Note: Descriptions are shown in the official language in which they were submitted.
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
MAMMALIAN ALPHA-HELICAL PROTEIN-53
BACKGROUND OF THE INVENTION
Inflammation normally is a localized, protective response to trauma or
microbial invasion that destroys, dilutes, or walls-off the injurious agent
and the injured
tissue. It is characterized in the acute form by the classic signs of pain,
neat, redness,
swelling, and loss of function. Microscopically it involves a complex series
of events,
including dilation of arterioles, capillaries, and venules, with increased
permeability and
blood flow, exudation of fluids, including plasma proteins, and leukocyte
migration into
l5 the area of inflammation.
Diseases characterized by inflammation are significant causes of
morbidity and mortality in humans. Commonly, inflammation occurs as a
defensive
response to invasion of the host by foreign, particularly microbial, material.
Responses
to mechanical trauma, toxins, and neoplasia also may results in inflammatory
reactions.
2 o The accumulation and subsequent activation of leukocytes are central
events in the
pathogenesis of most forms of inflammation. Deficiencies of inflammation
compromise
the host. Excessive inflammation caused by abnormal recognition of host tissue
as
foreign or prolongation of the inflammatory process may lead to inflammatory
diseases
as diverse as diabetes, arteriosclerosis, cataracts, reperfusion injury, and
cancer, to post-
2 5 infectious syndromes such as in infectious meningitis, rheumatic fever,
and to
rheumatic diseases such as systemic lupus erythematosus and rheumatoid
arthritis. The
centrality of the inflammatory response in these varied disease processes
makes its
regulation a major element in the prevention control or cure of human disease.
Thus,
there is a need to discover cytokines, which contribute to inflammation and
3 0 inflammatory related diseases so that antagonists such as antibodies can
be
administered to down-regulate the cytokine so as to ameliorate the
inflammation.
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
2
DESCRIPTION OF THE INVENTION
Introduction
The present invention addresses this need by providing novel
polypeptides and related compositions and methods and their antagonists.
Within one
aspect, the present invention provides an isolated polynucleotide encoding a
mammalian cytokine termed Zalpha53. The data show that the cytokine is
involved in
the inflammation response. Thus, antagonists of Zalpha53 can be used to lessen
inflammation especially inflammation associated with coronary heart disease,
rheumatoid arthritis, arteriosclerosis, Crohn's disease and inflammatory bowel
disease.
Two variants have been discovered. The first variant is SEQ ID NOs: 1
and 2. The polypeptide has a signal sequence extending from amino acid residue
1 to
amino acid residue 25. The mature polypeptide is SEQ ID NO: 3. The Zalpha53
polypeptide has four alpha helices, A, B, C and D. Helix A extends from amino
acid
residue 28 to amino acid residue 43, and is also represented by SEQ ID NO: 4.
Helix B
extends from amino acid residue 74 to amino acid residue 88, and is also
represented by
SEQ ID NO: S.Helix C of SEQ ID NO: 2 extends from amino acid residue extends
from amino acid residue 91 to amino acid residue 106, and is also represented
by SEQ
1D NO: 6. Helix D extends from amino acid residue 147 to amino acid residue
162, and
is also represented by SEQ ID NO: 7. '
2 o The second variant is SEQ ID NOs: 10 and 20. The polypeptide of SEQ
ID NO: 20 has a signal sequence extending from amino acid residue 1 to amino
acid
residue 25. The mature polypeptide is SEQ ID NO: 21. The polypeptide also has
four
alpha helices, A, B, C and D. Helix A extends from amino acid residue 28 to
amino
acid residue 43 of SEQ 1D NO: 20, and is also represented by SEQ ID NO: 28.
Helix B
2 5 extends from amino acid residue 61 to amino acid residue 76 of SEQ ID NO:
20, and is
also represented by SEQ ID NO: 29. Helix C extends from.amino acid residue 79
to
amino acid residue 94 of SEQ DJ NO: 20, and is also represented by SEQ 117 NO:
30.
Helix D extends from amino acid residue 135 to amino acid residue 150 of SEQ
ID
NO: 20, and is also represented by SEQ ID NO: 31.
3 0 Within a second aspect of the invention there is provided an expression
vector comprising (a) a transcription promoter; (b) a DNA segment encoding
Zalpha53
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
3
polypeptide, and (c) a transcription terminator, wherein the promoter, DNA
segment,
and terminator are operably linked.
Within a third aspect of the invention there is provided a cultured
eukaryotic or prokaryotic cell into which has been introduced an expression
vector as
disclosed above, wherein said cell expresses a protein polypeptide encoded by
the DNA
segment.
Within a further aspect of the invention there is provided a chimeric
polypeptide consisting essentially of a first portion and a second portion
joined by a
peptide bond. The first portion of the chimeric polypeptide consists
essentially of (a) a
1 o Zalpha53 polypeptide (b) allelic variants of Zalpha53; and (c) protein
polypeptides that
are at Least 90°Io identical to (a) or (b). The second portion of the
chimeric polypeptide
consists essentially of another polypeptide such as an affinity tag. Within
one
embodiment the affinity tag is an immunoglobulin Fc polypeptide. The invention
also
provides expression vectors encoding the chimeric polypeptides and host cells
transfected to produce the chimeric polypeptides.
Within an additional aspect of the invention there is provided an
antibody that specifically binds to a Zalpha53 polypeptide as disclosed above,
and also
an anti-idiotypic antibody that neutralizes the antibody to a Zalpha53
polypeptide.
An additional embodiment of the present invention relates to a peptide
2 0 or polypeptide that has the amino acid sequence of an epitope-bearing
portion of a
Zalpha53 polypeptide having an amino acid sequence described above. Peptides
or
polypeptides having the amino acid sequence of an epitope-bearing portion of a
Zalpha53 polypeptide of the present invention include portions of such
polypeptides
with at Least nine, preferably at Least 15 and more preferably at Least 30 to
50 amino
2 5 acids, although epitope-bearing polypeptides of any length up to and
including the
entire amino acid sequence of a polypeptide of the present invention described
above
are also included in the present invention. Examples of such epitope binding
regions are
SEQ ID NOs: 2-18, and 20-37. Also claimed are any of these polypeptides that
are
fused to another polypeptide or carrier molecule.
3 0 The teachings of all the references cited herein are incorporated in their
entirety herein by reference.
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
4
Prior to setting forth the invention in detail, it may be helpful to the
understanding thereof to define the following terms:
The term "affinity tag" is used herein to denote a polypeptide segment
that can be attached to a second polypeptide to provide for purification or
detection of
the second polypeptide or provide sites for attachment of the second
polypeptide to a
substrate. In principal, any peptide or protein for which an antibody or other
specific
binding agent is available can be used as an affinity tag. Affinity tags
include a poly-
histidine tract, protein A, Nilsson et al., EMBO J. 4:1075 (1985); Nilsson et
al.,
Methods Eyzzy~i.ol. 198:3 (1991), glutathione S transferase, Smith and
Johnson, Gefae
I o X7:31 (1988), Glu-Glu affinity tag, Grussenmeyer et al., PYOG. Natl. Acad.
Sci. USA
82:7952-4 (1985), substance P, FlagTM peptide, Hopp et al., Biotechfaology
6:1204-1210
(1988), streptavidin binding peptide, or other antigenic epitope or binding
domain. See,
in general, Ford et al., Protein Expressiofz afi.d Purificatiofa 2: 95-107
(1991). DNAs
encoding affinity tags are available from commercial suppliers (e.g.,
Pharmacia
Biotech, Piscataway, NJ).
The term "allelic variant" is used herein to denote any of two or more
alternative forms of a gene occupying the same chromosomal locus. Allelic
variation
arises naturally through mutation, and may result in phenotypic polymorphism
within
populations. Gene mutations can be silent (no change in the encoded
polypeptide) or
2 0 may encode polypeptides having altered amino acid sequence. The term
allelic variant
is also used herein to denote a protein encoded by an allelic variant of a
gene.
The terms "amino-terminal" and "carboxyl-terminal" are used herein to
denote positions within polypeptides. Where the context allows, these terms
are used
with reference to a particular sequence or portion of a polypeptide to denote
proximity
2 5 or relative position. For example, a certain sequence positioned carboxyl-
terminal to a
reference sequence within a polypeptide is located proximal to the carboxyl
terminus of
the reference sequence, but is not necessarily at the carboxyl terminus of the
complete
polypeptide.
The term "complementlanti-complement pair" denotes non-identical
3 0 moieties that form a non-covalently associated, stable pair under
appropriate conditions.
For instance, biotin and avidin (or streptavidin) are prototypical members of
a
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
complement/anti-complement pair. Other exemplary complement/anti-complement
pairs include receptor/ligand pairs, antibody/antigen (or hapten or epitope)
pairs,
sense/antisense polynucleotide pairs, and the like. Where subsequent
dissociation of
the eomplement/anti-complement pair is desirable, the complement/anti-
complement
5 pair preferably has a binding affinity of <109 M-1.
The term "complements of a polynucleotide molecule" is a
polynucleotide molecule having a complementary base sequence and reverse
orientation
as compared to a reference sequence. For example, the sequence 5' ATGCACGGG 3'
is complementary to 5' CCCGTGCAT 3'.
1 o The term "contig" denotes a polynucleotide that has a contiguous stretch
of identical or complementary sequence to another polynucleotide. Contiguous
sequences are said to "overlap" a given stretch of polynucleotide sequence
either in
their entirety or along a partial stretch of the polynucleotide. For example,
representative contigs to the polynucleotide sequence 5'-ATGGCTTAGCTT-3' are
5'-
TAGCTTgagtct-3' and 3'-gtcgacTACCGA-5'.
The term "degenerate nucleotide sequence" denotes a sequence of
nucleotides that includes one or more degenerate codons (as compared to a
reference
polynucleotide molecule that encodes a polypeptide). Degenerate codons contain
different triplets of nucleotides, but encode the same amino acid residue
(i.e., GAU and
2 o GAC triplets each encode Asp).
The term "expression vector" is used to denote a DNA molecule, linear
or circular, that comprises a segment encoding a polypeptide of interest
operably linked
to additional segments that provide for its transcription. Such additional
segments
include promoter and terminator sequences, and may also include one or more
origins
2 5 of replication, one or more selectable markers, an enhancer, a
polyadenylation signal,
etc. Expression vectors are generally derived from plasmid or viral DNA, or
may
contain elements of both.
The term "isolated", when applied to a polynucleotide, denotes that the
polynucleotide has been removed from its natural genetic milieu and is thus
free of
3 0 other extraneous or unwanted coding sequences, and is in a form suitable
for use within
genetically engineered protein production systems. Such isolated molecules are
those
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
that are separated from their natural environment and include cDNA and genomic
clones. Isolated DNA molecules of the present invention are free of other
genes with
which they are ordinarily associated, but may include naturally occurring 5'
and 3'
untranslated regions such as promoters and terminators. The identification of
associated regions will be evident to one of ordinary skill in the art (see
for example,
Dynan and Tijan, Nature 316:774-7~ (1985).
An "isolated" polypeptide or protein is a polypeptide or protein that is
found in a condition other than its native environment, such as apart from
blood and
animal tissue. In a preferred form, the isolated polypeptide is substantially
free of other
1 o polypeptides, particularly other polypeptides of animal origin. It is
preferred to provide
the polypeptides in a highly purified form, i.e. greater than 95% pure, more
preferably
greater than 99% pure. When used in this context, the term "isolated" does not
exclude
the presence of the same polypeptide in alternative physical forms, such as
dimers or
alternatively glycosylated or derivatized forms.
The term "operably linked", when referring to DNA segments, indicates
that the segments are arranged so that they function in concert for their
intended
purposes, e.g., transcription initiates in the promoter and proceeds through
the coding
segment to the terminator.
The term "ortholog" denotes a polypeptide or protein obtained from one
2 0 species that is the functional counterpart of a polypeptide or protein
from a different
species. Sequence differences among orthologs are the result of speciation.
"Paralogs" are distinct but structurally related proteins made by an
organism. Paralogs are believed to arise through gene duplication. For
example, a-
globin, b-globin, and myoglobin are paralogs of each other.
2 5 A "polynucleotide" is a single- or double-stranded polymer of
deoxyribonucleotide ox ribonucleotide bases read from the 5' to the 3' end.
Polynucleotides include RNA and DNA, and may be isolated from natural sources,
synthesized in vitro, or prepared from a combination of natural and synthetic
molecules.
Sizes of polynucleotides are expressed as base pairs (abbreviated "bp"),
nucleotides
3 0 ("nt"), or kilobases ("kb"). Where the context allows, the latter two
terms may describe
polynucleotides that are single-stranded or double-stranded. When the texm is
applied
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
7
to double-stranded molecules it is used to denote overall length and will be
understood
to be equivalent to the term "base pairs". It will be recognized by those
skilled in the
art that the two strands of a double-stranded polynucleotide may differ
slightly in length
and that the ends thereof may be staggered as a result of enzymatic cleavage;
thus all
nucleotides within a double-stranded polynucleotide molecule may not be
paired. Such
unpaired ends will in general not exceed 20 nt in length.
A "polypeptide" is a polymer of amino acid residues joined by peptide
bonds, whether produced naturally or synthetically. Polypeptides of less than
about 10
amino acid residues are commonly referred to as "peptides".
1 o The term "promoter" is used herein for its art-recognized meaning to
denote a portion of a gene containing DNA sequences that provide for the
binding of
RNA polymerase and initiation of transcription. Promoter sequences are
commonly,
but not always, found in the 5' non-coding regions of genes.
A "protein" is a macromolecule comprising one or more polypeptide
chains. A protein may also comprise non-peptidic components, such as
carbohydrate
groups. Carbohydrates and other non-peptidic substituents may be added to a
protein
by the cell in which the protein is produced, and will vary with the type of
cell.
Proteins are defined herein in terms of their amino acid backbone structures;
substituents such as carbohydrate groups are generally not specified, but may
be present
2 0 nonetheless.
The term "receptor" denotes a cell-associated protein that binds to a
bioactive molecule (i.e., a ligand) and mediates the effect of the ligand on
the cell.
Membrane-bound receptors are characterized by a multi-domain structure
comprising
an extracellular ligand-binding domain and an intracellular effector domain
that is
2 5 typically involved in signal transduction. Binding of ligand to receptor
results in a
conformational change in the receptor that causes an interaction between the
effector
domain and other molecules) in the cell. This interaction in turn leads to an
alteration
in the metabolism of the cell. Metabolic events that are linked to receptor-
.ligand
interactions include gene transcription, phosphorylation, dephosphorylation,
increases
3 0 in cyclic AMP production, mobilization of cellular calcium, mobilization
of membrane
lipids, cell adhesion, hydrolysis of inositol lipids and hydrolysis of
phospholipids. In
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
8
general, receptors can be membrane bound, cytosolic or nuclear; monomeric
(e.g.,
thyroid stimulating hormone receptor, beta-adrenergic receptor) or multimeric
(e.g.,
PDGF receptor, growth hormone receptor, IL-3 receptor, GM-CSF receptor, G-CSF
receptor, erythropoietin receptor and IL-6 receptor).
The term "secretory signal sequence" denotes a DNA sequence that
encodes a polypeptide (a "secretory peptide") that, as a component of a larger
polypeptide, directs the larger polypeptide through a secretory pathway of a
cell in
which it is synthesized. The larger polypeptide is commonly cleaved to remove
the
secretory peptide during transit through the secretory pathway.
The term "splice variant" is used herein to denote alternative forms of
RNA transcribed from a gene. Splice variation arises naturally through use of
alternative splicing sites within a transcribed RNA molecule, or less commonly
between separately transcribed RNA molecules, and may result in several mRNAs
transcribed from the same gene. Splice variants may encode polypeptides having
altered amino acid sequence. The term splice variant is also used herein to
denote a
protein encoded by a splice variant of an mRNA transcribed from a gene.
Molecular weights and lengths of polymers determined by imprecise
analytical methods (e.g., gel electrophoresis) will be understood to be
approximate
values. When such a value is expressed as "about" X or "approximately" X, the
stated
2 o value of X will be understood to be accurate to t10%.
Expressi~n of Zalpha53
Expression of the Zalp7~a53 gene is seen only in the testis. This pattern
of expression suggests that Zalpha53 may play a general role in development
and exert
2 5 important regulatory control of testicular differentiation, of the
hypothalamic-pituitary-
gonadal axis, and of gonadal steroidogenesis and spermatogenesis.
Development of testicular hormone production can be divided into early
and late steps, with the latter dependent on the activation of functionally
determined
Leydig cell precursors by luteinizing hormone (LH). However, the factors that
control
3 0 the early steps in this process remain unknown, Huhtaniemi , Reprod.
Fertil. Dev. 7:
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
9
1025-1035 (1995) suggesting that Zalpha53 might be responsible for activation
of a
non-steroidogenic, non-LH responsive precursor cell.
Once Leydig cell differentiation has occurred, production of steroid
hormones in the testis is dependent on the secretion of the gonadotrophins, LH
and
follicle-stimulating hormone (FSH), by the pituitary. LH stimulates production
of
testosterone by the Leydig cells, whereas spermatogenesis depends on both FSH
and
high intratesticular testosterone concentrations. LH and FSH secretion is in
turn under
control of gonadotrophin releasing hormone (GnRH) produced in the
hypothalamus,
I~aufman, The neuro endocrine regulation of male reproduction. in: Male
Infertility.
