Note: Descriptions are shown in the official language in which they were submitted.
CA 02434320 2003-07-02
WO 02/058723 PCT/US02/01849
CHEMOKINES AS ADJUVANTS OF IMMUNE RESPONSE
This application claims the benefit of European Patent Application EP 0 974
357 A1 filed July 16, 1998 and published January 26, 2000.
Field Of The Invention
The invention relates to the use of human chemokines in the treatment of
disease states, including cancer. The administered chemokines direct the
migration
of either all antigen-presenting dendritic cells or a specific subset of
dentritic cells.
In one embodiment, disease-specific antigens) and/or a moiety designed to
activate
dentritic cells is administered in conjunction with the chemokine(s).
Background Of The Invention
Dendritic cells (DC) specialize in the uptake of antigen and their
presentation
to T cells. DC thus play a critical role in antigen-specific immune responses.
DC are represented by a diverse population of morphologically similar cell
types distributed widely throughout the body in a variety of lymphoid and non-
lymphoid tissues (Caux, et al., 1995, Immunology Today 16:2; Steinman, 1991,
Ann.
Rev. Immunol. 9:271-296). These cells include lymphoid DC of the spleen, and
lymph nodes, Langerhans cells of the epidermis, and veiled cells in the blood
circulation. DC are collectively classified as a group based on their
morphology,
high levels of surface MHC-class II expression as well as several accessory
molecules (B7-1 [CD80] and B7-2[CD86]) that mediate T cell binding and
costimulation (Inaba, et al., 1990, Intern. Rev. Immunol. 6:197-206;
Frendenthal, et
al., 1990, Proc. Natl. Acad. Sci. USA 87:7698), and absence of certain other
surface
markers expressed on T cells, B cells, monocytes, and natural killer cells.
DC are bone marrow-derived and migrate as precursors through blood stream
to tissues, where they become resident cells such as Langerhans cells in the
epidermis.
In the periphery, following pathogen invasion, immature DC such as fresh
Langerhans cells are recruited at the site of inflammation (Kaplan, et al.,
1992, J.
Exp. Med. 175:1717-1728; McWilliam, et al., 1994, J. Exp. Med. 179:1331-1336)
where they capture and process antigens, (Inaba, et al., 1986. J. Exp. Med.
164:605-613; Streilein, et al., 1989, J. Immunol. 143:3925-3933; Romani, et
al.,
CA 02434320 2003-07-02
WO 02/058723 PCT/US02/01849
1989., J. Exp. Med. 169:1169-1178; Pure, et al., 1990. J. Exp. Med. 172:1459-
1469;
Schuler, et al., 1985, J. Exp. Med. 161:526-546).
Antigen-loaded DC then migrate from the peripheral tissue via the lymphatics
to the T cell rich area of lymph nodes, where the mature DC are called
interdigitating
cells (IDC) (Austyn, et al., 1988, J. Exp. Med. 167:646-651; Kupiec-Weglinski,
et al.,
1988, J. Exp. Med. 167:632-645; Larsen, et al., 1990, J. Exp. Med. 172:1483-
1494;
Fossum, S. 1988, Scand. J. Immunol. 27:97-105; Macatonia, et al., 1987, J.
Exp.
Med. 166:1654-1667; Kripke, ef al., 1990., J. Immunol. 145:2833-2838). At this
site,
they present the processed antigens to naive T cells and generate an antigen-
specific primary T cell response (Liu, et al., 1993, J. Exp. Med. 177:1299-
1307;
Sornasse, et al., 1992, J. Exp. Med. 175:15-21; Heufler, et al., 1988, J. Exp.
Med.
167:700-705).
During their migration from peripheral tissues to lymphoid organs, DC
undergo a maturation process encompassing dramatic changes in phenotype and
functions (Larsen, et al., 1990, J. Exp. Med. 172:1483-1494; Streilein, et
al., 1990,
Immunol. Rev. 117:159-184; De Smedt, et al., 1996, J. Exp. Med. 184:1413-
1424).
In particular, in contrast to immature DC such as fresh Langerhans cells,
which
capture and process soluble proteins efficiently and are effective at
activating
specific memory and effector T cells, mature DC such as IDC of lymphoid organs
are poor in antigen capture and processing but markedly efficient in naive T
cell
priming (Inaba, et al., 1986. J. Exp. Med. 164:605-613; Streilein, et al.,
1989, J.
Immunol. 143:3925-3933; Romani, et al., 1989, J. Exp. Med. 169:1169-1178;
Pure,
et al., 1990, J. Exp. Med. 172:1459-1469; Sallusto, et al., 1995, J. Exp. Med.
182:389-400; Cella, et al., 1997, Current Opin. Immunol. 9:10-16).
Signals regulating the traffic pattern of DC are complex and not fully
understood.
Signals provided by TNFa and LPS are known to induce in vivo migration of
resident DC from the tissues to the draining lymphoid organs (De Smedt, et
al.,
1996, J. Exp. Med. 184:1413-1424; MacPherson, et al., 1995, J. Immunol.
154:1317-1322; Roake, et al., 1995, J. Exp. Med. 181:2237-2247; Cumberbatch et
al., 1992, Immunology. 75:257-263; Cumberbatch, et al., 1995, Immunology.
84:31-
35).
Chemokines are small molecular weight proteins that regulate leukocyte
migration and activation (Oppenheim, 1993, Adv. Exp. Med. Biol. 351:183-186;
Schall, et al., 1994, Curr. Opin. Immunol. 6:865-873; Rollins, 1997, Blood
90:909-
2
CA 02434320 2003-07-02
WO 02/058723 PCT/US02/01849
928; Baggiolini, et al., 1994, Adv. Immunol. 55:97-179). They are secreted by
activated leukocytes themselves, and by stromal cells including endothelial
cells and
epithelial cells upon inflammatory stimuli (Oppenheim, 1993, Adv. Exp. Med.
Biol.
351:183-186; Schall, ef al., 1994, Curr. Opin. Immunol. 6:865-873; Rollins,
1997,
Blood 90:909-928; Baggiolini, et al., 1994, Adv. Immunol. 55:97-179).
Responses to
chemokines are mediated by seven transmembrane spanning G-protein-coupled
receptors (Rollins, 1997, Blood 90:909-928; Premack, et al., 1996, Nat. Med.
2:1174-1178; Murphy, P.M. 1994, Ann. Rev. Immunol. 12:593-633). Several
chemokines such as monocyte chemotactic protein (MCP)-3, MCP-4, macrophage
inflammatory protein (MIP)-1a, MIP-1~3, RANTES (regulated on activation,
normal T
cell expressed and secreted), SDF-1, Teck (thymus expressed chemokine) and
MDC (macrophage derived chemokine) have been reported to attract DC in vitro
(Sozzani, et al., 1995, J. Immunol. 155:3292-3295; Sozzani, et al., 1997, J.
Immunol.
159:1993-2000; Xu, et al., 1996, J. Leukoc. Biol. 60:365-371; MacPherson, et
al.,
1995, J. Immunol. 154:1317-1322; Roake, et al., 1995, J. Exp. Med. 181:2237-
2247).
In recent years, investigators have attempted to exploit the activity of DC in
the treatment of cancer. In an animal model, as few as 2 x 105 antigen-pulsed
DC
will induce immunity when injected into naive mice (Inaba at al., 1990,
Intern. Rev.
Immunol. 6:197-206). Flamand et al. (Eur. J. Immunol., 1994, 24:605-610)
pulsed
mouse DC with the idiotype antigen from a B-cell lymphoma and injected them
into
naive mice. This treatment effectively protected the recipient mice from
subsequent
tumor challenges and established a state of lasting immunity. Injection of
antigen
alone, or B cells pulsed with antigen, had no effect, suggesting that it was
the unique
characteristics of DC that were responsible for the anti-tumor response. It
has been
postulated that DC are not only capable of inducing anti-tumor immunity, but
that
they are absolutely essential for this process to occur (Ostrand-Rosenberg,
1994,
Current Opinion in Immunol. 6:722-727; Grabbe et al., 1995, Immunol. Today
16:117-120; Huang et al., 1994, Science 264:961-965). Huang and coworkers
(Huang et al., 1994, Science 264:961-965) inoculated mice with a B7-1
transfected
tumor that was known to produce anti-tumor immunity. They demonstrated that
only
mice with MHC-compatible APC were capable of rejecting a tumor challenge.
Studies in humans have demonstrated a similar role for DC. It has been
reported
that peptide-specific CTL are readily induced from purified CD8+ T cells using
peptide-pulsed DC, but are not elicited when peptide-pulsed monocytes are used
(Mehta-Damani et al., 1994, J. Immunology 153:996-1003).
Of significant clinical interest, the histologic infiltration of dendritic
cells into
primary tumor lesions has been associated with significantly prolonged patient
3
CA 02434320 2003-07-02
WO 02/058723 PCT/US02/01849
survival and a reduced incidence of metastatic disease in patients with
bladder,
lung, esophageal, gastric and nasopharygeal carcinoma. In contrast, a
comparatively poorer clinical prognosis is observed for patients with lesions
that
exhibit a sparse infiltration with DC and metastatic lesions are frequently
deficient in
DC infiltration (Becker, 1993, In Vivo 7:187; Zeid et al., 1993, Pathology
25:338;
Furihaton et al., 1992, 61:409; Tsujitani et al., 1990, Cancer 66:2012; Gianni
et al.,
1991, Pathol. Res. Pract. 187:496; Murphy et al., 1993, J. Inv. Dermatol.
100:3358).
A patient with advanced B-cell lymphoma was recently treated with DC pulsed
with
the patient's own tumor idiotype (Hsu et al., 1996, Nature Medicine 2(1 ):52).
