Note: Descriptions are shown in the official language in which they were submitted.
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
STIMULATION OF OSTEOGENESIS USING RANK LIGAND FUSION
PROTEINS
This invention was made in part with Government support under National
Institutes of Health Grants AR32788, AR46123 and DE05413. The Government has
certain rights in the invention.
This application claims the benefit of U.S. Provisional Applications Ser. Nos.
60/277,855, 60/311,163, 60/329,231, 60/328,876, and 60/329,393, filed March
22,
2001, August 9, 2001, October 12, 2001, October 12, 2001, and October 15,
2001,
respectively, all of which are hereby incorporated herein by reference.
Field of the Invention
The present invention relates to methods for enhancing processes of bone
formation by the administration of effective amounts of oligomeric complexes
of one
or more of RANKL, a RANKL fusion protein, analog, derivative, or mimic or
osteogenic compounds capable of 1 ) enhancing activity of intracellular
proteins in
osteoblasts or osteoblast precursors, wherein said activity is indicative of
bone
formation, or 2) inactivating phosphatases in osteoblasts or osteoblast
precursors,
wherein said inactivation is indicative of bone formation.
The present invention further relates to treating, preventing or inhibiting
bone
loss or reduced bone formation caused by diseases such as osteoporosis. It
further
relates to enhancing fracture repair and promoting bone ingrowth into
orthopedic
implants or sites of bony fusion by facilitating bone formation via
administration of
oligomeric complexes or osteogenic compounds described herein.
The invention further provides compositions for stimulating bone formation.
Background of the Invention
Various conditions and diseases which manifest themselves in bone loss or
thinning are a critical and growing health concern. It has been estimated that
as
many as 30 million Americans and 100 million worldwide are at risk for
osteoporosis
alone. Mundy et al., Science, 286: 1946-1949 (1999). Other conditions known to
involve bone loss include juvenile osteoporosis, osteogenesis imperfecta,
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
2
hypercalcemia, hyperparathyroidism, osteomalacia, osteohalisteresis,
osteolytic
bone disease, osteonecrosis, Paget's disease of bone, bone loss due to
rheumatoid
arthritis, inflammatory arthritis, osteomyelitis, corticosteroid treatment,
metastatic
bone diseases, periodontal bone loss, bone loss due to cancer, age-related
loss of
bone mass, and other forms of osteopenia. Additionally, new bone formation is
needed in many situations, e.g., to facilitate bone repair or replacement for
bone
fractures, bone defects, plastic surgery, dental and other implantations and
in other
such contexts.
Bone is a dense, specialized form of connective tissue. Bone matrix is
formed by osteoblast cells located at or near the surface of existing bone
matrix.
Bone is resorbed (eroded) by another cell type known as the osteoclast (a type
of
macrophage). These cells secrete acids, which dissolve bone minerals, and
hydrolases, which digest its organic components. Thus, bone formation and
remodeling is a dynamic process involving an ongoing interplay between the
~5 creation and erosion activities of osteoblasts and osteoclasts. Alberts, et
al.,
Molecular Biology of the Cell, Garland Publishing, N.Y. (3rd ed. 1994), pp.
1182-
1186.
Present forms of bone loss therapy are primarily anti-resorptive, in that they
inhibit bone resorption processes, rather than enhance bone formation. Among
the
2o agents which have been used or suggested for treatment of osteoporosis
because
of their claimed ability to inhibit bone resorption are estrogen, selective
estrogen
receptor modulators (SERM's), calcium, calcitriol, calcitonin (Sambrook, P. et
al.,
N.EngLJ.Med. 328:1747-1753), alendronate (Saag, K. et al., N.EngLJ.Med.
339:292-
299) and other bisphosphonates. Luckman et al., J. Bone Min. Res. 13, 581
(1998).
25 However, anti-resorptives fail to correct the low bone formation rate
frequently
involved in net bone loss, and may have undesired effects relating to their
impact on
the inhibition of bone resorption/remodeling or other unwanted side effects.
A key development in the field of bone cell biology is the recent discovery
that
RANK ligand (RANKL, also known as osteoprotegerin ligand (OPGL), TNF-related
3o activation induced cytokine (TRANCE), and osteoclast differentiation factor
(ODF)),
expressed on stromal cells, osteoblasts, activated T-lymphocytes and mammary
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
3
epithelium, is the unique molecule essential for differentiation of
macrophages into
osteoclasts. Lacey, et al., Cell 93: 165-176 (1998)(Osteoprotegerin Ligand Is
a
Cytokine that Regulates Osteoclast Differentiation and Activation.) The cell
surface
receptor for RANKL is RANK, Receptor Activator of Nuclear Factor (NF)-kappa B.
RANKL is a type-2 transmembrane protein with an intracellular domain of less
than
about 50 amino acids, a transmembrane domain of about 21 amino acids, and an
extracellular domain of about 240 to 250 amino acids. RANKL exists naturally
in
transmembrane and soluble forms. The deduced amino acid sequence for at least
the murine, rat and human forms of RANKL and variants thereof are known. See
e.g., Anderson, et al., U.S. Pat. No. 6,017,729, Boyle, U.S. Pat. No.
5,843,678, and
Xu J. et al., J. Bone Min. Res. (2000/15:2178) which are incorporated herein
by
reference. RANKL (OPGL) has been identified as a potent inducer of bone
resorption and as a positive regulator of osteoclast development. Lacey et
al.,
supra.
In addition to its role as a factor in osteoclast differentiation and
activation,
RANKL has been reported to induce human dendritic cell (DC) cluster formation.
Anderson et al., supra and mammary epithelium development J.Fata et al., "The
osteoclast differentiation factor osteoprotegerin ligand is essential for
mammary
gland development," Cell, 103:41-50 (2000). However, that RANKL could play a
2o role in anabolic bone formation processes or could be used in methods to
stimulate
osteoblast proliferation or bone nodule mineralization was previously unknown
and
unexpected.
Accordingly, even though much has been discovered about osteoclasts and
their manipulation for therapeutic purposes, not much is known about
osteoblasts
and bone formation. Thus, a need exists, in general, for methods for enhancing
bone formation and preventing or inhibiting bone loss by stimulating anabolic
processes, to a degree greater than coordinate resorption.
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
4
Summay of the Invention
Accordingly, among the objects of the present invention is the provision of
methods and compositions which stimulate osteogenesis, including enhanced
activity of osteoblasts, commitment of osteoblast precursors to the osteoblast
phenotype and in vivo bone matrix deposition. Thus, methods are provided for
enhancing bone formation as well as for treating diseases and conditions of
bone
loss by increasing bone formation, whether or not bone resorption processes
are
otherwise affected.
Briefly, therefore, the present invention is directed toward a method of
enhancing bone formation. The method calls for administering effective amounts
of
1 ) oligomeric complexes of one or more of RANKL, a RANKL fusion protein,
analog,
derivative, or mimic, 2) osteogenic compounds capable of enhancing activity of
intracellular proteins in osteoblasts or osteoblast precursors, wherein said
activity is
indicative of bone formation, or 3) osteogenic compounds capable of
inactivating
~5 phosphatases in osteoblasts or osteoblast precursors, wherein said
inactivation is
indicative of bone formation
Also provided is a method of treating a disease or condition manifested at
least in part by the loss of bone mass. The method comprises administering a
pharmaceutical composition comprising a RANKL fusion protein or an analog,
2o derivative or mimic thereof in an amount effective to promote bone
formation. In
another embodiment, a pharmaceutical composition comprising an osteogenic
compound capable of enhancing activity of intracellular proteins in
osteoblasts or
osteoblast precursors, wherein said activity is indicative of bone formation
may be
used. In a further embodiment, a pharmaceutical composition comprising an
25 osteogenic compound capable of inactivating phosphatases in osteoblasts or
osteoblast precursors, wherein said inactivation is indicative of bone
formation may
be employed. The loss of bone mass is thereby prevented, inhibited or
counteracted.
In another aspect, applicants have provided a composition for stimulating
so bone formation. The composition includes an effective amount of a RANKL
fusion
protein, oligomeric complex, or an analog, derivative or mimic thereof in a
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
pharmaceutically acceptable carrier or excipient. Further provided are
compositions
which include effective amounts of osteogenic compounds in pharmaceutically
acceptable carriers or excipients, wherein said osteogenic compounds are
capable
of 1 ) enhancing activity of intracellular proteins in osteoblasts or
osteoblast
5 precursors, wherein said activity is indicative of bone formation, or 2)
inactivating
phosphatases in osteoblasts or osteoblast precursors, wherein said
inactivation is
indicative of bone formation.
In one embodiment, intracelllular proteins are selected from IKB-a and IKB-
Vii.
In a preferred embodiment, the intracellular proteins exhibiting prolonged
activity
comprise intracellular kinases, and more preferably such kinases are ERK1/2,
IKK,
P13 kinase, Akt, JNK, and p38. In a more preferred embodiment, the kinases are
ERK1/2.
In another preferred embodiment, the activity of one or more intracellular
proteins constitutes phosphorylation of said protein(s). Specifically, the
~5 phosphorylated proteins include ERK1/2, IKK, P13 kinase, Akt, JNK, and p38.
More
preferably, the phosphorylated kinases are ERK1/2.
In another aspect, the activity of one or more intracellular proteins can be
detected for at least about 15-30 minutes following the incubation of the
osteogenic
compound with osteoblasts or osteoblast precursors. Preferably, the activity
can be
2o detected for 40 minutes, and more preferably it can be detected for at
least 60
minutes following said incubation.
In another embodiment, osteogenic compounds capable of inactivating one or
more phosphatases in osteoblasts or osteoblast precursors, wherein said
inactivation is indicative of bone formation may be used in the methods and
25 compositions of the present invention. Preferably, said phosphatase is
selected from
the group consisting of ERK1-, ERK2-, IKK-, P13 kinase-, Akt-, JNK-, and p38-
specific phosphatases, and more preferably the phosphatese is specific for
ERK1/2.
In another preferred embodiment, inactivation comprises phosphorylation of a
phosphatase.
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
6
The preferred oligomeric complexes used in the methods and compositions
described herein include oligomeric complexes of GST-RANKL, AP-RANKL, leucine
zipper-RANKL, and RANKL derivative comprising the "flap" domain of TALL-1.
Other objects and features will be in part apparent and in part pointed out
hereinafter.
Brief Description of Fictures
FIG. 1 is the structure and sequence of the RANKL murine cDNA and protein
used to produce the GST-RANKL fusion proteins discussed in Examples 1 and 25
below.
FIG. 2 depicts a size-exclusion chromatograph of the GST-RANKL fusion
protein under conditions replicating the physiological milieu. See Example 1.
FIG. 3 is a histological presentation of GST-RANKL stimulation of bone
formation ex vivo in whole calvarial organ culture, as discussed in Example 2.
Arrows mark parietal bone thickness.
FIG. 4 is a graphic depiction of the dose-dependent increase in calvarial
thickness due to GST-RANKL stimulation of bone formation in vitro, as
discussed in
Example 2. White bars indicate 1 dose exposure, whereas black bars indicate 2
2o dose exposure to GST-RANKL.
FIG. 5(a) is a histological presentation of GST-RANKL stimulation of bone
formation in vivo in mice, shown at low power magnification, as discussed in
Example 3.
FIG. 5(b) is a histological presentation of GST-RANKL stimulation of bone
formation in vivo in mice, shown at high power magnification, as discussed in
Example 3.
FIG. 5(c) depicts a dual-energy X-ray absorptiometry (DEXA) analysis of tibial
metaphyses comparing bone mineral density of animals administered GST-RANKL
or control vehicle in vivo, as discussed in Example 3. Scale bar = 1 mm.
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
7
FIG. 6 is a histological presentation of a mouse tibia at high magnification,
demonstrating in vivo activation of osteoblasts in animals administered GST-
RANKL
as discussed in Example 4. Arrow in the left panel indicates activated
osteoblasts,
whereas the arrow in the right panel indicates flat bone lining cells.
s FIG. 7 is a graphical depiction of the impact of controlled administration
of
GST-RANKL to animals, illustrating the number of osteoclasts and activated
osteoblasts, as discussed in Example 5. White bars indicate osteoclast
numbers,
whereas black bars indicate numbers of activated osteoblasts.
FIG. 8 is a histological presentation of GST-RANKL stimulation of mineralized
bone nodule formation in marrow cells cultured ex vivo, as discussed in
Example 6.
Red histochemical reaction product represents mineralizing colony forming
units of
osteoblasts.
FIG. 9 is a depiction of an in vivo double fluorochrome label incorporation
into
mineralizing bone, as discussed in Example 4. MAR represents mineral
apposition,
~5 BFR indicates bone formation, and (ex) and (en) indicate exocranial and
endocranial
surfaces of calvaria, respectively.
