Note: Descriptions are shown in the official language in which they were submitted.
CA 02430223 2003-05-30
RERATINOCYTE GRO~Q"f8 FACTOR-2
This invention relates to newly identified
polynucleotides, polypeptides encoded by such
polynucleotides, the use of such polynucleotides and
polypeptides, as well as the production of such
- polynucleotides and polypeptides. More particularly, the
polypeptide of the present invention is a Keratinocyte growth
factor, sometimes hereinafter referred to as "KGF-2". The
invention also relates to inhibiting the action of such
polypeptides. ._
The fibroblast growth factor family has emerged as a
large family of growth factors involved in soft-tissue growth
and regeneration. It presently includes several members that
share a varying degree of homology at the protein level, and
that, with one exception, appear to have a similar broad
mitogenic spectrum, i.e., they promote the proliferation of
a variety of cells of mesodemial and neuroectodermal origin
and/or promote angiogenesis.
The pattern of- expression of the different members of
the family is very different, ranging from extremely
restricted expressions of some stages of development, to
rather ubiquitous expression in a variety of tissues and
organs. All the members appear to~ bind heparin and heparin
sulfate proteoglycans and glycosaminoglycans and strongly
-la-
CA 02430223 2003-05-30
concentrate in the extracellular matrix. KGF was originally
identified as a member of the FGF family by sequence homology
or factor purification and cloning. .
K.eratinocyte growth factor (KGF) was isolated as' a
mitogen for a cultured marine keratinocyte line (Robin, J. S . ,
et al., PNAS, USA, 86:802-806 (1989)). Unlike the other
members of the FGF family, it has little activity on
mesenchyme-derived cells but stimulates the growth of
epithelial cells. The Reratinocyte growth factor gene
encodes a 194-amino acid polypeptide (Finch, P.W., et al.,
Science, 245:?52-X55 (1989)). The N-terminal 64 amino acids
are unique, but the remainder of the proteia has about 30%
homology to bFGF. RGF is, the most divergent member of the
FGF family. The molecule has a hydrophobic signal sequence
and is - efficiently secreted. Post-translational
modifications include cleavage of the signal sequence and N-
linked glycosylation at one site, resulting in a protein of
28 kDa. Reratinocyte growth factor is produced by
fibroblast derived from skin and fetal lung, (Rubin,~ et al. ,
(1989) ) . The Keratinocyte growth factor mRl~i was found, to be
expressed in adult kidney, colon and ilium, but not in brain
or lung (Finch, P.W., et al., Sc3.ence, 245:752-755 (1989) ) .
KGF displays the conserved regians within the FGF protein
family. RGF binds to the FGF-Z receptor with high affinity.
Summary of tl~e Irwer~~ior~
It is an object of the present invention to provide keratinocyte growth factor-
2. In accordance with
an aspect of the present invention there is provided an isolated
polynucleotide selected from the
group consisting of
a. a polynucleotide encoding the polypeptide having the deduced amino acid
sequence
of SEQ ID No. 2 or a fragment, analog or derivative of said polypeptide;
b. a polynucleotide encoding the polypeptide having the amino acid sequence
encoded
by the cDNA contained in ATCC Deposit No. 75977 or a fragment, analog or
derivative of said polypeptide.
-2-
CA 02430223 2003-05-30
In accordance with another aspect of the present invention there is provided a
polypeptide selected
from the group consisting of (i) a polypeptide having the deduced amino acid
sequence of SEQ ID
No. 2 and fragments, analogs and derivatives thereof and (ii) a polypeptide
encoded by the cDNA
of ATCC Deposit No. 75977 and fragments, analogs and derivatives of said
polypeptide.
In accordance with another aspect of the present invention there is provided a
process for identifying
compounds active as agonists to KGF-2 comprising:
a. combining a compound to be screened, and a reaction mixture containing
cells under
conditions where the cells are normally stimulated by KGF-2, said reaction
mixture
containing a label incorporated into the cells as they proliferate; and
b. determining the extent of proliferation of the cells to identify if the
compound is an
effective agonist.
The polypeptide of the present invention has been
putatively identified as a member of the FGF family, more
' particularly the polypeptide has been putatively identified
as KGF-2 as a result of amino acid sequence homology with
other members of the FGF family.
In accordance with one aspect of the present invention,
there are provided novel mature polypeptides which are KGF-2
' as well as biologically act~.ve and diagnostically" or~
therapeutically useful fragments, analogs and derivatives
thereof. The polypeptides of the present invention are of
human origin.
-2a-
CA 02430223 2003-05-30
In accordance with one aspect of the present invention,
there are. provided isolated nucleic~acid molecules encoding
human RGF-2, including mRNAs, DNAs, cDNAs, genomic DNA, as
well as antisense analogs thereof and biologically active and
diagnostically or therapeutically useful fragments thereof.
In accordance with another aspect of the present
invention, there is provided a process for producing such
w polypeptide by recombinant techniques through the use of
recombinant vectors, such as cloning and expression plasmids
useful as reagents in the rec~nbinant production of KGF-2
proteins, as well .as recombinant prokaryotic and/or
eukaryotic host cells comprising a human KGF-2 nucleic acid
sequence.
In accordance with yet a further aspect of the present
invention, there is provided a process for utilizing such
polypeptide, or polynucleotide encoding such polypeptide for
therapeutic'purposes, for example, to stimulate epithelial
cell proliferation for the purpose of wound healing, and to
stimulate hair follicle production and healing of dermal
wounds. .
In accordance with yet a further aspect of the present
invention, there are provided antibodies against ~ such
polypeptides. .'
In accordance with another aspect of the present
invention, there are provided nucleic acid probes comprising
nucleic acid molecules of sufficient length to specifically
hybridize to human RGF-2 sequences.
In accordance with yet another aspect of the present
invention, there are provided antagonists to such
polypeptides, which may be used to inhibit the action of such
polypeptides, for example, to reduce scarring during the
wound healing process and to prevent and/or treat tumor
proliferation, diabetic retinopathy, rheumatoid arthritis and
tumor growth-
-3 -
CA 02430223 2003-05-30
In accordance with yet. another aspect-of the present
invention, there are provided diagnostic assays for detecting
diseases or susceptibility to diseases related to mutations
in RGF-2 nucleic acid sequences or over-expression of the
polypeptides encoded by such sequences. -
In accordance with another aspect of the present
invention, there is provided a process fvr utilizing such
polypeptides, or polynucleotides encod3.ng such polypeptides,
for ire of tzn purposes related to scientific research,
synthesis of DNA and manufacture of DNA vectors.
These and other aspects of the present invention should
be apparent to those skilled in the art from the teachings -
herein.
The following drawings are illustrative of embodiments
of the invention and are not meant to limit the scope of the
invention as encompassed by the claims.
Figure 1 illustrates the cDNA and corresponding deduced
amino acid sequence of the polypeptide of the present
invention. The initial 36 amino acid .residues.represent the
putative leader sequence (underlined). The standard one-
letter abbreviations for amino acids are used. Sequencing
inaccuracies are a common problem when attempting to -
determine polynucleotide sequences. Sequencing was performed
using a 373 Automated DNA sequencer (Applied Biosystems,
Inc.). Sequencing accuracy is predicted to be greater than
97% accurate.
Figure 2 is an illustration of a comparison of the amino
acid sequence of the pol~rpeptide of the present invention and
other fibroblast growth factors.
In accordance with an aspect of the present invention,
there is provided an isolated nucleic acid (polynucleotide)
which encodes for the mature polypeptide having the deduced
amino acid sequence of Figure 1 (S8~ ID No. 2? or for the
mature polypeptide encoded by the cDNA of the clone deposited
as ATCC Deposit No. ?5977 on December 16, 1994.
-4-
CA 02430223 2003-05-30
A polynucleotide encoding a polypeptide of the present
invention may be obtained from a human prostate and fetal
lung. A fragment of the eDNA encoding the polypeptide was
initially isolated fram a library derived from a human normal
prostate. The open reading frame encoding the full-length
protein was subsequently isolated from a randomly primed
human fetal lung-cDNA library. it is structurally related to
the FGF family. It contains an open reading frame encoding
a protein of 208 amino acid residues of which approximately
the first 36 amino acid residues are the putative leader
sequence such that the mature protein comprises 1T2 amino
acids. The protein exhibits the. highest degree of homology
to human keratinocyte growth factor with 45 % identity and 82
% similarity over a 206 amino acid stretch. It is also
important that sequences that are conserved through the FGF
family are found to be consezved in the protein of the
present invention.
The polynucleotide of the present invention may be in
the form of RNA or in the foam of DNA, which DNA includes
cDNA, genomic DNA, and synthetic DNA. The DNA may be double-
stranded or single-stranded, and if single stranded may be
the coding strand or non-coding (anti-sense) strand. The
coding sequence which encodes the mature polypeptide may be
identical to the coding sequence shown in Figure 1 (SFQ ID
No. 1) or that of the deposited clone or may be a different
coding sequence which coding sequence, as a result of. the
redundancy or degeneracy of the genetic code, encodes the
same mature polypeptide as the DNA of Figure 1 (S8Q ID No. 1)
or the deposited cDNA.
The polynucleotide which encodes for the mature
polypeptide of Figure 1 (SBQ ID No. 2) or for the mature
polypeptide encoded by the deposited cDNA may include: only
the coding sequence for the mature polypeptide; the coding
sequence for the mature polypeptide and additional coding
sequence such as a leader ar secretory sequence or a
-5-
CA 02430223 2003-05-30
proprotein sequence; the coding sequence for the mature
polypeptide (and optionally additional coding sequence) and
non-coding sequence, such as introns or non-coding, sequence
5' and/or 3' of the coding sequence for the mature
polypeptide. - -
Thus, the term "polynucleotide encoding a polypeptide"
encompasses a polynucleotide which includes only coding
sequence for the polypeptide as well as a polynucleotide
which includes additional coding and/or non-coding sequence.
