stranded amplified nucleic acid molecules,
CA 02424575 2012-04-26
3b
wherein the at least one amplification primer is detectably labeled with a
detectable label that forms an anchor for removal of the single stranded
amplified nucleic acid molecules to generate a single stranded amplified
nucleic acid molecule;
(c) real-time sequencing the single-stranded amplified nucleic acid molecule;
and
(d) detecting whether the nucleotide is methylated or not methylated at the
predetermined position in the sample.
In another aspect, the present invention relates to a method for the diagnosis
of a
pathological condition or the predisposition for a pathological condition
associated with
aberrant DNA methylation comprising detection of the methylation status of a
nucleotide at a predetermined position in a nucleic acid molecule, the method
comprising:
(a) treating a sample comprising the nucleic acid molecule or consisting of
the
nucleic acid molecule in an aqueous solution with an agent suitable for the
conversion of the nucleotide if present in:
(i) methylated form; or
(ii) non-methylated form
to pair with a nucleotide normally not pairing with the nucleotide prior to
conversion;
(b) amplifying the nucleic acid molecule treated with the agent via at least
one
amplification primer to produce an amplification product and converting the
amplification product into single stranded amplified nucleic acid molecules,
wherein the at least one amplification primer is detectably labeled with a
detectable label that forms an anchor for removal of the single stranded
amplified nucleic acid molecules to generate a single stranded amplified
nucleic acid molecule;
(c) real-time sequencing the single-stranded amplified nucleic acid molecule;
and
(d) detecting whether the nucleotide is methylated or not methylated in the
predetermined position in the sample, wherein the determination of the
methylation status at the predetermined position provides a diagnosis of
CA 02424575 2013-04-04
3c
the pathological condition or the predisposition for the pathological
condition.
In another aspect, the present invention relates to a method for generating
new
nucleotide pairing partners upon amplification of at least one nucleic acid
molecule for
the detection of the methylation status of nucleotides of the nucleic acid
molecule, the
method comprising:
(a) providing the at least one nucleic acid molecule;
(b) treating the nucleic acid molecule with an agent suitable for conversion
of a
nucleotide if present in:
(i) methylated form; or
(ii) non-methylated form
to pair with new nucleotide pairing partners normally not pairing with the
nucleotide prior to conversion;
(c) amplifying the nucleic acid molecule via at least one amplification primer
to
produce an amplification product and converting the amplification product
into a single stranded nucleic acid molecules, wherein the at least one
amplification primer is detectably labeled with a detectable label that forms
an anchor for removal of the single stranded amplified nucleic acid
molecules to generate a single stranded amplified nucleic acid molecule
comprising the new nucleotide pairing partners normally not pairing with
the nucleotide prior to conversion;
(d) real-time sequencing the single stranded amplified nucleic acid molecule;
and
(e) determining the amount of the nucleotide pairing with the new nucleotide
pairing partners to detect the methylation status of nucleotides of the
nucleic acid molecule.
In another aspect, the present invention relates to a method for the diagnosis
of a
pathological condition or the predisposition for a pathological condition
associated with
aberrant DNA methylation comprising detection of the methylation status of a
nucleotide at a predetermined position in a nucleic acid molecule, the method
comprising:
CA 02424575 2013-04-04
,
3d
(a) treating a sample from a subject comprising the nucleic acid molecule or
consisting of the nucleic acid molecule in an aqueous solution with an
agent suitable for the conversion of the nucleotide if present in:
(i) methylated form; or
(ii) non-methylated form
to pair with a nucleotide normally not pairing with the nucleotide prior to
conversion;
(b) amplifying the nucleic acid molecule treated with the agent via at least
one
amplification primer to produce an amplification product and converting the
amplification product into single stranded amplified nucleic acid molecules,
wherein the at least one amplification primer is detectably labeled with a
detectable label that forms an anchor for removal of the single stranded
amplified nucleic acid molecules to generate a single stranded amplified
nucleic acid molecule;
(c) real-time sequencing the single-stranded amplified nucleic acid molecule;
and
(d) detecting whether the nucleotide is methylated or not methylated at the
predetermined position in the sample, wherein the presence of an aberrant
methylation status at the predetermined position indicates the presence of,
or predisposition to, the pathological condition, and wherein the absence of
the aberrant methylation status at the predetermined position indicates the
absence of, or lack of predisposition to, the pathological condition.
The figures show:
Figure 1. Schematic representation of the experimental approach used to
quantitate
the methylation grade at a distinct CpG by Pyrosequencing (PyroMeth). (A)
shows an
outline of the principal steps of the system. (B) gives a more detailed
overview of the
method-specific steps required for the sample preparation and sample analysis.
The
method allows the detection of the nucleotide incorporation at the MethylSNP
site in
real-time.
Figure 2. Calibration plot for determination of allele frequencies in a sample
pool with
PyroMeth. PCR products, homozygous for either C or T, where mixed in different
CA 02424575 2013-04-04
3e
proportions, in which allele C represents a methylated and T an unmethylated
CpG.
The measured allele frequency is plotted against the expected allele frequency
as
defined by the ratios of the two PCR products mixed together. Allele
frequencies were
calculated using the peak heights %C = peak C / (peak C + peak T) x 100. A
linear
relationship over the whole range of tested allele frequencies could be
confirmed (R2 =
0.9995). For each datapoint four independent analyses were performed (SD are
indicated by vertical bars). The standard linear regression formulars were
used later on
to normalize the data of patient and control samples.
Figure 3. Comparison of data obtained with the two different MethylSNP
analysis
techniques SNaPmeth and PyroMeth. Only results for the pilocytic astrocytoma
tumor
subtype are shown (n = 32). The data are sorted by an increasing methylation
grade
as obtained with PyroMeth (gray circles). Black circles represent values
obtained with
SNaPmeth. For each data point two individual PCR reactions were carried out
and
either analysed once (SNaPmeth) or twice each (SD are indicated by vertical
barS).
Figure 4. Methylation analysis of CpG no 7 with PyroMeth. 95 tumors and 33
controls
could be analysed successfully. Every circle and square represents an
individual
sample. The colour code of the sample groups are given below the diagram. All
tumor
groups show an indistinguishably broad range of methylation
CA 02424575 2003-04-14
4
(22%-93%), regardless of their WHO grade and subtype. In contrast, normal
brain
tissues and spinal cord seem to be consistently highly methylated (range from
63% to
91%). Thus, many of the tumor samples are hypomethylated. PA, pilocytic
astrocytoma; AU, low grade astrocytoma; AlII, anaplastic astrocytoma; AIV,
secondary glioblastoma; GB, primary glioblastom; OD, oligodendroglioma; OA,
oligoastrocytoma; C, cerebrum; Cl, cerebellum; TC, truncus cerebri; SC, spinal
cord.
Figure 5. Comparison of the methylation grade at CpG No. 7 in 6 primary
gliomas
and there respective recurrence. The case number and the glioma subtype are
indicated below the collums. Recurrences of PA show higher methylation than
the
primary tumors. Recurrences of All show a lower methylation in their
recurrence than
in the primary tumors. The methylation grade therefore makes the glioma
subtypes
and there recurrences distinguishable. PA: pilocytic astrocytoma;
astrocytoma
grade II; AIII: astrocytoma grade III; AIV: astrocytoma grade IV.
Figure 6. Comparison of the methylation grade of CpG No. 7 between 3 primary
pilocytic astrocytomas and the blood samples of the respective patients. In
all cases
the methylation grade is lower in the blood DNA than in tumor DNA_ The
methylation
grade makes therefore the DNA distinguishable.
Detailed description of the Invention
The present invention relates to a method for the detection of a methylated
nucleotide at at least one predetermined position in a nucleic acid molecule
comprising the steps of (a) treating a sample comprising said nucleic acid
molecule
or consisting of said nucleic acid molecule in an aqueous solution with an
agent
suitable for the conversion of said nucleotide to pair with a nucleotide
normally not
pairing with said nucleotide; (b) amplifying said nucleic acid molecule
treated with
said agent; (c) real-time sequencing said amplified nucleic acid molecule; and
(d)
detecting nucleotides that formerly methylated or not methylated in said
predetermined position in the sample.
