Note: Descriptions are shown in the official language in which they were submitted.
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
ISOLATED MOLECULES COMPRISING EPITOPES CONTAINING
SULFATED MOIETIES, ANTIBODIES TO SUCH EPITOPES, AND USES
THEREOF
FIELD OF THE INVENTION
[1.] The present invention relates to epitopes that are present on cells, such
as
cancer cells, metastatic cells, leukemia cells, and platelets, and that are
important in such
diverse physiological phenomena as cell rolling, metastasis, inflammation,
auto-immune
diseases, such as idiopathic thrombocytopenia purpura (ITP), adhesion,
thrombosis and/
or restenosis, and aggregation. The present invention relates to therapeutic
and diagnostic
methods and compositions using antibodies directed against such epitopes. The
present
invention also relates to the field of tissue targeting and identification,
with the aid of
phage display technology, of peptides and polypeptides that specifically bind
to target
cells. Such peptides and polypeptides are antibodies and antigen binding
fragments
thereof, constructs thereof, fragments of either or constructs of a fragment.
More
particularly, the peptides and polypeptides may have anti-cancer activity,
anti-metastatic
activity, anti-leukemia activity, anti-viral activity, anti-infection
activity, and/or activity
against other diseases, such as inflammatory diseases, diseases involving
abnormal or
pathogenic adhesion, thrombosis and/ or restenosis, diseases involving
abnormal or
pathogenic aggregation, and autoimmune diseases, cardiovascular diseases such
as
myocardial infarction, retinopathic diseases, diseases caused by sulfated
tyrosine-
dependent protein-protein interactions, and diseased cells generally.
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
BACKGROUND OF THE INVENTION
Antibodies, Phase Display, and Tissue Tar~etin~
[2.] Tissue-selective targeting of therapeutic agents is an emerging
discipline
in the pharmaceutical industry. New cancer treatments based on targeting have
been
designed to increase the specificity and potency of the treatment, while
reducing toxicity,
thereby enhancing overall efficacy. Mouse monoclonal antibodies (MAb's) to
tumor-
associated antigens have been employed - in an attempt to target toxin,
radionucleotide,
and chemotherapeutic conjugates to tumors. In addition, differentiation
antigens, such as
CD19, CD20, CD22 and CD25, have been exploited as cancer specific targets in
treating
hematopoietic malignancies. Although extensively studied, this approach has
several
limitations. One limitation is the difficulty of isolating appropriate
monoclonal antibodies
that display selective binding. A second limitation is the need for high
antibody
immunogenicity as a prerequisite for successful antibody isolation. A third
limitation is
that the final product comprises non-human sequences, which gives rise to an
immune
response to the non-human material (e.g., human anti-mouse antibody-HAMA
response).
The HAMA response often results in a shorter serum half life and prevents
repetitive
treatments, thus diminishing the therapeutic value of the antibody. This
latter limitation
has stimulated interest both in engineering chimeric or humanized monoclonal
antibodies
of murine origin, and in discovering human antibodies. Another limitation of
this
approach is that it enables the isolation of only a single antibody species
directed against
only known and purified antigens. Moreover, this method is not selective
insofar as it
allows for the isolation of antibodies against cell surface markers that are
present on
normal, as well as on malignant, cells.
[3.] There are many factors that influence the therapeutic efficacy of MAb's
for
treating cancer. These factors include specificity of antigen expression on
tumor cells,
level of expression, antigenic heterogeneity and accessibility of the tumor
mass.
Leukemia and lymphoma have been generally more responsive to treatment with
antibodies than solid tumors, such as carcinomas. MAb's rapidly bind to
leukemia and
lymphoma cells in the bloodstream and easily penetrate to malignant cells in
lymphatic
tissue, thus making lymphoid tumors excellent candidates for MAb-based
therapy. An
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
ideal system entails identifying a MAb that recognizes a marker on the cell
surface of
stem cells that are producing malignant progeny cells.
[4.] Phage libraries are used to select random single chain Fv's (scFv's) that
bind to isolated, pre-determined target proteins such as antibodies, hormones
and
receptors. In addition, the use of antibody display libraries in general, and
phage scFv
libraries in particular, facilitates an alternative means of discovering
unique molecules for
targeting specific, yet unrecognized and undetermined, cell surface moieties.
[5.] Leukemia, lymphoma, and myeloma are cancers that originate in the bone
marrow and lymphatic tissues and are involved in uncontrolled growth of cells.
Acute
lymphoblastic leukemia (ALL) is a heterogeneous disease that is defined by
specific
clinical - and immunological characteristics. Like other forms of ALL, the
definitive
cause of most cases of B-cell ALL (B-ALL) is not known although, in many
cases, the
disease results from acquired genetic alterations in the DNA of a single cell,
causing it to
become abnormal and multiply continuously. Prognosis for patients afflicted
with B-
ALL is significantly worse than for patients with other leulcemias, both in
children and in
adults.
[6.] Acute Myelogenous Leulcemia (AML) is a heterogeneous group of
neoplasms with a progenitor cell that, under normal conditions, gives rise to
terminally
differentiated cells of the myeloid series (erythrocytes, granulocytes,
monocytes, and
platelets). As in other forms of neoplasia, AML is associated with acquired
genetic
alterations that result in replacement of normally differentiated myeloid
cells with
relatively undifferentiated blasts, exhibiting one or more type of early
myeloid
differentiation. AML generally evolves in the bone marrow and, to a lesser
degree, in the
secondary hematopoietic organs. AML primarily affects adults, peaking in
incidence
between the ages of 15-40 years, but it is also known to affect both children
and older
adults. Nearly all patients with AML require treatment immediately after
diagnosis to
achieve clinical remission, in which there is no evidence of abnormal levels
of circulating
undifferentiated blast cells.
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
[7.] To date, a variety of monoclonal antibodies has been developed that
induce cytolytic activity against tumor cells. A humanized version of the
monoclonal
' antibody MuMAb4D5, directed to the extracellular domain of P 185 - growth
factor
receptor (HER2) - was approved by the FDA and is being used to treat human
breast
cancer (US Patent Nos. 5,821,337 and 5,720,954). Following binding, the
antibody is
capable of inhibiting tumor cell growth that is dependent on the HER2 growth
factor
receptor. In addition, a chimeric antibody against CD20, which causes rapid
depletion of
peripheral B cells, including those associated with lymphoma, was recently
approved by
the FDA (US Patent No. 5,843,439). The binding of this antibody to target
cells results
in complement-dependent lysis. This product has recently been approved and is
currently
being used in the clinic to treat low-grade B-cell non-Hodgkin's lymphoma.
[8.] Several other humanized and chimeric antibodies are under development
or are in clinical trials. In addition, a humanized Ig that specifically
reacts with CD33
antigen, expressed both on normal myeloid cells as well as on most types of
myeloid
leukemic cells, was conjugated to the anti-cancer drug calicheamicin, CMA-676
(Sievers
et al., Blood Supplement, 308, 504a (1997)). This conjugate, known as the drug
Mylotarg~, has recently received FDA approval (Caron et al., Cancer
Supplement, 73,
1049-1056 (1994)). In light of its cytolytic activity, an additional anti-CD33
antibody
(HumMl95), currently in clinical trials, was conjugated to several cytotoxic
agents,
,including the gelonin toxin (McGraw et al., Cancer Imnzunol. Imnzunother, 39,
367-374
(1994)) and radioisotopes 1311 (Caron et al., Blood 83, 1760-1768 (1994)),
~°Y (Jurcic et
al., Blood Supplement, 92, 613a (1998)) and 213Bi (Humm et al., Blood
Supplement,
38:231P (1997)).
[9.] A chimeric antibody against the leukocyte antigen CD45 (cHuLym3) is in
clinical studies for treatment of human leukemia and lymphoma (Sun et al.,
Cancer
Imnzunol. Imnzunother., 48, 595-602 (2000)). In in vitro assays, specific cell
lysis was
observed in ADCC (antibody dependent cell-mediated cytotoxicity) assays
(Henkart,
Immunity, 1, 343-346 (1994); Squier and Cohen, Current Opin. Inzmunol., 6, 447-
452
(1994)).
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
[10.] In contrast to mouse monoclonal humanization and construction of
chimeric antibodies, the use of phage display technology enables the isolation
of scFv's
comprising fully human sequences. A fully human antibody against the human
TGFb2
receptor based on a scFv clone derived from phage display technology was
recently
developed. This scFv, converted into a fully human IgG4 that is capable of
competing
with the binding of TGFb2 (Thompson et al., J. Inamuf~ol Metlaods, 227, 17-29
(1999)),
has strong anti-proliferative activity. This technology, known to one skilled
in the art, is
more specifically described in the following publications: Smith, Science,
228, 1315
(1985); Scott et al, Scieface, 249, 386-390 (1990); Cwirla et al., PNAS, 87,
6378-6382
(1990); Devlin et al., Science; 249, 404-406 (1990); Griffiths et al., EMBO,L,
13(14),
3245-3260 (1994); Bass et al., Proteins, 8, 309-314 (1990); McCafferty et al.,
Nature,
348, 552-554(1990); Nissim et al., EMBO J., 13, 692 -698 (1994); U.S. Patent
Nos
5,427,908, 5,432,018, 5,223,409 and 5,403,484, lib.
Ligand for Isolated scFv Antibody Molecules
[1 l.] Platelets, fibrinogen, GPIb, selectins, and PSGL-1 each play an
important
role in several pathogenic conditions or disease states, such as abnormal or
pathogenic
inflammation, abnormal or pathogenic immune reactions, autoimmune reactions,
metastasis, abnormal or pathogenic adhesion, thrombosis and/ or restenosis,
and abnormal
or pathogenic aggregation. Thus, antibodies that crossreact with platelets and
with these
molecules would be useful in the diagnosis and treatment of diseases and
disorders
involving these and other pathogenic conditions.
Platelets
[12.] Platelets are well-characterized components of the blood system and play
several important roles in hemostasis, thrombosis and/ or restenosis, and
restenosis.
Damage to blood vessel sets in motion a process known as hemostasis, which is
characterized by series of sequential events. The initial reaction to damaged
blood vessels
is the adhesion of platelets to the affected region on the inner surface of
the vessel. The
next step is the aggregation of many layers of platelets onto the previously
adhered
platelets, forming the hemostatic plug. This clump of platelets seals the
vessel wall. The
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
hemostatic plug is strengthened by the deposition of fibrin polymers. The clot
is
degraded only when the damage has been repaired.
Imuortance of Platelets in Metastasis
[13.] Tumor metastasis is perhaps the most important factor limiting the
survival
of cancer patients. Accumulated data indicate that the ability of tumor cells
to interact
with host platelets represents one of the indispensable determinants of
metastasis. Leslie
Oleksowicz, Z.M., "Characterization Of Tumor-Induced Platelet Aggregation: The
Role
Of Immunorelated GPIb And GPIIb/IIIa Expression By MCF-7 Breast Cancer Cells,"
Thrombosis Research 79: 261-274 (1995).
[14.] It has been demonstrated that the ability of tumor cells to aggregate
platelets correlates with the tumor cells' metastasis potential, and
inhibition of tumor-
induced platelet aggregation has been shown to correlate with the suppression
of
metastasis in rodent models. It has been demonstrated that tumor cell
interaction with
platelets involves membrane adhesion molecules and agonist secretion.
Expression of
immunorelated platelet glycoproteins has been identified on tumor cell lines.
It was
demonstrated that platelet immunorelated glycoproteins, GPTb, GPIIb/IIIa.
GPIb/IX and
the integrin a,, subunit are expressed on the surface of breast tumor cell
lines.
Oleksowicz, Z.M., "Characterization Of Tumor-Induced Platelet Aggregation: The
Role
Of Immunorelated GPIb And GPIIb/IIIa Expression By MCF-7 Breast Cancer Cells,"
Thrombosis Research 79: 261-274 (1995); Kamiyama, M., et al., "Inhibition of
platelet
GPIIb/IIIa binding to fibrinogen by serum factors: studies of circulating
immune
complexes and platelet antibodies in patients with hemophilia, immune
thrombocytopenic
purpura, human immunodeficiency virus-related immune thrombocytopenic purpura,
and
systemic lupus erythematosus," J Lab Clin Med 117(3): 209-17 (1991).
[15.] Gasic (J.T.B. Gasic et al., Proc. Natl. Acad. Sci. USA 61:46-52 (1968))
and coworkers showed that antibody- induced thrombocitopenia markedly reduced
the
number and volume of metastases produced by CT26 colon adenocarcinoma, Lewis
lung
carcinoma, and B16 melanoma. Karpatkin, S., et al., "Role of adhesive proteins
in
platelet tumor interaction in vitro and metastasis formation in vivo," J.
Clin. Invest. 81 (4):
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
1012-9 (1988); Clezardin, P., et al., "Role of platelet membrane glycoproteins
Ib/IX and
IIb/IIIa, and of platelet alpha-granule proteins in platelet aggregation
induced by human
osteosarcoma cells," Cancer Res. 53(19): 4695-700 (1993). Furthermore, a
single
polypeptide chain (60kd) was found to be expressed on surface membrane of HEL
cells
which is closely related to GPIb and corresponds to an incompletely or
abnormally O-
glycosylated GPIba subunit. Kieffer, N., et al., "Expression of platelet
glycoprotein Ib
alpha in HEL cells," J. Biol. Chem. 261(34): 15854-62 (1986).
GPIb Complex
[16.] Each step in the process of hemostasis requires the presence of
receptors
on the.platelet surface. One receptor that is important in hemostasis is the
glycoprotein
Ib-IX complex (also known as CD42). This receptor mediates adhesion (initial
attachment) of platelets to the blood vessel wall at sites of injury by
binding von
Willebrand factor (vWF) in the subendothelium. It also has crucial roles in
two other
platelet functions important in hemostasis: (a) aggregation of platelets
induced by high
shear in regions of arterial stenosis and (b) platelet activation induced by
low
concentrations of thrombin.
[17.] The GPIb-IX complex is one of the major components of the outer surface
of the platelet plasma membrane. The GPIb-IX complex comprises three membrane-
spanning polypeptides- a disulfide-linked 130 kDa a-chain and 25 kDa (3-chain
of GPIb
and noncovalently associated GPIX (22 kDa). All four units are presented in
equimolar
amounts on the platelet membrane, for efficient cell-surface expression and
function of
CD42 complex, indicating that proper assembly of the three subunits into a
complex is
required for full expression on the plasma membrane. The a-chain of GPIb
consists of
three distinct structural domains: (1) a globular N-terminal peptide domain
containing
leucine-rich repeat sequences and Cys-bonded flanking sequences; (2) a highly
glycosylated mucin-like macroglycopeptide domain; and (3) a membrane-
associated C-
terminal region that contains the disulfide bridge to GPIb (3 and
transmembrane and
cytoplasmic sequences.
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
[18.] Several lines of evidence indicate that the vWF and thrombin-binding
domain of the GPIb-IX complex reside in a globular region that encompasses
approximately 300 amino acids at the amino terminus of GPIba. The human
platelets
GPIb-IX complex is a key membrane receptor mediating both platelet function
and
reactivity. Recognition of subendothelial-bound vWF by GPIb allows platelets
to adhere
to damaged blood vessels. Further, binding of vWF to GPIba also induces
platelet
activation, which may involve the interaction of a cytoplasmic domain of the
GPIb-IX
with cytoskeleton or phospolipase A2. Moreover, GPIba contains a high-affinity
binding
site for a-thrombin, which, by an as-yet poorly defined mechanism, facilitates
platelet
activation.
[19.] The N-terminal globular domain of GPIba contains a cluster of negatively
charged amino. Several lines of evidence indicate that, in transfected CHO
cells
expressing GPIb-IX complex and in platelet GPIbcx, the three tyrosine residues
contained
in this domain (Tyr-276, Tyr-278, and Tyr-279) undergo sulfation.
Protein Sulfation
[20.] Protein sulfation is a widespread posttranslational modification that
involves enzymatic covalent attachment of sulfate, either to sugar side chains
or to the
polypeptide backbone. This modification occurs in the trans-Golgi compartment
and,
therefore affects only protein that traverses this compartment. Such proteins
include
secretory proteins, proteins targeted for granules, and the extracellular
regions of plasma
membrane proteins. Tyrosine is an amino acid residue presently known to
undergo
sulfation. J.W. Kehoe et al., Chemistry and Biol 7: R57-R61 (2000). Other
amino acids,
for example threonine, may perhaps also undergo sulfation, particularly in
diseased cells.
[21.] A number of proteins have been found to be tyrosine-sulfated, but the
presence of three or more sulfated tyrosines in a single polypeptide, as was
found on
GPIb, is not common. GPIba (CD42), which is expressed by platelets and
megakaryocytes mediates platelet attachment to and rolling on subendothelium
via
binding with vWF, also contains numerous negative charges at its N-terminal
domain.
Such a highly acidic and hydrophilic environment is thought to be a
prerequisite for
8
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
sulfation because tyrosylprotein sulfotransferase specifically recognizes and
sulfates
tyrosines adjacent to acidic amino residues. J.R. Bundgaard et al., JBC
272:21700-21705
(1997). Full sulfation of the acidic region of GPIba yields a region with
remarkable
density of negative charge -- 13 negative charges within a 19 amino acid
stretch, making
it a candidate site for electrostatic interaction with other proteins.
Selectins and PSGL-1
[22.] The P-, E-, and L- Selectins are a family of adhesion molecules that,
among other functions, mediate rolling of leukocytes on vascular endothelium.
P-
Selectin is stored in granules in platelets and is transported to the surface
after activation
by thrombin, histamine, phorbol ester, or other stimulatory molecules. P-
Selectin is also
expressed on activated endothelial cells. E-Selectin is expressed on
endothelial cells, and
L-Selectin is expressed on neutrophils, monocytes, T cells, and B cells.
[23.] P-Selectin Glycoprotein Ligand-1 (PSGL-1, also called CD162) is a mucin
glycoprotein ligand for P-Selectin, E-Selectin, and L-Selectin. PSGL-1 is a
disulfide-
linked homodimer that has a PACE (Paired Basic Amino Acid Converting Enzymes)
cleavage site. PSGL-1 also has three potential tyrosine sulfation sites
followed by
approximately 15 decamer repeats that are high in proline, serine, and
threonine. The
extracellular portion of PSGL-1 contains three N-linked glycosylation sites
and has
numerous sialylated, fucosylated O-linked oligosaccharide branches. K.L. Moore
et al.,
JBC 118:445-456 (1992). Most of the N-glycan sites and many of the O-glycan
sites axe
occupied. The structures of the O-glycans of PSGL-1 from human HL-60 cells
have been
determined. A subset of these O-glycans are core-2, sialylated and fucosylated
structures
that are required for binding to selectins. Tyrosine sulfation of an amino-
terminal region
of PSGL-1 is also required for binding to P-Selectin and L-Selectin. Further,
there is an
N-terminal propeptide that is probably cleaved post-translationally.
[24.] PSGL-1 has 361 residues in HL60 cells, with a 267 residue extracellular
region, a 25 residue trans-membrane region, and a 69 residue intracellular
region. The
sequence encoding PSGL-1 is in a single exon, so alternative splicing should
not be
possible. However, PSGL-1 in HL60 cells, and in most cell lines, has 15
consecutive
9
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
repeats of a 10 residue consensus sequences present in the extracellular
region, but there
are 14 and 16 repeats of this sequence, as well, in polymorphonuclear
leukocytes,
monocytes, and several other cell lines, including most native leukocytes.
PSGL-1 forms
a disulfide-bonded homodimer on the cell surface. V. Afshar-Kharghan et al.,
Blood
97:3306-3312 (2001).
[25.] PSGL-1 is expressed on neutrophils as a dimer, with apparent molecular
weight of both 250 kDa and 160 kDa, whereas on HL60 the dimeric form is 220
kDa.
When analyzed under reducing conditions, each subunit is reduced by half.
Differences
in molecular mass may be due to polymorphisms in the molecule caused by the
presence
of different numbers of decamer repeats. Leukocyte Typing VI. Edited by T.
Kishimoto
et al. (1997).
[26.] PSGL-1 is expressed on most blood leukocytes, such as neutrophils,
monocytes, leukocytes, subset of B cells, and all T cells and mediates rolling
of
neutrophils on P-Selectin. Leukocyte Typing VI. Edited by T. I~ishimoto et al.
(1997).
PSGL-1 may also mediate neutrophil-neutrophil interaction via binding with L-
Selectin,
thereby mediating inflammation. Snapp, et al., Blood 91(1): 154-64 (1998).
[27.] PSGL-1 mediates rolling of leukocytes on activated endothelium, on
activated platelets, and on other leukocytes and inflammatory sites.
[28.] A commercially available monoclonal antibody to human PGSL-1, KPL1,
was generated and shown to inhibit the interactions between PGSL-1 and P-
selectin and
between PGSL-1 and L-selectin. The KPLI epitope was mapped to the tyrosine
sulfation
consensus motif of PGSL-1 (YEYLDYD). I~PLl recognizes only this particular
epitope
and does not cross-react with sulfated epitopes present on other cells, such
as B-CLL
cells, AML cells, metastatic cells, multiple myeloma cells, and the like.
[29.] Leukocyte rolling is important in inflammation, and interaction between
P
Selectin (expressed by activated endothelium and on platelets, which may be
immobilized
at sites of injury) and PSGL-1 is instrumental for tethering and rolling of
leukocytes on
to
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
vessel walls. Ramachandran et al., PNAS 98(18): 10166-71 (2001); Afshar-
Kharghan, et
al., Blood 97(10): 3306-7 (2001).
[30.] Cell rolling is also important in metastasis, and P- and E-Selectin on
endothelial cells is believed to bind metastatic cells, thereby facilitating
extravasation
from the blood stream into the surrounding tissues.
[31.] Platelets are also involved in the process of metastasis; when
metastatic
cancer cells enter the blood stream, multicellular complexes composed of
platelets and
leukocytes coating the tumor cells are formed. These complexes, which may be
referred
to as microemboli, aid the tumor cells in evading the immune system. The
coating of
tumor cells by platelets requires expression of P-selectin by the platelets.
[32.] Treatment with heparin, an inhibitor of P- and L-Selectin inhibits tumor
cell-platelet interaction. Pretreatment of tumor cells with O-
sialoglycoprotease, which
removes sialylated, fucosylated mucin ligands, also inhibited tumor cell-
platelet complex
formation. Ifa vivo experiments indicate that either of these treatments
results in greater
monocyte association with circulating tumor cells, suggesting that reducing
platelet
binding increases access by immune cells to circulating tumor cells. Varki and
Varki,
Bf°az. J. Biol. Res. 34(6): 711-7 (2001).
[33.] PSGL-1 and GPIb share structural similarity, having mucin-like, highly
glycosylated ligand binding regions. Afshar-Kharghan, et al., Blood 97(10):
3306-7
(2001 ).
[34.] PSGL-1 has been found on all leukocytes: neutrophils, monocytes,
lymphocytes, activated peripheral T-cells, granulocytes, eosinophils,
platelets and on
some CD34 positive stem cells and certain subsets of B-cells. P-Selectin is
selectively
expressed on activated platelets and endothelial cells. Interaction between P-
Selectin and
PSGL-1 promotes rolling of leukocytes on vessel walls, and abnormal
accumulation of
leukocytes at vascular sites results in various pathological inflammations.
Stereo-specific
contributions of individual tyrosine sulfates on PSGL-1 are important for the
binding of
P-Selectin to PSGL-1. Charge is also important for binding: reducing NaCl
(from 150 to
11
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
50 mM) enhanced binding (Kd ~75nM). Tyrosine-sulfation on PSGL-1 enhances, but
is
not ultimately required for PSGL-1 adhesiofa on P-Selectin. PSGL-1 tyrosine
sulfation
supports slower rolling adhesiofa at all shear rates and supports polling
ad7zesiora at much
higher shear rates. (Rodgers SD, et al., Biophys J. 81: 2001-9 (2001)).
Fibrinogen
[35.] There are two forms of normal human fibrinogen: fibrinogen y major and
fibrinogen 'y prime minor variant, each of which is found in normal
individuals. Normal
fibrinogen, which is the more abundant form (comprising ~90% of the fibrinogen
found
in the body), is composed of two identical 55 kDa alpha (a) chains, two
identical 95 kDa
beta ((3) chains, and two identical 49.5 kDa gamma (y) chains. Normal variant
fibrinogen, which is the less abundant form (comprising ~10% of the fibrinogen
found in
the body), is composed of two identical 55 kDa alpha (a) chains, two identical
95 kDa
beta ((3) chains, one 49.5 kDa gamma (y) chain, and one 50.5 kDa gamma prime
(~y')
chain. The gamma and gamma prime chains are both coded for by the same gene,
with
alternative splicing occurnng at the 3' end. Normal gamma chain is composed of
amino
acids 1-411. Normal variant gamma prime chain is composed of 427 amino acids:
amino
acids 1-407 are the same as those in the normal gamma chain, and amino acids
408-427
are VRPEHPAETEYDSLYPEDDL. This region is normally occupied with thrombin
molecules.
[36.] Fibrinogen is converted into fibrin by the action of thrombin in the
presence of ionized calcium to produce coagulation of the blood. Fibrin is
also a
component of thrombi, and acute inflammatory exudates.
[37.] Platelets, and molecules (such as fibrinogen, GPIb, selectins, and PSGL-
1)
that play important roles in cell-cell interactions, cell-matrix interactions,
platelet-platelet
interactions, platelet-cell interactions, platelet-matrix interactions, cell
rolling and
adhesion, and hemostasis also play important roles in pathogenic conditions or
disease
states, such as abnormal or pathogenic inflammation, abnormal or pathogenic
immune
reactions, autoimmune reactions, metastasis, abnormal or pathogenic adhesion,
thrombosis and/ or restenosis, and abnormal or pathogenic aggregation. Thus,
antibodies
12
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
that crossreact with platelets and with these molecules would be useful in the
diagnosis
and treatment of diseases and disorders involving these and other pathogenic
conditions.
There is therefore a need to identify common epitopes in or among these
molecules and to
identify antibodies capable of crossreacting therewith.
[38.] Antibodies may be provided in many forms, such as fragments,
complexes, and multimers. Examples of antibody fragments include single chain
Fv
(scFv) fragments and Fab fragments.
[39.] It has been established that scFv penetrate tissues and are cleared from
the
blood more rapidly than a full size antibody because they are smaller in size.
Adams,
G.P., et al., Br. J. Cafzcer 77, 1405-1412 (1988); Hudson, P.J., Cuf°~.
Opin. I»zmurzol.
11(5), 548-557 (1999); Wu, A.M., et al., Tumor Targeting 4, 47 (1999). Thus,
scFv are
often employed in diagnostics involving radioactive labels such as tumor
imaging to
allow for a more rapid clearance of the radioactive label from the body. A
number of
cancer targeting scFv multimers have recently undergone pre-clinical
evaluation for in
vivo stability and efficacy. Adams, G.P., et al., Br. J. Carzcer-77, 1405-1412
(1988); Wu,
A.M., et al., Tumoy° Targeting 4, 47 (1999).
[40.] Single chain Fv (scFv) fragments are comprised of the variable domains
of
the heavy (VH) and light (VL) chains of an antibody tethered together by a
polypeptide
linker. The linker is long enough to allow the (VH) and the (VL) domains to
fold into a
functional Fv domain enabling the scFv to recognize and bind its target with
the similar
or increased affinity of the parent antibody.
[41.] Typically, scFv monomers are designed with the C-terminal end of the VH
domain tethered by a polypeptide linker to the N-terminal residue of the VL.
Optionally
an inverse orientation is employed: the C-terminal end of the VL domain is
tethered to the
N-terminal residue of VH through a polypeptide linker. Power, B., et al., J.
Immzzn. Meth.
242, 193-204 (2000). The polypeptide linker is typically around fifteen amino
acids in
length. When the linker is reduced to about three to seven amino acids, the
scFvs can not
fold into a functional Fv domain and instead associate with a second scFv to
form a
diabody. Further reducing the length of the linker to less than three amino
acids forces
13
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
the scFv association into trimers or tetramers, depending on the linker
length,
composition and Fv domain orientations. B.E. Powers, P.J. Hudson, J. Immuh.
Meth. 242
(2000) 193-194.
[42.] Recently, it has been discovered that multivalent antibody fragments
such
as scFv dimers, trimers, and tetramers often provide higher affinity over the
binding of
the parent antibody to the target. This higher affinity offers potential
advantages
including improved pharmaco-kinetics for tumor targeting applications.
Additionally, in
studying P-Selectin and its ligand PSGL-1, which are involved in tethering and
rolling of
leukocytes, scientists have concluded that cells expressing dimeric forms of
PSGL-1
established more stable rolling adhesions because of this higher binding
affinity. These
adhesions are more sheer resistant and exhibited less fluctuation in rolling
velocities.
Ramachandran, et al., PNAS, vol. 98(18): 10166-71 (2001).
[43.] The greater binding affinity of these multivalent forms may be
beneficial
in diagnostics and therapeutic regimens. For example, a scFv may be employed
as a
blocking agent to bind a target receptor and thus block the binding of the
"natural" ligand.
In such instances, it is desirable to have a higher affinity association
between the scFv and
the receptor to decrease chances for disassociation, which may allow an
undesirable
binding of the natural ligand to the target. In addition, this higher affinity
may be useful
when the target receptors are involved in adhesion and rolling or when the
target
receptors are on cells present in areas of high sheer flow, such as platelets.
[44.] It is an object of the present invention to provide isolated epitopes
that are
present on various molecules that are instrumental in processes such as cell
rolling,
inflammation, immune reactions, infection, autoimmune reactions, metastasis,
adhesion,
thrombosis and/ or restenosis, and aggregation, and which are present on
diseased cells,
such as AML cells, B-CLL cells, multiple myeloma cells, and metastatic cells.
[45.] Another object of the invention is to provide methods of using such
isolated epitopes to develop antibodies which recognize and crossreact with
epitopes that
are present on molecules that are instrumental in processes such as cell
rolling,
inflammation, immune reactions, infection, autoimmune reactions, metastasis,
adhesion,
14
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
thrombosis and/ or restenosis, and aggregation, and which are also present on
diseased
cells, such as AML cells, B-CLL cells, multiple myeloma cells, and metastatic
cells.
[46.] Other objectives of the invention include the use of such antibodies in
the
development and provision of medicaments for the inhibition of cell rolling,
inflammation, immune reactions, infection, autoimmune reactions, metastasis,
adhesion,
thrombosis and/ or restenosis, and aggregation, and for the treatment of
diseases, such as
AML, B-CLL, multiple myeloma, metastasis, cardiovascular diseases such as
myocardial
infarction, retinopathic diseases, diseases caused by sulfated tyrosine-
dependent protein-
protein interactions, or other diseases in which such cellular functions or
actions play a
significant role.
[47.] It is an object of this invention to utilize the epitopes and antibodies
in
methods for diagnosing various disease states of an individual, such as, for
example,
diseases, such as AML, B-CLL, multiple myeloma, and metastasis or other
diseases in
which such cellular functions or actions as cell rolling, inflammation, immune
reactions,
infection, autoimmune reactions, metastasis, adhesion, thrombosis and/ or
restenosis, and
aggregation play a significant role.
[48.] It is also an object of the invention to provide multivalent forms of
antibodies, fragments, and complexes. More specifically, it is an object of
the invention
to provide dimers, trimers and tetramers, sometimes referred to herein as
diabodies,
triabodies, and tetrabodies, respectively.
[49.] These and other objectives of the invention are provided herein.
SUMMARY OF THE INVENTION
[50.] The present invention provides epitopes that are found on ligands and
receptors that play important roles in such diverse processes as inflammation,
immune
reactions, metastasis, adhesion, thrombosis, restenosis, and aggregation.
Epitopes
according to the present invention are also found on leukemia and tumor cells,
particularly on leukemias of myeloid origin. Thus, these epitopes are useful
targets for
the therapeutic mediation of these processes. Antibodies directed against such
epitopes
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
are useful as therapeutic agents against cancers (both as anti-tumor agents
and as anti-
metastatic agents), leukemias, autoimmune diseases, inflammatory diseases,
cardiovascular diseases such as myocardial infarction, retinopathic diseases
and other
diseases mediated by abnormal platelet function, and diseases caused by
sulfated
tyrosine-dependent protein-protein interactions. The present invention
provides such
antibodies, compositions comprising the antibodies, and therapeutic and
diagnostic
methods using the antibodies.
[51.~ The present invention provides an isolated epitope comprising the
formula
(S)r
[(W)Z - P - (Y)t - P]q Formula (I)
Wherein:
W is any amino acid other than Aspartate and Glutamate
Y is any naturally occurring moiety that is capable of being sulfated
I' 1S (A)n,(A)"(X)u Or (X)u(A)n(A)m Or (A)"(X)u(A)m
Or (A)n(A)rn(X)u Or (X)u(A)m(A)n Or (A)n,(X)u(A)n
S is sulfate or a sulfated molecule
X is any amino acid except Aspartate, Glutamate, or Tyrosine
A is any negatively charged amino acid or leucine, isoleucine, proline,
phenylalanine, serine, or glycine
q islto6
z is 0, 1, or 2
r is0orl
16
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
t is 1, 2 or 3
a isOto2
n isOto3
m isOto3
wherein if n = 0 then m >0; wherein if m = 0 then n >0; wherein if q is l, r
is l, and if q
is >1 at least one of Y is sulfated; and further wherein the isolated epitope
is capable of
being bound by an antibody, antigen-binding fragment thereof, or complex
thereof
comprising an antibody or binding fragment thereof, comprising a first
hypervariable
region comprising SEQ ID NO: 8 or SEQ ID NO: 20.
[52.] The present invention provides an isolated epitope comprising Formula I
wherein the sulfated moiety is a peptido or glyco or lipo conjugate, or a
combination
thereof.
[53.] The present invention also provides an isolated epitope comprising
Formula I wherein W is Glycine, Y is a peptido conjugate of Tyrosine or a
glyco
conjugate of Asparagine, Serine or Threonine; A is Glutamate, y Carboxy
Glutamate or
Aspartate; and q is 1, 2, or 3. In certain of these embodiments, Y is a
peptido conjugate
of Tyrosine; q is 3; and r is l .e
[54.] The present invention also provides an isolated epitope comprising the
formula
An isolated epitope comprising the formula
(S)r (S)r (S)r
(~Z - P - (Y)r - P - (Y)c - P - (Y)c - P Formula II
Wherein:
17
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
W is any amino acid other than Aspartate and Glutamate
Y is any naturally occurring moiety that is capable of being sulfated
P 1S ~A~m~Ay~u Or ~X~OAOA~m Or ~A~yXyA~m
Or ~A~yA~mCXO Or ~X~yA~m~AO Or (A~m~X~u~A)n
S is a sulfate or a sulfated molecule
X is any amino acid except Aspartate, Glutamate or Tyrosine
A is any negatively charged amino acid or leucine, isoleucine, proline,
phenylalanine, serine, or glycine
z is 0, l, or 2
r is0orl
t is l, 2 or 3
a isOto2
n is 0 to 3
m is 0 to 3
wherein if n =0 then m > 0; wherein if m = 0 then n > 0; wherein at least one
Y is
sulfated; and further wherein the isolated epitope is capable of being bound
by an
antibody, antigen-binding fragment thereof, or complex thereof comprising an
antibody
or binding fragment thereof, comprising a first hypervariable region
comprising SEQ ID
NO: 8 or SEQ ID NO: 20.
[55.] The present invention provides an isolated epitope comprising Formula II
wherein the sulfated moiety is a peptido or glyco or lipo conjugate, or a
combination
thereof.
18
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
[56.] The present invention also provides an isolated epitope comprising
Formula II wherein: W is Glycine; Y is a peptide conjugate of Tyrosine or a
glyco
conjugate of Asparagine, Serine or Threonine; A is Glutamate, y Carboxy
Glutamate or
Aspartate, Leucine, Isoleucine, Proline Phenylalanine, Serine or Glycine. In
certain of
these embodiments, Y is a peptido conjugate of Tyrosine; q is 3; and r is 1.
[57.] The present invention provides an isolated epitope comprising the
formula
(S~r ~S~r (S~r
(CT)OX)u~)OD)mU')t ~X)OE')OD)mO')t~X)OE)OD)mO')t~D)m~E)OX)u Formula III
Wherein:
G is Glycine
E is Glutamate
D is Aspartate
Y is Tyrosine
S is sulfate or a sulfated
molecule
X is any amino acid except the above
z is 0, 1, or 2
t isl,2or3
r is0orl
a isOto2
n isOto3
m isOto3
19
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
wherein at least one Y is sulfated; wherein if n = 0 then m > 0; wherein if m
= 0 then n >
0; and further wherein the isolated epitope is capable of being bound by an
antibody,
antigen-binding fragment thereof, or complex thereof comprising an antibody or
binding
fragment thereof, comprising a first hypervariable region comprising SEQ ID
NO: 8 or
SEQ ID NO: 20.
[58.] The present invention provides an isolated epitope comprising Formula
III
wherein r is 1.
[59.] In any of the above embodiments, Y may comprise a lipid, carbohydrate,
peptide, glycolipid, glycoprotein, lipoprotein, and/ or lipopolysaccharide
molecule.
[60.] The present invention also provides derivatives, homologs, mimetics, and
variants of the above-described epitopes and provides epitopes as described
above and
having at least one post-translational modification in addition to sulfation.
[61.] The present invention provides compositions comprising one or more of
the above-described isolated epitopes. Isolated polynucleotides encoding at
least a
portion of the above-described epitopes are also provided.
[62.] The present invention also provides antibodies, antigen-binding
fragments
thereof, or complexes thereof comprising at least one antibody or binding
fragment
thereof capable of binding to or cross-reacting with at least one of the above-
described
epitopes.