FIG. 10 is an image of a Western blot depicting the rapid activation of the
members of the MAPK pathway in murine osteoclast precursors following the
treatment of cells with GST-RANKL. The activity was measured at the time of
GST-
2o RANKL/RANK interaction (0 minutes) and 5, 15, and 30 minutes following the
interaction. From the top, the second, fourth, and sixth panels show the total
levels
of JNK, p38, and ERK respectively. The first, third, and fifth panels depict
the
phosphorylated (activated) forms of JNK, p38, and ERK respectively.
FIG. 11 is an image of a Western blot depicting the activity of Akt in murine
25 osteoclast precursors following the treatment of cells with GST-RANKL. The
activation was monitored at the time of GST-RANKL/RANK interaction, and 5 and
15
minutes following the interaction. The bottom panel depicts the levels of
total Akt at
specified time points, whereas the top panel depicts the phosphorylated forms
of
Akt.
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
8
FIG. 12 is an image of a Western blot depicting the prolonged activity of the
kinases in MAPK pathway in murine osteoblasts following the GST-RANKL
treatment of cells compared to the treatment with RANKL alone. The time points
for
which the phosphorylation was measured included 0 minutes (time of GST-RANKL
or RANKL stimulation of cells), and 5, 10, 20, 30, and 60 minutes after GST-
RANKL/RANK or RANKL/RANK binding occurred. The kinases whose activity was
measured included ERK, JNK, p38, and Akt. pERK designates phosphorylated
ERK, ERK designates the total amount of the same protein, pJNK designates
phosphorylated JNK, JNK designates the total amount of JNK, pp38 designates
phosphorylated p38, p38 designates the total amount of p38, pAkt designates
phosphorylated Akt, and Akt designates the total amount of the same protein.
The
first panel from the top is p-IkBa, which designates phosphorylated IkBa,
whereas
IkBa designates the total amount of the same protein.
FIG. 13 is an image of a Western blot depicting the prolonged activity of
~5 ERK1/2 in murine osteoblast precursors following the treatment of cells
with GST-
RANKL. The time points at which ERK1/2 activity was measured include 0, 5, 10,
20, 30, and 60 minutes following GST-RANKL/RANK interaction. pERK designates
phosphorylated ERK whereas ERK designates the total amount of the same
protein.
FIG. 14 is a graphic presentation of alkaline phosphatase (AP) activity
2o following GST-RANKL exposure.
FIG. 15 depicts GST-RANKL as oligomeric complexes, whereas cleaved
RANKL (GST removed) does not exist in oligmeric forms. (a) shows that cleaved
RANKL migrates as a single trimeric species (1 n), while GST-RANKL exists as a
polydisperse mixture of non-covalently associated mono-trimeric (1 n) and
oligomeric
25 (2-100n) units under dynamic equlibrium. (b) depicts possible oligomeric
structures.
FIG. 16 consists of confocal microscopy images showing that cleaved
RANKL/RANK complexes are rapidly internalized, whereas GST-RANKL/RANK
complexes remain on the cell surface for at least one hour. On the merged
images,
colocalization of RANK (green fluorescence) and cell surface (red
fluorescence)
3o appears yellow.
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
9
FIG. 17 is an image of an agarose gel depicting the expression of Type I
collagen in response to GST-RANKL treatment. "+" indicates the treatment of
primary osteoblasts with GST-RANKL, whereas "-" indicates the lack of such
treatment. Osteoblasts were exposed to GST-RANKL for 1, 2, 4, or 6-hour
exposures at the beginning of each successive 48-hour treatment window. All
culltures harvested between 8-48 hours were exposed to GST-RANKL for 6 hours.
a-actin expression is used as a control for the experiment.
FIG. 18 is an image of an agarose gel depicting the expression of Cbfa1 in
the marrow of mice treated with GST-RANKL or GST alone (marked as "control").
The bottom panel is the experiment control, depicting the expression of HPRT
(hypoxanthine phosphoribosyl transferase).
FIG. 19 is a graphic representation of osteoblast proliferation as measured by
BrdU (5-bromo-2'-deoxyuridine) incorporation in response to GST-RANKL
treatment.
FIG. 20(a) is an image of a Western blot showing that osteoblasts transduced
with dominant-negative ERK fail to phosphorylate an ERK substrate, known as
RSK.
DN-ERK represents dominant-negative ERK. LacZ represents (3-galactosidase.
FIG. 20(b) is an image of an agarose gel showing that osteoblasts transduced
with dominant-negative ERK fail to upregulate the expression of type I
collagen in
2o response to GST-RANKL.
Abbreviations and Definitions
To facilitate understanding of the invention, a number of terms are defined
below:
"MAP kinase" or "MAPK" are used interchangeably herein, and are
abbreviations for mitogen activated protein kinase.
"ERK1/2" refers to ERK1 and ERK2, which are abbreviations for extracellular
signal-regulated kinase 1 and extracellular signal-regulated kinase 2,
respectively.
JNK is an abbreviation for c-iun N-terminal kinase.
3o p38 is a kinase of 38 kDa, which is a member of the MAPK family of kinases.
Akt is Akt serine threonine kinase.
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
"IKB" is an abbreviation for IkappaB protein. Thus, IKB-a is IkappaB a and
IKB-~i is IkappaB Vii.
"IKK" is an abbreviation for IkappaB (IKB) kinase.
"RSK" is an abbreviation for p90 ribosomal S6 protein kinase.
5 "RANKL" or "RANK ligand" are used interchangeably herein to indicate a
ligand for RANK (Receptor Activator of NFKB).
"AP" is an abbreviation for alkaline phosphatase.
"GST" is an abbreviation for glutathione-s-transferase.
"HPRT" is an abrreviation for hypoxanthine phosphoribosyl transferase.
10 "Cbfa1" is an abbreviation for core binding factor 1.
"LacZ" is an abbreviation for ~3-galactosidase.
"Osteogenic potential" or "osteogenic activity" are used interchangeably
herein to refer to any compound that is able to enhance bone formation, as
determined from bone formation assays.
"BrdU" is an abbreviation for 5-bromo-2'-deoxyuridine.
"TALL-1" is an abbreviation for a protein "TNF-and APOL-related leukocyte
expressed ligand 1 ".
By the term "an effective amount" is meant an amount of the substance in
question which produces a statistically significant effect. For example, an
"effective
2o amount" for therapeutic uses is the amount of the composition comprising an
active
compound herein required to provide a clinically significant increase in
healing rates
in fracture repair; reversal or inhibition of bone loss in osteoporosis;
prevention or
delay of onset of osteoporosis; stimulation and/or augmentation of bone
formation in
fracture non-unions and distraction osteogenesis; increase and/or acceleration
of
bone growth into prosthetic devices; repair or prevention of dental defects;
or
treatment or inhibition of other bone loss conditions, diseases or defects,
including
but not limited to those discussed herein above. Such effective amounts will
be
determined using routine optimization techniques and are dependent on the
particular condition to be treated, the condition of the patient, the route of
3o administration, the formulation, and the judgment of the practitioner and
other
factors evident to those skilled in the art. The dosage required for the
compounds of
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
11
the invention (for example, in osteoporosis where an increase in bone
formation is
desired) is manifested as that which induces a statistically significant
difference in
bone mass between treatment and control groups. This difference in bone mass
may be seen, for example, as at least 1-2%, or any clinically significant
increase in
bone mass in the treatment group. Other measurements of clinically significant
increases in healing may include, for example, an assay for the N-terminal
propeptide of Type I collagen, tests for breaking strength and tension,
breaking
strength and torsion, 4-point bending, increased connectivity in bone biopsies
and
other biomechanical tests well known to those skilled in the art. General
guidance
1o for treatment regimens is obtained from the experiments carried out in
animal
models of the disease of interest.
As used herein, "treatment" includes both prophylaxis and therapy. Thus, in
treating a subject, the compounds of the invention may be administered to a
subject
already suffering from loss of bone mass or to prevent or inhibit the
occurrence of
15 such condition.
Detailed Description of the Invention
In accordance with the present invention, applicants have discovered that
oligomeric complexes of RANKL fusion proteins, particularly oligomers of GST-
20 RANKL, or variants, analogs, derivatives and mimics thereof, can be
administered
in an amount and manner such that they stimulate a net increase in the numbers
of
activated osteoblasts and enhance the anabolic processes of bone formation.
Such
discovery provides the basis for methods useful to facilitate bone replacement
or
repair, as well as for treating diseases or conditions involving loss of bone
mass by
25 stimulating anabolic processes of bone formation.
The following detailed description is provided to aid those skilled in the art
in
practicing the present invention. Everi so, this detailed description should
not be
construed to unduly limit the present invention as modifications and
variations in the
embodiments discussed herein can be made by those of ordinary skill in the art
3o without departing from the spirit or scope of the present inventive
discovery.
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
12
All publications, patents, patent applications, databases and other references
cited in this application are herein incorporated by reference in their
entirety as if
each individual publication, patent, patent application, database or other
reference
were specifically and individually indicated to be incorporated by reference.
The selection and/or synthesis of RANKL, its fragments, variants, analogs,
mimics, fusion products and oligomeric complexes of such compounds, wherein
said
oligomeric complexes are capable of promoting bone formation as taught herein,
are
within the ability of a person of ordinary skill in the art and are
contemplated as
being within the scope of this invention. For example, Boyle, supra, provides
a
1o detailed discussion of the synthesis of various forms of RANKL therein
(called
"osteoprotegerin binding protein"), and discloses, e.g., murine and human
variants,
recombinant forms of RANKL, RANKL fragments, analogs, mimics and derivatives
of RANKL, and fusion-proteins thereof. Also included within the scope of the
invention are derivatives or analogs of RANKL which have been modified post-
translationally (such as glycosylated proteins), as well as polypeptides which
are
encoded by nucleic acids shown to hybridize to part or all of the polypeptide
coding
regions of RANKL cDNA under conditions of high stringency. See, e.g., Boyle
and
Anderson, et al., supra. The murine RANKL nucleic acid and amino acid
sequences
are provided herein as SEQ ID NO. 1 and SEQ ID NO. 2, respectively (see Fig.
1).
2o However, RANKL sequences from other species have been identified and are
available at http://www.ncbi.nlm.nih.gov/. Human RANKL nucleic acid and amino
acid sequences have, for instance, the following accession numbers: AF019047
and
AAB86811. Rat RANKL nucleic acid and amino acid sequences have, for example,
these accession numbers: NM 057149 and NP 476490. Accordingly, any of the
RANKL molecules may be used in the methods of the present invention, and are
thus contemplated within the scope of the present invention.
RANKL and related molecules can be synthesized by using nucleic acid
molecules which encode the peptides of this invention in an appropriate
expression
vector which include the encoding nucleotide sequences using procedures well
3o known in the art. Such DNA molecules may be prepared, and subsequently
analyzed, e.g., using automated DNA sequencing and the well-known codon-amino
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
13
acid relationship of the genetic code. Such a DNA molecule also may be
obtained
as genomic DNA or as cDNA using oligonucleotide probes and conventional
hybridization methodologies. Such DNA molecules may be incorporated into
expression vectors, including plasmids, which are adapted for the expression
of the
DNA and production of the polypeptide in a suitable host such as bacterium,
e.g.,
Escherichia coli, yeast cell, insect cell or mammalian cell. See, e.g.,
Examples 1 and
25. Methods for the production of such recombinant proteins, including fusion
proteins, are well known in the art and can be found in standard molecular
biology
references such as Sambrook et al., Molecular Cloning, 2nd ed., Cold Spring
1o Harbor Laboratory Press, 1989 and Ausubel et al., Current Protocols in
Molecular
Biology, 3rd ed., Wiley and Sons, 1995, and updates, incorporated herein by
reference.
It is further known that certain modifications can be made without completely
abolishing the polypeptide's activity. Modifications include the removal,
substitution
and addition of amino acids. Polypeptides containing other modifications can
be
synthesized by one skilled in the art. Thus, the effectiveness of the
polypeptides
can be modulated through various changes in the amino acid sequence or
structure.
Further, it should be understood that the aforementioned analogs or mimics
may be modified using methods known in the art to improve features such as
2o solubility, safety, or efficacy. A necessary characteristic of these
preferred
compounds is the capability to stimulate bone formation when employed
according
to applicants' methods described herein.
Applicants have discovered that administration of oligomers of GST-RANKL
results in enhanced anabolic processes of bone formation. As shown in Example
1
and FIG. 2, size exclusion chromatography indicates that RANKL fusion proteins
are
capable of existing as oligomeric complexes under physiologic conditions.
Oligomers of GST-RANKL are believed to be formed as a result of RANKL's and
GST's tendencies to trimerize and dimerize, respectively. Accordingly, other
fusion
partners besides GST may be used to form oligomeric complexes comprising
3o RANKL. Preferred fusion partners include alkaline phosphatase and leucine
zippers, however any other proteins with a tendency to form oligomeric
structures
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
14
are contemplated within the scope of the present invention. In a preferred
embodiment, RANKL fusion partners are added to the N-terminal of RANKL.
