Note: Descriptions are shown in the official language in which they were submitted.
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
NOVEL NUCLEIC ACIDS AND POLYPEPTIDES
2. BACKGROUND OF THE INVENTION
2.1 TECHNICAL FIELD
The present invention provides novel polynucleotides and proteins encoded by
such polynucleotides, along with uses for these polynucleotides and proteins,
for example
in therapeutic, diagnostic and research methods.
2.2 BACKGROUND
Technology aimed at the discovery of protein factors (including e.g.,
cytokines,
such as lymphokines, interferons, CSFs, chemokines, and interleukins) has
matured
rapidly over the past decade. The now routine hybridization cloning and
expression
cloning techniques clone novel polynucleotides "directly" in the sense that
they rely on
information directly related to the discovered protein (i.e., partial
DNA/amino acid
sequence of the protein in the case of hybridization cloning; activity of the
protein in the
case of expression cloning). More recent "indirect" cloning techniques such as
signal
sequence cloning, which isolates DNA sequences based on the presence of a now
well-recognized secretory leader sequence motif, as well as various PCR-based
or low
stringency hybridization-based cloning techniques, have advanced the state of
the art by
making available large numbers of DNA/amino acid sequences for proteins that
are
known to have biological activity, for example, by virtue of their secreted
nature in the
case of leader sequence cloning, by virtue of their cell or tissue source in
the case of
PCR-based techniques, or by virtue of structural similarity to other genes of
known
biological activity.
Identified polynucleotide and polypeptide sequences have numerous applications
in, for example, diagnostics, forensics, gene mapping; identification of
mutations
responsible for genetic disorders or other traits, to assess biodiversity, and
to produce
many other types of data and products dependent on DNA and amino acid
sequences.
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
3. SUMMARY OF THE INVENTION
The compositions of the present invention include novel isolated polypeptides,
novel
S isolated polynucleotides encoding such polypeptides, including recombinant
DNA
molecules, cloned genes or degenerate variants thereof, especially naturally
occurring
variants such as allelic variants, antisense polynucleotide molecules, and
antibodies that
specifically recognize one or more epitopes present on such polypeptides, as
well as
hybridomas producing such antibodies.
The compositions of the present invention additionally include vectors,
including
expression vectors, containing the polynucleotides of the invention, cells
genetically
engineered to contain such polynucleotides and cells genetically engineered to
express such
polynucleotides.
The present invention relates to a collection or library of at least one novel
nucleic
acid sequence assembled from,expressed sequence tags (ESTs) isolated mainly by
sequencing by hybridization (SBH), and in some cases, sequences obtained from
one or
more public databases. The invention relates also to the proteins encoded by
such
polynucleotides, along with therapeutic, diagnostic and research utilities for
these
polynucleotides and proteins. These nucleic acid sequences are designated as
SEQ ID NO:
1 - 6. The polypeptide sequences are designated SEQ ID NOS: 7 - 12. The
nucleic acids
and polypeptides are provided in the Sequence Listing. In the nucleic acids
provided in the
Sequence Listing, A is adenine; C is cytosine; G is guanine; T is thymine; and
N is any of
the four bases. In the amino acids provided in the Sequence Listing, *
corresponds to the
stop codon.
The nucleic acid sequences of the present invention also include, nucleic acid
sequences that hybridize to the complement of SEQ ID NO: 1 - 6 under stringent
hybridization conditions; nucleic acid sequences which are allelic variants or
species
homologues of any of the nucleic acid sequences recited above, or nucleic acid
sequences
that encode a peptide comprising a specific domain or truncation of the
peptides encoded by
SEQ ID NO: 7 - 12. A polynucleotide comprising a nucleotide sequence having at
least
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
90% identity to an identifying sequence of SEQ ID NO: 1 - 6 or a degenerate
variant or
fragment thereof. The identifying sequence can be 100 base pairs in length.
The nucleic acid sequences of the present invention also include the sequence
information from the nucleic acid sequences of SEQ ID NO: 1 - 6. The sequence
information can be a segment of any one of SEQ ID NO: 1 - 6 that uniquely
identifies or
represents the sequence information of SEQ ID NO: 1 - 6.
A collection as used in this application can be a collection of only one
polynucleotide. The collection of sequence information or identifying
information of each
sequence can be provided on a nucleic acid array. In one embodiment, segments
of
sequence information are provided on a nucleic acid array to detect the
polynucleotide that
contains the segment. The array can be designed to detect full-match or
mismatch to the
polynucleotide that contains the segment. The collection can also be provided
in a
computer-readable format.
This invention also includes the reverse or direct complement of any of the
nucleic
acid sequences recited above; cloning or expression vectors containing the
nucleic acid
sequences; and host cells or organisms transformed with these expression
vectors. Nucleic
acid sequences (or their reverse or direct complements) according to the
invention have
numerous applications in a variety of techniques known to those skilled in the
art of
molecular biology, such as use as hybridization probes, use as primers for
PCR, use in an
array, use in computer-readable media, use in sequencing full-length genes,
use for
chromosome and gene mapping, use in the recombinant production of protein, and
use in
the generation of anti-sense DNA or RNA, their chemical analogs and the like.
In a preferred embodiment, the nucleic acid sequences of SEQ ID NO: 1 - 6 or
novel
segments or parts of the nucleic acids of the invention are used as primers in
expression
assays that are well known in the art. In a particularly preferred embodiment,
the nucleic
acid sequences of SEQ ID NO: 1 - 6 or novel segments or parts of the nucleic
acids
provided herein are used in diagnostics for identifying expressed genes or, as
well known in
the art and exemplified by Vollrath et al., Science 258:52-59 (1992), as
expressed sequence
tags for physical mapping of the human genome.
The isolated polynucleotides of the invention include, but are not limited to,
a
polynucleotide comprising any one of the nucleotide sequences set forth in SEQ
ID NO: 1 -
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
6; a polynucleotide comprising any of the full length protein coding sequences
of SEQ ID
NO: 1 - 6; and a polynucleotide comprising any of the nucleotide sequences of
the mature
protein coding sequences of SEQ ID NO: 1 - 6. The polynucleotides of the
present invention
also include, but are not limited to, a polynucleotide that hybridizes under
stringent
hybridization conditions to (a) the complement of any one of the nucleotide
sequences set
forth in SEQ ID NO: 1 - 6; (b) a nucleotide sequence encoding any one of the
amino acid
sequences set forth in the Sequence Listing; (c) a polynucleotide which is an
allelic variant
of any polynucleotides recited above; (d) a polynucleotide which encodes a
species homolog
(e.g. orthologs) of any of the proteins recited above; or (e) a polynucleotide
that encodes a
polypeptide comprising a specific domain or truncation of any of the
polypeptides
comprising an amino acid sequence set forth in the Sequence Listing.
The isolated polypeptides of the invention include, but are not limited to, a
polypeptide comprising any of the amino acid sequences set forth in the
Sequence Listing;
or the corresponding full length or mature protein. Polypeptides of the
invention also include
I 5 polypeptides with biological activity that are encoded by (a) any of the
polynucleotides
having a nucleotide sequence set forth in SEQ ID NO: 1 - 6; or (b)
polynucleotides that
hybridize to the complement of the polynucleotides of (a) under stringent
hybridization
conditions. Biologically or immunologically active variants of any of the
polypeptide
sequences in the Sequence Listing, and "substantial equivalents" thereof
(e.g., with at least
about 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% amino acid sequence
identity)
that preferably retain biological activity are also contemplated. The
polypeptides of the
invention may be wholly or partially chemically synthesized but are preferably
produced by
recombinant means using the genetically engineered cells (e.g. host cells) of
the invention.
The invention also provides compositions comprising a polypeptide of the
invention. Polypeptide compositions of the invention may further comprise an
acceptable
carrier, such as a hydrophilic, e.g., pharmaceutically acceptable, carrier.
The invention also provides host cells transformed or transfected with a
polynucleotide of the invention.
The invention also relates to methods for producing a polypeptide of the
invention
comprising growing a culture of the host cells of the invention in a suitable
culture
medium under conditions permitting expression of the desired polypeptide, and
purifying
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
the polypeptide from the culture or from the host cells. Preferred embodiments
include
those in which the protein produced by such process is a mature form of the
protein.
Polynucleotides according to the invention have numerous applications in a
variety of techniques known to those skilled in the art of molecular biology.
These
techniques include use as hybridization probes, use as oligomers, or primers,
for PCR,
use for chromosome and gene mapping, use in the recombinant production of
protein,
and use in generation of anti-sense DNA or RNA, their chemical analogs and the
like.
For example, when the expression of an mRNA is largely restricted to a
particular cell or
tissue type, polynucleotides of the invention can be used as hybridization
probes to detect
the presence of the particular cell or tissue mRNA in a sample using, e. g.,
in situ
hybridization.
In other exemplary embodiments, the polynucleotides are used in diagnostics as
expressed sequence tags for identifying expressed genes or, as well known in
the art and
exemplified by Vollrath et al., Science 258:52-59 (1992), as expressed
sequence tags for
physical mapping of the human genome.
The polypeptides according to the invention can be used in a variety of
conventional procedures and methods that are currently applied to other
proteins. For
example, a polypeptide of the invention can be used to generate an antibody
that
specifically binds the polypeptide. Such antibodies, particularly monoclonal
antibodies,
are useful for detecting or quantitating the polypeptide in tissue. The
polypeptides of the
invention can also be used as molecular weight markers, and as a food
supplement.
Methods are also provided for preventing, treating, or ameliorating a medical
condition which comprises the step of administering to a mammalian subject a
therapeutically effective amount of a composition comprising a polypeptide of
the
present invention and a pharmaceutically acceptable carrier.
In particular, the polypeptides and polynucleotides of the invention can be
utilized, for example, in methods for the prevention and/or treatment of
disorders
involving aberrant protein expression or biological activity.
The present invention further relates to methods for detecting the presence of
the
polynucleotides or polypeptides of the invention in a sample. Such methods
can, for
example, be utilized as part of prognostic and diagnostic evaluation of
disorders as
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
recited herein and for the identification of subjects exhibiting a
predisposition to such
conditions. The invention provides a method for detecting the polynucleotides
of the
invention in a sample, comprising contacting the sample with a compound that
binds to
and forms a complex with the polynucleotide of interest for a period
sufficient to form
the complex and under conditions sufficient to form a complex and detecting
the complex
such that if a complex is detected, the polynucleotide of interest is
detected. The
invention also provides a method for detecting the polypeptides of the
invention in a
sample comprising contacting the sample with a compound that binds to and
forms a
complex with the polypeptide under conditions and for a period sufficient to
form the
complex and detecting the formation of the complex such that if a complex is
formed, the
polypeptide is detected.
The invention also provides kits comprising polynucleotide probes and/or
monoclonal antibodies, and optionally quantitative standards, for carrying out
methods of
the invention. Furthermore, the invention provides methods for evaluating the
efficacy of
drugs, and monitoring the progress of patients, involved in clinical trials
for the treatment
of disorders as recited above.
The invention also provides methods for the identification of compounds that
modulate (i.e., increase or decrease) the expression or activity of the
polynucleotides
and/or polypeptides of the invention. Such methods can be utilized, for
example, for the
identification of compounds that can ameliorate symptoms of disorders as
recited herein.
Such methods can include, but are not limited to, assays for identifying
compounds and
other substances that interact with (e.g., bind to) the polypeptides of the
invention. The
invention provides a method for identifying a compound that binds to the
polypeptides of
the invention comprising contacting the compound with a polypeptide of the
invention in
a cell for a time sufficient to form a polypeptide/compound complex, wherein
the
complex drives expression of a reporter gene sequence in the cell; and
detecting the
complex by detecting the reporter gene sequence expression such that if
expression of the
reporter gene is detected the compound that binds to a polypeptide of the
invention is
identified.
The methods of the invention also provides methods for treatment which involve
the administration of the polynucleotides or polypeptides of the invention to
individuals
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
exhibiting symptoms or tendencies. In addition, the invention encompasses
methods for
treating diseases or disorders as recited herein comprising administering
compounds and
other substances that modulate the overall activity of the target gene
products.
Compounds and other substances can effect such modulation either on the level
of target
gene/protein expression or target protein activity.
The polypeptides of the present invention and the polynucleotides encoding
them
are also useful for the same functions known to one of skill in the art as the
polypeptides
and polynucleotides to which they have homology (set forth in Table 2); for
which they
have a signature region (as set forth in Table 3); or for which they have
homology to a
gene family (as set forth in Table 4). If no homology is set forth for a
sequence, then the
polypeptides and polynucleotides of the present invention are useful for a
variety of
applications, as described herein, including use in arrays for detection.
4. DETAILED DESCRIPTION OF THE INVENTION
4.1 DEFINITIONS
It must be noted that as used herein and in the appended claims, the singular
forms "a", "an" and "the" include plural references unless the context clearly
dictates
otherwise.
The term "active" refers to those forms of the polypeptide which retain the
biologic and/or immunologic activities of any naturally occurring polypeptide.
According
to the invention, the terms "biologically active" or "biological activity"
refer to a protein
or peptide having structural, regulatory or biochemical functions of a
naturally occurring
molecule. Likewise "immunologically active" or "immunological activity" refers
to the
capability of the natural, recombinant or synthetic polypeptide to induce a
specific
immune response in appropriate animals or cells and to bind with specific
antibodies.
The term "activated cells" as used in this application are those cells which
are
engaged in extracellular or intracellular membrane trafficking, including the
export of
secretory or enzymatic molecules as part of a normal or disease process.
The terms "complementary" or "complementarity" refer to the natural binding of
polynucleotides by base pairing. For example, the sequence 5'-AGT-3' binds to
the
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
complementary sequence 3'-TCA-5'. Complementarity between two single-stranded
molecules may be "partial" such that only some of the nucleic acids bind or it
may be
"complete" such that total complementarity exists between the single stranded
molecules.
The degree of complementarity between the nucleic acid strands has significant
effects on
the efficiency and strength of the hybridization between the nucleic acid
strands.
The term "embryonic stem cells (ES)" refers to a cell that can give rise to
many
differentiated cell types in an embryo or an adult, including the germ cells.
The term
"germ line stem cells (GSCs)" refers to stem cells derived from primordial
stem cells that
provide a steady and continuous source of germ cells for the production of
gametes. The
term "primordial germ cells (PGCs)" refers to a small population of cells set
aside from
other cell lineages particularly from the yolk sac, mesenteries, or gonadal
ridges during
embryogenesis that have the potential to differentiate into germ cells and
other cells.
PGCs are the source from which GSCs and ES cells are derived The PGCs, the
GSCs
and the ES cells are capable of self renewal. Thus these cells not only
populate the germ
line and give rise to a plurality of terminally differentiated cells that
comprise the adult
specialized organs, but are able to regenerate themselves.
The term "expression modulating fragment," EMF, means a series of nucleotides
which modulates the expression of an operably linked ORF or another EMF.
As used herein, a sequence is said to "modulate the expression of an operably
linked sequence" when the expression of the sequence is altered by the
presence of the
EMF. EMFs include, but are not limited to, promoters, and promoter modulating
sequences (inducible elements). One class of EMFs are nucleic acid fragments
which
induce the expression of an operably linked ORF in response to a specific
regulatory
factor or physiological event.
The terms "nucleotide sequence" or "nucleic acid" or "polynucleotide" or
"oligonucleotide" are used interchangeably and refer to a heteropolymer of
nucleotides or
the sequence of these nucleotides. These phrases also refer to DNA or RNA of
genomic
or synthetic origin which may be single-stranded or double-stranded and may
represent
the sense or the antisense strand, to peptide nucleic acid (PNA) or to any DNA-
like or
RNA-like material. In the sequences herein A is adenine, C is cytosine, T is
thymine, G
is guanine and N is A, C, G or T (U). It is contemplated that where the
polynucleotide is
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
RNA, the T (thymine) in the sequences provided herein is substituted with U
(uracil).
Generally, nucleic acid segments provided by this invention may be assembled
from
fragments of the genome and short oligonucleotide linkers, or from a series of
oligonucleotides, or from individual nucleotides, to provide a synthetic
nucleic acid
which is capable of being expressed in a recombinant transcriptional unit
comprising
regulatory elements derived from a microbial or viral operon, or a eukaryotic
gene.
The terms "oligonucleotide fragment" or a "polynucleotide fragment",
"portion,"
or "segment" or "probe" or "primer" are used interchangeably and refer to a
sequence of
nucleotide residues which are at least about 5 nucleotides, more preferably at
least about
7 nucleotides, more preferably at least about 9 nucleotides, more preferably
at least about
11 nucleotides and most preferably at least about 17 nucleotides. The fragment
is
preferably less than about 500 nucleotides, preferably less than about 200
nucleotides,
more preferably less than about 100 nucleotides, more preferably less than
about 50
nucleotides and most preferably less than 30 nucleotides. Preferably the probe
is from
about 6 nucleotides to about 200 nucleotides, preferably from about 15 to
about 50
nucleotides, more preferably from about 17 to 30 nucleotides and most
preferably from
about 20 to 25 nucleotides. Preferably the fragments can be used in polymerase
chain
reaction (PCR), various hybridization procedures or microarray procedures to
identify or
amplify identical or related parts of mRNA or DNA molecules. A fragment or
segment
may uniquely identify each polynucleotide sequence of the present invention.
Preferably
the fragment comprises a sequence substantially similar to any one of SEQ ID
NOs: 1 - 6.
Probes may, for example, be used to determine whether specific mRNA
molecules are present in a cell or tissue or to isolate similar nucleic acid
sequences from
chromosomal DNA as described by Walsh et al. (Walsh, P.S. et al., 1992, PCR
Methods
Appl 1:241-250). They may be labeled by nick translation, Klenow fill-in
reaction, PCR,
or other methods well known in the art. Probes of the present invention, their
preparation
and/or labeling are elaborated in Sambrook, J. et al., 1989, Molecular
Cloning: A
Laboratory Manual, Cold Spring Harbor Laboratory, NY; or Ausubel, F.M. et al.,
1989,
Current Protocols in Molecular Biology, John Wiley & Sons, New York NY, both
of
which are incorporated herein by reference in their entirety.
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
The nucleic acid sequences of the present invention also include the sequence
information from the nucleic acid sequences of SEQ ID NOs: 1 - 6. The sequence
information can be a segment of any one of SEQ ID NOs: 1 - 6 that uniquely
identifies or
represents the sequence information of that sequence of SEQ ID NO: 1 - 6. One
such
5 segment can be a twenty-mer nucleic acid sequence because the probability
that a twenty-
mer is fully matched in the human genome is 1 in 300. In the human genome,
there are
three billion base pairs in one set of chromosomes. Because 4z°
possible twenty-mers
exist, there are 300 times more twenty-mers than there are base pairs in a set
of human
chromosomes. Using the same analysis, the probability for a seventeen-mer to
be fully
10 matched in the human genome is approximately 1 in 5. When these segments
are used in
arrays for expression studies, fifteen-mer segments can be used. The
probability that the
fifteen-mer is fully matched in the expressed sequences is also approximately
one in five
because expressed sequences comprise less than approximately 5% of the entire
genome
sequence.
Similarly, when using sequence information for detecting a single mismatch, a
segment can be a twenty-five mer. The probability that the twenty-five mer
would appear in
a human genome with a single mismatch is calculated by multiplying the
probability for a
full match (1=425) times the increased probability for mismatch at each
nucleotide position
(3 x 25). The probability that an eighteen mer with a single mismatch can be
detected in an
array for expression studies is approximately one in five. The probability
that a twenty-mer
with a single mismatch can be detected in a human genome is approximately one
in five.
The term "open reading frame," ORF, means a series of nucleotide triplets
coding
for amino acids without any termination codons and is a sequence translatable
into
protein.
The terms "operably linked" or "operably associated" refer to functionally
related
nucleic acid sequences. For example, a promoter is operably associated or
operably
linked with a coding sequence if the promoter controls the transcription of
the coding
sequence. While operably linked nucleic acid sequences can be contiguous and
in the
same reading frame, certain genetic elements e.g. repressor genes are not
contiguously
linked to the coding sequence but still control transcription/translation of
the coding
sequence.
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
11
The term "pluripotent" refers to the capability of a cell to differentiate
into a
number of differentiated cell types that are present in an adult organism. A
pluripotent
cell is restricted in its differentiation capability in comparison to a
totipotent cell.
The terms "polypeptide" or "peptide" or "amino acid sequence" refer to an
oligopeptide, peptide, polypeptide or protein sequence or fragment thereof and
to
naturally occurring or synthetic molecules. A polypeptide "fragment,"
"portion," or
"segment" is a stretch of amino acid residues of at least about 5 amino acids,
preferably at
least about 7 amino acids, more preferably at least about 9 amino acids and
most
preferably at least about 17 or more amino acids. The peptide preferably is
not greater
than about 200 amino acids, more preferably less than 150 amino acids and most
preferably less than 100 amino acids. Preferably the peptide is from about 5
to about 200
amino acids. To be active, any polypeptide must have sufficient length to
display
biological and/or immunological activity.
The term "naturally occurring polypeptide" refers to polypeptides produced by
cells that have not been genetically engineered and specifically contemplates
various
polypeptides arising from post-translational modifications of the polypeptide
including,
but not limited to, acetylation, carboxylation, glycosylation,
phosphorylation, lipidation
and acylation.
The term "translated protein coding portion" means a sequence which encodes
for
the full length protein which may include any leader sequence or any
processing
sequence.
The term "mature protein coding sequence" means a sequence which encodes a
peptide or protein without a signal or leader sequence. The "mature protein
portion"
means that portion of the protein which does not include a signal or leader
sequence. The
peptide may have been produced by processing in the cell which removes any
leader/signal sequence. The mature protein portion may or may not include the
initial
methionine residue. The methionine residue may be removed from the protein
during
processing in the cell. The peptide may be produced synthetically or the
protein may
have been produced using a polynucleotide only encoding for the mature protein
coding
sequence.
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
12
The term "derivative" refers to polypeptides chemically modified by such
techniques as ubiquitination, labeling (e.g., with radionuclides or various
enzymes),
covalent polymer attachment such as pegylation (derivatization with
polyethylene glycol)
and insertion or substitution by chemical synthesis of amino acids such as
ornithine,
which do not normally occur in human proteins.
The term "variant"(or "analog") refers to any polypeptide differing from
naturally
occurring polypeptides by amino acid insertions, deletions, and substitutions,
created
using, a g., recombinant DNA techniques. Guidance in determining which amino
acid
residues may be replaced, added or deleted without abolishing activities of
interest, may
be found by comparing the sequence of the particular polypeptide with that of
homologous peptides and minimizing the number of amino acid sequence changes
made
in regions of high homology (conserved regions) or by replacing amino acids
with
consensussequence.
Alternatively, recombinant variants encoding these same or similar
polypeptides
I 5 may be synthesized or selected by making use of the "redundancy" in the
genetic code.
Various codon substitutions, such as the silent changes which produce various
restriction
sites, may be introduced to optimize cloning into a plasmid or viral vector or
expression
in a particular prokaryotic or eukaryotic system. Mutations in the
polynucleotide
sequence may be reflected in the polypeptide or domains of other peptides
added to the
polypeptide to modify the properties of any part of the polypeptide, to change
characteristics such as ligand-binding affinities, interchain affinities, or
degradation/turnover rate.
Preferably, amino acid "substitutions" are the result of replacing one amino
acid
with another amino acid having similar structural and/or chemical properties,
i.e.,
conservative amino acid replacements. "Conservative" amino acid substitutions
may be
made on the basis of similarity in polarity, charge, solubility,
hydrophobicity,
hydrophilicity, and/or the amphipathic nature of the residues involved. For
example,
nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine,
valine, proline,
phenylalanine, tryptophan, and methionine; polar neutral amino acids include
glycine,
serine, threonine, cysteine, tyrosine, asparagine, and glutamine; positively
charged (basic)
amino acids include arginine, lysine, and histidine; and negatively charged
(acidic) amino
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
13
acids include aspartic acid and glutamic acid. "Insertions" or "deletions" are
preferably
in the range of about 1 to 20 amino acids, more preferably 1 to 10 amino
acids. The
variation allowed may be experimentally determined by systematically making
insertions,
deletions, or substitutions of amino acids in a polypeptide molecule using
recombinant
DNA techniques and assaying the resulting recombinant variants for activity.
Alternatively, where alteration of function is desired, insertions, deletions
or
non-conservative alterations can be engineered to produce altered
polypeptides. Such
alterations can, for example, alter one or more of the biological functions or
biochemical
characteristics of the polypeptides of the invention. For example, such
alterations may
change polypeptide characteristics such as ligand-binding affinities,
interchain affinities,
or degradation/turnover rate. Further, such alterations can be selected so as
to generate
polypeptides that are better suited for expression, scale up and the like in
the host cells
chosen for expression. For example, cysteine residues can be deleted or
substituted with
another amino acid residue in order to eliminate disulfide bridges.
The terms "purified" or "substantially purified" as used herein denotes that
the
indicated nucleic acid or polypeptide is present in the substantial absence of
other
biological macromolecules, e.g., polynucleotides, proteins, and the like. In
one
embodiment, the polynucleotide or polypeptide is purified such that it
constitutes at least
95% by weight, more preferably at least 99% by weight, of the indicated
biological
macromolecules present (but water, buffers, and other small molecules,
especially
molecules having a molecular weight of less than 1000 daltons, can be
present).
The term "isolated" as used herein refers to a nucleic acid or polypeptide
separated from at least one other component (e.g., nucleic acid or
polypeptide) present
with the nucleic acid or polypeptide in its natural source. In one embodiment,
the nucleic
acid or polypeptide is found in the presence of (if anything) only a solvent,
buffer, ion, or
other component normally present in a solution of the same. The terms
"isolated" and
"purified" do not encompass nucleic acids or polypeptides present in their
natural source.
The term "recombinant," when used herein to refer to a polypeptide or protein,
means that a polypeptide or protein is derived from recombinant (e.g.,
microbial, insect,
or mammalian) expression systems. "Microbial" refers to recombinant
polypeptides or
proteins made in bacterial or fungal (e.g., yeast) expression systems. As a
product,
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
14
"recombinant microbial" defines a polypeptide or protein essentially free of
native
endogenous substances and unaccompanied by associated native glycosylation.
Polypeptides or proteins expressed in most bacterial cultures, e.g., E. coli,
will be free of
glycosylation modifications; polypeptides or proteins expressed in yeast will
have a
S glycosylation pattern in general different from those expressed in mammalian
cells.
The term "recombinant expression vehicle or vector" refers to a plasmid or
phage
or virus or vector, for expressing a polypeptide from a DNA (RNA) sequence. An
expression vehicle can comprise a transcriptional unit comprising an assembly
of ( 1 ) a
genetic element or elements having a regulatory role in gene expression, for
example,
promoters or enhancers, (2) a structural or coding sequence which is
transcribed into
mRNA and translated into protein, and (3) appropriate transcription initiation
and
termination sequences. Structural units intended for use in yeast or
eukaryotic expression
systems preferably include a leader sequence enabling extracellular secretion
of
translated protein by a host cell. Alternatively, where recombinant protein is
expressed
without a leader or transport sequence, it may include an amino terminal
methionine
residue. This residue may or may not be subsequently cleaved from the
expressed
recombinant protein to provide a final product.
The term "recombinant expression system" means host cells which have stably
integrated a recombinant transcriptional unit into chromosomal DNA or carry
the
recombinant transcriptional unit extrachromosomally. Recombinant expression
systems
as defined herein will express heterologous polypeptides or proteins upon
induction of
the regulatory elements linked to the DNA segment or synthetic gene to be
expressed.
This term also means host cells which have stably integrated a recombinant
genetic
element or elements having a regulatory role in gene expression, for example,
promoters
or enhancers. Recombinant expression systems as defined herein will express
polypeptides or proteins endogenous to the cell upon induction of the
regulatory elements
linked to the endogenous DNA segment or gene to be expressed. The cells can be
prokaryotic or eukaryotic.
The term "secreted" includes a protein that is transported across or through a
membrane, including transport as a result of signal sequences in its amino
acid sequence
when it is expressed in a suitable host cell. "Secreted" proteins include
without limitation
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
proteins secreted wholly (e.g., soluble proteins) or partially (e.g.,
receptors) from the cell
in which they are expressed. "Secreted" proteins also include without
limitation proteins
that are transported across the membrane of the endoplasmic reticulum.
"Secreted"
proteins are also intended to include proteins containing non-typical signal
sequences
5 (e.g. Interleukin-1 Beta, see Krasney, P.A. and Young, P.R. (1992) Cytokine
4(2):134
-143) and factors released from damaged cells (e.g. Interleukin-1 Receptor
Antagonist,
see Arend, W.P. et. al. (1998) Annu. Rev. Immunol. 16:27-55)
Where desired, an expression vector may be designed to contain a "signal or
leader sequence" which will direct the polypeptide through the membrane of a
cell. Such
10 a sequence may be naturally present on the polypeptides of the present
invention or
provided from heterologous protein sources by recombinant DNA techniques.
The term "stringent" is used to refer to conditions that are commonly
understood
in the art as stringent. Stringent conditions can include highly stringent
conditions (i.e.,
hybridization to filter-bound DNA in 0.5 M NaHP04, 7% sodium dodecyl sulfate
(SDS),
15 1 mM EDTA at 65°C, and washing in O.1X SSC/0.1% SDS at 68°C),
and moderately
stringent conditions (i.e., washing in 0.2X SSC/0.1% SDS at 42°C).
Other exemplary
hybridization conditions are described herein in the examples.
In instances of hybridization of deoxyoligonucleotides, additional exemplary
stringent hybridization conditions include washing in 6X SSC/0.05% sodium
pyrophosphate at 37°C (for 14-base oligonucleotides), 48°C (for
17-base oligos), 55°C
(for 20-base oligonucleotides), and 60°C (for 23-base
oligonucleotides).
As used herein, "substantially equivalent" or "substantially similar" can
refer both
to nucleotide and amino acid sequences, for example a mutant sequence, that
varies from
a reference sequence by one or more substitutions, deletions, or additions,
the net effect
of which does not result in an adverse functional dissimilarity between the
reference and
subject sequences. Typically, such a substantially equivalent sequence varies
from one of
those listed herein by no more than about 35% (i.e., the number of individual
residue
substitutions, additions, and/or deletions in a substantially equivalent
sequence, as
compared to the corresponding reference sequence, divided by the total number
of
residues in the substantially equivalent sequence is about 0.35 or less). Such
a sequence
is said to have 65% sequence identity to the listed sequence. In one
embodiment, a
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
16
substantially equivalent, e.g., mutant, sequence of the invention varies from
a listed
sequence by no more than 30% (70% sequence identity); in a variation of this
embodiment, by no more than 25% (75% sequence identity); and in a further
variation of
this embodiment, by no more than 20% (80% sequence identity) and in a further
variation
of this embodiment, by no more than 10% (90% sequence identity) and in a
further
variation of this embodiment, by no more that 5% (95% sequence identity).
Substantially
equivalent, e.g., mutant, amino acid sequences according to the invention
preferably have
at least 80% sequence identity with a listed amino acid sequence, more
preferably at least
85% sequence identity, more preferably at least 90% sequence identity, more
preferably
at least 95% sequence identity, more preferably at least 98% sequence
identity, and most
preferably at least 99% sequence identity. Substantially equivalent nucleotide
sequence
of the invention can have lower percent sequence identities, taking into
account, for
example, the redundancy or degeneracy of the genetic code. Preferably, the
nucleotide
sequence has at least about 65% identity, more preferably at least about 75%
identity,
more preferably at least about 80% sequence identity, more preferably at least
85%
sequence identity, more preferably at least 90% sequence identity, more
preferably at
least about 95% sequence identity, more preferably at least 98% sequence
identity, and
most preferably at least 99% sequence identity. For the purposes of the
present
invention, sequences having substantially equivalent biological activity and
substantially
equivalent expression characteristics are considered substantially equivalent.
For the
purposes of determining equivalence, truncation of the mature sequence (e.g.,
via a
mutation which creates a spurious stop codon) should be disregarded. Sequence
identity
may be determined, e.g., using the Jotun Hein method (Rein, J. (1990) Methods
Enzymol. 183:626-645). Identity between sequences can also be determined by
other
methods known in the art, e.g. by varying hybridization conditions.
The term "totipotent" refers to the capability of a cell to differentiate into
all of
the cell types of an adult organism.
The term "transformation" means introducing DNA into a suitable host cell so
that the DNA is replicable, either as an extrachromosomal element, or by
chromosomal
integration. The term "transfection" refers to the taking up of an expression
vector by a
suitable host cell, whether or not any coding sequences are in fact expressed.
The term
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
17
"infection" refers to the introduction of nucleic acids into a suitable host
cell by use of a
virus or viral vector.
As used herein, an "uptake modulating fragment," UMF, means a series of
nucleotides which mediate the uptake of a linked DNA fragment into a cell.
UMFs can
be readily identified using known UMFs as a target sequence or target motif
with the
computer-based systems described below. The presence and activity of a UMF can
be
confirmed by attaching the suspected UMF to a marker sequence. The resulting
nucleic
acid molecule is then incubated with an appropriate host under appropriate
conditions and
the uptake of the marker sequence is determined. As described above, a UMF
will
increase the frequency of uptake of a linked marker sequence.
Each of the above terms is meant to encompass all that is described for each,
unless the context dictates otherwise.
4.2 NUCLEIC ACIDS OF THE INVENTION
Nucleotide sequences of the invention are set forth in the Sequence Listing.
The isolated polynucleotides of the invention include a polynucleotide
comprising
the nucleotide sequences of SEQ ID NO: 1 - 6; a polynucleotide encoding any
one of the
peptide sequences of SEQ ID NO: 7 - 12; and a polynucleotide comprising the
nucleotide
sequence encoding the mature protein coding sequence of the polynucleotides of
any one
of SEQ ID NO: 1 - 6. The polynucleotides of the present invention also
include, but are
not limited to, a polynucleotide that hybridizes under stringent conditions to
(a) the
complement of any of the nucleotides sequences of SEQ ID NO: 1 - 6; (b)
nucleotide
sequences encoding any one of the amino acid sequences set forth in the
Sequence
Listing as SEQ ID NO: 7 - 12; (c) a polynucleotide which is an allelic variant
of any
polynucleotide recited above; (d) a polynucleotide which encodes a species
homolog of
any of the proteins recited above; or (e) a polynucleotide that encodes a
polypeptide
comprising a specific domain or truncation of the polypeptides of SEQ ID NO: 7
- 12.
Domains of interest may depend on the nature of the encoded polypeptide; e.g.,
domains
in receptor-like polypeptides include ligand-binding, extracellular,
transmembrane, or
cytoplasmic domains, or combinations thereof; domains in immunoglobulin-like
proteins
include the variable immunoglobulin-like domains; domains in enzyme-like
polypeptides
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
18
include catalytic and substrate binding domains; and domains in ligand
polypeptides
include receptor-binding domains.
The polynucleotides of the invention include naturally occurring or wholly or
partially synthetic DNA, e.g., cDNA and genomic DNA, and RNA, e.g., mRNA. The
S polynucleotides may include all of the coding region of the cDNA or may
represent a
portion of the coding region of the cDNA.
The present invention also provides genes corresponding to the cDNA sequences
disclosed herein. The corresponding genes can be isolated in accordance with
known
methods using the sequence information disclosed herein. Such methods include
the
preparation of probes or primers from the disclosed sequence information for
identification
and/or amplification of genes in appropriate genomic libraries or other
sources of genomic
materials. Further 5' and 3' sequence can be obtained using methods known in
the art. For
example, full length cDNA or genomic DNA that corresponds to any of the
polynucleotides
of SEQ ID NO: 1 - 6 can be obtained by screening appropriate cDNA or genomic
DNA
I 5 libraries under suitable hybridization conditions using any of the
polynucleotides of SEQ ID
NO: 1 - 6 or a portion thereof as a probe. Alternatively, the polynucleotides
of SEQ ID
NO: 1 - 6 may be used as the basis for suitable primers) that allow
identification and/or
amplification of genes in appropriate genomic DNA or cDNA libraries.
The nucleic acid sequences of the invention can be assembled from ESTs and
sequences (including cDNA and genomic sequences) obtained from one or more
public
databases, such as dbEST, gbpri, and UniGene. The EST sequences can provide
identifying
sequence information, representative fragment or segment information, or novel
segment
information for the full-length gene.
The polynucleotides of the invention also provide polynucleotides including
nucleotide sequences that are substantially equivalent to the polynucleotides
recited
above. Polynucleotides according to the invention can have, e.g., at least
about 65%, at
least about 70%, at least about 75%, at least about 80%, 81 %, 82%, 83%, 84%,
more
typically at least about 85%, 86%, 87%, 88%, 89%, more typically at least
about 90%,
91%, 92%, 93%, 94%, and even more typically at least about 95%, 96%, 97%, 98%,
99%
sequence identity to a polynucleotide recited above.
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
19
Included within the scope of the nucleic acid sequences of the invention are
nucleic acid sequence fragments that hybridize under stringent conditions to
any of the
nucleotide sequences of SEQ ID NO: 1 - 6, or complements thereof, which
fragment is
greater than about 5 nucleotides, preferably 7 nucleotides, more preferably
greater than 9
nucleotides and most preferably greater than 17 nucleotides. Fragments of,
e.g. 15, 17, or
20 nucleotides or more that are selective for (i.e. specifically hybridize to)
any one of the
polynucleotides of the invention are contemplated. Probes capable of
specifically
hybridizing to a polynucleotide can differentiate polynucleotide sequences of
the
invention from other polynucleotide sequences in the same family of genes or
can
differentiate human genes from genes of other species, and are preferably
based on
unique nucleotide sequences.
The sequences falling within the scope of the present invention are not
limited to
these specific sequences, but also include allelic and species variations
thereof: Allelic and
species variations can be routinely determined by comparing the sequence
provided in SEQ
ID NO: 1 - 6, a representative fragment thereof, or a nucleotide sequence at
least 90%
identical, preferably 95% identical, to SEQ ID NOs: 1 - 6 with a sequence from
another
isolate of the same species. Furthermore, to accommodate codon variability,
the invention
includes nucleic acid molecules coding for the same amino acid sequences as do
the specific
ORFs disclosed herein. In other words, in the coding region of an ORF,
substitution of one
codon for another codon that encodes the same amino acid is expressly
contemplated.
The nearest neighbor or homology result for the nucleic acids of the present
invention, including SEQ ID NOs: 1 - 6, can be obtained by searching a
database using an
algorithm or a program. Preferably, a BLAST which stands for Basic Local
Alignment
Search Tool is used to search for local sequence alignments (Altshul, S.F. J
Mol. Evol. 36
290-300 (1993) and Altschul S.F. et al. J. Mol. Biol. 21:403-410 (1990)).
Alternatively a
FASTA version 3 search against Genpept, using Fastxy algorithm.
Species homologs (or orthologs) of the disclosed polynucleotides and proteins
are
also provided by the present invention. Species homologs may be isolated and
identified
by making suitable probes or primers from the sequences provided herein and
screening a
suitable nucleic acid source from the desired species.
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
The invention also encompasses allelic variants of the disclosed
polynucleotides
or proteins; that is, naturally-occurring alternative forms of the isolated
polynucleotide
which also encode proteins which are identical, homologous or related to that
encoded by
the polynucleotides.
The nucleic acid sequences of the invention are further directed to sequences
which encode variants of the described nucleic acids. These amino acid
sequence
variants may be prepared by methods known in the art by introducing
appropriate
nucleotide changes into a native or variant polynucleotide. There are two
variables in the
construction of amino acid sequence variants: the location of the mutation and
the nature
10 of the mutation. Nucleic acids encoding the amino acid sequence variants
are preferably
constructed by mutating the polynucleotide to encode an amino acid sequence
that does
not occur in nature. These nucleic acid alterations can be made at sites that
differ in the
nucleic acids from different species (variable positions) or in highly
conserved regions
(constant regions). Sites at such locations will typically be modified in
series, e.g., by
15 substituting first with conservative choices (e.g., hydrophobic amino acid
to a different
hydrophobic amino acid) and then with more distant choices (e.g., hydrophobic
amino
acid to a charged amino acid), and then deletions or insertions may be made at
the target
site. Amino acid sequence deletions generally range from about 1 to 30
residues,
preferably about 1 to 10 residues, and are typically contiguous. Amino acid
insertions
20 include amino- and/or carboxyl-terminal fusions ranging in length from one
to one
hundred or more residues, as well as intrasequence insertions of single or
multiple amino
acid residues. Intrasequence insertions may range generally from about 1 to 10
amino
residues, preferably from 1 to 5 residues. Examples of terminal insertions
include the
heterologous signal sequences necessary for secretion or for intracellular
targeting in
different host cells and sequences such as FLAG or poly-histidine sequences
useful for
purifying the expressed protein.
In a preferred method, polynucleotides encoding the novel amino acid sequences
are changed via site-directed mutagenesis. This method uses oligonucleotide
sequences
to alter a polynucleotide to encode the desired amino acid variant, as well as
sufficient
adjacent nucleotides on both sides of the changed amino acid to form a stable
duplex on
either side of the site of being changed. In general, the techniques of site-
directed
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
21
mutagenesis are well known to those of skill in the art and this technique is
exemplified
by publications such as, Edelman et al., DNA 2:183 (1983). A versatile and
efficient
method for producing site-specific changes in a polynucleotide sequence was
published
by Zoller and Smith, Nucleic Acids Res. 10:6487-6500 (1982). PCR may also be
used to
create amino acid sequence variants of the novel nucleic acids. When small
amounts of
template DNA are used as starting material, primers) that differs slightly in
sequence
from the corresponding region in the template DNA can generate the desired
amino acid
variant. PCR amplification results in a population of product DNA fragments
that differ
from the polynucleotide template encoding the polypeptide at the position
specified by
the primer. The product DNA fragments replace the corresponding region in the
plasmid
and this gives a polynucleotide encoding the desired amino acid variant.
A further technique for generating amino acid variants is the cassette
mutagenesis
technique described in Wells et al., Gene 34:315 (1985); and other mutagenesis
techniques well known in the art, such as, for example, the techniques in
Sambrook et al.,
supra, and Current Protocols in Molecular Biology, Ausubel et al. Due to the
inherent
degeneracy of the genetic code, other DNA sequences which encode substantially
the
same or a functionally equivalent amino acid sequence may be used in the
practice of the
invention for the cloning and expression of these novel nucleic acids. Such
DNA
sequences include those which are capable of hybridizing to the appropriate
novel nucleic
acid sequence under stringent conditions.
Polynucleotides encoding preferred polypeptide truncations of the invention
can
be used to generate polynucleotides encoding chimeric or fusion proteins
comprising one
or more domains of the invention and heterologous protein sequences.
The polynucleotides of the invention additionally include the complement of
any
of the polynucleotides recited above. The polynucleotide can be DNA (genomic,
eDNA,
amplified, or synthetic) or RNA. Methods and algorithms for obtaining such
polynucleotides are well known to those of skill in the art and can include,
for example,
methods for determining hybridization conditions that can routinely isolate
polynucleotides of the desired sequence identities.
In accordance with the invention, polynucleotide sequences comprising the
mature protein coding sequences corresponding to any one of SEQ ID NO: 1 - 6,
or
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
22
functional equivalents thereof, may be used to generate recombinant DNA
molecules that
direct the expression of that nucleic acid, or a functional equivalent
thereof, in
appropriate host cells. Also included are the cDNA inserts of any of the
clones identified
herein.
A polynucleotide according to the invention can be joined to any of a variety
of
other nucleotide sequences by well-established recombinant DNA techniques (see
Sambrook J et al. (1989) Molecular Cloning: A Laboratory Manual, Cold Spring
Harbor
Laboratory, NY). Useful nucleotide sequences for joining to polynucleotides
include an
assortment of vectors, e.g., plasmids, cosmids, lambda phage derivatives,
phagemids, and
the like, that are well known in the art. Accordingly, the invention also
provides a vector
including a polynucleotide of the invention and a host cell containing the
polynucleotide.
In general, the vector contains an origin of replication functional in at
least one organism,
convenient restriction endonuclease sites, and a selectable marker for the
host cell.
Vectors according to the invention include expression vectors, replication
vectors, probe
generation vectors, and sequencing vectors. A host cell according to the
invention can be
a prokaryotic or eukaryotic cell and can be a unicellular organism or part of
a
multicellular organism.
The present invention further provides recombinant constructs comprising a
nucleic acid having any of the nucleotide sequences of SEQ ID NOs: 1 - 6 or a
fragment
thereof or any other polynucleotides of the invention. In one embodiment, the
recombinant constructs of the present invention comprise a vector, such as a
plasmid or
viral vector, into which a nucleic acid having any of the nucleotide sequences
of SEQ ID
NOs: 1 - 6 or a fragment thereof is inserted, in a forward or reverse
orientation. In the
case of a vector comprising one of the ORFs of the present invention, the
vector may
further comprise regulatory sequences, including for example, a promoter,
operably
linked to the ORF. Large numbers of suitable vectors and promoters are known
to those
of skill in the art and are commercially available for generating the
recombinant
constructs of the present invention. The following vectors are provided by way
of
example. Bacterial: pBs, phagescript, PsiX 174, pBluescript SK, pBs KS, pNHBa,
pNHl6a, pNHl8a, pNH46a (Stratagene); pTrc99A, pKK223-3, pKK233-3, pDR540,
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
23
pRITS (Pharmacia). Eukaryotic: pWLneo, pSV2cat, pOG44, PXTI, pSG (Stratagene)
pSVK3, pBPV, pMSG, pSVL (Pharmacia).
The isolated polynucleotide of the invention may be operably linked to an
expression control sequence such as the pMT2 or pED expression vectors
disclosed in
Kaufman et al., Nucleic Acids Res. 19, 4485-4490 ( 1991 ), in order to produce
the protein
recombinantly. Many suitable expression control sequences are known in the
art.
General methods of expressing recombinant proteins are also known and are
exemplified
in R. Kaufman, Methods in Enzymology 185, 537-566 (1990). As defined herein
"operably linked" means that the isolated polynucleotide of the invention and
an
expression control sequence are situated within a vector or cell in such a way
that the
protein is expressed by a host cell which has been transformed (transfected)
with the
ligated polynucleotide/expression control sequence.
Promoter regions can be selected from any desired gene using CAT
(chloramphenicol transferase) vectors or other vectors with selectable
markers. Two
appropriate vectors are pKK232-8 and pCM7. Particular named bacterial
promoters
include lacI, lacZ, T3, T7, gpt, lambda PR, and trc. Eukaryotic promoters
include CMV
immediate early, HSV thymidine kinase, early and late SV40, LTRs from
retrovirus, and
mouse metallothionein-I. Selection of the appropriate vector and promoter is
well within
the level of ordinary skill in the art. Generally, recombinant expression
vectors will
include origins of replication and selectable markers permitting
transformation of the host
cell, e.g., the ampicillin resistance gene of E. coli and S. cerevisiae TRP1
gene, and a
promoter derived from a highly-expressed gene to direct transcription of a
downstream
structural sequence. Such promoters can be derived from operons encoding
glycolytic
enzymes such as 3-phosphoglycerate kinase (PGK), a-factor, acid phosphatase,
or heat
shock proteins, among others. The heterologous structural sequence is
assembled in
appropriate phase with translation initiation and termination sequences, and
preferably, a
leader sequence capable of directing secretion of translated protein into the
periplasmic
space or extracellular medium. Optionally, the heterologous sequence can
encode a
fusion protein including an amino terminal identification peptide imparting
desired
characteristics, e.g., stabilization or simplified purification of expressed
recombinant
product. Useful expression vectors for bacterial use are constructed by
inserting a
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
24
structural DNA sequence encoding a desired protein together with suitable
translation
initiation and termination signals in operable reading phase with a functional
promoter.
