Note: Descriptions are shown in the official language in which they were submitted.
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
SIRZ ACTIVITY
CLAIM OF PRIORITY
This application claims priority under 35 USC ~119(e) to U.S. Patent
Application Serial
No. 60/303,370, filed on July 6, 2001, and U.S. Patent Application Serial No.
60/303,456, also
filed on July 6, 2001, the entire contents of which are hereby incorporated by
reference.
GOVERNMENT SUPPORT
The invention was supported, in whole or in part, by a grant RO1 CA78461 to
RAW;
NHLBI/NIH Fellowship to SKD K08 HL04463. The U.S. Government has certain
rights in the
invention.
BACKGROUND
Regulation of the cell cycle is important in homeostasis of both cells and
organisms (e.g.,
mammalian cells or mammals). Disruptions in the normal regulation of the cell
cycle can occur,
for example, in tumors which proliferate uncontrollably, in response to DNA
damage (e.g.,
ionizing radiation) to the cell or organism, and under conditions of stress
(e.g., oxidative stress)
in the cell or organism.
The p53 tumor suppressor protein exerts anti-proliferative effects, including
growth
arrest, apoptosis, and cell senescence, in response to various types of
stress, e.g., DNA damage
(Levine, 1997; Giaccia and Kastan, 1998; Prives and Hall, 1999; Oren, 1999;
Vogelstein et al.,
2000). Inactivation of p53 function appears to be critical to tumorigenesis
(Hollstein et al.,
1999). Mutations in the p53 gene have been shown in more than half of all
human tumors
(Hollstein et al., 1994). Accumulating evidence further indicates that, in the
cells that retain
wild-type p53, other defects in the p53 pathway also play an important role in
tumorigenesis
(Prives and Hall, 1999; Lohrum and Vousden, 1999; Vousden, 2000). The
molecular function of
p53 that is required for tumor suppression involves its ability to act as a
transcriptional factor in
regulating endogenous gene expression. A number of genes which are critically
involved in
either cell growth arrest or apoptosis have been identified as p53 direct
targets, including
p21CIP1/WAF1, Mdm2, GADD45, Cyclin G, 14-3-3F, Noxa, p53AIP1, PUMA and others
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
(Nakano and Vousden, 2001; Yu et al., 2001; Oda et al., 2000a, 2000b; El-
Deriry et al., 1993;
Wu et al., 1993; Barak et al., 1993; Kastan et al., 1992; Olcamoto and Beach,
1994).
p53 is a short-lived protein whose activity is maintained at low levels in
normal cells.
Tight regulation of p53 is essential for its effect on tumorigenesis as well
as maintaining normal
cell growth. The precise mechanism by which p53 is activated by cellular
stress is not
completely understood. It is generally thought to involve primarily post-
translational
modifications of p53, including phosphorylation and acetylation (reviewed in
Appella and
Anderson, 2000; Giaccia and Kastan, 1998). Early studies demonstrated that
CBP/p300, a
histone acetyl-transferase (HAT), acts as a coactivator of p53 and potentiates
its transcriptional
activity as well as biological function in viv~ (Gu et al., 1997; Lill et al.,
1997; Avantaggiati et
al., 1997). Genetic studies have also revealed that p300 mutations are present
in several types of
tumors, and that mutations of CBP in human Rubinstein-Taybi syndrome as well
as CBP
knockout mice lead to higher risk of tumorigenesis, further supporting an
important role for this
interaction in the tumor suppressor pathway (reviewed in Goodman and Smolik,
2000; Gile et
al., 1998; Kung et al., 2000; Gayther et al., 2000). Significantly, the
observation of functional
synergism between p53 and CBP/p300 together with its intrinsic HAT activity
led to the
discovery of a novel FAT (Transcriptional factor acetyl-transferase) activity
of CBP/p300 on p53
which suggests that acetylation represents a general functional modification
for non-histone
proteins in vivo (Gu and Roeder, 1997) which has been shown for other
transcriptional factors
(reviewed in Kouzarides, 2000; Sterner and Berger, 2000; Muth et al., 2001).
p53 is specifically acetylated at multiple lysine residues (Lys 370, 371, 372,
381, 382) of
the C-terminal regulatory domain by CBP/p300. The acetylation of p53 can
dramatically
stimulate its sequence-specific DNA binding activity, perhaps as a result of
an acetylation-
induced conformational change (Gu and Roeder, 1997; Sakaguchi et al., 1998;
Liu et al., 1999).
By developing site-specific acetylated p53 antibodies, CBP/p300 mediated
acetylation of p53
was confirmed ih vivo by a number of studies (reviewed in Chao et al., 2000;
Ito et al., 2001). In
addition, p53 can be acetylated at Lys320 by another HAT cofactor, PCAF,
although the ifz vivo
functional consequence needs to be further elucidated (Sakaguchi et al., 1998;
Liu et al., 1999;
Liu et al., 2000). Steady-state levels of acetylated p53 are stimulated in
response to various
types of stress (reviewed in Ito et al., 2001).
2
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
Recently, by introducing a transcription defective pS3 mutant (pS3Q2SS26) into
mice, it
was found that the mutant mouse thymocytes and ES cells failed to undergo DNA
damage-
induced apoptosis (Chao et al., 2000; Jimenez et al., 2000). Interestingly,
this mutant protein
was phosphorylated normally at the N-terminus in response to DNA damage but
could not be
acetylated at the C-terminus (Chao et al., 2000), supporting a critical role
of pS3 acetylation in
transactivation as well as pS3-dependent apoptotic response (Chao et al.,
2000; Luo et al., 2000).
Furthermore, it has been found that oncogenic Ras and PML upregulate
acetylated pS3 in normal
primary fibroblasts, and induce premature senescence in a pS3-dependent manner
(Pearson et al.,
2000; Ferbeyre et al., 2000). Additionally acetylation, not phosphorylation of
the pS3 C-
terminus, may be required to induce metaphase chromosome fragility in the cell
(Yu et al.,
2000). Thus, CBP/p300-dependent acetylation of pS3 may be a critical event in
pS3-mediated
transcriptional activation, apoptosis, senescence, and chromosome fragility
In contrast, much less is known about the role of deacetylation in modulating
pS3
function. Under normal conditions, the proportion of acetylated pS3 in cells
remains low. This
may reflect the action of strong deacetylase activities in viv~. The
acetylation level of pS3 is
enhanced when the cells are treated with histone deacetylase (HDAC) inhibitors
such as
Trichostatin A (TSA). These observations led to identification of a HDAC1
complex which is
directly involved in pS3 deacetylation and functional regulation (Luo et al.,
2000; Juan et al.,
2000). PID/MTA2, a component of the HDAC1 complex, acts as an adaptor protein
to enhance
HDAC1-mediated deacetylation of pS3 which is repressed by TSA (Luo et al.,
2000). In
addition, Mdm2, a negative regulator of pS3, actively suppresses CBP/p300-
mediated pS3
acetylation, and this inhibitory effect can be abrogated by tumor suppressor p
19ARF..
Acetylation may have a critical role in the pS3-MDM2-pI9ARF feed back loop
(Ito et al., 2001;
Kobet et al., 2000).
The Silent Information Regulator (SIR) family of genes represents a highly
conserved
group of genes present in the genomes of organisms ranging from archaebacteria
to a variety of
eukaryotes (Frye, 2000). The encoded SIR proteins are involved in diverse
processes from
regulation of gene silencing to DNA repair. The proteins encoded by members of
the SIR2 gene
family show high sequence conservation in a 2S0 amino acid core domain. A well-
characterized
gene in this family is S. ce~evisiae SIR2, which is involved in silencing HM
loci that contain
information specifying yeast mating type, telomere position effects and cell
aging (Guarente,
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
1999; Kaeberlein et al., 1999; Shore, 2000). The yeast Sir2 protein belongs to
a family of
histone deacetylases (reviewed in Guarente, 2000; Shore, 2000). The Sir2
homolog, CobB, in
Salrraonella typhiryaurium, functions as an NAD (nicotinamide adenine
dinucleotide)-dependent
ADP-ribosyl transferase (Tsang and Escalante-Semerena, 1998).
The Sir2 protein is a deacetylase which uses NAD as a cofactor (Imai et al.,
2000;
Moazed, 2001; Smith et al., 2000; Tanner et al., 2000; Tanny and Moazed,
2001). Unlike other
deacetylases, many of which are involved in gene silencing, Sir2 is
insensitive to histone
deacetylase inhibitors like trichostatin A (TSA) (Imai et al., 2000; Landry et
al., 2000a; Smith et
al., 2000).
Deacetylation of acetyl-lysine by Sir2 is tightly coupled to NAD hydrolysis,
producing
nicotinamide and a novel acetyl-ADP ribose compound (1-O-acetyl-ADP-ribose)
(Tanner et al.,
2000; Landry et al., 2000b; Tanny and Moazed, 2001). The NAD-dependent
deacetylase
activity of Sir2 is essential for its functions which can connect its
biological role with cellular
metabolism in yeast (Guarente, 2000; Imai et al., 2000; Lin et al., 2000;
Smith et a1.,~2000).
Mammalian Sir2 homologs have NAD-dependent histone deacetylase activity (Imai
et al., 2000;
Smith et al., 2000). Most information about Sir2 mediated functions comes from
the studies in
yeast (Gartenberg, 2000; Gottschling, 2000).
Among Sir2 and its homolog proteins (HSTs) in yeast, Sir2 is the only protein
localized
in nuclei, which is critical for both gene silencing and extension of yeast
life-span (reviewed in
Guarente, 2000). Based on protein sequence homology analysis, mouse Sir2a and
its human
ortholog SIRT1 (or human Sir2a or hSir2) are the closest homologs to yeast
Sir2 (Imai et al.,
2000; Frye, 1999, 2000) and both exhibit nuclear localization (Figure 7C).
Homologues of Sir2
have been identified in almost all organisms examined including bacteria,
which has no histone
proteins (reviewed in Gray and Ekstrom, 2001; Frye, 1999; 2000; Brachrnann et
al., 1995). For
this reason it is likely that Sir2 also targets non-histone proteins for
functional regulation (Muth
et al., 2001).
The S. ce~evisiae Sir2 is involved in DNA damage responses (Martin et al.,
1999;
McAinsh et al., 1999; Mills et al., 1999). Tn mammalian cells, one of the
primary mediators of
the DNA damage response is the p53 protein (Levine, 1997; Oren, 1999;
Vogelstein et al.,
2000). Following DNA damage, the p53 protein is protected from rapid
degradation and
acquires transcription-activating functions, these changes being achieved
largely through post-
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
translational modifications (Abraham et al., 2000; Canman et al., 1998; Chehab
et al., 1999;
Sakaguchi et al., 1998; Shieh et al., 2000; Siliciano et al., 1997).
Transcriptional activation of
p53 protein in turn upregulates promoters of a number of genes including
p2lWAFl (el-Deiry et
al., 1993) that promotes cell cycle exit or death-inducing proteins like PIDD
(Lin et al., 2000).
The p53 protein is phosphorylated in response to DNA damage (Siliciano et al.,
1997).
There are at least 13 different residues both at the N and C terminal portions
of p53 protein that
are phosphorylated by various kinases (Appella and Anderson, 2000). For
example, the ATM
and ATR proteins phosphorylate p53 at residue SerlS (Khanna et al., 1998;
Siliciano et al.,
1997; Tibbetts et al., 1999) and Chkl/2 kinases at residue Ser20 (Chehab et
al., 1999; Shieh et
al., 2000).
Modification of SerlS is important for the functional activation of the p53
protein.
Phosphorylation of SerlS may increase the affinity of the p300 acetylase for
p53 (Dumaz and
Meek, 1999; Lambent et al., 1998).
p53 is acetylated ih vitro by p300 at Lys 370-372, 381 and 382 (Gu and Roeder,
1997).
In response to DNA damage, p53 is also acetylated i~z vivo at Lys 373 and Lys
382 (Abraham et
al., 2000; Sakaguchi et al., 1998). Other factors that can affect acetylation
of p53 include
MDM2 protein, which is involved in the negative regulation of p53 (Oren, 1999)
and can
suppress acetylation of p53 protein by p300 (Ito et al., 2001; Kobet et al.,
2000). While
acetylation by p300 and deacetylation by the TSA-sensitive HDAC1 complex (Luo
et al., 2000)
have been shown to be important in regulation of p53 protein activity, the
remaining factors
responsible for its regulation as a transcription factor remain elusive.
Analogs of NAD that inhibit endogenous ADP-ribosylases reduce induction of p21
WAFT
in response to DNA damage and overcome p53-dependent senescence (Vaziri et
al., 1997). In
addition, p53 protein can bind to the NAD-dependent poly-ADP-ribose
polymerase.
The SIR complex in Sacchay~omyces ce~evisiae was originally identified through
its
involvement in the maintenance of chromatin silencing at telomeres and at
mating type loci. It is
composed of four components, Sirlp, Sir2p, Sir3p, and Sir4p, that normally
reside at yeast
telomeres. In response to DNA damage, the SIR complexes relocate to the site
of double-
stranded breaks where they participate in the repair of the lesions by non-
homologous end
joining. This DNA damage response is dependent on the function of the
MEC1/RAD9 DNA
checkpoint pathway MEClis a homolog of the ATM protein that coordinates the
DNA damage
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
response in mammalian cells, in part by triggering the cascade of events that
lead to the
stabilization of the p53 protein (Canman et al., 1998). Another major function
of Sir2, gene
silencing, is closely tied to the regulation of lifespan in S. cerevisiae
(Guarente, 1999).
Double-strand breaks in the genome of mammals invoke a cascade of signaling
events
that ultimately cause phosphorylation and subsequent stabilization of p53
protein. In addition,
these strand breaks lead to activation of p53 protein as a transcription
factor. This activation may
be due largely to its acetylation (Gu and Roeder, 1997; Sakaguchi et al.,
1998). The resulting
stabilized, activated p53 protein contributes to the upregulation of cyclin-
dependent kinase
inhibitors such as p21 WAF1 and hence to the cytostatic effects of p53.
Alternatively, depending
on the cellular background or degree of damage, the apoptotic effects of p53
may predominate
through its ability to induce expression of pro-apoptotic proteins such as PmD
(Lin et al., 2000).
These various phenomena indicate that specific components of the machinery
that moiutors the
integrity of the genome are clearly able to alert p53 to the presence of
genetic damage, leading to
its functional activation. Conversely, in the event that damage has been
successfully repaired,
signals must be conveyed to p53 in order to deactivate it. Thus, a cell cycle
advance that has
been halted by p53 to enable repair to proceed should be relieved following
completion of repair,
enabling the cell to return to its active growth state. For this reason, the
inactivation of p53
becomes as important physiologically as its activation.
In light of this information, modulators of Sir2 a~idlor p53 activity would be
useful in
modulating various cellular processes including, e.g., repair of DNA damage,
apoptosis,
oncogenesis, gene silencing and senescence, inter alia.
SUMMARY
In one aspect, the present invention relates to methods and compositions
employing p53
and Sir2 proteins. Cellular and organismal processes are regulated by
modulating the activity of
Sir2 and/or p53. In some cases the regulated processes control a program of
regulated aging
and/or metabolism of a cell or an organism. Compounds that regulate the
activity of Sir2 and/or
p53 can be identified, for example, by a method described herein.
As used herein, the term "Sir2" refers to a protein that is at least 25%
identical to the 250
amino acid conserved Sir2 core catalytic domain, amino acids 258-451 of SEQ ID
NO. 12. A
6
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
Sir2 protein can be for example, at least 30, 40, 50, 60, 70, 80, 85, 90, 95,
99% identical to amino
acids 258-451 of SEQ ID NO. 12. For example, the Sir2 protein is human SIRTl,
GenBank
Accession No: AF083106. There are at least seven different Sir2 homologs
present in
mammalian cells (Frye, 1999, 2000; Imai et al., 2000; Gray and El~strom,
2001). The mouse
Sir2a and human SIRT1, are preferred Sir2 proteins.
Sir2 can be a protein (e.g., SEQ ID NOS. 8, 10, 12, 14, 16 or 18) or a
fragment of the
protein capable of deacetylating a substrate in the presence or NAD and/or an
NAD analog
and/or a fragment capable of binding to a target protein, e.g., a
transcription factor. Such
functions can be evaluated by a method described herein. A Sir2 fragment can
include a
"domain" which is a structurally stable folded unit of the full-length
protein. The Sir2 protein
can be encoded by the nucleic acid sequence of SEQ ID NOS. 7, 9, 11, 13, 15 or
17. In a
preferred embodiment, the Sir2 is a human Sir2. A model of the three-
dimensional structure of a
Sir2 protein has been determined (see, e.g., Bedalov et al. (2001), Min et al.
(2001), Finnin et al.,
(2001)) and provides guidance for identifying domains of Sir2. '
A "full length" Sir2 protein refers to a protein that has at least the length
of a naturally-
occurring Sir2 protein. A "full length" Sir2 protein or a fragment thereof can
also include other
sequences, e.g., a purification tag., or other attached compounds, e.g., an
attached fluorophore, or
cofactor.
The invention includes sequences and variants that include one or more
substitutions,
e.g., between one and six substitutions, e.g., with respect to a naturally-
occurring protein.