Formation of GST-RANKL used to form oligomeric complexes is described in
Examples 1 and 25. Furthermore, it is within the skill of the art to generate
other
forms of RANKL oligomers by well known techniques. For example, one could
construct RANKL oligomers using alternative proteins or polypeptides that have
an
intrinsic tendency to self-associate and/or form higher-order complexes. One
could
also create such oligomers by chemical modification or by synthesizing a
polymeric
form of RANKL in which many copies are linked together, e.g., similar to a
chain of
1o pearls. Such alternative embodiments are also within the scope of this
invention.
Alkaline phosphatase (AP), like GST, has a tendency to dimerize. APs form
a large family of enzymes that are common to all organisms. Humans possess
four
isoforms of AP, three of which are tissue-specific and one which is non-
specific and
can be found in bone, liver, and kidney. The three tissue-specific APs
include:
~ 5 placental AP (PLAP), germ cell AP (GCAP), and intestinal AP. The
construction of
an amino-terminal AP-RANKL may be performed similarly to the construction of
GST-RANKL fusion protein. Examples of alkaline phosphatases that may be used
include but are not limited to human placental AP-1, human placental AP-2,
human
placental AP precursor, mouse secreted AP, mouse embryonic AP precursor, and
2o mouse embryonic AP with the corresponding accession numbers: AAA51710,
AAA51707, AAC97139, AAL17657, P24823, and AAA37531. In one preferred
embodiment, human placental alkaline phosphatase is employed, however other
APs, isolated either from humans or from other mammalian species such as Mus
musculus may be used. The use of many different alkaline phosphatases is
25 believed to be feasible due to the ability of all APs to dimerize. Briefly,
a cDNA
encoding a desired isoform of AP can be isolated from a cDNA library and
spliced
upstream (at amino terminal) of a RANKL cDNA in a suitable expression vector,
such as, e.g., pcDNA 3.1, using appropriate restriction endonucleases, such
that
the resulting DNA sequence is in frame, with no intervening stop codons. The
so expression vector, comprising the nucleotide sequence encoding AP-RANKL can
then be introduced into host cells of choice by any of several trasfection or
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
transduction techniques known in the art. See also Example 17.
Alternatively, a RANKL fusion protein may comprise a peptide with the ability
to oligomerize, such as a leucine zipper domain. Leucine zippers were
originally
identified in several DNA-binding proteins (Landschulz et al., Science
240:1759,
5 1988). Leucine zipper domain is a term used to refer to a conserved peptide
domain
present in these (and other) proteins, which is responsible for dimerization
of the
proteins. The leucine zipper domain comprises a repetitive heptad repeat, with
four
or five leucine residues interspersed with other amino acids. Examples of
leucine
zipper domains are those found in the yeast transcription factor GCN4 and a
1o heat-stable DNA-binding protein found in rat liver (C/EBP; Landschulz et
al., Science
243:1681, 1989).
Leucine zipper domains are known to fold as short, parallel coiled coils.
(O'Shea et al., Science 254:539; 1991 ) The general architecture of the
parallel
coiled coil has been well characterized, with a "knobs-into-holes" packing as
15 proposed by Crick in 1953 (Acta Crystallogr.~6:689). The dimer formed by a
leucine
zipper domain is stabilized by the heptad repeat, designated (abcdefg)~
according to
the notation of McLachlan and Stewart (J. Mol. Biol. 98:293; 1975), in which
residues a and d are generally hydrophobic residues, with d being a leucine,
which
line up on the same face of a helix. Oppositely-charged residues commonly
occur at
2o positions g and e. Thus, in a parallel coiled coil formed from two helical
leucine
zipper domains, the "knobs" formed by the hydrophobic side chains of the first
helix
are packed into the "holes" formed between the side chains of the second
helix.
Several studies have indicated that conservative amino acids may be
substituted for individual leucine residues with minimal decrease in the
ability to
dimerize; multiple changes, however, usually result in loss of this ability
(Landschulz
et al., Science 243:1681, 1989; Turner and Tjian, Science 243:1689, 1989; Hu
et al.,
Science 250:1400, 1990). van Heekeren et al. reported that a number of
different
amino residues can be substituted for the leucine residues in the leucine
zipper
domain of GCN4, and further found that some GCN4 proteins containing two
leucine
3o substitutions were weakly active (Nucl. Acids Res. 20:3721, 1992).
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
16
Amino acid substitutions in the a and d residues of a synthetic peptide
representing the GCN4 leucine zipper domain have been found to change the
oligomerization properties of the leucine zipper domain (Alber, Sixth
Symposium of
the Protein Society, San Diego, Calif.). When all residues at position a are
changed
to isoleucine, the leucine zipper still forms a parallel dimer. When, in
addition to this
change, all leucine residues at position d are also changed to isoleucine, the
resultant peptide spontaneously forms a trimeric parallel coiled coil in
solution.
Substituting all amino acids at position d with isoleucine and at position a
with
leucine results in a peptide that tetramerizes. Peptides containing these
substitutions
1o are still referred to as leucine zipper domains. However, it should be
pointed out
that in a preferred embodiment leucine zippers capable of dimerizing proteins
are
used as RANKL fusion partners. Construction of a fusion RANKL-leucine zipper
fusion protein may be performed in a similar manner as for GST-RANKL and AP-
RANKL. See Example 18. In addition to bacteria, other suitable expression
15 systems such as mammalian cells and insect cells may be used. One of
ordinary
skill in the art can easily make necessary adjustments in order to express a
leucine
zipper-RANKL fusion protein.
In an alternative embodiment, a RANKL derivative may be used to form
oligomeric complexes. It has recently been discovered that a newly found TNF
20 ligand family member TALL-1 (also known as BAFF, THANK, BLyS, and zTNF4)
possesses the ability to oligomerize under physiological conditions (Liu et
al., Cell,
108:383-394, 2002). Liu et al. have shown that the "flap" region, named so due
to
the length of the loop that forms the flap and allows it to extend from the
molecule,
mediates trimer-trimer ineractions and subsequent cluster formation. This flap
25 region is unique to TALL-1 among TNF family members and is created by a
surface
DE loop (the loop that connects the strands D and E of TALL-1 ) that is longer
than
any DE loop of other TNF family proteins, which have been discovered so far.
The
oligmerization is thought to occur through a noncovalent interaction of the
long DE
loop with surrounding TALL-1 molecules, thereby resulting in the formation of
large
3o clusters. Since RANKL and TALL-1 are both TNF ligand family members and
possess similar ~i-strand core structure, in accordance with the invention,
RANKL is
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
17
mutated to create a mutant RANKL molecule that oligomerizes spontaneously at
physiological conditions. In one embodiment, modification of RANKL is designed
so
that its DE loop (amino acids 245-249 containing the amino acid sequence
SIKIP) is
substituted with the DE loop of TALL-1 (amino acid sequence KVHVFGDEL). See
Example 19. To further recapitulate the oligomerization domains of TALL-1, the
following amino acid changes may be made throughout the RANKL molecule:
168T~1, 187Y~L, 194K~F, 212F~Y, 252H~V, 279F~1, and 2838~E. See Example
20. The mutations can be introduced into RANKL by PCR-driven site-directed
mutagenesis, using, for example, the QuickChange Multi-Site Directed
Mutagenesis
1o Kit (available from Stratagene). To determine the oligomerization potential
of such
modified RANKL molecule, one can use the same assays as for testing GST-
RANKL, such as size-exclusion chromatography. One of ordinary skill in the art
can
make said mutations and test the structure and function of the mutated RANKL
without undue experimentation.
In vitro or in vivo assays can be used to determine the efficacy of oligomeric
RANKL complexes of the present invention in promoting bone formation in human
and animal patients as taught by applicants. For in vitro binding assays,
osteoblast-
like cells can be used. Suitable osteoblast-like cells include, but are not
limited to,
primary marrow stromal cells, primary osteoblasts, ST-2 cells, C1 cells, ROS
cells,
2o and MC3T3-E1 cells. Many of the cell lines are available from American Type
Culture Collection, Rockville, Md., and can be maintained in standard
specified
growth media. For in vitro functional assays, oligomeric complexes can be
tested by
culturing the cells with a range of concentrations of compounds and assessing
markers or indicia of bone formation such as osteoblast activation, bone
matrix
deposition, calvarial thickness and bone nodule formation. See Example 2
below. In
addition, osteoblast proliferation, expression of Collagen type I and/or
expression of
Cbfa1 may be used to assess bone formation. See Example 14 below.
Furthermore, a general protocol for treatment of osteoblasts with a compound
is well established in the art. See, for instance, Wyatt et al., BMC Cell
Biology, 2:14,
2001. A cell line of choice in this article was MC3T3-E1, which has been used
as an
in vitro model of osteoblastic differentiation and maturation. The treatment
of cells,
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
18
in this case with BMP-2, was performed in the following manner. The cells were
plated at 5000/cm2 in plastic 25 cm2 culture flasks in a-MEM supplemented with
5%
fetal bovine serum, 26 mM NaHC03, 2 mM glutamine, 100 u/ml penicillin, and 100
pg/ml streptomycin, and grown in humidified 5% C02/95% air at 37°C.
Cells were
passaged every 3-4 days after releasing with 0.002% pronase E in PBS. The
cells in
treatment groups were grown for 24 hours, then incubated with BMP-2 (50 ng/ml)
dissolved in PBS containing 4 mM HCI and 0.1 % bovine serum albumin (BSA) at
37°C for 24 and 48 hours. Control groups received equal volumes of
vehicles only.
Exemplary conditions for treatment of osteoblast cells or precursors with
oligomers, such as GST-RANKL, are described below. Osteoblast precursor cells
are incubated in the presence of vehicle, GST (a negative control), or
increasing
concentrations of purified oligomeric GST-RANKL (e.g. concentrations ranging
from
1 ng/ml to 100ng/ml). Bone morphogenetic protein (BMP)-2 is administered as a
positive control. Test compositions are administered for a period of 12 hours
only at
the initiation of the culture or once at initiation and once three days later,
again for a
duration of 12 hours. It is to be noted that the conditions used will vary
according to
the cell lines and compound used, their respective amounts, and additional
factors
such as plating conditions and media composition. Such adjustments are readily
determined by one skilled in this art.
2o Additionally, oligomeric RANKL compositions which enhance bone formation
according to applicants methods may be evaluated in various animal models. See
Examples 3-6 and descriptions below.
A commonly used assay is a neonatal mouse calvaria assay. Briefly, four
days after birth, the front and parietal bones of ICR Swiss white mouse pups
are
removed by microdissection and split along the sagittal suture. The bones are
then
incubated in a specified medium, wherein the medium contains either test or
control
compounds. Following the incubation, the bones are removed from the media, and
fixed in 10% buffered formalin for 24-48 hours, decalcified in 14% EDTA for 1
week,
processed through graded alcohols, and embedded in paraffin wax. Three micron
3o sections of the calvaria are prepared and assessed using histomorphometric
analysis of bone formation or bone resorption. Bone changes are measured on
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
19
sections cut 200 microns apart. Osteoblasts and osteoclasts are identified by
their
distinctive morphology.
In addition to this assay, the effect of compounds on murine calvarial bone
growth can also be tested in vivo. In one such example of this screening
assay,
male ICR Swiss white mice, aged 4-6 weeks are employed, using 4-5 mice per
group. Briefly, the test compound or the appropriate control is injected into
subcutaneous tissue over the right calvaria of normal mice. The mice are
sacrificed
on day 14, and bone growth is measured by histomorphometric means. Bone
samples are cleaned from adjacent tissues and fixed in 10% buffered formalin
for
24-48 hours, decalcified in 14% EDTA for 1-3 weeks, processed through graded
alcohols, and embedded in paraffin wax. Three to five micron sections of the
calvaria are prepared, and representative sections are selected for
histomorphometric assessment of the effects of bone formation and bone
resorption.
Sections are measured by using a camera lucida attachment to trace directly
the
microscopic image onto a digitizing plate. Bone changes are measured on
sections
cut 200 microns apart, over 4 adjacent 1X1 mm fields on both the injected and
noninjected sides of calvaria. New bone is identified by its characteristic
tinctorial
features, and osteoclasts and osteoblasts are identified by their distinctive
morphology. Histomorphometry software (OsteoMeasure, Osteometrix, Inc.,
2o Atlanta) can be used to process digitized input to determine cell counts
and measure
areas or perimeters.
Additional in vivo assays include dosing assays in intact animals, and dosing
assays in acute ovariectomized (OVX) animals (prevention model), and assays in
chronic OVX animals (treatment model). Prototypical dosing in intact animals
may
be accomplished by, for example, subcutaneous, intraperitoneal,
transepithelial, or
intravenous administration, and may be performed by injection, or other
delivery
techniques. The time period for administration of test compound may vary (for
instance, 28 days as well as 35 days may be appropriate). As an example, in
vivo
transepithelial or subcutaneous dosing assays may be performed as described
3o below.
