Note: Descriptions are shown in the official language in which they were submitted.
CA 02426582 2003-04-17
WO 02/061040 PCT/USO1/51307
1
DESCRIPTION
Gene Delivery Formulations and Methods for Treatment of Ischemic Conditions
Background Of The Invention
Field Of Invention
This invention relates to stimulating angiogenesis through the delivery and
expression of nucleic acids encoding angiogenic factors. In particular, the
formulations
and methods have applicability to the amelioration of ischemic conditions in
peripheral
vascular and coronary artery disease. Priority is claimed based on United
States
Provisional Application Serial No. 60/242,277, filed October 20, 2000, and
United States
Provisional Application Serial No. 60/294,454, filed May 29, 2001.
Description of Related Art
Ischemia is a medical term describing a shortage of blood supply to an organ
or
tissue of the body. Ischemia typically results from narrowing or obstruction
in the arteries
that supply oxygen-rich blood to the tissues. Severe and prolonged ischemia
leads to
death of the affected tissue (infarction).
Coronary artery disease (CAD) refers to diseases of the blood vessels
supplying
oxygenated blood to the musculature of the heart (myocardium) resulting in
cardiac
ischemia. Narrowing or occlusion of one or more of the coronary arteries
results in
cardiac ischemia. Transient ischemia resulting from a failure of the blood
supply to meet
demands placed on the heart by increased physical activity or other stress
results in angina
or chest pain. Severe or total obstruction of blood flow may result in death
of heart
muscle commonly referred to as a myocardial infarction (heart attack). Heart
disease is
the leading cause of death in the United States. Cardiac ischemia is currently
treated
through the use of medication and physical conditioning to reduce the heart's
oxygen
demands or with drugs, angioplasty or bypass surgery to improve blood flow to
the heart.
Peripheral vascular disease (PVD) refers to diseases of blood vessels outside
the
heart and brain. Narrowing of the vessels that carry blood to leg and arm
muscles is a
typical cause of PVD with single or multiple stenosis and/or occlusion of the
iliac-
femoral-popliteal arterial axis determining a reduction of the perfusion of
the muscles and
the skin of the lower limbs and thus a progressive tissue ischemia. Peripheral
artery
disease (PAD) is a condition similar to coronary artery disease and carotid
artery disease.
In PAD fatty deposits build up along artery walls and affect blood
circulation,
primarily in arteries leading to the legs and feet. Atherosclerosis is the
most common
CA 02426582 2003-04-17
WO 02/061040 PCT/USO1/51307
2
cause of chronic arterial occlusive disease of the lower extremities and can
lead to clinical
conditions ranging from intermittent claudication (ischemic pain) to
ulceration and
gangrene. The arterial narrowing or obstruction that occurs as a result of the
atherosclerotic process reduces blood flow to the lower limb during exercise
or at rest. A
S spectrum of symptoms results, the severity of which depends on the extent of
the
involvement and the available collateral circulation. The superficial femoral
and popliteal
arteries are the vessels most commonly affected by the atherosclerotic
process. The distal
aorta and its bifurcation into the two iliac arteries are the next most
frequent sites of
involvement.
Peripheral Arterial Disease (PAD) accounts for a sizable portion of annual
health-
care expenditures. Furthermore, beyond the actual health-care dollars spent,
PAD is a
major cause of disability, loss of work/wages, and lifestyle limitations
(Rosenfield, K., and
Isner, JM. (1998). In: Comprehensive Cardiology Medicine. J. Topol, ed.
Lippincott-
Raven Publishers, Philadelphia 3109-3134.) It has been estimated that PAD
affects 1 in
1 S 20 people over the age of 50 or 8 million people in the United States,
being more
commonly diagnosed in men than in women (Creager, MA. (2001) Cardiol Rev. 9,
238-
245)
Treatments for PVD include nonsurgical measures such as exercise, risk factor
modification, and pharmacological therapy, as well as surgical treatment,
which includes
interventional radiological procedures such as angioplasty or stmt insertion
and surgical
treatment such as endarterectomy, bypass grafting, and amputation. Angioplasty
involves
passage of a catheter with a deflated balloon on its tip into the narrowed
artery segment,
inflation of the balloon, and widening of the narrowed segment. However, no
effective
pharmacological treatment is available for vascularisation defects in the
lower limbs.
Many patients presenting with persistant ischaemic ulcers are not suitable for
surgical or
endovascular approaches.
In response to insufficiency of perfusion of the heart in CVD, the vascular
bed may
develop additional blood vessels, called collaterals that serve to route blood
around areas
of coronary narrowing and thus perfuse the myocardium. In the treatment of
myocardial
and peripheral ischemia, the induction of angiogenesis or new blood vessel
growth would
be expected to increase perfusion of ischemic tissues.
Studies have recently established the feasibility of using recombinant
angiogenic
growth factors, such as fibroblast growth factor (FGF) family (Yanagisawa-
Miwa, et al.,
Science, 257:1401-1403 (1992) and Baffour, et al., J Yasc Surg, 16:181-91
(1992)),
endothelial cell growth factor (ECGF)(Pu, et al., J Surg Res, 54:575-83
(1993)), vascular
endothelial growth factor (VEGF) (Takeshita, et al., Circulation, 90:228-234
(1994) and
CA 02426582 2003-04-17
WO 02/061040 PCT/USO1/51307
3
Takeshita, et al., J Clin Invest, 93:662-70 (1994)) and angiopoietin-1 in
combination with
VEGF (Chae, J.K. et al. Artherioscler Thromb Yasc Biol. December 2000) to
encourage
collateral artery development in animal models of myocardial and hindlimb
ischemia.
Repeated infra-muscular administration of growth factor was required to
maintain an
optimally high and local concentration. The requirement for repeated
administration is a
major limitation of recombinant protein therapy. Repeated administration of
recombinant
proteins produces spikes of protein concentration with only intermittent
concentrations in
the therapeutic range. Recent results from phase II trials of recombinant
VEGF~65 and
bFGF proteins in patients with myocardial ischemia have been either negative
at 3 months
or equivocal at 1 year suggesting that the short tissue residence time
obtained with
recombinant protein therapy is insufficient to obtain the desired therapeutic
effect.
(Chiron Corp. Press Release 3/12/2000; http://www.prnewswire.com/CHIR; Henry,
TD.
et al. (1998) J. Am. Coll. Cardiol. 31, 65A.)
Gene therapy has recently provided the pharmacological arts with the ability
to
deliver functional recombinant genes carried in expression constructs capable
of mediating
expression of these genes in host cells in vivo. Instead of delivering
purified or
recombinant proteins to a patient, delivery of genes in the context of
expression control
elements permits the local production of proteins by the patient. Production
of proteins in
vivo by the patient emulates natural expression and can result in prolonged
local
production of desired proteins in therapeutic concentration from a single
administration.
Arterial gene transfer constitutes an alternative strategy for accomplishing
therapeutic angiogenesis in patient with limb ischemia (Kanno, S. et al.
(1999).
Circulation 99, 2682-2687; Liau, G. et al. (2001) Drug Disc Today 1, 689-697;
Rissanen,
TT. et al. (2001) Eur. J. Clin. Invest. 31, 651-666). The potential
requirement to maintain
a suitably high and local concentration over a period of days or weeks
constitutes and
advantage for gene transfer versus recombinant protein therapy (Isner JM. and
Asahara T.
(1999) J. Clin. Invest. 103,1231'-1236. Various angioigenic approaches of this
nature are
already being investigated in clinical trials (Carmeliet, P. and Jain, RK.
(2000). Nature
407; 249-257).
Delivery of angiogenic factors as a gene therapy offers the potential for
enhanced
efficacy, less frequent dosing, and reduced systemic toxicity versus therapy
with the
recombinant protein. However, effective gene therapy requires identification
of proteins
with a desired therapeutic profile, the generation of expression vectors able
to control
production of genes encoding the desired protein, and efficient localized
delivery of the
expression vector to cells able to express the desired protein without causing
local tissue
destruction or systemic reaction.
CA 02426582 2003-04-17
WO 02/061040 PCT/USO1/51307
4
A gene therapy for PVD by delivery of DNA encoding vascular endothelial growth
factor (VEGF) for the promotion of angiogenesis has been tested in a human
clinical trial.
However, lower-extremity edema was observed in 31 of 90 (34%) patients treated
indicating that VEGF expression may have the undesirable side effect of
increased
vascular permeability. (Baumgartner et al. Ann Intern Med (2000) 132(11):880-
4).
Recent reports have described an increase in blood flow in infarcted
myocardium by the
overexpression of hepatocyte growth factor (HGF) from a gene delivered using
hemagglutinating virus of Japan (I-IVJ)-coated liposomes delivered by direct
injection into
the myocardium, direct infusion into a coronary artery as well as incubation
within the
pericardium. (Aoki et al. Gene Therapy 7 (5), 417-427, 2000.)
Delivery methods or vehicles that can deliver genes efficiently without
concomitant tissue injury is critical to effective gene therapy. Delivery of
genes to the
vascular tissue in vivo using viral vectors, including through the use of
poloxamer gel
formulation to restrict movement of the viral formulation from the site of
administration,
has been described. (Feldman et al. Gene Therapy (1997) 4, 189-198; Van Belle
et al.
Human Gene Therapy (1998) 9, 1013-1024; Hammond et al., US Patent No.
6,100,242).
Delivery of non-viral naked DNA to the heart using direct injection was
described by
Wolff et al., US Patent No. 5,693,622. Leiden et al described delivery of
genes to the
heart using direct injection in US Patent No. 5,661,133. Viral delivery to the
myocardium
using selective pressure regulated retroinfusion of coronary veins has also
been described.
Boekstaegers et al. Gene Therapy (2000) 7, 232-240. However, viral vectors
suffer from
several critical disadvantages. Viral vectors must be grown in mammalian
culture and
may be contaminated with other viruses originating from the host cells or
required media
components such as calf serum. Viral vectors necessarily involve the
introduction of
foreign viral proteins. Administration of such vectors in vivo can result in
profound
immune responses in the host.
The field of angiogenic growth factor therapy for patients with advanced
ischemic
heart disease has progressed rapidly over the last five years. (Simons et al.
Circulation
(2000) 102:e73-e86). Despite recent advances in therapeutic modalities for
treatment of
ischemia, there remains a further need for the identification of a protein
that can be
administered as a gene that is able to promote collateral vessel growth in
ischemic tissue in
mammals without undesirable side effects. Further, delivery methods and
formulations
are needed that can deliver such genes to ischemic tissue with increased
efficiency but
without immediate local or systemic toxicity or the generation of pathologic
immune
responses.
CA 02426582 2003-04-17
WO 02/061040 PCT/USO1/51307
Summary Of The Invention
The present inventors have developed a novel approach for efficient delivery
of
angiogenic factors to the cardiac and peripheral vasculature that avoids
problems with
toxicity inherent to existing delivery technologies.
In one embodiment, a polymeric gene delivery system provides protection of the
angiogenic factor expression plasmid from degradation by extracellular
nucleases and
facilitates its uptake by skeletal and cardiac myofibers within the delivery
region.
In one embodiment, a formulated expression system for efficient delivery of a
gene
encoding the novel angiogenic factor Developmental Endothelial Locus (Del-1)
protein is
provided.
In one embodiment of the invention, a formulated DEL-1 encoding plasmid DNA
is provided that enables sustained, local expression of Del-1 in a manner that
more closely
mimics the autocrine/paracrine modes of action associated with endogenous Del-
1. Local
delivery can reduce systemic exposure and potential toxicities associated with
systemic
administration.
In one embodiment a non-viral plasmid-based Del-1 gene formulation is
disclosed
that provides for localized treatment of ischemia in a peripheral limb, in
cardiac muscle, in
the kidney associated with renal vascular disease, ischemia associated with
cerebral
vascular disease, wound healing, non-union fractures associated with ischemia
and
avascular necrosis of the femoral head. The Del-1 gene is administered by
intramuscular
injection, intravascular, intracapsular into the joint, or by retrograde
venous perfusion. In
one embodiment the retrograde venous perfusion is of a limb, kidney, liver,
brain, or heart.
In one embodiment, the formulated Del-1 expression system is comprised of a
plasmid expression system formulated with a poloxamer polymeric gene delivery
system.
The plasmid expression system contains an eukaryotic expression cassette
encoding the
full length human Developmental Endothelial Locus (Del) 1 protein.
In one embodiment, the formulated Del-1 expression system is provided as a
single
vial formulation that is stable at 2-8° C. Treatment of the ischemic
tissue with the
formulated Del-1 expression system can be repeated if necessary.
Del-1 is a ligand for the alpha-v-beta-3 (avb3) integrin receptor. Thus, in
another
embodiment Del-1 is used in combination with another growth factor that acts
as a ligand
for a different receptor known to be important in the development of new blood
vessels.
In one embodiment, the nucleic acid encoding Del-1 is delivered in conjunction
with a
nucleic acid encoding VEGF, which is a ligand for the vascular endothelial
growth factor-
2 (VEGF-2) receptor, for the modulation of angiogenesis and vasculogenesis.
