Note: Descriptions are shown in the official language in which they were submitted.
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-1-
METHODS AND COMPOSITIONS FOR MODIFYING APOLIPOPROTEIN B
mRNA EDITING
This application claims the benefit of U.S. Provisional Patent
Application Serial No. 60/271,856, filed February 27, 2001, which is hereby
incorporated by reference in its entirety.
This invention was made, at least in part, using funding received from
the U.S. Public Health Service, grant DK43739. The U.S. government may have
certain rights in this invention.
FIELD OF THE INVENTION
The present invention related generally to the chimeric proteins,
compositions and products containing one or more chimeric proteins, as well as
the
use thereof to modify apolipoprotein B processing, to treat or prevent
atherogenic
diseases or disorders, and to modify the intravascular lipoprotein population.
BACKGROUND OF THE INVENTION
Cholesterol is carried in blood by specific carrier proteins called
apolipoproteins and from one tissue to another as lipoprotein particles.
Apolipoprotein
B is an integral and non-exchangeable structural component of lipoprotein
particles
referred to as chylomicrons, very low density lipoprotein ("VLDL"), and low
density
lipoprotein ("LDL"). Apolipoprotein B circulates in human plasma as two
isoforms,
apolipoprotein B 100 and apolipoprotein B48. Apolipoprotein B48 is generated
by an
RNA editing mechanism which changes codon 2153 (CAA) to a translation stop
codon
(UAA) (Chen et al., "Apolipoprotein B-48 is the product of a messenger RNA
with an
organ-specific in-frame stop codon," Science 238:363-366 (1987); Powell et
al., "A
novel form of tissue-specific RNA processing produces apolipoprotein-B48 in
intestine," Cell 50:831-840 (1987)). Editing is a site-specific deamination
event
catalyzed by apolipoprotein B mRNA editing catalytic subunit 1 (known as
APOBEC-
1) (Teng et al., "Molecular cloning of an apo B messenger RNA editing
protein,"
Science 260:18116-1819 (1993)) with the help of auxiliary factors (Teng et
al.,
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-2-
"Molecular cloning of an apo B messenger RNA editing protein," Science
260:18116-
1819 (1993); Yang et al., "Partial characterization of the auxiliary factors
involved in
apo B mRNA editing through APOBEC-1 affinity chromatography," J. Biol. Chem.
272:27700-27706 (1997); Yang et al., "Multiple protein domains determine the
cell
type-specific nuclear distribution of the catalytic subunit required for apo B
mRNA
editing," Proc. Natl. Acad. Sci. USA 94:13075-13080 (1997); Lellek et al.,
"Purification and Molecular cloning of a novel essential component of the apo
B
mRNA editing enzyme complex," J. Biol. Chem. 275:19848-19856 (2000); Mehta et
al., "Molecular cloning of apobec-1 complementation factor, a novel RNA-
binding
protein involved in the editing of apolipoprotein B mRNA," Mol. Cell. Biol.
20:1846-
1854 (2000); Yang et al., "Induction of cytidine to uridine editing on
cytoplasmic
apolipoprotein B mRNA by overexpressing APOBEC-l," J. Biol. Chem. 275:22663-
22669 (2000); Blanc et al., "Identification of GRY-RBP as an apoB mRNA binding
protein that interacts with both apobec-1 and with apobec-1 complementation
factor
(ACF) to modulate C to U editing," J. Biol. Chem. 276:10272-10283 (2001)) as a
holoenzyme or editosome (Smith et al. "In vitro apolipoprotein B mRNA editing:
Identification of a 27S editing complex," Proc. Natl. Acad. Sci. USA 88:1489-
1493
( 1991 ); Harris et al., "Extract-specific heterogeneity in high-order
complexes
containing apo B mRNA editing activity and RNA-binding proteins," J. Biol.
Chem.
268:7382-7392 (1993)). Apolipoprotein B100 and apolipoprotein B48 play
different
roles in lipid metabolism, most importantly, apolipoprotein B 100-associated
lipoproteins (VLDL and LDL) are much more atherogenic than apolipoprotein B48-
associated lipoproteins (chylomicrons and their remnants and VLDL).
Specifically, the apolipoprotein B48-associated lipoproteins are cleared
from serum more rapidly than the apolipoprotein B100-associated lipoproteins.
As a
result, apolipoprotein B48-VLDL usually are not present in serum for an amount
of
time sufficient for serum lipases to convert the VLDL to LDL. In contrast, the
apolipoprotein B100-VLDL are present in the serum for sufficient amounts of
time,
allowing serum lipases to convert the VLDL to LDL. Elevated serum levels of
LDL
are of particular biomedical significance as they are associated with an
increased risk of
atherogenic diseases or disorders. Lipoprotein analyses have shown that the
ability of
mammalian liver to edit results in a lowering of the VLDL + LDL : HDL ratio.
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-3-
Therefore, it would be desirable to identify an approach for modifying
apolipoprotein
B editing which would favor an increase in the relative concentration of
apolipoprotein
B48 in proportion to apolipoprotein B 100 (or total apolipoprotein
concentration),
thereby clearing a greater concentration of lipoproteins from serum and
minimizing the
atherogenic risks associated with high serum levels of VLDL and LDL.
Cuwent lipid-lowering therapies include statins and bile-acid-binding
resins. Statins are competitive inhibitors of hydroxymethylglutaryl-coenzyme A
(HMG-CoA) reductase, which catalyzes the committed step in the synthesis of
cholesterol (Davignon et al., "HMG-CoA reductase inhibitors: a look back and a
look
ahead," Can. J. Cardiol. 8:843-64 ( 1992)). Bile-acid-binding resins sequester
bile acids
in the intestine, thereby interrupting the enterohepatic circulation of bile
acids and
increasing the elimination of cholesterol from the body. These are effective
therapies
for some patients with hyperlipidemia; however, adverse effects have been
observed in
up to 30% of the patients, suggesting the need for alternative therapies.
Mutations in
the gene encoding the LDL-receptor or apolipoprotein B can cause a human
genetic
disease known as familial hypercholesterolemia, characterized by an elevated
level of
cholesterol and early atherosclerosis due to the defect in LDL-receptor
mediated
cholesterol uptake by cells (Goldstein et al., Familial hypercholesterolemia,"
In The
Metabolic and Molecular Bases of Inherited Disease, Vol. 2., p1981-2030,
Scriver et
al. (eds.), McGraw-Hill, New York (1995)). Therapy for children with this
disorder is
needed in order to prevent morbidity or mortality, however the National
Cholesterol
Education Program (NCEP) recommends consideration of drug treatment only for
children 10 years of age or older due to the risk that prolonged drug therapy
may
impair growth and pubertal development. Developing alternative approaches for
lowering serum LDL levels is therefore essential for the sectors of the
population still
at risk.
Stimulating hepatic apolipoprotein B mRNA editing is a means of
reducing serum LDL through the reduction in synthesis and secretion of
apolipoprotein
B100 containing VLDL. In most mammals (including humans), apolipoprotein B
mRNA editing is carried out only in the small intestine. The presence of
substantial
editing in liver (found in 4 species) is associated with a less atherogenic
lipoprotein
profile compared with animals that do not have liver editing activity (Greeve
et al.,
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-4-
"Apolipoprotein B mRNA editing in 12 different mammalian species: hepatic
expression is reflected in low concentrations of apoB-containing plasma
lipoproteins,"
J. Lipid Res. 34:1367-1383 (1993)). APOBEC-1 is expressed in all tissues that
carry
out apolipoprotein B mRNA editing (Teng et al., "Molecular cloning of an apo B
messenger RNA editing protein," Science 260:18116-1819 (1993)). Human liver
does
not express APOBEC-1 but it does express sufficient auxiliary proteins to
complement
exogenous APOBEC-1 in apolipoprotein B mRNA editing in transfected cells (Teng
et
al., "Molecular cloning of an apo B messenger RNA editing protein," Science
260:18116-1819 (1993); Sowden et al., "Apolipoprotein B RNA Sequence 3' ofthe
mooring sequence and cellular sources of auxiliary factors determine the
location and
extent of promiscuous editing," Nucleic Acids Res. 26:1644-1652 (1998)).
Transgenic experiments aiming to enhance hepatic editing through
apobec-1 gene transfer have shown a marked lowering of plasma apolipoprotein B
100
and significant reduction of serum LDL (Teng et al., "Adenovirus-mediated gene
transfer of rat apolipoprotein B mRNA editing protein in mice virtually
eliminates
apolipoprotein B 100 and normal low density lipoprotein production," J. Biol.
Chem.
269:29395-29404 (1994); Hughs et al., "Gene transfer of cytidine deaminase
APOBEC-1 lowers lipoprotein(a) in transgenic mice and induces apolipoprotein B
mRNA editing in rabbits," Hum. Gene Ther. 7:39-49 (1996); Nakamuta et al.,
"Complete phenotypic characterization of the apobec-1 knockout mice with a
wild-
type genetic background and a human apolipoprotein B transgenic background,
and
restoration of apolipoprotein B mRNA editing by somatic gene transfer of
Apobec-1,"
J. Biol. Chem. 271:25981-25988 (1996); Kozarsky et al., "Hepatic expression of
the
catalytic subunit of the apolipoprotein B mRNA editing enzyme ameliorates
hypercholesterolemia in LDL receptor-deficient rabbits," Hum. Gene Ther. 7:943-
957
( 1996); Farese et al., "Phenotypic analysis of mice expressing exclusively
apolipoprotein B48 or apolipoprotein B100," Proc. Natl. Acad. Sci. USA 93:6393-
6398 (1996); Qian et al., "Low expression of the apolipoprotein B mRNA editing
transgene in mice reduces LDL but does not cause liver dysplasia or tumors,"
Arteriosc. Thromb. Vasc. Biol. 18:1013-1020 (1998); Wu et al., "Normal
perinatal rise
in serum cholesterol is inhibited by hepatic delivery of adenoviral vector
expressing
apolipoprotein B mRNA editing enzyme in rabbits," J. Surg Res. 85:148-157
(1999)).
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-S-
Apolipoprotein B 100 is not essential for life as mice that synthesize
exclusively
apolipoprotein B48 (apolipoprotein B48-only mice) generated through targeted
mutagenesis developed normally, were healthy and fertile. Compared with wild-
type
mice fed on a chow diet, the level of LDL-cholesterol was lower in
apolipoprotein
S B48-only mice (Farese et al., "Phenotypic analysis of mice expressing
exclusively
apolipoprotein B48 or apolipoprotein B100," Proc. Natl. Acad. Sci. USA 93:6393-
6398 (1996)). However, the induction of apolipoprotein B mRNA editing activity
through apobec-1 gene transfer and tissue-specific overexpression poses a
significant
challenge in that it has induced hepatocellular dysplasia and carcinoma in
transgenic
mice and rabbits (Yamanaka et al., "Apolipoprotein B mRNA editing protein
induces
hepatocellular carcinoma and dysplasia in transgenic animals.," Proc. Natl.
Acad. Sci.
USA 92: 8483-8487 (1995); Yamanaka et al., "Hyperediting ofmultiple cytidines
of
apolipoprotein B mRNA by APOBEC-1 requil-es auxiliary proteins) but not a
mooring
sequence motif," J. Biol. Chem. 271:11 S06-11 S 10 ( 1996); Yamanaka et al.,
"A novel
1 S translational repressor mRNA is edited extensively in livers containing
tumors caused
by the transgene expression of the apoB mRNA editing enzyme," Genes & Dev.
11:321-333 (1997)). This was proposed to be due to persistent high levels of
APOBEC-1 expression resulting in unregulated and nonspecific mRNA editing
(Sowden et al., "Overexpression of APOBEC-1 results in mooring-sequence-
dependent promiscuous RNA editing," J. Biol. Chem. 271:3011-3017 (1996);
Yamanaka et al., "A novel translational repressor mRNA is edited extensively
in livers
containing tumors caused by the transgene expression of the apoB mRNA editing
enzyme," Genes & Dev. 11:321-333 (1997); Sowden et al., "Apolipoprotein B RNA
Sequence 3' of the mooring sequence and cellular sources of auxiliary factors
2S determine the location and extent of promiscuous editing," Nucleic Acids
Res.
26:1644-1652 (1998)). Adverse effects were not observed in transgenic animals
with
low to moderate levels of APOBEC-1 expression (Teng et al., "Adenovirus-
mediated
gene transfer of rat apolipoprotein B mRNA editing protein in mice virtually
eliminates
apolipoprotein B 100 and normal low density lipoprotein production," J. Biol.
Chem.
269:29395-29404 (1994); Qian et al., "Low expression ofthe apolipoprotein B
mRNA
editing transgene in mice reduces LDL but does not cause liver dysplasia or
tumors,"
Arteriosc. Thromb. Vasc. Biol. 18:1013-1020 (1998); Wu et al., "Normal
perinatal rise
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-6-
in serum cholesterol is inhibited by hepatic delivery of adenoviral vector
expressing
apolipoprotein B mRNA editing enzyme in rabbits," J. Surg Res. 85:148-157
(1999)).
Despite the limited success of apobec-1 gene therapy in modifying
apolipoprotein B
mRNA editing, such gene therapy poses too great a risk of adverse effects
stemming
from either persistent elevated levels of APOBEC-1 expression or problems
associated
with the use of infective transformation vectors (e.g., adenoviral vectors).
For these reasons, it would be desirable to identify an approach to
achieve apolipoprotein B mRNA editing, where its induction can be maintained
at low
levels and importantly, achieved in a transient manner. Moreover, it would be
desirable to identify an approach to achieve apolipoprotein B mRNA editing
which is
substantially free of the side-effects observed with reported gene therapy
approaches.
The present invention is directed to overcoming these and other deficiencies
in the art.
SUMMARY OF THE INVENTION
A first aspect of the present invention relates to a chimeric protein
including: a first polypeptide that includes a protein transduction domain and
a second
polypeptide that includes APOBEC-1 or a fragment thereof which can edit mRNA
encoding apolipoprotein B.
A second aspect of the present invention relates to a chimeric protein
including: a first polypeptide that includes a protein transduction domain;
and a second
polypeptide that includes APOBEC-1 Complementation Factor ("ACF") or a
fragment
thereof which can bind to apolipoprotein B mRNA to facilitate editing of the
mRNA
by APOBEC-1.
Third and fourth aspects of the present invention relate to DNA
molecules which encode one of the chimeric proteins of the present invention.
DNA
constructs, expression vectors, and recombinant host cells including such DNA
molecules are also disclosed.
A fifth aspect of the present invention relates to a composition which
includes: a pharmaceutically acceptable Garner and a chimeric protein of the
present
invention.
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
7-
A sixth aspect of the present invention relates to a composition which
includes: a first chimeric protein including a first polypeptide that includes
a protein
transduction domain and a second polypeptide that includes APOBEC-1 or a
fragment
thereof which can edit mRNA encoding apolipoprotein B; and a second chimeric
protein including a first polypeptide that includes a protein transduction
domain and a
second polypeptide that includes ACF or a fragment thereof which can bind to
apolipoprotein B mRNA to facilitate editing of the mRNA by APOBEC-1 or the
fragment thereof.
A seventh aspect of the present invention relates to a delivery device
which includes either a chimeric protein of the present invention or a
composition of
the present invention.
An eighth aspect of the present invention relates to a method of
modifying apolipoprotein B mRNA editing in vivo which includes: contacting
apolipoprotein B mRNA in a cell with a chimeric protein including a first
polypeptide
that includes a protein transduction domain and a second polypeptide that
includes
APOBEC-1 or a fragment thereof which can edit mRNA encoding apolipoprotein B,
under conditions effective to increase the concentration of apolipoprotein B48
which is
secreted by the cell as compared to the concentration of apolipoprotein B 100
which is
secreted by the cell, relative to an untreated cell.
A ninth aspect of the present invention relates to a method of reducing
serum LDL levels which includes: delivering into one or more cells of a
patient,
without genetically modifying the cells, an amount of a protein comprising
APOBEC-1
or a fragment thereof which can edit mRNA encoding apolipoprotein B, which
amount
is effective to increase the concentration of VLDL-apolipoprotein B48 that is
secreted
by the one or more cells into serum and, consequently, reduce the serum
concentration
of LDL.
A tenth aspect of the present invention relates to a method of treating
or preventing an atherogenic disease or disorder which includes: administering
to a
patient an effective amount of a protein including APOBEC-1 or a fragment
thereof
which can edit mRNA encoding apolipoprotein B, wherein upon said administering
the
protein is taken up by one or more cells of the patient that can synthesize
and secrete
VLDL-apolipoprotein B under conditions which are effective to increase the
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
_g_
concentration of VLDL-apolipoprotein B48 that is secreted by the one or more
cells
into serum, whereby rapid clearing of VLDL-apolipoprotein B48 fi~om serum
decreases the serum concentration of LDL to treat or prevent the atherogenic
disease
or disorder.
An eleventh aspect of the present invention relates to a liposome or
niosome which is targeted for uptake by a liver cell, the liposome or niosome
containing (i) APOBEC-1 or a fi-agment thereof which is effective to edit
apolipoprotein B mRNA, (ii) ACF or a fragment thereof which is effective to
bind
apolipoprotein B mRNA, or (iii) a combination thereof. Compositions which
include
the liposome or niosome are also disclosed.
The present invention demonstrates the efficacy of protein-mediated
delivery to increase intracellular APOBEC-1 in cells which produce and secrete
VLDL-apolipoprotein B. By increasing the extent of apolipoprotein B mRNA
editing
in vivo, it is possible to modify the ratio of VLDL-apolipoprotein B48 to VLDL-
apolipoprotein B 100 which is secreted by such cells, specifically increasing
the relative
serum concentration of VLDL-apolipoprotein B48 and decreasing the relative
serum
concentration of VLDL-apolipoprotein B100. Due to the nature of these
complexes,
the B48 complex is cleared much more rapidly from serum, minimizing the
conversion
of VLDL into LDL, a major atherogenic disease factor. By minimizing the amount
of
VLDL-apolipoprotein B100 and increasing the amount of VLDL-apolipoprotein B48,
it is possible to both treat and prevent atherogenic diseases or disorders.
Moreover, by
using protein delivery, it is possible to avoid the apparently unavoidable
side effects of
gene therapy. These results presented here open new possibilities for the
treatment of
hyperlipidemia through the induction of precisely controlled hepatic editing
activity.
BRIEF DESCRIPTION OF THE DRAWINGS
Figures 1 A-D illustrate the structure ( 1 A) and both nucleotide ( 1 B-C,
SEQ ID No: 1 ) and amino acid ( 1 D, SEQ ID No: 2) sequences for an exemplary
first
chimeric protein (designated TAT-hAPOBEC-CMPK) specific for human
apolipoprotein B mRNA editing. In Figures 1B-C, the region encoding human
APOBEC-1 is shown in lowercase letters and the start codon for this construct
is at
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-9-
the beginning of the sequence. The sequences encoding a TAT protein
transduction
domain and a hemagglutinin domain are shown in uppercase letters near the 5'
end
(i.e., upstream of the APOBEC-1 sequence). The sequence encoding CMPK is shown
3' of the APOBEC-1 sequence in uppercase letters. At the 3' terminal region
and
shown in lowercase letters is a sequence encoding a histidine tag. In Figure 1
D,
beginning from the N-terminal end, the TAT protein transduction domain is
shown in
bold, followed by the hemagglutinin domain also shown in bold, human APOBEC-1
shown underlined, CMPK also shown underlined, and the histidine tag shown in
bold
at the C-terminus.
Figures 2A-D illustrate the structure (2A) and both nucleotide (2B-C,
SEQ ID No: 3) and amino acid (2D, SEQ ID No: 4) sequences for an exemplary
first
chimeric protein (designated TAT-rAPOBEC-CMPK) specific for rat apolipoprotein
B
mRNA editing. In Figures 2B-C, the region encoding rat APOBEC-1 is shown in
lowercase letters and the start codon for this construct is at the beginning
of the
sequence. The sequences encoding a TAT protein transduction domain and a
hemagglutinin domain are shown in uppercase letters neat- the 5' end (i.e.,
upstream of
the APOBEC-1 sequence). The sequence encoding CMPK is shown 3' of the
APOBEC-1 sequence in uppercase letters. At the 3' terminal region and shown in
lowercase letters is a sequence encoding a histidine tag. In Figure 2D,
beginning from
the N-terminal end, the TAT protein transduction domain is shown in bold,
followed
by the hemagglutinin domain also shown in bold, rat APOBEC-1 shown underlined,
CMPK also shown underlined, and the histidine tag shown in bold at the C-
terminus.
Figures 3A-C illustrate the structure (3A) and both nucleotide (3B,
SEQ ID No: 5) and amino acid (3C, SEQ ID No: 6) sequences for an exemplary
second chimeric protein (designated TAT-hACF) specific for complementing human
APOBEC-1. In Figure 3B, the region encoding human ACF is shown in lowercase
letters and the start codon for this construct is at the beginning of the
sequence. The
sequence encoding a TAT protein transduction domain and a hemagglutinin domain
is
shown in uppercase letters near the 5' end (i.e., upstream of the ACF
sequence). At the
3' terminal region and shown in lowercase letters is a sequence encoding a
histidine
tag. In Figure 3C, beginning from the N-terminal end, the TAT protein
transduction
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-10-
domain is shown in bold, followed by the hemagglutinin domain also shown in
bold,
human ACF shown underlined, and the histidine tag shown in bold at the C-
terminus.
Figures 4A-C illustrate the structure (4A) and both nucleotide (4B,
SEQ ID No: 7) and amino acid (4C, SEQ ID No: 8) sequences for an exemplary
second chimeric protein (designated TAT-rACF) specific for complementing rat
APOBEC-1. In Figure 4B, the region encoding rat ACF is shown in lowercase
letters
and the start codon for this construct is at the beginning of the sequence.
The
sequence encoding a TAT protein transduction domain and a hemagglutinin domain
is
shown in uppercase letters near the 5' end (i.e., upstream of the ACF
sequence). At the
3' terminal region and shown in lowercase letters is a sequence encoding a
histidine
tag. In Figure 4C, beginning from the N-terminal end, the TAT protein
transduction
domain is shown in bold, followed by the hemagglutinin domain also shown in
bold, rat
ACF shown underlined, and the histidine tag shown in bold at the C-terminus.
Figures 5A-B illustrate the purification of fizll-length TAT-rAPOBEC-
CMPK protein. In Figure 5A, a schematic image illustrates generally the
structure of a
prokaryotic expression vector, pET-24b, encoding the TAT fusion protein.
Figure 5B
illustrates the image of a gel following two-column purification and silver-
staining.
The TAT fusion protein is the only protein recovered in significant
concentrations.
Figures 6A-F are images of immuno-stained cells exposed to the TAT
fusion protein TAT-rAPOBEC-CMPK. McArdle cells were treated with 650 nM of
recombinant TAT-rAPOBEC-CMPK for the indicated times (1h, 6h, or 24h). Cells
were fixed, permeabilized, reacted with antibody to the HA epitope and FITC-
conjugated anti-mouse secondary antibody and mounted in DAPI containing buffer
as
described in the Examples. Arrowheads indicated the position of select nuclei.
Figures 7A-F are images of immuno-stained cell exposed to TAT-
CMPK fusion protein. McArdle cells were treated with 1125 nM of recombinant
TAT-CMPK for the indicated times (1h, 6h, or 24h). Cells were fixed,
permeabilized,
reacted with antibody to the HA epitope and FITC-conjugated anti-mouse
secondary
antibody and mounted in DAPI containing buffer as described in the Examples.
Arrowheads indicated the position of select nuclei.
Figure 8 is an image of a gel indicating that TAT-CMPK did not
stimulate editing. McArdle cells were treated with 45 nM, 225 nM and 1125 nM
of
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-11-
recombinant TAT-CMPK for 24 h. Total cellular RNA was isolated and
apolipoprotein B mRNA was selectively amplified by reverse transcription-
polymerase
chain reaction ("RT-PCR") and the proportion of edited apolipoprotein B RNA
determined by poisoned primer extension as described in the Examples. CAA,
primer
extension product corresponding to unedited RNA; UAA, primer extension product
corresponding to edited RNA; P, primer.
Figure 9 is an image of a gel indicating that TAT-rAPOBEC-CMPK
increased editing activity in McArdle cells. The TAT fusion protein (360 nM or
62 ~g
protein/ml media) was added into cell culture media and RNAs were isolated
subsequent to treatment from wild type McArdle cells at the indicated time
points.
Control cells were treated with a corresponding aliquot of buffer B used to
dialyze the
recombinant protein. The editing efficiency was calculated as described in the
Examples. The standard deviations for each of the lanes on the gel, reading
left to
right, are as follows: 0.9, 2.2, 3.8, 2.1, 1.1, 0.9, 0.2, n=3. CAA, primer
extension
product corresponding to unedited RNA; UAA, primer extension product
corresponding to edited RNA; P, primer.
Figure 10 is an image of a gel indicating that TAT fusion protein
increased editing activity in primary rat hepatocytes. Hepatocytes were
prepared and
treated with TAT-rAPOBEC-CMPK as described in the Examples. Control cells were
treated with a corresponding aliquot of buffer B used to dialyze the
recombinant
protein. The increase in editing activity caused by TAT fusion protein was
apparent.
The standard deviations for each of the lanes on the gel, reading left to
right, are as
follows: 2.2, 3.6, 2.5, 1.9, n=3.
Figure 11 is an image showing the changes in secreted lipoprotein
profile due to TAT-rAPOBEC-CMPK treatment. Primary hepatocytes were treated
with TAT fusion protein first, then labeled with [35S]methionine and
[35S]cysteine.
Control cells (-) were treated with a corresponding aliquot of buffer B used
to dialyze
the recombinant protein. Cell culture media were collected, apolipoprotein B48
and
apolipoprotein B 100 were precipitated by anti-apoB antibody and separated by
SDS-
PAGE. The second band below apolipoprotein B48 might have been due to protein
degradation and the band between apolipoprotein B 100 and apolipoprotein B48
could
be C-3 complement. The editing efficiency of the same cells is shown at the
bottom.
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-12-
The results are from a single experiment representative three experiments with
similar
results.
DETAILED DESCRIPTION OF THE INVENTION
The present invention relates to protein-mediated approaches for
regulating apolipoprotein B mRNA editing and, therefore, regulating the
relative
concentration of secreted apolipoprotein B derivatives, which offers an
approach for
controlling the serum levels of atherogenic disease factors such as low
density
lipoproteins ("LDL") which associates with apolipoprotein B and its
derivatives.
According to one aspect of the present invention, a first chimeric
protein is provided for such uses. The first chimeric protein includes a first
polypeptide that includes a protein transduction domain and a second
polypeptide that
includes APOBEC-1 or a fragment thereof which can edit mRNA encoding
apolipoprotein B.
The first polypeptide can be any protein, or polypeptide fragment
thereof, which is suitable for inducing cellular uptake of the chimeric
protein.
By way of example, protein transduction domains from several known
proteins can be employed, including without limitation, HIV-1 Tat protein,
Drosophila
homeotic transcription factor (ANTP), and HSV-1 VP22 transcription factor
(Schwarze et al., "In vivo protein transduction: Intracellular delivery of
biologically
active proteins, compounds, and DNA," TIPS 21:45-48 (2000), which is hereby
incorporated by reference in its entirety).
A preferred protein transduction domain is the protein transduction
domain of the human immunodeficiency virus ("HIV") tat protein. An exemplary
HIV
tat protein transduction domain has an amino acid sequence of SEQ ID No: 9 as
follows:
Arg Lys Lys Arg Arg Gln Arg Arg Arg
s
This protein transduction domain has also been noted to be a nuclear
translocation
domain (HIV Sequence Compendium 2000, Kuiken et al. (eds.), Theoretical
Biology
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-13-
and Biophysics G~~oup, Los Alamos National Laboratory, which is hereby
incorporated
by reference in its entirety). One DNA molecule which encodes the HIV tat
protein
transduction domain has a nucleotide sequence of SEQ ID No: 10 as follows:
agaaaaaaaa gaagacaaag aagaaga 27
Variations of these tat sequences can also be employed. Such sequence variants
have
been reported in HIV Sequence Compendium 2000, Kuiken et al. (eds.),
Theoretical
Biology and Biophysics Cwoup, Los Alamos National Laboratory, which is hereby
incorporated by reference in its entirety.
Other cellular uptake polypeptides and their use have been described in
the literature, including membrane-permeable sequences of the SN50 peptide,
the Grb2
SH2 domain, and integrin (33, /3,, and a~, cytoplasmic domains (Hawiger,
"Noninvasive
intracellular delivery of functional peptides and proteins," Curr. Opin. Chem.
Biol.
3:89-94 (1999), which is hereby incorporated by reference in its entirety).
The second polypeptide can be either a full length APOBEC-1 or a
fragment thereof which includes the catalytic domain thereof. The APOBEC-1
protein
or fragment thereof is a mammalian APOBEC-1 protein or fragment thereof,
including
without limitation, human, rat, mouse, etc.