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
In a typical study, 70 three-month-old female Sprague-Dawley rats are
weight-matched and divided into seven groups, with ten animals in each group.
This
includes a baseline control group of animals sacrificed at the initiation of
the study; a
control group administered vehicle only; a PBS-treated control group; and a
positive
5 group administered a compound known to promote bone growth. Three dosage
levels of the test compound are administered to the remaining groups. Test
compound, PBS, and vehicle are administered subcutaneously once per day for 35
days. All animals are injected calcein nine days and two days before sacrifice
(to
ensure proper labeling of newly formed bone). Weekly body weights are
determined. At the end of 35 days, the animals are weighed and bled by orbital
or
cardiac puncture. Serum calcium, phosphate, osteocalcin, and CBCs are
determined. Both leg bones (femur and tibia) and lumbar vertabrae are removed,
cleaned of adhering soft tissue, and stored in 70% ethanol or 10% formalin for
evaluation, as performed by peripheral quantitative computed tomography (pQCT;
15 Ferretti, J, Bone, 17: 353S-364S, 1995), dual energy X-ray absorptiometry
(DEXA;
Laval-Jeantet A. et al., Calcif Tissue Intl, 56:14-18, 1995, and Casez J. et
al., Bone
and Mineral, 26:61-68, 1994) and/or histomorphometry. The effect of test
compounds on bone remodeling can thus be evaluated.
Test compounds can also be assayed in acute ovariectomized animals. Such
2o assays may also include an estrogen-treated group as a control. An example
of the
test in these animals is briefly described below.
In a typical study, 80 three-month-old female Sprague-Dawley rats are
weight-matched and divided into eight groups, with ten animals in each group.
This
includes a baseline control group of animals sacrificed at the initiation of
the study;
three control groups (sham OVX and vehicle only, OVX and vehicle only, and OVX
and PBS only); and a control OVX group that is administered a compound known
to
enhance bone mass. Three dosage levels of the test compound are administered
to
remaining groups of OVX animals.
Since ovariectomy induces hyperphagia, all OVX animals are pair-fed with
3o sham OVX animals throughout the 35 day study. Test compound, positive
control
compound, PBS or vehicle alone is administered transepithelially or
subcutaneously
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
21
once per day for 35 days. As an alternative, test compounds can be formulated
in
implantable pellets that are implanted for 35 days, or may be administered
transepithelially, such as by nasal administration. All animals are injected
with
calcein at intervals determined empirically, including but not limited to nine
days and
two days before sacrifice. Weekly body weights are determined. At the end of
the
35-day cycle, the animals blood and tissues are processed as described above.
Test compounds may also be assayed in chronic OVX animals. Briefly, 80 to
100 six month old female, Sprague-Dawley rats are subjected to sham surgery
(sham OVX), or ovariectomy (OVX) at the beginning of the experiment, and 10
1o animals are sacrificed at the same time to serve as baseline controls. Body
weights
are monitored weekly. After approximately six weeks or more of bone depletion,
10
sham OVX and 10 OVX rats are randomly selected for sacrifice as depletion
period
controls. Of the remaining animals, 10 sham OVX and 10 OVX rats are used as
placebo-treated controls. The remaining animals are treated with 3 toy doses
of test
compound for a period of 35 days. As a positive control, a group of OVX rats
can be
treated with a known anabolic agent in this model, such as PTH (Kimmel et al.,
Endocrinology, 132: 1577-1584, 1993). At the end of the experiment, the
animals
are sacrificed and femurs, tibiae, and lumbar vertebrae1 to 4 are excised and
collected. The proximal left and right tibiae are used for pQCT measurements,
2o cancellous bone mineral density (BMD), and histology, while the midshaft of
each
tibiae is subjected to cortical BMD or histology. The femurs are prepared for
pQCT
scanning of the midshaft prior to biomechanical testing. With respect to
lumbar
vertebrae (LV), LV2 are processed for BMD (pQCT may also be performed), LV3
are prepared for undecalcified bone histology, and LV4 are processed for
mechanical testing.
In a further embodiment, applicants have discovered that the interaction
between oligomeric RANKL and its receptor RANK on osteoblasts or osteoblast
precursors results in prolonged intracellular activity of intracellular
proteins. Mouse
osteoblasts, when treated with GST-RANKL in vitro manifested activation, as
3o characterized by the activation of NFKB and ERK intracellular signal
pathways. As
noted by the applicants, the time course of intracellular protein activity,
especially
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
22
ERK activity is different from that observed in osteoclast precursors, which
also
express RANK on the surface. In osteoclast precursors, ERK activity peaks 5-15
minutes after RANK/GST-RANKL interaction, and returns to basal levels after 15-
30
minutes. In contrast, the ERK activity in osteoblasts peaks at 10 minutes
after the
same interaction, and is still above the basal level after 60 minutes. The
prolongation of the time course is even more prominent in osteoblast precursor
cells,
wherein the demonstrated activity of ERK had not reached its maximum even 60
minutes after the RANK/oligomeric GST-RANKL interaction. Besides the different
time course of ERK activity, osteoblasts and osteoblast precursor cells also
exhibit
prolonged activity of kinases such as IKK, P13 kinase, Akt, p38 and JNK. This
osteoblast-related activity contrasts with GST-RANKL interaction with RANK on
osteoclasts, which results in short-lived activity of MAP kinases and bone
resorption.
While not being bound to a particular theory, it therefore appears that the
prolonged
activity of kinases observed in osteoblasts following oligomeric GST-RANKL
~ 5 stimulation plays a role in the anabolic bone processes.
It is known that TNF family cytokine-induced intracellular signaling is
attenuated by internalization of the receptor-ligand complex (see, e.g.,
Higuchi, M
and Aggarwal, B.B., J. Immunol., 152:3550-3558, 1994). Applicants, therefore
believe that oligomeric complexes comprising RANKL are not internalized as
2o promptly as RANKL trimers, thus allowing for a longer interaction with the
receptor
and prolonged intracellular signaling. See Fig. 16 and Example 13.
Accordingly, osteogenic compounds capable of enhancing activity of one or
more intracellular proteins in osteoblasts or osteoblast precursors, wherein
such
activity is indicative of bone formation, may be used in the methods of the
present
2s invention. Activated intracellular proteins include but are not limited to
kinases.
Preferably, the kinases comprise ERK1/2, JNK, P13 kinase, IKK, Akt, and p38,
and
even more preferably, the kinases are ERK1/2. Other intracellular proteins
include
IKB-a and IKB-Vii.
In another preferred embodiment, the activity comprises phosphorylation of
30 one or more intracellular proteins, and more preferably of kinases. For the
MAP
kinase family, full activation requires dual phosphorylation on tyrosine and
threonine
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
23
residues separated by a glutamate residue (known as TEY motif, where T is
threonine, E is glutamic acid, and Y is tyrosine) by a single upstream kinase
known
as MAP kinase kinase (MKK). The requirement for dual phosphorylation ensures
that MAP kinases are specifically activated by the action of MKK.
Any of the assays available in the art for determining whether a kinase has
been phosphorylated may be used. Preferably, such assays include Western blots
or kinase assays.
A Western blot can be generally performed as follows. Once the cell lysates
are generated, the intracellular proteins are separated on the basis of size
by
utilizing SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel
electrophoresis).
The separated proteins are transferred by electroblotting to a suitable
membrane
(such as nitrocellulose or polyvinylidene flouride) to which they adhere. The
membrane is washed to reduce non-specific signals, and then probed with an
antibody which recognizes only the specific amino acid which has been
~ 5 phosphorylated as a result of RANK signaling. After further washing, which
removes
excess antibody, a second antibody, which recognizes the first antibody (bound
to
specifically-phosphorylated proteins on the membrane) and contains a reporter
moiety is applied to the membrane. The addition of a developing agent, which
interacts with a reporter moiety on the second antibody results in
visualization of the
2o bands.
A kinase assay, for example for ERK1/2, can be performed by utilizing a
known substrate for this kinase such as p90 ribosomal S6 protein kinase (RSK).
Briefly, by way of example, treated osteoblasts are washed in ice-cold PBS,
e.g.,
three times, and extracted with lysis buffer in order to obtain cell lysates.
25 Supernatants obtained after microcentifugation of cell lysates are
incubated with
goat anti-RSK2 antibody (1:200) together with protein G-Sepharose at
4°C overnight.
The beads are collected by microcentrifugation, washed twice with lysis
buffer,
followed by kinase buffer. RSK2 phosphotransferase activity in the beads is
measured by using S6 kinase assay kit and [y-3zP]ATP according to the
protocols
3o provided by the manufacturer (Upstate Biotechnology, Inc).
An additional assay that can be applied to determine activation of osteoblasts
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
24
is an electrophoretic mobility gel shift assay (EMSA). This assay monitors
nuclear
translocation of a transcription factor complex (such as NFKB following
activation of
osteoblasts with GST-RANKL). Briefly, an EMSA may be conducted as follows.
Nuclei of treated osteoblastS are isolated and their extracts generated. The
nuclear
proteins are then incubated with a specific oligonucleotide probe that has
been
labeled with 32P orthophosphate. After an appropriate time, the putative
protein-
DNA complexes are separated on a PAGE gel (no SDS present), which is dried and
exposed to an X-ray film. If a specific complex has formed (in this case a
complex
of NFKB proteins with a specific DNA sequence) a band will be visible on the
developed film. Typically, appropriate controls are run in parallel with the
experimental samples) in order to ensure that the band is specific for
activated
osteoblasts. For detailed procedures on Western blotting, kinase assays, and
EMSA, see for example Lai et al., Journal of Biological Chemistry,
276(17):14443-
14450, April 27, 2001.
The activation in osteoblasts can be detected up to at least 60 minutes
following the incubation of said cells with oligomers, such as GST-RANKL. In
osteoblast precursor cells, the activation peaks after 5-10 minutes, and can
be
detected for up to at least 60 minutes. Accordingly, the activity of one or
more
intracellular proteins may be detected for at least about 30 minutes after the
2o incubation of the osteogenic compound with osteoblasts or osteoblast
precursors.
In a preferred embodiment, the activity is detected for at least about 40
minutes, and
more preferably for at least about 60 minutes after said incubation. In
another
preferred embodiment, the intracellular proteins whose activity is detected
for at
least about 30 minutes are kinases, and more preferably, the kinases are
ERK1/2.
To confirm that a compound that activates osteoblasts and/or stimulates
differentiation of osteoblast precursors can enhance anabolic bone processes,
such
compound can be tested in a bone formation assay, wherein an increase in bone
mass over the increase in background bone mass designates a compound as
having osteogenic activity. There are multiple bone formation assays that can
be
3o used successfully to screen potential osteogenic compounds of this
invention. For
example, cell-based assays for osteoblast differentiation and function, based
on
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
measuring collagen levels and alkaline phosphatase activity may be used. These
assays are well known in the art and easily performed by a skilled artisan.
Furthermore, multiple in vitro and in vivo bone formation assays have been
described in above sections. It should be noted that in vitro assays may be
5 performed with either osteoblasts or osteoblast precursors since both cell
types
exhibit prolonged activity of the same kinases following stimulation with
anabolic
forms of RANKL, such as GST-RANKL.
In cases when the intracellular activation assays and bone formation assays
are performed with a library of compounds, it may be necessary to positively
identify
a compound that has shown to be osteogenic. There are multiple ways to
determine
the identity of the compound. One process involves mass spectrometry,
available
from Neogenesis (http://www.neoaenesis.com). Neogenesis' ALIS (automated
ligand identification system) spectral search engine and data analysis
software allow
for a highly specific identification of a ligand structure based on the exact
mass of
~ 5 the ligand. One skilled in the art may also perform mass spectrometry
experiments
to determine the identity of the compound.
In another embodiment, osteogenic compounds capable of inactivating one or
more phosphatases in osteoblasts or osteoblast precursors, wherein said
inactivation is indicative of bone formation may be used in the methods of the
2o present invention. In one preferred embodiment, the phosphatases inhibit
the
kinases involved in osteogenesis, including p38, ERKs, JNK, IKK, and Akt. More
preferably, the phosphatases are MAPK specific or Akt specific, and even more
preferably they are ERK1/2 specific. While not being bound to a particular
theory,
this method is feasible for this purpose due to the fact that a kinase
activity is tightly
25 regulated by its corresponding phosphatase. In case of ERK1/2, the
phosphatase is
known as the mitogen activated protein kinase phosphatase-3 (MKP-3). This
phosphatase belongs to a family of dual specificity phosphatases, which are
responsible for the removal of phosphate groups from the threonine and
tyrosine
residues on their corresponding kinases (Camps et al., FASEB J., 14, pp.6-16,
1999). The prompt removal of phosphate groups by phosphatases ensures that
kinase activation is short-lived and that the level of phosphorylation is low
in a
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
26
resting cell. However, in order for the phosphatase to be active and remove
phosphate groups, it also needs to be phosphorylated. Therefore, inhibition of
phosphatase activity results in activation or prolongation of ERK1/2 activity.