Clinical Investigation, Cause Evaluation and Treatment., FH Comhaire, ed., pp
29-
54(Chapman and Hall, London, 1996). Since testicular products have been shown
to
control LH and FSH production, this suggests that Zalpha53 might regulate
hormone
production by the hypothalamus.
It is well known that steroidogenesis and spermatogenesis take place
within two different cellular compartments of the testes, with Leydig and
Sertoli cells
responsible for the former and latter, respectively, Saez, Endocrin. Rev. I5:
574-626
(1994). The activity of each of these cell types appears to be regulated by
the secretory
products of the other. Sertoli cell derived tumor necrosis factor-a,
fibroblast growth
factor, interleukin-1, transforming growth factor-B, epidermal growth
2 0 factorltransforming growth factor-a, activin, inhibin, insulin-like growth
factor-1,
platelet derived growth factor, endothelin, and ariginine-vasopressin have all
been
shown to regulate Leydig cell function, Saez , Endocrin. Rev. 15: 574-626
(1994).
Thus, Zalpha53 might control or modulate the activities of one or more of
these genes.
In men, aging is associated with a progressive decline in testicular
2 5 function. These changes are manifest clinically by decreased virility,
vigor, and libido
that point towards a relative testicular deficiency, Vermeulen, Anna. Med.
25:531-534
(1993); Pugeat et al., Horyn. Res. 43: 104-110 (1995). Hormone replacement
therapy
in elderly men is not currently recommended which suggests that a new therapy
for the
male climacterium would be very valuable.
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
POLYNUCLEOTIDES
The present invention also provides polynucleotide molecules, including
DNA and RNA molecules that encode the Zalpha53 polypeptides disclosed herein.
Those skilled in the art will readily recognize that, in view of the
degeneracy of the
5 genetic code, considerable sequence variation is possible among these
polynucleotide
molecules.
Polynucleotides, generally a cDNA sequence, of the present invention
encode the described polypeptides herein. A cDNA sequence that encodes a
polypeptide of the present invention is comprised of a series of colons, each
amino acid
10 residue of the polypeptide being encoded by a colon and each colon being
comprised
of three nucleotides. The amino acid residues are encoded by their respective
colons as
follows.
Alanine (Ale) is encoded by GCA, GCC, GCG or GCT;
Cysteine (Cys) is encoded by TGC or TGT;
Aspartic acid (Asp) is encoded by GAC or GAT;
Glutamic acid (Glu) is encoded by GAA or GAG;
Phenylalanine (Phe) is encoded by TTC or TTT;
Glycine (Gly) is encoded by GGA, GGC; GGG or GGT;
2 0 Histidine (His) is encoded by CAC or CAT;
Isoleucine (Ile) is encoded by ATA, ATC or ATT;
Lysine (Lys) is encoded by AAA, or AAG;
Leucine (Leu) is encoded by TTA, TTG, CTA, CTC, CTG or CTT;
Methionine (Met) is encoded by ATG;
2 5 Asparagine (Asn) is encoded by AAC or AAT;
Proline (Pro) is encoded by CCA, CCC, CCG or CCT;
Glutamine (Gln) is encoded by CAA or CAG;
Arginine (Arg) is encoded by AGA, AGG, CGA, CGC, CGG or CGT;
Serine (Ser) is encoded by AGC, AGT, TCA, TCC, TCG or TCT;
3 0 Threonine (Thr) is encoded by ACA, ACC, ACG or ACT;
Valine (Val) is encoded by GTA, GTC, GTG or GTT;
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
11
Tryptophan (Trp) is encoded by TGG; and
Tyrosine (Tyr) is encoded by TAC or TAT.
It is to be recognized that according to the present invention, when a
polynucleotide is claimed as described herein, it is understood that what is
claimed are
both the sense strand, the anti-sense strand, and the DNA as double-stranded
having
both the sense and anti-sense strand annealed together by their respective
hydrogen
bonds. Also claimed is the messenger RNA (mRNA) that encodes the polypeptides
of
the president invention, and which mRNA is encoded by the cDNA described
herein.
1 o Messenger RNA (mRNA) will encode a polypeptide using the same colons as
those
defined herein, with the exception that each thymine nucleotide (T) is
replaced by a
uracil nucleotide (U).
One of ordinary skill in the art will also appreciate that different species
can exhibit "preferential colon usage." In general, see, Grantham, et czl.,
Nuc. Acids
Res. 8:1893-1912 (1980); Haas, et al. Curr. Biol. 6:315-324 (1996); Wain-
Hobson, et
al., Gef2e 13:355-364 (1981); Grosjean and Fiers, Gene 18:199-209 (1982);
Holm, Nuc.
Acids Res. 14:3075-3087 (1986); Ikemura, J. Mol. Biol. 158:573-597 (1982). As
used
herein, the term "preferential colon usage" or "preferential colons" is a term
of art
referring to protein translation colons that are most frequently used in cells
of a certain
2 0 species, thus favoring one or a few representatives of the possible colons
encoding
each amino acid (See Table 2). For example, the amino acid Threonine (Thr) may
be
encoded by ACA, ACC, ACG, or ACT, but in mammalian cells ACC is the most
commonly used colon; in other species, for example, insect cells, yeast,
viruses or
bacteria, different Thr colons may be preferential. Preferential colons for a
particular
2 5 species can be introduced into the polynucleotides of the present
invention by a variety
of methods known in the art. Introduction of preferential colon sequences into
recombinant DNA can, for example, enhance production of the protein by making
protein translation more efficient within a particular cell type or species.
Sequences
containing preferential colons can be tested and optimized for expression in
various
3 0 species, and tested for functionality as disclosed herein.
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
12
Within preferred embodiments of the invention the isolated
polynucleotides will hybridize to similar sized regions of SEQ m NOs:l, or 19
or a
sequence complementary thereto, under stringent conditions. In general,
stringent
conditions are selected to be about 5°C lower than the thermal melting
point (Tm) for
the specific sequence at a defined ionic strength and pH. The Tm is the
temperature
(under defined ionic strength and pH) at which 50°10 of the target
sequence hybridizes to
a perfectly matched probe. Typical stringent conditions are those in which the
salt
concentration is up to about 0.03 M at pH 7 and the temperature is at least
about 60°C.
As previously noted, the isolated polynucleotides of the present
invention include DNA and RNA. Methods for preparing DNA and RNA are well
known in the art. In general, RNA is isolated from a tissue or cell that
produces large
amounts of Zalpha53 RNA. Such tissues and cells are identified by Northern
blotting,
Thomas, Proc. Natl. Acad. Sci. USA 77:5201 (1980) and are discussed below.
Total
RNA can be prepared using guanidine HCl extraction followed by isolation by
centrifugation in a CsCI gradient, Chirgwin et al., Biochemistry 18:52-94
(1979). Poly
(A)+ RNA is prepared from total RNA using the method of Aviv and Leder, Proc.
Natl.
Acad. Sci. USA 69:1408-1412 (1972). Complementary DNA (cDNA) is prepared from
poly(A)+ RNA using known methods. In the alternative, genomic DNA can be
isolated. Polynucleotides encoding Zalpha53 polypeptides are then identified
and
2 0 isolated by, for example, hybridization or PCR.
A full-length clone encoding Zalpha53 cari be obtained by conventional
cloning procedures. Complementary DNA (cDNA) clones are preferred, although
for
some applications (e.g., expression in transgenic animals) it may be
preferable to use a
genomic clone, onto modify a cDNA clone to include at least one genomic
intron.
2 5 Methods for preparing cDNA and genomic clones are well known and within
the level
of ordinary skill in the art, and include the use of the sequence disclosed
herein, or parts
thereof, for probing or priming a library. Expression libraries can be probed
with
antibodies to Zalpha53, receptor fragments, or other specific binding
partners.
The polynucleotides of the present invention can also be synthesized
3 0 using DNA synthesizers. Currently the method of choice is the
phosphoramidite
method. If chemically synthesized double stranded DNA is required for an
application
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
13
such as the synthesis of a gene or a gene fragment, then each complementary
strand is
made separately. The production of short genes (60 to 80 bp) is technically
straightforward and can be accomplished by synthesizing the complementary
strands
and then annealing them. For the production of longer genes (>300 bp),
however,
special strategies must be invoked, because the coupling efficiency of each
cycle during
chemical DNA synthesis is seldom 100/0. To overcome this problem, synthetic
genes
(double-stranded) are assembled in modular form from single-stranded fragments
that
are from 20 to 100 nucleotides in length.
See Glick and Pasternak, Molecular Biotechnology, PriyZCiples &
Applicati.orzs of Reconabiyzant DNA, (ASM Press, Washington, D.C. 1994);
Itakura et
al., Anfau. Rev. Bioclzem. 53: 323-356 (1984) and Climie et al., Proc. Natl.
Acad. Sci.
USA 87:633-637 (1990).
The present invention further provides counterpart polypeptides and
polynucleotides from other species (orthologs). These species include, but are
not
limited to mammalian, avian, amphibian, reptile, fish, insect and other
vertebrate and
invertebrate species. Of particular interest are Zalpha53 polypeptides from
other
mammalian species, including murine, porcine, ovine, bovine, canine, feline,
equine,
and other primate polypeptides. Orthologs of human Zalpha53 can be cloned
using
information and compositions provided by the present invention in combination
with
2 o conventional cloning techniques. For example, a cDNA can be cloned using
mRNA
obtained from a tissue or cell type that expresses Zalpha53 as disclosed
herein. Suitable
sources of mRNA can be identified by probing Northern blots with probes
designed
from the sequences disclosed herein. A library is then prepared from mRNA of a
positive tissue or cell line. A Zalpha53-encoding cDNA can then be isolated by
a
variety of methods, such as by probing with a complete or partial human cDNA
or with
one or more sets of degenerate probes based on the disclosed sequences. A cDNA
can
also be cloned using the polymerase chain reaction, or PCR (Mullis, U.S.
Patent No.
4,683,202), using primers designed from the representative human Zalpha53
sequence
disclosed herein. Within an additional method, the cDNA library can be used to
3 0 transform or transfect host cells, and expression of the cDNA of interest
can be detected
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
14
with an antibody to Zalpha53 polypeptide. Similar techniques can also be
applied to
the isolation of genomic clones.
Those skilled in the art will recognize that the sequence disclosed in
SEQ ~ NOs: 1, or 19 represent specific alleles of human Zalpha53 and that
allelic
variation and alternative splicing are expected to occur. Allelic variants of
this
sequence can be cloned by probing cDNA or genomic libraries from different
individuals according to standard procedures. Allelic variants of the DNA
sequence
shown in SEQ m NO:l, including those containing silent mutations and those in
which
mutations result in amino acid sequence changes, are within the scope of the
present
invention, as are proteins which are allelic variants of SEQ ID NOs:2, 3, 20
or 21.
cDNAs generated from alternatively spliced mRNAs, which retain the properties
of the
Zalpha53 polypeptide are included within the scope of the present invention,
as are
polypeptides encoded by such cDNAs and mRNAs. Allelic variants and splice
variants
of these sequences can be cloned by probing cDNA or genomic libraries from
different
individuals or tissues according to standard procedures known in the art.
The present invention also provides isolated Zalpha53 polypeptides that
are substantially identical to the polypeptides of SEQ m NOs: 2, 3, 20, or 21
and their
orthologs. The term "substantially identical" is used herein to denote
polypeptides
having 50%, 60%, 70%, 80% and most preferably at least 90%, 95% or 99%
sequence
2 0 identity to the sequences shown in SEQ ID NOs: 2, 3, 20, or 21 or their
orthologs.
Percent sequence identity is determined by conventional methods. See, for
example,
Altschul et al., Bull. MatJy. Bio. 48: 603-616 (1986) and Henikoff and
Henikoff, Proc.
Natl. Acad. Sci. USA 89:10915-10919 (1992). Briefly, two amino acid sequences
are
aligned to optimize the alignment scores using a gap opening penalty of 10, a
gap
extension penalty of 1, and the "BLOSUM 62" scoring matrix of Henikoff and
Henikoff
(ibid.) as shown in Table 1 (amino acids are indicated by the standard one-
letter codes).
The percent identity is then calculated as:
Total number of identical matches
x 100
3 0 [length of the longer sequence plus the
number of gaps introduced into the longer
sequence in order to align the two sequences]
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
E~ ,-~
N
M
i
Cl~ V~ N N
O
d' M CV
,~ N
d'
---,M N
d- N M ,
N i
r
V7 ' ,--i
O i
N on
-, N
-1 in ~ M O N ,
, . N
N .'
'
~N OM N~ i
N '-a .--~
i
M r--t
M O M N M
d' N .-a N N
M ' M
,-, ,.-~ N
~ M N ~
~ N d' ~ N i i N
cn
M
N
W O M
N O M M ,_, N M ,-, ~ N
,-r N
i O
a V~ N (V O M N ~ O M O N ;'
,~ ,-~ N
U ~ M .d- M M ~ ~ M ~ N r, i
M r--~d'
' M '
'
,-~ , M O i M
~O M O N ..~ ~ M d ,-i ,., M
O ~ M cn O N ~ M
~
'-' O p M N .-i N
~ '
tn O N M ~ p N O ; ,-, M N
f~ N N M N ,-, M
.
. M ~
, . ~
"''~, Ut ~ N N O .~ ,-~ O '~ ~ M (V
N ~ ,--~ ,-, N O O
~
~xzr~~aw~x~a~ ~w~, ~~' ~~~
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
16
Those skilled in the art appreciate that there are many established
algorithms to align two amino acid sequences. The "FASTA" similarity search
algorithm of Pearson and Lipman is a suitable protein alignment method for
examining
the level of identity shared by an amino acid sequence and the amino acid
sequence of a
putative variant. The FASTA algorithm is described by Pearson and Lipman,
Proc.
Nat'l Acad. Sci. USA 85:2444 (1988), and by Pearson, Metla. Erazyrnol. 183:63
(1990).
Briefly, FASTA first characterizes sequence similarity by identifying regions
shared by
the query sequence (e.g., SEQ m NOs: 2, 3, 20, or 21) and a test sequence that
have
either the highest density of identities (if the letup variable is 1 ) or
pairs of identities (if
letup=2), without considering conservative amino acid substitutions,
insertions or
deletions. The ten regions with the highest density of identities are then re-
scored' by
comparing the similarity of all paired amino acids using an amino acid
substitution
matrix, and the ends of the regions are "trimmed" to include only those
residues that
contribute to the highest score. If there are several regions with scores
greater than the
"cutoff' value (calculated by a predetermined formula based upon the length of
the
sequence and the letup value), then the trimmed initial regions are examined
to
determine whether the regions can be joined to form an approximate alignment
with
gaps. Finally, the highest scoring regions of the two amino acid sequences are
aligned
using a modification of the Needleman-Wunsch-Sellers algorithm (Needleman and
2 0 Wunsch, J. Mol. Biol. 48:444 (1970); Sellers, SIAM J. Appl. Math. 26:787
(1974),
which allows for amino acid insertions and deletions. Illustrative parameters
for
FASTA analysis are: letup=l, gap opening penalty=10, gap extension penalty=1,
and
substitution matrix=BLOSUM62. These parameters can be introduced into a FASTA
program by modifying the scoring matrix file ("SMATRIX"), as explained in
Appendix
2 of Pearson, Meth. Enzyj~zol. 183:63 (1990).
FASTA can also be used to determine the sequence identity of nucleic
acid molecules using a ratio as disclosed above. For nucleotide sequence
comparisons,
the letup value can range between one to six, preferably from four to six.
The present invention includes nucleic acid molecules that encode a
3 0 polypeptide having one or more conservative amino acid changes, compared
with the
amino acid sequence of SEQ ID NOs: 2, 3, 20, or 21. The BLOSUM62 table is an
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
17
amino acid substitution matrix derived from about 2,000 local multiple
alignments of
protein sequence segments, representing highly conserved regions of more than
500
groups of related proteins [Henikoff and Henikoff, Proc. Nat'l Acad. Sci. USA
89:10915 (1992)]. Accordingly, the BLOSUM62 substitution frequencies can be
used
to define conservative amino acid substitutions that may be introduced into
the amino
acid sequences of the present invention. As used herein, the language
"conservative
amino acid substitution" refers to a substitution represented by a BLOSUM62
value of
greater than -1. For example, an amino acid substitution is conservative if
the
substitution is characterized by a BLOSUM62 value of 0,1,2, or 3. Preferred
conservative annino acid substitutions are characterized by a BLOSUM62 value
of at
least 1 (e.g., 1,2 or 3), while more preferred conservative substitutions are
characterized
by a BLOSUM62 value of at least 2 (e.g., 2 or 3).
Sequence identity of polynucleotide molecules is determined by similar
methods using a ratio as disclosed above.