The vector will comprise one or more phenotypic selectable markers and an
origin of
replication to ensure maintenance of the vector and to, if desirable, provide
amplification
within the host. Suitable prokaryotic hosts for transformation include E.
coli, Bacillus
subtilis, Salmonella typhimurium and various species within the genera
Pseudomonas,
Streptomyces, and Staphylococcus, although others may also be employed as a
matter of
choice.
As a representative but non-limiting example, useful expression vectors for
bacterial use can comprise a selectable marker and bacterial origin of
replication derived
from commercially available plasmids comprising genetic elements of the well
known
cloning vector pBR322 (ATCC 37017). Such commercial vectors include, for
example,
pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GEM 1 (Promega
Biotech, Madison, WI, USA). These pBR322 "backbone" sections are combined with
an
appropriate promoter and the structural sequence to be expressed. Following
transformation of a suitable host strain and growth of the host strain to an
appropriate cell
density, the selected promoter is induced or derepressed by appropriate means
(e.g.,
temperature shift or chemical induction) and cells are cultured for an
additional period.
Cells are typically harvested by centrifugation, disrupted by physical or
chemical means,
and the resulting crude extract retained for further purification.
Polynucleotides of the invention can also be used to induce immune responses.
For example, as described in Fan et al., Nat. Biotech. 17:870-872 (1999),
incorporated
herein by reference, nucleic acid sequences encoding a polypeptide may be used
to
generate antibodies against the encoded polypeptide following topical
administration of
naked plasmid DNA or following injection, and preferably intra-muscular
injection of the
DNA. The nucleic acid sequences are preferably inserted in a recombinant
expression
vector and may be in the form of naked DNA.
4.3 ANTISENSE
Another aspect of the invention pertains to isolated antisense nucleic acid
molecules that are hybridizable to or complementary to the nucleic acid
molecule
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
comprising the nucleotide sequence of SEQ ID NO: 1 - 6, or fragments, analogs
or
derivatives thereof. An "antisense" nucleic acid comprises a nucleotide
sequence that is
complementary to a "sense" nucleic acid encoding a protein, e.g.,
complementary to the
coding strand of a double-stranded cDNA molecule or complementary to an mRNA
5 sequence. In specific aspects, antisense nucleic acid molecules are provided
that
comprise a sequence complementary to at least about 10, 25, 50, 100, 250 or
500
nucleotides or an entire coding strand, or to only a portion thereof. Nucleic
acid
molecules encoding fragments, homologs, derivatives and analogs of a protein
of any of
SEQ ID NO: 7 - 12 or antisense nucleic acids complementary to a nucleic acid
sequence
10 of SEQ ID NO: 1 - 6 are additionally provided.
In one embodiment, an antisense nucleic acid molecule is antisense to a
"coding
region" of the coding strand of a nucleotide sequence of the invention. The
term "coding
region" refers to the region of the nucleotide sequence comprising codons
which are
translated into amino acid residues. In another embodiment, the antisense
nucleic acid
15 molecule is antisense to a "noncoding region" of the coding strand of a
nucleotide
sequence of the invention. The term "noncoding region" refers to 5' and 3'
sequences that
flank the coding region that are not translated into amino acids (i.e., also
referred to as 5'
and 3' untranslated regions).
Given the coding strand sequences encoding a nucleic acid disclosed herein
(e.g.,
20 SEQ ID NO: 1 - 6, antisense nucleic acids of the invention can be designed
according to
the rules of Watson and Crick or Hoogsteen base pairing. The antisense nucleic
acid
molecule can be complementary to the entire coding region of an mRNA, but more
preferably is an oligonucleotide that is antisense to only a portion of the
coding or
noncoding region of an mRNA. For example, the antisense oligonucleotide can be
25 complementary to the region surrounding the translation start site of an
mRNA. An
antisense oligonucleotide can be, for example, about 5, 10, 15, 20, 25, 30,
35, 40, 45 or
50 nucleotides in length. An antisense nucleic acid of the invention can be
constructed
using chemical synthesis or enzymatic ligation reactions using procedures
known in the
art. For example, an antisense nucleic acid (e.g., an antisense
oligonucleotide) can be
chemically synthesized using naturally occurring nucleotides or variously
modified
nucleotides designed to increase the biological stability of the molecules or
to increase
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
26
the physical stability of the duplex formed between the antisense and sense
nucleic acids,
e.g., phosphorothioate derivatives and acridine substituted nucleotides can be
used.
Examples of modified nucleotides that can be used to generate the antisense
nucleic acid include: 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-
iodouracil,
hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil,
5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil,
dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine,
1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine,
2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-
methylguanine,
5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil,
beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil, S-methoxyuracil,
2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine,
pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-
thiouracil,
5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid
(v),
5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and
2,6-diaminopurine. Alternatively, the antisense nucleic acid can be produced
biologically
using an expression vector into which a nucleic acid has been subcloned in an
antisense
orientation (i.e., RNA transcribed from the inserted nucleic acid will be of
an antisense
orientation to a target nucleic acid of interest, described further in the
following
subsection).
The antisense nucleic acid molecules of the invention are typically
administered
to a subject or generated in situ such that they hybridize with or bind to
cellular mRNA
and/or genomic DNA encoding a protein according to the invention to thereby
inhibit
expression of the protein, e.g., by inhibiting transcription and/or
translation. The
hybridization can be by conventional nucleotide complementarity to form a
stable duplex,
or, for example, in the case of an antisense nucleic acid molecule that binds
to DNA
duplexes, through specific interactions in the major groove of the double
helix. An
example of a route of administration of antisense nucleic acid molecules of
the invention
includes direct injection at a tissue site. Alternatively, antisense nucleic
acid molecules
can be modified to target selected cells and then administered systemically.
For example,
for systemic administration, antisense molecules can be modified such that
they
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
27
specifically bind to receptors or antigens expressed on a selected cell
surface, e.g., by
linking the antisense nucleic acid molecules to peptides or antibodies that
bind to cell
surface receptors or antigens. The antisense nucleic acid molecules can also
be delivered
to cells using the vectors described herein. To achieve sufficient
intracellular
concentrations of antisense molecules, vector constructs in which the
antisense nucleic
acid molecule is placed under the control of a strong pol II or pol III
promoter are
preferred.
In yet another embodiment, the antisense nucleic acid molecule of the
invention is
an a-anomeric nucleic acid molecule. An a-anomeric nucleic acid molecule forms
specific double-stranded hybrids with complementary RNA in which, contrary to
the usual
a-units, the strands run parallel to each other (Gaultier et al. (1987)
Nucleic Acids Res 1 S:
6625-6641 ). The antisense nucleic acid molecule can also comprise a
2'-o-methylribonucleotide (moue et al. (1987) Nucleic Acids Res 15: 6131-6148)
or a
chimeric RNA -DNA analogue (moue et al. ( 1987) FEBS Lett 215: 327-330).
4.4 RIBOZYMES AND PNA MOIETIES
In still another embodiment, an antisense nucleic acid of the invention is a
ribozyme. Ribozymes are catalytic RNA molecules with ribonuclease activity
that are
capable of cleaving a single-stranded nucleic acid, such as an mRNA, to which
they have
a complementary region. Thus, ribozymes (e.g., hammerhead ribozymes (described
in
Haselhoff and Gerlach (1988) Nature 334:585-591)) can be used to catalytically
cleave
mRNA transcripts to thereby inhibit translation of an mRNA. A ribozyme having
specificity for a nucleic acid of the invention can be designed based upon the
nucleotide
sequence of a DNA disclosed herein (i.e., SEQ ID NO: 1 - 6). For example, a
derivative
of Tetrahymena L-19 IVS RNA can be constructed in which the nucleotide
sequence of
the active site is complementary to the nucleotide sequence to be cleaved in a
mRNA.
See, e.g., Cech et al. U.S. Pat. No. 4,987,071; and Cech et al. U.S. Pat. No.
5,116,742.
Alternatively, mRNA of the invention can be used to select a catalytic RNA
having a
specific ribonuclease activity from a pool of RNA molecules. See, e.g., Bartel
et al.,
(1993) Science 261:1411-1418.
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
28
Alternatively, gene expression can be inhibited by targeting nucleotide
sequences
complementary to the regulatory region (e.g., promoter and/or enhancers) to
form triple
helical structures that prevent transcription of the gene in target cells. See
generally,
Helene. ( 1991 ) Anticancer Drug Des. 6: 569-84; Helene. et al. ( 1992) Ann.
N. Y. Acad.
Sci. 660:27-36; and Maher (1992) Bioassays 14: 807-15.
In various embodiments, the nucleic acids of the invention can be modified at
the
base moiety, sugar moiety or phosphate backbone to improve, e.g., the
stability,
hybridization, or solubility of the molecule. For example, the deoxyribose
phosphate
backbone of the nucleic acids can be modified to generate peptide nucleic
acids (see
Hyrup et al. (1996) Bioorg Med Chem 4: 5-23). As used herein, the terms
"peptide
nucleic acids" or "PNAs" refer to nucleic acid mimics, e.g., DNA mimics, in
which the
deoxyribose phosphate backbone is replaced by a pseudopeptide backbone and
only the
four natural nucleobases are retained. The neutral backbone of PNAs has been
shown to
allow for specific hybridization to DNA and RNA under conditions of low ionic
strength.
The synthesis of PNA oligomers can be performed using standard solid phase
peptide
synthesis protocols as described in Hyrup et al. (1996) above; Perry-O'Keefe
et al. (1996)
PNAS 93: 14670-675.
PNAs of the invention can be used in therapeutic and diagnostic applications.
For
example, PNAs can be used as antisense or antigene agents for sequence-
specific
modulation of gene expression by, e.g., inducing transcription or translation
arrest or
inhibiting replication. PNAs of the invention can also be used, e.g., in the
analysis of
single base pair mutations in a gene by, e.g., PNA directed PCR clamping; as
artificial
restriction enzymes when used in combination with other enzymes, e.g., Sl
nucleases
(Hyrup B. ( 1996) above); or as probes or primers for DNA sequence and
hybridization
(Hyrup et al. (1996), above; Perry-O'Keefe (1996), above).
In another embodiment, PNAs of the invention can be modified, e.g., to enhance
their stability or cellular uptake, by attaching lipophilic or other helper
groups to PNA, by
the formation of PNA-DNA chimeras, or by the use of liposomes or other
techniques of
drug delivery known in the art. For example, PNA-DNA chimeras can be generated
that
may combine the advantageous properties of PNA and DNA. Such chimeras allow
DNA
recognition enzymes, e.g., RNase H and DNA polymerases, to interact with the
DNA
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
29
portion while the PNA portion would provide high binding affinity and
specificity.
PNA-DNA chimeras can be linked using linkers of appropriate lengths selected
in terms
of base stacking, number of bonds between the nucleobases, and orientation
(Hyrup
(1996) above). The synthesis of PNA-DNA chimeras can be performed as described
in
Hyrup (1996) above and Finn et al. (1996) Nucl Acids Res 24: 3357-63. For
example, a
DNA chain can be synthesized on a solid support using standard phosphoramidite
coupling chemistry, and modified nucleoside analogs, e.g.,
5'-(4-methoxytrityl)amino-5'-deoxy-thymidine phosphoramidite, can be used
between the
PNA and the 5' end of DNA (Mag et al. (1989) Nucl Acid Res 17: 5973-88). PNA
monomers are then coupled in a stepwise manner to produce a chimeric molecule
with a
5' PNA segment and a 3' DNA segment (Finn et al. ( 1996) above).
Alternatively,
chimeric molecules can be synthesized with a 5' DNA segment and a 3' PNA
segment.
See, Petersen et al. (1975) Bioorg Med Chem Lett 5: 1119-11124.
In other embodiments, the oligonucleotide may include other appended groups
such as peptides (e.g., for targeting host cell receptors in vivo), or agents
facilitating
transport across the cell membrane (see, e.g., Letsinger et al., 1989, Proc.
Natl. Acad. Sci.
U.S.A. 86:6553-6556; Lemaitre et al., 1987, Proc. Natl. Acad Sci. 84:648-652;
PCT
Publication No. W088/09810) or the blood-brain barrier (see, e.g., PCT
Publication No.
W089/10134). In addition, oligonucleotides can be modified with hybridization
triggered
cleavage agents (See, e.g., Krol et al., 1988, BioTechniques 6:958-976) or
intercalating
agents. (See, e.g., Zon, 1988, Pharm. Res. 5: 539-549). To this end, the
oligonucleotide
may be conjugated to another molecule, e.g., a peptide, a hybridization
triggered
cross-linking agent, a transport agent, a hybridization-triggered cleavage
agent, etc.
4.5 HOSTS
The present invention further provides host cells genetically engineered to
contain
the polynucleotides of the invention. For example, such host cells may contain
nucleic
acids of the invention introduced into the host cell using known
transformation,
transfection or infection methods. The present invention still further
provides host cells
genetically engineered to express the polynucleotides of the invention,
wherein such
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
polynucleotides are in operative association with a regulatory sequence
heterologous to
the host cell which drives expression of the polynucleotides in the cell.
Knowledge of nucleic acid sequences allows for modification of cells to
permit,
or increase, expression of endogenous polypeptide. Cells can be modified
(e.g., by
5 homologous recombination) to provide increased polypeptide expression by
replacing, in
whole or in part, the naturally occurring promoter with all or part of a
heterologous
promoter so that the cells express the polypeptide at higher levels. The
heterologous
promoter is inserted in such a manner that it is operatively linked to the
encoding
sequences. See, for example, PCT International Publication No. W094/12650, PCT
10 International Publication No. W092/20808, and PCT International Publication
No.
W091/09955. It is also contemplated that, in addition to heterologous promoter
DNA,
amplifiable marker DNA (e.g., ada, dhfr, and the multifunctional CAD gene
which
encodes carbamyl phosphate synthase, aspartate transcarbamylase, and
dihydroorotase)
and/or intron DNA may be inserted along with the heterologous promoter DNA. If
15 linked to the coding sequence, amplification of the marker DNA by standard
selection
methods results in co-amplification of the desired protein coding sequences in
the cells.
The host cell can be a higher eukaryotic host cell, such as a mammalian cell,
a
lower eukaryotic host cell, such as a yeast cell, or the host cell can be a
prokaryotic cell,
such as a bacterial cell. Introduction of the recombinant construct into the
host cell can
20 be effected by calcium phosphate transfection, DEAE, dextran mediated
transfection, or
electroporation (Davis, L. et al., Basic Methods in Molecular Biology (1986)).
The host
cells containing one of the polynucleotides of the invention, can be used in
conventional
manners to produce the gene product encoded by the isolated fragment (in the
case of an
ORF) or can be used to produce a heterologous protein under the control of the
EMF.
25 Any host/vector system can be used to express one or more of the ORFs of
the
present invention. These include, but are not limited to, eukaryotic hosts
such as HeLa
cells, Cv-1 cell, COS cells, 293 cells, and Sf9 cells, as well as prokaryotic
host such as E.
coli and B. subtilis. The most preferred cells are those which do not normally
express the
particular polypeptide or protein or which expresses the polypeptide or
protein at low
30 natural level. Mature proteins can be expressed in mammalian cells, yeast,
bacteria, or
other cells under the control of appropriate promoters. Cell-free translation
systems can
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
31
also be employed to produce such proteins using RNAs derived from the DNA
constructs
of the present invention. Appropriate cloning and expression vectors for use
with
prokaryotic and eukaryotic hosts are described by Sambrook, et al., in
Molecular
Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, New York
(1989),
the disclosure of which is hereby incorporated by reference.
Various mammalian cell culture systems can also be employed to express
recombinant protein. Examples of mammalian expression systems include the COS-
7
lines of monkey kidney fibroblasts, described by Gluzman, Cell 23:175 ( 1981
). Other
cell lines capable of expressing a compatible vector are, for example, the
C127, monkey
COS cells, Chinese Hamster Ovary (CHO) cells, human kidney 293 cells, human
epidermal A431 cells, human Co1o205 cells, 3T3 cells, CV-1 cells, other
transformed
primate cell lines, normal diploid cells, cell strains derived from in vitro
culture of
primary tissue, primary explants, HeLa cells, mouse L cells, BHK, HL-60, U937,
HaK or
Jurkat cells. Mammalian expression vectors will comprise an origin of
replication, a
suitable promoter and also any necessary ribosome binding sites,
polyadenylation site,
splice donor and acceptor sites, transcriptional termination sequences, and 5'
flanking
nontranscribed sequences. DNA sequences derived from the SV40 viral genome,
for
example, SV40 origin, early promoter, enhancer, splice, and polyadenylation
sites may be
used to provide the required nontranscribed genetic elements. Recombinant
polypeptides
and proteins produced in bacterial culture are usually isolated by initial
extraction from
cell pellets, followed by one or more salting-out, aqueous ion exchange or
size exclusion
chromatography steps. Protein refolding steps can be used, as necessary, in
completing
configuration of the mature protein. Finally, high performance liquid
chromatography
(HPLC) can be employed for final purification steps. Microbial cells employed
in
expression of proteins can be disrupted by any convenient method, including
freeze-thaw
cycling, sonication, mechanical disruption, or use of cell lysing agents.
Alternatively, it may be possible to produce the protein in lower eukaryotes
such
as yeast or insects or in prokaryotes such as bacteria. Potentially suitable
yeast strains
include Saccharomyces cerevisiae, Schizosaccharomyces pombe, Kluyveromyces
strains,
Candida, or any yeast strain capable of expressing heterologous proteins.
Potentially
suitable bacterial strains include Escherichia coli, Bacillus subtilis,
Salmonella
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
32
typhimurium, or any bacterial strain capable of expressing heterologous
proteins. If the
protein is made in yeast or bacteria, it may be necessary to modify the
protein produced
therein, for example by phosphorylation or glycosylation of the appropriate
sites, in order
to obtain the functional protein. Such covalent attachments may be
accomplished using
known chemical or enzymatic methods.
In another embodiment of the present invention, cells and tissues may be
engineered to express an endogenous gene comprising the polynucleotides of the
invention under the control of inducible regulatory elements, in which case
the regulatory
sequences of the endogenous gene may be replaced by homologous recombination.
As
described herein, gene targeting can be used to replace a gene's existing
regulatory region
with a regulatory sequence isolated from a different gene or a novel
regulatory sequence
synthesized by genetic engineering methods. Such regulatory sequences may be
comprised of promoters, enhancers, scaffold-attachment regions, negative
regulatory
elements, transcriptional initiation sites, regulatory protein binding sites
or combinations
of said sequences. Alternatively, sequences which affect the structure or
stability of the
RNA or protein produced may be replaced, removed, added, or otherwise modified
by
targeting. These sequence include polyadenylation signals, mRNA stability
elements,
splice sites, leader sequences for enhancing or modifying transport or
secretion properties
of the protein, or other sequences which alter or improve the function or
stability of
protein or RNA molecules.
The targeting event may be a simple insertion of the regulatory sequence,
placing
the gene under the control of the new regulatory sequence, e.g., inserting a
new promoter
or enhancer or both upstream of a gene. Alternatively, the targeting event may
be a
simple deletion of a regulatory element, such as the deletion of a tissue-
specific negative
regulatory element. Alternatively, the targeting event may replace an existing
element;
for example, a tissue-specific enhancer can be replaced by an enhancer that
has broader
or different cell-type specificity than the naturally occurring elements.
Here, the
naturally occurring sequences are deleted and new sequences are added. In all
cases, the
identification of the targeting event may be facilitated by the use of one or
more
selectable marker genes that are contiguous with the targeting DNA, allowing
for the
selection of cells in which the exogenous DNA has integrated into the host
cell genome.
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
33
The identification of the targeting event may also be facilitated by the use
of one or more
marker genes exhibiting the property of negative selection, such that the
negatively
selectable marker is linked to the exogenous DNA, but configured such that the
negatively selectable marker flanks the targeting sequence, and such that a
correct
homologous recombination event with sequences in the host cell genome does not
result
in the stable integration of the negatively selectable marker. Markers useful
for this
purpose include the Herpes Simplex Virus thymidine kinase (TK) gene or the
bacterial
xanthine-guanine phosphoribosyl-transferase (gpt) gene.
The gene targeting or gene activation techniques which can be used in
accordance
with this aspect of the invention are more particularly described in U.S.
Patent No.
5,272,071 to Chappel; U.S. Patent No. 5,578,461 to Sherwin et al.;
International
Application No. PCT/LTS92/09627 (W093/09222) by Selden et al.; and
international
Application No. PCT/US90/06436 (W091/06667) by Skoultchi et al., each of which
is
incorporated by reference herein in its entirety.
4.6 POLYPEPTIDES OF THE INVENTION
The isolated polypeptides of the invention include, but are not limited to, a
polypeptide comprising: the amino acid sequences set forth as any one of SEQ
ID NO: 7
- 12 or an amino acid sequence encoded by any one of the nucleotide sequences
SEQ ID
NOs: 1 - 6 or the corresponding full length or mature protein. Polypeptides of
the
invention also include polypeptides preferably with biological or
immunological activity
that are encoded by: (a) a polynucleotide having any one of the nucleotide
sequences set
forth in SEQ ID NOs: 1 - 6 or (b) polynucleotides encoding any one of the
amino acid
sequences set forth as SEQ ID NO: 7 - 12 or (c) polynucleotides that hybridize
to the
complement of the polynucleotides of either (a) or (b) under stringent
hybridization
conditions. The invention also provides biologically active or immunologically
active
variants of any of the amino acid sequences set forth as SEQ ID NO: 7 - 12 or
the
corresponding full length or mature protein; and "substantial equivalents"
thereof (e.g.,
with at least about 65%, at least about 70%, at least about 75%, at least
about 80%, at
least about 85%, 86%, 87%, 88%, 89%, at least about 90%, 91%, 92%, 93%, 94%,
typically at least about 95%, 96%, 97%, more typically at least about 98%, or
most
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
34
typically at least about 99% amino acid identity) that retain biological
activity.
Polypeptides encoded by allelic variants may have a similar, increased, or
decreased
activity compared to polypeptides comprising SEQ ID NO: 7 - 12.
Fragments of the proteins of the present invention which are capable of
exhibiting
biological activity are also encompassed by the present invention. Fragments
of the
protein may be in linear form or they may be cyclized using known methods, for
example, as described in H. U. Saragovi, et al., Bio/Technology 10, 773-778
(1992) and
in R. S. McDowell, et al., J. Amer. Chem. Soc. 114, 9245-9253 (1992), both of
which are
incorporated herein by reference. Such fragments may be fused to carrier
molecules such
as immunoglobulins for many purposes, including increasing the valency of
protein
binding sites.
The present invention also provides both full-length and mature forms (for
example, without a signal sequence or precursor sequence) of the disclosed
proteins. The
protein coding sequence is identified in the sequence listing by translation
of the
disclosed nucleotide sequences. The mature form of such protein may be
obtained by
expression of a full-length polynucleotide in a suitable mammalian cell or
other host cell.
The sequence of the mature form of the protein is also determinable from the
amino acid
sequence of the full-length form. Where proteins of the present invention are
membrane
bound, soluble forms of the proteins are also provided. In such forms, part or
all of the
regions causing the proteins to be membrane bound are deleted so that the
proteins are
fully secreted from the cell in which they are expressed.
Protein compositions of the present invention may further comprise an
acceptable
carrier, such as a hydrophilic, e.g., pharmaceutically acceptable, carrier.
The present invention further provides. isolated polypeptides encoded by the
nucleic acid fragments of the present invention or by degenerate variants of
the nucleic
acid fragments of the present invention. By "degenerate variant" is intended
nucleotide
fragments which differ from a nucleic acid fragment of the present invention
(e.g., an
ORF) by nucleotide sequence but, due to the degeneracy of the genetic code,
encode an
identical polypeptide sequence. Preferred nucleic acid fragments of the
present invention
are the ORFs that encode proteins.
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
A variety of methodologies known in the art can be utilized to obtain any one
of
the isolated polypeptides or proteins of the present invention. At the
simplest level, the
amino acid sequence can be synthesized using commercially available peptide
synthesizers. The synthetically-constructed protein sequences, by virtue of
sharing
S primary, secondary or tertiary structural and/or conformational
characteristics with
proteins may possess biological properties in common therewith, including
protein
activity. This technique is particularly useful in producing small peptides
and fragments
of larger polypeptides. Fragments are useful, for example, in generating
antibodies
against the native polypeptide. Thus, they may be employed as biologically
active or
10 immunological substitutes for natural, purified proteins in screening of
therapeutic
compounds and in immunological processes for the development of antibodies.
The polypeptides and proteins of the present invention can alternatively be
purified from cells which have been altered to express the desired polypeptide
or protein.
As used herein, a cell is said to be altered to express a desired polypeptide
or protein
15 when the cell, through genetic manipulation, is made to produce a
polypeptide or protein
which it normally does not produce or which the cell normally produces at a
lower level.
One skilled in the art can readily adapt procedures for introducing and
expressing either
recombinant or synthetic sequences into eukaryotic or prokaryotic cells in
order to
generate a cell which produces one of the polypeptides or proteins of the
present
20 invention.
The invention also relates to methods for producing a polypeptide comprising
growing a culture of host cells of the invention in a suitable culture medium,
and
purifying the protein from the cells or the culture in which the cells are
grown. For
example, the methods of the invention include a process for producing a
polypeptide in
25 which a host cell containing a suitable expression vector that includes a
polynucleotide of
the invention is cultured under conditions that allow expression of the
encoded
polypeptide. The polypeptide can be recovered from the culture, conveniently
from the
culture medium, or from a lysate prepared from the host cells and further
purified.
Preferred embodiments include those in which the protein produced by such
process is a
30 full length or mature form of the protein.
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
36
In an alternative method, the polypeptide or protein is purified from
bacterial
cells which naturally produce the polypeptide or protein. One skilled in the
art can
readily follow known methods for isolating polypeptides and proteins in order
to obtain
one of the isolated polypeptides or proteins of the present invention. These
include, but
are not limited to, immunochromatography, HPLC, size-exclusion chromatography,
ion-exchange chromatography, and immuno-affinity chromatography. See, e.g.,
Scopes,
Protein Purification: Principles and Practice, Springer-Verlag (1994);
Sambrook, et al.,
in Molecular Cloning: A Laboratory Manual; Ausubel et al., Current Protocols
in
Molecular Biology. Polypeptide fragments that retain biological/immunological
activity
include fragments comprising greater than about 100 amino acids, or greater
than about
200 amino acids, and fragments that encode specific protein domains.
The purified polypeptides can be used in in vitro binding assays which are
well
known in the art to identify molecules which bind to the polypeptides. These
molecules
include but are not limited to, for e.g., small molecules, molecules from
combinatorial
1 S libraries, antibodies or other proteins. The molecules identified in the
binding assay are
then tested for antagonist or agonist activity in in vivo tissue culture or
animal models
that are well known in the art. In brief, the molecules are titrated into a
plurality of cell
cultures or animals and then tested for either cell/animal death or prolonged
survival of
the animal/cells.
In addition, the peptides of the invention or molecules capable of binding to
the
peptides may be complexed with toxins, e.g., ricin or cholera, or with other
compounds
that are toxic to cells. The toxin-binding molecule complex is then targeted
to a tumor or
other cell by the specificity of the binding molecule for SEQ ID NO: 7 - 12.
The protein of the invention may also be expressed as a product of transgenic
animals, e.g., as a component of the milk of transgenic cows, goats, pigs, or
sheep which
are characterized by somatic or germ cells containing a nucleotide sequence
encoding the
protein.
The proteins provided herein also include proteins characterized by amino acid
sequences similar to those of purified proteins but into which modification
are naturally
provided or deliberately engineered. For example, modifications, in the
peptide or DNA
sequence, can be made by those skilled in the art using known techniques.
Modifications
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
37
of interest in the protein sequences may include the alteration, substitution,
replacement,
insertion or deletion of a selected amino acid residue in the coding sequence.
For
example, one or more of the cysteine residues may be deleted or replaced with
another
amino acid to alter the conformation of the molecule. Techniques for such
alteration,
substitution, replacement, insertion or deletion are well known to those
skilled in the art
(see, e.g., U.S. Pat. No. 4,518,584). Preferably, such alteration,
substitution, replacement,
insertion or deletion retains the desired activity of the protein. Regions of
the protein that
are important for the protein function can be determined by various methods
known in
the art including the alanine-scanning method which involved systematic
substitution of
single or strings of amino acids with alanine, followed by testing the
resulting
alanine-containing variant for biological activity. This type of analysis
determines the
importance of the substituted amino acids) in biological activity. Regions of
the protein
that are important for protein function may be determined by the eMATRIX
program.
Other fragments and derivatives of the sequences of proteins which would be
expected to retain protein activity in whole or in part and are useful for
screening or other
immunological methodologies may also be easily made by those skilled in the
art given
the disclosures herein. Such modifications are encompassed by the present
invention.
The protein may also be produced by operably linking the isolated
polynucleotide
of the invention to suitable control sequences in one or more insect
expression vectors,
and employing an insect expression system. Materials and methods for
baculovirus/insect cell expression systems are commercially available in kit
form from,
e.g., Invitrogen, San Diego, Calif., U.S.A. (the MaxBatT"'' kit), and such
methods are well
known in the art, as described in Summers and Smith, Texas Agricultural
Experiment
Station Bulletin No. 1555 (1987), incorporated herein by reference. As used
herein, an
insect cell capable of expressing a polynucleotide of the present invention is
"transformed."
The protein of the invention may be prepared by culturing transformed host
cells
under culture conditions suitable to express the recombinant protein. The
resulting
expressed protein may then be purified from such culture (i.e., from culture
medium or
cell extracts) using known purification processes, such as gel filtration and
ion exchange
chromatography. The purification of the protein may also include an affinity
column
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
38
containing agents which will bind to the protein; one or more column steps
over such
affinity resins as concanavalin A-agarose, heparin-toyopearlTM or Cibacrom
blue 3GA
SepharoseTM; one or more steps involving hydrophobic interaction
chromatography using
such resins as phenyl ether, butyl ether, or propyl ether; or immunoaffinity
chromatography.
Alternatively, the protein of the invention may also be expressed in a form
which
will facilitate purification. For example, it may be expressed as a fusion
protein, such as
those of maltose binding protein (MBP), glutathione-S-transferase (GST) or
thioredoxin
(TRX), or as a His tag. Kits for expression and purification of such fusion
proteins are
commercially available from New England BioLab (Beverly, Mass.), Pharmacia
(Piscataway, N.J.) and Invitrogen, respectively. The protein can also be
tagged with an
epitope and subsequently purified by using a specific antibody directed to
such epitope.
One such epitope ("FLAG~") is commercially available from Kodak (New Haven,
Conn.).
Finally, one or more reverse-phase high performance liquid chromatography (RP-
HPLC) steps employing hydrophobic RP-HPLC media, e.g., silica gel having
pendant
methyl or other aliphatic groups, can be employed to further purify the
protein. Some or
all of the foregoing purification steps, in various combinations, can also be
employed to
provide a substantially homogeneous isolated recombinant protein. The protein
thus
purified is substantially free of other mammalian proteins and is defined in
accordance
with the present invention as an "isolated protein."
The polypeptides of the invention include analogs (variants). This embraces
fragments, as well as peptides in which one or more amino acids has been
deleted,
inserted, or substituted. Also, analogs of the polypeptides of the invention
embrace
fusions of the polypeptides or modifications of the polypeptides of the
invention, wherein
the polypeptide or analog is fused to another moiety or moieties, e.g.,
targeting moiety or
another therapeutic agent. Such analogs may exhibit improved properties such
as activity
and/or stability. Examples of moieties which may be fused to the polypeptide
or an
analog include, for example, targeting moieties which provide for the delivery
of
polypeptide to pancreatic cells, e.g., antibodies to pancreatic cells,
antibodies to immune
cells such as T-cells, monocytes, dendritic cells, granulocytes, etc., as well
as receptor
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
39
and ligands expressed on pancreatic or immune cells. Other moieties which may
be
fused to the polypeptide include therapeutic agents which are used for
treatment, for
example, immunosuppressive drugs such as cyclosporin, SK506, azathioprine, CD3
antibodies and steroids. Also, polypeptides may be fused to immune modulators,
and
other cytokines such as alpha or beta interferon.
4.6.1 DETERMINING POLYPEPTIDE AND POLYNUCLEOTIDE
IDENTITY AND SIMILARITY
Preferred identity and/or similarity are designed to give the largest match
between the sequences tested. Methods to determine identity and similarity are
codified
in computer programs including, but are not limited to, the GCG program
package,
including GAP (Devereux, J., et al., Nucleic Acids Research 12(1):387 (1984);
Genetics
Computer Group, University of Wisconsin, Madison, WI), BLASTP, BLASTN,
BLASTX, FASTA (Altschul, S.F. et al., J. Molec. Biol. 215:403-410 (1990), PSI-
BLAST
(Altschul S.F. et al., Nucleic Acids Res. vol. 25, pp. 3389-3402, herein
incorporated by
reference), eMatrix software (Wu et al., J. Comp. Biol., Vol. 6, pp. 219-235
(1999),
herein incorporated by reference), eMotif software (Nevill-Manning et al, ISMB-
97, Vol.
4, pp. 202-209, herein incorporated by reference), pFam software (Sonnhammer
et al.,
Nucleic Acids Res., Vol. 26(1), pp. 320-322 (1998), herein incorporated by
reference)
and the Kyte-Doolittle hydrophobocity prediction algorithm (J. Mol Biol, 157,
pp. 105-31
(1982), incorporated herein by reference). The BLAST programs are publicly
available
from the National Center for Biotechnology Information (NCBI) and other
sources
(BLAST Manual, Altschul, S., et al. NCB NLM NIH Bethesda, MD 20894; Altschul,
S.,
et al., J. Mol. Biol. 215:403-410 (1990).
4.7 CHIMERIC AND FUSION PROTEINS
The invention also provides chimeric or fusion proteins. As used herein, a
"chimeric protein" or "fusion protein" comprises a polypeptide of the
invention
operatively linked to another polypeptide. Within a fusion protein the
polypeptide
according to the invention can correspond to all or a portion of a protein
according to the
invention. In one embodiment, a fusion protein comprises at least one
biologically active
portion of a protein according to the invention. In another embodiment, a
fusion protein
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
comprises at least two biologically active portions of a protein according to
the invention.
Within the fusion protein, the term "operatively linked" is intended to
indicate that the
polypeptide according to the invention and the other polypeptide are fused in-
frame to
each other. The polypeptide can be fused to the N-terminus or C-terminus, or
to the
5 middle.
For example, in one embodiment a fusion protein comprises a polypeptide
according to the invention operably linked to the extracellular domain of a
second
protein.
In another embodiment, the fusion protein is a GST-fusion protein in which the
10 polypeptide sequences of the invention are fused to the C-terminus of the
GST (i.e.,
glutathione S-transferase) sequences.
In another embodiment, the fusion protein is an immunoglobulin fusion protein
in
which the polypeptide sequences according to the invention comprise one or
more
domains fused to sequences derived from a member of the immunoglobulin protein
15 family. The immunoglobulin fusion proteins of the invention can be
incorporated into
pharmaceutical compositions and administered to a subject to inhibit an
interaction
between a ligand and a protein of the invention on the surface of a cell, to
thereby
suppress signal transduction in vivo. The immunoglobulin fusion proteins can
be used to
affect the bioavailability of a cognate ligand. Inhibition of the
ligand/protein interaction
20 may be useful therapeutically for both the treatment of proliferative and
differentiative
disorders, e.g., cancer as well as modulating (e.g., promoting or inhibiting)
cell survival.
Moreover, the immunoglobulin fusion proteins of the invention can be used as
immunogens to produce antibodies in a subject, to purify ligands, and in
screening assays
to identify molecules that inhibit the interaction of a polypeptide of the
invention with a
25 ligand.
A chimeric or fusion protein of the invention can be produced by standard
recombinant DNA techniques. For example, DNA fragments coding for the
different
polypeptide sequences are ligated together in-frame in accordance with
conventional
techniques, e.g., by employing blunt-ended or stagger-ended termini for
ligation,
30 restriction enzyme digestion to provide for appropriate termini, filling-in
of cohesive ends
as appropriate, alkaline phosphatase treatment to avoid undesirable joining,
and
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
41
enzymatic ligation. In another embodiment, the fusion gene can be synthesized
by
conventional techniques including automated DNA synthesizers. Alternatively,
PCR
amplification of gene fragments can be carried out using anchor primers that
give rise to
complementary overhangs between two consecutive gene fragments that can
subsequently be annealed and reamplified to generate a chimeric gene sequence
(see, for
example, Ausubel et al. (eds.) CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John
Wiley & Sons, 1992). Moreover, many expression vectors are commercially
available
that already encode a fusion moiety (e.g., a GST polypeptide). A nucleic acid
encoding a
polypeptide of the invention can be cloned into such an expression vector such
that the
fusion moiety is linked in-frame to the protein of the invention.
4.8 GENE THERAPY
Mutations in the polynucleotides of the invention gene may result in loss of
normal function of the encoded protein. The invention thus provides gene
therapy to
restore normal activity of the polypeptides of the invention; or to treat
disease states
involving polypeptides of the invention. Delivery of a functional gene
encoding
polypeptides of the invention to appropriate cells is effected ex vivo, in
situ, or in vivo by
use of vectors, and more particularly viral vectors (e.g., adenovirus, adeno-
associated
virus, or a retrovirus), or ex vivo by use of physical DNA transfer methods
(e.g.,
liposomes or chemical treatments). See, for example, Anderson, Nature,
supplement to
vol. 392, no. 6679, pp.25-20 (1998). For additional reviews of gene therapy
technology
see Friedmann, Science, 244: 1275-1281 (1989); Verma, Scientific American: 68-
84
(1990); and Miller, Nature, 357: 455-460 (1992). Introduction of any one of
the
nucleotides of the present invention or a gene encoding the polypeptides of
the present
invention can also be accomplished with extrachromosomal substrates (transient
expression) or artificial chromosomes (stable expression). Cells may also be
cultured ex
vivo in the presence of proteins of the present invention in order to
proliferate or to
produce a desired effect on or activity in such cells. Treated cells can then
be introduced
in vivo for therapeutic purposes. Alternatively, it is contemplated that in
other human
disease states, preventing the expression of or inhibiting the activity of
polypeptides of
the invention will be useful in treating the disease states. It is
contemplated that antisense
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
42
therapy or gene therapy could be applied to negatively regulate the expression
of
polypeptides of the invention.
Other methods inhibiting expression of a protein include the introduction of
antisense molecules to the nucleic acids of the present invention, their
complements, or their
translated RNA sequences, by methods known in the art. Further, the
polypeptides of the
present invention can be inhibited by using targeted deletion methods, or the
insertion of a
negative regulatory element such as a silencer, which is tissue specific.
The present invention still further provides cells genetically engineered in
vivo to
express the polynucleotides of the invention, wherein such polynucleotides are
in operative
association with a regulatory sequence heterologous to the host cell which
drives expression
of the polynucleotides in the cell. These methods can be used to increase or
decrease the
expression of the polynucleotides of the present invention.
Knowledge of DNA sequences provided by the invention allows for modification
of
cells to permit, increase, or decrease, expression of endogenous polypeptide.
Cells can be
modified (e.g., by homologous recombination) to provide increased polypeptide
expression
by replacing, in whole or in part, the naturally occurring promoter with all
or part of a
heterologous promoter so that the cells express the protein at higher levels.
The heterologous
promoter is inserted in such a manner that it is operatively linked to the
desired protein
encoding sequences. See, for example, PCT International Publication No. WO
94/12650,
PCT International Publication No. WO 92/20808, and PCT International
Publication No.
WO 91/09955. It is also contemplated that, in addition to heterologous
promoter DNA,
amplifiable marker DNA (e.g., ada, dhfr, and the multifunctional CAD gene
which encodes
carbamyl phosphate synthase, aspartate transcarbamylase, and dihydroorotase)
and/or intron
DNA may be inserted along with the heterologous promoter DNA. If linked to the
desired
protein coding sequence, amplification of the marker DNA by standard selection
methods
results in co-amplification of the desired protein coding sequences in the
cells.
In another embodiment of the present invention, cells and tissues may be
engineered
to express an endogenous gene comprising the polynucleotides of the invention
under the
control of inducible regulatory elements, in which case the regulatory
sequences of the
endogenous gene may be replaced by homologous recombination. As described
herein,
gene targeting can be used to replace a gene's existing regulatory region with
a regulatory
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
43
sequence isolated from a different gene or a novel regulatory sequence
synthesized by
genetic engineering methods. Such regulatory sequences may be comprised of
promoters,
enhancers, scaffold-attachment regions, negative regulatory elements,
transcriptional
initiation sites, regulatory protein binding sites or combinations of said
sequences.
S Alternatively, sequences which affect the structure or stability of the RNA
or protein
produced may be replaced, removed, added, or otherwise modified by targeting.
These
sequences include polyadenylation signals, mRNA stability elements, splice
sites, leader
sequences for enhancing or modifying transport or secretion properties of the
protein, or
other sequences which alter or improve the function or stability of protein or
RNA
molecules.
The targeting event may be a simple insertion of the regulatory sequence,
placing the
gene under the control of the new regulatory sequence, e.g., inserting a new
promoter or
enhancer or both upstream of a gene. Alternatively, the targeting event may be
a simple
deletion of a regulatory element, such as the deletion of a tissue-specific
negative regulatory
element. Alternatively, the targeting event may replace an existing element;
for example, a
tissue-specific enhancer can be replaced by an enhancer that has broader or
different
cell-type specificity than the naturally occurring elements. Here, the
naturally occurring
sequences are deleted and new sequences are added. In all cases, the
identification of the
targeting event may be facilitated by the use of one or more selectable marker
genes that are
contiguous with the targeting DNA, allowing for the selection of cells in
which the
exogenous DNA has integrated into the cell genome. The identification of the
targeting
event may also be facilitated by the use of one or more marker genes
exhibiting the property
of negative selection, such that the negatively selectable marker is linked to
the exogenous
DNA, but configured such that the negatively selectable marker flanks the
targeting
sequence, and such that a correct homologous recombination event with
sequences in the
host cell genome does not result in the stable integration of the negatively
selectable marker.
Markers useful for this purpose include the Herpes Simplex Virus thymidine
kinase (TK)
gene or the bacterial xanthine-guanine phosphoribosyl-transferase (gpt) gene.
The gene targeting or gene activation techniques which can be used in
accordance
with this aspect of the invention are more particularly described in U.S.
Patent No.
5,272,071 to Chappel; U.S. Patent No. 5,578,461 to Sherwin et al.;
International Application
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
44
No. PCT/LTS92/09627 (W093/09222) by Selden et al.; and International
Application No.
PCT/L1S90/06436 (W091/06667) by Skoultchi et al., each of which is
incorporated by
reference herein in its entirety.
4.9 TRANSGENIC ANIMALS
In preferred methods to determine biological functions of the polypeptides of
the
invention in vivo, one or more genes provided by the invention are either over
expressed
or inactivated in the germ line of animals using homologous recombination
[Capecchi,
Science 244:1288-1292 (1989)]. Animals in which the gene is over expressed,
under the
regulatory control of exogenous or endogenous promoter elements, are known as
transgenic animals. Animals in which an endogenous gene has been inactivated
by
homologous recombination are referred to as "knockout" animals. Knockout
animals,
preferably non-human mammals, can be prepared as described in U.S. Patent No.
5,557,032, incorporated herein by reference. Transgenic animals are useful to
determine
the roles polypeptides of the invention play in biological processes, and
preferably in
disease states. Transgenic animals are useful as model systems to identify
compounds
that modulate lipid metabolism. Transgenic animals, preferably non-human
mammals,
are produced using methods as described in U.S. Patent No 5,489,743 and PCT
Publication No. W094/28122, incorporated herein by reference.
Transgenic animals can be prepared wherein all or part of a promoter of the
polynucleotides of the invention is either activated or inactivated to alter
the level of
expression of the polypeptides of the invention. Inactivation can be carried
out using
homologous recombination methods described above. Activation can be achieved
by
supplementing or even replacing the homologous promoter to provide for
increased
protein expression. The homologous promoter can be supplemented by insertion
of one
or more heterologous enhancer elements known to confer promoter activation in
a
particular tissue.
The polynucleotides of the present invention also make possible the
development,
through, e.g., homologous recombination or knock out strategies, of animals
that fail to
express polypeptides of the invention or that express a variant polypeptide.
Such animals
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
are useful as models for studying the in vivo activities of polypeptide as
well as for
studying modulators of the polypeptides of the invention.
In preferred methods to determine biological functions of the polypeptides of
the
invention in vivo, one or more genes provided by the invention are either over
expressed
5 or inactivated in the germ line of animals using homologous recombination
[Capecchi,
Science 244:1288-1292 (1989)]. Animals in which the gene is over expressed,
under the
regulatory control of exogenous or endogenous promoter elements, are known as
transgenic animals. Animals in which an endogenous gene has been inactivated
by
homologous recombination are referred to as "knockout" animals. Knockout
animals,
10 preferably non-human mammals, can be prepared as described in U.S. Patent
No.
5,557,032, incorporated herein by reference. Transgenic animals are useful to
determine
the roles polypeptides of the invention play in biological processes, and
preferably in
disease states. Transgenic animals are useful as model systems to identify
compounds
that modulate lipid metabolism. Transgenic animals, preferably non-human
mammals,
15 are produced using methods as described in U.S. Patent No 5,489,743 and PCT
Publication No. W094/28122, incorporated herein by reference.
Transgenic animals can be prepared wherein all or part of the polynucleotides
of
the invention promoter is either activated or inactivated to alter the level
of expression of
the polypeptides of the invention. Inactivation can be carried out using
homologous
20 recombination methods described above. Activation can be achieved by
supplementing or
even replacing the homologous promoter to provide for increased protein
expression. The
homologous promoter can be supplemented by insertion of one or more
heterologous
enhancer elements known to confer promoter activation in a particular tissue.
25 4.10 USES AND BIOLOGICAL ACTIVITY
The polynucleotides and proteins of the present invention are expected to
exhibit
one or more of the uses or biological activities (including those associated
with assays
cited herein) identified herein. Uses or activities described for proteins of
the present
invention may be provided by administration or use of such proteins or of
30 polynucleotides encoding such proteins (such as, for example, in gene
therapies or
vectors suitable for introduction of DNA). The mechanism underlying the
particular
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
46
condition or pathology will dictate whether the polypeptides of the invention,
the
polynucleotides of the invention or modulators (activators or inhibitors)
thereof would be
beneficial to the subject in need of treatment. Thus, "therapeutic
compositions of the
invention" include compositions comprising isolated polynucleotides (including
recombinant DNA molecules, cloned genes and degenerate variants thereof) or
polypeptides of the invention (including full length protein, mature protein
and
truncations or domains thereof), or compounds and other substances that
modulate the
overall activity of the target gene products, either at the level of target
gene/protein
expression or target protein activity. Such modulators include polypeptides,
analogs,
(variants), including fragments and fusion proteins, antibodies and other
binding proteins;
chemical compounds that directly or indirectly activate or inhibit the
polypeptides of the
invention (identified, e.g., via drug screening assays as described herein);
antisense
polynucleotides and polynucleotides suitable for triple helix formation; and
in particular
antibodies or other binding partners that specifically recognize one or more
epitopes of
the polypeptides of the invention.