The present invention further relates to variants of the
hereinabove described polynucleotides which encode for
fragments, analogs and derivatives of the polypeptide having
the deduced amino acid sequence of Figure l (S8Q ID No. 2) or
the polypeptide encoded by the cDNA of the deposited clone.
The variant of the polynucleotide may be a naturally
occurring allelic variant of the polynucleotide or a non-
naturally occurring variant of the polynucleotide.
Thus, the present invention includes polynucieotides
encoding the same mature polypeptide as shown in -Figure 1
(S8Q ID No. 2) or the same mature polypeptide encoded by the
cDNA of the deposited clone as well as variants of such
polynucleotides which variants encode for a fragment,
derivative or analog of the polypept:ide of Figure 2 (SEQ ID
No. 2) or the polypeptide encoded by the cDNA of the
deposited clone. Such nucleotide variants include deleta.on
variants, substitution variants and addition or insertion
variants .
As hereinabove indicated, the polynucleotide may have a
coding sequence which is a naturally occurring allelic
variant of the coding sequence shown in Figure 1 (SEQ TD No.
1) or of the coding sequence of the deposited clone. As
known in the art, an allelic variant is an alternate forni of
a polynucleotide sequence which may have a substitution,
deletion or addition of one or more nucleotides, which does
-s-
CA 02430223 2003-05-30
not substantially alter the' funr_tion of the. encoded
polypeptide.
The present invention also includes polynucleotides,
wherein the coding sequence for the mature polypeptide may be
fused in the same reading frame to a polynucleotide sequence
which aids in expression and secretion of a polypeptide from
a host cell, for example, aleader sequence which functions
as a secretory sequence for controlling transport of a
polypeptide from the cell. The pol~rpeptide having a leader
sequence is a preprotein and may have the leader sequence
cleaved by the host cell to form the mature form of the
polypeptide. The polynu"~cleotides may also encode far a
proprotein which is the mature protein plus additional S'
amino acid residues. A mature protein haviag a prosequence
is a proprotein and is an inactive form of the protein. Once
the prosequence is cleaved an active mature protein remains.
Thus, for example, the polynucleotide of the present
invention may encode for a mature protein, or for a protein
having a pros~equence or for a protein having both a
prosequence and a presequenee (leader sequence).
The polynucleotides of the present invention may also
have the coding sequence fused in frame to a marker sequence
which allows for purification of the polypeptide of the
present invention. The marker sequence may be a hexes.-
histidine tag supplied by a pQB-9 vector to provide for
purification of the mature polypeptide fused to the marker in
the case of. a bacterial host, or, for example, the marker
sequence may be a hemagglutinin I,HA) tag when a mammalian
host, e.g. COS-7 cells, is used. The HA tag corresponds to
an epitope derived from the influenza hemagglutinin protein
(Wilson, I., et al., Cell, 37:767 (1984)).
The present invention further relates 'to
polynucleotides which hybridize to the hereinabove-described
sequences if there is at least 50% and preferably 70%
identity between the sequences. The present invention
CA 02430223 2003-05-30
particularly relates to polynucleotides which hybridize under
'. stringent . conditions to the hereinabove-described
polynucleotides. As herein used, the term "stringent
conditions" means hybridization w:i.ll occur only if .there is
at least 95 % and preferably at least 97 % identity'between
the sequences: The polynucleotides which hybridize to the
hereinabove described polynucleotides in a preferred
embodiment encode polypeptides which retain substantially the
same biological. function or activity as the mature
polypeptide encoded .by the cDNA of Figure 1 (SEQ ID No. 1) or
the deposited cDI~.
The deposits) referred to~herein will be maintained
under the terns of t:he Budapest Treaty on the International
Recognition of the Deposit of Micro-organisms for purposes of
Patent Procedure. These deposits are provided merely as
convenience to those of skill in the art and are not an
admission that a deposit is required under S. 27{3) of thePaten~Act.
DNA Plasmid 366885A was deposited on December 16, 1994 with the American Type
Culture Collection {ATCC), 1230T Parklawn Drive, Rockville, MD 20852, under
accession number ATCC 75977.
The sequence of the polynucleotides contained in the
deposited materials, as well as the amino acid sequence of .
the polypeptides~encoded thereby,
are controlling, in the event of any conflict
with any description of sequences herein. A license~may be
_ required to make, use or sell the deposited materials, and
no such license is hereby granted:.
The present invention further relates to a polypepti.de
which has the deduced amino acid sequence of Figure 1 (S$Q ID
No. 2) or which has the amino acid sequence encoded by the
deposited cDNA, as well as fragments, analogs and derivatives
of such polypeptide
The terms "fragment, " !'derivative" and '!analog" when
referring to the polyp.eptide of Figure 1 (SEQ ID No. 2) or
that encoded by the deposited cDNA, means a polypeptide which
retains essentially the same biological function or activity
as such polypeptide. Thus, an a~.~alog includes a proprotein
-a -
CA 02430223 2003-05-30
which can be activated by cleavage of the proproteiu portion
to produce an active mature polypeptide.
The polypeptide of the present invention may be a
recombinant polypeptide, a natural polypeptide or a synthetic
polypeptide, preferably a recombinant polypeptide.
The fragrneat, derivative or analog of the polypeptide
of Figure 1 (SBQ ID No. 2) or that encoded by the deposited
cDNA may be ti) one in which one or more of the amino acid
residues are substituted with a co~aserved or non-conserved
amino acid residue (preferably a conserved amino acid
residue) and such substituted amino acid residue may or may
not be one encoded by the genetic code, or (ii) one in which
one or more of the amino acid residues includes a substituent
groug, or (iii) one in which the mature polypeptide is fused
with another compound, such as a compound to increase the
half-life of the polypeptide (for example, polyethylene
glycol), or (iv) one in which the additional amino acids are
fused to the mature polypeptide, such as a leader or
secretory sequence or a sequence which is employed for
purification ~of the mature polypeptide or a proprotein
sequence. Such fragments, derivatives and analogs are deemed
to be within the scope of those skilled in the art from the
teachings herein.
The polypeptides and polynucleotides of the present
invention are preferably provided in an isolated form, and
preferably are purified to homogeneity.
The term "isolated" means that the material is removed
from its original environment (e. g., the natural environment
if it is naturally occurring). For example, a naturally-
occurring polynucleotide or polyppptide present in a living
animal is not isolated, but the same polynucleotide or
polypeptide, separated from some or all of the coexisting
materials in the natural system, is isolated. Such
polynucleotides could be part of a vector and/or such
polynucleotides or polypeptides could be part of a
_g_
CA 02430223 2003-05-30
composition, and still be isolated in that such vector or
composition is not part of its natural environment.
The present invention also relates to vectors which
include polynucleotides of the present invention, host cells
which are genetica3ly engineered With vectors of the
invention and the production of polypeptides of the invention
by recombinant techniques.
Host cells are -genetically engineered ~transduced or
transformed or transfected) with the vectors of this
invention which may be, for example, a cloning vector or an
expression vector. The vector may be, for example, in the
form of a plasmid, a viral particle, a phage, etc. The
engineered host cells can be cultured in conventional
nutrient media modified as appropriate for activating
promoters, selecting transformants or amplifying the KGF-2
genes. The culture conditions, such as temperature, pH and
the like, are those previously used with the host cell
selected for expression, and will be apparent to the
ordinarily skilled artisan.
The polynucleotides of the present invention may be
employed for producing polypep~ides by recombinant
.techniques. Thus, for example, the polynucleotide may be
included in any one of a variety of expression vectors for
expressing a polypeptide. Such vectors include chromosomal,
nonchromosomal and synthetic DNA sequences, e.g., derivatives
of SV40; bacterial plasmids; phage DNA; baculovirus; yeast.
plasmids; vectors derived from combinations of plasmids and
phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox
virus, and pseudorabies. However, any other vector may be
used as long as it is replicable and viable in the host.
The appropriate DNA sequence may be inserted into the
vector by a variety of procedures. In general, the DNA
sequence is inserted into an appropriate restriction
endonuclease sites) by procedures )sown in the art. Such
-10-
CA 02430223 2003-05-30
. procedures and others are deemed to be within the scope of
those skilled in the art.
The DNA sequence in the expression vector is operatively
linked to an appropriate expression control sequences)
(promoter) to direct mRNA synthesis. As representative
examples of such promoters, there may be mentioned: LTR or
SV40 promoter, the B. coli: ac or ~ pr , the phage lambda PL
promoter and other promoters known to control expression of
genes in prokaryotic or eukaryotic cells or their viruses.
The expression vector also contaias a ribosome binding site
for translation initiation and a transcription terminator.
The vector may also include appropriate sequences for
amplifying expression.
In addition, the expression vectors preferably contain
one or more selectable marker genes to provide a phenotypic
trait for selection of transfornted host cells such as
dihydrofolate reductase or neomycin resistance for eukaryotic
cell culture, or such as tetracycline or ampicillin
resistance in .~. coli.
The vector containing the appropriate DNA sequence as
hereinabove described, as well as an appropriate promoter or
control sequence, may be employed to transform an appropriate
host to pezmit the host to express the protein.
As representative examples of appropriate hosts, there
may be mentioned: bacterial cells, such as F. coli,
Strep_tonnvces, Salmonella typhimuri.um; fungal cells, such as
yeast; insect cells such as Drosophila S2 and Snodogtera Sf9;
animal cells such as CHO, COS or Bowes melanoma;
adenvviruses; plant cells, etc. The selection of an
appropriate host is deemed to be within the scope of those
skilled in the art from the teachings herein.