This
produced a measurable reduction in the patient's B-cell lymphoma. Treatment of
prostate cancer using DC pulsed with PSM antigen has been reported by Murphy
et
al. (The Prostate 1996 29:371 ).
Techniques have recently emerged for the in vitro propagation of large
numbers of DC from circulating monocytes or from CD34 hematopoietic
progenitors
in response to granulocyte-macrophage colony stimulating factor (GM-CSF) in
combination with either interleukin 4 (IL-4) or tissue necrosis factor a
(TNFa)
(Sallusto et al., 1994, J. Exp. Med. 179:1109-1118; Romani et al., 1994, J.
Exp.
Med. 180:83-93: Caux et al., 1992, Nature 360:258). The combination of GM-CSF
and IL-4 induces peripheral blood monocytes to differentiate into potent DC
(Kiertscher and Roth, 1996, J. Leukocyte Biol. 59:208-281 ). With the
combination of
these two cytokines a 100-fold increase in the yield of DC can be achieved
from
peripheral blood in vitro.
In mice, tumor antigen-loaded in vitro generated DC have been shown, by
various groups, to prevent the development of tumors and more importantly to
induce the regression of established tumors. A clinical trial has been
conducted in
which patients with melanoma are being treated with GM-CSF-activated APC
pulsed
with a peptide from the MAGE-1 tumor antigen (Mehta-Damani, et al., 1994, J.
Immunology 153:996-1003). Pre-immunization, tumor-infiltrating lymphocytes
from
two patients were predominantly CD4+ and lacked specific tumor reactivity. In
contrast, after immunization tumor infiltrating lymphocytes from the same
patients
were predominantly CD8+ and demonstrated MACE-1 specific anti-tumor
cytotoxicity. It thus appears from these studies that DC have a unique and
potent
capacity to stimulate immune responses.
Dendritic cell therapy thus represents a very promising approach to the
treatment of disease, in particular, cancer. There is a continuing need for
improved
materials and methods that can be used not only to expand and activate antigen
4
CA 02434320 2003-07-02
WO 02/058723 PCT/US02/01849
presenting dendritic cells, but to facilitate the migration of DC so as to be
both
therapeutically as well as prophylactically useful.
Summary of the Invention
The present invention fulfills the foregoing need by providing materials and
methods for treating disease states by facilitating or inhibiting the
migration or
activation of antigen-presenting dendritic cells. It has now been discovered
that
chemokines are useful therapeutic agents. Disease states which can be treated
in
accordance with the invention include parasitic infections, bacterial
infections, viral
infections, fungal infections, cancer, autoimmune diseases, graft rejection
and
allergy.
The invention provides a method of treating disease states comprising
administering to an individual in need thereof an amount of chemokine
sufficient to
increase the migration of immature dendritic cells to the site of antigen
delivery. In
one aspect of the invention a chemokine such as MCP-1, MCP-2, MCP-3, MCP-4,
MIP-1a, MIP-3a, RANTES, SDF-1, Teck, DC tactin-Vii, 6Ckine, MDC, MIP-5 or a
combination thereof is administered. In a preferred method of the invention, a
disease-associated antigen, such as a tumor-associated antigen is administered
in
conjunction with the chemokine.
Another aspect of the invention provides a method of treating disease states
comprising administering to an individual in need thereof an amount of
chemokine
sufficient to decrease the migration of immature dendritic cells to the site
of antigen
delivery.
In still another aspect of the invention, cytokines, in particular GM-CSF and
IL-4 are administered in combination, either before or concurrently, with the
chemokine. Administration of GM-CSF and IL-4 stimulates generation of DC from
precursors, thereby increasing the number of DC available to capture and
process
antigen.
Yet another aspect of the invention an activating agent such as TNF-a, IFN-a
RANK-L or agonists of RANK, and agonists of the toll-like receptor family of
molecules is administered to provide maturation signals which drives the
migration
of DC from tissues toward lymphoid organs through the draining lymph.
The present invention also provides a method of enhancing an immune
response in a mammal comprising administering chemokine MCP-4 or a
biologically
active fragment of MCP-4 to a mammal. Human MCP-4 (hMCP-4) is active on
5
CA 02434320 2003-07-02
WO 02/058723 PCT/US02/01849
human blood dendritic cells, recruiting dendritic cells and dendritic cell
precursors
from blood. In a preferred aspect, the chemokine is recombinant. Most
preferably,
the chemokine is administered with antigen, for instance, in the form of a
fusion
protein of recombinant chemokine and antigen. Such antigens can be tumor
associated, bacterial, viral or fungal.
Additionally, the present invention provides a method of enhancing an
immune response in a mammal comprising administering chemokine 6Ckine or a
biologically active fragment of 6Ckine to a mammal. Human 6Ckine is active on
human blood dendritic cells, recruiting dendritic cells and dendritic cell
precursors
from blood. By virtue of recruiting dendritic cells, chemokine 6Ckine acts as
an anti-
tumor agent, and specifically is shown to exert an angiostatic effect on tumor
vasculature. In a preferred aspect, the chemokine is recombinant. Most
preferably,
the chemokine is administered with antigen, for instance, in the form of a
fusion
protein of recombinant chemokine and antigen. Such antigens can be tumor
associated, bacterial, viral or fungal.
In still another aspect of the invention, cytokines, in particular GM-CSF and
IL-4 are administered in combination, either before or concurrently with the
chemokine.
In a final aspect, the invention provides fusion proteins comprising MCP-4 or
a biologically active portion of MCP-4 and antigen and 6Ckine or a
biologically active
portion of 6Ckine and antigen. These fusion proteins can be administered to a
mammal in the form of a plasmid, viral vector or in the form of a recombinant
vector.
Brief Description of the Drawings
Fig. 1 shows that immunization with a plasmid containing MIP-3a and a tumor
associated antigen has a protective effect against tumor engraftment.
Fig. 2 shows greater CTL activity with the administration of chemokine MIP-
3a.
Fig. 3 shows the nucleotide and partial amino acid sequence of chemokine
hMCP-4.
Fig. 4 shows that hMCP-4 injection promotes the recruitment of dendritic cells
in vivo in the mouse in a dose-dependent manner.
6
CA 02434320 2003-07-02
WO 02/058723 PCT/US02/01849
Fig. 5 shows that hMCP-4 is active in recruiting dendritic cells in human
blood.
Fig. 6 shows that MCP-4 injection increases the antigen-specific humoral
response following beta-galactosidase DNA immunization.
Fig. 7 shows that MCP-4 increases the anti-tumor effect induced by beta-
galactosidase DNA immunization when mice are challenged with a C26 colon
carcinoma cell line that expresses beta-galactosidase.
Fig. 8 shows that h6Ckine is active in recruiting dendritic cells in human
blood.
Fig. 9 shows that C26 colon carcinoma tumor cells engineered to express
m6Ckine are less tumorigenic and that this effect depends on CD8+ cells and
Natural Killer cell activity, in vivo.
Fig. 10 shows that C26 tumors expressing m6Ckine are significantly infiltrated
by dendritic cells and CD8+T cells compared with parental tumors.
Fig. 11 shows that C26 colon carcinoma tumor cells engineered to express
m6Ckine are less angiogenic than the parental C26 tumor.
Fig. 12 shows that injection of h6Ckine slows tumor growth in mice in vivo.
Fig. 13 shows that 6Ckine inhibits tumor growth and spontaneous metastasis
in established tumors in vivo.
Detailed Description of the Invention
All references cited herein are incorporated in their entirety by reference.
The relation between signals inducing DC migration in vivo and their
responses to chemokines was heretofore not known. The inventors have
discovered that the pattern of chemokine receptors expressed by DC change
according to their stage of maturation and that chemokines can be used to
drive
migration of DC subsets and thereby control the initiation of the immune
response.
Chemokines can be used in accordance with the invention as adjuvants to
attract
selectively the immature DC subsets at the site of antigen delivery. In the
context of
autoimmune disease, tissue rejection or allergy, the invention provides a
method of
7
CA 02434320 2003-07-02
WO 02/058723 PCT/US02/01849
blocking DC functions by interfering with their migration through e.g., the
development of CCR6, CCR7, and CCR2 agonists and antagonists.
Depending on the subset of DC presenting the antigen to the immune system,
the response could vary dramatically. DC can induce tolerance. DC found in the
medulla of the thymus play a role in the negative selection of developing self-
reactive thymocytes (Brocker, et al., 1997, J. Exp. Med. 185(3):541-550). DC
can
also tolerize self-reactive peripheral T cells (Kurts, et al., 1997, J. Exp.
Med.
186(2):239-245; Adler, et al., 1998, J. Exp. Med. 187(10):1555-1564). A
specific
subset of mouse DC, possibly of lymphoid origin, has been proposed to induce
immune tolerance (Ardavin, 1993, Nature 362(6422):761-763). Furthermore, the
recent description that the candidate human counterpart to the lymphoid DC
(the
DC-2) (Grouard, et al., 1997, J. Exp. Med. 185(6):1101-1111 ) cannot secrete
IL-12
suggests that, following presentation by this subpopulation, the immune
response
might be biased towards a TH-2 type.
When the goal is to decrease the immune response, tolerizing DC
(autoimmunity, allergy) are recruited, or the quality of the response is
modified by
recruiting specifically DC-2 (TH1 greater that TH2, i.e., in allergy).
A chemokine for use in the invention is a natural protein of the body that is
active on a restricted subset of DC, in particular, immature DC. Several of
these
chemokines, including, but not limited to, MIP-3a, Teck, MDC and MCP-4, and
6Ckine have been identified by the inventors.
