Note: Descriptions are shown in the official language in which they were submitted.
CA 02448796 2010-05-20
t
51440-28
1
VACCINE AGAINST THE NILE FEVER VIRUS
The present invention relates to in vivo and in vitro expression vectors
comprising and
expressing at least one polynucleotide of the West Nile fever virus, as well
as
immunogenic compositions and vaccines against West Nile fever. It also relates
to
methods for immunizing and vaccinating against the virus.
The West Nile fever virus (WNV) was first identified in man in 1937 in Ouganda
in the
West Nile Province (Zeller H. G., Med. Trop., 1999, 59, 490-494).
Widespread in Africa, it is also encountered in India, Pakistan and the
Mediterranean
basin and was identified for the first time in the USA in 1999 in New York
City
(Anderson J. F. et al., Science, 1999, 286, 2331-2333).
The West Nile fever virus affects birds as well as mammals, together with man.
The fever is characterized in birds by an attack of the central nervous system
and
death. The lesions include encephalitis, hemorrhages in the myocardium and
hemorrhages and necroses in the intestinal tract.
In chickens, experimental infections by subcutaneous inoculations of the West
Nile
fever virus isolated on crows led to necroses of the myocardium, nephrites and
pneumonia 5 to 10 days after inoculation and moderate to severe encephalitis
21 days
after inoculation (Senne D. A. et al., Avian Disease, 2000, 44, 642-649).
The West Nile fever virus also affects horses, particularly in North Africa
and Europe
(Cantile C. et al., Equine Vet. J., 2000, 32 (1), 31-35). These horses reveal
signs of
ataxia, weakness of the rear limbs, paresis evolving towards tetraplegia and
death.
Horses and camels are the main animals manifesting clinical signs in the form
of
encephalitis.
Anti-WNV antibodies were detected in certain rodents, in livestock,
particularly
bovines and ovines, as well as in domestic animals, particularly in the dog
(Zeller H. G., Med. Trop., 1999, 59, 490-494; Lundstrom J.O., Journal of
Vector
Ecology, 1999, 24 (1), 1-39).
CA 02448796 2010-05-20
51440-28
1a
The West Nile fever virus also affects with a number of symptoms the human
species
(Sampson B. A., Human pathology, 2000, 31 (5), 527-531; Marra C. M., Seminars
in
Neurology, 2000, 20 (3), 323-327).
The West Nile fever virus is transmitted to birds and mammals by the bites of
certain
mosquitoes (e.g. Culex, Aedes, Anopheles) and ticks.
Wild and domestic birds are a reservoir for the West Nile virus and a
propagation
vector as a result of their migrations.
CA 02448796 2006-12-12
51440-28
2
The virions of the West Nile fever virus are spherical particles with a
diameter of 50 nm constituted by a
lipoproteic envelope surrounding an icosahedric nucleocapsid containing a
positive polarity, single-strand
RNA.
A single open reading frame (ORF) encodes all the viral proteins in the form
of a polyprotein. The cleaving
and maturation of this polyprotein leads to the production of about ten
different viral proteins. The structural
proteins are encoded by the 5' part of the genome and correspond to the
nucleocapsid designated C (14
kDa), the envelope glycoprotein designated E (50 kDa), the pre-membrane
protein designated prM (23 kDa),
the membrane protein designated M (7 kDa). The non-structural proteins are
encoded by the 3' part of the
genome and correspond to the proteins NS1 (40 kDa), NS2A (19 kDa), NS2B (14
kDa), NS3 (74 kDa),
NS4A (15 kDa), NS4B (29 kDa), NS5 (97 kDa).
Parrish C. R. et al. (J. Gen. Virol., 1991, 72, 1645-1653), Kulkami A. B. et
al. (J. Viroi., 1992, 66 (6), 3583-
3592) and Hill A. B. et at. (J. Gen. Virol., 1992, 73, 1115-1123), on the
basis of the vaccinia virus,
constructed in vivo expression vectors containing various inserts
corresponding to nucleotide sequences
coding for non-structural proteins of the Kunjin virus, optionally associated
with structural proteins. These
vectors were administered to the mouse to evaluate the immune cell response.
The authors stress the
importance of the cell response, which is essentially stimulated by non-
structural proteins and especially
NS3, NS4A and NS4B. These articles reveal the difficulty in providing a good
vaccination strategy against
West Nile fever.
Hitherto there is no vaccine preventing infection by the WN virus.
The present invention relates to a means for preventing and/or combating
diseases caused by the WN virus.
Another objective of the invention is to propose such a means usable in
different animal species sensitive to
the disease caused by said virus and in particular equine and avian species.
Another objective of the invention is to propose immunization and vaccination
methods for the target
species.
Yet another objective of the invention is to propose means and methods making
it possible to ensure a
differential diagnosis.
Thus, the first object of the invention is in vitro and/or in vivo expression
vectors comprising a polynucleotide
encoding the envelope protein E of the WN virus. These vectors also comprise
the elements necessary for
the expression of the polynucleotide in the host cell.
CA 02448796 2006-12-12
51440-28
3
In addition to the polynucleotide encoding E, the expression vectors according
to the invention can comprise
one or more other polynucleotides encoding other proteins of the WN virus,
preferably structural proteins of
the WN virus and said sequences are preferably chosen from among those
encoding the pre-membrane
protein prM and the membrane protein M.
The vector preferably comprises a polynucleotide forming a single encoding
frame corresponding e.g. to
prM-E, WE and more particularly prM-M-E. A vector comprising several separate
polynucleotides encoding
the different proteins (e.g. prM and/or M and E) also falls within the scope
of the present invention. The
vector, more particularly in vivo, can also comprise polynucleotides
corresponding to more than one WN
virus strain, particularly two or more polynucleotides encoding E or prM-M-E
of different strains. As will be
shown hereinafter, the vector, particularly in vivo, can comprise one or more
nucleotide sequences encoding
immunogens of other pathogenic agents and/or cytokins.
According to a preferred embodiment of the invention, the expression vector
comprises a polynucleotide
encoding prM-M-E and preferably in a single reading frame.
The term polynucleotide encoding a protein of the WN virus mainly means a DNA
fragment encoding said
protein, or the complementary strand of said DNA fragment. An RNA is not
excluded.
In the sense of the invention, the term protein covers fragments, including
peptides and polypeptides. By
definition, the protein fragment is immunologically active in the sense that
once administered to the host, it is
able to evoke an immune response of the humorai and/or cellular type directed
against the protein.
Preferably the protein fragment is such that it has substantially the same
immunological activity as the total
protein. Thus, a protein fragment according to the invention comprises at
least one epitope or antigenic
determinant. The term epitope relates to a protein site able to induce an
immune reaction of the humoral
type (B cells) and/or cellular type (T cells).
Thus, the minimum structure of the polynucleotide is that encoding an epitope
or antigenic determinant of
the protein in question. A polynucleotide encoding a fragment of the total
protein more particularly
comprises a minimum of 21 nucleotides, particularly at least 42 nucleotides
and preferably at least 57, 87 or
150 consecutive nucleotides of the sequence in question. Epitope determination
procedures are well known
to the one skilled in the art and it is more particularly possible to use
overlapping peptide libraries (Hemmer
B. et al., Immunology Today, 1998, 19 (4), 163-168), Pepscan (Geysen H. M. et
al., Proc. Nat. Acad. Sci.
USA, 1984, 81 (13), 3998-4002; Geysen H. M. et al., Proc. Nat. Aced. Sci. USA,
1985, 82 (1), 178-182; Van
der Zee R. et al., Eur. J. Immunol., 1989, 19 (1), 43-47; Geysen H. M.,
Southeast Asian J. Trop. Med. Public
Health, 1990, 21 (4), 523-533; Multipin Peptide Synthesis Kits de Chiron) and
algorithms (De Groot A. et
al., Nature Biotechnology, 1999, 17, 533-561).
In particular the polynucleotides according to the invention comprise the
nucleotide sequence encoding one
or two transmembrane domains and preferably two of them, located in the
terminal part C of the protein E.
CA 02448796 2006-12-12
51440-28
4
For the WNV NY99 strain, these domains correspond to amino acid sequences 742
to 766 and 770 to 791
of GenBank AF196835.
Elements necessary for the expression of the polynucleotide or polynucleotides
are present. In minimum
manner, this consists of an initiation codon (ATG), a stop codon and a
promoter, as well as a
polyadenylation sequence for the plasmids and viral vectors other than
poxviruses. When the
polynucleotide encodes a polyprotein fragment, e.g. prM-E, M-E, prM-M-E, an
ATG is placed at 5' of the
reading frame and a stop codon is placed at 3'. As will be explained
hereinafter, other elements making it
possible to control the expression could be present, such as enhancer
sequences, stabilizing sequences
and signal sequences permitting the secretion of the protein.
The present invention also relates to preparations comprising such expression
vectors. It more particularly
relates to preparations comprising one or more in vivo expression vectors,
comprising and expressing one
or more of the above polynucleotides, including that encoding E, in a
pharmaceutically acceptable excipient
or vehicle.
According to a first embodiment of the invention, the other vector or vectors
in the preparation comprise and
express one or more other proteins of the WN virus, e.g. prM, M, prM-M.
According to another embodiment, the other vector or vectors in the
preparation comprise and express one
or more proteins of one or more other WN virus strains. In particular, the
preparation comprises at least two
vectors expressing, particularly in vivo, polynucleotides of different WN
strains encoding the same proteins
and/or for different proteins, preferably for the same proteins. This is more
particularly a matter of vectors
expressing in vivo E or prM-M-E of two, three or more different WN strains.
The invention is also directed at
mixtures of vectors expressing prM, M, E, prM-M, prM-E or M-E of different
strains.
According to yet another embodiment and as will be shown in greater detail
hereinafter, the other vector or
vectors in the preparation comprise and express one or more cytokins and/or
one or more.immunogens of
one or more other pathogenic agents.
The invention also relates to various combinations of these different
embodiments.
The preparations comprising an in vitro or in vivo expression vector
comprising and expressing a
polynucleotide encoding prM-M-E constitute a preferred embodiment of the
invention.
According to a special embodiment of the invention, the in vivo or in vitro
expression vectors comprise as
the sole polynucleotide or polynucleotides of the WN virus, a polynucleotide
encoding the protein E,
optionally associated with prM and/or M, preferably encoding prM-M-E and
optionally a signal sequence of
the WN virus.
CA 02448796 2011-11-23
51440-28
4a
In one aspect, the present invention relates to a composition comprising a
pharmaceutically acceptable vehicle or excipient, and a vector comprising a
recombinant
canarypox virus that encodes and expresses in vivo in an animal West Nile
Virus (WNV)
polyprotein prM-M-E.
CA 02448796 2006-12-12
51440-28
According to a special embodiment, one or more of the non-structural proteins
NS2A, NS2B and NS3 are
expressed jointly with the structural proteins according to the invention,
either via the same expression
vector, or via their own expression vector. They are preferably expressed
together on the basis of a single
polynucleotide.
5
Thus, the invention also relates to an in vivo or in vitro expression vector
comprising the polynucleotide
encoding NS2A, NS2B, NS3, their combinations and preferably for NS2A-NS2B-NS3.
Basically said vector
can be one of the above-described vectors comprising a polynucleotide encoding
one or more structural
proteins, particularly E or prM-M-E. As an alternative, the invention relates
to a preparation as described
hereinbefore, also incorporating at least one of these vectors expressing a
non-structural protein and
optionally a pharmaceutically acceptable vehicle or excipient.
In order to implement the expression vectors according to the invention, the
one skilled in the art has various
strains of the WN virus and the description of the nucleotide sequence of
their genome, of. particularly
Savage H. M. et al. (Am. J. Trop. Med. Hyg. 1999, 61 (4), 600-611), table 2,
which refers to 24 WN virus
strains and gives access references to polynucleotide sequences in GenBank.
Reference can e.g. be made to strain NY99 (GenBank AF196835). In GenBank, for
each protein the
corresponding DNA sequence is given (nucleotides 466-741 for prM, 742-966 for
M, 967-2469 for E, or 466-
2469 for prM-M-E, 3526-4218 for NS2A, 4219-4611 for NS2B and 4612-6468 for
NS3, or 3526-6468 for
NS2A-NS2B-NS3). By comparison and alignment of the sequences, the
determination of a polynucleotide
encoding such a protein in another WNV strain is immediate.
It was indicated hereinbefore that polynucleotide was understood to mean the
sequence encoding the
protein or a fragment or an epitope specific to the WN virus. Moreover, by
equivalence, the term
polynucleotide also covers the corresponding nucleotide sequences of the
different WN virus strains and
nucleotide sequences differing by the degeneracy of the code.
Within the family of WN viruses, identity between amino acid sequences prM-M-E
relative to that of NY99 is
equal to or greater than 90%. Thus, the invention covers polynucleotides
encoding an amino acid
sequence, whose identity with the native amino acid sequence is equal to or
greater than 90%, particularly
92%, preferably 95% and more specifically 98%. Fragments of these homologous
polynucleotides specific
with respect to WN viruses, are also considered equivalents.
Thus, on referring to a polynucleotide of the WN virus, this term covers
equivalent sequences within the
sense of the invention.
It has also been seen that the term protein covers immunologically active
peptides and polypeptides. For
the requirements of the invention, it covers:
a) corresponding proteins of the different WN virus strains,
CA 02448796 2006-12-12
51440-28
6
b) proteins differing therefrom, but maintaining with a native WN protein an
identity equal to or greater than
90%, particularly 92%, preferably 95% and more specifically 98%.
Thus, on referring to a protein of the WN virus, this term covers equivalent
proteins within the sense of the
invention.
Different WN virus strains are accessible in collections, particularly in the
American Type Culture Collection
(ATCC), e.g. under access numbers VR-82 or VR-1267. The Kunjin virus is in
fact considered to be a WN
virus.
According to the invention, preferably the polynucleotide also comprises a
nucleotide sequence encoding a
signal peptide, located upstream of the expressed protein in order to ensure
the secretion thereof. It can
consequently be an endogenic sequence, i.e. the natural signal sequence when
it exists (coming from the
same WN virus or another strain). For example, for the NY99 WN virus, the
endogenic signal sequence of E
corresponds to nucleotides 922 to 966 of the GenBank sequence and for prM it
is a matter of nucleotides
421 to 465. It can also be a nucleotide sequence encoding a heterologous
signal peptide, particularly that
encoding the signal peptide of the human tissue plasminogen activator (tPA)
(Hartikka J. et al., Human
Gene Therapy, 1996, 7, 1205-1217). The nucleotide sequence encoding the signal
peptide is inserted in
frame and upstream of the sequence encoding E or its combinations, e.g. prM-M-
E.
According to a first embodiment of the invention, the in vivo expression
vectors are viral vectors.
These expression vectors are advantageously poxviruses, e.g. the vaccinia
virus or attenuated mutants of
the vaccinia virus, e.g. MVA (Ankara strain) (Stick) H. and Hochstein-Mintzel
V., Munch. Med. Wschr., 1971,
113, 1149-1153; Sutter G. et at., Proc. Natl. Acad. Sci. U.S.A., 1992, 89,
10847-10851; commercial strain
ATCC VR-1508; MVA being obtained after more than 570 passages of the Ankara
vaccine strain on chicken
embryo fibroblasts) or NYVAC (its construction being described in US-A-5 494
807, particularly in examples
1 to 6, said patent also describing the insertion of heterologous genes in
sites of this recombinant and the
use of matched promoters - reference also to be made to WO-A-96/40241), avipox
(in particular canarypox,
fowlpox, pigeonpox, quailpox), swinepox, raccoonpox and camelpox,
adenoviruses, such as avian, canine,
porcine, bovine, human adenoviruses and herpes viruses, such as equine herpes
virus (EHV serotypes I
and 4), canine herpes virus (CHV), feline herpes virus (FHV), bovine herpes
viruses (BHV serotypes I and
4), porcine herpes virus (PRV), Marek's disease virus (MDV serotypes I and 2),
turkey herpes virus (HVT or
MDV serotype 3), and duck herpes virus. When a herpes virus is used, the
vector HVT is preferred for the
vaccination of the avian species and the vector EHV for the vaccination of
horses.
According to one of the preferred embodiments of the invention, the poxvirus
expression vector is a
canarypox or a fowipox, whereby such poxviruses can possibly be attenuated.
Reference can be made to
the canarypox commercially available from ATCC under access number VR-111.
Attenuated canarypox
viruses were described in US-A-5,756,103 and WO-A-01/05934. Numerous fowipox
virus vaccination
CA 02448796 2006-12-12
51440-28
7
strains are available, e.g. the DIFTOSEC CT strain marketed by MERIAL and the
NOBILIS VARIOLE
vaccine marketed by Intervet.
For poxviruses, the one skilled in the art can refer to WO-A-90112882 and more
particularly for the vaccinia
virus to US-A-4,769,330; US-A-4,722,848; US-A-4,603,112; US-A-5,1 10,587; US-A-
5,494,807; US-A-
5,762,938; for fowlpox to US-A-5,174,993; US-A-5,505,941; US-5,766,599; for
canarypox to US-A-
5,756,103; for swinepox to US-A-5,382,425 and for raccoonpox to WO-A-00/03030.
When the expression vector is a vaccinia virus, the insertion sites for the
polynucleotide or polynucleotides
to be expressed are in particular the gene of thymidine kinase (TK), the gene
of hemagglutinin (HA), the
region of the inclusion body of the A type (ATI). In the case of canarypox,
the insertion sites are more
particularly located in or are constituted by ORFs, C3, C5 and C6. In the case
of fowlpox, the insertion sites
are more particularly located in or constituted by the ORFs F7 and F8.
The insertion of genes in the MVA virus has been described in various
publications, including Carroll M. W.
et al., Vaccine, 1997, 15 (4), 387-394; Stittelaar K. J. et at., J. Viral.,
2000, 74 (9), 4236-4243; Sutter G. et
al., 1994, Vaccine, 12 (11), 1032-1040, to which the one skilled in the art
can refer. The complete MVA
genome is described in Antoine G., Virology, 1998, 244, 365-396, which enables
the one skilled in the art to
use other insertion sites or other promoters.
Preferably, when the expression vector is a poxvirus, the polynucleotide to be
expressed is inserted under
the control of a specific poxvirus promoter, particularly the vaccine promoter
7.5 kDa (Cochran et at., J.
Virology, 1985, 54,30-35), the vaccine promoter 13L (Riviere et al., J.
Virology, 1992, 66, 3424-3434), the
vaccine promoter HA (Shida, Virology, 1986, 150, 451-457), the cowpox promoter
ATI (Funahashi et al., J.
Gen. Viral., 1988, 69, 35-47), or the vaccine promoter H6 (Taylor J. at al.,
Vaccine, 1988, 6, 504-508; Guo
P. et al. J. Viral., 1989, 63, 4189-4198; Perkus M. et al., J. Viral., 1989,
63, 3829-3836).
Preferably, for the vaccination of mammals the expression vector is a
canarypox. Preferably, for the
vaccination of avians, particularly chickens, ducks, turkeys and geese, the
expression vector is a canarypox
or a fowlpox.
When the expression vector is a herpes virus HVT, appropriate insertion sites
are more particularly located
in the BamHl I fragment or in the BamHI M fragment of HVT. The HVT BamHl I
restriction fragment
comprises several open reading frames (ORFs) and three intergene regions and
comprises several
preferred insertion zones, namely the three intergene regions 1, 2 and 3,
which constitute preferred regions,
and ORF UL55 (FR-A-2 728 795, US-A-5 980 906). The HVT BamHl M restriction
fragment comprises ORF
UL43, which is also a preferred insertion site (FR-A-2 728 794, US-A-5 733
554).
When the expression vector is an EHV-1 or EHV-4 herpes virus, appropriate
insertion sites are in particular
TK, UL43 and UL45 (EP-A-668355).
CA 02448796 2006-12-12
51440-28
8
Preferably, when the expression vector is a herpes virus, the polynucleotide
to be expressed is inserted
under the control of a strong eukaryote promoter, preferably the CMV-IE
promoter. These strong promoters
are described hereinafter in the part of the description relating to plasmids.
According to a second embodiment of the invention, the in vivo expression
vectors are plasmidic vectors
known as plasmids.
The term plasmid covers any DNA transcription unit in the form of a
polynucleotide sequence comprising a
polynucleotide according to the invention and the elements necessary for its
in vivo expression. Preferably
there is a supercoiled or non-supercoiled, circular plasmid. The linear form
also falls within the scope of the
invention.
Each plasmid comprises a promoter able to ensure, in the host cells, the
expression of the polynucleotide
inserted under its dependency. In general, it is a strong eukaryote promoter.
The preferred strong
eukaryote promoter is the early cytomegalovirus promoter (CMV-IE) of human or
murine origin, or optionally
having another origin such as the rat or guinea pig. The CMV-IE promoter can
comprise the actual promoter
part, which may or may not be associated with the enhancer part. Reference can
be made to EP-A-260
148, EP-A-323 597, US-A-5 168 062, US-A-5 385 839, US-A-4 968 615, WO-A-
87/03905. Preference is
given to human CMV-IE (Boshart M. et al., Cell., 1985,41, 521-530) or murine
CMV-IE.
In more general terms, the promoter has either a viral ore cellular origin.
Astrong viral promoter other than
CMV-IE is the early/late promoter of the SV40 virus or the LTR promoter of the
Rous sarcoma virus. A
strong cellular promoter is the promoter'of a gene of the cytoskeleton, such
as e.g. the desmin promoter
(Kwissa M. et al., Vaccine, 2000, 18 (22), 2337-2344), or the actin promoter
(Miyazaki J. et aL, Gene, 1989,
79 (2), 269-277).
