Note: Descriptions are shown in the official language in which they were submitted.
Case 9123M/CA
CA 02449417 2003-12-04
la
Methods for Identifying Compounds for Regulating Cardiac Dysfunction
BACKGROUND OF THE INVENTION
Heart Failure
Heart failure is a progressive state of cardiac dysfunction resulting in
increasingly
inadequate perfusion of organs to meet their metabolic demands. Despite
improvements in
therapy, the mortality rate remains high (50% in 5 years). Historically, heart
failure was a
product of hypertensive or valvular heart disease in the majority of patients.
Today, improved
surveillance for high blood pressure, improved antihypertensive drug therapy,
and advances in
cardiac surgical techniques have caused a shift in etiology that now appears
to favor long-
standing coronary artery disease as the primary inciting factor (Swedberg et
al., 1990). But
regardless of etiology, it can not be over-emphasized that progression is an
inherent component
of heart failure, and therefore novel therapeutic strategies must address
slowing of disease
progression, not simply acute palliation of symptoms (Lipicky and Packer,
1993).
Current heart failure (HF) therapies provide modest symptomatic relief and
small but
significant slowing of disease progression and mortality. The current
mainstays of HF therapy
are the angiotensin converting enzyme (ACE) inhibitors. These drugs were the
first to clearly
slow disease progression. Moreover, this benefit is associated with reduction
in circulating levels
of vasoactive hormones, (reduced neurohumoral activation), providing powerful
support for the
so-called neurohumoral hypothesis of HF progression. These findings led to
more rigorous,
large-scale trials of other agents that block various neurohumoral mediators
found to be elevated
in heart failure. The agents that have advanced most rapidly are the (3-
Mockers, which now have
been shown in several trials to also slow disease progression and delay
mortality. However, it
should be pointed out that even after the introduction of these agents into
therapy mortality rates
remain high (5 year mortality rate of 50%) and worsening of HF constitutes a
leading cause of
hospitalization.
Ubiquitinylation Process
Ubiguitin: Proteasome Dependent Pathway
Ubiquitin-proteasome proteolysis is an important process for the normal
turnover of
cellular proteins and the regulation, via ubiquitin targeted degradation, of a
number of short-lived
proteins that are involved in a variety of cellular processes. Degradation of
a protein by the
ubiquitinylation pathway proceeds in two distinct processes: (1) the covalent
attachment of
CA 02449417 2003-12-04
Case 9123M/CA
2
multiple ubiquitin protein molecules to the target protein, and (2) the
degradation of the
ubiquitinylated protein by the 26S proteasome complex along with the release
of free and
reusable ubiquitin. Ubiquitin is attached to a target protein by a series of
ubiquitin conjugating
enzymes belonging to the E1 (activating), E2 (conjugating), and E3 (ligating)
families that act in
concert. The same enzymes attach an additional ubiquitin protein molecule to
the mono-
ubiquitinylated protein. Following additional cycles, the poly-ubiquitinylated
protein becomes the
target for degradation by the 26S proteasome with the concomitant release of
ubiquitin by
carboxy-terminal hydrolases (UCHLs) and ubiquitin-specific isopeptidases
(USPs). The
ubiquitinylation of a protein is a combinatorial process with one E 1
interacting with multiple E2
enzymes, each of which appears to be able to interact with multiple E3
enzymes. There are at
least 21 genes in the E2 family of conjugating enzymes. There are four
subfamilies of E3
enzymes; the E3a family, the large combinatorial SCF family, the ring finger
family, and the
HECT-domain family, each represented by multiple genes. In addition, there are
a large number
of the de-ubiquitinating enzymes UCHLs and USPs.
Ubiguitin: Proteasome Independent Pathway
Protein degradation is an example of the classical view of the function of the
ubiquitin-
proteasome pathway. By this mechanism, it is possible not only to recycle
important biological
molecules but also to tightly regulate cellular activities, such as
transcription, by controlling the
longevity of transcription factors. These are often short-lived molecules that
are rapidly degraded
once the transcriptional machinery has been activated. Moreover, there is
accumulating evidence
to suggest that ubiquitination may also be involved in the activation of
transcription factors
(Conaway, et al., 2002). The degradation activity generally appears to involve
an ubiquitin chain
(of at least 4 ubiquitin molecules) linked through lysine 48. However, there
are at least 3 other
lysines, particularly residue 63, in ubiquitin that may be involved in protein
modification.
Proteins ubiquitinated via this residue are not degraded by proteasomes, but
have instead been
identified with other functions such as DNA repair, signal transduction and
endocytosis
(Weissman, 2001). The transcription factor, NFkB, is of particular interest
because
ubiquitination appears to be involved at multiple levels of regulating signal
transduction.
Ubiquitination, utilizing the degradation pathway, is first responsible for
converting inactive
precursors, p105 and p100, to the active species, p52 and p50. However, the
heterodimer is
inhibited by IK(3. Upon activation of TRAF6 (TNF-receptor-associated factor
6), which is itself
an ubiquitin ligase and ubiquitinated, TAK1 (transforming growth factor-beta-
activated protein
Case 9123M/CA
CA 02449417 2003-12-04
3
kinase 1) is ubiquitinated and activated. TAK1 can phosphorylate both IKK
(1K(3 kinase) and
MKK, the latter activating the JNK-p3$ pathways. Phosphorylation of 1KK leads
to
phosphorylation of IK(3, which is ubiquitinated and targeted for degradation,
whereby inhibition
of NFkB is lifted (Wang, et al., 2001). Given the complexity of the enzymes
involved and the
consequences of protein modification, both ubiquitin conjugation and
degradation (with the
release of free ubiquitin) processes must be tightly regulated to ensure the
efficient and specific
removal of a protein or function of a protein at a certain time point or
physiological state.
Regulation of The Ubiquitin-Proteasome Protein Degradation Pathway in Skeletal
Muscle
Atrophy
The role of proteolytic pathways in skeletal muscle atrophy has been studied
in several
rodent models in which the atrophy response was initiated by a variety of
stimuli including
starvation, denervation, disuse, immobilization, sepsis, diabetes and
cachexia/tumor burden. It is
generally agreed that the atrophy process involves the lysosomal (cathepsins),
calcium-activated
proteases (calpains) and ubiquitin-proteasome pathways. The increased mRNA
expression of
ubiquitin, ubiquitin conjugating enzymes and proteasome subunits has been
observed in many
atrophy models (Medina et al., 1995; Taillandier et al., 1996; Voisin et al.,
1996; Mitch et al.,
1999; Liu et al., 2000) and it has been proposed that the rate limiting step
in the atrophy process
resides at the regulation of ubiquitin and the ubiquitin conjugating enzyme
pathway. In studies
where the atrophy response was reversed, for example, by re-feeding in a
starvation model
(Medina et al., 1995) or insulin administration in a diabetic model (Much et
al., 1999), the levels
of mRNA for ubiquitin-proteasome pathway components were restored to normal
levels. In a
tumor-bearing/cachexia model, muscle atrophy, or wasting, was blocked by the
administration of
the (3Z-adrenergic agonist clenbuterol with the concomitant block of the
increased expression of
ubiquitin mRNA (Costelli et al., 1995). The latter study demonstrated that an
anti-atrophy effect
could be pharmacologically achieved without directly modifying the initiating
stimulus for the
atrophy response.
Ubiquitinylation and Disease:
Further, ubiquitinylation affects a diverse group of proteins such as tumor
suppressors
(von Hippel Lindau), transcription factors, and ion channels (Glickman and
Ciechanover, 2002,
Kondo and Kaelin, 2001, Ciechanover et al., 2000). Consequently
ubiquitinylation is involved in
several cellular processes including cell cycle regulation, differentiation,
and cellular
CA 02449417 2003-12-04
Case 9123M/CA
4
homeostasis. In addition to the possibilities of muscle wasting and modulation
of inflammation
as discussed, ubiquitinylation has been identified in certain proliferative
diseases such as
hemangioblastomas, clear cell renal carcinomas, cervical cancer, and
pheochromocytoma.
Neurodegenerative diseases such as Parkinson's and Alzheimer's (Chung et al.,
2001, Layfield et
al., 2001) also have been linked to problems of the ubiquitinylation pathway:
and inappropriate
turnover of the sodium channel has been identified in Liddle syndrome, an
autosomal dominant
form of hypertension (Vu and Sakamoto, 2000). These examples help to
underscore the
importance of the ubiquitinylation pathway in cellular function and that
disruption of this
regulatory mechanism can have pathological consequences.
Regulation of the Ubiquitinylation Pathway in Heart Failure
Several investigators have reported abnormal protein turnover and expression
in failing
explanted human hearts (Scheler et al. 1999, Corbett et al., 1998, Pleissner
et al., 1997). In them,
increased levels of myosin light chain 2 protein and decreased expression of
HSP27 were
reported while increased accumulation of HSP27, desmin and actin fragments
were detected.
Still, others working with a canine model of heart failure have reported
abnormal expression of
proteins associated with energy metabolism, stress proteins (HSP60 and HSP70)
and reduction in
cytoskeletal protein, desmin while fording increased levels of desmin
fragments and myosin
heavy chain (Heinke et al., 1999, 1998). In heart samples from bovine dilated
cardiomyopathy,
along with other proteins ubiquitin carboxy-terminal hydrolase (UCHL-1, PGP-
9.5), a key
enzyme involved in ubiquitin recycling, has been reported increased (Weekes et
al., 1999). The
same group has also found that PGP-9.5, both message and protein, along with
protein
ubiquitination is increased in human dilated cardiomyopathy (Weekes et al.,
2000).
Although it has been proposed that during skeletal muscle atrophy, the
ubiquitin-
proteasome pathway plays a key role in the increased proteolysis of
intracellular proteins,
especially the myofibrillar proteins (Lecker et al., 1999), resulting in
decreased skeletal muscle
mass, the role of ubiquitin-proteasome pathway, if any, in heart failure is
unclear. In skeletal
muscle atrophy, the end result is one of loss of muscle mass and decreased
size of the myofibers.
In contrast, while components of ubiquitinylation may contribute to muscle
protein degradation
and turnover in various cardiomyopathies, heart failure is associated with
increased heart mass
and increase in the size of the cardiomyocytes. Rather than loss of muscle
protein, there is an
increase of sarcomeric proteins leading to increased muscle cell size.
CA 02449417 2003-12-04
Case 9123M/CA
SUMMARY OF THE INVENTION
The present invention pertains to screening for compounds that modulate either
expression or activity of a gene or gene family involved in ubiquitin-mediated
protein
degradation/signaling pathway in a failing heart. The present invention
identifies these genes and
families as targets to screen for compounds that modulate their activity.
In one embodiment, the invention provides for a method of screening an agent
useful for
modulating cardiomyopathy comprising the steps o~ (a) exposing one or more of
the proteins of
the invention to the agent; and (b) measuring activity of said protein;
wherein a modulation in the
activity of said protein indicates the agent is useful for modulating
cardiomyopathy.
In another embodiment, the invention provides for a method of screening an
agent useful
for modulating cardiomyopathy comprising the steps of: (a) expressing one or
more proteins of
the invention in a suitable cell population; (b) exposing the cell population
to the agent; and (c)
measuring activity of said proteins; wherein a modulation in the activity of
said proteins indicates
the agent is useful for modulating cardiomyopathy.
In another embodiment, the invention provides for a method of screening an
agent useful
for modulating expression of a gene or a family of genes involved in
cardiomyopathy comprising
the steps of: (a) exposing one or more of the genes of the invention to an
agent; and (b)
measuring expression of said gene; wherein a modulation in the expression of
said gene indicates
the agent is useful for modulating cardiomyopathy.
In another embodiment, the invention provides methods for identifying binding
partners
that bind to the proteins of the invention, comprising: (a) expressing a
protein of invention in a
suitable and cell, and (b) using appropriate means to identify the partners
that bind to it.
In another aspect of the invention the binding partner may be identified using
isolated
proteins of the invention.
All documents cited are, in relevant part, incorporated herein by reference;
the citation of
any document is not to be construed as an admission that it is prior art with
respect to the present
invention.
SEQUENCE LISTING DESCRIPTION
Each of the nucleotide and protein sequences of the present invention are
included in the
sequence listing, along with the corresponding Genbank or Derwent accession
numbers) and
animal species from which it is cloned, as shown in Table 1. Also shown are
accession numbers
for related nucleotide sequences that encode identical, or nearly identical,
amino acid sequences
CA 02449417 2003-12-04
Case 9123M/CA
as the sequence shown in the sequence listing. These related sequences differ
mainly in the
amount of 5' or 3' untranslated sequence shown.
CA 02449417 2003-12-04
Case 9123M/CA
Table 1
Sequence SEQ ID NO: Species Genbank Related Genbank
description nucleotide, Accession (GB) or Derwent
No. (D)
amino acid for nucleotideAccession Nos.
sequence
USP11; ubiquitin1, 2 H. sapiensNM 004651 U44839, BC000350,
specific protease AK055588
11
USP22; ubiquitin3, 4 H. SapiensXM 042698 AB028986,
specific protease AK025331,
22 BC007196,
AL049258,
AL110213,
AL 162082,
BC009452, BC025317
UBE1C; 5, 6 H. SapiensNM_003968 AL117566,
ubiquitin- AF046024,
activating AK002159,
enzyme
E1C (UBA3 BC022853,
homolog, yeast) AB012190
UBE2H; 7, 8 H. sapiensNM 003344 AK024519,
ubiquitin- AK026094,
conjugating BC006277, 229331,
enzyme E2H 229330, 229328
(UBC8 homolog,
yeast)
FBX032; F-box9, 10 H. sapiensNM 058229 BC024030,
only protein AK056986,
32
AJ420108, AY059629
USP9Y; ubiquitin11, 12 H. sapiensNM 004654 Y13618, Y13619,
specific protease AF000986,
CA 02449417 2003-12-04
Case 9123M/CA
Sequence SEQ ID NO: Species Genbank Related Genbank
description nucleotide, Accession (GB) or Derwent
No. (D)
amino acid for nucleotideAccession Nos.
sequence
9Y AK057605
CDC34, ubiquitin31, 32 R. XM 216827 AA818770 (RN.2427)
conjugating norvegicus NM_177613 (mouse)
enzyme NM_004359 (human)
USP18, ubiquitin33, 34 R. XM_232259 AA851237 (RN.4165)
specific norvegicus RN.806 NM 017414
protease
18 (human) NM 011909
(mouse)
ULEIA, 35, 36 R. XM 218333 AA956535 (RN.9014)
ubiquitin-like narvegicus NM 019748 (mouse)
1
(sentrin)
activating
enzyme
ElA
HERPUD1, 37, 38 R. NM 053523 AA957323 (RN.4028)
homocysteine- norvegicus NM 014685 (human)
inducible, NM 022331 (mouse)
endoplasmic
reticulum
stress-
inducible,
ubiquitin-like
domain member
1
UBE2C, 39, 40 R. XM 215924 AI103150 (RN.3102)
ubiquitin- norvegicus NM 026785 (mouse)
conjugating NM_007019 (human)
enzyme E2C
USP2, ubiquitin41, 42 R. NM_053774 AI103604 (RN.19491)
specific norvegicus NM 004205 (human)
protease
2 NM_171997 (human)
CA 02449417 2003-12-04
Case 9123M/CA
Sequence SEQ ID NO: Species Genbank Related Genbank
description nucleotide, Accession (GB) or Derwent
No. (D)
amino acid for nucleotideAccession Nos.
sequence
NM 016808 (mouse)
CA 02449417 2003-12-04
Case 9123M/CA
Sequence SEQ ID NO: Species Genbank Related Genbank
description nucleotide, Accession (GB) or Derwent
No. (D)
amino acid for nucleotideAccession Nos.
sequence
USPB, ubiquitin43, 44 R. XM 215821 AI168999 (RN.8650)
specific protease norvegicus NM 005154 (human)
8 NM_019729 (mouse)
UBE2L3, 45, 46 R. XM 344046 AI172301 (RN.54778)
ubiquitin- norvegicus NM_003347 (human)
conjugating NM_009456 (mouse)
enzyme E2L
3
USP9X, ubiquitin47, 48 R. XM 343766 AI236092 (RN.7604)
specific protease norvegicus NM 004652 (human)
9, X chromosome NM_021906 (human)
(fat facets-like NM 009481 (mouse)
Drosophila)
UBE2H, 49, 50 M. NM 009459 U19854
ubiquitin- musculus (MM.180409)
conjugating
enzyme E2H
UBE2G2, 51, 52 M. NM_019803 AI839191
ubiquitin- musculus (MM.29352)
conj ugating
enzyme E2G
2
HERC3, hect 53, 54 M. NM 028705 AI447997
domain & RLD musculus (MM.33788)
3,
ubiquitin
protein
ligase
USP16, ubiquitin55, 56 M. NM 024258 AI836979
specific protease rnusculus (MM.196253)
16
FBXW1B, F-box57, 58 M NM_134015 AW046376
CA 02449417 2003-12-04
Case 9123M/CA
11
Sequence SEQ ID NO: Species Genbank Related Genbank
description nucleotide, Accession (GB) or Derwent
No. (D)
amino acid for nucleotideAccession Nos.
sequence
and WD-40 musculus (MM.28017)
domain protein NM 012300 (human)
1B NM_033644 (human)
N4WBP4- 59, 60 M. NM 022995 AW047717
PENDING, musculus (MM.41009)
Nedd4 WW
binding protein
4
UBE2D1, 61, 62 M. NM_145420 AI836420
ubiquitin- musculus (MM.32638)
conj ugating
enzyme E2D
I ,
UBC4/5 homolog
(yeast)
NEDD4A, neural63, 64 M NM 010890 U96635 (MM.16553)
precursor musculus
cell
expressed,
developmentally
down-regulated
gene 4a
UBLS, ubiquitin-65, 66 M. NM 025401 AW124386
like 5 musculus (MM.22470)
HERPUD1, 67, 68 M. NM 022331 AI846938
homocysteine- rnusculus (MM.29151 )
inducible,
endoplasmic
reticulum
stress-
inducible,
ubiquitin-like
CA 02449417 2003-12-04
Case 9123M/CA
12
Sequence SEQ ID NO: Species Genbank Related Genbank
description nucleotide, Accession (GB) or Derwent
No. (D)
amino acid for nucleotideAccession Nos.
sequence
domain member
1
AR1H1, ariadne69, 70 M. XM_134935 AJ130977
ubiquitin- musculus (MM.200649)
conjugating NM_005744
enzyme E2 (human) XM 217157
binding protein (rat)
homolog 1
(Drosophila)
UBE2R2, 71, 72 M. NM 026275 AW122823
ubiquitin- musculus (MM.30272)
conjugating
enzyme E2R
2
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 shows real-time quantitative RT-PCR analysis of steady-state mRNA
levels for
USP11 in non-failing and end-stage heart failure tissue samples. Scatter plot
of OCt values of
individual samples in different etiological populations. Solid bar represents
the mean of each
etiological population. NF, non-failing; 1DCM, idiopathic dilated
cardiomyopathy; IsCM,
ischemic cardiomyopathy; Valvular, valvular cardiomyopathy. To determine if
any of the
etiological groups of heart failure samples were different from the non-
failing samples as a group,
a one-way analysis of variance (ANOVA) and a post hoc analysis using
Bonferroni's multiple
comparison tests on OCt values were performed. Results of the statistical
analyses are shown in
the boxes. P values <0.05 were considered significant.
Figure 2 shows real-time quantitative RT-PCR analysis of steady-state mRNA
levels for
USP22 in non-failing and end-stage heart failure tissue samples. Scatter plot
of OCt values of
individual samples in different etiological populations. Solid bar represents
the mean of each
etiological population. NF, non-failing; IDCM, idiopathic dilated
cardiomyopathy; IsCM,
CA 02449417 2003-12-04
Case ~123M1CA
13
ischemic cardiomyopathy; Valvular, valvular cardiomyopathy. To determine if
any of the
etiological groups of heart failure samples were different from the non-
failing samples as a group,
a one-way analysis of variance (ANOVA) and a post hoc analysis using
Bonferroni's multiple
comparison tests on dCt values were performed. Results of the statistical
analyses are shown in
the boxes. P values <0.05 were considered significant.
Figure 3 shows real-time quantitative RT-PCR analysis of steady-state mRNA
levels for
UBE1C in non-failing and end-stage heart failure tissue samples. Scatter plot
of ~Ct values of
individual samples in different etiological populations. Solid bar represents
the mean of each
etiological population. NF, non-failing; )DCM, idiopathic dilated
cardiomyopathy; IsCM,
ischemic cardiomyopathy; Valvular, valvular cardiomyopathy. To determine if
any of the
etiological groups of heart failure samples were different from the non-
failing samples as a group,
a one-way analysis of variance (ANOVA) and a post hoc analysis using
Bonferroni's multiple
comparison tests on OCt values were performed. Results of the statistical
analyses are shown in
the boxes. P values <0.05 were considered significant.
Figure 4 shows real-time quantitative RT-PCR analysis of steady-state mRNA
levels for
UBE2H in non-failing and end-stage heart failure tissue samples. Scatter plot
of ~Ct values of
individual samples in different etiological populations. Solid bar represents
the mean of each
etiological population. NF, non-failing; IDCM, idiopathic dilated
cardiomyopathy; IsCM,
ischemic cardiomyopathy; Valvular, valvular cardiomyopathy. To determine if
any of the
etiological groups of heart failure samples were different from the non-
failing samples as a group,
a one-way analysis of variance (ANOVA) and a post hoc analysis using
Bonferroni's multiple
comparison tests on OCt values were performed. Results of the statistical
analyses are shown in
the boxes. P values <0.05 were considered significant.
Figure 5 shows real-time quantitative RT-PCR analysis of steady-state mRNA
levels for
FBX032 in non-failing and end-stage heart failure tissue samples. Scatter plot
of ~Ct values of
individual samples in different etiological populations. Solid bar represents
the mean of each
etiological population. NF, non-failing; IDCM, idiopathic dilated
cardiomyopathy; IsCM,
ischemic cardiomyopathy; Valvular, valvular cardiomyopathy. To determine if
any of the
etiological groups of heart failure samples were different from the non-
failing samples as a group,
a one-way analysis of variance (ANOVA) and a post hoc analysis using
Bonferroni's multiple
comparison tests on ~Ct values were performed. Results of the statistical
analyses are shown in
the boxes. P values <0.05 were considered significant.
Case 9123M/CA
CA 02449417 2003-12-04
14
Figure 6 shows real-time quantitative RT-PCR analysis of steady-state mRNA
levels for
USP9Y in non-failing and end-stage heart failure tissue samples obtained from
males. Scatter
plot of tlCt values of individual samples in different etiological
populations. Solid bar represents
the mean of each etiological population. NF, non-failing; IDCM, idiopathic
dilated
cardiomyopathy; IsCM, ischemic cardiomyopathy; Valvular, valvular
cardiomyopathy. To
determine if any of the etiological groups of heart failure samples were
different from the non-
failing samples as a group, a one-way analysis of variance (ANOVA) and a post
hoc analysis
using Bonferroni's multiple comparison tests on ACt values were performed.
Results of the
statistical analyses are shown in the boxes. P values <0.05 were considered
significant.
DETAILED DESCRIPTION OF THE INVENTION
Many biological functions are accomplished by altering the expression of
various genes
through transcriptional (e.g. through control of initiation, provision of RNA
precursors, RNA
processing, etc.) and/or translational control. For example, fundamental
biological processes
such as cell cycle, cell differentiation and cell death, are often
characterized by the variations in
the expression levels of groups of genes.
Changes in gene expression also are associated with pathogenesis. For example,
the lack
of sufficient expression of functional tumor suppressor genes and/or the over
expression of
oncogene/protooncogenes could lead to tumorigenesis or hyperplastic growth of
cells (Marshall,
Cell 64:313-326 (1991); Weinberg, Science 254:1138-1146 (1991)). Thus, changes
in the
expression levels of particular genes (e.g., oncogenes or tumor suppressors)
serve as signposts for
the presence and progression of various diseases.
Monitoring changes in gene expression may also provide certain advantages
during
drug screening development. Often drugs are screened for the ability to
interact with a major
target without regard to other effects the drugs have on cells. Often such
other effects cause
toxicity in the whole animal, which prevent the development and use of the
potential drug.
The present inventors have examined left ventricular myocardial tissue samples
from
non-failing hearts with left ventricular myocardial tissue samples from
failing heart tissues as a
result of idiopathic dilated cardiomyopathy (IsCM), ischemic cardiomyopathy,
and valvular
cardiomyopathy to identify the global changes in gene expression during this
pathologic process.
These global changes in gene expression, also referred to as expression
profiles, provide useful
markers for diagnostic uses as well as markers that can be used to monitor
disease states, disease
progression, toxicity, drug efficacy and drug metabolism.
CA 02449417 2003-12-04
Case 9123M/CA
The expression profiles have been used to identify individual genes that are
differentially
expressed under one or more conditions. In addition, the present invention
identifies families of
genes that are differentially expressed. As used herein, "gene families"
includes, but is not
limited to; the specific genes identified by accession numbers herein, as well
as related
sequences. Related sequences may be, for example, sequences having a high
degree of sequence
identity with a specifically identified sequence either at the nucleotide
level or at the level of
amino acids of the encoded polypeptide. A high degree of sequence identity is
seen to be at least
about 65% sequence identity at the nucleotide level to said genes, preferably
about 80 or 85%
sequence identity or more preferably about 90 or 95% or more sequence identity
to said genes.
With regard to amino acid identity of encoded polypeptides, a high degree of
identity is seen to
be at least about 50% identity, more preferably about 75% identity and most
preferably about
85% or more sequence identity. In particular, related sequences include
homologous genes from
different organisms. For example, if the specifically identified gene were
from a non-human
mammal, the gene family would encompass homologous genes from other mammals
including
humans. If the specifically identified gene were a human gene, gene family
would encompass the
homologous gene from different organisms. Those skilled in the art will
appreciate that a
homologous gene may be of different length and may comprise regions with
differing amounts of
sequence identity to a specifically identified sequence.
Assay Formats
The genes and sequences identified as being differentially expressed in
failing as
opposed to non-failing heart tissues as well as related sequences may be used
in a variety of
nucleic acid detection assays to detect or quantititate the expression level
of a gene or multiple
genes in a given sample. For example, traditional Northern blotting, nuclease
protection, RT-
PCR, QPCR (quantitative RT-PCR), Taqman~ and differential display methods may
be used for
detecting gene expression levels. Those methods are useful for some of the
embodiments of the
invention. However, methods and assays of the invention may also be
efficiently designed with
hybridization-based methods for detecting the expression of a large number of
genes.
Any hybridization assay format may be used, including solution-based and solid
support-
based assay formats. Solid supports containing oligonucleotide probes for
differentially
expressed genes of the invention can be filters, polyvinyl chloride dishes,
silicon or glass based
chips, etc. Such supports and hybridization methods are widely available, for
example, those
disclosed by WO 95/11755. Any solid surface to which oligonucleotides can be
bound, either
CA 02449417 2003-12-04
Case 9123M/CA
16
directly or indirectly, either covalently or non-covalently, can be used. A
preferred solid support
is a high density array or DNA chip. These contain a particular
oligonucleotide probe in a
predetermined location on the array. Each predetermined location may contain
more than one
molecule of the probe, but each molecule within the predetermined location has
an identical
sequence. Such predetermined locations are termed features. There may be, for
example, from 2,
10, 100, 1000 to 10,000, 100,000 or 400,000 of such features on a single solid
support. The solid
support, or the area within which the probes are attached may be any
convenient size and may
preferably be on the order of a square centimeter.
Oligonucleotide probe arrays for expression monitoring can be made and used
according
to any techniques known in the art (see for example, Lockhart et al., (1996)
Nat. Biotech. 14,
1675-1680; McGall et al., (1996) Proc. Nat. Acad. Sci. USA 93, 13555-13460).
Such probe
arrays may contain at least two or more oligonucleotides that are
complementary to or hybridize
to two or more of the genes described in Table 1.
The genes which are assayed according to the present invention are typically
in the form
of mRNA or reverse transcribed mRNA. The genes may be cloned or not. The genes
may be
amplified or not. The cloning itself does not appear to bias the
representation of genes within a
population. However, it may be preferable to use polyadenylated RNA as a
source, as it can be
used with less processing steps.
Table 1 provides the Accession numbers and name for the nucleotide and amino
acid
sequences of the differentially expressed markers (SEQ ID NO: 1-12). The
sequences of the
genes in GenBank are expressly incorporated herein.
Probes based on the sequences of the genes described above may be prepared by
any
commonly available method. Oligonucleotide probes for interrogating the tissue
or cell sample
are preferably of sufficient length to specifically hybridize only to
appropriate, complementary
genes or transcripts. Typically the oligonucleotide probes will be at least
10, 12, 14, 16, 18, 20 or
25 nucleotides in length. In some cases longer probes of at least 30, 40 or 50
nucleotides will be
desirable.
As used herein, oligonucleotide sequences that are complementary to one or
more of the
genes and/or gene families described in Table 1, refer to oligonucleotides
that are capable of
hybridizing under stringent conditions to at least part of the nucleotide
sequences of said genes.
Such hybridizable oligonucleotides will typically exhibit at least about 75%
sequence identity at
the nucleotide level to said genes, preferably about 80 or 85% sequence
identity or more
preferably about 90 to 95% or more sequence identity to said genes.
CA 02449417 2003-12-04
Case 0123M/CA
17
"Bind(s) substantially" refers to complementary hybridization between a probe
nucleic
acid and a target nucleic acid and embraces minor mismatches that can be
accommodated by
reducing the stringency of the hybridization media to achieve the desired
detection of the target
polynucleotide sequence.
The terms "background" or "background signal intensity" refer to hybridization
signals
resulting from non-specific binding, or other interactions, between the
labeled target nucleic acids
and components of the oligonucleotide array (e.g., the oligonucleotide probes,
control probes, the
array substrate, etc.). Background signals may also be produced by intrinsic
fluorescence of the
array components themselves. A single background signal can be calculated for
the entire array,
or a different background signal may be calculated for each target nucleic
acid. In a preferred
embodiment, background is calculated as the average hybridization signal
intensity for the lowest
to 10% of the probes in the array, or, where a different background signal is
calculated for each
target gene, for the lowest 5 to 10% of the probes for each gene. Of course,
one of skill in the art
will appreciate that where the probes to a particular gene hybridize well and
thus appear to be
specifically binding to a target sequence, they should not be used in a
background signal
calculation. Alternatively, background may be calculated as the average
hybridization signal
intensity produced by hybridization to probes that are not complementary to
any sequence found
in the sample (e.g., probes directed to nucleic acids of the opposite sense or
to genes not found in
the sample such as bacterial genes where the sample is mammalian nucleic
acids). Background
can also be calculated as the average signal intensity produced by regions of
the array that lack
any probes at all.
The phrase "hybridizing specifically to" refers to the binding, duplexing, or
hybridizing
of a molecule substantially to or only to a particular nucleotide sequence or
sequences under
stringent conditions when that sequence is present in a complex mixture (e.g.,
total cellular) DNA
or RNA.
The terms "mismatch control" or "mismatch probe" refer to a probe whose
sequence is
deliberately selected not to be perfectly complementary to a particular target
sequence. For each
mismatch (MM) control in a high-density array there typically exists a
corresponding perfect
match (PM) probe that is perfectly complementary to the same particular target
sequence. The
mismatch may comprise one or more bases.
While the mismatch(s) may be located anywhere in the mismatch probe, terminal
mismatches are less desirable as a terminal mismatch is less likely to prevent
hybridization of the
target sequence. In a particularly preferred embodiment, the mismatch is
located at or near the
CA 02449417 2003-12-04
Case 9123M/CA
18
center of the probe such that the mismatch is most likely to destabilize the
duplex with the target
sequence under the test hybridization conditions.
The term "perfect match probe" refers to a probe that has a sequence that is
perfectly
complementary to a particular target sequence. The test probe is typically
perfectly
complementary to a portion (subsequence) of the target sequence. The perfect
match (PM) probe
can be a "test probe" or a "normalization control" probe, an expression level
control probe and
the like. A perfect match control or perfect match probe is, however,
distinguished from a
"mismatch control" or "mismatch probe" as defined herein.
As used herein a "probe" is defined as a nucleic acid, capable of binding to a
target
nucleic acid of complementary sequence through one or more types of chemical
bonds, usually
through complementary base pairing, usually through hydrogen bond formation.
As used herein,
a probe may include natural (i.e., A, G, U, C or T) or modified bases (7-
deazaguanosine, inosine,
etc.). In addition, the bases in probes may be joined by a linkage other than
a phosphodiester
bond, so long as it does not interfere with hybridization. Thus, probes may be
peptide nucleic
acids in which the constituent bases are joined by peptide bonds rather than
phosphodiester
linkages.
Hybridization
Nucleic acid hybridization simply involves contacting a probe and target
nucleic acid
under conditions where the probe and its complementary target can form stable
hybrid duplexes
through complementary base pairing (see WO 99/32660). The nucleic acids that
do not form
hybrid duplexes are then washed away leaving the hybridized nucleic acids to
be detected,
typically through detection of an attached detectable label. It is generally
recognized that nucleic
acids are denatured by increasing the temperature or decreasing the salt
concentration of the
buffer containing the nucleic acids. Under low stringency conditions (e.g.,
low temperature
and/or high salt) hybrid duplexes (e.g., DNA:DNA, RNA:RNA or RNA:DNA) will
form even
where the annealed sequences are not perfectly complementary. Thus specificity
of hybridization
is reduced at lower stringency. Conversely, at higher stringency (e.g., higher
temperature and/or
lower salt and/or in the presence of destabilizing reagents) successful
hybridization tolerates
fewer mismatches. One of skill in the art will appreciate that hybridization
conditions may be
selected to provide any degree of stringency. In a preferred embodiment,
hybridization is
performed at low stringency in this case in 6x SSPE-T at 37°C (0.005%
Triton x-100) to ensure
hybridization and then subsequent washes are performed at higher stringency
(e.g., 1 X SSPE-T at
CA 02449417 2003-12-04
Case 3123M/CA
19
37°C) to eliminate mismatched hybrid duplexes. Successive washes may be
performed at
increasingly higher stringency (e.g., down to as low as 0.25X SSPET at
37°C to 50°C) until a
desired level of hybridization specificity is obtained. Stringency can also be
increased by
addition of destabilizing agents such as formamide. Hybridization specificity
may be evaluated
by comparison of hybridization to the test probes with hybridization to the
various controls that
can be present (e.g., expression level control, normalization control,
mismatch controls, etc.).
In general, there is a trade-off between hybridization specificity
(stringency) and signal
intensity. Thus, in a preferred embodiment, the wash is performed at the
highest stringency that
produces consistent results and that provides a signal intensity greater than
approximately 10% of
the background intensity. Thus, in a preferred embodiment, the hybridized
array may be washed
at successively higher stringency solutions and read between each wash.
Analysis of the data sets
thus produced will reveal a wash stringency above which the hybridization
pattern is not
appreciably altered and which provides adequate signal for the particular
oligonucleotide probes
of interest.
Signal Detection
The hybridized nucleic acids are typically detected by detecting one or more
labels
attached to the sample nucleic acids. The labels may be incorporated by any of
a number of
means well known to those of skill in the art (see WO 99/32660). The label
could be a radiolabel
like 32P; a fluorescent label like fluorescein; or an enzyme-substrate label
pair, like biotin
followed by detection with straptavidin-horse radish peroxidase.
Data Analysis
The "percentage of sequence identity" or "sequence identity" is determined by
comparing two optimally aligned sequences or subsequences over a comparison
window or span,
wherein the portion of the polynucleotide sequence in the comparison window
may optionally
comprise additions or deletions (i.e., gaps) as compared to the reference
sequence (which does
not comprise additions or deletions) for optimal alignment of the two
sequences. The percentage
is calculated by determining the number of positions at which the identical
residue (e.g., nucleic
acid base or amino acid residue) occurs in both sequences to yield the number
of matched
positions, dividing the number of matched positions by the total number of
positions in the
window of comparison and multiplying the result by 100 to yield the percentage
of sequence
identity.
Case 9123M/CA
CA 02449417 2003-12-04
Percentage sequence identity can be calculated by the local homology algorithm
of Smith
& Waterman, Adv. Appl. Math. 2:482-485 (1981); by the homology alignment
algorithm of
Needleman & Wunsch, J. Mol. Biol. 48:443-445 (1970); or by computerized
implementations of
these algorithms (GAP & BESTFIT in the GCG Wisconsin Software Package,
Genetics
Computer Group) or by manual alignment and visual inspection.
Homology or sequence identity is determined by BLAST (Basic Local Alignment
Search
Tool) analysis using the algorithm employed by the programs blastp, blastn,
blastx, tblastn and
tblastx (Karlin et al. (1990) Proc. Natl. Acad. Sci. USA 87, 2264-2268 and
Altschul, (1993) J.
Mol. Evol. 36, 290-300, fully incorporated by reference), which are tailored
for sequence
similarity searching. The approach used by the BLAST program is to first
consider similar
segments between a query sequence and a database sequence, then to evaluate
the statistical
significance of all matches that are identified and finally to summarize only
those matches which
satisfy a preselected threshold of significance. For a discussion of basic
issues in similarity
searching of sequence databases, see Altschul et al. (1994) (Nat. Genet. 6,
119-129) which is
fully incorporated by reference. The search parameters for histogram,
descriptions,
alignments, expect (i.e., the statistical significance threshold for reporting
matches against
database sequences), cutoff, matrix and filter are at the default settings.
The default-scoring
matrix used by blastp, blastx, tblastn, and tblastx is the BLOSUM62 matrix
(Henikoff et al.
(1992) Proc. Natl. Acad. Sci. USA 89, 10915-10919).
Nucleic Acid Samples
As is apparent to one of ordinary skill in the art, nucleic acid samples,
which may be
DNA andlor RNA, used in the methods and assays of the invention may be
prepared by any
available method or process. Methods of isolating total mRNA are well known to
those of skill
in the art. For example, methods of isolation and purification of nucleic
acids are described in
detail in Chapter 3 of Tijssen, (1993) Laboratory Techniques in Biochemistry
and Molecular
Biology: Hybridization With Nucleic Acid Probes, Elsevier Press. Such samples
include RNA
samples, but also include cDNA synthesized from an mRNA sample isolated from a
cell or tissue
of interest. Such samples also include DNA amplified from the cDNA, and RNA
transcribed
from the amplified DNA. One of skill in the art would appreciate that it is
desirable to inhibit or
destroy RNase present in homogenates before homogenates can be used.
Biological samples may be of any biological tissue or fluid or cells from any
organism as
well as cells raised in vitro, such as cell lines and tissue culture cells.
Frequently, the sample will
Case 9123M/CA
CA 02449417 2003-12-04
21
be a "clinical sample" which is a sample derived from a patient. Typical
clinical samples include,
but are not limited to, sputum, blood, blood-cells (e.g., white cells),
various tissues or organs or
parts thereof, or fine needle biopsy samples, urine, peritoneal fluid, and
pleural fluid, or cells
therefrom.
Biological samples may also include sections of tissues, such as frozen
sections or
formalin fixed sections taken for histological purposes.
Databases
The present invention includes relational databases containing sequence
information, for
instance, for the genes and members of the gene families of Table 1 as well as
gene expression
information in various tissue samples. Databases may also contain information
associated with a
given sequence or tissue sample such as descriptive information about the gene
associated with
the sequence information, or descriptive information concerning the clinical
status of the tissue
sample, or the patient from which the sample was derived. The database may be
designed to
include different parts, for instance a sequence database and a gene
expression database.
Methods for the configuration and construction of such databases are widely
available; for
instance, see U.S. Patent 5,953,727, which is herein incorporated by reference
in its entirety.
The databases of the invention may be linked to an outside or external
database. In a
preferred embodiment, the external database is GenBank and the associated
databases maintained
by the National Center for Biotechnology Information (NCBI).
Any appropriate computer platform may be used to perform the necessary
comparisons
between sequence information, gene expression information and any other
information in the
database or provided as an input. For example, a large number of computer
workstations are
available from a variety of manufacturers; such as those available from
Silicon Graphics.
Clientlserver environments, database servers and networks are also widely
available and
appropriate platforms for the databases of the invention.
The databases of the invention may be used to produce, among other things,
electronic
Northern blots that allow the user to determine the cell type or tissue in
which a given gene is
expressed and to allow determination of the abundance or expression level of a
given gene in a
particular tissue or cell.
The databases of the invention may also be used to present information
identifying the
expression level in a sample of a set of genes comprising one or more of the
sequences of genes
or members of the gene families of Table 1, comprising comparing the
expression level of at least
CA 02449417 2003-12-04
Case 0123M/CA
22
one gene or member of a gene family of Table 1 in the sample to the level of
expression of the
gene in the database. Such methods may be used to predict the state of the
disease, progress of
the disease, and probable outcome of drug or gene therapy and such. Such
methods may also be
used in the drug or agent screening assays as described below.
Isolation of Other Related Nucleic Acid Molecules
As described above, the identification of the human nucleic acid molecules of
table 1
allows a skilled artisan to isolate nucleic acid molecules that encode other
members of the gene
family in addition to the human sequences herein described. Further, the
presently disclosed
nucleic acid molecules allow a skilled artisan to isolate nucleic acid
molecules that encode other
members of the family of genes.
Essentially, a skilled artisan can readily use the amino acid sequences of
Table 1 or
epitope-containing fragments thereof to generate antibody probes to screen
expression libraries
prepared from appropriate cells. 1n a preferred embodiment, the epitope
containing fragments
will contain the amino acid insertion and substitution described herein.
Typically, polyclonal
antiserum from mammals such as rabbits immunized with the purified protein (as
described
below) or monoclonal antibodies can be used to probe a mammalian cDNA or
genomic
expression library, such as lambda gtll library, to obtain the appropriate
coding sequence for
other members of the protein family. The cloned cDNA sequence can be expressed
as a fusion
protein, expressed directly using its own control sequences, or expressed by
constructions using
control sequences appropriate to the particular host used for expression of
the enzyme.
Alternatively, a portion of coding sequences herein described can be
synthesized and
used as a probe to retrieve DNA encoding a member of the protein family from
any mammalian
organism. Oligomers containing e.g., approximately 18-20 nucleotides can be
prepared and used
to screen genomic DNA or cDNA libraries to obtain hybridization under
stringent conditions or
conditions of sufficient stringency to eliminate an undue level of false
positives.
Additionally, pairs of oligonucleotide primers can be prepared for use in a
polymerase
chain reaction (PCR) to selectively clone an encoding nucleic acid molecule. A
PCR
denature/anneal/extend cycle for using such PCR primers is well known in the
art and can readily
be adapted for use in isolating other encoding nucleic acid molecules.
CA 02449417 2003-12-04
Case 3123M/CA
23
Recombinant DNA Molecules
The present invention further provides recombinant DNA molecules (rDNA) that
contain
a coding sequence of or a variant form of the sequences of Table 1. As used
herein, an rDNA
molecule is a DNA molecule that has been subjected to molecular manipulation.
Methods for
generating rDNA molecules are well known in the art, for example, see Sambrook
et al. ( 1989)
Molecular Cloning - A Laboratory Manual, Cold Spring Harbor Laboratory Press.
In the
preferred rDNA molecules, a coding DNA sequence is operably linked to
expression control
sequences and/or vector sequences.
The choice of vector and expression control sequences to which one of the
protein family
encoding sequences of the present invention is operably linked depends
directly, as is well known
in the art, on the functional properties desired (e.g., protein expression,
and the host cell to be
transformed). A vector of the present invention may be capable of directing
the replication or
insertion into the host chromosome, and preferably also expression, of the
structural gene
included in the rDNA molecule.
Expression control elements that are used for regulating the expression of an
operably
linked protein encoding sequence are known in the art and include, but are not
limited to,
inducible promoters, constitutive promoters, secretion signals, and other
regulatory elements.
Preferably, the inducible promoter is readily controlled, such as being
responsive to a nutrient in
the host cell's medium.
In one embodiment, the vector containing a coding nucleic acid molecule will
include a
prokaryotic replicon, i.e., a DNA sequence having the ability to direct
autonomous replication
and maintenance of the recombinant DNA molecule extra-chromosomally in a
prokaryotic host
cell, such as a bacterial host cell, transformed therewith. Such replicons are
well known in the
art. In addition, vectors that include a prokaryotic replicon may also include
a gene whose
expression confers a detectable marker (e.g. resistance to ampicillin).
Vectors that include a prokaryotic replicon can further include a prokaryotic
or
bacteriophage promoter capable of directing the expression (transcription and
translation) of the
coding gene sequences in a bacterial host cell, such as E. coli. A promoter is
an expression
control element formed by a DNA sequence that permits binding of RNA
polymerase and
transcription to occur. Promoter sequences compatible with bacterial hosts are
typically provided
in plasmid vectors containing convenient restriction sites for insertion of a
DNA segment of the
present invention. Examples of such vector plasmids are pUCB, pUC9, pBR322 and
pBR329
CA 02449417 2003-12-04
Case 9123M/CA
24
(BioRad Laboratories), pPL and pKK223 (Pharmacia). Any suitable prokaryotic
host can be
used to express an rDNA molecule encoding a protein of the invention.
Expression vectors compatible with eukaryotic cells, preferably those
compatible with
vertebrate cells, can also be used to form an rDNA molecule that contains a
coding sequence.
Eukaryotic cell expression vectors are well known in the art and are available
from several
commercial sources. Typically, such vectors are provided containing convenient
restriction sites
for insertion of the desired DNA segment.
Eukaryotic cell expression vectors used to construct the rDNA molecules of the
present
invention may further include a selectable marker that is effective in a
eukaryotic cell, preferably
a drug resistance selection marker. A preferred drug resistance marker is the
gene whose
expression results in neomycin resistance, i.e., the neomycin
phosphotransferase (neo) gene.
(Southern et al. (1982) J. Mol. Anal. Genet. 1, 327-341). Alternatively, the
selectable marker can
be present on a separate plasmid, the two vectors introduced by co-
transfection of the host cell,
and transfectants selected by culturing in the appropriate drug for the
selectable marker.
Host Cells Exuressing Nucleic Acid Molecule
The present invention further provides host cells transformed with a nucleic
acid
molecule that encode sequences listed in Table 1 or their variants. The host
cell can be either
prokaryotic or eukaryotic. Eukaryotic cells useful for expression of a protein
of the invention are
not limited, so long as the cell line is compatible with cell culture methods
and compatible with
the propagation of the expression vector and expression of the gene product.
Preferred
eukaryotic host cells include, but are not limited to, yeast, insect and
mammalian cells, preferably
vertebrate cells such as those from a mouse, rat, monkey or human cell line.
Preferred eukaryotic
host cells include Chinese hamster ovary (CHO) cells available from the ATCC
as CCL61, N1H
Swiss mouse embryo cells N1H-3T3 available from the ATCC as CRL1658, baby
hamster kidney
cells (BHK), and the like eukaryotic tissue culture cell lines.
Transformation of appropriate cell hosts with an rDNA molecule of the present
invention
is accomplished by well-known methods that typically depend on the type of
vector used and host
system employed. With regard to transformation of prokaryotic host cells,
electroporation and
salt treatment methods can be employed (see, for example, Sambrook et al.
(1989) Molecular
Cloning - A Laboratory Manual, Cold Spring Harbor Laboratory Press; Cohen et
al. (1972) Proc.
Natl. Acad. Sci. USA 69, 2110-2114). With regard to transformation of
vertebrate cells with
vectors containing rDNA, electroporation, cationic lipid or salt treatment
methods can be
Case 9123M/CA
CA 02449417 2003-12-04
employed (see, for example, Graham et al. (1973) Virology 52, 456-467; Wigler
et al. (1979)
Proc. Natl. Acad. Sci. USA 76, 1373-1376).
Successfully transformed cells, i.e., cells that contain an rDNA molecule of
the present
invention, can be identified by well known techniques including the selection
for a selectable
marker. For example, cells resulting from the introduction of an rDNA of the
present invention
can be cloned to produce single colonies. Cells from those colonies can be
harvested, lysed and
their DNA content examined for the presence of the rDNA using a method such as
that described
by Southern, (1975) J. Mol. Biol. 98, 503-517 or the proteins produced from
the cell assayed via
an immunological method.
Methods to Identify Binding Partners
The present invention provides methods for use in isolating and identifying
binding
partners of proteins of the invention. In some embodiments, a protein of the
invention is mixed
with a potential binding partner or an extract of a cell under conditions that
allow the association
of potential binding partners with the protein of the invention. After mixing,
peptides,
polypeptides, proteins, or other molecules that have become associated with a
protein of the
invention are separated from the mixture. The binding partner bound to the
protein of the
invention can then be removed and further analyzed. To identify and isolate a
binding partner,
the entire protein can be used. Alternatively, a fragment of the protein can
be used.
As used herein, a cellular extract refers to a preparation or fraction which
is made from a
lysed or disrupted cell. The preferred source of cellular extracts will be
cells derived from human
heart tissue
A variety of methods can be used to obtain an extract of a cell. Cells can be
disrupted
using either physical or chemical disruption methods. Examples of physical
disruption methods
include, but are not limited to, sonication and mechanical shearing. Examples
of chemical lysis
methods include, but are not limited to, detergent lysis and enzyme lysis. A
skilled artisan can
readily adapt methods for preparing cellular extracts in order to obtain
extracts for use in the
present methods.
Once an extract of a cell is prepared, the extract is mixed with the protein
of the invention
under conditions in which association of the protein with the binding parfier
can occur. A
variety of conditions can be used; the most preferred being conditions that
closely resemble
conditions found in the cytoplasm of a human cell. Parameters such as
osmolarity, pH,
CA 02449417 2003-12-04
Case 9123M/CA
26
temperature, and the concentration of cellular extract used, can be varied to
optimize the
association of the protein with the binding partner.
After mixing under appropriate conditions, the bound complex is separated from
the
mixture using a variety of techniques. For example, antibodies specific to a
protein of the
invention can be used to immunoprecipitate the binding partner complex.
Alternatively, standard
chemical separation techniques such as chromatography and density-gradient
centrifugation can
be used.
Alternatively, the nucleic acid molecule of the invention can be used in a
yeast two-
hybrid system. The yeast two-hybrid system has been used to identify other
protein partner pairs
and can readily be adapted to employ the nucleic acid molecules herein
described (see Stratagene
Hybrizap two-hybrid system).
Methods to Identify Agents that Modulate Expression
According to the present invention, the genes identified in Table 1 may be
used to
evaluate the effects of a candidate drug or agent. A candidate drug or agent
can be screened for
the ability to either stimulate or down-regulate the transcription or
expression of a given marker
or markers. For instance, agents that modulate gene expression in a sample to
that which
resembles a gene expression profile in a failing heart may be screened for the
ability to regulate
ubiquitinylation. According to the present invention, one can also compare the
specificity of a
drug effect by looking at the number of markers which the drug has and
comparing them. More
specific drugs will have less transcriptional targets. Similar sets of markers
identified for two
drugs may indicate a similarity of effects.
Assays to monitor the expression of a marker gene or genes as defined in Table
1 may
utilize any available means of monitoring for changes in the expression level
of the nucleic acids
of the invention. As used herein, an agent is said to modulate the expression
of a nucleic acid of
the invention if it is capable of up- or down-regulating expression of the
nucleic acid in a cell or a
tissue.
In one assay format, gene chips containing probes to one or more genes or
members of a
gene family from Table 1 may be used to directly monitor or detect changes in
gene expression in
the treated or exposed cell as described in more detail above. In another
format, cell lines that
contain reporter gene fusions between the open reading frame andlor 5'-~3'
regulatory regions of
a gene or member of a gene family in Table 1 and any assayable fusion partner
may be prepared.
Numerous assayable fusion partners are known and readily available including
the firefly
CA 02449417 2003-12-04
Case 3123M/CA
27
luciferase gene and the gene encoding chloramphenicol acetyltransferase (Alam
et al., Anal.
Biochem. 188:245-254 (1990)). Cell lines containing the reporter gene fusions
are then exposed
to the agent to be tested under appropriate conditions and time. Differential
expression of the
reporter gene between samples exposed to the agent and control samples
identifies agents which
modulate the expression of the nucleic acid.
Additional assay formats may be used to monitor the ability of the agent to
modulate the
expression of a gene or member of a gene family identified in Table 1. For
instance, as described
above, mRNA expression may be monitored directly by hybridization of probes to
the nucleic
acids of the invention. Cell lines are exposed to the agent to be tested under
appropriate
conditions and time and total RNA or mRNA is isolated by standard procedures
such those
disclosed in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold
Spring Harbor
Laboratory Press (1989).
In another assay format, cells or cell lines are first identified which
express the gene
products of the invention physiologically. Cells and/or cell lines so
identified would be expected
to comprise the necessary cellular machinery such that the fidelity of
modulation of the
transcriptional apparatus is maintained with regard to exogenous contact of
agent with
appropriate surface transduction mechanisms and/or the cytosolic cascades.
Further, such cells
or cell lines may be transduced or transfected with an expression (e.g., a
plasmid or viral vector)
construct comprising an operable non-translated 5'-promoter containing end of
the structural
gene encoding the instant gene products fused to one or more antigenic
fragments, which are
peculiar to the instant gene products, wherein said fragments are under the
transcriptional control
of said promoter and are expressed as polypeptides whose molecular weight can
be distinguished
from the naturally occurring polypeptides or may further comprise an
immunologically distinct
tag or some other detectable marker or tag. Such a process is well known in
the art (see
Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor
Laboratory
Press (1989)).
Cells or cell lines transduced or transfected as outlined above are then
contacted with
agents under appropriate conditions; for example, the agent comprises a
pharmaceutically
acceptable excipient and is contacted with cells comprised in an aqueous
physiological buffer
such as phosphate buffered saline (PBS) at physiological pH, Eagles balanced
salt solution (BSS)
at physiological pH, PBS or BSS comprising serum or conditioned media
comprising PBS or
BSS and/or serum incubated at 37°C. Said conditions may be modulated as
deemed necessary by
one of skill in the art. Subsequent to contacting the cells with the agent,
said cells are disrupted
CA 02449417 2003-12-04
Case 9123M/CA
28
and the polypeptides of the lysate are fractionated such that a polypeptide
fraction is pooled and
contacted with an antibody to be further processed by immunological assay
(e.g., ELISA,
immunoprecipitation or Western blot). The pool of proteins isolated from the
"agent-contacted"
sample is then compared with a control sample where only the excipient is
contacted with the
cells and an increase or decrease in the immunologically generated signal from
the "agent-
contacted" sample compared to the control is used to distinguish the
effectiveness of the agent.
Methods to Identify Agents that Modulate Activity
The present invention provides methods for identifying agents that modulate at
least one
activity of any of the sequences of Table 1. Such methods or assays may
utilize any means of
monitoring or detecting the desired activity.
In one format, cell lines or populations are exposed to the agent to be tested
under
appropriate conditions and time. In this format, probes such as specific
antibodies are used to
monitor the differential expression of the protein in the different cell
populations. Cellular
lysates may be prepared from the exposed cell line or population and a
control, unexposed cell
line or population. The cellular lysates are then analyzed with the probe.
Antibody probes can be prepared by immunizing suitable mammalian hosts
utilizing
appropriate immunization protocols using the peptides, polypeptides, or
protein of the invention
or antigen-containing fragments of any of the foregoing. To enhance
immunogenicity, these
peptides, polypeptides, proteins, or fragments thereof may be conjugated to
suitable carriers.
Methods for preparing immunogenic conjugates with carriers such as BSA, KLH,
or other carrier
proteins are well known in the art. In some circumstances, direct conjugation
using, for example,
carbodiimide reagents may be effective; in other instances linking reagents
such as those supplied
by Pierce Chemical Co. may be desirable to provide accessibility to the
hapten. The hapten
peptides can be extended at either the amino or carboxy terminus with a
cysteine residue or
interspersed with cysteine residues, for example, to facilitate linking to a
carrier. Administration
of the immunogens is conducted generally by injection over a suitable time
period and with use
of suitable adjuvants, as is generally understood in the art. During the
immunization schedule,
titers of antibodies are taken to determine adequacy of antibody formation.
While the polyclonal antisera produced in this way may be satisfactory for
some
applications, for pharmaceutical compositions use of monoclonal preparations
is preferred.
Immortalized cell lines which secrete the desired monoclonal antibodies may be
prepared using
standard methods (see, e.g., Kohler & Milstein, (1992) Biotechnology 24, 524-
526) or
CA 02449417 2003-12-04
Case 9123M/CA
29
modifications which effect immortalization of lymphocytes or spleen cells, as
is generally known.
The immortalized cell lines secreting the desired antibodies can be screened
by immunoassay in
which the antigen is the peptide hapten, polypeptide, or protein. When the
appropriate
immortalized cell culture secreting the desired antibody is identified, the
cells can be cultured
either in vitro or by production in ascites fluid.
The desired monoclonal antibodies may be recovered from the culture
supernatant or
from the ascites supernatant. Fragments of the monoclonal or the polyclonal
antisera which
contain the immunologically significant portion can be used as antagonists, as
well as the intact
antibodies. Use of immunologically reactive fragments, such as the Fab, Fab'
or F(ab')z is often
preferable, especially in a therapeutic context, as these fragments are
generally less immunogenic
than the whole immunoglobulin.
The antibodies or fragments may also be produced, using current technology, by
recombinant means. Antibody regions that bind specifically to the desired
regions of the protein
can also be produced in the context of chimeras with multiple species origin.
Agents that are assayed in the above method can be randomly selected or
rationally
selected or designed. As used herein, an agent is said to be randomly selected
when the agent is
chosen randomly without considering the specific sequences involved in the
association of the
protein of the invention alone or with its associated substrates, binding
partners, etc. An example
of randomly selected agents is the use a chemical library or a peptide
combinatorial library, or a
growth broth of an organism.
The agents of the present invention can be, as examples, peptides, peptide
mimetics,
antibodies, antibody fragments, small molecules, vitamin derivatives, as well
as carbohydrates.
Dominant negative proteins, DNA encoding these proteins, antibodies to these
proteins, peptide
fragments of these proteins or mimics of these proteins may be introduced into
cells to affect
function. "Mimic" as used herein refers to the modification of a region or
several regions of a
peptide molecule to provide a structure chemically different from the parent
peptide but
topographically and functionally similar to the parent peptide (see Meyers,
Molecular Biology
and Biotechnology, VCH Publishers, 659-664 ( 1995)). A skilled artisan can
readily recognize
that there is no limit as to the structural nature of the agents of the
present invention. A skilled
artisan can readily recognize that there is no limit as to the structural
nature of the agents of the
presentinvention.
Diagnostic Uses
CA 02449417 2003-12-04
Case 9123M/CA
As described above, the genes and gene expression information provided in
Table 1 may
be used as diagnostic markers for the prediction or identification of the
disease state of a sample
tissue. For instance, a tissue sample may be assayed by any of the methods
described above, and
the expression levels for a gene or member of a gene family from Table 1 may
be compared to
the expression levels found in non-failing heart. The expression level may
also be compared to
the expression levels observed in sample tissues exhibiting a particular
cardiomyopathy, which
may aid in its diagnosis. The comparison of expression data, as well as
available sequence or
other information may be done by researcher or diagnostician or may be done
with the aid of a
computer and databases as described above. Such methods may be used to
diagnose or identify
conditions characterized by abnormal expression of the genes that are
described in Table 1.
Those skilled in the art will appreciate that a wide variety of conditions are
associated
with abnormal ubiquitinylation or ubiquitin degradation. Ubiquitinylation
affects a diverse group
of proteins such as tumor suppressors (von Hippel Lindau), transcription
factors and ion channels
(Glickman and Ciechanover, 2002, Kondo and Kaelin, 2001, Ciechanover et al.,
2000).
Consequently, ubiquitinylation is involved in several cellular processes
including cell cycle
regulation, differentiation, and cellular homeostasis. Therefore, it is to be
expected that specific
pathologies are the manifestation of an inappropriately regulated
ubiquitinylation process. In
addition to the possibilities of cardiomyopathies, these include: muscle
wasting and modulation
of inflammation, proliferative diseases such as hemangioblastomas, clear cell
renal carcinomas,
cervical cancer and pheochromocytoma. Neurodegenerative diseases such as
Parkinson's and
Alzheimer's (Chung et al., 2001, Layfield et al., 2001) also have been linked
to dysfunction of
the ubiquitinylation pathway, and inappropriate turnover of the sodium channel
has been
identified in Liddle syndrome, an autosomal dominant form of hypertension (Vu
and Sakamoto,
2000). The methods of the present invention will be particularly useful in
diagnosing or
monitoring the treatment of these conditions. Agents which modulate the
expression of one or
more the genes or gene families identified in Table 1 and/or modulate the
activity of one or more
of the proteins encoded by one or more of the genes or members of a gene
family identified in
Table 1 will be useful in treatment of these disorders.
In some preferred embodiments, the present invention may be used to diagnose
and/or
monitor the treatment of drug-induced abnormalities in ubiquitinylation, e.g.
cardiomyopathies,
inflammation, Alzheimer's disease, etc.
Other embodiments of the present invention allow the diagnosis and/or
monitoring of the
treatment of other conditions that involve ubiquitinylation.
CA 02449417 2003-12-04
Case 9123M/CA
31
The present invention will be particularly useful by providing one or more
markers that
may be used as markers of abnormal ubiquitinylation to determine state and
progress of disorders
and diseases that involve ubiquitinylation as described above.
F1TAMP1.FC
Example 1 Total RNA Isolation from Explanted Hearts
Left ventricular myocardial tissue samples were obtained from 134 patients
with severe
end-stage heart failure at the time of orthotopic cardiac transplantation.
Heart failure was
secondary to ischemic (n=62), idiopathic (n=62), or valvular (n=10)
cardiomyopathy. In
addition, left ventricular myocardium was obtained from 14 non-failing hearts
not used for
transplantation. Hearts received cold, blood-containing, high potassium
cardioplegic solution in
vivo and the explanted hearts were immediately transferred to the laboratory
as previously
described (Dipla K, Mattielo JA, Jeevanandam V, Houser SR, Margulies KB.
Myocyte recovery
after mechanical circulatory support in humans with end-stage heart failure.
Circulation. 1998;
97:2316-2322.). Full thickness transmural sections of left ventricular free-
wall were excised,
placed in cryogenic vials, flash frozen in liquid nitrogen, and stored at -
80° C. Total RNA
isolation was performed from 0.5 - 1.5 g of tissue with the Large Scale Rapid
Total RNA
Isolation kit and PLGIII heavy phase lock gel tubes (Eppendorf/SPrime -3Prime,
Boulder, CO)
according to the manufacturers instructions except that RNA was resuspended in
a suitable
volume of lx RNA Secure (Ambion, Austin, TX) instead of RNAse free water.