The use of
the Del-1 and VEGF genes in combination addresses several unmet medical needs
CA 02426582 2003-04-17
WO 02/061040 PCT/USO1/51307
6
including coronary artery disease, wound healing, peripheral artery disease,
and
rheumatoid arthritis.
Brief Description Of The Drawings
A better understanding of this invention can be obtained when the following
detailed description of the preferred embodiments is considered in conjunction
with the
following drawings.
Figure 1. Effect of plasmid and poloxamer 188 concentration on delivery of
expression plasmid in murine skeletal muscle.
Figure 2. Expression of luciferase in tibialis anterior muscles of rats
injected with
luciferase expression plasmids formulated with isotonic saline compared with
polymeric
delivery systems.
Figure 3a and b. Expression plasmid maps for hDel-1.
Figure 4. Expression of mDel-1 in tibialis anterior muscles of mice.
Figure 5. Effects of Del-1 expression on capillary density in normoxic mouse
skeletal muscle.
Figure 6. Correlation of CD31 expression with expression of mDel-1 in normoxic
tibialis anterior muscles of CD1 mice injected with different doses
offormulated mDel-1
plasmid.
Figure 7. Effects of hDel-1 plasmid on exercise tolerance following induction
of
hindlimb ischemia following ligation of the femoral artery.
Figure 8. Effects of Del-1 and VEGF gene medicines in a rabbit model of
hindlimb ischemia.
Figure 9. Luciferase expression in murine myocardium following IM injection of
formulated pLC1088 plasmid (10 microliters).
Figure 10. Data shown represent luciferase expression in murine myocardium
following direct intramyocardial injection (10 microliters).
Figure 11a. Route of insertion of delivery catheter through the coronary sinus
as
viewed over the diaphragmatic aspect of the heart. .
Figure 11b. Placement of delivery catheter in the great cardiac vein as viewed
over the sternocostal aspect of the heart.
Figure 12. Depicts the sequence of human Del-1 (SEQ ID NO: 1) as utilized in
the pDL1680 expression plasmid.
Figure 13. Depicts the sequence of the pDL1680 human Del-1 expression plasmid
(SEQ ID NO: 2).
CA 02426582 2003-04-17
WO 02/061040 PCT/USO1/51307
7
Figure 14. Depicts the increased reproducibility of expression with polymer
based
formulations.
Figure 15. Depicts expression of hDel-1 mRNA within the myocardium of pigs
treated by rIV delivery with either pDL1680 formulated in saline or pDL1680
formulated
with 5 % poloxamer 188.
Figure 16. Nucleic acid sequence of a codon optimized VEGF 165 (SEQ ID NO:
3).
Figure 17. CD31 Staining at Day 7 for (A) control, (B) Del-1, (C) VEGF, and
(D)
Del-1NEGF.
Figure 18. Grid representing poloxamer and reverse poloxamer characteristics.
Figure 19. Characteristics of useful poloxamers for muscle delivery.
Detailed Description Of The Preferred Embodiments
As used herein the term "angiogenic protein" means any protein, polypeptide,
mutein or portion that is capable of, directly or indirectly, inducing the
formation of new
blood vessels. Such proteins include, for example, developmental endothelial
locus-1
(Del-1), acidic and basic fibroblast growth factors (aFGF and bFGF), vascular
endothelial
growth factor (VEGF), epidermal growth factor (EGF), transforming growth
factor-alpha
and -beta (TGF-alpha and TFG-beta), platelet-derived endothelial growth factor
(PD-
ECGF), platelet-derived growth factor (PDGF), tumor necrosis factor-alpha (TNF-
alpha),
hepatocyte growth factor (HGF), insulin like growth factor (IGF),
erythropoietin, colony
stimulating factor (CSF), macrophage-CSF (M-CSF), granulocyte/macrophage CSF
(GM-
CSF) and nitric oxide s,mthase (NOS). Preferably, the angiogenic protein
contains a
secretory signal sequence allowing for secretion of the protein. Del-1 and
VEGF are
preferred angiogenic proteins.
Developmentally Regulated Endothelial Locus-1 (Del-1) is a recently identified
endothelial cell-specific extracellular matrix protein expressed during
vascular
development in the embryo. (Penta, K. et al (1999). J. Biol. Chem. 274, 11101-
11109.)
The Del-1 gene was identified in an enhancer trap in transgenic mice as a gene
that is
expressed primarily in the endothelium of the developing vasculature and in
immediately
adjacent cell types (Hidai, C., et al. (1998). Genes Dev. 1, 21-33.) Del-1
protein and
nucleotide sequences encoding human and mouse Del-1 are the subject of U.S.
Patent
Nos. 5,877,281 and 5,874,562 incorporated herein by reference.
Further analysis of Del-1 expression in solid tumors and in acutely ischemic
rodent
skeletal muscle has indicated that expression of the Del-1 gene is locally up-
regulated in
areas of active angiogenesis. Del-1 is not normally expressed postnatally, but
expression
CA 02426582 2003-04-17
WO 02/061040 PCT/USO1/51307
8
of Del-1 is up regulated in response to ischemia and other angiogenic stimuli.
Del-1 has
been shown to be involved in the migration and adherence of endothelial cells
via ligation
of the alpha-v, beta-3 integrin receptor. Recombinant Del-1 has been shown to
increase
vessel formation in the chorioallantoic membrane assays.
The full length Del-1 protein encoded by the Del-1 encoding plasmid is an
approximately 52 kDa protein consisting of three EGF-like repeats followed by
two
discoidin I-like domains. An RGD sequence that mediates binding to the alpha-
v, beta 3
("av133" or "avb3") integrin receptor is contained within the B loop of the
second EGF-
like repeat in Del-1. The RGD sequence has been shown to be a cell binding
site for
fibronectin, discoidin I, nidogen/entactin, and tenascin (Anderson, 1990,
Experientia
46:2). The overall structure of Del-1 is depicted in Figure 3a.
Available data indicates that the mechanism of action for Del-1 is unique
among
integrin receptor ligands and among known angiogenic factors. Ligand binding
to the
ocv133 integrin receptor provides an anti-apoptosis signal to ischemic
endothelium (3) and
is known to be requisite for angiogenesis (4). Given the complex structure of
the Del-1
protein and the observation that C-terminal truncations of the full length Del-
1 sequence
support endothelial attachment, but do not elicit angiogenesis, it has been
postulated that
Del-1 may interact with a second, as yet unidentified, receptor (Penta et al.,
Journal of
Biological Chemistry (1999) 274; 11101-11109).
The therapeutic potential of intramuscularly administered non-viral formulated
Del-1 expression system has been shown by the present inventors in both the
mouse and
rabbit hindlimb ischemic model. Ischemia was created in the left hindlimb of
18 New
Zealand White rabbits by resection of the femoral artery after ligating the
distal external
iliac artery. Baseline angiography was performed on the ischemic limb the day
of surgery.
On day three post-surgery, the left quadricep femoris muscle of the animals
was injected
with 5 mg of plasmid coding for VEGF, Del-1 or empty vector for a negative
control.
Thirty days post-treatment, angiography was performed again on the ischemic
limb, and
the quadricep femoris muscle from the treated limb was harvested and evaluated
by RT-
PCR, CD-31 immunoassay, and analysis of collateral vessels formed in the
medial thigh of
the rabbit by angiography. Also an ischemic model was induced in 32 CD-1 mice
by
ligating the distal internal iliac artery and the point of the femoral artery
where it
bifurcates into the deep femoral artery. The day of surgery 70 micrograms of
plasmid
coding for VEGF, Del-1 or empty vector was administered. A sham control group
was
also used in which the animal's hind limb was opened the same as in the
surgeries and then
closed again with no plasmid administered. The animals were run on a treadmill
and their
run time to exhaustion was recorded. The VEGF and Del-1 administration of non-
viral
CA 02426582 2003-04-17
WO 02/061040 PCT/USO1/51307
9
formulated plasmid was significant (p<0.01) in the formation of new collateral
vessels in
the rabbit model. In the mouse model it was seen that the capillary to myocyte
ratio
increased 1.5 fold in the Del-1 group over controls which was significant at
(p<0.05), and
the run time to exhaustion on the treadmill was also significantly (p<0.05)
improved.
In another embodiment, modulation of angiogenesis and vasculogenesis is
achieved through generation of Del-1 in conjunction with another endothelial
cell growth
factor that utilizes a different receptor than that of Del-1. Del-1 is a
ligand for the alpha-v-
beta-3 (avb3) integrin receptor. (Hidai, C. et al. Genes and Development 1998,
12:21-33.).
In contrast, vascular endothelial growth factor, VEGF, is a ligand for the
vascular
endothelial growth factor receptor-1 (VEGFR-1, a.k.a. flt-1) and VEGFR-2
(a.k.a KDR in
humans). Current data indicates signaling through flt-1 is primarily involved
in
endothelial cell migration and is not necessary for proliferation as is KDR.
VEGFR-1 may
actually antagonize the activity of VEGFR-2. (Yancopoulos, GD, et al. Nature
(2000)
407: 242). The avb3 integrin receptor and the VEGF receptor-2 are involved in
two
significant pathways. It is believed that stimulation of the avb3 integrin
receptor mediates
endothelial cell migration, a process crucial to angiogenesis. The VEGF
receptor-2 is a
receptor tyrosine kinase that autophosphorylates upon stimulation, setting off
a cascade of
kinases that promote endothelial cell proliferation and motility. Stimulation
of the VEGF-
R2 results in up-regulation of avb3. Although avb3 is upregulated by ligation
of VEGF-
R2, it was possible that sufficient ligand to maximize the system was already
present in
the matrix such that further addition of Del-1 would not have an additive
effect. The
present inventors have now shown that addition of Del-1, a unique angiogenic
integrin
receptor ligand, is able to not only synergize with VEGF in promoting
angiogenesis but
results in a profound increase in endothelial cell migration and
proliferation.
The present inventors have surprisingly found that delivery of the two genes
at
sub-maximal levels results in endothelial cell migration that is clearly
superior to that of
maximal doses of the genes individually. The two receptors have been
previously
identified to interact with each other upon stimulation, although neither
requires direct
binding with its ligand to bind with the other. However, stimulation of one
receptor and
. subsequent binding of the unbound receptor leads to only partial binding.
The basis of this
invention states that co-administration of the two ligands, Del-1 and VEGF,
allows for
complete binding of the avb3 integrin and VEGF receptor-2.
As used herein the term "Del-1 gene" means any DNA sequence encoding a
functional protein of the Del-1 gene family. In accordance with the invention,
any
nucleotide sequence which encodes the amino acid sequence of the Del-1 gene
product
can be used to generate recombinant molecules which direct the expression of a
Del-1
CA 02426582 2003-04-17
WO 02/061040 PCT/USO1/51307
gene product. Due to the inherent degeneracy of the genetic code, other DNA
sequences
which encode substantially the same or a functionally equivalent amino acid
sequence,
may be used in the practice of the invention. Such DNA sequences include those
that are
capable of hybridizing to the murine and/or human Del-1 sequences under
stringent
5 conditions. The phrase "stringent conditions" as used herein refers to those
hybridizing
conditions that (1) employ low ionic strength and high temperature for
washing, for
example, O.O15M NaCI/O.OO15M sodium citrate/0.1 % SDS at 50°C; (2)
employ during
hybridization a denaturing agent such as formamide, for example, 50% (vol/vol)
formamide with 0.1% bovine serum albumin/0.1% Ficoll/0.1%
polyvinylpyrrolidone/SO
10 mM sodium phosphate buffer at pH 6.5 with 750 mM NaCI, 75 mM sodium citrate
at
42°C; or (3) employ SO% formamide, 5 x SSC (0.75M NaCI, 0.075M Sodium
pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 g/ml),
0.1
SDS, and 10% dextran sulfate at 42°C., with washes at 42°C. in
0.2 x SSC and 0.1% SDS.
Altered DNA sequences which may be used in accordance with the invention
include
deletions, additions or substitutions of different nucleotide residues
resulting in a sequence
that encodes the same or a functionally equivalent gene product. The gene
product itself
may contain deletions, additions or substitutions of amino acid residues
within a Del-1
sequence, which result in a silent change thus producing a functionally
equivalent Del-1
protein. Such amino acid substitutions may be made on the basis of similarity
in polarity,
charge, solubility, hydrophobicity, hydrophilicity, and/or the amphipathic
nature of the
residues involved. For example, negatively charged amino acids include
aspartic acid and
glutamic acid; positively charged amino acids include lysine, histidine and
arginine; amino
acids with uncharged polar head groups having similar hydrophilicity values
include the
following: glycine, asparagine, glutamine, serine, threonine, tyrosine; and
amino acids
with nonpolar head groups include alanine, valine, isoleucine, leucine,
phenylalanine,
proline, methionine, tryptophan. The DNA sequences of the invention may be
engineered
in order to alter a Del-1 coding sequence for a variety of ends, including but
not limited to,
alterations which modify processing and expression of the gene product. For
example,
mutations may be introduced using techniques which are well known in the art,
e.g., site-
directed mutagenesis, to insert new restriction sites, to alter glycosylation
patterns,
phosphorylation, etc. In another embodiment of the invention, a Del-1 or a
modified Del-
l sequence may be ligated to a heterologous sequence to encode a fusion
protein. In order
to express a biologically active Del-l, the nucleotide sequence coding for Del-
1, or a
functional equivalent, is inserted into an appropriate expression vector,
i.e., a vector that
contains the necessary elements for the transcription and translation of the
inserted coding
sequence.