Variant Zalpha53 polypeptides or substantially homologous Zalpha53
polypeptides are characterized as having one or more amino acid substitutions,
deletions or additions. These changes are preferably of a minor nature, that
is
conservative amino acid substitutions (see Table 2) and other substitutions
that do not
significantly affect the folding or activity of the polypeptide; small
deletions, typically
2 0 of one to about 30 amino acids; and small amino- or carboxyl-terminal
extensions, such
as an amino-terminal methionine residue, a small linker peptide of up to about
20-25
residues, or an affinity tag. The present invention thus includes polypeptides
of from 20
to 30 amino acid residues that comprise a sequence that is at least 90%,
preferably at
least 95%, and more preferably 99% or more identical to the corresponding
region of
2 5 SEQ m NOs: 2, 3, 20, or 21. Polypeptides comprising affinity tags can
further
comprise a proteolytic cleavage site between the Zalpha53 polypeptide and the
affinity
tag. Preferred such sites include thrombin cleavage sites and factor Xa
cleavage sites.
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
18
Table 2
Conservative amino acid substitutions
Basic: arginine
lysine
histidine
Acidic: glutamic
acid
aspartic
acid
Polar: glutamine
o asparagine
Hydrophobic: leucine
isoleucine
valine
Aromatic: phenylalanine
tryptophan
tyrosine
Small: glycine
2 0 alanine
serine
threonine
methionine
2 5 The present invention further provides a variety of other polypeptide
fusions [and related multimeric proteins comprising one or more polypeptide
fusions].
For example, a Zalpha53 polypeptide can be prepared as a fusion to a
dimerizing
protein as disclosed in U.S. Patents Nos. 5,155,027 and 5,567,584. Preferred
dimerizing proteins in this regard include immunoglobulin constant region
domains.
3 0 Immunoglobulin-Zalpha53 polypeptide fusions can be expressed in
genetically
engineered cells [to produce a variety of multimeric Zalpha53 analogs].
Auxiliary
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
19
domains can be fused to Zalpha53 polypeptides to target them to specific
cells, tissues,
or macromolecules (e.g., collagen). For example, a Zalpha53 polypeptide or
protein
could be targeted to a predetermined cell type by fusing a Zalpha53
polypeptide to a
ligand that specifically binds to a receptor on the surface of the target
cell. Tn this way,
polypeptides and proteins can be targeted for therapeutic or diagnostic
purposes. A
Zalpha53 polypeptide can be fused to two or more moieties, such as an affinity
tag for
purification and a targeting domain. Polypeptide fusions can also comprise one
or more
cleavage sites, particularly between domains. See, Tuan et al., Cofzrzective
Tissue
Research 34:1-9 (1996).
The proteins of the present invention can also comprise non-naturally
occurring amino acid residues. Non-naturally occurring amino acids include,
without
limitation, trarzs-3-methylproline, 2,4-methanoproline, cis-4-hydroxyproline,
trazzs-4-
hydroxyproline, N methylglycine; allo-threonine, methylthreonine,
hydroXyethylcysteine, hydroxyethylhomocysteine, nitroglutamine, homoglutamine,
pipecolic acid, thiazolidine carboxylic acid, dehydroproline, 3- and 4-
methylproline,
3,3-dimethylproline, ter-t-leucine, norvaline, 2-azaphenylalanine, 3-
azaphenylalanine, 4-
azaphenylalanine, and 4-fluorophenylalanine. Several methods are known in the
art for
incorporating non-naturally occurring amino acid residues into proteins. For
example,
an ijz vitro system can be employed wherein nonsense mutations are suppressed
using
2 0 chemically aminoacylated suppressor tRNAs.
Methods for synthesizing amino acids and aminoacylating tRNA are
known in the art. Transcription and translation of plasmids containing
nonsense
mutations is carried out in a cell-free system comprising an E. coli S30
extract and
commercially available enzymes and other reagents. Proteins are purified by
2 5 chromatography. See, for example, Robertson et al., J. Arzz. Clzenz. Soc.
113:2722
(1991); Ellman et al., Methods Efzzymol. 202:301 (1991; Chung et al., Sciezzce
259:806-
809 (1993); and Chung et al., Proc. Natl. Acad. Sci. USA 90:10145-1019 (1993).
Tn a
second method, translation is carried out in Xerzopus oocytes by
microinjection of
mutated mRNA and chemically aminoacylated suppressor tRNAs, Turcatti et al.,
J.
3 0 Biol. Chem. 271:19991-19998 (1996). Within a third method, E. coli cells
are cultured
in the absence of a natural amino acid that is to be replaced (e.g.,
phenylalanine) and in
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
the presence of the desired non-naturally occurring amino acids) (e.g., 2-
azaphenylalanine, 3-azaphenylalanine, 4-azaphenylalanine, or 4-
fluorophenylalanine).
The non-naturally occurring amino acid is incorporated into the protein in
place of its
natural counterpart. See, Koide et al., Bioclaem. 33:7470-7476 (1994).
Naturally
5 occurring amino acid residues can be converted to non-naturally occurring
species by in
vitro chemical modification. Chemical modification can be combined with site-
directed mutagenesis to further expand the range of substitutions, Wynn and
Richards,
Proteifa Sci. 2:395-403 (1993).
A limited number of non-conservative amino acids, amino acids that are
10 not encoded by the genetic code, non-naturally occurring amino acids, and
unnatural
amino acids may be substituted for Zalpha53 amino acid residues.
Essential amino acids in the polypeptides of the present invention can be
identified according to procedures known in the art, such as site-directed
mutagenesis
or alanine-scanning mutagenesis, Cunningham and Wells, Science 244: 1081-1085
15 (1989); Bass et al., Pr-oc. Natl. Acad. Sci. USA.88:4498-502 (1991). In the
latter
technique, single alanine mutations are introduced at every residue in the
molecule, and
the resultant mutant molecules are tested for biological activity as disclosed
below to
identify amino acid residues that are critical to the activity of the
molecule. See also,
Hilton et al., J. Biol. Chem. 271:4699-708, 1996. Sites of ligand-receptor
interaction
2 0 can also be determined by physical analysis of structure, as determined by
such
techniques as nuclear magnetic resonance, crystallography, electron
diffraction or
photoaffinity labeling, in conjunction with mutation of putative contact site
amino
acids. See, for example, de Vos et al., Science 255:306-312 (1992); Smith et
al., J.
Mol. Biol. 224:899-904 (1992); Wlodaver et al., FEBS Lett. 309:59-64 (1992).
2 5 Multiple amino acid substitutions can be made and tested using known
methods of mutagenesis and screening, such as those disclosed by Reidhaar-
Olson and
Sauer, Science 241:53-57 (1988) or Bowie and Sauer, Proc. Natl. Acad. Sci. USA
86:2152-2156 (1989). Briefly, these authors disclose methods for
simultaneously
randomizing two or more positions in a polypeptide, selecting for functional
3 0 polypeptide, and then sequencing the mutagenized polypeptides to determine
the
spectrum of allowable substitutions at each position. Other methods that can
be used
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
21
include phage display, e.g., Lowman et al., Biocherf2. 30:10832-10837 (1991);
Ladner et
al., U.S. Patent No. 5,223,409; Huse, WIPO Publication WO 92/06204) and region-
directed mutagenesis, Derbyshire et al., Gene 46:145 (1986); Ner et al., DNA
7:127
( 1988).
Variants of the disclosed Zalpha53 DNA and polypeptide sequences can
be generated through DNA shuffling as disclosed by Stemmer, Nature 370:389-
391,
(1994), Stemmer, Proc. Natl. Acad. Sci. USA 91:10747-10751 (1994) and W1P0
Publication WO 97/20078. Briefly, variant DNAs are generated by iyz vitro
homologous recombination by random fragmentation of a parent DNA followed by
1 o reassembly using PCR, resulting in randomly introduced point mutations.
This
technique can be modified by using a family of parent DNAs, such as allelic
variants or
DNAs from different species, to introduce additional variability into the
process.
Selection or screening for the desired activity, followed by additional
iterations of
mutagenesis and assay provides for rapid "evolution" of sequences by selecting
for
desirable mutations while simultaneously selecting against detrimental
changes.
Mutagenesis methods as disclosed herein can be combined with high-
throughput, automated screening methods to detect activity of cloned,
mutagenized
polypeptides in host cells. Mutagenized DNA molecules that encode active
polypeptides can be recovered from the host cells and rapidly sequenced using
modern
2 0 equipment. These methods allow the rapid determination of the importance
of
individual amino acid residues in a polypeptide of interest, and can be
applied to
polypeptides of unknown structure.
Using the methods discussed herein, one of ordinary skill in the art can
identify and/or prepare a variety of polypeptide fragments or variants of SEQ
ID NOs:
2 5 2, 3, 20, or 21 or that retain the properties of the wild-type Zalpha53
protein.
For any Zalpha53 polypeptide, including variants and fusion proteins,
one of ordinary skill in the art can readily generate a fully degenerate
polynucleotide
sequence encoding that variant using the information set forth in Tables 1 and
2 above.
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
22
PROTEIN PRODUCTION
The Zalpha53 polypeptides of the present invention, including full-
length polypeptides, biologically active fragments, and fusion polypeptides,
can be
produced in genetically engineered host cells according to conventional
techniques.
Suitable host cells are those cell types that can be transformed or
transfected with
exogenous DNA and grown in culture, and include bacteria, fungal cells, and
cultured
higher eukaryotic cells. Eukaryotic cells, particularly cultured cells of
multicellular
organisms, are preferred. Techniques for manipulating cloned DNA molecules and
introducing exogenous DNA into a variety of host cells are disclosed by
Sambrook et
al., Molecular Cloning: A Laboratory Manual, 2nd ed., (Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, NY, 1989), and Ausubel et al., eds.,
Current
Protocols in Molecular Biology (John Wiley and Sons, Inc., NY, 1987). .
In general, a DNA sequence encoding a Zalpha53 polypeptide is
operably linked to other genetic elements required for its expression,
generally
including a transcription promoter and terminator, within an expression
vector. The
vector will also commonly contain one or more selectable markers and one or
more
origins of replication, although those skilled in the art will recognize that
within certain
systems selectable markers may be provided on separate vectors, and
replication of the
exogenous DNA may be provided by integration into the host cell genome.
Selection
2 0 of promoters, terminators, selectable markers, vectors and other elements
is a matter of
routine design within the level of ordinary skill in the art. Many such
elements are
described in the literature and are available through commercial suppliers.
To direct a Zalpha53 polypeptide into the secretory pathway of a host
cell, a secretory signal sequence (also known as a leader sequence, prepro
sequence or
2 5 pre sequence) is provided in the expression vector. The secretory signal
sequence may
be that of Zalpha53, or may be derived from another secreted protein (e.g., t-
PA) or
synthesized de novo. The secretory signal sequence is operably linked to the
Zalpha53
DNA sequence, i.e., the two sequences are joined in the correct reading frame
and
positioned to direct the newly synthesized polypeptide into the secretory
pathway of the
3 0 host cell. Secretory signal sequences are commonly positioned 5' to the
DNA sequence
encoding the polypeptide of interest, although certain secretory signal
sequences may be
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
23
positioned elsewhere in the DNA sequence of interest (see, e.g., Welch et al.,
U.S.
Patent No. 5,037,743; Holland et al., U.S. Patent No. 5,143,830).
Alternatively, the secretory signal sequence contained in the
polypeptides of the present invention is used to direct other polypeptides
into the
secretory pathway. The present invention provides for such fusion
polypeptides. The
secretory signal sequence contained in the fusion polypeptides of the present
invention
is preferably fused amino-terminally to an additional peptide to direct the
additional
peptide into the secretory pathway. Such constructs have numerous applications
known
in the art. For example, these novel secretory signal sequence fusion
constructs can
direct the secretion of an active component of a normally non-secreted
protein, such as
a receptor. Such fusions may be used irz vivo or in vitro to direct peptides
through the
secretory pathway.
Cultured mammalian cells are suitable hosts within the present
invention. Methods for introducing exogenous DNA into mammalian host cells
include
calcium phosphate-mediated transfection, Wigler et al., Cell 14:725 (1978);
Corsaro
and Pearson, Somatic Cell Genetics 7:603 ( 1981 ); Graham and Van der Eb,
Virology
52:456 (1973), electroporation, Neumann et al., EMBO J. 1:841-845 (1982), DEAE-
dextran mediated transfection (Ausubel et al., ibid., and liposome-mediated
transfection, Hawley-Nelson et al., Focus 15:73 (1993); Ciccarone et al.,
Focus 15:80
(1993), and viral vectors, Miller and Rosman, BioTeclzniques 7:980(1989); Wang
and
Finer, Nature Med. 2:714 (1996). The production of recombinant polypeptides in
cultured mammalian cells is disclosed, for example, by Levinson et al., U.S.
Patent No.
4,713,339; Hagen et al., U.S. Patent No. 4,784,950; Palmiter et al., U.S.
Patent No.
4,579,821; and Ringold, U.S. Patent No. 4,656,134. Suitable cultured mammalian
cells
include the COS-1 (ATCC No. CRL 1650), COS-7 (ATCC No. CRL 1651), BHK
(ATCC No. CRL 1632), BHK 570 (ATCC No. CRL 10314), 293 (ATCC No. CRL
1573; Graham et al., J. Gefz. Virol. 36:59 (1977) and Chinese hamster ovary
(e.g. CHO-
Kl; ATCC No. CCL 61) cell lines. Additional suitable cell lines are known in
the art
and available from public depositories such as the American Type Culture
Collection,
3 0 Rockville, Maryland. In general, strong transcription promoters are
preferred, such as
promoters from SV-40 or cytomegalovirus. See, e.g., U.S. Patent No. 4,956,288.
Other
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
24
suitable promoters include those from metallothionein genes (U.S. Patent Nos.
4,579,821 and 4,601,978) and the adenovirus major late promoter.
Drug selection is generally used to select for cultured mammalian cells
into which foreign DNA has been inserted. Such cells are commonly referred to
as
"transfectants". Cells that have been cultured in the presence of the
selective agent and
are able to pass the gene of interest to their progeny are referred to as
"stable
transfectants." A preferred selectable marker is a gene encoding resistance to
the
antibiotic neomycin. Selection is carried out in the presence of a neomycin-
type drug,
such as G-418 or the like. Selection systems can also be used to increase the
expression
level of the gene of interest, a process referred to as "amplification."
Amplification is
carried out by culturing transfectants in the presence of a low level of the
selective
agent and then increasing the amount of selective agent to select for cells
that produce
high levels of the products of the introduced genes. A preferred amplifiable
selectable
marker is dihydrofolate reductase, which confers resistance to methotrexate.
Other
drug resistance genes (e.g. hygromycin resistance, multi-drug resistance,
puromycin
acetyltransferase) can also be used. Alternative markers that introduce an
altered
phenotype, such as green fluorescent protein, or cell surface proteins such as
CD4,
CDB, Class I MHC, placental alkaline phosphatase may be used to sort
transfected cells
from untransfected cells by such means as FAGS sorting or magnetic bead
separation
2 0 technology.
Other higher eukaryotic cells can also be used as hosts, including plant
cells, insect cells and avian cells. The use of Agrobacteriurn rhizogenes as a
vector for
expressing genes in plant cells has been reviewed by Sinkar et al., J. Biosci.
(Bangalore) 11:47 (1987). Transformation of insect cells and production of
foreign
polypeptides therein is disclosed by Guarino et al., U.S. Patent No. 5,162,222
and
WIPO publication WO 94/06463. Insect cells can be infected with recombinant
baculovirus, commonly derived from Autographa californica nuclear polyhedrosis
virus
(AcNPV). DNA encoding the Zalpha53 polypeptide is inserted into the
baculoviral
genome in place of the AcNPV polyhedrin gene coding sequence by one of two
3 o methods. The first is the traditional method of homologous DNA
recombination
between wild-type AcNPV and a transfer vector containing the Zalpha53 flanked
by
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
AcNPV sequences. Suitable insect cells, e.g. SF9 cells, are infected with wild-
type
AcNPV and transfected with a transfer vector comprising a Zalpha53
polynucleotide
operably linked to an AcNPV polyhedrin gene promoter, terminator, and flanking
sequences. See, King, L.A. and Possee, R.D., The Baculovirus Expression
Systerrz: A
5 Laboratory Guide, (Chapman & Hall, London); O'Reilly, D.R. et al.,
Baculovirus
Expression Vectors: A Laboratory Mafzual (Oxford University Press, New York,
New
York, 1994); and, Richardson, C. D., Ed., Baculovirus Expression Protocols.
Methods
irz Molecular Biology, (Humana Press, Totowa, NJ 1995). Natural recombination
within an insect cell will result in a recombinant baculovirus that contains
Zalpha53
10 driven by the polyhedrin promoter. Recombinant viral stocks are made by
methods
commonly used in the art.
The second method of making recombinant baculovirus utilizes a
transposon-based system described by Luckow, V.A, et al., J Virol 67:4566
(1993).
This system is sold in the Bac-to-Bac kit (Life Technologies, Rockville, MD).
This
15 system utilizes a transfer vector, pFastBaclT"' (Life Technologies)
containing a Tn7
transposon to move the DNA encoding the Zalpha53 polypeptide into a
baculovirus
genome maintained in E. coli as a large plasmid called a "bacmid." The
pFastBaclT""
transfer vector utilizes the AcNPV polyhedrin promoter to drive the expression
of the
gene of interest, in this case Zalpha53. However, pFastBaclT"" can be modified
to a
2 o considerable degree. The polyhedrin promoter can be removed and
substituted with the
baculovirus basic protein promoter (also known as Pcor, p6.9 or MP promoter),
which
is expressed earlier in the baculovirus infection, and has been shown to be
advantageous for expressing secreted proteins. See, Hill-Perkins, M.S. and
Possee,
R.D., J Gen Virol 71:971 (1990); Bonning, B.C. et al., J Gefz Virol 75:1551
(1994);
25 and, Chazenbalk, G.D., and Rapoport, B., JBiol Chem 270:1543 (1995). In
such
transfer vector constructs, a short or long version of the basic protein
promoter can be
used. Moreover, transfer vectors can be constructed that replace the native
Zalpha53
secretory signal sequences with secretory signal sequences derived from insect
proteins.