More particularly, the present invention also includes
recombinant constructs comprising one or more of the
sequences as broadly described above. The constructs
comprise a vector, such as a plasmid or viral vector, into
-11-
CA 02430223 2003-05-30
which--a sequence of the invention has been inserted, in a
forward or reverse orientation. In a preferred aspect of this
embodiment, the construct further comprises regulatory
sequences, including, for example, ~a promoter, operably
linked to the sequence. barge numbers of suitable vectors
and promoters are known to those of skill in the art, and are
comzaercially available. The following vectors are provided
by way of example; Bacterial: pQ$70, pQ$60, pQF-9 (Qiagen),
pBS, pDlO, phagescript, psiX174, pbluescript SR, pbsks,
pN88A, pNHl6a, pN~l8A, pN846A (Stratagene); ptrc99a, pKK223-
3, gRR233-3, pDR540, pRIT5 (Phanaacia) ; B'uka~ryotic: pWLNSO,
pSV2CAT, pOG44, pXTl, pSG (Stratagene) pSVK3, pBPV, pMSG, -
pSVIs (Pharmacia). However, any other plasmid or vector may
be used as long as they are replicable and viable in the
host.
Promoter regions can be selected from any desired gene
using CAT (chloramphenicol transferase) vectors or other
vectors with selectable markers. Two appropriate vectors are
pKR232-8 and pCM7. Particular named bacterial promoters
include lacI, lacZ, T3., T7, gpt, lambda PR, PL and trp.
Bukaryotic promoters include CMV immediate early, HSV
thymidine kinase, early and late SV40, LTRs from retrovirus,
and mouse metallothionein-I. Selection of the appropriatE
vector and promoter is well within the 3evel of ordinary
skill in the art.
In a further embodiment, the present invention relates
to host cells containing the above-described constructs. The
host cell can be a higher eukaryotic cell, such as a
mammalian cell, or a lower eukaryotic cell, such as a yeast
cell, or the host cell can be a prokaryotic cell, such as a
bacterial cell. Introduction of the construct into the host
cell can be effected by calcium phosphate transfection, DEAR-
Dextran mediated transfection, or electroporation (Davis, L.,
Dibner, M., Battey, I., Basic Methods in Molecular Biology,
(1986) ) .
-12 -
CA 02430223 2003-05-30
the constructs in host cells can be used in a
conventional manner to produce the gene product encoded by
the recombinant sequence. Alternatively, the polypeptides of
the invention can be synthetically produced by conventional
peptide synthesizers.
Mature proteins can be expressed in mammalian cells,
yeast, bacteria, or other cells under the control of
appropriate promoters. Celi-free translation systems can
also_be employed to produce such proteins using RHAs derived
from the DNA constructs of the present invention. '
Appropriate cloning and expression vectors for use with
prokaryotic and eukaryotic hosts are described by Sambrooh,
et al., Molecular Cloning: A Laboratory Manual, Second
8dition, Cold Spring Harbor, N.Y., (1989)..
Transcription of the DNA encoding the polypeptides of
the present invention by higher eukaryotes is increased by
inserting an enhancer- sequence into the vector. Enhancers
are cis-acting elements of DNA, usually about from 10 to 3 00
by that act on . a promoter to. i.n.crease its transcription.
Examples including the SV40 enhancer on the late side of the
replication origin by 100 to 270, a cytomegalovirus early
promoter enhancer, the polyoma enhancer on the late side of
the replication origin, and adenovinis enhancers.
Generally, recombinant expression vectors will include
origins of replication and selectable markers permitting
transformation of the host cell, e.g. , the ampicillin
resistance gene of E. coli and S. cerevisiae TRPl gene, and
a promoter derived from a highly-expressed gene~to direct
transcription of a downstream structural sequence. Such
gromoters can be derived from operons encoding glycolytic
enzymes such as 3-phosphoglycerate kinase (PGK), a-factor,
acid phosphatase, or heat shack proteins, among others. Th.e
heterologous structural sequence ~s assembled in appropriate
phase ~rith translation initiation and termination sequences,
-Z3-
CA 02430223 2003-05-30
and preferably, a leader sequence eapable of directing
secretion of translated protein inta the periplasmic space or
extracellular medium. Optionally, the heterologous sequence
can encode a fusion protein including an N-texminal
identi.ficativn peptide imparting desired characteristics,
e.g., stabilization or simplified purification of expressed
recombinant product.
Useful expression vectors for bacterial use are
constructed by inserting a structural DNA sequence encoding
a desired protein together with_ suitable translation
initiation and termination signals in operable reading phase
with a functional promoter. The vector will comprise one or
more phenotypic selectable markers and an origin of
replication to ensure maintenance of the vector and to, if
_ desirable, provide amplification within the host. Suitable
prokaryotic hosts for transformation include R. coli,
Bacillus subtilis, Salmonella typhiimirium and various species
within the genera Pseudomonas, Streptomyces, and
Staphylococcus, although others may also be employed as a
matter of choice .
As a representative but nonlimiting example, useful
expression vectors for bacterial use can comprise a
selectable marker and bacterial origin of replication derived
from commercially available plasmids comprising genetic
elements of the well known cloning vector pBR322 (ATCC
37017). Such commercial vectors include, for example,
_ pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GSM1
(Promega Biotec, Madison, WI, USA). These pBR322 "backbone"
sections are combined with an appropriate promoter and the
structural sequence to be expressed.
Following transformation of a suitable host strain and
growth of the host strain to an appropriate cell density, the
selected promoter is induced by appropriate means (e. g.,
temperature shift or chemical induction) and cells are
cultured for an additional period.
-14-
CA 02430223 2003-05-30
Cells are typically harvested by centrifugation,
disrupted by physical or chemical iaeans, and the resulting
crude extract retained for further purification.
Microbial cells employed in expression of proteins can
be disrupted by any convenient method, including freeze-thaw
cycling, sonication, mechanical disruption, or use of cell
lysiag agents, such methods are well know to those skilled in
the art.
Various mammalian cell culture systems can also be
employed to express recombinant protein. ales of
mammalian expression systems include the COS-7 lines of
monkey kidney fibroblasts, described by Gluzman, Cell, 23:175
(1981), and other cell lines capable of expressing a
compatible vector, far example, the 0127, 3T3, CHO, HeLa and
BHK cell lines. Mammalian expression vectors will comprise
an origin of replication, a suitable promoter and enhancer,
and also any necessary ribos~ne - binding sites,
polyadenylation site, splice donor and acceptor sites,
transcriptional termination sequences, and 5' flanking
nontranscribed sequences. DNA sequences derived from the,
SV40 splice, and polyadenylation sites may be used to grovide
the required nontranscribed genetic elements.
The KGF-2 polypeptide can be recovered and purified from
recombinant cell cultures by methods including am~uonium
sulfate or ethanol precipitation, acid extraction, anion or
cation exchange chromatography, phosphocellulose
chromatography, hydrophobic interaction chromatography,
affinity chromatography, hydroxylapatite chromatography and
lectin chromatography. Protein refolding steps can be used,
as necessary, in completing configuration of the mature
protein. Finally, high performance liquid chromatography
(HPLC) can be employed for final purification steps.
The polypeptides of the present invention may be a
naturally purified product, or a product of chemical
synthetic procedures, or produced by recombinant techniques
-15-
CA 02430223 2003-05-30
from'~a' prokaryotic or eukaryotic host (for example, by
bacterial, yeast, higher plant, insect and mammalian cells in
culture . Depending upon the host employed in a recombinant
production procedure, the polypeptides of the present
invention may be ~glycosylated or may be non-glycosylated.
Polypeptides of the imrention may also include an initial
methionine amino acid residue.
The polypegtide of the present invention may be employed
to stimulate new blood vessel growth or angiogenesis.
Particularly, the polypeptide of the present invention may
stimulate keratinocyte cell growth and proliferation.
Accordingly, the polypeptide of the present invention may be
used to stimulate wound healing, and also to stimulate
Reratinocytes which is related to the prevention of hair
loss.
The polypeptide of the present invention may also be
employed to heal dermal wounds by stimu:Lating epithelial cell
proliferation.
The polypegtide of the present invention may also be
employed to stimulate differentiation of cells, for example,
muscle cells and nervous tissue, prostate cells and lung
cells.
The signal sequence of RGF-2 encoding amino acids 1
through 36 may be employed to identify secreted proteins in
general by hybridization and/or computational search
algorithms.
The nucleotide sequence of RGF-2, could be employed to
isolate S' sequences by hybridisation. Plasmids comprising
the RGF-2 gene under the control of its native
promoter/enhancer sequences could then be used in in vitro
studies aimed at the identification of endogenous cellular
and viral transactivators of RGF-2 gene expression.
The RGF-2 protein may also be employed as a positive
control in experiments designed to identify peptido-mimetics
acting upon the RGF-2 receptor.
-16-
CA 02430223 2003-05-30
In accordance with yet a further aspect of the present
invention, there is provided a process .for utilizing such
polypeptides, or polynucleotides encoding such polypeptides,
for in vitro purposes related to scientific research,
synthesis of DNA, manufacture of )JNA vectors and for the
purpose~of providing diagnostics and therapeutics for the
treatment of human disease. '
Fragments of the full length R~GF-2 gene may be used as
a hybridization probe for a cDNA library to isolate the full
length KGF-2 genes and to isolate other genes which have a
high sequence similarity to these genes or similar biological
activity. Probes of this type generally have at least 20
bases. Preferably, however, the probes have at least 30
bases and generally do not exceed 50 bases, although they may
have a greater number of bases. The probe may also be used
to identify a cDNA clone corresponding, to a full length
transcript and a genomic clone or clones that contain the
complete RGF-2 genes including regulatory and promotor
regions, exons, and introns. An example of a screen
comprises isolating the .coding region of the RGF--2 gene by
using the known DNA sequence to synthesize an oligonucleotide
probe. Labeled oligonucleotides having a sequence
complementary to that of the gene of the present invention
are used to screen a library of human cDNA, genomic DNA or
mRNA to determine which members of the library the probe
hybridizes to.