CA 02424575 2003-04-14
The term "methylated nucleotide" refers to nucleotides that carry a methyl
group
attached to a position of a nucleotide that is accessible for methylation. As
has been
detailed herein above, these methylated nucleotides are found in nature and
are
often used as epigenetic markers. The most important example to date is
methylated
cytosine that occurs mostly in the context of the dinucleotide CpG, but also
in the
context of CpNpG- and CpNpN-sequences. In principle, other naturally occurring
nucleotides may also be methylated.
The term "predetermined position in a nucleic acid molecule" is used in
correction
with the fact/denotes the fact that in a predetermined specific position
within the
nucleic acid molecule, it is known which type of nucleotide (adenine, cytosine
or
guanine) is present. Advantageously, the nucleotide sequence around this
nucleotide
is also known. Such knowledge may be derived from prior established sequencing
data such as from databases. It is advantageously also known that the
nucleotide in
this position may occur in a methylated or in a non-methylated state,
depending on
the status of the cell or tissue harboring said nucleotide. The state may be
associated
or indicative of, for example, a disease or a differentiation status.
Methylation
appears, at least in some cases, to be reversible. Analysis of the methylation
status
of the nucleotide in the predetermined position will in many cases, with a
high degree
of reliability, allow a conclusion with regards to the status of the cell or
tissue_
Simultaneously, often a conclusion may be drawn with respect to, for example,
the
disease state of the organism, such as a mammal and most preferably a human
from
which this cell originates.
The term "sample" means, in connection with the present invention, any sample
of
natural or non-natural origin that carries a nucleic acid molecule. The
nucleic acid
molecule may also be either of natural or non-natural origin. It may be single-
or
double-stranded and includes oligo- as well as polynucleotides_ It is
preferred that the
sample is of natural origin. It is further preferred that the sample is
derived from a
mammal, preferably a human. Preferred are further those embodiments, wherein
said
sample is derived from a tissue, a body fluid or stool. A tissue sample is any
sample
that may be taken from a vertebrate and preferably a mammal for analysis. If a
tissue
sample or other sample is taken from a human, the human will have to give his
informed consent_ Tissue samples include those from skin, muscle, cartilage,
bone or
T
CA 02424575 2003-04-14
6
inner organs such as liver, heart, kidney, brain, nerve tissue, spleen,
pancreas, gut
and stomach wherein this list is not be understood as exclusive. Body fluids
include
blood and fluids derived therefrom such as serum, urine, intestinal fluid and
sputum,
to name the most important ones.
The term "comprising said nucleic acid molecule or consisting of said nucleic
acid
molecule in an aqueous solution" describes, in connection with the present
invention,
the options that the sample may comprise the nucleic acid molecule to be
analysed
alone or together with other components that may occur in the neighborhood of
the
nucleic acid molecule in its natural state such as components derived from a
cell.
Examples of such components are RNAs such as rRNA or mRNA when DNA is
under investigation or residual genomic or plasmid DNA when RNA is to be
analysed.
Care should be taken to remove components from the sample that can interfere
with
the desired analysis. Alternatively, the sample may consist of the nucleic
acid
molecule in an aqueous solution. This alternative requires that the nucleic
acid
molecule after synthesis or extraction from a cell has substantially been
purified. It is
important to note that in this regard, the term "consisting or also
encompasses the
term "essentially consisting of' in accordance with the present invention. The
nucleic
acid molecule is thus at least 95%, preferably at least 98%, more preferred at
least
99% and most preferred at least 99,8% pure, irrespective of the contents of
the
aqueous solution. The aqueous solution may be water such as distilled water, a
buffered solution such as a phosphate buffered solution or buffered solution
other
than a phosphate buffered solution, to name some important examples. It is
mandatory that the solution is free or essentially free of enzymes that
unspecifically
degrade the nucleic acid molecule to be analysed such as DNases or RNases. On
the other hand, the method of the invention, if desired, may be carried out in
the
presence of specifically degrading enzymes such as restriction enzymes or
ribozymes. For certain purposes, small interfering RNAs may also be tolerated.
The term "agent suitable for the conversion of said nucleotide if present in
(i)
methylated form or (ii) non-methylated form to pair with a nucleotide normally
not
pairing with said nucleotide prior to conversion" refers to an agent such as
sodium
bisulfite (sodium hydrogen sulfite, (NaHS03) and hydrochinone 1,4-
dihydroxybenzene (C6H602)) that converts a cytosine nucleotide in its (in this
case:)
CA 02424575 2003-04-14
7
non-methylated state (in other cases: methylated state) into uracil (for other
nucleotides other conversion products are feasible) so that it pairs with a
adenosine
instead of a guanine. Upon the subsequent generation of the complementary
strand,
an adenine will be inserted instead of a guanine thus giving rise to an SNP
("MethSNP") in this position. Similarly, adenine may be converted by nitric
acid
(HNO3) to hypoxanthine to give rise to a nucleotide pairing with cytosine,
whereas
guanine can be treated with ethylmethanesulfonate to give rise to a nucleotide
pairing with thymine. Insofar, the normal Watson-Crick pairing in this
predefined
position is maintained (adenine:thymidine/uracil and cytosine:guanine) upon
subsequent amplification of the strands but a different nucleotide pair may be
present, depending upon the methylation status of the nucleotide originally
present in
this position. It is to be understood that the aforementioned agents are not
intended
to limit the invention but are preferred examples of possible agents. Included
within
the scope of the invention are agents that convert the non-methylated or the
methylated nucleotide as mentioned hereinabove. Preferred are agents that
convert
nucleotides in the non-methylated state.
The term "amplifying" refers to any method that allows the generation of a
multitude
of identical or essentially identical (i_e. at least 95% more preferred at
least 98%,
even more preferred at least 90% and most preferred at least 99.5% such as
99.9%
identical) nucleic acid molecules or parts thereof. Such methods are well
established
in the art; see Sambrook et al. "Molecular Cloning, A Laboratory Manual", 2"4
edition
1989, CSH Press, Cold Spring Harbor. They include polymerase chain reaction
(PCR) and modifications thereof, ligase chain reaction (LCR) to name some
preferred
amplification methods.
The term "real-time sequencing" denotes, in accordance with the present
invention
sequence analyses which allow specific sequencing, I e. determination of the
sequence of a nucleic acid molecule in real-time. Real-time sequencing allows
to
immediately monitor the incorporation of nucleotides by polymerases such as,
for
example, DNA or RNA polymerases by either fluorescence or luminescence signals
which are subsequently emitted. Real-time sequencing techniques include but
are
not limited to Pyrosequencing or fluorescence didesoxy nucleotide sequencing.
=
CA 02424575 2003-04-14
8
The detection step may be any suitable detection step that can differentiate
between
a methylated and a corresponding non-methylated nucleotide. A preferred
detection ,
method is described herein below. The detection step of the luminescence or
fluorescence signal may be any suitable detection step that can differentiate
between
a formerly methylated (e.g after conversion C) and a corresponding formerly
non
methylated nucleotide (e.g. after convertion T). The preferred detection
method is
Pyrosequencing. This method is based on the release of inorganic pyrophosphate
(PM) when a nucleotide has been incorporated in a growing nucleic acid strand
during a polymerase reaction. The released pyrophosphat can be detected after
a
enzymatically driven reaction which subsequently generate light The amount of
the
generated light is proportional of the amount of nucleotides incorporated as
for each
incorporated nucleotide PP1 is released and can initiate the above described
reaction
cascade. Formerly methylated and formerly non-methylated nucleotides can be
dicriminated and their repective amount can be quantitated through the
distinct
amounts of generated light when distinct nucleotides were incorporated.
The method of the invention overcomes the above mentioned deficiencies of the
prior
art methods. In its simples aspect, the method of the invention combines
treatment of
nucleic acids with the aforementioned agent so to generate new pairing
partners
upon subsequent amplification, amplification and real-time sequencing to a
novel
combination of steps neither envisages nor suggested by the prior art.
Importantly,
the method of the invention is amenable to high throughput (HTS) analysis. For
example said treatment of the nucleic acid with the aforementioned agent for
converting said nucleotides can be carried out automatically by robots, with
e.g.
capillary devices and in parallel, e.g. in microtiter plates, to treat a great
number of
samples in parallel. All steps of the amplification reaction and detection of
the
formerly methylated or non-methylated nucleotide in said samples are carried
out in
microtiterplates by robots in the high throughput format.