By equivalence, the sub-fragments of these promoters, maintaining an adequate
promoting activity are
included within the present invention, e.g. truncated CMV-IE promoters
according to WO-A-98/00166. The
notion of the promoter according to the invention consequently includes
derivatives and sub-fragments
maintaining an adequate promoting activity, preferably substantially similar
to that of the actual promoter
from which they are derived. For CMV-IE, this notion comprises the actual
promoter part and/or the
enhancer part, as well as derivatives and sub-fragments.
Preferably, the plasmids comprise other expression control elements. It is in
particular advantageous to
incorporate stabilizing sequences of the intron type, preferably intron If of
the rabbit {3-globin gene (van
Ooyen et al., Science, 1979, 206: 337-344).
CA 02448796 2006-12-12
51440-28
9
As the polyadenylation signal (polyA) for the plasmids and viral vectors other
than poxviruses, use can more
particularly be made of the one of the bovine growth hormone (bGH) gene (US-A-
5 122 458), the one of the
rabbit R-globin gene or the one of the SV40 virus.
The other expression control elements usable in plasmids can also be used in
herpes virus expression
vectors.
According to another embodiment of the invention, the expression vectors are
expression vectors used for
the in vitro expression of proteins in an appropriate cell system. The
proteins can be harvested in the
culture supernatant after or not after secretion (if there Is no secretion a
cell lysis is done), optionally
concentrated by conventional concentration methods, particularly by
ultrafiltration and/or purified by
conventional purification means, particularly affinity, ion exchange or gel
filtration-type chromatography
methods.
Production takes place by the transfection of mammal cells by plasmids, by
replication of viral vectors on
mammal cells or avian cells, or by Baculovirus replication (US-A-4 745 051;
Vialard J. et all., J. Virol., 1990
64 (1), 37-50; Verne A., Virology, 1988, 167, 56-71), e.g. Autographa
californica Nuclear Polyhedrosis Virus
AcNPV, on insect cells (e.g. Sf9 Spodoptera frugiperda cells, ATCC CRL 1711).
Mammal cells which can
be used are in particular hamster cells (e.g. CHO or BHK-21) or monkey cells
(e.g. COS or VERO). Thus,
the invention also covers expression vectors incorporating a polynucleotide
according to the invention, the
thus produced WN proteins or fragments and the preparations containing the
same.
Thus, the present invention also relates to WN protein-concentrated and/or
purified preparations. When the
polynucleotide encodes several proteins, they are cleaved, and the
aforementioned preparations then
contain cleaved proteins.
The present invention also relates to immunogenic compositions and vaccines
against the WN virus
comprising at least one in vivo expression vector according to the invention
and a pharmaceutically
acceptable excipient or vehicle and optionally an adjuvant.
The immunogenic composition notion covers any composition which, once
administered to the target
species, induces an immune response directed against the WN virus. The term
vaccine is understood to
mean a composition able to induce an effective protection. The target species
are equines, canines, felines,
bovines, porcines, birds, preferably the horse, dog, cat, pig and in the case
of birds geese, turkeys, chickens
and ducks and which by definition covers reproducing animals, egg-layers and
meat animals.
The pharmaceutically acceptable vehicles or excipients are well known to the
one skilled in the art. For
example, it can be a 0.9% NaCl saline solution or a phosphate buffer. The
pharmaceutically acceptable
vehicles or excipients also cover any compound or combination of compounds
facilitating the administration
of the vector, particularly the transfection, and/or improving preservation.
CA 02448796 2006-12-12
51440-28
The doses and dose volumes are defined hereinafter in the general description
of immunization and
vaccination methods.
5 The immunogenic compositions and vaccines according to the invention
preferably comprise one or more
adjuvants, particularly chosen from among conventional adjuvants. Particularly
suitable within the scope of
the present invention are (1) polymers of acrylic or methacrylic acid, maleic
anhydride and alkenyl derivative
polymers, (2) immunostimulating sequences (ISS), particularly
oligodeoxyribonucleotide sequences having
one ore more non-methylated CpG units (Klinman D. M. et al., Proc. Natl. Acad.
Scl., USA, 1996, 93,2879-
10 2883; WO-A1-98/16247), (3) an oil in water emulsion, particularly the SPT
emulsion described on p 147 of
"Vaccine Design, The Subunit and Adjuvant Approach" published by M. Powell, M.
Newman, Plenum Press
1995, and the emulsion MF59 described on p 183 of the same work, (4) cation
lipids containing a quaternary
ammonium salt, (5) cytokins or (6) their combinations or mixtures.
The oil in water emulsion (3). which is particularly appropriate for viral
vectors, can in particular be based on:
- light liquid paraffin oil (European pharmacopoeia type),
- isoprenoid of such as squalane, squalene,
- oil resulting from the oligomerization of alkenes,
particularly isobutene or decene,
- esters of acids or alcohols having a straight-chain alkyl group,
- more particularly vegetable oils, ethyl oleate, propylene glycol,
di(caprylate/caprate), glycerol
tri(caprylate/caprate) and propylene glycol dioleate,
- esters of branched, fatty alcohols or acids, particularly isostearic acid
esters.
The oil is used in combination with emulsifiers to form the emulsion. The
emulsifiers are preferably nonionic
surfactants, particularly:
- esters of on the one hand sorbitan, mannide (e.g. anhydromannitol oleate),
glycerol, polyglycerol or
propylene glycol and on the other hand oleic, isostearic, ricinoleic or
hydroxystearic acids, said esters
being optionally ethoxylated,
- polyoxypropylene-polyoxyethylene copolymer blocks, particularly Pluronic ,
especially L121.
Among the type (1) adjuvant polymers, preference is given to polymers of
crosslinked acrylic or methacrylic
acid, particularly crosslinked by polyalkenyl ethers of sugars or
polyalcohols. These compounds are known
under the name carbomer (Pharmeuropa, vol. 8, no. 2, June 1996). The one
skilled in the art can also refer
to US-A-2 909 462, which describes such acrylic polymers crosslinked by a
polyhydroxyl compound having
at least three hydroxyl groups, preferably no more than eight such groups, the
hydrogen atoms of at least
three hydroxyl groups being replaced by unsaturated, aliphatic radicals having
at least two carbon atoms.
The preferred radicals are those containing 2 to 4 carbon atoms, e.g. vinyls,
allyls and other ethylenically
unsaturated groups. The unsaturated radicals can also contain other
substituents, such as methyl.
Products sold under the name Carbopol (BF Goodrich, Ohio, USA) are
particularly suitable. They are in
CA 02448796 2006-12-12
51440-28
11
particular crosslinked by allyl saccharose or by allyl pentaerythritol. Among
them particular reference can be
made to Carbopol 974P, 934P and 971 P.
Among the maleic anhydride-alkenyl derivative copolymers, preference is given
to EMA (Monsanto), which
are straight-chain or crosslinked ethylene-maleic anhydride copolymers and
they are e.g. crosslinked by
divinyl ether. Reference can be made to J. Fields et al., Nature 186: 778-780,
June 4, 1960.
With regards to their structure, the acrylic or methacrylic acid polymers and
EMA are preferably formed by
basic units having the following formula:
1 I2
I
--- i -- CHH - i +HZ)y---
COOH COOH
in which:
- R, and R2, which can be the same or different, represent H or CH3
- x = 0 or 1, preferably x = 1
- y= 1 or2,withx+y=2.
For EMA , x = 0 and y = 2 and for carbomers x = y = 1.
These polymers are dissolved in water or physiological salt solution (20 g/l
NaCI) and the pH is adjusted to
7.3 to 7.4 by, soda, in order to give the adjuvant solution in which the
expression vectors will be incorporated.
The polymer concentration in the final vaccine composition can range between
0.01 and 1.5% w/v, more
particularly 0.05 to I% w/v and preferably 0.1 to 0.4% w/v.
The cationic lipids (4) containing a quaternary ammonium salt and which are
particularly but not exclusively
suitable for plasmids, are preferably those complying with the following
formula:
CH3
C
R,-O-CHZ i H-CHZ i -RZ X
OR, CH3
in which R, is a saturated or unsaturated straight-chain aliphatic radical
having 12 to 18 carbon atoms, R2 is
another aliphatic radical containing 2 or 3 carbon atoms and X is an amine or
hydroxyl group.
CA 02448796 2006-12-12
51440-28
12
Among these cationic lipids, preference is given to DMRIE (N-(2-hydroxyethyl)-
N,N-dimethyl-2,3-
bis(tetradecyloxy)-1-propane ammonium ; WO-A-96/34109), preferably associated
with a neutral lipid,
preferably DOPE (dioleoyl-phosphatidyl-.ethanol amine; Behr J. P., 1994,
Bioconjugate Chemistry, 5, 382-
389) in order to form DMRIE-DOPE.
Preferably, the plasmid mixture with said adjuvant is formed extemporaneously
and preferably, prior to its
administration, the mixture formed in this way is given time to complex, e.g.
for between 10 and 60 minutes
and in particular approximately 30 minutes.
When DOPE is present, the DMRIE:DOPE molar ratio is preferably 95:5 to 5:95,
more particularly 1:1.
The DMRIE or DMRIE-DOPE adjuvant:plasmid weight ratio is between 50:1 and
1:10, particularly 10:1 and
1:5 and preferably 1:1 and 1:2.
The cytokin or cytokins (5) can be supplied in protein form to the composition
or vaccine, or can be co-
expressed in the host with the immunogen or immunogens. Preference is given to
the co-expression of the
cytokin or cytokins, either by the same vector as that expressing the
immunogen, or by its own vector.
The cytokins can in particular be chosen from among: interleukin 18 (IL-18),
interleukin 12 (IL-12),
interleukin 15 (IL-15), MIP-1a (macrophage inflammatory protein Ia; Marshall
E. et ai., Br. J. Cancer, 1997,
75 (12), 1715-1720), GM-CSF (Granulocyte-Macrophage Colony-Stimulating
Factor). Particular reference is
made to avian cytokins, particularly those of the chicken, such as c1L-18
(Schneider K. et al., J. Interferon
Cytokine Res., 2000, 20 (10), 879-883), cIL-15 (Xin K. -Q. et at., Vaccine,
1999, 17, 858-866), and equine.
cytokins, particularly equine GM-CSF (WO-A-00177210). Preferably, use is made
of cytokins of the species
to be vaccinated.
WO-A-00/77210 describes the nucleotide sequence and the amino acid sequence
corresponding to equine
GM-CSF, the in vitro GM-CSF production and the construction of vectors
(plasmids and viral vectors)
permitting the in vivo equine GM-CSF expression. These proteins, plasmids and
viral vectors can be used
in immunogenic compositions and equine vaccines according to the invention.
For example, use can be
made of the plasmid pJP097 described in example 3 of said earlier-dated
application or use can be made of
the teaching of the latter in order to produce other vectors or for the in
vitro production of equine GM-CSF
and the incorporation of said vectors or said equine GM-CSF in immunogenic
compositions or equine
vaccines according to the invention.
The present invention also relates to immunogenic compositions and so-called
subunit vaccines,
incorporating the protein E and optionally one or more other proteins of the
WN virus, particularly prM or M
and preferably produced by in vitro expression in the manner described
hereinbefore, as well as a
pharmaceutically acceptable vehicle or excipient.
CA 02448796 2006-12-12
51440-28
13
The pharmaceutically acceptable vehicles or excipients are known to the one
skilled in the art and can e.g.
be 0.9% NaCl saline solution or phosphate buffer.
The immunogenic compositions and subunit vaccines according to the invention
preferably comprise one or
more adjuvants, particularly chosen from among conventional adjuvants.
Particularly suitable within the
scope of the present invention are (1) an acrylic or methacrylic acid polymer,
a maleic anhydride and alkenyl
derivative polymer, (2) an immunostimulating sequence (ISS), particularly an
oligodeoxyribonucleotide
sequence having one or more non-methylated CpG units (Klinman D. M. at al.,
Proc. Nati. Acad. Sci. USA,
1996, 93,2879-2883; WO-A1-98/16247), (3) an oil in water emulsion,
particularly the emulsion SPT
described on p 147 of "Vaccine Design, The Subunit and Adjuvant Approach",
published by M. Powell, M.
Newmann, Plenum Press 1995, and the emulsion MF59 described on p 183 of the
same work, (4) a water in
oil emulsion (EP-A-639 071), (5) saponin, particularly Quil-A, or (6) alumina
hydroxide or an equivalent. The
different types of adjuvants defined under 1), 2) and 3) have been described
in greater detail herein before in
connection with the expression vector-based vaccines.
The doses and dose volumes are defined hereinafter in connection with the
general description of
immunization and vaccination methods.
According to the invention, the vaccination against the WN virus can be
combined with other vaccinations
within the framework of vaccination programs, in the form of immunization or
vaccination kits or in the form
of immunogenic compositions and multivalent vaccines, i.e. comprising at least
one vaccine component
against the WN virus and at least one vaccine component against at least one
other pathogenic agent. This
also includes the expression by the same expression vector of genes of at
least two pathogenic agents,
including the WN virus.
The Invention also relates to a multivalent immunogenic composition or a
multivalent vaccine against the
WN virus and against at least one other pathogen of the target species, using
the same in vivo expression
vector containing and expressing at least one polynucleotide of the WN virus
according to the invention and
at least one polynucleotide expressing an immunogen of another pathogen.
The thus expressed "immunogen" is understood to mean a protein, glycoprotein,
polypeptide, peptide,
epitope or derivative, e.g. fusion protein, inducing an immune response,
preferably of a protective nature.
As was stated hereinbefore, these multivalent compositions or vaccines also
comprise a pharmaceutically
acceptable vehicle or excipient, and optionally an adjuvant.
The invention also relates to a multivalent immunogenic composition or a
multivalent vaccine comprising at
least one in vivo expression vector in which at least one polynucleotide of
the WN virus is inserted and at
least a second expression vector in which a polynucleotide encoding an
immunogen of another pathogenic
CA 02448796 2006-12-12
51440-28
14
agent is inserted. As stated before, those multivalent compositions or
vaccines also comprise a
pharmaceutically acceptable vehicle or excipient, and optionally an adjuvant.
For the immunogenic compositions and multivalent vaccines, the other equine
pathogens are more
particularly chosen from among the group including viruses of equine
rhinopneumonia EHV-1 and/or EHV-4
(and preferably there is a combination of immunogens of EHV-1 and EHV-4),
equine influenza virus EIV,
eastern encephalitis virus EEV, western encephalitis virus WEV, Venezuelan
encephalitis virus VEV
(preference. is given to a combination of the three EEV, WEV and VEV),
Clostridium tetani (tetanus) and
their mixtures. Preferably, for EHV a choice is made of the genes gB and/or
gD; for EIV the genes HA, NP
and/or N; for viruses of encephalitis C and/or E2; and for Clostridium tetani
the gene encoding all or part of
the subunit C of the tetanic toxin. This includes the use of polynucleotides
encoding an immunologically
active fragment or an epitope of said immunogen.
The other avian pathogens are more particularly chosen from among the group
including viruses of the
Marek's disease virus MDV (serotypes I and 2, preferably 1), Newcastle disease
virus NDV, Gumboro
disease virus IBDV, infectious bronchitis virus IBV, infectious anaemia virus
CAV, infectious
laryngotracheitis virus iLTV, encephalomyelitis virus AEV (or avian leukosis
virus ALV), virus of hemorragic
enteritis of turkeys (HEV), pneumovirosis virus (TRTV), fowl plague virus
(avian influenza), chicken
hydropericarditis virus, avian reoviruses, Escherichia coil, Mycoplasma
gaiinarum, Mycoplasma
gallisepticum, Haemophr7us avium, Pasteurella gallinarum, Pasteurella
multocida gallicida, and mixtures
thereof. Preferably, for MDV a choice is made of the genes gB and/or gD, for
NDV the genes HN and/or F;
for IBDV the gene VP2; for IBV the genes S (more particularly S1), M and/or N;
for CAV the genes VPI
and/or VP2; for ILTV the genes gB and/or gD; for AEV the genes env and/or
gag/pro; for HEV the genes
100K and hexon; for TRTV the genes F and/or G and for fowl plague the genes
HA, N and/or NP. This
includes the use of polynucleotides encoding an immunologically active
fragment or an epitope of said
immunogen.
By way of example, in a multivalent immunogenic composition or a multivalent
vaccine according to the
invention, to which an adjuvant has optionally been added in the manner
described hereinbefore and which
is intended for the equine species, it is possible to incorporate one or more
of the plasmids described in WO-
A-98103198 and particularly in examples 8 to 25 thereof, and those described
in WO-A-00/77043 and which
relate to the equine species, particularly those described in examples 6 and 7
thereof. For the avian
species, it is e.g. possible to incorporate one or more of the plasmids
described in WO-A1-98/03659,
particularly in examples 7 to 27 thereof.
The immunogenic compositions or recombinant vaccines as described hereinbefore
can also be combined
with at least one conventional vaccine (inactivated, live attenuated,
subunits) directed against at least one
other pathogen.
CA 02448796 2006-12-12
51440-28
In the same way, the immunogenic compositions and subunit vaccines according
to the invention can form
the object of combined vaccination. Thus, the invention also relates to
multivalent immunogenic
compositions and multivalent vaccines comprising one or more proteins
according to the invention and one
or more immunogens (the term immunogen having been defined hereinbefore) of at
least one other
5 pathogenic agent (particularly from among the above list) and/or another
pathogenic agent in inactivated or
attenuated form. In the manner described hereinbefore, these multivalent
vaccines or compositions also
incorporate a pharmaceutically acceptable vehicle or exciplent and optionally
an adjuvant.
The present invention also relates to methods for the immunization and
vaccination of the target species
10 referred to hereinbefore.
These methods comprise the administration of an effective quantity of an
immunogenic composition or
vaccine according to the invention. This administration can more particularly
take place by the parenteral
route, e.g. by subcutaneous, intradermic or intramuscular administration, or
by oral and/or nasal routes.
15 One or more administrations can take place, particularly two
administrations.
The different vaccines can be injected by a needleless, liquid jet injector.
For plasmids it is also possible to
use gold particles coated with plasmid and ejected in such a way as to
penetrate the cells of the skin of the
subject to be immunized (Tang et al., Nature 1992, 356, 152-154).
The immunogenic compositions and vaccines according to the invention comprise
an effective expression
vector or polypeptide quantity.
In the case of immunogenic compositions or vaccines based on plasmid, a dose
consists in general terms
about in 10 pg to about 2000 pg, particularly about 50 pg to about 1000 pg.
The dose volumes can be
between 0.1 and 2 ml, preferably between 0.2 and 1 ml.
These doses and dose volumes are suitable for the vaccination of equines and
mammals..
For the vaccination of the avian species, a dose is more particularly between
about 10 .tg and about 500 gg
and preferably between about 50 jig and about 200 pg. The dose volumes can in
particular be between 0.1
and I mi, preferably between 0.2 and 0.5 mi.
The one skilled in the art has the necessary skill to optimize the effective
plasmid dose to be used for each
immunization or vaccination protocol and for defining the optimum
administration route.
In the case of immunogenic compositions or vaccines based on poxviruses, a
dose is in general terms
between about 102 pfu and about 109 pfu.
CA 02448796 2006-12-12
51440-28
16
For the equine species and mammals, when the vector is the vaccinia virus, the
dose is more particularly
between about 104 pfu and about 109 pfu, preferably between about 106 pfu and
about 108 pfu and when the
vector is thecanarypox virus, the dose is more particularly between about 106
pfu and about 109 pfu and
preferably between about 1055 pfu or 106 pfu and about 108 pfu.
For the avian species, when the vector is the canarypox virus, the dose is
more particularly between about
103 pfu and about 107 pfu, preferably between about 104 pfu and about 108 pfu
and when the vector is the
fowipox virus, the dose is more particularly between about 102 pfu and about
105 pfu, preferably between
about 103 pfu and about 105 pfu.
In the case of immunogenic compositions or vaccines based on the viral vector
other than poxviruses,
particularly herpes viruses, a dose is generally between about 103 pfu and
about 108 pfu. In the case of
immunogenic compositions or avian vaccines a dose is generally between about
103 pfu and about 106 pfu.
In the case of immunogenic compositions or equine vaccines a dose is generally
between about 106 pfu and
about 108 pfu.
The dose volumes of the immunogenic compositions and equine vaccines based on
viral vectors are
generally between 0.5 and 2.0 mi, preferably between 1.0 and 2.0 mi,
preferably 1.0 mi. The dose volumes
of immunogenic compositions and avian vaccines based on viral vectors are
generally between 0.1 and 1.0
ml, preferably between 0.1 and 0.5 ml and more particularly between 0.2 and
0.3 ml. Also in connection
with such a vaccine, the one skilled in the art has the necessary competence
to optimise the number of
administrations, the administration route and the doses to be used for each
immunization protocol. In
particular, there are two administrations in the horse, e.g. at 35 day
intervals.
In the case of immunogenic compositions or subunit vaccines, a dose comprises
in general terms about 10
g to about 2000 g, particularly about 50 g to approximately 1000 j. g. The
dose volumes of the
immunogenic compositions and equine vaccines based on viral vectors are
generally between 1.0 and 2.0
ml, preferably between 0.5 and 2.0 ml and more particularly 1.0 mi. The dose
volumes of the immunogenic
compositions and avian vaccines based on viral vectors are generally between
0.1 and 1.0 mi, preferably
between 0.1 and 0.5 mi, and more particularly between 0.2 and 0.3 mi. Also for
such a vaccine, the one
skilled in the art has the necessary skill to optimise the number of
administrations, the administration route
and the doses to be used for each immunization protocol.