Whether or not a particular substitution will be tolerated can be determined
by a method
described herein. One or more or all substitutions may be conservative. A
"conservative amino
acid substitution" is one in which the amino acid residue is replaced with an
amino acid residue
having a similar side chain. Families of amino acid residues having similar
side chains have
been defined in the art. These families include amino acids with basic side
chains (e.g., lysine,
arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid),
uncharged polar side
chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine,
cysteine), nonpolar side
chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine,
methionine, tryptophan),
beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic
side chains (e.g.,
tyrosine, phenylalanine, tryptophan, histidine).
The terms "identical" or percent "identity," in the context of two or more
nucleic acids or
7
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
polypeptide sequences, refer to two or more sequences or subsequences that are
the same or have
a specified percentage of amino acid residues or nucleotides that are the same
(i.e., about 50%
identity, preferably 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%,
94%, 95%,
96%, 97%, 98%, 99%, or higher identity over a specified region (e.g., the C.
elegans proteins
provided herein), when compared and aligned for maximum correspondence over a
comparison
window or designated region) as measured using a sequence comparison
methodology such as
BLAST or BLAST 2.0 with default parameters described below, or by manual
alignment and
visual inspection. Such sequences are then said to be "substantially
identical." Tlus definition
also refers to, or may be applied to, the complement of a test nucleic acid
sequence. The
definition also includes sequences that have deletions and/or additions, as
well as those that have
substitutions. As described below, the preferred algoritlnns can account for
gaps and the like.
Preferably, identity exists over a region that is at least about 25 amino
acids or nucleotides in
length, or more preferably over a region that is at least 50 or 100 amino
acids or nucleotides in
length.
The p53 polypeptide can have greater than or equal to 25%, 50%, 75%, 80%, 90%
overall identity or greater than or equal to 30%, 50%, 75%, 80%, 90% overall
similarity to SEQ
lD NO. 3. Preferably, the Sir2 or p53 polypeptide is a human protein (e.g., as
described herein),
although it may also be desirable to analyze Sir2 or p53 polypeptides isolated
from other
organisms such as yeast, worms, flies, fish, reptiles, birds, mammals
(especially rodents), and
primates using the methods of the invention.
In one aspect, the invention features a method of screening a compound. The
method
includes providing a reaction mixture including Sir2, a transcription factor,
and the compound,
and determining if the compound modulates Sir2 interaction with, e.g.,
binding, of the
transcription factor. Determining if the compound modulates Sir2binding may be
accomplished
by methods known in the art, including comparing the binding of Sir2 to the
transcription factor
at a first concentration of the compound and at a second concentration of the
compound. In a
further embodiment, either of the first or second concentration of the
compound may be zero,
e.g., as a reference or control.
In a further embodiment, the reaction mixture also includes a Sir2 cofactor,
such as NAD
or an NAD analog.
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
In a further embodiment, the transcription factor is p53 or a Sir-2 binding
fragment
thereof. The transcription factor, e.g., p53, or fragment thereof may be
acetylated or labeled. In
a preferred embodiment, the transcription factor is an acetylated p53
fragment, and the fragment
includes lysine 382.
In a further embodiment, the Sir2 included in the reaction mixture is a Sir2
variant, e.g., a
variant that has reduced deacetylase activity, such as the H363Y mutation. The
Sir2 may be
human, e.g., human SIRT1. Alternatively, the Sir2 may be marine, e.g., Sir2a.
In one
embodiment of the inventions, the Sir2 is exogenous and expressed from a
heterologous nucleic
acid. Additionally, in a further embodiment, the transcription factor may be
exogenous and
expressed from a heterologous nucleic acid.
The method of screening can be used to identify compounds that modulate, e.g.,
increase
or decrease, cell growth, modulate, e.g., slow or speed, aging, modulate,
e.g., increase or
decrease, lifespan, modulate cellular metabolism, e.g., by increasing or
decreasing a metabolic
function or rate.
In another aspect, the invention features a method of screening a compound by
providing
a reaction mixture comprising Sir2, a transcription factor, and the compound,
and determining if
the compound modulates Sir2-mediated deacetylation of the transcription
factor. The step of
determining if the compound modulates Sir2-mediated deacetylation of the
transcription factor
may be performed by methods lenown in the art, including comparing the binding
of Sir2 to the
transcription factor at a first concentration of the compound and at a second
concentration of the
compound. In a further embodiment, either of the first or second concentration
of the compound
may be zero, e.g., as a reference or control. In a further embodiment, the
reaction mixture also
includes a Sir2 cofactor, such as NAD or an NAD analog.
In a further embodiment, the transcription factor is p53 or a Sir-2 binding
fragment
thereof. The p53 or fragment thereof may be acetylated or labeled. In a
preferred embodiment,
the transcription factor is an acetylated p53 fragment, and the fragment
includes lysine 382.
In a further embodiment, the Sir2 included in the reaction mixture is a Sir2
variant that
has reduced deacetylase activity, such as the H363Y mutation. The Sir2 may be
human, e.g.,
human SIRT1. Alternatively, the Sir2 may be marine, e.g., Sir2a. In one
embodiment of the
inventions, the Sir2 is exogenous and expressed from a heterologous nucleic
acid. Additionally,
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
in a further embodiment, the transcription factor may be exogenous and
expressed from a
heterologous nucleic acid.
The method of screening can be used to identify compounds that modulate, e.g.,
increase
or decrease, cell growth, modulate, e.g., slow or speed, aging, modulate,
e.g., increase or
decrease, lifespan, modulate cellular metabolism, e.g., by increasing or
decreasing a metabolic
function or rate.
The present invention also relates to a method of screening a compound by
providing a
compound that interacts with Sir2, e.g., a compound that binds Sir2;
contacting the compound
with a cell or a system; and determining if the compound modulates
transcription of a p53-
regulated gene. Determining if the compound modulates transcription of a p53-
regulated gene
may be by any of the methods known in the art, including comparing the
modulation of
transcription of a p53-regulated gene at a first concentration of the compound
and at a second
concentration of the compound. In a further embodiment, either of the first or
second
concentration of the compound may be zero, e.g., as a reference or control.
In a related aspect, the invention features a method of evaluating a compound,
the method
comprising: contacting Sir2 or a transcription factor, e.g., p53, with a test
compound; evaluating
an interaction between the test compound and the Sir2 or the transcription
factor, e.g., p53;
contacting a cell or organism that produces the Sir2 or transcription factor
polypeptide with the
test compound; and evaluating the effect of the test compound on the rate of
aging on the cell or
organism. The interaction can, for example, be a physical interaction, e.g., a
direct binding
interaction, a covalent change in one or both of the test compound or the Sir2
or transcription
factor, a change in location of the test compound (e.g., a change in
subcellular localization), or a
functional interaction (e.g., an alteration in activity, stability, structure,
or activity of the
polypeptide).
In some embodiments, the method is repeated one or more times such that, e.g.,
a library
of test compounds can be evaluated. In an related embodiment, the evaluating
of the interaction
with the test compound and the Sir2 or the transcription factor, e.g., p53, is
repeated, and the
evaluating of the rate of aging is selectively used for compounds for which an
interaction is
to
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
detected. Possible test compounds include, e.g., small organic molecules,
peptides, antibodies,
and nucleic acid molecules.
In some embodiments, the interaction between the test compound and the Sir2 or
transcription factor, e.g., p53, is evaluated in vitro, e.g., using an
isolated polypeptide. The Sir2
or transcription factor, e.g., p53, polypeptide can be in solution (e.g., in a
micelle) or bound to a
solid support, e.g., a colurmi, agarose beads, a plastic well or dish, or a
chip (e.g., a microarray).
Similarly, the test compound can be in solution or bound to a solid support.
In other embodiments, the interaction between the test compound and the Sir2
or
transcription factor, e.g., p53, is evaluated using a cell-based assay. For
example, the cell can be
a yeast cell, an invertebrate cell (e.g., a fly cell), or a vertebrate cell
(e.g., a Xefzopus oocyte or a
mammalian cell, e.g., a mouse or human cell). In preferred embodiments, the
cell-based assay
measures the activity of the Sir2 or transcription factor, e.g., p53,
polypeptide.
In preferred embodiments, the effect of the test compound on the rate of aging
of a cell or
animal is evaluated only if an interaction between the test compound and the
Sir2 or transcription
factor, e.g., p53, is observed.
In some embodiments, the cell is a transgenic cell, e.g., a cell having a
transgene. In
some embodiments, the transgene encodes a protein that is normally exogenous
to the tTansgenic
cell. In some embodiments, the transgene encodes a human protein, e.g., a
human Sir2 or
transcription factor, e.g., p53, polypeptide. In some embodiments, the
transgene is linked to a
heterologous promoter. In other embodiments, the transgene is linked to its
native promoter. In
some embodiments, the cell is isolated from an organism that has been
contacted with the test
compound. In other embodiments, the cell is contacted directly with the test
compound.
In other embodiments, the rate of aging of an organism, e.g., an invertebrate
(e.g., a
worm or a fly) or a vertebrate (e.g., a rodent, e.g., a mouse) is determined.
The rate of aging of
an organism can be determined by a variety of methods, e.g., by one or more
of: a) assessing the
life span of the cell or the organism; (b) assessing the presence or abundance
of a gene transcript
or gene product in the cell or organism that has a biological age-dependent
expression pattern;
(c) evaluating resistance of the cell or organism to stress, e.g., genotoxic
stress (e.g., etopicide,
UV irradition, exposure to a mutagen, and so forth) or oxidative stress; (d)
evaluating one or
more metabolic parameters of the cell or organism; (e) evaluating the
proliferative capacity of
the cell or a set of cells present in the organism; (f) evaluating physical
appearance or behavior
11
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
of the cell or organism, and (g) assessing the presence or absence of a gene
transcript or gene
product in the cell or organism that has a p53-regulation-dependent expression
pattern. In one
example, evaluating the rate of aging includes directly measuring the average
life span of a group
of animals (e.g., a group of genetically matched animals) and comparing the
resulting average to
the average life span of a control group of animals (e.g., a group of animals
that did not receive
the test compound but are genetically matched to the group of animals that did
receive the test
compound). Alternatively, the rate of aging of an organism can be determined
by measuring an
age-related parameter. Examples of age-related parameters include: appearance,
e.g.; visible
signs of age; the expression of one or more genes or proteins (e.g., genes or
proteins that have an
age-related expression pattern); resistance to oxidative stress; metabolic
parameters (e.g., protein
synthesis or degradation, ubiquinone biosynthesis, cholesterol biosynthesis,
ATP levels, glucose
metabolism, nucleic acid metabolism, ribosomal translation rates, etc.); and
cellular proliferation
(e.g., of retinal cells, bone cells, white blood cells, etc.). In some
embodiments, the organism is a
transgenic animal. The transgenic animal can include a transgene that encodes,
e.g., a copy of a
Sir2 or transcription factor protein, e.g., a p53 protein, e.g., the Sir2 or
transcription factor, e.g., a
p53 polypeptide that was evaluated for an interaction with the test compound.
In some
embodiments, the transgene encodes a protein that is normally exogenous to the
transgenic
animal. For example, the transgene can encode a human protein, e.g., a human
Sir2 or
transcription factor, e.g., p53, polypeptide. In some embodiments, the
transgene is linleed to a
heterologous promoter. In other embodiments, the transgene is liuced to its
native promoter. In
some embodiments, the transgenic animal further comprises a genetic
alteration, e.g.; a point
mutation, insertion, or deficiency, in a gene encoding an endogenous Sir2 or
transcription factor,
e.g., p53, protein, such that the expression or activity of the endogenous
Sir2 or transcription
factor protein is reduced or eliminated.
In some embodiments, the organism is on a calorically rich diet, while in
other
embodiments the organism is on a calorically restricted diet.
In some embodiments, a portion of the organism's life, e.g., at least 20%,
30%, 40%,
50%, 60%, 70%, 80%, 90%, or more, of the expected life span of the organism,
has elapsed prior
to the organism being contacted with the test compound.
I2
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
In another aspect, the invention features a method of evaluating a protein,
comprising:
identifying or selecting a candidate protein, wherein the candidate protein is
a Sir2 or
transcription factor, e.g. p53, polypeptide; altering the sequence, expression
or activity of the
candidate protein in a cell or in one or more cells of an organism; and
determining whether the
alteration has an effect on the interaction, e.g., binding, of Sir2 with a
transcription. factor, e.g.
p53, or on the deacetylation of transcription factor, e.g. p53.
In some embodiments, the candidate protein is identified by amplification of
the gene or
a portion thereof encoding the candidate protein, e.g., using a method
described herein, e.g., PCR
amplification or the screening of a nucleic acid library. In preferred
embodiments, the candidate
protein is identified by searching a database, e.g., searching a sequence
database for protein
sequences homologous to Sir2 or a transcription factor, e.g., p53.
In preferred embodiments, the candidate protein is a human protein. In other
embodiments, the candidate protein is a mammalian protein, e.g., a mouse
protein. In other
embodiments, the protein is a vertebrate protein, e.g., a fish, bird or
reptile protein, or an
invertebrate protein, e.g., a worm or insect protein. In still other
embodiments, the protein is a
eukaryotic protein, e.g., yeast protein.
In another aspect, the invention features method of evaluating a protein, the
method
comprising a) identifying or selecting a candidate protein, wherein the
candidate protein is Sir2
or a transcription factor, e.g., p53; b) identifying one or more polymorphisms
in a gene, e.g., one
or more SNPs that encodes the candidate protein; and c) assessing
correspondence between the
presence of one or more of the polymorphisms and an interaction, e.g.,
binding, of Sir2 with the
transcription factor, e.g., p53, or with the deacetylation of the
transcription factor, e.g., p53. The
pol~nnorphisms can be naturally occurnng or laboratory induced. In one
embodiment, the
organism is an invertebrate, e.g., a fly or nematode; in another embodiment
the organism is a
mammal, e.g., a rodent or human. A variety of statistical and genetic methods
can be used to
assess correspondence between a polymorphism and longevity. Such correlative
methods
include determination of linkage disequilibrium, LOD scores, and the like.
13
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
In another aspect, the invention features a method of modulating cell growth
in an
animal, e.g., a mammal, by modulating the Sir2-mediated deacetylation of a
transcription factor
in the animal.
In one embodiment, the method includes modulating cell growth by increasing
acetylation of p53. In a further embodiment, the method includes inactivating
Sir2, e.g., by the
use of antisense, RNAi, antibodies, intrabodies, NAD depletion, a dominant
negative mutant of
Sir2, or by the addition of Sir2 cofactor-analogs, e.g., NAD analogs such as
those described in
Vaziri et al. (1997) or nicotinamide. In a further embodiment, the method
includes introducing a
deacetylation-resistant form of p53. In still another embodiment, the
invention is a method for
treating a mammal, e.g., a mammal having a disease characterized by unwanted
cell
proliferation, e.g., cancer, accelerated senescence-related disorders,
inflammatory and
autoimmune disorders, Alzheimer's disease, and aging-related disorders.
In another embodiment, the method includes modulating cell growth by
decreasing
acetylation of p53. In a further embodiment, the method includes increasing
NAD
concentrations. In a further embodiment, the method includes increasing Sir2
concentrations, e.g.
by addition of purified Sir2, by expression of Sir2 from heterologous genes,
or by increasing the
expression of endogenous Sir2, or by the addition of Sir2 cofactor-analogs,
e.g., NAD analogs
such as those described in Vaziri et al. (1997).
The present invention also relates to a method of modulating the growth of a
cell in vivo
or iyz vitro by modulating the Sir2-mediated deacetylation of a transcription
factor in the cell.
In one embodiment, the method includes modulating the growth of a cell by
increasing
acetylation of p53, thereby decreasing cell growth. Tn a further embodiment,
the method
includes inactivating Sir2, e.g., by the use of antisense, RNAi, antibodies,
intrabodies, NAD
depletion, a dominant negative mutant of Sir2, or nicotinamide, or decreasing
Sir2 activity by the
addition of Sir2 cofactor-analogs, e.g., NAD analogs such as those described
in Vaziri et al.
(1997). In a further embodiment, the method includes introducing a
deacetylation-resistant form
of p53.
In one embodiment, the method includes modulating the growth of a cell by
decreasing
acetylation of p53, thereby increasing cell growth. In a further embodiment,
the method includes
increasing NAD concentrations. W a further embodiment, the method includes
increasing Sir2
14
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
concentrations, e.g. by addition of purified Sir2, by expression of Sir2 from
heterologous genes,
or by increasing the expression of endogenous Sir2, or by the addition of Sir2
cofactor-analogs,
e.g., NAD analogs such as those described in Vaziri et al. (1997).
In one aspect the invention features a method of directing Sir2 to a
transcription factor
binding site, e.g., a p53 binding site, and thereby modifying the acetylation
status of the binding
site on histone or DNA. The method includes providing a Sir2-transcription
factor complex
under conditions such that the transcription factor targets Sir2 to the
transcription factor binding
site, allowing the Sir 2 to modify the acetylation status of histones and DNA
at the transcription
factor binding site.
In a preferred embodiment, the method is performed in vivo or ih vitro, e.g.,
in an animal
or in a cell.
In a preferred embodiment, the Sir2-transcription factor complex is provided
at a
different stage of development of the cell or animal or at a greater
concentration than occurs
naturally.
In a preferred embodiment, the Sir2 or transcription factor or both is
increased, e.g., by
supplying exogenous Sir2 and/or transcription factor, e.g., pS3, by supplying
an exogenous
nucleic acid encoding Sir2 or transcription factor, e.g., p53, or by inducing
endogenous
production of Sir2 or a transcription factor, e.g., p53.