One method of determining the ability of an osteogenic compound to
inactivate phosphatases in osteoblasts/osteoblast precursors involves
initially
activating osteoblasts/osteoblast precursors with a substance known to
activate
these cells, such as GST-RANKL or BMP-2 (bone morphogenetic protein 2). This
leads to activation of phosphatases, at which point osteoblasts/osteoblast
precursors are treated with a test compound and cell lysates are obtained. The
ability of the test compound to dephosphorylate (inactivate) phosphatase(s) is
determined by performing Western blots or kinase assays. See above. For
additional details on assessing phosphatase activity, see Muda et al., J Biol
Chem.,
273:9323-9329, 1998, and Camps et al., Science 280:1262-1265, 1998. If the
compound is determined to possess phosphatase inhibitory activity, it can
further be
tested in one of the bone formation assays to determine its osteogenic
activity.
These assays were also described above.
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
27
Pharmaceutical Compositions and Methods
In a preferred embodiment of the invention, a method of preventing or
inhibiting bone loss or of enhancing bone formation is provided by
administering 1 )
oligomeric complexes of one or more of RANKL, a RANKL fusion protein, analog,
derivative, or mimic, 2) osteogenic compounds capable of enhancing activity of
intracellular proteins in osteoblasts or osteoblast precursors, wherein said
activity is
indicative of bone formation, or 3) osteogenic compounds capable of
inactivating
intracellular proteins in osteoblasts or osteoblast precursors, wherein said
inactivation is indicative of bone formation. The bone forming compositions of
the
present invention may be utilized by providing an effective amount of such
compositions to a patient in need thereof. In one preferred embodiment, such
compositions are used to treat conditions selected from the group consisting
of:
osteoporosis, juvenile osteoporosis, osteogenesis imperfecta, hypercalcemia,
hyperparathyroidism, osteomalacia, osteohalisteresis, osteolytic bone disease,
~5 osteonecrosis, Paget's disease, rheumatoid arthritis, inflammatory
arthritis,
osteomyelitis, corticosteroid treatment, periodontal disease, skeletal
metastasis,
cancer, age-related bone loss, osteopenia, and degenerate joint disease.
For use for treatment of animal subjects, the compounds of the invention can
be formulated as pharmaceutical or veterinary compositions. Depending on the
2o subject to be treated, the mode of administration, and the type of
treatment desired,
e.g., prevention, prophylaxis, therapy; the compounds are formulated in ways
consonant with these parameters. A summary of such techniques is found in
Remington's Pharmaceutical Sciences, latest edition, Mack Publishing Co.,
Easton,
PA.
25 The administration of RANKL-comprising oligomers or osteogenic compounds
of the present invention may be pharmacokinetically and pharmacodynamically
controlled by calibrating various parameters of administration, including the
frequency, dosage, duration mode and route of administration. Thus, in one
embodiment bone mass formation is achieved by administering anabolic
3o compositions such as an oligomeric complex of one or more of RANKL, a RANKL
fusion protein, analog, derivative or mimic in a non-continuous, intermittent
manner,
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
28
such as by daily injection and/or ingestion. Generally, any osteogenic
compound as
described herein may be administered intermittently to achieve the same
affect.
Variations in the dosage, duration and mode of administration may also be
manipulated to produce the activity required.
For administration to animal or human subjects, the dosage of the
compounds of the invention is typically 0.01-100mg/kg. However, dosage levels
are
highly dependent on the nature of the disease or situation, the condition of
the
patient, the judgment of the practitioner, and the frequency and mode of
administration. If the oral route is employed, the absorption of the substance
will be
a factor effecting bioavailabiity. A low absorption will have the effect that
in the
gastro-intestinal tract higher concentrations, and thus higher dosages, will
be
necessary.
It will be understood that the appropriate dosage of the substance should
suitably be assessed by performing animal model tests, wherein the effective
dose
~ 5 level (e.g. EDSO) and the toxic dose level (e.g. TDSO) as well as the
lethal dose level
(e.g. LDSO or LD,o) are established in suitable and acceptable animal models.
Further, if a substance has proven efficient in such animal tests, controlled
clinical
trials should be performed.
In general, for use in treatment, the compositions of the invention may be
2o used alone or in combination with other compositions for the treatment of
bone loss.
Such compositions include anti-resorptives such as a bisphosphonate, a
calcitonin,
a calcitriol, an estrogen, SERM's and a calcium source, or a supplemental bone
formation agent like parathyroid hormone or its derivative, a bone
morphogenetic
protein, osteogenin, NaF, or a statin. See U.S. Patent No. 6,080,779
incorporated
25 herein by reference. Depending on the mode of administration, the compounds
will
be formulated into suitable compositions.
Formulations may be prepared in a manner suitable for systemic
administration or for topical or local administration. Systemic formulations
include,
but are not limited to those designed for injection (e.g., intramuscular,
intravenous
30 or subcutaneous injection) or may be prepared for transdermal,
transmucosal, or
oral administration. The formulation will generally include a diluent as well
as, in
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
29
some cases, adjuvants, buffers, preservatives and the like.
For transepithelial administration, penetrants appropriate to the barrier to
be
permeated are used in the formulation. Such penetrants are generally known in
the
art. For oral administration, the compounds can be administered also in
liposomal
compositions or as microemulsions. Suitable forms include syrups, capsules,
tablets, as is understood in the art. For injection, formulations can be
prepared in
conventional forms as liquid solutions or suspensions or as solid forms
suitable for
solution or suspension in liquid prior to injection or as emulsions. Suitable
excipients
include, for example, water, saline, dextrose, glycerol and the like. Such
compositions may also contain amounts of nontoxic auxiliary substances such as
wetting or emulsifying agents, pH buffering agents and the like, such as, for
example, sodium acetate, sorbitan monolaurate, and so forth.
RANKL-comprising oligomers and osteogenic compounds described herein
also may be administered locally to sites in patients, both human and other
~ 5 vertebrates, such as domestic animals, rodents and livestock, where bone
formation
and growth are desired using a variety of techniques known to those skilled in
the
art. For example, these may include sprays, lotions, gels or other vehicles
such as
alcohols, polyglycols, esters, oils and silicones. Such local applications
include, for
example, at a site of a bone fracture or defect to repair or replace damaged
bone.
2o Additionally, oligomeric complexes and osteogenic compounds of the present
invention may be administered e.g., in a suitable carrier, at a junction of an
autograft, allograft or prosthesis and native bone to assist in binding of the
graft or
prosthesis to the native bone.
Pharmaceutically acceptable excipients include, but are not limited to,
25 physiological saline, Ringer's, tocopherol, phosphate solution or buffer,
buffered
saline, and other carriers known in the art. Pharmaceutical compositions may
also
include stabilizers, anti-oxidants, colorants, and diluents. Pharmaceutically
acceptable carriers and additives are chosen such that side effects from the
pharmaceutical compound are minimized and the performance of the compound is
3o not canceled or inhibited to such an extent that treatment is ineffective.
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
The following examples illustrate the invention, but are not to be taken as
limiting the various aspects of the invention so illustrated.
EXAMPLES
5
Example 1
Expression of RANKL as a GST RANKL fusion protein. cDNA encoding
murine RANKL residues 158-316 was cloned into pGEX-4T-1 (Amersham; GenBank
Accession No. U13853 - see National Library of Medicine listing at
http:lincbi.nlm.nih.gov under nucleic acids.) downstream of glutathione S-
transferase using the Sall and Notl restriction endonucleases. Following IPTG-
mediated (0.05mM) induction of protein expression in BL21 (DE3) Escherischia
coli
(Invitrogen), cells were triturated into a lysis buffer comprising 150mM NaCI,
20mM
Tris-HCI pH 8.0, and 1 mM EDTA. Lysates were incubated with glutathione
sepharose (Amersham) for affinity purification of the GST-RANKL fusion
protein,
followed by excessive washing with buffer comprising 150mM NaCI and 20mM Tris-
HCI pH 8Ø Following competitive elution (10mM reduced glutathione) from the
affinity column, the isolated protein was then subjected to ion exchange
chromatography, eluted with a salt gradient ranging from 0-500mM NaCI, and
2o dialyzed against physiologic salt and pH. Purified GST-RANKL was then
assayed
for endotoxin contamination by limulus amoebocyte lysate assay, and
quantitated for
bioactivity by an in vitro osteoclastogenesis readout.
Under conditions replicating the physiological milieu, GST-RANKL forms large
oligomeric complexes, as demonstrated by size exclusion chromatography. See
25 FIG. 2. The majority of the protein, as determined by the area under the
curve in
FIG. 2, exists as oligomeric complexes of GST-RANKL.
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
31
Example 2
Ex vivo stimulation of bone formation in whole calvarial organ culture. An
assay for bone formation was carried out as described in U.S. Patent No.
6,080,779
col. 10, II. 29-55 incorporated herein by reference. Neo-natal mouse calvariae
were
placed in organ culture in the presence of vehicle, GST (a negative control),
or
increasing concentrations of purified GST-RANKL obtained as outlined in
Example
1. Bone morphogenetic protein (BMP)-2 was administered as a positive control.
Test compositions were administered for a period of 12 hours only at the
initiation of
the culture (1X) or once at initiation and once three days later, again for a
duration of
12 hours (2X). After seven days, calvarial thickness was determined
histomorphometrically and compared among the various control and experimental
groups to assess bone formation. Briefly, calvarial bones were removed from
the
incubation medium, fixed in 10% neutral buffered formalin for 12 hours,
decalcified
in 14% EDTA for 3 days, dehydrated through graded alcohols, and embedded in
paraffin for histological sectioning. Calvaria were sectioned coronally
through the
central portion of the parietal bone, perpendicular to the sagittal suture.
Representative coronal sections of comparable anatomic position were subjected
to
histomorphometric assessment (OsteoMeasure, Osteometrics Inc., Atlanta, GA) of
calvarial thickness. See FIG. 3. GST-RANKL induced a dose-dependent increase
2o in cavarial thickness when administered 1X or 2X. See FIG. 4. At the
highest doses
tested (100 ng/ml) calvarial thickness had doubled.
Example 3
In vivo stimulation of bone formation in mice. Mice, C3H/HeN (Harlan,
Indianapolis, IN) were administered 100 micrograms GST (control) or 100
micrograms GST-RANKL as obtained in Example 1, subcutaneously, once a day for
nine days. Histological examination of tibia reveals a marked increase in bone
mass
and a net increase in the numbers of activated osteoblasts in GST-RANKL-
treated
as compared to control mice. See FIGS. 5(a) and 5(b), taken at low power and
high
3o power magnification, respectively. The figures revealed a marked increase
in
cortical thickness and augmentation of the trabecular architecture of the
primary
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
32
spongiosa, relative to control animals receiving GST.
Dual-energy X-ray absorptiometry (DEXA) analysis of GST or GST-RANKL
administered mice was also conducted using standard procedures. Results (see
FIG. 5(c) show a significant increase in bone mineral density of GST-RANKL
compared to control.
Example 4
In vivo activation ofosteoblasfs. Mice C3H/HeN (Harlan, Indianapolis, IN)
were administered GST (control) or GST-RANKL, following the procedure set
forth in
Example 3. Histological examination of tibia at high magnification revealed a
marked activation of osteoblasts in GST-RANKL-treated as compared to control
mice. Quiescent osteoblasts are evident in control animals as thin bone-lining
cells,
whereas activated osteoblasts are evident in GST-RANKL-treated animals as
plump,
cuboidal cells along the bone surface. See FIG. 6.
~5 Measurement of the rate of bone formation during in vivo administration of
GST-RANKL, versus GST control, was accomplished by intraperitoneal
administration of 20 mg/kg calcein in 2% NaHC03 seven and two days before
euthanasia to allow incorporation of two fluorescent labels into mineralizing
bone
matrix. Following dissection, calvaria were fixed in 70% EtOH and embedded in
2o polymethyl methacrylate for histological sectioning. Shown in FIG. 9 are
fluorescent
micrographs of coronal sections of the parietal bone taken mid-way between the
coronal and lambdoidal sutures, with the external surface of the calvarium
oriented
upwards on the figure and the internal surface oriented downwards. The amount
of
bone synthesized during the five day period is that encompassed within the two
sets
25 of parallel fluorescent bands. While the magnitude of bone formation in
control
animals receiving only GST is insufficient to produce distinctly separated
double
labels, there is clear deposition of bone during the five days between the
first and
second labels in GST-RANKL-treated animals.
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
33
Example 5
Administration of GST RANKL stimulates osteoblast proliferation without
substantially affecting osteoclastogenesis. Purified GST-RANKL fusion product
was
administered subcutaneously to mice C3H/HeN (Harlan, Indianapolis, IN), in
increasing dosages of 5, 50, 500, 1,500, 5,000 pg/kg, once a day, for 7 days.