The invention also relates to the use of an in vivo expression vector or a
preparation of vectors or
polypeptides according to the invention for the preparation of an immunogenic
composition or a vaccine
intended to protect target species against the WN virus and possibly against
at least one other pathogenic
agent. The different characteristics indicated in the description are
applicable to this object of the invention.
A vaccine based on plasmid or a viral vaccine expressing one or more proteins
of the WN virus or a WN
subunit vaccine according to the present invention will not induce in the
vaccinated animal the production of
CA 02448796 2006-12-12
51440-28
17
antibodies against other proteins of said virus, which are not represented in
the immunogenic composition or
vaccine. This feature can be used for the development of differential
diagnostic methods making it possible
to make a distinction between animals infected by the WN pathogenic virus and
animals vaccinated with
vaccines according to the invention. In the former, these proteins and/or
antibodies directed against them
are present and can be detected by an antigen-antibody reaction. This is not
the case with the animals
vaccinated according to the invention, which remain negative. In order to
bring about this discrimination,
use is made of a protein which is not represented in the vaccine (not present
or not expressed), e.g. protein
C or protein NS1, NS2A, NS2B or NS3 when it is not represented in the vaccine.
Thus, the present invention relates to the use of vectors, preparations and
polypeptides according to the
invention for the preparation of immunogenic compositions and vaccines making
it possible to discriminate
between vaccinated animals and infected animals.
It also relates to an immunization and vaccination method associated with a
diagnostic method permitting
such a discrimination.
The protein selected for the diagnosis or one of its fragments or epitopes is
used as the antigen in the
diagnostic test and/or is used for producing polyclonal or monoclonal
antibodies. The one skilled in the art
has sufficient practical knowledge to produce these antibodies and to
implement antigens and/or antibodies
in conventional diagnostic methods, e.g. ELISA tests.
The invention will now be described in greater detail using embodiments
considered as non-(imitative
examples.
Examples
All the constructions are implemented using standard molecular biology methods
(cloning, digestion by
restriction enzymes, synthesis of a complementary single-strand DNA,
polymerase chain reaction,
elongation of an oligonucleotide by DNA polymerase...) described by Sambrook
J. at at. (Molecular Cloning:
A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory, Cold Spring
Harbor. New York, 1989). All
the restriction fragments used for the present invention, as well as the
various polymerase chain reaction
(PCR) are isolated and purified using the Geneclean kit (B10101 Inc. La
Jolla, CA).
Example 1: Culture of the West Nile fever virus
For their amplification, West Nile fever viruses NY99 (Lanciotti R. S. at al.,
Science, 1999, 286, 2333-7)) are
cultured on VERO cells (monkey renal cells), obtainable from the American Type
Culture Collection (ATCC)
under no. CCL-81.
CA 02448796 2006-12-12
51440-28
18
The VERO cells are cultured in 25 cm2 Falcon with eagle-MEM medium
supplemented by 1 % yeast extracts
and 10% calf serum containing approximately 100,000 cells/mi. The cells are
cultured at +37 C under a 5%
CO2 atmosphere.
After three days the cellular layer reaches to confluence. The culture medium
is then replaced by the eagle-
MEM medium supplemented by 1 % yeast extracts and 0.1 % cattle serum albumin
and the West Nile fever
virus is added at a rate of 5 pfu/cell.
When the cytopathogenic effect (CPE) is complete (generally 48 to 72 hours
after the start of culturing), the
viral suspensions are harvested and then clarified by centrifugation and
frozen at -70 C. In general, three to
four successive passages are necessary for producing a viral batch, which is
stored at -70 C.
Example 2: Extraction of viral RNA from the West Nile fever virus
The viral RNA contained in 100 mi of viral suspension of the West Nile fever
virus strain NY99 is extracted
after thawing with solutions of the High Pure Viral RNA Kit Cat # 1 858 882,
Roche Molecular Biochemicals,
whilst following the instructions of the supplier for the extraction stages.
The RNA sediment obtained at the
end of extraction is resuspended with I to 2 ml of RNase-free, sterile
distilled water.
Example 3: Construction of plasmid pFC 101
The complementary DNA (ADNC) of the West Nile fever virus NY99 is synthesized
with the Gene Amp RNA
PCR Kit (Cat # N 808 0017, Perkin-Elmer, Norwalk, CT 06859, USA) using the
conditions supplied by the
manufacture.
A reverse transcriptase polymerase chain reaction (RT-PCR reaction) is carried
out with 50 pl of viral RNA
suspension of the West Nile fever virus NY99 (example 2) and with the
following oligonucleotides:
CF101 (30 mer) (SEQ ID NO:1)
57TTITTGAATTCGTTACCCTCTCTAACTTC 3'
and FC102 (33 mer) (SEQ ID NO:2)
5.11 T1Ti i CTAGATTACCTCCGACTGCGTCTTGA 3'
This pair of oligonucleotides allows the incorporation of an EcoRl restriction
site, a Xbal restriction site and
a stop codon at 3' of the insert.
The synthesis of the first DNAc strand takes place by elongation of
oligonucleotide FC102, following the
hybridization of the latter with the RNA matrix.
The synthesis conditions of the first DNAc strand are a temperature of 42 C
for 15 min, then 99 C for 5 min
and finally 4 C for 5 min. The conditions of the PCR reaction in the presence
of the pair of oligonucleotides
CA 02448796 2006-12-12
51440-28
19
FC101 and FC102 area temperature of 95 C for 2 min, then 35 cycles (95 C for I
min, then 62 C for 1 min
and 72 C for 2 min) and finally 72 C for 7 min to produce a 302 bp fragment.
This fragment is digested by EcoRl and then by Xbal in order to isolate,
following agarose gel
electrophoresis, the approximately 290 bp EcoRI-Xbal fragment, which is called
fragment A.
The pVR1020 eukaryote expression plasmid (C. J. Luke et al. of Infectious
Diseases, 1997, 175, 95-97)
derived from the plasmid pVR1012 (fig. 1 and example 7 of WO-A-98/03199 -
Hartikka J. et al., 1997,
Human Gene Therapy, 7, 1205-1217), contains the frame encoding the signal
sequence of the human tissue
plasminogen activator (tPA).
A pVR1020 plasmid is modified by BamHI-BglIl digestion and insertion of a
sequence containing several
cloning sites (BamHI, NotI, EcoRl, Xbal, Pmll, Pstl, BgIII) and resulting from
the hybridization of the following
oligonucleotides.
BP326 (40 mer) (SEQ ID NO: 3)
5'GATCTGCAGCACGTGTCTTAGAGGATATCGAATTCGCGGCC 3' and
BP329 (40 mer) (SEQ ID No: 4)
5'GATCCGCGGCCGCGAATTCGATATCCTCTAGACACGTGCT3'
The thus obtained vector with a size of approximately 5105 base pairs (or bp)
is called pABI 10.
Fragment A is ligatured with the pAB110 expression plasmid previously digested
by Xbal and EcoRl, in
order to give the plasmid pFC101 (5376 bp). Under the control of the early
promoter of human
cytomegalovirus or hCMV-IE (human Cytomegalovirus Immediate Early), said
plasmid contains an insert
encoding the signal sequence of the activator of tPA followed by. the sequence
encoding the protein prM.
Example 4: Construction of plasmid pFC102
The complementary DNA (DNAc) of the West Nile fever virus NY99 is synthesized
with the Gene Amp RNA
PCR Kit (Cat # N 808 0017, Perkin-Elmer, Norwalk, CT 06859, USA) using the
conditions provided by the
supplier.
A reverse transcriptase polymerase chain reaction (RT-PCR reaction) takes
place with 50 gl of viral RNA
suspension of the West Nile fever virus NY99 (example 2) and with the
following oligonucleotides:
FC103 (30 mer) (SEQ ID NO: 5)
57TTTT GAATTCTCACTGACAGTGCAGACA 3'
and FC104 (33 mer) (SEQ ID NO: 6)
59 iii i I"CTAGATTAGCTGTAAGCTGGGGCCAC 3'
CA 02448796 2006-12-12
51440-28
This pair of oligonucleotides allows the incorporation of an EcoRl restriction
site and a Xbal restriction site
and a stop codon at 3' of the insert.
The first DNAc strand is synthesized by elongation of oligonucleotide FC104,
following the hybridization of
5 the latter on the RNA matrix.
The synthesis conditions of the first DNAc strand are a temperature of 42 C
for 15 min, then 99 C for 5 min
and finally 4 C for 5 min. The conditions of the PCR reaction in the presence
of the pair of oligonucleotides
FC103 and FC1 04 are a temperature of 95 C for 2 min, then 35 cycles (95 C for
I min, then 62 C for 1 min
10 and 72 C for 2 min) and finally 72 C for 7 min to produce a 252 bp
fragment.
This fragment is digested by EcoRl and then Xbal in order to isolate,
following agarose gel electrophoresis,
the approximately 240 bp EcoRI-Xbal fragment. This fragment is ligatured with
the pAB110 expression
plasmid (example 3) previously digested by Xbal and EcoRl in order to give the
plasmid pFC102 (5326 bp).
15 Under the control of the early human cytomegalovirus or hCMV-IE (human
Cytomegalovirus Immediate
Early) promoter, this plasmid contains an insert encoding the signal sequence
of the activator of tPA,
followed by the sequence encoding the protein M.
Example 5: Construction of plasmid pFC103
The complementary DNA (DNAc) of the West Nile fever virus NY99 is synthesized
with the Gene Amp RNA
PCR Kit (Cat # N 808 0017, Perkin-Elmer, Norwalk, CT 06859, USA) using the
conditions provided by the
supplier.
A reverse transcriptase polymerase chain reaction (RT-PCR reaction) takes
place with 50 l of viral RNA
suspension of the West Nile fever virus NY99 (example 2) and with the
following oligonucleotides:
FC105 (30 mer) (SEQ ID NO: 7) .
5'TTTTTGAATTCTTCAACTGCCTTGGAATG 3'
and FC106 (33 mer) (SEQ ID NO: 8)
5' I T i f f CTAGATfAAGCGTGCACGTTCACGGA 3'.
This pair of oligonucleotides allows the incorporation of an EcoRl restriction
site and a Xbal restriction site,
together with a stop codon at 3' of the insert.
The synthesis of the first DNAc strand takes place by elongation of
oligonucleotide FC106, following its
hybridization with the RNA matrix.
The synthesis conditions of the first DNAc strand are a temperature of 42 C
for 15 min, then 99 C for 5 min
and finally 4 C for 5 min. The PCR reaction conditions in the presence of the
pair of oligonucleotides FC105
CA 02448796 2006-12-12
51440-28
21
and FC106 are a temperature of 95 C for 2 min, then 35 cycles (95 C for 1 min,
then 62 C for I min and
72 C for 2 min), and finally 72 C for 7 min for producing a 1530 bp fragment.
This fragment is digested by EcoRl and then by Xbal in order to isolate,
following agarose gel
electrophoresis, the approximately 1518 bp EcorRI-Xbal fragment. This fragment
is ligatured with the pAB
110 expression plasmid (example 3) previously digested by Xbal and EcoRl in
order to give the plasmid
pFC103 (6604 bp). Under the control of the early promoter of human
cytomegalovirus or hCMV-IE (human
Cytomegalovirus Immediate Early), said plasmid contains an insert encoding the
signal sequence of the
activator of tPA, followed by the sequence encoding the protein E.
Example 6: Construction of plasmid pFC104
The complementary DNA (DNAc) of the West Nile fever virus NY99 is synthesized
with the Gene Amp RNA
PCR Kit (Cat # N 808 0017, Perkin-Elmer, Norwalk, CT 06859, USA) using the
conditions provided by the
supplier.
A reverse transcriptase polymerase chain reaction (RT-PCR reaction) takes
place with 50 pi of viral RNA
suspension of the West Nile fever virus NY99 (example 2) and with the
following oligonucleotides:
FC101 (30 mer) (SEQ ID NO :1)
and FC106 (33 mer) (SEQ ID NO :8)
This pair of oligonucleotides allows the incorporation of an EcoRl restriction
site, a Xbai restriction site and a
stop codon at 3' of the insert.
Synthesis of the first DNAc strand takes place by elongation of
oligonucleotide FC106, following its
hybridization with the RNA matrix.
The synthesis conditions of the first DNAc strand are a temperature of 42 C
for 15 min, then 99 C for 5 min
and finally 4 C for 5 min. The PCR reaction conditions in the presence of the
pair of oligonucleotides FC101
and FC106 are a temperature of 95 C for 2 min, then 35 cycles (95 C for 1 min,
then 62 C for 1 min and
72 C for 2 min) and finally 72 C for 7 min in order to produce a 2031 bp
fragment.
This fragment is digested by EcoRI and then Xbal in order to isolate,
following agarose gel electrophoresis,
the approximately 2019 bp EcoRI-Xbal fragment. This fragment is ligatured with
the pABI 10 expression
plasmid (example 3), previously digested by Xbal and EcoRl in order to give
the pFC104 plasmid (7105 bp).
Under the control of the early human cytomegalovirus promoter or hCMV-IE
(human Cytomegalovirus
Immediate Early), said plasmid contains an insert encoding the signal sequence
of the activator of tPA,
followed by the sequence encoding the protein prM-M-E.
Example 7: Construction of plasmid pFC105
CA 02448796 2006-12-12
51440-28
22
The complementary DNA (DNAc) of the West Nile fever virus NY99 is synthesized
with the Gene Amp RNA
PCR Kit (Cat # N 808 0017, Perkin-Elmer, Norwalk, CT 06859, USA) using the
conditions provided by the
supplier.
A reverse transcriptase polymerase chain reaction (RT-PCR reaction) takes
place with 50 gi of viral RNA
suspension of the West Nile fever virus NY99 (example 2) and with the
following oligonucleotides:
CF107 (36 mer) (SEQ ID NO :9)
57,TTTTTGATATCACCGGAATTGCAGTCATGATTGGC 3'
and FC106 (33 mer) (SEQ ID NO :8).
This pair of oligonucleotides allows the incorporation of an EcoRV restriction
site, a Xbal restriction site and
a stop codon at 3' of the insert.
Synthesis of the first DNAc strand takes place by elongation of the FC106
oligonucleotide, following its
hybridization with the RNA matrix.
The synthesis conditions of the first DNAc strand are a temperature of 42 C
for 15 min, then 99 C for 5 min
and finally 4 C for 5 min. The PCR reaction conditions in the presence of the
pair of oligonucleotides FC106
and FC107 are a temperature of 95 C for 2 min, then 35 cycles (95 C for I min,
then 62 C for 1 min and
72 C for 2 min) and finally 72 C for 7 min in order to produce a 2076 bp
fragment.
This fragment is digested by EcoRV and then Xbal in order to isolate,
following agarose gel electrophoresis,
the approximately 2058 bp EcoRV-Xbal fragment.
This fragment is ligatured with the pVR1012 expression plasmid, previously
digested by Xbal and EcoRV, in
order to give the plasmid pFC105 (6953 bp). Under the control of the early
human cytomegalovirus
promoter or hCMV-lE (human Cytomegalovirus Immediate Early), this plasmid
contains an insert encoding
the polyprotein prM-M-E.
Example 8: Construction of plasmid pFC106
The complementary DNA (DNAc) of the West Nile fever virus NY99 is synthesized
with the Gene Amp RNA
PCR Kit (Cat # N 808 0017, Perkin-Elmer, Norwalk, CT 06859, USA) using the
conditions provided by the
supplier.
A reverse transcriptase polymerase chain reaction (RT-PCR reaction) takes
place with 50 pI of viral RNA
suspension of the West Nile fever virus NY99 (example 2) and with the
following oligonucleotides:
FC108 (36 mer) (SEQ ID NO :10)
5' I I L i i TGATATCATGTATAATGCTGATATGATTGAC 3'
CA 02448796 2006-12-12
51440-28
23
and FC109 (36 mer) (SEQ ID NO :11)
5'TTTTTfTCTAGATTAACGTiTTCCCGAGGCGAAGTC 3'
This pair of oligonucleotides allows the incorporation of an EcoRV restriction
site, a Xbal restriction site, an
initiating ATG codon in 5' and a stop codon at 3' of the insert.
Synthesis of the first DNAc strand takes place by elongation of the
oligonucleotide FC109, following its
hybridization with the RNA matrix.
The synthesis conditions of the first DNAc strand are a temperature of 42 C
for 15 min, then 99 C for 5 min
and finally 4 C for 5 min. The PCR reaction conditions in the presence of the
pair of nucleotides FC108 and
FC109 are a temperature of 95 C for 2 min, then 35 cycles (95 C for I min, 62
C for 1 min and then 72 C
for 2 min) and finally 72 C for 7 min to produce a 2973 bp fragment.
This fragment is digested by EcoRV and then Xbal in order to isolate,
following agarose gel electrophoresis,
the approximately 2955 bp EcoRV-Xbal fragment.
This fragment is ligatured with the pVR 1012 expression plasmid previously
digested by Xbal and EcoRV in
order to give the plasmid pFC106 (7850 bp). Under the control of the early
human cytomegalovirus
promoter or hCMV-IE (human Cytomegalovirus Immediate Early), this plasmid
contains an insert encoding
the polyprotein NS2A-NS2B-NS3.
Example 9: Construction of the donor plasmid for insertion in site C5 of the
ALVAC canarypox virus
Fig. 16 of US patent 5,756,103 shows the sequence of a genomic DNA 3199 bp
fragment of the canarypox
virus. Analysis of this sequence has revealed an open reading frame (ORF)
called C51_, which starts at
position 1538 and ends at position 1859. The construction of an insertion
plasmid leading to the deletion of
the ORF C5L and its replacement by a multiple cloning site flanked by
transcription and translation stop
signals was implemented in the following way.
A PCR reaction was performed on the basis of the matrix constituted by genomic
DNA of the canarypox
virus and with the following oligonucleotides:
C5A1 (42 mer) (SEQ ID NO :12):
5'ATCATCGAGCTCCAGCTGTAATTCATGGTCGAAAAGAAGTGC 3'
and C5B1 (73 mer) (SEQ ID NO :13):
5'GAATTCCTCGAGCTGCAGCCCGGGTTTTTATAGCTAATTAGTCATTTTTTGAGAGTACCACTrCAGCTA
CCTC 3'
in order to isolate a 223 bp PCR fragment (fragment B).
CA 02448796 2006-12-12
51440-28
24
A PCR reaction was carried out on the basis of the matrix constituted by
genomic DNA of the canarypox
virus and with the following oligonucleotides:
C5C1 (72 mer) (SEQ ID NO :14):
5'CCCGGGCTGCAGCTCGAGGAATTCTI'TTTATTGATTAACTAGTCATTATAAAGATCTAAAATGCATAAT
TTC 3'
and C5D1 (45 mer) (SEQ ID NO :15):
5'GATGATGGTACCGTAAACAAATATAATGAAAAGTATTCTAAACTA3'
in order to isolate a 482 bp PCR fragment (fragment C).
Fragments B and C were hybridized together in order to serve as a matrix for a
PCR reaction performed with
the oligonucleotides C5AI (SEQ ID NO :12) and C5DI (SEQ ID NO :15) in order to
generate a 681 bp PCR
fragment. This fragment was digested by the restriction enzymes Sad and Kpnl
in order to isolate, following
agarose get electrophoresis, a 664 bp Sacl-Kpnl fragment. This fragment was
ligatured with the
bplueScript ti SK+ vector (Stratagene, La Jolla, USA, Cat # 2.12205),
previously digested by the restriction
enzymes Sacl and Kpnl, in order to give the piasmid pC5L. The sequence of this
plasmid was verified by
sequencing. This plasmid contains 166 bp of sequences upstream of ORF C5L
(left flanking arm C5), an
early transcription stop vaccine signal, stop codons in 6 reading frames, a
"multiple cloning site containing
restriction sites Smal, Pstl, Xhol and EcoRl and finally 425 bp of sequences
located downstream of ORF
C5L (right flanking arm C5).
The plasmid pMP528HRH (Perkus M. et al. J. Viral. 1989,63,3829-3836) was used
as the matrix for
amplifying the complete sequence of the vaccine promoter H6 (GenBank access
no. M28351) with the
following oligonucleotides:
JCA291 (34 mer) (SEQ ID NO :16)
5'AAACCCGGGTTCTT7ATTCTATACTfAAAAAGTG 3'
and JCA292 (43 mer) (SEQ ID NO :17)
5'AAAAGAATTCGTCGACTACGATACAAACTTAACGGATATCGCG3'
in order to amplify a 149 bp PCR fragment. This fragment was digested by
restriction enzymes Smal and
EcoRI in order to isolate, following agarose gel electrophoresis, a 138 bp
Smal-EcoRl restriction fragment.
This fragment was then ligatured with the plasmid pC5L, previously digested by
Smal and EcoRl, in order to
give the plasmid pFC107.
Example 10: Construction of the recombinant virus vCP1712
A PCR reaction was performed using the plasmid pFC105 (example 7) as the
matrix and the following
oligonucleotides:
FC110 (33 mer (SEQ ID NO : 18):
5 I i 1 I CGCGAACCGGAATTGCAGTCATGATTGGC 3'
and FC111 (39 mer) (SEQ ID NO : 19):
5TrrTGTCGACGCGGCCGCTTAAGCGTGCACGTTCACGGA 3'
CA 02448796 2006-12-12
51440-28
in order to amplify an approximately 2079 bp PCR fragment. This fragment was
digested by restriction
enzymes Nrul and Sall in order to isolate, following agarose gel
electrophoresis, an approximately 2068 bp
Nrul-Sall restriction fragment. This fragment was then ligatured with plasmid
pFC107 (example 9)
previously digested by restriction enzymes Nrui and Sail in order to give the
piasmid pFC1 08.