The polypeptides of the present invention may likewise be involved in cellular
activation or in one of the other physiological pathways described herein.
4.10.1 RESEARCH USES AND UTILITIES
The polynucleotides provided by the present invention can be used by the
research community for various purposes. The polynucleotides can be used to
express
recombinant protein for analysis, characterization or therapeutic use; as
markers for
tissues in which the corresponding protein is preferentially expressed (either
constitutively or at a particular stage of tissue differentiation or
development or in disease
states); as molecular weight markers on gels; as chromosome markers or tags
(when
labeled) to identify chromosomes or to map related gene positions; to compare
with
endogenous DNA sequences inpatients to identify potential genetic disorders;
as probes
to hybridize and thus discover novel, related DNA sequences; as a source of
information
to derive PCR primers for genetic fingerprinting; as a probe to "subtract-out"
known
sequences in the process of discovering other novel polynucleotides; for
selecting and
making oligomers for attachment to a "gene chip" or other support, including
for
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
47
examination of expression patterns; to raise anti-protein antibodies using DNA
immunization techniques; and as an antigen to raise anti-DNA antibodies or
elicit another
immune response. Where the polynucleotide encodes a protein which binds or
potentially binds to another protein (such as, for example, in a receptor-
ligand
interaction), the polynucleotide can also be used in interaction trap assays
(such as, for
example, that described in Gyuris et al., Cell 75:791-803 (1993)) to identify
polynucleotides encoding the other protein with which binding occurs or to
identify
inhibitors of the binding interaction.
The polypeptides provided by the present invention can similarly be used in
assays to determine biological activity, including in a panel of multiple
proteins for
high-throughput screening; to raise antibodies or to elicit another immune
response; as a
reagent (including the labeled reagent) in assays designed to quantitatively
determine
levels of the protein (or its receptor) in biological fluids; as markers for
tissues in which
the corresponding polypeptide is preferentially expressed (either
constitutively or at a
particular stage of tissue differentiation or development or in a disease
state); and, of
course, to isolate correlative receptors or ligands. Proteins involved in
these binding
interactions can also be used to screen for peptide or small molecule
inhibitors or agonists
of the binding interaction.
Any or all of these research utilities are capable of being developed into
reagent
grade or kit format for commercialization as research products.
Methods for performing the uses listed above are well known to those skilled
in
the art. References disclosing such methods include without limitation
"Molecular
Cloning: A Laboratory Manual", 2d ed., Cold Spring Harbor Laboratory Press,
Sambrook, J., E. F. Fritsch and T. Maniatis eds., 1989, and "Methods in
Enzymology:
Guide to Molecular Cloning Techniques", Academic Press, Berger, S. L. and A.
R.
Kimmel eds., 1987.
4.10.2 NUTRITIONAL USES
Polynucleotides and polypeptides of the present invention can also be used as
nutritional sources or supplements. Such uses include without limitation use
as a protein or
amino acid supplement, use as a carbon source, use as a nitrogen source and
use as a source
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
48
of carbohydrate. In such cases the polypeptide or polynucleotide of the
invention can be
added to the feed of a particular organism or can be administered as a
separate solid or liquid
preparation, such as in the form of powder, pills, solutions, suspensions or
capsules. In the
case of microorganisms, the polypeptide or polynucleotide of the invention can
be added to
the medium in or on which the microorganism is cultured.
4.10.3 CYTOHINE AND CELL PROLIFERATION/DIFFERENTIATION
ACTIVITY
A polypeptide of the present invention may exhibit activity relating to
cytokine,
cell proliferation (either inducing or inhibiting) or cell differentiation
(either inducing or
inhibiting) activity or may induce production of other cytokines in certain
cell
populations. A polynucleotide of the invention can encode a polypeptide
exhibiting such
attributes. Many protein factors discovered to date, including all known
cytokines, have
exhibited activity in one or more factor-dependent cell proliferation assays,
and hence the
assays serve as a convenient confirmation of cytokine activity. The activity
of therapeutic
compositions of the present invention is evidenced by any one of a number of
routine
factor dependent cell proliferation assays for cell lines including, without
limitation, 32D,
DA2, DA1G, T10, B9, B9/11, BaF3, MC9/G, M+(preB M+), 2E8, RBS, DA1, 123,
T1165, HT2, CTLL2, TF-l, Mo7e, CMK, HUVEC, and Caco. Therapeutic compositions
of the invention can be used in the following:
Assays for T-cell or thymocyte proliferation include without limitation those
described in: Current Protocols in Immunology, Ed by J. E. Coligan, A. M.
Kruisbeek, D.
H. Margulies, E. M. Shevach, W. Strober, Pub. Greene Publishing Associates and
Wiley-Interscience (Chapter 3, In Vitro assays for Mouse Lymphocyte Function
3.1-3.19;
Chapter 7, Immunologic studies in Humans); Takai et al., J. Immunol. 137:3494-
3500,
1986; Bertagnolli et al., J. Immunol. 145:1706-1712, 1990; Bertagnolli et al.,
Cellular
Immunology 133:327-341, 1991; Bertagnolli, et al., I. Immunol. 149:3778-3783,
1992;
Bowman et al., I. Immunol. 152:1756-1761, 1994.
Assays for cytokine production and/or proliferation of spleen cells, lymph
node
cells or thymocytes include, without limitation, those described in:
Polyclonal .T cell
stimulation, Kruisbeek, A. M. and Shevach, E. M. In Current Protocols in
Immunology.
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
49
J. E. e.a. Coligan eds. Vol 1 pp. 3.12.1-3.12.14, John Wiley and Sons,
Toronto. 1994; and
Measurement of mouse and human interleukin-y, Schreiber, R. D. In Current
Protocols in
Immunology. J. E. e.a. Coligan eds. Vol 1 pp. 6.8.1-6.8.8, John Wiley and
Sons, Toronto.
1994.
Assays for proliferation and differentiation of hematopoietic and
lymphopoietic
cells include, without limitation, those described in: Measurement of Human
and Murine
Interleukin 2 and Interleukin 4, Bottomly, K., Davis, L. S. and Lipsky, P. E.
In Current
Protocols in Immunology. J. E. e.a. Coligan eds. Vol I pp. 6.3.1-6.3.12, John
Wiley and
Sons, Toronto. 1991; deVries et al., J. Exp. Med. 173:1205-1211, 1991; Moreau
et al.,
Nature 336:690-692, 1988; Greenberger et al., Proc. Natl. Acad. Sci. U.S.A.
80:2931-2938, 1983; Measurement of mouse and human interleukin 6--Nordan, R.
In
Current Protocols in Immunology. J. E. Coligan eds. Vol 1 pp. 6.6.1-6.6.5,
John Wiley
and Sons, Toronto. 1991; Smith et al., Proc. Natl. Aced. Sci. U.S.A. 83:1857-
1861, 1986;
Measurement of human Interleukin l l--Bennett, F., Giannotti, J., Clark, S. C.
and Turner,
K. J. In Current Protocols in Immunology. J. E. Coligan eds. Vol 1 pp. 6.15.1
John
Wiley and Sons, Toronto. 1991; Measurement of mouse and human Interleukin
9--Ciarletta, A., Giannotti, J., Clark, S. C. and Turner, K. J. In Current
Protocols in
Immunology. J. E. Coligan eds. Vol 1 pp. 6.13.1, John Wiley and Sons, Toronto.
1991.
Assays for T-cell clone responses to antigens (which will identify, among
others,
proteins that affect APC-T cell interactions as well as direct T-cell effects
by measuring
proliferation and cytokine production) include, without limitation, those
described in:
Current Protocols in Immunology, Ed by J. E. Coligan, A. M. Kruisbeek, D. H.
Margulies, E. M. Shevach, W Strober, Pub. Greene Publishing Associates and
Wiley-Interscience (Chapter 3, In Vitro assays for Mouse Lymphocyte Function;
Chapter
6, Cytokines and their cellular receptors; Chapter 7, Immunologic studies in
Humans);
Weinberger et al., Proc. Natl. Acad. Sci. USA 77:6091-6095, 1980; Weinberger
et al.,
Eur. J. Immun. 11:405-411, 1981; Takai et al., J. Immunol. 137:3494-3500,
1986; Takai
et al., J. Immunol. 140:508-512, 1988.
4.10.4 STEM CELL GROWTH FACTOR ACTIVITY
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
A polypeptide of the present invention may exhibit stem cell growth factor
activity and be involved in the proliferation, differentiation and survival of
pluripotent
and totipotent stem cells including primordial germ cells, embryonic stem
cells,
hematopoietic stem cells and/or germ line stem cells. Administration of the
polypeptide
5 of the invention to stem cells in vivo or ex vivo is expected to maintain
and expand cell
populations in a totipotential or pluripotential state which would be useful
for re-
engineering damaged or diseased tissues, transplantation, manufacture of bio-
pharmaceuticals and the development of bio-sensors. The ability to produce
large
quantities of human cells has important working applications for the
production of human
10 proteins which currently must be obtained from non-human sources or donors,
implantation of cells to treat diseases such as Parkinson's, Alzheimer's and
other
neurodegenerative diseases; tissues for grafting such as bone marrow, skin,
cartilage,
tendons, bone, muscle (including cardiac muscle), blood vessels, cornea,
neural cells,
gastrointestinal cells and others; and organs for transplantation such as
kidney, liver,
15 pancreas (including islet cells), heart and lung.
It is contemplated that multiple different exogenous growth factors and/or
cytokines may be administered in combination with the polypeptide of the
invention to
achieve the desired effect, including any of the growth factors listed herein,
other stem
cell maintenance factors, and specifically including stem cell factor (SCF),
leukemia
20 inhibitory factor (LIF), Flt-3 ligand (Flt-3L), any of the interleukins,
recombinant soluble
IL-6 receptor fused to IL-6, macrophage inflammatory protein 1-alpha (MIP-1-
alpha), G-
CSF, GM-CSF, thrombopoietin (TPO), platelet factor 4 (PF-4), platelet-derived
growth
factor (PDGF), neural growth factors and basic fibroblast growth factor
(bFGF).
Since totipotent stem cells can give rise to virtually any mature cell type,
25 expansion of these cells in culture will facilitate the production of large
quantities of
mature cells. Techniques for culturing stem cells are known in the art and
administration
of polypeptides of the invention, optionally with other growth factors and/or
cytokines, is
expected to enhance the survival and proliferation of the stem cell
populations. This can
be accomplished by direct administration of the polypeptide of the invention
to the
30 culture medium. Alternatively, stroma cells transfected with a
polynucleotide that
encodes for the polypeptide of the invention can be used as a feeder layer for
the stem
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
51
cell populations in culture or in vivo. Stromal support cells for feeder
layers may include
embryonic bone marrow fibroblasts, bone marrow stromal cells, fetal liver
cells, or
cultured embryonic fibroblasts (see U.S. Patent No. 5,690,926).
Stem cells themselves can be transfected with a polynucleotide of the
invention to
induce autocrine expression of the polypeptide of the invention. This will
allow for
generation of undifferentiated totipotential/pluripotential stem cell lines
that are useful as
is or that can then be differentiated into the desired mature cell types.
These stable cell
lines can also serve as a source of undifferentiated
totipotential/pluripotential mRNA to
create cDNA libraries and templates for polymerase chain reaction experiments.
These
studies would allow for the isolation and identification of differentially
expressed genes
in stem cell populations that regulate stem cell proliferation and/or
maintenance.
Expansion and maintenance of totipotent stem cell populations will be useful
in
the treatment of many pathological conditions. For example, polypeptides of
the present
invention may be used to manipulate stem cells in culture to give rise to
neuroepithelial
cells that can be used to augment or replace cells damaged by illness,
autoimmune
disease, accidental damage or genetic disorders. The polypeptide of the
invention may be
useful for inducing the proliferation of neural cells and for the regeneration
of nerve and
brain tissue, i.e. for the treatment of central and peripheral nervous system
diseases and
neuropathies, as well as mechanical and traumatic disorders which involve
degeneration,
death or trauma to neural cells or nerve tissue. In addition, the expanded
stem cell
populations can also be genetically altered for gene therapy purposes and to
decrease host
rejection of replacement tissues after grafting or implantation.
Expression of the polypeptide of the invention and its effect on stem cells
can also
be manipulated to achieve controlled differentiation of the stem cells into
more
differentiated cell types. A broadly applicable method of obtaining pure
populations of a
specific differentiated cell type from undifferentiated stem cell populations
involves the
use of a cell-type specific promoter driving a selectable marker. The
selectable marker
allows only cells of the desired type to survive. For example, stem cells can
be induced
to differentiate into cardiomyocytes (Wobus et al., Differentiation, 48: 173-
182, (1991);
Klug et al., J. Clin. Invest., 98(1): 216-224, (1998)) or skeletal muscle
cells (Browder, L.
W. In: Principles of Tissue Engineering eds. Lanza et al., Academic Press (
1997)).
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
52
Alternatively, directed differentiation of stem cells can be accomplished by
culturing the
stem cells in the presence of a differentiation factor such as retinoic acid
and an
antagonist of the polypeptide of the invention which would inhibit the effects
of
endogenous stem cell factor activity and allow differentiation to proceed.
In vitro cultures of stem cells can be used to determine if the polypeptide of
the
invention exhibits stem cell growth factor activity. Stem cells are isolated
from any one
of various cell sources (including hematopoietic stem cells and embryonic stem
cells) and
cultured on a feeder layer, as described by Thompson et al. Proc. Natl. Acad.
Sci, U.S.A.,
92: 7844-7848 (1995), in the presence of the polypeptide of the invention
alone or in
combination with other growth factors or cytokines. The ability of the
polypeptide of the
invention to induce stem cells proliferation is determined by colony formation
on semi-
solid support e.g. as described by Bernstein et al., Blood, 77: 2316-2321
(1991).
4.10.5 HEMATOPOIESIS REGULATING ACTIVITY
A polypeptide of the present invention may be involved in regulation of
hematopoiesis and, consequently, in the treatment of myeloid or lymphoid cell
disorders.
Even marginal biological activity in support of colony forming cells or of
factor-dependent cell lines indicates involvement in regulating hematopoiesis,
e.g. in
supporting the growth and proliferation of erythroid progenitor cells alone or
in
combination with other cytokines, thereby indicating utility, for example, in
treating
various anemias or for use in conj unction with irradiation/chemotherapy to
stimulate the
production of erythroid precursors and/or erythroid cells; in supporting the
growth and
proliferation of myeloid cells such as granulocytes and monocytes/macrophages
(i.e.,
traditional CSF activity) useful, for example, in conjunction with
chemotherapy to
prevent or treat consequent myelo-suppression; in supporting the growth and
proliferation
of megakaryocytes and consequently of platelets thereby allowing prevention or
treatment of various platelet disorders such as thrombocytopenia, and
generally for use in
place of or complimentary to platelet transfusions; and/or in supporting the
growth and
proliferation of hematopoietic stem cells which are capable of maturing to any
and all of
the above-mentioned hematopoietic cells and therefore find therapeutic utility
in various
stem cell disorders (such as those usually treated with transplantation,
including, without
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
S3
limitation, aplastic anemia and paroxysmal nocturnal hemoglobinuria), as well
as in
repopulating the stem cell compartment post irradiation/chemotherapy, either
in-vivo or
ex-vivo (i.e., in conjunction with bone marrow transplantation or with
peripheral
progenitor cell transplantation (homologous or heterologous)) as normal cells
or
genetically manipulated for gene therapy.
Therapeutic compositions of the invention can be used in the following:
Suitable assays for proliferation and differentiation of various hematopoietic
lines
are cited above.
Assays for embryonic stem cell differentiation (which will identify, among
others,
proteins that influence embryonic differentiation hematopoiesis) include,
without
limitation, those described in: Johansson et al. Cellular Biology 15:141-151,
1995; Keller
et al., Molecular and Cellular Biology 13:473-486, 1993; McClanahan et al.,
Blood
81:2903-291 S, 1993.
Assays for stem cell survival and differentiation (which will identify, among
others, proteins that regulate lympho-hematopoiesis) include, without
limitation, those
described in: Methylcellulose colony forming assays, Freshney, M. G. In
Culture of
Hematopoietic Cells. R. I. Freshney, et al. eds. Vol pp. 265-268, Wiley-Liss,
Inc., New
York, N.Y. 1994; Hirayama et al., Proc. Natl. Acad. Sci. USA 89:5907-591 l,
1992;
Primitive hematopoietic colony forming cells with high proliferative
potential, McNiece,
I. K. and Briddell, R. A. In Culture of Hematopoietic Cells. R. I. Freshney,
et al. eds. Vol
pp. 23-39, Wiley-Liss, Inc., New York, N.Y. 1994; Neben et al., Experimental
Hematology 22:353-359, 1994; Cobblestone area forming cell assay, Ploemacher,
R. E.
In Culture of Hematopoietic Cells. R. I. Freshney, et al. eds. Vol pp. 1-21,
Wiley-Liss,
Inc., New York, N.Y. 1994; Long term bone marrow cultures in the presence of
stromal
cells, Spooncer, E., Dexter, M. and Allen, T. In Culture of Hematopoietic
Cells. R. I.
Freshney, et al. eds. Vol pp. 163-179, Wiley-Liss, Inc., New York, N.Y. 1994;
Long term
culture initiating cell assay, Sutherland, H. J. In Culture of Hematopoietic
Cells. R. I.
Freshney, et al. eds. Vol pp. 139-162, Wiley-Liss, Inc., New York, N.Y. 1994.
4.10.6 TISSUE GROWTH ACTIVITY
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
54
A polypeptide of the present invention also may be involved in bone,
cartilage,
tendon, ligament and/or nerve tissue growth or regeneration, as well as in
wound healing
and tissue repair and replacement, and in healing of burns, incisions and
ulcers.
A polypeptide of the present invention which induces cartilage and/or bone
growth in circumstances where bone is not normally formed, has application in
the
healing of bone fractures and cartilage damage or defects in humans and other
animals.
Compositions of a polypeptide, antibody, binding partner, or other modulator
of the
invention may have prophylactic use in closed as well as open fracture
reduction and also
in the improved fixation of artificial joints. De novo bone formation induced
by an
osteogenic agent contributes to the repair of congenital, trauma induced, or
oncologic
resection induced craniofacial defects, and also is useful in cosmetic plastic
surgery.
A polypeptide of this invention may also be involved in attracting bone-
forming
cells, stimulating growth of bone-forming cells, or inducing differentiation
of progenitors
of bone-forming cells. Treatment of osteoporosis, osteoarthritis, bone
degenerative
1 S disorders, or periodontal disease, such as through stimulation of bone
and/or cartilage
repair or by blocking inflammation or processes of tissue destruction
(collagenase
activity, osteoclast activity, etc.) mediated by inflammatory processes may
also be
possible using the composition of the invention.
Another category of tissue regeneration activity that may involve the
polypeptide
of the present invention is tendon/ligament formation. Induction of
tendon/ligament-like
tissue or other tissue formation in circumstances where such tissue is not
normally
formed, has application in the healing of tendon or ligament tears,
deformities and other
tendon or ligament defects in humans and other animals. Such a preparation
employing a
tendon/ligament-like tissue inducing protein may have prophylactic use in
preventing
damage to tendon or ligament tissue, as well as use in the improved fixation
of tendon or
ligament to bone or other tissues, and in repairing defects to tendon or
ligament tissue.
De novo tendon/ligament-like tissue formation induced by a composition of the
present
invention contributes to the repair of congenital, trauma induced, or other
tendon or
ligament defects of other origin, and is also useful in cosmetic plastic
surgery for
attachment or repair of tendons or ligaments. The compositions of the present
invention
may provide environment to attract tendon- or ligament-forming cells,
stimulate growth
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
of tendon- or ligament-forming cells, induce differentiation of progenitors of
tendon- or
ligament-forming cells, or induce growth of tendon/ligament cells or
progenitors ex vivo
for return in vivo to effect tissue repair. The compositions of the invention
may also be
useful in the treatment of tendinitis, carpal tunnel syndrome and other tendon
or ligament
5 defects. The compositions may also include an appropriate matrix and/or
sequestering
agent as a carrier as is well known in the art.
The compositions of the present invention may also be useful for proliferation
of
neural cells and for regeneration of nerve and brain tissue, i.e. for the
treatment of central
and peripheral nervous system diseases and neuropathies, as well as mechanical
and
10 traumatic disorders, which involve degeneration, death or trauma to neural
cells or nerve
tissue. More specifically, a composition may be used in the treatment of
diseases of the
peripheral nervous system, such as peripheral nerve injuries, peripheral
neuropathy and
localized neuropathies, and central nervous system diseases, such as
Alzheimer's,
Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, and
Shy-Drager
1 S syndrome. Further conditions which may be treated in accordance with the
present
invention include mechanical and traumatic disorders, such as spinal cord
disorders, head
trauma and cerebrovascular diseases such as stroke. Peripheral neuropathies
resulting
from chemotherapy or other medical therapies may also be treatable using a
composition
of the invention.
20 Compositions of the invention may also be useful to promote better or
faster
closure of non-healing wounds, including without limitation pressure ulcers,
ulcers
associated with vascular insufficiency, surgical and traumatic wounds, and the
like.
Compositions of the present invention may also be involved in the generation
or
regeneration of other tissues, such as organs (including, for example,
pancreas, liver,
25 intestine, kidney, skin, endothelium), muscle (smooth, skeletal or cardiac)
and vascular
(including vascular endothelium) tissue, or for promoting the growth of cells
comprising
such tissues. Part of the desired effects may be by inhibition or modulation
of fibrotic
scarring may allow normal tissue to regenerate. A polypeptide of the present
invention
may also exhibit angiogenic activity.
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
56
A composition of the present invention may also be useful for gut protection
or
regeneration and treatment of lung or liver fibrosis, reperfusion injury in
various tissues,
and conditions resulting from systemic cytokine damage.
A composition of the present invention may also be useful for promoting or
inhibiting differentiation of tissues described above from precursor tissues
or cells; or for
inhibiting the growth of tissues described above.
Therapeutic compositions of the invention can be used in the following:
Assays for tissue generation activity include, without limitation, those
described
in: International Patent Publication No. W095/16035 (bone, cartilage, tendon);
International Patent Publication No. W095/05846 (nerve, neuronal);
International Patent
Publication No. W091/07491 (skin, endothelium).
Assays for wound healing activity include, without limitation, those described
in:
Winter, Epidermal Wound Healing, pps. 71-112 (Maibach, H. I. and Rovee, D. T.,
eds.),
Year Book Medical Publishers, Inc., Chicago, as modified by Eaglstein and
Mertz, J.
Invest. Dermatol 71:382-84 (1978).
4.10.7 IMMUNE STIMULATING OR SUPPRESSING ACTIVITY
A polypeptide of the present invention may also exhibit immune stimulating or
immune suppressing activity, including without limitation the activities for
which assays
are described herein. A polynucleotide of the invention can encode a
polypeptide
exhibiting such activities. A protein may be useful in the treatment of
various immune
deficiencies and disorders (including severe combined immunodeficiency
(SCID)), e.g.,
in regulating (up or down) growth and proliferation of T and/or B lymphocytes,
as well as
effecting the cytolytic activity of NK cells and other cell populations. These
immune
deficiencies may be genetic or be caused by viral (e.g., HIV) as well as
bacterial or
fungal infections, or may result from autoimmune disorders. More specifically,
infectious
diseases causes by viral, bacterial, fungal or other infection may be
treatable using a
protein of the present invention, including infections by HIV, hepatitis
viruses, herpes
viruses, mycobacteria, Leishmania spp., malaria spp. and various fungal
infections such
as candidiasis. Of course, in this regard, proteins of the present invention
may also be
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
57
useful where a boost to the immune system generally may be desirable, i.e., in
the
treatment of cancer.
Autoimmune disorders which may be treated using a protein of the present
invention include, for example, connective tissue disease, multiple sclerosis,
systemic
lupus erythematosus, rheumatoid arthritis, autoimmune pulmonary inflammation,
Guillain-Barre syndrome, autoimmune thyroiditis, insulin dependent diabetes
mellitis,
myasthenia gravis, graft-versus-host disease and autoimmune inflammatory eye
disease.
Such a protein (or antagonists thereof, including antibodies) of the present
invention may
also to be useful in the treatment of allergic reactions and conditions (e.g.,
anaphylaxis,
serum sickness, drug reactions, food allergies, insect venom allergies,
mastocytosis,
allergic rhinitis, hypersensitivity pneumonitis, urticaria, angioedema,
eczema, atopic
dermatitis, allergic contact dermatitis, erythema multiforme, Stevens-Johnson
syndrome,
allergic conjunctivitis, atopic keratoconjunctivitis, venereal
keratoconjunctivitis, giant
papillary conjunctivitis and contact allergies), such as asthma (particularly
allergic
asthma) or other respiratory problems. Other conditions, in which immune
suppression is
desired (including, for example, organ transplantation), may also be treatable
using a
protein (or antagonists thereof) of the present invention. The therapeutic
effects of the
polypeptides or antagonists thereof on allergic reactions can be evaluated by
in vivo
animals models such as the cumulative contact enhancement test (Lastbom et
al.,
Toxicology 125: 59-66, 1998), skin prick test (Hoffmann et al., Allergy 54:
446-54,
1999), guinea pig skin sensitization test (Vohr et al., Arch. Toxocol. 73: 501-
9), and
murine local lymph node assay (Kimber et al., J. Toxicol. Environ. Health 53:
563-79).
Using the proteins of the invention it may also be possible to modulate immune
responses, in a number of ways. Down regulation may be in the form of
inhibiting or
blocking an immune response already in progress or may involve preventing the
induction of an immune response. The functions of activated T cells may be
inhibited by
suppressing T cell responses or by inducing specific tolerance in T cells, or
both.
Immunosuppression of T cell responses is generally an active, non-antigen-
specific,
process which requires continuous exposure of the T cells to the suppressive
agent.
Tolerance, which involves inducing non-responsiveness or anergy in T cells, is
distinguishable from immunosuppression in that it is generally antigen-
specific and
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
58
vitro antibody production, Mond, J. J. and Brunswick, M. In Current Protocols
in
Immunology. J. E. e.a. Coligan eds. Vol 1 pp. 3.8.1-3.8.16, John Wiley and
Sons,
Toronto. 1994.
Mixed lymphocyte reaction (MLR) assays (which will identify, among others,
proteins that generate predominantly Thl and CTL responses) include, without
limitation,
those described in: Current Protocols in Immunology, Ed by J. E. Coligan, A.
M.
Kruisbeek, D. H. Margulies, E. M. Shevach, W. Strober, Pub. Greene Publishing
Associates and Wiley-Interscience (Chapter 3, In Vitro assays for Mouse
Lymphocyte
Function 3.1-3.19; Chapter 7, Immunologic studies in Humans); Takai et al., J.
Immunol.
137:3494-3500, 1986; Takai et al., J. Immunol. 140:508-512, 1988; Bertagnolli
et al., J.
Immunol. 149:3778-3783, 1992.
Dendritic cell-dependent assays (which will identify, among others, proteins
expressed by dendritic cells that activate naive T-cells) include, without
limitation, those
described in: Guery et al., J. Immunol. 134:536-544, 1995; Inaba et al.,
Journal of
Experimental Medicine 173:549-559, 1991; Macatonia et al., Journal of
Immunology
154:5071-5079, 1995; Porgador et al., Journal of Experimental Medicine 182:255-
260,
1995; Nair et al., Journal of Virology 67:4062-4069, 1993; Huang et al.,
Science
264:961-965, 1994; Macatonia et al., Journal of Experimental Medicine 169:1255-
1264,
1989; Bhardwaj et al., Journal of Clinical Investigation 94:797-807, 1994; and
Inaba et
al., Journal of Experimental Medicine 172:631-640, 1990.
Assays for lymphocyte survival/apoptosis (which will identify, among others,
proteins that prevent apoptosis after superantigen induction and proteins that
regulate
lymphocyte homeostasis) include, without limitation, those described in:
Darzynkiewicz
et al., Cytometry 13:795-808, 1992; Gorczyca et al., Leukemia 7:659-670, 1993;
Gorczyca et al., Cancer Research 53:1945-1951, 1993; Itoh et al., Cell 66:233-
243, 1991;
Zacharchuk, Journal of Immunology 145:4037-4045, 1990; Zamai et al., Cytometry
14:891-897, 1993; Gorczyca et al., International Journal of Oncology 1:639-
648, 1992.
Assays for proteins that influence early steps of T-cell commitment and
development include, without limitation, those described in: Antica et al.,
Blood
84:111-117, 1994; Fine et al., Cellular Immunology 155:111-122, 1994; Galy et
al.,
Blood 85:2770-2778, 1995; Toki et al., Proc. Nat. Acad Sci. USA 88:7548-7551,
1991.
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
59
4.10.8 ACTIVIN1INHIBIN ACTIVITY
A polypeptide of the present invention may also exhibit activin- or inhibin-
related
activities. A polynucleotide of the invention may encode a polypeptide
exhibiting such
characteristics. Inhibins are characterized by their ability to inhibit the
release of follicle
stimulating hormone (FSH), while activins and are characterized by their
ability to
stimulate the release of follicle stimulating hormone (FSH). Thus, a
polypeptide of the
present invention, alone or in heterodimers with a member of the inhibin
family, may be
useful as a contraceptive based on the ability of inhibins to decrease
fertility in female
mammals and decrease spermatogenesis in male mammals. Administration of
sufficient
amounts of other inhibins can induce infertility in these mammals.
Alternatively, the
polypeptide of the invention, as a homodimer or as a heterodimer with other
protein
subunits of the inhibin group, may be useful as a fertility inducing
therapeutic, based
upon the ability of activin molecules in stimulating FSH release from cells of
the anterior
pituitary. See, for example, U.S. Pat. No. 4,798,885. A polypeptide of the
invention may
also be useful for advancement of the onset of fertility in sexually immature
mammals, so
as to increase the lifetime reproductive performance of domestic animals such
as, but not
limited to, cows, sheep and pigs.
The activity of a polypeptide of the invention may, among other means, be
measured by the following methods.
Assays for activin/inhibin activity include, without limitation, those
described in:
Vale et al., Endocrinology 91:562-572, 1972; Ling et al., Nature 321:779-782,
1986; Vale
et al., Nature 321:776-779, 1986; Mason et al., Nature 318:659-663, 1985;
Forage et al.,
Proc. Natl. Acad. Sci. USA 83:3091-3095, 1986.
4.10.9 CHEMOTACTIC/CHEMOKINETIC ACTIVITY
A polypeptide of the present invention may be involved in chemotactic or
chemokinetic activity for mammalian cells, including, for example, monocytes,
fibroblasts, neutrophils, T-cells, mast cells, eosinophils, epithelial and/or
endothelial
cells. A polynucleotide of the invention can encode a polypeptide exhibiting
such
attributes. Chemotactic and chemokinetic receptor activation can be used to
mobilize or
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
attract a desired cell population to a desired site of action. Chemotactic or
chemokinetic
compositions (e.g. proteins, antibodies, binding partners, or modulators of
the invention)
provide particular advantages in treatment of wounds and other trauma to
tissues, as well
as in treatment of localized infections. For example, attraction of
lymphocytes,
S monocytes or neutrophils to tumors or sites of infection may result in
improved immune
responses against the tumor or infecting agent.
A protein or peptide has chemotactic activity for a particular cell population
if it
can stimulate, directly or indirectly, the directed orientation or movement of
such cell
population. Preferably, the protein or peptide has the ability to directly
stimulate directed
10 movement of cells. Whether a particular protein has chemotactic activity
for a population
of cells can be readily determined by employing such protein or peptide in any
known
assay for cell chemotaxis.
Therapeutic compositions of the invention can be used in the following:
Assays for chemotactic activity (which will identify proteins that induce or
15 prevent chemotaxis) consist of assays that measure the ability of a protein
to induce the
migration of cells across a membrane as well as the ability of a protein to
induce the
adhesion of one cell population to another cell population. Suitable assays
for movement
and adhesion include, without limitation, those described in: Current
Protocols in
Immunology, Ed by J. E. Coligan, A. M. Kruisbeek, D. H. Marguiles, E. M.
Shevach, W.
20 Strober, Pub. Greene Publishing Associates and Wiley-Interscience (Chapter
6.12,
Measurement of alpha and beta Chemokines 6.12.1-6.12.28; Taub et al. J. Clin.
Invest.
95:1370-1376, 1995; Lind et al. APMIS 103:140-146, 1995; Muller et al Eur. J.
Immunol. 25:1744-1748; Gruber et al. J. of Immunol. 152:5860-5867, 1994;
Johnston et
al. J. of Immunol. 153:1762-1768, 1994.
4.10.10 HEMOSTATIC AND THROMBOLYTIC ACTIVITY
A polypeptide of the invention may also be involved in hemostatis or
thrombolysis or thrombosis. A polynucleotide of the invention can encode a
polypeptide
exhibiting such attributes. Compositions may be useful in treatment of various
coagulation disorders (including hereditary disorders, such as hemophiliac) or
to enhance
coagulation and other hemostatic events in treating wounds resulting from
trauma,
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
61
surgery or other causes. A composition of the invention may also be useful for
dissolving
or inhibiting formation of thromboses and for treatment and prevention of
conditions
resulting therefrom (such as, for example, infarction of cardiac and central
nervous
system vessels (e.g., stroke).
Therapeutic compositions of the invention can be used in the following:
Assay for hemostatic and thrombolytic activity include, without limitation,
those
described in: Linet et al., J. Clin. Pharmacol. 26:131-140, 1986; Burdick et
al.,
Thrombosis Res. 45:413-419, 1987; Humphrey et al., Fibrinolysis 5:71-79 ( 1991
);
Schaub, Prostaglandins 35:467-474, 1988.
4.10.11 CANCER DIAGNOSIS AND THERAPY
Polypeptides of the invention may be involved in cancer cell generation,
proliferation or metastasis. Detection of the presence or amount of
polynucleotides or
polypeptides of the invention may be useful for the diagnosis and/or prognosis
of one or
more types of cancer. For example, the presence or increased expression of a
polynucleotide/polypeptide of the invention may indicate a hereditary risk of
cancer, a
precancerous condition, or an ongoing malignancy. Conversely, a defect in the
gene or
absence of the polypeptide may be associated with a cancer condition.
Identification of
single nucleotide polymorphisms associated with cancer or a predisposition to
cancer
may also be useful for diagnosis or prognosis.
Cancer treatments promote tumor regression by inhibiting tumor cell
proliferation, inhibiting angiogenesis (growth of new blood vessels that is
necessary to
support tumor growth) and/or prohibiting metastasis by reducing tumor cell
motility or
invasiveness. Therapeutic compositions of the invention may be effective in
adult and
pediatric oncology including in solid phase tumors/malignancies, locally
advanced
tumors, human soft tissue sarcomas, metastatic cancer, including lymphatic
metastases,
blood cell malignancies including multiple myeloma, acute and chronic
leukemias, and
lymphomas, head and neck cancers including mouth cancer, larynx cancer and
thyroid
cancer, lung cancers including small cell carcinoma and non-small cell
cancers, breast
cancers including small cell carcinoma and ductal carcinoma, gastrointestinal
cancers
including esophageal cancer, stomach cancer, colon cancer, colorectal cancer
and polyps
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
62
associated with colorectal neoplasia, pancreatic cancers, liver cancer,
urologic cancers
including bladder cancer and prostate cancer, malignancies of the female
genital tract
including ovarian carcinoma, uterine (including endometrial) cancers, and
solid tumor in
the ovarian follicle, kidney cancers including renal cell carcinoma, brain
cancers
including intrinsic brain tumors, neuroblastoma, astrocytic brain tumors,
gliomas,
metastatic tumor cell invasion in the central nervous system, bone cancers
including
osteomas, skin cancers including malignant melanoma, tumor progression of
human skin
keratinocytes, squamous cell carcinoma, basal cell carcinoma,
hemangiopericytoma and
Karposi's sarcoma.
Polypeptides, polynucleotides, or modulators of polypeptides of the invention
(including inhibitors and stimulators of the biological activity of the
polypeptide of the
invention) may be administered to treat cancer. Therapeutic compositions can
be
administered in therapeutically effective dosages alone or in combination with
adjuvant
cancer therapy such as surgery, chemotherapy, radiotherapy, thermotherapy, and
laser
therapy, and may provide a beneficial effect, e.g. reducing tumor size,
slowing rate of
tumor growth, inhibiting metastasis, or otherwise improving overall clinical
condition,
without necessarily eradicating the cancer.
The composition can also be administered in therapeutically effective amounts
as
a portion of an anti-cancer cocktail. An anti-cancer cocktail is a mixture of
the
polypeptide or modulator of the invention with one or more anti-cancer drugs
in addition
to a pharmaceutically acceptable carrier for delivery. The use of anti-cancer
cocktails as
a cancer treatment is routine. Anti-cancer drugs that are well known in the
art and can be
used as a treatment in combination with the polypeptide or modulator of the
invention
include: Actinomycin D, Aminoglutethimide, Asparaginase, Bleomycin, Busulfan,
Carboplatin, Carmustine, Chlorambucil, Cisplatin (cis-DDP), Cyclophosphamide,
Cytarabine HCl (Cytosine arabinoside), Dacarbazine, Dactinomycin, Daunorubicin
HCI,
Doxorubicin HCI, Estramustine phosphate sodium, Etoposide (V 16-213),
Floxuridine, 5-
Fluorouracil (5-Fu), Flutamide, Hydroxyurea (hydroxycarbamide), Ifosfamide,
Interferon
Alpha-2a, Interferon Alpha-2b, Leuprolide acetate (LHRH-releasing factor
analog),
Lomustine, Mechlorethamine HCl (nitrogen mustard), Melphalan, Mercaptopurine,
Mesna, Methotrexate (MTX), Mitomycin, Mitoxantrone HCI, Octreotide,
Plicamycin,
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
63
Procarbazine HCI, Streptozocin, Tamoxifen citrate, Thioguanine, Thiotepa,
Vinblastine
sulfate, Vincristine sulfate, Amsacrine, Azacitidine, Hexamethylmelamine,
Interleukin-2,
Mitoguazone, Pentostatin, Semustine, Teniposide, and Vindesine sulfate.
In addition, therapeutic compositions of the invention may be used for
prophylactic treatment of cancer. There are hereditary conditions and/or
environmental
situations (e.g. exposure to carcinogens) known in the art that predispose an
individual to
developing cancers. Under these circumstances, it may be beneficial to treat
these
individuals with therapeutically effective doses of the polypeptide of the
invention to
reduce the risk of developing cancers.
In vitro models can be used to determine the effective doses of the
polypeptide of
the invention as a potential cancer treatment. These in vitro models include
proliferation
assays of cultured tumor cells, growth of cultured tumor cells in soft agar
(see Freshney,
(1987) Culture of Animal Cells: A Manual of Basic Technique, Wily-Liss, New
York,
NY Ch 18 and Ch 21 ), tumor systems in nude mice as described in Giovanella et
al., J.
Natl. Can. Inst., 52: 921-30 (1974), mobility and invasive potential of tumor
cells in
Boyden Chamber assays as described in Pilkington et al., Anticancer Res., 17:
4107-9
(1997), and angiogenesis assays such as induction of vascularization of the
chick
chorioallantoic membrane or induction of vascular endothelial cell migration
as described
in Ribatta et al., Intl. J. Dev. Biol., 40: 1189-97 ( 1999) and Li et al.,
Clin. Exp.
Metastasis, 17:423-9 (1999), respectively. Suitable tumor cells lines are
available, e.g.
from American Type Tissue Culture Collection catalogs.
4.10.12 RECEPTOR/LIGAND ACTIVITY
A polypeptide of the present invention may also demonstrate activity as
receptor,
receptor ligand or inhibitor or agonist of receptor/ligand interactions. A
polynucleotide
of the invention can encode a polypeptide exhibiting such characteristics.
Examples of
such receptors and ligands include, without limitation, cytokine receptors and
their
ligands, receptor kinases and their ligands, receptor phosphatases and their
ligands,
receptors involved in cell-cell interactions and their ligands (including
without limitation,
cellular adhesion molecules (such as selectins, integrins and their ligands)
and
receptor/ligand pairs involved in antigen presentation, antigen recognition
and
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
64
development of cellular and humoral immune responses. Receptors and ligands
are also
useful for screening of potential peptide or small molecule inhibitors of the
relevant
receptor/ligand interaction. A protein of the present invention (including,
without
limitation, fragments of receptors and ligands) may themselves be useful as
inhibitors of
receptor/ligand interactions.
The activity of a polypeptide of the invention may, among other means, be
measured by the following methods:
Suitable assays for receptor-ligand activity include without limitation those
described in: Current Protocols in Immunology, Ed by J. E. Coligan, A. M.
Kruisbeek,
D. H. Margulies, E. M. Shevach, W. Strober, Pub. Greene Publishing Associates
and
Wiley- Interscience (Chapter 7.28, Measurement of Cellular Adhesion under
static
conditions 7.28.1- 7.28.22), Takai et al., Proc. Natl. Acad. Sci. USA 84:6864-
6868, 1987;
Bierer et al., J. Exp. Med. 168:1145-1156, 1988; Rosenstein et al., J. Exp.
Med.
169:149-160 1989; Stoltenborg et al., J. Immunol. Methods 175:59-68, 1994;
Stitt et al.,
Cell 80:661-670, 1995.
By way of example, the polypeptides of the invention may be used as a receptor
for a ligand(s) thereby transmitting the biological activity of that
ligand(s). Ligands may
be identified through binding assays, affinity chromatography, dihybrid
screening assays,
BIAcore assays, gel overlay assays, or other methods known in the art.
Studies characterizing drugs or proteins as agonist or antagonist or partial
agonists
or a partial antagonist require the use of other proteins as competing
ligands. The
polypeptides of the present invention or ligand(s) thereof may be labeled by
being
coupled to radioisotopes, colorimetric molecules or a toxin molecules by
conventional
methods. ("Guide to Protein Purification" Murray P. Deutscher (ed) Methods in
Enzymology Vol. 182 (1990) Academic Press, Inc. San Diego). Examples of
radioisotopes include, but are not limited to, tritium and carbon-14 .
Examples of
colorimetric molecules include, but are not limited to, fluorescent molecules
such as
fluorescamine, or rhodamine or other colorimetric molecules. Examples of
toxins
include, but are not limited, to ricin.
4.10.13 DRUG SCREENING
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
This invention is particularly useful for screening chemical compounds by
using
the novel polypeptides or binding fragments thereof in any of a variety of
drug screening
techniques. The polypeptides or fragments employed in such a test may either
be free in
solution, affixed to a solid support, borne on a cell surface or located
intracellularly. One
5 method of drug screening utilizes eukaryotic or prokaryotic host cells which
are stably
transformed with recombinant nucleic acids expressing the polypeptide or a
fragment
thereof. Drugs are screened against such transformed cells in competitive
binding assays.
Such cells, either in viable or fixed form, can be used for standard binding
assays. One
may measure, for example, the formation of complexes between polypeptides of
the
10 invention or fragments and the agent being tested or examine the diminution
in complex
formation between the novel polypeptides and an appropriate cell line, which
are well
known in the art.
Sources for test compounds that may be screened for ability to bind to or
modulate (i.e., increase or decrease) the activity of polypeptides of the
invention include
15 (1) inorganic and organic chemical libraries, (2) natural product
libraries, and (3)
combinatorial libraries comprised of either random or mimetic peptides,
oligonucleotides
or organic molecules.
Chemical libraries may be readily synthesized or purchased from a number of
commercial sources, and may include structural analogs of known compounds or
20 compounds that are identified as "hits" or "leads" via natural product
screening.
The sources of natural product libraries are microorganisms (including
bacteria
and fungi), animals, plants or other vegetation, or marine organisms, and
libraries of
mixtures for screening may be created by: (1) fermentation and extraction of
broths from
soil, plant or marine microorganisms or (2) extraction of the organisms
themselves.
25 Natural product libraries include polyketides, non-ribosomal peptides, and
(non-naturally
occurring) variants thereof. For a review, see Science 282:63-68 (1998).
Combinatorial libraries are composed of large numbers of peptides,
oligonucleotides or organic compounds and can be readily prepared by
traditional
automated synthesis methods, PCR, cloning or proprietary synthetic methods. Of
30 particular interest are peptide and oligonucleotide combinatorial
libraries. Still other
libraries of interest include peptide, protein, peptidomimetic, multiparallel
synthetic
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
66
collection, recombinatorial, and polypeptide libraries. For a review of
combinatorial
chemistry and libraries created therefrom, see Myers, Curr. Opin. Biotechnol.
8:701-707
(1997). For reviews and examples of peptidomimetic libraries, see Al-Obeidi et
al., Mol.
Biotechnol, 9(3):205-23 (1998); Hruby et al., Curr Opin Chem Biol, 1(1):114-19
(1997);
Dorner et al., BioorgMed Chem, 4(5):709-15 (1996) (alkylated dipeptides).
Identification of modulators through use of the various libraries described
herein
permits modification of the candidate "hit" (or "lead") to optimize the
capacity of the
"hit" to bind a polypeptide of the invention. The molecules identified in the
binding assay
are then tested for antagonist or agonist activity in in vivo tissue culture
or animal models
that are well known in the art. In brief, the molecules are titrated into a
plurality of cell
cultures or animals and then tested for either cell/animal death or prolonged
survival of
the animal/cells.
The binding molecules thus identified may be complexed with toxins, e.g.,
ricin
or cholera, or with other compounds that are toxic to cells such as
radioisotopes. The
toxin-binding molecule complex is then targeted to a tumor or other cell by
the specificity
of the binding molecule for a polypeptide of the invention. Alternatively, the
binding
molecules may be complexed with imaging agents for targeting and imaging
purposes.
4.10.14 ASSAY FOR RECEPTOR ACTIVITY
The invention also provides methods to detect specific binding of a
polypeptide
e.g. a ligand or a receptor. The art provides numerous assays particularly
useful for
identifying previously unknown binding partners for receptor polypeptides of
the
invention. For example, expression cloning using mammalian or bacterial cells,
or
dihybrid screening assays can be used to identify polynucleotides encoding
binding
partners. As another example, affinity chromatography with the appropriate
immobilized
polypeptide of the invention can be used to isolate polypeptides that
recognize and bind
polypeptides of the invention. There are a number of different libraries used
for the
identification of compounds, and in particular small molecules, that modulate
(i. e.,
increase or decrease) biological activity of a polypeptide of the invention.
Ligands for
receptor polypeptides of the invention can also be identified by adding
exogenous
ligands, or cocktails of ligands to two cells populations that are genetically
identical
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
67
except for the expression of the receptor of the invention: one cell
population expresses
the receptor of the invention whereas the other does not. The response of the
two cell
populations to the addition of ligands(s) are then compared. Alternatively, an
expression
library can be co-expressed with the polypeptide of the invention in cells and
assayed for
S an autocrine response to identify potential ligand(s). As still another
example, BIAcore
assays, gel overlay assays, or other methods known in the art can be used to
identify
binding partner polypeptides, including, ( 1 ) organic and inorganic chemical
libraries, (2)
natural product libraries, and (3) combinatorial libraries comprised of random
peptides,
oligonucleotides or organic molecules.
