Note: Descriptions are shown in the official language in which they were submitted.
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
POLYPEPTIDES AND NUCLEIC ACIDS FOR BOLEKINE
FIELD OF THE INVENTION
The present invention relates generally to the identification and isolation of
novel DNA and to the
recombinant production of novel polypeptides. The invention also relates to
methods of use of Bolekine and its
role in the immune system and cell differentiation.
BACKGROUND OF THE INVENTION
Leukocytes include monocytes, macrophages, basophils, and eosinophils and play
an important role in
the immune response. These cells are important in the mechanisms initiated by
T and/or B lymphocytes and
secrete a range of cytokines which recruit and activate other inflammatory
cells and contribute to tissue
destruction.
Thus, investigation of the regulatory processes by which leukocytes move to
their appropriate
destination and interact with other cells is critical. Currently, leukocytes
are thought to move from the blood
to injured or inflamed tissues by rolling along the endothelial cells of the
blood vessel wall. This movement is
mediated by transient interactions between selectins and their ligands. Next,
the leukocyte must move through
the vessel wall and into..the tissues. This diapedesis and extravasation step
involves cell activation which
promotes a more stable leukocyte-endothelial cell interaction, again mediated
by integrins and their ligands.
Chemokines are a large family of structurally related polypeptide cytokines.
These molecules stimulate
leukocyte movement and may explain leukocyte trafficking in different
inflammatory situations. Chemokines
mediate the expression of particular adhesion molecules on endothelial cells,
and they produce chemoattractants
which activate specific cell types. In addition, the chemokines stimulate
proliferation and regulate activation of
specific cell types. In both of these activities, chemokines demonstrate a
high degree of target cell specificity.
The chemokine family is divided into two subfamilies based on whether two
amino terminal cysteine
residues are immediately adjacent (C-C) or separated by one amino acid (C-X-
C). Chemokines of the C-X-C
family generally activate neutrophils and fibroblasts while the C-C chemokines
act on a more diverse group of
target cells including moriocytes/macrophages, basophils, eosinophils and T
lymphocytes. The known
chemokines of both subfamilies are synthesized by many diverse cell types as
reviewed in Thomson A. (1994)
The Cytokine Handbook, 2 d Ed. Academic Press, N.Y. Chemokines are also
reviewed in Schall TJ (1994)
Chemotactic Cytokines: Targets for Therapeutic Development. International
Business Communications,
Southborough Mass. pp 180-270; and in Paul WE (1993) Fundamental Immunology,
3rd Ed. Raven Press, N.Y.
pp 822-826.
Known chemokines of the C-X-C subfamily include macrophage inflammatory
proteins alpha and beta
(MIP-1 and MIP-2 ), interleukin-8 (IL,-8), and growth regulated protein (GRO-
alpha and beta).
MIP-2 was first identified as a 6 kDa heparin binding protein secreted by the
mouse macrophage cell
1
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
line RAW 264.7 upon stimulation with lipopolysaccharide (LPS). M1P-2 is a
member of die C-X-C (or CXC)
subfamily of chemokines. Mouse MIP-2 is chemotactic for human neutrophils and
induces local neutrophil
infiltration when injected into the foot pads of mice. Rat MIP-2 shows 86%
amino acid homology to the mouse
MIP-2 and is chemotactic for rat neutrophils but does not stimulate migration
of rat alveolar macrophages or
human peripheral blood eosinophils or lymphocytes. In addition, the rat MIP-2
has been shown to stimulate
proliferation of rat alveolar epithelial cells but not fibroblasts.
Current techniques for diagnosis of abnormalities in inflamed or diseased
issues mainly rely on
observation of clinical symptoms or serological analyses of body tissues or
fluids for hormones, polypeptides
or various metabolites. Problems exist with these diagnostic techniques.
First, patients may not manifest clinical
symptoms at early stages of disease. Second, serological tests do not always
differentiate between invasive
diseases and genetic syndromes. Thus, the identification of expressed
chemokines is important to the
development of new diagnostic techniques, effective therapies, and to aid in
the understanding of molecular
pathogenesis.
To date, chemokines have been implicated in at least the following conditions:
psoriasis, inflammatory
bowel disease, renal disease, arthritis, immune-mediated alopecia, stroke,
encephalitis, MS, hepatitis, and others.
In addition, non-ELR-containing chemokines have been implicated in the
inhibition of angiogenesis, thus
indicating that these chemokines have a role in tumor vascularization and
tumorigenesis.
Therefore it is the object of this invention to identify polypeptides and
nucleic acids encoding the same
which have sequence identity and similarity with cytokine-induced neutrophil
chemoattractants, such as M1P-1,
MIP-2, and other related proteins.
2,0 We herein describe the identification and characterization of novel
chemokine family polypeptides,
designated herein as Bolekine polypeptides.
SUMMARY OF THE INVENTION
In one embodiment, the invention provides an isolated nucleic acid molecule
comprising a nucleotide
sequence that encodes a Bolekine polypeptide.
In one aspect, the isolated nucleic acid molecule comprises a nucleotide
sequence having at least about
80 % nucleic acid sequence identity, alternatively at least about 81 % nucleic
acid sequence identity, alternatively
at least about 82 % nucleic acid sequence identity, alternatively at least
about 83 % nucleic acid sequence identity,
alternatively at least about 84 % nucleic acid sequence identity,
alternatively at least about 85 % nucleic acid
sequence identity, alternatively at least about 86 % nucleic acid sequence
identity, alternatively at least about. 87 %
nucleic acid sequence identity, alternatively at least about 88 % nucleic acid
sequence identity, alternatively at
least about 89% nucleic acid sequence identity, alternatively at least about
90% nucleic acid sequence identity,
alternatively at least about 91 % nucleic acid sequence identity,
alternatively at least about 92% nucleic acid
sequence identity, alternatively at least about 93 % nucleic acid sequence
identity, alternatively at least about 94
nucleic acid sequence identity, alternatively at least about 95% nucleic acid
sequence identity, alternatively at
least about 96 % nucleic acid sequence identity, alternatively at least about
97 % nucleic acid sequence identity,
alternatively at least about 98 % nucleic acid sequence identity and
alternatively at least about 99% nucleic acid
2
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
sequence identity to (a) a DNA molecule encoding a Bolekine polypeptide having
a full-length amino acid
sequence as disclosed herein, an amino acid sequence lacking the signal
peptide as disclosed herein, an
extracellular domain of a transmembrane protein, with or without the signal
peptide, as disclosed herein or any
other specifically defined fragment of the full-length amino acid sequence as
disclosed herein, or (b) the
complement of the DNA molecule of (a).
In other aspects, the isolated nucleic acid molecule comprises a nucleotide
sequence having at least about
80 % nucleic acid sequence identity, alternatively at least about 81 % nucleic
acid sequence identity, alternatively
at least about 82 % nucleic acid sequence identity, alternatively at least
about 83 % nucleic acid sequence identity,
alternatively at least about 84 % nucleic acid sequence identity,
alternatively at least about 85 % nucleic acid
sequence identity, alternatively at least about 86 % nucleic acid sequence
identity, alternatively at least about 87
nucleic acid sequence identity, alternatively at least about 88 % nucleic acid
sequence identity, alternatively at
least about 89 % nucleic acid sequence identity, alternatively at least about
90 % nucleic acid sequence identity,
alternatively at least about 91 % nucleic acid sequence identity,
alternatively at least about 92% nucleic acid
sequence identity, alternatively at least about 93 % nucleic acid sequence
identity, alternatively at least about 94
nucleic acid sequence identity, alternatively at least about 95 % nucleic acid
sequence identity, alternatively at
least about 96 % nucleic acid sequence identity, alternatively at least about
97 % nucleic acid sequence identity,
alternatively at least about 98 % nucleic acid sequence identity and
alternatively at least about 99 % nucleic acid
sequence identity to (a) a DNA molecule comprising the coding sequence of a
full-length Bolekine polypeptide
cDNA as disclosed herein, the coding sequence of a Bolekine polypeptide
lacking the signal peptide as disclosed
herein, the coding sequence of an extracellular domain of a transmembrane
Bolekine polypeptide, with or without
the signal peptide, as disclosed herein or the coding sequence of any other
specifically defined fragment of the
full-length amino acid sequence as disclosed herein, or (b) the complement of
the DNA molecule of (a).
In a further aspect, the invention concerns an isolated nucleic acid molecule
comprising a nucleotide
sequence having at least about 80 % nucleic acid sequence identity,
alternatively at least about 81 % nucleic acid
sequence identity, alternatively at least about 82 % nucleic acid sequence
identity, alternatively at least about 83
nucleic acid sequence identity, alternatively at least about 84 % nucleic acid
sequence identity, alternatively at
least about 85 % nucleic acid sequence identity, alternatively at least about
86 % nucleic acid sequence identity,
alternatively at least about 87 % nucleic acid sequence identity,
alternatively at least about 88 % nucleic acid
sequence identity, alternatively at least about 89 % nucleic acid sequence
identity, alternatively at least about 90
nucleic acid sequence identity, alternatively at least about 91 % nucleic acid
sequence identity, alternatively at
least about 92 % nucleic acid sequence identity, alternatively at least about
93 % nucleic acid sequence identity,
alternatively at least about 94 % nucleic acid sequence identity,
alternatively at least about 95 % nucleic acid
sequence identity, alternatively at least about 96 % nucleic acid sequence
identity, alternatively at least about 97
nucleic acid sequence identity, alternatively at least about 98 % nucleic acid
sequence identity and alternatively
at least about 99 % nucleic acid sequence identity to (a) a DNA molecule that
encodes the same mature
polypeptide encoded by any of the human protein cDNAs deposited with the ATCC
as disclosed herein, or (b)
the complement of the DNA molecule of (a).
Another aspect the invention provides an isolated nucleic acid molecule
comprising a nucleotide
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
sequence encoding a Bolekine polypeptide which is either transmembrane domain-
deleted or transmembrane
domain-inactivated, or is complementary to such encoding nucleotide sequence,
wherein the transmembrane
domains) of such polypeptide are disclosed herein. Therefore, soluble
extracellular domains of the herein
described Bolekine polypeptides are contemplated.
Another embodiment is directed to fragments of a Bolekine polypeptide coding
sequence, or the
complement thereof, that may find use as, for example, hybridization probes,
for encoding fragments of a
Bolekine polypeptide that may optionally encode a polypeptide comprising a
binding site for an anti-Bolekine
antibody or as antisense oligonucleotide probes. Such nucleic acid fragments
are usually at least about 10
nucleotides in length, alternatively at least about 15 nucleotides in length,
alternatively at least about 20
nucleotides in length, alternatively at least about 30 nucleotides in length,
alternatively at least about 40
nucleotides in length, alternatively at least about 50 nucleotides in length,
alternatively at least about 60
nucleotides in length, alternatively at least about 70 nucleotides in length,
alternatively at least about 80
nucleotides in length, alternatively at least about 90 nucleotides in length,
alternatively at least about 100
nucleotides in length, alternatively at least about 110 nucleotides in length,
alternatively at least about 120
nucleotides in length, alternatively at least about 130 nucleotides in length,
alternatively at least about 140
nucleotides in length, alternatively at least about 150 nucleotides in length,
alternatively at least about 160
nucleotides in length, alternatively at least about 170 nucleotides in length,
alternatively at least about 180
nucleotides in length, alternatively at least about 190 nucleotides in length,
alternatively at least about 200
nucleotides in length, alternatively at least about 250 nucleotides in length,
alternatively at least about 300
nucleotides in length, alternatively at least about 350 nucleotides in length,
alternatively at least about 400
nucleotides in length, alternatively at least about 450 nucleotides in length,
alternatively at least about 500
nucleotides in length, alternatively at least about 600 nucleotides in length,
alternatively at least about 700
nucleotides in length, alternatively at least about 800 nucleotides in length,
alternatively at least about 900
nucleotides in length and alternatively at least about 1000 nucleotides in
length, wherein in this context the term
"about" means the referenced nucleotide sequence length plus or minus 10 % of
that referenced length. It is
noted that novel fragments of a Bolekine polypeptide-encoding nucleotide
sequence may be determined in a
routine manner by aligning the Bolekine polypeptide-encoding nucleotide
sequence with other known nucleotide
sequences using any of a number of well known sequence alignment programs and
determining which Bolekine
polypeptide-encoding nucleotide sequence fragments) axe novel. All of such
Bolekine polypeptide-encoding
nucleotide sequences are contemplated herein. Also contemplated are the
Bolekine polypeptide fragments
encoded by these nucleotide molecule fragments, preferably those Bolekine
polypeptide fragments that comprise
a binding site for an anti-Bolekine antibody.
In another embodiment, the invention provides isolated Bolekine polypeptide
encoded by any of the
isolated nucleic acid sequences hereinabove identified.
In a certain aspect, the invention concerns an isolated Bolekine polypeptide,
comprising an amino acid
sequence having at least about 80 % amino acid sequence identity,
alternatively at least about 81 % amino acid
sequence identity, alternatively at least about 82 % amino acid sequence
identity, alternatively at least about 83
amino acid sequence identity, alternatively at least about 84 % amino acid
sequence identity, alternatively at least
4
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
about 85% amino acid sequence identity, alternatively at least about 86% amino
acid sequence identity,
alternatively at least about 87% amino acid sequence identity, alternatively
at least about 88% amino acid
sequence identity, alternatively at least about 89 % amino acid sequence
identity, alternatively at least about 90
amino acid sequence identity, alternatively at least about 91 % amino acid
sequence identity, alternatively at least
about 92 % amino acid sequence identity, alternatively at least about 93 %
amino acid sequence identity,
alternatively at least about 94 % amino acid sequence identity, alternatively
at least about 95 % amino acid
sequence identity, alternatively at least about 96 % amino acid sequence
identity, alternatively at least about 97
amino acid sequence identity, alternatively at least about 98 % amino acid
sequence identity and alternatively at
least about 99 % amino acid sequence identity to a Bolekine polypeptide having
a full-length amino acid sequence
as disclosed herein, an amino acid sequence lacking the signal peptide as
disclosed herein, an extracellular
domain of a transmembrane protein, with or without the signal peptide, as
disclosed herein or any other
specifically defined fragment of the full-length amino acid sequence as
disclosed herein.
In a further aspect, the invention concerns an isolated Bolekine polypeptide
comprising an amino acid
sequence having at least about 80% amino acid sequence identity, alternatively
at least about 81 % amino acid
sequence identity, alternatively at least about 82 % amino acid sequence
identity, alternatively at least about 83
amino acid sequence identity, alternatively at least about 84 % amino acid
sequence identity, alternatively at least
about 85 % amino acid sequence identity, alternatively at least about 86 %
amino acid sequence identity,
alternatively at least about 87 % amino acid sequence identity, alternatively
at least about 88 % amino acid
sequence identity, alternatively at least about 89 % amino acid sequence
identity, alternatively at least about 90
amino acid sequence identity, alternatively at least about 91 % amino acid
sequence identity, alternatively at least
about 92% amino acid sequence identity, alternatively at least about 93% amino
acid sequence identity,
alternatively at least about 94 % amino acid sequence identity, alternatively
at least about 95 % amino acid
sequence identity, alternatively at least about 96 % amino acid sequence
identity, alternatively at least about 97
amino acid sequence identity, alternatively at least about 98 % amino acid
sequence identity and alternatively at ,
least about 99 % amino acid sequence identity to an amino acid sequence
encoded by any of the human protein
cDNAs deposited with the ATCC as disclosed herein.
In a specific aspect, the invention provides an isolated Bolekine polypeptide
without the N-terminal
signal sequence and/or the initiating methionine and is encoded by a
nucleotide sequence that encodes such an
amino acid sequence as hereinbefore described. Processes for producing the
same are also herein described,
wherein those processes comprise culturing a host cell comprising a vector
which comprises the appropriate
encoding nucleic acid molecule under conditions suitable for expression of the
Bolekine polypeptide and
recovering the Bolekine polypeptide from the cell culture.
Another aspect the invention provides an isolated Bolekine polypeptide which
is either transmembrane
domain-deleted or transmembrane domain-inactivated. Processes for producing
the same are also herein
described, wherein those processes comprise culturing a host cell comprising a
vector which comprises the
appropriate encoding nucleic acid molecule under conditions suitable for
expression of the Bolekine polypeptide
and recovering the Bolekine polypeptide from the cell culture.
In yet another embodiment, the invention concerns agonists and antagonists of
a native Bolekine
5
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
polypeptide as defined herein. In a particular embodiment, the agonist or
antagonist is an anti-Bolekine antibody
or a small molecule.
In a further embodiment, the invention concerns a method of identifying
agonists or antagonists to a
Bolekine polypeptide which comprise contacting the Bolekine polypeptide with a
candidate molecule and
monitoring a biological activity mediated by said Bolekine polypeptide.
Preferably, the Bolekine polypeptide
is a native Bolekine polypeptide.
In a still further embodiment, the invention concerns a composition of matter
comprising a Bolekine
polypeptide, or an agonist or antagonist of a Bolekine polypeptide as herein
described, or an anti-Bolekine
antibody, in combination with a carrier. Optionally, the carrier is a
pharmaceutically acceptable carrier.
Another embodiment of the present invention is directed to the use of a
Bolekine polypeptide, or an
agorllst or antagonist thereof as hereinbefore described, or an anti-Bolekine
antibody, for the preparation of a
medicament useful in the treatment of a condition which is responsive to the
Bolekine polypeptide, an agonist
or antagonist thereof or an anti-Bolekine antibody.
In other embodiments of the present invention, the invention provides vectors
comprising DNA
encoding any of the herein described polypeptides. Host cell comprising any
such vector are also provided. By
way of example, the host cells may be CHO cells, E. coli, or yeast. A process
for producing any of the herein
described polypeptides is further provided and comprises culturing host cells
under conditions suitable for
expression of the desired polypeptide and recovering the desired polypeptide
from the cell culture.
In other embodiments, the invention provides chimeric molecules comprising any
of the herein described
polypeptides fused to a heterologous polypeptide or amino acid sequence.
Example of such chimeric molecules
2.0 comprise any of the herein described polypeptides fused to an epitope tag
sequence or a Fc region of an
immunoglobulin.
Tn another embodiment, the invention provides an antibody which binds,
preferably specifically, to any
of the above or below described polypeptides. Optionally, the antibody is a
monoclonal antibody, humanized
antibody, antibody fragment or single-chain antibody.
In yet other embodiments, the invention provides oligonucleotide probes which
may be useful for
isolating genomic and cDNA nucleotide sequences, measuring or detecting
expression of an associated gene or
as antisense probes, wherein those probes may be derived from any of the above
or below described nucleotide
sequences. Preferred probe lengths are described above.
Tn yet other embodiments, the present invention is directed to methods of
using the Bolekine
polypeptides of the present invention for a variety of uses based upon the
functional biological assay data
presented in the Examples below.
Tn yet other embodiments the invention is directed to methods that will
increase the proliferation of
immune cells such as presented in Example 10.
In yet other embodiments the invention is directed to methods of use of
increasing vascular permeability
such as presented in Example 11.
6
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 shows a nucleotide sequence (SEQ ID NO:l) of a native sequence
Bolekine cDNA, wherein
SEQ ID NO:1 is a clone designated herein as Bolekine.
Figure 2 shows the amino acid sequence (SEQ ID N0:2) derived from the coding
sequence of SEQ ID
NO: l shown in Figure 1.
Figure 3 depicts the results of Northern blots analyzing the nucleic acid
encoding Bolekine.
Figures 4A through 4E are photomicrographs depicting the results of in situ
hybridization assays
performed on the nucleic acid encoding Bolekine. Figure 4A depicts fetal skin,
in the right frame is dark field
microscopy, displaying the in situ, in the left frame is normal bright field
microscopy. Figure 4B depicts fetal
kidney, in the right frame is dark field microscopy, displaying the in situ,
~in the left frame is normal bright field
microscopy. Figure 4C depicts fetal gut, in the right frame is dark field
microscopy, displaying the in situ, in
the left frame is normal bright field microscopy. Figure 4D depicts adult gut,
in the right frame is dark field
microscopy, displaying the in situ, in the left frame is normal bright field
microscopy. Figure 4E depicts
cerebrum, in the right frame is dark field microscopy, displaying the in situ,
in the left frame is normal bright
field microscopy.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
I. Definitions
The terms "Bolekine" as used herein encompass native sequence polypeptides and
polypeptide variants
(which are further defined herein). The Bolekine polypeptides described herein
may be isolated from a variety
of sources, such as from human tissue types or from another source, or
prepared by recombinant or synthetic
methods. The term "Bolekine polypeptide" refers to each individual Bolekine
polypeptide disclosed herein. All
disclosures in this specification which refer to the "Bolekine polypeptide"
refer to each of the polypeptides
individually as well as jointly. For example, descriptions of the preparation
of, purification of, derivation of,
formation of antibodies to or against, administration of, compositions
containing, treatment of a disease with,
etc., pertain to each polypeptide of the invention individually. The term
"Bolekine polypeptide" also includes
variants of the Bolekine polypeptides disclosed herein.
A "native sequence Bolekine polypeptide" comprises a polypeptide having the
same amino acid sequence
as the corresponding Bolekine polypeptide derived from nature. Such native
sequence Bolekine polypeptides
can be isolated from nature or can be produced by recombinant or synthetic
means. The term "native sequence
Bolekine polypeptide" specifically encompasses naturally-occurring truncated
or secreted forms of the specific
Bolekine polypeptide (e.g., an extracellular domain sequence), naturally-
occurring variant forms (e.g.,
alternatively spliced forms) and naturally-occurring allelic variants of the
polypeptide. In various embodiments
of the invention, the native sequence Bolekine polypeptides disclosed herein
are mature or full-length native
sequence polypeptides comprising the full-length amino acids sequences shown
in the accompanying figures.
Start and stop codons are shown in bold font and underlined in the figures.
However, while the Bolekine
polypeptide disclosed in the accompanying figures are shown to begin with
methionine residues designated herein
as amino acid position 1 in the figures, it is conceivable and possible that
other methionine residues located either
7
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
upstream or downstream from the amino acid position 1 in the figures may be
employed as the starting amino
acid residue for the Bolekine polypeptides.
The Bolekine polypeptide "extracellular domain" or "ECD" refers to a form of
the Bolekine polypeptide
which is essentially free of the transmembrane and cytoplasmic domains.
Ordinarily, a Bolekine polypeptide
ECD will have less than 1 % of such transmembrane andlor cytoplasmic domains
and preferably, will have less
S than 0.5 % of such domains. It will be understood that any txansmembrane
domains identified for the Bolekine
polypeptides of the present invention are identified pursuant to criteria
routinely employed in the art for
identifying that type of hydrophobic domain. The exact boundaries of a
transmembrane domain may vary but
most likely by no more than about 5 amino acids at either end of the domain as
initially identified herein.
Optionally, therefore, an extracellular domain of a Bolekine polypeptide may
contain from about 5 or fewer
amino acids on either side of the transmembrane domain/extracellular domain
boundary as identified in the
Examples or specification and such polypeptides, with or without the
associated signal peptide, and nucleic acid
encoding them, are comtemplated by the present invention.
The approximate location of the "signal peptides" of the various Bolekine
polypeptides disclosed herein
are shown in the present specification and/or the accompanying figures. It is
noted, however, that the C-terminal
boundary of a signal peptide may vary, but most likely by no more than about 5
amino acids on either side of
the signal peptide C-terminal boundary as initially identified herein, wherein
the C-terminal boundary of the
signal peptide may be identified pursuant to criteria routinely employed in
the art for identifying that type of
amino acid sequence element (e.g., Nielsen et al., Prot. En~. 10:1-6 (1997)
and von Heinje et al., Nucl. Acids.
Res. 14:4683-4690 (1986)). Moreover, it is also recognized that, in some
cases, cleavage of a signal sequence
from a secreted polypeptide is not entirely uniform, resulting in more than
one secreted species. These mature
polypeptides, whexe the signal peptide is cleaved within no more than about S
amino acids on either side of the
C-terminal boundary of the signal peptide as identified herein, and the
polynucleotides encoding them, are
contemplated by the present invention.
"Bolekine polypeptide variant" means an active Bolekine polypeptide as defined
above or below having
at least about 80 % amino acid sequence identity with a full-length native
sequence Bolekine polypeptide sequence
as disclosed herein, a Bolekine polypeptide sequence lacking the signal
peptide as disclosed herein, an
extracellular domain of a Bolekine polypeptide, with or without the signal
peptide, as disclosed herein or any
other fragment of a full-length Bolekine polypeptide sequence as disclosed
herein. Such Bolekine polypeptide
variants include, for instance, Bolekine polypeptides wherein one or more
amino acid residues are added, or
deleted, at the N- or C-terminus of the full-length native amino acid
sequence. Ordinarily, a Bolekine
polypeptide variant will have at least about 80% amino acid sequence identity,
alternatively at least about 81
amino acid sequence identity, alternatively at least about 82 % amino acid
sequence identity, alternatively at least
about 83 % amino acid sequence identity, alternatively at least about 84 %
amino acid sequence identity,
alternatively at least about 85% amino acid sequence identity, alternatively
at least about 86% amino acid
sequence identity, alternatively at least about 87 % amino acid sequence
identity, alternatively at least about 88
amino acid sequence identity, alternatively at least about 89 % amino acid
sequence identity, alternatively at least
about 90 % amino acid sequence identity, alternatively at least about 91 %
amino acid sequence identity,
8
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
alternatively at least about 92 % amino acid sequence identity, alternatively
at least about 93 % amino acid
sequence identity, alternatively at least about 94 % amino acid sequence
identity, alternatively at least about 95
amino acid sequence identity, alternatively at least about 96 % amino acid
sequence identity, alternatively at least
about 97 % amino acid sequence identity, alternatively at Least about 98 %
amino acid sequence identity and
alternatively at least about 99 % amino acid sequence identity to a full-
length native sequence Bolekine
polypeptide sequence as disclosed herein, a Bolekine polypeptide sequence
lacking the signal peptide as disclosed
herein, an extracellular domain of a Bolekine polypeptide, with or without the
signal peptide, as disclosed herein
or any other specifically defined fragment of a full-length Bolekine
polypeptide sequence as disclosed herein.
Ordinarily, Bolekine variant polypeptides are at least about 10 amino acids in
length, alternatively at least about
20 amino acids in length, alternatively at least about 30 amino acids in
length, alternatively at least about 40
amino acids in length, alternatively at Least about 50 amino acids in length,
alternatively at least about 60 amino
acids in length, alternatively at least about 70 amino acids in length,
alternatively at least about 80 amino acids
in length, alternatively at least about 90 amino acids in length,
alternatively at least about 100 amino acids in
length, alternatively at least about 150 amino acids in length, alternatively
at least about 200 amino acids in
length, alternatively at least about 300 amino acids in length, or more.
"Percent ( % ) amino acid sequence identity" with respect to the Bolekine
polypeptide sequences
identified herein is defined as the percentage of amino acid residues in a
candidate sequence that are identical
with the amino acid residues in the specific Bolekine polypeptide sequence,
after aligning the sequences and
introducing gaps, if necessary, to achieve the maximum percent sequence
identity, and not considering any
conservative substitutions as part of the sequence identity. Alignment for
purposes of determining percent amino
acid sequence identity can be achieved in various ways that are within the
skill in the art, for instance, using
publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign
(DNASTAR) software.
Those skilled in the art can determine appropriate parameters for measuring
alignment, including any algorithms
needed to achieve maximal alignment over the full length of the sequences
being compared. For purposes
herein, however, % amino acid sequence identity values are generated using the
sequence comparison computer
program ALIGN-2, wherein the complete source code for the ALIGN-2 program is
provided in Table 1 below.
The ALIGN-2 sequence comparison computer program was authored by Genentech,
Inc. and the source code
shown in Table 1 below has been filed with user documentation in the U. S.
Copyright Office, Washington D. C.,
20559, where it is registered under U.S. Copyright Registration No. TXU510087.
The ALIGN-2 program is
publicly available through Genentech, Inc., South San Francisco, California or
may be compiled from the source
code provided in Table 1 below. The ALIGN-2 program should be compiled for use
on a UNIX operating
system, preferably digital UNIX V4.OD. All sequence comparison parameters are
set by the ALIGN-2 program
and do not vary.