[63.] Likewise, a process for producing an antibody, antigen-binding fragment
thereof, or complex thereof comprising at least one antibody or binding
fragment thereof,
capable of binding to or cross reacting with at least one of the above-
described epitopes is
provided. The process comprises the steps of (a) providing a phage display
library; (b)
providing one of the above-described epitopes; (c) panning the phage display
library for a
phage particle displaying an oligopeptide or polypeptide capable of binding to
the isolated
epitope; and (d) producing an antibody, binding fragment thereof, or complex
comprising
an antibody or binding fragment thereof, comprising the peptide or polypeptide
capable
of binding to the isolated epitope.
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
[64.] The present invention also provides antibodies, antigen-binding
fragments
thereof, or complexes thereof comprising at least one antibody or binding
fragment
thereof having the binding capabilities of the scFv antibody fragment of SEQ
ID NO: 25
[Y1 scFv] and/ or SEQ ID NO: 203 [Y17 scFv].
[65.] Antibodies, antibody fragments, and antibody complexes having the
binding capabilities of a peptide or polypeptide, wherein the peptide or
polypeptide has a
first hypervariable region comprising SEQ ID NO: 8 [Y1 CDR3] or SEQ ID NO: 20
[Y17
CDR3] are provided. In certain of these embodiments, the peptide or
polypeptide has a
second hypervariable region comprising SEQ ID NO: 115 and/ or a third
hypervariable
region comprising SEQ ID NO: 114.
[66.] Antibodies, antibody fragments, and antibody complexes that are capable
of binding to a peptide or polypeptide epitope of approximately 3 to 126 amino
acid
residues in length and comprising at least one sulfated tyrosine residue and
at least two
acidic amino acids are provided. In certain of these embodiments, the epitope
further
comprises at least, one leucine, isoleucine, proline, phenylalanine, serine or
glycine
residue. In certain of these embodiments, one or more of the at least two
acidic amino
acid residues is replaced by a leucine, isoleucine, proline, Phenylalanine,
Serine or
Glycine residue. In certain other embodiments, the epitope comprises DYD or
EYE. In
certain embodiments, the epitope is DYD or EYE. In yet other embodiments, the
epitope
comprises DYE or EYD.
[67.] In certain embodiments, antibodies, antibody fragments, and antibody
complexes provided according to the present invention are capable of binding
to an
epitope on a carbohydrate, peptide, glycolipid, glycoprotein, lipoprotein,
and/ or
lipopolysaccharide molecule. Preferably, antibodies, antigen-binding fragments
thereof,
or complexes thereof comprising at least one antibody or binding fragment
thereof
according to the present invention are capable of binding to carbohydrate,
peptide
epitopes, glycolipid epitopes, glycoprotein epitopes, lipoprotein epitopes,
and/ or
lipopolysaccharide epitopes. In many embodiments, the carbohydrate, peptide,
glycolipid, glycoprotein, lipoprotein, and/ or lipopolysaccharide molecule
comprises at
least one sulfated moiety.
21
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
[68.) The present invention provides antibodies, antigen-binding fragments
thereof, or complexes thereof comprising at least one antibody or binding
fragment
thereof that are capable of binding to at least two different molecules
selected from the
group consisting of PSGL-1, fibrinogen y prime, GPlba, heparin, lumican,
complement
compound 4 (CC4), inter-alpha-inhibitor, and prothrombin, albeit not
necessarily
simultaneously. Also, the antibodies, antibody fragments, or complexes of the
present
invention will bind to any analog of these proteins, as long as the receptor
epitope is
intact.
[69.] In certain preferred embodiments, antibodies, antigen-binding fragments
thereof, or complexes thereof comprising at least one antibody or binding
fragment
thereof that are capable of binding to at least two proteins selected from the
group
consisting of PSGL-1, fibrinogen 'y prime, GPlba, lumican, complement compound
4,
interalpha inhibitor, prothrombin, and heparin and capable of binding to
diseased cells,
such as B-CLL cells, AML cells, multiple myeloma cells, and metastatic cells,
are
provided. In certain embodiments, antibodies, antigen-binding fragments
thereof, or
complexes thereof comprising at least one antibody or binding fragment thereof
that are
capable of binding to each of PSGL-l, fibrinogen ~ prime, GPlba, heparin,
lumican,
complement compound 4 (CC4), interalpha inhibitor, and prothrombin are
provided. In
certain embodiments, antibodies, antigen-binding fragments thereof, or
complexes thereof
comprising at least one antibody or binding fragment thereof that are capable
of binding
to each of PSGL-l, fibrinogen 'y prime, GPlba, and heparin are provided; and,
in certain
preferred embodiments, these antibodies, antigen-binding fragments thereof, or
complexes thereof comprising at least one antibody or binding fragment thereof
are also
capable of binding to diseased cells, such as B-CLL cells, AML cells, multiple
myeloma
cells, and metastatic cells.
[70.] The present invention provides antibodies, antigen-binding fragments
thereof, or complexes thereof comprising at least one antibody or binding
fragment
thereof that are capable of binding to at least two different molecules
selected from the
group consisting of PSGL-1, fibrinogen y prime, heparin, GPlba, lumican,
complement
compound 4 (CC4), interalpha inhibitor, and prothrombin, and further is
capable of
22
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
binding to an epitope on a carbohydrate and/ or a lipid molecule. In certain
of these
embodiments, the epitope on the carbohydrate and/ or lipid molecule comprises
at least
one sulfated moiety.
[71.] The present invention provides antibodies, antigen-binding fragments
thereof, or complexes thereof comprising at least one antibody or binding
fragment
thereof are capable of crossreacting with two or more epitopes, each epitope
comprising
one or more sulfated tyrosine residues within a cluster of acidic amino acids.
In certain of
these embodiments, antibodies, antigen-binding fragments thereof, or complexes
thereof
comprising at least one antibody or binding fragment thereof that are capable
of
crossreacting with at least one cell type selected from the group consisting
of B-CLL
cells, AML cells, multiple myeloma cells, and metastatic cells. In certain
other of these
embodiments, antibodies, antigen-binding fragments thereof, or complexes
thereof
comprising at least one antibody or binding fragment thereof are capable of
crossreacting
with PSGL-1. Preferably, antibodies, antigen-binding fragments thereof, or
complexes
thereof comprising at least one antibody or binding fragment thereof that are
capable of
crossreacting with PSGL-1 bind to the epitope QATEYEYLDYDFLPETE wherein at
least one tyrosine residue is sulfated.
[72.] In certain other of these embodiments, antibodies, antigen-binding
fragments thereof, or complexes thereof comprising at least one antibody or
binding
fragment thereof are capable of crossreacting with GPlb-cc. Preferably,
antibodies,
antigen-binding fragments thereof, or complexes thereof comprising at least
one antibody
or binding fragment thereof that are capable of crossreacting with GPlb-a bind
to the
epitope DEGDTDLYDYYPEEDTEGD wherein at least one tyrosine residue is sulfated,
the epitope TDLYDYYPEEDTE wherein at least one tyrosine residue is sulfated,
the
epitope GDEGDTDLYDYYP wherein at least one tyrosine residue is sulfated, the
epitope YDYYPEE wherein at least one tyrosine residue is sulfated, andlor the
epitope
TDLYDYYP wherein at least one tyrosine residue is sulfated.
[73.] In yet other of these embodiments, antibodies, antigen-binding fragments
thereof, or complexes thereof comprising at least one antibody or binding
fragment
23
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
thereof are capable of crossreacting with fibrinogen y prime. Preferably,
antibodies,
antigen-binding fragments hereof, or complexes thereof comprising at least one
antibody
or binding fragment thereof that are capable of crossreacting with fibrinogen
y' bind to the
epitope EPHAETEYDSLYPED wherein at least one tyrosine residue is sulfated.
[74.] In yet other of these embodiments, antibodies, antigen-binding fragments
thereof, or complexes thereof comprising an antibody or binding fragment
thereof that are
capable of crossreacting with heparin are provided.
[75.] In yet other of the se embodiments, antibodies, antigen-binding
fragments
thereof, or complexes thereof comprising an antibody or binding fragment
thereof that are
capable of crossreacting with complement compound 4 (CC4) are provided.
Preferably,
antibodies, antigen-binding fragments thereof, or complexes thereof comprising
at least
one antibody or binding fragment thereof that are capable of crossreacting
with CC4 bind
to the epitope MEANEDYEDYEYDELPAK wherein at least one tyrosine residue is
sulfated.
[76.] The present invention also provides antibodies, antigen-binding
fragments
thereof, or complexes thereof comprising at least one antibody or binding
fragment
thereof that are capable of binding to fragments, analogs, variants, and
mimetics of the
above-mentioned proteins, so long as the epitope is essentially intact.
[77.] The present invention provides antibodies, antigen-binding fragments
thereof, or complexes thereof comprising at least one antibody or binding
fragment
thereof that are capable of crossreacting with at least one cell type selected
from the
group consisting of B-CLL cells, AML cells, multiple myeloma cells, and
metastatic
cells;
[78.] The present invention also provides antibodies, antigen-binding
fragments
thereof, or complexes thereof comprising at least one antibody or binding
fragment
thereof, that are capable of inhibiting cell rolling; inhibiting inflammation;
inhibiting
auto-immune disease; inhibiting thrombosis; inhibiting restenosis; inhibiting
metastasis;
inhibiting growth and/ or replication of tumor cells; increasing mortality of
tumor cells;
24
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
inhibiting growth and/ or replication of leukemia cells; increasing the
mortality rate of
leukemia cells; increasing the susceptibility of diseased cells to damage by
anti-disease
agents; increasing the susceptibility of tumor cells to damage by anti-cancer
agents;
increasing the susceptibility of leukemia cells to damage by anti-leukemia
agents;
inhibiting increase in number of tumor cells in a patient having a tumor;
decreasing the
number of tumor cells in a patient having cancer; inhibiting increase in
number of
leukemia cells in a patient having leukemia; decreasing the number of leukemia
cells in a
patient having leukemia; inhibiting cell-cell, cell-matrix, platelet-matrix,
platelet-platelet,
andl or cell-platelet complex formation; inhibiting cell-cell, cell-matrix,
platelet-matrix,
platelet-platelet, and/ or cell-platelet adhesion; aggregation.
[79.] Pharmaceutical compositions comprising antibodies, antigen-binding
fragments thereof, or complexes thereof comprising at least one antibody or
binding
fragment thereof according to the present invention in amounts effective to
inhibit, treat,
ameliorate the effects of, or prevent diseases and/ or conditions of interest
are provided.
[80.] The present invention provides for the use of antibodies, antigen-
binding
fragments thereof, or complexes thereof according to the present invention in
the
manufacture of a medicament to inhibit, treat, ameliorate the effects of, or
prevent
diseases and/ or conditions of interest.
[81.] The present invention provides antibodies, antigen-binding fragments
thereof, or complexes thereof according to the present invention for use as a
medicament
to inhibit, treat, ameliorate the effects of, or prevent diseases and! or
conditions of
interest.
[82.] The present invention provides methods of inhibiting, treating,
ameliorating the effects of, or preventing diseases and/ or conditions of
interest
comprising administering to a patient in need thereof a pharmaceutical
composition
comprising an effective amount of an antibody, antigen-binding fragment
thereof, or
complex thereof comprising at least one antibody or binding fragment thereof,
according
to the present invention.
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
[83.] Antibodies, antigen-binding fragments thereof, or complexes thereof
comprising at least one antibody or binding fragment thereof according to the
present
invention may be complexed with or coupled to agents.
[84.] The present invention provides antibodies, antigen-binding fragments
thereof, or complexes thereof comprising at least one antibody or binding
fragment
thereof coupled to or complexed with an agent selected from the group
consisting of anti-
cancer, anti-metastasis, anti-leulcemia, anti-disease, anti-adhesion, anti-
thrombosis, anti-
restenosis, anti-autoimmune, anti-aggregation, anti-bacterial, anti-viral, and
anti-
inflammatory agents. .
[85.] The present invention also provides antibodies, antigen-binding
fragments
thereof, or complexes thereof comprising at least one antibody or binding
fragment
thereof coupled to or complexed with one or more toxins, radioisotopes, and
pharmaceutical agents.
[86.] The present invention provides antibodies, antigen-binding fragments
thereof, or complexes thereof comprising at least one antibody or binding
fragment
thereof coupled to or complexed with a vehicle or carrier that are capable of
being
coupled or complexed to more than one agent. Examples of such vehicles and
carriers
include dextran, lipophilic polymers, HPMA, and liposomes.
[87.] The present invention also provides antibodies, antigen-binding
fragments
thereof, or complexes thereof comprising at least one antibody or binding
fragment
thereof coupled to or complexed with a radioactive isotope or other imaging
agent.
Diagnostic kit comprising an antibodies, antigen-binding fragments thereof, or
complexes
thereof comprising at least one antibody or binding fragment thereof,
according to the
present invention are also provided.
[88.] The present invention provides an isolated epitope comprising GPIba
amino acid sequence Tyr 276 to Glu 282, wherein at least one of amino acids
276, 278
and 279 is sulfated. In a preferred embodiment, the epitope further comprises
GPIbaamino acids 283-285.
26
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
[89.] The present invention also provides antibodies, antigen-binding
fragments
thereof, or complexes thereof comprising at least one antibody or binding
fragment
thereof that are capable of binding to the epitope comprising GPIba amino acid
sequence
Tyr 276 to Glu 282, wherein at least one of amino acids 276, 278 and 279 is
sulfated,
wherein the binding is enhanced when the epitope further comprises GPIbaamino
acids
283-285.
[90.] An isolated GPlba N-terminal peptide having an apparent molecular
weight of about 40 KDa, said peptide comprising an epitope having the sequence
YDYYPEE, wherein at least one tyrosine residue in the epitope is sulfated and
an isolated
GPlba peptide consisting of amino acids 1 through 282, wherein at least one of
amino
acids 276, 278 and 279 is sulfated are also provided.
[91.] The present invention also provides polyclonal antibodies, antibody
fragments or antibody complexes that cross-react with the variable light chain
of human
monoclonal antibody scFv Yl. In certain embodiments, the polyclonal
antibodies,
antibody fragments or antibody complexes cross-react with a NdeI-EcoRl
restriction
fragment of the variable light chain of human monoclonal antibody Y-1.
Diagnostic kits
comprising such polyclonal antibodies are also provided.
DEFINITIONS:
[92.] Antibodies (Ab's), or immunoglobulins (IgG's), are protein molecules
that
bind to antigen. They are composed of units of four polypeptide chains (2
heavy and 2
light) linked together by disulfide bonds. Each of the chains has a constant
and variable
region. They can be divided into five classes, IgG, IgM. IgA, IgD, and IgE,
based on
their heavy chain component. The IgG class encompasses several sub-classes
including,
but not restricted to, IgGi, IgG2, IgG3, and IgG4. Immunoglobulins are
produced in vivo
by B lymphocytes and recognize a particular foreign antigenic determinant and
facilitate
clearing of that antigen.
[93.] Antibodies may be produced and used in many forms, including antibody
complexes. As used herein, the term "antibody complex" or "antibody complexes"
is
27
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
used to mean a complex of one or more antibodies with another antibody or with
an
antibody fragment or fragments, or a complex of two or more antibody
fragments.
Examples of antibody fragments include Fv, F(ab')2, F(ab'), Fc, and Fd
fragments.
[94.] As used herein in the specification and in the claims, an Fv is defined
as a
molecule that is made up of a variable region of a heavy chain of a human
antibody and a
variable region of a light chain of a human antibody, which may be the same or
different,
and in which the variable region of the heavy chain is connected, linlced,
fused or
covalently attached to, or associated with, the variable region of the light
chain. The Fv
can be a single chain Fv (scFv) or a disulfide stabilized Fv (dsFv). An scFv
is comprised
of the variable domains of each of the heavy and light chains of an antibody,
linked by a
flexible amino-acid polypeptide spacer, or linker. The linker may be branched
or
unbranched. Preferably, the linker is 0-15 amino acid residues, and most
preferably the
linker is (Gly4Ser)3.
[95.] The Fv molecule itself is comprised of a first chain and a second chain,
each chain comprising a first, second and third hypervariable region. The
hypervariable
loops within the variable domains of the light and heavy chains are termed
Complementary Determining Regions (CDR). There are CDRl, CDR2 and CDR3
regions in each of the heavy and light chains. These regions are believed to
form the
antigen binding site and can be specifically modified to yield enhanced
binding activity.
The most variable of these regions in nature being the CDR3 region of the
heavy chain.
The CDR3 region is understood to be the most exposed region of the Ig molecule
and as
shown and provided herein is the site primarily responsible for the selective
and/or
specific binding characteristics observed.
[96.] A fragment of an Fv molecule is defined as any molecule smaller than the
original Fv that still retains the selective and/or specific binding
characteristics of the
original Fv. Examples of such fragments include but are limited to (1) a
minibody, which
comprises a fragment of the heavy chain only of the Fv, (2) a microbody, which
comprises a small fractional unit of antibody heavy chain variable region (PCT
Application No. PCT/IL99/00581), (3) similar bodies comprising a fragment of
the light
chain, and (4) similar bodies comprising a functional unit of a light chain
variable region.
28
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
[97.] As used herein the term "Fab fragment" is a monovalent antigen-binding
fragment of an immunoglobulin. A Fab fragment is composed of the light chain
and part
of the heavy chain.
[98.] A F(ab')2 fragment is a bivalent antigen binding fragment of an
immunoglobulin obtained by pepsin digestion. It contains both light chains and
part of
both heavy chains.
[99.] A Fc fragment is a non-antigen-binding portion of an immunoglobulin. It
contains the carboxy-terminal portion of heavy chains and the binding sites
for the Fc
receptor.
[100.] A Fd fragment is the variable region and first constant region of the
heavy
chain of an immunoglobulin.
[101.] Polyclonal antibodies are the product of an immune response and are
formed by a number of different B-lymphocytes. Monoclonal antibodies are
derived
from a single cell.
[102.] A cassette, as applied to polypeptides and as defined in the present
invention, refers to a given sequence of consecutive amino acids that serves
as a
frameworlc and is considered a single unit and is manipulated as such. Amino
acids can
be replaced, inserted into, removed, or attached at one or both ends.
Likewise, stretches
of amino acids can be replaced, inserted into, removed or attached at one or
both ends.
[103.] The term "epitope" is used herein to mean the antigenic determinant or
antigen site that interacts with an antibody, antibody fragment, antibody
complex or a
complex comprising a binding fragment thereof or T-cell receptor. The term
epitope is
used interchangeably herein with the terms ligand, domain, and binding region.
[104.] Selectivity is herein defined as the ability of a targeting molecule to
choose
and bind one cell type or cell state from a mixture of cell types or cell
states, all cell types
or cell states of which may be specific for the targeting molecule.
29
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
[105.] The term "affinity" as used herein is a measure of the binding strength
(association constant) between a receptor (e.g., one binding site on an
antibody) and a
ligand (e.g., antigenic determinant). The strength of the sum total of
noncovalent
interactions between a single antigen-binding site on an antibody and a single
epitope is
the affinity of the antibody for that epitope. Low affinity antibodies bind
antigen weakly
and tend to dissociate readily, whereas high-affinity antibodies bind antigen
more tightly
and remain bound longer. The term "avidity" differs from affinity because the
former
reflects the valence of the antigen-antibody interaction.
[106.] Specificity of antibody-antigen interaction: Although the antigen-
antibody
reaction is specific, in some cases antibody elicited by one antigen can cross-
react with
another unrelated antigen. Such cross-reactions occur if two different
antigens share an
homologous or similar epitope or an anchor region thereof or if antibodies
specific for
one epitope bind to an unrelated epitope possessing similar chemical
properties.
[107.] A platelet is a disc-like cytoplasmic fragment of a megakaryocyte that
is
shed in the marrow sinus and subsequently are circulating in the peripheral
blood stream.
Platelets have several physiological functions including a major role in
clotting. A
platelet contains granules in the central part and peripherally, clear
protoplasm, but no
definite nucleus.
[108.] Agglutination as used herein means the process by which suspended
bacteria, cells, discs, or other particles of similar size are caused to
adhere and form into
clumps. The process is similar to precipitation but the particles are larger
and are in
suspension rather than being in solution.
[109.] The term aggregation means a clumping of platelets induced in vitro,
and
thrombin and collagen, as part of a sequential mechanism leading to the
formation of a
thrombus or hemostatic plug.
[110.] Conservative amino acid substitution is defined as a change in the
amino
acid composition by way of changing one or two amino acids of a peptide,
polypeptide or
protein, or fragment thereof. The substitution is of amino acids with
generally similar
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
properties (e.g., acidic, basic, aromatic, size, positively or negatively
charged, polar, non-
polar) such that the substitutions do not substantially in a major way alter
peptide,
polypeptide or protein characteristics (e.g., charge, IEF, affinity, avidity,
conformation,
solubility) or activity. Typical substitutions that may be performed for such
conservative
amino acid substitution may be among the groups of amino acids as follows:
(i) glycine (G), alanine (A), valine (V), leucine (L) and isoleucine (I)
(ii) aspartic acid (D) and glutamic acid (E)
(iii) alanine (A), serine (S) and threonine (T)
(iv) histidine (H), lysine (K) and arginine (R)
(v) asparagine (N) and glutamine (Q)
(vi) phenylalanine (F), tyrosine (Y) and tryptophan (W)
[11 l.] Conservative amino acid substitutions can be made in, as well as,
flanking
the hypervariable regions primarily responsible for the selective and/or
specific binding
characteristics of the molecule, as well as other parts of the molecule, e.g.,
variable heavy
chain cassette. Additionally or alternatively, modification can be
accomplished by
reconstructing the molecules to form full-size antibodies, diabodies (dimers),
triabodies
(timers) and/or tetrabodies (tetramers) or to form minibodies or microbodies.
[112.] A phagemid is defined as a phage particle that carries plasmid DNA.
Phagemids are plasmid vectors designed to contain an origin of replication
from a
filamentous phage, such as m13 of fd. Because it carries plasmid DNA, the
phagemid
particle does not have sufficient space to contain the full complement of the
phage
genome. The component that is missing from the phage genome is information
essential
for packaging the phage particle. In order to propagate the phage, therefore,
it is
necessary to culture the desired phage particles together with a helper phage
strain that
complements the missing packaging information.
31
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
[113.] A promoter is a region on DNA at which RNA polymerase binds and
initiates transcription.
[114.] A phage display library (also termed phage peptide/antibody library,
phage
library, or peptide/antibody library) comprises a large population of phage
(generally l Og
109), each phage particle displaying a different peptide or polypeptide
sequence. These
peptide or polypeptide fragments may constructed to be of variable length. The
displayed
peptide or polypeptide can be derived from, but need not be limited to, human
antibody
heavy or light chains.
[115.] A pharmaceutical composition refers to a formulation which comprises a
peptide or polypeptide of the invention and a pharmaceutically acceptable
carrier,
excipient or diluent thereof.
[116.] A pharmaceutical agent refers to an agent that is useful in the
prophylactic
treatment or diagnosis of a mammal including, but not restricted to, a human,
bovine,
equine, porcine, murine, canine, feline, or any other warm-blooded animal. The
pharmaceutical agent is selected from the group comprising radioisotope,
toxin,
oligonucleotide, recombinant protein, antibody fragment, and anti-cancer
agent.
Examples of such pharmaceutical agents include, but are not limited to anti-
viral agents
including acyclovir, ganciclovir and zidovudine; anti-thrombosis/restenosis
agents
including cilostazol, dalteparin sodium, reviparin sodium, and aspirin; anti-
inflammatory
agents including zaltoprofen, pranoprofen, droxicam, acetyl salicylic 17,
diclofenac,
ibuprofen, dexibuprofen, sulindac, naproxen, amtolmetin, celecoxib,
indomethacin,
rofecoxib, and nimesulid; anti-autoimmune agents including leflunomide,
denileulcin
diftitox, subreum, WinRho SDF, defibrotide, and cyclophosphamide; and anti-
adhesion/anti-aggregation agents including limaprost, clorcromene, and
hyaluronic acid.
[117.] An anti-leukemia agent is an agent with anti-leukemia activity. For
example, anti-
leukemia agents include agents that inhibit or halt the growth of leukemic or
immature
pre-leukemic cells, agents that kill leukemic or pre-leukemic, agents that
increase the
susceptibility of leukemic or pre-leukemic cells to other anti-leukemia
agents, and agents
that inhibit metastasis of leukemic cells. In the present invention, an anti-
leukemia agent
32
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
may also be agent with anti-angiogenic activity that prevents, inhibits,
retards or halts
vascularization of tumors.
[118.] The expression pattern of a gene can be studied by analyzing the amount
of gene product produced under various conditions, at specific times, in
various tissues,
etc. A gene is considered to be "over expressed" when the amount of gene
product is
higher than that found in a normal control, e.g., non-diseased control.
[119.] A given cell may express on its surface a protein having a binding site
(or
epitope) for a given antibody, but that binding site may be exist in a cryptic
form (e.g., be
sterically hindered or be blocked, or lack features needed for binding by the
antibody) in
the cell in a state, which may be called a first stage (stage I ). Stage I may
be, for
example, a normal, healthy, non-diseased status. When the epitope exists in
cryptic form,
it is not recognized by the given antibody, i.e., there is no binding of the
antibody to this
epitope or to the given cell at stage I. However, the epitope may be exposed
by, e.g.,
undergoing modifications itself, or being unbloclced because nearby or
associated
molecules axe modified or because a region undergoes a conformational change.
Examples of modifications include changes in folding, changes in post-
translational
modifications, changes in phospholipidation, changes in sulfation, changes in
glycosylation, and the like. Such modifications may occur when the cell enters
a different
state, which may be called a second stage (stage II). Examples of second
states, or stages,
include activation, proliferation, transformation, or in a malignant status.
Upon being
modified, the epitope may then be exposed, and the antibody may bind.
[120.] Peptido-mimetics are small molecules, peptides, polypeptides, lipids,
polysaccharides or conjugates thereof that have the same functional effect or
activity of
another entity such as an antibody.
BRIEF DESCRIPTION OF THE DRAWINGS
[121.] FIG. 1 shows cleavage sites of endoprotease on the a chain of GPIb.
33
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
[122.] FIG. 2 depicts a Western blot showing binding of Y1 and Y17 to
platelets
in reduced and non-reduced conditions.
[123.] FIG. 3 is an outline of the optimal determinants for binding of Y1 to
its
epitope:
[124.] FIG. 4 depicts a Western blot demonstrating that cleavage of platelet
GPIb
by O-Sialoglycoprotein endoprotease abolishes binding of both Yl and Y17.
[125.] FIG. 5 depicts a Western blot demonstrating that Yl and Y17 bind
similar
glycocalicin fragments after cleavage by O-Sialoglycoprotein endoprotease.
[126.] FIG. 6 depicts the results of FACS analysis demonstrating that specific
GPIb proteolysis abolishes Y1 binding to platelets.
[127.] FIG. 7 depicts a Western blot demonstrating that Y1 binds the N-
terminal
(His 1- Glu 282) fragment of platelet GPIba after cleavage by mocarhagin.
[128.] FIG. 8 depicts a Western blot showing binding of Yl and Y17 to
glycocalicin after cleavage by mocarhagin.
[129.] FIG. 9 depicts a Western blot showing the binding of Y1 and Y17 to
platelets.
[130.] FIG. 10 depicts a Western blot demonstrating that Yl and Y17 bind
glycocalicin similarly after cleavage by Ficin.
[131.] FIG. 11 depicts a Western blot demonstrating that Yl reacts with the
larger fragment generated by cathepsin G cleavage of GPIbaa.
[132.] FIG. 12 depicts a Western blot demonstrating that Y1 and Y17 react with
the larger fragment generated by cathepsin G cleavage of GPIbaa.
[133.] FIG. 13 depicts a Western blot demonstrating that cleavage of
glycocalicin
by mocarhagin and cathepsin G abolishes binding of Yl.
34
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
[134.] FIG. 14 depicts a Western blot showing the binding of Yl and Y17 to
lysate of washed platelets cleaved by mocarhagin and cathepsin G.
[135.] FIG. 15 is a graph illustrating inhibition by Yl-scFv of agglutination
of
washed platelets.
[136.] FIG. 16 is a graph illustrating inhibition by Y1-scFv of aggregation of
platelets in platelet-rich plasma.
[137.] FIG. 17 is a graph illustrating induction of agglutination of washed
platelets by Y1-IgG.
[138.] FIG. 18 is a graph illustrating induction of platelet aggregation in
platelet-
rich-plasma by Yl-IgG.
[139.] FIG. 19 provides results of an ELISA assay.
[140.] FIG. 20 depicts a Western blot illustrating the specificity of binding
of Yl
and a-CD42 (N1-19) to their ligands.
[141.] FIG. 21 depicts a Western blot Yl reactivity with Yl-ligand on KG-1
cell
membrane purified using immunoprecipitation and RP-HPLC.
[142.] FIG. 22 depicts a Western blot showing the effect of O-
Sialoglycoprotein
endopeptidase cleavage on Y1 binding.
[143.] FIG. 23 depicts a Western blot showing the effect after aryl-sulfatase
cleavage on Y1 binding to RP-HPLC purified KG-1 cell lysates, and heparin-BSA.
[144.] FIG. 24 depicts the immunoprecipitation scheme used in the analysis of
the specificity of Y1 binding, the results of which are depicted in FIG. Tab
2A, page 17B.
[145.] FIG. 25 depicts Western blots comparing binding of Yl and anti-CD-162
antibody to cells from AML patients and normal blood.
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
[146.] FIG. 26 depicts the results of a FACS analysis showing the ability of
antibodies KPLl, PL1, and PL2 to compete with Yl for binding.
[147.] FIG. 27 depicts the results of a FAGS analysis demonstrating the
specificity of Yl binding.
[148.] FIG. 28 also depicts the results of a FAGS analysis demonstrating the
specificity of Y1 binding.
[149.] FIG. 29 is a graph illustrating % inhibition of Yl binding in the
presence
of various peptides.
[150.] FIG. 30 is a graph depicting liver weights in mice in different
treatment
groups. FIG. 31 is a graph depicting % MOLT cells in bone marrow in mice in
different
treatment groups.
[151.] FIG. 32 is a graph depicting % MOLT cells in blood in mice in different
treatment groups.
[152.] FIG. 33 is a graph depicting liver weights (mean +/- SEM) of mice at
day
35.
[153.] FIG. 34 is a graph depicting liver weights (mean +l- SEM) of mice at
day
35.
[154.] FIG. 35 is a graph illustrating effect of treatment on,survival.
[155.] FIG. 36 is a graph depicting % occurrence of leukemia in different
treatment groups.
[156.] FIG. 37 is a graph depicting % KG-1 cells in blood in different
treatment
groups.
[157.] FIG. 38 is a graph illustrating %KG-1 cells in bone marrow of
experimental animals.
36
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
[158.] FIG. 39 is a graph illustrating the pharmakokinetics of TCA-
precipitable
radioactivity in plasma after intravenous injection of l2sl-CONY1 in mice. The
sequence
of CONY1 is given as SEQ ID NO: 204.
[159.] FIG. 40 is a graph illustrating the specific radioactivity of various
organs/
tissues after intravenous injection of lasl-CONYl in mice.
[ 160.] FIG. 41 is a graph illustrating the distribution of radioactivity of
various
organs/ tissues after intravenous injection of lasl-CONY1 in mice.
[161.] FIG. 42 is a graph of the Superdex 75 profile of Y1-cys-kak.
[162.] FIG. 43 reveals the size of the dimers compared to the monomer in
reducing and non-reducing conditions.
[163.] FIG. 44 depicts a FAGS analysis showing the level of binding of the IgG-
Y1 molecule compared to that of scFv-Yl.
[164.] FIG. 45 depicts Western blots showing binding of Y1 and other
antibodies
to natural human platelet derived glycocalicin and to recombinant glycocalicin
produced
in E. coli.
[165.] FIG. 46 shows a binding comparison between a Yl dimer, the Yl scFv
(CONY1), and Yl IgG.
[166.] FIG. 47 shows a binding comparison between a Y1 sulfide bridge dimer
with the Y1 scFv (CONYl).
[167.] FIG. 48 provides the amino acid and nucleotide sequences of the heavy
and light chains of Y1-IgG. The open reading frame (ORF) of the nucleotide
sequence of
Y1-HC (SEQ ID NO: 205), the amino acid sequence of Y1-HC (SEQ ID NO: 206), the
ORF of the nucleotide sequence of Y1-LC (SEQ ID NO: 207), and the amino acid
sequence of Yl-LC (SEQ ID NO: 208) are provided.
[168.] FIG. 49 provides the amino acid sequence of TM1 (SEQ ID NO: 209).
37
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
[169.] FIG. 50 provides the amino acid and nucleotide sequences of the Y16
scFv
(SEQ ID NO: 210).
[170.] FIG. 51 provides the amino acid sequence of the Y1 Biotag (SEQ ID NO:
211).
[171.] FIG. 52 provides the amino acid sequence of the Yl-cys-kak SCFV (SEQ
ID NO:. 212).
DETAILED DESCRIPTION OF THE INVENTION
[172.] In the present invention, whole cells were used to select specific
antibodies
that recognize leukemia cell surface determinants, wherein the specific
receptor was not
previously known or characterized. Additionally, a mufti-step biopanning
process was
utilized, in which phage were selected by panning on more than one cell type.
This is a
marked improvement over prior art methods in which the selection of antigen-
specific
phage antibodies has largely relied on biopanning against an immobilized
single antigen,
and there was only limited selection using whole cells as a target.
[173.] Certain epitopes that were identified by this multistep process are
characterized by the presence of sulfated moieties, such as sulfated tyrosine
residues or
sulfated carbohydrate or lipid moieties, preferably within a cluster of two or
more acidic
amino acids, are found on ligands and receptors that play important roles in
such diverse
processes as inflammation, immune reactions, infection, autoimmune reactions,
metastasis, adhesion, thrombosis and/ or restenosis, cell rolling, and
aggregation. Such
epitopes are also found on diseased cells, such as B-CLL cells, AML cells,
multiple
myeloma cells, and metastatic cells. These epitopes are useful targets for the
therapeutic
mediation of these processes and for diagnostic procedures.
[174.] Although, these epitopes have variable primary amino acid sequences,
antibodies directed against such sulfated epitopes are often capable of
binding to, or
crossreacting with, more than one such epitope on more than one molecule,
albeit not
necessarily simultaneously. Such antibodies are useful as therapeutic agents
against
cancers (both as anti-tumor agents and as anti-metastatic agents), leukemias,
autoimmune
38
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
diseases, viral diseases, diseases involving abnormal aggregation, diseases
involving
abnormal adhesion, infarction, cardiovascular diseases and inflammatory
diseases.
[175.] The human scFv Y1 antibody was isolated from a human antibody phage
display library that was used to screen fixed human platelets in order to
identify
antibodies that bind platelets. Several clones (different scFv antibodies)
were isolated and
characterized. One of these clones, designated as Y1, unexpectedly was found
to bind
leukemia cells derived from AML patients and patients having certain other
leukemias.
Another clone, Y17, was also isolated by panning on fixed platelets and was
found to
bind to human blood.
[176.] Proteins extracted from human platelets were Western blot analyzed on
SDS-PAGE using the Yl scFv antibody and the Yl7 scFv antibody, in order to
identify
the receptors to which the antibodies bind on the surface of the platelets.
Using this
methodology, it was determined that the Yl scFv and Y17 scFv epitope on
platelets is
glycocalicin, one of the subunits of the CD42 complex.
[177.] The human platelet derived glycocalicin extracellular fragment was
purified from activated platelets. It was digested with various proteases,
such as ficin,
mocarhagin, cathepsin G, in order to localize precisely the Y1 binding epitope
on the
glycocalicin molecule. Analysis was performed by the Western blot methodology
using
the Y1 antibody as a detection tool. In addition, commercially available anti-
glycocalicin
antibodies (antibodies that are known to bind to different epitopes of
glycocalicin) were
used in a competition binding assay with the Y1 antibody to determine the Y1
binding
epitope on glycocalicin.
[178.] Based on the results, it was concluded that amino acids 272 through 285
of
glycocalicin play a major role in the binding of Yl to glycocalicin. In
addition, since the
E. coli derived recombinant N- terminal polypeptide of glycocalicin (amino
acids 1 to 340
and 1 to 480) was not detectable by the Y1 antibody, it was concluded that Yl
binding to
its epitope depends on post-translational modifications, such as glycosylation
or sulfation,
which are modifications that are not known to occur in E. coli).
39
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
[179.] In order to verify this hypothesis, the purified glycocalicin was
treated
with enzymes (glycosidases) that remove N and O-linked sugar moieties from
proteins
and enzymes (sulfatases) that remove sulfate moieties from proteins. The
binding of the
Yl antibody to glycocalicin or glycocalicin derived fragments was not affected
by the
glycosidases. This result indicates that sulfated groups are essential for the
binding of Y1
to glycocalicin.
[180.] In order to further verify these results, sulfated and non-sulfated
synthetic
peptides based on the identified epitope (amino acids 272 to 285 of
glycocalicin) were
prepared and used to assess the binding specificity of theYl antibody to
glycocalicin in
their presence (ELISA assay). Sulfated peptides inhibited the binding of the
Y1 antibody
to glycocalicin several folds higher than the related non-sulfated peptides
indicating that
sulfation is required for binding.
[181.] From the above experimental results, it was concluded that the epitope
for
Y1 antibody is located between amino acids 272 and 285 on glycocalicin in
which there
is cluster of negatively charged amino acids.
[182.] In parallel, the binding of the Y1 antibody to KG-1 cells (a human cell
line
derived from AML patient), to various human plasma derived proteins, and to
primary
leukemia patient blood samples was studied.