In one embodiment, the present invention relates to a method of evaluating a
compound,
e.g., a potential modulator of Sir2 or transcription factor, e.g., p53
activity, comprising the steps
of contacting the transcription factor, e.g., p53, Sir2, and NAD or an NAD
analog with the
compound; evaluating an interaction between the compound and one or more of
the transcription
factor, e.g., p53, Sir2, and a cofactor such as NAD or an NAD analog;
contacting the compound
with a cell or organism having transcription factor, e.g., p53 or Sir2
activity; and evaluating the
rate of aging of the cell or organism. In a preferred embodiment, evaluating
the rate of aging
comprises one or more of:
a) assessing the life span of the cell or organism;
b) assessing the presence or absence of a gene transcript or gene product in
the cell
or organism that has a biological age-dependent expression pattern;
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
c) evaluating resistance of the cell or organism to stress;
d) evaluating one or more metabolic parameters of the cell or organism;
e) evaluating the proliferative capacity of the cell or a set of cells present
in the
organism;
f) evaluating physical appearance, behavior, or other characteristic of the
cell or
organism; and
g) assessing the presence or absence of a gene transcript or gene product in
the cell
or organism that has a p53-regulation-dependent expression pattern.
The details of one or more embodiments of the invention are set forth in the
accompanying drawings and the description below. Other features, objects, and
advantages of
the invention will be apparent from the description and drawings, and from the
claims.
DESCRIPTION OF DRAWINGS
Figure 1. Interactions between p53 and mammalian Sir2a both iya vitro and in
vivo.
(A) is an autoradiograph demonstrating direct interactions of Sir2a with GST
p53. The
GST p53 full length protein (GST p53) (lane 1), the N-terminus of p53 protein
(1-73) (lane 2),
the middle part of p53 (100-290) (lane 3), the C-terminus of p53 (290-393)
(lane 4), and GST
alone (lane 6) were used in GST pull-down assay with ifs. vitro translated 35S-
labeled full length
mouse Sir2a. (B) is two western blots demonstrating p53 interactions with
Sir2a in H1299 cells.
Western blot analyses of the indicated whole cell extract (WCE) (lanes 1, 3,
5, 7), or the p53
immunoprecipitates with M2 antibody (IP/Flag-p53) prepared from the
transfected H1299 cells
(lane 6, 8), or the Sir2a immunoprecipitates (IP/Flag-Sir2a) with M2 antibody
prepared from the
transfected H1299 cells (lanes 2, 4) with either anti-p53 monoclonal antibody
(DO-1) (lanes 1-
4), or anti-Sir2a polyclonal antibody (lanes 5-8). The cells were either
firansfected with p53
(lanes 3, 4) or Sir2a (lanes 7, 8) alone, or cotransfected with p53 and Sir2a
(lanes 1, 2, 5, 6). (C)
is a schematic representation of the high homology regions between mouse Sir2a
and human
SIRT1 (hSIRTI). The core domain represents the very conserved enzymatic domain
among all
Sir2 family proteins (Frye, 1999, 2000). (D) is a western blot demonstrating
p53 interactions
with human SIRT1 in H1299 cells. Western blot analyses of the indicated whole
cell extract
(WCE) (lanes 1, 3) or the Flag-hSIRTl immunoprecipitates with M2 antibody
(IP/hSIRTl)
16
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
(lanes 2, 4) prepared from either the hSIRTI and p53 cotransfectedH1299 cells
(lanes 1, 2) or the
p53 alone transfected cells (lanes 3, 4) with anti-p53 monoclonal antibody (DO-
1).
Figure 2. P53 interacts with mammalian Sir2a (mouse Sir2a and hSIRTl) in
normal
cells.
(A) is two western blots demonshating the interaction between p53 and hSIRTl
in H460
cells. (B) is two western blots demonstrating the interaction between p53 and
Sir2a in F9 cells.
(C) The interaction between p53 and hSIRTl un HCT116 cells either at the
normal condition
(lanes, 1-3) or after DNA damage treatment by etoposide (lanes, 4-6). Western
blot analyses of
the indicated whole cell extract (WCE) (lanes 1, 4), or immunoprecipitates
with anti-Sir2a
antibody (IP/anti-Sir2a) (lanes 2, 5) prepared from different cell extracts,
or control
immunoprecipitates with pre-irmnunoserum from the same extracts (lanes 3, 6),
with anti-p53
monoclonal antibodies (DO-I for human p53, 42I for mouse p53), or anti-Sir2a
antibody.
Figure 3. TSA-insensitive deacetylation of p53 by mammalian Sir2a.
(A) Colloidal blue staining of a SDS-PAGE gel containing protein Marker (lane
1), a
control eluate from M2 loaded with untransfected cell extract (lane 2), and
100 ng of the highly
purified Flag-tagged Sir2a recombinant protein (lane 3). (B) Deacetylation of
p53 by Sir2a, 2.5
dug of 14C-labeled acetylated p53 (lane 1) was incubated with either the
control eludate (lane 4),
the purified 10 ng of Sir2a (lanes 2 and 3), or the same amount of Sir2a in
the presence of 500
nM TSA (lane 5) for 60 min at 30EC. NAD (50 ~.m) was also added in each
reaction except lane
2. The proteins were analyzed by resolution on SDS-PAGE and autoradiography
(upper) or
Coomassie blue staining (lower). (C). Reduction of the steady-state levels of
acetylated p53 by
both mouse Sir2a and human SIRTl expression. Western blot analysis of H1299
cell extracts
from the cells cotransfected with p53 and p300 (lane 1), or in combination
with Sir2a (lane 2), or
in combination with hSIRTl (lane 4), or in combination with Sir2aH355A (lane
3), in
combination with hSIRTS (lane 5), or in combination with PARP (lane 6) by
acetylated p53-
specific antibody (upper) or DO-1 for total p53 (lower). (D) Deacetylation of
p53 by Sir2a in
the presence of TSA. Western blot analysis of acetylated p53 levels in H1299
cells cotransfected
with p53 and p300 (lanes 1, 3), or cotransfected with p53, p300 and Sir2a
(lanes 2, 4) by
17
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
acetylated p53-specific antibody (upper) or OF-1 for total p53 (lower). Cells
were either not
treated (lanes 1, 2) or treated with S00 nM TSA (lanes 3, 4).
Figure 4. Abrogation of mammalian Sir2a mediated deacetylation of p53 by
nicotinamide.
(A) Sir2a-mediated deacetylation of p53 is inhibited by nicotinamide. 2.5 :g
of 14C-
labeled acetylated p53 (lane 1) was incubated with 10 ng of purified Sir2a and
50 pM NAD
alone (lane 2), or in the presence of either SmM of nicotinamide (lane 3) or 3
mM of 3-AB (3-
aminobenzamide) (lane 4) for 60 min at 30EC. The proteins were analyzed by
resolution on
SDS-PAGE and autoradiography (upper) or Coomassie blue staining (lower). (B)
The Sir2a-
mediated deacetylation of endogenous p53 was abrogated in the presence of
nicotinamide. Cell
extracts from the mock-infected MEF p53 (+/+) cell (lanes 1-2, 5-6), or the
pBabe-Sir2ainfected
cells (lanes 3-4, 7-8), either untreated (lanes 1, 3, 5, 7), or treated with
etoposide and TSA (lane
2, 4), or in combination with nicotinamide (lanes 6, 8) for 6 hr were analyzed
by Western blot
with acetylated p53-specific antibody (upper) or DO-1 for total p53 (lower).
(C) Synergistic
induction of p53 acetylation levels by TSA and nicotinamide during DNA damage
response.
Western blot analysis of cell extracts from the H460 cells treated with
etoposide alone (lane 2),
or in combination with TSA (lane 3), or TSA and nicotinamide (lane 4), or TSA
and 3-AB (lane
5) for 6 hr by acetylated p53-specific antibody (upper) or DO-1 for total p53
(lower). The cell
extracts from untreated cells (lane 1), or treated with a proteasome inhibitor
LLNL (50 :M) were
also included (lane 6).
Figure 5. Bar graphs illustrating repression of p53-mediated transcriptional
activation by
mammalian Sir2a.
(A), (B) MEF (p53-/-) cells were transiently transfected with 10 ng of CMV p53
alone, or
in combination with indicated Sir2a constructs together with either the PG13-
Luc reporter
construct (A), or a control reporter construct (TIC-Luc) (B) by calcium
phosphate precipitation
essentially as previously described (Luo et al., 2000). (C), (D) MEF (p53-l-)
cells were
transiently transfected with 10 ng of CMV p53 alone, or in combination with
S:g of either CMV
Sir2a, or CMV hSlRTl, or CMV hSlRTS (C), or CMV Sir2aH355A as indicated (D)
together
with the PG13-Luc reporter construct. All transfections were done in duplicate
and ,
18
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
representative experiments depict the average of three experiments with
standard deviations
indicated.
Figure 6. Inhibition of pS3-dependent apoptosis by Sir2a.
(A) H1299 cells were transfected with pS3 alone, or cotransfected with pS3 and
Sir2a, or
cotransfected with pS3 and Sir2aH3SSA. After transfection, the cells were
fixed, stained for pS3
by FITC-conjugated a-pS3 antibody, and analyzed by flow cyrntometry for
apoptotic cells
(subG1) according to DNA content (PI staining). (B) The experiments were
repeated at least
three times; this bar graph depicts the average of three experiments with
standard deviations
indicated.
Figure 7. Inhibition of pS3-dependent apoptotic response to stress by
mammalian Sir2a.
(A) Repression of the apoptotic response to DNA damage by Sir2a. Both mock
infected
cells and p/babe-Sir2a infected MEF pS3(+/+) cells were either not treated (1
and 2) or treated
with either 20 ~,M etoposide. The cells were analyzed by flow cytometry for
apoptotic cells
(subGl) according to DNA content (PI staining). (B) Similar results were
obtained for three
times, and this bar graph of representative data depicts the average of three
experiments with
standard deviations indicated (B).
Figure 8. Co-precipitation of hSir2 and pS3 protein.
(A) Immunoprecipitation of hSir2 with a C-terminal polyclonal rabbit antibody
followed
by immunoblotting with the same antibody revealed the existence of a 120Kd
protein in normal
BJ fibroblasts (left panel), and increased levels in these cells expressing
the wild type (middle
panel) and HY mutant (right panel) of hSir2. (B) Immunofluorescence analysis
of hSir2
indicated the existence of a nuclear protein with a punctuate staining
pattern. (C) Nuclear
lysates from H1299 cells ectopically expressing pS3 and hSir2 were
precipitated with the anti-
hSir2 antibody The blot was probed the anti-hSir2 antibody and a polyclonal
sheep anti-pS3
antibody (bottom panel). (D) pS3 protein was immunoprecipitated with the Do-1
anti-pS3
antibody from lysates of non-irradiated and irradiated (6Gy) BJT cells
(expressing telomerase)
that had been stably infected with pYESir2wt and pYESir2HY mutant vectors. The
blot was
probed with anti-hSir2 antibody and rabbit anti-pS3 polyclonal antibodies
(CMl+SC6243).
19
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
Figure 9. Effect of hSir2 expression on p53 acetylation in vitro.
The deacetylation activity of mSir2 on the human p53 C-terminal peptide
(residues 368-
386) di-acetylated at positions 373 and 382. (A, B) HPLC chromatograms of
products of
deacetylation assays with mSir2 and the indicated concentrations of NAD. Peaks
1 and 2
correspond to the monomeric and dimeric forms of the p53 peptide,
respectively. Peals 3
corresponds to the singly deacetylated monomer identified by mass
spectroscopy. (C-F) Amino-
terminal Edman sequencing of peaks 1 and 3. Chromatograms of positions 373 and
382 are
shown. Peaks of acetyl-lysine (AcK) and simple lysine (K) are indicated in
each panel. Small
peaks of lysine in panels C, D and F are due to residual fractions of previous
lysines at positions
372 and 381.
Figure 10. hSir2 effects on p53 acetylation in vivo.
(A) Reconstitution of the acetylation and deacetylation cascade in immortal
human
epithelial H1299 cells by transient co-transfection of the indicated genes.
After co-transfection of
the mentioned constructs, the cellular lysates were analyzed by Western blot
analysis, using Ab-1
to detect K382 p53, DO-1 for total p53 or [3 actin for loading control. Lane
3, co-transfection of
CMVwtp53 and p300 generates acetylated p53 at K382, lane 4, co-transfection of
the acetylation
mutant K382R of p53 with p300. Lane 5, Same as 4 but with co-transfected wild
type hSir2.
Lanes 7-8, co-transfection of the acetylation mutant K320R with or without
wild type hSir2.
Lane 9, Co-transfection of CMVwtp53, CMVp300 and wild type hSir2.
(B) BJ cells expressing telomerase (BJT), were stably infected with either a
wild type
hSir2 or a mutant hSir2HY virus. The hSir2-expressing mass cultures were subj
ected to 6Gy of
ionizing radiation in presence of low concentrations of TSA (O.lmg/ml) and the
p53 acetylation
was measured at indicated time points by immunoblotting with Ab-1 that
recognizes specifically
the deacetylated K382 p53 protein. The blots were subsequently probed with
anti-p53, anti-p21,
anti-(3~ actin and anti-hSir2 antibodies. Time (hrs) post 6 Gy of irradiation
is shown inside the
brackets.
(C) Deacetylation of p53 in vivo in MCF7 cells. Four-fold ectopic expression
of wild
type hSir2 or hSir2HY mutant in MCF7 cells radiated with 6Gy of ionizing
radiation and its
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
effect on p53 acetylation at K382. The blot was probed for acetylation with Ab-
1 and reprobed
with other antibodies as in (B). Times shown are post irradiation in hours.
Figure 11. hSir2 expression and its influence on p53 activity
(A) is a bar graph depicting transcriptional activity of p53 protein, as
measured in H1299
cells by co-transfection p53 with a p21 WAF1 promoter-luciferase construct
(p2lPluc).
Transcriptional activity of p53 protein was measured upon ectopic expression
of wild type hSir2,
hSir2HY (B) is a bar graph illustrating results from control SV40-Luciferase
transfections with
CMVp53 and increasing amounts of wild type hSir2 in to H1299 cells and
luciferase activity was
measured and expressed as Relative Light Unit (%RLU). (C) Is an immunoblot
demonstrating
levels of p21 WAF1 in MCF73L cells expressing wt hSir2 or hSir2HY protein in
response to 6Gy
of ionizing radiation. The blot was probed with Do 1 for detection of p53 and
(3 actin for loading
control.
Figure 12. Effects of hSir2 on p53-dependent apoptosis and radiosensitivity
(A) is a bar graph illustrating ectopic expression of hSir2wt and its
influence on p53-
dependent apoptosis in H1299 cells. H1299 cells were transfected with a wild
type p53
expression construct to induce p53-dependent apoptosis. Amiexin V positive and
propidium
iodide negative cells were measured.
(B) is a line graph comparison of gamma-ray survival. Dose-response curves are
shown
for different types of BJ cells treated with ionizing radiation while growing
exponentially and
asynchronously. Twelve days after radiation the colonies were counted and
survival calculated as
described previously (Dhar et al., 2000). The ataxia-telangiectasia (A-T) cell
line was used a
positive control to indicate radiosensitivity in an exponentially growing
population.
Figures 13A and 13B. The coding nucleic acid (SEQ ID NO. 2) and deduced amino
acid
(SEQ ID NO. 3) of human p53.
Figure 14. The nucleic acid (SEQ ID NO. 4) sequence of human p53 (GenBanlc
Accession No: K03199).
21
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
Figures 15A, B, C and D. The nucleic acid (SEQ ID NO. 5) and deduced amino
acid
sequence (SEQ ID NO. 6) of mouse Sir2.
Figures 16A, B and C. The nucleic acid (SEQ ID NO. 7) and deduced amino acid
sequence (SEQ m NO. 8) of mouse Sir2 GenBanlc Accession No: AF214646.
Figures 17A and B. The nucleic acid (SEQ m NO. 9) and deduced amino acid
sequence
(SEQ m NO. 10) of human Sir2 SIRT2 GenBanlc Accession No: AF083107.
Figures 18A, B and C. The nucleic acid (SEQ m NO. 11) and deduced amino acid
sequence (SEQ ID NO. 12) of human Sir2 SIRTl GenBank Accession No: AF083106.
Figure 19. The nucleic acid (SEQ m NO. 13) and deduced amino acid sequence
(SEQ
m NO. 14) of human Sir2 SIRT3 GenBank Accession No: AF083108.
Figures 20A and B. The nucleic acid (SEQ m NO. 15) and deduced amino acid
sequence (SEQ m NO. 16) of human Sir2 SIRT4 GenBanlc Accession No: AF083109.
Figures 21A and B. The nucleic acid (SEQ m NO. 17) and deduced amino acid
sequence (SEQ m NO. 18) of human Sir2 SIRTS GenBank Accession No: AF083110.
DETAILED DESCRIPTION
As described below, hSir2 directly binds the human p53 protein both iya vitYO
and ih vivo
and can deacetylate p53, e.g., at the K382 residue of p53. A functional
consequence of this
deacetylation is an attenuation of the p53 protein's activity, e.g., as a
transcription factor
operating at a cellular promoter, e.g., the p2lWAFl promoter. In another
cellular context, in
which the DNA damage response leads to apoptosis, hSir2 activity attenuates
the p53-dependent
apoptotic response. Hence, hSir2 can negatively regulate a program of cellular
death.