In situations where ALIGN-2 is employed for amino acid sequence comparisons,
the % amino acid
sequence identity of a given amino acid sequence A to, with, or against a
given amino acid sequence B (which
can alternatively be phrased as a given amino acid sequence A that has or
comprises a certain % amino acid
sequence identity to, with, or against a given amino acid sequence B) is
calculated as follows:
9
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
100 times the fraction X/Y
where X is the number of amino acid residues scored as identical matches by
the sequence alignment program
ALIGN-2 in that program's alignment of A and B, and where Y is the total
number of amino acid residues in
B. It will be appreciated that where the length of amino acid sequence A is
not equal to the length of amino acid
sequence B, the % amino acid sequence identity of A to B will not equal the %
amino acid sequence identity of
B to A. As examples of % amino acid sequence identity calculations using this
method, Tables 2 and 3
demonstrate how to calculate the % amino acid sequence identity of the amino
acid sequence designated
"Comparison Protein" to the amino acid sequence designated "Bolekine", wherein
"Bolekine" represents the
amino acid sequence of a hypothetical Bolekine polypeptide of interest,
"Comparison Protein" represents the
amino acid sequence of a polypeptide against which the "Bolekine" polypeptide
of interest is being compared,
and "X, "Y" and "Z" each represent different hypothetical amino acid residues.
Unless specifically stated otherwise, all % amino acid sequence identity
values used herein are obtained
as described in the immediately preceding paragraph using the ALIGN-2 computer
program. However, % amino
acid sequence identity values may also be obtained as described below by using
the WU-BLAST-2 computer
program (Altschul et al., Methods in Enzvmoloay 266:460-480 (1996)). Most of
the WU-BLAST-2 search
parameters are set to the default values. Those not set to default values,
i.e., the adjustable parameters, are set
with the following values: overlap span = 1, overlap fraction = 0.125, word
threshold (T) = 11, and scoring
matrix = BLOSUM62. When WU-BLAST-2 is employed, a % amino acid sequence
identity value is
determined by dividing (a) the number of matching identical amino acid
residues between the amino acid
sequence of the Bolekine polypeptide of interest having a sequence derived
from the native Bolekine polypeptide
and the comparison amino acid sequence of interest (i.e., the sequence against
which the Bolekine polypeptide
of interest is being compared which may be a Bolekine variant polypeptide) as
determined by WU-BLAST-2 by
(b) the total number of amino acid residues of the Bolekine polypeptide of
interest. For example, in the
statement "a polypeptide comprising an the amino acid sequence A which has or
having at least 80 % amino acid
sequence identity to the amino acid sequence B", the amino acid sequence A is
the comparison amino acid
sequence of interest and the amino acid sequence B is the amino acid sequence
of the Bolekine polypeptide of
interest.
Percent amino acid sequence identity may also be determined using the sequence
comparison program
NCBI-BLAST2 (Altschul et al., Nucleic Acids Res. 25:3389-3402 (1997)). The
NCBI-BLAST2 sequence
comparison program may be downloaded from http://www.ncbi.nlm.nih.gov or
otherwise obtained from the
National Institute of Health, Bethesda, MD. NCBI-BLAST2 uses several search
parameters, wherein all of those
search parameters are set to default values including, for example, unmask =
yes, strand = all, expected
occurrences = 10, minimum low complexity length = 1515, multi-pass e-value =
O.OI, constant for rnulti-pass
= 25, dropoff for final gapped alignment = 25 and scoring matrix = BLOSUM62.
In situations where NCBI-BLAST2 is employed for amino acid sequence
comparisons, the % amino
acid sequence identity of a given amino acid sequence A to, with, or against a
given amino acid sequence B
(which can alternatively be phrased as a given amino acid sequence A that has
or comprises a certain % amino
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
acid sequence identity to, with, or against a given amino acid sequence B) is
calculated as follows;
100 times the fraction X/Y
where X is the number of amino acid residues scored as identical matches by
the sequence alignment program
NCBI-BLAST2 in that program's alignment of A and B, and where Y is the total
number of amino acid residues
in B. It will be appreciated that where the length of amino acid sequence A is
not equal to the length of amino
acid sequence B, the % amino acid sequence identity of A to B will not equal
the % amino acid sequence identity
of B to A.
"Bolekine variant polynucleotide" or "Bolekine variant nucleic acid sequence"
means a nucleic acid
molecule which encodes an active Bolekine polypeptide as defined below and
which has at least about 80%
nucleic acid sequence identity with a nucleotide acid sequence encoding a full-
length native sequence Bolekine
polypeptide sequence as disclosed herein, a full-length native sequence
Bolekine polypeptide sequence lacking
the signal peptide as disclosed herein, an extracellular domain of a Bolekine
polypeptide, with or without the
signal peptide, as disclosed herein or any other fragment of a full-length
Bolekine polypeptide sequence as
disclosed herein. Ordinarily, a Bolekine variant polynucleotide will have at
least about 80% nucleic acid
sequence identity, alternatively at least about 81 % nucleic acid sequence
identity, alternatively at least about 82
nucleic acid sequence identity, alternatively at Least about 83 % nucleic acid
sequence identity, alternatively at
least about 84 % nucleic acid sequence identity, alternatively at least about
85 % nucleic acid sequence identity,
alternatively at least about 86 % nucleic acid sequence identity,
alternatively at least about 87 % nucleic acid
sequence identity, alternatively at least about 88 % nucleic acid sequence
identity, alternatively at least about 89
nucleic acid sequence identity, alternatively at least about 90% nucleic acid
sequence identity, alternatively at
least about 91 % nucleic acid sequence identity, alternatively at least about
92% nucleic acid sequence identity,
alternatively at least about 93 % nucleic acid sequence identity,
alternatively at least about 94 % nucleic acid
sequence identity, alternatively at least about 95 % nucleic acid sequence
identity, alternatively at least about 96
2.5 nucleic acid sequence identity, alternatively at least about 97 % nucleic
acid sequence identity, alternatively at
least about 98 % nucleic acid sequence identity and alternatively at least
about 99 % nucleic acid sequence identity
with a nucleic acid sequence encoding a full-length native sequence Bolekine
polypeptide sequence as disclosed
herein, a full-length native sequence Bolekine polypeptide sequence lacking
the signal peptide as disclosed
herein, an extracellular domain of a Bolekine polypeptide, with or without the
signal sequence, as disclosed
herein or any other fragment of a full-length Bolekine polypeptide sequence as
disclosed herein. Variants do
not encompass the native nucleotide sequence.
Ordinarily, Bolekine variant polynucleotides are at least about 30 nucleotides
in length, alternatively
at least about 60 nucleotides in length, alternatively at least about 90
nucleotides in length, alternatively at least
about 120 nucleotides in length, alternatively at least about 1S0 nucleotides
in length, alternatively at least about
180 nucleotides in length, alternatively at least about 210 nucleotides in
length, alternatively at least about 240
nucleotides in length, alternatively at least about 270 nucleotides in Length,
alternatively at least about 300
nucleotides in length, alternatively at least about 450 nucleotides in length,
alternatively at Least about 600
11
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
nucleotides in length, alternatively at least about 900 nucleotides in length,
or more.
"Percent (%) nucleic acid sequence identity" with respect to Bolekine-encoding
nucleic acid sequences
identified herein is defined as the percentage of nucleotides in a candidate
sequence that are identical with the
nucleotides in the Bolekine nucleic acid sequence of interest, after aligning
the sequences and introducing gaps,
if necessary, to achieve the maximum percent sequence identity. Alignment for
purposes of determining percent
nucleic acid sequence identity can be achieved in various ways that are within
the skill in the art, for instance,
using publicly available computer software such as BLAST, BLAST-2, ALIGN or
Megalign (DNASTAR)
software. For purposes herein, however, % nucleic acid sequence identity
values are generated using the
sequence comparison computer program ALIGN-2, wherein the complete source code
for the ALIGN-2 program
is provided in Table 1 below. The ALIGN-2 sequence comparison computer program
was authored by
Genentech, Inc. and the source code shown in Table 1 below has been filed with
user documentation in the U.S.
Copyright Office, Washington D.C., 20559, where it is registered under U.S.
Copyright Registration No.
TXU510087. The ALIGN-2 program is publicly available through Genentech, Inc.,
South San Francisco,
California or may be compiled from the source code provided in Table 1 below.
The ALIGN-2 program should
be compiled for use on a UNIX operating system, preferably digital UNIX V4.OD.
All sequence comparison
parameters are set by the ALIGN-2 program and do not vary.
In situations where ALIGN-2 is employed for nucleic acid sequence comparisons,
the % nucleic acid
sequence identity of a given nucleic acid sequence C to, with, or against a
given nucleic acid sequence D (which
can alternatively be phrased as a given nucleic acid sequence C that has or
comprises a certain % nucleic acid
sequence identity to, with, or against a given nucleic acid sequence D) is
calculated as follows:
100 times the fraction W/Z
where W is the number of nucleotides scored as identical matches by the
sequence alignment program ALIGN-2
in that program's alignment of C and D, and where Z is the total number of
nucleotides in D. It will be
appreciated that where the length of nucleic acid sequence C is not equal to
the length of nucleic acid sequence
D, the % nucleic acid sequence identity of C to D will not equal the % nucleic
acid sequence identity of D to
C. As examples of % nucleic acid sequence identity calculations, Tables 4 and
5, demonstrate how to calculate
the % nucleic acid sequence identity of the nucleic acid sequence designated
"Comparison DNA" to the nucleic
acid sequence designated "Bolekine-DNA", wherein "Bolekine-DNA" represents a
hypothetical Bolekine-
encoding nucleic acid sequence of interest, "Comparison DNA" represents the
nucleotide sequence of a nucleic
acid molecule against which the "Bolekine-DNA" nucleic acid molecule of
interest is being compared, and "N",
"L" and "V" each represent different hypothetical nucleotides.
Unless specifically stated otherwise, all % nucleic acid sequence identity
values used herein are obtained
as described in the immediately preceding paragraph using the ALIGN-2 computer
program. However,
nucleic acid sequence identity values may also be obtained as described below
by using the WU-BLAST-2
computer program (Altschul et al., Methods in Enzymolo~y 266:460-480 (1996)).
Most of the WU-BLAST-2
search parameters are set to the default values. Those not set to default
values, i.e., the adjustable parameters,
12
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
are set with the following values: overlap span = 1, overlap fraction = 0.125,
word threshold (T) = 11, and
scoring matrix = BLOSUM62. When WU-BLAST-2 is employed, a % nucleic acid
sequence identity value is
determined by dividing (a) the number of matching identical nucleotides
between the nucleic acid sequence of
the Bolekine polypeptide-encoding nucleic acid molecule of interest having a
sequence derived from the native
sequence Bolekine polypeptide-encoding nucleic acid and the comparison nucleic
acid molecule of interest (i.e.,
the sequence against which the Bolekine polypeptide-encoding nucleic acid
molecule of interest is being
compared which may be a variant Bolekine polynucleotide) as determined by WU-
BLAST-2 by (b) the total
number of nucleotides of the Bolekine polypeptide-encoding nucleic acid
molecule of interest. For example, in
the statement "an isolated nucleic acid molecule comprising a nucleic acid
sequence A which has or having at
least 80% nucleic acid sequence identity to the nucleic acid sequence B", the
nucleic acid sequence A is the
comparison nucleic acid molecule of interest and the nucleic acid sequence B
is the nucleic acid sequence of the
Bolekine polypeptide-encoding nucleic acid molecule of interest.
Percent nucleic acid sequence identity may also be determined using the
sequence comparison program
NCBI-BLAST2 (Altschul et al., Nucleic Acids Res. 25:3389-3402 (1997)). The
NCBI-BLAST2 sequence
comparison program may be downloaded from http://www.ncbi.nlm.nih.gov or
otherwise obtained from the
National Institute of Health, Bethesda, MD. NCBI-BLAST2 uses several search
parameters, wherein all of those
search parameters are set to default values including, for example, unmask =
yes, strand = all, expected
occurrences = 10, minimum low complexity length = 15/5, multi-pass e-value =
0.01, constant for multi-pass
= 25, dropoff for final gapped alignment = 25 and scoring matrix = BLOSUM62.
In situations where NCBI-BLAST2 is employed for sequence comparisons, the %
nucleic acid sequence
identity of a given nucleic acid sequence C to, with, or against a given
nucleic acid sequence D (which can
alternatively be phrased as a given nucleic acid sequence C that has or
comprises a certain % nucleic acid
sequence identity to, with, or against a given nucleic acid sequence D) is
calculated as follows:
100 times the fraction W/Z
where W is the number of nucleotides scored as identical matches by the
sequence alignment program NCBI-
BLAST2 in that program's alignment of C and D, and where Z is the total number
of nucleotides in D. It will
be appreciated that where the length of nucleic acid sequence C is not equal
to the length of nucleic acid sequence
D, the % nucleic acid sequence identity of C to D will not equal the % nucleic
acid sequence identity of D to
C.
In other embodiments, Bolekine variant polynucleotides are nucleic acid
molecules that encode an active
Bolekine polypeptide and which are capable of hybridizing, preferably under
stringent hybridization and wash
conditions, to nucleotide sequences encoding a full-length Bolekine
polypeptide as disclosed herein. Bolekine
variant polypeptides may be those that are encoded by a Bolekine variant
polynucleotide.
"Isolated, " when used to describe the various polypeptides disclosed herein,
means polypeptide that has
been identified and separated and/or recovered from a component of its natural
environment. Contaminant
components of its natural environment are materials that would typically
interfere with diagnostic or therapeutic
13
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
uses for the polypeptide, and may include enzymes, hormones, and other
proteinaceous or non-proteinaceous
solutes. In preferred embodiments, the polypeptide will be purified (1) to a
degree sufficient to obtain at least
15 residues of N-terminal or internal amino acid sequence by use of a spinning
cup sequenator, or (2) to
homogeneity by SDS-PAGE under non-reducing or reducing conditions using
Coomassie blue or, preferably,
silver stain. Isolated polypeptide includes polypeptide ifz situ within
recombinant cells, since at least one
component of the Bolekine polypeptide natural environment will not be present.
Ordinarily, however, isolated
polypeptide will be prepared by at least one purification step.
An "isolated" Bolekine polypeptide-encoding nucleic acid or other polypeptide-
encoding nucleic acid
is a nucleic acid molecule that is identified and separated from at least one
contaminant nucleic acid molecule
with which it is ordinarily associated in the natural source of the
polypeptide-encoding nucleic acid. An isolated
polypeptide-encoding nucleic acid molecule is other than in the form or
setting in which it is found in nature.
Isolated polypeptide-encoding nucleic acid molecules therefore
are.distinguished from the specific polypeptide-
encoding nucleic acid molecule as it exists in natural cells. However, an
isolated polypeptide-encoding nucleic
acid molecule includes polypeptide-encoding nucleic acid molecules contained
in cells that ordinarily express the
polypeptide where, for example, the nucleic acid molecule is in a chromosomal
location different from that of
natural cells.
The term "control sequences" refers to DNA sequences necessary for the
expression of an operably
linked coding sequence in a particular host organism. The control sequences
that are suitable for prokaryotes,
for example, include a promoter, optionally an operator sequence, and a
ribosome binding site. Eukaryotic cells
are known to utilize promoters, polyadenylation signals, and enhancers.
Nucleic acid is "operably linked" when it is placed into a functional
relationship with another nucleic
acid sequence. For example, DNA for a presequence or secretory leader is
operably linked to DNA for a
polypeptide if it is expressed as a preprotein that participates in the
secretion of the polypeptide; a promoter or
enhanc~r is operably linked to a coding sequence if it affects the
transcription of the sequence; or a ribosome
binding site is operably linked to a coding sequence if it is positioned so as
to facilitate translation. Generally,
"operably linked" means that the DNA sequences being linked are contiguous,
and, in the case of a secretory
leader, contiguous and in reading phase. However, enhancers do not have to be
contiguous. Linking is
accomplished by ligation at convenient restriction sites. If such sites do not
exist, the synthetic oligonucleotide
adaptors or linkers are used in accordance with conventional practice.
The term "antibody" is used in the broadest sense and specifically covers, for
example, single anti-
Bolekine monoclonal antibodies (including agonist, antagonist, and
neutralizing antibodies), anti-Bolekine
antibody compositions with polyepitopic specificity, single chain anti-
Bolekine antibodies, and fragments of anti-
Bolekine antibodies (see below). The term "monoclonal antibody" as used herein
refers to an antibody obtained
from a population of substantially homogeneous antibodies, i.e., the
individual antibodies comprising the
population are identical except for possible naturally-occurring mutations
that may be present in minor amounts.
"Stringency" of hybridization reactions is readily determinable by one of
ordinary skill in the art, and
generally is an empirical calculation dependent upon probe length, washing
temperature, and salt concentration.
In general, longer probes require higher temperatures for proper annealing,
while shorter probes need lower
14
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
temperatures. Hybridization generally depends on the ability of denatured DNA
to reanneal when
complementary strands are present in an environment below their melting
temperature. The higher the degree
of desired homology between the probe and hybridizable sequence, the higher
the relative temperature which
can be used. As a result, it follows that higher relative temperatures would
tend to make the reaction conditions
more stringent, while lower temperatures less so. For, additional details and
explanation of stringency of
hybridization reactions, see Ausubel et al., Current Protocols in Molecular
Biology, Whey Interscience
Publishers, (1995).
"Stringent conditions" or "high stringency conditions", as defined herein, may
be identified by those
that: (1) employ low ionic strength and high temperature for washing, for
example 0,015 M sodium
chloride/0,0015 M sodium citrate/0.1% sodium dodecyl sulfate at 50°C;
(2) employ during hybridization a
denaturing agent, such as formamide, for example, 50% (v/v) formamide with 0.1
% bovine serum
albumin/0.1 % Ficoll/0.1 % polyvinylpyrrolidone/SOmM sodium phosphate buffer
at pH 6.5 with 750 mM sodium
chloride, 75 mM sodium citrate at 42°C; or (3) employ 50% formamide, 5
x SSC (0.75 M NaCI, 0.075 M
sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1 % sodium pyrophosphate,
5 x Denhardt's solution,
sonicated salmon sperm DNA (50 ,ug/ml), 0.1 % SDS, and 10% dextran sulfate at
42°C, with washes at 42°C
in 0.2 x SSC (sodium chloride/sodium citrate) and 50 % formamide at 55
°C, followed by a high-stringency wash
consisting of 0.1 x SSC containing EDTA at 55°C.
"Moderately stringent conditions" may be identified as described by Sambrook
et al., Molecular
Cloning: A Laboratory Manual, New York: Cold Spring Harbor Press, 1989, and
include the use of washing
solution and hybridization conditions (e.g., temperature, ionic strength and
%SDS) less stringent that those
described above. An example of moderately stringent conditions is overnight
incubation at 37°C in a solution
comprising: 20 % formamide, 5 x SSC (150 mM NaCI, 15 mM trisodium citrate), 50
mM sodium phosphate (pH
7.6), 5 x Denhardt's solution, 10% dextran sulfate, and 20 mg/ml denatured
sheared salmon sperm DNA,
followed by washing the filters in 1 x SSC at about 37-50°C. The
skilled artisan will recognize how to adjust
the temperature, ionic strength, etc. as necessary to accommodate factors such
as probe length and the like.
The term "epitope tagged" when used herein refers to a chimeric polypeptide
comprising a Bolekine
polypeptide fused to a "tag polypeptide". The tag polypeptide has enough
residues to provide an epitope against
which an antibody can be made, yet is short enough such that it does not
interfere with activity of the polypeptide
to which it is fused. The tag polypeptide preferably also is fairly unique so
that the antibody does not
substantially cross-react with other epitopes. Suitable tag polypeptides
generally have at least six amino acid
residues and usually between about 8 and SO amino acid residues (preferably,
between about 10 and 20 amino
acid residues).
As used herein, the term "immunoadhesin" designates antibody-like molecules
which combine the
binding specificity of a heterologous protein (an "adhesin") with the effector
functions of immunoglobulin
constant domains. Structurally, the immunoadhesins comprise a fusion of an
amino acid sequence with the
desired binding specificity which is other than the antigen recognition and
binding site of an antibody (i.e., is
"heterologous"), and an immunoglobulin constant domain sequence. The adhesin
part of an immunoadhesin
molecule typically is a contiguous amino acid sequence comprising at least the
binding site of a receptor or a
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
ligand. The immunoglobulin constant domain sequence in the immunoadhesin may
be obtained from any
immunoglobulin, such as IgG-1, IgG-2, IgG-3, or IgG-4 subtypes, IgA (including
IgA-l and IgA-2), IgE, IgD
or IgM.
"Active" or "activity" for the purposes herein refers to forms) of a Bolekine
polypeptide which retain
a biological and/or an immunological activity of native or naturally-occurring
Bolekine, wherein "biological"
activity refers to a biological function (either inhibitory or stimulatory)
caused by a native or naturally-occurring
Bolekine other than the ability to induce the production of an antibody
against an antigenic epitope possessed by
a native or naturally-occurring Bolekine and an "immunological" activity
refers to the ability to induce the
production of an antibody against an antigenic epitope possessed by a native
or naturally-occurring Bolekine.
The term "antagonist" is used in the broadest sense, and includes any molecule
that partially or fully
blocks, inhibits, or neutralizes a biological activity of a native Bolekine
polypeptide disclosed herein. In a
similar manner, the term "agonist" is used in the broadest sense and includes
any molecule that mimics a
biological activity of a native Bolekine polypeptide disclosed herein.
Suitable agonist or antagonist molecules
specifically include agonist or antagonist antibodies or antibody fragments,
fragments or amino acid sequence
variants of native Bolekine polypeptides, peptides, antisense
oligonucleotides, small organic molecules, etc.
Methods for identifying agonists or antagonists of a Bolekine polypeptide may
comprise contacting a Bolekine
polypeptide with a candidate agonist or antagonist molecule and measuring a
detectable change in one or more
biological activities normally associated with the Bolekine polypeptide.
"Treatment" refers to both therapeutic treatment and prophylactic or
preventative measures, wherein
the object is to prevent or slow down (lessen) the targeted pathologic
condition or disorder. Those in need of
treatment include those already with the disorder as well as those prone to
have the disorder or those in whom
the disorder is to be prevented.
"Chronic" administration refers to administration of the agents) in a
continuous mode as opposed to
an acute mode, so as to maintain the initial therapeutic effect (activity) for
an extended period of time.
"Intermittent" administration is treatment that is not consecutively done
without interruption, but rather is cyclic
in nature.
"Mammal" for purposes of treatment refers to any animal classified as a
mammal, including humans,
domestic and farm animals, and zoo, sports, or pet animals, such as dogs,
cats, cattle, horses, sheep, pigs, goats,
rabbits, etc. Preferably, the mammal is human.
Administration "in combination with" one or more further therapeutic agents
includes simultaneous
(concurrent) and consecutive administration in any order.
"Carriers" as used herein include pharmaceutically acceptable carriexs,
excipients, or stabilizers which
are nontoxic to the cell or mammal being exposed thereto at the dosages and
concentrations employed. Often
the physiologically acceptable carrier is an aqueous pH buffered solution.
Examples of physiologically
acceptable carriers include buffers such as phosphate, citrate, and other
organic acids; antioxidants including
ascorbic acid; low molecular weight (less than about 10 residues) polypeptide;
proteins, such as serum albumin,
gelatin, or immunoglobulins; hydrophilic polymers such as
polyvinylpyrrolidone; amino acids such as glycine,
glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and
other carbohydrates including
16
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols
such as mannitol or sorbitol; salt-
forming counterions such as sodium; and/or nonionic surfactants such as
TWEEN'~, polyethylene glycol (PEG),
and PLURONICS''a'.
"Antibody fragments" comprise a portion of an intact antibody, preferably the
antigen binding or
variable region of the intact antibody. Examples of antibody fragments include
Fab, Fab', F(ab')2, and Fv
fragments; diabodies; linear antibodies (Zapata et al., Protein En~. 8(10):
1057-1062 [1995]); single-chain
antibody molecules; and multispecific antibodies formed from antibody
fragments.
Papain digestion of antibodies produces two identical antigen-binding
fragments, called "Fab"
fragments, each with a single antigen-binding site, and a residual "Fc"
fragment, a designation reflecting the
ability to crystallize readily. Pepsin treatment yields an F(ab')z fragment
that has two antigen-combining sites
and is still capable of cross-linking antigen.
"Fv" is the minimum antibody fragment which contains a complete antigen-
recognition and -binding
site. This region consists of a dimer of one heavy- and one light-chain
variable domain in tight, non-covalent
association. It is in this configuration that the three CDRs of each variable
domain interact to define an antigen-
binding site on the surface of the VH VL dimer. Collectively, the six CDRs
confer antigen-binding specificity to
the antibody. However, even a single variable domain (or half of an Fv
comprising only three CDRs specific
for an antigen) has the ability to recognize and bind antigen, although at a
lower affinity than the entire binding
site.
The Fab fragment also contains the constant domain of the light chain and the
first constant domain
(CHl) of the heavy chain. Fab fragments differ from Fab' fragments by the
addition of a few residues at the
carboxy terminus of the heavy chain CHl domain including one or more cysteines
from the antibody hinge
region. Fab'-SH is the designation herein for Fab' in which the cysteine
residues) of the constant domains bear
a free thiol group. F(ab')2 antibody fragments originally were produced as
pairs of Fab' fragments which have
hinge cysteines between them. Other chemical couplings of antibody fragments
are also known.
The "light chains" of antibodies (immunoglobulins) from any vertebrate species
can be assigned to one
of two clearly distinct types, called kappa and lambda, based on the amino
acid sequences of their constant
domains.
Depending on the amino acid sequence of the constant domain of their heavy
chains, immunoglobulins
can be assigned to different classes. There are five major classes of
immunoglobulins: IgA, IgD, IgE, IgG, and
IgM, and several of these may be further divided into subclasses (isotypes),
e.g., IgGl, IgG2, IgG3, IgG4, IgA,
and IgA2.
"Single-chain Fv" or "sFv" antibody fragments comprise the VH and VL domains
of antibody, wherein
these domains are present in a single polypeptide chain. Preferably, the Fv
polypeptide further comprises a
polypeptide linker between the VH and VL domains which enables the sFv to form
the desired structure for
antigen binding. For a review of sFv, see Pluckthun in The Pharmacol~ of
Monoclonal Antibodies, vol. 113,
Rosenburg and Moore eds., Springer-Verlag, New York, pp. 269-315 (1994).
The term "diabodies" refers to small antibody fragments with two antigen-
binding sites, which
fragments comprise a heavy-chain variable domain (VH) connected to a light-
chain variable domain (VL) in the
17
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
same polypeptide chain (VH-V,~. By using a linker that is too short to allow
pairing between the two domains
on the same chain, the domains are forced to pair with the complementary
domains of another chain and create
two antigen-binding sites. Diabodies are described more fully in, for example,
EP 404,097; WO 93/11161; and
Hollinger et al., Proc. Natl. Acad. Sci. USA, 90:6444-6448 (1993).
An "isolated" antibody is one which has been identified and separated and/or
recovered from a
component of its natural environment. Contaminant components of its natural
environment are materials which
would interfere with diagnostic or therapeutic uses for the antibody, and may
include enzymes, hormones, and
other proteinaceous or nonproteinaceous solutes. In preferred embodiments, the
antibody will be purified (1)
to greater than 95 % by weight of antibody as determined by the Lowry method,
and most preferably more than
99% by Weight, (2) to a degree sufficient to obtain at least 15 residues of N-
terminal or internal amino acid
sequence by use of a spinning cup sequenator, or (3) to homogeneity by SDS-
PAGE under reducing or
nonreducing conditions using Coomassie blue or, preferably, silver stain.
Isolated antibody includes the antibody
in situ within recombinant cells since at least one component of the
antibody's natural environment will not be
present. Ordinarily, however, isolated antibody will be prepared by at least
one purification step.
An antibody that "specifically binds to" or is "specific for" a particular
polypeptide or an epitope on
a particular polypeptide is one that binds to that particular polypeptide or
epitope on a particular polypeptide
without substantially binding to any other polypeptide or polypeptide epitope.