CA 02426582 2003-04-17
WO 02/061040 PCT/USO1/51307
11
As used herein the term "Del-1 protein" means any polypeptide sequence encoded
by a nucleic acid derived from the sequence of the Del-1 gene and having Del-1
activity.
As used herein, vascular endothelial growth factor, ("VEGF"), is a homodimeric
heavily glycosylated protein of 46-48 kDa (24 kDa subunits) although
glycosylation is not
required for biological activity. The homodimeric subunits are linked by
disulphide
bonds. The human gene has a length of approximately 12 kb and contains eight
exons. At
least four species of mRNA encoding VEGF-A have been identified and found to
be
expressed in a tissue-specific manner. The 165 amino acid form of the factor
(VEGF-165)
is the most common form found in most tissues. VEGF-121 and VEGF-165 are
soluble
secreted forms of the factor while VEGF-189 and VEGF-206 are mostly bound to
heparin-
containing proteoglycans on the cell surface or in the basement membrane. They
arise
from differential splicing with the 165 amino acid form of VEGF lacking
sequences
encoded by exon 6 and the 121 amino acid form lacking exon 6 and 7 sequences.
A high-affinity glycoprotein VEGF receptor of 170-235 kDa is expressed on
vascular endothelial cells. The high-affinity receptor for VEGF, now known as
VEGF-R1,
has been identified as the gene product of the flt-1. Another receptor for
VEGF, now
known as VEGF-R2, is KDR, also known as flk-1. Signaling through the KDR/VEGFR-
2
receptor up-regulates expression of integrin receptors.
Other VEGF-related factors are VEGF-B, which forms heterodimers with VEGF
and VEGF-C (a.k.a. VEGF-2). VEGF-C is a protein of 23 kDa that is derived by
proteolytic cleavage from a larger precursor. Another receptor for VEGF-C is
Flt-4.
VEGF-D has been described also and is the ligand for both KDR/Flk-1 and Flt-4.
Thus,
the ligands for KDR/VEGFR-2 include VEGF-A and VEGF-C and VEGF-D family
members. (Yancopoulos, GD, et al. Nature (2000)). In one embodiment, VEGF-A, C
and
D are used in conjunction with Del-1 to promote angiogenesis.
By "suitable for internal administration" is meant that the compounds are
suitable
to be administered within the tissue of an organism, for example within a
muscle or within
_ ___~a _~___ _~a~...7...~..il.. ..__L....a..~...._....1_. ..... _~a....~.
CA 02426582 2003-04-17
WO 02/061040 PCT/USO1/51307
12
including the great cardiac vein (GCV), middle cardiac vein (MCV), posterior
vein of the
left ventricle (PVLV), anterior interventricular vein (AIV), or any of their
side branches.
This delivery modality was originally described for delivery of drugs,
cardioprotective
agents or cardioplegia during myocardial surgery. (Kar et al. Heart Lung
(1992) 21; 148-
59; Herity et al. Catheter Cardiovasc Interv (2000) 51; 358-63). Retrograde
delivery of
naked plasmid DNA encoding the marker proteins LacZ and luciferase was
described by
Wolff in WO00/15285. No teaching or suggestion of DNA formulated with
transfection
facilitating agents was provided.
A "vector" is molecule incorporating nucleic acid sequences encoding
therapeutic
products) as well as, various regulatory elements for transcription,
translation, transcript
stability, replication, and other functions as are known in the art. A vector
may be a
nucleic acid such as a plasmid or other DNA vector. Alternatively, a vector
may be
modified virus whose native form contains the genomic material of a viral
particle.
A "transcript stabilizer" is a sequence within the vector which contributes to
prolonging the half life (slowing the elimination) of a transcript. "Post-
translational
processing" means modifications made to the expressed gene product. These may
include
addition of side chains such as carbohydrates, lipids, inorganic or organic
compounds, the
cleavage of targeting signals or propeptide elements, as well as the
positioning of the gene
product in a particular compartment of the cell such as the mitochondria,
nucleus, or
membranes. The vector may comprise one or more genes in a linear or
circularized
configuration. The vector may also comprise a plasmid backbone or other
elements
involved in the production, manufacture, or analysis of a gene product. An
"expression
vector" is a vector that allows for production of a product encoded for by a
nucleic acid
sequence contained in the vector. For example, expression of a particular
growth factor
protein encoded by a particular gene. A "gene product" means products encoded
by the
nucleic acid sequences of the vector.
By "prolong the localized bioavailability of a nucleic acid" is meant that a
nucleic
acid when administered to an organism in a composition comprising such a
compound will
be available for uptake by cells for a longer period of time than if
administered in a
composition without such a compound. This increased availability of nucleic
acid to cells
could occur, for example, due to increased duration of contact between the
composition
containing the nucleic acid and a cell or due to protection of the nucleic
acid from attack
by nucleases. The compounds that prolong the localized bioavailability of a
nucleic acid
are suitable for internal administration.
The compounds which prolong the localized bioavailability of a nucleic acid
may
also achieve one or more of the following effects, due to their physical,
chemical or
CA 02426582 2003-04-17
WO 02/061040 PCT/USO1/51307
13
rheological properties: (1) Protect nucleic acid, for example plasmid DNA,
from
nucleases; (2) increase the area of contact between nucleic acid, such as
plasmid DNA,
through extracellular matrices and over cellular membranes, into which the
nucleic acid is
to be taken up; (3) concentrate nucleic acid, such as plasmid DNA, at cell
surfaces due to
water exclusion; (4) indirectly facilitate uptake of nucleic acid, such as
plasmid DNA, by
disrupting cellular membranes due to osmotic, hydrophobic or lytic effects.
The following
compounds may be suitable for use as compounds which prolong the localized
bioavailability of a nucleic acid: , poloxamers (Pluronics0); poloxamines
(Tetronics);
polyglutamate; ethylene vinyl acetates; polyethylene glycols; dextrans;
polyvinylpyrrolidones; polyvinylalcohols; propylene glycols; and
polyvinylacetates.
These substances may be prepared as solutions, suspensions, gels, emulsions or
microemulsions. By "solutions" is meant water soluble polymers and/or
surfactants in
solution with nucleic acids.
The compounds which prolong the bioavailability of a nucleic acid may also
interact or associate with the nucleic acid by intermolecular forces and/or
valence bonds
such as: Van der Waals forces, ion-dipole interactions, ion-induced dipole
interactions,
hydrogen bonds, or ionic bonds. These interactions may serve the following
functions: (1)
stereoselectively protect nucleic acids from nucleases by shielding; (2)
facilitate the
cellular uptake of nucleic acid by "piggyback endocytosis". Piggyback
endocytosis is the
cellular uptake of a drug or other molecule complexed to a Garner that may be
taken up by
endocytosis. CV Uglea and C Dumitriu-Medvichi. Medical Applications of
Synthetic
Oligomers. In: Polymeric Biomaterials. Edited by Severian Dumitriu. Marcel
Dekker, Inc.
1993, incorporated herein by reference. To achieve the desired effects set
forth it is
desirable, but not necessary, that the compounds which prolong the
bioavailability of a
nucleic acid have amphipathic properties; that is, have both hydrophilic and
hydrophobic
regions. The hydrophilic region of the compounds may associate with the
largely ionic
and hydrophilic regions of the nucleic acid, while the hydrophobic region of
the
compounds may act to retard diffusion of nucleic acid and to protect nucleic
acid from
nucleases. Additionally, the hydrophobic region may specifically interact with
cell
membranes, possibly facilitating endocytosis of the compound and thereby
nucleic acid
associated with the compound. This process may increase the pericellular
concentration of
nucleic acid. Agents which may have amphipathic properties and are generally
regarded
as being pharmaceutically acceptable are the following: poloxamers
(Pluronics);
poloxamines (Tetronics); ethylene vinyl acetates; polyethylene glycols;
polyvinylpyrrolidones; polyvinylalcohols; and polyvinylacetates. Also,
copolymer
systems such as polyethylene glycol-polylactic acid (PEG-PLA), polyethylene
glycol-
CA 02426582 2003-04-17
WO 02/061040 PCT/USO1/51307
14
polyhydroxybutyric acid (PEG-PHB), polyvinylpyrrolidone-polyvinylalcohol (PVP-
PVA),
and derivatized copolymers such as copolymers of N-vinyl purine (or
pyrimidine)
derivatives and N-vinylpyrrolidone.
A particular advantage of non-condensing polymer formulations of non-viral
nucleic acids is that their use greatly decreases the coefficient of variation
as shown in
Figure 14, comparing plasmid in saline and plasmid formulated with PVP, a non
condensing polymer.
As used herein term "poloxamer" means any di- or tri-block copolymer composed
of the hydrophobe propylene oxide (POP, polyoxypropylene has the formula
(C3H60)X
and thus has a unit mw of 58) and the hydrophile ethylene oxide (POE,
polyoxyethylene
has the formula (C2H40)X and thus has a unit mw of 44). Poloxainers are in the
polyglycol
chemical family. The common chemical name for poloxamers is polyoxypropylene-
polyoxyethylene block copolymer. The CAS number is 9003-11-6.
Pluronic0 is a trademark for poloxamers manufactured by BASF. In Europe the
pharmaceutical grade poloxamers manufactured by BASF is sold under the mark
Lutrol.
Poloxamers of the Pluronic0 type are tri-block copolymers in which the
hydrophobe
propylene oxide block is sandwiched between two hydrophile ethylene oxide
blocks and
has the following general formula and structure:
GHQ
1
HC?~GH~CH~Oj ~-(Cht~~~i0) ~(CH~Cli~t3)~.-i~
BASF poloxamers of the "reverse Pluronic~" type have the following structure:
CHI C H
HC~(CHCi~ZO).x-(C~~GMaOI,~"(CHaGHO)x~-H
As used herein, the term "poloxamine" refers to poly(oxyethylene)-
poly(oxypropylene) (POE-POP) block copolymers where a POE-POP unit is linked
to
another POE-POP unit by an amine and having the general structure (POE" -
POPm)2 N -
CZH4 - N - (POPm - POE")2. TETRONIC~ and TETRONIC R nonionic surfactants
produced by BASF are exemplary poloxamines. By virtue of their amine group,
poloxamines have a positive charge but are not thought to condense DNA at the
concentrations used.
CA 02426582 2003-04-17
WO 02/061040 PCT/USO1/51307
Poloxamines are in the alkoxylated amine chemical family. Poloxamines of the
BASF Tetronic~ type have the chemical name: 1,2-Ethanediamine, polymer with
the
following formula: (POE" - POPm)Z N - CZH4 - N - (POPm - POE")Z and the CAS
number: 11111-34-5. Reverse Tetronics~ have the formula:
5 (POP" - POEm)2 -N - C2H4 - N - (POEm - POP")2 and the CAS number: 26316-
40-5.
The following BASF Tetronics~ have been found to be useful in increasing the
delivery of plasmid DNA to muscle and are applicable to the enhanced delivery
of genes
including that encoding Del-1 by direct injection into muscle or by retrograde
delivery.
10 TETRONICO 904 is supplied as a liquid having an average molecular weight of
6,700 Da.
TETRONIC~ 908 is supplied as a solid having an average molecular weight of
25,000 Da.
TETRONICO 1107 is supplied as a solid having an average molecular weight of
1 S 15,000 Da.
TETRONIC~ 9084 is supplied as a liquid having an average molecular weight of
7,240 Da.
Example 1: Formulation for Enhanced Plasmid Delivery to Skeletal M oy fibers
Enhanced delivery of plasmid to muscle may be accomplished by formulation with
PINCTM (Protective, Interactive, Non-Condensing) polymeric delivery systems.
The
PINCTM delivery system for Del-1 is comprised of a U.S.P. NF grade poloxamer
188
(Pluronic~ F68). Fibure 1 shows the effect of plasmid and poloxamer 188
concentration
on delivery of expression plasmid in murine skeletal muscle. Mice were
injected im into
the tibialis anterior muscles with 10 microliters plasmid/poloxamer 188
formulation
containing plasmid and poloxamer at concentrations ranging from 0.1 to 3.0
mg/ml and 1
to 10 % (w/v), respectively. Injected muscles were harvested 7-day post
injection and
assayed for luciferase expression. Data presented are the mean +/- SEM for n =
10
muscles/group. An optimized plasmid/poloxamer 188 formulation consisting of 1
mg/ml
plasmid with 5 % (w/v) poloxamer 188 yielded expression that was approximately
one log
higher than the level of expression observed when an equivalent concentration
of plasmid
was formulated in isotonic saline. This optimized plasmid poloxamer
formulation was
subsequently tested in rat skeletal muscle (Figure 2).
