Note: Descriptions are shown in the official language in which they were submitted.
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
METHODS OF DIAGNOSING COLORECTAL CANCER AND/OR BREAST CANCER,
COMPOSITIONS, AND METHODS OF SCREENING FOR COLORECTAL CANCER
AND/OR BREAST CANCER MODULATORS
FIELD OF THE INVENTION
The invention relates to the identification of expression profiles and the
nucleic acids
involved in breast and/or colorectal cancer, and to the use of such expression
profiles and
nucleic acids in diagnosis and prognosis of such cancers. The invention
further relates to
methods for identifying and using candidate agents and/or targets which
modulate certain
cancers.
BACKGROUND OF THE INVENTION
The identification of novel therapeutic targets and diagnostic markers is
essential for
improving the current treatment of cancer patients. Recent advances in
molecular medicine
have increased the interest in tumor-specific cell surface antigens that could
serve as
targets for various immunotherapeutic or small molecule strategies. Antigens
suitable for
immunotherapeutic strategies should be highly expressed in cancer tissues and
ideally not
expressed in normal adult tissues. Expression in tissues that are dispensable
for life,
however, may be tolerated. Examples of such antigens include Her2/neu and the
B-cell
antigen CD20. Humanized monoclonal antibodies directed to Her2/neu (Herceptin)
are
currently in use for the treatment of metastatic breast cancer (Ross and
Fletcher, 1998,
Stem Cells 16:413-428). Similarly, anti-CD20 monoclonal antibodies (Rituxin)
are used to
effectively treat non-Hodgekin's lymphoma (Maloney et al., 1997, Blood 90:2188-
2195;
Leget and Czuczman, 1998, Curr. Opin. Oncol. 10:548-551 ).
Breast cancer is a significant cancer in Western populations. It develops as
the result of a
pathologic transformation of normal breast epithelium to an invasive cancer.
There have
been a number of recently characterized genetic alterations that have been
implicated in
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
breast cancer. However, identification of additional genetic alterations
involved in the
development of breast cancer is needed.
Imaging of breast cancer for diagnosis has been problematic and limited. In
addition,
dissemination of tumor cells (metastases) to locoregional lymph nodes is an
important
prognostic factor; five year survival rates drop from 80 percent in patients
with no lymph
node metastases to 45 to 50 percent in those patients who do have lymph node
metastases.
A recent report showed that micrometastases can be detected from lymph nodes
using
reverse transcriptase-PCR methods based on the presence of mRNA for
carcinoembryonic
antigen, which has previously been shown to be present in the vast majority of
breast
cancers but not in normal tissues. Liefers et al., New England J. of Med.
339(4):223 (1998).
Another disease state which requires more attention is colon cancer (used
interchangeably
herein with "colorectal cancer"). There have been a number of recently
characterized
genetic alterations that have been implicated in colorectal cancer, including
mutations in two
classes of genes, tumor-suppressor genes and proto-oncogenes, with recent work
suggesting that mutations in DNA repair genes may also be involved in
tumorigenesis. For
example, inactivating mutations of both alleles of the adenomatous polyposis
coli (APC)
gene, a tumor suppressor gene, appears to be one of the earliest events in
colorectal
cancer, and may even be the initiating event. Other genes implicated in
colorectal cancer
include the MCC gene, the p53 gene, the DCC (deleted in colorectal carcinoma)
gene and
other chromosome 18q genes, and genes in the TGF-(3 signalling pathway. For a
review,
see Molecular Biology of Colorectal Cancer, pp238-299, in Curr. Probl. Cancer,
Sept/Oct
1997.
Thus, methods that can be used for diagnosis and prognosis of breast and
colorectal cancer
would be desirable. While academia and industry has made an effort to identify
novel
sequences, there has not been an equal effort exerted to identify the function
of the novel
sequences, particularly with regard to their involvement in disease states.
For example,
databases provide the sequences for accession numbers T32108 (SEQ ID NO:1 ),
AW136973 (SEQ ID N0:2), AK000747 (SEQ ID N0:3) and AK000123 (SEQ ID N0:4), yet
none of these sequences have been associated with a gene product involved in a
disease
state. Similarly, the amino acid sequence for Ephrin-A3 (Kozlosky et al.,
Oncogene
10(2):299-306 (1995)) is found at accession number P52797 (SEQ ID NO:S), which
is nearly
identical to the amino acid sequence for EHK1 (Davis et al., Science
266(5186):816-819
(1994)), deduced from the cDNA sequence shown in accession number L37360 (SEQ
ID
N0:6). These two proteins are possibly the result of mRNA splice variants of
the same
gene. The amino acid sequence of a mouse homolog of Ephrin-A3 is shown in
accession
number 008545 (SEQ ID N0:7). These proteins are members of the family of EPH-
related
2
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
receptor tyrosine kinase ligands (LERKs). However, while various LERKs,
including Ephrin-
A3/EHK1, have been associated with development of neural networks (see, e.g.
Gao et al.,
PNAS 96(7):4073-4077 (1999); Wilkinson, Curr. Biol. 10(12):R447-451 (2000)),
Ephrin-A3
has not been associated with any disease state.
Accordingly, provided herein are methods that can be used in diagnosis and
prognosis of
breast and colorectal cancer. Further provided are methods that can be used to
screen
candidate bioactive agents for the ability to modulate breast and/or colon
cancer.
Additionally, provided herein are molecular targets for therapeutic
intervention in certain
cancers.
SUMMARY OF THE INVENTION
The present invention provides methods for screening for compositions which
modulate
breast cancer. In an alternative embodiment, the present invention provides
methods for
screening for compositions which modulate colorectal cancer. In one aspect, a
method of
screening drug candidates comprises providing a cell that expresses an
expression profile
gene or fragments thereof. Preferred embodiments of thb expression profile
gene as
described herein include the sequence comprising SEQ ID N0:8 (encoding CHA4)
or SEQ
ID N0:9 (encoding CBK8), or a fragment thereof. The method further includes
adding a
drug candidate to the cell and determining the effect of the drug candidate on
the expression
of the expression profile gene.
In one embodiment, the method of screening drug candidates includes comparing
the level
of expression in the absence of the drug candidate to the level of expression
in the presence
of the drug candidate, wherein the concentration of the drug candidate can
vary when
present, and wherein the comparison can occur after addition or removal of the
drug
candidate. In a preferred embodiment, the cell expresses at least two
expression profile
genes. The profile genes may show an increase or decrease.
Also provided herein is a method of screening for a bioactive agent capable of
binding to
CHA4 or CBKB, or a fragment thereof, the method comprising combining CHA4,
CBKB, or
fragment thereof and a candidate bioactive agent, and determining the binding
of the
candidate agent to the CHA4, CBKB, or fragment thereof.
Further provided herein is a method for screening for a bioactive agent
capable of
modulating the bioactivity of CHA4 or CBKB, or a fragment thereof. In one
embodiment, the
method comprises combining CHA4 or CBK8 or fragment thereof and a candidate
bioactive
agent, and determining the effect of the candidate agent on the bioactivity of
CHA4 or CBK8
3
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
or the fragment thereof. In one embodiment, CHA4 has the bioactivity of a
breast cancer
modulating protein. In another embodiment, CHA4 or CBK8 has the bioactivity of
a
colorectal cancer modulating protein. In yet another embodiment, CHA4 has the
bioactivity
of a breast cancer modulating protein and a colorectal cancer modulating
protein.
Also provided herein is a method of evaluating the effect of a candidate
cancer drug
comprising administering the drug to a transgenic animal expressing or over-
expressing
CHA4 or CBKB, or a fragment thereof, or an animal lacking CHA4 or CBK8 for
example as a
result of a gene knockout. ,
Additionally, provided herein is a method of evaluating the effect of a
candidate cancer drug
comprising administering the drug to a patient and removing a cell sample from
the patient.
The expression profile of the III is then determined. Preferably, the
determination of the
expression profile comprises determining the expression of CHA4 and/or CBKB.
This
method may further comprise comparing the expression profile to an expression
profile of a
healthy individual.
Furthermore, a method of diagnosing breast cancer and/or colorectal cancer is
provided.
The method comprises determining the expression of a gene which comprising SEQ
ID
N0:8 or SEQ ID NO: 9, or a fragment thereof, in a first tissue sample of a
first individual, and
comparing this to the expression of the gene from a second normal tissue
sample of the first
individual or a tissue sample of a second individual. the comparison of the
expression
indicates that the first individual has cancer. In one embodiment, the first
tissue sample is
breast tissue and the cancer is breast cancer. In another embodiment, the
first tissue
sample is colorectal tissue and the cancer is colorectal cancer.
In another aspect, the present invention provides an antibody which
specifically binds to
CHA4 or CBKB, or a fragment thereof. Preferably the antibody is a monoclonal
antibody.
The antibody can be a fragment of an antibody such as a single stranded
antibody as further
described herein, or can be conjugated to another molecule. In one embodiment,
the
antibody is a humanized antibody.
In one embodiment a method for screening for a bioactive agent capable of
interfering with
the binding of CHA4 or a fragment thereof, and an antibody which binds to said
CHA4 or
fragment thereof is provided. In a preferred embodiment, the method comprises
combining
CHA4 or a fragment thereof, a candidate bioactive agent and an antibody which
binds to
said CHA4 or fragment thereof. The method furfher includes determining the
binding of said
CHA4 or fragment thereof and said antibody. In another embodiment a method for
screening for a bioactive agent capable of interfering with the binding of
CBK8 or a fragment
4
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
thereof, and an antibody which 'binds to said CBK8 or fragment thereof is
provided. In a
preferred embodiment, the method comprises combining CBK8 or a fragment
thereof, a
candidate bioactive agent and an antibody which binds to said CBK8 or fragment
thereof.
The method further includes determining the binding of said CBK8 or fragment
thereof and
said antibody. Wherein there is a change in binding, an agent is identified as
an interfering
agent. The interfering agent can be an agonist or an antagonist. Preferably,
the antibody as
well as the agent inhibits breast cancer and/or colorectal cancer.
In one aspect of the invention, a method for inhibiting the activity of a
breast cancer or
colorectal cancer modulating protein are provided. The method comprises
binding an
inhibitor to the protein. In a preferred embodiment, the protein is CHA4. In
another
preferred embodiment, the protein is CBK8.
In another aspect, the invention provides a method for neutralizing the effect
of a breast
cancer or colorectal cancer modulating protein. The method comprises
contacting an agent
specific for the protein with 'the protein in an amount sufficient to effect
neutralization. In a
preferred embodiment, the protein is CHA4. In another preferred embodiment,
the protein is
CBK8.
In a further aspect, a method for inhibiting breast cancer and/or colorectal
cancer is
provided. In one embodiment, the method comprises administering to a cell a
composition
comprising an antibody to CHA4 or a fragment thereof. In another embodiment,
the method
comprises administering to a cell a composition comprising an antibody to CBK8
or a
fragment thereof. In one embodiment, the antibody is conjugated to a
therapeutic moiety.
Such therapeutic moieties include a cytotoxic agent and a radioisotope. The
method can be
performed in vitro or in vivo, preferably in vivo to an individual. In a
preferred embodiment
the method of inhibiting breast cancer and/or colorectal cancer is provided to
an individual
with such cancer.
As described herein, methods of inhibiting breast cancer and/or colorectal
cancer can be
performed by administering any inhibitor of CHA4 or CBK8 activity to a cell or
individual. In
one embodiment, a CHA4 inhibitor is an antisense molecule to CHA4. In one
embodiment,
a CBK8 inhibitor is an antisense molecule to CBK8.
Moreover, provided herein is a biochip comprising a nucleic acid segment which
encodes
CHA4 and/or CBKB, or a fragment thereof, wherein the biochip comprises fewer
than 1000
nucleic acid probes. Preferably at least two nucleic acid segments are
included.
5
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
Also provided herein are methods of eliciting an immune response in an
individual. In one
embodiment a method provided herein comprises administering to an individual a
composition comprising CHA4 or CBKB, or a fragment thereof. In another aspect,
said
composition comprises a nucleic acid comprising a sequence encoding CHA4 or
CBKB, or a
fragment thereof. In another aspect, a composition comprising CHA4 or CBKB, or
a
fragment thereof is provided. In a preferred embodiment, the composition
comprises a
pharmaceutically acceptable carrier.
Other aspects of the invention will become apparent to the skilled artisan by
the following
description of the invention.
DETAILED DESCRIPTION OF THE FIGURES
Figure 1 shows an embodiment of a nucleic acid (SEQ ID N0:8) (mRNA) which
includes a
sequence which encodes a difFerentially expressed protein provided herein,
CHA4. Start
(ATG) and stop (TAG) codons are underlined.
Figure 2 shows an embodiment of the amino acid sequence of CHA4 (SEQ ID
N0:10).
Figures 3A-3D show the relative amount of expression of CHA4 in various
samples of breast
cancer tissue (3A), colorectal cancer tissue (3B), including primary tumors
(dark bars) and
metastatic tissue (light bars), and several normal tissue types (3C-3D). CHA4
is upregulated
in both breast cancer tissue and colorectal cancer tissue as compared with
normal tissues.
Figure 4 shows an embodiment of a nucleic acid (SEQ ID N0:9) (mRNA) which
includes a
sequence which encodes a colorectal cancer protein provided herein, CBKB. The
start
(ATG) and stop (TAA) codons are underlined. The bold sequence is substantially
complementary to that of accession no. AW136973 (SEQ ID N0:2).
Figure 5 shows an embodiment of an amino acid sequence of CBK8 (SEO ID N0:11
). each
of the two sequences in bold corresponds to a Band 4.1 domain. The sequence
underlined
corresponds to a Pleckstrin domain.
Figures 6A-6C show the relative amounts of expression of CBK8 in several
different
colorectal cancer tissue samples (Figure 6A), including primary tumor samples
(solid bars)
and samples of metastatic tissue (light bars), and various normal tissue types
(Figure 6B
and 6C). CBK8 is overexpressed in coloroectal cancer tissue as compared to
normal
tissues.
6
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
DETAILED DESCRIPTION OF THE INVENTION
The present invention provides novel methods for diagnosis and prognosis
evaluation for
breast and colorectal cancer, as well as methods for screening for
compositions which
modulate breast and colorectal cancer and compositions which bind to
modulators of breast
and colorectal cancer. In one aspect, the expression levels of genes are
determined in
different patient samples for which either diagnosis or prognosis information
is desired, to
provide expression profiles. An expression profile of a particular sample is
essentially a
"fingerprint" of the state of the sample; while two states may have any
particular gene
similarly expressed, the evaluation of a number of genes simultaneously allows
the
generation of a gene expression profile that is unique to the state of the
cell. That is, normal
tissue may be distinguished from cancer tissue, and within cancer tissue,
different prognosis
states (good or poor long term survival prospects, for example) may be
determined. By
comparing expression profiles of cancer tissue in different states,
information regarding
which genes are important (including both up- and down-regulation of genes) in
each of
these states is obtained. The identification of sequences that are
differentially expressed in
cancer tissue versus normal tissue, as well as differential expression
resulting in different
prognostic outcomes, allows the use of this information in a number of ways.
For example,
the evaluation of a particular treatment regime may be evaluated: does a
chemotherapeutic
drug act to improve the long-term prognosis in a particular patient.
Similarly, diagnosis may
be done or confirmed by comparing patient samples with the known expression
profiles.
Furthermore, these gene expression profiles (or individual genes) allow
screening of drug
candidates with an eye to mimicking or altering a particular expression
profile; for example,
screening can be done for drugs that suppress the expression profile gene or
convert a poor
prognosis profile to a better prognosis profile. This may be done by making
biochips
comprising sets of the important cancer genes, which can then be used in these
screens.
These methods can also be done on the protein basis; that is, protein
expression levels of
the cancer proteins can be evaluated for diagnostic and prognostic purposes or
to screen
candidate agents. In addition, the cancer nucleic acid sequences can be
administered for
gene therapy purposes, including the administration of antisense nucleic
acids, or the cancer
proteins (including antibodies and other modulators thereof) administered as
therapeutic
drugs.
The methods of screening, diagnosis, prognosis and treatment provided herein
relate to
cancer. Preferably, the cancer is breast cancer and/or colorectal cancer.
Thus the present invention provides nucleic acid and protein sequences that
are differentially
expressed in breast cancer and/or colorectal cancer when compared to normal
tissue. The
sequences provided herein are termed "differentially expressed sequences" . As
outlined
7
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
below, sequences include those that are up-regulated (i.e. expressed at a
higher level) in
breast cancer and/or colorectal cancer, as well as those that are down-
regulated (i.e.
expressed at a lower level) in breast cancer and/or colorectal cancer. In a
preferred
embodiment, the differentially expressed sequences are from humans; however,
as will be
appreciated by those in the art, difFerentially expressed sequences from other
organisms
may be useful in animal models of disease and drug evaluation; thus, other
differentially
expressed sequences are provided, from vertebrates, including mammals,
including rodents
(rats, mice, hamsters, guinea pigs, etc.), primates, farm animals (including
sheep, goats,
pigs, cows, horses, etc). Differentially expressed sequences from other
organisms may be
obtained using the techniques outlined below.
In a preferred embodiment, the differentially expressed sequences are those of
nucleic acids
encoding CHA4 or fragments thereof. Preferably, the differentially expressed
sequence is
that depicted in Figure 1, or a fragment thereof. Preferably, the
differentially expressed
sequences encode a protein having the amino acid sequence depicted in Figure
2, or a
fragment thereof. In a preferred embodiment, CHA4 is human Ephrin-A3.
In another preferred embodiment, the differentially expressed sequences are
those of
nucleic acids encoding CBK8 or fragments thereof. Preferably, the
differentially expressed
sequence is that depicted in Figure 4, or a fragment thereof. Preferably, the
differentially
expressed sequences encode a protein having the amino acid sequence depicted
in Figure
5, or a fragment thereof.
Differentially expressed sequences can include both nucleic acid and amino
acid
sequences. In a preferred embodiment, the differentially expressed sequences
are
recombinant nucleic acids. By the term "recombinant nucleic acid" herein is
meant nucleic
acid, originally formed in vitro, in general, by the manipulation of nucleic
acid by polymerases
and endonucleases, in a form not normally found in nature. Thus an isolated
nucleic acid, in
a linear form, or an expression vector formed in vitro by ligating DNA
molecules that are not
normally joined, are both considered recombinant for the purposes of this
invention. It is
understood that once a recombinant nucleic acid is made and reintroduced into
a host cell or
organism, it will replicate non-recombinantly, i.e. using the in vivo cellular
machinery of the
host cell rather than in vitro manipulations; however, such nucleic acids,
once produced
recombinantly, although subsequently replicated non-recombinantly, are still
considered
recombinant for the purposes of the invention.
Similarly, a "recombinant protein" is a protein made using recombinant
techniques, i.e.
through the expression of a recombinant nucleic acid as depicted above. A
recombinant
protein is distinguished from naturally occurring protein by at least one or
more
8
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
characteristics. For example, the protein may be isolated or purified away
from some or all
of the proteins and compounds with which it is normally associated in its wild
type host, and
thus may be substantially pure. For example, an isolated protein is
unaccompanied by at
least some of the material with which it is normally associated in its natural
state, preferably
constituting at least about 0.5%, more preferably at least about 5% by weight
of the total
protein in a given sample. A substantially pure protein comprises at least
about 75% by
weight of the total protein, with at~least about 80% being preferred, and at
least about 90%
being particularly preferred. The definition includes the production of a
differentially
expressed protein from one organism in a different organism or host cell.
Alternatively, the
protein may be made at a significantly higher concentration than is normally
seen, through
the use of an inducible promoter or high expression promoter, such that the
protein is made
at increased concentration levels. Alternatively, the protein may be in a form
not normally
found in nature, as in the addition of an epitope tag or amino acid
substitutions, insertions
and deletions, as discussed below.
In a preferred embodiment, the differentially expressed sequences are nucleic
acids. As will
be appreciated by those in the art and is more fully outlined below,
differentially expressed
sequences are useful in a variety of applications, including diagnostic
applications, which will
detect naturally occurring nucleic acids, as well as screening applications;
for example,
biochips comprising nucleic acid probes to the differentially expressed
sequences can be
generated. In the broadest sense, then, by "nucleic acid" or "oligonucleotide"
or grammatical
equivalents herein means at least two nucleotides covalently linked together.
A nucleic acid
of the present invention will generally contain phosphodiester bonds, although
in some
cases, as outlined below, nucleic acid analogs are included that may have
alternate
backbones, comprising, for example, phosphoramidate (Beaucage et al.,
Tetrahedron
49(10):1925 (1993) and references therein; Letsinger, J. Org. Chem. 35:3800
(1970); Sprinzl
et al., Eur. J. Biochem. 81:579 (1977); Letsinger et al., Nucl. Acids Res.
14:3487 (1986);
Sawai et al, Chem. Lett. 805 (1984), Letsinger et al., J. Am. Chem. Soc.
110:4470 (1988);
and Pauwels et al., Chemica Scripta 26:141 91986)), phosphorothioate (Mag et
al., Nucleic
Acids Res. 19:1437 (1991 ); and U.S. Patent No. 5,644,048), phosphorodithioate
(Briu et al.,
J. Am. Chem. Soc. 111:2321 (1989), O-methylphophoroamidite linkages (see
Eckstein,
Oligonucleotides and Analogues: A Practical Approach, Oxford University
Press), and
peptide nucleic acid backbones and linkages (see Egholm, J. Am. Chem. Soc.
114:1895
(1992); Meier et al., Chem. Int. Ed. Engl. 31:1008 (1992); Nielsen, Nature,
365:566 (1993);
Carlsson et al., Nature 380:207 (1996), all of which are incorporated by
reference). Other
analog nucleic acids include those with positive backbones (Denpcy et al.,
Proc. Natl. Acad.
Sci. USA 92:6097 (1995); non-ionic backbones (U.S. Patent Nos. 5,386,023,
5,637,684,
5,602,240, 5,216,141 and 4,469,863; Kiedrowshi et al., Angew. Chem. Intl. Ed.
English
30:423 (1991 ); Letsinger et al., J. Am. Chem. Soc. 110:4470 (1988); Letsinger
et al.,
9
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
Nucleoside & Nucleotide 13:1597 (1994); Chapters 2 and 3, ASC Symposium Series
580,
"Carbohydrate Modifications in Antisense Research", Ed. Y.S. Sanghui and P.
Dan Cook;
Mesmaeker et al., Bioorganic & Medicinal Chem. Lett. 4:395 (1994); Jeffs et
al., J.
Biomolecular NMR 34:17 (1994); Tetrahedron Lett. 37:743 (1996)) and non-ribose
backbones, including those described in U.S. Patent Nos. 5,235,033 and
5,034,506, and
Chapters 6 and 7, ASC Symposium Series 580, "Carbohydrate Modifications in
Antisense
Research", Ed. Y.S. Sanghui and P. Dan Cook. Nucleic acids containing one or
more
carbocyclic sugars are also included within one definition of nucleic acids
(see Jenkins et al.,
Chem. Soc. Rev. (1995) pp169-176). Several nucleic acid analogs are described
in Rawls,
C & E News June 2, 1997 page 35. All of these references are hereby expressly
incorporated by reference. These modifications of the ribose-phosphate
backbone may be
done for a variety of reasons, for example to increase the stability and half-
life of such
molecules in physiological environments or as probes on a biochip.