For example, a secretory signal sequence from Ecdysteroid Glucosyltransferase
(EGT),
3 0 honey bee Melittin (Invitrogen, Carlsbad, CA), or baculovirus gp67
(PharMingen, San
Diego, CA) can be used in constructs to replace the native Zalpha53 secretory
signal
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
26
sequence. In addition, transfer vectors can include an in-frame fusion with
DNA
encoding an epitope tag at the C- or N-terminus of the expressed Zalpha53
polypeptide,
for example, a Glu-Glu epitope tag, Grussenmeyer, T. et al., Proc Natl Acad
Sci.
82:7952 (1985). Using a technique known in the art, a transfer vector
containing
Zalpha53 is transformed into E. coli, and screened for bacmids which contain
an
interrupted lacZ gene indicative of recombinant baculovirus. The bacmid DNA
containing the recombinant baculovirus genome is isolated, using common
techniques,
and used to transfect Spodoptera frzzgiperda cells, e.g. Sf9 cells.
Recombinant virus
that expresses Zalpha53 is subsequently produced. Recombinant viral stocks are
made
by methods commonly used the art.
The recombinant virus is used to infect host cells, typically a cell line
derived from the fall army worm, Spodoptera frugiperda. See, in general, Glick
and
Pasternak, Molecular Biotechnology: PriYZCiples azzd Applicatiozzs of
Recoznbizzant
DNA (ASM Press, Washington, D.C., 1994). Another suitable cell line is,the
High
FiveOrM cell line (Invitrogen) derived from Trichoplusia ni (U.S. Patent
#5,300,435).
Commercially available serum-free media are used to grow and maintain the
cells.
Suitable media are Sf900 IIT"" (Life Technologies) or ESF 921rM (Expression
Systems)
for the Sf9 cells; and Ex-ce110405T"" (JRH Biosciences, Lenexa, KS) or Express
FiveOT~" (Life Technologies) for the T. ni cells. The cells are grown up from
an
2 o inoculation density of approximately 2-5 x 105 cells to a density of 1-2 x
106 cells at
which time a recombinant viral stock is added at a multiplicity of infection
(MOB of
0.1 to 10, more typically near 3. The recombinant virus-infected cells
typically produce
the recombinant Zalpha53 polypeptide at 12-72 hours post-infection and secrete
it with
varying efficiency into the medium. The culture is usually harvested 48 hours
post-
2 5 infection. Centrifugation is used to separate the cells from the medium
(supernatant).
The supernatant containing the Zalpha53 polypeptide is filtered through
micropore
filters, usually 0.45 ~,m pore size. Procedures used are generally described
in available
laboratory manuals (King, L. A. and Possee, R.D., ibid.; O'Reilly, D.R. et
al., ibid.;
Richardson, C. D., ibid.). Subsequent purification of the Zalpha53 polypeptide
from
3 0 the supernatant can be achieved using methods described herein.
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
27
Fungal cells, including yeast cells, can also be used within the present
invention. Yeast species of particular interest in this regard include
Saccharorrzyces
cerevisiae, Pichia pastoris, and Piclzia rrzethanolica. Methods for
transforming S.
cerevisiae cells with exogenous DNA and producing recombinant polypeptides
therefrom are disclosed by, for example, Kawasaki, U.S. Patent No. 4,599,31 l;
Kawasaki et al., U.S. Patent No. 4,931,373; Brake, U.S. Patent No. 4,870,008;
Welch et
al., U.S. Patent No. 5,037,743; and Murray et al., U.S. Patent No. 4,845,075.
Transformed cells are selected by phenotype determined by the selectable
marker,
commonly drug resistance or the ability to grow in the absence of a particular
nutrient
(e.g., leucine). A preferred vector system for use in Saccharomyces cerevisiae
is the
POTI vector system disclosed by Kawasaki et al. (U.S. Patent No. 4,931,373),
which
allows transformed cells to be selected by growth in glucose-containing media.
Suitable promoters and terminators for use in yeast include those from
glycolytic
enzyme genes (see, e.g., Kawasaki, U.S. Patent No. 4,599,311; Kingsman et al.,
U.S.
Patent No. 4,615,974; and Bitter, U.S. Patent No. 4,977,092) and alcohol
dehydrogenase genes. See also U.S. Patents Nos. 4,990,446; 5,063,154;
5,139,936 and
4,661,454. Transformation systems for other yeasts, including Flarzserzula
polymorplaa,
Schizosaccharonzyces pombe, Kluyveronzyces lactic, Kluyveromyces fragilis,
Ustilago
maydis, Pichia pastoris, Piclzia metl2arzolica, Pich.ia guillermondii and
Carcdida
2 0 maltosa are known in the art. See, for example, Gleeson et al., J. Gerz.
Microbiol.
132:3459 (1986) and Cregg, U.S. Patent No. 4,882,279. Aspergillus cells may be
utilized according to the methods of McKnight et al., U.S. Patent No.
4,935,349.
Methods for transforming Acrefnoniunz chfysogerzum are disclosed by Sumino et
al.,
U.S. Patent No. 5,162,228. Methods for transforming Neurospof°a are
disclosed by
2 5 Lambowitz, U.S. Patent No. 4,486,533.
The use of Pichia methanolica as host for the production of recombinant
proteins is disclosed in WIPO Publications WO 97/17450, WO 97/17451, WO
98/02536, and WO 98/02565. DNA molecules for use in transforming P.
nzetha~zolica
will commonly be prepared as double-stranded, circular plasmids, which are
preferably
3 0 linearized prior to transformation. For polypeptide production in P.
methanolica, it is
preferred that the promoter and terminator in the plasmid be that of a P.
rraethafzolica
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
28
gene, such as a P. metlzatzolica alcohol utilization gene (AUGI orAUG2). Other
useful
promoters include those of the dihydroxyacetone synthase (DHAS), formate
dehydrogenase (FMD), and catalase (CAT) genes. To facilitate integration of
the DNA
into the host chromosome, it is preferred to have the entire expression
segment of the
plasmid flanked at both ends by host DNA sequences. A preferred selectable
marker
for use in Pichia methaf2olica is a P. metlzayaolica ADE2 gene, which encodes
phosphoribosyl-5-aminoimidazole carboxylase (AIRC; EC 4.1.1.21), which allows
ade2 host cells to grow in the absence of adenine. For large-scale, industrial
processes
where it is desirable to minimize the use of methanol, it is preferred to use
host cells in
1 o which both methanol utilization genes (AUGl and AUG2) are deleted. For
production
of secreted proteins, host cells deficient in vacuolar protease genes (PEP4
and PRBI )
are preferred. Electroporation is used to facilitate the introduction of a
plasmid
containing DNA encoding a polypeptide of interest into P. metharaolica cells.
It is
preferred to transform P. fraetlaafaolica cells by electroporation using an
exponentially
l5 decaying, pulsed electric field having a field strength of from 2.5 to 4.5
kV/cm,
preferably about 3.75 kV/cm, and a time constant (t) of from 1. to 40
milliseconds, most
preferably about 20 milliseconds.
Prokaryotic host cells, including strains of the bacteria Eschericlaia coli,
Bacillus and other genera are also useful host cells within the present
invention.
2 0 Techniques for transforming these hosts and expressing foreign DNA
sequences cloned
therein are well known in the art, see, e.g., Sambrook et al., ibid.). When
expressing a
Zalpha53 polypeptide in bacteria such as E. coli, the polypeptide may be
retained in the
cytoplasm, typically as insoluble granules, or may be directed to the
periplasmic space
by a bacterial secretion sequence. In the former case, the cells are lysed,
and the
2 5 granules are recovered and denatured using, for example, guanidine
isothiocyanate or
urea. The denatured polypeptide can then be refolded and dimerized by diluting
the
denaturant, such as by dialysis against a solution of urea and a combination
of reduced
and oxidized glutathione, followed by dialysis against a buffered saline
solution. In the
latter case, the polypeptide can be recovered from the periplasmic space in a
soluble
3 o and functional form by disrupting the cells (by, for example, sonication
or osmotic
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
29
shock) to release the contents of the periplasmic space and recovering the
protein,
thereby obviating the need for denaturation and refolding.
Transformed or transfected host cells are cultured according to
conventional procedures in a culture medium containing nutrients and other
components required for the growth of the chosen host cells. A variety of
suitable
media, including defined media and complex media, are known in the art and
generally
include a carbon source, a nitrogen source, essential amino acids, vitamins
and
minerals. Media may also contain such components as growth factors or serum,
as
required. The growth medium will generally select for cells containing the
exogenously
added DNA by, for example, drug selection or deficiency in an essential
nutrient, which
is complemented by the selectable marker carried on the expression vector or
co-
transfected into the host cell. P. rrzethanolica cells are cultured in a
medium comprising
adequate sources of carbon, nitrogen and trace nutrients at a temperature of
about 25°G
to 35°C. Liquid cultures are provided with sufficient aeration by
conventional means,
such as shaking of small flasks or sparging of fermentors. A preferred culture
medium
for P. rnethafzolica is YEPD (2% D-glucose, 2% BactoTM Peptone (Difco
Laboratories,
Detroit, Mn, 1% BactoTM yeast extract (Difco Laboratories), 0.004% adenine and
0.006% L-leucine).
Another embodiment of the present invention provides for a peptide or
2 0 polypeptide comprising an epitope-bearing portion of a Zalpha53
polypeptide of the
invention. The epitope of this polypeptide portion is an immunogenic or
antigenic
epitope of a polypeptide of the invention. A region of a protein to which an
antibody
can bind is defined as an "antigenic epitope". See for instance, Geysen, H.M.
et al.,
Proc. Natl. Acad Sci. USA 81: 3998-4002 (1984).
2 5 As to the selection of peptides or polypeptides bearing an antigenic
epitope (i.e., that contain a region of a protein molecule to which an
antibody can bind),
it is well known in the art that relatively short synthetic peptides that
mimic part of a
protein sequence are routinely capable of eliciting an antiserum that reacts
with the
partially mimicked protein. See Sutcliffe, J.G. et al. Sciezzce 219: 660-666
(1983).
3 0 Peptides capable of eliciting protein-reactive sera are frequently
represented in the
primary sequence of a protein, can be characterized by a set of simple
chemical rules,
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
and are confined neither to immunodominant regions of intact proteins (i.e.,
immunogenic epitopes) nor to the amino or carboxyl terminals. Peptides that
are
extremely hydrophobic and those of six or fewer residues generally are
ineffective at
inducing antibodies that bind to the mimicked protein; longer soluble
peptides,
5 especially those containing proline residues, usually are effective.
Antigenic epitope-bearing peptides and polypeptides of the invention are
therefore useful to raise antibodies, including monoclonal antibodies, which
bind
specifically to a polypeptide of the invention. Antigenic epitope-bearing
peptides and
polypeptides of the present invention contain a sequence of at least nine,
preferably
10 between 15 to about 30 amino acids contained within the amino acid sequence
of a
polypeptide of the invention. However, peptides or polypeptides comprising a
larger
portion of an amino acid sequence of the invention, containing from 30 to 50
amino
acids, or any length up to and including the entire amino acid sequence of a
polypeptide
of the invention, also are useful for inducing antibodies that react with the
protein.
15 Preferably, the amino acid sequence of the epitope-bearing peptide is
selected to
provide substantial solubility in aqueous solvents (i.e., the sequence
includes relatively
hydrophilic residues and hydrophobic residues are preferably avoided); and
sequences
containing proline residues are particularly preferred. All of the
polypeptides shown in
the sequence listing contain antigenic epitopes to be used according to the
present
2 0 invention. The present invention also provides polypeptide fragments or
peptides
comprising an epitope-bearing portion of a Zalpha53 polypeptide described
herein.
Such fragments or peptides may comprise an "immunogenic epitope," which is a
part of
a protein that elicits an antibody response when the entire protein is used as
an
immunogen. Immunogenic epitope-bearing peptides can be identified using
standard
2 5 methods [see, for example, Geysen et al., supra. See also U.S. Patent No.
4,708,781
(1987) further describes how to identify a peptide bearing an immunogenic
epitope of a
desired protein.
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
3l
Protein Isolation
It is preferred to purify the polypeptides of the present invention to
>80% purity, more preferably to >_90% purity, even more preferably
>_95°lo purity, and
particularly preferred is a pharmaceutically pure state, that is greater than
99.9% pure
with respect to contaminating macromolecules, particularly other proteins and
nucleic
acids, and free of infectious and pyrogenic agents. Preferably, a purified
polypeptide is
substantially free of other polypeptides, particularly other polypeptides of
animal origin.
Expressed recombinant Zalpha53 polypeptides (or chimeric Zalpha53
polypeptides) can be purified using fractionation and/or conventional
purification
methods and media. Ammonium sulfate precipitation and acid or chaotrope
extraction
may be used for fractionation of samples. Exemplary purification steps may
include
hydroxyapatite, size exclusion, FPLC and reverse-phase high performance liquid
chromatography. Suitable chromatographic media include derivatized dextrans,
agarose, cellulose, polyacrylamide, specialty silicas, and the like. PEI,
DEAE, QAE
and Q derivatives are preferred. Exemplary chromatographic media include those
media
derivatized with phenyl, butyl, or octyl groups, such as Phenyl-Sepharose FF
(Pharmacia), Toyopearl butyl 650 (Toso Haas, Montgomeryville, PA), Octyl-
Sepharose
(Pharmacia) and the like; or polyacrylic resins, such as Amberchrom CG 71
(Toso
Haas) and the like. Suitable solid supports include glass beads, silica-based
resins,
2 0 cellulosic resins, agarose beads, cross-linked agarose beads, polystyrene
beads, cross-
linked polyacrylamide resins and the like that are insoluble under the
conditions in
which they are to be used. These supports may be modified with reactive groups
that
allow attachment of proteins by amino groups, carboxyl groups, sulfhydryl
groups,
hydroxyl groups and/or carbohydrate moieties. Examples of coupling chemistries
2 5 include cyanogen bromide activation, N-hydroxysuccinimide activation,
epoxide
activation, sulfhydryl activation, hydrazide activation, and carboxyl and
amino
derivatives for carbodiimide coupling chemistries. These and other solid media
are
well known and widely used in the art, and are available from commercial
suppliers.
Methods for binding receptor polypeptides to support media are well known in
the art.
3 0 Selection of a particular method is a matter of routine design and is
determined in part
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
32
by the properties of the chosen support. See, for example, Affinity
Chrornatogr-aphy:
Principles & Methods (Pharmacia LIMB Biotechnology, Uppsala, Sweden, 1988).
The polypeptides of the present invention can be isolated by exploitation
of their properties. For example, immobilized metal ion adsorption (IMAC)
chromatography can be used to purify histidine-rich proteins, including those
comprising polyhistidine tags. Briefly, a gel is first charged with divalent
metal ions to
form a chelate, Sulkowski, Trends irz Biocheni. 3:1 (1985). Histidine-rich
proteins will
be adsorbed to this matrix with differing affinities, depending upon the metal
ion used,
and will be eluted by competitive elution, lowering the pH, or use of strong
chelating
agents. Other methods of purification include purification of glycosylated
proteins by
lectin affinity chromatography and ion exchange chromatography. Methods in
Enzyrnol., Vol. 182, "Guide to Protein Purification", M. Deutscher, (ed.),page
529-539
(Acad. Press, San Diego, 1990). Within additional embodiments of the
invention, a
fusion of the polypeptide of interest and an affinity tag (e.g., maltose-
binding protein,
an immunoglobulin domain) may be constructed to facilitate purification.
Moreover, using methods described in the art, polypeptide fusions, or
hybrid Zalpha53 proteins, are constructed using regions or domains of the
inventive
Zalpha53, Sambrook et al., ibid., Altschul et al., ibid., Picard, Cur. Opin.
Biology,
5:511 (1994). These methods allow the determination of the biological
importance of
2 0 larger domains or regions in a polypeptide of interest. Such hybrids may
alter reaction
kinetics, binding, constrict or expand the substrate specificity, or alter
tissue and
cellular localization of a polypeptide, and can be applied to polypeptides of
unknown
structure.
Fusion proteins can be prepared by methods known to those skilled in
2 5 the art by preparing each component of the fusion protein and chemically
conjugating
them. Alternatively, a polynucleotide encoding both components of the fusion
protein
in the proper reading frame can be generated using known techniques and
expressed by
the methods described herein. For example, part or all of a domains)
conferring a
biological function may be swapped between Zalpha53 of the present invention
with
3 0 the functionally equivalent domains) from another family member. Such
domains
include, but are not limited to, the secretory signal sequence, conserved, and
significant
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
33
domains or regions in this family. Such fusion proteins would be expected to
have a
biological functional profile that is the same or similar to polypeptides of
the present
invention or other known family proteins, depending on the fusion constructed.