[183.] The Y1 antibody was found to bind with relatively low affinity to two
human plasma derived proteins, one in the size of ~SOkD molecular weight,
which was
identified as fibrinogen y prime and a -~-80kD molecular weight protein, which
was
identified as complement compound 4 (CC4) and human lumican. These proteins
contain sulfated tyrosine residues accompanied by a stretch of negatively
charged amino
acids.
[184.] The Yl ligand on KG-1 cells was identified as PSGL-1, which is a
receptor for E, L- and P- selectins. PSGL-1 was identified as the ligand of
the Yl
antibody on KG-1 cells based on competition assays (wherein binding of the Y1
antibody
to the KG-1 cells was carried out in the presence of different commercially
available anti
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
PSGL-1 antibodies) and upon a set of experiments using sulfated and non-
sulfated
synthetic peptides derived from the N-terminal site of PSGL-1. The N-terminal
site of
PSGL-1 contains sulfated tyrosine residues accompanied by a cluster of
negatively
charged amino acids.
[185.] Although the Y1 antibody binds to several molecules, such as the
glycocalicin molecule on platelets, fibrinogen-gamma prime, the complement
compound
4 of human plasma, and the PSGL-1 molecule on KG-1 cells, its affinity to
primary
leukemia cells derived from either AML or multiple myeloma (MM) patients is
several
magnitudes higher relative to the previously mentioned epitopes. Moreover, the
fact that
commercially available anti PSGL-1 antibody (KPL1) does not recognize all (7
out of 12)
diseased primary leukemia cells in blood samples derived from patients, while
the Y1
antibody recognizes them specifically and selectively, indicates that there
are additional
epitopes for Y1 antibody on primary leukemia cells that differ from that on KG-
1 cells.
[186.] Examples of sulfated epitopes according to the present invention
include
those delineated in Formulae I, II, and III, as well as derivatives, homologs,
mimetics, and
variants thereof.
Formula (I):
(S)r
[(W)Z - P - (~')c - P]q
Wherein:
W is any amino acid other than Aspartate and Glutamate
Y is any naturally occurring moiety that is capable of being sulfated
P 1S (A)m(A)n(X)u or (X)u(A)n(A)m Or (A)n(~)u(A)m
Or (A)n(A)m(X)u Or (x)u(A)m(A)n Or (A)m(X)u(A)n
41
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
S is sulfate or a sulfated molecule
X is any amino acid except Aspartate, Glutamate, or Tyrosine
A is any negatively charged amino acid or leucine, isoleucine, proline,
phenylalanine, serine, or glycine
q islto6
z is0, l,or2
r is0orl
t isl,2or3
a isOto2
n isOto3
m isOto3
wherein if n = 0 then m >0; wherein if m = 0 then n >0; wherein if q is 1, r
is 1, and if q
is >1 at least one of Y is sulfated; and further wherein the isolated epitope
is capable of
being bound by an antibody, antigen-binding fragment thereof, or complex
thereof
comprising an antibody or binding fragment thereof, comprising a first
hypervariable
region comprising SEQ ID NO: 8 or SEQ ID NO: 20.
[187.] A preferred epitope is the epitope of Formula I wherein W is Glycine, Y
is
a peptido conjugate of Tyrosine or a glyco conjugate of Asparagine, Serine or
Threonine;
A is Glutamate, y Carboxy Glutamate or Aspartate; and q is 1, 2, or 3. In
certain
embodiments, Y is a peptido conjugate of Tyrosine; q is 3; and r is 1.
Formula II:
\S)r ~s)r \S)r
(W)Z - P - (Y)r - P - (Y)t - P - (Y)t - P Formula II
42
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Wherein:
W is any amino acid other than Aspartate and Glutamate
Y is any naturally occurring moiety that is capable of being sulfated
P is ~A~m~AyXy Or (X~OA-OA~m Or (A)n(X)u(A)m
Or ~A~yA~m~Xy Or ~X~yA~m~AO Or ~A~m(XyA~n
S is a sulfate or a sulfated molecule
X is any amino acid except Aspartate, Glutamate or Tyrosine
A is any negatively charged amino acid or leucine, isoleucine, proline,
phenylalanine, serine, or glycine
z is 0, 1, or 2
r is0orl
t is 1, 2 or 3
a is 0 to 2
n isOto3
m isOto3
wherein if n =0 then m > 0; wherein if m = 0 then n > 0; wherein at least one
Y is
sulfated; and further wherein the isolated epitope is capable of being bound
by an
antibody, antigen-binding fragment thereof, or complex thereof comprising an
antibody
or binding fragment thereof, comprising a first hypervariable region
comprising SEQ ID
NO: 8 or SEQ ID NO: 20.
[188.] A preferred epitope is the epitope of Formula II wherein: W is Glycine;
Y
is a peptide conjugate of Tyrosine or a glyco conjugate of Asparagine, Serine
or
43
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Threonine; A is Glutamate, y Carboxy Glutamate or Aspartate, Leucine,
Isoleucine
Phenylalanine, Serine or Glycine. In certain embodiments, Y is a peptido
conjugate of
Tyrosine; q is 3; and r is 1.
Formula III:
~S)r ~S~r ~S~r .
(CT)z~X)OE)UD)m~Y)t ~X)OE)OD)m(Y)t(X)u(E)n(D)rn(Y)t(D)m(E)n(X)u
Wherein:
G is Glycine
E is Glutamate
D is Aspartate
Y is Tyrosine
S is sulfate or a sulfated molecule
X is any amino acid except the above
z is 0, 1, or 2
t is l, 2 or 3
r is0orl
a is 0 to 2
n is 0 to 3
m is 0 to 3
44
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
wherein at least one Y is sulfated; wherein if n = 0 then m > 0; wherein if m
= 0 then n >
0; and further wherein the isolated epitope is capable of being bound by an
antibody,
antigen-binding fragment thereof, or complex thereof comprising an antibody or
binding
fragment thereof, comprising a first hypervariable region comprising SEQ ID
NO: 8 or
SEQ ID NO: 20.
[189.] A preferred epitope is the epitope of Formula III wherein r is 1.
[ 190.] The sulfated moiety of any of the Formulae may be also a peptido- or
glyco- or lipo- conjugate. Y may comprise a lipid and/ or carbohydrate
molecule. The
epitopes may have at least one post-translational modification in addition to
sulfation.
[191.] Such epitopes are found on such diverse molecules as GPIb and PSGL-1
and are found on certain diseased cells, such as B-CLL cells, AML cells,
multiple
myeloma cells, and metastatic cells. Sulfation of tyrosine and/ or other
moieties is
particularly important for binding to these epitopes. Human proteins known to
be
tyrosine sulfated include the following:
Peptide Sequence
Thrombomodulin (408-426) E C P E G Y I L D D G F I C T D I D E
HumanGPIbcc (269-287) DEGDTDLYDYYPEEDTEGD
Human Heparin Cofactor II (56-75) GEEDDDYLDLEEDDDYIDIVD
Human Fibrinogen ~' (408-427) V R P E H P A E T E Y D S L Y P E D O L
a-2-Antiplasmin P P M E E D Y P Q F G S P
Cholecystokinin (CCK) R I S D R D Y M G W M D F
a-2-Choriogonadotropin C H C S T C Y Y H K S - C O O H
Complement C4 MEANEDYEDYEYDELPAK
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
PSGL-1 QATEYEYLDYDFLPET
Factor VIII (716-731) GDYYEDSYEDISAYLL
Lumican GYYDYDFPL
Yl - Production and Selection
[192.] One example of an antibody of the present invention that binds to
epitopes
of Formulae I-III is the fully human monoclonal antibody Y1. The selection,
production,
and initial characterization of Y1 are described in detail in U.S. Patent
application Serial
Nos. 09/751,181 and 60/258,948. Briefly, a phage display library displaying
scFv
antibody fragments was utilized to obtain and produce targeting molecules, and
flow
cytometry, particularly fluorescence-activated cell sorting (FACS), was used
for
identifying and isolating specific phage clones, the peptide or polypeptide of
which
recognizes target cells. The phage display library used herein was constructed
from
peripheral blood lymphocytes of a non-immunized human donor.
[193.] Phage clones were selected by and identified through a multi-step
procedure known as biopanning. Biopanning was carned out by incubating phage
displaying protein ligand variants (a phage display library) with a target,
removing
unbound phage by a washing technique, and specifically eluting the bound
phage. The
eluted phage were optionally amplified before being taken through additional
cycles of
binding and optional amplification which enriched the pool of specific
sequences in favor
of those phage clones bearing antibody fragments that display the best binding
to the
target. After several rounds, individual phage clones were characterized, and
the
sequences of the peptides displayed by the clones were determined by
sequencing the
corresponding DNA of the phage virion.
[194.] In the present invention, screening of platelets was carried out
against non-
defined epitopes for the initial biopanning steps, with subsequent clone
selection
performed with a desired target cell (e.g., B-CLL cells, AML cells, multiple
myeloma
cells, and metastatic cells), the targeted cell surface markers of which are
unknown.
46
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
[195.] Malignant and diseased blood cells (e.g., leukemia or lymphoma) are
characterized as immature cells that express cell surface proteins normally
found in
partially differentiated hematopoietic progenitors. Thus, platelets are an
attractive source
for the identification of premature cell surface markers expressed on diseased
or
malignant blood cells.
[196.] Y1, an scFv clone which binds to platelets and myleogenous leukemia
cells, particularly AML cells, was selected. Y1 scFv has the sequence SEQ ID
NO: 25.
The binding characteristics of Y1 are primarily attributable to its heavy
chain CDR3
region, which has the sequence SEQ ID NO: 8. Full Y1-IgG antibodies were also
produced.
[197.] A second scFv clone, Y17, which binds to platelets and cell lines
derived
from human myleogenous leukemia cells, particularly AML cells, was also
selected. Y17
scFv has the sequence SEQ 1D NO: 203. The binding characteristics of Y17 are
primarily
attributable to its heavy chain CDR3 region, which has the sequence SEQ ID NO:
20.
Full Y17-IgG antibodies were also produced.
Antibody Production
[198.] CDRs according to the present invention may also be inserted into
cassettes to produces antibodies. A cassette, as applied to polypeptides and
as defined in
the present invention, refers to a given sequence of consecutive amino acids
that serves as
a framework and is considered a single unit and is manipulated as such. Amino
acids can
be replaced, inserted into, removed, or attached at one or both ends.
Likewise, stretches
of amino acids can be replaced, inserted into, removed or attached at one or
both ends.
[199.] The amino acid sequence of the cassette may ostensibly be fixed,
whereas
the replaced, inserted or attached sequence can be highly variable. The
cassette can be
comprised of several domains, each of which encompasses a function crucial to
the final
construct.
47
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
[200.] The hypervariable regions of antibodies of the invention form the
antigen
binding sites of antibodies of the present invention. The antigen-binding site
is
complementary to the structure of the epitopes to which the antibodies bind
and therefore
are referred to as complementarity-determining regions (CDRs). There are three
CDRs
on each light and heavy chain of an antibody, each located on the loops that
connect the ~3
strands of the VH and VL domains..
[201.] The cassette of a particular embodiment of the present invention
comprises, from the N-terminus, frameworlc region 1 (FRl), CDRl, framework
region 2
(FR2), CDR2, and framework region 3 (FR3).
[202.] In an embodiment of the invention, it is possible to replace distinct
regions
within the cassette. For example, the CDR2 and CDRl hypervariable regions of
the
cassette may be replaced or modified by non-conservative or, preferably,
conservative
amino acid substitutions. More specifically, the CDR2 and CDR1 regions of a
cassette of
consecutive amino acids selected from the group comprising of SEQ ID NOs: 30-
113 or a
fragment thereof can be replaced by SEQ m NOs:115 and 114, respectively. Even
more
specifically, the CDR2 and CDRl regions of a cassette of consecutive amino
acids
selected from the group comprising of SEQ ID NOs: 30-32, 35, 37-39, 41, 43,
45, 46, 48,
51, 54, 57, 59-68, 70, 71, 76-85, 87, 89-92, 94, 97, 99, 103, 106, 112, and
113 or
fragment thereof can be replaced by SEQ ID NOs:115 and 114, respectively.
[203.] 111 a preferred embodiment of the invention, the peptide or polypeptide
comprises a heavy and a light chain, and each chain comprises a first, second
and third
hypervariable region which are the CDR3, CDR2 and CDR1 regions, respectively.
The
binding selectivity and specificity are determined particularly by the CDR3
region of a
chain, possibly by the CDR3 region of the light chain and, preferably, by the
CDR3
region of the heavy chain, and secondarily by the CDR2 and CDRl regions of the
light
chain and, preferably, of the heavy chain. The binding selectivity and
specificity may
also be secondarily influenced by the upstream or downstream regions flanking
the first,
second, and/or third hypervariable regions.
48
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
[204.] In a preferred embodiment, the CDR3 region of the peptide or
polypeptide
has an amino acid sequence selected from the group comprising SEQ ID NOs:B-24.
[205.] In a more preferred embodiment, the CDR3 region of the heavy chain has
an amino acid sequence selected from the group comprising SEQ ID NOs:B-24, the
CDR2 has an amino acid sequence identical to SEQ ID N0:115, and the CDRl
region
has an amino acid sequence identical to SEQ ID NO:l 14.
[206.] In a most preferred embodiment of the invention, the CDR3 region has an
amino acid sequence identical to SEQ ID N0:8.
[207.] A preferred embodiment of the invention is a scFv with a CDR3 sequence
identical to SEQ ID NO: 8 and a full scFv sequence identical to SEQ ID N0:25.
[208.] In a most preferred embodiment of the invention the CDR3, CDR2 and
CDR1 regions have the amino acid SEQ ID NOs:B, 115 and 114, respectively.
[209.] In an embodiment of the invention, the Fv peptide comprises a CDRl and
CDR2 region of the variable heavy chain which itself comprises a cassette with
an amino
acid sequence selected from the group comprising SEQ ID NOs:30-113; a CDR3
region,
preferably of the variable heavy chain, which has an amino acid sequence
selected from
the group comprising SEQ ID N0:8-24; an upstream region flanking the CDR3
region
which has the amino acid sequence of SEQ >D N0:117; a downstream region
flanking the
CDR3 region which has the amino acid sequence of SEQ ID N0:116; a spacer of 0-
20
amino acid residues of SEQ 117 NO: 123 or 124; a variable light chain region
the
sequence of which is SEQ.ID N0:7.
[210.] Similarly, in another embodiment the upstream region flanking the CDR2
region has the amino acid sequence of SEQ ID N0:119, the downstream region
flanking
the CDR2 region has the amino acid sequence of SEQ ID N0:118, the upstream
region
flanking the CDRl region has the amino acid sequence of SEQ ID N0:121 and the
downstream region flanlcing the CDRl region has the amino acid sequence of SEQ
ID
N0:120.
49
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
[211.] A preferred embodiment of the invention provides for a peptide or
polypeptide wherein the second and third hypervariable regions are a CDR2 and
a CDRl
hypervariable region, respectively and wherein the CDR3 amino acid sequence is
SEQ ID
N0:8, wherein the CDR2 amino acid sequence is SEQ m NO:115, wherein the CDR1
amino acid sequence is SEQ m NO:l 14, wherein the upstream region flanking the
CDR3
region has the amino acid sequence of SEQ m N0:117, wherein the downstream
region
flanking the CDR3 region has the amino acid sequence of SEQ m N0:116, wherein
the
upstream region flanking the CDR2 region has the amino acid sequence of SEQ m
N0:119, wherein the downstream region flanking the CDR2 region has the amino
acid
sequence of SEQ ID N0:118, wherein the upstream region flanking the CDRl
region has
the amino acid sequence of SEQ m N0:121 and wherein the downstream region
flanking
the CDRl region has the amino acid sequence of SEQ m N0:120.
[212.] Another preferred embodiment of the invention provides for an Fv
molecule that comprises a first chain having a first, a second and a third
hypervariable
region and a second chain having a first, a second and a third hypervariable
region,
wherein one of the hypervariable regions of the first chain has a sequence
selected from
the group consisting of SEQ ID NOs:B-24, and wherein one of the hypervariable
regions
of the second chain has a sequence selected from the group consisting of SEQ m
NOs: l-
6 and 125-202, and wherein the first, second and third hypervariable regions
are a CDR3,
CDR2 and CDRl region, respectively and wherein the Fv is a scFv or a dsFv, and
optionally having one or more tags.
[213.] Another embodiment of the invention provides for a peptide or
polypeptide (i) wherein the first chain and the second chain each comprises a
first
hypervariable region selected from the group consisting of SEQ m NOs:B-24; or
(ii)
wherein the first hypervariable region of the first and second chains are
identical and
selected from the group consisting of SEQ m NOs:B-24; or (iii) wherein the
first
hypervariable region of the first chain is selected from the group consisting
of SEQ ID
NOs:B-24, and the first hypemariable region of the second chain is selected
from the
group consisting of SEQ ID NOs:l-6 and 125-202; or (iv) wherein the first
hypervariable
region of the first chain is selected from the group consisting of SEQ m NOs:l-
6 and
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
125-202, and the first hypervariable region of the second chain is selected
from the group
consisting of SEQ ID NOs:B-24.
A further embodiment provides for the peptide or polypeptide of the invention
wherein
the second and third hypervariable regions of the first chain are SEQ ID NOs:l
14 and
115, respectively.
[214.] For all the amino acid sequences of _< 25 amino acid residues described
and detailed herein (e.g., CDR regions, CDR flanking regions), it is to be
understood and
considered as a further embodiment of the invention that these amino acid
sequences
include within their scope one or two amino acid substitutions) and that
preferably the
substitutions are conservative amino acid substitutions. For all the amino
acid sequences
of > 25 amino acid residues described and detailed herein, it is to be
understood and
considered as an embodiment of the invention that these amino acid sequences
include
within their scope an amino acid sequence with >_ 90% sequence similarity to
the original
sequence (Altschul et ccl., Nucleic Acids Res., 25, 3389-3402 (1997)). Similar
or
homologous amino acids are defined as non-identical amino acids which display
similar
properties, e.g., acidic, basic, aromatic, size, positively or negatively
charged, polar, non-
polar.
[215.] Percentage amino acid similarity or homology or sequence similarity is
determined by comparing the amino acid sequences of two different peptides or
polypeptides. The two sequences are aligned, usually by use of one of a
variety of
computer programs designed for the purpose, and amino acid residues at each
position are
compared. Amino acid identity or homology is then determined. An algorithm is
then
applied to determine the percentage amino acid similarity. It is generally
preferable to
compare amino acid sequences, due to the greatly increased sensitivity to
detection of
subtle relationships between the peptide, polypeptide or protein molecules.
Protein
comparison can take into account the presence of conservative amino acid
substitutions,
whereby a mismatch may yet yield a positive score if the non-identical amino
acid has
similar physical and/or chemical properties (Altschul et al., Nucleic Acids
Res., 25, 3389-
3402 (1997).
51
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
[216.] In an embodiment of the invention the three hypervariable regions of
each
of the light and heavy chains can be interchanged between the two chains and
among the
three hypervariable sites within and/or between chains.
Polyclonal Antibodies Against VL (derived from Yl
[217.] The DNA fragment encoding the VL domain (variable light chain) of
human antibody was PCR-cloned from the Yl clone (the identical DNA fragment
can be
obtained from any other clone in the Nissim I library (Nissim et al.,
"Antibody fragments
from a 'single pot' phage display library as irmnunochemical reagents," ENTBO
J. 13(3):
692-698 (1994)) or even from the human genome using the same methodology) with
the
following synthetic oligonucleotide primers: oligo 5'-Nde1 ,
(TTTCATATGGAGCTGACTCAGGACCCTGCT) and oligo 3'-EcoRI
(TTTGAATTCCTATTTTGCTTTTGCGGC). After amplification by polymerase chain
reaction (PCR conditions: 94° 1', 56° 2', 72° 2' x30 then
65° 5') the obtained DNA
fragment was digested with NdeI and.EcoRI restriction enzymes and cloned into
NdeI and
EcoRI restriction enzymes sites of a pre-digested plasmid, which is an IPTG
inducible
expression vector used for prokaryotic expression of recombinant proteins in
E. coli. E.
coli cells were transformed with the ligation mixture and positive clones were
selected by
PCR amplification using the above oligonucleotide primers. Cells harboring
this plasmid
were grown and induced for expression by IPTG. Bacterial cells were harvested
by
centrifugation from 1 liter of culture post induction with IPTG, inclusion
bodies were
isolated and solubilized in guanidine-HCl + DTE, and refolded by dilution in a
buffer
containing TRIS-ARGIN1NE-EDTA. After refolding at 5-10 ° for 48 hrs,
the solution
containing protein was dialyzed and concentrated to 20mM Glycine pH 9. The
dialyzed
solution containing proteins was re-purified by using an ionic exchange
column,
HiTrapQ, and eluted with a gradient of NaCI. The main peak was analyzed by SDS-
PAGE and by gel filtration. At least 10 mgs of purified VL were obtained from
an original
1 liter culture.
[218.] Rabbits were immunized with VL (400mg) in the presence of CFA
(complete Fruend's adjuvant) then by VL (200mg) in the presence of IFA
(incomplete
52
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Fruend's adjuvant) at 2 to 4 weeks intervals. The titers obtained were low
(1:50-1:100)
probably due to the high homology between the VL's from human and rabbit.
Polvclonal Antibodies against sc~ Antibodies
[219.] Two individual scFv antibody clones (Y1 and N14 ) derived from the
Nissim I antibody phage display library (Nissim et al., "Antibody fragments
from a
'single pot' phage display library as immunochemical reagents," EMBO J. 13(3):
692-698
(1994))were cultured separately. After IPTG induction the cultures were grown
at 22° C
for 16 hours. The scFv antibody fragments were harvested from the bacterial
cell
periplasm and were purified on a Protein A-Sepharose column. All the
procedures for
bacterial clone culturing, induction protocol, scFv antibody fragment
harvesting and
antibody fragment purification were carried out in accordance with: Harnson
J.L.,
Williams S.C., Winter G, and Nissim A. Met7zods E~zymol. 267 : 83-109 (1996).
Basically, any two or more individual scFv clones can be selected from the
Nissim I
antibody phage display library in order to prepare rabbit derived polyclonal
antibodies
that recognize any individual scFv antibody that is present in the Nissim
library or any
IgG or fragment thereof provided that it contains the same VL or a fragment
thereof.
[220.] Rabbits were immunized with 400 mg of 1:1 ratio mixture of the purified
scFv antibody fragments in the presence of complete Fruend's adjuvant then
with 200 mg
of that mixture in the presence of incomplete Fruend's adjuvant, at 2 to 4
weeks intervals.
[221.] For detection of the scFv antibodies binding to cells by flow cytometry
(FACS) or to various protein fractions on SDS-PAGE ( Western blot analysis),
the
polyclonal anti scFv antibodies were used directly from the serum of the
immunized
rabbits or after purification on a Protein A-Sepharose column.
Characterization of Yl Binding Site~on Platelets
[222.] Circulating platelets are cytoplasmic particles released from the
periphery
of megakaryocytes. Platelets play an important role in hemostasis. Upon
vascular injury,
platelets adhere to damaged tissue surfaces and attach one another (cohesion).
This
sequence of events occurs rapidly, forming a structureless mass (commonly
called a
53
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
platelet plug or thrombus) at the site of vascular injury. The cohesion
phenomenon, also
known as aggregation, may be initiated i~ vitro by a variety of substances, or
agonists,
such as: collagen, adenosine-diphosphate (ADP), epinephrine, serotonin, and
ristocetin.
Aggregation is one of the numerous ira vitro tests performed as a measure of
platelet
function.
[223.] Several lines of evidence in the prior art indicate that the cluster of
negatively charged amino acids between Asp269 and Asp287 of GPIba is important
for
von Willebrand Factor (vWF) binding to platelets, which in turn mediates
platelet
adhesion to damaged blood vessels, platelet aggregation induced by high shear
in regions
of arterial stenosis, and platelet activation induced by low concentrations of
thrombin.
Ward, C.M., et al., Biochemistry 35(15): 4929-39 (1996). The interaction of
vWF with
GPIb is dependent upon an activation event or coyformationah change in vWF
structure
when bound to matrix or exposed to shear. This process is mimicked i~c
vitf°o by specific
modulators that bind to vWF, such as ristocetin and botrocetin.
Reactivity of Yl to Platelet Cell Extract
[224.] Immunobhotting and endoprotease cleavage techniques were used to
identify the epitope for Y1 on the surface membrane of platelets. Endoprotease
cleavage
sites on the GPIba molecule are shown in FIG. 1.
Western Blot Analysis
[225.] Y1 scFv was selected from phage antibody library by biopanning on
human platelets and was found to bind to fixed and washed human platelets.
Characterization of Y1 was done by using ELISA assay and by FAGS analysis.
[226.] In order to characterize the epitope on the platelet membrane to which
Yl
binds, platelet surface proteins were separated by SDS-PAGE (under both
reducing and
non-reducing conditions) and immunobhotted with biotin labeled-Yl under
reducing and
non-reducing conditions. The results of this experiment demonstrate that Y1
reacts with a
protein with a molecular mass of 135 kDa under reducing conditions, and with a
protein
with molecular mass of 160 h~Da under non-reducing conditions. These molecular
54
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
masses correspond to platelet GPIba, which has a molecular mass of 135 kDa
under
reducing conditions. Under non-reducing conditions, the GPIba chain disulfide-
linked to
GPIb(3 has a molecular mass of 160-kDa. (FIG. 2).
[227.] The GPIba chain is disulfide-linked to the GPIb(3 chain to form the
platelet membrane protein GPIb. Monoclonal antibodies, MCA466S (Serotec) and
S.C.7071(Santa Cruz), are known to bind respectively to the C-terminal
fragment of
GPIba and to the N-terminal of GPIba and were found to react to the same
fragments
with which Y1 reacts under reducing and non-reducing conditions (the S.C. was
used
only under reducing conditions). These results further confirm that Y1 binds
to the
GPIba platelet surface protein.
[228.] Further analysis on semipurified GPIb fragment (glycocalicin) by
Western
analysis confirmed that indeed Y1 binds to the alpha subunit of the GPIb
complex.
[229.] Western analysis of recombinant GPIb expressed in E. coli demonstrated
that GPIb expressed in E. coli does not react with Y1. Thus, it appears that
post-
translational modification, wluch does not occur in E. coli is required for Y1
binding.
Neither N- nor O- glycanases affect the binding of Y1 to KG-1 cells. However,
Yl
binding can be inactivated by treatment of ligands with aryl sulfatases or by
proteases.
(FIG. 3).
Localization of Yl Enitope Site on GPIba fragment of ~lycocalicin (GC)
[230.] To further localize the Yl binding site, specific endoproteases with
known
cleavage sites were used to digest GPlb and the fragments were tested for Y1
binding.
Effect of O-Sialo~lvconrotein endonrotease on Yl binding to platelet GPIba
[231.] The enzyme O-Sialoglycoprotein endoprotease from PasteuYella
hae~raolytica (Cedarlan CLE 100) selectively cleaves human platelet GPIb and
specifically
cleaves only proteins containing sialylated, O-linked glycans. O-
Sialoglycoprotein
endoprotease does not cleave N-linked glycoproteins or unglycosylated
proteins. This
enzyme has been reported to cleave GPIb, which is heavily O-glycosylated, but
not
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
GPIIb-IIIa or other receptors on platelets. GPIba was digested with O-
Sialoglycoprotein
endoprotease in order to further establish the binding of Yl to the molecule.
[232.] Immunoblots (FIGS. 4 and 5) and FACS analysis (FIG. 6) demonstrated
that incubation of washed platelets with O-Sialoglycoprotein endoprotease
abolishes
binding of Yl, as well as the binding of monoclonal antibody MCA466S
(Serotec), which
is directed against GPIba. The endoprotease did not alter the binding of a
monoclonal
antibody (anti-CD61) directed against GPIIb/IIIa. (FIG. 4). These results
provide
additional evidence that the receptor for Y1 on platelet membranes is GPIba.
Mocarha~in Cleavage of GPIb -- Mapping of the Yl Epitope
[233.] Mocarhagin [Sigma L4515a] is a cobra venom metalloproteinase that
cleaves
platelet GPIba specifically at a single site between residues glu-282 and asp-
283, thereby
generating two stable products: a ~45-kDa N-terminal fragment (Hisl-G1u282),
which is
released into the supernatant, and a membrane-bound ~95 kDa C-terminal
fragment.
[234.] Washed platelets were treated by mocarhagin, and platelet lysates were
electrophoresed on SDS-polyacrylamide gels and transferred to nitrocellulose.
Western
blot analysis of lysates of mocarhagin-treated washed platelets with Yl shows
a loss of
the band corresponding to GPIba (135 kDa ) and binding of Y1 to the N-terminal
~45
kDa tryptic fragment. A monoclonal antibody (MCA466S) directed against the
C-terminal fragment of GPIba reacted with the ~95 kDa C-terminal fragment, and
a
monoclonal antibody (S.C.7071) directed against the N-terminal fragment of
GPIba
reacted with the same ~45 kDa fragment that was recognized by Y1. (FIG. 7).
[235.] Mocarhagin treatment of glycocalicin (soluble, extracellular fragment
of
GPIba) gave similar results to those observed with washed platelets, showing
binding of
Y1 and monoclonal antibody S.C.7071 to the ~45 kDa N-terminal cleavage product
fragment of GPIba. (FIG. 8). These results suggest that the epitope for Y1 is
contained
within the sequence Hisl-G1u282.
56
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Characterization of the Y17 Clone-Binding to GPIb
[236.] Y17, a second scFv human antibody fragment of the invention, which was
selected in the same manner as Y1, was characterized using the methods used to
characterize Yl. [See Example 17] Briefly, Y17 was selected from a phage
antibody
library by biopanning on human platelets. Characterization of Y17 was done by
using
ELISA assay and FAGS analysis. Y17 was found to bind to both fixed and washed
human platelets. In order to further characterize the receptor on platelet
membranes
which bind Y17, platelet proteins were separated by SDS-PAGE and immunoblotted
with
biotin labeled-Y17 under reducing and non-reducing conditions. The results
demonstrated that Y17 reacts with protein having an apparent molecular weight
of 135
kDa under reducing conditions, and with a protein having an apparent molecular
weight
of 160 kDa under non-reducing conditions. These results correspond to platelet
GPIba
which under reducing conditions has a molecular weight of 135 kDa and under
non-
reducing conditions has a molecular weight of 160 kDa and consists of the
GPIba-chain
disulfide linked to GPIba. Monoclonal antibodies, MCA466S (Serotec) directed
against
the C-terminal fragment of GPIba monoclonal antibody S.C. 7071 (Santa Cruz)
that
recognize the N-terminus of GPIba react with the same baaids as Y17 under
reducing and
non-reducing conditions. (FIG. 2).
[237.] Western Blots show that Y1 and Y17 bind similarly to platelet lysates.
(FIG. 9).
[238.] Y1 and Y17 also bind similarly to glycocalicin after cleavage of
glycocalicin by O-Sialoglycoprotein Endoprotease or Ficin. (FIGS. 5 and 10).
[239.] FAGS analysis indicated that Y1 have similar binding profiles to
platelets
and KG-1. In addition, both do not bind to Raji and T2 cells. In contrast, TMl
(SEQ ID
NO: 209), Y16 (SEQ ID NO: 210)and Y45 do not bind to any of the above
mentioned
human cell lines.
57
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
[240.] These results demonstrate that Y1 and Y17, two monoclonal antibody
fragments of the present invention, share an epitope on various cells, and
that this epitope
is not recognized by any other tested monoclonal antibodies.
Cathensin G Cleavage of GPIb -- Manning of the Yl Enitoue
[241.] Cathepsin G (Sigma C4428), a neutrophil serine protease, cleaves
glycocalicin at a first cleavage site between residues Leu-275 and Tyr-276 and
at a
second cleavage site between residues Val-296 and Lys-297. Cathepsin G
treatment of
glycocalicin generates two N-terminal fragments: a small N-terminal 42 kDa
fragment
(Hisl-Leu275), a large N-terminal 45 lcDa N-terminal fragment (Hisl-Val-296),
and
corresponding ~95 kDa C-terminal fragments. (FIG. 1).
[242.] Glycocalicin and glycocalicin fragments generated by cathepsin G
digestion were electrophoresed on SDS-polyacrylamide gels and transferred to
nitrocellulose for Western analysis. In immunoblots, Yl bound to the larger N-
terminal
fragment (His 1-Val-296), but not to the smaller N-terminal fragment (His1-
Leu275), nor
to the C-terminal fragment. Likewise, commercial monoclonal antibody SZ2
(Irmnmlotech 0719), which is known to recognize an epitope on GPIba between
residues
Tyr276 and G1u282 also reacts only with the larger N-terminal fragment. (FIGS.
11 and
12).
[243.] Moreover, monoclonal antibody S.C.7071 which is known to recognize an
epitope between Hisl and Leu 275, bound to both N-terminal fragments. Y1 does
not
bind to the His 1-Leu 275 fragment bound by S.C.7071. These results suggest
that the
epitope for Y1 is localized between the first and second cathepsin-G cleavage
site that is
within the sequence Tyr 276-Val 296 or more probably between amino acids 276
to 282.
Effect Of Synthetic Partial GPIba Peptides On Yl Binding To Purified
Glycocalicin
and to Washed Platelets (WP)
[244.] ELISA assays were developed to evaluate the effect of the GPIb derived
synthetic peptides on the binding of Y1 to purified glycocalicin . In
addition, FACS
analysis using washed platelets was carried out. To evaluate the importance of
sulfated
58
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
tyrosine within the Y1 binding site of GPIb, a competitive binding FAGS
analysis was
used. Y1-scFv at a concentration of 1 ~.g was preincubated with different
peptides at
concentrations of 2.5 and 200 p,M. After a preincubation for 30 minutes at
room
temperature the mixture was added to a tube containing 107 washed platelets
and the
binding of Y1 to the washed platelets was assessed using polyclonal rabbit
anti-scFv-PE.
The inhibitory effect of the peptides compared to control binding (Y1 alone)
was
evaluated by measuring the residual binding of Yl to washed platelets. The
peptides and
the results are described in Table 1 and are similar to results that were
observed using the
same peptides in an ELISA assay (Table B). In both assays, a control level of
Y1 binding
was determined, as follows. A polystyrene microtiter maxisorb plate was coated
with (a)
purified glycocalicin or (b) washed platelets. After extensive washing, 0.5
~g/well of Y1
was added. The plate was then incubated with rabbit anti-scFv followed by
addition of
anti rabbit -HRP (horse radish peroxidase) and HRP substrate. The level of
anti rabbit -
HRP binding was measured by the intensity of the color produced, and the level
of anti
rabbit -HRP binding correlates with the level of binding of anti Yl-scFv and
the level of
binding of Yl . The optical density was measured at A4o5. Each sample was
assayed in
duplicate, and the average was calculated.
[245.] The effect of synthetic GPIba peptides on Y1 binding to purified
glycocalicin was evaluated by mixing varying concentrations of the peptides
with a
constant amount of Y1. After a preincubation for 30 minutes at room
temperature, the
mixture was added to a polystyrene microtiter maxisorb plate coated with
purified
glycocalicin, as described for evaluation of Y1 binding in the absence of
peptides. The
inhibitory effect of the peptides was evaluated by measuring the residual
binding of Ylto
glycocalicin using rabbit anti YlscFv and anti rabbit -HRP antibodies, as
described for
evaluation of Y1 binding in the absence of peptides. This study was performed
with four
peptides representing various subsets of the sequence 268 to 285 and a control
peptide.
Each peptide was tested at different concentrations: 200 ~M, 25~.M, 2.S~.M,
and O.SuM.
[246.] The five peptides are as follows in Table 1:
59
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Table 1
Peptide Name Characterization Sequence
EGR negative control peptideREEGRQHFFLLEGRSSYS
P-1 residues 268-285 of GDEGDTDLYDYYPEEDTE
GPIba
P- 1-S residues 268-285 of GDEGDTDLY*DY*Y*PEEDTE
GPIba
P-2-S residues 273-285 of TDLY*DY*Y*PEEDTE
GPIba
P-3-S residues 268-280 of GDEGDTDLY*DY*Y*P
GPIba
Y* is identical to Y which is sulfated tyrosine.
[247.] The results obtained from these assays are presented in Tables 2 and 3
below.
Table 2
Effect 'of Synthetic GPIba Peptides on Y1 Binding to Glycocalicin
0.25 fig/ well Y1
Residual
Binding
of Yl
(% of
baseline)
Peptide 200 ttM 25uM 2.S~M O.S~.M
Concentration
EGR 85 89 100 121
P-1 61 71 94 88
P-1-S 0 25 62 89
P-2-S 15 52 78
P-3-S 21 67 80
[248.] These results clearly show that the inhibitory effect of the peptides
containing sulfated tyrosine is significantly higher than that observed for
the non-sulfated
peptide. This effect is dose-dependent, and peptides containing longer N'
(upstream)
flanking sequences had a higher inhibitory effect than peptides with extended
C'
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
(downstream) flanking sequences. These results clearly support the conclusion
that
sulfated tyrosine is required for Yl binding to GPIba, and that sequences
upstream and
downstream from the sulfated region enhance Yl binding to GPIba.