The full length human APOBEC-1 has an amino acid sequence
according to SEQ ID No: 11 as follows:
Met Thr Ser Glu Lys Gly Pro Ser Thr Gly Asp Pro Thr Leu Arg Arg
1 5 10 15
Arg Ile Glu Pro Trp Glu Phe Asp Val Phe Tyr Asp Pro Arg Glu Leu
20 25 30
Arg Lys Glu Ala Cys Leu Leu Tyr Glu Ile Lys Trp Gly Met Ser Arg
35 40 45
Lys Ile Trp Arg Ser Ser Gly Lys Asn Thr Thr Asn His Val Glu Val
50 55 60
Asn Phe Ile Lys Lys Phe Thr Ser Glu Arg Asp Phe His Pro Ser Ile
65 70 75 80
Ser Cys Ser Ile Thr Trp Phe Leu Ser Trp Ser Pro Cys Trp Glu Cys
85 90 95
Ser Gln Ala Ile Arg Glu Phe Leu Ser Arg His Pro Gly Val Thr Leu
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
- 14-
100 105 110
Val Ile Tyr Val Ala Arg Leu Phe Trp His Met Asp Gln Gln Asn Arg
115 120 125
Gln Gly Leu Arg Asp Leu Val Asn Ser Gly Val Thr Ile Gln Ile Met
130 135 140
Arg Ala Ser Glu Tyr Tyr His Cys Trp Arg Asn Phe Val Asn Tyr Pro
145 150 155 160
Pro Gly Asp Glu Ala His Trp Pro Gln Tyr Pro Pro Leu Trp Met Met
165 170 175
Leu Tyr Ala Leu Glu Leu His Cys Ile Ile Leu Ser Leu Pro Pro Cys
180 185 190
Leu Lys Ile Ser Arg Arg Trp Gln Asn His Leu Thr Phe Phe Arg Leu
195 200 205
His Leu Gln Asn Cys His Tyr Gln Thr Ile Pro Pro His Ile Leu Leu
210 215 220
Ala Thr Gly Leu Ile His Pro Ser Val Ala Trp Arg
2S 225 230 235
This human APOBEC-1 sequence is reported at Genbank Accession No. NP 001635,
which is hereby incorporated by reference in its entirety. The full length
human
APOBEC-1 is believed to include a putative bipartite nuclear localization
signal
between amino acid residues 15-34, a catalytic center between amino acid
residues 61-
98, and a putative cytoplasmic retention signal between amino acid residues
173-229.
A cDNA sequence which encodes the full length human APOBEC-1 is set forth as
SEQ ID No: 12 as follows:
atgacttctg agaaaggtcc ttcaaccggt gaccccactc tgaggagaag aatcgaaccc 60
tgggagtttg acgtcttcta tgaccccaga gaacttcgta aagaggcctg tctgctctac 120
gaaatcaagt ggggcatgag ccggaagatc tggcgaagct caggcaaaaa caccaccaat 180
cacgtggaag ttaattttat aaaaaaattt acgtcagaaa gagattttca cccatccatc 240
agctgctcca tcacctggtt cttgtcctgg agtccctgct gggaatgctc ccaggctatt 300
agagagtttc tgagtcggca ccctggtgtg actctagtga tctacgtagc tcggcttttt 360
tggcacatgg atcaacaaaa tcggcaaggt ctcagggacc ttgttaacag tggagtaact 420
attcagatta tgagagcatc agagtattat cactgctgga ggaattttgt caactaccca 480
cctggggatg aagctcactg gccacaatac ccacctctgt ggatgatgtt gtacgcactg 540
gagctgcact gcataattct aagtcttcca ccctgtttaa agatttcaag aagatggcaa 600
aatcatctta catttttcag acttcatctt caaaactgcc attaccaaac gattccgcca 660
cacatccttt tagctacagg gctgatacat ccttctgtgg cttggagatg a 711
The full length rat APOBEC-1 has an amino acid sequence according to
SEQ ID No: 13 as follows:
Met Ser Ser Glu Thr Gly Pro Val Ala Val Asp Pro Thr Leu Arg Arg
1 5 10 15
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
- 15-
Arg Ile Glu Pro His Glu Phe Glu Val Phe Phe Asp Pro Arg Glu Leu
20 25 30
Arg Lys Glu Thr Cys Leu Leu Tyr Glu Ile Asn Trp Gly Gly Arg His
35 40 45
Ser Ile Trp Arg His Thr Ser Gln Asn Thr Asn Lys His Val Glu Val
50 55 60
Asn Phe Ile Glu Lys Phe Thr Thr Glu Arg Tyr Phe Cys Pro Asn Thr
65 70 75 80
Arg Cys Ser Ile Thr,Trp Phe Leu Ser Trp Ser Pro Cys Gly Glu Cys
85 90 95
Ser Arg Ala Ile Thr Glu Phe Leu Ser Arg Tyr Pro His Val Thr Leu
100 105 110
Phe Ile Tyr Ile Ala Arg Leu Tyr His His Ala Asp Pro Arg Asn Arg
115 120 125
Gln Gly Leu Arg Asp Leu Ile Ser Ser Gly Val Thr Ile Gln Ile Met
130 135 140
Thr Glu Gln Glu Ser Gly Tyr Cys Trp Arg Asn Phe Val Asn Tyr Ser
145 150 155 160
Pro Ser Asn Glu Ala His Trp Pro Arg Tyr Pro His Leu Trp Val Arg
165 170 175
Leu Tyr Val Leu Glu Leu Tyr Cys Ile Ile Leu Gly Leu Pro Pro Cys
180 185 190
Leu Asn Ile Leu Arg Arg Lys Gln Pro Gln Leu Thr Phe Phe Thr Ile
195 200 205
Ala Leu Gln Ser Cys His Tyr Gln Arg Leu Pro Pro His Ile Leu Trp
210 215 220
Ala Thr Gly Leu Lys
225
This rat APOBEC-1 sequence is reported at Genbank Accession No. P38483, which
is
hereby incorporated by reference in its entirety. Recombinant studies using
rat
APOBEC-1 have demonstrated that an N-terminal region, containing the putative
nuclear localization signal, is required for nuclear distribution of APOBEC-1
while a
C-terminal region, containing a putative cytoplasmic retention signal (Yang et
al.,
"Multiple protein domains determine the cell type-specific nuclear
distribution of the
catalytic subunit required for apolipoprotein B mRNA editing," Proc. Natl.
Acad. Sci.
USA 94:13075-13080 (1997), which is hereby incorporated by reference in its
entirety.
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
- 16-
A cDNA sequence which encodes the full length rat APOBEC-1 is set forth as SEQ
ID
No: 14 as follows:
atgagttccgagacaggccctgtagctgttgatcccactctgaggagaagaattgagccc60
cacgagtttgaagtcttctttgacccccgggaacttcggaaagagacctgtctgctgtat120
gagatcaactggggaggaaggcacagcatctggcgacacacgagccaaaacaccaacaaa180
cacgttgaagtcaatttcatagaaaaatttactacagaaagatacttttgtccaaacacc240
agatgctccattacctggttcctgtcctggagtccctgtggggagtgctccagggccatt300
acagaatttttgagccgatacccccatgtaactctgtttatttatatagcacggctttat360
caccacgcagatcctcgaaatcggcaaggactcagggaccttattagcagcggtgttact420
atccagatcatgacggagcaagagtctggctactgctggaggaattttgtcaactactcc480
ccttcgaatgaagctcattggccaaggtacccccatctgtgggtgaggctgtacgtactg540
gaactctactgcatcattttaggacttccaccctgtttaaatattttaagaagaaaacaa600
cctcaactcacgtttttcacgattgctcttcaaagctgccattaccaaaggctaccaccc660
cacatcctgtgggccacagggttgaaatga 690
The cDNA molecule is reported at Genbank Accession No. L07114, which is hereby
incorporated by reference in its entirety.
The full length mouse APOBEC-1 has an amino acid sequence
according to SEQ ID No: 15 as follows:
Met Ser Ser Glu Thr Gly Pro Val Ala Val Asp Pro Thr Leu Arg Arg
1 5 10 15
Arg Ile Glu Pro His Glu Phe Glu Val Phe Phe Asp Pro Arg Glu Leu
20 25 30
Arg Lys Glu Thr Cys Leu Leu Tyr Glu Ile Asn Trp Gly Gly Arg His
35 40 45
Ser Val Trp Arg His Thr Ser Gln Asn Thr Ser Asn His Val Glu Val
50 55 60
Asn Phe Leu Glu Lys Phe Thr Thr Glu Arg Tyr Phe Arg Pro Asn Thr
65 70 75 80
Arg Cys Ser Ile Thr Trp Phe Leu Ser Trp Ser Pro Cys Gly Glu Cys
85 90 95
Ser Arg Ala Ile Thr Glu Phe Leu Ser Arg His Pro Tyr Val Thr Leu
100 105 110
Phe Ile Tyr Ile Ala Arg Leu Tyr His His Thr Asp Gln Arg Asn Arg
115 120 125
Gln Gly Leu Arg Asp Leu Ile Ser Ser Gly Val Thr Ile Gln Ile Met
130 135 140
Thr Glu Gln Glu Tyr Cys Tyr Cys Trp Arg Asn Phe Val Asn Tyr Pro
145 150 155 160
Pro Ser Asn Glu Ala Tyr Trp Pro Arg Tyr Pro His Leu Trp Val Lys
165 170 175
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-17-
Leu Tyr Val Leu Glu Leu Tyr Cys Ile Ile Leu Gly Leu Pro Pro Cys
180 185 190
Leu Lys Ile Leu Arg Arg Lys Gln Pro Gln Leu Thr Phe Phe Thr Ile
195 200 205
Thr Leu Gln Thr Cys His Tyr Gln Arg Ile Pro Pro His Leu Leu Trp
210 215 220
Ala Thr Gly Leu Lys
225
This mouse APOBEC-1 sequence is reported at Genbank Accession No. NP-112436,
which is hereby incorporated by reference in its entirety. A cDNA sequence
which
encodes the full length mouse APOBEC-1 is set forth as SEQ ID No: 16 as
follows:
atgagttccgagacaggccctgtagctgttgatcccactctgaggagaagaattgagccc60
cacgagtttgaagtcttctttgacccccgggagcttcggaaagagacctgtctgctgtat120
20gagatcaactggggtggaaggcacagtgtctggcgacacacgagccaaaacaccagcaac180
cacgttgaagtcaacttcttagaaaaatttactacagaaagatactttcgtccgaacacc240
agatgctccattacctggttcctgtcctggagtccctgcggggagtgctccagggccatt300
acagagtttctgagccgacacccctatgtaactctgtttatttacatagcacggctttat360
caccacacggatcagcgaaaccgccaaggactcagggaccttattagcagcggtgtgact420
25atccagatcatgacagagcaagagtattgttactgctggaggaatttcgtcaactacccc480
ccttcaaacgaagcttattggccaaggtacccccatctgtgggtgaaactgtatgtattg540
gagctctactgcatcattttaggacttccaccctgtttaaaaattttaagaagaaagcaa600
cctcaactcacgtttttcacaattactcttcaaacctgccattaccaaaggataccaccc660
catctcctttgggctacagggttgaaatga 690
30
The cDNA molecule is reported at Genbank Accession No. NM_031159, which is
hereby incorporated by reference in its entirety.
The first chimeric protein of the present invention can also include one
or more other.polypeptide sequences, including without limitation: (i) a
polypeptide
35 that includes a cytoplasmic localization protein or a fragment thereof
which, upon
cellular uptake of the first chimeric protein, localizes the first chimeric
protein to the
cytoplasm; (ii) a polypeptide that includes a plurality of adjacent histidine
residues; and
(iii) a polypeptide that includes an epitope tag.
The polypeptide that includes a cytoplasmic localization protein or a
40 fragment thereof can be any protein, or fragment thereof, which can
effectively retain
the first chimeric protein within the cytoplasm of a cell into which the first
chimeric
protein has been translocated. One such protein is chicken muscle pyruvate
kinase
("CMPK"), which has an amino acid sequence of SEQ ID No: 17 as follows:
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-18-
Met Ser Lys His His Asp Ala Gly Thr Ala Phe Ile Gln Thr Gln Gln
1 5 10 15
Leu His Ala Ala Met Ala Asp Thr Phe Leu Glu His Met Cys Arg Leu
20 25 30
Asp Ile Asp Ser Glu Pro Thr Ile Ala Arg Asn Thr Gly Ile Ile Cys
35 40 45
Thr Ile Gly Pro Ala Ser Arg Ser Val Asp Lys Leu Lys Glu Met Ile
50 55 60
Lys Ser Gly Met Asn Val Ala Arg Leu Asn Phe Ser His Gly Thr His
65 70 75 80
Glu Tyr His Glu Gly Thr Ile Lys Asn Val Arg Glu Ala Thr Glu Ser
85 90 95
Phe Ala Ser Asp Pro Ile Thr Tyr Arg Pro Val Ala Ile Ala Leu Asp
100 105 110
Thr Lys Gly Pro Glu Ile Arg Thr Gly Leu Ile Lys Gly Ser Gly Thr
115 120 125
Ala Glu Val Glu Leu Lys Lys Gly Ala Ala Leu Lys Val Thr Leu Asp
130 135 140
Asn Ala Phe Met Glu Asn Cys Asp Glu Asn Val Leu Trp Val Asp Tyr
145 150 155 160
Lys Asn Leu Ile Lys Val Ile Asp Val Gly Ser Lys Ile Tyr Val Asp
165 170 175
Asp Gly Leu Ile Ser Leu Leu Val Lys Glu Lys Gly Lys Asp Phe Val
3$ 180 185 190
Met Thr Glu Val Glu Asn Gly Gly Met Leu Gly Ser Lys Lys Gly Val
195 200 205
Asn Leu Pro Gly Ala Ala Val Asp Leu Pro Ala Val Ser Glu Lys Asp
210 215 220
Ile Gln Asp Leu Lys Phe Gly Val Glu Gln Asn Val Asp Met Val Phe
225 230 235 240
Ala Ser Phe Ile Arg Lys Ala Ala Asp Val His Ala Val Arg Lys Val
245 250 255
Leu Gly Glu Lys Gly Lys His Ile Lys Ile Ile Ser Lys Ile Glu Asn
260 265 270
His Glu Gly Val Arg Arg Phe Asp Glu Ile Met Glu Ala Ser Asp Gly
275 280 285
Ile Met Val Ala Arg Gly Asp Leu Gly Ile Glu Ile Pro Ala Glu Lys
290 295 300
Val Phe Leu Ala Gln Lys Met Met Ile Gly Arg Cys Asn Arg Ala Gly
305 310 315 320
Lys Pro Ile Ile Cys Ala Thr Gln Met Leu Glu Ser Met Ile Lys Lys
325 330 335
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-19-
Pro Arg Pro Thr Arg Ala Glu Gly Ser Asp Val Ala Asn Ala Val Leu
340 345 350
Asp Gly Ala Asp Cys Ile Met Leu Ser Gly Glu Thr Ala Lys Gly Asp
355 360 365
Tyr Pro Leu Glu Ala Val Arg Met Gln His Ala Ile Ala Arg Glu Ala
370 375 380
Glu Ala Ala Met Phe His Arg Gln Gln Phe Glu Glu Ile Leu Arg His
385 390 395 400
Ser Val His His Arg Glu Pro Ala Asp Ala Met Ala Ala Gly Ala Val
405 410 415
Glu Ala Ser Phe Lys Cys Leu Ala Ala Ala Leu Ile Val Met Thr Glu
420 425 430
Ser Gly Arg Ser Ala His Leu Val Ser Arg Tyr Arg Pro Arg Ala Pro
435 440 445
Ile Ile Ala Val Thr Arg Asn Asp Gln Thr Ala Arg Gln Ala His Leu
450 455 460
Tyr Arg Gly Val Phe Pro Val Leu Cys Lys Gln Pro Ala His Asp Ala
465 470 475 480
Trp Ala Glu Asp Val Asp Leu Arg Val Asn Leu Gly Met Asn Val Gly
485 490 495
Lys Ala Arg Gly Phe Phe Lys Thr Gly Asp Leu Val Ile Val Leu Thr
500 505 510
3S Gly Trp Arg Pro Gly Ser Gly Tyr Thr Asn Thr Met Arg Val Val Pro
515 520 525
Val Pro
530
A DNA molecule encoding the full length CMPK has a nucleotide sequence
according
to SEQ ID No: 18 as follows:
atgtcgaagcaccacgatgcagggaccgctttcatccagacccagcagctgcacgctgcc60
atggcagacacctttctggagcacatgtgccgcctggacatcgactccgagccaaccatt120
gccagaaacaccggcatcatctgcaccatcggcccagcctcccgctctgtggacaagctg180
aaggaaatgattaaatctggaatgaatgttgcccgcctcaacttctcgcacggcacccac240
gagtatcatgagggcacaattaagaacgtgcgagaggccacagagagctttgcctctgac300
ccgatcacctacagacctgtggctattgcactggacaccaagggacctgaaatccgaact360
ggactcatcaagggaagtggcacagcagaggtggagctcaagaagggcgcagctctcaaa420
gtgacgctggacaatgccttcatggagaactgcgatgagaatgtgctgtgggtggactac480
aagaacctcatcaaagttatagatgtgggcagcaaaatctatgtggatgacggtctcatt540
tccttgctggttaaggagaaaggcaaggactttgtcatgactgaggttgagaacggtggc600
atgcttggtagtaagaagggagtgaacctcccaggtgctgcggtcgacctgcctgcagtc660
tcagagaaggacattcaggacctgaaatttggcgtggagcagaatgtggacatggtgttc720
gcttccttcatccgcaaagctgctgatgtccatgctgtcaggaaggtgctaggggaaaag780
ggaaagcacatcaagattatcagcaagattgagaatcacgagggtgtgcgcaggtttgat840
gagatcatggaggccagcgatggcattatggtggcccgtggtgacctgggtattgagatc900
cctgctgaaaaagtcttcctcgcacagaagatgatgattgggcgctgcaacagggctggc960
aaacccatcatttgtgccactcagatgttggaaagcatgatcaagaaacctcgcccgacc1020
cgcgctgagggcagtgatgttgccaatgcagttctggatggagcagactgcatcatgctg1080
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-20-
tctggggaga ccgccaaggg agactaccca ctggaggctg tgcgcatgca gcacgctatt 1140
gctcgtgagg ctgaggccgc aatgttccat cgtcagcagt ttgaagaaat cttacgccac 1200
agtgtacacc acagggagcc tgctgatgcc atggcagcag gcgcggtgga ggcctccttt 1260
aagtgcttag cagcagctct gatagttatg accgagtctg gcaggtctgc acacctggtg 1320
tcccggtacc gcccgcgggc tcccatcatc gccgtcaccc gcaatgacca aacagcacgc 1380
caggcacacc tgtaccgcgg cgtcttcccc gtgctgtgca agcagccggc ccacgatgcc 1440
tgggcagagg atgtggatct ccgtgtgaac ctgggcatga atgtcggcaa agcccgtgga 1500
ttcttcaaga ccggggacct ggtgatcgtg ctgacgggct ggcgccccgg ctccggctac 1560
accaacacca tgcgggtggt gcccgtgcca tga 1593
The amino acid sequence and nucleotide sequence for the full length CMPK is
reported
at Genbank Accession Nos. AAA49021 and J00903, respectively, each of which is
hereby incorporated by reference in its entirety.
Fragments of CMPK which afford cytoplasmic retention of the first
chimeric protein include, without limitation, polypeptides containing at a
minimum
residues 1-479 of SEQ ID No: 18.
The polypeptide that includes a plurality of histidine residues preferably
contains a sufficient number of histidine residues so as to allow the first
chimeric
protein containing such histidine residues to be bound by an antibody which
recognizes
the plurality of histidine residues. One type of DNA molecule encoding Hn is
(cac)",
where n is greater than l, but preferably greater than about 5. This His
region can be
used during immuno-purification, which is described in greater detail below.
The polypeptide that includes an epitope tag can be any epitope tag that
is recognized with antibodies raised against the epitope tag. An exemplary
epitope tag
is a hemagglutinin ("HA") domain. The HA domain is present only when it is
desirable
to examine, i.e., in vitro, localization of the first chimeric protein within
cells that have
translocated it. One suitable HA domain has an amino acid sequence according
to
SEQ ID No: 19 as follows:
Tyr Pro Tyr Asp Val Pro Asp Tyr Ala
1 5
This HA sequence is encoded by a DNA molecule having a nucleotide sequence
according to SEQ ID No: 20 as follows:
tacccctacg acgtgcccga ctacgcc 27
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-21 -
An exemplary first chimeric protein of the present invention which is
suitable for use in humans, designated TAT-hAPOBEC-CMPK, is set forth in
Figure
1A. This first chimeric protein (human) includes: an N-terminal HIV tat
protein
transduction domain, a hemagglutinin domain, a polypeptide fragment of human
APOBEC-1, a CMPK domain, and a C-terminal His tag. The amino acid sequence
(SEQ ID No: 2) and encoding nucleotide sequence (SEQ ID No: 1 ) of this
exemplary
first chimeric protein (human) is set forth in Figures 1 D and 1 B-C,
respectively.
An exemplary first chimeric protein of the present invention which is
suitable for use in rats, designated TAT-rAPOBEC-CMPK, is set forth in Figure
2A.
This fu-st chimeric protein (rat) includes: an N-terminal HIV tat protein
transduction
domain, a hemagglutinin domain, a polypeptide fragment of rat APOBEC-1, a CMPK
domain, and a C-terminal His tag. The amino acid sequence (SEQ ID No: 4) and
encoding nucleotide sequence (SEQ ID No: 3) of this exemplary first chimeric
protein
(rat) is set forth in Figures'2D and 2B-C, respectively.
According to a second aspect of the present invention, a second
chimeric protein is provided for use in combination with the first chimeric
protein
described above. The second chimeric protein includes a first polypeptide that
includes
a protein transduction domain and a second polypeptide the includes ACF or a
fragment thereof which can bind to apolipoprotein B mRNA.
The first polypeptide of the second chimeric protein can be a protein
transduction domain of the type described above. The protein transduction
domain of
the second chimeric protein can be the same or different from the protein
transduction
domain of the first chimeric protein.
The second polypeptide of the second chimeric protein, as noted above,
includes ACF or a fragment thereof which can bind to apolipoprotein B mRNA.
Although it has been proposed that a number of different proteins assist
APOBEC-1 in
editing apolipoprotein B mRNA, ACF has been identified as the minimal protein
complement for editing in vitro in the human system (Mehta et al., Molecular
cloning
of apobec-1 complementation factor, a novel RNA binding protein involved in
the
editing of apo B mRNA," Mol. Cell. Biol. 20:1846-1854 (2000), which is hereby
incorporated by reference in its entirety). In accordance with the present
invention,
therefore, the second chimeric protein binds apolipoprotein B mRNA at the
mooring
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-22-
sequence and through its interactions with the first chimeric protein,
sequesters the
first chimeric protein to the cytidine of the apolipoprotein B mRNA to be
edited (i.e.,
at position 6666), thereby resulting in its conversion to a uridine. As noted
above, this
conversion results in a stop codon that contributes to expression of the
apolipoprotein
B48 derivative.
Recent studies have suggested that APOBEC-1 requires a chaperone
for its nuclear localization (Yang et al., "Intracellular trafficking
determinants in
APOBEC-1, the catalytic subunit for cytidine to uridine editing of
apolipoprotein B
mRNA," Exp. Cell Res. 267:153-164 (2001), which is hereby incorporated by
reference in its entirety). More recently, however, it has been learned that
APOBEC-1
is most likely associated with ACF throughout the cell and, therefore, it may
import to
the nucleus as an APOBEC-1/ACF complex. A bipartite nuclear localization
signal is
predicted in ACF (see below).
ACF is expressed at sufficient levels within the hepatic cells of rat
(Dance et al., "Two proteins essential for apolipoprotein B mRNA editing are
expressed fi-om a single gene through alternative splicing," J. Biol. Chem.,
electronically published as manuscript M111337200 (2002), which is hereby
incorporated by reference in its entirety), such that augmenting of the
intracellular ACF
concentration is not needed. However, to optimize apolipoprotein B mRNA
editing, in
some instances it may be desirable to increase the intracellular concentration
of ACF.
The full length rat ACF has an amino acid sequence according to SEQ
ID No: 21 as follows:
Met Glu Ser Asn His Lys Ser Gly Asp Gly Leu Ser Gly Thr Gln Lys
i 5 to i5
Glu Ala Ala Leu Arg Ala Leu Val Gln Arg Thr Gly Tyr Ser Leu Val
20 25 30
Gln Glu Asn Gly Gln Arg Lys Tyr Gly Gly Pro Pro Pro Gly Trp Asp
40 45
Thr Thr Pro Pro Glu Arg Gly Cys Glu Ile Phe Ile Gly Lys Leu Pro
50 55 60
Arg Asp Leu Phe Glu Asp Glu Leu Ile Pro Leu Cys Glu Lys Ile Gly
65 70 75 80
Lys Ile Tyr Glu Met Arg Met Met Met Asp Phe Asn Gly Asn Asn Arg
85 90 95
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
- 23 -
Gly Tyr Ala Phe Val Thr Phe Ser Asn Lys Gln Glu Ala Lys Asn Ala
100 105 110
Ile Lys Gln Leu Asn Asn Tyr Glu Ile Arg Asn Gly Arg Leu Leu Gly
115 120 125
Val Cys Ala 5er Val Asp Asn Cys Arg Leu Phe Val Gly Gly Ile Pro
130 135 140
Lys Thr Lys Lys Arg Glu Glu Ile Leu Ser Glu Met Lys Lys Val Thr
145 150 155 160
Glu Gly Val Val Asp Val Ile Val Tyr Pro Ser Ala Ala Asp Lys Thr
IS 165 170 175
Lys Asn Arg Gly Phe Ala Phe Val Glu Tyr Glu Ser His Arg Ala Ala
180 185 190
Ala Met Ala Arg Arg Arg Leu Leu Pro Gly Arg Ile Gln Leu Trp Gly
195 200 205
His Pro Ile Ala Val Asp Trp Ala Glu Pro Glu Val Glu Val Asp Glu
210 215 220
Asp Thr Met Ser Ser Val Lys Ile Leu Tyr Val Arg Asn Leu Met Leu
225 230 235 240
Ser Thr Ser Glu Glu Met Ile Glu Lys Glu Phe Asn Ser Ile Lys Pro
245 250 255
Gly Ala Val Glu Arg Val Lys Lys Ile Arg Asp Tyr Ala Phe Val His
260 265 270
3S Phe Ser Asn Arg Glu Asp Ala Val Glu Ala Met Lys Ala Leu Asn Gly
275 280 285
Lys Val Leu Asp Gly Ser Pro Ile Glu Val Thr Leu Ala Lys Pro Val
290 295 300
Asp Lys Asp Ser Tyr Val Arg Tyr Thr Arg Gly Thr Gly Gly Arg Asn
305 310 315 320
Thr Met Leu Gln Glu Tyr Thr Tyr Pro Leu Ser His Val Tyr Asp Pro
325 330 335
Thr Thr Thr Tyr Leu Gly Ala Pro Val Phe Tyr Thr Pro Gln Ala Tyr
340 345 350
S0 Ala Ala Ile Pro Ser Leu His Phe Pro Ala Thr Lys Gly His Leu Ser
355 360 365
Asn Arg Ala Leu Ile Arg Thr Pro Ser Val Arg Glu Ile Tyr Met Asn
370 375 380
Val Pro Val Gly Ala Ala Gly Val Arg Gly Leu Gly Gly Arg Gly Tyr
385 390 395 400
Leu Ala Tyr Thr Gly Leu Gly Arg Gly Tyr Gln Val Lys Gly Asp Lys
405 410 415
Arg Gln Asp Lys Leu Tyr Asp Leu Leu Pro Gly Met Glu Leu Thr Pro
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-24-
420 425 430
$
Met Asn Thr Ile Ser Leu Lys Pro Gln Gly Val Lys Leu Ala Pro Gln
435 440 445
Ile Leu Glu Glu Ile Cys Gln Lys Asn Asn Trp Gly Gln Pro Val Tyr
450 455 460
Gln Leu His Ser Ala Ile Gly Gln Asp Gln Arg Gln Leu Phe Leu Tyr
465 470 475 480
Lys Val Thr Ile Pro Ala Leu Ala Ser Gln Asn Pro Ala Ile His Pro
485 490 495
I$ Phe Thr Pro Pro Lys Leu Ser Ala Tyr Val Asp Glu Ala Lys Arg Tyr
500 505 510
Ala Ala Glu His Thr Leu Gln Thr Leu Gly Ile Pro Thr Glu Gly Gly
515 520 525
Asp Ala Gly Thr Thr Ala Pro Thr Ala Thr Ser Ala Thr Val Phe Pro
530 535 540
Gly Tyr Ala Val Pro Ser Ala Thr Ala Pro Val Ser Thr Ala Gln Leu
2$ 545 550 555 560
Lys Gln Ala Val Thr Leu Gly Gln Asp Leu Ala Ala Tyr Thr Thr Tyr
565 570 575
Glu Val Tyr Pro Thr Phe Ala Val Thr Thr Arg Gly Asp Gly Tyr Gly
580 585 590
Thr Phe
3$
A DNA molecule encoding the full length rat ACF has a nucleotide sequence
according to SEQ ID No: 22 as follows:
atggaatcaaatcacaaatccggggatggattgagcggcacccagaaggaagcagcactc60
cgcgcactggtccagcgcacaggatatagcttggtccaggaaaatggacaaagaaaatat120
ggtggtcctccaccaggctgggatactacacccccagaaaggggctgcgagattttcatt180
gggaaacttccccgggacctttttgaggatgaactcataccattgtgtgaaaaaattggt240
aaaatttatgaaatgagaatgatgatggatttcaatgggaacaacagaggctatgcattt300
gtaaccttctcaaataagcaggaagccaagaatgcaatcaagcaacttaataattatgaa360
4$ attcggaatggccgtctcctgggcgtctgtgccagtgtggacaactgccggttgtttgtg420
gggggaatccccaaaaccaaaaagagagaagaaatcttgtcagagatgaaaaaggtcact480
gaaggagttgttgatgtcattgtctacccaagcgctgccgataaaaccaaaaaccggggg540
tttgcctttgtggaatatgagagtcaccgcgcagccgccatggctaggcggaggctgctg600
ccaggaagaattcagttgtggggacatcctatcgcagtagactgggcagagccagaagtc660
$0 gaagttgacgaagacacaatgtcttccgtgaaaatcctgtacgtaaggaaccttatgctg720
tctacctcggaagagatgattgagaaggaattcaacagtattaaaccaggtgctgtggaa780
cgggtgaagaagatccgagactatgcttttgtgcatttcagtaaccgagaagatgcagtt840
gaagccatgaaggctttgaatggcaaggtgctggatggttccccaatagaagtgaccttg900
gccaagccagtggacaaggacagttacgttaggtacacccggggcaccgggggcaggaac960
$$ accatgctgcaagaatacacctaccctctgagccatgtttatgaccctaccacaacctac1020
cttggagctcctgtcttctatactccccaagcctacgcagccattccaagtcttcatttc1080
ccagctaccaaaggacatctcagcaacagagctctcatccggaccccttctgtcagagaa1140
atttacatgaatgtccctgtaggggctgcgggcgtgagaggactgggcggccgtgggtat1200
ttggcatatacaggcctgggtcgaggataccaggtcaaaggagacaagagacaagacaaa1260
60 ctctatgaccttctgcctgggatggagctcaccccgatgaatactatctctttaaaacca1320
caaggagttaaacttgctcctcagatattagaagaaatctgtcagaaaaataactgggga1380
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-25-
cagccagtgt accagctgca ctctgccatt ggacaagacc aaagacagtt attcctatac 1440
aaagtaacta tcccagcgct ggccagccag aatcctgcga tccacccttt cacaccccca 1500
aagctaagcg cctacgtgga tgaagcaaag aggtacgccg cagagcacac cctacagaca 1560
ctaggcatcc ccacagaagg aggggacgct gggactacag cacccactgc cacatccgcc 1620
actgtgtttc caggatacgc tgtccccagt gccaccgctc ctgtgtctac agcccagctc 1680
aagcaagcag tgacacttgg acaagactta gcagcatata caacctatga ggtctaccct 1740
acttttgcag tgaccacccg aggtgatgga tatggcacct tctga 1785
The amino acid sequence and nucleotide sequence for the full length rat ACF65
is
reported at Genbank Accession Nos. AAK50145 and AY028945, respectively, each
of
which is hereby incorporated by reference in its entirety. In addition, it
should be
noted that a short isoform of rat ACF64 exists, as identified at Genbank
Accession No.