This invention provides a method for identification of
the receptors for the RGF-2 polypeptide. The gene encoding
the receptor can be identified by numerous methods known to
those of skill in the art, for e~cample, ligand panning and
FAGS sorting (Coligan, et al., Current Protocols in Immun.,
1(2), Chapter 5, !1991)). Preferably, expression cloning is
employed wherein polyadenylated RNA is prepared from a cell
responsive to the polypeptides, and a cDNA library created
from this RNA is divided into pools and used to transfect COS
-17-
CA 02430223 2003-05-30
cells or other :cells that are not responsive to the
polypeptides. Transfected cells which are grown on glass
slides are exposed to the labeled polypeptides. The
polypeptides can be labeled by a variety of means including
iodination or inclusion of a recognition site for a. site-
specific protein kinase. Following fixation and incubation,
the slides are subjected to autoradiographic analysis.
Positive pools are identified and sub-pools are prepared and
re-transfected using an iterative sub-pooling and re-
screening process, eventually yielding a single clones that
encodes the putative receptor.
As an alternative approach for receptor identification,
the labeled polypeptides can be photoaffinity linked with
cell membrane or extract preparations that express the
receptor~molecule. Cross-linked material is resolved by PAGF
analysis and exposed to x-ray film. The labeled complex
containing the receptors of the polypeptides can be excised,
resolved into peptide fragments, and subjected to protein
microsequencing. The amino acid sequence obtained from
microsequencing would be used to design a set of degenerate
oligonucleotide probes to screen a cDI.~TA library to identify
the genes encoding the putative receptors.
This invention provides a method of screening compounds
to identify those which agonize the action of KGF-2 or block
the function of KGF-2. An example of such an assay comprises
combining'a mammalian Keratinocyte cell, the compound to be
screened and '[H] thymidine under cell culture conditions
where the keratinocyte cell would normally proliferate. A
control assay may be performed in the absence of the compound
to be screened and compared to the .amount of keratinocyte
proliferation in the presence of the compound to determine if
the compound stimulates proliferation of Keratinocytes.
To screen for antagonists, the same assay may be
prepared in the presence of KGF-2 and the ability of the
compound to prevent Keratinocyte proliferation is measured
_18_
CA 02430223 2003-05-30
and a determination of antagonist: ability is made. The
amount of Keratinocyte cell proliferation is measured by
liquid scintillation chromatography which measures the
incorporation of 3i81 thymidine.
In another method, a mammalian cell or membrane
preparation expressing the KGF-2 receptor would be incubated
with labeled KGF-2 in the presence of the compound. The
ability of the compound to enhance or block this interaction
could then be measured. Alternatively, the response of a
known second messenger system following interaction of KGF-2 -
and receptor would be measured and compared in the presence
or absence of the compound. Such second messenger systems .
include but are not limited to, cPW guanyiate cycla.se, ion
channels or phosphoinositide hydrolysis.
$xamples of potential RGF-2 antagonists include an
antibody, or in some cases, an oligonucleotide, which binds
to the polypeptide. Alternative3y, a potential KGF-2
antagonist may be a mutant fozm of KGF-Z which binds to KGF-2
receptors, however, no second messenger response is elicited
and therefore the action of KGF-2 is effectively blocked.
Another potential KGF-2 antagonist is an antisense
construct prepared using antisense technology. Antisense __
technology can be used to control gene expression throu3h
triple-helix formation or antisense DNA or RNA, both of which
methods are based on binding of a polynucleotide to DNA or
RNA. For example, the 5' coding portion of the
polynucleotide sequence, which encodes for the mature
polypeptides of the present invention, is used to design an
antisense RNA oligonucleotide of from about 10 to 40 base
pairs in length. A DNA aligonucleotide is designed to be
complementary to a region of the gene involved in
' transcription (triple helix -see Lee et al., Nucl. Acids
Res., 6:3073 (1979); Cooney et al, Science, 241:456 (1988);
and Dervan et a3., Science, 251: 1360 (1991)), thereby
preventing transcription and the production of KGF-2. The
_Zg_
CA 02430223 2003-05-30
antisense RNA oligonucleotide hybridizes to the mRNA in vivo
and blocks translation of the mRNA molecule into~KGF-2
polypeptide (Antisense - Okano, J. Neurochem., 56:560 11991);
Oligodeoxynucleotides as Antisense Inhibitors of Gene
$xpression, CRC Press, Boca Raton, FL (1988)).. The
oligonucleotides described above can also be delivered to
cells such that the antisense RNA or DNA may be expressed in
vivo to inhibit production of KGF-2.
Potential KGF-2 antagonists include small molecules
which bind to and occupy the bindiug site of the RGF-2
receptor thereby making the receptor inaccessible to KGF-2
such that normal biological activity is prevented. 8xamples
of small molecules include but are not limited to small
peptides or peptide-like molecules.
The KGF-2 antagonists may be employed to prevent the
induction of new blood vessel growth or angiogenesis in
tumors. Angiogenesis stimulated by KGF-2 also contributes to
several pathologies which may also be treated by the
antagonists of the present invention, including diabetic
retinopathy, and inhibition of the growth of pathological
' tissues, such as in rheumatoid arthritis.
KGF-2 antagonists may also be employed to treat
glomerulonephritis, which is characterized by the marked
proliferation of giomerular epithelial cells which form a
cellular mass filling Bowman~s space.
The antagonists may also be employed to inhibit the
over-production of scar tissue seen in keloid formation after
surgery, fibrosis after myocardial infarction or fibrotic
lesions associated with pulmonary fibrosis and restenosis.
KGF-2 antagonists may also be employed to treat other
proliferative diseases which are stimulated by KGF-2',
including cancer and Kaposi's sarcoma.
KGF-2 antagonists may also be employed to treat
keratrtis which is a chronic infiltration of the deep layers
-20-
CA 02430223 2003-05-30
of the cornea with uveal inflamoaation characterised by
epithelial cell prolifezation.
The antagonists may be employed in a composition With a
pharmaceutically acceptable carrier, e.g., as hereinafter
described.
The polypeptides, agonists rind antagonists of the
present invention may be employed in combination with a
suitab~:e pharmaceutical carrier to comprise a pharmaceutical
composition. Such c~npositions coaaprise a therapeutically
effective amount of the polypeptide, agonist or antagonist
. and a pharmaceutically acceptable carrier or excipient. Such
a carrier includes but ~is not limited to saline, buffered
saline, dextrose, water, glycerol, ethanol, and combinations
thereof. The formulation should suit the mode of
c~ administration. .
The invention also provides a pharmaceutical pack or kit
comprising one or more containers filled with one or more of
the ingredients of the pharmaceutical compositions of. the
invention. Associated with such containers) can be a notice
'in the form prescribed by a govezumental agency regulating
the manufacture, use or sale of pharmaceuticals or biological
products, which notice reflects approval by the agency of .
manufacture, use or sale for human administration, In
addition, the polygeptides, agonists and antagonists of the
present invention may be employed in conjunction with other
therapeutic compounds.
The pharmaceutical compositions may be administered in
a convenient manner such as by the oral; topical,
intravenous, intraperitoneal, intramuscular, subcutaneous,
intranasal or intradermal routes. The pharmaceutical
compositions are administered in an amount which is effective
for treating and/or prophylaxis of the specific indication.
In general, they are administered in an amount of at least
about 10 ~g/kg body weight and in mast cases they will be
administered in an. amount not in excess of about 8 mg/Kg body
-21-
CA 02430223 2003-05-30
weight per day. In most cases, the dosage is from about -10.
.t
~g/kg to about 1 mg/kg body weight daily, taking into account
the routes of administration, symptoms, etc. In the specifis
case of topical administration dosages are preferably
administered from about 0.1 ~Cg to 9 mg per cni .
The KGF-2 polypeptides, agonists and antagonists which
are polypeptides may also be employed in accordance with the
present iuveation by expression of such polypeptides in vivo,
which is oftea referred to as gene therapy."
Thus, for- example, cells from a patient may be
engineered with a polynucleotide tDWA or RNA) encoding a
polypeptide ex vivo; with the engineered cells then being
provided to a patient to be treated with the polypeptide.
Such methods are well-kaown in the art. For example, cells
may be engineered by procedures known in the art by use of a
retroviral particle containing RNA encoding a polypeptide of
the present invention.
Similarly, cells may be engineered an vivo for
expression of a polypeptide in vivo by, for example,
procedures known in the art. As known in the art, a producer
cell for producing a retroviral particle containing RNA
.encoding the polypeptide of the present invention may be __
administered to a patient for engineering cells .in vivo and
expression of the polypeptide in ~ivo. These and other
methods for administering a polypeptide of the present
invention by such method should be apparent. to those skilled
in the art from the teachings of the present invention. For
example, the expression vehicle for engineering cells may be
other than a retrovirus, for example,, an adenovirus which may
be used to engineer cells in vivo after combination with a
suitable delivery vehicle. Examples of other delivery
vehicles include an HSV-based vector system, adeno-associated
virus vectors, and inert vehicles, for example, dextran
coated ferrite particles.
-22-
CA 02430223 2003-05-30
This invention is.also related to the use of the KGF-2
gene as part of a diagnostic assay for detecting diseases or
susceptibility to diseases related to the presence of
mutations in the KGF-2 nucleic acid sequences:
Individuals carrying mutations in the KGF-2 gene~may be
detected at the DNA level by a variety of techniques.
Nucleic acids for diagnosis may be obtained from'a patients
cel7Ls, such as from.biood, urine, saliva, tissue biopsy and
autopsy material. The genomic DNA may be used directly for
detection or tray be amplified enzymatically by using PCR
(Saiki et al., Nature,.324:163-166 (X986)? prior to analysis.
