Note: Descriptions are shown in the official language in which they were submitted.
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
CANCER-LINKED GENES AS TARGETS FOR
CHEMOTHERAPY
This application claims the benefit of U.S. provisional application Serial
No. 60/239,294, filed 11 October 2000; 60/239,297, filed 11 October 2000;
60/239,605, filed 11 October 2000; 60/239,802, filed 12 October 2000;
60/239,805, filed 12 October 2000; 60/239,806, filed 12 October 2000;
60/240,622, filed 16 October 2000; 60/241,682, filed 19 October 2000;
60/241,723, filed 19 October 2000; and 60/244,932, filed 31 October 2000,
the disclosures of which are hereby incorporated by reference in their
entirety.
FIELD OF THE INVENTION
The present invention relates to methods of screening cancer-linked
genes and expression products for involvement in the cancer initiation and
facilitation process and the use of such genes for screening potential anti-
cancer agents, including small organic compounds and other molecules.
BACKGROUND OF THE INVENTION
Cancer-linked genes are valuable in that they indicate genetic
differences between cancer cells and normal cells, such as where a gene is
expressed in a cancer cell but not in a non-cancer cell, or where said gene is
over-expressed or expressed at a higher level in a cancer as opposed to
normal or non-cancer cell. In addition, the expression of such a gene in a
normal cell but not in a cancer cell, especially of the same type of tissue,
can
indicate important functions in the cancerous process. For example, screening
assays for novel drugs are based on the response of model cell based
systems in vitro to treatment with specific compounds. Various measures of
1
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
cellular response have been utilized, including the release of cytokines,
alterations in cell surface markers, activation of specific enzymes, as well
as
alterations in ion flux and/or pH. Some such screens rely on specific genes,
such as oncogenes (or gene mutations). In accordance with the present
invention, a cancer-linked gene has been identified and its putative amino
acid sequence worked out. Such gene is useful in the diagnosing of cancer,
the screening of anticancer agents and the treatment of cancer using such
agents, especially in that these genes encode polypeptides that can act as
markers, such as cell surface markers, thereby providing ready targets for
anti-tumor agents such as antibodies, preferably antibodies complexed to
cytotoxic agents, including apoptotic agents. .
BRIEF SUMMARY OF THE INVENTION
In accordance with the present invention, there is provided herein a set
of genes related to, or linked to, cancer, or otherwise involved in the cancer
initiating and facilitating process and the derived amino acid sequences
thereof.
In a particular embodiment, such genes are those corresponding to the
sequences of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19 and which
encode polypeptides, including those comprising a sequence of SEQ ID NO:
2, 4, 6, 8, 10, 12, 14, 16, 18 and 20.
More particularly, such genes whose expression is changed in
cancerous, as compared to non-cancerous cells, from a specific tissue, for
example, lung, where the gene would include a polynucleotide corresponding
to the nucleotide sequence of SEQ ID NO: 1 or sequences that are
substantially identical to said sequence and/or encode the polypeptide with
amino acid sequence of SEQ ID NO: 2 or a polypeptide differing therefrom by
conservative amino acid substitutions..
2
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
It is another object of the present invention to provide methods of using
such characteristic genes as a basis for assaying the potential ability of
selected chemical agents to modulate upward or downward the expression of
said cancer characteristic, or related, genes.
It is a further object of the present invention to provide methods of
detecting the expression, or non-expression, or amount of expression, of said
characteristic gene, or portions thereof, as a means of determining the
cancerous, or non-cancerous, status (or potential cancerous status) of
selected cells as grown in culture or as maintained in situ.
It is a still further object of the present invention to provide methods for
treating cancerous conditions utilizing selected chemical agents as
determined from their ability to modulate (i.e., increase or decrease) the
characteristic gene, or its protein product.
The present invention also relates to a process for treating cancer
comprising contacting a cancerous cell with an agent having activity against
an expression product encoded by the genes, which process may be
conducted either ex vivo or in vivo and which product is disclosed herein.
Such agents may comprise an antibody or other molecule or portion that is
specific for said expression product. In a preferred embodiment, the
polypeptide product of such genes is a polypeptide as disclosed herein, such
as SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20.
DETAILED SUMMARY OF THE INVENTION
The present invention relates to processes for utilizing a
nucleotide sequence for a cancer-linked gene (SEQ ID NO: 1, 3, 5, 7, 9, 11,
13, 15, 17 and 19) and the derived amino acid sequence (SEQ ID NO: 2, 4, 6,
8, 10, 12, 14, 16, 18 and 20) as targets for chemotherapeutic agents,
especially anti-cancer agents.
3
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
Characteristic gene sequences whose expression, or non-expression,
or change in expression, are indicative of the cancerous or non-cancerous
status of a given cell and whose expression is changed in cancerous, as
compared to non-cancerous cells, from a specific tissue, are genes that
include the nucleotide sequences disclosed herein or sequences that are
substantially identical to said sequence, at least about 90% identical,
preferably 95% identical, most preferably at least about 98% identical and
especially where such gene has the sequence of SEQ ID NO: 1, 3, 5, 7, 9, 11,
13, 15, 17 and 19. Such sequences have been searched within the GenBank
database, with the following results.
The present invention relates to nucleotide sequences and derived
polypeptides having the following characteristics:
A nucleotide sequence with Genbank Accession Numbers:
NM 014109 and AA235448, representing an amplified bromodomain-
containing protein in cancer that was identified with the following specific
characteristics: UniGene Cluster: Hs. 46677; Locus Link ID: none;
Sequence Information: 1934 by mRNA (cDNA is SEQ ID NO: 1) 1086 by
ORF and 362 amino acids (SEQ ID NO: 2) with Chromosomal Location:
8q24 (based on alignment to mapped human genomic sequence). The
deposited information represented a prediction of coding sequence deduced
from a cDNA clone of unknown function. In accordance with the present
invention, this message was up-regulated by at least 3-fold in lung cancer
versus normal lung tissue. A search against the Prosite database reveals a
domain with 100% similarity to the bromodomain 2 sequence, which is
contained in a number of transcription factors. A key role for bromodomain
proteins in maintaining normal proliferation is indicated by the implication
of
several bromodomain proteins in cancer, with four of these identified at
translocation breakpoints.
A novel gene identified based upon EST sequences present within
dbEST. This novel gene represents a novel member of the family of Toll-like
4
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
receptors and a portion of the polypeptide derived therefrom has at least 39%
sequence identity to human toll-like receptor 1. Five of the human Toll-like
receptors (called TLRs 1-5) may be direct homologs of the corresponding fly
molecule and may constitute an important component of innate immunity in
humans. Expression analysis shows that this gene is specifically expressed
by B-lymphocytes. Characteristics were: Genbank Accession Number for
sample EST in cluster: AA648836; UniGene Cluster: Hs.89206; Locus
Link ID: 10330; Cluster Name: ESTs, Weakly similar to TLR6 [H.sapiens];
Sequence Information: 1274 by mRNA (cDNA is SEQ ID NO: 3 with
encoded polypeptide SEQ ID NO: 4. The UniGene cluster is composed of 10
sequences, all derived from tonsil. Microarray expression analysis indicates
specific expression in B-lymphocytes.
A nucleotide sequence with Genbank Accession Number: AB015631
with the following specific characteristics: Genbank Accession Number:
AB015631; UniGene Cluster: Hs.8752; Locus Link ID: 10330; Cluster
Name: Transmembrane protein 4; Sequence Information: 814 by mRNA
(cDNA is SEQ ID NO: 5 with encoded polypeptide as SEQ ID NO: 6) and
Chromosomal Location: 12. The UniGene cluster is composed of over 22
sequences derived from a number of tissues. Strongest levels of expression
in normal tissues were detected in skeletal muscle.
A nucleotide sequence with Genbank Accession Number: NM 014397,
AB026289 and with the following specific characteristics: UniGene Cluster:
Hs.9625; Locus Link ID: 27073; Public Cluster Name: SIDE-1512, putative
serine-threonine protein kinase; Sequence Information: 1597 by mRNA
(SEQ ID NO: 7), 921 by ORF and 307 amino acids (and SEQ ID NO: 8) with
Chromosomal Location: 9q33. From the record in Genbank the complete
mRNA and protein sequences are obtained. SIDE-1512 shares sequence
similarity with murine NEK1, a kinase involved in cell cycle regulation. The
UniGene cluster contains over 150 EST sequences from a variety of tissue
sources. The top BLAST score was to protein kinase nek1, which contains an
N-terminal protein kinase domain with about 42% identity to the catalytic
domain of NIMA, a protein kinase that controls initiation of mitosis in
5
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
Aspergillus nidulans. In addition, both Nek1 and NIMA have a long, basic C-
terminal extension and are therefore similar in overall structure.
A nucleotide sequence with Genbank Accession Number: NM 006035,
6 AF128625 and with the following specific characteristics: UniGene Cluster:
Hs.12908; Locus Link ID: 9578; Cluster Name: CDC42-binding protein
kinase beta (DMPK-like; MRCKbeta); Sequence information: 6780 by
mRNA (SEQ ID NO: 9), 5136 by ORF and 1711 amino acids (SEQ ID NO: 10)
with Chromosomal Location: 14q32.3. The UniGene cluster contained over
215 EST sequences from a variety of tissue sources. The p21 GTPases, Rho
and Cd~2, regulate numerous cellular functions by binding to members of a
serine/threonine protein kinase subfamily. These functions include the
remodeling of the cell cytoskeleton that is a feature of cell growth and
differentiation. Two of these p21 GTPase-regulated kinases, the myotonic
dystrophy protein kinase-related Cdc42-binding kinases (MRCKalpha and
beta), have been demonstrated to phosphorylate nonmuscle myosin light
chain, a prerequisite for the activation of actin-myosin contractility. A
BLAST
search showed A portion of SEQ ID NO: 10 to have about 49% identity to
human myotonic dystrophy kinase.
A nucleotide sequence with Genbank Accession Number: NM 002654
with the following specific characteristics: UniGene Cluster: Hs.198281;
Locus Link ID: 5315; Cluster Name: Pyruvate kinase, muscle; Sequence
Information:2287 by mRNA (SEQ 1D NO: 11 with derived amino acid
sequence SEQ ID NO: 12)) with Chromosomal Location: 15q22. This gene
in a member of a small sub-family within the cdk family of protein kinases.
PCTIARE-3 appears to play a role in signal transduction in terminally
differentiated cells. The cloning of the human and murine PCTAIRE-3 genes
have been described but no other information is available in the scientific
literature. The UniGene cluster is composed of 64 sequences derived from a
number of tissues. PCTAIRE-3 was expressed in colon adenocarcinomas
tested and was expressed at a lower level or not at all in normal colon tissue
samples tested.
6
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
A nucleotide sequence with Genbank Accession Number: NM 006293
with the following specific characteristics: UniGene Cluster: Hs.301; Locus
Link ID: 7301; Cluster Name: TYR03 protein tyrosine kinase; Sequence
lnformation:4364 by mRNA (SEQ ID NO: 13 with derived amino acid
sequence SEQ ID NO: 14) with Chromosomal Location: 15q15.1-q21.1.
The UniGene cluster is composed of over 45 sequences derived from a
number of tissues. Strongest levels of expression in normal tissues detected
in brain. SEQ ID NO: 14 displays appreciable homology to a variety of
receptor tyrosine kinases. For example, a portion of SEQ ID NO: 14 has at
least about 43% identity to AXL receptor tyrosine kinase. Over-expression of
axl cDNA in NIH 3T3 cells induces neoplastic transformation with the
concomitant appearance of a 140 kD axl tyrosine-phosphorylated protein.
A nucleotide sequence with Genbank Accession Number: NM 002969
with the following specific characteristics: UniGene Cluster: Hs.55039;
Locus Link ID: 6300; Cluster Name: Mitogen-activated protein kinase 12;
Sequence Information: 1457 by mRNA (SEQ ID NO: 15 with derived amino
acid sequence of SEQ ID NO: 16) with Chromosomal Location: 22q13.33.
The UniGene cluster is composed of over 22 sequences derived from a
number of tissues. The strongest levels of expression in normal tissues were
detected in skeletal muscle. This sequence displays appreciable homology to
a variety of mitogen-activated protein kinases, for example, with human
mitogen-activated protein kinase p38delta. The p38 mitogen-activated protein
kinases (MAPK) play a crucial role in stress and inflammatory responses and
are also involved in activation of the human immunodeficiency virus gene
expression.
A nucleotide sequence with Genbank Accession Number: W31344 with
the following specific characteristics: UniGene Cluster: Hs.55444; Locus
Link ID: unknown; Cluster Name: ESTs; Chromosomal Location: unknown.
The UniGene cluster is composed of over 9 sequences, all of which are
derived from parathyroid. The GenBank database shows an exact match to
AF153819 (Homo sapiens inwardly-rectifying potassium channel Kir2.1). This
match is entirely confined to the 3' untranslated region of the GenBank entry.
7
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
The translation product of thyrocarcin and the Kir2.1 gene are identical;
however, we cannot formally rule out the possibility that thyrocarcin is a
completely different gene that shares some splicing with Kir2.l. SEQ ID NO:
17 shows the nucleotide sequence for Kir2.1 and SEQ ID NO: 21 shows EST
cluster identified from expression analysis that is specific for thyroid
adenocarcinoma. The derived amino acid sequence from SEQ ID NO: 17 is
shown as SEQ ID NO: 18. The sequence of the EST cluster displays no
obvious homology to known proteins. However,, for the case where the EST
cluster is simply the 3'-untranslated region of Kir2.1, this gene is an
inwardly-
rectifying potassium channel.
A nucleotide sequence with Genbank Accession Number: AA133334,
representing a Sox2-like HMG-box Oncogenically Expressed Sequence with
the following specific characteristics: UniGene Cluster: Hs.129911; Locus
Link ID: none; Sequence Information: 1050 by mRNA (bp = base pair, SEQ
ID NO: 19), 264 by ORF and 88 amino acids (SEQ ID NO: 20) with
Chromosomal Location: unknown. SEQ ID NO: 19 is present as an EST
(Expressed Sequence Tag) in the Gene Logic database. It has been
elongated to 1050 by by overlapping contigs in the public databases. The
unigene cluster indicates widespread expression and it was found that the
message is upregulated by at least 3-fold in lung cancer versus normal lung
tissue. This sequence significant homolgy with Ovis aries SOX-2 gene, and to
a slightly lesser extent the murine SOX-2. The Sox gene family consists of a
large number of embryonically expressed genes related via the possession of
a 79-amino-acid DNA-binding domain known as the HMG box. These genes
are transcription factors likely to be involved in the regulation of gene
expression.
The nucleotides and polypeptides, as gene products, used in the
processes of the present invention may comprise a recombinant polynucleotide
or polypeptide, a natural polynucleotide or polypeptide, or a synthetic
polynucleotide or polypeptide, preferably a recombinant polynucleotide or
. polypeptide.
8
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
Fragments of such polynucleotides and polypeptides as are disclosed
herein may also be useful in practicing the processes of the present
invention.
For example, a fragment, derivative or analog of the polypeptide (SEQ ID NO:
2, 4, 6, 8, 10, 12, 14, 16, 18 and 20) may be (i) one in which one or more of
the
amino acid residues are substituted with a conserved or non-conserved amino
acid residue (preferably a conserved amino acid residue) and such substituted
amino acid residue may or may not be one encoded by the genetic code, or (ii)
one in which one or more of the amino acid residues includes a substituent
group, or (iii) one in which the mature polypeptide is fused with another
compound, such as a compound to increase the half life of the polypeptide (for
example, polyethylene glycol), or (iv) one in which the additional amino acids
are
fused to the mature polypeptide, such as a leader or secretory sequence or a
sequence which is employed for purification of the mature polypeptide or a
proprotein sequence. Such fragments, derivatives and analogs are deemed to
be within the scope of those skilled in the art from the teachings herein.
In one aspect, the present invention relates to an isolated polynucleotide
comprising a polynucleotide at least 65% identical to the polynucleotide of
SEQ
ID NO: 3, or its complement. In preferred embodiments, said isolated
polynucleotide comprises a polynucleotide that has sequence identity of at
least
80%, preferably at least about 90%, most preferably at least about 95%,
especially at least about 98% and most especially is identical to the sequence
of
SEQ ID NO: 3. An isolated polynucleotide of the invention may also include the
complement of any of the foregoing.
In another aspect, the present invention relates to an isolated
polypeptide, including a purified polypeptide, comprising an amino acid
sequence at least 90% identical to the amino acid sequence of SEQ ID NO: 4.
In preferred embodiments, said isolated polypeptide comprises an amino acid
sequence having sequence identity of at least 95%, preferably at least about
98%, and especially is identical to, the sequence of SEQ ID NO: 4. The present
invention also includes isolated active fragments of such polypeptides where
said fragments retain the biological activity of the polypeptide or where such
9
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
active fragments are useful as specific targets for cancer treatment,
prevention
or diagnosis.
The polynucleotides and polypeptides useful in practicing the processes
of the present invention may likewise be obtained in an isolated or purified
form.
In addition, the polypeptide disclosed herein as being useful in practicing
the
processes of the invention include different types of proteins in terms of
function
so that, as recited elsewhere herein, some are enzymes, some are transcription
factors and other may be cell surface receptors. Precisely how such cancer-
linked proteins are used in the processes of the invention may thus differ
depending on the function and cellular location of the protein and therefore
modification, or optimization, of the methods disclosed herein may be
desirable
in light of said differences. For example, a cell-surface receptor is an
excellent
target for cytotoxic antibodies whereas a transcription factor or enzyme is a
useful target for a small organic compound with anti-neoplastic activity.
As used herein, the term "isolated" means that the material is removed
from its original environment (e.g., the natural environment if it is
naturally
occurring). It could also be produced recombinantly and subsequently purified.
For example, a naturally-occurring polynucleotide or polypeptide present in a
living animal is not isolated, but the same polynucleotide or polypeptide,
separated from some or all of the coexisting materials in the natural system,
is
isolated. Such polynucleotides, for example, those prepared recombinantly,
could be part of a vector and/or such polynucleotides or polypeptides could be
part of a composition, and still be isolated in that such vector or
composition is
not part of its natural environment. In one embodiment of the present
invention,
such isolated, or purified, polypeptide is useful in generating antibodies for
practicing the invention, or where said antibody is attached to a cytotoxic or
cytolytic agent, such as an apoptotic agent.
As known in the art "similarity" between two polypeptides is determined
by comparing the amino acid sequence and its conserved amino acid
substitutes of one polypeptide to the sequence of a second polypeptide.