The chemokine used in practicing the invention may be a recombinant protein
with an amino-acid sequence identical to the natural product, or a recombinant
protein derived from the natural product but including modifications that
changes its
pharmacokinetic properties white keeping its original chemoattractant
property. The
mode of delivery of the chemokine may be by injection, including intradermal,
intramuscular and subcutaneous, or topical, such as an ointment or a patch.
The chemokine may also be delivered as a nucleic acid sequence by the way
of a vector, such as a viral vector (e.g., adenovirus, poxvirus, retrovirus,
lentivirus),
or an engineered plasmid DNA.
8
CA 02434320 2003-07-02
WO 02/058723 PCT/US02/01849
The term "chemokine" as used herein includes chemotactic agents. A
chemotactic agent may be a small chemical compound which is a selective
agonist
of a chemokine receptor expressed by immature DC. CCR6, the natural receptor
of
the chemokine MIP-3a is an example of such a receptor.
In a particularly preferred embodiment of the invention, the chemokine is
administered with a disease-associated antigen. The antigen can be any
molecular
moiety against which an increase or decrease in immune response is sought.
This
includes antigens derived from organisms known to cause diseases in man or
animal such as bacteria, viruses, parasites (e.g., Leishmania) and fungi. This
also
includes antigens expressed by tumors (tumor-associated antigens) and plant
antigens (allergens).
Tumor associated antigens for use in the invention include, but are not
limited
to Melan-A, tyrosinase, p97, ~i-HCG, GaINAc, MAGE-1, MAGE-2, MAGE-3, MAGE-
4, MAGE-12, MART-1, MUC1, MUC2, MUC3, MUC4, MUC18, CEA, DDC,
melanoma antigen gp75, HKer 8, high molecular weight melanoma antigen, K19,
Tyr1 and Tyr2, members of the pMel 17 gene family, c-Met, PSA, PSM, a-
fetoprotein, thyroperoxidase, gp100, NY-ESO-1, telomerase and p53. This list
is
not intended to be exhaustive, but merely exemplary of the types of antigen
which
may be used in the practice of the invention.
Different combinations of antigens may be used that show optimal function
with different ethnic groups, sex, geographic distributions, and stage of
disease. In
one embodiment of the invention at least two or more different antigens are
administered in conjunction with the administration of chemokine.
The antigen can by delivered or administered at the same site and the same
time as the chemokine, or after a delay not exceeding 48 hours. Concurrent or
combined administration, as used herein means the chemokine and antigen are
administered to the subject either (a) simultaneously in time, or (b) at
different times
during the course of a common treatment schedule. In the latter case, the two
compounds are administered sufficiently close in time to achieve the intended
effect.
The antigen can be in the form of a protein, or one or several peptides, or of
a
nucleic acid sequence included in a delivery vector.
Both primary and metastatic cancer can be treated in accordance with the
invention. Types of cancers which can be treated include but are not limited
to
melanoma, breast, pancreatic, colon, lung, glioma, hepatocellular,
endometrial,
gastric, intestinal, renal, prostate, thyroid, ovarian, testicular, liver,
head and neck,
9
CA 02434320 2003-07-02
WO 02/058723 PCT/US02/01849
colorectal, esophagus, stomach, eye, bladder, glioblastoma, and metastatic
carcinomas. The term "carcinoma" refers to malignancies of epithelial or
endocrine
tissues including respiratory system carcinomas, gastrointestinal system
carcinomas, genitourinary system carcinomas, prostatic carcinomas, endocrine
system carcinomas, and melanomas. Metastatic, as this term is used herein, is
defined as the spread of tumor to a site distant to from the primary tumor
including
regional lymph nodes.
A moiety designed to activate, induce or stimulate maturity of the DC may be
advantageously administered. Such agents provide maturation signals which
promote migration from the tissues to the lymph nodes. This moiety can be a
natural product of the body such as TNF-a or RP-105, or an agonist antibody
recognizing a specific. structure on DC such as an anti-CD-40 antibody, or
another
substance. The activating substance can be a sequence of nucleic acids
containing
unmethylated CpG motifs or agonist of a toll-like receptor known to stimulate
DC. In
the embodiment of the invention where the chemokine and/or antigen is
delivered by
the means of a plasmid vector, these nucleic acid sequences may be part of the
vector.
GM-CSF and IL-4 can advantageous be administered in combination with the
chemokine and/or antigen. The administration combination of GM-CSF and IL-4
stimulates generation of DC from precursors. GM-CSF and IL-4 may be
administered for purposes of increasing the number of circulating immature DC
which might then be locally recruited locally be the subsequent injection of
chemokine(s). This protocol would imply a systemic pre-treatment for a least
five to
seven days with GM-CSF and IL-4. An alternative would be to favor by local
administration of GM-CSF and IL-4 the local differentiation of DC-precursors
(monocytes) into immature DC which could then pick up the antigen delivered at
the
same site.
Generally, chemokine(s) and/or antigens) and/or activating agents) and/or
cytokine(s) are administered as pharmaceutical compositions comprising an
effective amount of chemokine(s) and/or antigens) and/or activating agents)
and/or
cytokine(s) in a pharmaceutical carrier. These reagents can be combined for
therapeutic use with additional active or inert ingredients, e.g., in
conventional
pharmaceutically acceptable carriers or diluents, e.g., immunogenic adjuvants,
along
with physiologically innocuous stabilizers and excipients. A pharmaceutical
carrier
CA 02434320 2003-07-02
WO 02/058723 PCT/US02/01849
can be any compatible, non-toxic substance suitable for delivering the
compositions
of the invention to a patient.
The quantities of reagents necessary for effective therapy will depend upon
many different factors, including means of administration, target site,
physiological
state of the patient, and other medicants administered. Thus, treatment
dosages
should be titrated to optimize safety and efficacy. Animal testing of
effective doses
for treatment of particular cancers will provide further predictive indication
of human
dosage. Various considerations are described, e.g., in Gilman et al. (eds.)
(1990)
Goodman and Gilman's: The Pharmacological Bases of Therapeutics, 8th Ed.,
Pergamon Press; and Remington's Pharmaceutical Sciences, 17th ed. (1990), Mack
Publishing Co., Easton, PA. Methods for administration are discussed therein
and
below, e.g., for intravenous, intraperitoneal, or intramuscular
administration,
transdermal diffusion, and others. Pharmaceutically acceptable carriers will
include
water, saline, buffers, and other compounds described, e.g., in the Merck
Index,
Merck & Co., Rahway, New Jersey. Slow release formulations, or a slow release
apparatus may be used for continuous administration.
Dosage ranges for chemokine(s) and/or antigens) and/or activating agents)
would ordinarily be expected to be in amounts lower than 1 mM concentrations,
typically less than about 10 NM concentrations, usually less than about 100
nM,
preferably less than about 10 pM (picomolar), and most preferably less than
about 1
fM (femtomolar), with an appropriate carrier. Generally, treatment is
initiated with
smaller dosages which are less than the optimum dose of the compound.
Thereafter, the dosage is increased by small increments until the optimum
effect
under the circumstance is reached. Determination of the proper dosage and
administration regime for a particular situation is within the skill of the
art.
The preferred biologically active dose of GM-CSF and IL-4 in the practice of
the claimed invention is that dosing combination which will induce maximum
increase in the number of circulating CD14+/CD13+ precursor cells; the
expression
of antigen presenting molecules on the surface of DC precursors and mature DC;
antigen presenting activity to T cells; and/or stimulation of antigen-
dependent T cell
response consistent with mature DC function. In the practice of the invention
the
amount of IL-4 to be used for subcutaneously administration typically ranges
from
about 0.05 to about 8.Opg/kg/day, preferably 0.25 - 6.0 Ng/kg/day, most
preferably
0.50 - 4.0 Ng/kg/day. The amount of GM-CSF is to be used for subcutaneous
administration typically ranges from about 0.25pg/kg/day to about 10.0
pg/kg/day,
11
CA 02434320 2003-07-02
WO 02/058723 PCT/US02/01849
preferably from about 1.0 - 8.0 Ng/kg/day, most preferably 2.5 - S.ONg/kg/day.
An
effective amount for a particular patient can be established by measuring a
significant change in one or more of the parameters indicated above.
It has been found that the administration of chemokine MCP-4 or a
biologically active fragment of MCP-4 promotes the recruitment of dendritic
cells in
vivo in the mouse in a dose-dependent manner and is also active on human
dendritic cells isolated from blood. Biologically active fragment means a
portion of
the MCP-4 molecule which is sufficient to stimulate a measurable immune
response.
This response can be measured as an enhanced antigen specific stimulation of
immunoglobulin levels in serum, typically known as a B-cell response. In
addition, a
biologically active fragment of MCP-4 will stimulate the production of certain
classes
of immunoglobulins such as IgG2a that require an increase in T Cells. In
addition, a
biologically active fragment of MCP-4 will enhance an antigen-specific anti-
tumor
response. An enhanced response could be measured by a slower tumor growth or
lower tumor incidence following challenge with a tumor expressing the antigen.
An
enhanced immune response could also be measured by analyzing the antigen-
specific cytotoxic response of defined populations of lymphocytes (blood,
spleen,
lymph nodes, tumor). Of course, it is recognized that small molecules that are
CCR2 agonists (e.g., found by drug discovery screen) would also enhance the
antigen-specific anti-tumor response. The rationale is that all MCPs (1-4) are
natural CCR2 agonists, and subsequently an artificial, small molecule agonist
may
have the same effect. Many current therapeutics are small molecules obtained
by
organic chemistry synthesis.
Preferred embodiments consist of but are not restricted to recombinant
hMCP-4 protein alone or combined with substances allowing for its slow release
at
delivering site (depot); fusions proteins consisting of hMCP-4 or fraction of
hMCP-4
and an antigen (peptide more than 9 amino acids or protein); DNA or viral
vector
encoding for hMCP-4 or fraction of hMCP-4 with or without an antigen (peptide
more
than 9 amino acids or protein), or a nucleic acid sequence included in a
delivery
vector.