Sir2 proteins can also deacetylate histones. For example, Sir2 can deacetylate
lysines 9
or 14 of histone H3. Histone deacetylation alters local chromatin structure
and consequently can
22
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
regulate the transcription of a gene in that vicinity. Sir2 proteins can bind
to a number of other
proteins, termed "Sir2,-binding partners." For example, hSIRTl binds to p53.
In many instances
the Sir-2 binding partners are transcription factors, e.g., proteins that
recognize specific DNA
sites. W teraction between Sir2 and Sir2-binding partners delivers Sir2 to
specific regions of a
genome and can result in local modification of substrates, e.g., histones and
transcription factors
localized to the specific region. Accordingly, cellular processes can be
regulated by compounds
that alter (e.g., enhance or diminish) the ability of a Sir2 protein to
interact with a Sir2-binding
parW er or that alter that ability of a Sir2 protein to modify a substrate.
While not wishing to be
bound by theory, a Sir2-transcription factor complex may be directed to a
region of DNA with a
transcription factor binding site; once there, Sir2 may alter the acetylation
status of the region,
e.g., by deacetylating histones, non-histone proteins, and/or DNA. This would
locally raise the
concentration of Sir2 and may potentially result in the Sir2-mediated
silencing of genes located
at or near transcription-factor binding sites. Certain organismal programs
such as aging or
metabolism and disorders such as cancer can be controlled using such
compounds.
While not wishing to be bound by theory, in mammalian cells, signals
indicating the
successful completion of DNA repair may be relayed via hSir2 to acetylated
proteins like p53
that have been charged with the task of imposing a growth arrest following DNA
damage. These
signals enable hSir2 to reverse part or all of the damage-induced activation
of p53 as a
transcription factor by deacetylating the K3 ~2 residue of p53. By doing so,
hSir2 reduces the
likelihood of subsequent apoptosis and, at the same time, makes it possible
for cells to re-enter
the active cell cycle, enabling them to return to the physiological state that
they enjoyed prior to
sustaining damage to their genomes.
W activation of the p53 signaling pathway is involved in the pathogenesis of
most if not
all human tumors (Hollstein et al., 1994; Lohrum and Vousden, 1999). In about
half of these
tumors, mutation of the p53 gene itself suffices to derail function. In some
of the remaining
tumors, loss of p 14A~, which acts to down-regulate p53 protein levels, has
been implicated
(Lohrum and Vousden, 1999; Prives and Hall, 1999). The present invention is
related to the
discovery of a novel mode by which an incipient cancer cell attenuate at least
some p53
functions via modulation of the activity of hSir2, which, like the other two
genetic strategies,
may result in the inactivation of both the cytostatic and pro-apoptotic
functions of p53.
23
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
The invention is thus based in part on the discovery of the existence of a p53
regulatory
pathway that is regulated by mammalian Sir2oc. Sir2a is involved in gene
silencing and
extension of life span in yeast and C. elegayZS (reviewed in Guarente, 2000;
Shore, 2000;
I~aeberlein et al., 1999; Tissenbaun and Guarente, 2001). p53 binds to mouse
Sir2a as well as
its human ortholog hSIRTI both iya vitro and in vivo. p53 is a substrate for
the NAD-dependent
deacetylase activity of mammalian Sir2a. Sir2a-mediated deacetylation
antagonizes p53-
dependent transcriptional activation and apoptosis. Sir2a-mediated
deacetylation of p53 is
inhibited by nicotinamide both ih vitro and ifa vivo. Sir2a specifically
inhibits p53-dependent
apoptosis in response to DNA damage and/or oxidative stress, but not p53-
independent, Fas-
mediated cell death. Accordingly, compounds that alter (e.g., decrease or
enhance) the
interaction between Sir2 and p53 can be used to regulate processes downstream
of p53, e.g.,
apoptosis. Such compounds may alter the catalytic activity of Sir2 for a
substrate such as p53 or
may alter the interaction between Sir2 and p53.
The present invention relates to the discovery that p53 is a binding partner
of mammalian
Sir2a, which physically binds to p53 both ifa vitro and isz vivo. In some
cases, p53 is also a
substrate of Sir2. Sir2a specifically represses p53-mediated functions
including p53-dependent
apoptotic response to stress.
p53 can be, for example, the mature protein (e.g., SEQ ID NO. 3) or a fragment
thereof.
The p53 protein can be encoded by the nucleic acid sequence of SEQ ID NOS. 2
and/or 4). In a
preferred embodiment, p53 is the human p53. Deacetylation of p53 can be
mediated by
Sir2,e.g., in combination with a cofactor, such as NAD and/or an NAD analog.
The phrase "deacetylating p53" refers to the removal of one or more acetyl
groups (e.g.,
CH3COa-) from p53 that is acetylated on at least one amino acid residue. Tn a
preferred
embodiment, p53 is deacetylated at a lysine of p53 selected from the group
consisting of lysine
370, lysine 371, lysine 372, lysine 381 and lysine 382 of SEQ ID NO. 3. p53
can be
deacetylated in the presence or absence of DNA damage or oxidative cellular
stress. The DNA
damage can be caused by, for example, ionizing radiation (e.g., 6 Gy of
ionizing radiation), or a
tumor or some other uncontrolled cell proliferation. p53 is deacetylated in
the presence of DNA
damage or oxidative stress by combining p53, Sir2, NAD and/or an NAD analog.
Sir2 can be the mature protein (e.g., SEQ ID NOS. 8, 10, 12, 14, 16 or 18) or
a fragment
of the mature protein capable of deacetylating p53 in the presence or NAD
and/or an NAD
24
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
analog. The Sir2 protein can be encoded by the nucleic acid sequence of SEQ m
NOS. 7, 9, 11,
13, 15 or 17). In a preferred embodiment, the Sir2 is human Sir2.
In one embodiment, the invention is a method of deacetylating p53 comprising
the step of
combining Sir2 and NAD and/or an NAD analog with p53. The combination can be
performed
in the presence or the absence of cells. Such combinations can be in tissue
culture (e.g., BJT
cells, MCF-7 cells) or in an organism (e.g., a mammal, e.g., as a human).
Combination of p53,
Sir2 and NAD andlor an NAD analog can be any placement of p53, Sir 2 and NAD
or a NAD
analog in sufficient proximity to cause Sir2 to deacetylate p53 that is
acetylated on at least one
amino acid residue, which deacetylation by Sir2 requires the presence of NAD
and/or an NAD
analog.
"NAD" refers to nicotinamide adenine dinucleotide. An "NAD analog" as used
herein
refers to a compound (e.g., a synthetic or naturally occurring chemical, drug,
protein, peptide,
small organic molecule) which possesses structural similarity to component
groups of NAD
(e.g., adenine, ribose and phosphate groups) or functional similarity (e.g.,
deacetylates p53 in the
presence of Sir2). For example, an NAD analog can be 3-aminobenzamide or 1,3-
dihydroisoquinoline (H. Vaziri et al., EMBO J. 16:6018-6033 (1997), the entire
teachings of
which are hereby incorporated by reference).
"p53 activity" refers to one or more activity of p53, e.g., p-53 mediated
apoptosis, cell
cycle arrest, and/or senescence, .
"Modulating p53 activity" refers to increasing or decreasing p53 activity,
e.g., p-53
mediated apoptosis, cell cycle arrest, and/or senescence, e.g. by altering the
acetylation or
phosphorylation status of p53.
"Acetylation status" refers to the presence or absence of one or more acetyl
groups (e.g.,
CH3C02-) at one or more lysine (K) residues, e.g., K370, K371, K372, K381,
and/or K382 of
SEQ )D NO. 3. "Altering the acetylation status" refers to adding or removing
one or more acetyl
groups (e.g., CH3COa-) at one or more lysine (K) residues, e.g., K370, K371,
K372, K381, and/or .
K382 of SEQ m NO. 3, e.g., by modulating Sir2 activity
Similarly, "phosphorylation status" refers to the presence or absence of one
or more
phosphate groups (P03 ) at one or more residues, e.g., serine 15 and/or serine
20 of SEQ ID NO.
3. "Altering the phosphorylation status" refers to adding or removing one or
more phosphate
groups (P03-) at one or more residues, e.g., serine 15 and/or serine 20 of SEQ
m NO. 3.
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
"Sir2 activity" refers to one or more activity of Sir2, e.g., deacetylation of
p53 or histone
proteins.
"Modulating Sir2 activity" refers to increasing or decreasing one or more
activity of Sir2,
e.g., deacetylation of p53 or histone proteins, e.g., by altering the binding
affinity of Sir2 and
p52, introducing exogenous Sir2 (e.g., by expressing or adding purified
recombinant Sir2),
increasing or decreasing levels of NAD and/or an NAD analog (e.g., 3-
aminobenzamide, 1,3-
dihydroxyisoquinoline), and/or increasing or decreasing levels of a Sir2
inhibitor, e.g.,
nicotinamide and/or a nicotinamide analog. Additionally or alternatively,
modulating Sir2
activity can be accomplished by expressing, e.g. by transfection, a dominant
negative gene of
Sir2 (e.g., SirHY). The dominant negative gene can, for example, reduce the
activity of
endogenous Sir2 on p53 deacetylation thereby modulating the activity of Sir2.
A "nicotinamide analog" as used herein refers to a compound (e.g., a synthetic
or
naturally occurring chemical, drug, protein, peptide, small organic molecule)
which possesses
structural similarity to component groups of nicotinamide or functional
similarity (e.g., reduces
Sir2 deacetylation activity ofp53).
The Sir2a-mediated pathway is critical for cells under stress
It is believed that there are multiple pathways in cells for regulation of p53
function
(Prives and Hall, 1999; Giaccia and Kastan, 1998; Ashcroft et al., 2000). In
normal cells, Mdm2
is the major negative regulator for p53, and Mdm2-mediated repression appears
sufficient to
downregulate p53 activity. Sir2 regulation of p53 may be an Mdm2-independent,
negative
regulatory pathway for p53. Interestingly, while no obvious effect by Sir2a
expression was
observed in cells at normal conditions, Sir2a became critical in protecting
cells from apoptosis
when cells were either treated by DNA damage or under oxidative stress (Figure
7). Thus,
Sir2a-mediated pathway can be critical for cell survival when the p53 negative-
control mediated
by Mdm2 is severely attenuated in response to DNA damage or other types of
stress.
p53 is often found in latent or inactive forms and the levels of p53 protein
are very low in
unstressed cells, mainly due to the tight regulation by Mdm2 through
functional inhibition and
protein degradation mechanisms (reviewed in Freedman et al., 1999). However,
in response to
DNA damage, p53 is phosphorylated at multiple sites at the N-terminus; these
phosphorylation
26
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
events contribute to p53 stabilization and activation by preventing Mdm2
binding to p53
(reviewed in Appella and Anderson, 2000; Giaccia and Kastan, 1998; Shieh et
al., 1997, 2000;
Unger et al., 1999; Hirao et al., 2000). Mdm2 itself is also phosphorylated by
ATM during DNA
damage response, and this modification attenuates its inhibitory potential on
p53 (Maya et al.,.
2001). Furthermore, while p53 is strongly stabilized and highly acetylated in
stressed cells,
acetylation of the C-terminal multiple lysine sites may occur at the same
sites responsible for
Mdm2-mediated ubiquitination (Rodriguez et al., 2000; Nakamura et al., 2000),
and the highly
acetylated p53 may not be effectively degraded by Mdm2 without deacetylation
(Ito et al.,
2001). Thus, in contrast to unstressed cells, the main p53 negative regulatory
pathway mediated
by Mdm2 is blocked at several levels in response to DNA damage (Maya et al.,
2001). Under
these circumstances, Sir2a-mediated regulation may become a major factor in
controlling p53
activity, making it possible for cells to adjust p53 activity to allow time
for DNA repair before
committing to apoptosis.
In oncogene-induced premature senescence of cells, the p53 negative regulatory
pathway
controlled by Mdm2 may be blocked (reviewed in Sherr and Weber, 2000;
Sharpless and
Depinho, 1999; Serrano et al., 1997). However, in contrast to DNA damage
response, the
Mdm2-mediated pathway is abrogated by induction of p 14A~ (or mouse p 19A~) in
these cells
(Honda and Yasuda, 1999; Weber et al., 1999; Tao et al., 1999a, 1999b; Zhang
et al., 1998;
Pomerantz et al., 1998). Furthermore, when primary fibroblasts undergo
senescence, a
progressive increase of the p53 acetylation levels was observed in serially
passaged cells
(Pearson et al., 2000). Oncogenic Ras and PML induced p53-dependent premature
senescence,
and upregulated the p53 acetylation levels in both mouse and human normal
fibroblasts (Pearson
et al., 2000; Ferbeyre et al., 2000). Thus, mammalian Sir2a-mediated
regulation may also play
an important role in oncogene-induced premature senescence.
Attenuation of p53-mediated transactivation by Sir2a
Earlier studies indicated that p53-mediated transcriptional activation is
sufficient and also
absolutely required for its effect on cell growth arrest, while both
transactivation-dependent and -
independent pathways are involved in p53-mediated apoptosis (reviewed in
Prives and Hall,
1999; Vousden, 2000). p53 may be effective to induce apoptosis by activating
pro-apoptotic
genes ih vivo (reviewed in Nalcano and Vousden, 2001; Yu et al., 2001). Thus,
tight regulation
27
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
of pS3-mediated transactivation is critical for its effect on both cell growth
and apoptosis (Chao
et al., 2000; Jimenez et al., 2000).
Recent studies indicate that the intrinsic histone deacetylase activity of
Sir2a is essential
for its mediated functions (reviewed in Gurante, 2000). Reversible acetylation
was originally
identified in histones (reviewed in Cheung et al., 2000; Wolffe et al., 2000);
however,
accumulating evidence indicates that transcriptional factors are also
functional targets of
acetylation (reviewed in Serner and Bergen 2000; Kouzarides, 2000). Thus, the
transcriptional
attenuation mediated by histone deacetylases may act through the effects on
both histone and
non-histone transcriptional factors (Sterner and Berger, 2000; Kuo and Allis,
1998). Microarray
surveys for transcriptional effects of Sir2 in yeast revealed that Sir2
appears to repress amino
acid biosynthesis genes, which are not located at traditional "silenced" loci
(Bernstein et al.,
2000). Thus, in addition to silencing (repression) at telomeres, mating type
loci and ribosomal
DNA (reviewed in Guarente, 2000; Shore, 2000), Sir2 may also be targeted to
specific
endogenous genes for transcriptional regulation in yeast.
In contrast to the yeast counterpart Sir2, the mouse Sir2a protein does not
colocalize with
nucleoli, telomeres or centromeres by co-immunofluorescence assay, indicating
that this protein
is not associated with the most highly tandemly repeated DNA in the mouse
genome. The
immunostaining pattern of human SIRTl as well as mouse Sir2a indicates that
mammalian
Sir2cc is, similar to HDAC1, broadly localized in the nucleus, further
supporting the notion that
mammalian Sir2a may be recruited to specific target genes for transcriptional
regulation in vivo.
Mammalian Sir2a may inhibit pS3-mediated functions by attenuation of the
transcriptional activation potential of pS3. Since deacetylation of pS3 is
critical, but may not be
the only function mediated by this Sir2a-pS3 interaction, additional functions
mediated by Sir2a,
such as histone deacetylation, may also contribute to this regulation. As one
theory, riot meant to
be limiting, pS3 and Sir2a may strongly interact to deacetylate pS3 and
possibly recruit the pS3-
Sir2a complex to the target promoter. The subsequent transcription repression
may act both
through decreasing pS3 transactivation capability and through Sir2a-mediated
histone
deacetylation at the target promoter region. In contrast to HDAC 1-mediated
effect, this
transcriptional regulation is not affected by TSA treatment. Other cellular
factors may use a
similar mechanism to recruit Sir2a for TSA-insensitive transcriptional
regulation in mammalian
cells.
28
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
Novel implications for cancer therapy
Inactivation of p53 fiuictions has been well documented as a common mechanism
for
tumorigenesis (Hollstein et al., 1999; Vogelstein et al., 2000). Many cancer
therapy drugs have
been designed based on either reactivating p53 functions or inactivating p53
negative regulators.
Since p53 is strongly activated in response to DNA damage, mainly through
attenuation of the
Mdm2-mediated negative regulatory pathway (Maya et al., 2001), many DNA damage-
inducing
drugs such as etoposide are very effective antitumor drugs in cancer therapy
(reviewed in
Chresta and Hickman, 1996; Lutzker and Levine, 1996). Maximum induction of p53
acetylation
in normal cells, however, requires both types of deacetylase ii~lubitors in
addition to DNA
damage, and there may be at least three different p53 negative regulatory
pathways in
mammalian cells. Inhibitors for HDAC-mediated deacetylases, including sodium
butyrate, TSA,
SAHA and others, have been also proposed as antitumor drugs (Butler et al.,
2000; Finnin et al.,
1999; Taunton et al., 1996; Yoshida et al., 1995; Buckley et al., 1996).
Combining DNA
damage drugs, HDAC-mediated deacetylase inhibitors, and Sir2a-mediated
deacetylase
inhibitors, may have synergistic effects in cancer therapy for maximally
activating p53.