Figure 2 shows expression of luciferase in tibialis anterior muscles of rats
injected
with the luciferase expression plasmid pLC0888 formulated with isotonic
saline,
polyvinylpyrrolidone, or poloxamer 188 PINCTM delivery systems. The luciferase
CA 02426582 2003-04-17
WO 02/061040 PCT/USO1/51307
16
expression plasmid pLC0888 incorporates the cytomegalovirus (CMV) promoter, a
5'
synthetic intron, a gene encoding luciferase, and the 3' polyadenylation
signal and
untranslated region from the bovine growth hormone gene. Bars with different
superscripts are different (p<0.05). The approximate one log increase in gene
expression
over plasmid formulated in saline that was observed in mice was also observed
in rats.
Intramuscular injection of plasmid formulated in poloxamer 188 has been well
tolerated,
and has not been associated with any gross pathology.
In addition to formulation with non-condensing polymeric delivery systems,
electroporation has also been utilized to enhance plasmid delivery to skeletal
muscle in
some studies. Electroporation using optimized parameters has been shown to
yield an
additional 1 to 2 log increases in plasmid delivery. This enhanced delivery
results in
expression of the plasmid-encoded transgene in a substantial majority of
myofibers within
limb muscle of mice. Electroporation has been used to investigate the full
dose response
to locally expressed Del-1. Results from preclinical~studies indicate that
therapeutic levels
of Del-1 expression may be achieved with or without further mechanical
enhancement
such as with electroporation.
Example 2: Del-1 Expression Plasmid
A Del-1 expression system was developed incorporating the cytomegalovirus
(CMV) promoter, a 5' synthetic intron, the hDel-1 cDNA, and the 3'
polyadenylation
signal and untranslated region from the human growth hormone gene (figure 3b).
In
addition to the expression plasmid encoding human Del-1, an analogous murine
Del-1
expression plasmid has been constructed. The mDel-1 plasmid has been utilized
in some
preclinical murine studies. The Del-1 expression cassette shown in Figure 3b
is contained
in a plasmid backbone containing the bacterial gene for kanamycin resistance
(Figure 3c),
which allows for selective growth during plasmid production. Use of other
expression
backbones including for example alternative promoters, 5' and 3' untranslated
regions,
polyadenylation signals may be employed and are well known in the art. Figure
12
depicts the nucleotide sequence for human Del-1 while Figure 13 depicts the
nucleotide
sequence of human Del-1 expression plasmid pDL1680 shown schematically in
Figure 3c.
Example 3: Pharmacology of Del-1 gene medicine
Del-1 Western: The protein product from the Del-1 encoding vector was analyzed
by performing a SDS-PAGE gel. The lyophilized muscle tissue was homogenized in
2m1
tubes containing 2.Smm silica beads with lysis buffer at 10 microliters/mg wet
weight, and
the non-soluble material was centrifuged out. A NOVEX Tris-Glycine gel was ran
with a
CA 02426582 2003-04-17
WO 02/061040 PCT/USO1/51307
17
high molecular weight marker (SIGMA #C3312), 50 nanograms of a peptide
standard
(PROGENITOR), or 50 micrograms total protein of unknown samples per lane. The
gel
was transferred to nitrocellulose membrane, and blocked for 1 hour in PBS/0.1%
Tween-
20/5% dry milk/4% BSA. The primary antibody was a rat anti-Del-1 monoclonal
added at
a dilution of 1:500 into blocking buffer over night. After thorough was
washing in
PBS/0.1% Tween-20, an anti-rat HRP secondary antibody was added in PBS/0.1%
Tween-20 at 1:10,000 dilution. The membrane was incubated for 1 hour, then
washed
thoroughly and incubated in AMERSHAM ECL chemiluminescent reagent for 1-2
minutes, and exposed to X-OMAT AR film.
IGEN.~ The protein product from the formulated Del-1 expression system was
quantitated by an ORIGEN IGEN immunoassay specifically developed for Del-1.
Briefly,
the lyophilized muscle tissue is homogenized in 2 ml tubes containing 2.5 mm
silica beads
in lysis buffer at 10 microliters/mg wet weight, and non-soluble material is
centrifuged
out. The assay utilizes avidin coated beads, a biotinylated capture antibody
and a
ruthenylated detection antibody. All reagents are incubated to allow binding,
then
sampled through the IGEN instrument, where a magnetic capture system binds the
bead
complexes, and the unbound fraction is washed away. An electric current is
passed
through the bound complexes, resulting in the ruthenylated component emitting
a signal
that is measured by the detector. The dynamic range of this assay is 10
picograms-100
nanograms/mg total protein in the lysate.
RT PCR: The Del-1 and VEGF-165 were analyzed to identify the presence of
Del-1 and VEGF-165 RNA by RT-PCR. The procedure for the RT-PCR was to first
harvest the muscles from the hindlimb, lyopholyze and homogenize the tissue.
Then the
tissues were processed for RNA using bead beating and Tel-Test RNA Stat 60. To
eliminate any contaminating DNA from the samples a standard Dnase I
(Boehringer
Mannheim) procedure was performed. RT-PCR was performed using SUPERSCRIPTTM
ONE STEPTM RT-PCR System (GIBCOBRL). Both cDNA synthesis and PCR are
performed in a single tube using gene specific primers. Primers for both DEL-1
and
VEGF are designed to span the synthetic intron of the plasmid. The DEL-1
primers yield
a 304 by fragment (DNA contamination yields 421 bp). Primers are sense 5'-TGA
CCTCCA TAG AAG ACA CCG GGA C-3' (SEQ ID NO: 4) and antisense 5'-GTG ATG
CAA CCT CCA CAA CAC TAG A-3' (SEQ ID NO: 5). The VEGF primers yield a 724
by fragment (DNA contaminant would yield 841 bp). The sense primer is the same
as
Del-1 and the antisense is 5'-GGA GGGGTC ACA GGG ATG C-3' (SEQ ID NO: 6). RT
reaction and PCR cycling parameters are as follows. RT at SO° C for 30
min; 95°C for 2
CA 02426582 2003-04-17
WO 02/061040 PCT/USO1/51307
18
min.; PCR cycling at 95°C for 30 sec; 65°C for 40 sec x 35
cycles. Extension at 65°C for
min. then to 4°C.
Immunohistolog~ for Del-1 and VEGF: The Del-1 and VEGF-165 gene medicines
were visualized in the treated muscle samples by immunohistochemical analysis.
5 Immunohistochemical localization for Del-1 was performed on S~.m
cryosections which
were immunostained using a rat anti-mouse Del-1 antibody diluted 1:500 for 1
hour after
blocking with normal rabbit serum. Muscle sections were then rinsed with PBS
and
incubated for 1 hour with a biotinylated rabbit anti-rat IgG (Vector
Laboratories) at a
dilution of 1:400. Muscle sections were subsequently rinsed with PBS and
incubated with
avidin-HRP (ABC Elite, Vector Laboratories) for 1 hour. After sections were
rinsed with
PBS, immune complexes were visualized by reaction with DAB (Vector
Laboratories).
Immunohistochemical localization for VEGF-165 was performed on 3 mm2 paraffin
sections. The sections were immunostained using a rabbit anti-human VEGF
antibody
(Intergen Company) diluted 1:200 for 1 hour after blocking with normal goat
serum.
Muscle sections were rinsed with PBS and incubated for 1 hour with a
biotinylated goat
anti-rabbit IgG (Vector Laboratories) at a dilution of 1:400. Muscle sections
were
subsequently rinsed with PBS and incubated with avidin-HRP (ABC Elite, Vector
Laboratories) for 1 hour. After sections were rinsed with PBS, immune
complexes were
visualized by reaction with DAB (Vector Laboratories).
Quantitive RT PCR: The quantification of the RNA from the treated muscles with
formulated Del-1 expression system was analyzed by RT-PCR. The total RNA was
isolated from muscle samples using RNAzoI. Residual plasmid DNA was removed by
treating RNA samples with Dnase. The mRNA in the Del-1 samples was quantified
using
a single step Taqman RT-PCR assay in an ABI-7700 thermal cycler. The 5' and 3'
primers
that spanned the intron in the 5' UTR of the Del-1 mRNA were used for
amplification of
the mRNA specific amplicon.
Capillary Density and Capillary to Muscle Fiber Ratio: The capillary density
was
analyzed by a semi-quantitative western blot for CD-31. Briefly, the
lyopholized muscle
tissue was homogenized in 2 ml tubes containing 2.5 mm silica beads lysis
buffer at
10u1/mg wet weight, and non-soluble material was centrifuged out. A Novex Tris-
Glycine
gel is run with a high molecular weight marker (Sigma #C3312), 50 nanograms
Peptide
Standard (RDI), or SO micrograms total protein of unknown samples per lane.
The gel
was transferred to nitrocellulose membrane, and blocked for 1 hour in PBS/0.1%
Tween-
20/ 5% dry milk/4% BSA. The primary antibody, goat anti-CD31 (RDI) was added
at
1:500 into the blocking buffer, and incubated at room temperature overnight,
with shaking.
After thorough washing in PBS/0.1% Tween-20, an anti-goat-HRP secondary was
added,
CA 02426582 2003-04-17
WO 02/061040 PCT/USO1/51307
19
in PBS/0.1% Tween-20, at 1:10,000. The membrane was incubated for 1 hour, then
washed thoroughly and incubated in Amersham ECL chemiluminescent reagent for 1-
2
minutes, and exposed to X-GMAT AR film. The film was scanned into the computer
and
the pixel density of each band was assessed using ImageQuant software. Since
it is
possible to have gel-to-gel variations, all numbers are reported as a
percentage of the
CD31 peptide standard run on the same gel.
The capillary to muscle fiber ratio was determined by immunohistochemical
localization for CD-31. Samples of muscle tissue that were 5 mm2 cryosections
were
immunostained using a rat anti-mouse CD 31 antibody (PharMingen) diluted
1:1000 for 1
hour after blocking with normal rabbit serum. Muscle sections were rinsed with
PBS and
incubated for 1 hour with a biotinylated rabbit anti-rat IgG (Vector
Laboratories) at a
dilution of 1:400. Muscle sections were subsequently rinsed with PBS and
incubated with
avidin-HRP (ABC Elite, Vector Laboratories) for 1 hour. After sections were
rinsed with
PBS, immune complexes were visualized by reaction with DAB (Vector
Laboratories).
The image analysis for capillary to myocyte ratio was performed using the
Optimas image analysis software using a custom macro for counting capillaries
and
myofibers. Images from cryosections immunostained for CD-31 were analyzed and
a ratio
of capillaries to myofibers was established.
An.~iography Assessment: Angiography was used to evaluate the collateral
arteries that had developed during the rabbit hindlimb ischemic model
experiment. The
right femoral artery was catheterized and injected with 4 mls of contrast
agent
(VISIOPAQUETM). Serial images of both hindlimbs were recorded. Quantitative
angiographic analysis of the collateral vessel development was performed by a
blinded
observer directly counting the number of vessels crossing two perpendicular
planes
measured from anatomical landmarks on the femur and then averaged. The image
used
for the analysis was taken at 130 frames on the cine loop taken from the
camera using
DIACOM VIEW TM software. This analysis was performed three separate times and
the
average of the observations was recorded.
Treadmill: A treadmill stress test was performed to analyze the physiological
changes with the administration of the Del-1, VEGF-165, non-coding plasmids
along with
a sham operative control group. The animals were placed on the treadmill at a
seven
degrees angle for five minutes at five meters/minutes to acclimate to the
treadmill. After
the initial five minutes, the treadmill speed is increased to ten
meters/minutes and the
clock started. The speed is increased every two minutes until signs of fatigue
are noticed.
The signs of fatigue are a change in gait, unable to run to the front of the
treadmill and
CA 02426582 2003-04-17
WO 02/061040 PCT/USO1/51307
spending more than five seconds on the shocker grid. When any combination of
these
signs is observed the animal is removed and the time is stopped.
Statistical Analysis: All results are expressed as means + SEM. Statistical
significance was evaluated using a one-way ANOVA with Duncan as the post-hoc
5 analysis. A P value< 0.05 was interpreted to denote statistical
significance.
Animal Models: The preclinical pharmacology of the formulated Del-1
expression system has been evaluated in mouse and rabbit animal models.
Intramuscular
injection of formulated Del-1 plasmid has been shown to increase capillary
density in
normoxic skeletal muscle and to increase collateral vessel formation and
exercise
10 tolerance in animal models of limb ischemia. The biological effects of the
formulated
Del-1 plasmid are dose dependent. No evidence of toxicity or gross pathology
related to
the expressed Del-1 has been observed in animal models.
The level and duration of mDel-1 expression in tibialis anterior muscles of
mice
following injection of formulated mDel-1 plasmid with and without
electroporation are
15 presented in figure 4. Ten micrograms formulated Del-1 plasmid were
injected into the
tibialis anterior muscles of CD-1 mice. Injected muscles were harvested at 7,
14, 30 and
60-day post injection and assayed for mDel-1 mRNA by qrtPCR. Data points shown
represent the mean +/- SEM for n=5/group/time point. Results from this
experiment
indicate that expression of mDel-1 decreased at the rate of approximately one
log per
20 month when administered without electroporation. Administration of mDel-1
encoding
nucleic acids in conjunction with electroporation resulted in an approximate
two log
increase in the level of Del-1 mRNA, and furthermore, appeared to increase the
persistence of mDel-1 expression.