GST
in moles equivalent to the highest dosage of RANKL served as a negative
control.
The mice were sacrificed and long bones were fixed, decalcified and stained
for
tartrate resistant acid phosphatase (TRAP) activity. TRAP activity is a
specific
phenotypic marker of the osteoclast in the context of bone. The number of
activated
osteoblasts and osteoclasts, per mm trabecular bone surface was
histomorphometrically quantitated. As seen in FIG. 7, GST-RANKL administered
in
an intermittent fashion (namely, by daily injection), resulted in a dose-
dependent
increase in activated osteoblast, but not osteoclast number. GST had no
noticeable
impact on either osteoblasts or osteoclasts.
Example 6
Enhancement of osteoblast precursor differentiation as evidenced by ex vivo
bone nodule formulation. Equal numbers of marrow cells from GST-RANKL (100
pg) and GST treated mice, as discussed in Example 3, were placed in
osteoblastogenic conditions for 28 days to determine if the number of
osteoblasts
and their committed precursors capable of forming bone were increased. After
the
28 days, the cells were stained with Alizarin red to identify mineralized bone
nodules
and Hematoxylin to identify colony forming units.
Marrow cells derived from GST-RANKL treated mice generated substantially
more mineralized bone nodules than did their GST administered counterparts
(See
FIG. 8).
Example 7
GST RANKL rapidly activates MAP kinases in murine osteoclast precursors.
3o Wild type C57BL/6 mice were purchased from Harlan Industries (Indianapolis,
IN).
For the isolation of osteoclast precursors, bone marrow macrophages (BMMs)
were
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
34
isolated from whole bone marrow of four to six week old mice and incubated in
tissue culture dishes at 37°C in 5% CO2. After 24 hours in culture, the
non-adherent
cells were collected and layered on a Ficoll Hypaque gradient and the cells at
the
gradient interface were collected. Cells were replated at 65,000/cmZ in a-
minimal
essential medium, supplemented with 10% heat inactivated fetal bovine serum,
at
37°C in 5% C02 in the presence of recombinant mouse M-CSF (10ng/ml).
Cells
were treated with GST-RANKL on day 4 or 5. In the experiments addressing the
activity of Akt, the cells were cultured in serum and M-CSF free medium for 24
hours
prior to GST-RANKL stimulation.
Immunoblotting (Western blotting) of osteoclast precursors was performed
according to the following instructions. Cytokine-treated or control
monolayers of
BMMs were washed twice with ice-cold PBS. Cells were lysed in the buffer
containing 20 mM Tris (pH 7.5), 150 mM NaCI, 1 mM EDTA, 1 mM EGTA, 1 % Triton
X-100, 2.5 mM sodium pyrophoshate, 1 mM ~3-glycerophosphate, 1 mM Na3P04, 1
~ s mM NaF, and 1 X protease inhibitor cocktail. Fifty ug of cell lysates were
boiled in
the presence of SDS sample buffer (0.5 M Tris-HCI, pH 6.8, 10% w/v SDS, 10%
glycerol, 0.05% w/v bromphenol blue) for 5 minutes and separated on SDS-PAGE,
using 8% gels. Proteins were transferred to nitrocellulose membranes using a
semi-
dry blotter (Bio-Rad, Richmond, CA) and incubated in blocking solution (5% non-
fat
2o dry milk in tris-buffered saline containing 0.1 % Tween 20) for 1 hour to
reduce
nonspecific binding. Membranes were then exposed to primary antibodies
overnight
at 4°C, washed three times, and incubated with secondary goat anti-
mouse or rabbit
IgG horseradish peroxidase-conjugated antibody for 1 hour. Membranes were
washed extensively, and enhanced chemiluminiscence detection assay was
25 performed following the manufacturer's directions (Amersham).
The results of the immunoblotting assay are depicted in Figure 10. As can be
seen from this figure, the total cellular amounts of JNK, p38, and ERK did not
change significantly at any point of the assay. The phosphorylation
(activation) of
ERK and p38 was detected 5 minutes following the GST-RANKL stimulation,
3o peaked at 10 minutes after RANK/GST-RANKL interaction, and was undetectable
30 minutes after the interaction. JNK was phosphorylated 15 minutes after the
GST-
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
RANKL stimulation, however the protein was also rapidly dephosphorylated so
that
by 30 minutes following GST-RANKL stimulation, phosphorylated forms of JNK
were
undetectable. The data indicated transient and short-lived activity of ERK,
JNK, and
p38 in murine osteoclast precursors following the GST-RANKL stimulation.
5
Example 8
GST RANKL rapidly activates Akt in murine osteoclast precursors.
Osteoclast precursors were isolated, maintained, and manipulated as described
in
Example 7. Immnublotting protocol was also the same as in Example 7, except
that
a primary antibody was specific for phospho-Akt, obtained from Cell Signaling.
Fig. 11 shows that there was a detectable phosphorylation of Akt at the time
of GST-RANKL stimulation, indicating rapid activation of this protein. Akt is
a
substrate for P13 kinase, and in its active state is involved in anti-
apoptotic signaling.
Akt activity increased with time, i.e. the number of phosphorylated Akt
molecules in
~5 osteoclast precursors increased with time. Thus, the activity of Akt was
greater at 5
minutes than at 0 minutes, and it peaked at 15 minutes following GST-RANKL
stimulation.
Example 9
2o GST RANKL-induced activity of MAP kinases is prolonged in murine
osteoblasts. Primary osteoblasts were isolated from neonatal murine calvaria
by
sequential enzymatic digestion. Briefly, calvaria were minced and incubated at
room
temperature for 20 minutes with gentle shaking in an enzymatic solution
containing
0.1 % collagenase, 0.05% trypsin, and 4 mM NA2EDTA in calcium- and magnesium-
25 free phosphate buffered saline (PBS). This procedure was repeated to yield
a total
of six digests. The cells isolated from the last four to six digests were
cultured in
MEM containing 15% FBS, 50 pM ascorbic acid, and 10 mM ~3-glycerophosphate.
Cells were maintained at 37°C in a humidified atmosphere containing 6%
C02, with
daily replenishment of media and cytokines.
3o Following cytokine treatment at the indicated times and dosages, cells were
lysed in RIPA buffer containing 10 mM Tris-HCI pH 7.4, 150 mM NaCI, 1 %
Nonidet
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
36
P-40, 0.2% sodium deoxycholate, and 1 mM EDTA, with 1 mM Na3P04, 1 mM NaF,
and 1 X protease inhibitor cocktail added immediately prior to use. Protein
concentration was quantitated and standardized by Micro BCA Protein Assay
(Pierce). Lysates were denatured by heat in Laemmli buffer, resolved by SDS-
PAGE, and transferred onto nitrocellulose. Levels of total and phosphorylated
ERK,
JNK, p38, Akt, and IkBa were determined using primary and secondary antibodies
according to the manufacturer's established protocols, with conventional
chemiluminiscent detection. Membranes were stripped between hybridizations in
PBS containing 10 pM ~i-mercaptoethanol and 2% SDS.
The results of the immunoblot assay measuring the activity of MAP kinases
following GST-RANKL or equimolar RANKL stimulation are shown in Fig. 12. GST-
RANKL stimulation was performed as described in Example 7. The kinases whose
phosphorylation was measured include ERK, JNK, p38, and Akt. Again, as seen in
osteoclast precursors, the amount of total protein did not significantly
change in the
~5 cell at any time points. However, all of the kinases tested exhibited
prolonged activity
in osteoblasts. Both ERKs were activated by 5 minutes after GST-RANKL
stimulation, and their activity could be detected at 60 minutes following the
stimulation. The activity of JNK, p38, and Akt was detectable at the time of
GST-
RANKL stimulation, and could be detected for at least 60 minutes following the
2o stimulation. In addition, phosphorylation of IkBa was detected 10 minutes
after the
stimulation and it increased until the end of the assay (60 minutes),
indicating
increased translocation of NFkB into the nucleus. The data suggest that the
pattern
of MAP kinase activity is different from the activity of the same kinases in
osteoclasts. The prolonged activity observed in osteoblasts seems to play a
role in
25 accelerated anabolic bone processes. In addition, RANKL treatment was not
able to
induce prolonged activity of kinases as was seen with GST-RANKL.
Example 10
GST RANKL-induced ERk1/2 activity is prolonged in murine osteoblast
3o precursors. Osteoblast precursors were isolated and maintained according to
the
procedures set forth in Example 9. The immunoblotting was performed in the
same
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
37
manner as immunoblotting in Example 9.
As observed in Fig. 13, ERK activity in osteoblast precursors was prolonged
and it increased with time. Whereas in osteoblasts the activity was prolonged
but
did not change significantly over time, ERK activity in osteoblast precursors
was first
detected at 10 minutes following GST-RANKL stimulation, and it increased up to
60
minutes following the activation, which was the length of time for which the
assay
was performed.
Example 11
AP activity following GST RANKL exposure in osteoblasts. Primary calvarial
osteoblasts were cultured in MEM containing 15% FBS, 50 uM ascorbic acid, and
10
mM ~3-glycerophosphate. Cells were maintained at 37°C, with daily
replenishment of
media and cytokines. Osteoblast alkaline phosphatase (AP) activity, a direct
measure of osteoblast differentiation and function, was quantitated by
addition of a
~5 colorimetric substrate, 5.5 mM p-nitrophenyl phosphate. The cells were then
exposed to GST-RANKL, administered in different regimens. Pulsatile exposure
to
50 ng/ml GST-RANKL was provided as 1, 3, 6, 8, or 24 hours of total exposure
per
48-hour treatment window. After 4 such 48-hour treatments, AP activity was
quantitated (~S.D.) and normalized to total protein levels.
2o As can be seen from Fig. 14, the maximum anabolic effect was observed
when GST-RANKL exposure was provided for an 8-hour treatment window, once
every 48 hours. Thus, GST-RANKL induced increase in AP activity when
administered in an intermittent fashion.
25 Example 12
Oligomerization of GST RANKL. GST-RANKL was subjected to proteolysis to
isolate the cleaved RANKL fragment from its GST fusion partner. Briefly, GST-
RANKL was incubated with the type-14 human rhinovirus 3C protease (Amersham
Pharmacia Biotech) for 4 hours at 4°C in 50 mM Tris-HCI, pH 7.0, 150 mM
NaCI, 10
3o mM EDTA, and 1 mM DTT. Uncleaved fusion protein and GST-tagged protease
were removed by passage over a glutathione affinity matrix. All purified
recombinant
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
38
proteins were assayed for endotoxin contamination by limulus amoebocyte lysate
assay (Bio Whittaker), and analyzed by mass spectrometry to confirm identity.
Both
GST-RANKL and cleaved RANKL were dialyzed against physiologic salt and pH,
and fractionated by gel filtration in Superose-6 26/60 using an AKTA explorer
chromatography system (Amersham Pharmacia). Elution volumes were calibrated
to molecular weight using the following standards: ribonuclease A (13,700),
chymotrypsinogen A (25,000), ovalbumin (43,000), bovine serum albumin
(67,000),
aldolase (158,000), catalase (232,000), ferritin (440,000), thyroglobulin
(669,000),
and blue dextran 2000 (2,000,000). Fractions containing protein from different
elution volumes were subjected to Western analysis using a monoclonal anti-GST
primary antibody. As FIG. 15(a) shows, cleaved RANKL migrated as a single
trimeric species (1 n), whereas GST-RANKL migrated as a polydisperse mixture
of
non-covalently associated mono-trimeric (1 n) and oligomeric (2-100n) under
dynamic equilibrium. Crystallographic evidence has established that GST
~5 possesses an innate tendency to dimerize, while RANKL spontaneously
trimerizes.
A single GST-RANKL trier, consisting of 3 RANKL molecules and 3 GST molecules,
thus contains a free GST that is not bound to a neighboring GST, resulting in
a 3:2
stoichiometry that engenders a propensity to oligomerize. High-order, branched
oligomers form when the GST of a given GST-RANKL trimer forms a dimer with the
2o GST from a neighboring GST-RANKL trimer (see FIG. 15(b)).
Example 13
Internalization of GST RANKL. Primary murine osteoblasts were maintained
in a-MEM containing 10% fetal bovine serum, and cultured in MEM containing 15%
25 FBS, 50 pM ascorbic acid, and 10 mM ~i-glycerophosphate for
differentiation. Cells
were maintained at 37°C in a humidified atmosphere containing 6% C02,
with daily
replenishment of media and cytokines. Primary murine osteoblasts were cultured
on
coverslips in a-MEM containing 10% fetal bovine serum and treated with GST-
RANKL or cleaved RANKL for the indicated times. For phospholipid membrane
3o staining, cells were incubated for 20 minutes with Vybrant Dil lipophilic
carbocyanine
membrane fluorescent stain (Molecular Probes). Cells were fixed in 4%
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
39
paraformaldehyde, permeabilized with 0.1 % Triton-X, blocked with 1
BSA/0.2%nonfat dry milk in PBS, and stained for RANK with a polyclonal anti-
RANK
antibody. Serial optical sections were obtained using a Radiance2100 laser
scanning confocal microscope (BioRad). Microscope settings were calibrated to
black level values using cells stained with an isotypic Ig control. GST-RANKL
was
cleaved as described in Example 12.