In one sequencing reaction up to 30 bp or more can be investigated. Therefor
not
only one but if preferred all nucleotides formerly methylated or not
methylated in this
said sequence can be detected. For example, in one microtiter plate, for
example, 96
different gene loci can be screened for methylated/non-methylated cytosine
nucleotides. By applying the above-mentioned methods, for example, 3 CpG
dinucleotides in their methylated/non-methylated status can be detected.
Accordingly,
CA 02424575 2003-04-14
9
in case of 96 different gen loci, up to 288 CpG dinucleotide can be detected.
It is also
envisaged, that the above-mentioned methods are applied in multiplex format.
Thus,
the present invention facilitates the quantitation of methylated versus non-
methylated
nucleotides at the respective positions. Namely, the amount of the emitted
light
during a real-time sequencing of the respective gene locus is proportional to
the
amount of incorporated nucleotides at the respective position. PyroMeth
software
calculates the frequency of alleles, I a methylated/non-methylated nucleotides
on
the basis of the emitted light. Particularly, allele frequencies were
calculated using
the peak heights: %C = peak C I (peak C peak T) x 100.
In another preferred embodiment of the method of the invention, said tissue is
a
tumor tissue, a tissue affected by a neurodegenerative disease or a tissue
affected
with another neurological disorder. More preferred tumors which may be
analysed in
accordance with the invention include primary tumors, metastases or residual
tumors.
Neurological or neurodegenerytic diseases/disorders comprise
diseases/disorders
affecting the brain or the central nervous system leading to, for example,
failures of
the brain and/or nervous systems. It is also envisaged that the method of the
invention can be used to analyse immune deficiencies or growth abnormalities.
The method in a particularly preferred embodiment considers that said primary
tumor
is a glioma. Additionally, in another particularly preferred embodiment said
primary
tumor is a solid tumor such of the skin, breast, brain, cervical carcinomas,
testicular
carcinomas, etc. More particularly, cancers that may be diagnosed by using the
methods of the present inventipon include, but are not limited to: Cardiac:
sarcoma
(a ng iosarcoma, fibrosarcoma, rhabdomyosarcoma, lipase rcoma), myxoma,
rhabdomyoma, fibroma, lipoma and teratoma; Lung: bronchogenic carcinoma
(squamous cell, undifferentiated small cell, undifferentiated large cell,
adenocarcinoma), alveolar (bronchiolar) carcinoma, bronchial adenoma, sarcoma,
lymphoma, chondromatous hamartoma, mesothelioma; Gastrointestinal: esophagus
(squamous cell carcinoma, adenocarcinoma, leiomyosarcoma, lymphoma), stomach
(carcinoma, lymphoma, leiomyosarcoma), pancreas (ductal adenocarcinoma,
insulinoma, glucagonoma, gastrinoma, carcinoici tumors, vipoma), small bowel
(adenocarcinoma, lymphoma, carcinoid tumors, Karposi's sarcoma, leiomyoma,
hemangioma, lipoma, neurofibroma, fibroma), large bowel (adenocarcinoma,
tubular
CA 02424575 2003-04-14
adenoma, villous adenoma, hamartoma, leiomyoma); Genitourinary tract: kidney
(adenocarcinoma, Wilm's tumor (nephroblastomaj, lymphoma, leukemia), bladder
and urethra (squamous cell carcinoma, transitional cell carcinoma,
adenocarcinoma),
prostate (adenocarcinoma, sarcoma), testis (seminomaõ teratoma, embryonal
carcinoma, teratocarcinoma, choriocarcinoma, sarcoma, interstitial cell
carcinoma,
fibroma, fibroadenoma, adenomatoid tumors, lipoma); Liver: hepatoma
(hepatocellular carcinoma), cholangiocarcinorna, hepatoblastoma, angiosarcoma,
hepatocellular adenoma, hemangioma; Bone: osteogenic sarcoma (osteosarcoma),
fibrosarcoma, malignant fibrous histiocytoma, chondrosarcoma, Ewing's sarcoma,
malignant lymphoma (reticulum cell sarcoma), multiple myeloma, malignant giant
cell
tumor chordoma, osteochronfroma (osteocartilaginous exostoses), benign
chondroma, chondroblastoma, chondromyxofibroma, osteoid osteoma and giant cell
tumors; Nervous system: skull (osteoma, hemangloma, granuloma, xanthoma,
osteitis deformans), meninges (meningioma, meningiosarcoma, gliomatosis),
brain
(astrocytoma, medulloblastoma, glioma, ependymoma, germinoma [pinealomal,
glioblastoma multiform, oligodendrogliama, schwannoma, retinoblastoma,
congenital
tumors), spinal cord neurofibroma, meningioma, glioma, sarcoma);
Gynecological:
uterus (endometrial carcinoma), cervix (cervical carcinoma, pre-tumor cervical
dysplasia), ovaries (ovarian carcinoma [serous cystadenocarcinoma, mucinous
cystadenocarcinoma, unclassified carcinoma], gran ulosa-thecal cell tumors,
Sertoli-
Leydig cell tumors, dysgerminoma, malignant teratoma), vulva (squamous cell
carcinoma, intraepithelial carcinoma, adenocarcinoma, fibmsarcoma, melanoma),
vagina (clear cell carcinoma, squamous cell carcinoma, botryoid sarcoma
(embryonal
rhabdomyosarcomal fallopian tubes (carcinoma); Hematologic: blood (myeloid
leukemia [acute and chronic], acute lymphoblastic leukemia, chronic
lymphocytic
leukemia, myeloproliferative diseases, multiple myeloma, myelodysplastic
syndrome), Hodgkin's disease, non-Hodgkin's lymphoma [malignant lymphoma];
Skin: malignant melanoma, basal cell carcinoma, squamous cell carcinoma,
Karposi's sarcoma, moles dysplastic nevi, lipoma, angioma, dermatofibroma,
keloids,
psoriasis; and Adrenal glands: neuroblastoma. It is most preferred that said
glioma is
an astrocytoma, an oligodendroglioma, an oligoastrocytoma, a glioblastoma, a
pilocytic astrocytoma. Examples of astrocytomas that may be analysed in
accordance with the invention include those mentioned in the appended
examples.
CA 02424575 2003-04-14
11
Also preferred are embodiments wherein said neurodegenerative disease is
Alzheimer disease, Parkinson disease, Huntington disease, Rett-Syndrome_
As regards said further neurological disorders it is preferred that those are
Prader-
VVilli-Syndrome or Angelman-Syndrome, Fragile X-Syndrome, ATR-X-Syndrome_
The nucleic acid molecule may be any nucleic acid molecule known in the art
including a peptide nucleic acid molecule (PNA). In an additional preferred
embodiment of the method of the invention said nucleic acid molecule is a DNA
molecule or an RNA molecule. DNA molecules include genomic DNA as well as
cDNA wherein genomic DNA is preferred since naturally occurring. RNA includes
ribosomal RNA (rRNA), transfer RNA and messenger RNA (mRNA). Again, it is to
be
understood that these options are preferred options that are not intended to
limit the
scope of the invention.
As mentioned above, a variety of amplification methods are known in the art,
all of
which are expected to be useful in the method of the invention. It is
preferred that the
amplification in step (b) is effected by LCR or PCR. The PCR is a powerful
technique
used to amplify DNA millions of fold, by repeated replication of a template,
in a short
period of time. The process utilizes sets of specific in vitro synthesized
oligonucleotides to prime DNA synthesis. The design of the primers is
dependent
upon the sequences of the DNA that is desired to be analyzed. It is known that
the
length of a primer results from different parameters (Gillam (1979), Gene 8,
81-97;
Innis (1990), PCR Protocols: A guide to methods and applications, Academic
Press,
San Diego, USA). Preferably, the primer should only hybridize or bind to a
specific
region of a target nucleotide sequence. The length of a primer that
statistically
hybridizes only to one region of a target nucleotide sequence can be
calculated by
the following formula: (%) x (whereby x is the length of the primer). For
example a
hepta- or octanucleotide would be sufficient to bind statistically only once
on a
sequence of 37 kb. However, it is known that a primer exactly matching to a
complementary template strand must be at least 9 base pairs in length,
otherwise no
stable-double strand can be generated (Goulian (1973), Biochemistry 12, 2893-
2901). It is also envisaged that computer-based algorithms can be used to
design
primers capable of amplifying the nucleic acid molecules of the invention.