The word "label" when used herein refers to a detectable compound or
composition which is conjugated
directly or indirectly to the antibody so as to generate a "labeled" antibody.
The label may be detectable by itself
(e.g. radioisotope labels or fluorescent labels) or, in the case of an
enzymatic label, may catalyze chemical
alteration of a substrate compound or composition which is detectable.
By "solid phase" is meant a non-aqueous matrix to which the antibody of the
present invention can
adhere. Examples of solid phases encompassed herein include those formed
partially or entirely of glass (e.g.,
controlled pore glass), polysaccharides (e.g., agarose), polyacrylamides,
polystyrene, polyvinyl alcohol and
silicones. In certain embodiments, depending on the context, the solid phase
can comprise the well of an assay
plate; in others it is a purification column (e.g., an affinity chromatography
column). This term also includes
a discontinuous solid phase of discrete particles, such as those described in
U.S. Patent No. 4,275,149.
A "liposome" is a small vesicle composed of various types of lipids,
phospholipids andlor surfactant
which is useful for delivery of a drug (such as a Bolekine polypeptide or
antibody thereto) to a mammal. The
components of the liposome are commonly arranged in a bilayer formation,
similar to the lipid arrangement of
biological membranes.
A "small molecule" is defined herein to have a molecular weight below about
500 Daltons.
An "effective amount" of a polypeptide disclosed herein or an agonist or
antagonist thereof is an amount
sufficient to carry out a specifically stated purpose. An "effective amount"
may be determined empirically and
in a routine manner, in relation to the stated purpose.
A "pluripotent cell" is defined herein as a cell that is not fixed to a
developmental lineage.
18
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
Table 1
/*
*
* C-C
increased
from
12
to
1S
* Z
is
average
of
EQ
* B
is
average
of
ND
* match
with
stop
is
M;
stop-stop
=
0;
J
(joker)
match
=
0
* %
#defineM -8 /* value of a match with a stop ~'/
I int _day[26] [26] _ {
~
/* A B C D E F G H I J K L M N O P Q R S T U V W X Y Z */
/* ~ 2, 0,-2, 0, 0,-4, 1,-1,-1, 0,-1,-2,-1, O, M, 1, 0,-2,
A 1, 1, 0, 0,-6, 0,-3, 0},
*/
l* ~ 0, 3,-4, 3, 2,-S, 0, 1,-2, 0, 0,-3,-2, 2, M,-1, 1, 0,
B 0, 0, 0,-2,-S, 0,-3, 1},
*l
/* ~-2,-4,15,-5,-S,-4,-3,-3,-2, 0,-S,-6,-S,-4 -M,-3,-5,-4,
C 0,-2, 0,-2,-8, 0, 0,-5},
*/
I$ /* ~ 0, 3,-5, 4, 3,-6, 1, 1,-2, 0, 0,-4,-3, 2, M,-1, 2,-1,
D 0, 0, 0,-2,-7, 0,-4, 2},
*!
/* ~ 0, 2,-5, 3, 4,-S, 0, 1,-2, 0, 0,-3,-2, I, M,-1, 2,-1,
E 0, 0, 0,-2,-7, 0,-4, 3},
*/
/* ~-4,-S,-4,-6,-S, 9,-S,-2, I, 0,-5, 2, 0,-4, M,-5,-S,-4,-3,-3,
F 0,-I, 0, 0, 7,-S},
*/
/* ~ 1, 0,-3, 1, 0,-5, S,-2,-3, 0,-2,-4,-3, O, M,-l,-1,-3,
G 1, 0, 0,-1,-7, 0,-5, 0},
*/
/* f-1, 1,-3, 1, 1,-2,-2, 6,-2, 0, 0,-2,-2, 2, M, 0, 3, 2,-I,-1,
H 0,-2,-3, 0, 0, 2},
*l
/* ~-1,-2,-2,-Z,-2, I,-3,-2, 5, 0,-2, 2, 2,-2, M,-2,-2,-2,-1,
I 0, 0, 4,-5, 0,-I,-2},
*!
/* { 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, O, M, 0, 0, 0,
J 0, 0, 0, 0, 0, 0, 0, 0},
*/
/* f-1, 0,-S, 0, 0,-5,-2, 0,-2, 0, S,-3, 0, 1, M,-1, 1, 3,
K 0, 0, 0,-2,-3, 0,-4, 0},
*/
/* {-2,-3,-6,-4,-3, 2,-4,-2, 2, 0,-3, 6, 4,-3, M,-3,-2,-3,-3,-1,
L 0, 2,-2, 0,-l,-2},
*/
/* f-1,-2,-S,-3,-2, 0,-3,-2, 2, 0, 0, 4, 6,-2, M,-2,-1, 0,-2,-1,
M 0, 2,-4, 0,-2,-1},
*/
~.$/* { 0, 2,-4, 2; I,-4, 0, 2,-2, 0, 1,-3,-2, 2, M,-1, 1, 0,
N 1, 0, 0,-2,-4, 0,-2, 1},
*/
/* ~ M,
O M,_M,
*/ M, M, M, M, M, M, M, M, M, M, M, O, M, M, M, M, M, M, M,
M -M =M,
M},
/* _
P _
*/ _
~ 1,-I,-3,-1,-I,-S,-1, 0,-2, 0,-1,-3,-2,-1, M, 6, 0, 0,
1, 0, 0,-1,-6, 0,-5, 0},
/* ~ 0, 1,-S, 2, 2,-S,-1, 3,-2, 0, 1,-2,-1, 1, M, 0, 4, I,-1,-1,
Q 0,-2,-S, 0,-4, 3},
*/
/* ~-2, 0,-4,-l,-1,-4,-3, 2,-2, 0, 3,-3, 0, O, M, 0, 1, 6,
R 0,-1, 0,-2, 2, 0,-4, 0},
*/
30 /* ~ 1, 0, 0, 0, 0,-3, 1,-I,-1, 0, 0,-3,-2, 1, M, 1,-1, 0,
S 2, 1, 0,-I,-2, 0,-3, 0},
*/
/* { 1, 0,-2, 0, 0,-3, 0,-1, 0, 0, 0,-1,-1, O, M, 0,-1,-1,
T I, 3, 0, 0,-S, 0,-3, 0},
*1
/* ~ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, O, M, 0, 0, 0,
U 0, 0, 0, 0, 0, 0, 0, 0},
*/
/* ~ 0,-2,-2,-2,-2,-1,-1,-2, 4, 0,-2, 2, 2,-2, M,-1,-2,-2,-1,
V 0, 0, 4,-6, 0,-2,-2},
*/
/* ~-6,-S,-8,-7,-7, 0,-7,-3,-S, 0,-3,-2,-4,-4, M,-6,-5, 2,-2,-5,
W 0,-6,17, 0, 0,-6},
*/
3$ /* I o, o, o, o, o, o, o, o, o, o, o, o, o, o,_M, o, o, o,
x o, o, o, o, o, o, o, o},
*/
/* ~-3,-3, 0,-4,-4, 7,-S, 0,-1, 0,-4,-1,-2,-2, M,-S,-4,-4,-3,-3,
Y 0,-2, 0, 0,10,-4},
*/
/* ~ 0, 1,-S, 2, 3,-5, 0, Z,-2, 0, 0,-2,-1, 1, M, 0, 3, 0,
Z 0, 0, 0,-2,-6, 0,-4, 4}
*/
};
45
$0
I9
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
Table 1 (cont'~
/*
y'/
#include
<
stdio.h
>
#include
<ctype.h>
#defineMAXJMP 16 /* max jumps in a ding *!
#defineMAXGAP 24 /* don't continue to penalize
gaps larger than this */
#defineJMPS 1024 /* max jmps in an path */
#defineMX 4 /* save if there's at least
MX-1 bases since last jmp
*/
#defineDMAT 3 /* value of matching bases
*/
#defineDMIS 0 /* penalty for mismatched
bases */
#defineDINSO 8 /* penalty for a gap */
#defineDINS1 1 /* penalty per base */
#definePINSO 8 /* penalty for a gap */
#definePINS1 4 /* penalty per residue */
struct
jmp
f
short n[MAXJMP];
/*
size
of
jmp
(neg
for
defy)
*/
unsigned x[MAXJMP]; /* base no. of jmp in
short seq x */
}; /* limits seq to 2''16 -1
*/
structng
di f
int score;/* score at last jmp *!
long offset;/* offset of prev block */
short ijmp;/* current jmp index */
struct jp; /* list of jmps */
jmp
struct
path
{
int spc; /* number of leading spaces
*/
shortn[JMPS]; f jmp (gap) *!
/*
size
o
int x[JMPS];
/*
loc
of
jmp
(last
elem
before
gap)
*/
char *ofile; /* output file name *!
char *namex[2]; /* seq names: getseqs() */
char *prog; /* prog name for err msgs
*/
char *seqx[2]; /* seqs: getseqs() */
4o int dmax; /* best ding: nwQ */
int dmax0; /* final diag */
int dna; /* set if dna: main() */
int endgaps; /* set if penalizing end
gaps */
int gapx, /* total gaps in seqs */
gapy;
int len0, /* seq lens */
lent;
int ngapx, /* total size of gaps */
ngapy;
int smax; /* max score: nwQ */
int *xbm; /* bitmap for matching */
long offset; /* current offset in jmp
file */
structdiag*dx; /* holds diagonals */
structpathpp[2]; /* holds path for seqs */
char *callocQ,*mallocQ, *indexQ, *strcpyQ;
char *getseq(),
*g
calloc();
5 5
20
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
Table 1 (cony)
/* Needleman-Wunsch alignment program
*
* usage: progs filet filet
* where filet and filet are two dna or two protein sequences.
* The sequences can be in upper- or lower-case an may contain ambiguity
* Any lines beginning with ';', ' > ' or ' <' are ignored
* Max file length is 65535 (limited by unsigned short x in the jmp struct)
* A sequence with 1/3 or more of its elements ACGTU is assumed to be DNA
* Output is in the file "align.out"
* The program may create a tmp file in /tmp to hold info about traceback.
* Original version developed under BSD 4.3 on a vax 8650
*l
#include "nw.h"
#include "day.h"
static dbval[26] _ ~
1,14,2,13,0,0,4,11,0,0,12,0,3,15,0,0,0,5,6,8,8,7,9,0,10,0
static -pbval[26] _ {
1, 2 ~ (I < < ('D'-'A')) ~ (1 < < ('N'-'A')), 4, 8, 16, 32, 64,
128, 256, OxFFFFFFF, 1 < < 10, 1 < < 11, 1 < < 12, 1 < < 13, 1 < < 14,
1«15, 1«16, 1«17, 1«18, 1«19, 1«20, 1«21, 1«22,
1«23, 1«24, 1«25(1«('E'-'A'))~(1«('Q'-'A'))
main(ac, av) main
int ac;
char *av~;
f
prog = av[0];
if (ac ! = 3) ~
fprintf(stderr,"usage: %s filet filet\n", prog);
fprintf(stderr,"where filet and filet are two dna or two protein
sequences.\n");
fprintf(stderr, "The sequences can be in upper- or lower-case\n");
fprintf(stderr, "Any lines beginning with ' ;' or ' < ' are ignored\n");
fprintf(stderr, "Output is in the file \"align.out\"\n");
exit(1);
1
namex[0] = av[1];
namex[1] = av[2];
seqx[0] = getseq(namex[0], &IenO);
seqx[1] = getseq(namex[1], &lenl);
xbm = (dna)? dbval : ~bval;
endgaps = 0; /* 1 to penalize endgaps */
ofile = "align.out"; /* output file */
nwQ; /* fill in the matrix, get the possible jmps */
readjmpsQ; /* get the actual jmps */
print(); /* print stats, alignment *l
cleanup(0); /* unlink any tmp files */
21
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
Table 1 ~cont'1
/* do the alignment, return best score: main()
dna: values in Fitch and Smith, PNAS, 80, 1382-1386, 1983
* pro: PAM 250 values
* When scores are equal, we prefer mismatches to any gap, prefer
* a new gap to extending an ongoing gap, and prefer a gap in seqx
* to a gap in seq y.
*/
nw
nwQ
f
char *px, *py; /~' seqs and ptrs */
int *ndely, *dely; /* keep track of defy */
int ndelx, deli; /* keep track of deli */
int *tmp; /* for swapping row0, rowl */
int mis; /* score for each type */ .
int ins0, insl; /* insertion penalties */
register id; /* diagonal index */
register ij; l* jmp index */
register *col0, *coll; /* score for curr, last row */
register xx, yy; /* index into seqs */
dx = (struct diag *)g calloc("to get diags", len0+lenl+1, sizeof(struct
diag));
. ndely = (int *)g_calloc("to get ndely", lent+1, sizeof(int));
defy = (int *)g_calloc("to get dely", lenl + 1, sizeof(int));
col0 = (int *)g calloc("to get col0", lent+1, sizeof(int));
coil = (int *)g_calloc("to get coil", lenl+1, sizeof(int));
ins0 = (dna)? DINSO : PINSO;
insl = (dna)? DINS1 : PINS1;
smax = -10000;
if (endgaps) ~
for (col0[0] = defy[0] _ -ins0, yy = 1; yy < = leni; yy++) {
col0[yy] = dely[yy] = col0[yy-1] - insl;
ndely[yy] = yy;
col0[0] = 0; /* Waterman Bull Math Biol 84 */
else
for (yy = 1; yy < = lenl; yy++)
defy[yy] _ -ins0;
/* fill in match matrix
*/
for (px = seqx[0], xx = 1; xx < = len0; px++, xx++) {
/* initialize first entry in col
*/
if (endgaps) f
if (xx == 1)
coil[0] = deli = -(ins0+insl);
else
toll[0] = delx = col0[0] - insl;
ndelx = xx;
else ~
toll [0] = o;
deli = -ins0;
ndelx = 0;
22
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
Table 1 (cont'1
for (py = seqx[1], yy = 1; yy < = lenl; py++,
yy++) {
mis = col0[yy-1];
if (dna)
S mis +_ (xbm[*px-'A']&xbm[*py-'A'])? DMAT : DMIS;
else
mis += day[*px-'A'][*py-'A'];
/* update penalty for del in x seq;
* favor new del over ongong del
* ignore MAXGAP if weighting endgaps
*/
if (endgaps ~ ( ndely(yy] < MAXGAP) {
if (col0[yy] - ins0 > = defy[yy]) ~
defy[yy] = col0[yy] - (ins0+insl);
ndely[yy] = 1;
~ else {
dely[yy] -= insl;
ndely[yy]++;
} else {
if (coIO[yy] - (ins0+insl) > = dely[yy]) f
defy[yy] = col0[yy] - (ins0+insl);
ndely[yy] = 1;
~ else
ndely[yy] + +;
I* update penalty for del in y seq;
* favor new del over ongong del
*/
if (endgaps ~ ~ ndelx < MAXGAP) ~
if (toll[yy-1] - ins0 > = delx) ~
delx = coil[yy-1] - (ins0+insl);
ndelx = 1;
~ else {
delx -= insl;
ndelx+ +;
~ else ~
if (colt[yy-1] - (ins0+insl) > = delx) f
delx = toll[yy-1] - (ins0+insl);
ndelx = 1;
~ else
ndelx++;
/* pick the maximum score; we're favoring
* mis over any de1 and delx over defy
*/
60
...nw
23
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
Table 1 fcont')
id=xx-yy+lenl-1;
if (mis > = delx && mis > = dely[yy])
toll [yy] = mis;
else if (delx > = dely[yy]) f
col l [yy] = delx;
ij = dx[id].ijmp;
if (dx[id].jp.n[0] && (!dna ~ ~ (ndelx > = MAXJMP
&& xx > dx[id].jp.x[ij]+MX) ~ ~ mis > dx[id].score+DINSO)) ~
dx[id].ijmp++;
if (++ij > = MAXJMP) ~
writejmps(id);
ij = dx[id].ijmp = 0;
dx[id].offset = offset;
offset += sizeof(struct jmp) + sizeof(offset);
dx[id].jp.n[ij] = ndelx;
dx[id].jp.x[ij] = xx;
dx[id].score = delx;
else ~
toll[yy] = dely[yy];
ij = dx[id].ijmp;
if (dx[id].jp.n[0] && (!dna ~ ~ (ndely[yy] > = MAXJMP
&& xx > dx[id].jp.x[ij]+MX) ~ ~ mis > dx[id].score+DINSO)) ~
dx[id].ijmp++;
if (++ij > = MAXJMP) {
writejmps(id);
3o ij = dx[id].ijmp = 0;
dx[id].offset = offset;
offset += sizeof(struct jmp) + sizeof(offset);
dx[id].jp.n[ij] _ -ndely[yy];
dx[id].jp.x[ij] = xx;
dx[id].score = dely[yy];
if (xx == len0 && yy < lenl) f
/* last col
*/
if (endgaps)
colt[yy] -= ins0+insl*(lenl-yy);
if (col l [yy] > smax) {
smax = coil[yy];
dmax = id;
5~ if (endgaps && xx < len0)
toll[yy-1] -= ins0+insl*(len0-xx);
if (toll [yy-I] > smax) f
smax = coll[yy-1];
dmax = id;
)
tmp = col0; col0 = toll; coil = tmp;
(void) free((char *)ndely);
(void) free((char *)dely);
(void) free((char *)col0);
(void) free((char *)coll); }
...nw
24
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
Table 1 (cony)
/*
* print() -- only routine visible outside this module
* static:
* getmatQ -- trace back best path, count matches: print()
* pr align() -- print alignment of described in array p~: print()
* dumpblockQ -- dump a block of lines with numbers, stars: pr align()
* nums() -- put out a number line: dumpblockQ
* putline() -- put out a line (name, [num], seq, [num]): dumpblock()
* stars() - -put a line of stars: dumpblock()
* stripnameQ -- strip any path and prefix from a seqname
*/
IS #include "nw.h"
#define SPC 3
#define P_LINE 256 /* maximum output line */
#define P_SPC 3 /* space between name or num and seq */
extern _day[26][26];
int olen; /* set output line length */
FILE *fx; /* output file */
print
print()
int lx, 1y, firstgap, lastgap; /* overlap */
if ((fx = fopen(ofile, "w")) _ = 0) f
fprintf(stderr,"%s: can't write %s\n", prog, ofile);
cleanup(1);
fprintf(fx, " < first sequence: % s (length = % d)\n", namex[0], len0);
fprintf(fx, "<second sequence: %s (length = %d)\n", namex[l], lenl);
olen = 60;
lx = len0;
1y = lenl;
firstgap = lastgap = 0;
if (dmax < lenl - 1) ~ /* leading gap in x */
pp[0].spc = firstgap = lent - dmax - 1;
1y -= pp[0].spc;
else if (dmax > lenl - 1) f /* leading gap in y */
pp[1].spc = firstgap = dmax - (lenl - 1);
lx -= pp[l].spc; .
if (dmax0 < len0 - 1) ~ /* trailing gap in X */
lastgap = len0 - dmax0 -1;
lx -= lastgap; '
1
else if (dmax0 > len0 - 1) f /* trailing gap in y */
lastgap = dmax0 - (len0 - 1);
1y -= lastgap;
getmat(Ix, 1y, firstgap, lastgap);
pr align();
.
25
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
Table 1 (cony)
/*
* trace back the best path, count matches
*/
static
S getmat(lx, 1y, firstgap, lastgap) getrilat
int lx, 1y; /* "core" (minus endgaps) */
int firstgap, lastgap; /* leading trailing overlap */
{
int nm, i0, i1, siz0, sizl;
ehar outx[32]; '
double pct;
register n0, n1;
register char *p0, *pl;
/* get total matches, score
*/
i0 = i1 = siz0 = sizl = 0;
p0 = seqx[0] + pp[1].spc;
p1 = seqx[1] + pp[0].spc;
n0 = pp[1].spc + 1;
n1 = pp[0].spc + 1;
nm=0;
while ( *p0 && *pl ) {
if (siz0) {
p1++;
n1++;
siz0--;
else if (sizl) {
p0++;
n0++;
sizl--;
else {
if (xbm[*p0-'A']&xbm[*pl-'A'])
nm++;
if (n0++ _= pp[0].x[i0])
siz0 = pp[0].n[i0-I-+];
if (n1++ _= pp[1].x[il])
sizl = pp[1].n[il++];
p0++;
p1++;
)
/* pct homology:
* if penalizing endgaps, base is the shorter seq
* else, knock off overhangs and take shorter core
*/
if (endgaps)
lx = (len0 < lenl)? len0 : lenl;
else
lx = (lx < 1y)? lx : 1y;
pct = 100.*(double)nm/(double)lx;
fprintf(fx, "\n");
fprintf(fx, " < % d match % s in an overlap of % d: % .2f percent
similarity\n",
~ (~ _= 1)? .... : ,~es~~ lx, pct)>
26
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
Table 1 (cont'1
fprintf(fx, " < gaps in first sequence: % d", gapx); ...getlriat
if (gapx) ~
(void) sprintf(outx, " ( % d % s % s)",
S ngapx, (dna)? "base": "residue", (ngapx = = I)? "": "s");
fprintf(fx,"%s", outx);
fprintf(fx, ",'gaps in second sequence: %d", gapy);
if (gapY) f
(void) sprintf(outx, " ( % d % s % s)",
ngapy, (dna)? "base": "residue", (ngapy = = 1)? "": "s");
fprintf(fx," % s", outx);
if (dna)
fprintf(fx,
"\n < score: % d (match = % d, mismatch = % d, gap penalty = % d + % d per
base)\n",
smax, DMAT, DMIS, DINSO, DINS1);
else
fprintf(fx,
"\n < score: % d (Dayhoff PAM 250 matrix, gap penalty = % d + % d per
residue)\n",
smax, PINSO, PINS1);
if (endgaps)
fprintf(fx,
" < endgaps penalized. left endgap: % d % s % s, right endgap: % d % s % s\n",
firstgap, (dna)? "base" : "residue", (firstgap == I)? "" : "s",
lastgap, (dna)? "base" : "residue", (lastgap == 1)? "" : "s");
else
fprintf(fx, " < endgaps not penalized\n");
static nm; /* matches in core -- for checking */
static lmax; /* lengths of stripped file names */
static ij[2]; /* jmp index for a path */
static nc[2]; /* number at start of current line */
3$ static ni[2]; l* current elem number -- for gapping */
static siz[2];
static char*ps[2]; /* ptr to current element */
static char*po[2]; /* ptr to next output char slot */
static charout[2][P LINE]; /* output line *l
static charstar[P-LINE]; /* set by stars() */
/*
* print of described in struct path pp0
alignment
*/
static
pr align() pr align
f
int nn; /* char count */
int more;
register i;
for (i = 0, Imax = 0; i < 2; i++) ~
nn = stripname(namex[i]);
if (nn > lmax)
lmax = nn;
nc[i] = 1;
ni[i] = l;
siz[i] = ij[i] = o;
(70 ps[i] = seqx[i];
po[i] = out[i];
27
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
Table l~cont')
for (nn = nm = 0, more = 1; more; ) f ...pP align
for (i = more = 0; i < 2; i++) ~
/*
S * do we have more of this sequence?
*!
if (!*ps[i])
continue;
more+ +;
if (pp[i].spc) { /* leading space */
*po[i]++ _ ' '~
pp[i].spc--;
else if (siz[i]) ~ l* in a gap */
*po[i]++ _ ' ';
siz(i]--;
else { /* we're putting a seq element
*!
*po(i] _ *ps[i];
if (islower(*ps[i]))
*ps[i] = toupper(*ps[i]);
2,5 po[i]++;
ps[i]++;
r*
* are we at next gap for this seq?
*/
if (ni[i] _= pp[i].x[ij[i]]) {
/*
* we need to merge all gaps
* at this location
*/
siz[i] = pp[i].n[ij[i]++];
while (ni[i] _= pp[i].x[ij[i]])
siz[i] += pp[i].n[ij[i]++];
ni[i]++;
)
if (++nn == olen ~ ~ !more && nn) ~
dumpblockQ;
for (i = 0; i G 2; i++)
po[i] = out[i];
nn=0;
) ,
/*
* dump a block of lines, including numbers, stars: pr align()
*%
SS static
dumpblockp dumpblock
f
register i;
for (i = 0; i < 2; i++)
*po[i]__ _ '\0';
28
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
Table 1 (cony)
. .. dumpblocl~
(void) putt('\n', fx);
for (i = 0; i < 2; i++) f
if (*out[i] && (*out[i] ! _ ' ' ~ ~ *(po[i]) ! _ ' ')) 1
if (i = = 0)
nums(i);
if (i == 0 && *out[1])
stars();
putline(i);
if (i == 0 && *out[1])
fprintf(fx, star);
if (i == 1)
nums(i);
/*
* put out a number line: dumpblockQ
*/
static
nums(ix) hums
int ix; /* index in outs holding seq line */
char nline~ LINE];
register i, j;
register char *pn, *px, *py;
for (pn = mine, i = 0; i < lmax+P SPC; i++, pn++)
*pn = . . ; _
for (i = nc[ix], py = out[ix]; *py; py++, pn++) {
if (*py =- ' ' ~ ~ *PY =- ~-')
*pn = , , ;
else f
if (i%10 == 0 ~ ~ (i == 1 && nc[ix] != 1)) 1
j = (i < 0)? -i : i;
for (px = pn; j; j /= 10, px--)
*px=j%10+'0';
if <i < o)
*px = . .;
1
else
*pn = . , .
i++;
1
i;
*Pn = ~\0~;
nc[ix] = i;
$0 for (pn = mine; *pn; pn++)
(void) putt(*pn, fx);
(void) putt('\n', fx);
1
SS /*
* put out a line (name, [num], seq, [num]): dumpblockQ
*/
static
putline(ix) puthrie
60 int ix;
29
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
Table 1 cony)
int i;
register char *px;
for (px = namex[ix], i = 0; *px && *px ! _ ':'; px++, i++)
(void) putc(*px, fx);
for (; i < lmax+P SPC; i++)
(void) putc(' ', fx);
/* these count from 1:
* nib is current element (from 1)
nc~ is number at start of current Iine
*/
for (px = out[ix]; *px; px++)
(void) putc(*px&Ox7F, fx);
(void) putc('\n', fx);
...putline
/*
* put a line of stars (seqs always in out[0], out[1]): dumpblockQ
*/
static
stars()
stars
f
int i;
register char *p0, *pl, cx, *px;
if (!*out[o] I,I (*out[0] _ _ ' ' && *(po[o]) _ _ ' ') I I
!*out[1] I I (*out[1] _ _ ' ' && *(po[l]) _- ' '))
return;
px = star;
for (i = lmax+P SPC; i; i--)
*px++ _ ' w
for (p0 = out[0], p1 = out[1]; *p0 && *pl; p0++, p1++) {
if (isalpha(*p0) && isalpha(*pl)) {
if (xbm[*p0-'A']&xbm[*pl-'A']) ~
cx = ' *'
nm+ +;
else if (!dna && day[*p0-'A'][*pl-'A'] > 0)
cx = ' ' ;
else
cx = ";
else
cx = ";
*px++ = cx;
*px++ _ '\n';
*px = '\0';
1
30
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
Table 1 (cony)
/*
* strip path or prefix from pn, return len: pr align()
*%
static
stripname(pn) strlpname
char *pn; /~' file name (may be path) */
register char *px, *py;
1O py = 0;
for (px = pn; *px; px++)
if (*px =_ '/')
py=px+1;
if (py)
(void) strcpy(pn, py);
return(strlen(pn));
25
35
45
55
31
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
Table 1 ~cont')
/*
* cleanup() -- cleanup any tmp file
getseq() -- read in seq, set dna, len, maxlen
* g callocQ -- callocQ with error checkin
* readjmpsQ -- get the good jmps, from tmp file if necessary
* writejmpsQ -- write a filled array of jmps to a tmp file: nwQ
*/
#include "nw.h"
#include < sys/file. h >
char *jname = "/tmp/homgXXXXXX"; /* tmp file for jmps */
FILE *fj;
int cleanup(); /* cleanup tmp file */
long lseekQ;
/*
* remove any tmp file if we blow
*!