In contrast to PID/HDAC1-mediated p53 regulation (Luo et al., 2000), the
invention
shows that mammalian Sir2a-mediated effect on p53 is NAD-dependent, indicating
that this type
of regulation is closely linked to cellular metabolism (reviewed Guarente
2000; Alfred, 2000;
Campisi, 2000; Min et al., 2001). In fact, null mutants of NPT1, a gene that
functions in NAD
synthesis, show phenotypes similar to that of Sir2 mutants in gene silencing
(Smith et al., 2000)
and in life extension in response to caloric restriction in yeast (Lin et al.,
2000). Thus, metabolic
rate may play a role in Sir2a-mediated regulation of p53 function and,
perhaps, modulate the
sensitivity of cells in p53-dependent apoptotic response.
In yet another embodiment, the invention is a method of modulating p53-
mediated
apoptosis by modulating Sir2 activity. Sir2 activity can be modulated as
described' herein (e.g.,
overexpressing Sir2, transfecting a cell with a dominant negative regulating
gene). An increase
in Sir2 activity (e.g., by overexpressing Sir2) can result in a decrease in
p53-mediated apoptosis.
29
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
A decrease in Sir2 activity (e.g., transfecting a cell with a dominant
negative gene) can result in
an increase in p53-mediated apoptosis.
In still another embodiment, the invention is a method of screening for a
compound(e.g.,
a small organic or inorganic molecule) which modulates (e.g., increases or
decreases) Sir2-
mediated deacetylation of p53. In the method, Sir2, p53, NAD and/or an NAD
analog, and the
compound to be tested are combined, the Sir2-mediated deacetylation of p53 is
measured and
compared to the Sir2-mediated deacetylation of p53 measured in the absence of
the compound.
An increase in the Sir2-mediated deacetylation of p53 in the presence of the
compound being
tested compared to the Sir2-mediated deacetylation of p53 in the absence of
the compound
indicates that the compound increases Sir2 deacetylation of p53. Lileewise, a
decrease in the
Sir2-mediated deacetylation of p53 in the presence of the compound being
tested compared to
the Sir2-mediated deacetylation of p53 in the absence of the compound
indicates that the
compound decreases deacetylation of p53 by Sir2. As used herein, "Sir2-
mediated
deacetylation" refers to the NAD-dependent removal of acetyl groups which
requires Sir2.
In another embodiment, the present invention relates to a method of screening
a
compound by providing an in vitro test mixture comprising a transcription
factor or a fragment
thereof, Sir2, and a Sir2 cofactor with the compound, evaluating an activity
of a component of
the test mixture in the presence of the compound, and comparing the activity
in the presence of
the compound to a reference obtained in the absence of the compound.
In another embodiment, the present invention relates to a method of screening
a
compound that is a potential NAD analog by providing an in vitro test mixture
comprising a
transcription factor or a fragment thereof, Sir2, and the compound, evaluating
an activity of a
component of the test mixture in the presence of the compound, and comparing
the activity in the
presence of the compound to a reference obtained in the absence of the
compound,
In one embodiment the Sir2 is human, e.g., human SIRT1. In another embodiment,
the
Sir2 is marine, e.g., marine Sir2a.
In one embodiment the Sir2 cofactor is NAD or an NAD analog.
In another embodiment the transcription factor is p53 or a fragment thereof,
and it may be
acetylated and/or labeled.
In a further embodiment, the evaluated activity is Sir2 activity, e.g.,
deacetylation of a
protein, e.g., deacetylation of a histone protein, and/or deacetylation of the
transcription factor,
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
e.g., deacetylation of p53. The Sir2 activity may also be binding of a
protein, e.g., binding of a
histone protein and/or binding of the transcription factor, e.g.,. binding of
p53. The Sir2 activity
may be evaluated by detecting production of nicotinamide.
In a further embodiment, the evaluated activity is p53 activity The p53
activity may be
evaluated by detecting cell cycle arrest, apoptosis, senescence, and/or a
change in the levels of
transcription or translation products of a gene regulated by p53. Methods for
detecting such
changes and genes regulated by p53 are known in the art and include those
methods and genes
disclosed in U.S. Pat. No. 6,171,789, which is incorporated herein by
reference in its entirety.
In one embodiment, the test mixture is provided in a cell-free system.
In another embodiment, the test mixture is provided in a cell-based system,
wherein one
of the components is exogenous. The term "exogenous" refers to a component
that is either
added directly, or expressed from a heterologous DNA source, such as
transfected DNA. Many
methods are known in the art for expression of heterologous or exogenous gene
products.
In a further embodiment, the evaluated activity is an effect on the rate of
aging of a cell or
organism. Such an effect may be evaluated by contacting the compound with a
cell or organism
having p53 or Sir2 activity, e.g., endogenous or exogenous p53 or Sir2
activity; and evaluating
the rate of aging of the cell or organism. The rate of aging may be evaluated
by several methods,
including:
a) assessing the life span of the cell or organism;
b) assessing the presence or absence of a gene transcript or gene product in
the cell
or organism that has a biological age-dependent expression pattern;
c) evaluating resistance of the cell or organism to stress;
d) evaluating one or more metabolic parameters of the cell or organism;
e) evaluating the proliferative capacity of the cell or a set of cells present
in the
organism;
f) evaluating physical appearance, behavior, or other characteristic of the
cell or
organism; and
(g) assessing the presence or absence of a gene transcript or gene product in
the cell
or organism that has a p53-regulation-dependent expression pattern.
The compounds identified by the methods of the invention can be used, for
example, to
treat cancer (e.g., a compound which decreases Sir2-mediated deacetylation of
p53) or prevent
31
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
p53-mediated apoptosis (e.g., acompound which increases Sir2-mediated
deacetylation of p53).
The compounds can be used in methods of treating a cell or an organism, e.g.,
a cell or organism
that has been exposed to DNA-damaging ionizing radiation, by modulating Sir2
activity in the
cell. In the method of treating cancer in a mammal, Sir2 activity can be
reduced. In a preferred
embodiment, Sir2 activity is reduced by nicotinamide or a nicotinamide analog.
In yet another embodiment, the invention is a method of screening for analogs
of NAD.
In the method, Sir2, p53 and a compound to be tested as an analog of NAD
(e.g., a srilall organic
or inorganic molecule) are combined. Deacetylation of the p53 by the Sir2 is
measured and
compared to the measured deacetylation of p53 by Sir2 in the presence of NAD.
A compound
which, for example, promotes Sir2-mediated deacetylation of p53 when combined
with Sir2 and
p53, is an NAD analog and can be used in place of NAD, for example, as a
cofactor with Sir2 to
prevent or decrease p53-mediated apoptosis.
In a further embodiment, the invention is a method of treating cancer in a
mammal
comprising the step of modulating Sir2 activity in tumor cells to cause an
increase in p53
activity The Sir2 activity can be modulated as described herein (e.g.,
overexpression of Sir2,
transfection of a cell with a dominant negative regulatory gene, or
nicotinamide or a
nicotinamide analog).
In another embodiment, the invention includes a method of treating a cell that
has been
exposed to ionizing radiation, the method comprising modulating Sir2 activity
in the cell. In a
particular embodiment, in a cell which has undergone DNA damage or oxidative
stress, Sir2
activity can be modulated to reduce Sir2 activity (e.g., by transfecting a
cell with a dominant
negative regulatory gene, or by addition or expression of nicotinamide or a
nicotinamide analog)
which can result in the arrest of the growth cycle of the cell, allowing the
cell to repair at least a
portion of the DNA damage caused by the ionizing radiation. Once the cell has
repaired a
portion of the DNA damage, the reduction in Sir2 activity can be removed and
the cell cycle of
the cell resumed.
In still another embodiment, the invention includes an isolated protein
complex of Sir2
and acetylated p53. p53 cam also be phosphorylated (e.g., on one or both of
serine 15 or serine
20 of SEQ m NO. 3).
The compounds or NAD analogs identified by the methods of the invention can be
used
in the treatment of diseases or conditions such as cancer, or following DNA
damage or oxidative
32
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
stress. The compounds or NAD analogs can be administered alone or as mixtures
with
conventional excipients, such as pharmaceutically, or physiologically,
acceptable organic, or
inorganic earner substances such as water, salt solutions (e.g., Ringer's
solution), alcohols, oils
and gelatins. Such preparations can be sterilized and, if desired, mixed with
lubricants,
preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing
osmotic pressure,
buffers, coloring, andlor aromatic substances and the like which do not
deleteriously react with
the NAD analogs or compounds identified by the methods of the invention.
The dosage and frequency (single or multiple doses) of the compound or NAD
analog
administered to a mammal can vary depending upon a variety of factors,
including the duration
of DNA damage, oxidative stress or cancer condition.
In some embodiments of the present invention, the rate of aging of a cell,
e.g., a yeast
cell, invertebrate cell (e.g., fly cell), or vertebrate cell (e.g., mammalian
cell, e.g., human or
mouse cell) is determined. For example, the rate of aging of the cell can be
evaluated by
measuring the expression of one or more genes or proteins (e.g., genes or
proteins that have an
age-related expression pattern), by measuring the cell's resistance to stress,
e.g., genotoxic stress
or oxidative stress, by measuring one or more metabolic parameters (e.g.,
protein synthesis or
degradation, ubiquinone biosynthesis, cholesterol biosynthesis, ATP levels
within the cell,
glucose metabolism, nucleic acid metabolism, ribosomal translation rates,
etc.), by measuring
cellular proliferation, or any combination of measurements thereof.
In other embodiments, the rate of aging of an organism, e.g., an invertebrate
(e.g., a worm
or a fly) or a vertebrate (e.g., a rodent, e.g., a mouse) is determined. The
rate of aging of an
organism can be determined by directly measuring the average life span of a
group of animals
(e.g., a group of genetically matched animals) and comparing the resulting
average to the
average life span of a control group of animals (e.g., a group of animals that
did not receive the
test compound but are genetically matched to the group of animals that did
receive the test
compound). Alternatively, the rate of aging of an organism can be determined
visually, e.g., by
looking for visible signs of age (e.g., physical appearance or behavior), by
measuring the
expression of one or more genes or proteins (e.g., genes or proteins that have
an age-related
expression pattern), by measuring the cell's resistance to genotoxic (e.g.,
caused by exposure to
etoposide, W irradiation, mutagens, etc.) or oxidative stress, by measuring
one or.more
metabolic parameters (e.g., protein synthesis or degradation, ubiquinone
biosynthesis, cholesterol
33
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
biosynthesis, ATP levels, glucose metabolism, nucleic acid metabolism,
ribosomal translation
rates, etc.), by measuring cellular proliferation (e.g., of retinal cells,
bone cells, white blood cells,
etc.), or any combination of measurements thereof. In one embodiment, the
visual assessment is
for evidence of apoptosis, e.g., nuclear fragmentation.
All animals typically go through a period of growth and maturation followed by
a period
of progressive and irreversible physiological decline ending in death. The
length of time from
birth to death is known as the life span of an organism, and each organism has
a characteristic
average life span. Aging is a physical manifestation of the charges underlying
the-passage of
time as measured by percent of average life span.
In some cases, characteristics of aging can be quite obvious. For example,
characteristics
of older humans include skin wrinkling, graying of the hair, baldness, and
cataracts, as well as
hypermelanosis, osteoporosis, cerebral cortical atrophy, lymphoid depletion,
thymic atrophy,
increased incidence of diabetes type II, atherosclerosis, cancer, and heart
disease. Nehlin et al.
(2000), Annals NY Acad Sci 980:176-79. Other aspects of mammalian aging
include weight
loss, lordokyphosis (hunchback spine), absence of vigor, lymphoid atrophy,
decreased bone
density, dermal thickening and subcutaneous adipose tissue, decreased ability
to tolerate stress
(including heat or cold, wounding, anesthesia, and hematopoietic precursor
cell ablation), Iiver
pathology, atrophy of intestinal villi, skin ulceration, amyloid deposits, and
joint diseases. Tyner
et al. (2002), Nature 415:45-53.
Careful observation reveals characteristics of aging in other eukaryotes,
including
invertebrates. For example, characteristics of aging in the model organism C.
elegans include
slow movement, flaccidity, yolk accumulation, intestinal autofluorescence
(lipofuscin), loss of
ability to eat food or dispel waste, necrotic cavities in tissues, and germ
cell appearance.
Those skilled in the art will recognize that the aging process is also
manifested at the
cellular level, as well as in mitochondria. Cellular aging is manifested in
loss of doubling
capacity, increased levels of apoptosis, changes in differentiated phenotype,
and changes in
metabolism, e.g., decreased levels of protein synthesis and turnover.
Given the programmed nature of cellular and organismal aging, it is possible
to evaluate
the "biological age" of a cell or organism by means of phenotypic
characteristics that are
correlated with aging. For example, biological age can be deduced from
patterns of gene
expression, resistance to stress (e.g., oxidative or genotoxic stress), rate
of cellular proliferation,
34
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
and the metabolic characteristics of cells (e.g., rates of protein synthesis
and turnover,
mitochondrial function, ubiquinone biosynthesis, cholesterol biosynthesis, ATP
levels within the
cell, levels of a Krebs cycle intermediate in the cell, glucose metabolism,
nucleic acid
metabolism, ribosomal translation rates, etc.). As used herein, "biological
age" is a measure of
the age of a cell or organism based upon the molecular characteristics of the
cell or organism.
Biological age is distinct from "temporal age," which refers to the age of a
cell or organism as
measured by days, months, and years.
Described below are exemplary methods for identifying compounds that can
reduce the
rate of aging of an organism and thereby slow or ameliorate the pathologies
associated with
increased temporal age. Activation of p53 may lead to cell cycle arrest or to
apoptosis; Sir2 can
suppress this effect by deacetylating p53. Accordingly, the expression or
activity of p53 andlor
Sir2 gene products in an organism can be a determinant of the rate of aging
and life span of the
organism. Reduction in the level and/or activity of such gene products would
reduce the rate of
aging and may ameliorate (at least temporarily) the symptoms of aging. A
variety of techniques
may be utilized to inhibit the expression, synthesis, or activity of such
target genes andlor
proteins. Such molecules may include, but are not limited to small organic
molecules, peptides,
antibodies, antisense, ribozyme molecules, triple helix molecules, and the
like.
The following assays provide methods (also referred to herein as "evaluating a
compound" or "screening a compound") for identifying modulators, i.e.,
candidate or test
compounds (e.g., peptides, peptidomimetics, small molecules or other drugs)
which modulate
Sir2 or p53 activity, e.g., have a stimulatory or inhibitory effect on, for
example, Sir2 or p53
expression or activity, or have a stimulatory or inhibitory effect on, for
example, the expression
or activity of a Sir2 or p53 substrate. Such compounds can be agonists or
antagonists of Sir2 or
p53 function. These assays may be performed in animals, e.g., mammals, in
organs, in cells, in
cell extracts, e.g., purified or unpurified nuclear extracts, intracellular
extracts, in purified
preparations, in cell-free systems, in cell fractions enriched for certain
components, e.g.,
organelles or compounds, or in other systems known in the art. Given the
teachings herein and
the state of the art, a person of ordinary skill in the art would be able to
choose an appropriate
system and assay for practicing the methods of the present invention.
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
Some exemplary screening assays for assessing activity or function include one
or more
of the following features:
- use of a transgenic cell, e.g., with a transgene encoding Sir2 or p53 or a
mutant thereof;
- use of a mammalian cell that expresses Sir2 or p53;
- detection of binding of a labeled compound to Sir2 or a transcription factor
where the
compound is, for example, a peptide, protein, antibody or small organic
molecule; e.g., the
compound interferes with or disrupts an interaction between Sir2 and a
transcription factor
- use of proximity assays that detect interaction between Sir2 and a
transcription factor
(e.g., p53), or fragments thereof, for example, fluorescence proximity
assays..
- use of a two hybrid assay to detect interaction between Sir2 and a
transcription factor
(e.g., p53) or fragments thereof. In some instances, the two hybrid assay can
be evaluated in the
presence of a test compound, e.g., to determine if the test compound disrupts
or interferes with
an interaction. Two hybrid assays can, for example, be conducted using yeast
or bacterial
systems.
- use of radio-labelled substrates, e.g. 355, 3H,14C, e.g., to determine
acetylation status,
metabolic status, rate of protein synthesis, iyater alia.
- use of antibodies specific for certain acetylated or de-acetylated forms of
the substrate.
One embodiment herein accordingly comprises methods for the identification of
small molecule
drug candidates from large libraries of compounds that appear to have
therapeutic activity to
affect metabolic maintenance and/or to reverse or prevent cell death and thus
exhibits potential
therapeutic utility, such as the ability to enhance longevity. Small organic
molecules and
peptides having effective inhibitory activity may be designed de novo,
identified through assays
or screens, or obtained by a combination of the two techniques. Non-protein
drug design may be
carried out using computer graphic modeling to design non-peptide, organic
molecules able to
bind to p53 or Sir2. The use of nuclear magnetic resonance (NMR) data for
modeling is also
lcnown in the art, as described by Lam et al., Scieh.ce 263: 380, 1994, using
information from x-
ray crystal structure studies of p53 or Sir2, such as that described in Min,
J. et al., Cell 105:269-
279, 2001.
Small molecules may also be developed by generating a library of molecules,
selecting
for those molecules which act as ligands for a specified target, (using
protein functional assays,
for example), and identifying the selected ligands. See, e.g., Kohl et al.,
Scieface 260: 1934,
36
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
1993. Techniques for constructing and screening combinatorial libraries of
small molecules or
oligomeric biomolecules to identify those that specifically bind to a given
receptor protein are
known. Suitable oligomers include peptides, oligonucleotides, carbohydrates,
nonoligonucleotides (e.g., phosphorothioate oligonucleotides; see Chem. and
Engineering News,
page 20, 7 Feb. 1994) and nonpeptide polymers-(see, e.g., "peptoids" of Simon
et al., Proc. Natl.