RNA or cDNA may also be used for the same purpose. As an
example,, PCR primers complementary to the nucleic acid
encoding KGF-2 can be used to identify and analyze KGF-2
mutations. For example, deletions and insertions can be
detected by a change in size of the amplified product in
comparison to the normal genotype. Point mutations can be
identified by hybridizing amplified DNA to radiolabeled RGF-2
RNA or alternatively, radiolabeled KGF-2 antisense DNA
sequences. Perfectly matched sequences can be distinguished
from mismatched duplexes by RNase A digestion or by
differences in melting temperatures.
Genetic testing based on DNA sequence differences may be
achieved by detection of alteration in el:ectrophoretic
mobility of DNA fragments in gels with or without denaturing
agents. Small sequence deletions and insertions can be
visualized by high resolution gel electrophoresis. DNA
fragments of different sequences may be distinguished on
denaturing formamide gradient gels in which the mobilities of
different DNA fragments are retarded in the gel at different
positions according to their specific melting or partial
melting temperatures (see, e.g., Myers et al., Science,
230:1242 (1985) ) .
Sequence changes at specific locations may also be
revealed by nuclease protection assays, such as RNase and S1
-23 -
.__.._..__.~.~n.-~~"~~N.~~"~-_..__. _.,.~.,-
CA 02430223 2003-05-30
protection 4r the chemical'cleavage method (e.g., Cotton et
al., PNAS, iTSA, $5:439'7-4401 (1985) ) . .
Thus, the detection of a specific DNA sequence may be
achieved by methods such as hybridization, RNase protection,
chemical cleavage, direct DNA sequencing or the wse of
restriction enzymes, (e. g., Restriction Fragment Length
Polymoxphisms (RFLPy) and Southern blotting of genomic DNA.
In~ addition to snore conventional gel-electrophoresis and
DNA sequencing, mutations can also be detected by in situ
analysis.
The ~ gresent invention also relates to a diagnostic assay
for detecting altered levels of RGF-2 protein in various
tissues since an over-expression of the proteins compared to
no~aal control tissue samples may detect the presence of a
disease or susceptibility to a disease, for example, a tumor.
Assays used to detect levels of RGF-~2 protein in a sample
derived from a host are well-known to those of skill in the
art and include ~adioimmunoassays, competitive-binding
assays, Western Blot analysis, SLISA assays and "sandwich"
assay. An BLISA assay (Coligan, et al.., Current Protocols in
Immunology, 1(2), Chapter 6, (1991)) initially comprises
preparing an antibody specific to the RGF-2 antigen,
preferably a monoclonal antibody. In addition a reporter
antibody is prepared against the monoclonal antibody. To the
reporter antibody is attached a detectable reagent such as
radioactivity, fluorescence or, in this example, a
horseradish peroxidase enzyme. A sample is removed from a
host and incubated on a solid support, e.g. a polystyrene
dish, that binds the proteins in the sample. Any free
protein binding sites on the dish are then covered by
incubating with a non-specific grotein like bovine serum
albumen. Next, the monoclonal antibody is incubated in the
dish during which time the monoclonal antibodies attach to
any RGF-2 proteins attached to the polystyrene dish. All
unbound monoclonal antibody is washed out with buffer. The
-24-
CA 02430223 2003-05-30
reporter antibody linked to horseradish peroxidase is now
placed in the dish resulting in binding of the reporter
antibody to any monoclonal antibody bound to RGF-2.
Unattached reporter antibody is then washed out. Peroxidase
substrates are then added to the dish and the amount of color
developed in a given time period is a measurement of the
amount of RGF-2 protein present in a given volume of patient
sample when compared against a standard curve.
A competition assay may be employed wherein antibodies
specific to KGF-2 are attached to a solid support and labeled
RGF-2 and a sample derived from the host are passed over the
solid support and the amount of label detected, for example
by liquid scintillation chromatography, caa be correlated to
a quantity of RGF-2 in the sample.
A "sandwich" assay is similar to an BhISA assay. In a
"sandwich" assay RGF-2 is passed over a solid support and
binds to antibody attached to a solid support. A second
antibody is then bound to the RGF-2. A third antibody which
is labeled and specific to the second antibody is then passed
over the solid support and binds t:o the second antibody and
an amount can then be quantified.
The sequences of the present invention are also valuable
for chromosome identification. The sequence is s~gecifical~.y
targeted to and can hybridize with a particular location on
an individual human chromosome. Moreover, there is a current
need for identifying particular sites on the chromosome.. Few
chromosome marking reagents based on actual sequence data
(repeat polymorphisms) are presently available for marking
chromosomal location. The mapping of DNAs to chromosomes
according to the present invention is an important first step
in correlating those sequences with genes associated with
disease.
Briefly, sequences can be mapped to chromosomes by
preparing PCR primers (preferably 15-25 bp? from the cDNA.
Computer analysis of the 3 ' untranslated region is used to
-25-
CA 02430223 2003-05-30
rapidly'select primers that do not span more than one exon in
the genomic DNA, thus complicating the amplification process.
These primers are then used for PCR screening of somatic cell
hybrids containing individual human chromosomes. Only those
hybrids containing the humaa gene corresponding to the primer
will yield an amplified fragment.
PCR mapping of somatic cell hybrids is a rapid procedure
for assigning a particular DNA toga particular chromosome.
Using t-he present invention with the same oligonucleotide
primers, sublocalization can be achieved with panels of
fragments from specific chromosomes or' pools of large genomic
clones in an analogous manner. Other uaapping strategies that
can similarly be used to map to its chromosome include in
si to hybridization, prescreening with labeled flaw-sorted
chromosomes and preselection by hybridization to construct
chromosome specific-cDNA libraries.
Fluorescence in situ hybridization (FISH) of a cDHA
clone to a metaphase chromosomal spread can be used to
provide a precise chromosomal location in one steg. This
technique can be used with cDNA as short as 500 or 600 bases;
however, clones larger than 2, 000 by have a higher likelihood
of binding to a unique chromosomal location with sufficient
signal intensity for simple detection. FISH requires use of
the clones from Which the EST was derived, and the longer the
better. For example, 2,000 by is gaod, 4,000 is better, and
more than 4, 000 is probably not necessary to get good results
a reasonable percentage of the time. For a review of this
technique, see Verina et al., Human Chromosomes: a Manual of
Basic Techniquese Pergamon Press, New York (I988).
Once a sequence has been mapped to a precise chromosomal
location, the physical position of the sequence on the
chromosome can be correlated with genetic map data. Such
data are found, for example, in V. McKusick, Mendelian
Inheritance in Man (available on line through Johns Hopkins
University Welch Medical Library). The relationship between
-26-
CA 02430223 2003-05-30
genes and diseases that have been mapped to the same
chromosomal region are then identified through linkage
analysis (coinheritance of physically adjacent genes).
Next, it is necessary to determine the differences in
the cDNA or genomic sequence between affected and unaffected
individuals . If a m~utatian is obsexved in some or all of the
offected individuals but not in any noxmal individuals, then
the mutation is likely to be the causative agent of the
disease.
With current resolution of physical mapping and genetic
mapping techniques, a eDNA precisely localized to a
chromosomal region associated with the disease.could be one
of between 50 and 500 potential causative genes. (This
assumes 1 megabase mapping resolution and one gene per 20
kb) .
The polypeptides, their fragments or other derivatives,
or analogs thereof, or cells expressing them can be used as
an immunogen to produce antibodZ.es thereto. These antibodies
can be, for example, polyclonal or monoclonal antibodies.
The present invention also includes chimeric, single chain,
and humanized antibodies, as well as Fab fragcaents, or the
product of an Fab expression library. Various procedures
known in the art may be used for the production of such
antibodies and fragments.
Antibodies generated against the polypeptides
corresponding to a sequence of the present invention can be
obtained by direct injection of the polypeptides into an
animal or by administering the polypeptides to an animal,
preferably a nonhuman. The antibody so obtained will then
bind the polypeptides itself. In this manner, even a
sequence encoding only a fragment of the polypeptides can be
used to generate antibodies binding the whole native
polypeptides. Such antiboda.es can then be used to isolate
the polypeptide from tissue expressing that polypeptide.
-27-
CA 02430223 2003-05-30
For preparation of monoclonal antibodies, any technique
which provides antibodies produced by continuous cell line
cultures can be used. Examples include the hybridoma
technique (Kohler and Milstein, 1975, Nature, 256:495-497),
the trioma technique, the human 8-cell hybridoma technique
(Kozbor et al. , 1983, It~aaunology Today 4: 72) , aad the 8BV-
hybridoma technique to produce human monoclonal antibodies
(Cole, et al., 1985, in Monoclonal .Antibodies and Cancer
Therapy;, A3an R. Liss, Inc., pp. 77-96).
Techniques described for the production of single chain
antibodies (U. S. Patent 4,946,778) can be adapted to produce
single chain antibodies to immunogenic polypeptide products
of this invention: .Also, transgenic mice may be used to
express humanized antibodies to iu~nunogenic polypeptide
products of this invention.
The present invention will be further described with
reference to the following examples; however, it is to be
understood that the present invention is not limited to such
examples. All parts or amounts, unless otherwise specified,
are by weight.
In order to facilitate understanding of the following
.examples certain frequently occurring methods and/or terms
will be described.
"Plasmids" are designated by a lower case p preceded
and/or followed by capital letters and/or numbers. The
starting plasmids herein are either commercially available,
publicly available on an unrestricted basis, or can be
constructed from available plasmids in accord with published
procedures. Tn addition, equivalent glasmids to those
described are known in the art and will be apparent to the
ordinarily skilled artisan.