Table 3
Effect of Synthetic GPIba Peptides on Y1 Binding to Washed Platelets as
Described By
Comparative FACS Analysis
Residual Binding of
Yl (% of baseline)
(Geo Mean)
Peptide 200~.M 2.S~M
Concentration
EGR 119 96
P-1 87 106
P-1-S 5 41
P-2-S 7 61
P-3-S 26 82
Control - No 114
Peptide
[249.] These results further support the hypothesis that sulfated tyrosine
residues
within the specific region are important for Y1 recognition on GPIb. Overall,
analysis of
N-terminal peptide proteolytic fragments of mocarhagin and cathepsin G suggest
that the
GPIbcc amino acid sequence Tyr276-Glu-282 is or contains an important epitope
for
binding of Yl. (FIGS. Tab 1C pages 6 and 7). Further characterization
indicated that in
addition to residues 276-282 (sulfated anionic sequence) of glycocalicin,
upstream amino
acids 283-285 are involved in the recognition site of Y 1.
Biological Activity Of Yl scFv , Y17 scFv and I~G Yl On Platelets Function
[250.] Localization experiments suggested that the Y1 binding site resides at
the
alpha-thrombin and vWF binding sites, which are important for platelet
aggregation.
Therefore the binding of Yl scFv, Y17 scFv, and Y1 IgG to washed platelets and
to
platelet-rich-plasma was studied to determine the effects of the binding on
platelet
aggregation.
61
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Effect of Yl-scFv and Y17-scFv on A~~lutination of Washed Platelets (W.P.)
[251.] Aggregation is determined in PRP due to the presence of thrombotic
agents, while agglutination is determined in washed platelets. The effect of
Yl (scFv) on
agglutination of washed platelets was tested at various concentrations of Yl.
Platelets
were pre-incubated with Y1 scFv, Y17 scFv, Y16-scFv, or a control TM-1 scFv
for 4 min
at 37°C before being exposed to ristocetin, an inducer of platelet
agglutination and
aggregation.
[252.] The results of this study are presented in Table 4 and in FIG. 15.
Preincubation of platelets with 25 ~.g/ml Y1 scFv inhibited agglutination of
washed
platelets induced by ristocetin. At a Yl concentration of 12.5 ~g/ml, only
partial
inhibition of platelet agglutination was observed. No inhibition of platelet
agglutination
was observed at a concentration of 4 ~.g/ml of Y1. These results indicate that
inhibitory
activity of Yl on washed platelet agglutination is dose dependent. Incubation
of washed
platelets with negative control scFv TMl had no effect on platelet
agglutination induced
by ristocetin. Neither Y17 nor Y16, which is another scFv clone selected from
the same
phage display library and using the same multistep procedure used to select
Yl,
significantly inhibit agglutination of washed platelets.
Table 4
ScFv Concentration %inhibition % agglutination
TM-1 scFv 25 ~g/ml 10 90
Y1 scFv 25 ~.g/ml 77 23
Yl scFv 12.5 ~g/ml 33 67
Yl scFv 4 ~g/ml 8 92
Y17 scFv 25 ~.g/ml 15 85
Y16 scFv 38 ~g/ml 14 86
* 100% agglutination is calibrated on the basis of ristocetin treatment.
62
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Effect of Yl-scFv and Y17-scFv on A~~re~ation of Platelet -Rich -Plasma (PRP)
[253.] The effect of Yl (scFv) on aggregation of platelet-rich-plasma (PRP)
was
tested at various concentrations of Y1. PRP was pre-incubated with Y1 scFv,
Y17 scFv,
or a control sTM-1 cFv for 4 min at 37 °C before being exposed to
ristocetin, an inducer of
platelet agglutination and aggregation. A reversible inhibitory effect was
observed when
scFv was added to PRP prior to the addition of ristocetin, and it was dose
dependent.
[254.] The results of this study are presented in Table 5 and in FIG. 16. Y1
at a
final concentration of 50 ~.g/ml inhibited ~80 % of platelet aggregation in
platelet rich
plasma induced by ristocetin as was recorded during the first 4 minutes. There
was no
significant inhibition of platelet aggregation at a Yl concentration of
25ug/ml. Y17 did
not inhibit aggregation of platelets. Incubation of washed platelets with
50~ag/ml of the
negative control scFv, TM1, had no effect on platelet aggregation induced by
ristocetin.
(Table 5).
[255.] A comparison between washed platelets and PRP indicated that (1) scFv
Yl has an inhibitory effect on platelet aggregation and agglutination induced
by
ristocetin; (2) the effect is dose dependent; (3) higher inhibitory effect is
observed in
washed platelets relative to PRP; (4) reversible inhibitory effect was
detected in PRP; (5)
neither TM1 not Y16 scFv antibody fragments has an effect; and (6) Y17 is a
negative
control in this assay.
Table 5
ScFv Concentration % inhibition% aggregation
TM-1 scFv 50 ~.g/ml 0 100
Y1 scFv 50 ~glml 80 20
Yl scFv 25 ~g/ml 13 87
Y17 scFv 38 ~g/ml 0 100
* 100% agglutination is calibrated on the basis of ristocetin treatment.
63
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Effect of Yl-I~G on A~~lutination of Washed Platelets (W.P.
[256.] Due to its natural structure the full IgG Y1 has two binding sites on
GPIba
and one binding site for an Fc receptor. It is likely that if full IgG Y1
binds two GPIba
molecules, it will activate platelets and induce platelet agglutination.
Furthermore,
because platelets have an Fc-receptor, Y1-IgG can induce platelet
agglutination by
binding to GPIba and to an Fc-receptor, thereby producing platelet
agglutination by each
IgG Y1 binding to three platelets. Therefore, the effect of IgG Yl on
aggregation of
washed platelets was tested at different concentrations of Yl-IgG in the
presence or
absence of ristocetin. Induction of platelet aggregation by Yl-IgG was
monitored for 4
min at 37°C, followed by addition of ristocetin.
[257.] The results are presented in Table 6 and FIG. 17 without agonist. Yl-
IgG
alone at a final concentration of SO~.g/ml induced platelet agglutination ~39%
of normal
agglutination of washed platelets. Induction of platelet agglutination by Yl-
IgG was
tested for 4 min at 37 ° C, followed by addition of ristocetin. No
additional effect on
platelet agglutination was seen after the addition of ristocetin: normal
platelet
agglutination was observed. However, there was no induction of platelet
agglutination
when platelets were incubated with 1 ug/ ml Y1.
[258.] There was no reduction of platelet agglutination when a commercial
monoclonal antibody against GPIba (CD42) (Pharmigen), which inhibits platelet
agglutination, or control human IgG-Lambda (Sigma) were used as above.
64
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Table 6 % inhibition % agglutination
Without Without
With With
Ristocetin ristocetin
ristocetin ristocetin
IgG Ab Concentration
Y1-IgG 50 ~g/ml 61 5 39 95
Y1-IgG 25 ~g/ml 65 5 35 95
Y1-IgG 12.5 ug/ml62 5 38 95
Y1-IgG 3:5 txg/ml66 14 34 86
Yl-IgG 1 ~g/ml 92 7 8 93
Mouse anti-human 99.5 100 0.5 0
CD42 IgG 20 ~zg/ml
Control human 99.5 25 0.5 75
IgG 20 ~g/m
Control ristocetin-- ~ 0 -- 100
Activation
Effect of Yl-I~G on A~~re~ation of Platelet -Rich-Plasma (PRP)
[259.] The effect of Y1-IgG on aggregation of Platelet-Rich-Plasma was tested
at
different concentrations of Yl-IgG in the presence or absence of ristocetin.
Induction of
platelet aggregation by Y1-IgG was tested for 4 min at 37°C, followed
by addition of
ristocetin.
[260.] The results are presented in Table 7 and FIG. 18. No effect on platelet
aggregation was seen after the addition of ristocetin: normal platelet
aggregation was
observed. Y1-IgG at a final concentration of 50 ~g/ml induced platelet
aggregation in
Platelet-Rich-Plasma, before the addition of ristocetin. Y1-IgG at a
concentration of 25
~g/ml only partially induced platelet aggregation before the addition of
ristocetin. No
induction of platelet aggregation was observed with Yl-IgG concentrations of
10 ~g/ml,
4 ~g/ml, or 1 ug/ml. Commercial monoclonal antibodies against GPIba (Pharmigen
),
which inhibit platelet aggregation at concentration of 20 ~g/ml, did not
induce platelet
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
aggregation. Control human IgG- Lambda (Sigma) in the same concentration as Y1-
IgG
also did not induce platelet aggregation.
Table 7 % inhibition % aggregation
Without With Without With
ristocetinristocetinristocetinristocetin
IgG Concentration
Yl-IgG 50 ug/ml64 0 36 100
Yl-IgG 25 ~g/ml75 8 25 92
Yl-IgG 10 ~glml93 10 7 90
Yl-IgG 4 ~g/ml 98 5 2 95
Yl-IgG 1 ~g/ml 95.5 0.5 0.5 99.5
Human anti-CD4299.5 0.5 0.5 99.5
IgG 20 ~g/ml
Control ristocetin-- 0 -- 100
Activation
Identification of Yl Plasma Soluble Li~ands and Cell Lines
[261.] Antibodies against GPIba (CD42b) recognize platelet lysate and
glycocalicin and but not KG-1 cell lysate (a Y1 binding positive myeloid cell
line) or Raji
cell lysate (a B cell line that is negative for Y1 binding at concentrations
at which KG-1
cells are positive for Y1 binding). In contrast, Y1 recognized both
glycocalicin, platelet
lysate, and KG-1 cells, but not Raji cell extract. The negative control scFv-
181, did not
recognize any of the relevant proteins. (FIG. 20).
[262.] The uniqueness of Y1 cross-reactivity was further demonstrated in a
comparative analysis between Y1 and SZ2 (Mab against the sulfated region of
GPIb). In
contrast to SZ2, Yl binds not only to GPIb, but also to plasma proteins and to
myeloid
derived cell extracts as described below.
66
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Yl Li~ands in Human Plasma
[263.] Two proteins immunoreacted with Y1 both in normal as well as in
leukemia patients plasma. The first is designated H P-ligand 1, which has a
molecular
mass of ~50 kDa under reducing conditions and >300 kDa under non-reducing
conditions and which completely disappears from the serum after coagulation;
and (2) H
P-ligand 2, which has a molecular mass of ~80 kDa under both reducing and non-
reducing conditions and which remains in serum after coagulation. After
purification
using a Q-Sepharose column reverse phase (RP-HPLC) 2D gel electrophoresis, and
peptide mapping, the ~50 kDa ligand was identified as the normal variant of
the gamma
chain (~ prime) of human fibrinogen. The sequence VRPEHPAETEYDSLYPEDDL, is
present only in fibrinogen gamma prime, but not the abundant form of
fibrinogen gamma,
and is similar to GPIb anionic region containing sulfated tyrosine. Most
likely this is the
binding site for Yl. The ~80 kDa was identified as complement compound 4 (CC4)
and
Lumican. As above, it contains sulfated tyrosine residues accompanied by a
stretch of
negatively charged amino acids.
Sindin~ of Yl to Primary Leukemia Cells
[264.] FACS analysis indicates that Y1 binds selectively to leukemia cells,
but
not to normal blood cells both in normal blood sample and normal cells within
the blood
of leukemia samples. A summary of the results from patient analysis is shown
in the
following tables.
Table 8: Results of the patients with Y1
Disease Number Positive % Positive
Multiple Myeloma 16/16 100%
AML 60/75 80%
B-Leukemia 29/43 67%
67
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Table 9: B-Leukemia
Type Source Number % Positive % Negative
Positive
Pre-B-ALL BM 3/3 100 0
B-ALL BM ' 3/9 33 67
B-CLL PB 17/23 74 26
B-Lymphoma PB 5/8 62 38
BM = Bone Marrow
PB = Peripheral Blood
Characterization of Yl Epitope on Myeloid Cells (KG-1)
[265.] Approximately 25 billion KG-1 cells were collected for the purification
of
the Yl epitope from the KG-1 cell membranes. KG-1 membrane preparations were
found
to contain at least 2 subunits to which Y1 binds: a 110 kDa subunit and a 120
kDa
subunit. Y1 also binds to a 220 kDa subunit, which may be a dimer of the 110
kDa
subunit. Purification of Y1 epitope was accomplished by immunoprecipitation
with Y1,
and reverse phase (RP-HPLC). 2~.1 of the pooled fractions were used for
Western
blotting with scFv Y1, and 40.1 were used for silver staining. (FIG. 21).
[266.] Y1 ligand was further characterized using enzymatic treatments with
proteases, glycanases, and sulfates; Western blotting with Y1, anti-CD42
antibodies, anti-
CD162 antibodies and 181, immunoprecipitation using Y1 and anti-CD162
antibodies;
FACS analysis using Yl anti-CD162 antibodies; and sequencing.
[267.] The table below summarizes the biochemical experiments preformed to
characterize and localize the Y1 binding site on KG-1 cells.
68
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Western Blot Analysis with Y1 on SDS-PAGE Reducing Gels
Table 10
Substrate Treatment Condition Reactivity Presented
with in
Y 1 Figure
RP-HPLC KG- O-Sialo 30' at 37"C Reactivity Tab 2A slide
only
1 membrane glycoprotein with the 14
fraction endopeptidase 120kDa form
~
RP-HPLC KG- O-Sialo 4hr at 37"C No reactivityTab 2A slide
1 membrane glycoprotein- 14
fraction eridopeptidase
RP-HPLC KG- aryl-sulfatasel8hr at 22"CNo reactivityTab 2A slide
1 membrane 14
fraction
RP-HPLC KG- mocarhagin 7' at 37"C No reactivityTab 2A slide
1 membrane 14
fraction
GlycocalicinO-Sialo 30' at 37"C Enhanced Tab 2A slide
(GC) glycoprotein binding 14
endopeptidase
Heparin-BSA aryl-sulfatasel8hr at 22"CBinds to Tab 2A slide
Y1 as
without 16
treatment
[268.] In summary, following treatment with endopeptidases the Y1 signal is
cleaved off and cannot be detected. Most likely, the fragment containing the
Y1 binding
site is found on the N'-terminus and it is too small to be determined under
the conditions
used in the above experiments. In addition, the results obtained with the aryl-
sulfatase
which remove sulfate entities from proteins (within the KG-1 cell extract),
but not from
sugar moieties (on the heparin) further support our hypothesis that sulfate is
required for
Y1 recognition. Interestingly, O-Sialo glycoprotein endopeptidase enhanced the
Y1 signal
in the GC cleavage product. We assume that following this treatment the Yl
binding site,
now located at the C' terminus is better exposed to the Y1 binding.
69
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Correlation between Yl and PSGL-1 antibody-KPLl: Western Slot Analysis
[269.] The binding of scFv Y1 antibody and commercially available anti-PSGL-1
monoclonal antibody (KPLl) to KPLl immunoprecipitated (IP) membrane proteins
derived from KG-1 cells was assessed. A Raji cell lysate was used as a Y1 and
KPLl
negative control.
[270.] The membrane fraction of KG-1 cells was immunoprecipitated with KPL1.
The IP fraction was further immunoprecipitated either with scFv Yl antibody or
with
KPL1. The non-precipitated (eluate) fractions were analyzed by Western blot,
using
either scFv Yl or KPLl antibodies.
[271.] Both the immunoprecipitation scheme and the results are shown in Figure
24. KPL1 does not recognize glycocalicin. However, both scFv Yl and KPLl
antibodies recognize membrane proteins on KG-1 cells.
[272.] Lysates from cell lines and primary white blood cells were
immunoprecipitated with anti-CD162 ailtibodies and centrifuged to produce a
supernatant
and an eluate. Western blot analysis of the proteins present in the eluate and
supernatant
was performed using scFv Y1 and anti-CD162 antibodies. KG-1 membrane
preparations
contain two subunits 0110 kDa and 120 kDa) to which anti-CD162 (PSGL-1)
antibodies bind. In contrast, normal white blood cell membrane preparations
have only
the smaller subunit. Membrane preparations from AML patients have only the
larger
subunit. scFv Y1 binds to a distinct species, which is found in the
supernatant of the
immunoprecipitation, and to which anti-CD 162 antibodies do not bind. (FIG.
25).
FRCS Analysis
[273.] The binding of Y1 antibody (both the scFv and the IgG forms) to KG-1
cells in the presence of anti-PSGL-1 (anti-CD162) (KPLl) antibodies was
assessed in
competitive binding assays using FAGS analysis. To this end, different
commercially
available anti-PSGL-1 antibodies, KPL1 (an antibody that identifies the
sulfated tyrosine
N-terminal domain of PSGL-1), PL1 (an antibody that identifies the non-
sulfated N-
terminal domain of PSGL-1), and PL2 (an antibody that identifies a non-
sulfated internal
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
domain of the PSGL-1 receptor) were used. Only KPLl completely inhibits the
binding
of Y1 to KG-1 cells, while PL1 partially inhibits binding. There is no
inhibition of
binding in the presence of the PL2 antibody. (Figure 26) Raji cells did not
bind to KPL1
antibodies. Similarly, complete IgG Y1 at different concentrations inhibits
the binding of
KPLl antibody to KG-1 cells in a dose dependent mode (Figure 27) Likewise,
KPLl
antibody inhibits the binding of full IgG Y1 antibody to KG-1 cells in a dose
dependent
mode. (Figure 28).
Correlation Between Y1 and KPLl Binding to Primary Leukemia Cells
[274.] Analysis of binding of scFv Y1 antibodies and anti-CD162 antibodies to
diseased cells also illustrates that scFv Y1 has binding characteristics
different from those
of anti-CD162 antibodies. Specifically, FACS analysis of Y1 and anti-CD162
binding to
Pre-B-ALL, HCL, AML, B-ALL, B-CLL, unclassified leukemia, B-PLL, and multiple
myeloma cells from human patients showed the two antibodies have different
binding
profiles. (Table F). Y1 binds to the leukemic cells in 10 of 12 samples. In
contrast, anti-
CD162 bound only 5 out of 12 samples. Out of the 12 samples, 5 were found to
bind Yl
but not anti-CD162. Thus, it may be concluded that, in leukemic cells, scFv Yl
binds to
a ligand other than that recognized by anti-CD162.
71
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Table 11: Leukemia samples -- Analysis of Anti-CD162 versus Y1
Reaction with
the Leukemia
Cells
Patient # Disease ScFv Yl Anti CD162
42291 Pre-B-ALL + -
42299 HCL - -
42311 AML + +
42321 B-ALL - -
42323 B-CLL + -
42325 Unclassified+ -
42332 B-CLL + -
42352 B-PLL + +/ -
42330 AML + +
42334 MM + -
42366 AML + +
42370 AML/ALL + +/-
[275.] Overall, sulfated-tyrosine containing Yl-binding domains in GPTba, Fng-
~ prime, and PSGL-l, are DEGDTDLYDYYPEEDTEGD (amino acids 269-287),
EHPAETEYDSLYPED (amino acids 411-427), and QATEYELDYDFLPETE (amino
acids 1-17), respectively. An additional binding site, with a higher affinity
to Yl, is most
likely to be expressed on primary leukemia cells. Interestingly, blood samples
that are
positive both to scFv Y1 and anti-CD162 were derived from AML patients, while
B-cell
were negative to anti-CD 162.
Binding Analysis of Sulfated Peptides to Yl
[276.] A competitive binding ELISA assay was used to assess the importance of
the presence and position of sulfated tyrosines to the binding of peptides to
Y1.
[277.] Glycocalicin was immobilized on a Maxisorb plate. scFv Y1 was
preincubated with a peptide of interest for 10 minutes at three different
concentrations (1,
and 100 ~M) in order to observe a dose response. (Table 12). After
preincubation, the
72
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
mixture (Y1 + peptide) was added to the plates and binding of scFv Yl was
assessed
using polyclonal rabbit anti-VL, which recognizes the VL chain of scFv Y1,
followed by
anti-rabbit-HRP. In mixtures in which the peptide bound to scFv Y1, a decrease
in the
binding of scFv Y1 to glycocalicin compared to control binding was observed.
In
mixtures in which the peptide did not bind to scFv Yl, no change in the
binding of scFv
Y1 to glycocalicin compared to control binding was observed.
[278.] The experiment was done twice, and the results are described in an
ELISA
graph. (Figure 29) Peptides derived from Fbrinogen did not inhibit the binding
of the
Yl, regardless of sulfation. Non-sulfated peptides from PSGL-1 did not inhibit
Y1
binding to glycocalicin. All sulfated peptides derived from PSGL-1 inhibited
Y1 binding
to glycocalicin. Peptides P-YYY* and P-YY* Y* were the best inhibitors,
followed in
efficiency by P- Y*Y Y* then P-YY*Y then P- Y* Y*Y and P- Y*YY. Non-sulfated
peptides derived from glycocalicin did not inhibit Y1 binding to glycocalicin,
but
glycocalicin-derived peptide having the same sequence sulfated on three
sulfates (G- Y*
Y* Y*) did inhibit the binding, with efficiency similar to that of P-Y Y*Y.
[279.] Thus, it is clear that not every sulfated peptide binds to scFv Y1 to
the
same extent. Also, significantly, these results demonstrate that only one
sulfated tyrosine
is necessary for binding, as can be seen with peptides P- Y*YY and P-YY Y*.
Further, it
can be seen that the amino acid context of the sulfated tyrosines influences
Y1 binding.
For example, P- Y*YY (containing one sulfated tyrosine in the sequence EY*E)
inhibits
binding efficiently only at 100~M. In contrast, P-YYY*(containing one sulfated
tyrosine
in the sequence DY*D) inhibits binding efficiently at luM.
73
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Table 12: Sulfated Peptides
Name Source Sequence #aa MW Sulfation
of
Peptide
F-YY Fibrinogen-'y-VRPEHPAETEYESLYPEDDL 20 2389 -
prime chain
F- Y* Fibrinogen-y-VRPEHPAETEY*ESLY*PEDDL 20 2549 Sulfated
Y*
prime chain
P-YYY PSGL-1-n- QATEYEYLDYDFLPETE 17 2126 -
terminus
P- Y*YY PSGL-1-n- QATEY*EYLDYDFLPETE 17 2206 Sulfated
terminus
P- Y* PSGL-1-n- QATEY*EY*LDYDFLPETE 17 2286 Sulfated
Y*Y
terminus
P- Y*Y PSGL-1-n- QATEY*EYLDY*DFLPETE 17 2286 Sulfated
Y*
terminus
P-Y Y*Y PSGL-1-n- QATEYEY*LDYDFLPETE 17 2286 Sulfated
terminus
P-Y Y* PSGL-1-n- QATEYEY*LDY*DFLPETE 17 2286 Sulfated
Y*
terminus
P-YY PSGL-1-n- QATEYEYLDY*DFLPETE 17 2286 Sulfated
Y*
terminus -
G-YYY GPIba GDEGDTDLYDYYPEEDTE 18 2126 -
G-Y*Y*Y*GPIba GDEGDTDLY*DY*Y*PEEDTE 18 2366 Sulfated
-
Y*=Sulfated Tyrosine
HYpothesis/Conclusions
[280.] (1) Y1 resembles L-selectin which recognizes both sulfated
protein and sugar moieties, and is distinct from the P-selectin which
recognizes only
sulfated proteins. Therefore, it can compete for the bonding of both proteins.
[281.] (2) Variation irk sulfation during differentiation and cell growth
may affect Y1 binding. Therefore, Yl may compete with both P and L selectins
for
binding to their sulfated ligands.
ha vivo models for evaluating the efficacy of the leukemia-specific antibody.
[282.] Two human leukemia models were developed in immuno-deficient mice
as well as in assay systems.
74
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
[283.] The human cell lines used were MOLT4 cells derived from a T cell
leukemia patient and KG-1 cells derived from an AML patient. Antibodies
specific for
the relevant human antigens on each cell line were used to identify and
quantify
malignant cell engraftment.
T-ALL (MOLT4) Model
[284.] The iya vivo mouse model for T-ALL uses SLID mice (Jackson
Laboratories) injected with MOLT4 cells derived from a T cell leukemia
patient.
[285.] In one experiment, SCID mice were pretreated with 100mg/kg Cytoxan
(CTX, Cyclophosphamid for injection, Mead Johnson). Eleven days after CTX
injection,
MOLT-4 cells were injected intravenously into the tail vein. Control mice were
injected
with PBS alone. One week post-MOLT-4 injection mice were injected with CONYl-
Doxorubicin, which is a conjugate between scFv CON Y1 polypeptide, having
_K_A_K_
amino acid residues at its carboxy end and doxorubicin via a short organic
linker;
CONY1, which is a scFv antibody fragment derived from Y1 scFv in which the DNA
sequences encoding the myc tag of Y1 were deleted and replaced with a DNA
sequence
encoding the amino acids lysine, alanine, lysine (KAK); or free Doxorubicin .
The mice
were injected three times per week for three weeks. Control mice were injected
with PBS;
and another control group did not receive any treatment. (Table M).
Table 13
Number of Mice Inoculation Treatment
PBS only --
9 MOLT-4 --
9 MOLT-4 CONY-Dox (2.5 mglkg)
9 MOLT-4 CONY-Dox (2.5 mg/kg)
8 MOLT-4 Free Dox (0.1 mg/kg)
[286.] Mice started to die 32 days post cell inoculation, and the surviving
mice
were sacrificed at this time. Bone marrow cells were analyzed by flow
cytometry using
7s
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
anti-human CD44-FITC and Yl-Biotin/SAV-PE. Blood samples from several animals
were monitored for platelet and white blood cell count. Livers were weighted
and
examined for tumor appearance. Other organs were also examined for tumor
appearance.
[287.] The results are depicted in (FIGS. 30, 31 and 32). Massive tumor
growths
(white nodules) were seen in the livers of all mice inj ected with MOLT-4
cells. However,
livers of mice injected with MOLT-4 and treated with CONY1 or CONY1-
Doxorubicin
conjugate weighted significantly less than those of mice injected with MOLT-4
and
treated with free Doxorubicin or left untreated. (FIG 30).
[288.] The percentage of MOLT-4 cells found in the bone marrow was very low.
(FIG 31 ).
[289.] ° Overall,' these results demonstrate that the MOLT-4 model can
be used as
a useful model for liver metastases of leukemia cells.
[290.] In a second experiment, SCm mice were i.v. injected with 2x107 MOLT-4
cells/mouse, 5 days post treatment with cyclophosphamide. Anti-cancer agents
or PBS
(negative control animals) were injected i.v. three times/week from day 5 post
MOLT-4
cells injection and onward. On day 35, blood was drawn from the animals, the
animals
were sacrificed, and their livers were excised and weighed. In the untreated,
PBS-treated
MOLT-4 cell-bearing animals, the liver presented with a very massive tumor
growth, and
its size was increased 2-3-fold relative to PBS control uninfected animals. In
this
experiment, there were five treatment groups:
1. PBS control, uninfected with MOLT-4 cells
2. PBS-treated MOLT-4 control
3. MOLT-4 group, treated with Y 1 scFv (CONY 1), 75 p.g/mouse
4. - MOLT-4 group, treated with CONYl scFv -Doxorubicin, 75 ug/mouse
MOLT-4 group, treated with Doxorubicin, 0.1 mg/kg.
76
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
[291.] In parallel, portions of liver tissue were taken for histology and cell
harvesting for
FACS analysis. The survival rate of another group of treated animals was
recorded
relative to that of control untreated mice.
[292.] The liver weights, on day 35, are presented in (FIG. 33). As shown,
liver
size almost tripled in the tumor-infected mice, negative control PBS treated
relative to
PBS control, and non-MOLT-4-injected mice. The liver weights of mice treated
with a
low dose of Doxorubicin were similar to that of PBS treated tumor-infected
mice. On the
other hand, CONY1 scFv and CONY1 scFv-Doxorubicin conjugate treatments
markedly
inhibited tumor growth in the liver (much lower liver weights).
[293.] In a third experiment, using the identical SCID/MOLT-4 protocol, there
were 6 groups:
1. PBS control, uninfected MOLT-4 cells
2. PBS-treated Molt control
3. Molt group, treated with CONYl scFv, 75 ~,g/mouse
4. Molt group, treated with a non-specific scFv antibody derived from the
Nissim I
library, 75 ~,g/mouse (control)
5. Molt group, treated with Y1-IgG, 5 ~.g/mouse 6. MOLT-4 group, treated with
a
non-specific human-IgG, 5 ~,g/mouse (control)
[294.] The results shown in (FIG. 34) indicate that treatment with either
CONY1
scFv or Yl IgG inhibited tumor growth (based on liver weights), while little
or no effect
was seen in the animals treated with the non-specific antibody molecules.
[295.] Survival was assessed in mice from three groups which received
continued
treatment, and the results axe presented in (FIG. 35). As shown, only survival
of CONY1
scFv-treated mice was prolonged.
77
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
AML KG-1 Model
[296.] The in vivo mouse model for human AML uses SGID/NOD mice (Jackson
Laboratories} inoculated with KG-1 cells derived from a human AML cell line.
[297.] In a first experiment, NOD/SCID mice were pretreated with 100mg/kg
CYTOXAN~. Four days post CYTOXAN~ injection, KG-1 cells were injected
intravenously into the tail vein of six groups of mice. (Table N, Groups 2 and
5-9). One
group of mice (Table N, Group 1) was injected with PBS alone (control).
[297.][[297.]
Beginning 19 days post KG-1 injection mice were treated with: CONYl,
Doxorubicin, CONY1-Doxorubicin conjugate, or Mylotarg~. (Mylotarg~ is a
monoclonal antibody (anti CD33) conjugated chemically to calcheamicin recently
approved by the FDA for treatment of AML patients age 60 and over in a first
relapse.)
Mice were treated once or three times per week for three weeks. One group
(group 2) of
KG-1 inoculated mice were left untreated. (Table N). Two other groups of mice
(groups
3 and 4) were injected with KG-1 cells that were previously incubated with
CONY1 or
181-scFv (a negative, non-specific control antibody) in serum free RPMI
containing 1%
BSA at 4°C for 1 h. The antibodies were used at a concentration of
0.25mg scFv/108 cells
(75ug/mouse). Before injection into the mice the preincubated KG-1 cells were
washed
and resuspended in RPMI. The KG-1 cells in RPMI were inoculated into mice at a
concentration of 75 ug scFv/ 0.2 ml RPMI per mouse. Group 3 mice were
inoculated
with KG-1 + CONYl, and group 4 mice were inoculated with KG-1 + 181-scFv.
(Table
N). This treatment (group 3 and 4) was carried out one day after the
inoculation of
groups 1-2 and 5-9, i.e., at five days after CYTOXAN injection.
78
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Table 14
# of Group InoculationTreatment
Mice #
9 1 PBS --
11 2 KG-1 --
9 3 KG-1 + Yl --
9 4 KG-1 + 181 --
8 5 KG-1 75 ~.g/mouse (2.5 mg/kg) CONY1,
3
times per week
9 6 KG-1 0.1 mg/kg Doxorubicin, 3 times
per
week
7 KG-1 5 mg/kg Doxorubicin, 1 time
per week
11 8 KG-1 75 tzg/mouse (2.5 mg/kg) CONY1-
Doxorubicin, 3 times per week
9 9 KG-1 0.2 mg/kg Mylotarg~, 1 time
per week
[298.] Mice were sacrificed from 60 to 65 days post cell injection. Bone
marrow
and blood samples were analyzed by flow cytometry using mouse anti human CD34-
FITC (IQP 144F) (or anti CD44-FITC (MCA89F, Serotec)) and Yl-Biotin/SAV-PE.
Mouse IgGI-FITC (IQP 191-F) was used as an isotype control, and mouse IgG2a-
FITC
(MCA929F, Serotec) was used as a negative control. Flow cytometry was
performed
using FACSCalibur system and CellQwest software, Becton Dickinson.
[299.] The results are depicted in (FIGS. Tab 6, pages 5 and 6). Nine out of
10
KG-1 cells-injected mice that were treated with Smg/kg free Doxorubicin (group
7) died
within three weeks after treatment initiation.
[300.] The bone marrow of mice injected with KG-1 cells that were not treated
(group 2) contained about 30% KG-1 cells on average of bone marrow cell
population.
All mice in this group developed leukemia.
[301.] Overall, nearly all mice developed leukemia, with average of 30% KG-1
cells in the bone marrow (as determined by FACS analysis). In general, KG-1
79
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
engraftment was confined to the bone marrow. Less than 10% KG-1 cells were
found in
the blood In one case a solid tumor was observed on peritoneal wall.
[302.] Mice injected with KG-1 cells and treated with 0.1 mg/kg free
Doxorubicin (group 6) had a statistically significant (p<0.05) lower
percentage of KG-1
cells in their bone marrow, as compared to group 2.
[303.] Mice injected with KG-1 cells and treated with CONYl-Doxorubicin
conjugate (group 5) had a lower percentage of KG-1 cells in their bone marrow
as
compared to group 2 (16.3% versus 30.4%, respectively). However, this
difference was
not found tb be statistically significant. It was found during the experiment
that the
CONY1-Doxorubicin was contaminated with lipopolysaccharides (LPS). Therefore,
the
optimal concentrations of CONYl-Doxorubicin could not be used, and treatment
was
stopped before the end of the experiment.
[304.] Mice injected with KG-1 cells incubated ih vitro with CONYl or 181-scFv
(groups 3 and 4, respectively) had a significantly lower percentage of KG-1
cells in their
bone marrow.
[305.] The bone marrow of both mice injected with PBS only (negative control)
and mice injected with KG-1 cells and treated with MylotargT"" (group 9) was
free of KG
1 cells. These results demonstrate that this irz vivo model is a useful model
for AML.
[306.] The overall percentage of KG-1 cells found in the blood stream of the
various groups was very low overall, with high variation within the groups. It
should be
noted that one mouse treated with MylotargT"~ demonstrated relatively high
percentage of
KG-1 cells in the blood, but not in bone marrow.
[307.] Identification of human leukemia cells (KG-1 origin) in the bone marrow
and in the blood stream of the mice, was performed by FACS analysis, using
commercially available anti-human CD34 or CD44 antibodies in parallel With the
Yl
scFv antibodies.
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
[308.] On the first day of analysis, there was a significant difference
between
mice injected with KG-1 alone (group 2), which had higher percentage of KG-1
cells in
their bone marrow, as compared to mice treated with CONYl-Doxorubicin (group
8). On
the third day of analysis this situation was reversed: mice from group 8 bad a
higher
percentage of KG-1 cells in their bone marrow when compared to mice from group
2.
This situation may have resulted from the following: A) choosing mice in worse
physical
condition in the first day, B) proliferation of KG-1 cells in mice from group
8 during the
days after treatment termination, and C) the number of mice in each group was
too small
to generate statistically significant results.
[309.] An additional experiment was performed in which SCID-NOD mice were
i.v. injected with 3x104 MOLT- 4 cells/mouse 5 days post treatment with
cyclophosphamide. Anti-cancer agents or PBS were injected IV three times/week,
from
day 14 onward. On day 60, blood was drawn, then the animals were sacrificed.
Bone
marrow was extracted and analyzed by FAGS analysis using a commercially
available
antiCD44 antibody for the detection of MOLT-4 cells in the mice bone marrow
cell
population.
[310.] This study consisted of 7 groups:
1. PBS control, uninfected with MOLT-4 cells
2. PBS-treated KG 1 control
3. KG 1 group, treated with CONY1 scFv, 75 ~,g/mouse
4. KG 1 group, treated with CONY I scFv -Doxorubicin, 75 ~,g/mouse
S. KG 1 group, treated with Doxorubicin, 0.1 mglkg
6. KG 1 group, treated with Doxorubicin, 3 mglkg, once a week
81
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
7. KG 1 group, treated with MylotaxgTM, 7 ~g/mouse, once a week (MylotargTM is
antibody linked to a chemotherapeutic agent, and is FDA-approved for use in
leukemia
patients).
[31 l.] The results of the study are~presented in (FIG. 38). As shown, the KG-
1
cell-bearing mice had a high prevalence of cancer cells in the bone marrow.
CONYl
scFv, alone, had no effect on the development of the malignancy. Mylotarg
completely
inhibited the prevalence of bone marrow cancer. Doxorubicin, either alone, or
in the
CONY1 scFv-Doxorubicin conjugate, caused a 50% reduction in the number of
tumor
cells in the bone marrow.
Pharmacokinetics of CONYIin Immunosunpressed Mice
[312.] CONY 1 scFv was labeled with 1~SI-Bolton Hunter reagent (to lysine).
The labeling reaction was carried out at 4°C in a borate buffer (pH
9.2) with l2sl-Bolton
Hunter reagent, then l2sl-CONYl was purified on a PD-10 chromatography column.
The
radioactive protein was then admixed with unlabeled CONY-1 to yield a solution
of
75ugJm1 CONY-1 containing 2.5x106 CPM/ml in saline.
[313.] Male Balb-C mice were pretreated by intraperitoneal injection of 0.5
mlJmouse of 0.9% NaI. After 2 hours, the mice were injected intravenously with
0.2 ml
of the labeled CONY-1 solution, resulting in a lasl-CONY-1 dose of 15 fag
(5x105 CPM)
per mouse.
[314.] At various times after injection, blood was collected over EDTA, mice
were sacrificed, and tissues were excised. Samples and organs were taken at 5,
15, and
30 minutes and at 1, 2, 4, 8, and 24 hours after injection. Two to four mice
were used per
time point. Plasma was separated and either counted for gamma radioactivity or
subjected to precipitation with trichloroacetic acid (TCA). After
centrifugation, TCA
precipitates were subjected to gamma radioactivity counting. Liver, lung,
kidney, spleen,
and bone marrow samples were weighed and counted for gamma radioactivity.
Plasma
TCA precipitated radioactivity was plotted against time, and a two-compartment
kinetics
82
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
model was fitted. Organ/ tissue total and specific radioactivity values were
calculated.
The results are shown in (FIGS. 39, 40 and 41).
[315.] Comparison of the blood and plasma radioactivity values indicated that
practically all of the CONY-1 resided in the plasma and did not adhere to
erythrocytes.