Acad. Sci. USA 89 9367, 1992). See also U.S. Pat. No. 5,270,170 to Schatz;
Scott and Smith,
Science 249: 386-390, 1990; Devlin et al., Science 249: 404-406, 1990;
Edgington,
BIOlTechnology, 11: 285, 1993. Libraries may be synthesized in solution on
solid supports, or
expressed on the surface of bacteriophage viruses (phage display libraries).
Known screening methods may be used by those skilled in the art to screen
combinatorial
libraries to identify active molecules. For example, an increase (or decrease)
in pS3 or Sir2
activity due to contact with an agonist or antagonist can be monitored.
In one embodiment, assays for screening candidate or test compounds that are
substrates
of a Sir2 or p53 protein or polypeptide or biologically active portion thereof
are provided. In
another embodiment, assays for screening candidate or test compounds which
bind to or
modulate the' activity of a Sir2 or pS3 protein or polypeptide or biologically
active portion
thereof, e.g., modulate the ability of Sir2 or pS3 to interact with a ligand,
are provided. In still
another embodiment, assays for screening candidate or test compounds for the
ability to bind to
or modulate the activity of a Sir2 or pS3 protein or polypeptide and to also
alter the rate of aging
of a cell or an organism are provided.
Examples of methods for the synthesis of molecular libraries can be found in
the art, for
example in: DeWitt et al., Proc. Natl. Acad. Sci. U.S.A. 90: 6909, 1993; Erb.
et al., Proc. Natl.
Acad. Sci. USA 91: 11422, 1994; Zuckermann et al., J. Med. Clzem. 37: 2678,
1994; Cho et al.,
Science 261: 1303, 1993; Carrell et al., Angew. Claena. Int. Ed. Engl. 33:
2059, 1994; Carell et
al., Angew. Clzem. Int. Ed. Engl. 33: 2061, 1994; and in Gallop et al., J.
Med. Chem. 37:1233,
1994.
Libraries of compounds may be presented in solution (e.g., Houghten,
Biotechniques 13:
4I2-421, 1992), or on beads (Lam, Nature 354: 82-84, 1991), chips (Fodor,
Nature 364: SSS-
556, 1993), bacteria (Ladner U.S. P.N. 5,223,409), spores (Ladner U.S. P.N.
'409), plasmids (Cull
et al., P~oc Natl Acad Sci USA 89: 1865-1869, 1992) or on phage (Scott and
Smith, Science 249:
37
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
386-390, 1990); (Devlin, Science 249: 404-406, 1990); (Cwirla et al., P~oc.
Natl. Acad. Sci
U.S.A. 87: 6378-6382, 1990); (Felici, J. Mol. Biol. 222: 30I-310, 1991);
(Ladner supra.).
The compounds tested as modulators of Sir2 or p53 can be any small chemical
compound, or a biological entity, such as a protein, e.g., an antibody, a
sugar, a nucleic acid, e.g.,
an antisense oligonucleotide or a ribozyme, or a lipid. Alternatively,
modulators can be
genetically altered versions of Sir2 or p53. Typically, test compounds will be
small chemical
molecules and peptides, or antibodies, antisense molecules, or ribozymes.
Essentially any
chemical compound can be used as a potential modulator or ligand in the assays
of the invention,
although most often compounds that can be dissolved in aqueous or organic
(especially DMSO-
based) solutions are used. The assays are designed to screen large chemical
libraries by
automating the assay steps and providing compounds from any convenient source
to assays,
which are typically run in parallel (e.g., in microtiter formats on microtiter
plates in robotic
assays). It will be appreciated that there are many suppliers of chemical
compounds, including
Sigma (St. Louis, MO), Aldrich (St. Louis, MO), Sigma-Aldrich (St. Louis, MO),
Fluka
Chemika-Biochemica Analytika (Buchs Switzerland) and the like.
In one preferred embodiment, high throughput screening methods known to one of
ordinary skill in the art involve providing a combinatorial chemical or
peptide library containing
a large number of potential therapeutic compounds (potential modulator or
ligand compounds).
Such "combinatorial chemical libraries" or "ligand libraries" are then
screened in one or more
assays, as described herein, to identify those library members (particular
chemical species or
subclasses) that display a desired characteristic activity. The compounds thus
identified can
serve as conventional "lead compounds" or can themselves be used as potential
or actual
therapeutics.
A combinatorial chemical library is a collection of diverse chemical compounds
generated by either chemical synthesis or biological synthesis, by combining a
number of
chemical "building blocks" such as reagents. For example, a linear
combinatorial chemical
library such as a polypeptide library is formed by combining a set of chemical
building blocks
(amino acids) in every possible way for a given compound length (i.e., the
number of amino
acids in a polypeptide compound). Millions of chemical compounds can be
synthesized through
such combinatorial mixing of chemical building blocks. Moreover, a
combinatorial library can
38
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
be designed to sample a family of compounds based on a parental compound,
e.g., based on the
chemical structure of NAD or nicotinamide.
Preparation and screening of combinatorial chemical libraries is well known to
those of
skill in the art. Such combinatorial chemical libraries include, but are not
limited to, peptide
Libraries (see, e.g., U.S. Patent 5,010,175, Furlca, Irat. J. Pept. Prot. Res.
37:487-493 (1991) and
Houghton et al., Nature 354:84-88 (1991)). Other chemistries for generating
chemical diversity
libraries can also be used. Such chemistries include, but are not limited to:
peptoids (e.g., PCT
Publication No. WO 91/19735), encoded peptides (e.g., PCT Publication No. WO
93/20242),
random bio-oligomers (e.g., PCT Publication No. WO 92/00091), benzodiazepines
(e.g., U.S.
Pat. No. 5,288,514), diversomers such as hydantoins, benzodiazepines and
dipeptides (Hobbs et
al., Proc. Nat. Acad. Sci. USA 90:6909-6913 (1993)), vinylogous polypeptides
(Hagihara et al.,
J. AnZeY Chena. Soc. 114:6568 (1992)), nonpeptidal peptidomimetics with
glucose scaffolding
(Hirsclmlann et al., J. Amer Chem. Soc. 114:9217-9218 (1992)), analogous
organic syntheses of
small compound libraries (Chen et al., J. Amef: C7Zem. Soc. 116:2661 (1994)),
oligocarbamates
(Cho et al., Science 261:1303 (1993)), and/or peptidyl phosphonates (Campbell
et al., J. Org.
Chem. 59:658 (1994)), nucleic acid libraries (see Ausubel, Berger and
Sambrook, all supra),
peptide nucleic acid libraries (see, e.g., U.S. Patent 5,539,083), antibody
libraries (see, e.g.,
Vaughn et al., Nature Biotechnology, 14(3):309-314 (1996) and
PCT/LTS96/10287), carbohydrate
Libraries (see, e.g., Liang et al., Science, 274:1520-1522 (1996) and U.S.
Patent 5,593,853), small
organc molecule libraries (see, e.g., benzodiazepines, Baum C&EN, Jan 18, page
33 (1993);
isoprenoids, U.S. Patent 5,569,588; thiazolidinones and metathiazanones, U.S.
Patent 5,54.9,974;
pyrrolidines, U.S. Patents 5,525,735 and 5,519,134; morpholino compounds, U.S.
Patent
5,506,337; benzodiazepines, 5,288,514, and the like).
Devices for the preparation of combinatorial libraries are commercially
available (see,
e.g., 357 MPS, 390 MPS, Advanced Chem Tech, Louisville ICY, Symphony, Rainin,
Woburn,
MA, 433AApplied Biosystems, Foster City, CA, 9050 Plus, Millipore, Bedford,
MA). In
addition, numerous combinatorial libraries are themselves commercially
available (see, e.g.,
ComGenex, Princeton, N.J., Asinex, Moscow, Ru, Tripos, Inc., St. Louis, MO,
ChemStar, Ltd,
Moscow, RU, 3D Pharmaceuticals, Exton, PA, Martelc Biosciences, Columbia, MD,
etc.).
In one embodiment, the invention provides solid phase based in vitro assays in
a high
throughput format, e.g., where each assay includes a cell or tissue expressing
Sir2 and/or p53. In
39
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
a high throughput assays, it is possible to screen up to several thousand
different modulators or
ligands in a single day. In particular, each well of a microtiter plate can be
used to run a separate
assay against a selected potential modulator, or, if concentration or
incubation time effects are to
be observed, every S-10 wells can test a single modulator. Thus, a single
standard microtiter
plate can assay about 96 modulators. If 1536 well plates are used, then a
single plate can easily
assay from about 100- about 1500 different compounds. It is possible to assay
many plates per
day; assay screens for up to about 6,000, 20,000, 50,000, or 100,000 or more
different
compounds are possible using the integrated systems of the invention.
Candidate Sir2- or p53-interacting molecules encompass many chemical classes.
They
can be organic molecules, preferably small organic compounds having molecular
weights of 50
to 2,500 Daltons. The candidate molecules comprise functional groups necessary
for structural
interaction with proteins, particularly hydrogen bonding, for example,
carbonyl, hydroxyl, and
carboxyl groups. The candidate molecules can comprise cyclic carbon or
heterocyclic structures
and aromatic or polyaromatic structures substituted with the above groups. In
one embodiment,
the candidate molecules are structurally and/or chemically related to NAD or
to nicotinamide.
Other techniques are known in the art for screening synthesized molecules to
select those
with the desired activity, and for labeling the members of the library so that
selected active
molecules may be identified, as in U.S. P.N. 5,283,173 to Fields et al., (use
of genetically altered
Saccharomyces cerevisiae to screen peptides for interactions). As used herein,
"combinatorial
library" refers to collections of diverse ohigomeric biomolecuhes of differing
sequence, which can
be screened simultaneously for activity as a ligand for a particular target.
Combinatorial libraries
may also be referred to as "shape libraries", i.e., a population of randomized
fragments that are
potential ligands. The shape of a molecule refers to those features of a
molecule that govern its
interactions with other molecules, including Van der Waals, hydrophobic,
electrostatic and
dynamic.
Nucleic acid molecules may also act as ligands for receptor proteins. See,
e.g.,
Edgington, BIOlTechfzology 11: 285, 1993. U.5. P.N. 5,270,163 to Gold and
Tuerk describes a
method for identifying nucleic acid ligands for a given target molecule by
selecting from a
library of RNA molecules with randomized sequences those molecules that bind
specifically to
the target molecule. A method for the in vitro selection of RNA molecules
immunohogically
cross-reactive with a specific peptide is disclosed in Tsai et al., P~oc.
Natl. Acad. Sci. USA 89:
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
8864, (1992); and Tsai et al. Immunology 150:1137, (1993). In the method, an
antiserum raised
against a peptide is used to select RNA molecules from a library of RNA
molecules; selected
RNA molecules and the peptide compete for antibody binding, indicating that
the RNA epitope
functions as a specific inhibitor of the antibody-antigen interaction.
Antibodies that are both specific for a target gene protein and that interfere
with its
activity may be used to inhibit target gene function. Such antibodies may be
generated using
standard techniques, against the proteins themselves or against peptides
corresponding to
portions of the proteins. Such antibodies include but are not limited to
polyclonal, monoclonal,
Fab fragments, single chain antibodies, chimeric antibodies, and the like.
Where fragments of
the antibody are used, the smallest inhibitory fragment which binds to the
target protein's binding
domain is preferred. For example, peptides having an amino acid sequence
corresponding to the
domain of the variable region of the antibody that binds to the target gene
protein may be used.
Such peptides may be synthesized chemically or produced via recombinant DNA
technology
using methods well known in the art (e.g., see Sambrook et al., Eds.,
Molecular Cloning: A
Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, (1989), or
Ausubel, F. M. et
al., eds. Current Protocols in Molecular Biology (1994).
Alternatively, single chain neutralizing antibodies that bind to intracellular
target gene
epitopes may also be administered. Such single chain antibodies may be
administered, for
example, by expressing nucleotide sequences encoding single-chain antibodies
within the target
cell population by utilizing, for example, techniques such as those described
in Marasco et al.,
PYOC. Natl. Acad. Sci. USA 90: 7889-7893 (1993).
Also encompassed are assays for cellular proteins that interact with Sir2 or
p53. Any
method suitable for detecting protein-protein interactions may be used. The
traditional methods
that may be used include, for example, co-immunoprecipitation, crosslinking,
and co-purification
through gradients or chromatographic columns. For these assays, Sir2 or p53
can be a full-
length protein or an active fragment. Additional methods include those methods
that allow for
the simultaneous identification of genes that encode proteins that interact
with Sir2 or p53.
These methods include, for example, probing expression libraries using a
labeled Sir2 or p53
protein, Sir2 or p53 fragment, or Sir2 or p53 fusion protein.
One method to detect protein-protein interaction in vivo is the two-hybrid
system, see, for
example, Chien et al., Proc. Natl. Acad. Sci, USA 88: 9578-9582 (1991). In
brief, the two-hybrid
41
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
system utilizes plasmids constructed to encode two hybrid proteins: one
plasmid comprises the
nucleotides encoding the DNA binding domain of a transcriptional activator
protein fused to the
Sir2 or p53 nucleotide sequence encoding the Sir2 or p53 polypeptide, and the
other plasmid
comprises the nucleotides encoding the transcriptional activator protein's
activation domain
fused to a cDNA encoding an unknown protein that has been recombined into the
plasmid from a
cDNA library. The DNA binding domain fusion plasmid and the cDNA fusion
protein library
plasmids are transformed into a strain of yeast that contains a reporter gene,
for example lacZ,
whose regulatory region contains the activator's binding site. Either hybrid
protein alone cannot
activate translation of the reporter gene because it is lacking either the DNA
binding domain or
the activator domain. Interaction of the two hybrid proteins, however,
reconstitutes a functional
activator protein and results in activation of the reporter gene that is
detected by an assay for the
reporter gene product. The colonies that reconstitute activator activity are
purified and the
library plasmids responsible for reporter gene activity are isolated and
sequenced. The DNA
sequence is then used to identify the protein encoded by the library plasmid.
Macromolecules that interact with Sir2 or p53 are referred to as Sir2 or p53
binding
partners. Sir2 or p53 binding partners are likely to be involved in the
regulation of Sir2 or p53
function. Therefore, it is possible to identify compounds that interfere with
the interaction
between Sir2 or p53 and its binding partners. The basic principle of assay
systems used to
identify compounds that interfere with the interaction of Sir2 or p53 and a
binding partner is to
prepare a reaction mixture containing Sir2 or p53 or a Sir2 or p53 fragment
and the binding
partner under conditions that allow complex formation. The reaction mixture is
prepared in the
presence or absence of the test compound to test for inhibitory activity The
test compound may
be added prior to or subsequent to Sir2/ or p53/binding partner complex
formation. The
formation of a complex in a control but not with the test compound confirms
that the test
compound interferes with complex formation. The assay can be conducted either
in the solid
phase or in the liquid phase.
In another embodiment, an assay is a cell-based assay comprising contacting a
cell
expressing Sir2 or p53 with a test compound and determining the ability of the
test compound to
modulate (e.g. stimulate or inhibit) the activity of Sir2 or p53. A preferred
activity is the
deacetylation function of Sir2 on p53; a further preferred activity is the
ability of p53 to cause
ERU cycle arrest or apoptosis. Determining the ability of the test compound to
modulate the
42
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
activity of Sir2 or p53 can be accomplished, for example, by determining the
ability of Sir2 or
p53 to bind to or interact with the test molecule, or by determining the
ability of the test
molecule to stimulate or inhibit the activity of Sir2 or p53. Cell-based
systems can be used to
identify compounds that inhibit Sir2 or p53. Such cells can be recombinant or
non-recombinant,
such as cell lines that express the Sir2 or p53 gene. Preferred systems are
mammalian or yeast
cells that express Sir2 or p53. In utilizing such systems, cells are exposed
to compounds
suspected of ameliorating body weight disorders or increasing lifespan. After
exposure, the cells
are assayed, for example, for expression of the Sir2 or p53 gene or activity
of the Sir2 or p53
protein. Alternatively, the cells are assayed for phenotypes such as those
resembling body
weight disorders or lifespan extension. The cells may also be assayed for the
inhibition of the
deacetylation function of Sir2 on p53, or the apoptotic or cytostatic function
of p53.
Another preferred cell for a cell-based assay comprises a yeast cell
transformed with a
vector comprising the Sir2 or p53 gene. One use for a yeast cell expressing
Sir2 or p53 is to
mutagenize the yeast and screen for yeast that will survive only when the Sir2
or p53 polypeptide
is functioning normally. Synthetic lethal screens are described in Holtzman et
al. (1993), J. Cell
Bio. 122: 635-644. The yeast that require Sir2 or p53 function for survival
can then be used to
screen test compounds for those that iWibit Sir2 or p53 activity. Test
compounds that results in a
decrease in yeast survival are likely inhibitors of Sir2 or p53 in this
system.
In yet another embodiment, an assay is a cell-free assay in which Sir2 or p53
protein or
biologically active portion thereof is contacted with a test compound and the
ability of the test
compound to bind to the Sir2 or p53 protein or biologically active portion
thereof is determined.