An additional 16 total RNA samples from individual non-failing human left
ventricles
were purchased from commercial vendors. Another total RNA sample from whole
human non-
failing heart was purchased from Clontech (Palo Alto, CA). This lot is a pool
of RNA from eight
Caucasian males and females, ages 25 - 73, and was used only as an internal
control for
quantitative RT-PCR assays as well as for assessment of primer efficiencies.
All O.D. 260/280 ratios were > 1.9 and approximately 1 ~tg of each RNA sample
was
analyzed by agarose gel electrophoresis for confirmation of intact 18S and 28S
ribosomal RNA
bands. We further verified that any DNA contamination, if present, does not
significantly
contribute to the Ct values obtained by RT-PCR.
Primer Optimization and RT-PCR AmplificationPrimers and probes (Table 2) were
designed
using Primer Express software and were purchased from PE Applied Biosystems
(Foster City,
CA). Primers and probe for the reference gene, GAPDH, were purchased from PE
Applied
Case 9123M/CA
CA 02449417 2003-12-04
32
Biosystems. Probes for target and reference genes were labeled on the 5' end
with 6-carboxy-
fluorescein (FAM), and on the 3' end with the quencher dye 6-carboxy-
tetramethyl-rhodamine
(TAMRA). Where possible, primers and probes were designed to flank or cross
exon-exon
boundaries. The 7700 ABI Sequence Detector, TaqMan EZ RT-PCR core reagents, 96
well
Optical plates and Optical caps were also purchased from PE Applied
Biosystems.
TABLE 2. Primer and Probe Sequences
ene onward Primer everse Primer aqMan Probe
SP11 GT GGC ACT ACT CGT TGG TAG AAG CT AGA TCG AGT
TTG CCA
TG ACA A (SEQ GG ACA TAG G GG CAG C (SEQ
ID NO: ID NO:
13) SEQ ID NO: 14) 15)
GC GGT TGC CAT GG ACA CAT ACG AT CTC AAA CGA
AGC TTT
A (SEQ ID NO: GG TGA TC (SEQ GAA CAC TCA GC
16) ID (SEQ
SP22 O: 17) NO: 18)
GA GGA GCC AAT CT CCA ATG ACT CA CTG GAG ACT
GGG
GC (SEQ )D NO: GA ACT TTA CAT G GTC G (SEQ ID
19) NO:
E1C (SEQ ID NO: 20) 21)
CGG ACG TGG TCA GCC TTC ATA TGG TA CGA TCC TGG
GAG
GC T (SEQ D? NO: GT TCC TT (SEQ GAC TTA ATG (SEQ
22) ID ID
BE2H O: 23) O: 24)
GT CCG GCT GTT CA AGG ACT TTC
GGA
SEQ ID NO: 25) GT ACC ACT T CT GAG TGG CAT
(SEQ CGC
BX032 NO: 26) CA (SEQ >D NO:
27)
GG GCC AGG TTC AG TTG CTA CGG AT CTC TTC CAA
TTG CAG
T (SEQ ID NO: AAT TCT CAT (SEQC CAG ACT TCA
28) (SEQ
SP9Y ID NO: 29) ID NO: 30)
Primer and probe combinations were optimized for multiplex, quantitative RT-
PCR
analysis by amplification of each target sequence alone and in combination
with the reference
gene GAPDH from triplicate samples of 250, 50, 10, 2, and 0.4 ng of Clontech
whole heart total
RNA. Reaction volumes totaled 20 p1 and included S p1 of RNA and TaqMan
primers and
probes specific for the target (300 nM and 150 nM, respectively). The EZ-RT
kit was used for all
other components of the reaction and amounts included were as suggested by PE
Applied
CA 02449417 2003-12-04
Case 9123M/CA
33
Biosystems in the EZ-RT instruction manual. RNA and reaction components were
added to
individual wells of a 96 well plate and placed in an ABI 7700 Sequence
Detector. All reactions
were incubated for 2 min at 50°C, 30 min at 60°C and 5 min at
95°C, followed by 40 cycles of
20 sec at 94°C and 1 min at 62°C.
After ampliftcation, the efficiency of each primer-probe combination was
determined by
preparing a plot of Ct values on the y-axis and the log values of the number
of nanograms of
input RNA on the x-axis. Primer efficiency was calculated by substituting the
slope (m) of the
line into the equation 10'x-'° -1 x 100. Primer-probe combinations were
considered acceptable if
the reaction efficiency was > 80% for both target and reference genes.
Data AnalysisThe Ct value is defined as the fractional cycle number at which
fluorescence
resulting from amplification reaches a threshold level that was set at 10
standard deviations above
the baseline fluorescence detected between cycles 3 and 15. Therefore, a lower
Ct value
indicates greater relative initial template abundance. Delta Ct values (Ct
target gene - Ct GAPDH
reference gene) were calculated for each for each sample from the average of
triplicate samples.
To determine if any of the etiological groups of heart failure samples were
different from the
non-failing samples as a group, we performed a one-way analysis of variance
(ANOVA) and a
post hoc analysis using Bonferroni's multiple comparison tests on ACt values.
Data are reported
as the change in mean OCt value (AOCt) of the diseased groups compared to the
mean for the
group of non-failing samples. P values < 0.05 were considered significant. The
fold change from
one group to another can then be determined by calculating 2-
°°~'. Statistically significant
changes in the expression of ubiquitin pathway related genes in end-stage
human heart failure are
shown in Table 3.
Change in
Gene Expression
(expressed
as fold
change)
ene DCM versus sCM versus alvular versus
on-Failing Non- on-Failing DCM versus
ailing IsCM
SP11 1.40 1.38 1.18
SP22 1.39 1.29 1.39
BE1C 1.37 1.36 1.39
BE2H 1.46 1.33
BX032 1.69 1.48
SP9Y 1.57 ~ 1.56
~
CA 02449417 2003-12-04
Case 9123M/CA
34
Example 2 Rat Model of Heart Failure
The rat aorta-vena cava fistula induced volume overload is an established
model of
eccentric remodeling in which dilation of the left ventricle (LV) occurs with
a decrease in the
ratio of wall thickness to chamber dimension. Myocyte lengthening (sarcomere
addition in
series) and muscle fiber thinning are associated with LV remodeling. As
reported by Brower and
Janicki (2001, Brower et al., 1996), some animals develop overt signs of
congestive heart failure
(CHF) (body weight gains of > 50 grams in a 7 day period together with labored
respiration
and/or edema). The predictive development and progression of these features
leading to eventual
congestive heart failure makes this an ideal model for a temporal analysis of
the molecular
changes accompanying the gross morphological changes.
Male Sprague-Dawley rats (Taconic, Germantown, NJ) weighing between 200-250g
were
anesthetized with isoflurane gas, placed on their backs, abdomens shaved and
desinfected. A
midline incision was made over the abdominal area, and the peritoneal cavity
was exposed.
Using cotton swabs, the abdominal vena cava and aorta were isolated distal to
the renal arteries.
Both vessels were then held off above and below the fistula site with forgers.
A hole was made
in the aorta with a heparinized 18g short-bevelled needle. The needle was
inserted completely
through the aorta and into the side of the vena cava until the entire bevel
could be observed
through the vena cava, being careful not to puncture a second hole. The needle
was removed and
a drop of cyanoacrylate glue was placed on the aortic puncture site. After one
minute flow was
restored. Antibiotics were added to the abdomen, and the incision was closed
using 4-0 Dexon II.
Sham operated animals were subjected to abdominal surgery minus the generation
of the aorta-
vena cava fistula.
Total RNA Isolation from Rat Hearts. Animals were euthanized and the hearts
were
immediately removed, dissected and flash-frozen in liquid nitrogen. Total RNA
was isolated
from about 0.25 g of frozen powdered left ventricular tissue that had been
flash frozen in liquid
nitrogen, using Trizol reagent (GibcoBRL), PLGIII heavy phase lock gel tubes
(Eppendorf/SPrime -3Prime), and RNeasy columns (Ambion) according to the
manufacturers
instructions. The RNA was resuspended in a suitable volume of RNAse free water
and
contaminating DNA was removed using the DNA-free kit from Ambion. All O.D.
260/280 ratios
were > 1.9, and approximately 1 mg of each RNA sample was analyzed by agarose
gel
electrophoresis for confirmation of intact 18S and 28S ribosomal RNA bands.
CA 02449417 2003-12-04
Case 0123M/CA
Affymetrix GeneChip Study Design. Individual rats were analyzed as follows:
Rats with an
aorta-vena cava fistula (AVF) were euthanized at 1 week post fistula (n=9), at
3 weeks (n=8), at 5
weeks (n=9), at 8 weeks (n=8), and rats at an average of 20 weeks (range 14
weeks to 22 weeks)
(n=8); rats with an AVF showing clinical signs of congestive heart failure
were euthanized at an
average of 20 weeks post fistula (range 14 weeks to 22 weeks) (n=8); rats sham
operated were
euthanized at 1 week post operative (n=9), 3 weeks (n=7), 5 weeks (n=7), 8
weeks (n=8), and at
an average of 20 weeks (range 14 weeks to 22 weeks) (n=6).
Affymetrix GeneChip Analysis. Ten micrograms of total RNA were used to prepare
biotin-
labeled and fragmented cRNA, which was then hybridized to Affymetrix RG-U34 A,
B and C
chips as described in the protocol provided in the Affymetrix GeneChip
Expression Analysis
Technical Manual. Statistical analysis is based on the Affy signal, or the
average difference
fluorescence intensity, (MAS 5.0 algorithm, Affymetrix). Quantile
normalization is used to
remove sources of variability not due to the biological sources of interest.
Gene filtering is
performed based on the minimum number of Affy Absent Calls per experimental
condition. An
ANOVA statistical model with log (base 2) of the Affy signal as a response is
fitted for each non-
filtered gene. The model parameter estimates are used to calculate Log Fold
Change (LFC)
between experimental conditions, and a corresponding uncertainty measure,
Standard Error (SE).
A statistical test is performed to compare the ratio of LFC and SE to 0 (0
represents no difference
between compared groups) and determine the NLOGP value ( -1og10[P value]) of
significance.
An NLOGP value of 3 corresponds to a P-value = 0.001 level of significance.
Genes involved in
ubiquitin-mediated processes that displayed a statistically significant level
of differential
expression (NLOGP of 3 or greater) in the AVF groups, or AVF with clinical
signs of congestive
heart failure group, relative to the sham-operated groups are listed in Table
4.
Table 4. Differential Expression of Selected Ubiquitin Pathway Genes in Rat
Aorta-Vena
Cava Fistula Model. AVF versus Sham groups, except as noted in heading.
Gene Affymetrix Fold Fold Fold
change
Acronym Accession Change Change
Number AVF-HF AVF-HF
v v
Sham AVF
1 3wk Swk 8wk 20wk
wk
DC34 c AA818770 -1.23
at
CA 02449417 2003-12-04
Case 3123M/CA
36
SP18 c AA851237 -1.42
at
BLEIA c AA956535 1.43
at
ERPUD1 c AA957323 -1.54
at
BE2C c AI103150 2.26
at
SP2 c AI103604 -1.51-1.53 -1.77
at
SP8 c AI168999 1.41 1.67
at
BE2L3 c AI172301 -1.22
at
SP9X c AI236092 1.3
at
Example 3 Mouse Model of Heart Failure
Cardiac hypertrophy and remodeling of the heart involves a number of
endocrine,
paracrine, and autocrine growth factors and peptide hormones that respond to
injury, increased
pressure, or genetic defects in contractile performance. The initial response
is adaptive and
temporarily maintains cardiac output, but sustained hypertrophy and remodeling
can eventually
lead to heart failure. Associated with the hypertrophic response is a change
in the cardiac gene
expression profile, including the increased expression of embryonic genes.
Calcineurin, a
calcium-calmodulin activated serine/threonine-specific phosphatase, was
proposed as a key
component of the hypertrophic signaling cascade based on its interaction with
the NFATc4
transcription factor, which in turn interacts with the cardiac-specific GATA4
transcription factor,
To demonstrate the potential involvement of calcineurin in cardiac
hypertrophy, Molkentin, et al,
(Cell 1998, 93:215-228), generated transgenic mice expressing a constitutively
activated mutant
of calcineurin in the heart. The calcineurin transgenic mice demonstrated
significant cardiac
hypertrophy and remodeling that rapidly progressed to dilated heart failure
within 8 to 12 weeks
after birth.
Total RNA Isolation from Mouse Hearts. Calcineurin transgenic mice and their
non-
transgenic littermates were sacrificed at 2 weeks, 4 weeks, 8 weeks, and 12
weeks after birth.
Animals were euthanized and the hearts were immediately removed, dissected and
flash-frozen in
liquid nitrogen. Total RNA was isolated from about 0.25 g of frozen powdered
left ventricular
tissue that had been flash frozen in liquid nitrogen, using Trizol reagent
(GibcoBRL), PLGIII
heavy phase lock gel tubes (Eppendorf/SPrime -3Prime), and RNeasy columns
(Ambion)
according to the manufacturers instructions. The RNA was resuspended in a
suitable volume of
RNAse free water and contaminating DNA was removed using the DNA-free kit from
Ambion,
CA 02449417 2003-12-04
Case 9123M/CA
37
All O.D. 260/280 ratios were > 1.9, and approximately 1 mg of each RNA sample
was analyzed
by agarose gel electrophoresis for confirmation of intact 18S and 28S
ribosomal RNA bands.
Affymetrix GeneChip Study Design. Individual RNA samples from calcineurin
transgenic
mice (n=6 per time point) or their non-transgenic littermates (n=6 per time
point) were analyzed
at 2 weeks, 4 weeks, 8 weeks, and 12 weeks after birth. Each group contained
of both males and
females.
Affymetrix GeneChip Analysis. Ten micrograms of total RNA were used to prepare
biotin-
labeled and fragmented cRNA, which was then hybridized to Affymetrix MG-U74
Av2, Bv2 and
Cv2 chips as described in the protocol provided in the Affymetrix GeneChip
Expression Analysis
Technical Manual. Statistical analysis is based on the Affy signal, or the
average difference
fluorescence intensity, (MAS 5.0 algorithm, Affymetrix). Quantile
normalization is used to
remove sources of variability not due to the biological sources of interest.
Gene filtering is
performed based on the minimum number of Affy Absent Calls per experimental
condition. An
ANOVA statistical model with log (base 2) of the Affy signal as a response is
fitted for each non-
filtered gene. The model parameter estimates are used to calculate Log Fold
Change (LFC)
between experimental conditions, and a corresponding uncertainty measure,
Standard Error (SE).
A statistical test is performed to compare the ratio of LFC and SE to 0 (0
represents no difference
between compared groups) and determine the NLOGP value ( -1og10[P value]) of
significance.
An NLOGP value of 3 corresponds to a P-value = 0.001 level of significance.
Genes involved in
ubiquitin-mediated processes that displayed a statistically significant level
of differential
expression (NLOGP of 3 or greater) in the caleineurin transgenic groups,
relative to the non-
transgenic groups are listed in Table 5.
Table 5. Differential Expression of Selected Ubiquitin Pathway Genes in
Constitutively
Activated Calcineurin Transgenic Mouse Model.
Affymetrix
AccessionFold ChangeFold ChangeFold ChangeFold Change
ene Acronym Number 2wks 4wks 8wks l2wks
BE2H 100529 1.7
at
BE2G2 109685 2.05 1.67 1.53 1.82
at
ERC3 114779 -1.52 -1.91
at
SP 16 I 16145 1.63 1.72 1.84 1.76
at
CA 02449417 2003-12-04
Case 9123M/CA
38
BXW1B 160764 1.35
at
4WBP4-PENDING162942 2.12 1.73 2.12
at
BE2D1 165448 -1.72 -1.59
i at
EDD4A 93101 s 1.43 1.25
at
BLS 4268 f -1.22 -1.31
at
ERPUD1 5057 at -1.93 -1.55 -1.53 -1.53
RIH1 95563 at 1.48 1.33
BE2R2 97460 at -1.26
Example 4 Drub Screening Assays
Candidate agents and compounds will be screened for their ability to modulate
the
expression levels and/or activities of one or more of the genes identified as
being involved in the
abnormal regulation of ubiquitinylation by any technique known to those
skilled in the art
including assays described above. In some preferred embodiments, the assay of
gene expression
level may be conducted using real time PCR. Real time PCR detection may be
accomplished by
the use of the ABI PRISM 7700 Sequence Detection System. This system measures
the
fluorescence intensity of the sample each cycle and is able to detect the
presence of specific
amplicons within the PCR reaction. Each sample is assayed for the level of one
or more of the
genes identified as being involved in cardiomyopathies including, but not
limited to, those
identified in Table 1.
The expression of level of a control gene, for example GAPDH, may be used to
normalize the expression levels. Normalized expression levels from cells
exposed to the agents
and compounds are then compared to the normalized expression levels in control
cells. Agents
that modulate expression level of one or more of the genes may be further
tested as drug
candidates in appropriate in vitro and in vivo models.
Except as otherwise noted, all amounts including quantities, percentages,
portions, and
proportions, are understood to be modified by the word "about", and amounts
are not intended to
indicate significant digits.
Except as otherwise noted, the articles "a", "an", and "the" mean "one or
more".
While particular embodiments of the present invention have been illustrated
and
described, it would be obvious to those skilled in the art that various other
changes and
modifications can be made without departing from the spirit and scope of the
invention. It is
CA 02449417 2003-12-04
Case 9123M/CA
39
therefore intended to cover in the appended claims all such changes and
modifications that are
within the scope of this invention.
CA 02449417 2003-12-04
1
SEQUENCE LISTING
<110> The Procter and Gamble
Company
Doersen, Claus-Jens W
$ Kawamoto, Richard M
<120> Methods for Identifyingmpounds RegulatingCardiac
Co for
Dysfunction
I~ <130> 9123M
<140> Not Yet Assigned
<141> 2003-12-04
IS <150> US 60/430,945
<151> 2002-12-04
<160> 72
20 <170> PatentIn version 3.2
<210> 1
<211> 3167
<212> DNA
25 <213> Homo Sapiens
<220>
<221> CDS
30 <222> (680)..(2752)
<400> 1
gaattccgct tctacagctg ctgctgcggcggctatggcggcggcacgggcggtggactg60
35 aggatagaga gccacagcac gaggagctgccaggcctggacagccagtgcggccagatag120
aaaacggcga gagtgggcga gaacgtccactgcgggccggcgaaagctggttccttgtgg180
agaagcactg gtataagcag tgggaggcatactgcagggaggggaccaggactccagcac240
40
cttccctggc tgcatcaaca atccacactctttcaagatgagataaactggccctcaagg300
aggactggtg gaaggcgagg attatgtgctgctcccagcacgtgcttggcattacctggt360
45 cagctggtat ggtctagagc atggccagccacccattgaacgcaaggtcatagagctgcc420
caacatccag aaggtcgaag tgtacccagtagaactgctgcttgtccggcacaatgattt480
gggcaaatct cacactgttc agttcagccataccgattctattggcctagtattgcgcac540
50
agctcgggag cggtttctgg tggagccccaggaagacactcggctttgggccaagaactc600
agaaggctct ttggataggt tgtatgacacacacatcacggttctcgatgcggcccttga660
55 gactgggcag ttgatcatc atg cgc aag gat ggc 712
gag acc aaa act tgg
ccc
Met Glu Thr Arg Lys Asp Gly
Lys Thr Trp
Pro
1 5 10
CA 02449417 2003-12-04
2
agc gca cag ctg cat gtc atg aac aac aac atg tcg gaa gag gat gag 760
Ser Ala Gln Leu His Val Met Asn Asn Asn Met Ser Glu Glu Asp Glu
15 20 25
gac ttc aag ggt cag cca ggc atc tgt ggc ctc acc aat ctg ggc aac 808
Asp Phe Lys Gly Gln Pro Gly Ile Cys Gly Leu Thr Asn Leu Gly Asn
30 35 40
acg tgc ttc atg aac tcg gcc ctg cag tgc ctc agc aat gtg cca cag 856
Thr Cys Phe Met Asn Ser Ala Leu Gln Cys Leu Ser Asn Val Pro Gln
45 50 55
ctc acc gag tac ttc ctc aac aac tgc tac ctg gag gag ctc aac ttc 904
Leu Thr Glu Tyr Phe Leu Asn Asn Cys Tyr Leu Glu Glu Leu Asn Phe
60 65 70 75
cgc aac cca ctg ggc atg aag ggt gag atc gca gag gcc tat gca gac 952
Arg Asn Pro Leu Gly Met Lys Gly Glu Ile Ala Glu Ala Tyr Ala Asp
80 85 90
ctg gtg aag cag gcg tgg tct ggc cac cac cgc tcc att gtg cca cat 1000
Leu Val Lys Gln Ala Trp Ser Gly His His Arg Ser Ile Val Pro His
95 100 105
2$ gtg ttc aag aac aag gtt ggc cat ttt gca tcc caa ttt ctg ggc tac 1048
Val Phe Lys Asn Lys Val Gly His Phe Ala Ser Gln Phe Leu Gly Tyr
110 115 120
cag cag cat gac tct cag gag ctg ctg tca ttc ctc ctg gac ggg ctg 1096
Gln Gln His Asp Ser Gln Glu Leu Leu Ser Phe Leu Leu Asp Gly Leu
125 130 135
cat gag gac ctt aat cgg gtg aag aag aag gag tat gtg gag ctg tgc 1144
His Glu Asp Leu Asn Arg Val Lys Lys Lys Glu Tyr Val Glu Leu Cys
140 145 150 155
gat get get ggg cga ccg gat cag gag gtg gca cag gag gca tgg caa 1192
Asp Ala Ala Gly Arg Pro Asp Gln Glu Val Ala Gln Glu Ala Trp Gln
160 165 170
aac cac aaa cgg cgg aac gat tct gtg atc gtg gac act ttc cac ggc 1240
Asn His Lys Arg Arg Asn Asp 5er Val Ile Val Asp Thr Phe His Gly
175 180 185
ctc ttc aag tcc acg ctg gtg tgc ccc gat tgt ggc aat gta tct gtg 1288
Leu Phe Lys Ser Thr Leu Va1 Cys Pro Asp Cys Gly Asn Val Ser Val
190 195 200
acc ttc gac ccc ttc tgc tac ctc agt gtt cca ctg cct atc agc cac 1336
$0 Thr Phe Asp Pro Phe Cys Tyr Leu Ser Val Pro Leu Pro Ile Ser His
205 210 215
aag agg gtc ttg gag gtc ttc ttt atc ccc atg gat ccg cgc cgc aag 1384
Lys Arg Val Leu Glu Val Phe Phe Ile Pro Met Asp Pro Arg Arg Lys
SS 220 225 230 235
cca gag cag cac cgg ctc gtg gtc ccc aag aaa ggc aag atc tcg gat 1432
Pro Glu Gln His Arg Leu Val Val Pro Lys Lys Gly Lys Ile Ser Asp
CA 02449417 2003-12-04
3
240 245 250
cta tgt gtg get ctg tcc aaa cac acg ggc atc tcg cca gag agg atg 1480
Leu Cys Val Ala Leu Ser Lys His Thr Gly Ile Ser Pro Glu Arg Met
$ 255 260 265
atg gtg get gat gtc ttc agt cac cgc ttc tat aag ctc tat cag cta 1528
Met Val Ala Asp Val Phe Ser His Arg Phe Tyr Lys Leu Tyr Gln Leu
270 275 280
gag gag cct ctg agc agc atc ttg gac cgt gat gat atc ttc gtc tat 1576
Glu Glu Pro Leu Ser Ser Ile Leu Asp Arg Asp Asp Ile Phe Val Tyr
285 290 295
1$ gag gtg tca ggt cgc att gag gcc att gag ggc tca aga gag gac atc 1624
Glu Val Ser Gly Arg Ile Glu Ala Ile Glu Gly Ser Arg Glu Asp Ile
300 305 310 315
gtg gtt cct gtc tac ctg cgg gag cgc acc cct gcc cgt gac tac aac 1672
Val Val Pro Val Tyr Leu Arg Glu Arg Thr Pro Ala Arg Asp Tyr Asn
320 325 330
aac tcc tac tac ggc ctg atg ctt ttt gga cac ccc ctc ctg gta tca 1720
Asn Ser Tyr Tyr Gly Leu Met Leu Phe Gly His Pro Leu Leu Val Ser
2$ 335 340 345
gtg ccc cgg gac cgc ttc acc tgg gag ggc ctg tat aac gtc ctg atg 1768
Val Pro Arg Asp Arg Phe Thr Trp Glu Gly Leu Tyr Asn Val Leu Met
350 355 360
tac cgg ctc tca cgc tac gtg acc aaa ccc aac tca gat gat gag gac 1816
Tyr Arg Leu Ser Arg Tyr Val Thr Lys Pro Asn Ser Asp Asp Glu Asp
365 370 375
3$ gat ggg gat gag aaa gaa gat gac gag gag gat aaa gat gac gtc cct 1864
Asp Gly Asp Glu Lys Glu Asp Asp Glu Glu Asp Lys Asp Asp Val Pro
380 385 390 395
ggg ccc tca act ggg ggc agc ctc cga gac cct gag cca gag cag get 1912
Gly Pro Ser Thr Gly Gly Ser Leu Arg Asp Pro Glu Pro Glu Gln Ala
400 405 410
ggg ccc agc tct gga gtc acg aac agg tgc ccg ttc ctc ctg gac aat 1960
Gly Pro Ser Ser Gly Val Thr Asn Arg Cys Pro Phe Leu Leu Asp Asn
4$ 415 420 425
tgc ctt ggc aca tct cag tgg ccc cca agg cga cga cgc aag cag ctg 2008
Cys Leu Gly Thr Ser Gln Trp Pro Pro Arg Arg Arg Arg Lys Gln Leu
430 435 440
$0
ttc acc ctg cag acg gtg aac tcc aat ggg acc agc gac cgc aca acc 2056
Phe Thr Leu Gln Thr Val Asn Ser Asn Gly Thr Ser Asp Arg Thr Thr
445 450 455
$$ tcc cct gaa gaa gtc cat gcc cag ccg tac att get atc gac tgg gag 2104
Ser Pro Glu Glu Val His Ala Gln Pro Tyr Ile Ala Ile Asp Trp Glu
460 465 470 475
CA 02449417 2003-12-04
4
cca gag atg aag aag cgt tac tat gac gag gta gag get gag ggc tac 2152
Pro Glu Met Lys Lys Arg Tyr Tyr Asp Glu Val Glu Ala Glu Gly Tyr
480 485 490
S gtg aag cat gac tgc gtc ggg tac gtg atg aag aag get ccc gtg cgg 2200
Val Lys His Asp Cys Val Gly Tyr Val Met Lys Lys Ala Pro Val Arg
495 500 505
ctg cag gag tgc att gag ctc ttc acc act gtg gag acc ctg gag aag 2248
1~ Leu Gln Glu Cys Ile Glu Leu Phe Thr Thr Val Glu Thr Leu Glu Lys
510 515 520
gaa aac ccc tgg tac tgc cct tcc tgc aag cag cac cag ctg gca acc 2296
Glu Asn Pro Trp Tyr Cys Pro Ser Cys Lys Gln His Gln Leu Ala Thr
IS 525 530 535
aag aag ctg gac ctg tgg atg ctg ccg gag att ctc atc atc cac ctg 2344
Lys Lys Leu Asp Leu Trp Met Leu Pro Glu Ile Leu Ile Ile His Leu
540 545 550 555
aaa cgc ttt tcc tac acc aag ttc tcc cga gag aag ctg gac acc ctc 2392
Lys Arg Phe Ser Tyr Thr Lys Phe Ser Arg Glu Lys Leu Asp Thr Leu
560 565 570
2S gtg gag ttt cct atc cgg gac ctg gac ttc tct gag ttt gtc atc cag 2440
Val Glu Phe Pro Ile Arg Asp Leu Asp Phe Ser Glu Phe Val Ile Gln
575 580 585
cca cag aat gag tcg aat ccg gag ctg tac aaa tat gac ctc atc gcg 2488
Pro Gln Asn Glu Ser Asn Pro Glu Leu Tyr Lys Tyr Asp Leu Ile Ala
590 595 600
gtt tcc aac cat tat ggg ggc atg cgt gat gga cac tac aca aca ttt 2536
Val Ser Asn His Tyr Gly Gly Met Arg Asp Gly His Tyr Thr Thr Phe
3S 605 610 615
gcc tgc aac aag gac agc ggc cag tgg cac tac ttt gat gac aac agc 2584
Ala Cys Asn Lys Asp Ser Gly Gln Trp His Tyr Phe Asp Asp Asn Ser
620 625 630 635
gtc tcc cct gtc aat gag aat cag atc gag tcc aag gca gcc tat gtc 2632
Val Ser Pro Val Asn Glu Asn Gln Ile Glu Ser Lys Ala Ala Tyr Val
640 645 650
4S ctc ttc tac caa cgc cag gac gtg gcg cga cgc ctg ctg tcc ccg gcc 2680
Leu Phe Tyr Gln Arg Gln Asp Val Ala Arg Arg Leu Leu Ser Pro Ala
655 660 665
ggc tca tct ggc gcc cca gcc tcc cct gcc tgc agc tcc cca ccc agc 2728
S~ Gly Ser Ser Gly Ala Pro Ala Ser Pro Ala Cys Ser Ser Pro Pro Ser
670 675 680
tct gag ttc atg gat gtt aat tga gagccctggg tcctgccaca gaaaaaaaaa 2782
Ser Glu Phe Met Asp Val Asn
SS 685 690
aaaaaaagcc ctctctgcaa tctcgcttct cgtgtccgcc ccgcttctct tattcgtgtt 2842
CA 02449417 2003-12-04
$
aggtgccccc gccaggcattgcaggcttagtcgtggctactgttctcctgtgccgctgca2902
tcgctctctc ccgggaaagaacaggtcgtgtctcctcctagcagtgcgcgccccgcctgt2962
$ gtttgccctt ccagcagtgaccctcccttctagtctttatttatggtcgtgcccttccct3022
ctcctcagcc cagagtgttctgcgtgggtggtgatgggggttcacctgaacacagagtgt3082
attttcttat tgaggccctgtaccttctgctgtgtgtgtgtatatataaagcaccagtct3142
gctccccaaa aaaaaaacggaattc 3167
<210> 2
1$ <211> 690
<212> PRT
<213> Homo sapiens
<400> 2
Met Glu Thr Arg Lys Lys Asp Gly Thr Trp Pro Ser Ala Gln Leu His
1 5 10 15
2$ Val Met Asn Asn Asn Met Ser Glu Glu Asp Glu Asp Phe Lys Gly Gln
20 25 30
Pro Gly Ile Cys Gly Leu Thr Asn Leu Gly Asn Thr Cys Phe Met Asn
35 40 45
3$
Ser Ala Leu Gln Cys Leu Ser Asn Val Pro Gln Leu Thr Glu Tyr Phe
55 60
Leu Asn Asn Cys Tyr Leu Glu Glu Leu Asn Phe Arg Asn Pro Leu Gly
65 70 75 80
Met Lys Gly Glu Ile Ala Glu Ala Tyr Ala Asp Leu Val Lys Gln Ala
85 90 95
4$ Trp Ser Gly His His Arg Ser Ile Val Pro His Val Phe Lys Asn Lys
100 105 110
Val Gly His Phe Ala Ser Gln Phe Leu Gly Tyr Gln Gln His Asp Ser
$0 115 120 125
$$
Gln Glu Leu Leu Ser Phe Leu Leu Asp Gly Leu His Glu Asp Leu Asn
130 135 140
Arg Val Lys Lys Lys Glu Tyr Val Glu Leu Cys Asp Ala Ala Gly Arg
145 150 155 160
CA 02449417 2003-12-04
6
Pro Asp Gln Glu Val Ala Gln Glu Ala Trp Gln Asn His Lys Arg Arg
165 170 175
Asn Asp Ser Val Ile Val Asp Thr Phe His Gly Leu Phe Lys Ser Thr
180 185 190
Leu Val Cys Pro Asp Cys Gly Asn Val Ser Val Thr Phe Asp Pro Phe
195 200 205
IS Cys Tyr Leu Ser Val Pro Leu Pro Ile Ser His Lys Arg Val Leu Glu
210 215 220
Val Phe Phe Ile Pro Met Asp Pro Arg Arg Lys Pro Glu Gln His Arg
225 230 235 240
30
Leu Val Val Pro Lys Lys Gly Lys Ile Ser Asp Leu Cys Val Ala Leu
245 250 255
Ser Lys His Thr Gly Ile Ser Pro Glu Arg Met Met Val Ala Asp Val
260 265 270
Phe Ser His Arg Phe Tyr Lys Leu Tyr Gln Leu Glu Glu Pro Leu Ser
275 280 285
Ser Ile Leu Asp Arg Asp Asp Ile Phe Val Tyr Glu Val Ser Gly Arg
290 295 300
Ile Glu Ala Ile Glu Gly Ser Arg Glu Asp Ile Val Val Pro Val Tyr
305 310 315 320
SO
Leu Arg Glu Arg Thr Pro Ala Arg Asp Tyr Asn Asn Ser Tyr Tyr Gly
325 330 335
Leu Met Leu Phe Gly His Pro Leu Leu Val Ser Val Pro Arg Asp Arg
340 345 350
Phe Thr Trp Glu Gly Leu Tyr Asn Val Leu Met Tyr Arg Leu Ser Arg
355 360 365
Tyr Val Thr Lys Pro Asn Ser Asp Asp Glu Asp Asp Gly Asp Glu Lys
370 375 380
CA 02449417 2003-12-04
7
Glu Asp Asp Glu Glu Asp Lys Asp Asp Val Pro Gly Pro Ser Thr Gly
385 390 395 400
Gly Ser Leu Arg Asp Pro Glu Pro Glu Gln Ala Gly Pro Ser Ser Gly
405 410 415
Val Thr Asn Arg Cys Pro Phe Leu Leu Asp Asn Cys Leu Gly Thr Ser
1~ 420 425 430
20
Gln Trp Pro Pro Arg Arg Arg Arg Lys Gln Leu Phe Thr Leu Gln Thr
435 440 445
Val Asn Ser Asn Gly Thr Ser Asp Arg Thr Thr Ser Pro Glu Glu Val
450 455 460
His Ala Gln Pro Tyr Ile Ala Ile Asp Trp Glu Pro Glu Met Lys Lys
465 470 475 480
Arg Tyr Tyr Asp Glu Val Glu Ala Glu Gly Tyr Val Lys His Asp Cys
485 490 495
Val Gly Tyr Val Met Lys Lys Ala Pro Val Arg Leu Gln Glu Cys Ile
500 505 510
40
Glu Leu Phe Thr Thr Val Glu Thr Leu Glu Lys Glu Asn Pro Trp Tyr
515 520 525
Cys Pro Ser Cys Lys Gln His Gln Leu Ala Thr Lys Lys Leu Asp Leu
530 535 540
Trp Met Leu Pro Glu Ile Leu Ile Ile His Leu Lys Arg Phe Ser Tyr
545 550 555 560
Thr Lys Phe Ser Arg Glu Lys Leu Asp Thr Leu Val Glu Phe Pro Ile
565 570 575
Arg Asp Leu Asp Phe Ser Glu Phe Val Ile Gln Pro Gln Asn Glu Ser
$0 580 585 590
5$
Asn Pro Glu Leu Tyr Lys Tyr Asp Leu Ile Ala Val Ser Asn His Tyr
595 600 605
Gly Gly Met Arg Asp Gly His Tyr Thr Thr Phe Ala Cys Asn Lys Asp
610 615 620
CA 02449417 2003-12-04
8
10
Ser Gly Gln Trp His Tyr Phe Asp Asp Asn Ser Val Ser Pro Val Asn
625 630 635 640
Glu Asn Gln Ile Glu Ser Lys Ala Ala Tyr Val Leu Phe Tyr Gln Arg
645 650 655
Gln Asp Val Ala Arg Arg Leu Leu Ser Pro Ala Gly Ser Ser Gly Ala
660 665 670
1$ Pro Ala Ser Pro Ala Cys Ser Ser Pro Pro Ser Ser Glu Phe Met Asp
675 680 685
Val Asn
20 690
<210> 3
<211> 5219
25 <212> DNA
<213> Homo Sapiens
<220>
30 <221> misc feature
<222> (1). (5219)
<223> n = A, T, G, or
C
<220>
35 <221> CDS
<222> (206)..(1783)
<223> n = A, T, G, or
C
<400> 3
40 gcagccgcag ctcgggggcg tggcagcatc ccctcggcgatcgcgcagcc 60
atgcctgcct
ccatctttgt ccggcctccg tcggcgcccg ggccttggcc 120
cgctgtgttc agcctggcca
gccgccgagc agcccccacg gtcgtcctcg cctccctcgccgccgccccc 180
ccgcgctggc
45
cgcgcgcggc cgggccttgc atggtgtcc cggcca gag gagggc 232
ccccc ccc
MetValSer ArgPro Glu GluGly
Pro
1 5
50 gag gcc atg gac gcc gag gcggtagcg ccgccg ggc tcgcac 280
ctg tgc
Glu Ala Met Asp Ala Glu AlaValAla ProPro Gly SerHis
Leu Cys
15 20 25
ctg ggc agc ttc aag gtg aactggaag cagaac ctg gccatc 328
gac cgg
SS Leu Gly Ser Phe Lys Val AsnTrpLys GlnAsn Leu AlaIle
Asp Arg
30 35 40
tac cag tgc ttc gtg tgg ggcacgget gaggcc cgc cgcaag 376
agc aag
CA 02449417 2003-12-04
9
Tyr Gln Cys Phe Val Trp Ser Gly Thr Ala G1u Ala Arg Lys Arg Lys
45 50 55
gcc aag tcc tgt atc tgc cat gtc tgt ggc gtc cac ctc aac agg ctg 424
$ Ala Lys Ser Cys Ile Cys His Val Cys Gly Val His Leu Asn Arg Leu
60 65 70
cat tcc tgc ctc tac tgt gtc ttc ttc ggc tgt ttc aca aag aag cat 472
His Ser Cys Leu Tyr Cys Val Phe Phe Gly Cys Phe Thr Lys Lys His
1~ 75 80 85
1$
att cac gag cat gcg aag gcg aag cgg cac aac ctg gcc att gat ctg 520
Ile His Glu His Ala Lys Ala Lys Arg His Asn Leu Ala Ile Asp Leu
90 95 100 105
atg tac gga ggc atc tac tgt ttt ctg tgc cag gac tac atc tat gac 568
Met Tyr Gly Gly Ile Tyr Cys Phe Leu Cys Gln Asp Tyr Ile Tyr Asp
110 115 120
20 aaa gac atg gaa ata atc gcc aag gag gag cag cga aaa get tgg aaa 616
Lys Asp Met Glu Ile Ile Ala Lys Glu Glu Gln Arg Lys Ala Trp Lys
125 130 135
atg caa ggc gtt gga gag aag ttt tca act tgg gaa cca acc aaa cgg 664
2$ Met Gln Gly Val Gly Glu Lys Phe Ser Thr Trp Glu Pro Thr Lys Arg
140 145 150
gag ctt gaa ctg ctg aag cac aac ccg aaa agg aga aag atc acc tcg 712
Glu Leu Glu Leu Leu Lys His Asn Pro Lys Arg Arg Lys Ile Thr Ser
3~ 155 160 165
3$
aac tgc acc ata ggt ctg cgt ggg ctg atc aac ctt ggg aac aca tgc 760
Asn Cys Thr Ile Gly Leu Arg Gly Leu Ile Asn Leu Gly Asn Thr Cys
170 175 180 185
ttc atg aac tgc atc gtg cag gcc ctg acc cac acg cca ctt ctg cgg 808
Phe Met Asn Cys Ile Val Gln Ala Leu Thr His Thr Pro Leu Leu Arg
190 195 200
40 gac ttc ttc ctg tct gac agg cac cgc tgt gag atg cag agc ccc agc 856
Asp Phe Phe Leu Ser Asp Arg His Arg Cys Glu Met Gln Ser Pro Ser
205 210 215
tcc tgt ctg gtc tgt gag atg tcc tca ctg ttt cag gag ttt tac tct 904
4$ Ser Cys Leu Val Cys Glu Met Ser Ser Leu Phe Gln Glu Phe Tyr Ser
220 225 230
gga cac cgg tcc cct cac atc ccg tat aag ttg ctg cac ctg gtg tgg 952
Gly His Arg Ser Pro His Ile Pro Tyr Lys Leu Leu His Leu Val Trp
$~ 235 240 245
acc cac gcg agg cac cta gca ggc tac gag cag cag gac gcc cac gag 1000
Thr His Ala Arg His Leu Ala Gly Tyr Glu Gln Gln Asp Ala His Glu
250 255 260 265
$$
ttc ctc atc gcg gcc ctg gac gtg ctc cac cga cac tgc aaa ggt gat 1048
Phe Leu Ile Ala Ala Leu Asp Val Leu His Arg His Cys Lys Gly Asp
270 275 280
CA 02449417 2003-12-04
1~
gac aat ggg aag aag gcc aac aac ccc aac cac tgc aac tgc atc ata 1096
Asp Asn Gly Lys Lys Ala Asn Asn Pro Asn His Cys Asn Cys Ile Ile
285 290 295
gac cag atc ttc aca ggc ggg ttg cag tca gac gtc acc tgc caa gtc 1144
Asp Gln Ile Phe Thr Gly Gly Leu Gln Ser Asp Val Thr Cys Gln Val
300 305 310
tgc cat gga gtc tcc acc acc atc gac ccc ttc tgg gac atc agc ttg 1192
Cys His Gly Val Ser Thr Thr Ile Asp Pro Phe Trp Asp Ile Ser Leu
315 320 325
gat ctc ccc ggc tct tcc acc cca ttc tgg ccc ctg agc cca ggg agc 1240
Asp Leu Pro Gly Ser Ser Thr Pro Phe Trp Pro Leu Ser Pro Gly Ser
330 335 340 345
gag ggc aac gtg gta aac ggg gaa agc cac gtg tcg gga acc acc acg 1288
Glu Gly Asn Val Val Asn Gly Glu Ser His Val Ser Gly Thr Thr Thr
350 355 360
ctc acg gac tgc ctg cga cga ttc acc aga cca gag cac ttg ggc agc 1336
Leu Thr Asp Cys Leu Arg Arg Phe Thr Arg Pro Glu His Leu Gly Ser
365 370 375
agc gcc aag atc aag tgc agc ggt tgc cat agc tac cag gag tcc aca 1384
Ser Ala Lys Ile Lys Cys Ser Gly Cys His Ser Tyr Gln Glu Ser Thr
380 385 390
aag cag ctc act atg aag aaa ctg ccc atc gta gcc tgt ttt cat ctc 1432
Lys Gln Leu Thr Met Lys Lys Leu Pro Ile Val Ala Cys Phe His Leu
395 400 405
aaa cga ttt gaa cac tca gcc aag ctg cgg cgg aag atc acc acg tat 1480
3S Lys Arg Phe Glu His Ser Ala Lys Leu Arg Arg Lys Ile Thr Thr Tyr
410 415 420 425
gtg tcc ttc ccc ctg gag ctg gac atg acc cct ttc atg gcc tcc agc 1528
Val Ser Phe Pro Leu Glu Leu Asp Met Thr Pro Phe Met Ala Ser Ser
4~ 430 435 440
aaa gag agc agg atg aat gga cag tac cag cag ccc acg gac agt ctc 1576
Lys Glu Ser Arg Met Asn Gly Gln Tyr Gln Gln Pro Thr Asp Ser Leu
445 450 455
aac aat gac aac aag tat tcc ctg ttt get gtt gtt aac cat caa ggg 1624
Asn Asn Asp Asn Lys Tyr Ser Leu Phe Ala Val Val Asn His Gln Gly
460 465 470
S~ acc ttg gag agt ggc cac tac acc agc ttt atc cgg cag cac aaa gac 1672
Thr Leu Glu Ser Gly His Tyr Thr Ser Phe Ile Arg Gln His Lys Asp
475 480 485
cag tgg ttc aag tgt gac gat gcc atc atc acc aag gcc agc atc aag 1720
SS Gln Trp Phe Lys Cys Asp Asp Ala Ile Ile Thr Lys Ala Ser Ile Lys
490 495 500 505
gac gtc ctg gac agc gaa ggg tac ttg ctg ttc tat cac aaa cag ttc 1768
CA 02449417 2003-12-04
11
Asp Val Leu Asp Ser Glu Gly Tyr Leu Leu Phe Tyr His Lys Gln Phe
510 515 520
ctg gaa tac gag tag ccttatctgc agctggtcag aaaaacaaag gcaatgcatt 1823
Leu Glu Tyr Glu
525
ggcaagcctcacaaagtgatcctccctggcccccccctcccccaagtctcccgccgcctc1883
cccggcctggtgacaccacctcccatgcagatgtggcccctctgcacctgggacccatcg1943
ggtcgggatggaccacacggacggggaggctcctggagctgctttgaagatggatgagat2003
gaggggtgtgctctgggtgggaggagcagcgtacacccgtcaccagaacatctcttgtgt2063
catgacatgggggtgcaacgggggcctcacagcacagagtgaccgctgcctggcgttccc2123
cagcactcggtgtggaaaggcccctacctgctgtaagattatgggtccatgaaagcagta2183
agctggacacagaggtgtagtgtgcgggacagagggccttgcagatgcctttctgttggt2243
gttttagtgttaaaatacggagagtatggaactcttcaccntccattttctcagcggctg2303
tgaagcagcctcctagcttcggaagtacggacactacgtcgcgttttcaagcgtgtctgt2363
tctgcaggtaacagcatcaagctgcacgtggaagcatctcgcggttttctagaaacaggc2423
attttcttatccctctcccgctcctttttccacaaaggtgaatttcataaatgtaatact2483
agtaaagtgaatgaattactgagtttatacagaaatttaggtaacttctcctttagtctc2543
aagagcgagtcttgctttttaatgggtgccgtttatgttgctgcccgccctgtgtgcctg2603
gctcctctgggtgccttggtgtctgctggtggctggcagtgggcgcagcggaggagagtt2663
gtgctgcagctcatacggtgtgtctgtcatctcagtctggagtaaatgcagtgtctgccg2723
gtgtctgatgggttctgtccctcgtattttctttgccttctatcccattgcctggctacc2783
gctgcctggcagccaagggtgttggtcgcgaagctggagtggcctctggtggagcctgca2843
tcttgtctcgtctgcctctgctttacatttggtgtactttcgggcgtggtggcagtaaaa2903
tgacaccgtgattgagcttgtcagcagagctgaaagagaaagtagaaggatgtgcattgt2963
ttcttgtaagatatcttgcatgtatctgtgtattcaaattcaaacagagatggtttgtcc3023
atttgtccactgagaaattagaaactagggacaagggggaggaaaagtactgaaatacag3083
tttatgaagcaagtgtgtctcgggctgtgcttgtcccaggagccccagcagcatctgaac3143
tgaggcttcttcagtcctgcaggaacaggatcatctgtctcagcggtgggcagatgtttt3203
catagacagccagggagtaaacactgttggctctgtgggctgtatggtctctgccataaa3263
tagtacagagatgtggctgtgtctagtacaacttttagacacagaaatctgaatgacata3323
tattgttctgtgtcaagaaacttagattttttttttaactatttaaaaacgtgaaaccta3383
CA 02449417 2003-12-04
12
ttcttagctcacaggccatggagaagctggtggggaccagacccagctccttagctggct3443
gggctggggangggggtagtgacagtggcagctgctactcactgctcagtgtggaaaaca3503
caggacttggcaatcacagcccgcagaaccatcatgtgtggcagaagcctgagggatgcg3563
gtttcttgcccacgtgctctgttcattttctgttgtttttctgcacttaaagaattcaca3623
tggaagcatgttttataaaatgaattaccagagaaacagagatgggccgagattttcaga3683
aatggtcccatgtgaccaagttctgctgtttgggtgacagtgctttgaagatctcctttg3743
aggatgtgcagtctttttttttttttttttgagatggagtttgttgcccaggctggagtg3803
agtggcacagtctcggctcactgcaacctccacctcctgggttcaagcagttctcgtgcc3863
gcagcctcccaagtagctgggactacaggcatgcaccaccacgccaggctaatttttgta3923
tttttagtagagatggggtttcaccatgtctcaaactcctgacctcaggcgatccaccca3983
cctcagcgtcccaaagtgctgggattataggcgtgagccaccgcacctggcctatgagtg4043
gtcttttaattaggaacaaatctaatggaaaggagagttgactgaagttggcccacagga4103
ttgtgagctgggcagtgccttcatgaaggcttgccaccttgggacgccccagtttactgg4163
ggtgtcttgcggagtgcagaaggctttctggcagctgcctgggtttggccagaccctgcc4223
tcccctcccgccggccaacccctagtccccttcctgtctccacttgcattcaggggtggc4283
tgctgttctgagaacattagaactgggaagagagatggagtcacatggatttttggtggg4343
cattattctaaactttcgtatccaagttagtcccccttattccactgtggcattgccgtt4403
ctaagcagttacctgatgcctgctgctgaagagctgctcacaggaggcggcggcggccct4463
ggcactgccccttgcattaggtcttgtgtttgatgtgttcttgtgaatttactttgtcag4523
aacaaaatatttacgcgttgggttcaggaatttcttttagctccccatctggctgtgaaa4583
ttcaggaaacctcccgttgcctagtaatcaccccatgtaggtgtacattgtgacaaagtg4643
catctgaccactaaggggcccccttggtgaccccagcacattcacagcagtgttaaaatg4703
gcctgcattttggagatgctggctggcctttcagtgcctcccaggaagacacatggcctt4763
tccctcttcagatgcctgaagggagtgctttgaggcaggtgatgtgctgggagtgtgggc4823
ggcctccctctggccccggggccctctgtggaccttggctccctccgtggacctgggctt4883
cgtggtgagcactgcagcctccctgggcattccctccagcgccagcaccactgcaacata4943
tagacctgagtgctattgtattttggcttggtgtgtatgctcttcattgtgtaaaattgc5003
tgttcttttgacaatttaagtgattgttttgtttactgtaagtttgaaaataaaaatgaa5063
gaaaaaaattccaatgactgtgctgtggttggagactttatttaccaagatgtttactct5123
CA 02449417 2003-12-04
13
tcctttcccc ttccattttg aggagctgtg tcactcctcc tcccccccag tgctttgtag 5183
tctctcctat gtcataataa agctacattt tctctg 5219
<210> 4
<211> 525
<212> PRT
<213> Homo sapiens
<400> 4
Met Val Ser Arg Pro Glu Pro Glu Gly Glu Ala Met Asp Ala Glu Leu
IS 1 5 10 15
25
Ala Val Ala Pro Pro Gly Cys Ser His Leu Gly Ser Phe Lys Val Asp
20 25 30
Asn Trp Lys Gln Asn Leu Arg Ala Ile Tyr Gln Cys Phe Val Trp Ser
35 40 45
Gly Thr Ala Glu Ala Arg Lys Arg Lys Ala Lys Ser Cys Ile Cys His
50 55 60
Val Cys Gly Val His Leu Asn Arg Leu His Ser Cys Leu Tyr Cys Val
65 70 75 80
Phe Phe Gly Cys Phe Thr Lys Lys His Ile His Glu His Ala Lys Ala
3$ 85 90 95
45
Lys Arg His Asn Leu Ala Ile Asp Leu Met Tyr Gly Gly Ile Tyr Cys
100 105 110
Phe Leu Cys Gln Asp Tyr Ile Tyr Asp Lys Asp Met Glu Ile Ile Ala
115 120 125
Lys Glu Glu Gln Arg Lys Ala Trp Lys Met Gln Gly Val Gly Glu Lys
130 135 140
$0 Phe Ser Thr Trp Glu Pro Thr Lys Arg Glu Leu Glu Leu Leu Lys His
145 150 155 160
Asn Pro Lys Arg Arg Lys Ile Thr Ser Asn Cys Thr Ile Gly Leu Arg
55 165 170 175
Gly Leu Ile Asn Leu Gly Asn Thr Cys Phe Met Asn Cys Ile Val Gln
CA 02449417 2003-12-04
14
180 185 190
Ala Leu Thr His Thr Pro Leu Leu Arg Asp Phe Phe Leu Ser Asp Arg
$ 195 200 205
His Arg Cys Glu Met Gln Ser Pro Ser Ser Cys Leu Val Cys Glu Met
210 215 220
Ser Ser Leu Phe Gln Glu Phe Tyr Ser Gly His Arg Ser Pro His Ile
225 230 235 240
1$
Pro Tyr Lys Leu Leu His Leu Val Trp Thr His Ala Arg His Leu Ala
245 250 255
Gly Tyr Glu Gln Gln Asp Ala His Glu Phe Leu Ile Ala Ala Leu Asp
260 265 270
Val Leu His Arg His Cys Lys Gly Asp Asp Asn Gly Lys Lys Ala Asn
2.5 275 280 285
Asn Pro Asn His Cys Asn Cys Ile Ile Asp Gln Ile Phe Thr Gly Gly
290 295 300
Leu Gln Ser Asp Val Thr Cys Gln Val Cys His Gly Val Ser Thr Thr
305 310 315 320
3$
Ile Asp Pro Phe Trp Asp Ile Ser Leu Asp Leu Pro Gly Ser Ser Thr
325 330 335
Pro Phe Trp Pro Leu Ser Pro Gly Ser Glu Gly Asn Val Val Asn Gly
340 345 350
Glu Ser His Val Ser Gly Thr Thr Thr Leu Thr Asp Cys Leu Arg Arg
4$ 355 360 365
Phe Thr Arg Pro Glu His Leu Gly Ser Ser Ala Lys Ile Lys Cys Ser
370 375 380
$0
Gly Cys His Ser Tyr Gln Glu Ser Thr Lys Gln Leu Thr Met Lys Lys