The role of downstream intracellular signaling molecules in the signaling
cascade
of the polypeptide of the invention can be determined. For example, a chimeric
protein in
which the cytoplasmic domain of the polypeptide of the invention is fused to
the
extracellular portion of a protein, whose ligand has been identified, is
produced in a host
cell. The cell is then incubated with the ligand specific for the
extracellular portion of the
chimeric protein, thereby activating the chimeric receptor. Known downstream
proteins
involved in intracellular signaling can then be assayed for expected
modifications i.e.
phosphorylation. Other methods known to those in the art can also be used to
identify
signaling molecules involved in receptor activity.
4.10.15 ANTI-INFLAMMATORY ACTIVITY
Compositions of the present invention may also exhibit anti-inflammatory
activity. The anti-inflammatory activity may be achieved by providing a
stimulus to cells
involved in the inflammatory response, by inhibiting or promoting cell-cell
interactions
(such as, for example, cell adhesion), by inhibiting or promoting chemotaxis
of cells
involved in the inflammatory process, inhibiting or promoting cell
extravasation, or by
stimulating or suppressing production of other factors which more directly
inhibit or
promote an inflammatory response. Compositions with such activities can be
used to treat
inflammatory conditions including chronic or acute conditions), including
without
limitation intimation associated with infection (such as septic shock, sepsis
or systemic
inflammatory response syndrome (SIRS)), ischemia-reperfusion injury, endotoxin
lethality, arthritis, complement-mediated hyperacute rejection, nephritis,
cytokine or
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
68
chemokine-induced lung injury, inflammatory bowel disease, Crohn's disease or
resulting
from over production of cytokines such as TNF or IL-1. Compositions of the
invention
may also be useful to treat anaphylaxis and hypersensitivity to an antigenic
substance or
material. Compositions of this invention may be utilized to prevent or treat
conditions
such as, but not limited to, sepsis, acute pancreatitis, endotoxin shock,
cytokine induced
shock, rheumatoid arthritis, chronic inflammatory arthritis, pancreatic cell
damage from
diabetes mellitus type l, graft versus host disease, inflammatory bowel
disease,
inflamation associated with pulmonary disease, other autoimmune disease or
inflammatory disease, an antiproliferative agent such as for acute or chronic
mylegenous
leukemia or in the prevention of premature labor secondary to intrauterine
infections.
4.10.16 LEUKEMIAS
Leukemias and related disorders may be treated or prevented by administration
of
a therapeutic that promotes or inhibits function of the polynucleotides and/or
polypeptides of the invention. Such leukemias and related disorders include
but are not
limited to acute leukemia, acute lymphocytic leukemia, acute myelocytic
leukemia,
myeloblastic, promyelocytic, myelomonocytic, monocytic, erythroleukemia,
chronic
leukemia, chronic myelocytic (granulocytic) leukemia and chronic lymphocytic
leukemia
(for a review of such disorders, see Fishman et al., 1985, Medicine, 2d Ed.,
J.B.
Lippincott Co., Philadelphia).
4.10.17 NERVOUS SYSTEM DISORDERS
Nervous system disorders, involving cell types which can be tested for
efficacy of
intervention with compounds that modulate the activity of the polynucleotides
and/or
polypeptides of the invention, and which can be treated upon thus observing an
indication
of therapeutic utility, include but are not limited to nervous system
injuries, and diseases
or disorders which result in either a disconnection of axons, a diminution or
degeneration
of neurons, or demyelination. Nervous system lesions which may be treated in a
patient
(including human and non-human mammalian patients) according to the invention
include but are not limited to the following lesions of either the central
(including spinal
cord, brain) or peripheral nervous systems:
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
69
(i) traumatic lesions, including lesions caused by physical injury or
associated
with surgery, for example, lesions which sever a portion of the nervous
system, or
compression injuries;
(ii) ischemic lesions, in which a lack of oxygen in a portion of the nervous
system results in neuronal injury or death, including cerebral infarction or
ischemia, or
spinal cord infarction or ischemia;
(iii) infectious lesions, in which a portion of the nervous system is
destroyed or
injured as a result of infection, for example, by an abscess or associated
with infection by
human immunodeficiency virus, herpes zoster, or herpes simplex virus or with
Lyme
disease, tuberculosis, syphilis;
(iv) degenerative lesions, in which a portion of the nervous system is
destroyed
or injured as a result of a degenerative process including but not limited to
degeneration
associated with Parkinson's disease, Alzheimer's disease, Huntington's chorea,
or
amyotrophic lateral sclerosis;
(v) lesions associated with nutritional diseases or disorders, in which a
portion
of the nervous system is destroyed or injured by a nutritional disorder or
disorder of
metabolism including but not limited to, vitamin B12 deficiency, folic acid
deficiency,
Wernicke disease, tobacco-alcohol amblyopia, Marchiafava-Bignami disease
(primary
degeneration of the corpus callosum), and alcoholic cerebellar degeneration;
(vi) neurological lesions associated with systemic diseases including but not
limited to diabetes (diabetic neuropathy, Bell's palsy), systemic lupus
erythematosus,
carcinoma, or sarcoidosis;
(vii) lesions caused by toxic substances including alcohol, lead, or
particular
neurotoxins; and
(viii) demyelinated lesions in which a portion of the nervous system is
destroyed or injured by a demyelinating disease including but not limited to
multiple
sclerosis, human immunodeficiency virus-associated myelopathy, transverse
myelopathy
or various etiologies, progressive multifocal leukoencephalopathy, and central
pontine
myelinolysis.
Therapeutics which are useful according to the invention for treatment of a
nervous system disorder may be selected by testing for biological activity in
promoting
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
the survival or differentiation of neurons. For example, and not by way of
limitation,
therapeutics which elicit any of the following effects may be useful according
to the
invention:
(i) increased survival time of neurons in culture;
5 (ii) increased sprouting of neurons in culture or in vivo;
(iii) increased production of a neuron-associated molecule in culture or in
vivo,
e.g., choline acetyltransferase or acetylcholinesterase with respect to motor
neurons; or
(iv) decreased symptoms of neuron dysfunction in vivo.
Such effects may be measured by any method known in the art. In preferred,
10 non-limiting embodiments, increased survival of neurons may be measured by
the
method set forth in Arakawa et al. (1990, J. Neurosci. 10:3507-3515);
increased sprouting
of neurons may be detected by methods set forth in Pestronk et al. (1980, Exp.
Neurol.
70:65-82) or Brown et al. (1981, Ann. Rev. Neurosci. 4:17-42); increased
production of
neuron-associated molecules may be measured by bioassay, enzymatic assay,
antibody
I 5 binding, Northern blot assay, etc., depending on the molecule to be
measured; and motor
neuron dysfunction may be measured by assessing the physical manifestation of
motor
neuron disorder, e.g., weakness, motor neuron conduction velocity, or
functional
disability.
In specific embodiments, motor neuron disorders that may be treated according
to
20 the invention include but are not limited to disorders such as infarction,
infection,
exposure to toxin, trauma, surgical damage, degenerative disease or malignancy
that may
affect motor neurons as well as other components of the nervous system, as
well as
disorders that selectively affect neurons such as amyotrophic lateral
sclerosis, and
including but not limited to progressive spinal muscular atrophy, progressive
bulbar
25 palsy, primary lateral sclerosis, infantile and juvenile muscular atrophy,
progressive
bulbar paralysis of childhood (Fazio-Londe syndrome), poliomyelitis and the
post polio
syndrome, and Hereditary Motorsensory Neuropathy (Charcot-Marie-Tooth
Disease).
4.10.18 OTHER ACTIVITIES
30 A polypeptide of the invention may also exhibit one or more of the
following
additional activities or effects: inhibiting the growth, infection or function
of, or killing,
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
71
infectious agents, including, without limitation, bacteria, viruses, fungi and
other
parasites; effecting (suppressing or enhancing) bodily characteristics,
including, without
limitation, height, weight, hair color, eye color, skin, fat to lean ratio or
other tissue
pigmentation, or organ or body part size or shape (such as, for example,
breast
augmentation or diminution, change in bone form or shape); effecting
biorhythms or
circadian cycles or rhythms; effecting the fertility of male or female
subjects; effecting
the metabolism, catabolism, anabolism, processing, utilization, storage or
elimination of
dietary fat, lipid, protein, carbohydrate, vitamins, minerals, co-factors or
other nutritional
factors or component(s); effecting behavioral characteristics, including,
without
limitation, appetite, libido, stress, cognition (including cognitive
disorders), depression
(including depressive disorders) and violent behaviors; providing analgesic
effects or
other pain reducing effects; promoting differentiation and growth of embryonic
stem cells
in lineages other than hematopoietic lineages; hormonal or endocrine activity;
in the case
of enzymes, correcting deficiencies of the enzyme and treating deficiency-
related
diseases; treatment of hyperproliferative disorders (such as, for example,
psoriasis);
immunoglobulin-like activity (such as, for example, the ability to bind
antigens or
complement); and the ability to act as an antigen in a vaccine composition to
raise an
immune response against such protein or another material or entity which is
cross-reactive with such protein.
4.10.19 IDENTIFICATION OF POLYMORPHISMS
The demonstration of polymorphisms makes possible the identification of such
polymorphisms in human subjects and the pharmacogenetic use of this
information for
diagnosis and treatment. Such polymorphisms may be associated with, e.g.,
differential
predisposition or susceptibility to various disease states (such as disorders
involving
inflammation or immune response) or a differential response to drug
administration, and
this genetic information can be used to tailor preventive or therapeutic
treatment
appropriately. For example, the existence of a polymorphism associated with a
predisposition to inflammation or autoimmune disease makes possible the
diagnosis of
this condition in humans by identifying the presence of the polymorphism.
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
72
Polymorphisms can be identified in a variety of ways known in the art which
all
generally involve obtaining a sample from a patient, analyzing DNA from the
sample,
optionally involving isolation or amplification of the DNA, and identifying
the presence
of the polymorphism in the DNA. For example, PCR may be used to amplify an
appropriate fragment of genomic DNA which may then be sequenced.
Alternatively, the
DNA may be subjected to allele-specific oligonucleotide hybridization (in
which
appropriate oligonucleotides are hybridized to the DNA under conditions
permitting
detection of a single base mismatch) or to a single nucleotide extension assay
(in which
an oligonucleotide that hybridizes immediately adjacent to the position of the
polymorphism is extended with one or more labeled nucleotides). In addition,
traditional
restriction fragment length polymorphism analysis (using restriction enzymes
that
provide differential digestion of the genomic DNA depending on the presence or
absence
of the polymorphism) may be performed. Arrays with nucleotide sequences of the
present invention can be used to detect polymorphisms. The array can comprise
modified
nucleotide sequences of the present invention in order to detect the
nucleotide sequences
of the present invention. In the alternative, any one of the nucleotide
sequences of the
present invention can be placed on the array to detect changes from those
sequences.
Alternatively a polymorphism resulting in a change in the amino acid sequence
could also be detected by detecting a corresponding change in amino acid
sequence of the
protein, e.g., by an antibody specific to the variant sequence.
4.10.20 ARTHRITIS AND INFLAMMATION
The immunosuppressive effects of the compositions of the invention against
rheumatoid arthritis is determined in an experimental animal model system. The
experimental model system is adjuvant induced arthritis in rats, and the
protocol is
described by J. Holoshitz, et at., 1983, Science, 219:56, or by B. Waksman et
al., 1963,
Int. Arch. Allergy Appl. Immunol., 23:129. Induction of the disease can be
caused by a
single injection, generally intradermally, of a suspension of killed
Mycobacterium
tuberculosis in complete Freund's adjuvant (CFA). The route of injection can
vary, but
rats may be injected at the base of the tail with an adjuvant mixture. The
polypeptide is
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
73
administered in phosphate buffered solution (PBS) at a dose of about 1-5
mg/kg. The
control consists of administering PBS only.
The procedure for testing the effects of the test compound would consist of
intradermally injecting killed Mycobacterium tuberculosis in CFA followed by
immediately administering the test compound and subsequent treatment every
other day
until day 24. At 14, 15, 18, 20, 22, and 24 days after injection of
Mycobacterium CFA, an
overall arthritis score may be obtained as described by J. Holoskitz above. An
analysis of
the data would reveal that the test compound would have a dramatic affect on
the
swelling of the joints as measured by a decrease of the arthritis score.
4.11 THERAPEUTIC METHODS
The compositions (including polypeptide fragments, analogs, variants and
antibodies or other binding partners or modulators including antisense
polynucleotides)
of the invention have numerous applications in a variety of therapeutic
methods.
Examples of therapeutic applications include, but are not limited to, those
exemplified
herein.
4.11.1 EXAMPLE
One embodiment of the invention is the administration of an effective amount
of
the polypeptides or other composition of the invention to individuals affected
by a
disease or disorder that can be modulated by regulating the peptides of the
invention.
While the mode of administration is not particularly important, parenteral
administration
is preferred. An exemplary mode of administration is to deliver an intravenous
bolus.
The dosage of the polypeptides or other composition of the invention will
normally be
determined by the prescribing physician. It is to be expected that the dosage
will vary
according to the age, weight, condition and response of the individual
patient. Typically,
the amount of polypeptide administered per dose will be in the range of about
0.01 ~g/kg
to 100 mg/kg of body weight, with the preferred dose being about 0.1 ~g/kg to
10 mg/kg
of patient body weight. For parenteral administration, polypeptides of the
invention will
be formulated in an injectable form combined with a pharmaceutically
acceptable
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
74
parenteral vehicle. Such vehicles are well known in the art and examples
include water,
saline, Ringer's solution, dextrose solution, and solutions consisting of
small amounts of
the human serum albumin. The vehicle may contain minor amounts of additives
that
maintain the isotonicity and stability of the polypeptide or other active
ingredient. The
preparation of such solutions is within the skill of the art.
4.12 PHARMACEUTICAL FORMULATIONS AND ROUTES OF
ADMINISTRATION
A protein or other composition of the present invention (from whatever source
derived, including without limitation from recombinant and non-recombinant
sources and
including antibodies and other binding partners of the polypeptides of the
invention) may
be administered to a patient in need, by itself, or in pharmaceutical
compositions where it
is mixed with suitable carriers or excipient(s) at doses to treat or
ameliorate a variety of
disorders. Such a composition may optionally contain (in addition to protein
or other
active ingredient and a carrier) diluents, fillers, salts, buffers,
stabilizers, solubilizers, and
other materials well known in the art. The term "pharmaceutically acceptable"
means a
non-toxic material that does not interfere with the effectiveness of the
biological activity
of the active ingredient(s). The characteristics of the carrier will depend on
the route of
administration. The pharmaceutical composition of the invention may also
contain
cytokines, lymphokines, or other hematopoietic factors such as M-CSF, GM-CSF,
TNF,
IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-
13, IL-14,
IL-15, IFN, TNFO, TNF1, TNF2, G-CSF, Meg-CSF, thrombopoietin, stem cell
factor,
and erythropoietin. In further compositions, proteins of the invention may be
combined
with other agents beneficial to the treatment of the disease or disorder in
question. These
agents include various growth factors such as epidermal growth factor (EGF),
platelet-derived growth factor (PDGF), transforming growth factors (TGF-a and
TGF-(3),
insulin-like growth factor (IGF), as well as cytokines described herein.
The pharmaceutical composition may further contain other agents which either
enhance the activity of the protein or other active ingredient or complement
its activity or
use in treatment. Such additional factors and/or agents may be included in the
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
pharmaceutical composition to produce a synergistic effect with protein or
other active
ingredient of the invention, or to minimize side effects. Conversely, protein
or other
active ingredient of the present invention may be included in formulations of
the
particular clotting factor, cytokine, lymphokine, other hematopoietic factor,
thrombolytic
5 or anti-thrombotic factor, or anti- inflammatory agent to minimize side
effects of the
clotting factor, cytokine, lymphokine, other hematopoietic factor,
thrombolytic or
anti-thrombotic factor, or anti-inflammatory agent (such as IL-lRa, IL-1 Hyl,
IL-1 Hy2,
anti-TNF, corticosteroids, immunosuppressive agents). A protein of the present
invention may be active in multimers (e.g., heterodimers or homodimers) or
complexes
10 with itself or other proteins. As a result, pharmaceutical compositions of
the invention
may comprise a protein of the invention in such multimeric or complexed form.
As an alternative to being included in a pharmaceutical composition of the
invention including a first protein, a second protein or a therapeutic agent
may be
concurrently administered with the first protein (e.g., at the same time, or
at differing
15 times provided that therapeutic concentrations of the combination of agents
is achieved at
the treatment site). Techniques for formulation and administration of the
compounds of
the instant application may be found in "Remington's Pharmaceutical Sciences,"
Mack
Publishing Co., Easton, PA, latest edition. A therapeutically effective dose
further refers
to that amount of the compound sufficient to result in amelioration of
symptoms, e.g.,
20 treatment, healing, prevention or amelioration of the relevant medical
condition, or an
increase in rate of treatment, healing, prevention or amelioration of such
conditions.
When applied to an individual active ingredient, administered alone, a
therapeutically
effective dose refers to that ingredient alone. When applied to a combination,
a
therapeutically effective dose refers to combined amounts of the active
ingredients that
25 result in the therapeutic effect, whether administered in combination,
serially or
simultaneously.
In practicing the method of treatment or use of the present invention, a
therapeutically effective amount of protein or other active ingredient of the
present
invention is administered to a mammal having a condition to be treated.
Protein or other
30 active ingredient of the present invention may be administered in
accordance with the
method of the invention either alone or in combination with other therapies
such as
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
76
treatments employing cytokines, lymphokines or other hematopoietic factors.
When co-
administered with one or more cytokines, lymphokines or other hematopoietic
factors,
protein or other active ingredient of the present invention may be
administered either
simultaneously with the cytokine(s), lymphokine(s), other hematopoietic
factor(s),
thrombolytic or anti-thrombotic factors, or sequentially. If administered
sequentially, the
attending physician will decide on the appropriate sequence of administering
protein or
other active ingredient of the present invention in combination with
cytokine(s),
lymphokine(s), other hematopoietic factor(s), thrombolytic or anti-thrombotic
factors.
4.12.1 ROUTES OF ADMINISTRATION
Suitable routes of administration may, for example, include oral, rectal,
transmucosal, or intestinal administration; parenteral delivery, including
intramuscular,
subcutaneous, intramedullary injections, as well as intrathecal, direct
intraventricular,
intravenous, intraperitoneal, intranasal, or intraocular injections.
Administration of
I 5 protein or other active ingredient of the present invention used in the
pharmaceutical
composition or to practice the method of the present invention can be carried
out in a
variety of conventional ways, such as oral ingestion, inhalation, topical
application or
cutaneous, subcutaneous, intraperitoneal, parenteral or intravenous injection.
Intravenous
administration to the patient is preferred.
Alternately, one may administer the compound in a local rather than systemic
manner, for example, via injection of the compound directly into a arthritic
joints or in
fibrotic tissue, often in a depot or sustained release formulation. In order
to prevent the
scarring process frequently occurring as complication of glaucoma surgery, the
compounds may be administered topically, for example, as eye drops.
Furthermore, one
may administer the drug in a targeted drug delivery system, for example, in a
liposome
coated with a specific antibody, targeting, for example, arthritic or fibrotic
tissue. The
liposomes will be targeted to and taken up selectively by the afflicted
tissue.
The polypeptides of the invention are administered by any route that delivers
an
effective dosage to the desired site of action. The determination of a
suitable route of
administration and an effective dosage for a particular indication is within
the level of
skill in the art. Preferably for wound treatment, one administers the
therapeutic
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
77
compound directly to the site. Suitable dosage ranges for the polypeptides of
the
invention can be extrapolated from these dosages or from similar studies in
appropriate
animal models. Dosages can then be adjusted as necessary by the clinician to
provide
maximal therapeutic benefit.
4.12.2 COMPOSITIONS/FORMULATIONS
Pharmaceutical compositions for use in accordance with the present invention
thus may be formulated in a conventional manner using one or more
physiologically
acceptable carriers comprising excipients and auxiliaries which facilitate
processing of
the active compounds into preparations which can be used pharmaceutically.
These
pharmaceutical compositions may be manufactured in a manner that is itself
known, e.g.,
by means of conventional mixing, dissolving, granulating, dragee-making,
levigating,
emulsifying, encapsulating, entrapping or lyophilizing processes. Proper
formulation is
dependent upon the route of administration chosen. When a therapeutically
effective
amount of protein or other active ingredient of the present invention is
administered
orally, protein or other active ingredient of the present invention will be in
the form of a
tablet, capsule, powder, solution or elixir. When administered in tablet form,
the
pharmaceutical composition of the invention may additionally contain a solid
carrier such
as a gelatin or an adjuvant. The tablet, capsule, and powder contain from
about 5 to 95%
protein or other active ingredient of the present invention, and preferably
from about 25
to 90% protein or other active ingredient of the present invention. When
administered in
liquid form, a liquid carrier such as water, petroleum, oils of animal or
plant origin such
as peanut oil, mineral oil, soybean oil, or sesame oil, or synthetic oils may
be added. The
liquid form of the pharmaceutical composition may further contain
physiological saline
solution, dextrose or other saccharide solution, or glycols such as ethylene
glycol,
propylene glycol or polyethylene glycol. When administered in liquid form, the
pharmaceutical composition contains from about 0.5 to 90% by weight of protein
or other
active ingredient of the present invention, and preferably from about 1 to 50%
protein or
other active ingredient of the present invention.
When a therapeutically effective amount of protein or other active ingredient
of
the present invention is administered by intravenous, cutaneous or
subcutaneous
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
78
injection, protein or other active ingredient of the present invention will be
in the form of
a pyrogen-free, parenterally acceptable aqueous solution. The preparation of
such
parenterally acceptable protein or other active ingredient solutions, having
due regard to
pH, isotonicity, stability, and the like, is within the skill in the art. A
preferred
pharmaceutical composition for intravenous, cutaneous, or subcutaneous
injection should
contain, in addition to protein or other active ingredient of the present
invention, an
isotonic vehicle such as Sodium Chloride Injection, Ringer's Injection,
Dextrose
Injection, Dextrose and Sodium Chloride Injection, Lactated Ringer's
Injection, or other
vehicle as known in the art. The pharmaceutical composition of the present
invention
may also contain stabilizers, preservatives, buffers, antioxidants, or other
additives
known to those of skill in the art. For injection, the agents of the invention
may be
formulated in aqueous solutions, preferably in physiologically compatible
buffers such as
Hanks's solution, Ringer's solution, or physiological saline buffer. For
transmucosal
administration, penetrants appropriate to the barrier to be permeated are used
in the
formulation. Such penetrants are generally known in the art.
For oral administration, the compounds can be formulated readily by combining
the active compounds with pharmaceutically acceptable carriers well known in
the art.
Such carriers enable the compounds of the invention to be formulated as
tablets, pills,
dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like,
for oral
ingestion by a patient to be treated. Pharmaceutical preparations for oral use
can be
obtained from a solid excipient, optionally grinding a resulting mixture, and
processing
the mixture of granules, after adding suitable auxiliaries, if desired, to
obtain tablets or
dragee cores. Suitable excipients are, in particular, fillers such as sugars,
including
lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for
example, maize
starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth,
methyl cellulose,
hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose, and/or
polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added,
such as the
cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof
such as sodium
alginate. Dragee cores are provided with suitable coatings. For this purpose,
concentrated sugar solutions may be used, which may optionally contain gum
arabic, talc,
polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, and/or titanium
dioxide, lacquer
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
79
solutions, and suitable organic solvents or solvent mixtures. Dyestuffs or
pigments may
be added to the tablets or dragee coatings for identification or to
characterize different
combinations of active compound doses.
Pharmaceutical preparations which can be used orally include push-fit capsules
made of gelatin, as well as soft, sealed capsules made of gelatin and a
plasticizes, such as
glycerol or sorbitol. The push-fit capsules can contain the active ingredients
in admixture
with filler such as lactose, binders such as starches, andlor lubricants such
as talc or
magnesium stearate and, optionally, stabilizers. In soft capsules, the active
compounds
may be dissolved or suspended in suitable liquids, such as fatty oils, liquid
paraffin, or
liquid polyethylene glycols. In addition, stabilizers may be added. All
formulations for
oral administration should be in dosages suitable for such administration. For
buccal
administration, the compositions may take the form of tablets or lozenges
formulated in
conventional manner.
For administration by inhalation, the compounds for use according to the
present
1 S invention are conveniently delivered in the form of an aerosol spray
presentation from
pressurized packs or a nebuliser, with the use of a suitable propellant, e.g.,
dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane,
carbon
dioxide or other suitable gas. In the case of a pressurized aerosol the dosage
unit may be
determined by providing a valve to deliver a metered amount. Capsules and
cartridges
of, e.g., gelatin for use in an inhaler or insufflator may be formulated
containing a powder
mix of the compound and a suitable powder base such as lactose or starch. The
compounds may be formulated for parenteral administration by injection, e.g.,
by bolus
injection or continuous infusion. Formulations for injection may be presented
in unit
dosage form, e.g., in ampules or in mufti-dose containers, with an added
preservative.
The compositions may take such forms as suspensions, solutions or emulsions in
oily or
aqueous vehicles, and may contain formulatory agents such as suspending,
stabilizing
and/or dispersing agents.
Pharmaceutical formulations for parenteral administration include aqueous
solutions of the active compounds in water-soluble form. Additionally,
suspensions of
the active compounds may be prepared as appropriate oily injection
suspensions.
Suitable lipophilic solvents or vehicles include fatty oils such as sesame
oil, or synthetic
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
fatty acid esters, such as ethyl oleate or triglycerides, or liposomes.
Aqueous injection
suspensions may contain substances which increase the viscosity of the
suspension, such
as sodium carboxymethyl cellulose, sorbitol, or dextran. Optionally, the
suspension may
also contain suitable stabilizers or agents which increase the solubility of
the compounds
5 to allow for the preparation of highly concentrated solutions.
Alternatively, the active
ingredient may be in powder form for constitution with a suitable vehicle,
e.g., sterile
pyrogen-free water, before use.
The compounds may also be formulated in rectal compositions such as
suppositories or retention enemas, e.g., containing conventional suppository
bases such as
10 cocoa butter or other glycerides. In addition to the formulations described
previously, the
compounds may also be formulated as a depot preparation. Such long acting
formulations may be administered by implantation (for example subcutaneously
or
intramuscularly) or by intramuscular injection. Thus, for example, the
compounds may
be formulated with suitable polymeric or hydrophobic materials (for example as
an
15 emulsion in an acceptable oil) or ion exchange resins, or as sparingly
soluble derivatives,
for example, as a sparingly soluble salt.
A pharmaceutical carrier for the hydrophobic compounds of the invention is a
co-
solvent system comprising benzyl alcohol, a nonpolar surfactant, a water-
miscible
organic polymer, and an aqueous phase. The co-solvent system may be the VPD
20 co-solvent system. VPD is a solution of 3% w/v benzyl alcohol, 8% w/v of
the nonpolar
surfactant polysorbate 80, and 65% w/v polyethylene glycol 300, made up to
volume in
absolute ethanol. The VPD co-solvent system (VPD:SW) consists of VPD diluted
1:1
with a 5% dextrose in water solution. This co-solvent system dissolves
hydrophobic
compounds well, and itself produces low toxicity upon systemic administration.
25 Naturally, the proportions of a co-solvent system may be varied
considerably without
destroying its solubility and toxicity characteristics. Furthermore, the
identity of the
co-solvent components may be varied: for example, other low-toxicity nonpolar
surfactants may be used instead of polysorbate 80; the fraction size of
polyethylene
glycol may be varied; other biocompatible polymers may replace polyethylene
glycol,
30 e.g. polyvinyl pyrrolidone; and other sugars or polysaccharides may
substitute for
dextrose. Alternatively, other delivery systems for hydrophobic pharmaceutical
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
81
compounds may be employed. Liposomes and emulsions are well known examples of
delivery vehicles or carriers for hydrophobic drugs. Certain organic solvents
such as
dimethylsulfoxide also may be employed, although usually at the cost of
greater toxicity.
Additionally, the compounds may be delivered using a sustained-release system,
such as
semipermeable matrices of solid hydrophobic polymers containing the
therapeutic agent.
Various types of sustained-release materials have been established and are
well known by
those skilled in the art. Sustained-release capsules may, depending on their
chemical
nature, release the compounds for a few weeks up to over 100 days. Depending
on the
chemical nature and the biological stability of the therapeutic reagent,
additional
strategies for protein or other active ingredient stabilization may be
employed.
The pharmaceutical compositions also may comprise suitable solid or gel phase
carriers or excipients. Examples of such carriers or excipients include but
are not limited
to calcium carbonate, calcium phosphate, various sugars, starches, cellulose
derivatives,
gelatin, and polymers such as polyethylene glycols. Many of the active
ingredients of the
invention may be provided as salts with pharmaceutically compatible counter
ions. Such
pharmaceutically acceptable base addition salts are those salts which retain
the biological
effectiveness and properties of the free acids and which are obtained by
reaction with
inorganic or organic bases such as sodium hydroxide, magnesium hydroxide,
ammonia,
trialkylamine, dialkylamine, monoalkylamine, dibasic amino acids, sodium
acetate,
potassium benzoate, triethanol amine and the like.
The pharmaceutical composition of the invention may be in the form of a
complex of the proteins) or other active ingredients) of present invention
along with
protein or peptide antigens. The protein and/or peptide antigen will deliver a
stimulatory
signal to both B and T lymphocytes. B lymphocytes will respond to antigen
through their
surface immunoglobulin receptor. T lymphocytes will respond to antigen through
the T
cell receptor (TCR) following presentation of the antigen by MHC proteins. MHC
and
structurally related proteins including those encoded by class I and class II
MHC genes
on host cells will serve to present the peptide antigens) to T lymphocytes.
The antigen
components could also be supplied as purified MHC-peptide complexes alone or
with
co-stimulatory molecules that can directly signal T cells. Alternatively
antibodies able to
bind surface immunoglobulin and other molecules on B cells as well as
antibodies able to
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
82
bind the TCR and other molecules on T cells can be combined with the
pharmaceutical
composition of the invention.
The pharmaceutical composition of the invention may be in the form of a
liposome in which protein of the present invention is combined, in addition to
other
S pharmaceutically acceptable carriers, with amphipathic agents such as lipids
which exist
in aggregated form as micelles, insoluble monolayers, liquid crystals, or
lamellar layers
in aqueous solution. Suitable lipids for liposomal formulation include,
without limitation,
monoglycerides, diglycerides, sulfatides, lysolecithins, phospholipids,
saponin, bile acids,
and the like. Preparation of such liposomal formulations is within the level
of skill in the
art, as disclosed, for example, in U.S. Patent Nos. 4,235,871; 4,501,728;
4,837,028; and
4,737,323, all of which are incorporated herein by reference.
The amount of protein or other active ingredient of the present invention in
the
pharmaceutical composition of the present invention will depend upon the
nature and
severity of the condition being treated, and on the nature of prior treatments
which the
patient has undergone. Ultimately, the attending physician will decide the
amount of
protein or other active ingredient of the present invention with which to
treat each
individual patient. Initially, the attending physician will administer low
doses of protein
or other active ingredient of the present invention and observe the patient's
response.
Larger doses of protein or other active ingredient of the present invention
may be
administered until the optimal therapeutic effect is obtained for the patient,
and at that
point the dosage is not increased further. It is contemplated that the various
pharmaceutical compositions used to practice the method of the present
invention should
contain about 0.01 pg to about 100 mg (preferably about 0.1 pg to about 10 mg,
more
preferably about 0.1 pg to about 1 mg) of protein or other active ingredient
of the present
invention per kg body weight. For compositions of the present invention which
are
useful for bone, cartilage, tendon or ligament regeneration, the therapeutic
method
includes administering the composition topically, systematically, or locally
as an implant
or device. When administered, the therapeutic composition for use in this
invention is, of
course, in a pyrogen-free, physiologically acceptable form. Further, the
composition may
desirably be encapsulated or injected in a viscous form for delivery to the
site of bone,
cartilage or tissue damage. Topical administration may be suitable for wound
healing
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
83
and tissue repair. Therapeutically useful agents other than a protein or other
active
ingredient of the invention which may also optionally be included in the
composition as
described above, may alternatively or additionally, be administered
simultaneously or
sequentially with the composition in the methods of the invention. Preferably
for bone
and/or cartilage formation, the composition would include a matrix capable of
delivering
the protein-containing or other active ingredient-containing composition to
the site of
bone and/or cartilage damage, providing a structure for the developing bone
and cartilage
and optimally capable of being resorbed into the body. Such matrices may be
formed of
materials presently in use for other implanted medical applications.
The choice of matrix material is based on biocompatibility, biodegradability,
mechanical properties, cosmetic appearance and interface properties. The
particular
application of the compositions will define the appropriate formulation.
Potential
matrices for the compositions may be biodegradable and chemically defined
calcium
sulfate, tricalcium phosphate, hydroxyapatite, polylactic acid, polyglycolic
acid and
polyanhydrides. Other potential materials are biodegradable and biologically
well-defined, such as bone or dermal collagen. Further matrices are comprised
of pure
proteins or extracellular matrix components. Other potential matrices are
nonbiodegradable and chemically defined, such as sintered hydroxyapatite,
bioglass,
aluminates, or other ceramics. Matrices may be comprised of combinations of
any of the
above mentioned types of material, such as polylactic acid and hydroxyapatite
or
collagen and tricalcium phosphate. The bioceramics may be altered in
composition, such
as in calcium-aluminate-phosphate and processing to alter pore size, particle
size, particle
shape, and biodegradability. Presently preferred is a 50:50 (mole weight)
copolymer of
lactic acid and glycolic acid in the form of porous particles having diameters
ranging
from 150 to 800 microns. In some applications, it will be useful to utilize a
sequestering
agent, such as carboxymethyl cellulose or autologous blood clot, to prevent
the protein
compositions from disassociating from the matrix.
A preferred family of sequestering agents is cellulosic materials such as
alkylcelluloses (including hydroxyalkylcelluloses), including methylcellulose,
ethylcellulose, hydroxyethylcellulose, hydroxypropylcellulose,
hydroxypropyl-methylcellulose, and carboxymethylcellulose, the most preferred
being
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
84
cationic salts of carboxymethylcellulose (CMC). Other preferred sequestering
agents
include hyaluronic acid, sodium alginate, polyethylene glycol),
polyoxyethylene oxide,
carboxyvinyl polymer and polyvinyl alcohol). The amount of sequestering agent
useful
herein is 0.5-20 wt %, preferably 1-10 wt % based on total formulation weight,
which
represents the amount necessary to prevent desorption of the protein from the
polymer
matrix and to provide appropriate handling of the composition, yet not so much
that the
progenitor cells are prevented from infiltrating the matrix, thereby providing
the protein
the opportunity to assist the osteogenic activity of the progenitor cells. In
further
compositions, proteins or other active ingredients of the invention may be
combined with
other agents beneficial to the treatment of the bone and/or cartilage defect,
wound, or
tissue in question. These agents include various growth factors such as
epidermal growth
factor (EGF), platelet derived growth factor (PDGF), transforming growth
factors
(TGF-a and TGF-~3), and insulin-like growth factor (IGF).
The therapeutic compositions are also presently valuable for veterinary
applications. Particularly domestic animals and thoroughbred horses, in
addition to
humans, are desired patients for such treatment with proteins or other active
ingredients
of the present invention. The dosage regimen of a protein-containing
pharmaceutical
composition to be used in tissue regeneration will be determined by the
attending
physician considering various factors which modify the action of the proteins,
e.g.,
amount of tissue weight desired to be formed, the site of damage, the
condition of the
damaged tissue, the size of a wound, type of damaged tissue (e.g., bone), the
patient's
age, sex, and diet, the severity of any infection, time of administration and
other clinical
factors. The dosage may vary with the type of matrix used in the
reconstitution and with
inclusion of other proteins in the pharmaceutical composition. For example,
the addition
of other known growth factors, such as IGF I (insulin like growth factor I),
to the final
composition, may also effect the dosage. Progress can be monitored by periodic
assessment of tissue/bone growth and/or repair, for example, X-rays,
histomorphometric
determinations and tetracycline labeling.
Polynucleotides of the present invention can also be used for gene therapy.
Such
polynucleotides can be introduced either in vivo or ex vivo into cells for
expression in a
mammalian subject. Polynucleotides of the invention may also be administered
by other
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
known methods for introduction of nucleic acid into a cell or organism
(including,
without limitation, in the form of viral vectors or naked DNA). Cells may also
be
cultured ex vivo in the presence of proteins of the present invention in order
to proliferate
or to produce a desired effect on or activity in such cells. Treated cells can
then be
5 introduced in vivo for therapeutic purposes.
4.12.3 EFFECTIVE DOSAGE
Pharmaceutical compositions suitable for use in the present invention include
compositions wherein the active ingredients are contained in an effective
amount to
10 achieve its intended purpose. More specifically, a therapeutically
effective amount
means an amount effective to prevent development of or to alleviate the
existing
symptoms of the subject being treated. Determination of the effective amount
is well
within the capability of those skilled in the art, especially in light of the
detailed
disclosure provided herein. For any compound used in the method of the
invention, the
15 therapeutically effective dose can be estimated initially from appropriate
in vitro assays.
For example, a dose can be formulated in animal models to achieve a
circulating
concentration range that can be used to more accurately determine useful doses
in
humans. For example, a dose can be formulated in animal models to achieve a
circulating concentration range that includes the ICso as determined in cell
culture (i.e.,
20 the concentration of the test compound which achieves a half maximal
inhibition of the
protein's biological activity). Such information can be used to more
accurately determine
useful doses in humans.
A therapeutically effective dose refers to that amount of the compound that
results
in amelioration of symptoms or a prolongation of survival in a patient.
Toxicity and
25 therapeutic efficacy of such compounds can be determined by standard
pharmaceutical
procedures in cell cultures or experimental animals, e.g., for determining the
LDso (the
dose lethal to 50% of the population) and the EDso (the dose therapeutically
effective in
50% of the population). The dose ratio between toxic and therapeutic effects
is the
therapeutic index and it can be expressed as the ratio between LDso and EDso.
30 Compounds which exhibit high therapeutic indices are preferred. The data
obtained from
these cell culture assays and animal studies can be used in formulating a
range of dosage
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
86
for use in human. The dosage of such compounds lies preferably within a range
of
circulating concentrations that include the EDSo with little or no toxicity.
The dosage
may vary within this range depending upon the dosage form employed and the
route of
administration utilized. The exact formulation, route of administration and
dosage can be
chosen by the individual physician in view of the patient's condition. See,
e.g., Fingl et
al., 1975, in "The Pharmacological Basis of Therapeutics", Ch. 1 p.1 . Dosage
amount
and interval may be adjusted individually to provide plasma levels of the
active moiety
which are sufficient to maintain the desired effects, or minimal effective
concentration
(MEC). The MEC will vary for each compound but can be estimated from in vitro
data.
Dosages necessary to achieve the MEC will depend on individual characteristics
and
route of administration. However, HPLC assays or bioassays can be used to
determine
plasma concentrations.
Dosage intervals can also be determined using MEC value. Compounds should
be administered using a regimen which maintains plasma levels above the MEC
for
10-90% of the time, preferably between 30-90% and most preferably between 50-
90%.
In cases of local administration or selective uptake, the effective local
concentration of
the drug may not be related to plasma concentration.
An exemplary dosage regimen for polypeptides or other compositions of the
invention will be in the range of about 0.01 ~g/kg to 100 mg/kg of body weight
daily,
with the preferred dose being about 0.1 ~g/kg to 25 mg/kg of patient body
weight daily,
varying in adults and children. Dosing may be once daily, or equivalent doses
may be
delivered at longer or shorter intervals.
The amount of composition administered will, of course, be dependent on the
subject being treated, on the subject's age and weight, the severity of the
affliction, the
manner of administration and the judgment of the prescribing physician.
4.12.4 PACKAGING
The compositions may, if desired, be presented in a pack or dispenser device
which may contain one or more unit dosage forms containing the active
ingredient. The
pack may, for example, comprise metal or plastic foil, such as a blister pack.
The pack or
dispenser device may be accompanied by instructions for administration.
Compositions
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
87
comprising a compound of the invention formulated in a compatible
pharmaceutical
carrier may also be prepared, placed in an appropriate container, and labeled
for
treatment of an indicated condition.
S 4.13 ANTIBODIES
Also included in the invention are antibodies to proteins, or fragments of
proteins
of the invention. The term "antibody" as used herein refers to immunoglobulin
molecules
and immunologically active portions of immunoglobulin (Ig) molecules, i.e.,
molecules
that contain an antigen-binding site that specifically binds (immunoreacts
with) an
antigen. Such antibodies include, but are not limited to, polyclonal,
monoclonal,
chimeric, single chain, Fab, Fab' and F~ab~>z fragments, and an Fab expression
library. In
general, an antibody molecule obtained from humans relates to any of the
classes IgG,
IgM, IgA, IgE and IgD, which differ from one another by the nature of the
heavy chain
present in the molecule. Certain classes have subclasses as well, such as
IgG,, IgG2, and
others. Furthermore, in humans, the light chain may be a kappa chain or a
lambda chain.
Reference herein to antibodies includes a reference to all such classes,
subclasses and
types of human antibody species.
An isolated related protein of the invention may be intended to serve as an
antigen, or a portion or fragment thereof, and additionally can be used as an
immunogen
to generate antibodies that immunospecifically bind the antigen, using
standard
techniques for polyclonal and monoclonal antibody preparation. The full-length
protein
can be used or, alternatively, the invention provides antigenic peptide
fragments of the
antigen for use as immunogens. An antigenic peptide fragment comprises at
least 6
amino acid residues of the amino acid sequence of the full length protein,
such as an
amino acid sequence shown in SEQ ID NO: 7 - 12, and encompasses an epitope
thereof
such that an antibody raised against the peptide forms a specific immune
complex with
the full length protein or with any fragment that contains the epitope.
Preferably, the
antigenic peptide comprises at least 10 amino acid residues, or at least 15
amino acid
residues, or at least 20 amino acid residues, or at least 30 amino acid
residues. Preferred
epitopes encompassed by the antigenic peptide are regions of the protein that
are located
on its surface; commonly these are hydrophilic regions.
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
88
In certain embodiments of the invention, at least one epitope encompassed by
the
antigenic peptide is a surface region of the protein, e.g., a hydrophilic
region. A
hydrophobicity analysis of the human related protein sequence will indicate
which
regions of a related protein are particularly hydrophilic and, therefore, are
likely to
encode surface residues useful for targeting antibody production. As a means
for
targeting antibody production, hydropathy plots showing regions of
hydrophilicity and
hydrophobicity may be generated by any method well known in the art,
including, for
example, the Kyte Doolittle or the Hopp Woods methods, either with or without
Fourier
transformation. See, e.g., Hopp and Woods, 1981, Proc. Nat. Acad. Sci. USA 78:
3824-
3828; Kyte and Doolittle 1982, J. Mol. Biol. 157: 105-142, each of which is
incorporated
herein by reference in its entirety. Antibodies that are specific for one or
more domains
within an antigenic protein, or derivatives, fragments, analogs or homologs
thereof, are
also provided herein.
A protein of the invention, or a derivative, fragment, analog, homolog or
ortholog
thereof, may be utilized as an immunogen in the generation of antibodies that
immunospecifically bind these protein components.
The term "specific for" indicates that the variable regions of the antibodies
of the
invention recognize and bind polypeptides of the invention exclusively (i.e.,
able to
distinguish the polypeptide of the invention from other similar polypeptides
despite
sequence identity, homology, or similarity found in the family of
polypeptides), but may
also interact with other proteins (for example, S aureus protein A or other
antibodies in
ELISA techniques) through interactions with sequences outside the variable
region of the
antibodies, and in particular, in the constant region of the molecule.
Screening assays to
determine binding specificity of an antibody of the invention are well known
and
routinely practiced in the art. For a comprehensive discussion of such assays,
see Harlow
et al. (Eds), Antibodies A Laboratory Manual; Cold Spring Harbor Laboratory;
Cold
Spring Harbor, NY (1988), Chapter 6. Antibodies that recognize and bind
fragments of
the polypeptides of the invention are also contemplated, provided that the
antibodies are
first and foremost specific for, as defined above, full-length polypeptides of
the
invention. As with antibodies that are specific for full length polypeptides
of the
invention, antibodies of the invention that recognize fragments are those
which can
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
89
distinguish polypeptides from the same family of polypeptides despite inherent
sequence
identity, homology, or similarity found in the family of proteins.
Antibodies of the invention are useful for, for example, therapeutic purposes
(by
modulating activity of a polypeptide of the invention), diagnostic purposes to
detect or
quantitate a polypeptide of the invention, as well as purification of a
polypeptide of the
invention. Kits comprising an antibody of the invention for any of the
purposes
described herein are also comprehended. In general, a kit of the invention
also includes a
control antigen for which the antibody is immunospecific. The invention
further provides
a hybridoma that produces an antibody according to the invention. Antibodies
of the
invention are useful for detection and/or purification of the polypeptides of
the invention.
Monoclonal antibodies binding to the protein of the invention may be useful
diagnostic agents for the immunodetection of the protein. Neutralizing
monoclonal
antibodies binding to the protein may also be useful therapeutics for both
conditions
associated with the protein and also in the treatment of some forms of cancer
where
abnormal expression of the protein is involved. In the case of cancerous cells
or
leukemic cells, neutralizing monoclonal antibodies against the protein may be
useful in
detecting and preventing the metastatic spread of the cancerous cells, which
may be
mediated by the protein.
The labeled antibodies of the present invention can be used for in vitro, in
vivo,
and in situ assays to identify cells or tissues in which a fragment of the
polypeptide of
interest is expressed. The antibodies may also be used directly in therapies
or other
diagnostics. The present invention further provides the above-described
antibodies
immobilized on a solid support. Examples of such solid supports include
plastics such as
polycarbonate, complex carbohydrates such as agarose and Sepharose~, acrylic
resins
and such as polyacrylamide and latex beads. Techniques for coupling antibodies
to such
solid supports are well known in the art (Weir, D.M. et al., "Handbook of
Experimental
Immunology" 4th Ed., Blackwell Scientific Publications, Oxford, England,
Chapter 10
(1986); Jacoby, W.D. et al., Meth. Enzym. 34 Academic Press, N.Y. (1974)). The
immobilized antibodies of the present invention can be used for in vitro, in
vivo, and in
situ assays as well as for immuno-affinity purification of the proteins of the
present
invention.
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
Various procedures known within the art may be used for the production of
polyclonal or monoclonal antibodies directed against a protein of the
invention, or against
derivatives, fragments, analogs homologs or orthologs thereof (see, for
example,
Antibodies: A Laboratory Manual, Harlow E, and Lane D, 1988, Cold Spring
Harbor
Laboratory Press, Cold Spring Harbor, NY, incorporated herein by reference).
Some of
these antibodies are discussed below.
4.13.1 POLYCLONAL ANTIBODIES
For the production of polyclonal antibodies, various suitable host animals
(e.g.,
10 rabbit, goat, mouse or other mammal) may be immunized by one or more
injections with
the native protein, a synthetic variant thereof, or a derivative of the
foregoing. An
appropriate immunogenic preparation can contain, for example, the naturally
occurring
immunogenic protein, a chemically synthesized polypeptide representing the
immunogenic protein, or a recombinantly expressed immunogenic protein.