Binding of the test compound to the Sir2 or p53 protein can be determined
either directly or
indirectly as described above. In a preferred embodiment, the assay includes
contacting the Sir2
or p53 protein or biologically active portion thereof with a known compound
which binds Sir2 or
p53 to form an assay mixture, contacting the assay mixture with a test
compound, and
determining the ability of the test compound to interact with an Sir2 or p53
protein, wherein
determining the ability of the test compound to interact with an Sir2 or p53
protein comprises
determining the ability of the test compound to preferentially bind to Sir2 or
p53 or a
biologically active portion thereof as compared to the known compound.
W yet another embodiment, an assay is a cell-free system in which Sir2 protein
or
biologically active portion thereof is contacted with p53 protein or
biologically active portion
43
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
thereof, to form a mixture comprising a detectable amount bound p53:Sir
complex. And a test
compound is contacted with the mixture, and the ability of the compound to
effect the stability or
formation of the p53:Sir2 complex is determined. Interaction of the test
compound with he
p53:Sir2 complex may be determined directly or by methods known in the art. W
a preferred
embodiment, the method comprises contacting p53 with Sir2 to form a mixture
comprising the
p53:Sir2 complex, further contacting the mixture with a compound to be tested,
and evaluating
the binding kinetics of p53:Sir2 complex both in the presence and the absence
of the test
compound to directly bind the p53:Sir2 complex is evaluated. The cell-free
assays are amenable
to use of both soluble and/or membrane-bound forms of proteins. In the case of
cell-free assays
in which a membrane-bound form of a protein is used it may be desirable to
utilize a solubilizing
agent such that the membrane-bound form of the protein is maintained in
solution. Examples of
such solubilizing agents include non-ionic detergents such as n-
octylglucoside, n-
dodecylglucoside, n-dodecylmaltoside, octanoyl-N-methylglucamide, decanoyl-N-
methylglucamide, Triton X-100, Triton X-114, Thesit, Isotridecypoly(ethylene
glycol ether)n, 3-
[(3-cholamidopropyl)dimethylammonio]-1-propane sulfonate (CHAPS), 3-[(3-
cholamidopropyl)dimethylammonio]-2-hydroxy-1-propane sulfonate (CHAPSO), or N-
dodecyl,N,N-dimethyl-3-amino-1-propane sulfonate.
In more than one embodiment of the above assay methods, it may be desirable to
immobilize either Sir2 or p53 or its target molecule to facilitate separation
of complexed from
uncomplexed forms of one or both of the proteins, as well as to accommodate
automation of the
assay. Binding of a test compound to an Sir2 or p53 protein, or interaction of
an Sir2 or p53
protein with a target molecule in the presence and absence of a candidate
compound, can be
accomplished in any vessel suitable for containing the reactants. Examples of
such vessels
include microtiter plates, test tubes, and micro-centrifuge tubes. In one
embodiment, a fusion
protein can be provided which adds a domain that allows one or both of the
proteins to be bound
to a matrix. For example, glutathione-S-transferase/Sir2 or /p53 fusion
proteins or glutathione-S-
transferase/target fusion proteins can be adsorbed onto glutathione sepharose
beads (Sigma
Chemical, St. Louis, Mo.) or glutathione derivatized microtitre plates, which
are then combined
with the test compound or the test compound and either the non-adsorbed target
protein or Sir2
or p53 protein, and the mixture incubated under conditions conducive to
complex formation
(e.g., at physiological conditions for salt and pH). Following incubation, the
beads or microtiter
44
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
plate wells are washed to remove any unbound components, the matrix
immobilized in the case
of beads, complex determined either directly or indirectly, for example, as
described above.
Alternatively, the complexes can be dissociated from the matrix, and the level
of Sir2 or p53
binding or activity deternlined using standard techniques.
Other techniques for immobilizing proteins on matrices can also be used in the
screening
assays of the invention. For example, either a Sir2 or p53 protein or a Sir2
or p53 target molecule
can be immobilized utilizing conjugation of biotin and streptavidin.
Biotinylated Sir2 or p53
protein or target molecules can be prepared from biotin-NHS (N-hydroxy-
succinimide) using
techniques well known in the art (e.g., biotinylation kit, Pierce Chemicals,
Rockford, Ill.), and
immobilized in the wells of streptavidin-coated 96 well plates (Pierce
Chemical). Alternatively,
antibodies reactive with Sir2 or p53 protein or target molecules but which do
not interfere with
binding of the Sir2 or p53 protein to its target molecule can be derivatized
to the wells of the
plate, and unbound target Sir2 or p53 protein trapped in the wells by antibody
conjugation.
Methods for detecting such complexes, in addition to those described above for
the GST
irninobilized complexes, include immunodetection of complexes using antibodies
reactive with
the Sir2 or p53 protein or target molecule, as well as enzyme-linked assays
which rely on
detecting an enzymatic activity associated with the Sir2 or p53 protein or
target molecule.
In addition to cell-based and in vitro assay systems, non-human organisms,
e.g.,
transgenic non-human organisms, can also be used. A transgenic organism is one
in which a
heterologous DNA sequence is chromosomally integrated into the germ cells of
the animal. A
transgenic organism will also have the transgene integrated into the
chromosomes of its somatic
cells. Organisms of any species, including, but not limited to: yeast, worms,
flies, fish, reptiles,
birds, mammals (e.g., mice, rats, rabbits, guinea pigs, pigs, micro-pigs, and
goats), and non-
human primates (e.g., baboons, monkeys, chimpanzees) may be used in the
methods of the
invention.
Accordingly, in another embodiment, the invention features a method of
identifying a
compound that alters the rate of aging of a cell or an organism, comprising:
contacting a Sir2 or
p53 polypeptide with a test compound; evaluating an interaction between the
test compound and
the Sir2 or p53 polypeptide; and further evaluating the effect of the test
compound on the rate of
aging of a cell or organism.
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
The interaction between a test compound and the Sir2 or p53 polypeptide can be
performed by any of the methods described herein, e.g., using cell-based
assays or cell-free irZ
vitro assays. Weather the interaction between the test compound and the Sir2
or p53 polypeptide
is evaluated prior to the evaluation of the effect of the text compound on the
rate of aging of a
cell or organism is not critical to the method. However, it is preferable to
evaluate the interaction
between the test compound and Sir2 or p53 polypeptide first, so that test
compounds that do not
interact with the Sir2 or p53 polypeptide do not have to be tested for their
effect upon the rate of
aging. It can also be preferable to use an assay for evaluating the
interaction between the test
compound and the Sir2 or p53 polypeptide that can be adapted for lugh
throughput screening,
thus making it possible to screen one or more libraries of test compounds.
Possible test
compounds include, e.g., small organic molecules, peptides, antibodies, and
nucleic acid
molecules, as described above.
The rate of aging of an organism can be determined using methods known in the
art. For
example, the rate of aging of an organism can be determined by directly
measuring the life span
of the organism. Preferably, a statistical measure, e.g., an average or median
value, of the life
span of a group of animals, e.g., a group of genetically matched animals, will
be determined and
the resulting statistical value compared to an equivalent statistical value,
e.g, an average of
median value, of the life span of a control group of animals, e.g., a group of
animals that did not
receive the test compound but are genetically matched to the group of animals
that did receive
the test compound. Such methods are suitable for organisms that have a short
life span, such as
worms or flies. See, for example, Rogina et al. (2000), SciefZCe 290:2137-40.
Direct
measurement of life span can also be preformed with other organisms such as
rodents, as
discussed, for example, in Weindruch et al. (196), .Iouf°nal
ofNutritiora 116(4):641-54. Those
skilled in the art will recognize that there are many ways of measuring the
statistical difference
(e.g., using the Student's T test) between two sets of data, any of which may
be suitable for the
methods of the invention.
To reduce the time that it takes to measure a change in the rate of aging
using data on the
Iife span of the organisms treated with the test compound, various
modifications or treatments of
the organisms can be implemented. For example, anmals fed on a calorically
rich diet tend to
live shorter lives, thus reducing the time that needs to elapse to determine
when the average life
span of the test group of animals has exceeded the average life span of the
control group of
46
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
animals. Alternatively, the test compound can be administered to test animals
that have already
lived for 50%, 60%, 70%, 80%, 90%, or more of their expected life span. Thus,
the test
compound can be administered to an adult organism, or even an old adult
organism. Other
possibilities include the use of genetically modified organisms. For example,
the organisms
could harbor mutations (e.g., a Hyperhinetic~ or Shapers mutation in
Drosoplzila, or a mutation in
a silent information regulator gene (e.g., Sir2), or a catalase or superoxide
dismutase gene) or
transgenes (e.g., encoding a transporter protein (e.g., a carboxylate
transport protein such as
INDY) or a protein involved in insulin signaling and metabolic regulation
(e.g., IGF-1)) that
reduce their average Iife span. See Rogina et al. (1997), Pi°oc. Natl.
Acad. Sci., USA 94:6303-6;
Rogina and Helfand (2000), Biogerofztology 1:163-9; and Guarente and Kenyon
(2000), Nature
408:255-62. Those skilled in the art will understand that it may also be
desirable to practice the
methods of the invention using organisms that are long-lived, such as
calorically restricted
animals, or animals carrying mutations or transgenes that increase their Iife
span.
A proxy for rate of aging of a cell or an organism can be determined using
biomarkers
that are indicative of the biological age of the organism (i.e., age-related
parameters). Using
biomarkers for determining biological age can greatly facilitate screens for
compounds that alter
the rate of aging, as they bypass the requirement of waiting for the animal to
die in order to
determine the rate of aging. Biomarkers suitable for use in the present
invention include, but are
not limited to, levels of protein modification, e.g., accumulation of
glycosylated proteins, rates or
levels of protein turnover, levels or composition of T cell populations,
protein activity, physical
characteristics, macular degeneration, and/or increased copper and zinc
concentrations in
neuronal tissues. The expression of genes whose regulation is biological age-
dependent is a
particularly preferred biomarker for use in the methods of the invention.
Numerous genes are
known to be expressed in a biological age-dependent manner. In Drosophila, for
example, such
genes include wingless and engrailed. See Rogina and Helfand (1997),
Meclzaniszns of
Development 63:89-97. In mice, the expression of the ras oncogene is elevated
in older animals.
See Hass et al. (1993), Mutat. Res. 295(4-6):281-9. Similarly, in rodents and
worms, genes that
are differentially expressed in young and old organisms have been identified
by transcriptional
profiling using microarrays. See, e.g., Lee et al. (1999), Science 285:1390-
93; WO 01/12851;
and Hill et al. (2000), Science 290:809-812. For example, Hill et al. (2000)
Science 90:809
discloses genes whose transcripts are up-regulated in nematodes that are at 2
weeks in
47
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
development. Examples of such genes include the genes described in cluster
(4,1):69 of Hill,
supra. Any gene whose regulation is biological age-dependent is suitable for
the methods of the
invention. Preferably, more than one gene is analyzed so as to improve the
accuracy of the
determination. Analysis of gene expression can be performed by any technique
known in the art,
including Northern, in-situ hybridization, quantitative PCR, and
transcriptional profiling using
microarrays. Methods of determining biological age based on gene expression
patterns are
described in WO 01/12851.
Metabolic parameters can also be used to evaluate the rate of aging of a cell
or organism.
For example, the rate of protein synthesis and degradation decreases in
biologically aged cells,
and the levels proteins having advanced glycosylation end product
modifications increases. See,
Lambert and Merry (2000), Exp. Gerontol 35(5):583-94; and WO 01/79842. In
addition,
animals that harbor mutations conferring longer life span (and thus a reduced
rate of aging) can
show defects in ubiquinone biosynthesis, mitochondrial biogenesis, glucose
metabolism, nucleic
acid metabolism, ribosomal translation rates, and cholesterol biosynthesis.
See, for example,
WO 98/17823 and WO 99/10482. Thus, by measuring any of these parameters or
some
combination thereof, it is possible to indirectly evaluate the rate of aging
of a cell or an organism.
Methods of analyzing protein synthesis, degradation, and modification with
advanced
glycosylation end products are known in the art, as described in Lambert and
Merry (2000), Exp.
Gerontol 35(5):583-94 and WO 01/79842. Similarly, methods of analyzing
ubiquinone
biosynthesis, mitochondrial biogenesis, and glucose metabolism are known in
the art (see, e.g.,.
Marbois et al. J. Biol. Chern. 271:2995; Proft et al. EMBO J. 14:6116; and WO
98/17823), as are
methods of analyzing nucleic acid metabolism, ribosomal translation rates, and
cholesterol
biosynthesis (see, e.g., WO 99/10482).
Cellular proliferation is another parameter that can be used to evaluate the
biological age
of a cell or organism. Cells from biologically aged organisms demonstrate
reduced proliferative
capacity as compared to the cells of a corresponding younger orgaiusm. See Li
et al. (1997),
Invest. Ophthalmol. 38(1):100-7; and Wolf and Pendergrass (1999), J Ge~oyztol.
A Biol. Sci. Med.
Sci. 54(11):B502-17. It will be understood by one skilled in the art that
there are many methods
for evaluating the proliferative capacity of cells that are suitable for use
in the methods of the
invention. For example, cells can be labeled in vitro (or in vivo) with BrdU
to determine the
percent of dividing cells or evaluated using a colony forming assay, as
described in Li et al.
48
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
(1997), supra. Cells suitable for the analysis of proliferative capacity
include cells grown in
tissue culture, cells isolated from an animal that has been treated with a
test compound, cells that
are part of a live animal, or cells that are part of a tissue section obtained
from an animal. With
respect to cells present in an animal or tissue section thereof, preferable
cells include lens
epithelial cells, osteoblasts, osteoclasts, and lymphoid cells.
Basically, any biomarlcer that is altered in a biological age-dependent manner
has the
potential to be used to evaluate the effect of a test compound upon the rate
of aging of a cell or
an organism. Thus, additional biomarkers include visual appearance, resistance
to oxidative
stress, cellular transformation (the ability to adopt a transformed (i.e.,
cancerous or malignant)
phenotype), or DNA methylation (e.g., of a ras oncogene). See, for example,
Finkel and
Holbrook (2000), Nature 408:239-47; Kari et al. (1999), JNutr Health Aging
3(2):92-101; and
Hass et al. (1993), Mutat. Res. 295(4-6):281-9.
A cell used in the methods of the invention can be from a stable cell line or
a primary
culture obtained from an organism, e.g., a organism treated with the test
compound.
A transgenic cell or animal used in the methods of the invention can include a
transgene
that encodes, e.g., a copy of a Sir2 or p53 protein, e.g., the Sir2 or p53
polypeptide that was
evaluated for an interaction with the test compound. The transgene can encode
a protein that is
normally exogenous to the transgenic cell or animal, including a human
protein, e.g., a human
Sir2 or p53 polypeptide. The transgene can be linked to a heterologous or a
native promoter.
Transgenic Organisms
This disclosure further relates to a method of producing transgenic animals,
e.g., mice or
flies. In one embodiment, the transgenic animal is engineered to express,
overexpress or
ectopically express Sir2 or p53, which method comprises the introduction of
several copies of a
segment comprising at least the polynucleotide sequence encoding SEQ m NO. 2
with a suitable
promoter into the cells of an embryo at an early stage. Techniques known in
the art may be used
to introduce the Sir2 or p53 transgene into animals to produce the founder
line of animals. Such
techniques include, but are not limited to: pronuclear microinjection (U.5.
P.N. 4,873,191);
retrovirus mediated gene transfer into germ lines (Van der Putten et al.,
Proc. Natl. Acad. Sci.
LISA 82: 6148-6152, 1985; gene targeting in embryonic stem cells (Thompson et
al., Cell 56:
313-321, 1989; electroporation of embryos (Lo, Mol. Cell Biol. 3: 1803-1814,
1983; and sperm-
49
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
mediated gene transfer (Lavitrano, et al., Cell 57: 717-723, 1989; etc. For a
review of such
techniques, see Gordon, Intl. Rev. Cytol. 115: 171-229, 1989.
Gene targeting by homologous recombination in embryonic stem cells to produce
a
transgenic animal with a mutation in the Sir2 or p53 gene ("knock-out"
mutation) can also be
performed . In such so-called "knock-out" animals, there is inactivation of
the Sir2 or p53 gene
or altered gene expression, such that the animals can be useful to study the
function of the Sir2 or
p53 gene, thus providing animals models of human disease, which are otherwise
not readily
available through spontaneous, chemical or irradiation mutagenesis.
A particularly useful transgenic animal in one in which the Sir2 or p53
homolog has been
disrupted or knocked out.
Transgenic animals such as mice, for example, may be used as test substrates
for the
identification of drugs, pharmaceuticals, therapies and interventions that can
be used for the
ameliorating or slowing the effects of aging.
Accordingly, the invention features a transgenic organism that contains a
transgene
encoding a Sir2 or p53 polypeptide. In preferred embodiments, the Sir2 or p53
r polypeptide is a
human Sir2 or p53 polypeptide. The Sir2 or p53 polypeptide can be exogenous to
(z.e., not
naturally present in) the transgenic organism.
The transgenic organism can be a yeast cell, an insect, e.g., a worm or a fly,
a fish, a
reptile, a bird, or a mammal, e.g., a rodent.
The transgenic organism can further comprise a genetic alteration, e.g., a
point mutation,
insertion, or deficiency, in an endogenous gene. The endogenous gene harboring
the genetic
alteration can be a gene involved in the regulation of life span, e.g., a gene
in the insulin
signaling pathway, a gene encoding a Sir2 or transcription factor protein, or
both. In cases where
the genetically altered gene is a Sir2 or transcription factor, e.g., p53,
polypeptide, it is preferable
that the expression or activity of the endogenous Sir2 or transcription
factor, e.g., p53, protein is
reduced or eliminated.