Preferably,
CA 02424575 2003-04-14
12
the primers of the invention are at least 10 nucleotides in length, more
preferred at
least 12 nucleotides in length, even more preferred at least 15 nucleotides in
length,
particularly preferred at least 18 nucleotides in length, even more
particularly
preferred at least 20 nucleotides in length and most preferably at least 25
nucleotides
in length. The invention, however, can also be carried out with primers which
are
shorter or longer.
The PCR technique is carried out through many cycles (usually 20 - 50) of
melting
the template at high temperature, allowing the primers to anneal to
complimentary
sequences within the template and then replicating the template with DNA
polymerase. The process has been automated with the use of thermostable DNA
polymerases isolated from bacteria that grow in thermal vents in the ocean or
hot
springs. During the first round of replication a single copy of DNA is
converted to two
copies and so on resulting in an exponential increase in the number of copies
of the
sequences targeted by the primers. After just 20 cycles a single copy of DNA
is
amplified over 2,000,000 fold.
The LCR is another technique that allows detection of single point mutations
in
disease genes (Taylor (1995), Curr Opin Biotechnol. 1, 24-29; Yamanishi
(1993),
Hum Cell 2, 143-147; Leffler (1993) Ann Bid Clin 51, 821-8).The technique
utilizes a
themlostable DNA ligase to ligate together perfectly adjacent oligos. Two sets
of
oligos are designed to anneal to one strand of the gene at the site of the
mutation, a
second set of two oligos anneals to the other strand_ The oligos are designed
such
that they will only completely anneal to the wild-type sequences. In the
example
shown below for the sickle-cell mutation, the 3' nucleotide of one oligo in
each pair is
mismatched. This mismatch prevent the annealing of the oligos directly
adjacent to
each other_ Therefore, DNA ligase will not ligate the two oligos of each pair
together.
With the wild-type sequence the oligo pairs that are ligated together become
targets
for annealing the oligos and, therefore, result in an exponential
amplification of the
wild-type target. Given that prior sequence knowledge is required in order to
detect
point mutations in disease genes, the LCR technique is utilized for the
diagnosis of
the presence of a mutant allele in high risk patients.
CA 02424575 2003-04-14
13
For further guidance, see Taylor (1995), Cliff Opi11 Biotechnol. 1, 24-29,
Yamanishi
(1993), Hum Cell 2, 143-147, and Leffler (1993) Ann Biol Glin 51, 821-6.
In a particularly preferred embodiment of the method of the invention, one
amplification primer is detectably labeled. The detectable label
advantageously forms
an anchor which allows removal of single stranded amplified molecules after
amplification. In a further particularly preferred embodiment of the
invention, said
amplification products are therefore converted into single stranded molecules
(e.g.
upon heat application such as application of temperatures higher than 90 C)
prior to
further processing in step (c). The anchor may be taken up by a further
molecule
which may be affixed to a solid support such as a chip, a bead, a column
material, a
microtiter plate etc. having a glass surface, a plastic surface such as a
homopolymer
or on other surface. The anchor and further molecule may be binding pair that
have
naturally a high affinity exceeding 10e6 M such as an antibody/antigen pair or
a
biotin/ avidin or biotin /streptavidin pair.
In accordance with the present invention, it is especially preferred that said
label is
biotin, avidin, streptavidin or a derivative thereof or a magnetic bead.
Derivatives of
streptavidin include molecules having a lower binding affinity for biotin and
include
Strep-tag I, Strep-tag II and Strep-tag III described in DE-Al 101 13 776 or
US-A
5,506,121. These molecules allow the dissociation from biotin under rather
mild
physiological conditions_
It is also preferred in accordance with the present invention that said
methylated
nucleotide is an adenine, guanine or a cytosine.
In a most preferred embodiment of the method of the present invention, said
real-
time sequencing comprises;
(a) hybridization of a sequencing primer to said amplified nucleic acid
molecule in single-stranded form;
(b) addition of a DNA polymerase, a ATP sulfurylase, a luciferase, an
apyrase, adenosine-phosphosulfate (APS) and iuciferin;
(c) sequential addition of all four different dNTPs;
CA 02424575 2003-04-14
14
(d) detection of a luminescent signal wherein the intensity of the
luminescent signal is correlated with the incorporation of a specific
nucleotide at a specific position in the nucleic acid molecule and
wherein the intensity of said signal is indicative of the methylation status
of said nucleotide in said predetermined position.
Most preferably, real-time sequencing is performed by the pyrosequencing
method
which is further explained in the appended examples. In said pyrosequencing
method
an amplified nucleic acid molecule is separated to a single-stranded nucleic
acid
molecule, as described herein below_ The DNA complementary strand synthesis is
subsequently done after annealing of a further primer monitored to determine
sequences, namely, pyrophosphate released as a reaction product upon
synthesizing a complementary DNA strand is converted into ATP, which reacts
with
luciferine using luciferase to generate luminescence. Since pyrosequencing is
inexpensive and can be used, e.g., for sequencing a large number of samples
simultaneously, it is applicable as a high throughput monitor for DNA.
Pyrosequencing is briefly explained as follows. The apparatus used is a so-
called
luminescence photometer. Reagents, including DNA samples; primers to determine
the starting point of complementary strand synthesis; DNA synthesizing
enzymes; an
enzyme a pyrase to decompose dNTP which has been added as a substrate and
remained unreacted; sulfurylase to convert pyrophosphate into ATP; luciferine;
and
luciferase involved in the reaction of luciferine with ATP, are placed in a
titer plate. At
this moment, no complementary strand synthesis occurs because dNTP, a
substrate
for the reaction, is not present. Four kinds of dNTP (i.e., dATP, dCTP, dTTP
and
dGTP) are added in a designated order from the top of the reaction vessel, for
example, by an ink jet system. If dCTP is the designated base to be
synthesized, no
reaction occurs when dATP, dTTP or dGTP is added. Reaction occurs only when
dCTP is added, then the complementary strand is extended by one base length,
and
pyrophosphate (PPi) is released. This pyrophosphate is converted into ATP by
ATP
sulfurylase and the ATP reacts with luciferine in the presence of luciferase
to emit
chemiluminescence. This chemilurninescence is detected using a secondary
photon
multiplier tube or the like. Remaining dCTP or unreacted dNTP is decomposed by
apyrase which converts it into a form which has no effect on the subsequent
repetitive dNTP injection and the reaction which follows. The four kinds of
dNTPs are
CA 02424575 2003-04-14
added repeatedly in a designated order and the base sequence is determined one
by
one according to the presence or absence of chemiluminescence emitted each
time.
(see Ronaghi, M. et al. Science 281, 363-365 (1998)). The reported possible
length
of DNA to be sequenced ranges between 20 bases and 30 bases, however, is not
limited thereto. This is because the sequencing is involved in a step
reaction, in
which the efficiency of the reaction is largely affected by the possible
length of the
base to be sequenced. Examples of possible systems in which pyrosequencing is
used include a palm-sized DNA sequencer, a DNA sequencer for large scale
analyses for gene diagnoses or comparative analyses, and a DNA mutation
analysis
system.
Further, various primers can be immobilized on a solid surface, beads or the
like, and
the target nucleic acid is obtained by hybridizing a double-stranded nucleic
acid
sample with these primers so that a necessary and sufficient amount of nucleic
acid
sample can be readily supplied_ Since the target nucleic acid can be injected
into a
reaction vessel without processing it into a single strand, only a simple
sample
preparation is required for the sequencing reaction.
Longer DNAs can also be sequenced and analyzed by carrying out a sufficient
and
thorough reaction. Therefore, the structure of the reaction vessel is devised
such that
the reaction chamber is in contact with a vibrating element to thoroughly mix
added
dNTP with a reaction solution. The reaction efficiency can be increased by
stirring the
injected dNTP.