As will be appreciated by those in the art, all of these nucleic acid analogs
may find use in
the present invention. In addition, mixtures of naturally occurring nucleic
acids and analogs
can be made; alternatively, mixtures of different nucleic acid analogs, and
mixtures of
naturally occurring nucleic acids and analogs may be made.
Particularly preferred are peptide nucleic acids (PNA) which includes peptide
nucleic acid
analogs. These backbones are substantially non-ionic under neutral conditions,
in contrast
to the highly charged phosphodiester backbone of naturally occurring nucleic
acids. This
results in two advantages. First, the PNA backbone exhibits improved
hybridization kinetics.
PNAs have larger changes in the melting temperature (Tm) for mismatched versus
perfectly
matched basepairs. DNA and RNA typically exhibit a 2-4°C drop in Tm for
an internal
mismatch. With the non-ionic PNA backbone, the drop is closer to 7-9°C.
Similarly, due to
their non-ionic nature, hybridization of the bases attached to these backbones
is relatively
insensitive to salt concentration. In addition, PNAs are not degraded by
cellular enzymes,
and thus can be more stable.
The nucleic acids may be single stranded or double stranded, as specified, or
contain
portions of both double stranded or single stranded sequence. As will be
appreciated by
those in the art, the depiction of a single strand ("Watson") also defines the
sequence of the
other strand ("Crick"); thus the sequences described herein also includes the
complement of
the sequence. The nucleic acid may be DNA, both genomic and cDNA, RNA or a
hybrid,
where the nucleic acid contains any combination of deoxyribo- and ribo-
nucleotides, and any
combination of bases, including uracil, adenine, thymine, cytosine, guanine,
inosine,
xanthine hypoxanthine, isocytosine, isoguanine, etc. As used herein, the term
"nucleoside"
includes nucleotides and nucleoside and nucleotide analogs, and modified
nucleosides such
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
as amino modified nucleosides. In addition, "nucleoside" includes non-
naturally occurring
analog structures. Thus for example the individual units of a peptide nucleic
acid, each
containing a base, are referred to herein as a nucleoside.
A differentially expressed sequence can be initially identified by substantial
nucleic acid
and/or amino acid sequence homology to the differentially expressed sequences
outlined
herein. Such homology can be based upon the overall nucleic acid or amino acid
sequence,
and is generally determined as outlined below, using either homology programs
or
hybridization conditions.
The differentially expressed sequences of the invention can be identified as
follows.
Samples of normal and tumor tissue are applied to biochips comprising nucleic
acid probes.
The samples are first microdissected, if applicable, and treated as is know in
the art for the
preparation of mRNA. Suitable biochips are commercially available, for example
from
Affymetrix. Gene expression profiles as described herein are generated, and
the data
analyzed.
In a preferred embodiment, the genes showing changes in expression as between
normal
and disease states are compared to genes expressed in other normal tissues,
including, but
not limited to lung, heart, brain, liver, breast, kidney, muscle, prostate,
small intestine, large
intestine, spleen, bone, and placenta. In a preferred embodiment, those genes
identified
during the cancer screen that are expressed in any significant amount in other
tissues are
removed from the profile, although in some embodiments, this is not necessary.
That is,
when screening for drugs, it is preferable that the target be disease
specific, to minimize
possible side effects.
In a preferred embodiment, differentially expressed sequences are those that
are up-
regulated in breast cancer and/or colorectal cancer; that is, the expression
of these genes is
higher in carcinoma as compared to normal breast or colon tissue. "Up-
regulation" as used
herein means at least about a 50% increase, preferably a two-fold change, more
preferably
at least about a three fold change, with at least about five-fold or higher
being preferred. All
accession numbers herein are for the GenBank sequence database and the
sequences of
the accession numbers are hereby expressly incorporated by reference. GenBank
is known
in the art, see, e.g., Benson, DA, et al., Nucleic Acids Research 26:1-7
(1998) and the NCBI
web site (www.ncbi.nlm.nih.gov). In addition, these genes were found to be
expressed in a
limited amount or not at all in heart, brain, lung, liver, kidney, muscle,
pancreas, testes,
stomach, small intestine and spleen.
11
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
In a preferred embodiment, CHA4 is upregulated in breast cancer. In a
preferred
embodiment, CHA4 and/or CBK8 is upregulated in colorectal cancer.
In another embodiment, differentially expressed sequences are those that are
down-
regulated in breast or colorectal cancer; that is, the expression of these
genes is lower in, for
example, carcinoma as compared to normal tissue. "Down-regulation" as used
herein
means at least about a two-fold change, preferably at least about a three fold
change, with at
least about five-fold or higher being preferred.
Differentially expressed proteins of the present invention may be classified
as secreted
proteins, transmembrane proteins or intracellular proteins. In a preferred
embodiment the
differentially expressed protein is an intracellular protein. Intracellular
proteins may be found
in the cytoplasm and/or in the nucleus and may be associated with the plasma
membrane.
Intracellular proteins are involved in all aspects of cellular function and
replication (including,
for example, signaling pathways); aberrant expression of such proteins results
in
unregulated or disregulated cellular processes. For example, many
intracellular proteins
have enzymatic activity such as protein kinase activity, protein phosphatase
activity,
protease activity, nucleotide cyclase activity, polymerase activity and the
like. Intracellular
proteins also serve as docking proteins that are involved in organizing
complexes of
proteins, or targeting proteins to various subcellular localizations, and are
involved in
maintaining the structural integrity of organelles.
An increasingly appreciated concept in characterizing intracellular proteins
is the presence in
the proteins of one or more motifs for which defined functions have been
attributed. In
addition to the highly conserved sequences found in the enzymatic domain of
proteins,
highly conserved sequences have been identified in proteins that are involved
in protein-
protein interaction. For example, Src-homology-2 (SH2) domains bind tyrosine-
phosphorylated targets in a sequence dependent manner. PTB domains, which are
distinct
from SH2 domains, also bind tyrosine phosphorylated targets. SH3 domains bind
to proline-
rich targets. In addition, PH domains, tetratricopeptide repeats and WD
domains to name
only a few, have been shown to mediate protein-protein interactions. Some of
these may
also be involved in binding to phospholipids or other second messengers.
Several
cytoskeleton-associated proteins have been found to contain certain motifs.
for example,
the Band 4.1 domain has been identified in a number of proteins that associate
with other
proteins at the interface between the plasma membrane and the cytoskeleton.
(See, Rees
et al., Nature 347:685-689 (1990); Funayama et al., J. Cell Biol. 115:1039-
1048 (1991 );
Takeuchi et al., J. Cell Sci. 107:1921-1928 (1994)) . Proteins which contain a
Band 4.1
domain included Band 4.1, Ezrin, Moesin, Radixin, Talin, Filopodin and Merlin,
which all
have been shown or are suspected to bind cytoskeletal proteins, and many of
which are
12
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
associated with cell motility. Several protein tyrosine phosphatases (e.g.
PTPN3, PTPN4,
PTPN14, PTP-D1, PTP-RL10 and PTP2E) also possess a Band 4.1 motif. Another
motif
which frequently occurs in proteins which are constituents of the cytoskeleton
or are involved
in intracellular signaling is the pleckstrin homology (PH) domain. (See Mayer
et al., Cell
73:629-630 (1993); Haslam et al., Nature 363:309-310 (1993); Musacchio et al.,
Trends
Biochem. Sci. 18:343-353 (1994); Pawson, Nature 373:573-580 (1995); Ingley et
al., J. Cell
Biochem. 56:436-443 (1994); Saraste et al., Curr. Oipn. Struct. Biol. 5:403-
408 (1995);
Riddihough, Nat. Struct. Biol. 1:755-757 (1994)). Proteins which have been
identified as
possessing at least one PH domain include Pleckstrin, Ser/Thr protein kinases
(Act/Rac
family; beta-adrenergic receptor kinases), Tyrosine protein kinases
(Btk/Itk/Tec subfamily),
Insulin Receptor Substrate 1, Regulators of small G-proteins (guanine
nucleotide releasing
factor, guanine nucleotide exchange proteins, GTPase activating proteins),
cytoskeletal
proteins (dynamin, spectrin beta-chain, syntrophin), mammalian
phosphatidylinositol-specific
phospholipase C, oxysterol binding proteins (OSDBP, OSH1, YHR073w), and Mouse
protein
citron (a putative rho/rac effector). Putative functions which have been
suggested for the PH
domain include binding to G-proteins, binding lipids, binding to
phosphorylated Ser/Tyr
residues and attachment to membranes by an unknown mechanism.
As will be appreciated by one of ordinary skill in the art, specific motifs
can be identified on
the basis of primary sequence; thus, an analysis of the sequence of proteins
may provide
insight into both the enzymatic potential of the molecule and/or molecules
with which the
protein may associate.
In a preferred embodiment, CBK8 is an intracellular protein. In a preferred
embodiment,
CBK8 is associated with the plasma membrane and/or the cytoskeleton of a cell
in which it is
expressed. In one embodiment, CBK8 is involved in intracellular signaling.
In a preferred embodiment, the differentially expressed sequences are
transmembrane
proteins. Transmembrane proteins are molecules that span the phospholipid
bilayer of a
cell. They may have an intracellular domain, an extracellular domain, or both.
The
intracellular domains of such proteins may have a number of functions
including those
already described for intracellular proteins. For example, the intracellular
domain may have
enzymatic activity and/or may serve as a binding site for additional proteins.
Frequently the
intracellular domain of transmembrane proteins serves both roles. For example
certain
receptor tyrosine kinases have both protein kinase activity and SH2 domains.
In addition,
autophosphorylation of tyrosines on the receptor molecule itself, creates
binding sites for
additional SH2 domain containing proteins.
13
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
Transmembrane proteins may contain from one to many transmembrane domains. For
example, receptor tyrosine kinases, certain cytokine receptors, receptor
guanylyl cyclases
and receptor serine/threonine protein kinases contain a single transmembrane
domain.
However, various other proteins including channels and adenylyl cyclases
contain numerous
transmembrane domains. Many important cell surface receptors are classified as
"seven
transmembrane domain" proteins, as they contain 7 membrane spanning regions.
Important
transmembrane protein receptors include, but are not limited to insulin
receptor, insulin-like
growth factor receptor, human growth hormone receptor, glucose transporters,
transferrin
receptor, epidermal growth factor receptor, low density lipoprotein receptor,
epidermal
growth factor receptor, leptin receptor, interleukin receptors, e.g. IL-1
receptor, IL-2 receptor,
etc.
Characteristics of transmembrane domains include approximately 20 consecutive
hydrophobic amino acids that may be followed by charged amino acids.
Therefore, upon
analysis of the amino acid sequence of a particular protein, the localization
and number of
transmembrane domains within the protein may be predicted.
The extracellular domains of transmembrane proteins are diverse; however,
conserved
motifs are found repeatedly among various extracellular domains. Conserved
structure
and/or functions have been ascribed to different extracellular motifs. For
example, cytokine
receptors are characterized by a cluster of cysteines and a WSXWS (W=
tryptophan, S=
serine, X=any amino acid) motif (SEQ ID N0:12). Immunoglobulin-like domains
are highly
conserved. Mucin-like domains may be involved in cell adhesion and leucine-
rich repeats
participate in protein-protein interactions.
Many extracellular domains are involved in binding to other molecules. In one
aspect,
extracellular domains are receptors. Factors that bind the receptor domain
include
circulating ligands, which may be peptides, proteins, or small molecules such
as adenosine
and the like. For example, growth factors such as EGF, FGF and PDGF are
circulating
growth factors that bind to their cognate receptors to initiate a variety of
cellular responses.
Other factors include cytokines, mitogenic factors, neurotrophic factors and
the like.
Extracellular domains also bind to cell-associated molecules. In this respect,
they mediate
cell-cell interactions. Cell-associated ligands can be tethered to the cell
for example via a
glycosylphosphatidylinositol (GPI) anchor, or may themselves be transmembrane
proteins.
Extracellular domains also associate with the extracellular matrix and
contribute to the
maintenance of the cell structure.
Differentially expressed proteins that are transmembrane are particularly
preferred in the
present invention as they are good targets for immunotherapeutics, as are
described herein.
14
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
In addition, as outlined below, transmembrane proteins can be also useful in
imaging
modalities.
It will also be appreciated by those in the art that a transmembrane protein
can be made
soluble by removing transmembrane sequences, for example through recombinant
methods. Furthermore, transmembrane proteins that have been made soluble can
be
made to be secreted through recombinant means by adding an appropriate signal
sequence.
In a preferred embodiment, the differentially expressed proteins are secreted
proteins; the
secretion of which can be either constitutive or regulated. These proteins
have a signal
peptide or signal sequence that targets the molecule to the secretory pathway.
Secreted
proteins are involved in numerous physiological events; by virtue of their
circulating nature,
they serve to transmit signals to various other cell types. The secreted
protein may function
in an autocrine manner (acting on the cell that secreted the factor), a
paracrine manner
(acting on cells in close proximity to the cell that secreted the factor) or
an endocrine manner
(acting on cells at a distance). Thus secreted molecules find use in
modulating or altering
numerous aspects of physiology. Differentially expressed proteins that are
secreted proteins
are particularly preferred in the present invention as they serve as good
targets for
diagnostic markers, for example for blood tests.
In a preferred embodiment, CHA4 is a secreted protein.
A differentially expressed sequence is initially identified by substantial
nucleic acid and/or
amino acid sequence homology to the differentially expressed sequences
outlined herein.
Such homology can be based upon the overall nucleic acid or amino acid
sequence, and is
generally determined as outlined below, using either homology programs or
hybridization
conditions.
As used herein, a nucleic acid is a "differentially expressed nucleic acid" if
the overall
homology of the nucleic acid sequence to the nucleic acid sequences encoding
the amino
acid sequences of the figures is preferably greater than about 75%, more
preferably greater
than about 80%, even more preferably greater than about 85% and most
preferably greater
than 90%. In some embodiments the homology will be as high as about 93 to 95
or 98%.
Homology in this context means sequence similarity or identity, with identity
being preferred.
A preferred comparison for homology purposes is to compare the sequence
containing
sequencing errors to the correct sequence. This homology will be determined
using
standard techniques known in the art, including, but not limited to, the local
homology
algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981 ), by the homology
alignment
algorithm of Needleman & Wunsch, J. Mol. Biool. 48:443 (1970), by the search
for similarity
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
method of Pearson & Lipman, PNAS USA 85:2444 (1988), by computerized
implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the
Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science
Drive,
Madison, WI), the Best Fit sequence program described by Devereux et al.,
Nucl. Acid Res.
12:387-395 (1984), preferably using the default settings, or by inspection.
In a preferred embodiment, the sequences which are used to determine sequence
identity or
similarity are selected from the sequences set forth in the figures. In one
embodiment the
sequences utilized herein are those set forth in the figures. In another
embodiment, the
sequences are naturally occurring allelic variants of the sequences set forth
in the figures.
In another embodiment, the sequences are sequence variants as further
described herein.
One example of a useful algorithm is PILEUP. PILEUP creates a multiple
sequence
alignment from a group of related sequences using progressive, pairwise
alignments. It can
also plot a tree showing the clustering relationships used to create the
alignment. PILEUP
uses a simplification of the progressive alignment method of Feng & Doolittle,
J. Mol. Evol.
35:351-360 (1987); the method is similar to that described by Higgins & Sharp
CABIOS
5:151-153 (1989). Useful PILEUP parameters including a default gap weight of
3.00, a
default gap length weight of 0.10, and weighted end gaps.
Another example of a useful algorithm is the BLAST algorithm, described in
Altschul et al., J.
Mol. Biol. 215, 403-410, (1990) and ICarlin et al., PNAS USA 90:5873-5787
(1993). A
particularly useful BLAST program is the WU-BLAST-2 program which was obtained
from
Altschul et al., Methods in Enzymology, 266: 460-480 (1996). WU-BLAST-2 uses
several
search parameters, most of which are set to the default values. The adjustable
parameters
are set with the following values: overlap span =1, overlap fraction = 0.125,
word threshold
(T) = 11. The HSP S and HSP S2 parameters are dynamic values and are
established by
the program itself depending upon the composition of the particular sequence
and
composition of the particular database against which the sequence of interest
is being
searched; however, the values may be adjusted to increase sensitivity. A %
amino acid
sequence identity value is determined by the number of matching identical
residues divided
by the total number of residues of the "longer" sequence in the aligned
region. The "longer"
sequence is the one having the most actual residues in the aligned region
(gaps introduced
by WU-Blast-2 to maximize the alignment score are ignored).
Thus, "percent (%) nucleic acid sequence identity" is defined as the
percentage of
nucleotide residues in a candidate sequence that are identical with the
nucleotide residues
of Figure 1 (SEQ ID N0:8) or Figure 4 (SEQ ID N0:9). A preferred method
utilizes the
16
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
BLASTN module of WU-BLAST-2 set to the default parameters, with overlap span
and
overlap fraction set to 1 and 0.125, respectively.
The alignment may include the introduction of gaps in the sequences to be
aligned. In
addition, for sequences which contain either more or fewer nucleosides than
those of the
figures, it is understood that the percentage of homology will be determined
based on the
number of homologous nucleosides in relation to the total number of
nucleosides. Thus, for
example, homology of sequences shorter than those of the sequences identified
herein and
as discussed below, will be determined using the number of nucleosides in the
shorter
sequence.
In one embodiment, the nucleic acid homology is determined through
hybridization studies.
Thus, for example, nucleic acids which hybridize under high stringency to the
nucleic acid
sequences which encode the peptides identified in the figures, or their
complements, are
considered a differentially expressed sequence. High stringency conditions are
known in the
art; see for example Maniatis et al., Molecular Cloning: A Laboratory Manual,
2d Edition,
1989, Sambrook and Russell, Molecular Cloning: A Laboratory Manual, Third
Edition, 2001,
and Short Protocols in Molecular Biology, Third Edition (ed. Ausubel, et al.)
1995, each of
which are hereby incorporated by reference. Stringent conditions are sequence-
dependent
and will be different in different circumstances. Longer sequences hybridize
specifically at
higher temperatures. An extensive guide to the hybridization of nucleic acids
is found in
Tijssen, Techniques in Biochemistry and Molecular Biology--Hybridization with
Nucleic Acid
Probes, "Overview of principles of hybridization and the strategy of nucleic
acid assays"
(1993). Generally, stringent conditions are selected to be about 5-10'C lower
than the
thermal melting point (Tm) for the specific sequence at a defined ionic
strength pH. The Tm
is the temperature (under defined ionic strength, pH and nucleic acid
concentration) at which
50% of the probes complementary to the target hybridize to the target sequence
at
equilibrium (as the target sequences are present in excess, at Tm, 50% of the
probes are
occupied at equilibrium). Stringent conditions will be those in which the salt
concentration is
less than about 1.0 M sodium ion, typically about 0.01 to 1.0 M sodium ion
concentration (or
other salts) at pH 7.0 to 8.3 and the temperature is at least about
30°C for short probes (e.g.
10 to 50 nucleotides) and at least about 60°C for long probes (e.g.
greater than 50
nucleotides). Stringent conditions may also be achieved with the addition of
destabilizing
agents such as formamide.
The degree of stringency can be based, for example, on the calculated
(estimated) melting
temperature (Tm) of the nucleic acid sequence binding complex or probe.
Calculation of Tm
is well known in the art (see, e.g. page 9.50-9.51 of Sambrook (1989), below).
For example,
"maximum stringency" typically occurs at about Tm-5°C (5° below
the Tm of the probe);
17
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
"high stringency" at about 5-10° below the Tm; "intermediate
stringency" at about 10-20°
below the Tm of the probe; and "low stringency" at about 20-25° below
the Tm. In general,
hybridization conditions are carried out under high ionic strength conditions,
for example,
using 6XSSC or 6XSSPE. Under high stringency conditions, hybridization is
followed by two
washes with low salt solution, for example 0.5XSSC, at the calculated
temperature. Under
medium stringency conditions, hybridization is followed by two washes with
medium salt
solution, for example 2XSSC. Under low stringency conditions, hybridization is
followed by
two washes with high salt solution, for example 6XSSC.
In another embodiment, less stringent hybridization conditions are used; for
example,
moderate or low stringency conditions may be used, as are known in the art;
see Maniatis,
supra, Sambrook, supra and Ausubel, supra, and Tijssen, supra.
In addition, the differentially expressed nucleic acid sequences of the
invention are
fragments of larger genes, i.e. they are nucleic acid segments. "Genes" in
this context
includes coding regions, non-coding regions, and mixtures of coding and non-
coding
regions. Accordingly, as will be appreciated by those in the art, using the
sequences
provided herein, additional sequences of the differentially expressed genes
can be obtained,
using techniques well known in the art for cloning either longer sequences or
the full length
sequences; see Maniatis et al., Sambrook and Russell and Ausubel, et al.,
supra, hereby
expressly incorporated by reference.
Once the differentially expressed nucleic acid is identified, it can be cloned
and, if necessary,
its constituent parts recombined to form the entire differentially expressed
nucleic acid.
Once isolated from its natural source, e.g., contained within a plasmid or
other vector or
excised therefrom as a linear nucleic acid segment, the recombinant
differentially expressed
nucleic acid can be further-used as a probe to identify and isolate other
differentially
expressed nucleic acids, for example additional coding regions. It can also be
used as a
"precursor" nucleic acid to make modified or variant differentially expressed
nucleic acids
and proteins.
The differentially expressed nucleic acids of the present invention are used
in several ways.
In a first embodiment, nucleic acid probes to the differentially expressed
nucleic acids are
made and attached to biochips to be used in screening and diagnostic methods,
as outlined
below, or for administration, for example for gene therapy and/or antisense
applications.
Alternatively, the differentially expressed nucleic acids that include coding
regions of
differentially expressed proteins can be put into expression vectors for the
expression of
differentially expressed proteins, again either for screening purposes or for
administration to
a patient.
18
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
In a preferred embodiment, nucleic acid probes to differentially expressed
nucleic acids
(both the nucleic acid sequences encoding peptides outlined in the figures
and/or the
complements thereof) are made. The nucleic acid probes attached to the biochip
are
designed to be substantially complementary to the differentially expressed
nucleic acids, i.e.
the target sequence (either the target sequence of the sample or to other
probe sequences,
for example in sandwich assays), such that hybridization of the target
sequence and the
probes of the present invention occurs. As outlined below, this
complementarity need not be
perfect; there may be any number of base pair mismatches which will interfere
with
hybridization between the target sequence and the single stranded nucleic
acids of the
present invention. However, if the number of mutations is so great that no
hybridization can
occur under even the least stringent of hybridization conditions, the sequence
is not a
complementary target sequence. Thus, by "substantially complementary" herein
is meant
that the probes are sufficiently complementary to the target sequences to
hybridize under
normal reaction conditions, particularly high stringency conditions, as
outlined herein.
A nucleic acid probe is generally single stranded but can be partially single
and partially
double stranded. The strandedness of the probe is dictated by the structure,
composition,
and properties of the target sequence. In general, the nucleic acid probes
range from about
8 to about 100 bases long, with from about 10 to about 80 bases being
preferred, and from
about 30 to about 50 bases being particularly preferred. That is, generally
whole genes are
not used. In some embodiments, much longer nucleic acids can be used, up to
hundreds of
bases.
In a preferred embodiment, more than one probe per sequence is used, with
either
overlapping probes or probes to different sections of the target being used.
That is, two,
three, four or more probes, with three being preferred, are used to build in a
redundancy for
a particular target. The probes can be overlapping (i.e. have some sequence in
common),
or separate.