. The effect of hDel-1 gene expression in normoxic tibialis anterior muscle of
mice
7-day post injection with and without electroporation was determined as is
shown in
Figure 5. Mice were injected IM into the tibialis anterior with formulated Del-
1 or control
plasmid followed by use of electroporation to further enhance plasmid uptake
(+EP) in
half of the injected muscles. Panel A: Results in the bar graph depict
capillary density at 7
days post-treatment determined by computer image analysis of CD31
immunostaining.
Data show the mean +/- SEM for n=3/group. An asterisk indicates that the
groups are
different from control (p<0.01). Panel B: Photographs show representative CD-
31
immunostaining in muscle cross-sections. A single 10 microgram dose of hDel-1
plasmid
DNA increased capillary:myofiber ratio by approximately 60 % (p<0.01).
Increasing the
level of hDel-1 expression through the use of electroporation did not further
increase
capillary:myofiber ratio. Although not shown, the effects of human and marine
Del-1 in
this model were equivalent.
CA 02426582 2003-04-17
WO 02/061040 PCT/USO1/51307
21
The immunohistological analysis showed that the formulated Del-1 plasmid
caused
a very minimal inflammatory effect, whereas the VEGF-165 formulated plasmid
resulted
in a massive infiltration of inflammatory cells. The inflammation seen with
formulated
VEGF-165 expression system agrees with other studies showing the increase in
inflammatory cells even seeing the extreme of hemangiomas when VEGF-165 is
expressed for long amounts of time (Springer M, et al. Molecular Cell.
1998;2:549-558;
Ozawa C, et al. Annu. Rev. Pharmacol. Toxicol. 2000; 40:295-317).
Example 4: Dose response relationship
To investigate the relationship between expressed Del-1 protein and increased
expression of the capillary endothelial surface antigen CD31 experiment was
performed to
quantify the concentration of expressed mDel-1 and CD31 within the injected
muscle.
Mice were injected instramuscularly with either 10 micrograms non-coding
plasmid, 10
micrograms Del-1 plasmid, 20 micrograms Del-1 plasmid, or 30 micrograms Del-1
plasmid administered in conjunction with electroporation. Muscles were
harvested 7 days
post injection and assayed for mDel-1 by sandwich iriununoassay and for CD31
by
Western blot followed by densitometry. Results from this experiment are shown
in Figure
6. Expression of mDel-1 was strongly correlated with expression of the
capillary
endothelial surface antigen CD31 (R=0.65, p<0.01). The approximate ECSO for
the Del-1
concentration dependent increase in CD31 was approximately 5 ng/g wet muscle.
Example 5: Effects of formulated Del-1 plasmid in murine hind limb ischemia
In addition to studies in normoxic mouse hindlimb, the effects of formulated
Del-1
plasmid have been investigated in a murine hind limb ischemia model. CD-1 mice
(26-
31 gm) were obtained from Charles River (Houston). Briefly, after sedation
with ketamine
(7.4 mg/gm), xylazine (0.4 mg/gm) and acepromozine (0.08mg/gm), the femoral
artery
was ligated in both legs. A longitudinal incision was made on the medial side
of the thigh
inferiorly from the inguinal ligament down to a point proximal of the patella.
With this
incision, the femoral was ligated at its proximal origin where it branched
from the iliac to
the point distally where it bifurcated into the popliteal and sapheneous
arteries.
Immediately after ligation of the femoral artery, formulated hDel-1 plasmid,
formulated hVEGF plasmid or control (non-coding) plasmid was injected
intrasmuscularly
(i.m.) with a 28 gauge 1/2" needle in five different places into the thigh and
lower limb (70
micrograms total dose/hindlimb divided among the tibialis anterior (10
micrograms),
gastrocnemius (20 micrograms), and quadriceps (40 micrograms) muscles and
administered immediately following surgery). Each injection consisted of 0.1
ml of a
CA 02426582 2003-04-17
WO 02/061040 PCT/USO1/51307
22
poloxamer formulation at a concentration of lmg/ml. Revascularization was
assessed by
the physiological endpoint of a treadmill stress test and by CD-31 semi-
quantitative
western blot analysis. Exercise tolerance was determined at weekly intervals
through four
weeks post surgery. Formulated VEGF plasmid was included for comparison since
numerous studies have indicated that overexpression of VEGF can lead to
increased
revascularization in ischemic tissue.
Data shown in Figure 7 represent the mean +/- SEM for n=7-8 animals/group.
Different superscripts associated with different groups indicated that the
exercise times for
the groups are different (p<0.05). Results from this study presented in Figure
7 show that
both Del-1 and VEGF gene medicines increased exercise tolerance versus control
(p<0.05). An evaluation of mouse skeletal muscle treated with formulated Del-1
plasmid
over a six month time period by qRT-PCR showed that, after six months, the
formulated
Del-1 plasmid has not significantly decreased in expression.
Example 6: Effects of formulated Del-1 plasmid in the rabbit femoral artery
excision
ischemia model
The most common animal model employed for investigation of angiogenic factors
in hindlimb ischemia is the rabbit femoral artery excision model. A study of
similar
design to that described above in mice was conducted in New Zealand rabbits.
The first
model used 14 male New Zealand Rabbits (4 kg) to create the rabbit hindlimb
ischemic
model. Briefly, after sedation with ketamine (20mg/kg), xylazine (Smg/kg) and
acepromozine (2.Smg/kg), the femoral artery was resected from the left leg. A
longitudinal incision was made on the medial side of the thigh inferiorly from
the inguinal
ligament down to a point proximal of the patella. With this incision, the
femoral artery
was dissected free and the connecting arterial branches were dissected free
and ligated.
The femoral artery was now excised from its proximal origin where it branched
from the
external iliac to the point distally where it bifurcated into the popliteal
and sapheneous
arteries.
For the rabbit hindlimb ischemia model, the non-viral formulated DNA encoding
Del-1, VEGF -165, or a non-coding plasmid for a control was injected
instramuscularly
with a 28 gauge 1/2" needle in ten different places into the medial portion of
the thigh of
the rabbit three days post surgery. The concentration of the DNA used was
lmg/ml
formulated with poloxamer 188 with each injection consisting of O.SmI for a
total of 5 mg
of DNA.
Angiography was performed immediately after surgery and again at one month.
Revascularization of the ischemic limb was evaluated 30 days post-treatment by
CD-31
CA 02426582 2003-04-17
WO 02/061040 PCT/USO1/51307
23
semi-quantitative western blot analysis and angiography analysis. Results for
the number
of new collateral vessels crossing over the mid thigh region are shown in
Figure 8.
Numbers of animals/group were n=3 (control), n=5 (Del-1), and n=6 (VEGF). Bars
represent the mean +/- SEM for the number of new collateral vessels crossing
over the mid
thigh. Bars with different superscripts are different (p<0.01). Both Del-1 and
VEGF
elicited a more than two-fold increase in collateral vessel development over
the one month
course of the experiment (p<0.05).
Example 7: Optimization of the formulation and delivery of Del-1 plasmid to
myocardium
Experiments to identify and optimize the formulation and delivery of Del-1
plasmid DNA to myocardium were conducted. Results suggest that maximal
delivery
efficiency to the left ventricle is attained with a polymer formulation
administered via
retrograde IV infusion. Eight pigs were dosed with formulated plasmid via this
route (4
with poloxamer, 4 with cationic lipids) and the procedure was well tolerated.
However, at
7 days gross pathology was noted in the myocardium of pigs dosed with cationic
lipid
formulations. The delivery of contrast media or dye via that procedure
resulted in
localized extravasation into the parenchyma of the left ventricle. Expression
of Del-1
mRNA was highest in pigs dosed with the poloxamer formulation. Results from
experiments conducted in a murine model to assess different formulations for
direct
intramyocardial injection suggest that either formulation with polyglutamate
or increasing
the concentration of plasmid from 1 mg/ml to 3 mg/ml appear to enhance plasmid
delivery
to myocardium when administered by needle injection.
Example 8: Percutaneous Delivery the Myocardium
Potential percutaneous delivery modalities were tested in pigs and compared
based
on safety, technical feasibility, and plasmid delivery efficiency. Gene
expression and
tolerability data for these experiments are summarized in Table 1. For all
percutaneous
delivery experiments conducted major organs have been sampled to assess
biodistribution
of the plasmid at harvest (usually 7 day post-administration). Results (not
shown) reveal
that the plasmid is primarily localized to the heart regardless of the route
of administration
or formulation.
Delivery via needle infection catheter
Between two experiments a total of N=6 pigs were dosed with Del-1 plasmid DNA
formulated in either poloxamer 188 (n=4) or saline (n=2) and administered via
helical
CA 02426582 2003-04-17
WO 02/061040 PCT/USO1/51307
24
needle injection catheters provided by BioCardia, Inc. The delivery procedure
was well
tolerated in all animals and no remarkable findings of gross pathology were
made at the
time of harvest. Expression data shown on Table I indicated low level Del-1
expression
localized within the injected left ventricle using IM needle catheter delivery
in contrast to
the high levels obtained with retrograde venous delivery.
Table 1
Del-1 mRNA Percent positive Del-1 mRNA in
in LV' sections positive sectionsz
IM Catheter 23,589 20 120,184
(10 sites) 6,136 16 18,949
Retro IV 114,020 28 405,075
806,555 41 2,177,932
'Copies Del-1 mRNA/microgram total RNA in all sections analyzed, LOQ = 500
copies/microgram (500,000 -1,000,000 typical level achieved in murine limb
muscle)
ZCopies Del-1 mRNA/microgram total RNA (average of positive sections)
Delivery of a formulated DNA to the myocardium with a needle injection
catheter
is most analogous to intramuscular injection using a needle and syringe.
Results from
mouse studies shown in proceeding sections of this report suggest that
intramuscular
injection may not be as efficient for introducing gene medicines into
myocardium as it is
1 S for skeletal muscle.
Delivery to the pericardial space
Delivery to the pericardial space was accomplished via use of a trocar device
(PERDUCERTM) from Comedicus, Inc. A positively charged cationic lipid
formulation
was tested via this route. The delivery procedure appeared to be well-
tolerated. Low level
expression of Del-1 mRNA (<500 copies/micrograms total RNA) was detected in
myocardial tissue.
Delivery to the left ventricle via retrograde IV in usion
Retrograde IV ("rIV") delivery to the left ventricle was accomplished via
placement of a 7F balloon catheter (10, shown in Figures 11A and 11B) through
the
coronary sinus (20, Figure 11A), the great cardiac vein (30, Figure 11B), and
into the mid
region of the anterior intraventricular vein (40). After the inflation of the
balloon (15) to
occlude venous outflow, injection of 10 ml of formulated plasmid was performed
either by
CA 02426582 2003-04-17
WO 02/061040 PCT/USO1/51307
maximum hand pressure or at a controlled rate; the rate being either a
volume/time rate
such as lml/second, or at a predetermined pressure. Delivery of contrast media
or dye via
this procedure resulted in localized extravasation (50) of the media into the
parenchyma of
the left ventricle. The arrows (60 and 70) on Figures 11A and 11B show the
direction of
S flow for the formulated plasmid through and from the catheter (10). The
arrows (80 and
90) on Figures 11A and 11B show the direction of blood flow in the vein.
Following delivery of the formulated plasmid the inflated balloon (15) was
left in
place for several minutes (2 - 10 minutes in pigs depending on the experiment)
to increase
residence time of the formulation within the tissue. Eight pigs were dosed
with formulated
10 plasmid via this route (n=4 with' poloxamer formulation, n=4 with cationic
lipid
formulations). The delivery procedure was well-tolerated in all animals.
However, upon
harvest 7 days post administration significant gross pathology was noted in
the
myocardium of pigs dosed with cationic lipid formulations. Pathology appeared
to be
more severe in pigs dosed with the 1:3 (-/+) formulation than with the 1:0.5 (-
/+)
15 formulation.
Expression of Del-1 mRNA was highest in pigs dosed with the poloxamer 188
formulation and decreased significantly with higher concentrations of cationic
lipid as
shown in Table 2. Of the delivery modalities and formulations tested only the
poloxamer
formulation administered via retrograde IV infusion yielded levels of
expression that were
20 comparable to those typically achieved in murine limb muscle following IM
injection.
Both deliveries via intramyocardial injection and via retrograde IV infusion
of a
poloxamer formulation appear to be well-tolerated.
Table 2. Summary of data from percutaneous myocardial delivery studies
conducted to date.
Formulation Technical Del-1 mltNA Gross
Success' pathology
IM catheter Poloxamer 188 5% 6/6 Detectable Negative
(n=4)
Pericardial Cationic lipid (1:3, -/+) 1/3 <LOQ (n=3) Mild
Retrograde IV Cationic lipid (1:3, -/+) 2/2 <LOQ (n=2) Moderate/severe
Retrograde IV Cationic lipid (1:0.5, -/+) 2/2 3997 (n=2) Mild/moderate
Retrograde IV Poloxamer 188 5% 4/4 397279 (n=2) Negative
25 'Technical success is defined as the proportion of delivery procedures that
were accomplished
without significant problems.
CA 02426582 2003-04-17
WO 02/061040 PCT/USO1/51307
26
ZCopies Del-1 mRNA/micrograms total RNA, LOQ=500 copies (500,000-1,000,000
typical level
achieved in murine limb muscle).