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
The sequence information disclosed herein, as derived from the
GenBank submissions, can readily be utilized by those skilled in the art to
prepare the corresponding full-length polypeptide by peptide synthesis. The
same is true for either the polynucleotides or polypeptides disclosed herein
for
use in the methods of the invention.
As used herein, the terms "portion," "segment," and "fragment," when
used in relation to polypeptides, refer to a continuous sequence of residues,
such as amino acid residues, which sequence forms a subset of a larger
sequence. For example, if a polypeptide were subjected to treatment with any
of
the common endopeptidases, such as trypsin or chymotrypsin, the oligopeptides
resulting from such treatment would represent portions, segments or fragments
of the starting polypeptide. When used in relation to a polynucleotides, such
terms refer to the products produced by treatment of said polynucleotides with
any of the common endonucleases.
The present invention further relates to a vector comprising any of the
polynucleotides disclosed herein and to a recombinant cell comprising such
vectors, or such polynucleotides or expressing the polypeptides disclosed
herein, especially the polypeptide whose amino acid sequence is the
sequence of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20.
Methods of producing such cells and vectors are well known to those
skilled in the molecular biology art. See, for example, Sambrook, et al.,
Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor,
N.Y., (1989), Wu et al, Methods in Gene Biotechnology (CRC Press, New
York, NY, 1997), and Recombinant Gene Expression Protocols, in Methods in
Molecular Biology, Vol. 62, (Tuan, ed., Humana Press, Totowa, NJ, 1997), the
disclosures of which are hereby incorporated by reference.
In another aspect, the present invention relates to a process for
identifying an agent that modulates the activity of a cancer-related gene
comprising:
11
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
(a) contacting a compound with a cell containing a gene that
corresponds to a polynucleotide having a sequence selected from the group
consisting of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19 and under
conditions promoting the expression of said gene; and
(b) detecting a difference in expression of said gene relative to when
said compound is not present
thereby identifying an agent that modulates the activity of a cancer-
related gene.
In specific embodiments of the present invention, the genes useful for
the invention comprise genes that correspond to polynucleotides having a
sequence selected from SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19, or
may comprise the sequence of any of the polynucleotides disclosed herein
(where the latter are cDNA sequences). As used herein, "corresponding
genes" refers to genes that encode an RNA that is at least 90% identical,
preferably at least 95% identical, most preferably at least 98% identical, and
especially identical, to an RNA encoded by one of the nucleotide sequences
disclosed herein (i.e., SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19). Such
genes will also encode the same polypeptide sequence as any of the
sequences disclosed herein, preferably SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16,
18 and 20, but may include differences in such amino acid sequences where
such differences are limited to conservative amino acid substitutions, such as
where the same overall three dimensional structure, and thus the same
antigenic character, is maintained. Thus, amino acid sequences may be within
the scope of the present invention where they react with the same antibodies
that react with polypeptides comprising the sequences of SEQ ID NO: 2, 4, 6,
8, 10, 12, 14, 16, 18 and 20 as disclosed herein.
As used herein, the term "conservative amino acid substitution" are
defined herein as exchanges within one of the following five groups:
I. Small aliphatic, nonpolar or slightly polar residues:
Ala, Ser, Thr, Pro, Gly;
II. Polar, negatively charged residues and their amides:
12
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
Asp, Asn, Glu, Gln;
III. Polar, positively charged residues:
His, Arg, Lys;
IV. Large, aliphatic, nonpolar residues:
Met Leu, Ile, Val, Cys
V. Large, aromatic residues:
Phe, Tyr, Trp
In accordance with the present invention, model cellular systems using
cell lines, primary cells, or tissue samples are maintained in growth medium
and may be treated with compounds that may be at a single concentration or
at a range of concentrations. At specific times after treatment, cellular RNAs
are isolated from the treated cells, primary cells or tumors, which RNAs are
indicative of expression of selected genes. The cellular RNA is then divided
and subjected to analysis that detects the presence and/or quantity of
specific
RNA transcripts, which transcripts may then be amplified for detection
purposes using standard methodologies, such as, for example, reverse
transcriptase polymerase chain reaction (RT-PCR), etc. The presence or
absence, or levels, of specific RNA transcripts are determined from these
measurements and a metric derived for the type and degree of response of
the sample to the treated compound compared to control samples.
In accordance with the foregoing, there is thus disclosed herein
processes for using a cancer-linked gene sequence (SEQ ID NO: 1, 3, 5, 7, 9,
11, 13, 15, 17 and 19) whose expression is, or can be, as a result of the
methods of the present invention, linked to, or used to characterize, the
cancerous, or non-cancerous, status of the cells, or tissues, to be tested.
Thus, the processes of the present invention identify novel anti-neoplastic
agents based on their alteration of expression of the polynucleotide sequence
disclosed herein in specific model systems. The methods of the invention may
therefore be used with a variety of cell lines or with primary samples from
tumors maintained in vitro under suitable culture conditions for varying
periods
of time, or in situ in suitable animal models.
13
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
More particularly, genes have been identified that is expressed at a
level in cancer cells that is difFerent from the expression level in non-
cancer
cells. In one instance, the identified genes are expressed at higher levels in
cancer cells than in normal cells.
The polynucleotides of the invention can include fully operation genes
with attendant control or regulatory sequences or merely a polynucleotide
sequence encoding the corresponding polypeptide or an active fragment or
analog thereof.
In one embodiment of the present invention, said gene modulation is
downward modulation, so that, as a result of exposure to the chemical agent
to be tested, one or more genes of the cancerous cell will be expressed at a
lower level (or not expressed at all) when exposed to the agent as compared
to the expression when not exposed to the agent. For example, the gene
encoding the polypeptide of SEQ ID NO: 2 is expressed at a higher level in
cells of lung cancer than in normal lung cells.
In a preferred embodiment a selected set of said genes are expressed
in the reference cell, including the genes) sequences identified for use
according to the present invention, but are not expressed in the cell to be
tested as a result of the exposure of the cell to be tested to the chemical
agent. Thus, where said chemical agent causes the gene, or genes, of the
tested cell to be expressed at a lower level than the same genes of the
reference, this is indicative of downward modulation and indicates that the
chemical agent to be tested has anti-neoplastic activity.
Sequences encoding the same proteins as any of SEQ ID NO: 2, 4, 6,
8, 10, 12, 14, 16, 18 and 20, regardless of the percent identity of such
sequences, are also specifically contemplated by any of the methods of the
present invention that rely on any or all of said sequences, regardless of how
they are otherwise described or limited. Thus, any such sequences are
available for use in carrying out any of the methods disclosed according to
the
14
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
invention. Such sequences also include any open reading frames, as defined
herein, present within the sequence of SEQ ID NO: 1.
The genes identified by the present disclosure are considered "cancer-
s related" genes, as this term is used herein, and include genes expressed at
higher levels (due, for example, to elevated rates of expression, elevated
extent of expression or increased copy number) in cancer cells relative to
expression of these genes in normal (i.e., non-cancerous) cells where said
cancerous state or status of test cells or tissues has been determined by
methods known in the art, such as by reverse transcriptase polymerase chain
reaction (RT-PCR) as described in the Example below. In specific
embodiments, this relates to the genes whose sequences correspond to the
sequences of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19. As used herein,
the term "correspond" means that the gene has the indicated nucleotide
sequence or that it encodes substantially the same RNA as would be encoded
by the indicated sequence, the term "substantially" meaning about at least
90% identical as defined elsewhere herein and includes splice variants
thereof.
The sequences disclosed herein may be genomic in nature and thus
represent the sequence of an actual gene, such as a human gene, or may be
a cDNA sequence derived from a messenger RNA (mRNA) and thus
represent contiguous exonic sequences derived from a corresponding
genomic sequence or they may be wholly synthetic in origin for purposes of
practicing the processes of the invention. Because of the processing that may
take place in transforming the initial RNA transcript into the final mRNA, the
sequences disclosed herein may represent less than the full genomic
sequence. They may also represent sequences derived from ribosomal and
transfer RNAs. Consequently, the genes present in the cell (and representing
the genomic sequences) and the sequences disclosed herein, which are
mostly cDNA sequences, may be identical or may be such that the cDNAs
contain less than the full genomic sequence. Such genes and cDNA
sequences are still considered corresponding sequences because they both
encode similar RNA sequences. Thus, by way of non-limiting example only, a
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
gene that encodes an RNA transcript, which is then processed into a shorter
mRNA, is deemed to encode both such RNAs and therefore encodes an RNA
complementary to (using the usual Watson-Crick complementarity rules), or
that would otherwise be encoded by, a cDNA (for example, a sequence as
disclosed herein). Thus, the sequences disclosed herein correspond to genes
contained in the cancerous or normal cells used to determine relative levels
of
expression because they represent the same sequences or are
complementary to RNAs encoded by these genes. Such genes also include
different alleles and splice variants that may occur in the cells used in the
processes of the invention.
The genes of the invention "correspond to" a polynucleotide having a
sequence of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19 if the gene
encodes an RNA (processed or unprocessed, including naturally occurring
splice variants and alleles) that is at least 90% identical, preferably at
least
95% identical, most preferably at least 98% identical to, and especially
identical to, an RNA that would be encoded by, or be complementary to, such
as by hybridization with, a polynucleotide having the indicated sequence. In
addition, genes including sequences at least 90% identical to a sequence
selected from SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19, preferably at
least about 95% identical to such a sequence, more preferably at least about
98% identical to such sequence and most preferably comprising such
sequence are specifically contemplated by all of the processes of the present
invention as being genes that correspond to these sequences. In addition,
sequences encoding the same proteins as any of these sequences,
regardless of the percent identity of such sequences, are also specifically
contemplated by any of the methods of the present invention that rely on any
or all of said sequences, regardless of how they are otherwise described or
limited. Thus, any such sequences are available for use in carrying out any of
the methods disclosed according to the invention. Such sequences also
include any open reading frames, as defined herein, present within any of the
sequences of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19.
16
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
Further in accordance with the present invention, the term "percent
identity" or "percent identical," when referring to a sequence, means that a
sequence is compared to a claimed or described sequence after alignment of
the sequence to be compared (the "Compared Sequence") with the described or
claimed sequence (the "Reference Sequence"). The Percent Identity is then
determined according to the following formula:
Percent Identity = 100 [1-(C/R)]
wherein C is the number of differences between the Reference Sequence and
the Compared Sequence over the length of alignment between the Reference
Sequence and the Compared Sequence wherein (i) each base or amino acid in
the Reference Sequence that does not have a corresponding aligned base or
amino acid in the Compared Sequence and (ii) each gap in the Reference
Sequence and (iii) each aligned base or amino acid in the Reference Sequence
that is difFerent from an aligned base or amino acid in the Compared Sequence,
constitutes a difference; and R is the number of bases or amino acids in the
Reference Sequence over the length of the alignment with the Compared
Sequence with any gap created in the Reference Sequence also being counted
as a base or amino acid.
If an alignment exists between the Compared Sequence and the
Reference Sequence for which the percent identity as calculated above is about
equal to or greater than a specified minimum Percent Identity then the
Compared Sequence has the specified minimum percent identity to the
Reference Sequence even though alignments may exist in which the
hereinabove calculated Percent Identity is less than the specified Percent
Identity.
As used herein and except as noted otherwise, all terms are defined as
given below.
In accordance with the present invention, the term "DNA segment" or
"DNA sequence" refers to a DNA polymer, in the form of a separate fragment
17
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
or as a component of a larger DNA construct, which has been derived from
DNA isolated at least once in substantially pure form, i.e., free of
contaminating endogenous materials and in a quantity or concentration
enabling identification, manipulation, and recovery of the segment and its
component nucleotide sequences by standard biochemical methods, for
example, using a cloning vector. Such segments are provided in the form of
an open reading frame uninterrupted by internal nontranslated sequences, or
introns, which are typically present in eukaryotic genes. Sequences of non-
translated DNA may be present downstream from the open reading frame,
where the same do not interfere with manipulation or expression of the coding
regions.
The term "coding region" refers to that portion of a gene which either
naturally or normally codes for the expression product of that gene in its
natural genomic environment, i.e., the region coding in vivo for the native
expression product of the gene. The coding region can be from a normal,
mutated or altered gene, or can even be from a DNA sequence, or gene,
wholly synthesized in the laboratory using methods well known to those of
skill in the art of DNA synthesis.
In accordance with the present invention, the term "nucleotide
sequence" refers to a heteropolymer of deoxyribonucleotides. Generally, DNA
segments encoding the proteins provided by this invention are assembled
from cDNA fragments and short oligonucleotide linkers, or from a series of
oligonucleotides, to provide a synthetic gene which is capable of being
expressed in a recombinant transcriptional unit comprising regulatory
elements derived from a microbial or viral operon.
The term "expression product" means that polypeptide or protein that is
the natural translation product of the gene and any nucleic acid sequence
coding equivalents resulting from genetic code degeneracy and thus coding
for the same amino acid(s).
The term "active fragment," when referring to a coding sequence, means
a portion comprising less than the complete coding region whose expression
18
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
product retains essentially the same biological function or activity as the
expression product of the complete coding region.
The term "primer" means a short nucleic acid sequence that is paired
with one strand of DNA and provides a free 3'-OH end at which a DNA
polymerase starts synthesis of a deoxyribonucleotide chain.
The term "promoter" means a region of DNA involved in binding of RNA
polymerase to initiate transcription. The term "enhancer" refers to a region
of
DNA that, when present and active, has the effect of increasing expression of
a different DNA sequence that is being expressed, thereby increasing the
amount of expression product formed from said different DNA sequence.
The term "open reading frame (ORF)" means a series of triplets coding
for amino acids without any termination codons and is a sequence
(potentially) translatable into protein.
As used herein, reference to a DNA sequence includes both single
stranded and double stranded DNA. Thus, the specific sequence, unless the
context indicates otherwise, refers to the single strand DNA of such
sequence, the duplex of such sequence with its complement (double stranded
DNA) and the complement of such sequence.
The present invention also relates to methods of assaying potential
antitumor agents based on their modulation of the expression of the gene
sequence according to the invention and methods for diagnosing cancerous,
or potentially cancerous, conditions as a result of the patterns of expression
of
the gene sequence disclosed herein as well as related gene sequence based
on common expression or regulation of such genes.
In carrying out the foregoing assays, relative antineoplastic activity may be
ascertained by the extent to which a given chemical agent modulates the
expression of genes present in a cancerous cell. Thus, a first chemical agent
that modulates the expression of a gene associated with the cancerous state
19
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
(i.e., a gene that includes one of the sequences of the invention as disclosed
herein and present in cancerous cells) to a larger degree than a second
chemical agent tested by the assays of the invention is thereby deemed to have
higher, or more desirable, or more advantageous, anti-neoplastic activity than
said second chemical agent.
The gene expression to be measured is commonly assayed using RNA
expression as an indicator. Thus, the greater the level of RNA (messenger RNA)
detected the higher the level of expression of the corresponding gene. Thus,
gene expression, either absolute or relative, is determined by the relative
expression of the RNAs encoded by such genes.
RNA may be isolated from samples in a variety of ways, including lysis
and denaturation with a phenolic solution containing a chaotropic agent (e.g.,
triazol) followed by isopropanol precipitation, ethanol wash, and resuspension
in
aqueous solution; or lysis and denaturation followed by isolation on solid
support, such as a Qiagen resin and reconstitution in aqueous solution; or
lysis
and denaturation in non-phenolic, aqueous solutions followed by enzymatic
conversion of RNA to DNA template copies.
Normally, prior to applying the processes of the invention, steady state
RNA expression levels for the genes, and sets of genes, disclosed herein will
have been obtained. It is the steady state level of such expression that is
affected by potential anti-neoplastic agents as determined herein. Such steady
state levels of expression are easily determined by any methods that are
sensitive, specific and accurate. Such methods include, but are in no way
limited
to, real time quantitative polymerase chain reaction (PCR), for example, using
a
Perkin-Elmer 7700 sequence detection system with gene specific primer probe
combinations as designed using any of several commercially available software
packages, such as Primer Express software., solid support based hybridization
array technology using appropriate internal controls for quantitation,
including
filter, bead, or microchip based arrays, solid support based hybridization
arrays
using, for example, chemiluminescent! fluorescent, or electrochemical reaction
based detection systems.
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
The gene patterns indicative of a cancerous state need not be
characteristic of every cell found to be cancerous. Thus, the methods
disclosed herein are useful for detecting the presence of a cancerous
condition within a tissue where less than all cells exhibit the complete
pattern.
Thus, for example, a set of selected genes, comprising sequences
corresponding to the sequence of SEQ ID NO: 1, may be found, using
appropriate probes, either DNA or RNA, to be present in as little as 60% of
cells derived from a sample of tumorous, or malignant, tissue while being
absent from as much as 60% of cells derived from corresponding non-
cancerous, or otherwise normal, tissue (and thus being present in as much as
40% of such normal tissue cells). In a preferred embodiment, such gene
pattern is found to be present in at least 50% of cells drawn from a cancerous
tissue, such as the lung cancer disclosed herein. In an additional .
embodiment, such gene pattern is found to be present in at least 100% of
cells drawn from a cancerous tissue and absent from at least 100% of a
corresponding normal, non-cancerous, tissue sample, although the latter
embodiment may represent a rare occurrence.
In another aspect the present invention relates to a process for
determining the cancerous status of a test cell, comprising determining
expression in said test cell of a gene sequence as disclosed herein and then
comparing said expression to expression of said at least one gene in at least
one cell known to be non-cancerous whereby a difference in said expression
indicates that said cell is cancerous.
In one embodiment, said change in expression is a change in copy
number, including either an increase or decrease in copy number. In
accordance with the present invention, said change in gene copy number may
be determined by determining a change in expression of messenger RNA
encoded by said gene sequence.
Changes in gene copy number may be determined by determining a
change in expression of messenger RNA encoded by a particular gene
21
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
sequence, especially that of Such change in gene copy number may be
determined by determining a change in expression of messenger RNA
encoded by a particular gene sequence, especially that of SEQ ID NO: 1, 3, 5,
7, 9, 11, 13, 15, 17 and 19. Also in accordance with the present invention,
said gene may be a cancer initiating gene, a'cancer facilitating gene, or a
cancer suppressing gene. In carrying out the methods of the present
invention, a cancer facilitating gene is a gene that, while not directly
initiating
or suppressing tumor formation or growth, said gene acts, such as through
the actions of its expression product, to direct, enhance, or otherwise
facilitate
the progress of the cancerous condition, including where such gene acts
against genes, or gene expression products, that would otherwise have the
effect of decreasing tumor formation and/or growth.