"Digestion" of DNA refers to catalytic cleavage of the
DNA with a restriction enzyme that acts only at certain
sequences in the DNA. The various restriction enzymes used
herein are commercially availab7.e and their reaction
-28-
CA 02430223 2003-05-30
conditions, cofactors and other requirements were used as
' would be known to the ordinarily skilled artisan. For
analytical purposes, typically 1 ~Cg of plasmid or DNA
fragment is used with about 2 units of enzyme in about 20 ~C1
of buffer solution. For the purpose of isolating DNA
fragments for plasmid construction, typically 5 to 50 ~.g of
DNA are digested with 20 to 250 units of eazyme in a larger
volume. Appropriate buffers and substrate amounts for
particular restriction enzymes are specified by the
manufacturer. Incubation times of about 1 hour at 37' C are
ordinarily used, but may vary in accordaace with the
supplier's instructions. After digestion the reaction is
electrophoresed directly on a polyacrylami.de gel to isolate
the desired fragment.
Size separation of the cleav~:d fragments is performed
using 8 percent polyacrylamide gel described by Goeddel, D.
et al., Nucleic Acids Res., 8:4057 (1980). -
"Oligonucleotides" refers to either a single stranded
polydeoxynucleotide or two complementary polydeoxynucleotide
strands which may be chemically synthesized. Such synthetic
oligonucleotides have no 5' phosphate and thus will not
ligate to another oligonucleotide without adding a phosphate
with an ATP in the presence of a kinase. A synthetic
oligonucleotide will ligate to a fragment that has not been
dephosphorylated.
"Ligation" refers to the process of forming
phosphodiester bonds between two double stranded nucleic acid
fragments (Maniatis, T., et a1_, Id., p. I46). Unless
otherwise provided, ligation may be accomplished using known
buffers and conditions With 30 units of T4 DNA ligase
("ligase") per 0.5 ~.g of approximately equimolar amounts of
the DNA fragments to be ligated.
A cel3 has been ~'transfornied" by exogenous DNA when scich
exogenous DNA has been introduced inside the cell membrane.
Exogenous DISA may or may not be integrated (covalently
-29-
CA 02430223 2003-05-30
linked) inter-chromosomal DNA making the genome of the cell.
Prokaryote and yeast, fvr example, the exogenous DNA may be
maintained on an episomal element, such a plasmid. With
respect to eukaryotic cells, a stably transfoztned or
transfected cell is one in which the exogenous DNA has-become
integrated into the chromosome so that it is inherited by
daughter cells through chr~aosome replication. This ability
is demonstrated by the ability of the eukaryotic cell to
establish cell lines or clones comprised of a population of
daughter cell containing the exogenous DNA. An ale of
- transformation is exhibited in Graham, F. and Van der Eb, A.,
Virology, 52:456-457 (I973).
"Transduction" or "transduced" refers to a process by
which cells take up foreign DNA and integrate that foreign
DNA into their chromosome. Transduction can be accomplished,
for example, by transfection, which refers to various
techniques by which cells take up DNA, or infection, by which
viruses are used to transfer DNA into cells.
- 8xample Z
Bacterial $xpression and Purification of RGF-2
The DNA sequence encoding RGF-2, ATCC # 75977, is
initially amplified using PCR ol.igonucleotide primers
corresponding to the 5' and 3' end sequences of the processed
KGF-2 cDNA (including the signal peptide sequence). The 5'
oligonucleotide primer has the sequence 5'
CCCCACATGTGGAAATGGATACTGACACATTGTGCC 3' (SFQ ID. No. 3)
contains an Afl III restriction enzyme site including and
followed by 30 nucleotides of KGF-2 coding sequence starting
from the presumed initiation codon..' The 3' sequence 5'
CCCAAGCTTCCACA.AAC,GTTGCCTTCCTCTATGAG 3 ' ( SEQ ID No . 4 )
contains complementary sequences to Hind III site andwis
followed by 26 nucleotides of KGF-2. The restriction enzyme
sites are compatible with the restriction enzyme sites on the
bacterial expression vector pQE-60 (Qiagen, Inc. Chatswor~h,
-30-
CA 02430223 2003-05-30
CA) . gQ$-60 encodes antibiotic resistance (A~p'~ , a bacterial
origin of replication ~(ori), an IPTG-regulatable promoter
operator (P/o) , a ribosome binding site (RBS) , a 6-Fiis tag
and restriction enzyme sites. pQS-60 is then digested with
Ncol and HindIII. The amplified sequences are ligated into
p~8-60 and are inserted in frame. The ligation mixture is
then used to transform ~. coli strain M15/rep 4 (Qiagen,
Inc.) by the procedure' described in Sambrook, J: et al.,
Molecular Cloning: A haboratory Manual, Cbld~ Sgring
habOratory Press, (1989). MIS/rep4 contains multiple copies
of the plastaid pREP4, which expresses the lacI repressor and
also confers kanamycin resistance (Kanr) . Transfoximants are
identified by their ability to grow on h8 plates and
ampicillin/kanamycin resistant colonies are selected.
Plasmid D1~ is isolated and confirmed by restriction
analysis. Clones containing the desired constructs are grown
overnight (0/N) in liquid culture in LB media supplemented
with both Amp (loo ug/ml) and Kan (25 ug/m1). The O/N
culture is used to inoculate a large culture at a ratio of
1:100 to 3:250. The cells are grown to an optical density
600 (0.D.6°°) of between 0.4 and 0.6. IPTG ("Isopropyl-B-D-
thiogalacto. pyranosiden) is then added to a final
concentration of Z mM. IPTG induces by inactivating the lacl
repressor, clearing the P/0 leading to increased gene
expression. Cells are grown an extra 3 to 4 hours. Cells
ate then harvested by centrifugation. The cell pellet is
solubilized in the chaotropi.c agent 6 Molar Guanidine HCl.
After clarification, solubilized KGF-2 is purified from this
solution by chromatography on a Heparin affinity column under
conditions that allow for tight binding of the proteins
(Hochuli, 8. et al., J. Chromatography 411:177-184 (1984)).
KGF-2 ( 75 % pure) is eluted from the column by high salt
buffer.
-31-
CA 02430223 2003-05-30
Example 2
Bacterial ression aiid Purification of a truncated version
of RGF-2
The DNA sequence encoding KGF-2, ATCC # 75977, is
initially amplified using PCR oligonucleotide primers
corresponding to the 5' and 3' sequences of the truncated
version of the RGF-2 polypeptide. The truncated version
comprises the polypeptide minus the S6 amino acid signal
sequence, with a methionine and alanine residue being added
just before the cysteine residue which comprises amino acid
3? of the full-length protein. The 5' oligonucleotide primer
has the sequence 5' CATGCCATGGCGTGCC~A.GCCCTTGGTCAGGACATG 3'
(SEQ ID No. 5) contains an Ncol restriction enzyme site
including and followed by 24 nucleotides of RGF-2 coding
sequence. The 3' sequence S' CCCAAGCTTCCACAAACGTTGCCTTCCTC
TATGAG 3' (SEQ ID No. 6) contains complementary seguences to
Hind III site and is followed by 26 nucleotides of the KGF-2
gene. The restriction enzyme sites axe compatible with the
restriction enzyme sites on the bacterial expression vector
pQE-60 (Qiagen, Inc. Chatsworth, CA). ,pQE-60 encodes
antibiotic resistance (Amp'), a bacterial origin of
replication (ori), an IPTG-regulatable promoter operator
(P/0) , a ribosome binding site (RFtS) , a 6-Hi.s tag and
restriction enzyme sites. pQE-60 is then digested with Ncol
and HindIII. The amplified sequences are ligated into pQE-60
and are inserted in frame. The ligation mixture is then used
to transform 8. coli strain Mi5/rep 4 (Qiagen, Inc.) by the
procedure described in Sambrook, J. et al., Molecular
Cloning: A Laboratory Manual, Cold Spring Laboratory Press,
(1989). M15/rep4 contains multiple copies of the plasmid
pREP4, which expresses the lacI repressor and also confers
kanamycin resistance (Kan') . Transformants are identified,- by
their ability to grow on LB plates and ampicillin/kanamycin
resistant colonies are selected. Plasmid DNA is isolated and
confirmed by restriction analysis. Clones containing the
-32-
CA 02430223 2003-05-30
desired constructs are grown overnight (0/N) -in liquid
culture in LB media supplemented~with both Amp (1o0 ug/ml)
and Ran (25 ug/ml). The O/N culture is used to inoculate a
large culture at a ratio of 1:140 to 1:250. The cells are
grown to an optical density 600 (0.D.6°") of between 0.4 and
0.6, IPTG ("Isopropyl-B-D-thiogalacto pyranoside") is then
added to a final concentration of 1 mM. IPTG induces by
inactivating the lacI repressor, clearing the P/O leading to
increased gene expression. Cells are grown an extra~3 to 4
hours. Cells are then harvested by centrifugation. The cell
pellet is solubilized in the chaotropic agent 6 Molar
Guanidine HCl. After clarification, solubilized KGF-2 is
purified from this solution by chromatography on a Heparin
affinity column under conditions that allow for tight binding
the proteins (Hochuli, E. et al.; J. Chromatography 411:177-
184 (1984)). RGF-2 protein is eluted from. the column by high
salt buffer.
Example 3
Clonin and cession of RGF-2 usin the baculovirus
ex»ression system
The DNA sequence encoding the full length KGF-2 protein,
ATCC # 75977, is amplified using PCR oligonucleotide primers
corresponding to the 5' and 3' sequences of the gene:
The 5' primer has the sequence 5'
GCGGGATCCGCCATCAT'GTGGAAATGGATACTCAC 3' (S$Q ID No. 7) and
contains a BamHI restriction enzyme site (in bold) followed
by 6 nucleotides resembling an efficient signal for the
initiation of translation in eukaryotic cells (Roaak, M., J.
Mol. Biol . , 196 : 947-950 (1.987? . and just behind the first 17
nucleotides of the KGF-2 gene (the initiation codon for
translation ~~ATG" is underlined).