Primary osteoblasts in culture were exposed to 5 nM cleaved RANKL or GST-
RANKL. At the indicated times, the cell surface was stained with a lipophilic
fluorescent dye, and RANK was stained with an anti-RANK antibody. Confocal
microscopy was employed to localize RANK (green fluorescence) and the cell
surface (red fluorescence). On the merged images, colocalization of RANK and
the
cell surface appears yellow (overlap of green and red fluorescence). GST-
RANKL:RANK complexes remain on the cell surface for at least one hour,
corresponding to the sustained intracellular RANK signaling. In contrast,
cleaved
RANKL-RANK complexes are completely internalized within one hour, correlating
to
the absence of cleaved RANKL-induced RANK signaling at that time. Results are
shown in FIG. 16.
Example 14
2o Expression of Type I collagen and Cbfa 1 in response to GST RANKL. For in
vivo experiments, mice were administered 5 ug/kg GST-RANKL or GST alone as a
control by subcutaneous injection and euthanized one hour later. For in vitro
experimentation, primary osteoblasts were exposed to 100 ng/ml GST-RANKL or
GST alone as a control. RNA was isolated with the RNeasy Total RNA System
(Qiagen) and digested with deoxyribonuclease to eliminate genomic DNA.
Meesenger RNA was subsequently isolated from total RNA with the Oligotex mRNA
Purification System (Qiagen) and analyzed with the Platinum Quantitative RT-
PCR
Thermoscript One-Step System (Life Technologies). Briefly, 1 pg mRNA was
reverse-transcribed to cDNA using murine gene-specific oligonucleotide primers
3o designed to span exon-intron boundaries: Cbfa1 sense 5'-
CCGCACGACAACCGCACCAT-3' (SEQ ID NO. 3), Cbfa1 antisense 5'-
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
CGCTCCGGCCCACAAATCTC-3' (SEQ ID NO. 4), and Collagen type I chain a,
sense 5'-TCTCCACTCTTCTAGTTCCT-3' (SEQ ID NO. 5) and Colagen type I chain
a, antisense 5'-TTGGGTCATTTCCACATGC-3' (SEQ ID NO. 6). Reverse
transcription was performed at 60°C for 30 minutes, followed by
denaturation at 95°C
5 for 5 minutes. Touchdown PCR amplification immediately ensued. As control,
expression levels of hypoxanthine phosphoribosyl transferase (HPRT) were
assessed concomitantly. Reaction products were fractionated
electrophoretically in
2% agarose, and results were presented from the linear range of the assay.
Type I collagen, synthesized by osteoblasts, is the major organic component
of bone. As shown in FIG. 17, primary osteoblasts gradually upregulate
collagen
expression as they differentiate in culture. Intermittent GST-RANKL exposure
accelerates this process, inducing robust collagen expression within 12 hours
of
initial exposure to it. Cbfa1 is the master transcription factor for
osteoblastogenesis,
and its absence results in a complete lack of osteoblasts and bone formation
in mice
~5 (see, e.g., Otto et al., Cell 89, pp.765-771, 1997, and Komori et al., Cell
89, pp. 755-
764, 1997). As shown in Fig. 18, expression of Cbfa1 is enhanced in the marrow
within one hour of systemic GST-RANKL administration relative to the
expression of
control animals receiving GST alone.
2o Example 15
GST RANKL stimulates osteoblasf proliferation. The proliferation rate of
osteoblasts in vitro was assessed by incorporation of 5-bromo-2'-deoxyuridine
(brdU) into DNA. Briefly, cells were cultured in the presence of 10 pM BrdU
for 48
hours, in the presence or absence of 100 ng/ml GST-RANKL, or a molar
equivalent
25 of GST alone as control. BrdU incorporation was quantitated by ELISA
(Amersham
Pharmacia Biotech) using a peroxidase-labelled anti-BrdU antibody.
Spectrophotometric measurement was performed at 450 nm following addition of
the
colorimetric substrate 3,3'-5,5'-tetramethylbenzidine.
As shown in Fig. 19, GST-RANKL treatment enhanced the rate of osteoblast
so proliferation by up to 4-fold during a 48-hour assay period.
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
41
Example 16
ERK activation is involved in anabolic effects of GST RANKL. A kinase-
defective ERK1 cDNA (see Robbins et al., J. Biol. Chem., 268, pp.5097-5106,
1993)
used in this experiment was a result of mutating alanine nucleotides at
positions 211
and 212 to cytosine and guanine, respectively, resulting in replacement of
lysine 71
with arginine (Erk1 K71 R). ERK1 K71 R functions in a dominant-negative
fashion to
block both ERK1 and ERK2 activities (see Li et al., Immunol., 96, pp.524-528,
1999).
The ERK1 K71 R cDNA was cloned into the Ncol and BamHl restriction
endonuclease sites of the SFG retroviral vector as described previously (see
Ory et
1o al., Proc. Natl. Acad. Sci. USA, 93, pp.11400-11406, 1996). For generation
of
retroviral particles pseudotyped with vesicular stomatitis virus (VSV)-G
glycoprotein,
the SFG-ERK1 K71 R retroviral vector was transfected into a 293GPG packaginig
cell line that expresses Mul V gag-pol and VSV-G glycoprotein under
tetracycline
regulation. Conditioned medium was harvested following tetracycline withdrawal
from days 3 to 7, and found to contain a viral titer z 5X106 colony forming
units/ml.
Before transduction, the medium was filtered through a 0.45 pm membrane, and
hexadimethrine bromide (polybrene) was added to a concentration of 8 pg/ml. As
a
negative control, a retrovirus carrying a LacZ cDNA was generated in the same
fashion. Transduction with VSV-pseudotyped retroviri has been shown to exert
no
2o imact on osteobalst differentiation or function (see Kalajzic et al.,
Virology, 284,
pp.37-45, 2001 and Liu et al., Bone 29, pp.331-335, 2001 ). For retroviral
transduction, primary murine osteoblasts were cultured at a density of 60
cells per
mm2 in 150-mm culture dishes, and exposure to 25 ml of conditioned medium
containing z 5X106 colony forming units/ml was allowed for 24 hours.
Transduction
2s efficiency exceeded 90%, as evidenced by X-gal staining of osteoblasts
transduced
with the LacZ retrovirus.
As seen in Fig. 20(a), osteoblasts transduced with dominant-negative ERK
failed to phosphorylate RSK, a known downstream ERK substrate in response to a
treatment with GST-RANKL. In addition, Fig. 20(b) shows that osteoblasts
3o transduced with dominant-negative ERK failed to upregulate expression of
type I
collagen in response to GST-RANKL.
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
42
Example 17
Expression of RANKL as an AP-RANKL fusion protein. cDNA encoding
murine RANKL residues 158-316 is cloned into the appropriate vector using the
appropriate restriction endonucleases. A cDNA encoding the human alkaline
phosphatase 1 is isolated from a cDNA library and spliced upstream (at amino
terminal) of a RANKL cDNA in a suitable mammalian expression vector, such as,
e.g., pcDNA3.1, using appropriate restriction endonucleases, such that the
resulting
DNA sequence is in frame, with no intervening stop codons. The resulting
vector is
transduced into a mammalian cell line, suce as, e.g., CHO cells by standard
methods. Purified AP-RANKL is then assayed for endotoxin contamination by
limulus amoebocyte lysate assay, and quantitated for bioactivity by an in
vitro
osteoclastogenesis readout. Human AP 1 is a secreted protein, and as a result,
AP
fusion protein is secreted into the media. After the sufficient amount of time
for the
AP-RANKL to be expressed and secreted by mammalian cells in vitro, the media
is
~5 affinity purified to isolate AP-RANKL. The empirical mass of the AP-RANKL
fusion
protein is determined by mass spectrometry. The ability of AP-RANKL to form
oligomeric complexes is checked by size exclusion chromatography.
Example 18
2o Expression of RANKL as a GCN4-RANKL fusion protein. cDNA encoding
murine RANKL residues 158-316 is cloned into the appropriate vector using the
appropriate restriction endonucleases. A DNA sequence encoding the GCN4
peptide is spliced upstream (at amino terminal) of a RANKL cDNA in a suitable
expression vector, such as, e.g., pGEX-6P-1 (Accession No. U78872), using
25 appropriate restriction endonucleases, such that the resulting DNA sequence
is in
frame, with no intervening stop codons. Following IPTG-mediated (0.05mM)
induction of protein expression in BL21 (DE3) Escherischia coli (Invitrogen),
cells are
triturated into a lysis buffer comprising 150mM NaCI, 20mM Tris-HCI pH 8.0,
and
1 mM EDTA. Lysates are affinity purified to isolate GCN4--RANKL fusion
protein.
3o The isolated protein is then subjected to ion exchange chromatography,
eluted with
a salt gradient ranging from 0-500mM NaCI, and dialyzed against physiologic
salt
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
43
and pH. Purified GCN4-RANKL is then assayed for endotoxin contamination by
limulus amoebocyte lysate assay, and quantitated for bioactivity by an in
vitro
osteoclastogenesis readout.
The empirical mass of the GCN4-RANKL fusion protein is determined by
mass spectrometry. The ability of GCN4-RANKL to form oligomeric complexes is
checked by size exclusion chromatography.
Example 19
Expression of a RANKL derivative comprising the TALL-1 flap region. Murine
RANKL containing residues 158-316 is mutated so that its DE loop (amino acids
245-249 containing the amino acid sequence SIKIP) is substituted with the DE
loop
of TALL-1 (amino acid sequence KVHVFGDEL). The mutations can be introduced
into RANKL by PCR-driven site-directed mutagenesis, using the QuickChange
Multi-
Site Directed Mutagenesis Kit (available from Stratagene). The mutated RANKL
is
~5 cloned into the appropriate vector, such as, e.g., pGEX-6P-1 (Accession No.
U78872) using the appropriate restriction endonucleases such that the
resulting
DNA sequence is in frame, with no intervening stop codons. Following IPTG-
mediated (0.05mM) induction of protein expression in BL21 (DE3) Escherischia
coli
(Invitrogen), cells are triturated into a lysis buffer comprising 150mM NaCI,
20mM
2o Tris-HCI pH 8.0, and 1 mM EDTA. Lysates are incubated with glutathione
sepharose
(Amersham) for affinity purification of the mutated RANKL protein, followed by
excessive washing with buffer comprising 150mM NaCI and 20mM Tris-HCI pH 8Ø
Following competitive elution (10mM reduced glutathione) from the affinity
column.
The isolated protein is then subjected to ion exchange chromatography, eluted
with
25 a salt gradient ranging from 0-500mM NaCI, and dialyzed against physiologic
salt
and pH. Purified RANKL derivative is then assayed for endotoxin contamination
by
limulus amoebocyte lysate assay, and quantitated for bioactivity by an in
vitro
osteoclastogenesis readout.
The empirical mass of the mutant RANKL is determined by mass
3o spectrometry. The ability of mutated RANKL to form oligomeric complexes is
checked by size exclusion chromatography.
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
44
Example 20
Expression of a RANKL derivative comprising the TALL-1 flap region and
additional amino acid changes. Murine RANKL containing residues 158-316 is
mutated so that its DE loop (amino acids 245-249 containing the amino acid
sequence SIKIP) is substituted with the DE loop of TALL-1 (amino acid sequence
KVHVFGDEL). The following amino acid changes are made throughout the RANKL
molecule to increase the similarity with the TALL-1 structure: 168T~1, 187Y~L,
194K~F, 212F~Y, 252H~V, 279F~1, and 283R~E. The mutations can be introduced
into RANKL by PCR-driven site-directed mutagenesis, using the QuickChange
Multi-
Site Directed Mutagenesis Kit (available from Stratagene). The mutated RANKL
is
cloned into the appropriate vector, such as, e.g., pGEX-6P-1 using the
appropriate
restriction endonucleases such that the resulting DNA sequence is in frame,
with no
intervening stop codons. Following IPTG-mediated (0.05mM) induction of protein
expression in BL21 (DE3) Escherischia coli (Invitrogen), cells are triturated
into a
~ 5 lysis buffer comprising 150mM NaCI, 20mM Tris-HCI pH 8.0, and 1 mM EDTA.