Although the presence or absence of expression of a gene
corresponding to a sequence of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 and
19 may be indicative of a cancerous status for a given cell, the mere presence
or absence of such a gene may not alone be sufficient to achieve a malignant
condition and thus the level of expression of such gene pattern may also be a
significant factor in determining the attainment of a cancerous state. Thus,
while a pattern of genes may be present in both cancerous and non-
cancerous cells, the level of expression, as determined by any of the methods
disclosed herein, all of which are well known in the art, may differ between
the
cancerous versus the non-cancerous cells. Thus, it becomes essential to also
determine the level of expression of a gene such as that disclosed herein,
including substantially similar sequences and sequences comprising said
sequence, as a separate means of diagnosing the presence of a cancerous
status for a given cell, groups of cells, or tissues, either in culture or in
situ.
The level of expression of the polypeptides disclosed herein is also a
measure of gene expression, such as polypeptides having sequence identical,
or similar to any polypeptide encoded by the sequence of SEQ ID NO: 1, 3, 5,
7, 9, 11, 13, 15, 17 and 19, such as the polypeptide whose amino acid
sequence is the sequence of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20.
22
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
In accordance with the foregoing, the present invention further relates
to a process for determining the cancerous status of a cell to be tested,
comprising determining the level of expression in said cell of at least one
gene
that includes one of the nucleotide sequences selected from the sequences of
SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19, including sequences
substantially identical to said sequences, or characteristic fragments
thereof,
or the complements of any of the foregoing and then comparing said
expression to that of a cell known to be non-cancerous whereby the difference
in said expression indicates that said cell to be tested is cancerous.
In accordance with the invention, although gene expression for a gene
that includes as a portion thereof one of the sequences of SEQ ID NO: 1, 3, 5,
7, 9, 11, 13, 15, 17 and 19, is preferably determined by use of a probe that
is
a fragment of such nucleotide sequence, it is to be understood that the probe
may be formed from a different portion of the gene. Expression of the gene
may be determined by use of a nucleotide probe that hybridizes to messenger
RNA (mRNA) transcribed from a portion of the gene other than the specific
nucleotide sequence disclosed herein. ,
It should be noted that there are a variety of different contexts in which
genes have been evaluated as being involved in the cancerous process.
Thus, some genes may be oncogenes and encode proteins that are directly
involved in the cancerous process and thereby promote the occurrence of
cancer in an animal. In addition, other genes may serve to suppress the
cancerous state in a given cell or cell type and thereby work against a
cancerous condition forming in an animal. Other genes may simply be
involved either directly or indirectly in the cancerous process or condition
and
may serve in an ancillary capacity with respect to the cancerous state. All
such types of genes are deemed with those to be determined in accordance
with the invention as disclosed herein. Thus, the gene determined by said
process of the invention may be an oncogene, or the gene determined by said
process may be a cancer facilitating gene, the latter including a gene that
directly or indirectly affects the cancerous process, either in the promotion
of a
cancerous condition or in facilitating the progress of cancerous growth or
23
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
otherwise modulating the growth of cancer cells, either in vivo or ex vivo. In
addition, the gene determined by said process may be a cancer suppressor
gene, which gene works either directly or indirectly to suppress the
initiation or
progress of a cancerous condition. Such genes may work indirectly where
their expression alters the activity of some other gene or gene expression
product that is itself directly involved in initiating or facilitating the
progress of
a cancerous condition. For example, a gene that encodes a polypeptide,
either wild or mutant in type, which polypeptide acts to suppress of tumor
suppressor gene, or its expression product, will thereby act indirectly to
promote tumor growth.
In accordance with the foregoing, the process of the present invention
includes cancer modulating agents that are themselves either polypeptides, or
small chemical entities, that affect the cancerous process, including
initiation,
suppression or facilitation of tumor growth, either in vivo or ex vivo. Said
cancer modulating agent may have the effect of increasing gene expression
or said cancer modulating agent may have the effect of decreasing gene
expression as such terms have been described herein.
In keeping with the disclosure herein, the present invention also relates
to a process for treating cancer comprising contacting a cancerous cell with
an agent having activity against an expression product encoded by a gene
sequence as disclosed herein, such as the sequence of SEQ ID NO: 1, 3, 5,
7, 9, 11, 13, 15, 17 and 19.
The proteins encoded by the genes disclosed herein due to their
expression, or elevated expression, in cancer cells, represent highly useful
therapeutic targets for "targeted therapies" utilizing such affinity
structures as,
for example, antibodies coupled to some cytotoxic agent. In such
methodology, it is advantageous that nothing need be known about the
endogenous ligands or binding partners for such cell surface molecules.
Rather, an antibody or equivalent molecule that can specifically recognize the
cell surface molecule (which could include an artificial peptide, a surrogate
ligand, and the like) that is coupled to some agent that can induce cell death
24
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
or a block in cell cycling offers therapeutic promise against these proteins.
Thus, such approaches include the use of so-called suicide "bullets" against
intracellular proteins
With the advent of methods of molecular biology and recombinant
technology, it is now possible to produce antibody molecules by
recombinant means and thereby generate gene sequences that code for
specific amino acid sequences found in the polypeptide structure of the
antibodies. Such antibodies can be produced by either cloning the gene
sequences encoding the polypeptide chains of said antibodies or by direct
synthesis of said polypeptide chains, with in vitro assembly of the
synthesized chains to form active tetrameric (H~L2) structures with affinity
for specific epitopes and antigenic determinants. This has permitted the
ready production of antibodies having sequences characteristic of
neutralizing antibodies from different species and sources.
Regardless of the source of the antibodies, or how they are
recombinantly constructed, or how they are synthesized, in vitro or in
vivo, using transgenic animals, such as cows, goats and sheep, using
large cell cultures of laboratory or commercial size, in bioreactors or by
direct chemical synthesis employing no living organisms at any stage of
the process, all antibodies have a similar overall 3 dimensional structure.
This structure is often given as HZL2 and refers to the fact that antibodies
commonly comprise 2 light (L) amino acid chains and 2 heavy (H) amino
acid chains. Both chains have regions capable of interacting with a
structurally complementary antigenic target. The regions interacting with
the target are referred to as "variable" or "V" regions and are
characterized by differences in amino acid sequence from antibodies of
different antigenic specificity.
The variable regions of either H or L chains contains the amino acid
sequences capable of specifically binding to antigenic targets. Within
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
these sequences are smaller sequences dubbed "hypervariable" because
of their extreme variability between antibodies of differing specificity.
Such hypervariable regions are also referred to as "complementarity
determining regions" or "CDR" regions. These CDR regions account for
the basic specificity of the antibody for a particular antigenic determinant
structure.
The CDRs represent non-contiguous stretches of amino acids
within the variable regions but, regardless of species, the positional
locations of these critical amino acid sequences within the variable heavy
and light chain regions have been found to have similar locations within
the amino acid sequences of the variable chains. The variable heavy ana
light chains of all antibodies each have 3 CDR regions, each non-
contiguous with the others (termed L1, L2, L3, H 1, H2, H3) for the
respective light (L) and heavy (H) chains. The accepted CDR regions have
been described by ICabat et al, J. Biol. CHem. 252:6609-6616 (1977).
The numbering scheme is shown in the figures, where the CDRs are
underlined and the numbers follow the Kabat scheme.
In all mammalian species, antibody polypeptides contain constant
(i.e., highly conserved) and variable regions, and, within the latter, there
are the CDRs and the so-called "framework regions" made up of amino
acid sequences within the variable region of the heavy or light chain but
outside the CDRs.
The antibodies disclosed according to the invention may also be wholly
synthetic, wherein the polypeptide chains of the antibodies are synthesized
and, possibly, optimized for binding to the polypeptides disclosed herein as
being receptors. Such antibodies may be chimeric or humanized antibodies
and may be fully tetrameric in structure, or may be dimeric and comprise only
a single heavy and a single light chain. Such antibodies may also include
fragments, such as Fab and F(ab2)' fragments, capable of reacting with and
binding to any of the polypeptides disclosed herein as being receptors.
26
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
In one aspect, the present invention relates to immunoglobulins, or
antibodies, as described herein, that react with, especially where they are
specific for, the polypeptides having amino acid sequences as disclosed
herein, preferably those having an amino acid sequence of one of SEQ ID
NO: 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20. Such antibodies may commonly be
in the form of a composition, especially a pharmaceutical composition.
The pharmaceutical compositions useful herein also contain a
pharmaceutically acceptable carrier, including any suitable diluent or
excipient, which includes any pharmaceutical agent that does not itself
induce the production of antibodies harmful to the individual receiving the
composition, and which may be administered without undue toxicity.
Pharmaceutically acceptable carriers include, but are not limited to, liquids
such as water, saline, glycerol and ethanol, and the like, including carriers
useful in forming sprays for nasal and other respiratory tract delivery or
for delivery to the ophthalmic system. A thorough discussion of
pharmaceutically acceptable carriers, diluents, and other excipients is
presented in REMINGTON'S PHARMACEUTICAL SCIENCES (Mack Pub.
Co., N.J. current edition).
The process of the present invention includes embodiments of the
above-recited processes wherein the cancer cell is contacted in vivo as well
as ex vivo, preferably wherein said agent comprises a portion, or is part of
an
overall molecular structure, having affinity for said expression product. In
one
such embodiment, said portion having affinity for said expression product is
an antibody, especially where said expression product is a polypeptide or
oligopeptide or comprises an oligopeptide portion, or comprises a polypeptide.
Such an agent can therefore be a single molecular structure,
comprising both affinity portion and anti-cancer activity portions, wherein
said
portions are derived from separate molecules, or molecular structures,
27
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
possessing such activity when separated and wherein such agent has been
formed by combining said portions into one larger molecular structure, such
as where said portions are combined into the form of an adduct. Said anti-
cancer and affinity portions may be joined covalently, such as in the form of
a
single polypeptide, or polypeptide-like, structure or may be joined non-
covalently, such as by hydrophobic or electrostatic interactions, such
structures having been formed by means well known in the chemical arts.
Alternatively, the anti-cancer and affinity portions may be formed from
separate domains of a single molecule that exhibits, as part of the same
chemical structure, more than one activity wherein one of the activities is
against cancer cells, or tumor formation or growth, and the other activity is
affinity for an expression product produced by expression of genes related to
the cancerous process or condition.
In one embodiment of the present invention, a chemical agent, such as
a protein or other polypeptide, is joined to an agent, such as an antibody,
having affinity for an expression product of a cancerous cell, such as a
polypeptide or protein encoded by a gene related to the cancerous process,
especially a gene as disclosed herein according to the present invention.
Thus, where the presence of said expression product is essential to tumor
initiation and/or growth, binding of said agent to said expression product
will
have the effect of negating said tumor promoting activity. In one such
embodiment, said agent is an apoptosis-inducing agent that induces cell
suicide, thereby killing the cancer cell and halting tumor growth..
Other genes within the cancer cell that are regulated in a manner
similar to that of the genes disclosed herein and thus change their expression
in a coordinated way in response to chemical compounds represent genes
that are located within a common metabolic, signaling, physiological, or
functional pathway so that by analyzing and identifying such commonly
regulated groups of genes (groups that include the gene, or similar
sequences, disclosed according to the invention, one can (a) assign known
genes and novel genes to specific pathways and (b) identify specific functions
and functional roles for novel genes that are grouped into pathways with
28
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
genes for which their functions are already characterized or described. For
example, one might identify a group of 10 genes, at least one of which is the
gene as disclosed herein, that change expression in a coordinated fashion
and for which the function of one, such as the polypeptide encoded by the
sequence disclosed herein, is known then the other genes are thereby
implicated in a similar function or pathway and may thus play a role in the
cancer-initiating or cancer-facilitating process. In the same way, if a gene
were found in normal cells but not in cancer cells, or happens to be expressed
at a higher level in normal as opposed to cancer cells, then a similar
conclusion may be drawn as to its involvement in cancer, or other diseases.
Therefore, the processes disclosed according to the present invention at once
provide a novel means of assigning function to genes, i.e. a novel method of
functional genomics, and a means for identifying chemical compounds that
have potential therapeutic effects on specific cellular pathways. Such
chemical compounds may have therapeutic relevance to a variety of diseases
outside of cancer as well, in cases where such diseases are known or are
demonstrated to involve the specific cellular pathway that is affected.
The polypeptides disclosed herein, preferably those of SEQ ID NO: 2,
4, 6, 8, 10, 12, 14, 16, 18 and 20, also find use as vaccines in that, where
the
polypeptide represents a surface protein present on a cancer cell, such
polypeptide may be administered to an animal, especially a human being, for
purposes of activating cytotoxic T lymphocytes (CTLs) that will be specific
for,
and act to lyze, cancer cells in said animal. Where used as vaccines, such
polypeptides are present in the form of a pharmaceutical composition. The
present invention may also employ polypeptides that have the same, or
similar, immunogenic character as the polypeptides of SEQ ID NO: 2, 4, 6, 8,
10, 12, 14, 16, 18 and 20 and thereby elicit the same, or similar, immunogenic
response after administration to an animal, such as an animal at risk of
developing cancer, or afflicted therewith. Thus, the polypeptides disclosed
according to the invention will commonly find use as immunogenic
compositions.
29
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
The present invention also relates to a process that comprises a
method for producing a product comprising identifying an agent according to
one of the disclosed processes for identifying such an agent (i.e., the
therapeutic agents identified according to the assay procedures disclosed
herein) wherein said product is the data collected with respect to said agent
as a result of said identification process, or assay, and wherein said data is
sufficient to convey the chemical character and/or structure and/or properties
of said agent. For example, the present invention specifically contemplates a
situation whereby a user of an assay of the invention may use the assay to
screen for compounds having the desired enzyme modulating activity and,
having identified the compound, then conveys that mtorma~ion y.e.,
information as to structure, dosage, etc) to another user who then utilizes
the
information to reproduce the agent and administer it for therapeutic or
research purposes according to the invention. For example, the user of the
assay (user 1) may screen a number of test compounds without knowing the
structure or identity of the compounds (such as where a number of code
numbers are used the first user is simply given samples labeled with said
code numbers) and, after performing the screening process, using one or
more assay processes of the present invention, then imparts to a second user
(user 2), verbally or in writing or some equivalent fashion, sufficient
information to identify the compounds having a particular modulating activity
(for example, the code number with the corresponding results). This
transmission of information from user 1 to user 2 is specifically contemplated
by the present invention.
The genes useful in the methods of the invention disclosed herein are
genes corresponding to a polynucleotide having the sequence of SEQ ID NO:
1, 3, 5, 7, 9, 11, 13, 15, 17 or 19 and represent genes that may be over-
expressed in malignant cancer, such as is a gene corresponding to SEQ ID
NO: 1 for lung, the latter being expressed at least three fold higher in lung
cancer samples as compared to normal lung tissues. In addition, in any given
sample, not all cancer cells may express this gene a substantial expression
thereof in a substantial number of such cells is sufficient to warrant a
determination of a cancerous, or potentially cancerous, condition.
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
Thus, the polynucleotide sequences disclosed according to the present
invention are expressed in cancer compared to normal tissue samples or may
be expressed at a higher level in cancer as compared to normal tissues.
Further, such polynucleotide, or gene, sequence expression in normal tissues
may correlate with individuals having a family history of cancer.
Such gene sequences may play a direct role in cancer progression,
such as in cancer initiation or cancer cell proliferation/survival. For
example,
one or more genes encoding the same polypeptide as one or more of the
sequences disclosed herein represent novel individual gene targets for
screening and discovery of small molecules that inhibit enzyme or other
cellular functions, e.g. kinase inhibitors. Such molecules represent valuable
therapeutics for cancer. In addition, small molecules or agents, such as small
organic molecules, that down-regulate the expression of these genes in
cancer would represent valuable anti-cancer therapeutics. Expression of the
gene in normal tissues may indicate a predisposition towards development of
lung cancer. The encoded polypeptide might represent a potentially useful cell
surface target for therapeutic molecules such as cytolytic antibodies, or
antibodies attached to cytotoxic, or cytolytic, agents. .
It should be cautioned that, in carrying out the procedures of the
present invention as disclosed herein, any reference to particular buffers,
media, reagents, cells, culture conditions and the like are not intended to be
limiting, but are to be read so as to include all related materials that one
of
ordinary skill in the art would recognize as being of interest or value in the
particular context in which that discussion is presented. For example, it is
often possible to substitute one buffer system or culture medium for another
and still achieve similar, if not identical, results. Those of skill in the
art will
have sufficient knowledge of such systems and methodologies so as to be
able, without undue experimentation, to make such substitutions as will
optimally serve their purposes in using the methods and procedures disclosed
herein.
31
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
The present invention will now be further described by way of the
following non-limiting example. In applying the disclosure of the example, it
should be kept clearly in mind that other and different embodiments of the
methods disclosed according to the present invention will no doubt suggest
themselves to those of skill in the relevant art. The following example shows
how a potential anti-neoplastic agent may be identified using one or more of
the genes disclosed herein.
EXAMPLE
SW480 cells are grown to a density of 105 cells/cm2 in Leibovitz's L-15
medium supplemented with 2 mM L-glutamine (90%) and 10% fetal bovine
serum. The cells are collected after treatment with 0.25% trypsin, 0.02%
EDTA at 37°C for 2 to 5 minutes. The trypsinized cells are then diluted
with 30
ml growth medium and plated at a density of 50,000 cells per well in a 96 well
plate (200 p.l/well). The following day, cells are treated with either
compound
buffer alone, or compound buffer containing a chemical agent to be tested, for
24 hours. The media is then removed, the cells lysed and the RNA recovered
using the RNAeasy reagents and protocol obtained from Qiagen. RNA is
quantitated and 10 ng of sample in 1 p,1 are added to 24 p,1 of Taqman
reaction
mix containing 1X PCR buffer, RNAsin, reverse transcriptase, nucleoside
triphosphates, amplitaq gold, tween 20, glycerol, bovine serum albumin (BSA)
and specific PCR primers and probes for a reference gene (18S RNA) and a
test gene (Gene X). Reverse transcription is then carried out at 48°C
for 30
minutes. The sample is then applied to a Perlin Elmer 7700 sequence
detector and heat denatured for 10 minutes at 95°C. Amplification is
performed through 40 cycles using 15 seconds annealing at 60°C followed
by
a 60 second extension at 72°C and 30 second denaturation at
95°C. Data
files are then captured and the data analyzed with the appropriate baseline
windows and thresholds.
32
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
The quantitative difference between the target and reference gene is
then calculated and a relative expression value determined for all of the
samples used. This procedure is then repeated for other genes functionally
related to the gene as disclosed herein and the level of function, or
expression, noted. The relative expression ratios for each pair of genes is
determined (i.e., a ratio of expression is determined for each target gene
versus each of the other genes for which expression is measured, where each
gene's absolute expression is determined relative to the reference gene for
each compound, or chemical agent, to be screened). The samples are then
scored and ranked according to the degree of alteration of the expression
profile in the treated samples relative to the control. The overall expression
of
the particular gene relative to the controls, as modulated by one chemical
agent relative to another, is also ascertained. Chemical agents having the
most effect on a given gene, or set of genes, are considered the most anti-
neoplastic.