Moreover, such fusion proteins may exhibit other properties as disclosed
herein.
Zalpha53 polypeptides or fragments thereof may also be prepared
through chemical synthesis. Zalpha53 polypeptides may be monomers or
multimers;
glycosylated or non-glycosylated; pegylated or non-pegylated; and may or may
not
include an initial methionine amino acid residue.
1 o Chemical Synthesis of Polypeptides
Polypeptides, especially polypeptides of the present invention can also
be synthesized by exclusive solid phase synthesis, partial solid phase
methods, fragment .
condensation or classical solution synthesis. The polypeptides are preferably
prepared
by solid phase peptide synthesis, for example as described by Merrifield, J.
Arn. Chena.
Soc. 85:2149 (1963).
ASSAYS
The activity of.molecules of the present invention can be measured using
a variety of assays. Of particular interest are changes in steroidogenesis,
2 o spermatogenesis, in the testis, LH and FSH production and GnRH in the
hypothalamus.
Such assays are well known in the art.
Proteins of the present invention are useful for increasing sperm
production. Zalpha53 can be measured in vitro using cultured cells or in vivo
by
administering molecules of the claimed invention to the appropriate animal
model. For
2 5 instance, Zalpha53 transfected (or co-transfected) expression host cells
may be
embedded in an alginate environment and injected (implanted) into recipient
animals.
Alginate-poly-L-lysine microencapsulation, permselective membrane
encapsulation and
diffusion chambers have been described as a means to entrap transfected
mammalian
cells or primary mammalian cells. These types of non-immunogenic
"encapsulations"
3 0 or microenvironments permit the transfer of nutrients into the
microenvironment, and
also permit the diffusion of proteins and other macromolecules secreted or
released by
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
34
the captured cells across the environmental barrier to the recipient animal.
Most
importantly, the capsules or microenvironments mask and shield the foreign,
embedded
cells from the recipient animal's immune response. Such microenvironments can
extend the life of the injected cells from a few hours or days (naked cells)
to several
weeks (embedded cells).
Alginate threads provide a simple and quick means for generating
embedded cells. The materials needed to generate the alginate threads are
readily
available and relatively inexpensive. Once made, the alginate threads are
relatively
strong and durable, both iya vitro and, based on data obtained using the
threads, in vivo.
The alginate threads~are easily manipulable and the methodology is scalable
for
preparation of numerous threads. In an exemplary procedure, 3% alginate is
prepared
in sterile H20, and sterile filtered. Just prior to preparation of alginate
threads, the
alginate solution is again filtered. An approximately 50% cell suspension
(containing
about 5 x 105 to about 5 x 107 cells/ml) is mixed with the 3% alginate
solution. One
ml of the alginate/cell suspension is extruded into a 100 nnM sterile filtered
CaCl2
solution over a time period of ~15 min, forming a "thread". The extruded
thread is then
transferred into a solution of 50 mM CaCI~, and then into a solution of 25 mM
CaCI~.
The thread is then rinsed with deionized water before coating the thread by
incubating
in a 0.01% solution of poly-L-lysine. Finally, the thread is rinsed with
Lactated
2 o Ringer's Solution and drawn from solution into a syringe barrel (without
needle
attached). A large bore needle is then attached to the syringe, and the thread
is
intraperitoneally injected into a recipient in a minimal volume of the
Lactated Ringer's
Solution.
An alternative ijz vivo approach for assaying proteins of the present
2 5 invention involves viral delivery systems. Exemplary viruses for this
purpose include
adenovirus, herpesvirus, vaccinia virus and adeno-associated virus (AAV).
Adenovirus, a double-stranded DNA virus, is currently the best studied gene
transfer
vector for delivery of heterologous nucleic acid [for a review, see T.C.
Becker et al.,
Metla. Cell Biol. 43:161 (1994); and J.T. Douglas and D.T. Curiel, Science &
Medicine
3 0 4:44 (1997)]. The adenovirus system offers several advantages: adenovirus
can (i)
accommodate relatively large DNA inserts; (ii) be grown to high-titer; (iii)
infect a
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
broad range of mammalian cell types; and (iv) be used with a large number of
available
vectors containing different promoters. Also, because adenoviruses are stable
in the
bloodstream, they can be administered by intravenous injection.
By deleting portions of the adenovirus genome, larger inserts (up to 7
5 kb) of heterologous DNA can be accommodated. These inserts can be
incorporated
into the viral DNA by direct ligation or by homologous recombination with a co
transfected plasmid. In an exemplary system, the essential E 1 gene has been
deleted
from the viral vector, and the virus will not replicate unless the E1 gene is
provided by
the host cell (the human 293 cell line is exemplary). When intravenously
administered
1 o to intact animals, adenovirus primarily targets the liver. If the
adenoviral delivery
system has an E1 gene deletion, the virus cannot replicate in the host cells.
However,
the host's tissue (e.g., liver) will express and process (and, if a secretory
signal
sequence is present, secrete) the heterologous protein. Secreted proteins will
enter the
circulation in the highly vascularized liver, and effects on the infected
animal can be
15 determined.
The adenovirus system can also be used for protein production i~ vitro.
By culturing adenovirus-infected non-293 cells under conditions where the
cells are not
rapidly dividing, the cells can produce proteins for extended periods of time.
For
instance, BHI~ cells are grown to confluence in cell factories then exposed to
the
2 0 adenoviral vector encoding the secreted protein of interest. The cells are
then grown
under serum-free conditions, which allows infected cells to survive for
several weeks
without significant cell division. Alternatively, adenovirus vector infected
2935 cells
can be grown in suspension culture at relatively high cell density to produce
significant
amounts. of protein (see Gamier et al., Cytotechnol. 15:145 (1994). With
either
2 5 protocol, an expressed, secreted heterologous protein can be repeatedly
isolated from
the cell culture supernatant. Within the infected 2935 cell production
protocol, non-
secreted, proteins may also be effectively obtained.
Agonists and Antagonists
3 o In view of the tissue distribution observed for Zalpha53, agonists
(including the natural ligand/ substrate/ cofactor/ etc.) and antagonists have
enormous
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
36
potential in both in vitro and r.'fa vivo applications. Compounds identified
as Zalpha53
agonists are useful for stimulating the immune system or spermatogenesis. For
example, Zalpha53 and agonist compounds are useful as components of defined
cell
culture media, and may be used alone or in combination with other cytokines
and
hormones to replace serum that is commonly used in cell culture.
Antagonists
Antagonists are also useful as research reagents for characterizing sites
of ligand-receptor interaction. Antagonists of Zalpha53 can also be used to
down-
regulate inflammation as discussed in more further detail below. Inhibitors of
Zalpha53
activity (Zalpha53 antagonists) include anti-Zalpha53 antibodies and soluble
Zalpha53
receptors, as well as other peptidic and non-peptidic agents (including
ribozymes).
Zalpha53 can also be used to identify inhibitors (antagonists) of its
activity. Test
compounds are added to the assays disclosed herein to identify compounds that
inhibit
the activity of Zalpha53. In addition to those assays disclosed herein,
samples can be
tested for inhibition of Zalpha53 activity within a variety of assays designed
to measure
receptor binding or the stimulation/inhibition of Zalpha53-dependent cellular
responses.
For example, Zalpha53-responsive cell lines can be transfected with a reporter
gene
construct that is responsive to a Zalpha53-stimulated cellular pathway.
Reporter gene
2 0 constructs of this type are known in the art, and will generally comprise
a Zalpha53-
DNA response element operably linked to a gene encoding a protein that can be
assayed, such as luciferase. DNA response elements can include, but are not
limited to,
cyclic AMP response elements (CRE), hormone response elements (HRE) insulin
response element (IRE), Nasrin et al., Proc. Natl. Acad. Sci. USA $7:5273
(1990) and
2 5 serum response elements (SRE) (Shaw et al. Cell 56: 563 (1989). Cyclic AMP
response elements are reviewed in Roestler et al., J. Biol. Chenz. 263 (
19):9063 (1988)
and Habener, Molec. Endocrif~ol. 4 (8):1087 (1990). Hormone response elements
are
reviewed in Beato, Cell 56:335 (1989). Candidate compounds, solutions,
mixtures or
extracts are tested for the ability to inhibit the activity of Zalpha53 on the
target cells as
3 0 evidenced by a decrease in Zalpha53 stimulation of reporter gene
expression. Assays of
this type will detect compounds that directly block Zalpha53 binding to cell-
surface
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
37
receptors, as well as compounds that block processes in the cellular pathway
subsequent
to receptor-ligand binding. In the alternative, compounds or other samples can
be
tested for direct blocking of Zalpha53 binding to receptor using Zalpha53
tagged with a
detectable Iabel (e.g., lash biotin, horseradish peroxidase, FTTC, and the
like). Within
assays of this type, the ability of a test sample to inhibit the binding of
labeled Zalpha53
to the receptor is indicative of inhibitory activity, which can be confirmed
through
secondary assays. Receptors used within binding assays may be cellular
receptors or
isolated, immobilized receptors.
A Zalpha53 polypeptide can be expressed as a fusion with an
immunoglobulin heavy chain constant region, typically an Fc fragment, which
contains
two constant region domains and lacks the variable region. Methods for
preparing such
fusions are disclosed in U.S. Patents Nos. 5,155,027 and 5,567,584.. Such
fusions are
typically secreted as multimeric molecules wherein the Fc portions are
disulfide bonded
to each other and two non-Ig polypeptides are arrayed in closed proximity to
each other.
Fusions of this type can be used to affinity purify the ligand. For use in
assays, the
chimeras are bound to a support via the Fc region and used in an ELISA format.
,
A Zalpha53 ligand-binding polypeptide can also be used for purification
of ligand. The polypeptide is immobilized on a solid support, such as beads of
agarose,
cross-linked agarose, glass, cellulosic resins, silica-based resins,
polystyrene, cross-
2 0 linked polyacrylamide, or like materials that are stable under the
conditions of use.
Methods for linking polypeptides to solid supports are known in the art, and
include
amine chemistry, cyanogen bromide activation, N-hydroxysuccinimide activation,
epoxide activation, sulfhydryl activation, and hydrazide activation. The
resulting
medium will generally be configured in the form of a column, and fluids
containing
2 5 ligand are passed through the column one or more times to allow ligand to
bind to the
receptor polypeptide. The ligand is then eluted using changes in salt
concentration,
chaotropic agents (guanidine HCl), or pH to disrupt ligand-receptor binding.
An assay system that uses a ligand-binding receptor (or an antibody, one
member of a complement/ anti-complement pair) or a binding fragment thereof,
and a
3 0 commercially available biosensor instrument (BIAcore, Pharmacia Biosensor,
Piscataway, NJ) may be advantageously employed. Such receptor, antibody,
member of
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
38
a complement/anti-complement pair or fragment is immobilized onto the surface
of a
receptor chip. Use of this instrument is disclosed by Karlsson, J. Izzzmurzol.
Methods
145:229 (1991) and Cunningham and Wells, J. Mol. Biol. 234:554. (I993). A
receptor,
antibody, member or fragment is covalently attached, using amine or sulfhydryl
chemistry, to dextran fibers that are attached to gold film within the flow
cell. A test
sample is passed through the cell. If a ligand, epitope, or opposite member of
the
complementlanti-complement pair is present in the sample, it will bind to the
immobilized receptor, antibody or member, respectively, causing a change in
the
refractive index of the medium, which is detected as a change in surface
plasmon
resonance of the gold film. This system allows the determination of on- and
off rates,
from which binding affinity can be calculated, and assessment of stoichiometry
of
binding.
Ligand-binding receptor polypeptides can also be used within other
assay systems known in the art. Such systems include Scatchard analysis for
determination of binding affinity, Scatchard, Anzz. NYAcad. Sci. S1: 660
(1949) and
calorimetric assays, Cunningham et al., Science 253:545 (1991); Cunningham et
al.,
Sciezzce 245:821 (1991).
Zalpha53 polypeptides can also be used to prepare antibodies that
specifically bind to Zalpha53 epitopes, peptides or polypeptides. The Zalpha53
2 0 polypeptide or a fragment thereof serves as an antigen (immunogen) to
inoculate an
animal and elicit an immune response. Suitable antigens would be the Zalpha53
polypeptides encoded by SEQ 1D NOs: 2-18 and 20-37. Antibodies generated from
this
immune response can be isolated and purified as described herein. Methods for
preparing and isolating polyclonal and monoclonal antibodies are well known in
the art.
2 5 See, for example, Current Protocols in Izriznuzzology, Cooligan, et al.
(eds.), National
Institutes of Health, (John Wiley and Sons, Inc., 1995); Sambrook et al.,
Molecular
Clozzifzg: A Laboratory Mayzual, Second Edition (Cold Spring Harbor, NY,
1989); and
Hurrell, J. G. R., Ed., Mofaoclofzal Hybridoma Antibodies: Techfziques and
Applications
(CRC Press, Inc., Boca Raton, FL, 1982).
3 0 As would be evident to one of ordinary skill in the art, polyclonal
antibodies can be generated from inoculating a variety of warm-blooded animals
such
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
39
as horses, cows, goats, sheep, dogs, chickens, rabbits, mice, and rats with a
Zalpha53
polypeptide or a fragment thereof. The immunogenicity of a Zalpha53
polypeptide may
be increased through the use of an adjuvant, such as alum (aluminum hydroxide)
or
Freund's complete or incomplete adjuvant. Polypeptides useful for immunization
also
include fusion polypeptides, such as fusions of Zalpha53 or a portion thereof
with an
immunoglobulin polypeptide or with maltose binding protein. The polypeptide
immunogen may be a full-length molecule or a portion thereof. If the
polypeptide
portion is "hapten-like", such portion may be advantageously joined or linked
to a
macromolecular carrier (such as keyhole limpet hemocyanin (I~LH), bovine serum
albumin (BSA) or tetanus toxoid) for immunization.
As used herein, the term "antibodies" includes polyclonal antibodies,
affinity-purified polyclonal antibodies, monoclonal antibodies, and antigen-
binding
fragments, such as F(ab')2, Fab proteolytic fragments, Genetically engineered
intact
antibodies or fragments, such as chimeric antibodies, Fv fragments, single
chain
antibodies and the like, as well as synthetic antigen-binding peptides and
polypeptides.
Non-human antibodies may be humanized by grafting non-human CDRs onto human
framework and constant regions, or by incorporating the entire non-human
variable
domains (optionally "cloaking" them with a human-like surface by replacement
of
exposed residues, wherein the result is a "veneered" antibody). In some
instances,
2 0 humanized antibodies may retain non-human residues within the human
variable region
framework domains to enhance proper binding characteristics. Through
humanizing
antibodies, biological half life may be increased, and the potential for
adverse immune
reactions upon administration to humans is reduced.
Alternative techniques for generating or selecting antibodies useful
2 5 herein include ira vitro exposure of lymphocytes to Zalpha53 protein or
peptide, and
selection of antibody display libraries in phage or similar vectors (for
instance, through
use of immobilized or labeled Zalpha53 protein or peptide). Genes encoding
polypeptides having potential Zalpha53 polypeptide-binding domains can be
obtained
by screening random peptide libraries displayed on phage (phage display) or on
3 0 bacteria, such as E. coli. Nucleotide sequences encoding the polypeptides
can be
obtained in a number of ways, such as through random mutagenesis and random
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
polynucleotide synthesis. These random peptide display libraries can be used
to screen
for peptides that interact with a known target, which can be a protein or
polypeptide,
such as a ligand or receptor, a biological or synthetic macromolecule, or
organic or
inorganic substances. Techniques for creating and screening such random
peptide
5 display libraries are known in the art (Ladner et al., US Patent NO.
5,223,409; Ladner
et al., US Patent NO. 4,946,778; Ladner et al., US Patent NO. 5,403,484 and
Ladner et
al., US Patent NO. 5,571,698) and random peptide display libraries and kits
for
screening such libraries are available commercially, for instance from
Clontech (Palo
Alto, CA), Invitrogen Inc. (San Diego, CA), New England Biolabs, Inc.
(Beverly, MA)
10 and Pharmacia LIMB Biotechnology Inc. (Piscataway, NJ). Random peptide
display
libraries can be screened using the Zalpha53 sequences disclosed herein to
identify
proteins that bind to Zalpha53. These "binding proteins" which interact with
Zalpha53
polypeptides can be used for tagging cells; for isolating homolog polypeptides
by
affinity purification; they can be directly or indirectly conjugated to drugs,
toxins,
15 radionuclides and the like. These binding proteins can also be used in
analytical
methods such as for screening expression libraries and neutralizing activity.
The
binding proteins can also be used for diagnostic assays for determining
circulating
levels of polypeptides; for detecting or quantitating soluble polypeptides as
marker of
underlying pathology or disease. These binding proteins can also act as
Zalpha53
2 0 "antagonists" to block Zalpha53 binding and signal transduction iyz vitro
and irz vivo.
Antibodies are determined to be specifically binding if: (1) they exhibit a
threshold level of binding activity, and (2) they do not significantly cross-
react with
related polypeptide molecules. First, antibodies herein specifically bind if
they bind to
a Zalpha53 polypeptide, peptide or epitope with a binding affinity (Ka) of 106
M 1 or
2 5 greater, preferably 107 M 1 or greater, more preferably 108 M 1 or
greater, and most
preferably 109 M 1 or greater. The binding affinity of an antibody can be
readily
determined by one of ordinary skill in the art, for example, by Scatchard
analysis.