Furthermore,
15 the protein may be conjugated to a second protein known to be immunogenic
in the
mammal being immunized. Examples of such immunogenic proteins include but are
not
limited to keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin, and
soybean trypsin inhibitor. The preparation can further include an adjuvant.
Various
adjuvants used to increase the immunological response include, but are not
limited to,
20 Freund's (complete and incomplete), mineral gels (e.g., aluminum
hydroxide), surface-
active substances (e.g., lysolecithin, pluronic polyols, polyanions, peptides,
oil emulsions,
dinitrophenol, etc.), adjuvants usable in humans such as Bacille Calmette-
Guerin and
Corynebacterium parvum, or similar immunostimulatory agents. Additional
examples of
adjuvants that can be employed include MPL-TDM adjuvant (monophosphoryl Lipid
A,
25 synthetic trehalose dicorynomycolate).
The polyclonal antibody molecules directed against the immunogenic protein can
be isolated from the mammal (e.g., from the blood) and further purified by
well known
techniques, such as affinity chromatography using protein A or protein G,
which provide
primarily the IgG fraction of immune serum. Subsequently, or alternatively,
the specific
30 antigen which is the target of the immunoglobulin sought, or an epitope
thereof, may be
immobilized on a column to purify the immune specific antibody by
immunoaffinity
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
91
chromatography. Purification of immunoglobulins is discussed, for example, by
D.
Wilkinson (The Scientist, published by The Scientist, Inc., Philadelphia PA,
Vol. 14, No.
8 (April 17, 2000), pp. 25-28).
4.13.2 MONOCLONAL ANTIBODIES
The term "monoclonal antibody" (MAb) or "monoclonal antibody composition",
as used herein, refers to a population of antibody molecules that contain only
one
molecular species of antibody molecule consisting of a unique light chain gene
product
and a unique heavy chain gene product. In particular, the complementarity
determining
regions (CDRs) of the monoclonal antibody are identical in all the molecules
of the
population. MAbs thus contain an antigen-binding site capable of
immunoreacting with a
particular epitope of the antigen characterized by a unique binding affinity
for it.
Monoclonal antibodies can be prepared using hybridoma methods, such as those
described by Kohler and Milstein, Nature, 256:495 ( 1975). In a hybridoma
method, a
mouse, hamster, or other appropriate host animal, is typically immunized with
an
immunizing agent to elicit lymphocytes that produce or are capable of
producing
antibodies that will specifically bind to the immunizing agent. Alternatively,
the
lymphocytes can be immunized in vitro.
The immunizing agent will typically include the protein antigen, a fragment
thereof or a fusion protein thereof. Generally, either peripheral blood
lymphocytes are
used if cells of human origin are desired, or spleen cells or lymph node cells
are used if
non-human mammalian sources are desired. The lymphocytes are then fused with
an
immortalized cell line using a suitable fusing agent, such as polyethylene
glycol, to form
a hybridoma cell (Goding, Monoclonal Antibodies: Principles and Practice,
Academic
Press, (1986) pp. 59-103). Immortalized cell lines are usually transformed
mammalian
cells, particularly myeloma cells of rodent, bovine and human origin. Usually,
rat or
mouse myeloma cell lines are employed. The hybridoma cells can be cultured in
a
suitable culture medium that preferably contains one or more substances that
inhibit the
growth or survival of the unfused, immortalized cells. For example, if the
parental cells
lack the enzyme hypoxanthine guanine phosphoribosyl transferase (HGPRT or
HPRT),
the culture medium for the hybridomas typically will include hypoxanthine,
aminopterin,
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
92
and thymidine ("HAT medium"), which substances prevent the growth of HGPRT-
deficient cells.
Preferred immortalized cell lines are those that fuse efficiently, support
stable
high level expression of antibody by the selected antibody-producing cells,
and are
S sensitive to a medium such as HAT medium. More preferred immortalized cell
lines are
murine myeloma lines, which can be obtained, for instance, from the Salk
Institute Cell
Distribution Center, San Diego, California and the American Type Culture
Collection,
Manassas, Virginia. Human myeloma and mouse-human heteromyeloma cell lines
also
have been described for the production of human monoclonal antibodies (Kozbor,
J.
Immunol., 133:3001 (1984); Brodeur et al., Monoclonal Antibody Production
Techni9ues
and Applications, Marcel Dekker, Inc., New York, (1987) pp. 51-63).
The culture medium in which the hybridoma cells are cultured can then be
assayed for the presence of monoclonal antibodies directed against the
antigen.
Preferably, the binding specificity of monoclonal antibodies produced by the
hybridoma
cells is determined by immunoprecipitation or by an in vitro binding assay,
such as
radioimmunoassay (RIA) or enzyme-linked immunoabsorbent assay (ELISA). Such
techniques and assays are known in the art. The binding affinity of the
monoclonal
antibody can, for example, be determined by the Scatchard analysis of Munson
and
Pollard, Anal. Biochem., 107:220 (1980). Preferably, antibodies having a high
degree of
specificity and a high binding affinity for the target antigen are isolated.
f
After the desired hybridoma cells are identified, the clones can be subcloned
by
limiting dilution procedures and grown by standard methods. Suitable culture
media for
this purpose include, for example, Dulbecco's Modified Eagle's Medium and RPMI-
1640
medium. Alternatively, the hybridoma cells can be grown in vivo as ascites in
a
mammal.
The monoclonal antibodies secreted by the subclones can be isolated or
purified
from the culture medium or ascites fluid by conventional immunoglobulin
purification
procedures such as, for example, protein A-Sepharose, hydroxylapatite
chromatography,
gel electrophoresis, dialysis, or affinity chromatography.
The monoclonal antibodies can also be made by recombinant DNA methods, such
as those described in U.S. Patent No. 4,816,567. DNA encoding the monoclonal
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
93
antibodies of the invention can be readily isolated and sequenced using
conventional
procedures (e.g., by using oligonucleotide probes that are capable of binding
specifically
to genes encoding the heavy and light chains of marine antibodies). The
hybridoma cells
of the invention serve as a preferred source of such DNA. Once isolated, the
DNA can
be placed into expression vectors, which are then transfected into host cells
such as
simian COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do
not
otherwise produce immunoglobulin protein, to obtain the synthesis of
monoclonal
antibodies in the recombinant host cells. The DNA also can be modified, for
example, by
substituting the coding sequence for human heavy and light chain constant
domains in
place of the homologous marine sequences (U.S. Patent No. 4,816,567; Morrison,
Nature
368, 812-13 (1994)) or by covalently joining to the immunoglobulin coding
sequence all
or part of the coding sequence for a non-immunoglobulin polypeptide. Such a
non-
immunoglobulin polypeptide can be substituted for the constant domains of an
antibody
of the invention, or can be substituted for the variable domains of one
antigen-combining
site of an antibody of the invention to create a chimeric bivalent antibody.
4.13.3 HUMANIZED ANTIBODIES
The antibodies directed against the protein antigens of the invention can
further
comprise humanized antibodies or human antibodies. These antibodies are
suitable for
administration to humans without engendering an immune response by the human
against
the administered immunoglobulin. Humanized forms of antibodies are chimeric
immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab,
Fab',
F(ab')2 or other antigen-binding subsequences of antibodies) that are
principally
comprised of the sequence of a human immunoglobulin, and contain minimal
sequence
derived from a non-human immunoglobulin. Humanization can be performed
following
the method of Winter and co-workers (Jones et al., Nature, 321:522-525 (1986);
Riechmann et al., Nature, 332:323-327 (1988); Verhoeyen et al., Science,
239:1534-1536
(1988)), by substituting rodent CDRs or CDR sequences for the corresponding
sequences
of a human antibody. (See also U.S. Patent No. 5,225,539). In some instances,
Fv
framework residues of the human immunoglobulin are replaced by corresponding
non-
human residues. Humanized antibodies can also comprise residues that are found
neither
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
94
in the recipient antibody nor in the imported CDR or framework sequences. In
general,
the humanized antibody will comprise substantially all of at least one, and
typically two,
variable domains, in which all or substantially all of the CDR regions
correspond to those
of a non-human immunoglobulin and all or substantially all of the framework
regions are
those of a human immunoglobulin consensus sequence. The humanized antibody
optimally also will comprise at least a portion of an immunoglobulin constant
region
(Fc), typically that of a human immunoglobulin (Jones et al., 1986; Riechmann
et al.,
1988; and Presta, Curr. Op. Struct. Biol., 2:593-596 (1992)).
4.13.4 HUMAN ANTIBODIES
Fully human antibodies relate to antibody molecules in which essentially the
entire sequences of both the light chain and the heavy chain, including the
CDRs, arise
from human genes. Such antibodies are termed "human antibodies", or "fully
human
antibodies" herein. Human monoclonal antibodies can be prepared by the trioma
technique; the human B-cell hybridoma technique (see Kozbor, et al., 1983
Immunol
Today 4: 72) and the EBV hybridoma technique to produce human monoclonal
antibodies (see Cole, et al., 1985 In: MONOCLONAL ANTIBODIES AND CANCER
THERAPY,
Alan R. Liss, Inc., pp. 77-96). Human monoclonal antibodies may be utilized in
the
practice of the present invention and may be produced by using human
hybridomas (see
Cote, et al., 1983. Proc Natl Acad Sci USA 80: 2026-2030) or by transforming
human
B-cells with Epstein Barr Virus in vitro (see Cole, et al., 1985 In:
MONOCLONAL
ANTIBODIES AND CANCER THERAPY, Alan R. Liss, Inc., pp. 77-96).
In addition, human antibodies can also be produced using additional
techniques,
including phage display libraries (Hoogenboom and Winter, J. Mol. Biol.,
227:381
(1991); Marks et al., J. Mol. Biol., 222:581 (1991)). Similarly, human
antibodies can be
made by introducing human immunoglobulin loci into transgenic animals, e.g.,
mice in
which the endogenous immunoglobulin genes have been partially or completely
inactivated. Upon challenge, human antibody production is observed, which
closely
resembles that seen in humans in all respects, including gene rearrangement,
assembly,
and antibody repertoire. This approach is described, for example, in U.S.
Patent Nos.
5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,661,016, and in Marks
et al.
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
(Bio/Technolo~y 10, 779-783 (1992)); Lonberg et al. (Nature 368 856-859
(1994));
Morrison (Nature 368, 812-13 (1994)); Fishwild et al, (Nature Biotechnolo~y
14, 845-51
(1996)); Neuberger (Nature Biotechnolo~y 14, 826 (1996)); and Lonberg and
Huszar
(Intern. Rev. Immunol. 13 65-93 (1995)).
Human antibodies may additionally be produced using transgenic nonhuman
animals that are modified so as to produce fully human antibodies rather than
the
animal's endogenous antibodies in response to challenge by an antigen. (See
PCT
publication W094/02602). The endogenous genes encoding the heavy and light
immunoglobulin chains in the nonhuman host have been incapacitated, and active
loci
10 encoding human heavy and light chain immunoglobulins are inserted into the
host's
genome. The human genes are incorporated, for example, using yeast artificial
chromosomes containing the requisite human DNA segments. An animal which
provides
all the desired modifications is then obtained as progeny by crossbreeding
intermediate
transgenic animals containing fewer than the full complement of the
modifications. The
15 preferred embodiment of such a nonhuman animal is a mouse, and is termed
the
XenomouseTM as disclosed in PCT publications WO 96/33735 and WO 96/34096. This
animal produces B cells that secrete fully human immunoglobulins. The
antibodies can
be obtained directly from the animal after immunization with an immunogen of
interest,
as, for example, a preparation of a polyclonal antibody, or alternatively from
20 immortalized B cells derived from the animal, such as hybridomas producing
monoclonal
antibodies. Additionally, the genes encoding the immunoglobulins with human
variable
regions can be recovered and expressed to obtain the antibodies directly, or
can be further
modified to obtain analogs of antibodies such as, for example, single chain Fv
molecules.
An example of a method of producing a nonhuman host, exemplified as a mouse,
25 lacking expression of an endogenous immunoglobulin heavy chain is disclosed
in U.S.
Patent No. 5,939,598. It can be obtained by a method including deleting the J
segment
genes from at least one endogenous heavy chain locus in an embryonic stem cell
to
prevent rearrangement of the locus and to prevent formation of a transcript of
a
rearranged immunoglobulin heavy chain locus, the deletion being effected by a
targeting
30 vector containing a gene encoding a selectable marker; and producing from
the
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
96
embryonic stem cell a transgenic mouse whose somatic and germ cells contain
the gene
encoding the selectable marker.
A method for producing an antibody of interest, such as a human antibody, is
disclosed in U.S. Patent No. 5,916,771. It includes introducing an expression
vector that
contains a nucleotide sequence encoding a heavy chain into one mammalian host
cell in
culture, introducing an expression vector containing a nucleotide sequence
encoding a
light chain into another mammalian host cell, and fusing the two cells to form
a hybrid
cell. The hybrid cell expresses an antibody containing the heavy chain and the
light
chain.
In a further improvement on this procedure, a method for identifying a
clinically
relevant epitope on an immunogen, and a correlative method for selecting an
antibody
that binds immunospecifically to the relevant epitope with high affinity, are
disclosed in
PCT publication WO 99/53049.
4.13.5 FAB FRAGMENTS AND SINGLE CHAIN ANTIBODIES
According to the invention, techniques can be adapted for the production of
single-chain antibodies specific to an antigenic protein of the invention (see
e.g., U.S.
Patent No. 4,946,778). In addition, methods can be adapted for the
construction of Fan
expression libraries (see e.g., Huse, et al., 1989 Science 246: 1275-1281) to
allow rapid
and effective identification of monoclonal F~b fragments with the desired
specificity for a
protein or derivatives, fragments, analogs or homologs thereof. Antibody
fragments that
contain the idiotypes to a protein antigen may be produced by techniques known
in the
art including, but not limited to: (i) an F~a6~~2 fragment produced by pepsin
digestion of an
antibody molecule; (ii) an Fab fragment generated by reducing the disulfide
bridges of an
F~ab~)2 fragment; (iii) an Fab fragment generated by the treatment of the
antibody molecule
with papain and a reducing agent and (iv) F~ fragments.
4.13.6 BISPECIFIC ANTIBODIES
Bispecific antibodies are monoclonal, preferably human or humanized,
antibodies
that have binding specificities for at least two different antigens. In the
present case, one
of the binding specificities is for an antigenic protein of the invention. The
second
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
97
binding target is any other antigen, and advantageously is a cell-surface
protein or
receptor or receptor subunit.
Methods for making bispecific antibodies are known in the art. Traditionally,
the
recombinant production of bispecific antibodies is based on the co-expression
of two
immunoglobulin heavy-chain/light-chain pairs, where the two heavy chains have
different specificities (Milstein and Cuello, Nature, 305:537-539 (1983)).
Because of the
random assortment of immunoglobulin heavy and light chains, these hybridomas
(quadromas) produce a potential mixture of ten different antibody molecules,
of which
only one has the correct bispecific structure. The purification of the correct
molecule is
usually accomplished by affinity chromatography steps. Similar procedures are
disclosed
in WO 93/08829, published 13 May 1993, and in Traunecker et al., 1991 EMBO J.,
10:3655-3659.
Antibody variable domains with the desired binding specificities (antibody-
antigen combining sites) can be fused to immunoglobulin constant domain
sequences.
The fusion preferably is with an immunoglobulin heavy-chain constant domain,
comprising at least part of the hinge, CH2, and CH3 regions. It is preferred
to have the
first heavy-chain constant region (CH1) containing the site necessary for
light-chain
binding present in at least one of the fusions. DNAs encoding the
immunoglobulin
heavy-chain fusions and, if desired, the immunoglobulin light chain, are
inserted into
separate expression vectors, and are co-transfected into a suitable host
organism. For
further details of generating bispecific antibodies see, for example, Suresh
et al., Methods
in Enzymolo~y, 121:210 (1986).
According to another approach described in WO 96/27011, the interface between
a pair of antibody molecules can be engineered to maximize the percentage of
heterodimers that are recovered from recombinant cell culture. The preferred
interface
comprises at least a part of the CH3 region of an antibody constant domain. In
this
method, one or more small amino acid side chains from the interface of the
first antibody
molecule are replaced with larger side chains (e.g. tyrosine or tryptophan).
Compensatory "cavities" of identical or similar size to the large side chains)
are created
on the interface of the second antibody molecule by replacing large amino acid
side
chains with smaller ones (e.g. alanine or threonine). This provides a
mechanism for
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
98
increasing the yield of the heterodimer over other unwanted end-products such
as
homodimers.
Bispecific antibodies can be prepared as full length antibodies or antibody
fragments (e.g. F(ab')Z bispecific antibodies). Techniques for generating
bispecific
antibodies from antibody fragments have been described in the literature. For
example,
bispecific antibodies can be prepared using chemical linkage. Brennan et al.,
Science
229:81 (1985) describe a procedure wherein intact antibodies are
proteolytically cleaved
to generate F(ab')2 fragments. These fragments are reduced in the presence of
the dithiol
complexing agent sodium arsenite to stabilize vicinal dithiols and prevent
intermolecular
disulfide formation. The Fab' fragments generated are then converted to
thionitrobenzoate (TNB) derivatives. One of the Fab'-TNB derivatives is then
reconverted to the Fab'-thiol by reduction with mercaptoethylamine and is
mixed with an
equimolar amount of the other Fab'-TNB derivative to form the bispecific
antibody. The
bispecific antibodies produced can be used as agents for the selective
immobilization of
enzymes.
Additionally, Fab' fragments can be directly recovered from E. coli and
chemically coupled to form bispecific antibodies. Shalaby et al., J. Exp. Med.
175:217-225 (1992) describe the production of a fully humanized bispecific
antibody
F(ab')Z molecule. Each Fab' fragment was separately secreted from E. coli and
subjected
to directed chemical coupling in vitro to form the bispecific antibody. The
bispecific
antibody thus formed was able to bind to cells overexpressing the ErbB2
receptor and
normal human T cells, as well as trigger the lytic activity of human cytotoxic
lymphocytes against human breast tumor targets.
Various techniques for making and isolating bispecific antibody fragments
directly from recombinant cell culture have also been described. For example,
bispecific
antibodies have been produced using leucine zippers. Kostelny et al., J.
Immunol.
148(5):1547-1553 (1992). The leucine zipper peptides from the Fos and Jun
proteins
were linked to the Fab' portions of two different antibodies by gene fusion.
The antibody
homodimers were reduced at the hinge region to form monomers and then re-
oxidized to
form the antibody heterodimers. This method can also be utilized for the
production of
antibody homodimers. The "diabody" technology described by Hollinger et al.,
Proc.
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
99
Natl. Acad. Sci. USA 90:6444-6448 ( 1993) has provided an alternative
mechanism for
making bispecific antibody fragments. The fragments comprise a heavy-chain
variable
domain (VH) connected to a light-chain variable domain (VL) by a linker which
is too
short to allow pairing between the two domains on the same chain. Accordingly,
the V,-,
and V~ domains of one fragment are forced to pair with the complementary V~
and Vi-,
domains of another fragment, thereby forming two antigen-binding sites.
Another
strategy for making bispecific antibody fragments by the use of single-chain
Fv (sFv)
dimers has also been reported. See, Gruber et al., J. Immunol. 152:5368
(1994).
Antibodies with more than two valencies are contemplated. For example,
trispecific antibodies can be prepared. Tutt et al., J. Immunol. 147:60
(1991).
Exemplary bispecific antibodies can bind to two different epitopes, at least
one of
which originates in the protein antigen of the invention. Alternatively, an
anti-antigenic
arm of an immunoglobulin molecule can be combined with an arm which binds to a
triggering molecule on a leukocyte such as a T-cell receptor molecule (e.g.
CD2, CD3,
CD28, or B7), or Fc receptors for IgG (Fc~yR), such as Fc~yRI (CD64), Fc~yRII
(CD32) and
Fc~yRIII (CD16) so as to focus cellular defense mechanisms to the cell
expressing the
particular antigen. Bispecific antibodies can also be used to direct cytotoxic
agents to
cells which express a particular antigen. These antibodies possess an antigen-
binding
arm and an arm which binds a cytotoxic agent or a radionuclide chelator, such
as
EOTUBE, DPTA, DOTA, or TETA. Another bispecific antibody of interest binds the
protein antigen described herein and further binds tissue factor (TF).
4.13.7 HETEROCONJUGATE ANTIBODIES
Heteroconjugate antibodies are also within the scope of the present invention.
Heteroconjugate antibodies are composed of two covalently joined antibodies.
Such
antibodies have, for example, been proposed to target immune system cells to
unwanted
cells (U.S. Patent No. 4,676,980), and for treatment of HIV infection (WO
91/00360;
WO 92/200373; EP 03089). It is contemplated that the antibodies can be
prepared in
vitro using known methods in synthetic protein chemistry, including those
involving
crosslinking agents. For example, immunotoxins can be constructed using a
disulfide
exchange reaction or by forming a thioether bond. Examples of suitable
reagents for this
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
100
purpose include iminothiolate and methyl-4-mercaptobutyrimidate and those
disclosed,
for example, in U.S. Patent No. 4,676,980.
4.13.8 EFFECTOR FUNCTION ENGINEERING
It can be desirable to modify the antibody of the invention with respect to
effector
function, so as to enhance, e.g., the effectiveness of the antibody in
treating cancer. For
example, cysteine residues) can be introduced into the Fc region, thereby
allowing
interchain disulfide bond formation in this region. The homodimeric antibody
thus
generated can have improved internalization capability and/or increased
complement-
mediated cell killing and antibody-dependent cellular cytotoxicity (ADCC). See
Caron
et al., J. Exp Med., 176: 1191-1195 (1992) and Shopes, J. Immunol., 148: 2918-
2922
(1992). Homodimeric antibodies with enhanced anti-tumor activity can also be
prepared
using heterobifunctional cross-linkers as described in Wolff et al. Cancer
Research, 53:
2560-2565 (1993). Alternatively, an antibody can be engineered that has dual
Fc
regions and can thereby have enhanced complement lysis and ADCC capabilities.
See
Stevenson et al., Anti-Cancer Drug Design, 3: 219-230 (1989).
4.13.9 IMMUNOCONJUGATES
The invention also pertains to immunoconjugates comprising an antibody
conjugated to a cytotoxic agent such as a chemotherapeutic agent, toxin (e.g.,
an
enzymatically active toxin of bacterial, fungal, plant, or animal origin, or
fragments
thereof), or a radioactive isotope (i.e., a radioconjugate).
Chemotherapeutic agents useful in the generation of such immunoconjugates have
been described above. Enzymatically active toxins and fragments thereof that
can be
used include diphtheria A chain, nonbinding active fragments of diphtheria
toxin,
exotoxin A chain (from Pseudomonas aeruginosa), ricin A chain, abrin A chain,
modeccin A chain, alpha-sarcin, Aleurites fordii proteins, dianthin proteins,
Phytolaca
americana proteins (PAPI, PAPA, and PAP-S), momordica charantia inhibitor,
curcin,
crotin, sapaonaria officinalis inhibitor, gelonin, mitogellin, restrictocin,
phenomycin,
enomycin, and the tricothecenes. A variety of radionuclides are available for
the
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
101
production of radioconjugated antibodies. Examples include 2~2Bi, ~3~I, ~3~In,
9oY, and
i s6Re.
Conjugates of the antibody and cytotoxic agent are made using a variety of
bifunctional protein-coupling agents such as N-succinimidyl-3-(2-
pyridyldithiol)
propionate (SPDP), iminothiolane (IT), bifunctional derivatives of imidoesters
(such as
dimethyl adipimidate HCL), active esters (such as disuccinimidyl suberate),
aldehydes
(such as glutareldehyde), bis-azido compounds (such as bis (p-azidobenzoyl)
hexanediamine), bis-diazonium derivatives (such as bis-(p-diazoniumbenzoyl)-
ethylenediamine), diisocyanates (such as tolyene 2,6-diisocyanate), and bis-
active
fluorine compounds (such as 1,5-difluoro-2,4-dinitrobenzene). For example, a
ricin
immunotoxin can be prepared as described in Vitetta et al., Science, 238: 1098
(1987).
Carbon-14-labeled 1-isothiocyanatobenzyl-3-methyldiethylene
triaminepentaacetic acid
(MX-DTPA) is an exemplary chelating agent for conjugation of radionucleotide
to the
antibody. See W094/11026.
In another embodiment, the antibody can be conjugated to a "receptor" (such
streptavidin) for utilization in tumor pretargeting wherein the antibody-
receptor conjugate
is administered to the patient, followed by removal of unbound conjugate from
the
circulation using a clearing agent and then administration of a "ligand"
(e.g., avidin) that
is in turn conjugated to a cytotoxic agent.
4.14 COMPUTER READABLE SEQUENCES
In one application of this embodiment, a nucleotide sequence of the present
invention can be recorded on computer readable media. As used herein,
"computer
readable media" refers to any medium which can be read and accessed directly
by a
computer. Such media include, but are not limited to: magnetic storage media,
such as
floppy discs, hard disc storage medium, and magnetic tape; optical storage
media such as
CD-ROM; electrical storage media such as RAM and ROM; and hybrids of these
categories such as magnetic/optical storage media. A skilled artisan can
readily
appreciate how any of the presently known computer readable mediums can be
used to
create a manufacture comprising computer readable medium having recorded
thereon a
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
102
nucleotide sequence of the present invention. As used herein, "recorded"
refers to a
process for storing information on computer readable medium. A skilled artisan
can
readily adopt any of the presently known methods for recording information on
computer
readable medium to generate manufactures comprising the nucleotide sequence
information of the present invention.
A variety of data storage structures are available to a skilled artisan for
creating a
computer readable medium having recorded thereon a nucleotide sequence of the
present
invention. The choice of the data storage structure will generally be based on
the means
chosen to access the stored information. In addition, a variety of data
processor programs
and formats can be used to store the nucleotide sequence information of the
present
invention on computer readable medium. The sequence information can be
represented
in a word processing text file, formatted in commercially-available software
such as
WordPerfect and Microsoft Word, or represented in the form of an ASCII file,
stored in a
database application, such as DB2, Sybase, Oracle, or the like. A skilled
artisan can
readily adapt any number of data processor structuring formats (e.g. text file
or database)
in order to obtain computer readable medium having recorded thereon the
nucleotide
sequence information of the present invention.
By providing any of the nucleotide sequences SEQ ID NOs: 1 - 6 or a
representative fragment thereof; or a nucleotide sequence at least 95%
identical to any of
the nucleotide sequences of SEQ ID NOs: 1 - 6 in computer readable form, a
skilled
artisan can routinely access the sequence information for a variety of
purposes.
Computer software is publicly available which allows a skilled artisan to
access sequence
information provided in a computer readable medium. The examples which follow
demonstrate how software which implements the BLAST (Altschul et al., J. Mol.
Biol.
215:403-410 (1990)) and BLAZE (Brutlag et al., Comp. Chem. 17:203-207 (1993))
search algorithms on a Sybase system is used to identify open reading frames
(ORFs)
within a nucleic acid sequence. Such ORFs may be protein encoding fragments
and may
be useful in producing commercially important proteins such as enzymes used in
fermentation reactions and in the production of commercially useful
metabolites.
As used herein, "a computer-based system" refers to the hardware means,
software means, and data storage means used to analyze the nucleotide sequence
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
103
information of the present invention. The minimum hardware means of the
computer-based systems of the present invention comprises a central processing
unit
(CPU), input means, output means, and data storage means. A skilled artisan
can readily
appreciate that any one of the currently available computer-based systems are
suitable for
S use in the present invention. As stated above, the computer-based systems of
the present
invention comprise a data storage means having stored therein a nucleotide
sequence of
the present invention and the necessary hardware means and software means for
supporting and implementing a search means. As used herein, "data storage
means"
refers to memory which can store nucleotide sequence information of the
present
invention, or a memory access means which can access manufactures having
recorded
thereon the nucleotide sequence information of the present invention.
As used herein, "search means" refers to one or more programs which are
implemented on the computer-based system to compare a target sequence or
target
structural motif with the sequence information stored within the data storage
means.
Search means are used to identify fragments or regions of a known sequence
which
match a particular target sequence or target motif. A variety of known
algorithms are
disclosed publicly and a variety of commercially available software for
conducting search
means are and can be used in the computer-based systems of the present
invention.
Examples of such software includes, but is not limited to, Smith-Waterman,
MacPattern
(EMBL), BLASTN and BLASTA (NPOLYPEPTIDEIA). A skilled artisan can readily
recognize that any one of the available algorithms or implementing software
packages for
conducting homology searches can be adapted for use in the present computer-
based
systems. As used herein, a "target sequence" can be any nucleic acid or amino
acid
sequence of six or more nucleotides or two or more amino acids. A skilled
artisan can
readily recognize that the longer a target sequence is, the less likely a
target sequence will
be present as a random occurrence in the database. The most preferred sequence
length
of a target sequence is from about 10 to 300 amino acids, more preferably from
about 30
to 100 nucleotide residues. However, it is well recognized that searches for
commercially important fragments, such as sequence fragments involved in gene
expression and protein processing, may be of shorter length.
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
104
As used herein, "a target structural motif," or "target motif," refers to any
rationally selected sequence or combination of sequences in which the
sequences) are
chosen based on a three-dimensional configuration which is formed upon the
folding of
the target motif. There are a variety of target motifs known in the art.
Protein target
motifs include, but are not limited to, enzyme active sites and signal
sequences. Nucleic
acid target motifs include, but are not limited to, promoter sequences,
hairpin structures
and inducible expression elements (protein binding sequences).
4.15 TRIPLE HELIX FORMATION
In addition, the fragments of the present invention, as broadly described, can
be
used to control gene expression through triple helix formation or antisense
DNA or RNA,
both of which methods are based on the binding of a polynucleotide sequence to
DNA or
RNA. Polynucleotides suitable for use in these methods are preferably 20 to 40
bases in
length and are designed to be complementary to a region of the gene involved
in
transcription (triple helix - see Lee et al., Nucl. Acids Res. 6:3073 (1979);
Cooney et al.,
Science 15241:456 (1988); and Dervan et al., Science 251:1360 (1991)) or to
the mRNA
itself (antisense - Olmno, J. Neurochem. 56:560 (1991); Oligodeoxynucleotides
as
Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988)).
Triple
helix-formation optimally results in a shut-off of RNA transcription from DNA,
while
antisense RNA hybridization blocks translation of an mRNA molecule into
polypeptide.
Both techniques have been demonstrated to be effective in model systems.
Information
contained in the sequences of the present invention is necessary for the
design of an
antisense or triple helix oligonucleotide.
4.16 DIAGNOSTIC ASSAYS AND KITS
The present invention further provides methods to identify the presence or
expression of one of the ORFs of the present invention, or homolog thereof, in
a test
sample, using a nucleic acid probe or antibodies of the present invention,
optionally
conjugated or otherwise associated with a suitable label.
In general, methods for detecting a polynucleotide of the invention can
comprise
contacting a sample with a compound that binds to and forms a complex with the
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
105
polynucleotide for a period sufficient to form the complex, and detecting the
complex, so
that if a complex is detected, a polynucleotide of the invention is detected
in the sample.
Such methods can also comprise contacting a sample under stringent
hybridization
conditions with nucleic acid primers that anneal to a polynucleotide of the
invention
under such conditions, and amplifying annealed polynucleotides, so that if a
polynucleotide is amplified, a polynucleotide of the invention is detected in
the sample.
In general, methods for detecting a polypeptide of the invention can comprise
contacting a sample with a compound that binds to and forms a complex with the
polypeptide for a period sufficient to form the complex, and detecting the
complex, so
that if a complex is detected, a polypeptide of the invention is detected in
the sample.
In detail, such methods comprise incubating a test sample with one or more of
the
antibodies or one or more of the nucleic acid probes of the present invention
and assaying
for binding of the nucleic acid probes or antibodies to components within the
test sample.
Conditions for incubating a nucleic acid probe or antibody with a test sample
vary. Incubation conditions depend on the format employed in the assay, the
detection
methods employed, and the type and nature of the nucleic acid probe or
antibody used in
the assay. One skilled in the art will recognize that any one of the commonly
available
hybridization, amplification or immunological assay formats can readily be
adapted to
employ the nucleic acid probes or antibodies of the present invention.
Examples of such
assays can be found in Chard, T., An Introduction to Radioimmunoassay and
Related
Techniques, Elsevier Science Publishers, Amsterdam, The Netherlands (1986);
Bullock,
G.R. et al., Techniques in Immunocytochemistry, Academic Press, Orlando, FL
Vol. I
(1982), Vol. 2 (1983), Vol. 3 (1985); Tijssen, P., Practice and Theory of
immunoassays:
Laboratory Techniques in Biochemistry and Molecular Biology, Elsevier Science
Publishers, Amsterdam, The Netherlands (1985). The test samples of the present
invention include cells, protein or membrane extracts of cells, or biological
fluids such as
sputum, blood, serum, plasma, or urine. The test sample used in the above-
described
method will vary based on the assay format, nature of the detection method and
the
tissues, cells or extracts used as the sample to be assayed. Methods for
preparing protein
extracts or membrane extracts of cells are well known in the art and can be
readily be
adapted in order to obtain a sample which is compatible with the system
utilized.
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
106
In another embodiment of the present invention, kits are provided which
contain
the necessary reagents to carry out the assays of the present invention.
Specifically, the
invention provides a compartment kit to receive, in close confinement, one or
more
containers which comprises: (a) a first container comprising one of the probes
or
antibodies of the present invention; and (b) one or more other containers
comprising one
or more of the following: wash reagents, reagents capable of detecting
presence of a
bound probe or antibody.
In detail, a compartment kit includes any kit in which reagents are contained
in
separate containers. Such containers include small glass containers, plastic
containers or
strips of plastic or paper. Such containers allows one to efficiently transfer
reagents from
one compartment to another compartment such that the samples and reagents are
not
cross-contaminated, and the agents or solutions of each container can be added
in a
quantitative fashion from one compartment to another. Such containers will
include a
container which will accept the test sample, a container which contains the
antibodies
1 S used in the assay, containers which contain wash reagents (such as
phosphate buffered
saline, Tris-buffers, etc.), and containers which contain the reagents used to
detect the
bound antibody or probe. Types of detection reagents include labeled nucleic
acid probes,
labeled secondary antibodies, or in the alternative, if the primary antibody
is labeled, the
enzymatic, or antibody binding reagents which are capable of reacting with the
labeled
antibody. One skilled in the art will readily recognize that the disclosed
probes and
antibodies of the present invention can be readily incorporated into one of
the established
kit formats which are well known in the art.
4.17 MEDICAL IMAGING
The novel polypeptides and binding partners of the invention are useful in
medical imaging of sites expressing the molecules of the invention (e.g.,
where the
polypeptide of the invention is involved in the immune response, for imaging
sites of
'inflammation or infection). See, e.g., Kunkel et al., U.S. Pat. NO.
5,413,778. Such
methods involve chemical attachment of a labeling or imaging agent,
administration of
the labeled polypeptide to a subject in a pharmaceutically acceptable carrier,
and imaging
the labeled polypeptide in vivo at the target site.
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
107
4.18 SCREENING ASSAYS
Using the isolated proteins and polynucleotides of the invention, the present
invention further provides methods of obtaining and identifying agents which
bind to a
polypeptide encoded by an ORF corresponding to any of the nucleotide sequences
set
forth in SEQ ID NOs: 1 - 6, or bind to a specific domain of the polypeptide
encoded by
the nucleic acid. In detail, said method comprises the steps of:
(a) contacting an agent with an isolated protein encoded by an ORF of the
present invention, or nucleic acid of the invention; and
(b) determining whether the agent binds to said protein or said nucleic acid.
In general, therefore, such methods for identifying compounds that bind to a
polynucleotide of the invention can comprise contacting a compound with a
polynucleotide of the invention for a time sufficient to form a
polynucleotide/compound
complex, and detecting the complex, so that if a polynucleotide/compound
complex is
detected, a compound that binds to a polynucleotide of the invention is
identified.
Likewise, in general, therefore, such methods for identifying compounds that
bind
to a polypeptide of the invention can comprise contacting a compound with a
polypeptide
of the invention for a time sufficient to form a polypeptide/compound complex,
and
detecting the complex, so that if a polypeptide/compound complex is detected,
a
compound that binds to a polynucleotide of the invention is identified.
Methods for identifying compounds that bind to a polypeptide of the invention
can also comprise contacting a compound with a polypeptide of the invention in
a cell for
a time sufficient to form a polypeptide/compound complex, wherein the complex
drives
expression of a receptor gene sequence in the cell, and detecting the complex
by
detecting reporter gene sequence expression, so that if a polypeptide/compound
complex
is detected, a compound that binds a polypeptide of the invention is
identified.
Compounds identified via such methods can include compounds which modulate
the activity of a polypeptide of the invention (that is, increase or decrease
its activity,
relative to activity observed in the absence of the compound). Alternatively,
compounds
identified via such methods can include compounds which modulate the
expression of a
polynucleotide of the invention (that is, increase or decrease expression
relative to
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
108
expression levels observed in the absence of the compound). Compounds, such as
compounds identified via the methods of the invention, can be tested using
standard
assays well known to those of skill in the art for their ability to modulate
activity/expression.
The agents screened in the above assay can be, but are not limited to,
peptides,
carbohydrates, vitamin derivatives, or other pharmaceutical agents. The agents
can be
selected and screened at random or rationally selected or designed using
protein modeling
techniques.
For random screening, agents such as peptides, carbohydrates, pharmaceutical
agents and the like are selected at random and are assayed for their ability
to bind to the
protein encoded by the ORF of the present invention. Alternatively, agents may
be
rationally selected or designed. As used herein, an agent is said to be
"rationally selected
or designed" when the agent is chosen based on the configuration of the
particular
protein. For example, one skilled in the art can readily adapt currently
available
procedures to generate peptides, pharmaceutical agents and the like, capable
of binding to
a specific peptide sequence, in order to generate rationally designed
antipeptide peptides,
for example see Hurby et al., Application of Synthetic Peptides: Antisense
Peptides," In
Synthetic Peptides, A User's Guide, W.H. Freeman, NY (1992), pp. 289-307, and
Kaspczak et al., Biochemistry 28:9230-8 (1989), or pharmaceutical agents, or
the like.
In addition to the foregoing, one class of agents of the present invention, as
broadly described, can be used to control gene expression through binding to
one of the
ORFs or EMFs of the present invention. As described above, such agents can be
randomly screened or rationally designed/selected. Targeting the ORF or EMF
allows a
skilled artisan to design sequence specific or element specific agents,
modulating the
expression of either a single ORF or multiple ORFs which rely on the same EMF
for
expression control. One class of DNA binding agents are agents which contain
base
residues which hybridize or form a triple helix formation by binding to DNA or
RNA.
Such agents can be based on the classic phosphodiester, ribonucleic acid
backbone, or
can be a variety of sulfliydryl or polymeric derivatives which have base
attachment
capacity.
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
109
Agents suitable for use in these methods preferably contain 20 to 40 bases and
are
designed to be complementary to a region of the gene involved in transcription
(triple
helix - see Lee et al., Nucl. Acids Res. 6:3073 (1979); Cooney et al., Science
241:456
(1988); and Dervan et al., Science 251:1360 (1991)) or to the mRNA itself
(antisense -
Okano, J. Neurochem. 56:560 (1991); Oligodeoxynucleotides as Antisense
Inhibitors of
Gene Expression, CRC Press, Boca Raton, FL (1988)). Triple helix-formation
optimally
results in a shut-off of RNA transcription from DNA, while antisense RNA
hybridization
blocks translation of an mRNA molecule into polypeptide. Both techniques have
been
demonstrated to be effective in model systems. Information contained in the
sequences
of the present invention is necessary for the design of an antisense or triple
helix
oligonucleotide and other DNA binding agents.
Agents which bind to a protein encoded by one of the ORFs of the present
invention can be used as a diagnostic agent. Agents which bind to a protein
encoded by
one of the ORFs of the present invention can be formulated using known
techniques to
generate a pharmaceutical composition.
4.19 USE OF NUCLEIC ACIDS AS PROBES
Another aspect of the subject invention is to provide for polypeptide-specific
nucleic acid hybridization probes capable of hybridizing with naturally
occurring
nucleotide sequences. The hybridization probes of the subject invention may be
derived
from any of the nucleotide sequences SEQ ID NOs: 1 - 6. Because the
corresponding
gene is only expressed in a limited number of tissues, a hybridization probe
derived from
any of the nucleotide sequences SEQ ID NOs: 1 - 6 can be used as an indicator
of the
presence of RNA of cell type of such a tissue in a sample.
Any suitable hybridization technique can be employed, such as, for example, in
situ hybridization. PCR as described in US Patents Nos. 4,683,195 and
4,965,188
provides additional uses for oligonucleotides based upon the nucleotide
sequences. Such
probes used in PCR may be of recombinant origin, may be chemically
synthesized, or a
mixture of both. The probe will comprise a discrete nucleotide sequence for
the detection
of identical sequences or a degenerate pool of possible sequences for
identification of
closely related genomic sequences.
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
110
Other means for producing specific hybridization probes for nucleic acids
include
the cloning of nucleic acid sequences into vectors for the production of mRNA
probes.
Such vectors are known in the art and are commercially available and may be
used to
synthesize RNA probes in vitro by means of the addition of the appropriate RNA
polymerise as T7 or SP6 RNA polymerise and the appropriate radioactively
labeled
nucleotides. The nucleotide sequences may be used to construct hybridization
probes for
mapping their respective genomic sequences. The nucleotide sequence provided
herein
may be mapped to a chromosome or specific regions of a chromosome using well
known
genetic and/or chromosomal mapping techniques. These techniques include in
situ
hybridization, linkage analysis against known chromosomal markers,
hybridization
screening with libraries or flow-sorted chromosomal preparations specific to
known
chromosomes, and the like. The technique of fluorescent in situ hybridization
of
chromosome spreads has been described, among other places, in Verma et al
(1988)
Human Chromosomes: A Manual of Basic Techniques, Pergamon Press, New York NY.
Fluorescent in situ hybridization of chromosomal preparations and other
physical
chromosome mapping techniques may be correlated with additional genetic map
data.
Examples of genetic map data can be found in the 1994 Genome Issue of Science
(265:1981 f). Correlation between the location of a nucleic acid on a physical
chromosomal map and a specific disease (or predisposition to a specific
disease) may
help delimit the region of DNA associated with that genetic disease. The
nucleotide
sequences of the subject invention may be used to detect differences in gene
sequences
between normal, carrier or affected individuals.
4.20 PREPARATION OF SUPPORT BOUND OLIGONUCLEOTIDES
Oligonucleotides, i.e., small nucleic acid segments, may be readily prepared
by, for
example, directly synthesizing the oligonucleotide by chemical means, as is
commonly
practiced using an automated oligonucleotide synthesizer.
Support bound oligonucleotides may be prepared by any of the methods known to
those of skill in the art using any suitable support such as glass,
polystyrene or Teflon. One
strategy is to precisely spot oligonucleotides synthesized by standard
synthesizers.
Immobilization can be achieved using passive adsorption (Inouye & Hondo,
(1990) J. Clin.
Microbiol. 28(6) 1469-72); using UV light (Nagata et al., 1985; Dahlen et al.,
1987;
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
111
Morrissey & Collins, (1989) Mol. Cell Probes 3(2) 189-207) or by covalent
binding of base
modified DNA (Keller et al., 1988; 1989); all references being specifically
incorporated
herein.
Another strategy that may be employed is the use of the strong biotin-
streptavidin
interaction as a linker. For example, Broude et al. (1994) Proc. Natl. Acad.
Sci. USA 91 (8)
3072-6, describe the use of biotinylated probes, although these are duplex
probes, that are
immobilized on streptavidin-coated magnetic beads. Streptavidin-coated beads
may be
purchased from Dynal, Oslo. Of course, this same linking chemistry is
applicable to coating
any surface with streptavidin. Biotinylated probes may be purchased from
various sources,
such as, e.g., Operon Technologies (Alameda, CA).
Nunc Laboratories (Naperville, IL) is also selling suitable material that
could be
used. Nunc Laboratories have developed a method by which DNA can be covalently
bound
to the microwell surface termed Covalink NH. CovaLink NH is a polystyrene
surface
grafted with secondary amino groups (>NH) that serve as bridge-heads for
further covalent
coupling. CovaLink Modules may be purchased from Nunc Laboratories. DNA
molecules
may be bound to CovaLink exclusively at the 5'-end by a phosphoramidate bond,
allowing
immobilization of more than 1 pmol of DNA (Rasmussen et al., (1991) Anal.
Biochem.
198(1) 138-42).
The use of CovaLink NH strips for covalent binding of DNA molecules at the 5'-
end
has been described (Rasmussen et al., ( 1991 ). In this technology, a
phosphoramidate bond
is employed (Chu et al., (1983) Nucleic Acids Res. 11 (8) 6513-29). This is
beneficial as
immobilization using only a single covalent bond is preferred. The
phosphoramidate bond
joins the DNA to the CovaLink NH secondary amino groups that are positioned at
the end
of spacer arms covalently grafted onto the polystyrene surface through a 2 nm
long spacer
arm. To link an oligonucleotide to CovaLink NH via an phosphoramidate bond,
the
oligonucleotide terminus must have a 5'-end phosphate group. It is, perhaps,
even possible
for biotin to be covalently bound to CovaLink and then streptavidin used to
bind the probes.
More specifically, the linkage method includes dissolving DNA in water (7.5
ng/ul)
and denaturing for 10 min. at 95°C and cooling on ice for 10 min. Ice-
cold 0.1 M
1-methylimidazole, pH 7.0 (1-Melm~), is then added to a final concentration of
10 mM
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
112
1-MeIm7. A ss DNA solution is then dispensed into CovaLink NH strips (75
ul/well)
standing on ice.
Carbodiimide 0.2 M 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC),
dissolved in 10 mM 1-MeIm~, is made fresh and 25 u1 added per well. The strips
are
incubated for 5 hours at SO°C. After incubation the strips are washed
using, e.g.,
Nunc-Immuno Wash; first the wells are washed 3 times, then they are soaked
with washing
solution for 5 min., and finally they are washed 3 times (where in the washing
solution is 0.4
N NaOH, 0.25% SDS heated to 50°C).
It is contemplated that a further suitable method for use with the present
invention is
that described in PCT Patent Application WO 90/03382 (Southern & Maskos),
incorporated
herein by reference. This method of preparing an oligonucleotide bound to a
support
involves attaching a nucleoside 3'-reagent through the phosphate group by a
covalent
phosphodiester link to aliphatic hydroxyl groups carried by the support. The
oligonucleotide is then synthesized on the supported nucleoside and protecting
groups
removed from the synthetic oligonucleotide chain under standard conditions
that do not
cleave the oligonucleotide from the support. Suitable reagents include
nucleoside
phosphoramidite and nucleoside hydrogen phosphorate.
An on-chip strategy for the preparation of DNA probe for the preparation of
DNA
probe arrays may be employed. For example, addressable laser-activated
photodeprotection
may be employed in the chemical synthesis of oligonucleotides directly on a
glass surface,
as described by Fodor et al. ( 1991 ) Science 251 (4995) 767-73, incorporated
herein by
reference. Probes may also be immobilized on nylon supports as described by
Van Ness et
al. ( 1991 ) Nucleic Acids Res. 19( 12) 3345-50; or linked to Teflon using the
method of
Duncan & Cavalier (1988) Anal. Biochem. 169(1) 104-8; all references being
specifically
incorporated herein.