25
33
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
SEQUENCE LISTING
<110> Young, Paul
Horrigan, Stephen
Weaver, Zoe
Endress, Gregory
<120> Cancer-Linked Genes as Targets for Chemotherapy
<130> 689290-79
<150> US/60/239,294
<151> 2000-10-11
<150> US/60/239,297
<151> 2000-10-11
<150> US/60/239,605
<151> 2000-10-11
<150> US/60/239,802
<151> 2000-10-12
<150> US/60/239,805
<151> 2000-10-12
<150> US/60/239,806
<151> 2000-10-12
<150> US/60/240,622
<151> 2000-10-16
<150> US/60/241,682
<151> 2000-10-19
<150> US/60/241,723
<151> 2000-10-19
<150> US/60/244,932
<151> 2000-10-31
<160> 21
<170> PatentIn version 3.0
<210> 1
<211> 1934
<212> DNA
<213> Homo sapiens
<400> 1
ctgtcattca tgctttggaa aagtttactg tatatacatt agacattcct gttctttttg 60
gagttagtac tacatcccct gaagaaacat gtgcccaggt gattcgtgaa gctaagagaa 120
cagcaccaag tatagtgtat gttcctcata tccacgtgtg gtgggaaata gttggaccga 180
cacttaaagc cacatttacc acattattac agaatattcc ttcatttgct ccagttttac 240
tacttgcaac ttctgacaaa ccccattccg ctttgccaga agaggtgcaa gaattgttta 300
tccgtgatta tggagagatt tttaatgtcc agttaccgga taaagaagaa cggacaaaat 360
tttttgaaga tttaattcta aaacaagctg ctaagcctcc tatatcaaaa aagaaagcag 420
1
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
ttttgcaggctttggaggtactcccagtagcaccaccacctgagccaagatcactgacag480
cagaagaagtgaaacgactagaagaacaagaagaagatacatttagagaactgaggattt540
tcttaagaaatgttacacataggcttgctattgacaagcgattccgagtgtttactaagc600
ctgttgaccctgatgaggttcctgattatgtcactgtaataaagcaaccaatggaccttt660
catctgtaatcagtaaaattgatctacacaagtatctgactgtgaaagactatttgagag720
atattgatctaatctgtagtaatgccttagaatacaatccagatagagatcctggagatc780
gtcttattaggcatagagcctgtgctttaagagatactgcctatgccataattaaagaag840
aacttgatgaagactttgagcagctctgtgaagaaattcaggaatctagaaagaaaagag900
gttgtagctcctccaaatatgccccgtcttactaccatgtgatgccaaagcaaaattcca960
ctcttgttggtgataaaagatcagacccagagcagaatgaaaagctaaagacaccgagta1020
ctcctgtggcttgcagcactcctgctcagttgaagaggaaaattcgcaaaaagtcaaact1080
ggtacttaggcaccataaaaaagcgaaggaagatttcacaggcaaaggatgatagccaga1140
atgccatagatcacaaaattgagagtgatacagaggaaactcaagacacaagtgtagatc1200
ataatgagaccggaaacacaggagagtcttcggtggaagaaaatgaaaaacagcaaaatg1260
cctctgaaagcaaactggaattgagaaataattcaaatacttgtaatatagagaatgagc1320
ttgaagactctaggaagactacagcatgtacagaattgagagacaagattgcttgtaatg1380
gagatgcttctagctctcagataatacatatttctgatgaaaatgaaggaaaagaaatgt1440
gtgttctgcgaatgactcgagctagacgttcccaggtagaacagcagcagctcatcactg1500
ttgaaaaggctttggcaattctttctcagcctacaccctcacttgttgtggatcatgagc1560
gattaaaaaatcttttgaagactgttgttaaaaaaagtcaaaactacaacatatttcagt1620
tggaaaatttgtatgcagtaatcagccaatgtatttatcggcatcgcaaggaccatgata1680
aaacatcacttattcagaaaatggagcaagaggtagaaaacttcagttgttccagatgat1740
gatgtcatggtatcgagtattctttatattcagttcctatttaagtcatttttgtcatgt1800
ccgcctaattgatgtagtatgaaaccctgcatctttaaggaaaagattaaaatagtaaaa1860
taaaagtatttaaactttcctgatatttatgtacatattaagataaatgtcatgtgtaag1920
ataactgataaata 1934
<210> 2
<211> 362
<212> PRT
<213> Homo Sapiens
<400> 2
Met Asp Leu Ser Ser Val Ile Ser Lys Ile Asp Leu His Lys Tyr Leu
1 5 10 15
Thr Val Lys Asp Tyr Leu Arg Asp Ile Asp Leu Ile Cys Ser Asn Ala
20 25 30
Leu Glu Tyr Asn Pro Asp Arg Asp Pro Gly Asp Arg Leu Ile Arg His
35 40 45
Arg Ala Cys Ala Leu Arg Asp Thr Ala Tyr Ala Ile Ile Lys Glu Glu
50 55 60
Leu Asp Glu Asp Phe Glu Gln Leu Cys Glu Glu Ile Gln Glu Ser Arg
65 70 75 80
Lys Lys Arg Gly Cys Ser Ser Ser Lys Tyr Ala Pro Ser Tyr Tyr His
85 90 95
Va1 Met Pro Lys Gln Asn Ser Thr Leu Val Gly Asp Lys Arg Ser Asp
100 105 110
Pro G1u Gln Asn Glu Lys Leu Lys Thr Pro Ser Thr Pro Val Ala Cys
115 120 125
Ser Thr Pro Ala Gln Leu Lys Arg Lys Ile Arg Lys Lys Ser Asn Trp
2
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
130 135 140
Tyr Leu Gly Thr Ile Lys Lys Arg Arg Lys Ile Ser Gln Ala Lys Asp
l45 150 155 160
Asp Ser Gln Asn Ala Ile Asp His Lys Ile Glu Ser Asp Thr Glu Glu
165 170 175
Thr Gln Asp Thr Ser Val Asp His Asn Glu Thr Gly Asn Thr Gly Glu
180 185 190
Ser Ser Val Glu Glu Asn Glu Lys Gln Gln Asn Ala Ser Glu Ser Lys
195 200 205
Leu Glu Leu Arg Asn Asn Ser Asn Thr Cys Asn Ile Glu Asn Glu Leu
210 215 220
Glu Asp Ser Arg Lys Thr Thr Ala Cys Thr Glu Leu Arg Asp Lys Ile
225 230 235 240
Ala Cys Asn Gly Asp Ala Ser Ser Ser Gln Ile Ile His I1e Ser Asp
245 250 255
Glu Asn Glu Gly Lys Glu Met Cys Val Leu Arg Met Thr Arg A1a Arg
260 265 270
Arg Ser Gln Va1 Glu Gln Gln Gln Leu Ile Thr Val Glu Lys Ala Leu
275 280 285
Ala Ile Leu Ser Gln Pro Thr Pro Ser Leu Val Val Asp His Glu Arg
290 295 300
Leu Lys Asn Leu Leu Lys Thr Val Val Lys Lys Ser Gln Asn Tyr Asn
305 310 315 320
21e Phe Gln Leu Glu Asn Leu Tyr Ala Val Ile Ser Gln Cys Ile Tyr
325 330 335
Arg His Arg Lys Asp His Asp Lys Thr Ser Leu Ile Gln Lys Met G1u
340 345 350
Gln Glu Val Glu Asn Phe Ser Cys Ser Arg
355 360
<210> 3
<211> 1274
<212> DNA
<213> Homo Sapiens
<400> 3
cacgaggcagactgaagattgtggcttggtattcacaggcaggtttcagacatttagatc 60
tttcttttaatgactaacaccatgcctatctgtggagaagctggcaacatgtcacacctg 120
gaaattgtttttcaacattaatactattatttggcagtaatccagattgcttttgccacc 180
aacctgaagacatatagaggcagaaggacaggaataattctatttgtttcctgttttgaa 240
acttccatctgtaaggctatcaaaaggagatgtgagagagggtattgagtctggcctgac 300
aatgcagttcttaaaccaaaggtccattatgcttctcctctctgagaatcctgacttacc 360
tcaacaacggagacatggcacagtagccagcttggagacttctcagccaatgctctgaga 420
tcaagtcgaagacccaatatacagggttttgagctcatcttcatcattcatatgaggaaa 480
taagtggtaaaatccttggaaatacaatgagactcatcagaaacatttacatattttgta 540
3
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
gtattgttatgacagcagagggtgatgctccagagctgccagaagaaagggaactgatga600
ccaactgctccaacatgtctctaagaaaggttcccgcagacttgaccccagccacaacga660
cactggatttatcctataacctcctttttcaactccagagttcagattttcattctgtct720
ccaaactgagagttttgattctatgccataacagaattcaacagctggatctcaaaacct780
ttgaattcaacaaggagttaagatatttagatttgtctaataacagactgaagagtgtaa840
cttggtatttactggcaggtctcaggtatttagatctttcttttaatgactttgacacca900
tgcctatctgtgaggaagctggcaacatgtcacacctggaaatcctaggtttgagtgggg960
caaaaatacaaaaatcagatttccagaaaattgctcatctgcatctaaatactgtcttct1020
taggattcagaactcttcctcattatgaagaaggtagcctgcccatcttaaacacaacaa1080
aactgcacattgttttaccaatggacacaaatttctgggttcttttgcgtgatggaatca1140
agacttcaaaaatattagaaatgacaaatatagatggcaaaagccaatttgtaagttatg1200
aaatgcaacgaaatcttagtttagaacatgctaagacatcggttctattgcttaataaag1260
ttgatttactctgg 1274
<210> 4
<211> 256
<212> PRT
<213> Homo sapiens
<400> 4
Met Arg Leu Ile Arg Asn Ile Tyr Ile Phe Cys Ser Ile Val Met Thr
1 5 10 15
Ala Glu Gly Asp Ala Pro Glu Leu Pro Glu Glu Arg Glu Leu Met Thr
20 25 30
Asn Cys Ser Asn Met Ser Leu Arg Lys Val Pro Ala Asp Leu Thr Pro
35 40 45
A1a Thr Thr Thr Leu Asp Leu Ser Tyr Asn Leu Leu Phe Gln Leu Gln
50 55 60
Ser Ser Asp Phe His Ser Val Ser Lys Leu Arg Val Leu Ile Leu Cys
65 70 75 80
His Asn Arg Ile Gln Gln Leu Asp Leu Lys Thr Phe Glu Phe Asn Lys
85 90 95
Glu Leu Arg Tyr Leu Asp Leu Ser Asn Asn Arg Leu Lys Ser Val Thr
100 105 110
Trp Tyr Leu Leu Ala Gly Leu Arg Tyr Leu Asp Leu Ser Phe Asn Asp
115 120 125
Phe Asp Thr Met Pro Ile Cys Glu G1u A1a Gly Asn Met Ser His Leu
130 135 140
Glu Ile Leu Gly Leu Ser Gly Ala Lys Ile Gln Lys Ser Asp Phe Gln
145 150 155 160
Lys Ile Ala His Leu His Leu Asn Thr Val Phe Leu Gly Phe Arg Thr
165 170 175
Leu Pro His Tyr Glu Glu Gly Ser Leu Pro Ile Leu Asn Thr Thr Lys
180 185 190
Leu His Ile Val Leu Pro Met Asp Thr Asn Phe Trp Val Leu Leu Arg
195 200 205
4
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
Asp Gly Ile Lys Thr Ser Lys Ile Leu Glu Met Thr Asn I1e Asp Gly
210 215 220
Lys Ser Gln Phe Val Ser Tyr Glu Met Gln Arg Asn Leu Ser Leu Glu
225 230 235 240
His Ala Lys Thr Ser Val Leu Leu Leu Asn Lys Val Asp Leu Leu Trp
245 250 255
<210>
<211>
814
<212>
DNA
<213> Sapiens
Homo
<400>
5
agaatcccggacagccctgc tccctgcagccaggtgtagtttcgggagcc actggggcca60
aagtgagagtccagcggtct tccagcgcttgggccacggcggcggccctg ggagcagagg120
tggagcgaccccattacgct aaagatgaaaggctggggttggctggccct gcttctgggg180
gccctgctgggaaccgcctg ggctcggaggagccaggatctccactgtgg agcatgcagg240
gctctggtggatgaactaga atgggaaattgcccaggtggaccccaagaa gaccattcag300
atgggatctttccggatcaa tccagatggcagccagtcagtggtggaggt gccttatgcc360
cgctcagaggcccacctcac agagctgctggaggagatatgtgaccggat gaaggagtat420
ggggaacagattgatccttc cacccatcgcaagaactacgtacgtgtagt gggccggaat480
ggagaatccagtgaactgga cctacaaggcatccgaatcgactcagatat tagcggcacc540
ctcaagtttgcgtgtgagag cattgtggaggaatacgaggatgaactcat tgaattcttt600
tcccgagaggctgacaatgt taaagacaaactttgcagtaagcgaacaga tctttgtgac660
catgccctgcacatatcgca tgatgagctatgaaccactggagcagccca cactggcttg720
atggatcacccccaggaggg gaaaatggtggcaatgccttttatatatta tgtttttact780
gaaattaactgaaaaaatat gaaaccaaaagtac 814
<2l0>
6
<211>
182
<212>
PRT
<213>
Homo
Sapiens
<400>
6
Met Lys Leu Leu Gly Ala Leu Leu Gly
Gly Trp Leu
Gly Trp
Leu Ala
1 5 10 15
Thr Ala Asp Leu Cys Gly Ala Cys Arg
Trp Ala His
Arg Arg
Ser Gln
20 25 30
Ala Leu Glu Ile Gln Val Asp Pro Lys
Val Asp Ala
Glu Leu
Glu Trp
35 40 45
Lys Thr Arg Ile Pro Asp Gly Ser Gln
Ile Gln Asn
Met Gly
Ser Phe
50 55 60
Ser Val Arg Ser A1a His Leu Thr Glu
Val Glu Glu
Val Pro
Tyr Ala
65 70 75 80
Leu Leu Met Lys Tyr Gly Glu Gln Tle
Glu Glu Glu
Ile Cys
Asp Arg
85 90 95
Asp Pro Tyr Val Val Val Gly Arg Asn
Ser Thr Arg
His Arg
Lys Asn
100 105 1l0
Gly Glu Ser Ser Glu Leu Asp Leu Gln Gly Ile Arg Ile Asp Ser Asp
5
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
115 120 125
Ile Ser Gly Thr Leu Lys Phe Ala Cys Glu Ser Ile Val Glu G1u Tyr
130 135 140
Glu Asp Glu Leu Ile Glu Phe Phe Ser Arg Glu Ala Asp Asn Val Lys
145 150 155 160
Asp Lys Leu Cys Ser Lys Arg Thr Asp Leu Cys Asp His Ala Leu His
165 170 175
Ile Ser His Asp Glu Leu
180
<210> 7
<211> 1597
<212> DNA
<213> Homo Sapiens
<400>
7 60
gcggccgctgcgccgcaaactcgtgtgggacgcaccgctccagccgcccgcgggccagcg
caccggtcccccagcggcagccgagcccgcccgcgcgccgttcgtgccctcgtgaggctg120
gcatgcaggatggcaggacagcccggccacatgccccatggagggagttccaacaacctc180
tgccacaccctggggcctgtgcatcctcctgacccacagaggcatcccaacacgctgtct240
tttcgctgctcgctggcggacttccagatcgaaaagaagataggccgaggacagttcagc300
gaggtgtacaaggccacctgcctgctggacaggaagacagtggctctgaagaaggtgcag360
atctttgagatgatggacgccaaggcgaggcaggactgtgtcaaggagatcggcctcttg420
aagcaactgaaccacccaaatatcatcaagtatttggactcgtttatcgaagacaacgag480
ctgaacattgtgctggagttggctgacgcaggggacctctcgcagatgatcaagtacttt540
aagaagcagaagcggctcatcccggagaggacagtatggaagtactttgtgcagctgtgc600
agcgccgtggagcacatgcattcacgccgggtgatgcaccgagacatcaagcctgccaac660
gtgttcatcacagccacgggcgtcgtgaagctcggtgaccttggtctgggccgcttcttc720
agctctgagaccaccgcagcccactccctagtggggacgccctactacatgtcaccggag780
aggatccatgagaacggctacaacttcaagtccgacatctggtccttgggctgtctgctg840
tacgagatggcagccctccagagccccttctatggagataagatgaatctcttctccctg900
tgccagaagatcgagcagtgtgactaccccccactccccggggagcactactccgagaag960
ttacgagaactggtcagcatgtgcatctgccctgacccccaccagagacctgacatcgga1020
tacgtgcaccaggtggccaagcagatgcacatctggatgtccagcacctgagcgtggatg1080
caccgtgccttatcaaagccagcaccactttgccttacttgagtcgtcttctcttcgagt1140
ggccacctggtagcctagaacagctaagaccacagggttcagcaggttccccaaaaggct1200
gcccagccttacagcagatgctgaaggcagagcagctgagggaggggcgctggccacatg1260
tcactgatggtcagattccaaagtcctttctttatactgttgtggacaatctcagctggg1320
tcaataagggcaggtggttcagcgagccacggcagccccctgtatctggattgtaatgtg1380
aatctttagggtaattcctccagtgacctgtcaaggcttatgctaacaggagacttgcag1440
gagaccgtgtgatttgtgtagtgagcctttgaaaatggttagtaccgggttcagtttagt1500
tcttggtatcttttcaatcaagctgtgtgcttaatttactctgttgtaaagggataaagt1560
ggaaatcatttttttccgtggaaaaaaaaaaaaaaaa 1597
<210> 8
<211> 306
<212> PRT
<213> Homo Sapiens
400> 8
Met Pro His Gly Gly Ser Ser Asn Asn Leu Cys His Thr Leu Gly Pro
1 5 10 15
Val His Pro Pro Asp Pro Gln Arg His Pro Asn Thr Leu Ser Phe Arg
6
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
20 25 30
Cys Ser Leu Ala Asp Phe Gln Ile Glu Lys Lys Ile Gly Arg Gly Gln
35 40 45
Phe Ser Glu Val Tyr Lys Ala Thr Cys Leu Leu Asp Arg Lys Thr Val
50 55 60
Ala Leu Lys Lys Val Gln Ile Phe Glu Met Met Asp Ala Lys Ala Arg
65 70 75 80
Gln Asp Cys Val Lys Glu Ile Gly Leu Leu Lys Gln Leu Asn.His Pro