Second, antibodies are determined to specifically bind if they do not
significantly cross-react with related polypeptides. Antibodies do not
significantly
3 0 cross-react with related polypeptide molecules, for example, if they
detect Zalpha53 but
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
41
not known related polypeptides using a standard Western blot analysis (Ausubel
et al.,
ibid.). Examples of known related polypeptides are orthologs, proteins from
the same
species that are members of a protein family (e.g. IL-16), Zalpha53
polypeptides, and
non-human Zalpha53. Moreover, antibodies may be "screened against" known
related
polypeptides to isolate a population that specifically binds to the inventive
polypeptides. For example, antibodies raised to Zalpha53 are adsorbed to
related
polypeptides adhered to insoluble matrix; antibodies specific to Zalpha53 will
flow
through the matrix under the proper buffer conditions. Such screening allows
isolation
of polyclonal and monoclonal antibodies non-crossreactive to closely related
1 o polypeptides, Antibodies: A Laboratory Manual, Harlow and Lane (eds.)
(Cold Spring
Harbor Laboratory~Press, 1988); Current Protocols in Iminujaology, Cooligan,
et al.
(eds.), National Institutes of Health (John Wiley and Sons, Inc., 1995).
Screening and
isolation of specific antibodies is well known in the art. See, Fundamental
Irratnunology, Paul (eds.) (Raven Press, 1993); Getzoff et al., Adv. iya
Iframunol. 43: 1-98
(1988); Monoclonal Antibodies: Principles and Practice, Goding, J.W. (eds.),
(Academic Press Ltd., 1996); Benjamin et al., Ann. Rev. Inamunol. 2: 67-101
(1984).
A variety of assays known to those skilled in the art can be utilized to
detect antibodies that specifically bind to Zalpha53 proteins or peptides.
Exemplary
assays are described in detail in Afatibodies: A Laboratory Manual, Harlow and
Lane
2 0 (Eds.) (Cold Spring Harbor Laboratory Press, 1988). Representative
examples of such
assays include: concurrent immunoelectrophoresis, radioimmunoassay,
radioimmuno-
precipitation, enzyme-linked immunosorbent assay (ELISA), dot blot or Western
blot
assay, inhibition or competition assay, and sandwich assay. In addition,
antibodies can
be screened for binding to wild type versus mutant Zalpha53 protein or
polypeptide.
2 5 Antibodies to Zalpha53 may be used for tagging cells that express
Zalpha53; for isolating Zalpha53 by affinity purification; for diagnostic
assays for
determining circulating levels of Zalpha53 polypeptides; for detecting or
quantitating
soluble Zalpha53 as marker of underlying pathology or disease; in analytical
methods
employing FAGS; for screening expression libraries; for generating anti-
idiotypic
3 0 antibodies; and as neutralizing antibodies or as antagonists to block
Zalpha53 in vitro
and in vivo. Suitable direct tags or labels include radionuclides, enzymes,
substrates,
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
42
cofactors, inhibitors, fluorescent markers, chemiluminescent markers, magnetic
particles and the like; indirect tags or labels may feature use of biotin-
avidin or other
complement/anti-complement pairs as intermediates. Antibodies herein may also
be
directly or indirectly conjugated to drugs, toxins, radionuclides and the
like, and these
conjugates used for ih vivo diagnostic or therapeutic applications. Moreover,
antibodies
to Zalpha53 or fragments thereof may be used in vitro to detect denatured
Zalpha53 or
fragments thereof in assays, for example, Western Blots or other assays known
in the
art.
1o BIOACTIVE CONJUGATES:
Antibodies or polypeptides herein can also be directly or indirectly
conjugated to drugs, toxins, radionuclides and the like, and these conjugates
used for 132
vivo diagnostic or therapeutic applications. For instance, polypeptides or
antibodies of
the present invention can be used to identify or treat tissues or organs that
express a
corresponding anti-complementary molecule (receptor or antigen, respectively,
for
instance). More specifically, Zalpha53 polypeptides or anti-Zalpha53
antibodies, or
bioactive fragments or portions thereof, can be coupled to detectable or
cytotoxic
molecules and delivered to a mammal having cells, tissues or organs that
express the
anti-complementary molecule.
2 o Suitable detectable molecules may be directly or indirectly attached to
the polypeptide or antibody, and include radionuclides, enzymes, substrates,
cofactors,
inhibitors, fluorescent markers, chemiluminescent markers, magnetic particles
and the
like. Suitable cytotoxic molecules may be directly or indirectly attached to
the
polypeptide or antibody, and include bacterial or plant toxins (for instance,
diphtheria
2 5 toxin, Pseudosnonas exotoxin, ricin, abrin and the like), as well as
therapeutic
radionuclides, such as iodine-131, rhenium-188 or yttrium-90 (either directly
attached
to the polypeptide or antibody, or indirectly attached through means of a
chelating
moiety, for instance). Polypeptides or antibodies may also be conjugated to
cytotoxic
drugs, such as adriamycin. For indirect attachment of a detectable or
cytotoxic
3 0 molecule, the detectable or cytotoxic molecule can be conjugated with a
member of a
complementary/ anticomplementary pair, where the other member is bound to the
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
43
polypeptide or antibody portion. For these purposes, biotin/streptavidin is an
exemplary complementary/ anticomplementary pair.
In another embodiment, polypeptide-toxin fusion proteins or antibody-
toxin fusion proteins can be used for targeted cell or tissue inhibition or
ablation (for
instance, to treat cancer cells or tissues). Alternatively, if the polypeptide
has multiple
functional domains (i.e., an activation domain or a ligand binding domain,
plus a
targeting domain), a fusion protein including only the targeting domain may be
suitable
for directing a detectable molecule, a cytotoxic molecule or a complementary
molecule
to a cell or tissue type of interest. In instances where the domain only
fusion protein
includes a complementary molecule, the anti-complementary molecule can be
conjugated to a detectable or cytotoxic molecule. Such domain-complementary
molecule fusion proteins thus represent a generic targeting vehicle for
cell/tissue-
specific delivery of generic anti-complementary-detectable/ cytotoxic molecule
conjugates. .
In another embodiment, Zalpha53-cytokine fusion proteins or antibody-
cytokine fusion proteins can be used for enhancing i~ vivo killing of target
tissues (for
example, blood and bone marrow cancers), if the Zalpha53 polypeptide or anti-
Zalpha53 antibody targets the hyperproliferative blood or bone marrow cell.
See,
generally, Hornick et al., Blood 89:4437 (1997). The described fusion proteins
enable
2 0 targeting of a cytokine to a desired site of action, thereby providing an
elevated local
concentration of cytokine. Suitable Zalpha53 polypeptides or anti-Zalpha53
antibodies
target an undesirable cell or tissue (i.e., a tumor or a leukemia), and the
fused cytokine
mediated improved target cell lysis by effector cells. Suitable cytokines for
this purpose
include interleukin 2 and granulocyte-macrophage colony-stimulating factor (GM-
2 5 CSF), for instance.
In yet another embodiment, if the Zalpha53 polypeptide or anti-Zalpha53
antibody targets vascular cells or tissues, such polypeptide or antibody may
be
conjugated with a radionuclide, and particularly with a beta-emitting
radionuclide, to
reduce restenosis. Such therapeutic approach poses less danger to clinicians
who
3 0 administer the radioactive therapy. For instance, iridium-192 impregnated
ribbons
placed into scented vessels of patients until the required radiation dose was
delivered
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
44
showed decreased tissue growth in the vessel and greater luminal diameter than
the
control group, which received placebo ribbons. Further, revascularisation and
stmt
thrombosis were significantly lower in the treatment group. Similar results
are
predicted with targeting of a bioactive conjugate containing a radionuclide,
as described
herein.
The bioactive polypeptide or antibody conjugates described herein can
be delivered intravenously, intraarterially or intraductally, or may be
introduced locally
at the intended site of action.
USES OF POLYNUCLEOTIDElPOLYPEPTIDE:
Molecules of the present invention can be used to identify and isolate
receptors involved in spermatogenesis, steroidogenesis, testicular
differentiation and
regulatory control of the hypothalamic-pituitary-gonadal axis or receptors of
the
immune system. For example, proteins and peptides of the present invention can
be
immobilized on a column and membrane preparations run over the column,
Izzzzzzobilized Affinity Ligazzd Tec7zniques, Hermanson et al., eds., pp.195-
202 (Academic
Press, San Diego, CA, 1992,). Proteins and peptides can also be radiolabeled,
Methods
izz Ezzzyznol., vol. 182, "Guide to Protein Purification", M. Deutscher, ed.,
pp 721-737
(Acad. Press, San Diego, 1990) or photoaffinity labeled, Brunner et al., Anfz.
Rev.
2 0 Biochem. 62:483-514 (1993) and Fedan et al., Biochezzz. Pharnzacol.
33:1167 (1984)
and specific cell-surface proteins can be identified.
The molecules of the present invention will be useful for testing
disorders of the reproductive system and immunological systems.
2 5 GENE THERAPY:
Polynucleotides encoding Zalpha53 polypeptides are useful within gene
therapy applications where it is desired to increase or inhibit Zalpha53
activity. If a
mammal has a mutated or absent Zalp7ia53 gene, the Zalpha53 gene can be
introduced
into the cells of the mammal. In one embodiment, a gene encoding a Zalpha53
3 0 polypeptide is introduced izz vivo in a viral vector. Such vectors include
an attenuated
or defective DNA virus, such as, but not linnited to, herpes simplex virus
(HSV),
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
papillomavinis, Epstein Barr virus (EBV), adenovirus, adeno-associated virus
(AAV),
and the like. Defective viruses, which entirely or almost entirely lack viral
genes, are
preferred. A defective virus is not infective after introduction into a cell.
Use of
defective viral vectors allows for administration to cells in a specific,
localized area,
5 without concern that the vector can infect other cells. Examples of
particular vectors
include, but are not limited to, a defective herpes simplex virus 1 (HSV1)
vector,
Kaplitt et al., Molec. Cell. Neurosci. 2:320 (1991); an attenuated adenovirus
vector,
such as the vector described by Stratford-Perricaudet et al., J. Clizz.
Itzvest. 90:626
(1992); and a defective adeno-associated virus vector, Samulski et al., J.
Virol. 61:3096
l0 (1987); Samulski et al., J. Virol. 63:3822 (1989).
In another embodiment, a Zalpha53 gene can be introduced in a
retroviral vector, e.g., as described in Anderson et al., U.S. Patent No.
5,399,346; Mann
et al. Cell 33:153, 1983; Temin et al., U.S. Patent No. 4,650,764; Temin et
al:, U.S..
Patent No. 4,980,289; Markowitz et al., J. Virol. 62:1120 (1988); Temin et
al., U.S.
15 Patent No. 5,124,263; International Patent Publication No. WO 95/07358,
published
March 16, 1995 by Dougherty et al.; and I~uo et al., Blood 82:84.5 (1993).
Alternatively, the vector can be introduced by lipofection izz vivo using
liposomes.
Synthetic cationic lipids can be used to prepare liposomes for izz vivo
transfection of a
gene encoding a marker, Felgner et al., Proc. Natl. Acad. Sci. USA 84:7413
(1987);
2 0 Mackey et al., Proc. Natl. Acad. Sci. USA 85:8027 ( 1988). The use of
lipofection to
introduce exogenous genes into specific organs in vivo has certain practical
advantages.
Molecular targeting of liposomes to specific cells represents one area of
benefit. More
particularly, directing transfection to particular cells represents one area
of benefit. For
instance, directing transfection to particular cell types would be
particularly
2 5 advantageous in a tissue with cellular heterogeneity, such as the
pancreas, liver, kidney,
and brain. Lipids may be chemically coupled to other molecules for the purpose
of
targeting. Targeted peptides (e.g., hormones or neurotransmitters), proteins
such as
antibodies, or non-peptide molecules can be coupled to Iiposomes chemically.
It is possible to remove the target cells from the body; to introduce the
3 0 vector as a naked DNA plasmid; and then to re-implant the transformed
cells into the
body. Naked DNA vectors for gene therapy can be introduced into the desired
host
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
46
cells by methods known in the art, e.g., transfection, electroporation,
microinjection,
transduction, cell fusion, DEAF dextran, calcium phosphate precipitation, use
of a gene
gun or use of a DNA vector transporter. See, for example, Wu et al., J. Biol.
Cherra.
267:963 (1992); Wu et al., J. Biol. Chefn. 263:14621-4, (1958).
Antisense methodology can be used to inhibit Zalpha53 gene
transcription, such as to inhibit cell proliferation in vivo. Polynucleotides
that are
complementary to a segment of a Zalpha53 polynucleotide (e.g., a
polynucleotide as set
froth in SEQ m NO: 1 or 19) are designed to bind to Zalpha53-encoding mRNA and
to
inhibit translation of such mRNA. Such antisense polynucleotides are used to
inhibit
expression of Zalpha53 polypeptide-encoding genes in cell culture or in a
subject.
The present invention also provides reagents that will find use in
diagnostic applications. For example, the Zalpha53 gene, a probe comprising
Zalplaa53
DNA or RNA or a'subsequence thereof can be used to determine if the Zalpha53
gene
is present on chromosome 10 or if a mutation has occurred. Detectable
chromosomal
aberrations at the Zalpha53 gene locus include, but are not limited to,
aneuploidy, gene
copy number changes, insertions, deletions, restriction site changes and
rearrangements.
Such aberrations can be detected using polynucleotides of the present
invention by
employing molecular genetic techniques, such as restriction fragment length
polymorphism (RFLP) analysis, short tandem repeat (STR) analysis employing PCR
2 0 techniques, and other genetic linkage analysis techniques known in the art
(Sambrook et
al., ibid.; Ausubel et. aL, ibid.; Marian, Chest 108:255 (1995).
Transgenic mice, engineered to express the Zalpha53 gene, and mice
that exhibit a complete absence of Zalpl~a53 gene function, referred to as
"knockout
mice", Snouwaert et al., Science 257:1053 (1992), may also be generated,
Lowell et al.,
Nature 366:740-42 (1993). These mice may be employed to study the Zalplza53
gene
and the protein encoded thereby in an if2 vivo system.
CHROMOSOMAL LOCALIZATION:
Zalplza53 has been mapped to chromosome 10. Radiation hybrid
3 0 mapping is a somatic cell genetic technique developed for constructing
high-resolution,
contiguous maps of mammalian chromosomes (Cox et al., Scieyace 25D:245 (1990).
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
47
Partial or full knowledge of a gene's sequence allows one to design PCR
primers
suitable for use with chromosomal radiation hybrid mapping panels. Radiation
hybrid
mapping panels are commercially available which cover the entire human genome,
such
as the Stanford G3 RH Panel and the GeneBridge 4 RH Panel (Research Genetics,
Inc.,
Huntsville, AL). These panels enable rapid, PCR-based chromosomal
localizations and
ordering of genes, sequence-tagged sites (STSs), and other nonpolymorphic and
polymorphic markers within a region of interest. This includes establishing
directly
proportional physical distances between newly discovered genes of interest and
previously mapped markers. The precise knowledge of a gene's position can be
useful
for a number of purposes, including: 1) determining if a sequence is part of
an existing
contig and obtaining additional surrounding genetic sequences in various
forms, such as
YACs, BACs or cDNA clones; 2)'providing a possible candidate gene for an
inheritable
disease which shows linkage to the same chromosomal region; and 3) cross-
referencing
model organisms, such as mouse, which may aid in determining what function a
particular gene might have.
Sequence tagged sites (STSs) can also be used independently for
chromosomal localization. An STS is a DNA sequence that is unique in the human
genome and can be used as a reference point for a particular chromosome or
region of a
chromosome. An STS is defined by a pair of oligonucleotide primers that are
used in a
2 0 polymerase chain reaction to specifically detect this site in the presence
of all other
genomic sequences. Since STSs are based solely on DNA sequence they can be
completely described within an electronic database, for example, Database of
Sequence
Tagged Sites (dbSTS), GenBank, (National Center for Biological Information,
National
Institutes of Health, Bethesda, MD http:llwww.ncbi.nlm.nih.gov), and can be
searched
2 5 with a gene sequence of interest for the mapping data contained within
these short
genomic landmark STS sequences.
For pharmaceutical use, the proteins of the present invention are
formulated fox parenteral, particularly intravenous or subcutaneous, delivery
according
to conventional methods. Intravenous administration will be by bolus injection
or
3 0 infusion over a typical period of one to several hours. In general,
pharmaceutical
formulations will include a Zalpha53 protein in combination with a
pharmaceutically
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
48
acceptable vehicle, such as saline, buffered saline, 5% dextrose in water or
the like.
Formulations may further include one or more excipients, preservatives,
solubilizers,
buffering agents, albumin to prevent protein loss on vial surfaces, etc.
Methods of
formulation are well known in the art and are disclosed, for example, in
Remington:
The Science afad Pf actice of Phafmacy, Gennaro, ed.,(Mack Publishing Co.,
Easton,
PA, 19th ed,, 1995). Therapeutic doses will generally be in the range of 0.1
to 100
p.g/kg of patient weight per day, preferably 0.5-20 mg/kg per day, with the
exact dose
determined by the clinician according to accepted standards, taking into
account the
nature and severity of the condition to be treated, patient traits, etc.