The plasma radioactivity values were similar to those of the TCA precipitates,
indicating
that they were associated with undegraded protein. FIG. 39 shows CONY-1 levels
in the
plasma at various time points after administration. The values were fitted
statistically to a
two-compartment model, and the half life values of blood clearance obtained
were 35 and
190 minutes, respectively.
[316.] The distribution of radioactivity in various tissues at the specified
time
points after administration are shown as specific and total radioactivity in
(FIGS. 40 and
41), respectively. In most tissues, there was no specific accumulation of
radioactivity, as
is evident from the comparison of the specific activity to that of the blood.
Slightly
higher values were seen in the kidney at 4 hours and in the bone marrow at 4
and 8 hours;
this is most probably related to the excretion of degradation products.
[317.] The results indicate that CONY-1 is excreted in mice at a half life of
35
minutes. The second compartment excretion rate is of minor importance and may
be the
result of the presence of some polymeric forms of the inj ected material.
There is no
major specific uptake of CONY-1 in body tissues, with the exception of a
slight increase
in the bone marrow.
Production of Antibodies and Fragments
[318.] Antibodies, fragments thereof, constructs thereof, peptides,
polypeptides,
proteins, and fragments and constructs thereof can be produced in either
prokaryotic or
eukaryotic expression systems. Methods for producing antibodies and fragments
in
prokaryotic and eulcaryotic systems are well-known in the art.
[319.] A eukaryotic cell system, as defined in the present invention and as
discussed, refers to an expression system for producing peptides or
polypeptides by
genetic engineering methods, wherein the host cell is a eukaryote. A
eukaryotic
83
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
expression system may be a mammalian system, and the peptide or polypeptide
produced
in the mammalian expression system, after purification, is preferably
substantially free of
mammalian contaminants. Other examples of a useful eukaryotic expression
system
include yeast expression systems.
[320.] A preferred prokaryotic system for production of the peptide or
polypeptide of the invention uses E. coli as the host for the expression
vector. The
peptide or polypeptide produced in the E. coli system, after purification, is
substantially
free of E. coli contaminating proteins. Use of a prokaryotic expression system
may result
in the addition of a methionine residue to the N-terminus of some or all of
the sequences
provided for in the present invention. Removal of the N-terminal methionine
residue
after peptide or polypeptide production to allow for full expression of the
peptide or
polypeptide can be performed as is known in the art, one example being with
the use of
Ae~omoraas aminopeptidase under suitable conditions (U.S. Patent No.
5,763,215).
Types of Antibody Fragments and Constructs
[321.] The present invention provides for a peptide or polypeptide comprising
an
antibody or antigen binding fragment thereof, a construct thereof, or a
construct of a
fragment. Antibodies according to the present invention include IgG, IgA, IgD,
IgE, or
IgM antibodies. The IgG class encompasses several sub-classes including IgGI,
IgG2,
IgG3, and IgG4.
[322.] Antibody fragments according to the present invention include Fv, scFv,
dsFv, Fab, Fab2, and Fd molecules. Smaller antibody fragments, such as
fragments of
Fv's, are also included in the term "fragments", as long as they retain the
binding
characteristics of the original antibody or larger fragment. Examples of such
fragments
would be (1) a minibody, which comprises a fragment of the heavy chain only of
the Fv,
(2) a microbody, which comprises a small fractional unit of antibody heavy
chain variable
region (PCT Application No. PCT/IL99/00581), (3) similar bodies comprising a
fragment
of the light chain, and (4) similar bodies comprising a functional unit of a
light chain
variable region. Constructs include, for example, multimers such as diabodies,
triabodies,
and tetrabodies. The phrases "antibody, binding fragment thereof, or complex
comprising
84
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
an antibody or binding fragment thereof' and "antibody or fragment" are
intended to
encompass all of these molecules, as well as derivatives and homologs,
mimetics, and
variants thereof, unless it is specified otherwise or indicated otherwise
based on context
and/ or knowledge in the art.
[323.] Once an antibody, fragment, or construct having desired binding
capabilities has been selected and/ or developed, it is well within the
ability of one skilled
in the art using the guidance provided herein to produce constructs and
fragments which
retain the characteristics of the original antibody. For example, entire
antibody
molecules, Fv fragments, Fab fragments, Fab2 fragments, dimers, trimers, and
other
constructs can be made which retain the desired characteristics of the
originally selected
or developed antibody, fragment, or construct.
[324.] If it is desired to substitute amino acids but still retain the
characteristics of
an antibody or fragment, it is well within the skill in the art to make
conservative amino
acid substitutions. Modifications such as conjugating to pharmaceutical or
diagnostic
agents, may also be made to antibodies or fragments without altering their
binding
characteristics. Other modifications, such as those made to produce more
stable
antibodies or fragments may also be made to antibodies or fragments without
altering
their specificity. For example, peptoid modification, semipeptoid
modification, cyclic
peptide modification, N terminus modification, C terminus modification,
peptide bond
modification, backbone modification, and residue modification may be
performed. It is
also within the ability of the skilled worker following the guidance of the
present
specification to test the modified antibodies or fragments to assess whether
their binding
characteristics have been changed.
[325.] Likewise, it is within the ability of the skilled worker using the
guidance
provided herein to alter the binding characteristics of an antibody, fragment,
or construct
to obtain a molecule with more desirable characteristics. For example, once an
antibody
having a desirable properties is identified, random or directed mutagenesis
may be used to
generate variants of the antibody, and those variants may be screened for
desirable
characteristics.
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
[326.] Antibodies and fragments according to the present invention may also
have a tag may be inserted or attached thereto to aid in the preparation and
identification
thereof, and in diagnostics. The tag can later be removed from the molecule.
Examples
of useful tags include: AU1, AUS, BTag, c-myc, FLAG, Glu-Glu, HA, His6, HSV,
HTTPHH, IRS, KT3, Protein C, S-Tag~, T7, V5, and VSV-G (Jarvik and Telmer,
A~zn.
Rev. Gen., 32, 601-618 (1998)). The tag is preferably c-myc.
Multimeric Antibodies
[327.] The present invention provides for a Yl or Y17 peptide or polypeptide
comprising an scFv molecule. As used herein a scFv is defined as a molecule
which is
made up of a variable region of a heavy chain of a human antibody and a
variable region
of a light chain of a human antibody, which may be the same or different, and
in which
the variable region of the heavy chain is connected, linked, fused or
covalently attached
to, or associated with, the variable region of the light chain.
[328.] A Y1 and Y17 scFv construct may be a multimer (e.g., dimes, trimer,
tetramer, and the like) of scFv molecules that incorporate one or more of the
hypervariable domains of the Yl or Y17 antibody. All scFv derived constructs
and
fragments retain enhanced binding characteristics so as to bind selectively
and/or
specifically to a target cell in favor of other cells. The binding selectivity
and/or
specificity is primarily determined by hypervariable regions.
[329.] The hypervariable loops within the variable domains of the light and
heavy
chains are termed Complementary Determining Regions (CDR). There are CDRl,
CDR2
and CDR3 regions in each of the heavy and light chains. The most variable of
these
regions is the CDR3 region of the heavy chain. The CDR3 region is understood
to be the
most exposed region of the Ig molecule, and as provided herein, is the site
primarily
responsible for the selective and/or specific binding characteristics
observed.
86
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
[330.] The Yl and Yl7 peptide of the subject invention can be constructed to
fold into multivalent Fv forms. Y1 and Y17 multimeric forms were constructed
to
improve binding affinity and specificity and increased half life in blood.
[331.] Mulitvalent forms of scFv have been produced by others. One approach
has been to link two scFvs with linkers. Another approach involves using
disulfide bonds
between two scFvs for the linkage. The simplest approach to production of
dimeric or
trimeric Fv was reported by Holliger et al., PNAS, 90, 6444-6448 (1993) and A.
I~ortt, et
al., Protein Eng., 10, 423-433 (1997). One such method was designed to make
dimers of
scFvs by adding a sequence of the FOS and JITN protein region to form a
leucine zipper
between them at the c-terminus of the scFv. I~ostelny SA et al., Jlmmunol.
1992 Mar
1;148(5):1547-53; De Kruif J et al., JBiol Chem. 1996 Mar 29;271(13):7630-4.
Another
method was designed to make tetramers by adding a streptavidin coding sequence
at the
c-terminus of the scFv. Streptavidin is composed of 4 subunits so when the
scFv-
streptavidin is folded, 4 subunits accommodate themselves to form a tetramer.
Kipriyanov SM et al., Hurry Antibodies Hybridonaas, 1995;6(3):93-101. In yet
another
method, to make dimers, trimers and tetramers, a free cysteine is introduced
in the protein
of interest. A peptide-based cross linker with variable numbers (2 to 4) of
maleimide
groups was used to cross link the protein of interest to the free cysteines.
Cochran JR et
al., Ir~amunity, 2000 Mar;l2(3):241-50.
[332.] In this system, the phage library (as described herein above) was
designed
to display scFvs, which can fold into the monovalent form of the Fv region of
an
antibody. Further, and also discussed herein above, the construct is suitable
for bacterial
expression. The genetically engineered scFvs comprise heavy chain and light
chain
variable regions joined by a contiguously encoded 15 amino acid flexible
peptide spacer.
The preferred spacer is (Gly4Ser)3. The length of this spacer, along with its
amino acid
constituents provides for a nonbulky spacer, which allows the VH and the VL
regions to
fold into a functional Fv domain that provides effective binding to its
target.
[333.] The present invention is directed to Yl and Y17 multimers prepared by
any known method in the art. A preferred method of forming multimers, and
especially
dimers, employs the use of cysteine residues to form disulfide bonds between
two
87
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
monomers. In this embodiment, dimers are formed by adding a cysteine on the
carboxyl
terminus of the scFvs (referred to as Y1-cys scFv or Yl dimer) in order to
facilitate dimer
formation. After the DNA construct was made (See Example 2D and 6D) and used
for
transfection, Yl dimers were expressed in a production vector and refolded in
vitro. The
protein was analyzed by SDS-PAGE, HPLC, and FACS. However, none of these first
attempts indicated that a dimer formed. Thus, the process was repeated and
this time,
two-liter fermentation batches of the antibodies were run. After expressing Yl-
cys in E.
coli strain BL21, refolding was done in arginine. Following refolding, the
protein was
dialyzed and purified by Q-sepharose and gel filtration (sephadex 75). Two
peaks were
detected by SDS-PAGE (non-reduced) and by gel filtration. The peaks were
collected
separately and analyzed by FACS. Monomer and dimer binding to Jurkat cells was
checked by FACS. The binding by dimers required only 1/100 the amount of the
monomeric antibody for the same level of staining, indicating that the dimer
has greater
avidity. Conditions for dimer refolding were determined, and material
comprising >90%
dimers (mg quantities) was produced after subsequent dialysis,
chromatographic, and gel
filtration steps. The purified diner was characterized by gel filtration and
by SDS-PAGE
analysis under oxidizing conditions. The diner's binding capacity was
confirmed by
radioreceptor assay, ELISA, and FAGS analyses.
[334.] To compare the binding of the scFv monomer (also referred to as CONYl)
with the Y1 diner, binding competition experiments were done in vitro on KG-1
cells. In
addition, these experiments also compared the binding of the full Y1 IgG to
the scFv Y1
monomers. To perform this study, a Y1 IgG was labeled with biotin. This study
revealed
that Y1 IgG competed with IgG Y1-Biotin. Non-relevant human IgG did not
compete
with the labeled Y1 IgG. Y1 scFvs (Sp.g and 10 ug) partially competed with Y1
IgG-
Biotin (SOng). The studies also showed that lng of IgGYl-FITC bound to KG-1
cells
(without serum) to the same extent as leg of Y1 scFv-FITC, but in the presence
of serum,
most of this binding was blocked. These studies also showed that the binding
of the Y1
diner is at least 20-fold higher than that of the Yl scFv monomer as analyzed
by
radioreceptor assay, ELISA or FACS.
88
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
[335.] In yet another embodiment, a lysine-alanine-lysine was added in
addition
to the cysteine at the carboxyl end (referred to as Yl-cys-kak scFv). The
amino acid
sequence of this scFv construct is reproduced below and is also SEQ ID NO:
212.
1 MEVQLVESGG GVVRPGGSLR LSCAASGFTF DDYGMSWVRQ
APGKGLEWVS GINWNGGSTG 60
61 YADSVKGRFT ISRDNAKNSL YLQMNSLRAE DTAVYYCARM
RAPVIWGQGT LVTVSRGGGG 120
121 SGGGGSGGGG SSELTQDPAV SVALGQTVRI TCQGDSLRSY
YASWYQQKPG QAPVLVIYGK 180
181 NNRPSGIPDR FSGSSSGNTA SLTITGAQAE DEADYYCNSR
DSSGNHVVFG GGTKLTVLGG 240
241 GGCKAK
[336.] The Y1-cys-kak was produced in a ~,-pL vector in bacteria. Expression
in
the ~,-pL vector was induced by increasing the temperature to 42°C.
Inclusion bodies
were obtained from induced cultures and semi-purified by aqueous solutions, to
remove
unwanted soluble proteins. The inclusion bodies were solubilized in guanidine,
reduced
by DTE, and refolded ih vitro in a solution based on arginine/ox-glutathione.
After
refolding, the protein was dialyzed and concentrated by tangential flow
filtration to a
buffer containing Urea/phosphate buffer. The protein was repurified and
concentrated by
ionic-chromatography in an SP-column.
[337.] The dimer was characterized by SDS-page electrophoresis, gel filtration
chromatography, ELISA, radioreceptor binding, and FACS. The apparent affinity
of the
dimer was higher than the monomer due to the avidity effect. This effect was
confirmed
by ELISA to glycocalicin, FAGS to KG-1 cells, and competition in a
radioreceptor assay.
[338.] HPLC was performed to profile the dimer after refolding and
purification
from a Superdex 75 gel filtration column. In Figure 42, the Y1-cys-kak (dimer)
is the
first peak on the left 010.8 minutes) and the subsequent peak is the monomer
(~12
89
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
minutes). The dimer is approximately 52kDa and the monomer 26kDa, according to
protein size markers run on the same column. The balance between the dimer and
monomer can be changed by varying the conditions of the refolding
(concentration of the
oxidized agent and the concentration of the protein in the refolding buffer).
The dimer
and monomer were separated by chromatography in a superdex 75 column.
[339.] In Figure 43, a gel is shown with a mixed population of dimers and
monomers. In the reduced form, the monomers are seen due to the reduction
between the
two monomers and in the non reduced form, two population are seen (as in the
gel
filtration experiment) a monomer fraction of about 30kDa and a dimer of about
60kDa.
[340.] An ELISA assay was performed to ascertain the differences in binding
between the monomer (the Yl scFv-also known as Y1-kak) and the dimer Yl-cys-
kak
(the cysteine dimer) for antigen GPIb (glycocalicin) derived from platelets. A
polyclonal
anti single chain antibody and/or a novel polyclonal anti-VL (derived from
rabbits) and
anti-rabbit HRP, were used to detect the binding to GPIb. The dirner was
approximately
100 fold more active than the monomer. For instance, to reach 0.8 OD units
12.8~.g/ml of
monomer was used compared to only O.l~ag/ml of dimer. See Figure 19.
[341.] In addition, FACS binding analysis to KG-1 cells showed that the dimer
is
more sensitive than the monomer when a two or three step binding assay was
performed.
Dimers directly labeled by FITC showed a slight advantage (use of l Ox fold
less material)
than the monomer. The radio receptor assay on KG-1 cells, where the dimer was
used as
competitor, showed that the dimer is 30x fold more efficient than the monomer.
[342.] Varying the length of the spacers is yet another preferred method of
forming dimers, trimers, and triamers (often referred to in the art as
diabodies, triabodies
and tetrabodies, respectively). Dimers are formed under conditions where the
spacer
joining the two variable chains of a scFv is shortened to generally 5-12 amino
acid
residues. This shortened spacer prevents the two variable chains from the same
molecule
from folding into a functional Fv domain. Instead, the domains are forced to
pair with
complimentary domains of another molecule to create two binding domains. In a
preferred method, a spacer of only 5 amino acids (Gly4Ser) was used for
diabody
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
construction. This dimer can be formed from two identical scFvs, or from two
different
populations of scFvs and retain the selective and/or specific enhanced binding
activity of
the parent scFv(s), and/ or show increased binding strength or affinity.
[343.J In a similar fashion, triabodies are formed under conditions where the
spacer joining the two variable chains of a scFv is shortened to generally
less than 5
amino acid residues, preventing the two variable chains from the same molecule
from
folding into a functional Fv domain. Instead, three separate scFv molecules
associate to
form a trimer. In a preferred method, triabodies were obtained by removing
this flexible
spacer completely. The triabody can be formed from three identical scFvs, or
from two
or three different populations of scFvs and retain the selective and/or
specific enhanced
binding activity of the parent scFv(s), and/or show increased binding strength
or affinity.
[344.J Tetrabodies are similarly formed under conditions where the spacer
joining the two variable chains of a scFv is shortened to generally less than
5 amino acid
residues, preventing the two variable chains from the same molecule from
folding into a
functional Fv domain. Instead, four separate scFv molecules associate to form
a tetramer.
The tetrabody can be formed from four identical scFvs, or from 1-4 individual
units from
different populations of scFvs and should retain the selective and/or specific
enhanced
binding activity of the parent scFv(s), and/or show increased binding strength
or affinity.
[345.] Whether triabodies or tetrabodies form under conditions where the
spacer
is generally less than 5 amino acid residues long depends on the amino acid
sequence of
the particular scFv(s) in the mixture and the reaction conditions.
[346.J In a preferred method, tetramers are formed via a biotin/streptavidin
association. A novel fermentation construct that is capable of being
enzymatically
labeled with biotin (referred to herein as Yl-biotag or Yl-B) was created. A
sequence
that is a substrate for the BirA enzyme was added at the Y1 C-terminus. The
BirA
enzyme adds a biotin to the lysine residue within the sequence. Yl-biotag was
expressed
in E. coli. The inclusion body material was isolated and refolded. The purity
of the
folded protein was >95%, and >100 mg were obtained from a 1-L culture (small-
scale,
non-optimized conditions). The molecular weight of this form was found to be
similar to
91
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
that of the scFv according to HPLC, SDS-PAGE, and mass spectroscopy. Yl-biotag
was
found to be the most consistent reagent for FACE analysis. However, when Yl-
biotag
binding to KG-1 cells was examined in the presence of serum, high
concentrations (10-
fold more) are required for comparable binding in the absence of serum.
Nevertheless,
this construct offered the advantage of specific biotinylation in which the
binding site of
the molecule remains intact. Further, each molecule is labeled by only one
biotin -- each
molecule receives one biotin on the carboxyl end.
[347.] Limiting labeling to one biotin/molecule in a desired location enabled
production of tetramers with streptavidin. The tetramers were formed by
incubating Yl-
B with steptavidin-PE.
[348.] FACS analysis~indicated that the tetramers made by Yl-biotag and
streptavidin-PE were 100 to 1000 fold more sensitive that Y1 scFv monomers. Y1-
biotag
tetramers with streptavidin-PE appear to specifically bind to one of the Yl-
reactive cell
lines (KG-1). The differential of this reaction, from background binding, was
very high,
and offered high sensitivity to detect low amounts of receptor. FAGS
evaluation of
normal whole blood with YlBSAV tetramers indicated that no highly reactive
population
is present. Monocytes and granulocytes were positive to a small extent. In
cell lines
where a positive result was present, such as with KG-1 cells, the tetramers
were at least
100-fold more reactive.
[349.] Then, the tetramers were incubated with the cell samples. A low dose of
the Yl tetramers (5 ng) binds well to the cell line (KG-1) providing a 10 to
20-fold higher
response than previously observed with other Y1 antibody forms. A minor
reaction was
observed when a negative cell line was examined with varying doses of the
tetramers.
Conlu~ates for Diagnostic and Pharmaceutical Use
[350.] The antibodies and binding fragments thereof of the subject invention
can
be associated with, combined, fused or linked to various pharmaceutical
agents, such as
drugs, toxins, and radioactive isotopes with, optionally, a pharmaceutically
effective
carrier, to form drug-peptide compositions, fusions or conjugates having anti-
disease
92
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
and/or anti-cancer activity. Such conjugates and fusions may also be used for
diagnostic
purposes.
[351.] Examples of carriers useful in the invention include dextran, HPMA (a
lipophilic polymer) or any other polymer. Alternatively, decorated liposomes
can be
used, such as liposomes decorated with scFv Yl molecules, such as Doxil, a
commercially available liposome containing large amounts of doxorubicin. Such
liposomes can be prepared to contain one or more desired pharmaceutical agents
and be
admixed with the antibodies of the present invention to provide a high drug to
antibody
ratio..
[352.] Alteniatively, the link between the antibody or fragment thereof and
the
pharmaceutical agent may be a direct link. A direct link between two or more
neighboring molecules may be produced via a chemical bond between elements or
groups
of elements in the molecules. The chemical bond can be for example, an ionic
bond, a
covalent bond, a hydrophobic bond, a hydrophilic bond, an electrostatic bond
or a
hydrogen bond. The bonds can be, for example, amine, carboxy, amide, hydroxyl,
peptide and/ or disulfide bonds. The direct link may preferably be a protease
resistant
bond.
[353.] The link between the peptide and the pharmaceutical agent or between
the
peptide and carrier, or between the carrier and pharmaceutical agent may be
via a linker
compound. As used herein in the specification and in the claims, a linker
compound is
defined as a compound that joins two or more moieties together. The linker can
be
straight-chained or branched. A branched linker compound may be composed of a
double-branch, triple branch, or quadruple or more branched compound. Linker
compounds useful in the present invention include those selected from the
group
comprising dicarboxylic acids, malemido hydrazides, PDPH, carboxylic acid
hydrazides,
and small peptides.
[354.] More specific examples of linker compounds useful according to the
present invention, include:
93
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
a. Dicarboxylic acids such as succinic acid, glutaric acid, and adipic acid;
b. Maleimido hydrazides such as N-[ -maleimidocaproic acid] hydrazide, 4-[N-
maleimidomethyl]cyclohexan-1-carboxylhydrazide, and N-[ -maleimidoundcanoic
acid]
hydrazide;
c. PDPH linkers such as (3-[2-pyridyldithio]propionyl hydrazide) conjugated to
sulfurhydryl reactive protein; and
d. Carboxylic acid hydrazides selected from 2-5 carbon atoms.
[355.] Linking via direct coupling using small peptide linkers is also useful.
For
example, direct coupling between the free sugar of, for example, the anti-
cancer drug
doxorubicin and a scFv may be accomplished using small peptides. Examples of
small
peptides include AU1, AUS, BTag, c-myc, FLAG, Glu-Glu, HA, His6, HSV, HTTPHH,
IRS, KT3, Protein C, S- Tag°, T7, V5, and VSV-G.
[356.] Antibodies, and fragments thereof, of the present invention may be
bound
to, conjugated to, complexed with or otherwise associated with imaging agents
(also
called indicative markers), such as radioisotopes, and these conjugates can be
used for
diagnostic and imaging purposes. Kits comprising such radioisotope-antibody
(or
fragment) conjugates are provided.
[357.] Examples of radioisotopes useful for diagnostics include mindium,
u3indium, 9~"'rhenium, losrhenium, loirhenium, 9~"'technetium, 121mtellurium,
iaamtellurium, 12s"'telluriunm l~sthulium, 167thulium lssthulimn lasiodine,
la6iodine,
isliodine, ls3iodine, 8lmkrypton, 33xenon, 9°yttrium, Zlsbismuth,
77bromine, ~8fluorine,
95ruthenium o7ruthenium losmthenium losruthenium 1°7merc Zos 67
ury, mercury, gallium
and 68gallium. Preferred radioactive isotopes, are opaque to X-rays or
paramagnetic ions.
[35~.] The indicative marker molecule may also be a fluorescent marker
molecule. Examples of fluorescent marker molecules include fluorescein,
phycoerythrin,
or rhodamine, or modifications or conjugates thereof.
94
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
[359.] Antibodies or fragments conjugated to indicative markers may be used to
diagnose or monitor disease states. Such monitoring may be carried out in
vivo, ira vitf-o,
or ex vivo. Where the moutoring or diagnosis is carried out ifa vivo or ex
vivo, the
imaging agent is preferably physiologically acceptable in that it does not
harm the patient
to an unacceptable level. Acceptable levels of harm may be determined by
clinicians
using such criteria as the severity of the disease and the availability of
other options.
[360.] The present invention provides for a diagnostic kit for ih vitro
analysis of
treatment efficacy before, during, or after treatment, comprising an imaging
agent
comprising a peptide of the invention linked to an indicative marker molecule,
or imaging
agent. The invention further provides for a method of using the imaging agent
for
diagnostic localization and imaging of a cancer, more specifically a tumor,
comprising the
following steps:
a) contacting the cells with the composition,
b) measuring the radioactivity bound to the cells, and hence
c) visualizing the tumor.
[361.] Examples of suitable imaging agents include fluorescent dyes, such as
FITC, PE, and the like, and fluorescent proteins, such as green fluorescent
proteins.
Other examples include radioactive molecules and enzymes that react with a
substrate to
produce a recognizable change, such as a color change.
[362.] In one example, the imaging agent of the kit is a fluorescent dye, such
as
FITC, and the kit provides for analysis of treatment efficacy of cancers, more
specifically
blood-related cancers, e.g., leukemia, lymphoma and myeloma. FAGS analysis is
used to
determine the percentage of cells stained by the imaging agent and the
intensity of
staining at each stage of the disease, e.g., upon diagnosis, during treatment,
during
remission and during relapse.
[363.] Antibodies, and fragments thereof, of the present invention may be
bound
to, conjugated to, or otherwise associated with anti-cancer agents, anti-
leukemic agents,
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
anti-viral agents, anti-metastatic agents, anti-inflammatory agents, anti-
thrombosis agents,
anti-xestenosis agents, anti-aggregation agents, anti-autoimmune agents, anti-
adhesion
agents, anti-cardiovascular disease agents, or other anti-disease agents or
pharmaceutical
agent. A pharmaceutical agent refers to an agent that is useful in the
prophylactic
treatment or diagnosis of a mammal including, but not restricted to, a human,
bovine,
equine, porcine, murine, canine, feline, or any other warm-blooded animal.
[364.] Examples of such pharmaceutical agents include, but are not limited to
anti-viral agents including acyclovir, ganciclovir and zidovudine; anti-
thrombosis/restenosis agents including cilostazol, dalteparin sodium,
reviparin sodium,
and aspirin; anti-inflammatory agents including zaltoprofen, pranoprofen,
droxicam,
acetyl salicylic 17, diclofenac, ibuprofen, dexibuprofen, sulindac, naproxen,
amtolmetin,
celecoxib, indomethacin, rofecoxib, and nimesulid; anti-autoimmune agents
including
leflunomide, denileukin diftitox, subreum, WinRho SDF, defibrotide, and
cyclophosphamide; and anti-adhesion/anti-aggregation agents including
limaprost,
clorcromene, and hyaluronic acid.
[365.] Other exemplary pharmaceutical agents include doxorubicin,
methoxymorpholinyldoxorubicin (morpholinodoxorubicin), adriamycin, cis-
platinum,
taxol, calicheamicin, vincristine, cytarabine (Ara-C), cyclophosphamide,
prednisone,
daunorubicin, idarubicin, fludarabine, chlorambucil, interferon alpha,
hydroxyurea,
temozolomide, thalidomide and bleomycin, and derivatives and combinations
thereof
[366.] An anti-cancer agent is an agent with anti-cancer activity. For
example,
anti-cancer agents include agents that inhibit or halt the growth of cancerous
or immature
pre-cancerous cells, agents that kill cancerous or pre-cancerous, agents that
increase the
susceptibility of cancerous or pre-cancerous cells to other anti-cancer
agents, and agents
that inhibit metastasis of cancerous cells. In the present invention, an anti-
cancer agent
may also be agent with anti-angiogenic activity that prevents, inhibits,
retards or halts
vascularization of tumors.
[367.] Inhibition of growth of a cancer cell includes, for example, the (i)
prevention of cancerous or metastatic growth, (ii) slowing down of the
cancerous or
96
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
metastatic growth, (iii) the total prevention of the growth process of the
cancer cell or the
metastatic process, while leaving the cell intact and alive, or (iv) killing
the cancer cell.
[368.] An anti-leukemia agent is an agent with anti-leukemia activity. For
example, anti-leukemia agents include agents that inhibit or halt the growth
of leukemic
or immature pre-leukemic cells, agents that kill leukemic or pre-leukemic,
agents that
increase the susceptibility of leukemic or pre-leukemic cells to other anti-
leukemia
agents, and agents that inhibit metastasis of leukemic cells. In the present
invention, an
anti-leukemia agent may also be agent with anti-angiogenic activity that
prevents,
inhibits, retards or halts vascularization of tumors.
[369.] Inhibition of growth of a leukemia cell includes, for example, the (i)
prevention of leukemic or metastatic growth, (ii) slowing down of the leukemic
or
metastatic growth, (iii) the total prevention of the growth process of the
leukemia cell or
the metastatic process, while leaving the cell intact and alive, or (iv)
killing the leukemia
cell.
[370.] Examples of anti-disease, anti-cancer, and anti-leukemic agents to
which
antibodies and fragments of the present invention may usefully be linked
include toxins,
radioisotopes, and pharmaceuticals.
[371.] Examples of toxins include gelonin, Pseudo~rzonas exotoxin (PE), PE40,
PE38, diphtheria toxin, ricin, or modifications or derivatives thereof.
[372.] Examples of radioisotopes include gamma-emitters, positron-emitters,
and
x-ray emitters that may be used for localization and/or therapy, and beta-
emitters and
alpha-emitters that may be used for therapy.
[373.] More specific examples of therapeutic radioisotopes include 1 i
lindium,
n3indium, ~9'T'rhenium, losrhenium, loirhenium, 99°'technetium,
lzimtellurium,
izzmtellurium, lzsT"telluriunm l~5thulium, 167thulium 168thulium iz3iodine,
Iz~iodine,
i3liodine,133iodine, $Imkrypton, 33xenon, 9°yttrium, zl3bismuth,
"bromine, lgfluorine,
9sruthenium, 97ruthenium, lo3ruthenium, losmthenium, 1°7mercury,
zo3mercury, 67gallium
and ~8gallium.
97
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
[374.] Non-limiting examples of anti-cancer or anti-leukemia pharmaceutical
agents include doxorubicin, adriamycin, cis-platinum, taxol, calicheamicin,
vincristine,
cytarabine (Ara-C), cyclophosphamide, prednisone, daunorubicin, idarubicin,
fludarabine,
chlorambucil, interferon alpha, hydroxyurea, temozolomide, thalidomide and
bleomycin,
and derivatives thereof, an combinations thereof.
Pharmaceutical Compositions
[375.] Antibodies, constructs, conjugates, and fragments of the subject
invention may be
administered to patients in need thereof via any suitable method. Exemplary
methods
include intravenous, intramuscular, subcutaneous, topical, intratracheal,
intrathecal,
intraperitoneal, intralymphatic, nasal, sublingual, oral, rectal, vaginal,
respiratory, buccal,
intradermal, transdermal or intrapleural administration.
[376.] For intravenous administration, the formulation preferably will be
prepared so that
the amount administered to the patient will be an effective amount from about
0.1 mg to
about 1000mg of the desired composition. More preferably, the amount
administered will
be in the range of about ling to about SOOmg of the desired composition. The
compositions of the invention are effective over a wide dosage range, and
depend on
factors such as the particulars of the disease to be treated, the half life of
the peptide or
polypeptide-based pharmaceutical composition in the body of the patient,
physical and
chemical characteristics of the pharmaceutical agent and of the pharmaceutical
composition, mode of administration of the pharmaceutical composition,
particulars of
the patient to be treated or diagnosed, as well as other parameters deemed
important by
the treating physician.
[377.] Pharmaceutical composition for oral administration may be in any
suitable form.
Examples include tablets, liquids, emulsions, suspensions, syrups, pills,
caplets, and
capsules. Methods of making pharmaceutical compositions are well known in the
art.
See, e.g., Remington, The Science and Practice of Pharmacy, Alfonso R. Gennaro
(Ed.)
Lippincott, Williams & Wilkins (pub).
98
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
[378.] The pharmaceutical composition may also be formulated so as to
facilitate timed,
sustained, pulsed, or continuous release. The pharmaceutical composition may
also be
administered in a device, such as a timed, sustained, pulsed, or continuous
release device.
[379.] The pharmaceutical composition for topical administration can be in any
suitable form, such as creams, ointments, lotions, patches, solutions,
suspensions, and
gels.
[380.] Compositions comprising antibodies, constructs, conjugates, and
fragments of the subject invention may comprise conventional pharmaceutically
acceptable diluents, excipients, Garners, and the like. Tablets, pills,
caplets and capsules
may include conventional excipients such as lactose, starch and magnesium
stearate.
Suppositories may include excipients such as waxes and glycerol. Injectable
solutions
comprise sterile pyrogen-free media such as saline, and may include buffering
agents,
stabilizing agents or preservatives. Conventional enteric coatings may also be
used.
EXAMPLES
[381.] The following examples axe set forth to aid in understanding the
invention
but are not intended and should not be construed, to limit its scope in any
way. Although
specific reagents and reaction conditions are described, modifications can be
made that
are meant to be encompassed by the scope of the invention. The following
examples,
therefore, are provided to further illustrate the invention.
Examule 1 : Preparation of Platelets
1.1 Preparation of washed platelets.
[382.] Platelet concentrate in acid-citrate-dextrose (ACD) was obtained from a
blood banlc, platelets were isolated, washed once in buffer containing ACD and
saline in a
ratio of 1:7. The platelets were centrifuged at 800 g for 10 min after each
wash and were
resuspended in Tyrodes solution (2 mM MgCl2, 137 mM NaCI, 2.68 mM I~C1, 3 mM
NaH2P04, 0.1 % glucose, 5 mM Hepes and 0.35 % albumin, pH 7.35) and count the
number of cells.
99
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
1.2 Preparation of~latelet-rich 1p asma
[383.] Blood was collected into a tube containng 3.8 % sodium citrate.
Platelet-
rich plasma was prepared by centrifugation at 250 x g for 10 minutes.
Example 2: Platelet aggregation
[384.] For platelet aggregation studies, platelet rich plasma (PRP) and washed
platelets were stirred at 500 rpm at 37°C in whole blood
Lumiaggregometer (Chronolog,
Havertown,PA). The difference in light transmission through the platelet
suspension and
suspending medium was taken as 100% aggregation. The effect of Yl on platelet
aggregation was evaluated by addition of different concentration of Y1 before
the
addition of agonist, and the effect was recorded for four minutes.
Example 3: Treatment of Platelets with Endonroteases
3.1 Cleava a of platelets by Mocarha~in
[385.] For mocarhagin digestion, lOg washed platelets in TS buffer ( 0.01 M
Tris,
0.15 M sodium chloride, pH 7.4) containing 1 mM calcium chloride were treated
with 12
~.g/ml mocarhagin (final concentration) for 1 hour at 22°C and
digestion was stopped by
adding EDTA to 0.01 M.
3.2 Cleava eg- Of ~lycocalicin by Cathepsin G
[386.] 108 washed platelets in TS buffer containing 1 mM calcium chloride was
incubated with 1.8 ug/ml cathepsin G (final concentration) for 4 hours at
22°C and
digestion was stopped by adding PMSF to 1 mM.
3.3 Cleava eg of ~lycocalicin by O-Sialo~~coprotein endo~rotease
[387.] 106 platelets in 0.1 M Tris buffer pH 7.4 containing 0.2 % albumin and
protease inhibitors (10 ~.M leupeptin, 0.24 mM PMSF) was incubated with 0.14
mg/ml
O-Sialoglycoprotein endoprotease (final concentration) for 45 min at
37°C and digestion
was stopped by adding sample buffer and boiling. The sample buffer used
contained 3%
loo
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
SDS, 12% glycerol, SOmM TrisHCl, 2% (3-mercaptoethanol, and 0.03% bromphenol
blue.
Example 4: Cleavage of Glycocalicin by Endoproteases
Cleavage of ,glycocalicin by Mocarha~in
[388.] For mocarhagin digestion, glycocalicin in TS buffer containing 1 mM
calcium chloride was incubated with 10 ~ g/ml mocarhagin (final concentration)
for 1
hour at 22 ° C and digestion was stopped by adding EDTA to 0.01 M.
Cleavage of ~lycocalicin by Cathepsin G
[389.] For cathepsin G digestion, glycocalicin in TS buffer containing 1 mM
calcium chloride was incubated with 3.4 ug/ml cathepsin G (final
concentration) for 4
hour at 22 ° C and digestion was stopped by adding PMSF to 1 mM.
Cleavage of ~lycocalicin by O-Sialo~lycoprotein endoprotease
[390.] Glycocalicin in 0.05 M Tris buffer pH 7.4 was incubated with 1.2 mg/ml
O-Sialoglycoprotein endoprotease (final concentration) for 15 min at
37°C and digestion
was stopped by adding sample buffer (as described in Example 3(YH) and
boiling.
Example 5: Construction of Full Sized Yl I~G
[391.] Whole IgG molecules have several advantages over the Fv forms,
including a longer half life ih vivo and the potential for inducing an in-vivo
cellular
response, such as those mediated by ADCC or CDC (complement dependent
cytotoxicity;
Tomlinson, CuYref~t Opifzions oflnamunology, 5, 83-89(1993)). By a molecular
cloning
approach that is described below, we have converted the Y1 Fv regions into
full sized
IgGl molecules. Yl-IgGl construction was accomplished by joining fragments of
cDNA
to each other in the following order: The sequence of the Yl-IgG heavy and
light chains
are presented in FIG. 48. The open reading frame (ORF) of the nucleotide
sequence of .