3Partial degradation of RNA during shipping precluded quantification of Del-1
mRNA in these
samples.
S Example 9: Direct IM injection of formulated plasmid in mouse heart
Because direct intramyocardial injection can be performed in rodents,
experiments
were conducted to assess the utility of various polymer formulations for
delivery of gene
medicines to myocardium. Observations made in these experiments are considered
in the
selection of formulations/formulation parameters for testing in larger animals
with a
needle injection catheter. All experiments described in the section below were
conducted
in mice using the luciferase reporter plasmid pLC0888. In brief, mice are
anesthetized
with pentobarbital, intubated, and then the chest opened via an incision along
the midline
of the sternum. The heart, beating at 500-600 beats/min, was gently elevated
in the chest
cavity using a sterile swab and formulated plasmid injected with an insulin
syringe.
Survival following the injection procedure is generally greater than 80 %
unless otherwise
affected by toxicity of the formulation. For comparative purposes it should be
noted that
the level of luciferase expression observed in mouse skeletal muscle 7d
following
injection of pLC1088 formulated in 5% poloxamer 188 is approximately 107
RLU/mg
protein.
The objective of this experiment was to determine whether increasing the
concentration of plasmid in a poloxamer 188 formulation would increase
delivery of
pLC0888. Nonetheless, results from this experiment presented below in figure 9
suggest
that increasing the concentration of plasmid in the 5% poloxamer 188
formulation from 1
mg/ml to 3 mg ml increases delivery efficiency to cells in the myocardium.
Data shown
represent the mean +/- SD for n=3/group. CD-1 mice were injected with the 1,
3, and 12
mg/ml formulations. C57 BL6 mice were injected with the 6 mg/ml formulation.
Further experiments have indicated that direct IM injection of a lmg/ml
plasmid,
5% poloxamer formulation does result in measurable levels of luciferase
expression in the
injected heart.
A comparison of various formulations for delivery of plasmid to myocardium via
intramyocardial injection was conducted. Results shown in Figure 10a indicate
that
formulation of plasmid in poly glutamic acid yields more efficient plasmid
delivery than
the other formulations tested. An additional study the results of which are
shown in
Figure lOb has confirmed this result versus formulation in saline. Data
represent the mean
+/- SD for n=3/group (panel A), n=4-5/group (panel B).
CA 02426582 2003-04-17
WO 02/061040 PCT/USO1/51307
27
ExamQle 10: Non-condensing_polymer formulated plasmid
In one embodiment of the present invention, the compound in which the DNA is
formulated can be shown to interact with the DNA by one or more of the
following
methods: FTIR; ITC; DELSA; and fluorescence quenching. In certain
circumstances, the
compound may be shown to provide protection against nucleases in vitro.
Preferred
compounds do not result in condensation of the DNA but do facilitate
dispersion and
delivery to solid tissues (e.g., muscle, tumors) and effect an increased
extent and levels of
expression. As shown in Figure 12, preferred compounds effect an increased
reproducibility of expression.
Example 11: Formulated Del-1 Expression Plasmid Pharmaceutical Product
In one embodiment of the present invention, the facilitating agent is
Poloxamer
188 having the following chemical composition:
HO(CHZCH20)so(CH(CH3)CH20)z7(CHZCHZO)BOH.
In one embodiment the del-1 drug product includes:
Component Drug Product Composition (mg/vial)
Drug Substance (pDL1680) 5.0
Facilitating Agent (Poloxamer250
188)
Excipients: (TRIS) 0.45
(TRIS-HCl) 0.70
In one embodiment the formulated DNA is prepared by aseptically mixing equal
volumes of the plasmid DNA, pDL1680, and the poloxamer 188 as follows:
pDL1680 Poloxamer 188
Dilute to 2.0 mg/mL DNA Facilitating Agent (10% w/v Poloxamer 188 in WFI)
Filter through 0.2 micrometer filter Filter through 0.2 micrometer filter
Mix 1:1 v/v to a final concentration of 1.0 mg/mL DNA, 5% w/v Poloxamer 188
and
5.0 mM Tris-HCl
1
Filter sterilize through 0.2 micrometer filter
CA 02426582 2003-04-17
WO 02/061040 PCT/USO1/51307
28
After filtration, the composition or mixture may be lyophilized and stored.
When
needed for use, the lyophilized composition can be rehydrated in normal saline
solution.
Example 12: Formulated Del-1 Expression Plasmid Delivered with Electroporation
S The term "pulse voltage device", or "pulse voltage injection device" as used
herein
relates to an apparatus that is capable of causing or causes uptake of nucleic
acid
molecules into the cells of an organism by emitting a localized pulse of
electricity to the
cells, thereby causing the cell membrane to destabilize and result in the
formation of
passageways or pores in the cell membrane. It is understood that conventional
devices of
this type are calibrated to allow one of ordinary skill in the art to select
and/or adjust the
desired voltage amplitude and/or the duration of pulsed voltage and therefore
it is expected
that future devices that perform this function will also be calibrated in the
same manner.
The type of injection device is not considered a limiting aspect of the
present invention.
The primary importance of a pulse voltage device is, in fact, the capability
of the device to
facilitate delivery of compositions of the invention into the cells of an
organism. The
pulse voltage injection device can include, for example, an electroporetic
apparatus as
described in U.S. Patent 5,439,440, U.S. Patent 5,704,908 or U.S. Patent
5,702,384 or as
published in PCT WO 96/12520, PCT WO 96/12006, PCT WO 95/19805, and PCT WO
97/07826, all of which are incorporated herein by reference in their entirety.
The term "apparatus" as used herein relates to the set of components that upon
combination allow the delivery of compositions of the invention into the cells
of an
organism by pulse voltage delivery methods. The apparatus of the invention can
be a
combination of a syringe or syringes, various combinations of electrodes,
devices that are
useful for target selection by means such as optical fibers and video
monitoring, and a
generator for producing voltage pulses which can be calibrated for various
voltage
amplitudes, durations and cycles. The syringe can be of a variety of sizes and
can be
selected to inject compositions of the invention at different delivery depths
such as to the
skin of an organism such as a mammal, or through the skin.
In one embodiment, administration of vector (plasmid) and use of formulations
for
delivery are by pulse voltage delivery to cells in combination with needle or
needle free
injection, or by direct applied pulse voltage wherein the electroporation
device electrodes
are pressed directly against the targeted tissue or cells, such as for example
epidermal
cells, and the vector is applied topically before or after pulse application
and delivered
through and or to the cells.
CA 02426582 2003-04-17
WO 02/061040 PCT/USO1/51307
29
The route of administration of any selected vector construct will depend on
the
particular use for the expression vectors. In general, a specific formulation
for each vector
construct used will focus on vector delivery with regard to the particular
targeted tissue,
the pulse voltage delivery parameters, followed by demonstration of efficacy.
Delivery
studies will include uptake assays to evaluate cellular uptake of the vectors
and expression
of the DNA of choice. Such assays will also determine the localization of the
target DNA
after uptake, and establishing the requirements for maintenance of steady-
state
concentrations of expressed protein. Efficacy and cytotoxicity can then be
tested.
Toxicity will not only include cell viability but also cell function.
Muscle cells have the unique ability to take up DNA from the extracellular
space
after simple injection of DNA particles as a solution, suspension, or colloid
into the
muscle. Expression of DNA by this method can be sustained for several months.
Studies were conducted to determine the potential of Del-1, when delivered IM
as
a non-viral gene medicine, to increase vascular density in hindlimb muscle of
mice.
Briefly, 10 micrograms of PINCTM polymer-formulated mDel-1, hDel-1 or hVEGFI6s
plasmid (10 micrograms plasmid dose) were injected into the tibialis anterior
muscles of
male CD-1 mice. In some instances, electroporation was utilized to further
enhance the
transfection efficiency of myofibers over that achieved with formulated
plasmid. Injected
muscles were harvested 7 days post-treatment, snap frozen, cryo-sectioned, and
immunohistochemical analyses for the capillary endothelial surface antigen CD
31, Del-1,
and VEGFi6s were performed. Images were analyzed using the OPTIMAS image
analysis
software equipped with a custom macro to calculate the capillary:myocyte ratio
in skeletal
muscle. Electroporation increased transfection efficiency and transgene
expression by as
much as two logs. Electroporation of untreated muscles resulted in little or
no detectable
pathology and did not affect capillary:myofiber ratio (2.56 nonelectroporation
versus 2.52
electroporated). Injection of either formulated del-1 or VEGFI6s expression
plasmids
elicited significant increases in capillary:myofiber ratio (p<0.05) that
ranged between 30
and 50 percent above control values. Enhanced transgene expression resulting
from
electroporation further enhanced capillary:myocyte ratio by as much as 70%
versus
control although the effect of electroporation was not significant in all
cases. Increased
immunostaining for CD 31 was observed in close proximity to areas of transgene
expression. The pattern of CD 31 immunostaining was similar in muscles
injected with
either formulated Del-1 or VEGF,~s expression plasmids. However,
pharmacological
levels of VEGF~6s achieved through the use of electroporation were associated
with vessel
clusters and severe localized edema, which were not observed in other
treatment groups.
These results suggest that non-viral formulated Del-1 expression system may be
useful in
CA 02426582 2003-04-17
WO 02/061040 PCT/USO1/51307
stimulating the re-vascularization of ischemic tissue and point to the utility
of
electroporation as a tool for investigating the dose response and therapeutic
index of non-
viral gene medicines.
Example 13: Comparison of expression levels measured after delivery of plasmid
5 formulated with either saline or poloxamer to pig myocardium
Studies were undertaken to compare expression levels measured after delivery
of
plasmid (1 mg/mL) formulated in saline or in 5% poloxamer. pDL1680 (1 mg/ml)
with
5% poloxamer 188 in isotonic saline was compared with pDL1680 (lmg/ml) in
isotonic
saline. SPF Yorkshire pigs (approximately SO kg) were used in the studies.
10 Test article (10 ml, 10 mg plasmid dose) was delivered into the mid region
of the
AIV (or other vein if AIV could not be accessed) by rIV infusion using a
balloon catheter.
The catheter was positioned in the target vein under fluoroscopic guidance
with
radiographic contrast medium used as needed. The delivery site was assessed by
administering contrast medium to determine the region of distribution (i.e.,
blush), and to
15 ensure correction positioning of the catheter to minimize collateral
drainage. Following
positioning of the catheter a 10 ml bolus of formulated Del-1 plasmid was
delivered under
either maximal hand pressure or over a period of approximately 10 seconds or
less.
Results indicated that delivery under maximal hand pressure increased
transfection of the
myocardium compared with administration under controlled pressure.
20 The target region of myocardium identified as the region of most intense
blush
when contrast medium was administered immediately prior to administration of
test article
was harvested (total area approximately 4.5 x 4.5 cm) and sectioned into
approximately 1
x 1 cm cubes. These tissue samples, as well as samples form more distal
regions of
myocardium and samples of lung, liver, kidney, and spleen were assayed for
hDel-1
25 transgene mRNA by quantitative rtPCR ("qrtPCR"). In addition,
immunohistochemistry
for hDel-1 protein was performed on samples of myocardium taken from the
target region
of delivery.
The delivery procedure was well-tolerated with no major in-life events or
gross
pathology associated with the myocardium noted. Minor bruising was noted at
the site of
30 balloon inflation in some pigs. Figure 15 shows expression of hDel-1 mRNA
within the
myocardium of pigs treated by rIV delivery with either pDL1680 formulated in
saline or
pDL1680 formulated with 5 % poloxamer 188. Data points represent the mean hDel-
1
mRNA level within the 4.5 x 4.5 cm target region for delivery. Solid circles
show results
with maximum hand pressure while open circles show results with timed
administration.
Pooled treatment group means are shown as horizontal lines in the figure.
Results for
CA 02426582 2003-04-17
WO 02/061040 PCT/USO1/51307
31
hDel-1 mRNA shown in Figure 15 indicate that formulation with 5 % poloxamer
188
yielded approximately 6x higher levels of hDel-1 mRNA within the targeted
region of
myocardium versus formulation in saline (p=0.036) regardless of whether
maximum hand
pressure or timed administration was performed. Expression of the hDel-1
transgene in
more distal regions of the myocardium and distal organs was absent or
negligible and
unaffected by formulation.
Example 14: Use of Del-1 and VEGF in combination for angio eg nesis
The cDNA encoding VEGF 165 was chemically synthesized and cloned into a
mammalian expression plasmid having a (CMV) promoter, a S' synthetic intron,
the hDel
1 cDNA, and the 3' polyadenylation signal and untranslated region from the
human growth
hormone gene as with the Del-1 expression plasmid shown in Figure 3b. The
coding
sequence of VEGF used is shown on Figure 16. The codon usage of VEGF 165 was
analyzed respective to the known preferred codons found in highly expressed
human
proteins. Eight codons of the native VEGF 165 sequence that represent rarely
used codons
1 S were altered to conform with those codons used in highly expressed human
proteins. The
modified codons are shown on Figure 16 where the native codon is depicted
between the
strands.