As will be appreciated by those in the art, nucleic acids can be attached or
immobilized to a
solid support in a wide variety of ways. By "immobilized" and grammatical
equivalents herein
is meant the association or binding between the nucleic acid probe and the
solid support is
sufficient to be stable under the conditions of binding, washing, analysis,
and removal as
outlined below. The binding can be covalent or non-covalent. By "non-covalent
binding" and
grammatical equivalents herein is meant one or more of either electrostatic,
hydrophilic, and
hydrophobic interactions. Included in non-covalent binding is the covalent
attachment of a
molecule, such as, streptavidin to the support and the non-covalent binding of
the
biotinylated probe to the streptavidin. By "covalent binding" and grammatical
equivalents
herein is meant that the two moieties, the solid support and the probe, are
attached by at
19
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
least one bond, including sigma bonds, pi bonds and coordination bonds.
Covalent bonds
can be formed directly between the probe and the solid support or can be
formed by a cross
linker or by inclusion of a specific reactive group on either the solid
support or the probe or
both molecules. Immobilization may also involve a combination of covalent and
non-
covalent interactions.
In general, the probes are attached to the biochip in a wide variety of ways,
as will be
appreciated by those in the art. As described herein, the nucleic acids can
either be
synthesized first, with subsequent attachment to the biochip, or can be
directly synthesized
on the biochip. '
The biochip comprises a suitable solid substrate. By "substrate" or "solid
support" or other
grammatical equivalents herein is meant any material that can be modified to
contain
discrete individual sites appropriate for the attachment or association of the
nucleic acid
probes and is amenable to at least one detection method. As will be
appreciated by those in
the art, the number of possible substrates are very large, and include, but
are not limited to,
glass and modified or functionalized glass, plastics (including acrylics,
polystyrene and
copolymers of styrene and other materials, polypropylene, polyethylene,
polybutylene,
polyurethanes, TefIonJ, etc.), polysaccharides, nylon or nitrocellulose,
resins, silica or
silica-based materials including silicon and modified silicon, carbon, metals,
inorganic
glasses, plastics, etc. In general, the substrates allow optical detection and
do not
appreciably fluorescese. A preferred substrate is described in PCT publication
WO
00/55621, herein incorporated by reference in its entirety.
Generally the substrate is planar, although as will be appreciated by those in
the art, other
configurations of substrates may be used as well. For example, the probes may
be placed
on the inside surface of a tube, for flow-through sample analysis to minimize
sample volume.
Similarly, the substrate may be flexible, such as a flexible foam, including
closed cell foams
made of particular plastics.
In a preferred embodiment, the surface of the biochip and the probe may be
derivatized with
chemical functional groups for subsequent attachment of the two. Thus, for
example, the
biochip is derivatized with a chemical functional group including, but not
limited to, amino
groups, carboxy groups, oxo groups and thiol groups, with amino groups being
particularly
preferred. Using these functional groups, the probes can be attached using
functional
groups on the probes. For example, nucleic acids containing amino groups can
be attached
to surfaces comprising amino groups, for example using linkers as are known in
the art; for
example, homo-or hetero-bifunctional linkers as are well known (see 1994
Pierce Chemical
Company catalog, technical section on cross-linkers, pages 155-200,
incorporated herein by
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
reference). In addition, in some cases, additional linkers, such as alkyl
groups (including
substituted and heteroalkyl groups) may be used.
In this embodiment, the oligonucleotides are synthesized as is known in the
art, and then
attached to the surface of the solid support. As will be appreciated by those
skilled in the art,
either the 5' or 3' terminus may be attached to the solid support, or
attachment may be via
an internal nucleoside.
In an additional embodiment, the immobilization to the solid support may be
very strong, yet
non-covalent. For example, biotinylated oligonucleotides can be made, which
bind to
surfaces covalently coated with streptavidin, resulting in attachment.
Alternatively, the oligonucleotides may be synthesized on the surface, as is
known in the art.
For example, photoactivation techniques utilizing photopolymerization
compounds and
techniques are used. In a preferred embodiment, the nucleic acids can be
synthesized in
situ, using well known photolithographic techniques, such as those described
in WO
95/25116; WO 95/35505; U.S. Patent Nos. 5,700,637 and 5,445,934; and
references cited
within, all of which are expressly incorporated by reference; these methods of
attachment
form the basis. of the Affimetrix GeneChipT"" technology.
In a preferred embodiment, differentially expressed nucleic acids encoding
differentially
expressed proteins are used to make a variety of expression vectors to express
differentially
expressed proteins which can then be used in screening assays, as described
below. The
expression vectors may be either self-replicating extrachromosomal vectors or
vectors which
integrate into a host genome. Generally, these expression vectors include
transcriptional
and translational regulatory nucleic acid operably linked to the nucleic acid
encoding the
differentially expressed protein. The term "control sequences" refers to DNA
sequences
necessary for the expression of an operably linked coding sequence in a
particular host
organism. The control sequences that are suitable for prokaryotes, for
example, include a
promoter, optionally an operator sequence, and a ribosome binding site.
Eukaryotic cells
are known to utilize promoters, polyadenylation signals, and enhancers.
Nucleic acid is "operably linked" when it is placed into a functional
relationship with another
nucleic acid sequence. For example, DNA for a presequence or secretory leader
is operably
linked to DNA for a polypeptide if it is expressed as a preprotein that
participates in the
secretion of the polypeptide; a promoter or enhancer is operably linked to a
coding sequence
if it affects the transcription of the sequence; or a ribosome binding site is
operably linked to
a coding sequence if it is positioned so as to facilitate translation.
Generally, "operably
linked" means that the DNA sequences being linked are contiguous, and, in the
case of a
21
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
secretory leader, contiguous and in reading phase. However, enhancers do not
have to be
contiguous. Linking is accomplished by ligation at convenient restriction
sites. If such sites
do not exist, the synthetic oligonucleotide adaptors or linkers are used in
accordance with
conventional practice. The transcriptional and translational regulatory
nucleic acid will
generally be appropriate to the host cell used to express the differentially
expressed protein;
for example, transcriptional and translational regulatory nucleic acid
sequences from Bacillus
are preferably used to express the differentially expressed protein in
Bacillus. Numerous
types of appropriate expression vectors, and suitable regulatory sequences are
known in the
art for a variety of host cells.
In general, the transcriptional and translational regulatory sequences may
include, but are
not limited to, promoter sequences, ribosomal binding sites, transcriptional
start and stop
sequences, translational start and stop sequences, and enhancer or activator
sequences. In
a preferred embodiment, the regulatory sequences include a promoter and
transcriptional
start and stop sequences.
Promoter sequences encode either constitutive or inducible promoters. The
promoters may
be either naturally occurring promoters or hybrid promoters. Hybrid promoters,
which
combine elements of more than one promoter, are also known in the art, and are
useful in
the present invention.
In addition, the expression vector may comprise additional elements. For
example, the
expression vector may have two replication systems, thus allowing it to be
maintained in two
organisms, for example in mammalian or insect cells for expression and in a
procaryotic
host for cloning and amplification. Furthermore, for integrating expression
vectors, the
expression vector contains at least one sequence homologous to the host cell
genome, and
preferably two homologous sequences which flank the expression construct. The
integrating vector may be directed to a specific locus in the host cell by
selecting the
appropriate homologous sequence for inclusion in the vector. Constructs for
integrating
vectors are well known in the art.
In addition, in a preferred embodiment, the expression vector contains a
selectable marker
gene to allow the selection of transformed host cells. Selection genes are
well known in the
art and will vary with the host cell used.
The differentially expressed proteins of the present invention are produced by
culturing a
host cell transformed with an expression vector containing nucleic acid
encoding a
differentially expressed protein, under the appropriate conditions to induce
or cause
expression of the differentially expressed protein. The conditions appropriate
for
22
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
differentially expressed protein expression will vary with the choice of the
expression vector
and the host cell, and will be easily ascertained by one skilled in the art
through routine
experimentation. For example, the use of constitutive promoters in the
expression vector
will require optimizing the growth and proliferation of the host cell, while
the use of an
inducible promoter requires the appropriate growth conditions for induction.
In addition, in
some embodiments, the timing of the harvest is important. For example, the
baculoviral
systems used in insect cell expression are lytic viruses, and thus harvest
time selection can
be crucial for product yield.
Appropriate host cells include yeast, bacteria, archaebacteria, fungi, and
insect and animal
cells, including mammalian cells. Of particular interest are Drosophila
melangaster cells,
Saccharomyces cerevisiae and other yeasts, E. coli, Bacillus subtilis, Sf9
cells, C129 cells,
293 cells, Neurospora, BHK, CHO, COS, HeLa cells, THP1 cell line (a macrophage
cell line)
and human cells and cell lines.
In a preferred embodiment, the differentially expressed proteins are expressed
in
mammalian cells. Mammalian expression systems are also known in the art, and
include
retroviral systems. A preferred expression vector system is a retroviral
vector system such
as is generally described in PCT/US97/01019 and PCT/US97/01048, both of which
are
hereby expressly incorporated by reference. Of particular use as mammalian
promoters are
the promoters from mammalian viral genes, since the viral genes are often
highly expressed
and have a broad host range. Examples include the SV40 early promoter, mouse
mammary
tumor virus LTR promoter, adenovirus major late promoter, herpes simplex virus
promoter,
and the CMV promoter. Typically, transcription termination and polyadenylation
sequences
recognized by mammalian cells are regulatory regions located 3' to the
translation stop
codon and thus, together with the promoter elements, flank the coding
sequence. Examples
of transcription terminator and polyadenlytion signals include those derived
form SV40.
The methods of introducing exogenous nucleic acid into mammalian hosts, as
well as other
hosts, is well known in the art, and will vary with the host cell used.
Techniques include
dextran-mediated transfection, calcium phosphate precipitation, polybrene
mediated
transfection, protoplast fusion, electroporation, viral infection,
encapsulation of the
polynucleotide(s) in liposomes, and direct microinjection of the DNA into
nuclei.
In a preferred embodiment, differentially expressed proteins are expressed in
bacterial
systems. Bacterial expression systems are well known in the art. Promoters
from
bacteriophage may also be used and are known in the art. In addition,
synthetic promoters
and hybrid promoters are also useful; for example, the tac promoter is a
hybrid of the trp and
lac promoter sequences. Furthermore, a bacterial promoter can include
naturally occurring
23
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
promoters of non-bacterial origin that have the ability to bind bacterial RNA
polymerase and
initiate transcription. In addition to a functioning promoter sequence, an
efficient ribosome
binding site is desirable. The expression vector may also include a signal
peptide sequence
that provides for secretion of the differentially expressed protein in
bacteria. The protein is
either secreted into the growth media (gram-positive bacteria) or into the
periplasmic space,
located between the inner and outer membrane of the cell (gram-negative
bacteria). The
bacterial expression vector may also include a selectable marker gene to allow
for the
selection of bacterial strains that have been transformed. Suitable selection
genes include
genes which render the bacteria resistant to drugs such as. ampicillin,
chloramphenicol,
erythromycin, kanamycin, neomycin and tetracycline. Selectable markers also
include
biosynthetic genes, such as those in the histidine, tryptophan and leucine
biosynthetic
pathways. These components are assembled into expression vectors. Expression
vectors
for bacteria are well known in the art, and include vectors for Bacillus
subtilis, E. coli,
Streptococcus cremoris, and Streptococcus lividans, among others. The
bacterial
expression vectors are transformed into bacterial host cells using techniques
well known in
the art, such as calcium chloride treatment, electroporation, and others.
In one embodiment, differentially expressed proteins are produced in insect
cells.
Expression vectors for the transformation of insect cells, and in particular,
baculovirus-based
expression vectors, are well known in the art.
In a preferred embodiment, differentially expressed protein is produced in
yeast cells. Yeast
expression systems are well known in the art, and include expression vectors
for
Saccharomyces cerevisiae, Candida albicans and C. maltosa, Hansenula
polymorpha,
Kluyveromyces fragilis and K. lactis, Pichia guillerimondii and P. pastoris,
Schizosaccharomyces pombe, and Yarrowia lipolytica.
The differentially expressed protein may also be made as a fusion protein,
using techniques
well known in the art. Thus, for example, for the creation of monoclonal
antibodies, if the
desired epitope is small, the differentially expressed protein may be fused to
a carrier protein
to form an immunogen. Alternatively, the differentially expressed protein may
be made as a
fusion protein to increase expression, or for other reasons. For example, when
the
differentially expressed protein is a differentially expressed peptide, the
nucleic acid
encoding the peptide may be linked to other nucleic acid for expression
purposes.
In one embodiment, the differentially expressed nucleic acids, proteins and
antibodies of the
invention are labeled. By "labeled" herein is meant that a compound has at
least one
element, isotope or chemical compound attached to enable the detection of the
compound.
In general, labels fall into three classes: a) isotopic labels, which may be
radioactive or
24
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
heavy isotopes; b) immune labels, which may be antibodies or antigens; and c)
colored or
fluorescent dyes. The labels may be incorporated into the differentially
expressed nucleic
acids, proteins and antibodies at any position. For example, the label should
be capable of
producing, either directly or indirectly, a detectable signal. The detectable
moiety may be a
radioisotope, such as 3H,'4C, 32P, 355, or'~51, a fluorescent or
chemiluminescent compound,
such as fluorescein isothiocyanate, rhodamine, or luciferin, or an enzyme,
such as alkaline
phosphatase, beta-galactosidase or horseradish peroxidase. Any method known in
the art
for conjugating the antibody to the label may be employed, including those
methods
described by Hunter et al., Nature, 144:945 (1962); David et al.,
Biochemistry, 13:1014
(1974); Pain et al., J. Immunol. Meth., 40:219 (1981); and Nygren, J.
Histochem. and
Cytochem., 30:407 (1982).
Accordingly, the present invention also provides differentially expressed
protein sequences.
A difFerentially expressed protein of the present invention may be identified
in several ways.
"Protein" in this sense includes proteins, polypeptides, and peptides. As will
be appreciated
by those in the art, the nucleic acid sequences of the invention can be used
to generate
protein sequences. There are a variety of ways to do this, including cloning
the entire gene
and verifying its frame and amino acid sequence, or by comparing it to known
sequences to
search for homology to provide a frame, assuming the differentially expressed
protein has
homology to some protein in the database being used. Generally, the nucleic
acid
sequences are input into a program that will search all three frames for
homology. This is
done in a preferred embodiment using the following NCBI Advanced BLAST
parameters.
The program is blastx or blastn. The database is nr. The input data is as
"Sequence in
FASTA format". The organism list is "none". The "expect" is 10; the filter is
default. The
"descriptions" is 500, the "alignments" is 500, and the "alignment view" is
pairwise. The
"Query Genetic Codes" is standard (1 ). The matrix is BLOSUM62; gap existence
cost is 11,
per residue gap cost is 1; and the lambda ratio is .85 default. This results
in the generation
of a putative protein sequence.
Also included within one embodiment of differentially expressed proteins are
amino acid
variants of the naturally occurring sequences, as determined herein.
Preferably, the variants
are preferably greater than about 75% homologous to the wild-type sequence,
more
preferably greater than about 80%, even more preferably greater than about 85%
and most
preferably greater than 90%. In some embodiments the homology will be as high
as about
93 to 95 or 98%. As for nucleic acids, homology in this context means sequence
similarity
or identity, with identity being preferred. This homology will be determined
using standard
techniques known in the art as are outlined above for the nucleic acid
homologies.
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
Differentially expressed proteins of the present invention may be shorter or
longer than the
wild type amino acid sequences. Thus, in a preferred embodiment, included
within the
definition of differentially expressed proteins are portions or fragments of
the wild type
sequences. herein. In addition, as outlined above, the differentially
expressed nucleic acids
of the invention may be used to obtain additional coding regions, and thus
additional protein
sequence, using techniques known in the art.
In a preferred embodiment, the differentially expressed proteins are
derivative or variant
differentially expressed proteins as compared to the wild-type sequence. That
is, as outlined
more fully below, the derivative differentially expressed peptide will contain
at least one
amino acid substitution, deletion or insertion, with amino acid substitutions
being particularly
preferred. The amino acid substitution, insertion or deletion may occur at any
residue within
the differentially expressed peptide.
Also included in an embodiment of differentially expressed proteins of the
present invention
are amino acid sequence variants. These variants fall into one or more of
three classes:
substitutional, insertional or deletional variants. These variants ordinarily
are prepared by
site specific mutagenesis of nucleotides in the DNA encoding the
differentially expressed
protein, using cassette or PCR mutagenesis or other techniques well known in
the art, to
produce DNA encoding the variant, and thereafter expressing the DNA in
recombinant cell
culture as outlined above. However, variant differentially expressed protein
fragments
having up to about 100-150 residues may be prepared by in vitro synthesis
using established
techniques. Amino acid sequence variants are characterized by the
predetermined nature of
the variation, a feature that sets them apart from naturally occurring allelic
or interspecies
variation of the differentially expressed protein amino acid sequence. The
variants typically
exhibit the same qualitative biological activity as the naturally occurring
analogue, although
variants can also be selected which have modified characteristics as will be
more fully
outlined below.
While the site or region for introducing an amino acid sequence variation is
predetermined,
the mutation per se need not be predetermined. For example, in order to
optimize the
performance of a mutation at a given site, random mutagenesis may be conducted
at the
target codon or region and the expressed differentially expressed variants
screened for the
optimal combination of desired activity. Techniques for making substitution
mutations at
predetermined sites in DNA having a known sequence are well known, for
example, M13
primer mutagenesis and PCR mutagenesis. Screening of the mutants is done using
assays
of differentially expressed protein activities.
26
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
Amino acid substitutions are typically of single residues; insertions usually
will be on the
order of from about 1 to 20 amino acids, although considerably larger
insertions may be
tolerated. Deletions range from about 1 to about 20 residues, although in some
cases
deletions may be much larger.
Substitutions, deletions, insertions or any combination thereof may be used to
arrive at a
final derivative. Generally these changes are done on a few amino acids to
minimize the
alteration of the molecule. However, larger changes may be tolerated in
certain
circumstances. When small alterations in the characteristics of the
differentially expressed
protein are desired, substitutions are generally made in accordance with the
following chart:
Chart I
Original Residue Exemplary Substitutions
Ala Ser
Arg Lys
Asn Gln, His
Asp Glu
Cys Ser
Gln Asn
Glu Asp
Gly Pro
His Asn, Gln
Ile Leu, Val
Leu Ile, Val
Lys Arg, Gln, Glu
Met Leu, Ile
Phe Met, Leu, Tyr
Ser Thr
Thr Ser
Trp Tyr
Tyr Trp, Phe
Val Ile, Leu
Substantial changes in function or immunological identity are made by
selecting substitutions
that are less conservative than those shown in Chart I. For example,
substitutions may be
made which more significantly affect: the structure of the polypeptide
backbone in the area
of the alteration, for example the alpha-helical or beta-sheet structure; the
charge or
hydrophobicity of the molecule at the target site; or the bulk of the side
chain. The
substitutions which in general are expected to produce the greatest changes in
the
polypeptide's properties are those in which (a) a hydrophilic residue, e.g.
seryl or threonyl is
substituted for (or by) a hydrophobic residue, e.g. leucyl, isoleucyl,
phenylalanyl, valyl or
alanyl; (b) a cysteine or proline is substituted for (or by) any other
residue; (c) a residue
having an electropositive side chain, e.g. lysyl, arginyl, or histidyl, is
substituted for (or by) an
electronegative residue, e.g. glutamyl or aspartyl; or (d) a residue having a
bulky side chain,
e.g. phenylalanine, is substituted for (or by) one not having a side chain,
e.g. glycine.
27
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
The variants typically exhibit the same qualitative biological activity and
will elicit the same
immune response as the naturally-occurring analogue, although variants also
are selected to
modify the characteristics of the differentially expressed proteins as needed.
Alternatively,
the variant may be designed such that the biological activity of the
differentially expressed
protein is altered. For example, glycosylation sites may be altered or
removed.
Covalent modifications of differentially expressed polypeptides are included
within the scope
of this invention. One type of covalent modification includes reacting
targeted amino acid
residues of a differentially expressed polypeptide with an organic
derivatizing agent that is
capable of reacting with selected side chains or the N-or C-terminal residues
of a
differentially expressed polypeptide. Derivatization with bifunctional agents
is useful, for
instance, for crosslinking differentially expressed to a water-insoluble
support matrix or
surface for use in the method for purifying anti-differentially expressed
antibodies or
screening assays, as is more fully described below. Commonly used crosslinking
agents
include, e.g., 1,1-bis(diazoacetyl)-2-phenylethane, glutaraldehyde, N-
hydroxysuccinimide
esters, for example, esters with 4-azidosalicylic acid, homobifunctional
imidoesters, including
disuccinimidyl esters such as 3,3'-dithiobis(succinimidylpropionate),
bifunctional maleimides
such as bis-N-maleimido-1,8-octane and.agents such as methyl-3-[(p-
azidophenyl)-
dithio]propioimidate.
Other modifications include deamidation of glutaminyl and asparaginyl residues
to the
corresponding glutamyl and aspartyl residues, respectively, hydroxylation of
proline and
lysine, phosphorylation of hydroxyl groups of seryl, threonyl or tyrosyl
residues, methylation
of the a-amino groups of lysine, arginine, and histidine side chains [T.E.
Creighton, Proteins:
Structure and Molecular Properties, W.H. Freeman & Co., San Francisco, pp. 79-
86 (1983)],
acetylation of the N-terminal amine, and amidation of any C-terminal carboxyl
group.
Another type of covalent modification of the differentially expressed
polypeptide included
within the scope of this invention comprises altering the native glycosylation
pattern of the
polypeptide. "Altering the native glycosylation pattern" is intended for
purposes herein to
mean deleting one or more carbohydrate moieties found in native sequence
differentially
expressed polypeptide, and/or adding one or more glycosylation sites that are
not present in
the native sequence differentially expressed polypeptide.
Addition of glycosylation sites to differentially expressed polypeptides may
be accomplished
by altering the amino acid sequence thereof. The alteration may be made, for
example, by
the addition of, or substitution by, one or more serine or threonine residues
to the native
sequence differentially expressed polypeptide (for O-linked glycosylation
sites). The
differentially expressed amino acid sequence may optionally be altered through
changes at
28
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
the DNA level, particularly by mutating the DNA encoding the difFerentially
expressed
polypeptide at preselected bases such that codons are generated that will
translate into the
desired amino acids.
Another means of increasing the number of carbohydrate moieties on the
differentially
expressed polypeptide is by chemical or enzymatic coupling of glycosides to
the polypeptide.
Such methods are described in the art, e.g., in WO 87/05330 published 11
September 1987,
and in Apliri and Wriston, differentially expressed Crit. Rev. Biochem., pp.
259-306 (1981).
Removal of carbohydrate moieties present on the differentially expressed
polypeptide may
be accomplished chemically or enzymatically or by mutational substitution of
codons
encoding for amino acid residues that serve as targets for glycosylation.
Chemical
deglycosylation techniques are known in the art and described, for instance,
by Hakimuddin,
et al., Arch. Biochem. Biophys., 259:52 (1987) and by Edge et al., Anal.
Biochem., 118:131
(1981 ). Enzymatic cleavage of carbohydrate moieties on polypeptides can be
achieved by
the use of a variety of endo-and exo-glycosidases as described by Thotakura et
al., Meth.
Enzymol., 138:350 (1987).