385 390 395 400
$$
Leu Pro Ile Val Ala Cys Phe His Leu Lys Arg Phe Glu His Ser Ala
405 410 415
CA 02449417 2003-12-04
IS
Lys Leu Arg Arg Lys Ile Thr Thr Tyr Val Ser Phe Pro Leu Glu Leu
420 425 430
Asp Met Thr Pro Phe Met Ala Ser Ser Lys Glu Ser Arg Met Asn Gly
435 440 445
Gln Tyr Gln Gln Pro Thr Asp Ser Leu Asn Asn Asp Asn Lys Tyr Ser
450 455 460
Leu Phe Ala Val Val Asn His Gln Gly Thr Leu Glu Ser Gly His Tyr
465 470 475 480
Thr Ser Phe Ile Arg Gln His Lys Asp Gln Trp Phe Lys Cys Asp Asp
485 490 495
25
Ala Ile Ile Thr Lys Ala Ser Ile Lys Asp Val Leu Asp Ser Glu Gly
500 505 510
Tyr Leu Leu Phe Tyr His Lys Gln Phe Leu Glu Tyr Glu
515 520 525
<210> 5
<211> 2130
<212> DNA
<213> Homo sapiens
<220>
<221> CDS
<222> (17)..(1408)
4~ <400> 5
gggggcggag aacaat a 52
atg aga
gcg agg
gat
ggc
gag
gag
ccg
gag
aag
aa
Met u s
Ala Pro Arg
Asp Glu Arg
Gly Lys
Glu Ly
Gl
1 5 10
aga gag gagctg ctggetgagaaa atggetgtt gatggt gggtgt 100
ata
Arg Glu GluLeu LeuAlaGluLys MetAlaVal AspGly GlyCys
Ile
15 20 25
ggg act ggagac tgggaaggtcgc tggaaccat gtaaag aagttc 148
gac
Gly Thr GlyAsp TrpGluGlyArg TrpAsnHis ValLys LysPhe
Asp
30 35 40
ctc cga tctgga cccttcacacac cctgatttc gaaccg agcact 196
gag
Leu Arg SerGly ProPheThrHis ProAspPhe GluPro SerThr
Glu
45 50 55 60
gaa ctc cagttc ttgttagataca tgtaaagtt ctagtc attgga 244
tct
Glu Leu GlnPhe LeuLeuAspThr CysLysVal LeuVal IleGly
Ser
CA 02449417 2003-12-04
1
65 70 75
get ggc ggc tta gga tgt gag ctc ctg aaa aat ctg gcc ttg tct ggt 292
Ala Gly Gly Leu Gly Cys Glu Leu Leu Lys Asn Leu Ala Leu Ser Gly
$ 80 85 90
ttt aga cag att cat gtt ata gat atg gac act ata gat gtt tcc aat 340
Phe Arg Gln Ile His Val Ile Asp Met Asp Thr Ile Asp Val Ser Asn
95 100 105
cta aat agg cag ttt tta ttt agg cct aaa gat att gga aga cct aag 388
Leu Asn Arg Gln Phe Leu Phe Arg Pro Lys Asp Ile Gly Arg Pro Lys
110 115 120
1$ get gaa gttgetgca gaatttctaaat gacagagtt cctaactgc aat 436
Ala Glu ValAlaAla GluPheLeuAsn AspArgVal ProAsnCys Asn
125 130 135 140
gta gtt ccacatttc tacaagattcaa gattttaac gacactttc tat 484
Val Val ProHisPhe TyrLysIleGln AspPheAsn AspThrPhe Tyr
145 150 155
cga caa tttcatatt attgtatgtgga ctggactct atcatcgcc aga 532
Arg Gln PheHisIle IleValCysGly LeuAspSer IleIleAla Arg
2$ 160 165 170
aga tgg ataaatggc atgctgatatct cttctaaat tatgaagat ggt 580
Arg Trp IleAsnGly MetLeuIleSer LeuLeuAsn TyrGluAsp Gly
175 180 185
gtc tta gatccaagc tccattgtccct ttgatagat ggggggaca gaa 628
Val Leu AspProSer SerIleValPro LeuIleAsp GlyGlyThr Glu
190 195 200
3$ ggt ttt aaaggaaat gcccgggtgatt ctgcctgga atgactget tgt 676
Gly Phe LysGlyAsn AlaArgValIle LeuProGly MetThrAla Cys
205 210 215 220
atc gaa tgcacgctg gaactttatcca ccacaggtt aattttccc atg 724
Ile Glu CysThrLeu GluLeuTyrPro ProGlnVal AsnPhePro Met
225 230 235
tgc acc attgcatct atgcccaggcta ccagaacac tgtattgag tat 772
Cys Thr IleAlaSer MetProArgLeu ProGluHis CysIleGlu Tyr
4$ 240 245 250
gta agg atgttgcag tggcctaaggag cagcctttt ggagaaggg gtt 820
Val Arg MetLeuGln TrpProLysGlu GlnProPhe GlyGluGly Val
255 260 265
$0
cca tta ggtggagat gatcctgaacat atacaatgg attttccaa aaa 868
Pro Leu GlyGlyAsp AspProGluHis IleGlnTrp IlePheGln Lys
270 275 280
$$ tcc cta gagagagca tcacaatataat attaggggt gttacgtat agg 916
Ser Leu GluArgAla SerGlnTyrAsn IleArgGly ValThrTyr Arg
285 290 295 300
CA 02449417 2003-12-04
17
ctc act caa ggg gta gta aaa aga atc att cct gca gta get tcc aca 964
Leu Thr Gln Gly Val Val Lys Arg Ile Ile Pro Ala Val Ala Ser Thr
305 310 315
aat gca gtc att gca get gtg tgt gcc act gag gtt ttt aaa ata gcc 1012
Asn Ala Val Ile Ala Ala Val Cys Ala Thr Glu Val Phe Lys Ile Ala
320 325 330
aca agt gca tac att ccc ttg aat aat tac ttg gtg ttt aat gat gta 1060
Thr Ser Ala Tyr Ile Pro Leu Asn Asn Tyr Leu Val Phe Asn Asp Val
335 340 345
gat ggg ctg tat aca tac aca ttt gaa gca gaa aga aag gaa aac tgc 1108
Asp Gly Leu Tyr Thr Tyr Thr Phe Glu Ala Glu Arg Lys Glu Asn Cys
1$ 350 355 360
cca get tgt agc cag ctt cct caa aat att cag ttt tct cca tca get 1156
Pro Ala Cys Ser Gln Leu Pro Gln Asn Ile Gln Phe Ser Pro Ser Ala
365 370 375 380
aaa cta cag gag gtt ttg gat tat cta acc aat agt get tct ctg caa 1204
Lys Leu Gln Glu Val Leu Asp Tyr Leu Thr Asn Ser Ala Ser Leu Gln
385 390 395
2S atg aaa tct cca gcc atc aca gcc acc cta gag gga aaa aat aga aca 1252
Met Lys Ser Pro Ala Ile Thr Ala Thr Leu Glu Gly Lys Asn Arg Thr
400 405 410
ctt tac tta cag tcg gta acc tct att gaa gaa cga aca agg cca aat 1300
Leu Tyr Leu Gln Ser Val Thr Ser Ile Glu Glu Arg Thr Arg Pro Asn
415 420 425
ctc tcc aaa aca ttg aaa gaa ttg ggg ctt gtt gat gga caa gaa ctg 1348
Leu Ser Lys Thr Leu Lys Glu Leu Gly Leu Val Asp Gly Gln Glu Leu
430 435 440
gcg gtt get gat gtc acc acc cca cag act gta cta ttc aaa ctt cat 1396
Ala Val Ala Asp Val Thr Thr Pro Gln Thr Val Leu Phe Lys Leu His
445 450 455 460
ttt act tct taa ggaaaatctc cacataatag aaaactcatg gaaataatat 1448
Phe Thr Ser
4$ actttgtggatgctaagaagttgaatcgatgtcatttttagcaatagtgttgccacgatt1508
tgtctttttt tatataatgaaccactcttttttaactttgtaaccttcccttgaagacag1568
aattttggtg ttggtgcttgtaagcattttcattaataatatgagaaatgatacctggag1628
agagagatta tgagcaaatgtattgcttcttttagaggaggaagcatacaacctcttttg1688
tgtgaatttt gttattatggtcaaagaatgcattcctaagttttcatttgagtacccaaa1748
tacacaaaaggtgtccctttaaggaaaataaagaattaagttttaaataacattacattt1808
tacaatctga catctggagtatattgaacataggctatttcttgatataacactcattta1868
CA 02449417 2003-12-04
Ig
attgtggccatccaaatgaatattattgcagaatttatcttgttcataatgatttgtaaa1928
tggtgttatagctgaatacctgtgcatgaatgggcaatattttcatctgtttacttgtag1988
$ tgccatagaggccaatatgcacaatattaactaatgccaagacatggctgtttaaaaaat2048
ttaatgttcaaacagttatcactgatgcttttgcactatttattaataaaatcatatatt2108
gtgtaaaaaaaaaaaaaaaaas 2130
<210> 6
<211> 463
<212> PRT
I$ <213> Homosapiens
<400> 6
Met Ala Gly Glu Lys Lys Arg Arg
Asp Glu Pro Arg Ile Glu
Glu Glu
1 5 10 15
Leu Leu Ala Glu Lys Met Ala Val Asp Gly Gly Cys Gly Asp Thr Gly
20 25 30
2$
Asp Trp Glu Gly Arg Trp Asn His Val Lys Lys Phe Leu Glu Arg Ser
40 45
Gly Pro Phe Thr His Pro Asp Phe Glu Pro Ser Thr Glu Ser Leu Gln
50 55 60
3$ Phe Leu Leu Asp Thr Cys Lys Val Leu Val Ile Gly Ala Gly Gly Leu
65 70 75 80
Gly Cys Glu Leu Leu Lys Asn Leu Ala Leu Ser Gly Phe Arg Gln Ile
85 90 95
$~
His Val Ile Asp Met Asp Thr Ile Asp Val Ser Asn Leu Asn Arg Gln
100 105 110
Phe Leu Phe Arg Pro Lys Asp Ile Gly Arg Pro Lys Ala Glu Val Ala
115 120 125
Ala Glu Phe Leu Asn Asp Arg Val Pro Asn Cys Asn Val Val Pro His
130 135 140
$$ Phe Tyr Lys Ile Gln Asp Phe Asn Asp Thr Phe Tyr Arg Gln Phe His
145 150 155 160
CA 02449417 2003-12-04
19
Ile Ile Val Cys Gly Leu Asp Ser Ile Ile Ala Arg Arg Trp Ile Asn
165 170 175
$ Gly Met Leu Ile Ser Leu Leu Asn Tyr Glu Asp Gly Val Leu Asp Pro
180 185 190
Ser Ser Ile Val Pro Leu Ile Asp Gly Gly Thr Glu Gly Phe Lys Gly
195 200 205
20
Asn Ala Arg Val Ile Leu Pro Gly Met Thr Ala Cys Ile Glu Cys Thr
210 215 220
Leu Glu Leu Tyr Pro Pro Gln Val Asn Phe Pro Met Cys Thr Ile Ala
225 230 235 240
Ser Met Pro Arg Leu Pro Glu His Cys Ile Glu Tyr Val Arg Met Leu
245 250 255
Gln Trp Pro Lys Glu Gln Pro Phe Gly Glu Gly Val Pro Leu Gly Gly
260 265 270
Asp Asp Pro Glu His Ile Gln Trp Ile Phe Gln Lys Ser Leu Glu Arg
275 280 285
40
Ala Ser Gln Tyr Asn Ile Arg Gly Val Thr Tyr Arg Leu Thr Gln Gly
290 295 300
Val Val Lys Arg Ile Ile Pro Ala Val Ala Ser Thr Asn Ala Val Ile
305 310 315 320
Ala Ala Val Cys Ala Thr Glu Val Phe Lys Ile Ala Thr Ser Ala Tyr
325 330 335
Ile Pro Leu Asn Asn Tyr Leu Val Phe Asn Asp Val Asp Gly Leu Tyr
340 345 350
Thr Tyr Thr Phe Glu Ala Glu Arg Lys Glu Asn Cys Pro Ala Cys Ser
355 360 365
Gln Leu Pro Gln Asn Ile Gln Phe Ser Pro Ser Ala Lys Leu Gln Glu
370 375 380
Val Leu Asp Tyr Leu Thr Asn Ser Ala Ser Leu Gln Met Lys Ser Pro
385 390 395 400
CA 02449417 2003-12-04
5
Ala Ile Thr Ala Thr Leu Glu Gly Lys Asn Arg Thr Leu Tyr Leu Gln
405 410 415
Ser Val Thr Ser Ile Glu Glu Arg Thr Arg Pro Asn Leu Ser Lys Thr
420 425 430
Leu Lys Glu Leu Gly Leu Val Asp Gly Gln Glu Leu Ala Val Ala Asp
435 440 445
Val Thr Thr Pro Gln Thr Val Leu Phe Lys Leu His Phe Thr Ser
450 455 460
<210> 7
<211> 1579
<212> DNA
<213> Homo Sapiens
<220>
<221>
CDS
<222> (54)..(605)
<400> 7
ccgggccgtg acagacggcc cggcggcgac 56
ggcagaggaa acc
gggagagagg atg
Met
1
tca tctccc agtccgggc aagaggcgg atggacacg gacgtggtcaag 104
Ser SerPro SerProGly LysArgArg MetAspThr AspValValLys
5 10 15
ctc atcgag agtaaacat gaggttacg atcctggga ggacttaatgaa 152
Leu IleGlu SerLysHis GluValThr IleLeuGly GlyLeuAsnGlu
20 25 30
ttt gtagtg aagttttat ggaccacaa ggaacacca tatgaaggcgga 200
Phe ValVal LysPheTyr GlyProGln GlyThrPro TyrGluGlyGly
35 40 45
gta tggaaa gttagagtg gacctacct gataaatac cctttcaaatct 248
Val TrpLys ValArgVal AspLeuPro AspLysTyr ProPheLysSer
55 60 65
50 cca tctata ggattcatg aataaaatt ttccatccc aacattgatgaa 296
Pro SerIle GlyPheMet AsnLysIle PheHisPro AsnIleAspGlu
70 75 80
gcg tcagga actgtgtgt ctagatgta attaatcaa acttggacaget 344
SS Ala SerGly ThrValCys LeuAspVal IleAsnGln ThrTrpThrAla
85 90 95
ctc tatgat cttaccaat atatttgag tccttcctg cctcagttattg 392
CA 02449417 2003-12-04
21
Leu Tyr Asp Leu Thr Asn Ile Phe Glu Ser Phe Leu Pro Gln Leu Leu
100 105 110
gcc tat cct aac ccc ata gat cct ctc aat ggt gac get gca gcc atg 440
$ Ala Tyr Pro Asn Pro Ile Asp Pro Leu Asn Gly Asp Ala Ala Ala Met
115 120 125
tac ctc cac cga cca gaa gaa tac aag cag aaa att aaa gag tac atc 488
Tyr Leu His Arg Pro Glu Glu Tyr Lys Gln Lys Ile Lys Glu Tyr Ile
1~ 130 135 140 145
cag aaa tac gcc acg gag gag gcg ctg aaa gaa cag gaa gag ggt acc 536
Gln Lys Tyr Ala Thr Glu Glu Ala Leu Lys Glu Gln Glu Glu Gly Thr
150 155 160
1$
ggg gac agc tca tcg gag agc tct atg tct gac ttt tcc gaa gat gag 584
Gly Asp Ser Ser Ser Glu Ser Ser Met Ser Asp Phe Ser Glu Asp Glu
165 170 175
20 gcc cag gat atg gag ttg tag tagaaaaagc acctgctttt cagaaagact 635
Ala Gln Asp Met Glu Leu
180
attatttcctaaccatgagaagcagactataatattcatatttaaacaaagcaatttttt695
2$
ttattactaaacaaggtttttatgaataatagcattgatatatatatattatatatcacc755
ctttagatcttgatttcttggtcatttctcaacctgaggtgcatagcatattcccacatt815
30 ccatttggtagcaatatgcggtctgaatgcatgcattcatgagtccatgtggccaagtca875
gcctgtgtgctactgaactgtcgaaggaaatagccgctctgataggtagatgtgagtaaa935
aagaacaggaaaaaattgcttcttttattggtttccaaagaaacaaaccaaaccaaccag995
3$
ctcttggatgtgaagataaaatagtgcttttttgaaatggagaggaaaaacttggggagg1055
aagaggcctgctgtgggggcatcggagccagccatgtaagaatcagagctgctccttcct1115
40 gtgaatcctaggtggccctatgtcttctgtggagttacagtataaagcagggagctaatt1175
aagagtattaaaacttaaaaccattttttgactctgattttaagtacatttttatatgtc1235
agttgctgcccttcacactaccaggccctgcagccacagtgttctgttggagaaacttgg1295
4$
ggaagtgttttctgaaccagttctttttcttggggtagagcgtgaaatccagacctgttt1355
ttgaaaggacagcacaggaggagaaaagtgactgggacgatgcttcctctcatccaaaac1415
$~ acatgcagagtcacatcctcatcctagtgtttggcagtttgagaccgctaccctgaactt1475
aagagctttaaatatgagggttgtgtttctgggggggttatttttttggtgtgtgtgtgt1535
gtgtattgtgcttagaaaggttgcagatttcatcttcacctacc 1579
$$
<210> s
<211> 1a3
CA 02449417 2003-12-04
22
<212> PRT
<213> Homo sapiens
<400> 8
$
Met Ser Ser Pro Ser Pro Gly Lys Arg Arg Met Asp Thr Asp Val Val
1 5 10 15
Lys Leu Ile Glu Ser Lys His Glu Val Thr Ile Leu Gly Gly Leu Asn
25 30
Glu Phe Val Val Lys Phe Tyr Gly Pro Gln Gly Thr Pro Tyr Glu Gly
1$ 35 40 45
2$
Gly Val Trp Lys Val Arg Val Asp Leu Pro Asp Lys Tyr Pro Phe Lys
50 55 60
Ser Pro Ser Ile Gly Phe Met Asn Lys Ile Phe His Pro Asn Ile Asp
65 70 75 80
Glu Ala Ser Gly Thr Val Cys Leu Asp Val Ile Asn Gln Thr Trp Thr
85 90 95
Ala Leu Tyr Asp Leu Thr Asn Ile Phe Glu Ser Phe Leu Pro Gln Leu
100 105 110
Leu Ala Tyr Pro Asn Pro Ile Asp Pro Leu Asn Gly Asp Ala Ala Ala
3$ 115 120 125
4$
Met Tyr Leu His Arg Pro Glu Glu Tyr Lys Gln Lys Ile Lys Glu Tyr
130 135 140
Ile Gln Lys Tyr Ala Thr Glu Glu Ala Leu Lys Glu Gln Glu Glu Gly
145 150 155 160
Thr GIy Asp Ser Ser Ser Glu Ser Ser Met Ser Asp Phe Ser Glu Asp
165 170 175
$~ Glu Ala Gln Asp Met Glu Leu
180
<210> 9
$$ <211> 1530
<212> DNA
<213> Homo sapiens
CA 02449417 2003-12-04
23
<220>
<221> CDS
<222> (193)..(1260)
<400> 9
agcactcccg gagcctgcaa cgcttgagat cctctccgcg cccgccaccc cgcagggtgc 60
cccgcgccgt tcccgccgcc ccgccgcccc cgtcgcgggc ccctgcaccc cgagcatccg 120
ccccgggtgg cacgtccccg agcccaccag gccggccccg tctccccatc cgtctagtcc 180
gctcgcggtg cc atg cca ttc ctc ggg cag gac tgg cgg tcc ccc ggg cag 231
Met Pro Phe Leu Gly Gln Asp Trp Arg Ser Pro Gly Gln
1 5 to
aac tgg gtg aag acg gcc gac ggc tgg aag cgc ttc ctg gat gag aag 279
Asn Trp Val Lys Thr Ala Asp Gly Trp Lys Arg Phe Leu Asp Glu Lys
15 20 25
agc ggc agt ttc gtg agc gac ctc agc agt tac tgc aac aag gag gta 327
Ser Gly Ser Phe Val Ser Asp Leu Ser Ser Tyr Cys Asn Lys Glu Val
35 40 45
2$ tac aat aag gag aat ctt ttc aac agc ctg aac tat gat gtt gca gcc 375
Tyr Asn Lys Glu Asn Leu Phe Asn Ser Leu Asn Tyr Asp Val Ala Ala
50 55 60
aag aag aga aag aag gac atg ctg aat agc aaa acc aaa act cag tat 423
30 Lys Lys Arg Lys Lys Asp Met Leu Asn Ser Lys Thr Lys Thr Gln Tyr
65 70 75
ttc cac caa gaa aaa tgg atc tat gtt cac aaa gga agt act aaa gag 471
Phe His Gln Glu Lys Trp Ile Tyr Val His Lys Gly Ser Thr Lys Glu
3$ 80 85 90
cgc cat gga tat tgc acc ctg ggg gaa get ttc aac aga ctg gac ttc 519
Arg His Gly Tyr Cys Thr Leu Gly Glu Ala Phe Asn Arg Leu Asp Phe
95 100 105
tca act gcc att ctg gat tcc aga aga ttt aac tac gtg gtc cgg ctg 567
Ser Thr Ala Ile Leu Asp Ser Arg Arg Phe Asn Tyr Val Val Arg Leu
110 115 120 125
ttg gag ctg ata gca aag tca cag ctc aca tcc ctg agt ggc atc gcc 615
Leu Glu Leu Ile Ala Lys Ser Gln Leu Thr Ser Leu Ser Gly Ile Ala
130 135 140
caa aag aac ttc atg aat att ttg gaa aaa gtg gta ctg aaa gtc ctt 663
$0 Gln Lys Asn Phe Met Asn Ile Leu Glu Lys Val Val Leu Lys Val Leu
145 150 155
gaa gac cag caa aac att aga cta ata agg gaa cta ctc cag acc ctc 711
Glu Asp Gln Gln Asn Ile Arg Leu Ile Arg Glu Leu Leu Gln Thr Leu
$$ 160 165 170
tac aca tcc tta tgt aca ctg gtc caa aga gtc ggc aag tct gtg ctg 759
Tyr Thr Ser Leu Cys Thr Leu Val Gln Arg Val Gly Lys Ser Val Leu
CA 02449417 2003-12-04
24
175 180 185
gtc ggg aac att aac atg tgg gtg tat cgg atg gag acg att ctc cac 807
Val Gly Asn Ile Asn Met Trp Val Tyr Arg Met Glu Thr Ile Leu His
$ 190 195 200 205
tgg cag cag cag ctg aac aac att cag atc acc agg cct gcc ttc aaa 855
Trp Gln Gln Gln Leu Asn Asn Ile Gln Ile Thr Arg Pro Ala Phe Lys
210 215 220
ggc ctc acc ttc act gac ctg cct ttg tgc cta caa ctg aac atc atg 903
Gly Leu Thr Phe Thr Asp Leu Pro Leu Cys Leu Gln Leu Asn Ile Met
225 230 235
cag agg ctg agc gac ggg cgg gac ctg gtc agc ctg ggc cag get gcc 951
Gln Arg Leu Ser Asp Gly Arg Asp Leu Val Ser Leu Gly Gln Ala Ala
240 245 250
ccc gac ctg cac gtg ctc agc gaa gac cgg ctg ctg tgg aag aaa ctc 999
Pro Asp Leu His Val Leu Ser Glu Asp Arg Leu Leu Trp Lys Lys Leu
255 260 265
tgc cag tac cac ttc tcc gag cgg cag atc cgc aaa cga tta att ctg 1047
Cys Gln Tyr His Phe Ser Glu Arg Gln Ile Arg Lys Arg Leu Ile Leu
270 275 280 285
tca gac aaa ggg cag ctg gat tgg aag aag atg tat ttc aaa ctt gtc 1095
Ser Asp Lys Gly Gln Leu Asp Trp Lys Lys Met Tyr Phe Lys Leu Val
290 295 300
cga tgt tac cca agg aaa gag cag tat gga gat acc ctt cag ctc tgc 1143
Arg Cys Tyr Pro Arg Lys Glu Gln Tyr Gly Asp Thr Leu Gln Leu Cys
305 310 315
aaa cac tgt cac atc ctt tcc tgg aag ggc act gac cat ccg tgc act 1191
Lys His Cys His Ile Leu Ser Trp Lys Gly Thr Asp His Pro Cys Thr
320 325 330
gcc aat aac cca gag agc tgc tcc gtt tca ctt tca ccc cag gac ttt 1239
Ala Asn Asn Pro Glu Ser Cys Ser Val Ser Leu Ser Pro Gln Asp Phe
335 340 345
atc aac ttg ttc aag ttc tga atcccagcac atgacaacac ttcagaaggg 1290
Ile Asn Leu Phe Lys Phe
350 355
tccccctgct gactggagag ctgggaatat ggcatttgga cacttcattt gtaaatagtg 1350
tacattttaa acattggctc gaaacttcag agataagtca tggagaggac attggagggg 1410
agaaatgcag ttgctgactg ggaatttaag aatgtgaact tctcactaga attggtatgg 1470
aaaagcaaaa tactgtaaat aaactttttt tctaacaatt tgccaaaaaa aaaaaaaaaa 1530
SS
<210> 10
<211> 355
<212> PRT
CA 02449417 2003-12-04
<213> Homo sapiens
<400> 10
$ Met Pro Phe Leu Gly Gln Asp Trp Arg Ser Pro Gly Gln Asn Trp Val
1 5 10 15
Lys Thr Ala Asp Gly Trp Lys Arg Phe Leu Asp Glu Lys Ser Gly Ser
10 20 25 30
Phe Val Ser Asp Leu Ser Ser Tyr Cys Asn Lys Glu Val Tyr Asn Lys
40 45
20
Glu Asn Leu Phe Asn Ser Leu Asn Tyr Asp Val Ala Ala Lys Lys Arg
50 55 60
Lys Lys Asp Met Leu Asn Ser Lys Thr Lys Thr Gln Tyr Phe His Gln
65 70 75 80
2S Glu Lys Trp Ile Tyr Val His Lys Gly Ser Thr Lys Glu Arg His Gly
85 90 95
Tyr Cys Thr Leu Gly Glu Ala Phe Asn Arg Leu Asp Phe Ser Thr Ala
30 loo l05 llo
40
Ile Leu Asp Ser Arg Arg Phe Asn Tyr Val Val Arg Leu Leu Glu Leu
115 120 125
Ile Ala Lys Ser Gln Leu Thr Ser Leu Ser Gly Ile Ala Gln Lys Asn
130 135 140
Phe Met Asn Ile Leu Glu Lys Val Val Leu Lys Val Leu Glu Asp Gln
145 150 155 160
Gln Asn Ile Arg Leu Ile Arg Glu Leu Leu Gln Thr Leu Tyr Thr Ser
165 170 175
Leu Cys Thr Leu Val Gln Arg Val Gly Lys Ser Val Leu Val Gly Asn
180 185 190
Ile Asn Met Trp Val Tyr Arg Met Glu Thr Ile Leu His Trp Gln Gln
195 200 205
Gln Leu Asn Asn Ile Gln Ile Thr Arg Pro Ala Phe Lys Gly Leu Thr
210 215 220
CA 02449417 2003-12-04
26
10
Phe Thr Asp Leu Pro Leu Cys Leu Gln Leu Asn Ile Met Gln Arg Leu
225 230 235 240
Ser Asp Gly Arg Asp Leu Val Ser Leu Gly Gln Ala Ala Pro Asp Leu
245 250 255
His Val Leu Ser Glu Asp Arg Leu Leu Trp Lys Lys Leu Cys Gln Tyr
260 265 270
1$ His Phe Ser Glu Arg Gln Ile Arg Lys Arg Leu Ile Leu Ser Asp Lys
275 280 285
Gly Gln Leu Asp Trp Lys Lys Met Tyr Phe Lys Leu Val Arg Cys Tyr
20 290 295 300
2$
Pro Arg Lys Glu Gln Tyr Gly Asp Thr Leu Gln Leu Cys Lys His Cys
305 310 315 320
His Ile Leu Ser Trp Lys Gly Thr Asp His Pro Cys Thr Ala Asn Asn
325 330 335
Pro Glu Ser Cys Ser Val Ser Leu Ser Pro Gln Asp Phe Ile Asn Leu
340 345 350
3$ Phe Lys Phe
355
<210> 11
<211> 9372
<212> DNA
<213> Homo Sapiens
<220>
<221> CDS
<222> (946)..(8613)
<400> 11
$0 tgaataattgaactttgtttatttctccatatttttgcagtggtaattccattataaaac60
ctaatgaaac aatgtttttatagatggtgtggaaagacttttctgggctcagaggtgaaa120
ctgacccttg tgtatcagcagcatttctgactgactgagagagtgtagtgattaacagag180
ttgtgatgtt agttaagaaacttagatttgccattgtagcttttctaccaattagcagat240
tgtttaactc actgaaattgtaaagtggtagacgtggacttagtcattactgggcagctt300
CA 02449417 2003-12-04
27
atgaattgtattcatttactcatgatgtaaaaatggttagtctccacttttaaggctcta 360
gttctagtggctaaataggtacttatttatacagtatgataactgctgtattaaaataca 420
tgtctcaaatgtggaatagtagaagaggtgaagaaaatcatagtttgaggtagaatactg 480
tttgctggtcttaaaaactgtggtattttggtgattccataaattaggtcagatacttcc 540
1~ actggagggaaacagtttaaaggatatatgtgatactattaatagaatgaggaagacaca 600
ccagatatttaggagggaattagcgagcttgaaactaagagctggtttgaatgagactgg 660
gtcataagtgatttcaagtaccagattaaggcactgagattttatttttaagcactgaag 720
1$
tcagattttttccttttaaaagaaaggattcatgatgaaatctgctttttgttttgcaga 780
gagcttggagataattctggtggctgtgtggagtatgtgttggaggtattaaattttcac 840
2~ agtatatataaggcagcaattgataggcctttcacagattcttctgataactacataaag 900
agacaaaaaaaagaaaaaagagcaaagatctgtgctgtgtcaagt aca gcc 957
atg atc
Met Thr Ala
Ile
1
2$
act cat ggc tct cca gta gga ggg aac gac agc cag ggc cag gtt ctt 1005
Thr His Gly Ser Pro Val Gly Gly Asn Asp Ser Gln Gly Gln Val Leu
10 15 20
gat ggc cag tct cag cat ctc ttc caa cag aac cag act tca tca cct 1053
Asp Gly Gln Ser Gln His Leu Phe Gln Gln Asn Gln Thr Ser Ser Pro
25 30 35
gat tct tcc aat gag aat tcc gta gca act cct cct cca gag gaa caa 1101
3$ Asp Ser Ser Asn Glu Asn Ser Val Ala Thr Pro Pro Pro Glu Glu Gln
40 45 50
ggg caa ggt gat gcc cca cca cag cat gaa gat gaa gag cct gca ttt 1149
Gly Gln Gly Asp Ala Pro Pro Gln His Glu Asp Glu Glu Pro Ala Phe
55 60 65
cca cat act gag ctg gca aac ctg gat gac atg atc aac agg cct cga 1197
Pro His Thr Glu Leu Ala Asn Leu Asp Asp Met Ile Asn Arg Pro Arg
70 75 80
4$
tgg gtg gtt cct gtt ttg cca aaa ggg gaa tta gaa gtg ctt tta gaa 1245
Trp Val Val Pro Val Leu Pro Lys Gly Glu Leu Glu Val Leu Leu Glu
85 90 95 100
$0 get get att gat ctt agt gta aaa ggc ctt gat gtt aaa agt gaa gca 1293
Ala Ala Ile Asp Leu Ser Val Lys Gly Leu Asp Val Lys Ser Glu Ala
105 110 115
tgc caa cgt ttt ttt cga gat gga cta aca ata tct ttc act aaa att 1341
$$ Cys Gln Arg Phe Phe Arg Asp Gly Leu Thr Ile Ser Phe Thr Lys Ile
120 125 130
ctt atg gat gag get gtg agt ggc tgg aag ttt gaa att cat aga tgt 1389
CA 02449417 2003-12-04
28
Leu Met Asp Glu Ala Val Ser Gly Trp Lys Phe Glu Ile His Arg Cys
135 140 145
att att aac aat act cat cgc cta gtg gag ctt tgt gtg gcc aag ttg 1437
Ile Ile Asn Asn Thr His Arg Leu Val Glu Leu Cys Val Ala Lys Leu
150 155 160
tcc caa gat tgg ttt cca ctt cta gaa ctt ctc gcc atg gcc tta aat 1485
Ser Gln Asp Trp Phe Pro Leu Leu Glu Leu Leu Ala Met Ala Leu Asn
lss 170 175 lao
cct cac tgc aag ttt cat atc tac aat ggt aca cgt ccg tgt gaa tta 1533
Pro His Cys Lys Phe His Ile Tyr Asn Gly Thr Arg Pro Cys Glu Leu
185 190 195
att tcc tca aat get cag ttg cct gaa gaa gaa tta ttt get cgt tct 1581
Ile Ser Ser Asn Ala Gln Leu Pro Glu Glu Glu Leu Phe Ala Arg Ser
200 205 210
tca gat cct cga tca cca aaa ggt tgg cta gtg gat ctc atc aat aaa 1629
Ser Asp Pro Arg Ser Pro Lys Gly Trp Leu Val Asp Leu Ile Asn Lys
215 220 225
ttt ggc aca tta aat ggg ttc cag att ttg cat gat cgt ttt ttt aat 1677
2S Phe Gly Thr Leu Asn Gly Phe Gln Ile Leu His Asp Arg Phe Phe Asn
230 235 240
gga tca gca tta aat att caa ata att gca get ctt att aaa cca ttt 1725
Gly Ser Ala Leu Asn Ile Gln Ile Ile Ala Ala Leu Ile Lys Pro Phe
245 250 255 260
gga caa tgc tat gag ttt ctc agt caa cat aca ctg aaa aag tac ttc 1773
Gly Gln Cys Tyr Glu Phe Leu Ser Gln His Thr Leu Lys Lys Tyr Phe
265 270 275
att cca gtt ata gaa ata gtt cca cat tta ttg gaa aac tta act gat 1821
Ile Pro Val Ile Glu Ile Val Pro His Leu Leu Glu Asn Leu Thr Asp
280 285 290
gaa gaa ctg aaa aag gag gca aag aat gaa gcc aaa aat gat gcc ctt 1869
Glu Glu Leu Lys Lys Glu Ala Lys Asn Glu Ala Lys Asn Asp Ala Leu
295 300 305
tca atg att att aaa tct ttg aag aac tta get tca aga att tca gga 1917
4$ Ser Met Ile Ile Lys Ser Leu Lys Asn Leu Ala Ser Arg Ile Ser Gly
310 315 320
caa gat gag act ata aaa aat ttg gaa att ttt agg tta aag atg ata 1965
Gln Asp Glu Thr Ile Lys Asn Leu Glu Ile Phe Arg Leu Lys Met Ile
325 330 335 340
ctc aga ttg ttg caa att tcc tct ttt aat gga aag atg aat gca ctg 2013
Leu Arg Leu Leu Gln Ile Ser Ser Phe Asn Gly Lys Met Asn Ala Leu
345 350 355
SS
aat gaa ata aat aag gtt ata tct agt gta tca tat tat act cat cgg 2061
Asn Glu Ile Asn Lys Val Ile Ser Ser Val Ser Tyr Tyr Thr His Arg
360 365 370
CA 02449417 2003-12-04
29
cat agt aat cct gag gag gaa gaa tgg ctg aca get gag cga atg gca 2109
His Ser Asn Pro Glu Glu Glu Glu Trp Leu Thr Ala Glu Arg Met Ala
375 380 385
gaa tgg ata cag caa aat aat atc tta tcc ata gtc ttg caa gac agt 2157
Glu Trp Ile Gln Gln Asn Asn Ile Leu Ser Ile Val Leu Gln Asp Ser
390 395 400
IO ctt cat caa cca caa tat gta gaa aag cta gag aaa att ctt cgt ttt 2205
Leu His Gln Pro Gln Tyr Val Glu Lys Leu Glu Lys Ile Leu Arg Phe
405 410 415 420
gtg att aaa gaa aag get ctt aca tta cag gac ctt gat aat atc tgg 2253
1$ Val Ile Lys Glu Lys Ala Leu Thr Leu Gln Asp Leu Asp Asn Ile Trp
425 430 435
gca gca cag gca gga aaa cat gaa gcc att gtg aag aat gta cat gat 2301
Ala Ala Gln Ala Gly Lys His Glu Ala Ile Val Lys Asn Val His Asp
20 440 445 450
2$
ctg cta gca aag ttg get tgg gat ttt tct cct gga caa ctt gat cat 2349
Leu Leu Ala Lys Leu Ala Trp Asp Phe Ser Pro Gly Gln Leu Asp His
455 460 465
ctt ttt gat tgc ttt aag gca agt tgg aca aat gca agt aaa aag caa 2397
Leu Phe Asp Cys Phe Lys Ala Ser Trp Thr Asn Ala Ser Lys Lys Gln
470 475 480
30 cgt gaa aag ctc ctt gag ttg ata cgc cgt ctt gca gaa gat gat aaa 2445
Arg Glu Lys Leu Leu Glu Leu Ile Arg Arg Leu Ala Glu Asp Asp Lys
485 490 495 500
gat ggt gtg atg gca cac aaa gtg ttg aac ctt ctt tgg aac ctg get 2493
3$ Asp Gly Val Met Ala His Lys Val Leu Asn Leu Leu Trp Asn Leu Ala
505 510 515
cag agt gat gat gtg cct gta gac atc atg gac ctt get ctt agt gcc 2541
Gln Ser Asp Asp Val Pro Val Asp Ile Met Asp Leu Ala Leu Ser Ala
40 520 525 530
4$
cac ata aaa ata cta gat tat agt tgt tcc cag gat cga gat gca cag 2589
His Ile Lys Ile Leu Asp Tyr Ser Cys Ser Gln Asp Arg Asp Ala Gln
535 540 545
aag atc cag tgg ata gat cac ttt ata gaa gaa ctt cgc aca aat gac 2637
Lys Ile Gln Trp Ile Asp His Phe Ile Glu Glu Leu Arg Thr Asn Asp
550 555 560
$0 aag tgg gta att cct get ctg aaa caa ata aga gaa att tgt agt ttg 2685
Lys Trp Val Ile Pro Ala Leu Lys Gln Ile Arg Glu Ile Cys Ser Leu
565 570 575 580
ttt ggt gaa gca tct caa aat ttg agt caa act cag cga agt ccc cac 2733
$$ Phe Gly Glu Ala Ser Gln Asn Leu Ser Gln Thr Gln Arg Ser Pro His
585 590 595
ata ttt tat cgc cat gat tta atc aac cag ctt caa caa aat cat get 2781
CA 02449417 2003-12-04
Ile Phe Tyr Arg His Asp Leu Ile Asn Gln Leu Gln Gln Asn His Ala
600 605 610
tta gtt act ttg gta gca gaa aac ctt gca acc tac atg aat agc atc 2829
5 Leu Val Thr Leu Val Ala Glu Asn Leu Ala Thr Tyr Met Asn Ser Ile
615 620 625
aga ttg tat get gga gat cat gaa gac tat gat cca caa aca gtg agg 2877
Arg Leu Tyr Ala Gly Asp His Glu Asp Tyr Asp Pro Gln Thr Val Arg
10 630 635 640
ctt gga agt cga tac agt cat gtt caa gaa gtt caa gaa cga cta aac 2925
Leu Gly Ser Arg Tyr Ser His Val Gln Glu Val Gln Glu Arg Leu Asn
645 650 655 660
ttc ctt aga ttt tta ctg aag gat ggc caa ctg tgg ctc tgt get cct 2973
Phe Leu Arg Phe Leu Leu Lys Asp Gly Gln Leu Trp Leu Cys Ala Pro
665 670 675
cag gca aaa caa ata tgg aag tgc tta gca gaa aat gca gtt tat ctt 3021
Gln Ala Lys Gln Ile Trp Lys Cys Leu Ala Glu Asn Ala Val Tyr Leu
680 685 690
tgt gat cgt gaa gcc tgt ttt aag tgg tat tcc aag tta atg ggg gat 3069
Cys Asp Arg Glu Ala Cys Phe Lys Trp Tyr Ser Lys Leu Met Gly Asp
695 700 705
gaa cca gac ttg gat cct gat att aat aag gac ttc ttt gaa agt aat 3117
Glu Pro Asp Leu Asp Pro Asp Ile Asn Lys Asp Phe Phe Glu Ser Asn
710 715 720
gta ctt cag ctt gat cct tcc ctt tta act gaa aat gga atg aaa tgc 3165
Val Leu Gln Leu Asp Pro Ser Leu Leu Thr Glu Asn Gly Met Lys Cys
725 730 735 740
ttt gaa aga ttt ttc aaa get gtc aat tgt cga gaa agg aaa cta ata 3213
Phe Glu Arg Phe Phe Lys Ala Val Asn Cys Arg Glu Arg Lys Leu Ile
745 750 755
gca aaa aga aga tcc tat atg atg gat gat ttg gaa tta att gga cta 3261
Ala Lys Arg Arg Ser Tyr Met Met Asp Asp Leu Glu Leu Ile Gly Leu
760 765 770
gac tac ctt tgg agg gtt gtg att cag agt agt gac gag att get aac 3309
Asp Tyr Leu Trp Arg Val Val Ile Gln Ser Ser Asp Glu Ile Ala Asn
775 780 785
aga get ata gat ctt ctt aaa gag ata tac aca aac ctt ggc cca aga 3357
Arg Ala Ile Asp Leu Leu Lys Glu Ile Tyr Thr Asn Leu Gly Pro Arg
790 795 800
tta aaa gcc aat cag gtg gtt atc cat gaa gac ttc att cag tct tgc 3405
Leu Lys Ala Asn Gln Val Val Ile His Glu Asp Phe IIe Gln Ser Cys
805 810 815 820
ttt gat cgt tta aaa gca tca tat gat aca ctg tgt gtt ttt gat ggt 3453
Phe Asp Arg Leu Lys Ala Ser Tyr Asp Thr Leu Cys Val Phe Asp Gly
825 830 835
CA 02449417 2003-12-04
31
gac aaa aac agc att aat tgt gca aga caa gaa gcc att cga atg gtt 3501
Asp Lys Asn Ser Ile Asn Cys Ala Arg Gln Glu Ala Ile Arg Met Val
840 845 850
aga gta tta act gtt ata aaa gag tac att aat gaa tgt gac agt gat 3549
Arg Val Leu Thr Val Ile Lys Glu Tyr Ile Asn Glu Cys Asp Ser Asp
855 860 865
1~ tat cac aag gaa aga atg att tta cct atg tcg aga gca ttt tgt ggc 3597
Tyr His Lys Glu Arg Met Ile Leu Pro Met Ser Arg Ala Phe Cys Gly
870 875 880
aaa cac ctc tct ctt ata gtt cgg ttt cca aac cag ggc aga cag gtt 3645
1$ Lys His Leu Ser Leu Ile Val Arg Phe Pro Asn Gln Gly Arg Gln Val
885 890 895 900
gat gag ttg gat ata tgg ttt cat acg aat gac aca att ggt tca gta 3693
Asp Glu Leu Asp Ile Trp Phe His Thr Asn Asp Thr Ile Gly Ser Val
905 910 915
cgg cga tgt att gtt aat cgt att aaa gcc aat gta gcc cac aaa aaa 3741
Arg Arg Cys Ile Val Asn Arg Ile Lys Ala Asn Val Ala His Lys Lys
920 925 930
att gaa ctt ttt gtg ggt ggt gag ctg ata gat tct gaa aat gac aga 3789
Ile Glu Leu Phe Val Gly Gly Glu Leu Ile Asp Ser Glu Asn Asp Arg
935 940 945
aag ctaatt ggacaa ttaaac ttaaaa gat aaa 3837
tct cta att
aca gcc
Lys LeuIle GlyGln LeuAsn LeuLys Asp Lys
Ser Leu Ile
Thr Ala
950 955 960
aaa cttaca caaata aatttc aatatg cca tca 3885
agt cct gat
agc tct
Lys LeuThr GlnIle AsnPhe AsnMet Pro Ser
Ser Pro Asp
Ser Ser
965 970 975 980
tcc gattcc tcaact gcatct cctgga aac cac 3933
cgt aat cat
tac aat
Ser AspSer SerThr AlaSer ProGly Asn His
Arg Asn His
Tyr Asn
4~ 985 990 995
gat ggtccc aatcta aaggtg gaaagt tgt ttg ggg gtg ata 3978
cct
Asp GlyPro AsnLeu LysVal GluSer Cys Leu Gly Val Ile
Pro
1000 1005 1010
atg tcagtg catccc aaatac atctct ttc ctt caa ttt gca 4023
tgg
Met SerVal HisPro LysTyr IleSer Phe Leu Gln Phe Ala
Trp
1015 1020 1025
aac ttaggt agcaac ctgaat atgcca cct ctt aat gga gca 4068
aaa
Asn LeuGly SerAsn LeuAsn MetPro Pro Leu Asn Gly Ala
Lys
1030 1035 1040
aga gtactt atgaaa cttatg ccacca gat aga get gta gaa 4113
aca
Arg ValLeu MetLys LeuMet ProPro Asp Arg Ala Val Glu
Thr
1045 1050 1055
aaa ttacga actgtt tgtttg gaccat gca aac gga gaa ggc 4158
ctt
CA 02449417 2003-12-04
32
Lys Leu Arg Thr Val Cys Leu Asp His Ala Asn Leu Gly Glu Gly
1060 1065 1070
aaa ctt agt cca ccc ctt gac tcc ctt ttc ttt ggt cct tct gcc 4203
$ Lys Leu Ser Pro Pro Leu Asp Ser Leu Phe Phe Gly Pro Ser Ala
1075 1080 1085
tcc caa gtt cta tac cta aca gag gta gtt tat gcc ttg tta atg 4248
Ser Gln Val Leu Tyr Leu Thr Glu Val Val Tyr Ala Leu Leu Met
1~ 1090 1095 1100
cct get ggt gtg cct cta act gat ggg tcc tct gac ttt caa gtt 4293
Pro Ala Gly Val Pro Leu Thr Asp Gly Ser Ser Asp Phe Gln Val
1105 1110 1115
cac ttc ttg aaa agt ggt ggc tta cct ctt gta ctg agt atg cta 4338
His Phe Leu Lys Ser Gly Gly Leu Pro Leu Val Leu Ser Met Leu
1120 1125 1130
2~ ata aga aat aac ttc ttg cca aat aca gat atg gaa act cga agg 4383
Ile Arg Asn Asn Phe Leu Pro Asn Thr Asp Met Glu Thr Arg Arg
1135 1140 1145
ggt get tat tta aat get ctt aaa ata gcc aaa ctg ttg tta act 4428
2$ Gly Ala Tyr Leu Asn Ala Leu Lys Ile Ala Lys Leu Leu Leu Thr
1150 1155 1160
gcg att ggc tat ggc cat gtt cga get gta gca gaa get tgt cag 4473
Ala Ile Gly Tyr Gly His Val Arg Ala Val Ala Glu Ala Cys Gln
3~ 1165 1170 1175
3$
cca gtt gta gat ggt aca gac ccc ata aca cag att aac caa gtt 4518
Pro Val Val Asp Gly Thr Asp Pro Ile Thr Gln Ile Asn Gln Val
1180 1185 1190
act cat gat caa gca gtg gtg cta caa agt gcc ctt cag agc att 4563
Thr His Asp Gln Ala Val Val Leu Gln Ser Ala Leu Gln Ser Ile
1195 1200 1205
40 cct aat ccc tca tcc gag tgc gta ctt aga aat gag tcc ata ctt 4608
Pro Asn Pro Ser Ser Glu Cys Val Leu Arg Asn Glu Ser Ile Leu
1210 1215 1220
ctt get cag gaa ata tct aat gag get tca aga tat atg cct gat 4653
4$ Leu Ala Gln Glu Ile Ser Asn Glu Ala Ser Arg Tyr Met Pro Asp
1225 1230 1235
att tgt gta att agg get ata cag aaa att atc tgg gca tca gca 4698
Ile Cys Val Ile Arg Ala Ile Gln Lys Ile Ile Trp Ala Ser Ala
1240 1245 1250
tgt ggg gca tta gga cta ttt ttt agc cca aat gaa gaa ata act 4743
Cys Gly Ala Leu Gly Leu Phe Phe Ser Pro Asn Glu Glu Ile Thr
1255 1260 1265
$$
aaa att tat cag atg acc acc aat gga agc aat aag ctg gag gtg 4788
Lys Ile Tyr Gln Met Thr Thr Asn Gly Ser Asn Lys Leu Glu Val
1270 1275 1280
CA 02449417 2003-12-04
33
gaa gat gaa caa gtt tgt tgt gaa gca ctg gaa gtg atg acc tta 4833
Glu Asp Glu Gln Val Cys Cys Glu Ala Leu Glu Val Met Thr Leu
1285 1290 1295
tgt tttget tta cttcca acagcgttg gat gcacttagt aaa gaa 4878
Cys PheAla Leu LeuPro ThrAlaLeu Asp AlaLeuSer Lys Glu
1300 1305 1310
aaa gcctgg cag accttc atcattgac tta ttattgcac tgt cca 4923
Lys AlaTrp Gln ThrPhe IleIleAsp Leu LeuLeuHis Cys Pro
1315 1320 1325
agc aaaact gtt cgtcag ttggcacag gag cagttcttt tta atg 4968
1$ Ser LysThr Val ArgGln LeuAlaGln Glu GlnPhePhe Leu Met
1330 1335 1340
tgc accaga tgt tgcatg ggacacagg cct ctgcttttc ttc att 5013
Cys ThrArg Cys CysMet GlyHisArg Pro LeuLeuPhe Phe Ile
1345 1350 1355
act ttactc ttt accata ctggggagc aca gcaagagag aag ggt 5058
Thr LeuLeu Phe ThrIle LeuGlySer Thr AlaArgGlu Lys Gly
1360 1365 1370
aaa tattca ggt gattat ttcacactt tta cggcacctt ctc aat 5103
Lys TyrSer Gly AspTyr PheThrLeu Leu ArgHisLeu Leu Asn
1375 1380 1385
tat gettac aat ggcaat attaacata ccc aatgetgaa gtt ctt 5148
Tyr AlaTyr Asn GlyAsn IleAsnIle Pro AsnAlaGlu Val Leu
1390 1395 1400
ctt gtcagt gaa attgat tggctcaaa agg attagggat aat gtt 5193
3S Leu ValSer Glu IleAsp TrpLeuLys Arg IleArgAsp Asn Val
1405 1410 1415
aaa aacaca ggt gaaaca ggtgtcgaa gag ccaatactg gaa ggc 5238
Lys AsnThr Gly GluThr GlyValGlu Glu ProIleLeu Glu Gly
1420 1425 1430
cac cttggg gta acaaaa gagttattg gcc tttcaaact tct gag 5283
His LeuGly Val ThrLys GluLeuLeu Ala PheGlnThr Ser Glu
1435 1440 1445
aaa aagtat cac tttggt tgtgaaaaa gga ggtgetaat ctc att 5328
Lys LysTyr His PheGly CysGluLys Gly GlyAlaAsn Leu Ile
1450 1455 1460
aaa gaatta att gatgat ttcatcttt ccc gcatccaaa gtt tac 5373
Lys GluLeu Ile AspAsp PheIlePhe Pro AlaSerLys Val Tyr
1465 1470 1475
ctg cagtat tta agaagt ggagaacta cca getgagcag get att 5418
$S Leu GlnTyr Leu ArgSer GlyGluLeu Pro AlaGluGln Ala Ile
1480 1485 1490
cca gtctgt agt tcaccc gttaccatc aat gccggtttt gag cta 5463
CA 02449417 2003-12-04
34
Pro Val Cys Ser Ser Pro Val Thr Ile Asn Ala Gly Phe Glu Leu
1495 1500 1505
ctt gta gca tta get att ggc tgt gtg agg aat ctc aaa cag ata 5508
$ Leu Val Ala Leu Ala Ile Gly Cys Val Arg Asn Leu Lys Gln Ile
1510 1515 1520
gta gac tgt ttg act gaa atg tat tac atg ggc aca gca att act 5553
Val Asp Cys Leu Thr Glu Met Tyr Tyr Met Gly Thr Ala Ile Thr
1525 1530 1535
act tgt gaa gca ctt act gag tgg gaa tat ctg ccc cct gtt gga 5598
Thr Cys Glu Ala Leu Thr Glu Trp Glu Tyr Leu Pro Pro Val Gly
1540 1545 1550
ccc cgc cca cca aaa gga ttt gtg gga ctc aaa aat get ggt get 5643
Pro Arg Pro Pro Lys Gly Phe Val Gly Leu Lys Asn Ala Gly Ala
1555 1560 1565
acg tgt tac atg aac tct gtg atc cag cag cta tac atg att cct 5688
Thr Cys Tyr Met Asn Ser Val Ile Gln Gln Leu Tyr Met Ile Pro
1570 1575 1580
tct atc agg aac agt att ctt gca att gaa ggc aca ggt agt gat 5733
2S Ser Ile Arg Asn Ser Ile Leu Ala Ile Glu Gly Thr Gly Ser Asp
1585 1590 1595
tta cac gat gat atg ttc ggg gat gag aag cag gac agt gag agt 5778
Leu His Asp Asp Met Phe Gly Asp Glu Lys Gln Asp Ser Glu Ser
1600 1605 1610
aat gtt gat ccc cga gat gat gta ttt gga tat cct cat caa ttt 5823
Asn Val Asp Pro Arg Asp Asp Val Phe Gly Tyr Pro His Gln Phe
1615 1620 1625
gaa gac aag cca gca tta agt aag aca gaa gat agg aaa gag tat 5868
Glu Asp Lys Pro Ala Leu Ser Lys Thr Glu Asp Arg Lys Glu Tyr
1630 1635 1640
aat att ggt gtc cta aga cac ctt cag gtc atc ttt ggt cat tta 5913
Asn Ile Gly Val Leu Arg His Leu Gln Val Ile Phe Gly His Leu
1645 1650 1655
get get tcc caa cta caa tac tat gta ccc aga gga ttt tgg aaa 5958
4$ Ala Ala Ser Gln Leu Gln Tyr Tyr Val Pro Arg Gly Phe Trp Lys
1660 1665 1670
cag ttc agg ctt tgg ggt gaa cct gtt aat ctc cgt gaa caa cat 6003
Gln Phe Arg Leu Trp Gly Glu Pro Val Asn Leu Arg Glu Gln His
$0 1675 1680 1685
gat gcc tta gag ttt ttt aat tct ttg gtg gat agt tta gat gaa 6048
Asp Ala Leu Glu Phe Phe Asn Ser Leu Val Asp Ser Leu Asp Glu
1690 1695 1700
$$
get tta aaa get tta gga cac ccg get ata cta agt aaa gtc cta 6093
Ala Leu Lys Ala Leu Gly His Pro Ala Ile Leu Ser Lys Val Leu
1705 1710 1715
CA 02449417 2003-12-04
5
gga ggc tcc ttt get gat cag aag atc tgc cag ggc tgc cca cat 6138
Gly Gly Ser Phe Ala Asp Gln Lys Ile Cys Gln Gly Cys Pro His
1720 1725 1730
agg ttt gaa tgt gaa gaa tct ttt aca act ttg aat gtg gat att 6183
Arg Phe Glu Cys Glu Glu Ser Phe Thr Thr Leu Asn Val Asp Ile
1735 1740 1745
10 aga aat cat caa aat ctt ctt gac tct ttg gaa cag tat atc aaa 6228
Arg Asn His Gln Asn Leu Leu Asp Ser Leu Glu Gln Tyr Ile Lys
1750 1755 1760
gga gat tta ttg gaa ggt gca aat gca tat cat tgt gaa aaa tgt 6273
IS Gly Asp Leu Leu Glu Gly Ala Asn Ala Tyr His Cys Glu Lys Cys
1765 1770 1775
gat aaa aag gtt gac aca gta aag cgc ctg cta att aaa aaa ttg 6318
Asp Lys Lys Val Asp Thr Val Lys Arg Leu Leu Ile Lys Lys Leu
20 1780 178s 1790
cct cgg gtt ctt get atc caa ctc aaa cga ttt gac tat gac tgg 6363
Pro Arg Val Leu Ala Ile Gln Leu Lys Arg Phe Asp Tyr Asp Trp
1795 1800 1805
gaa aga gaa tgt gca att aaa ttc aat gat tat ttt gaa ttt cct 6408
Glu Arg Glu Cys Ala Ile Lys Phe Asn Asp Tyr Phe Glu Phe Pro
1810 1815 1820
cga gag ctg gat atg gga cct tac aca gta gca ggt gtt gca aac 6453
Arg Glu Leu Asp Met Gly Pro Tyr Thr Val Ala Gly Val Ala Asn
1825 1830 1835
ctg gaa agg gat aat gta aac tca gaa aat gag ttg att gaa cag 6498
Leu Glu Arg Asp Asn Val Asn Ser Glu Asn Glu Leu Ile Glu Gln
1840 1845 1850
aaa gag cag tct gac aat gaa act gca gga ggc aca aag tac aga 6543
Lys Glu Gln Ser Asp Asn Glu Thr Ala Gly Gly Thr Lys Tyr Arg
1855 1860 1865
ctt gta gga gtg ctt gta cac agt ggt caa gca agc ggt ggg cat 6588
Leu Val Gly Val Leu Val His Ser Gly Gln Ala Ser Gly Gly His
1870 1875 1880
tat tat tct tac atc att caa agg aat ggt aaa gat gat cag aca 6633
Tyr Tyr Ser Tyr Ile Ile Gln Arg Asn Gly Lys Asp Asp Gln Thr
1885 1890 1895
gat cac tgg tat aaa ttt gat gat gga gat gta aca gaa tgc aaa 6678
Asp His Trp Tyr Lys Phe Asp Asp Gly Asp Val Thr Glu Cys Lys
1900 1905 1910
atg gat gat gat gaa gaa atg aaa aat cag tgt ttt ggt gga gag 6723
SS Met Asp Asp Asp Glu Glu Met Lys Asn Gln Cys Phe Gly Gly Glu
1915 1920 1925
tac atg gga gaa gta ttt gat cac atg atg aag cgc atg tca tat 6768
CA 02449417 2003-12-04
36
Tyr Met Gly Glu Val Phe Asp His Met Met Lys Arg Met Ser Tyr
1930 1935 1940
agg cga cag aag agg tgg tgg aat get tac ata cct ttt tat gaa 6813
Arg Arg Gln Lys Arg Trp Trp Asn Ala Tyr Ile Pro Phe Tyr Glu
1945 1950 1955
caa atg gat atg ata gat gaa gat gat gag atg ata aga tac ata 6858
Gln Met Asp Met Ile Asp Glu Asp Asp Glu Met Ile Arg Tyr Ile
1960 1965 1970
tca gag cta act att gca aga ccc cat cag atc att atg tca cca 6903
Ser Glu Leu Thr Ile Ala Arg Pro His Gln Ile Ile Met Ser Pro
1975 1980 1985
gcc att gag aga agt gta cgg aaa caa aat gtg aaa ttt atg cat 6948
Ala Ile Glu Arg Ser Val Arg Lys Gln Asn Val Lys Phe Met His
1990 1995 2000
aac cga ttg caa tat agt tta gag tat ttt cag ttt gtg aaa aaa 6993
Asn Arg Leu Gln Tyr Ser Leu Glu Tyr Phe Gln Phe Val Lys Lys
2005 2010 2015
ctg ctt aca tgt aat ggt gtt tat tta aac cct get cca ggg cag 7038
Leu Leu Thr Cys Asn Gly Val Tyr Leu Asn Pro Ala Pro Gly Gln
2020 2025 2030
gat tat ttg ttg cct gaa gca gaa gaa att act atg att agt att 7083
Asp Tyr Leu Leu Pro Glu Ala Glu Glu Ile Thr Met Ile Ser Ile
2035 2040 2045
cag ctt get get aga ttc ctc ttt acc act gga ttt cac acc aag 7128
Gln Leu Ala Ala Arg Phe Leu Phe Thr Thr Gly Phe His Thr Lys
2050 2055 2060
aaa ata gtt cgt ggt cct gcc agt gac tgg tat gat gca ctg tgc 7173
Lys Ile Val Arg Gly Pro Ala Ser Asp Trp Tyr Asp Ala Leu Cys
2065 2070 2075
gtt ctt ctc cgt cac agc aaa aat gta cgt ttt tgg ttt act cat 7218
Val Leu Leu Arg His Ser Lys Asn Val Arg Phe Trp Phe Thr His
2080 2085 2090
aat gtc ctt ttt aat gta tca aat cgc ttc tct gaa tac ctc ctg 7263
Asn Val Leu Phe Asn Val Ser Asn Arg Phe Ser Glu Tyr Leu Leu
2095 2100 2105
gag tgc cct agt gca gaa gtg agg ggt gca ttt gca aaa ctt ata 7308
Glu Cys Pro Ser Ala Glu Val Arg Gly Ala Phe Ala Lys Leu Ile
2110 2115 2120
gtg ttt att gca cac ttt tcc ttg caa gat ggg tct tgt cct tct 7353
Val Phe Ile Ala His Phe Ser Leu Gln Asp Gly Ser Cys Pro Ser
2125 2130 2135
cct ttt gca tct cca gga cct tct agt cag gca tgt gat aac ttg 7398
Pro Phe Ala Ser Pro Gly Pro Ser Ser Gln Ala Cys Asp Asn Leu
2140 2145 2150
CA 02449417 2003-12-04
37
agc ttg agt gac cac tta cta aga gcc aca cta aat ctc ttg aga 7443
Ser Leu Ser Asp His Leu Leu Arg Ala Thr Leu Asn Leu Leu Arg
2155 2160 2165
agg gaa gtt tca gag cat gga cat cat tta cag caa tat ttt aat 7488
Arg Glu Val Ser Glu His Gly His His Leu Gln Gln Tyr Phe Asn
2170 2175 2180
ttg ttt gta atg tat gcc aat tta ggt gtg gca gaa aaa aca cag 7533
Leu Phe Val Met Tyr Ala Asn Leu Gly Val Ala Glu Lys Thr Gln
2185 2190 2195
ctt ctg aaa ttg aat gta cct get acc ttt atg ctt gtg tct tta 7578
1$ Leu Leu Lys Leu Asn Val Pro Ala Thr Phe Met Leu Val Ser Leu
2200 2205 2210
gac gag gga cca ggt cct cca atc aaa tat cag tat get gaa tta 7623
Asp Glu Gly Pro Gly Pro Pro Ile Lys Tyr Gln Tyr Ala GIu Leu
2215 2220 2225
ggc aag tta tat tca gta gtg tct cag ctg att cgt tgt tgc aat 7668
Gly Lys Leu Tyr Ser Val Val Ser Gln Leu Ile Arg Cys Cys Asn
2230 2235 2240
gtg tca tca aca atg cag tct tca atc aat ggt aat ccc cct ctc 7713
Val Ser Ser Thr Met Gln Ser Ser Ile Asn Gly Asn Pro Pro Leu
2245 2250 2255
ccc aat cct ttc ggt gac ctt aat tta tca cag cct ata atg cca 7758
Pro Asn Pro Phe Gly Asp Leu Asn Leu Ser Gln Pro Ile Met Pro