In the DNA base sequencing method, pyrophosphate produced upon a DNA
complementary strand synthesis is converted into ATP, the ATP is reacted with
luciferine using luciferase to generate chemiluminescence, the emitted
chemiluminescence is detected, whereby the kind of incorporated nucleic acid
is
detected and thus the base sequence is determined. The four kinds of dNTPs are
supplied into a reaction vessel in a designated order by pressurizing via
capillaries or
narrow grooves which conned the reaction vessel and reagent reservoirs. Also a
palm-sized DNA sequencing apparatus can be used, and many kinds of DNAs can
be simultaneously analyzed by providing a multiple number of reaction chambers
in a
small area.
It is also preferred in accordance with the invention that the method further
comprises
quantifying the methylated nucleotides (or, alternatively non-methylated
nucleotides).
CA 02424575 2003-04-14
16
= The quantification of methylated nucleotides is an important means to
draw in many
instances a valid conclusion with regard to the epigenetic status of the
analysed
sample, for example, the methylation grade of nucleotides allows to draw
conclusions
about the progression of tumors or allows to draw conclusions about the
response of
an individual during therapy or allows to distinguish normal tissue from tumor
tissue.
This is because the analysed tissues or cell samples may not be uniformly
methylated or not methylated in a specific predefined chromosomal position_
Rather,
a majority of cells only may be methylated or not methylated in said specific
predefined chromosomal position. Insofar, a quantitation of the readout will
help in
providing a meaningful analysis. Ouantitation is best carried out by including
an
internal standard such as a tissue or cell sample known to consist or
essentially
consist (with regard to the percent values in connection with the term
"essentially",
see above) of methylated or non-methylated nucleotides at the position of
interest.
Alternatively an recombinantly or artificial ((sempsynthetically produced)
nucleic acid
molecule may serve as a control_ The skilled artisan may without undue burden
determine conditions or use host cells that are devoid of a methylation
system.
Alternatively, the nucleic acids may be methylated within a cell or in vitro
using
appropriate methylases. As mentioned hereinabove, quantitation Is done by
analysing the emitted light arising due to incorporation of nucleotides.
The method of the invention in a different preferred embodiment requires that
said
agent suitable for the conversion of said nucleotide to pair with a nucleotide
normally
not pairing with said nucleotide is sodium bisulfite.
As stated elsewhere in this specification, bisulfite reacts with non-
methylated cytosine
and changes its base-pairing behaviour. After bisulfite treatment, the former
cytosine
residue (now an uracil) pairs after subsequently amplified as a thymine in an
amplifying reaction with adenine.
A particularly preferred version of this embodiment is further detailed below:
As mentioned, this embodiment takes advantage of the fact that bisulfite
modification
of genomic DNA creates common single nucleotide polymorphisms (SNPs), such as
[CM, at differentially methylated CpGs, which we call MethylSNPs. On the one
hand,
the primer extension approach SNaPshotTM from Applied Biosystems, to
investigate a
particular MethylSNP was used, calling this version SNaPmeth. This approach
was
CA 02424575 2003-04-14
17
compared with the method of the present invention, which makes in this
specific
embodiment use of the sequencing-by-synthesis technique PyrosequencingTM from
Pyrosequencing to analyse the percentage of methylation at the same CpG. This
embodiment of the invention is also called technique PyroMeth (Fig.1). In
SNaPmeth,
the polymerase extends a primer complementary to the bisulfite-modified DNA
template by adding only a single fluorescently labeled nucleotide to its 3
end. After
capillary electrophoresis of the extended primer, the labeling of the four
dideoxynucleotide triphospates (ddNTPs) with different fluorescent dyes allows
the
GeneScene software to distinguish between the two bases incorporated at the
polymorphic site. In PyroMeth, the MethylSNP is analysed by real-time
sequencing,
based on the detection of the stepwise nucleotide incorporation by
luminescence.
After hybridization of primer and template, the four deoxynucleotide
triphosphates
(dNTPs) are added separately according to a predetermined dispensation order.
Only
if the offered nucleotide is complementary to the bisulfite-treated template
is it
incorporated and inorganic pyrophospate (PPi) is released. PPi drives an
ensuing
reaction cascade at the end of which a certain amount of light is released
that is
equivalent to the amount of incorporated nucleotides. Unincorporated dNTPs are
degraded after each reaction cycle and therefore the intensity of any light
signal can
be reliably assigned to a specific dNTP. We used both methods to test
methylation of
CpG no 7 [11] in 97 primary tumors of different glioma subtypes and 33 control
tissues derived from three parts of the brain and spinal cord as a biomarker
for
molecular diagnosis of pilocytic astrocytomas. As is evident from the appended
example, the method of the invention is superior to the SnaPmeth technology.
The invention further relates to a method for the diagnosis of a pathological
condition
or the predisposition for a pathological condition comprising detection of the
methylation status of a nucleotide at at least one predetermined position in a
nucleic
acid molecule comprising the steps of (a) treating a sample comprising said
nucleic
acid molecule or consisting of said nucleic acid molecule in an aqueous
solution with
an agent suitable for the conversion of said nucleotide if present in (i)
methylated
form; or (ii) non-methylated form to pair with a nucleotide normally not
pairing with
said nucleotide prior to conversion; (b) amplifying said nucleic acid molecule
treated
with said agent; (c) real-time sequencing said amplified nucleic acid
molecule; and
(d) detecting whether said nucleotide is formerly methylated or non-methylated
in
CA 02424575 2003-04-14
18
said predetermined position in the sample wherein a methylated or a not
methylated
nucleotide is indicative of a pathological condition or the predisposition for
said
pathological condition.
For the following preferred embodiments, the same definitions and explanations
as
given herein above for corresponding embodiments apply.
In a preferred embodiment of this method of the invention, said pathological
condition
is cancer, a neurodegenerative disease or another neurological disorder.
More preferred, said tumor is a primary tumor, a metastasis or a residual
tumor. It is
particularly preferred that said primary tumor is a glioma and most preferred
that said
glioma is an astrocytoma, oligodendroglioma, oligoastrocytoma, pilocytic
astrocytoma
or glioblastoma.
Further preferred in accordance with the method of the invention is that said
neurodegenerative disease is Alzheimer disease, Parkinson disease, Huntington
disease, Rett-Syndrome.
It is also preferred that said neurological disorder is Prader-Willi-Syndrome
or
Angelman-Syndrome, Fragile-X-Syndrome, ATR-X-Syndrome.
Again, preferred is further a method wherein said nucleic acid molecule is a
DNA
molecule or an RNA molecule.
In a different preferred embodiment of this method of the invention, the
amplification
in step (b) is effected by LCR or PCR. More preferred, amplification is
carried out
under conditions wherein one amplification primer is detectably labeled. Said
label
preferably is biotin, avidin, streptavidin or a derivative thereof or a
magnetic bead.
Also in this embodiment of the invention, said methylated nucleotide
preferably is an
adenine, guanine or a cytosine.
CA 02424575 2003-04-14
19
It is again particularly preferred that this embodiment of the method of the
invention is
carried out under conditions wherein said real-time sequencing comprises:
(a) hybridization of a sequencing primer to said amplified DNA in single-
stranded form;
(b) addition of a DNA polymerase, a ATP sulfurylase, a luciferase, an
apyrase, adenosine-phosphosulfate (APS) and luciferin;
(c) sequential addition of all four different dNTPs;
(d) detection of a luminescent signal wherein the intensity of the
luminescent signal is correlated with the incorporation of a specific
nucleotide at a specific position in the DNA and wherein the intensity of
said signal is indicative of the methylation status of said nucleotide in
said predetermined position.
Preferably, the method further comprises steps for quantifying the formerly
methylated nucleotides.
Further preferred is, again, that said agent suitable for the conversion of
said
nucleotide to pair with a nucleotide normally not pairing with said nucleotide
is
sodium bisulfite_
In all embodiment referred to herein above it is preferred that at least the
detection
step and more preferred all steps are carried out in the high throughput
format_
Nucleic acid-extraction from said tissues, body fluid or the like, can be done
automatically by robots_ Said conversion and purification of said nucleic
acids can
also be carried out automatically by robots, with e.g. capillary devices and
e.g. in
microtiterplates_ All steps of the amplification reaction and detection of the
formerly
methylated or non-methylated nucleotide in said samples can be carried out in
microtiter plates by robots in the high throughput format.