AF290984, which is hereby incorporated by reference in its entirety.
The fizll length human ACF has an amino acid sequence according to
SEQ ID No: 23 as follows:
Met Glu Ser Asn His Lys Ser Gly Asp Gly Leu Ser Gly Thr Gln Lys
1 5 10 15
Glu Ala Ala Leu Arg Ala Leu Val Gln Arg Thr Gly Tyr Ser Leu Val
20 25 30
Gln Glu Asn Gly Gln Arg Lys Tyr Gly Gly Pro Pro Pro Gly Trp Asp
40 45
Ala Ala Pro Pro Glu Arg Gly Cys Glu Ile Phe Ile Gly Lys Leu Pro
50 55 60
Arg Asp Leu Phe Glu Asp Glu Leu Ile Pro Leu Cys Glu Lys Ile Gly
30 65 70 75 80
Lys Ile Tyr Glu Met Arg Met Met Met Asp Phe Asn Gly Asn Asn Arg
85 90 95
3S Gly Tyr Ala Phe Val Thr Phe Ser Asn Lys Val Glu Ala Lys Asn Ala
100 105 110
Ile Lys Gln Leu Asn Asn Tyr Glu Ile Arg Asn Gly Arg Leu Leu Gly
115 120 125
Val Cys Ala Ser Val Asp Asn Cys Arg Leu Phe Val Gly Gly Ile Pro
130 135 140
Lys Thr Lys Lys Arg Glu Glu Ile Leu Ser Glu Met Lys Lys Val Thr
4$ 145 150 155 160
Glu Gly Val Val Asp Val Ile Val Tyr Pro Ser Ala Ala Asp Lys Thr
165 170 175
Lys Asn Arg Gly Phe Ala Phe Val Glu Tyr Glu Ser His Arg Ala Ala
180 185 190
Ala Met Ala Arg Arg Lys Leu Leu Pro Gly Arg Ile Gln Leu Trp Gly
195 200 205
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-26-
His Gly Ile Ala Val Asp Trp Ala Glu Pro Glu Val Glu Val Asp Glu
210 215 220
S Asp Thr Met Ser Ser Val Lys Ile Leu Tyr Val Arg Asn Leu Met Leu
225 230 235 240
Ser Thr Ser Glu Glu Met Ile Glu Lys Glu Phe Asn Asn Ile Lys Pro
245 250 255
Gly Ala Val Glu Arg Val Lys Lys Ile Arg Asp Tyr Ala Phe Val His
260 265 270
Phe Ser Asn Arg Lys Asp Ala Val Glu Ala Met Lys Ala Leu Asn Gly
1S 275 280 285
Lys Val Leu Asp Gly Ser Pro Ile Glu Val Thr Leu Ala Lys Pro Val
290 295 300
Asp Lys Asp Ser Tyr Val Arg Tyr Thr Arg Gly Thr Gly Gly Arg Gly
305 310 315 320
Thr Met Leu Gln Gly Glu Tyr Thr Tyr Ser Leu Gly Gln Val Tyr Asp
325 330 335
Pro Thr Thr Thr Tyr Leu Gly Ala Pro Val Phe Tyr Ala Pro Gln Thr
340 345 350
Tyr Ala Ala Ile Pro Ser Leu His Phe Pro Ala Thr Lys Gly His Leu
355 360 365
Ser Asn Arg Ala Ile Ile Arg Ala Pro Ser Val Arg Gly Ala Ala Gly
370 375 380
Val Arg Gly Leu Gly Gly Arg Gly Tyr Leu Ala Tyr Thr Gly Leu Gly
385 390 395 400
Arg Gly Tyr Gln Val Lys Gly Asp Lys Arg Glu Asp Lys Leu Tyr Asp
405 410 415
Ile Leu Pro Gly Met Glu Leu Thr Pro Met Asn Pro Val Thr Leu Lys
420 425 430
Pro Gln Gly Ile Lys Leu Ala Pro Gln Ile Leu Glu Glu Ile Cys Gln
4$ 435 440 445
Lys Asn Asn Trp Gly Gln Pro Val Tyr Gln -Leu His Ser Ala Ile Gly
450 455 460
Gln Asp Gln Arg Gln Leu Phe Leu Tyr Lys Ile Thr Ile Pro Ala Leu
465 470 475 480
Ala Ser Gln Asn Pro Ala Ile His Pro Phe Thr Pro Pro Lys Leu Ser
485 490 495
Ala Phe Val Asp Glu Ala Lys Thr Tyr Ala Ala Glu Tyr Thr Leu Gln
500 505 510
Thr Leu Gly Ile Pro Thr Asp Gly Gly Asp Gly Thr Met Ala Thr Ala
515 520 525
Ala Ala Ala Ala Thr Ala Phe Pro Gly Tyr Ala Val Pro Asn Ala Thr
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-27-
530 535 540
Ala Pro Val Ser Ala Ala Gln Leu Lys Gln Ala Val Thr Leu Gly Gln
545 550 555 560
Asp Leu Ala Ala Tyr Thr Thr Tyr Glu Val Tyr Pro Thr Phe Ala Val
565 570 575
Thr Ala Arg Gly Asp Gly Tyr Gly Thr Phe
580 585
A DNA molecule encoding the full length human ACF has a nucleotide sequence
according to SEQ ID No: 24 as follows:
atggaatcaaatcacaaatccggggatggattgagcggcactcagaaggaagcagccctc60
cgcgcactggtccagcgcacaggatatagcttggtccaggaaaatggacaaagaaaatat120
ggtggccctccacctggttgggatgctgcaccccctgaaaggggctgtgaaatttttatt180
ggaaaacttccccgagacctttttgaggatgagcttataccattatgtgaaaaaatcggt240
aaaatttatgaaatgagaatgatgatggattttaatggcaacaatagaggatatgcattt300
gtaacattttcaaataaagtggaagccaagaatgcaatcaagcaacttaataattatgaa360
attagaaatgggcgcctcttaggggtttgtgccagtgtggacaactgccgattatttgtt420
gggggcatcccaaaaaccaaaaagagagaagaaatcttatcggagatgaaaaaggttact480
gaaggtgttgtcgatgtcatcgtctacccaagcgctgcagataaaaccaaaaaccgaggc540
tttgccttcgtggagtatgagagtcatcgagcagctgccatggcgaggaggaaactgcta600
ccaggaagaattcagttatggggacatggtattgcagtagactgggcagagccagaagta660
gaagttgatgaagatacaatgtcttcagtgaaaatcctatatgtaagaaatcttatgctg720
tctacctctgaagagatgattgaaaaggaattcaacaatatcaaaccaggtgctgtggag780
agggtgaagaaaattcgagactatgcttttgtgcacttcagtaaccgaaaagatgcagtt840
gaggctatgaaagctttaaatggcaaggtgctggatggttcccccattgaagtcacccta900
gcaaaaccagtggacaaggacagttatgttaggtatacccgaggcacaggtggaaggggc960
accatgctgcaaggagagtatacctactctttgggccaagtttatgatcccaccacaacc1020
taccttggagctcctgtcttctatgccccccagacctatgcagcaattcccagtcttcat1080
ttcccagccaccaaaggacatctcagcaacagagccattatccgagccccttctgttaga1140
ggggctgcgggagtgagaggactgggcggccgtggctatttggcatacacaggcctgggt1200
cgaggataccaggtcaaaggagacaaaagagaagacaaactctatgacattttacctggg1260
atggagctcaccccaatgaatcctgtcacattaaaaccccaaggaattaaactcgctccc1320
cagatattagaagagatttgtcagaaaaataactggggacagccagtgtaccagctgcac1380
tctgctattggacaagaccaaagacagctattcttgtacaaaataactattcctgctcta1440
gccagccagaatcctgcaatccaccctttcacacctccaaagctgagtgcctttgtggat1500
gaagcaaagacgtatgcagccgaatacaccctgcagaccctgggcatccccactgatgga1560
ggcgatggcaccatggctactgctgctgctgctgctactgctttcccaggatatgctgtc1620
cctaatgcaactgcacccgtgtctgcagcccagctcaagcaagcggtaacccttggacaa1680
gacttagcagcatatacaacctatgaggtctacccaacttttgcagtgactgcccgaggg1740
gatggatatggcaccttctga 1761
The amino acid sequence and nucleotide sequence for the full length human ACF
is
reported at Genbank Accession Nos. AAF76221 and AF271789, respectively, each
of
which is hereby incorporated by reference in its entirety.
In comparing the human and rat ACF homologs, it is apparent that
these proteins share 93.5 percent identity at the amino acid level and,
moreover,
antibodies raised against the human ACF also recognize rat ACF. Is has been
reported
that functional complementation of apolipoprotein B mRNA editing by APOBEC-1
involves the N-terminal 380 residues of ACF (Blanc et al., "Mutagenesis of
Apobec-1
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-28-
complementation factor reveals distinct domains that modulate RNA binding,
protein-
protein interaction with Apobec-1, and complementation of C to U RNA-editing
activity," J. Biol. Chem. 276(49): 46386-46393 (2001), which is hereby
incorporated
by reference in its entirety).
The second chimeric protein of the present invention can also include
one or more other polypeptide sequences, including without limitation: (i) a
polypeptide that includes a cytoplasmic localization protein or a fragment
thereof
which, upon cellular uptake of the second chimeric protein, localizes the
second
chimeric protein to the cytoplasm; (ii) a polypeptide that includes a
plurality of
adjacent histidine residues; and (iii) a polypeptide that includes a
hemagglutinin
domain. Each of these has been described above with respect to the first
chimeric
protein.
An exemplary second chimeric protein of the present invention which is
suitable for use in humans, designated TAT-hACF, is set forth in Figure 3A.
This
second chimeric protein (human) includes: an N-terminal HIV tat protein
transduction
domain, a hemagglutinin domain, a polypeptide fragment of human ACF, and a C-
terminal His tag. The amino acid sequence (SEQ ID No: 6) and encoding
nucleotide
sequence (SEQ ID No: 5) of this exemplary second chimeric protein (human) is
set
forth in Figures 3B-C.
An exemplary second chimeric protein of the present invention which is
suitable for use in rats, designated TAT-rACF, is set forth in Figure 4A. This
second
chimeric protein (rat) includes: an N-terminal HIV tat protein transduction
domain, a
hemagglutinin domain, a polypeptide fragment of rat ACF, and a C-terminal His
tag.
The amino acid sequence (SEQ ID No: 8) and encoding nucleotide sequence (SEQ
ID
No: 7) of this exemplary second chimeric protein (rat) is set forth in Figures
4B-C.
DNA molecules encoding the above-identified first and second chimeric
proteins can be assembled using conventional molecular genetic manipulation
for
subcloning gene fragments, such as described by Sambrook et al., Molecular
Cloning:
A Laboratory Manual, Cold Springs Laboratory, Cold Springs Harbor, New York
(1989), and Ausubel et al. (ed.), Current Protocols in Molecular BioloQV, John
Wiley
& Sons (New York, N~ ( 1999 and preceding editions), each of which is hereby
incorporated by reference in its entirety. In conjunction therewith, desired
fragments
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-29-
of the APOBEC-l, ACF, or CMPK encoding DNA molecules can be obtained using
the PCR technique together with specific sets of primers chosen to represent
particula~-
poitions of the protein. Erlich et al., Science 252:1643-51 ( 1991 ), which is
hereby
incorporated by reference in its entirety.
Once the desired DNA molecules have been assembled, DNA
constructs can be assembled by ligating together the DNA molecule encoding the
fn-st
or second chimeric protein with appropriate regulatory sequences including,
without
limitation, a promoter sequence operably connected 5' to the DNA molecule, a
3'
regulatory sequence operably connected 3' of the DNA molecule, as well as any
enhancer elements, suppressor elements, etc. The DNA construct can then be
inserted
into an appropriate expression vector. Thereafter, the vector can be used to
transform
a host cell, typically although not exclusively a prokaryote, and the
recombinant host
cell can express the first or second chimeric protein of the present
invention.
When a prokaryotic host cell is selected for subsequent transformation,
the promoter region used to construct the DNA construct (i.e., transgene)
should be
appropriate for the particular host. The DNA sequences of eukaryotic
promoters, as
described infra for expression in eukaryotic host cells, differ from those of
prokaryotic
promoters. Eukaryotic promoters and accompanying genetic signals may not be
recognized in or may not function in a prokaryotic system and, further,
prokaryotic
promoters are not recognized and do not function in eukaryotic cells.
Similarly, translation of mRNA in prokaryotes depends upon the
presence of the proper prokaryotic signals which differ from those of
eukaryotes.
Efficient translation of mRNA in prokaryotes requires a ribosome binding site
called
the Shine-Dalgarno ("SD") sequence on the mRNA. This sequence is a short
nucleotide sequence of mRNA that is located before the start codon, usually
AUG,
which encodes the amino-terminal methionine of the protein. The SD sequences
are
complementary to the 3'-end of the 16S rRNA (ribosomal RNA) and probably
promote binding of mRNA to ribosomes by duplexing with the rRNA to allow
correct
positioning of the ribosome. For a review on maximizing gene expression, see
Roberts
and Lauer, Methods in Enzymology, 68:473 (1979), which is hereby incorporated
by
reference in its entirety.
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-30-
Promoters vary in their "strength" (i. e., their ability to promote
transcription). For the purposes of expressing a cloned gene, it is desirable
to use
strong promoters in order to obtain a high level of transcription and, hence,
expression
of the gene. Depending upon the host cell system utilized, any one of a number
of
suitable promoters may be used. For instance, when cloning in E. coli, its
bacteriophages, or plasmids, promoters such as the T7 phage promoter, lac
promoter,
trp promoter, recA promoter, ribosomal RNA promoter, the PR and PL promoters
of
coliphage lambda and others, including but not limited, to lacUVS, ompF, 6!a,
lpp, and
the like, may be used to direct high levels of transcription of adjacent DNA
segments.
Additionally, a hybrid trp-lacUV 5 (tac) promoter or other E. coli promoters
produced
by recombinant DNA or other synthetic DNA techniques may be used to provide
for
transcription of the inserted gene.
Bacterial host cell strains and expression vectors may be chosen which
inhibit the action of the promoter unless specifically induced. In certain
operons, the
addition of specific inducers is necessary for efficient transcription of the
inserted
DNA. For example, the lac operon is induced by the addition of lactose or IPTG
(isopropylthio-beta-D-galactoside). A vaxiety of other operons, such as trp,
pro, etc.,
are under different controls.
Specific initiation signals are also required for efficient gene
transcription and translation in prokaryotic cells. These transcription and
translation
initiation signals may vary in "strength" as measured by the quantity of gene
specific
messenger RNA and protein synthesized, respectively. The DNA expression
vector,
which contains a promoter, may also contain any combination of various
"strong"
transcription and/or translation initiation signals. For instance, efficient
translation in
E. coli requires a Shine-Dalgarno ("SD") sequence about 7-9 bases 5' to the
initiation
codon ("ATG") to provide a ribosome binding site. Thus, any SD-ATG combination
that can be utilized by host cell ribosomes may be employed. Such combinations
include, but are not limited to, the SD-ATG combination from the cro gene or
the N
gene of coliphage lambda, or from the E. coli tryptophan E, D, C, B or A
genes.
Additionally, any SD-ATG combination produced by recombinant DNA or other
techniques involving incorporation of synthetic nucleotides may be used.
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-31 -
Mammalian cells can also be used to recombinantly produce the first or
second chimeric proteins of the present invention. Suitable mammalian host
cells
include, without limitation: COS (e.g., ATCC No. CRL 1650 or 1651), BHK (e.g.,
ATCC No. CRL 6281), CHO (ATCC No. CCL 61), HeLa (e.g., ATCC No. CCL 2),
293 (ATCC No. 1573), CHOP, and NS-1 cells. Suitable expression vectors for
directing expression in mammalian cells generally include a promoter, as well
as other
transcription and translation control sequences known in the art. Common
promoters
include, without limitation, SV40, MMTV, metallothionein-l, adenovirus Ela,
CMV,
immediate early, immunoglobulin heavy chain promoter and enhancer, and RSV-
LTR.
Regardless of the selection of host cell, once the DNA molecule coding
for a first or second chimeric protein has been ligated to its appropriate
regulatory
regions using well known molecular cloning techniques, it can then be
introduced into
a suitable vector or otherwise introduced directly into a host cell using
transformation
protocols well known in the art (Sambrook et al., Molecular Cloning: A
Laboratory
Manual, Second Edition, Cold Spring Harbor Press, NY (1989), which is hereby
incorporated by reference in its entirety).
The recombinant DNA molecule can be introduced into host cells via
transformation, particularly transduction, conjugation, mobilization, or
electroporation.
Suitable host cells include, but are not limited to, bacteria, virus, yeast,
mammalian
cells, insect, plant, and the like. The host cells, when grown in an
appropriate medium,
are capable of expressing the chimeric protein, which can then be isolated
therefrom
and, if necessary, purified. The first or second chimeric protein is
preferably produced
in purified form (preferably at least about 80%, more preferably 90%, pure) by
conventional techniques, including immuno-purification techniques. Immuno-
isolation
followed by metal-chelating affinity chromatography and cationic exchange
chromatography is described in Example 1 infra.
A further aspect of the present invention relates to a number of
compositions, preferably pharmaceutical compositions, which include the first
andlor
second chimeric protein of the present invention.
According to one embodiment, a composition includes a
pharmaceutically acceptable Garner and the first chimeric protein of the
present
invention. The first chimeric protein is preferably present in an amount which
is
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-32-
effective to modify apolipoprotein B mRNA editing in cells which uptake the
first
chimeric protein.
According to a second embodiment, a composition includes the first
and second chimeric proteins of the present invention. This composition can
also
include a pharmaceutically acceptable carrier in which the first and second
chimeric
proteins are dispersed. Preferably, the first chimeric protein is present in
an amount
which is effective to modify apolipoprotein B mRNA editing in cells which
uptake the
first chimeric protein and the second chimeric protein is present in an amount
which is
effective to bind apolipoprotein B mRNA and assist the first chimeric protein
in
modifying apolipoprotein B mRNA in cells which uptake the first and second
chimeric
proteins.
The compositions of the present invention can also include suitable
excipients, or stabilizers, and can be in solid or liquid form such as,
tablets, capsules,
powders, solutions, suspensions, or emulsions. Typically, the compositions
will
contain from about 0.01 to 99 percent, preferably from about 20 to 75 percent
of the
chimeric protein(s), together with the carrier, excipient, stabilizer, etc.
The solid unit dosage forms can be of the conventional type. The solid
form can be a capsule, such as an ordinary gelatin type containing the first
and/or
second chimeric proteins) of the present invention and a carrier, for example,
lubricants and inert fillers such as, lactose, sucrose, or cornstarch. In
another
embodiment, these first and/or second chimeric proteins) are tableted with
conventional tablet bases such as lactose, sucrose, or cornstarch in
combination with
binders like acacia, cornstarch, or gelatin, disintegrating agents, such as
cornstarch,
potato starch, or alginic acid, and a lubricant, like stearic acid or
magnesium stearate.
The first and/or second chimeric proteins) of the present invention may
also be administered in injectable or topically-applied dosages by solution or
suspension of these materials in a physiologically acceptable diluent with a
pharmaceutical carrier. Such carriers include sterile liquids, such as water
and oils,
with or without the addition of a surfactant and other pharmaceutically and
physiologically acceptable carrier, including adjuvants, excipients or
stabilizers.
Illustrative oils are those of petroleum, animal, vegetable, or synthetic
origin, for
example, peanut oil, soybean oil, or mineral oil. In general, water, saline,
aqueous
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-33-
dextrose and related sugar solution, and glycols, such as propylene glycol or
polyethylene glycol, are prefewed liquid carriers, particularly for injectable
solutions.
For use as aerosols, the first and/or second chimeric proteins) of the
present invention in solution or suspension may be packaged in a pressurized
aerosol
container together with suitable propellants, for example, hydrocarbon
propellants like
propane, butane, or isobutane with conventional adjuvants. The compositions of
the
present invention also may be administered in a non-pressurized form such as
in a
nebulizer or atomizer.
Depending upon the treatment being effected, the compounds of the
present invention can be administered orally, topically, transdermally,
parenterally,
subcutaneously, intravenously, intramuscularly, intraperitoneally, by
intracavitary or
intravesical instillation, intraocularly, intraarterially, intralesionally, or
by application to
mucous membranes, such as, that of the nose, throat, and bronchial tubes. In
most
instances, subcutaneous, intravenous, intramusculax, intraperitoneal, and
intraarterial
routes are preferred.
Compositions within the scope of this invention include all
compositions wherein the first and/or second chimeric proteins of the present
invention
is contained in an amount effective to achieve its intended purpose, noted
above.
While individual needs vary, determination of optimal ranges of effective
amounts of
each of the first and second chimeric proteins is within the skill of the art.
Typical
dosages comprise about 0.01 to about 100 mg/kg-body wt. The preferred dosages
comprise about 0.1 to about 100 mg/kg-body wt. The most preferred dosages
comprise about 1 to about 100 mg/kg~body wt.
The amounts of the first and second chimeric proteins can be
determined by one of ordinary skill in the art using routine testing to
optimize the
dosage levels of the first and second chimeric proteins in accordance with the
desired
degree of apolipoprotein B mRNA editing. Based on May 2001 guidelines by the
National Institutes of Health's National Cholesterol Education Program (NCEP),
individuals at low risk for a heart attack should have LDL levels under 160
mg/dL,
while those at highest risk should aim for LDLs under 100 mg/dL. Treatment
regimen
for the administration of the first and/or second chimeric proteins of the
present
invention can also be determined readily by those with ordinary skill in art.
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-34-
Typically, the fn-st and/or second chimeric proteins (or compositions
which contain one or both of the chimeric proteins of the present invention)
can be
administered via a drug delivery device which includes a chimeric protein or a
composition of the present invention. Exemplary delivery devices include,
without
limitation, liposomes, niosomes, transdermal patches, implants, and syringes.
Liposomes are vesicles comprised of one or more concentrically
ordered lipid bilayers which encapsulate an aqueous phase. They are normally
not
leaky, but can become leaky if a hole or pore occurs in the membrane, if the
membrane
is dissolved or' degrades, or if the membrane temperature is increased to the
phase
transition temperature. Current methods of drug delivery via liposomes require
that
the liposome carrier ultimately become permeable and release the encapsulated
drug at
the target site. This can be accomplished, for example, in a passive manner
wherein
the liposome bilayer degrades over time through the action of various agents
in the
body. Every liposome composition will have a characteristic half life in the
circulation
or at other sites in the body and, thus, by controlling the half life of the
liposome
composition, the rate at which the bilayer degrades can be somewhat regulated.
In contrast to passive drug release, active drug release involves using an
agent to induce a permeability change in the liposome vesicle. Liposome
membranes
can be constructed so that they become destabilized when the environment
becomes
acidic near the liposome membrane (see, e.g., Proc. Natl. Acad. Sci. USA
84:7851
(1987); Biochemistry 28:908 (1989), which is hereby incorporated by reference
in its
entirety). When liposomes are endocytosed by a target cell, for example, they
can be
routed to acidic endosomes which will destabilize the liposome and result in
drug
release.
Alternatively, the liposome membrane can be chemically modified such
that an enzyme is placed as a coating on the membrane which slowly
destabilizes the
liposome. Since control of drug release depends on the concentration of enzyme
initially placed in the membrane, there is no real effective way to modulate
or alter
drug release to achieve "on demand" drug delivery. The same problem exists for
pH-
sensitive liposomes in that as soon as the liposome vesicle comes into contact
with a
target cell, it will be engulfed and a drop in pH will lead to drug release.
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-35-
This liposome delivery system can also be made to accumulate at a
target organ, tissue, or cell via active twgeting. In accordance with the
present
invention, liposomes can be targeted to liver cells by incorporating into the
liposome
bilayer a molecule which target hepatocyte receptors. One such molecule is the
asialoglycoprotein asialofetuin, which targets the asialoglycoprotein receptor
of
hepatocytes. The incorporation of asialofetuin into the liposome bilayer can
be
performed according to the procedures set forth in Wu et al., "Increased liver
uptake
of liposomes and improved targeting efficacy by labeling with asialofetuin in
rodents,"
He~atolog_y 27(3):772-778 (1998), which is hereby incorporated by reference in
its
entirety.
Niosomes are vesicles formed by amphiphilic materials. Non-ionic
surfactants were the first materials studied (Iga et al., "Membrane
modification by
negatively charged stearylpolyoxyethylene derivatives for thermosensitive
liposomes:
Reduced liposomal aggregation and avoidance of reticuloendothelial system
uptake," J.
Drug Target 2:259-67 ( 1994), which is hereby incorporated by reference in its
entirety) and a large number of surfactants have since been found to self
assemble into
closed bilayer vesicles (Ahl et al., "Enhancement of the in vivo circulation
lifetime of
L-alpha-distearoylphosphatidylcholine liposomes: Importance of liposomal
aggregation
versus complement opsonization," Biochim Biophys Acta 1329:370-82 (1997),
which
is hereby incorporated by reference in its entirety). These niosomal materials
may be
used for delivery of the first or second chimeric protein or for delivery of
APOBEC-1
or fragments thereof alone or in combination with ACF or fragments thereof.
For example, 200nm doxorubicin niosomes with a polyoxyethylene
(molecular weight 1,000) surface have been shown to be rapidly taken up by the
liver
(Uchegbu et al., "Distribution, metabolism and tumoricidal activity of
doxorubicin
administered in sorbitan monostearate (Span 60) niosomes in the mouse," Pharm.
Res.
12:1019-24 (1995), which is hereby incorporated by reference in its entirety),
allowing
polymeric drug conjugates to be formed for delivery of the drug (see Duncan,
"Drug
polymer conjugates - potential for improved chemotherapy," Anti-Cancer Drugs
3:175-210 (1992), which is hereby incorporated by reference in its entirety).
These
techniques can be readily adapted for delivery of the first and second
chimeric proteins
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-36-
or, alternatively, APOBEC-1 or a fragment thereof alone or in combination with
ACF
or a fi-agment thereof.
Compositions including the liposomes or niosomes in a
pharmaceutically acceptable carrier are also contemplated.
Transdermal delivery devices have been employed for delivery of low
molecular weight proteins by using lipid-based compositions (i.e., in the form
of a
patch) in combination with sonophoresis. However, as reported in U.S. Patent
No.
6,041,253 to Ellinwood, Jr. et al., which is hereby incorporated by reference
in its
entirety, transdermal delivery can be further enhanced by the application of
an electric
field, for example, by iontophoresis or electroporation. Using low frequency
ultrasound which induces cavitation of the lipid layers of the stratum
corneum, higher
transdermal fluxes, rapid control of transdermal fluxes, and drug delivery at
lower
ultrasound intensities can be achieved. Still further enhancement can be
obtained using
a combination of chemical enhancers and/or magnetic field along with the
electric field
and ultrasound.