In Vitro assa~ofDel-1 and VEGF combination in tubule ormation
Using Primary Endothelial Cells from Human Umbilical Veins (HUVEC cells) a
3D-collagen gel was constructed in which Del-1, VEGF, or Del-1/VEGF was added.
Cells were photographed at 2 days to determine the proficiency of Del-1, VEGF,
or the
combination in inducing tubule formation. The combination group of Del-l and
VEGF
showed superior tubule formation to control, Del-1, or VEGF alone.
In Vivo assay ofDel-1 and VEGF combination in capillary development
Ten total micrograms of 5% poloxamer 188 formulated plasmid DNA encoding
Del-1 (10 micrograms), VEGF (10 micrograms), Del-1 and VEGF (at 5 micrograms
per
plasmid), or an empty vector control were injected into the anterior tibialis
of male CD-1
mice. Immediately following injection of the formulated plasmid DNA,
electroporation
was performed. Approximately, two minutes after injection, an electric field
was applied
in the form of 2 square wave pulses (one per second) of 25 millisecond ("ms")
each and
375 V/cm delivered by an Electro Square Porator (T820, Genetronics, San Diego,
CA).
The clamp electrodes consist of 2 stainless steel parallel plate calipers (1.5
cm z) that are
placed in contact with the skin so that the leg is held in a semi-extended
position
CA 02426582 2003-04-17
WO 02/061040 PCT/USO1/51307
32
throughout pulse administration. Typically the leg of the mouse was positioned
between
the two plates, which were compressed together until snug with a 3-4 mm
separation
distance between the plates. Transgene mRNA expression was measured using rt-
PCR at
7 and 28 days, and capillary to myocyte ("C/M") ratios were calculated by
immunohistochemistry on anti-CD31 stained tissue. Transgene mRNA expression
showed elevated expression at 7 days, which decreased by several logs at 28
days. As
shown in Figure 17, C/M ratios for Del-1 and VEGF alone were 1.5 to 2-fold
better than
empty vector, confirming earlier experiments. Suboptimal doses of Del-1 and
VEGF in
combination yielded a remarkable increase in capillary endothelial cell
density in
comparison with optimal doses (twice the dose of either) of the genes alone.
In the Del-
1NEGF combination, resulting CD-31 positive endothelial cells were too
numerous to
count. The combination of Del-1 and VEGF was also shown experimentally to
increase
exercise tolerance over control plasmid or VEGF alone.
Although the combination of Del-1 and VEGF in this example was formulated
using two separate plasmids, one skilled in the art would understand that Del-
1 and VEGF
can also be expressed from a single plasmid carrying two transcription
expression units or
from a single transcription expression unit having an internal ribosomal entry
site.
Example 15: Poloxamer formulations for gene deliver~y retrograde delivery
In the nomenclature of poloxamers, the non-proprietary name "poloxamer" is
followed by a number, the first two digits of which, when multiplied by 100,
equals the
approximate molecular weight ("mw") of the polyoxypropylene ("POP") and the
third
digit, when multiplied by 10 equals the approximate % by weight of the
polyoxyethylene
("POE"). Thus, poloxamer 188 would have an average POP mw of approximately
1800
and an average POE % of 80%. Calculated according to the poloxamer
nomenclature for
poloxamer 188 (a.k.a. F68) the average number of POP groups are derived as
follows:
1800 = 58 (mw of C3H60) = 31 POP units. The total mw = 1800 = (20/100) = 9000.
The
average number of POE are derived as follows: (total approximate mw - mw POP)
s 44
(mw of C2H40) is thus (9000-1800) = 7200 = 44 = 163. Therefore the formula for
poloxamer 188 (a.k.a. F68): HO-(CZH4O)$Z-(C3H6O)31- (CZH40)g2-H.
Alternatively, from the formula HO-(C2H4O)X-(C3H6O)y (CZH40)X H, the average
molecular weight, the percentage of POE, and the numbers of POE and POP units
can be
otherwise derived depending on the variable known. Thus if the total mw and %
POE is
known the formula can be derived as follows:
Average number of POE groups are derived as follows: (total approximate mw -
18 (the mw of the terminal hydroxy and hydrogen groups)) x wt% POE) = mw POE =
44
CA 02426582 2003-04-17
WO 02/061040 PCT/USO1/51307
33
= number of POE groups, therefore for F68; ((8400-18) x 80%) = 6705.6 = 44 =
152.4 (-
2 = 76)
Average number of POP groups can be derived as follows: ((total approximate mw
- 18) - mw POE) = mw POP = 58. Therefore for F68: ((8400-18) - 6705.6 = 1676.4
T 58
= 30. The formula for poloxamer 188, a.k.a. F68, would thus be: HO-(CzH40)76
(C3H6O)30- (C2HaO)76-H
In the BASF nomenclature, a letter describing the physical form of the
poloxamer
is followed by a first number arbitrarily representing the molecular weight of
the POP
step-wise up the y axis of the poloxamer grid and the second number
representing the
POE. PLURONICO F68 is the BASF trademark for poloxamer 188. BASF gives 8400 as
the average mw for F68 but states an average mw of 8600 for F68NF grade and
gives
values of POE = 80 (x 2), and POP = 27: therefore the POP mw = 1566, POE % =
81.6%
with the resulting formula: HO-(CZH40)g0-(C3H60)27- (C2H40)8o-H which would
have a
resulting mw of 18 + 7040 +1566 = 8624
Because in actual practice, poloxamers are typically synthesized according to
a.
process in which a hydrophobe of the desired molecular weight is generated by
the
controlled addition of propylene oxide to the two hydroxyl groups of propylene
glycol
followed by addition of ethylene oxide to sandwich the hydrophobe between
hydrophilic
groups results in a population of molecules in a relatively circumscribed
range of a
molecular weights characterized by a hydrophobe having a defined average
molecular
weight and total average percentage of hydrophile groups.
Since both the ratio and weights of EO and PO vary within this family of
surfactants, BASF developed a PLURONICO grid to provide a graphic
representation of
the relationship between copolymer structure, physical form and surfactant
characteristics.
On the PLURONIC~ surfactant grid the molecular weight ranges of the hydrophobe
(propylene oxide) are plotted against the weight-percent of the hydrophile
(ethylene oxide)
present in each molecule. Poloxamer species defined by their location on the
PLURONIC~ grid can be expected to have shared properties that are a function
of their
total molecular weight and relative hydrophobicity.
The PLLrRONICO Grid, a facsimile of which is shown on Figure 18, clarifies the
use of the letter-number combinations to identify the various products of the
PLURONICO series. The alphabetical designation explains the physical form of
the
product: 'L' for liquids, 'P' for pastes, 'F' for solid forms. The first digit
(two digits in a
three-digit number) in the numerical designation, multiplied by 300, indicates
the
approximate molecular weight of the hydrophobe (vertical axis at the left of
the Grid). The
CA 02426582 2003-04-17
WO 02/061040 PCT/USO1/51307
34
last digit, when multiplied by 10, indicates the approximate ethylene oxide
content in the
molecule, read from the horizontal axis.
Figure 19 shows the chemical characteristics of poloxamers determined to
increase
delivery of plasmid DNA to muscle. Preferred poloxamers are circled on Figure
18 and
include poloxamers represented by PLURONICSO F38, F68, F87, F88, F108 and
F127.
In particular, the poloxamer 188, typified by PLURONIC~ F68 has been shown by
the
present inventors to significantly increase the delivery of plasmid DNA with
concomitant
expression of angiogenic transgenes in both skeletal and cardiac muscle.
Example 16
Figure 3B and 3C depict the structure of the preferred plasmid vector for use
to
deliver an angiogenic protein to the ischemic tissue. As shown, the plasmid
include post-
transcriptional elements (5' UTR including a synthetic intron and hGH polyA
signal) that
could be expected to improve the level and fidelity of protein expression. In
this
embodiment, the expression cassette, as shown in Figure 3B, includes a CMV 5'
UTR,
termed UT12 (SEQ. ID. N0:8) in addition to a synthetic intron, IVSB, within
the 5' UTR.
The sequence of UT12 (SEQ ID NO: 8) is shown below:
5'TCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGAC
CGATCCAGCCTCCGCGGCCGGGAACGGTGCATTGGAACGCGGATTCCCCGTG3'
Cryptic splicing in transcripts from eukaryotic expression vectors is
obviously
undesirable. To obtain control over the splicing pattern and to maximize gene
expression,
suboptimal introns can be replaced by a strong intron. A synthetic intron with
consensus
splicing sequences should be optimal for this purpose. The synthetic intron of
the present
embodiment (IVS 8) includes consensus sequences for the 5' splice site, 3'
splice site and
branch point. When incorporated into eukaryotic vectors designed to express
therapeutic
genes, the synthetic intron will direct the splicing of RNA transcripts in a
highly efficient
and accurate manner, thereby minimizing cryptic splicing and maximizing
production of
the desired gene product.
The first and sixth position of the S' splice site consensus sequence are
partially
ambiguous. The S' splice site pairs with U1 snRNA. The chosen sequence
minimizes the
free energy of helix formation between U1 RNA and the synthetic 5' splice
site.
5'ss 5' CAGGUAAGU 3' SEQ.ID.NO: 9
U1 RNA 3' GUCCAUUCA 5' SEQ.ID.NO: 10
In mammals, the branch point sequence is very ambiguous. The branch point
sequence, except for a single bulged A residue, pairs with U2 snRNA. The
chosen
sequence minimizes the free energy of helix formation between U2 RNA and the
synthetic
CA 02426582 2003-04-17
WO 02/061040 PCT/USO1/51307
branch point sequence. It also matches the branch point sequence that is
obligatory for
yeast pre-mRNA splicing. The branch point is typically located 18-38 nts
upstream of the
3' splice site. The branch point of the synthetic intron is located 24 nts
upstream from the
3' splice site.
5 BP 5' UACUAAC 3' SEQ.ID.NO: 11
U2 RNA 3' AUGAU G 5' SEQ.ID.NO: 12
The polypyrimidine tract of the consensus sequence for 3' splice sites is not
exactly
defined. At least 5 consecutive uracil residues are needed for optimal 3'
splice site
10 function. This concept is incorporated into the polypyrimidine tract of the
synthetic
intron, which has 7 consecutive uracil residues.
Splicing in vitro is optimal when introns are >80 nts in length. Although many
introns may be thousands of bases in length, most naturally occurring introns
are 90-200 nt
in length. The synthetic intron in the preferred embodiment, IVSB, the length
of the
15 synthetic intron is 118 nucleotides. The sequence of IVS8, (SEQ.ID.N0:13),
is shown
below:
5'ss
PacI ~ BbsI
NNNNNNNNNNTTAATTAACAGGTAAGTGTCTTCCTCCTGTTTCCTTCCCCCTGCT
PstI NheI
ATTCTGCTCAACCTTCCTATCAGAAACTGCAGTATCTGTATTTTTGCTAGCAGTT
BP 3'ss
~ EarI ~ NcoI
ATACTAACGGTTCTTTTTTTCTCTTCACAGGCCACCATGG
Exonic sequences are in boldface. N = any base. Consensus splicing signals are
double-
underlined. Restriction enzyme recognition sites are over-lined. The
restriction enzyme
BbsI may be used to cleave the DNA precisely at the 5' splice site, and Earl
may be used
to cleave the DNA precisely at the 3' splice site. The two restriction sites,
BbsI and Earl,
located within the synthetic intron, permit the intron to be easily and
precisely deleted.
The PstI and NheI sites are included to facilitate the verification of cloning
procedures.
Double-stranded DNA with this sequence may be prepared using mutually priming
long
oligonucleotides.
To more closely match the structure of naturally occurnng genes, which
typically
contain many introns, the synthetic intron may be inserted into the gene of
interest at
multiple locations. When multiple introns are inserted, however, care must be
taken to
ensure that the lengths of resultant internal exons are less than 300
nucleotides. If internal
exons are greater than 300 nucleotides in length, exon skipping may occur.
CA 02426582 2003-04-17
WO 02/061040 PCT/USO1/51307
36
The foregoing disclosure and description of the invention are illustrative and
explanatory thereof, and various changes in the size, shape, and materials, as
well as in the
details of the illustrated system may be made without departing from the
spirit of the
invention. The invention is claimed using terminology that depends upon a
historic
presumptive presentation that recitation of a single element covers one or
more, and
recitation of two elements covers two or more, and the like.
CA 02426582 2003-04-17
WO 02/061040 PCT/USO1/51307
SEQUENCE LISTING
<110> VALENTIS,
INC.