85 90 95
Asn Ile Ile Lys Tyr Leu Asp Ser Phe Ile Glu Asp Asn Glu Leu Asn
100 105 110
Ile Val Leu Glu Leu Ala Asp Ala Gly Asp Leu Ser Gln Met Ile Lys
115 120 125
Tyr Phe Lys Lys Gln Lys Arg Leu Ile Pro Glu Arg Thr Val Trp Lys
130 135 140
Tyr Phe Val Gln Leu Cys Ser Ala Val Glu His Met His Ser Arg Arg
145 150 155 160
Val Met His Arg Asp Ile Lys Pro Ala Asn Val Phe Ile Thr Ala Thr
165 170 175
Gly Val Val Lys Leu Gly Asp Leu Gly Leu Gly Arg Phe Phe Ser Ser
l80 185 190
Glu Thr Thr Ala Ala His Ser Leu Val Gly Thr Pro Tyr Tyr Met Ser
195 200 205
Pro Glu Arg Ile His Glu Asn Gly Tyr Asn Phe Lys Ser Asp Ile Trp
210 215 220
Ser Leu Gly Cys Leu Leu Tyr Glu Met Ala Ala Leu Gln Ser Pro Phe
225 230 235 240
Tyr Gly Asp Lys Met Asn Leu Phe Ser Leu Cys Gln Lys Ile Glu Gln
245 250 255
Cys Asp Tyr Pro Pro Leu Pro Gly Glu His Tyr Ser Glu Lys Leu Arg
260 265 270
Glu Leu Val Ser Met Cys Ile Cys Pro Asp Pro His Gln Arg Pro Asp
275 280 285
Ile Gly Tyr Val His Gln Val Ala Lys Gln Met His Ile Trp Met Ser
290 295 300
Ser Thr
305
<210> 9
<211> 6780
<212> DNA
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
<213> Homo Sapiens
<220>
<221> misc_feature
<223> n=a,t,g or c
<400>
9 60
gggcggggctgagggcggcgggggcgggccgcccgagctgggagggcggcggcgccgagg
ggaggagagcggcccatggacccgcggggcccggcgccccagactctgcgccgtcgggac 120
ggagcccaagatgtcggcctaggccggggcgcgacgacgcggacggggcggcgaggaggc 180
gccgctgctgccggggctcgcagccgccgagcccccgagggcgcgccctgacggactggc 240
cgagccggcggtgagaggccggcgcgtctggagcgggccgcgcggcaccatgtcggccaa 300
ggtgcggctcaagaagctggagcagctgctcctggacgggccctggcgcaacgagagcgc 360
cctgagcgtggaaacgctgctcgacgtgctcgtctgcctgtacaccgagtgcagccactc 420
ggccctgcgccgcgacaagtacgtggccgagttcctcgagtgggctaaaccatttacaca 480
gctggtgaaagaaatgcagcttcatcgagaagactttgaaataattaaagtaattggaag 540
aggtgcttttggtgaggttgctgttgtcaaaatgaagaatactgaacgaatttatgcaat 600
gaaaatcctcaacaagtgggagatgctgaaaagagcagagaccgcgtgcttccgagagga 660
gcgcgatgtgctggtgaacggcgactgccagtggatcaccgcgctgcactacgcctttca 720
ggacgagaaccacctgtacttagtcatggattactatgtgggtggtgatttactgaccct 780
gctcagcaaatttgaagacaagcttccggaagatatggcgaggttctacattggtgaaat 840
ggtgctggccattgactccatccatcagcttcattacgtgcacagagacattaaacctga 900
caatgtccttttggacgtgaatggtcatatccgcctggctgactttggatcatgtttgaa 960
gatgaatgatgatggcactgtgcagtcctccgtggccgtgggcacacctgactacatctc 1020
gccggagatcctgcaggcgatggaggacggcatgggcaaatacgggcctgagtgtgactg 1080
gtggtctctgggtgtctgcatgtatgagatgctctatggagaaacgccgttttatgcgga 1140
gtcactcgtggagacctatgggaagatcatgaaccatgaagagcgattccagttcccatc 1200
ccatgtcacggatgtatctgaagaagcgaaggacctcatccagagactgatctgcagtag 1260
agaacgccggctggggcagaatggaatagaggatttcaaaaagcatgcgttttttgaagg 1320
tctaaattgggaaaatatacgaaacctagaagcaccttatattcctgatgtgagcagtcc 1380
ctctgacacatccaacttcgacgtggatgacgacgtgctgagaaacacggaaatattacc 1440
tcctggttctcacacaggcttttctggattacatttgccattcattggttttacattcac 1500
aacggaaagctgtttttctgatcgaggctctctgaagagcataatgcagtccaacacatt 1560
aaccaaagatgaggatgtgcagcgggacctggagcacagcctgcagatggaagcttacga 1620
gaggaggattcggaggctggaacaggagaagctggagctgagcaggaagctgcaagagtc 1680
cacccagaccgtgcagtccctccacggctcatctcgggccctcagcaattcaaaccgaga 1740
taaagaaatcaaaaagctaaatgaagaaatcgaacgcttgaagaataaaatagcagattc 1800
aaacaggctggagcgacagcttgaggacacagtggcgcttcgccaagagcgtgaggactc 1860
cacgcagcggctgcgggggctggagaagcagcaccgcgtggtccggcaggagaaggagga 1920
gctgcacaagcaactggttgaagcctcagagcggttgaaatcccaggccaaggaactcaa 1980
agatgcccatcagcagcgaaagctggccctgcaggagttctcggagctgaacgagcgcat 2040
ggcagagctccgtgcccagaagcagaaggtgtcccggcagctgcgagacaaggaggagga 2100
gatggaggtggccacgcagaaggtggacgccatgcggcaggaaatgcggagagctgagaa 2160
gctcaggaaagagctggaagctcagcttgatgatgctgttgctgaggcctccaaggagcg 2220
caagcttcgtgagcacagcgagaacttctgcaagcaaatggaaagcgagctggaggccct 2280
caaggtgaagcaaggaggccggggagcgggtgccaccttagagcaccagcaagagatttc 2340
caaaatcaaatccgagctggagaagaaagtcttattttatgaagaggaattggtcagacg 2400
tgaggcctcccatgtgctagaagtgaaaaatgtgaagaaggaggtgcatgattcagaaag 2460
ccaccagctggccctgcagaaagaaatcttgatgttaaaagataagttagaaaagtcaaa 2520
gcgagaacggcataacgagatggaggaggcagtaggtacaataaaagataaatacgaacg 2580
agaaagagcgatgctgtttgatgaaaacaagaagctaactgctgaaaatgaaaagctctg 2640
ttcctttgtggataaactcacagctcaaaatagacagctggaggatgagctgcaggatct 2700
ggcagccaagaaggagtcagtggcccactgggaagctcagattgcggaaatcattcagtg 2760
ggtcagtgacgagaaagatgcccggggttaccttcaagctcttgcttccaagatgaccga 2820
agagctcgaggctttgaggagttctagtctggggtcaagaacactggacccgctgtggaa 2880
ggtgcgccgcagccagaagctggacatgtccgcgcggctggagctgcagtcggccctgga 2940
ggcggagatccgggccaagcagcttgtccaggaggagctcaggaaggtcaaggacgccaa 3000
cctcaccttggaaagcaaactaaaggattccgaagccaaaaacagagaattattagaaga 3060
aatggaaattttgaagaaaaagatggaagaaaaattcagagcagatactgggctcaaact 3120
g
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
tccagatttt caggattcca tttttgagta tttcaacact gctcctcttg cacatgacct 3180
gacatttaga accagctcag ctagtgagca agaaacacaa gctccgaagc cagaagcgtc 3240
cccgtcgatg tctgtggctg catcagagca gcaggaggac atggctcggc ccccgcagag 3300
gccatccgct gtgccgttgc ccaccacgca ggccctggtt ctggctggac cgaagccaaa 3360
agctcaccag ttcagcatca agtccttctc cagccctact cagtgcagcc actgcacctc 3420
cctgatggtt gggctgatcc ggcagggcta cgcctgcgag gtgtgttcct ttgcttgcca 3480
cgtgtcctgc aaagacggtg ccccccaggt gtgcccaata cctcccgagc agtccaagag 3540
gcctctgggc gtggacgtgc agcgaggcat cggaacagcc tacaaaggcc atgtcaaggt 3600
cccaaagccc acgggggtga agaagggatg gcagcgcgca tatgcagtcg tctgtgagtg 3660
caagctcttc ctgtatgatc tgcctgaagg aaaatccacc cagcctggtg tcattgcgag 3720
ccaagtcttg gatctcagag atgacgagtt ttccgtgagc tcagtcctgg cctcagatgt 3780
cattcatgct acacgccgag atattccatg tatattcagg gtgacggcct ctctcttagg 3840
tgcaccttct aagaccagct cgctgctcat tctgacagaa aatgagaatg aaaagaggaa 3900
gtgggttggg attctagaag gactccagtc catccttcat aaaaaccggc tgaggaatca 3960
ggtcgtgcat gttcccttgg aagcctacga cagctcgctg cctctcatca aggccatcct 4020
gacagctgcc atcgtggatg cagacaggat tgcagtcggc ctagaagaag ggctctatgt 4080
catagaggtc acccgagatg tgatcgtccg tgccgctgac tgtaagaagg tacaccagat 4140
cgagcttgct cccagggaga agatcgtaat cctcctctgt ggccggaacc accatgtgca 4200
cctctatccg tggtcgtccc ttgatggagc ggaaggcagc tttgacatca agcttccgga 4260
aaccaaaggc tgccagctca tggccacggc cacactcaag aggaactctg gcacctgcct 4320
gtttgtggcc gtgaaacggc tgatcctttg ctatgagatc cagagaacga agccattcca 4380
cagaaagttc aatgagattg tggctcccgg cagcgtgcag tgcctggcgg tgctcaggga 4440
caggctctgt gtgggctacc cttctgggtt ctgcctgctg agcatccagg gggacgggca 4500
gcctctaaac ctggtaaatc ccaatgaccc ctcgcttgcg ttcctctcac aacagtcttt 4560
tgatgccctt tgtgctgtgg agctcgaaag cgaggagtac ctgctttgct tcagccacat 4620
gggactgtac gtggacccgc aaggccggag ggcacgcgcg caggagctca tgtggcctgc 4680
ggctcctgtc gcctgtagtt gcagccccac ccacgtcacg gtgtacagcg agtatggcgt 4740
ggacgtcttt gatgtgcgca ccatggagtg ggtgcagacc atcggcctgc ggaggataag 4800
gcccctgaac tctgaaggca ccctcaacct cctcaactgc gagcctccac gcttgatcta 4860
cttcaagagc aagttctcgg gagcggttct caacgtgccg gacacctccg acaacagcaa 4920
gaagcagatg ctgcgcacca ggagcaaaag gcggttcgtc ttcaaggtcc cagaggaaga 4980
gagactgcag cagaggcgag agatgcttag agacccagaa ttgagatcca aaatgatatc 5040
caacccaacc aacttcaacc acgtggccca catgggccca ggcgacggca tgcaggtgct 5100
catggacctg cctctgagtg ctgtgccccc ctcccaggag gaaaggccgg gccccgctcc 5160
caccaacctg gctcgccagc ctccatccag gaacaagccc tacatctcgt ggccctcatc 5220
aggtggatcg gagcctagcg tgactgtgcc tctgagaagt atgtctgatc cagaccagga 5280
ctttgacaaa gagcctgatt cggactccac caaacactca actccatcga atagctccaa 5340
CCCCagCggC CCaCCgagCC CCaaCtCCCC CC3CaggagC CagCt CCCCC tcgaaggcct 5400
ggagcagccg gcctgtgaca cctgaagccg ccagctcgcc acaggggcca gggagctgga 5460
gatggcctcc agcgtcagtg ccaagactga gcgggccctc cagtgttgtc caaggaaatg 5520
tagaatcact ttgtagatat ggagatgaag aagacaaatc tttattataa tattgatcag 5580
ttttatgccg cattgttcgt ggcagtagac cacatctgtt cgtctgcaca gctgtgaggc 5640
gatgctgttc catctgcaca tgaaggaccc ccatacagcc tgtctcccac ccctgacaac 5700
ccgagagggc atatggggcc ctgccaacac cacttcctca gcagaaaccc gtcatgacgc 5760
ggctgcttcg gaagcagaca tctggggaca cagcctcagt acccagtctt ttccctagtt 5820
cctgaaactt tcctaggacc ttaagagaat agtaggaggt cctatagcat tcccagtgtc 5880
actagaattt tgaagacagg aaagtggagg ttagtctgtg gccttttttt catttagcca 5940
ttgcacagtc agctgcagaa gtcctgctga ccacctagtc atggacaaag gcccaggacc 6000
agtgacaccc tgcgtccctg tgtgcgttaa gttcattctg ggtcgcagcc atgaagtgtc 6060
accagtatct actactgtga agtcagctgt gctgttttcc attcgcttcc acggcttctg 6120
cctcctgcca taaaaccagc gagtgtcgtg gtgcaggcag gccctgtggc ctgctgggct 6180
gagggaagtc agagccccag ggcgccacga agcagccact gggatacccc accccgcccc 6240
gccnnccccc ccccccccnc cagtcnagnc ccgaaatgga gcccccgtga ttagtagccc 6300
gtatgatcac gtagacccac ccaacacact cctgcacact ggccccggcc cacggcacag 6360
caatcccctg cgcgtggatt tcacctcacc ctttgtacca gatgttgagt gaccagctct 6420
gtggccctgt gtcgtcagag gcttgtgatt aactgtggcg gcagacacag cttgtccaca 6480
gcttgggcca ggcttcccct gtcctcccac cggtcggctg cttggcaagg ctgttcagga 6540
cgtgcacttc cccaagtcgg cactgagtgg cccagcacca cctagccctg ccaccccact 6600
gccctcctgg gccttctgct ggatgggcac ctggggggtt ctggtttttt acttttttaa 6660
9
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
tgtaagtctc agtctttgta attaattatt gaattgtgag aacatttttg aacaatttac 6720
ctgtcaataa agcagaagac ggcagtttta aagttaaaaa aaaaaaaaaa aaaaaaaaaa 6780
<210> 10
<211> 1711
<212> PRT
<213> Homo Sapiens
<400> 10
Met Ser Ala Lys Val Arg Leu Lys Lys Leu Glu Gln Leu Leu Leu Asp
1 5 10 15
G1y Pro Trp Arg Asn Glu Ser Ala Leu Ser Val Glu Thr Leu Leu Asp
20 25 30
Val Leu Val Cys Leu Tyr Thr Glu Cys Ser His Ser Ala Leu Arg Arg
35 40 45
Asp Lys Tyr Val Ala G1u Phe Leu Glu Trp Ala Lys Pro Phe Thr Gln
50 55 60
Leu Val Lys Glu Met Gln Leu His Arg Glu Asp Phe Glu Ile Ile Lys
65 70 75 80
Val Ile Gly Arg Gly Ala Phe Gly Glu Val Ala Val Val Lys Met Lys
85 90 95
Asn Thr Glu Arg Ile Tyr Ala Met Lys Ile Leu Asn Lys Trp Glu Met
100 105 110
Leu Lys Arg Ala Glu Thr Ala Cys Phe Arg Glu Glu Arg Asp Val Leu
115 120 125
Val Asn Gly Asp Cys Gln Trp Ile Thr Ala Leu His Tyr Ala Phe Gln
130 135 140
Asp Glu Asn His Leu Tyr Leu Val Met Asp Tyr Tyr Val Gly Gly Asp
145 150 155 160
Leu Leu Thr Leu Leu Ser Lys Phe Glu Asp Lys Leu Pro Glu Asp Met
165 170 175
Ala Arg Phe Tyr Ile Gly Glu Met Va1 Leu Ala Ile Asp Ser I1e His
180 185 190
Gln Leu His Tyr Val His Arg Asp Ile Lys Pro Asp Asn Val Leu Leu
195 200 205
Asp Val Asn Gly His Ile Arg Leu Ala Asp Phe Gly Ser Cys Leu Lys
210 215 220
Met Asn Asp Asp Gly Thr Val Gln Ser Ser Val Ala Val Gly Thr Pro
225 230 235 240
Asp Tyr Ile Ser Pro Glu Ile Leu Gln Ala Met Glu Asp Gly Met Gly
245 250 255
Lys Tyr Gly Pro Glu Cys Asp Trp Trp Ser Leu Gly Val Cys Met Tyr
1~
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
260 265 270
Glu Met Leu Tyr Gly G1u Thr Pro. Phe Tyr Ala Glu Ser Leu Val Glu
275 280 285
Thr Tyr Gly Lys Ile Met Asn His Glu Glu Arg Phe Gln Phe Pro Ser
290 295 300
His Val Thr Asp Val Ser Glu Glu A1a Lys Asp Leu Ile Gln Arg Leu
305 310 315 320
Ile Cys Ser Arg Glu Arg Arg Leu Gly Gln Asn Gly Ile Glu Asp Phe
325 330 335
Lys Lys His Ala Phe Phe Glu Gly Leu Asn Trp Glu Asn I1e Arg Asn
340 345 350
Leu Glu Ala Pro Tyr Ile Pro Asp Val Ser Ser Pro Ser Asp Thr Ser
355 360 365
Asn Phe Asp Val Asp Asp Asp Val Leu Arg Asn Thr Glu Ile Leu Pro
370 375 380
Pro Gly Ser His Thr Gly Phe Ser Gly Leu His Leu Pro Phe Ile Gly
385 390 395 400
Phe Thr Phe Thr Thr Glu Ser Cys Phe Ser Asp Arg Gly Ser Leu Lys
405 410 415
Ser Ile Met Gln Ser Ann Thr Leu Thr Lys Asp Glu Asp Val Gln Arg
420 425 430
Asp Leu Glu His 5er Leu Gln Met Glu Ala Tyr Glu Arg Arg Ile Arg
435 440 445
Arg Leu Glu Gln Glu Lys Leu Glu Leu Ser Arg Lys Leu Gln Glu Ser
450 455 460
Thr Gln Thr Val Gln Ser Leu His Gly Ser Ser Arg Ala Leu Ser Asn
465 470 475 480
Ser Asn Arg Asp Lys Glu Ile Lys Lys Leu Asn Glu Glu Ile G1u Arg
485 490 495
Leu Lys Asn Lys Ile Ala Asp Ser Asn Arg Leu Glu Arg Gln Leu Glu
500 505 510
Asp Thr Val Ala Leu Arg Gln Glu Arg Glu Asp Ser Thr Gln Arg Leu
515 520 525
Arg Gly Leu Glu Lys Gln His Arg Val Val Arg Gln Glu Lys Glu Glu