Human MCP-4 (hMCP-4) belongs to the CC family of chemokines. Its
sequence was first published in 1996. (Uguccioni et a1.,1996, Monocyte
Chemotactic Protein 4 (MCP-4), A Novel Structural and Functional Analogue of
12
CA 02434320 2003-07-02
WO 02/058723 PCT/US02/01849
MCP-3 and Eotaxin, J. Exp. Med. 183:2379-2394). Human MCP-4 is a peptide of
8.6 kDa that consists of 75 amino acid residues. (Fig. 3.) It is also known as
CK-~-
10, SCY-A13 and NCC-1 (Swiss-Prot accession number Q99616) and was renamed
CCL13 in the new chemokine nomenclature. (Zlotnik et al., 2000, Chemokines: A
New Classification System and Their Role In Immunity, Immunity, 12:121-127).
6Ckine belongs to the CC family of chemokines (Hedrick, et al., 1997, J.
Immunol. 159: 1589-1593.) It is also known as CK-a-9, exodus-2 and SLC (Swiss-
Prot accession number 000585 for human protein) and was renamed CCL21.
Human 6Ckine (h6Ckine) binds to the chemokine CCR7 while mouse 6Ckine
(m6Ckine) binds to CCR7 as well as to the CXCR3 receptor, although with a
lower
affinity (Jenh, et al., 1999, J. Immunol. 162: 3765-3769.) Mouse 6Ckine has
been
shown to have anti-tumor effect when injected into tumors in mice (Sharma, et
al.,
2000, J. Immunol. 164: 4558-4563.)
6Ckine like MIP-3a and MCP-4 induces the migration of mature DC.
Interestingly, 6Ckine, as well as MIP-3~3 can induce the migration of all
human DC
populations after maturation, including CD1 a+ Langerhans cells, CD14+
interstitial
DC, monocyte-derived DC, circulating blood CD11c+ DC, monocytes, and
circulating
blood CD11c- plasmacytoid DC. The response to 6Ckine is observed after
maturation induced by several DC activators, including CD40-L, TNF-a, and LPS.
As seen in the case of MIP-3~3, CCR7 is up-regulated during DC activation, via
6Ckine, likely explaining the response to 6Ckine.
It is therefore proposed that the chemokine h6Ckine could be used in cancer
treatment. Preferred embodiments consist of but are not restricted to:
recombinant
h6Ckine protein alone or combined with substances allowing for its slow
release at
delivering site (depot at tumor site); fusion proteins or constructs made by
chemical
ligation consisting of h6Ckine or fraction of h6Ckine and a targeting moiety
allowing
delivery of the construct into tumors (e.g., antibody or fragment of antibody,
protein
ligand, peptide of more than 10 amino acids); DNA or viral vector (e.g.,
adenovirus)
encoding for h6Ckine or fraction of h6Ckine with or without a targeting moiety
as
described above.
13
CA 02434320 2003-07-02
WO 02/058723 PCT/US02/01849
EXAMPLES
The invention can be illustrated by way of the following non-limiting
examples,
which can be more easily understood by reference to the following materials
and
methods.
Hematopoietic factors, reagents and cell lines. Recombinant GM-CSF (specific
activity: 2.106 U/mg, Schering-Plough Research Institute, Kenilworth, NJ) was
used
at a saturating concentration of 100 ng/ml. Recombinant human TNFa (specific
activity: 2x10 U/mg, Genzyme, Boston, MA) was used at an optimal concentration
of 2.5 ng/m. Recombinant human SCF (specific activity: 4x105 U/mg, R&D
Abington, UK ) was used at an optimal concentration of 25 ng/ml. Recombinant
human IL-4 (specific activity: 2.10 U/mg, Schering-Plough Research Institute,
Kenilworth, NJ) was used at a saturating concentration of 50 U/ml. Recombinant
human chemokines MIP-1a (specific activity: 2x105 U/mg, 9x102 U/M), RANTES
(specific activity: 1x104 U/mg, 8x10~~ U/M), MIP-3a (specific activity: 4x105
U/mg,
3x102 U/M) and MIP-3(3 (specific activity: 1x104 U/mg, 9x10~~ U/M) were
obtained
through R&D (Abington, UK). LPS was used at 10 ng/ml (Sigma).
The murine CD40 ligand transfected cell line (CD40-L L cells) was used as a
stimulator of DC maturation.
Generation of DC from cord blood CD34+ HPC. Umbilical cord blood samples were
obtained following full term delivery. Cells bearing CD34+ antigen were
isolated
from mononuclear fractions through positive selection as described (Caux, et
al.,
1996, J. Exp. Med. 184:695-706; Caux, et al., 1990, Blood. 75:2292-2298),
using
anti-CD34+ monoclonal antibody (Immu-133.3, Immunotech Marseille, France),
goat anti mouse IgG coated microbeads (Miltenyi Biotec GmBH, Bergish Gladbach,
Germany) and Minimacs separation columns (Miltenyi Biotec). In all experiments
the isolated cells were 80% to 99% CD34+. After purification, CD34+ cells were
cryopreserved in 10% DMSO.
Cultures were established in the presence of SCF, GM-CSF and TNFa as
described (Caux, et al., 1996, J. Exp. Med. 184:695-706) in endotoxin-free
medium
consisting of RPMI 1640 (Gibco, Grand Island, NY) supplemented with 10% (v/v)
heat-inactivated fetal bovine serum (FBS) (Life Techniques, France, Irvine,
UK), 10
mM Hepes, 2 mM L-glutamine, 5x10-5 M ~i-mercaptoethanol, 100 pg/ml gentamicin
(Schering-Plough, Levallois, France) (referred to as complete medium). After
thawing, CD34+ cells were seeded for expansion in 25 to 75 cm2 culture vessels
(Linbro, ICN Biomedicals, Acron, OH) at 2x104 cells/ml. Optimal conditions
were
maintained by splitting these cultures at day 5 and 10 with medium containing
fresh
14
CA 02434320 2003-07-02
WO 02/058723 PCT/US02/01849
GM-CSF and TNFa (cell concentration: 1-3x105 cells/ml). At day 12, between 70
to
90% of the cells are CD1 a+ DC.
Isolation of immature and mature DC according to CD86 expression by FACS-
sorting. After 12 days of culture in presence of GM-CSF and TNFa, cells were
collected and labeled with FITC-conjugated OKT6 (CD1a) (Ortho Diagnosis
System, Raritan, NJ) and PE-conjugated IT2.2 (CD86) (Pharmingen, San Diego,
CA). Cells were separated according to CD1 a and CD86 expression into immature
CD1a+CD86-, and mature CD1a+CD86+ DC populations using a FACStarplus~
(laser setting: power 250 mW, excitation wavelength 488 nm, Becton-Dickinson,
Sunnyvale, CA). All the procedures of staining and sorting were performed in
presence of 0.5 mM EDTA in order to avoid cell aggregation. Reanalysis of the
sorted populations showed a purity > 98%.
Generation of DC from peripheral blood monocytes. Monocytes were purified by
immunomagnetic depletion (Dynabeads, Dynal Oslo, Norway) after preparation of
PBMC followed by a 52% Percoll gradient. The depletion was performed with anti-
CD3 (OKT3), anti-CD19 (4G2), anti-CD8 (OKTB), anti-CD56 (NKH1, Coulter
Corporation, Hialeah, FL) and anti-CD16 (10N16, Immunotech) monoclonal
antibodies. Monocyte-derived dendritic cells were produced by culturing
purified
monocytes for 6-7 days in the presence of GM-CSF and IL-4 (Sallusto, et al.,
1994,
J. Exp. Med. 179:1109-1118).
Induction of maturation of in vitro generated DC. CD34+ HPC were cultured
until
day 6 in presence of GM-CSF+TNFa and in presence of GM-CSF alone from day 6
to day 12 in order to preserve their immaturity. Immature DC from CD34+ HPC or
monocyte-derived DC were activated for 3h to 72h in presence of TNFa (2.5
ng/ml)
or LPS (10 ng/ml) or CD40L transfected L cells (1 L cells for 5 DC) as
described
(Caux, et al., 1994, J. Exp. Med. 180:1263-1272) .
Purification of CD11c+ DC from peripheral blood or tonsils. CD11c+ DC were
prepared as previously described from peripheral blood or tonsils (Grouard, et
al.,
1996, Nature 384:364-367). Briefly, tonsils obtained from children undergoing
tonsillectomy were finely minced and digested with collagenase IV and DNase I
(Sigma). The collected cells were centrifuged through Ficoll-Hypaque with SRBC
(BioMerieux, Lyon, France) for 15 min at 500 rpm, then for 30 min at 2000 rpm.
Peripheral blood mononuclear cells (PBMC) were isolated by Ficoll-Hypaque.
CD3+
T cells (OKT3), CD19+ B cells (4G7), and CD14+ monocytes (MOP9) were removed
from the resulting low density cells by magnetic beads (anti-mouse Ig-coated
Dynabeads, Dynal). A second depletion was performed with anti-NKH1, anti-
CA 02434320 2003-07-02
WO 02/058723 PCT/US02/01849
glycophorine A (Immunotech) and anti-CD20 (1 F54). The remaining cells were
stained with the following mAbs: anti-CD1a FITC (OKT6); anti-CD14 FITC, anti-
CD57 FITC, anti-CD16 FITC, anti-CD7 FITC, anti-CD20 FITC, anti-CD3 FITC
(Becton Dickinson, Mountain View, CA); anti-CD4 PE-Cy5 (Immunotech) and anti-
s CD11c PE (Becton Dickinson). CD4+CD11c+lineage- DC were isolated by cell
sorting using a FACStarPlus~ (laser setting: power 250 mW, excitation
wavelength
488 nm). All the procedures of depletion, staining and sorting were performed
in
presence of 0.5 mM EDTA. Reanalysis of the sorted population showed a purity >
97%.