5
Plasmid pFC108 was linearized by Noti, then transfected in primary chicken
embryo cells infected with the
canarypox virus (ALVAC strain) according to the previously described calcium
phosphate precipitation
method (Panicali et Paoletti Proc. Nat. Acad. Sci. 1982, 79, 4927-4931;
Piccini et al. In Methods in
Enzymology, 1987, 153, 545-563, publishers Wu R. and Grossman L. Academic
Press). Positive plaques
10 were selected on the basis of a hybridization with a radioactively labelled
probe specific to the nucleotide
sequence of the envelope glycoprotein E. These plaques underwent 4 successive
selection/purification
cycles until a pure population was isolated. A representative plaque
corresponding to in vitro recombination
between the donor piasmid pFC108 and the genome of the ALVAC canarypox virus
was then amplified and
the recombinant virus stock obtained was designated vCP1712.
Example 11: Construction of the recombinant virus vCP1713
Plasmid pFC104 (example 6) was digested by the restriction enzyme Sail and
Pmll in order to isolate,
following agarose gel electrophoresis, an approximately 2213 bp Pmil-Sail
restriction fragment. This
fragment was ligatured with piasmid pFC107 (example 9) previously digested by
the Nrul and Sall restriction
enzymes in order to give the plasmid pFC109.
Plasmid pFC1 09 was linearized by Noti, then transfected in primary chicken
embryo cells infected with the
canarypox virus (ALVAC strain) according to the method of example 10. A
representative plaque
corresponding to in vitro recombination between the donor plasmid pFC109 and
the genome of the ALVAC
canarypox virus was selected on the basis of a hybridization of a
radioactively labelled probe specific to the
nucleotide sequence of the envelope glycoprotein E and was then amplified. The
recombinant virus stock
obtained was designated vCP1713.
Example 12: Construction of the recombinant virus vCP1714
Plasmid pFC103 (example 5) was digested by the Sall and Pmll restriction
enzymes in order to isolate,
following agarose gel electrophoresis, an approximately 1712 bp Pmll-Sall
restriction fragment. This
fragment was ligatured with the plasmid pFC107 (example 9) previously digested
by the Nrul and Sall
restriction enzymes in order to give the piasmid pFC110.
Plasmid pFC110 was linearized by Nod, then transfected in primary chicken
embryo cells infected with the
canarypox virus (ALVAC strain) according to the method of example 10. A
representative plaque
corresponding to in vitro recombination between the donor plasmid pFC110 and
the genome of the ALVAC
canarypox virus was selected on the basis of a hybridization with a
radioactively labelled probe specific to
CA 02448796 2006-12-12
51440-28
26
the nucleotide sequence of the envelope glycoprotein E and was then amplified.
The recombinant virus
stock obtained was then designated vCPI 714.
Example 13: Construction of the recombinant virus vCP1715
Plasmid pFC102 (example 4) was digested by the Sall and Pmll restriction
enzymes in order to isolate,
following agarose gel electrophoresis, an approximately 434 bp Pmll-Sall
restriction fragment. This
fragment was ligatured with the plasmid pFC107 (example 9) previously digested
by the Nrul and Sall
restriction enzymes to give the plasmid pFC1 11.
Plasmid pFC111 was linearized by Noti, then transfected in primary chicken
embryo cells infected with the
canarypox virus (ALVAC strain) according to the method of example 10. A
representative plaque
corresponding to in vitro recombination between the donor plasmid pFC111 and
the genome of the ALVAC
canarypox virus was selected on the basis of hybridization with a
radioactively labelled probe specific to the
nucleotide sequence of the membrane M glycoprotein and was then amplified. The
recombinant virus stock
obtained was designated vCP1715.
Example 14: Construction of the recombinant virus vCPI716
Plasmid pFC101 (example 3) is digested by the Sall and Pmll restriction
enzymes in order to isolate,
following agarose gel electrophoresis, an approximately 484 bp Pmlt-Salt
restriction fragment. This
fragment is ligatured with the plasmid pFC107 (example 9) previously digested
by the Nrul and Sall
restriction enzymes to give the plasmid pFCI 12.
Plasmid pFC112 was linearized by Noti and then transfected in primary chicken
embryo cells infected with
the canarypox virus (ALVAC strain) according to the method of example 10. A
representative plaque
corresponding to in vitro recombination between the donor plasmid pFC112 and
the genome of the ALVAC
canarypox virus was selected on the basis of a hybridization with a
radioactively labelled probe specific to
the nucleotide sequence of the pre-membrane prM glycoprotein and was then
amplified. The recombinant
virus stock obtained was designated vCP1716.
Example 15: Construction of the donor plasmid for insertion in site C6 of the
ALVAC canarypox virus
Fig. 4 of WO-A-01/05934 shows the sequence of a 3700 bp genomic DNA fragment
of the canarypox virus.
Analysis of this sequence revealed an open reading frame (ORF) called CM,
which starts at position 377
and ends at position 2254. The construction of an insertion plasmid leading to
the deletion of the ORF C6L
and its replacement by a multiple cloning site flanked by transcription and
translation stop signals was
implemented in the following way.
CA 02448796 2006-12-12
51440-28
27
A PCR reaction was performed on the basis of the matrix constituted by the
genomic DNA of the canarypox
virus and with the following oligonucleotides:
C6AI (42 mer) (SEQ ID NO :20):
5'ATCATCGAGCTCGCGGCCGCCTATCAAAAGTCTTAATGAGTT 3'
and C6B1 (73 mer) (SEQ ID NO :21):
5'GAATTCCTCGAGCTGCAGCCCGGGTTTTTATAGCTAATTAGTCATTTTTTCGTAAGTAAGTATTT TATT
TAA 3'
to isolate a 432 bp PCR fragment (fragment D).
A PCR reaction was performed on the basis of the matrix constituted by the
genomic DNA of the canarypox
virus and with the following oligonucleotides:
C6C1 (72 mer) (SEQ ID NO :22):
5'CCCGGGCTGCAGCTCGAGGAATTCTTTTTATTGATTAACTAGTCAAATGAGTATATATAATTGAAAAAG
TAA 3'
and C6DI (45 mer) (SEQ ID NO :23):
5'GATGATGGTACCTTCATAAATACAAGTTTGATTAAACTTAAGTTG 3'
to isolate a 1210 bp PCR fragment (fragment E).
Fragments D and E were hybridized together to serve as a matrix for a PCR
reaction performed with the
oligonucleotides C6A1 (SEQ ID NO :20) and C6D1 (SEQ ID NO :23) to generate a
1630 bp PCR fragment.
This fragment was digested by the Sacl and Kpnl restriction enzymes to
isolate, after agarose gel
electrophoresis, a 1613 bp Sacl-Kpnl fragment. This fragment was ligatured
with the bplueScript II SK+
vector (Stratagene, La Jolla, CA, USA, Cat # 212205) previously digested by
the Sac[ and Kpnl restriction
enzymes to give the plasmid pC6L. The sequence of this plasmid was verified by
sequencing. Said plasmid
contains 370 bp of sequences upstream of ORF C6L (C6 left flanking arm), an
early transcription stop
vaccinia signal, stop codons in the six reading frames, a multiple cloning
site containing the Smal, Pstl, Xhol
and EcoRl restriction sites and finally 1156 bp of sequences downstream of the
ORF C6L (C6 right flanking
arm).
Plasmid pMPIVC (Schmitt J. F. C. et al., J. Viral., 1988, 62, 1889-1897, Saiki
R. K. et al., Science, 1988,
239, 487-491) was used as the matrix for amplifying the complete sequence of
the I3L vaccine promoter
with the following oligonucleotides:
FC1 12 (33 mer) (SEQ ID NO :24):
5'AAACCCGGGCGGTGGTTTGCGATTCCGAAATCT3'
and FC113 (43 mer) (SEQ ID NO :25):
5'AAAAGAATTCGGATCCGATTAAACCTAAATAATTGTACTTTGT3'
to amplify a 151 bp PCR fragment. This fragment was digested by the Smal and
EcoRl restriction enzymes
in order to isolate, following agarose get electrophoresis, an approximately
136 bp Smal-EcoRl restriction
fragment. This fragment was then ligatured with plasmid pC6L previously
digested by Smal and EcoRl to
give the plasmid pFC113.
CA 02448796 2006-12-12
51440-28
28
Example 16: Construction of recombinant viruses vCP1717 and vCP1718
A PCR reaction was performed using the plasmid pFC106 (example 8) as the
matrix and the following
oligonucleotides:
FC114 (33 mer) (SEQ ID NO :26):
5'TTTCACGTGATGTATAATGCTGATATGATTGAC3
and FC115 (42 mer) (SEQ ID NO :27):
57TTTGGATCCGCGGCCGCTTAACGTTTTCCCGAGGCGAAGTC 3'
to amplify an approximately 2973 bp PCR fragment. This fragment was digested
with the Pmll and BamHl
restriction enzymes to isolate, following agarose gel electrophoresis, the
approximately 2958 bp Pmll-BamHl
restriction fragment (fragment F). Plasmid pFC1 13 (example 15) was digested
by the PmlI and BamHI
restriction enzymes to isolate, following agarose gel electrophoresis, the
approximately 4500 bp Pmll-BamHl
restriction fragment (fragment G). Fragments F and G were then ligatured
together to give the plasmid
pFC114.
Plasmid pFC114 was linearized by Nod, then transfected in primary chicken
embryo cells infected with
canarypox virus vCP1713 (example 11) according to the previously described
calcium phosphate
precipitation method (Panicali et Paoletti Proc. Nat. Acad. Sci. 1982, 79,
4927-4931; Piccini at al. In Methods
in Enzymology, 1987, 153, 545-563, publishers Wu R. and Grossman L. Academic
Press). Positive plaques
were selected on the basis of a hybridization with a radioactively labelled
probe specific to the nucleotide
sequence of envelope glycoprotein E. These ranges underwent four successive
selection/purification cycles
of the ranges until a pure population was isolated. A representative plaque
corresponding to in vitro
recombination between the donor plasmid pFC1 14 and the genome of the ALVAC
canarypox virus was then
amplified and the recombinant virus stock obtained was designated vCP1717.
The Notl-linearized pFC1 14 plasmid was also used for transfecting primary
chicken embryo cells infected
with the vCP1 712 canarypox virus (example 10) using the procedure described
hereinbefore. The thus
obtained recombinant virus stock was designated vCP1718.
Example 17: Construction of plasmid pFC115
The complementary DNA (DNAc) of the West Nile fever virus NY99 was synthesized
with Gene Amp RNA
PCR Kit (Cat # N 808 0017, Perkin-Elmer, Norwalk, CT 06859, USA) using the
conditions provided by the
supplier.
A reverse transcriptase polymerase chain reaction (RT-PCR reaction) was
carried out with 50 pi of viral RNA
suspension of the West Nile fever virus NY99 (example 2) and with the
following oligonucleotides:
FC116 (39 mer) (SEQ ID NO :28)
57TTTTTGATATCATGACCGGAATTGCAGTCATGATTGGC 3'
CA 02448796 2006-12-12
51440-28
29
and FC106 (33 mer) (SEQ ID NO :8).
This pair of oligonucleotides makes it possible to incorporate an EcoRV
restriction site, a Xbal restriction
site, an initiator code at 5' and a stop code at 3' of the insert.
Synthesis of the first DNAc strand takes place by elongation of the
oligonucleotide FC106, following its
hybridization with the RNA matrix.
The synthesis conditions of the first DNAc strand are a temperature of 42 C
for 15 min, then 99 C for 5 min
and finally 4 C for 5 min. The conditions of the PCR reaction in the presence
of the pair of oligonucleotides
FC 106 and FC116 are a temperature of 95 C for 2 min, then 35 cycles (95 C for
I min, 62 C for 1 min and
then 72 C for 2 min) and finally 72 C for 7 min to produce a 2079 bp fragment.
This fragment is digested by EcoRV and then Xbal to isolate, following agarose
gel electrophoresis, the
approximately 2061 bp EcoRV-Xbal fragment.
This fragment is ligatured with the pVR1 012 expression plasmid previously
digested by Xbal and EcoRV to
give the plasmid pFC1 15 (6956 bp). Under the control of the early human
cytomegalovirus promoter or
hCMV-IE (human Cytomegalovirus Immediate Early), this plasmid contains an
insert encoding the
polyprotein prM-M-E.
Example 18: Construction of the recombinant viruses vCP2017
A PCR reaction was carried out using the plasmid pFC115 (example 17) as the
matrix and the following
oligonucleotides:
FC117 (36 mer) (SEQ ID NO :29):
5T fTTCGCGAATGACCGGAATTGCAGTCATGATTGGC3'
and FC111 (39 mer) (SEQ ID NO :19)
to amplify an approximately 2082 bp PCR fragment. This fragment was digested
by Nrul and Sall restriction
enzymes to isolate, after agarose gel electrophoresis, an approximately 2071
bp Nrl-Sall restriction
fragment. This fragment was then ligatured with plasmid pFC107 (example 9)
previously digested by the
Nrul and Sail restriction enzymes to give the plasmid pFC1 16.
Plasmid pFC116 was linearized by Notl and then transfected in primary chicken
embryo cells infected with
canarypox virus (ALVAC strain) using the procedure of example 10. A
representative plaque corresponding
to in vitro recombination between the donor plasmid pFC1 16 and the genome of
the ALVAC canarypox virus
was selected on the basis of a hybridization with a radioactively labelled
probe specific to the nucleotide
sequence of the envelope glycoprotein E and was then amplified. The
recombinant virus stock obtained
was designed vCP2017.
CA 02448796 2006-12-12
51440-28
Example 19: Production of recombinant vaccines
For the preparation of equine vaccines, the recombinant canarypox vCP1712
virus (example 10) is
adjuvanted with carbomer solutions, namely CarbopolTM974P manufactured by BF
Goodrich, Ohio, USA
5 (molecular weight about 3,000,000).
A 1.5% CarbopolTM974P stock solution is initially prepared in distilled water
containing 1 g/l of sodium
chloride. This stock solution is then used for the preparation of a 4 mg/ml
CarbopolTM974P solution in
physiological salt solution. The stock solution is mixed.with the adequate
volume of said physiological salt
10 solution, either in a single stage or in several successive stages, the pH
value being adjusted in each stage
with a 1 N sodium hydroxide solution (or even more concentrated) in order to
obtain a final pH value of 7.3 to
7.4.
The ready-to-use CarbopolTM974P solution obtained in this way is used for
taking up recombinant,
15 lyophilized viruses or for diluting concentrated, recombinant virus stock
solutions. For example, to obtain a
viral suspension containing 108 pfu/1 ml dose, a viral stock solution is
diluted so as to obtain a titer of 108'3
pfu/ml, followed by dilution in equal parts with said ready-to-use 4 mg/ml
CarbopolTM974P solution.
Recombinant vaccines can also be produced with recombinant canarypox viruses
vCP1713 (example 11) or
20 vCP1717 (example 16) or vCP1718 (example 16) or vCP2017 (example 18) or a
mixture of three canarypox
viruses vCP1714 (example 12), vCP1715 (example 13) and vCP1716 (example 14)
according to the
procedure described hereinbefore.
Example 20: Production of DNA vaccines for equines
An DNA solution containing the plasmid pFC104 (example 6) is concentrated by
ethanolic precipitation in
the manner described by Sambrook et al (1989). The DNA sediment is taken up by
a 0.9% NaCl solution so
as to obtain a concentration of 1 mg/ml. A 0.75 mM DMRIE-DOPE solution is
prepared by taking up a
DMRIE-DOPE lyophilizate by a suitable sterile H2O volume.
The formation of plasmid-lipid DNA complexes is brought about by diluting in
equal parts the 0.75 mM
DMRIE-DOPE solution (1:1) with the I mg/ml DNA solution in 0.9% NaCl. The DNA
solution is
progressively introduced with the aid of a 26G crimped needle along the wall
of the flask containing the
cationic lipid solution so as to prevent the formation of foam. Gentle
stirring takes place as soon as the two
solutions have mixed. Finally a composition comprising 0.375 mM of DMRIE-DOPE
and 500 g/ml plasmid
is obtained.
It is desirable for all the solutions used to be at ambient temperature for
all the operations described
hereinbefore. DNA/DMRIE-DOPE complexing takes place at ambient temperature for
30 minutes before
immunizing the animals.
CA 02448796 2006-12-12
51440-28
31,
DNA vaccines can also be produced with DNA solutions containing plasmids
pFC104 (example 6) and
pFC106 (example 8) or containing plasmids pFC105 (example 7) and pFC106,
plasmids pFC115 (example
17) and pFC106, or containing plasmid pFC101, pFC102 and pFC103 (examples 3 to
5), or containing
plasmid pFC105 or pFC1 15 according to the procedure described in the present
example.
Example 21: In vitro expression tests
The expression of WN proteins is tested for each construction by conventional
indirect immunofluorescence
and Western Blot methods.
These tests are carried out on 96 well plates containing CHO cells cultured in
monolayers and transfected
by plasmids or containing CEF cells cultured in monolayers and infected by
recombinant viruses.
The WN proteins are detected by the use of infected chicken or horse sera and
of labelled anti-sera.
The size of the fragments obtained after migration on agarose gel is compared
with those expected.
Example 22: Effectiveness on animals
The recombinant vaccines and plasmid vaccines are injected twice at
approximately two week intervals into
approximately seven day old, unvaccinated SPF chickens by the intramuscular
route and in a volume of
approximately 0.1 mi. An unvaccinated control group is included in the study.
The chickens are challenged by subcutaneous administration into the neck of
I034TCID50 of pathogenic
WN virus.
Virernia, antibody response and mortality are observed. Autopsies are carried
out to observe lesions.
Example 23: Titration anti-WNV neutralizing antibodies
Dilution series are produced for each serum at a rate of 3 in DMEM medium to
which was added 10% fetal
calf serum in 96 well plates of the cellular culture type. To 0.05 ml of
diluted serum is added 0.05 mi of
culture medium containing approximately 100 CCIP50Iml of WNV. This mixture is
incubated for 2 hours at
37 C in an oven in an atmosphere containing 5% C02.
0.15 mi of a suspension of VERO cells containing approximately 100,000
cells/ml was then added to each
mixture. The cytopathic effect (CPE) was observed by phase contrast microscopy
after 4 to 5 days culturing
at 37 C in an atmosphere containing 5% CO2. The neutralizing titers of each
serum are calculated using the
Karber method. The titers are given in the form of the largest dilution
inhibiting the cytopathic effect for 50%
CA 02448796 2006-12-12
51440-28
32
of the wells. The titers are expressed in log10 VN50. Each serum is titrated
at least twice and preferably
four times.
Example 24: Test on horses of vCP2017
Recombinant vaccines containing vCP2017 (example 18) formulated
extemporaneously with 1 ml of
Carbopol 974P adjuvant (4 mg/ml) were injected twice at 35 day intervals into
horses aged more than
three months and which had not been previously vaccinated, using the
intramuscular route and a volume of
approximately I ml. Three groups of animals were vaccinated, with doses of
10'ICCID50 (i.e. 105*64pfu) for
group 1, 108'8CCID50 (i.e.108-' pfu) for group 2 and 107'8CCID50 (i.e. 107.64
pfu) for group 3. An
unvaccinated control group was included in the study.
The serology was observed. The neutralizing antibody titers were established
and expressed in logI 0
VN50, as indicated in example 23.
Group Titers at day 0 Titers at day 35 Titers at day 49
1 < 0.6 < 0.78 2.66
2 < 0.6 1.14 2.58
3 <0.6 1.16 2.26
control < 0.6 < 0.6 < 0.6
CA 02448796 2011-11-23
51440-28
33
SEQUENCE LISTING IN ELECTRONIC FORM
In accordance with Section 111(1) of the Patent Rules, this description
contains a
sequence listing in electronic form in ASCII text format (file: 51440-28 Seq
11-NOV-11
v2.txt).
A copy of the sequence listing in electronic form is available from the
Canadian Intellectual
Property Office.
The sequences in the sequence listing in electronic form are reproduced in the
following
table.