Determination of
1 o dose is within the level of ordinary skill in the art. The proteins may be
administered
fox acute treatment, over one week or less, often over a period of one to
three days or
may be used in chronic treatment, over several months or years. Administration
of the
protein can be subcutaneous, intraperitoneal or rectal depending on the
disease to be
treated.
Tissue Expression and Use
Zalpha53 represents a novel polypeptide with a putative signal peptide
leader sequence and alpha helical structure. This gene encodes a secreted
polypeptide
with secondary structure indicating it is a member of the four-helix bundle
cytokine
2 o family. Alternatively, this polypeptide may have other activities
associated with other
biological functions including: enzymatic activity, association with the cell
membrane,
or function as a carrier protein.
Use of Zalpha53
2 5 Zalpha53 can be administered to an immunocompromised mammal,
preferably a human, such as cancer patients who have undergone chemotherapy,
AmS
patients and the elderly. This will stimulate their immune systems. Zalpha53
can also be
used as a vaccine adjuvant to be administered before, With or after the
administration of
a vaccine. Zalpha53 may also be administered to stimulate the immune system to
attack
3 0 tumors.
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
49
Use of Antagonists of Zalplza53
An antagonist to Zalpha53, such as an antibody, soluble receptor or
small molecule antagonist can be administered to a mammal, preferably a human,
to
alleviate an inflammatory response. Antagonists, such as antibodies, to
Zalpha53 can be
used to treat patients having inflammatory related diseases such
arteriosclerotic heart
disease [see Paulsson,G. et al., Arterioscler- Throfnb. Vasc. Biol., 20:10-17
(2000)],
inflammatory bowel disease, Crohn's disease, rheumatoid arthritis and
pancreatitis.
EDUCATIONAL KTT UTILITY OF ZALPHA53 POLYPEPTIDES,
l0 POLYNUCLEOTIDES AND ANTIBODIES
Polynucleotides and polypeptides of the present invention will
additionally find use as educational tools as a laboratory practicum kits for
courses
related to genetics and molecular biology, protein chemistry and antibody
production
and analysis. Due to its unique polynucleotide and polypeptide sequence
molecules of
Zalpha53 can be used as standards or as "unknowns" for testing purposes. For
example, Zalpha53 polynucleotides can be used as an aid, such as, for example,
to teach
a student how to prepare expression constructs for bacterial, viral, and/or
mammalian
expression, including fusion constructs, wherein Zalpha53 is the gene to be
expressed;
2 0 for determining the restriction endonuclease cleavage sites of the
polynucleotides;
determining mRNA and DNA localization of Zalpha53 polynucleotides in tissues
(i.e.,
by Northern and Southern blotting as well as polymerase chain reaction); and
for
identifying related polynucleotides and polypeptides by nucleic acid
hybridization.
Zalpha53 polypeptides can be used educationally as an aid to teach
2 5 preparation of antibodies; identifying proteins by Western blotting;
protein purification;
determining the weight of expressed Zalpha53 polypeptides as a ratio to total
protein
expressed; identifying peptide cleavage sites; coupling amino and carboxyl
terminal
tags; amino acid sequence analysis, as well as, but not limited to monitoring
biological
activities of both the native and tagged protein (i.e., receptor binding,
signal
3 0 transduction, proliferation, and differentiation) in vitro and in vivo.
Zalpha53
polypeptides can also be used to teach analytical skills such as mass
spectrometry,
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
circular dichroism to determine conformation, in particular the locations of
the disulfide
bonds, x-ray crystallography to determine the three-dimensional structure in
atomic
detail, nuclear magnetic resonance spectroscopy to reveal the structure of
proteins in
solution. For example, a kit containing the Zalpha53 polypeptide can be given
to the
5 student to analyze. Since the amino acid sequence would be known by the
professor the
protein can be given to the student as a test to determine the skills or
develop the skills
of the student, the teacher would then know whether or not the student has
correctly
analyzed the polypeptide. Since every polypeptide is unique, the educational
utility of
Zalpha53 would be unique unto itself.
10 The antibodies which bind specifically to Zalpha53 can be used as a
teaching aid to instruct students how to prepare affinity chromatography
columns to
purify Zalpha53, cloning and sequencing the polynucleotide that encodes an
antibody
and thus as a practicum for teaching a student how to design humanized
antibodies. The
Zalpha53 gene, polypeptide or antibody would then be packaged by reagent
companies
15 and sold to universities so that the students gain skill in art of
molecular biology.
Because each gene and protein is unique, each gene and protein creates unique
challenges and learning experiences for students in a lab practicum. Such
educational
kits containing the Zalpha53 gene, polypeptide, or antibody, are considered
within the
scope of the present invention.
2 0 The invention is further illustrated by the following non-limiting
examples.
Example 1
Cloning of Zalpha53
2 5 The Zalpha53 cDNA was discovered in a testis cDNA library. The
marathon cDNA was made using the marathon-ReadyTM kit (Clontech, Palo Alto,
CA)
and QC tested with clathrin primers ZC21195 GAGGAGACCATAACCCCCGACAG
(SEQ ID NO: 38) and ZC21196 CATAGCTCCCACCACACGATTTT (SEQ 1l? NO:
39) and then diluted based on the intensity of the clathrin band. To assure
quality of the
3 0 panel samples, three tests for quality control (QC) were run: (1) To
assess the RNA
quality used for the libraries, the in-house cDNAs were tested for average
insert size by
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
51
PCR with vector oligos that were specific for the vector sequences for an
individual
cDNA library; (2) Standardization of the concentration of the cDNA in panel
samples
was achieved using standard PCR methods to amplify full length alpha tubulin
or
G3PDH cDNA using a 5' vector oligo ZC14,063
CACCAGACATAATAGCTGACAGACT (SEQ ID NO: 40) and 3' alpha tubulin
specific oligo primer ZC17,574 GGTRTTGCTCAGCATGCACAC (SEQ ID NO: 41)
or 3' G3PDH specific oligo primer ZC17,600
CATGTAGGCCATGAGGTCCACCAC1 (SEQ ID N0:.42); and (3) a sample was sent
to sequencing to check for possible ribosomal or mitochondrial DNA
contamination.
1 o The panel was set up in a 96-well format that included a human genomic DNA
(Clontech, Palo Alto, CA) positive control sample. Each well contained
approximately
0.2-100 pg/~.l of cDNA. The PCR reactions were set up using oligos ZC37195
GTCCCTGTTTCAGCACATCATC (SEQ D~ NO: 43) and ZC37194
GTCTTCCTCCTCTATCATTTGTTTC (SEQ m NO: 44)., TaKaRa Ex TaqTM
(TAKARA Shuzo Co LTD, Biomedicals Group, Japan), and Rediload dye (Research
Genetics, Inc., Huntsville, AL). The amplification was carried out as follows:
1 cycle at
94°C for 2 minutes, 35 cycles of 94°C for 30 seconds,
57.0°C for 30 seconds and 72°C
for 30 seconds, followed by 1 cycle at 72°C for 5 minutes. About 10 ~,l
of the PCR
reaction product was subjected to standard Agarose gel electrophoresis using a
4%
2 0 agarose gel. The correctly predicted DNA fragment size of ~272bp was
observed in
four testis samples.
The DNA fragment for testis cDNA and testis 1K library pool were
excised and purified using a Gel Extraction Kit (Qiagen, Chatsworth, CA)
according to
manufacturer's instructions. The fragment for the testis 1 K library pool was
confirmed
2 5 by sequencing to show that it was indeed Zalpha53 but had an insertion of
36bp.
From the foregoing, it will be appreciated that, although specific
embodiments of the invention have been described herein for purposes of
illustration,
various modifications may be made without deviating from the spirit and scope
of the
invention. Accordingly, the invention is not limited except as by the appended
claims.
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
1
SEQUENCE LISTING
<110> Gao, Zeren
Shoemaker, Kimberly E.
<120> Mammalian Alpha-Helical Protein-53
<130> 00-106PC
<150> 60124-9,686
<151> 2000-11-17
<160> 44
<170> FastSEQ fior Windows Version 3.0
<210>1
<211>774
<212>DNA
<213>Homo Sapiens
<220>
<221> CDS
<222> (247)...(753)
<400>
1
ggcccgacctgaagcactggctccagccttagggaaggttttggccgtgggttttgttgg 60
cacgtaccattttgctgaaagacagagcaccttgaggacgttatccctaaaatgagagag 120
gactgggattgaaaggctgactacagaaatggctgctgcccagacgccctcaaaagccaa 180
ggatcctcagrgttggttataaaatatttaagggcgagaaaaggatcgcaggagccaggc 240
cctgag agc ttg tcc ctg atc atc acc gag 288
atg gag ttt cag ttc
cac
Met Ser Leu Ser Leu e Gln Ile Ile Thr Glu
Glu Ph His Phe
1 5 10
cat cag gcg gag gag agt cgc cgt ttg atg cga gaa gta agg tcg gaa 336
His Gln Ala Glu Glu Ser Arg Arg Leu Met Arg Glu Val Arg Ser Glu
15 20 25 30
ata acc aga tgt cgt gaa aaa att aag aaa gca acg gag gag ctg aat 384
Ile Thr Arg Cys Arg Glu Lys Ile Lys Lys Ala Thr Glu Glu Leu Asn
35 40 45
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
2
gaa gag aaa atc aag ctg gaa tct aag gtt caa cag ttt ttt gaa aaa 432
Glu Glu Lys Tle Lys Leu Glu Ser Lys Ual Gln Gln Phe Phe Glu Lys
50 55 60
tcc ttc ttc tta cag ctt ttg aaa get cat gaa aat get tta gaa aaa 480
Ser Phe Phe Leu Gln Leu Leu Lys Ala His Glu Asn Ala Leu Glu Lys
65 70 75
cag tac agt gaa att aca aac cat agg aat atg ctt ctt caa acc ttt 528
Gln Tyr Ser Glu Ile Thr Asn His Arg Asn Met Leu Leu Gln Thr Phe
80 85 90
gag get ata aag aaa caa atg ata gag gag gaa gac aaa ttt att aag 576
Glu Ala Ile Lys Lys Gln Met Ile Glu Glu Glu Asp Lys Phe Ile Lys
95 100 105 110
gaa att aca gac ttt aat aat gat tat gaa ata aca aag aaa aga gag 624
Glu Ile Thr Asp Phe Asn Asn Asp Tyr Glu Ile Thr Lys Lys Arg Glu
115 120 125
ctt ttg atg aaa gaa aat gtc aag att gaa ata tct gac tta gaa aac 672
Leu Leu Met Lys Glu Asn Ual Lys Ile Glu Ile Ser Asp Leu Glu Asn
130 135 140
caa gca aac atg ttg aaa agt ggt atg aat aaa tat cac ctc att tgt 720
Gln Ala Asn Met Leu Lys Ser Gly Met Asn Lys Tyr His Leu Ile Cys
145 150 155
ctt gca tta atg aaa ata act tat ttt gaa tga atgaattttc caaaaattta 773
Leu Ala Leu Met Lys Ile Thr Tyr Phe Glu
160 165
a 774
<210>2
<211>168
<212>PRT
<213>Homo Sapiens
<400> 2
Met Ser Leu Glu Ser Leu Phe Gln His Ile Ile Phe Thr Glu His Gln
1 5 10 15
Ala Glu Glu Ser Arg Arg Leu Met Arg Glu Ual Arg Ser Glu Ile Thr
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
3
20 25 30
Arg Cys Arg Glu Lys Ile Lys Lys Ala Thr Glu Glu Leu Asn Glu Glu
35 40 45
Lys Ile Lys Leu Glu Ser Lys Ual Gln Gln Phe Phe Glu Lys Ser Phe
50 55 60
Phe Leu Gln Leu Leu Lys Ala His Glu Asn Ala Leu Glu Lys Gln Tyr
65 70 75 80
Ser Glw Ile Thr Asn His Arg Asn Met Leu Leu Gln Thr Phe Glu Ala
85 90 95
Ile Lys Lys Gln Met Ile Glu Glu Glu Asp Lys Phe Ile Lys Glu Ile
100 105 110
Thr Asp Phe Asn Asri Asp Tyr Glu Ile Thr Lys Lys Arg Glu Leu Leu
115 120 125
Met Lys Glu Asn Ual Lys Ile Glu Ile Ser Asp Leu Glu Asn Gln Ala
130 135 140
Asn Met Leu Lys Ser Gly Met Asn Lys Tyr His Leu Ile Cys Leu Ala
145 150 155 160
Leu Met Lys Ile Thr Tyr Phe Glu
165
<210>3
<211>143
<212>PRT
<213>Homo sapiens
<400> 3
Glu Ual Arg Ser Glu Ile Thr Arg Cys Arg Glu Lys Ile Lys Lys Ala
1 5 10 15
Thr Glu Glu Leu Asn Glu Glu Lys Ile Lys Leu Glu Ser Lys Ual Gln
20 25 30
Gln Phe Phe Glu Lys Ser Phe Phe Leu Gln Leu Leu Lys Ala His Glu
35 40 45
Asn Ala Leu Glu Lys Gln Tyr Ser Glu Ile Thr Asn His Arg Asn Met
50 55 60
Leu Leu Gln Thr Phe Glu Ala Ile Lys Lys Gln Met Ile Glu Glu Glu
65 70 75 80
Asp Lys Phe Ile Lys Glu Ile Thr Asp Phe Asn Asn Asp Tyr Glu Ile
85 90 95
Thr Lys Lys Arg Glu Leu Leu Met Lys Glu Asn Ual Lys Ile Glu Ile
100 105 110
Ser Asp Leu Glu Asn Gln Ala Asn Met Leu Lys Ser Gly Met Asn Lys
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
4
115 120 125
Tyr His Leu Ile Cys Leu Ala Leu Met Lys Ile Thr Tyr Phe Glu
130 135 140
<210>4
<211>16
<212>PRT
<213>Homo sapiens
<400> 4
Arg Ser Glu Ile Thr Arg Cys Arg Glu Lys Ile Lys Lys Ala Thr Glu
1 5 10 15
<210>5
<211>15
<212>PRT
<213>Homo sapiens
<400> 5
Asn Ala Leu Glu Lys Gln Tyr Ser Glu Ile Thr Asn His Arg Asn
1 5 10 15
<210>6
<211>15
<212>PRT
<213>Homo Sapiens
<400> 6