Implantable or injectable protein depot compositions can also be
employed, providing long-term delivery of, e.g., the first and second chimeric
proteins. For example, U.S. Patent No. 6,331,311 to Brodbeck et al., which is
hereby
incorporated by reference in its entirety, reports an injectable depot gel
composition
which includes a biocompatible polymer, a solvent that dissolves the polymer
and
forms a viscous gel, and an emulsifying agent in the form of a dispersed
droplet phase
in the viscous gel. Upon injection, such a gel composition can provide a
relatively
continuous rate of dispersion of the agent to be delivered, thereby avoiding
an initial
burst of the agent to be delivered.
Other suitable protein delivery system which are known to those of skill
in the art can also be employed to achieve the desired delivery and, thus,
modification
in the editing of apolipoprotein B mRNA and its concomitant effects.
By virtue of the first chimeric protein being able to edit apolipoprotein
B mRNA, the present invention affords a method of modifying apolipoprotein B
mRNA editing in vivo. This aspect of the present invention can be carried out
by
contacting apolipoprotein B mRNA in a cell with the first chimeric protein of
the
present invention under conditions effective to increase the concentration of
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-37-
apolipoprotein B48 which is secreted by the cell as compared to the
concentration of
apolipoprotein BI00 which is secreted by the cell, relative to an untreated
cell (i.e.,
which has not taken up the first chimeric protein). Basically, the contacting
is carried
out by exposing the cell to the first chimeric protein under conditions
effective to
induce cellular uptake of the first chimeric protein. Because the first
chimeric protein
includes the first polypeptide (i.e., which includes a protein transduction
domain), the
first chimeric protein is taken up by the cell. In addition, the same cell can
also be
contacted with the second chimeric protein of the present invention, causing
the
second chimeric protein also to be taken up by the cell. As a result, the
apolipoprotein
B mRNA in the cell is contacted by the second chimeric protein, binding the
apolipoprotein mRNA (as described above) so as to facilitate editing thereof
by the
first chimeric protein. The cell in which the apolipoprotein B mRNA editing is
modified can be any cell which can synthesize and secrete VLDL with
apolipoprotein
B or its derivatives. Exemplary cells of this type include liver cells and
intestinal cells,
although preferably liver cells. The cell can also be in a mammal, preferably
a human.
Likewise, the present invention also affords a method of reducing serum
LDL levels. This aspect of the present invention can be ca~Tied out by
delivering into
one or more cells of a patient, without genetically modifying the cells, an
amount of a
protein comprising APOBEC-1 or a fragment thereof which can edit mRNA encoding
apolipoprotein B, which amount is effective to increase the concentration of
VLDL-
apolipoprotein B48 that is secreted by the one or more cells into serum and,
consequently, reduce the serum concentration of LDL. In accordance with this
aspect
of the present invention, the patient is a mammal, preferably a human, and the
one or
more cells are preferably liver cells, intestinal cells, or a combination
thereof.
To sustain the reduced serum LDL levels, delivery of the protein into
the one or more cells is preferably repeated periodically (i.e., following a
delay of from
about 1 to about 7 days).
Delivery of the protein into the one or more cells can be carried out by
exposing the one or more cells to the protein under conditions effective to
cause
cellular uptake of the protein. Preferably, the protein which includes APOBEC-
1 or a
fragment thereof is actually the first chimeric protein of the present
invention and the
protein transduction domain induces cellular uptake by the one or more cells.
In
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-38-
addition to delivering the protein, a second protein can also be delivered
simultaneously into the one or more cells of the patient, without genetically
modifying
the cells, where the second protein includes ACF or a fragment thereof which
can bind
to apolipoprotein B mRNA. Preferably, the second protein is the second
chimeric
protein of the present invention and the protein transduction domain induces
cellular
uptake by the one or more cells.
Alternatively, APOBEC-1 can be delivered directly into one or more
liver cells by contacting each of them with liposomes including a molecule
which binds
to a hepatocyte receptor (e.g., asialofetuin), thereby inducing uptake of the
liposomes
and degradation thereof intracellularly to empty their contents into the one
or more
liver cells. In addition, ACF or a fragment thereof which can bind to
apolipoprotein B
mRNA can also be delivered via the liposomes.
By increasing the ratio of apolipoprotein B48 to apolipoprotein B 100
which is secreted by the one or more cells, the present invention also relates
to a
method of treating or preventing an atherogenic disease or disorder. This
aspect of the
present invention can be carried out by administering to a patient an
effective amount
of a protein comprising APOBEC-1 or a fragment thereof which can edit mRNA
encoding apolipoprotein B, wherein upon said administering the protein is
taken up by
one or more cells of the patient that can synthesize and secrete VLDL-
apolipoprotein
under conditions which are effective to increase the concentration of VLDL-
apolipoprotein B48 that is secreted by the one or more cells into serum,
whereby rapid
clearing of VLDL-apolipoprotein B48 from serum decreases the serum
concentration
of LDL to treat or prevent the atherogenic disease or disorder. In accordance
with this
aspect of the present invention, the patient is a mammal, preferably a human,
and the
one or more cells are preferably liver cells.
Administration of the protein can be carried out according to any of the
above-identified approaches. Continued preventative or therapeutic treatment
can be
effected by repeatedly administering the APOBEC-1 protein periodically (i.e.,
following a delay of from about 1 to about 7 days).
Preferably, the protein which includes APOBEC-1 or a fragment
thereof is actually the first chimeric protein of the present invention and
the protein
transduction domain induces cellular uptake by the one or more cells. As with
the
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-39-
above-described methods, a second protein that includes ACF or a fragment
thereof
which can bind to apolipoprotein B mRNA can also be delivered simultaneously.
Preferably, the second protein is the second chimeric protein of the present
invention
and the protein transduction domain induces cellular uptake by the one or more
cells.
. Alternatively, using a liposome delivery vehicle, APOBEC-1 and
optionally ACF can be delivered directly into one or more liver cells by
contacting each
of them with a liposome including a molecule which binds to a hepatocyte
receptor,
thereby inducing uptake of the liposomes and degradation thereof
intracellularly to
empty their contents into the one or more liver cells.
EXAMPLES
The following examples are intended to illustrate, but by no means are
intended to limit, the scope of the present invention as set forth in the
appended claims.
Example 1 - Generation of TAT Fusion Protein
The induction of hepatic apolipoprotein B mRNA editing was sought
through TAT mediated APOBEC-1 protein transduction into liver cells. It has
been
shown that linking an I l-amino-acid protein transduction domain (PTD) of HIV-
1
TAT protein to heterologous protein conferred the ability to transduce into
cells
(Nagahara et al., "Transduction of full-length TAT fusion proteins into
mammalian
cells: TAT-p27K'pl induces cell migration," Nature Med. 4:1449-1452 (1998);
Schwarze et al., "In vivo protein transduction: delivery of a biologically
active protein
into the mouse," Science 285:1569-1572 (1999); Vocero-Akbani et al., "Killing
HIV-
infected cells by transduction with an HIV protease-activated caspase-3
protein,"
Nature Med. 5:29-33 ( 1999), each of which is hereby incorporated by reference
in its
entirety). PTD-linked protein transduced into 100% of cells and the
transduction
process occuwed in a rapid and concentration-dependent but receptor- and
transporter-independent manner (Schwarze et al., "Protein transduction:
unrestricted
delivery into all cells," Trends Cell Biol. 10:290-295 (2000), which is hereby
incorporated by reference in its entirety). Liver cells have been shown to be
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-40-
susceptible to transduction (Nagaha~-a et al., "Transduction of full-length
TAT fusion
proteins into mammalian cells: TAT-p27K'P' induces cell migration," Nature
Med.
4:1449-1452 (1998), which is hereby incorporated by reference in its
entirety). In
order to produce in-frame TAT fusion protein from E. coli, a prokaryotic
expression
vector was constructed that has an N-terminal PTD flanked by glycine residues
for free
bond rotation of the domain (Schwarze et al., "In vivo protein transduction:
delivery of
a biologically active protein into the mouse," Science 285:1569-1572 (1999),
which is
hereby incorporated by reference in its entirety), an hemagglutinin (HA) tag
and a C-
terminal 6-histidine tag. Using this vector as a backbone, a plasmid was
constructed to
encode full-length TAT-rAPOBEC-CMPK protein, SEQ ID No: 4 (Figures 2A, 2D,
and 5A). APOBEC-1 conjugated to CMPK was used in this study because it showed
a
less robust editing activity in vitro and targeted primarily cytoplasmic mRNAs
(Yang
et al., "Induction of cytidine to uridine editing on cytoplasmic
apolipoprotein B mRNA
by overexpressing APOBEC-l," J. Biol. Chem. 275:22663-22669 (2000), which is
hereby incorporated by reference in its entirety). In vitro studies
demonstrated that
APOBEC-1 retained catalytic activity when conjugated to various lengths of non-
specific proteins (Siddiqui et al., "Disproportionate relationship between
APOBEC-1
expression and apoB mRNA editing activity," Exp. Cell Res. 252:154-164 (1999);
Yang et al., "Induction of cytidine to uridine editing on cytoplasmic
apolipoprotein B
mRNA by overexpressing APOBEC-1," J. Biol. Chem. 275:22663-22669 (2000), each
of which is hereby incorporated by reference in its entirety).
A double-stranded oligomeric nucleotide encoding the 9-amino acid
TAT domain flanked by glycine residues (sense strand shown below, SEQ ID No:
25)
catatgggaa gaaaaaaaag aagacaaaga agaagaggcc tcgag 45
and a PCR product encoding HA-rAPOBEC-CMPK (SEQ ID No: 26 as set forth
below)
atgggctcta gataccccta cgacgtgccc gactacgccg atatcagttc cgagacaggc 60
cctgtagctg ttgatcccac tctgaggaga agaattgagc cccacgagtt tgaagtcttc 120
tttgaccccc gggaacttcg gaaagagacc tgtctgctgt atgagatcaa ctggggagga 180
aggcacagca tctggcgaca cacgagccaa aacaccaaca aacacgttga agtcaatttc 240
atagaaaaat ttactacaga aagatacttt tgtccaaaca ccagatgctc cattacctgg 300
ttcctgtcct ggagtccctg tggggagtgc tccagggcca ttacagaatt tttgagccga 360
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-41 -
tacccccatgtaactctgtttatttatatagcacggctttatcaccacgcagatcctcga420
aatcggcaaggactcagggaccttattagcagcggtgttactatccagatcatgacggag480
caagagtct9gctactgctggaggaattttgtcaactactccccttcgaatgaagctcat540
tggccaaggtacccccatctgtgggtgaggctgtacgtactggaactctactgcatcatt600
ttaggacttccaccctgtttaaatattttaagaagaaaacaacctcaactcacgtttttc660
acgattgctcttcaaagctgccattaccaaaggctaccaccccacatcctgtgggccaca720
gggttgaaagaattccacgctgccatggcagacacctttctggagcacatgtgccgcctg780
gacatcgactccgagccaaccattgccagaaacaccggcatcatctgcaccatcggccca840
gcctcccgctctgtggacaagctgaaggaaatgattaaatctggaatgaatgttgcccgc900
1~ ctcaacttctcgcacggcacccacgagtatcatgagggcacaattaagaacgtgcgagag960
gccacagagagctttgcctctgacccgatcacctacagacctgtggctattgcactggac1020
accaagggacctgaaatccgaactggactcatcaagggaagtggcacagcagaggtggag1080
ctcaagaagggcgcagctctcaaagtgacgctggacaatgccttcatggagaactgcgat1140
gagaatgtgctgtgggtggactacaagaacctcatcaaagttatagatgtgggcagcaaa1200
.15atctatgtggatgacggtctcatttccttgctggttaaggagaaaggcaaggactttgtc1260
atgactgaggttgagaacggtggcatgcttggtagtaagaagggagtgaacctcccaggt1320
gctgcggtcgacctgcctgcagtctcagagaaggacattcaggacctgaaatttggcgtg1380
gagcagaatgtggacatggtgttcgcttccttcatccgcaaagctgctgatgtccatgct1440
gtcaggaaggtgctaggggaaaagggaaagcacatcaagattatcagcaagattgagaat1500
2~ cacgagggtgtgcgcaggtttgatgagatcatggaggccagcgatggcattatggtggcc1560
cgtggtgacctgggtattgagatccctgctgaaaaagtcttcctcgcacagaagatgatg1620
attgggcgctgcaacagggctggcaaacccatcatttgtgccactcagatgttggaaagc1680
atgatcaagaaacctcgcccgacccgcgctgagggcagtgatgttgccaatgcagttctg1740
gatggagcagactgcatcatgctgtctggggagaccgccaagggagactacccactggag1800
25 gctgtgcgcatgcagcacgctattgctcgtgaggctgaggccgcaatgttccatcgtcag1860
cagtttgaagaaatcttacgccacagtgtacaccacagggagcctgctgatgccatggca1920
gcaggcgcggtggaggcctcctttaagtgcttagcagcagctctgatagttatgaccgag1980
tctggcaggtctgcacacctggtgtcccggtaccgcccgcgggctcccatcatcgccgtc2040
acccgcaatgaccaaacagcacgccaggcacacctgtaccgcggcgtcttccccgtgctg2100
3~ tgcaagcagccggcccacgatgcctgggcagaggatgtggatctccgtgtgaacctgggc2160
atgaatgtcggcaaagcccgtggattcttcaagaccggggacctggtgatcgtgctgacg2220
ggctggcgccccggctccggctacaccaacaccatgcgggtggtgcccgtgcca 2274
or HA-CMPK (SEQ ID No: 27 as set forth below)
ctcgagatgtacccctacgacgtgcccgactacgccgatatccacgctgccatggcagac60
acctttctggagcacatgtgccgcctggacatcgactccgagccaaccattgccagaaac120
accggcatcatctgcaccatcggcccagcctcccgctctgtggacaagctgaaggaaatg180
attaaatctggaatgaatgttgcccgcctcaacttctcgcacggcacccacgagtatcat240
gagggcacaattaagaacgtgcgagaggccacagagagctttgcctctgacccgatcacc300
tacagacctgtggctattgcactggacaccaagggacctgaaatccgaactggactcatc360
aagggaagtggcacagcagaggtggagctcaagaagggcgcagctctcaaagtgacgctg420
gacaatgccttcatggagaactgcgatgagaatgtgctgtgggtggactacaagaacctc480
atcaaagttatagatgtgggcagcaaaatctatgtggatgacggtctcatttccttgctg540
gttaaggagaaaggcaaggactttgtcatgactgaggttgagaacggtggcatgcttggt600
agtaagaagggagtgaacctcccaggtgctgcggtcgacctgcctgcagtctcagagaag660
gacattcaggacctgaaatttggcgtggagcagaatgtggacatggtgttcgcttccttc720
atccgcaaagctgctgatgtccatgctgtcaggaaggtgctaggggaaaagggaaagcac780
atcaagattatcagcaagattgagaatcacgagggtgtgcgcaggtttgatgagatcatg840
gaggccagcgatggcattatggtggcccgtggtgacctgggtattgagatccctgctgaa900
aaagtcttcctcgcacagaagatgatgattgggcgctgcaacagggctggcaaacccatc960
atttgtgccactcagatgttggaaagcatgatcaagaaacctcgcccgacccgcgctgag1020
ggcagtgatgttgccaatgcagttctggatggagcagactgcatcatgctgtctggggag1080
accgccaagggagactacccactggaggctgtgcgcatgcagcacgctattgctcgtgag1140
gctgaggccgcaatgttccatcgtcagcagtttgaagaaatcttacgccacagtgtacac1200
cacagggagcctgctgatgccatggcagcaggcgcggtggaggcctcctttaagtgctta1260
gcagcagctctgatagttatgaccgagtctggcaggtctgcacacctggtgtcccggtac1320
cgcccgcgggctcccatcatcgccgtcacccgcaatgaccaaacagcacgccaggcacac1380
ctgtaccgcggcgtcttccccgtgctgtgcaagcagccggcccacgatgcctgggcagag1440
gatgtggatctccgtgtgaacctgggcatgaatgtcggcaaagcccgtggattcttcaag1500
accggggacctggtgatcgtgctgacgggctggcgccccggctccggctacaccaacacc1560
atgcgggtggtgcccgtgccatgactcgag 1590
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-42-
(Yang et al., "Induction of cytidine to uridine editing on cytoplasmic
apolipoprotein B
mRNA by overexpressing APOBEC-l," J. Biol. Chem. 275:22663-22669 (2000),
which is hereby incorporated by reference in its entirety) were inserted into
NdeIlXhoI
digested pPROEX vector (Life, Gaithersburg, Maryland). The entire constructs
(TAT-
S rAPOBEC-CMPK (SEQ ID No: 3) or TAT-CMPK (SEQ ID No: 28 as set forth
below)
catatgggaagaaaaaaaagaagacaaagaagaagaggcctcgagatgtacccctacgac60
gtgcccgactacgccgatatccacgctgccatggcagacacctttctggagcacatgtgc120
cgcctggacatcgactccgagccaaccattgccagaaacaccggcatcatctgcaccatc180
ggcccagcctcccgctctgtggacaagctgaaggaaatgattaaatctggaatgaatgtt240
gcccgcctcaacttctcgcacggcacccacgagtatcatgagggcacaattaagaacgtg300
cgagaggccacagagagctttgcctctgacccgatcacctacagacctgtggctattgca360
ctggacaccaagggacctgaaatccgaactggactcatcaagggaagtggcacagcagag420
gtggagctcaagaagggcgcagctctcaaagtgacgctggacaatgccttcatggagaac480
tgcgatgagaatgtgctgtgggtggactacaagaacctcatcaaagttatagatgtgggc540
agcaaaatctatgtggatgacggtctcatttccttgctggttaaggagaaaggcaaggac600
tttgtcatgactgaggttgagaacggtggcatgcttggtagtaagaagggagtgaacctc660
ccaggtgctgcggtcgacctgcctgcagtctcagagaaggacattcaggacctgaaattt720
ggcgtggagcagaatgtggacatggtgttcgcttccttcatccgcaaagctgctgatgtc780
catgctgtcaggaaggtgctaggggaaaagggaaagcacatcaagattatcagcaagatt840
gagaatcacgagggtgtgcgcaggtttgatgagatcatggaggccagcgatggcattatg900
gtggcccgtggtgacctgggtattgagatccctgctgaaaaagtcttcctcgcacagaag960
atgatgattgggcgctgcaacagggctggcaaacccatcatttgtgccactcagatgttg1020
gaaagcatgatcaagaaacctcgcccgacccgcgctgagggcagtgatgttgccaatgca1080
gttctggatggagcagactgcatcatgctgtctggggagaccgccaagggagactaccca1140
ctggaggctgtgcgcatgcagcacgctattgctcgtgaggctgaggccgcaatgttccat1200
cgtcagcagtttgaagaaatcttacgccacagtgtacaccacagggagcctgctgatgcc1260
atggcagcaggcgcggtggaggcctcctttaagtgcttagcagcagctctgatagttatg1320
accgagtctggcaggtctgcacacctggtgtcccggtaccgcccgcgggctcccatcatc1380
gccgtcacccgcaatgaccaaacagcacgccaggcacacctgtaccgcggcgtcttcccc1440
gtgctgtgcaagcagccggcccacgatgcctgggcagaggatgtggatctccgtgtgaac1500
ctgggcatgaatgtcggcaaagcccgtggattcttcaagaccggggacctggtgatcgtg1560
ctgacgggctggcgccccggctccggctacaccaacaccatgcgggtggtgcccgtgcca1620
tgactcgag 1629
were inserted into pET 24b (Novagen, Madison, Wisconsin) vector to take
advantage
of the C-terminal His6 tag. TAT fusion proteins (referred to as TAT-CMPK, the
expression product of SEQ ID No: 28, and TAT-rAPOBEC-CMPK, SEQ ID No: 4)
were purified from BL-21(DE3) codon plus cells (Stratagene, La Jolla,
California).
Two to four 1-liter cultures were inoculated with a 10 ml overnight culture
each and
induced by 0.1 mM IPTG at 30°C for 1 hour. Soluble proteins were
obtained by
French press in 25 ml of buffer A (8M urea, 10 mM Tris pH 8, 100 mM NaH2POa).
Cellular lysates were cleared by centrifugation, loaded onto a 5-ml Ni-NTA
column
(Qiagen, Valencia, California) in buffer A with 10-20 mM imidazole, washed and
eluted with imidazole in buffer A'stepwise' (100, 175 and 250 mM) and loaded
onto a
HiTrap SP column (Amersham Pharmacia, Piscataway, New Jersey). The column was
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
- 43 -
washed and eluted with 1 M NaCI in buffer A. The urea and high salt were
removed
from the relevant fractions by rapid dialysis against buffer B (30 mM Tris
pH=8.5, 50
mM NaCI, 10~M zinc acetate, 5% glycerol). The elution profile was analyzed by
SDS-PAGE. Gels were stained with silver according to manufacture's
recommendations (Bio-Rad, Hercules, California).
Recombinant proteins were solubilized in 8M urea buffer from bacterial
cells so as to maximize their yield from inclusion bodies. Previous studies
have shown
that denatured proteins could transduce as well as native proteins (Schwarze
et al., "In
vivo protein transduction: delivery of a biologically active protein into the
mouse,"
Science 285:1569-1572 (1999), which is hereby incorporated by reference in its
entirety). The proteins were purified through metal-chelating affinity
chromatography
followed by cationic exchange chromatography. The urea was removed by rapid
dialysis and the purity of full-length 86 kDa TAT-rAPOBEC-CMPK, SEQ ID No: 4,
was apparent as shown by silver staining (Figure SB). The purification of full-
length
protein was also confirmed by western blot using anti-His6 antibody.
Example 2 - In vitro Introduction of TAT-rAPOBEC-CMPK
into McArdle Cells
The uptake of TAT-rAPOBEC-CMPK, SEQ ID No: 4, into McArdle
cells was evaluated using an antibody reactive with the HA epitope and
fluorescence
microscopy.
McArdle RH7777 cells were obtained from ATCC (Manassas, Virginia)
and cultured as described previously (Yang et al., "Partial characterization
of the
auxiliary factors involved in apo B mRNA editing through APOBEC-1 affinity
chromatography," J. Biol. Chem. 272:27700-27706 ( 1997), which is hereby
incorporated by reference in its entirety). McArdle cells, grown on six well
cluster
plates were treated with either TAT-rAPOBEC-CMPK or TAT-CMPK for the
indicated times. Cells were then washed extensively with PBS and subsequently
fixed
with 2% paraformaldehyde, permeabilized with 0.4% Triton X100, blocked with 1%
BSA and reacted with affinity purified anti-HA (Babco, Berkeley, CA) and
affinity
purified FITC conjugated goat anti-mouse secondary antibody (Organon Teknika,
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-44-
West Chester, PA), each at 1:1000 dilution. Fluorescence was observed and
electronic
images captured on an inverted, fluorescence Olympus microscope.
Recombinant APOBEC-1 has a tendency to aggregate, a property
which persists in TAT-rAPOBEC-CMPK, apparent as aggregates of HA antibody-
reactive material attached to the surface of cells 1h following the addition
of the
protein to the media (Figures 6A-B). Aggregation was not a property of the TAT
motif or CMPK as control protein (TAT-CMPK) at a higher molar concentration
appeared as an array of speckles attached to the surface of McArdle cells 1 h
following
its addition to the media (Figures 7A and B).
Within 6 h following treatment, both TAT-rAPOBEC-CMPK (Figures
6C-D) and TAT-CMPK (Figures 7C-D) were apparent inside the cells and the cell
surface-attached aggregates appeared to be more disperse. Following 24 h of
treatment, many of the cells treated with TAT-rAPOBEC-CMPK demonstrated bright
perinuclear fluorescence and also a low intensity of fluorescence throughout
the
I 5 nucleus and cytoplasm (Figures 6E-F). Cells treated for 24 h with TAT-CMPK
demonstrated bright fluorescent speckles in the cytoplasm and fainter
homogenous
nuclear fluorescence (Figure 7E-F). The nuclear distribution of the
recombinant
protein might have been facilitated by the embedded nuclear localization
signal (NLS)
in TAT sequence (Schwarze et al., "In vivo protein transduction: delivery of a
biologically active protein into the mouse," Science 285:1569-1572 (1999),
which is
hereby incorporated by reference in its entirety) as APOBEC-1 alone does not
have a
functional NLS (Yang et al., "Multiple protein domains determine the cell type-
specific
nuclear distribution of the catalytic subunit required for apo B mRNA
editing," Proc.
Natl. Acad. Sci. USA 94:13075-13080 (1997), which is hereby incorporated by
reference in its entirety) and 6His-HA-APOBEC-CMPK was excluded from the
nucleus (Yang et al., "Induction of cytidine to uridine editing on cytoplasmic
apolipoprotein B mRNA by overexpressing APOBEC-1," J. Biol. Chem. 275:22663-
22669 (2000), which is hereby incorporated by reference in its entirety). The
data
suggested that both TAT-rAPOBEC-CMPK and TAT-CMPK were taken up by
McArdle cells. Comparatively, the efficiency of TAT-rAPOBEC-CMPK uptake was
poorer than that for TAT-CMPK, and the distribution of these proteins within
the cells
appeared different.
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-45-
Example 3 - Measurement of Apolipoprotein B mRNA Editing in TAT
rAPOBEC-CMPK Transduced McArdle Cells
Given that TAT-CMPK entered McArdle cells, as demonstrated in
Example 2, an evaluation was made as to whether this would affect
apolipoprotein B
mRNA editing activity (Figure 8). Cells were treated with the indicated
amounts of
TAT-CMPK (using the same preparation of protein as in Figure 7) and total
cellular
RNA was isolated following 24 h and the proportion of edited apolipoprotein B
mRNA measured.
Total cellular RNA was isolated from cells with Tri-Reagent (Molecular
Research Center, Cincinnati, Ohio) according to manufacture's recommendations.
Purified RNAs were digested with RQ-DNase I (Promega, Madison, Wisconsin) and
with RsaI (Promega) restriction enzyme that has a recognition site between the
PCR
annealing sites of target substrates to ensure the removal of the
contaminating genomic
DNA.
Editing activity was determined by the reverse transcriptase-polymerise
chain reaction (RT-PCR) methodology described previously (Smith et al. "In
vitro
apolipoprotein B mRNA editing: Identification of a 27S editing complex," Proc.
Natl.
Acad. Sci. USA 88:1489-1493 (1991), which is hereby incorporated by reference
in its
entirety). First strand cDNA was generated using oligo dT-primed total
cellular RNA.
Specific PCR amplification of rat apolipoprotein B sequence surrounding the
editing
site was accomplished using ND 1 /ND2 primer pairs set forth below:
ND1 (SEQ ID No: 29)
atctgactgg gagagacaag tag 23
ND2 (SEQ ID No: 30)
gttcttttta agtcctgtgc atc 23
PCR products were gel isolated and the editing efficiency was
determined by poisoned primer extension assay using 32P ATP (NEN, Boston,
Massachusetts) end-labeled DD3 primer (SEQ ID No: 31) as follows:
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-46-
aatcatgtaa atcataacta tctttaatat actga 35
under high concentration of dideoxy GTP as described previously (Smith et al.
"In
vitro apolipoprotein B mRNA editing: Identification of a 27S editing complex,"
Proc.
Natl. Acad. Sci. USA 88:1489-1493 (1991); Sowden et al., "Overexpression of
APOBEC-1 results in mooring-sequence-dependent promiscuous RNA editing," J.
Biol. Chem. 271:3011-3017 (1996), each of which is hereby incorporated by
reference
in its entirety). Primer extension products were resolved on a 10% denaturing
polyacrylamide gel, autoradiographed, and then quantified by a laser
densitometric
scanning (Molecular Dynamics, Sunnyvale, California). Percent editing was
calculated
as the counts in the UAA (edited) band divided by the sum of the counts in UAA
and
those in the CAA (unedited) bands and multiplied by 100.
No change in the percent editing of apolipoprotein B mRNA relative to
untreated cells (see Figure 9) was observed with TAT-CMPK concentrations
ranging
from 45 to 1125 nM (5 to 133 ~g protein/ml of media) (Figure 8).
In contrast, editing activity increased in McArdle cells with 360 nM (62
~g protein/ml media) TAT-rAPOBEC-CMPK following 6 h and continued to a peak
by 24 h, a more than 3-fold increase over the level of editing observed in
control cells
(Figure 9). The proportion of edited RNA remained elevated up to 48 h after
treatment (Figure 9) and approached baseline by 72 h. It has been reported
that the
enzymatic activity lagged the appearance of the transduced protein inside the
cells,
probably due to a slow refolding of the transduced protein (Schwarze et al.,
"In vivo
protein transduction: delivery of a biologically active protein into the
mouse," Science
285:1569-1572 (1999), which is hereby incorporated by reference in its
entirety).
Taken together, the results demonstrated that TAT-rAPOBEC-CMPK transduced into
McArdle cells, refolded into an enzymatically active conformation over the
first 6 hr
and then edited apolipoprotein B mRNA. The reduction in the proportion of
edited
apolipoprotein B mRNA after 48 hr was likely due to enzyme inactivation and
apolipoprotein B mRNA turnover. This characteristic was important as it
demonstrated the transient and reversible nature of the protein transduction
system.
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-47-
Example 4 - In vitro Introduction of TAT-rAPOBEC-CMPK into Primary
Hepatocytes
To determine if the results obtained using McArdle cells would be
applicable in primary liver cells, cultured rat primary hepatocytes were
prepared and
then treated with TAT-rAPOBEC-CMPK. The rat primary hepatocytes were prepared
from unfasted, male Sprague-Dawley rats (250-275 g body weight, Taconic Farm)
fed
ad libitum normal rat chow as described previously (Van Mater et al., "Ethanol
increases apolipoprotein B mRNA editing in rat primary hepatocytes and McArdle
cells," Biochem. Biophys. Res. Comm. 252:334-339 (1998), which is hereby
incorporated by reference in its entirety). Recombinant TAT fusion protein was
added
directly to the cell culture media after dialysis.