530 535 540
Leu His Lys G1n Leu Val Glu Ala Ser Glu Arg Leu Lys Ser Gln Ala
545 550 555 560
Lys Glu Leu Lys Asp Ala His Gln Gln Arg Lys Leu Ala Leu Gln Glu
565 570 575
11
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
Phe Ser Glu Leu Asn Glu Arg Met Ala Glu Leu Arg Ala Gln Lys Gln
580 585 590
Lys Val Ser Arg Gln Leu Arg Asp Lys Glu Glu Glu Met Glu Val Ala
595 600 605
Thr Gln Lys Val Asp Ala Met Arg Gln Glu Met Arg Arg Ala Glu Lys
610 615 620
Leu Arg Lys Glu Leu Glu Ala Gln Leu Asp Asp Ala Val Ala Glu Ala
625 630 635 640
Ser Lys Glu Arg Lys Leu Arg G1u His Ser Glu Asn Phe Cys Lys Gln
645 650 655
Met Glu Ser Glu Leu Glu Ala Leu Lys Val Lys Gln Gly Gly Arg Gly
660 665 670
Ala Gly A1a Thr Leu Glu His Gln Gln Glu Ile Ser Lys Ile Lys Ser
675 680 685
Glu Leu Glu Lys Lys Val Leu Phe Tyr Glu Glu Glu Leu Val Arg Arg
690 695 700
Glu Ala Ser His Val Leu Glu Val Lys Asn Va1 Lys Lys Glu Val His
705 710 715 720
Asp Ser Glu Ser His Gln Leu Ala Leu Gln Lys Glu Ile Leu Met Leu
725 730 735
Lys Asp Lys Leu Glu Lys Ser Lys Arg Glu Arg His Asn Glu Met Glu
740 745 750
Glu Ala Val Gly Thr Ile Lys Asp Lys Tyr Glu Arg Glu Arg Ala Met
755 760 765
Leu Phe Asp Glu Asn Lys Lys Leu Thr Ala Glu Asn Glu Lys Leu Cys
770 775 780
Ser Phe Val Asp Lys Leu Thr Ala Gln Asn Arg Gln Leu Glu Asp Glu
785 790 795 800
Leu Gln Asp Leu Ala A1a Lys Lys Glu Ser Val Ala His Trp Glu Ala
805 810 815
Gln Ile Ala Glu Ile Ile Gln Trp Val Ser Asp Glu Lys Asp Ala Arg
820 825 830
Gly Tyr Leu Gln Ala Leu Ala Ser Lys Met Thr Glu Glu Leu Glu Ala
835 840 845
Leu Arg Ser Ser Ser Leu Gly Ser Arg Thr Leu Asp Pro Leu Trp Lys
850 855 860
Val Arg Arg Ser Gln Lys T~eu Asp Met Ser Ala Arg Leu Glu Leu Gln
865 870 875 880
Ser Ala Leu Glu A1a Glu Ile Arg Ala Lys Gln Leu Val Gln Glu Glu
885 890 895
12
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
Leu Arg Lys Val Lys Asp Ala Asn Leu Thr Leu Glu Ser Lys Leu Lys
900 905 910
Asp Ser Glu Ala Lys Asn Arg Glu Leu Leu Glu Glu Met Glu Ile Leu
915 920 925
Lys Lys Lys Met Glu Glu Lys Phe Arg Ala Asp Thr Gly Leu Lys Leu
930 935 940
Pro Asp Phe Gln Asp Ser Ile Phe Glu Tyr Phe Asn Thr Ala Pro Leu
945 950 955 960
Ala His Asp Leu Thr Phe Arg Thr Ser Ser Ala Ser Glu Gln Glu Thr
965 970 975
Gln Ala Pro Lys Pro Glu Ala Ser Pro Ser Met Ser Val Ala Ala Ser
980 985 990
Glu Gln Gln Glu Asp Met Ala Arg Pro Pro Gln Arg Pro Ser Ala Val
gg5 1000 1005
Pro Leu Pro Thr Thr Gln Ala Leu Val Leu Ala Gly Pro Lys Pro
1010 1015 1020
Lys Ala His Gln Phe Ser Ile Lys Ser Phe Ser Ser Pro Thr Gln
1025 1030 1035
Cys Ser His Cys Thr Ser Leu Met Val Gly Leu Ile Arg Gln Gly
1040 1045 1050
Tyr Ala Cys Glu Val Cys Ser Phe Ala Cys His Val Ser Cys Lys
1055 1060 1065
Asp Gly Ala Pro Gln Val Cys Pro Ile Pro Pro Glu Gln Ser Lys
1070 1075 1080
Arg Pro Leu Gly Val Asp Val Gln Arg Gly Ile Gly Thr Ala Tyr
1085 1090 1095
Lys Gly His Val Lys Val Pro Lys Pro Thr Gly Val Lys Lys Gly
1100 1105 1110
Trp Gln Arg Ala Tyr Ala Val Val Cys Glu Cys Lys Leu Phe Leu
1115 1120 1125
Tyr Asp Leu Pro Glu Gly Lys Ser Thr Gln Pro Gly Val Ile Ala
1130 1135 1140
Ser Gln Val Leu Asp Leu Arg Asp Asp Glu Phe Ser Val Ser Ser
1145 1150 1155
Val Leu Ala Ser Asp Val Ile His Ala Thr Arg Arg Asp Ile Pro
1160 1165 1170
Cys Ile Phe Arg Val Thr Ala Ser Leu Leu Gly Ala Pro Ser Lys
1175 1180 1185
Thr Ser Ser Leu Leu Ile Leu Thr Glu Asn Glu Asn Glu Lys Arg
13
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
1190 1195 1200
Lys Trp Val G1y Ile Leu Glu Gly Leu Gln Ser Ile Leu His Lys
1205 1210 1215
Asn Arg Leu Arg Asn Gln Val Val His Val Pro Leu Glu Ala Tyr
1220 1225 1230
Asp Ser Ser Leu Pro Leu Ile Lys Ala I1e Leu Thr Ala A1a Ile
1235 1240 1245
Val Asp Ala Asp Arg Ile Ala Val Gly Leu Glu Glu Gly Leu Tyr
1250 1255 1260
Val Ile Glu Val Thr Arg Asp Val Ile Val Arg Ala Ala Asp Cys
1265 1270 1275
Lys Lys Val His Gln Ile Glu Leu Ala Pro Arg Glu Lys Ile Val
1280 1285 ' 1290
Ile Leu Leu Cys Gly Arg Asn His His Val His Leu Tyr Pro Trp
1295 1300 1305
Ser Ser Leu Asp Gly Ala Glu Gly Ser Phe Asp Ile Lys Leu Pro
1310 1315 1320
Glu Thr Lys Gly Cys Gln Leu Met A1a Thr Ala Thr Leu Lys Arg
1325 1330 1335
Asn Ser Gly Thr Cys Leu Phe Val Ala Val Lys Arg Leu Ile Leu
1340 1345 1350
Cys Tyr Glu Ile Gln Arg Thr Lys Pro Phe His Arg Lys Phe Asn
1355 1360 1365
Glu Ile Val Ala Pro Gly Ser Val Gln Cys Leu Ala Val Leu Arg
1370 1375 1380
Asp Arg Leu Cys Val Gly Tyr Pro Ser Gly Phe Cys Leu Leu Ser
1385 1390 1395
Ile Gln Gly Asp Gly Gln Pro Leu Asn Leu Val Asn Pro Asn Asp
1400 1405 1410
Pro Ser Leu Ala Phe Leu Ser Gln Gln Ser Phe Asp Ala Leu Cys
1415 1420 1425
Ala Val Glu Leu Glu Ser Glu Glu Tyr Leu Leu Cys Phe Ser His
1430 1435 1440
Met Gly Leu Tyr Val Asp Pro Gln Gly Arg Arg Ala Arg Ala Gln
1445 1450 1455
Glu Leu Met Trp Pro Ala Ala Pro Val Ala Cys Ser Cys Ser Pro
1460 1465 1470
Thr His Val Thr Val Tyr Ser G1u Tyr Gly Val Asp Val Phe Asp
1475 1480 1485
14
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
Val Arg Thr Met Glu Trp Val Gln Thr Ile Gly Leu Arg Arg Ile
1490 1495 1500
Arg Pro Leu Asn Ser Glu Gly Thr Leu Asn Leu Leu Asn Cys Glu
1505 1510 1515
Pro Pro Arg Leu Ile Tyr Phe Lys Ser Lys Phe Ser Gly Ala Val
1520 1525 1530
Leu Asn Val Pro Asp Thr Ser Asp Asn Ser Lys Lys Gln Met Leu
1535 1540 1545
Arg Thr Arg Ser Lys Arg Arg Phe Val Phe Lys Val Pro Glu G1u
1550 1555 1560
Glu Arg Leu Gln Gln Arg Arg Glu Met Leu Arg Asp Pro Glu Leu
1565 1570 1575
Arg Ser Lys Met Ile Ser Asn Pro Thr Asn Phe Asn His Val Ala
1580 1585 1590
His Met Gly Pro Gly Asp Gly Met Gln Val Leu Met Asp Leu Pro
1595 1600 1605
Leu Ser Ala Val Pro Pro Ser Gln Glu Glu Arg Pro Gly Pro Ala
1610 1615 1620
Pro Thr Asn Leu Ala Arg G1n Pro Pro Ser Arg Asn Lys Pro Tyr
1625 1630 1635
Ile Ser Trp Pro Ser Ser Gly Gly Ser Glu Pro Ser Val Thr Val
1640 1645 1650
Pro Leu Arg Ser Met Ser Asp Pro Asp Gln Asp Phe Asp Lys Glu
1655 1660 1665
Pro Asp Ser Asp Ser Thr Lys His Ser Thr Pro Ser Asn Ser Ser
1670 1675 1680
Asn Pro Ser Gly Pro Pro Ser Pro Asn Ser Pro His Arg Ser Gln
1685 1690 1695
Leu Pro Leu Glu Gly Leu G1u Gln Pro Ala Cys Asp Thr
1700 1705 1710
<210> 11
<211> 2287
<212> DNA
<213> Homo sapiens
<400>
11
ggctgaggcagtggctccttgcacagcagctgcacgcgccgtggctccggatcttcttcg 60
tctttgcagcgtagcccgagtcggtcagcgccagaggacctcagcagccatgtcgaagcc 120
ccatagtgaagccgggactgccttcattcagacccagcagctgcacgcagccatggctga 180
cacattcctggagcacatgtgccgcctggacattgattcaccacccatcacagcccggaa 240
cactggcatcatctgtaccattggcccagcttcccgatcagtggagacgttgaaggagat 300
gattaagtctggaatgaatgtggctcgtctgaacttctctcatggaactcatgagtacca 360
tgcggagaccatcaagaatgtgcgcacagccacggaaagctttgcttctgaccccatcct 420
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
ctaccggcccgttgctgtggctctagacactaaaggacctgagatccgaactgggctcat480
caagggcagcggcactgcagaggtggagctgaagaagggagccactctcaaaatcacgct540
ggataacgcctacatggaaaagtgtgacgagaacatcctgtggctggactacaagaacat600
ctgcaaggtggtggaagtgggcagcaagatctacgtggatgatgggcttatttctctcca660
ggtgaagcagaaaggtgccgacttcctggtgacggaggtggaaaatggtggctccttggg720
cagcaagaagggtgtgaaccttcctggggctgctgtggacttgcctgctgtgtcggagaa780
ggacatccaggatctgaagtttggggtcgagcaggatgttgatatggtgtttgcgtcatt840
catccgcaaggcatctgatgtccatgaagttaggaaggtcctgggagagaagggaaagaa900
catcaagattatcagcaaaatcgagaatcatgagggggttcggaggtttgatgaaatcct960
ggaggccagtgatgggatcatggtggctcgtggtgatctaggcattgagattcctgcaga1020
gaaggtcttccttgctcagaagatgatgattggacggtgcaaccgagctgggaagcctgt1080
catctgtgctactcagatgctggagagcatgatcaagaagccccgccccactcgggctga1140
aggcagtgatgtggccaatgcagtcctggatggagccgactgcatcatgctgtctggaga1200
aacagccaaaggggactatcctctggaggctgtgcgcatgcagaacctgattgcccgtga1260
ggcagaggctgccatctaccacttgcaattatttgaggaactccgccgcctggcgcccat1320
taccagcgaccccacagaagccaccgccgtgggtgccgtggaggcctccttcaagtgctg1380
cagtggggccataatcgtcctcaccaagtctggcaggtctgctcaccaggtggccagata1440
ccgcccacgtgcccccatcattgctgtgacccggaatccccagacagctcgtcaggccca1500
cctgtaccgtggcatcttccctgtgctgtgcaaggacccagtccaggaggcctgggctga1560
ggacgtggacctccgggtgaactttgccatgaatgttggcaaggcccgaggcttcttcaa1620
gaagggagatgtggtcattgtgctgaccggatggcgccctggctccggcttcaccaacac1680
catgcgtgttgttcctgtgccgtgatggaccccagagcccctcctccagcccctgtccca1740
cccccttcccccagcccatccattaggccagcaacgcttgtagaactcactctgggctgt1800
aacgtggcactggtaggttgggacaccagggaagaagatcaacgcctcactgaaacatgg1860
ctgtgtttgcagcctgctctagtgggacagcccagagcctggctgccccatcatgtggcc1920
ccacccaatcaagggaagaaggaggaatgctggactggaggcccctggagccagatggca1980
agagggtgacagcttcctttcctgtgtgtactctgtccagttcctttagaaaaaatggat2040
gcccagaggactcccaaccctggcttggggtcaagaaacagccagcaagagttaggggcc2100
ttagggcactgggctgttgttccattgaagccgactctggccctggcccttacttgcttc2160
tctagctctctaggcctctccagtttgcacctgtccccaccctccactcagctgtcctgc2220
agcaaacactccaccctccaccttccattttcccccactactgcagcacctccaggcctg2280
ttgccgc 2287
<210> 12
<211> 531
<212> PRT
<213> HomoSapiens
<400> 12
Met Ser ProHis SerGluAla GlyThrAla PheIleGln ThrGln
Lys
1 5 10 15
G1n Leu AlaAla MetAlaAsp ThrPheLeu GluHisMet CysArg
His
20 25 30
Leu Asp AspSer ProProIle ThrAlaArg AsnThrGly IleIle
Ile
35 40 45
Cys Thr GlyPro AlaSerArg SerValGlu ThrLeuLys GluMet
Ile
50 55 60
Ile Lys GlyMet AsnValAla ArgLeuAsn PheSerHis GlyThr
Ser
65 70 75 80
His Glu HisAla GluThrIle LysAsnVal ArgThrAla ThrGlu
Tyr
85 90 95
Ser Phe Ala Ser Asp Pro Ile Leu Tyr Arg Pro Val A1a Val Ala Leu
16
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
100 105 110
Asp Thr Lys Gly Pro Glu Ile Arg Thr Gly Leu Ile Lys Gly Ser Gly
115 120 125
Thr Ala Glu Val Glu Leu Lys Lys Gly Ala Thr Leu Lys Ile Thr Leu
130 135 140
Asp Asn Ala Tyr Met Glu Lys Cys Asp Glu Asn Ile Leu Trp Leu Asp
145 150 155 160
Tyr Lys Asn Ile Cys Lys Val Val Glu Val Gly Ser Lys Ile Tyr Val
165 170 175
Asp Asp Gly Leu Ile Ser Leu Gln Val Lys Gln Lys Gly Ala Asp Phe
180 185 190
Leu Va1 Thr Glu Val Glu Asn Gly Gly Ser Leu Gly Ser Lys Lys Gly
195 200 205
Val Asn Leu Pro Gly Ala Ala Val Asp Leu Pro Ala Val Ser Glu Lys
210 215 220
Asp Ile Gln Asp Leu Lys Phe Gly Val Glu Gln Asp Val Asp Met Val
225 230 235 240
Phe Ala Ser Phe Ile Arg Lys Ala Ser Asp Val His Glu Val Arg Lys
245 250 255
Val Leu Gly Glu Lys Gly Lys Asn Ile Lys Ile Ile Ser Lys Ile Glu
260 265 270
Asn His Glu Gly Val Arg Arg Phe Asp Glu Ile Leu Glu Ala Ser Asp
275 280 285
Gly Ile Met Val Ala Arg Gly Asp Leu Gly Ile Glu Ile Pro Ala Glu
290 295 300
Lys Val Phe Leu Ala Gln Lys Met Met Ile Gly Arg Cys Asn Arg Ala
305 310 315 320
Gly Lys Pro Val Ile Cys Ala Thr Gln Met Leu Glu Ser Met Ile Lys
325 330 335
Lys Pro Arg Pro Thr Arg Ala Glu Gly Ser Asp Val Ala Asn Ala Val
340 345 350
Leu Asp Gly Ala Asp Cys Ile Met Leu Ser Gly Glu Thr Ala Lys Gly
355 360 365
Asp Tyr Pro Leu Glu Ala Val Arg Met G1n Asn Leu Ile Ala Arg Glu
370 375 380
Ala Glu Ala A1a Ile Tyr His Leu Gln Leu Phe Glu Glu Leu Arg Arg
385 390 395 400
Leu Ala Pro Ile Thr Ser Asp Pro Thr Glu Ala Thr Ala Val Gly Ala
405 410 415
1~
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
Val Glu Ala Ser Phe Lys Cys Cys Ser Gly Ala Ile Ile Val Leu Thr
420 425 430
Lys Ser Gly Arg Ser Ala His Gln Val Ala Arg Tyr Arg Pro Arg Ala
435 440 445
Pro Ile Ile Ala Val Thr Arg Asn Pro Gln Thr Ala Arg Gln Ala His
450 455 460
Leu Tyr Arg Gly Ile Phe Pro Val Leu Cys Lys Asp Pro Val Gln Glu
465 470 475 480
Ala Trp Ala Glu Asp Val Asp Leu Arg Val Asn Phe Ala Met Asn Val
485 490 495
Gly Lys Ala Arg Gly Phe Phe Lys Lys Gly Asp Val Val I1e Val Leu
500 505 510
Thr Gly Trp Arg Pro Gly Ser Gly Phe Thr Asn Thr Met Arg Val Val
5l5 520 525
Pro Val Pro
530
<210> 13
<211> 4364
<212> DNA
<213> Homo Sapiens
<400>
13
cattagatctttacatgaaagtaaaatttataagatttctagaaagtcaaaagatgataa60
ctatttcttaggatactaaaagcactcacattatagaaaaaaaatcagttaactatactc120
cacaaacattaaaggctccctataaaaaaacatttttaataggcaagccacagaaagggc180
aaatattaatagtttgcaatacatatgtatgaaaaggaattgaatctagaatatttaaca240
aagctttacaactcaaaaaatacaaagaaaatatttttcttccaattggcaaattactta300
aacagaaccttcacaaaagaagataagaatgtttaataaacatttgaagccataataatg360