In a different preferred embodiment, at the same time, the methylation status
of more
than one predetermined nucleotide such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 or even
more,
such as at least 20, 50, 100 or 1000 predetermined positions is detected. One
sample can be analysed at more than one predetermined nucleotide positions at
the
same time, or a number of samples can be analysed at more than one
predetermined
nucleotide positions at the same time In one detection step of a sample more
than
CA 02424575 2003-04-14
one predetermined nucleotide positions can be analysed (multiplexing), either
in one
nucleic acid fragment, or in 2, 3 or more different nucleic acid fragments.
The present invention, thus generally described, will be understood more
readily by
reference to the following examples, which are provided by way of illustration
and are
not intended to be limiting of the present invention.
Example
1 Materials and Methods
1.1 Patient samples
This study included 97 primary tumor samples, distributed as follows: 32
pilocytic
astrocytomas (range 2 - 35 years, 16 male, 14 female), 29 astrocytomas grade
Ii
(range 9 - 54 years, 12 male, 17 female), 10 astrocytomas grade III (range 3 -
67
years, 4 male, 6 female), 6 astrocytomas grade IV (range 10 - 71 years, 3
male, 3
females), 3 glioblastoma multiform (range 46 - 70 years, 2 male, 1 female), 7
oligoastrocytomas (range 20 - 63 years, 2 male, 5 female), 10
oligodendrogliomas
(range 17 - 60 years, 3 male, 7 female). 33 control tissues derived from 9
healthy
individuals (range 0.6 - 88 years, all male) from three parts of the brain,
including
cerebrum (C, n = 9), cerebellum (Cl, n = 8) and truncus cerebri (TC, n = 15),
as well
as spinal cord (SC, n =- 1). Details of the individual patients and specimens
are
published elsewhere [12]. All tumour and control samples are derived from
unrelated
patients/individuals. The histological typing of the tissues was done
according to the
classification of the World Health Organization (WHO) [13]. No substantial
contamination of the tumor samples with normal tissues was evident. Control
tissues
were provided through the Brain and Tissue Bank for Developmental Disorders,
University of Miami, USA, contract No. NOI-HD-8-3284 under sponsorship of The
National Institutes of Health, except for the samples of individual number
1100
(Department of Pathology, University of Southern California, School of
Medicine, Los
Angeles, USA) and samples from individual number 7909 (Department of Human
Molecular Genetics, Max Planck Institute for Molecular Genetics, Berlin,
Germany).
All tissues were stored at --20 C. Genomic DNA was extracted following a
standard
procedure, described elsewhere [14].
CA 02424575 2011-06-07
21
1.2 Sodium bisulfite conversion
Sodium bisulfite conversion of whole genomic DNA was performed as described
previously [15], with slight modifications according to Eads et at (10].
Briefly, 250 ng
of genomic DNA (in a volume of 8p1) were denatured at 95 C. 10 min, followed
by
incubation in a 0.3 M NaOH concentrated solution at 42 C, 15 min. DNA and 10
pl of
4% low melting agarose (SeaPlaque, FMC Bioproducts, Rockland, Maine, USA) were
mixed, and a single bead with a final volume of 20 pi was formed in prechilled
mineral oil. Bisuifite conversion was performed with a 5 M sodium bisulfite
solution at
50 C, 14 h, under exclusion of light. TE-buffer (pH 8) was Used for washing
the
beads six times, 15 min for each wash. Desulphonation Was done in 0.2 M NaOH
twice for 15 min each. The second wash with NaOH was neutralized with 1 M NCI,
followed by two additional washing steps, again, with TE buffer. For
amplification with
PCR the agarose beads were diluted with 180 pl HPLC H20.
1.3 PCR
Bisulfite converted genomic DNA was amplified with primers. It is preferred
that said
primers encompass nucleic acid sequences not comprising nucleotides which are
formerly methylated. It is also preferred that said primers span regions
comprising
originally methylated or non-methylated nucleotides. In the present invention,
for
example, bisulfite converted genomic DNA was amplified with primers fully
complementary to the deaminated DNA strands (forward 5'-
TGAGTIGGAATAING1TAGGGTAGATGTG ¨3'; reverse
CAACTCTCTATATCCCMCTAACATAAATCA -3'), yielding a product of 102 bp
length. For the PyroMeth assay, the forward primer was biotinylated. The
primers do
not contain CpG dinucleotides so that the amplification step does not
discriminate
between templates according to their original methylation status. The
following
protocol was used for PCR reaction (modifications for the SNaPmeth application
are
indicated in brackets): the PCR reactions had a total volume of 50 p1(25 pl).
10 p1(5
p1) of agarose-embedded DNA were used as template DNA. The template DNA, 10
pM of each primer, 10 mM dNTPs, 0.4 U Ampli-TaqTm Gold Polymerase (0.2 U) were
incubated with 5.0 pi reaction buffer (2.5 pl). The amplification was
performed in a
PTC 200 cycler from M..1 Research under the program conditions 95 C/ID min
followed by 40 cycles of 9:5 C/1 min, 58 C/1 min, 72 C/1 min, and an extension
step
1 "
CA 02424575 2003-04-14
22
at 72 C for 5 min. For each sample, two independent PCR amplifications were
performed and analysed. For PyroMeth, unincorporated primers and cINTPs were
separated from the PCR product using the Invisorb PCR HTS 96 Kit (Invitek
GmbH,
Berlin, Germany). For the SNaPmeth assay, enzyme-based digestion of single
stranded oligonucleotides and unicorporated dNTPs was performed, using SAP and
Exol according to the supplier's recommendation (Amersham, Braunschweig,
Germany).
1.4 Standardization experiments
To obtain "homozygous" templates for MethylSNP analysis with respect to either
the
converted CpG or TpG "allele", cloned PCR fragments of 746 bp length (modified
top
strand), derived from bisulfite sequencing experiments [11] served as
templates for
PCR. Amplification products were mixed in different proportions (PyroMeth: 21
proportions in 5% increments from C/T 100:0 to UT: 0:100). The mean of four
independent measurements with standard deviations (SD) were plotted in the
calibration plots (Fig. 2). To normalize for background and other factors
influencing
peak heights and peak areas in a systematic way, data of patient samples and
controls were corrected to the calibration curve, according to the
calculations outlined
below in the MethylSNP analysis section.
1.5 MethylSNP analysis
SNaPmeth. 1 - 3 pi of SAP- and Exol-treated PCR product (- 0.15 pmol) were
used
for each SNaPmeth primer extension reaction. 0.5 pmol primer (5--
TTAGGGGGGTGAATATTGGG -3) and 1.25 pi SNaPshot Ready Reaction Mix
(including AmpliTaq DNA polymerase, fluorescence-labeled (F) ddNTPs, reaction
buffer; PE Biosystems, Weiterstadt, Germany) were added to a total reaction
volume
of 10 pl. Cycling parameters: 96 C./30 sec, 60 C/1 min, 25 cycles in a 96 well
microtiter plate. Post-extension treatment with SAP (1 h, 37 C), removed the
5'
phosphoryl groups of unicorporated [F]ddNTPs, prohibiting interference of
fluorescence signals during electrophoresis. For electrophoresis on the ABI
PRISM
310 Genetic Analyzer POP4TM polymer was used, with an injection time 4 sec and
a
collection time 13 min. The run files were analysed using GeneScan Analysis
Software version 2.1. Peak area values were used to calculate allele
frequencies in
% (e.g. peak area C/peak. area C+T) x 100), representing the methylation grade
at
_ .
CA 02424575 2003-04-14
23
CpG no 7. The mean of the calculated allele frequencies of one sample was
normalized to the calibration curve (y = mx b, with y: observed allele
frequency, rre
regression coefficient as the slope of the function, x: expected allele
frequency, b:
intersection point of curve with zero).
PyroMeth. Single-stranded PCR fragments are needed for the sequencing-by-
synthesis reaction. To purify the biotinylated PCR fragments they are
immobilized on
streptavidin-coated Dynabeads Streptavidin (Dynal AS, Oslo, Norway),
according to the protocol of the SNP Reagent Kit 5 x 96, Pyrosequencing. After
incubation for 15 min at 65 C, the reactions were transferred into a PSCirm 96
well
reaction plate and denatured in 0.5 M NaOH, 10 min. The single stranded PCR
fragments were captured with the magnetic rod, transferred in a PSQ 96 well
plate
and washed in lx annealing buffer. Again transferred, the single stranded PCR
fragments were hybridized with 10 pmol sequencing primer (5 -
GGGGTGAATATTGGG ¨3 ) in lx annealing buffer, 80 C for 2 min, then moved to
room temperature.