Chemotaxis assay. Cell migration was evaluated using a chemotaxis microchamber
technique (48-well Boyden microchamber, Neuroprobe, Pleasanton, CA) (Bacon, et
al., 1988, Br. J. Pharmacol. 95:966-974). Briefly, human recombinant MIP-3a
and
MIP-3~3, MIP-1a and RANTES were diluted to concentrations ranging from 1 ng/ml
to 1000 ng/ml in RPMI 1640 medium, and were added to the lower wells of the
chemotaxis chamber. 105 cells/well (or 5x104 cells/well for CD11c+ DC) in 50p1
of
RPMI 1640 medium were applied to the upper wells of the chamber, with a
standard
5-Nm pore polyvinylpyrrolidone-free polycarbonate filter (Neuroprobe)
separating the
lower wells. The chamber was incubated at 37°C in humidified air with
5% C02 for
1 h. Then, cells which had migrated to the underside of the filter were
stained with
Field's A and Field's B (BDH, Dorcet, England) and counted using an image
analyzer (software: Vision Explorer and ETC 3000, Graphtek, Mirmande, France)
in
two randomly selected low power fields (magnification x 20). Each assay was
performed in duplicate and the results were expressed as the mean ~ SD of
migrating cells per 2 fields.
Extraction of total RNA and Synthesis of cDNA. Cells were prepared as
described
above, and total RNA was extracted by the guanidinium thiocyanate method as
mentioned by the manufacturer (RNAgents total RNA isolation system, Promega).
After DNAse I (RQ1 RNAse free DNAse, Promega) treatment, RNA was quantified
by spectrophotometry and the quality was evaluated by electrophoresis in
formaldehyde denaturing conditions. First strand cDNA was synthesized from
total
RNA extracted in RNAse-free conditions. The reaction was performed with 5 ~g
of
total RNA, 25 ng/Nl oligo dTl2-18 primers (Pharmacia, Orsay, France) and the
Superscript kit (Superscript II RNase H- Reverse Transcripase, Gibco BRL), as
described by the manufacturer. For all samples, synthesis of cDNA was
controlled
and calibrated by RT-PCR using ~i-actin primers for 21 cycles.
RT PCR analysis. Semi-quantitative PCR was performed in a Perkin Elmer 9600
thermal cycler, in a final volume of 100 NI reaction mixture containing 2.5 U
16
CA 02434320 2003-07-02
WO 02/058723 _ _... .. PCT/US02/01849 ...
AmpIiTaq enzyme (50/N1, Perkin Elmer, Paris, France) with its 1X buffer, 0.2
mM of
each dNTP (Perkin Elmer, Paris, France), 5% DMSO, and 1 pM of each forward and
reverse primers. CCR6 (Accession No. 279784) and CCR7 (Accession No. L08176)
primers were designed within regions of lowest homology between the chemokine
receptors. +80/CCR6 5'- ATTTCAGCGATGTTTTCGACTC -3' forward primer,
-1081/CCR6 5'- GGAGAAGCCTGAGGACTTGTA -3' reverse primer, +154/CCR7
5'-GATTACATCGGAGACAACACC -3' forward primer and -1202/CCR7
5'-TAGTCCAGGCAGAAGAGTCG -3' reverse primer were used for RT-PCR and
sequencing. For both chemokine receptors, the reaction mixture was subjected
to 30
and 35 cycles of PCR with the following conditions : 94°C for 1 min,
61.5°C for 2 min
and 72°C for 3 min. PCR products were visualized on 1.2% agarose gels
containing
0.5 Ng/ml ethidium bromide. Reaction products migrating at the predicted size
(1,021
by for CCR6 and 1,067 by for CCR7) were gel purified and subcloned into pCRll
TA
cloning vector (Invitrogen, Leek, The Netherlands) for sequencing verification
on an
ABI 373A Sequencer (Applied Biosystems, Foster City, CA.) using dye terminator
technology. Two other oligonucleotides, -622/CCR6
5'-GCTGCCTTGGGTGTTGTATTT -3' and +662/CCR7 5'
AGAGGAGCAGCAGTGAGCAA -3', were used as probes for hybridization with the
PCR products separated on 1.2% agarose gel and blotted onto Hybond N+
membranes (Amersham, Les Ulis, France).
Calcium fluorimetry. Intracellular Ca2+ concentration was measured using the
fluorescent probe Indo-1, according to the technique reported by Grynkiewicz
et al.
(J. Biol. Chem., 1985, 260:3440-3450) Briefly, cells were washed in PBS and
resuspended at 107 cells/ml in complete RPMI 1640 medium (see above). Then,
cells were incubated for 45 min at room temperature with 3 Ng/ml Indo-1 AM
(Molecular Probes) in the dark. After incubation, cells were washed and
resuspended in HBSS/1 % FCS at 107 cells/ml. Before measurement of
intracellular
Ca2+ concentration, cells were diluted 10 fold in HBSS/10 mM Hepes/1.6 mM
CaCl2
preheated at 39°C. Samples were excited at 330 nm with continuous
stirring and
the Indo-1 fluorescence was measured as a function of time at 405 nm (dye is
complexed with Ca2+) and 485 nm (Ca2+-free medium), in a 810 Photomultiplier
Detection System (software: Felix, Photon Technology International, Monmouth
Junction, NJ). Results are expressed as the ratio of values obtained at the
two
emission wavelengths.
In situ hybridization. In situ hybridization was performed as described
(Peuchmaur,
et al., 1990, Am. J. Pathol. 136:383-390). Two couple primers were used for
amplifying by RT-PCR the majority of the open reading frame of MIP-3a
(Accession
No. D86955) and MIP-3(3 3a (Accession No. 077180) genes. +77/MIP-3a 5'-
17
CA 02434320 2003-07-02
WO 02/058723 PCT/US02/01849
TTGCTCCTGGCTGCTTTG -3' forward primer and -425/MIP-3a 5'-
ACCCTCCATGATGTGCAAG -3' reverse primer, +25/MIP-3~i 5'-
CTGCTGGTTCTCTGGACTTC -3' forward primer and -439/MIP-3~i 5'-
CACACTCACACTCACACACAC -3' reverse primer, were used as described above
with an annealing temperature at 62°C. Then, PCR products were cloned
into pCRll
TA cloning vector (Invitrogen, Leek, The Netherlands) for the generation of
sense
and anti-sense probes with the adapted promoters. Sense and antisense 35S-
labeled probes of MIP-3a and MIP-3~i, were obtained by run off transcription
of the
367 by and 435 by fragments, respectively. Six Nm human tonsil sections were
fixed in acetone and 4% paraformaldehyde followed by 0.1 M
triethanolamine/0.25%
acetic anhydride. The sections were hybridized overnight, RNAse A treated and
exposed for 24 days. After development sections were stained with hematoxylin.
Example 1
Differential responsiveness fo MIP-3a and MIP-3~
during development of CD34+-derived DC
To understand the regulation of DC traffic the response to various
chemokines of DC at different stages of maturation was studied. DC were
generated
from CD34+ HPC cultured in the presence of GM-CSF+ TNFa, and tested at
different days of culture for their ability to migrate in response to
chemokines in
Boyden microchambers. MIP-3a and MIP-3~ recruited 2 to 3 times more CD34+-
derived DC than MIP-1a or RANTES. However, MIP-3a and MIP-3~ attracted DC
collected at different time points of the culture. The response to MIP-3a was
already
detected at day 4, maximal at day 5-6 and lasted until day 10. At day 13 to
14, the
response to MIP-3a was usually lost. In contrast, the response to MIP-3a,
which
could not be detected before day 10, peaked at day 13, and persisted beyond
day
15. Of note, at early time points, when most of the cells in culture were
still DC
precursors (CD1a-CD86-), the response to MIP-3a could be detected at
concentrations of 1 to 10 ng/ml (depending on the experiment). In contrast,
four
days later, when almost all cells were immature DC (CD1 a+CD86-), >_300 ng/ml
were needed to attract the cells, suggesting a progressive desensitization of
the
cells during maturation. Relatively high concentrations of MIP-3~i (300 ng/ml)
were
also needed to recruit mature DC (CD1a+CD86+). Checkerboard analysis
established that MIP-3a and MIP-3(3 induced chemotaxis and not chemokinesis of
DC.
To confirm the relation between the stage of maturation and the response to
MIP-3a and MIP-3~, CD34+-derived DC were sorted by FACS at day 10 of culture
according to CD86 expression into immature DC (CD1a+CD86-) and mature DC
18
CA 02434320 2003-07-02
WO 02/058723 PCT/US02/01849
(CD1 a+CD86+). CD1 a+CD86- responded exclusively to MIP-3a while
CD1a+CD86+ responded mainly to MIP-3~i. These observations also confirmed that
the cells recruited by MIP-3a and MIP-3~ were indeed DC (CD1a+). The
correlation between DC maturation and chemokine responsiveness was further
illustrated when the immaturity of DC was preserved by removing TNFa from day
6
to day 12 and when their maturation was synchronized by addition of TNFa, LPS
or
CD40L. Response to MIP-3a had strongly decreased upon 48h maturation with
TNFa, LPS and CD40L. Meanwhile, the response to MIP-3~3 was induced by all
three signals, CD40L and LPS being more potent than TNFa. In kinetics
experiments, the response to MIP-3a decreased by 50 to 70% after only 24h of
CD40 activation and was completely lost at 72h. The response to MIP-3a was
already maximal after 24h of CD40 activation and required relatively high
concentration of chemokine (100-300 ng/ml at 48h).