2260 2265 2270
att cag cag aat gtg tta gac att tta ttt gtg aga aca agt tat 7803
3$ Ile Gln Gln Asn Val Leu Asp Ile Leu Phe Val Arg Thr Ser Tyr
2275 2280 2285
gtg aag aaa att att gaa gac tgc agt aac tca gag gat acc atc 7848
Val Lys Lys Ile Ile Glu Asp Cys Ser Asn Ser Glu Asp Thr Ile
2290 2295 2300
aaa tta ctt cgc ttt tgc tct tgg gag aat cct cag ttc tca tct 7893
Lys Leu Leu Arg Phe Cys Ser Trp Glu Asn Pro Gln Phe Ser Ser
2305 2310 2315
act gtc ctc agc gaa ctt ctc tgg cag gtt gca tat tca tat acc 7938
Thr Val Leu Ser Glu Leu Leu Trp Gln Val Ala Tyr Ser Tyr Thr
2320 2325 2330
SO tat gaa ctt cgg cca tat tta gat cta ctt ttc caa att tta ctg 7983
Tyr Glu Leu Arg Pro Tyr Leu Asp Leu Leu Phe Gln Ile Leu Leu
2335 2340 2345
att gag gac tcc tgg cag act cac aga att cat aat gca ctt aaa 8028
$$ Ile Glu Asp Ser Trp Gln Thr His Arg Ile His Asn Ala Leu Lys
2350 2355 2360
gga att cca gat gac aga gat ggg ctg ttc gat aca ata cag cgc 8073
CA 02449417 2003-12-04
38
Gly Ile Pro Asp Asp Arg Asp Gly Leu Phe Asp Thr Ile Gln Arg
2365 2370 2375
tcg aag aat cac tat caa aaa cga gca tat cag tgc ata aaa tgt 8118
Ser Lys Asn His Tyr Gln Lys Arg Ala Tyr Gln Cys Ile Lys Cys
2380 2385 2390
atg gta get cta ttt agc agt tgt cct gtt get tac cag atc tta 8163
Met Val Ala Leu Phe Ser Ser Cys Pro Val Ala Tyr Gln Ile Leu
2395 2400 2405
IS
cag ggt aac gga gat ctt aaa aga aaa tgg acc tgg gca gtg gaa 8208
Gln Gly Asn Gly Asp Leu Lys Arg Lys Trp Thr Trp Ala Val Glu
2410 2415 2420
tgg cta gga gat gaa ctt gaa aga aga cca tat act ggc aat cct 8253
Trp Leu Gly Asp Glu Leu Glu Arg Arg Pro Tyr Thr Gly Asn Pro
2425 2430 2435
20 cag tat agt tac aac aat tgg tct cct cca gta caa agc aat gaa 8298
Gln Tyr Ser Tyr Asn Asn Trp Ser Pro Pro Val Gln Ser Asn Glu
2440 2445 2450
aca gca aat ggt tat ttc tta gaa aga tca cat agt get agg atg 8343
25 Thr Ala Asn Gly Tyr Phe Leu Glu Arg Ser His Ser Ala Arg Met
2455 2460 2465
aca ctt gca aaa get tgt gaa ctc tgt cca gaa gag gag cca gat 8388
Thr Leu Ala Lys Ala Cys Glu Leu Cys Pro Glu Glu Glu Pro Asp
30 2470 2475 2480
gac cag gat gcc cca gat gag cat gag ccc tct cca tca gaa gat 8433
Asp Gln Asp Ala Pro Asp Glu His Glu Pro Ser Pro Ser Glu Asp
2485 2490 2495
gcc cca tta tat cct cat tca cct gcc tct cag tat caa cag aat 8478
Ala Pro Leu Tyr Pro His Ser Pro Ala Ser Gln Tyr Gln Gln Asn
2500 2505 2510
aat cat gta cat gga cag cca tat aca gga cca gca gca cat cac 8523
Asn His Val His Gly Gln Pro Tyr Thr Gly Pro Ala Ala His His
2515 2520 2525
ttg aac aac cct cag aaa aca ggc caa cga aca caa gaa aat tat 8568
4$ Leu Asn Asn Pro Gln Lys Thr Gly Gln Arg Thr Gln Glu Asn Tyr
2530 2535 2540
gaa ggc aat gaa gaa gta tcc tca cct cag atg aag gat cag tga 8613
Glu Gly Asn Glu Glu Val Ser Ser Pro Gln Met Lys Asp Gln
$~ 2545 2550 2555
aaagcaataa ttaactgctt cctttatgac tatgcactaa ggtcttatag tccaaacttt 8673
ctctgtgtct ggctagtatt gaaaactaga taaactgctc caaaccaaca tggagtaaag 8733
agcatattca ctggtttatt tgcagtaatt tgcaatttgt cagtgtataa gacacatgca 8793
gggtgaagtg tacagagttt tgtaacaaat gactggtcct aatctgtaaa tgagaaaggt 8853
CA 02449417 2003-12-04
39
atatatacta tgttaatgtctgactgttaattcttaagcaagaaactttttttgatgaaa8913
acaagtcaga tctacacagtcacacaattattttttgttgtgttcactacattgtgcaat8973
tgatattgcc tgctttgagcagtttggtcaacttaccaacttccccccaaaaaagggaac9033
ataaaagagc ccatctttgtcagtttacaccaatagtttcttgttaatccttctttcctg9093
gatatataaggctggtggtaacttttgaattatatggttgatgtggaaaattggcagtgt9153
aacatttcta gatacttttcattacctttttattctggtatataggctaaccactttaaa9213
gctattctta tgctgtaacagttagcatggcttcacactgtttgtgtagccaagaggaca9273
gaattacatg aatgacagtgcccagagtgacagctgtatattgctcagagcttttatttc9333
ttatacctag aataaatataaaatgggggaaaaaaaaaa 9372
<210> 12
<211> 2555
<212> PRT
<213> Homo Sapiens
<400> 12
35
Met Thr Ala Ile Thr His Gly Ser Pro Val Gly Gly Asn Asp Ser Gln
1 5 10 15
Gly Gln Val Leu Asp Gly Gln Ser Gln His Leu Phe Gln Gln Asn Gln
20 25 30
Thr Ser Ser Pro Asp Ser Ser Asn Glu Asn Ser Val Ala Thr Pro Pro
40 45
Pro Glu Glu Gln Gly Gln Gly Asp Ala Pro Pro Gln His Glu Asp Glu
55 60
Glu Pro Ala Phe Pro His Thr Glu Leu Ala Asn Leu Asp Asp Met Ile
4$ 65 70 75 80
Asn Arg Pro Arg Trp Val Val Pro Val Leu Pro Lys Gly Glu Leu Glu
85 90 95
Val Leu Leu Glu Ala Ala Ile Asp Leu Ser Val Lys Gly Leu Asp Val
100 105 110
Lys Ser Glu Ala Cys Gln Arg Phe Phe Arg Asp Gly Leu Thr Ile Ser
115 120 125
CA 02449417 2003-12-04
5
Phe Thr Lys Ile Leu Met Asp Glu Ala Val Ser Gly Trp Lys Phe Glu
130 135 140
Ile His Arg Cys Ile Ile Asn Asn Thr His Arg Leu Val Glu Leu Cys
145 150 155 160
10 Val Ala Lys Leu Ser Gln Asp Trp Phe Pro Leu Leu Glu Leu Leu Ala
165 170 175
Met Ala Leu Asn Pro His Cys Lys Phe His Ile Tyr Asn Gly Thr Arg
IS 180 185 190
25
Pro Cys Glu Leu Ile Ser Ser Asn Ala Gln Leu Pro Glu Glu Glu Leu
195 200 205
Phe Ala Arg Ser Ser Asp Pro Arg Ser Pro Lys Gly Trp Leu Val Asp
210 215 220
Leu Ile Asn Lys Phe Gly Thr Leu Asn Gly Phe Gln Ile Leu His Asp
225 230 235 240
Arg Phe Phe Asn Gly Ser Ala Leu Asn Ile Gln Ile Ile Ala Ala Leu
245 250 255
Ile Lys Pro Phe Gly Gln Cys Tyr Glu Phe Leu Ser Gln His Thr Leu
260 265 270
Lys Lys Tyr Phe Ile Pro Val Ile Glu Ile Val Pro His Leu Leu Glu
275 280 285
45
Asn Leu Thr Asp Glu Glu Leu Lys Lys Glu Ala Lys Asn Glu Ala Lys
290 295 300
Asn Asp Ala Leu Ser Met Ile Ile Lys Ser Leu Lys Asn Leu Ala Ser
305 310 315 320
$0 Arg Ile Ser Gly Gln Asp Glu Thr Ile Lys Asn Leu Glu Ile Phe Arg
325 330 335
Leu Lys Met Ile Leu Arg Leu Leu Gln Ile Ser Ser Phe Asn Gly Lys
55 340 345 350
Met Asn Ala Leu Asn Glu Ile Asn Lys Val Ile Ser Ser Val Ser Tyr
CA 02449417 2003-12-04
41
355 360 365
Tyr Thr His Arg His Ser Asn Pro Glu Glu Glu Glu Trp Leu Thr Ala
370 375 380
Glu Arg Met Ala Glu Trp Ile Gln Gln Asn Asn Ile Leu Ser Ile Val
385 390 395 400
15
Leu Gln Asp Ser Leu His Gln Pro Gln Tyr Val Glu Lys Leu Glu Lys
405 410 415
Ile Leu Arg Phe Val Ile Lys Glu Lys Ala Leu Thr Leu Gln Asp Leu
420 425 430
Asp Asn Ile Trp Ala Ala Gln Ala Gly Lys His Glu Ala Ile Val Lys
435 440 445
Asn Val His Asp Leu Leu Ala Lys Leu Ala Trp Asp Phe Ser Pro Gly
450 455 460
Gln Leu Asp His Leu Phe Asp Cys Phe Lys Ala Ser Trp Thr Asn Ala
465 470 475 480
35
Ser Lys Lys Gln Arg Glu Lys Leu Leu Glu Leu Ile Arg Arg Leu Ala
485 490 495
Glu Asp Asp Lys Asp Gly Val Met Ala His Lys Val Leu Asn Leu Leu
500 505 510
Trp Asn Leu Ala Gln Ser Asp Asp Val Pro Val Asp Ile Met Asp Leu
515 520 525
Ala Leu Ser Ala His Ile Lys Ile Leu Asp Tyr Ser Cys Ser Gln Asp
4$ 530 535 540
Arg Asp Ala Gln Lys Ile Gln Trp Ile Asp His Phe Ile Glu Glu Leu
545 550 555 560
Arg Thr Asn Asp Lys Trp Val Ile Pro Ala Leu Lys Gln Ile Arg Glu
565 570 575
Ile Cys Ser Leu Phe Gly Glu Ala Ser Gln Asn Leu Ser Gln Thr Gln
580 585 590
CA 02449417 2003-12-04
42
$
Arg Ser Pro His Ile Phe Tyr Arg His Asp Leu Ile Asn Gln Leu Gln
595 600 605
Gln Asn His Ala Leu Val Thr Leu Val Ala Glu Asn Leu Ala Thr Tyr
610 615 620
Met Asn Ser Ile Arg Leu Tyr Ala Gly Asp His Glu Asp Tyr Asp Pro
625 630 635 640
Gln Thr Val Arg Leu Gly Ser Arg Tyr Ser His Val Gln Glu Val Gln
1$ 645 650 655
2$
Glu Arg Leu Asn Phe Leu Arg Phe Leu Leu Lys Asp Gly Gln Leu Trp
660 665 670
Leu Cys Ala Pro Gln Ala Lys Gln Ile Trp Lys Cys Leu Ala Glu Asn
675 680 685
Ala Val Tyr Leu Cys Asp Arg Glu Ala Cys Phe Lys Trp Tyr Ser Lys
690 695 700
Leu Met Gly Asp Glu Pro Asp Leu Asp Pro Asp Ile Asn Lys Asp Phe
705 710 715 720
Phe Glu Ser Asn Val Leu Gln Leu Asp Pro Ser Leu Leu Thr Glu Asn
3$ 725 730 735
4$
Gly Met Lys Cys Phe Glu Arg Phe Phe Lys Ala Val Asn Cys Arg Glu
740 745 750
Arg Lys Leu Ile Ala Lys Arg Arg Ser Tyr Met Met Asp Asp Leu Glu
755 760 765
Leu Ile Gly Leu Asp Tyr Leu Trp Arg Val Val Ile Gln Ser Ser Asp
770 775 780
$0 Glu Ile Ala Asn Arg Ala Ile Asp Leu Leu Lys Glu Ile Tyr Thr Asn
785 790 795 800
Leu Gly Pro Arg Leu Lys Ala Asn Gln Val Val Ile His Glu Asp Phe
$$ 805 810 815
Ile Gln Ser Cys Phe Asp Arg Leu Lys Ala Ser Tyr Asp Thr Leu Cys
CA 02449417 2003-12-04
43
820 825 830
Val Phe Asp Gly Asp Lys Asn Ser Ile Asn Cys Ala Arg Gln Glu Ala
835 840 845
Ile Arg Met Val Arg Val Leu Thr Val Ile Lys Glu Tyr Ile Asn Glu
850 855 860
Cys Asp Ser Asp Tyr His Lys Glu Arg Met Ile Leu Pro Met Ser Arg
865 870 875 880
Ala Phe Cys Gly Lys His Leu Ser Leu Ile Val Arg Phe Pro Asn Gln
885 890 895
Gly Arg Gln Val Asp Glu Leu Asp Ile Trp Phe His Thr Asn Asp Thr
900 905 910
Ile Gly Ser Val Arg Arg Cys Ile Val Asn Arg Ile Lys Ala Asn Val
915 920 925
Ala His Lys Lys Ile Glu Leu Phe Val Gly Gly Glu Leu Ile Asp Ser
930 935 940
Glu Asn Asp Arg Lys Leu Ile Gly Gln Leu Asn Leu Lys Asp Lys Ser
945 950 955 960
Leu Ile Thr Ala Lys Leu Thr Gln Ile Asn Phe Asn Met Pro Ser Ser
965 970 975
Pro Asp Ser Ser Ser Asp Ser Ser Thr Ala Ser Pro Gly Asn His Arg
980 985 990
Asn His Tyr Asn Asp Gly Pro Asn Leu Lys Val Glu Ser Cys Leu Pro
4$ 995 1000 1005
Gly Val Ile Met Ser Val His Pro Lys Tyr Ile Ser Phe Leu Trp
1010 1015 1020
SO
Gln Phe Ala Asn Leu Gly Ser Asn Leu Asn Met Pro Pro Leu Lys
1025 1030 1035
Asn Gly Ala Arg Val Leu Met Lys Leu Met Pro Pro Asp Arg Thr
1040 1045 1050
CA 02449417 2003-12-04
44
Ala Val Glu Lys Leu Arg Thr Val Cys Leu Asp His Ala Asn Leu
1055 1060 1065
Gly Glu Gly Lys Leu Ser Pro Pro Leu Asp Ser Leu Phe Phe Gly
1070 1075 1080
Pro Ser Ala Ser Gln Val Leu Tyr Leu Thr Glu Val Val Tyr Ala
1085 1090 1095
Leu Leu Met Pro Ala Gly Val Pro Leu Thr Asp Gly Ser Ser Asp
IS 1100 1105 1110
25
Phe Gln Val His Phe Leu Lys Ser Gly Gly Leu Pro Leu Val Leu
1115 1120 1125
Ser Met Leu Ile Arg Asn Asn Phe Leu Pro Asn Thr Asp Met Glu
1130 1135 1140
Thr Arg Arg Gly Ala Tyr Leu Asn Ala Leu Lys Ile Ala Lys Leu
1145 1150 1155
Leu Leu Thr Ala Ile Gly Tyr Gly His Val Arg Ala Val Ala Glu
1160 1165 1170
Ala Cys Gln Pro Val Val Asp Gly Thr Asp Pro Ile Thr Gln Ile
1175 1180 1185
45
Asn Gln Val Thr His Asp Gln Ala Val Val Leu Gln Ser Ala Leu
1190 1195 1200
Gln Ser Ile Pro Asn Pro Ser Ser Glu Cys Val Leu Arg Asn Glu
1205 1210 1215
Ser Ile Leu Leu Ala Gln Glu Ile Ser Asn Glu Ala Ser Arg Tyr
1220 1225 1230
$0 Met Pro Asp Ile Cys Val Ile Arg Ala Ile Gln Lys Ile Ile Trp
1235 1240 1245
Ala Ser Ala Cys Gly Ala Leu Gly Leu Phe Phe Ser Pro Asn Glu
55 1250 1255 1260
Glu Ile Thr Lys Ile Tyr Gln Met Thr Thr Asn Gly Ser Asn Lys
CA 02449417 2003-12-04
1265 1270 1275
Leu Glu Val Glu Asp Glu Gln Val Cys Cys Glu Ala Leu Glu Val
$ 1280 1285 1290
Met Thr Leu Cys Phe Ala Leu Leu Pro Thr Ala Leu Asp Ala Leu
1295 1300 1305
Ser Lys Glu Lys Ala Trp Gln Thr Phe Ile Ile Asp Leu Leu Leu
1310 1315 1320
1$
His Cys Pro Ser Lys Thr Val Arg Gln Leu Ala Gln Glu Gln Phe
1325 1330 1335
Phe Leu Met Cys Thr Arg Cys Cys Met Gly His Arg Pro Leu Leu
1340 1345 1350
Phe Phe Ile Thr Leu Leu Phe Thr Ile Leu Gly Ser Thr Ala Arg
1355 1360 1365
35
Glu Lys Gly Lys Tyr Ser Gly Asp Tyr Phe Thr Leu Leu Arg His
1370 1375 1380
Leu Leu Asn Tyr Ala Tyr Asn Gly Asn Ile Asn Ile Pro Asn Ala
1385 1390 1395
Glu Val Leu Leu Val Ser Glu Ile Asp Trp Leu Lys Arg Ile Arg
1400 1405 1410
Asp Asn Val Lys Asn Thr Gly Glu Thr Gly Val Glu Glu Pro Ile
1415 1420 1425
Leu Glu Gly His Leu Gly Val Thr Lys Glu Leu Leu Ala Phe Gln
1430 1435 1440
Thr Ser Glu Lys Lys Tyr His Phe Gly Cys Glu Lys Gly Gly Ala
1445 1450 1455
Asn Leu Ile Lys Glu Leu Ile Asp Asp Phe Ile Phe Pro Ala Ser
1460 1465 1470
Lys Val Tyr Leu Gln Tyr Leu Arg Ser Gly Glu Leu Pro Ala Glu
1475 1480 1485
CA 02449417 2003-12-04
46
Gln Ala Ile Pro Val Cys Ser Ser Pro Val Thr Ile Asn Ala Gly
1490 1495 1500
Phe Glu Leu Leu Val Ala Leu Ala Ile Gly Cys Val Arg Asn Leu
1505 1510 1515
Lys Gln Ile Val Asp Cys Leu Thr Glu Met Tyr Tyr Met Gly Thr
1520 1525 1530
Ala Ile Thr Thr Cys Glu Ala Leu Thr Glu Trp Glu Tyr Leu Pro
1535 1540 1545
25
Pro Val Gly Pro Arg Pro Pro Lys Gly Phe Val Gly Leu Lys Asn
1550 1555 1560
Ala Gly Ala Thr Cys Tyr Met Asn Ser Val Ile Gln Gln Leu Tyr
1565 1570 1575
Met Ile Pro Ser Ile Arg Asn Ser Ile Leu Ala Ile Glu Gly Thr
1580 1585 1590
Gly Ser Asp Leu His Asp Asp Met Phe Gly Asp Glu Lys Gln Asp
1595 1600 1605
Ser Glu Ser Asn Val Asp Pro Arg Asp Asp Val Phe Gly Tyr Pro
3$ 1610 1615 1620
45
His Gln Phe Glu Asp Lys Pro Ala Leu Ser Lys Thr Glu Asp Arg
1625 1630 1635
Lys Glu Tyr Asn Ile Gly Val Leu Arg His Leu Gln Val Ile Phe
1640 1645 1650
Gly His Leu Ala Ala Ser Gln Leu Gln Tyr Tyr Val Pro Arg Gly
1655 1660 1665
$0 Phe Trp Lys Gln Phe Arg Leu Trp Gly Glu Pro Val Asn Leu Arg
1670 1675 1680
Glu Gln His Asp Ala Leu Glu Phe Phe Asn Ser Leu Val Asp Ser
55 1685 1690 1695
Leu Asp Glu Ala Leu Lys Ala Leu Gly His Pro Ala Ile Leu Ser
CA 02449417 2003-12-04
47
1700 1705 1710
Lys Val Leu Gly Gly Ser Phe Ala Asp Gln Lys Ile Cys Gln Gly
$ 1715 1720 1725
Cys Pro His Arg Phe Glu Cys Glu Glu Ser Phe Thr Thr Leu Asn
1730 1735 1740
Val Asp Ile Arg Asn His Gln Asn Leu Leu Asp Ser Leu Glu Gln
1745 1750 1755
1$
Tyr Ile Lys Gly Asp Leu Leu Glu Gly Ala Asn Ala Tyr His Cys
1760 1765 1770
Glu Lys Cys Asp Lys Lys Val Asp Thr Val Lys Arg Leu Leu Ile
1775 1780 1785
Lys Lys Leu Pro Arg Val Leu Ala Ile Gln Leu Lys Arg Phe Asp
2$ 1790 1795 1800
Tyr Asp Trp Glu Arg Glu Cys Ala Ile Lys Phe Asn Asp Tyr Phe
1805 1810 1815
Glu Phe Pro Arg Glu Leu Asp Met Gly Pro Tyr Thr Val Ala Gly
1820 1825 1830
3$
Val Ala Asn Leu Glu Arg Asp Asn Val Asn Ser Glu Asn Glu Leu
1835 1840 1845
Ile Glu Gln Lys Glu Gln Ser Asp Asn Glu Thr Ala Gly Gly Thr
1850 1855 1860
Lys Tyr Arg Leu Val Gly Val Leu Val His Ser Gly Gln Ala Ser
4$ 1865 1870 1875
Gly Gly His Tyr Tyr Ser Tyr Ile Ile Gln Arg Asn Gly Lys Asp
1880 1885 1890
$0
Asp Gln Thr Asp His Trp Tyr Lys Phe Asp Asp Gly Asp Val Thr
1895 1900 1905
$$
Glu Cys Lys Met Asp Asp Asp Glu Glu Met Lys Asn Gln Cys Phe
1910 1915 1920
CA 02449417 2003-12-04
48
Gly Gly Glu Tyr Met Gly Glu Val Phe Asp His Met Met Lys Arg
1925 1930 1935
Met Ser Tyr Arg Arg Gln Lys Arg Trp Trp Asn Ala Tyr Ile Pro
1940 1945 1950
Phe Tyr Glu Gln Met Asp Met Ile Asp Glu Asp Asp Glu Met Ile
1955 1960 1965
Arg Tyr Ile Ser Glu Leu Thr Ile Ala Arg Pro His Gln Ile Ile
IS 1970 1975 1980
25
Met Ser Pro Ala Ile Glu Arg Ser Val Arg Lys Gln Asn Val Lys
1985 1990 1995
Phe Met His Asn Arg Leu Gln Tyr Ser Leu Glu Tyr Phe Gln Phe
2000 2005 2010
Val Lys Lys Leu Leu Thr Cys Asn Gly Val Tyr Leu Asn Pro Ala
2015 2020 2025
Pro Gly Gln Asp Tyr Leu Leu Pro Glu Ala Glu Glu Ile Thr Met
2030 2035 2040
Ile Ser Ile Gln Leu Ala Ala Arg Phe Leu Phe Thr Thr Gly Phe
2045 2050 2055
45
His Thr Lys Lys Ile Val Arg Gly Pro Ala Ser Asp Trp Tyr Asp
2060 2065 2070
Ala Leu Cys Val Leu Leu Arg His Ser Lys Asn Val Arg Phe Trp
2075 2080 2085
Phe Thr His Asn Val Leu Phe Asn Val Ser Asn Arg Phe Ser Glu
2090 2095 2100
Tyr Leu Leu Glu Cys Pro Ser Ala Glu Val Arg Gly Ala Phe Ala
2105 2110 2115
Lys Leu Ile Val Phe Ile Ala His Phe Ser Leu Gln Asp Gly Ser
5$ 2120 2125 2130
Cys Pro Ser Pro Phe Ala Ser Pro Gly Pro Ser Ser Gln Ala Cys
CA 02449417 2003-12-04
49
2135 2140 2145
Asp Asn Leu Ser Leu Ser Asp His Leu Leu Arg Ala Thr Leu Asn
$ 2150 2155 2160
Leu Leu Arg Arg Glu Val Ser Glu His Gly His His Leu Gln Gln
2165 2170 2175
Tyr Phe Asn Leu Phe Val Met Tyr Ala Asn Leu Gly Val Ala Glu
2180 2185 2190
1$
Lys Thr Gln Leu Leu Lys Leu Asn Val Pro Ala Thr Phe Met Leu
2195 2200 2205
Val Ser Leu Asp Glu Gly Pro Gly Pro Pro Ile Lys Tyr Gln Tyr
2210 2215 2220
Ala Glu Leu Gly Lys Leu Tyr Ser Val Val Ser Gln Leu Ile Arg
2$ 2225 2230 2235
Cys Cys Asn Val Ser Ser Thr Met Gln Ser Ser Ile Asn Gly Asn
2240 2245 2250
Pro Pro Leu Pro Asn Pro Phe Gly Asp Leu Asn Leu Ser Gln Pro
2255 2260 2265
3$
Ile Met Pro Ile Gln Gln Asn Val Leu Asp Ile Leu Phe Val Arg
2270 2275 2280
Thr Ser Tyr Val Lys Lys Ile Ile Glu Asp Cys Ser Asn Ser Glu
2285 2290 2295
Asp Thr Ile Lys Leu Leu Arg Phe Cys Ser Trp Glu Asn Pro Gln
4$ 2300 2305 2310
$0
Phe Ser Ser Thr Val Leu Ser Glu Leu Leu Trp Gln Val Ala Tyr
2315 2320 2325
Ser Tyr Thr Tyr Glu Leu Arg Pro Tyr Leu Asp Leu Leu Phe Gln
2330 2335 2340
$$
Ile Leu Leu Ile Glu Asp Ser Trp Gln Thr His Arg Ile His Asn
2345 2350 2355
CA 02449417 2003-12-04
$0
$
Ala Leu Lys Gly Ile Pro Asp Asp Arg Asp Gly Leu Phe Asp Thr
2360 2365 2370
Ile Gln Arg Ser Lys Asn His Tyr Gln Lys Arg Ala Tyr Gln Cys
2375 2380 2385
Ile Lys Cys Met Val Ala Leu Phe Ser Ser Cys Pro Val Ala Tyr
2390 2395 2400
Gln Ile Leu Gln Gly Asn Gly Asp Leu Lys Arg Lys Trp Thr Trp
1$ 2405 2410 2415
2$
Ala Val Glu Trp Leu Gly Asp Glu Leu Glu Arg Arg Pro Tyr Thr
2420 2425 2430
Gly Asn Pro Gln Tyr Ser Tyr Asn Asn Trp Ser Pro Pro Val Gln
2435 2440 2445
Ser Asn Glu Thr Ala Asn Gly Tyr Phe Leu Glu Arg Ser His Ser
2450 2455 2460
Ala Arg Met Thr Leu Ala Lys Ala Cys Glu Leu Cys Pro Glu Glu
2465 2470 2475
Glu Pro Asp Asp Gln Asp Ala Pro Asp Glu His Glu Pro Ser Pro
2480 2485 2490
4$
Ser Glu Asp Ala Pro Leu Tyr Pro His Ser Pro Ala Ser Gln Tyr
2495 2500 2505
Gln Gln Asn Asn His Val His Gly Gln Pro Tyr Thr Gly Pro Ala
2510 2515 2520
Ala His His Leu Asn Asn Pro Gln Lys Thr Gly Gln Arg Thr Gln
2525 2530 2535
$0 Glu Asn Tyr Glu Gly Asn Glu Glu Val Ser Ser Pro Gln Met Lys
2540 2545 2550
Asp Gln
$$ 2555
<210> 13
CA 02449417 2003-12-04
$l
<211> 22
<212> DNA
<213> Homo Sapiens
$ <400> 13
agtggcacta ctttgatgac as 22
<210> 14
<211> 22
<212> DNA
<213> Homo sapiens
<400> 14
1$ cgttggtaga agaggacata gg 22
<210> 15
<211> 22
<212> DNA
<213> Homo sapiens
<400> 15
actagatcga gtccaaggca gc 22
2$
<210> 16
<211> 17
<212> DNA
<213> Homo Sapiens
<400> 16
agcggttgcc atagcta 17
3$
<210> 17
<211> 20
<212> DNA
<213> Homo sapiens
<400> 17
aggacacata cgtggtgatc 20
4$ <210> is
<211> 26
<212> DNA
<213> Homo sapiens
$0 <400> is
catctcaaac gatttgaaca ctcagc 26
<210> 19
$$ <211> 15
<212> DNA
<213> Homo Sapiens
52
<400> 19
cgaggagcca atggc 15
<210> 20
<211> 24
<212> DNA
<213> Homo sapiens
<400> 20
gctccaatga ctagaacttt acat 24
<210> 21
IS <211> 22
<212> DNA
<213> Homo sapiens
<400> 21
acactggaga ctgggaaggt cg 22
<210> 22
<211> 16
2S <212> DNA
<213> Homo Sapiens
<400> 22
cggacgtggt caagct 16
<210> 23
<211> 20
<212> DNA
3S <213> Homo Sapiens
<400> 23
gccttcatat ggtgttcctt 20
<210> 24
<211> 24
<212> DNA
<213> Homo Sapiens
<400> 24
ttacgatcct gggaggactt aatg 24
<210> 25
<211> 15
<212> DNA
<213> Homo Sapiens
<400> 25
ggtccggctg ttgga 15
CA 02449417 2003-12-04
$3
<210> 26
<211> 22
<212> DNA
<213> Homo Sapiens
<400> 26
tcaaggactt tcagtaccac tt 22
1~ <210> 27
<211> 18
<212> DNA
<213> Homo Sapiens
1$ <400> 27
cctgagtggc atcgccca 18
<210> 28
2~ <211> 17
<212> DNA
<213> Homo Sapiens
<400> 28
2$ agggccaggt tcttgat 17
<210> 29
<211> 21
3~ <212> DNA
<213> Homo Sapiens
<400> 29
gagttgctac ggaattctca t 21
3$
<210> 30
<211> 27
<212> DNA
4~ <213> Homo Sapiens
<400> 30
catctcttcc aacagaacca gacttca 27
4$
<210> 31
<211> 1080
<212> DNA
<213> Rattus norvegicus
$
<220>
<221> misc_feature
<222> (13) . (14)
$$ <223> n is a, c, g, or t
<220>
<221> CDS
CA 02449417 2003-12-04
54
<222> (42)..(749)
<220>
<221> misc_feature
$ <222> (49) . (49)
<223> n is a, c, g, or t
<400> 31
ccccggcccc ggnnccctcc gccgccgccg ccgtcaccgc c atg gcc cng ccg ctg 56
Met Ala Xaa Pro Leu
1 5
gtg ccc agc tcg cag aag gcg ctg ctg ctg gag ctg aag ggg ctg cag 104
Val Pro Ser Ser Gln Lys Ala Leu Leu Leu Glu Leu Lys Gly Leu Gln
1$ 10 15 20
gag gag ccg gtg gag ggc ttc cgg gtg acg ctg gtg gac gag ggc gac 152
Glu Glu Pro Val Glu Gly Phe Arg Val Thr Leu Val Asp Glu Gly Asp
25 30 35
ctg tac aac tgg gag gtg gcc atc ttc gga ccc ccc aac acc tac tat 200
Leu Tyr Asn Trp Glu Val Ala Ile Phe Gly Pro Pro Asn Thr Tyr Tyr
40 45 50
gag ggc ggc tac ttc aag get cgc ctc aag ttc ccc atc gac tac cca 248
Glu Gly Gly Tyr Phe Lys Ala Arg Leu Lys Phe Pro Ile Asp Tyr Pro
55 60 65
tat tcc cca cca gcc ttc cgg ttc ctc acc aag atg tgg cac cca aac 296
Tyr Ser Pro Pro Ala Phe Arg Phe Leu Thr Lys Met Trp His Pro Asn
70 75 80 85
atc tat gag aca ggg gac gta tgc atc tcc atc ctc cat ccc cca gtt 344
Ile Tyr Glu Thr Gly Asp Val Cys Ile Ser Ile Leu His Pro Pro Val
90 95 100
gat gac cca cag agt ggg gag cta ccc tca gag cgg tgg aac ccc acg 392
Asp Asp Pro Gln Ser Gly Glu Leu Pro Ser Glu Arg Trp Asn Pro Thr
105 110 115
cag aat gtc agg acc atc ctc ctg agt gtg atc tcc ctg ctg aat gag 440
Gln Asn Val Arg Thr Ile Leu Leu Ser Val Ile Ser Leu Leu Asn Glu
120 125 130
ccc aacacc ttctcgcct gccaacgtggac gcctcggtg atgtacaga 488
Pro AsnThr PheSerPro AlaAsnValAsp AlaSerVal MetTyrArg
135 140 145
aaa tggaag gagagcaag gggaaggaccgc gagtacacg gacatcatc 536
$0 Lys TrpLys GluSerLys GlyLysAspArg GluTyrThr AspIleIle
150 155 160 165
cgg aagcag gtcctgggg accaaggtggac gcagagcgc gatggcgtg 584
Arg LysGln ValLeuGly ThrLysValAsp AlaGluArg AspGlyVal
$$ 170 175 180
aag gtg ccc acc acg ctg gcc gag tac tgc gtg aag acc aag gcg ccg 632
Lys Val Pro Thr Thr Leu Ala Glu Tyr Cys Val Lys Thr Lys Ala Pro
CA 02449417 2003-12-04
55
185 190 195
gcg ccc gac gag ggc tca gac ttc tac gac tac gag gac 680
ctc gac tat
Ala Pro Asp Glu Gly Ser Asp Phe Tyr Asp Tyr Glu Asp
Leu Asp Tyr
200 205 210
ggt gaa gtg gag gag gcc gac tgc ttt gat gaa gat gac 728
agc ggg gag
Gly Glu Val Glu G1u Ala Asp Cys Phe Asp Glu Asp Asp
Ser Gly Glu
215 220 225
tct ggc acc gag gag tcc tga cgtccc aattt 779
ccca tgaaataaac
ttaca
Ser Gly Thr Glu Glu Ser
230 235
tacctcagca ggacccgtgt gggcctcaggcgacagactacctcaccgaggttcaatgtg839
ggctcccatc ccatgatcct taggtcctcttaccctgtattccccatgggttttcctcgg899
ctttggagaa gagctgtggt gcagggcagacaccccactcagccttcagaggatgacaag959
cctgggaggc tgggaaccga ctgcccaggggagccagagactccagcccaaagagggcca1019
gccccacagt ctcctctctg cttttggtgtgtgtgaaatccaaataaaatagctttctga1079
g loso
<210> 32
<211> 235
<212> PRT
<213> Rattus norvegicus
<220>
feature
<221> misc
_
<222> (3). (3)
<223> The 'Xaa' at location tands , or Leu.
3 s for Gln,
Arg,
Pro
<400> 32
Met Ala Xaa Pro Leu Val Pro Ser Gln Ala Leu Leu Glu
Ser Lys Leu
1 5 10 15
Leu Lys Gly Leu Gln Glu Glu Pro Val Glu Gly Phe Arg Val Thr Leu
20 25 30
Val Asp Glu Gly Asp Leu Tyr Asn Trp Glu Val Ala Ile Phe Gly Pro
35 40 45
$5
Pro Asn Thr Tyr Tyr Glu Gly Gly Tyr Phe Lys Ala Arg Leu Lys Phe
50 55 60
Pro Ile Asp Tyr Pro Tyr Ser Pro Pro Ala Phe Arg Phe Leu Thr Lys
65 70 75 80
CA 02449417 2003-12-04
56
Met Trp His Pro Asn Ile Tyr Glu Thr Gly Asp Val Cys Ile Ser Ile
85 90 95
Leu His Pro Pro Val Asp Asp Pro Gln Ser Gly Glu Leu Pro Ser Glu
100 105 110
Arg Trp Asn Pro Thr Gln Asn Val Arg Thr Ile Leu Leu Ser Val Ile
115 120 125
Ser Leu Leu Asn Glu Pro Asn Thr Phe Ser Pro Ala Asn Val Asp Ala
1$ 130 135 140
25
Ser Val Met Tyr Arg Lys Trp Lys Glu Ser Lys Gly Lys Asp Arg Glu
145 150 155 160
Tyr Thr Asp Ile Ile Arg Lys Gln Val Leu Gly Thr Lys Val Asp Ala
165 170 175
Glu Arg Asp Gly Val Lys Val Pro Thr Thr Leu Ala Glu Tyr Cys Val
180 185 190
Lys Thr Lys Ala Pro Ala Pro Asp Glu Gly Ser Asp Leu Phe Tyr Asp
195 200 205
Asp Tyr Tyr Glu Asp Gly Glu Val Glu Glu Ala Asp Ser Cys Phe Gly
210 215 220
Asp Glu Glu Asp Asp Ser Gly Thr Glu Glu Ser
225 230 235
<210> 33
<211> 978
<212> DNA
<213> Rattus norvegicus
<220>
<221> CDS
<222> (1) . . (945)
<400> 33
atg gag gtt ggc tgc tgg tgt agc aca gaa atg agg ttg get get gat 48
Met Glu Val Gly Cys Trp Cys Ser Thr Glu Met Arg Leu Ala Ala Asp
1 5 10 15
gta gca cag aaa tgt tat ttt tgg att tct ttc cca cgt cct tgt aag 96
Val Ala Gln Lys Cys Tyr Phe Trp Ile Ser Phe Pro Arg Pro Cys Lys
CA 02449417 2003-12-04
57
20 25 30
gtg tat cct cct ctt gag tgc att agt aag get tgt tgg tca ttt aac 144
Val Tyr Pro Pro Leu Glu Cys Ile Ser Lys Ala Cys Trp Ser Phe Asn
35 40 45
ttt gcagat cttcacagc tccttcccagag ggtttcgtt gggttacac 192
Phe AlaAsp LeuHisSer SerPheProGlu GlyPheVal GlyLeuHis
50 55 60
aac atcggt cagacatgt tgccttaactcc ttgattcag gtgttcatg 240
Asn IleGly GlnThrCys CysLeuAsnSer LeuIleGln ValPheMet
65 70 75 80
IS atg aatgtg gacttcagg atggtattgaag aggataaca gtgccacga 288
Met AsnVal AspPheArg MetValLeuLys ArgIleThr ValProArg
85 90 95
ggg gcagaa gaacagaag agaagtgtcccc ttccagctg cttttgctg 336
Gly AlaGlu GluGlnLys ArgSerValPro PheGlnLeu LeuLeuLeu
100 105 110
ctg gagaag atgcaggac agccggcagaag gcagtgctg cccacggag 384
Leu GluLys MetG1nAsp SerArgGlnLys AlaValLeu ProThrGlu
2$ 115 120 125
ctc gttcag tgcctccag aaatacaacgtg ccattgttt gtccagcac 432
Leu ValGln CysLeuGln LysTyrAsnVal ProLeuPhe ValGlnHis
130 135 140
gat getget catctcttc cttacaatctgg aacctgact aaggaccag 480
Asp AlaAla HisLeuPhe LeuThrIleTrp AsnLeuThr LysAspGln
145 150 155 160
atc acggac atagacttg gcagagcggctg caggatctg ttcacaatc 528
Ile ThrAsp IleAspLeu AlaGluArgLeu GlnAspLeu PheThrIle
165 170 175
tgg acc gag gag tcc ctg atg tgc gtg ggc tgt gga gca gag agc agc 576
Trp Thr Glu Glu Ser Leu Met Cys Val Gly Cys Gly Ala Glu Ser Ser
180 185 190
agg agg ggc aag ttg ctc act ctc tct ctt cct ctt ttt gat atg gat 624
Arg Arg Gly Lys Leu Leu Thr Leu Ser Leu Pro Leu Phe Asp Met Asp
195 200 205
tca aag ccc cta aaa aca ctg gag gat gcc ttg aga tgt ttc ttc cag 672
Ser Lys Pro Leu Lys Thr Leu Glu Asp Ala Leu Arg Cys Phe Phe Gln
210 215 220
ccc aaa gag tta gca agc tca gac aag tgc ttc tgt gag acc tgc ggg 720
Pro Lys Glu Leu Ala Ser Ser Asp Lys Cys Phe Cys Glu Thr Cys Gly
225 230 235 240
$5 aag aag acg cct tgc aaa cag get cag aag ctg act ggt ttc cct cag 768
Lys Lys Thr Pro Cys Lys Gln Ala Gln Lys Leu Thr Gly Phe Pro Gln
245 250 255
CA 02449417 2003-12-04
58
acc ctgaccatc cacctcatg agattctct gtcaggaac tcacagaca 816
Thr LeuThrIle HisLeuMet ArgPheSer ValArgAsn SerGlnThr
260 265 270
gta aagatctgc cactcagtg tacttcccg cagagcttg gatttcagt 864
Val LysIleCys HisSerVal TyrPhePro GlnSerLeu AspPheSer
275 280 285
cag attctgcca accacggat caggtgagg cttgccttc catccctta 912
Gln IleLeuPro ThrThrAsp GlnValArg LeuAlaPhe HisProLeu
290 295 300
ttc accctggga gactctgtt cttctgacg tagccgtccatct ccatcggcta 965
Phe ThrLeuGly AspSerVal LeuLeuThr
1$ 305 310
ctggacacac tca 978
<210> 34
<211> 314
<212> PRT
<213> Rattus norvegicus
2$ <400> 34
Met Glu Val Gly Cys Trp Cys Ser Thr Glu Met Arg Leu Ala Ala Asp
1 5 10 15
Val Ala Gln Lys Cys Tyr Phe Trp Ile Ser Phe Pro Arg Pro Cys Lys
20 25 30
Val Tyr Pro Pro Leu Glu Cys Ile Ser Lys Ala Cys Trp Ser Phe Asn
35 40 45
Phe Ala Asp Leu His Ser Ser Phe Pro Glu Gly Phe Val Gly Leu His
50 55 60
SO
Asn Ile Gly Gln Thr Cys Cys Leu Asn Ser Leu Ile Gln Val Phe Met
65 70 75 80
Met Asn Val Asp Phe Arg Met Val Leu Lys Arg Ile Thr Val Pro Arg
85 90 95
Gly Ala Glu Glu Gln Lys Arg Ser Val Pro Phe Gln Leu Leu Leu Leu
100 105 110
$S Leu Glu Lys Met Gln Asp Ser Arg Gln Lys Ala Val Leu Pro Thr Glu
115 120 125
CA 02449417 2003-12-04
59
Leu Val Gln Cys Leu Gln Lys Tyr Asn Val Pro Leu Phe Val Gln His
130 135 140
$ Asp Ala Ala His Leu Phe Leu Thr Ile Trp Asn Leu Thr Lys Asp Gln
145 150 155 160
Ile Thr Asp Ile Asp Leu Ala Glu Arg Leu Gln Asp Leu Phe Thr Ile
165 170 175
1$
Trp Thr Glu Glu Ser Leu Met Cys Val Gly Cys Gly Ala Glu Ser Ser
180 185 190
Arg Arg Gly Lys Leu Leu Thr Leu Ser Leu Pro Leu Phe Asp Met Asp
195 200 205
Ser Lys Pro Leu Lys Thr Leu Glu Asp Ala Leu Arg Cys Phe Phe Gln
210 215 220
2$ Pro Lys Glu Leu Ala Ser Ser Asp Lys Cys Phe Cys Glu Thr Cys Gly
225 230 235 240
Lys Lys Thr Pro Cys Lys Gln Ala Gln Lys Leu Thr G1y Phe Pro Gln
245 250 255
40
Thr Leu Thr Ile His Leu Met Arg Phe Ser Val Arg Asn Ser Gln Thr
260 265 270
Val Lys Ile Cys His Ser Val Tyr Phe Pro Gln Ser Leu Asp Phe Ser
275 280 285
Gln Ile Leu Pro Thr Thr Asp Gln Val Arg Leu Ala Phe His Pro Leu
290 295 300
4$ Phe Thr Leu Gly Asp Ser Val Leu Leu Thr
305 310
<210> 35
S0 <211> 1161
<212> DNA
<213> Rattus norvegicus
55 <220>
<221> CDS
<222> (79)..(1161)
CA 02449417 2003-12-04
60
<400> 35
cgcaagcgcg tcccgggtgc acgggctctc cgccggcggt tagcgagagc gggatcgggt 60
gagctgaaag ccggcgcc atg gtg gag aag gag gag gtc agc ggc ggc ggc 111
$ Met Val Glu Lys Glu Glu Val Ser Gly Gly Gly
1 5 10
ggc ggc atc agc gag gag gag gca gcg cag tat gac cga cag atc cgc 159
Gly Gly Ile Ser Glu Glu Glu Ala Ala Gln Tyr Asp Arg Gln Ile Arg
15 20 25
1$
ctg tgg gga ctg gag get cag aag cgg ctt cga get tct cgg gta ctg 207
Leu Trp Gly Leu Glu Ala Gln Lys Arg Leu Arg Ala Ser Arg Val Leu
30 35 40
att gtc ggc atg aaa gga ctt ggg get gaa atc gcc aag aac ctt atc 255
Ile Val Gly Met Lys Gly Leu Gly Ala Glu Ile Ala Lys Asn Leu Ile
45 50 55
ctg gca gga gtg aaa ggg ctc acc atg ctg gac cat gaa cag gta tct 303
Leu Ala Gly Val Lys Gly Leu Thr Met Leu Asp His Glu Gln Val Ser
60 65 70 75
cca gaa gac ctt gga get cag ttc ttg att cga act ggg tct gtg ggc 351
2$ Pro Glu Asp Leu Gly Ala G1n Phe Leu Ile Arg Thr Gly Ser Val Gly
80 85 90
caa aac agg gcc gag gcc tct ttg gaa cga gcc cag aat ctc aac ccc 399
Gln Asn Arg Ala Glu Ala Ser Leu Glu Arg Ala Gln Asn Leu Asn Pro
95 100 105
atg gtg gat gta aag gtg gac act gag gat ata gag aag aag cca gag 447
Met Val Asp Val Lys Val Asp Thr Glu Asp Ile Glu Lys Lys Pro Glu
110 115 120
3$
tcc ttc ttc aca gag ttt gat gcg gtg tgc ctg act tgc tgc tcc aaa 495
Ser Phe Phe Thr Glu Phe Asp Ala Val Cys Leu Thr Cys Cys Ser Lys
125 130 135
gat gtc atc att aaa gtc gac cag atc tgt cac aga aat agc atc aag 543
Asp Val Ile Ile Lys Val Asp Gln Ile Cys His Arg Asn Ser Ile Lys
140 145 150 155
ttc ttc aca gga gat gtc ttt ggg tac cat ggg tac acc ttt gca aat 591
4$ Phe Phe Thr Gly Asp Val Phe Gly Tyr His Gly Tyr Thr Phe Ala Asn
160 165 170
ctt gga gag cat gaa ttt gta gaa gag aaa acc aaa gtt acc aaa gtc 639
Leu Gly Glu His Glu Phe Val Glu Glu Lys Thr Lys Val Thr Lys Val
$0 175 180 185
$$
agc caa gga gtg gaa gat gga cct gat gcc aag aga gca aag ctt gac 687
Ser Gln Gly Val Glu Asp Gly Pro Asp Ala Lys Arg Ala Lys Leu Asp
190 195 200
tca tcg gag acc acc atg gtc aaa aag aaa gtg ctt ttc tgc cct gta 735
Ser Ser Glu Thr Thr Met Val Lys Lys Lys Val Leu Phe Cys Pro Val
205 210 215
CA 02449417 2003-12-04
61
aag gaagcg ctagcagtg gactggagtgga gagaaagcc caggetgcc 783
Lys GluAla LeuAlaVal AspTrpSerGly GluLysAla GlnAlaAla
220 225 230 235
ctg aagcgc actgcccca gactactttctg ctgcaagtg ttgctgaag 831
Leu LysArg ThrAlaPro AspTyrPheLeu LeuGlnVal LeuLeuLys
240 245 250
ttc cgcacg gataaaggg agagaccctact tctgacagc tacagcgag 879
Phe ArgThr AspLysGly ArgAspProThr SerAspSer TyrSerGlu
255 260 265
gat gccgag ctgctgctg cagatacgcaat gacgtgttt gactcgctg 927
1$ Asp AlaGlu LeuLeuLeu GlnIleArgAsn AspValPhe AspSerLeu
270 275 280
ggc gtcagt cctgacctg cttcccgatgac tttgtcagg ttggcatct 975
Gly ValSer ProAspLeu LeuProAspAsp PheValArg LeuAlaSer
2~ 285 290 295
gca cagaca ggcgtctgt gttgggtactgc ttctctgag atggcccca 1023
Ala GlnThr GlyValCys ValGlyTyrCys PheSerGlu MetAlaPro
300 305 310 315
2$
gta tgtget gtggttgga ggaatcttggca caggaaatt gtgaaggcc 1071
Val CysAla ValValGly GlyIleLeuAla GlnGluIle ValLysAla
320 325 330
30 ctg tctcaa agggaccct cctcacaacaac ttcttcttc ttcgatggc 1119
Leu SerGln ArgAspPro ProHisAsnAsn PhePhePhe PheAspGly
335 340 345
atg aagggg agtggaatt gtggagtgcctt ggtccccag tga 1161
3$ Met LysGly SerGlyIle ValGluCysLeu GlyProGln
350 355 360
<210> 36
40 <211> 360
<212> PRT
<213> Rattus norvegicus
<400> 36
4$
Met Val Glu Lys Glu Glu Val Ser Gly Gly Gly Gly Gly Ile Ser Glu
1 5 10 15
$fl Glu Glu Ala Ala Gln Tyr Asp Arg Gln Ile Arg Leu Trp Gly Leu Glu
25 30
Ala Gln Lys Arg Leu Arg Ala Ser Arg Val Leu Ile Val Gly Met Lys
$$ 35 40 45
Gly Leu Gly Ala Glu Ile Ala Lys Asn Leu Ile Leu Ala Gly Val Lys
CA 02449417 2003-12-04
62
50 55 60
Gly Leu Thr Met Leu Asp His Glu Gln Val Ser Pro Glu Asp Leu Gly
S 65 70 75 80
Ala Gln Phe Leu Ile Arg Thr Gly Ser Val Gly Gln Asn Arg Ala Glu
85 90 95
Ala Ser Leu Glu Arg Ala Gln Asn Leu Asn Pro Met Val Asp Val Lys
100 105 110
IS
Val Asp Thr Glu Asp Ile Glu Lys Lys Pro Glu Ser Phe Phe Thr Glu
115 120 125
Phe Asp Ala Val Cys Leu Thr Cys Cys Ser Lys Asp val Ile Ile Lys
130 135 140
Val Asp Gln Ile Cys His Arg Asn Ser Ile Lys Phe Phe Thr Gly Asp
145 150 155 160
Val Phe Gly Tyr His Gly Tyr Thr Phe Ala Asn Leu Gly Glu His Glu
165 170 175
Phe Val Glu Glu Lys Thr Lys Val Thr Lys Val Ser Gln Gly Val Glu
180 185 190
Asp Gly Pro Asp Ala Lys Arg Ala Lys Leu Asp Ser Ser Glu Thr Thr
195 200 205
Met Val Lys Lys Lys Val Leu Phe Cys Pro Val Lys Glu Ala Leu Ala
210 215 220
Val Asp Trp Ser Gly Glu Lys Ala Gln Ala Ala Leu Lys Arg Thr Ala
225 230 235 240
Pro Asp Tyr Phe Leu Leu Gln Val Leu Leu Lys Phe Arg Thr Asp Lys
245 250 255
S~
Gly Arg Asp Pro Thr Ser Asp Ser Tyr Ser Glu Asp Ala Glu Leu Leu
260 265 270
Leu Gln Ile Arg Asn Asp Val Phe Asp Ser Leu Gly Val Ser Pro Asp
275 280 285
CA 02449417 2003-12-04
63
Leu Leu Pro Asp Asp Phe Val Arg Leu Ala Ser Ala Gln Thr Gly Val
290 295 300
Cys Val Gly Tyr Cys Phe Ser Glu Met Ala Pro Val Cys Ala Val Val
305 310 315 320
Gly Gly Ile Leu Ala Gln Glu Ile Val Lys Ala Leu Ser Gln Arg Asp
325 330 335
Pro Pro His Asn Asn Phe Phe Phe Phe Asp Gly Met Lys Gly Ser Gly
1$ 340 345 350
Ile Val Glu Cys Leu Gly Pro Gln
355 360
<210> 37
<211> 1857
<212> DNA
<213> Rattus
norvegicus
<220>
<221> CDS
<222> (92)..(1267)
<400> 37
aagacaccaagtgtcgttgt ggtcgcag cgccgcccgt tcggcatccc 60
gg acggctgcgt
tgagcgcagtcgagcctcca gccgcaga c atg gagccc ccacagccc 112
gc gag
Met GluPro ProGlnPro
Glu
1 5
gag gtcacg ctgctg gtgaag agcccc aatcag cgccaccgcgac 160
ccg
Glu ValThr LeuLeu ValLys SerPro AsnGln ArgHisArgAsp
Pro
10 15 20
ttg ctgagt ggcgac cgcggt tggagt gtgagt cgcctcaaggcc 208
gag
Leu LeuSer GlyAsp ArgGly TrpSer ValSer ArgLeuLysAla
Glu
4$ 25 30 35
cac agccga gtctac cccgaa cgcccg cgccca gaggaccagagg 256
ctg
His SerArg ValTyr ProGlu ArgPro ArgPro GluAspGlnArg
Leu
40 45 50 55
SO
tta tattct gggaag ctgctg ttggat caccaa tgtctccaagac 304
att
Leu TyrSer GlyLys LeuLeu LeuAsp HisGln CysLeuGlnAsp
Ile
60 65 70
SS ttg ccaaag caggaa aagcga catgtt ttgcac ctcgtgtgcaat 352
ctt
Leu ProLys GlnGlu LysArg HisVal LeuHis LeuValCysAsn
Leu
75 80 85
CA 02449417 2003-12-04
64
gtg agg agt ccc tca aaa aag cca gaa gcc agc aca aag ggt get gag 400
Val Arg Ser Pro Ser Lys Lys Pro Glu Ala Ser Thr Lys Gly Ala Glu
90 95 100
tcc aca gag cag ccg gac aac act agt cag gca cag tat cct ggg gat 448
Ser Thr Glu Gln Pro Asp Asn Thr Ser Gln Ala Gln Tyr Pro Gly Asp
105 110 115
tcc tca agc gat ggc tta cgg gaa agg gaa gtc ctt cgg aac ctt cct 496
Ser Ser Ser Asp Gly Leu Arg Glu Arg Glu Val Leu Arg Asn Leu Pro
120 125 130 135
ccc tct gga tgg gag aac gtc tct agg cct gaa gcc gtc cag cag act 544
Pro Ser Gly Trp Glu Asn Val Ser Arg Pro Glu Ala Val Gln Gln Thr
IS 140 145 150
ttc caa ggc ctc ggg ccc ggc ttc tct ggc tac acc acc tac ggg tgg 592
Phe Gln Gly Leu Gly Pro Gly Phe Ser Gly Tyr Thr Thr Tyr Gly Trp
155 160 165
ctg cag ctc tcc tgg ttc cag cag atc tat gca aga cag tac tac atg 640
Leu Gln Leu Ser Trp Phe Gln Gln Ile Tyr Ala Arg Gln Tyr Tyr Met
170 175 180
caa tac ttg get gcc act get get tca gga get ttt ggc cct aca cca 688
Gln Tyr Leu Ala Ala Thr Ala Ala Ser Gly Ala Phe Gly Pro Thr Pro
185 190 195
agt gca caa gaa ata cct gtg gtc tct aca ccg get ccc gcc cct ata 736
Ser Ala Gln Glu Ile Pro Val Val Ser Thr Pro Ala Pro Ala Pro Ile
200 205 210 215
cac aac cag ttt ccg gca gaa aac cag ccg gcc aat cag aat gca gcc 784
His Asn Gln Phe Pro Ala Glu Asn Gln Pro Ala Asn Gln Asn Ala Ala
3$ 220 225 230
get caa gcg gtt gtt aat ccc gga gcc aat cag aac ttg cgg atg aat 832
Ala G1n Ala Val Val Asn Pro Gly Ala Asn Gln Asn Leu Arg Met Asn
235 240 245
gca caa ggc ggc cct ctg gtg gaa gaa gat gat gag ata aac cga gac 880
Ala Gln Gly Gly Pro Leu Val Glu Glu Asp Asp Glu Ile Asn Arg Asp
250 255 260
tgg ttg gat tgg acc tac tca gca gcg aca ttt tcc gtt ttc ctc agc 928
Trp Leu Asp Trp Thr Tyr Ser Ala Ala Thr Phe Ser Val Phe Leu Ser
265 270 275
att ctt tac ttc tac tcc tcc ctg agc aga ttc ctc atg gtc atg ggc 976
$0 Ile Leu Tyr Phe Tyr Ser Ser Leu Ser Arg Phe Leu Met Val Met Gly
280 285 290 295
gcc acc gta gtc atg tac ctg cac cac gtc ggg tgg ttt cca ttc aga 1024
Ala Thr Val Val Met Tyr Leu His His Val Gly Trp Phe Pro Phe Arg
5$ 300 305 310
cag agg cca gtt cag aac ttc cca gat gac ggt ccc cct cag gaa get 1072
Gln Arg Pro Val Gln Asn Phe Pro Asp Asp Gly Pro Pro Gln Glu Ala
CA 02449417 2003-12-04
6$
315 320 325
gcc aac cag gac ccc aac aat aac ctc cag gga ggt ttg gac cct gaa 1120
Ala Asn Gln Asp Pro Asn Asn Asn Leu Gln Gly Gly Leu Asp Pro Glu
$ 330 335 340
1~
atg gaa gac ccc aac cgc ctc ccc gta ggc cgt gaa gtg ctg gac cct 1168
Met Glu Asp Pro Asn Arg Leu Pro Val Gly Arg Glu Val Leu Asp Pro
345 350 355
gag cat acc agc ccc tcg ttc atg agc aca gca tgg cta gtc ttc aag 1216
Glu His Thr Ser Pro Ser Phe Met Ser Thr Ala Trp Leu Val Phe Lys
360 365 370 375
15 act ttc gcc tct gaa ggc cca gcc gca aac 1264
ttt ctt ctt cca cta
ccg
Thr Phe Ala Ser Glu Gly Pro Ala Ala Asn
Phe Leu Leu Pro Leu
Pro
380 385 390
tga tggcccctgt cttt cacagcttgg cgt 1317
gctctgttgc actggat
tggagg
20
cccctggcgtggactcgagagagtcattgaaaacccacaggatgacgatgtgcttctgtg1377
ccaagcaaaagcacaaactaagacatgaagccgtggtacaaactgaacagggcccctcat1437
2$ gtcgttattctgaagagctttaatgtatactgtatgtagtctcataggcactgtaaacag1497
aaggcccagggtcgcatgttctgcctgagcacctccccagacgtgtgtgcatgtgtgccg1557
tacatggaagtcatagacgtgtgtgcatgtgtgctctacatggaagtcatagatgcagaa1617
30
acggttctgctggttcgatttgattcctgttggaatgttgcaattacactaagtgtacta1677
ctttatataatcagtgacttgctagacatgttagcaggacttttctaggagagacttatt1737
35 gtatcattgctttttaaaacgcagtgcttacttactgagggcggcgacttggcacaggta1797
aagcctttgccgggttttctgttcaataaagttttgctatgaacgacaaaaaaaaaaaaa1857
40 <zlo> 38
<211> 391
<212> PRT
<213> Rattus norvegicus
4$ <400> 38
Met Glu Pro Glu Pro Gln Pro Glu Pro Val Thr Leu Leu Val Lys Ser
1 5 10 15
Pro Asn Gln Arg His Arg Asp Leu Glu Leu Ser Gly Asp Arg Gly Trp
20 25 30
$$ Ser Val Ser Arg Leu Lys Ala His Leu Ser Arg Val Tyr Pro Glu Arg
35 40 45
CA 02449417 2003-12-04
66
Pro Arg Pro Glu Asp Gln Arg Leu Ile Tyr Ser Gly Lys Leu Leu Leu
50 55 60
Asp His Gln Cys Leu Gln Asp Leu Leu Pro Lys Gln Glu Lys Arg His
65 70 75 80
Val Leu His Leu Val Cys Asn Val Arg Ser Pro Ser Lys Lys Pro Glu
1~ 85 90 95
20
Ala Ser Thr Lys Gly Ala Glu Ser Thr Glu Gln Pro Asp Asn Thr Ser
100 105 110
Gln Ala Gln Tyr Pro Gly Asp Ser Ser Ser Asp Gly Leu Arg Glu Arg
115 120 125
Glu Val Leu Arg Asn Leu Pro Pro Ser Gly Trp Glu Asn Val Ser Arg
130 135 140
2$ Pro Glu Ala Val Gln Gln Thr Phe Gln Gly Leu Gly Pro Gly Phe Ser
145 150 155 160
Gly Tyr Thr Thr Tyr Gly Trp Leu Gln Leu Ser Trp Phe Gln Gln Ile
30 165 170 175
40
Tyr Ala Arg Gln Tyr Tyr Met Gln Tyr Leu Ala Ala Thr Ala Ala Ser
180 185 190
Gly Ala Phe Gly Pro Thr Pro Ser Ala Gln Glu Ile Pro Val Val Ser
195 200 205
Thr Pro Ala Pro Ala Pro Ile His Asn Gln Phe Pro Ala Glu Asn Gln
210 215 220
4S Pro Ala Asn Gln Asn Ala Ala Ala Gln Ala Val Val Asn Pro Gly Ala
225 230 235 240
Asn Gln Asn Leu Arg Met Asn Ala Gln Gly Gly Pro Leu Val Glu Glu
$0 245 250 255
Asp Asp Glu Ile Asn Arg Asp Trp Leu Asp Trp Thr Tyr Ser Ala Ala
260 265 270
Thr Phe Ser Val Phe Leu Ser Ile Leu Tyr Phe Tyr Ser Ser Leu Ser
275 280 285
CA 02449417 2003-12-04
67
10
Arg Phe Leu Met Val Met Gly Ala Thr Val Val Met Tyr Leu His His
290 295 300
Val Gly Trp Phe Pro Phe Arg Gln Arg Pro Val Gln Asn Phe Pro Asp
305 310 315 320
Asp Gly Pro Pro Gln Glu Ala Ala Asn Gln Asp Pro Asn Asn Asn Leu
325 330 335
1$ Gln Gly Gly Leu Asp Pro Glu Met Glu Asp Pro Asn Arg Leu Pro Val
340 345 350
Gly Arg Glu Val Leu Asp Pro Glu His Thr Ser Pro Ser Phe Met Ser
20 355 360 365
30
Thr Ala Trp Leu Val Phe Lys Thr Phe Phe Ala Ser Leu Leu Pro Glu
370 375 380
Gly Pro Pro Ala Leu Ala Asn
385 390
<210> 39
<211> 722
<212> DNA
<213> Rattus norvegicus
<220>
<221> CDS
<222> (19)..(558)
<400> 39
cgtgccagcacctctggg atg gcctcgcagaac cgcgaccca getgcagcc 51
Met AlaSerGlnAsn ArgAspPro AlaAlaAla
1 5 10
agc gccgcc gttcga aaaggagcagaa ccctgcggg ggcgccgcc 99
gtt
Ser AlaAla ValArg LysGlyAlaGlu ProCysGly GlyAlaAla
Val
15 20 25
cgg cctgtg ggcaag aggctacagcag gagctgatg accctcatg 147
ggc
Arg ProVal GlyLys ArgLeuGlnGln GluLeuMet ThrLeuMet
Gly
30 35 40
atg ggtgac aaagga atttccgccttc cccgaatca gacaacctg 195
tct
SS Met GlyAsp LysGly IleSerAlaPhe ProGluSer AspAsnLeu
Ser
45 50 55
ttc tgggta ggaacc atccatggagcc gccggcact gtatatgaa 243
aaa
CA 02449417 2003-12-04
68
Phe Lys Trp Val Gly Thr Ile His Gly Ala Ala Gly Thr Val Tyr Glu
60 65 70 75
gac ctg agg tat aaa ctc tcc cta gag ttc ccc agt ggc tac cct tac 291
Asp Leu Arg Tyr Lys Leu Ser Leu Glu Phe Pro Ser Gly Tyr Pro Tyr
80 85 90
aac gca ccc aca gtg aag ttc ctc aca ccg tgc tac cac ccc aac gtg 339
Asn Ala Pro Thr Val Lys Phe Leu Thr Pro Cys Tyr His Pro Asn Val
95 100 105
gac acc cag ggc aac atc tgc ctg gac atc ctc aag gac aag tgg tct 387
Asp Thr Gln Gly Asn Ile Cys Leu Asp Ile Leu Lys Asp Lys Trp Ser
110 115 120
IS
gca ctg tat gat gtc agg acc atc ttg ctc tcc atc cag agc ctg cta 435
Ala Leu Tyr Asp Val Arg Thr Ile Leu Leu Ser Ile Gln Ser Leu Leu