Y1-HC (SEQ ID NO: 205), the amino acid sequence of Y1-HC (SEQ ID NO: 206), the
101
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
ORF of the nucleotide sequence of Yl-LC (SEQ m NO: 207), and the amino acid
sequence of Y1-LC (SEQ ID NO: 208) are presented.
[392.] A leader sequence compatible for a mammalian expression system: An
exchangeable system was designed to allow convenient insertion of elements
required for
a full IgG molecule. The following complimentary double stranded
oligonucleotides
encoding a putative leader sequence were synthesized, annealed, and ligated
into the XlaoI
site of the pBJ-2 mammalian expression vector (under the SRaS promoter).
5'-TCGACCTCATCACCATGGCCTGGGCTCTGCTGCTCCTCACCCTCCTCACTCA
GGACACAGGGTCCTGGGCCGAT
and
5'-GATCGATTGCACCAGCTGGATATCGGCCCAGGACCCTGTGTCCTGAGTGAG
GAGGGTGAGGAGCAGCAGAGCCCAGGCCATGGTGATGAGG. Upstream of the
initiation ATG codon, two Kozal~ elements were included. In addition, an
internal
EcoRV site was introduced between the putative cleavage site of the leader
sequence and
the XlaoI site to allow subcloning of the variable regions. This modified
vector was
designated pBJ-3.
[393.] The VL encoding sequence derived from the Y1 scFv cDNA sequence
was inserted between the leader and the constant light region-encoding
sequence.
Similarly, the VH encoding sequence derived fiom the Y1 scFv cDNA sequence was
inserted between the leader and the constant heavy region-encoding sequence
This was
accomplished by PCR amplification of the vector pHEN-Y1, encoding for the
original
Y1, to obtain the VL and the VH regions, individually.
The oligonucleotides
[394.] 5'-TTTGATATCCAGCTGGTGGAGTCTGGGGGA (sense) and
5'-GCTGACCTAGGACGGTCAGCTTGGT (anti-sense) were used for the VL PCR
reaction. The cDNA product of the expected size of 350 by was purified,
sequenced and
digested with EcoRV and Av~II restriction enzymes. The same procedure was
employed
102
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
to amplify and purify the VH cDNA region, using the sense and the anti-sense
oligonucleotides
[395.] 5'-GGGATATCCAGCTG(C/G)(A/T)GGAGTCGGGC
and
5'-GGACTCGAGACGGTGACCAGGGTACCTTG, respectively.
[396.] Constant regions: The constant ~.3 (CL-7~3) region and the constant
heavy regions CH1-CH3 derived for IgGl cDNA were individually synthesized as
follows:
[397.] For the constant CL-~,3 region, RT-PCR was performed on mRNA
extracted from a pool of normal peripheral B-cells (CD19+ cells) in
combination with the
sense 5'- CCGTCCTAGGTCAGCCCAAGGCTGC and the anti-sense
5'-TTTGCGGCCGCTCATGAACATTCTGTAGGGGCCACTGT oligonucleotides. The
PCR product of the expected size 0400 bp) was purified, sequenced, and
digested with
AvrII and NotI restriction enzymes.
[398.] For the constant IgGl regions (y chain), a human B cell clone (CMV -
clone #40), immortalized at BTG, was selected for PCR amplification. This
clone was
shown to secrete IgGl against human CMV and was also shown to induce ADCC
response in in-vity-o assays. For the CH1-CH3 cDNA, oligonucleotides
5'-ACCGCTCGAGTGC(T/C)TCCACCAAGGGCCCATC(G/C)GTCTTC (sense)
and
5'-TTTGCGGCCGCTCATTTACCC(A/G)GAGACAGGGAGAGGCT (anti-sense) were
synthesized and used for PCR amplification. As described for the CL cDNA
encoding
sequence, the PCR product of expected size (1500 bp) was purified, sequenced,
and
digested with AvYII and NotI restriction enzymes.
103
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
[399.] For the final expression vectors, a triple ligation procedure was
carried
out using the EcoRV-NotI pre-digested pBJ-3 vector, EcoRV AvrII variable cDNAs
and
AvrII-NotI constant regions. The final vectors for heavy chain and light chain
expression
were designated pBJ-Yl-HC and pBJ-Yl-LC, respectively.
[400.] An additional vector, pBJ-Yl-LP, was constructed based on the pBJ-Y1
LC to allow double selection based on the puromycin resistant gene (PAC). In
this vector
the neomycin-resistant gene of the pBJ-Yl-LC plasmid was replaced with a
fragment of
~1600bp encoding for the PAC gene (from the pMCC-ZP vector).
[401.] The open reading frame (ORF) of both the Y1-HC and Y1-LC and their
encoded amino acid sequences axe presented as SEQ IDNOS. 205-208.
[402.] The leader sequence is underlined. The VH and VL regions are each
encoded by amino acid sequences that are bolded, followed by either the IgGl
(for the
heavy chain) or the ~,3 (for the light chain) constant region sequences.
[403.] Expression of Yl heavy and light chain in CHO cells.
Vectors pBJ-Y1-HC and pBJ-Yl-LC were used individually for the transfection
and
selection of stable cells expressing the heavy or light chains. Following
selection on 6418
and cell growth, the secreted protein in the supernatant was analyzed for IgGl
expression
by the capture EIA assay and by Western blot analysis, as described below:
[404.] Capture EIA assay: The wells of 96 well-plates were pre-coated with
mouse anti-human IgGl Fc (Sigma). The supernatant from above was added to the
wells,
and the presence of heavy chain IgGl was detected with biotinylated goat anti-
y chain
specific antibody (Sigma), streptavidin-HRP and substrate. An ELISA plate
reader
monitored development of the color at A4os.
[405.] Western blot analysis: The supernatant for the above cells was run on
12.5% SDS-PAGE. Expression of each chain was detected with (a) goat anti-human
IgG-
HRP (H+L; Sigma Cat #A8667) for heavy chain detection end (b) biotinylated
goat
' 104
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
anti-human ~,3 chain (Southern Biotechnology Association, Cat #2070-08) for
light chain
detection.
[406.] Expression of both chains was confirmed by the above assays, and co-
transfection was carried out to obtain full size Y1-IgGl.
Expression and Purification of IgG-Yl
[407.] Cell Culture and Transfection: CHO cells were cultivated in F-12
medium with 10% fetal calf serum and 40p.g/ml gentamicin at 37°C in 5%
COZ
atmosphere. One day before transfection 0.8-1x106 cells were seeded on 90mm
dishes.
The cultures were co-transfected with 10~,g of light and heavy chains DNA by
the
FuGene (Roche) transfection reagent technique. After 2 days of growth in
nonselective
medium, the cells were cultured for 10-12 days in F-12 medium containing
SSO~,g/ml
neomycin and 3 ~,g/ml puromycin. The cells were trypsinized and cloned by
limiting
dilution of 0.5 cell/well in Costar 96-well plates. Individual colonies were
picked, grown
in six-well dishes and transferred to flaslcs.
[408.] Determination of heavy and light chain secretion: A sandwich ELISA
assay was used to determine the concentration of the antibody secreted into
the
supernatant of transfected CHO cells.111 order to determine the concentration
of the
antibody, the following reagents were used: monoclonal anti human IgGl(Fc)
(Sigma) as
the coated antibody, goat anti-human IgG (y-chain specific) biotin conjugate
as the
detector (Sigma), and pure human IgGl, lambda (Sigma) as standard. Based on
this
ELISA assay the production rate varied between 3-4~g/ml.
[409.] Production and Purification of MAb from the cells: Cells were grown
in roller bottles to a final concentration of 1-2x108 cells per bottle in F-12
medium with
10% fetal calf serum, supplemented with neomycin and puromycin. For the
production,
cells were cultured in the same medium, but with 2% of fetal calf serum for an
additional
two days.
105
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
[410.] The secreted antibody was purified on a protein G-Sepharose column
(Pharmacia). Binding was in 20mM sodium phosphate buffer, pH 7.0; elution was
performed in O.1M glycine buffer, pH 2.5-3Ø The quantity of the purified
antibody was
determined by UV absorbance; purity was analyzed by SDS-PAGE. Under non-
denaturing conditions the full IgG antibody has its expected molecular weight
of 160kD.
In denaturing gels both heavy and light chains have the expected molecular
size of 55 and
28 kD, respectively.
[411.] Binding of full size IgG-Yl molecule: Binding experiments were
performed to determine the level of binding of the IgG-Y1 molecule compared to
the
binding level of the scFv-Y1 molecule. A two-step staining procedure was
employed,
wherein 5 ng of IgG-Yl were reacted with both RAJI cells (negative control,
Figure 44)
and Jurkat cells (Y1 positive cells, Figure 44). For detection, PE-labeled
goat anti-human
IgG was used. Similarly, 1 ~.g ~of scFv-Yl was reacted with Jurkat cells
(Figure 44), and
PE-labeled rabbit anti-scFv was used for detection. Results indicate that both
IgG-Yl and
scFv-Y1 bind to Jurkat cells, with approximately 103-fold more scFv-Yl
molecules
needed to obtain a level of detection similar to that of the IgG-Yl .
Example 6: Preparation of Fab and F(ab')2 fragments derived from the full I~G
Yl
antibody.
Cell Culture and Transient Transfection:
[412.] CHO~ cells were cultivated in F-12 medium supplemented with 10% fetal
calf serum and 40 ug/ml gentamicin at 37°C in 5% C02 atmosphere. One
day before
transfection 1-1.5-1x106 cells were seeded on 90mm dishes. The cultures were
co-
transfected with 10 ~.g of DNA encoding the variable light and variable heavy
chains of
the Y1 antibody, each in a separate eukaryotic expression system. Transfection
was
carried out with the FuGene (Roche) transfection reagent technique.
[413.] After 2 days of growth in nonselective growth media, the cells were
cultured for 10-12 days in F-12 medium containing 550 ~.g/ml neomycin and 3
~g/ml
puromycin. The cells were trypsinized and cloned by limiting dilution of 0.5
cell/well in
106
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Costar 96-well plastic plates. Individual colonies were picked, grown in six-
well dishes
and transferred to flasks for further selection (to determine level of
expression and
antibody secretion to the growth media).
Cell Culture and Long-Term Transfection:
[414.] CHO- cells were cultivated in F-12 medium supplemented with 10% fetal
calf serum and 40 ~.g/ml gentamicin at 37°C in 5% COZ atmosphere. One
day before
transfection 0.8-1x106 cells were seeded on 90mm dishes. The cultures were
transfected
with 10 ~g of DNA encoding the variable light and variable heavy chains of the
Yl
antibody cloned under the CMV (cytomegalovirus) promoter and the dhfr gene
under the
sv-40 promoter. Transfection was carned out using the FuGene (Roche)
transfection
reagent technique. After 2 days of growth in nonselective growth media, the
cells were
cultured in a media containing 100nM-S~M methotrexate (MTX) and dialyzed fetal
calf
serum in order to select for clones (after limiting dilution) that express
increased levels of
the full Y1 antibody.
Determination of heavy and light chains secretion:
[415.] A sandwich ELISA assay was established to determine the concentration
of the antibody that is being secreted into the supernatant of transfected CHO
cells. In
order, to quantitate the concentration of the antibody, the following reagents
were used: a
monoclonal anti human IgG1(Fc) (Sigma) as the coated antibody, a goat anti
human
IgG(~y-chain specific) biotin conjugate as the detector (Sigma) and a purified
human
IgGl, lambda (Sigma) as standard.
Production and Purification of Mab from the cells:
[416.] Cells were grown in roller bottles to a final concentration of 1-2x10$
cells
per bottle in F-12 medium supplemented with 10% fetal calf serum, neomycin and
puromycin (as indicated above). For antibody production, cells were cultured
in the same
medium, but with 2% of fetal calf serum for additional two days.
l07
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
[417.] The secreted antibody was purified on a protein G sepharose column
(Pharmacia) and ion exchange column-Q sepharose (Pharmacia). Binding was in
20mM
sodium phosphate buffer pH 7.0, while elution was in O.1M glycine buffer pH
2.5-3Ø
The quantity of the purified antibody was determined by UV absorbance and
ELISA,
while its purity was analyzed by SDS-PAGE and HPLC. Under non-denaturing
conditions the full IgG antibody has its expected molecular weight of 160kD.
In
denaturing gels both heavy and light chains have the expected molecular size
of 55 and
28 kD respectively.
Fragmentation of Yl I~G into Fab and F(ab')Z:
[418.] The IgG molecule is composed of two identical light chains and two
identical heavy chains. These chains are held together in folds (domains) by a
combination of non-covalent interactions and covalent bonds (disulfide
linkages). The
light chain consists of one variable domain and one constant domain. The heavy
chain
consists of a variable domain (VH) and three separate constant domains (CH 1,2
and 3).
The "hinge" region between constant heavy domain one (CH1) and constant heavy
domain two (CH2) is readily accessible to proteolytic attack by enzymes.
Cleavage at this
point produces Fab or F(ab')2 fragments and the Fc portion. The Fab portion of
the
molecule retains the antigen binding capability of the molecule, but has low
nonspecific
binding. The Fab portion is best suited to those situations where the antigen
binding
capabilities without effector functions are desired.
[419.] In vivo Fab and F(ab')a fragments are used as diagnostic and
therapeutic
agents. To make cancer chemotherapeutic agents tumor-specific instead of
damaging to
all cells, the agents can be linked to antibodies that bind to cell surface
antigens of
tumors. Using Fab or F(ab')2 fragments in place of intact IgG offers several
advantages:
[420.] (1) The fragments can more easily cross capillaries and diffuse to
tissue
surfaces.
l08
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
[421.] (2) Fragments not bound to conjugate will be cleared more rapidly than
intact unbound IgG; and, therefore, more of the fragment-therapeutic agent
will reach the
target area.
[422.] An initial attempt to prepare monovalent and divalent antibody
fragments
has been done by using immobilized Ficin (Pierce). Ficin cleavage produces
F(ab')2
fragments in the presence of 1mM cysteine. Similarly, by increasing the
concentration of
cysteine activator in the digestion buffer to lOmM, Fab fragments can be
created from the
original IgG.
[423.] After digestion, the fragments are purified on an immobilized Protein A
column. The F(ab')~ and Fab fragments were concentrated using a
microconcentrator with
either a 10,000 or 30,000 Dalton molecular weight cutoff. Protein recovery was
determined using absorbance at 280 nm. Fragment purity was determined using
gel
electrophoresis.
Detailed procedure for the preparation of the Fab Fragment:
[424.] 1 mg of purified Yl antibody was applied to a 2 ml column of
Immobilized Ficin in Digestion buffer in a concentration of 2 mg/ml of
cysteine. HCL
(for the preparation of F(ab')Z fragments) and 20mg/ml (for the preparation of
Fab
fragments), at 37° C for 5 hours (for Fab) and 20 hours (F(ab')Z).
Reaction was terminated
by eluting the digest with 4 ml of Immunopure Binding buffer. Separation of
Fab or
F(ab')2 fragments from undigested IgG and Fc fragments was done by using
Protein A
column with Binding buffer. The Fab or F(ab')2 was contained in the flow
through. By
reading the absorbarlce at 280nm, the peak fractions containing the fragments
were
pooled. Fragments were concentrated and dialyzed against PBS by using
microconcentrator with 10,000 Dalton molecular weight cutoff. Protein
recovery, purity
and characterization were determined by using absorbance at 280nm, gel
electrophoresis
and HPLC.
109
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Cell Extract (Lvsatel Preparation
[425.] 2x10 cells were harvested and centrifuged in microcentrifuge (1300 rpm,
4°C, 5 minutes). To wash, 0.5-1 ml PBS+pi was applied to the pellet and
mixed gently.
The mixture was centrifuged as before. Washing with 0.5-1 ml PBS+pi was
repeated,
and the mixture was centrifuged as above. The pelleted cells were resuspended
in lysis
buffer (200 ul/20x 106 cell pellet). The lysis buffer used was 50 mM Tris pH
7.4, 1 mm
PMSF 1 % NP-40, and 1 mM EDTA, although other suitable lysis buffers may be
used.
The suspension was incubated for about 60 minutes on ice, then centrifuged
(3000 rpm, 4
°C, 5 min). The supernatant was collected and divided into aliquots.
Preparation of a crude membrane fraction and extraction of membrane proteins
[426.] Twenty volumes of homogenization buffer was added to one volume of
packed cells. The homogenization buffer used was 2% (w/v) Tween 20, 1 rnM
MgS04, 2
mM CaCl2, 150 mM NaCI, and 25 mM Tris-HCI, pH 7.4. The following protease
inhibitors were also added: 1mM PMSF, 5 ug/ml Leupeptin, and 5 ~ag/ml
Aprotonin. T'he
cells were homogenized using three to five strokes in a Potter-Elvehjem
homogenizer
with a rotating Teflon pestle (Ultra-Torex). The sample was kept cold during
homogenization, then stirred for 1 hour in an ice-bath. The sample was
subjected to a few
additional strokes in the homogenizer, then centrifuged at 3000 g for 30 min
at 4 °C. The
supernatant was collected and centrifuged at 45000 g (19000 rpm rotor ss-34)
for 1 hour
at 4 °C. The supernatant from the 45000g centrifugation was discarded.
A solution of 50
mM Tris 7.4, 1mM EDTA, 1% NP-40 and protease inhibitors was added to the
pellet, and
the dissolved pellet was put it on ice for one hour.
Membrane Fraction Purification on HPLC column
[427.] An RPC column (Phannacia Type PLRP-S 300 A) was used for membrane
fraction purification. The buffers used were (A) 20mM Tris 8.0 and (B) 60%
propanol in
DDW. The flow rate was 1 ml/minute, with the exception of the wash step during
which
the flow rate was 2 ml/min. The whole procedure was performed at ambient
temperature.
110
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
[428.] The elution sample after immunoprecipitation (IP) of Jurkat or KG-1
membrane fraction was added with sample buffer (62mM Tris pH 6.8, 10%
Glycerol,
3%SDS, 720mM mercaptoethanol) diluted with buffer A at a ratio of 1:4.
[429.] The sample was loaded on the column, and the flow-through liquid was
s
collected. The column was washed with buffer A until the optic density of the
flow
declined to zero.
[430.] The proteins were eluted from the column according to the following
program: 5 minutes with 80% A, then 40 minutes gradient of 80-0% of A and 20-
100%
B. A second gradient was then applied to bring the composition of the flow to
80% A,
and this composition was used to wash the column for 5 more minutes. The
elution liquid
was collected in a fraction collector, in 1 ml fraction sizes.
[431.] The samples were evaporated to small volumes in a Speed-Vac evaporator,
then analyzed using SDS-PAGE (SDS-polyacrylamide gel electrophoresis) and
western
blotting.
Purification of Normal Human Plasma on O Senharose columns
[432.] 5 ml of normal human fresh frozen plasma was diluted 1:10 with start
buffer and filtered through a 0.45 ~m syringe filter (Sartorius, cat # 16555).
Start buffer
is 20 mM Tris-HCI, pH 8.0 and contains protease inhibitors (5 ~.g/ml
leupeptin, 5 Pg/ml
aprotinin, and 1mM PMSF).
[433.] A 5 ml HiTrap Q Sepharose column (Amersham Pharmacia, cat #
17-1154-01) was attached to a P-1 peristaltic pump (Amersham Pharmacia). The
column
was washed according to the commercial protocol at a flow rate of
approximately 4
ml/minute. The diluted filtered plasma was loaded on the column, and the flow-
through
liquid was collected. The column was washed with 20 volumes of 0.3 M NaCI
solution in
start buffer. Proteins were eluted at 0.6 M, 0.8 M, and 1.0 M NaCI solutions
in start
buffer. Elution vohunes were 50, 20 and 20 ml, respectively. The whole
procedure was
performed at 4 °C.
111
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
[434.] - Eluted fractions were subjected to SDS-PAGE analysis in duplicated
gels,
followed by Western blot analysis using biotinylated Y1 and antibody 181 as a
negative
control. Fibrinogen 'y prime was found in the 0.6M NaCI elution fraction. The
1.0 M
NaCl elution fraction contained complement compound 4 (CC4), lumican,
prothrombin,
and inter-alpha-inhibitor.
Purification of Normal Human Plasma on HPLC column
[435.] Q Sepharose purified normal human plasma was mixed with Urea (to a
final concentration of at least 8M), DTT (to a final concentration of 30 mM)
and TFA (to
a final concentration of 0.1 %).
[436:] The purified plasma solution was loaded on a 3 ml RPC column
(AmersOham Pharmacia), and the flow-through liquid was collected. The column
was
washed with buffer A until the optic density of the flow declined to zero. The
proteins
were eluted from the column according to the following program: 5 minutes with
90% A,
then 40 minutes gradient of 90-0% of A and 10-100% B. A second gradient was
then
used to bring the composition of the flow to 90% A, and this composition was
used to
continue washing the column for 5 more minutes. The buffers used were (A) 0.1%
TFA
in DDW and (B) 80% CAN and 0.1% TFA in DDW. The flow rate was 1 ml/minute,
with
the exception of the wash step, during which the flow rate was 2 ml/ minute.
[437.] The elution liquid was collected in a fraction collector, in 1 ml
fraction
sizes. The whole procedure was performed at ambient temperature.
[438.] The samples were evaporated to small volumes in a Speed-Vac evaporator,
then analyzed using SDS-PAGE and western blot.
Indirect Immunoblotting with Non-Labeled CD162 Antibod
[439.] Samples were run on 10% SDS-PAGE at 140-160 Volts for 3.5 hours at
Sigma Z37, 503-9 appliance. The electrophoresed samples were transferred onto
a
nitrocellulose membrane overnight on 20 Volts in Tris Glycine buffer (20%
MeOH, 192
mM glycine, 25 mM TRIS, pH 8.3) at room temperature. The nitrocellulose
membrane
112
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
was blocked using 5% skim milk in PBS (phosphate buffered saline) for one hour
at room
temperature. The nitrocellulose membrane was washed 3 times for 5 minutes each
with
0.05% Tween 20 in PBS. The membrane was incubated with Super Signal mixture
(Pierce) for 5 minutes as directed in the commercial protocol, then excess
solution was
dried. The membrane was use to expose it to X-ray film (Fuji), and the film
was
developed.
Western Blot Analysis of Yl Receptor - Processing of the Filter After Blotting
[440.] The nitrocellulose membrane was blocked using 5% skim milk for one
hour at room temperature. The membrane was then washed 3 times for 5 minutes
each
with 0.05% Tween 20 in PBS at room temperature. The membrane was incubated
with
S~.glml Y1-biotin (or 181-biotin) in 2% skim milk in PBS for one hour at room
temperature. The membrane was then washed 3 times for 5 minutes each with cold
0.05%
Tween 20 in PBS in the cold room (about 4 to about 10 °C ). The
membrane was then
incubated in the cold room with a 1:1000 dilution of SAV-HRP (streptavidin-
HRP) (at a
final concentration of 1 g/ ml) in 2% skim milk, 0.05% Tween. The dilution was
carned
out at room temperature (about 25 °C), then the diluted SAV-HRP was
cooled on ice for
10-15 minutes before use. The incubation was carried out for 1 hour with
gentle shalcing.
After the incubation with SAV-HRP, the membrane was washed, as above. The
membrane was then incubated with Super Signal mixture (Pierce) for 5 minutes
as
directed in the commercial protocol, then excess solution was dried. The
membrane was
use to expose it to X-ray film (Fuji), and the film was developed.
Example 7: Prokaryotic expression of recombinant ~lycocalicin (GC)
[441.] The DNA fragment encoding for glycocalicin (GC, amino acid 1 to amino
acid 493 of GPIba) was cloned into an IPTG inducible prokaryotic vector
cassette. E.
coli (BL21 DE3) cells harboring the newly constructed plasmid were grown at
37°C to
O.D. 0.7-0.8, than at 37°C for 3 hours for in the presence of IPTG for
induction.
[442.] SDS-polyacrylamide gel loaded either with semi-purified human platelet
derived glycocalicin ("GC") or with E. coli cell lysates ("total") derived
from induced and
113
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
non-induced cells were analyzed. Western blot analysis was performed with
biotinylated
Y1-scFv, polyclonal rabbit anti-human glycocalicin antibody, commercially
available
mouse anti-human CD42 monoclonal antibody (SZ2 Immunotech, PM640 Serotec, HIPl
Pharmigen, AN51 DAKO), and polyclonal antibody against the N-terminus of GPIba
(Sc-7071, Santa Cruz).
[443.] The two polyclonal antibodies recognized both the recombinant bacterial
derived glycocalicin and the natural human platelet derived glycocalicin. The
Y1- scFv
and the commercially available antibodies recognized the natural human-derived
glycocalicin, but did not recognize the bacterial derived recombinant platelet
glycocalicin.
FIG. 45.
[444.] The prokaryotic (e.g., E. coli) system lacks post-translational
modification
mechanisms, such as mechanisms for glycosylation and sulfation. Thus, the lack
of
recognition by Yl-scFv of the bacterially produced glycocalicin supports the
conclusion
that post-translational modification, such as glycosylation and sulfation, is
essential for
'Y1-scFv binding to glycocalicin.
FRCS Protocol for Blood/Eone Marrow Samples
[445.] Samples provided from hospitals. Patients sample 30~1/tube. Add 5~.1
/tube of CD33-APC (for AML) or CD 19-APC (for B-CLL) or CD38-APC (for Multiple
Myeloma). Add 5~,1/tube of CD45-PerCp and 5~,1 of scFv-Y1 or control scFv-N31
or
CD162-PE (KPL1). Incubate tubes 30 minutes at 4°C with low shaking.
Wash by adding
2m1 PBS and spin 5 minutes at 1200rpm. Discard supernatant.
[446.] For a one step assay continue with the lysis step:
[447.] Add 500,1 BD Lysine solution diluted 1:10 with ddH20 (300.1 to patient
sample). Vortex at high speed and incubate 12 minutes at 4°C. Wash as
above. Discard
supernatant. And add 500.1 PBS. The samples are read in the FACS using blood
sample
acquisition setup according to international standards.
114
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
[448.] For two or more assays: working buffer is PBS + 1%BSA + 0.05%
sodium azide. Incubations and wash as above.
[449.] Lysis of the red blood cells is the final step in the assay, followed
by
resuspension with 5001 PBS.
EXAMPLE 8: Construction of Triabodies
[450.] The vector pHEN-Y1, encoding the original Y1, was amplified using PCR
for both the VL and the VH regions, individually. The sense oligonucleotide 5'-
AACTCGAGTGAGCTGACACAGGACCCT, and the anti-sense oligonucleotide
5'-TTTGTCGACTCATTTCTTTTTTGCGGCCGCACC were used for the VL PCR
reaction. The cDNA product of the expected size of 350 by was purified,
sequenced,
and digested with XhoI and NotI restriction enzymes.
[451.] The same procedure was employed to amplify the VH region (using the
sense oligonucleotide 5'-ATGAAATACCTATTGCCTACGG and anti-sense
oligonucleotide 5'-AACTCGAGACGGTGACCAGGGTACC). The VH PCR product
was digested with NcoI and XhoI restriction enzymes. A triple ligation
procedure into the
pHEN vector, pre-digested with NcoI-NotI, was employed. The final vector was
designated pTria-Y1.
[452.] Following E. coli transformation, several clones were picked for
further
analysis, which included DNA sequencing, protein expression, and extraction
from the
periplasmic space of the bacteria. SDS-PAGE under reducing conditions and
Western
blot analysis were performed to confirm the size of the Y1 triabodies.
EXAMPLE 9: Construction of Diabodies
[453.] The pTria-Y1 vector from above was linearized withXlzoI restriction
enzyme, and synthetic complimentary double stranded oligonucleotides
(5'-TCGAGAGGTGGAGGCGGT and 5' TCGAACCGCCTCCACCTC) were
pre-annealed and ligated into the XhoI site, between the Y1-heavy and Yl-light
chains.
115
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
This new vector was designated pDia-Yl . As described for the triabodies, the
DNA
sequence and protein expression was confirmed.
Example 10: Exuression and Purification of Diabodies and Triabodies
[454.] Expression in E-coli was essentially as described for the scFv-Yl .
However, the purification of Yl diabodies and triabodies from the periplasm of
the
transformed E. coli cells was different. The scFv Y1 monomer form can be
purified on
an affinity column of Protein-A Sepharose beads. Multimeric forms of Y1 are,
however,
ineffectually purified by this procedure. Therefore, periplasmic proteins
extracted from
the bacteria were precipitated over-night with 60% ammonium sulfate,
resuspended in
H20, and loaded onto a Sephacryl-200 (Pharmacia) size exclusion column
pre-equilibrated with O.l.xPBS. Fractions were collected and analyzed by HPLC,
and
separate fractions containing either the dimer or timer forms were collected
for FITC
labeling and FAGS analysis.
EXAMPLE 11: Sindin~ of Yl diabodies and triabodies to cells
[455.] FAGS analysis was performed on Jurkat cells using a "three step
staining
procedure." First, crude extracts or purified unlabeled scFv are stained, then
mouse
anti-myc antibodies, and finally, FITC- or PE-conjugated anti-mouse
antibodies. FACS
analysis requires 5-8x105 cells, which have been Ficoll-purified and
resuspended in PBS+1
BSA. Binding was carried out for 1 hour at 4°C. After each step, cells
were washed
and resuspended in PBS+1 % BSA. After the final staining step, cells were
fixed by re-
suspending in PBS, 1 % BSA, 2 % formaldehyde, and then read by FACS
(Becton-Dickinson).
[456.] The binding of Y1-scFv was compared to that of diabodies and
triabodies.
In this analysis (Figure 44), the binding profile of all three forms was very
similar,
indicating that the above modifications in the molecule did not alter, conceal
or destroy
the apparent binding affinity of Y1 to its ligand.
116
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
EXAMPLE 12: A Study of the Affinity of the S-S Yl-Dimer in Comparison to
CONYl and Yl-I~G. using a Radiorecentor Binding Assav with KG-1 Cells
[457.] The assay system involved the use of radioactive ligands that were
prepared by iodination with 1~SI using chloramine T on the Yl-IgG construct or
the
Bolton-Hunter (CONY1) reagent. The assay tubes contained 5x106 KG-1 cells per
0.2 ml
and a labeled tracer with varying amounts of unlabeled competitor, in PBS +
0.1 % BSA,
pH 7.4. After one hour incubation with agitation at 4 °C, the cells
were thoroughly
washed with cold buffer and taken for radioactivity counting.
[458.] For the radio receptor binding assay (RR.A), 2 ng/tube of l2sl-Yl-IgG
was
used, and competition was performed with each of the three molecules. The
results are
provided in Figure 46. The results presented in this figure demonstrate that
the affinity of
the S-S Y1 dimer was twofold lower than most of the full Y1 antibody and 30
times
higher than that of CONY 1. A rough estimate of the affinity of the Y1-IgG in
this
experiment is 2x 10-8 M. The corresponding affinity of the dimer is,
therefore, 4 x 10-$
M.
[459.] In a second RRA using labeled CONYl, a 100 ng/tube of l2sl-Yl-IgG was
used, and competition was performed with each of the three molecules. The
results are
provided in Figure 47. This figure shows that the affinity of the S-S dimer
was 20 times
higher than that of CONY1. A rough estimate of the affinity of CONY 1 in this
experiment is 10-6M. The corresponding affinity of the dimer is, therefore, Sx
10-$ M.
EXAMPLE 13: Production of Yl-cys-kak (cysteine dimer)
[460.] One liter of 7~pL-yl-cys-kak bacterial culture was induced at
42°C for 2-3
hrs. This culture was centrifuged at 5000 RPM for 30 minutes. The pellet was
resuspended in 180 ml of TE (SOmM Tris-HCl pH 7.4, 20mM EDTA). 8 ml of
lysozyme
(from a 5 mg/ml stock) was added and incubated for 1 hr. 20 ml of SM NaCI and
25 ml
of 25% Triton was added and incubated for another hour. This mixture was
centrifuged
at 13000 RPM for 60 minutes at 4° C. The supernatant was discarded. The
pellet was
resuspended in TE with the aid of a tissuemiser (or homogenizer). This process
was
117
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
repeated 3-4 times until the inclusion bodies (pellet) were gray/light brown
in color. The
inclusion bodies were solubilized in 6M Guanidine-HCI, O.1M Tris pH 7.4, 2 mM
EDTA
(1.5 grams of inclusion bodies in 10 ml solubilization buffer provided ~10
mg/ml soluble
protein). This was incubated for at least 4 hrs. The protein concentration was
measured
and brought to a concentration of 10 mg/ml. DTE was added to a final
concentration of
65 mM and incubated overnight at room temperature. Re-foldirxg was initiated
by
dilution of 10 ml of protein (drop by drop) to a solution containing 0.5 M
Arginine, 0.1 M
Tris pH 8, 2 mM EDTA, 0.9 mM GSSG. The re-folding solution was incubated at
~10°
C for 48 hrs. The re-folding solution containing the protein was dialyzed in a
buffer
containing 25 mM Phosphate buffer pH 6, 100 mM Urea, and concentrated to 500
ml.
The concentrated/dialyzed solution was bound to an SP-sepharose column, and
the
protein was eluted by a gradient of NaCI (up to 1M).
EXAMPLE 14: ELISA to GC (~lycocalicin)
[461:] 100 ml of purified glycocalicin was incubated in a 96 flat well
maxisorp
plates, overnight at 4 degrees Celsius. The plate was washed with PBST
(PBS+0.05%
tween) 3 times, then 200 ml of PBST-milk (PBST + 2% Non fat milk), for 1 hr at
room
temperature. The plate was washed with PBST, and the monomer or dimer (100 ml)
was
added in PBST-milk at different concentrations for 1hr at room temp. Then the
plate was
washed axzd anti-VL polyclonal (derived from immunized rabbits with VL derived
from
Y1) (1:100 diluted in PBST-milk) was added for an hour. The plate was washed
and
anti-rabbit HRP was added for an additional hour. The plate was washed 5 times
and 100
~1 TMB substrate was added for approximately 15 minutes then 100 ~l of 0.5
H2S04 was
added to stop the reaction. The optical density of the plate was measured at
450nm in an
ELISA reader.
EXAMPLE 15: E. coli expression of recombinant ~lvcocalicin (GC
[462.] The DNA fragment encoding the N-terminal soluble part of human platelet
GPlb - glycocalicin (GC, amino acid 1 to amino acid 493) was cloned into an
IPTG
inducible prokaryotic vector cassette. E. coli (BL21 DE3) cells harboring the
newly
constructed plasmid were grown at 37°C to O.D. 0.7-0.8, than at
37°C for 3 hours for in
118
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
the presence of IPTG for induction. SDS-polyacrylamide gel loaded either with
semi-purified human platelet derived GC or with E. coli cell lysates (total
protein content)
derived from induced and non-induced cells were analyzed. Western blot
analysis was
performed with scFv Y1-biotinylated, polyclonal rabbit anti-human GC antibody,
mouse
anti-human CD42 monoclonal antibody (SZ2 Immunotech, PM640 Serotec, HIP1
Pharmigen, AN51 DAKO, commercially available) and polyclonal antibody against
the
N-terminus of GPIba (Sc-7071, Santa Cruz). The two polyclonal antibodies
recognized
both the recombinant bacterial derived GC as well as the natural huma~l
platelet derived
GC. The scFv Yl and the commercially available antibodies recognized only the
natural
human derived GC, but not the bacterial derived recombinant platelet GC.
[463.] Post-translational modification, such as glycosylation and sulfation is
essential for scFv and commercially available antibodies binding to GC. The
prokaryotic
(E. coli) system lacks post-translation modification mechanisms, such as
glycosylation
and sulfation.
Example 16: Production of tetramers of Yl
[464.] A construct was designed where the following sequence,
LNDIFEAQKIEWHE, was added at the C-terminus of the Y1 by PCR and cloning into
an IPTG inducible expression vector cassette. The clone was named Y1-biotag.
This
sequence is a substrate for the enzyme BirA, that in the presence of free
biotin, the
enzyme is capable of covalently connecting biotin to the lysine (I~) residue
(Phenotypic
analysis of antigen-specific T lymphocytes. Science. 1996 Oct 4;274(5284):94-
6, Altman
JD et al). This construct was produced as inclusion bodies in BL21 bacterial
cells.
Refolding was performed as described previously. Inclusion bodies were
solubilized in
guanidine-DTE. Refolding was done by dilution in a buffer containing arginine-
tris-
EDTA. Dialysis and concentration was performed followed by HiTrapQ ionic
exchange
purification.
[465.] The purified Y1-biotag scFv was incubated with BirA enzyme (purchased
from Avidity) and biotin as recommended by the provider. The biotinylated Y1-
biotag
119
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
was analyzed by HABA test (that estimates the amount of biotin per molecule)
and
demonstrated that there was around >0.8 biotin residues/molecule.
[466.] The Yl-biotag biotinylated was incubated with Streptavidin-PE
(Phycoerythrin) to form complexes and used in FACS experiments using KG-1
cells
(positive for Y1). The sensitivity of the binding was increased at least 100
fold due to the
increase in avidity. Streptavidin can bind up to 4 biotinilated-Y1-biotag
molecules.