Another type of covalent modification of differentially expressed comprises
linking the
differentially expressed polypeptide to one of a variety of nonproteinaceous
polymers, e.g.,
polyethylene glycol, polypropylene glycol, or polyoxyalkylenes, in the manner
set forth in U.S.
Patent Nos. 4,640,835; 4,496,689; 4,301,144; 4,670,417; 4,791,192 or
4,179,337.
Differentially expressed polypeptides of the present invention may also be
modified in a way
to form chimeric molecules comprising a differentially expressed polypeptide
fused to
another, heterologous polypeptide or amino acid sequence. In one embodiment,
such a
chimeric molecule comprises a fusion of a differentially expressed polypeptide
with a tag
polypeptide which provides an epitope to which an anti-tag antibody can
selectively bind.
The epitope tag is generally placed at the amino-or carboxyl-terminus of the
differentially
expressed polypeptide. The presence of such epitope-tagged forms of a
differentially
expressed polypeptide can be detected using an antibody against the tag
polypeptide. Also,
provision of the epitope tag enables the differentially expressed polypeptide
to be readily
purified by affinity purification using an anti-tag antibody or another type
of affinity matrix that
binds to the epitope tag. In an alternative embodiment, the chimeric molecule
may
comprise a fusion of a differentially expressed polypeptide with an
immunoglobulin or a
particular region of an immunoglobulin. For a bivalent form of the chimeric
molecule, such a
fusion could be to the Fc region of an IgG molecule.
29
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
Various tag polypeptides and their respective antibodies are well known in the
art.
Examples include poly-histidine (poly-his) or poly-histidine-glycine (poly-his-
gly) tags; the flu
HA tag polypeptide and its antibody 12CA5 [Field et al., Mol. Cell. Biol.,
8:2159-2165 (1988)];
the c-myc tag and the 8F9, 3C7, 6E10, G4, B7 and 9E10 antibodies thereto [Evan
et al.,
Molecular and Cellular Biology, 5:3610-3616 (1985)]; and the Herpes Simplex
virus
glycoprotein D (gD) tag and its antibody [Paborsky et al., Protein
Engineering, 3(6):547-553
(1990)]. Other tag polypeptides include the Flag-peptide [Hopp et al.,
BioTechnology,
6:1204-1210 (1988)]; the KT3 epitope peptide [Martin et al., Science, 255:192-
194 (1992)];
tubulin epitope peptide [Skinner et al., J. Biol. Chem., 266:15163-15166 (1991
)]; and the T7
gene 10 protein peptide tag [Lutz-Freyermuth et al., Proc. Natl. Acad. Sci.
USA, 87:6393-
6397 (1990)].
Also included with the definition of differentially expressed protein in one
embodiment are
other differentially expressed proteins of the differentially expressed
family, and differentially
expressed proteins from other organisms, which are cloned and expressed as
outlined
below. Thus, probe or degenerate polymerase chain reaction (PCR) primer
sequences may
be used to find other related differentially expressed proteins from humans or
other
organisms. As will be appreciated by those in the art, particularly useful
probe and/or PCR
primer sequences include the unique areas of the differentially expressed
nucleic acid
sequence. As is generally known in the art, preferred PCR primers are from
about 15 to
about 35 nucleotides in length, with from about 20 to about 30 being
preferred, and may
contain inosine as needed. The conditions for the PCR reaction are well known
in the art.
In addition, as is outlined herein, differentially expressed proteins can be
made that are
longer than those depicted in the figures, for example, by the elucidation of
additional
sequences, the addition of epitope or purification tags, the addition of other
fusion
sequences, etc.
Differentially expressed proteins may also be identified as being encoded by
differentially
expressed nucleic acids. Thus, differentially expressed proteins are encoded
by nucleic
acids that will hybridize to the sequences of the sequence listings, or their
complements, as
outlined herein.
In a preferred embodiment, when the differentially expressed protein is to be
used to
generate antibodies, for example for immunotherapy, the differentially
expressed protein
should share at least one epitope or determinant with the full length protein.
By "epitope" or
"determinant" herein is meant a portion of a protein which will generate
and/or bind an
antibody or T-cell receptor in the context of MHC. Thus, in most instances,
antibodies made
to a smaller differentially expressed protein will be able to bind to the full
length protein. In a
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
preferred embodiment, the epitope is unique; that is, antibodies generated to
a unique
epitope show little or no cross-reactivity.
In one embodiment, the term "antibody" includes antibody fragments, as are
known in the
art, including Fab, Fab2, single chain antibodies (Fv for example), chimeric
antibodies, etc.,
either produced by the modification of whole antibodies or those synthesized
de novo using
recombinant DNA technologies.
Methods of preparing polyclonal antibodies are known to the skilled artisan.
Polyclonal
antibodies can be raised in a mammal, for example, by one or more injections
of an
immunizing agent and, if desired, an adjuvant. Typically, the immunizing agent
and/or
adjuvant will be injected in the mammal by multiple subcutaneous or
intraperitoneal
injections. The immunizing agent may include CHA4 or CBKB, or fragment thereof
or a
fusion protein thereof. It may be useful to conjugate the immunizing agent to
a protein
known to be immunogenic in the mammal being immunized. Examples of such
immunogenic proteins include but are not limited to keyhole limpet hemocyanin,
serum
albumin, bovine thyroglobulin, and soybean trypsin inhibitor. Examples of
adjuvants which
may be employed include Freund's complete adjuvant and MPL-TDM adjuvant
(monophosphoryl Lipid A, synthetic trehalose dicorynomycolate). The
immunization protocol
may be selected by one skilled in the art without undue experimentation.
The antibodies may, alternatively, be monoclonal antibodies. Monoclonal
antibodies may be
prepared using hybridoma methods, such as those described by Kohler and
Milstein,
Nature, 256:495 (1975). In a hybridoma method, a mouse, hamster, or other
appropriate
host animal, is typically immunized with an immunizing agent to elicit
lymphocytes that
produce or are capable of producing antibodies that will specifically bind to
the immunizing
agent. Alternatively, the lymphocytes may be immunized in vitro. The
immunizing agent will
typically include the CHA4 or CBK8 polypeptide, or fragment thereof or a
fusion protein
thereof. Generally, either peripheral blood lymphocytes ("PBLs") are used if
cells of human
origin are desired, or spleen cells or lymph node cells are used if non-human
mammalian
sources are desired. The lymphocytes are then fused with an immortalized cell
line using a
suitable fusing agent, such as polyethylene glycol, to form a hybridoma cell
[coding,
Monoclonal Antibodies: Principles and Practice, Academic Press, (1986) pp. 59-
103].
Immortalized cell lines are usually transformed mammalian cells, particularly
myeloma cells
of rodent, bovine and human origin. Usually, rat or mouse myeloma cell lines
are employed.
The hybridoma cells may be cultured in a suitable culture medium that
preferably contains
one or more substances that inhibit the growth or survival of the unfused,
immortalized cells.
For example, if the parental cells lack the enzyme hypoxanthine guanine
phosphoribosyl
transferase (HGPRT or HPRT), the culture medium for the hybridomas typically
will include
31
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
hypoxanthine, aminopterin, and thymidine ("HAT medium"), which substances
prevent the
growth of HGPRT-deficient cells.
In one embodiment, the antibodies are bispecific antibodies. Bispecific
antibodies are
monoclonal, preferably human or humanized, antibodies that have binding
specificities for at
least two different antigens. In the present case, one of the binding
specificities is for the
CHA4 or CBKB, or a fragment thereof, the other one is for any other antigen,
and preferably
for a cell-surface protein or receptor or receptor subunit, preferably one
that is tumor
specific.
In a preferred embodiment, the antibodies to differentially expressed are
capable of reducing
or eliminating the biological function of differentially expressed, as is
described below. That
is, the addition of anti-differentially expressed antibodies (either
polyclonal or preferably
monoclonal) to differentially expressed (or cells containing differentially
expressed) may
reduce or eliminate the differentially expressed activity. Generally, at least
a 25% decrease
in activity is preferred, with at least about 50% being particularly preferred
and about a 95-
100% decrease being especially preferred.
In a preferred embodiment the antibodies to the differentially expressed
proteins are
humanized antibodies. Humanized forms of non-human (e.g., murine) antibodies
are
chimeric molecules of immunoglobulins, immunoglobulin chains or fragments
thereof (such
as Fv, Fab, Fab', F(ab')2 or other antigen-binding subsequences of antibodies)
which contain
minimal sequence derived from non-human immunoglobulin. Humanized antibodies
include
human immunoglobulins (recipient antibody) in which residues form a
complementary
determining region (CDR) of the recipient are replaced by residues from a CDR
of a
non-human species (donor antibody) such as mouse, rat or rabbit having the
desired
specificity, affinity and capacity. In some instances, Fv framework residues
of the human
immunoglobulin are replaced by corresponding non-human residues. Humanized
antibodies
may also comprise residues which are found neither in the recipient antibody
nor in the
imported CDR or framework sequences. In general, the humanized antibody will
comprise
substantially all of at least one, and typically two, variable domains, in
which all or
substantially all of the CDR regions correspond to those of a non-human
immunoglobulin
and all or substantially all of the FR regions are those of a human
immunoglobulin
consensus sequence. The humanized antibody optimally also will comprise at
least a
portion of an immunoglobulin constant region (Fc), typically that of a human
immunoglobulin
[Jones et al., Nature, 321:522-525 (1986); Riechmann et al., Nature, 332:323-
329 (1988);
and Presta, Curr. 0a. Struct. Biol., 2:593-596 (1992)].
32
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
Methods for humanizing non-human antibodies are well known in the art.
Generally, a
humanized antibody has one or more amino acid residues introduced into it from
a source
which is non-human. These non-human amino acid residues are often referred to
as import
residues, which are typically taken from an import variable domain.
Humanization can be
essentially performed following the method of Winter and co-workers [Jones et
al., Nature,
321:522-525 (1986); Riechmann et al., Nature, 332:323-327 (1988); Verhoeyen et
al.,
Science, 239:1534-1536 (1988)], by substituting rodent CDRs or CDR sequences
for the
corresponding sequences of a human antibody. Accordingly, such humanized
antibodies
are chimeric antibodies (U.S. Patent No. 4,816,567), wherein substantially
less than an
intact human variable domain has been substituted by the corresponding
sequence from a
non-human species. In practice, humanized antibodies are typically human
antibodies in
which some CDR residues and possibly some FR residues are substituted by
residues from
analogous sites in rodent antibodies.
Human antibodies can also be produced using various techniques known in the
art,
including phage display libraries [Hoogenboom and Winter, J. Mol. Biol.,
227:381 (1991 );
Marks et al., J. Mol. Biol., 222:581 (1991 )]. The techniques of Cole et al.
and Boerner et al.
are also available for the preparation of human monoclonal antibodies (Cole et
al.,
Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985) and
Boerner et al., J.
Immunol., 147 1 :86-95 (1991 )]. Similarly, human antibodies can be made by
introducing of
human immunoglobulin loci into transgenic animals, e.g., mice in which the
endogenous
immunoglobulin genes have been partially or completely inactivated. Upon
challenge,
human antibody production is observed, which closely resembles that seen in
humans in all
respects, including gene rearrangement, assembly, and antibody repertoire.
This approach
is described, for example, in U.S. Patent Nos. 5,545,807; 5,545,806;
5,569,825; 5,625,126;
5,633,425; 5,661,016, and in the following scientific publications: Marks et
al.,
Bio/Technoloay 10, 779-783 (1992); Lonberg et al., Nature 368 856-859 (1994);
Morrison,
Nature 368, 812-13 (1994); Fishwild et al., Nature Biotechnoloay 14, 845-51
(1996);
Neuberger, Nature Biotechnolocty 14, 826 (1996); Lonberg and Huszar, Intern.
Rev.
Immunol. 13 65-93 (1995).
By immunotherapy is meant treatment of cancer with an antibody raised against
differentially
expressed proteins. As used herein, immunotherapy can be passive or active.
Passive
immunotherapy as defined herein is the passive transfer of antibody to a
recipient (patient).
Active immunization is the induction of antibody and/or T-cell responses in a
recipient
(patient). Induction of an immune response is the result of providing the
recipient with an
antigen to which antibodies are raised. As appreciated by one of ordinary
skill in the art, the
antigen may be provided by injecting a polypeptide against which antibodies
are desired to
33
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
be raised into a recipient, or contacting the recipient with a nucleic acid
capable of
expressing the antigen and under conditions for expression of the antigen.
In a preferred embodiment the differentially expressed proteins against which
antibodies are
raised are secreted proteins as described above. Without being bound by
theory, antibodies
used for treatment, bind and prevent the secreted protein from binding to its
receptor,
thereby inactivating the secreted differentially expressed protein.
In another preferred embodiment, the differentially expressed protein to which
antibodies are
raised is a transmembrane protein. Without being bound by theory, antibodies
used for
treatment, bind the extracellular domain of the differentially expressed
protein and prevent it
from binding to other proteins, such as circulating ligands or cell-associated
molecules. The
antibody may cause down-regulation of the transmembrane differentially
expressed protein.
As will be appreciated by one of ordinary skill in the art, the antibody may
be a competitive,
non-competitive or uncompetitive inhibitor of protein binding to the
extracellular domain of
the differentially expressed protein. The antibody is also an antagonist of
the differentially
expressed protein. Further, the antibody prevents activation of the
transmembrane
differentially expressed protein. In one aspect, when the antibody prevents
the binding of
other molecules to the differentially expressed protein, the antibody prevents
growth of the
cell. The antibody also sensitizes the cell to cytotoxic agents, including,
but not limited to
TNF-a, TNF-b, !L-1, INF-g and 1L-2, or chemotherapeutic agents including 5FU,
vinblastine,
actinomycin D, cisplatin, methotrexate, and the like. In some instances the
antibody belongs
to a sub-type that activates serum complement when complexed with the
transmembrane
protein thereby mediating cytotoxicity. Thus, differentially expressed is
treated by
administering to a patient.antibodies directed against the transmembrane
differentially
expressed protein.
In another preferred embodiment, the antibody is conjugated to a therapeutic
moiety. In one
aspect the therapeutic moiety is a small molecule that modulates the activity
of the
differentially expressed protein. In another aspect the therapeutic moiety
modulates the
activity of molecules associated with or in close proximity to the
differentially expressed
protein. The therapeutic moiety may inhibit enzymatic activity such as
protease or protein
kinase activity associated with cancer.
In a preferred embodiment, the therapeutic moiety may also be a cytotoxic
agent. In this
method, targeting the cytotoxic agent to tumor tissue or cells, results in a
reduction in the
number of afflicted cells, thereby reducing symptoms associated with cancer.
Cytotoxic
agents are numerous and varied and include, but are not limited to, cytotoxic
drugs or toxins
or active fragments of such toxins. Suitable toxins and their corresponding
fragments
34
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
include diptheria A chain, exotoxin A chain, ricin A chain, abrin A chain,
curcin, crotin,
phenomycin, enomycin and the like. Cytotoxic agents also include
radiochemicals made by
conjugating radioisotopes to antibodies raised against differentially
expressed proteins, or
binding of a radionuclide to a chelating agent that has been covalently
attached to the
antibody. Targeting the therapeutic moiety to transmembrane differentially
expressed
proteins not only serves to increase the local concentration of therapeutic
moiety in the
differentially expressed afflicted area, but also serves to reduce deleterious
side effects that
may be associated with the therapeutic moiety.
In another preferred embodiment, the PC protein against which the antibodies
are raised is
an intracellular protein. In this case, the antibody may be conjugated to a
protein which
facilitates entry into the cell. In one case, the antibody enters the cell by
endocytosis. In
another embodiment, a nucleic acid encoding the antibody is administered to
the individual
or cell. Moreover, wherein the PC protein can be targeted within a cell, i.e.,
the nucleus, an
antibody thereto contains a signal for that target localization, i.e., a
nuclear localization
signal.
The differentially expressed antibodies of the invention specifically bind to
differentially
expressed proteins. By "specifically bind" herein is meant that the antibodies
bind to the
protein with a biriding constant in the range of at least 10~- 10-6 M-', with
a preferred range
being 10-' -10-9 M-'.
In a preferred embodiment, the differentially expressed protein is purified or
isolated after
expression. Differentially expressed proteins may be isolated or purified in a
variety of ways
known to those skilled in the art depending on what other components are
present in the
sample. Standard purification methods include electrophoretic, molecular,
immunological
and chromatographic techniques, including ion exchange, hydrophobic, affinity,
and reverse-
phase HPLC chromatography, and chromatofocusing. For example, the
differentially
expressed protein may be purified using a standard anti-differentially
expressed antibody
column. Ultrafiltration and diafiltration techniques, in conjunction with
protein concentration,
are also useful. For general guidance in suitable purification techniques, see
Scopes, R.,
Protein Purification, Springer-Verlag, NY (1982). The degree of purification
necessary will
vary depending on the use of the differentially expressed protein. In some
instances no
purification will be necessary.
Once expressed and purified if necessary, the differentially expressed
proteins and nucleic
acids are useful in a number of applications.
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
In one aspect, the expression levels of genes are determined for different
cellular states in
the cancer phenotype; that is, the expression levels of genes in normal tissue
and in cancer
tissue (and in some cases, for varying severities of cancer that relate to
prognosis, as
outlined below) are evaluated to provide expression profiles. An expression
profile of a
particular cell state or point of development is essentially a "fingerprint"
of the state; while
two states may have any particular gene similarly expressed, the evaluation of
a number of
genes simultaneously allows the generation of a gene expression profile that
is unique to the
state of the cell. By comparing expression profiles of cells in different
states, information
regarding which genes are important (including both up- and down-regulation of
genes) in
each of these states is obtained. Then, diagnosis may be done or confirmed:
does tissue
from a particular patient have the gene expression profile of normal or cancer
tissue.
"DifFerential expression," or grammatical equivalents as used herein, refers
to both
qualitative as well as quantitative differences in the genes' temporal and/or
cellular
expression patterns within and among the cells. Thus, a differentially
expressed gene can
qualitatively have its expression altered, including an activation or
inactivation, in, for
example, normal versus, for example, cancer tissue. That is, genes may be
turned on or
turned ofF in a particular state, relative to another state. As is apparent to
the skilled artisan,
any comparison of two or more states can be made. Such a qualitatively
regulated gene will
exhibit an expression pattern within a state or cell type which is detectable
by standard
techniques in one such state or cell type, but is not detectable in both.
Alternatively, the
determination is quantitative in that expression is increased or decreased;
that is, the
expression of the gene is either upregulated, resulting in an increased amount
of transcript,
or downregulated, resulting in a decreased amount of transcript. The degree to
which
expression differs need only be large enough to quantify via standard
characterization
techniques as outlined below, such as by use of Affymetrix GeneChipT"~
expression arrays,
Lockhart, Nature Biotechnology, 14:1675-1680 (1996), hereby expressly
incorporated by
reference. Other techniques include, but are not limited to, quantitative
reverse
transcriptase PCR, Northern analysis and RNase protection. As outlined above,
preferably
the change in expression (i.e. upregulation or downregulation) is at least
about 50%, more
preferably at least about 100%, more preferably at least about 150%, more
preferably, at
least about 200%, with from 300 to at least 1000% being especially preferred.
As will be appreciated by those in the art, this may be done by evaluation at
either the gene
transcript, or the protein level; that is, the amount of gene expression may
be monitored
using nucleic acid probes to the DNA or RNA equivalent of the gene transcript,
and the
quantification of gene expression levels, or, alternatively, the final gene
product itself
(protein) can be monitored, for example through the use of antibodies to the
differentially
expressed protein and standard immunoassays (ELISAs,e tc.) or other
techniques, including
36
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
mass spectroscopy assays, 2D gel electrophoresis assays, etc. Thus, the
proteins
corresponding to breast or colorectal cancer genes, i.e. those identified as
being important in
a breast or colorectal cancer phenotype, can be evaluated in a breast or
colorectal cancer
diagnostic test.
In a preferred embodiment, gene expression monitoring is done and a number of
genes, i.e.
an expression profile, is monitored simultaneously, although multiple protein
expression
monitoring can be done as well. Similarly, these assays may be done on an
individual basis
as well.
In this embodiment, the differentially expressed nucleic acid probes are
attached to biochips
as outlined herein for the detection and quantification of differentially
expressed sequences
in a particular cell. The assays are further described below in the example.
In a preferred embodiment nucleic acids encoding the differentially expressed
protein are
detected. Although DNA or RNA encoding the differentially expressed protein
may be
detected, of particular interest are methods wherein the mRNA encoding a
differentially
expressed protein is detected. The presence of mRNA in a sample is an
indication that the
differentially expressed gene has been transcribed to form the mRNA, and
suggests that the
protein is expressed. Probes to detect the mRNA can be any
nucleotide/deoxynucleotide
probe that is complementary to and base pairs with the mRNA and includes but
is not limited
to oligonucleotides, cDNA or RNA. Probes also should contain a detectable
label, as
defined herein. In one method the mRNA is detected after immobilizing the
nucleic acid to
be examined on a solid support such as nylon membranes and hybridizing the
probe with
the sample. Following washing to remove the non-specifically bound probe, the
label is
detected. In another method detection of the mRNA is performed in situ. In
this method
permeabilized cells or tissue samples are contacted with a detectably labeled
nucleic acid
probe for sufficient time to allow the probe to hybridize with the target
mRNA. Following
washing to remove the non-specifically bound probe, the label is detected. For
example a
digoxygenin labeled riboprobe (RNA probe) that is complementary to the mRNA
encoding a
differentially expressed protein is detected by binding the digoxygenin with
an anti-
digoxygenin secondary antibody and developed with nitro blue tetrazolium and
5-bromo-4-chloro-3-indoyl phosphate.
In a preferred embodiment, any of the three classes of proteins as described
herein
(secreted, transmembrane or intracellular proteins) are used in diagnostic
assays. The
differentially expressed proteins, antibodies, nucleic acids, modified
proteins and cells
containing differentially expressed sequences are used in diagnostic assays.
This can be
done on an individual gene or corresponding polypeptide level. In a preferred
embodiment,
37
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
the expression profiles are used, preferably in conjunction with high
throughput screening
techniques to allow monitoring for expression profile genes and/or
corresponding
polypeptides.
As described and defined herein, differentially expressed proteins, including
intracellular,
transmembrane or secreted proteins, find use as markers of breast cancer and
colorectal
cancer. Detection of these proteins in putative cancer tissue of patients
allows for a
determination or diagnosis of cancer. Numerous methods known to those of
ordinary skill in
the art find use in detecting cancer. In one embodiment, antibodies are used
to detect
cancer. A preferred method separates proteins from a sample or patient by
electrophoresis
on a gel (typically a denaturing and reducing protein gel, but may be any
other type of gel
including isoelectric focusing gels and the like). Following separation of
proteins, the breast
or colorectal cancer protein is detected by immunoblotting with antibodies
raised against the
cancer protein. Methods of immunoblotting are well known to those of ordinary
skill in the
art.
In another preferred method, antibodies to the differentially expressed
protein find use in in
situ imaging techniques. In this method cells are contacted with from one to
many
antibodies to the differentially expressed protein(s). Following washing to
remove non-
specific antibody binding, the presence of the antibody or antibodies is
detected. In one
embodiment the antibody is detected by incubating with a secondary antibody
that contains
a detectable label. In another method the primary antibody to the
differentially expressed
proteins) contains a detectable label. In another preferred embodiment each
one of
multiple primary antibodies contains a distinct and detectable label. This
method finds
particular use in simultaneous screening for a pluralilty of differentially
expressed proteins.