cleanup(i) cleanup
int i;
f
if (fj)
(void) unlink(jname);
exit(i);
1
/*
* read, return ptr to seq, set dna, len, maxlen
* skip lines starting with ';', ' <', or ' >'
* seq in upper or lower case
*/
char *
getseq(file, len) getSe(1
char *file; /* file name */
int *len; /* seq len */
1
char line[1024], *pseq;
register char *px, *py;
int natgc, tlen;
FILE *fp;
if ((fp = fopen(file, "r")) _ = 0) 1
fprintf(stderr,"%s: can't read %s\n", prog, file);
exit(1);
tlen = natgc = 0;
while (fgets(line, 1024, fp)) 1
if (*line =- ''' ~ ~ *line =- '<' ~ ~ *line =_ '>')
continue;
for (px = line; *px ! _ '\n'; px++)
if (isupper(*px) ~ ~ islower(*px))
tlen++;
1
if ((pseq = malloc((unsigned)(tlen+6))) _ = 0) f
fprintf(stderr,"%s: malloc() failed to get %d bytes for %s\n", prog, tlen+6,
file);
exit(1);
1
pseq[0] = pseq[1] = pseq[2] = pseq[3] _ '\0';
32
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
Table 1 (cony)
...getseq
py = pseq + 4;
*len = tlen;
rewind(fp);
S
while (fgets(line, 1024, fp)) ~
if (*line =- ';' ( ~ *line =_ ' <' ~ ~ *line =_ ' >')
continue;
for (px = line; *px ! _ '\n'; px++) ~
if (isupper(*px))
*py++ _ *px;
else if (islower(*px))
*py++ = toupper{*px);
if (index("ATGCU",*(py-1)))
natgc++;
*PY++ = '\0';
*PY = ~\0~;
(void) fclose(fp);
dna = natgc > (tlen/3);
return(pseq+4);
char
g calloc(msg, nx, sz) g_Ca110C
char *msg; /* program, calling routine */
int nx, sz; /* number and size of elements */
char *px, *callocQ;
if ((px = calloc((unsigned)nx, (unsigned)sz)) _ = 0) {
if (*msg) f
fprintf(stderr, "%s: g callocQ failed %s (n= %d, sz= %d)\n", prog, msg, nx,
sz);
exit(1);
return(px);
/*
* get final jmps from dx0 or tmp file, set pp~, reset dmax: main()
*/
readjmpsQ read] rilpS
int fd = -1;
int siz, i0, i1;
register i, j, xx;
SO if (1j) {
(void) fclose(fj);
if ((fd = open(jname, O_RDONLY, 0)) < 0) ~
fprintf(stderr, "%s: can't open() %s\n", prog, jname);
cleanup(1);
for (i = i0 = i1 = 0, dmax0 = dmax, xx = len0; ; i++) f
wile (1) f
for (j = dx[dmax].ijmp; j > = 0 && dx[dmax].jp.x(j] > = xx; j--)
60 ;
33
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
Table 1 (coot')
...readjmps
if (j < 0 && dx[dmax].offset && fj) {
(void) lseek(fd, dx[dmax].offset, 0);
(void) read(fd, (char *)&dx[dmax].jp, sizeof(struct jmp));
S (void) read(fd, (char *)&dx[dmax].offset, sizeof(dx[dmax].offset));
dx[dmax].ijmp = MAXJMP-1;
else
break;
1
if (i > = JMPS) f
fprintf(stderr, " % s: too many gaps in alignment\n", prog);
cleanup(1);
f~ >=0)1
siz = dx[dmax].jp.n[j];
xx = dx[dmax].jp.x[j];
dmax += siz;
if (siz < 0) ~ /* gap in second seq */
pp[1].n[il] _ -siz;
xx + = siz;
l*id=xx-yy+lenl-1
*/
pp[1].x[il] = x~ - dmax + lent - 1;
gapy++;
ngapy -= siz;
/* ignore MAXGAP when doing endgaps */
siz = (-siz < MAXGAP ~ ~ endgaps)? -siz : MAXGAP;
i1++;
30 1
else if (siz > 0) { /* gap in first seq */
pp[0].n[i0] = siz;
pp[0].x[i0] = xx;
gapx++;
3$ ngapx += siz;
/* ignore MAXGAP when doing endgaps */
siz = (siz < MAXGAP ~ ~ endgaps)? siz : MAXGAP;
i0++;
else
break;
/* reverse the order of jmps
*/
for (j = 0, i0--; j < i0; j++, i0--)
~
i = PP[O]~nG]; PP[O].nU] = PP[Ol.n[i0];
PP[Ol.n[i0] = i;
1 - PP[0].x[j]; PP[O].x[j] = pp[0].x[i0];
pp[0].x[i0] = i;
for (j = 0, i1--; j < i1; j++, i1--)
~
i = pp[l].n[j]; pp[1].n[j] = pp(1].n(il];
pp[l].n[il] = i;
i = PP[1]~xG]; PP[1]-xC>] = PP(1].x(il];
PP[1].x[il] = i;
if (fd > = 0)
(void) close(fd);
if (fj) ~
(void) unlink(jname);
fj = 0;
offset = 0;
34
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
Table 1 (cony)
/*
* write a filled jmp struct offset of the prev one (if any): nwQ
*/
writejmps(ix) writejmps
int ix;
char *mktemp();
if (!fj) ~
if (mktemp(jname) < 0) {
fprintf(stderr, " % s: can't mktempQ % s\n", prog, jname);
cleanup(1);
if ((fj = fopen(jname, "w")) _= 0) ~
fprintf(stderr, " % s: can't write % s\n", prog, jname);
exit(1);
(void) fwrite((char *)&dx[ix].jp, sizeof(struct jmp), 1, fj);
(void) fwrite((char *)&dx[ix].offset, sizeof(dx[ix].offset), 1, fj);
30
40
50
60
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
Table 2
PRO XXXXXXXXXXXXXXX (Length = 15 amino acids)
Comparison Protein XXXXXYYYYYYY (Length = 12 amino acids)
% amino acid sequence identity =
(the number of identically matching amino acid residues between the two
polypeptide sequences as determined
by ALIGN-2) divided by (the total number of amino acid residues of the PRO
polypeptide) _
5 divided by 15 = 33.3
Table 3
PRO XXXXXXXXXX (Length = 10 amino acids)
Comparison Protein XXXXXYYYYYYZZYZ (Length = 15 amino acids)
amino acid sequence identity =
(the number of identically matching amino acid residues between the two
polypeptide sequences as determined
by ALIGN-2) divided by (the total number of amino acid residues of the PRO
polypeptide) _
5 divided by 10 = 50
Table 4
2.5
PRO-DNA NNNNNNNNNNNNNN (Length = 14 nucleotides)
Comparison DNA NNNNNNLLLLLLLLLL (Length = 16 nucleotides)
nucleic acid sequence identity =
(the number of identically matching nucleotides between the two nucleic acid
sequences as determined by
ALIGN-2) divided by (the total number of nucleotides of the PRO-DNA nucleic
acid sequence) _
6 divided by 14 = 42.9
36
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
Table 5
PRO-DNA NNNNNNNNNNNN (Length = 12 nucleotides)
Comparison DNA NNNNLLLVV (Length = 9 nucleotides)
% nucleic acid sequence identity =
(the number of identically matching nucleotides between the two nucleic acid
sequences as determined by
ALIGN-2) divided by (the total number of nucleotides of the PRO-DNA nucleic
acid sequence) _
4 divided by 12 = 33.3
II. Compositions and Methods of the Invention
A. Full-Length Bolekine Polvpe~tides
The present invention provides newly identified and isolated nucleotide
sequences encoding polypeptides
referred to in the present application as Bolekine polypeptides. In
particular, cDNAs encoding various Bolekine
polypeptides have been identified and isolated, as disclosed in further detail
in the Examples below. However,
for sake of simplicity, in the present specification the protein encoded by
the full length native nucleic acid
molecules disclosed herein as well as all further native homologues and
variants included in the foregoing
definition of Bolekine, will be referred to as Bolekine, regardless of their
origin or mode of preparation.
As disclosed in the Examples below, Bolekine cDNA clone has been deposited
with the ATCC. The
actual nucleotide sequences of those clones can readily be determined by the
skilled artisan by sequencing of the
deposited clone using routine methods in the art. The predicted amino acid
sequence can be determined from
the nucleotide sequence using routine skill. For the Bolekine polypeptides and
encoding nucleic acids described
herein, Applicants have identified what is believed to be the reading frame
best identifiable with the sequence
information available at the time.
B. Bolekine Polypeptide Variants
In addition to the full-length native sequence Bolekine polypeptides described
herein, it is contemplated
that Bolekine variants can be prepared. Bolekine variants can be prepared by
introducing appropriate nucleotide
changes into the Bolekine DNA, and/or by synthesis of the desired Bolekine
polypeptide. Those skilled in the
art will appreciate that amino acid changes may alter post-translational
processes of the Bolekine, such as
changing the number or position of glycosylation sites or altering the
membrane anchoring characteristics.
Variations in the native full-length sequence Bolekine or in various domains
of the Bolekine described
herein, can be made, for example, using any of the techniques and guidelines
for conservative and non-
conservative mutations set forth, for instance, in U.S. Patent No. 5,364,934.
Variations may be a substitution,
deletion or insertion of one or more codons encoding the Bolekine that results
in a change in the amino acid
sequence of the Bolekine as compared with the native sequence Bolekine.
Optionally the variation is by
37
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
substitution of at least one amino acid with any other amino acid in one or
more of the domains of the Bolekine.
Guidance in determining which amino acid residue may be inserted, substituted
or deleted without adversely
affecting the desired activity may be found by comparing the sequence of the
Bolekine with that of homologous
known protein molecules and minimizing the number of amino acid sequence
changes made in regions of high
homology. Amino acid substitutions can be the result of replacing one amino
acid with another amino acid
having similar structural and/or chemical properties, such as the replacement
of a leucine with a serine, i.e.,
conservative amino acid replacements. Insertions or deletions may optionally
be in the range of about 1 to 5
amino acids. The variation allowed may be determined by systematically making
insertions, deletions or
substitutions of amino acids in the sequence and testing the resulting
variants for activity exhibited by the full-
length or mature native sequence.
Bolekine polypeptide fragments are provided herein. Such fragments may be
truncated at the N-
terminus or C-terminus, or may lack internal residues, for example, when
compared with a full length native
protein. Certain fragments lack amino acid residues that are not essential for
a desired biological activity of the
Bolekine polypeptide.
Bolekine fragments may be prepared by any of a number of conventional
techniques. Desired peptide
fragments may be chemically synthesized. An alternative approach involves
generating Bolekine fragments by
enzymatic digestion, e.g., by treating the protein with an enzyme known to
cleave proteins at sites defined by
particular amino acid residues, or by digesting the DNA with suitable
restriction enzymes and isolating the
desired fragment. Yet another suitable technique involves isolating and
amplifying a DNA fragment encoding
a desired polypeptide fragment, by polymerase chain reaction (PCR).
Oligonucleotides that define the desired
termini of the DNA fragment are employed at the 5' and 3' primers in the PCR.
Preferably, Bolekine
polypeptide fragments share at least one biological and/or immunological
activity with the native Bolekine
polypeptide disclosed herein.
In particular embodiments, conservative substitutions of interest are shown in
Table 6 under the heading
of preferred substitutions. If such substitutions result in a change in
biological activity, then more substantial
changes, denominated exemplary substitutions in Table 6, or as further
described below in reference to amino
acid classes, are introduced and the products screened.
3~
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
Table 6
Original Exemplary Preferred
Residue Substitutions Substitutions
Ala (A) val; leu; ile val
Arg (R) lys; gln; asn lys
Asn (N) gln; his; lys; arg gln
Asp (D) glu glu
Cys (C) ser ser
Gln (Q) asn asn
Glu (E) asp asp
Gly (G) pro; ala ala
His (H) asn; gln; lys; arg arg
Ile (I) leu; val; met; ala; phe;
norleucine leu
Leu (L) norleucine; ile; val;
met; ala; phe ile
Lys (K) arg; gln; asn arg
Met (M) leu; phe; ile leu
Phe (F) leu; val; ile; ala; tyr leu
Pro (P) ala ala
Ser (S) thr thr
Thr (T) ser ser
Trp (W) tyr; phe tyr
Tyr (Y) trp; phe; thr; ser phe
Val (V) ile; leu; met; phe;
ala; norleucine leu
Substantial modifications in function or immunological identity of the
Bolekine polypeptide are
accomplished by selecting substitutions that differ significantly in their
effect on maintaining (a) the structure
of the polypeptide backbone in the area of the substitution, for example, as a
sheet or helical conformation, (b)
the charge or hydrophobicity of the molecule at the target site, or (c) the
bulk of the side chain. Naturally
occurring residues are divided into groups based on common side-chain
properties:
(1) hydrophobic: norleucine, met, ala, val, leu, ile;
(2) neutral hydrophilic: cys, ser, thr;
(3) acidic: asp, glu;
(4) basic: asn, gln, his, lys, arg;
(5) residues that influence chain orientation: gly, pro; and
(6) aromatic: trp, tyr, phe.
Non-conservative substitutions will entail exchanging a member of one of these
classes for another class.
Such substituted residues also may be introduced into the conservative
substitution sites or, more preferably, into
the remaining (non-conserved) sites.
The variations can be made using methods known in the art such as
oligonucleotide-mediated (site-
directed) mutagenesis, alanine scanning, and PCR mutagenesis. Site-directed
mutagenesis [Carter et al., Nucl.
Acids Res., 13:4331 (1986); Zoller et al., Nucl. Acids Res., 10:6487 (1987)],
cassette mutagenesis [Wells et
39
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
al., Gene, 34:315 (1985)], restriction selection mutagenesis [Wells et al.,
Philos. Traps. R. Soc. London SerA,
317:415 (1986)] or other known techniques can be performed on the cloned DNA
to produce the Bolekine
variant DNA.
Scanning amino acid analysis can also be employed to identify one or more
amino acids along a
contiguous sequence. Among the preferred scanning amino acids are relatively
small, neutral amino acids. Such
amino acids include alanine, glycine, serine, and cysteine. Alanine is
typically a preferred scanning amino acid
among this group because it eliminates the side-chain beyond the beta-carbon
and is less likely to alter the main-
chain conformation of the variant [Cunningham and Wells, Science, 244: 1081-
1085 (1989)]. Alanine is also
typically preferred because it is the most common amino acid. Further, it is
frequently found in both buried and
exposed positions [Creighton, The Proteins, (W.H. Freeman ~Z Co., N.Y.);
Chothia, J. Mol. Biol., 150:1
(1976)]. If alanine substitution does not yield adequate amounts of variant,
an isoteric amino acid can be used.
C. Modifications of Bolekine
Covalent modifications of Bolekine are included within the scope of this
invention. One type of covalent
modification includes reacting targeted amino acid residues of a Bolekine
polypeptide with an organic
derivatizing agent that is capable of reacting with selected side chains or
the N- or C- terminal residues of the
Bolekine. Derivatization with bifunctional agents is useful, for instance, for
crosslinking Bolekine to a water-
insoluble support matrix or surface for use in the method for purifying anti-
Bolekine antibodies, and vice-versa.
Commonly used crosslinking agents include, e.g., 1,1-bis(diazoacetyl)-2-
phenylethane, glutaraldehyde, N-
hydroxysuccinimide esters, for example, esters with 4-azidosalicylic acid,
homobifunctional imidoesters,
including disuccinimidyl esters such as 3,3'-
dithiobis(succinimidylpropionate), bifunctional maleimides such as
bis-N-maleimido-1,8-octane and agents such as methyl-3-[(p-
azidophenyl)dithio]propioimidate.
Other modifications include deamidation of glutaminyl and asparaginyl residues
to the corresponding
glutamyl and aspartyl residues, respectively, hydroxylation of proline and
lysine, phosphorylation of hydroxyl
groups of seryl or threonyl residues, methylation of the a-amino groups of
lysine, arginine, and histidine side
chains [T.E. Creighton, Proteins: Structure and Molecular Properties, W.H.
Freeman & Co., San Francisco,
pp. 79-86 (1983)], acetylation of the N-terminal amine, and amidation of any C-
terminal carboxyl group.
Another type of covalent modification of the Bolekine polypeptide included
within the scope of this
invention comprises altering the native glycosylation pattern of the
polypeptide. "Altering the native
glycosylation pattern" is intended for purposes herein to mean deleting one or
more carbohydrate moieties found
in native sequence Bolekine (either by removing the underlying glycosylation
site or by deleting the glycosylation
by chemical and/or enzymatic means), and/or adding one or more glycosylation
sites that are not present in the
native sequence Bolekine. In addition, the phrase includes qualitative changes
in the glycosylation of the native
proteins, involving a change in the nature and proportions of the various
carbohydrate moieties present.
Addition of glycosylation sites to the Bolekine polypeptide may be
accomplished by altering the amino
acid sequence. The alteration may be made, for example, by the addition of, or
substitution by, one or more
serine or threonine residues to the native sequence Bolekine (for O-linked
glycosylation sites). The Bolekine
amino acid sequence may optionally be altered through changes at the DNA
level, particularly by mutating the
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
DNA encoding the Bolekine polypeptide at preselected bases such that codons
are generated that will translate
into the desired amino acids.
Another means of increasing the number of carbohydrate moieties on the
Bolekine polypeptide is by
chemical or enzymatic coupling of glycosides to the polypeptide. Such methods
are described in the art, e.g.,
in WO 87/05330 published 11 September 1987, and in Aplin and Wriston, CRC
Crit. Rev. Biochem., pp. 259-
306 (1981).
Removal of carbohydrate moieties present on the Bolekine polypeptide may be
accomplished chemically
or enzymatically or by mutational substitution of codons encoding for amino
acid residues that serve as targets
for glycosylation. Chemical deglycosylation techniques are known in the art
and described, for instance, by
Hakimuddin, et al., Arch. Biachem. Biophys., 259:52 (1987) and by Edge et al.,
Anal. Biochem., 118:131
(1981). Enzymatic cleavage of carbohydrate moieties on polypeptides can be
achieved by the use of a variety
of endo- and exo-glycosidases as described by Thotakura et al., Meth.
Enzymol., 138:350 (1987).
Another type of covalent modification of Bolekine comprises linking the
Bolekine polypeptide to one
of a variety of nonproteinaceous polymers, e.g., polyethylene glycol (PEG),
polypropylene glycol, or
polyoxyalkylenes, in the manner set forth in U.S. Patent Nos. 4,640,835;
4,496,689; 4,301,144; 4,670,417;
4,791,192 or 4,179,337.
The Bolekine of the present invention may also be modified in a way to form a
chimeric molecule
comprising Bolekine fused to another, heterologous polypeptide or amino acid
sequence.
In one embodiment, such a chimeric molecule comprises a fusion of the Bolekine
with a tag polypeptide
which provides an epitope to which an anti-tag antibody can selectively bind.
The epitope tag is generally placed
at the amino- or carboxyl- terminus of the Bolekine. The presence of such
epitope-tagged forms of the Bolekine
can be.detected using an antibody against the tag polypeptide. Also, provision
of the epitope tag enables the
Bolekine to be readily purified by affinity purification using an anti-tag
antibody or another type of affinity
matrix that binds to the epitope tag. Various tag polypeptides and their
respective antibodies are well known in
the art. Examples include poly-histidine (poly-his) or poly-histidine-glycine
(poly-his-gly) tags; the flu HA tag
polypeptide and its antibody 12CA5 [Field et al., Mol. Cell. Biol., 8:2159-
2165 (1988)]; the c-myc tag and the
8F9, 3C7, 6E10, G4, B7 and 9E10 antibodies thereto [Evan et al., Molecular and
Cellular Biolo~y, 5:3610-3616
(1985)]; and the Herpes Simplex virus glycoprotein D (gD) tag and its antibody
[Paborsky et al., Protein
En~ineerin~, 3(6):547-553 (1990)]. Other tag polypeptides include the Flag-
peptide [Hopp et al.,
BioTechnolo~y, 6:1204-1210 (1988)]; the KT3 epitope peptide [Martin et al.,
Science, 255:192-194 (1992)];
an a-tubulin epitope peptide [Skinner et al., J. Biol. Chem., 266:15163-15166
(1991)]; and the T7 gene 10
protein peptide tag [Lutz-Freyermuth et al., Proc. Natl. Acad. Sci. USA,
87:6393-6397 (1990)].
In an alternative embodiment, the chimeric molecule may comprise a fusion of
the Bolekine with an
immunoglobulin or a particular region of an immunoglobulin. For a bivalent
form of the chimeric molecule (also
referred to as an "immunoadhesin"), such a fusion could be to the Fc region of
an IgG molecule. The Ig fusions
preferably include the substitution of a soluble (transmembrane domain deleted
or inactivated) form of a Bolekine
polypeptide in place of at least one variable region within an Ig molecule. In
a particularly preferred
embodiment, the immunoglobulin fusion includes the hinge, CH2 and CH3, or the
hinge, CHl, CH2 and CH3
41
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
regions of an IgG1 molecule. For the production of immunoglobulin fusions see
also US Patent No. 5,428,130
issued June 27, 1995.
D. Pr~aration of Bolekine
The description below relates primarily to production of Bolekine by culturing
cells transformed or
transfected with a vector containing Bolekine nucleic acid. It is, of course,
contemplated that alternative
methods, which are well known in the art, may be employed to prepare Bolekine.
For instance, the Bolekine
sequence, or portions thereof, may be produced by direct peptide synthesis
using solid-phase techniques [see,
e.g., Stewart et al., Solid-Phase Peptide Synthesis, W.H. Freeman Co., San
Francisco, CA (1969); Merrifield,
J. Am. Chem. Soc., 85:2149-2154 (1963)]. ht vitro protein synthesis may be
performed using manual
techniques or by automation. Automated, synthesis may be accomplished, for
instance, using an Applied
Biosystems Peptide Synthesizer (Foster City, CA) using manufacturer's
instructions. Various portions of the
Bolekine may be chemically synthesized separately and combined using chemical
or enzymatic methods to
produce the full-length Bolekine.
1. Isolation of DNA Encoding Bolekine
DNA encoding Bolekine may be obtained from a cDNA library prepared from tissue
believed to possess
the Bolekine mRNA and to express it at a detectable level. Accordingly, human
Bolekine DNA can be
conveniently obtained from a cDNA library prepared from human tissue, such as
described in the Examples.
The Bolekine-encoding gene may also be obtained from a genomic library or by
known synthetic procedures
(e.g., automated nucleic acid synthesis).
Libraries can be screened with probes (such as antibodies to the Bolekine or
oligonucleotides of at least
about 20-80 bases) designed to identify the gene of interest or the protein
encoded by it. Screening the cDNA
or genomic library with the selected probe may be conducted using standard
procedures, such as described in
Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring
Harbor Laboratory Press,
1989). An alternative means to isolate the gene encoding Bolekine is to use
PCR methodology [Sambrook et
al., supra; Dieffenbach et al., PCR Primer: A Laboratory Manual (Cold Spring
Harbor Laboratory Press,
1995)].
The Examples below describe techniques for screening a cDNA libraxy. The
oligonucleotide sequences
selected as probes should be of sufficient length and sufficiently unambiguous
that false positives are nninirnized.
The oligonucleotide is preferably labeled such that it can be detected upon
hybridization to DNA in the library
being screened. Methods of labeling are well known in the art, and include the
use of radiolabels like 32P-labeled
ATP, biotinylation or enzyme labeling. Hybridization conditions, including
moderate stringency and high
stringency, are provided in Sambrook et al., su ra.
Sequences identified in such library screening methods can be compared and
aligned to other known
sequences deposited and available in public databases such as GenBank or other
private sequence databases.
Sequence identity (at either the amino acid or nucleotide level) within
defined regions of the molecule or across
the full-length sequence can be determined using methods known in the art and
as described herein.
42
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
Nucleic acid having protein coding sequence may be obtained by screening
selected cDNA or genomic
libraries using the deduced amino acid sequence disclosed herein for the first
time, and, if necessary, using
conventional primer extension procedures as described in Sambrook et al.,
supra, to detect precursors and
processing intermediates of mRNA that may not have been reverse-transcribed
into cDNA.
2. Selection and Transformation of Host Cells
Host cells are transfected or transformed with expression or cloning vectors
described herein for
Bolekine production and cultured in conventional nutrient media modified as
appropriate for inducing promoters,
selecting transformants, or amplifying the genes encoding the desired
sequences. The culture conditions, such
as media, temperature, pH and the like, can be selected by the skilled artisan
without undue experimentation.
In general, principles, protocols, and practical techniques for maximizing the
productivity of cell cultures can
be found in Mammalian Cell Biotechnolo~y: a Practical Approach, M. Butler, ed.
(IRL Press, 1991) and
Sambrook et al., supra.
Methods of eukaryotic cell transfection and prokaryotic cell transformation
are known to the ordinarily
skilled artisan, for example, CaCl2, CaP04, liposome-mediated and
electroporation. Depending on the host cell
used, transformation is performed using standard techniques appropriate to
such cells. The calcium treatment
employing calcium chloride, as described in Sambrook et al., supra, or
electroporation is generally used for
prokaryotes. Infection with Agrobacterium tumefaciezzs is used for
transformation of certain plant cells, as
described by Shaw et al., Gene, 23:315 (1983) and WO 89/05859 published 29
June 1989. For mammalian cells
without such cell walls, the calcium phosphate precipitation method of Graham
and van der Eb, Viroloay,
52:456-457 (1978) can be employed. General aspects of mammalian cell host
system transfections have been
described in U.S. Patent No. 4,399,216. Transformations into yeast are
typically carried out according to the
method of Van Solingen et al., J. Bact., 130:946 (1977) and Hsiao et al.,
Proc. Natl. Acad. Sci. (USA), 76:3829
(1979). However, other methods for introducing DNA into cells, such as by
nuclear microinjection,
electroporation, bacterial protoplast fusion with intact cells, or
polycations, e.g., polybrene, polyornithine, may
2,5 also be used. For various techniques for transforming mammalian cells, see
Keown et al., Methods in
Enzymology, 185:527-537 (1990) and Mansour et al., Nature, 336:348-352 (1988).
Suitable host cells for cloning or expressing the DNA in the vectors herein
include prokaryote, yeast,
or higher eukaryote cells. Suitable prokaryotes include but are not limited to
eubacteria, such as Gram-negative
or Gram-positive organisms, for example, Enterobacteriaceae such as E. coli.
Various E. coli strains are
publicly available, such as E. coli K12 strain MM294 (ATCC 31,446); E. coli
X1776 (ATCC 31,537); E. coli
strain W3110 (ATCC 27,325) and KS 772 (ATCC 53,635). Other suitable
prokaryotic host cells include
Enterobacteriaceae such as Eschez-icltia, e.g., E. coli, Enterobacter,
Erwinia, Klebsiella, Proteus, Salmonella,
e.g., Salntonella typhinturium, Sez-ratia, e.g., Sert~atia marcescarts, and
Shigella, as well as Bacilli such as B.
subtilis and B. liclzenifornzis (e.g., B. licheniforntis 41P disclosed in DD
266,710 published 12 April 1989),
Pseudomonas such as P. aerugizzosa, and Stz-eptonzyces. These examples are
illustrative rather than limiting.
Strain W3110 is one particularly preferred host or parent host because it is a
common host strain for recombinant
DNA product fermentations. Preferably, the host cell secretes minimal amounts
of proteolytic enzymes. For
43
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
example, strain W3110 may be modified to effect a genetic mutation in the
genes encoding proteins endogenous
to the host, with examples of such hosts including E. cold W3110 strain 1A2,
which has the complete genotype
tozzA ; E. coli W3110 strain 9E4, which has the complete genotype tonA ptr3;
E. coli W3110 strain 27C7
(ATCC 55, 244), which has the complete genotype toztA ptr3 plzoA EI S (argF
lac) 169 degP ornpT kazzr; E. coli
W3110 strain 37D6, which has the complete genotype tonA ptr3 pltoA EIS (argF
lac)169 degP ompT rbs7
llvG kanr; E. coli W3110 strain 40B4, which is strain 37D6 with a non-
kanamycin resistant degP deletion
mutation; and an E. coli strain having mutant periplasmic protease disclosed
in U. S. Patent No. 4,946,783 issued
7 August 1990. Alternatively, in vitro methods of cloning, e.g., PCR or other
nucleic acid polymerase
reactions, are suitable.