125 130 135
gga gaa ccc aac atc gag agc cct ttg aac aca cat get gca gag ctc 483
Gly Glu Pro Asn Ile Glu Ser Pro Leu Asn Thr His Ala Ala Glu Leu
140 145 150 155
tgg aaa aac ccc aca gca ttt aag aag tac ctg caa gaa aca tat tca 531
Trp Lys Asn Pro Thr Ala Phe Lys Lys Tyr Leu Gln Glu Thr Tyr Ser
160 165 170
aag cag gtc tcc aac caa gag ccc tga cgccagctct ccagctttct 578
Lys Gln Val Ser Asn Gln Glu Pro
175
cttgtgtcgt ctcttttctt agatgtctgt cctttctccg tggtttctga gctgtgctgt 638
tttgttttat ttgttttttt aaattaagtc tgcttgaacc catacaatgt atattaaata 698
aatgcacgtt gattgttttt gtat 722
<210> 40
<211> 179
<212> PRT
<213> Rattus norvegicus
<400> 40
Met Ala Ser Gln Asn Arg Asp Pro Ala Ala Ala Ser Val Ala Ala Val
1 5 10 15
Arg Lys Gly Ala Glu Pro Cys Gly Gly Ala Ala Arg Gly Pro Val Gly
20 25 30
Lys Arg Leu Gln Gln Glu Leu Met Thr Leu Met Met Ser Gly Asp Lys
35 40 45
Gly Ile Ser Ala Phe Pro Glu Ser Asp Asn Leu Phe Lys Trp Val Gly
CA 02449417 2003-12-04
69
50 55 60
Thr Ile His Gly Ala Ala Gly Thr Val Tyr Glu Asp Leu Arg Tyr Lys
65 70 75 80
15
Leu Ser Leu Glu Phe Pro Ser Gly Tyr Pro Tyr Asn Ala Pro Thr Val
85 90 95
Lys Phe Leu Thr Pro Cys Tyr His Pro Asn Val Asp Thr Gln Gly Asn
100 105 110
Ile Cys Leu Asp Ile Leu Lys Asp Lys Trp Ser Ala Leu Tyr Asp Val
115 120 125
Arg Thr Ile Leu Leu Ser Ile Gln Ser Leu Leu Gly Glu Pro Asn Ile
130 135 140
Glu Ser Pro Leu Asn Thr His Ala Ala Glu Leu Trp Lys Asn Pro Thr
145 150 155 160
35
Ala Phe Lys Lys Tyr Leu Gln Glu Thr Tyr Ser Lys Gln Val Ser Asn
165 170 175
Gln Glu Pro
<210> 41
<211> 1857
<212> DNA
<213> Rattus
norvegicus
<220>
<221> CDS
<222> (1). .(1857)
<400> 41
atg tcc ctctcctcc accctgaag cgctataca gaatcgtcc cgc 48
cag
Met Ser LeuSerSer ThrLeuLys ArgTyrThr GluSerSex Arg
Gln
1 5 10 15
tac aca gccccttat gccaaatcg ggctatggc acctacacc cct 96
gat
Tyr Thr AlaProTyr AlaLysSer GlyTyrGly ThrTyrThr Pro
Asp
20 25 30
tct tcc ggggccaac ctggccgcc tccttcctg gagaaggaa aaa 144
tat
Ser Ser GlyAlaAsn LeuAlaAla SerPheLeu GluLysGlu Lys
Tyr
35 40 45
CA 02449417 2003-12-04
~o
ctt ggt ttc aag ccg gtc tcc ccc acc agc ttc ctc cca cgg ccc cgc 192
Leu Gly Phe Lys Pro Val Ser Pro Thr Ser Phe Leu Pro Arg Pro Arg
50 55 60
S acc tac ggc ccc tcc tcc atc ctg gac tgt gac agg ggc cgc ccc ctg 240
Thr Tyr Gly Pro Ser Ser Ile Leu Asp Cys Asp Arg G1y Arg Pro Leu
65 70 75 80
ctg aga tct gac atc act ggg ggt agt aag cgg tct gag agc cag acc 288
Leu Arg Ser Asp Ile Thr Gly Gly Ser Lys Arg Ser Glu Ser Gln Thr
85 90 95
cgt ggc aat gaa agg ccc tca ggc agt gga ctc aac gga ggc agt gga 336
Arg Gly Asn Glu Arg Pro Ser Gly Ser Gly Leu Asn Gly Gly Ser Gly
l00 105 110
ttt cct tat gga gtg acc agc aac tcc ctc agc tac ctg ccc atg aat 384
Phe Pro Tyr Gly Val Thr Ser Asn Ser Leu Ser Tyr Leu Pro Met Asn
115 120 125
gcc aga gac cag ggc gtg acc ctg ggc cag aag aaa tcg aac agc caa 432
Ala Arg Asp Gln Gly Val Thr Leu Gly Gln Lys Lys Ser Asn Ser Gln
130 135 140
tca gac ctg gcc cgg gat ttc tcc agc ctc cgg acc tca gat agc tac 480
Ser Asp Leu Ala Arg Asp Phe Ser Ser Leu Arg Thr Ser Asp Ser Tyr
145 150 155 160
agg act tca gat ggc tac cgg gcc tca gat ggc tct agg ata gac ccc 528
Arg Thr Ser Asp Gly Tyr Arg Ala Ser Asp Gly Ser Arg Ile Asp Pro
165 170 175
gga aac ctg ggt cgc agc ccc atg ctg gcc cgc aca cgt aag gag ctc 576
Gly Asn Leu Gly Arg Ser Pro Met Leu Ala Arg Thr Arg Lys Glu Leu
180 185 190
tgt gcc ctg cag ggc ctc tac caa gca gcc agc cgt tct gag tac cta 624
Cys Ala Leu Gln Gly Leu Tyr Gln Ala Ala Ser Arg Ser Glu Tyr Leu
195 200 205
aca gac tat ctg gag aac tat ggc cgc aag ggc agt gca cca cag gtg 672
Thr Asp Tyr Leu Glu Asn Tyr Gly Arg Lys Gly Ser Ala Pro Gln Val
210 215 220
4S ctc aca cag gcc cct ccc tcc cga gtc ccc gaa gtc ctc agt ccc acc 720
Leu Thr Gln Ala Pro Pro Ser Arg Val Pro Glu Val Leu Ser Pro Thr
225 230 235 240
tac cga cca agt ggc cgc tac aca ctg tgg gag aag aac aag ggc cag 768
SO Tyr Arg Pro Ser Gly Arg Tyr Thr Leu Trp Glu Lys Asn Lys Gly Gln
245 250 255
get tct ggg gcc agc cgc tcc act tct cca ggg cga gac acc atg aat 816
Ala Ser Gly Ala Ser Arg Ser Thr Ser Pro Gly Arg Asp Thr Met Asn
$$ 260 265 270
tca aag agt gcc cag ggt ctg get ggt ctt cga aac ctt ggg aac acg 864
Ser Lys Ser Ala Gln Gly Leu Ala Gly Leu Arg Asn Leu Gly Asn Thr
CA 02449417 2003-12-04
~1
275 280 285
tgc ttcatg aactcaatt cttcagtgtctg agcaacacc cgcgagttg 912
Cys PheMet AsnSerIle LeuGlnCysLeu SerAsnThr ArgGluLeu
$ 290 295 300
aga gattac tgcctccag aggctgtacatg cgggacctc ggccatacc 960
Arg AspTyr CysLeuGln ArgLeuTyrMet ArgAspLeu GlyHisThr
305 310 315 320
agc agtgca cacacaget ctcatggaagag tttgcaaaa ctaatccag 1008
Ser SerAla HisThrAla LeuMetGluGlu PheAlaLys LeuIleGln
325 330 335
acc atatgg acgtcatcc cccaatgatgtg gtgagccca tctgagttc 1056
Thr IleTrp ThrSerSer ProAsnAspVal ValSexPro SexGluPhe
340 345 350
aag acccag atccagaga tatgcaccacgc ttcgttggc tataatcag 1104
Lys ThrGln IleGlnArg TyrAlaProArg PheValGly TyrAsnGln
355 360 365
cag gatgcccag gaattcctc cgtttcctt ctggatggc ctccacaac 1152
Gln AspAlaGln GluPheLeu ArgPheLeu LeuAspGly LeuHisAsn
2$ 370 375 380
gag gtgaaccgg gtggcagca aggcctaag cccagccct gagagcctt 1200
Glu ValAsnArg ValAlaAla ArgProLys ProSerPro GluSerLeu
385 390 395 400
gat catctccct gatgaagag aaagggcga cagatgtgg aggaagtat 1248
Asp HisLeuPro AspGluGlu LysGlyArg GlnMetTrp ArgLysTyr
405 410 415
cta gaaagggaa gacagtcgg attggggat ctcttcgtc gggcagcta 1296
Leu GluArgGlu AspSerArg IleGlyAsp LeuPheVal GlyGlnLeu
420 425 430
aag agctccctg acgtgcacc gactgcggc tactgctct acagtgttc 1344
Lys SerSerLeu ThrCysThr AspCysGly TyrCysSer ThrValPhe
435 440 445
gat cccttctgg gacctctcg ttgcccatt gcaaagaga ggctatcct 1392
Asp ProPheTrp AspLeuSer LeuProIle AlaLysArg GlyTyrPro
450 455 460
gaa gtgacgtta atggattgt atgaggctc ttcaccaaa gaggatgtg 1440
Glu ValThrLeu MetAspCys MetArgLeu PheThrLys GluAspVal
465 470 475 480
SO
ttg gatggggat gagaaacca acatgctgc cgctgccgg gccagaaaa 1488
Leu AspGlyAsp GluLysPro ThrCysCys ArgCysArg AlaArgLys
485 490 495
cga tgtataaag aagttctct gtccagagg ttcccaaag atcttggtg 1536
Arg CysIleLys LysPheSer ValGlnArg PheProLys IleLeuVal
500 505 510
CA 02449417 2003-12-04
72
ctc cac ctg aag cgg ttc tca gaa tcc agg ata cga acc agc aag ctc 1584
Leu His Leu Lys Arg Phe Ser Glu Ser Arg Ile Arg Thr Ser Lys Leu
515 520 525
aca acatttgtg aatttccca ctaagagacctg gacttgaga gaattt 1632
Thr ThrPheVal AsnPhePro LeuArgAspLeu AspLeuArg GluPhe
530 535 540
get tcagaaaac accaaccat getgtttacaac ctgtatget gtgtcc 1680
Ala SerGluAsn ThrAsnHis AlaValTyrAsn LeuTyrAla ValSer
545 550 555 560
aat cactccgga accaccatg ggaggtcactat acagcctac tgccga 1728
Asn HisSerGly ThrThrMet GlyGlyHisTyr ThrAlaTyr CysArg
565 570 575
agt ccg gtt acg ggc gaa tgg cac act ttc aat gac tcc agt gtc aca 1776
Ser Pro Val Thr Gly Glu Trp His Thr Phe Asn Asp Ser Ser Val Thr
580 585 590
ccc atg tcc tcc agc caa gtg cgc acc agc gac gcc tat ttg ctc ttc 1824
Pro Met Ser Ser Ser Gln Val Arg Thr Ser Asp Ala Tyr Leu Leu Phe
595 600 605
2$ tat gaa ctg gcc agt cca ccc tcc cgt atg tag 1857
Tyr Glu Leu Ala Ser Pro Pro Ser Arg Met
610 615
<210> 42
<211> 618
<212> PRT
<213> Rattus norvegicus
<400> 42
Met Ser Gln Leu Ser Ser Thr Leu Lys Arg Tyr Thr Glu Ser Ser Arg
1 5 10 15
Tyr Thr Asp Ala Pro Tyr Ala Lys Ser Gly Tyr Gly Thr Tyr Thr Pro
20 25 30
Ser Ser Tyr Gly Ala Asn Leu Ala Ala Ser Phe Leu Glu Lys Glu Lys
35 40 45
Leu Gly Phe Lys Pro Val Ser Pro Thr Ser Phe Leu Pro Arg Pro Arg
$0 50 55 60
$5
Thr Tyr Gly Pro Ser Ser Ile Leu Asp Cys Asp Arg Gly Arg Pro Leu
65 70 75 80
Leu Arg Ser Asp Ile Thr Gly Gly Ser Lys Arg Ser Glu Ser Gln Thr
85 90 95
CA 02449417 2003-12-04
73
$
Arg Gly Asn Glu Arg Pro Ser Gly Ser Gly Leu Asn Gly Gly Ser Gly
100 105 110
Phe Pro Tyr Gly Val Thr Ser Asn Ser Leu Ser Tyr Leu Pro Met Asn
115 120 125
Ala Arg Asp Gln Gly Val Thr Leu Gly Gln Lys Lys Ser Asn Ser Gln
130 135 140
1$ Ser Asp Leu Ala Arg Asp Phe Ser Ser Leu Arg Thr Ser Asp Ser Tyr
145 150 155 160
Arg Thr Ser Asp Gly Tyr Arg Ala Ser Asp Gly Ser Arg Ile Asp Pro
165 170 175
2$
Gly Asn Leu Gly Arg Ser Pro Met Leu Ala Arg Thr Arg Lys Glu Leu
180 185 190
Cys Ala Leu Gln Gly Leu Tyr Gln Ala Ala Ser Arg Ser Glu Tyr Leu
195 200 205
Thr Asp Tyr Leu Glu Asn Tyr Gly Arg Lys Gly Ser Ala Pro Gln Val
210 215 220
Leu Thr Gln Ala Pro Pro Ser Arg Val Pro Glu Val Leu Ser Pro Thr
225 230 235 240
Tyr Arg Pro Ser Gly Arg Tyr Thr Leu Trp Glu Lys Asn Lys Gly Gln
245 250 255
4$
$0
Ala Ser Gly Ala Ser Arg Ser Thr Ser Pro Gly Arg Asp Thr Met Asn
260 265 270
Ser Lys Ser Ala Gln Gly Leu Ala Gly Leu Arg Asn Leu Gly Asn Thr
275 280 285
Cys Phe Met Asn Ser Ile Leu Gln Cys Leu Ser Asn Thr Arg Glu Leu
290 295 300
$$ Arg Asp Tyr Cys Leu Gln Arg Leu Tyr Met Arg Asp Leu Gly His Thr
305 310 315 320
CA 02449417 2003-12-04
74
Ser Ser Ala His Thr Ala Leu Met Glu Glu Phe Ala Lys Leu Ile Gln
325 330 335
$ Thr Ile Trp Thr Ser Ser Pro Asn Asp Val Val Ser Pro Ser Glu Phe
340 345 350
Lys Thr Gln Ile Gln Arg Tyr Ala Pro Arg Phe Val Gly Tyr Asn Gln
1~ 355 360 365
Gln Asp Ala Gln Glu Phe Leu Arg Phe Leu Leu Asp Gly Leu His Asn
370 375 380
Glu Val Asn Arg Val Ala Ala Arg Pro Lys Pro Ser Pro Glu Ser Leu
385 390 395 400
Asp His Leu Pro Asp Glu Glu Lys Gly Arg Gln Met Trp Arg Lys Tyr
405 410 415
2$ Leu Glu Arg Glu Asp Ser Arg Ile Gly Asp Leu Phe Val Gly Gln Leu
420 425 430
Lys Ser Ser Leu Thr Cys Thr Asp Cys Gly Tyr Cys Ser Thr Val Phe
435 440 445
Asp Pro Phe Trp Asp Leu Ser Leu Pro Ile Ala Lys Arg Gly Tyr Pro
450 455 460
Glu Val Thr Leu Met Asp Cys Met Arg Leu Phe Thr Lys Glu Asp Val
465 470 475 480
Leu Asp Gly Asp Glu Lys Pro Thr Cys Cys Arg Cys Arg Ala Arg Lys
485 490 495
4$ Arg Cys Ile Lys Lys Phe Ser Val Gln Arg Phe Pro Lys Ile Leu Val
500 505 510
Leu His Leu Lys Arg Phe Ser Glu Ser Arg Ile Arg Thr Ser Lys Leu
$0 515 520 525
Thr Thr Phe Val Asn Phe Pro Leu Arg Asp Leu Asp Leu Arg Glu Phe
530 535 540
Ala Ser Glu Asn Thr Asn His Ala Val Tyr Asn Leu Tyr Ala Val Ser
545 550 555 560
CA 02449417 2003-12-04
7$
Asn His Ser Gly Thr Thr Met Gly Gly His Tyr Thr Ala Tyr Cys Arg
565 570 575
$
Ser Pro Val Thr Gly Glu Trp His Thr Phe Asn Asp Ser Ser Val Thr
580 585 590
Pro Met Ser Ser Ser Gln Val Arg Thr Ser Asp Ala Tyr Leu Leu Phe
595 600 605
1$ Tyr Glu Leu Ala Ser Pro Pro Ser Arg Met
610 615
<210> 43
<211> 3385
<212> DNA
<213> Rattus norvegicus
2$ <220>
<221> CDS
<222> (167)..(3385)
<400> 43
gcgctgcttt gcgtctgaga acggaggctc gttctccttc tggtggtggg cgatgggcgt 60
caggcgagaa ggccggcgtt agcggagcgc gggcgctgcg gaaagaacta cttttcatga 120
accacattat ccgtttgttg aagtagaaaa gcaagaatca ttcatc atg cct get 175
3$ Met Pro Ala
1
gta gettcagtt cctaaagaa ctctacctc agttcttcactc aaagac 223
Val AlaSerVal ProLysGlu LeuTyrLeu SerSerSerLeu LysAsp
5 10 15
ctc aataagaag acagaagtt aaacctgag aaaaccagcacc aagaat 271
Leu AsnLysLys ThrGluVal LysProGlu LysThrSerThr LysAsn
20 25 30 35
4$
tat atacacagc getcagaag attttcaag gcagcagaagaa tgcaga 319
Tyr IleHisSer AlaGlnLys IlePheLys AlaAlaGluGlu CysArg
40 45 50
$0 cta gatcgtgat gaggaaagg gcctatgtg ctttatatgaaa tatgtg 367
Leu AspArgAsp GluGluArg AlaTyrVal LeuTyrMetLys TyrVal
55 60 65
gcg gtttataat cttatcaaa aagagacct gatttcaagcaa cagcag 415
$$ Ala ValTyrAsn LeuIleLys LysArgPro AspPheLysGln GlnGln
70 75 80
gac tattacctt tcaatactt ggacctgca aacatcaaaaag getatt 463
CA 02449417 2003-12-04
Asp Tyr Tyr Leu Ser Ile Leu Gly Pro Ala Asn Ile Lys Lys Ala Ile
85 90 95
gaa gaa get gaa aga ctc tct gag agc ctc aaa ctg aga tac gaa gag 511
$ Glu Glu Ala Glu Arg Leu Ser Glu Ser Leu Lys Leu Arg Tyr Glu Glu
100 105 110 115
get gaa gtt cgg aaa cag ctt gaa gaa aag gac aga cgg gag gaa gaa 559
Ala Glu Val Arg Lys Gln Leu Glu Glu Lys Asp Arg Arg Glu Glu Glu
1~ 120 125 130
cag ctg cag caa cag aaa agg cag gag atg gga aga gag gat agt ggt 607
Gln Leu Gln Gln Gln Lys Arg Gln Glu Met Gly Arg Glu Asp Ser Gly
135 140 145
IS
gcg gcg gcc aaa cgc tcc gtg gaa aat tta ctg gat tcc aaa acc aaa 655
Ala Ala Ala Lys Arg Ser Val Glu Asn Leu Leu Asp Ser Lys Thr Lys
150 155 160
20 atc caa agg gta ttg caa gtt cat tgt gta aac act ggt cct gtt tgc 703
Ile Gln Arg Val Leu Gln Val His Cys Val Asn Thr Gly Pro Val Cys
165 170 175
cag gtc aat gga gag aag agc gaa gga ggt gca gca gca gag aga gga 751
25 Gln Val Asn Gly Glu Lys Ser Glu Gly Gly Ala Ala Ala Glu Arg Gly
180 185 190 195
gca gtc aca gca aag gag cta tat aca atg atg atg gat aaa aac aca 799
Ala Val Thr Ala Lys Glu Leu Tyr Thr Met Met Met Asp Lys Asn Thr
200 205 210
agc ctg att ata atg gat get cgg aaa ata cag gat tat cag cat tcc 847
Ser Leu Ile Ile Met Asp Ala Arg Lys Ile Gln Asp Tyr Gln His Ser
215 220 225
tgt atc ttg ggc tct ctc agt gtt cct gaa gaa get atc agt cca gga 895
Cys Ile Leu Gly Ser Leu Ser Val Pro Glu Glu Ala Ile Ser Pro Gly
230 235 240
gtc act gcc aat tgg att gaa gca aag ctt tca gat gat tct aaa gac 943
Val Thr Ala Asn Trp Ile Glu Ala Lys Leu Ser Asp Asp Ser Lys Asp
245 250 255
acg tgg aaa aaa agg ggg agt gtg gac tat gtg gtc ctg ctg gac tgg 991
4$ Thr Trp Lys Lys Arg Gly Ser Val Asp Tyr Val Val Leu Leu Asp Trp
260 265 270 275
ttt agt tca gcg aaa gat ttg ctg ctc ggg acc acg cta cgg agt ctg 1039
Phe Ser Ser Ala Lys Asp Leu Leu Leu Gly Thr Thr Leu Arg Ser Leu
280 285 290
aaa gat get ctt ttc aag tgg gaa agt aaa get gtc ctg cac cat gag 1087
Lys Asp Ala Leu Phe Lys Trp Glu Ser Lys Ala Val Leu His His Glu
295 300 305
ccc ttg gtg ctg gag ggc ggc tat gag aac tgg ctc ctg tgc tat cca 1135
Pro Leu Val Leu Glu Gly Gly Tyr Glu Asn Trp Leu Leu Cys Tyr Pro
310 315 320
CA 02449417 2003-12-04
cag ttc aca aca aat get aag gtt act cca ccc cct cgg agc agg cct 1183
Gln Phe Thr Thr Asn Ala Lys Val Thr Pro Pro Pro Arg Ser Arg Pro
325 330 335
gaa gag atg cca cct cct cct tta gaa gca aat gag aag gca cag ttg 1231
Glu Glu Met Pro Pro Pro Pro Leu Glu Ala Asn Glu Lys Ala Gln Leu
340 345 350 355
10 gta act gat caa gat ggt aaa ccg aga ccg tta gtc cag tcg get cta 1279
Val Thr Asp Gln Asp Gly Lys Pro Arg Pro Leu Val Gln Ser Ala Leu
360 365 370
gcc gga ccc agt gtg get ccc aaa get gaa get tca ccc ata att cag 1327
1$ Ala Gly Pro Ser Val Ala Pro Lys Ala Glu Ala Ser Pro Ile Ile Gln
375 380 385
cca gtg cct get aca aag aat gtt cca cag gtt gat cgt aca aaa aaa 1375
Pro Val Pro Ala Thr Lys Asn Val Pro Gln Val Asp Arg Thr Lys Lys
2~ 390 395 400
cca gca gtt aag ttg cct gaa gat cat aga atg aaa tct gaa agt aca 1423
Pro Ala Val Lys Leu Pro Glu Asp His Arg Met Lys Ser Glu Ser Thr
405 410 415
gat cag agt gga aga gtt ctt tct gac cga tcc acc aag cca gta ttt 1471
Asp Gln Ser Gly Arg Val Leu Ser Asp Arg Ser Thr Lys Pro Val Phe
420 425 430 435
acc tct cca gcc acc atg cta aca gat gaa gaa aag get cgc att cat 1519
Thr 5er Pro Ala Thr Met Leu Thr Asp Glu Glu Lys Ala Arg Ile His
440 445 450
gaa gaa aca gcc ctt ctt atg gaa aag aat aga cag gag aag gaa ctg 1567
3$ Glu Glu Thr Ala Leu Leu Met Glu Lys Asn Arg Gln Glu Lys Glu Leu
455 460 465
tgg gaa agg cag cag aag gaa cag aaa gag aag ctg aga agg gag gaa 1615
Trp Glu Arg Gln Gln Lys Glu Gln Lys Glu Lys Leu Arg Arg Glu Glu
4~ 470 475 480
caa gag cgc aaa get gga aag acc cag gat gca gaa gaa cgg gac ttc 1663
Gln Glu Arg Lys Ala Gly Lys Thr Gln Asp Ala Glu Glu Arg Asp Phe
485 490 495
act gag aat cag cac aaa gca aag gat gga caa gag aag aga gac agc 1711
Thr Glu Asn Gln His Lys Ala Lys Asp Gly Gln Glu Lys Arg Asp Ser
500 505 510 515
aaa cag acc aag gca gaa gac aga gag ccc cca gca gat ggg gcc cag 1759
Lys Gln Thr Lys Ala Glu Asp Arg Glu Pro Pro Ala Asp Gly Ala Gln
520 52S 530
gac gcc aca gga acg caa aga caa agt aag agt gaa cac gat get tcc 1807
$$ Asp Ala Thr Gly Thr Gln Arg Gln Ser Lys Ser Glu His Asp Ala Ser
535 540 545
gat get aag gta tct gtg gaa ggt aaa agg tgt ccc atg tca gaa gtg 1855
CA 02449417 2003-12-04
~s
Asp Ala Lys Val Ser Val Glu Gly Lys Arg Cys Pro Met Ser Glu Val
550 555 560
cag aag agg cca gca gat gtg tcg tct gca tcc tcc atg tcg gga gag 1903
$ Gln Lys Arg Pro Ala Asp Val Ser Ser Ala Ser Ser Met Ser Gly Glu
565 570 575
ctg agt gca ggc aag get cag cga gaa cct ttg aca aga gca aga agt 1951
Leu Ser Ala Gly Lys Ala Gln Arg Glu Pro Leu Thr Arg Ala Arg Ser
1~ 580 585 590 595
IS
gaa gaa atg ggg aga att gtg cca gga ctg cct tta ggc tgg gcc aag 1999
Glu Glu Met Gly Arg Ile Val Pro Gly Leu Pro Leu Gly Trp Ala Lys
600 605 610
ttt ctt gat cca atc act ggg act ttt cgt tac tac cat tca ccc aca 2047
Phe Leu Asp Pro Ile Thr Gly Thr Phe Arg Tyr Tyr His Ser Pro Thr
615 620 625
20 aac acg gtt cac atg tat ccg cct gag atg get cct tcg tct gtg cct 2095
Asn Thr Val His Met Tyr Pro Pro Glu Met Ala Pro Ser Ser Val Pro
630 635 640
cct tcc acc cct ccc act cac aaa gtc aag ccc cag atc cct get gag 2143
2S Pro Ser Thr Pro Pro Thr His Lys Val Lys Pro Gln Ile Pro Ala Glu
645 650 655
cgg gac agg gag cca tcc aaa ctg aag cgc tcc tac tcc tca cca gac 2191
Arg Asp Arg Glu Pro Ser Lys Leu Lys Arg Ser Tyr Ser Ser Pro Asp
3~ 660 665 670 675
atc act cag gcc ctg cag gag gag gag aag agg agg cca gca gtg acc 2239
Ile Thr Gln Ala Leu Gln Glu Glu Glu Lys Arg Arg Pro Ala Val Thr
680 685 690
ccg aca gtc aac cgg gag aac aag ccg ccg tgt tac cct aaa get gag 2287
Pro Thr Val Asn Arg Glu Asn Lys Pro Pro Cys Tyr Pro Lys Ala Glu
695 700 705
4~ atc tcg agg ctt tct get tct cag att cgg aac ctc aat ccc gtt ttt 2335
Ile Ser Arg Leu Ser Ala Ser Gln Ile Arg Asn Leu Asn Pro Val Phe
710 715 720
gga gga tct gga cca get ctt act gga ctt cgt aat ttg gga aat act 2383
4$ Gly Gly Ser Gly Pro Ala Leu Thr Gly Leu Arg Asn Leu Gly Asn Thr
725 730 735
tgt tac atg aac tca ata tta cag tgc ctg tgc aat get cca cat ttg 2431
Cys Tyr Met Asn Ser Ile Leu Gln Cys Leu Cys Asn Ala Pro His Leu
740 745 750 755
get gat tat ttc aac cga aac tgc tac cag gac gat atc aac agg tca 2479
Ala Asp Tyr Phe Asn Arg Asn Cys Tyr Gln Asp Asp Ile Asn Arg Ser
760 765 770
aat ttg ttg ggg cat aaa ggt gaa gtg gca gaa gaa ttt ggt ata atc 2527
Asn Leu Leu Gly His Lys Gly Glu Val Ala Glu Glu Phe Gly Ile Ile
775 780 785
CA 02449417 2003-12-04
79
atg aag gca ctg tgg aca gga cag tat aga tac atc agt cca aaa gac 2575
Met Lys Ala Leu Trp Thr Gly Gln Tyr Arg Tyr Ile Ser Pro Lys Asp
790 795 800
ttt aaa gtc acc att ggt aag att aat gac cag ttt gca gga tcc agc 2623
Phe Lys Val Thr Ile Gly Lys Ile Asn Asp Gln Phe Ala Gly Ser Ser
805 810 815
$
cag caa gat tca caa gag ctg ctg ctt ttc ctc atg gat ggc ctc cac 2671
Gln Gln Asp Ser Gln Glu Leu Leu Leu Phe Leu Met Asp Gly Leu His
820 825 830 835
gag gat cta aat aag get gac aat cgg aag agg cat aag gaa gag aac 2719
1$ Glu Asp Leu Asn Lys Ala Asp Asn Arg Lys Arg His Lys Glu Glu Asn
840 845 850
aat gac cac ctc gat gac ttt aaa gcg gca gaa cat gcc tgg cag aag 2767
Asn Asp His Leu Asp Asp Phe Lys Ala Ala Glu His Ala Trp Gln Lys
2~ 855 860 865
cac aag cag ctc aat gag tcc att att gtc gca ctc ttt cag ggt cag 2815
His Lys Gln Leu Asn Glu Ser Ile Ile Val Ala Leu Phe Gln Gly Gln
870 875 880
2$
ttc aaa tcc aca gtg cag tgc ctc acc tgt cac aag aag tct cgg aca 2863
Phe Lys Ser Thr Val Gln Cys Leu Thr Cys His Lys Lys Ser Arg Thr
885 890 895
30 ttc gag get ttc atg tat ttg tct ttg cca cta gca tcc aca agt aaa 2911
Phe Glu Ala Phe Met Tyr Leu Ser Leu Pro Leu Ala Ser Thr Ser Lys
900 905 910 915
tgt act tta cag gac tgc ctt aga tta ttt tcc aaa gaa gaa aag ctt 2959
3$ Cys Thr Leu Gln Asp Cys Leu Arg Leu Phe Ser Lys Glu Glu Lys Leu
920 925 930
aca gat aac aac aga ttt tac tgc agc cat tgc cga get cgg cgg gat 3007
Thr Asp Asn Asn Arg Phe Tyr Cys Ser His Cys Arg Ala Arg Arg Asp
4~ 935 940 945
tct cta aag aaa ata gaa atc tgg aaa ttg cct cct gtg ctg tta gta 3055
Ser Leu Lys Lys Ile Glu Ile Trp Lys Leu Pro Pro Val Leu Leu Val
950 955 960
4$
cac ctg aaa cga ttc tcc tat gac ggc agg tgg aag cag aaa ctg caa 3103
His Leu Lys Arg Phe Ser Tyr Asp Gly Arg Trp Lys Gln Lys Leu Gln
965 970 975
$0 acg tcc gtg gat ttc cca tta gaa aat ctt gac ctg tca cag tat gtt 3151
Thr Ser Val Asp Phe Pro Leu Glu Asn Leu Asp Leu Ser Gln Tyr Val
980 985 990 995
att ggc cca aaa agc agt ttg aag aaa tat aac ttg ttt tct gtt 3196
$$ Ile Gly Pro Lys Ser Ser Leu Lys Lys Tyr Asn Leu Phe Ser Val
1000 1005 1010
tca aac cac tac ggc ggg ctc gat gga ggc cac tac acg gcc tat 3241
CA 02449417 2003-12-04
80
Ser AsnHisTyr Gly GlyLeuAsp GlyGly His TyrThrAlaTyr
1015 1020 1025
tgt aaaaacgcg gcg aggcagcgc tggttt aag tttgatgaccac 3286
$ Cys LysAsnAla Ala ArgGlnArg TrpPhe Lys PheAspAspHis
1030 1035 1040
gag gtttcggac atc tccgtgtct tctgtg agg tcgtcagcaget 3331
Glu ValSerAsp Ile SerValSer SerVal Arg SerSerAlaAla
1045 1050 1055
tat atcctgttt tac acctccctg gggcca cgc gtgactgaggca 3376
Tyr IleLeuPhe Tyr ThrSerLeu GlyPro Arg ValThrGluAla
1060 1065 1070
1$
gcc acataa 3385
Ala Thr
<210> 44
<211> 1072
<212> PRT
<213> Rattus norvegicus
2$
<400> 44
Met Pro Ala Val Ala Ser Val Pro Lys Glu Leu Tyr Leu Ser Ser Ser
1 5 10 15
3$
Leu Lys Asp Leu Asn Lys Lys Thr Glu Val Lys Pro Glu Lys Thr Ser
20 25 30
Thr Lys Asn Tyr Ile His Ser Ala Gln Lys Ile Phe Lys Ala Ala Glu
40 45
Glu Cys Arg Leu Asp Arg Asp Glu Glu Arg Ala Tyr Val Leu Tyr Met
55 60
Lys Tyr Val Ala Val Tyr Asn Leu Ile Lys Lys Arg Pro Asp Phe Lys
4$ 65 70 75 80
$0
$$
Gln Gln Gln Asp Tyr Tyr Leu Ser Ile Leu Gly Pro Ala Asn Ile Lys
85 90 95
Lys Ala Ile Glu Glu Ala Glu Arg Leu Ser Glu Ser Leu Lys Leu Arg
100 105 110
Tyr Glu Glu Ala Glu Val Arg Lys Gln Leu Glu Glu Lys Asp Arg Arg
115 120 125
CA 02449417 2003-12-04
81
Glu Glu Glu Gln Leu Gln Gln Gln Lys Arg Gln Glu Met Gly Arg Glu
130 135 140
Asp Ser Gly Ala Ala Ala Lys Arg Ser Val Glu Asn Leu Leu Asp Ser
145 150 155 160
Lys Thr Lys Ile Gln Arg Val Leu Gln Val His Cys Val Asn Thr Gly
165 170 175
Pro Val Cys Gln Val Asn Gly Glu Lys Ser Glu Gly Gly Ala Ala Ala
180 185 190
25
Glu Arg Gly Ala Val Thr Ala Lys Glu Leu Tyr Thr Met Met Met Asp
195 200 205
Lys Asn Thr Ser Leu Ile Ile Met Asp Ala Arg Lys Ile Gln Asp Tyr
210 215 220
Gln His Ser Cys Ile Leu Gly Ser Leu Ser Val Pro Glu Glu Ala Ile
225 230 235 240
Ser Pro Gly Val Thr Ala Asn Trp Ile Glu Ala Lys Leu Ser Asp Asp
245 250 255
Ser Lys Asp Thr Trp Lys Lys Arg Gly Ser Val Asp Tyr Val Val Leu
3$ 260 265 270
45
Leu Asp Trp Phe Ser Ser Ala Lys Asp Leu Leu Leu Gly Thr Thr Leu
275 280 285
Arg Ser Leu Lys Asp Ala Leu Phe Lys Trp Glu Ser Lys Ala Val Leu
290 295 300
His His Glu Pro Leu Val Leu Glu Gly Gly Tyr Glu Asn Trp Leu Leu
305 310 315 320
$0 Cys Tyr Pro Gln Phe Thr Thr Asn Ala Lys Val Thr Pro Pro Pro Arg
325 330 335
Ser Arg Pro Glu Glu Met Pro Pro Pro Pro Leu Glu Ala Asn Glu Lys
5$ 340 345 350
Ala Gln Leu Val Thr Asp Gln Asp Gly Lys Pro Arg Pro Leu Val Gln
CA 02449417 2003-12-04
82
355 360 365
Ser Ala Leu Ala Gly Pro Ser Val Ala Pro Lys Ala Glu Ala Ser Pro
$ 370 375 380
Ile Ile Gln Pro Val Pro Ala Thr Lys Asn Val Pro Gln Val Asp Arg
385 390 395 400
1$
Thr Lys Lys Pro Ala Val Lys Leu Pro Glu Asp His Arg Met Lys Ser
405 410 415
Glu Ser Thr Asp Gln Ser Gly Arg Val Leu Ser Asp Arg Ser Thr Lys
420 425 430
Pro Val Phe Thr Ser Pro Ala Thr Met Leu Thr Asp Glu Glu Lys Ala
435 440 445
Arg Ile His Glu Glu Thr Ala Leu Leu Met Glu Lys Asn Arg Gln Glu
2$ 450 455 460
3$
Lys Glu Leu Trp Glu Arg Gln Gln Lys Glu Gln Lys Glu Lys Leu Arg
465 470 475 480
Arg Glu Glu Gln Glu Arg Lys Ala Gly Lys Thr Gln Asp Ala Glu Glu
485 490 495
Arg Asp Phe Thr Glu Asn Gln His Lys Ala Lys Asp Gly Gln Glu Lys
500 505 510
Arg Asp Ser Lys Gln Thr Lys Ala Glu Asp Arg Glu Pro Pro Ala Asp
515 520 525
Gly Ala Gln Asp Ala Thr Gly Thr Gln Arg Gln Ser Lys Ser Glu His
4$ 530 535 540
Asp Ala Ser Asp Ala Lys Val Ser Val Glu Gly Lys Arg Cys Pro Met
545 550 555 560
$0
$$
Ser Glu Val Gln Lys Arg Pro Ala Asp Val Ser Ser Ala Ser Ser Met
565 570 575
Ser Gly Glu Leu Ser Ala Gly Lys Ala Gln Arg Glu Pro Leu Thr Arg
580 585 590
CA 02449417 2003-12-04
83
Ala Arg Ser Glu Glu Met Gly Arg Ile Val Pro Gly Leu Pro Leu Gly
595 600 605
Trp Ala Lys Phe Leu Asp Pro Ile Thr Gly Thr Phe Arg Tyr Tyr His
610 615 620
Ser Pro Thr Asn Thr Val His Met Tyr Pro Pro Glu Met Ala Pro Ser
625 630 635 640
Ser Val Pro Pro Ser Thr Pro Pro Thr His Lys Val Lys Pro Gln Ile
645 650 655
25
Pro Ala Glu Arg Asp Arg Glu Pro Ser Lys Leu Lys Arg Ser Tyr Ser
660 665 670
Ser Pro Asp Ile Thr Gln Ala Leu Gln Glu Glu Glu Lys Arg Arg Pro
675 680 685
Ala Val Thr Pro Thr Val Asn Arg Glu Asn Lys Pro Pro Cys Tyr Pro
690 695 700
Lys Ala Glu Ile Ser Arg Leu Ser Ala Ser Gln Ile Arg Asn Leu Asn
705 710 715 720
Pro Val Phe Gly Gly Ser Gly Pro Ala Leu Thr Gly Leu Arg Asn Leu
3$ 725 730 735
45
Gly Asn Thr Cys Tyr Met Asn Ser Ile Leu Gln Cys Leu Cys Asn Ala
740 745 750
Pro His Leu Ala Asp Tyr Phe Asn Arg Asn Cys Tyr Gln Asp Asp Ile
755 760 765
Asn Arg Ser Asn Leu Leu Gly His Lys Gly Glu Val Ala Glu Glu Phe
770 775 780
Gly Ile Ile Met Lys Ala Leu Trp Thr Gly Gln Tyr Arg Tyr Ile Ser
785 790 795 800
Pro Lys Asp Phe Lys Val Thr Ile Gly Lys Ile Asn Asp Gln Phe Ala
805 810 815
Gly Ser Ser Gln Gln Asp Ser Gln Glu Leu Leu Leu Phe Leu Met Asp
CA 02449417 2003-12-04
84
820 825 830
Gly Leu His Glu Asp Leu Asn Lys Ala Asp Asn Arg Lys Arg His Lys
$ 835 840 845
1$
Glu Glu Asn Asn Asp His Leu Asp Asp Phe Lys Ala Ala Glu His Ala
850 855 860
Trp Gln Lys His Lys Gln Leu Asn Glu Ser Ile Ile Val Ala Leu Phe
865 870 875 880
Gln Gly Gln Phe Lys Ser Thr Val Gln Cys Leu Thr Cys His Lys Lys
885 890 895
Ser Arg Thr Phe Glu Ala Phe Met Tyr Leu Ser Leu Pro Leu Ala Ser
900 905 910
Thr Ser Lys Cys Thr Leu Gln Asp Cys Leu Arg Leu Phe Ser Lys Glu
2$ 915 920 925
Glu Lys Leu Thr Asp Asn Asn Arg Phe Tyr Cys Ser His Cys Arg Ala
930 935 940
Arg Arg Asp Ser Leu Lys Lys Ile Glu Ile Trp Lys Leu Pro Pro Val
945 950 955 960
3$
Leu Leu Val His Leu Lys Arg Phe Ser Tyr Asp Gly Arg Trp Lys Gln
965 970 975
Lys Leu Gln Thr Ser Val Asp Phe Pro Leu Glu Asn Leu Asp Leu Ser
980 985 990
Gln Tyr Val Ile Gly Pro Lys Ser Ser Leu Lys Lys Tyr Asn Leu Phe
4$ 995 1000 1005
Ser Val Ser Asn His Tyr Gly Gly Leu Asp Gly Gly His Tyr Thr
1010 1015 1020
$0
Ala Tyr Cys Lys Asn Ala Ala Arg Gln Arg Trp Phe Lys Phe Asp
1025 1030 1035
$$
Asp His Glu Val Ser Asp Ile Ser Val Ser Ser Val Arg Ser Ser
1040 1045 1050
CA 02449417 2003-12-04
85
Ala Ala Tyr Ile Leu Phe Tyr Thr Ser Leu Gly Pro Arg Val Thr
1055 1060 1065
Glu Ala Ala Thr
1070
<210> 45
<211> 504
<212> DNA
<213> Rattus norvegicus
<220>
<221> CDS
<222> (1)..(504)
<400> 45
atg gta cgt ctg ggt atc ttg ggt tta gat gcc ttc tgt atg ttc att 48
Met Val Arg Leu Gly Ile Leu Gly Leu Asp Ala Phe Cys Met Phe Ile
1 5 10 15
ggt gtt ggg gaa gta gcg gag ctt gaa gag atc cgc aaa tgt gga atg 96
Gly Val Gly Glu Val Ala Glu Leu Glu Glu Ile Arg Lys Cys Gly Met
20 25 30
aaa aac ttc cgt aac atc cag gtt gat gaa get aat tta ttg act tgg 144
Lys Asn Phe Arg Asn Ile Gln Val Asp Glu Ala Asn Leu Leu Thr Trp
40 45
caa ggg ctt att gtt cct gac aac cct cca tat gat aag gga gcc ttc 192
Gln Gly Leu Ile Val Pro Asp Asn Pro Pro Tyr Asp Lys Gly Ala Phe
3$ 50 55 60
aga att gag atc aac ttc cca gca gag tat ccc ttc aag cca ccc aag 240
Arg Ile Glu Ile Asn Phe Pro Ala Glu Tyr Pro Phe Lys Pro Pro Lys
65 70 75 80
atc aca ttt aaa aca aag atc tac cac cct aac atc gac gag aag ggg 288
Ile Thr Phe Lys Thr Lys Ile Tyr His Pro Asn Ile Asp Glu Lys Gly
85 90 95
4S cag gtc tgt ctg ccc gta att agt gcg gaa aac tgg aag ccg gcc acc 336
Gln Val Cys Leu Pro Val Ile Ser Ala Glu Asn Trp Lys Pro Ala Thr
100 105 110
aag act gac caa gta atc cag tcc ctc ata gca ctg gtg aac gac cct 384
$0 Lys Thr Asp Gln Val Ile Gln Ser Leu Ile Ala Leu Val Asn Asp Pro
115 120 125
cag cct gag cac cca ctc cgg get gac cta get gaa gaa tac tct aag 432
Gln Pro Glu His Pro Leu Arg Ala Asp Leu Ala Glu Glu Tyr Ser Lys
$5 130 135 140
gac cgt aaa aaa ttc tgt aag aat get gaa gag ttt aca aag aaa tat 480
Asp Arg Lys Lys Phe Cys Lys Asn Ala Glu Glu Phe Thr Lys Lys Tyr
CA 02449417 2003-12-04
86
145 150 155 160
ggg gaa aag cga cct gtg gac taa 504
Gly Glu Lys Arg Pro Val Asp
$ 165
<210> 46
<211> 167
<212> PRT
<213> Rattus norvegicus
<400> 46
1$ Met Val Arg Leu Gly Ile Leu Gly Leu Asp Ala Phe Cys Met Phe Ile
1 5 10 15
Gly Val Gly Glu Val Ala Glu Leu Glu Glu Ile Arg Lys Cys Gly Met
20 25 30
2$
Lys Asn Phe Arg Asn Ile Gln Val Asp Glu Ala Asn Leu Leu Thr Trp
40 45
Gln Gly Leu Ile Val Pro Asp Asn Pro Pro Tyr Asp Lys Gly Ala Phe
50 55 60
Arg Ile Glu Ile Asn Phe Pro Ala Glu Tyr Pro Phe Lys Pro Pro Lys
65 70 75 80
3$ Ile Thr Phe Lys Thr Lys Ile Tyr His Pro Asn Ile Asp Glu Lys Gly
85 90 95
Gln Val Cys Leu Pro Val Ile Ser Ala Glu Asn Trp Lys Pro Ala Thr
loo l05 llo
4$
$0
Lys Thr Asp Gln Val Ile Gln Ser Leu Ile Ala Leu Val Asn Asp Pro
115 120 125
Gln Pro Glu His Pro Leu Arg Ala Asp Leu Ala Glu Glu Tyr Ser Lys
130 135 140
Asp Arg Lys Lys Phe Cys Lys Asn Ala Glu Glu Phe Thr Lys Lys Tyr
145 150 155 160
$$ Gly Glu Lys Arg Pro Val Asp
165
CA 02449417 2003-12-04
87
<zlo> 47
<211> 7620
<212> DNA
<213> Rattus norvegicus
<220>
<221> CDS
<222> (1)..(7620)
<400> 47
atg aca gcc acg act cgt ggc tct cca gtt gga ggg aat gac aac cag 48
Met Thr Ala Thr Thr Arg Gly Ser Pro Val Gly Gly Asn Asp Asn Gln
1 5 10 15
ggc caa get cct gat gga cag tct cag ccc ccc ctc caa cag aat cag 96
Gly Gln Ala Pro Asp Gly Gln Ser Gln Pro Pro Leu Gln Gln Asn Gln
25 30
20 act tca tcg cct gat tca tcc aat gaa aat tcc cct gca act cct cct 144
Thr Ser Ser Pro Asp Ser Ser Asn Glu Asn Ser Pro Ala Thr Pro Pro
35 40 45
gat gag caa ggc caa ggt gat get cct ccc cag att gaa gat gag gaa 192
ZS Asp Glu Gln Gly Gln Gly Asp Ala Pro Pro Gln Ile Glu Asp Glu Glu
50 55 60
cct gca ttt cca cac act gac ctg gca aag tta gat gat atg atc aac 240
Pro Ala Phe Pro His Thr Asp Leu Ala Lys Leu Asp Asp Met Ile Asn
3~ 65 70 75 80
agg cct cgc tgg gtc gtt cca gtt ttg ccg aaa ggg gaa tta gaa gtg 288
Arg Pro Arg Trp Val Val Pro Val Leu Pro Lys Gly Glu Leu Glu Val
85 90 95
ctt ttagaa getgetatt gatcttagt aagaaaggc cttgatgtc aaa 336
Leu LeuGlu AlaAlaIle AspLeuSer LysLysGly LeuAspVal Lys
100 105 110
4~ agt gaagca tgtcagaga tttttccga gatgggcta acaatctca ttc 384
Ser GluAla CysGlnArg PhePheArg AspGlyLeu ThrIleSer Phe
115 120 125
aca aaaatc cttacagat gaagcagtg agtggctgg aagtttgaa att 432
4$ Thr LysIle LeuThrAsp GluAlaVal SerGlyTrp LysPheGlu Ile
130 135 140
cat agatgt attattaac aatactcat cgcctggtg gagctgtgt gtg 480
His ArgCys IleIleAsn AsnThrHis ArgLeuVal GluLeuCys Val
145 150 155 160
get aagtta gcccaagac tggtttcca cttctagaa cttcttgcc atg 528
Ala LysLeu AlaGlnAsp TrpPhePro LeuLeuGlu LeuLeuAla Met
165 170 175
55
gcc ttaaat cctcattgc aaattccat atctacaat ggtacacgt ccc 576
Ala LeuAsn ProHisCys LysPheHis IleTyrAsn GlyThrArg Pro
180 185 190
CA 02449417 2003-12-04
88
tgc gag tca gtg tcc tca agt gtt cag ttg cct gaa gat gaa ctc ttt 624
Cys Glu Ser Val Ser Ser Ser Val Gln Leu Pro Glu Asp Glu Leu Phe
195 200 205
$
get cgt tct cca gac cct cga tca cca aaa ggt tgg cta gtg gat ctc 672
Ala Arg Ser Pro Asp Pro Arg Ser Pro Lys Gly Trp Leu Val Asp Leu
210 215 220
ctc aacaaa tttggcact ttaaatggattc cagatactg catgatcgt 720
Leu AsnLys PheGlyThr LeuAsnGlyPhe GlnIleLeu HisAspArg
225 230 235 240
ttt attaat ggatcagca ttaaatgttcag ataattgca gcccttatt 768
1$ Phe IleAsn GlySerAla LeuAsnValGln IleIleAla AlaLeuIle
245 250 255
aaa ccattt ggacagtgc tatgagtttctt actcttcac acggtgaaa 816
Lys ProPhe GlyGlnCys TyrGluPheLeu ThrLeuHis ThrValLys
2~ 260 265 270
aaa tacttt cttccaata atagaaatggtt ccacagttt ttagaaaac 864
Lys TyrPhe LeuProIle IleGluMetVal ProGlnPhe LeuGluAsn
275 280 285
2$
tta actgat gaagagctg aagaaagaagca aagaatgaa gccaaaaat 912
Leu ThrAsp GluGluLeu LysLysGluAla LysAsnGlu AlaLysAsn
290 295 300
30 gat getctc tcaatgatt attaaatcattg aagagttta gettcacga 960
Asp AlaLeu SerMetIle IleLysSerLeu LysSerLeu AlaSerArg
305 310 315 320
gtt cctgga caggaagaa actgtaaagaac ttagaaata tttaggtta 1008
3$ Val ProGly GlnGluGlu ThrValLysAsn LeuGluIle PheArgLeu
325 330 335
aaa atgata cttagatta ttgcaaatttct tccttcaat ggaaagatg 1056
Lys MetIle LeuArgLeu LeuGlnIleSer SerPheAsn GlyLysMet
4~ 340 345 350
aat gcactg aatgaggttaat aaggtgatt tccagtgtg tcatactat 1104
Asn AlaLeu AsnGluValAsn LysValIle SerSerVal SerTyrTyr
355 360 365
4$
acc catcgg catggcagttct gaggaagaa gagtggctc acagcagag 1152
Thr HisArg HisGlySerSer GluGluGlu GluTrpLeu ThrAlaGlu
370 375 380
$0 agg atgget gaatggatacag cagaacaat attttatca atagtttta 1200
Arg MetAla GluTrpIleGln GlnAsnAsn IleLeuSer IleValLeu
385 390 395 400
cga gatagt cttcatcaacca cagtatgta gagaaacta gaaaagatt 1248
$$ Arg AspSer LeuHisGlnPro GlnTyrVal GluLysLeu GluLysIle
405 410 415
ctt cgcttt gtcataaaagaa aaagetctg accttgcaa gatcttgat 1296
CA 02449417 2003-12-04
89
Leu Arg Phe Val Ile Lys Glu Lys Ala Leu Thr Leu Gln Asp Leu Asp
420 425 430
aat atc tgg gca gca cag gca ggg aaa cat gaa gcc atc gta aag aat 1344
$ Asn Ile Trp Ala Ala Gln Ala Gly Lys His Glu Ala Ile Val Lys Asn
435 440 445
gtc cat gat cta ctg gcc aaa ttg gca tgg gat ttt tct cct gaa caa 1392
Val His Asp Leu Leu Ala Lys Leu Ala Trp Asp Phe Ser Pro Glu Gln
450 455 460
1$
ctt gat cat ctt ttt gat tgc ttt aag gcc agt tgg aca aat gca agt 1440
Leu Asp His Leu Phe Asp Cys Phe Lys Ala Ser Trp Thr Asn Ala Ser
465 470 475 480
aaa aag caa cgt gaa aag ctc ctt gag ctg att cgt cgt ctt gca gaa 1488
Lys Lys Gln Arg Glu Lys Leu Leu Glu Leu Ile Arg Arg Leu Ala Glu
485 490 495
gat gat aaa gat ggt gtg atg gca cat aaa gtg ttg aac ctt ctg tgg 1536
Asp Asp Lys Asp Gly Val Met Ala His Lys Val Leu Asn Leu Leu Trp
500 505 510
aat cta get cac agt gat gat gtg cct gtg gat atc atg gac ttg get 1584
2$ Asn Leu Ala His Ser Asp Asp Val Pro Val Asp Ile Met Asp Leu Ala
515 520 525
ctc agt get cac atc aaa ata cta gat tat agt tgc tcc cag gac cgg 1632
Leu Ser Ala His Ile Lys Ile Leu Asp Tyr Ser Cys Ser Gln Asp Arg
530 535 540
3$
gac aca caa aag atc cag tgg ata gat cgc ttc ata gaa gaa ctt cgc 1680
Asp Thr Gln Lys Ile Gln Trp Ile Asp Arg Phe Ile Glu Glu Leu Arg
545 550 555 560
aca aat gac aag tgg gtc att cct gca ctg aaa caa att aga gaa att 1728
Thr Asn Asp Lys Trp Val Ile Pro Ala Leu Lys Gln Ile Arg Glu Ile
565 570 575
tgc agt ttg ttt ggt gaa gca cct caa aat ttg agt caa act cag aga 1776
Cys Ser Leu Phe Gly Glu Ala Pro Gln Asn Leu Ser Gln Thr Gln Arg
580 585 590
agt ccc cat gta ttt tat cgc cat gat tta atc aat caa ctt cag cac 1824
4$ Ser Pro His Val Phe Tyr Arg His Asp Leu Ile Asn Gln Leu Gln His
595 600 605
aat cat gcc cta gtt act ttg gta gca gaa aac ctt gca act tac atg 1872
Asn His Ala Leu Val Thr Leu Val Ala Glu Asn Leu Ala Thr Tyr Met
$0 610 615 620
$$
gaa agc atg aga ctg tat ggc aga gac aat gaa gac tat gac cca caa 1920
Glu Ser Met Arg Leu Tyr Gly Arg Asp Asn Glu Asp Tyr Asp Pro Gln
625 630 635 640
act gtg aga gtg gga agt aga tat agt cat gtt caa gaa gtc caa gaa 1968
Thr Val Arg Val Gly Ser Arg Tyr Ser His Val Gln Glu Val Gln Glu
645 650 655
CA 02449417 2003-12-04
90
cgt ctt aac ttt ctt aga ttt tta ttg aag gat ggc cag cta tgg ctg 2016
Arg Leu Asn Phe Leu Arg Phe Leu Leu Lys Asp Gly Gln Leu Trp Leu
660 665 670
tgt get cct cag gca aaa caa ata tgg aag tgc tta gca gag aat gcg 2064
Cys Ala Pro Gln Ala Lys Gln Ile Trp Lys Cys Leu Ala Glu Asn Ala
675 680 685
gtt tat ctt tgt gac cgt gaa gcc tgc ttt aag tgg tat tcc aaa tta 2112
Val Tyr Leu Cys Asp Arg Glu Ala Cys Phe Lys Trp Tyr Ser Lys Leu
690 695 700
atg gga gat gaa cca gac tta gat cct gat atc aat aag gac ttc ttt 2160
1$ Met Gly Asp Glu Pro Asp Leu Asp Pro Asp Ile Asn Lys Asp Phe Phe
705 710 715 720
gaa agt aat gtg ctt cag ctt gat cct tca cta tta act gaa aat gga 2208
Glu Ser Asn Val Leu Gln Leu Asp Pro Ser Leu Leu Thr Glu Asn Gly
725 730 735
2$
atg aaa tgt ttt gag aga ttc ttc aaa get gtg aat tgt cga gaa gga 2256
Met Lys Cys Phe Glu Arg Phe Phe Lys Ala Val Asn Cys Arg Glu Gly
740 745 750
aaa cta gta gca aaa aga aga gcc tat atg atg gat gat ttg gaa ttg 2304
Lys Leu Val Ala Lys Arg Arg Ala Tyr Met Met Asp Asp Leu Glu Leu
755 760 765
ata gga tta gac tat ctt tgg agg gtt gta att cag agt aat gat gat 2352
Ile Gly Leu Asp Tyr Leu Trp Arg Val Val Ile Gln Ser Asn Asp Asp
770 775 780
att gcc agc cga get att gat ctc ctc aaa gag ata tac aca aac ctt 2400
3$ Ile Ala Ser Arg Ala Ile Asp Leu Leu Lys Glu Ile Tyr Thr Asn Leu
785 790 795 800
ggt cca aga ctg cag gtc aat cag gtg gtg atc cat gaa gac ttc att 2448
Gly Pro Arg Leu Gln Val Asn Gln Val Val Ile His Glu Asp Phe Ile
805 810 815
4$
cag tct tgc ttt gat cgt ttg aaa gcc tct tat gac acg ttg tgt gtt 2496
Gln Ser Cys Phe Asp Arg Leu Lys Ala Ser Tyr Asp Thr Leu Cys Val
820 825 830
ttg gat ggt gac aaa gac agt att aat tgt gca aga cag gaa get gtt 2544
Leu Asp Gly Asp Lys Asp Ser Ile Asn Cys Ala Arg Gln Glu Ala Val
835 840 845
$0 cga atg gtc cga gta tta act gtt tta aga gaa tat ata aat gaa tgt 2592
Arg Met Val Arg Val Leu Thr Val Leu Arg Glu Tyr Ile Asn Glu Cys
850 855 860
gac agt gat tat cat gaa gaa aga aca att ttg cct atg tca aga get 2640
$$ Asp Ser Asp Tyr His Glu Glu Arg Thr Ile Leu Pro Met Ser Arg Ala
865 870 875 880
ttc cgt ggt aaa cac ctc tct ttt ata gtt cgg ttt cca aac cag ggc 2688
CA 02449417 2003-12-04
91
Phe Arg Gly Lys His Leu Ser Phe Ile Val Arg Phe Pro Asn Gln Gly
885 890 895
aga caa gta gat gac ttg gaa gtt tgg tct cat aca aat gat acc att 2736
$ Arg Gln Val Asp Asp Leu Glu Val Trp Ser His Thr Asn Asp Thr Ile
900 905 910
ggt tca gtt cga cga tgt ata cta aat cgc att aaa gcc aat gta get 2784
Gly Ser Val Arg Arg Cys Ile Leu Asn Arg Ile Lys Ala Asn Val Ala
l~ 915 920 925
1$
cat aca aaa att gaa ctc ttt gtg ggt ggt gag ctt att gat cct gga 2832
His Thr Lys Ile Glu Leu Phe Val Gly Gly Glu Leu Ile Asp Pro Gly
930 935 940
gat gac aga aag ttg att gga caa tta aac cta aaa gat aaa tca cta 2880
Asp Asp Arg Lys Leu Ile Gly Gln Leu Asn Leu Lys Asp Lys Ser Leu
945 950 955 960
2~ att aca gcc aaa ctt aca caa atc agc tcc aat atg ccg tca agt cct 2928
Ile Thr Ala Lys Leu Thr Gln Ile Ser Ser Asn Met Pro Ser Ser Pro
965 970 975
gat agc tcc tct gat tcc tca act gga tct cct gga aac cat ggt aat 2976
2$ Asp Ser Ser Ser Asp Ser Ser Thr Gly Ser Pro Gly Asn His Gly Asn
980 985 990
cat tac agt gat ggt ccc aac cca gag gta gaa agc tgt ttg cct gga 3024
His Tyr Ser Asp Gly Pro Asn Pro Glu Val Glu Ser Cys Leu Pro Gly
3~ 995 1000 1005
3$
gtg ata atg tca ctt cat ccc aga tac atc tct ttc ctt tgg caa 3069
Val Ile Met Ser Leu His Pro Arg Tyr Ile Ser Phe Leu Trp Gln
1010 1015 1020
gtt gca gac tta ggg agc agc cta aat atg ccc cct ctt aga gat 3114
Val Ala Asp Leu Gly Ser Ser Leu Asn Met Pro Pro Leu Arg Asp
1025 1030 1035
40 gga gca aga gtt ctt atg aaa ctt atg ccg cca gat agt aca aca 3159
Gly Ala Arg Val Leu Met Lys Leu Met Pro Pro Asp Ser Thr Thr
1040 1045 1050
ata gaa aaa tta aga get att tgt tta gat cat gcc aaa ctt gga 3204
4$ Ile Glu Lys Leu Arg Ala Ile Cys Leu Asp His Ala Lys Leu Gly
1055 1060 1065
gaa agc agc ctt agt cca tct ctt gac tca ctt ttc ttt ggt cct 3249
Glu Ser Ser Leu Ser Pro Ser Leu Asp Ser Leu Phe Phe Gly Pro
$~ 1070 1075 1080
$$
tca gcc tca caa gtg cta tac cta aca gag gta gtc tat gcc ctg 3294
Ser Ala Ser Gln Val Leu Tyr Leu Thr Glu Val Val Tyr Ala Leu
1085 1090 1095
tta atg cct get ggt gca ccc ctg get gat gac tcc tct gat ttt 3339
Leu Met Pro Ala Gly Ala Pro Leu Ala Asp Asp Ser Ser Asp Phe
1100 1105 1110
CA 02449417 2003-12-04
92
cag ttt cac ttcttgaaa agt ggtggt ttgcccctt gtt ctgagt 3384
Gln Phe His PheLeuLys Ser GlyGly LeuProLeu Val LeuSer
1115 1120 1125
atg cta acc agaaataac ttc ctacca aatgetgat atg gaaact 3429
Met Leu Thr ArgAsnAsn Phe LeuPro AsnAlaAsp Met GluThr
1130 1135 1140
cga agg ggt gcctacctc aat getctt aaaatagcc aaa ctgtta 3474
Arg Arg Gly AlaTyrLeu Asn AlaLeu LysIleAla Lys LeuLeu
1145 1150 1155
cta act gcc attggctat ggc catgtt cgggetgtg gca gaagca 3519
IS Leu Thr Ala IleGlyTyr Gly HisVal ArgAlaVal Ala GluAla
1160 1165 1170
tgt cag cca ggtgtagaa ggc gtgaat cctatgaca tcg gtcaac 3564
Cys Gln Pro GlyValGlu Gly ValAsn ProMetThr Ser ValAsn
2~ 1175 1180 1185
caa gta act catgatcaa gca gtggtg ctacaaagt gcc cttcag 3609
Gln Val Thr HisAspGln Ala ValVal LeuGlnSer Ala LeuGln
1190 1195 1200
2$
agc att cct aacccatca tct gaatgc atgcttaga aac gtgtct 3654
Ser Ile Pro AsnProSer Ser GluCys MetLeuArg Asn ValSer
1205 1210 1215
30 gtt cgt ctt getcagcag att tctgat gaggettca aga tatatg 3699
Val Arg Leu AlaGlnGln Ile SerAsp GluAlaSer Arg TyrMet
1220 1225 1230
cct gat att tgtgtaatt aga getata caaaagatt att tggaca 3744
3$ Pro Asp Ile CysValIle Arg AlaIle GlnLysIle Ile TrpThr
1235 1240 1245
tca gga tgt gggggatta caa ctggta ttcagccca aat gaggaa 3789
Ser Gly Cys GlyGlyLeu Gln LeuVal PheSerPro Asn GluGlu
4~ 1250 1255 1260
gtc aca aaa atttatgag aag accaat gcaggcaat gag ccagac 3834
Val Thr Lys IleTyrGlu Lys ThrAsn AlaGlyAsn Glu ProAsp
1265 1270 1275
45