As will be appreciated by one of ordinary skill in the art, numerous other
histological imaging
techniques are useful in the invention.
In a preferred embodiment the label is detected in a fluorometer which has the
ability to
detect and distinguish emissions of different wavelengths. In addition, a
fluorescence
activated cell sorter (FACS) can be used in the method.
In another preferred embodiment, antibodies find use in diagnosing
differentially expressed
from blood samples and other bodily secretions. As previously described,
certain
differentially expressed proteins are secretedlcirculating molecules. Blood
samples and
other bodily secretions, therefore, are useful as samples to be probed or
tested for the
presence of secreted differentially expressed proteins. Antibodies can be used
to detect the
differentially expressed by any of the previously described immunoassay
techniques
38
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
including ELISA, immunoblotting (Western blotting), immunoprecipitation,
BIACORE
technology and the like, as will be appreciated by one of ordinary skill in
the art.
In a preferred embodiment, in situ hybridization of labeled differentially
expressed nucleic
acid probes to tissue arrays is done. For example, arrays of tissue samples,
including
breast or colorectal cancer tissue and/or normal tissue, are made. In situ
hybridization as is
known in the art can then be done.
It is understood that when comparing the fingerprints between an individual
and a standard,
the skilled artisan can make a diagnosis as well as a prognosis. It is further
understood that
the genes which indicate the diagnosis may differ from those which indicate
the prognosis.
In a preferred embodiment, the differentially expressed proteins, antibodies,
nucleic acids,
modified proteins and cells containing differentially expressed sequences are
used in
prognosis assays. As above, gene expression profiles can be generated that
correlate to
breast and/or colorectal cancer severity, in terms of long term prognosis.
Again, this may be
done on either a protein or gene level, with the use of genes being preferred.
As above, the
differentially expressed probes are attached to biochips for the detection and
quantification
of differentially expressed sequences in a tissue or patient. The assays
proceed as outlined
for diagnosis.
In a preferred embodiment, any of the three classes of proteins as described
herein are
used in drug screening assays. The differentially expressed proteins,
antibodies, nucleic
acids, modified proteins and cells containing difFerentially expressed
sequences are used in
drug screening assays or by evaluating the effect of drug candidates on a
"gene expression
profile" or expression profile of polypeptides. In a preferred embodiment, the
expression
profiles are used, preferably in conjunction with high throughput screening
techniques to
allow monitoring for expression profile genes after treatment with a candidate
agent,
Zlokarnik, et al., Science 279, 84-8 (1998), Heid, 1996 #69.
In a preferred embodiment, the differentially expressed proteins, antibodies,
nucleic acids,
modified proteins and cells containing the native or modified differentially
expressed proteins
are used in screening assays. That is, the present invention provides novel
methods for
screening for compositions which modulate the breast or colorectal cancer
phenotype. As
above, this can be done on an individual gene level or by evaluating the
effect of drug
candidates on a "gene expression profile". In a preferred embodiment, the
expression
profiles are used, preferably in conjunction with high throughput screening
techniques to
allow monitoring for expression profile genes after treatment with a candidate
agent, see
Zlokarnik, supra.
39
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
Having identified the differentially expressed genes herein, a variety of
assays may be
executed. In a preferred embodiment, assays may be run on an individual gene
or protein
level. That is, having identified a particular gene as up regulated in breast
and/or colorectal
cancer, candidate bioactive agents may be screened to modulate this gene's
response;
preferably to down regulate the gene, although in some circumstances to up
regulate the
gene. "Modulation" thus includes both an increase and a decrease in gene
expression. The
preferred amount of modulation will depend on the original change of the gene
expression in
normal versus tumor tissue, with changes of at least 10%, preferably
50°!°, more preferably
100-300%, and in some embodiments 300-1000% or greater. Thus, if a gene
exhibits a 4
fold increase in tumor compared to normal tissue, a decrease of about four
fold is desired; in
the case of a 10 fold decrease in tumor compared to normal tissue, a 10 fold
increase in
expression for a candidate agent is desired.
As will be appreciated by those in the art, this may be done by evaluation at
either the gene
or the protein level; that is, the amount of gene expression may be monitored
using nucleic
acid probes and the quantification of gene expression levels, or,
alternatively, the gene
product itself can be monitored, for example through the use of antibodies to
the
differentially expressed protein and standard immunoassays.
In a preferred embodiment, gene expression monitoring is done and a number of
genes, i.e.
an expression profile, is monitored simultaneously, although multiple protein
expression
monitoring can be done as well.
In this embodiment, the differentially expressed nucleic acid probes are
attached to biochips
as outlined herein for the detection and quantification of differentially
expressed sequences
in a particular cell. The assays are further described below.
Generally, in a preferred embodiment, a candidate bioactive agent is added to
the cells prior
to analysis. Moreover, screens are provided to identify a candidate bioactive
agent which
modulates cancer, modulates cancer proteins, binds to a cancer protein, or
interferes
between the binding of a cancer protein and an antibody.
The term "candidate bioactive agent" or "drug candidate" or grammatical
equivalents as
used herein describes any molecule, e.g., protein, oligopeptide, small organic
molecule,
polysaccharide, polynucleotide, etc., to be tested for bioactive agents that
are capable of
directly or indirectly altering the cancer phenotype or the expression of a
differentially
expressed sequence, including both nucleic acid sequences and protein
sequences. In
preferred embodiments, the bioactive agents modulate the expression profiles,
or
expression profile nucleic acids or proteins provided herein. In a
particularly preferred
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
embodiment, the candidate agent suppresses a cancer phenotype, for example to
a normal
tissue fingerprint. Similarly, the candidate agent preferably suppresses a
severe cancer
phenotype. Generally a plurality of assay mixtures are run in parallel with
different agent
concentrations to obtain a differential response to the various
concentrations. Typically, one
of these concentrations serves as a negative control, i.e., at zero
concentration or below the
level of detection.
In one aspect, a candidate agent will neutralize the effect of a CRC protein.
By "neutralize"
is meant that activity of a protein is either inhibited or counter acted
against so as to have
substantially no effect on a cell.
Candidate agents encompass numerous chemical classes, though typically they
are organic
molecules, preferably small organic compounds having a molecular weight of
more than 100
and less than about 2,500 daltons. Preferred small molecules are less than
2000, or less
than 1500 or less than 1000 or less than 500 D. Candidate agents comprise
functional
groups necessary for structural interaction with proteins, particularly
hydrogen bonding, and
typically include at least an amine, carbonyl, hydroxyl or carboxyl group,
preferably at least
two of the functional chemical groups. The candidate agents often comprise
cyclical carbon
or heterocyclic structures and/or aromatic or polyaromatic structures
substituted with one or
more of the above functional groups. Candidate agents are also found among
biomolecules
including peptides, saccharides, fatty acids, steroids, purines, pyrimidines,
derivatives,
structural analogs or combinations thereof. Particularly preferred are
peptides.
Candidate agents are obtained from a wide variety of sources including
libraries of synthetic
or natural compounds. For example, numerous means are available for random and
directed synthesis of a wide variety of organic compounds and biomolecules,
including
expression of randomized oligonucleotides. Alternatively, libraries of natural
compounds in
the form of bacterial, fungal, plant and animal extracts are available or
readily produced.
Additionally, natural or synthetically produced libraries and compounds are
readily modified
through conventional chemical, physical and biochemical means. Known
pharmacological
agents may be subjected to directed or random chemical modifications, such as
acylation,
alkylation, esterification, amidification to produce structural analogs.
In a preferred embodiment, the candidate bioactive agents are proteins. By
"protein" herein
is meant at least two covalently attached amino acids, which includes
proteins, polypeptides,
oligopeptides and peptides. The protein may be made up of naturally occurring
amino acids
and peptide bonds, or synthetic peptidomimetic structures. Thus "amino acid",
or "peptide
residue", as used herein means both naturally occurring and synthetic amino
acids. For
example, homo-phenylalanine, citrulline and noreleucine are considered amino
acids for the
41
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
purposes of the invention. "Amino acid" also includes imino acid residues such
as proline
and hydroxyproline. The side chains may be in either the (R) or the (S)
configuration. In
the preferred embodiment, the amino acids are in the (S) or L-configuration.
If non-naturally
occurring side chains are used, non-amino acid substituents may be used, for
example to
prevent or retard in vivo degradations.
In a preferred embodiment, the candidate bioactive agents are naturally
occurring proteins
or fragments of naturally occurring proteins. Thus, for example, cellular
extracts containing
proteins, or random or directed digests of proteinaceous cellular extracts,
may be used. In
this way libraries of procaryotic and eucaryotic proteins may be made for
screening in the
methods of the invention. Particularly preferred in this embodiment are
libraries of bacterial,
fungal, viral, and mammalian proteins, with the latter being preferred, and
human proteins
being especially preferred.
In a preferred embodiment, the candidate bioactive agents are peptides of from
about 5 to
about 30 amino acids, with from about 5 to about 20 amino acids being
preferred, and from
about 7 to about 15 being particularly preferred. The peptides may be digests
of naturally
occurring proteins as is outlined above, random peptides, or "biased" random
peptides. By
"randomized" or grammatical equivalents herein is meant that each nucleic acid
and peptide
consists of essentially random nucleotides and amino acids, respectively.
Since generally
these random peptides (or nucleic acids, discussed below) are chemically
synthesized, they
may incorporate any nucleotide or amino acid at any position. The synthetic
process can be
designed to generate randomized proteins or nucleic acids, to allow the
formation of all or
most of the possible combinations over the length of the sequence, thus
forming a library of
randomized candidate bioactive proteinaceous agents.
In one embodiment, the library is fully randomized, with no sequence
preferences or
constants at any position. In a preferred embodiment, the library is biased.
That is, some
positions within the sequence are either held constant, or are selected from a
limited number
of possibilities. For example, in a preferred embodiment, the nucleotides or
amino acid
residues are randomized within a defined class, for example, of hydrophobic
amino acids,
hydrophilic residues, sterically biased (either small or large) residues,
towards the creation of
nucleic acid binding domains, the creation of cysteines, for cross-linking,
prolines for SH-3
domains, serines, threonines, tyrosines or histidines for phosphorylation
sites, etc., or to
purines, etc.
In a preferred embodiment, the candidate bioactive agents are nucleic acids,
as defined
above.
42
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
As described above generally for proteins, nucleic acid candidate bioactive
agents may be
naturally occurring nucleic acids, random nucleic acids, or "biased" random
nucleic acids.
For example, digests of procaryotic or eucaryotic genomes may be used as is
outlined
above for proteins.
In a preferred embodiment, the candidate bioactive agents are organic chemical
moieties, a
wide variety of which are available in the literature.
After the candidate agent has been added and the cells allowed to incubate for
some period
of time, the sample containing the target sequences to be analyzed is added to
the biochip.
If required, the target sequence is prepared using known techniques. For
example, the
sample may be treated to lyse the cells, using known lysis buffers,
electroporation, etc., with
purification and/or amplification such as PCR occurring as needed, as will be
appreciated by
those in the art. For example, an in vitro transcription with labels
covalently attached to the
nucleosides is done. Generally, the nucleic acids are labeled with biotin-FITC
or PE, or with
cy3 or cy5.
In a preferred embodiment, the target sequence is labeled with, for example, a
fluorescent, a
chemiluminescent, a chemical, or a radioactive signal, to provide a means of
detecting the
target sequence's specific binding to a probe. The label also can be an
enzyme, such as,
alkaline phosphatase or horseradish peroxidase, which when provided with an
appropriate
substrate produces a product that can be detected. Alternatively, the label
can be a labeled
compound or small molecule, such as an enzyme inhibitor, that binds but is not
catalyzed or
altered by the enzyme. The label also can be a moiety or compound, such as, an
epitope
tag or biotin which specifically binds to streptavidin. For the example of
biotin, the
streptavidin is labeled as described above, thereby, providing a detectable
signal for the
bound target sequence. As known in the art, unbound labeled streptavidin is
removed prior
to analysis.
As will be appreciated by those in the art, these assays can be direct
hybridization assays or
can comprise "sandwich assays", which include the use of multiple probes, as
is generally
outlined in U.S. Patent Nos. 5,681,702, 5,597,909, 5,545,730, 5,594,117,
5,591,584,
5,571,670, 5,580,731, 5,571,670, 5,591,584, 5,624,802, 5,635,352, 5,594,118,
5,359,100,
5,124,246 and 5,681,697, all of which are hereby incorporated by reference. In
this
embodiment, in general, the target nucleic acid is prepared as outlined above,
and then
added to the biochip comprising a plurality of nucleic acid probes, under
conditions that allow
the formation of a hybridization complex.
43
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
A variety of hybridization conditions may be used in the present invention,
including high,
moderate and low stringency conditions as outlined above. The assays are
generally run
under stringency conditions which allows formation of the label probe
hybridization complex
only in the presence of target. Stringency can be controlled by altering a
step parameter that
is a thermodynamic variable, including, but not limited to, temperature,
formamide
concentration, salt concentration, chaotropic salt concentration pH, organic
solvent
concentration, etc.
These parameters may also be used to control non-specific binding, as is
generally outlined
in U.S. Patent No. 5,681,697. Thus it may be desirable to perform certain
steps at higher
stringency conditions to reduce non-specific binding.
The reactions outlined herein may be accomplished in a variety of ways, as
will be
appreciated by those in the art. Components of the reaction may be added
simultaneously,
or sequentially, in any order, with preferred embodiments outlined below. In
addition, the
reaction may include a variety of other reagents may be included in the
assays. These
include reagents like salts, buffers, neutral proteins, e.g. albumin,
detergents, etc which may
be used to facilitate optimal hybridization and detection, and/or reduce non-
specific or
background interactions. Also reagents that otherwise improve the efficiency
of the assay,
such as protease inhibitors, nuclease inhibitors, anti-microbial agents, etc.,
may be used,
depending on the sample preparation methods and purity of the target.
Once the assay is run, the data is analyzed to determine the expression
levels, and changes
in expression levels as between states, of individual genes, forming a gene
expression
profile.
The screens are done to identify drugs or bioactive agents that modulate the
cancer
phenotype. Specifically, there are several types of screens that can be run. A
preferred
embodiment is in the screening of candidate agents that can induce or suppress
a particular
expression profile, thus preferably generating the associated phenotype. That
is, candidate
agents that can mimic or produce an expression profile in, for example, breast
or colorectal
cancer similar to the expression profile of normal breast or colon tissue is
expected to result
in a suppression of the breast or colorectal cancer phenotype. Thus, in this
embodiment,
mimicking an expression profile, or changing one profile to another, is the
goal.
In a preferred embodiment, as for the diagnosis and prognosis applications,
having identified
the differentially expressed genes important in any one state, screens can be
run to alter the
expression of the genes individually. That is, screening for modulation of
regulation of
expression of a single gene can be done; that is, rather than try to mimic all
or part of an
44
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
expression profile, screening for regulation of individual genes can be done.
Thus, for
example, particularly in the case of target genes whose presence or absence is
unique
between two states, screening is done for modulators of the target gene
expression.
In a preferred embodiment, screening is done to alter the biological function
of the
expression product of the differentially expressed gene. Again, having
identified the
importance of a gene in a particular state, screening for agents that bind
and/or modulate
the biological activity of the gene product can be run as is more fully
outlined below.
Thus, screening of candidate agents that modulate the cancer phenotype either
at the gene
expression level or the protein level can be done.
In addition screens can be done for novel genes that are induced in response
to a candidate
agent. After identifying a candidate agent based upon its ability to suppress
a breast and/or
colorectal cancer expression pattern leading to a normal expression pattern,
or modulate a
single differentially expressed gene expression profile so as to mimic the
expression of the
gene from normal tissue, a screen as described above can be performed to
identify genes
that are specifically modulated in response to the agent. Comparing expression
profiles
between normal tissue and agent treated cancer tissue reveals genes that are
not
expressed in normal tissue or cancer tissue, but are expressed in agent
treated tissue.
These agent specific sequences can be identified and used by any of the
methods described
herein for differentially expressed genes or proteins. In particular these
sequences and the
proteins they encode find use in marking or identifying agent treated cells.
In addition,
antibodies can be raised against the agent induced proteins and used to target
novel
therapeutics to the treated cancer tissue sample.
Thus, in one embodiment, a candidate agent is administered to a population of
breast or
colorectal cancer cells, that thus has an associated breast or colorectal
cancer expression
profile. By "administration" or "contacting" herein is meant that the
candidate agent is added
to the cells in such a manner as to allow the agent to act upon the cell,
whether by uptake
and intracellular action, or by action at the cell surface. In some
embodiments, nucleic acid
encoding a proteinaceous candidate agent (i.e. a peptide) may be put into a
viral construct
such as a retroviral construct and added to the cell, such that expression of
the peptide
agent is accomplished; see PCT US97/01019, hereby expressly incorporated by
reference.
Once the candidate agent has been administered to the cells, the cells can be
washed if
desired and are allowed to incubate under preferably physiological conditions
for some
period of time. The cells are then harvested and a new gene expression profile
is
generated, as outlined herein.
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
Thus, for example, breast or colorectal cancer tissue may be screened for
agents that
reduce or suppress the breast or colorectal cancer phenotype. A change in at
least one
gene of the expression profile indicates that the agent has an effect on
breast or colorectal
cancer activity. By defining such a signature for the particular phenotype,
screens for new
drugs that alter the phenotype can be devised. With this approach, the drug
target need not
be known and need not be represented in the original expression screening
platform, nor
does the level of transcript for the target protein need to change.
In a preferred embodiment, as outlined above, screens may be done on
individual genes
and gene products (proteins). That is, having identified a particular
differentially expressed
gene as important in a particular state, screening of modulators of either the
expression of
the gene or the gene product itself can be done. The gene products of
differentially
expressed genes are sometimes referred to herein as "differentially expressed
proteins" or
"cancer modulating proteins". Additionally, "modulator" and "modulating"
proteins are
sometimes used interchangeably herein. In one embodiment, the differentially
expressed
protein is termed CHA4. In another embodiment, the diferentially expressed
protein is
termed CBKB. CHA4 and CBK8 sequences can be identified as described herein for
differentially expressed sequences. In one embodiment, CHA4 sequences are
depicted in
Figures 1 (SEQ ID N0:8) and 2 (SEQ ID N0:10). In one embodiment, CBK8
sequences are
depicted in Figures 4 (SEQ ID N0:9) and 5 (SEQ ID N0:11). The differentially
expressed
protein may be a fragment, or alternatively, be the full length protein to the
fragment shown
herein. Preferably, the differentially expressed protein is a fragment. In a
preferred
embodiment, the amino acid sequence which is used to determine sequence
identity or
similarity is that depicted in Figure 2 or Figure 5. In another embodiment,
the sequences are
naturally occurring allelic variants of a protein having the sequence depicted
in Figure 2 or
Figure 5. In another embodiment, the sequences are sequence variants as
further
described herein.
Preferably, the differentially expressed protein is a fragment of
approximately 14 to 24 amino
acids long. More preferably the fragment is a soluble fragment. Preferably,
the fragment
includes a non-transmembrane region. In a preferred embodiment, the fragment
has an N-
terminal Cys to aid in solubility. In one embodiment, the c-terminus of the
fragment is kept
as a free acid and the n-terminus is a free amine to aid in coupling, i.e., to
cysteine.
Preferably, the fragment of approximately 14 to 24 amino acids long. More
preferably the
fragment is a soluble fragment. In another embodiment, a CHA4 fragment has at
least one
CHA4 bioactivity or at least one CBK8 bioactivity, as defined below.
46
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
In one embodiment the difFerentially expressed proteins are conjugated to an
immunogenic
agent as discussed herein. In one embodiment the differentially expressed
protein is
conjugated to BSA.
Thus, in a preferred embodiment, screening for modulators of expression of
specific genes
can be done. This will be done as outlined above, but in general the
expression of only one
or a few genes are evaluated.
In a preferred embodiment, screens are designed to first find candidate agents
that can bind
to differentially expressed proteins, and then these agents may be used in
assays that
evaluate the ability of the candidate agent to modulate differentially
expressed activity. ,
Thus, as will be appreciated by those in the art, there are a number of
different assays which
may be run; binding assays and activity assays.
In a preferred embodiment, binding assays are done. ' In general, purified or
isolated gene
product is used; that is, the gene products of one or more differentially
expressed nucleic
acids are made. In general, this is done as is known in the art. For example,
antibodies are
generated to the protein gene products, and standard immunoassays are run to
determine
the amount of protein present. Alternatively, cells comprising the
differentially expressed
proteins can be used in the assays.
Thus, in a preferred embodiment, the methods comprise combining a
differentially
expressed protein and a candidate bioactive agent, and determining the binding
of the
candidate agent to the differentially expressed protein. Preferred embodiments
utilize the
human differentially expressed protein, although other mammalian proteins may
also be
used, for example for the development of animal models of human disease. In
some
embodiments, as outlined herein, variant or derivative difFerentially
expressed proteins may
be used.
Generally, in a preferred embodiment of the methods herein, the differentially
expressed
protein or the candidate agent is non-diffusably bound to an insoluble support
having
isolated sample receiving areas (e.g. a microtiter plate, an array, etc.). It
is understood that
alternatively, soluble assays known in the art may be perFormed. The insoluble
supports
may be made of any composition to which the compositions can be bound, is
readily
separated from soluble material, and is otherwise compatible with the overall
method of
screening. The surface of such supports may be solid or porous and of any
convenient
shape. Examples of suitable insoluble supports include microtiter plates,
arrays,
membranes and beads. These are typically made of glass, plastic (e.g.,
polystyrene),
polysaccharides, nylon or nitrocellulose, teflonT"", etc. Microtiter plates
and arrays are
47
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
especially convenient because a large number of assays can be carried out
simultaneously,
using small amounts of reagents and samples. The particular manner of binding
of the
composition is not crucial so long as it is compatible with the reagents and
overall methods
of the invention, maintains the activity of the composition and is
nondiffusable. Preferred
methods of binding include the use of antibodies (which do not sterically
block either the
ligand binding site or activation sequence when the protein is bound to the
support), direct
binding to "sticky" or ionic supports, chemical crosslinking, the synthesis of
the protein or
agent on the surface, etc. Following binding of the protein or agent, excess
unbound
material is removed by washing. The sample receiving areas may then be blocked
through
incubation with bovine serum albumin (BSA), casein or other innocuous protein
or other
moiety.
In a preferred embodiment, the differentially expressed protein is bound to
the support, and
a candidate bioactive agent is added to the assay. Alternatively, the
candidate agent is
bound to the support and the differentially expressed protein is added. Novel
binding agents
include specific antibodies, non-natural binding agents identified in screens
of chemical
libraries, peptide analogs, etc. Of particular interest are screening assays
for agents that
have a low toxicity for human cells. A wide variety of assays may be used for
this purpose,
including labeled in vitro protein-protein binding assays, electrophoretic
mobility shift assays,
immunoassays for protein binding, functional assays (phosphorylation assays
etc.) and the
like.
The determination of the binding of the candidate bioactive agent to the
differentially
expressed protein may be done in a number of ways. In a preferred embodiment,
the
candidate bioactive agent is labeled, and binding determined directly. For
example, this may
be done by attaching all or a portion of the differentially expressed protein
to a solid support,
adding a labeled candidate agent (for example a fluorescent label), washing
off excess
reagent, and determining whether the label is present on the solid support.
Various blocking
and washing steps may be utilized as is known in the art.