Gln Thr Phe Glu Ala Ile Lys Lys GIn Met Ile Glu Glu Glu Asp
1 5 10 15
<210>7
<211>16
<212>PRT
<213>Homo Sapiens
<400> 7
Leu Lys Ser Gly Met Asn Lys Tyr His Leu Ile Cys Leu Ala Leu Met
1 5 10 15
<210> 8
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
<211> 28
<212> PRT
<213> Homo sapiens
<400> 8
Glu Ual Arg Ser Glu Ile Thr Arg Cys Arg Glu Lys Tle Lys Lys Ala
1 5 10 15
Thr Glu Glu Leu Asn Glu Glu Lys Ile Lys Leu Glu
20 25
<210>9
<211>43
<212>PRT
<213>Homo sapiens
<400> 9
GluGlu AsnGlu Glu Lys Lys Leu Glu Ser Lys Val
Leu Ile Gln Gln
1 5 10 15
PhePhe LysSer Phe Phe Gln Leu Leu Lys Ala His
Glu Leu Glu Asn
20 25 30
AlaLeu LysGln Tyr Ser Ile Thr Asn
Glu Glu
35 40
<210>10
<211>42
<212>PRT
<213>Homo Sapiens
<400> 10
GluLys TyrSer Ile AsnHis Arg Asn Met Leu
Gln Glu Thr Leu Gln
1 5 10 15
ThrPhe AlaIle Lys MetIle Glu Glu Glu Asp
Glu Lys Gln Lys Phe
20 25 30
IleLys IleThr Phe AsnAsp
Glu Asp Asn
35 40
<210>11
<211>41
<212>PRT
<213>Homo sapiens
<400> 11
Glu Glu Glu Asp Lys Phe Ile Lys Glu Ile Thr Asp Phe Asn Asn Asp
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
6
1 5 10 15
Tyr Glu Ile Thr Lys Lys Arg Glu Leu Leu Met Lys Glu Asn Ual Lys
20 25 30
Ile Glu Ile Ser Asp Leu Glu Asn Gln
35 40
<210>12
<211>38
<212>PRT
<213>Homo Sapiens
<400> 12
Asn Asn Asp Tyr Glu Ile Thr Lys Lys Arg Glu Leu Leu Met Lys Glu
1 5 . 10 15
Asn Ual Lys Ile Glu Ile Ser Asp Leu Glu Asn Gln Ala Asn Met Leu
20 25 30
Lys Ser Gly Met Asn Lys
<210>13
<211>61
<212>PRT
<213>Homo Sapiens
<400> 13
ArgSerGlu IleThrArg CysArgGluLys IleLys LysAlaThr
Glu
1 5 10 15
GluLeuAsn GluGluLys IleLysLeuGlu SerLys UalGlnGln
Phe
20 25 30
PheGluLys SerPhePhe LeuGlnLeuLeu LysAla HisGluAsn
Ala
35 40 45
LeuGluLys GlnTyrSer GluIleThrAsn HisArg Asn
50 55 60
<210>14
<211>79
<212>PRT
<213>Homo sapiens
<400> 14
Arg Ser Glu Ile Thr Arg Cys Arg Glu Lys Ile Lys Lys Ala Thr Glu
1 5 10 15
Glu Leu Asn Glu Giu Lys Ile Lys Leu Glu Ser Lys Ual Gln Gln Phe
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
7
20 25 30
PheGluLys SerPhe LeuGlnLeuLeu AlaHis Glu Asn
Phe Lys Ala
35 40 45
LeuGluLys GlnTyr GluIleThrAsn ArgAsn Met Leu
Ser His Leu
50 55 60
GlnThrPhe GluAla LysLysGlnMet GluGlu Glu Asp
Ile Ile
65 70 75
<210>15
<211>135
<212>PRT
<213>Homo sapiens
<400> 15
ArgSerGlu IleThrArg CysArgGluLys IleLys LysAlaThr Glu
1 5 10 15
GluLeuAsn GluGluLys IleLysLeuGlu SerLys UalGlnGln Phe
20 25 ~ 30
PheGluLys SerPhePhe LeuGlnLeuLeu LysAla HisGluAsn Ala
35 40 45
LeuGluLys GlnTyrSer GluIleThrAsn HisArg AsnMetLeu Leu
50 55 60
GlnThrPhe GluAlaIle LysLysGlnMet IleGlu GluGluAsp Lys
65 70 75 80
PheIleLys GluIleThr AspPheAsnAsn AspTyr GluIleThr Lys
85 90 95
LysArgGlu LeuLeuMet LysGluAsnUal LysIle GluIleSer Asp
100 105 110
LeuGluAsn GlnAlaAsn MetLeuLysSer GlyMet AsnLysTyr His
115 120 125
LeuIleCys LeuAlaLeu Met
130 135
<210>16
<211>33
<212>PRT
<213>Homo sapiens
<400> 16
Asn Ala Leu Glu Lys Gln Tyr Ser Glu Ile Thr Asn His Arg Asn Met
1 5 10 15
Leu Leu Gln Thr Phe Glu Ala Ile Lys Lys Gln Met Ile Glu Glu Glu
20 25 ' 30
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
8
Asp
<210>17
<211>89
<212>PRT
<213>Homo sapiens
<400> 17
AsnAlaLeu GluLysGln TyrSerGluIle ThrAsn HisArgAsn Met
1 5 10 15
LeuLeuGln ThrPheGlu AlaIleLysLys GlnMet IleGluGlu Glu
20 25 30
AspLysPhe IleLysGlu IleThrAspPhe AsnAsn AspTyrGlu Ile
35 40 45
ThrLysLys ArgGluLeu LeuMetLysGlu AsnUal LysTleGlu Ile
50 55 60
SerAspLeu GluAsnGln AlaAsnMetLeu LysSer GlyMetAsn Lys
65 70 75 80
TyrHisLeu IleCysLeu AlaLeuMet
85
<210>18
<211>72
<212>PRT
<213>Homo sapiens
<400> 18
LeuGlnThr PheGluAla IleLysLysGln MetIle GluGluGlu
Asp
1 5 10 15
LysPheIle LysGluIle ThrAspPheAsn AsnAsp TyrGluIle
Thr
20 25 30
LysLysArg GluLeuLeu MetLysGluAsn UalLys IleGluIle
Ser
35 40 45
AspLeuGlu AsnGlnAla AsnMetLeuLys SerGly MetAsnLys
Tyr
50 55 60
HisLeuIle CysLeuAla LeuMet
65 70
<210>19
<211>738
<212>DNA
<213>Homo sapiens
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
9
<220>
<221> CDS
<222> (247)...(717)
<400>
19
ggcccgacctgaagcactggctccagccttagggaaggttttggccgtgggttttgttgg 60
cacgtaccattttgctgaaagacagagcaccttgaggacgttatccctaaaatgagagag 120
gactgggattgaaaggctgactacagaaatggctgctgcccagacgccctcaaaagccaa 180
ggatcctcagggttggttataaaatatttaagggcgagaaaaggatcgcaggagccaggc 240
cctgag agc ttg tcc ctg atc atc acc gag 288
atg gag ttt cag ttc
cac
Met Ser Leu Ser Leu e Gln Ile Tle Thr Glu
Glu Ph His Phe
1 5 10
cat cag gcg gag gag agt cgc cgt ttg atg cga gaa gta agg tcg gaa 336
His Gln Ala Glu Glu Ser Arg Arg Leu Met Arg Glu Ual Arg Ser Glu
15 20 25 30
ata acc aga tgt cgt gaa aaa att aag aaa gca acg gag gag ctg aat - 384
Ile Thr Arg Cys Arg Glu Lys Ile Lys Lys Ala Thr Glu Glu Leu Asn
35 40 45
gaa gag aaa atc aag ctg gaa tct aag ctt ttg aaa get cat gaa aat 432
Glu Glu Lys Ile Lys Leu Glu Ser Lys Leu Leu Lys Ala His Glu Asn
50 55 60
get tta gaa aaa cag tac agt gaa att aca aac cat agg aat atg ctt 480
Ala Leu Glu Lys Gln Tyr Ser Glu Ile Thr Asn His Arg Asn Met Leu
65 70 75
ctt caa acc ttt gag get ata aag aaa caa atg ata gag gag gaa gac 528
Leu Gln Thr Phe Glu Ala Ile Lys Lys Gln Met Ile Glu Glu Glu Asp
80 85 90
aaa ttt att aag gaa att aca gac ttt aat aat gat tat gaa ata aca 576
Lys Phe Ile Lys Glu Ile Thr Asp Phe Asn Asn Asp Tyr Glu Ile Thr
95 100 105 110
aag aaa aga gag ctt ttg atg aaa gaa aat gtc aag att gaa ata tct 624
Lys Lys Arg Glu Leu Leu Met Lys Glu Asn Ual Lys Ile Glu Ile Ser
115 120 125
gac tta gaa aac caa gca aac atg ttg aaa agt ggt atg aat aaa tat 672
Asp Leu Glu Asn Gln Ala Asn Met Leu Lys Ser Gly Met Asn Lys Tyr
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
130 135 140
cac ctc att tgt ctt gca tta atg aaa ata act tat ttt gaa tga 717
His Leu Ile Cys Leu Ala Leu Met Lys Ile Thr Tyr Phe Glu
145 150 155
atgaattttc caaaaattta a 738
<210>20
<211>156
<212>PRT
<213>Homo sapiens
<400> 20
MetSerLeu GluSer LeuPheGlnHis IleIlePhe ThrGlu HisGln
1 5 10 15
AlaGluGlu SerArg ArgLeuMetArg GluUalArg SerGlu IleThr
20 25 30
ArgCysArg GluLys IleLysLysAla ThrGluGlu LeuAsn GluGlu
35 40 45
LysIleLys LeuGlu SerLysLeuLeu LysAlaHis GluAsn AlaLeu
50 55 60
GluLysGln TyrSer GluTleThrAsn HisArgAsn MetLeu LeuGln
65 70 75 80
ThrPheGlu AlaIle LysLysGlnMet IleGluGlu GluAsp LysPhe
85 90 95
IleLysGlu IleThr AspPheAsnAsn AspTyrGlu IleThr LysLys
100 105 110
ArgGluLeu LeuMet LysGluAsnUal LysIleGlu IleSer AspLeu
115 120 125
GluAsnGln AlaAsn MetLeuLysSer GlyMetAsn LysTyr HisLeu
130 135 140
IleCysLeu AlaLeu MetLysIleThr TyrPheGlu
145 150 155
<210> 21
<211> 131
<212> PRT
<213> Homo sapiens
<400> 21
Glu Ual Arg Ser Glu Ile Thr Arg Cys Arg Glu Lys Ile Lys Lys Ala
1 5 10 15
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
11
Thr Glu Glu Leu Asn Glu Glu Lys Ile Lys Leu Glu Ser Lys Leu Leu
20 25 30
Lys Ala His Glu Asn Ala Leu Glu Lys Gln Tyr Ser Glu Ile Thr Asn
35 40 45
His Arg Asn Met Leu Leu Gln Thr Phe Glu Ala Ile Lys Lys Gln Met
50 55 60
Ile Glu Glu Glu Asp Lys Phe Ile Lys Glu Ile Thr Asp Phe Asn Asn
65 70 75 80
Asp Tyr Glu Ile Thr Lys Lys Arg Glu Leu Leu Met Lys Glu Asn Ual
85 90 95
Lys Ile Glu Ile Ser Asp Leu Glu Asn Gln Ala Asn Met Leu Lys Ser
100 105 110
Gly Met Asn Lys Tyr His Leu Ile Cys Leu Ala Leu Met Lys Ile Thr
115 120 125
Tyr Phe Glu
130
<210>22
<211>45
<212>PRT
<213>Homo Sapiens
<400> 22
GluUal SerGlu Ile Thr Cys ArgGlu Lys Ile Lys Lys
Arg Arg Ala
1 5 20 15
ThrGlu LeuAsn Glu Glu Ile LysLeu Glu Ser Lys Leu
Glu Lys Leu
20 25 30
LysAla GluAsn Ala Leu Lys GlnTyr Ser Glu
His Glu
35 40 45
<210>23
<211>54
<212>PRT
<213>Homo sapiens
<400> 23
ArgGlu IleLysLys Ala GluGlu Leu Asn GluLys
Lys Thr Glu Ile
1 5 10 15
LysLeu SerLysLeu Leu AlaHis Glu Asn LeuGlu
Glu Lys Ala Lys
20 25 30
GlnTyr GluIleThr Asn ArgAsn Met Leu GlnThr
Ser His Leu Phe
35 40 45
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
12
Glu Ala Ile Lys Lys Gln
<210>24
<211>54
<212>PRT
<213>Homo Sapiens
<400> 24
GluSer LysLeuLeu LysAla GluAsn Leu Lys Gln
His Ala Glu Tyr
1 5 10 15
SerGlu IleThrAsn HisArg MetLeu Gln Phe Glu
Asn Leu Thr Ala
20 25 30
IleLys LysGlnMet IleGlu GluAsp Phe Lys Glu
Glu Lys Ile Ile
35 40 45
ThrAsp PheAsnAsn Asp
50
<210>25
<211>45
<212>PRT
<213>Homo Sapiens
<400> 25
GluIle AsnHis Asn Met LeuGln Thr Phe Glu Ala
Thr Arg Leu Ile
1 5 10 15
LysLys MetIle Glu Glu LysPhe Ile Lys Glu Ile
Gln Glu Asp Thr
20 25 30
AspPhe AsnAsp Glu Ile LysLys Arg Glu
Asn Tyr Thr
35 40 45
<210>26
<211>42
<212>PRT
<213>Homo Sapiens
<400> 26
LysLys MetIle Glu Glu Glu Lys Phe Ile Lys Glu
Gln Asp Ile Thr
1 5 10 15
AspPhe AsnAsp Tyr Glu Ile Lys Lys Arg Glu Leu
Asn Thr Leu Met
20 25 30
LysGlu ValLys Ile Glu Ile Asp
Asn Ser
35 40
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
13
<210>27
<211>38
<212>PRT
<213>Homo sapiens
<400> 27
AsnAsn Tyr Glu Ile Thr Lys Lys Arg Glu Leu Leu
Asp Met Lys Glu
1 5 10 15
AsnVal Ile Glu Ile Ser Asp Leu Glu Asn Gln Ala
Lys Asn Met Leu
20 25 30
LysSer Met Asn Lys
Gly
35
<210>28
<211>16
<212>PRT
<213>Homo sapiens
<400> 28
Arg Ser Glu Ile Thr Arg Cys Arg Glu Lys Ile Lys Lys Ala Thr Glu
1 5 10 15
<210>29
<211>16
<212>PRT
<213>Homo Sapiens
<400> 29
Glu Asn Ala Leu Glu Lys Gln Tyr Ser Glu Ile Thr Asn His Arg Asn
1 5 10 15
<210>30
<211>16
<212>PRT
<213>Homo Sapiens
<400> 30
Leu Gln Thr Phe Glu Ala Ile Lys Lys Gln Met Ile Glu Glu Glu Asp
1 5 10 15
<210> 31
<211> 16
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
14
<212> PRT
<213> Homo sapiens
<400> 31
Leu Lys Ser Gly Met Asn Lys Tyr His Leu Ile Cys Leu Ala Leu Met
1 5 ~ 10 15
<210>32
<211>49
<212>PRT
<213>Homo sapiens
<400> 32
ArgSer IleThr Cys GluLys Ile Lys AlaThr
Glu Arg Arg Lys Glu
1 5 10 15
GluLeu GluGlu Ile LeuGlu Ser Lys LeuLys
Asn Lys Lys Leu Ala
20 25 30
HisGlu AlaLeu Lys TyrSer Glu I'le AsnHis
Asn Glu Gln Thr Arg
35 40 45
Asn
<210>33
<211>67
<212>PRT
<213>Homo sapiens
<400> 33
Arg Ser Glu Ile Thr Arg Cys Arg Glu Lys Ile Lys Lys Ala Thr Glu
1 5 10 15
Glu Leu Asn Glu Glu Lys Ile Lys Leu Glu Ser Lys Leu Leu Lys Ala
20 25 30
His Glu Asn Ala Leu Glu Lys Gln Tyr Ser Glu Ile Thr Asn His Arg
35 40 45
Asn Met Leu Leu Gln Thr Phe Glu Ala Ile Lys Lys Gln Met Ile Glu
50 55 60
Glu Glu Asp
<210>34
<211>123
<212>PRT
<213>Homo Sapiens
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
15 ,
<400> 34
Arg Ser Glu Ile Thr Arg Cys Arg Glu Lys Ile Lys Lys Ala Thr Glu
1 5 10 15
Glu Leu Asn Glu Glu Lys Ile Lys Leu Glu Ser Lys Leu Leu Lys Ala
20 25 30
His Glu Asn Ala Leu Glu Lys Gln Tyr Ser Glu Ile Thr Asn Nis Arg
35 40 45
Asn Met Leu Leu Gln Thr Phe Glu Ala Ile Lys Lys Gln Met Ile Glu
50 55 60
Glu Glu Asp Lys Phe Ile Lys Glu Ile Thr Asp Phe Asn Asn Asp Tyr
65 70 75 80
Glu Ile Thr Lys Lys Arg Glu Leu Leu Met Lys Glu Asn Ual Lys Ile
85 90 95
Glu Ile Ser Asp Leu Glu Asn Gln Ala Asn Met Leu Lys Ser Gly Met
100 105 110
Asn Lys Tyr His Leu Ile Cys Leu Ala Leu Met
115 120
<210>35
<211>34
<212>PRT
<213>Homo sapiens
<400> 35
Glu Asn Ala Leu Glu Lys Gln Tyr Ser Glu Ile Thr Asn His Arg Asn
1 5 l0 15
Met Leu Leu Gln Thr Phe Glu Ala Ile Lys Lys Gln Met Ile Glu Glu
20 25 30
Glu Asp
<210>36
<211>90
<212>PRT
<213>Homo sapiens
<400> 36
GluAsnAla LeuGluLysGln TyrSerGlu IleThrAsn HisArgAsn
1 5 10 15
MetLeuLeu GlnThrPheGlu AlaIleLys LysGlnMet IleGluGlu
20 25 30
GluAspLys PheIleLysGlu IleThrAsp PheAsnAsn AspTyrGlu
35 40 45
IleThrLys LysArgGluLeu LeuMetLys GluAsnUal LysIleGlu
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
16
50 55 60
Ile Ser Asp Leu Glu Asn Gln Ala Asn Met Leu Lys Ser Gly Met Asn
65 70 75 80
Lys Tyr His Leu Ile Cys Leu Ala Leu Met
85 90
<210>37
<211>72
<212>PRT
<213>Homo Sapiens
<400> 37
LeuGlnThrPheGlu AlaTle LysLysGlnMet IleGluGlu GluAsp
1 5 10 15
LysPheIleLysGlu IleThr AspPheAsnAsn AspTyrGlu IleThr
20 25 30
LysLysArgGluLeu LeuMet LysGluAsnUal LysIleGlu IleSer
35 40 45
AspLeuGluAsnGln AlaAsn MetLeuLysSer GlyMetAsn LysTyr
50 55 60
HisLeuIleCysLeu AlaLeu Met
65 70
<210>38
<211>23
<212>DNA
<213>Nomo Sapiens
<400> 38
gaggagacca taacccccga cag 23
<210>39
<211>23
<212>DNA
<213>Homo sapiens
<400> 39
catagctccc accacacgat ttt 23
<210>40
<211>25
<212>DNA
<213>Homo Sapiens
CA 02429265 2003-05-15
WO 02/079248 PCT/USO1/43884
17
<400> 40
caccagacat aatagctgac agact 25
<210>41
<211>21
<212>DNA
<213>Homo sapiens
<400> 41
ggtrttgctc agcatgcaca c 21
<210>42
<211>24
<212>DNA
<213>Homo sapiens
<400> 42
catgtaggcc atgaggtcca ccac 24
<210>43
<211>22
<212>DNA
<213>Homo sapiens
<400> 43
gtccctgttt cagcacatca tc 22
<210>44
<211>25
<212>DNA
<213>Homo sapiens
<400> 44
gtcttcctcc tctatcattt gtttc 25