It has been shown that the editing efficiency in primary rat hepatocytes
decreased as a result of proliferation after 72 hours in culture (Van Mater et
al.,
"Ethanol increases apolipoprotein B mRNA editing in rat primary hepatocytes
and
McArdle cells," Biochem. Biophys. Res. Comm. 252:334-339 (1998), which is
hereby
incorporated by reference in its entirety). Together with the fact that TAT-
rAPOBEC-
CMPK maximally increased editing 24 hours after treatment in McArdle cells, a
decision was made to evaluate dose response for a fixed time rather than study
kinetics. Primary hepatocytes were treated with the indicated amounts of TAT-
rAPOBEC-CMPK and analyzed for edited apolipoprotein B mRNA 24 hours
afterwards. Analysis of apolipoprotein B mRNA was carried out a described in
Example 3 above.
The editing activity of hepatocytes increased in proportion to the
amount of TAT-rAPOBEC-CMPK added to the cell culture media relative to cells
treated with buffer alone (Figure 10) or treated with TAT-CMPK (Figure 8).
Given
that the primary hepatocytes were seeded at the same cell number as McArdle
cells, a
comparison of the data in Figures 9 and 10 suggested that TAT-rAPOBEC-CMPK
was more effective in inducing editing activity in the primary cell culture.
This was true
for several preparations of recombinant protein and primary cells and,
therefore, the
difference may be due to the fact that the primary hepatocytes have a higher
baseline of
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
- 48 -
editing than McArdle cells (48% versus 7%) and/or may be "primed" with more
auxiliary factors.
Promiscuous editing of additional cytidines in rat apolipoprotein B
mRNA of transfected cells (Sowden et al., "Overexpression of APOBEC-1 results
in
mooring-sequence-dependent promiscuous RNA editing," J. Biol. Chem. 271:3011-
3017 (1996); Yamanaka et al., "Hyperediting of multiple cytidines of
apolipoprotein B
mRNA by APOBEC-1 requires auxiliary proteins) but not a mooring sequence
motif,"
J. Biol. Chem. 271:11506-11510 (1996); Sowden et al., "Apolipoprotein B RNA
Sequence 3' of the mooring sequence and cellular sources of auxiliary factors
determine the location and extent of promiscuous editing," Nucleic Acids Res.
26:1644-1652 (1998), each of which is hereby incorporated by reference in its
entirety)
or hyper-editing of other mRNAs in transgenic mice and rabbits (Yamanaka et
al.,
"Hyperediting of multiple cytidines of apolipoprotein B mRNA by APOBEC-1
requires auxiliary proteins) but not a mooring sequence motif," J. Biol. Chem.
271:11506-11510 (1996); Yamanaka et al., "A novel translational repressor mRNA
is
edited extensively in livers containing tumors caused by the transgene
expression of the
apoB mRNA editing enzyme," Genes & Dev. 11:321-333 (1997), each ofwhich is
hereby incorporated by reference in its entirety) has been observed in
response to very
high levels of APOBEC-1 expression. Editing of cytidines 5' of the wild type
editing
site (C6666) was a bellwether for the loss of editing site fidelity in rat
cells and could
be used to monitor the induction of promiscuous editing in relation to changes
in
APOBEC-1 expression (Sowden et al., "Apolipoprotein B RNA Sequence 3' of the
mooring sequence and cellular sources of auxiliary factors determine the
location and
extent of promiscuous editing," Nucleic Acids Res. 26:1644-1652 (1998);
Siddiqui et
al., "Disproportionate relationship between APOBEC-1 expression and apoB mRNA
editing activity," Exp. Cell Res. 252:154-164 ( 1999), each of which is hereby
incorporated by reference in its entirety). Promiscuous editing of cytidine 3'
C6666 in
apolipoprotein B mRNA did not occur to a significant extent in rat cells and
hyperediting of mRNAs other than apolipoprotein B was not a characteristic of
APOBEC-1 overexpression in rat cells (Sowden et al., "Apolipoprotein B RNA
Sequence 3' of the mooring sequence and cellular sources of auxiliary factors
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-49-
determine the location and extent of promiscuous editing," Nucleic Acids Res.
26:1644-1652 (1998), which is hereby incorporated by reference in its
entirety).
Despite the high level of editing activity in treated primary hepatocytes,
promiscuous editing (evident as additional primer extension products above UAA
(Sowden et al., "Determinants involved in regulating the proportion of edited
apolipoprotein B RNAs," RNA 2:274-288 (1996); Sowden et al., "Apolipoprotein B
RNA Sequence 3' of the mooring sequence and cellular sources of auxiliary
factors
determine the location and extent of promiscuous editing," Nucleic Acids Res.
26:1644-1652 (1998), each of which is hereby incorporated by reference in its
entirety)
was not observed (Figure 10). Given that our detection limit for promiscuous
editing
was 0.3% (Sowden et al., "Determinants involved in regulating the proportion
of
edited apolipoprotein B RNAs," RNA 2:274-288 (1996), which is hereby
incorporated
by reference in its entirety) the data suggested that TAT-rAPOBEC-CMPK could
be
used to substantially increase site-specific editing of apolipoprotein B mRNA
without
significant loss of fidelity of the reaction.
Example 5 - Analysis of Secreted Lipoprotein Products by Transduced
Primary Hepatocytes
To further confirm the eff cacy of this method, secreted apolipoprotein
B protein was evaluated in primary rat hepatocytes that were long-term
metabolically
labeled with [35S]-methionine and [35S]-cysteine after TAT-rAPOBEC-CMPK
treatment.
Twelve to eighteen hour rat primary hepatocytes grown in Waymouth's
752/1 media (Sigma, St. Louis, MO) were treated for 11 hours with TAT-rAPOBEC-
CMPK and then incubated for 1 hour in DMEM deficient medium (without
methionine, cysteine and L-glutamine) (Sigma, St. Louis, MO) containing 0.2%
(w/v)
BSA, 0.1 nM insulin, 100 p,g/ml streptomycin and 50 ~g/ml gentamicin. The
medium
was replaced with fresh labeling medium containing 0.7~Ci/ml L-[35S]-
Methionine and
L-[35S]-Cysteine using EXPRE35S3sS protein labeling mix (NEN, Boston,
Massachusetts). Cells were incubated in the labeling medium for 30 minutes.
One
volume of Waymouth's medium with cold cysteine and methionine was added to
cells
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-50-
and the labeling continued for an additional 12 hours, after which cell
culture medium
was collected for the isolation and analysis of secreted apolipoprotein B
protein and
RNAs. (RNA analysis was conducted as in Example 3 above.)
Immunoprecipitation of apolipoprotein B from cell culture medium was
performed as described previously (Sparks et al., "Insulin-mediated inhibition
of
apolipoprotein B secretion requires an intracellular trafficking event and
phosphatidylinositol 3-kinase activation: studies with brefeldin A and
wortmannin in
primary cultures of rat hepatocytes," Biochem. J. 313:567-574 (1996), which is
hereby incorporated by reference in its entirety). A rabbit polyclonal
antibody raised
against rat apolipoprotein B and reactive with the N-terminus of
apolipoprotein B 100
and apolipoprotein B48 (obtained from Drs. J.D. Sparks and C.E. Sparks,
University
of Rochester) was used to precipitate apolipoprotein B. The immunoprecipitants
were
separated by SDS-PAGE on 5% gel. The gel was dried and exposed to film to
reveal
the secreted apolipoprotein B containing lipoprotein profile which represents
the
secreted apolipoprotein B48 and apolipoprotein B 100 during the 12 hour
labeling
period.
The secreted [35S]-labeled apolipoprotein B lipoproteins were isolated
from the cell culture media exposed to cells for 12 hours followed by
immunoprecipitation, and analyzed by autoradiography after SDS-PAGE
separation.
The signal on the gel was in direct proportion to the number of cysteine and
methionine residues in apolipoprotein B100 and apolipoprotein B48. Since
apolipoprotein B48 was the N-terminal 48% of apolipoprotein B100, stronger
signal
was expected from apolipoprotein B100 in control cells. However, as the
editing
efficiency approached 90% due to TAT-rAPOBEC-CMPK treatment, an increasing
amount of apolipoprotein B48 was secreted, and apolipoprotein B100 became
almost
undetectable (Figure 11). Thus, lowering apolipoprotein B100 associated
atherogenic
risk factors through precisely controlled hepatic apolipoprotein B mRNA
editing was
achievable by protein transduction with TAT-rAPOBEC-CMPK.
Discussion of Examples 1-5
It is believed that the present invention offers a novel approach to
curtail hepatic output of apolipoprotein B 100 associated atherogenic factors
through
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-51-
up-regulating apolipoprotein B mRNA editing by using protein transduction into
target
(e.g., liver) cells. The PTD, amino acid residues 49-57, of HIV-1 TAT protein
has
been used in other systems to deliver functional full-length protein molecules
into cells
(Nagahara et al., "Transduction of full-length TAT fusion proteins into
mammalian
cells: TAT-p27K'Pl induces cell migration," Nature Med. 4:1449-1452 (1998);
Schwarze et al., "In vivo protein transduction: delivery of a biologically
active protein
into the mouse," Science 285:1569-1572 (1999); Vocero-Akbani et al., "Killing
HIV-
infected cells by transduction with an HIV protease-activated caspase-3
protein,"
Nature Med. 5:29-33 (1999), each of which is hereby incorporated by reference
in its
entirety). Some of these fusion molecules, when introduced into mice, entered
all
tissue cells, even crossing the blood brain barrier (Schwarze et al., "In vivo
protein
transduction: delivery of a biologically active protein into the mouse,"
Science
285:1569-1572 (1999), which is hereby incorporated by reference in its
entirety).
Although the detailed mechanism for the cellular uptake of the fusions remains
unknown, denaturing of the protein during membrane transduction is thought to
be a
rapid process and the rate limiting event is the renaturing of the transduced
protein
once inside of cells (Schwarze et al., "Protein transduction: unrestricted
delivery into
all cells," Trends Cell Biol. 10:290-295 (2000), which is hereby incorporated
by
reference in its entirety).
In this regard, the protein transduction method may have limitations in
that some proteins may not be able successfully to adopt an active
conformation after
they have been unfolded. It is significant, therefore, that the above Examples
demonstrate that both TAT-CMPK (expression product of SEQ ID No: 28) and TAT-
rAPOBEC-CMPK (SEQ ID No: 4) had the capacity to enter hepatocytes and that
TAT-rAPOBEC-CMPK activated editing within 6 hours of its addition to the
media.
Similar kinetics have been observed with TAT-rAPOBEC-CMPK prepared under
native conditions.
Importantly, TAT-CMPK could not stimulate editing activity,
demonstrating that the observed changes in editing were specific to APOBEC-1
containing recombinant proteins. Considering the tendency for APOBEC-1
containing
proteins to aggregate, part of the lag in entering cells could have been due
to the
inability of these multimeric complexes to cross the plasma membrane and the
time it
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-52-
took for TAT-rAPOBEC-CMPK monomers to dissociate fi~om the aggregates and
cross the membrane. This is supported by the finding that TAT-CMPK, which did
not
appear to form large aggregates, appeared to accumulate within the cells with
more
rapid kinetics than that observed for TAT-rAPOBEC-CMPK. The six hour lag
before
an increase in editing activity could be measured may have also been due to
the time
required for the transduced protein to refold and assemble editosomes.
Apolipoprotein B mRNA editing occurs in the cell nucleus despite the
fact that editing factors can also be demonstrated in the cytoplasm (Yang et
al.,
"Induction of cytidine to uridine editing on cytoplasmic apolipoprotein B mRNA
by
overexpressing APOBEC-1," J. Biol. Chem. 275:22663-22669 (2000), which is
hereby
incorporated by reference in its entirety). The mechanism responsible for
APOBEC-
1's distribution in the nucleus is not understood (Yang et al., "Intracellular
Trafficking
Determinants in APOBEC-1, the Catalytic Subunit for Cytidine to Uridine
Editing of
ApoB mRNA," Exp. Cell Res. 267:163-184 (2001), which is hereby incorporated by
reference in its entirety), however its mass appeared to be important as the
chimeric
protein APOBEC-CMPK was excluded from the nucleus (Yang et al., "Multiple
protein domains determine the cell type-specific nuclear distribution of the
catalytic
subunit required for apo B mRNA editing," Proc. Natl. Acad. Sci. USA 94:13075-
13080 (1997); Yang et al., "Induction of cytidine to uridine editing on
cytoplasmic
apolipoprotein B mRNA by overexpressing APOBEC-1," J. Biol. Chem. 275:22663-
22669 (2000), each of which is hereby incorporated by reference in its
entirety). TAT-
rAPOBEC-CMPK's ability to distribute in both the cytoplasm and the nucleus was
consistent with the proposed ability of the TAT PTD to act also as a nuclear
localization signal (Schwarze et al., "In vivo protein transduction: delivery
of a
biologically active protein into the mouse," Science 285:1569-1572 (1999),
which is
hereby incorporated by reference in its entirety). Although TAT-rAPOBEC-CMPK's
distribution mimicked that of the wild type enzyme's distribution (Yang et
al.,
"Multiple protein domains determine the cell type-specific nuclear
distribution of the
catalytic subunit required for apo B mRNA editing," Proc. Natl. Acad. Sci. USA
94:13075-13080 (1997), which is hereby incorporated by reference in its
entirety),
uncertainty remains as to whether all of the transduced TAT-rAPOBEC-CMPK
molecules were active in editing, as well as whether cytoplasmic or nuclear
transcripts
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-53-
were edited. Nonetheless, regardless of the degree of activity or its
localization within
the cell, a positive reduction in apolipoprotein B 100 lipoprotein was
demonstrated.
Enhancement of editing activity by overexpression of APOBEC-1
through gene transfer has been shown to be associated with promiscuous editing
on
both nuclear and cytoplasmic transcripts (Sowden et al., "Overexpression of
APOBEC-1 results in mooring-sequence-dependent promiscuous RNA editing," J.
Biol. Chem. 271:3011-3017 (1996); Yang et al., "Induction of cytidine to
uridine
editing on cytoplasmic apolipoprotein B mRNA by overexpressing APOBEC-1," J.
Biol. Chem. 275:22663-22669 (2000), each of which is hereby incorporated by
reference in its entirety). Metabolic stimulation of apolipoprotein B mRNA
editing
always retained fidelity (Wu et al., "ApoB mRNA editing: validation of a
sensitive
assay and developmental biology of RNA editing in the rat," J. Biol. Chem.
265:12312-12316 (1990); Greeve et al., "Apolipoprotein B mRNA editing in 12
different mammalian species: hepatic expression is reflected in low
concentrations of
apoB-containing plasma lipoproteins," J. Lipid Res. 34:1367-1383 (1993); Phung
et
al., "Regulation of hepatic apoB RNA editing in the genetically obese Zucker
rat,"
Metabolism 45:1056-1058 (1996); von Wronski et al., "Insulin increases
expression of
apobec-l, the catalytic subunit of the apoB B mRNA editing complex in rat
hepatocytes," Metabolism Clinical & Exp. 7:869-873 (1998), each of which is
hereby
incorporated by reference in its entirety). It is highly significant,
therefore, that the
fidelity of the editing activity was retained with TAT-rAPOBEC-CMPK even when
editing was enhanced to >90%. This level of high fidelity editing could not be
achieved without hyper-editing in apobec-1 transgenic animals (Yamanaka et
al.,
"Hyperediting of multiple cytidines of apolipoprotein B mRNA by APOBEC-1
requires auxiliary proteins) but not a mooring sequence motif," J. Biol. Chem.
271:11506-11510 (1996); Yamanaka et al., "A novel translational repressor mRNA
is
edited extensively in livers containing tumors caused by the transgene
expression of the
apoB mRNA editing enzyme," Genes & Dev. 11:321-333 (1997); Sowden et al.,
"Overexpression of APOBEC-1 results in mooring-sequence-dependent promiscuous
RNA editing," J. Biol. Chem. 271:3011-3017 (1996); Sowden et al.,
"Apolipoprotein
B RNA Sequence 3' of the mooring sequence and cellular sources of auxiliary
factors
determine the location and extent of promiscuous editing," Nucleic Acids Res.
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-54-
26:1644-1652 (1998); each of which is hereby incorporated by reference in its
entirety). There was no pathology in transgenic animals in which induction of
hepatic
apolipoprotein B mRNA editing was achieved at a low level of apobec-1
expression
and these animals had a markedly lower serum apolipoprotein B 100 and
significantly
reduced serum LDL compared to controls (Teng et al., "Adenovirus-mediated gene
transfer of rat apolipoprotein B mRNA editing protein in mice virtually
eliminates
apolipoprotein B-100 and normal low density lipoprotein production," J. Biol.
Chem.
269:29395-29404 (1994); Hughs et al., "Gene transfer of cytidine deaminase
APOBEC-1 lowers lipoprotein(a) in transgenic mice and induces apolipoprotein B
mRNA editing in rabbits," Hum. Gene Ther. 7:39-49 (1996); Kozarsky et al.,
"Hepatic
expression of the catalytic subunit of the apolipoprotein B mRNA editing
enzyme
ameliorates hypercholesterolemia in LDL receptor-deficient rabbits," Hum. Gene
Ther.
7:943-957 ( 1996); Farese et al., "Phenotypic analysis of mice expressing
exclusively
apolipoprotein B48 or apolipoprotein B100," Proc. Natl. Acad. Sci. USA 93:6393-
6398 ( 1996); Qian et al., "Low expression of the apolipoprotein B mRNA
editing
transgene in mice reduces LDL but does not cause liver dysplasia or tumors,"
Anteriosc. Thromb. Vasc. Biol. 18:1013-1020 (1998); Wu et al., "Normal
perinatal rise
in serum cholesterol is inhibited by hepatic delivery of adenoviral vector
expressing
apolipoprotein B mRNA editing enzyme in rabbits," J. Sur._ .g Res. 85:148-157
(1999),
each of which is hereby incorporated by reference in its entirety).
Interestingly,
apobec-1 gene transfer into apobec-1 gene knockout mice restored editing and
reduced serum LDL levels (Nakamuta et al., "Complete phenotypic
characterization of
the apobec-1 knockout mice with a wild-type genetic background and a human
apolipoprotein B transgenic background, and restoration of apolipoprotein B
mRNA
editing by somatic gene transfer of Apobec-1," J. Biol. Chem. 271:25981-25988
( 1996), which is hereby incorporated by reference in its entirety),
demonstrating that
APOBEC-1 has therapeutic potential in livers with no prior editing activity.
The
induction of hepatic editing of apolipoprotein B mRNA in apobec-1 transgenic
rabbits
with an LDL receptor deficiency also ameliorated hypercholesterolemia
(Kozarsky et
al., "Hepatic expression of the catalytic subunit of the apolipoprotein B mRNA
editing
enzyme ameliorates hypercholesterolemia in LDL receptor-deficient rabbits,"
Hum.
Gene Ther. 7:943-957 ( 1996), which is hereby incorporated by reference in its
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-55-
entirety). Taken together,.these studies suggested that apolipoprotein B mRNA
editing could be safely targeted as a mechanism for reducing serum LDL and the
risk
of atherogenic diseases.
However, controlling a low level of apobec-1 expression using gene
therapy is difFcult and, quite often, unpredictable. For all of these reasons,
despite the
limited success of gene therapy approaches, gene therapy using apobec-1 does
not
appear to be a promising avenue which can be pursued for preventative or
therapeutic
control over atherogenic disease factors. The advantage of protein
transduction
therapy is that the dose can be modulated relative to the desired response and
that the
effect on editing can be terminated by withdrawing therapy.
The PTD should allow protein to enter all cells of the body, even if the
protein is delivery intravenously (Schwarze et al., "In vivo protein
transduction:
delivery of a biologically active protein into the mouse," Science 285:1569-
1572
(1999), which is hereby incorporated by reference in its entirety). Ideally
the liver
should be specifically targeted with TAT-rAPOBEC-CMPK and an intraperitoneal
injection can be utilized to accomplish a first pass clearance, transducing
most of the
protein into hepatocytes. Even though APOBEC-1 is not widely expressed in
tissues
(Teng et al., "Molecular cloning of an apo B messenger RNA editing protein,"
Science
260:18116-1819 (1993), which is hereby incorporated by reference in its
entirety), its
generalized expression in transgenic animals did not induce pathology (Teng et
al.,
"Adenovirus-mediated gene transfer of rat apolipoprotein B mRNA editing
protein in
mice virtually eliminates apolipoprotein B-100 and normal low density
lipoprotein
production," J. Biol. Chem. 269:29395-29404 (1994); Hughs et al., "Gene
transfer of
cytidine deaminase APOBEC-1 lowers lipoprotein(a) in transgenic mice and
induces
apolipoprotein B mRNA editing in rabbits," Hum. Gene Ther. 7:39-49 ( 1996);
Kozarsky et al., "Hepatic expression of the catalytic subunit of the
apolipoprotein B
mRNA editing enzyme ameliorates hypercholesterolemia in LDL receptor-deficient
rabbits," Hum. Gene Ther. 7:943-957 ( 1996); Farese et al., "Phenotypic
analysis of
mice expressing exclusively apolipoprotein B48 or apolipoprotein B100," Proc.
Natl.
Acad. Sci. USA 93:6393-6398 (1996); Qian et al., "Low expression of the
apolipoprotein B mRNA editing transgene in mice reduces LDL but does not cause
liver dysplasia or tumors," Arteriosc. Thromb. Vasc. Biol. 18:1013-1020
(1998); Wu
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-56-
et al., "l~lormal perinatal rise in serum cholesterol is inhibited by hepatic
delivery of
adenoviral vector expressing apolipoprotein B mRNA editing enzyme in rabbits,"
J.
SurQ. Res. 85:148-157 ( 1999), each of which is hereby incorporated by
reference in its
entirety).
Uptake of TAT-rAPOBEC-CMPK or TAT-hAPOBEC-CMPK is
unlikely to induce any side effects. Aside from one study suggesting that
overexpression of APOBEC-1 in liver can lead to editing of mRNAs other than
apolipoprotein B (Yamanaka et al., "A novel translational repressor mRNA is
edited
extensively in livers containing tumors caused by the transgene expression of
the apoB
mRNA editing enzyme," Genes & Dev. 11:321-333 (1997), which is hereby
incorporated by reference in its entirety) no other mRNA substrates for APOBEC-
1
have been found (Skuse et al., "Neurofibromatosis type I mRNA undergoes base-
modification RNA editing," Nucleic Acids Res. 24:478-486 (1996); Sowden et
al.,
"Apolipoprotein B RNA Sequence 3' of the mooring sequence and cellular sources
of
auxiliary factors determine the location and extent of promiscuous editing,"
Nucleic
Acids Res. 26:1644-1652 (1998), each of which is hereby incorporated by
reference in
its entirety). Furthermore, apobec-1 gene knock out studies have shown that
there
were no other editing enzymes capable of editing apolipoprotein B mRNA and
that
APOBEC-1 was not required for life (Hirano et al., "Targeted disruption of the
mouse
apobec-1 gene abolishes apolipoprotein B mRNA editing and eliminates
apolipoprotein
B48," J. Biol. Chem. 271:9887-9890 ( 1996); Nakamuta et al., "Complete
phenotypic
characterization of the apobec-1 knockout mice with a wild-type genetic
background
and a human apolipoprotein B transgenic background, and restoration of
apolipoprotein B mRNA editing by somatic gene transfer of Apobec-l," J. Biol.
Chem.
271:25981-25988 ( 1996), each of which is hereby incorporated by reference in
its
entirety). Taken together the data suggest that mRNA editing by APOBEC is self
limited due to its specificity for apolipoprotein B mRNA and, therefore,
neither TAT-
rAPOBEC-CMPK nor TAT-hAPOBEC-CMPK is likely to have effects in tissues other
than those which express apolipoprotein B mRNA and auxiliary proteins.
Current cholesterol-lowering therapies target circulating cholesterol at
the level of enhanced elimination or reduced production. A sector of the
population
remains at risk for atherosclerosis due to side effects from current therapies
in some of
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
-57-
these patients and the inability of others with defects in apolipoprotein B
and/or the
LDL receptor mediated uptake pathway to completely benefit from conventional
cholesterol lowering therapies. Hypercholesterolemia is an early onset disease
yet the
restricted usage of conventional therapies among children due to the potential
of
interfering with pubertal development has not been resolved. Protein based
therapies
such as insulin or growth hormone have been extensively used among children to
treat
Type I diabetes or pituitary dwarfism, respectively. To the patient or the
parent of the
patient, the reversible nature of protein based therapy may be more appealing
than
gene therapy. To this end, the above results illustrate an alternative to
conventional or
gene therapy approaches for reducing the risk of atherosclerosis in the
sectors of
population at risk.
Although preferred embodiments have been depicted and described in
detail herein, it will be apparent to those skilled in the relevant art that
various
modifications, additions, substitutions, and the like can be made without
departing
from the spirit of the invention and these are therefore considered to be
within the
scope of the invention as defined in the claims which follow.
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
SEQUENCE LISTING
<110>. University of Rochester.
Smith, Harold C..
Yang, Yan .
Sowden, Mark P..
<120>. METHODS AND. COMPOSITIONS. FOR MODIFYING APOLIPOPROTEIN B
mRNA EDITING
<130> 176/60682
<140>.
<141>
<150> 60/271,856
<151> 2001-02-27
<160> 31.
<170> PatentIn Ver. 2.1
<210> 1 . .
<211> 2406
<212> DNA
<213> Artificial Sequence .
<220>
<223> Description of Artificial. Sequence: ..
TAT-hAPOBEC-CMPK
<400> 1. .
atggctagca tgactggtgg. acagcaaatg. ggtcgggatc cgggatatgg aagaaaaaaa. 60
agaagacaaa gaagaagagg. ctctagatac. ccctacgacg tgcccgacta cgccgatatc 120
acttctgaga aaggtccttc aaccggtgac cccactctga ggagaagaat cgaaccctgg. 180
gagtttgacg tcttctatga ccccagagaa. cttcgtaaag aggcctgtct gctctacgaa. 240.
atcaagtggg. gcatgagccg gaagatctgg. cgaagctcag gcaaaaacac caccaatcac 300.
gtggaagtta attttataaa aaaatttacg. tcagaaagag attttcaccc atccatcagc. 360
tgctccatca cctggttctt. gtcctggagt. ccctgctggg aatgctccca ggctattaga 420
..........
gagtttctga gtcggcaccc. tggtgtgact ctagtgatct. acgtagctcg gcttttttgg 480
..........
cacatggatc aacaaaatcg gcaaggtctc agggaccttg. ttaacagtgg. agtaactatt. 540 .
cagattatga gagcatcaga gtattatcac tgctggagga attttgtcaa ctacccacct 600 .
ggggatgaag ctcactggcc. acaataccca. cctctgtgga tgatgttgta cgcactggag 660 .
ctgcactgca taattctaag tcttccaccc tgtttaaaga tttcaagaag atggcaaaat. 720 ......
catcttacat ttttcagact tcatcttcaa aactgccatt accaaacgat tccgccacac 780....
atccttttag ctacagggct gatacatcct. tctgtggctt ggagagaatt ccacgctgcc 840
atggcagaca cctttctgga. gcacatgtgc cgcctggaca tcgactccga gccaaccatt. 900...
gccagaaaca ccggcatcat ctgcaccatc ggcccagcct cccgctctgt ggacaagctg 960..
1
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
aaggaaatga ttaaatctgg aatgaatgtt gcccgcctca. acttctcgca cggcacccac 1020
gagtatcatg agggcacaat taagaacgtg cgagaggcca cagagagctt tgcctctgac 1080
ccgatcacct acagacctgt ggctattgca ctggacacca agggacctga aatccgaact 1140
ggactcatca agggaagtgg cacagcagag. gtggagctca agaagggcgc agctctcaaa 1200
gtgacgctgg acaatgcctt catggagaac tgcgatgaga atgtgctgtg ggtggactac 1260
aagaacctca tcaaagttat agatgtgggc. agcaaaatct atgtggatga cggtctcatt 1320
tccttgctgg ttaaggagaa aggcaaggac tttgtcatga ctgaggttga gaacggtggc 1380
atgcttggta gtaagaaggg. agtgaacctc. ccaggtgctg. cggtcgacct gcctgcagtc 1440
tcagagaagg acattcagga cctgaaattt ggcgtggagc agaatgtgga catggtgttc 1500
gcttccttca tccgcaaagc tgctgatgtc catgctgtca ggaaggtgct aggggaaaag 1560
ggaaagcaca. tcaagattat cagcaagatt gagaatcacg agggtgtgcg caggtttgat 1620
gagatcatgg aggccagcga tggcattatg. gtggcccgtg gtgacctggg tattgagatc 1680
cctgctgaaa aagtcttcct cgcacagaag. atgatgattg ggcgctgcaa cagggctggc 1740
aaacccatca. tttgtgccac tcagatgttg gaaagcatga tcaagaaacc tcgcccgacc 1800
cgcgctgagg. gcagtgatgt tgccaatgca gttctggatg gagcagactg. catcatgctg 1860
tctggggaga. ccgccaaggg agactaccca. ctggaggctg tgcgcatgca gcacgctatt 1920
gctcgtgagg. ctgaggccgc aatgttccat. cgtcagcagt ttgaagaaat cttacgccac 1980
agtgtacacc. acagggagcc tgctgatgcc atggcagcag gcgcggtgga ggcctccttt 2040
aagtgcttag cagcagctct gatagttatg accgagtctg. gcaggtctgc acacctggtg. 2100.
tcccggtacc gcccgcgggc tcccatcatc gccgtcaccc. gcaatgacca aacagcacgc 2160..
caggcacacc tgtaccgcgg cgtcttcccc. gtgctgtgca agcagccggc ccacgatgcc 2220 .
tgggcagagg atgtggatct ccgtgtgaac ctgggcatga atgtcggcaa agcccgtgga 2280......
ttcttcaaga ccggggacct ggtgatcgtg. ctgacgggct. ggcgccccgg ctccggctac 2340
accaacacca tgcgggtggt. gcccgtgcca gcggccgcac. tcgagcacca ccaccaccac
2400.......
cactga 2406 .