[467.] The sequence of Yl-biotag is as follows, and is SEQ 1T7 NO: 211:
MEVQLVESGG GVVRPGGSLR LSCAASGFTF DDYGMSWVRQ
41 APGKGLEWVS GIN-WNGGSTG YADSVKGRFT ISRDNAKNSL
81 YLQMNSLRAE DTAVYYCARM RAPVIWGQGT LVTVSRGGGG
121 SGGGGSGGGG SSELTQDPAV SVALGQTVRI TCQGDSLRSY
161 YASWYQQKPG QAPVLVIYGK NNRPSGIPDR FSGSSSGNTA
201 SLTITGAQAE DEADYYCNSR DSSGNNVVFG GGTKLTVLGG
241 GGLNDIFEAQ KIEWHE
Example 17: Characterization of Y17 Activity
[468.] The enzyme O-Sialoglycoprotein endoprotease from Pastoral laaernolytica
that selectively cleaves human platelets GPIb, was used in order to establish
the
specificity of binding of Y17 to GPIba. The O-Sialoglycoprotein endoprotease,
specifically cleaved only proteins containing sialyated, O-linl~ed glycans,
and does not
cleave N-linl~ed glycoproteins or unglycosylated proteins. This enzyme has
been reported
to cleave GPIb, which is heavily O-glycosylated, but not GPIIb-IIIa or other
receptors on
the platelets. Incubation of washed platelets with O-Sialoglycoprotein
endoprotease
which cleaved GPIb, abolishes binding of Y17 as well as the binding of
monoclonal
antibody (MCA466S-serotec) directed against GPIba to the GPIb as was shown by
12o
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
immunoblots and by FACS analysis. These endoprotease did not change the
binding of
monoclonal antibody (anti CD61) directed against GPIIb/IIIa (FIG. 4).
Examule 18: Identification of Y17 Epitope on Platelets GPIb
[469.] An interesting approach to identification of the Y1 epitope on
platelets
GPIb is to use endoproteases enzyme whose cleavage sites on platelets GPIb are
fully
characterized.
18.1: Effect of Mocarhagin on the Mauuin~ of Yl Enitone
[470.] Mocarhagin, a cobra venom metalloproteinase cleaves platelet GPIba
specifically at a single site between residues glu-282 and asp-283, generates
two stable
products, a 45-kDa N-terminal fragment (His-1-Glu-282) found in the
supernatant and a
membrane bound 100 kDa C-terminal fragment.
[471.] Washed platelets were treated by mocarhagin and, platelets lysate were
separated on SDS-polyacrylamide gels and transferred to nitrocellulose.
Analysis of
mocarhagin-treated washed platelets by Western blot analysis with Y1-results
in loss of
the band corresponding to GPIb (135 kDa) and, binding of Y17 to the N-terminal
45 kDa
tryptic fragment. Monoclonal antibodies, MCA466S directed against the C-
terminal
fragment of GPIba reacted with the 100 kDa C-terminal fragment while,
monoclonal
antibody S.C.7071 which recognizes the N-terminal of GPIba reacted with the
same 45
kDa N-terminal fragment that was recognized by Y17 (FIG. 14).
[472.] Mocarhagin treatment of glycocalicin gave results similar to those
observed with washed platelets, showing binding of Y1 and monoclonal
antibodies, S.C.
7071 to 45 kDa N-terminal cleavage product fragment of GPIba (Figure 8). The
results
suggest that the epitope for Y17 is contained within the sequence His-1-Glu-
282.
18.2: Effect of Cathepsin G on the Mapping of Y17 Epitope
[473.] Cathepsin G, a neutroplul serine protease, cleaved glycocalicin between
residues leu-275 and Tyr-276 and a second cleavage site between residues Val-
296 and
121
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Lys-297. Glycocalicin treated by cathepsin G generated two N-terminal
fragments, a
small fragment 42 kDa fragment (Hisl-Leu275) and a large 45 kDa N-terminal
fragment
(Hisl-Val-296), in addition to a ~95 kDa C-terminal fragment. Glycocalicin and
glycocalicin fragments generated by cathepsin G digestion were separated on
SDS-
polyacrylamide gels and transferred to nitrocellulose. Y17 bound to the larger
fragment
(Hisl-Val-296), but not to the smaller fragment (Hisl-Leu275). Moreover,
monoclonal
antibody S.C. 7071 which recognizes an epitope within Hisl-Leu275 blotted both
fragments (FIG. 12). Analysis of N-terminal peptide proteolytic fragments of
mocarhagin
and cathepsin G suggests that the BPIba amino acid sequence Tyr-276-Glu-282 is
an
important recognition motif for binding of Y17.
Example 19: Effect of Y17-scFv on vWF-dependent A~~lutination
[474.] The effect of Y17-scFv on vWF-dependent agglutination of platelets was
tested at different concentrations of Y17. In contrast to Y1, Y17 at a final
concentration
of 10, 25 or 50 ~.g/ml did not inhibit vWF-dependent platelet agglutination in
washed
platelets induced by ristocetin. Analysis of N-terminal peptide proteolytic
fragments of
mocarhagin and cathepsin G suggests that the GPIba amino acid sequence Tyr-276-
Glu-
282 is an important recognition motif for binding of Y17 and Yl. Since Y17
does not
inhibit platelet aggregation, it seems that Yl and Y17 do not bind to the same
sequences,
but to overlapping sequences.
122
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
SEQUENCE LISTING
<110> Bio-Technology General Corp
<210> 1
<211> 10
<212> PRT
<213> Homo Sapiens
<400> 1
Ser Ser Tyr Thr Ser Ser Ser Thr Leu Val
2 5 10
<210> 2
<211> 10
<212> PRT
<213> Homo sapiens
<400> 2
Ser Ser Tyr Thr Ser Ser Ser Thr Leu Gly
1 5 10
<210> 3
<211> 9
<212> PRT
<213> Homo Sapiens
<400> 3
Gln Ser Tyr Asp Ser Asn Leu Arg Val
1 5
<210> 4
<211> 8
1
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
<212> PRT
<213> Homo Sapiens
<400> 4
Gln Gln Leu Asn Ser Tyr Pro Thr
1 5
<210> 5
<211> 11
<212> PRT
<213> Homo Sapiens
<400> 5
Asn Ser Arg Asp Ser Ser Gly Phe Gln Leu Val
1 5 10
<210> 6
<211> 9
<212> PRT
<213> Homo Sapiens
<400> 6
Gln Gln Ala Asn Ser Phe Pro Ile Thr
1 5
<210> 7
<211> 111
<212> PRT
<213> Homo Sapiens
<400> 7
Ser Glu Leu Thr Gln Asp Pro Ala Val Ser Val Ala Leu Gly Gln Thr
1 5 10 15
Val Arg Ile Thr Cys Gln Gly Asp Ser Leu Arg Ser Tyr Tyr Ala 5er
2
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
20 25 30
Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Val Leu Val Ile Tyr Gly
35 40 45
Lys Asn Asn Arg Pro Ser Gly Ile Pro Asp~Arg Phe Ser Gly Ser Ser
50 55 60
Ser Gly Asn Thr Ala Ser Leu Thr Ile Thr Gly Ala Gln Ala Glu Asp
65 70 75 80
Glu Ala Asp Tyr Tyr Cys Asn Ser Arg Asp Ser Ser Gly Asn His Val
85 90 95
Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Gly Ala Ala Ala
100 105 110
<210> 8
<2l1> 6
<212> PRT
<213> Homo sapiens
<400> 8
Met Arg Ala Pro val Ile
1 5
<210> 9
<211> 8
<212> PRT
<213> Homo Sapiens
<400> 9
Pro Trp Asp Asp Val Thr Pro Pro
1 5
<210> 10
<211> 12
<212> PRT
<213> Homo Sapiens
3
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
<400> 10
Gly Phe Pro Arg Ile Thr Pro Pro Ser Ala Glu Ile
1 5 10
<210> 11
<211> 5
<212> PRT
<213> Homo Sapiens
<400> 11
Gly Phe Pro Met Pro
1 5
< 210 ~ '1_ 2
<211> 10
<212> PRT
<213> Homo Sapiens
<400> 12
Gly Phe Pro His Ser Ser Ser Val Ser Arg
1 5 10
<210> 13
<211> 11
<212> PRT
<213> Homo Sapiens
<400> 13
Arg Phe Pro Met Arg His Glu Lys Thr Asn Tyr
1 5 10
<210> 14
4
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
<211> 8
<212> PRT
<213> Homo Sapiens
<400> 14
Arg Phe Pro Pro Thr Ala Thr Ile
1 5
<2l0> 15
<211> 7
<212> PRT
<2l3> Homo Sapiens
<400> 15
Thr Gln Arg Arg Asp Leu Gly
1 5
<210> 16
<211> 11
<2l2> PRT
<213> Homo Sapiens
<400> 16
Lys Phe Pro Gly Gly Thr Val Arg Gly Leu Lys
1 5 10
<210> 17
<211> 12
<212> PRT
<213> Homo Sapiens
<400> 17
Gly Phe Pro Val Ile Val Glu Glu Arg Gln Ser Thr
1 5 10
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
<210> 18
<211> 10
<212> PRT
<213> Homo sapiens
<400> 18
Arg Phe Pro Gln Arg Val Asp Asn Arg Val
1 5 ~ 10
<2l0> 19
<211> 8
<212> PRT
<213> Homo Sapiens
<400> 19
Thr Gly Gln Ser Ile Lys Arg Ser
1 5
<210> 20
<211> 6
<212> PRT
<213> Homo Sapiens
<400> 20
Leu Thr His Pro Tyr Phe
1 5
<210> 21
<211> 6
<212> PRT
<213> Homo Sapiens
6
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
<400> 21
Leu Arg Pro Pro Gln Ser
1 5
<210> 22
<211> 11
<212> PRT
<213> Homo Sapiens
<400> 22
Thr Ser Lys Asn Thr Ser Ser Ser Lys Arg His
1 5 10
<210> 23
<211> 12
<212> PRT
<213> Homo Sapiens
<400> 23
Arg Tyr Tyr Cys Arg Ser Ser Asp Cys Thr Val Ser
1 5 10
<210> 24
<211> 10
<212> PRT
<213> Homo Sapiens
<400> 24
Phe Arg Arg Met Glu Thr Val Pro Ala Pro
1 ~ 5 10
<210> 25
7
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
<211> 277
<212> PRT
<213> Homo sapiens
<400> 25
Met Lys Tyr Leu Leu Pro Thr Ala Ala Ala Gly Leu Leu Leu Leu Ala
1 5 10 15
Ala Gln Pro Ala Met Ala Glu Val Gln Leu Val Glu Ser Gly Gly G1y
20 . 25 30
Val Val Arg Pro Gly Gly Ser Leu Arg Leu 5er Cys Ala Ala Ser Gly
35 40 45
Phe Thr Phe Asp Asp Tyr Gly Met Ser Trp Val Arg Gln Ala Pro Gly
50 55 60
Lys Gly Leu Glu Trp Val Ser Gly Ile Asn Trp Asn Gly Gly Ser Thr
65 70 75 80
Gly Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn
85 90 95
Ala Lys Asn Ser Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp
100 105 110
Thr Ala Val Tyr Tyr Cys Ala Arg Met Arg Ala Pro Val Ile Trp Gly
115 120 125
Gln Gly Thr Leu Val Thr Val Ser Arg Gly Gly Gly Gly Ser G1y Gly
130 135 140
Gly Gly Ser Gly Gly Gly Gly Ser Ser Glu Leu Thr Gln Asp Pro Ala
145 150 155 160
Val Ser Val Ala Leu Gly Gln Thr Val Arg Ile Thr Cys Gln Gly Asp
165 170 175
Ser Leu Arg Ser Tyr Tyr Ala Ser Trp Tyr Gln Gln Lys Pro Gly Gln
180 ~ 185 190
Ala Pro Val Leu Val Ile Tyr Gly Lys Asn Asn Arg Pro Ser Gly Ile
195 200 205
Pro Asp Arg Phe Ser Gly Ser Ser Ser Gly Asn Thr Ala Ser Leu Thr
210 215 220
Ile Thr Gly Ala Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Asn Ser
225 230 235 240
Arg Asp Ser Ser Gly Asn His Val Val Phe Gly Gly Gly Thr Lys Leu
245 250 255
Thr Val Leu Gly Ala Ala Ala Glu Gln Lys Leu Ile Ser Glu Glu Asp
260 265 270
8
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Leu
Asn
Gly
Ala
Ala
275
<210>26
<211>464
<212>PRT
<213>Homo sapiens
<400> 26
Met Ala Trp Ala Leu Leu Leu Leu Thr Leu Leu Thr Gln Asp Thr Gly
1 5 10 15
Ser Trp A1a Asp I1e Gln Leu Val Glu Ser Gly Gly Gly Val Val Arg
20 25 30
Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe
35 40 45
Asp Asp Tyr Gly Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu
50 55 60
Glu Trp Val Ser Gly Ile Asn Trp Asn Gly Gly Ser Thr Gly Tyr Ala
65 70 75 80
Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn
85 90 95
Ser Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val
100 105 110
Tyr Tyr Cys Ala Arg Met Arg Ala Pro Val Ile Trp Gly Gln Gly Thr
115 120 125
Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe Pro
130 135 140
Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala Leu Gly
145 150 155 160
Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp Asn
165 170 175
Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gln
180 185 190
Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser Ser
195 200 205
Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys Pro Ser
210 2l5 220
9
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Asn Thr Lys Val Asp Lys Arg Val~Glu Pro Lys Ser Cys Asp Lys Thr
225 230 235 240
His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser
245 250 255
Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg
260 265 270
Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro
275 280 285
Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala
290 295 300
Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val
305 310 315 320
Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr
325 330 335
Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr
340 345 350
Ile gPr Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu
355 360 365
Pro Pro Ser Arg Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys
370 375 380
Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser
385 390 395 400
Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Ser Pro Val Leu Asp
405 410 415
Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr val Asp Lys Ser
420 425 430
Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala
435 440 445
Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Leu Gly Lys
450 455 460
<210>27
<211>233
<212>PRT
<213>Homo sapiens
<400> 27
Met Ala Trp Ala Leu Leu Leu Leu Thr Leu Leu Thr Gln Asp Thr Gly
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
1 5 10 15
Ser Trp Ala Asp Ala Glu Leu Thr Gln Asp Pro Ala Val Ser Val Ala
20 25 30
Leu Gly Gln Thr Val Arg Ile Thr Cys Gln Gly Asp 5er Leu Arg Ser
35 40 45
Tyr Tyr Ala Ser Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Val Leu
50 55 60
Val Ile Tyr Gly Lys Asn Asn Arg Pro Ser Gly Ile Pro Asp Arg Phe
65 70 75 80
Ser Gly Ser Ser Ser Gly Asn Thr Ala Ser Leu Thr Ile Thr Gly Ala
85 90 95
Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Asn Ser Arg Asp Ser Ser
100 105 110
Gly Asn His Val Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Gly
115 120 225
Gln Pro Lys Ala Ala Pro Ser Val Thr Leu Phe Pro Pro Ser Ser Glu
130 135 140
Glu Leu Gln Ala Asn Lys Ala Thr Leu Val Cys Leu Ile Ser Asp Phe
145 150 155 160
Tyr Pro Gly Ala Val Thr Val Ala Trp Lys Ala Asp Ser Ser Pro Val
165 170 175
Lys Ala Gly Val Glu Thr Thr Thr Pro Ser Lys Gln Ser Asn Asn Lys
180 185 190
Tyr Ala Ala Ser Ser Tyr Leu Ser Leu Thr Pro Glu Gln Trp Lys Ser
195 200 205
His Lys Ser Tyr Ser Cys Gln Val Thr His Glu Gly Ser Thr Val Glu
210 215 220
Lys Thr Val Ala Pro Thr Glu Cys Ser
225 230
<210> 28
<211> 11
<212> PRT
<213> Homo Sapiens
<400> 28
Phe Leu Thr Tyr Asn Ser Tyr Glu Val Pro Thr
l 5 10
11
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
<210> 29
<211> 9
<212> PRT
<213> Homo Sapiens
<400> 29
Thr Asn Trp Tyr Leu Arg Pro Leu Asn
1 5
<210> 30
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 30
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Thr Val Lys Ile Ser Cys Lys Val Ser Gly Tyr Thr Phe Thr Asp Tyr
20 25 30
Tyr Met His Trp Val Gln G1n Ala Pro Gly Lys Gly Leu Glu Trp Met
35 40 45
Gly Leu Val Asp Pro Glu Asp Gly Glu Thr Ile Tyr Ala Glu Lys Phe
50 55 60
Gln Gly Arg Val Thr Ile Thr Ala Asp Thr Ser Thr Asp Thr Ala Tyr
65 70 ~ 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Thr
<210> 31
<211> 98
<212> PRT
12
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
<213> Homo Sapiens
<400> 31
Gln Val GIn Leu VaI Gln Ser Gly Ala Glu Val Lys Lys Pro GIy Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Ile Phe Thr Asp Tyr
20 25 30
Tyr Met His Trp Val Arg Gln Ala Pro Gly Gln Glu Leu Gly Trp Met
35 40 45
Gly Arg Ile Asn Pro Asn Ser Gly Gly Thr Asn Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Met Thr Arg Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Thr Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr AIa Thr Tyr Tyr Cys
85 90 95
Ala Arg
<210> 32
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 32
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Val Ser Gly Tyr Thr Leu Thr Glu Leu
20 25 30
Ser Met His Trp Val Arg Gln Ala Pro Gly Lys GIy Leu Glu Trp Met
35 40 ' 45
GIy Gly Phe Asp Pro Glu Asp Gly Glu Thr Tle Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Met Thr Glu Asp Thr Ser Thr Asp Thr Ala Tyr
65 ~ 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
AIa Thr
13
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
<210> 33
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 33
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Gly Tyr
20 25 30
Tyr Met His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Arg Ile Asn Pro Asn Ser Gly Gly Thr Asn Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Ser Thr Arg Asp Thr Ser I1e Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Val Val Tyr Tyr Cys
85 90 95
Ala Arg
<210> 34
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 34
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Gly Tyr
20 25 30
Tyr Met His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Trp Ile Asn Pro Asn Ser Gly Gly Thr Asn Tyr Ala Gln Lys Phe
50 55 60
14
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Gln Gly Arg Val Thr Met Thr Arg Asp Thr Ser Ile Ser Thr Ala Tyr
65 ' 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 ~ 95
Ala Arg
<210> 35
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 35
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 25
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Gly Tyr
20 25 30
Tyr Met His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Trp Ile Asn Pro Asn Ser Gly Gly Thr Asn Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Trp Va1 Thr Met Thr Arg Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 ' 90 95
Ala Arg
<2l0> 36
<211> 98
<212> PRT
<213> Homo Sapiens
<220>
<22l> X
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
<222> (1) . . (98)
<223> Xaa
<400> 36
Gln Val Gln Leu Val Gln Ser Gly Ala G1u Val Lys Lys Leu Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Gly Tyr
20 25 30
Tyr Met His Trp Val Xaa Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 ' 45
Gly Trp Ile Asn Pro Asn Ser Gly Gly Thr Asn Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Met Thr Arg Asp Thr Ser IIe Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg
<210> 37
<211> 98
<2l2> PRT
<213> Homo Sapiens
<400> 37
Gln Val Gln Leu Val Gln Ser Gly Ala G1u Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Cys Met His Trp Val Arg Gln Val His Ala Gln Gly Leu Glu Trp Met
35 40 45
Gly Leu Val Cys Pro Ser Asp Gly Ser Thr Ser Tyr Ala Gln Lys Phe
50 55 60
Gln Ala Arg Val Thr Ile Thr Arg Asp Thr Ser Met Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Met Tyr Tyr Cys
85 90 95
16
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Val Arg
<210> 38
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 38
Gln Met Gln Leu Val Gln Ser Gly Pro Glu Val Lys Lys Pro Gly Thr
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Phe Thr Phe Thr Ser Ser
20 25 30
Ala Val Gln Trp Val Arg Gln Ala Arg Gly Gln Arg Leu Glu Trp Ile
35 ' 40 45
Gly Trp 21e Val Val Gly Ser Gly Asn Thr Asn Tyr Ala Gln Lys Phe
50 55 60
Gln Glu Arg Val Thr Ile Thr Arg Asp Met Ser Thr Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Ala
<210> 39
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 39
Gln Val Gln Leu Va1 Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser
1 . 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr
20 25 30
Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
17
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Gly Gly Ile,Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg
<210> 40
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 40
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr
20 25 30
Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly~Leu Glu Trp Met
35 40 45
Gly Arg Ile Ile Pro Ile Leu Gly Ile Ala Asn Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Ile Thr Ala Asp Lys Ser Thr Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr A1a Val Tyr Tyr Cys
85 90 95
Ala Arg
<210> 41
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 41
18
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr
20 25 30
Ala Met His Trp Val Arg Gln Ala Pro Gly Gln Arg Leu Glu Trp Met
35 40 45
Gly Trp Ile Asn Ala Gly Asn Gly Asn Thr Lys Tyr Ser Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Ile Thr Arg Asp Thr Ser Ala Ser Thr Ala Tyr
65 70~ 75 80
Met Glu Leu Ser Ser Leu Arg Ser GIu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg
<210> 42
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 42
Gln Val G1n Leu Val Gln Ser G1y Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr
20 25 30
Ala Met His Trp Val Arg Gln Ala Pro Gly Gln Arg Leu Glu Trp Met
35 40 45
Gly Trp Ser Asn Ala Gly Asn Gly Asn Thr Lys Tyr Ser Gln Glu Phe
50 55 60
Gln Gly Arg Val Thr Ile Thr Arg Asp Thr Ser Ala Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Met Ala Val Tyr Tyr Cys
85 90 95
Ala Arg
<210> 43
19
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
<211> 98
<212> PRT
<213> Homo sapiens
<400> 43
Gln Val Gln Leu Val Gln Ser Gly Ser Glu Leu Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr
20 25 30
Ala Met Asn Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Trp Ile Asn Thr Asn Thr Gly Asn Pro Thr Tyr Ala Gln Gly Phe
50 55 60
Thr Gly Arg Phe Val Phe Ser Leu Asp Thr Ser Val Ser Thr Ala Tyr
65 70 75 80
Leu Gln Ile Cys Ser Leu Lys Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg
<210> 44
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 44
Gln Val Gln Leu Val Gln Ser Gly Ser Glu Leu Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr
20 25 30
Ala Met Asn Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Trp Ile Asn Thr Asn Thr Gly Asn Pro Thr Tyr Ala Gln Gly Phe
50 55 60
Thr Gly Arg Phe Val Phe Ser Leu Asp Thr Ser Val Ser Thr Ala Tyr
65 70 75 80
Leu Gln Ile Ser Ser Leu Lys Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Ala Arg
<210> 45
<211> 98
<212> PRT
<213> Homo sapiens
<400> 45
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr 5er Tyr
20 25 30
Asp I1e Asn Trp Val Arg Gln Ala Thr Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Trp Met Asn Pro Asn Ser Gly Asn Thr Gly Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Met Thr Arg Asn Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg
<210> 46
<211> 98
<212> PRT
<213> Homo sapiens
<400> 46
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr
20 25 30
Gly Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
21
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Gly Trp Ile Ser Ala Tyr Asn Gly Asn Thr Asn Tyr Ala Gln Lys Leu
50 55 60
Gln Gly Arg Val Thr Met Thr Thr Asp Thr Ser Thr Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Arg Ser Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
A1a Arg
<210> 47
<211> 92
<212> PRT
<213> Homo Sapiens
<4nn~ 47
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr
20 25 30
Gly Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Trp Ile Ser Ala Tyr Asn Gly Asn Thr Asn Tyr Ala Gln Lys Leu
50 55 60
Gln Gly Arg Val Thr Met Thr Thr Asp Thr Ser Thr Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Arg Ser Leu Arg Ser Asp Asp Thr Ala
85 90
<210> 48
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 48
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
22
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr
20 25 30
Tyr Met His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 . 45
Gly Ile Ile Asn Pro Ser Gly G1y Ser Thr Ser Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Met Thr Arg Asp Thr Ser Thr Ser Thr Val Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg
<210> 49
<211> 98
<212> PRT
<213> Homo sapi,ens
<400> 49
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Asn Ser Tyr
20 25 30
Tyr Met His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Ile Ile Asn Pro Ser Gly Gly Ser Thr Ser Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Met Thr Arg Asp Thr Ser Thr Ser Thr Val Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser GIu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg
<210> 50
<211> 98
23
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
<212> PRT
<213> Homo sapiens
<400> 50
Gln Met Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Thr Gly 'Ser
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Tyr Arg
20 25 ~ 30
Tyr Leu His Trp Val Arg Gln Ala Pro Gly Gln Ala Leu Glu Trp Met
35 40 45
Gly Trp Ile Thr Pro Phe Asn Gly Asn Thr Asn Tyr Ala Gln Lys Phe
50 55 60
Gln Asp Arg Val Thr Ile Thr Arg Asp Arg Ser Met Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Met Tyr Tyr Cys
85 90 95
Ala Arg
<210> 51
<211> 98
<212> PRT
<213> Homo sapiens
<400> 5l
Gln Met Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Thr Gly Ser
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Tyr Arg
20 25 30
Tyr Leu His Trp Val Arg Gln Ala Pro Gly Gln Ala Leu Glu Trp Met
35 40 45
Gly Trp Ile Thr Pro Phe Asn Gly Asn Thr Asn Tyr Ala Gln Lys Phe
50 55 60
Gln Asp Arg Val Thr Ile Thr Arg Asp Arg Ser Met Ser Thr Ala Tyr
65 - 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Met Tyr Tyr Cys
85 90 95
24
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Ala Arg
<210> 52
<211> 96
<212> PRT
<213> Homo Sapiens
<400> 52
Gln Val Thr Leu Lys Glu Ser Gly Pro Val Leu Val Lys Pro Thr Glu
1 5 10 15
Thr Leu Thr Leu Thr Cys Thr Val Ser Gly Phe Ser Leu Ser Asn Ala
20 25 30
Arg Met Gly Val Ser Trp Ile Arg Gln Pro Pro Gly Lys Ala Leu Glu
35 40 45
Trp Leu Ala His Ile Phe Ser Asn Asp Glu Lys Ser Tyr Ser Thr Ser
50 55 60
Leu Lys Ser Arg Leu Thr Ile Ser Lys Asp Thr Ser Lys Ser Gln Val
65 70 75 80
Va1 Leu Thr Met Thr Asn Met Asp Pro Val Asp Thr Ala Thr Tyr Tyr
85 90 95
<210> 53
<211> 99
<212> PRT
<213> Homo Sapiens
<400> 53
Gln Ile Thr Leu Lys Glu Ser Gly Pro Thr Leu Val Lys Pro Thr Gln
1 5 10 15
Thr Leu Thr Leu Thr Cys Thr Phe Ser Gly Phe Ser Leu Ser Thr Ser
20 25 30
Glu Trp Cys Gly Trp Ile Arg Gln Pro Pro Gly Lys Ala Leu Glu Trp
35 40 45
Leu Ala Leu Ile Tyr Trp Asn Asp Asp Lys Arg Tyr Ser Pro Ser Leu
50 55 60
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Lys Ser Arg Leu Thr Ile Thr Lys Asp Thr Ser Lys Asn Gln Val Val
65 70 75 80
Leu Thr Met Thr Asn Met Asp Pro Val Asp Thr Ala Thr Tyr Tyr Cys
85 90 95
Ala His Arg
<210> 54
<211> 96
<212> PRT
<213> Homo Sapiens
<400> 54
Gln Val Thr Leu Arg Glu Ser Gly Pro Ala Leu Val Lys Pro Thr Gln
1 5 10 15
Thr Leu Thr Leu Thr Cys Thr Phe Ser Gly Phe Ser Leu Ser Thr Ser
20 25 30
Gly Met Cys Val Ser Trp Ile Arg Gln Pro Pro Gly Lys Ala Leu Glu
35 40 45
Trp Leu Ala Leu Ile Asp Trp Asp Asp Asp Lys Tyr Tyr Ser Thr Ser
50 55 60
Leu Lys Thr Arg Leu Thr Ile Ser Lys Asp Thr Ser Lys Asn Gln Val
65 70 75 80
Val Leu Thr Met Thr Asn Met Asp Pro Val Asp Thr Ala Thr Tyr Tyr
85 90 95
<210> 55
<211> 96
<212> PRT
<213> Hamo sapiens
<400> 55
Gln Val Thr Leu Lys Glu Ser Gly Pro Ala Leu Val Lys Pro Thr Gln
1 5 10 15
Thr Leu Thr Leu Thr Cys Thr Phe Ser Gly Phe Ser Leu Ser Thr Ser
20 25 30
Gly Met Arg Val Ser Trp Ile Arg Gln Pro Pro Gly Lys Ala Leu Glu
35 40 45
26
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Trp Leu Ala Arg Ile Asp Trp Asp Asp Asp Lys Phe Tyr Ser Thr Ser
50 55 60
Leu Lys Thr Arg Leu Thr Ile Ser Lys Asp Thr Ser Lys Asn Gln Val
65 70 '75 80
Val Leu Thr Met Thr Asn Met Asp Pro Val Asp Thr Ala Thr Tyr Tyr
85 90 95
<210> 56
<211> 100
<212> PRT
<213> Homo sapiens
<400> 56
Gln Ile Thr Leu Lys Glu Ser Gly Pro Thr Leu Val Lys Pro Thr Gln
1 5 10 15
Thr Leu Thr Leu Thr Cys Thr Phe Ser Gly Phe Ser Leu Ser Thr Ser
20 25 30
Gly Val Gly Val Gly Trp Ile Arg Gln Pro Pro Gly Lys Ala Leu Glu
35 40 45
Trp Leu Ala Leu Ile Tyr Trp Asn Asp Asp Lys Arg Tyr Ser Pro Ser
50 55 60
Leu Lys Ser Arg Leu Thr 21e Thr Lys Asp Thr Ser Lys Asn Gln Val
65 70 75 80
Val Leu Thr Met Thr Asn Met Asp Pro Val Asp Thr Ala Thr Tyr Tyr
85 90 95
Cys Ala His Arg
100
<210> 57
<211> 100
<212> PRT
<213> Homo Sapiens
<400> 57
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp His
27
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
20 25 30
Tyr Met Asp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Gly Arg Thr Arg Asn Lys Ala Asn Ser Tyr Thr Thr Glu Tyr Ala Ala
50 55 60
Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Asn Ser
65 70 75 80
Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr Glu Asp Thr Ala Val Tyr
85 90 95
Tyr Cys Ala Arg
100
<210> 58
<211> 100
<212> PRT
<213> Homo Sapiens
<400> 58
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp His
20 25 30
Tyr Met Ser Trp Val Arg Gln Ala Gln Gly Lys Gly Leu Glu Leu Val
35 40 45
Gly Leu Ile Arg Asn Lys Ala Asn Ser Tyr Thr Thr Glu Tyr Ala Ala
50 55 60
Ser Val Lys Gly Arg Leu Thr Ile Ser Arg Glu Asp Ser Lys Asn Thr
65 70 75 80
Leu Tyr Leu Gln Met Ser Ser Leu Lys Thr Glu Asp Leu Ala Val Tyr
85 90 95
Tyr Cys Ala Arg
100
<210> 59
<211> 100
<212> PRT
<213> Homo Sapiens
as
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
<400> 59
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp His
20 25 30
Tyr Met Ser Trp Val Arg Gln Ala Gln G1y Lys Gly Leu Glu Leu Val
35 40 45
G1y Leu Ile Arg Asn Lys Ala Asn Ser Tyr Thr Thr Glu Tyr Ala Ala
50 55 60
Ser Val Lys Gly Arg Leu Thr Ile Ser Arg Glu Asp Ser Lys Asn Thr
65 70 75 80
Leu Tyr Leu Gln Met Ser Ser Leu Lys Thr Glu Asp Leu Ala Val Tyr
85 90 95
Tyr Cys Ala Arg
100
<210> 60
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 60
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Arg
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr
20 25 30
Ala Met His Trp Va1 Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Gly Ile Ser Trp Asn Ser Gly Ser Ile Gly Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Leu Tyr Tyr Cys
85 90 95
Ala Lys
29
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
<210> 61
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 61
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Arg Pro Gly Gly
1 5 10 25
Ser Leu Arg Leu Ser Cys Ala Aha Ser Gly Phe Thr Phe Asp Asp Tyr
20 25 30
Gly Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Gly Ile Asn Trp Asn Gly Gly Ser Thr Gly Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Leu Tyr His Cys
85 90 95
Ala Arg
<210> 62
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 62
Glu Val Gln Leu Val Glu Ser Gly G1y Val Val Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr
20 25 30 ,
Thr Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Leu Ile Ser Trp Asp Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Ser Leu Tyr
65 70 75 80
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Leu Gln Met Asn Ser Leu Arg Thr Glu Asp Thr Ala Leu Tyr Tyr Cys
85 90 95
Ala Lys
<210> 63
<211>. 98
<212> PRT
<213> Homo Sapiens
<400> 63
Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Tyr
20 25 30
Tyr Met Ser Trp Ile Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Tyr Ile Ser Ser Ser Gly Ser Thr Ile Tyr Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg AIa Glu Asp Thr AIa Val Tyr Tyr Cys
85 90 95
Ala Arg
<210> 64
<211> 100
<212> PRT
<213> Homo Sapiens
<400> 64
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asn Ala
20 25 30
Trp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
31
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
35 40 45
Gly Arg Ile Lys Ser Lys Thr Asp Gly Gly Thr Thr Asp Tyr Ala Ala
50 55 60
Pro Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Asn Thr
65 70 75 80
Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr Glu Asp Thr Ala Val Tyr
85 90 95
Tyr Cys Thr Thr
100
<210> 65
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 65
Glu Va1 Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
Z 5 10 15
Ser Leu Arg Leu Ser Cys Pro Ala 5er Gly Phe Thr Phe Ser Asn His
20 25 30
Tyr Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Tyr Ile Ser Gly Asp Ser Gly Tyr Thr Asn Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Asn Asn Ser Pro Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Val Lys
<210> 66
<211> 98
<212> PRT
<213> Homo sapiens
<400> 66
32
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asn His
20 25 30
Tyr Thr Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Tyr Ser Ser Gly Asn Ser Gly Tyr Thr Asn Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn 5er Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Val Lys
<210> 67
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 67
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asn Ser
20 25 30
Asp Met Asn Trp Val His Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Gly Val Ser Trp Asn Gly Ser Arg Thr His Tyr Ala Asp Ser Val
50 55~ 60
Lys Gly Arg Phe Ile Ile Ser Arg Asp Asn Ser Arg Asn Thr Leu Tyr
65 70 75 80
Leu Gln Thr Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Val Arg
<210> 68
<211> 97
33
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
<212> PRT
<213> Homo Sapiens
<400> 68
Glu Val Gln Leu Val Glu Thr Gly Gly Gly Leu Ile Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Val Ser Ser Asn
20 25 30
Tyr Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Val Ile Tyr Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys
50 55 60
Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu
65 70 75 80
Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala
85 90 95
Arg
<210> 69
<211> 97
<212> PRT
<213> Homo Sapiens
<400> 69
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Val Ser Ser Asn
20 25 30
Tyr Met Ser Trp Val Arg Gln A1a Pro Gly Lys Gly Leu Glu Trp Val
35 40 ' 45
Ser Val Ile Tyr Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys
50 55 60
Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu
65 70 75 80
Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala
85 90 95
34
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Arg
<210> 70
<211> 97
<212> PRT
<213> Homo Sapiens
<400> 70
Glu Val Gln Leu Val His Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Gly Ser Gly Phe Thr Phe Ser Sex Tyr
20 25 30
Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Va1
35 40 45
Ser Ala Ile Gly Thr Gly Gly Gly Thr Tyr Tyr Ala A'sp Ser Val Lys
50 55 60
Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr Leu
65 70 75 80
Gln Met Asn Ser Leu Arg Ala Glu Asp Met Ala Val Tyr Tyr Cys Ala
85 90 95
Arg
<210> 71
<211> 97
<212> PRT
<213> Homo Sapiens
<400> 71
Glu Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu-Arg Leu Ser Cys AIa Gly Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Ala Met His Trp Val Arg Gln Ala Pro GIy Lys Gly Leu Glu Trp Val
35 40 45
Ser Ala Ile Gly Thr Gly Gly Gly Thr Tyr Tyr Ala Asp Ser Val Lys
50 55 60
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr Leu
65 70 75 80
Gln Met Asn Ser Leu Arg Ala Glu Asp Met Ala Val Tyr Tyr Cys Ala
85 90 95
Arg
<210> 72