By "labeled" herein is meant that the compound is either directly or
indirectly labeled with a
label which provides a detectable signal, e.g. radioisotope, fluorescers,
enzyme, antibodies,
particles such as magnetic particles, chemiluminescers, or specific binding
molecules, etc.
Specific binding molecules include pairs, such as biotin and streptavidin,
digoxin and
antidigoxin etc. For the specific binding members, the complementary member
would
normally be labeled with a molecule which provides for detection, in
accordance with known
procedures, as outlined above. The label can directly or indirectly provide a
detectable
signal.
48
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
In some embodiments, only one of the components is labeled. For example, the
proteins (or
proteinaceous candidate agents) may be labeled at tyrosine positions
using'~SI, or with
fluorophores. Alternatively, more than one component may be labeled with
different labels;
using'~51 for the proteins, for example, and a fluorophor for the candidate
agents.
In a preferred embodiment, the binding of the candidate bioactive agent is
determined
through the use of competitive binding assays. In this embodiment, the
competitor is a
binding moiety known to bind to the target molecule (i.e. breast or colorectal
cancer), such
as an antibody, peptide, binding partner, ligand, etc. Under certain
circumstances, there
may be competitive binding as between the bioactive agent and the binding
moiety, with the
binding moiety displacing the bioactive agent.
In one embodiment, the candidate bioactive agent is labeled. Either the
candidate bioactive
agent, or the competitor, or both, is added first to the protein for a time
sufficient to allow
binding, if present. Incubations may be performed at any temperature which
facilitates
optimal activity, typically between 4 and 40°C. Incubation periods are
selected for optimum
activity, but may also be optimized to facilitate rapid high through put
screening. Typically
between 0.1 and 1 hour will be sufficient. Excess reagent is generally removed
or washed
away. The second component is then added, and the presence or absence of the
labeled
component is followed, to indicate binding.
In a preferred embodiment, the competitor is added first, followed by the
candidate bioactive
agent. Displacement of the competitor is an indication that the candidate
bioactive agent is
binding to the differentially expressed protein and thus is capable of binding
to, and
potentially modulating, the activity of the differentially expressed protein.
In this
embodiment, either component can be labeled. Thus, for example, if the
competitor is
labeled, the presence of label in the wash solution indicates displacement by
the agent.
Alternatively, if the candidate bioactive agent is labeled, the presence of
the label on the
support indicates displacement.
In an alternative embodiment, the candidate bioactive agent is added first,
with incubation
and washing, followed by the competitor. The absence of binding by the
competitor may
indicate that the bioactive agent is bound to the differentially expressed
protein with a higher
affinity. Thus, if the candidate bioactive agent is labeled, the presence of
the label on the
support, coupled with a lack of competitor binding, may indicate that the
candidate agent is
capable of binding to the differentially expressed protein.
In a preferred embodiment, the methods comprise differential screening to
identity bioactive
agents that are capable of modulating the activity of the differentially
expressed proteins. In
49
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
this embodiment, the methods comprise combining a differentially expressed
protein and a
competitor in a first sample. A second sample comprises a candidate bioactive
agent, a
differentially expressed protein and a competitor. The binding of the
competitor is
determined for both samples, and a change, or difference in binding between
the two
samples indicates the presence of an agent capable of binding to the
differentially
expressed protein and potentially modulating its activity. That is, if the
binding of the
competitor is different in the second sample relative to the first sample, the
agent is capable
of binding to the differentially expressed protein.
Alternatively, a preferred embodiment utilizes differential screening to
identify drug
candidates that bind to the native differentially expressed protein, but
cannot bind to
modified differentially expressed proteins. The structure of the
differentially expressed
protein may be modeled, and used in rational drug design to synthesize agents
that interact
with that site. Drug candidates that affect breast or colorectal cancer
bioactivity are also
identified by screening drugs for the ability to either enhance or reduce the
activity of the
protein.
Positive controls and negative controls may be used in the assays. Preferably
all control and
test samples are performed in at least triplicate to obtain statistically
significant results.
Incubation of all samples is for a time sufficient for the binding of the
agent to the protein.
Following incubation, all samples are washed free of non-specifically bound
material and the
amount of bound, generally labeled agent determined. For example, where a
radiolabel is
employed, the samples may be counted in a scintillation counter to determine
the amount of
bound compound.
A variety of other reagents may be included in the screening assays. These
include
reagents like salts, neutral proteins, e.g. albumin, detergents, etc which may
be used to
facilitate optimal protein-protein binding and/or reduce non-specific or
background
interactions. Also reagents that otherwise improve the efficiency of the
assay, such as
protease inhibitors, nuclease inhibitors, anti-microbial agents, etc., may be
used. The
mixture of components may be added in any order that provides for the
requisite binding.
Screening for agents that modulate the activity of differentially expressed
proteins may also
be done. In a preferred embodiment, methods for screening for a bioactive
agent capable of
modulating the activity of differentially expressed proteins comprise the
steps of adding a
candidate bioactive agent to a sample of differentially expressed proteins, as
above, and
determining an alteration in the biological activity of differentially
expressed proteins.
"Modulating the activity" of breast and/or colorectal cancer includes an
increase in activity, a
decrease in activity, or a change in the type or kind of activity present.
Thus, in this
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
embodiment, the candidate agent should both bind to cancer proteins (although
this may not
be necessary), and alter its biological or biochemical activity as defined
herein. The
methods include both in vitro screening methods, as are generally outlined
above, and in
vivo screening of cells for alterations in the presence, distribution,
activity or amount of
differentially expressed proteins.
Thus, in this embodiment, the methods comprise combining a breast or
colorectal cancer
sample and a candidate bioactive agent, and evaluating the effect on breast or
colorectal
cancer activity, respectively. By "cancer activity" or grammatical equivalents
herein is meant
at least one of cancer's biological activities, including, but not limited to,
cell division,
preferably in breast or colon tissue, cell proliferation, tumor growth, and
transformation of
cells. In one embodiment, cancer activity includes activation of CHA4 or a
substrate thereof
by CHA4. In another embodiment, cancer activity includes activation of CBK8 or
a substrate
thereof by CBKB. An inhibitor of cancer activity is an agent which inhibits
any one or more
cancer activities.
, In a preferred embodiment, the activity of the differentially expressed
protein is increased; in
another preferred embodiment, the activity of the differentially expressed
protein is
decreased. Thus, bioactive agents that are antagonists are preferred in some
embodiments, and bioactive agents that are agonists may be preferred in other
embodiments.
In a preferred embodiment, the invention provides methods for screening for
bioactive
agents capable of modulating the activity of a differentially expressed
protein. The methods
comprise adding a candidate bioactive agent, as defined above, to a cell
comprising
differentially expressed proteins. Preferred cell types include almost any
cell. The cells
contain a recombinant nucleic acid that encodes a differentially expressed
protein. In a
preferred embodiment, a library of candidate agents are tested on a plurality
of cells.
In one aspect, the assays are evaluated in the presence or absence or previous
or
subsequent exposure of physiological signals, for example hormones,
antibodies, peptides,
antigens, cytokines, growth factors, action potentials, pharmacological agents
including
chemotherapeutics, radiation, carcinogenics, or other cells (i.e. cell-cell
contacts). In another
example, the determinations are determined at different stages of the cell
cycle process.
In this way, bioactive agents are identified. Compounds with pharmacological
activity are
able to enhance or interfere with the activity of the differentially expressed
protein. In one
embodiment, "CHA4 protein activity" as used herein includes at least one of
the following:
cancer activity, binding to hek, elk or another Eph family receptor tyrosine
kinase, binding to
51
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
CHA4, activation of CHA4 or activation of substrates of CHA4 by CHA4. An
inhibitor of
CHA4 inhibits at least one of CHA4's bioactivities. In one embodiment, "CBK8
protein
activity" as used herein includes at least one of the following: cancer
activity, binding to a
plasma membrane-associated protein, binding to a cytoskeletal protein, binding
to CBKB,
activation of CBK8 or activation of substrates of CBK8 by CBKB. An inhibitor
of CBK8
inhibits at least one of CBKB's bioactivities.
In one embodiment, a method of inhibiting breast cancer cell division is
provided. The
method comprises administration of a breast cancer inhibitor. In another
embodiment, a
method of inhibiting colorectal cancer cell division is provided. The method
comprises
administration of a colorectal cancer inhibitor.
In another embodiment, a method of inhibiting tumor growth is provided. The
method
comprises administration of a breast and/or colorectal cancer inhibitor. In a
preferred
embodiment, the inhibitor is an inhibitor of CHA4. In another preferred
embodiment, the
inhibitor is an inhibitor of CBKB.
In a further embodiment, methods of treating cells or individuals with cancer
are provided.
The method comprises administration of a breast and/or colorectal cancer
inhibitor. In a
preferred embodiment, the inhibitor is an inhibitor of CHA4. In another
preferred
embodiment, the inhibitor is an inhibitor of CBKB.
In one embodiment, a differentially expressed protein inhibitor is an antibody
as discussed
above. In another embodiment, the inhibitor is an antisense molecule.
Antisense
molecules as used herein include antisense or sense oligonucleotides
comprising a singe-
stranded nucleic acid sequence (either RNA or DNA) capable of binding to
target mRNA
(sense) or DNA (antisense) sequences for differentially expressed molecules. A
preferred
antisense molecule is for CHA4 or CBKB, or for a ligand or activator thereof.
Antisense or
sense oligonucleotides, according to the present invention, comprise a
fragment generally at
least about 14 nucleotides, preferably from about 14 to 30 nucleotides. The
ability to derive
an antisense or a sense oligonucleotide, based upon a cDNA sequence encoding a
given
protein is described in, for example, Stein and Cohen (Cancer Res. 48:2659,
1988) and van
der Krol et al. (BioTechni4ues 6:958, 1988).
Antisense molecules may be introduced into a cell containing the target
nucleotide sequence
by formation of a conjugate with a ligand binding molecule, as described in WO
91/04753.
Suitable ligand binding molecules include, but are not limited to, cell
surface receptors,
growth factors, other cytokines, or other ligands that bind to cell surface
receptors.
Preferably, conjugation of the ligand binding molecule does not substantially
interfere with
52
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
the ability of the ligand binding molecule to bind to its corresponding
molecule or receptor, or
block entry of the sense or antisense oligonucleotide or its conjugated
version into the cell.
Alternatively, a sense or an antisense oligonucleotide may be introduced into
a cell
containing the target nucleic acid sequence by formation of an oligonucleotide-
lipid complex,
as described in WO 90/10448. It is understood that the use of antisense
molecules or knock
out and knock in models may also be used in screening assays as discussed
above, in
addition to methods of treatment.
The compounds having the desired pharmacological activity may be administered
in a
physiologically acceptable carrier to a host, as previously described. The
agents may be
administered in a variety of ways, orally, parenterally e.g., subcutaneously,
intraperitoneally,
intravascularly, etc. Depending upon the manner of introduction, the compounds
may be
formulated in a variety of ways. The concentration of therapeutically active
compound in the
formulation may vary from about 0.1-100 wt.%. The agents may be administered
alone or in
combination with other treatments, i.e., radiation.
The pharmaceutical compositions can be prepared in various forms, such as
granules,
tablets, pills, suppositories, capsules, suspensions, salves, lotions and the
like.
Pharmaceutical grade organic or inorganic carriers and/or diluents suitable
for oral and
topical use can be used to make up compositions containing the therapeutically-
active
compounds. Diluents known to the art include aqueous media, vegetable and
animal oils
and fats. Stabilizing agents, wetting and emulsifying agents, salts for
varying the osmotic
pressure or buffers for securing an adequate pH value, and skin penetration
enhancers can
be used as auxiliary agents.
Without being bound by theory, it appears that the various differentially
expressed
sequences are important in breast and/or colorectal cancer. Accordingly,
disorders based
on mutant or variant cancer genes may be determined. In one embodiment, the
invention
provides methods for identifying cells containing variant cancer genes
comprising
determining all or part of the sequence of at least one endogeneous cancer
gene in a cell.
As will be appreciated by those in the art, this may be done using any number
of sequencing
techniques. In a preferred embodiment, the invention provides methods of
identifying the
cancer genotype of an individual comprising determining all or part of the
sequence of at
least one cancer gene of the individual. This is generally done in at least
one tissue of the
individual, and may include the evaluation of a number of tissues or different
samples of the
same tissue. The method may include comparing the sequence of the sequenced
gene to a
known gene, i.e. a wild-type gene.
53
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
The sequence of all or part of the differentially expressed gene can then be
compared to the
sequence of a known differentially expressed gene to determine if any
differences exist.
This can be done using any number of known homology programs, such as Bestfit,
etc. In a
preferred embodiment, the presence of a difference in the sequence between the
differentially expressed gene of the patient and the known differentially
expressed gene is
indicative of a disease state or a propensity for a disease state, as outlined
herein.
In a preferred embodiment, the differentially expressed genes are used as
probes to
determine the number of copies of the differentially expressed gene in the
genome.
In another preferred embodiment differentially expressed genes are used as
probed to
determine the chromosomal localization of the differentially expressed genes.
Information
such as chromosomal localization finds use in providing a diagnosis or
prognosis in
particular when chromosomal abnormalities such as translocations, and the like
are
identified in differentially expressed gene loci.
Thus, in one embodiment, methods of modulating breast cancer and/or colorectal
cancer in
cells or organisms are provided. In one embodiment, the methods comprise
administering
to a cell an antibody that reduces or eliminates the biological activity of an
endogenous
differentially expressed protein. Alternatively, the methods comprise
administering to a cell
or organism a recombinant nucleic acid encoding a differentially expressed
protein. As will
be appreciated by those in the art, this may be accomplished in any number of
ways. In a
preferred embodiment, for example when the differentially expressed sequence
is down-
regulated in cancer, the activity of the differentially expressed gene is
increased by
increasing the amount of differentially expressed protein in the cell, for
example by
overexpressing the endogenous protein or by administering a gene encoding the
sequence,
using known gene-therapy techniques. In a preferred embodiment, the gene
therapy
techniques include the incorporation of the exogenous gene using enhanced
homologous
recombination (EHR), for example as described in PCT/US93/03868, hereby
incorporated
by reference in its entirety. Alternatively, for example when the
differentially expressed
sequence is up-regulated in cancer, the activity of the endogeneous gene is
decreased, for
example by the administration of an inhibitor of cancer, such as an antisense
nucleic acid.
In one embodiment, the differentially expressed proteins of the present
invention may be
used to generate polyclonal and monoclonal antibodies to differentially
expressed proteins,
which are useful as described herein. Similarly, the differentially expressed
proteins can be
coupled, using standard technology, to affinity chromatography columns. These
columns
may then be used to purify differentially expressed antibodies. In a preferred
embodiment,
the antibodies are generated to epitopes unique to a differentially expressed
protein; that is,
54
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
the antibodies show little or no cross-reactivity to other proteins. These
antibodies find use
in a number of applications. For example, the differentially expressed
antibodies may be
coupled to standard affinity chromatography columns and used to purify
differentially
expressed proteins. The antibodies may also be used as blocking polypeptides,
as outlined
above, since they will specifically bind to the differentially expressed
protein.
In one embodiment, a therapeutically effective dose of a differentially
expressed nucleic acid
or differentially expressed protein or modulator thereof is administered to a
patient. By
"therapeutically efFective dose" herein is meant a dose that produces the
effects for which it
is administered. The exact dose will depend on the purpose of the treatment,
and will be
ascertainable by one skilled in the art using known techniques. As is known in
the art,
adjustments for degradation, systemic versus localized delivery, and rate of
new protease
synthesis, as well as the age, body weight, general health, sex, diet, time of
administration,
drug interaction and the severity of the condition may be necessary, and will
be
ascertainable with routine experimentation by those skilled in the art.
A "patient" for the purposes of the present invention includes both humans and
other
animals, particularly mammals, and organisms. Thus the methods are applicable
to both
human therapy and veterinary applications. In the preferred embodiment the
patient is a
mammal, and in the most preferred embodiment the patient is human.
The administration of the differentially expressed proteins and modulators of
the present
invention can be done in a variety of ways as discussed above, including, but
not limited to,
orally, subcutaneously, intravenously, intranasally, transdermally,
intraperitoneally,
intramuscularly, intrapulmonary, vaginally, rectally, or intraocularly. In
some instances, for
example, in the treatment of wounds and inflammation, the differentially
expressed proteins
and modulators may be directly applied as a solution or spray.
The pharmaceutical compositions of the present invention comprise a
differentially
expressed protein in a form suitable for administration to a patient. In the
preferred
embodiment, the pharmaceutical compositions are in a water soluble form, such
as being
present as pharmaceutically acceptable salts, which is meant to include both
acid and base
addition salts. "Pharmaceutically acceptable acid addition salt" refers to
those salts that
retain the biological effectiveness of the free bases and that are not
biologically or otherwise
undesirable, formed with inorganic acids such as hydrochloric acid,
hydrobromic acid,
sulfuric acid, nitric acid, phosphoric acid and the like, and organic acids
such as acetic acid,
propionic acid, glycolic acid, pyruvic acid, oxalic acid, malefic acid,
malonic acid, succinic
acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid,
mandelic acid,
methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, salicylic
acid and the like.
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
"Pharmaceutically acceptable base addition salts" include those derived from
inorganic
bases such as sodium, potassium, lithium, ammonium, calcium, magnesium, iron,
zinc,
copper, manganese, aluminum salts and the like. Particularly preferred are the
ammonium,
potassium, sodium, calcium, and magnesium salts. Salts derived from
pharmaceutically
acceptable organic non-toxic bases include salts of primary, secondary, and
tertiary amines,
substituted amines including naturally occurring substituted amines, cyclic
amines and basic
ion exchange resins, such as isopropylamine, trimethylamine, diethylamine,
triethylamine,
tripropylamine, and ethanolamine.
The pharmaceutical compositions may also include one or more of the following:
carrier
proteins such as serum albumin; buffers; fillers such as microcrystalline
cellulose, lactose,
corn and other starches; binding agents; sweeteners and other flavoring
agents; coloring
agents; and polyethylene glycol. Additives are well known in the art, and are
used in a
variety of formulations.
In a preferred embodiment, differentially expressed proteins and modulators
are
administered as therapeutic agents, and can be formulated as outlined above.
Similarly,
differentially expressed genes (including both the full-length sequence,
partial sequences, or
regulatory sequences of the differentially expressed coding regions) can be
administered in
gene therapy applications, as is known in the art. These differentially
expressed genes can
include antisense applications, either as gene therapy (i.e. for incorporation
into the genome)
or as antisense compositions, as will be appreciated by those in the art.
In a preferred embodiment, differentially expressed genes are administered as
DNA
vaccines, either single genes or combinations of differentially expressed
genes. Naked DNA
vaccines are generally known in the art. Brower, Nature Biotechnology, 16:1304-
1305
(1998).
In one embodiment, differentially expressed genes of the present invention are
used as DNA
vaccines. Methods for the use of genes as DNA vaccines are well known to one
of ordinary
skill in the art, and include placing a differentially expressed gene or
portion of a differentially
expressed gene under the control of a promoter for expression in a patient
with breast
cancer or cancer. The differentially expressed gene used for DNA vaccines can
encode full-
length differentially expressed proteins, but more preferably encodes portions
of the
differentially expressed proteins including peptides derived from the
differentially expressed
protein. In a preferred embodiment a patient is immunized with a DNA vaccine
comprising a
plurality of nucleotide sequences derived from a differentially expressed
gene. Similarly, it is
possible to immunize a patient with a plurality of differentially expressed
genes or portions
thereof as defined herein. Without being bound by theory, expression of the
polypeptide
56
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
encoded by the DNA vaccine, cytotoxic T-cells, helper T-cells and antibodies
are induced
which recognize and destroy or eliminate cells expressing differentially
expressed proteins.
In a preferred embodiment, the DNA vaccines include a gene encoding an
adjuvant
molecule with the DNA vaccine. Such adjuvant molecules include cytokines that
increase
the immunogenic response to the differentially expressed polypeptide encoded
by the DNA
vaccine. Additional or alternative adjuvants are known to those of ordinary
skit! in the art and
find use in the invention.
In another preferred embodiment differentially expressed genes find use in
generating
animal models of cancer. For example, as is appreciated by one of ordinary
skill in the art,
when the cancer gene identified is repressed or diminished in cancer tissue,
gene therapy
technology wherein antisense RNA directed to the cancer gene will also
diminish or repress
expression of the gene. An animal generated as such serves as an animal model
of cancer
that finds use in screening bioactive drug candidates. Similarly, gene
knockout technology,
for example as a result of homologous recombination with an appropriate gene
targeting
vector, will result in the absence of the cancer protein. When desired, tissue-
specific
expression or knockout of the cancer protein may be necessary.
It is also possible that the differentially expressed protein is overexpressed
in breast and/or
coloretal cancer. As such, transgenic animals can be generated that
overexpress the
differentially expressed protein. Depending on the desired expression level,
promoters of
various strengths can be employed to express the transgene. Also, the number
of copies of
the integrated transgene can be determined and compared for a determination of
the
expression level of the transgene. Animals generated by such methods find use
as animal
models of differentially expressed and are additionally useful in screening
for bioactive
molecules to treat disorders related to the differentially expressed protein.
It is understood that the examples described herein in no way serve to limit
the true scope of
this invention, but rather are presented for illustrative purposes. All
references and
sequences of accession numbers cited herein are incorporated by reference in
their entirety.
EXAMPLES
Example 1
~bridization of cRNA to oliaonucleotide arrays
This protocol outlines the method for purification and labeling of RNA for
hybridization to
oligonucleotide arrays. Total RNA is purified from cells or tissue, double-
stranded cDNA is
57
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
prepared from the RNA, the cDNA is purified, the cDNA is then labeled with
biotin during an
in vitro transcription (IVT) reaction, the cRNA prepared in the IVT reaction
is purified,
fragmented, and hybridized to an oligonucleotide array.
Purification of Total RNA from Tissue or Cells
Homogenization
Before using the tissue homogenizes (Polytron PT3100 fitted with probe
9100072,
Kinematica), clean it with soapy water and rinse thoroughly. Sterilize by
running the
homogenizes in ethanol, and then run the homogenizes in at least 3 mL of
TRlzol reagent
(Life Technology/GibcoBRL).
Estimate tissue weight. Homogenize tissue samples in 1 mL of TRlzol per 50 mg
of tissue. If
cells derived from experimental model systems are used as the source of RNA,
use 1 mL of
TRlzol per 5-10 x 106 cells. Homogenize tissue or cells thoroughly.
After each sample homogenization run the probe in at least 3 mL fresh TRlzol,
and then add
this TRlzol back to the homogenized sample. Wash the probe with at least 50 mL
fresh
RNase-free water before proceeding to the next sample.
RNA isolation
Following sample homogenization, centrifuge sample in a microfuge at 12 OOOg
for 10 min
at 4°C (microfuge tubes) or in a Sorvall centrifuge (Sorvall Centrifuge
RT7 Plus) at 4000
RPM for 60 min at 4°C (15 mL conical tubes).
Transfer 1 mL of supernatant to a new microcentrifuge tube. Add 0.5 uL linear
acrylamide
and incubate at room temperature for 4 minutes. Store the remaining clarified
homogenate
at -20°C or colder. Add 0.2 mL chloroform. Invert tube and shake
vigorously for 15 seconds
until sample is thoroughly mixed. Inclubate sample at room temperature for 5
minutes.
Centrifuge at 12 OOOg for 15 minutes at 4°C.