In addition to prokaryotes, eukaryotic microbes such as filamentous fungi or
yeast are suitable cloning
or expression hosts for Bolekine-encoding vectors. Saccltaromyces cerevisiae
is a commonly used lower
eukaryotic host microorganism. Others include Schizosaccharotnyces pombe
(Beach and Nurse, Nature, 290:
140 [1981]; EP 139,383 published 2 May 1985); Kluyveromyces hosts (U.S. Patent
No. 4,943,529; Fleer et al.,
Bio/Technolosy, 9:968-975 (1991)) such as, e.g., K. lactis (MW98-8C, CBS683,
CBS4574; Louvencourt et al.,
J. Bacteriol., 154(2):737-742 [1983]), K. fragilis (ATCC 12,424), K.
bulgaricus (ATCC 16,045), K. wickeramii
(ATCC 24,178), K. waltii (ATCC 56,500), K. drosophilarum (ATCC 36,906; Van den
Berg et al.,
Bio/Technoloey, 8:135 (1990)), K. thermotolerans, and K. ntarxianus; yarrowia
(EP 402,226); Pichia pastoris
(EP 183,070; Sreekrishna et al., J. Basic Microbiol., 28:265-278 [1988]);
Candida; Triclzodernza reesia (EP
244,234); Neurospora crassa (Case et al., Proc. Natl. Acad. Sci. USA, 76:5259-
5263 [1979]); Sclzwanniomyces
such as Schwanniomyces occidentalis (EP 394,538 published 31 October 1990);
and filamentous fungi such as,
e.g., Neurospora, Perticillium, Tolypocladiztm (WO 91/00357 published 10
January 1991), andAspergillus hosts
such as A. nidulans (Ballance et al., Biochem. Biophys. Res. Commun., 112:284-
289 [1983]; Tilburn et al.,
Gene, 26:205-221 [1983]; Yelton et al. , Proc. Natl. Acad. Sci. USA, 81: 1470-
1474 [1984]) and A. niger (Kelly
and Hynes, EMBO J., 4:475-479 [1985]). Methylotropic yeasts are suitable
herein and include, but are not
limited to, yeast capable of growth on methanol selected from the genera
consisting of Hazzsenula, Candida,
Kloeckera, Pichia, Saccharomyces, Torulopsis, and Rlzodotorula. A list of
specific species that are exemplary
of this class of yeasts may be found in C. Anthony, The Biochemistry of Meth
l~phs, 269 (1982).
Suitable host cells for the expression of glycosylated Bolekine are derived
from multicellular organisms.
Examples of invertebrate cells include insect cells such as Drosophila S2 and
Spodoptera Sf9, as well as plant
cells. Examples of useful mammalian host cell lines include Chinese hamster
ovary (CHO) and COS cells.
More specific examples include monkey kidney CV1 line transformed by SV40 (COS-
7, ATCC CRL 1651);
human embryonic kidney line (293 or 293 cells subcloned for growth in
suspension culture, Graham et al., J.
Gen Virol., 36:59 (1977)); Chinese hamster ovary cells/-DHFR (CHO, Urlaub and
Chasin, Proc. Natl. Acad.
Sci. USA, 77:4216 (1980)); mouse sertoli cells (TM4, Mather, Biol. Reprod.,
23:243-251 (1980)); human lung
cells (W138, ATCC CCL 75); human liver cells (Hep G2, HB 8065); and mouse
mammary tumor (MMT
060562, ATCC CCL51). The selection of the appropriate host cell is deemed to
be within the skill in the art.
44
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
3. Selection and Use of a Replicable Vector
The nucleic acid (e.g., cDNA or genomic DNA) encoding Bolekine may be inserted
into a replicable
vector for cloning (amplification of the DNA) or for expression. Various
vectors are publicly available. The
vector may, for example, be in the form of a plasmid, cosmid, viral particle,
or phage. The appropriate nucleic
acid sequence may be inserted into the vector by a variety of procedures. In
general, DNA is inserted into an
appropriate restriction endonuclease sites) using techniques known in the art.
Vector components generally
include, but are not limited to, one or more of a signal sequence, an origin
of replication, one or more marker
genes, an enhancer element, a promoter, and a transcription termination
sequence. Construction of suitable
vectors containing one or more of these components employs standard ligation
techniques which are known to
the skilled artisan.
The Bolekine may be produced recombinantly not only directly, but also as a
fusion polypeptide with
a heterologous polypeptide, which may be a signal sequence or other
polypeptide having a specific cleavage site
at the N-terminus of the mature protein or polypeptide. In general, the signal
sequence may be a component of
the vector, or it may be a part of the Bolekine-encoding DNA that is inserted
into the vector. The signal
sequence may be a prokaryotic signal sequence selected, for example, from the
group of the alkaline
phosphatase, penicillinase, lpp, or heat-stable enterotoxin II leaders. For
yeast secretion the signal sequence may
be, e.g., the yeast invertase leader, alpha factor leader (including
Saccharomyces and Kluyverofnyees a-factor
leaders, the latter described in U.S. Patent No. 5,010,182), or acid
phosphatase leader, the C. albicans
glucoamylase leader (EP 362,179 published 4 April 1990), or the signal
described in WO 90/13646 published
15 November 1990. In mammalian cell expression, mammalian signal sequences may
be used to direct secretion
of the protein, such as signal sequences from secreted polypeptides of the
same or related species, as well as
viral secretory leaders.
Both expression and cloning vectors contain a nucleic acid sequence that
enables the vector to replicate
in one or more selected host cells. Such sequences are well known for a
variety of bacteria, yeast, and viruses.
The origin of replication from the plasmid pBR322 is suitable for most Gram-
negative bacteria, the 2w plasmid
origin is suitable for yeast, and various viral origins (SV40, polyoma,
adenovirus, VSV or BPV) are useful for
cloning vectors in mammalian cells.
Expression and cloning vectors will typically contain a selection gene, also
termed a selectable marker.
Typical selection genes encode proteins that (a) confer resistance to
antibiotics or other toxins, e.g., ampicillin,
neomycin, methotrexate, or tetracycline, (b) complement auxotrophic
deficiencies, or (c) supply critical nutrients
not available from complex media, e.g., the gene encoding D-alanine racemase
for Bacilli.
An example of suitable selectable markers for mammalian cells are those that
enable the identification
of cells competent to take up the Bolekine-encoding nucleic acid, such as DHFR
or thymidine kinase. An
appropriate host cell when wild-type DHFR is employed is the CHO cell line
deficient in DHFR activity,
prepared and propagated as described by Urlaub et al., Proc. Natl. Acad. Sci.
USA, 77:4216 (1980). A suitable
selection gene for use in yeast is the trpl gene present in the yeast plasmid
YRp7 [Stinchcomb et al., Nature,
282:39 (1979); Kingsman et al., Gene, 7:141 (1979); Tschemper et al., Gene,
10:157 (1980)]. The trpl gene
provides a selection marker for a mutant strain of yeast lacking the ability
to grow in tryptophan, for example,
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
ATCC No. 44076 or PEP4-1 [Jones, Genetics, 85:12 (1977)].
Expression and cloning vectors usually contain a promoter operably linked to
the Bolekine-encoding
nucleic acid sequence to direct mRNA synthesis. Promoters recognized by a
variety of potential host cells are
well known. Promoters suitable for use with prokaryotic hosts include the (3-
lactamase and lactose promoter
systems [Chang et al., Nature, 275:615 (1978); Goeddel et al., Nature, 281:544
(1979)], alkaline phosphatase,
a tryptophan (trp) promoter system [Goeddel, Nucleic Acids Res., 8:4057
(1980); EP 36,776], and hybrid
promoters such as the tac promoter [deBoer et al., Proc. Natl. Acad. Sci. USA,
80:21-25 (1983)]. Promoters
for use in bacterial systems also will contain a Shine-Dalgarno (S.D.)
sequence operably linked to the DNA
encoding Bolekine.
Examples of suitable promoting sequences for use with yeast hosts include the
promoters for 3-
phosphoglycerate kinase [Hitzeman et al., J. Biol. Chem., 255:2073 (1980)] or
other glycolytic enzymes [Hess
et al., J. Adv. Enzyme Ree., 7:149 (1968); Holland, Biochemistry, 17:4900
(1978)], such as enolase,
glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase,
phosphofructokinase, glucose-
6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase,
triosephosphate isomerase, phosphoglucose
isomerase, and glucokinase.
Other yeast promoters, which are inducible promoters having the additional
advantage of transcription
controlled by growth conditions, are the promoter regions for alcohol
dehydrogenase 2, isocytochrome C, acid
phosphatase, degradative enzymes associated with nitrogen metabolism,
metallothionein, glyceraldehyde-3-
phosphate dehydrogenase, and enzymes responsible for maltose and galactose
utilization. Suitable vectors and
promoters for use in yeast expression are further described in EP 73,657.
Bolekine transcription from vectors in mammalian host cells is controlled, for
example, by promoters
obtained from the genomes of viruses such as polyoma virus, fowlpox virus (UK
2,211,504 published 5 July
1989), adenovirus (such as Adenovirus 2), bovine papilloma virus, avian
sarcoma virus, cytomegalovirus, a
retrovirus, hepatitis-B virus and Simian Virus 40 (SV40), from heterologous
mammalian promoters, e.g., the
actin promoter or an immunoglobulin promoter, and from heat-shock promoters,
provided such promoters are
compatible with the host cell systems.
Transcription of a DNA encoding the Bolekine by higher eukaryotes may be
increased by inserting an
enhancer sequence into the vector. Enhancers are cis-acting elements of DNA,
usually about from 10 to 300
bp, that act on a promoter to increase its transcription. Many enhancer
sequences are now known from
mammalian genes (globin, elastase, albumin, a-fetoprotein, and insulin).
Typically, however, one will use an
enhancer from a eukaryotic cell virus. Examples.include the SV40 enhancer on
the late side of the replication
origin (bp 100-270), the cytomegalovirus early promoter enhancer, the polyoma
enhancer on the late side of the
replication origin, and adenovirus enhancers. The enhancer may be spliced into
the vector at a position 5' or
3' to the Bolekine coding sequence, but is preferably located at a site 5'
from the promoter.
Expression vectors used in eukaryotic host cells (yeast, fungi, insect, plant,
animal, human, or nucleated
cells from other multicellular organisms) will also contain sequences
necessary for the termination of
transcription and for stabilizing the mRNA. Such sequences are commonly
available from the 5' and,
occasionally 3', untranslated regions of eukaryotic or viral DNAs or cDNAs.
These regions contain nucleotide
46
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
segments transcribed as polyadenylated fragments in the untranslated portion
of the mRNA encoding Bolekine.
Still other methods, vectors, and host cells suitable for adaptation to the
synthesis of Bolekine in
recombinant vertebrate cell culture are described in Gething et al., Nature,
293:620-625 (1981); Mantei et al.,
Nature, 281:40-46 (1979); EP 117,060; and EP 117,058.
4. Detecting Gene Amplification/Expression
Gene amplification andlor expression may be measured in a sample directly, for
example, by
conventional Southexn blotting, Northern blotting to quantitate the
transcription of mRNA [Thomas, Proc. Natl.
Acad. Sci. USA, 77:5201-5205 (1980)], dot blotting (DNA analysis), or ifa situ
hybridization, using an
appropriately labeled probe, based on the sequences provided herein.
Alternatively, antibodies may be employed
that can recognize specific duplexes, including DNA duplexes, RNA duplexes,
and DNA-RNA hybrid duplexes
or DNA-protein duplexes. The antibodies in turn may be labeled and the assay
may be carried out where the
duplex is bound to a surface, so that upon the formation of duplex on the
surface, the presence of antibody bound
to the duplex can be detected.
Gene expression, alternatively, may be measured by immunological methods, such
as
immunohistochemical staining of cells or tissue sections and assay of cell
culture or body fluids, to quantitate
directly the expression of gene product. Antibodies useful for
immunohistochemical staining andlor assay of
sample fluids may be either monoclonal or polyclonal, and may be prepared in
any mammal. Conveniently, the
antibodies may be prepared against a native sequence Bolekine polypeptide or
against a synthetic peptide based
on the DNA sequences provided herein or against exogenous sequence fused to
Bolekine DNA and encoding a
specific antibody epitope.
5. Purification of Polypeptide
Forms of Bolekine may be recovered from culture medium or from host cell
lysates. If membrane-
bound, it can be released from the membrane using a suitable detergent
solution (e.g. Triton-X 100) or by
enzymatic cleavage. Cells employed in expression of Bolekine can be disrupted
by various physical or chemical
means, such as freeze-thaw cycling, sonication, mechanical disruption, or cell
lysing agents.
It may be desired to purify Bolekine from recombinant cell proteins or
polypeptides. The following
procedures are exemplary of suitable purification procedures: by fractionation
on an ion-exchange column;
ethanol precipitation; reverse phase HPLC; chromatography on silica or on a
cation-exchange resin such as
DEAE; chromatofocusing; SDS-PAGE; ammonium sulfate precipitation; gel
filtration using, for example,
Sephadex G-75; protein A Sepharose columns to remove contaminants such as IgG;
and metal chelating columns
to bind epitope-tagged forms of the Bolekine. Various methods of protein
purification may be employed and
such methods are known in the art and described for example in Deutscher,
Methods in Enzvmolo~y, 182
(1990); Scopes, Protein Purification: Principles and Practice, Springer-
Verlag, New York (1982). The
purification steps) selected will depend, for example, on the nature of the
production process used and the
particular Bolekine pxoduced.
47
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
E. Uses for Bolekine
Nucleotide sequences (or their complement) encoding Bolekine have various
applications in the art of
molecular biology, including uses as hybridization probes, in chromosome and
gene mapping and in the
generation of anti-sense RNA and DNA. Bolekine nucleic acid will also be
useful for the preparation of
Bolekine polypeptides by the recombinant techniques described herein.
The full-length native sequence Bolekine gene, or portions thereof, may be
used as hybridization probes
for a cDNA library to isolate the full-length Bolekine cDNA or to isolate
still other cDNAs (for instance, those
encoding naturally-occurring variants of Bolekine or Bolekine from other
species) which have a desired sequence
identity to the native Bolekine sequence disclosed herein. Optionally, the
length of the probes will be about 20
to about 50 bases. The hybridization probes may be derived from at least
partially novel regions of the full
length native nucleotide sequence wherein those regions may be determined
without undue experimentation or
from genomic sequences including promoters, enhancer elements and introns of
native sequence Bolekine. By
way of example, a screening method will comprise isolating the coding region
of the Bolekine gene using the
known DNA sequence to synthesize a selected probe of about 40 bases.
Hybridization probes may be labeled
by a variety of labels, including radionucleotides such as 32P or 355, or
enzymatic labels such as alkaline
phosphatase coupled to the probe via avidin/biotin coupling systems. Labeled
probes having a sequence
complementary to that of the Bolekine gene of the present invention can be
used to screen libraries of human
cDNA, genomic DNA or mRNA to determine which members of such libraries the
probe hybridizes to.
Hybridization techniques are described in further detail in the Examples
below.
Any EST sequences disclosed in the present application may similarly be
employed as probes, using
the methods disclosed herein.
Other useful fragments of the Bolekine nucleic acids include antisense or
sense oligonucleotides
comprising a singe-stranded nucleic acid sequence (either RNA or DNA) capable
of binding to target Bolekine
mRNA (sense) or Bolekine DNA (antisense) sequences. Antisense or sense
oligonucleotides, according to the
present invention, comprise a fragment of the coding region of Bolekine DNA.
Such a fragment generally
comprises at least about 14 nucleotides, preferably from about 14 to 30
nucleotides. The ability to derive an
antisense or a sense oligonucleotide, based upon a cDNA sequence encoding a
given protein is described in, for
example, Stein and Cohen (Cancer Res. 48:2659, 1988) and van der Krol et al.
BioTechni4ues 6:958, 1988).
Binding of antisense or sense oligonucleotides to target nucleic acid
sequences results in the formation
of duplexes that block transcription or translation of the target sequence by
one of several means, including
enhanced degradation of the duplexes, premature termination of transcription
or translation, or by other means.
The antisense oligonucleotides thus may be used to block expression of
Bolekine proteins. Antisense or sense
oligonucleotides further comprise oligonucleotides having modified sugar-
phosphodiester backbones (or other
sugar linkages, such as those described in WO 91/06629) and wherein such sugar
linkages are resistant to
endogenous nucleases. Such oligonucleotides with resistant sugar linkages are
stable ira vivo (i.e., capable of
resisting enzymatic degradation) but retain sequence specificity to be able to
bind to target nucleotide sequences.
Other examples of sense or antisense oliganucleotides include those
oligonucleotides which are
covalently linked to organic moieties, such as those described in WO 90/10048,
and other moieties that increases
48
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
affinity of the oligonucleotide for a target nucleic acid sequence, such as
poly-(L-lysine). Further still,
intercalating agents, such as ellipticine, and alkylating agents or metal
complexes may be attached to sense or
antisense oligonucleotides to modify binding specificities of the antisense or
sense oligonucleotide for the target
nucleotide sequence.
Antisense or sense oligonucleotides may be introduced into a cell containing
the target nucleic acid
sequence by any gene transfer method, including, for example, CaP04-mediated
DNA transfection,
electroporation, or by using gene transfer vectors such as Epstein-Barr virus.
In a preferred procedure, an
antisense or sense oligonucleotide is inserted into a suitable retroviral
vector. A cell containing the target nucleic
acid sequence is contacted with the recombinant retroviral vector, either in
vivo or ex vivo. Suitable retroviral
vectors include, but are not limited to, those derived from the marine
retrovirus M-MuLV, N2 (a retrovirus
derived from M-MuLV), or the double copy vectors designated DCTSA, DCTSB and
DCTSC (see WO
90/13641).
Sense or antisense oligonucleotides also may be introduced into a cell
containing the target nucleotide
sequence by formation of a conjugate with a ligand binding molecule, as
described in WO 91/04753. Suitable
ligand binding molecules include, but are not limited to, cell surface
receptors, growth factors, other cytokines,
or other ligands that bind to cell surface receptors. Preferably, conjugation
of the ligand binding molecule does
not substantially interfere with the ability of the ligand binding molecule to
bind to its corresponding molecule
or receptor, or block entry of the sense or antisense oligonucleotide or its
conjugated version into the cell.
Alternatively, a sense or an antisense oligonucleotide may be introduced into
a cell containing the target
nucleic acid sequence by formation of an oligonucleotide-lipid complex, as
described in WO 90/10448. The
sense or antisense oligonucleotide-lipid complex is preferably dissociated
within the cell by an endogenous lipase.
Antisense or sense RNA or DNA molecules are generally at least about 5 bases
in length, about 10 bases
in length, about 15 bases in length, about 20 bases in length, about 25 bases
in length, about 30 bases in length,
about 35 bases in length, about 40 bases in length, about 45 bases in length,
about 50 bases in length, about 55
bases in length, about 60 bases in length, about 65 bases in length, about 70
bases in length, about 75 bases in
2,5 length, about 80 bases in length, about 85 bases in length, about 90 bases
in length, about 95 bases in length,
about 100 bases in length, or more.
The probes may also be employed in PCR techniques to generate a pool of
sequences for identification
of closely related Bolekine coding sequences.
Nucleotide sequences encoding Bolekine can also be used to construct
hybridization probes for mapping
the gene which encodes that Bolekine and for the genetic analysis of
individuals with genetic disorders. The
nucleotide sequences provided herein may be mapped to a chromosome and
specific regions of a chromosome
using known techniques, such as in situ hybridization, linkage analysis
against known chromosomal markers,
and hybridization screening with libraries.
When the coding sequences for Bolekine encode a protein which binds to another
protein (example,
where the Bolekine is a receptor), the Bolekine can be used in assays to
identify the other proteins or molecules
involved in the binding interaction. By such methods, inhibitors of the
receptor/ligand binding interaction can
be identified. Proteins involved in such binding interactions can also be used
to screen for peptide ox small
49
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
molecule inhibitors or agonists of the binding interaction. Also, the receptor
Bolekine can be used to isolate
correlative ligand(s). Screening assays can be designed to find lead compounds
that mimic the biological activity
of a native Bolekine or a receptor for Bolekine. Such screening assays will
include assays amenable to high-
throughput screening of chemical libraries, making them particularly suitable
for identifying small molecule drug
candidates. Small molecules contemplated include synthetic organic or
inorganic compounds. The assays can
be performed in a variety of formats, including protein-protein binding
assays, biochemical screening assays,
immunoassays and cell based assays, which are well characterized in the art.
Nucleic acids which encode Bolekine or its modified forms can also be used to
generate either transgenic
animals or "knock out" animals which, in turn, are useful in the development
and screening of therapeutically
useful reagents. A transgenic animal (e.g., a mouse or rat) is an animal
having cells that contain a transgene,
which transgene was introduced into the animal or an ancestor of the animal at
a prenatal, e.g., an embryonic
stage. A transgene is a DNA which is integrated into the genome of a cell from
which a transgenic animal
develops. In one embodiment, cDNA encoding Bolekine can be used to clone
genomic DNA encoding Bolekine
in accordance with established techniques and the genomic sequences used to
generate transgenic animals that
contain cells which express DNA encoding Bolekine. Methods for generating
transgenic animals, particularly
animals such as mice or rats, have become conventional in the art and are
described, for example, in U. S. Patent
Nos. 4,736,866 and 4,870,009. Typically, particular cells would be targeted
for Bolekine transgene
incorporation with tissue-specific enhancers. Transgenic animals that include
a copy of a transgene encoding
Bolekine introduced into the germ line of the animal at an embryonic stage can
be used to examine the effect of
increased expression of DNA encoding Bolekine. Such animals can be used as
tester animals for reagents
thought to confer protection from, for example, pathological conditions
associated with its overexpression. In
accordance with this facet of the invention, an animal is treated with the
reagent and a reduced incidence of the
pathological condition, compared to untreated animals bearing the transgene,
would indicate a potential
therapeutic intervention for the pathological condition.
Alternatively, non-human homologues of Bolekine can be used to construct a
Bolekine "knock out"
animal which has a defective or altered gene encoding Bolekine as a result of
homologous recombination between
the endogenous gene encoding Bolekine and altered genomic DNA encoding
Bolekine introduced into an
embryonic stem cell of the animal. For example, cDNA encoding Bolekine can be
used to clone genomic DNA
encoding Bolekine in accordance with established techniques. A portion of the
genomic DNA encoding Bolekine
can be deleted or replaced with another gene, such as a gene encoding a
selectable marker which can be used
to monitor integration. Typically, several kilobases of unaltered flanking DNA
(both at the 5' and 3' ends) are
included in the vector [see e.g., Thomas and Capecchi, Cell, 51:503 (1987) for
a description of homologous
recombination vectors]. The vector is introduced into an embryonic stem cell
line (e.g., by electroporation) and
cells in which the introduced DNA has homologously recombined with the
endogenous DNA are selected [see
e.g., Li et al., Cell, 69:915 (1992)]. The selected cells are then injected
into a blastocyst of an animal (e.g.,
a mouse or rat) to form aggregation chimeras [see e.g., Bradley, in
Teratocarcinomas and Embryonic Stem
Cells: A Practical Approach, E. J. Robertson, ed. (IRL, Oxford, 1987), pp. 113-
152]. A chimeric embryo can
then be implanted into a suitable pseudopregnant female foster animal and the
embryo brought to term to create
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
a "knock out" animal. Progeny harboring the homologously recombined DNA in
their germ cells can be
identified by standard techniques and used to breed animals in which all cells
of the animal contain the
homologously recombined DNA. Knockout animals can be characterized for
instance, for their ability to defend
against certain pathological conditions and for their development of
pathological conditions due to absence of
the Bolekine polypeptide.
Nucleic acid encoding the Bolekine polypeptides may also be used in gene
therapy. In gene therapy
applications, genes are introduced into cells in order to achieve izz vivo
synthesis of a therapeutically effective
genetic product, for example fox replacement of a defective gene. "Gene
therapy" includes both conventional
gene therapy where a lasting effect is achieved by a single treatment, and the
administration of gene therapeutic
agents, which involves the one time or repeated administration of a
therapeutically effective DNA or mRNA.
Antisense RNAs and DNAs can be used as therapeutic agents for blocking the
expression of certain genes izz
vivo. It has already been shown that short antisense oligonucleotides can be
imported into cells where they act
as inhibitors, despite their low intracellular concentrations caused by their
restricted uptake by the cell
membrane. (Zamecnik et al., Proc. Natl. Acad. Sci. USA 83:4143-4146 [1986]).
The oligonucleotides can be
modified to enhance their uptake, e.g. by substituting their negatively
charged phosphodiester groups by
uncharged groups.
There are a variety of techniques available for introducing nucleic acids into
viable cells. The
techniques vary depending upon whether the nucleic acid is transferred into
cultured cells izz vitro, or izz vivo in
the cells of the intended host. Techniques suitable for the transfer of
nucleic acid into mammalian cells iza vitro
include the use of liposomes, electroporation, microinjection, cell fusion,
DEAE-dextran, the calcium phosphate
precipitation method, etc. The currently preferred izz vivo gene transfer
techniques include transfection with viral
(typically retroviral) vectors and viral coat protein-liposome mediated
transfection (Dzau et al., Trends in
Biotechnoloay 11, 205-210 [1993]). In some situations it is desirable to
provide the nucleic acid source with
an agent that targets the target cells, such as an antibody specific for a
cell surface membrane protein or the
target cell, a ligand for a receptor on the target cell, etc. Where liposomes
are employed, proteins which bind
to a cell surface membrane protein associated with endocytosis may be used for
targeting and/or to facilitate
uptake, e.g. capsid proteins or fragments thereof tropic for a particular cell
type, antibodies for proteins which
undergo internalization in cycling, proteins that target intracellular
localization and enhance intracellular half life.
The technique of receptor-mediated endocytosis is described, for example, by
Wu et al., J. Biol. Chem. 262,
4429-4432 (1987); and Wagner et al., Proc. Natl. Acad. Sci. USA 87, 3410-3414
(1990). For review of gene
marking and gene therapy protocols see Anderson et al., Science 256, 808-813
(1992).
The Bolekine polypeptides described herein may also be employed as molecular
weight markers for
protein electrophoresis purposes and the isolated nucleic acid sequences may
be used for recombinantly
expressing those markers.
The nucleic acid molecules encoding the Bolekine polypeptides or fragments
thereof described herein
are useful for chromosome identification. In this regard, there exists an
ongoing need to identify new
chromosome markers, since relatively few chromosome marking reagents, based
upon actual sequence data are
presently available. Each Bolekine nucleic acid molecule of the present
invention can be used as a chromosome
51
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
marker.
The Bolekine polypeptides and nucleic acid molecules of the present invention
may also be used
diagnostically for tissue typing, wherein the Bolekine polypeptides of the
present invention may be differentially
expressed in one tissue as compared to another, preferably in a diseased
tissue as compared to a normal tissue
of the same tissue type. Bolekine nucleic acid molecules will find use for
generating probes for PCR, Northern
analysis, Southern analysis and Western analysis.
The Bolekine polypeptides described herein may also be employed as therapeutic
agents. The Bolekine
polypeptides of the present invention can be formulated according to known
methods to prepare pharmaceutically
useful compositions, whereby the Bolekine product hereof is combined in
admixture with a pharmaceutically
acceptable carrier vehicle. Therapeutic formulations are prepared for storage
by mixing the active ingredient
having the desired degree of purity with optional physiologically acceptable
carriers, excipients or stabilizers
(Remin~ton's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980)), in
the form of lyophilized
formulations or aqueous solutions. Acceptable carriers, excipients or
stabilizers are nontoxic to recipients at the
dosages and concentrations employed, and include buffers such as phosphate,
citrate and other organic acids;
antioxidants including ascorbic acid; low molecular weight (less than about 10
residues) polypeptides; proteins,
such as serum albumin, gelatin or immunoglobulins; hydrophilic polymers such
as polyvinylpyrrolidone, amino
acids such as glycine, glutamine, asparagine, arginine or lysine;
monosaccharides, disaccharides and other
carbohydrates including glucose, mannose, or dextrins; chelating agents such
as EDTA; sugar alcohols such as
mannitol or sorbitol; salt-forming counterions such as sodium; and/or nonionic
surfactants such as TWEENTM,
PLURONICSTM or PEG.