Taken together, these results establish that immature CD34+-derived DC
respond to MIP-3a while mature DC respond to MIP-3~3.
Example 2
Responses to MIP-3a and MIP-3~3 parallel the expression
of their respective receptors CCR6 and CCR7 on CD34+-derived DC
To define the mechanisms of regulation of MIP-3a and MIP-3~
responsiveness, the expression of their respective receptors CCR6 (Power, et
al.,
1997, J. Exp. Med. 186:825-835; Greaves, et al., 1997, J. Exp. Med. 186:837-
844;
Baba, et al., 1997, J. Biol. Chem. 272:14893-14898; Liao, et al., 1997,
Biochem.
Biophys. Res. Commun. 236:212-217) and CCR7 (Yoshida, et al., 199, J. Biol.
Chem. 272:13803-13809) mRNA was studied by semi-quantitative RT-PCR. During
DC development from CD34+ HPC, CCR6 mRNA was first detected at day 6,
increased up to day 10 after when it decreased and became barely detectable at
day 14. In contrast, CCR7 mRNA appeared at day 10 and steadily increased up to
day 14. Moreover, CD40L-dependent maturation induced progressive down
regulation of CCR6 mRNA which became almost undetectable after 72h, and up
regulation of CCR7 mRNA as early as 24h. Similar results were obtained after
either LPS or TNFa-induced DC maturation. The up-regulation of CCR7 mRNA
following activation was confirmed by Southern blot analysis of cDNA
libraries.
In line with the migration assays, and the regulation of CCR6 and CCR7
expression, MIP-3 a induced a Ca2+ flux exclusively in resting/immature DC and
MIP-3~ in mature DC only. Maximal Ca2+ fluxes were observed with 30 ng/ml of
MIP-3a and 30 ng/ml of MIP-3a, on immature and mature DC, respectively.
19
CA 02434320 2003-07-02
WO 02/058723 PCT/US02/01849
These results show that changes in responsiveness to MIP-3a and MIP-3~
are linked to the regulation of CCR6 and CCR7 mRNA expression, and suggest
that
CCR6 and CCR7 are the major functional receptors expressed on DC for MIP-3a
and MIP-3~3, respectively.
Example 3
The response to MIP-3/3 is also induced
upon maturation of monocyte-derived DC
Monocyte-derived DC, generated by culturing monocytes in presence of GM-
CSF+IL-4 for 6 days, are typically immature DC (CD1a+, CD14-, CD801ow,
CD861ow, CD83-) (Cella, et al., 1997, Current Opin. Immunol. 9:10-16;
Sallusto, et
al., 1994, J. Exp. Med. 179:1109-1118). They migrated in response to MIP-1«and
RANTES but neither to MIP-3a nor to MIP-3~i. The lack of response of monocyte-
derived DC to MIP-3a is in accordance with the absence of CCR6 expression on
those cells (Power, et al., 1997, J. Exp. Med. 186:825-835; Greaves, et al.,
1997, J.
Exp. Med. 186:837-844). Upon maturation induced by TNFa, LPS, or CD40L,
responses to MIP-1 « and RANTES were lost while response to MIP-3~3 was
induced.
Like with CD34+-derived DC, the response to MIP-3~i correlated with the up-
regulation of CCR7 mRNA expression observed upon maturation induced by TNFa,
LPS or CD40L. Again, up-regulation of CCR7 occurred at early time points (3
h),
after TNFR or CD40 signaling. Moreover, migration and chemokine receptor
expression data were in agreement with Ca2+ flux results.
These results extend to monocyte-derived DC the concept that upon
maturation, DC loose their responsiveness to various chemokines while they
become sensitive to a single chemokine, MIP-3~i.
Example 4
Peripheral blood CD 11 c+ DC migrate
in response to MIP-3~3 after maturation
The chemotactic activities of MIP-3a and MIP-3~i on immature CD11c+ DC
isolated from peripheral blood (or tonsils) also were studied. Freshly
isolated DC did
not migrate in response to MIP-3a, nor to MIP-3~i, an observation which
correlates
with the absence of CCR6 and CCR7 mRNA expression in these cells. However,
the maturation which is known to occur after overnight culture with GM-CSF,
turned
on the response of CD11c+ DC to MIP-3~ but not to MIP-3a. Once more, the
response to MIP-3~i correlated with the induction of CCR7 mRNA expression.
CA 02434320 2003-07-02
WO 02/058723 PCT/US02/01849
Therefore, even though immature CD11 c+ DC freshly isolated from blood
cannot respond to MIP-3a, these results show that the maturation dependent on
responsiveness to MIP-3~3 also applies to ex-vivo isolated DC.
Example 5
In vivo MIP-3a is expressed in inflamed epithelium
and MIP-3~3 within T cell rich areas of tonsils
The physiological relevance of the findings reported in Example 4 was
addressed through the analysis of MIP-3a and MIP-3a mRNA expressions by in
situ
hybridization on sections of inflamed tonsils. mRNA for MIP-3a was detected at
high
levels in inflamed epithelial crypts but not in T cell rich areas nor in B
cell follicles. In
fact, MIP-3a expression was restricted to cells lining the epithelial crypts.
In
contrast, expression of MIP-3(i mRNA was restricted to T cell rich areas. The
strongest signal was present in scattered cells, with a distribution
overlapping that of
IDC. Outside the paracortical area, no signal could be detected in B cell
follicles,
nor in epithelial crypts. Serial sections showed clear absence of MIP-3~i
expression
within epithelial crypts where MIP-3a was abundantly present. Sense probes for
MIP-3a and MIP-3~3, did not generate background hybridization.
Therefore, MIP-3a expression is restricted to inflamed epithelium, at the site
of antigen entry where immature DC should be recruited. In contrast, MIP-3(i
is only
detected in paracortical areas, where mature IDC home and generate primary T
cell
responses.
Example 6
Chemokine MIP-3a administration in an in vitro mouse model
Since MIP-3a was shown by the inventors to be a chemotactic factor for
mouse immature dendritic cells in vitro, the ability of the chemokine MIP-3a
to attract
immature DC in vivo and to modulate the antigen-specific immune response
against
a tumor in vivo was studied. If a tumor-associated antigen is delivered at the
same
time, more DC will be available to capture the antigen, and therefore the
antigen-
specific response against this antigen should be increased.
Chemokine was delivered in vivo via a plasmid vector (pcDNA3, InVitrogen),
that contains the cDNA encoding mouse MIP-3a under the control of the CMV
promoter (PMIP-3a). The antigen used was (3-galactosidase isolated from E.
coli.
21
CA 02434320 2003-07-02
WO 02/058723 PCT/US02/01849
The antigen was delivered in vivo via the same plasmid vector pcDNA3 (called
pLacz). The tumor was a.C26 colon carcinoma syngeneic in BALB/c mice that has
been stably transfected with the gene encoding for ~i-galactosidase.
Therefore, in
this system, ~i-galactosidase defines a tumor-associated antigen.
Groups of 6 female 6 week-old mice were injected with either the empty
pcDNA3 plasmid (negative control), the plasmid pLacz encoding the antigen
alone,
or a mixture of pLacz and PMIP-3a. Injections (50 ~g of total plasmid) were
performed in the hind footpad every week for 4 weeks. After that time, mice
were
injected subcutaneously with the C26 tumor cell line expressing ~3-
galactosidase.
Typically, all mice develop subcutaneous tumors after 10 days. The appearance
of
tumors in these groups of mice were monitored. It was found that the
appearance of
tumors was delayed after pLacz and pLacz+PMIP-a injection. (Fig. 1 ) This
shows
that immunization with a plasmid encoding a tumor-associated antigen has a
protective effect against tumor engraftment. The delay was greater with
pLacz+PMIP-3a than with pLacz, suggesting that the chemokine MIP-3a increases
the tumor associated antigen-specific immune response when delivered with the
antigen.
It is believed that a good anti-tumor response is associated with a strong T
cell-mediated antigen-specific cytotoxicity (CTL activity). Therefore, the CTL
activity
in the same groups of mice was analyzed 30 days after tumor inoculation.
Spleen
cells were removed and stimulated for five days with irradiated syngeneic DC
plus
an immunodominant CTL peptide derived from ~-galactosidase in the presence of
interleukin-2. Then their ability to lyse a cell line stably transfected with
the gene
encoding for ~i-galactosidase (P13.1 ) was measured, in parallel with their
ability to
lyse the parental cell line P815 that does not express ~-galactosidase. (Fig.
2) This
was done using different ratios of effectors (splenocytes) versus targets
(P13.1 or
P815). The results show that mice injected with pLacz+P-MIP-3a prior to tumor
challenge have a greater CTL activity than mice injected only with pLacz or
with
PCDNA3 alone, against the tumor-associated antigen ~-galactosidase.
22
CA 02434320 2003-07-02
WO 02/058723 PCT/US02/01849
Example 7
Chemokine hMCP-4 administration
in an in vivo mouse model
The inventors have shown that hMCP-4 local injection can promote the
recruitment of dendritic cells in vivo in the mouse in a dose-dependent
manner.
(Fig. 4)
6- to 10-week-old female BALB/c mice were purchased from Charles River
(Iffa-Credo, L'Arbresle, France) and maintained in our facilities under
standard
conditions. Procedures involving animals and their care were conducted in
conformity with EEC (European Economic Community) Council Directive 86/609,
OJL 358,1, December 12, 1987. Recombinant human MCP-4 protein, >97% pure
(Fig. 3), was obtained from Peprotech and resuspended in PBS (Gibco-BRL).
Groups of three mice were injected with PBS alone or varying amounts of human
MCP-4 in PBS, intracutaneously in the right hind footpad under a 50p, volume.