Transfer aqueous (top clear) layer to a new microcentrifuge tube, being
careful not to
remove any of the material at the aqueous/organic phase interface. Add 0.5 mL
isopropanol,
vortex for 2 seconds, and incubate at RT for 10 minutes. Centrifuge afi 10
OOOg for 10
minutes at 4°C.
58
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
Pour off supernatant, add 1 mL cold 75% ethanol, invert tube to loosen pellet,
and centrifuge
at 750Og for 5 min at 4°C.
Pour off supernatant, spin in microcentrifuge briefly and use a pipette to
remove the
remaining ethanol wash from the pellet. Dry the pellet at room temperature in
a fume hood
for at least 10 minutes.
Resuspend RNA pellet in 50 uL RNase-free water. Vortex. Incubate at
65°C for 10 minutes,
vortex for 3 seconds to resuspend pellet, and spin briefly to collect sample
in the bottom of
the microcentrifuge tube.
RNA guantification and quality control
Use 1 uL of RNA sample to quantify RNA in a spectrometer. The ratio of the
optical density
readings at 260 and 280 nm should be between 1.4 and 2.0 OD. Use between 250-
500 ng
of RNA sample to run on a 1 % agarose electrophoretic gel to check integrity
of 28S, 18S
and 5S RNAs. Smearing of the RNA should be minimal and not biased toward RNAs
of
lower molecular weight.
RNA purification
Purify no more than 100 ug of RNA on an individual RNeasy column (Qiagen).
Follow
manufacturer's instructions for RNA purification. Adjust the sample to a
volume of 100 uL
with RNase-free water. Add 350 uL Buffer RLT and then 250 uL ethanol to the
sample. Mix
gently by pipetting and then apply sample to the RNeasy column. Centrifuge in
a
microcentrifuge for 15 seconds afi 10 000 RPM.
Transfer column to a new 2 mL collection tube. Add 500 uL Buffer RPE and
centrifuge again
for 15 seconds at 10 000 RPM.
Discard flow through. Add 500 uL Buffer RPE and centrifuge for 15 seconds at
10 000 RPM.
Discard flow through. Centrifuge for 2 minutes at 15 000 RPM to dry column.
Transfer column to a new 1.5 mL collection tube and apply 30-40 uL of RNase-
free water
directly onto the column membrane. Let the column sit for 1 minute, then
centrifuge at 10
000 RPM. Repeat the elusion with another 30-40 uL RNase-free water. Store RNA
at -20°C
or colder.
59
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
Preparation of polyA+ RNA
PolyA+ RNA can be purified from total RNA if desired using the Oligotex mRNA
Purification
System (Qiagen) by following the manufacturer's instructions. Before
proceeding with cDNA
synthesis the polyA+ RNA must be ethanol precipitated and resuspended as the
Oligotex
procedure leaves a reagent in the polyA+RNA which inhibits downstream
reactions.
cDNA Synthesis
Reagents for cDNA synthesis are obtained from the Superscript Choice System
for cDNA
Synthesis kit (GibcoBRL).
Before aliquoting RNA to use in cDNA synthesis, heat RNA at 70°C for 2
minutes to disloge
RNA that is adhering to the plastic tube. Vortex, spin briefly in
microcentrifuge, and then
keep RNA at room temperature until aliquot is taken.
Use 5-10 ug of total RNA or 1 ug of polyA+ RNA as starting material.
Combine primers and RNA
Total RNA 5-10 ug
T7-(dT)24 primer (100 pmol/uL) 1 uL (2 ug/uL)
Add water to a total volume of 11 uL
Heat to 70°C for 10 minutes. Place on ice for 2 minutes.
First strand synthesis reaction
Add 7 uL of the following first strand reaction mix to each RNA-primer sample:
5X First strand buffer 4 uL (Final concentration: 1X)
0.1 M DTT 2 uL (Final concentration: 0.01 M)
10 mM dNTPs 1 uL (Final concentration: 0.5 mM)
Incubate sample at 37°C for 2 minutes.
To each sample add:
Superscript II reverse transcriptase 2 uL
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
Incubate at 37°C for 1 hour and then place sample on ice.
Second sfrand cDNA synthesis reaction
Prepare the following second strand reaction mix for each sample:
DEPC water 91 uL
5X Second strand bufFer 30 uL (Final concentration: 1X)
mM dNTPs 3 uL (Final concentration: 0.2 mM)
E. cold DNA ligase (10 U/uL) 1 uL
E. cold DNA Polymerase (10 U/uL) 4 uL
E. cold RNase H (2 U/uL) 1 uL
10 Total volume of second strand reaction mix per sample is 130 a L. Add mix
to first strand
cDNA synthesis sample.
Incubate 2 hours at 16°C. Add 2 uL T4 DNA Polymerase and incubate 4
minutes at 16°C.
Add 10 uL of 0.5 M EDTA to stop the reaction and place the tubes on ice.
Purificafion of cDNA
Use Phase Lock Gel Light tubes (Eppendorf) for cDNA purification.
Spin Phase Lock Gel tubes for 1 minute at 15 000 RPM. Add the cDNA sample. Add
an
equal volume of pH 8 phenol:cholorform:isoamyl alcohol (25:24:1 ), shake
vigorously and
then centrifuge for 5 minutes at 15 000 RPM.
Transfer the upper (aqueous) phase to a new microcentrifuge tube. Ethanol
precipitate the
DNA by adding 1 volume of 5 M NH40Ac and 2.5 volumes of cold (-20°C)
100% ethanol .
Vortex and then centrifuge at 16°C for 30 minutes at 15 000 RPM.
Remove supernatant from cDNA pellet and then wash pellet with 500 uL of cold (-
20°C) 80%
ethanol. Centrifuge sample for 5 min at 16°C at 15 000 RPM. Remove the
supernatant,
repeat 80% ethanol wash once more, remove supernatant, and then allow pellet
to air dry.
Resuspend pellet in 3 uL of RNase-free water.
In vitro Transcription (IVT) and labeling with biotin
61
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
In vitro transcription is performed using reagents from the T7 Megascript kit
(Ambion) unless
otherwise indicated.
Aliquot 1.5 uL of cDNA into an RNase-free thin walled PCR tube and place on
ice.
Prepare the following IVT mix at room temperature:
T7 10XATP (75 mM) 2 uL
T7 10XGTP (75 mM) 2 uL
T7 10XCTP (75 mM) 1.5 uL
T7 10XUTP (75 mM) 1.5 uL
Bio-11-UTP (10 mM) 3.75 uL (Boehringer Mannheim or
Enzo
Diagnostics)
Bio-16-CTP (10 mM) 3.75 uL (Enzo Diagnostics)
T7 buffer (10X) 2 uL
T7 enzyme mix (10X) ~ 2 uL
Remove the cDNA from ice and add 18.5 uL of IVT mix to each cDNA sample. Final
volume
of sample is 20 uL.
Incubate at 37°C for 6 hours in a PCR machine, using a heated lid to
prevent condensation.
Purification of labeled IVT product
Use RNeasy columns (Qiagen) to purify IVT product. Follow manufacturer's
instructions or
see section entitled "RNA purification using RNeasy Kit" above.
Elute IVT product two times using 20-30 uL of RNase-free water. Quantitate IVT
yield by
taking an optical density reading. If the concentration of the sample is less
than 0.4 ug/uL,
then ethanol precipitate and resuspend in a smaller volume.
Fragmentation of cRNA
Aliquot 15 ug of cRNA in a maximum volume of 16 uL into a microfuge tube. Add
2 uL of 5X
Fragmentation buffer for every 8 uL of cRNA used.
5X Fragmentation buffer:
100 mM Tris-acetate, pH 8.1
62
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
500 mM potassium acetate
150 mM magnesium acetate
Incubate for 35 minutes at 95°C. Centrifuge briefly and place on
ice.
Hybridization of cRNA to Olinonucleotide Array
10-15 ug of cRNA are used in a total volume of 300 uL of hybridization
solution. Prepare the
hybridization solution as follows:
Fragmented cRNA (15 ug) 20 uL
948-b control oligonucleotide (Affymetrix)50 pM
BioB control cRNA (Affymetrix) 1.5
pM
BioC control cRNA (Affymetrix) 5 pM
BioD control cRNA (Affymetrix) 25 pM
CRE control cRNA (Affymetrix) 100
pM
Herring sperm DNA (10 mg/mL) 3 uL
Bovine serum albumin (50 mg/mL) 3 uL
2X MES 150
uL
RNase-free water 118 uL
Example 2
Hybridization to Oligonucleotide Arrays
This method allows one to compare RNAs from two different sources on the same
oligonucleotide array (for example, RNA prepared from tumor tissue versus RNA
prepared
from normal tissue). The starting material for this method is IVT product
prepared as
described in Example 1, above. The cRNA is reverse transcribed in the presence
of either
Cy3 (sample 1 ) or Cy5 (sample 2) conjugated dUTP. After labeling the two
samples, the
RNA is degraded and the samples are purified to recover the Cy3 and Cy5 dUTP.
The
differentially labelled samples are combined and the cDNA is further purified
to remove
fragments less than 100 by in length. The sample is then fragmented and
hybridized to
oligonucleotide arrays.
Labeling of cRNA
Prepare reaction in RNase-free thin-walled PCR tubes. Use non-biotinylated IVT
product as
prepared above in Example 1. This IVT product can also be prepared from DNA.
IVT cRNA 4 ug
63
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
Random Hexamers (1 ug/uL) 4 uL
Add RNase-free water to a total volume of 14 uL
Incubate at 70°C for 10 minutes, and then place on ice.
Prepare a 50X dNTP mix by combining NTPs obtained from Amersham Pharmacia
Biotech:
100 mM dATP 25 uL (Final concentration: 25 mM)
100 mM dCTP 25 uL (Final concentration: 25 mM)
100 mM dGTP 25 uL (Final concentration: 25 mM)
100 mM dTTP ~ 10 uL (Final concentration: 10 mM)
RNase-free water 15 a L
Reverse transcription is performed on the IVT product by adding the following
reagents from
the Superscript Choice System for cDNA Synthesis kit (GibcoBRL) to the IVT-
random
hexamer mixture.
5X first strand buffer 6 uL
0.1 MDTT 3uL
50X dNTP mix 0.6 uL (as prepared above)
RNase-free water 2.4 uL
Cy3 or Cy5 dUTP (1 mM) 3 uL (Amersham Pharmacia Biotech)
Superscript II reverse transcriptase1 uL
Incubate for 30 minutes at 42C.
Add 1 uL Superscript II reverse
transcriptase and let reaction
proceed for 1 hour at 42C.
Place reaction on ice.
RNA degradation
Prepare degradation buffer composed of 1 M NaOH and 2 mM EDTA. To the labeled
cDNA
mixture above, add:
Degradation buffer 1.5 uL
Incubate at 65°C for 10 minutes.
Recovery of CY3 and Cv5-dUTP
64
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
Combine each sample with 500 uL TE and apply onto a Microcon 30 column. Spin
column at
000 RPM in a microcentrifuge for 10 minutes. Recycle Cy3 and Cy5 dUTP
contained in
column flow-through. Proceed with protocol using concentrated sample remaining
in column.
Purification of cDNA
5 cDNA is purified using the Qiaquick PCR Purification Kit (Qiagen), following
the
manufacturer's directions.
Combine the Cy3 and Cy5 labelled samples that are to be compared on the same
chip. Add:
3M NaOAc 2 uL
Buffer PB 5 volumes
10 Apply sample to Qiaquick column. Spin at 10 OOOg in a microcentrifuge for
10 minutes
Discard flow through and add 750 uL Buffer PB to column. Centrifuge at 10 OOOg
for 1
minute. Discard flow through. Spin at maximum speed for 1 minute to dry
column.
Add 30 uL of Buffer EB directly to membrane. Wait 1 minute. Centrifuge at 10
OOOg or less
for 1 minute.
Fragmenfafion
Prepare fragmentation buffer:
DNase I 1 uL (Ambion)
1X First strand buffer 99 uL (Gibco-BRL)
Add 1 uL of fragmentation buffer to each sample. Incubate at 37°C for
15 minutes. Incubate
at 95°C for 5 minutes to heat-inactivate DNase.
Spin samples in speed vacuum to dry completely.
Hybridization
Resuspend the dried sample in the following hybridization mix:
50X dNTP 1 uL
20X SSC 2.3 uL
sodium pyrophosphate 200 mM) 7.5 uL
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
herring sperm DNA (1 mg/mL) 1 .uL
Vortex sample, centrifuge briefly, and add:
1 %SDS 3uL
Incubate at 95°C for 2-3 minutes, cool at 20 room temperature for 20
minutes.
Hybridize samples to oligonucleotide arrays overnight. When oligonucleotides
are 50mers,
hybridize samples at 65°C. When oligonucleotides are 30mers, hybridize
samples at 57°C.
IIVashinq after hybridization
First wash: Wash slides for 1 minute at 65°C in Buffer 1
Second wash: Wash slides for 5 minutes at room temperature in Buffer 2
Third wash: Wash slides for 5 minutes at room temperature in Buffer 2
Buffer 1:
3X SSC, 0.03% SDS
Buffer 2:
1 X SSC
Buffer 3:
0.2X SSC
After the three washes, dry the slides by centrifuging them, and then scan
using appropriate
laser power and photomultiplier tube gain.
Example 3
Expression studies were performed herein, substantially as described above.
The biochip
contained the sequence shown in accession number T32108 andlor accession
number
AW136973 as a probe.
As indicated in Figures 3A-3D, CHA4 is upregulated in breast cancer tissue
(3A) and colon
cancer tissue (3B) compared with expression in adrenal gland, aorta, aortic
valve, artery,
bladder, bone marrow, brain, breast, CD14+ monocytes, CD14- cells, colonic
epithelial cells,
cervix, colon, diaphragm, esophagus, gallbladder, heart, kidney, liver, lungs,
lymph node,
muscle, vagus nerve, omentum, ovary, pancreas, prostate, rectum, salivary
gland, skin,
66
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
small intestine, ileum, jejunum, spinal cord, spleen, stomach, testis, thymus,
thyroid,
trachea, urethra, uterus, and vein/vena cava (3C-3D).
As indicated in Figures 6A-6C, CBK8 is upregulated in colon cancer tissue
(6A), including
primary tumor tissue (dark bars) and metastatic tissue (light bars), compared
with
expression in normal adrenal gland, aorta, aortic valve, artery, bladder, bone
marrow, brain,
breast, colonic epithelial cells (CEP), cervix, colon, diaphragm, esophagus,
gallbladder,
heart, kidney, liver, lungs, lymph node, muscle, ovary, pancreas, prostate,
rectum, salivary
gland, skin, small intestine, ileum, jejunum, spinal cord, spleen, stomach,
testis, thymus,
thyroid, trachea, ureter and uterus (6B-6C).
67
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
SEQUENCE LISTING
<110> EOS BIOTECHNOLOGY, INC.
<120> METHODS OF DIAGNOSING COLORECTAL CANCER AND/OR BREAST CANCER,
COMPOSITIONS, AND METHODS OF SCREENING FOR COLORECTAL CANCER AND/OR BREAST
CANCER MODULATORS
<130> FP-69439-1-PC/DJB/JJD
<150> US 09/733,756
<151> 2000-12-08
<150> US 09/733,757
<151> 2000-12-08
<160> 12
<170> PatentIn version 3.1
<210> 1
<211> 186
<212> DNA
<213> Homo Sapiens
<220>
<221> misc_feature
<222> (2). (2)
<223> "n" at position 2 can be any base
<400> 1
anctccagtt tattttttta agactaagag cagagtatga aagtcacagc caaagcactt 60
gaaaaaggcc caggaggata ggtgggacca catagggtga gcagggcaag gtcctgggag 120
atggttcccg gctcagggct ggaagggagg gggcgctgtt gttttacggt ctccaaaagt 180
gtctgt 186
<210> 2
<211> 218
<212> DNA
<213> Homo Sapiens
<400> 2
tttttttttt tttttttctt aaaatagtca ccagacggct ttaacaagga aagctcttct 60
gatcttctaa tattcaggat tttgcagata tcactgacag ctttaaaaac cacagctgag 120
aagctgactc gcaacctcac catcttcaaa tteggcagac gaaggcgcag cattttatgc 180
tgaggggtga agagaagctt tgcatctgcc tggacccc 218
<210> 3
<211> 3017
<212> DNA
<213> Homo Sapiens
1
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
<400>
3
atgaaatgtatttgagatgtgaccatgagaatcaatacgcccaatggatggctgcctgca60
tgttggcatcgaagggcaaaaccatggcagacagctectaccagccagaggtcctcaaca120
tcctttcatttctgaggatgaaaaacaggaactctgcatctcaggtggcttecagtcteg180
aaaacatggatatgaacccagaatgttttgtgtcaccacggtgtgcaaaaagacacaaat240
ccaaacagctggccgeceggatcctggaggcgcaccagaacgtggcccagatgcccctgg300
tcgaagccaagctgcggttcatccaggcgtggcagtcactgcetgagtttggcctcacet360
actaccttgtcagatttaaaggaagcaaaaaagatgacattctgggagtttcatataaca420
ggttgattaaaattgatgcagecaccgggattccagtgacaacatggagattcacaaata480
tcaaacagtggaatgtaaactgggaaacccggcaggtggtcatcgagtttgaccaaaacg540
tetttactgctttcacctgcctgagtgcagattgcaagattgtgcacgagtacattggcg600
gctacattttettgtccacccgctccaaggaccagaatgaaacactcgatgaggacttgt660
tccacaaattgaccggcggtcaggattgaaacaagcacgcgtgctcggctcacaccaaca720
aggcaagccaaaggcgcccctccccagagggatccctaacgtgcccagcatgtagattct780
ggactaacagacaacatacattcaccgctggtcacccagatCCtCattCaaaCCCaCtgC840
tggcacatccctttccttactttgccctgtgctaccagccacggaaggagcctctcttgt900
tttttctataaaatgggtaggcaggagaaaagcaggtgccctaagattgctctaaggcec960
agcatgtggttacagttctctgacttgcagaacctgccaggtgtatggctacaagtcatc1020
ctcgtgetgatetgtctcattactaagtcaatggagaagacagaaaggtaaaaatcacgt1080
gtagcaagaataactcttatttcacaaactcaggtatgaaacgaaacgcctgtccttcat1140
ggaactgcttttagctcctgtcttttcaaaatggcagagggagttcctacacacactttt1200
tccctggaggccaaggtetaggggtagaaaggggaggggtggggctaccaggtagcagtt1260
gacaacccaaggtcagaggagtggecetcagtgtcatctgtccacagtgatacctgccaa1320
gatgaccactgacccacatctggtettagtcattggtctcctcagatttctggggccacc1380
tgcaagccccattccattcctacagatctctcagccacctgtaagtcctttgtgaagatg1440
tgggtgacacagggggacaggaaaacecatttctcaacccagatccatgtctccactget1500
tctactctgggttgggattcaggaagacaggcacagtcctctctgttcatagaaacacet1560
gccagtgtcaaggattccagtcaggtgtctatcccaactggtcagggagagaagggcaga1620
cccattctcaaagaccaccgtgtccaaggtCtgaCagCtCCCCd.CtggCtgCCCCCaCag1680
gggctttaggetggtctgggtcatggggaagegtccctcttatcgctggtctgtgttctc1740
ctggatttggtatctatgttggtacgactcctggccttttatctaaaggactttggcttt1800
2
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
tgtaaatcacaagccaataatagaCttttttCtCCCCCtCtgttttttgctgtgtcatct1860
ctgccttgagactgccttgagacagtgcttgccttgagagagtgagccaattaacagctg1920
cctgaattgtcattttccattttggtttgttagaggtgggaggggtgggttttgagaagg1980
tcaaaagcaataccagaagtaaagggaaatatcagacaatattttattattttttcatag2040
atgttctgccacacaaagaacttggggtgtaaggataaggcaaaagctccaatcccattt2100
ttcagttctcctaggatgcacccctcagggagcctggccagagttccgaggcccgtgagc2160
gtcagctgttgctttattttccatcaaagccctctgagaagtgagacctcagcaattccg2220
ggagccacatagagacagacttggcaagggaccccctggttctgagccagtagctgccat2280
ctggaaattcctcttttagcctctccttagaggtgaatgtgagtgaagcctcccaggcac2340
ccgctgaatttctgaggccttgcttaaagctcagaagtggtttaggcatttggaaaatct2400
ggttcacatcataaagaacttgatttgaaatgttttctatagaaacaagtgctaagtgta2460
ccgtattatacttgatgttggtcatttctcagtcctatttctcagttctattattttaga2520
acctagtcagttctttaagattataactggtcctacattaaaataatgcttctcgatgtc2580
agattttacctgtttgctgctgagaacatctctgcctaatttaccaaagccagaccttca2640
gttcaacatgcttccttagcttttcatagttgtctgacatttccatgaaaacaaaggaac2700
caactttgttttaaccaaactttgtttggttacagttttcaggggagcgtttcttccatg2760
acacacagcaacatcccaaagaaataaacaagtgtgacaaaaaaaaaaaaaaacaaacct2820
aaatgctactgttccaaagagcaacttgatggttttttttaatactgggtgcaaaaggtc2880
acccaaattcctatgatgaaattttaaattaatgggcacctttcaacatcatttgcttcc2940
ttatctacagttgattcagaaatctgcattttttattcttttatatgacttttaagtaaa3000
agatttatatggatttg 3017
<210>
4
<211>
3120
<212>
DNA
<213> sapiens
Homo
<400>
4
aaaggaaacacaagttgcttttgataacacatgatgcaaagaaagaattagaaagaatga60
gcaatgaagccggtataaatgacaaacaagtgtccaaaggcccaagaagttactaccaaa120
agctttcaaacaatattggtttatctttaaagacacatccatagcatactttaaaaataa180
ggaacttgaacaaggagaaccacaagaaaaactaaatcttagaggctgcgaagttgtgcc240
cgatgtaaatgtagcaggaagaaaatttggaatcaagttactaatccctgttgccgatgg300
tatgaatgaaatgtatttgagatgtgaccatgagaatcaatacgcccaatggatggctgc360
3
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
ctgcatgttggcatcgaagggcaaaaccatggcagacagctcctaccagccagaggtcct420
caacatcctttcatttctgaggatgaaaaacaggaactctgcatctcaggtggcttccag480
tctcgaaaacatggatatgaacccagaatgttttgtgtcaccacggtgtgcaaaaagaca540
caaatccaaacagctggccgcccggatcctggaggcgcaccagaacgtggcccagatgcc600
cctggtcgaagccaagctgcggttcatccaggcgtggcagtcactgcctgagtttggcct660
cacctactaccttgtcagatttaaaggaagcaaaaaagatgacattctgggagtttcata720
taacaggttgattaaaattgatgcagccaccgggattccagtgacaacatggagattcac780
aaatatcaaacagtggaatgtaaactgggaaacccggcaggtggtcatcgagtttgacca840
aaacgtctttactgctttcacctgcctgagtgcagattgcaagattgtgcacgagtacat900
tggcggctacattttcttgtccacccgctccaaggaccagaatgaaacactcgatgagga960
cttgttccacaaattgaccggcggtcaggattgaaacaagcacgcgtgctcggctcacac1020
caacaaggcaagccaaaggcgCCCCtCCCCagagggatCCCtaaCgtgCCCagCatgtag1080
attctggactaacagacaacatacattcaccgctggtcacccagatcctcattcaaaccc1140
actgctggcacatccctttccttactttgccctgtgctaccagccacggaaggagcctct1200
cttgttttttctataaaatgggtaggcaggagaaaagcaggtgccctaagattgctctaa1260
ggcccagcatgtggttacagttctctgacttgcagaacctgccaggtgtatggctacaag1320
ttatcctcgtgctgatctgtctcattactaagtcaatggagaagacagaaaggtaaaaat1380
cacgtgtagcaagaacaactcttatttcacaaactcaggtatgaaacgaaacgcctgtcc1440
ttcatggaactgcttttagctcctgtcttttcaaaatggcagagggagttcctacacaca1500
ctttttccctggaggccaaggtctaggggtagaaaggggaggggtggggctaccaggtag1560
cagttgacaacccaaggtcagaggagtggccctcagtgtcatctgtccacagtgatacct1620
gccaagatgaccactgacccacatctggtcttagtcattggtctcctcagatttctgggg1680
ccacctgcaagccccattccattcctacagatctctcagccacctgtaagtcctttgtga1740
agatgtgggtgacacagggggacaggaaaacccatttctcaacccagatccatgtctcca1800
CtgCttCtaCtctgggttgggattcaggaagacaggcacagtcctctctgttcatagaaa1860
cacctgccagtgtcaaggattccagtcaggtgtctatcccaactggtcagggagagaagg1920
gcagacccattctcaaagaccaccatgttcaaggtctgacagctccccactggCtgCCCC1980
cacaggggctttaggctggtctgggtcatggggaagcgtccctcttatcgctggtctgtg2040
ttctcctggatttggtatctatgttggtacgactcctggccttttatctaaaggactttg2100
gcttttgtaaatcacaagccaataatagacttttttctccccctctgttttttgctgtgt2160
catctctgccttgagactgccttgagacagtgcttgccctgagagagtgagccaattaac2220
4
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
agctgectgaattgtcattttecattttggtttgttagaggtgggaggggtgggttttga 2280
gaaggtcaaaagcaatacoagaagtaaagggaaatatcagacaatattttattatttttt 2340
catagatgttetgccacacaaagaacttggggtgtaaggataaggcaaaagetccaatec 2400
catttttcagttctcctaggatgcaccectcagggagcetggccagagttecgaggcccg 2460
tgagegtcagotgttgetttattttccatcaaagccctctgagaagtgagacetcagcaa 2520
ttccgggagcoacatagagacagacttggcaagggaccccctggttetgagccagtaget 2580
gccatctggaaattcctcttttagcctctccttagaggtgaatgtgaatgaagcetceca 2640
ggcacccgctgaatttctgaggccttgcttaaagetcagaagtggtttaggcatttggaa 2700
aatctggttcacatcataaagaacttgatttgaaatgttttctatagaaacaagtgetaa 2760
gtgtacegtattatacttgatgttggtcatttctcagtcctatttctcagttctattatt 2820
ttagaacctagtcagttotttaagattataactggtcctacattaaaataatgcttcteg 2880
atgtcagattttacctgtttgctgctgagaacatctetgcctaatttaccaaagecagac 2940
cttcagttcaacatgcttccttagcttttcatagttgtetgacatttccatgaaaacaaa 3000
ggaaccaactttgttttaaccaaactttgt~ttggttacagttttcaggggagegtttctt 3060
.