The formulations to be used for iia vivo administration must be sterile. This
is readily accomplished by
filtration through sterile filtration membranes, prior to or following
lyophilization and reconstitution.
Therapeutic compositions herein generally are placed into a container having a
sterile access port, for
example, an intravenous solution bag or vial having a stopper pierceable by a
hypodermic injection needle.
The route of administration is in accord with known methods, e.g. injection or
infusion by intravenous,
intraperitoneal, intracerebral, intramuscular, intraocular, intraarterial or
intralesional routes, topical
administration, or by sustained release systems.
Dosages and desired drug concentrations of pharmaceutical compositions of the
present invention may
vary depending on the particular use envisioned. The determination of the
appropriate dosage or route of
administration is well within the skill of an ordinary physician. Animal
experiments provide reliable guidance
for the determination of effective doses for human therapy. Interspecies
scaling of effective doses can be
performed following the principles laid down by Mordenti, J. and Chappell, W.
"The use of interspecies scaling
in toxicokinetics" In Toxicokinetics and New Drug Development, Yacobi et al.,
Eds., Pergamon Press, New
York 1989, pp. 42-96.
When ih vivo administration of a Bolekine polypeptide or agonist or antagonist
thereof is employed,
normal dosage amounts may vary from about 10 ng/kg to up to 100 mg/kg of
mammal body weight or more per
day, preferably about 1 ~cg/kg/day to 10 mg/kg/day, depending upon the route
of administration. Guidance as
to particular dosages and methods of delivery is provided in the literature;
see, for example, U.S. Pat. Nos.
52
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
4,657,760; 5,206,344; or 5,225,212. It is anticipated that different
formulations will be effective for different
treatment compounds and different disorders, that administration targeting one
organ or tissue, for example, may
necessitate delivery in a manner different from that to another oxgan or
tissue.
Where sustained-release administration of a Bolekine polypeptide is desired in
a formulation with release
characteristics suitable for the treatment of any disease or disorder
requiring administration of the Bolekine
polypeptide, microencapsulation of the Bolekine polypeptide is contemplated.
Microencapsulation of
recombinant proteins for sustained release has been successfully performed
with human growth hormone (rhGH),
interferon- (rhIFN- ), interleukin-2, and MN rgp120. Johnson et al., Nat.
Med., 2:795-799 (1996); Yasuda,
Biomed. Ther., 27:1221-1223 (1993); Hora et al., Bio/Technology, 8:755-758
(1990); Cleland, "Design and
Production of Single hnmunization Vaccines Using Polylactide Polyglycolide
Microsphere Systems," in Vaccine
Design: The Subunit and Adiuvant Approach, Powell and Newman, eds, (Plenum
Press: New York, 1995), pp.
439-462; WO 97/03692, WO 96/40072, WO 96/07399; and U.S. Pat. No. 5,654,010.
The sustained-release formulations of these proteins were developed using poly-
lactic-coglycolic acid
(PLGA) polymer due to its biocompatibility and wide range of biodegradable
properties. The degradation
products of PLGA, lactic and glycolic. acids, can be cleared quickly within
the human body. Moreover, the
degradability of this polymer can be adjusted from months to years depending
on its molecular weight and
composition. Lewis, "Controlled release of bioactive agents from
lactide/glycolide polymer," in: M. Chasm
and R. Langer (Eds.), Biodegradable Polymers as Drug Delivery Systems (Marcel
Dekker: New York, 1990),
pp. 1-41.
This invention encompasses methods of screening compounds to identify those
that mimic the Bolekine
2,0 polypeptide (agonists) or prevent the effect of the Bolekine polypeptide
(antagonists). Screening assays for
antagonist drug candidates are designed to identify compounds that bind or
complex with the Bolekine
polypeptides encoded by the genes identified herein, or otherwise interfere
with the interaction of the encoded
polypeptides with other cellular proteins. Such screening assays will include
assays amenable to high-throughput
screening of chemical libraries, making themparticularly suitable for
identifying small molecule drug candidates.
The assays can be performed in a variety of formats, including protein-protein
binding assays,
biochemical screening assays, immunoassays, and cell-based assays, which are
well characterized in the art.
All assays for antagonists are common in that they call for contacting the
drug candidate with a Bolekine
polypeptide encoded by a nucleic acid identified herein under conditions and
for a time sufficient to allow these
two components to interact.
In binding assays, the interaction is binding and the complex formed can be
isolated or detected in the
reaction mixture. In a particular embodiment, the Bolekine polypeptide encoded
by the gene identified herein
or the drug candidate is immobilized on a solid phase, e.g., on a microtiter
plate, by covalent or non-covalent
attachments. Non-covalent attachment generally is accomplished by coating the
solid surface with a solution of
the Bolekine polypeptide and drying. Alternatively, an immobilized antibody,
e.g., a monoclonal antibody,
specific for the Bolekine polypeptide to be immobilized can be used to anchor
it to a solid surface. The assay
is performed by adding the non-immobilized component, which may be labeled by
a detectable label, to the
immobilized component, e.g., the coated surface containing the anchored
component. When the reaction is
53
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
complete, the non-reacted components are removed, e.g., by washing, and
complexes anchored on the solid
surface are detected. When the originally non-immobilized component carries a
detectable label, the detection
of label immobilized on the surface indicates that complexing occurred, Where
the originally non-immobilized
component does not carry a label, complexing can be detected, for example, by
using a labeled antibody
specifically binding the immobilized complex.
If the candidate compound interacts with but does not bind to a particular
Bolekine polypeptide encoded
by a gene identified herein, its interaction with that polypeptide can be
assayed by methods well known for
detecting protein-protein interactions. Such assays include traditional
approaches, such as, e.g., cross-linking,
co-immunoprecipitation, and co-purification through gradients or
chromatographic columns. In addition,
protein-protein interactions can be monitored by using a yeast-based genetic
system described by Fields and co-
workers (Fields and Song, Nature (London), 340:245-246 (1989); Chien et al.,
Proc. Natl. Acad. Sci. USA,
88:9578-9582 (1991)) as disclosed by Chevray and Nathans, Proc. Natl. Acad.
Sci. USA, 89: 5789-5793 (1991).
Many transcriptional activators, such as yeast GAL4, consist of two physically
discrete modular domains, one
acting as the DNA-binding domain, the other one functioning as the
transcription-activation domain. The yeast
expression system described in the foregoing publications (generally referred
to as the "two-hybrid system")
takes advantage of this property, and employs two hybrid proteins, one in
which the target protein is fused to
the DNA-binding domain of GAL4, and another, in which candidate activating
proteins are fused to the
activation domain. The expression of a GAL1-ZaeZ reporter gene under control
of a GAL4-activated promoter
depends on reconstitution of GAh4 activity via protein-protein interaction.
Colonies containing interacting
polypeptides are detected with a chromogenic substrate for (3-galactosidase. A
complete kit
2.0 (MATCHMAI~ERTM) for identifying protein-protein interactions between two
specific proteins using the two-
hybrid technique is commercially available from Clontech. This system can also
be extended to map protein
domains involved in specific protein interactions as well as to pinpoint amino
acid residues that are crucial for
these interactions,
Compounds that interfere with the interaction of a gene encoding a Bolekine
polypeptide identified
herein and other intra- or extracellular components can be tested as follows:
usually a reaction mixture is
prepared containing the product of the gene and the intra- or extracellular
component under conditions and for
a time allowing for the interaction and binding of the two products. To test
the ability of a candidate compound
to inhibit binding, the reaction is run in the absence and in the presence of
the test compound. In addition, a
placebo may be added to a third reaction mixture, to serve as positive
control. The binding (complex formation)
between the test compound and the intra- or extracellular component present in
the mixture is monitored as
described hereinabove. The formation of a complex in the control reactions)
but not in the reaction mixture
containing the test compound indicates that the test compound interferes with
the interaction of the test compound
and its reaction partner.
To assay for antagonists, the Bolekine polypeptide may be added to a cell
along with the compound to
be screened for a particular activity and the ability of the compound to
inhibit the activity of interest in the
presence of the Bolekine polypeptide indicates that the compound is an
antagonist to the Bolekine polypeptide.
Alternatively, antagonists may be detected by combining the Bolekine
polypeptide and a potential antagonist with
54
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
membrane-bound Bolekine polypeptide receptors or recombinant receptors under
appropriate conditions for a
competitive inhibition assay. The Bolekine polypeptide can be labeled, such as
by radioactivity, such that the
number of Bolekine polypeptide molecules bound to the receptor can be used to
determine the effectiveness of
the potential antagonist. The gene encoding the receptor can be identified by
numerous methods known to those
of skill in the art, for example, ligand panning and FAGS sorting. Coligan et
al., Current Protocols in Immun.,
1(2): Chapter 5 (1991). Preferably, expression cloning is employed wherein
polyadenylated RNA is prepared
from a cell responsive to the Bolekine polypeptide and a cDNA library created
from this RNA is divided into
pools and used to transfect COS cells or other cells that are not responsive
to the Bolekine polypeptide.
Transfected cells that are grown on glass slides are exposed to labeled
Bolekine polypeptide. The Bolekine
polypeptide can be labeled by a variety of means including iodination or
inclusion of a recognition site for a site-
specific protein kinase. Following fixation and incubation, the slides are
subjected to autoradiographic analysis.
Positive pools are identified and sub-pools are prepared and re-transfected
using an interactive sub-pooling and
re-screening process, eventually yielding a single clone that encodes the
putative receptor.
As an alternative approach for receptor identification, labeled Bolekine
polypeptide can be photoaffinity-
linked with cell membrane or extract preparations that express the receptor
molecule. Cross-linked material is
resolved by PAGE and exposed to X-ray filin. The labeled complex containing
the receptor can be excised,
resolved into peptide fragments, and subjected to protein micro-sequencing.
The amino acid sequence obtained
from micro- sequencing would be used to design a set of degenerate
oligonucleotide probes to screen a cDNA
library to identify the gene encoding the putative receptor.
In another assay for antagonists, mammalian Bells or a membrane preparation
expressing the receptor
would be incubated with labeled Bolekine polypeptide in the presence of the
candidate compound. The ability
of the compound to enhance or block this interaction could then be measured.
More specific examples of potential antagonists include an oligonucleotide
that binds to the fusions of
immunoglobulin with Bolekine polypeptide, and, in particular, antibodies
including, without limitation, poly-
and monoclonal antibodies and antibody fragments, single-chain antibodies,
anti-idiotypic antibodies, and
chimeric or humanized versions of such antibodies or fragments, as well as
human antibodies and antibody
fragments. Alternatively, a potential antagonist may be a closely related
protein, for example, a mutated form
of the Bolekine polypeptide that recognizes the receptor but imparts no
effect, thereby competitively inhibiting
the action of the Bolekine polypeptide.
Another potential Bolekine polypeptide antagonist is an antisense RNA or DNA
construct prepared using
antisense technology, where, e.g., an antisense RNA or DNA molecule acts to
block directly the translation of
mRNA by hybridizing to targeted mRNA and preventing protein translation.
Antisense technology can be used
to control gene expression through triple-helix formation or antisense DNA or
RNA, both of which methods are
based on binding of a polynucleotide to DNA or RNA. For example, the 5' coding
portion of the polynucleotide
sequence, which encodes the mature Bolekine polypeptides herein, is used to
design an antisense RNA
oligonucleotide of from about 10 to 40 base pairs in length. A DNA
oligonucleotide is designed to be
complementary to a region of the gene involved in transcription (triple helix -
see Lee et al., Nucl. Acids Res.,
6:3073 (1979); Cooney et al., Science, 241: 456 (1988); Dervan et al.,
Science, 251:1360 (1991)), thereby
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
preventing transcription and the production of the Bolekine polypeptide. The
antisense RNA oligonucleotide
hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule
into the Bolekine polypeptide
(antisense - Okano, Neurochem., 56:560 (1991); Oli~odeoxynucleotides as
Antisense Inhibitors of Gene
Expression (CRC Press: Boca Raton, FL, 1988). The oligonucleotides described
above can also be delivered
to cells such that the antisense RNA or DNA may be expressed in vivo to
inhibit production of the Bolekine
polypeptide. When antisense DNA is used, oligodeoxyribonucleotides derived
from the translation-initiation site,
e.g., between about -10 and +10 positions of the target gene nucleotide
sequence, are preferred.
Potential antagonists include small molecules that bind to the active site,
the receptor binding site, or
growth factor or other relevant binding site of the Bolekine polypeptide,
thereby blocking the normal biological
activity of the Bolekine polypeptide. Examples of small molecules include, but
are not~limited to, small peptides
or peptide-like molecules, preferably soluble peptides, and synthetic non-
peptidyl organic or inorganic
compounds.
Ribozymes are enzymatic RNA molecules capable of catalyzing the specific
cleavage of RNA.
Ribozymes act by sequence-specific hybridization to the complementary target
RNA, followed by
endonucleolytic cleavage. Specific ribozyme cleavage sites within a potential
RNA target can be identified by
known techniques. For further details see, e.g., Rossi, Current Bioloay, 4:469-
471 (1994), and PCT publication
No. WO 97/33551 (published September 18, 1997).
Nucleic acid molecules in triple-helix formation used to inhibit transcription
should be single-stranded
and composed of deoxynucleotides. The base composition of these
oligonucleotides is designed such that it
promotes triple-helix formation via Hoogsteen base-pairing rules, which
generally require sizeable stretches of
purines or pyrimidines on one strand of a duplex. For further details see,
e.g., PCT publication No. WO
97/33551, supra.
These small molecules can be identified by any one or more of the screening
assays discussed
hereinabove and/or by any other screening techniques well known for those
skilled in the art.
Diagnostic and therapeutic uses of the herein disclosed molecules may also be
based upon the positive
functional assay hits disclosed and described below.
As chemokines that lack the ELR motif such as Bolekine, are angiostatic
(Strieter RM. et al. Journal
of Biolouical Chemistry 1995; 270: 27348-27357), then Bolekine may be useful
in treating tumors by inhibiting
the neovascularization that accompanies tumor growth. Admistration of the
Bolekine polypeptide either alone
or in combination with another angiostatic factor such as anti-VEGF, may prove
useful in limiting or reducing
tumor growth.
Chemokines may be able to activate immune cells, as shown with the CXC
chemokines activation of
neutrophils (Baggiolini et al. Adv Immunoloay 1994; 55:97-179), and the non-
CXC chemokines are mainly
chemotactic for T lymphocytes. Bolekine may be useful in treating infection,
as local administration of the
polypeptide would stimulate immune cells already present at the site of
infection and induce more immune cells
to migrate to the site, thus removing the infection at a faster rate.
56
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
F. Anti-Bolekine Antibodies
The present invention further provides anti-Bolekine antibodies. Exemplary
antibodies include
polyclonal, monoclonal, humanized, bispecific, and heteroconjugate antibodies.
1. Polyclonal Antibodies
The anti-Bolekine antibodies may comprise polyclonal antibodies. Methods of
preparing polyclonal
antibodies are known to the skilled artisan. Polyclonal antibodies can be
raised in a mammal, for example, by
one or more injections of an immunizing agent and, if desired, an adjuvant.
Typically, the immunizing agent
and/or adjuvant will be injected in the mammal by multiple subcutaneous or
intraperitoneal injections. The
immunizing agent may include the Bolekine polypeptide or a fusion protein
thereof. It may be useful to
conjugate the immunizing agent to a protein known to be immunogenic in the
mammal being immunized.
Examples of such hnmunogenic proteins include but are not limited to keyhole
limpet hemocyanin, serum
albumin, bovine thyroglobulin, and soybean trypsin inhibitor. Examples of
adjuvants which may be employed
include Freund's complete adjuvant and MPL-TDM adjuvant (monophosphoryl Lipid
A, synthetic trehalose
dicorynomycolate). The immunization protocol may be selected by one skilled in
the art without undue
experimentation.
2. Monoclonal Antibodies
The anti-Bolekine antibodies may, alternatively, be monoclonal antibodies.
Monoclonal antibodies may
be prepared using hybridoma methods, such as those described by Kohler and
Milstein, Nature, 256:495 (1975).
In a hybridoma method, a mouse, hamster, or other appropriate host animal, is
typically immunized with an
immunizing agent to elicit lymphocytes that produce or are capable of
producing antibodies that will specifically
bind to the immunizing agent. Alternatively, the lymphocytes may be immunized
in vitro.
The immunizing agent will typically include the Bolekine polypeptide or a
fusion protein thereof.
Generally, either peripheral blood lymphocytes ( "PBLs") are used if cells of
human origin are desired, or spleen
cells or lymph node cells are used if non-human mammalian sources are desired.
The lymphocytes are then
fused with an immortalized cell line using a suitable fusing agent, such as
polyethylene glycol, to form a
hybridoma cell [coding, Monoclonal Antibodies: Principles and Practice,
Academic Press, (196) pp. 59-103].
Immortalized cell lines are usually transformed mammalian cells, particularly
myeloma cells of rodent, bovine
and human origin. Usually, rat or mouse myeloma cell lines are employed. The
hybridoma cells may be
cultured in a suitable culture medium that preferably contains one or more
substances that inhibit the growth or
survival of the unfused, immortalized cells. For example, if the parental
cells lack the enzyme hypoxanthine
guanine phosphoribosyl transferase (HGPRT or HPRT), the culture medium for the
hybridomas typically will
include hypoxanthine, aminopterin, and thymidine ("HAT medium"), which
substances prevent the growth of
HGPRT-deficient cells.
Preferred immortalized cell lines are those that fuse efficiently, support
stable high level expression of
antibody by the selected antibody-producing cells, and are sensitive to a
medium such as HAT medium. More
preferred immortalized cell lines are marine myeloma lines, which can be
obtained, for instance, from the Salk
Institute Cell Distribution Center, San Diego, California and the American
Type Culture Collection, Manassas,
Virginia. Human myeloma and mouse-human heteromyeloma cell lines also have
been described for the
57
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
production of human monoclonal antibodies [I~ozbor, J. Immunol., 133:3001
(1984); Brodeur et al., Monoclonal
Antibody Production Techni9ues and Applications, Marcel Dekker, Inc., New
York, (1987) pp. 51-63].
The culture medium in which the hybridoma cells are cultured can then be
assayed for the presence of
monoclonal antibodies directed against Bolekine. Preferably, the binding
specificity of monoclonal antibodies
produced by the hybridoma cells is determined by immunoprecipitation or by an
itz vitro binding assay; such as
radioimmunoassay (RIA) or enzyme-linked immunoabsorbent assay (ELISA). Such
techniques and assays are
known in the art. The binding affinity of the monoclonal antibody can, for
example, be determined by the
Scatchard analysis of Munson and Pollaxd, Anal. Biochem., 107:220 (1980).
After the desired hybridoma cells are identified, the clones may be subcloned
by limiting dilution
procedures and grown by standard methods [coding, su ra . Suitable culture
media for this purpose include,
for example, Dulbecco's Modified Eagle's Medium and RPMI-1640 medium.
Alternatively, the hybridoma cells
may be grown itz vivo as ascites in a mammal.
The monoclonal antibodies secreted by the subclones may be isolated or
purified from the culture
medium or ascites fluid by conventional irnmunoglobulin purification
procedures such as, for example, protein
A-Sepharose, hydroxylapatite chromatography, gel electrophoresis, dialysis, or
affinity chromatography.
The monoclonal antibodies may also be made by recombinant DNA methods, such as
those described
in U. S. Patent No. 4,816,567. DNA encoding the monoclonal antibodies of the
invention can be readily isolated
and sequenced using conventional procedures (e.g., by using oligonucleotide
probes that are capable of binding
specifically to genes encoding the heavy and light chains of marine
antibodies). The hybridoma cells of the
invention serve as a preferred source of such DNA. Once isolated, the DNA may
be placed into expression
vectors, which are then transfected into host cells such as simian COS cells,
Chinese hamster ovary (CHO) cells,
or myeloma cells that do not otherwise produce immunoglobulin protein, to
obtain the synthesis of monoclonal
antibodies in the recombinant host cells. The DNA also may be modified, for
example, by substituting the
coding sequence for human heavy and light chain constant domains in place of
the homologous marine sequences
[U.S. Patent No. 4,816,567; Morrison et al., su ra or by covalently joining to
the immunoglobulin coding
sequence all or part of the coding sequence for a non-immunoglobulin
polypeptide. Such a non-immunoglobulin
polypeptide can be substituted for the constant domains of an antibody of the
invention, or can be substituted for
the variable domains of one antigen-combining site of an antibody of the
invention to create a chimeric bivalent
antibody.
The antibodies may be monovalent antibodies. Methods for preparing monovalent
antibodies are well
known in the art. For example, one method involves recombinant expression of
immunoglobulin light chain and
modified heavy chain. The heavy chain is truncated generally at any point in
the Fc region so as to prevent
heavy chain crosslinking. Alternatively, the relevant cysteine residues are
substituted with another amino acid
residue or are deleted so as to prevent crosslinking.
In vitro methods are also suitable for preparing monovalent antibodies.
Digestion of antibodies to
produce fragments thereof, particularly, Fab fragments, can be accomplished
using routine techniques known
in the art.
5~
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
3. Human and Humanized Antibodies
The anti-Bolekine antibodies of the invention may further comprise humanized
antibodies or human
antibodies. Humanized forms of non-human (e.g., marine) antibodies are
chimeric immunoglobulins,
immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab', F(ab')2 or
other antigen-binding
subsequences of antibodies) which contain minimal sequence derived from non-
human immunoglobulin.
Humanized antibodies include human immunoglobulins (recipient antibody) in
which residues from a
complementary determining region (CDR) of the recipient are replaced by
residues from a CDR of a non-human
species (donor antibody) such as mouse, rat or rabbit having the desired
specificity, affinity and capacity. In
some instances, Fv framework residues of the human immunoglobulin are replaced
by corresponding non-human
residues. Humanized antibodies may also comprise residues which are found
neither in the recipient antibody
nor in the imported CDR or framework sequences. In general, the humanized
antibody will comprise
substantially all of at least one, and typically two, variable domains, in
which all or substantially all of the CDR
regions correspond to those of a non-human immunoglobulin and all or
substantially all of the FR regions are
those of a human immunoglobulin consensus sequence. The humanized antibody
optimally also will comprise
at least a portion of an immunoglobulin constant region (Fc), typically that
of a human immunoglobulin [Jones
et al., Nature, 321:522-525 (1986); Riechmann et al., Nature, 332:323-329
(1988); and Presta, Curr. Op.
Struct. Biol., 2:593-596 (1992)].
Methods for humanizing non-human antibodies are well known in the art.
Generally, a humanized
antibody has one or more amino acid residues introduced into it from a source
which is non-human. These non-
human amino acid residues are often referred to as "import" residues, which
are typically taken from an
"import" variable domain. Humanization can be essentially performed following
the method of Winter and co-
workers [Jones et al., Nature, 321:522-525 (1986); Riechmann et al., Nature,
332:323-327 (1988); Verhoeyen
et al., Science, 239:1534-1536 (1988)], by substituting rodent CDRs or CDR
sequences for the corresponding
sequences of a human antibody. Accordingly, such "humanized" antibodies are
chimeric antibodies (U.5. Patent
No. 4,816,567), wherein substantially Iess than an intact human variable
domain has been substituted by the
corresponding sequence from a non-human species. In practice, humanized
antibodies are typically human
antibodies in which some CDR residues and possibly some FR residues are
substituted by residues from
analogous sites in rodent antibodies.
Human antibodies can also be produced using various technitques known in the
art, including phage
display libraries [Hoogenboom and Winter, J. Mol. Biol., 227:381 (1991); Marks
et al., J. Mol. Biol., 222:581
(1991)]. The techniques of Cole et al. and Boerner et al. are also available
for the preparation of human
monoclonal antibodies (Cole et al., Monoclonal Antibodies and Cancer Therany,
Alan R. Liss, p. 77 (1985) and
Boerner et al., J. Immunol., 147 1 :86-95 (1991)]. Similarly, human antibodies
can be made by introducing
of human inununoglobulin loci into transgenic animals, e.g., mice in which the
endogenous immunoglobulin
genes have been partially or completely inactivated. Upon challenge, human
antibody production is observed,
which closely resembles that seen in humans in all respects, including gene
rearrangement, assembly, and
antibody repertoire. This approach is described, for example, in U.S. Patent
Nos. 5,545,807; 5,545,806;
5,569,825; 5,625,126; 5,633,425; 5,661,016, and in the following scientific
publications: Marks et al.,
59
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
BiolTechnology 10, 779-783 (1992); Lonberg et al., Nature 368 856-859 (1994);
Morrison, Nature 368, 812-13
(1994); Fishwild et al., Nature Biotechnolo~y 14, 845-51 (1996); Neuberger,
Nature Biotechnoloev 14, 826
(1996); Lonberg and Huszar, Intern. Rev. Immunol. 13 65-93 (1995).
The antibodies may also be affinity matured using known selection and/or
mutagenesis methods as
described above. Preferred affinity matured antibodies have an affinity which
is five times, more preferably 10
times, even more preferably 20 or 30 times greater than the starting antibody
(generally marine, humanized or
human) from which the matured antibody is prepared.
4. Bispecific Antibodies
Bispecific antibodies are monoclonal, preferably human or humanized,
antibodies that have binding
specificities for at least two different antigens. In the present case, one of
the binding specificities is for the
Bolekine, the other one is for any other antigen, and preferably for a cell-
surface protein or receptor or receptor
subunit.
Methods for making bispecific antibodies are known in the art. Traditionally,
the recombinant
production of bispecific antibodies is based on the co-expression of two
immunoglobulin heavy-chain/light-chain
pairs, where the two heavy chains have different specificities [Milstein and
Cuello, Nature, 305:537-539 (1983)].
Because of the random assortment of immunoglobulin heavy and light chains,
these hybridomas (quadromas)
produce a potential mixture of ten different antibody molecules, of which only
one has the correct bispecific
structure. The purification of the correct molecule is usually accomplished by
affinity chromatography steps.
Similar procedures are disclosed in WO 93/08829, published 13 May 1993, and in
Traunecker et al., EMBO
J., 10:3655-3659 (1991).
Antibody variable domains with the desired binding specificities (antibody-
antigen combining sites) can
be fused to immunoglobulin constant domain sequences. The fusion preferably is
with an immunoglobulin
heavy-chain constant domain, comprising at least part of the hinge, CH2, and
CH3 regions. It is preferred to
have the first heavy-chain constant region (CHl) containing the site necessary
for light-chain binding present
in at least one of the fusions. DNAs encoding the immunoglobulin heavy-chain
fusions and, if desired, the
immunoglobulin light chain, are inserted into separate expression vectors, and
are co-transfected into a suitable
host organism. For further details of generating bispecific antibodies see,
for example, Suresh et al., Methods
in Enzvmolo~y, 121:210 (1986).
According to another approach described in WO 96/27011, the interface between
a pair of antibody
molecules can be engineered to maximize the percentage of heterodimers which
are recovered from recombinant
cell culture. The preferred interface comprises at least a part of the CH3
region of an antibody constant domain.
In this method, one or more small amino acid side chains from the interface of
the first antibody molecule are
replaced with larger side chains (e.g. tyrosine or tryptophan). Compensatory
"cavities" of identical or similar
size to the large side chains) are created on the interface of the second
antibody molecule by replacing large
amino acid side chains with smaller ones (e.g. alanine or threonine). This
provides a mechanism for increasing
the yield of the heterodimer over other unwanted end-products such as
homodimers.