acatcattagccatgatggaaatgcaaatttaagtaccacttcacatccacaagaaaaag420
ataaaaataaaaggactgagctcaccaaacattggtgaggatgtggtaatactgaaattc480
ttgtaccgtgctcctgagggtataacatattacaggatttttttgaaaactagtggttcc540
ttataaacttaatgccctggcaacctcacacctatttacttaagaatgaaagggccccgc600
cctcctccctcctcgctcgcgggccgggcccggcatggtgcggcgtcgccgccgatggcg660
ctgaggcggagcatggggcggccggggctcccgccgctgccgctgccgccgccaccgcgg720
ctcgggctgctgctggcggagtccgccgccgcaggtctgaagctcatgggagccccggtg780
aagctgacagtgtctcaggggcagccggtgaagctcaactgcagtgtggaggggatggag840
gagcctgacatccagtgggtgaaggatggggctgtggtccagaacttggaccagttgtac900
atcccagtcagcgagcagcactggatcggcttcctcagcctgaagtcagtggagcgctct960
gacgccggccggtactggtgccaggtggaggatgggggtgaaaccgagatctcccagcca1020
gtgtggctcacggtagaaggtgtgccatttttcacagtggagccaaaagatctggcagtg1080
ccacccaatgcccctttccaactgtcttgtgaggctgtgggtccccctgaacctgttacc1140
attgtctggtggagaggaactacgaagatcgggggacccgctccctctccatctgtttta1200
aatgtaacaggggtgacccagagcaccatgttttcctgtgaagctcacaacctaaaaggc1260
ctggcctcttctcgcacagccactgttcaccttcaagcactgcctgcagcccccttcaac1320
atcaccgtgacaaagctttccagcagcaacgctagtgtggcctggatgccaggtgctgat1380
ggccgagctctgctacagtcctgtacagttcaggtgacacaggccccaggaggctgggaa1440
gtcctggctgttgtggtccctgtgcccccctttacctgcctgctccgggacctggtgcct1500
gccaccaactacagcctcagggtgcgctgtgccaatgccttggggccctctccctatgct1560
gactgggtgccctttcagaccaagggtctagccccagccagcgctccccaaaacctccat1620
gccatccgcacagattcaggcctcatcttggagtgggaagaagtgatccccgaggcccct1680
ttggaaggccccctgggaccctacaaactgtcctgggttcaagacaatggaacccaggat1740
18
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
gacag tggaggggaccagggccaatttgacaggctgggatccccaaaaggacctg1800
gagct
. tgtgcgtctccaatgcagttggctgtggaccctggagtcagccactggtg1860
atcgtacgtg
gtctcttctcatgaccgtgcaggccagcagggccctcctcacagccgcacatcctgggta1920
cctgtggtccttggtgtgctaacggccctggtgacggctgctgccctggccctcatcctg1980
cttcgaaagagacggaaagagacgcggtttgggcaagcctttgacagtgtcatggcccgg2040
ggagagccagccgttcacttccgggcagcccggtccttcaatcgagaaaggcccgagcgc2100
atcgaggccacattggacagcttgggcatcagcgatgaactaaaggaaaaactggaggat2160
gtgctcatcccagagcagcagttcaccctgggccggatgttgggcaaaggagagtttggt2220
tcagtgcgggaggcccagctgaagcaagaggatggctcctttgtgaaagtggctgtgaag2280
atgctgaaagctgacatcattgcctcaagcgacattgaagagttcctcagggaagcagct2340
tgcatgaaggagtttgaccatccacacgtggccaaacttgttggggtaagcctccggagc2400
agggctaaaggccgtctccccatccccatggtcatcttgcccttcatgaagcatggggac2460
ctgcatgccttcctgctcgcctcccggattggggagaacccctttaacctacccctccag2520
accctgatccggttcatggtggacattgcctgcggcatggagtacctgagctctcggaac2580
ttcatccaccgagacctggctgctcggaattgcatgctggcagaggacatgacagtgtgt2640
gtggctgacttcggactctcccggaagatctacagtggggactactatcgtcaaggctgt2700
gcctccaaactgcctgtcaagtggctggccctggagagcctggccgacaacctgtatact2760
gtgcagagtgacgtgtgggcgttcggggtgaccatgtgggagatcatgacacgtgggcag2820
acgccatatgctggcatcgaaaacgctgagatttacaactacctcattggcgggaaccgc2880
ctgaaacagcctccggagtgtatggaggacgtgtatgatctcatgtaccagtgctggagt2940
gctgaccccaagcagcgcccgagctttacttgtctgcgaatggaactggagaacatcttg3000
ggccagctgtctgtgctatctgccagccaggaccccttatacatcaacatcgagagagct3060
gaggagcccactgtgggaggcagcctggagctacctggcagggatcagccctacagtggg3120
gctggggatggcagtggcatgggggcagtgggtggcactcccagtgactgtcggtacata3180
ctcacccccggagggctggctgagcagccagggcaggcagagcaccagccagagagtccc3240
ctcaatgagacacagaggcttttgctgctgcagcaagggctactgccacacagtagctgt3300
tagcccacaggcagagggcatcggggccatttggccggctctggtggccactgagctggc3360
tgactaagccccgtctgaccccagcccagacagcaaggtgtggaggctcctgtggtagtc3420
ctcccaagctgtgctgggaagcccggactgaccaaatcacccaatcccagttcttcctgc3480
aaccactctgtggccagcctggcatcagtttaggccttggcttgatggaagtgggccagt3540
cctggttgtctgaacccaggcagctggcaggagtggggtggttatgtttccatggttacc3600
atgggtgtggatggcagtgtggggagggcaggtccagctctgtgggccctaccctcctgc3660
tgagctgcccctgctgcttaagtgcatgcattgagctgcctccagcctggtggcccagct3720
attaccacacttggggtttaaatatccaggtgtgcccctccaagtcagaaagagatgtcc3780
ttgtaatattcccttttaggtgagggttggtaaggggttggtatctcaggtctgaatctt3840
caccatctttctgattccgcaccctgcctacgccaggagaagttgaggggagcatgcttc3900
cctgcagctgaccgggtcacacaaaggcatgctggagtacccagcctatcaggtgcccct3960
cttccaaaggcagcgtgccgagccagcaagaggaaggggtgctgtgaggcttgcccagga4020
gcaagtgaggccggagaggagttcaggaacccttctccatacccacaatctgagcacgct4080
accaaatctcaaaatatcctaagactaacaaaggcagctgtgtctgagcccaacccttct4140
aaacggtgacctttagtgccaacttcccctctaactggacagcctcttctgtcccaagtc4200
tccagagagaaatcaggcctgatgagggggaattcctggaacctggaccccagccttggt4260
gggggagcctctggaatgcatggggcgggtcctagctgttagggacatttccaagctgtt4320
agttgctgtttaaaatagaaataaaattgaagactaaagaccta 4364
<210> 14
<211> 882
<212> PRT
<213> Homo Sapiens
<400> 14
Met A1a Leu Arg Arg Ser Met Gly Arg Pro Gly Leu Pro Pro Leu Pro
1 5 10 15
Leu Pro Pro Pro Pro Arg Leu Gly Leu Leu Leu Ala Glu Ser Ala Ala
20 25 30
Ala Gly Leu Lys Leu Met Gly Ala Pro Val Lys Leu Thr Val Ser Gln
19
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
35 40 45
Gly Gln Pro Val Lys Leu Asn Cys Ser Val Glu Gly Met Glu Glu Pro
50 55 60
Asp Ile Gln Trp Val Lys Asp Gly Ala Val Val Gln Asn Leu Asp Gln
65 70 75 80
Leu Tyr Ile Pro Val Ser Glu Gln His Trp Ile Gly Phe Leu Ser Leu
85 90 95
Lys Ser Val Glu Arg Ser Asp Ala Gly Arg Tyr Trp Cys Gln Val Glu
100 105 110
Asp Gly Gly Glu Thr Glu Ile Ser Gln Pro Val Trp Leu Thr Val Glu
115 120 125
G1y Val Pro Phe Phe Thr Val Glu Pro Lys Asp Leu Ala Val Pro Pro
130 135 140
Asn Ala Pro Phe Gln Leu Ser Cys Glu Ala Val Gly Pro Pro Glu Pro
145 150 155 160
Val Thr Ile Val Trp Trp Arg Gly Thr Thr Lys Ile Gly Gly Pro Ala
165 170 175
Pro Ser Pro Ser Val Leu Asn Val Thr Gly Val Thr Gln Ser Thr Met
180 185 190
Phe Ser Cys Glu Ala His Asn Leu Lys Gly Leu Ala Ser Ser Arg Thr
195 200 205
Ala Thr Val His Leu Gln Ala Leu Pro Ala Ala Pro Phe Asn Ile Thr
210 215 220
Val Thr Lys Leu Sex Ser Ser Asn Ala Ser Val Ala Trp Met Pro Gly
225 230 235 240
Ala Asp Gly Arg Ala Leu Leu Gln Ser Cys Thr Val Gln Val Thr Gln
245 250 255
Ala Pro Gly G1y Trp Glu Val Leu Ala Val Val Val Pro Val Pro Pro
260 265 270
Phe Thr Cys Leu Leu Arg Asp Leu Val Pro Ala Thr Asn Tyr Ser Leu
275 280 285
Arg Val Arg Cys Ala Asn Ala Leu Gly Pro Ser Pro Tyr Ala Asp Trp
290 295 300
Val Pro Phe Gln Thr Lys Gly Leu Ala Pro Ala Ser Ala Pro Gln Asn
305 310 315 320
Leu His Ala Ile Arg Thr Asp Ser Gly Leu I1e Leu Glu Trp Glu Glu
325 330 335
Val Ile Pro Glu Ala Pro Leu Glu Gly Pro Leu Gly Pro Tyr Lys Leu
340 345 350
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
Ser Trp Val Gln Asp Asn Gly Thr Gln Asp Glu Leu Thr Val Glu Gly
355 360 365
Thr Arg Ala Asn Leu Thr Gly Txp Asp Pro Gln Lys Asp Leu Ile Val
370 375 380
Arg Val Cys Val Ser Asn Ala Val Gly Cys Gly Pro Trp Ser Gln Pro
385 390 395 400
Leu Val Val Ser Ser His Asp Arg Ala Gly Gln Gln Gly Pro Pro His
405 410 415
Ser Arg Thr Ser Trp Val Pro Val Val Leu Gly Val Leu Thr Ala Leu
420 425 430
Val Thr Ala Ala Ala Leu Ala Leu I1e Leu Leu Arg Lys Arg Arg Lys
435 440 445
Glu Thr Arg Phe Gly Gln Ala Phe Asp Ser Val Met Ala Arg Gly Glu
450 455 460
Pro Ala Val His Phe Arg Ala Ala Arg Ser Phe Asn Arg Glu Arg Pro
465 470 475 480
Glu Arg Ile Glu Ala Thr Leu Asp Ser Leu Gly Ile Ser Asp Glu Leu
485 490 495
Lys Glu Lys Leu Glu Asp Val Leu Ile Pro Glu Gln Gln Phe Thr Leu
500 505 510
Gly Arg Met Leu Gly Lys Gly Glu Phe Gly Ser Va1 Arg Glu Ala Gln
515 520 525
Leu Lys Gln Glu Asp Gly Ser Phe Val Lys Val Ala Val Lys Met Leu
530 535 540
Lys Ala Asp Ile Ile Ala Ser Ser Asp Ile Glu Glu Phe Leu Arg Glu
545 550 555 560
Ala Ala Cys Met Lys Glu Phe Asp His Pro His Val Ala Lys Leu Val
565 570 575
Gly Val Ser Leu Arg Ser Arg Ala Lys G1y Arg Leu Pro Ile Pro Met
580 585 590
Va1 Ile Leu Pro Phe Met Lys His Gly Asp Leu His Ala Phe Leu Leu
595 600 605
Ala Ser Arg Ile Gly Glu Asn Pro Phe Asn Leu Pro Leu Gln Thr Leu
610 615 620
Ile Arg Phe Met Val Asp Ile Ala Cys Gly Met Glu Tyr Leu Ser Ser
625 630 635 640
Arg Asn Phe Ile His Arg Asp Leu Ala Ala Arg Asn Cys Met Leu Ala
645 650 655
Glu Asp Met Thr Val Cys Val Ala Asp Phe Gly Leu Ser Arg Lys Ile
660 665 670
21
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
Tyr Ser Gly Asp Tyr Tyr Arg Gln Gly Cys Ala Ser Lys Leu Pro Val
675 680 685
Lys Trp Leu Ala Leu Glu Ser Leu Ala Asp Asn Leu Tyr Thr Val Gln
690 695 700
Ser Asp Val Trp Ala Phe Gly Val Thr Met Trp Glu Ile Met Thr Arg
705 710 715 720
Gly Gln Thr Pro Tyr Ala Gly 21e Glu Asn Ala Glu Ile Tyr Asn Tyr
725 730 735
Leu Ile Gly Gly Asn Arg Leu Lys Gln Pro Pro Glu Cys Met Glu Asp
740 745 750
Val Tyr Asp Leu Met Tyr Gln Cys Trp Ser Ala Asp Pro Lys Gln Arg
755 760 765
Pro Ser Phe Thr Cys Leu Arg Met Glu Leu Glu Asn Ile Leu Gly G1n
770 775 780
Leu Ser Val Leu Ser Ala Ser Gln Asp Pro Leu Tyr Ile Asn 21e Glu
785 790 795 800
Arg Ala Glu Glu Pro Thr Val Gly Gly Ser Leu Glu Leu Pro Gly Arg
805 810 815
Asp Gln Pro Tyr Ser Gly Ala Gly Asp Gly Ser Gly Met Gly Ala Val
820 825 830
Gly Gly Thr Pro Ser Asp Cys Arg Tyr Ile Leu Thr Pro Gly Gly Leu
835 840 845
Ala Glu Gln Pro Gly Gln Ala G1u His Gln Pro Glu Ser Pro Leu Asn
850 855 860
Glu Thr Gln Arg Leu Leu Leu Leu Gln Gln Gly Leu Leu Pro His Ser
865 870 875 880
Ser Cys
<210>
15
<211>
1457
<212>
DNA
<213> sapiens
Homo
<400>
15
ggccgcttcgggtttccggaggggccggagggcgggcgagggcgtcacgtgcgcgccgcc 60
cgcgggccggttggtccccgggcgggggaggggccgtgcgcagcctgggtcggggtcggg 120
ccggggtcggcacctgggacatccctgagggaagggccgggagcgggagcgccccagcgg 180
ccggcgggcgggcgggcgagcggacgagcggcgcggagccggcccgaggcgcgcgccgag 240
ggagccccgtccccggtcgtgggggcaccgcccgcaggctctgcggggtgggcagctccc 300
gggcctgccatgagctctccgccgcccgcccgcagtggcttttaccgccaggaggtgacc 360
aagacggcctgggaggtgcgcgccgtgtaccgggacctgcagcccgtgggctcgggcgcc 420
tacggcgcggtgtgctcggccgtggacggccgcaccggcgctaaggtggccatcaagaag 480
ctgtatcggcccttccagtccgagctgttcgccaagcgcgcctaccgcgagctgcgcctg 540
ctcaagcacatgcgccacgagaacgtgatcgggctgctggacgtattcactcctgatgag 600
22
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
accctggatgacttcacggacttttacctggtgatgccgttcatgggcaccgacctgggc660
aagctcatgaaacatgagaagctaggcgaggaccggatccagttcctcgtgtaccagatg720
ctgaaggggctgaggtatatccacgctgccggcatcatccacagagacctgaagcccggc780
aacctggctgtgaacgaagactgtgagctgaagatcctggacttcggcctggccaggcag840
gcagacagtgagatgactgggtacgtggtgacccggtggtaccgggctcccgaggtcatc900
ttgaattggatgcgctacacgcagacggtggacatctggtccgtgggctgcatcatggcg960
gagatgatcacaggcaagacgctgttcaagggcagcgaccacctggaccagctgaaggag1020
atcatgaaggtgacggggacgcctccggctgagtttgtgcagcggctgcagagcgatgag1080
gccaagaacaacatgaagggcctccccgaattggagaagaaggattttgcctctatcctg1140
accaatgcaagccctctggctgtgaacctcctggagaagatgctggtgctggacgcggag1200
cagcgggtgacggcaggcgaggcgctggcccatccctacttcgagtccctgcacgacacg2260
gaagatgagccccaggtccagaagtatgatgactcctttgacgacgttgaccgcacactg1320
gatgaatggaagcgtgttacttacaaagaggtgctcagcttcaagcctccccggcagctg1380
ggggccagggtctccaaggagacgcctctgtgaagatctctgggctccggggtggcagtg1440
aggaccaccttcacctt 1457
<210> 16
<211> 367
<212> PRT
<213> Homo sapiens
<400> 16
Met Ser Ser Pro Pro Pro Ala Arg Ser Gly Phe Tyr Arg Gln Glu Val
1 5 10 15
Thr Lys Thr Ala Trp Glu Val Arg Ala Val Tyr Arg Asp Leu Gln Pro
20 25 30
Val Gly Ser Gly Ala Tyr Gly Ala Val Cys Ser Ala Val Asp Gly Arg
35 40 45
Thr Gly Ala Lys Val Ala Ile Lys Lys Leu Tyr Arg Pro Phe Gln Ser
50 55 60
Glu Leu Phe Ala Lys Arg Ala Tyr Arg Glu Leu Arg Leu Leu Lys His
65 70 75 80
Met Arg His Glu Asn Val Ile Gly Leu Leu Asp Val Phe Thr Pro Asp
85 90 95
Glu Thr Leu Asp Asp Phe Thr Asp Phe Tyr Leu Val Met Pro Phe Met
100 105 110
Gly Thr Asp Leu Gly Lys Leu Met Lys His Glu Lys Leu Gly Glu Asp
115 120 125
Arg Ile Gln Phe Leu Val Tyr Gln Met Leu Lys Gly Leu Arg Tyr Ile
130 135 140
His Ala Ala Gly Ile Ile His Arg Asp Leu Lys Pro Gly Asn Leu Ala
145 150 155 160
Va1 Asn Glu Asp Cys Glu Leu Lys Ile Leu Asp Phe Gly Leu Ala Arg
165 170 175
Gln Ala Asp Ser Glu Met Thr Gly Tyr Val Val Thr Arg Trp Tyr Arg
180 185 190
23
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
Ala Pro Glu Val Ile Leu Asn Trp Met Arg Tyr Thr Gln Thr Val Asp
195 200 205
Ile Trp Ser Val Gly Cys Ile Met Ala Glu Met Ile Thr Gly Lys Thr
210 215 220
Leu Phe Lys Gly Ser Asp His Leu Asp Gln Leu Lys Glu Ile Met Lys