<210> 2
<211> 801
<212>. PRT
<213>. Artificial. Sequence .
<220>. . .
<223>. Description of Artificial. Sequence:.
TAT-hAPOBEC-CMPK ....
<400>. 2.
Met Ala Ser Met Thr Gly Gly Gln Gln Met Gly Arg Asp Pro Gly Tyr
1. 5 . 10. . . . . . . . . . . . . 15 .
Gly. Arg Lys. Lys Arg Arg. Gln Arg Arg Arg Gly. Ser Arg. Tyr Pro Tyr
20. . 25. 30
Asp Val. Pro. Asp Tyr Ala Asp Ile Thr Ser Glu Lys. Gly Pro Ser Thr
35 40 45
Gly Asp Pro. Thr. Leu Arg Arg Arg. Ile Glu Pro Trp Glu Phe Asp Val....
50 55 60. . .
2. .
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
Phe. Tyr Asp Pro Arg Glu Leu Arg Lys Glu Ala. Cys Leu Leu Tyr Glu
65...... 70 75 80
Ile LysTrp Gly SerArgLys IleTrpArg.Ser SerGly.Lys.Asn .
Met
85 90 95.
Thr ThrAsn HisVal GluValAsn PheIleLysLys PheThr SerGlu
100 105 110
Arg AspPhe His.Pro SerIleSer Cys.Ser.IleThr.TrpPhe LeuSer......
115 120 125
Trp SerPro Cys.Trp GluCysSer.GlnAla.IleArg GluPhe LeuSer...
130. 135 140
Arg HisPro.GlyVal ThrLeuVal.IleTyrValAla ArgLeu PheTrp..
145 150. 155 160.
His Met Asp Gln Gln Asn Arg Gln Gly Leu Arg. Asp Leu Val Asn Ser....
165 170 ..... 175
Gly. Val. Thr Ile Gln Ile. Met Arg Ala Ser Glu Tyr. Tyr. His. Cys Trp
180 185 190.
Arg Asn Phe Val Asn Tyr. Pro Pro Gly. Asp Glu Ala His Trp. Pro. Gln ..
195 200 205
Tyr Pro. Pro Leu Trp Met Met Leu Tyr. Ala Leu Glu Leu His. Cys. Ile
210. ~ 215. 220
Ile Leu Ser Leu Pro Pro. Cys. Leu Lys Ile Ser Arg Arg Trp. Gln Asn
225 230 235. 240. .
His Leu Thr Phe Phe Arg Leu His. Leu Gln Asn Cys. His. Tyr. Gln Thr
245 250 . . . . 255. .
Ile. Pro Pro His Ile Leu Leu Ala Thr. Gly Leu Ile His Pro Ser. Val.
260... 265 270
Ala Trp. Arg Glu Phe His Ala Ala Met Ala Asp Thr Phe. Leu Glu His
275. 280. 285. . . . .
Met Cys Arg Leu Asp. Ile Asp Ser Glu Pro. Thr Ile Ala Arg Asn Thr.
. . 290. 295 300. .
Gly Ile Ile Cys. Thr Ile Gly Pro. Ala Ser. Arg. Ser. Val Asp Lys Leu
305 310 315 320...
3
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
Lys Glu Met Ile Lys Ser Gly Met Asn Val Ala Arg. Leu Asn Phe. Ser
325 330 335 ......
His Gly Thr His. Glu Tyr His Glu Gly. Thr Ile Lys Asn Val Arg Glu
340.. 345 350
Ala Thr Glu Ser. Phe Ala Ser. Asp. Pro Ile Thr Tyr Arg Pro Val Ala
355 360. . . . . 365.
Ile Ala Leu Asp. Thr Lys Gly Pro. Glu Ile Arg. Thr Gly. Leu Ile Lys .
370. 375 380. .
Gly Ser Gly Thr. Ala Glu Val. Glu Leu Lys Lys Gly. Ala Ala Leu Lys .
385 390 395 400
Val Thr Leu Asp Asn Ala Phe Met Glu Asn Cys. Asp Glu Asn Val Leu ...
405 . 410 415
Trp. Val. Asp Tyr. Lys Asn Leu Ile Lys. Val Ile Asp Val. Gly. Ser. Lys
420 425. 430. .
Ile Tyr Val Asp Asp Gly. Leu Ile Ser Leu Leu Val Lys Glu Lys. Gly
435 440 445
Lys Asp Phe Val. Met Thr Glu Val. Glu Asn Gly Gly Met Leu Gly. Ser
450 455. 460
Lys Lys Gly. Val. Asn Leu. Pro Gly Ala Rla Val Asp Leu Pro Ala Val..
465 470 475 480...
Ser Glu Lys Asp. Ile Gln Asp. Leu Lys Phe. Gly. Val. Glu Gln Asn Val.
485 490 495.
Asp. Met Val. Phe Ala Ser Phe Ile. Arg Lys Ala Ala Asp Val His. Ala
500 505 510
Val. Arg Lys Val. Leu Gly Glu Lys. Gly Lys His Ile Lys. Ile Ile Ser
515 520 525.....
Lys. Ile. Glu Asn His. Glu Gly Val Arg Arg. Phe.Asp. Glu Ile Met Glu
530... 535 540
Ala Ser. Asp Gly Ile. Met Val Ala Arg. Gly. Asp. Leu Gly Ile Glu Ile
545 550 555. . . . 560 .
Pro Ala. Glu Lys Val Phe Leu Ala Gln Lys. Met Met Ile Gly. Arg. Cys
565. . 570. 575
4
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
Asn Arg Ala Gly Lys. Pro Ile Ile Cys Ala Thr Gln Met Leu Glu Ser.
580 585 . 590
Met Ile Lys Lys Pro Arg. Pro Thr Arg Ala Glu Gly Ser Asp Val Ala
595 600 605
Asn Ala Val Leu Asp Gly. Ala Asp Cys Ile Met Leu Ser Gly Glu Thr
610 615. 620
Ala Lys Gly. Asp Tyr. Pro. Leu Glu Ala Val Arg Met Gln His Ala Ile
625. . 630 . . . . . 635. . . 640
Ala. Arg Glu Ala. Glu Ala Ala Met Phe His Arg Gln Gln Phe Glu Glu
645 650 655
Ile Leu Arg. His Ser Val His His Arg. Glu Pro Ala Asp. Ala Met Ala
660 665. . . . . . 670. .
Ala Gly Ala Val. Glu Ala Ser Phe Lys Cys Leu. Ala Ala Ala Leu Ile
675 680 685
Val. Met Thr Glu Ser. Gly Arg Ser. Ala His Leu Val Ser Arg Tyr. Arg ...
690. 695 700. . .
Pro Arg Ala Pro. Ile Ile. Ala Val Thr. Arg. Asn Asp Gln Thr. Ala Arg
705 710... 715 720 ........
Gln Ala His. Leu Tyr. Arg. Gly Val Phe. Pro. Val Leu Cys. Lys Gln Pro.
725. . . . . . 730 735 .
Ala His. Asp Ala Trp. Ala Glu Asp Val. Asp Leu Arg Val. Asn Leu Gly ...
790 745....... 750
Met Asn Val. Gly Lys. Ala Arg Gly Phe. Phe Lys Thr Gly Asp Leu Val ,......
755 760. 765 . . . . .
Ile Val Leu Thr Gly. Trp Arg. Pro Gly. Ser Gly Tyr Thr Asn Thr Met
770 775 780..
Arg Val. Val Pro Val Pro Ala Ala Ala Leu Glu His. His His His His..
785 790 795 . . . 800. .
Hi s.
<210>. 3
.
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
<211> 2385
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:
TAT-rAPOBEC-CMPK
<400> 3
atggctagca tgactggtgg acagcaaatg ggtcgggatc cgggatatgg aagaaaaaaa 60 .
agaagacaaa gaagaagagg ctctagatac. ccctacgacg. tgcccgacta cgccgatatc 120
agttccgaga caggccctgt agctgttgat. cccactctga ggagaagaat tgagccccac. 180.
gagtttgaag tcttctttga cccccgggaa. cttcggaaag agacctgtct gctgtatgag. 240 .
atcaactggg gaggaaggca cagcatctgg. cgacacacga gccaaaacac caacaaacac 300
gttgaagtca atttcataga aaaatttact. acagaaagat. acttttgtcc aaacaccaga 360
tgctccatta cctggttcct gtcctggagt ccctgtgggg. agtgctccag ggccattaca 420
gaatttttga. gccgataccc ccatgtaact ctgtttattt. atatagcacg gctttatcac. 480
cacgcagatc ctcgaaatcg gcaaggactc agggacctta. ttagcagcgg tgttactatc 540
cagatcatga cggagcaaga gtctggctac tgctggagga attttgtcaa. ctactcccct 600...
tcgaatgaag ctcattggcc aaggtacccc. catctgtggg tgaggctgta cgtactggaa 660..
ctctactgca tcattttagg acttccaccc. tgtttaaata ttttaagaag aaaacaacct 720
caactcacgt ttttcacgat tgctcttcaa agctgccatt accaaaggct accaccccac 780 .......
atcctgtggg ccacagggtt gaaagaattc cacgctgcca tggcagacac ctttctggag 840.
cacatgtgcc gcctggacat cgactccgag ccaaccattg ccagaaacac cggcatcatc 900
tgcaccatcg gcccagcctc ccgctctgtg gacaagctga aggaaatgat taaatctgga 960
atgaatgttg. cccgcctcaa cttctcgcac ggcacccacg. agtatcatga gggcacaatt 1020
aagaacgtgc gagaggccac agagagcttt gcctctgacc cgatcaccta cagacctgtg. 1080
gctattgcac tggacaccaa gggacctgaa atccgaactg. gactcatcaa gggaagtggc. 1140.
acagcagagg tggagctcaa gaagggcgca gctctcaaag. tgacgctgga caatgccttc 1200
atggagaact gcgatgagaa tgtgctgtgg gtggactaca agaacctcat caaagttata 1260
gatgtgggca gcaaaatcta tgtggatgac. ggtctcattt ccttgctggt taaggagaaa 1320
ggcaaggact ttgtcatgac tgaggttgag aacggtggca tgcttggtag. taagaaggga 1380
gtgaacctcc. caggtgctgc ggtcgacctg cctgcagtct. cagagaagga cattcaggac 1440
ctgaaatttg gcgtggagca gaatgtggac atggtgttcg. cttccttcat ccgcaaagct 1500
gctgatgtcc atgctgtcag gaaggtgcta ggggaaaagg. gaaagcacat caagattatc. 1560
agcaagattg agaatcacga gggtgtgcgc. aggtttgatg. agatcatgga ggccagcgat 1620
ggcattatgg tggcccgtgg tgacctgggt attgagatcc ctgctgaaaa agtcttcctc 1680
gcacagaaga tgatgattgg gcgctgcaac agggctggca aacccatcat ttgtgccact. 1740
cagatgttgg aaagcatgat.caagaaacct. cgcccgaccc gcgctgaggg. cagtgatgtt 1800.
gccaatgcag ttctggatgg agcagactgc atcatgctgt ctggggagac. cgccaaggga 1860......
gactacccac tggaggctgt gcgcatgcag cacgctattg ctcgtgaggc tgaggccgca 1920
atgttccatc gtcagcagtt tgaagaaatc ttacgccaca gtgtacacca cagggagcct 1980 ..
gctgatgcca tggcagcagg cgcggtggag gcctccttta agtgcttagc agcagctctg 2040 ....
atagttatga ccgagtctgg caggtctgca cacctggtgt cccggtaccg. cccgcgggct 2100
cccatcatcg ccgtcacccg caatgaccaa acagcacgcc aggcacacct. gtaccgcggc 2160.
gtcttccccg tgctgtgcaa gcagccggcc cacgatgcct. gggcagagga tgtggatctc 2220 ....
..
cgtgtgaacc tgggcatgaa tgtcggcaaa gcccgtggat tcttcaagac cggggacctg 2280...
gtgatcgtgc tgacgggctg gcgccccggc tccggctaca ccaacaccat gcgggtggtg 2340 ....
6.
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
cccgtgccag cggccgcact cgagcaccac caccaccacc actga 2385
<210> 4
<211> 794
<212>. PRT
<213> Artificial Sequence
<220>
<223>. Description of Artificial Sequence: .
TAT-rAPOBEC-CMPK
<400> 4.
Met. Ala Ser. Met Thr Gly Gly Gln Gln Met Gly Arg Asp Pro Gly Tyr .
1 5 ~ . 10 15
Gly. Arg Lys Lys Arg Arg Gln Arg Arg Arg Gly Ser. Arg. Tyr Pro Tyr ....
20 25 30
Asp Val Pro Asp Tyr. Ala Asp Ile Ser Ser Glu Thr Gly Pro Val Ala
35 40 . 45
Val Asp. Pro. Thr Leu Arg Arg Arg Ile Glu Pro. His. Glu Phe Glu Val
0. . . 5 5. 6 0.
Phe Phe Asp Pro Arg Glu Leu Arg Lys. Glu Thr Cys. Leu Leu Tyr Glu ....
65 . 70. 75 80. .
Ile Asn Trp. Gly Gly. Arg His Ser Ile.Trp Arg His. Thr. Ser Gln Asn ..
85...... 90 95
Thr Asn Lys His Val. Glu Val Asn Phe Ile Glu Lys. Phe Thr Thr Glu
100 105.... 110
Arg Tyr Phe Cys Pro Asn Thr Arg Cys.Ser Ile Thr. Trp. Phe Leu Ser..
115 120 125.
Trp. Ser Pro Cys Gly Glu Cys Ser Arg. Ala Ile Thr. Glu Phe Leu Ser
130 135. . . 140. .
Arg Tyr Pro His Val. Thr Leu Phe Ile Tyr Ile. Ala. Arg Leu Tyr. His .
145 . . . . 150 155 160 .
His Ala Asp Pro. Arg. Asn Arg Gln Gly. Leu Arg Asp. Leu Ile. Ser. Ser .
165. . 170. 175 .
Gly Val Thr Ile Gln Ile Met.Thr Glu Gln Glu Ser. Gly.Tyr Cys.Trp
180 185. . . . . 190 .
7
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
Arg Asn Phe Val Asn Tyr Ser Pro Ser Asn Glu Ala His Trp Pro. Arg....
195 . 200 205.
Tyr Pro His Leu Trp Val Arg Leu Tyr Val Leu Glu Leu Tyr. Cys Ile
210.. 215 220
Ile Leu Gly Leu Pro Pro Cys Leu Asn Ile Leu Arg Arg Lys. Gln Pro
225 230.. 235 240
Gln Leu Thr Phe Phe Thr. Ile Ala Leu Gln Ser Cys. His Tyr Gln Arg ....
245 250 255..
Leu Pro. Pro. His.Ile Leu Trp Ala Thr. Gly Leu Lys Glu Phe. His Ala ..
260. ~ 265 270.
Ala Met. Ala Asp.Thr Phe. Leu Glu His Met Cys Arg Leu Asp. Ile Asp ..
275. 280 285
Ser Glu Pro Thr. Ile. Ala Arg. Asn Thr. Gly Ile Ile. Cys. Thr Ile. Gly
290. . . . 295. . . 300.
Pro Ala Ser. Arg Ser. Val Asp Lys Leu Lys Glu Met Ile Lys Ser Gly
305 310 315 320 .
Met Asn Val Ala Arg Leu. Asn Phe Ser His Gly Thr. His Glu Tyr His.......
325. 330 335
Glu Gly Thr Ile Lys Asn Val Arg Glu Ala Thr Glu Ser. Phe. Ala Ser
340. 345 350. . . .
Asp Pro Ile Thr. Tyr. Arg Pro Val Ala Ile Ala Leu Asp.Thr. Lys. Gly...
355 . 360 . 365.
Pro. Glu Ile. Arg Thr Gly Leu Ile Lys Gly Ser. Gly. Thr Ala. Glu Val..
370. 375 380.
Glu Leu Lys Lys Gly Ala. Ala Leu Lys Val. Thr Leu Asp Asn Ala Phe
385. 390 . . 395. 400
Met Glu Asn Cys Asp. Glu Asn Val Leu Trp Val Asp Tyr. Lys. Asn Leu
405. 410 415
Ile Lys. Val Ile Asp Val. Gly. Ser Lys Ile Tyr Val Asp. Asp Gly Leu ..
420. . . . 425. 430.
Ile Ser. Leu Leu Val Lys. Glu Lys Gly Lys. Asp. Phe Val Met Thr Glu ..
435. 440 445 .
8
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
Val Glu Asn Gly Gly Met. Leu Gly Ser Lys Lys Gly Val Asn Leu Pro
450 455 .460
Gly Ala Ala Val Asp Leu Pro. Ala Val Ser Glu Lys. Asp Ile Gln Asp
465 470 475 480
Leu Lys Phe Gly Val Glu Gln Asn Val Asp Met Val Phe Ala Ser. Phe
485 . 490 495
Ile Rrg Lys Ala Ala Asp Val His Ala Val Arg Lys Val Leu Gly. Glu
500 505 510
Lys Gly. Lys His Ile Lys Ile. Ile Ser Lys Ile Glu Asn His Glu Gly.
515 520 525
Val Arg Arg Phe Asp Glu Ile Met Glu Ala Ser Asp Gly Ile. Met Val
530 535. . 540.
Ala Arg Gly. Asp Leu Gly Ile Glu Ile Pro Ala Glu Lys Val Phe Leu
545 550 555 560
Ala. Gln Lys Met Met Ile Gly. Arg Cys Asn Arg. Ala Gly Lys Pro Ile
565 ... 570 575
Ile Cys Ala Thr Gln Met Leu Glu Ser. Met Ile Lys Lys Pro. Arg Pro
580. . . 585. . 590 .
Thr Arg Ala Glu Gly Ser. Asp Val Ala Rsn Ala Val Leu Asp. Gly. Ala .
595 600.. 605
Asp Cys Ile Met Leu Ser. Gly Glu Thr Ala Lys Gly Asp. Tyr Pro Leu ...
610 615 620
Glu Ala Val Arg. Met Gln His Ala Ile Ala Arg Glu Ala Glu Ala Ala
625 630 .. 635 640.......
Met Phe His Arg Gln Gln Phe Glu Glu Ile Leu Arg. His Ser Val His
645. . 650. 655.
His Arg Glu Pro Ala Asp Ala Met Ala Ala Gly. Ala Val. Glu Ala Ser....
660 665 670
Phe Lys Cys Leu Ala Ala Ala. Leu Ile.Val Met Thr Glu Ser Gly Arg
675 680. 685.
Ser. Ala His Leu Val. Ser Arg. Tyr Arg. Pro. Arg. Ala. Pro. Ile Ile Ala
690 695. . . . . . . 700.
9
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
Val Thr Arg Asn Asp Gln Thr Rla Arg Gln Ala His Leu Tyr Arg Gly
705 710 715 720
Val Phe Pro Val Leu Cys Lys. Gln Pro Ala His Asp Ala Trp Ala Glu
725 730 735
Asp Val. Asp Leu Arg Val Asn Leu Gly Met Asn Val Gly Lys. Ala Arg .
740 745 . 750. .
Gly Phe Phe Lys Thr Gly Asp Leu Val Ile Val. Leu Thr Gly Trp Arg.
755 760 . 765
Pro Gly. Ser Gly Tyr Thr Asn Thr. Met Arg Val. Val Pro Val Pro Ala
770 775.. 780
Ala. Ala Leu Glu His. His His His. His. His.
785 790
<210> 5
<211> 1914
<212> DNA
<213> Artificial Sequence
<220> . .
<223>. Description of Artificial Sequence: TAT-hACF
<400>. 5
atggctagca tgactggtgg acagcaaatg ggtcgggatc cgggatatgg aagaaaaaaa 60
agaagacaaa gaagaagagg ctctagatac ccctacgacg tgcccgacta cgccgatatc 120
atggaatcaa atcacaaatc cggggatgga ttgagcggca ctcagaagga agcagccctc 180.
cgcgcactgg tccagcgcac aggatatagc. ttggtccagg aaaatggaca aagaaaatat 240 .
ggtggccctc cacctggttg ggatgctgca ccccctgaaa ggggctgtga aatttttatt. 300
ggaaaacttc cccgagacct ttttgaggat gagcttatac cattatgtga. aaaaatcggt 360
aaaatttatg aaatgagaat gatgatggat tttaatggca acaatagagg atatgcattt. 420
gtaacatttt caaataaagt ggaagccaag aatgcaatca agcaacttaa taattatgaa 480
attagaaatg ggcgcctctt aggggtttgt gccagtgtgg acaactgccg attatttgtt. 540
gggggcatcc caaaaaccaa aaagagagaa gaaatcttat cggagatgaa aaaggttact 600
gaaggtgttg tcgatgtcat. cgtctaccca agcgctgcag ataaaaccaa aaaccgaggc 660..
tttgccttcg tggagtatga. gagtcatcga acagctgcca tggcgaggag gaaactgcta 720....
ccaggaagaa ttcagttatg. gggacatggt attgcagtag actgggcaga gccagaagta 780..
gaagttgatg aagatacaat gtcttcagtg aaaatcctat atgtaagaaa tcttatgctg 840.
tctacctctg aagagatgat tgaaaaggaa ttcaacaata tcaaaccagg tgctgtggag 900..
..... agggtgaaga aaattcgaga ctatgctttt gtgcacttca gtaaccgaaa agatgcagtt 960
...
gaggctatga aagctttaaa tggcaaggtg ctggatggtt cccccattga agtcacccta 1020.
gcaaaaccag tggacaagga cagttatgtt aggtataccc gaggcacagg tggaaggggc 1080.
accatgctgc aaggagagta tacctactct ttgggccaag tttatgatcc caccacaacc 1140
10.
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
taccttggag ctcctgtctt ctatgccccc cagacctatg. cagcaattcc cagtcttcat 1200
ttcccagcca ccaaaggaca tctcagcaac agagccatta. tccgagcccc ttctgttaga 1260
ggggctgcgg gagtgagagg actgggcggc cgtggctatt. tggcatacac aggcctgggt 1320
cgaggatacc aggtcaaagg agacaaaaga gaagacaaac tctatgacat tttacctggg 1380
atggagctca ccccaatgaa tcctgtcaca ttaaaacccc aaggaattaa actcgctccc 1440
cagatattag aagagatttg tcagaaaaat aactggggac agccagtgta ccagctgcac 1500
tctgctattg gacaagacca aagacagcta ttcttgtaca aaataactat tcctgctcta 1560
gccagccaga atcctgcaat, ccaccctttc acacctccaa agctgagtgc ctttgtggat 1620
gaagcaaaga cgtatgcagc cgaatacacc ctgcagaccc tgggcatccc cactgatgga 1680
ggcgatggca. ccatggctac tgctgctgct gctgctactg ctttcccagg atatgctgtc 1740
cctaatgcaa ctgcacccgt gtctgcagcc cagctcaagc aagcggtaac ccttggacaa 1800
gacttagcag catatacaac ctatgaggtc tacccaactt ttgcagtgac tgcccgaggg. 1860
gatggatatg gcaccttcgc. ggccgcactc gagcaccacc accaccacca ctga .. 1914
<210> 6
<211> 637
<212> PRT
<213>. Artificial Sequence
<220>
<223>. Description of Artificial Sequence: TAT-hACF
<400> 6
Met Ala Ser Met Thr Gly Gly Gln Gln Met Gly Arg Asp. Pro. Gly Tyr
1 5 10. 15 . .
Gly Arg Lys Lys Arg Arg Gln Arg. Arg. Arg Gly Ser Arg. Tyr. Pro. Tyr
20 25 30.....
Asp Val Pro Asp. Tyr Ala Asp. Ile Met Glu Ser. Asn His Lys Ser Gly
35 40 45. .
Asp Gly Leu Ser Gly. Thr Gln Lys. Glu Ala Ala. Leu Arg Ala Leu Val.
50 55 . 60.
Gln Arg Thr Gly Tyr Ser Leu Val Gln Glu Asn Gly. Gln Arg Lys. Tyr
6 5. 7 0. 7 5. . 8 0
Gly. Gly. Pro Pro. Pro Gly Trp. Asp Ala Ala Pro. Pro Glu Arg. Gly. Cys.
85 90. . . . . . . . 95 .
Glu Ile Phe Ile Gly Lys Leu Pro Arg. Asp Leu Phe Glu Asp Glu Leu
100 105...... 110
Ile Pro. Leu Cys. Glu Lys Ile. Gly.~Lys Ile Tyr. Glu Met Arg Met Met
115. 120 . 125 .
11
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
Met Asp. Phe Asn Gly Asn Asn Arg Gly Tyr Ala Phe Val. Thr Phe Ser
130 135 140..
Asn Lys Val Glu Ala Lys Asn Ala Ile Lys Gln Leu Asn Asn Tyr Glu
145.. 150 155 160
Ile Arg Asn Gly Arg Leu Leu Gly Val Cys Ala Ser. Val Asp Asn Cys
165. 170 175
Arg. Leu Phe Val Gly Gly Ile Pro Lys Thr Lys Lys. Arg Glu Glu Ile
180 185 .. 190
Leu Ser Glu Met Lys Lys Val Thr Glu Gly Val Val. Asp Val. Ile Val
195 .. 200 205
Tyr. Pro Ser Ala Ala Asp Lys. Thr Lys Asn Arg. Gly Phe Ala. Phe Val.
210 215 220.
Glu Tyr. Glu Ser. His Arg Thr Ala Ala Met Ala Arg. Arg Lys. Leu Leu
225...... 230 235 240
Pro Gly. Arg Ile. Gln Leu Trp Gly His Gly. Ile Ala Val Asp Trp. Ala
245 250 , 255..
Glu Pro Glu Val Glu Val. Asp Glu Asp Thr. Met Ser Ser. Val Lys. Ile
260 265 270.
Leu Tyr Val. Arg. Asn Leu Met Leu Ser Thr Ser. Glu Glu Met.Ile Glu .
275. . 280 285. . . . .
Lys Glu Phe Asn Asn Ile Lys Pro. Gly Ala Val. Glu Arg. Val. Lys Lys
290 . . . 295 300.
Ile.Arg Asp. Tyr Ala Phe Val. His Phe Ser Asn Arg Lys Asp. Ala Val.
305. 310 315. 320. .
Glu Ala Met. Lys Ala Leu Asn Gly Lys. Val Leu Asp Gly Ser. Pro Ile ...
325 . 330 335
Glu Val. Thr Leu Ala Lys. Pro Val Asp Lys Asp. Ser Tyr. Val Arg Tyr
340. . 345. 350
Thr Arg Gly. Thr Gly Gly Arg. Gly Thr. Met Leu Gln Gly. Glu Tyr. Thr
355. 360 . . 365.
Tyr. Ser Leu Gly Gln Val. Tyr Asp. Pro. Thr Thr Thr. Tyr Leu Gly. Ala .
370 . 375 380 .
12
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
Pro Val Phe Tyr Ala Pro Gln Thr Tyr Ala Ala Ile Pro Ser Leu His.
385 390 395 400
Phe Pro Ala Thr. Lys. Gly His Leu Ser Asn Arg Ala Ile Ile Arg Ala
405 . . 410 415
Pro Ser Val Arg. Gly Ala Ala Gly Val Arg. Gly Leu Gly Gly Arg Gly..
420 425 . . 430.
Tyr. Leu Ala Tyr Thr. Gly Leu Gly Arg Gly Tyr Gln Val Lys Gly Asp
435 440 445..
Lys Arg Glu Asp. Lys. Leu Tyr. Asp Ile Leu Pro Gly Met Glu Leu Thr..
450 455. 460
Pro Met Asn Pro Val. Thr Leu Lys Pro. Gln Gly. Ile Lys Leu Ala Pro
465. 470 475. . 480
Gln Ile Leu Glu Glu Ile. Cys Gln Lys Asn Asn Trp. Gly Gln Pro. Val
485 . . . 490. 495.
Tyr Gln Leu His. Ser. Ala. Ile Gly Gln Asp. Gln Arg. Gln Leu Phe Leu ....
500. . . 505 510. . .
Tyr Lys Ile Thr. Ile Pro. Ala Leu Ala Ser. Gln Asn Pro Ala Ile His ....
515 520 .... 525
Pro Phe Thr Pro Pro Lys Leu Ser Ala. Phe Val. Asp Glu Ala Lys Thr
530 .... 535 540
Tyr Ala Ala Glu Tyr Thr Leu Gln Thr Leu Gly Ile Pro.Thr Asp. Gly
545 550. 555 560 .
Gly. Asp Gly Thr. Met Ala Thr Ala Ala Ala Ala. Ala Thr.Ala Phe Pro .
565 570 575.
Gly Tyr Ala Val Pro. Asn Ala Thr Ala. Pro Val. Ser Ala Ala Gln Leu
580. . . . 585. 590
Lys Gln Ala Val. Thr. Leu Gly. Gln Asp Leu Ala Ala. Tyr Thr Thr. Tyr...
595 . . . 600. 605.