Lysates are incubated with glutathione sepharose (Amersham) for affinity
purification of the mutated RANKL protein, followed by excessive washing with
buffer comprising 150mM NaCI and 20mM Tris-HCI pH 8Ø Following competitive
elution (10mM reduced glutathione) from the affinity column, The isolated
protein is
2o then subjected to ion exchange chromatography, eluted with a salt gradient
ranging
from 0-500mM NaCI, and dialyzed against physiologic salt and pH. Purified
RANKL
derivative is then assayed for endotoxin contamination by limulus amoebocyte
lysate
assay, and quantitated for bioactivity by an in vitro osteoclastogenesis
readout. The
empirical mass of the mutant RANKL is determined by mass spectrometry. The
25 ability of mutated RANKL to form oligomeric complexes is checked by size
exclusion
chromatography.
Example 21
Ex vivo stimulation of bone formation in whole calvarial organ culture. An
3o assay for bone formation is carried out as described in U.S. Patent No.
6,080,779
col. 10, II. 29-55 incorporated herein by reference. Neo-natal mouse calvariae
are
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
placed in organ culture in the presence of vehicle, AP (a negative control),
or
increasing concentrations of purified AP-RANKL. Bone morphogenetic protein
(BMP)-2 is administered as a positive control. Test compositions are
administered
for a period of 12 hours only at the initiation of the culture (1X) or once at
initiation
5 and once three days later, again for a duration of 12 hours (2X). After
seven days,
calvarial thickness is determined histomorphometrically and compared among the
various control and experimental groups to assess bone formation.
Example 22
1o In vivo stimulation of bone formation in mice. Mice, C3H/HeN (Harlan,
Indianapolis, IN) are administered 100 micrograms AP (control) or 100
micrograms
AP-RANKL subcutaneously, once a day for nine days. Histological examination of
tibia is then performed to assess the increase in bone mass and a net increase
in
the numbers of activated osteoblasts in AP-RANKL-treated as compared to
control
15 mice.
Dual-energy X-ray absorptiometry (DEXA) analysis of AP or AP-RANKL
administered mice is also conducted using standard procedures to assess the
change in bone mineral density in AP-RANKL mice compared to AP-treated mice.
2o Example 23
Ex vivo stimulation of bone formation in whole calvarial organ culfure. An
assay for bone formation is carried out as described in U.S. Patent No.
6,080,779
col. 10, II. 29-55 incorporated herein by reference. Neo-natal mouse calvariae
are
placed in organ culture in the presence of vehicle, GCN4 (a negative control),
or
25 increasing concentrations of purified GCN4-RANKL. Bone morphogenetic
protein
(BMP)-2 is administered as a positive control. Test compositions are
administered
for a period of 12 hours only at the initiation of the culture (1X) or once at
initiation
and once three days later, again for a duration of 12 hours (2X). After seven
days,
calvarial thickness is determined histomorphometrically and compared among the
3o various control and experimental groups to assess bone formation.
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
46
Example 24
In vivo stimulation of bone formation in mice. Mice, C3H/HeN (Harlan,
Indianapolis, IN) are administered 100 micrograms GCN4 (control) or 100
micrograms GCN4-RANKL subcutaneously, once a day for nine days. Histological
examination of tibia is then performed to assess the increase in bone mass and
a
net increase in the numbers of activated osteoblasts in GCN4-RANKL-treated as
compared to control mice.
Dual-energy X-ray absorptiometry (DEXA) analysis of GCN4 or GCN4-
RANKL administered mice is also conducted using standard procedures to assess
the change in bone mineral density in GCN4-RANKL mice compared to GCN4-
treated mice.
Example 25
Expression of RANKL as a GST RANKL fusion protein. cDNA encoding
murine RANKL residues 158-316 was cloned into pGEX-6p-1 (Amersham; GenBank
~5 Accession No. 078872 - see National Library of Medicine listing at
http://ncbi.nlm.nih.gov under nucleic acids.) downstream of glutathione S-
transferase using the Sall and Notl restriction endonucleases. Following IPTG-
mediated (0.05mM) induction of protein expression in BL21 (DE3) Escherischia
coli
(Invitrogen), cells were triturated into a lysis buffer comprising 150mM NaCI,
20mM
2o Tris-HCI pH 8.0, and 1 mM EDTA. Lysates were incubated with glutathione
sepharose (Amersham) for affinity purification of the GST-RANKL fusion
protein,
followed by excessive washing with buffer comprising 150mM NaCI and 20mM Tris-
HCI pH 8Ø Following competitive elution (10mM reduced glutathione) from the
affinity column, the isolated protein was then subjected to ion exchange
2s chromatography, eluted with a salt gradient ranging from 0-500mM NaCI, and
dialyzed against physiologic salt and pH. Purified GST-RANKL was then assayed
for endotoxin contamination by limulus amoebocyte lysate assay, and
quantitated for
bioactivity by an in vitro osteoclastogenesis readout.
Under conditions replicating the physiological milieu, GST-RANKL formed
30 large oligomeric complexes, as demonstrated by size exclusion
chromatography
(data not shown). The majority of the protein existed as oligomeric complexes
of
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
47
GST-RANKL (data not shown).
Example 26
Twenty, six week old C57BL/6 mice were randomly assigned to two
experimental groups. Group 1 mice (10) received 100ug injection of GST- RANKL
in
the intramedullary cavity of the right femur. Group 2 mice (10) received an
equimolar volume injection of GST vehicle in the intramedullary cavity of the
right
femur.
Mice were anesthetized with a Ketamine/Xylazine cocktail (100mg/kg
ketamine and 10mg/kg xylazine IP) and placed in left lateral recumbancy. The
major
trochanter and lateral femoral condyle of the right femur were identified and
the
intramedullary injection site was equidistant between these landmarks. The
injections were made with 29 gauge needles on tuberculin syringes. On day 9,
the
mice were re-anesthetized with Ketamine/Xylazine cocktail (100mg/kg ketamine
and
~5 10mg/kg xylazine IP) and dual energy x-ray absorptiometry (DEXA, Piximus)
analysis was done on each animal. Plain radiographs were taken immediately
following DEXA analysis (Faxitron, KV 0.15, time =20sec). Animals were
sacrificed
by COZ asphyxiation and both femurs harvested for histological analysis. The
femurs were fixed in 10% buffered formalin for 48 hours and decalcified for 1
week.
2o The DEXA analysis showed a significant difference in total bone mineral
density
(TBMD) between GST-RANKL-treated group and the control group ( see Table 1 ).
No significant difference was seen in either GST-RANKL or control group when
comparing bone mineral density of the right and left femurs (see Table 2).
There
was no significant difference in skeletal density when comparing plain
radiographs of
25 both groups.
Table 1. BMD by Group
Means and standard deviations are reported. P-values test for significant
differences between groups. They are based on unpaired t-tests.
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
48
Control RANKL p-
Variable (n = 10) (n = 10 value
Total BMD (g/cmZ) 0.0529 0.0656 0.008
0.006 0.010
Right femur BMD 0.0543 0.0632 0.02
(g/cm2) 0.006 0.004
Left femur BMD 0.0561 0.0658 0.03
(g/cm2) 0.007 0.007
Table 2. Femoral BMD by Side
Means and standard deviations for
are reported for right and each
left femurs
1o group. P-values test for nt differences n right and leftThey
significa betwee sides.
are based on paired t-tests.
Right Left Femur Difference
Femur _ p-
D ght
Group BMD (g~cm ~ L f ~ value
2
~9~cm
)
Control 0.0543 0.0561 -0.0018 0.06
0.006 0.007 0.003
GST- 0.0632 0.0658 -0.0026 0.49
RAN KL 0.004 0.007 0.006
Other features, objects and advantages of the present invention will be
apparent to those skilled in the art. The explanations and illustrations
presented
herein are intended to acquaint others skilled in the art with the invention,
its
principles, and its practical application. Those skilled in the art may adapt
and apply
the invention in its numerous forms, as may be best suited to the requirements
of a
particular use. Accordingly, the specific embodiments of the present invention
as
set forth are not intended as being exhaustive or limiting of the present
invention.
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
1
SEQUENCE LIS
<110> Barnes-Jewish Hospital, d/b/a The Jewish Hospital of St. Louis
<120> STIMULATION OF OSTEOGENESIS USING RANK LIGAND FUSION PROTEINS
<130> BJCH 10054.2
<150> US 60/277,855
<151> 2001-03-22 ,
<160> 6
<170>
PatentIn
version
3.1
<210>
1
<211>
951
<212>
DNA
<213> musculus
Mus
<400>
1
atgcgccgggccagccgagactacggcaagtacctgcgcagctcggaggagatgggcagc60
ggccccggcgtcccacacgagggtccgctgcaccccgcgccttctgcaccggctccggcg12.0
ccgccacccgccgcctcccgctccatgttcctggccctcctggggctgggactgggccag180
gtggtctgcagcatcgctctgttcctgtactttcgagcgcagatggatcctaacagaata240
tcagaagacagcactcactgcttttatagaatcctgagactccatgaaaacgcaggtttg300
caggactcgactctggagagtgaagacacactacctgactcctgcaggaggatgaaacaa360
gcctttcagggggccgtgcagaaggaactgcaacacattgtggggccacagcgcttctca420
ggagctccagctatgatggaaggctcatggttggatgtggcccagcgaggcaagcctgag480
gcccagccatttgcacacctcaccatcaatgctgccagcatcccatcgggttcccataaa540
gtcactctgtcctcttggtaccacgatcgaggctgggccaagatctctaacatgacgtta600
agcaacggaaaactaagggttaaccaagatggcttctattacctgtacgccaacatttgc660
tttcggcatcatgaaacatcgggaagcgtacctacagactatcttcagctgatggtgtat720
gtcgttaaaaccagcatcaaaatcccaagttctcataacctgatgaaaggagggagcacg780
aaaaactggtcgggcaattctgaattccacttttattccataaatgttgggggatttttc840
aagctccgagctggtgaagaaattagcattcaggtgtccaacccttccctgctggatccg900
gatcaagatgcgacgtactttggggctttcaaagttcaggacatagactga 951
<210> 2
<211> 316
<212> PRT
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
2
<213> Mus musculus
<400> 2
Met Arg Arg Ala Ser Arg Asp Tyr Gly Lys Tyr Leu Arg Ser Ser Glu
1 5 10 15
Glu Met Gly Ser Gly Pro Gly Val Pro His Glu Gly Pro Leu His Pro
20 25 30
Ala Pro Ser Ala Pro Ala Pro Ala Pro Pro Pro Ala Ala Ser Arg Ser
35 40 45
Met Phe Leu Ala Leu Leu Gly Leu Gly Leu Gly Gln Val Val Cys Ser
50 55 60
Ile Ala Leu Phe Leu Tyr Phe Arg Ala Gln Met Asp Pro Asn Arg Ile
65 70 75 80
Ser Glu Asp Ser Thr His Cys Phe Tyr Arg Ile Leu Arg Leu His Glu
85 90 95
Asn Ala Gly Leu Gln Asp Ser Thr Leu Glu Ser Glu Asp Thr Leu Pro
100 105 110
Asp Ser Cys Arg Arg Met Lys Gln Ala Phe Gln Gly Ala Val Gln Lys
115 120 125
Glu Leu Gln His Ile Val Gly Pro Gln Arg Phe Ser Gly Ala Pro Ala
130 135 140
Met Met Glu Gly Ser Trp Leu Asp Val Ala Gln Arg Gly Lys Pro Glu
145 150 155 160
Ala Gln Pro Phe Ala His Leu Thr Ile Asn Ala Ala Ser Ile Pro Ser
165 170 175
Gly Ser His Lys Val Thr Leu Ser Ser Trp Tyr His Asp Arg Gly Trp
180 185 190
Ala Lys Ile Ser Asn Met Thr Leu Ser Asn Gly Lys Leu Arg Val Asn
195 200 205
Gln Asp Gly Phe Tyr Tyr Leu Tyr Ala Asn Ile Cys Phe Arg His His
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
3
210 215 220
Glu Thr Ser Gly Ser Val Pro Thr Asp Tyr Leu Gln Leu Met Val Tyr
225 230 235 240
Val Val Lys Thr Ser Ile Lys Ile Pro Ser Ser His Asn Leu Met Lys
245 250 255
Gly Gly Ser Thr Lys Asn Trp Ser Gly Asn Ser Glu Phe His Phe Tyr
260 265 270
Ser Ile Asn Val Gly Gly Phe Phe Lys Leu Arg Ala Gly Glu Glu Ile
275 280 285
Ser Ile Gln Val Ser Asn Pro Ser Leu Leu Asp Pro Asp Gln Asp Ala
290 295 300
Thr Tyr Phe Gly Ala Phe Lys Val Gln Asp Ile Asp
305 310 315
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Primer
<400> 3
ccgcacgaca accgcaccat 20
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Primer
<400> 4
cgctccggcc cacaaatctc 20
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
CA 02441538 2003-09-22
WO 02/080955 PCT/US02/09271
4
<223> Primer
<400> 5
tctccactct tctagttcct 20
<210> 6
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> Primer
<400> 6
ttgggtcatt tccacatgc 1g