<120> GENE DELIVERY AND METHODFOR TREATMENT
FORMULATION OF ISCHEMIC
CONDITIONS
<130> 265/043
<140> not yet
assigned
<141> 2001-10-19
<150> US 60/242,277
<151> 2000-10-20
<150> US 60/294,454
<151> 2001-05-29
<160> 13
<170> PatentIn
version 3.1
<210> 1
<211> 1443
<212> DNA
<213> Homo Sapiens
<400> 1
atgaagcgct cggtagccgtctggctcttggtcgggctcagcctcggtgtcccccagttc60
ggcaaaggtg atatttgtgatcccaatccatgtgaaaatggaggtatctgtttgccagga120
ttggctgatg gttccttttcctgtgagtgtccagatggcttcacagaccccaactgttct180
agtgttgtgg aggttgcatcagatgaagaagaaccaacttcagcaggtccctgcactcct240
aatccatgcc ataatggaggaacctgtgaaataagtgaagcataccgaggggatacattc300
ataggctatg tttgtaaatgtccccgaggatttaatgggattcactgtcagcacaacata360
aatgaatgcg aagttgagccttgcaaaaatggtggaatatgtacagatcttgttgctaac420
tattcctgtg agtgcccaggcgaatttatgggaagaaattgtcaatacaaatgctcaggc480
ccactgggaa ttgaaggtggaattatatcaaaccagcaaatcacagcttcctctactcac540
cgagctcttt ttggactccaaaaatggtatccctactatgcacgtcttaataagaagggg600
cttataaatg cgtggacagctgcagaaaatgacagatggccgtggattcagataaatttg660
caaaggaaaa tgagagttactggtgtgattacccaaggagccaagaggattggaagccca720
gagtatataa aatcctacaaaattgcctacagtaatgatggaaagacttgggcaatgtac780
aaagtgaaag gcaccaatgaagacatggtgtttcgtggaaacattgataacaacactcca840
tatgctaact ctttcacaccccccataaaagctcagtatgtaagactctatccccaagtt900
tgtcgaagac attgcactttgcgaatggaacttcttggctgtgaactgtcgggttgttct960
gagcctctgg gtatgaaatcaggacatatacaagactatcagatcactgcctccagcatc1020
1
CA 02426582 2003-04-17
WO 02/061040 PCT/USO1/51307
ttcagaacgctcaacatggacatgttcacttgggaaccaaggaaagctcggctggacaag1080
caaggcaaagtgaatgcctggacctctggccacaatgaccagtcacaatggttacaggtg1140
gatcttcttgttccaaccaaagtgactggcatcattacacaaggagctaaagattttggt1200
catgtacagtttgttggctcctacaaactggcttacagcaatgatggagaacactggact1260
gtataccaggatgaaaagcaaagaaaagataaggttttccagggaaattttgacaatgac1320
actcacagaaaaaatgtcatcgaccctcccatctatgcacgacacataagaatccttcct1380
tggtcctggtacgggaggatcacattgcggtcagagctgctgggctgcacagaggaggaa1440
tga 1443
<210>
2
<211>
5195
<212>
DNA
<213>
Artificial
Sequence
<220>
<223>
Sequence
of the
pDL1680
Human
Del-1
Expression
Plasmid
<400>
2
ggtacggtcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccc60
cgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccat120
tgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtat180
catatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattat240
gcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatc300
gctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgac360
tcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaa420
aatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggt480
aggcgtgtacggtgggaggtctatataagcagagctcgtttagtgaaccgtcagatcgcc540
tggagacgccatccacgctgttttgacctccatagaagacaccgggaccgatccagcctc600
cgcggccgggaacggtgcattggaacgcggattccccgtgttaattaacaggtaagtgtc660
ttcctcctgtttccttcccctgctattctgctcaaccttcctatcagaaactgcagtatc720
tgtatttttgctagcagtaatactaacggttctttttttctcttcacaggccaccaagct780
tatgaagcgctcggtagccgtctggctcttggtcgggctcagcctcggtgtcccccagtt840
cggcaaaggtgatatttgtgatcccaatccatgtgaaaatggaggtatctgtttgccagg900
attggctgatggttccttttcctgtgagtgtccagatggcttcacagaccccaactgttc960
tagtgttgtggaggttgcatcagatgaagaagaaccaacttcagcaggtc~ctgcactcc1020
taatccatgccataatggaggaacctgtgaaataagtgaagcataccgaggggatacatt1080
2
CA 02426582 2003-04-17
WO 02/061040 PCT/USO1/51307
cataggctatgtttgtaaatgtccccgaggatttaatgggattcactgtcagcacaacat1140
aaatgaatgcgaagttgagccttgcaaaaatggtggaatatgtacagatcttgttgctaa1200
ctattcctgtgagtgcccaggcgaatttatgggaagaaattgtcaatacaaatgctcagg1260
cccactgggaattgaaggtggaattatatcaaaccagcaaatcacagcttcctctactca1320
ccgagctctttttggactccaaaaatggtatccctactatgcacgtcttaataagaaggg1380
gcttataaatgcgtggacagctgcagaaaatgacagatggccgtggattcagataaattt1440
gcaaaggaaaatgagagttactggtgtgattacccaaggagccaagaggattggaagccc1500
agagtatataaaatcctacaaaattgcctacagtaatgatggaaagacttgggcaatgta1560
caaagtgaaaggcaccaatgaagacatggtgtttcgtggaaacattgataacaacactcc1620
atatgctaactctttcacaccccccataaaagctcagtatgtaagactctatccccaagt1680
ttgtcgaagacattgcactttgcgaatggaacttcttggctgtgaactgtcgggttgttc1740
tgagcctctgggtatgaaatcaggacatatacaagactatcagatcactgcctccagcat1800
cttcagaacgctcaacatggacatgttcacttgggaaccaaggaaagctcggctggacaa1860
gcaaggcaaagtgaatgcctggacctctggccacaatgaccagtcacaatggttacaggt1920
ggatcttcttgttccaaccaaagtgactggcatcattacacaaggagctaaagattttgg1980
tcatgtacagtttgttggctcctacaaactggcttacagcaatgatggagaacactggac2040
tgtataccaggatgaaaagcaaagaaaagataaggttttccagggaaattttgacaatga2100
cactcacagaaaaaatgtcatcgaccctcccatctatgcacgacacataagaatccttcc2160
ttggtcctggtacgggaggatcacattgcggtcagagctgctgggctgcacagaggagga2220
atgagggtatactacgaccgtctagaaaagccgaattctgcaggaattgggtggcatccc2280
tgtgacccctccccagtgcctctcctggccctggaagttgccactccagtgcccaccagc2340
cttgtcctaataaaattaagttgcatcattttgtctgactaggtgtccttctataatatt2400
atggggtggaggggggtggtatggagcaaggggcaagttgggaagacaacctgtagggct2460
cgagggggggcccggtactctgccggtctccctatagtgagtcgtattaatttcgataag2520
ccaggttaacctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgg2580
gcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagc2640
ggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcagg2700
aaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgct2760
ggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtca2820
gaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccct2880
cgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttc2940
3
CA 02426582 2003-04-17
WO 02/061040 PCT/USO1/51307
gggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgt3000
tcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatc3060
cggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagc3120
cactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtg3180
gtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagcc3240
agttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtag3300
cggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaaga3360
tcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggat3420
tttggtcatgagcgcgcctaggcttttgcaaagatcgatcaagagacaggatgaggatcg3480
tttcgcatgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagagg3540
ctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccgg3600
ctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaat3660
gaactgcaagacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgca3720
gctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccg3780
gggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgat3840
gcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaa3900
catcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctg3960
gacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgagcatg4020
cccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtg4080
gaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctat4140
caggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgac4200
cgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgc4260
cttcttgacgagttcttctgagcgggactctggggttcgaaatgaccgaccaagcgacgc4320
ccaacctgccatcacgagatttcgattccaccgccgccttctatgaaaggttgggcttcg4380
gaatcgttttccgggacgccggctggatgatcctccagcgcggggatctcatgctggagt4440
tcttcgcccaccctaggcgcgctcatgagcggatacatatttgaatgtatttagaaaaat4500
aaacaaataggggttccgcgcacatttccccgaaaagtgccacctaaattgtaagcgtta4560
atattttgttaaaattcgcgttaaatttttgttaaatcagctcattttttaaccaatagg4620
ccgaaatcggcaaaatcccttataaatcaaaagaatagaccgagatagggttgagtgttg4680
ttccagtttggaacaagagtccactattaaagaacgtggactccaacgtcaaagggcgaa4740
aaaccgtctatcagggcgatggcccactacgtgaaccatcaccctaatcaagttttttgg4800
4
CA 02426582 2003-04-17
WO 02/061040 PCT/USO1/51307
ggtcgaggtgccgtaaagcactaaatcggaaccctaaagggagcccccgatttagagctt4860
gacggggaaagccggcgaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggcg4920
ctagggcgctggcaagtgtagcggtcacgctgcgcgtaaccaccacacccgccgcgctta4980
atgcgccgctacagggcgcgtcccattcgccattcaggctgcgcaactgttgggaagggc5040
gatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggc5100
gattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtg5160
agcgcgcgtaatacgactcactatagggcgaattg 5195
<210> 3
<211> 576
<212> DNA
<213> Artificial Sequence
<220>
<223> Codon optimized VEGF 165
<400> 3
atgaactttc tgctgtcttg ggtgcattgg agcctggccc tgctgctcta cctccaccat 60
gccaagtggt cccaggctgc acccatggca gaaggaggag ggcagaatca tcacgaagtg 120
gtgaagttca tggatgtcta tcagcgcagc tactgccatc caatcgagac cctggtggac 180
atcttccagg agtaccctga tgagatcgag tacatcttca agccatcctg tgtgcccctg 240
atgcgctgcg ggggctgctg caatgacgag ggcctggagt gtgtgcccac tgaggagtcc 300
aacatcacca tgcagattat gcggatcaaa cctcaccaag gccagcacat cggagagatg 360
agcttcctgc agcacaacaa atgtgaatgc agaccaaaga aagatagagc aagacaagaa 420
aatccctgtg ggccttgctc cgagcggaga aagcatctgt ttgtgcaaga tccgcagacg 480
tgtaaatgtt cctgcaaaaa cacagactcg cgttgcaagg cgaggcagct tgagttaaac 540
gaacgtactt gcagatgtga caagccgagg cggtga 576
<210> 4
<211> 25
<212> DNA
<213> Artificial sequence
<220>
<223> Del-1 sense PCR primer
<400> 4
tgacctccat agaagacacc gggac 25
<210> 5
<211> 25
<212> DNA
<213> Artificial sequence
CA 02426582 2003-04-17
WO 02/061040 PCT/USO1/51307
<220>
<223> Del-1 anti-sense PCR primer
<400> 5
gtgatgcaac ctccacaaca ctaga . 25
<210> 6
<211> 19
<212> DNA
<213> Artificial sequence
<220>
<223> VEGF anti-sense PCR primer
<400> 6
ggaggggtca cagggatgc 19
<210>
7
<211>
576
<212>
DNA
<213> Sapiens
Homo
<400>
7
atgaactttctgctgtcttgggtgcattggagccttgccttgctgctctacctccaccat60
gccaagtggtcccaggctgcacccatggcagaaggaggagggcagaatcatcacgaagtg120
gtgaagttcatggatgtctatcagcgcagctactgccatccaatcgagaccctggtggac180
atcttccaggagtaccctgatgagatcgagtacatcttcaagccatcctgtgtgcccctg240
atgcgatgcgggggctgctgcaatgacgagggcctggagtgtgtgcccactgaggagtcc300
aacatcaccatgcagattatgcggatcaaacctcaccaaggccagcacataggagagatg360
agcttcctacagcacaacaaatgtgaatgcagaccaaagaaagatagagcaagacaagaa420
aatccctgtgggccttgctcagagcggagaaagcatttgtttgtacaagatccgcagacg480
tgtaaatgttcctgcaaaaacacagactcgcgttgcaaggcgaggcagcttgagttaaac540
gaacgtacttgcagatgtgacaagccgaggcggtga 576
<210> 8
<211> 110
<212> DNA
<213> Artificial sequence
<220>
<223> 5' Untranslated region derived from CMV termed UT12
<400> 8
tcagatcgcc tggagacgcc atccacgctg ttttgacctc catagaagac accgggaccg 60
atccagcctc cgcggccggg aacggtgcat tggaacgcgg attccccgtg 110
<210> 9
<211> 9
6
CA 02426582 2003-04-17
WO 02/061040 PCT/USO1/51307
<212> RNA
<213> Artificial sequence
<220>
<223> 5' splice site sequence of a synthetic intron
<400> 9
cagguaagu
9
<210> 10
<211> 9
<212> RNA
<213> Homo Sapiens
<400> 10
guccauuca 9
<210> 11
<211> 7
<212> RNA
<213> Artificial sequence
<220>
<223> Branch point sequence for a synthetic intron
<400> 11
uacuaac 7
<210> 12
<211> 6
<212> RNA
<213> Homo sapiens
<400> 12
augaug 6
<210> 13
<211> 160
<212> DNA
<213> Artificial sequence
<220>
<223> A synthetic intron termed IVS8 where exonic sequences are
represented by n, n can be any base and can be longer or
shorter
<220>
<221> misc_feature
<222> (1). (10)
<223> any base
<220>
<221> misc_feature
<222> (151)..(160)
<223> any base
7
CA 02426582 2003-04-17
WO 02/061040 PCT/USO1/51307
<400> 13
nnnnnnnnnn ttaattaaca ggtaagtgtc ttcctcctgt ttccttcccc ctgctattct 60
gctcaacctt cctatcagaa actgcagtat ctgtattttt gctagcagtt atactaacgg 120
ttcttttttt ctcttcacag gccaccatgg nnnnnnnnnn 160
8