Mice
were sacrificed after 2 or 20 hours and the skin at the site of injection as
well as the
popliteal lymph node, draining the injection site, removed. Local cell
recruitment in
the skin was examined by immuno-histochemistry with specific monoclonal
antibodies according to standard techniques. Cell suspensions were prepared
from
lymph nodes in RPMI 1640 + 10% fetal calf serum (FCS) (Gibco-BRL). Cell were
numerated and stained in PBS + 2% FCS with biotin-CD11 c and FITC-CD11 b
antibodies (Becton Dickinson), followed by PE-streptavidin (Dako), according
to
standard procedures. Expression of CD11b and CD 11c, that define populations
of
mouse dendritic cells, was analyzed on a Facscan flow cytometer (Becton
Dickinson) using the CeIIQuest software. From this analysis and numeration,
the
number of CD11 b+CD11 c+ in each lymph node was determined. These
experiments show (A) that local injection of hMCP-4 is able to induce the
recruitment of cells expressing CD11 b at the site of injection after a short
period (2
hours). These cells could be mouse blood dendritic cells or dendritic cell
precursors
such as monocytes, since both can express CD11 b. In the mouse, no circulating
blood dendritic cells have been identified, due to limitations in techniques.
In
humans, however, blood dendritic cells can be isolated and they respond in
chemotaxis assays to hMCP-4 (Fig. 3). (B) In the draining lymph node, where
antigen-specific immune responses are initiated, hMCP-4 induces the
recruitment of
dendritic cells identified by the co-expression of CD11 b and CD11 c, but only
after a
longer period (20 hours). This delay most likely corresponds to the maturation
and
23
CA 02434320 2003-07-02
WO 02/058723 PCT/US02/01849
migration time necessary for dendritic cells or their precursors, initially
recruited in
the skin, in order to migrate to the draining lymph node.
Example 8
Response of dendritic cells derived from human blood to hMCP-4
hMCP-4 is also active on human dendritic cells, including dendritic cells
isolated from blood. (Fig. 5)
Panel A: Human circulating blood CD11 c+ DC were enriched by magnetic
bead depletion, and studied in transwell (5~m pore size) migration assay, in
response to various chemokines. The migration was revealed after 2 hours by
triple
staining: lineage markers FITC, HLA-DR tricolor, and CD11 c PE, and analyzed
by
Facs. Each chemokine was tested over a wide range of concentrations (1 to 1000
ng/ml) and only the optimal response is shown. Results are expressed as
migration
index and represent the mean values obtained from 3 to 10 independent
experiments. Blood CD11c+ mainly respond to MCP-4 as well as to MCP1, 2 and 3
(not shown). SDF-1, lacking selectivity, being the only other chemokine
strongly
active on CD11c+ DC.
Panel B: Different human DC and DC precursor populations including blood
CD11 c+ DC, monocytes, monocyte-derived DC, CD1 a+ Langerhans cell precursors
and CD14+ interstitial DC precursors were studied in transwell (5~m pore size)
migration assay, in response to MCP-1 and MCP-4. All populations respond to
MCP-4 except CD1a+ Langerhans cell precursors. In addition monocyte-derived DC
respond to MCP-4 but not to MCP-1, through a receptor different from CCR2.
Importantly MCP-4 is active on human DC. In particular, compared to other
chemokines MCP-4 is the most potent chemokine inducing the migration of
circulating blood CD11 c+ DC. MCP-1, and MCP-2 and MCP-3 display a similar
activity on blood DC. The MCPs likely recruit blood DC through CCR2 which is
highly expressed on these cells. In addition, MCP-4 is active on all DC or DC
precursors populations (blood CD11 c+DC, monocytes, monocyte-derived DC,
CD14+ interstitial type DC precursors) except the CD1a+ Langerhans cell
precursors
which do not express CCR2. Finally MCP-4, but not MCP-1 induces the migration
of
monocyte derived DC, likely through a receptor different from CCR2.
24
CA 02434320 2003-07-02
WO 02/058723 PCT/US02/01849
Example 9
hMCP-4 and ~galactosidase administration
in an in vivo mouse model
Furthermore, hMCP-4 can be used as adjuvant of an antigen-specific immune
response induced by plasmid DNA vaccination. In addition, when hMCP-4 is used
as adjuvant of plasmid DNA vaccination, it can increase the protection of mice
subsequently challenged with a tumor expressing the antigen encoded by the
plasmid DNA.
Groups of seven 6 to 8 week-old female BALB/c mice (Iffa-Credo, L'Arbresle,
France) were injected with PBS alone or 100.ng of human MCP-4 in PBS,
intracutaneously in the right hind footpad under a 50 p1 volume. After three
hours,
mice were injected at the same site with 50 p,g of control pcDNA3 plasmid
(InVitrogen) or 50 ~,g of pcDNA3 plasmid encoding for beta-galactosidase under
the
CMV promoter (pLacz, InVitrogen), under a 50 p1 volume of PBS. This
immunization
protocol was repeated four times at one week interval.
Serum was collected one day before the first immunization and one week
after the last immunization. Levels of beta-galactosidase specific
immunoglobulins
in serum were measured with specific ELISA assays as previously described
(Mendoza et al., 1997, J. Immunol. 159:5777-5781 ).
As seen in Fig. 6, MCP-4 injection increases the antigen-specific humoral
response following beta-galactosidase DNA immunization (50 micrograms DNA
injection 3 hours after 100 ng hMCP-4 injection in rear right footpad). Figure
6
shows anti-betagalactosidase antibodies measured after 4 immunizations
[significance hMCP-4 + pLacz compared with PBS + pLacz: Student's test.]
One week after the last immunization, groups of mice were challenged with a
subcutaneous injection in the right flank of 5 x 104 C26-BAG colon carcinoma
cells
which express beta-galactosidase (a kind gift from Mario Colombo, Instituto
Nazionale Tumori, Milan, Italy), under a 100 p1 volume of RPMI-1640. The onset
of
tumors was appraised three times a week by palpation.
CA 02434320 2003-07-02
WO 02/058723 PCT/US02/01849
As seen in Fig. 7, MCP-4 injection increases the anti-tumor effect induced by
beta-galactosidase DNA immunization (50 micrograms DNA injection 3 hours after
100 ng hMCP-4 injection in rear right footpad, four immunizations prior to
tumor
challenge) when mice are challenged with a C26 colon carcinoma cell line that
expresses beta-galactosidase [significance hMCP-4 + pLacz compared with PBS +
pLacz : p<0.05 logrank MCP-4 opp: hMCP-4 injected at distant site.]
Examples 7-9 thus indicate that the chemokine hMCP-4 can be used as
adjuvant of immune responses, in particular anti-tumor responses. The enhanced
immune response as mediated by MCP-4 administration has been measured as
enhanced antigen-specific immunoglobulin levels in serum. Thus, there is
clearly an
enhancement of B cell responses to MCP-4 administration. In addition, since
there
is an increase in subclasses of immunoglobulins such as IgG2a, that require T
Cell
mediated help for switch, it is likely that there is an increase in T Cell
mediated
responses as well.
Example 10
Response of human dendritic cells to h6Ckine chemokine
In this example, the inventors have shown that human 6Ckine (h6Ckine) is a
chemotactic factor for all known subsets of dendritic cells in man, in vitro.
In
particular, h6Ckine is active on human blood dendritic cells following a short
3 hour
incubation with GM-CSF, IL-3 and CD40L. (Fig. 8)
Different human DC populations including CD1a+ Langerhans cell, CD14+
interstitial DC, monocyte-derived DC, circulating blood CD11 c+ DC, monocytes,
and
circulating blood CD11 c- plasmacytoid DC were studied in migration assay, in
response to human 6Ckine before and after maturation. CD34-derived DC
precursors were isolated by Facs-sorting according to CD1a and CD14 expression
after 6 days of culture in presence of GM-CSF+TNF and SCF. Cells were cultured
until day 12 in GM-CSF alone (immature) or GM-CSF+CD40-L (mature) for the last
two days. Monocyte-derived DC were generated by culturing monocytes in
presence
of GM-CSF+IL-4 for 5 days and activated (mature) or not (immature) with CD40-L
for the last 2 days. Human circulating blood CD11c+ DC and CD11c- plasmacytoid
DC were enriched by magnetic bead depletion, and facs-sorted using triple
staining
26
CA 02434320 2003-07-02
WO 02/058723 PCT/US02/01849
into lineage markers FITC negative, HLA-DR tricolor positive, and CD11c PE
positive and negative. CD11c+ DC and CD11c- plasmacytoid DC were cultured for
three hours in presence of GM-CSF+IL-.3 with (mature) or without (immature)
CD40-
L.
Migration assays were carried out during 1 to 3 hours using 5 or 8~m pore size
Transwell (6.5mm diameter, COSTAR, Cambridge, MA), and revealed by facs
analysis. All populations respond to 6Ckine but only after CD40-L activation.
Example 11
Chemokine m6Ckine gene transfer in tumor models
In this example, the inventors have shown that:
C26 colon carcinoma tumor cells engineered to express m6Ckine are less
tumorigenic and that this effect depends on CD8+ cells and Natural Killer cell
activity, in vivo. (Fig. 9);
C26 tumors expressing m6Ckine are significantly infiltrated by dendritic cells
and CD8+T cells compared with parental tumors. (Fig. 10); and
C26 colon carcinoma tumor cells engineered to express m6Ckine are less
angiogenic than the parental C26 tumor. (Fig. 11 )
6- to 10-week-old female BALB/c (H-2d) mice were purchased from Charles
River (Iffa-Credo, L'Arbresle, France) and maintained under standard
conditions.