ctt gaa gat gaacaggtt tgc tgtgag gcattggaa gtg atgaca 3879
Leu Glu Asp GluGlnVal Cys CysGlu AlaLeuGlu Val MetThr
1280 1285 1290
50 ctg tgt ttc gccctgatt cca acagcc ttagatget cta agtaaa 3924
Leu Cys Phe AlaLeuIle Pro ThrAla LeuAspAla Leu SerLys
1295 1300 1305
gaa aag get tggcagaca ttt attatt gacttactg tta cactgt 3969
55 Glu Lys Ala TrpGlnThr Phe IleIle AspLeuLeu Leu HisCys
1310 1315 1320
cac agc aaa aaagggtta gaa tgcatc cctcaaact ctt caggga 4014
CA 02449417 2003-12-04
93
His Ser Lys Lys Gly Leu Glu Cys Ile Pro Gln Thr Leu Gln Gly
1325 1330 1335
cag tat gag gtc act aaa cat gca gtg agc aca gcc aga gag agg 4059
$ Gln Tyr Glu Val Thr Lys His Ala Val Ser Thr Ala Arg Glu Arg
1340 1345 1350
get aaa cat tca ggc gac tac ttt act ctt tta agg cat ctt ctt 4104
Ala Lys His Ser Gly Asp Tyr Phe Thr Leu Leu Arg His Leu Leu
1355 1360 1365
1$
aat tac get tac aac agt aac att aat gta ccc aat get gaa gtt 4149
Asn Tyr Ala Tyr Asn Ser Asn Ile Asn Val Pro Asn Ala Glu Val
1370 1375 1380
ctt cta aat aat gaa att gat tgg ctt aaa aga att agg gat gat 4194
Leu Leu Asn Asn Glu Ile Asp Trp Leu Lys Arg Ile Arg Asp Asp
1385 1390 1395
gtt aaa aga aca ggt gaa aca ggc gtt gaa gag aca atc tta gaa 4239
Val Lys Arg Thr Gly Glu Thr Gly Val Glu Glu Thr Ile Leu Glu
1400 1405 1410
gga cac ctt ggg gtt aca aag gag cta ctg get ttt cag acc cct 4284
2$ Gly His Leu Gly Val Thr Lys Glu Leu Leu Ala Phe Gln Thr Pro
1415 1420 1425
gag aaa aag ttt cat att ggt tgt gaa aag ggg ggt get aat ctc 4329
Glu Lys Lys Phe His Ile Gly Cys Glu Lys Gly Gly Ala Asn Leu
1430 1435 1440
att aaa gaa tta atc gac gat ttc atc ttt cct gca tcc aat gtt 4374
Ile Lys Glu Leu Ile Asp Asp Phe Ile Phe Pro Ala Ser Asn Val
1445 1450 1455
3$
tac ctc cag tat atg aga aat gga gaa ctc cct get gag cag gcc 4419
Tyr Leu Gln Tyr Met Arg Asn Gly Glu Leu Pro Ala Glu Gln Ala
1460 1465 1470
att cct gtc tgt ggt tca cca gcc aca att aat get ggt ttt gag 4464
Ile Pro Val Cys Gly Ser Pro Ala Thr Ile Asn Ala Gly Phe Glu
1475 1480 1485
tta ctt gta gca tta get gtt ggc tgt gta agg aac ctc aaa cag 4509
4$ Leu Leu Val Ala Leu Ala Val Gly Cys Val Arg Asn Leu Lys Gln
1490 1495 1500
ata gta gat tct ttg act gaa atg tat tac att ggt aca gca ata 4554
Ile Val Asp Ser Leu Thr Glu Met Tyr Tyr Ile Gly Thr Ala Ile
$0 1505 1510 1515
$$
act act tgt gag gca ctt act gag tgg gaa tac ctg cca cct gtt 4599
Thr Thr Cys Glu Ala Leu Thr Glu Trp Glu Tyr Leu Pro Pro Val
1520 1525 1530
gga ccc cgt cca cca aaa gga ttt gtg ggg ctg aaa aat get ggt 4644
Gly Pro Arg Pro Pro Lys Gly Phe Val Gly Leu Lys Asn Ala Gly
1535 1540 1545
CA 02449417 2003-12-04
94
get act tgt tac atg aat tct gtg att cag caa ctc tat atg att 4689
Ala Thr Cys Tyr Met Asn Ser Val Ile Gln Gln Leu Tyr Met Ile
1550 1555 1560
ccc tct atc agg aac ggt att ctt gca att gaa ggc aca ggt agt 4734
Pro Ser Ile Arg Asn Gly Ile Leu Ala Ile Glu Gly Thr Gly Ser
1565 1570 1575
gat gta gat gat gat atg tct ggg gat gag aag cag gac aat gag 4779
Asp Val Asp Asp Asp Met Ser Gly Asp Glu Lys Gln Asp Asn Glu
1580 1585 1590
agc aat gtt gat ccc agg gat gat gtg ttt gga tat cct caa caa 4824
Ser Asn Val Asp Pro Arg Asp Asp Val Phe Gly Tyr Pro Gln Gln
1595 1600 1605
ttt gaa gac aaa cca cca ctg agt aaa aca gaa gat aga aaa gag 4869
Phe Glu Asp Lys Pro Pro Leu Ser Lys Thr Glu Asp Arg Lys Glu
1610 1615 1620
2$
tac aat att ggt gtt cta aga cac ctt caa gtt atc ttt ggc cat 4914
Tyr Asn Ile Gly Val Leu Arg His Leu Gln Val Ile Phe Gly His
1625 1630 1635
tta get get tct cga cta cag tac tat gtg ccc aga gga ttt tgg 4959
Leu Ala Ala Ser Arg Leu Gln Tyr Tyr Val Pro Arg Gly Phe Trp
1640 1645 1650
30 aaa cag ttc agg ctt tgg ggt gag cct gtt aat ctt cgt gaa caa 5004
Lys Gln Phe Arg Leu Trp Gly Glu Pro Val Asn Leu Arg Glu Gln
1655 1660 1665
cat gat get tta gag ttc ttt aat tca ttg gtg gat agt tta gat 5049
3$ His Asp Ala Leu Glu Phe Phe Asn Ser Leu Val Asp Ser Leu Asp
1670 1675 1680
gaa get tta aaa gcc tta ggg cat cca get atg cta agt aaa gtc 5094
Glu Ala Leu Lys Ala Leu Gly His Pro Ala Met Leu Ser Lys Val
4~ 1685 1690 1695
ttg gga ggt tcc ttc get gat cag aaa att tgt caa ggc tgc cca 5139
Leu Gly Gly Ser Phe Ala Asp Gln Lys Ile Cys Gln Gly Cys Pro
1700 1705 1710
cat agg tat gaa tgt gaa gaa tct ttt acg act ctg aat gta gac 5184
His Arg Tyr Glu Cys Glu Glu Ser Phe Thr Thr Leu Asn Val Asp
1715 1720 1725
SO att aga aac cac caa aat ctt ctt gat tct ttg gaa cag tat gtc 5229
Ile Arg Asn His Gln Asn Leu Leu Asp Ser Leu Glu Gln Tyr Val
1730 1735 1740
aaa gga gat tta cta gaa ggg gca aat get tat cat tgt gaa aaa 5274
$$ Lys Gly Asp Leu Leu Glu Gly Ala Asn Ala Tyr His Cys Glu Lys
1745 1750 1755
tgc aat aaa aag gtt gat act gta aag cgc ttg cta att aaa aag 5319
CA 02449417 2003-12-04
95
Cys Asn Lys Lys Val Asp Thr Val Lys Arg Leu Leu Ile Lys Lys
1760 1765 1770
ttg cct cct gtt ctt get atc caa cta aaa cga ttc gat tat gac 5364
$ Leu Pro Pro Val Leu Ala Ile Gln Leu Lys Arg Phe Asp Tyr Asp
1775 1780 1785
tgg gaa aga gaa tgt gca atc aag ttc aat gat tac ttt gag ttt 5409
Trp Glu Arg Glu Cys Ala Ile Lys Phe Asn Asp Tyr Phe Glu Phe
1~ 1790 1795 1800
cct cga gag tta gac atg gag ccg tac aca gtt gca ggt gtt get 5454
Pro Arg Glu Leu Asp Met Glu Pro Tyr Thr Val Ala Gly Val Ala
1805 1810 1815
1$
aaa cta gag gga gat aat gtc aac cca gaa agt cag ctg ata caa 5499
Lys Leu Glu Gly Asp Asn Val Asn Pro Glu Ser Gln Leu Ile Gln
1820 1825 1830
20 cag aat gag cag tct gaa agc gaa aaa gcc gga agc aca aaa tac 5544
Gln Asn Glu Gln Ser Glu Ser Glu Lys Ala Gly Ser Thr Lys Tyr
1835 1840 1845
aga ctt gtg ggt gtg ctt gta cac agt ggt caa gca agt ggg gga 5589
2$ Arg Leu Val Gly Val Leu Val His Ser Gly Gln Ala Ser Gly Gly
1850 1855 1860
cat tac tat tct tac atc att cag agg aat gga gga gat ggt gaa 5634
His Tyr Tyr Ser Tyr Ile Ile Gln Arg Asn Gly Gly Asp Gly Glu
3~ 1865 1870 1875
3$
aaa aat cgt tgg tat aaa ttt gat gat gga gat gta aca gag tgt 5679
Lys Asn Arg Trp Tyr Lys Phe Asp Asp Gly Asp Val Thr Glu Cys
1880 1885 1890
aaa atg gat gat gat gaa gaa atg aaa aac cag tgt ttt ggt ggc 5724
Lys Met Asp Asp Asp Glu Glu Met Lys Asn Gln Cys Phe Gly Gly
1895 1900 1905
40 gag tac atg gga gaa gtg ttt gat cac atg atg aag cgc atg tcg 5769
Glu Tyr Met Gly Glu Val Phe Asp His Met Met Lys Arg Met Ser
1910 1915 1920
tac agg cgg cag aaa agg tgg tgg aat gca tat ata ctt ttt tat 5814
4$ Tyr Arg Arg Gln Lys Arg Trp Trp Asn Ala Tyr Ile Leu Phe Tyr
1925 1930 1935
gaa aga atg gat acg ata gat cat gat gat gag gtg ata aga tac 5859
Glu Arg Met Asp Thr Ile Asp His Asp Asp Glu Val Ile Arg Tyr
$~ 1940 1945 1950
ata tca gag att get atc acc aca agg ccc cat cag att gtt atg 5904
Ile Ser Glu Ile Ala Ile Thr Thr Arg Pro His Gln Ile Val Met
1955 1960 1965
$$
cca tcg gcc att gaa aga agt gtg cgg aag cag aat gtc caa ttc 5949
Pro Ser Ala Ile Glu Arg Ser Val Arg Lys Gln Asn Val Gln Phe
1970 1975 1980
CA 02449417 2003-12-04
96
atg cat aac cga atg cag tac agt ttg gaa tat ttt cag ttt atg 5994
Met His Asn Arg Met Gln Tyr Ser Leu Glu Tyr Phe Gln Phe Met
1985 1990 1995
aaa aag cta cttacatgt aat ggtgtttat ttaaac cctcca cca 6039
Lys Lys Leu LeuThrCys Asn GlyValTyr LeuAsn ProPro Pro
2000 2005 2010
ggg caa gat cacctgtct cct gaagcagaa gaaatc actatg att 6084
Gly Gln Asp HisLeuSer Pro GluAlaGlu GluIle ThrMet Ile
2015 2020 2025
agt att cag cttgetget agg ttccttttt actaca ggattt cac 6129
1$ Ser Ile Gln LeuAlaAla Arg PheLeuPhe ThrThr GlyPhe His
2030 2035 2040
aca aag aaa atagtccga gga tccgccagt gattgg tatgat gca 6174
Thr Lys Lys IleValArg Gly SerAlaSer AspTrp TyrAsp Ala
2045 2050 2055
ttg tgt att ctcctccgt cac agcaagaat gtgcgg ttttgg ttt 6219
Leu Cys Ile LeuLeuArg His SerLysAsn ValArg PheTrp Phe
2060 2065 2070
get cac aat gtgcttttt aat gtttcaaat cgattc tctgag tac 6264
Ala His Asn ValLeuPhe Asn ValSerAsn ArgPhe SerGlu Tyr
2075 2080 2085
ctt ttg gaa tgccctagt gca gaagtgaga ggtgca tttget aaa 6309
Leu Leu Glu CysProSer Ala GluValArg GlyAla PheAla Lys
2090 2095 2100
ctt ata gtt ttcattgca cac ttttcctta caagat gggcct tgt 6354
Leu Ile Val PheIleAla His PheSerLeu GlnAsp GlyPro Cys
2105 2110 2115
cct tca cct tttgcatct cct ggaccttct agtcag gettat gat 6399
Pro Ser Pro PheAlaSer Pro GlyProSer SerGln AlaTyr Asp
2120 2125 2130
aac tta agt ttgagtgac cac ctactaaga gcagta ctaaat ctc 6444
Asn Leu Ser LeuSerAsp His LeuLeuArg AlaVal LeuAsn Leu
2135 2140 2145
ttg agg agggag gtttcagag catggacgt cattta cagcag tat 6489
Leu Arg ArgGlu ValSerGlu HisGlyArg HisLeu GlnGln Tyr
2150 2155 2160
ttc aac ttgttt gtaatgtat gccaattta ggagtg gcagag aaa 6534
Phe Asn LeuPhe ValMetTyr AlaAsnLeu GlyVal AlaGlu Lys
2165 2170 2175
aca cag ctgctc aaactgagt gtacctget accttt atgctt gtg 6579
5$ Thr Gln LeuLeu LysLeuSer ValProAla ThrPhe MetLeu Val
2180 2185 2190
tcc tta gatgaa ggtcctggt cctccaatt aaatat cagtat get 6624
CA 02449417 2003-12-04
97
Ser Leu Asp Glu Gly Pro Gly Pro Pro Ile Lys Tyr Gln Tyr Ala
2195 2200 2205
gaa tta ggc aaa tta tac tcc gta gtg tca cag tta atc cgc tgt 6669
$ Glu Leu Gly Lys Leu Tyr Ser Val Val Ser Gln Leu Ile Arg Cys
2210 2215 2220
tgc aat gtc tct tca aga atg cag tct tca atc aat ggt aat cct 6714
Cys Asn Val Ser Ser Arg Met Gln Ser Ser Ile Asn Gly Asn Pro
2225 2230 2235
I$
tct ctt cca aat cct ttt ggt gat cct aat tta tca caa cct ata 6759
Ser Leu Pro Asn Pro Phe Gly Asp Pro Asn Leu Ser Gln Pro Ile
2240 2245 2250
atg cca att caa caa aat gtg gta gac att tta ttt gtg aga aca 6804
Met Pro Ile Gln Gln Asn Val Val Asp Ile Leu Phe Val Arg Thr
2255 2260 2265
agt tat gtg aag aaa att att gaa gac tgc agt aac tct gat gag 6849
Ser Tyr Val Lys Lys Ile Ile Glu Asp Cys Ser Asn Ser Asp Glu
2270 2275 2280
acc gtc aaa ttg ctt cgc ttt tgc tgc tgg gag aat cct cag ttc 6894
2$ Thr Val Lys Leu Leu Arg Phe Cys Cys Trp Glu Asn Pro Gln Phe
2285 2290 2295
tca tct act gtc ctg agt gaa ctt ctt tgg cag gtt gcg tat tcc 6939
Ser Ser Thr Val Leu Ser Glu Leu Leu Trp Gln Val Ala Tyr Ser
2300 2305 2310
3$
tat act tac gaa ctc cgg ccc tat ttg gat ctg ctt tta caa atc 6984
Tyr Thr Tyr Glu Leu Arg Pro Tyr Leu Asp Leu Leu Leu Gln Ile
2315 2320 2325
tta ctg att gaa gac tcc tgg cag act cac aga att cat aat gcc 7029
Leu Leu Ile Glu Asp Ser Trp Gln Thr His Arg Ile His Asn Ala
2330 2335 2340
ctt aaa gga att cca gat gac cga gat ggg ctg ttt gac aca att 7074
Leu Lys Gly Ile Pro Asp Asp Arg Asp Gly Leu Phe Asp Thr Ile
2345 2350 2355
cag cgt tct aag aat cac tat caa aaa aga gca tac caa tgt ata 7119
4$ Gln Arg Ser Lys Asn His Tyr Gln Lys Arg Ala Tyr Gln Cys Ile
2360 2365 2370
aaa tgt atg gta gcc ctc ttt agc agt tgt cct gtg get tac caa 7164
Lys Cys Met Val Ala Leu Phe Ser Ser Cys Pro Val Ala Tyr Gln
$0 2375 2380 2385
$$
atc ctg cag ggc aat gga gat ctt aaa agg aaa tgg acc tgg gca 7209
Ile Leu Gln Gly Asn Gly Asp Leu Lys Arg Lys Trp Thr Trp Ala
2390 2395 2400
gta gag tgg ctt gga gat gaa ctc gaa aga aga cca tac act ggc 7254
Val Glu Trp Leu Gly Asp Glu Leu Glu Arg Arg Pro Tyr Thr Gly
2405 2410 2415
CA 02449417 2003-12-04
98
aat cct cag tacacttac aac aactggtct cctcca gtg caaagc 7299
Asn Pro Gln TyrThrTyr Asn AsnTrpSer ProPro Val GlnSer
2420 2425 2430
aat gaa aca tcaaatggc tac ttcttggag agatca cat agcget 7344
Asn Glu Thr SerAsnGly Tyr PheLeuGlu ArgSer His SerAla
2435 2440 2445
agg atg aca cttgcaaaa get tgtgaactc tgtcct gag gaggaa 7389
Arg Met Thr LeuAlaLys Ala CysGluLeu CysPro Glu GluGlu
2450 2455 2460
cca gat gac caagatgcc cca gatgagcat gaatca cct ccacct 7434
1$ Pro Asp Asp GlnAspAla Pro AspGluHis GluSer Pro ProPro
2465 2470 2475
gaa gat gcc ccattatac ccc cattcccct ggatct caa tatcag 7479
Glu Asp Ala ProLeuTyr Pro HisSerPro GlySer Gln TyrGln
2~ 2480 2485 2490
cag aat aac catgtgcat gga cagccctat acaggc cca gccgca 7524
Gln Asn Asn HisValHis Gly GlnProTyr ThrGly Pro AlaAla
2495 2500 2505
2$
cat cac atg aacaaccct cag agaactggc caacga gca caagaa 7569
His His Met AsnAsnPro Gln ArgThrGly GlnArg Ala GlnGlu
2510 2515 2520
30 aat tat gaa ggcagtgaa gaa gtgtcccca cctcag acc aaggat 7614
Asn Tyr Glu GlySerGlu Glu ValSerPro ProGln Thr LysAsp
2525 2530 2535
cag tga 7620
3$ Gln
<210> 48
4~ <211> 2539
<212> PRT
<213> Rattus norvegicus
<400> 48
4$
Met Thr Ala Thr Thr Arg Gly Ser Pro Val Gly Gly Asn Asp Asn Gln
1 5 10 15
$~ Gly Gln Ala Pro Asp Gly Gln Ser Gln Pro Pro Leu Gln Gln Asn Gln
25 30
Thr Ser Ser Pro Asp Ser Ser Asn Glu Asn Ser Pro Ala Thr Pro Pro
$$ 35 40 45
Asp Glu Gln Gly Gln Gly Asp Ala Pro Pro Gln Ile Glu Asp Glu Glu
CA 02449417 2003-12-04
99
50 55 60
Pro AlaPhe ProHisThr AspLeuAla LysLeuAsp AspMetIleAsn
$ 65 70 75 80
Arg ProArg TrpValVal ProValLeu ProLysGly GluLeuGluVal
85 90 95
Leu LeuGlu AlaAlaIle AspLeuSer LysLysGly LeuAspValLys
100 105 110
IS
Ser GluAla CysGlnArg PhePheArg AspGlyLeu ThrIleSerPhe
115 120 125
Thr LysIle LeuThrAsp GluAlaVal SerGlyTrp LysPheGluIle
130 135 140
His ArgCys IleIleAsn AsnThrHis ArgLeuVal GluLeuCysVal
145 150 155 160
Ala LysLeu AlaGlnAsp TrpPhePro LeuLeuGlu LeuLeuAlaMet
165 170 175
Ala LeuAsn ProHisCys LysPheHis IleTyrAsn GlyThrArgPro
180 185 190
Cys GluSer ValSerSer SerValGln LeuProGlu AspGluLeuPhe
195 200 205
Ala ArgSer ProAspPro ArgSerPro LysGlyTrp LeuValAspLeu
210 215 220
Leu Asn Lys Phe Gly Thr Leu Asn Gly Phe Gln Ile Leu His Asp Arg
225 230 235 240
Phe Ile GlySer AlaLeu Val GlnIleIle AlaLeu Ile
Asn Asn Ala
245 250 255
Lys Pro GlyGln CysTyr Phe LeuThrLeu ThrVal Lys
Phe Glu His
260 265 270
Lys Tyr LeuPro IleIle Met ValProGln LeuGlu Asn
Phe Glu Phe
275 280 285
CA 02449417 2003-12-04
100
Leu Thr Asp Glu Glu Leu Lys Lys Glu Ala Lys Asn Glu Ala Lys Asn
290 295 300
Asp Ala Leu Ser Met Ile Ile Lys Ser Leu Lys Ser Leu Ala Ser Arg
305 310 315 320
Val Pro Gly Gln Glu Glu Thr Val Lys Asn Leu Glu Ile Phe Arg Leu
325 330 335
Lys Met Ile Leu Arg Leu Leu Gln Ile Ser Ser Phe Asn Gly Lys Met
1$ 340 345 350
25
Asn Ala Leu Asn Glu Val Asn Lys Val Ile Ser Ser Val Ser Tyr Tyr
355 360 365
Thr His Arg His Gly Ser Ser Glu Glu Glu Glu Trp Leu Thr Ala Glu
370 375 380
Arg Met Ala Glu Trp Ile Gln Gln Asn Asn Ile Leu Ser Ile Val Leu
385 390 395 400
Arg Asp Ser Leu His Gln Pro Gln Tyr Val Glu Lys Leu Glu Lys Ile
405 410 415
Leu Arg Phe Val Ile Lys Glu Lys Ala Leu Thr Leu Gln Asp Leu Asp
420 425 430
45
Asn Ile Trp Ala Ala Gln Ala Gly Lys His Glu Ala Ile Val Lys Asn
435 440 445
Val His Asp Leu Leu Ala Lys Leu Ala Trp Asp Phe Ser Pro Glu Gln
450 455 460
Leu Asp His Leu Phe Asp Cys Phe Lys Ala Ser Trp Thr Asn Ala Ser
465 470 475 480
$0 Lys Lys Gln Arg Glu Lys Leu Leu Glu Leu Ile Arg Arg Leu Ala Glu
485 490 495
Asp Asp Lys Asp Gly Val Met Ala His Lys Val Leu Asn Leu Leu Trp
$$ 500 505 510
Asn Leu Ala His Ser Asp Asp Val Pro Val Asp Ile Met Asp Leu Ala
CA 02449417 2003-12-04
101
515 520 525
Leu Ser Ala His Ile Lys Ile Leu Asp Tyr Ser Cys Ser Gln Asp Arg
530 535 540
Asp Thr Gln Lys Ile Gln Trp Ile Asp Arg Phe Ile Glu Glu Leu Arg
545 550 555 560
Thr Asn Asp Lys Trp Val Ile Pro Ala Leu Lys Gln Ile Arg Glu Ile
565 570 575
Cys Ser Leu Phe Gly Glu Ala Pro Gln Asn Leu Ser Gln Thr Gln Arg
580 585 590
Ser Pro His Val Phe Tyr Arg His Asp Leu Ile Asn Gln Leu Gln His
595 600 605
Asn His Ala Leu Val Thr Leu Val Ala Glu Asn Leu Ala Thr Tyr Met
2$ 610 615 620
Glu Ser Met Arg Leu Tyr Gly Arg Asp Asn Glu Asp Tyr Asp Pro Gln
625 630 635 640
35
Thr Val Arg Val Gly Ser Arg Tyr Ser His Val Gln Glu Val Gln Glu
645 650 655
Arg Leu Asn Phe Leu Arg Phe Leu Leu Lys Asp Gly Gln Leu Trp Leu
660 665 670
Cys Ala Pro Gln Ala Lys Gln Ile Trp Lys Cys Leu Ala Glu Asn Ala
675 680 685
Val Tyr Leu Cys Asp Arg Glu Ala Cys Phe Lys Trp Tyr Ser Lys Leu
690 695 700
Met Gly Asp Glu Pro Asp Leu Asp Pro Asp Ile Asn Lys Asp Phe Phe
705 710 715 720
Glu Ser Asn Val Leu Gln Leu Asp Pro Ser Leu Leu Thr Glu Asn Gly
725 730 735
Met Lys Cys Phe Glu Arg Phe Phe Lys Ala Val Asn Cys Arg Glu Gly
740 745 750
CA 02449417 2003-12-04
102
Lys Leu Val Ala Lys Arg Arg Ala Tyr Met Met Asp Asp Leu Glu Leu
755 760 765
Ile Gly Leu Asp Tyr Leu Trp Arg Val Val Ile Gln Ser Asn Asp Asp
770 775 780
Ile Ala Ser Arg Ala Ile Asp Leu Leu Lys Glu Ile Tyr Thr Asn Leu
785 790 795 800
Gly Pro Arg Leu Gln Val Asn Gln Val Val Ile His Glu Asp Phe Ile
I$ 805 810 815
25
Gln Ser Cys Phe Asp Arg Leu Lys Ala Ser Tyr Asp Thr Leu Cys Val
820 825 830
Leu Asp Gly Asp Lys Asp Ser Ile Asn Cys Ala Arg Gln Glu Ala Val
835 840 845
Arg Met Val Arg Val Leu Thr Val Leu Arg Glu Tyr Ile Asn Glu Cys
850 855 860
Asp Ser Asp Tyr His Glu Glu Arg Thr Ile Leu Pro Met Ser Arg Ala
865 870 875 880
Phe Arg Gly Lys His Leu Ser Phe Ile Val Arg Phe Pro Asn Gln Gly
3$ 885 890 895
Arg Gln Val Asp Asp Leu Glu Val Trp Ser His Thr Asn Asp Thr Ile
900 905 910
45
Gly Ser Val Arg Arg Cys Ile Leu Asn Arg Ile Lys Ala Asn Val Ala
915 920 925
His Thr Lys Ile Glu Leu Phe Val Gly Gly Glu Leu Ile Asp Pro Gly
930 935 940
$0 Asp Asp Arg Lys Leu Ile Gly Gln Leu Asn Leu Lys Asp Lys Ser Leu
945 950 955 960
Ile Thr Ala Lys Leu Thr Gln Ile Ser Ser Asn Met Pro Ser Ser Pro
55 965 970 975
Asp Ser Ser Ser Asp Ser Ser Thr Gly Ser Pro Gly Asn His Gly Asn
CA 02449417 2003-12-04
103
980 985 990
His Tyr Ser Asp Gly Pro Asn Pro Glu Val Glu Ser Cys Leu Pro Gly
995 1000 1005
Val Ile Met Ser Leu His Pro Arg Tyr Ile Ser Phe Leu Trp Gln
1010 1015 1020
15
Val Ala Asp Leu Gly Ser Ser Leu Asn Met Pro Pro Leu Arg Asp
1025 1030 1035
Gly Ala Arg Val Leu Met Lys Leu Met Pro Pro Asp Ser Thr Thr
1040 1045 1050
Ile Glu Lys Leu Arg Ala Ile Cys Leu Asp His Ala Lys Leu Gly
1055 1060 1065
Glu Ser Ser Leu Ser Pro Ser Leu Asp Ser Leu Phe Phe Gly Pro
1070 1075 loso
Ser Ala Ser Gln Val Leu Tyr Leu Thr Glu Val Val Tyr Ala Leu
1085 1090 1095
Leu Met Pro Ala Gly Ala Pro Leu Ala Asp Asp Ser Ser Asp Phe
1100 1105 1110
Gln Phe His Phe Leu Lys Ser Gly Gly Leu Pro Leu Val Leu Ser
1115 1120 1125
Met Leu Thr Arg Asn Asn Phe Leu Pro Asn Ala Asp Met Glu Thr
1130 1135 1140
Arg Arg Gly Ala Tyr Leu Asn Ala Leu Lys Ile Ala Lys Leu Leu
1145 1150 1155
SO
Leu Thr Ala Ile Gly Tyr Gly His Val Arg Ala Val Ala Glu Ala
1160 1165 1170
Cys Gln Pro Gly val Glu Gly Val Asn Pro Met Thr Ser Val Asn
1175 1180 1185
Gln Val Thr His Asp Gln Ala Val Val Leu Gln Ser Ala Leu Gln
1190 1195 1200
CA 02449417 2003-12-04
104
S
Ser Ile Pro Asn Pro Ser Ser Glu Cys Met Leu Arg Asn Val Ser
1205 1210 1215
Val Arg Leu Ala Gln Gln Ile Ser Asp Glu Ala Ser Arg Tyr Met
1220 1225 1230
Pro Asp Ile Cys Val Ile Arg Ala Ile Gln Lys Ile Ile Trp Thr
1235 1240 1245
Ser Gly Cys Gly Gly Leu Gln Leu Val Phe Ser Pro Asn Glu Glu
IS 1250 1255 1260
Val Thr Lys Ile Tyr Glu Lys Thr Asn Ala Gly Asn Glu Pro Asp
1265 1270 1275
25
Leu Glu Asp Glu Gln Val Cys Cys Glu Ala Leu Glu Val Met Thr
1280 1285 1290
Leu Cys Phe Ala Leu Ile Pro Thr Ala Leu Asp Ala Leu Ser Lys
1295 1300 1305
Glu Lys Ala Trp Gln Thr Phe Ile Ile Asp Leu Leu Leu His Cys
1310 1315 1320
His Ser Lys Lys Gly Leu Glu Cys Ile Pro Gln Thr Leu Gln Gly
3$ 1325 1330 1335
Gln Tyr Glu Val Thr Lys His Ala Val Ser Thr Ala Arg Glu Arg
1340 1345 1350
45
Ala Lys His Ser Gly Asp Tyr Phe Thr Leu Leu Arg His Leu Leu
1355 1360 1365
Asn Tyr Ala Tyr Asn Ser Asn Ile Asn Val Pro Asn Ala Glu Val
1370 1375 1380
$0 Leu Leu Asn Asn Glu Ile Asp Trp Leu Lys Arg Ile Arg Asp Asp
1385 1390 1395
Val Lys Arg Thr Gly Glu Thr Gly Val Glu Glu Thr Ile Leu Glu
$S 1400 1405 1410
Gly His Leu Gly Val Thr Lys Glu Leu Leu Ala Phe Gln Thr Pro
CA 02449417 2003-12-04
105
1415 1420 1425
Glu Lys Lys PheHisIle Gly CysGlu LysGlyGly Ala AsnLeu
$ 1430 1435 1440
Ile Lys Glu LeuIleAsp Asp PheIle PheProAla Ser AsnVal
1445 1450 1455
Tyr Leu Gln TyrMetArg Asn GlyGlu LeuProAla Glu GlnAla
1460 1465 1470
Ile Pro Val CysGlySer Pro AlaThr IleAsnAla Gly PheGlu
1475 1480 1485
Leu Leu Val AlaLeuAla Val GlyCys ValArgAsn Leu LysGln
1490 1495 1500
Ile Val Asp SerLeuThr Glu MetTyr TyrIleGly Thr AlaIle
1505 1510 1515
Thr Thr Cys GluAlaLeu Thr GluTrp GluTyrLeu Pro ProVal
1520 1525 1530
Gly Pro Arg ProProLys Gly PheVal GlyLeuLys Asn AlaGly
1535 1540 1545
Ala Thr Cys TyrMetAsn Ser ValIle GlnGlnLeu Tyr MetIle
1550 1555 1560
Pro Ser Ile ArgAsnGly Ile LeuAla IleGluGly Thr GlySer
1565 1570 1575
Asp Val Asp AspAspMet Ser GlyAsp GluLysGln Asp AsnGlu
1580 1585 1590
Ser Asn Val AspProArg Asp AspVal PheGlyTyr Pro GlnGln
1595 1600 1605
Phe Glu Asp LysProPro Leu SerLys ThrGluAsp Arg LysGlu
1610 1615 1620
Tyr Asn Ile GlyValLeu Arg HisLeu GlnValIle Phe GlyHis
1625 1630 1635
CA 02449417 2003-12-04
106
Leu Ala Ala Ser Arg Leu Gln Tyr Tyr Val Pro Arg Gly Phe Trp
1640 1645 1650
Lys Gln Phe Arg Leu Trp Gly Glu Pro Val Asn Leu Arg Glu Gln
1655 1660 1665
His Asp Ala Leu Glu Phe Phe Asn Ser Leu Val Asp Ser Leu Asp
1670 1675 1680
Glu Ala Leu Lys Ala Leu Gly His Pro Ala Met Leu Ser Lys Val
1$ 1685 1690 1695
2$
Leu Gly Gly Ser Phe Ala Asp Gln Lys Ile Cys Gln Gly Cys Pro
1700 1705 1710
His Arg Tyr Glu Cys Glu Glu Ser Phe Thr Thr Leu Asn Val Asp
1715 1720 1725
Ile Arg Asn His Gln Asn Leu Leu Asp Ser Leu Glu Gln Tyr Val
1730 1735 1740
Lys Gly Asp Leu Leu Glu Gly Ala Asn Ala Tyr His Cys Glu Lys
1745 1750 1755
Cys Asn Lys Lys Val Asp Thr Val Lys Arg Leu Leu Ile Lys Lys
3$ 1760 1765 1770
4$
Leu Pro Pro Val Leu Ala Ile Gln Leu Lys Arg Phe Asp Tyr Asp
1775 1780 1785
Trp Glu Arg Glu Cys Ala Ile Lys Phe Asn Asp Tyr Phe Glu Phe
1790 1795 1800
Pro Arg Glu Leu Asp Met Glu Pro Tyr Thr Val Ala Gly Val Ala
1805 1810 1815
$0 Lys Leu Glu Gly Asp Asn Val Asn Pro Glu Ser Gln Leu Ile Gln
1820 1825 1830
Gln Asn Glu Gln Ser Glu Ser Glu Lys Ala Gly Ser Thr Lys Tyr
$$ 1835 1840 1845
Arg Leu Val Gly Val Leu Val His Ser Gly Gln Ala Ser Gly Gly
CA 02449417 2003-12-04
107
1850 1855 1860
His Tyr Tyr SerTyrIle Ile GlnArg AsnGlyGly Asp GlyGlu
$ 1865 1870 1875
Lys Asn Arg TrpTyrLys Phe AspAsp GlyAspVal Thr GluCys
1880 1885 1890
Lys Met Asp AspAspGlu Glu MetLys AsnGlnCys Phe GlyGly
1895 1900 1905
Glu Tyr Met GlyGluVal Phe AspHis MetMetLys Arg MetSer
1910 1915 1920
Tyr Arg Arg GlnLysArg Trp TrpAsn AlaTyrIle Leu PheTyr
1925 1930 1935
Glu Arg Met AspThrIle Asp HisAsp AspGluVal Ile ArgTyr
1940 1945 1950
Ile Ser Glu IleAlaIle Thr ThrArg ProHisGln Ile ValMet
1955 1960 1965
Pro Ser Ala IleGluArg Ser ValArg LysGlnAsn Val GlnPhe
1970 1975 1980
Met His Asn ArgMetGln Tyr SerLeu GluTyrPhe Gln PheMet
1985 1990 1995
Lys Lys Leu LeuThrCys Asn GlyVal TyrLeuAsn Pro ProPro
2000 2005 2010
Gly Gln Asp HisLeuSer Pro GluAla GluGluIle Thr MetIle
2015 2020 2025
Ser Ile Gln LeuAlaAla Arg PheLeu PheThrThr Gly PheHis
2030 2035 2040
Thr Lys Lys IleValArg Gly SerAla SerAspTrp Tyr AspAla
2045 2050 2055
SS
Leu Cys Ile LeuLeuArg His SerLys AsnValArg Phe TrpPhe
2060 2065 2070
CA 02449417 2003-12-04
108
Ala His Asn Val Leu Phe Asn Val Ser Asn Arg Phe Ser Glu Tyr
2075 2080 2085
Leu Leu Glu Cys Pro Ser Ala Glu Val Arg Gly Ala Phe Ala Lys
2090 2095 2100
Leu Ile Val Phe Ile Ala His Phe Ser Leu Gln Asp Gly Pro Cys
2105 2110 2115
Pro Ser Pro Phe Ala Ser Pro Gly Pro Ser Ser Gln Ala Tyr Asp
2120 2125 2130
25
Asn Leu Ser Leu Ser Asp His Leu Leu Arg Ala Val Leu Asn Leu
2135 2140 2145
Leu Arg Arg Glu Val Ser Glu His Gly Arg His Leu Gln Gln Tyr
2150 2155 2160
Phe Asn Leu Phe Val Met Tyr Ala Asn Leu Gly Val Ala Glu Lys
2165 2170 2175
Thr Gln Leu Leu Lys Leu Ser Val Pro Ala Thr Phe Met Leu Val
2180 2185 2190
Ser Leu Asp Glu Gly Pro Gly Pro Pro Ile Lys Tyr Gln Tyr Ala
3$ 2195 2200 2205
45
Glu Leu Gly Lys Leu Tyr Ser Val Val Ser Gln Leu Ile Arg Cys
2210 2215 2220
Cys Asn Val Ser Ser Arg Met Gln Ser Ser Ile Asn Gly Asn Pro
2225 2230 2235
Ser Leu Pro Asn Pro Phe Gly Asp Pro Asn Leu Ser Gln Pro Ile
2240 2245 2250
$0 Met Pro Ile Gln Gln Asn Val Val Asp Ile Leu Phe Val Arg Thr
2255 2260 2265
Ser Tyr Val Lys Lys Ile Ile Glu Asp Cys Ser Asn Ser Asp Glu
55 2270 2275 2280
Thr Val Lys Leu Leu Arg Phe Cys Cys Trp Glu Asn Pro Gln Phe
CA 02449417 2003-12-04
109
2285 2290 2295
Ser Ser Thr Val Leu Ser Glu Leu Leu Trp Gln Val Ala Tyr Ser
$ 2300 2305 2310
Tyr Thr Tyr Glu Leu Arg Pro Tyr Leu Asp Leu Leu Leu Gln Ile
2315 2320 2325
Leu Leu Ile Glu Asp Ser Trp Gln Thr His Arg Ile His Asn Ala
2330 2335 2340
1$
Leu Lys Gly Ile Pro Asp Asp Arg Asp Gly Leu Phe Asp Thr Ile
2345 2350 2355
Gln Arg Ser Lys Asn His Tyr Gln Lys Arg Ala Tyr Gln Cys Ile
2360 2365 2370
Lys Cys Met Val Ala Leu Phe Ser Ser Cys Pro Val Ala Tyr Gln
2$ 2375 2380 2385
3$
Ile Leu Gln Gly Asn Gly Asp Leu Lys Arg Lys Trp Thr Trp Ala
2390 2395 2400
Val Glu Trp Leu Gly Asp Glu Leu Glu Arg Arg Pro Tyr Thr Gly
2405 2410 2415
Asn Pro Gln Tyr Thr Tyr Asn Asn Trp Ser Pro Pro Val Gln Ser
2420 2425 2430
Asn Glu Thr Ser Asn Gly Tyr Phe Leu Glu Arg Ser His Ser Ala
2435 2440 2445
Arg Met Thr Leu Ala Lys Ala Cys Glu Leu Cys Pro Glu Glu Glu
4$ 2450 2455 2460
$0
Pro Asp Asp Gln Asp Ala Pro Asp Glu His Glu Ser Pro Pro Pro
2465 2470 2475
Glu Asp Ala Pro Leu Tyr Pro His Ser Pro Gly Ser Gln Tyr Gln
2480 2485 2490
$$
Gln Asn Asn His Val His Gly Gln Pro Tyr Thr Gly Pro Ala Ala
2495 2500 2505
CA 02449417 2003-12-04
110
$
His His Met Asn Asn Pro Gln Arg Thr Gly Gln Arg Ala Gln Glu
2510 2515 2520
Asn Tyr Glu Gly Ser Glu Glu Val Ser Pro Pro Gln Thr Lys Asp
2525 2530 2535
Gln
<210> 49
1$ <211> 2655
<212> DNA
<213> Mus musculus
<220>
<221>
CDS
<222> (165)..(716)
<400>
49
2$ gcggctgagc tgttgccacc tcggccga gg gccggcgag
60
ggaccccacg a
ggaccgcggg
ccgcgggccc tgcgagctgg tgacagacgg gccaagga gg
gagagaggc 120
cccggacccg g
ggcggcggcg caggcgacgg gcagcggcga cacc tcatccccc
176
ggaggcagcg atg
Met SerSer
Pro
1
agt cccggc aagagg cggatggac acggacgta gtcaag ctcattgaa 224
Ser ProGly LysArg ArgMetAsp ThrAspVal ValLys LeuIleGlu
3$ 5 10 15 20
agc aaacat gaggtt acaatccta ggaggactc aatgaa ttcgttgtc 272
Ser LysHis GluVal ThrIleLeu GlyGlyLeu AsnGlu PheValVal
25 30 35
aag ttttac ggacca caaggaaca ccatatgaa ggcggg gtgtggaaa 320
Lys PheTyr GlyPro GlnGlyThr ProTyrGlu GlyGly ValTrpLys
40 45 50
4$ gtg agagtg gacctt cctgataaa taccctttc aagtct ccatctata 368
Val ArgVal AspLeu ProAspLys TyrProPhe LysSer ProSerIle
55 60 65
gga ttcatg aataaa attttccat cccaacatt gatgaa gcgtcagga 416
$0 Gly PheMet AsnLys IlePheHis ProAsnIle AspGlu AlaSerGly
70 75 80
act gtgtgt ctagat gtaattaat caaacttgg acaget ctctatgat 464
Thr ValCys LeuAsp ValIleAsn GlnThrTrp ThrAla LeuTyrAsp
$$ 85 90 95 100
ctt accaat atattt gagtccttc ctgccccag ttgctg gcctatcct 512
Leu ThrAsn IlePhe GluSerPhe LeuProGln LeuLeu AlaTyrPro
CA 02449417 2003-12-04
111
105 110 115
aac ccc ata gat cct ctc aat ggt gac get gca gcc atg tac ctc cac 560
Asn Pro Ile Asp Pro Leu Asn Gly Asp Ala Ala Ala Met Tyr Leu His
$ 120 125 130
cga cca gaa gag tac aag cag aaa att aaa gag tac atc cag aag tac 608
Arg Pro Glu Glu Tyr Lys Gln Lys Ile Lys Glu Tyr Ile Gln Lys Tyr
135 140 145
gca acg gaa gag gcc ctg aag gaa cag gaa gag ggc act ggc gac agc 656
Ala Thr Glu Glu Ala Leu Lys Glu Gln Glu Glu Gly Thr Gly Asp Ser
150 155 160
tca tcg gag agt tct atg tct gac ttc tca gaa gat gag gcc cag gac 704
Ser Ser Glu Ser Ser Met Ser Asp Phe Ser Glu Asp Glu Ala Gln Asp
165 170 175 180
atg gag ttg tag tagaaaaggc atctgctttt cagaaagact attatttcct 756
Met Glu Leu
aaccatgaga agcagactct aatattcata tttaaacaaa gcaatttttt ttattactaa 816
acaaggtttttatgaataatagcattgatatatatatattatatatcaccctttagatct876
tgatttcttggtcatttctcaacctgaggtgcatagcatattcccacattccattttggt936
agcaatatgcagtccgaatgcatgcattcacaagtccatttggccaagtcagcctgtgtg996
ctactgaactgtcaagagattgccactctcagaggtaaacatgaggaaaacaggaaaagt1056
ttgcttctttttattgatggttccaaagaaacaaaccaaatctaccagctcttggatgaa1116
gatagaacagtgcttttccagagtgggaaggaaggggttgagacgcgtgctttgagagcc1176
tgtgaggctgctccgtccttgccagctgctccctagtcctgagtggtccttggtgaggag1236
cagcaagatgcagcgagttgagtgagacttagggcttttgattttttttttttttttttt1296
ttgactcggatttaagtgcatttttctaggtagactcctgccctccttgctaccagacct1356
gcagccaccttggttttgccttggagaacatttggggagcatttcctgaacccatgtctt1416
4$ ttgggggtacagcttgtcatccagcaggaattattgagcgagcaggactggaggagacgg1476
gaatgaagacacaagagtgacatctgatcctagcacggggcctgttgatccattgcctgg1536
actgagctgtgaaactggacgcggttttggttttttgttttgtgtttcttttttcttaat1596
ttgtgtgaattgtacctagacaggttacagatttaattttcacctacaagggacagtctc1656
ctccctggacaaggctcagtggaccatcagatggaggaagactggccccattgcttgagc1716
ccctgtgcgacccttgacctccagccttagttctcctggaagctgccaactgcttacggg1776
agtgggtagattgggcgtctgagacccagaacatcctaaatttgcaatgggtaacagctg1836
CA 02449417 2003-12-04
112
aaacaaacggaagtttttgtaccaaagtggccggaggtggggaagaactactttcgagaa1896
ttgttacggaggcaggttgaggggacactttgaccctccaaggtaacagccagtcagatg1956
$ gcttgaggtgcctggcccatgctgccggctaaatgccatccagtgtgcccagcagtttca2016
gacctgactctggaggaatttggagacagtgtagacagcagctctgctctgtattctttt2076
tgacaaaaccagaacagtagaagtagccaatcgtaagacctgaagacattttgaatgtcc2136
cactggactaacctttcttttgatgtgtgtttttagtttagaagtgctatattccacaag2196
ggttaagtcaatgaggttggaagacacctatctttttttttaattcaaaaagcacaatca2256
1$ gtctttcctttgaaaatccatataaagtacaacttttagcgtgattattttcctaaatac2316
aaagacaaataatttacttattttatgttaattacgggcatgaagcaaaaggtttctttg2376
gggaacatgcagttttgtagtgctgggttggttcatgtcctctggcaccctggcttgttg2436
aaaggtggctttagctgtgtgctgtgtacctgcttacgtggcctgctgtcctctgtgtga2496
ttaggagggtttctgctggccctgcagcttgcttccctgcggattaggcctttgctcatg2556
2$ ctatagccttcatgtgggtgctacctagagcaggcgtgaactgctgggtggtgattgtga2616
gttcagacaataaaaaaaatgtatttttttcaatactgt 2655
<210> 50
<211> 183
<212> PRT
<213> Mus musculus
3$ <400> 50
Met Ser Ser Pro Ser Pro Gly Lys Arg Arg Met Asp Thr Asp Val Val
1 5 10 15
Lys Leu Ile Glu Ser Lys His Glu Val Thr Ile Leu Gly Gly Leu Asn
20 25 30
4$ Glu Phe Val Val Lys Phe Tyr Gly Pro Gln Gly Thr Pro Tyr Glu Gly
35 40 45
Gly Val Trp Lys Val Arg Val Asp Leu Pro Asp Lys Tyr Pro Phe Lys
$0 50 55 60
$$
Ser Pro Ser Ile Gly Phe Met Asn Lys Ile Phe His Pro Asn Ile Asp
65 70 75 80
Glu Ala Ser Gly Thr Val Cys Leu Asp Val Ile Asn Gln Thr Trp Thr
85 90 95
CA 02449417 2003-12-04
113
Ala Leu Tyr Asp Leu Thr Asn Ile Phe Glu Ser Phe Leu Pro Gln Leu
100 105 110
Leu Ala Tyr Pro Asn Pro Ile Asp Pro Leu Asn Gly Asp Ala Ala Ala
115 120 125
Met Tyr Leu His Arg Pro Glu Glu Tyr Lys Gln Lys Ile Lys Glu Tyr
130 135 140
1$ Ile Gln Lys Tyr Ala Thr Glu Glu Ala Leu Lys Glu Gln Glu Glu Gly
145 150 155 160
Thr Gly Asp Ser Ser Ser Glu Ser Ser Met Ser Asp Phe Ser Glu Asp
165 170 175
Glu Ala Gln Asp Met Glu Leu
180
2$
<210> 51
<211> 2037
<212> DNA
<213> Mus
musculus
<220>
<221> CDS
3$ <222> (54)..(551)
<400> 51
gcgggcggga caggttccgc ggtatg 56
ccggcgcgga
tgtggcgagg
ctgctgaacg
Met
1
gcg acg gcgttg aagaggctg atggetgag tataagcaattaacc 104
ggg
Ala Thr AlaLeu LysArgLeu MetAlaGlu TyrLysGlnLeuThr
Gly
5 10 15
4$
ctg cct ccagaa ggaatcgtg gcaggcccc atgaatgaagagaat 152
aat
Leu Pro ProGlu GlyIleVal AlaGlyPro MetAsnGluGluAsn
Asn
20 25 30
$0 ttt gaa tgggag gcattgatc atgggccct gaagacacttgtttt 200
ttt
Phe Glu TrpGlu AlaLeuIle MetGlyPro GluAspThrCysPhe
Phe
35 40 45
gag ggt gttttt cccgccatc ctgagtttc ccacttgactacccc 248
ttt
$$ Glu Gly ValPhe ProAlaIle LeuSerPhe ProLeuAspTyrPro
Phe
55 60 65
ttg cct ccgaag atgagattc acctgtgag atgttccatcccaat 296
agc
CA 02449417 2003-12-04
114
Leu Ser Pro Pro Lys Met Arg Phe Thr Cys Glu Met Phe His Pro Asn
70 75 80
atc tat cct gat ggc aga gtc tgc atc tcc atc ctg cat get cca ggt 344
Ile Tyr Pro Asp Gly Arg Val Cys Ile Ser Ile Leu His Ala Pro Gly
85 90 95
gat gat ccc atg ggt tat gag agc agt gcc gag cgg tgg agc cca gtg 392
Asp Asp Pro Met Gly Tyr Glu Ser Ser Ala Glu Arg Trp Ser Pro Val
100 105 110
cag agt gtg gag aag atc ctg ctt tct gtc gtg agc atg ctg gca gag 440
Gln Ser Val Glu Lys Ile Leu Leu Ser Val Val Ser Met Leu Ala Glu
115 120 125
1$
ccc aac gat gag agt gga gca aac gta gat get tcc aag atg tgg cgg 488
Pro Asn Asp Glu Ser Gly Ala Asn Val Asp Ala Ser Lys Met Trp Arg
130 135 140 145
gat gac gag cag cag att cag aag 536
cgg ttc gtc
tac
aag
atc
gcc
aag
Asp Asp Glu Gln Ile Ala Gln Ile Gln Lys
Arg Phe Lys Val
Tyr
Lys
150 155 160
tct ctg ctc tga 591
ggg ggctccccct
gtgcacactg
agcactctgc
tcgagaacct
2$ Ser Leu Leu
Gly
165
gtggcgacag cgctgccatgccaacaccaacacaggcagtgcagagccacagcccccgtt651
gtttcttcct ttccacccaagccaggcagcttcctagatcatgactgggataatgacagc711
tgctgcgctg ctaaagactcctcctgctgtgttgtgtgcgcacctcagggagggcccagg771
ctgtcctcac tacctctctcagccatggggtcctcacctctgctccttcctgcagtgccg831
agggcctgtc ctgttgtctgccagggactggatactaatgctgctccctcttgggacatg891
gggccttgga aaagcagtgcaggcctgttgtccctgcctctcagttcccaggtgtcccag951
gaagcattct gagcttcttttgacactttgcacttagaagcctaggttgcctttggcatg1011
gtgacagaag cttgctatatgagtcacagatgtcaccatagccccttccaggggatgctt1071
tgtaaatggg ttcatgagaagaggggacatgggtcagcaagactgctgctttttctggtt1131
gcatccatgt ctgagttagtggtgcacactcgaccgacaggcgggactgtcagagcttta1191
gtgtgggtct cctgggggccctgcatacacactgcaccagggttagctcttggattagat1251
tgttgttcgc tgtcagggttggagggaatctgccactgggtgctcagcagaggagctcct1311
tctgaactgg atgggctggggagctgctatggtgcaggccagggtggagggggtctgaca1371
gcaggacctg ctgagccacagggcccgagccgaccccacaagcaataacagatgtggagt1431
gcggtggatg cttggccttttctaaacaggttacatttaaacacgagtttctatttttaa1491
gatacagctt atcagggggtgtgtggccgatctcactgcgcattgtctgcttctgtccca1551
CA 02449417 2003-12-04
115
tgcccacatg tcagtggccagcactgtgcatgtttcatggtgttcatagttcccagccct1611
ggggctccag ggggcacctgtgggcaccttgtgctttccttctcgggggagcccagtctg1671
tttgaaatgc aacagagtctggtgttgggaggtgcaggaagggggttgtaccaaaatagt1731
attgcaggcc actgagatgaaggcctctctgtaaggaagtggtctgtgtggggtgatgtc1791
cacacacagagtggtcacagggcatgtcgctgtcctcaggcctccctggcaagtgcggga1851
ggaagagagg cagtctctttgcaaaacaaagtatttttattcatttgtatttattaaatg1911
aaaaaaaatt ctctgttgtccctcttctgagatggactttaattgctgttaaataaaatt1971
gtgtacctgt caaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa2031
aaaaaa 2037
<210> 52
<211> 165
<212> PRT
<213> Mus musculus
<400> 52
Met Ala Gly Thr Ala Leu Lys Arg Leu Met Ala Glu Tyr Lys Gln Leu
1 5 10 15
35
Thr Leu Asn Pro Pro Glu Gly Ile Val Ala Gly Pro Met Asn Glu Glu
20 25 30
Asn Phe Phe Glu Trp Glu Ala Leu Ile Met Gly Pro Glu Asp Thr Cys
40 45
Phe Glu Phe Gly Val Phe Pro Ala Ile Leu Ser Phe Pro Leu Asp Tyr
55 60
Pro Leu Ser Pro Pro Lys Met Arg Phe Thr Cys Glu Met Phe His Pro
45 65 70 75 80
55
Asn Ile Tyr Pro Asp Gly Arg Val Cys Ile Ser Ile Leu His Ala Pro
85 90 95
Gly Asp Asp Pro Met Gly Tyr Glu Ser Ser Ala Glu Arg Trp Ser Pro
100 105 110
Val Gln Ser Val Glu Lys Ile Leu Leu Ser Val Val Ser Met Leu Ala
115 120 125
CA 02449417 2003-12-04
116
Glu Pro Asn Asp Glu Ser Gly Ala Asn Val Asp Ala Ser Lys Met Trp
130 135 140
Arg Asp Asp Arg Glu Gln Phe Tyr Lys Ile Ala Lys Gln Ile Val Gln
145 150 155 160
Lys Ser Leu Gly Leu
165
<210> 53
1$ <211> 4754
<212> DNA
<213> Mus musculus
<220>
<221> CDS
<222> (114)..(3266)
<400> 53
2$ cccacgc gtc atcttcatgc tttccctttg 60
cgatagctgc
atggtgaggg
acagcaacat
ctttgag gca tgagaccctg aaggataaga acaatg 116
gtgcagagaa
aaaggctata
Met
1
tta tgttgg gggtat tggtctctg ggccaacca ggcatcagctccaac 164
Leu CysTrp GlyTyr TrpSerLeu GlyGlnPro GlyIleSerSerAsn
5 10 15
3$ ctg caagga atcgtg getgagccc caggtgtgc cgctttgtatcggac 212
Leu GlnGly IleVal AlaGluPro GlnValCys ArgPheValSerAsp
20 25 30
aga agcatc aaggaa gtggcgtgc ggaggaaac cactccgtgttcctg 260
Arg SerIle LysGlu ValAlaCys GlyGlyAsn HisSerValPheLeu
35 40 45
ctg gaggac ggggag gtttacacg tgtggagta aacaccaaggggcag 308
Leu GluAsp GlyGlu ValTyrThr CysGlyVal AsnThrLysGlyGln
4$ 50 55 60 65
ctt ggccat gagagg gaaggtaac aagccagaa caaattggagcatta 356
Leu GlyHis GluArg GluGlyAsn LysProGlu GlnIleGlyAlaLeu
70 75 80
$0
get gatcag catatc atacacgtg gcatgtggc gagtcacacagtctg 404
Ala AspGln HisIle IleHisVal AlaCysGly GluSerHisSerLeu
85 90 95
$$ get ctcagt gaccgg ggtcagctg ttttcttgg ggtgcaggaagtgat 452
Ala LeuSer AspArg GlyGlnLeu PheSerTrp GlyAlaGlySerAsp
100 105 110
CA 02449417 2003-12-04
117
ggc caa ctg ggc ctc atg act act gag gat tcc gtg get gtg ccc agg 500
Gly Gln Leu Gly Leu Met Thr Thr Glu Asp Ser Val Ala Val Pro Arg
115 120 125
$ cta atc cag aaa ctg aac cag cag acc ata tta caa gtt tcc tgt ggc 548
Leu Ile Gln Lys Leu Asn Gln Gln Thr Ile Leu Gln Val Ser Cys Gly
130 135 140 145
aac tgg cac tgc ttg get ctg gca get gat ggc cag ttc ttc aca tgg 596
Asn Trp His Cys Leu Ala Leu Ala Ala Asp Gly Gln Phe Phe Thr Trp
150 155 160
ggg aag aac agc cat gga cag ctg gga ctg ggg aag gag ttc ccc tcc 644
Gly Lys Asn Ser His Gly Gln Leu Gly Leu Gly Lys Glu Phe Pro Ser
1$ 165 170 175
caa acc agc cca cag agg gtg aga tct ttg gaa ggg atc ccg ctg get 692
Gln Thr Ser Pro Gln Arg Val Arg Ser Leu Glu Gly Ile Pro Leu Ala
180 185 190
cag gtg get gca gga ggg get cat agc ttt gcc ctg tct ctc tcg gga 740
Gln Val Ala Ala Gly Gly Ala His Ser Phe Ala Leu Ser Leu Ser Gly
195 200 205
2$ get gtt ttt ggc tgg gga atg aat aat gca ggg cag cta ggg ctc agt 788
Ala Val Phe Gly Trp Gly Met Asn Asn Ala Gly Gln Leu Gly Leu Ser
210 215 220 225
gat gaa aaa gac cgg gag tct cca tgc cac gtg aag ctt tta cgc aca 836
Asp Glu Lys Asp Arg Glu Ser Pro Cys His Val Lys Leu Leu Arg Thr
230 235 240
cag aaa gtc gtc tat att agt tgt gga gag gag cac aca gca gtt ctc 884
Gln Lys Val Val Tyr Ile Ser Cys Gly Glu Glu His Thr Ala Val Leu
3$ 245 250 255
aca aag agt ggg ggc gtg ttt acc ttt ggt get ggc tcc tgt ggg cag 932
Thr Lys Ser Gly Gly Val Phe Thr Phe Gly Ala Gly Ser Cys Gly Gln
260 265 270
ctt gga cat gac tcg gtg aat gat gaa gtt aat ccg aga aga gtc ctg 980
Leu Gly His Asp Ser Val Asn Asp Glu Val Asn Pro Arg Arg Val Leu
275 280 285
4$ gag ctg atg ggc agt gaa gta act cag att get tgt ggc aga cag cac 1028
Glu Leu Met Gly Ser Glu Val Thr Gln Ile Ala Cys Gly Arg Gln His
290 295 300 305
act cta gcc ctt gtg cct tct tct gga ctc atc tat gca ttt ggt tgt 1076
$0 Thr Leu Ala Leu Val Pro Ser Ser Gly Leu Ile Tyr Ala Phe Gly Cys
310 315 320
gga get aaa ggt cag ctg gga acc gga cat aca tgt aat gtc aag tgc 1124
Gly Ala Lys Gly Gln Leu Gly Thr Gly His Thr Cys Asn Val Lys Cys
$$ 325 330 335
cca tct cct gtg aag ggc cac tgg get gcc cac agc agt cag ctt tca 1172
Pro Ser Pro Val Lys Gly His Trp Ala Ala His Ser Ser Gln Leu Ser
CA 02449417 2003-12-04
118
340 345 350
get cgc gcc gat cgc ttt aag tat cgt gtc gtt aag cag atc ttc tct 1220
Ala Arg Ala Asp Arg Phe Lys Tyr Arg Val Val Lys Gln Ile Phe Ser
$ 355 360 365
gga ggg gac cag act ttt gta ctt tgc tcc acg tat gag aat tct tct 1268
Gly Gly Asp Gln Thr Phe Val Leu Cys Ser Thr Tyr Glu Asn Ser Ser
370 375 380 385
cct get gtt gac ttc aga act gtg aac caa aca cat tat acc aac tta 1316
Pro Ala Val Asp Phe Arg Thr Val Asn Gln Thr His Tyr Thr Asn Leu
390 395 400
1$ ata aat gat gaa acc ata gca gtt tgg aga caa aaa ctc aca gaa cac 1364
Ile Asn Asp Glu Thr Ile Ala Val Trp Arg Gln Lys Leu Thr Glu His
405 410 415
aac aac gca aat act gtc aat ggt gtt gtt cag ata ctg tct tct gca 1412
Asn Asn Ala Asn Thr Val Asn Gly Val Val Gln Ile Leu Ser Ser Ala
420 425 430
get tgt tgg aat gga agc ttt ctg aaa aaa aaa att gat gaa cat ttt 1460
Ala Cys Trp Asn Gly Ser Phe Leu Lys Lys Lys Ile Asp Glu His Phe
2$ 435 440 445
aaa act agt ccc aaa atc ccc ggg att gac ctg aac tca act agg att 1508
Lys Thr Ser Pro Lys Ile Pro Gly Ile Asp Leu Asn Ser Thr Arg Ile
450 455 460 465
tta ttt gag aag tta atg cac tct cag cac tcc atg att cta gaa cag 1556
Leu Phe Glu Lys Leu Met His Ser Gln His Ser Met Ile Leu Glu Gln
470 475 480
ata tta aac agc ttt gaa agt tgc ctc att ccc cag tta tca agt tca 1604
Ile Leu Asn Ser Phe Glu Ser Cys Leu Ile Pro Gln Leu Ser Ser Ser
485 490 495
ccc cca gat gtg gaa gca atg aga atc tat tta atc cta ccg gag ttt 1652
Pro Pro Asp Val Glu Ala Met Arg Ile Tyr Leu Ile Leu Pro Glu Phe
500 505 510
ccg ctg ctt cag gac tct aag tat tac ata acg ctg acc att ccc ctg 1700
Pro Leu Leu Gln Asp Ser Lys Tyr Tyr Ile Thr Leu Thr Ile Pro Leu
4$ 515 520 525
gca atg gcc att ctg cgg ctg gaa aca aac cct agc aaa gta tta gat 1748
Ala Met Ala Ile Leu Arg Leu Glu Thr Asn Pro Ser Lys Val Leu Asp
530 535 540 545
aac tgg tgg tct cag gca tgc ccc aaa tat ttc atg aag ctg gta acc 1796
Asn Trp Trp Ser Gln Ala Cys Pro Lys Tyr Phe Met Lys Leu Val Thr
550 555 560
SS ctg tat aaa ggt gcc gtc ctt tac ctc cta agg gga agg aag aca ttc 1844
Leu Tyr Lys Gly Ala Val Leu Tyr Leu Leu Arg Gly Arg Lys Thr Phe
565 570 575
CA 02449417 2003-12-04
119
cta atc ccg gta ctg ttt aac aac tac atg act gca acc ctc aag ctt 1892
Leu Ile Pro Val Leu Phe Asn Asn Tyr Met Thr Ala Thr Leu Lys Leu
580 585 590
ctg gag aag ttg tac aag gta aat ctt aag gtg aag cat gtg gaa tac 1940
Leu Glu Lys Leu Tyr Lys Val Asn Leu Lys Val Lys His Val Glu Tyr
595 600 605
gat aag ttt tat atc cct gag att tct agt ctt gtg gac att cag gaa 1988
1~ Asp Lys Phe Tyr Ile Pro Glu Ile Ser Ser Leu Val Asp Ile Gln Glu
610 615 620 625
gac tac ctc atg tgg ttt ttg cat caa tct ggg atg aag get aga ccc 2036
Asp Tyr Leu Met Trp Phe Leu His Gln Ser Gly Met Lys Ala Arg Pro
1$ 630 635 640
tct atc atg cag gat get gta acc ctt tgt tcc tat cct ttc atc ttt 2084