To link an oligonucleotide to a nylon support, as described by Van Ness et al.
( 1991 ), requires activation of the nylon surface via alkylation and
selective activation of the
5'-amine of oligonucleotides with cyanuric chloride.
One particular way to prepare support bound oligonucleotides is to utilize the
light-generated synthesis described by Pease et al., (1994) PNAS USA 91(11)
5022-6,
incorporated herein by reference). These authors used current
photolithographic techniques
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
113
to generate arrays of immobilized oligonucleotide probes (DNA chips). These
methods, in
which light is used to direct the synthesis of oligonucleotide probes in high-
density,
miniaturized arrays, utilize photolabile S'-protected N acyl-deoxynucleoside
phosphoramidites, surface linker chemistry and versatile combinatorial
synthesis strategies.
A matrix of 256 spatially defined oligonucleotide probes may be generated in
this manner.
4.21 PREPARATION OF NUCLEIC ACID FRAGMENTS
The nucleic acids may be obtained from any appropriate source, such as cDNAs,
genomic DNA, chromosomal DNA, microdissected chromosome bands, cosmid or YAC
inserts, and RNA, including mRNA without any amplification steps. For example,
Sambrook et al. ( 1989) describes three protocols for the isolation of high
molecular weight
DNA from mammalian cells (p. 9.14-9.23).
DNA fragments may be prepared as clones in M 13, plasmid or lambda vectors
and/or prepared directly from genomic DNA or cDNA by PCR or other
amplification
methods. Samples may be prepared or dispensed in multiwell plates. About 100-
1000 ng of
DNA samples may be prepared in 2-500 ml of final volume.
The nucleic acids would then be fragmented by any of the methods known to
those
of skill in the art including, for example, using restriction enzymes as
described at 9.24-9.28
of Sambrook et al. (1989), shearing by ultrasound and NaOH treatment.
Low pressure shearing is also appropriate, as described by Schriefer et al.
(1990)
Nucleic Acids Res. 18(24) 7455-6, incorporated herein by reference). In this
method, DNA
samples are passed through a small French pressure cell at a variety of low to
intermediate
pressures. A lever device allows controlled application of low to intermediate
pressures to
the cell. The results of these studies indicate that low-pressure shearing is
a useful
alternative to sonic and enzymatic DNA fragmentation methods.
One particularly suitable way for fragmenting DNA is contemplated to be that
using
the two base recognition endonuclease, CviJI, described by Fitzgerald et al.
(1992) Nucleic
Acids Res. 20(14) 3753-62. These authors described an approach for the rapid
fragmentation and fractionation of DNA into particular sizes that they
contemplated to be
suitable for shotgun cloning and sequencing.
The restriction endonuclease CviJI normally cleaves the recognition sequence
PuGCPy between the G and C to leave blunt ends. Atypical reaction conditions,
which alter
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
114
the specificity of this enzyme (CviJI**), yield a quasi-random distribution of
DNA
fragments form the small molecule pUC 19 (2688 base pairs). Fitzgerald et al.
( 1992)
quantitatively evaluated the randomness of this fragmentation strategy, using
a CviJI**
digest of pUCl9 that was size fractionated by a rapid gel filtration method
and directly
ligated, without end repair, to a lac Z minus M13 cloning vector. Sequence
analysis of 76
clones showed that CviJI* * restricts pyGCPy and PuGCPu, in addition to PuGCPy
sites, and
that new sequence data is accumulated at a rate consistent with random
fragmentation.
As reported in the literature, advantages of this approach compared to
sonication and
agarose gel fractionation include: smaller amounts of DNA are required (0.2-
0.5 ug instead
of 2-5 ug); and fewer steps are involved (no preligation, end repair, chemical
extraction, or
agarose gel electrophoresis and elution are needed
Irrespective of the manner in which the nucleic acid fragments are obtained or
prepared, it is important to denature the DNA to give single stranded pieces
available for
hybridization. This is achieved by incubating the DNA solution for 2-5 minutes
at 80-90°C.
The solution is then cooled quickly to 2°C to prevent renaturation of
the DNA fragments
before they are contacted with the chip. Phosphate groups must also be removed
from
genomic DNA by methods known in the art.
4.22 PREPARATION OF DNA ARRAYS
Arrays may be prepared by spotting DNA samples on a support such as a nylon
membrane. Spotting may be performed by using arrays of metal pins (the
positions of which
correspond to an array of wells in a microtiter plate) to repeated by transfer
of about 20 n1 of
a DNA solution to a nylon membrane. By offset printing, a density of dots
higher than the
density of the wells is achieved. One to 25 dots may be accommodated in 1 mm2,
depending on the type of label used. By avoiding spotting in some preselected
number of
rows and columns, separate subsets (subarrays) may be formed. Samples in one
subarray
may be the same genomic segment of DNA (or the same gene) from different
individuals, or
may be different, overlapped genomic clones. Each of the subarrays may
represent replica
spotting of the same samples. In one example, a selected gene segment may be
amplified
from 64 patients. For each patient, the amplified gene segment may be in one
96-well plate
(all 96 wells containing the same sample). A plate for each of the 64 patients
is prepared. By
using a 96-pin device, all samples may be spotted on one 8 x 12 cm membrane.
Subarrays
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
115
may contain 64 samples, one from each patient. Where the 96 subarrays are
identical, the
dot span may be 1 mm2 and there may be a I mm space between subarrays.
Another approach is to use membranes or plates (available from NUNC,
Naperville,
Illinois) which may be partitioned by physical spacers e.g. a plastic grid
molded over the
membrane, the grid being similar to the sort of membrane applied to the bottom
of multiwell
plates, or hydrophobic strips. A fixed physical spacer is not preferred for
imaging by
exposure to flat phosphor-storage screens or x-ray F lms.
The present invention is illustrated in the following examples. Upon
consideration
of the present disclosure, one of skill in the art will appreciate that many
other embodiments
I 0 and variations may be made in the scope of the present invention.
Accordingly, it is
intended that the broader aspects of the present invention not be limited to
the disclosure of
the following examples. The present invention is not to be limited in scope by
the
exemplified embodiments which are intended as illustrations of single aspects
of the
invention, and compositions and methods which are functionally equivalent are
within the
scope of the invention. Indeed, numerous modifications and variations in the
practice of the
invention are expected to occur to those skilled in the art upon consideration
of the present
preferred embodiments. Consequently, the only limitations which should be
placed upon
the scope of the invention are those which appear in the appended claims.
All references cited within the body of the instant specification are hereby
incorporated by reference in their entirety.
5. EXAMPLES
5.1 EXAMPLE 1
Novel Nucleic Acid Seguences Obtained From Various Libraries
A plurality of novel nucleic acids were obtained from cDNA libraries prepared
from
various human tissues and in some cases isolated from a genomic library
derived from
human chromosome using standard PCR, SBH sequence signature analysis and
Sanger
sequencing techniques. The inserts of the library were amplified with PCR
using primers
specific for the vector sequences which flank the inserts. Clones from eDNA
libraries were
spotted on nylon membrane filters and screened with oligonucleotide probes
(e.g., 7-mers)
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
116
to obtain signature sequences. The clones were clustered into groups of
similar or identical
sequences. Representative clones were selected for sequencing..
In some cases, the 5' sequence of the amplified inserts was then deduced using
a
typical Sanger sequencing protocol. PCR products were purified and subjected
to
fluorescent dye terminator cycle sequencing. Single pass gel sequencing was
done using a
377 Applied Biosystems (ABI) sequencer to obtain the novel nucleic acid
sequences. In
some cases RACE (Random Amplification of cDNA Ends) was performed to further
extend
the sequence in the 5' direction.
5.2 EXAMPLE 2
Novel Nucleic Acids
The novel nucleic acids of the present invention of the invention were
assembled
from sequences that were obtained from a cDNA library by methods described in
Example
1 above, and in some cases sequences obtained from one or more public
databases. The
nucleic acids were assembled using an EST sequence as a seed. Then a recursive
algorithm
was used to extend the seed EST into an extended assemblage, by pulling
additional
sequences from different databases (i.e., Hyseq's database containing EST
sequences,
dbEST version 114, gb pri 114 and UniGene version 101) that belong to this
assemblage.
The algorithm terminated when there was no additional sequences from the above
databases
that would extend the assemblage. Inclusion of component sequences into the
assemblage
was based on a BLASTN hit to the extending assemblage with BLAST score greater
than
300 and percent identity greater than 95%.
Using PHRAP (LJniv. of Washington) or CAP4 (Paracel), a full length gene cDNA
sequence and its corresponding protein sequence were generated from the
assemblage. Any
frame shifts and incorrect stop codons were corrected by hand editing. During
editing, the
sequence was checked using FASTY and/or BLAST against Genbank (i.e., dbEST
version
121, gb pri 121, UniGene version 121, Genpept release 121) and the amino acid
version of
Genseq released February 15, 2001. Other computer programs which may have been
used
in the editing process were phredPhrap and Consed (University of Washington)
and ed-
ready, ed-ext and cg-zip-2 (Hyseq, Inc.). The full-length nucleotide and amino
acid
sequences, including splice variants resulting from these procedures are shown
in the
Sequence Listing as SEQ ID NOS: 1 - 6.
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
117
Table 1 shows the various tissue sources of SEQ ID NO: 1 - 6.
The nearest neighbor results for polypeptides encoded by SEQ ID NO: 1 - 6
(i.e.
SEQ ID NO: 7 - 12) were obtained by a BLASTP (version 2.0a1 19MP-WashU) search
against Genpept, Geneseq and SwissProt databases using BLAST algorithm. The
nearest
neighbor result showed the closest homologue with functional annotation for
SEQ ID
NO: 7 - 12. The translated amino acid sequences for which the nucleic acid
sequence
encodes are shown in the Sequence Listing. The homologues with identifiable
functions
for SEQ ID NO: 7 - 12 are shown in Table 2 below. Using eMatrix software
package
(Stanford University, Stanford, CA) (Wu et al., J. Comp. Biol., Vol. 6 pp. 219-
235 (1999)
herein incorporated by reference), polypeptides encoded by SEQ ID NO: 1 - 6
(i.e. SEQ
ID NO: 7 - 12) were examined to determine whether they had identifiable
signature
regions. Table 3 shows the signature region found in the indicated polypeptide
sequences, the description of the signature, the eMatrix p-values) and the
positions) of
the signature within the polypeptide sequence.
Using the Pfam software program (Sonnhammer et al., Nucleic Acids Res., Vol.
26( 1 ) pp. 320-322 ( 1998) herein incorporated by reference) polypeptides
encoded by
SEQ ID NO: 1 - 6 (i.e. SEQ ID NO: 7 - 12) were examined for domains with
homology
to certain peptide domains. Table 4 shows the name of the domain found, the
description, the product of all the e-value of similar domains found, the pFam
score for
the identified domain within the sequence, number of similar domains found,
and the
position of the domain in the SEQ ID NO: being interrogated.
The GeneAtlasT"" software package (Molecular Simulations Inc. (MSI), San
Diego, CA) was used to predict the three-dimensional structure models for the
polypeptides encoded by SEQ ID NO: 1 - 6 (i.e. SEQ ID NO: 7 - 12). Models were
generated by (1) PSI-BLAST which is a multiple alignment sequence profile-
based
searching developed by Altschul et al, (Nucl. Acids. Res. 25, 3389-3408
(1997)), (2)
High Throughput Modeling (HTM) (Molecular Simulations Inc. (MSI) San Diego,
CA,)
which is an automated sequence and structure searching procedure
(http://www.msi.com/), and (3) SeqFoldT"' which is a fold recognition method
described
by Fischer and Eis~enberg (J. Mol. Biol. 209, 779-791 (1998)). This analysis
was carried
out, in part, by comparing the polypeptides of the invention with the known
NMR
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
118
(nuclear magnetic resonance) and x-ray crystal three-dimensional structures as
templates.
Table 5 shows, "PDB ID", the Protein DataBase (PDB) identifier given to
template
structure; "Chain ID", identifier of the subcomponent of the PDB template
structure;
"Compound Information", information of the PDB template structure and/or its
subcomponents; "PDB Function Annotation" gives function of the PDB template as
annotated by the PDB files (http:/www.rcsb.org,/PDB/); start and end amino
acid position
of the protein sequence aligned; PSI-BLAST score, the verify score, the
SeqFold score,
and the Potentials) of Mean Force (PMF). The verify score produced by
GeneAtlas'M
software (MSI), is based on Dr. Eisenberg's Profile-3D threading program
developed in
Dr. David Eisenberg's laboratory (US patent no. 5,436,850 and Luthy, Bowie,
and
Eisenberg, Nature, 356:83-85 (1992)) and a publication by R. Sanchez and A.
Sali, Proc.
Natl. Acad. Sci. USA, 95:12502-13597. The verify score produced by GeneAtlas
normalizes the verify score for proteins with different lengths so that a
unified cutoff can
be used to select good models as follows:
Verify score (normalized) _ (raw score- 1/2 high score)/(1/2 high score)
The PMF score, produced by GeneAtlasTM software (MSI), is a composite scoring
function that depends in part on the compactness of the model, sequence
identity in the
alignment used to build the model, pairwise and surface mean force potential
(MFP). As
given in Table 5, a verify score between 0 to 1.0, with I being the best,
represents a good
model. Similarly, a PMF score between 0 to 1.0, with I being the best,
represents a good
model. A SeqFoldTM score of more than 50 is considered significant. A good
model may
also be determined by one of skill in the art based on all the information in
Table 5 taken
in totality.
Table 6 correlates each of SEQ ID NO: I - 6 to a specific chromosomal
location.
Table 7 is a correlation table of the novel polynucleotide sequences SEQ ID
NO:
1 - 6, novel polypeptide sequences SEQ ID NO: 7 - 12, and their corresponding
priority
nucleotide sequences in the priority application USSN 09/814,354, herein
incorporated
by reference in its entirety.
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
119
Table 1
Tissue Ori in RNA/Tissue Librar SE ID
Source Name NO:
adrenal gland Clontech ADR002 6
adult brain Clontech ABR006 2-3 6
adult brain Clontech ABR008 I-4 6
adult brain GIBCO AB3001 3
adult brain Invitro en ABT004 3
adult heart GIBCO AHR001 6
adult lung GIBCO ALG001 4 6
adult lun Invitrogen LGT002 5
adult s Teen Clontech SPLc01 6
bladder Invitrogen BLD001 5
cervix BioChain CVX001 1 6
endothelial cells Strategene EDT001 4 6
fetal brain Clontech FBR001 3
fetal brain Clontech FBR004 3
fetal brain Clontech FBR006 1-4 6
fetal brain Clontech FBRS03 2
fetal brain GIBCO HFB001 3-4
fetal heart Invitrogen FHR001 1
fetal kidney Clontech FICD002 I
fetal liver-s teen Soares FLS001 1 6
fetal liver-s teen Soares FLS002 1 4
fetal muscle Invitro en FMS002 I 5
infant brain NULL IBM002 3
infant brain Soares IB2002 3-5
infant brain Soares IB2003 3 5
leukocytes GIBCO LUC001 6
lym hocyte ATCC LPC001 6
mammary gland Invitrogen MMG001 5-6
*Mixture of 16 tissuesVarious VendorsCGd012 1 3 5
- mRNA
*Mixture of 16 tissuesVarious VendorsCGd015 6
- mRNA
neuron Strategene NTD001 1 3 6
neuronal cells Strate ene NTU001 3
ovary Invitroaen AOV001 4-5
ituitary land Clontech PIT004 6
testis GIBCO ATS001 5
thalamus Clontech THA002 4
thymus Clonetech THM001 1
thymus Clontech THMc02 1-2 4
th roid gland Clontech THR001 6
umbilical cord BioChain FUC001 1 4
*The 16 tissue/mRNAs and their vendor sources are as follows: 1) Normal adult
brain mRNA
(Invitrogen), 2) Normal adult kidney mRNA (Invitrogen), 3) Normal fetal brain
mRNA (Invitrogen), 4)
Normal adult liver mRNA (Invitrogen), 5) Normal fetal kidney mRNA
(Invitrogen), 6) Normal fetal liver
mRNA (Invitrogen), 7) normal fetal skin mRNA (Invitrogen), 8) human adrenal
gland mRNA (Clontech),
9) Human bone marrow mRNA (Clontech), 10) Human leukemia lymphoblastic mRNA
(Clontech), I 1)
Human thymus mRNA (Clontech), 12) human lymph node mRNA (Clontech), 13) human
so\spinal cord
mRNA (Clontech), 14) human thyroid mRNA (Clontech), 15) human esophagus mRNA
(BioChain), 16)
human conceptional umbilical cord mRNA (BioChain).
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
120
Table 2
SEQ ID Accession Species Description Score
NO: No.
Identit
7 g116553223Homo SapienscDNA FLJ32932 fis, clone3029 99
TESTI2007464, weakly
similar to
ZINC FINGER PROTEIN 85.
7 AAM69532 Homo sapiensMOLE- Human bone marrow 2752 99
expressed probe encoded
protein SEQ
ID NO: 29838.
7 AAM57139 Homo SapiensMOLE- Human brain expressed2752 99
single
exon probe encoded protein
SEQ ID
NO: 29244.
8 112655913 Homo sa s routy-4A mRNA, com 1657 100
iens lete cds.
8 g15917720 Mus musculuss routy 4 1553 92
8 14850326 Mus musculuss routy-4 1553 92
9 g1915328 Rattus Muncl3-1 5460 96
norvegicus
9 g15689401 Homo SapiensmRNA for KIAA1032 protein,5143 99
partial
cds.
9 AAY27134 Homo sapiensSONG/ Human muncl3 (Hmuncl3)4601 81
of a tide.
g114424532Homo Sapiensvery long-chain acyl-CoA3806 100
synthetase;
lipidosin, clone MGC:14352
IMAGE:4298937, mRNA,
complete
cds.
10 g19957538 Homo sapiensvery lonb chain acyl-CoA3803 99
synthetase
(BG 1 ) mRNA, com lete
cds.
10 g13327076 Homo SapiensmRNA for KIAA0631 protein,3331 100
partial
cds.
11 AAB47516 Homo SapiensMILL- Human phospholipase2520 100
C,
16835.
11 AAG63220 Homo SapiensINCY- Amino acid sequence2520 100
of a
human 1i id metabolism
enzyme.
11 g114715017Homo SapiensSimilar to phospholipase2520 100
C, delta,
clone MGC:9744 IMAGE:3854215,
mRNA, com lete cds.
l2 g117862022DrosophilaLD05405p 685 35
melano
aster
12 g13702632 Schizosaccharputative global transcriptional435 31
omyces regulator; putative ccr4
pombe subunit
homolo ue
12 g13859080 Schizosaccharsimilar to yeast glucose-repressible435 31
omyces alcohol dehydrogenase
pombe transcriptional
effector (carbon catabolite
repressor
rotein 4)
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
121
Table 3
SEQ DatabaseDescription xResults
ID
NO: entr
ID
7 PD01066PROTEIN ZINC PDO I 066 19.43 9.471 e-27 22-61
FINGER
ZINC-FINGER METAL-
BINDING NU.
7 PD00066PROTEIN ZINC-FINGERPD00066 13.92 8.800e-14 311-324
PD00066 13.92
METAL-BINDI. 8.800e-14 339-352 PD00066 l 3.92
8.800e-14 423-
436 PD00066 13.92 4.500e-13 283-296
PD00066
13.92 5.500e-13 367-380 PD00066
I 3.92 4.857e-12
479-492 PD00066 13.92 3.077e-10
227-240
PD00066 13.92 5.154e-10 395-408
PD00066 13.92
5.154e-10 451-464
7 BL00028Zinc finger, BL00028 16.07 1.450e-13 491-508
C2H2 type, BL00028 16.07
domain proteins.2.957e-12 407-424 BL00028 16.07
I .346e-11 463-
480 BL00028 16.07 3.077e-11 435-452
BL00028
16.07 4.462e-1 I 21 I-228 BL00028
16.07 5.500e-11
323-340 BL00028 16.07 6.192e-11
351-368
BL00028 16.07 9.308e-11 267-284
BL00028 16.07
1.600e-10 295-312 BL00028 16.07
2.800e-09 239-
256 BL00028 16.07 3.571e-09 379-396
7 PR00048C2H2-TYPE ZINC PR00048A 10.52 2.636e-15 460-474
PR00048A
FINGER SIGNATURE10.52 2.929e-13 488-502 PR00048B
6.02 6.000e-12
364-374 PR00048A 10.52 9.471
e-12 320-334
PR00048A 10.52 9.471e-12 404-418
PR00048A
10.52 3.368e-11 208-222 PR00048B
6.02 3.769e-11
420-430 PR00048B 6.02 6.538e-1
I 336-346
PR00048A 10.52 7.632e-11 432-446
PR00048A
10.52 l .000e-10 292-306 PR00048A
10.52 6.087e-
10 264-278 PR00048B 6.02 6.625e-10
280-290
PR00048A 10.52 3.520e-09 348-362
PR00048A
10.52 4.240e-09 236-250 PR00048B
6.02 5.737e-09
308-318 PR00048B 6.02 5.737e-09
448-458
7 BL00479Phorbol esters BL00479A 19.86 9.234e-09 282-305
/
diacylglycerol
binding
domain roteins.
9 PR00360C2 DOMAIN PR00360B 13.61 5.263e-10 87-101
PR00360A 14.59
SIGNATURE 7.387e-10 63-76
BL00455Putative AMP-bindingBL00455 13.31 I.OOOe-13 281-297
domain roteins.
10 PR00154AMP-BINDING PR00154B 9.53 9.308e-11 286-295
SIGNATURE
11 BL50007Phosphatidylinositol-BL50007A 19.61 3.152e-40 33-79
BL50007D 19.54
specific phospholipase7.698e-35 267-309 BL50007B 20.90
X- 6.571 e-30 92-
box domain proteins130 BL50007E 25.63 7.585e-20
prof. 429-466 BL50007C
8.97 4.522e-14 157-174
1 I PR00360C2 DOMAIN PR00360B 13.61 8.636e-1 1 400-414
SIGNATURE
11 PR00390PHOSPHOLIPASE PR00390A 15.09 5.390e-20 32-51
C PR00390E 14.63
SIGNATURE 9.357e-20 293-312 PR00390B 12.57
5.909e-18 58-
79 PR00390D 15.76 3.250e-17 272-294
PR00390C
12.52 5.714e-14 156-174 PR00390F
12.03 5.333e-10
443-454
11 PF01140Matrix protein PFOI 140D 15.54 8.535e-09 183-218
~ (MA), p15.
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
122
* Results include in order: Accession No., subtype, e-value, and amino acid
position of the
signature in the corresponding polypeptide
Table 4
SEQ Pfam Model Description E-valueScore No: of Position
ID of
NO:a Pfam the Domain
Domains
7 zf C2H2 Zinc finger, C2H2 6.2e-76265.7 11 209-
type
231:237-
259:265-
287:293-
315:321-
343:349-
371:377-
399:405-
427:433-
455:461-
483:489-511
7 KRAB KRAB box 2.2e-2287.8 1 20-60
7 zf BED BED zinc fin er 1.9 -I.0 1 334-372
7 zf MYND MYND finger 4.5 -9.7 1 21 1-239
7 GATA GATA zinc fin er 5.5 -10.3 1 207-253
7 zf C3HC4 Zinc finger, C3HC4 6.5 -6.7 1 379-410
type
(RING finger)
7 LIM LIM domain 10 -20.1 1 463-517
9 C2 C2 domain 5.3e-29109.8 2 48-139:917-
1007
9 SPX SPX domain 1.5 -61.1 1 588-754
9 si ma70 Si ma-70 factor 3.4 -I 1 582-750
10.1
10 AMP-bindin AMP-binding enzyme 4e-81 282.9 1 134-599
11 PI-PLC-X Phosphatidylinositol-specific1.8e-75264.1 1 28-173
hos holi ase
11 PI-PLC-Y Phosphatidylinositol-specific6.4e-54192.6 1 217-334
hos holi ase
11 C2 C2 domain 6.7e-2389.5 1 352-442
11 TT ORF2 TT viral ORF2 4.6 -94.3 1 95-207
12 Exo_endo-phosEndonuclease/Exonuclease/ph6.7e-31116.1 1 122-433
~ ~ ~ ~ ~
osphatase fa
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
123
wa wQ
~° ~° UO UO UO
O W O W N U N U N Ua
a~ z a~.aU Q~.aU
o z~ z~, zwaZ zwaz zw
U U z
~a~W wa~W ~Q
z-; ~~ zoN~ zoN~ z0
m wzz ~.zz wzz~ ~.zz~ wz
ate" ~ a H z a ~ z w c7 ~ z w C7 ~
N w ~ N w O N O W a N O W uj a N O
"V a. "c~a~. 'J~°'~z '''~°r~z
r~izc7 wz~ wa'zFa.,° wa'z~° w'1'
a'~.~'-'~ aa..'~'"z c~..,wwUw a~.wwUw oa..w
U ° C7 E-~ ~ C7 C7 E-~ ~ C7 ~ C7
ozz ozz oz°~~z o~°x~z oz_
U ~ 0G U ~ m U u. r~. v~ r3., U rte, a. v~ rte. U r3»
0 ai o xi a a Q
a
o ~ ~~a ~ aza a ~~ wa ~~ wa
8 N r~ ~ a W Z Z~... U N r~ p a W z z U U W ~ W U U W G~, W U U
o ~w~zao~ ~w~zwo° w~ ~,z w~ ~,~ w
~~w~a~~~ z°o~°xxz°o~°~z°
O' w a. U A O ~ v~ U d v. a. U ° O ~... v~ U ° CO U N a~ U
° m U N 2 U ° xi
a> a ~ o
SON
H
I~ O fn O
Q d' ~ 00 O
O O O O
4.~'
L
a o, oN N oo v
7 0 0 0 0 0
y ~ M
n N ~ N
N N N trt
N M N N
A Q
Q V~1 V~'1 v7 O~O
N ~ N N N
Q
E" ~ ~O ~ ~ T O
<t N
z
..
ac
v a a U U U
Oa
p" -~ c~ ca
A
ao
wz
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
124
UO UO UO UO UO
N U N U N U N U N U
..~ U Q ~ .a U Q ~ .a U a ~ -~ U Q ~ .a U Q ~ .a U
o az zwaz zwaz zwaz zwaz zwaz_
:r ~' N ° ~' F" N ° ~ ~ N ° ~ ~' N ° ~ ~' N
° ~ E" N
az~,J az~,J az~.J az~~.
Wa~W wa~w wa~W wa~W Wa~W
zznN~ zoN~ zoN~ zoNa znzN~
N L1,
i i
VO UWVO Uw~O UW~O Uw~O Uw~O
cn U .. ~ E-~ cn U ~. z (- v~ U ~~~ z F" v~ U ~-~ z ~- cn U ,-, Z E"' v~ U
Wcc~a NOw a NOwuaa NOw a NOwr.~a NOw a
o W~~~z W~z~o w~~~z W~z~z W~z~z
a .,~ ~ .~~ a
w U w a. W W U W a. W W U w a. w w U W a. w w U w a w w U w
O~~ ~00~0 ~00~0 ~00~~ ~~O~V ~~O~xO
z ozx~-z oz~~.z ozx~.z ozxHz ozx~.z
o. cn c~. U u. a, v~ w U rs. a. v~ rr.., U u. a. cn u., U cl. ~. r~ ~, U u. a.
tn r3,
Q ~ ~Q ~ ~a ~ ~a ~ c~
~ w ~: z ~ w u.: z = w c.,..~ z ~ w ~.; ~ ~ w c~; z ~ w c~.;
o ~,~ a ~c~ a ~,c~ a ~~ a ~,~ a
zzz~x zz~~x zzz~x zz~~x zzz~x zzz~
o ~w~zUw~w~~Uw~~~zUw~wwzUw~ww~Uw~wwz
z~oaQAZ~oaQAZ~o'aaoz~oQQOZ~oaQ z~oa
oz~xz ozxxz ozxxz ozxxz ozxxz°o~~x
U N a U ° W U N n. U ° x1 U N a. U ° m U N o. U
° m U N 2 U ° ~1 U N a. U
L
a ° °'
L
O O O O O
H
1.
L 00 O N O Q~
O f~1 N M V
H
O O O O O
O O
M M M
°a
~1 I~ 01 N
M M f~1 M
H
~a
E"' a M ~O O~
V~ N N N M M
z
aA
s~
U U U U U U
E E ~ ~ E
A
ao
Wz
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
125
z z z z z z
UO UO UO UO UO UO
z~= z~ ~H z~ ~~= z~
NU NU NU NU NU NU
Q ~ ,~ U a ~ W U Q ~ ~a U a ~ W U Q ~ ,-a U Q ~ ~7 U
Waz zWaz zWaz zWaz zWaz zWaz
Wa~X Wa~~ Wax wa~~ Wax Wax
zoN~ ~~N~ zzn,N~ z~N~ z~N~ z
UW~O UW~O UW~O U~~O UW~O UW~O
z U z~ F., ~ U ~ ~ E- U .. Z F- "' U .. ~ E-' U .. z E~ U
N O w r~i a N O W Q N O W ui a N O W Q N O W u.~ a N O W
~0.°r~z vr~r~~z "~°r~z ~x°~z ~r~°~z ~x°~
w z~° w~'~~ w~z~~,.,° u~.~~'z~ w~z~° w~'z~
'~ ~ W U a "4 ~ W U ~ ..7 ~ W U a .~ C~ W U ~ W ~ W U a .a ~ W U
0., W ~ ~ W C, W ~, ~ W a. W ~" ~ w a. W ~ a W o. W ~, ~ W o. W E-~ ~
~~o~o ~ooxo ~ooxU ~ooxo ~ooxo ~oo~
ozx~.z ozxHz oz~~-z oz~~-~ ozx~-z ozx~
U rte" a. v~ rte. U u, a. v~ rte. U cr. a, v~ rte. U rte. a, v~ u. U rte. o.
v~ U.. U u. a, v~
a Q a Q a a
= z'i'wc~Z"'wr.0~."z'i'w~z"'ww~'i'w~U.,"zt"w
o a ~o a ~c~ a ~c~ a ~o a ~o a
x zzz~x zzz~x zzz~x zzz~x zzz~x zZ
o Uwww~zUw~w~zU~~~..,~zUw~c~..~zUw~w~zUw~w
z°oz°zz°o~°xxz°oz°xxz°oz.degre
e.xz°o~°xxz°oz
° W U N n. U ° W U N cL U ° f~ U N a. U ° m U N o.
U ° CA U N a. U Ca a7 U N
a° L M
0
~o ~ o
w~ _
'~'~ L O O O 00
O O O I~
O O
L
y v O l~ c~1 Q~
m ~n N O o
O O O O i
.,., O v~
W V1 ~ V7 V1 V1 M
p~ . a~ e~ a> d~ c~ c>
pa ~ ~ ~ ~ V
~O M c'1 M M M
V1 M ~ ~ 00
w a ~ ~ ~ ~n
E
~ d'
E" Q ~ o o ° ~ o~°o
(I~ M wt
~.
r~
U U U U U U U
A p
p, ~ E E E ~ E
ao
wz
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
126
z z z
0 0 0
..:
az~ o~z ~~z oaz
W N - ~ U W ~ U w ~ U W
Q~WU ,cn ~z~ WOZ~ wOZ~ w0Q
:= a~~N ~dz~~~ O_.n,~.~~~ 00.~~~ O_nW..~~~ O
E" , :' p O CG E"' ~ ~ N W F- ~ ~ N w E- ~ a N W F»
W d a: W a» f3, F-~ 0. ~ a' O O ~ V a" O ~ _~ p a' O ~ ,-; V c'L'
c~a z ~ N oW, U ~ w a O M ~ U U ~ W u. V ~ ~ W u. U U ~ w ~.,
A ~zzo zzozD~zzzzQU ~a QU '~d ~U
W~ d~r~~oz~,o~oo~z ~oo~z Qoo~~
z N°w~z ~oa~QOO~o~~z ~o~~z ~o~~z
p ~Ca.O~ >CH~~'~zUE->GH~>"'O SCE-,r~~"O >CE-°=>"O >G
W 2 W Q w U D d W d U .a .... w a V .~ .-. W d U ,.~ .. W
~w-~w~o~- .~,~~o~- wwNo~ .a
W ~,w~~w ~,~ zww~~,~z~.d ~.~zad ~.~z~,d ~,
~ zz~~~~a~= ~c~~d~_- ~c~~d~
o_xH~ ow~~w Wow~~~ °~~~~ °~~~z o
c~. U c~. 2 cn Lt. U c~ z E-' UC7 c.c. a: U c~ ...
z
a ~ ~~ ~ z w z w z w z
z ~w w~.Q_~ww d Qw~ a Qw~ a awe a
x z z Z U a ~ a W w U cn O w ~ U v~ O w ~ U cn O w ~ U
o ~ z U til ~ u., ~ ~ z o z ~ z Q ~.o c~ C7 ~ Q N r~ C7 Z Q v, v~ C7 Z Q
V O Q d p z U O Q U Q d Q -- o o d a --~ (j O d d ~= ~j O d d --
off.., U D a'1 OU N a~. U ~ to U ~ U Eu'-~ d c~ ~ U c~. FW-~ d r~ cZG U rte" H
d ~ ~ U rte: E~'-
a A L ~°
0
0
w~
t~ O 00 \O M
00 O Q~ l0 01
O O O O O
y~~'
L
~ V
,n v7 O
O O, O O
.,... c~ G~ t~ l~
~n ~~ ~ ~ M ~ M
v
~O M M
N M N O ~ N
~n ~ ~' ~ in
H
O ~ O~
V~ ~ ~h N N M M
~r
H
x~
v ~ a d d d d
A c ~ ~ ~ ~~ y w
~, ~ ~ ~ ~ .~
a
'" o
az
w
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
127
z z xzw
0 0 0 .~ o w o
Q~ aoH. aH~Q a~~a Q~~Q
0 0 . o
o~w o~z ~~~~o ~~-x°o =~xoo
z~H ozwy.,z ~z°-Mz ~z~.Mz
xozo xozo z wzo Q Wzo Q wzo a
o ~~-~0. za~~~ z~o~o~= z~.o~o~ z~-oUO~
~.a oo.a o . a o z a o . z a o .
a o~~~ ~o~N~ ~zaNz~ 0.zQNz~ ~~QNz~ ~z
U~"Z cC V W~~ ~~F_-UV W ~?~E:VU~ c~~-~-Vow a!?,
Q c~ w ~- ~ a u: w rs. ~ a ZW Z °U ~= ~ a z Z ° ~ ~; Q z z
° ~ v ,-,
0.1 v~ cn N w z N w z z z N w Z
o~-~z ~o~-~z ~oa~',~w~ ~o~~w~. ~o0.~-r~°- "o
~~~-o x~~~o xH~~o~ x~x~:o~ wa~z°a wQ
a~w-- waVa~ waUz waUz
W ~" p F- J W v~ p E. ,~ .~ v~ w ~ ~' .-a .~ v~ w ~ 'i' .-a ,~ v~ w ~ ~'
~z~.a ~.az~.Q a.~z~~; z ~.~z~~.z ~.~z~°-z
U~~~z U~E~-~WA~ U~~W~1~ USE-~-ri D~ U
a a a
Q U a Q W U Z nw ~ ~ as z nw ~, D 0.1 Z ~ ~ D ca Z
rnOwm Uv~OW~ 2pQp-'~WQ~~QQ'~WQ,xpQ°'~Waz~
o ~n v~ C7 Z Q ~n cn C7 Z U V cn a 2 U V v~ a Z V U ~ a_ Z U
~ ~ a z w ~ ~ a x ~ ~ O ~ ~ W x >- D O ~ ~ W ~ ~- D O ~ ~ ~ 2 ?, ~
a r~ ~ V r-L: F- a r~ ~ U c~: ?~ a a > Z w U ~ a a > ~ W U 7- a a > Z w U ?~ a
aA L
~o
w~
00 M ~ CO O
O O O O
W~ d
~L p O I~ ~ ~_O
y U ~ N ,~ O
O O O O O
tin M M OM M
N N N N N
v'1 l~ V~ 00
00 ~ ~1 M
A d
Z d °~ ~ ono
V1 M N M M
~d
E" d O ~O ~ ~~ M
l/~ ~ N N
z
dA
~..
U a U U U U
p O w ~ ~ .~o
p, .r
A
~, O
Wz
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
128
x~a xzw x~~ x~a xzw
o~~a o~~a o~~a o~~a o~~Q
°oz ~H°~oz ~~.°oz ~~-°xoz ~~.°oz
0
z~Me zz~Mz zz~Me zz~Mz zz~Mr~
o zooo z~z~oo z~a,.z~oo z~a,.z~oo z~zooo z
°z a o . oz a o °z a o °z a o . oz a o
~c~~w~w ~o~-wo=w ~o~-w~-w ~.°~=~~-.~ ~=
° aNza ~,zaNza ~,zQ~"z~ ~,zaNz~ ~,zaNz~ ~.
E- U 0 W L ~ E- U O t.Ur.7 ~ ?, E- U ~ V t~ ?~ E- U V W r~ >- F- U C7 W
~QZZUrx ~azzU~ U~-~zzo~ U~,zzox v
o zN~o zozN~o zozN~o z~zN~o zozN~o z
a. o~-z~ ~zo~.z~ ~zo~-zH dzo~.zH ~zo~-z~
c~_., >." W a. ~ O ate., >" w ~ ~ O off.., >"' w a. ~ O off." >.' w a. v O
off.. ~'.' w ,z., v
c~ E- ~ ~ ~C E-~ a E-' 0 U 7C E-~ ~ E- ~ U ~C E- ~ ~ p U W Q U z ° U w
U z ~ ~ w a U z ~ ~ w a U z cW n w a U z rx v~ ~ v~
vi w a, W W v? w ,1, ~ ..~ v~ w a, ~a ,..a cn w a, .-~ ,~ zn w 0., z o,..a..,
~~z~ ow~~z~ ow~wz~ o~'~~z~ ow~wz~ o
E- u.7 D ~ U rx E- w L7 ~ U a: E-~ W ~1 ~ U ~ F- W D ~ U r~ E- W C~ ~ U
D z ..,U p z ..,U a U a U a U
w ~r~~azw w ~r~a~z~ °w ~~r~~ °w zn~iz
Q_~,o~-Qa Q_~,o~Qa Q_~o~Qa Q_~oHQa Q_~,o~Qa
~.~-z x ~ ~-Hz x ~ ~.~.z w ~.~z x ~-~z x
U v~ a w z U ° U v~ a w Z U ° U v~ a w z U ° U rn a
w Z U ° U ~ a w Z U
o~~wQ .~Wo~~Wa .~Wo~~WQ .~Wo~~WQ~zo~~WQ .
Q>zw~~oaa>zw~~oaQ>zw~~Qa>zw~~Qa>zw~~
a ° °'
,~ '- c~
','
w
w ~
L
° o°'o °o °0 0
0
~L ° ~ ~ ~ 0
a a
> ~' 0 0 0 0
N V1 N
.. tn M ~1 c'1 V1 V'1
N N N
M V7
° d
°o
M M cn V
H d ~ ~ °~ oW°
V~ N N N N M
z
d °
U U U U U U
p A ~ ~ ~ ~ .gin
p, ~ ° ~ ° °
°
ao
Wz
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
129
X X X ~ X
z z z o z
W 0.. ~. ~ W OW. ~ ~ W 0. .-. ~, W Oa.. ~. ~ W 0. ~
a~.~a a~-~a a~.~a a~.~a a~.~a
zz~M'z z~~Me zz~Mz z~~Mz zz~M'z
o ~o~o~ z~o~o~ z~o~o~ z~o~o° z~o~oo
a o z a o z a o z a o . z a
o ~QNz~ ~,~aNz° ~,zaNz~ ~,zaNza ~,zaNz~
o ?~ E" U C7 W ~ >- F- U O C7 c~ >- Er- U C7 W r~ ~- E- U C7 W ~ j- F- U O w
azz°~ ~az~°~ ~QZZ°~ ~az~°~ ~a~~°x
A zzN~z zzzN~z zzzN~z zzzN~z zzzN~z
a,
O a. >"' w 0. ~ O ate., >"' w ~- ~ O off.., >"' W °~ ~ O per., >" W
°- ~ O ate., >"' w ~
aUz°~ WaUZ°~ WaUz°~ WaUz°~ WaUz°~
~.7 V1 W ~ W .~ V~ W ~ ~a .-7 V7 W Gy, ~.a ..a ~ W p" ~-.~ .a V7 W
'~zWa~ '~'~~Wz~ o~~Wz~ ow~Wz~ ow~Wz~
~~WD.~ °U~f--'WGa... UC~E-WCW. Uc~.E-'WL1'. Ufi~E»W~I.J
a ~j a ~j a ~,j a ~j a
b
° ° ~znr~z ° ~oai~ ° ~ooaz ° ~~r~~ ~ ~oai
. a_~ozQ~ . a~ozQ~ . a_~ozaz . a_~ozaz , a~ozQ
o ° U v~ a W Z U ° U v~ Q W U ° U rn a W z U ° U
cn Q W Z U ° U ~ a W Z
Woa~,Wa .~w°o~WQ .~Wo~~WQ .~W°~~,~a .~~o~~~a
°°aa>z~~~°aa>~w~~Qa>zw~~°a>zw~~°aa>z~~
~o
w~
O O O O
O O O O
w~' ~
.. f.
._ ,-, o
N l~ N
O O O O
rr C' v1 N ~t
VJ f~1 M V1 V1
N N N N
~D O~
M M l~
N ~ 0~0
v~
H
N ~ n O
V~ fn M M
z
QA
x~
U U U U U
AA
A
'~ O
az
w
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
130
z
z z z z z z z z z z
a ego ode o 0
~wz zwz Zwz °z
p" U ~ W C7 W W C7 W W C7 W W C7 W W C7 W a" Z
z z ~., z ~. z ~. ~- H ~. z H ~- z ~. ~- z ~- c~ w
0 owo o~o owo owo o~,o zo
c az z x x rx ~ x x x x
o z ~.. ° C7 p E- A., U a. n. U a. o. U a. a. U o. a. U a. D u: O
°°~-z~~ ~zc~ c~z~ c~zc~ ozc~ ozc~ z°'
o ~zaNz~ zNz zNz z_Nz zNz zNz m~ o
c~~-~U~w ~:;o ~,~o o,~o n~o
v--zzo~ z~~ zoz zoz zoz z~z W~,
r~ ~z"Nwz m~aa m,_;m mom m,.:..;m m:.:m ~a c7
o~~o a~a a~a a~a Qua a~Q ~~ z
~.z~ z z z z z z z z z z w
~oa~.,~''w~- ~W~? oWo oWo oWo oWo c7~" F
x~-~~=~'~ x°x xV~ x~x ~tV~t ~o~t zW °x
waUz°U wzw wzw w,zw wzw wZ~w
--~ ,~ v~ w ~ ~' ,.~ ~ W ..4 ~ ~.7 W W ~7 .~ W ..a ~ o
a.~z~°'z a.~'; n. wwa. a. u; a. a.~'; a, a.ww ap U
~Vawa ~w~ ~w~ ~w~ gW~ ~w~ z
owxaz~ o>o o?o o?o o>o o?o o~. w
U rL E- w ~.1 " U r-~. U U rs, U U u.. U U rz. U U w U v~ U C7
U Q . ., Q . ., Q . ., Q . ., Q . ., Q
o z ~~z x~z ~~z x~z x~z
z w ~ p as w ~ f~ p w ~ ~1 0 w ~ o L w ~ 0 p w ~ O
zoQ~owazzwa~zza~~zQ~zza~z~Q~ ~~~oaz
o ~zoaa~~~.~z~w~zz~~zz~-~zZw~zz o~o~zz
~-o~n=~~xzx°z~z°~~~z°xxz°xzz°~xz ~wawxa
~-as>zWUNn.UUNa.UUNa.UUNG.UUNo.UU Hzr~.r~U.a
D a~
aM,
Gz. a>
~n 00 N M Ov
G, ~ ~O 00 00 00
O O O O O
~~ N
n O N
O O O O
~, M ~ ~ <t' ~ M ~ V'1
Vi M M M C~t M M M O
00 ~ ~ 00 00 ~ O 00
vD M 00 \O ~O ~ O M
00 N M ~t ~n O Own
M Wit' t~ v't o0 ~ 01 r
~n M M ~t V V'1 N N
H
M O d' N
V~ ~ N N M
z
~A
U U a a a a a a
_o
N N N N N x
A
ao
Wz
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
131
z z
C7 E.. C7 E-. N f~l N Vl W W N
ai~~ oaz~ w~ moa ~ ~zV
z°'~ ~a~X~a~X°W °W ._ooz ~__.~~
W°° w°° v~,~z~vWzw~Q ~Q °°~oa
"°°
H~.z ~.~-z oo~~oo~~o.~ oa ~~ ' UU?
0 owe, o.~m H~~,~H4~,~xo xo axw~ °W-~z
C ~ Q ~ Q ' ~" N Q ~.., N Q A., ~ a. ~ cG '-' p rx
C7 ~ ~ C7 A- p O U ~ ~' O U °' ~ N p N ° O H ° ,.Ua
M W O EW
cn ,~ '~ ~"' _ ~." a ~." a ~."' --~ v~ ~ a U Ll v~
A p~~ p~..Ua -~'~~zO~~zO~~ a x aW~'~~~'aW
f~. v~ p v~ (~ U C7 U C7 ° ° W v~ ° °
V ~~W z~Q~z WZ WZ U~jW Oa.~0 U
G~ + N ~ + N O E.a., rn W Q ~ v~ W v~ p c~ p ~ ~ c~ U ~ Z ~ ~
z Wow°oowo
~ ~ W p = W U a, ?' a U a. ~- a O cn O oa ° ~ O °~ ax" ax"
° ax.,
U U H U U F- Q a U W O a U W ~ ~j ~ ~ p v~ ~ z v~ cn v~
a a o a a O ° O -a ~1 O -~ ° '~ Ll ~ O ° a O O ° O
aax aax z~xwz~x ~-°- ~~ ~x~-xzx°-x
U U a. U U o. W v~ W u: W c~ W ~ x :a ~ ..a ,~ o. x F- C, o. i a.