Procedures involving animals and their care were conducted in conformity with
EEC
(European Economic Community) Council Directive 86/609, OJL 358,1, December
12, 1987. All tumor cell cultures were performed in DMEM (Gibco-BRL, Life
Technologies, Paisley Park, Scotland) supplemented with 10% FCS (Gibco-BRL), 1
mM hepes (Gibco-BRL), Gentallin (Schering-Plough, Union, NJ), 2 x 10-5 M beta-
2
mercaptoethanol (Sigma, St Louis, MO). All cell cultures were performed at
37°C in
a humidified incubator with 5% C02. The cDNA encoding mouse 6Ckine/SLC
(m6Ckine/SLC) was cloned into the pcDNA3 vector (InVitrogen, Carlsbad, CA)
which contains a CMV promoter. C26 colon carcinoma tumor cells (kindly
provided
by Mario P. Colombo, Instituto Nazionale per to Studio a la Cura dei Tumori,
Milano,
Italy) were transfected with this construction using the Fugene reagent (Roche
Molecular Diagnostics, Mannheim, Germany) according to the manufacturer's
instructions. Single C26 clones expressing m6Ckine/SLC mRNA (C26-6CK) were
obtained after neomycin (Sigma) selection at 800 ~g/ml. C26 or C26-6CK tumor
27
CA 02434320 2003-07-02
WO 02/058723 PCT/US02/01849
cells were injected s.c. in the right flank in 100 p1 DMEM and tumor growth
was
monitored by palpation three times a week. For antibody depletion, 0.5 mg of
anti-
CD8 (clone 2.43), rat control (GL113) purified antibodies or 200 ~I rabbit
anti-asialo
GM1 serum (Wako Pure Chemicals, Osaka, Japan) were injected i.p. in 200 ~,I
PBS
one day before tumor inoculation, then 0.2 mg of antibodies or 100 p1 anti-
asialo
GM1 serum were injected after three days and once a week during the course of
the
experiment. Fig. 10 shows that subcutaneous C26-6CK cell injection results in
significantly delayed tumor intake compared to parental tumor cells (p<0.01 )
by
logrank analysis (A and B: C26 + control vs C26-6CK + control). Depleting CD8+
cells (A) or Natural Killer cell activity (B) with specific antibodies in vivo
partially
reverts the delayed tumorigenicity of the C26-6CK tumor cells, indicating that
CD8+
cells and NK cells play a role in delaying tumor growth.
Tumors were surgically removed when reaching an approximate size of 1 cm.
The tumor mass was minced into small fragments and incubated in collagenase A
(Roche Molecular Biochemicals) solution for 30 min at 37°C under
agitation. The
suspension was then washed several times in DMEM. Staining of cell suspensions
was performed in PBS + 5% FCS. Prior to incubation with FITC-, biotin- or PE-
labeled specific antibodies, Fc receptors were blocked using Fc-BIockTM
CD16/CD32
antibody (PharMingen, San Diego, CA). The various antibodies (all from
PharMingen) used in this study were CD8~3 (53-5.8), CD11 c (HL3), anti-MHC
class II
I-Ad/I-Ed (269), CD3 (145-2C11 ). Biotinylated antibodies were revealed with
PE-
streptavidin (Becton Dickinson). Phenotypic parameters were acquired on a
FacScan (Becton Dickinson, Mountain View, CA) and analyzed using the CeIIQuest
software (Becton Dickinson). In Fig. 10, C26 wild-type tumors or C26-6CK
tumors
expressing m6Ckine have been analyzed for CD8 T cells and CD11c+MHC classll+
dendritic cell (DC) infiltration by flow cytometry analysis of whole tumor
suspension
(n=7). Data show a significant recruitment of both leukocyte subsets in C26-
6CK
tumors compared to C26 tumors (Student's t test). These results suggest that
m6Ckine gene transfer into tumors promote both the recruitment of dendritic
cells,
which are essential cells to initiate immune responses, including anti-tumor
responses, as well as CD8 T cells, which are effector cells of the adaptive
immune
response.
28
CA 02434320 2003-07-02
WO 02/058723 PCT/US02/01849
In some experiments, tumors were removed from animals and embedded in
OCT compound (Miles laboratory, Elkhart, IN) before being snap frozen in
liquid
nitrogen and store at -80°C until immunohistochemistry procedures. Five-
micrometer cryostat sections applied onto glass slides were fixed in acetone
and
incubated with 1 % H202 for 10 min at room temperature. Slides were then
incubated
with the biotin-blockTM and avidin-blockTM reagents (both from Vector,
Burlingame,
CA). All incubations were followed by three 2 min-washes in PBS (Gibco-BRL).
Slides were then pre-incubated for 30 min with a 1/10 dilution of serum from
the
same species of the secondary antibody (Dako, Glostrup, Denmark). Slides were
then incubated sequentially with 5 ,ug/ml of purified CD105 (clone MJ7/18,
PharMingen, San Diego, CA), biotinylated secondary antibody (rabbit anti-rat
from
Vector), streptavidin-alkaline (ABC kit from Vector). Enzyme reaction was
developed with the corresponding Vector substrate. Angiogenesis assays were
carried out by determining the hemoglobin content of Matrigel (Becton
Dickinson,
Bedford, MA) pellets containing developing tumors cells in vivo. BALB/c mice
were
injected with 0.5 ml Matrigel mixed with 2 x 105 C26 or C26-6CK cells s.c. in
the
abdominal midline. After nine days, Matrigel pellets were removed, the
surrounding
connective tissue was dissected away and pellets were liquefied in MatriSperse
solution v/v (Becton Dickinson) for 90 min at 4°C. Hemoglobin content
was
determined by the Drabkin method (reagents from Sigma). Figure 11A shows that
C26-6CK tumors are less vascularized than the parental C26 tumor. Figure 11 B
shows that C26-6CK tumor cells are less angiogenic than C26 cells in a
Matrigel
assay. Overall, these results indicate that gene transfer of m6Ckine chemokine
into
tumor has angiostatic effect on the tumor vasculature.
These results indicate that the chemokine 6Ckine could be used in cancer
treatment through gene transfer. Preferred embodiments consist of but are not
restricted to: DNA or viral vector (e.g. adenovirus) encoding for m6Ckine or
h6Ckine
or fraction of m6Ckine or h6Ckine, with or without a targeting moiety (peptide
or
antibody).
Example 12
Local delivery of the
chemokine 6Ckine Into tumors in vivo
29
CA 02434320 2003-07-02
WO 02/058723 PCT/US02/01849
In this example, the inventors have shown that injection of recombinant
human or mouse 6Ckine protein into pre-existing C26 tumors increases survival
of
tumor-bearing mice. Injection of h6Ckine slows tumor growth. (Fig. 12)
6- to 10-week-old female BALB/c (H-2d) mice were purchased from Charles
River (Iffa-Credo, L'Arbresle, France) and maintained under standard
conditions.
Procedures involving animals and their care were conducted in conformity with
EEC
(European Economic Community) Council Directive 86/609, OJL 358,1, December
12, 1987. All tumor cell cultures were performed in DMEM (Gibco-BRL, Life
Technologies, Paisley Park, Scotland) supplemented with 10% FCS (Gibco-BRL), 1
mM hepes (Gibco-BRL), Gentallin (Schering-Plough, Union, NJ), 2 x 10'5 M beta-
2
mercaptoethanol (Sigma, St Louis, MO). All cell cultures were performed at
37°C in
a humidified incubator with 5% C02. C26 cells were provided by Mario P.
Colombo
(Milano, Italy).
C26 tumor cells were injected s.c. in the right flank in 100 ~I DMEM and tumor
growth was monitored by palpation three times a week. In some experiments,
tumor
volume was monitored using a calliper and calculated as: tumor volume = small
diameterz x large diameter x 0.4. For treatment with recombinant chemokines,
mice
were injected intra-tumorally with 10 ng >97% pure recombinant human or mouse
6Ckine/SLC (R&D Systems, Minneapolis, MN) under 50 ~,I PBS. Figure 1 shows
that mice injected with h6Ckine or m6Ckine show improvement in survival
compared
with PBS vehicle alone (A). Injection of h6Ckine also decreased the growth of
tumors (B). These data show that intra-tumor delivery of recombinant 6Ckine
chemokines has anti-tumor effect.
Example 13
rAdl6Ckine mitigation of metastatic tumors
Female mice (BALB/c ByJ; Jackson Laboratories) were injected by
subcutaneous route with 3x10'5 4T1-p53 mammary tumor cells (syngeneic) in a
volume of 0.2 ml (medium) into the left flank of animals. Animals received an
intratumoral injection when the tumor grew to a size of 50-100 mm3 of 100 ~I
of
CMCB (1 e10 PN/injection) in VPBS. Mice received 3 injections per week
(Monday,
Wednesday, Friday) for two weeks. The tumors were measured three times weekly
CA 02434320 2003-07-02
WO 02/058723 PCT/US02/01849
using a caliper (length, width, depth), the tumor volume was calculated
according to
formula:
V=4/3 r3 where
r=(W(mm) + L(mm)+D (mm)) divided by 6
Animals were sacrificed if tumors exceed 1000 mm3.
3 mice from each group were sacrificed, starting at the time when the tumors
reached 50mm3 (typically day 10), and the tumors and lungs were resected for
tissue processing for the biochemical analyses described below and to assess
the
presence of metastases by gross and histological means.
As shown in Fig. 13, 6Ckine inhibits tumor growth and spontaneous
metastasis by in established tumors by augmenting immunity and suppressing
angiogenesis.
Many modifications and variations of this invention can be made without
departing from its spirit and scope, as will be apparent to those skilled in
the art.
The specific embodiments described herein are offered by way of example only,
and
the invention is to be limited only by the terms of the appended claims, along
with
the full scope of equivalents to which such claims are entitled.
31