SEQUENCE TABLE
<110> Merial Limited
LOOSMORE, SHEENA MAY
MINKE, JULES MAARTEN
AUDONNET, JEAN-CHRISTOPHE FRANCIS
<120> RECOMBINANT VACCINE AGAINST WEST NILE VIRUS
<130> MER FLH3161
<140> WO PCT/FR02/01200
<141> 2002-04-05
<150> FR 01/04737
<151> 2001-04-06
<160> 31
<170> Patentln Ver. 3.2
<210> 1
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 1
ttttttgaat tcgttaccct ctctaacttc 30
CA 02448796 2011-11-23
51440-28
34
<210> 2
<211> 33
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 2
tttttttcta gattacctcc gactgcgtct tga 33
<210> 3
<211> 40
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 3
gatctgcagc acgtgtctag aggatatcga attcgcggcc 40
<210> 4
<211> 40
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 4
gatccgcggc cgcgaattcg atatcctcta gacacgtgct 40
<210> 5
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 5
ttttttgaat tctcactgac agtgcagaca 30
<210> 6
<211> 33
CA 02448796 2011-11-23
51440-28
<212> DNA
<213> Artificial Sequence
<220>
5 <223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 6
tttttttcta gattagctgt aagctggggc cac 33
<210> 7
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 7
ttttttgaat tcttcaactg ccttggaatg 30
<210> 8
<211> 33
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 8
tttttttcta gattaagcgt gcacgttcac gga 33
<210> 9
<211> 36
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 9
ttttttgata tcaccggaat tgcagtcatg attggc 36
<210> 10
<211> 36
<212> DNA
<213> Artificial Sequence
CA 02448796 2011-11-23
51440-28
36
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 10
ttttttgata tcatgtataa tgctgatatg attgac 36
<210> 11
<211> 36
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 11
tttttttcta gattaacgtt ttcccgaggc gaagtc 36
<210> 12
<211> 42
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 12
atcatcgagc tccagctgta attcatggtc gaaaagaagt gc 42
<210> 13
<211> 73
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 13
gaattcctcg agctgcagcc cgggttttta tagctaatta gtcatttttt gagagtacca 60
cttcagctac ctc 73
<210> 14
<211> 72
<212> DNA
<213> Artificial Sequence
CA 02448796 2011-11-23
51440-28
37
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 14
cccgggctgc agctcgagga attcttttta ttgattaact agtcattata aagatctaaa 60
atgcataatt tc 72
<210> 15
<211> 45
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 15
gatgatggta ccgtaaacaa atataatgaa aagtattcta aacta 45
<210> 16
<211> 34
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 16
aaacccgggt tctttattct atacttaaaa agtg 34
<210> 17
<211> 43
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 17
aaaagaattc gtcgactacg atacaaactt aacggatatc gcg 43
<210> 18
<211> 33
<212> DNA
<213> Artificial Sequence
CA 02448796 2011-11-23
51440-28
38
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 18
ttttcgcgaa ccggaattgc agtcatgatt ggc 33
<210> 19
<211> 39
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 19
ttttgtcgac gcggccgctt aagcgtgcac gttcacgga 39
<210> 20
<211> 42
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 20
atcatcgagc tcgcggccgc ctatcaaaag tcttaatgag tt 42
<210> 21
<211> 73
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 21
gaattcctcg agctgcagcc cgggttttta tagctaatta gtcatttttt cgtaagtaag 60
tatttttatt taa 73
<210> 22
<211> 72
<212> DNA
<213> Artificial Sequence
CA 02448796 2011-11-23
51440-28
39
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 22
cccgggctgc agctcgagga attcttttta ttgattaact agtcaaatga gtatatataa 60
ttgaaaaagt as 72
<210> 23
<211> 45
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 23
gatgatggta ccttcataaa tacaagtttg attaaactta agttg 45
<210> 24
<211> 33
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 24
aaacccgggc ggtggtttgc gattccgaaa tct 33
<210> 25
<211> 43
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 25
aaaagaattc ggatccgatt aaacctaaat aattgtactt tgt 43
<210> 26
<211> 33
<212> DNA
<213> Artificial Sequence
CA 02448796 2011-11-23
51440-28
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
5 <400> 26
tttcacgtga tgtataatgc tgatatgatt gac 33
<210> 27
10 <211> 42
<212> DNA
<213> Artificial Sequence
<220>
15 <223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 27
ttttggatcc gcggccgctt aacgttttcc cgaggcgaag tc 42
<210> 28
<211> 39
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 28
ttttttgata tcatgaccgg aattgcagtc atgattggc 39
<210> 29
<211> 36
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic
oligonucleotide
<400> 29
ttttcgcgaa tgaccggaat tgcagtcatg attggc 36
<210> 30
<211> 11029
<212> DNA
<213> West Nile virus
<220>
<221> CDS
<222> (97)..(10395)
CA 02448796 2011-11-23
51440-28
41
<400> 30
agtagttcgc ctgtgtgagc tgacaaactt agtagtgttt gtgaggatta acaacaatta 60
acacagtgcg agctgtttct tagcacgaag atctcg atg tct aag aaa cca gga 114
Met Ser Lys Lys Pro Gly
1 5
ggg ccc ggc aag agc cgg get gtc aat atg cta aaa cgc gga atg ccc 162
Gly Pro Gly Lys Ser Arg Ala Val Asn Met Leu Lys Arg Gly Met Pro
10 15 20
cgc gtg ttg tcc ttg att gga ctg aag agg get atg ttg agc ctg atc 210
Arg Val Leu Ser Leu Ile Gly Leu Lys Arg Ala Met Leu Ser Leu Ile
25 30 35
gac ggc aag ggg cca ata cga ttt gtg ttg get ctc ttg gcg ttc ttc 258
Asp Gly Lys Gly Pro Ile Arg Phe Val Leu Ala Leu Leu Ala Phe Phe
40 45 50
agg ttc aca gca att get ccg acc cga gca gtg ctg gat cga tgg aga 306
Arg Phe Thr Ala Ile Ala Pro Thr Arg Ala Val Leu Asp Arg Trp Arg
55 60 65 70
ggt gtg aac aaa caa aca gcg atg aaa cac ctt ctg agt ttt aag aag 354
Gly Val Asn Lys Gln Thr Ala Met Lys His Leu Leu Ser Phe Lys Lys
75 80 85
gaa cta ggg acc ttg acc agt get atc aat cgg cgg agc tca aaa caa 402
Glu Leu Gly Thr Leu Thr Ser Ala Ile Asn Arg Arg Ser Ser Lys Gln
90 95 100
aag aaa aga gga gga aag acc gga att gca gtc atg att ggc ctg atc 450
Lys Lys Arg Gly Gly Lys Thr Gly Ile Ala Val Met Ile Gly Leu Ile
105 110 115
gcc agc gta gga gca gtt acc ctc tct aac ttc caa ggg aag gtg atg 498
Ala Ser Val Gly Ala Val Thr Leu Ser Asn Phe Gln Gly Lys Val Met
120 125 130
atg acg gta aat get act gac gtc aca gat gtc atc acg att cca aca 546
Met Thr Val Asn Ala Thr Asp Val Thr Asp Val Ile Thr Ile Pro Thr
135 140 145 150
get gut gga aag aac cta tgc att gtc aga gca atg gat gtg gga tac 594
Ala Ala Gly Lys Asn Leu Cys Ile Val Arg Ala Met Asp Val Gly Tyr
155 160 165
atg tgc gat gat act atc act tat gaa tgc cca gtg ctg tcg get ggt 642
Met Cys Asp Asp Thr Ile Thr Tyr Glu Cys Pro Val Leu Ser Ala Gly
170 175 180
aat gat cca gaa gac atc gac tgt tgg tgc aca aag tca gca gtc tac 690
Asn Asp Pro Glu Asp Ile Asp Cys Trp Cys Thr Lys Ser Ala Val Tyr
185 190 195
CA 02448796 2011-11-23
51440-28
42
gtc agg tat gga aga tgc acc aag aca cgc cac tca aga cgc agt cgg 738
Val Arg Tyr Gly Arg Cys Thr Lys Thr Arg His Ser Arg Arg Ser Arg
200 205 210
agg tca ctg aca gtg cag aca cac gga gaa agc act cta gcg aac aag 786
Arg Ser Leu Thr Val Gln Thr His Gly Glu Ser Thr Leu Ala Asn Lys
215 220 225 230
aag ggg get tgg atg gac agc acc aag gcc aca agg tat ttg gta aaa 834
Lys Gly Ala Trp Met Asp Ser Thr Lys Ala Thr Arg Tyr Leu Val Lys
235 240 245
aca gaa tca tgg atc ttg agg aac cct gga tat gcc ctg gtg gca gcc 882
Thr Glu Ser Trp Ile Leu Arg Asn Pro Gly Tyr Ala Leu Val Ala Ala
250 255 260
gtc att ggt tgg atg ctt ggg agc aac acc atg cag aga gtt gtg ttt 930
Val Ile Gly Trp Met Leu Gly Ser Asn Thr Met Gln Arg Val Val Phe
265 270 275
gtc gtg cta ttg ctt ttg gtg gcc cca get tac agc ttc aac tgc ctt 978
Val Val Leu Leu Leu Leu Val Ala Pro Ala Tyr Ser Phe Asn Cys Leu
280 285 290
gga atg agc aac aga gac ttc ttg gaa gga gtg tct gga gca aca tgg 1026
Gly Met Ser Asn Arg Asp Phe Leu Glu Gly Val Ser Gly Ala Thr Trp
295 300 305 310
gtg gat ttg gtt ctc gaa ggc gac agc tgc gtg act atc atg tct aag 1074
Val Asp Leu Val Leu Glu Gly Asp Ser Cys Val Thr Ile Met Ser Lys
315 320 325
gac aag cct acc atc gat gtg aag atg atg aat atg gag gcg gcc aac 1122
Asp Lys Pro Thr Ile Asp Val Lys Met Met Asn Met Glu Ala Ala Asn
330 335 340
ctg gca gag gtc cgc agt tat tgc tat ttg get acc gtc agc gat ctc 1170
Leu Ala Glu Val Arg Ser Tyr Cys Tyr Leu Ala Thr Val Ser Asp Leu
345 350 355
tcc acc aaa get gcg tgc ccg acc atg gga gaa get cac aat gac aaa 1218
Ser Thr Lys Ala Ala Cys Pro Thr Met Gly Glu Ala His Asn Asp Lys
360 365 370
cgt get gac cca get ttt gtg tgc aga caa gga gtg gtg gac agg ggc 1266
Arg Ala Asp Pro Ala Phe Val Cys Arg Gln Gly Val Val Asp Arg Gly
375 380 385 390
tgg ggc aac ggc tgc gga cta ttt ggc aaa gga agc att gac aca tgc 1314
Trp Gly Asn Gly Cys Gly Leu Phe Gly Lys Gly Ser Ile Asp Thr Cys
395 400 405
CA 02448796 2011-11-23
51440-28
43
gcc aaa ttt gcc tgc tct acc aag gca ata gga aga acc atc ttg aaa 1362
Ala Lys Phe Ala Cys Ser Thr Lys Ala Ile Gly Arg Thr Ile Leu Lys
410 415 420
gag aat atc aag tac gaa gtg gcc att ttt gtc cat gga cca act act 1410
Glu Asn Ile Lys Tyr Glu Val Ala Ile Phe Val His Gly Pro Thr Thr
425 430 435
gtg gag tcg cac gga aac tac tcc aca cag gtt gga gcc act cag gca 1458
Val Glu Ser His Gly Asn Tyr Ser Thr Gln Val Gly Ala Thr Gln Ala
440 445 450
ggg aga ttc agc atc act cct gcg gcg cct tca tac aca cta aag ctt 1506
Gly Arg Phe Ser Ile Thr Pro Ala Ala Pro Ser Tyr Thr Leu Lys Leu
455 460 465 470
gga gaa tat gga gag gtg aca gtg gac tgt gaa cca cgg tca ggg att 1554
Gly Glu Tyr Gly Glu Val Thr Val Asp Cys Glu Pro Arg Ser Gly Ile
475 480 485
gac acc aat gca tac tac gtg atg act gtt gga aca aag acg ttc ttg 1602
Asp Thr Asn Ala Tyr Tyr Val Met Thr Val Gly Thr Lys Thr Phe Leu
490 495 500
gtc cat cgt gag tgg ttc atg gac ctc aac ctc cct tgg agc agt get 1650
Val His Arg Glu Trp Phe Met Asp Leu Asn Leu Pro Trp Ser Ser Ala
505 510 515
gga agt act gtg tgg agg aac aga gag acg tta atg gag ttt gag gaa 1698
Gly Ser Thr Val Trp Arg Asn Arg Glu Thr Leu Met Glu Phe Glu Glu
520 525 530
cca cac gcc acg aag cag tct gtg ata gca ttg ggc tca caa gag gga 1746
Pro His Ala Thr Lys Gln Ser Val Ile Ala Leu Gly Ser Gln Glu Gly
535 540 545 550
get ctg cat caa get ttg get gga gcc att cct gtg gaa ttt tca agc 1794
Ala Leu His Gln Ala Leu Ala Gly Ala Ile Pro Val Glu Phe Ser Ser
555 560 565
aac act gtc aag ttg acg tcg ggt cat ttg aag tgt aga gtg aag atg 1842
Asn Thr Val Lys Leu Thr Ser Gly His Leu Lys Cys Arg Val Lys Met
570 575 580
gaa aaa ttg cag ttg aag gga aca acc tat ggc gtc tgt tca aag get 1890
Glu Lys Leu Gln Leu Lys Gly Thr Thr Tyr Gly Val Cys Ser Lys Ala
585 590 595
ttc aag ttt ctt ggg act ccc gca gac aca ggt cac ggc act gtg gtg 1938
Phe Lys Phe Leu Gly Thr Pro Ala Asp Thr Gly His Gly Thr Val Val
600 605 610
CA 02448796 2011-11-23
51440-28
44
ttg gaa ttg cag tac act ggc acg gat gga cct tgc aaa gtt cct atc 1986
Leu Glu Leu Gin Tyr Thr Gly Thr Asp Gly Pro Cys Lys Val Pro Ile
615 620 625 630
tcg tca gtg get tca ttg aac gac cta acg cca gtg ggc aga ttg gtc 2034
Ser Ser Val Ala Ser Leu Asn Asp Leu Thr Pro Val Gly Arg Leu Val
635 640 645
act gtc aac cct ttt gtt tca gtg gcc acg gcc aac get aag gtc ctg 2082
Thr Val Asn Pro Phe Val Ser Val Ala Thr Ala Asn Ala Lys Val Leu
650 655 660
att gaa ttg gaa cca ccc ttt gga gac tca tac ata gtg gtg ggc aga 2130
Ile Glu Leu Glu Pro Pro Phe Gly Asp Ser Tyr Ile Val Val Gly Arg
665 670 675
gga gaa caa cag atc aat cac cat tgg cac aag tct gga agc agc att 2178
Gly Glu Gln Gln Ile Asn His His Trp His Lys Ser Gly Ser Ser Ile
680 685 690
ggc aaa gcc ttt aca acc acc ctc aaa gga gcg cag aga cta gcc get 2226
Gly Lys Ala Phe Thr Thr Thr Leu Lys Gly Ala Gln Arg Leu Ala Ala
695 700 705 710
cta gga gac aca get tgg gac ttt gga tca gtt gga ggg gtg ttc acc 2274
Leu Gly Asp Thr Ala Trp Asp Phe Gly Ser Val Gly Gly Val Phe Thr
715 720 725
tca gtt ggg aag get gtc cat caa gtg ttc gga gga gca ttc cgc tca 2322
Ser Val Gly Lys Ala Val His Gln Val Phe Gly Gly Ala Phe Arg Ser
730 735 740
ctg ttc gga ggc atg tcc tgg ata acg caa gga ttg ctg ggg get ctc 2370
Leu Phe Gly Gly Met Ser Trp Ile Thr Gln Gly Leu Leu Gly Ala Leu
745 750 755
ctg ttg tgg atg ggc atc aat get cgt gat agg tcc ata get ctc acg 2418
Leu Leu Trp Met Gly Ile Asn Ala Arg Asp Arg Ser Ile Ala Leu Thr
760 765 770
ttt ctc gca gtt gga gga gtt ctg ctc ttc ctc tcc gtg aac gtg cac 2466
Phe Leu Ala Val Gly Gly Val Leu Leu Phe Leu Ser Val Asn Val His
775 780 785 790
get gac act ggg tgt gcc ata gac atc agc cgg caa gag ctg aga tgt 2514
Ala Asp Thr Gly Cys Ala Ile Asp Ile Ser Arg Gln Glu Leu Arg Cys
795 800 805
gga agt gga gtg ttc ata cac aat gat gtg gag get tgg atg gac cgg 2562
Gly Ser Gly Val Phe Ile His Asn Asp Val Glu Ala Trp Met Asp Arg
810 815 820
tac aag tat tac cct gaa acg cca caa ggc cta gcc aag atc att cag 2610
Tyr Lys Tyr Tyr Pro Glu Thr Pro Gin Gly Leu Ala Lys Ile Ile Gln
825 830 835
CA 02448796 2011-11-23
51440-28
aaa get cat aag gaa gga gtg tgc ggt cta cga tca gtt tcc aga ctg 2658
Lys Ala His Lys Glu Gly Val Cys Gly Leu Arg Ser Val Ser Arg Leu
840 845 850
5
gag cat caa atg tgg gaa gca gtg aag gac gag ctg aac act ctt ttg 2706
Glu His Gln Met Trp Glu Ala Val Lys Asp Glu Leu Asn Thr Leu Leu
855 860 865 870
10 aag gag aat ggt gtg gac ctt agt gtc gtg gtt gag aaa cag gag gga 2754
Lys Glu Asn Gly Val Asp Leu Ser Val Val Val Glu Lys Gln Glu Gly
875 880 885
atg tac aag tca gca cct aaa cgc ctc acc gcc acc acg gaa aaa ttg 2802
15 Met Tyr Lys Ser Ala Pro Lys Arg Leu Thr Ala Thr Thr Glu Lys Leu
890 895 900
gaa att ggc tgg aag gcc tgg gga aag agt att tta ttt gca cca gaa 2850
Glu Ile Gly Trp Lys Ala Trp Gly Lys Ser Ile Leu Phe Ala Pro Glu
20 905 910 915
ctc gcc aac aac acc ttt gtg gtt gat ggt ccg gag acc aag gaa tgt 2898
Leu Ala Asn Asn Thr Phe Val Val Asp Gly Pro Glu Thr Lys Glu Cys
920 925 930
ccg act cag aat cgc get tgg aat agc tta gaa gtg gag gat ttt gga 2946
Pro Thr Gln Asn Arg Ala Trp Asn Ser Leu Glu Val Glu Asp Phe Gly
935 940 945 950
ttt ggt ctc acc agc act cgg atg ttc ctg aag gtc aga gag agc aac 2994
Phe Gly Leu Thr Ser Thr Arg Met Phe Leu Lys Val Arg Glu Ser Asn
955 960 965
aca act gaa tgt gac tcg aag atc att gga acg get gtc aag aac aac 3042
Thr Thr Glu Cys Asp Ser Lys Ile Ile Gly Thr Ala Val Lys Asn Asn
970 975 980
ttg gcg atc cac agt gac ctg tcc tat tgg att gaa agc agg ctc aat 3090