Ser Ile Met Gln Asp Ala Val Thr Leu Cys Ser Tyr Pro Phe Ile Phe
645 650 655
gat gcc caa get aag acc aag atg ctg cag act gat gcc gag tta cag 2132
Asp Ala Gln Ala Lys Thr Lys Met Leu Gln Thr Asp Ala Glu Leu Gln
660 665 670
atg cag gtg gca gtc aat gga gcc aac ctg cag aat gtc ttc atg ctt 2180
Met Gln Val Ala Val Asn Gly Ala Asn Leu Gln Asn Val Phe Met Leu
675 680 685
ctt acc ctg gag cct ctg ctg gcc aga agc ccc ttc ctg gtc ctc cat 2228
Leu Thr Leu Glu Pro Leu Leu Ala Arg Ser Pro Phe Leu Val Leu His
690 695 700 705
gtc cgt agg aac cac ctt gtt gga gat gcc ctg aga gag ctg agc att 2276
Val Arg Arg Asn His Leu Val Gly Asp Ala Leu Arg Glu Leu Ser Ile
710 715 720
cac tct gac att gac ttg aag aag cct ctc aaa gta atc ttt gat ggg 2324
His Ser Asp Ile Asp Leu Lys Lys Pro Leu Lys Val Ile Phe Asp Gly
725 730 735
gaa gaa gga gta gat get ggt ggt gtt acg aag gag ttc ttt ctt ttg 2372
Glu Glu Gly Val Asp Ala Gly Gly Val Thr Lys Glu Phe Phe Leu Leu
740 745 750
4$ cta tta aaa gaa ctt ttg aat ccc att tat ggg atg ttt acc tac tat 2420
Leu Leu Lys Glu Leu Leu Asn Pro Ile Tyr Gly Met Phe Thr Tyr Tyr
755 760 765
caa gat tca aat ctc ttg tgg ttt tca gat aca tgt ttt gta gag cac 2468
S0 Gln Asp Ser Asn Leu Leu Trp Phe Ser Asp Thr Cys Phe Val Glu His
770 775 780 785
aac tgg ttt cac ttg att ggc ata acc tgt gga tta get atc tac aac 2516
Asn Trp Phe His Leu Ile Gly Ile Thr Cys Gly Leu Ala Ile Tyr Asn
55 790 795 800
tcc act gtg gtt gac ctc cac ttc ccg ttg get ctc tac aag aag tta 2564
Ser Thr Val Val Asp Leu His Phe Pro Leu Ala Leu Tyr Lys Lys Leu
CA 02449417 2003-12-04
120
805 810 815
ctg aat gta aag ccc agc ttg gaa gat ttg aag gaa ctg tca cca act 2612
Leu Asn Val Lys Pro Ser Leu Glu Asp Leu Lys Glu Leu Ser Pro Thr
820 825 830
gaa gga agg agt ctt caa gag ctt cta gat tac ccc ggt gaa gac atc 2660
Glu Gly Arg Ser Leu Gln Glu Leu Leu Asp Tyr Pro Gly Glu Asp Ile
835 840 845
gag gag accttttgc ctcaacttc acggtgtgccga gaaagctat ggg 2708
Glu Glu ThrPheCys LeuAsnPhe ThrValCysArg GluSerTyr Gly
850 855 860 865
gtg ata gaacagaag aagttgata cccgggggagac agagtggcc gtg 2756
Val Ile GluGlnLys LysLeuIle ProGlyGlyAsp ArgValAla Val
870 875 880
tgc aaa gacaacagg caagaattc gtggacgettat gtgaattac atc 2804
Cys Lys AspAsnArg GlnGluPhe ValAspAlaTyr ValAsnTyr Ile
885 890 895
ttc caa atttcggtt cacgagtgg tacacagccttc tccagtggc ttc 2852
Phe Gln IleSerVal HisGluTrp TyrThrAlaPhe SerSerGly Phe
900 905 910
cta aag gtg tgt ggt ggc aaa gtc ctc gag ctc ttc cag cct gca gaa 2900
Leu Lys Val Cys Gly Gly Lys Val Leu Glu Leu Phe Gln Pro Ala Glu
915 920 925
ctg agg gccatgatg gtgggg agcaac tat gac tgg gaa gag 2948
aac ctg
Leu Arg AlaMetMet ValGly SerAsn Tyr Asp Trp Glu Glu
Asn Leu
930 935 940 945
gaa gag actgetgtc tacagg gattat tca age aca cat ccc 2996
ggt act
Glu Glu ThrAlaVal TyrArg AspTyr Ser Ser Thr His Pro
Gly Thr
950 955 960
gtg aaa ctcttctgg gagaca cacgag ttc cca ttg gag aag 3044
ttc aag
Val Lys LeuPheTrp GluThr HisGlu Phe Pro Leu Glu Lys
Phe Lys
965 970975
aag aag tttcttttg ttccta ggcagt gac cgg att ccc atc 3092
aca tat
Lys Lys PheLeuLeu PheLeu GlySer Asp Arg Ile Pro Ile
Thr Tyr
980 985 990
ggc atg gccagtctt cagatc atccag tcc aca gcc act ggg 3140
atc gag
Gly Met AlaSerLeu GlnIle IleGln Ser Thr Ala Thr Gly
Ile Glu
995 1000 1005
gaa tac ttacccgtg gcccat c c tac aac ctt ctt gac 3185
ac tg ctc
Glu Tyr LeuProVal AlaHis r s Tyr Asn Leu Leu Asp
Th Cy Leu
1010 1015 1020
5$ cct aag tatagcagc aaagag c g aag get cgg ctg acc 3230
at at cag
Pro Lys TyrSerSer LysGlu e t Lys Ala Arg Leu Thr
Il Me Gln
1025 1030 1035
CA 02449417 2003-12-04
121
gcc ctc gag ggt 3276
gac aac ttt agt
tat ttg gcc
tga ggtaccccag
Ala Leu Glu Gly
Asp Asn Phe Ser
Tyr Leu Ala
1040 1045 1050
$ cttacctaagacatccatcccttccttcttctgtggccacattgaggctgaataaaatac3336
catgggaagtgatttctatttttttattgtttaagtggtttgaaacttttgaatcctaaa3396
ccctagtcaaggtgtttctggggttcaatagtgaatagtctttctgaaaaaatcagtggt3456
tggggatgagccaaaaaaaaaattggctttggtatgggaagtggacttgattttgttttg3516
ttttgttttgttttaaaccgaggtacctgttgttccttcatctgtgaatgtgttgcaatc3576
1$ tgctggatttaatggcagtaggttttcagcttttgtttcccagatgtccctcagtcctga3636
tgtttcttcaccatgctttgctgctctcttcctggcctctcagtccctacaggggtgact3696
tgatggatatgtcccttcttgcccgccatgcagaacatttcctactcctcagcactggaa3756
atgcatggcttgttgcagcccagcccagcccacagatggaactcccaagacaaagaagct3816
gagccttgtcatagctcttgagtctttgtgggaacctttatgaacatgtcctgctttaag3876
gaaataggtcatgagtgcctactgcctgggcctcctgaaacacacatacacaagagccgc3936
aggttgcaggcgggctgcatgtgtcttgttagccatgacccgtggatttacagtgaattg3996
gtagaccttctttatcatacttttgaaatgcaagttgcattttcttgtttccatattgcc4056
taagaacagtacaattaataaaggtttccccttctttattcctttctagctcctgctctc4116
ttCCttCCCtttCttCttgtgCtCCCCtCtCCtCCCttCCtCttgCtCtCCtaCtCttCC4176
3$ ttgtctttgctgcttgactccgttcccctcttccttctggtagtggatgcatgctgtctt4236
ttttattttaaattttgtaagtttttttttaaacctctgtctctaactgtgaaaatatga4296
agatactctttataatagagtttttgttttatcacatgtgaagtgtgcatttacagtgaa4356
atttcagcagggggattatgttaagtcaaatgcgtgtgtctcaaaagtgacatgtttaac4416
tgctcatcactgtataagaaaattctacatggtcaaagagttcatgtaattctaatttta4476
aatctgtagtagatagagaaagtatttatttatctaaaatgaagtacttatagattgtga4536
tgcagcaccgagtcttgatgaaggaatgtagatttttgcttttcctgtttttgttttgaa4596
aagttactccaattgctaaattggtagtttttttgtccttataaatataacatttaaaaa4656
agatacacaattatataaaatgtttattttctatgtgtctgcatatagttcaatattatc4716
caataaatttggtgttttaacttaaaaaaaaaaaaaaa 4754
<210> 54
<211> 1050
<212> PRT
CA 02449417 2003-12-04
122
<213> Mus musculus
<400> 54
$ Met Leu Cys Trp Gly Tyr Trp Ser Leu Gly Gln Pro Gly Ile Ser Ser
1 5 10 15
Asn Leu Gln Gly Ile Val Ala Glu Pro Gln Val Cys Arg Phe Val Ser
20 25 30
20
Asp Arg Ser Ile Lys Glu Val Ala Cys Gly Gly Asn His Ser Val Phe
35 40 45
Leu Leu Glu Asp Gly Glu Val Tyr Thr Cys Gly Val Asn Thr Lys Gly
50 55 60
Gln Leu Gly His Glu Arg Glu Gly Asn Lys Pro Glu Gln Ile Gly Ala
65 70 75 80
2S Leu Ala Asp Gln His Ile Ile His Val Ala Cys Gly Glu Ser His Ser
85 90 95
Leu Ala Leu Ser Asp Arg Gly Gln Leu Phe Ser Trp Gly Ala Gly Ser
30 loo l05 llo
40
Asp Gly Gln Leu Gly Leu Met Thr Thr Glu Asp Ser Val Ala Val Pro
115 120 125
Arg Leu Ile Gln Lys Leu Asn Gln Gln Thr Ile Leu Gln Val Ser Cys
130 135 140
Gly Asn Trp His Cys Leu Ala Leu Ala Ala Asp Gly Gln Phe Phe Thr
145 150 155 160
Trp Gly Lys Asn Ser His Gly Gln Leu Gly Leu Gly Lys Glu Phe Pro
165 170 175
Ser Gln Thr Ser Pro Gln Arg Val Arg Ser Leu Glu Gly Ile Pro Leu
180 185 190
Ala Gln Val Ala Ala Gly Gly Ala His Ser Phe Ala Leu Ser Leu Ser
195 200 205
Gly Ala Val Phe Gly Trp Gly Met Asn Asn Ala Gly Gln Leu Gly Leu
210 215 220
CA 02449417 2003-12-04
123
10
Ser Asp Glu Lys Asp Arg Glu Ser Pro Cys His Val Lys Leu Leu Arg
225 230 235 240
Thr Gln Lys Val Val Tyr Ile Ser Cys Gly Glu Glu His Thr Ala Val
245 250 255
Leu Thr Lys Ser Gly Gly Val Phe Thr Phe Gly Ala Gly Ser Cys Gly
260 265 270
1$ Gln Leu Gly His Asp Ser Val Asn Asp Glu Val Asn Pro Arg Arg Val
275 280 285
Leu Glu Leu Met Gly Ser Glu Val Thr Gln Ile Ala Cys Gly Arg Gln
20 290 295 300
30
His Thr Leu Ala Leu Val Pro Ser Ser Gly Leu Ile Tyr Ala Phe Gly
305 310 315 320
Cys Gly Ala Lys Gly Gln Leu Gly Thr Gly His Thr Cys Asn Val Lys
325 330 335
Cys Pro Ser Pro Val Lys Gly His Trp Ala Ala His Ser Ser Gln Leu
340 345 350
Ser Ala Arg Ala Asp Arg Phe Lys Tyr Arg Val Val Lys Gln Ile Phe
355 360 365
Ser Gly Gly Asp Gln Thr Phe Val Leu Cys Ser Thr Tyr Glu Asn Ser
370 375 380
Ser Pro Ala Val Asp Phe Arg Thr Val Asn Gln Thr His Tyr Thr Asn
385 390 395 400
SO
Leu Ile Asn Asp Glu Thr Ile Ala Val Trp Arg Gln Lys Leu Thr Glu
405 410 415
His Asn Asn Ala Asn Thr Val Asn Gly Val Val Gln Ile Leu Ser Ser
420 425 430
SS Ala Ala Cys Trp Asn Gly Ser Phe Leu Lys Lys Lys Ile Asp Glu His
435 440 445
CA 02449417 2003-12-04
124
Phe Lys Thr Ser Pro Lys Ile Pro Gly Ile Asp Leu Asn Ser Thr Arg
450 455 460
$ Ile Leu Phe Glu Lys Leu Met His Ser Gln His Ser Met Ile Leu Glu
465 470 475 480
Gln Ile Leu Asn Ser Phe Glu Ser Cys Leu Ile Pro Gln Leu Ser Ser
1~ 485 490 495
1$
Ser Pro Pro Asp Val Glu Ala Met Arg Ile Tyr Leu Ile Leu Pro Glu
500 505 510
Phe Pro Leu Leu Gln Asp Ser Lys Tyr Tyr Ile Thr Leu Thr Ile Pro
515 520 525
Leu Ala Met Ala Ile Leu Arg Leu Glu Thr Asn Pro Ser Lys Val Leu
530 535 540
2$ Asp Asn Trp Trp Ser Gln Ala Cys Pro Lys Tyr Phe Met Lys Leu Val
545 550 555 560
Thr Leu Tyr Lys Gly Ala Val Leu Tyr Leu Leu Arg Gly Arg Lys Thr
565 570 575
Phe Leu Ile Pro Val Leu Phe Asn Asn Tyr Met Thr Ala Thr Leu Lys
580 585 590
3$
Leu Leu Glu Lys Leu Tyr Lys Val Asn Leu Lys Val Lys His Val Glu
595 600 605
Tyr Asp Lys Phe Tyr Ile Pro Glu Ile Ser Ser Leu Val Asp Ile Gln
610 615 620
4$ Glu Asp Tyr Leu Met Trp Phe Leu His Gln Ser Gly Met Lys Ala Arg
625 630 635 640
Pro Ser Ile Met Gln Asp Ala Val Thr Leu Cys Ser Tyr Pro Phe Ile
$~ 645 650 655
$$
Phe Asp Ala Gln Ala Lys Thr Lys Met Leu Gln Thr Asp Ala Glu Leu
660 665 670
Gln Met Gln Va1 Ala Val Asn Gly Ala Asn Leu Gln Asn Val Phe Met
675 680 685
CA 02449417 2003-12-04
125
Leu Leu Thr Leu Glu Pro Leu Leu Ala Arg Ser Pro Phe Leu Val Leu
690 695 700
His Val Arg Arg Asn His Leu Val Gly Asp Ala Leu Arg Glu Leu Ser
705 710 715 720
1~
Ile His Ser Asp Ile Asp Leu Lys Lys Pro Leu Lys Val Ile Phe Asp
725 730 735
IS Gly Glu Glu Gly Val Asp Ala Gly Gly Val Thr Lys Glu Phe Phe Leu
740 745 750
Leu Leu Leu Lys Glu Leu Leu Asn Pro Ile Tyr Gly Met Phe Thr Tyr
20 755 760 765
Tyr Gln Asp Ser Asn Leu Leu Trp Phe Ser Asp Thr Cys Phe Val Glu
770 775 780
His Asn Trp Phe His Leu Ile Gly Ile Thr Cys Gly Leu Ala Ile Tyr
785 790 795 800
Asn Ser Thr Val Val Asp Leu His Phe Pro Leu Ala Leu Tyr Lys Lys
805 810 815
3$ Leu Leu Asn Val Lys Pro Ser Leu Glu Asp Leu Lys Glu Leu Ser Pro
820 825 830
Thr Glu Gly Arg Ser Leu Gln Glu Leu Leu Asp Tyr Pro Gly Glu Asp
4~ 835 $40 845
Ile Glu Glu Thr Phe Cys Leu Asn Phe Thr Val Cys Arg Glu Ser Tyr
850 855 860
Gly Val Ile Glu Gln Lys Lys Leu Ile Pro Gly Gly Asp Arg Val Ala
865 870 875 880
Val Cys Lys Asp Asn Arg Gln Glu Phe Val Asp Ala Tyr Val Asn Tyr
885 890 895
SS Ile Phe Gln Ile Ser Val His Glu Trp Tyr Thr Ala Phe Ser Ser Gly
900 905 910
CA 02449417 2003-12-04
126
Phe Leu Lys Val Cys Gly Gly Lys Val Leu Glu Leu Phe Gln Pro Ala
915 920 925
$ Glu Leu Arg Ala Met Met Val Gly Asn Ser Asn Tyr Asp Trp Glu Glu
930 935 940
Leu Glu Glu Thr Ala Val Tyr Arg Gly Asp Tyr Ser Ser Thr His Pro
945 950 955 960
1$
Thr Val Lys Leu Phe Trp Glu Thr Phe His Glu Phe Pro Leu Glu Lys
965 970 975
Lys Lys Lys Phe Leu Leu Phe Leu Thr Gly Ser Asp Arg Ile Pro Ile
980 985 990
Tyr Gly Met Ala Ser Leu Gln Ile Ile Ile Gln Ser Thr Ala Thr Gly
995 1000 1005
2$ Glu Glu Tyr Leu Pro Val Ala His Thr Cys Tyr Asn Leu Leu Asp
1010 1015 1020
Leu Pro Lys Tyr Ser Ser Lys Glu Ile Met Lys Ala Arg Leu Thr
1025 1030 1035
Gln Ala Leu Asp Asn Tyr Glu Gly Phe Ser Leu Ala
1040 1045 1050
<210> 55
<211> 2862
<212> DNA
<213> Mus musculus
<220>
<221> CDS
4$ <222> (89)..(2566)
<400> 55
ggctccgggc ccgtcgcggg aggcagttat gggcgccgtcgccccggattgtaactttgt60
$0 gtcagcgtgc agtccataaa gtgccagc atg aaa cgg aag ggg 112
ggg aag acc
Met Gly Lys Lys Arg Lys Gly
Thr
1 5
aga agt get cca gac acg gtg gcc tca gca gaa gtg tgc 160
gag tct cca
$$ Arg Ser Ala Pro Asp Thr Val Ala Ser Ala Glu Val Cys
Glu Ser Pro
10 15 20
aga cac ctt aga aaa ggg ttg gaa caa ttg aaa get tta 208
ggt aat aaa
CA 02449417 2003-12-04
127
Arg His Leu Arg Lys Gly Leu Glu Gln Gly Asn Leu Lys Lys Ala Leu
25 30 35 40
gta aat gtg gag tgg aat atc tgc caa gac tgt aag act gac aat aaa 256
$ Val Asn Val Glu Trp Asn Ile Cys Gln Asp Cys Lys Thr Asp Asn Lys
45 50 55
gtg aaa gat aaa cct gag gag gaa gca gaa gac cct tcg gtt tgg ctc 304
Val Lys Asp Lys Pro Glu Glu Glu Ala Glu Asp Pro Ser Val Trp Leu
1~ 60 65 70
1$
tgt ctt aaa tgt ggc cat cag ggc tgt ggc aga gat tct cag gag cag 352
Cys Leu Lys Cys Gly His Gln Gly Cys Gly Arg Asp Ser Gln Glu Gln
75 80 85
cat gcc ttg aag cac tac acg aca ccg aga tcc gag cct cac tac ctg 400
His Ala Leu Lys His Tyr Thr Thr Pro Arg Ser Glu Pro His Tyr Leu
90 95 100
20 gtg ctc agt ctg gac aac tgg agc gtc tgg tgc tac aag tgt gac gag 448
Val Leu Ser Leu Asp Asn Trp Ser Val Trp Cys Tyr Lys Cys Asp Glu
105 110 115 120
gaa gtc aag tac tgt agc tca aac cga ttg ggc caa gtg gtt gat tat 496
2$ Glu Val Lys Tyr Cys Ser Ser Asn Arg Leu Gly Gln Val Val Asp Tyr
125 130 135
gtt aga aaa caa get ggc gta aga act tca aaa cca gca gag aaa aat 544
Val Arg Lys Gln Ala Gly Val Arg Thr Ser Lys Pro Ala Glu Lys Asn
30 140 145 150
3$
aat gga cac att gag ctc gaa aat aaa aaa ttg gag aaa gag agt aaa 592
Asn Gly His Ile Glu Leu Glu Asn Lys Lys Leu Glu Lys Glu Ser Lys
155 160 165
aat gaa caa gag aaa gag aaa tcg gaa aac ctg get aaa gaa act att 640
Asn Glu Gln Glu Lys Glu Lys Ser Glu Asn Leu Ala Lys Glu Thr Ile
170 175 180
40 ccc atg gac tct get tcc cag ata act gtg aaa gga ctc agt aat ttg 688
Pro Met Asp Ser Ala Ser Gln Ile Thr Val Lys Gly Leu Ser Asn Leu
185 190 195 200
ggg aat act tgt ttc ttc aat gca gtt atg cag aac ttg tca caa acg 736
4$ Gly Asn Thr Cys Phe Phe Asn Ala Val Met Gln Asn Leu Ser Gln Thr
205 210 215
cca gtg ctt aga gaa cta cta aaa gaa gtg aag atg tct gga acg att 784
Pro Val Leu Arg Glu Leu Leu Lys Glu Val Lys Met Ser Gly Thr Ile
$~ 220 225 230
$$
gta aaa ata gag cca cct gat ctg gca cta aca gaa cct tta gaa gta 832
Val Lys Ile Glu Pro Pro Asp Leu Ala Leu Thr Glu Pro Leu Glu Val
235 240 245
aac ctc gag cct cca ggt cct ctt act tta gcc atg agc cag ttt ctc 880
Asn Leu Glu Pro Pro Gly Pro Leu Thr Leu Ala Met Ser Gln Phe Leu
250 255 260
CA 02449417 2003-12-04
128
agt gag atg caa gag aac aaa aag cga gtt gtg aca cct aaa gag ctc 928
Ser Glu Met Gln Glu Asn Lys Lys Arg Val Val Thr Pro Lys Glu Leu
265 270 275 280
ttt tct cag gtc tgt aaa aaa gca aca cgt ttt aaa ggg tac cag caa 976
Phe Ser Gln Val Cys Lys Lys Ala Thr Arg Phe Lys Gly Tyr Gln Gln
285 290 295
caa gac agc cag gag ctg ctt cgc tac cta ctg gat ggg atg aga gcg 1024
Gln Asp Ser Gln Glu Leu Leu Arg Tyr Leu Leu Asp Gly Met Arg Ala
300 305 310
gaa gaa cac caa aga gtg agt aaa gga att ctt aaa gca ttt ggt aat 1072
1$ Glu Glu His Gln Arg Val Ser Lys Gly Ile Leu Lys Ala Phe Gly Asn
315 320 325
tct act gaa aaa ttg gat gaa gaa gta aaa aat aaa gtt aaa gat tat 1120
Ser Thr Glu Lys Leu Asp Glu Glu val Lys Asn Lys Val Lys Asp Tyr
330 335 340
2$
gaa aag aaa aag gca atc ccg agt ttt gtg gac cgc atc ttt ggt ggc 1168
Glu Lys Lys Lys Ala Ile Pro Ser Phe Val Asp Arg Ile Phe Gly Gly
345 350 355 360
gag ctg act agt acg atc atg tgt gat gaa tgc agg act gtc tcc tta 1216
Glu Leu Thr Ser Thr Ile Met Cys Asp Glu Cys Arg Thr Val Ser Leu
365 370 375
gtg cat gaa tcg ttc ctt gat ttg tct ctt cca gtt tta gat gat cag 1264
Val His Glu Ser Phe Leu Asp Leu Ser Leu Pro Val Leu Asp Asp Gln
380 385 390
agt ggt aag aaa agt ata aat gat aaa aat gtg aaa atg aca atg gag 1312
3$ Ser Gly Lys Lys Ser Ile Asn Asp Lys Asn Val Lys Met Thr Met Glu
395 400 405
gaa gaa gat aaa gac agt gag gaa gag aaa gat gac agc tac atg aaa 1360
Glu Glu Asp Lys Asp Ser Glu Glu Glu Lys Asp Asp Ser Tyr Met Lys
410 415 420
4$
tca agg agc gat ctt ccg tca ggg aca agc aag cac cta cag aaa aag 1408
Ser Arg Ser Asp Leu Pro Ser Gly Thr Ser Lys His Leu Gln Lys Lys
425 430 435 440
gca aag aag cag gcc aaa aag cag gcc aag aac caa cga agg caa caa 1456
Ala Lys Lys Gln Ala Lys Lys Gln Ala Lys Asn Gln Arg Arg Gln Gln
445 450 455
$0 aaa att caa gaa aga ttt ctt cac ttc aat gag ctc tgc gcc act gac 1504
Lys Ile Gln Glu Arg Phe Leu His Phe Asn Glu Leu Cys Ala Thr Asp
460 465 470
tac acg gaa gac aat gaa cgt gaa get gac aca gca ctt gcg gga gaa 1552
$$ Tyr Thr Glu Asp Asn Glu Arg Glu Ala Asp Thr Ala Leu Ala Gly Glu
475 480 485
gtg gaa gtg gat acc gac tcc acc cat ggt tct caa gag gag gcc aca 1600
CA 02449417 2003-12-04
129
Val Glu Val Asp Thr Asp Ser Thr His Gly Ser Gln Glu Glu Ala Thr
490 495 500
cag ata gag ctg tct gtt aac cag aag gat ttg gat ggc caa gag agc 1648
$ Gln Ile Glu Leu Ser Val Asn Gln Lys Asp Leu Asp Gly Gln Glu Ser
505 510 515 520
atg ata gaa agg aca cct gat gtg cag gaa agc cca gag gac cta gga 1696
Met Ile Glu Arg Thr Pro Asp Val Gln Glu Ser Pro Glu Asp Leu Gly
525 530 535
1$
gtg aaa agt get aac acc gag agt gat ctg ggg att gtg acg cct get 1744
Val Lys Ser Ala Asn Thr Glu Ser Asp Leu Gly Ile Val Thr Pro Ala
540 545 550
cct gaa tgt cct agg gat ttc aat ggt gcc ttc ctg gaa gaa agg acc 1792
Pro Glu Cys Pro Arg Asp Phe Asn Gly Ala Phe Leu Glu Glu Arg Thr
555 560 565
20 agt gga gaa cta gac att atc aat ggt tta aaa aac ctt aat ttg aat 1840
Ser Gly Glu Leu Asp Ile Ile Asn Gly Leu Lys Asn Leu Asn Leu Asn
570 575 580
get get gtt gat cct gat gaa ata aat ata gag att ccg aat gac agt 1888
2$ Ala Ala Val Asp Pro Asp Glu Ile Asn Ile Glu Ile Pro Asn Asp Ser
5g5 590 595 600
cat tct gca ccc aag gta tat gag gtc atg aac gag gac cca gaa act 1936
His Ser Ala Pro Lys Val Tyr Glu Val Met Asn Glu Asp Pro Glu Thr
3~ 605 610 615
3$
get ttc tgt acc ctc gcg aac cga gaa gcg ttt agt act gat gag tgt 1984
Ala Phe Cys Thr Leu Ala Asn Arg Glu Ala Phe Ser Thr Asp Glu Cys
620 625 630
tcc att caa cat tgc tta tat cag ttc acc cgg aat gag aaa ctt caa 2032
Ser Ile Gln His Cys Leu Tyr Gln Phe Thr Arg Asn Glu Lys Leu Gln
635 640 645
40 gat gcc aat aaa ctg ctt tgt gaa gtg tgt tca aga cgg cag tgt aat 2080
Asp Ala Asn Lys Leu Leu Cys Glu Val Cys Ser Arg Arg Gln Cys Asn
650 655 660
gga cca aag gca aat ata aaa ggt gac agg aga cat gtt tac acc aat 2128
4$ Gly Pro Lys Ala Asn Ile Lys Gly Asp Arg Arg His Val Tyr Thr Asn
665 670 675 680
gcc aag aag cag atg ctg gtc tcc ctc gcg cct cct gtc ctc act ctg 2176
Ala Lys Lys Gln Met Leu Val Ser Leu Ala Pro Pro Val Leu Thr Leu
$~ 685 690 695
$$
cat tta aag cga ttc cag cag get ggt ttt aac ctg cgc aaa gtt aac 2224
His Leu Lys Arg Phe Gln Gln Ala Gly Phe Asn Leu Arg Lys Val Asn
700 705 710
aaa cac ata aag ttt cca gaa atc tta gat ttg get cct ttt tgt acc 2272
Lys His Ile Lys Phe Pro Glu Ile Leu Asp Leu Ala Pro Phe Cys Thr
715 720 725
CA 02449417 2003-12-04
130
ctt aaatgtaag aatgttget gaagaaagt acacgagtg ctgtattcc 2320
Leu LysCysLys AsnValAla GluGluSer ThrArgVal LeuTyrSer
730 735 740
tta tatggagtt gttgaacac agtggtact atgaggtca gggcattac 2368
Leu TyrGlyVal ValGluHis SerGlyThr MetArgSer GlyHisTyr
745 750 755 760
act gcctatgcg aaggagaga actgcaagc tgtcacctc tccaatctt 2416
Thr AlaTyrAla LysGluArg ThrAlaSer CysHisLeu SerAsnLeu
765 770 775
gtt cttcacggt gacattcca caagattgt gaaatggaa tcaaccaaa 2464
1$ Val LeuHisGly AspIlePro GlnAspCys GluMetGlu SerThrLys
780 785 790
ggg cagtggttt cacatcagc gatacacat gtgcaaget gtgcctata 2512
Gly GlnTrpPhe HisIleSer AspThrHis ValGlnAla ValProIle
795 800 805
act aaagtactg aactcacaa gcatatctc ctattttat gagagaata 2560
Thr LysValLeu AsnSerGln AlaTyrLeu LeuPheTyr GluArgIle
810 815 820
ctg tgataacaaaaag tgctttctct tatactggct 2616
ggaaatacac
ctatggcttt
Leu
825
attataacaa taaaaagt ta tatgttcacc taagtaaatg
acagaaaaaa 2676
aactataaat
aatcatgttt atttatttaa aataatttac agcggttttg
tattagcata 2736
atacaggcaa
ctggttttta ttccttct ag aggaaggatt tgaataacta
agttctgtgc 2796
tttcaacttt
ttactctgac tgggtggtag atcaataaac tgatattccc
aaaaaaaaaa 2856
tgcttgacac
aaaaaa 2862
<210> 56
<211> 825
<212> PRT
<213> Mus musculus
<400> 56
Met Gly Lys Lys Arg Thr Lys Gly Arg Ser Ala Pro Asp Thr Val Ala
1 5 10 15
55
Ser Glu Ser Ala Glu Pro Val Cys Arg His Leu Arg Lys Gly Leu Glu
20 25 30
Gln Gly Asn Leu Lys Lys Ala Leu Val Asn Val Glu Trp Asn Ile Cys
35 40 45
CA 02449417 2003-12-04
131
Gln Asp Cys Lys Thr Asp Asn Lys Val Lys Asp Lys Pro Glu Glu Glu
50 55 60
Ala Glu Asp Pro Ser Val Trp Leu Cys Leu Lys Cys Gly His Gln Gly
65 70 75 80
10 Cys Gly Arg Asp Ser Gln Glu Gln His Ala Leu Lys His Tyr Thr Thr
85 90 95
Pro Arg Ser Glu Pro His Tyr Leu Val Leu Ser Leu Asp Asn Trp Ser
100 105 110
2$
Val Trp Cys Tyr Lys Cys Asp Glu Glu Val Lys Tyr Cys Ser Ser Asn
115 120 125
Arg Leu Gly Gln Val Val Asp Tyr Val Arg Lys Gln Ala Gly Val Arg
130 135 140
Thr Ser Lys Pro Ala Glu Lys Asn Asn Gly His Ile Glu Leu Glu Asn
145 150 155 160
Lys Lys Leu Glu Lys Glu Ser Lys Asn Glu Gln Glu Lys Glu Lys Ser
165 170 175
Glu Asn Leu Ala Lys Glu Thr Ile Pro Met Asp Ser Ala Ser Gln Ile
180 185 190
45
Thr Val Lys Gly Leu Ser Asn Leu Gly Asn Thr Cys Phe Phe Asn Ala
195 200 205
Val Met Gln Asn Leu Ser Gln Thr Pro Val Leu Arg Glu Leu Leu Lys
210 215 220
Glu Val Lys Met Ser Gly Thr Ile Val Lys Ile Glu Pro Pro Asp Leu
225 230 235 240
$0 Ala Leu Thr Glu Pro Leu Glu Val Asn Leu Glu Pro Pro Gly Pro Leu
245 250 255
Thr Leu Ala Met Ser Gln Phe Leu Ser Glu Met Gln Glu Asn Lys Lys
55 260 265 270
Arg Val Val Thr Pro Lys Glu Leu Phe Ser Gln Val Cys Lys Lys Ala
CA 02449417 2003-12-04
132
275 280 285
Thr Arg Phe Lys Gly Tyr Gln Gln Gln Asp Ser Gln Glu Leu Leu Arg
$ 290 295 300
Tyr Leu Leu Asp Gly Met Arg Ala Glu Glu His Gln Arg Val Ser Lys
305 310 315 320
I$
Gly Ile Leu Lys Ala Phe Gly Asn Ser Thr Glu Lys Leu Asp Glu Glu
325 330 335
Val Lys Asn Lys Val Lys Asp Tyr Glu Lys Lys Lys Ala Ile Pro Ser
340 345 350
Phe Val Asp Arg Ile Phe Gly Gly Glu Leu Thr Ser Thr Ile Met Cys
355 360 365
Asp Glu Cys Arg Thr Val Ser Leu Val His Glu Ser Phe Leu Asp Leu
2$ 370 375 380
Ser Leu Pro Val Leu Asp Asp Gln Ser Gly Lys Lys Ser Ile Asn Asp
385 390 395 400
3$
Lys Asn Val Lys Met Thr Met Glu Glu Glu Asp Lys Asp Ser Glu Glu
405 410 415
Glu Lys Asp Asp Ser Tyr Met Lys Ser Arg Ser Asp Leu Pro Ser Gly
420 425 430
Thr Ser Lys His Leu Gln Lys Lys Ala Lys Lys Gln Ala Lys Lys Gln
435 440 445
Ala Lys Asn Gln Arg Arg Gln Gln Lys Ile Gln Glu Arg Phe Leu His
4$ 450 455 460
$0
$$
Phe Asn Glu Leu Cys Ala Thr Asp Tyr Thr Glu Asp Asn Glu Arg Glu
465 470 475 480
Ala Asp Thr Ala Leu Ala Gly Glu Val Glu Val Asp Thr Asp Ser Thr
485 490 495
His Gly Ser Gln Glu Glu Ala Thr Gln Ile Glu Leu Ser Val Asn Gln
500 505 510
CA 02449417 2003-12-04
133
Lys Asp Leu Asp Gly Gln Glu Ser Met Ile Glu Arg Thr Pro Asp Val
515 520 525
Gln Glu Ser Pro Glu Asp Leu Gly Val Lys Ser Ala Asn Thr Glu Ser
530 535 540
Asp Leu Gly Ile Val Thr Pro Ala Pro Glu Cys Pro Arg Asp Phe Asn
545 550 555 560
Gly Ala Phe Leu Glu Glu Arg Thr Ser Gly Glu Leu Asp Ile Ile Asn
565 570 575
25
Gly Leu Lys Asn Leu Asn Leu Asn Ala Ala Val Asp Pro Asp Glu Ile
580 585 590
Asn Ile Glu Ile Pro Asn Asp Ser His Ser Ala Pro Lys Val Tyr Glu
595 600 605
Val Met Asn Glu Asp Pro Glu Thr Ala Phe Cys Thr Leu Ala Asn Arg
610 615 620
Glu Ala Phe Ser Thr Asp Glu Cys Ser Ile Gln His Cys Leu Tyr Gln
625 630 635 640
Phe Thr Arg Asn Glu Lys Leu Gln Asp Ala Asn Lys Leu Leu Cys Glu
3$ 645 650 655
45
Val Cys Ser Arg Arg Gln Cys Asn Gly Pro Lys Ala Asn Ile Lys Gly
660 665 670
Asp Arg Arg His Val Tyr Thr Asn Ala Lys Lys Gln Met Leu Val Ser
675 680 685
Leu Ala Pro Pro Val Leu Thr Leu His Leu Lys Arg Phe Gln Gln Ala
690 695 700
SO Gly Phe Asn Leu Arg Lys Val Asn Lys His Ile Lys Phe Pro Glu Ile
705 710 715 720
Leu Asp Leu Ala Pro Phe Cys Thr Leu Lys Cys Lys Asn Val Ala Glu
$$ 725 730 735
Glu Ser Thr Arg Val Leu Tyr Ser Leu Tyr Gly Val Val Glu His Ser
CA 02449417 2003-12-04
134
740 745 750
Gly Thr Met Arg Ser Gly His Tyr Thr Ala Tyr Ala Lys Glu Arg Thr
755 760 765
1~
Ala Ser Cys His Leu Ser Asn Leu Val Leu His Gly Asp Ile Pro Gln
770 775 780
Asp Cys Glu Met Glu Ser Thr Lys Gly Gln Trp Phe His Ile Ser Asp
785 790 795 800
Thr His Val Gln Ala Val Pro Ile Thr Lys Val Leu Asn Ser Gln Ala
805 810 815
Tyr Leu Leu Phe Tyr Glu Arg Ile Leu
820 825
<210> 57
<211> 4030
<212> DNA
<213> Mus musculus
3~ <220>
<221> CDS
<222> (17)..(1708)
<400> 57
ggccgcc ggg 52
gccgcc
atg
gag
ccc
gac
tcg
gtg
att
gaa
gac
aag
acc
atc
Met
Glu
Pro
Asp
Ser
Val
Ile
Glu
Asp
Lys
Thr
Ile
1 5 10
gag ctcatg tgttctgtgcca aggtctttg tggctaggc tgcgccaac 100
4~ Glu LeuMet CysSerValPro ArgSerLeu TrpLeuGly CysAlaAsn
15 20 25
ctg gtagag agcatgtgcgca ctgagttgc ctgcagagc atgcccagt 148
Leu ValGlu SerMetCysAla LeuSerCys LeuGlnSer MetProSer
30 35 40
gtc agatgt ctccagaacact tcagttatg gaagatcaa aatgaagat 196
Val ArgCys LeuGlnAsnThr SerValMet GluAspGln AsnGluAsp
45 50 55 60
gag tcccca aagaaaagtget ctttggcag atcag.taat ggaacgtca 244
Glu SerPro LysLysSerAla LeuTrpGln IleSerAsn GlyThrSer
65 70 75
tct gtgatt gtctccagaaag aggccgtca gaggggaac taccagaaa 292
Ser ValIle ValSerArgLys ArgProSer GluGlyAsn TyrGlnLys
80 85 90
CA 02449417 2003-12-04
135
gaa aag gac ttg tgc att aag tac ttt gac cag tgg tct gaa tca gat 340
Glu Lys Asp Leu Cys Ile Lys Tyr Phe Asp Gln Trp Ser Glu Ser Asp
95 100 105
S cag gtg gaa ttt gtg gag cat ctt atc tca cgg atg tgt cat tat cag 388
Gln Val Glu Phe Val Glu His Leu Ile Ser Arg Met Cys His Tyr Gln
110 115 120
cat gga cat att aac tct tac ctg aag ccc atg ttg cag cgg gac ttt 436
l~ His Gly His Ile Asn Ser Tyr Leu Lys Pro Met Leu Gln Arg Asp Phe
125 130 135 140
atc act get tta cca gag caa ggc tta gat cac ata gca gaa aac att 484
Ile Thr Ala Leu Pro Glu Gln Gly Leu Asp His Ile Ala Glu Asn Ile
1$ 145 150 155
ctc tcc tac ctg gat gcc agg tct ctg tgt gca gca gag ctg gtg tgt 532
Leu Ser Tyr Leu Asp Ala Arg Ser Leu Cys Ala Ala Glu Leu Val Cys
160 165 170
aaa gaa tgg cag cga gtg atc tca gaa ggg atg ctt tgg aag aag ctg 580
Lys Glu Trp Gln Arg Val Ile Ser Glu Gly Met Leu Trp Lys Lys Leu
175 180 185
att gag agg atg gtg cgc acc gac cct ctc tgg aag gga ctc tca gaa 628
Ile Glu Arg Met Val Arg Thr Asp Pro Leu Trp Lys Gly Leu Ser Glu
190 195 200
aga aga ggc tgg gat cag tac ctg ttt aaa aac aga cct aca gat ggc 676
Arg Arg Gly Trp Asp Gln Tyr Leu Phe Lys Asn Arg Pro Thr Asp Gly
205 210 215 220
cct ccc aac tca ttt tat aga tca tta tac cca aag att atc cag gac 724
Pro Pro Asn Ser Phe Tyr Arg Ser Leu Tyr Pro Lys Ile Ile Gln Asp
3$ 225 230 235
ata gag acc ata gaa tcc aac tgg cgg tgt gga cga cac aac ttg cag 772
Ile Glu Thr Ile Glu Ser Asn Trp Arg Cys Gly Arg His Asn Leu Gln
240 245 250
agg atc cag tgc cgc tct gaa aat agt aag ggt gtc tac tgt ttg caa 820
Arg Ile Gln Cys Arg Ser Glu Asn Ser Lys Gly Val Tyr Cys Leu Gln
255 260 265
4S tat gat gat gac aaa att atc agt ggc ctc cgg gac aac tct atc aag 868
Tyr Asp Asp Asp Lys Ile Ile Ser Gly Leu Arg Asp Asn Ser Ile Lys
270 275 280
atc tgg gat aaa agc agc ttg gaa tgt ttg aaa gtg cta acg ggc cac 916
$~ Ile Trp Asp Lys Ser Ser Leu Glu Cys Leu Lys Val Leu Thr Gly His
285 290 295 300
aca ggc tct gtc ctc tgc ctc cag tat gat gag cga gtc att gta act 964
Thr Gly Ser Val Leu Cys Leu Gln Tyr Asp Glu Arg Val Ile Val Thr
55 305 310 315
ggt tct tca gac tcc acg gtg aga gtc tgg gat gtg aac act ggt gag 1012
Gly Ser Ser Asp Ser Thr Val Arg Val Trp Asp Val Asn Thr Gly Glu
CA 02449417 2003-12-04
136
320 325 330
gtg ctcaacaca ctcatccac cacaatgaa gccgtactg cacttacgc 1060
Val LeuAsnThr LeuIleHis HisAsnGlu AlaValLeu HisLeuArg
335 340 345
ttc agcaatgga ctgatggtg acttgttcc aaggaccgt tccattgcc 1108
Phe SerAsnGly LeuMetVal ThrCysSer LysAspArg SerIleAla
350 355 360
gtg tgggacatg gettctgcc accgatatc actttacgc cgtgttctg 1156
Val TrpAspMet AlaSerAla ThrAspIle ThrLeuArg ArgValLeu
365 370 375 380
gtt ggccaccgt getgetgtc aatgtagta gactttgat gataaatac 1204
Val GlyHisArg AlaAlaVal AsnValVal AspPheAsp AspLysTyr
385 390 395
atc gtg tct get tca gga gac agg acc att aaa gtg tgg agc acg agc 1252
Ile Val Ser Ala Ser Gly Asp Arg Thr Ile Lys Val Trp Ser Thr Ser
400 405 410
aca tgtgag tttgtccgc actctgaatggg cacaagcga ggcatcgcc 1300
Thr CysGlu PheValArg ThrLeuAsnGly HisLysArg GlyIleAla
415 420 425
tgt ctgcag taccgcgac cggcttgttgtt agtggatca tcagataat 1348
Cys LeuGln TyrArgAsp ArgLeuValVal SerGlySer SerAspAsn
430 435 440
acc atccgg ttatgggat attgaatgtggt gcctgttta agagtccta 1396
Thr IleArg LeuTrpAsp IleGluCysGly AlaCysLeu ArgValLeu
445 450 455 460
gag gggcac gaagaattg gtccggtgcatc cgttttgat aacaagagg 1444
Glu GlyHis GluGluLeu ValArgCysIle ArgPheAsp AsnLysArg
465 470 475
att gtc agt ggc gcc tat gat ggg aag att aaa gtc tgg gac ttg cag 1492
Ile Val Ser Gly Ala Tyr Asp Gly Lys Ile Lys Val Trp Asp Leu Gln
480 485 490
get get ctt gac cct cgg gcc cca gca agc aca ttg tgt ctg cgc acc 1540
Ala Ala Leu Asp Pro Arg Ala Pro Ala Ser Thr Leu Cys Leu Arg Thr
495 500 505
ttg gtg gaa cac tct gga cgt gtg ttt cgg ctg cag ttt gat gag ttt 1588
Leu Val Glu His Ser Gly Arg Val Phe Arg Leu Gln Phe Asp Glu Phe
510 515 520
cag atc atc agc agc tcc cat gat gac act att ttg att tgg gat ttc 1636
Gln Ile Ile Ser Ser Ser His Asp Asp Thr Ile Leu Ile Trp Asp Phe
525 530 535 540
$5 tta aat gtg cct ccc agt gcc cag aat gag acc cgc tct ccc tcc aga 1684
Leu Asn Val Pro Pro Ser Ala Gln Asn Glu Thr Arg Ser Pro Ser Arg
545 550 555
CA 02449417 2003-12-04
137
acc tac acc tat atc tcc aga tag cagcctgcac tttggcccaa tctgggtttc 1738
Thr Tyr Thr Tyr Ile Ser Arg
560
ctggtcttga actactggct atatggctat cacatgccta agggagttcg ttcacagctg 1798
agtttggggctggactggttccagatgctgggtagatacagagcagccccacccctcaag1858
ccctgacattctcactgcaccccagctctacttggagaaggactccttagctctccactg1918
caagtagagcagcagctcatgtccctcccttcagtgaagaccccagcgcttcccatgcac1978
acgttcccacgaaggacacagcaaggactgtcaggagaagccctgcttctaacttatgtc2038
gtcgctttgcgccttggtttggtactaaaagcagccttgcattctcggtgaagtgctggg2098
tgccaaacgactacacagcgtcttcagggctttcctctccagcagcagcttctccttaga2158
ccgtcagtcacagtcaccgtcgctctgacgtgcataggaatgtgtcggacaatgggcaga2218
tctggattatcttagtatttttggattacactttctttctgtttgtttcttttaatttaa2278
agaataagtgggctatattacctctgcacaggtgatatagctattttcttttattaactg2338
ttctctgttcttcctcatcttctgatatttggtagagtaacacctttatccgagtgcttg2398
cctcctaatttaaaatactgtatccgcatgtagatagagtgtacataacagtccaagctc2458
aagggtgctggccggccccctgcacctgagacactactgtggagattgtcacacctactc2518
cagggttgctgtgctggcctagagcctccttcagtattcacttgggttttagttgtcact2578
gtctttgtgtgtgctgtgtgttttcagacagaacttgagaagtctcccatgtttatttgt2638
tgtgtgacatctgcagtgggcaggtatcttcacagtctccacattgctgttcttttcctc2698
acgcttacccctagagctagtgctcacctccttggggtgatcattagcttctctgtccaa2758
catcctaccacacggcagtgaccctgagatggagatggcggccagtggacagggctcctg2818
gctctgggctccctgtactcggatgggtgttgggggctatagagttagagcctgtggagc2878
aggtcagctggccagagccctcattagggacaaggcactcctctgtgtgtggggcacagc2938
ctcaggccctgtcagctctgctgtcactcatcacggtgagagtggcacccaggcaggaca2998
ttggtgacattatttccctctttcaaaattaggttttgatttccccttgccattgtttcc3058
aaagatgaaggaatgttagtacggttttaaaggaccaaccagcccctcccagtgaatgaa3118
gcctcttcccatggaagcacactctaggagagagaaggcctctgggctccgcctggcctg3178
gcattatgaatgcagtggggtcagtgtgtggtggatgtgtgtactgggttggctttcctt3238
SS tttagtttttttactttttagtttagtttgttcttttccttccccaataaatcattctca3298
catgcttccatgtttgtttctgagaggtgggggctcaaatgtatagaaagtaggccccag3358
CA 02449417 2003-12-04
138
tccataaggaggtgtgaacacacccccttactgcttatcacccatttgacaggaacgccc3418
aggaggagagggggaggggaagaggtgagttctgcacagtcggacatttctgttgctttt3478
$ gcatgtttaatatagacgttcctgtcgatccttgggagatcatggccttcagatatgcac3538
acgacctttgaattgtgcctactaattatagcaggggacttgggtacccaaggaattcca3598
atttctgggattacagtagtaattcccagctgtactctggacttgattttgctaactgta3658
actgagcaactgtaaattactgctatattaatgtgttaaagcactggggtagtctaattc3718
taactggtaattatgtttgccaattatctgtttgaaataaatatgtgtctgaacagctat3778
tgaaactgttaaattgtacagatattatcatgacggctttgtactgtggaatgtgcttaa3838
taaaaacaaaagtttgacctttgtccaataaattgctaagtaatgtcaataaatcaagat3898
gagtattatgcagtacacctgacctggcttcctggcgattgttacttcagctactgattc3958
aagccaatcctctaaataaagtgttgcagtgctcctctgttctgtcacatttctcagaaa4018
aaaaaaaaaaas 4030
2$
<210> 58
<211> 563
<212> PRT
<213> Mus musculus
<400> 58
3$
Met Glu Pro Asp Ser Val Ile Glu Asp Lys Thr Ile Glu Leu Met Cys
1 5 10 15
Ser Val Pro Arg Ser Leu Trp Leu Gly Cys Ala Asn Leu Val Glu Ser
20 25 30
Met Cys Ala Leu Ser Cys Leu Gln Ser Met Pro Ser Val Arg Cys Leu
35 40 45
4$ Gln Asn Thr Ser Val Met Glu Asp Gln Asn Glu Asp Glu Ser Pro Lys
55 60
Lys Ser Ala Leu Trp Gln Ile Ser Asn Gly Thr Ser Ser Val Ile Val
$0 65 70 75 80
$$
Ser Arg Lys Arg Pro Ser Glu Gly Asn Tyr Gln Lys Glu Lys Asp Leu
85 90 95
Cys Ile Lys Tyr Phe Asp Gln Trp Ser Glu Ser Asp Gln Val Glu Phe
100 105 110
CA 02449417 2003-12-04
139
Val Glu His Leu Ile Ser Arg Met Cys His Tyr Gln His Gly His Ile
115 120 125
Asn Ser Tyr Leu Lys Pro Met Leu Gln Arg Asp Phe Ile Thr Ala Leu
130 135 140
Pro Glu Gln Gly Leu Asp His Ile Ala Glu Asn Ile Leu Ser Tyr Leu
145 150 155 160
1S Asp Ala Arg Ser Leu Cys Ala Ala Glu Leu Val Cys Lys Glu Trp Gln
165 170 175
Arg Val Ile Ser Glu Gly Met Leu Trp Lys Lys Leu Ile Glu Arg Met
180 185 190
Val Arg Thr Asp Pro Leu Trp Lys Gly Leu Ser Glu Arg Arg Gly Trp
195 200 205
Asp Gln Tyr Leu Phe Lys Asn Arg Pro Thr Asp Gly Pro Pro Asn Ser
210 215 220
Phe Tyr Arg Ser Leu Tyr Pro Lys Ile Ile Gln Asp Ile Glu Thr Ile
225 230 235 240
Glu Ser Asn Trp Arg Cys Gly Arg His Asn Leu Gln Arg Ile Gln Cys
245 250 255
Arg Ser Glu Asn Ser Lys Gly Val Tyr Cys Leu Gln Tyr Asp Asp Asp
260 265 270
Lys Ile Ile Ser Gly Leu Arg Asp Asn Ser Ile Lys Ile Trp Asp Lys
275 280 285
Ser Ser Leu Glu Cys Leu Lys Val Leu Thr Gly His Thr Gly Ser Val
290 295 300
SO
Leu Cys Leu Gln Tyr Asp Glu Arg Val Ile Val Thr Gly Ser Ser Asp
305 310 315 320
$$ Ser Thr Val Arg Val Trp Asp Val Asn Thr Gly Glu Val Leu Asn Thr
325 330 335
CA 02449417 2003-12-04
140
Leu Ile His His Asn Glu Ala Val Leu His Leu Arg Phe Ser Asn Gly
340 345 350
$ Leu Met Val Thr Cys Ser Lys Asp Arg Ser Ile Ala Val Trp Asp Met
355 360 365
Ala Ser Ala Thr Asp Ile Thr Leu Arg Arg Val Leu Val Gly His Arg
370 375 380
Ala Ala Val Asn Val Val Asp Phe Asp Asp Lys Tyr Ile Val Ser Ala
385 390 395 400
1$
Ser Gly Asp Arg Thr Ile Lys Val Trp Ser Thr Ser Thr Cys Glu Phe
405 410 415
Val Arg Thr Leu Asn Gly His Lys Arg Gly Ile Ala Cys Leu Gln Tyr
420 425 430
2$ Arg Asp Arg Leu Val Val Ser Gly Ser Ser Asp Asn Thr Ile Arg Leu
435 440 445
Trp Asp Ile Glu Cys Gly Ala Cys Leu Arg Val Leu Glu Gly His Glu
450 455 460
Glu Leu Val Arg Cys Ile Arg Phe Asp Asn Lys Arg Ile Val Ser Gly
465 470 475 480
3$
Ala Tyr Asp Gly Lys Ile Lys Val Trp Asp Leu Gln Ala Ala Leu Asp
485 490 495
Pro Arg Ala Pro Ala Ser Thr Leu Cys Leu Arg Thr Leu Val Glu His
500 505 510
4$ Ser Gly Arg Val Phe Arg Leu Gln Phe Asp Glu Phe Gln Ile Ile Ser
515 520 525
Ser Ser His Asp Asp Thr Ile Leu Ile Trp Asp Phe Leu Asn Val Pro
$0 530 535 540
Pro Ser Ala Gln Asn Glu Thr Arg Ser Pro Ser Arg Thr Tyr Thr Tyr
545 550 555 560
$$
Ile Ser Arg
CA 02449417 2003-12-04
141
<210> 59
<211> 1207
<212> DNA
<213> Mus musculus
<220>
<221> misc_feature
<222> (228)..(228)
<223> n is a, c, g, or t
<220>
IS <221> CDS
<222> (391)..(1173)
<400> 59
gagaccgtctgcctgcctcc gagcgcgggcgcgggcgcaacccgatctcc ttggacttga60
atgaggagcgggcggcggcg ctcagctgcggatcggccggcgcgcaggct gagcccggcg120
gccccgtgccccggccgccc gcccgtgccccgcacgccgcccgcggccac ggcccgccgc180
cccggggctcccgctcggcg gccgggggagccagctcgcctcgggganct cggcggcgcc240
cgagcccgcgccgcgctgct cgctgtatgcggggcccgagcccgcgcgcc ggccggagcc300
gcccccgcgccccgcgcctc gcgccccgcgccgcccgtgaccgcttgatg ggggtcaacg360
gcaccgccgccgccgccgcc gggcagcccaatg tct gcg cgt gca act 414
cct gcc
Met Ser
Pro Ala
Arg Ala
Thr Ala
1 5
cag cgc ttg ttc ccc agc gag atc gag ctg gag ttc 462
tct atg acg gtg
Gln Arg Leu Phe Pro Ser Glu Ile Glu Leu Glu Phe
Ser Met Thr Val
10 15 20
caa atc gtc atc gtg gta atg atg atg gtg gtt atg 510
gtg gtg gtg att
Gln Ile Val Ile Val Val Met Met Met Val Val Met
Val Val Val Ile
25 30 35 40
acg tgc ctg agc cac tac ctg tca cgc tcc ttc atc 558
ctg aag gcc agc
Thr Cys Leu Ser His Tyr Leu Ser Arg Ser Phe Ile
Leu Lys Ala Ser
4$ 45 50 55
cga cac agc cag gcc agg agg aga gac gat gga ctg tcc tcg gaa gga 606
Arg His Ser Gln Ala Arg Arg Arg Asp Asp Gly Leu Ser Ser Glu Gly
65 70
tgc ctc tgg ccc tca gag agt acg gtg tca ggt gga atg ccg gag cca 654
Cys Leu Trp Pro Ser Glu Ser Thr Val Ser Gly Gly Met Pro Glu Pro
75 80 85
55 cag gtc tat gcc ccg cct cgg ccc act gac cga ctc get gtg ccc ccc 702
Gln Val Tyr Ala Pro Pro Arg Pro Thr Asp Arg Leu Ala Val Pro Pro
90 95 100
CA 02449417 2003-12-04
142
ttc atccag cggagccga ttccaaccc acctacccc tacctgcag cac 750
Phe IleGln ArgSerArg PheGlnPro ThrTyrPro TyrLeuGln His
105 110 115 120
gaa attgcc ctgccaccc accatctca ctgtctgat ggggaggag ccc 798
Glu IleAla LeuProPro ThrIleSer LeuSerAsp GlyGluGlu Pro
125 130 135
cca ccctac cagggcccc tgcaccctc cagctacgg gaccctgag caa 846
Pro ProTyr GlnGlyPro CysThrLeu GlnLeuArg AspProGlu Gln
140 145 150
cag ctggag ctgaaccgg gaatctgtg cgcgcaccc cctaaccgg acc 894
Gln LeuGlu LeuAsnArg GluSerVal ArgAlaPro ProAsnArg Thr
IS 155 160 165
atc ttcgac agtgacctt atagacagc accatgctg gggggcccc tgt 942
Ile PheAsp SerAspLeu IleAspSer ThrMetLeu GlyGlyPro Cys
170 175 180
ccc cccagc agtaactcg ggcatcagc gccacctgc tacagcagc ggt 990
Pro ProSer SerAsnSer GlyIleSer AlaThrCys TyrSerSer Gly
185 190 195 200
ggg cgcatg gaggggccg ccccccacc tacagcgag gtcattggc cac 1038
Gly ArgMet GluGlyPro ProProThr TyrSerGlu ValIleGly His
205 210 215
tac cctggc tcctccttc cagcaccag caaagtaac gggccatcc tcc 1086
Tyr ProGly SerSerPhe GlnHisGln GlnSerAsn GlyProSer Ser
220 225 230
ctg ctagag gggacccgg ctccatcac tcgcacatt gccccactg gag 1134
Leu LeuGlu GlyThrArg LeuHisHis SerHisIle AlaProLeu Glu
235 240 245
aac aaggag aaggagaaa cagaaaggt caccccctc taggagtgggggc 1183
Asn LysGlu LysGluLys GlnLysGly HisProLeu
250 255 260
cggggcgcct gtaggcaaaa 1207
ccgt
<210> 60
<211> z6o
<212> PRT
<213> Mus musculus
<400> 60
Met Ser Pro Ala Arg Ala Thr Ala Gln Arg Ser Leu Phe Pro Ser Met
1 5 10 15
Glu Ile Thr Glu Leu Glu Phe Val Gln Ile Val Val Ile Val Val Val
20 25 30
CA 02449417 2003-12-04
143
Met Met Val Met Val Val Met Ile Thr Cys Leu Leu Ser His Tyr Lys
35 40 45
$ Leu Ser Ala Arg Ser Phe Ile Ser Arg His Ser Gln Ala Arg Arg Arg
50 55 60
Asp Asp Gly Leu Ser Ser Glu Gly Cys Leu Trp Pro Ser Glu Ser Thr
65 70 75 80
20
Val Ser Gly Gly Met Pro Glu Pro Gln Val Tyr Ala Pro Pro Arg Pro
85 90 95
Thr Asp Arg Leu Ala Val Pro Pro Phe Ile Gln Arg Ser Arg Phe Gln
100 105 110
Pro Thr Tyr Pro Tyr Leu Gln His Glu Ile Ala Leu Pro Pro Thr Ile
115 120 125
Ser Leu Ser Asp Gly Glu Glu Pro Pro Pro Tyr Gln Gly Pro Cys Thr
130 135 140
Leu Gln Leu Arg Asp Pro Glu Gln Gln Leu Glu Leu Asn Arg Glu Ser
145 150 155 160
40
Val Arg Ala Pro Pro Asn Arg Thr Ile Phe Asp Ser Asp Leu Ile Asp
165 170 175
Ser Thr Met Leu Gly Gly Pro Cys Pro Pro Ser Ser Asn Ser Gly Ile
180 185 190
Ser Ala Thr Cys Tyr Ser Ser Gly Gly Arg Met Glu Gly Pro Pro Pro
195 200 205
Thr Tyr Ser Glu Val Ile Gly His Tyr Pro Gly Ser Ser Phe Gln His
210 215 220
Gln Gln Ser Asn Gly Pro Ser Ser Leu Leu Glu Gly Thr Arg Leu His
$0 225 230 235 240
His Ser His Ile Ala Pro Leu Glu Asn Lys Glu Lys Glu Lys Gln Lys
245 250 255
Gly His Pro Leu
260
CA 02449417 2003-12-04
144
<210> 61
<211> 1427
$ <212> DNA
<213> Mus musculus
<220>
1~ <221> CDS
<222> (110 )..(553)
<400> 61
ggcgccgccg cccgcacact gcccgggcgc acacggagca 60
cgcgcaccgc gccctgcgag
1$
gcggcagccc gggacacgcg agcccccgcc gcctgcccc 118
gacactccgc atg
gcg
ctg
Met Ala Leu
1
aag cgg cag gaattaagt gatttacagcgt gatcca cct gcc 166
atc aaa
Lys Arg Gln GluLeuSer AspLeuGlnArg AspPro Pro Ala
Ile Lys
10 15
cac tgc gcg cccgtggga gatgacttgttc cactgg caa gca 214
tca gga
2$ His Cys Ala ProValGly AspAspLeuPhe HisTrp Gln Ala
Ser Gly
20 25 30 35
acc atc ggg cctgacagc gcctatcaaggt ggagtc ttc ttc 262
atg ccc
Thr Ile Gly ProAspSer AlaTyrGlnGly GlyVal Phe Phe
Met Pro
3~ 40 45 50
3$
ctc act gtc cac ttt ccg aca gac tat ccc ttt aaa cca cca aag att 310
Leu Thr Val His Phe Pro Thr Asp Tyr Pro Phe Lys Pro Pro Lys Ile
55 60 65
get ttc aca aca aaa atc tac cac cca aat ata aac agc aac ggg agt 358
Ala Phe Thr Thr Lys Ile Tyr His Pro Asn Ile Asn Ser Asn Gly Ser
70 75 80
40 att tgt ctt gac atc ctg agg tcc cag tgg tcg ccc get ttg act gta 406
Ile Cys Leu Asp Ile Leu Arg Ser Gln Trp Ser Pro Ala Leu Thr Val
85 90 95
tcg aaa gtc ttg ctg tcc ata tgc tcg ctg ctc tgt gat cct aat cca 454
4$ Ser Lys Val Leu Leu Ser Ile Cys Ser Leu Leu Cys Asp Pro Asn Pro
100 105 110 115
gac gat ccc tta gta cca gat att gca cag atc tat aaa tca gac aaa 502
Asp Asp Pro Leu Val Pro Asp Ile Ala Gln Ile Tyr Lys Ser Asp Lys
$0 120 125 130
gaa aaa tac aac agg cac gca aga gaa tgg act cag aaa tat gca atg 550
Glu Lys Tyr Asn Arg His Ala Arg Glu Trp Thr Gln Lys Tyr Ala Met
135 140 145
$$
taa agtttcaaac actttcactt acgccagagt actgtaaaat ctatgtcttt 603
tccagcgtta gcattaagcc gggcgccgtt tgccgtgtcc ttcgttccac gagccctttg 663
CA 02449417 2003-12-04
145
gtttttactcattttaagtgtgtttctgaagcaagacaaaacaaacttccaagaataccc723
tggaaactctgctgagagcatttagtattctgtgctcattgaagaggacctttctttcgg783
tttccgagacacttggaccccctgcatctccagcaagatctgtgacgtgactgagaaagc843
aaccagacgcttttctttctctgaaacgagacgtttttcacccgagaaacattgtatgtg903
ccgtccaagatgtcgtcacttttatacatctggattcagatctcattcttcgttagctca963
ctttataatttgtatttttttactgtatagactaaatatattctatgtcaactcctgact1023
cctcctccccacccccatcccccgtgaacagtattgaagctcccaacagctgatgatgaa1083
1S