H ~j F
a Q a QQ as ~-a aa_,Q OUoa_..a oU
o ~ ac x ~z o~ Boa ~wQ ~",~~
o, z zwW~ zW~ °a ~-a oxx o~x °~°a °w
W ~ '1 W ~ ~ ~ x 0. x ~ 0. U ~ 0. U p. C. 0. x 0. 0.
v Q Hay ~-a~ aU aU ooN ooN o~oU o~
v 0.~~a~~ °a~z ~z UCx..,Wf~Uoz.wcoaz.~?aw
V p L
H
~Tr
U V: ~O WO N N ~
O O O O O ~ O O
L
M f~ O M I~ v1
M M O O N
O O O O O O O O
V't N C' ~ 00 O~ M
H N ~ N ~ N
G) N N N N N N a)
00 Os n O~ ~n Oy o0 v0
M ~I Cf1 I~
Wdv°oov"',O~O~ o
N
H
~d
dd ~ N ~ o
V1 ~h O~ ~ 001 V Q~ N O~
H
d
x
v a a a a a a a a
W O C C ~, ~, X X
(NC ~ ~ ~U ~U 'b~ 'D~
ao
wz
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
132
z
N N N Q Q
z~ ~z~ ~z~ a~a~ z a~ z x o°
° aOZ a°~ ~'°~'° z " ~ oa
aA ~~oaQ ~~oQr~ U~r~ aQ ~z~ ~~~ w
n~ wo~r~z wQpp~ w~"~U+~owo +~°wo z~ z
0
U U ?~ ~ ~ U Cj ?~ p~ ' U ~ z 0 z + a, ~ ~ + a. ~ off.. a Z a
w.~x°~ wwxc~~ w~,o~,o~c~~
w~ a;~"xw~ v °'r~wx ~~- ~- xz~-W xz°-w oa o
c D U M ~ Z W f> U M ~ z W ~1 ~j M U ~ U ~ U Q N z U p N z O ~ D
ce Q ..a U ~ O ~ Q ,~ Lj ~ O ~ Ll ...7 Cj ~ O ~ O ~ ...a z p ~ .a Z, C7 w 0.1
O 0.1
ri U w ~ Q w a. U w ~ Q W A_. U w ~ W ~ W ~ U m z ~ U ~ z ~ Q ~ a
U
o. .a ~ Q ~ p D .-a ~ Q ~ p Ll ~ ~ Q p ~ a p a W D Q y. W p Q ?~ U U
W W ~., O U ~cj w A- O U u7 W p.., O v~ U v~ U va~ ~ Z Q ra~ ~ z p W Ci7 W
aa00~0a~00~OQa00OU~U~O~a ~O~Q QQ Q
o~xx~xopxxoxo~xx~3~3~z~x ~xax o0 0
a, a. a, a. a, a, a. a, a. a. a. ~- c.
~ z v~ cn p w ~ z cn cn p cn ~: z tn v~ O D O D z vi U w z tn U v~ c~ c~ rx
0~ 00 op o0 0° oor~zr~z o-~o owo QQ Q
~~o~..ax..,.aas.Z~ox..,ax..:aox.",.~"~~a~,c~. W~w~~ox..,Ucx.U~ax,U~UZ~ ~
'fl Qa.,a OUaa.,a OU~a °a°a w
~z~z ~. ~ ;~z ,~
oz o~o~ o~o~ oaoa ~~ ~~ oa o
xa xwxa xwxa ~-x~xzw~Q ~W~'a xx x
0 0. x n.. c. a, x a. a. a. x ~ U ~'- U w cn a Z w ~, a Z a. U a,
v~ U v~ v~ v~ U v~ v~ v~ U Q _. ., a . " F-. Q x F-~ Q x w .a v~
V OU OWOU OwOU ~,=.z~OZ~2 ~~~~-lx Mao~
ax, W ax., ~ ax, w ox, ~ ax., W v~ z cn z off.. ~C a U c. ~ a U a, w z a.
a° L
a
~o~
L 00
°. °o N ~ o~°o ~ o~, o
a ~'
o O O O O o 0
~,..,~' a~
L _
L ~ 'r' N r oo N M
N ~ O <t ~~ ~O M
O ~ ~ O O O O O
Q~ M V ~ ~ M
N N N
a> a> a> a~ ~ a> a~ ai
00 ~n oo t~
M O~ M V1
w Q v O r O ~ O r O
O ~!1 41 ~ ~ u1
Vl N O~ C' 00 ~ O~ ~ Q~
z
QA
x~
v x, m a a a a
p A ~, x, o- a- ~ ~ 3 3
'D 'n 'O 'O 'O 'O L S-.
A
ao
wz
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
133
z
o ° ° az az
° c'Ew- a'Ew- UH U~
a. ~ a. a Ca ~ Ca ~
o U ~?~ cant ~O ~O
z ~o ~~ °nro °n~o
a ' wa wa ~x ~z
R o as aQ o°~ o°
E.., v~ w ua w r~i
° ~ ~o ~° Hz~~z
W ~ ~ U w z U w
xc~wx~
a ~~° ~~c~ o~.U°~
0 ozz o~z o°zo°
A ~,~.~ ~~-~ °z~oo
z ~~o ~~o o~~o~
o ~ Mo
aN ~-x aN ~ z~ a°z_~ Q°w~ w
~.U ~ am.~~ a~w~~
° p o~~.x ° o~~.x °~- a °~. a ~ a°
°' ~ ~~.~'~~.~z~,a~.'~z~~z~. ~wa-~z~_waw~~z ~z
° ~.~U.a~Hawa~v~o~awa°,~° ~~zzx~~~zz'=~ ~.z
v Nwao o ~-~ wo o ~~ awe aw~Ua ~a
aaax~x~~oaaxzx~ oa ~~zx ~~rxx ax ~x
W z U a, G.z~ a, v~ z ° U U o. c~ a, v~ z L1 U C7 c~ U a. w C7 v~ U o.
W .~ U ..~ U
w ~
L ,-.~ 00 00 O
° V1 ~ l~ O
O O O
L
L ° ~ O~ r~
N C1 N
H
O O D O
v 'd' v7
.. v~ N o0 00
Q) N N c)
00 00 ~ Wit'
M M O O
°a
WQ ° o
a
Q Q O
z
QA
x~
v a a
pA, A
A
ao
Wz
0 o O O
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
134
w z
z
a a
VH c~~ ~v~~ z
mop ~°~ z ~ o
a~~ a ~- ~~' i w z m
U ~ C7 U m C7 ~ ~ o p E'_' Z ~
W~~ W°~ ~~z~~a +0.~°
0 oar o~~ °n°~~°o ~~°W
. ~. ~ z ~. a
°= ate., ~ ~ o~." ° ~ U U O ° A~ ~ U 0 N z
a.a o x~.N~. wz~~ mo
m zoo zoo ~zW~;z ~mz~
ate. z z~a z~a ~~~°n~~ ~oz~ vv
U ~, + N m, -+I- N O [a-~ V7 W Cn 0 ~ J m ~ V7 fn
Q
z a~w ~~w Ur~~-aom ~~?~ 00
U U E-~ U U E-. O a U w ~ p z v~ U cn
-7p L1 0,~~ O-~O
aax aax z~xw~-~ ~zax
U U a, U U a, w v~ w u~ ~ ,~ E- a. U a» U x ~
a a aQ as ~; ~ ~ aN
U a z U
o UV UU Oz apQ U~.' Da ~p OE-~.u:
zw:: '~w;; ~.a ozx ~w~-a ,m~ ~~,o~~-~'z;,
o W v~ a W v~ a ~ x ~ «. U W cn a Z a, U ~...~ .. Z W a~ ~ a m
Ha ~-a a~ o~ ~-az ~ ~Uao~-aw~w
v ~- ~- Boa.; o ~,a oa.;~,,~o oz~
a'~.x~a~~ °a'~z ~~w~;a'~.~a~ ~wz~a~.m~~zon~
0
w~ _
I~ ~ M 00
N ~ O v1
O O O O O
e""~' N
L
y yO M 0
N O
O O O O O
t~ n ~ ~f' I~ O~ ~n
N a) c) N N N N
r ~ ~ r
m Owe
A d
0o wo ~r .-- ~r M
~n v, ~n v, ~.,
v v v ~r ~r ~t
E
~Q
d d M .--~ t~ N N N d~
M M M M M M M
z
da
v a a a a a
as
A A N N ~ .,-~', 0
N cC ~ U 'D i. s.
ao
Wz
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
135
0
0
w
ca
0
a
a
a,
M
H
~~zzo~zx
ioHa~~~
~z~~ a
U ~ ci~ 0.
w z D
a
L
w
~o~
wd
L
N
O
.r
L
'
L ~'
C~ O
V O
ar V1
..
H N
Q
E'~
V1
V1 cn
z
Q
x~
U
ao
wz
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
136
Table 6
SE ID NO: Chromsomal location
I 19
3 19
4 15 25.1- 25.2
17
Table 7
SEQ ID NO of Full-lengthSEQ ID NO of Full-lengthSEQ ID NO in Priority
Nucleotide Se uencePe tide Se uence Application
USSN 09/814,354
1 7 1
2 8 2
3 9 3
4 10 4
5 11 5
6 I 12 I 7
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
006PCT sequence Listing.txt
SEQUENCE LISTING
<110> Hyseq, Inc
Tang, Tom Y.
zhou, Ping
Goodrich, Ryle
Asundi, vinod
Liu, Chenghua
Wehrman, Tom
Ren, Feiyan
Drmanac, Radoje, T.
<120> NOVEL NUCLEIC ACIDS AND POLYPEPTIDES
<130> 21272-006-061 CIP
<140> unknown
<141> 2002-03-20
<150> 09/814,354
<151> 2001-3-21
<160> 12
<170> Patentln version 3.0
<210> 1
<211> 2104
<212> DNA
<213> Homo sapiens
<220>
<221> CDS
<222> (229)..(1866)
<400> 1
ctggtggtggtcgttttggt tctgtgtggtgtttcaccaacttcggcctatggctctgtc60
tgacgtcaccgaagtgacgg aacggaaaagcgcgagaagcggctcggttcccaccacgga120
gaggcgggagtgagtcaact gacaagcgctggggacagtggcgtccttgtcttgcctttg180
tctctcccgccccgctcttc cctggctgggctggcggaggccttgctg g aac ctg 237
at
Me t Asn Leu
1
act gag ccc ctg gcg atg gaa atg cct aca ggc cgt 285
ggt gca gac cag
Thr Glu Pro Leu Ala Met Glu Met Pro Thr G~ly Arg
G1y Ala Asp Gln
10 15
gtg gtc gag gac gtg gcc tat ttc cag gag tgg ggg 333
ttt ata tcc gag
Va1 Val Glu Asp Va1 Ala Tyr Phe Gln Glu Trp Gly
Phe Ile Ser Glu
20 25 30 35
cac ctt gag get cag aga ctg tac gat gtg ctg gag 381
gat ttg cgt atg
His Leu Glu Ala Gln Arg Leu Tyr Asp Va1 Leu Glu
Asp Leu Arg Met
40 45 50
aat ttg ctt ttg tcc tca ggt tct cat gga gag gat 429
gcc cta tgg get
Asn Leu Leu Leu Ser Ser G1y Ser His G1y Glu Asp
Ala Leu Trp Ala
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
006PCT Sequence Listing.txt
55 60 65
gaggaggca ccttcacag caag9tttt tctgtagga gtgtcagag gtt 477
GluGluAla ProSerGln GlnGlyPhe SerValGly ValSerGlu Val
70 75 80
acaacttca aagccctgt ctgtccagc cagaaggtc caccctagt gag 525
ThrThrSer .LysProCys LeuSerSer GlnLysVal HisProSer Glu
85 90 95
acatgtggc ccacccttg aaagacatt ctgtgcctg gttgagcac aat 573
ThrCysGly ProProLeu LysAspIle LeuCysLeu ValGluHis Asn
100 105 110 115
ggaattcat cctgagcaa cacatatat atttgtgag gcagagctt ttt 621
GlyIleHis ProGluGln HisIleTyr IleCysGlu AlaGluLeu Phe
120 125 130
cagcaccca aagcagcaa attggagaa aatctttcc agaggggat gat 669
GlnHisPro LysGlnGln IleGlyGlu AsnLeuSer ArgGlyAsp Asp
135 140 145
tggatacct tcatttggg aagaaccac agagttcac atggcagag gag 717
TrpIlePro SerPheG1y LysAsnHis ArgValHis MetAlaGlu Glu
150 155 160
atcttcaca tgcatggag ggctggaag gacttacca gccacctca tgc 765
IlePheThr CysMetGlu GlyTrpLys AspLeuPro AlaThrSer Cys
165 170 175
cttctccag caccagggc cctcaaagc gagtggaag ccatacagg gac 813
LeuLeuGln HisGlnGly ProGlnSer GluTrpLys ProTyrArg Asp
180 185 190 195
acagaggac agagaagcc tttcagact ggacaaaat gattacaaa tgt 861
ThrGluAsp ArgGluAla PheGlnThr GlyGlnAsn AspTyrLys Cys
200 205 210
agtgaatgt gggaaaacc ttcacctgc agctattca tttgttgag cac 909
SerGluCys GlyLysThr PheThrCys SerTyrSer PheValGlu His
215 220 225
cagaaaatc cacacag9a gaaaggtct tatgaatgt aacaaatgt g 957
g
GlnLysIle HisThrGly GluArgSer TyrGluCys AsnLysCys G~y
230 235 240
aaattcttt aagtacagt gccaatttc atgaaacat cagacagtt cac 1005
LysPhePhe LysTyrSer AlaAsnPhe MetLysHis GlnThrVal His
245 250 255
actagtgaa aggacttat gagtgcaga gaatgtg aaatccttt atg 1053
a
ThrSerGlu ArgThrTyr GluCysArg GluCysG~y LysSerPhe Met
260 265 270 275
tacaactac cgactcatg agacataag cgagttcac actg gaa agg 1101
a
TyrAsnTyr ArgLeuMet ArgHisLys ArgValHis ThrG~yGlu Arg
280 285 290
ccttatgag tgcaacaca tgtgggaaa ttctttcgg tacagctcc aca 1149
ProTyrGlu CysAsnThr CysGlyLys PhePheArg TyrSerSer Thr
295 300 305
ttt gtt aga cat cag aga gtt cac acc gga gaa agg ccg tat gag tgc 1197
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
006PCT Listing.txt
Sequence
Phe ValArg HisGlnArg ValHis ThrGlyGluArg ProTyrGlu Cys
310 315 320
agg gaatgt gggaaattc tttatg gacagctccaca ctcattaaa cat 1245
Arg GluCys GlyLysPhe PheMet AspSerSerThr LeuIleLys His
325 330 335
cag agagtt cacaccgga gaaaga ccttataagtgc aatgattgt ggg 1293
Gln ArgVal HisThrGly GluArg ProTyrLysCys AsnAspCys G1y
340 345 350 355
aaa tttttt aggtatatc tccaca ctcattagacat cagagaatt cac 1341
Lys PhePhe ArgTyrIle SerThr LeuIleArgHis GlnArgIle His
360 365 370
act ggagaa aggccttat gagtgc agtgtatgtggg gaattgttt agg 1389
Thr G1yGlu ArgProTyr GluCys SerValCysGly GluLeuPhe Arg
375 380 385
tac aactcc agccttgtt aaacat tggagaaatcac actggagaa agg 1437
Tyr AsnSer SerLeuVal LysHis TrpArgAsnHis ThrGlyGlu Arg
390 395 400
cct tataaa tgcagtgaa tgtggg aaatcatttagg taccactgc agg 1485
Pro TyrLys CysSerGlu CysG1y LysSerPheArg TyrHisCys Arg
405 410 415
ctc attaga caccagaga gtccac acgggagaaagg ccttatgag tgc 1533
Leu IleArg HisGlnArg ValHis ThrG1yGluArg ProTyrGlu Cys
420 425 430 435
agc gaatgc gggaaattc tttcgt tacaactccaac ctcattaaa cat 1581
Ser GluCys GlyLysPhe PheArg TyrAsnSerAsn LeuIleLys His
440 445 450
tgg agaaat cacactgga gaaagg ccttacgagtgc agagagtgt ggg 1629
Trp ArgAsn HisThrG1y GluArg ProTyrGluCys ArgGluCys Gly
455 460 465
aaa gccttt agccacaag catata cttgttgagcac cagaaaatc cac 1677
Lys AlaPhe SerHisLys HisIle LeuValGluHis GlnLysIle His
470 475 480
agt ggagaa agaccttat gagtgc agcgaatgccag aaggccttt att 1725
Ser G1yGlu ArgProTyr GluCys SerGluCysGln LysAlaPhe Ile
485 490 495
aga aagtct cacctggtt catcac cagaaaatccac agtgaagag agg 1773
Arg LysSer HisLeuVal HisHis GlnLysIleHis SerGluGlu Arg
500 505 510 515
ctt gt tgc tccatgaat gt9ggg aattctttaget aaaactcca acc 1821
Leu Va~Cys SerMetAsn ValGly AsnSerLeuAla LysThrPro Thr
520 525 530
tca ttaaac atcagagat ttcaca atggagaaagtt taccattga cta 1869
Ser LeuAsn IleArgAsp PheThr MetGluLysVal TyrHis
535 540 545
ttgtaattgg ccacattttt atgcaactaa
1929
gtagtaatgt tctccagaac
tatataaatt
atttttcctc gtacccatta acaacaactc
1989
ttaccaagaa attccccttc
gtaaaatgct
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
006PCT Sequence Listing.txt
cctacttccc cagaaatgtc tcaactgtat ttctatactc tatggtactt atatgaggta 2049
ccaatagata tctatgaatt tgatatatat ttgtacctca tataagtgga ttcta 2104
<210> 2
<211> 2061
<212> DNA
<213> Homo sapiens
<220>
<221> CDS
<222> (245)..(1144)
<400> 2
gtggcactgtgccgaaattcccgggtcgacgatttcgtagcgagctgagctgatttcgcg60
gagctggcgctgtggagcgcagggagccttgccggttcctccgaccggcgtctgcgagta120
cagcggcggctaacctgccccggcttcaggatttacacagacgtggggcgatgcttgtga180
ccctgcagctcctcaaaggcccctagaagcctgtttctccgtacagtccaggacctccag240
cccc atg atc cca agc gcc ttg act 289
gag ccc cag ccc ccc aac
ccg tca
Met Glu Ile Pro Ser Ala Leu Thr
Pro Pro Gln Pro Pro Asn
Ser
1 5 10 15
gtcatggtc cagcccctt cttgacagc cggatgtcc cacagccgg ctc 337
ValMetVal GlnProLeu LeuAspSer ArgMetSer HisSerArg Leu
20 25 30
cagcaccca ctcaccatc ctacccatt gaccaggtg aagaccagc cat 385
GlnHisPro LeuThrIle LeuProIle AspGlnVal LysThrSer His
35 40 45
gt gagaat gactacata gacaaccct agcctggcc ctgaccacc g 433
c
Va~GluAsn AspTyrIle AspAsnPro SerLeuAla LeuThrThr G~y
50 55 60
ccaaagcgg acccggggc ggggcccca gagctggcc ccgacgccc gcc 481
ProLysArg ThrArgG1y G1yAlaPro GluLeuAla ProThrPro Ala
65 70 75
cgctgtgac caggatgtc acccaccat tggatctcc ttcagcg9g cgc 529
ArgCysAsp GlnAspVal ThrHisHis TrpIleSer PheSerGly Arg
80 85 90 95
cccagctct gtgagcagc agcagcagc acatcctct gaccaacgg ctc 577
ProSerSer Va~ISerSer SerSerSer ThrSerSer AspGlnArg Leu
100 105 110
ttagaccac atggcacca ccacccgt9 getgaccag gcctcacca agg 625
LeuAspHis MetAlaPro ProProVal AlaAspGln AlaSerPro Arg
115 120 125
getgtgcgc atccagccc aaggtggtc cactgccag ccgctggac ctc 673
AlaVa1Arg IleGlnPro LysValVal HisCysGln ProLeuAsp Leu
130 135 140
aagg~cccg gcggtccca cccgagctg gacaagcac ttcttgctg tgc 721
Lys G y Pro Ala Val Pro Pro Glu Leu Asp Lys His Phe Leu Leu Cys
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
006PCT Listing.txt
Sequence
145 150 155
gaggcctgtggg aagtgt aaatgc aaggagtgtgca tccccccgg acg 769
GluAlaCysG1y LysCys LysCys LysGluCysAla SerProArg Thr
160 165 170 175
ttgccttcctgc tgggtc tgcaac caggagtgcctg tgctcagcc cag 817
LeuProSerCys TrpVal CysAsn GlnGluCysLeu CysSerAla Gln
180 185 190
actctggtcaac tatggc acgtgc atgtgtttggtg cagggcatc ttc 865
ThrLeuValAsn TyrG1y ThrCys MetCysLeuVa~lGlnG1yIle Phe
195 200 205
taccactgcacg aatgag gacgat gagggctcctgc getgaccac ccc 913
TyrHisCysThr AsnGlu AspAsp GluG1ySerCys AlaAspHis Pro
210 215 220
tgctcctgctcc cgctcc aactgc tgcgcccgctgg tccttcatg ggt 961
CysSerCysSer ArgSer AsnCys CysAlaArgTrp SerPheMet G1y
225 230 235
getctctccgt gt ctg ccctgc ctgctctgctac ctgcctgcc acc 1009
AlaLeuSerVa~ Va~Leu ProCys LeuLeuCysTyr LeuProAla Thr
240 245 250 255
ggctgcgtgaag ctggcc cagcgt ggctacgaccgt ctgcgccgc cct 1057
GlyCysVa1Lys LeuAla GlnArg G1yTyrAspArg LeuArgArg Pro
260 265 270
ggttgccgctgc aagcac acgaac agcgtcatctgc aaagcagcc agc 1105
G1yCysArgCys LysHis ThrAsn SerValIleCys LysAlaAla Ser
275 280 285
ggggatgccaag accagc aggccc gacaagcctttc tgacagtttgtgt 1154
G1yAspAlaLys ThrSer ArgPro AspLysProPhe
290 295
cgaagcccca gtgctctgcc gttctcttct gacatctaag
aagactgcag 1214
tggaaacctg
caaggtcaga ggttttagcc gaccttgcta gtctgcccac
tccctacccc 1274
tcctgaggct
cagcttcgga aaatacagag cgtaccctgt attccccaag
gtgatgaaga 1334
accaccacca
agcactttgg ggcttttttt aaactttgtg tcaaacagac
aatgcagggg 1394
cagggtcctg
cagggtgtgg tttgggggga tttcagaaga cagaacacag
1454
aatttttctt atgtggacac
atatccggaa actgcagctg ttcccagccc ctccttctcc
ctccctccct 1514
cttgaatgcc
ccgccccccc cttcctcttt tggcactcac aggagctagc
1574
tccttgtctt tgcctgggag
gaattgttaactgagtaccagggtacctttaaagaagacccttggagtcttctatacctt1634
cttctccttccccatctcactccaccccactttgtccctgatgtcttggggaaggtgtag1694
aacaccctagcagttcctattgtatatacttgggagccactgagaacagaggacggccag1754
tgagtccaagcctcgttcctccttctgcctccccggagcc acaggatggatttaggagcc1814
actgctcagtgcacttctcccttccaactgcatcaactaa ctctcgggggtgttctgctc1874
accacaccgtccttcggttcttactgagtcacagactcgc ctgcccactacgtgtcctgg1934
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
006PCT Sequence Listing.txt
gttctctcta ctcagatccc ttccagaaac tttatatggg tagaggaagc cagggcggca 1994
aatgcgagac caaatatcat tttgccaatg agtctgaggc tgtggtctct ggatccagtc 2054
atgtatt 2061
<210> 3
<211> 3271
<212> DNA
<213> Homo sapiens
<220>
<221> CDS
<222> (6)..(3227)
<400> 3
accgc at g g 47
aag cgc
atc aac
cgg aag
ga ccc
gag
atc
ttc
gag
ctc
Me t Ile u
Lys Arg Arg
Gl Asn
Lys
Pro
Glu
Ile
Phe
Glu
Leu
1 5 10
atccaggagatc ttcgcg gtgaccaag acggcgcac acgcagcag atg 95
IleGlnGluIle PheAla Va1ThrLys ThrAlaHis ThrGlnGln Met
15 20 25 30
aaggcggtcaag cagagc gtgctggac ggcacgtcc aagtggtcc gcc 143
LysAlaValLys GlnSer ValLeuAsp G1yThrSer LysTrpSer Ala
35 40 45
aagatcagcatc accgtg gtctgcgcc cagggcttg caggcaaag gac 191
LysIleSerIle ThrVa1 ValCysAla GlnGlyLeu GlnAlaLys Asp
50 55 60
aagacaggatcc agtgac ccctatgtc accgtccag gtcgggaag acc 239
LysThrGlySer SerAsp ProTyrVal ThrValGln ValGlyLys Thr
65 70 75
aagaaacggaca aaaacc atctatggg aacctcaac ccggtgtgg gag 287
LysLysArgThr LysThr IleTyrG1y AsnLeuAsn ProVa~1Trp Glu
80 85 90
gagaatttccac tttgaa tgtcacaat tcctccgac cgcatcaag gt9 335
GluAsnPheHis PheGlu CysHisAsn SerSerAsp ArgIleLys Val
95 100 105 110
cgcgtctgggac gaggat gacgacatc aaatcccgc gt9aaacag agg 383
ArgValTrpAsp GluAsp AspAspIle LysSerArg ValLysGln Arg
115 120 125
ttcaagagggaa tctgac gatttcctg g9gcagacg atcattgag gt9 431
PheLysArgGlu SerAsp AspPheLeu GlyGlnThr IleIleGlu Val
130 135 140
cggacgctcagc ggcgag atggacgtg tggtacaac ctggacaag cga 479
ArgThrLeuSer GlyGlu MetAspVa1 TrpTyrAsn LeuAspLys Arg
145 150 155
actgacaaatct gccgt tcgg9tgcc atccggctc cacatcagt gt9 527
ThrAspLysSer AlaVa~ SerGlyAla IleArgLeu HisIleSer Val
160 165 170
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
006PCT Sequence Listing.txt
gag atc aaa ggc gag gag aag gtg gcc ccg tac cat gtc cag tac acc 575
Glu Ile Lys G1y Glu Glu Lys Va1 Ala Pro Tyr His Val Gln Tyr Thr
175 180 185 190
tgt ctg cat gag aac ctg ttc cac ttc gtg acc gac gtg cag aac aat 623
Cys Leu His Glu Asn Leu Phe His Phe Val Thr Asp Val Gln Asn Asn
195 200 205
ggggtcgtg aagatccca gatgccaag ggtgacgat gcctggaag gtt 671
G1yValVa1 LysIlePro AspAlaLys G1yAspAsp AlaTrpLys Val
210 215 220
tactacgat gagacagcc caggagatt gtggacgag tttgccatg cgc 719
TyrTyrAsp GluThrAla GlnGluIle Va~IAspGlu PheAlaMet Arg
225 230 235
tacg9cgtc gagtccatc taccaagcc atgacccac tttgcctgc ctc 767
TyrGlyVal GluSerIle TyrGlnAla MetThrHis PheAlaCys Leu
240 245 250
tcctccaag tatatgtgc ccaggggtg cctgccgtc atgagcacc ctg 815
SerSerLys TyrMetCys ProG1yVa1 ProAlaVal MetSerThr Leu
255 260 265 270
ctcgccaac atcaatgcc tactacgca cacaccacc gcctccacc aac 863
LeuAlaAsn IleAsnAla TyrTyrAla HisThrThr AlaSerThr Asn
275 280 285
gtgtctgcc tccgaccgc ttcgccgcc tccaacttt gggaaagag cgc 911
Va1SerAla SerAspArg PheAlaAla SerAsnPhe GlyLysGlu Arg
290 295 300
ttcgtgaaa ctcctggac cagctgcat aactccctg cggattgac ctc 959
PheValLys LeuLeuAsp GlnLeuHis AsnSerLeu ArgIleAsp Leu
305 310 315
tccatgtac cggaataac ttcccagcc agcagcccg gagagactc cag 1007
SerMetTyr ArgAsnAsn PheProAla SerSerPro GluArgLeu Gln
320 325 330
gacctcaaa tccactgtg gaccttctc accagcatc accttcttt cgg 1055
AspLeuLys SerThrVal AspLeuLeu ThrSerIle ThrPhePhe Arg
335 340 345 350
atgaaggta caagaactc cagagcccg ccccgagcc agccaggtg gta 1103
MetLysVal GlnGluLeu GlnSerPro ProArgAla SerGlnVa1 Val
355 360 365
aaggactgt gt9aaagcc tgccttaat tctacctac gagtacatc ttc 1151
LysAspCys ValLysAla CysLeuAsn SerThrTyr GluTyrIle Phe
370 375 380
aataactgc catgaactg tacagccgg gagtaccag acagacccg gcc 1199
AsnAsnCys HisGluLeu TyrSerArg GluTyrGln ThrAspPro Ala
385 390 395
aagaagggg gaagttccc ccagaggaa caggggccc agcatcaag aac 1247
LysLysGly GluValPro ProGluGlu GlnGlyPro SerIleLys Asn
400 405 410
ctcgacttc tggtccaag ctgattacc ctcatagtg tccatcatt gag 1295
LeuAspPhe TrpSerLys LeuIleThr LeuIleVal SerIleIle Glu
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
006PCT Listing.txt
Sequence
415 420 425 430
gaagacaag aattcctac actccctgc ctcaaccag tttccccag gag 1343
GluAspLys AsnSerTyr ThrProCys LeuAsnGln PheProGln Glu
435 440 445
ctgaatgtg ggtaaaatc agcgetgaa gtgatgtgg aatctgttt gcc 1391
LeuAsnVa1 G1yLysIle SerAlaGlu Va1MetTrp AsnLeuPhe Ala
450 455 460
caagacatg aagtacgcc atggaggag cacgacaag catcgtcta tgc 1439
GlnAspMet LysTyrAla MetGluGlu HisAspLys HisArgLeu Cys
465 470 475
aagagtgcc gactacatg aacctccac ttcaaggtg aaatggctc tac 1487
LysSerAla AspTyrMet AsnLeuHis PheLysVal LysTrpLeu Tyr
480 485 490
aatgagtat gtgacggaa cttcccgcc ttcaaggac cgcgtgcct gag 1535
AsnGluTyr Va1ThrGlu LeuProAla PheLysAsp ArgValPro Glu
495 500 505 510
taccctgca tggtttgaa cccttcgtc atccagtgg ctggatgag aat 1583
TyrProAla TrpPheGlu ProPheVal IleGlnTrp LeuAspGlu Asn
515 520 525
gaggaggtg tcccgggat ttcctgcac ggtgccctg gagcgagac aag 1631
GluGluVal SerArgAsp PheLeuHis G1yAlaLeu GluArgAsp Lys
530 535 540
aaggatggg ttccagcag acctcagag catgcccta ttctcctgc tcc 1679
LysAspGly PheGlnGln ThrSerGlu HisAlaLeu PheSerCys Ser
545 550 555
gtggt gat gttttctcc caactcaac cagagcttt gaaatcatc aag 1727
ValVa~Asp ValPheSer GlnLeuAsn GlnSerPhe GluIleIle Lys
560 565 570
aaactcgag tgtcccgac cctcagatc gtggggcac tacatgagg cgc 1775
LysLeuGlu CysProAsp ProGlnIle Va1GlyHis TyrMetArg Arg
575 580 585 590
tttgccaag accatcagt aatgtgctc ctccagtat gcagacatc atc 1823
PheAlaLys ThrIleSer AsnValLeu LeuGlnTyr AlaAspIle Ile
595 600 605
tccaaggac tttgcctcc tactgctcc aaggagaag gagaaagtg ccc 1871
SerLysAsp PheAlaSer TyrCysSer LysGluLys GluLysVa1 Pro
610 615 620
tgcattctc atgaataac actcaacag ctacgagtt cagctggag aag 1919
CysIleLeu MetAsnAsn ThrGlnGln LeuArgVal GlnLeuGlu Lys
625 630 635
atgttcgaa gccatggga ggaaaggag ctggatget gaagccagt gac 1967
MetPheGlu AlaMetGly G1yLysGlu LeuAspAla GluAlaSer Asp
640 645 650
atcctgaag gagcttcag gtgaaactc aataacgtc ttggatgag ctc 2015
IleLeuLys GluLeuGln Va1LysLeu AsnAsnVal LeuAspGlu Leu
655 660 665 670
agccgggtg tttgetacc agcttccag ccgcacatt gaagagtgt gtc 2063
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
006PCT Listing.txt
Sequence
SerArgVal PheAlaThr SerPheGln ProHisIle GluGlu CysVal
675 680 685
aaacagatg ggtgacatc cttagccag gttaagggc acaggc aatgtg 2111
LysGlnMet GlyAspIle LeuSerGln ValLysG1y ThrG~lyAsnVal
690 695 700
ccagccagt gcctgcagc agcgtggcc caggacgcg gacaat gtgttg 2159
ProAlaSer AlaCysSer SerVa1Ala GlnAspAla AspAsn ValLeu
705 710 715
cagcccatc atggacctg ctggacagc aacctgacc ctcttt gccaaa 2207
GlnProIle MetAspLeu LeuAspSer AsnLeuThr LeuPhe AlaLys
720 725 730
atctgtgag aagactgtg ctgaagcga gtgctgaag gagctg tggaag 2255
IleCysGlu LysThrVal LeuLysArg Va1LeuLys GluLeu TrpLys
735 740 745 750
ctggttatg aacaccatg gagaaaacc atcgtcctg ccgccc ctcact 2303
LeuValMet AsnThrMet GluLySThr IleValLeu ProPro LeuThr
755 760 765
gaccagacg atgatcggg aacctcttg agaaaacat ggcaag ggatta 2351
AspGlnThr MetIleG1y AsnLeuLeu ArgLysHis G1yLys GlyLeu
770 775 780
gaaaagggc agggtgaaa ttgccaagc cactcagac ggaacc cagatg 2399
GluLysGly ArgVa1Lys LeuProSer HisSerAsp GlyThr GlnMet
785 790 795
atcttcaat gcagccaag gagctgggt cagctgtcc aaactc aaggat 2447
IlePheAsn AlaAlaLys GluLeuGly GlnLeuSer LysLeu LysAsp
800 805 810
cacatggta cgagaagaa gccaagagc ttgacccca aagcag tgcgcg 2495
HisMetVal ArgGluGlu AlaLysSer LeuThrPro LysGln CysAla
815 820 825 830
gttgttgag ttggccctg gacaccatc aagcaatat ttccac gcgggt 2543
ValValGlu LeuAlaLeu AspThrIle LysGlnTyr PheHis AlaGly
835 840 845
ggcgtgggc ctcaagaag accttcctg gagaagagc ccggac ctgcaa 2591
G1yVa~IGly LeuLysLys ThrPheLeu GluLysSer ProAsp LeuGln
850 855 860
tccttgcgc tatgccctg tcactctac acgcaggcc accgac ctgcta 2639
SerLeuArg TyrAlaLeu SerLeuTyr ThrGlnAla ThrAsp LeuLeu
865 870 875
atcaagacc tttgtacag acgcaatcg gcccagggc ttgggt gtagaa 2687
IleLysThr PheValGln ThrGlnSer AlaGlnG1y LeuG~IyValGlu
880 885 890
gaccctgtg ggtgaagtc tctgtccat gttgagctg ttcact catcca 2735
AspProVal GlyGluVal SerValHis ValGluLeu PheThr HisPro
895 900 905 910
Ggaactggg gaacacaag gtcacagtg aaagtggtg getgcc aatgac 2783
1y ThrGly GluHisLys ValThrVal LysVa1Va1 AlaAla AsnAsp
915 920 925
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
006PCT Listing.txt
Sequence
ctc aagtgg cagacttct ggcatc ttccggccgttc atcgaggtc aac 2831
Leu LysTrp GlnThrSer G1yIle PheArgProPhe IleGluVal Asn
930 935 940
atc attggg ccccagctc agcgac aagaaacgcaag tttgcgacc aaa 2879
Ile IleGly ProGlnLeu SerAsp LysLysArgLys PheAlaThr Lys
945 950 955
tcc aagaac aatagctgg getccc aagtacaatgag agcttccag ttc 2927
Ser LysAsn AsnSerTrp AlaPro LysTyrAsnGlu SerPheGln Phe
960 965 970
acg ctgagc gccgacgcg ggtccc gagtgctatgag ctgcaggtg tgc 2975
Thr LeuSer AlaAspAla G1yPro GluCysTyrGlu LeuGlnVal Cys
975 980 985 990
gtc aaggac tactgcttc gcgcgc gaggaccgcacg gtggggctg gcc 3023
Val LysAsp TyrCysPhe AlaArg GluAspArgThr Va1GlyLeu Ala
995 1000 1005
gtg ctgcag ctgcgtgag ctggcc cagcgcgggagc gccgcctgc tgg 3071
Val LeuGln LeuArgGlu LeuAla GlnArgG1ySer AlaAlaCys Trp
1010 1015 1020
ctg ccgctc ggccgccgc atccac atggacgacacg ggcctcacg gtg 3119
Leu ProLeu G1yArgArg IleHis MetAspAspThr G1yLeuThr V
~1a
1025 1030 1035
ctg cgaatc ctctcgcag cgcagc aacgacgaggtg gccaaggag ttc 3167
Leu ArgIle LeuSerGln ArgSer AsnAspGluVa~IAlaLysGlu Phe
1040 1045 1050
gtg aagctc aagtcggac acgcgc tccgccgaggag ggcggtgcc gcg 3215
Val LysLeu LysSerAsp ThrArg SerAlaGluGlu G1yG1yAla Ala
1055 1060 1065 1070
cct gcgcct tagcgcgggcggt cgg ca tgcgcctgc 3270
ccgagcgg c gcggagggcg
Pro AlaPro
c 3271
<210> 4
<211> 3264
<212> DNA
<213> Homo sapiens
<220>
<221> CDS
<222> (7)..(2181)
<400> 4
gggcag atg cca cgc aat tct g a get g9a tac g c tgc cca cac g9g 48
Met Pro Arg Asn Ser G~y Ala Gly Tyr G~y Cys Pro His Gly
1 5 10
gac ccc agc atg ctg gac agc aga gag acc cca cag gag agc cgg cag 96
Asp Pro Ser Met Leu Asp Ser Arg Glu Thr Pro Gln Glu Ser Arg Gln
15 20 25 30
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
006PCT Listing.txt
Sequence
gacatgatt gtgaggacc acccaagaa aaattgaaa accagctca ctg 144
AspMetIle ValArgThr ThrGlnGlu LysLeuLys ThrSerSer Leu
35 40 45
actgacagg cagccactc tccaaagag tccctgaac catgetctc gag 192
ThrAspArg GlnProLeu SerLysGlu SerLeuAsn HisAlaLeu Glu
50 55 60
ctctcagtg ccagagaag gtgaataat gcccagtgg gatgetcca gag 240
LeuSerVa1 ProGluLys ValAsnAsn AlaGlnTrp AspAlaPro Glu
65 70 75
gaggcgctg tggacgact cgggccgat gggcgggtg cgcctgcgc ata 288
GluAlaLeu TrpThrThr ArgAlaAsp GlyArgVa1 ArgLeuArg Ile
80 85 90
gaccccagc tgcccacag cttccctac actgtgcat cggatgttc tac 336
AspProSer CysProGln LeuProTyr ThrValHis ArgMetPhe Tyr
95 100 105 110
gaggccctg gataagtat ggggacctc atcgetttg ggcttcaag cgc 384
GluAlaLeu AspLysTyr G1yAspLeu IleAlaLeu G1yPheLys Arg
115 120 125
caggacaag tgggaacac atctcctac tcccaatac tacctgctc gcc 432
GlnAspLys TrpGluHis IleSerTyr SerGlnTyr TyrLeuLeu Ala
130 135 140
cgcagagcc gccaagggc ttcctgaag ctcggcctg aagcaggcc cac 480
ArgArgAla AlaLysG~lyPheLeuLys LeuG1yLeu LysGlnAla His
145 150 155
agtgtggcc atcctcggc ttcaactcc ccggagtgg ttcttctcg gca 528
SerVa1Ala IleLeuG1y PheAsnSer ProGluTrp PhePheSer Ala
160 165 170
gt g9caca gtatttgca g ggcatc gtcactg9c atctacacc acc 576
t
~
Va~GlyThr ValPheAla y GlyIle ValThrGly IleTyrThr Thr
G
175 180 185 190
agctcccca gaggcctgc cagtacatc gettatgac tgctgcgcc aat 624
SerSerPro GluAlaCys GlnTyrIle AlaTyrAsp CysCysAla Asn
195 200 205
gtcatcatg gtcgacacg cagaagcag ctggaaaag atcctgaag atc 672
ValIleMet ValAspThr GlnLysGln LeuGluLys IleLeuLys Ile
210 215 220
tggaaacag ttgccacat ctaaaggca gtcgt9ata tataaagaa cct 720
TrpLysGln LeuProHis LeuLysAla ValValIle TyrLysGlu Pro
225 230 235
cctccaaac aagatggcc aatgtgtac acgatggag gaattcatg gag 768
ProProAsn LysMetAla AsnValTyr ThrMetGlu GluPheMet Glu
240 245 250
ctggggaat gaagtgcct gaggaagcc ctggacgcc atcattgac acc 816
LeuG1yAsn GluVa1Pro GluGluAla LeuAspAla IleIleAsp Thr
255 260 265 270
cagcagccc aaccagtgc tgtgtgcta gtctacact tccggcacc act 864
GlnGlnPro AsnGlnCys CysValLeu ValTyrThr SerGlyThr Thr
275 280 285
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
006PCT sequence Listing.txt
gggaacccc aagggcgtg atgctgagt caagacaat atcacgtgg acg 912
G1yAsnPro LysG~IyVa1 MetLeuSer GlnAspAsn IleThrTrp Thr
290 295 300
gcacggtac ggcagccag gccggtgac atccggccg gcagaagtc cag 960
AlaArgTyr GlySerGln AlaG1yAsp IleArgPro AlaGluVal Gln
305 310 315
caggaggtg gtagtcagc tacctgccc ctcagccat attgccgcc cag 1008
GlnGluVa1 ValValSer TyrLeuPro LeuSerHis IleAlaAla Gln
320 325 330
atctacgac ctgtggaca ggcatccag tggggggcc caggtttgc ttt 1056
IleTyrAsp LeuTrpThr GlyIleGln TrpGlyAla GlnValCys Phe
335 340 345 350
gccgaaccc gacgccctg aaggggagc ctggtgaac acgctgcgg gag 1104
AlaGluPro AspAlaLeu LysG1ySer LeuVa1Asn ThrLeuArg Glu
355 360 365
gtggagccc acatcacac atgggggtg ccccgggta tgggagaag atc 1152
ValGluPro ThrSerHis MetG1yVa1 ProArgVal TrpGluLys Ile
370 375 380
atggagcgc atccaggag gtggcgget cagtctggc ttcatccgg cga 1200
MetGluArg IleGlnGlu Va1AlaAla GlnSerG1y PheIleArg Arg
385 390 395
aagatgctg ctgtgggcc atgtcggtg accttggag cagaacctc acc 1248
LysMetLeu LeuTrpAla MetSerVal ThrLeuGlu GlnAsnLeu Thr
400 405 410
tgccccggc agcgacctg aagcccttc acaaccaga ctggcagat tac 1296
CysProGly SerAspLeu LysProPhe ThrThrArg LeuAlaAsp Tyr
415 420 425 430
ctggtgcta gccaaggtt cgccaggca ctgggattt gccaagtgt caa 1344
LeuVa1Leu AlaLysVal ArgGlnAla LeuG1yPhe AlaLysCys Gln
435 440 445
aagaacttc tatggagcg gcccccatg atggcagag acacagcac ttc 1392
LysAsnPhe TyrG1yAla AlaProMet MetAlaGlu ThrGlnHis Phe
450 455 460
ttcctgggt ctcaacatc cgcttgtat gcgggctac ggcctcagt gag 1440
PheLeuGly LeuAsnIle ArgLeuTyr AlaG1yTyr G1yLeuSer Glu
465 470 475
acctcaggc ccccacttc atgtccagt ccctacaac taccggctg tac 1488
ThrSerGly ProHisPhe MetSerSer ProTyrAsn TyrArgLeu Tyr
480 485 490
agctcaggc aagttggtg cccggctgt cgggtgaag ctggtgaac cag 1536
SerSerG1y LysLeuVal ProGlyCys ArgValLys LeuValAsn Gln
495 500 505 510
gacgcagag ggcattggc gagatctgc ctgtggggc cgcaccata ttc 1584
AspAlaGlu G1yIleG1y GluIleCys LeuTrpG1y ArgThrIle Phe
515 520 525
atgg tac ctgaacatg gaggacaag acttgtgag gccatcgac gag 1632
c
MetG~yTyr LeuAsnMet GluAspLys ThrCysGlu AlaIleAsp Glu
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
006PCT sequence Listing.txt
530 535 540
gaaggctgg ctgcacacg ggtgatget ggccgcctg gacgccgat ggc 1680
GluGlyTrp LeuHisThr G1yAspAla G1yArgLeu AspAlaAsp G1y
545 550 555
ttcctctac atcactggg cgcctcaaa gaattaatc atcacaget ggt 1728
PheLeuTyr IleThrGly ArgLeuLys GluLeuIle IleThrAla Gly
560 565 570
ggggagaat gtgccccct gtgcccatc gaggaggcc gtgaagatg gag 1776
G1yGluAsn Va~1ProPro Va1ProIle GluGluAla Va1LysMet Glu
575 580 585 590
ctgcccatc atcagcaac gccatgctc attggggac cagaggaag ttc 1824
LeuProIle IleSerAsn AlaMetLeu IleG1yAsp GlnArgLys Phe
595 600 605
ctgtccatg ctgctcacc ttgaagtgc actctggac ccagacacc tct 1872
LeuSerMet LeuLeuThr LeuLysCys ThrLeuAsp ProAspThr Ser
610 615 620
gaccagact gataatctg actgaacaa getgtggag ttctgccag agg 1920
AspGlnThr AspAsnLeu ThrGluGln AlaVa1Glu PheCysGln Arg
625 630 635
gtgggcagc agagccacc acagtgtcc gagatcata gagaagaag gat 1968
Va1G1ySer ArgAlaThr ThrValSer GluIleIle GluLysLys Asp
640 645 650
gaggccgtg taccaggcc atcgaagag gggatccgg agggtcaac atg 2016
GluAlaVa1 TyrGlnAla IleGluGlu GlyIleArg ArgValAsn Met
655 660 665 670
aacgcggcg gcccggccc taccacatc cagaagtgg gccattctc gag 2064
AsnAlaAla AlaArgPro TyrHisIle GlnLysTrp AlaIleLeu Glu
675 680 685
agagacttc tccatttcg ggtggagag ttgggtccc acgatgaaa ctg 2112
ArgAspPhe SerIleSer G1yG~lyGlu LeuGlyPro ThrMetLys Leu
690 695 700
aaacggctc acagttttg gagaagtac aaaggtatc attgactcc ttt 2160
LysArgLeu ThrValLeu GluLysTyr LysGlyIle IleAspSer Phe
705 710 715
taccaagag caaaaaatg taatc ctatagaata 2213
agggcctatg
cctgcagttt
TyrGlnGlu GlnLysMet
720
gagggcaggc gttccgagcc tcttcctgag ccccaggtct cttcagtctg ggcacaggca 2273
tttctgccaagtctgttagatctccaggtcagggcacagcactggctctacatttaccag2333
gtcttacgccaacaatagctgacaattccaagaagcttcacgtgtgggtagttttaattc2393
agtttaagtattgctttttgttcaggtgacaaatgagatcagctctccttccagaacgaa2453
agggctgataatttttggccttagttccaggtagattaaaaagctgctagctcacataca2513
ggacagccagcagtaggctgtggagcgggtaggagagagatggctgatactgctcacgtg2573
cgctgcaggaaaagcaatcagtcacaactcacctagcgacctgacttactctggaatctt2633