ccatgacaoacagcaacatcccaaagaaataaacaagtgtgacaaaaaaaaaaaaaaaaa 3120
<210> 5
<211> 238
<212> PRT
<213> Homo Sapiens
<400> 5
Met Ala Ala Ala Pro Leu Leu Leu Leu Leu Leu Leu Val Pro Val Pro
1 5 10 15
Leu Leu Pro Leu Leu Ala Gln Gly Pro Gly Gly Ala Leu Gly Asn Arg
20 25 30
His Ala Val Tyr Trp Asn Ser Ser Asn Gln His Leu Arg Arg Glu Gly
35 40 45
Tyr Thr Val Gln Val Asn Val Asn Asp Tyr Leu Asp Ile Tyr Cys Pro
50 55 60
His Tyr Asn Ser Ser Gly Val Gly Pro Gly Ala Gly Pro Gly Pro Gly
65 70 75 80
Gly Gly Ala Glu Gln Tyr Val Leu Tyr Met Val Ser Arg Asn Gly Tyr
85 90 95
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
Arg Thr Cys Asn Ala Ser Gln Gly Phe Lys Arg.Trp Glu Cys Asn Arg
100 105 110
Pro His Ala Pro His Ser Pro Ile Lys Phe Ser Glu Lys Phe Gln Arg
115 120 125
Tyr Ser Ala Phe Ser Leu Gly Tyr Glu Phe His Ala Gly His Glu Tyr
130 135 140
Tyr Tyr Ile Ser Thr Pro Thr His Asn Leu His Trp Lys Cys Leu Arg
145 150 155 160
Met Lys Val Phe Val Cys Cys Ala Ser Thr Ser His Ser Gly Glu Lys
165 170 175
Pro Val Pro Thr Leu Pro Gln Phe Thr Met Gly Pro Asn Val Lys Ile
180 185 190
Asn Val Leu Glu Asp Phe Glu Gly Glu Asn Pro Gln Val Pro Lys Leu
195 200 205
Glu Lys Ser Ile Ser Gly Thr Ser Pro Lys Arg Glu His Leu Pro Leu
210 215 220
Ala Val Gly Ile Ala Phe Phe Leu Met Thr Phe Leu Ala Ser
225 230 235
<210>
6
<211>
758
<212>
DNA
<213>
Homo
Sapiens
<400>
6
gcggcggcggctccggggatggcggcggctccgctgctgctgctgctgctgctcgtgecc60
gtgccgctgctgccgctgctggcccaagggcccggaggggcgctgggaaaccggcatgcg120
gtgtactggaacagctccaaccagcacctgcggcgagagggctacaccgtgcaggtgaac180
gtgaacgactatctggatatttactgcccgcactacaacagctcgggggcgggaccgggg240
cccggaggcggggcagagcagtacgtgctgtacatggtgagccgcaacggctaccgcacc300
tgcaacgccagccagggcttcaagcgctgggagtgcaaccggccgcacgccccgcacagc360
cccatcaagttctcggagaagttccagcgctacagcgccttctctctgggctacgagttc420
cacgccggccacgagtactactacatctccacgcccactcacaacctgcactggaagtgt480
ctgaggatgaaggtgttcgtctgctgcgcctCCdCatCgCaCtCCggggagaagccggtc540
6
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
cccactctcc cccagttcac catgggcccc aatgtgaaga tcaacgtgct ggaagacttt 600
gagggagaga accctcaggt gcccaagctt gagaagagca tcagcgggac cagccccaaa 660
cgggaacacc tgcccctggc cgtgggcatc gccttcttcc tcatgacgtt cttggcctcc 720
tagctctgcc ccctcccctg gggggggaga gatggggc 758
<210> 7
<211> 187
<212> PRT
<213> Mus musculus
<400> 7
Met Arg Arg Glu Gly Tyr Thr Val Gln Val Asn Val Asn Asp Tyr Leu
1 5 10 15
Asp Ile Tyr Cys Pro His Tyr Asn Ser Ser Gly Pro Gly Gly Gly Ala
20 25 30
Glu Gln Tyr Val Leu Tyr Met Val Asn Leu Ser Gly Tyr Arg Thr Cys
35 40 45
Asn Ala Ser Gln Gly Ser Lys Arg Trp Glu Cys Asn Arg Gln His Ala
50 55 60
Ser His Ser Pro Ile Lys Phe Ser Glu Lys Phe Gln Arg Tyr Ser Ala
65 70 75 80
Phe Ser Leu Gly Tyr Glu Phe His Ala Gly Gln Glu Tyr Tyr Tyr Ile
85 90 95
Ser Thr Pro Thr His Asn Leu His Trp Lys Cys Leu Arg Met Lys Val
100 105 110
Phe Val Cys Cys Ala Ser Thr Ser His Ser Gly Glu Lys Pro Val Pro
115 120 125
Thr Leu Pro Gln Phe Thr Met Gly Pro Asn Val Lys Ile Asn Val Leu
130 135 140
Glu Asp Phe Glu Gly Glu Asn Pro Gln Val Pro Lys Leu Glu Lys Ser
145 150 155 160
Ile Ser Gly Thr Ser Pro Lys Arg Glu His Leu Pro Leu Ala Val Gly
165 170 175
7
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
Ile Ala Phe Phe Leu Met Thr Leu Leu Ala Ser
180 185
<210>
8
<211>
1743
<212>
DNA
<213> sapiens
Homo
<400>
8
gctgctgctgctgctgctgctcgtgcccgtgccgctgctgccgctgctggcccaagggcc~60
cggaggggcgctgggaaaccggcatgcggtgtactggaacagctccaaccagcacctgcg 120
gcgagagggctacaccgtgcaggtgaacgtgaacgactatctggatatttactgcccgca 180
ctacaacagctcgggggtgggccccggggcgggaccggggcccggaggcggggcagagca 240
gtacgtgctgtacatggtgagecgcaacggctaccgcacctgcaacgccagccagggctt 300
caagcgctgggagtgcaaccggCCgCaCgCCCCgCaCagCCCCatCaagttCtCggagaa 360
gttccagcgctacagcgccttctctctgggctacgagttccacgccggccacgagtacta 420
CtaCatCtCCaCgCCCa.CtCaCaaCCtgCaCtggaagtgtctgaggatgaaggtgttcgt 480
ctgctgcgcctccacatcgcactccggggagaagCCggtCCCCa.CtCtCCCCCagttCaC 540
catgggccccaatgtgaagatcaacgtgctggaagactttgagggagagaaccctcaggt 600
gcccaagcttgagaagagcatcagcgggaccagccccaaacgggaacacctgcccctggc 660
cgtgggcatcgCCttCttCCtcatgacgttCttggCCtCCtagctctgccCCCtCCCCtg 720
gggggggagagatggggcggggcttggaaggagcagggagCCtttggCCtctccaaggga 780
agcctagtgggcctagacccctcctcccatggctagaagtggggcctgcaccatacatct 840
gtgtCCgCCCCCtCtaCCCCttccccccacgtagggcactgtagtggaccaagcacgggg 900
acagccatgggtcccgggcggccttgtggctctggtaatgtttggtaccaaacttggggg 960
ccaaaaagggcagtgctcaggactccctggCCCCtggtaCCtttCCCtgactcctggtgc 1020
CCtCtCCCtttgtCCCCCCagagagacatatgcccccagagagagcaaatcgaagcgtgg 1080
gaggcacccc cattgctctc ctccaggggc agaacatggg gaggggacta gatgggcaag 1140
gggcagcactgcctgctgcttccttcccctgtttacagcaataagcacgtCCtCCtCCCC1200
cactcccacttccaggattgtggtttggattgaaaccaagtttacaagtagaCaCCCCtg1260
ggggggcgggcagtggacaaggatgccaaggggtgggcattggggtgccaggcaggcatg1320
tacagactctatatctctatatataatgtacagacagacagagtcccttccctctttaac1380
CCCCtgaCCtttcttgacttCCCCttCagCttCagaCCCCttCCCCaCCaggctaggccc1440
cccacacctgggggaccccctggcccctcttttgtcttctgtgaagacaggacctatgca1500
acgcacagacacttttggagaccgtaaaacaacagcgccccctcccttccagccctgagc1560
8
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
cgggaaccat ctcccaggac cttgccctgc tCa.CCCtatg tggtcccacc tatCCtCCtg 1620
ggcctttttc aagtgctttg gctgtgactt tcatactctg ctcttagtct aaaaaaaata 1680
aactggagat aaaaataaaa aaaatacctc gagaaaaaaa aaaaaaaaaa aaaaaaaaaa 1740
aaa 1743
<210>
9
<211>
2103
<212>
DNA
<213> Sapiens
Homo
<400>
9
cggcacgaggcgcgactgcgaggctggacgytacgggctcctggaaaggagacaccagca60
tttgccacaatgctgtcatccactgactttacatttgcttcctgggagcttgtggtccgc120
gttgaccatcccaatgaagagcagcagaaagacgtcacactgagagtatctggagacctt180
cacgttggaggagtgatgctcaagttagtagaacagatcaatatatcccaagactggtca240
gactttgctctttggtgggaacagaagcattgctggcttctgaaaacccactggaccctg300
gacaaatatggggtccaggcagatgcaaag,CttCtCttCaCCCCtCagCataaaatgctg360
cgccttcgtctgccgaatttgaagatggtgaggttgcgagtcagcttctcagctgtggtt420
tttaaagctgtcagtgatatctgcaaaatcctgaatattagaagatcagaagagctttcc480
ttgttaaagccgtctggtgactattttaagaagaagaagaaaaaagacaaaaataataag540
gaacccataattgaagatattctaaacctggagagttctccaacagcttcaggttcatca600
gtaagtcctggtttatacagtaaaaccatgacccctatatatgaccccatcaatggaaca660
ccagcatcatccaccatgacttggttcagtgacagccctttgacggaacaaaactgcagc720
atCCtCgCattCagCCaaCCCCCCCagtCCCCagaagCaCttgcggatatgtaccagcct780
cggtctctggttgataaagccaagctcaatgcaggttggctagaCtCCtCaCgCtCCCtt840
atggaacaaggcatccaagaggatgagcagctgctcttacgatttaaatattattctttc900
ttcgacttgaatcctaaatatgatgctgtccgaataaaccaactctatgagcaagccagg960
tgggccattctcttagaagaaattgattgcacagaggaagaaatgttgatctttgcagct1020
ctacagtaccacattagcaaactgtcgttgtctgctgaaacacaggattttgcaggcgag1080
tccgaggttgatgaaatagaagcggcgctttctaatttggaagtaaccctagaaggtgga1140
aaagcggacagccttttggaggacattactgatatccctaaacttgcagataatctcaaa1200
ttatttaggcccaagaagttactaccaaaagctttcaaacaatattggtttatctttaaa1260
gacacatccatagcatactttaaaaataaggaacttgaacaaggagaaccactagaaaaa1320
ctaaatcttagaggctgegaagttgtgcccgatgtaaatgtagcaggaagaaaatttgga1380
9
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
atcaagttactaatccctgttgccgatggtatgaatgaaatgtatttgagatgtgaccat1440
gagaatcaatacgcccaatggatggctgcctgcatgttggcatcgaagggcaaaaccatg1500
gcagacagctcctaccagccagaggtcctcaacatcctttcatttctgaggatgaaaaac1560
aggaactctgcatctcaggtggcttccagtctcgaaaacatggatatgaacccagaatgt1620
tttgtgtcaccacggtgtgcaaagaaacacaaatccaaacagctggccgcccggatcctg1680
gaggcgcaccagaacgtggcccagatgcccctggtcgaagccaagctgcggttcatccag1740
gcgtggcagtcactgcctgagtttggcctcacctactaccttgtcagatttaaaggaagc1800
aaaaaagatgacattctgggagtttcatataacaggttgattaaaattgatgCagCCa.CC1860
gggattccagtgacaacatggagattcacaaatatcaaacagtggaatgtaaactgggaa1920
acccggcaggtggtcatcgagtttgaccaaaacgtctttactgctttcacctgcctgagt1980
gcagattgcaagattgtgcacgagtacattggcggctacattttCttgtCCaCCCgCtCC2040
aaggaccaga atgaaacact cgatgaggac ttgttccaca aattgaccgg cggtcaggat 2100
taa 2103
<210> 10
<211> 238
<212> PRT
<213> Homo Sapiens
<400> 10
Met Ala Ala Ala Pro Leu Leu Leu Leu Leu Leu Leu Val Pro Val Pro
1 5 10 15
Leu Leu Pro Leu Leu Ala Gln Gly Pro Gly Gly Ala Leu Gly Asn Arg
20 25 30
His Ala Val Tyr Trp Asn Ser Ser Asn Gln His Leu Arg Arg Glu Gly
35 40 45
Tyr Thr Val Gln Val Asn Val Asn Asp Tyr Leu Asp Ile Tyr Cys Pro
50 55 60
His Tyr Asn Ser Ser Gly Val Gly Pro Gly Ala Gly Pro Gly Pro Gly
65 70 75 80
Gly Gly Ala G1u Gln Tyr Val Leu Tyr Met Val Ser Arg Asn Gly Tyr
85 90 95
Arg Thr Cys Asn Ala Ser Gln Gly Phe Lys Arg Trp Glu Cys Asn Arg
100 105 110
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
Pro His Ala Pro His Ser Pro Ile Lys Phe Ser Glu Lys Phe Gln Arg
115 120 125
Tyr Ser Ala Phe Ser Leu Gly Tyr Glu Phe His Ala Gly His Glu Tyr
130 135 140
Tyr Tyr Ile Ser Thr Pro Thr His Asn Leu His Trp Lys Cys Leu Arg
145 150 155 160
Met Lys Val Phe Val Cys Cys Ala Ser Thr Ser His Ser Gly Glu Lys
165 170 175
Pro Val Pro Thr Leu Pro Gln Phe Thr Met Gly Pro Asn Val Lys Ile
180 185 190
Asn Val Leu Glu Asp Phe Glu Gly Glu Asn Pro Gln Val Pro Lys Leu
195 200 205
Glu Lys Ser Ile Ser Gly Thr Ser Pro Lys Arg Glu His Leu Pro Leu
210 215 220
Ala Val Gly Ile Ala Phe Phe Leu Met Thr Phe Leu Ala Ser
225 230 235
<210> 11
<211> 677
<212> PRT
<213> Homo Sapiens
<400> 11
Met Leu Ser Ser Thr Asp Phe Thr Phe Ala Ser Trp Glu Leu Val Val
1 5 10 15
Arg Val Asp His Pro Asn Glu Glu Gln Gln Lys Asp Val Thr Leu Arg
20 25 30
Val Ser Gly Asp Leu His Val Gly Gly Va1 Met Leu Lys Leu Val Glu
35 40 45
Gln Ile Asn Ile Ser Gln Asp Trp Ser Asp Phe Ala Leu Trp Trp Glu
50 55 60
Gln Lys His Cys Trp Leu Leu Lys Thr His Trp Thr Leu Asp Lys Tyr
65 70 75 80
11
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
Gly Val Gln Ala Asp Ala Lys Leu Leu Phe Thr Pro Gln His Lys Met
85 90 95
Leu Arg Leu Arg Leu Pro Asn Leu Lys Met Val Arg Leu Arg Val Ser
100 105 110
Phe Ser Ala Val Val Phe Lys Ala Val Ser Asp Ile Cys Lys Ile Leu
115 120 125
Asn Ile Arg Arg Ser Glu Glu Leu Ser Leu Leu Lys Pro Ser Gly Asp
130 135 140
Tyr Phe Lys Lys Lys Lys Lys Lys Asp Lys Asn Asn Lys Glu Pro Ile
145 150 155 160
Ile Glu Asp Ile Leu Asn Leu Glu Ser Ser Pro Thr Ala Ser Gly Ser
165 170 175
Ser Val Ser Pro Gly Leu Tyr Ser Lys Thr Met Thr Pro Ile Tyr Asp
180 185 190
Pro Ile Asn Gly Thr Pro Ala Ser Ser Thr Met Thr Trp Phe Ser Asp
195 200 205
Ser Pro Leu Thr Glu Gln Asn Cys Ser Ile Leu Ala Phe Ser Gln Pro
210 215 220
Pro Gln Ser Pro Glu Ala Leu Ala Asp Met Tyr Gln Pro Arg Ser Leu
225 230 235 240
Val Asp Lys Ala Lys Leu Asn Ala Gly Trp Leu Asp Ser Ser Arg Ser
245 250 255
Leu Met Glu Gln Gly Ile Gln Glu Asp Glu Gln Leu Leu Leu Arg Phe
260 265 270
Lys Tyr Tyr Ser Phe Phe Asp Leu Asn Pro Lys Tyr Asp Ala Val Arg
275 280 285
Ile Asn Gln Leu Tyr Glu Gln Ala Arg Trp Ala Ile Leu Leu Glu Glu
290 295 300
Ile Asp Cys Thr Glu Glu Glu Met Leu Ile Phe Ala Ala Leu Gln Tyr
305 310 315 320
His Ile Ser Lys Leu Ser Leu Ser Ala Glu Thr Gln Asp Phe Ala Gly
12
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
325 330 335
Glu Ser Glu Val Asp Glu Ile Glu Ala Ala Leu Ser Asn Leu Glu Val
340 345 350
Thr Leu Glu Gly Gly Lys Ala Asp Ser Leu Leu Glu Asp Ile Thr Asp
355 360 365
Ile Pro Lys Leu Ala Asp Asn Leu Lys Leu Phe Arg Pro Lys Lys Leu
370 375 380
Leu Pro Lys Ala Phe Lys Gln Tyr Trp Phe Ile Phe Lys Asp Thr Ser
385 390 395 400
Ile Ala Tyr Phe Lys Asn Lys Glu Leu Glu Gln Gly Glu Pro Leu Glu
405 410 415
Lys Leu Asn Leu Arg Gly Cys Glu Val Val Pro Asp Val Asn Val Ala
420 425 430
Gly Arg Lys Phe Gly Ile Lys Leu Leu Ile Pro Val Ala Asp Gly Met
435 440 445
Asn Glu Met Tyr Leu Arg Cys Asp His Glu Asn Gln Tyr Ala Gln Trp
450 455 460
Met Ala Ala Cys Met Leu Ala Ser Lys Gly Lys Thr Met Ala Asp Ser
465 470 475 480
Ser Tyr Gln Pro Glu Val Leu Asn Ile Leu Ser Phe Leu Arg Met Lys
485 490 495
Asn Arg Asn Ser Ala Ser Gln Val Ala Ser Ser Leu Glu Asn Met Asp
500 505 510
Met Asn Pro Glu Cys Phe Val Ser Pro Arg Cys Ala Lys Lys His Lys
515 520 525
Ser Lys Gln Leu Ala Ala Arg Ile Leu Glu Ala His Gln Asn Val Ala
530 535 540
Gln Met Pro Leu Val Glu Ala Lys Leu Arg Phe Ile Gln Ala Trp Gln
545 550 555 560
Ser Leu Pro Glu Phe Gly Leu Thr Tyr Tyr Leu Val Arg Phe Lys Gly
565 570 575
13
CA 02431313 2003-06-05
WO 02/059609 PCT/USO1/48368
Ser Lys Lys Asp Asp Ile Leu Gly Val Ser Tyr Asn Arg Leu Ile Lys
580 585 - 590
Ile Asp Ala Ala Thr Gly Ile Pro Val Thr Thr Trp Arg Phe Thr Asn
595 600 605
Ile Lys Gln Trp Asn Val Asn Trp Glu Thr Arg Gln Val Val Ile Glu
610 615 620
Phe Asp Gln Asn Val Phe Thr Ala Phe Thr Cys Leu Ser Ala Asp Cys
625 630 635 640
Lys Ile Val His Glu Tyr Ile Gly Gly Tyr Ile Phe Leu Ser Thr Arg
645 650 655
Ser Lys Asp Gln Asn Glu Thr Leu Asp Glu Asp Leu Phe His Lys Leu
660 665 670
Thr Gly Gly Gln Asp
675
<210> 12
<211> 5
<212> PRT
<213> Unknown
<220>
<223> cytokine receptor extracellular motif found in many species
<220>
<221> MISC_FEATURE
<222> (3). (3)
<223> "Xaa" at position 3 can be any amino acid.
<400> 12
Trp Ser Xaa Trp Ser
1 5
14