ttaactgcccccgccccttgtcttagcatattctgtgggttgaatgcgtatttcttaaac1143
cggaactgatctgcacactgtatttctcagtatactgattagaatggagaaacacttgtt1203
tgggttttattgtacttgacttaactttattgcaatgtgaattaattgcactgttaggta1263
ggaaggtgtgtgactttttttgttgttgctcttcacctttgaccttttttttttttctgt1323
ataggcaatattatattgacaccttttacagatctgactgtagccttttccatataaata1383
aaatgctttttctactattaaaaaaaaaaaaaaaaaaaaaaaaa 1427
<210> 62
3~ <211> 147
<212> PRT
<213> Mus musculus
<400> 62
Met Ala Leu Lys Arg Ile Gln Lys Glu Leu Ser Asp Leu Gln Arg Asp
1 5 10 15
4~ Pro Pro Ala His Cys Ser Ala Gly Pro Val Gly Asp Asp Leu Phe His
20 25 30
Trp Gln Ala Thr Ile Met Gly Pro Pro Asp Ser Ala Tyr Gln Gly Gly
35 40 45
$~
Val Phe Phe Leu Thr Val His Phe Pro Thr Asp Tyr Pro Phe Lys Pro
50 55 60
Pro Lys Ile Ala Phe Thr Thr Lys Ile Tyr His Pro Asn Ile Asn Ser
70 75 80
Asn Gly Ser Ile Cys Leu Asp Ile Leu Arg Ser Gln Trp Ser Pro Ala
85 90 95
CA 02449417 2003-12-04
146
Leu Thr Val Ser Lys Val Leu Leu Ser Ile Cys Ser Leu Leu Cys Asp
100 105 110
Pro Asn Pro Asp Asp Pro Leu Val Pro Asp Ile Ala Gln Ile Tyr Lys
115 120 125
Ser Asp Lys Glu Lys Tyr Asn Arg His Ala Arg Glu Trp Thr Gln Lys
130 135 140
Tyr Ala Met
1$ 145
<210> 63
<211> 5581
<212> DNA
<213> Mus musculus
<220>
<221> CDS
<222> (612)..(2945)
<400> 63
cggagagcccgagcctgatgaggctcagtcctgccctggtcctcaaggtccctggtttaa 60
cttctcagcccagataccctgtgatgctgctcctacaccacctcctgcagtctctgagga 120
ccaacctactccctccctccagctgctggcctcctctaaaccaatgaatacacccggtgc 180
tgccaatccttgttccccagtgcagctctcttcctctctccttctctctcggtctctcgc 240
tctctctcgccgctgcagcctagtaggggcgcttcgtccagcatgagctcggacatggca 300
gccgacgagtcgagcgcccagtactctcggaggacgaggtatgggagttttgcctggata 360
agacagaagatggtggcggatcccccggaagtgatgttacagatacttgtgagcctccat 420
gtggatgctgggagttgaatccgaattccctggaagaggagcacgtgctgttcactgctg 480
atccgtacctggagctccacaacgatgacacacgagttgtgagagtgaaggttatagctg 540
gcataggcctggccaagaaagacatcttgggagccagtgatccttacgtaagagtgacat 600
tgtatgacccg atg acc agc 650
agt gga gtg cag
atc ctt aca aaa
act atc
$0 Met Ser Thr Ser Gln Thr
Gly Ile Val Lys
Leu Thr
Ile
1 5 10
aaa aag tct ttg aat cca aaa tgg aat gaa gaa ata ctg ttc agg gtc 698
Lys Lys Ser Leu Asn Pro Lys Trp Asn Glu Glu Ile Leu Phe Arg Val
5$ 15 20 25
ctt cca cag cga cac cgc att ctt ttc gaa gtg ttt gat gaa aac cgt 746
Leu Pro Gln Arg His Arg Ile Leu Phe Glu Val Phe Asp Glu Asn Arg
CA 02449417 2003-12-04
147
30 35 40 45
ttg acaaga gatgatttc ctaggtcaa gtggatgtc cctctctatcct 794
Leu ThrArg AspAspPhe LeuGlyGln ValAspVal ProLeuTyrPro
50 55 60
tta ccgact gaaaaccca agaatggag agaccatat acatttaaggat 842
Leu ProThr GluAsnPro ArgMetGlu ArgProTyr ThrPheLysAsp
65 70 75
ttt gttctt catccaaga agtcacaaa tcaagagtt aaaggttatctg 890
Phe ValLeu HisProArg SerHisLys SerArgVal LysGlyTyrLeu
80 85 90
aga ttaaaa atgacttat ttacctaaa aatggctca gaagatgaaaat 938
Arg LeuLys MetThrTyr LeuProLys AsnGlySer GluAspGluAsn
95 100 105
gca gaccag getgaggag ttagagcct ggctgggtt gttttggaccaa 986
Ala AspGln AlaGluGlu LeuGluPro GlyTrpVal ValLeuAspGln
110 115 120 125
cca gatget gccactcat ttgccgcat ccaccagaa ccctctccccta 1034
Pro AspAla AlaThrHis LeuProHis ProProGlu ProSerProLeu
2$ 130 135 140
cct ccagga tgggaagag aggcaggat gtccttgga aggacctactac 1082
Pro ProGly TrpGluGlu ArgGlnAsp ValLeuGly ArgThrTyrTyr
145 150 155
gta aaccat gaatctaga agaacacag tggaaaagg ccaagccctgac 1130
Val AsnHis GluSerArg ArgThrGln TrpLysArg ProSerProAsp
160 165 170
3$ gat gacctc acggatgaa gacaatgat gatatgcag ctgcaagcgcag 1178
Asp AspLeu ThrAspGlu AspAsnAsp AspMetGln LeuGlnAlaGln
175 180 185
cga gcattc accaccagg cggcagata tcggaggat gtggatggccct 1226
Arg AlaPhe ThrThrArg ArgGlnIle SerGluAsp ValAspGlyPro
190 195 200 205
gac aaccgg gagtcccct gagaattgg gaaatcgta cgagaagatgaa 1274
Asp AsnArg GluSerPro GluAsnTrp GluIleVal ArgGluAspGlu
zlo 215 220
aac accgag tatagtggt caggetgtc cagtcacct ccatcgggtcac 1322
Asn ThrGlu TyrSerGly GlnAlaVal GlnSerPro ProSerGlyHis
225 230 235
att gatgtg cagactcac cttgcagaa gagtttaat accagacttgcc 1370
Ile AspVal GlnThrHis LeuAlaGlu GluPheAsn ThrArgLeuAla
240 245 250
gtg tgtgga aatccagcc accagccag ccggttacc agctcaaatcat 1418
Val CysGly AsnProAla ThrSerGln ProValThr SerSerAsnHis
255 260 265
CA 02449417 2003-12-04
148
tcc agc aga gga ggc agc ttg cag acc tgt atc ttt gag gaa cag cct 1466
Ser Ser Arg Gly Gly Ser Leu Gln Thr Cys Ile Phe Glu Glu Gln Pro
270 275 280 285
S aca ctt cct gtg ctt ttg cct act tca tct gga ttg cca cca ggt tgg 1514
Thr Leu Pro Val Leu Leu Pro Thr Ser Ser Gly Leu Pro Pro Gly Trp
290 295 300
gaa gaa aaa caa gat gac aga gga aga tca tac tat gta gac cac aac 1562
Glu Glu Lys Gln Asp Asp Arg Gly Arg Ser Tyr Tyr Val Asp His Asn
305 310 315
tct aaa acc acc aca tgg tcc aag ccc acc atg cag gat gat cca aga 1610
Ser Lys Thr Thr Thr Trp Ser Lys Pro Thr Met Gln Asp Asp Pro Arg
1$ 320 325 330
tcg aaa atc cct get cat ctg aga gga aag act gac tcc aat gac ctg 1658
Ser Lys Ile Pro Ala His Leu Arg Gly Lys Thr Asp Ser Asn Asp Leu
335 340 345
gga ccc tta cct cca ggc tgg gaa gaa aga acc cac aca gat ggg cga 1706
Gly Pro Leu Pro Pro Gly Trp Glu Glu Arg Thr His Thr Asp Gly Arg
350 355 360 365
gtc ttc ttc ata aac cac aat ata aag aag acc cag tgg gaa gat cct 1754
Val Phe Phe Ile Asn His Asn Ile Lys Lys Thr Gln Trp Glu Asp Pro
370 375 380
cgc ctg cag aac gtg gca atc act gga cca gca gtg ccc tac tcc aga 1802
Arg Leu Gln Asn Val Ala Ile Thr Gly Pro Ala Val Pro Tyr Ser Arg
385 390 395
gat tac aag aga aag tac gag ttc ttc aga agg aag ctc aag aag cag 1850
Asp Tyr Lys Arg Lys Tyr Glu Phe Phe Arg Arg Lys Leu Lys Lys Gln
400 405 410
act gac att cca aac aaa ttt gaa atg aag ctt cgc cgc gca aac att 1898
Thr Asp Ile Pro Asn Lys Phe Glu Met Lys Leu Arg Arg Ala Asn Ile
415 420 425
ctg gag gat tct tac cgg agg att atg ggt gtg aag aga get gac ttg 1946
Leu Glu Asp Ser Tyr Arg Arg Ile Met Gly Val Lys Arg Ala Asp Leu
430 435 440 445
4S ctc aag gcc aga ctc tgg att gag ttt gat ggt gaa aag ggc ctt gac 1994
Leu Lys Ala Arg Leu Trp Ile Glu Phe Asp Gly Glu Lys Gly Leu Asp
450 455 460
tat gga ggg gtt gcc aga gag tgg ttc ttc ctc atc tcg aag gaa atg 2042
$0 Tyr Gly Gly Val Ala Arg Glu Trp Phe Phe Leu Ile Ser Lys Glu Met
465 470 475
ttc aac cct tac tac ggc ctg ttt gaa tat tct get acg gat aat tac 2090
Phe Asn Pro Tyr Tyr Gly Leu Phe Glu Tyr Ser Ala Thr Asp Asn Tyr
55 480 485 490
acc cta cag ata aat cct aac tcg ggc ttg tgt aat gaa gat cac ctc 2138
Thr Leu Gln Ile Asn Pro Asn Ser Gly Leu Cys Asn Glu Asp His Leu
CA 02449417 2003-12-04
149
495 500 505
tca tac ttc aag ttc att ggc cgt gtg get ggg atg gca gtt tat cat 2186
Ser Tyr Phe Lys Phe Ile Gly Arg Val Ala Gly Met Ala Val Tyr His
$ 510 515 520 525
ggc aag ctg ttg gat ggg ttt ttc atc cgt ccg ttt tac aag atg atg 2234
Gly Lys Leu Leu Asp Gly Phe Phe Ile Arg Pro Phe Tyr Lys Met Met
530 535 540
ctt cag aaa ctg ata aca ctg cac gac atg gag tcc gtg gat agt gaa 2282
Leu Gln Lys Leu Ile Thr Leu His Asp Met Glu Ser Val Asp Ser Glu
545 550 555
1$ tat tac agt tct ctg cga tgg att ctt gaa aat gac ccg acg gag ctg 2330
Tyr Tyr Ser Ser Leu Arg Trp Ile Leu Glu Asn Asp Pro Thr Glu Leu
560 565 570
gac ctg aga ttt atc ata gat gaa gaa ctt ttt gga cag aca cat cag 2378
Asp Leu Arg Phe Ile Ile Asp Glu Glu Leu Phe Gly Gln Thr His Gln
575 580 585
cac gaactg aaaacc ggaggatcagag attgttgtc accaataag aac 2426
His GluLeu LysThr GlyGlySerGlu IleValVal ThrAsnLys Asn
2$ 590 595 600 605
aaa aaggag tatatc taccttgtaata caatggcga tttgtgaac cgt 2474
Lys LysGlu TyrIle TyrLeuValIle GlnTrpArg PheValAsn Arg
610 615 620
atc cagaag caaatg gcagettttaaa gagggattt tttgaactg ata 2522
Ile GlnLys GlnMet AlaAlaPheLys GluGlyPhe PheGluLeu Ile
625 630 635
3$ cca caggat ctcatc aagatatttgat gaaaatgag ctagagctt ctc 2570
Pro GlnAsp LeuIle LysIlePheAsp GluAsnGlu LeuGluLeu Leu
640 645 650
atg tgtggt ctggga gatgtggatgtg aacgactgg cgggaacac aca 2618
Met CysGly LeuGly AspValAspVal AsnAspTrp ArgGluHis Thr
655 660 665
aaa tacaaa aatggc tacagcatgaac caccaggtc atccactgg ttc 2666
Lys TyrLys AsnGly TyrSerMetAsn HisGlnVal IleHisTrp Phe
4$ 670 675 680 685
tgg aagget gtttgg atgatggattcg gaaaaaaga atacgctta ctt 2714
Trp LysAla ValTrp MetMetAspSer GluLysArg IleArgLeu Leu
690 695 700
$0
cag tttgtc actggc acatcccgtgtg ccgatgaat gggtttget gaa 2762
Gln PheVal ThrGly ThrSerArgVal ProMetAsn GlyPheAla Glu
705 710 715
$$ ctc tatggc tcgaat ggaccacaatcc ttcacagtg gaacaatgg ggc 2810
Leu TyrGly SerAsn GlyProGlnSer PheThrVal GluGlnTrp Gly
720 725 730
CA 02449417 2003-12-04
150
acc cct gat aag ctg cca aga gca cac acc tgc ttc aat cgc ctg gac 2858
Thr Pro Asp Lys Leu Pro Arg Ala His Thr Cys Phe Asn Arg Leu Asp
735 740 745
ctg cca ccc tac gaa tcc ttt gac gaa ctc tgg gat aaa ctt cag atg 2906
Leu Pro Pro Tyr Glu Ser Phe Asp Glu Leu Trp Asp Lys Leu Gln Met
750 755 760 765
gca att aac aca gat tag 2955
gag cag ggc attacaaaaa
ttt gat
ggc gtt
Ala Ile Asn Thr n Gly Asp
Glu Gl Phe Asp
Gly Val
770 775
aaaacaagctgtggtgtcttgtacaccatagtttctaagcaaaagcaaaaacaaaatcac3015
attttaacattttccagatagtttctaaaagatggtcactggctcttcccaccgagacca3075
gaggacagtttatccatgatttagccaccaccatgctgacctgttcacttgtccagttac3135
tttgtccagttgttggggttcatgtgtacggcaggatgtgagtcctgtacgcctgagttc3195
ttaccctatctcatcttgctaggcacatccttctgaaactactgagattccaactgtgaa3255
atatctgtaatgagtagctggtgggaaaaatttgatgctttttaaagatgaaatttggac3315
aaagaaagtctttaatgattagtatactgcgacatacttagtaccacatgtcgctactta3375
ttctgtagacctgcctagtgtaccttatcgcctagaaccttgaagccgctttggttgatg3435
tatcacacgtgtttttagtcacttaagtcactagtgtttaaaaaaaaaaatgtactcttc3495
acttgggaagtatttcacgtttgttagcatgcagcttgagccttaacaggcgattatgga3555
gacaagtggagcaagcttttattgcagtgtgtagtgagtcttaggcctcctttttgcctg3615
tgcatcctaaggctagagtcattatgtgttagtgcgttagaattccttcaaacacgaaac3675
aagctccacaacgcagtgtttctaagcatgccgtgaagaaccgagttccatgtatgactt3735
gcccttaccagccactcttcacgcttgcagtcacgtagtacatacgtgtttacggagttc3795
attatgtttacagattaagcgaatttctgtagttgcatttttatatttttagtatcacat3855
tagtatataaaaatttgtttaaaataaccaaagagtagttcaatgcataatttgtatgaa3915
tttgttaccaagtttcttatgctttctaaaaaaatactgtttcctatgaaaattatgttt3975
aatcaaaagtcaagaacccttggggcaaaatgctacaggtggagtcccaccatagtcacc4035
tttgaggcacaggaagaggttccatgcatgaatctgcacacatgagcagtgctggctgct4095
gtgcaccgggcccttgggatgaagccatcagcactgacatccagccccgtcttcatcctc4155
aggcttagaaacaagtgggatggtgactttacagtcagtgggaactaagagcccgcagaa4215
taacaaaggcagaaggacaggaaagcgaggtccgagtccgactgcgaggtcatatctgcc4275
aaggctccttctagtcagcttacactggtgattatacggaaaatgctctagatatgagaa4335
CA 02449417 2003-12-04
1$1
aagcaatgtggcatgtaatgagttaggtaagcttgtgttataaactttccgaatgcttat4395
aagtagcctgtgggagctgtaagaaatacttggggccattgatttaagcttgttggctct4455
$ aacatgactaatacctgtcagcccatggtagggatttcagtgacagtagtggaaacgctt4515
tccacagaccacaccactatgttgatcggtgaaagacacccccaggccagtgcatgcttc4575
cagagtgtcctgatcagtcagccagcatggccaccgtccagtgttgatttttatcattag4635
ccagctgagcctgcagcacggggctcatttccccgtctggcagatgtggatagctgggcc4695
cactcattctgtctctcaaggctatggtaagttcttaaaggggtacttttctgcaagcca4755
1$ ccagagtctgagtcagctgtcccctcccagaaagcatgttcacctaaagtgatttagcct4815
aggcgaggaggatccctactacgtgctggattatgtgtgtgttcatgaaaggatttcagc4875
gtcaaaagttcacttcctccatagtggcaaaataacactaatatgggctggtgtgttatc4935
tggagtgcccccattgtgtggaactaagggtgaaaacagaacggtacacggttgttcagt4995
gtcgtccccagaactcatccccagcagggcttagaaaacacgagcttccttcctccttca5055
2$ cactcattttcctttggatgattcagtgacatcacagaacctggtgtccccctccctacc5115
ccaggtgtgtagtaatgtccgaagggaccctggctggaacaccactgccccccatgctag5175
tgcatgaaaacatctcgttatattctaccactggggcattgtggagtcacattcacgaaa5235
cacgaagaccttgtacttctctagaaaagtgttttagcctactttttctctaatccccac5295
cccaacaaatgaaacacaaaattgcattacaaaagcaaacccaaatggtatttgttttcg5355
3$ attttatttataccgctcgagttattccttatacgtatcaagttaaactcaattggtttt5415
aatgataagctatttgacattgtttttaaattttttcttatatggtaaatgtatatccag5475
atttaaggtatcgaaatttattgcataaactataaaatcattttcaaaaatctcaattcc5535
acaaataaagttctattctgattttaaaaaaaaaaaaaaaaaaaaa 5581
<210> 64
<211> 777
<212> PRT
<213> Mus musculus
<400> 64
Met Ser Gly Ile Leu Thr Ser Val Gln Thr Lys Thr Ile Lys Lys Ser
1 5 10 15
$$ Leu Asn Pro Lys Trp Asn Glu Glu Ile Leu Phe Arg Val Leu Pro Gln
20 25 30
CA 02449417 2003-12-04
152
Arg His Arg Ile Leu Phe Glu Val Phe Asp Glu Asn Arg Leu Thr Arg
35 40 45
Asp Asp Phe Leu Gly Gln Val Asp Val Pro Leu Tyr Pro Leu Pro Thr
50 55 60
Glu Asn Pro Arg Met Glu Arg Pro Tyr Thr Phe Lys Asp Phe Val Leu
65 70 75 80
1$
His Pro Arg Ser His Lys Ser Arg Val Lys Gly Tyr Leu Arg Leu Lys
85 90 95
Met Thr Tyr Leu Pro Lys Asn Gly Ser Glu Asp Glu Asn Ala Asp Gln
100 105 110
Ala Glu Glu Leu Glu Pro Gly Trp Val Val Leu Asp Gln Pro Asp Ala
115 120 125
2$ Ala Thr His Leu Pro His Pro Pro Glu Pro Ser Pro Leu Pro Pro Gly
130 135 140
Trp Glu Glu Arg Gln Asp Val Leu Gly Arg Thr Tyr Tyr Val Asn His
145 150 155 160
40
Glu Ser Arg Arg Thr Gln Trp Lys Arg Pro Ser Pro Asp Asp Asp Leu
165 170 175
Thr Asp Glu Asp Asn Asp Asp Met Gln Leu Gln Ala Gln Arg Ala Phe
180 185 190
Thr Thr Arg Arg Gln Ile Ser Glu Asp Val Asp Gly Pro Asp Asn Arg
195 200 205
Glu Ser Pro Glu Asn Trp Glu Ile Val Arg Glu Asp Glu Asn Thr Glu
210 215 220
Tyr Ser Gly Gln Ala Val Gln Ser Pro Pro Ser Gly His Ile Asp Val
225 230 235 240
Gln Thr His Leu Ala Glu Glu Phe Asn Thr Arg Leu Ala Val Cys Gly
245 250 255
Asn Pro Ala Thr Ser Gln Pro Val Thr Ser Ser Asn His Ser Ser Arg
260 265 270
CA 02449417 2003-12-04
153
10
Gly Gly Ser Leu Gln Thr Cys Ile Phe Glu Glu Gln Pro Thr Leu Pro
275 280 285
Val Leu Leu Pro Thr Ser Ser Gly Leu Pro Pro Gly Trp Glu Glu Lys
290 295 300
Gln Asp Asp Arg Gly Arg Ser Tyr Tyr Val Asp His Asn Ser Lys Thr
305 310 315 320
1$ Thr Thr Trp Ser Lys Pro Thr Met Gln Asp Asp Pro Arg Ser Lys Ile
325 330 335
Pro Ala His Leu Arg Gly Lys Thr Asp Ser Asn Asp Leu Gly Pro Leu
20 340 345 350
30
Pro Pro Gly Trp Glu Glu Arg Thr His Thr Asp Gly Arg Val Phe Phe
355 360 365
Ile Asn His Asn Ile Lys Lys Thr Gln Trp Glu Asp Pro Arg Leu Gln
370 375 380
Asn Val Ala Ile Thr Gly Pro Ala Val Pro Tyr Ser Arg Asp Tyr Lys
385 390 395 400
3$ Arg Lys Tyr Glu Phe Phe Arg Arg Lys Leu Lys Lys Gln Thr Asp Ile
405 410 415
Pro Asn Lys Phe Glu Met Lys Leu Arg Arg Ala Asn Ile Leu Glu Asp
40 420 425 430
Ser Tyr Arg Arg Ile Met Gly Val Lys Arg Ala Asp Leu Leu Lys Ala
435 440 445
Arg Leu Trp Ile Glu Phe Asp Gly Glu Lys Gly Leu Asp Tyr Gly Gly
450 455 460
SO
Val Ala Arg Glu Trp Phe Phe Leu Ile Ser Lys Glu Met Phe Asn Pro
465 470 475 480
$$ Tyr Tyr Gly Leu Phe Glu Tyr Ser Ala Thr Asp Asn Tyr Thr Leu Gln
485 490 495
CA 02449417 2003-12-04
154
Ile Asn Pro Asn Ser Gly Leu Cys Asn Glu Asp His Leu Ser Tyr Phe
500 505 510
Lys Phe Ile Gly Arg Val Ala Gly Met Ala Val Tyr His Gly Lys Leu
515 520 525
Leu Asp Gly Phe Phe Ile Arg Pro Phe Tyr Lys Met Met Leu Gln Lys
530 535 540
20
Leu Ile Thr Leu His Asp Met Glu Ser Val Asp Ser Glu Tyr Tyr Ser
545 550 555 560
Ser Leu Arg Trp Ile Leu Glu Asn Asp Pro Thr Glu Leu Asp Leu Arg
565 570 575
Phe Ile Ile Asp Glu Glu Leu Phe Gly Gln Thr His Gln His Glu Leu
580 585 590
Lys Thr Gly Gly Ser Glu Ile Val Val Thr Asn Lys Asn Lys Lys Glu
595 600 605
Tyr Ile Tyr Leu Val Ile Gln Trp Arg Phe Val Asn Arg Ile Gln Lys
610 615 620
40
Gln Met Ala Ala Phe Lys Glu Gly Phe Phe Glu Leu Ile Pro Gln Asp
625 630 635 640
Leu Ile Lys Ile Phe Asp Glu Asn Glu Leu Glu Leu Leu Met Cys Gly
645 650 655
Leu Gly Asp Val Asp Val Asn Asp Trp Arg Glu His Thr Lys Tyr Lys
660 665 670
4$ Asn Gly Tyr Ser Met Asn His Gln Val Ile His Trp Phe Trp Lys Ala
675 680 685
Val Trp Met Met Asp Ser Glu Lys Arg Ile Arg Leu Leu Gln Phe Val
$0 690 695 700
5$
Thr Gly Thr Ser Arg Val Pro Met Asn Gly Phe Ala Glu Leu Tyr Gly
705 710 715 720
Ser Asn Gly Pro Gln Ser Phe Thr Val Glu Gln Trp Gly Thr Pro Asp
725 730 735
CA 02449417 2003-12-04
155
1~
Lys Leu Pro Arg Ala His Thr Cys Phe Asn Arg Leu Asp Leu Pro Pro
740 745 750
Tyr Glu Ser Phe Asp Glu Leu Trp Asp Lys Leu Gln Met Ala Ile Glu
755 760 765
Asn Thr Gln Gly Phe Asp Gly Val Asp
770 775
15 <210> 65
<211> 455
<212> DNA
<213> Mus musculus
<220>
<221> CDS
<222> (104)..(325)
<400> 65
gtcttccgct tcctgtttgc ccggccggggttcctcgctc 60
aggcttaact gagctacgag
ttgtgtcgtc gataggttcg aca atgatt gaggtg 115
aggatattgg
agctccagcc
MetIle GluVal
1
gtt aac gac ctcgga aaa gtc gtt aagtgc aacacc 163
tgc cgt aag cgc
Val Asn Asp LeuGly Lys Val Val LysCys AsnThr
Cys Arg Lys Arg
5 10 15 20
gat acc atc gacttg aaa ctg get getcaa actggc 211
gac ggc aag ata
Asp Thr Ile AspLeu Lys Leu Ala AlaGln ThrGly
Asp Gly Lys Ile
25 30 35
acc tgg aac atcgtt aaa aag tac acgatt tttaag 259
cgc aag ctt tgg
Thr Trp Asn IleVal Lys Lys Tyr ThrIle PheLys
Arg Lys Leu Trp
40 45 50
gac gtg tct ggagat gaa atc gat gggatg aacctg 307
cac ctg tat cac
4S Asp Val Ser GlyAsp Glu Ile Asp GlyMet AsnLeu
His Leu Tyr His
55 60 65
gag tat tac tagagggggattc cttctcctcc 355
ctt cag tcgccctgct
Glu Tyr Tyr
Leu Gln
70
ctgccctgcc ctcctctccc gacactggtgtagatggtca ttttaacag
415
atcctcatct t
ttcacatgaa tgctgctgtc 455
taaaaacttg
gctgctgctt
<210> 66
<2I1> 73
CA 02449417 2003-12-04
156
<212> PRT
<213> Mus musculus
<400> 66
Met Ile Glu Val Val Cys Asn Asp Arg Leu Gly Lys Lys Val Arg Val
1 5 10 15
Lys Cys Asn Thr Asp Asp Thr Ile Gly Asp Leu Lys Lys Leu Ile Ala
25 30
Ala Gln Thr Gly Thr Arg Trp Asn Lys Ile Val Leu Lys Lys Trp Tyr
IS 35 40 45
25
Thr Ile Phe Lys Asp His Val Ser Leu Gly Asp Tyr Glu Ile His Asp
50 55 60
Gly Met Asn Leu Glu Leu Tyr Tyr Gln
65 70
<210> 67
<211> 1871
<212> DNA
<213> Mus musculus
<220>
<221> CDS
<222> (93)..(1268)
<400> 67
aaagacgcca agtgtcgttg gacggctgcg tcgccgcccg ttcggcatcc
60
tgtggtctca
ctgagcgcag tcgagccgcc ac atggagccc gagccacag ccc 113
agcgacgcag
MetGluPro GluProGln Pro
1 5
gag gtc acgctg ctggtgaag agtcccaatcag cgccaccgc gac 161
ccg
Glu Val ThrLeu LeuValLys SerProAsnGln ArgHisArg Asp
Pro
l0 15 20
ttg ctg agtggc gaccgcagt tggagtgtgagt cgcctcaag gcc 209
gag
Leu Leu SerGly AspArgSer TrpSerValSer ArgLeuLys Ala
Glu
25 30 35
cac agc cgagtc taccccgag cgcccgcgtcca gaggaccag agg 257
ctg
His Ser ArgVal TyrProGlu ArgProArgPro GluAspGln Arg
Leu
40 45 50 55
tta tat tctggg aagctgctg ttggatcaccag tgtctccaa gat 305
att
Leu Tyr SerGly LysLeuLeu LeuAspHisGln CysLeuGln Asp
Ile
60 65 70
CA 02449417 2003-12-04
157
ttg ctt cca aag cag gaa aag cga cat gtt ttg cac ctt gtg tgc aat 353
Leu Leu Pro Lys Gln Glu Lys Arg His Val Leu His Leu Val Cys Asn
75 80 85
S gtg aag aat ccc tcc aaa atg cca gaa acc agc aca aag ggt get gaa 401
Val Lys Asn Pro Ser Lys Met Pro Glu Thr Ser Thr Lys Gly Ala Glu
90 95 100
tcc aca gag cag ccg gac aac tct aat cag aca cag cat cct ggg gac 449
Ser Thr Glu Gln Pro Asp Asn Ser Asn Gln Thr Gln His Pro Gly Asp
105 110 115
tcc tca agt gat ggt tta cgg caa aga gaa gtt ctt cgg aac ctt tct 497
Ser Ser Ser Asp Gly Leu Arg Gln Arg Glu Val Leu Arg Asn Leu Ser
120 125 130 135
ccc tcc gga tgg gag aac atc tct agg cct gag get gtc cag cag act 545
Pro Ser Gly Trp Glu Asn Ile Ser Arg Pro Glu Ala Val Gln Gln Thr
140 145 150
ttc caa ggc ctg ggg cct ggc ttc tct ggc tac aca acg tat ggg tgg 593
Phe Gln Gly Leu Gly Pro Gly Phe Ser Gly Tyr Thr Thr Tyr Gly Trp
155 160 165
ctg cag ctc tcc tgg ttc cag cag atc tat gca agg cag tac tac atg 641
Leu Gln Leu Ser Trp Phe Gln Gln Ile Tyr Ala Arg Gln Tyr Tyr Met
170 175 180
caa tac tta get gcc act get gca tca gga act ttt gtc ccg aca cca 689
Gln Tyr Leu Ala Ala Thr Ala Ala Ser Gly Thr Phe Val Pro Thr Pro
185 190 195
agt gca caa gag ata cct gtg gtc tct aca cct get ccg get cct ata 737
Ser Ala Gln Glu Ile Pro Val Val Ser Thr Pro Ala Pro Ala Pro Ile
200 205 210 215
cac aac cag ttt ccg gca gaa aac cag ccg gcc aat cag aat gca get 785
His Asn Gln Phe Pro Ala Glu Asn Gln Pro Ala Asn Gln Asn Ala Ala
220 225 230
get caa gcg gtt gtc aat ccc gga gcc aat cag aac ttg cgg atg aat 833
Ala Gln Ala Val Val Asn Pro Gly Ala Asn Gln Asn Leu Arg Met Asn
235 240 245
gca caa ggt ggc ccc ctg gtg gag gaa gat gat gag ata aac cga gac 881
Ala Gln Gly Gly Pro Leu Val Glu Glu Asp Asp Glu Ile Asn Arg Asp
250 255 260
tgg ttg gat tgg acc tat tcc gca gcg acg ttt tct gtt ttc ctc agc 929
SO Trp Leu Asp Trp Thr Tyr Ser Ala Ala Thr Phe Ser Val Phe Leu Ser
265 270 275
atc ctt tac ttc tac tcc tcg ctg agc aga ttt ctc atg gtc atg ggt 977
Ile Leu Tyr Phe Tyr Ser Ser Leu Ser Arg Phe Leu Met Val Met Gly
5$ 280 285 290 295
gcc act gta gtc atg tac ctg cac cac gtc ggg tgg ttt ccg ttc aga 1025
Ala Thr Val Val Met Tyr Leu His His Val Gly Trp Phe Pro Phe Arg
CA 02449417 2003-12-04
158
300 305 310
cag agg cca gtt cag aac ttc ccg gat gat ggt ggt cct cga gat get 1073
Gln Arg Pro Val Gln Asn Phe Pro Asp Asp Gly Gly Pro Arg Asp Ala
315 320 325
gcc aac cag gac ccc aac aat aac ctc cag gga ggt atg gac cca gaa 1121
Ala Asn Gln Asp Pro Asn Asn Asn Leu Gln Gly Gly Met Asp Pro Glu
330 335 340
atg gaa gac ccc aac cgc ctc ccc cca gac cgc gaa gtg ctg gac cct 1169
Met Glu Asp Pro Asn Arg Leu Pro Pro Asp Arg Glu Val Leu Asp Pro
345 350 355
1$ gag cac agc ccc tcg ttt agc aca tgg cta ttc aag 1217
acc atg gca gtc
Glu His Ser Thr Trp Leu Phe Lys
Thr Ser Ala Val
Pro Ser
Phe Met
360 365 370 375
act ttc gcc tct ctt ctt gaa ggc cca gcc gcc aac 1265
ttt cca cca cta
Thr Phe Ala Ser Leu Leu Glu Gly Pro Ala Ala Asn
Phe Pro Pro Leu
380 385 390
tga tggcccttgt gctctgtcgc cttt gacagctcgg cgt 1318
tggtgg actggat
ctggctccggctccttttcc tcccctggcgtggactcgacagagtcattgaaaacccaca1378
ggatgacatgtgcttctgtg ccaagcaaaagcacaaactaagacatgaagccgtggtaca1438
aactgaacagggcccctcat gtcgttattctgaagagctttaatgtatactgtatgtagt1498
ttcataggcactgtaagcag aaggcccagggtcgcatgttctgcctgagcacctccccag1558
atgtgtgtgcatgtgtgctg tacatggaagtcatagacgtgtgtgcatgtgtgctctaca1618
3$ tggaagtcatagatgcagaa acggttctgctggttcgatttgattcctgttggaatgttc1678
aaattacactaagtgtacta ctttatataatcagtgaattgctagacatgttagcaggac1738
ttttctaggagagacttatg tataattgctttttaaaatgcagtgctttcctttaaaccg1798
agggtggcgacttggcagag gtaaaacctttgccgagttttctgttcaataaagttttgc1858
tatgaatgactgt 1871
<220> 68
<211> 391
<212> PRT
<213> Mus musculus
SO
<400> 68
$5
Met Glu Pro Glu Pro Gln Pro Glu Pro Val Thr Leu Leu Val Lys Ser
1 5 10 15
Pro Asn Gln Arg His Arg Asp Leu Glu Leu Ser Gly Asp Arg Ser Trp
20 25 30
CA 02449417 2003-12-04
159
Ser Val Ser Arg Leu Lys Ala His Leu Ser Arg Val Tyr Pro Glu Arg
35 40 45
Pro Arg Pro Glu Asp Gln Arg Leu Ile Tyr Ser Gly Lys Leu Leu Leu
50 55 60
Asp His Gln Cys Leu Gln Asp Leu Leu Pro Lys Gln Glu Lys Arg His
65 70 75 80
1$ Val Leu His Leu Val Cys Asn Val Lys Asn Pro Ser Lys Met Pro Glu
85 90 95
Thr Ser Thr Lys Gly Ala Glu Ser Thr Glu Gln Pro Asp Asn Ser Asn
loo l05 llo
Gln Thr Gln His Pro Gly Asp Ser Ser Ser Asp Gly Leu Arg Gln Arg
115 120 125
Glu Val Leu Arg Asn Leu Ser Pro Ser Gly Trp Glu Asn Ile Ser Arg
130 135 140
Pro Glu Ala Val Gln Gln Thr Phe Gln Gly Leu Gly Pro Gly Phe Ser
145 150 155 160
Gly Tyr Thr Thr Tyr Gly Trp Leu Gln Leu Ser Trp Phe Gln Gln Ile
165 170 175
Tyr Ala Arg Gln Tyr Tyr Met Gln Tyr Leu Ala Ala Thr Ala Ala Ser
180 185 190
Gly Thr Phe Val Pro Thr Pro Ser Ala Gln Glu Ile Pro Val Val Ser
195 200 205
Thr Pro Ala Pro Ala Pro Ile His Asn Gln Phe Pro Ala Glu Asn Gln
210 215 220
Pro Ala Asn Gln Asn Ala Ala Ala Gln Ala Val Val Asn Pro Gly Ala
225 230 235 240
S$ Asn Gln Asn Leu Arg Met Asn Ala Gln Gly Gly Pro Leu Val Glu Glu
245 250 255
CA 02449417 2003-12-04
160
Asp Asp Glu Ile Asn Arg Asp Trp Leu Asp Trp Thr Tyr Ser Ala Ala
260 265 270
Thr Phe Ser Val Phe Leu Ser Ile Leu Tyr Phe Tyr Ser Ser Leu Ser
275 280 285
Arg Phe Leu Met Val Met Gly Ala Thr Val Val Met Tyr Leu His His
290 295 300
20
Val Gly Trp Phe Pro Phe Arg Gln Arg Pro Val Gln Asn Phe Pro Asp
305 310 315 320
Asp Gly Gly Pro Arg Asp Ala Ala Asn Gln Asp Pro Asn Asn Asn Leu
325 330 335
Gln Gly Gly Met Asp Pro Glu Met Glu Asp Pro Asn Arg Leu Pro Pro
340 345 350
Asp Arg Glu Val Leu Asp Pro Glu His Thr Ser Pro Ser Phe Met Ser
355 360 365
Thr Ala Trp Leu Val Phe Lys Thr Phe Phe Ala Ser Leu Leu Pro Glu
370 375 380
Gly Pro Pro Ala Leu Ala Asn
385 390
<210> 69
<211> 4451
<212> DNA
<213> Mus musculus
<220>
<221> CDS
<222> (305)..(1642)
<400> 69
cgagttcgacgaggacgaggagtgcagcgaggaggacagcggcgccgaggaggaggagga60
cgacgacgaggacgagccggacgatgataacctggatctgggcgaggtggagctggtgga120
gcccgggctgggcgtcggcggggagcgagacggactgctgtgcggggagactggcggtgg180
cggcggcagcgctctgggtccgggaggcggcggcggcggtggcggtggcggcggcggccc240
gggacacgagcaggaggaggattaccgctacgaggtgctcacggccgaacagatcctgca300
gcac atg g gaa atc cgg gtc aac 349
gt tgt gag gag gtc
atc cag
aat cca
CA 02449417 2003-12-04
161
Met Val Glu Cys Ile Arg Glu Val Asn Glu Val Ile Gln Asn Pro
1 5 10 15
gca act atc acg aga ata ctc ctt agc cac ttc aat tgg gat aaa gag 397
$ Ala Thr Ile Thr Arg Ile Leu Leu Ser His Phe Asn Trp Asp Lys Glu
20 25 30
aag cta atg gaa agg tac ttt gat gga aac ctg gag aag ctc ttt get 445
Lys Leu Met Glu Arg Tyr Phe Asp Gly Asn Leu Glu Lys Leu Phe Ala
1~ 35 40 45
1$
gag tgt cat gta att aat cca agt aaa aag tct cga act cgc cag atg 493
Glu Cys His Val Ile Asn Pro Ser Lys Lys Ser Arg Thr Arg Gln Met
50 55 60
aat aca agg tca tcg gca cag gat atg ccg tgt cag atc tgc tac ttg 541
Asn Thr Arg Ser Ser Ala Gln Asp Met Pro Cys Gln Ile Cys Tyr Leu
65 70 75
20 aac tac cct aac tcg tat ttt act ggc ctt gaa tgt gga cat aag ttt 589
Asn Tyr Pro Asn Ser Tyr Phe Thr Gly Leu Glu Cys Gly His Lys Phe
80 85 90 95
tgt atg cag tgc tgg agt gaa tat tta act aca aaa ata atg gag gaa 637
2$ Cys Met Gln Cys Trp Ser Glu Tyr Leu Thr Thr Lys Ile Met Glu Glu
100 105 110
ggc atg ggg cag act att tcg tgt cct gcg cat ggt tgt gat atc tta 685
Gly Met Gly Gln Thr Ile Ser Cys Pro Ala His Gly Cys Asp Ile Leu
3~ 115 120 125
gtg gat gac aac aca gtt atg cgc ctg atc aca gat tcc aaa gtt aag 733
Val Asp Asp Asn Thr Val Met Arg Leu Ile Thr Asp Ser Lys Val Lys
130 135 140
3$
tta aaa tat caa cat tta ata aca aat agc ttt gta gag tgc aac cga 781
Leu Lys Tyr Gln His Leu Ile Thr Asn Ser Phe Val Glu Cys Asn Arg
145 150 155
40 ctg tta aag tgg tgt cct gcc cca gat tgc cac cat gtt gtt aaa gtc 829
Leu Leu Lys Trp Cys Pro Ala Pro Asp Cys His His Val Val Lys Val
160 165 170 175
cag tat cct gat gca aaa cca gtt cgc tgc aaa tgt ggc cgc cag ttt 877
4$ Gln Tyr Pro Asp Ala Lys Pro val Arg Cys Lys Cys Gly Arg Gln Phe
180 185 190
tgc ttt aac tgt ggt gaa aat tgg cat gat cca gtt aaa tgt aag tgg 925
Cys Phe Asn Cys Gly Glu Asn Trp His Asp Pro Val Lys Cys Lys Trp
$~ 195 200 205
ttg aag aag tgg att aaa aag tgt gat gat gac agt gaa act tct aat 973
Leu Lys Lys Trp Ile Lys Lys Cys Asp Asp Asp Ser Glu Thr Ser Asn
210 215 220
$$
tgg att gca get aac aca aag gaa tgt ccc aaa tgc cat gtc aca att 1021
Trp Ile Ala Ala Asn Thr Lys Glu Cys Pro Lys Cys His Val Thr Ile
225 230 235
CA 02449417 2003-12-04
162
gag aag gat ggc ggt tgt aat cac atg gtc tgt cgt aac cag aac tgt 1069
Glu Lys Asp Gly Gly Cys Asn His Met Val Cys Arg Asn Gln Asn Cys
240 245 250 255
aaa gca gaa ttt tgc tgg gtg tgt ctt ggc cct tgg gaa ccg cat gga 1117
Lys Ala Glu Phe Cys Trp Val Cys Leu Gly Pro Trp Glu Pro His Gly
260 265 270
tct gcc tgg tac aac tgt aac cgc tat aat gag gat gat gca aag gca 1165
Ser Ala Trp Tyr Asn Cys Asn Arg Tyr Asn Glu Asp Asp Ala Lys Ala
275 280 285
gca aga gat gcc caa gag cga tct agg gcg gcc ctg cag aga tac ctg 1213
1$ Ala Arg Asp Ala Gln Glu Arg Ser Arg Ala Ala Leu Gln Arg Tyr Leu
290 295 300
ttc tac tgt aat cgc tat atg aac cac atg cag agt cta cgc ttc gag 1261
Phe Tyr Cys Asn Arg Tyr Met Asn His Met Gln Ser Leu Arg Phe Glu
2~ 305 310 315
2$
cat aag ctg tat get cag gtg aaa cag aag atg gag gag atg cag cag 1309
His Lys Leu Tyr Ala Gln Val Lys Gln Lys Met Glu Glu Met Gln Gln
320 325 330 335
cac aac atg tcc tgg atc gag gtg cag ttc ctg aag aaa gca gtt gat 1357
His Asn Met Ser Trp Ile Glu Val Gln Phe Leu Lys Lys Ala Val Asp
340 345 350
30 gtc ctc tgc cag tgt cgt gcc aca ctc atg tac act tat gtc ttc get 1405
Val Leu Cys Gln Cys Arg Ala Thr Leu Met Tyr Thr Tyr Val Phe Ala
355 360 365
ttc tac ctc aaa aag aat aac cag tcc att atc ttt gag aat aat caa 1453
3$ Phe Tyr Leu Lys Lys Asn Asn Gln Ser Ile Ile Phe Glu Asn Asn Gln
370 375 380
gca gat cta gaa aat gcc aca gag gtg ctt tcg ggc tac ctt gaa cga 1501
Ala Asp Leu Glu Asn Ala Thr Glu Val Leu Ser Gly Tyr Leu Glu Arg
4~ 385 390 395
4$
gat att tcc caa gat tct ctg caa gat ata aag cag aaa gtc caa gat 1549
Asp Ile Ser Gln Asp Ser Leu Gln Asp Ile Lys Gln Lys Val Gln Asp
400 405 410 415
aag tac aga tac tgt gag agt cga cga agg gtt ttg tta cag cat gtg 1597
Lys Tyr Arg Tyr Cys Glu Ser Arg Arg Arg Val Leu Leu Gln His Val
420 425 430
$~ cat gaa ggc tat gaa aaa gat ctg tgg gag tac att gag gac tga 1642
His Glu Gly Tyr Glu Lys Asp Leu Trp Glu Tyr Ile Glu Asp
435 440 445
gactggccct gcataaaatg aactctgaaa actttaccat ctagagtgct catgcaatta 1702
$$
aaacaaacac aaacaaggag gcactaagcc tgttctgaca ccgctggtct gtagtaccag 1762
aattctgttt tgttaacgga aagtttaagt aaattatatt gtaataaaaa aggtagataa 1822
CA 02449417 2003-12-04
163
accattgtacaacagtattctaggccgccaacaaagtgtgacagacacacaaaagccctc1882
caactttaacttgtaacgtagcttcattctcaacgctgacttcctttttctttttcctga1942
S
gtgtagtacagttaaaatttcaatagctccttgacactgcttttcatgtccaaaccagcc2002
attttgttgtactttggtaaaggacctcttccccttcctcccctgcacatacacacctcc2062
acacacagttggattcactttctctcataccctcaggtcatgagtgaataatgattatta2122
gctacttgtaaaggaaattctttggagggagaaggggataggcagcaagaggattaaaaa2182
acaaaaaacacaaaaactttgtatatgacttttaaaacaagaggacaacacagtattttt2242
1S
caaaattgtatatagcgcatatgcatggataaagcaagcgtggcacgtgtttgcataatg2302
tttaattacaaaaatatttattctttaaaaagcttcaagattatgtctatttgctgtgca2362
ttttctttcagttggctttatctttctagggttgggttgggataaaggtgtttgttaagc2422
ccctctgcaagacctaactagagtgctttccccctcctgaggtcagtttgccctttgtgg2482
tttggttgtatcttttgctggccatgggcctcatgcctagaattctccgcttctggatct2542
2S
agatccaggaagtcacattctaagcaaatgcctcggcctgttaaagggtttagttgcttc2602
agttcatgaatgatcctatcccagcctactcctctgtggccttgacgcccccattccagc2662
3~ ctgtgtgcccacaccacgcacactgcctgccgtaggctttctaggcttcccatcacatct2722
cggggaggcatttcaaagtttcttttcctgttttatttttcctgaattgctgctttgagc2782
cttttaaattttagttatggctcgtctctcatcccttctttatgttagggtgttgaatac2842
3S
aatgttttcactttaaatataaataaatagccattcacttagtctgagattgtgaattaa2902
aatggtggatactgaaattacttgtgtgtgttgcggtgggttcagtttgaaggcaaacac2962
40 cactagaacatgatactcccatccagtacatttgagtaggaatcactgagttttgcttct3022
tttctattgtcagcatataggagaataatgcattttagctgtgatgtccatttttatgaa3082
atttctactaaaagctatgttaaaagtaaaggatggtggtggttttattaactatatact3142
4S
tgtttaggccattctgcctgtggtatttttcaacaggtcagcatccctaagactgtcagt3202
tttatataagagtgcagagtgaactaggcaactagatcaagaggtaaaactattaaatgc3262
S~ cagttttggctgaggacctctttgtcttcctttaactgtcctgtgcctagggagtgttta3322
ccatttgtgaggcagccgtgcctgctcttgcagtgtacatcttattactccattgggaag3382
taggctcactttcctctggctttttgcctaagttaggctttgctgaatcaccctactttt3442
SS
ccttttagaaaggttgttacatgagatgtacttgcaactgttcttttcccatcagaaatc3502
agtgaatgtttgctgagtatattatgctgcttcctcaaaccacttgtcgctttaggatca3562
CA 02449417 2003-12-04
164
acttgtatctttttcttccctttccttgtcacctcaggtggcaaatctgaagtcaagtgt3622
ctgcttttccattttctctatcccctatcattctcccattatccatttgactttatttta3682
aataattgcatcaatcttaagacctttatcaacaccaaggagatttcaaagaaagctcaa3742
gtaagttccttttcctggtgactttgaaaagcgaccagaattgtcacatagatatatgtg3802
gtcccttaaaatgctttgtgtatgtggtgtttaaaaagagttgacttcacagtatctagg3862
tctgagtgtcataagttctcttcatgctctgccctgcaacaagcgtccaaaaaagagtgt3922
gcatctcatagtctcagtccccaccacggagggatagtgtagttggtgacactttctagt3982
cccacatgggacctgaggatattgcactcacaatttgtgtggatcaaggggaactggctc4042
ttctgctacatccaagtttttaacaaccgtctccatatctgacagcatttccagaattta4102
cctgcctttgtcagtagctagcttcagtgctcccagctgggacaggcaagccatattgtt4162
aacagcttccctatttgacctacccaagtctctcagagggctctacttaaacatcagggt4222
ctccctgtgttgttgagatcagttacattgtcagtgcatgcttcatttgagcaattcatt4282
gagcaacaggtgaattttcaatgatttacaataaaattttgatccaaagctcaggagaca4342
taccatagtggtaaatggagtagcatataacattaccagactctaaattctttgtaattt4402
gctgcaacccagattgtatatgttttatgtgtgttcaaataaatatatt 4451
<210> 70
<211> 445
<212> PRT
<213> Mus musculus
<400> 70
Met Val Glu Cys Ile Arg Glu Val Asn Glu Val Ile Gln Asn Pro Ala
1 5 10 15
Thr Ile Thr Arg Ile Leu Leu Ser His Phe Asn Trp Asp Lys Glu Lys
20 25 30
Leu Met Glu Arg Tyr Phe Asp Gly Asn Leu Glu Lys Leu Phe Ala Glu
35 40 45
Cys His Val Ile Asn Pro Ser Lys Lys Ser Arg Thr Arg Gln Met Asn
50 55 60
Thr Arg Ser Ser Ala Gln Asp Met Pro Cys Gln Ile Cys Tyr Leu Asn
70 75 80
CA 02449417 2003-12-04
16$
Tyr Pro Asn Ser Tyr Phe Thr Gly Leu Glu Cys Gly His Lys Phe Cys
85 90 95
Met Gln Cys Trp Ser Glu Tyr Leu Thr Thr Lys Ile Met Glu Glu Gly
100 105 110
Met Gly Gln Thr Ile Ser Cys Pro Ala His Gly Cys Asp Ile Leu Val
115 120 125
Asp Asp Asn Thr Val Met Arg Leu Ile Thr Asp Ser Lys Val Lys Leu
1$ 130 135 140
2$
Lys Tyr Gln His Leu Ile Thr Asn Ser Phe Val Glu Cys Asn Arg Leu
145 150 155 160
Leu Lys Trp Cys Pro Ala Pro Asp Cys His His Val Val Lys Val Gln
165 170 175
Tyr Pro Asp Ala Lys Pro Val Arg Cys Lys Cys Gly Arg Gln Phe Cys
180 185 190
Phe Asn Cys Gly Glu Asn Trp His Asp Pro Val Lys Cys Lys Trp Leu
195 200 205
Lys Lys Trp Ile Lys Lys Cys Asp Asp Asp Ser Glu Thr Ser Asn Trp
3$ 210 215 220
4$
Ile Ala Ala Asn Thr Lys Glu Cys Pro Lys Cys His Val Thr Ile Glu
225 230 235 240
Lys Asp Gly Gly Cys Asn His Met Val Cys Arg Asn Gln Asn Cys Lys
245 250 255
Ala Glu Phe Cys Trp Val Cys Leu Gly Pro Trp Glu Pro His Gly Ser
260 265 270
$0 Ala Trp Tyr Asn Cys Asn Arg Tyr Asn Glu Asp Asp Ala Lys Ala Ala
275 280 285
Arg Asp Ala Gln Glu Arg Ser Arg Ala Ala Leu Gln Arg Tyr Leu Phe
$$ 290 295 300
Tyr Cys Asn Arg Tyr Met Asn His Met Gln Ser Leu Arg Phe Glu His
CA 02449417 2003-12-04
166
305 310 315 320
Lys Leu Tyr Ala Gln Val Lys Gln Lys Met Glu Glu Met Gln Gln His
$ 325 330 335
Asn Met Ser Trp Ile Glu Val Gln Phe Leu Lys Lys Ala Val Asp Val
340 345 350
Leu Cys Gln Cys Arg Ala Thr Leu Met Tyr Thr Tyr Val Phe Ala Phe
355 360 365
1$
Tyr Leu Lys Lys Asn Asn Gln Ser Ile Ile Phe Glu Asn Asn Gln Ala
370 375 380
Asp Leu Glu Asn Ala Thr Glu Val Leu Ser Gly Tyr Leu Glu Arg Asp
385 390 395 400
Ile Ser Gln Asp Ser Leu Gln Asp Ile Lys Gln Lys Val Gln Asp Lys
2$ 405 410 415
Tyr Arg Tyr Cys Glu Ser Arg Arg Arg Val Leu Leu Gln His Val His
420 425 430
Glu Gly Tyr Glu Lys Asp Leu Trp Glu Tyr Ile Glu Asp
435 440 445
3$
<210> 71
<211> 3314
<212> DNA
<213> Mus musculus
<220>
<221> CDS
<222> (51)..(767)
4$
<400> 71
gcggtgcgcgaggactgggg gcacggccgc cgccgccgcg atggcc 56
ccgcggcccc
MetAla
1
$0
cag cag atg agc tcgcag aaagccctgatg cttgagctgaaa 104
cag acc
Gln Gln Met Ser SerGln LysAlaLeuMet LeuGluLeuLys
Gln Thr
5 10 15
$$ tcc ctg gag ccg gtggag ggcttccggatc accctggtggat 152
cag gaa
Ser Leu Glu Pro ValGlu GlyPheArgIle ThrLeuValAsp
Gln Glu
20 25 30
CA 02449417 2003-12-04
167
gag tcc gac ctc tac aac tgg gag gtg gcc atc ttc gga ccc cct aac 200
Glu Ser Asp Leu Tyr Asn Trp Glu Val Ala Ile Phe Gly Pro Pro Asn
35 40 45 50
acc ctc tac gaa ggc ggc tac ttc aag gca cat att aag ttt cct att 248
Thr Leu Tyr Glu Gly Gly Tyr Phe Lys Ala His Ile Lys Phe Pro Ile
55 60 65
gat tac cca tat tca cca cct acc ttc aga ttc ttg acc aaa atg tgg 296
Asp Tyr Pro Tyr Ser Pro Pro Thr Phe Arg Phe Leu Thr Lys Met Trp
70 75 80
cac ccc aac att tat gag aat gga gat gta tgc att tca att ctt cat 344
His Pro Asn Ile Tyr Glu Asn Gly Asp Val Cys Ile Ser Ile Leu His
85 90 95
ccg cct gta gat gac ccg cag agt gga gag cta ccc tct gaa agg tgg 392
Pro Pro Val Asp Asp Pro Gln Ser Gly Glu Leu Pro Ser Glu Arg Trp
100 105 110
aac cct act cag aac gtt agg act atc ctg tta agt gtg atc tca ctg 440
Asn Pro Thr Gln Asn Val Arg Thr Ile Leu Leu Ser Val Ile Ser Leu
115 120 125 130
ctt aat gag ccc aac acc ttt tct cca gcc aat gtg gat get tca gtc 488
Leu Asn Glu Pro Asn Thr Phe Ser Pro Ala Asn Val Asp Ala Ser Val
135 140 145
atg ttc agg aaa tgg agg gac agc aaa gga aaa gac aag gaa tat get 536
Met Phe Arg Lys Trp Arg Asp Ser Lys Gly Lys Asp Lys Glu Tyr Ala
150 155 160
gag atc att agg aaa cag gtc tca gcc act aaa get gag gcg gag aag 584
Glu Ile Ile Arg Lys Gln Val Ser Ala Thr Lys Ala Glu Ala Glu Lys
165 170 175
gat gga gtg aag gtc ccc aca acc ctg gca gaa tac tgc atc aaa act 632
Asp Gly Val Lys Val Pro Thr Thr Leu Ala Glu Tyr Cys Ile Lys Thr
180 185 190
aaa gtg cct tcc aat gac aac agc tca gat ttg ctt tat gac gac ttg 680
Lys Val Pro Ser Asn Asp Asn Ser Ser Asp Leu Leu Tyr Asp Asp Leu
195 200 205 210
4S tat gac gac gac att gat gat gaa gat gaa gag gaa gaa gat gcc gac 728
Tyr Asp Asp Asp Ile Asp Asp Glu Asp Glu Glu Glu Glu Asp Ala Asp
215 220 225
tgt tat gat gat gat gat tct gga aat gag gag tcg tga catgttcctt 777
Cys Tyr Asp Asp Asp Asp Ser Gly Asn Glu Glu Ser
230 235
cagtgcccct gtactgcccg gacgtctcag gccaaaggga gggagcaagt ggggatctac 837
$$ agtggccact cagcaaaaac ttactcccgg ggcggggaag caaacagccc ctgctgaccc 897
tttgcggatc tcagtttgct ccttttatgg acctttactg gagagagttc cctccacaga 957
CA 02449417 2003-12-04
168
atgtctgaagtcttgcattctttcccttccatcactgtattgattcttttttaaaaacag1017
ccaccacccctcaaactcccacctcacctcatctctgcagaatgttcacagcaaaacacc1077
tttgtctgtttttagattcttgaagaattagtctgttcaagacattgtgtttaaagctgg1137
gagcccactgggagtccacaagtgctgcatatattgggtagcaaaagaaaatgggaaaaa1197
aagaaaaaaaaaaaacaacaaaaccaaaaaaaaaataaaataaaaaaataaaaataaaaa1257
aagcccacaaaacaaacttaaaaaaaaaaaaaagccaatttgccaagggttagctgctcc1317
tttccattagcgtgtgtgcatctgttcagccccgtggtggtaagttttgtttctttccct1377
1$tcctaaggctgggctgcggtgggcatcagggacttactctcgctaagtctgatgaaatgt1437
gctgcctcagtgacaccatcccaacatggaggctgcagctactctaaggagctatcagat1497
tttgttttttggaattgattgggatctgaaagcctgaaataaatattcatactttacata1557
gaaccgagcacttggttgctatttattttaaaggtgggataactttttccaccagaaagt1617
gggggaggggaggtggttagtgtgtgtgcgttcctggttctgaaaccacagaaggcctat1677
25cccagtgttggctgatgcctcgggggaaggaagagtgagggctgcggcgggaggatgcag1737
cccaggtactcataagagggttgatttaagtagccactttaattactcagtgttagtcct1797
acatgcatgggttaagattgtgctgtctttgagctgcgtatcttgatagtgacaactgtg1857
gatgtgtgcagcttgggactggtccttttcctcactggagatgatctggacttcttgtac1917
tttggccaaggagtgcaagcagaaatggtgtgcggagcttcccctggccccagctgactc1977
35caggcagccttgtttcctgggtgtcagtcacacgtggctcccccaagcctgagctccggt2037
agcttcatcctagacttgaaagagggttttgtttagcaaactgtctaagtaaagccagac2097
ttcaaggatagggcttaagattcgtgtgtgccagggtcacagctcggaaccaaagggcag2157
agggaaactgggaaggactgaccctctggttaagtagacagaccatgcttcctcctctca2217
tggttccctttcctttctgatctcagggttttcattctctcttcacactcctgaacgaat2277
45gctatttccctggcttcaaaagttcggtctgttatcaaatgagaatgtttagtggtgaac2337
agtgaaatttagtgagtttacagtcagggctgtacctgagtctcctgactcaggaacaca2397
gtaaagagacatttcgagtttgttgctcccagatagcctgcagatagatgtacagccaaa2457
tcctctctgatcctccttccccagtgcccacctgcctaccactgaaagttcaatagccag2517
ttgtttggccttactctcttggcaccctaaaactaaccctttccatactaaagcacccca2577
55gtcaagggcaggttaggcacctggccagtgggaggccccgctggcctgtggtgcgtgtta2637
actcggaggcagagaggcaagaggaagtgggcctcagcctgtggtgggggtggtcagttc2697
CA 02449417 2003-12-04
169
caaggctgtgtggacttaggcagcccagatgctgcagtctaaactgagttaacatgcaca2757
cacttaggtccctgaacacctgtcctgtgggaaaagccttgagtgcattaattttccctt2817
$ ttgggaatagatagttttggggtgcaagtagaagttttgagcagttgtgctgtttgcctg2877
gtgtgagatgaacgtgactcctctgggtctatccaggcctcgctgagtgcgtgctcttta2937
tcctgatcccactgttgcccctccctctccgtcgcccggctttctcattctagaactctc2997
ttaaccacactacgtttgtaatcacttctccctcctggcctggccaccatttgctgggtc3057
cctcgtgtttgatcctggccactggaaggggaattgccccctccccagccctcatcaacc3117
1$ aggtttacatttacaactttaaaagattcagatgcaatttcaactgaaaccagcagacat3177
cctgaccttactagttttcttagttttcattgtagatggtttttcagtttaacgaatgag3237
aagtttatctgatgctttttgttggcttcccctttagtggtttgtctctttctgcccacc3297
tgtctaataaaactgtg 3314
<210> 72
2$ <211> 238
<212> PRT
<213> Mus musculus
<400> 72
Met Ala Gln Gln Gln Met Thr Ser Ser Gln Lys Ala Leu Met Leu Glu
1 5 10 15
3$ Leu Lys Ser Leu Gln Glu Glu Pro Val Glu Gly Phe Arg Ile Thr Leu
20 25 30
Val Asp Glu Ser Asp Leu Tyr Asn Trp Glu Val Ala Ile Phe Gly Pro
35 40 45
Pro Asn Thr Leu Tyr Glu Gly Gly Tyr Phe Lys Ala His Ile Lys Phe
55 60
4$
Pro Ile Asp Tyr Pro Tyr Ser Pro Pro Thr Phe Arg Phe Leu Thr Lys
65 70 75 80
$0
Met Trp His Pro Asn Ile Tyr Glu Asn Gly Asp Val Cys Ile Ser Ile
85 90 95
$$ Leu His Pro Pro Val Asp Asp Pro Gln Ser Gly Glu Leu Pro Ser Glu
100 105 110
CA 02449417 2003-12-04
170
Arg Trp Asn Pro Thr Gln Asn Val Arg Thr Ile Leu Leu Ser Val Ile
115 120 125
Ser Leu Leu Asn Glu Pro Asn Thr Phe Ser Pro Ala Asn Val Asp Ala
130 135 140
Ser Val Met Phe Arg Lys Trp Arg Asp Ser Lys Gly Lys Asp Lys Glu
145 150 155 160
1$
Tyr Ala Glu Ile Ile Arg Lys Gln Val Ser Ala Thr Lys Ala Glu Ala
165 170 175
Glu Lys Asp Gly Val Lys Val Pro Thr Thr Leu Ala Glu Tyr Cys Ile
180 185 190
Lys Thr Lys Val Pro Ser Asn Asp Asn Ser Ser Asp Leu Leu Tyr Asp
195 200 205
Asp Leu Tyr Asp Asp Asp Ile Asp Asp Glu Asp Glu Glu Glu Glu Asp
210 215 220
Ala Asp Cys Tyr Asp Asp Asp Asp Ser Gly Asn Glu Glu Ser
225 230 235
CA 02449417 2003-12-04