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
006PCT Sequence Listing.txt
ggcgggcatcgccgaccctattattccattaccaggcactccgccacccacatgccaact2693
gacttgatgcttaataaaactgctgctgcctgtttgattctatttaatgtataatttgaa2753
tattaaaccttttaacagaactgtcaacaaggacctgattttttttgtcaattgagcagg2813
tgggaccagtgcagagagtagtgggcatttaactcacaggactgtgcacagcgggcatgc2873
gagtgaccattagtgccctggaataaacaaaggtgcaggatggggtcaagtggcgcattc2933
tcataaaagcagccagctctacgttagcctgtcgccaccagaccaccccacttccattct2993
gaatacgggaagcagccattctcagtagcaagctgagccaaaatgaccgaaggcatctga3053
acaggaaacaggtagagaaagcaaacatctcagttttggaattctttattactttgaacc3113
caagagccactgataactggcacaatccaatgaaacagaggaagcagcagcttaaacaaa3173
ggaaaatacatttaagattataagtttgggggggcggttacaagcttaaaaagtgaccca3233
gacagggatatccttgctaaaaaaaaaaaaa 3264
<210> 5
<211> 2385
<212> DNA
<213> Homo sapiens
<220>
<221> CDS
<222> (388)..(1827)
<400> 5
gctggacctcgattacgcct agcttggcacgaggtggcacgaggctggaa gaattcgcgg60
cgccggtcgctcttccgtcc ccgccgactccctccgatggcggcaccaag aggcccgggc120
tgcgggcgctgaagaagatg ggagtgtgaccactccaacaacgaccgtct agagggggct180
gagatcgaggagttcctgcg gcggctgctgaagcggccggagctggagga gatcttccat240
cagtactcgggcgaggaccg cgtgctgagtgcccctgagctgctggagtt cctggaggac300
cagggcgaggagggcgccac actggcccgcgcccagcagctcattcagac ctatgagctc360
aacgagacagccaagcagca tgagctgatg aca 411
ctg gat
ggc ttc
atg atg
Met Thr
Leu Asp
Gly Phe
Met Met
1 5
tac ctg tcg ccg gag ggg gcc ttg aac acc cac acg tgt 459
ttg get gac
Tyr Leu Ser Pro Glu Gly Ala Leu Asn Thr His Thr Cys
Leu Ala Asp
15 20
gtg ttc gac atg aac cag ctt gcc tac ttc atc tct tcc 507
cag ccc cac
Val Phe Asp Met Asn Gln Leu Ala Tyr Phe Ile Ser Ser
Gln Pro His
25 30 35 40
tcc cac acc tat ctg act tcc cag ggg ggg ccc agc agc 555
aac gac atc
Ser His Thr Tyr Leu Thr Ser Gln Gly Gly Pro Ser Ser
Asn Asp Ile
45 50 55
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
006PCT Sequence Listing.txt
accgaggcc tatgttagg gcctttgcc cagggatgc cgctgcgtg gag 603
ThrGluAla TyrValArg AlaPheAla GlnG1yCys ArgCysVal Glu
60 65 70
ctggactgc tgggagggg ccaggaggg gagcccgtc atctatcat ggc 651
LeuAspCys TrpGluGly ProG1yG1y GluProVal IleTyrHis G1y
75 80 85
cataccctc acctccaag attctcttc cgggacgt gtccaagcc gt 699
~
HisThrLeu ThrSerLys IleLeuPhe ArgAspVa ValGlnAla Va
90 95 100
cgcgaccat gccttcacg ctgtcccct taccctgtc atcctatcc ctg 747
ArgAspHis AlaPheThr LeuSerPro TyrProVal IleLeuSer Leu
105 110 115 120
gagaaccac tgcgggctg gagcagcag getgccatg gcccgccac ctc 795
GluAsnHis CysGlyLeu GluGlnGln AlaAlaMet AlaArgHis Leu
125 130 135
tgcaccatc ctgggggac atgctggtg acacaggcg ctggactcc cca 843
CysThrIle LeuG1yAsp MetLeuVa1 ThrGlnAla LeuAspSer Pro
140 145 150
aatcccgag gagctgcca tccccagag cagctgaag ggccgggtc ctg 891
AsnProGlu GluLeuPro SerProGlu GlnLeuLys G1yArgVal Leu
155 160 165
gtgaaggga aagaagctg cccgetget cggagcgag gatggccgg get 939
Va1LysG1y LysLysLeu ProAlaAla ArgSerGlu AspG1yArg Ala
170 175 180
ctgtcggat cgggaggag gaggaggag gatgacgag gaggaagaa gag 987
LeuSerAsp ArgGluGlu GluGluGlu AspAspGlu GluGluGlu Glu
185 190 195 200
gaggtggag getgcagcg cagaggcgg ctggccaag cagatctcc ccg 1035
GluVa1Glu AlaAlaAla GlnArgArg LeuAlaLys GlnIleSer Pro
205 210 215
gagctgtcg gccctgget gtgtactgc cacgccacc cgcctgcgg acc 1083
GluLeuSer AlaLeuAla Va~lTyrCys HisAlaThr ArgLeuArg Thr
220 225 230
ctgcaccct gcccccaac gccccacaa ccctgccag gtcagctcc ctc 1131
LeuHisPro AlaProAsn AlaProGln ProCysGln ValSerSer Leu
235 240 245
agcgagcgc aaagccaag aaactcatt cgggaggca gggaacagc ttt 1179
SerGluArg LysAlaLys LysLeuIle ArgGluAla GlyAsnSer Phe
250 255 260
gtcaggcac aatgcccgc cagctgacc cgcgt9tac ccgctgg9g ctg 1227
ValArgHis AsnAlaArg GlnLeuThr ArgValTyr ProLeuGly Leu
265 270 275 280
cggatgaac tcagccaac tacagtccc caggagatg tggaactcg ggc 1275
ArgMetAsn SerAlaAsn TyrSerPro GlnGluMet TrpAsnSer G1y
285 290 295
tgtcagctg gtggccttg aacttccag acgccaggc tacgagatg gac 1323
CysGlnLeu Va1AlaLeu AsnPheGln ThrProG1y TyrGluMet Asp
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
006PCT sequence Listing.txt
300 305 310
ctcaatgcc gggcgcttc ctagtcaat gggcagtgt ggctacgtc cta 1371
LeuAsnAla GlyArgPhe LeuValAsn GlyGlnCys GlyTyrVal Leu
315 320 325
aaacctgcc tgcctgcgg caacctgac tcgaccttt gaccccgag tac 1419
LysProAla CysLeuArg GlnProAsp SerThrPhe AspProGlu Tyr
330 335 340
ccaggacct cccagaacc actctcagc atccaggtg ctgactgca cag 1467
ProGlyPro ProArgThr ThrLeuSer IleGlnVal LeuThrAla Gln
345 350 355 360
cagctgccc aagctgaat gccgagaag ccacactcc attgtggac ccc 1515
GlnLeuPro LysLeuAsn AlaGluLys ProHisSer IleValAsp Pro
365 370 375
ctggtgcgc attgagatc catggggtg cccgcagac tgtgcccgg cag 1563
LeuValArg IleGluIle HisGlyVal ProAlaAsp CysAlaArg Gln
380 385 390
gagactgac tacgtgctc aacaatggc ttcaacccc cgctggggg cag 1611
GluThrAsp TyrVa1Leu AsnAsnG1y PheAsnPro ArgTrpG1y Gln
395 400 405
accctgcag ttccagctg cgggetccg gagctggca ctggtccgg ttt 1659
ThrLeuGln PheGlnLeu ArgAlaPro GluLeuAla LeuValArg Phe
410 415 420
gt9gt gaa gattatgac gccacctcc cccaatgac tttgt9g cag 1707
c
~
ValVa~Glu AspTyrAsp AlaThrSer ProAsnAsp PheValG Gln
y
425 430 435 440
tttacactg cctcttagc agcctaaag caag9gtac cgccacata cac 1755
PheThrLeu ProLeuSer SerLeuLys GlnGlyTyr ArgHisIle His
445 450 455
ctgctttcc aaggacggg gcctcactg tcaccagcc acgctcttc atc 1803
LeuLeuSer LysAspGly AlaSerLeu SerProAla ThrLeuPhe Ile
460 465 470
caaatccgc atccagcgc tcctgagggcccacct cactcgcctt 1857
ggggttctgc
GlnIleArg IleGlnArg Ser
475
gagtgccagtccacatcccctgcagagccctctcctcctctggagtcaggtggtgggagt1917
accagccccccagcccacccacttggcccactcagcccattcaccaggcgctggtctcac1977
ctgggtgctgagggctgcctgggcccctcctgaagaacagaaaggtgttcatgtgacttc2037
agtgagctccaaccctggggccctgagatggccccagctcctcttgtcctcagcccaccc2097
ctcattgtgacttatgaggagcaagcctgttgctgccaggagacttggggagcaggacac2157
ttgtgggccctcagttcccctctgtcctcccgtgggccatcccagcctccttcccccaga2217
ggagcgcagtcactccacttggccccgaccccgagcttagcccctaagcc ctcctttacc2277
ccaggccttcctggactcctccctccagctccggaacctgagctcccctt cccttctcaa2337
agcaagaagggagcgctgaggcatgaagccctggggaaactggcagta 2385
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
006PCT Sequence Listing.txt
<210> 6
<211> 3509
<212> DNA
<213> Homo Sapiens
<220>
<221> CDS
<222> (Z48)..(1558)
<400> 6
cgccaagaag agcaggaaga ccgaatgctagcggc ggtgcggcct
gttcagggcc 60
gccgg
ggggcctgag ccggctgtgt gagcccgtggtgaag ctgtactacc
gggaagaggc 120
tctgc
agtggctgag gacgtgctca gatgcctggcaagac ggcgcggtgc
tgcagatcgg 180
acgtg
cgatgttaag tacaaggtgg aacccgcccgccttc accgaactgc
agttgccgcg 240
agcgc
ctacatc atg t tgc c 289
gcc gt ccc gaa
g9g aaa ttt
ttc ctc
cc agc
ct
Met Cys Leu u
Ala Pro Ser Glu
Gly Lys Le Phe
Phe
Pro
Va~
1 5 10
ggggatccc gccagctcc cttttc cgctggtat aaggaagccaag ccc 337
G1yAspPro AlaSerSer LeuPhe ArgTrpTyr LysGluAlaLys Pro
15 20 25 30
ggagcggcg gagcccgag gtcggt gtcccctcg tcattgtctccc tcc 385
GlyAlaAla GluProGlu ValG~lyValProSer SerLeuSerPro Ser
35 40 45
tcaccttct tcttcttgg actgag actgatgtg gaggagcgtgtc tac 433
SerProSer SerSerTrp ThrGlu ThrAspVal GluGluArgVal Tyr
50 55 60
accccgtcc aatgccgac atcggg ctaaggctc aagcttcactgc acc 481
ThrProSer AsnAlaAsp IleGly LeuArgLeu LysLeuHisCys Thr
65 70 75
ccaggcgat gggcagcgc tttggg cacagccgg gagttggaaagt gtg 529
ProG1yAsp GlyGlnArg PheG1y HisSerArg GluLeuGluSer V 1a
80 85 90
tgtgtggta gaggetggg cctggc acctgcact tttgaccaccgg cat 577
CysVa1Val GluAlaG~lyProG~lyThrCysThr PheAspHisArg His
95 100 105 110
ctctacacg aagaaggt9 actgag gacgetctc atccgcactgtc tct 625
LeuTyrThr LysLysVal ThrGlu AspAlaLeu IleArgThrVal Ser
115 120 125
tacaacatc ctggcagac acgtac gcgcagact gagttctcgcga acg 673
TyrAsnIle LeuAlaAsp ThrTyr AlaGlnThr GluPheSerArg Thr
130 135 140
gttctgtac ccatactgt gccccc tacgccctg gagctcgactac cgc 721
ValLeuTyr ProTyrCys AlaPro TyrAlaLeu GluLeuAspTyr Arg
145 150 155
cagaacctt atccagaag gaactc accggctac aacgccgatgtc atc 769
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
006PCT Listing.txt
Sequence
GlnAsnLeu IleGlnLys GluLeuThr GlyTyrAsn AlaAsp ValIle
160 165 170
tgtttgcag gaggttgac cgcgcagtg ttttctgac agcttg gtaccc 817
CysLeuGln GluValAsp ArgAlaVa1 PheSerAsp SerLeu ValPro
175 180 185 190
gccctagag gccttcggg ctcgagggg gtgtttcga atcaag cagcac 865
AlaLeuGlu AlaPheG1y LeuGluG1y Va1PheArg IleLys GlnHis
195 200 205
gaag9cctg gccactttc taccgaaag tctaagttc agcctt cttagc 913
GluGlyLeu AlaThrPhe TyrArgLys SerLysPhe SerLeu LeuSer
210 215 220
cagcatgac atttcattc tacgaagcc ctcgagtcc gaccca cttcac 961
GlnHisAsp IleSerPhe TyrGluAla LeuGluSer AspPro LeuHis
225 230 235
aaagaactg ctggagaaa ctagttttg tacccatca gcgcag gagaag 1009
LysGluLeu LeuGluLys LeuValLeu TyrProSer AlaGln GluLys
240 245 250
gtgctccag agatcttct gttcttcag gtttcagtt cttcag tctaca 1057
ValLeuGln ArgSerSer ValLeuGln ValSerVal LeuGln SerThr
255 260 265 270
aaggactct tctaaaagg atatgtgtt getaatacc catctt tactgg 1105
LysAspSer SerLysArg IleCysVal AlaAsnThr HisLeu TyrTrp
275 280 285
catcctaaa ggtgggtat attcgcctc attcaaatg gcagta gccttg 1153
HisProLys GlyGlyTyr IleArgLeu IleGlnMet AlaVal AlaLeu
290 295 300
getcacata agacatgtt tcatgtgat ctgtatcct ggcata ccagtt 1201
AlaHisIle ArgHisVal SerCysAsp LeuTyrPro GlyIle ProVal
305 310 315
atattttgt ggggacttt aatagtaca ccatcaaca ggaatg tatcat 1249
IlePheCys GlyAspPhe AsnSerThr ProSerThr GlyMet TyrHis
320 325 330
tttgtcatc aatggcagc attccagag gatcatgaa gactgg gettcc 1297
PheValIle AsnG1ySer IleProGlu AspHisGlu AspTrp AlaSer
335 340 345 350
aatggggag gaggaaaga tgcaatatg tctcttaca catttc ttcaag 1345
AsnG1yGlu GluGluArg CysAsnMet SerLeuThr HisPhe PheLys
355 360 365
ctgaaaagt gettgtggt gaacctget tacacaaat tatgtt g ggc 1393
t
LeuLysSer AlaCysGly GluProAla TyrThrAsn TyrVal G~yGly
370 375 380
tttcatgga tgtctagat tacattttc attgactta aatget ttagag 1441
PheHisGly CysLeuAsp TyrIlePhe IleAspLeu AsnAla LeuGlu
385 390 395
gttgaacag gtgattcca ttacctagt catgaagaa gttacc acccac 1489
ValGluGln ValIlePro LeuProSer HisGluGlu ValThr ThrHis
400 405 410
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
006PCT Listing.txt
Sequence
cag gcc cct agt ccc tct cac ata 1537
tta gtt tcc gat gca ctt
cat gta
Gln Ala Pro Ser Pro Ser His Ile
Leu Val Ser Asp Ala Leu
His Val
415 420 425 430
tgt gat aaa tgg tgtgtttaa 1590
tta aaa tag tggaattgaa
at g gtctgaaaag
Cys Asp Lys Trp
Leu Lys
435
gaagtagttattttagcagaaaatttaatatgaatcaaagcttatatgtaaacttcaagg1650
aggaatggtaaaatgttcagccctcctagttatgttcctgatgtcttcgttatgaaactg1710
ttgatgtttgcatcatacatcttctctttccttgttttcctctacaattggaggagaaac1770
aaatatatttcttactagcaaaatagaaaattgaattatttttctccaaattgagactct1830
cagaaaaggaagattgaattagcgtgttttttgtttgtttgtttttgtttttgtttttgt1890
ttttttgagatggagtttcactcttgttgcccaggctggagtgcaatggcacaatctcgg1950
ctcactgcaacctccgccccctgggtttaagcgattctcctgcctcagcttcccgagtag2010
ctgggattacaggcatgcgccaacatgtctggctaatttttgtatttttagtagaaatgg2070
ggtttcgccacgttggccaggctggtcttgaactcctgacctcaggtgatccacccacct2130
cggcctcccaaagtgttgggattacaggcgtgagccaccgcacccggcccttgtgtacat2190
ttttataagagaatttttttagctaggagttcagaatttttaaagtaccatttgaatgat2250
cttaatttttctttcatgacaacacattccaaaatgaatcatgcttatgtactaagaggg2310
aaaatgtatttaagttaagggtgagagacttaagttataggtgaccttagagacctaagg2370
tgagagacttgacacatggaaggagtaacattagggtctacctctacctcaatttagtta2430
gcgatttactacaatttcagagctttaacaaaagataaaaataaatcgtcaccaattgtt2490
attgcttctcatctttcatttttcaatgaacaagtaaggtattttcattcttatttttag2550
gattttagtttttagtgtatggtacaaatgaacacagtttatattctaattcttactgca2610
gctcattttaatttttaggatgcaagcacaatttagtattcaaagtgagtagcaacatat2670
tcaacttgatcccattgtcttcagttactcttgcccatgaaaaatgttcataaatgaaca2730
gggtatttgaccatatgatattagaaaatacagcacattactttatgagaaactacctac2790
tgatatgggcttgaaattttggatgaatcattgagcatttctacactagaagtaatttca2850
aaattgttggtttttataaacaggaaaaaggttgagtagtgggacttttaagcatctctg2910
aaataaaaaacttctttttacagacaagcattatagtttgagttacagacaacagtgtgt2970
atatatgtaatatatatatagtaaaatgaaatttaaatatgaagccaaactttttaaaat3030
tagaaactacaaatggttatactgattagtgtctagcctagagtggtaaccatgctttac3090
taattcagttatgaaatacattatttataatgcattagctgtattagctgttgctttttt3150
gatgttcaggataactatgttatctcatttctgcatttaattaatagctcgagtattaaa3210
agcccactcccttcaagaaaagctttgattttccccagtcatgaaagcccttgtttcaaa3270
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
006PCT Listing.txt
Sequence
ttctttaatctctgaacctagtatcataagaatttcctcttttgataacatctgtacttt3330
catattctgctcactatcaaatgtattgttaacacttagtaagtttgaaaatgaaggggt3390
tttatctgcatttgacattgaaccttgaagtactttaagtactccaaggggaaaattaaa3450
gtggaagtttcttcggatcttgtttagaaaaaactataaataaaaaattgatgctaaaa 3509
<210> 7
<211> 545
<212> PRT
<213> Homo Sapiens
<400> 7
Met Asn Leu Thr Glu Gly Pro Leu Ala Met Ala Glu Met Asp Pro Thr
1 5 10 15
Gln Gly Arg Val Val Phe Glu Asp Val Ala Ile Tyr Phe Ser Gln Glu
20 25 30
Glu Trp Gly His Leu Asp Glu Ala Gln Arg Leu Leu Tyr Arg Asp Val
35 40 45
Met Leu Glu Asn Leu Ala Leu Leu Ser Ser Leu Gly Ser Trp His Gly
50 55 60
Ala Glu Asp Glu Glu Ala Pro Ser Gln Gln Gly Phe Ser Val Gly Val
65 70 75 80
Ser Glu Val Thr Thr Ser Lys Pro Cys Leu Ser Ser Gln Lys Val His
85 90 95
Pro Ser Glu Thr Cys Gly Pro Pro Leu Lys Asp Ile Leu Cys Leu Val
100 105 110
Glu His Asn Gly Ile His Pro Glu Gln His Ile Tyr Ile Cys Glu Ala
115 120 125
Glu Leu Phe Gln His Pro Lys Gln Gln Ile Gly Glu Asn Leu Ser Arg
130 135 140
Gly Asp Asp Trp Ile Pro Ser Phe Gly Lys Asn His Arg Val His Met
145 150 155 160
Ala Glu Glu Ile Phe Thr Cys Met Glu Gly Trp Lys Asp Leu Pro Ala
165 170 175
Thr Ser Cys Leu Leu Gln His Gln Gly Pro Gln Ser Glu Trp Lys Pro
180 185 190
Tyr Arg Asp Thr Glu Asp Arg Glu Ala Phe Gln Thr Gly Gln Asn Asp
195 200 205
Tyr Lys Cys Ser Glu Cys Gly Lys Thr Phe Thr Cys Ser Tyr Ser Phe
210 215 220
Val Glu His Gln Lys Ile His Thr Gly Glu Arg Ser Tyr Glu Cys Asn
225 230 235 240
Lys Cys Gly Lys Phe Phe Lys Tyr Ser Ala Asn Phe Met Lys His Gln
245 250 255
Thr Val His Thr Ser Glu Arg Thr Tyr Glu Cys Arg Glu Cys Gly Lys
260 265 270
Ser Phe Met Tyr Asn Tyr Arg Leu Met Arg His Lys Arg Val His Thr
275 280 285
Gly Glu Arg Pro Tyr Glu Cys Asn Thr Cys Gly Lys Phe Phe Arg Tyr
290 295 300
Ser Ser Thr Phe Val Arg His Gln Arg Val His Thr Gly Glu Arg Pro
305 310 315 320
Tyr Glu Cys Arg Glu Cys Gly Lys Phe Phe Met Asp Ser Ser Thr Leu
325 330 335
Ile Lys His Gln Arg Val His Thr Gly Glu Arg Pro Tyr Lys Cys Asn
340 345 350
Asp Cys Gly Lys Phe Phe Arg Tyr Ile Ser Thr Leu Ile Arg His Gln
355 360 365
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
006PCT Sequence Listing.txt
Arg Ile His Thr Gly Glu Arg Pro Tyr Glu Cys Ser Val Cys Gly Glu
370 375 380
Leu Phe Arg Tyr Asn Ser Ser Leu Val Lys His Trp Arg Asn His Thr
385 390 395 400
Gly Glu Arg Pro Tyr Lys Cys Ser Glu Cys Gly Lys Ser Phe Arg Tyr
405 410 415
His Cys Arg Leu Ile Arg His Gln Arg Val His Thr Gly Glu Arg Pro
420 425 430
Tyr Glu Cys Ser Glu Cys Gly Lys Phe Phe Arg Tyr Asn Ser Asn Leu
435 440 445
Ile Lys His Trp Arg Asn His Thr Gly Glu Arg Pro Tyr Glu Cys Arg
450 455 460
Glu Cys Gly Lys Ala Phe Ser His Lys His Ile Leu Val Glu His Gln
465 470 475 480
Lys Ile His Ser Gly Glu Arg Pro Tyr Glu Cys Ser Glu Cys Gln Lys
485 490 495
Ala Phe Ile Arg Lys Ser His Leu Val His His Gln Lys Ile His Ser
500 505 510
Glu Glu Arg Leu Val Cys Ser Met Asn Val Gly Asn Ser Leu Ala Lys
515 520 525
Thr Pro Thr Ser Leu Asn Ile Arg Asp Phe Thr Met Glu Lys Val Tyr
530 535 540
His
545
<210> 8
<211> 299
<212> PRT
<213> Homo Sapiens
<400> 8
Met Glu Pro Pro Ile Pro Gln Ser Ala Pro Leu Thr Pro Asn Ser Val
1 5 10 15
Met Val Gln Pro Leu Leu Asp Ser Arg Met Ser His Ser Arg Leu Gln
20 25 30
His Pro Leu Thr Ile Leu Pro Ile Asp Gln Val Lys Thr Ser His Val
35 40 45
Glu Asn Asp Tyr Ile Asp Asn Pro Ser Leu Ala Leu Thr Thr Gly Pro
50 55 60
Lys Arg Thr Arg Gly Gly Ala Pro Glu Leu Ala Pro Thr Pro Ala Arg
65 70 75 80
Cys Asp Gln Asp Val Thr His His Trp Ile Ser Phe Ser Gly Arg Pro
85 ' 90 95
Ser Ser Val Ser Ser Ser Ser Ser Thr Ser Ser Asp Gln Arg Leu Leu
100 105 110
Asp His Met Ala Pro Pro Pro Val Ala Asp Gln Ala Ser Pro Arg Ala
115 120 125
Val Arg Ile Gln Pro Lys Val Val His Cys Gln Pro Leu Asp Leu Lys
130 135 140
Gly Pro Ala Val Pro Pro Glu Leu Asp Lys His Phe Leu Leu Cys Glu
145 150 155 160
Ala Cys Gly Ly5 Cys Lys CyS Lys Glu Cys Ala Ser Pro Arg Thr Leu
165 170 175
Pro Ser Cys Trp Val Cys Asn Gln Glu Cys Leu Cys Ser Ala Gln Thr
180 185 190
Leu Val Asn Tyr Gly Thr Cys Met Cys Leu Val Gln Gly Ile Phe Tyr
195 200 205
His Cys Thr Asn Glu Asp Asp Glu Gly Ser Cys Ala Asp His Pro Cys
210 215 220
Ser Cys Ser Arg Ser Asn Cys Cys Ala Arg Trp Ser Phe Met Gly Ala
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
006PCT Sequence Listing.txt
225 230 235 240
Leu Ser Val Val Leu Pro Cys Leu Leu Cys Tyr Leu Pro Ala Thr Gly
245 250 255
Cys Val Lys Leu Ala Gln Arg Gly Tyr Asp Arg Leu Arg Arg Pro Gly
260 265 270
Cys Arg Cys Lys His Thr Asn Ser Val Ile Cys Lys Ala Ala Ser Gly
275 280 285
Asp Ala Lys Thr Ser Arg Pro Asp Lys Pro Phe
290 295
<210> 9
<211> 1073
<212> PRT
<213> Homo sapiens
<400> 9
Met Lys Ile Arg Glu Arg Asn Lys Pro Glu Ile Phe Glu Leu Ile Gln
1 5 10 15
Glu Ile Phe Ala Val Thr Lys Thr Ala His Thr Gln Gln Met Lys Ala
20 25 30
Val Lys Gln Ser Val Leu Asp Gly Thr Ser Lys Trp Ser Ala Lys Ile
35 40 45
Ser Ile Thr Val Val Cys Ala Gln Gly Leu Gln Ala Lys Asp Lys Thr
50 55 60
Gly Ser Ser Asp Pro Tyr Val Thr Val Gln Val Gly Lys Thr Lys Lys
65 70 75 80
Arg Thr Lys Thr Ile Tyr Gly Asn Leu Asn Pro Val Trp Glu Glu Asn
85 90 95
Phe His Phe Glu Cys His Asn Ser Ser Asp Arg Ile Lys Val Arg Val
100 105 110
Trp Asp Glu Asp Asp Asp Ile Lys Ser Arg Val Lys Gln Arg Phe Lys
115 120 ~ 125
Arg Glu Ser Asp Asp Phe Leu Gly Gln Thr Ile Ile Glu Val Arg Thr
130 135 140
Leu Ser Gly Glu Met Asp Val Trp Tyr Asn Leu Asp Lys Arg Thr Asp
145 150 155 160
Lys Ser Ala Val Ser Gly Ala Ile Arg Leu His Ile Ser Val Glu Ile
165 170 175
Lys Gly Glu Glu Lys Val Ala Pro Tyr His Val Gln Tyr Thr Cys Leu
180 185 190
His Glu Asn Leu Phe His Phe Val Thr Asp Val Gln Asn Asn Gly Val
195 200 205
Val Lys Ile Pro Asp Ala Lys Gly Asp Asp Ala Trp Lys Val Tyr Tyr
210 215 220
Asp Glu Thr Ala Gln Glu Ile Val Asp Glu Phe Ala Met Arg Tyr Gly
225 230 235 240
Val Glu Ser Ile Tyr Gln Ala Met Thr His Phe Ala Cys Leu Ser Ser
245 250 255
Lys Tyr Met Cys Pro Gly Val Pro Ala Val Met Ser Thr Leu Leu Ala
260 265 270
Asn Ile Asn Ala Tyr Tyr Ala His Thr Thr Ala Ser Thr Asn Val Ser
275 280 285
Ala Ser Asp Arg Phe Ala Ala Ser Asn Phe Gly Lys Glu Arg Phe Val
290 295 300
Lys Leu Leu Asp Gln Leu His Asn Ser Leu Arg Ile Asp Leu Ser Met
305 310 315 320
Tyr Arg Asn Asn Phe Pro Ala Ser Ser Pro Glu Arg Leu Gln Asp Leu
325 330 335
Lys Ser Thr Val Asp Leu Leu Thr Ser Ile Thr Phe Phe Arg Met Lys
340 345 350
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
006PCT Listing.txt
Sequence
ValGlnGlu LeuGlnSer ProProArg A1aSerGln ValValLys Asp
355 360 365
CysValLys AlaCysLeu AsnSerThr TyrGluTyr IlePheAsn Asn
370 375 380
CysHisGlu LeuTyrSer ArgGluTyr GlnThrAsp ProAlaLys Lys
385 390 395 400
GlyGluVal ProProGlu GluGlnGly ProSerIle LysAsnLeu Asp
405 410 415
PheTrpSer LysLeuIle ThrLeuIle ValSerIle IleGluGlu Asp
420 425 430
LysAsnSer TyrThrPro CysLeuAsn GlnPhePro GlnGluLeu Asn
435 440 445
ValGlyLys IleSerAla GluValMet TrpAsnLeu PheAlaGln Asp
450 455 460
MetLysTyr AlaMetGlu GluHisAsp LysHisArg LeuCysLys Ser
465 470 475 480
AlaAspTyr MetAsnLeu HisPheLys ValLysTrp LeuTyrAsn Glu
485 490 495
TyrValThr GluLeuPro AlaPheLys AspArgVal ProGluTyr Pro
500 505 510
AlaTrpPhe GluProPhe ValIleGln TrpLeuAsp GluAsnGlu Glu
515 520 525
ValSerArg AspPheLeu HisGlyAla LeuGluArg AspLysLys Asp
530 535 540
GlyPheGln GlnThrSer GluHisAla LeuPheSer CysSerVal Val
545 550 555 560
AspValPhe SerGlnLeu AsnGlnSer PheGluIle IleLysLys Leu
565 570 575
GluCysPro AspProGln IleValGly HisTyrMet ArgArgPhe Ala
580 585 590
LysThrIle SerAsnVal LeuLeuGln TyrAlaAsp IleIleSer Lys
595 600 605
AspPheAla SerTyrCys SerLysGlu LysGluLys ValProCys Ile
610 615 620
LeuMetAsn AsnThrGln GlnLeuArg ValGlnLeu GluLysMet Phe
625 630 635 640
GluAlaMet GlyGlyLys GluLeuAsp AlaGluAla SerAspIle Leu
645 650 655
LysGluLeu GlnValLys LeuAsnAsn ValLeuAsp GluLeuSer Arg
660 665 670
ValPheAla ThrSerPhe GlnProHis IleGluGlu CysValLys Gln
675 680 685
MetGlyAsp IleLeuSer GlnValLys GlyThrGly AsnValPro Ala
690 695 700
SerAlaCys SerSerVal AlaGlnAsp AlaAspAsn ValLeuGln Pro
705 710 715 720
IleMetAsp LeuLeuAsp SerAsnLeu ThrLeuPhe AlaLysIle Cys
725 730 735
GluLysThr ValLeuLys ArgValLeu LysGluLeu TrpLysLeu Val
740 745 750
MetAsnThr MetGluLys ThrIleVal LeuProPro LeuThrAsp Gln
755 760 765
ThrMetIle GlyAsnLeu LeuArgLys HisGlyLys GlyLeuGlu Lys
770 775 780
GlyArgVal LysLeuPro SerHisSer AspGlyThr GlnMetIle Phe
785 790 795 800
AsnAlaAla LysGluLeu GlyGlnLeu SerLysLeu LysAspHis Met
805 810 815
ValArgGlu GluAlaLys SerLeuThr ProLysGln CysAlaVal Val
820 825 830
GluLeuAla LeuAspThr IleLysGln TyrPheHis AlaGlyGly Val
835 840 845
GlyLeuLys LysThrPhe LeuGluLys SerProAsp LeuGlnSer Leu
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
006PCT Sequence Listing.txt
850 855 860
Arg Tyr Ala Leu Ser Leu Tyr Thr Gln Ala Thr Asp Leu Leu Ile Lys
865 870 875 880
Thr Phe Val Gln Thr Gln Ser Ala Gln Gly Leu Gly Val Glu Asp Pro
885 890 895
Val Gly Glu Val Ser Val His Val Glu Leu Phe Thr His Pro Gly Thr
900 905 910
Gly Glu His Lys Val Thr Val Lys Val Val Ala Ala Asn asp Leu Lys
915 920 925
Trp Gln Thr Ser Gly Ile Phe Arg Pro Phe Ile Glu Val Asn Ile Ile
930 935 940
Gly Pro Gln Leu Ser Asp Lys Lys Arg Lys Phe Ala Thr Lys Ser Lys
945 950 955 960
Asn Asn Ser Trp Ala Pro Lys Tyr Asn Glu Ser Phe Gln Phe Thr Leu
965 970 975
Ser Ala Asp Ala Gly Pro Glu Cys Tyr Glu Leu Gln Val Cys Val Lys
980 985 990
Asp Tyr Cys Phe Ala Arg Glu Asp Arg Thr Val Gly Leu Ala Val Leu
995 1000 1005
Gln Leu Arg Glu Leu Ala Gln Arg Gly Ser Ala Ala Cys Trp Leu Pro
1010 1015 1020
Leu Gly Arg Arg Ile His Met Asp Asp Thr Gly Leu Thr Val Leu Arg
1025 1030 1035 1040
Ile Leu Ser Gln Arg Ser Asn Asp Glu Val Ala Lys Glu Phe Val Lys
1045 1050 1055
Leu Lys Ser Asp Thr Arg Ser Ala Glu Glu Gly Gly Ala Ala Pro Ala
1060 1065 1070
Pro
<210> 10
<211> 724
<212> PRT
<213> Homo Sapiens
<400> 10
Met Pro Arg Asn Ser Gly Ala Gly Tyr Gly Cys Pro His Gly Asp Pro
1 5 10 15
Ser Met Leu Asp Ser Arg Glu Thr Pro Gln Glu Ser Arg Gln Asp Met
20 25 30
Ile Val Arg Thr Thr Gln Glu Lys Leu Lys Thr Ser Ser Leu Thr Asp
35 40 45
Arg Gln Pro Leu Ser Lys Glu Ser Leu Asn His Ala Leu Glu Leu Ser
50 55 60
Val Pro Glu Lys Val Asn Asn Ala Gln Trp Asp Ala Pro Glu Glu Ala
65 70 75 80
Leu Trp Thr Thr Arg Ala Asp Gly Arg Val Arg Leu Arg Ile Asp Pro
85 90 95
Ser Cys Pro Gln Leu Pro Tyr Thr Val His Arg Met Phe Tyr Glu Ala
100 105 110
Leu Asp Lys Tyr Gly Asp Leu Ile Ala Leu Gly Phe Lys Arg Gln Asp
115 120 125
Lys Trp Glu His Ile Ser Tyr Ser Gln Tyr Tyr Leu Leu Ala Arg Arg
130 135 140
Ala Ala Lys Gly Phe Leu Lys Leu Gly Leu Lys Gln Ala His Ser Val
145 150 155 160
Ala Ile Leu Gly Phe Asn Ser Pro Glu Trp Phe Phe Ser Ala Val Gly
165 170 175
Thr Val Phe Ala Gly Gly Ile Val Thr Gly Ile Tyr Thr Thr Ser Ser
180 185 190
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
006PCT Sequence Listing.txt
Pro Glu Ala Cys Gln Tyr Ile Ala Tyr Asp Cys Cys Ala Asn Val Ile
195 200 205
Met Val Asp Thr Gln Lys Gln Leu Glu Lys Ile Leu Lys Ile Trp Lys
210 215 220
Gln Leu Pro His Leu Lys Ala Val Val Ile Tyr Lys Glu Pro Pro Pro
225 230 23S 240
Asn Ly5 Met Ala Asn Val Tyr Thr Met Glu Glu Phe Met Glu Leu Gly
245 250 255
Asn Glu Val Pro Glu Glu Ala Leu Asp Ala Ile Ile Asp Thr Gln Gln
260 265 270
Pro Asn Gln Cys Cys Val Leu Val Tyr Thr Ser Gly Thr Thr Gly Asn
275 280 285
Pro Lys Gly Val Met Leu Ser Gln Asp Asn Ile Thr Trp Thr Ala Arg
290 295 300
Tyr Gly Ser Gln Ala Gly Asp Ile Arg Pro Ala Glu Val Gln Gln Glu
305 310 315 320
Val Val val Ser Tyr Leu Pro Leu ser His Ile Ala Ala Gln Ile Tyr
325 330 335
Asp Leu Trp Thr Gly Ile Gln Trp Gly Ala Gln Val Cys Phe Ala Glu
340 345 350
Pro Asp Ala Leu Lys Gly Ser Leu Val Asn Thr Leu Arg Glu Val Glu
355 360 ~ 365
Pro Thr Ser His Met Gly Val Pro Arg Val Trp Glu Lys Ile Met Glu
370 375 380
Arg Ile Gln Glu Val Ala Ala Gln Ser Gly Phe Ile Arg Arg Lys Met
385 390 395 400
Leu Leu Trp Ala Met Ser Val Thr Leu Glu Gln Asn Leu Thr Cys Pro
405 410 415
Gly Ser Asp Leu Lys Pro Phe Thr Thr Arg Leu Ala Asp Tyr Leu Val
420 425 430
Leu Ala Ly5 Val Arg Gln Ala Leu Gly Phe Ala Lys Cys Gln Lys Asn
435 440 445
Phe Tyr Gly Ala Ala Pro Met Met Ala Glu Thr Gln His Phe Phe Leu
450 455 460
Gly Leu A5n Ile Arg Leu Tyr Ala Gly Tyr Gly Leu Ser Glu Thr Ser
465 470 475 480
Gly Pro His Phe Met Ser Ser Pro Tyr Asn Tyr Arg Leu Tyr Ser Ser
485 490 495
Gly Lys Leu Val Pro Gly Cys Arg Val Lys Leu Val Asn Gln Asp Ala
500 505 510
Glu Gly Ile Gly Glu Ile Cys Leu Trp Gly Arg Thr Ile Phe Met Gly
515 520 525
Tyr Leu Asn Met Glu Asp Lys Thr Cys Glu Ala Ile Asp Glu Glu Gly
530 535 540
Trp Leu His Thr Gly Asp Ala Gly Arg Leu Asp Ala Asp Gly Phe Leu
545 550 555 560
Tyr Ile Thr Gly Arg Leu Lys Glu Leu Ile Ile Thr Ala Gly Gly Glu
565 570 575
Asn Val Pro Pro Val Pro Ile Glu Glu Ala Val Lys Met Glu Leu Pro
580 585 590
Ile Ile Ser Asn Ala Met Leu Ile Gly Asp Gln Arg Lys Phe Leu Ser
595 600 605
Met Leu Leu Thr Leu Lys Cys Thr Leu Asp Pro Asp Thr Ser Asp Gln
610 615 620
Thr Asp Asn Leu Thr Glu Gln Ala Val Glu Phe Cys Gln Arg Val Gly
625 630 635 640
Ser Arg Ala Thr Thr Val Ser Glu Ile Ile Glu Lys Lys Asp Glu Ala
645 650 655
Val Tyr Gln Ala Ile Glu Glu Gly Ile Arg Arg Val Asn Met Asn Ala
660 665 670
Ala Ala Arg Pro Tyr His Ile Gln Lys Trp Ala Ile Leu Glu Arg Asp
675 680 685
Phe Ser Ile Ser Gly Gly Glu Leu Gly Pro Thr Met Lys Leu Lys Arg
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
006PCT Sequence Listing.txt
690 695 700
Leu Thr Val Leu Glu Lys Tyr Lys Gly Ile Ile Asp Ser Phe Tyr Gln
705 710 715 720
Glu Gln Lys Met
<210> 11
<211> 479
<212> PRT
<213> Homo sapiens
<400> 11
Met Thr Leu Asp Gly Phe Met Met Tyr Leu Leu Ser Pro Glu Gly Ala
1 5 10 15
Ala Leu Asp Asn Thr His Thr Cys Val Phe Gln Asp Met Asn Gln Pro
20 25 30
Leu Ala His Tyr Phe Ile Ser Ser Ser His Asn Thr Tyr Leu Thr Asp
35 40 45
Ser Gln Ile Gly Gly Pro Ser Ser Thr Glu Ala Tyr Val Arg Ala Phe
50 55 60
Ala Gln Gly Cys Arg Cys Val Glu Leu Asp Cys Trp Glu Gly Pro Gly
65 70 75 80
Gly Glu Pro Val Ile Tyr His Gly His Thr Leu Thr Ser Lys Ile Leu
85 90 95
Phe Arg Asp Val Val Gln Ala Val Arg Asp His Ala Phe Thr Leu Ser
100 105 110
Pro Tyr Pro Val Ile Leu Ser Leu Glu Asn His Cys Gly Leu Glu Gln
115 120 125
Gln Ala Ala Met Ala Arg His Leu Cys Thr Ile Leu Gly Asp Met Leu
130 135 140
Val Thr Gln Ala Leu Asp Ser Pro Asn Pro Glu Glu Leu Pro Ser Pro
145 150 155 160
Glu Gln Leu Lys Gly Arg Val Leu Val Lys Gly Lys Lys Leu Pro Ala
165 170 175
Ala Arg Ser Glu Asp Gly Arg Ala Leu Ser Asp Arg Glu Glu Glu Glu
180 185 190
Glu Asp Asp Glu Glu Glu Glu Glu Glu Val Glu Ala Ala Ala Gln Arg
195 200 205
Arg Leu Ala Lys Gln Ile Ser Pro Glu Leu Ser Ala Leu Ala Val Tyr
210 215 220
Cys His Ala Thr Arg Leu Arg Thr Leu His Pro Ala Pro Asn Ala Pro
225 230 235 240
Gln Pro Cys Gln Val Ser Ser Leu Ser Glu Arg Lys Ala Lys Lys Leu
245 250 255
Ile Arg Glu Ala Gly Asn Ser Phe Val Arg His Asn Ala Arg Gln Leu
260 265 270
Thr Arg Val Tyr Pro Leu Gly Leu Arg Met Asn Ser Ala Asn Tyr Ser
275 280 285
Pro Gln Glu Met Trp Asn Ser Gly Cys Gln Leu Val Ala Leu Asn Phe
290 295 300
Gln Thr Pro Gly Tyr Glu Met Asp Leu Asn Ala Gly Arg Phe Leu Val
305 310 315 320
Asn Gly Gln Cys Gly Tyr Val Leu Lys Pro Ala Cys Leu Arg Gln Pro
325 330 335
Asp Ser Thr Phe Asp Pro Glu Tyr Pro Gly Pro Pro Arg Thr Thr Leu
340 345 350
Ser Ile Gln Val Leu Thr Ala Gln Gln Leu Pro Lys Leu Asn Ala Glu
355 360 365
Lys Pro His Ser Ile Val Asp Pro Leu Val Arg Ile Glu Ile His Gly
370 375 380
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
006PCT Listing.txt
Se9uence
ValProAla AspCysAla ArgGlnGlu ThrAspTyr ValLeuAsn Asn
385 390 395 400
GlyPheAsn ProArgTrp GlyGlnThr LeuGlnPhe GlnLeuArg Ala
405 410 415
ProGluLeu AlaLeuVal ArgPheVal ValGluAsp TyrAspAla Thr
420 425 430
SerProAsn AspPheVal GlyGlnPhe ThrLeuPro LeuSerSer Leu
435 440 445
LysGlnGly TyrArgHis IleHisLeu LeuSerLys AspGlyAla Ser
450 455 460
LeuSerPro AlaThrLeu PheIleGln IleArgIle GlnArgSer
465 470 475
<210> 12
<211> 436
<212> PRT
<213> Homo Sapiens
<400> 12
Met Ala Gly Phe Pro Val Cys Pro Lys Leu Ser Leu Glu Phe Gly Asp
1 5 10 15
Pro Ala Ser Ser Leu Phe Arg Trp Tyr Lys Glu Ala Lys Pro Gly Ala
20 25 30
Ala Glu Pro Glu Val Gly Val Pro Ser Ser Leu Ser Pro Ser Ser Pro
35 40 45
Ser Ser Ser Trp Thr Glu Thr Asp Val Glu Glu Arg Val Tyr Thr Pro
50 55 60
Ser Asn Ala Asp Ile Gly Leu Arg Leu Lys Leu His Cys Thr Pro Gly
65 70 75 80
Asp Gly Gln Arg Phe Gly His Ser Arg Glu Leu Glu Ser Val Cys Val
85 90 95
Val Glu Ala Gly Pro Gly Thr Cys Thr Phe Asp His Arg His Leu Tyr
100 105 110
Thr Lys Lys Val Thr Glu Asp Ala Leu Ile Arg Thr Val Ser Tyr Asn
115 120 125
Ile Leu Ala Asp Thr Tyr Ala Gln Thr Glu Phe Ser Arg Thr Val Leu
130 135 140
Tyr Pro Tyr Cys Ala Pro Tyr Ala Leu Glu Leu Asp Tyr Arg Gln Asn
145 150 155 160
Leu Ile Gln Lys Glu Leu Thr Gly Tyr Asn Ala Asp Val Ile Cys Leu
165 170 175
Gln Glu Val Asp Arg Ala Val Phe Ser Asp Ser Leu Val Pro Ala Leu
180 185 190
Glu Ala Phe Gly Leu Glu Gly Val Phe Arg Ile Lys Gln His Glu Gly
195 200 205
Leu Ala Thr Phe Tyr Arg Lys Ser Lys Phe Ser Leu Leu Ser Gln His
210 215 220
Asp Ile Ser Phe Tyr Glu Ala Leu Glu Ser Asp Pro Leu His Lys Glu
225 230 235 240
Leu Leu Glu Lys Leu Val Leu Tyr Pro Ser Ala Gln Glu Lys Val Leu
245 250 255
Gln Arg Ser Ser Val Leu Gln Val Ser Val Leu Gln Ser Thr Lys Asp
260 265 270
Ser Ser Lys Arg Ile Cys Val Ala Asn Thr His Leu Tyr Trp His Pro
275 280 285
Lys Gly Gly Tyr Ile Arg Leu Ile Gln Met Ala Val Ala Leu Ala His
290 295 300
Ile Arg His Val Ser Cys Asp Leu Tyr Pro Gly Ile Pro Val Ile Phe
305 310 315 320
cys Gly Asp Phe Asn ser Thr Pro ser Thr Gly Met Tyr His Phe val
CA 02441670 2003-09-22
WO 02/077257 PCT/US02/08781
006PCT sequence Listing.txt
325 330 335
Ile Asn Gly Ser Ile Pro Glu Asp His Glu Asp Trp Ala Ser Asn Gly
340 345 350
Glu Glu Glu Arg Cys Asn Met Ser Leu Thr His Phe Phe Lys Leu Lys
355 360 365
Ser Ala Cys Gly Glu Pro Ala Tyr Thr Asn Tyr Val Gly Gly Phe His
370 375 380
Gly Cys Leu Asp Tyr Ile Phe Ile Asp Leu Asn Ala Leu Glu Val Glu
385 390 395 400
Gln Val Ile Pro Leu Pro Ser His Glu Glu Val Thr Thr His Gln Ala
405 410 415
Leu Pro Ser Val Ser His Pro Ser Asp His Ile Ala Leu Val Cys Asp
420 425 430
Leu Lys Trp Lys
435