Leu Ala Ile His Ser Asp Leu Ser Tyr Trp Ile Glu Ser Arg Leu Asn
985 990 995
gat acg tgg aag ctt gaa agg gca gtt ctg ggt gaa gtc aaa tca tgt 3138
Asp Thr Trp Lys Leu Glu Arg Ala Val Leu Gly Glu Val Lys Ser Cys
1000 1005 1010
acg tgg cct gag acg cat acc ttg tgg ggc gat gga atc ctt gag agt 3186
Thr Trp Pro Glu Thr His Thr Leu Trp Gly Asp Gly Ile Leu Glu Ser
1015 1020 1025 1030
gac ttg ata ata cca gtc aca ctg gcg gga cca cga agc aat cac aat 3234
Asp Leu Ile Ile Pro Val Thr Leu Ala Gly Pro Arg Ser Asn His Asn
1035 1040 1045
CA 02448796 2011-11-23
51440-28
46
cgg aga cct ggg tac aag aca caa aac cag ggc cca tgg gac gaa ggc 3282
Arg Arg Pro Gly Tyr Lys Thr Gln Asn Gln Gly Pro Trp Asp Glu Gly
1050 1055 1060
cgg gta gag att gac ttc gat tac tgc cca gga act acg gtc acc ctg 3330
Arg Val Glu Ile Asp Phe Asp Tyr Cys Pro Gly Thr Thr Val Thr Leu
1065 1070 1075
agt gag agc tgc gga cac cgt gga cct gcc act cgc acc acc aca gag 3378
Ser Glu Ser Cys Gly His Arg Gly Pro Ala Thr Arg Thr Thr Thr Glu
1080 1085 1090
agc gga aag ttg ata aca gat tgg tgc tgc agg agc tgc acc tta cca 3426
Ser Gly Lys Leu Ile Thr Asp Trp Cys Cys Arg Ser Cys Thr Leu Pro
1095 1100 1105 1110
cca ctg cgc tac caa act gac agc ggc tgt tgg tat ggt atg gag atc 3474
Pro Leu Arg Tyr Gln Thr Asp Ser Gly Cys Trp Tyr Gly Met Glu Ile
1115 1120 1125
aga cca cag aga cat gat gaa aag acc ctc gtg cag tca caa gtg aat 3522
Arg Pro Gln Arg His Asp Glu Lys Thr Leu Val Gln Ser Gln Val Asn
1130 1135 1140
get tat aat get gat atg att gac cct ttt cag ttg ggc ctt ctg gtc 3570
Ala Tyr Asn Ala Asp Met Ile Asp Pro Phe Gln Leu Gly Leu Leu Val
1145 1150 1155
gtg ttc ttg gcc acc cag gag gtc ctt cgc aag agg tgg aca gcc aag 3618
Val Phe Leu Ala Thr Gln Glu Val Leu Arg Lys Arg Trp Thr Ala Lys
1160 1165 1170
atc agc atg cca get ata ctg att get ctg cta gtc ctg gtg ttt ggg 3666
Ile Ser Met Pro Ala Ile Leu Ile Ala Leu Leu Val Leu Val Phe Gly
1175 1180 1185 1190
ggc att act tac act gat gtg tta cgc tat gtc atc ttg gtg ggg gca 3714
Gly Ile Thr Tyr Thr Asp Val Leu Arg Tyr Val Ile Leu Val Gly Ala
1195 1200 1205
get ttc gca gaa tct aat tcg gga gga gac gtg gta cac ttg gcg ctc 3762
Ala Phe Ala Glu Ser Asn Ser Gly Gly Asp Val Val His Leu Ala Leu
1210 1215 1220
atg gcg acc ttc aag ata caa cca gtg ttt atg gtg gca tcg ttt ctc 3810
Met Ala Thr Phe Lys Ile Gln Pro Val Phe Met Val Ala Ser Phe Leu
1225 1230 1235
aaa gcg aga tgg acc aac cag gag aac att ttg ttg atg ttg gcg get 3858
Lys Ala Arg Trp Thr Asn Gln Glu Asn Ile Leu Leu Met Leu Ala Ala
1240 1245 1250
gtt ttc ttt caa atg get tat cac gat gcc cgc caa att ctg ctc tgg 3906
Val Phe Phe Gln Met Ala Tyr His Asp Ala Arg Gln Ile Leu Leu Trp
1255 1260 1265 1270
CA 02448796 2011-11-23
51440-28
47
gag atc cct gat gtg ttg aat tca ctg gcg gta get tgg atg ata ctg 3954
Glu Ile Pro Asp Val Leu Asn Ser Leu Ala Val Ala Trp Met Ile Leu
1275 1280 1285
aga gcc ata aca ttc aca acg aca tca aac gtg gtt gtt ccg ctg cta 4002
Arg Ala Ile Thr Phe Thr Thr Thr Ser Asn Val Val Val Pro Leu Leu
1290 1295 1300
gcc ctg cta aca ccc ggg ctg aga tgc ttg aat ctg gat gtg tac agg 4050
Ala Leu Leu Thr Pro Gly Leu Arg Cys Leu Asn Leu Asp Val Tyr Arg
1305 1310 1315
ata ctg ctg ttg atg gtc gga ata ggc agc ttg atc agg gag aag agg 4098
Ile Leu Leu Leu Met Val Gly Ile Gly Ser Leu Ile Arg Glu Lys Arg
1320 1325 1330
agt gca get gca aaa aag aaa gga gca agt ctg cta tgc ttg get cta 4146
Ser Ala Ala Ala Lys Lys Lys Gly Ala Ser Leu Leu Cys Leu Ala Leu
1335 1340 1345 1350
gcc tca aca gga ctt ttc aac ccc atg atc ctt get get gga ctg att 4194
Ala Ser Thr Gly Leu Phe Asn Pro Met Ile Leu Ala Ala Gly Leu Ile
1355 1360 1365
gca tgt gat ccc aac cgt aaa cgc gga tgg ccc gca act gaa gtg atg 4242
Ala Cys Asp Pro Asn Arg Lys Arg Gly Trp Pro Ala Thr Glu Val Met
1370 1375 1380
aca get gtc ggc cta atg ttt gcc atc gtc gga ggg ctg gca gag ctt 4290
Thr Ala Val Gly Leu Met Phe Ala Ile Val Gly Gly Leu Ala Glu Leu
1385 1390 1395
gac att gac tcc atg gcc att cca atg act atc gcg ggg ctc atg ttt 4338
Asp Ile Asp Ser Met Ala Ile Pro Met Thr Ile Ala Gly Leu Met Phe
1400 1405 1410
get get ttc gtg att tct ggg aaa tca aca gat atg tgg att gag aga 4386
Ala Ala Phe Val Ile Ser Gly Lys Ser Thr Asp Met Trp Ile Glu Arg
1415 1420 1425 1430
acg gcg gac att tcc tgg gaa agt gat gca gaa att aca ggc tcg agc 4434
Thr Ala Asp Ile Ser Trp Glu Ser Asp Ala Glu Ile Thr Gly Ser Ser
1435 1440 1445
gaa aga gtt gat gtg cgg ctt gat gat gat gga aac ttc cag ctc atg 4482
Glu Arg Val Asp Val Arg Leu Asp Asp Asp Gly Asn Phe Gln Leu Met
1450 1455 1460
aat gat cca gga gca cct tgg aag ata tgg atg ctc aga atg gtc tgt 4530
Asn Asp Pro Gly Ala Pro Trp Lys Ile Trp Met Leu Arg Met Val Cys
1465 1470 1475
CA 02448796 2011-11-23
51440-28
48
ctc gcg att agt gcg tac acc ccc tgg gca atc ttg ccc tca gta gtt 4578
Leu Ala Ile Ser Ala Tyr Thr Pro Trp Ala Ile Leu Pro Ser Val Val
1480 1485 1490
gga ttt tgg ata act ctc caa tac aca aag aga gga ggc gtg ttg tgg 4626
Gly Phe Trp Ile Thr Leu Gln Tyr Thr Lys Arg Gly Gly Val Leu Trp
1495 1500 1505 1510
gac act ccc tca cca aag gag tac aaa aag ggg gac acg acc acc ggc 4674
Asp Thr Pro Ser Pro Lys Glu Tyr Lys Lys Gly Asp Thr Thr Thr Gly
1515 1520 1525
gtc tac agg atc atg act cgt ggg ctg ctc ggc agt tat caa gca gga 4722
Val Tyr Arg Ile Met Thr Arg Gly Leu Leu Gly Ser Tyr Gln Ala Gly
1530 1535 1540
gcg ggc gtg atg gtt gaa ggt gtt ttc cac acc ctt tgg cat aca aca 4770
Ala Gly Val Met Val Glu Gly Val Phe His Thr Leu Trp His Thr Thr
1545 1550 1555
aaa gga gcc get ttg atg agc gga gag ggc cgc ctg gac cca tac tgg 4818
Lys Gly Ala Ala Leu Met Ser Gly Glu Gly Arg Leu Asp Pro Tyr Trp
1560 1565 1570
ggc agt gtc aag gag gat cga ctt tgt tac gga gga ccc tgg aaa ttg 4866
Gly Ser Val Lys Glu Asp Arg Leu Cys Tyr Gly Gly Pro Trp Lys Leu
1575 1580 1585 1590
cag cac aag tgg aac ggg cag gat gag gtg cag atg att gtg gtg gaa 4914
Gln His Lys Trp Asn Gly Gln Asp Glu Val Gln Met Ile Val Val Glu
1595 1600 1605
cct ggc aag aac gtt aag aac gtc cag acg aaa cca ggg gtg ttc aaa 4962
Pro Gly Lys Asn Val Lys Asn Val Gln Thr Lys Pro Gly Val Phe Lys
1610 1615 1620
aca cct gaa gga gaa atc ggg gcc gtg act ttg gac ttc ccc act gga 5010
Thr Pro Glu Gly Glu Ile Gly Ala Val Thr Leu Asp Phe Pro Thr Gly
1625 1630 1635
aca tca ggc tca cca ata gtg gac aaa aac ggt gat gtg att ggg ctt 5058
Thr Ser Gly Ser Pro Ile Val Asp Lys Asn Gly Asp Val Ile Gly Leu
1640 1645 1650
tat ggc aat gga gtc ata atg ccc aac ggc tca tac ata agc gcg ata 5106
Tyr Gly Asn Gly Val Ile Met Pro Asn Gly Ser Tyr Ile Ser Ala Ile
1655 1660 1665 1670
gtg cag ggt gaa agg atg gat gag cca atc cca gcc gga ttc gaa cct 5154
Val Gln Gly Glu Arg Met Asp Glu Pro Ile Pro Ala Gly Phe Glu Pro
1675 1680 1685
gag atg ctg agg aaa aaa cag atc act gta ctg gat ctc cat ccc ggc 5202
Glu Met Leu Arg Lys Lys Gln Ile Thr Val Leu Asp Leu His Pro Gly
1690 1695 1700
CA 02448796 2011-11-23
51440-28
49
gcc ggt aaa aca agg agg att ctg cca cag atc atc aaa gag gcc ata 5250
Ala Gly Lys Thr Arg Arg Ile Leu Pro Gln Ile Ile Lys Glu Ala Ile
1705 1710 1715
aac aga aga ctg aga aca gcc gtg cta gca cca acc agg gtt gtg get 5298
Asn Arg Arg Leu Arg Thr Ala Val Leu Ala Pro Thr Arg Val Val Ala
1720 1725 1730
get gag atg get gaa gca ctg aga gga ctg ccc atc cgg tac cag aca 5346
Ala Glu Met Ala Glu Ala Leu Arg Gly Leu Pro Ile Arg Tyr Gln Thr
1735 1740 1745 1750
tcc gca gtg ccc aga gaa cat aat gga aat gag att gtt gat gtc atg 5394
Ser Ala Val Pro Arg Glu His Asn Gly Asn Glu Ile Val Asp Val Met
1755 1760 1765
tgt cat get acc ctc acc cac agg ctg atg tct cct cac agg gtg ccg 5442
Cys His Ala Thr Leu Thr His Arg Leu Met Ser Pro His Arg Val Pro
1770 1775 1780
aac tac aac ctg ttc gtg atg gat gag get cat ttc acc gac cca get 5490
Asn Tyr Asn Leu Phe Val Met Asp Glu Ala His Phe Thr Asp Pro Ala
1785 1790 1795
agc att gca gca aga ggt tac att tcc aca aag gtc gag cta ggg gag 5538
Ser Ile Ala Ala Arg Gly Tyr Ile Ser Thr Lys Val Glu Leu Gly Glu
1800 1805 1810
gcg gcg gca ata ttc atg aca gcc acc cca cca ggc act tca gat cca 5586
Ala Ala Ala Ile Phe Met Thr Ala Thr Pro Pro Gly Thr Ser Asp Pro
1815 1820 1825 1830
ttc cca gag tcc aat tca cca att tcc gac tta cag act gag atc ccg 5634
Phe Pro Glu Ser Asn Ser Pro Ile Ser Asp Leu Gln Thr Glu Ile Pro
1835 1840 1845
gat cga get tgg aac tct gga tac gaa tgg atc aca gaa tac acc ggg 5682
Asp Arg Ala Trp Asn Ser Gly Tyr Glu Trp Ile Thr Glu Tyr Thr Gly
1850 1855 1860
aag acg gtt tgg ttt gtg cct agt gtc aag atg ggg aat gag att gcc 5730
Lys Thr Val Trp Phe Val Pro Ser Val Lys Met Gly Asn Glu Ile Ala
1865 1870 1875
ctt tgc cta caa cgt get gga aag aaa gta gtc caa ttg aac aga aag 5778
Leu Cys Leu Gln Arg Ala Gly Lys Lys Val Val Gln Leu Asn Arg Lys
1880 1885 1890
tcg tac gag acg gag tac cca aaa tgt aag aac gat gat tgg gac ttt 5826
Ser Tyr Glu Thr Glu Tyr Pro Lys Cys Lys Asn Asp Asp Trp Asp Phe
1895 1900 1905 1910
CA 02448796 2011-11-23
51440-28
gtt atc aca aca gac ata tct gaa atg ggg get aac ttc aag gcg agc 5874
Val Ile Thr Thr Asp Ile Ser Glu Met Gly Ala Asn Phe Lys Ala Ser
1915 1920 1925
5 agg gtg att gac agc cgg aag agt gtg aaa cca acc atc ata aca gaa 5922
Arg Val Ile Asp Ser Arg Lys Ser Val Lys Pro Thr Ile Ile Thr Glu
1930 1935 1940
gga gaa ggg aga gtg atc ctg gga gaa cca tct gca gtg aca gca get 5970
10 Gly Glu Gly Arg Val Ile Leu Gly Glu Pro Ser Ala Val Thr Ala Ala
1945 1950 1955
agt gcc gcc cag aga cgt gga cgt atc ggt aga aat ccg tcg caa gtt 6018
Ser Ala Ala Gln Arg Arg Gly Arg Ile Gly Arg Asn Pro Ser Gln Val
15 1960 1965 1970
ggt gat gag tac tgt tat ggg ggg cac acg aat gaa gac gac tcg aac 6066
Gly Asp Glu Tyr Cys Tyr Gly Gly His Thr Asn Glu Asp Asp Ser Asn
1975 1980 1985 1990
ttc gcc cat tgg act gag gca cga atc atg ctg gac aac atc aac atg 6114
Phe Ala His Trp Thr Glu Ala Arg Ile Met Leu Asp Asn Ile Asn Met
1995 2000 2005
cca aac gga ctg atc get caa ttc tac caa cca gag cgt gag aag gta 6162
Pro Asn Gly Leu Ile Ala Gln Phe Tyr Gln Pro Glu Arg Glu Lys Val
2010 2015 2020
tat acc atg gat ggg gaa tac cgg ctc aga gga gaa gag aga aaa aac 6210
Tyr Thr Met Asp Gly Glu Tyr Arg Leu Arg Gly Glu Glu Arg Lys Asn
2025 2030 2035
ttt ctg gaa ctg ttg agg act gca gat ctg cca gtt tgg ctg get tac 6258
Phe Leu Glu Leu Leu Arg Thr Ala Asp Leu Pro Val Trp Leu Ala Tyr
2040 2045 2050
aag gtt gca gcg get gga gtg tca tac cac gac cgg agg tgg tgc ttt 6306
Lys Val Ala Ala Ala Gly Val Ser Tyr His Asp Arg Arg Trp Cys Phe
2055 2060 2065 2070
gat ggt cct agg aca aac aca att tta gaa gac aac aac gaa gtg gaa 6354
Asp Gly Pro Arg Thr Asn Thr Ile Leu Glu Asp Asn Asn Glu Val Glu
2075 2080 2085
gtc atc acg aag ctt ggt gaa agg aag att ctg agg ccg cgc tgg att 6402
Val Ile Thr Lys Leu Gly Glu Arg Lys Ile Leu Arg Pro Arg Trp Ile
2090 2095 2100
gac gcc agg gtg tac tcg gat cac cag gca cta aag gcg ttc aag gac 6450
Asp Ala Arg Val Tyr Ser Asp His Gln Ala Leu Lys Ala Phe Lys Asp
2105 2110 2115
ttc gcc tcg gga aaa cgt tct cag ata ggg ctc att gag gtt ctg gga 6498
Phe Ala Ser Gly Lys Arg Ser Gln Ile Gly Leu Ile Glu Val Leu Gly
2120 2125 2130
CA 02448796 2011-11-23
51440-28
51
aag atg cct gag cac ttc atg ggg aag aca tgg gaa gca ctt gac acc 6546
Lys Met Pro Glu His Phe Met Gly Lys Thr Trp Glu Ala Leu Asp Thr
2135 2140 2145 2150
atg tac gtt gtg gcc act gca gag aaa gga gga aga get cac aga atg 6594
Met Tyr Val Val Ala Thr Ala Glu Lys Gly Gly Arg Ala His Arg Met
2155 2160 2165
gcc ctg gag gaa ctg cca gat get ctt cag aca att gcc ttg att gcc 6642
Ala Leu Glu Glu Leu Pro Asp Ala Leu Gln Thr Ile Ala Leu Ile Ala
2170 2175 2180
tta ttg agt gtg atg acc atg gga gta ttc ttc ctc ctc atg cag cgg 6690
Leu Leu Ser Val Met Thr Met Gly Val Phe Phe Leu Leu Met Gln Arg
2185 2190 2195
aag ggc att gga aag ata ggt ttg gga ggc get gtc ttg gga gtc gcg 6738
Lys Gly Ile Gly Lys Ile Gly Leu Gly Gly Ala Val Leu Gly Val Ala
2200 2205 2210
acc ttt ttc tgt tgg atg get gaa gtt cca gga acg aag atc gcc gga 6786
Thr Phe Phe Cys Trp Met Ala Glu Val Pro Gly Thr Lys Ile Ala Gly
2215 2220 2225 2230
atg ttg ctg ctc tcc ctt ctc ttg atg att gtg cta att cct gag cca 6834
Met Leu Leu Leu Ser Leu Leu Leu Met Ile Val Leu Ile Pro Glu Pro
2235 2240 2245
gag aag caa cgt tcg cag aca gac aac cag cta gcc gtg ttc ctg att 6882
Glu Lys Gln Arg Ser Gln Thr Asp Asn Gln Leu Ala Val Phe Leu Ile
2250 2255 2260
tgt gtc atg acc ctt gtg agc gca gtg gca gcc aac gag atg ggt tgg 6930
Cys Val Met Thr Leu Val Ser Ala Val Ala Ala Asn Glu Met Gly Trp
2265 2270 2275
cta gat aag acc aag agt gac ata agc agt ttg ttt ggg caa aga att 6978
Leu Asp Lys Thr Lys Ser Asp Ile Ser Ser Leu Phe Gly Gin Arg Ile
2280 2285 2290
gag gtc aag gag aat ttc agc atg gga gag ttt ctt ttg gac ttg agg 7026
Glu Val Lys Glu Asn Phe Ser Met Gly Glu Phe Leu Leu Asp Leu Arg
2295 2300 2305 2310
ccg gca aca gcc tgg tca ctg tac get gtg aca aca gcg gtc ctc act 7074
Pro Ala Thr Ala Trp Ser Leu Tyr Ala Val Thr Thr Ala Val Leu Thr
2315 2320 2325
cca ctg cta aag cat ttg atc acg tca gat tac atc aac acc tca ttg 7122
Pro Leu Leu Lys His Leu Ile Thr Ser Asp Tyr Ile Asn Thr Ser Leu
2330 2335 2340
CA 02448796 2011-11-23
51440-28
52
acc tca ata aac gtt cag gca agt gca cta ttc aca ctc gcg cga ggc 7170
Thr Ser Ile Asn Val Gln Ala Ser Ala Leu Phe Thr Leu Ala Arg Gly
2345 2350 2355
ttc ccc ttc gtc gat gtt gga gtg tcg get ctc ctg cta gca gcc gga 7218
Phe Pro Phe Val Asp Val Gly Val Ser Ala Leu Leu Leu Ala Ala Gly
2360 2365 2370
tgc tgg gga caa gtc acc ctc acc gtt acg gta aca gcg gca aca ctc 7266
Cys Trp Gly Gln Val Thr Leu Thr Val Thr Val Thr Ala Ala Thr Leu
2375 2380 2385 2390
ctt ttt tgc cac tat gcc tac atg gtt ccc ggt tgg caa get gag gca 7314
Leu Phe Cys His Tyr Ala Tyr Met Val Pro Gly Trp Gln Ala Glu Ala
2395 2400 2405
atg cgc tca gcc cag cgg cgg aca gcg gcc gga atc atg aag aac get 7362
Met Arg Ser Ala Gln Arg Arg Thr Ala Ala Gly Ile Met Lys Asn Ala
2410 2415 2420
gta gtg gat ggc atc gtg gcc acg gac gtc cca gaa tta gag cgc acc 7410
Val Val Asp Gly Ile Val Ala Thr Asp Val Pro Glu Leu Glu Arg Thr
2425 2430 2435
aca ccc atc atg cag aag aaa gtt gga cag atc atg ctg atc ttg gtg 7458