The sequencing reaction was performed at 25 C in a volume of 40 11.1 lx
annealing
buffer on the automated PSQTM 06 System from Pyrosequencing. Enzyme and
substrate from the SNP Reagent Kit were dissolved in each 620 al high purity
water,
after reaching room temperature. Then, they were loaded into a special
cartridge, just
like 160 ti.1 of each deoxynucleoside triphosphate from the same kit. The
cartridge
and the sample plate were placed into the instrument and the analysis runs
automatically. The order of nucleotide dispensation was defined before,
corresponding the template sequence. Allele frequencies were calculated using
the
integrated software SNP Software AQ. Peak ,heights given in the pyrogram were
used to calculate the methylation grade of CpG no 7 in percent (e.g.: %C e-:
peak
height C / (peak height C 4- peak height T) x 100). The mean of the calculated
allele
frequencies of one sample was normalized to the calibration curve (see above).
2 Results
To determine the accuracy of each method for measuring allele frequency within
a
DNA pool we performed standardization experiments with well-defined DNA
samples
prior to the analysis of the tumor samples. Since it cannot be guaranteed for
any kind
CA 02424575 2003-04-14
24
of genomic DNA that a CpG of interest is methylated or non-methylated to 100%,
we
used cloned PCR fragments. These 746-bp fragments were obtained from former
bisulfite sequencing experiments [11] and known to comprise our test CpG no 7
either in a "methylated" (CpG) or "unmethylated" (TpG) state. Using the
piasmids as
templates we generated "homozygous" PCR products containing the test CpG as
the
only polymorphic site. The amplification products were mixed in different
proportions.
The relationships between peak heights in a pyrogram (PyroMeth) or peak areas
in
an electropherogram (SNaPmeth) and the underlying allele frequencies were
investigated (Fig. 2). A minor allele frequency of 5% could be detected
without any
problem. The SD obtained with SNaPmeth ranged between 0% and 3.7%, in the
PyroMeth assay between 0.2% and 1%. Over the whole data points a linear
relationship of the measured allele frequencies was observed. Both, pooling of
plasmid DNA and PCR products resulted in satisfying allele frequency detection
(data
not shown). We used PCR products for the calibration curves to avoid repeated
culturing of plasmids and preparation of plasmid DNA.
To investigate the stability of the analysis systems themselves, we assayed
twelve
individual PCR products two times (data not shown). The PCR products were
obtained from genomic DNA from six different patients. For SNaPmeth, the
greatest
difference in methylation grades, i.e. percent of allele C detected in the
same PCR
product, was 15.9 % with an average difference of 4.7%. For PyroMeth, the
greatest
difference was 3.6% with an average difference of 0.6%. After determining the
accuracy and the reproducibility of SNaPmeth and PyroMeth, we analyzed the
methylation grade of CpG no 7 in a total of 97 primary tumor samples of 5
different
glioma subtypes_ DNA out of 33 tissues from three different parts of the brain
and
spinal cord served as controls. Data were normalized against the calibration
curves
as outlined in the materials and methods section. The data obtained with
SNaPmeth
were very similar to the data generated with PyroMeth. The trends of
methylation
grades in tumor and control groups were identical. However, the individual
methylation values of the samples differed systematically between the two
assays. In
general, the SNaPmeth assay detected a higher amount of allele C (on average
8%),
representing higher methylation (Fig. 3). Overall, the SD for the two
independently
generated and analysed PCR amplicons showed higher values with this SNP
analysis technique (range 0.2% ¨ 11.2%, average 3%), as in the real-time
sequencing approach PyroMeth (0.5% ¨ 4.9%, average 1.8%).
CA 02424575 2003-04-14
The results about the assessment of CpG no 7 as a potential biomarker are
shown
in Figure 4. Data as derived from the sequencing-by-synthesis assay PyroMeth
are
presented. The control groups show a fairly homogeneous methylation in
contrast to
all tumor subtypes. The latter present a broad range of methylation values
irrespective of the tumor grade as shown for astrocytomas. The stratification
of the
control groups according to the tissue type did not reveal any tissue
dependency of
methylation. This could be proven for the tumor subtypes as well (data not
shown).
As methylation may depend on age and gender, we also analyzed the influence of
these parameters. Neither age nor gender dependency was found in the tumor
samples (data not shown).
3 Discussion
We have described two semi-automated techniques to quantitate DNA methylation
at
a single CpG. SNaPmeth is based on a single nucleotide primer extension
approach
with fluorescently labeled ddNTPs while PyroMeth is based on a real-time DNA
sequencing technique. Investigating methylation by a primer extension reaction
has
already been described by others [8]. These authors used radioactively labeled
ddNTPs and called their method methylation-sensitive single nucleotide primer
extension (Ms-SNuPE). Our non-radioactive version of the method has several
advantages: (i) no hazards from radioactivity, (ii) no time consuming pouring,
loading,
and running of denaturing polyacrylamid gels electrophoresis, (iii)
simultaneous
detection of C and T alleles in one reaction, and (iv) it is semi-automated
and suitable
for high-troughput. Thus, SNaPmeth improves this type of approach
significantly. If
one compares SNaPmeth with PyroMeth, the latter is more reliable and accurate,
i.e.
the SD values were consistently lower in all experiments.
In total, we screened 130 samples with our new MethylSNP detection methods. As
shown in Figure 3, the trend of methylation found with one approach was nearly
exactly mirrored by the results of the other. However, the methylation values
determined with SNaPmeth were consistently higher than the values detected
with
PyroMeth. To allow maximum comparability between the data generated with both
methods, the experimental set up was done in parallel as much as possible
(e.g.
DNA derived from the same bisulfite treatment, one mastermix for all PCRs,
same
thermocycler)_ Therefore, we believe that the reason for the slight shift (on
average
8%) between the results obtained with both methods lies in the assays
themselves_
CA 02424575 2003-04-14
26
In SNaPmeth, the primer extension reaction occurs in the presence of all four
differently fluorescence-labeled ddNTPs, this may lead to a preferential
incorporation
of particular nucleotides [16]. The competition of nucleotides for
incorporation is
circumvented in the PyroMeth approach, as the unlabeled dNTPs are added
separately one after the other. Furthermore, traces of agarose of the DNA-
embedding beads may have a negative influence on capillary ectrophoresis,
which
has to be carried out for separating the extension products in SNaPmeth [17].
In the
PyroMeth approach minimal traces of agarose will be present as well, but they
may
be better tolerated since no electrophoresis and detection of laser-induced
fluorescence is required_
Using the method of two-dimensional (2D) DNA fingerprinting, we previously
found
CpG no 7 consistently hypomethylated in nearly all pilocytic astrocytomas
(10/11) but
only a negligible portion of astrocytomas (2/18) under investigation [111. In
this study,
we analysed 32 pilocytic astrocytomas and 29 astrocytomas grade 11 and no
difference in methylation of this CpG could be observed between the two glioma
subtypes. Rather in both subgroups, a substantial portion of tumor samples was
remarkably hypomethylated while others showed the same high level of
methylation
as the control tissues. This broad range of methylation from 20% to 90% was
also
found in the other tumor subtypes (Fig. 4). Only among the 7 oligoastrocytomas
no
dramatic hypomethylation was observed, which might be due to the small number
of
samples analyzed. Interestingly, we could demonstrate that, among the samples
analyzed in this and the previous study, all those with the typical spot shift
in 2D DNA
fingerprints, indicating the loss of the methyl group at CpG no 7 [11], had a
methylation grade below 70%, whereas those without the spot shift had values
above
70% (data not shown). It cannot be excluded that tumor samples with a high
grade of
methylation of CpG no 7 are contaminated with normal tissue but this was not
evident
from histopathological investigations_ Nevertheless, our data confirm that
hypomethylation may be as important as hypermethylation in cancer [2]_ A
database
search for coding sequences next to CpG no 7 did not reveal any functional
genes in
that region. Thus, we no longer consider the observed demethylation of this
CpG a
pivotal event in tumorigenesis of pilocytic astrocytomas, but an unspectacular
concomitant of early tumor development in gliomas.