The 3' primer has the sequence
5' GCGCGGTACCACAAACGTTGCCTTCCT 3' (SBQ ID No. 8) and contains
the cleavage site for the restriction endonuclease Asp718 and
-33-
CA 02430223 2003-05-30
19 nucleotides complementary to the 3' non-translated
sequence of the KGF-2 gene. The amplified sequences are
isolated from a 1% agarose gel using a commercially available
kit from Qiagen, Inc., Chatsworth, CA. The fragment is then
digested with the endonucleases BamHI and Asp~l8 and then
purified again on a 1% agarose gel. 'This fragment is
designated F2.
The vector pAx (modification of p~Th941 vector, discussed
below) is used for the expression of the RGF-2 protein using
the baculovirus expression system (for review see: Summers,
M.D. and Smith, G.E. 1987, A manual of methods for
baculovirus vectors and insect cell culture procedures, Texas
Agricultural Experimental Station Bulletin No. 1555). This
expression vector contains the strong polyhedrin promoter of
the Autographs californica nuclear polyhidrosis virus
(AcMNPV) followed by the recognition sites for the
restriction endonucleases BamHI and Asp718. The
polyadenylation site of the simian virus (SV)40 is used for
efficient polyadenylation. For an easy selection of
recombinant viruses the beta-galactosidase gene from E.coli
is inserted in the same orientation as the polyhedrin
promoter followed by the polyadenylation signal of the _
polyhedrin gene. The polyhedrin sequences are flanked at
both sides by viral sequences for the cell-mediated
homologous recombination of co-trarisfected wild-type viral
DNA. Many other baculovirus vectors could be used in place
of pRGl such as pAc373, pVL941 and pAcIMi (Luckow, V.A. and
Suna~ers, M.D., Virology, 170:31-39).
The plasrnid is digested with the restriction enzymes
BamHI and Asp718. The DNA is then isolated from a 1% agarose
gel using the commercially available kit (Qiagen, Inc.,
Chatsworth, CA?. This vector DNA is designated V2.
Fragment F2 and the piasmid V2 are ligated with T4 DNA
ligase . E . coli HBi01 cells are then transfozmed and bacteria
identified that contained the plasmid (pBacKGF-2) with the
-34-
CA 02430223 2003-05-30
KGF-2 gene using PCR with both cloning oligonucleotides. The
sequence of the cloned fragment is confixmed ~by DNA
sequencing.
beg of the plasmid pBacKGF-2 is co-transfected~with 1.0
~g of a commercially available linearized' bacalovirus
("BaculoGold'" baculovirus DNA", Phar<ni.ngen, San Diego, CA. )
using the lipofection method (Felgner et al..Proc. Natl.
Acad. Sci. I1SA, 84 : ?413-?41? (198?) ) .
leg of BaculoGold°' virus DNA and 5 ~g of the plasmid
pBacKGF-2 are mixed in a sterile well of a microtiter plate
containing 50 gel of serum free Grace's medium (Life
Technologies Inc., Gaithersburg, MD). Afterwards 10 ~C1
Lipof ectin~ plus 90 ~Cl Grace' s medium are added, mixed and
incubated for 15 uzinutes at room. temperature . Then the
transfection mixture is added drop-wise to the Sf9 insect
cells tATCC CRL 1711) seeded in a 35 mttt tissue culture plate
with Z ml Grace's medium without serum. The plate is rocked
back and forth to mix~the newly added solution. The plate is
then incubated for 5 hours at 27°C. After 5 hours the
transfection salution is removed from the plate and 1 ml of
Grace's insect medium supplemented with 10% fetal calf serum
is added. The plate is put ba~..k into an incubator and
cultivation continued at 27°C for four days.
After four days the supernatant is collected and a
plaque assay performed sim3.lar as described by Summers and
Smith (supra). As a modification an agarose gel with "Blue
Gal" (Life Technologies Inc., Gaithersburg) is used which
allows an easy isolation of blue stained plaques. (A
detailed description of a "plaque assay" can also be found a.n
the user's guide for insect cell culture and baculovirology
distributed by Life Technologies Inc., Gaithersburg, page 9-
10) .
Four days after the serial dilution, the viruses are
added to the cells and blue stained plaques are picked with
the tip of an Bppendorf pipette. The agar containing the
CA 02430223 2003-05-30
recombinant viruses is then resuspended in an Bppendorf tube
containing 200 ~Cl of Grace s medium. The agar is~ removed ~by
a brief centrifugation and the supernatant containing the
recombinant baculovirus is used to infect Sf9 cells seeded in
35 mm dishes. Four days later the supernatants of these
culture dishes are harvested and then stored at 4°C.
Sf9 cells are grown in Grace s medium supplemented with
10% heat-inactivated FBS. The cells are infected with the
recombinant baculovirus V-RGF-2 at a multiplicity of
infection (MOI) of 2. Six hours later the medium is removed
and replaced with SF900 II medium minus methionine and
cysteine (Life Technologies Inc., Gaithersburg). 42 hours
later 5 ~xCi of 35S-methionine and S ~xCi ~S cysteine (Amersham)
are added. The cells are further incubated for 16 hours
before they are harvested by centrifugation and the labelled
proteins visualized by SD&-PAGE and autoradiography.
Example 4
Expression of Recombinant KGF-2 in COS cells
The expression of plasmid, KGF-2 HA is derived from a
vector pcDNAI/Amp (Invitrogen) containing: 1) SV40 origin of
replication, 2) ampici.llin resistance gene, 3) E.coli
replication origin, 4) CMV gromoter followed by a polylinker
region, a SV40 intron and polyadenylation site. A DNA
fragment encoding the entire RGF-2 precursor and a HA tag
fused in frame to its 3' end is cloned into the polylinker
region of the vector, therefore, the recombinant protein
expression is directed under the CMV promoter. The HA tag
correspond to an epitope derived from the influenza
hemagglutinin protein as previously described (I. Wilson, H.
Niman, R. Heighten, A Cherenson, M. Connolly, and R. Lerner,
L984, Cell 37:'76'7, (1.984) ) . The infusion of IiA tag to the
target protein allows easy detection of the recombinant
protein with an antibody that recognizes the HA epitope.
-36-
CA 02430223 2003-05-30
The plasmid construction strategy is described as
follows:
The DNA sequence encoding KGF-2, ATCC # 75977, is
constructed by PCR using two primers: the 5' primer S'
CCCAAGCTTATGThGAAATGGATACTGACACATTGTGCC 3' (SEQ ID .No. 9)
contains a Hind III site followed by 30 nucleotides of KGF-2
coding sequence starting from the initiation codon; the.3'
sequence 5' TGCTCTAGACTAAGCGTAGT'C'PGC~GACGTCGTATC,GGTATGAGTG
TACCACCATTG~AAGAAAGTGAGG 3' (SBQ ID .No. 10) contains
complementary sequences to an I~aaI site, translation stog
codon, DA tag and the last 32 nucleotides of the RGF-2 coding
sequence (not including the stop codon). Therefore, the PCR
product contains a Ni:nd III site, RGF-2 coding sequence
followed by HA tag fused in frame, a translation termination
stop codon next to the HA tag, and an Xhal site . The PCR
amplified DNA fragment and the vector, pcDNAI/Amp, are
digested with Hind III and Xba I restriction enzyme and
ligated. The ligation mixture is transformed into fi. coli
strain XL1 Blue (Stratagene Cloning Systems, La Jolla, CA)
the transformed culture is plated on ampicillin media plates
and resistant colonies are selected. Plasmid DNA is isolated
from transformants and examined by PCR and restriction
analysis for the presence of the correct fragment. For
expression of the recombinant KGF-2, C4S cells are
transfected with the expression vector by DEAF-DBXTRAN method
(J. Sambrook, B. Fritsch, T. Maniatis, Molecular Cloning: A
Laboratory Manual, Cold Spring Laboratory Press, (1989)).
The expression of the I~GF-2 IiA protein is detected by
radiolabelling and inanunoprecipitation method (E. Harlow, D.
' Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor
Laboratory Press, (1988)). Cells are labelled for 8 hours
with ~S-cysteine two days post transfection. Culture media
are then collected and cells are lysed with detergent (RIPA
buffer (150 mM NaCl, 1% NP-40, 0.1.% SDS, 1% NP-40, 0.5% DOC,
50mM Tris, pH ?.5) (Wilson, I. et al., Id. 37:767 (1984)).
-37-
CA 02430223 2003-05-30
Both cell lysate and culture media are precipitated with a ~iA
_ specific monoclonal antibody. Proteins precipitated are
analyzed on 15% SDS-PAGIs gels.
Example 5
Transcription and translation of recombinant RGF-2 in vitro:
A PCR product is derived from the cloned cDNA in the pA2
vector used for insect cell expression of RGF-2. The grimers
used for this PCR were:
5' ATTAACCCTCACTAAAGGGAGGCCA'fGTGC~AATGGATACTGACACATTGTGCC 3~
tSEQ ID No . 11 ) and 5' CCCAA.GCTTCCACAAACGTTGCCTTCCTCTATGAG 3
(SEQ ID No. 12).
The first primer contains the sequence of a T3 promoter
5' to the ATG initiation codon. The second primer is
complimentary to the 3' end of the RGF-Z open reading frame,
and encodes the reverse complement of a stop codon.
The resulting PCR product is purified using a
commercially available kit from Qiagen. 0.5 ~Cg of this DNA
is used as a template for an in vitro transcription-
translation reaction. The reaction is performed with a kit
commercially available from Promega under the name of TNT.
The assay is performed as described in the instructions for
the kit, using radioactively labe7:ed methionine as a
substrate, with the exception that only 1/2 of the indicated
volumes of reagents are used and that the reaction is allowed
to proceed at 33°C for 1.5 hours.