Thr Pro Ile Met Gln Lys Lys Val Gly Gln Ile Met Leu Ile Leu Val
2440 2445 2450
tct cta get gca gta gta gtg aac ccg tct gtg aag aca gta cga gaa 7506
Ser Leu Ala Ala Val Val Val Asn Pro Ser Val Lys Thr Val Arg Glu
2455 2460 2465 2470
gcc gga att ttg atc acg gcc gca gcg gtg acg ctt tgg gag aat gga 7554
Ala Gly Ile Leu Ile Thr Ala Ala Ala Val Thr Leu Trp Glu Asn Gly
2475 2480 2485
gca ago tct gtt tgg aac gca aca act gcc atc gga ctc tgc cac atc 7602
Ala Ser Ser Val Trp Asn Ala Thr Thr Ala Ile Gly Leu Cys His Ile
2490 2495 2500
atg cgt ggg ggt tgg ttg tca tgt cta tcc ata aca tgg aca ctc ata 7650
Met Arg Gly Gly Trp Leu Ser Cys Leu Ser Ile Thr Trp Thr Leu Ile
2505 2510 2515
aag aac atg gaa aaa cca gga cta aaa aga ggt ggg gca aaa gga cgc 7698
Lys Asn Met Glu Lys Pro Gly Leu Lys Arg Gly Gly Ala Lys Gly Arg
2520 2525 2530
acc ttg gga gag gtt tgg aaa gaa aga ctc aac cag atg aca aaa gaa 7746
Thr Leu Gly Glu Val Trp Lys Glu Arg Leu Asn Gln Met Thr Lys Glu
2535 2540 2545 2550
gag ttc act agg tac cgc aaa gag gcc atc atc gaa gtc gat cgc tca 7794
Glu Phe Thr Arg Tyr Arg Lys Glu Ala Ile Ile Glu Val Asp Arg Ser
2555 2560 2565
CA 02448796 2011-11-23
51440-28
53
gcg gca aaa cac gcc agg aaa gaa ggc aat gtc act gga ggg cat cca 7842
Ala Ala Lys His Ala Arg Lys Glu Gly Asn Val Thr Gly Gly His Pro
2570 2575 2580
gtc tct agg ggc aca gca aaa ctg aga tgg ctg gtc gaa cgg agg ttt 7890
Val Ser Arg Gly Thr Ala Lys Leu Arg Trp Leu Val Glu Arg Arg Phe
2585 2590 2595
ctc gaa ccg gtc gga aaa gtg att gac ctt gga tgt gga aga ggc ggt 7938
Leu Glu Pro Val Gly Lys Val Ile Asp Leu Gly Cys Gly Arg Gly Gly
2600 2605 2610
tgg tgt tac tat atg gca acc caa aaa aga gtc caa gaa gtc aga ggg 7986
Trp Cys Tyr Tyr Met Ala Thr Gin Lys Arg Val Gin Glu Val Arg Gly
2615 2620 2625 2630
tac aca aag ggc ggt ccc gga cat gaa gag ccc caa cta gtg caa agt 8034
Tyr Thr Lys Gly Gly Pro Gly His Glu Glu Pro Gin Leu Val Gin Ser
2635 2640 2645
tat gga tgg aac att gtc acc atg aag agt gga gtg gat gtg ttc tac 8082
Tyr Gly Trp Asn Ile Val Thr Met Lys Ser Gly Val Asp Val Phe Tyr
2650 2655 2660
aga cct tct gag tgt tgt gac acc ctc ctt tgt gac atc gga gag tcc 8130
Arg Pro Ser Glu Cys Cys Asp Thr Leu Leu Cys Asp Ile Gly Glu Ser
2665 2670 2675
tcg tca agt get gag gtt gaa gag cat agg acg att cgg gtc ctt gaa 8178
Ser Ser Ser Ala Glu Val Glu Glu His Arg Thr Ile Arg Val Leu Glu
2680 2685 2690
atg gtt gag gac tgg ctg cac cga ggg cca agg gaa ttt tgc gtg aag 8226
Met Val Glu Asp Trp Leu His Arg Gly Pro Arg Glu Phe Cys Val Lys
2695 2700 2705 2710
gtg ctc tgc ccc tac atg ccg aaa gtc ata gag aag atg gag ctg ctc 8274
Val Leu Cys Pro Tyr Met Pro Lys Val Ile Glu Lys Met Glu Leu Leu
2715 2720 2725
caa cgc cgg tat ggg ggg gga ctg gtc aga aac cca ctc tca cgg aat 8322
Gin Arg Arg Tyr Gly Gly Gly Leu Val Arg Asn Pro Leu Ser Arg Asn
2730 2735 2740
tcc acg cac gag atg tat tgg gtg agt cga get tca ggc aat gtg gta 8370
Ser Thr His Glu Met Tyr Trp Val Ser Arg Ala Ser Gly Asn Val Val
2745 2750 2755
cat tca gtg aat atg acc agc cag gtg ctc cta gga aga atg gaa aaa 8418
His Ser Val Asn Met Thr Ser Gin Val Leu Leu Gly Arg Met Glu Lys
2760 2765 2770
CA 02448796 2011-11-23
51440-28
54
agg acc tgg aag gga ccc caa tac gag gaa gat gta aac ttg gga agt 8466
Arg Thr Trp Lys Gly Pro Gin Tyr Glu Glu Asp Val Asn Leu Gly Ser
2775 2780 2785 2790
gga acc agg gcg gtg gga aaa ccc ctg ctc aac tca gac acc agt aaa 8514
Gly Thr Arg Ala Val Gly Lys Pro Leu Leu Asn Ser Asp Thr Ser Lys
2795 2800 2805
atc aag aac agg att gaa cga ctc agg cgt gag tac agt tcg acg tgg 8562
Ile Lys Asn Arg Ile Glu Arg Leu Arg Arg Glu Tyr Ser Ser Thr Trp
2810 2815 2820
cac cac gat gag aac cac cca tat aga acc tgg aac tat cac ggc agt 8610
His His Asp Glu Asn His Pro Tyr Arg Thr Trp Asn Tyr His Gly Ser
2825 2830 2835
tat gat gtg aag ccc aca ggc tcc gcc agt tcg ctg gtc aat gga gtg 8658
Tyr Asp Val Lys Pro Thr Gly Ser Ala Ser Ser Leu Val Asn Gly Val
2840 2845 2850
gtc agg ctc ctc tca aaa cca tgg gac acc atc acg aat gtt acc acc 8706
Val Arg Leu Leu Ser Lys Pro Trp Asp Thr Ile Thr Asn Val Thr Thr
2855 2860 2865 2870
atg gcc atg act gac act act ccc ttc ggg cag cag cga gtg ttc aaa 8754
Met Ala Met Thr Asp Thr Thr Pro Phe Gly Gin Gin Arg Val Phe Lys
2875 2880 2885
gag aag gtg gac acg aaa get cct gaa ccg cca gaa gga gtg aag tac 8802
Glu Lys Val Asp Thr Lys Ala Pro Glu Pro Pro Glu Gly Val Lys Tyr
2890 2895 2900
gtg ctc aat gag acc acc aac tgg ttg tgg gcg ttt ttg gcc aga gaa 8850
Val Leu Asn Glu Thr Thr Asn Trp Leu Trp Ala Phe Leu Ala Arg Glu
2905 2910 2915
aaa cgt ccc aga atg tgc tct cga gag gaa ttc ata aga aag gtc aac 8898
Lys Arg Pro Arg Met Cys Ser Arg Glu Glu Phe Ile Arg Lys Val Asn
2920 2925 2930
agc aat gca get ttg ggt gcc atg ttt gaa gag cag aat caa tgg agg 8946
Ser Asn Ala Ala Leu Gly Ala Met Phe Glu Glu Gin Asn Gin Trp Arg
2935 2940 2945 2950
agc gcc aga gaa gca gtt gaa gat cca aaa ttt tgg gag atg gtg gat 8994
Ser Ala Arg Glu Ala Val Glu Asp Pro Lys Phe Trp Glu Met Val Asp
2955 2960 2965
gag gag cgc gag gca cat ctg cgg ggg gaa tgt cac act tgc att tac 9042
Glu Glu Arg Glu Ala His Leu Arg Gly Glu Cys His Thr Cys Ile Tyr
2970 2975 2980
aac atg atg gga aag aga gag aaa aaa ccc gga gag ttc gga aag gcc 9090
Asn Met Met Gly Lys Arg Glu Lys Lys Pro Gly Glu Phe Gly Lys Ala
2985 2990 2995
CA 02448796 2011-11-23
51440-28
aag gga agc aga gcc att tgg ttc atg tgg ctc gga get cgc ttt ctg 9138
Lys Gly Ser Arg Ala Ile Trp Phe Met Trp Leu Gly Ala Arg Phe Leu
3000 3005 3010
5
gag ttc gag get ctg ggt ttt ctc aat gaa gac cac tgg ctt gga aga 9186
Glu Phe Glu Ala Leu Gly Phe Leu Asn Glu Asp His Trp Leu Gly Arg
3015 3020 3025 3030
10 aag aac tca gga gga ggt gtc gag ggc ttg ggc ctc caa aaa ctg ggt 9234
Lys Asn Ser Gly Gly Gly Val Glu Gly Leu Gly Leu Gln Lys Leu Gly
3035 3040 3045
tac atc ctg cgt gaa gtt ggc acc cgg cct ggg ggc aag atc tat get 9282
15 Tyr Ile Leu Arg Glu Val Gly Thr Arg Pro Gly Gly Lys Ile Tyr Ala
3050 3055 3060
gat gac aca get ggc tgg gac acc cgc atc acg aga get gac ttg gaa 9330
Asp Asp Thr Ala Gly Trp Asp Thr Arg Ile Thr Arg Ala Asp Leu Glu
20 3065 3070 3075
aat gaa get aag gtg ctt gag ctg ctt gat ggg gaa cat cgg cgt ctt 9378
Asn Glu Ala Lys Val Leu Glu Leu Leu Asp Gly Glu His Arg Arg Leu
3080 3085 3090
gcc agg gcc atc att gag ctc acc tat cgt cac aaa gtt gtg aaa gtg 9426
Ala Arg Ala Ile Ile Glu Leu Thr Tyr Arg His Lys Val Val Lys Val
3095 3100 3105 3110
atg cgc ccg get get gat gga aga acc gtc atg gat gtt atc tcc aga 9474
Met Arg Pro Ala Ala Asp Gly Arg Thr Val Met Asp Val Ile Ser Arg
3115 3120 3125
gaa gat cag agg ggg agt gga caa gtt gtc acc tac gcc cta aac act 9522
Glu Asp Gln Arg Gly Ser Gly Gln Val Val Thr Tyr Ala Leu Asn Thr
3130 3135 3140
ttc acc aac ctg gcc gtc cag ctg gtg agg atg atg gaa ggg gaa gga 9570
Phe Thr Asn Leu Ala Val Gln Leu Val Arg Met Met Glu Gly Glu Gly
3145 3150 3155
gtg att ggc cca gat gat gtg gag aaa ctc aca aaa ggg aaa gga ccc 9618
Val Ile Gly Pro Asp Asp Val Glu Lys Leu Thr Lys Gly Lys Gly Pro
3160 3165 3170
aaa gtc agg acc tgg ctg ttt gag aat ggg gaa gaa aga ctc agc cgc 9666
Lys Val Arg Thr Trp Leu Phe Glu Asn Gly Glu Glu Arg Leu Ser Arg
3175 3180 3185 3190
atg get gtc agt gga gat gac tgt gtg gta aag ccc ctg gac gat cgc 9714
Met Ala Val Ser Gly Asp Asp Cys Val Val Lys Pro Leu Asp Asp Arg
3195 3200 3205
CA 02448796 2011-11-23
51440-28
56
ttt gcc acc tcg ctc cac ttc ctc aat get atg tca aag gtt cgc aaa 9762
Phe Ala Thr Ser Leu His Phe Leu Asn Ala Met Ser Lys Val Arg Lys
3210 3215 3220
gac atc caa gag tgg aaa ccg tca act gga tgg tat gat tgg cag cag 9810
Asp Ile Gln Glu Trp Lys Pro Ser Thr Gly Trp Tyr Asp Trp Gln Gln
3225 3230 3235
gtt cca ttt tgc tca aac cat ttc act gaa ttg atc atg aaa gat gga 9858
Val Pro Phe Cys Ser Asn His Phe Thr Glu Leu Ile Met Lys Asp Gly
3240 3245 3250
aga aca ctg gtg gtt cca tgc cga gga cag gat gaa ttg gta ggc aga 9906
Arg Thr Leu Val Val Pro Cys Arg Gly Gln Asp Glu Leu Val Gly Arg
3255 3260 3265 3270
get cgc ata tct cca ggg gcc gga tgg aac gtc cgc gac act get tgt 9954
Ala Arg Ile Ser Pro Gly Ala Gly Trp Asn Val Arg Asp Thr Ala Cys
3275 3280 3285
ctg get aag tct tat gcc cag atg tgg ctg ctt ctg tac ttc cac aga 10002
Leu Ala Lys Ser Tyr Ala Gln Met Trp Leu Leu Leu Tyr Phe His Arg
3290 3295 3300
aga gac ctg cgg ctc atg gcc aac gcc att tgc tcc get gtc cct gtg 10050
Arg Asp Leu Arg Leu Met Ala Asn Ala Ile Cys Ser Ala Val Pro Val
3305 3310 3315
aat tgg gtc cct acc gga aga acc acg tgg tcc atc cat gca gga gga 10098
Asn Trp Val Pro Thr Gly Arg Thr Thr Trp Ser Ile His Ala Gly Gly
3320 3325 3330
gag tgg atg aca aca gag gac atg ttg gag gtc tgg aac cgt gtt tgg 10146
Glu Trp Met Thr Thr Glu Asp Met Leu Glu Val Trp Asn Arg Val Trp
3335 3340 3345 3350
ata gag gag aat gaa tgg atg gaa gac aaa acc cca gtg gag aaa tgg 10194
Ile Glu Glu Asn Glu Trp Met Glu Asp Lys Thr Pro Val Glu Lys Trp
3355 3360 3365
agt gac gtc cca tat tca gga aaa cga gag gac atc tgg tgt ggc agc 10242
Ser Asp Val Pro Tyr Ser Gly Lys Arg Glu Asp Ile Trp Cys Gly Ser
3370 3375 3380
ctg att ggc aca aga gcc cga gcc acg tgg gca gaa aac atc cag gtg 10290
Leu Ile Gly Thr Arg Ala Arg Ala Thr Trp Ala Glu Asn Ile Gln Val
3385 3390 3395
get atc aac caa gtc aga gca atc atc gga gat gag aag tat gtg gat 10338
Ala Ile Asn Gln Val Arg Ala Ile Ile Gly Asp Glu Lys Tyr Val Asp
3400 3405 3410
tac atg agt tca cta aag aga tat gaa gac aca act ttg gtt gag gac 10386
Tyr Met Ser Ser Leu Lys Arg Tyr Glu Asp Thr Thr Leu Val Glu Asp
3415 3420 3425 3430
CA 02448796 2011-11-23
51440-28
57
aca gta ctg tagatattta atcaattgta aatagacaat ataagtatgc 10435
Thr Val Leu
ataaaagtgt agttttatag tagtatttag tggtgttagt gtaaatagtt aagaaaattt 10495
tgaggagaaa gtcaggccgg gaagttcccg ccaccggaag ttgagtagac ggtgctgcct 10555
gcgactcaac cccaggagga ctgggtgaac aaagccgcga agtgatccat gtaagccctc 10615
agaaccgtct cggaaggagg accccacatg ttgtaacttc aaagcccaat gtcagaccac 10675
gctacggcgt gctactctgc ggagagtgca gtctgcgata gtgccccagg aggactgggt 10735
taacaaaggc aaaccaacgc cccacgcggc cctagccccg gtaatggtgt taaccagggc 10795
gaaaggacta gaggttagag gagaccccgc ggtttaaagt gcacggccca gcctgactga 10855
agctgtaggt caggggaagg actagaggtt agtggagacc ccgtgccaca aaacaccaca 10915
acaaaacagc atattgacac ctgggataga ctaggagatc ttctgctctg cacaaccagc 10975
cacacggcac agtgcgccga caatggtggc tggtggtgcg agaacacagg atct 11029
<210> 31
<211> 3433
<212> PRT
<213> West Nile virus
<400> 31
Met Ser Lys Lys Pro Gly Gly Pro Gly Lys Ser Arg Ala Val Asn Met
1 5 10 15
Leu Lys Arg Gly Met Pro Arg Val Leu Ser Leu Ile Gly Leu Lys Arg
20 25 30
Ala Met Leu Ser Leu Ile Asp Gly Lys Gly Pro Ile Arg Phe Val Leu
35 40 45
Ala Leu Leu Ala Phe Phe Arg Phe Thr Ala Ile Ala Pro Thr Arg Ala
55 60
Val Leu Asp Arg Trp Arg Gly Val Asn Lys Gin Thr Ala Met Lys His
45 65 70 75 80
Leu Leu Ser Phe Lys Lys Glu Leu Gly Thr Leu Thr Ser Ala Ile Asn
85 90 95
50 Arg Arg Ser Ser Lys Gin Lys Lys Arg Gly Gly Lys Thr Gly Ile Ala
100 105 110
Val Met Ile Gly Leu Ile Ala Ser Val Gly Ala Val Thr Leu Ser Asn
115 120 125
CA 02448796 2011-11-23
51440-28
58
Phe Gln Gly Lys Val Met Met Thr Val Asn Ala Thr Asp Val Thr Asp
130 135 140
Val Ile Thr Ile Pro Thr Ala Ala Gly Lys Asn Leu Cys Ile Val Arg
145 150 155 160
Ala Met Asp Val Gly Tyr Met Cys Asp Asp Thr Ile Thr Tyr Glu Cys
165 170 175
Pro Val Leu Ser Ala Gly Asn Asp Pro Glu Asp Ile Asp Cys Trp Cys
180 185 190
Thr Lys Ser Ala Val Tyr Val Arg Tyr Gly Arg Cys Thr Lys Thr Arg
195 200 205
His Ser Arg Arg Ser Arg Arg Ser Leu Thr Val Gln Thr His Gly Glu
210 215 220
Ser Thr Leu Ala Asn Lys Lys Gly Ala Trp Met Asp Ser Thr Lys Ala
225 230 235 240
Thr Arg Tyr Leu Val Lys Thr Glu Ser Trp Ile Leu Arg Asn Pro Gly
245 250 255
Tyr Ala Leu Val Ala Ala Val Ile Gly Trp Met Leu Gly Ser Asn Thr
260 265 270
Met Gln Arg Val Val Phe Val Val Leu Leu Leu Leu Val Ala Pro Ala
275 280 285
Tyr Ser Phe Asn Cys Leu Gly Met Ser Asn Arg Asp Phe Leu Glu Gly
290 295 300
Val Ser Gly Ala Thr Trp Val Asp Leu Val Leu Glu Gly Asp Ser Cys
305 310 315 320
Val Thr Ile Met Ser Lys Asp Lys Pro Thr Ile Asp Val Lys Met Met
325 330 335
Asn Met Glu Ala Ala Asn Leu Ala Glu Val Arg Ser Tyr Cys Tyr Leu
340 345 350
Ala Thr Val Ser Asp Leu Ser Thr Lys Ala Ala Cys Pro Thr Met Gly
355 360 365
Glu Ala His Asn Asp Lys Arg Ala Asp Pro Ala Phe Val Cys Arg Gln
370 375 380
Gly Val Val Asp Arg Gly Trp Gly Asn Gly Cys Gly Leu Phe Gly Lys
385 390 395 400
Gly Ser Ile Asp Thr Cys Ala Lys Phe Ala Cys Ser Thr Lys Ala Ile
405 410 415
CA 02448796 2011-11-23
51440-28
59
Gly Arg Thr Ile Leu Lys Glu Asn Ile Lys Tyr Glu Val Ala Ile Phe
420 425 430
Val His Gly Pro Thr Thr Val Glu Ser His Gly Asn Tyr Ser Thr Gln
435 440 445
Val Gly Ala Thr Gln Ala Gly Arg Phe Ser Ile Thr Pro Ala Ala Pro
450 455 460
Ser Tyr Thr Leu Lys Leu Gly Glu Tyr Gly Glu Val Thr Val Asp Cys
465 470 475 480
Glu Pro Arg Ser Gly Ile Asp Thr Asn Ala Tyr Tyr Val Met Thr Val
485 490 495
Gly Thr Lys Thr Phe Leu Val His Arg Glu Trp Phe Met Asp Leu Asn
500 505 510
Leu Pro Trp Ser Ser Ala Gly Ser Thr Val Trp Arg Asn Arg Glu Thr
515 520 525
Leu Met Glu Phe Glu Glu Pro His Ala Thr Lys Gln Ser Val Ile Ala
530 535 540
Leu Gly Ser Gln Glu Gly Ala Leu His Gln Ala Leu Ala Gly Ala Ile
545 550 555 560
Pro Val Glu Phe Ser Ser Asn Thr Val Lys Leu Thr Ser Gly His Leu
565 570 575
Lys Cys Arg Val Lys Met Glu Lys Leu Gln Leu Lys Gly Thr Thr Tyr
580 585 590
Gly Val Cys Ser Lys Ala Phe Lys Phe Leu Gly Thr Pro Ala Asp Thr
595 600 605
Gly His Gly Thr Val Val Leu Glu Leu Gin Tyr Thr Gly Thr Asp Gly
610 615 620
Pro Cys Lys Val Pro Ile Ser Ser Val Ala Ser Leu Asn Asp Leu Thr
625 630 635 640
Pro Val Gly Arg Leu Val Thr Val Asn Pro Phe Val Ser Val Ala Thr
645 650 655
Ala Asn Ala Lys Val Leu Ile Glu Leu Glu Pro Pro Phe Gly Asp Ser
660 665 670
Tyr Ile Val Val Gly Arg Gly Glu Gln Gln Ile Asn His His Trp His
675 680 685
Lys Ser Gly Ser Ser Ile Gly Lys Ala Phe Thr Thr Thr Leu Lys Gly
690 695 700
CA 02448796 2011-11-23
51440-28
Ala Gln Arg Leu Ala Ala Leu Gly Asp Thr Ala Trp Asp Phe Gly Ser
705 710 715 720
Val Gly Gly Val Phe Thr Ser Val Gly Lys Ala Val His Gln Val Phe