225 230 235 240
Val Thr Gly Thr Pro Pro Ala G1u Phe Val Gln Arg Leu Gln Ser Asp
245 250 255
Glu Ala Lys Asn Asn Met Lys Gly Leu Pro Glu Leu G1u Lys Lys Asp
260 265 270
Phe Ala Ser Ile Leu Thr Asn A1a Ser Pro Leu Ala Val Asn Leu Leu
275 280 285
Glu Lys Met Leu Val Leu Asp Ala Glu Gln Arg Val Thr Ala Gly Glu
290 295 300
Ala Leu Ala His Pro Tyr Phe Glu Ser Leu His Asp Thr Glu Asp Glu
305 310 315 320
Pro Gln Val Gln Lys Tyr Asp Asp Ser Phe Asp Asp Val Asp Arg Thr
325 330 335
Leu Asp Glu Trp Lys Arg Va1 Thr Tyr Lys Glu Val Leu Ser Phe Lys
340 345 350
Pro Pro Arg Gln Leu G1y Ala Arg Val Ser Lys Glu Thr Pro Leu
355 360 365
<210> 17
<211> 5243
<212> DNA
<213> Homo Sapiens
<400>
17
cttttcttgcaggacatgttctctggatgtcagctgagtcattaaagtaactctgcatgt60
cagtagacagaccttggtagaaccacaaggctcccagagacacccatctctcctcatttt120
tttggtgtgtgtgtcttcaccgaacattcaaaactgtttctccaaagcgttttgcaaaaa180
ctcagactgttttccaaagcagaagcactggagtccccagcagaagcgatgggcagtgtg240
cgaaccaaccgctacagcatcgtctcttcagaagaagacggtatgaagttggccaccatg300
gcagttgcaaatggctttgggaacgggaagagtaaagtccacacccgacaacagtgcagg360
agccgctttgtgaagaaagatggccactgtaatgttcagttcatcaatgtgggtgagaag420
gggcaacggtacctcgcagacatcttcaccacgtgtgtggacattcgctggcggtggatg480
ctggttatcttctgcctggctttcgtcctgtcatggctgttttttggctgtgtgttttgg540
ttgatagctctgctccatggggacctggatgcatccaaagagggcaaagcttgtgtgtcc600
gaggtcaacagcttcacggctgccttcctcttctccattgagacccagacaaccataggc660
tatggtttcagatgtgtcacggatgaatgcccaattgctgttttcatggtggtgttccag720
tcaatcgtgggctgcatcatcgatgctttcatcattggcgcagtcatggccaagatggca780
aagccaaagaagagaaacgagactcttgtcttcagtcacaatgccgtgattgccatgaga840
gacggcaagctgtgtttgatgtggcgagtgggcaatcttcggaaaagccacttggtggaa900
gctcatgttcgagcacagctcctcaaatccagaattacttctgaaggggagtatatccct960
ctggatcaaatagacatcaatgttgggtttgacagtggaatcgatcgtatatttctggtg1020
tccccaatcactatagtccatgaaatagatgaagacagtcctttatatgatttgagtaaa1080
caggacattgacaacgcagactttgaaatcgtggtcatactggaaggcatggtggaagcc1140
actgccatgacgacacagtgccgtagctcttatctagcaaatgaaatcctgtggggccac1200
24
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
cgctatgagc ctgtgctctt tgaagagaag cactactaca aagtggacta ttccaggttc 1260
cacaaaactt acgaagtccc caacactccc ctttgtagtg ccagagactt agcagaaaag 1320
aaatatatcc tctcaaatgc aaattcattt tgctatgaaa atgaagttgc cctcacaagc 1380
aaagaggaag acgacagtga aaatggagtt ccagaaagca ctagtacgga cacgccccct 1440
gacatagacc ttcacaacca ggcaagtgta cctctagagc ccaggccctt acggcgagag 1500
tcggagatat gactgactga ttccttctct ggaatagtta ctttacaaca cggtctgttg 1560
gtcagaggcc caaaacagtt atacagatga cggtactggt caagatgggt caagcaagcg 1620
gccacaaggg actgaggcaa gcacaatggt ttcaaagaaa gactgtaagc tccatgatta 1680
gcataaagca ctaaccatgt ctccatgtga cccgatggca catagatgtt gtagaataag 1740
ttatgggttt ttatgttttg ttttgtgttt ttccaaaact tgaacttgca ggcaagcctt 1800
ggttgggtat ttgatttatc cagaatgctt ctctttaggg aacaaggatg tttttaatgg 1860
cataacaaag gcaagactct gccttaattt ttgaaaagct gctaactaca tgaacacaaa 1920
tgtgtatttt tgttgcagtg tagttttcct tttgtgtaat tttaaagtca gtgttgaatt 1980
ttattgaaag ctcatgatgc gcttcaaagt ggcaagtatt tggctattaa ctgccaaaac 2040
aagagcctga ttttttgagg ccagtaattc gtttgctaga attgattttt tttctctctc 2100
tctttgttac ataagggcat tatgtaacac tagccgaatg gtagcctctg ggttgttgtt 2160
tttttctttt cctccatgat gttaatgggt tatctcaaat tttaagttaa actacctaaa 2220
ataaatacca aagataatgc atatttttgc acagtggagc ttacacttaa aagaaaacaa 2280
agccccatgg gctgccttga aatcaagaga caataacttt gaacctcagc aagaccttga 2340
accgccggtt cattttgcac cttattcaga aaatagagca tcatactcac cgagtctagt 2400
cagtgtagtg cttttaaaaa ttttgtcctt tcatgtaact tttttatttt aagaggaaga 2460
agaagaaagg ggcacacaca cacaataccg acgtctatcc tttcctgcta ggcagtgctg 2520
gccaggctca tgtgtagtgt gcgagatggt gatgtactct tatatttttc tgggcttttc 2580
cttttgcaca ttccaaaatt catttcataa gacaagatct tcataggacc tccttggcat 2640
cctggcattc tcaaaactga gccatccagc atgaaagata aatgggttta aacccttgct 2700
gctgaattta ttgcctggac tgtcaggaca tcaccagccc accttcacct tagggaagat 2760
gccacacctg gcctccacac ttgctcttct gatcagtctg tctggattga gtcctacagt 2820
gtcagatagg gcggcaaatg ccaaagcagg gaaacaggga ggtgtggaca agccagtttg 2880
atgcagcact tcagatcaag tgcttaggaa ggagaggaaa cttgcctttt ttatggcaga 2940
ggatagtaat gaaaatgtct cagtatttta gggtcaatga gagccataaa aatataacat 3000
aatcacaagt aaaggagata atggtctaaa acagctattt cccttttctg tgtgcatact 3060
tatgactgaa tgtgagctaa gcattttctc ctgtggagcc ctagagcagg ttactaagga 3120
aggacacatt gttttccaga agcctcccct gcctggctga ctgccttgct agaaacataa 3180
tttttttttt ctcactgaag ctcaataatg gaactctttt tttttttttt tttaatttaa 3240
agttccctat ttgtgaattc tgggattact gacttttctt tttaattgga gtctcaaaat 3300
caactctctt atggtattat atctctgtat gccattaaaa aacagcttgt tctagaatca 3360
tgtattttgt aaactgatgt ttgtgatggt ctctggttct tgaacagcca tatctgaatg 3420
ccgtgcctgc aaaactatga caatttttgc tgttttcagc cttcagattt gatggcttgg 3480
gaaactgagg tgttattttc aatgaaacaa agaaagagat gttaagcaag tggttgtttt 3540
agatccaaat gtaaaggcag gtttgggaag gtgtttaaag agttggagga attggggatt 3600
gagttgtaaa gaaaacttac agaagaggca acaatttggt tcttgacagt gagaggatat 3660
tgagggcttc agctgctgct attatgatgt tttgcaaagg aaaataatca aaccaaagag 3720
tattcagtga tatgtaaatt aaatgaagat acagtggaga atgggggtga ccacaaaaga 3780
ggctccccct aaacacacag tgctgccact taaaaagact tgagaaattt gaaagggggt 3840
gggtatgggg ggggcaagaa agagggaggg aaatctttca acttatttct gaaaaagaga 3900
aaaaaatata aaatttctgg tgcacaggtt tgttttttca agaaaatttt gcagaagcta 3960
tgtttttaaa gtgtacattt tataaagttt atcagatatt ttcatattta aagccaaatg 4020
taaatagagg tctgtaaaga aaaataattg ccatagaaag tataatttca gtgcagtaat 4080
ttctgagagc tagtacctat atgctaccgg ttagcatggt tttagcaaat atataccagc 4140
cttataaggt tcgtattgct atgttcttct gttatttatt tcagcatgga ctgttcattt 4200
gaaacctttt tctagttatt agcgttttaa cagttacaag ctttaaatgg caattttttt 4260
tttttttttt tttttttttt tttttttgtc aagagccaag acacaggtaa tgcacgacat 4320
tgattgctgc attttacctt caaaatattt gtccttattg actgggtctc cttaattaat 4380
gtacacatgt cattagaatg cagacggagg ggactcacca tgaatatctg gggttgattc 4440
ccagatgtgt gttgcttctc tattgcaagc agattccctg ttggatttac ttcggattta 4500
ttccctttta aagaattttt gcccatatct ggaagggcac tatatttttg ggaggagcca 4560
tagattcctg gttatcctat ttttaaacaa aatgtagaca aagtgaactc tattttgatt 4620
attgagaaag gagtagtttt ctatccctct aagagtatac ttgaatcaga cattttaagg 4680
atgtcactat ggcactgttg tcatttccaa attcctagaa aagtttgttt tactttgttt 4740
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
ttattctgttaatgcattctttcttctctttacttcctttcttaccagtacactcctatc4800
tcaactctgtttatttgatgagttctgtcccgtaaatcatatttcccttacaattaataa4860
atgtcacttcatattttataataaaccactcagtaaaagcaaaagcttgtcctgagaagt4920
agagtgagttctttttcactctgtgtctaataatgttaaggtgggaaaaaaaaaagtgtg4980
gcatagctacctgcccatccccaaccctcagcaaagtagaatctcttttctggtaatttt5040
gggtttccgctctgggctctggcaagttgaacaatcctagccattgacaatcgtgatagt5100
tattattttcccatttgctgtctttttgtatctaaagtcttcctattgtactgcacaaac5160
catggattgtacatatttttatatattatgtcttattttattatttctaaataaaaaaat5220
taaaaattgaaaacaaattcttg 5243
<210> 18
<211> 427
<212> PRT
<213> Homo Sapiens
<400> 18
Met Gly Ser Val Arg Thr Asn Arg Tyr Ser Ile Val Ser Ser Glu Glu
1 5 10 15
Asp Gly Met Lys Leu Ala Thr Met Ala Val Ala Asn Gly Phe Gly Asn
20 25 30
Gly Lys Ser Lys Val His Thr Arg Gln Gln Cys Arg Ser Arg Phe Val
35 40 45
Lys Lys Asp Gly His Cys Asn Val Gln Phe Ile Asn Val Gly Glu Lys
50 55 60
Gly Gln Arg Tyr Leu Ala Asp Ile Phe Thr Thr Cys Val Asp Ile Arg
65 70 75 80
Trp Arg Trp Met Leu Val I1e Phe Cys Leu Ala Phe Val Leu Ser Trp
85 90 95
Leu Phe Phe Gly Cys Val Phe Trp Leu Ile Ala Leu Leu His Gly Asp
100 105 110
Leu Asp Ala Ser Lys Glu Gly Lys Ala Cys Val Ser Glu Val Asn Ser
115 120 125
Phe Thr Ala Ala Phe Leu Phe Ser Ile Glu Thr Gln Thr Thr Ile Gly
130 135 140
Tyr Gly Phe Arg Cys Val Thr Asp Glu Cys Pro Ile Ala Val Phe Met
145 150 155 160
Val Val Phe Gln Ser Ile Val Gly Cys Ile Ile Asp Ala Phe Ile Ile
165 170 175
Gly Ala Val Met Ala Lys Met Ala Lys Pro Lys Lys Arg Asn Glu Thr
180 185 190
Leu Val Phe Ser His Asn Ala Val Ile Ala Met Arg Asp Gly Lys Leu
195 200 205
Cys Leu Met Trp Arg Val Gly Asn Leu Arg Lys Ser His Leu Val Glu
210 215 220
26
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
Ala His Val Arg Ala Gln Leu Leu Lys Ser Arg Ile Thr Ser Glu Gly
225 230 235 240
Glu Tyr Ile Pro Leu Asp Gln Ile Asp Ile Asn Val Gly Phe Asp Ser
245 250 255
Gly Ile Asp Arg Ile Phe Leu Val Ser Pro Ile Thr Ile Val His Glu
260 265 270
Ile Asp Glu Asp Ser Pro Leu Tyr Asp Leu Ser Lys Gln Asp Ile Asp
275 280 285
Asn Ala Asp Phe Glu Ile Val Val Ile Leu Glu Gly Met Val Glu Ala
290 295 300
Thr Ala Met Thr Thr Gln Cys Arg Ser Ser Tyr Leu Ala Asn Glu Ile
305 310 315 320
Leu Trp Gly His Arg Tyr Glu Pro Val Leu Phe Glu Glu Lys His Tyr
325 330 335
Tyr Lys Val Asp Tyr Ser Arg Phe His Lys Thr Tyr Glu Val Pro Asn
340 345 350
Thr Pro Leu Cys Ser Ala Arg Asp Leu Ala Glu Lys Lys Tyr Ile Leu
355 360 365
Ser Asn Ala Asn Ser Phe Cys Tyr Glu Asn Glu Val Ala Leu Thr Ser
370 375 380
Lys Glu Glu Asp Asp Ser Glu Asn Gly Val Pro Glu Ser Thr Ser Thr
385 390 395 400
Asp Thr Pro Pro Asp Ile Asp Leu His Asn Gln Ala Ser Val Pro Leu
405 410 415
Glu Pro Arg Pro Leu Arg Arg Glu Ser Glu Ile
420 425
<210> 19
<211> 1050
<212> DNA
<213> Homo Sapiens
<400>
19
tttatattttttcagtgtccatatttcaaaaatttatttatctcaaactgtgcataatgg60
agtaaaaacttaagttgaaaatgtacctgttataaggatgatattagttcaaatatatac120
atggattctcggcagactgattcaaataatacagagccgaatcttttaaaatacaactac180
ggaaaataaaggggggaaaaccttaaaatatcacaataaatttacagaaatattacaaac240
cataagaaaatatttcaaacacagtaatttcatggttttttttatctgaacaaaatggaa300
agttgggatcgaacaaaagctattataaattaccaacggtgtcaacctgcatggccattt360
ttgcttttaacagtaagttataaaatttagtacagtctaaaacttttgccctttttaaac420
aagaccacagagatggttcgccagtacttattctaattttttccttttgtacaattttta480
aacaattaaaatgtccaaatttgaataattttcttcttttcacgtttgcaactgtcctaa540
atttcagctgcagaatcaaaattcagcaagaagcctctccttgaaaaatattggcaaatt600
ctcagcttataaacaatggacattttgattgccatgtttatctcgataaatactgtacaa660
aagttgcttgcaaatattaaaacatttttttcgtcgcttggagactagctctaaatatta720
ttggtaaagacttttgcaaacttcctgcaaagctcctaccgtaccactagaacttttaaa780
aagtttttcgtagctttctttcctccagatctatacaaggtccattcccccgccctcccc840
27
CA 02425643 2003-04-11
WO 02/31198 PCT/USO1/31607
accctcccca ggttttctct gtacaaaaat agtcccccaa aaagaagtcc aggatctctc 900
tcataaaagt tttcttgtcg gcatcgcggt ttttgcgtga gtgtggatgg gattggtgtt 960
ctcttttgca gctgtcattt gctgtgggtg atgggatttt tttttttcct ttttcttttt 1020
gagcgtaccg ggttttctcc atgctgtttc 1050
<210> 20
<211> 88
<212> PRT
<213> Homo Sapiens
<400> 20
Met Glu Lys Thr Arg Tyr Ala Gln Lys Glu Lys Gly Lys Lys Lys Ile
1 5 10 15
Pro Ser Pro Thr Ala Asn Asp Ser Cys Lys Arg Glu His Gln Ser His
20 25 30
Pro His Ser Arg Lys Asn Arg Asp Ala Asp Lys Lys Thr Phe Met Arg
35 40 45
Glu Ile Leu Asp Phe Phe Leu Gly Asp Tyr Phe Cys Thr Glu Lys Thr
50 55 60
Trp Gly Gly Trp Gly Gly Arg Gly Asn Gly Pro Cys Ile Asp Leu Glu
65 70 75 80
Glu Arg Lys Leu Arg Lys Thr Phe
<210> 21
<211> 881
<212> DNA
<213> Homo Sapiens
<400>
21
ttttttttttttgtcaagagccaagacacaggtaatgcacgacattgattgctgcatttt 60
accttcaaaatatttgtccttattgactgggtctccttaattaatgtacacatgtcatta 120
gaatgcagacggaggggactcaccatgaatattctgggttgattcccagatgtgtgttgc 180
ttctctattgcaagcagattccctgttggatttacttcggatttattcccttttaaagaa 240
tttttgcccatatctggaagggcactatatttttgggaggagccatagattcctggttat 300
cctatttttaaacaaaatgtagacaaagtgaactctattttgattattgagaaaggagta 360
gttttctatccctctaagagtatacttgaatcagacattttaaggatgtcactatggcac 420
tgttgtcatttccaaattcctagaaaagtttgttttactttgtttttattctgttaatgc 480
attctttcttctctttacttcctttcttaccagtacactcctatctcaactctgtttatt 540
tgatgagttctgtcccgtaaatcatatttcccttacaattaataaatgtcacttcatatt 600
ttataataaaccactcagtaaaagcaaaagcttgtcctgagaagtactctgtgtctaata 660
atgttaagggcatagctacctgcccatccccaaccctcagcaaagtagaatctcttttct 720
ggtaattttgggtttccgctctgggotctggcaagttgaacaatcctagccattgacaat 780
cgtgatagttattattttcccatttgctgtctttttgtatctaaagtcttcctattgtac 840
tgcacaaaccatggattgtacatatttttatatattatgtc 881
28