Any kind of SNP detection method may be adapted for MethylSNP analysis_
However, assays suitable for the analysis of allele frequencies in DNA pools,
such as
CA 02424575 2013-04-04
s
,
27
Pyrosequencing and SNaPshot, are most appropriate. We have demonstrated that
quantitative MethylSNP analysis by the method of the invention is a favorable
alternative to existing high-throughput methylation assays [9,10]. Depending
on the
platform used, between 48 (one-capillary system) and approximately 2.300
genotypes
per day (96-capillary system) can be analysed with SNaPmeth. As to PyroMeth.
i.e.,
one preferred embodiment of the invention, the available PTPTm system from
Pyrosequencing allows for 25,000 genotypes per day. Thus, with this system a
customized panel of 250 CpGs may be analysed in 100 samples within 24 hours.
The scope of the claims should not be limited by the preferred embodiments set
forth
in the examples, but should be given the broadest interpretation consistent
with the
description as a whole.
CA 02424575 2003-04-14
28
References
1. Robertson, K.D., Wolffe, A.P. (2002) DNA methylation in health and disease.
Nat. Rev. Genet, 1, 11-19.
2. Ehrlich, M. (2002) DNA methylation in cancer: too much, but also too
little.
Oncogene, 21, 5400-5413.
3. Costello, J.F., Fruhwald, M.C., Smiraglia, D.J., Rush, L.J., Robertson,
G.P.,
Gao, X., Wright, F.A., Feramisco, J.D., Peltomaki, P., Lang, J.C., Schuller,
D.E.,
Yu, L., Bloomfield, C.D., Caligiuri, M.A., Yates, A., Nishikawa, R., Su, H.H.
Petrolli, N.J., Zhang, X_, O'Dorisio, M.S., Held, W.A., Cavenee, W.K., Plass,
C_
(2000) Aberrant CpG-island methylation has non-random and tumour-type-
specific patterns. Nat. Genet,, 24, 132-138.
4. Toyota, M., Ahuja, N., Ohe-Toyota, M., Herman, J.G., Baylin, S.B., Issa,
J.P.
(1999) CpG island methylator phenotype in colorectal cancer. Proc. Natl. Acad.
Sci. USA, 96, 8681-8686.
5. Eads, C.A., Lord, R.V., Wickramasinghe, K., Long, T.I., Kurumboor, S.K.,
Bernstein, L., Peters, J.H., DeMeester, S.R., DeMeester, T.R., Skinner, K.A.,
Laird, P.W. (2001) Epigenetic patterns in the progression of esophageal
adenocarcinoma. Cancer Res_, 61, 3410-3418.
6. Usadel, H., Brabender J, Danenberg KD, Jeronimo C, Harden 5, Engles J,
Danenberg PV, Yang S, Sidransky D. (2002) Quantitative Adenomatous
Polyposis Coll Promoter Methylation Analysis in Tumor Tissue, Serum, and
Plasma DNA of Patients with Lung Cancer_ Cancer Res., 62, 371-376.
7. Frommer, M., Mcdonald, L.E., Millar, D.S., Collis, C.M., Watt, F., Grigg,
G.W.,
Molloy, P.L. and Paul, C.L. (1992) A genomic sequencing protocol that yields a
positive display of 5-rnethylcytosine residues in individual DNA strands.
Proc.
Natl. Acad. Sci. USA, 89, 1827-1831.
8. Gonzalgo, M.L. and Jones, P.A. (1997) Rapid quantitation of methylation
differences at specific sites using methylation-sensitive single nucleotide
primer
extension (Ms-SNuPE). Nucleic Acids Res., 25, 2529-2531.
CA 02424575 2003-04-14
29
9. Adorjan, P., Distler, J., Lipscher, E., Model, F., Mailer, J., Pelet, C.,
Braun, A.,
Florl, A.R., GUtig, D., Grabs, G., Howe, A., Kursar, M., Lesche, R., Leu, E.,
Lewin, A., Maier, S., !Willer, V., Otto, T., Scholz, C., Schulz. WA, Seifert,
H.,
Schwope, I., Ziebarth, H., Berlin, K., Piepenbrock, C. and Olek, A. (2002)
Tumour class prediction and discovery by microarray-based DNA methylation
analysis. Nucleic Acids Res., 30, e21.
10. Eads, C.A., Danenberg, K.D., Kawakami, K., Saltz, L.B., Blake, C.,
Shibata, D.,
Danenberg, P.V., Laird, P.W. (2000) MethyLight: a high-throughput assay to
measure DNA methylation. Nucleic Acids Res., 28, e32.
11_ Uhlmann, K., Marczinek, K., Hampe, J., Thiel, G., Nurnberg, P. (1999)
Changes
in methylation patterns identified by two-dimensional DNA fingerprinting_
Electrophoresis, 20, 1748-1755.
12. Uhlmann, K_, Rohde, K., Zeller, C., Szymas, J., Vogel, S., Marczinek, K.,
Thiel,
G., Nurnberg, P_, Laird, P.W. (submitted) Distinct Methylation Profiles of
Glioma
Subtypes. mt. J. Cancer
13_ Kleihues, P., Burger, P.C., Scheithauer, B.W. (1993) The new WHO
classification of brain tumours. Brain Pathol., 3, 255-268.
14.Marczinek, K., Hampe, J., Uhlmann, K., Thiel, G., Barth, I., Mrowka, R.,
Vogel,
S., Nurnberg, P. (1998) Genomic difference analysis by two-dimensional DNA
fingerprinting reveals typical changes in human low-grade gliomas. Gila, 1998,
23, 130-138.
15.0Iek, A., Oswald, J., Walter, J. (1996) A modified and improved method for
bisulphite based cytosine methylation analysis. Nucleic Acids Res., 24, 5064-
5066.
16.M6tyas, G., Giunta, C., Steinmann, B., Hossle, J.P. and Hellwig, R. (2002)
Quantification of Single Nucleotide Polymorphisms: A Novel Method That
Combines Primer Extension Assay and Capillary Electrophoresis. Hum. Mut 19,
58-68.
CA 02424575 2003-04-14
17.Makridakis, J.M. and Reichardt, J.K.V. (2001) Multiplex Automated Primer
Extension Analysis: Simultaneous Genotyping of Several Polymorphisms.
Biorechniques, 31, 1374-1380.
CA 02424575 2004-07-07
31
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: UHLMANN, Karen
NURNBERG, Peter
BRINCKMANN, Anja
(ii) TITLE OF INVENTION: METHOD OF DETECTING EPIGENETIC
BIOMARKERS BY QUANTITATIVE METHYLSNP ANALYSIS
(iii) NUMBER OF SEQUENCES: 4
(iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: GOUDREAU GAGE DUBUC
(B) STREET: 800 Place-Victoria, P.O.Box 242, #3400, Stock
Exhange Tower
(C) CITY: Montreal
(D) STATE: Quebec
(E) COUNTRY: CANADA
(F) ZIP: H4Z 1E9
(v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk
(B) COMPUTER: IBM PC compatible
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.30
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: CA 2,424,575
(B) FILING DATE: 14-APR-2003
(C) CLASSIFICATION:
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: LECLERC, Alain M.
(C) REFERENCE/DOCKET NUMBER: AML/13716.2
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 514-397-7675
(B) TELEFAX: 514-397-4382
(2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 28 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: other nucleic acid
(A) DESCRIPTION: /desc = "DNA"
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Artificial
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
TGAGTTGGAA TAAGTTAGGG TAGATGTG 28
CA 02424575 2004-07-07
32
(2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 32 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: other nucleic acid
(A) DESCRIPTION: /desc = "DNA"
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Artificial
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
CAACTCTCTA TATCCCTTTC TAACATAAAT CA 32
(2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: other nucleic acid
(A) DESCRIPTION: /desc = "DNA"
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Artificial
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
TTAGGGGGGT GAATATTGGG 20
(2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 15 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: other nucleic acid
(A) DESCRIPTION: /desc = "DNA"
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Artificial
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
GGGGTGAATA TTGGG 15