5 725 730 735
Gly Gly Ala Phe Arg Ser Leu Phe Gly Gly Met Ser Trp Ile Thr Gln
740 745 750
10 Gly Leu Leu Gly Ala Leu Leu Leu Trp Met Gly Ile Asn Ala Arg Asp
755 760 765
Arg Ser Ile Ala Leu Thr Phe Leu Ala Val Gly Gly Val Leu Leu Phe
770 775 780
Leu Ser Val Asn Val His Ala Asp Thr Gly Cys Ala Ile Asp Ile Ser
785 790 795 800
Arg Gln Glu Leu Arg Cys Gly Ser Gly Val Phe Ile His Asn Asp Val
805 810 815
Glu Ala Trp Met Asp Arg Tyr Lys Tyr Tyr Pro Glu Thr Pro Gln Gly
820 825 830
Leu Ala Lys Ile Ile Gln Lys Ala His Lys Glu Gly Val Cys Gly Leu
835 840 845
Arg Ser Val Ser Arg Leu Glu His Gln Met Trp Glu Ala Val Lys Asp
850 855 860
Glu Leu Asn Thr Leu Leu Lys Glu Asn Gly Val Asp Leu Ser Val Val
865 870 875 880
Val Glu Lys Gln Glu Gly Met Tyr Lys Ser Ala Pro Lys Arg Leu Thr
885 890 895
Ala Thr Thr Glu Lys Leu Glu Ile Gly Trp Lys Ala Trp Gly Lys Ser
900 905 910
Ile Leu Phe Ala Pro Glu Leu Ala Asn Asn Thr Phe Val Val Asp Gly
915 920 925
Pro Glu Thr Lys Glu Cys Pro Thr Gln Asn Arg Ala Trp Asn Ser Leu
930 935 940
Glu Val Glu Asp Phe Gly Phe Gly Leu Thr Ser Thr Arg Met Phe Leu
945 950 955 960
Lys Val Arg Glu Ser Asn Thr Thr Glu Cys Asp Ser Lys Ile Ile Gly
965 970 975
Thr Ala Val Lys Asn Asn Leu Ala Ile His Ser Asp Leu Ser Tyr Trp
980 985 990
CA 02448796 2011-11-23
51440-28
61
Ile Glu Ser Arg Leu Asn Asp Thr Trp Lys Leu Glu Arg Ala Val Leu
995 1000 1005
Gly Glu Val Lys Ser Cys Thr Trp Pro Glu Thr His Thr Leu Trp Gly
1010 1015 1020
Asp Gly Ile Leu Glu Ser Asp Leu Ile Ile Pro Val Thr Leu Ala Gly
1025 1030 1035 1040
Pro Arg Ser Asn His Asn Arg Arg Pro Gly Tyr Lys Thr Gln Asn Gln
1045 1050 1055
Gly Pro Trp Asp Glu Gly Arg Val Glu Ile Asp Phe Asp Tyr Cys Pro
1060 1065 1070
Gly Thr Thr Val Thr Leu Ser Glu Ser Cys Gly His Arg Gly Pro Ala
1075 1080 1085
Thr Arg Thr Thr Thr Glu Ser Gly Lys Leu Ile Thr Asp Trp Cys Cys
1090 1095 1100
Arg Ser Cys Thr Leu Pro Pro Leu Arg Tyr Gln Thr Asp Ser Gly Cys
1105 1110 1115 1120
Trp Tyr Gly Met Glu Ile Arg Pro Gin Arg His Asp Glu Lys Thr Leu
1125 1130 1135
Val Gln Ser Gln Val Asn Ala Tyr Asn Ala Asp Met Ile Asp Pro Phe
1140 1145 1150
Gln Leu Gly Leu Leu Val Val Phe Leu Ala Thr Gln Glu Val Leu Arg
1155 1160 1165
Lys Arg Trp Thr Ala Lys Ile Ser Met Pro Ala Ile Leu Ile Ala Leu
1170 1175 1180
Leu Val Leu Val Phe Gly Gly Ile Thr Tyr Thr Asp Val Leu Arg Tyr
1185 1190 1195 1200
Val Ile Leu Val Gly Ala Ala Phe Ala Glu Ser Asn Ser Gly Gly Asp
1205 1210 1215
Val Val His Leu Ala Leu Met Ala Thr Phe Lys Ile Gln Pro Val Phe
1220 1225 1230
Met Val Ala Ser Phe Leu Lys Ala Arg Trp Thr Asn Gln Glu Asn Ile
1235 1240 1245
Leu Leu Met Leu Ala Ala Val Phe Phe Gln Met Ala Tyr His Asp Ala
1250 1255 1260
Arg Gln Ile Leu Leu Trp Glu Ile Pro Asp Val Leu Asn Ser Leu Ala
1265 1270 1275 1280
CA 02448796 2011-11-23
51440-28
62
Val Ala Trp Met Ile Leu Arg Ala Ile Thr Phe Thr Thr Thr Ser Asn
1285 1290 1295
Val Val Val Pro Leu Leu Ala Leu Leu Thr Pro Gly Leu Arg Cys Leu
1300 1305 1310
Asn Leu Asp Val Tyr Arg Ile Leu Leu Leu Met Val Gly Ile Gly Ser
1315 1320 1325
Leu Ile Arg Glu Lys Arg Ser Ala Ala Ala Lys Lys Lys Gly Ala Ser
1330 1335 1340
Leu Leu Cys Leu Ala Leu Ala Ser Thr Gly Leu Phe Asn Pro Met Ile
1345 1350 1355 1360
Leu Ala Ala Gly Leu Ile Ala Cys Asp Pro Asn Arg Lys Arg Gly Trp
1365 1370 1375
Pro Ala Thr Glu Val Met Thr Ala Val Gly Leu Met Phe Ala Ile Val
1380 1385 1390
Gly Gly Leu Ala Glu Leu Asp Ile Asp Ser Met Ala Ile Pro Met Thr
1395 1400 1405
Ile Ala Gly Leu Met Phe Ala Ala Phe Val Ile Ser Gly Lys Ser Thr
1410 1415 1420
Asp Met Trp Ile Glu Arg Thr Ala Asp Ile Ser Trp Glu Ser Asp Ala
1425 1430 1435 1440
Glu Ile Thr Gly Ser Ser Glu Arg Val Asp Val Arg Leu Asp Asp Asp
1445 1450 1455
Gly Asn Phe Gin Leu Met Asn Asp Pro Gly Ala Pro Trp Lys Ile Trp
1460 1465 1470
Met Leu Arg Met Val Cys Leu Ala Ile Ser Ala Tyr Thr Pro Trp Ala
1475 1480 1485
Ile Leu Pro Ser Val Val Gly Phe Trp Ile Thr Leu Gin Tyr Thr Lys
1490 1495 1500
Arg Gly Gly Val Leu Trp Asp Thr Pro Ser Pro Lys Glu Tyr Lys Lys
1505 1510 1515 1520
Gly Asp Thr Thr Thr Gly Val Tyr Arg Ile Met Thr Arg Gly Leu Leu
1525 1530 1535
Gly Ser Tyr Gin Ala Gly Ala Gly Val Met Val Glu Gly Val Phe His
1540 1545 1550
Thr Leu Trp His Thr Thr Lys Gly Ala Ala Leu Met Ser Gly Glu Gly
1555 1560 1565
CA 02448796 2011-11-23
51440-28
63
Arg Leu Asp Pro Tyr Trp Gly Ser Val Lys Glu Asp Arg Leu Cys Tyr
1570 1575 1580
Gly Gly Pro Trp Lys Leu Gln His Lys Trp Asn Gly Gln Asp Glu Val
1585 1590 1595 1600
Gln Met Ile Val Val Glu Pro Gly Lys Asn Val Lys Asn Val Gln Thr
1605 1610 1615
Lys Pro Gly Val Phe Lys Thr Pro Glu Gly Glu Ile Gly Ala Val Thr
1620 1625 1630
Leu Asp Phe Pro Thr Gly Thr Ser Gly Ser Pro Ile Val Asp Lys Asn
1635 1640 1645
Gly Asp Val Ile Gly Leu Tyr Gly Asn Gly Val Ile Met Pro Asn Gly
1650 1655 1660
Ser Tyr Ile Ser Ala Ile Val Gln Gly Glu Arg Met Asp Glu Pro Ile
1665 1670 1675 1680
Pro Ala Gly Phe Glu Pro Glu Met Leu Arg Lys Lys Gln Ile Thr Val
1685 1690 1695
Leu Asp Leu His Pro Gly Ala Gly Lys Thr Arg Arg Ile Leu Pro Gln
1700 1705 1710
Ile Ile Lys Glu Ala Ile Asn Arg Arg Leu Arg Thr Ala Val Leu Ala
1715 1720 1725
Pro Thr Arg Val Val Ala Ala Glu Met Ala Glu Ala Leu Arg Gly Leu
1730 1735 1740
Pro Ile Arg Tyr Gln Thr Ser Ala Val Pro Arg Glu His Asn Gly Asn
1745 1750 1755 1760
Glu Ile Val Asp Val Met Cys His Ala Thr Leu Thr His Arg Leu Met
1765 1770 1775
Ser Pro His Arg Val Pro Asn Tyr Asn Leu Phe Val Met Asp Glu Ala
1780 1785 1790
His Phe Thr Asp Pro Ala Ser Ile Ala Ala Arg Gly Tyr Ile Ser Thr
1795 1800 1805
Lys Val Glu Leu Gly Glu Ala Ala Ala Ile Phe Met Thr Ala Thr Pro
1810 1815 1820
Pro Gly Thr Ser Asp Pro Phe Pro Glu Ser Asn Ser Pro Ile Ser Asp
1825 1830 1835 1840
Leu Gln Thr Glu Ile Pro Asp Arg Ala Trp Asn Ser Gly Tyr Glu Trp
1845 1850 1855
CA 02448796 2011-11-23
51440-28
64
Ile Thr Glu Tyr Thr Gly Lys Thr Val Trp Phe Val Pro Ser Val Lys
1860 1865 1870
Met Gly Asn Glu Ile Ala Leu Cys Leu Gln Arg Ala Gly Lys Lys Val
1875 1880 1885
Val Gln Leu Asn Arg Lys Ser Tyr Glu Thr Glu Tyr Pro Lys Cys Lys
1890 1895 1900
Asn Asp Asp Trp Asp Phe Val Ile Thr Thr Asp Ile Ser Glu Met Gly
1905 1910 1915 1920
Ala Asn Phe Lys Ala Ser Arg Val Ile Asp Ser Arg Lys Ser Val Lys
1925 1930 1935
Pro Thr Ile Ile Thr Glu Gly Glu Gly Arg Val Ile Leu Gly Glu Pro
1940 1945 1950
Ser Ala Val Thr Ala Ala Ser Ala Ala Gln Arg Arg Gly Arg Ile Gly
1955 1960 1965
Arg Asn Pro Ser Gln Val Gly Asp Glu Tyr Cys Tyr Gly Gly His Thr
1970 1975 1980
Asn Glu Asp Asp Ser Asn Phe Ala His Trp Thr Glu Ala Arg Ile Met
1985 1990 1995 2000
Leu Asp Asn Ile Asn Met Pro Asn Gly Leu Ile Ala Gln Phe Tyr Gln
2005 2010 2015
Pro Glu Arg Glu Lys Val Tyr Thr Met Asp Gly Glu Tyr Arg Leu Arg
2020 2025 2030
Gly Glu Glu Arg Lys Asn Phe Leu Glu Leu Leu Arg Thr Ala Asp Leu
2035 2040 2045
Pro Val Trp Leu Ala Tyr Lys Val Ala Ala Ala Gly Val Ser Tyr His
2050 2055 2060
Asp Arg Arg Trp Cys Phe Asp Gly Pro Arg Thr Asn Thr Ile Leu Glu
2065 2070 2075 2080
Asp Asn Asn Glu Val Glu Val Ile Thr Lys Leu Gly Glu Arg Lys Ile
2085 2090 2095
Leu Arg Pro Arg Trp Ile Asp Ala Arg Val Tyr Ser Asp His Gln Ala
2100 2105 2110
Leu Lys Ala Phe Lys Asp Phe Ala Ser Gly Lys Arg Ser Gln Ile Gly
2115 2120 2125
Leu Ile Glu Val Leu Gly Lys Met Pro Glu His Phe Met Gly Lys Thr
2130 2135 2140
CA 02448796 2011-11-23
51440-28
Trp Glu Ala Leu Asp Thr Met Tyr Val Val Ala Thr Ala Glu Lys Gly
2145 2150 2155 2160
Gly Arg Ala His Arg Met Ala Leu Glu Glu Leu Pro Asp Ala Leu Gln
5 2165 2170 2175
Thr Ile Ala Leu Ile Ala Leu Leu Ser Val Met Thr Met Gly Val Phe
2180 2185 2190
10 Phe Leu Leu Met Gln Arg Lys Gly Ile Gly Lys Ile Gly Leu Gly Gly
2195 2200 2205
Ala Val Leu Gly Val Ala Thr Phe Phe Cys Trp Met Ala Glu Val Pro
2210 2215 2220
Gly Thr Lys Ile Ala Gly Met Leu Leu Leu Ser Leu Leu Leu Met Ile
2225 2230 2235 2240
Val Leu Ile Pro Glu Pro Glu Lys Gln Arg Ser Gln Thr Asp Asn Gln
2245 2250 2255
Leu Ala Val Phe Leu Ile Cys Val Met Thr Leu Val Ser Ala Val Ala
2260 2265 2270
Ala Asn Glu Met Gly Trp Leu Asp Lys Thr Lys Ser Asp Ile Ser Ser
2275 2280 2285
Leu Phe Gly Gln Arg Ile Glu Val Lys Glu Asn Phe Ser Met Gly Glu
2290 2295 2300
Phe Leu Leu Asp Leu Arg Pro Ala Thr Ala Trp Ser Leu Tyr Ala Val
2305 2310 2315 2320
Thr Thr Ala Val Leu Thr Pro Leu Leu Lys His Leu Ile Thr Ser Asp
2325 2330 2335
Tyr Ile Asn Thr Ser Leu Thr Ser Ile Asn Val Gln Ala Ser Ala Leu
2340 2345 2350
Phe Thr Leu Ala Arg Gly Phe Pro Phe Val Asp Val Gly Val Ser Ala
2355 2360 2365
Leu Leu Leu Ala Ala Gly Cys Trp Gly Gln Val Thr Leu Thr Val Thr
2370 2375 2380
Val Thr Ala Ala Thr Leu Leu Phe Cys His Tyr Ala Tyr Met Val Pro
2385 2390 2395 2400
Gly Trp Gln Ala Glu Ala Met Arg Ser Ala Gln Arg Arg Thr Ala Ala
2405 2410 2415
Gly Ile Met Lys Asn Ala Val Val Asp Gly Ile Val Ala Thr Asp Val
2420 2425 2430
CA 02448796 2011-11-23
51440-28
66
Pro Glu Leu Glu Arg Thr Thr Pro Ile Met Gln Lys Lys Val Gly Gln
2435 2440 2445
Ile Met Leu Ile Leu Val Ser Leu Ala Ala Val Val Val Asn Pro Ser
2450 2455 2460
Val Lys Thr Val Arg Glu Ala Gly Ile Leu Ile Thr Ala Ala Ala Val
2465 2470 2475 2480
Thr Leu Trp Glu Asn Gly Ala Ser Ser Val Trp Asn Ala Thr Thr Ala
2485 2490 2495
Ile Gly Leu Cys His Ile Met Arg Gly Gly Trp Leu Ser Cys Leu Ser
2500 2505 2510
Ile Thr Trp Thr Leu Ile Lys Asn Met Glu Lys Pro Gly Leu Lys Arg
2515 2520 2525
Gly Gly Ala Lys Gly Arg Thr Leu Gly Glu Val Trp Lys Glu Arg Leu
2530 2535 2540
Asn Gln Met Thr Lys Glu Glu Phe Thr Arg Tyr Arg Lys Glu Ala Ile
2545 2550 2555 2560
Ile Glu Val Asp Arg Ser Ala Ala Lys His Ala Arg Lys Glu Gly Asn
2565 2570 2575
Val Thr Gly Gly His Pro Val Ser Arg Gly Thr Ala Lys Leu Arg Trp
2580 2585 2590
Leu Val Glu Arg Arg Phe Leu Glu Pro Val Gly Lys Val Ile Asp Leu
2595 2600 2605
Gly Cys Gly Arg Gly Gly Trp Cys Tyr Tyr Met Ala Thr Gln Lys Arg
2610 2615 2620
Val Gln Glu Val Arg Gly Tyr Thr Lys Gly Gly Pro Gly His Glu Glu
2625 2630 2635 2640
Pro Gln Leu Val Gln Ser Tyr Gly Trp Asn Ile Val Thr Met Lys Ser
2645 2650 2655
Gly Val Asp Val Phe Tyr Arg Pro Ser Glu Cys Cys Asp Thr Leu Leu
2660 2665 2670
Cys Asp Ile Gly Glu Ser Ser Ser Ser Ala Glu Val Glu Glu His Arg
2675 2680 2685
Thr Ile Arg Val Leu Glu Met Val Glu Asp Trp Leu His Arg Gly Pro
2690 2695 2700
Arg Glu Phe Cys Val Lys Val Leu Cys Pro Tyr Met Pro Lys Val Ile
2705 2710 2715 2720
CA 02448796 2011-11-23
51440-28
67
Glu Lys Met Glu Leu Leu Gin Arg Arg Tyr Gly Gly Gly Leu Val Arg
2725 2730 2735
Asn Pro Leu Ser Arg Asn Ser Thr His Glu Met Tyr Trp Val Ser Arg
2740 2745 2750
Ala Ser Gly Asn Val Val His Ser Val Asn Met Thr Ser Gin Val Leu
2755 2760 2765
Leu Gly Arg Met Glu Lys Arg Thr Trp Lys Gly Pro Gin Tyr Glu Glu
2770 2775 2780
Asp Val Asn Leu Gly Ser Gly Thr Arg Ala Val Gly Lys Pro Leu Leu
2785 2790 2795 2800
Asn Ser Asp Thr Ser Lys Ile Lys Asn Arg Ile Glu Arg Leu Arg Arg
2805 2810 2815
Glu Tyr Ser Ser Thr Trp His His Asp Glu Asn His Pro Tyr Arg Thr
2820 2825 2830
Trp Asn Tyr His Gly Ser Tyr Asp Val Lys Pro Thr Gly Ser Ala Ser
2835 2840 2845
Ser Leu Val Asn Gly Val Val Arg Leu Leu Ser Lys Pro Trp Asp Thr
2850 2855 2860
Ile Thr Asn Val Thr Thr Met Ala Met Thr Asp Thr Thr Pro Phe Gly
2865 2870 2875 2880
Gin Gin Arg Val Phe Lys Glu Lys Val Asp Thr Lys Ala Pro Glu Pro
2885 2890 2895
Pro Glu Gly Val Lys Tyr Val Leu Asn Glu Thr Thr Asn Trp Leu Trp
2900 2905 2910
Ala Phe Leu Ala Arg Glu Lys Arg Pro Arg Met Cys Ser Arg Glu Glu
2915 2920 2925
Phe Ile Arg Lys Val Asn Ser Asn Ala Ala Leu Gly Ala Met Phe Glu
2930 2935 2940
Glu Gin Asn Gin Trp Arg Ser Ala Arg Glu Ala Val Glu Asp Pro Lys
2945 2950 2955 2960
Phe Trp Glu Met Val Asp Glu Glu Arg Glu Ala His Leu Arg Gly Glu
2965 2970 2975
Cys His Thr Cys Ile Tyr Asn Met Met Gly Lys Arg Glu Lys Lys Pro
2980 2985 2990
Giy Glu Phe Gly Lys Ala Lys Gly Ser Arg Ala Ile Trp Phe Met Trp
2995 3000 3005
CA 02448796 2011-11-23
51440-28
68
Leu Gly Ala Arg Phe Leu Glu Phe Glu Ala Leu Gly Phe Leu Asn Glu
3010 3015 3020
Asp His Trp Leu Gly Arg Lys Asn Ser Gly Gly Gly Val Glu Gly Leu
3025 3030 3035 3040
Gly Leu Gln Lys Leu Gly Tyr Ile Leu Arg Glu Val Gly Thr Arg Pro
3045 3050 3055
Gly Gly Lys Ile Tyr Ala Asp Asp Thr Ala Gly Trp Asp Thr Arg Ile
3060 3065 3070
Thr Arg Ala Asp Leu Glu Asn Glu Ala Lys Val Leu Glu Leu Leu Asp
3075 3080 3085
Gly Glu His Arg Arg Leu Ala Arg Ala Ile Ile Glu Leu Thr Tyr Arg
3090 3095 3100
His Lys Val Val Lys Val Met Arg Pro Ala Ala Asp Gly Arg Thr Val
3105 3110 3115 3120
Met Asp Val Ile Ser Arg Glu Asp Gln Arg Gly Ser Gly Gln Val Val
3125 3130 3135
Thr Tyr Ala Leu Asn Thr Phe Thr Asn Leu Ala Val Gln Leu Val Arg
3140 3145 3150
Met Met Glu Gly Glu Gly Val Ile Gly Pro Asp Asp Val Glu Lys Leu
3155 3160 3165
Thr Lys Gly Lys Gly Pro Lys Val Arg Thr Trp Leu Phe Glu Asn Gly
3170 3175 3180
Glu Glu Arg Leu Ser Arg Met Ala Val Ser Gly Asp Asp Cys Val Val
3185 3190 3195 3200
Lys Pro Leu Asp Asp Arg Phe Ala Thr Ser Leu His Phe Leu Asn Ala
3205 3210 3215
Met Ser Lys Val Arg Lys Asp Ile Gln Glu Trp Lys Pro Ser Thr Gly
3220 3225 3230
Trp Tyr Asp Trp Gln Gln Val Pro Phe Cys Ser Asn His Phe Thr Glu
3235 3240 3245
Leu Ile Met Lys Asp Gly Arg Thr Leu Val Val Pro Cys Arg Gly Gln
3250 3255 3260
Asp Glu Leu Val Gly Arg Ala Arg Ile Ser Pro Gly Ala Gly Trp Asn
3265 3270 3275 3280
Val Arg Asp Thr Ala Cys Leu Ala Lys Ser Tyr Ala Gln Met Trp Leu
3285 3290 3295
CA 02448796 2011-11-23
51440-28
69
Leu Leu Tyr Phe His Arg Arg Asp Leu Arg Leu Met Ala Asn Ala Ile
3300 3305 3310
Cys Ser Ala Val Pro Val Asn Trp Val Pro Thr Gly Arg Thr Thr Trp
3315 3320 3325
Ser Ile His Ala Gly Gly Glu Trp Met Thr Thr Glu Asp Met Leu Glu
3330 3335 3340
Val Trp Asn Arg Val Trp Ile Glu Glu Asn Glu Trp Met Glu Asp Lys
3345 3350 3355 3360
Thr Pro Val Glu Lys Trp Ser Asp Val Pro Tyr Ser Gly Lys Arg Glu
3365 3370 3375
Asp Ile Trp Cys Gly Ser Leu Ile Gly Thr Arg Ala Arg Ala Thr Trp
3380 3385 3390
Ala Glu Asn Ile Gln Val Ala Ile Asn Gln Val Arg Ala Ile Ile Gly
3395 3400 3405
Asp Glu Lys Tyr Val Asp Tyr Met Ser Ser Leu Lys Arg Tyr Glu Asp
3410 3415 3420
Thr Thr Leu Val Glu Asp Thr Val Leu
3425 3430