Bispecific antibodies can be prepared as full length antibodies or antibody
fragments (e.g. F(ab')Z
bispecific antibodies). Techniques for generating bispecific antibodies from
antibody fragments have been
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
described in the literature. For example, bispecific antibodies can be
prepared can be prepared using chemical
linkage. Brennan et al. , Science 229:81 (1985) describe a procedure wherein
intact antibodies are proteolytically
cleaved to generate F(ab')2 fragments. These fragments are reduced in the
presence of the dithiol complexing
agent sodium arsenate to stabilize vicinal dithiols and prevent intermolecular
disulfide formation. The Fab'
fragments generated are then converted to thionitrobenzoate (TNB) derivatives.
One of the Fab'-TNB
derivatives is then reconverted to the Fab'-thiol by reduction with
mercaptoethylamine and is mixed with an
equimolar amount of the other Fab'-TNB derivative to form the bispecific
antibody. The bispecific antibodies
produced can be used as agents for the selective immobilization of enzymes.
Fab' fragments may be directly recovered from E. cola and chemically coupled
to form bispecific
antibodies. Shalaby et al., J. Exp. Med. 175:217-225 (1992) describe the
production of a fully humanized
bispecific antibody F(ab')Z molecule. Each Fab' fragment was separately
secreted from E. cola and subjected
to directed chemical coupling in vitro to form the bispecific antibody. The
bispecific antibody thus formed was
able to bind to cells overexpressing the ErbB2 receptor and normal human T
cells, as well as trigger the lytic
activity of human cytotoxic lymphocytes against human breast tumor targets.
Various technique for making and isolating bispecific antibody fragments
directly from recombinant cell
culture have also been described. For example, bispecific antibodies have been
produced using leucine zippers.
I~ostelny et al., J. Immunol. 148(5):1547-1553 (1992). The leucine zipper
peptides from the Fos and Jun
proteins were linked to the Fab' portions of two different antibodies by gene
fusion. The antibody homodimers
were reduced at the hinge region to form monomers and then re-oxidized to form
the antibody heterodimers.
This method can also be utilized for the production of antibody homodimers.
The "diabody" technology
described by Hollinger et al., Proc. Natl. Acad. Sci. USA 90:6444-6448 (1993)
has provided an alternative
mechanism for making bispecific antibody fragments. The fragments comprise a
heavy-chain variable domain
(VH) connected to a light-chain variable domain (VL) by a linker which is too
short to allow pairing between the
two domains on the same chain. Accordingly, the VH and VL domains of one
fragment are forced to pair with
the complementary VL and VH domains of another fragment, thereby forming two
antigen-binding sites. Another
strategy for making bispecific antibody fragments by the use of single-chain
Fv (sFv) dimers has also been
reported. See, Gruber et aZ., J. Irnmunol. 152:5368 (1994).
Antibodies with more than two valencies are contemplated. For example,
trispecific antibodies can be prepared.
Tutt et al., J. hnmunol. 147:60 (1991).
Exemplary bispecific antibodies may bind to two different epitopes on a given
Bolekine polypeptide
herein. Alternatively, an anti-Bolekine polypeptide arm may be combined with
an arm which binds to a
triggering molecule on a leukocyte such as a T-cell receptor molecule (e.g.
CD2, CD3, CD28, or B7), or Fc
receptors for IgG (FcyR), such as Fc~yRI (CD64), FcyRII (CD32) and FcyRIII
(CD16) so as to focus cellular
defense mechanisms to the cell expressing the particular Bolekine polypeptide.
Bispecific antibodies may also
be used to localize cytotoxic agents to cells which express a particular
Bolekine polypeptide. These antibodies
possess a Bolekine-binding arm and an arm which binds a cytotoxic agent or a
radionuclide chelator, such as
EOTUBE, DPTA, DOTA, or TETA. Another bispecific antibody of interest binds the
Bolekine polypeptide
and further binds tissue factor (TF).
61
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
5. Heteroconiuaate Antibodies
Heteroconjugate antibodies are also within the scope of the present invention.
Heteroconjugate
antibodies are composed of two covalently joined antibodies. Such antibodies
have, for example, been proposed
to target immune system cells to unwanted cells [U. S. Patent No. 4,676,980],
and for treatment of HIV infection
[WO 91!00360; WO 92/200373; EP 03089]. It is contemplated that the antibodies
may be prepared itz vitro
using known methods in synthetic protein chemistry, including those involving
crosslinking agents. For
example, immunotoxins may be constructed using a disulfide exchange reaction
or by forming a thioether bond.
Examples of suitable reagents for this purpose include iminothiolate and
methyl-4-mercaptobutyrimidate and
those disclosed, for example, in U.S. Patent No. 4,676,980.
6. Effector Function Enaineerine
It may be desirable to modify the antibody of the invention with respect to
effector function, so as to
enhance, e.g., the effectiveness of the antibody in treating cancer. For
example, cysteine residues) may be
introduced into the Fc region, thereby allowing interchain disulfide bond
formation in this region. The
homodimeric antibody thus generated may have improved internalization
capability and/or increased
complement-mediated cell killing and antibody-dependent cellular cytotoxicity
(ADCC). See Caron et al., J.
Exp Med., 176: 1191-1195 (1992) and Shopes, J. Immunol., 148: 2918-2922
(1992). Homodimeric antibodies
with enhanced anti-tumor activity may also be prepared using
heterobifunctional cross-linkers as described in
Wolff et al. Cancer Research, 53: 2560-2565 (1993). Alternatively, an antibody
can be engineered that has dual
Fc regions and may thereby have enhanced complement lysis and ADCC
capabilities. See Stevenson et al.,
Anti-Cancer Drue Desien, 3: 219-230 (1989).
7. Immunocom'ueates
The invention also pertains to immunoconjugates comprising an antibody
conjugated to a cytotoxic agent
such as a chemotherapeutic agent, toxin (e. g. , an enzymatically active toxin
of bacterial, fungal, plant, or animal
origin, or fragments thereof), or a radioactive isotope (i.e., a
radioconjugate).
Chemotherapeutic agents useful in the generation of such immunoconjugates have
been described above.
Enzymatically active toxins and fragments thereof that can be used include
diphtheria A chain, nonbinding active
fragments of diphtheria toxin, exotoxin A chain (from Pseudontonas
aeruginosa), ricin A chain, abrin A chain,
modeccin A chain, alpha-sarcin, Aleurites fotdii proteins, dianthin proteins,
Phytolaca americatta proteins
(PAPI, PAPA, and PAP-S), momordica charantia inhibitor, curcin, crotin,
sapaonaria officinalis inhibitor,
gelonin, mitogellin, restrictocin, phenomycin, enomycin, and the
tricothecenes. A variety of radionuclides are
available for the production of radioconjugated antibodies. Examples include
Zl2Bi, 13'I, '3'In, 9°Y, and iseRe.
Conjugates of the antibody and cytotoxic agent are made using a variety of
bifunctional protein-coupling
agents such as N-succinimidyl-3-(2-pyridyldithiol) propionate (SPDP),
iminothiolane (IT), bifunctional
derivatives of imidoesters (such as dimethyl adipimidate HCL), active esters
(such as disuccinirnidyl suberate),
aldehydes (such as glutareldehyde), bis-azido compounds (such as bis (p-
azidobenzoyl) hexanediamine), bis-
diazonium derivatives (such as bis-(p-diazoniumbenzoyl)-ethylenediamine),
diisocyanates (such as tolyene 2,6-
diisocyanate), and bis-active fluorine compounds (such as 1,5-difluoro-2,4-
dinitrobenzene). For example, a ricin
immunotoxin can be prepared as described in Vitetta et al., Science, 238: 1098
(1987). Carbon-14-labeled 1-
62
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
isothiocyanatobenzyl-3-methyldiethylene triaminepentaacetic acid (MX-DTPA) is
an exemplary chelating agent
for conjugation of radionucleotide to the antibody. See W094/11026.
In another embodiment, the antibody may be conjugated to a "receptor" (such
streptavidin) for
utilization in tumor pretargeting wherein the antibody-receptor conjugate is
administered to the patient, followed
by removal of unbound conjugate from the circulation using a clearing agent
and then administration of a
"Iigand" (e.g., avidin) that is conjugated to a cytotoxic agent (e.g., a
radionucleotide).
8. Immunoliposomes
The antibodies disclosed herein may also be formulated as immunoliposomes.
Liposomes containing
the antibody are prepared by methods known in the art, such as described in
Epstein et al., Proc. Natl. Acad.
Sci. USA, 82: 3688 (1985); Hwang et al., Proc. Natl Acad. Sci. USA, 77: 4030
(1980); and U.S. Pat. Nos.
4,485,045 and 4,544,545. Liposomes with enhanced circulation time are
disclosed in U.S. Patent No.
5,013,556.
Particularly useful liposomes can be generated by the reverse-phase
evaporation method with a lipid
composition comprising phosphatidylcholine, cholesterol, and PEG-derivatized
phosphatidylethanolamine (PEG-
PE). Liposomes are extruded through filters of defined pore size to yield
liposomes with the desired diameter.
Fab' fragments of the antibody of the present invention can be conjugated to
the liposomes as described in Martin
et al ., J. Biol. Chem., 257: 286-288 (1982) via a disulfide-interchange
reaction. A chemotherapeutic agent
(such as Doxorubicin) is optionally contained within the liposome. See Gabizon
et al. , J. National Cancer Inst. ,
81(19): 1484 (1989).
9. Pharmaceutical Compositions of Antibodies
Antibodies specifically binding a Bolekine polypeptide identified herein, as
well as other molecules
identified by the screening assays disclosed hereinbefore, can be administered
for the treatment of various
disorders in the form of pharmaceutical compositions.
If the Bolekine polypeptide is intracellular and whole antibodies are used as
inhibitors, internalizing
antibodies are preferred. However, lipofections or liposomes can also be used
to deliver the antibody, or an
antibody fragment, into cells. Where antibody fragments are used, the smallest
inhibitory fragment that
specifically binds to the binding domain of the target protein is preferred.
For example, based upon the variable-
region sequences of an antibody, peptide molecules can be designed that retain
the ability to bind the target
protein sequence. Such peptides can be synthesized chemically and/or produced
by recombinant DNA
technology. See, e.g., Marasco et al., Proc. Natl. Acad. Sci. USA, 90: 7889-
7893 (1993), The fomentation
herein may also contain more than one active compound as necessary for the
particular indication being treated,
preferably those with complementary activities that do not adversely affect
each other. Alternatively, or in
addition, the composition may comprise an agent that enhances its function,
such as, for example, a cytotoxic
agent, cytokine, chemotherapeutic agent, or growth-inhibitory agent. Such
molecules are suitably present in
combination in amounts that are effective for the purpose intended.
The active ingredients may also be entrapped in microcapsules prepared, for
example, by coacervation
techniques or by interfacial polymerization, for example,
hydroxymethylcellulose or gelatin-microcapsules and
poly-(methylmethacylate) microcapsules, respectively, in colloidal drug
delivery systems (for example,
63
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
liposomes, albumin microspheres, microemulsions, nano-particles, and
nanocapsules) or in macroemulsions.
Such techniques are disclosed in Remington's Pharmaceutical Sciences, supra.
The formulations to be used for itz vivo administration must be sterile. This
is readily accomplished by
filtration through sterile filtration membranes.
Sustained-release preparations may be prepared. Suitable examples of sustained-
release preparations
include semipermeable matrices of solid hydrophobic polymers containing the'
antibody, which matrices are in
the form of shaped articles, e.g., films, or microcapsules. Examples of
sustained-release matrices include
polyesters, hydrogels (for example, poly(2-hydroxyethyl-methacrylate), or
poly(vinylalcohol)), polylactides
(U.S. Pat. No. 3,773,919), copolymers of L-glutamic acid and y ethyl-L-
glutamate, non-degradable etlrylene-
vinyl acetate, degradable lactic acid-glycolic acid copolymers such as the
LUBolekineN DEPOT TM (injectable
microspheres composed of lactic acid-glycolic acid copolymer and leuprolide
acetate), and poly-D-(-)-3-
hydroxybutyric acid. While polymers such as ethylene-vinyl acetate and lactic
acid-glycolic acid enable release
of molecules for over 100 days, certain hydrogels release proteins for shorter
time periods. When encapsulated
antibodies remain in the body for a long time, they may denature or aggregate
as a result of exposure to moisture
at 37°C, resulting in a loss of biological activity and possible
changes in immunogenicity. Rational strategies
can be devised for stabilization depending on the mechanism involved. For
example, if the aggregation
mechanism is discovered to be intermolecular S-S bond formation through thio-
disulfide interchange, stabilization
may be achieved by modifying sulfhydryl residues, lyophilizing from acidic
solutions, controlling moisture
content, using appropriate additives, and developing specific polymer matrix
compositions.
2.0 G. Uses for anti-Bolekine Antibodies
The anti-Bolekine antibodies of the invention have various utilities. For
example, anti-Bolekine
antibodies may be used in diagnostic assays for Bolekine, e.g., detecting its
expression (and in some cases,
differential expression) in specific cells, tissues, or serum. Various
diagnostic assay techniques known in the
art may be used, such as competitive binding assays, direct or indirect
sandwich assays and immunoprecipitation
2,5 assays conducted in either heterogeneous or homogeneous phases [Zola,
Monoclonal Antibodies: A Manual of
Technigues, CRC Press, Tnc. (1987) pp. 147-158]. The antibodies used in the
diagnostic assays can be labeled
with a detectable moiety. The detectable moiety should be capable of
producing, either directly or indirectly,
a detectable signal. For example, the detectable moiety may be a radioisotope,
such as 3H, '4C, 32P, 3sS, or lzsh
a fluorescent or chemiluminescent compound, such as fluorescein
isothiocyanate, rhodamine, or luciferin, or
30 an enzyme, such as alkaline phosphatase, beta-galactosidase or horseradish
peroxidase. Any method known in
the art for conjugating the antibody to the detectable moiety may be employed,
including those methods described
by Hunter et al., Nature, 144:945 (1962); David et al., Biochemistry, 13:1014
(1974); Pain et al., J. Immunol.
Meth., 40:219 (1981); and Nygren, J. Histochem. and Cvtochem., 30:407 (1982).
Anti-Bolekine antibodies also are useful for the affinity purification of
Bolekine from recombinant cell
35 culture or natural sources. In this process, the antibodies against
Bolekine are immobilized on a suitable support,
such a Sephadex resin or filter paper, using methods well known in the art.
The immobilized antibody then is
contacted with a sample containing the Bolekine to be purified, and thereafter
the support is washed with a
64
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
suitable solvent that will remove substantially all the material in the sample
except the Bolekine, which is bound
to the immobilized antibody. Finally, the support is washed with another
suitable solvent that will release the
Bolekine from the antibody.
The following examples are offered for illustrative purposes only, and are not
intended to limit the scope
of the present invention in any way.
All patent and literature references cited in the present specification are
hereby incorporated by reference
in their entirety.
EXAMPLES
Commercially available reagents referred to in the examples were used
according to manufacturer's
instructions unless otherwise indicated. The source of those cells identified
in the following examples, and
throughout the specification, by ATCC accession numbers is the American Type
Culture Collection, Manassas,
VA.
EXAMPLE 1: Isolation of cDNA Clones Encoding Human Bolekine
The extracellular domain (ECD) sequences (including the secretion signal, if
any) of from about 950
known secreted proteins from the Swiss-Prot public protein database were used
to search expressed sequence
tag (EST) databases. The EST databases included public EST databases (e.g.,
GenBank) and a proprietary EST
DNA database (LIFESEQTM, Incyte Pharmaceuticals, Palo Alto, CA). The search
was performed using the
computer program BLAST or BLAST2 (Altshul et al., Methods in Enzymoloay
266:460-480 (1996)) as a
comparison of the ECD protein sequences to a 6 frame translation of the EST
sequence. Those comparisons
resulting in a BLAST score of 70~ (or in some cases 90) or greater that did
not encode known proteins were
clustered and assembled into consensus DNA sequences with the program "phrap"
(Phil Green, University of
Washington, Seattle, Washington;
http://bozeman.mbt.washington.edu/phrap.docs/phrap.html).
A consensus DNA sequence was assembled relative to other EST sequences using
phrap. Based on the
consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a
cDNA library that contained
the sequence of interest, and 2) for use as probes to isolate a clone of the
full-length coding sequence for
Bolekine.. Forward and reverse PCR primers generally range from 20 to 30
nucleotides and are often designed
to give a PCR product of about 100-1000 by in length. The probe sequences are
typically 40-S5 by in length.
In some cases, additional oligonucleotides are synthesized when the consensus
sequence is greater than about
1-1.Skbp. In order to screen several libraries for a full-length clone, DNA
from the libraries was screened by
PCR amplification, as per Ausubel et al., Current Protocols in Molecular
Biolo~y, with the PCR primer pair.
A positive library was then used to isolate clones encoding the gene of
interest by the in vivo cloning procedure
using the probe oligonucleotide and one of the primer pairs.
A pair of PCR primers (forward and reverse) were synthesized:
forward PCR primer: 5'-CAGCGCCCTCCCCATGTCCCTG-3' (SEQ ID NO: 3)
reverse PCR primer: 5'-TCCCAACTGGTTTGGAGTTTTCCC-3' (SEQ ID NO: 4)
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
Additionally, a synthetic oligonucleotide hybridization probe was constructed
from the consensus sequence which
had the following nucleotide sequence.
hybridization probe
5'-CTCCGGTCAGCATGAGGCTCCTGGCGGCCGCTGCTCCTGCTGCTG-3' (SEQ ID NO:S)
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pair identified above. A
positive library was then used to
isolate clones encoding the Bolekine gene using the probe oligonucleotide and
one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal
kidney tissue. The cDNA
libraries used to isolate the cDNA clones were constructed by standard methods
using commercially available
reagents such as those from Invitrogen, San Diego, CA, The cDNA was primed
with oligo dT containing a NotI
site, linked with blunt to SalI hemikinased adaptors, cleaved with NotI, sized
appropriately by gel
electrophoresis, and cloned in a defined orientation into a suitable cloning
vector (such as pRKB or pRKD;
pRKSB is a precursor of pRKSD that does not contain the SfiI site; see, Holmes
et al., Science, 253:1278-1280
(1991)) in the unique XhoI and NotI sites.
DNA sequencing of the clones isolated as described above gave the full-length
DNA sequence for
Bolekine (SEQ ID NO:1) and the derived protein sequence for Bolekine.
The entire nucleotide sequence of Bolekine is shown in Figure 1 (SEQ ID NO:1).
The Bolekine
sequence contains a single open reading frame with an apparent translational
initiation site at nucleotide positions
167-169 [I~ozak et al., su ra and ending at the stop codon at nucleotide
positions 500-502 (Figure 1). The
2.0 predicted polypeptide precursor is 111 amino acids long (Figure 2 (SEQ 1D
N0:2)). Bolekine has been
deposited with the ATCC. It is understood that the deposited clone contains
the actual sequence and that the
sequences provided herein are merely representative based on current
sequencing techniques. Moreover, given
the sequences provided herein and knowledge of the universal genetic code, the
corresponding nucleotides for
any given amino acid can be routinely identified and vice versa.
Analysis of the amino acid sequence of the full-length Bolekine polypeptide
suggests that portions of
it possess sequence identity with human macrophage inflammatory protein-2,
cytokine-induced neutrophil
chemoattractant 2, and neutrophil chemotactic factor 2-beta, thereby
indicating that Bolekine is a novel
chemokine.
As discussed further below, the cDNA was subcloned into a baculovirus vector
and expressed in insect
cells as a C-terminally tagged IgG fusion protein. N-terminal sequencing of
the resultant protein identified the
signal sequence cleavage site, yielding a mature polypeptide of 77 amino
acids. The mature sequence, showing
31-40% identity to other human CXC chemokines, includes the four canonical
cysteine residues but lacks the
ELR motif.
EXAMPLE 2: Use of Bolekine-encoding DNA as a hybridization probe
The following method describes use of a nucleotide sequence encoding Bolekine
as a hybridization
probe.
66
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
DNA comprising the coding sequence of full-length Bolekine (as shown in Figure
1, SEQ ID NO:1)
is employed as a probe to screen for homologous DNAs (such as those encoding
naturally-occurring variants
of Bolekine) in human tissue cDNA libraries or human tissue genomic libraries.
Hybridization and washing of filters containing either library DNAs is
performed under the following
high stringency conditions. Hybridization of radiolabeled Bolekine-derived
probe to the filters is performed in
a solution of 50 % formamide, Sx SSC, 0.1 % SDS, 0.1 % sodium pyrophosphate,
50 mM sodium phosphate, pH
6.8, 2x Denhardt's solution, and 10% dextran sulfate at 42°C for 20
hours. Washing of the filters is performed
in an aqueous solution of 0.1 x SSC and 0.1 % SDS at 42°C.
DNAs having a desired sequence identity with the DNA encoding full-length
native sequence Bolekine
polypeptide can then be identified using standard techniques known in the art.
EXAMPLE 3: Expression of Bolekine Polypentides in E. coli
This example illustrates the preparation of unglycosylated forms of Bolekine
polypeptides by
recombinant expression in E. coli.
The DNA sequence encoding Bolekine (SEQ ID NO:1) is initially amplified using
selected PCR
primers. The primers should contain restriction enzyme sites which correspond
to the restriction enzyme sites
on the selected expression vector. A variety of expression vectors may be
employed. An example of a suitable
vector is pBR322 (derived from E. coli; see Bolivar et al., Gene, 2 :95
(1977)) which contains genes for
ampicillin and tetracycline resistance. The vector is digested with
restriction enzyme and dephosphorylated.
The PCR amplified sequences are then ligated into the vector. The vector will
preferably include sequences
2,0 which encode for an antibiotic resistance gene, a trp promoter, a polyhis
leader (including the first six STII
codons, polyhis sequence, and enterokinase cleavage site), the Bolekine coding
region, lambda transcriptional
terminator, and an argU gene.
The ligation mixture is then used to transform a selected E. coli strain using
the methods described in
Sambrook et al. , supra. Transformants are identified by their ability to grow
on LB plates and antibiotic resistant
colonies are then selected. Plasmid DNA can be isolated and confirmed by
restriction analysis and DNA
sequencing.
Selected clones can be grown overnight in liquid culture medium such as LB
broth supplemented with
antibiotics. The overnight culture may subsequently be used to inoculate a
larger scale culture. The cells are
then grown to a desired optical density, during which the expression promoter
is turned on.
After culturing the cells for several more hours, the cells can be harvested
by centrifugation. The cell
pellet obtained by the centrifugation can be solubilized using various agents
known in the art, and the solubilized
Bolekine polypeptide can then be purified using a metal chelating column under
conditions that allow tight
binding of the polypeptide.
EXAMPLE 4: Expression of Bolekine P~peptides in Mammalian Cells
This example illustrates preparation of glycosylated forms of Bolekine
polypeptides by recombinant
expression in mammalian cells.
67
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
The vector, pRKS (see EP 307,247, published March 15, 1989), is employed as
the expression vector.
Optionally, the Bolekine-encoding DNA is ligated into pRKS with selected
restriction enzymes to allow insertion
of the Bolekine-encoding DNA using ligation methods such as described in
Sambrook et al., supra. The
resulting vector is called pRI~S-Bolekine.
In one embodiment, the selected host cells may be 293 cells. Human 293 cells
(ATCC CCL 1573) are
grown to confluence in tissue culture plates in medium such as DMEM
supplemented with fetal calf serum and
optionally, nutrient components and/or antibiotics. About 10 ~.g pRI~S-
Bolekine DNA is mixed with about 1
,ug DNA encoding the VA RNA gene [Thimmappaya et al., Cell, 31 :543 (1982)]
and dissolved in 500 ~,l of 1
mM Tris-HCI, 0.1 mM EDTA, 0.227 M CaCl2. To this mixture is added, dropwise,
500 w1 of 50 mM HEPES
(pH 7.35), 280 mM NaCl, 1.5 mM NaP04, and a precipitate is allowed to form for
10 minutes at 25°C. The
precipitate is suspended and added to the 293 cells and allowed to settle for
about four hours at 37°C. The
culture medium is aspirated off and 2 ml of 20% glycerol in PBS is added for
30 seconds. The 293 cells are
then washed with serum free medium, fresh medium is added and the cells are
incubated for about 5 days.
Approximately 24 hours after the transfections, the culture medium is removed
and replaced with culture
medium (alone) or culture medium containing 200 ,uCi/ml 35S-cysteine and 200
,uCi/ml 35S-methionine. After
a 12 hour incubation, the conditioned medium is collected, concentrated on a
spin filter, and loaded onto a 15
SDS gel. The processed gel may be dried and exposed to film for a selected
period of time to reveal the
presence of Bolekine polypeptide. The cultures containing transfected cells
may undergo further incubation (in
serum free medium) and the medium is tested in selected bioassays.
In an alternative technique, Bolekine-encoding DNA may be introduced into 293
cells transiently using
the dextran sulfate method described by Somparyrac et al., Proc. Natl. Acad.
Sci., 12:7575 (1981). 293 cells
are grown to maximal density in a spinner flask and 700 ~,g pRKS-Bolekine DNA
is added. The cells are first
concentrated from the spinner flask by centrifugation and washed with PBS. The
DNA-dextran precipitate is
incubated on the cell pellet for four hours. The cells are treated with 20 %
glycerol for 90 seconds, washed with
tissue culture medium, and re-introduced into the spinner flask containing
tissue culture medium, 5 ~.g/ml bovine
insulin and 0.1 ~cg/ml bovine transferrin. After about four days, the
conditioned media is centrifuged and filtered
to remove cells and debris. The sample containing expressed Bolekine
polypeptide can then be concentrated and
purified by any selected method, such as dialysis and/or column
chromatography.
In another embodiment, Bolekine polypeptide can be expressed in CHO cells. The
pRI~S-Bolekine
vector can be transfected into CHO cells using known reagents such as CaP04 or
DEAE-dextran. As described
above, the cell cultures can be incubated, and the medium replaced with
culture medium (alone) or medium
containing a radiolabel such as 35S-methionine. After determining the presence
of Bolekine polypeptide, the
culture medium may be replaced with serum free medium. Preferably, the
cultures are incubated for about 6
days, and then the conditioned medium is harvested. The medium containing the
expressed Bolekine polypeptide
can then be concentrated and purified by any selected method.
Epitope-tagged Bolekine polypeptide may also be expressed in host CHO cells.
The Bolekine-encoding
DNA may be subcloned out of the pRI~S vector. The subclone insert can undergo
PCR to fuse in frame with
a selected epitope tag such as a poly-his tag into a Baculovirus expression
vector. The poly-his tagged Bolekine-
6~
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
encoding DNA insert can then be subcloned into a SV40 driven vector containing
a selection marker such as
DHFR for selection of stable clones. Finally, the CHO cells can be transfected
(as described above) with the
SV40 driven vector. Labeling may be performed, as described above, to verify
expression. The culture medium
containing the expressed poly-His tagged Bolekine polypeptide can then be
concentrated and purified by any
selected method, such as by Ni2+-chelate affinity chromatography.
EXAMPLE 5: Expression of a Bolekine Polypeptide in Yeast
The following method describes recombinant expression of Bolekine polypeptides
in yeast. First, yeast
expression vectors are constructed for intracellular production or secretion
of Bolekine polypeptide from the
ADH2/GAPDH promoter. DNA encoding the Bolekine polypeptide of interest, a
selected signal peptide and
the promoter is inserted into suitable restriction enzyme sites in the
selected plasmid to direct intracellular
expression of the Bolekine polypeptide. For secretion, DNA encoding the
Bolekine polypeptide can be cloned
into the selected plasmid, together with DNA encoding the ADH2/GAPDH promoter,
the yeast alpha-factor
secretory signal/leader sequence, and linker sequences (if needed) for
expression of the Bolekine polypeptide.
Yeast cells, such as yeast strain AB 110, can then be transformed with the
expression plasmids described
above and cultured in selected fermentation media. The transformed yeast
supernatants can be analyzed by
precipitation with 10 % trichloroacetic acid and separation by SDS-PAGE,
followed by staining of the gels with
Coomassie Blue stain.
Recombinant Bolekine polypeptide can subsequently be isolated and purified by
removing the yeast cells
from the fermentation medium by centrifugation and then concentrating the
medium using selected cartridge
filters. The concentrate containing the Bolekine polypeptide may further be
purified using selected column
chromatography resins.