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 72
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ser Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Tyr Val
35 40 45
Ser Ala Ile Ser Ser Asn Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
Val Gln Met Ser Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Val Arg
<210> 73
<211> 35
<212> PRT
<213> Homo Sapiens
<400> 73
Thr Phe Ser Ser Tyr Ala Met His Trp Val Arg Gln Ala Pro Gly Lys
1 5 10 15
Gly Leu Glu Tyr Val Ser Ala Ile Ser Ser Asn Gly Gly Ser Thr Tyr
36
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
20 25 30
Tyr Ala Asp
<210> 74
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 74
Gln Val Gln Leu Val Glu Ser G1y Gly Gly Val Val Gln Pro Gly Arg
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Sex Tyr
20 25 30
Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ala Val Ile Ser Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg
<210> 75
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 75
Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
37
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Ala Val Ile Ser Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg
<210> 76
<21l> 98
<212> PRT
<213> Homo sapiens
<400> 76
Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg
l 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ala Val Ile Ser Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg
<210> 77
<211> 98
<212> PRT
<213> Homo sapiens
<400> 77
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
38
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Sex Tyr
20 25 30
Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 ' 45
Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Lys
<210> 78
<211> 97
<212> PRT
<213> Homo Sapiens
<400> 78
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Asp Met His Trp Val Arg Gln Ala Thr Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Ala Ile Gly Thr Ala Gly Asp Thr Tyr Tyr Pro Gly Ser Val Lys
50 55 60
Gly Arg Phe Thr Ile Ser Arg Glu Asn Ala Lys Asn Ser Leu Tyr Leu
65 70 75 80
Gln Met Asn Ser Leu Arg Ala Gly Asp Thr Ala Val Tyr Tyr Cys Ala
85 90 95
Arg
<210> 79
<211> 98
<212> PRT
39
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
<213> Homo sapiens
<400> 79
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 - 25 30
Glu Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Tyr Ile Ser Ser Ser Gly Ser Thr Ile Tyr Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Alw Ara
<210> 80
<211> 98
<212> PRT
<213> Homo sapiens
<400> 80
Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ala Val Ile Ser Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val
50 55 ' 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Ly.s
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
<210> 81
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 81
Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ala Val Ile Trp Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg
<210> 82
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 82
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
Z 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Ser Met. Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Tyr Ile Ser Ser Ser Ser Ser Thr Ile Tyr Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr
41
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Asp Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg
<210> 83
<211> 97
<212> PRT
<213> Homo Sapiens
<400> 83
Glu Asp Gln Leu Val Glu Ser Gly G1y Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Pro Ser Cys Ala Ala Ser Gly Phe Ala Phe Ser Ser Tyr
20 25 30
Val Leu His Trp Val Arg Arg Ala Pro G1y Lys Gly Pro Glu Trp Val
35 40 45
Ser Ala Ile Gly Thr Gly Gly Asp Thr Tyr Tyr Ala Asp Ser Val Met
50 55 60
Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Lys Ser Leu Tyr Leu
65 70 75 80
Gln Met Asn Ser Leu Ile Ala Glu Asp Met Ala Val Tyr Tyr Cys Ala
85 90 95
Arg
<210> 84
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 84
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
42
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Trp Met His,Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Val Trp Val
35 40 45
Ser Arg Ile Asn Ser Asp Gly Ser Ser Thr Thr Tyr Ala Asp 5er Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg
<210> 85
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 85
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 20 15
Ser Leu Arg Leu Ser Cys Ala Ala 5er Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Trp Met Ser Trp Va1 Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ala Asn Ile Lys Gln Asp Gly Ser Glu Lys Tyr Tyr Val Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 ~ 90 95
Ala Arg
<210> 86
<211> 97
<212> PRT
<213> Homo Sapiens
<400> 86
43
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Gln Val Gln Leu Gln Gln Trp Gly Ala Gly Leu Leu Lys Pro Ser Glu
I , 5 10 1~
Thr Leu Ser Leu Thr Cys Ala Val Tyr Gly Gly Ser Phe Ser Gly Tyr
20 25 30
Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile
35 40 45
Gly Glu Ile Ile His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu Lys
50 55 60
Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe Ser Leu
65 70 75 80
Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala
85 90 95
Arg
<210> 87
<211> 97
<212> PRT
<213> Homo sapiens
<400> 87
Gln Val Gln Leu Gln Gln Trp Gly Ala Gly Leu Leu Lys Pro Ser Glu
1 5 10 15
Thr Leu Ser Leu Thr Cys Ala Val Tyr Gly Gly Ser Phe Ser Gly Tyr
20 25 30
Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile
35 40 45
Gly Glu Ile Asn His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu Lys
50 55 60
Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe Ser Leu
65 70 75 80
Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala,,Val Tyr Tyr Cys Ala
85 90 95
Arg
<210> 88
<211> 97
44
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
<212> PRT
<213> Homo Sapiens
<400> 88
Gln Val Gln Leu Gln Gln Trp Gly Ala Gly Leu Leu Lys Pro Ser Glu
1 5 10 15
Thr Leu Ser Leu Thr Cys Ala Val Tyr Gly Gly Ser Val Ser Gly Tyr
20 ~ 25 30
Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile
35 40 45
Gly Tyr Ile Tyr Tyr Ser Gly Ser Thr Asn Asn Asn Pro Ser Leu Lys
50 55 60
Ser Arg A1a Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe Ser Leu
65 70 75 80
Asn Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Cys Cys Ala
85 90 95
Arg
<210> 89
<211> 99
<212> PRT
<213> Homo Sapiens
<400> 89
Gln Leu Gln Leu Gln Glu Ser Gly Ser Gly Leu Val Lys Pro Ser Gln
1 5 10 15
Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Gly
20 25 30
Gly Tyr Ser Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu
35 40 45
Trp Ile Gly Tyr Ile Tyr His Ser Gly Ser Thr Tyr Tyr Asn Pro Ser
50 55 60
Leu Lys Ser Arg Val Thr Ile Ser Val Asp Arg Ser Lys Asn Gln Phe
65 70 75 80
Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr
85 90 95
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Cys Ala Arg
<210> 90
<211> 99
<212> PRT
<213> Homo Sapiens
<400> 90
GIn Va1 Gln Leu Gln Glu Ser GIy Pro Gly Leu Val Lys Pro Ser Gln
1 5 10 15
Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser Ser Gly
20 25 30
Gly Tyr Tyr Trp Ser Trp Ile Arg Gln His Pro Gly Lys Gly Leu Glu
35 40 45
Trp TlP Gly Tyr Ile Tyr Tyr Ser Gly Ser Thr Tyr Tyr Asn Pro Ser
50 55 60
Leu Lys Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe
65 70 75 80
Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr
85 90 95
Cys Ala Arg
<210> 91
<211> 99
<212> PRT
<213> Homo Sapiens
<400> 91
Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser GIu
1 5 10 15
Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser VaI Ser Ser GIy
20 25 30
Ser Tyr Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu
35 40 .45
Trp Ile Gly Tyr Ile Tyr Tyr Ser Gly Ser Thr Asn Tyr Asn Pro Ser
50 55 60
46
Ser Leu Lys Leu Ser Ser
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Leu Lys Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe
65 70 75 80
Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr
85 90 95
Cys Ala Arg
<210> 92
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 92
Gln Val Gln Leu GIn Glti Ser Gly Pro Gly Leu Val Lys Pro Ser Glu
1 5 10 15
Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Tyr Ser Ile Ser Ser Gly
20 25 30
Tyr Tyr Trp Gly Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu G1u Trp
35 40 45
Ile Gly Ser Ile Tyr His Ser Gly Ser Thr Tyr Tyr Asn Pro Ser Leu
50 55 60
Lys Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe Ser
65 70 75 80
Leu Lys Leu~Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys
85 90 95
AIa Arg
<210> 93
<211> 98
<212> PRT
<2l3> Homo Sapiens
<400> 93
Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu
1 5 10 15
Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Tyr Ser Ile Ser Ser Gly
47
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
20 25 30
Tyr Tyr Trp Gly Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp
35 40 45
Ile Gly Ser Ile Tyr His Ser Gly Ser Thr Tyr Tyr Asn Pro Ser Leu
50 55 60
Lys Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe Ser
65 70 75 80
Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys
85 90 95
A1a Arg
<210> 94
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 94
Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Asp
1 5 10 15
Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Tyr Ser Ile Ser Ser Ser
20 25 30
Asn Trp Trp Gly Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp
35 40 45
Ile Gly Tyr Ile Tyr Tyr Ser Gly Ser Thr Tyr Tyr Asn Pro Ser Leu
50 55 60
Lys Ser Arg Val Thr Met Ser Val Asp Thr Ser Lys Asn Gln Phe Ser
65 70 75 80
Leu Lys Leu Ser Ser Val Thr Ala Val Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg
<210> 95
<211> 98
<212> PRT
<213> Homo Sapiens
48
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
<400> 95
Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gln
1 5 10 15
Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Tyr Ser Ile Ser Ser Ser
20 25 30
Asn Trp Trp Gly Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp
35 40 45
Ile Gly Tyr Ile Tyr Tyr Ser Gly Ser Ile Tyr Tyr Asn Pro Ser Leu
50 55 60
Lys Ser Arg Val Thr Met Ser Val Asp Thr Ser Lys Asn Gln Phe Ser
65 70 75 80
Leu Lys Leu Ser Ser Val Thr Ala Val Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg
<210> 96
<211> 98
<212> PI2T
<213> Homo sapiens
<400> 96
Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu
1 5 10 15
Thr Leu Ser Leu Thr Cys Val Val Ser Gly Gly~Ser Tle Ser Ser Ser
20 25 30
Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp
35 40 45
Ile Gly Glu Ile Tyr His Ser Gly Asn Pro Asn Tyr Asn Pro Ser Leu
50 55 60
Lys Ser Arg Val Thr Ile Ser Ile Asp Lys Ser Lys Asn Gln Phe Ser
65 ~ 70 75 80
Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg
49
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
<210> 97
<211> 98
<2l2> PRT
<213> Homo Sapiens
<400> 97
Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu
1 5 10 15
Thr Leu Ser Leu Thr Cys Val Val Ser Gly Gly Ser Ile Ser Ser Ser
20 25 ~ 30
Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu G1u Trp
35 40 45
Ile Gly Glu Ile Tyr His Ser Gly Ser Pro Asn Tyr Asn Pro Ser Leu
50 55 60
Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser
65 70 75 80
Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg
<210> 98
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 98
Gln Va1 Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Pro Gly
1 5 ZO 15
Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser
20 25 30
Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp
35 40 45
Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu
50 55 60
Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser
65 70 75 80
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Cys Cys
85 90 95
Ala Arg
<210>99
<211>98
<212>PRT
<213>Homo Sapiens
<400> 99
Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly
1 5 10 15
Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser
20 25 30
Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp
35 40 45
Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu
50 55 60
Lys Ser Arg Val Thr Ile 5er Val Asp Lys Ser Lys Asn Gln Phe Ser
65 70 75 80
Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg
<210> 100
<211> 99
<212> PRT
<213> Homo Sapiens
<400> 100
Gln Leu Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu
1 5 10 15
Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser 5er Ser
20 25 30
Ser Tyr Tyr Trp Gly Trp I1e Arg Gln Pro Pro Gly Lys Gly Leu Glu
51
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
35 40 45
Trp Ile Gly Ser Ile Tyr Tyr Ser Gly Ser Thr Tyr Tyr Asn Pro Ser
50 55 . 60
Leu Lys Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe
65 70 75 80
Ser Leu Lys Leu Ser Ser Val Thr,Ala Ala Asp Thr Ala Val Tyr Tyr
85 90 95
Cys Ala Arg
<210> 101
<211> 99
<2I2> PRT
<213> Homo Sapiens
<400~ 101
Gln Leu Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu
1 5 10 15
Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser Ser Ser
20 25 30
Ser Tyr Tyr Trp Gly Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu
35 40 45
Trp Ile Gly Ser Ile Tyr Tyr Ser Gly Ser Thr Tyr Tyr Asn Pro Ser
50 55 60
Leu Lys Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn His Phe
65 70 75 80
Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr
85 90 95
Cys Ala Arg
<210> 102
<211> 97
<212> PRT
<213> Homo Sapiens
<400> 102
52
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu
1 5 10 15
Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser Ser Tyr
20 25 30
Tyr Trp Ser Trp Ile Arg Gln Pro Ala Gly Lys Gly Leu Glu Trp Ile
35 40 45
Gly Arg Ile Tyr Thr Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu Lys
50 55 60
Ser Arg Val Thr Asn Ser Val Asp Thr Ser Lys Asn Gln Phe Ser Leu
65 70 75 80
Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala
85 90 95
Arg
<210> 103
<211> 97
<212> PRT
<213> Homo sapiens
<400> 103
Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu
1 5 10 l5
Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser Ser Tyr
20 25 30
Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile
35 40 45
Gly Tyr Ile Tyr Tyr Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu Lys
50 55~ 60
Ser Arg Val Thr Ile 5er Val Asp Thr Ser Lys Asn Gln Phe Ser Leu
65 70 75 80
Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala
85 90 95
Arg
<210> 104
<211> 97
53
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
<212> PRT
<213> Homo Sapiens
<400> 104
Gln Val Gln Leu G1n Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu
1 5 10 15
Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Val Ser Ser Tyr
20 25 30
Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile
35 40 45
Gly Tyr Ile Tyr Tyr Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu Lys
50 55 60
Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Met Gln Phe Ser Leu
65 70 75 80
Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala
85 90 95
Arg
<210> 105
<211> 97
<212> PRT
<213> Homo Sapiens
<400> 105
Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Asp
1 5 10 15
Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser Ser Tyr
20 25 30
Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile
35 40 45
Gly Tyr Ile Tyr Tyr Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu Lys
50 55 60
Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe Ser Leu
65 70 75 80
Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala
85 90 95
54
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Arg
<210> 106
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 106
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Glu
1 5 10 15
Ser Leu Lys Ile Ser Cys Lys Gly Ser Gly Tyr Ser Phe Thr Ser Tyr
20 25 30
Trp Tle Gly Trp Val Arg Gln Met Pro Gly Lys Gly Leu Glu Trp Met
35 40 45
Gly Ile Ile Tyr Pro Gly Asp Ser Asp Thr Arg Tyr Ser Pro Ser Phe
50 55 60
Gln Gly Gln Val Thr Ile Ser Ala Asp Lys Ser Ile Ser Thr Ala Tyr
65 70 75 80
Leu Gln Trp Ser 5er Leu Lys Ala Ser Asp Thr Ala Met Tyr Tyr Cys
85 90 95
Ala Arg
<210> 107
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 107
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Glu
1 5 10 15
Ser Leu Lys Ile Ser Cys Lys Gly Ser Gly Tyr Ser Phe Thr Ser Tyr
20 25 30
Trp Ile Gly Trp Val Arg Gln Met Pro Gly Lys Gly Leu Glu Trp Met
35 40 45
Gly Ile Ile Tyr Pro Gly Asp Ser Asp Thr Arg Tyr Ser Pro Ser Phe
50 55 60
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Gln Gly Gln Val Thr Ile Ser Ala Asp Lys Pro Ile Ser Thr Ala Tyr
65 70 75 80
Leu Gln Trp Ser Ser Leu Lys Ala Ser Asp Thr Ala Met Tyr Tyr Cys
85 90 95
Ala Arg
<210> 108
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 108
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Glu
Z 5 10 15
Ser Leu Lys Ile Ser Cys Lys Gly Ser Gly Tyr Ser Phe Thr Ser Tyr
20 25 30
Trp Ile Gly Trp Val Arg Gln Met Pro Gly Lys Gly Leu Glu Trp Met
35 40 45
Gly Ile Ile Tyr Pro Gly Asp Ser Asp Thr Arg Tyr Ser Pro Ser Phe
50 55 60
Gln Gly Gln Val Thr Ile Ser Ala Asp Lys Ser Ile Ser Thr Ala Tyr
65 70 75 80
Leu Gln Trp Ser Ser Leu Lys Ala Ser Asp Thr Ala Met Tyr Tyr Cys
85 90 95
Ala Arg
<210> 109
<211> 98
<212> PRT
<213> Homo sapiens
<400> 109
Glu Val Gln Leu Leu Gln Ser Ala Ala Glu Val Lys Arg Pro Gly Glu
1 5 10 15
Ser Leu Arg Ile Ser Cys Lys Thr Ser Gly Tyr Ser Phe Thr Ser Tyr
56
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
20 25 30
Trp Ile His Trp Val Arg Gln Met Pro Gly Lys Glu Leu Glu Trp Met
35 40 45
Gly Ser Ile Tyr Pro Gly Asn Ser Asp Thr~Arg Tyr Ser Pro Ser Phe
50 55 60
Gln Gly His Val Thr Ile Ser Ala Asp Ser Ser 5er Ser Thr Ala Tyr
65 70 75 80
Leu Gln Trp Ser Ser Leu Lys Ala Ser Asp Ala Ala Met Tyr Tyr Cys
85 90 95
Val Arg
<210> 110
<211> 98
<212> PRT
<213> Homo Sapiens
<400> 110
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Glu
1 5 10 15
Ser Leu Arg Ile Ser Cys Lys Gly Ser G1y Tyr Ser Phe Thr Ser Tyr
20 25 30
Trp Ile Ser Trp Val Arg Gln Met Pro G1y Lys Gly Leu Glu Trp Met
35 40 45
Gly Arg Ile Asp Pro Ser Asp Ser Tyr Thr Asn Tyr Ser Pro Ser Phe
50 55 60
Gln Gly His Val Tar Ile Ser Ala Asp Lys Ser Ile Ser Thr Ala Tyr
65 70 75 80
Leu Gln Trp Ser Ser Leu Lys Ala Ser Asp Thr Ala Met Tyr Tyr Cys
85 90 95
Ala Arg
<210> 111
<211> 98
<212> PRT
<213> Homo Sapiens
57
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
<400> 111
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Glu
1 5 10 15
Ser Leu Arg Ile Ser Cys Lys Gly Ser Gly Tyr Ser Phe Thr Ser Tyr
20 25 30
Trp Ile Ser Trp Val Arg Gln Met Pro Gly Lys Gly Leu Glu Trp Met
35 40 45
Gly Arg Ile Asp Pro Ser Asp Ser Tyr Thr Asn Tyr Ser Pro Ser Phe
50 55 60
Gln Gly His Val Thr Ile Ser Ala Asp Lys 5er Ile Ser Thr Ala Tyr
65 70 75 80
Leu Gln Trp Ser Ser Leu Lys Ala Ser Asp Thr Ala Met Tyr Tyr Cys
85 90 95
Ala Arg
<210> ll2
<211> l01
<212> PRT
<213> Homo Sapiens
<400> 112
Gln Val Gln Leu Gln Gln Ser Gly Pro Gly Leu Val Lys Pro Ser Gln
1 S 10 15
Thr Leu Ser Leu Thr Cys Ala Ile Ser Gly Asp Ser Val Ser Ser Asn
20 25 30
Ser Ala Ala Trp Asn Trp Ile Arg Gln Ser Pro Ser Arg Gly Leu Glu
35 40 45
Trp Leu Gly Arg Thr Tyr Tyr Arg Ser Lys Trp Tyr Asn Asp Tyr Ala
50 55 60
Val Ser Val Lys Ser Arg Ile Thr Ile Asn Pro Asp Thr Ser Lys Asn
65 70 75 80
Gln Phe Ser Leu Gln Leu Asn Ser Val Thr Pro Glu Asp Thr Ala Val
85 90 95
Tyr Tyr Cys Ala Arg
100
58
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
<210> 113
<211> 87
<212> PRT
<213> Homo Sapiens
<400> 113
Arg Lys Leu Gly Ala Ser Val Lys Val Ser Arg Lys Ala Ser Ser Tyr
1 5 ZO 15
Thr Phe Thr Ser Tyr Asp Ile His Cys Val Arg Gln Ala Pro Gly Lys
20 25 30
Gly Leu Lys Gly Trp Met Gly Gly Ile Tyr Ser Gly Asn Gly Lys Thr
35 40 45
Gly Tyr Ala Gln Lys Phe Gln Arg Val Thr Met Thr Arg Asp Met Ser
50 55 60
Thr Ser Thr Ala Tyr Met Glu Leu Ser Ser Gln Arg Ser Glu Asp Ile
65 70 75 80
Asp Val Tyr Tyr Cys Ala Arg
<210> 114
<211> 5
<212> PRT
<213> Homo Sapiens
<400> 114
Asp Tyr Gly Met Ser
1 5
<210> 115
<211> 17
<212> PRT
<213> .Homo Sapiens
<400> 115
Gly Ile Asn Trp Asn Gly Gly Ser Thr Gly Tyr Ala Asp Ser Val Lys
1 5 10 15
59
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Gly
<210>1l6
<211>11
<212>PRT
<213>Homo sapiens
<400> 116
Trp Gly Gln Gly Thr Leu Val Thr Val Ser Arg
1 5 10
<210> 117
<211> 11
<212> PRT
<213> Homo sapiens
<400> l17
Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg
1 5 10
<210> 118
<211> 11
<212> PRT
<213> Homo sapiens
<400> 118
Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn
1 5 10
<210> 119
<211> 8
<212> PRT
<213> Homo Sapiens
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
<400> 119
Gly Lys Gly Leu Glu Trp Val Ser
1 5
<210> 120
<211> 6
<212> PRT
<213> Homo Sapiens
<400> 120
Trp Val Arg Gln Ala Pro
1 5
<210> 121
<211> 11
<212> PRT
<213> Homo Sapiens
<400> 121
Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp
1 5 10
<210> 122
<211> 7
<~12> PRT
<213> Homo Sapiens
<400> 122
Ala Val Tyr Tyr Cys Ala Arg
1 5
<210> 123
<211> 20
<212> PRT
<213> Homo Sapiens
61
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
<400> 123
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly
1 5 10 15
Gly Gly Gly Ser
<210> 124
<211> 15
<212> PRT
<213> Homo Sapiens
<400> 124
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser
1 5 10 15
<210> 125
<211> 9
<212> PRT
<213> Homo sapiens
<400> 125
Asn Ser Arg Asp Ser 5er Gly Asn His
1 5
<210> 126
<211> 8
<212> PRT
<213> Homo Sapiens
<400> 126
Ala Ala Trp Asp Asp Ser Leu Val
1 5
<210> 127
<211> 8
62
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
<212> PRT
<213> Homo Sapiens
<400> 127
Met Gln Ser Ile Gln Leu Pro Thr
1 5
<210> 128
<211> 9
<212> PRT
<213> Homo Sapiens
<400> 128
Met Gln Ser Ile Gln Leu Pro Ala Thr
1 5
<210> 129
<211> 10
<212> PRT
<213> Homo Sapiens
<400> 129
Ala Ala Trp Asp Asp Gly Leu Ser Leu Val
1 5 10
<210> 130
<211> 10
<212> PRT
<213> Homo sapiens
<400> 130
Ala Ala Trp Asp Asp Ser Leu Ser Gly Val
1 5 ZO
<210> 131
63
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
<211> 11
<212> PRT
<213> Homo Sapiens
<400> 131
Asn Ser Arg Asp Ser Ser Gly Ser Val Arg Val
1 5 10
<210> 132
<211> 9
<212> PRT
<213> Homo Sapiens
<400> 132
Leu Leu Tyr Tyr Gly Gly Ala Tyr Val
1 5
<210> 133
<211> 11
<212> PRT
<213> Homo Sapiens
<400> 133
Asn Ser Arg Asp Ser Ser Gly Val Ser Arg Val
1 5 10
<210> 134
<211> 10
<212> PRT
<213> Homo Sapiens
<400> 134
Ala Ala Trp Asp Asp Ser Leu Pro Tyr Val
1 5 10
64
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
<210> 135
<211> 12
<212> .PRT
<213> Homo Sapiens
<400> 135
Ala Ala Trp Asp Asp Ser Leu Cys Pro Glu Phe Val
1 5 10
<210> 136
<211> 11
<212> PRT
<213> Homo Sapiens
<400> 136
Ala Ala Trp Asp Asp Ser Leu Ala Trp Phe Val
1 5 10
<210> 137
<211> 10
<212> PRT
<213> Homo Sapiens
<400> I37
Leu Ala Trp Asp Thr Ser Pro Arg Trp Val
1 5 10
<210> 138
<211> 10
<212> PRT
<213> Homo sapiens
<400> 138
Thr Ala Trp Asp Asp Ser Leu Ala Val Val
1 5 10
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
<210> 139
<211> 11
<212> PRT
<213> Homo Sapiens
<400> 139
Asn Ser Arg Asp Ser Ser Gly Asn His Arg Val
1 5 10
<210> 140
<211> 9
<212> PRT
<213> Homo Sapiens
<400> 140
Gln Gln Tyr Gly Ser Ser Gln Arg Thr
1 5
<210> 141
<211> 10
<212> PRT
<213> Homo sapiens
<400> 141
Ala Ala Trp Asp Asp Ser Leu Arg Leu Va1
1 5 10
<210> 142
<211> 9
<212> PRT
<213> Homo Sapiens
<400> 142
Met Gln Gly Thr His Trp Arg Pro Thr
66
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
1 5
<210> 143
<211> 9
<212> PRT
<213> Homo Sapiens
<400> 143
Met Gln Gly Lys His Trp Pro Leu Thr
1 5
<210> 144
<211> 9
<212> PRT
<213> Homo Sapiens
<400> 144
Ala Ala Trp Asp Asp Ser Leu Gly Phe
1 5
<210> 145
<211> 9
<212> PRT
<213> Homo Sapiens
<400> 145
Met Gln Gly Thr His Arg Arg Ala Thr
1 5
<210> 146
<211> 9
<212> PRT
<213> Homo Sapiens
<400> 146
67
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Met Gln Ala Leu Gln Thr Pro Leu Thr
1 5
<210> 147
<211> 9
<212> PRT
<213> Homo Sapiens
<400> 147
Met Arg Gly Thr His Arg Arg Ala Thr
1 5
<210> 148
<211> 9
<212> PRT
<213> Homo sapiens
<400> 148
Met Gln Gly Thr His Trp His Pro Thr
1 5
<210> 149
<211> 8
<212> PRT
<213> Homo Sapiens
<400> 149
Met Gln Ala Leu Gln Ser Pro Thr
1 5
<210> l50
<211> ZO
<212> PRT
<213> Homo Sapiens
<400> 150
68
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Ala Ala Trp Asp Asp Ser Leu Ala Phe Val
1. 5 10
<210> 151
<211> 8
<212> PRT
<213> Homo Sapiens
<400> 151
Met Gln Ala Leu Gln Thr Pro Thr
1 5
<210> 152
<211> 8
<212> PRT
<213> Homo Sapiens
<400> 152
Gln Gln Ser Tyr Ser Thr Arg Thr
1 5
<210> 153
<211> 9
<212> PRT
<213> Homo Sapiens
<400> 153
Met Gln Gly Thr His Trp Pro Phe Thr
I 5
<210> 154
<211> 9
<212> PRT
<213> Homo Sapiens
69
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
<400> 154
Met Gln Gly Thr His Trp Pro Ala Thr
1 5
<210> 155
<211> 10
<212> PRT
<213> Homo Sapiens
<400> 155
Ala Ala Trp Asp Asp Ser Leu Arg Ser Val
1 5 10
<210> 156
<211> 9
<212a PRT
<213> Homo Sapiens
<400> 156
Ala Ala Trp Asp Asp Ser Leu Leu Val
1 5
<210> 157
<211> 11
<2l2> PRT
<213> Homo Sapiens
<400> 157
Asp Ser Trp Asp Asn Ser Leu Val Ser Pro Val
1' ,5 10
<210> 158
<211> 9
<212> PRT
<213> Homo sapiens
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
<400> 158
Met Gln Ala Leu Gln Ser Pro Ala Thr
1 5
<210> 159
<211> 9
<212> PRT
<2l3> Homo Sapiens
<400> 159
Met Gln Ala Leu Gln Thr Pro Val Thr
1 5
<210> 160
<211> 11
<212> PRT
<213> Homo Sapiens
<400> 160
Ala Ala Trp Asp Asp Ser Leu Ser Ala Tyr Val
1 5 10
<210> 161
<211> 11
<212> PRT
<213> Homo Sapiens
<400> 161
Asn Ser Arg Asp Ser Ser Gly Arg Val Asn Val
1 5 10
<210> 162
<211> 8
<212> PRT
71
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
<213> Homo Sapiens
<400> 162
Met Gln Ala Leu Arg Thr Arg Thr
1 5
<210> 163
<211> 11
<212> PRT
<213> Homo Sapiens
<400> 163
Ala Ala Trp Asp Asp Ser Leu Phe Tyr Pro Val
1 5 10
<210> 164
<211> 9
<212> PRT
<213> Homo Sapiens
<400> 164
Met Gln Gly Thr His Trp Pro Val Thr
1 5
<210> 165
<211> 8
<212> PRT
<213> Homo Sapiens
<400> 165
Met Gln Gly Thr His Trp Arg Thr
1 5
<210> 166
<211> 10
72
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
<212> PRT
<213> Homo Sapiens
<400> 166
Ala Ala Trp Asp Asp Ser Leu Phe Tyr Val
1 . 5 10
<210> 167
<211> 9
<212> PRT
<213> Homo Sapiens
<400> 167
Met Gln Ser Ile Gln Leu Pro Leu Thr
1 5
<210> 168
<211> 11
<212> PRT
<213> Homo Sapiens
<400> 168
Ala Ala Trp Asp Asp Ser Leu Leu Gly Ser Val
1 5 10
<210> 169
<211> 9
<212> PRT
<2I3> Homo sapiens
<400> 169
Cys Ser Tyr Ala Gly Ser Ser Tyr Val
1 5
73
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
<210> 170
<211> 8
<212> PRT
<213> Homo Sapiens
<400> 170
Gln Gln Asp Tyr Asn Leu Leu Thr
1 5
<210> 171
<211> 10
<212> PRT
<213> Homo sapiens
<400> 171
Val Leu Tyr Met Gly Ser Gly Ser Ala Val
1 5 10
<210> 172
<211> 9
<212> PRT
<213> Homo Sapiens
<400> 172
Met Gln Arg Ile Glu Phe Pro Asn Thr
1 5
<210> 173
<211> 11
<212> PRT
<213> Homo Sapiens
<400> 173
74
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Ala Ala Trp Asp Asp Ser Leu Ala Cys Ala Val
1 5 10
<210> 174
<211> 8
<212> PRT
<213> Homo sapiens
<400> 174
Gln Gln Ala Asn Ser Phe Arg Thr
1 5
<210> 175
<211> 11
<212> PRT
<213> Homo sapiens
<400> 175
Ala Ala Trp Asp Asp Ser Leu Ser Arg Pro Val
1 5 10
<210> 176
<211> 10
<212> PRT
<213> Homo Sapiens
<400> 176
Ala Ala Trp Asp Asp Ser Leu Tyr Asn Val
1 5 10
<210> 177
<211> 11
<212> PRT
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
<213> Homo Sapiens
<400> 177
Ala Ala Trp Asp Asp Ser Leu Asn Arg Asn Val
1 5 10
<210> 178
<211> 8
<212> PRT
<213> Homo Sapiens
<400> 178
Met Gln Val Leu Gln Thr Arg Thr
1 5
<210> 179
<211> 8
<212> PRT
<213> Homo Sapiens
<400> 179
Met Gln Ala Leu Gln Thr Arg Thr
1 5
<210> 180
<211> 8
<212> PRT
<213> Homo Sapiens
<400> 180
Gln Gln Ser Tyr Ser Thr Arg Met
1 5
<210> 18l
76
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
<211> 8
<212> PRT
<213> Homo Sapiens
<400> 181
Met Gln Ala Leu Gln Thr Leu Thr
1 5
<210> 182
<211> 8
<212> PRT
<213> Homo Sapiens
<400> 182
Met Arg Ala Leu Gln Thr Pro Thr
1 S
<210> 183
<211> 11
<212> PRT
<213> Homo Sapiens
<400> 183
Ala Ala Trp Asp Asp Ser Leu Pro Gly Tyr Val
1 5 10
<210>184
<211>10
<212>PRT
<213>Homo Sapiens
<400> 184
Ala Ala Trp Asp Asp Ser Leu Gly Phe Val
1 5 10
77
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
<210> 185
<211> 10
<212> PRT
<213> Homo Sapiens
<400> 185
Ala Ala Trp Asp Asp Ser Leu Phe Leu Val
1 5 ~ 10
<210> 186
<211> 8
<212> PRT
<213> Homo Sapiens
<400> 186
Met Gln Ser Tle Gln Leu Arg Thr
1 5
<210> 187
<211> 10
<212> PRT
<213> Homo Sapiens
<400> 187
Ala Ala Trp Asp Asp Ser Leu Ser Ile Val
1 5 10
<210> 188
<211> 8
<212> PRT
78
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
<213> Homo Sapiens
<400> 188
Met Gln Gly Thr His Trp Pro Thr
1 5
<210> 189
<211> 8
<212> PRT
<213> Homo Sapiens
<400> 189
Met Gln Ala Leu His Thr Arg Thr
1 5
<2l0> 190
<211> 9
<212> PRT
<213> Homo Sapiens
<400> 190
Asn Ser Arg Asp Ser Ser G1y Ser Val
1 5
<210> 191
<211> 9
<212> PRT
<213> Homo sapiens
<400> 191
Gln Gln Tyr Gly Ser Ser Pro Tyr Thr
1 5
79
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
<210> 192
<211> 8
<212> PRT
<213> Homo Sapiens
<400> 192
Gln Gln Ser Tyr.Ser Thr Arg Thr
1 5
<210> 193
<211> 9
<212> PRT
<213> Homo Sapiens
<400> 193
Gln Gln Ala Asn Ser Phe Ala Ala Thr
1 5
<210> 194
<211> 9
<212> PRT
<213> Homo Sapiens
<400> I94
Gln Gln Ala Asn Ser Phe Pro Ala Thr
1 5
<210> 195
<211> 10
<212> PRT
<213> Homo Sapiens
<400> 195
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Val Leu Tyr Met Gly Ser Gly Val Tyr Val
1 5 10
<210> 196
<211> 11
<212> PRT
<213> Homo Sapiens
<400> 196
Ala Ala Trp Asp Asp Ser Leu Trp Ser Ala Val
1 5 10
<210> 197
<211> 12
<212> PRT
<213> Homo Sapiens
<400> 197
Ala Ala Trp Asp Asp Ser Leu Pro Arg Arg Leu Val
1 5 10
<210> 198
<211> 11
<212> PRT
<213> Homo Sapiens
<400> 198
Ala Ala Trp Asp.Asp Ser Leu Pro Ser Gly Val
1 5 10
<210> 199
<211> 8
<212> PRT
~1
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
<213> Homo sapiens
<400> 199
Met Gln Ala Leu Gln Thr Leu Thr
1 5
<210> 200
<211> 10
<212> PRT
<213> Homo sapiens
<400> 200
Ala Ala Trp Asp Asp Gly Leu Leu Arg Val
1 5 10
<210> 201
<211> 10
<212> PRT
<213> Homo sapiens
<400> 201
Ala Ala Trp Asp Asp Ser Leu Ala Leu Val
1 5 10
<210> 202
<211> 11
<212> PRT
<213> Homo Sapiens
<400> 202
Asn Ser Arg Asp Ser Ser Gly Phe Gln Leu Val
1 5 10
~2
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
<210> 203
<2I1> 277
<2I2> PRT
<213> Homo sapiens
<400> 203
Met Lys Tyr Leu Leu Pro Thr Ala Ala Ala Gly Leu Leu Leu Leu Ala
1 5 10 15
Ala Gln Pro Ala Met Ala Glu Val Gln Leu Val Glu Ser Gly Gly Gly
20 25 30
Val Val Arg Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly
35 40 45
Phe Thr Phe Asp Asp Tyr Gly Met Ser Trp Val Arg Gln Ala Pro Gly
50 55 60
Lys Gly Leu Glu Trp Val Ser Gly Ile Asn Trp Asn Gly Gly Ser Thr
65 70 75 80
Gly Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr I1e Ser Arg Asp Asn
85 90 95
Ala Lys Asn Ser Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp
100 105 110
Thr Ala Val Tyr Tyr Cys Ala Arg Leu Thr His Pro Tyr Phe Trp Gly'
II5 120 125
GIn Gly Thr Leu Val Thr Val Ser Arg Gly GIy GIy Gly Ser Gly Gly
130 135 140
Gly Gly Ser Gly Gly Gly Gly Ser Ser Glu Leu Thr Gln Asp Pro Ala
245 150 155 160
Val Ser Val Ala Leu Gly Gln Thr Val Arg Ile Thr Cys Gln Gly Asp
165 170 175
Ser Leu Arg Ser Tyr Tyr Ala Ser Trp Tyr Gln Gln Lys Pro Gly Gln
180 185 190
Ala Pro Val Leu Val Ile Tyr Gly Lys Asn Asn Arg Pro Ser Gly Ile
195 200 205
Pro Asp Arg Phe Ser Gly Ser Ser Ser Gly Asn Thr Ala Ser Leu Thr
210 215 220
Ile Thr Gly Ala Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Asn Ser
225 ' 230 235 240
Arg~Asp Ser Ser Gly Asn His Val Val Phe Gly Gly Gly Thr Lys Leu
245 250 255
83
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
Thr Val Leu Gly Ala Ala Ala Glu Gln Lys Leu Ile Ser Glu Glu Asp
260 265 270
Leu Asn Gly Ala Ala
275
<210> 204
<211> 266
<212> PRT
<213> Homo Sapiens
<400> 204
Met Lys Tyr Leu Leu Pro Thr Ala Ala Ala Gly Leu Leu Leu Leu Ala
1 5 10 15
Ala Gln Pro Ala Met Ala Glu Val Gln Leu Va1 Glu Ser Gly Gly Gly
20 25 30
Val Val Arg Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly
35 40 45
Phe Thr Phe Asp Asp Tyr Gly Met Ser Trp Val Arg Gln Ala Pro Gly
50 55 60
' Lys Gly Leu Glu Trp Val Ser Gly Ile Asn Trp Asn Gly Gly Ser~Thr
65 70 75 80
Gly Tyr A1a Asp Ser Val Lys Gly Arg Phe Thr Iie Ser Arg Asp Asn
85 90 95
Ala Lys Asn Ser Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp
100 105 110
Thr Ala Val Tyr Tyr Cys Ala Arg Met Arg Ala Pro Val Ile Trp Gly
115 120 125
Gln Gly Thr Leu Val Thr Val Ser Arg Gly Gly G1y Gly Ser Gly Gly
130 135 140
Gly Gly Ser Gly Gly Gly Gly Ser 5er Glu Leu Thr Gln Asp Pro Ala
145 150 155 160
Val Ser Val Ala Leu Gly Gln Thr Val Arg Ile Thr Cys Gln Gly Asp
265 170 175
Ser Leu Arg Ser Tyr Tyr Ala Ser Trp Tyr Gln Gln Lys Pro Gly Gln
180 185 190
Ala Pro Val Leu Val Ile Tyr Gly Lys Asn Asn Arg Pro Ser Gly Ile
195 200 205
Pro Asp Arg Phe Ser Gly Ser Ser Ser Gly Asn Thr Ala Ser Leu Thr
$4
CA 02433225 2003-06-27
WO 02/053700 PCT/USO1/49442
210 215 220
Ile Thr Gly Ala Gln Ala Glu Asp Glu A1a Asp Tyr Tyr Cys Asn Ser
225 230 , 235 240
Arg Asp Ser Ser Gly Asn His Val Val Phe Gly Gly Gly Thr,Lys".,Leu
245 250 2'55
Thr Val Leu Gly Ala Ala Ala Lys Ala Lys
260 265