Five ~l of the reaction is electrophoretically separated
on a denaturing 10 to 15% polyacrylamide gel. The gel is
fixed for 30 minutes in a mixture of water: Methanol: Acetic
acid at 6:3:1 volumes respectively. The gel is then dried
under heat and vacuum and subsequently exposed to wn X-ray
film for 16 hours. The film is developed showing the
presence of a radioactive protein band corresponding in size
to the conceptually translated RGF-2, strongly suggesting
_3g_
-..
CA 02430223 2003-05-30
_ that the cloned ~cDl~tA for KGF-2 contains an open reading frame
that codes for a protein of the expected size.
Numerous modifications and variations of the present
invention are possible in light of the above teachings and,
therefore, within the scope of the appended claims, the
invention may be practiced otherwise than as particularly
described.
-39-
CA 02430223 2003-05-30
SgQ~~ LISTING
- (1) GgNERAL INFORMATION:
(i) APPLICANT: GRUH$R, BT AL.
(~1) TI~$ OF IION~ Kerat:inocyte Gro~h Factor-2
(iii) N~$R OF SEQUENCES: 12
(iv) CORRLSPONDENCS ADDR$SS:
(A) ADDRESSEE: CARBLLA, BYRtU3. SIN, GILFILLAN,
~~I ~ STgyIART & OLSTEIN
($) STgggT: 6 BBCKER FARM ROAD
(C1 CITY: ROSSLAND .
(D) STATE: N$W JERSEY
(g) COUNTRY: USA
(F) ZIP: 07068 .
(v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: 3.5 INCH'DISI~TTB
~~R: IHM PS/2TM
( C ) OPERATING SYSTEM : MS -DOS T'"t
(D) SOFTWARE: WORD PERFECT 5.1~
( ) APPLICATION DATA:
(A) APPLICATION Nt3MH8R:
(g) FILING DATE: Concurrently
(C) CLASSIFICATION:
(vi.i) PRIOR APpLI~TxON DATA
(A) APPLICATION NUMEER:
(g) FILING DATE:
-40-
CA 02430223 2003-05-30
(viii). ATTORNEY/AGENT INFORMATION:
- (A) NAME: FERRARO, GREGORY D.
(B) REGISTRATION NUMB$R: 36,134
(C) REFBRENCE/DOCKET NUMBER: 325840-261
(ix) TBLECOMMUNICATiON INFORMATION:
(A) TELEPHONE: 201-994-1700
(B) TBLEFAX: 201-994-1744
(2) INFORMATION FOR SEQ ID N0:1:
(i) SEQDENCE CHARACTERISTICS
(A) LENGTH: 627 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNBSS: SINGLE
(D) TOPOLOGY: LINEAR
ii ) MOLBCDLE TYPfi : _ cDNA
(xi) SEQUENCE DESCRIPTION: SEQ~ID NO:1:
ATGTGGAAAT GGATACTGAC ACATTl3TGCC TCAGCCTTTC CCCACCTGCC60
CGGCTGCTGC
TGCTGCTGCT TTTTGTTGCT GTTCTTGGTG TCTTCCGTCC CTGTCACCTG120
CCAAGCCCIT
GGTCAGGACA TGGTGTCACC AGAGGCCACC AACTCTTCT'T CCTCCTCCTT180
CTCCTCTCCT
TCCAGCGCGG GAAGGCATGT GCGGAGCTAC AATCACCTTC AAGGAGATGT240
CCGCTGGAGA
AAGCTATTCT CTT!'CACCRA GTACTTTCTC AAGATTGAG,A AGAACGGG1~A300
GGTCAGCGGG
ACCAAGAAGG AGAACTGCCC GTACAGCATC CTGGAGATAA CATCAGTAGA360
fiATCGGAGTT
GTTGCCGTCA AAGCCATTAA CAGCRACTGT TACITAGCCA TGAACAAGAA420
GGGGAAACTC
TATGGCTCAA AAGAATTTAA CAATGACTGT AAGCTGAAGG AGAGGATAGA480
GGAAAATGGA
TACAATACCT ATGCATCATT TAACTGGCAG CATAATGGGA GGCAAATGTA540
TGTGGCATTG
AATGGAAAAG GAGCTCCAAG GAGAGGACAG AAAACACGAA GGAAAAACAC600
CTCTGCTCAC
TTTCTTCCAA TGGTGGTACA CTCATAG 627
-41-
CA 02430223 2003-05-30
(2) INFORMATION FOR SBQ ID N0:2:
(i) SEQUSNC$ CF~ARACTERISTICS
(A) LENGTH : 2 08 AMINO ACIDS
(B) TYPE: AMINO ACID
C) STRANDBDNESS
(D) TOPOLOGY: LINEAR
(ii) MOL$COLB TYPE: PROTEIN
(xi.) SBQIIFsNCE DBS~tIP~'ION: SEQ ID N0:2:
Met Trp Lys Trp Ile Leu Thr His Cys Ala Ser Ala Phe Pro His
-35 -30 -25
Leu Pro Gly Cys Cys Cys Cys Cys Phe Leu Leu Leu Phe Leu Val
-20 -15 -10
Ser Ser Val Pro Val Thr Cys Gln Ala Leu Gly Gln Asp Met Val
-5 1 5
Ser Pro Glu Ala Thr Asn Ser SerSer Ser Ser Phe Ser Ser Pro
15 20
Ser Ser Ala Gly Arg His Val Arg;SerTyr Asn His Leu Gln Gly
25 30 35
Asp Val Arg Trp Arg Lys Leu PheSer Phe Thr Lys Tyr Phe Leu
40 45 50
Lys Ile Glu Lys Asn Gly Lys ValSer Gly Thr Lys Lys Glu Asn
55 60 65
Cys Pro Tyr Ser Ile Leu Glu Ile?'hrSer Val Glu .IleGly Val
70 75 80
Val Ala Val Lys Ala Ile Asn SerAsn Tyr Tyr Leu Ala Met Asn
85 90 95
Lys Lys Gly Lys Leu Tyr Gly SerLys Glu Phe Asn Asn Asp Cys
100 105 110
Lys Leu Lys Glu Arg Ile Glu GluAsn Gly Tyr Asn Thr Tyr Ala
115 120 125
Ser Phe Asn Trp Gln His Asn GlyArg Gln Met Tyr Val Ala Leu
130 135 140
-42-
CA 02430223 2003-05-30
Asn Gly Lys Gly Ala Pro Arg Arg Gly.Gln Lys Thr Arg Arg Lys
145 150 155
Asn Thr Ser Ala Hi.s Phe Leu Pro Met val Val His Ser
160 165 170
(2) INFORMATION FOR SEQ ID N0:3:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 36 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDN'FsSS : SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: 0ligonucleotide
(xi) SEQUENCE DESCRIPTION: SgQ ID N0:3:
CCCCACATGT GGAAATGGAT ACTGACACAT TGTGCC 36
(2) INFORMATION FOR SEQ ID N0:4:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 35 BASE PAIRS
(B) TYPE: NtTCLEIC ACID
(C) STR.ANDEDNFsSS: SINGLE
(D) TOPOLOGY: LTNEAR
(ii) MOLECULE TYPE: Oligonucleotide
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:4:
CCCAAGCTTC'CACAAACGTT GCC'I'TCCTCT ATGAG 35
(2) INFORMATION FOR SEQ ID N0:5:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 36 BASE PAIRS
-43-
CA 02430223 2003-05-30
(B) TYPE:. NUCLEIC ACID
{C) STR.ANDEDNESS: SINGLE
{D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:5:
CATGCCATGG CGTGCCAAGC CCTTGGTCAG GACATG 36
(2) INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS
{A) LENGTH: 35 BASE PAIRS
(B) TYPE: NtTCLEIC ACID
(C) STRANDEDNESS: SINGLE
fD) TOPOLOGY: LINEAR
{ii) MOLECULE TYPE:- Oligonucleoti:de
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:6:
CCCAAGCTTC CACAAACGTT GCCTTCCTCT ATGAG 35
(2) INFORMATION FOR S8Q ID N0:7:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 35 BASE PAIRS
(B) TYPE: NUCLEIC ACID
fC) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:7:
GCGGGATCCG CCATCATGTG GAAATGGATA CTCAC 35
-44 -
CA 02430223 2003-05-30
(2) TNFORMATION FOR SEQ ID N0:8:
(i) SEQUENCE QiARACTERISTICS
(A) LENGTH: 26 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDBDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide
(xi) SEQUENCE DsscRIPTxON; sEQ xD No: s:
CGCGGTACCA CAAACGTTGC CTTCGT 26
(2) INFORMATION FOR SEQ ID N0:9:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 39 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide
(xi) SEQUENCE DESCRIPTTON: SEQ ID N0:9:
CCCAAGCTTA TGTGGAAATG GATACTGACA CATTGTGCC 39
(2) INFORMATION FOR SEQ ID N0:10:
(i) SBQUENCE CHARACTERISTICS
(A) LENGTH: 69 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide
-45-
CA 02430223 2003-05-30
(xi) ssQc~rcE DESCRIPTION: sEQ =D NO: is:
TGCTCTAGAC TAAGCGTAGT CTGGGACGTC GTATGGGTAT GAGTGTACCA CCATTGGAAG 60
AAAGTGAGG ~ 69
(2) INFORMATION FOR S8Q ID N0:11:
(i) SEQUENCE C'~ARACTERISTICS
(A) LENGTH: 54 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) SfiR.ANDEDNESS : SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECOLE TYPE: Oligonucleotide
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:11:
ATTAACCCTC ACTAAAGGGA GGCCATGTGG AAATGGATAC TGACACATTG TGCC 54
(2) INFORMATION FOR SEQ ID N0:12:
(i) SEQUENCE CHARACTBRISTICS
(A) LENGTH: 35 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleoti.de ,
(xi) SEQU&NCE DESCRIPTION: SEQ ID N0:12:
CCCAAGCTTC CACAAACGTT GCCTTCCTCT ATGAG 35
-46-