Glu Val. Tyr Pro Thr. Phe. Ala Val Thr Ala. Arg. Gly. Asp Gly Tyr Gly....
610 . 615 620 .
Thr. Phe Ala Ala Ala. Leu Glu His His His His. His His
625. 630 635. . .
13
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
<210> 7
<211> 1914
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial. Sequence: TAT-rACF .
<400> 7
atggctagca tgactggtgg acagcaaatg ggtcgggatc cgggatatgg aagaaaaaaa 60
agaagacaaa gaagaagagg ctctagatac ccctacgacg tgcccgacta cgccgatatc 120
atggaatcaa atcacaaatc cggggatgga ttgagcggca cccagaagga agcagcactc 180
cgcgcactgg tccagcgcac aggatatagc ttggtccagg aaaatggaca. aagaaaatat 240
ggtggtcctc caccaggctg ggatactaca cccccagaaa ggggctgcga gattttcatt 300
gggaaacttc cccgggacct ttttgaggat gaactcatac cattgtgtga aaaaattggt 360 ..
aaaatttatg aaatgagaat gatgatggat ttcaatggga acaacagagg ctatgcattt 420
gtaaccttct caaataagca ggaagccaag aatgcaatca agcaacttaa taattatgaa 480 ..
attcggaatg gccgtctcct. gggcgtctgt gccagtgtgg. acaactgccg gttgtttgtg. 540
gggggaatcc ccaaaaccaa. aaagagagaa gaaatcttgt cagagatgaa aaaggtcact. 600
gaaggagttg ttgatgtcat. tgtctaccca agcgctgccg ataaaaccaa aaaccggggg 660.
tttgcctttg tggaatatga gagtcaccgc gcagccgcca tggctaggcg gaggctgctg. 720 .
ccaggaagaa ttcagttgtg. gggacatcct.atcgcagtag actgggcaga gccagaagtc 780 .
gaagttgacg aagacacaat gtcttccgtg. aaaatcctgt. acgtaaggaa ccttatgctg 840
tctacctcgg aagagatgat tgagaaggaa. ttcaacagta ttaaaccagg tgctgtggaa 900 .
cgggtgaaga agatccgaga ctatgctttt gtgcatttca gtaaccgaga agatgcagtt 960
gaagccatga aggctttgaa tggcaaggtg ctggatggtt ccccaataga agtgaccttg 1020.
gccaagccag tggacaagga cagttacgtt aggtacaccc ggggcaccgg gggcaggaac 1080
accatgctgc aagaatacac ctaccctctg. agccatgttt atgaccctac cacaacctac 1140....
cttggagctc ctgtcttcta tactccccaa gcctacgcag ccattccaag tcttcatttc 1200....
ccagctacca aaggacatct. cagcaacaga gctctcatcc ggaccccttc tgtcagaggg. 1260.
gctgcgggcg tgagaggact gggcggccgt. gggtatttgg catatacagg cctgggtcga 1320
ggataccagg tcaaaggaga caagagacaa gacaaactct atgaccttct gcctgggatg 1380.
gagctcaccc cgatgaatac tatctcttta aaaccacaag gagttaaact tgctcctcag 1440....
atattagaag aaatctgtca gaaaaataac tggggacagc cagtgtacca gctgcactct 1500....
gccattggac aagaccaaag acagttattc ctatacaaag taactatccc agcgctggcc 1560....
agccagaatc ctgcgatcca ccctttcaca cccccaaagc. taagcgccta cgtggatgaa. 1620....
gcaaagaggt acgccgcaga gcacacccta cagacactag gcatccccac agaaggaggg. 1680 ...
gacgctggga ctacagcacc. cactgccaca tccgccactg tgtttccagg. atacgctgtc. 1740 .
cccagtgcca ccgctcctgt. gtctacagcc. cagctcaagc. aagcagtgac acttggacaa. 1800
gacttagcag catatacaac. ctatgaggtc taccctactt ttgcagtgac cacccgaggt 1860..
gatggatatg gcaccttcgc. ggccgcactc gagcaccacc accaccacca ctga . 1914.
<210> 8
<211> 637
<212> PRT
<213> Artificial Sequence
14 .
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
<220>
<223> Description of Artificial Sequence: TAT-rACF
<400> 8
Met Ala Ser Met. Thr Gly Gly Gln Gln Met Gly. Arg Asp Pro Gly Tyr
1. 5 10 15 .
Gly Arg Lys Lys. Arg Arg. Gln Arg Arg Arg Gly Ser Arg Tyr Pro Tyr
20. 25 30. . . .
Asp. Val Pro Asp Tyr Ala Asp. Ile Met Glu Ser Asn His Lys Ser Gly
35 40 . 45
Asp Gly Leu Ser. Gly Thr. Gln Lys Glu Ala Ala Leu Arg Ala Leu Val
50 55 60
Gln Arg Thr Gly Tyr Ser. Leu Val Gln Glu Asn Gly Gln Arg. Lys Tyr
65. 70 75 . . 80
Gly Gly Pro Pro. Pro Gly Trp Asp. Thr Thr Pro Pro Glu Arg Gly. Cys
85 90 95 . .
Glu Ile Phe Ile. Gly. Lys Leu Pro. Arg Asp Leu Phe Glu Asp Glu Leu
100 .. 105 110
Ile Pro Leu Cys Glu Lys Ile Gly Lys. Ile Tyr Glu Met Arg Met Met
115 120 125..
Met Asp. Phe Asn Gly. Asn Asn Arg. Gly. Tyr. Ala Phe Val Thr Phe Ser.....
130. 135 140
Asn Lys Gln Glu Ala Lys. Asn Ala Ile. Lys. Gln Leu Asn Asn Tyr Glu .
145 150 155 160
Ile Arg Asn Gly Arg. Leu Leu Gly Val. Cys. Ala Ser Val. Asp. Asn Cys
165. 170. . . . 175
Arg Leu Phe Val. Gly Gly. Ile Pro. Lys. Thr. Lys Lys. Arg Glu Glu Ile.
180. 185 190
Leu Ser Glu Met Lys Lys Val Thr. Glu Gly Val Val Asp Val Ile Val
195 200.... 205
Tyr Pro Ser Ala. Ala Asp Lys Thr Lys Asn Arg Gly. Phe Ala Phe. Val
. . 210 . 215 . . 220. . .
Glu Tyr. Glu Ser His. Arg Ala Ala. Ala Met. Ala Arg. Arg Arg. Leu Leu
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
225 230 235 240
Pro. Gly Arg Ile Gln Leu Trp. Gly His Pro Ile Ala Val. Asp Trp Ala
245 250 255 ..
Glu Pro Glu Val Glu Val Asp Glu Asp. Thr Met Ser Ser Val Lys Ile
260 265 270.
Leu Tyr Val Arg Asn Leu Met Leu Ser. Thr Ser Glu Glu Met Ile Glu
275 280.. 285
Lys Glu Phe Asn Ser Ile Lys Pro Gly Ala Val. Glu Arg Val. Lys Lys
290. 295 300 . .
Ile Arg Asp Tyr Ala Phe Val His Phe Ser Asn Arg Glu Asp Ala Val
305. . 310 315 . 320
Glu Ala Met. Lys Ala Leu Asn Gly. Lys Val Leu Asp Gly Ser Pro Ile
325 330 335
Glu Val.Thr. Leu Ala Lys. Pro Val Asp. Lys Asp Ser. Tyr Val Arg Tyr
340 345 350 .
Thr Arg Gly Thr Gly Gly Arg Asn Thr Met Leu Gln Glu Tyr Thr Tyr..
355 360 365
Pro. Leu Ser. His Val Tyr Asp Pro. Thr Thr. Thr Tyr Leu Gly. Ala Pro.
370. 375 380
Val Phe Tyr. Thr. Pro. Gln Ala Tyr Ala Ala. Ile Pro Ser. Leu His. Phe ..
385. . . 390 395 . . 400. . .
Pro. Ala Thr. Lys Gly. His Leu Ser Asn Arg Ala Leu Ile Arg Thr. Pro...
405 . 410. 415
Ser. Val Arg. Gly Ala. Ala Gly Val. Arg Gly. Leu Gly Gly. Arg Gly Tyr.
420 425 430.
Leu Ala Tyr. Thr Gly Leu Gly Arg Gly. Tyr. Gln Val. Lys Gly. Asp. Lys
435 440 445 ....
Arg. Gln Asp Lys Leu Tyr Asp. Leu Leu Pro. Gly Met Glu Leu Thr. Pro .
450. 455 . . 460 .
Met Asn Thr. Ile Ser Leu Lys Pro Gln Gly Val Lys. Leu Ala Pro. Gln
. 465 470 475. . . . . 480
Ile Leu Glu Glu Ile Cys. Gln Lys Asn Asn Trp Gly. Gln Pro. Val. Tyr
16
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
485 490 495
Gln Leu His Ser Ala Ile Gly Gln Asp Gln Arg Gln Leu Phe Leu Tyr
500 505 510
Lys Val Thr Ile Pro Ala Leu Ala Ser Gln Asn Pro Ala Ile His. Pro...
515 520 525 .
Phe Thr Pro Pro Lys Leu Ser Ala Tyr. Val Asp Glu Ala Lys Arg Tyr
530 535 540
Ala Ala Glu His. Thr Leu Gln Thr Leu Gly Ile Pro Thr. Glu Gly Gly..
545 550. 555 560. . .
Asp Ala Gly. Thr Thr Ala Pro Thr Ala. Thr Ser Ala Thr Val Phe Pro
565. . . . 570 575. . .
Gly Tyr Ala Val Pro Ser Ala Thr. Ala Pro Val Ser Thr Ala Gln Leu
580 585. 590 .
Lys. Gln Ala Val. Thr. Leu Gly Gln Asp Leu Ala Ala Tyr Thr. Thr Tyr ..
595 . . 600 605 .
Glu Val Tyr Pro Thr Phe Ala Val Thr Thr. Arg Gly Asp Gly Tyr Gly
610 615 . 620
Thr Phe Ala Ala Ala. Leu Glu His. His His His. His. His
625 630 . 635
<210>. 9.
<211>. 9
<212> PRT.
<213> Artificial. Sequence .
<220>
<223> Description of. Artificial. Sequence: protein
transduction domain of HIV-1 .
<400> 9
Arg Lys Lys Arg. Arg Gln Arg. Arg. Arg
1. 5
<210> 10.
<211>. 27
<212>. DNA
<213> Artificial Sequence
17
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
<220>
<223> Description of Artificial Sequence: encodes.
protein transduction domain of HIV-1
<400> 10
agaaaaaaaa gaagacaaag aagaaga.. 27
<210> 11
<211> 236
<212> PRT
<213> Homo Sapiens.
<400> 11
Met Thr Ser. Glu Lys Gly Pro. Ser Thr Gly Asp Pro. Thr Leu Arg Arg
1 5 10 15. . . .
Arg Ile Glu Pro Trp. Glu Phe Asp. Val Phe Tyr Asp. Pro Arg Glu Leu
20 25. . 30
Arg Lys Glu Ala Cys. Leu Leu Tyr Glu Ile Lys Trp Gly. Met Ser Arg
35 40. . 45. .
Lys Ile Trp Arg Ser. Ser. Gly Lys. Asn Thr. Thr Asn His. Val. Glu Val.
50 55. . . 60
Asn Phe Ile Lys Lys Phe Thr Ser Glu Arg Asp. Phe His Pro Ser. Ile
65 70 75. 80.
Ser Cys Ser Ile Thr. Trp. Phe Leu Ser. Trp Ser. Pro Cys Trp. Glu Cys.
85..... 90 95
Ser Gln Ala Ile Arg Glu Phe Leu Ser Arg. His. Pro Gly Val Thr. Leu
100 105 110 ...
Val Ile Tyr Val Ala Arg Leu Phe Trp His Met Asp Gln Gln Asn. Arg
115 120 . 125
Gln Gly Leu Arg. Asp. Leu Val Asn Ser. Gly Val Thr Ile. Gln Ile Met
130 135 140
Arg Ala Ser Glu Tyr. Tyr His Cys. Trp. Arg Asn Phe Val. Asn Tyr Pro
145 150 155 160 .
Pro Gly Asp Glu Rla His Trp Pro Gln Tyr. Pro. Pro Leu Trp Met Met..
165 170. . . . . 175 .
18.
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
Leu Tyr Ala Leu Glu Leu His Cys Ile. Ile Leu Ser Leu Pro Pro Cys
180 185 190
Leu Lys Ile Ser Arg Arg Trp. Gln Asn His Leu Thr Phe Phe Arg Leu
195 200 205
His Leu Gln Asn Cys His Tyr Gln Thr Ile Pro. Pro His Ile Leu Leu
210 215. 220
Ala Thr Gly Leu Ile His Pro Ser Val. Ala Trp Arg
225 230 235..
<210> 12
<211> 711
<212> DNA
<213> Homo sapiens
<400>. 12
atgacttctg agaaaggtcc ttcaaccggt gaccccactc tgaggagaag aatcgaaccc 60
tgggagtttg acgtcttcta tgaccccaga gaacttcgta aagaggcctg tctgctctac 120
gaaatcaagt ggggcatgag ccggaagatc tggcgaagct caggcaaaaa caccaccaat 180
cacgtggaag ttaattttat aaaaaaattt. acgtcagaaa gagattttca cccatccatc 240
agctgctcca tcacctggtt cttgtcctgg. agtccctgct gggaatgctc ccaggctatt. 300 .
agagagtttc tgagtcggca ccctggtgtg. actctagtga tctacgtagc tcggcttttt. 360
tggcacatgg atcaacaaaa tcggcaaggt ctcagggacc ttgttaacag. tggagtaact 420.......
attcagatta. tgagagcatc agagtattat cactgctgga ggaattttgt caactaccca 480 ......
cctggggatg aagctcactg. gccacaatac ccacctctgt ggatgatgtt. gtacgcactg. 540 .
gagctgcact gcataattct aagtcttcca ccctgtttaa agatttcaag. aagatggcaa 600...
aatcatctta catttttcag. acttcatctt caaaactgcc attaccaaac gattccgcca 660.
cacatccttt tagctacagg gctgatacat ccttctgtgg cttggagatg. a. 711
<210> 13 .
<211> 229
<212> PRT
<213> Rattus norvegicus.
<400> 13
Met Ser Ser Glu Thr Gly Pro Val. Ala Val. Asp Pro Thr. Leu Arg Arg .
1 5 10 15 .
Arg. Ile Glu Pro His Glu Phe Glu Val Phe. Phe Asp Pro Arg Glu Leu
20 25 . 30
Arg. Lys Glu Thr Cys Leu Leu Tyr. Glu Ile Asn Trp Gly. Gly Arg His
35 40............ 45.
19..........
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
Ser Ile Trp Arg His Thr Ser. Gln Asn Thr Asn Lys. His Val Glu Val
50 55 60 .
Asn Phe Ile Glu Lys Phe Thr Thr Glu Arg Tyr Phe Cys. Pro. Asn Thr.
65 70. . . 75. 80
Arg Cys. Ser Ile Thr Trp Phe Leu Ser Trp Ser. Pro. Cys Gly. Glu Cys .
85 90 95
Ser. Arg AlaIleThr GluPheLeu Ser.ArgTyr.ProHisValThr Leu
100 105. 110
Phe Ile TyrIle.Ala RrgLeuTyr His.HisAla AspProArg.Asn Arg .
115 120 . 125.
.
Gln Gly LeuArgAsp LeuIleSer.Ser.Gly.Val ThrIleGlnIle Met .
130 135 140
Thr Glu GlnGluSer Gly.Tyr.Cys Trp.ArgAsn PheValAsnTyr Ser ...
145 . . 150. 155. 160 . . . .
. .
. .
.
Pro Ser AsnGluAla HisTrpPro Arg.Tyr.Pro His.LeuTrpVal Rrg
165.. 170. 175.
Leu Tyr ValLeuGlu LeuTyr.Cys IleIleLeu Gly.LeuProPro.Cys
180 185. 190
Leu Asn IleLeuArg ArgLysGln Pro.GlnLeu ThrPhe.PheThr Ile.
195.. 200. 205..
. .
Ala Leu Gln Ser Cys. His Tyr. Gln Arg Leu Pro Pro. His. Ile Leu. Trp
210 215 220 ...
Ala. Thr. Gly. Leu Lys . . .
225. . .
<210>. 14
<211> 690
<212> DNA .
<213> Rattus norvegicus
<400> 14 .
atgagttccg agacaggccc tgtagctgtt gatcccactc tgaggagaag aattgagccc 60
cacgagtttg aagtcttctt tgacccccgg gaacttcgga aagagacctg. tctgctgtat. 120
gagatcaact ggggaggaag gcacagcatc tggcgacaca cgagccaaaa caccaacaaa 180
cacgttgaag tcaatttcat agaaaaattt actacagaaa gatacttttg. tccaaacacc 240
agatgctcca ttacctggtt cctgtcctgg agtccctgtg gggagtgctc. cagggccatt 300
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
acagaatttt tgagccgata cccccatgta actctgttta tttatatagc. acggctttat 360
caccacgcag atcctcgaaa tcggcaagga ctcagggacc ttattagcag cggtgttact 420
atccagatca tgacggagca agagtctggc tactgctgga ggaattttgt caactactcc 480
ccttcgaatg aagctcattg gccaaggtac. ccccatctgt gggtgaggct. gtacgtactg 540
gaactctact gcatcatttt aggacttcca ccctgtttaa atattttaag aagaaaacaa 600
cctcaactca cgtttttcac gattgctctt. caaagctgcc attaccaaag gctaccaccc 660
cacatcctgt gggccacagg gttgaaatga . 690
<210> 15...
<211> 229.
<212> PRT ..
<213> Mus musculus
<400> 15.
Met Ser. Ser. Glu Thr. Gly Pro Val. Ala Val Asp. Pro Thr Leu Arg Arg
1. 5. 10 15
Arg Ile Glu Pro His Glu Phe Glu Val Phe Phe Asp Pro Arg Glu Leu
20. 25 30
Arg. Lys Glu Thr Cys Leu Leu Tyr Glu Ile Asn Trp Gly. Gly Arg His
35 40 45 .
Ser. Val Trp Arg His Thr Ser Gln Asn Thr Ser Asn His. Val Glu Val....
50 . 55 60
Asn Phe Leu Glu Lys Phe Thr Thr. Glu Arg Tyr Phe Arg Pro. Asn Thr
65 70 75 80 .
Arg Cys. Ser Ile Thr Trp Phe Leu Ser Trp Ser. Pro Cys Gly Glu Cys
85 90 . 95
Ser Arg Ala Ile. Thr Glu Phe Leu Ser Arg His. Pro Tyr Val. Thr. Leu .
100. 105 110. . . . .
Phe Ile Tyr Ile. Ala Arg Leu Tyr. His His Thr Asp Gln Arg. Asn Arg
115 120.. 125
Gln Gly Leu Arg Asp. Leu Ile Ser Ser Gly Val Thr Ile. Gln Ile Met
130 135 140
Thr. Glu Gln Glu Tyr. Cys Tyr Cys Trp Arg Asn Phe Val. Asn Tyr Pro .
145 . . 150. 155 160
Pro. Ser Asn Glu Ala Tyr Trp Pro Arg Tyr. Pro His Leu Trp. Val Lys...
165. 170 175
21 .
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
Leu Tyr Val Leu Glu Leu Tyr Cys. Ile Ile Leu Gly Leu Pro Pro Cys.
180 185 190
Leu Lys Ile Leu Arg Arg. Lys Gln Pro. Gln Leu Thr Phe Phe. Thr. Ile
195 200 205
Thr Leu Gln Thr Cys His. Tyr Gln Arg Ile Pro Pro His. Leu Leu Trp
210 215. 220
Ala Thr Gly Leu Lys
225
<210> 16
<211> 690
<212> DNA
<213> Mus musculus
<400> 16
atgagttccg agacaggccc tgtagctgtt gatcccactc tgaggagaag. aattgagccc 60
cacgagtttg aagtcttctt tgacccccgg gagcttcgga aagagacctg tctgctgtat 120
gagatcaact. ggggtggaag gcacagtgtc tggcgacaca cgagccaaaa caccagcaac 180
cacgttgaag tcaacttctt agaaaaattt actacagaaa gatactttcg. tccgaacacc.240
agatgctcca ttacctggtt cctgtcctgg agtccctgcg gggagtgctc cagggccatt 300 ...
acagagtttc tgagccgaca cccctatgta actctgttta tttacatagc acggctttat. 360
caccacacgg atcagcgaaa ccgccaagga ctcagggacc ttattagcag cggtgtgact 420
atccagatca tgacagagca agagtattgt tactgctgga ggaatttcgt caactacccc 480...
ccttcaaacg aagcttattg gccaaggtac ccccatctgt gggtgaaact. gtatgtattg 540..
gagctctact. gcatcatttt. aggacttcca ccctgtttaa aaattttaag. aagaaagcaa 600..
cctcaactca cgtttttcac. aattactctt caaacctgcc attaccaaag. gataccaccc 660..
catctccttt gggctacagg. gttgaaatga .. 690
<210> 17
<211> 530
<212>. PRT
<213> Callus. gallus
<400> 17
Met Ser Lys His. His Asp Ala Gly Thr Ala Phe Ile Gln Thr Gln Gln ..
1 5 10 . 15
Leu His Ala Ala. Met Ala Asp. Thr Phe Leu Glu His Met Cys Arg Leu ..
20 . . . 25 30
Asp Ile Asp. Ser Glu Pro.Thr Ile. Ala Arg Asn Thr. Gly Ile. Ile Cys...
35 40. 45. .
22.
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
Thr Ile Gly Pro Ala Ser Arg Ser. Val. Asp Lys Leu Lys Glu Met Ile
50 55 . 60
Lys Ser Gly AsnVal.Ala Leu AsnPhe.Ser His Thr His
Met Arg Gly.
65 70. 75 80
Glu Tyr. His GlyThr Ile Asn ValArgGlu Ala Glu Ser
Glu Lys Thr
85 90 95.
Phe Ala Ser ProIle Thr Arg Pro.Val.Ala Ile Leu Asp
Asp Tyr Ala
100 105 110.
Thr Lys Gly. Pro. Glu Ile Arg Thr Gly Leu Ile Lys Gly 5er Gly Thr
115 120 125
Ala Glu Val Glu Leu Lys. Lys Gly. Ala Ala. Leu Lys Val Thr. Leu Asp.
130 . 135 140
Asn Ala Phe Met. Glu Asn Cys. Asp. Glu Asn Val. Leu Trp Val Asp Tyr .........
145 . 150 155 160 .
Lys Asn Leu Ile Lys Val Ile Asp. Val. Gly Ser Lys. Ile Tyr Val Asp .~.
165 170 175
Asp Gly Leu Ile Ser Leu Leu Val. Lys. Glu Lys Gly. Lys. Asp. Phe Val
180 185 190 ...
Met Thr. Glu Val Glu Asn Gly Gly. Met Leu Gly Ser Lys Lys. Gly Val
195 200 205 .
Asn Leu Pro Gly Ala. Ala Val Asp. Leu Pro. Ala Val. Ser Glu Lys Asp
210 215 220
Ile Gln Asp Leu Lys. Phe Gly Val. Glu Gln Asn Val Asp Met. Val Phe .
225 230. . . 235. 240.
Ala Ser Phe Ile Arg. Lys. Ala Ala. Asp Val. His Ala Val Arg Lys. Val..
245 250. . 255. . . .
Leu Gly Glu Lys. Gly Lys His. Ile. Lys Ile Ile Ser. Lys Ile Glu Asn
260 265 . 270
His Glu Gly Val Arg Arg Phe Asp. Glu Ile Met Glu Ala.Ser Asp Gly
275 . 280 . 285 .
Ile Met Val Ala Arg Gly Asp. Leu Gly Ile. Glu Ile Pro. Ala. Glu Lys
290 295 ........ 300
23
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
Val. Phe Leu Ala Gln Lys Met Met Ile Gly Arg. Cys Asn Arg Ala Gly
305 310. 315 320
Lys Pro Ile Ile Cys Ala Thr. Gln Met Leu Glu Ser Met Ile Lys Lys
325 330 335
Pro Arg Pro Thr Arg Ala Glu Gly Ser Asp Val Ala Asn Ala Val. Leu
340 345 350 .
Asp Gly Ala Asp Cys Ile Met Leu Ser Gly Glu Thr. Ala Lys. Gly. Asp.
355 360 365
Tyr Pro Leu Glu Ala Val Arg Met Gln His Ala Ile Ala Arg. Glu Ala
370 375 380
Glu Ala Ala Met Phe His Arg Gln Gln Phe Glu Glu Ile Leu Arg His .
385 .. 390 395 400
Ser Val His His Arg Glu Pro Ala Asp Ala Met Ala. Ala. Gly. Ala. Val
405 410 415..
Glu Ala Ser Phe Lys Cys Leu Ala Ala Ala Leu Ile Val Met Thr Glu
420. 425. . . . . 430
Ser. Gly Arg Ser Ala. His. Leu Val.Ser. Arg. Tyr. Arg. Pro. Arg Ala Pro
435 440 445
Ile. Ile Ala Val. Thr. Arg Asn Asp. Gln Thr. Ala Arg Gln Ala His Leu
450 455. 460 .
Tyr. Arg. Gly. Val. Phe Pro. Val Leu Cys Lys Gln Pro. Ala His Asp Ala
465 . . . . . . . 470 . 475. . . 480
Trp Ala Glu Asp. Val. Asp. Leu Arg. Val Asn Leu Gly Met Asn Val. Gly ..
485 490 495. . . . . . .
Lys Ala Arg Gly Phe Phe Lys Thr Gly Asp Leu Val Ile Val. Leu Thr
500. . . 505. 510 .
Gly. Trp Arg Pro Gly Ser Gly Tyr. Thr Asn Thr. Met. Arg. Val Val. Pro
515 520 . 525
Val. Pro
530
<210> 18
<211> 1593
24
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
<212>. DNA
<213> Callus gallus.
<400> 18
atgtcgaagc accacgatgc agggaccgct ttcatccaga cccagcagct, gcacgctgcc 60
atggcagaca cctttctgga gcacatgtgc cgcctggaca tcgactccga gccaaccatt 120
gccagaaaca ccggcatcat ctgcaccatc ggcccagcct cccgctctgt. ggacaagctg 180
aaggaaatga ttaaatctgg aatgaatgtt gcccgcctca acttctcgca cggcacccac 240.
gagtatcatg agggcacaat taagaacgtg cgagaggcca cagagagctt tgcctctgac 300
ccgatcacct acagacctgt ggctattgca ctggacacca agggacctga aatccgaact 360 .
ggactcatca agggaagtgg cacagcagag gtggagctca agaagggcgc agctctcaaa 420
gtgacgctgg acaatgcctt. catggagaac tgcgatgaga atgtgctgtg. ggtggactac 480
aagaacctca tcaaagttat agatgtgggc agcaaaatct atgtggatga. cggtctcatt. 540
tccttgctgg ttaaggagaa aggcaaggac tttgtcatga ctgaggttga gaacggtggc 600
atgcttggta gtaagaaggg agtgaacctc ccaggtgctg cggtcgacct gcctgcagtc 660
tcagagaagg. acattcagga cctgaaattt ggcgtggagc agaatgtgga catggtgttc 720
gcttccttca tccgcaaagc tgctgatgtc catgctgtca ggaaggtgct aggggaaaag 780
ggaaagcaca tcaagattat. cagcaagatt gagaatcacg. agggtgtgcg. caggtttgat 840
gagatcatgg aggccagcga tggcattatg gtggcccgtg gtgacctggg. tattgagatc 900.
cctgctgaaa aagtcttcct cgcacagaag atgatgattg ggcgctgcaa cagggctggc 960
aaacccatca tttgtgccac tcagatgttg gaaagcatga tcaagaaacc tcgcccgacc 1020
cgcgctgagg gcagtgatgt tgccaatgca gttctggatg gagcagactg catcatgctg 1080...
tctggggaga ccgccaaggg agactaccca ctggaggctg tgcgcatgca. gcacgctatt 1140.
gctcgtgagg ctgaggccgc aatgttccat cgtcagcagt ttgaagaaat cttacgccac 1200
agtgtacacc acagggagcc tgctgatgcc atggcagcag gcgcggtgga ggcctccttt 1260 .
aagtgcttag cagcagctct. gatagttatg accgagtctg gcaggtctgc. acacctggtg 1320
tcccggtacc gcccgcgggc. tcccatcatc gccgtcaccc gcaatgacca. aacagcacgc 1380
caggcacacc tgtaccgcgg. cgtcttcccc gtgctgtgca agcagccggc ccacgatgcc 1440
tgggcagagg atgtggatct ccgtgtgaac ctgggcatga atgtcggcaa. agcccgtgga 1500
ttcttcaaga ccggggacct ggtgatcgtg ctgacgggct ggcgccccgg ctccggctac 1560
accaacacca tgcgggtggt gcccgtgcca tga 1593
<210> 19 ' ...
<211> 9
<212> PRT ..
<213> Artificial. Sequence
<220> .
<223> Description of Artificial Sequence: . hemagglutinin
epitope tag
<400> 19
Tyr. Pro Tyr Asp. Val Pro. Asp. Tyr. Ala
1. 5
<210> 20
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
<211> 27
<212> DNR
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: encodes
hemagglutinin epitope tag
<400> 20 .
tacccctacg acgtgcccga ctacgcc 27
<210> 21 .
<211> 594...
<212> PRT
<213> Rattus norvegicus ..
<400> 21
Met Glu Ser Asn His. Lys. Ser Gly. Asp. Gly Leu Ser. Gly Thr Gln Lys
1 5 . 10 15. .