EXAMPLE 6: Preuaration of Antibodies that Bind Bolekine Polypeptides
This example illustrates the preparation of monoclonal antibodies which can
specifically bind to Bolekine
polypeptides.
Techniques for producing the monoclonal antibodies are known in the art and
are described, for
instance, in Goding, supra. Immunogens that may be employed include purified
Bolekine polypeptide, fusion
proteins containing a Bolekine polypeptide, and cells expressing recombinant
Bolekine polypeptide on the cell
surface. Selection of the immunogen can be made by the skilled artisan without
undue experimentation.
Mice, such as Balb/c, are immunized with the Bolekine immunogen emulsified in
complete Freund's
adjuvant and injected subcutaneously or intraperitoneally in an amount from 1-
100 micrograms. Alternatively,
the immunogen is emulsified in MPL-TDM adjuvant (Ribi Immunochemical Research,
Hamilton, MT) and
injected into the animal's hind foot pads. The immunized mice are then boosted
10 to 12 days later with
additional immunogen emulsified in the selected adjuvant. Thereafter, for
several weeks, the mice may also be
boosted with additional immunization injections. Serum samples may be
periodically obtained from the mice
by retro-orbital bleeding for testing in ELISA assays to detect anti-Bolekine
polypeptide antibodies.
After a suitable antibody titer has been detected, the animals "positive" for
antibodies can be injected
69
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
with a final intravenous injection of Bolekine polypeptide. Three to four days
later, the mice are sacrificed and
the spleen cells are harvested. The spleen cells are then fused (using 35 %
polyethylene glycol) to a selected
marine myeloma cell line such as P3X63AgU.l, available from ATCC, No. CRL
1597. The fusions generate
hybridoma cells which can then be plated in 96 well tissue culture plates
containing HAT (hypoxanthine,
aminopterin, and thymidine) medium to inhibit proliferation of non-fused
cells, myeloma hybrids, and spleen
cell hybrids.
The hybridoma cells will be screened in an .ELISA for reactivity against
Bolekine polypeptide.
Determination of "positive" hybridoma cells secreting the desired monoclonal
antibodies against a Bolekine
polypeptide is within the skill in the art.
The positive hybridoma cells can be injected intraperitoneally into syngeneic
Balb/c mice to produce
ascites containing the anti-Bolekine polypeptide monoclonal antibodies.
Alternatively, the hybridoma cells can
be grown in tissue culture flasks or roller bottles. Purification of the
monoclonal antibodies produced in the
ascites can be accomplished using ammonium sulfate precipitation, followed by
gel exclusion chromatography.
Alternatively, affinity chromatography based upon binding of antibody to
protein A or protein G can be
employed.
EXAMPLE 7: Expression of Bolekine Polypeptides in Baculoviius Infected Cells
The following method describes recombinant expression of Bolekine polypeptides
in baculovirus
infected insect cells.
In general, the Bolekine-encoding .DNA is fused upstream of an epitope tag
contained within a
2,0 baculovirus expression vector. Such epitope tags include poly-his tags and
immunoglobulin tags (like Fc regions
of IgG). A variety of plasmids may be employed, including plasmids derived
from commercially available
plasmids such as pVL1393 (Novagen). Briefly, the Bolekine-encoding DNA or the
desired portion of the
Bolekine-encoding DNA (such as the sequence encoding the extracellular domain
of a transmembrane protein)
is amplified by PCR with primers complementary to the 5' and 3' regions. The
5' primer may incorporate
2.5 flanking (selected) restriction enzyme sites. The product is then digested
with those selected restriction enzymes
and subcloned into the expression vector.
The fragment was then subcloned into the pb.PH.IgG vector via those respective
sites. The pb.PH.IgG plasmid
is a derivatives of the pVL1393 plasmid (Pharmingen) and encodes the Fc region
of the human IgG gene
downstream of the cloning site.
30 In general, recombinant baculovirus is generated by co-transfecting the
above plasmid and
BaculoGoldTM virus DNA (Pharmingen) into Spodoptera frugiperda ("Sf9") cells
(ATCC CRL 1711) using
lipofectin (commercially available from GIBCO-BRL). After 4 to 5 days of
incubation at 2~oC, the released
viruses are harvested and used for further amplifications. Viral infection and
protein expression is performed
as described by O'Reilley et al., Baculovirus expression vectors: A laboratory
Manual, Oxford:Oxford
35 University Press (1994).
In this case, The pb.PH.SST DNA.IgG plasmid was co-transfected with Baculogold
Baculovirus DNA
(Pharmingen) using Lipofectin (Gibco BRL) into 105 Sf9 cells grown in Hink's
TNM-FH medium (JRH
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
Biosciences) supplemented with 10% fetal bovine serum (FBS) (Hyclone). Cells
were incubated for 5 days at
28°C. The supernatant was harvested and subsequently used for the 1st
viral amplification by infecting Sf9 cells
in Hink's TNM-FH medium supplemented with 10% FBS at an approximate
multiplicity of infection (MOI) of
10. Cells were incubated for 3 days at 28°C. The supernatant was
harvested and the expression of the
recombinant Bolekin-IgG was determined by hatching binding of 1 mL of
supernatant to 30 ~L of Protein-A
Sepharose CL-4B beads (Pharmacia) followed by subsequent SDS-PAGE analysis
comparing to a known
concentration of protein standard marker by Coomassie blue staining.
The first viral amplification supernatant was used to infect a 500 mL spinner
culture of Sf9 cells grown
in ESF-921 medium (Expression Systems LLC) at an approximate MOI of 0.1. Cells
were incubated for 3 days
at 28°C. The supernatant was harvested and filtered. Batching binding
and SDS-PAGE analysis were repeated
to confirm expression in the spinner culture. The 500 mL of supernatant was
subsequently submitted for
purification.
In general, expressed poly-his tagged Bolekine polypeptide can then be
purified, for example, by Ni2+_
chelate affinity chromatography as follows. Extracts are prepared from
recombinant virus-infected Sf9 cells as
described by Rupert et al., Nature, 362:175-179 (1993). Briefly, Sf9 cells are
washed, resuspended in sonication
buffer (25 mL Hepes, pH 7.9; 12.5 mM MgCl2; 0.1 mM EDTA; 10% Glycerol; 0.1 %
NP-40; 0.4 M KCl),
and sonicated twice for 20 seconds on ice. The sonicates are cleared by
centrifugation, and the supernatant is
diluted 50-fold in loading buffer (50 mM phosphate, 300 mM NaCI, 10 %
Glycerol, pH 7.8) and filtered through
a 0.45 micron filter. A Ni2+-NTA agarose column (commercially available from
Qiagen) is prepared with a
bed volume of 5 mL, washed with 25 mL of water and equilibrated with 25 mL of
loading buffer. The filtered
cell extract is loaded onto the column at 0.5 mL per minute. The column is
washed to baseline A2g0 with
loading buffer, at which point fraction collection is started. Next, the
column is washed with a secondary wash
buffer (50 mM phosphate; 300 mM NaCI, 10 % Glycerol, pH 6.0), which elutes
nonspecifically bound protein.
After reaching A2g0 baseline again, the column is developed with a 0 to 500 mM
Imidazole gradient in the
secondary wash buffer. One mL fractions are collected and analyzed by SDS-PAGE
and silver staining or
western blot with Ni2'~-NTA-conjugated to alkaline phosphatase (Qiagen).
Fractions containing the eluted
His 10-tagged Bolekine polypeptide are pooled and dialyzed against loading
buffer.
Alternatively, purification of the IgG tagged (or Fc tagged) Bolekine
polypeptide can be performed using
known chromatography techniques, including for instance, Protein A or protein
G column chromatography.
In this case, the conditioned media from the transfected Sf9 cells (500 mL,
see above) were harvested
by centrifugation to remove the cells and filtered through 0.22 micron
filters. Immunoadhesin (Fc containing)
constructs of Bolekine protein were purified from the conditioned media. The
conditioned media was pumped
onto a 5 ml Protein A column (Pharmacia) which had been equilibrated in 20 mM
Na phosphate, pH 6.8, buffer.
After loading, the column was washed extensively with equilibration buffer
before elusion with 100 mM citric
acid, pH 3.5. The eluted protein was immediately neutralized by collecting 1
ml fractions into tubes containing
275 /cL of I M Tris, pH 9, buffer. The highly purified protein was
subsequently desalted into a storage buffer
containing 10 mM Hepes, 0.14 M NaCl and 4% mannitol, pH 6.8, with a 25 ml G25
Superfine (Pharmacia)
column and stored at -80° C. The homogeneity of the protein was
assessed by SDS polyacrylamide gels and
71
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
by N-terminal amino acid sequencing by Edman degradation.
Purified protein encoded by Bolekine was separated on a tris-HCl gel and
electroblotted to a PVDF
membrane. The band of interest was excised and then subjected to Edman
degradation in order to confirm the
protein product.
EXAMPLE 8: Northern Blot Analysis
Expression of Bolekine mRNA in human tissues was examined by Northern blot
analysis. In general,
human RNA blots were hybridized to a 32P-labelled DNA probe based on the full
length Bolekine cDNA; the
probe was generated by digesting and purifying the Bolekine cDNA insert. Human
fetal RNA blot MTN
(Clontech) and human adult RNA blot MTN-II (Clontech) were incubated with the
DNA probes. Blots were
incubated with the probes in hybridization buffer (5 X SSPE; 2 X Denhardt's
solution; I00 mg/mL denatured
sheared salmon sperm DNA; 50% formamide; 2% SDS) for 60 hours at 42°C.
The blots were washed several
times in 2 X SSC; 0.05 % SDS for 1 hour at room temperature, followed by a 30
minute wash in O.1X SSC;
0.1 % SDS at 50°C. The blots were developed after overnight exposure by
phosphorimager analysis (Fuji).
In this case, Northern blots containing human poly (A)+RNA from various
tissues (2 ~eg/lane) were
purchased from Clontech. A 469-by fragment containing the entire coding region
of Bolekine was amplified by
PCR using the following two primers, forward and reverse, respectively:
Forward Primer: 5'AGCGCACGGCCACAGACAG 3'(SEQ ID N0:6)
and
Reverse Primer: 5'GACCCTGCGCTTCTCGTTCCA 3' (SEQ ID N0:7).
A Bolekine-specific [32P]dCTP-labeled cDNA probe was synthesized by random
priming of this 469-by
fragment (High Prime, Boehringer Mannheim) and unincorporated nucleotides were
removed (NucTrap Probe
Purification Column, Stratagene). Membranes were analyzed by Northern blot
hybridization as previously
described (McMaster, M.T. et al., J. Immunol. 154(8):3771-3778, 1995).
As shown in Figure 3, Bolekine mRNA transcripts were detected. A 2 kb
transcript was detected at
low levels in various tissues, with moderate levels of expression in spleen,
lymph node, and colon, and highest
levels in kidney and small intestine. No expression can be detected in lung
and unstimulated peripheral blood
leukocytes (PBL).
EXAMPLE 9: In Situ Hybridization Showing Expression Patterns
Formalin-fixed, paraffin-embedded normal and diseased human fetal and adult
tissues were sectioned,
deparaffinized, deproteinated in proteinase K (20 mg/ml) for 15 minutes at
37°C, and further processed for in
situ hybridization as described (Lu, L.H., and N.A. Gillett, Cell Vision,
1:169-176, 1994). A [33-P] UTP-
labeled antisense riboprobe was generated from a 463 by PCR product (primer
sequences as described for
Northern analysis) and hybridized at 55°C overnight. The slides were
dipped in Kodak NTB2 nuclear track
emulsion and exposed for 4 weeks.
Fetal tissues examined include: placenta, umbilical cord, liver, kidney,
adrenals, thyroid, lungs, heart,
great vessels, esophagus, stomach, small intestine, spleen, thymus, pancreas,
brain, eye, spinal cord, body wall,
72
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
pelvis and lower limb. Adult tissues examined include liver, kidney, adrenal
myocardium, aorta, spleen, lymph
node, pancreas, lung, skin, cerebral cortex (rm), hippocampus (rm), eye,
stomach, gastric carcW oma, colon,
colonic carcinoma, thyroid (chimp), parathyroid (chimp), ovary (chimp) and
chondrosarcoma. Acetominophen
induced liver injury and hepatic cirrhosis.
Results are shown in Figures 4A-4E which are photomicrographs, including both
dark field (right
frame) and H&E stained tissue in bright field (left frame). An intense signal
was visible in various human
tissues. Figure 4A depicts normal skin which had specific strong expression in
the epithelial cells of the stratum
basale; this deepest most layer of the epidermis is the single cell thick
layer of cells along the basement
membrane which are the progenitors for all of the overlying epidermal cells in
the skin. There was no expression
in epidermal cells in the overlying layers (stratum spinosum, stratum
granulosum etc.). Expression was also
apparent in the dermis, which is the connective tissue immediately underlying
the epidermis. Figure 4B depicts
fetal kidney. In the fetal kidney, expression was specific in developing
tubules and expression was seen in the
tubular epithelium. Figure 4C and Figure 4D are fetal gut and adult gut
respectively. Sections of normal adult
human large bowel and fetal bowel were evaluated for expression. Both bowel
specimens had specific moderate
to strong expression in a multifocal pattern within the lamina propria of
villi. Figure 4E are sections of cerebrum
that were evaluated for expression. Sections of cerebrum had strong specific
expression in a subset of superfical
cortical neurons; the pattern was distinct and suggests delineation of a
specific population of neurons present in
the cortex.
EXAMPLE 10: Stimulatory Activity in Mixed Lymphocyte Reaction (MLR) Assay
(no.24)
This example shows that the polypeptides of the invention are active as
stimulators of the proliferation
of T-lymphocytes. Compounds which stimulate proliferation of lymphocytes are
useful therapeutically where
enhancement of an immune response is beneficial. A therapeutic agent may also
take the form of antagonists
of Bolekine, for example, marine-human chimeric, humanized or human antibodies
against the polypeptide,
which would be expected to inhibit T-lymphocyte proliferation.
The basic protocol for this assay is described in Current Protocols in
I»ttttunology, unit 3.12; edited by
J. E. Coligan, A. M. Kruisbeek, D. H. Marglies, E. M. Shevach, W. Strober,
National Institutes of Health,
Published by John Wiley & Sons, Inc.
More specifically, in one assay variant, peripheral blood mononuclear cells
(PBMC) are isolated from
mammalian individuals, for example a human volunteer, by leukopheresis (one
donor will supply stimulator
PBMCs, the other donor will supply responder PBMCs). If desired, the cells are
frozen in fetal bovine serum
and DMSO after isolation. Frozen cells may be thawed overnight in assay media
(37°C, 5% C02 ) and then
washed and resuspended to 3 x 106 cells/ml of assay media (RPMI; 10% fetal
bovine serum, 1%
penicillin/streptomycin, 1 % glutamine, 1 % HEPES, 1 % non-essential amino
acids, 1 % pyruvate).
The stimulator PBMCs are prepared by irradiating the cells (about 3000 Rads).
The assay is prepared by plating
in triplicate wells a mixture of: 100:1 of test sample diluted to 1 % or to
0.1 % ; 50:1 of irradiated stimulator cells
and 50:1 of responder PBMC cells. 100 microliters of cell culture media or 100
microliter of CD4-IgG is used
as the control. The wells are then incubated at 37 °C, 5 % C02 for 4
days. On day 5 and each well is pulsed with
73
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
tritiated thymidine (1.0 mCi/well; Amersham). After 6 hours the cells are
washed 3 times and then the uptake
of the label is evaluated.
In another variant of this assay, PBMCs are isolated from the spleens of
Balb/c mice and C57B6 mice.
The cells are teased from freshly harvested spleens in assay media (RPMI;10 %
fetal bovine serum, 1
penicillin/streptomycin, 1 % glutamine, 1 % HEPES, 1 % non-essential amino
acids, 1 % pyruvate) and the
PBMCs are isolated by overlaying these cells over Lympholyte M (Organon
Teknika), centrifuging at 2000
rpm for 20 minutes, collecting and washing the mononuclear cell layer in assay
media and resuspending the cells
to lx 107 cells/ml of assay media. The assay is then conducted as described
above. The results of this assay
for compounds of the invention are shown below in Table 7. Positive increases
over control are considered
positive with increases of greater than or equal to 180% being preferred.
However, any value greater than
control indicates a stimulatory effect for the test protein.
TABLE 7
PRO PRO Concentration Percent Increase Over Control
Bolekine 12.40 nM 112.0
Bolekine 124.00 nM 192.7
EXAMPLE 11: Skin Vascular Permeability Assay (no.64)
This assay shows that Bolekine stimulates an immune response and can induce
inflammation by inducing
mononuclear cell, eosinophil and PMN infiltration at the site of injection of
the animal. This skin vascular
permeability assay is conducted as follows. Hairless guinea pigs weighing 350
grams or more are anesthetized
with ketamine (75-80 mg/Kg) and 5 mg/Kg Xylazine intramuscularly (IM). A
sample of purified Bolekine
polypeptide or a conditioned media test sample is injected intradermally onto
the backs of the test animals with
100 mL per injection site. It is possible to have about 10-30, preferably
about 16-24, injection sites per animal.
One mL of Evans blue dye (1 % in physiologic buffered saline) is injected
intracardially. Blemishes at the
injection sites are then measured (mm diameter) at lhr, 6 hrs and 24 hrs post
injection. Animals were sacrificed
at the appropriate time after injection. Each skin injection site is biopsied
and fixed in paraformaldehyde. The
skins are then prepared for histopathalogic evaluation. Each site is evaluated
for inflammatory cell infiltration
into the skin. Sites with visible inflammatory cell inflammation are scored as
positive. Inflammatory cells may
be neutrophilic, eosinophilic, monocytic or lymphocytic
At least a minimal perivascular infiltrate at the injection site is scored as
positive, no infiltrate at the site
of injection is scored as negative. Bolekine scored positive in this assay
EXAMPLE 12: Neuronal differentiation of ES cells.(No. 137)
ES cells are grown at clonal density on 24-well plates in ES + LIF medium [to
stop differentiation] for
two days to establish small colonies. The medium is then changed to KSR
medium, LlF containing various
amounts of Bolekine protein and the ES clones are allowed to grow and
differentiate for 7 days in culture. On
the 7th day the cells are fixed and processed for immunocytochemistry with
antibodies raised against the neuronal
marker MAP2. The degree of neuronal differentiation is assessed using
fluorescence microscopy.
74
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
ES media-High glucose DMEM-10 % Fetal Calf Serum- SC media supplement-plus LIF-
KSR medium-GMEM-
10% KSR [Knock out serum replacement supplement]- glutamine- Pen/Strep- non-
essential amino acids- and 2-
ME. Fixation-4 % paraformaldehyde- MAP2 antibody [Pharmingen] diluted 1:1000
in PBST [0.1 % Triton] with
3 % normal goat serum.
Results will be calculated as the % of ES colonies containing neurons and the
% of neurons within
individual colonies.
Wells that have neuronal colony and cell counts lOx above background will be
considered positive,
containing a protein that influences neuronal differentiation. Bolekine at a
final concentration of 124.00 nM
tested positive for neuronal differentiation.
EXAMPLE 13: Purification of Bolekine Polypeptides Usina Specific Antibodies
Native or recombinant Bolekine polypeptides may be purified by a variety of
standard techniques in the
art of protein purification. For example, pro-Bolekine polypeptide, mature
Bolekine polypeptide, or pre-
Bolekine polypeptide is purified by immunoaffinity chromatography using
antibodies specific for the Bolekine
polypeptide of interest. In general, an immunoaffinity column is constructed
by covalently coupling the
anti-Bolekine polypeptide antibody to an activated chromatographic resin.
Polyclonal immunoglobulins are prepared from immune sera either by
precipitation with ammonium
sulfate or by purification on immobilized Protein A (Pharmacia LKB
Biotechnology, Piscataway, N.J.).
Likewise, monoclonal antibodies are prepared from mouse ascites fluid by
ammonium sulfate precipitation or
chromatography on immobilized Protein A. Partially purified immunoglobulin is
covalently attached to a
chromatographic resin such as CnBr-activated SEPHAROSETM (Pharmacia LKB
Biotechnology). The antibody
is coupled to the resin, the resin is blocked, and the derivative resin is
washed according to the manufacturer's
instructions.
Such an immunoaffinity column is utilized in the purification of Bolekine
polypeptide by preparing a
fraction from cells containing Bolekine polypeptide in a soluble form. This
preparation is derived by
solubilization of the whole cell or of a subcellular fraction obtained via
differential centrifugation by the addition
of detergent or by other methods well known in the art. Alternatively, soluble
Bolekine polypeptide containing
a signal sequence may be secreted in useful quantity into the medium in which
the cells are grown.
A soluble Bolekine polypeptide-containing preparation is passed over the
immunoaffinity column, and
the column is washed under conditions that allow the preferential absorbance
of Bolekine polypeptide (e. g. , high
ionic strength buffers in the presence of detergent). Then, the column is
eluted under conditions that disrupt
antibody/Bolekine polypeptide binding (e.g., a low pH buffer such as
approximately pH 2-3, or a high
concentration of a chaotrope such as urea or thiocyanate ion), and Bolekine
polypeptide is collected.
EXAMPLE 14: Drua Screenine
This invention is particularly useful for screening compounds by using
Bolekine polypeptides or binding
fragment thereof in any of a variety of drug screening techniques. The
Bolekine polypeptide or fragment
employed in such a test may either be free in solution, affixed to a solid
support, borne on a cell surface, or
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
located intracellularly, One method of drug screening utilizes eukaryotic or
prokaryotic host cells which are
stably transformed with recombinant nucleic acids expressing the Bolekine
polypeptide or fragment. Drugs are
screened against such transformed cells in competitive binding assays. Such
cells, either in viable or fixed form,
can be used for standard binding assays. One may measure, for example, the
formation of complexes between
Bolekine polypeptide or a fragment and the agent being tested. Alternatively,
one can examine the diminution
S in complex formation between the Bolekine polypeptide and its target cell or
target receptors caused by the agent
being tested.
Thus, the present invention provides methods of screening for drugs or any
other agents which can
affect a Bolekine polypeptide-associated disease or disorder. These methods
comprise contacting such an agent
with an Bolekine polypeptide or fragment thereof and assaying (i) for the
presence of a complex between the
agent and the Bolekine polypeptide or fragment, or (ii) for the presence of a
complex between the Bolekine
polypeptide or fragment and the cell, by methods well known in the art. In
such competitive binding assays,
the Bolekine polypeptide or fragment is typically labeled. After suitable
incubation, free Bolekine polypeptide
or fragment is separated from that present in bound form, and the amount of
free or uncomplexed label is a
measure of the ability of the particular agent to bind to Bolekine polypeptide
or to interfere with the Bolekine
1 S polypeptide/cell complex.
Another technique for drug screening provides high throughput screening for
compounds having suitable
binding affinity to a polypeptide and is described in detail in WO 84/03564,
published on September 13, 1984.
Briefly stated, large numbers of different small peptide test compounds are
synthesized on a solid substrate, such
as plastic pins or some other surface. As applied to a Bolekine polypeptide,
the peptide test compounds are
2,0 reacted with Bolekine polypeptide and washed. Bound Bolekine polypeptide
is detected by methods well known
in the art. Purified Bolekine polypeptide can also be coated directly onto
plates for use in the aforementioned
drug screening techniques. In addition, non-neutralizing antibodies can be
used to capture the peptide and
immobilize it on the solid support.
This invention also contemplates the use of competitive drug screening assays
in which neutralizing
2S antibodies capable of binding Bolekine polypeptide specifically compete
with a test compound for binding to
Bolekine polypeptide or fragments thereof. In this manner, the antibodies can
be used to detect the presence of
any peptide which shares one or more antigenic determinants with Bolekine
polypeptide.
EXAMPLE 15: Rational Drua Design
30 The goal of rational drug design is to produce structural analogs of
biologically active polypeptide of
interest (i. e. , a Bolekine polypeptide) or of small molecules with which
they interact, e. g. , agonists, antagonists,
or inhibitors. Any of these examples can be used to fashion drugs which are
more active or stable forms of the
Bolekine polypeptide or which enhance or interfere with the function of the
Bolekine polypeptide izz vivo (cf.,
Hodgson, Bio/Technolo~y, 9: 19-21 (1991)).
3S In one approach, the three-dimensional structure of the Bolekine
polypeptide, or of a Bolekine
polypeptide-inhibitor complex, is determined by x-ray crystallography, by
computer modeling or, most typically,
by a combination of the two approaches. Both the shape and charges of the
Bolekine polypeptide must be
76
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
ascertained to elucidate the structure and to determine active sites) of the
molecule. Less often, useful
information regarding the structure of the Bolekine polypeptide may be gained
by modeling based on the
structure of homologous proteins. In both cases, relevant structural
information is used to design analogous
Bolekine polypeptide-like molecules or to identify efficient inhibitors.
Useful examples of rational drug design
may include molecules which have improved activity or stability as shown by
Braxton and Wells, Biochemistry,
31:7796-7801 (1992) or which act as inhibitors, agonists, or antagonists of
native peptides as shown by Athauda
et al., J. Biochem., 113:742-746 (1993).
It is also possible to isolate a target-specific antibody, selected by
functional assay, as described above,
and then to solve its crystal structure. This approach, in principle, yields a
pharmacore upon which subsequent
drug design can be based. It is possible to bypass protein crystallography
altogether by generating anti-idiotypic
antibodies (anti-ids) to a functional, pharmacologically active antibody. As a
mirror image of a mirror image,
the binding site of the anti-ids would be expected to be an analog of the
original receptor. The anti-id could then
be used to identify and isolate peptides from banks of chemically or
biologically produced peptides. The isolated
peptides would then act as the pharmacore.
By virtue of the present invention, sufficient amounts of the Bolekine
polypeptide may be made available
to perform such analytical studies as X-ray crystallography. In addition,
knowledge of the Bolekine polypeptide
amino acid sequence provided herein will provide guidance to those employing
computer modeling techniques
in place of or in addition to x-ray crystallography.
Deposit of Material
The following materials have been deposited with the American Type Culture
Collection, 10801 University
Blvd., Manassas, VA 20110-2209, USA (ATCC):
Material ATCC Den. No. Deposit Date
DNA39523-1192 (Bolekine) 209424 October 31,1997
These deposits were made under the provisions of the Budapest Treaty on the
International Recognition
of the Deposit of Microorganisms for the Purpose of Patent Procedure and the
Regulations thereunder (Budapest
Treaty). This assures maintenance of a viable culture of the deposit for 30
years from the date of deposit. The
deposits will be made available by ATCC under the terms of the Budapest
Treaty, and subject to an agreement
between Genentech, Inc. and ATCC, which assures permanent and unrestricted
availability of the progeny of
the culture of the deposit to the public upon issuance of the pertinent U.S.
patent or upon laying open to the
public of any U.S. or foreign patent application, whichever comes first, and
assures availability of the progeny
to one determined by the U.S. Commissioner of Patents and Trademarks to be
entitled thereto according to 35
USC ~ 122 and the Commissioner's rules pursuant thereto (including 37 CFR ~
1.14 with particular reference
to 886 OG 638).
The assignee of the present application has agreed that if a culture of the
materials on deposit should
die or be lost or destroyed when cultivated under suitable conditions, the
materials will be promptly replaced on
77
CA 02441700 2003-09-19
WO 02/077028 PCT/USO1/09552
notification with another of the same. Availability of the deposited material
is not to be construed as a license
to practice the invention in contravention of the rights granted under the
authority of any government in
accordance with its patent laws.
The foregoing written specification is considered to be sufficient to enable
one skilled in the art to
practice the invention. The present invention is not to be limited in scope by
the construct deposited, since the
deposited embodiment is intended as a single illustration of certain aspects
of the invention and any constructs
that are functionally equivalent are within the scope of this invention. The
deposit of material herein does not
constitute an admission that the written description herein contained is
inadequate to enable the practice of any
aspect of the invention, including the best mode thereof, nor is it to be
construed as limiting the scope of the
claims to the specific illustrations that it represents. Indeed, various
modifications of the invention in addition
to those shown and described herein will become apparent to those skilled in
the art from the foregoing
description and fall within the scope of the appended claims.
7~