Glu Ala Ala Leu Arg Ala Leu Val. Gln Arg Thr Gly Tyr Ser. Leu Val
20. . . . . 25 30. . .
Gln Glu Asn Gly. Gln Arg. Lys Tyr. Gly Gly Pro. Pro Pro Gly. Trp Asp ...
35 . . . . 40 45. . .
Thr Thr Pro Pro. Glu Arg. Gly. Cys Glu Ile. Phe Ile Gly. Lys Leu Pro....
50 55 60
Arg Asp Leu Phe. Glu Asp Glu Leu Ile Pro Leu Cys Glu Lys Ile Gly .
65 70 75. 80 .
Lys Ile Tyr Glu Met Arg. Met. Met Met. Asp Phe Asn Gly. Asn Asn Arg...
85 90 . 95 . . . . .
Gly Tyr Ala Phe. Val Thr. Phe Ser Asn Lys. Gln Glu Ala. Lys Asn Ala ..
100 105. 110
Ile Lys Gln Leu Asn Asn Tyr Glu Ile Arg. Asn Gly. Arg Leu Leu Gly ..
115 120 125
Val. Cys Ala Ser Val. Asp Asn Cys Arg Leu Phe Val Gly. Gly. Ile. Pro.
130 ... 135 .. 140
Lys Thr Lys Lys Arg. Glu Glu Ile. Leu Ser. Glu Met Lys. Lys Val Thr
145 150 . . 155 . 160
26
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
Glu Gly Val Val Asp Val Ile Val Tyr Pro Ser Ala Ala Asp Lys Thr
165 170 175
Lys Asn Arg Gly Phe Ala Phe Val. Glu Tyr Glu Ser His Arg Ala Ala
180 185 190.
Ala Met Ala Arg Arg Arg Leu Leu Pro Gly Arg Ile. Gln Leu Trp Gly.
195 200 205
His Pro Ile Ala Val Asp Trp. Ala Glu Pro Glu Val Glu Val Asp Glu
210 215. 220 .
Asp Thr. Met Ser Ser Val. Lys.Ile Leu Tyr Val Arg Asn Leu Met Leu
225 230 235 240.
Ser Thr Ser Glu Glu Met Ile Glu Lys Glu Phe Asn Ser Ile Lys Pro
245 . 250 255
Gly. Ala Val Glu Arg Val Lys Lys Ile Arg Asp Tyr. Ala Phe Val. His ..
260 265 . 270
Phe Ser Asn Arg Glu Asp. Ala Val Glu Ala. Met Lys Ala Leu Asn Gly ..
275 280 285
Lys Val Leu Asp Gly. Ser Pro Ile Glu Val. Thr Leu Ala Lys Pro Val
290 295. 300
Asp Lys Asp. Ser Tyr Val. Arg Tyr. Thr. Arg Gly Thr. Gly Gly. Arg Asn
305 310 315. 320
Thr. Met Leu Gln Glu Tyr Thr Tyr. Pro. Leu Ser His Va1 Tyr Asp Pro.
325. . 330 . . . 335
Thr Thr Thr Tyr Leu Gly Ala Pro Val. Phe Tyr Thr. Pro Gln Ala Tyr
340 345.. 350
Ala Ala Ile Pro Ser. Leu His. Phe Pro Ala Thr Lys. Gly His Leu Ser
355 360 365
Asn Arg Ala Leu Ile Arg. Thr. Pro Ser Val. Arg. Glu Ile Tyr Met Asn ..
370 375.. 380
Val Pro Val Gly Ala Ala. Gly Val Arg Gly. Leu Gly Gly Arg Gly Tyr
385 390. . . . 395 400 .
Leu Ala Tyr Thr Gly Leu Gly Arg Gly Tyr Gln Val Lys Gly Asp Lys
405 . . . . . 410. 415
27
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
Arg Gln Asp Lys Leu Tyr Asp Leu Leu Pro. Gly Met Glu Leu Thr Pro
420 425 . 430
Met Asn Thr Ile Ser Leu Lys. Pro Gln Gly. Val Lys. Leu Ala Pro Gln
435 440 445
Ile Leu Glu Glu Ile Cys Gln Lys Asn Asn Trp. Gly Gln Pro. Val. Tyr
450 455 .. 460
Gln Leu His Ser Ala Ile Gly Gln Asp Gln Arg. Gln Leu Phe Leu Tyr,
465. 470 475 480
Lys Val Thr Ile Pro Ala Leu Ala Ser Gln Asn. Pro Ala Ile His. Pro
485 . 490. 495 . .
Phe Thr. Pro Pro. Lys Leu Ser. Ala Tyr. Val Asp. Glu Ala Lys Arg. Tyr
500 505 510
Ala Ala Glu His Thr. Leu Gln Thr Leu Gly Ile Pro Thr. Glu Gly Gly
515 520 525
Asp. Ala Gly Thr Thr Ala. Pro Thr Ala Thr. Ser Ala Thr. Val. Phe Pro
530 535 540.
Gly Tyr Ala Val Pro. Ser Ala Thr Ala Pro. Val Ser Thr Ala Gln Leu . '.
545 550 555 560
Lys Gln Ala Val Thr Leu Gly Gln Asp Leu Ala Ala Tyr Thr Thr Tyr
565. . . 570. 575 .
Glu Val Tyr Pro Thr. Phe Ala Val Thr Thr. Arg Gly. Asp Gly Tyr Gly....
580. 585. 590
Thr. Phe
<210> 22
<211>. 1785
<212> DNA
<213> Rattus norvegicus.
<400> 22 ..
atggaatcaa atcacaaatc. cggggatgga ttgagcggca cccagaagga. agcagcactc 60
cgcgcactgg tccagcgcac. aggatatagc ttggtccagg. aaaatggaca aagaaaatat 120.
ggtggtcctc caccaggctg. ggatactaca cccccagaaa ggggctgcga. gattttcatt 180
gggaaacttc cccgggacct. ttttgaggat. gaactcatac cattgtgtga. aaaaattggt 240
aaaatttatg aaatgagaat gatgatggat ttcaatggga acaacagagg ctatgcattt 300
2 8. .
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
gtaaccttct caaataagca. ggaagccaag aatgcaatca agcaacttaa taattatgaa 360.
attcggaatg gccgtctcct gggcgtctgt gccagtgtgg acaactgccg. gttgtttgtg 420
gggggaatcc ccaaaaccaa aaagagagaa gaaatcttgt cagagatgaa aaaggtcact 480
gaaggagttg ttgatgtcat tgtctaccca agcgctgccg ataaaaccaa aaaccggggg 540
tttgcctttg tggaatatga gagtcaccgc gcagccgcca tggctaggcg gaggctgctg 600 .
ccaggaagaa ttcagttgtg gggacatcct atcgcagtag actgggcaga gccagaagtc 660
gaagttgacg aagacacaat gtcttccgtg aaaatcctgt acgtaaggaa ccttatgctg 720
tctacctcgg. aagagatgat tgagaaggaa ttcaacagta ttaaaccagg tgctgtggaa 780 ..
cgggtgaaga agatccgaga ctatgctttt gtgcatttca gtaaccgaga agatgcagtt 840
gaagccatga, aggctttgaa tggcaaggtg ctggatggtt ccccaataga agtgaccttg 900
gccaagccag tggacaagga cagttacgtt aggtacaccc ggggcaccgg gggcaggaac 960
accatgctgc aagaatacac ctaccctctg agccatgttt atgaccctac cacaacctac 1020
cttggagctc. ctgtcttcta tactccccaa gcctacgcag ccattccaag tcttcatttc 1080 ...
ccagctacca aaggacatct cagcaacaga. gctctcatcc ggaccccttc tgtcagagaa 1140....
atttacatga atgtccctgt aggggctgcg ggcgtgagag gactgggcgg ccgtgggtat. 1200
ttggcatata caggcctggg tcgaggatac caggtcaaag. gagacaagag acaagacaaa. 1260
ctctatgacc ttctgcctgg gatggagctc accccgatga atactatctc tttaaaacca. 1320
caaggagtta aacttgctcc tcagatatta gaagaaatct gtcagaaaaa taactgggga 1380
cagccagtgt accagctgca ctctgccatt ggacaagacc aaagacagtt attcctatac 1440
aaagtaacta tcccagcgct ggccagccag aatcctgcga tccacccttt cacaccccca 1500..
aagctaagcg cctacgtgga tgaagcaaag aggtacgccg. cagagcacac cctacagaca 1560.
ctaggcatcc ccacagaagg aggggacgct gggactacag. cacccactgc cacatccgcc 1620 .
actgtgtttc. caggatacgc tgtccccagt gccaccgctc ctgtgtctac agcccagctc 1680.
aagcaagcag. tgacacttgg acaagactta gcagcatata caacctatga ggtctaccct 1740
acttttgcag. tgaccacccg aggtgatgga tatggcacct tctga . 1785.
<210> 23
<211> 586
<212> PRT ~ ..
<213>. Homo. Sapiens
<400> 23
Met Glu Ser Asn His. Lys. Ser Gly Asp Gly. Leu Ser. Gly Thr Gln Lys..
1 . . 5 . . . 10 15
Glu Ala Ala Leu Arg. Ala. Leu Val Gln Arg Thr Gly. Tyr Ser Leu Val
20. . . 25 30
Gln Glu Asn Gly Gln Arg Lys. Tyr. Gly Gly. Pro. Pro. Pro. Gly Trp. Asp
35. . . 40 45 .
Ala Ala Pro Pro Glu Arg Gly Cys Glu Ile Phe Ile Gly Lys. Leu Pro
0. 5 5. 6 0.
Arg Asp Leu Phe. Glu Asp Glu Leu Ile Pro. Leu Cys. Glu Lys. Ile Gly
65 70. . 75 80
29
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
Lys Ile Tyr Glu Met Arg Met Met Met Asp Phe Asn Gly Asn Asn Arg
85. 90 95
Gly Tyr Ala Phe. Val. Thr. Phe Ser Asn Lys Val Glu Ala Lys Asn Ala ..
100 105 110
Ile Lys Gln Leu Asn Asn Tyr Glu Ile Arg Asn Gly Arg Leu Leu Gly
115 120 125
Val. Cys Ala Ser. Val Asp. Asn Cys Arg. Leu Phe Val Gly. Gly Ile Pro..
130 135 140
Lys Thr Lys Lys Arg. Glu Glu Ile Leu Ser Glu Met Lys Lys. Val Thr.
145 150. . . 155 160. .
Glu Gly. Val Val Asp. Val. Ile Val Tyr Pro. Ser Ala Ala Asp. Lys Thr.....
165 ...... 170 175
Lys Asn Arg Gly. Phe Ala Phe Val. Glu Tyr Glu Ser. His Arg Ala Ala.
180. . 185. 190
Ala Met Ala Arg. Arg Lys Leu Leu Pro Gly Arg Ile. Gln Leu Trp. Gly
195 200 205
His Gly. Ile. Ala Val Asp Trp. Ala Glu Pro. Glu Val Glu Val. Asp Glu
210 215 . 220 . . . .
Asp. Thr. Met Ser Ser. Val. Lys. Ile Leu Tyr Val. Arg Asri Leu Met Leu .
225. . . . 230. . . 235. 240 .
Ser Thr. Ser. Glu Glu Met Ile. Glu Lys Glu Phe Asn Asn Ile. Lys Pro
245 250. . 255.
Gly. Ala Val Glu Arg Val. Lys. Lys Ile Arg Asp. Tyr Ala. Phe Val His.
260 265 . 270
Phe Ser Asn Arg Lys. Asp. Ala Val Glu Ala. Met Lys Ala Leu Asn Gly
275 280 285.....
Lys. Val Leu Asp. Gly. Ser. Pro Ile. Glu Val Thr. Leu Ala Lys. Pro Val.
290. 295 300
Asp Lys Asp. Ser. Tyr Val Arg. Tyr Thr Arg Gly. Thr Gly Gly. Arg. Gly.
305 310 315 . 320.
Thr Met Leu Gln Gly. Glu Tyr. Thr Tyr. Ser. Leu Gly Gln Val Tyr. Asp
325. . . 330 335.
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
Pro Thr Thr Thr Tyr. Leu Gly Ala Pro Val Phe Tyr Ala Pro Gln Thr
340 345 350
Tyr Ala Ala Ile. Pro Ser Leu His Phe Pro Ala Thr Lys Gly His Leu
355 360 365
Ser Asn Arg. Ala Ile Ile Arg. Ala Pro Ser Val Arg Gly. Ala Ala Gly .
370 375. . . . 380.
Val. Arg Gly. Leu Gly Gly. Arg Gly Tyr Leu Ala Tyr Thr Gly. Leu Gly
385. 390 395. . . 400
Arg Gly Tyr Gln Val. Lys Gly. Asp Lys Arg. Glu Asp Lys Leu Tyr Asp
405 410... 415
Ile. Leu Pro Gly Met Glu Leu Thr. Pro. Met Asn Pro Val Thr. Leu Lys
420. 425 430
Pro Gln Gly Ile Lys. Leu Ala. Pro. Gln Ile. Leu Glu Glu Ile Cys Gln
435. . 440 445 .
Lys Asn Asn Trp Gly Gln Pro Val Tyr Gln Leu His Ser. Ala Ile Gly...
450 455. 460
Gln Asp Gln Arg Gln Leu Phe Leu Tyr. Lys. Ile Thr. Ile Pro Ala Leu
465. 470. 475. 480
Ala Ser Gln Asn Pro. Ala Ile His. Pro Phe Thr. Pro Pro Lys Leu Ser
485... 490 495
Ala. Phe Val Asp Glu Ala. Lys Thr Tyr. Ala Ala Glu Tyr Thr Leu Gln
500 505.... 510
Thr Leu Gly Ile Pro. Thr Asp. Gly Gly Asp Gly. Thr Met Ala Thr Ala
515 520.... 525
Ala Ala Ala Ala Thr. Ala Phe Pro Gly Tyr Ala. Val Pro Asn Ala Thr
530 535 540 .
Ala Pro Val Ser. Ala. Ala. Gln Leu Lys. Gln Ala Val. Thr. Leu Gly Gln .
545 550. . . 555 560. .
Asp Leu Ala Ala Tyr. Thr.Thr Tyr Glu Val. Tyr. Pro. Thr Phe Ala Val..
565 . 570 . . 575 . . .
Thr Ala Arg Gly. Asp. Gly Tyr. Gly Thr Phe
580 585. .
31
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
<210> 24
<211> 1761
<212> DNA
<213> Homo Sapiens
<400> 24
atggaatcaa atcacaaatc cggggatgga ttgagcggca ctcagaagga agcagccctc 60
cgcgcactgg tccagcgcac aggatatagc ttggtccagg aaaatggaca aagaaaatat 120
ggtggccctc cacctggttg ggatgctgca ccccctgaaa ggggctgtga aatttttatt 180
ggaaaacttc cccgagacct ttttgaggat gagcttatac cattatgtga. aaaaatcggt 240
aaaatttatg aaatgagaat gatgatggat tttaatggca acaatagagg atatgcattt 300
gtaacatttt caaataaagt ggaagccaag aatgcaatca agcaacttaa taattatgaa 360
attagaaatg ggcgcctctt aggggtttgt gccagtgtgg acaactgccg. attatttgtt 420
gggggcatcc caaaaaccaa aaagagagaa gaaatcttat cggagatgaa.aaaggttact 480
gaaggtgttg tcgatgtcat cgtctaccca agcgctgcag. ataaaaccaa aaaccgaggc. 540
tttgccttcg tggagtatga gagtcatcga gcagctgcca. tggcgaggag. gaaactgcta 600
ccaggaagaa ttcagttatg gggacatggt attgcagtag. actgggcaga gccagaagta 660
gaagttgatg. aagatacaat gtcttcagtg aaaatcctat atgtaagaaa tcttatgctg 720.
tctacctctg aagagatgat tgaaaaggaa ttcaacaata tcaaaccagg tgctgtggag 780
agggtgaaga. aaattcgaga ctatgctttt gtgcacttca gtaaccgaaa agatgcagtt 840
gaggctatga aagctttaaa. tggcaaggtg ctggatggtt cccccattga agtcacccta 900
gcaaaaccag tggacaagga cagttatgtt aggtataccc gaggcacagg tggaaggggc 960
accatgctgc aaggagagta. tacctactct. ttgggccaag. tttatgatcc caccacaacc 1020
taccttggag ctcctgtctt. ctatgccccc. cagacctatg. cagcaattcc cagtcttcat 1080..
ttcccagcca ccaaaggaca tctcagcaac agagccatta. tccgagcccc ttctgttaga 1140....
ggggctgcgg gagtgagagg actgggcggc cgtggctatt tggcatacac aggcctgggt 1200.
cgaggatacc aggtcaaagg agacaaaaga. gaagacaaac tctatgacat.tttacctggg 1260..
atggagctca ccccaatgaa tcctgtcaca ttaaaacccc aaggaattaa.actcgctccc
1320..........
cagatattag aagagatttg tcagaaaaat. aactggggac agccagtgta ccagctgcac.
1380..........
tctgctattg gacaagacca aagacagcta. ttcttgtaca. aaataactat tcctgctcta 1440.
gccagccaga atcctgcaat ccaccctttc. acacctccaa agctgagtgc ctttgtggat 1500
gaagcaaaga cgtatgcagc cgaatacacc ctgcagaccc tgggcatccc. cactgatgga 1560 ....
ggcgatggca ccatggctac tgctgctgct gctgctactg. ctttcccagg. atatgctgtc 1620.
cctaatgcaa ctgcacccgt gtctgcagcc cagctcaagc. aagcggtaac ccttggacaa 1680
.........
gacttagcag catatacaac ctatgaggtc tacccaactt. ttgcagtgac tgcccgaggg 1740...
gatggatatg gcaccttctg a 1761.
<210> 25 ...
<211> 45
<212> DNA
<213> Artificial. Sequence .
<220>
<223> Description of Artificial. Sequence:. oligomer
encoding. TAT protein transduction domain ....
32
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
<400>. 25
catatgggaa gaaaaaaaag aagacaaaga agaagaggcc tcgag ~45
<210> 26
<211> 2274
<212> DNA
<213> Artificial Sequence.
<220>
<223> Description of Artificial Sequence:.
HA-rAPOBEC-CMPK construct
<400> 26
atgggctcta gataccccta cgacgtgccc gactacgccg. atatcagttc. cgagacaggc 60
cctgtagctg ttgatcccac tctgaggaga agaattgagc cccacgagtt. tgaagtcttc 120
tttgaccccc gggaacttcg gaaagagacc tgtctgctgt atgagatcaa. ctggggagga 180
aggcacagca tctggcgaca cacgagccaa aacaccaaca aacacgttga agtcaatttc. 240
atagaaaaat ttactacaga. aagatacttt tgtccaaaca ccagatgctc cattacctgg 300
ttcctgtcct ggagtccctg. tggggagtgc. tccagggcca. ttacagaatt tttgagccga 360
tacccccatg taactctgtt. tatttatata gcacggcttt. atcaccacgc agatcctcga 420.
aatcggcaag gactcaggga ccttattagc agcggtgtta ctatccagat catgacggag 480 .
caagagtctg gctactgctg gaggaatttt gtcaactact ccccttcgaa tgaagctcat 540
tggccaaggt acccccatct gtgggtgagg ctgtacgtac tggaactcta ctgcatcatt 600.
ttaggacttc caccctgttt aaatatttta agaagaaaac. aacctcaact cacgtttttc 660.
acgattgctc ttcaaagctg ccattaccaa aggctaccac cccacatcct gtgggccaca 720
gggttgaaag aattccacgc tgccatggca gacacctttc. tggagcacat gtgccgcctg. 780
gacatcgact. ccgagccaac cattgccaga aacaccggca. tcatctgcac catcggccca 840
gcctcccgct ctgtggacaa. gctgaaggaa atgattaaat ctggaatgaa tgttgcccgc. 900
ctcaacttct cgcacggcac ccacgagtat catgagggca caattaagaa. cgtgcgagag. 960
gccacagaga. gctttgcctc tgacccgatc acctacagac ctgtggctat tgcactggac 1020.
accaagggac ctgaaatccg aactggactc atcaagggaa gtggcacagc agaggtggag 1080 .
ctcaagaagg. gcgcagctct caaagtgacg ctggacaatg. ccttcatgga gaactgcgat 1140
gagaatgtgc tgtgggtgga ctacaagaac ctcatcaaag. ttatagatgt. gggcagcaaa 1200.
atctatgtgg. atgacggtct catttccttg ctggttaagg. agaaaggcaa. ggactttgtc 1260
atgactgagg ttgagaacgg tggcatgctt ggtagtaaga. agggagtgaa. cctcccaggt 1320.
gctgcggtcg acctgcctgc agtctcagag aaggacattc. aggacctgaa. atttggcgtg 1380 .
gagcagaatg tggacatggt gttcgcttcc ttcatccgca. aagctgctga. tgtccatgct 1440
gtcaggaagg tgctagggga. aaagggaaag cacatcaaga ttatcagcaa gattgagaat 1500
cacgagggtg tgcgcaggtt. tgatgagatc atggaggcca. gcgatggcat tatggtggcc 1560 .
cgtggtgacc tgggtattga. gatccctgct gaaaaagtct tcctcgcaca. gaagatgatg 1620
attgggcgct gcaacagggc tggcaaaccc atcatttgtg ccactcagat gttggaaagc. 1680
atgatcaaga aacctcgccc. gacccgcgct gagggcagtg atgttgccaa tgcagttctg 1740.
gatggagcag actgcatcat gctgtctggg gagaccgcca agggagacta cccactggag 1800
gctgtgcgca tgcagcacgc tattgctcgt gaggctgagg ccgcaatgtt ccatcgtcag 1860
cagtttgaag aaatcttacg ccacagtgta caccacaggg. agcctgctga tgccatggca 1920..
gcaggcgcgg tggaggcctc ctttaagtgc ttagcagcag. ctctgatagt tatgaccgag. 1980 .
tctggcaggt ctgcacacct. ggtgtcccgg taccgcccgc. gggctcccat catcgccgtc 2040
33.
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
acccgcaatg accaaacagc acgccaggca cacctgtacc gcggcgtctt. ccccgtgctg 2100
tgcaagcagc cggcccacga tgcctgggca gaggatgtgg atctccgtgt gaacctgggc 2160
atgaatgtcg. gcaaagcccg tggattcttc aagaccgggg acctggtgat cgtgctgacg 2220
ggctggcgcc ccggctccgg ctacaccaac accatgcggg tggtgcccgt gcca 2274
<210> 27
<211> 1590
<212> DNA
<213> Artificial. Sequence
<220>
<223> Description of. Artificial Sequence: HA-CMPK
construct ....
<400>. 27. .
ctcgagatgt acccctacga cgtgcccgac tacgccgata tccacgctgc catggcagac 60..
acctttctgg. agcacatgtg ccgcctggac atcgactccg agccaaccat tgccagaaac 120.
accggcatca tctgcaccat.cggcccagcc tcccgctctg tggacaagct gaaggaaatg. 180
attaaatctg gaatgaatgt. tgcccgcctc aacttctcgc. acggcaccca cgagtatcat 240
gagggcacaa ttaagaacgt, gcgagaggcc acagagagct ttgcctctga cccgatcacc 300
tacagacctg tggctattgc actggacacc aagggacctg. aaatccgaac. tggactcatc 360.
aagggaagtg gcacagcaga ggtggagctc aagaagggcg cagctctcaa agtgacgctg. 420
gacaatgcct tcatggagaa ctgcgatgag aatgtgctgt gggtggacta caagaacctc 480.
atcaaagtta tagatgtggg. cagcaaaatc tatgtggatg acggtctcat ttccttgctg. 540.
gttaaggaga aaggcaagga ctttgtcatg actgaggttg agaacggtgg catgcttggt 600..
agtaagaagg gagtgaacct cccaggtgct gcggtcgacc tgcctgcagt ctcagagaag. 660........
gacattcagg. acctgaaatt tggcgtggag cagaatgtgg. acatggtgtt cgcttccttc. 720
......
atccgcaaag ctgctgatgt.ccatgctgtc aggaaggtgc taggggaaaa. gggaaagcac 780 ..
atcaagatta tcagcaagat tgagaatcac gagggtgtgc gcaggtttga. tgagatcatg 840 ....
gaggccagcg atggcattat ggtggcccgt ggtgacctgg. gtattgagat. ccctgctgaa 900..
aaagtcttcc tcgcacagaa gatgatgatt gggcgctgca. acagggctgg. caaacccatc 960...
atttgtgcca ctcagatgtt ggaaagcatg atcaagaaac ctcgcccgac ccgcgctgag. 1020.
ggcagtgatg ttgccaatgc agttctggat ggagcagact gcatcatgct gtctggggag. 1080
accgccaagg gagactaccc actggaggct gtgcgcatgc agcacgctat tgctcgtgag 1140...
gctgaggccg caatgttcca tcgtcagcag tttgaagaaa tcttacgcca cagtgtacac 1200.
cacagggagc ctgctgatgc catggcagca ggcgcggtgg aggcctcctt taagtgctta. 1260.
gcagcagctc tgatagttat gaccgagtct ggcaggtctg cacacctggt gtcccggtac 1320.....
cgcccgcggg ctcccatcat cgccgtcacc cgcaatgacc aaacagcacg. ccaggcacac 1380
ctgtaccgcg gcgtcttccc cgtgctgtgc aagcagccgg. cccacgatgc ctgggcagag 1440
gatgtggatc tccgtgtgaa cctgggcatg aatgtcggca. aagcccgtgg. attcttcaag 1500
accggggacc tggtgatcgt. gctgacgggc tggcgccccg gctccggcta caccaacacc 1560
atgcgggtgg tgcccgtgcc atgactcgag 1590
<210> 28
<211> 1629
<212> DNA
34
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: TAT-HA-CMPK
construct
<400> 28
catatgggaa gaaaaaaaag aagacaaaga agaagaggcc tcgagatgta cccctacgac. 60 .
gtgcccgact acgccgatat ccacgctgcc atggcagaca cctttctgga gcacatgtgc. 120...
cgcctggaca tcgactccga gccaaccatt gccagaaaca ccggcatcat ctgcaccatc. 180...
ggcccagcct cccgctctgt ggacaagctg aaggaaatga ttaaatctgg aatgaatgtt 240 .
gcccgcctca acttctcgca cggcacccac gagtatcatg agggcacaat taagaacgtg. 300
cgagaggcca cagagagctt tgcctctgac ccgatcacct acagacctgt ggctattgca. 360 ...
ctggacacca agggacctga aatccgaact ggactcatca agggaagtgg cacagcagag. 420 ...
gtggagctca agaagggcgc agctctcaaa gtgacgctgg acaatgcctt catggagaac. 480..
tgcgatgaga atgtgctgtg ggtggactac aagaacctca tcaaagttat agatgtgggc 540 .
agcaaaatct atgtggatga cggtctcatt tccttgctgg ttaaggagaa aggcaaggac 600
tttgtcatga. ctgaggttga gaacggtggc atgcttggta. gtaagaaggg agtgaacctc 660..
ccaggtgctg cggtcgacct gcctgcagtc tcagagaagg acattcagga cctgaaattt 720
ggcgtggagc agaatgtgga catggtgttc gcttccttca tccgcaaagc tgctgatgtc 780
catgctgtca ggaaggtgct aggggaaaag ggaaagcaca tcaagattat cagcaagatt. 840
gagaatcacg agggtgtgcg caggtttgat gagatcatgg aggccagcga. tggcattatg. 900
gtggcccgtg gtgacctggg. tattgagatc cctgctgaaa aagtcttcct cgcacagaag. 960
atgatgattg ggcgctgcaa cagggctggc aaacccatca tttgtgccac tcagatgttg 1020..
gaaagcatga tcaagaaacc tcgcccgacc cgcgctgagg gcagtgatgt tgccaatgca 1080 .
gttctggatg gagcagactg. catcatgctg tctggggaga ccgccaaggg. agactaccca 1140
ctggaggctg tgcgcatgca gcacgctatt gctcgtgagg ctgaggccgc aatgttccat 1200 ..
cgtcagcagt ttgaagaaat cttacgccac agtgtacacc acagggagcc tgctgatgcc 1260
atggcagcag gcgcggtgga ggcctccttt aagtgcttag cagcagctct gatagttatg 1320
accgagtctg gcaggtctgc. acacctggtg. tcccggtacc gcccgcgggc tcccatcatc, 1380 .
gccgtcaccc gcaatgacca, aacagcacgc caggcacacc tgtaccgcgg. cgtcttcccc 1440
gtgctgtgca agcagccggc ccacgatgcc tgggcagagg atgtggatct ccgtgtgaac 1500
ctgggcatga atgtcggcaa agcccgtgga ttcttcaaga ccggggacct ggtgatcgtg 1560
ctgacgggct ggcgccccgg ctccggctac accaacacca tgcgggtggt. gcccgtgcca 1620
tgactcgag 1629
<210> 29....
<211> 23
<212> DNA
<213> Artificial Sequence..
<220>
<223> Description of Artificial. Sequence:.. primer ND1 .
<400> 29
atctgactgg gagagacaag tag 23
3 5.
CA 02439472 2003-08-27
WO 02/068676 PCT/US02/05824
<210> 30
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial. Sequence:.. primer. ND2
<400> 30
gttcttttta agtcctgtgc atc 23
<210> 31 .
<211> 35
<212>. DNA .
<213> Artificial Sequence
<220>
<223> Description of. Artificial Sequence:.. primer. DD3
<400> 31
aatcatgtaa atcataacta tctttaatat actga 35
36