Therapeutic Uses
In another embodiment, the invention features a method of altering the
expression or
activity of a Sir2 or p53 polypeptide, comprising administering to a cell or
an organism a
compound that increases or decreases the expression or activity of the Sir2 or
p53 polypeptide in
an amount effective to increase or decrease the activity of the Sir2 or p53
polypeptide.
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
The Sir2 or p53 polypeptide can also be a yeast, invertebrate (e.g., worm or
fly), or
vertebrate (e.g., fish, reptile, bird, or mammal (e.g., mouse)) protein. .
The cell to which the compound is administered can be an invertebrate cell,
e.g., a worm
cell or a fly cell, or a vertebrate cell, e.g., a fish cell (e.g., zebrafish
cell), a bird cell (e.g., chiclcen
cell), a reptile cell (e.g., amphibian cell, e.g., Xen.opus cell), or a
mammalian cell (e.g., mouse or
human cell). Similarly, the organism to which the compound is administered can
be an
invertebrate, e.g., a worm or a fly, or a vertebrate, e.g., a fish (e.g.,
zebrafish), a bird (e.g.,
chicken), a reptile (e.g., amphibian, e.g., Xenopus), or a mammal (e.g.,
rodent or a human).
When the organism is a human, it is preferred that the human is not obese or
diabetic.
The compound that is administered to the cell or organism can be an agonist
that
increases the expression or activity of the Sir2 ox p53 polypeptide or an
antagonist that decreases
the expression or activity of the Sir2 or p53 polypeptide. Whether agonist or
antagonist, the
compound can be a small organic compound, an antibody, a polypeptide, or a
nucleic acid
molecule.
The agonist or antagonist can alter the concentration of metabolites, e.g.,
Krebs Cycle
intermediates, e.g., succinate, citrate, or a-keto-glutarate, within the cell
or within one or more
cells of the organism. Such action is expected to alter the cell's or the
organism's resistance to
oxidative stress. For example, an antagonist could increase the cell's or the
organism's
resistance to oxidative stress. In addition, the agonist or antagonist can
alter one or more aging-
related parameters, e.g., the expression of one or more genes or proteins
(e.g., genes or proteins
that have an age-related expression pattern), or the value of one or more
metabolic parameters
(e.g., one or more metabolic parameters that reflect the rate of aging of the
cell or organism). ,
the agonist or antagonist alters the rate of aging of the cell or organism.
Ideally, the compound reduces, e.g., partially reduces, the expression of the
Sir2 or p53
polypeptide. For example, anti-sense RNA, or ribozymes can be used to reduce
the expression
of the Sir2 or p53 polypeptide. Double-stranded inhibitory RNA is particularly
useful as it can
be used to selectively reduce the expression of one allele of a gene and not
the other, thereby
achieving an approximate SO% reduction in the expression of the Sir2 or p53
polypeptide. See
Garrus et al. (2001), Cell 107(1):55-65.
In one embodiment, treatment of aging comprises modulating the expression of a
Sir2 or
p53 polypeptide. A cell or subject can be treated with a compound that
modulates the expression
51
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
of a Sir2 or p53 gene. These compounds can be nucleic acid molecules
substantially
complementary to a Sir2 or p53 gene. Such approaches include oligonucleotide-
based therapies
such as antisense, ribozymes, and triple helices .
Oligonucleotides may be designed to reduce or inhibit mutant target gene
activity.
Techniques for the production and use of such molecules are well lcnown to
those of ordinary
skill in the art. Antisense RNA and DNA molecules act to directly block the
translation of
mRNA by hybridizing to targeted mRNA and preventing protein translation. With
respect to
antisense DNA, oligodeoxyribonucleotides derived from the translation
initiation site, e.g.,
between the -10 and +10 regions of the target gene nucleotide sequence of
interest, are preferred.
Antisense oligonucleotides are preferably 10 to 50 nucleotides in length, and
more preferably 15
to 30 nucleotides in length. An antisense compound is an antisense molecule
corresponding to
the entire Sir2 or p53 mRNA or a fragment thereof.
Ribozymes are enzymatic RNA molecules capable of catalyzing the specific
cleavage of
RNA. The mechanism of ribozyme action involves sequence specific hybridization
of the
ribozyme molecule to complementary target RNA, followed by an endonucleolytic
cleavage.
The composition of ribozyrne molecules includes one or more sequences
complementary to the
target gene mRNA, and includes the well known catalytic sequence responsible
for mRNA
cleavage disclosed, for example, in U.S. P.N. 5,093,246. Within the scope of
this disclosure are
engineered hammerhead motif ribozyme molecules that specifically and
efficiently catalyze
endonucleolytic cleavage of RNA sequences encoding target gene proteins.
Specific ribozyme
cleavage sites within any potential RNA target are initially identified by
scanning the molecule
of interest for ribozyme cleavage sites that include the sequences GUA, GUU,
and GUC. Once
identified, short RNA sequences of between 15 and 20 ribonucleotides
corresponding to the
region of the target gene containing the cleavage site may be evaluated for
predicted structural
features, such as secondary structure, that may render the oligonucleotide
sequence unsuitable.
The suitability of candidate sequences may also be evaluated by testing their
accessibility to
hybridization with complementary oligonucleotides, using ribonuclease
protection assays.
Nucleic acid molecules used in triple helix formation for the inhibition of
transcription
should be single stranded and composed of deoxyribonucleotides. The base
composition of these
oligonucleotides are designed to promote triple helix formation via Hoogsteen
base pairing rules,
52
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
which generally require sizeable stretches of either purines or pyrimidines to
be present on one
strand of a duplex. Nucleotide sequences may be pyrimidine-based, which will
result in TAT
and CGC triplets across the three associated strands of the resulting triple
helix. The pyrimidine-
rich molecules provide base complementarity to a purine-rich region of a
single strand of the
duplex in a parallel orientation to that strand. In addition, nucleic acid
molecules may be chosen
that are purine-rich, for example, containing a stretch of G residues. These
molecules will form a
triple helix with a DNA duplex that is rich in GC pairs, in which the majority
of the purine
residues are located on a single strand of the targeted duplex, resulting in
GGC triplets across the
three strands in the triplex.
Alternatively, the potential sequences targeted for triple helix formation may
be increased
by creating a "switchback" nucleic acid molecule. Switchback molecules are
synthesized in an
alternating 5'-3', 3'-5' manner, such that they base pair with first one
strand of a duplex and then
the other, eliminating the necessity for a sizeable stretch of either purines
or pyrimidines to be
present on one strand of a duplex.
The antisense, ribozyme, andlor triple helix molecules described herein may
reduce or
inhibit the transcription (triple helix) and/or translation (antisense,
ribozyrne) of mRNA produced
by both normal and mutant target gene alleles. If it is desired to retain
substantially normal
levels of target gene activity, nucleic acid molecules that encode and express
target gene
polypeptides exhibiting normal activity may be introduced into cells wia gene
therapy methods
that do not contain sequences susceptible to whatever antisense, ribozyme, or
triple helix
treatments are being utilized. Alternatively, it may be preferable to
coadminister normal target
gene protein into the cell or tissue in order to maintain the requisite level
of cellular or tissue
target gene activity.
Antisense RNA and DNA, ribozyme, and triple helix molecules may be prepared by
any
method known in the art for the synthesis of DNA and RNA molecules. These
include
techniques for chemically synthesizing oligodeoxyribonucleotides and
oligoribonucleotides, for
example solid phase phosphoramidite chemical synthesis. Alternatively, RNA
molecules may be
generated by in vitro and in vivo transcription of DNA sequences encoding the
antisense RNA
molecule. Such DNA sequences may be incorporated into a wide variety of
vectors that
incorporate suitable RNA polymerise promoters such as the T7 or SP6 polymerise
promoters.
53
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
Alternatively, antisense cDNA constructs that synthesize antisense RNA
constitutively or
inducibly, depending on the promoter used, can be introduced stably into cell
lines. Various
well-lrnown modifications to the DNA molecules may be introduced as a means of
increasing
intracellular stability and half life. Possible modifications include but are
not limited~to the
addition of flanking sequences of ribonucleotides or deoxyribonucleotides of
the 5' and/or 3' ends
of the molecule or the use of phosphorothioate or 2' O-methyl rather than
phosphodiesterase
linkages within the oligodeoxyribonucleotide backbone.
Modulators of Sir2 or p53 expression can be identified by a method wherein a
cell is
contacted with a candidate compound and the expression of Sir2 or p53 mRNA or
protein in the
cell is determined. The level of expression of Sir2 or p53 mRNA or protein in
the presence of the
candidate compound is compared to the level of expression of mRNA or protein
in the absence
of the candidate compound. The candidate compound can then be identified as a
modulator of
Sir2 or p53 expression based on this comparison. For example, when expression
of Sir2 or p53
mRNA or protein is greater in the presence of the candidate compound than in
its absence, the
candidate compound is identified as a stimulator of Sir2 or p53 mRNA or
protein expression.
Alternatively, when expression of Sir2 or p53 mRNA or protein is less in the
presence of the
candidate compound than in its absence, the candidate compound is identified
as an inhibitor of
Sir2 or p53 mRNA or protein expression. The level of Sir2 or p53 mRNA or
protein expression
in the cells can be determined by methods described herein for detecting Sir2
or p53 mRNA or
protein.
Delivery of antisense, triplex agents, ribozymes, and the like can be achieved
using a
recombinant expression vector such as a chimeric virus or a colloidal
dispersion system or by
injection. Useful virus vectors include adenovirus, herpes virus, vaccinia,
and/or RNA virus such
as a retrovirus. The retrovirus can be a derivative of a marine or avian
retrovirus such as
Moloney marine leukemia virus or Rous sarcoma virus. All of these vectors can
transfer or
incorporate a gene for a selectable marker so that transduced cells can be
identified and
generated. The specific nucleotide sequences that can be inserted into the
retroviral genome to
allow target specific delivery of the retroviral vector containing an
antisense oligonucleotide can
be determined by one of skill in the art.
Another delivery system for polynucleotides is a colloidal dispersion system.
Colloidal
dispersion systems include macromolecular complexes, nanocapsules,
microspheres, beads, and
54
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
lipid-based systems including oil-in-water emulsions, micelles, mixed micelles
and liposomes.
A preferred colloidal delivery system is a liposome, an artificial membrane
vesicle useful as in
vivo or in vitro delivery vehicles. The composition of a liposome is usually a
combination of
phospholipids, usually in combination with steroids, particularly cholesterol.
The Sir2 or p53 gene may also be underexpressed.
Methods whereby the level of Sir2 or p53 gene activity may be increased to
levels
wherein disease symptoms are ameliorated also include increasing the level of
gene activity, for
example by either increasing the level of Sir2 or p53 gene present or by
increasing the level of
gene product which is present.
For example, a target gene protein, at a level sufficient to ameliorate
metabolic imbalance
symptoms, may be administered to a patient exhibiting such symptoms. One of
skill in the art
will readily know how to determine the concentration of effective, non-toxic
doses of the normal
target gene protein. Additionally, RNA sequences encoding target gene protein
may be directly
administered to a patient exhibiting disease symptoms, at a concentration
sufficient to produce a
level of target gene protein such that the disease symptoms are ameliorated.
Administration may
be by a method effective to achieve intracellular administration of compounds,
such as, for
example, liposome administration. The RNA molecules may be produced, for
example, by
recombinant techniques such as those described above.
Further, patients may be treated by gene replacement therapy. One or more
copies of a
normal target gene, or a portion of the gene that directs the production of a
normal target gene
protein with target gene function, may be inserted into cells using vectors
that include, but are
not limited to adenovirus, adenoma-associated virus, and retrovirus vectors,
in addition to other
particles that introduce DNA into cells, such as liposomes. Additionally,
techniques such as
those described above may be utilized for the introduction of normal target
gene sequences into
human cells.
Cells, preferably autologous cells, containing and expressing normal target
gene
sequences may then be introduced or reintroduced into the patient at positions
which allow for
the amelioration of metabolic disease symptoms. Such cell replacement
techniques may be
preferred, for example, when the target gene product is a secreted,
extracellular gene product.
In instances where the target gene protein is extracellular, or is a
transmembrane protein,
any of the administration techniques described, below which are appropriate
for peptide
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
administration may be utilized to effectively administer inhibitory target
gene antibodies to their
site of action.
The identified compounds that inhibit target gene expression, synthesis and/or
activity
can be administered to a patient at therapeutically effective doses to treat
or ameliorate or delay
the symptoms of aging. A therapeutically effective dose refers to that amount
of the compound
sufficient to result in amelioration or delay of symptoms of aging.
Toxicity and therapeutic efficacy of such compounds can be determined by
standard
pharmaceutical procedures in cell cultures or experimental animals, e.g., for
determining the
LD50 (the dose lethal to 50% of the population) and the ED50 (the dose
therapeutically effective
in 50% of the population). The dose ratio between toxic and therapeutic
effects is the therapeutic
index and it can be expressed as the ratio LD50 l ED50. Compounds that exhibit
large
therapeutic indices are preferred. While compounds that exhibit toxic side
effects may be used,
care should be taken to design a delivery system that targets such compounds
to the site of
affected tissue in order to minimize potential damage to uninfected cells and,
thereby, reduce
side effects. The data obtained from the cell culture assays and animal
studies can be used in
formulating a range of dosage for use in humans. The dosage of such compounds
lies preferably
within a range of circulating concentrations that include the ED50 with Iittle
or no toxicity. The
dosage may vary within this range depending upon the dosage form employed and
the route of
administration utilized. For any compound used in the method of the invention,
the
therapeutically effective dose can be estimated initially from cell culture
assays. A dose may be
formulated in animal models to achieve a circulating plasma concentration
range that includes
the IC50 (i.e., the concentration of the test compound which achieves a half
maximal inhibition
of symptoms) as determined in cell culture. Such information can be used to
more accurately
determine useful doses in humans. Levels in plasma may be measured, for
example, by high
performance liquid chromatography. .
Pharmaceutical compositions may be formulated in conventional manner using one
or
more physiologically acceptable carriers or excipients. Thus, the compounds
and their
physiologically acceptable salts and solvates may be formulated for
administration by inhalation
or insufflation (either through the mouth or the nose) or oral, buccal,
parenteral or rectal
administration.
56
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
For oral administration, the pharmaceutical compositions may take the form of,
fox
example, tablets or capsules prepared by conventional means with
pharmaceutically acceptable
excipients such as binding agents (e.g., pregelatinised maize starch,
polyvinylpyrrolidone or
hydroxypropyl methylcellulose); fillers (e.g., lactose, microcrystalline
cellulose or calcium
hydrogen phosphate); lubricants (e.g., magnesium stearate, talc or silica);
disintegrants (e.g.,
potato starch or sodium starch glycolate); or wetting agents (e.g., sodium
lauryl sulphate). The
tablets may be coated by methods well known in the art. Liquid preparations
for oral
administration may take the form of, for example, solutions, syrups, or
suspensions, or they may
be presented as a dry product for constitution with water or other suitable
vehicle before use.
Such liquid preparations may be prepared by conventional means with
pharmaceutically
acceptable additives such as suspending agents (e.g., sorbitol syrup,
cellulose derivatives or
hydrogenated edible fats); emulsifying agents (e.g., lecithin or acacia); non-
aqueous vehicles
(e.g., almond oil, oily esters, ethyl alcohol or fractionated vegetable oils);
and preservatives (e.g.,
methyl or propyl-p-hydroxybenzoates or sorbic acid). The preparations may also
contain buffer
salts, flavoring, coloring, and sweetening agents as appropriate.
Preparations for oral administration may be suitably formulated to give
controlled release
of the active compound. For buccal administration the compositions may take
the form of tablets
or lozenges formulated in conventional manner. For administration by
inhalation, the
compounds for use according to the present invention are conveniently
delivered in the form of
an aerosol spray presentation from pressurized packs or a nebuliser, with the
use of a suitable
propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane,
dichlorotetrafluoroethane,
carbon dioxide or other suitable gas. In the case of a pressurized aerosol the
dosage unit may be
determined by providing a valve to deliver a metered amount. Capsules and
cartridges of e.g.
gelatin for use in an inhaler or insufflator may be formulated containing a
powder mix of the
compound and a suitable powder base such as lactose or starch. The compounds
may be
formulated for parenteral administration by injection, e.g., by bolus
injection or continuous
infusion. Formulations for injection may be presented in unit dosage form,
e.g., in ampoules or
in multi-dose containers, with an added preservative. The compositions may
take such forms as
suspensions, solutions, or emulsions in oily or aqueous vehicles, and may
contain formulatory
agents such as suspending, stabilizing, and/or dispersing agents.
Alternatively, the active
ingredient may be in powder form for constitution with a suitable vehicle,
e.g., sterile pyrogen-
57
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
free water, before use. The compounds may also be formulated in rectal
compositions such as
suppositories or retention enemas, e.g., containing conventional suppository
bases such as cocoa
butter or other glycerides. hi addition to the formulations described
previously, the compounds
may also be formulated as a depot preparation. Such long acting formulations
may be
administered by implantation (for example subcutaneously or intramuscularly)
or by
intramuscular injection. Thus, for example, the compounds may be formulated
with suitable
polymeric or hydrophobic materials (for example as m emulsion in an acceptable
oil) or ion
exchange resins, or as sparingly soluble derivatives, for example, as a
sparingly soluble salt.
All references cited herein are incorporated by reference in their entirety
The invention
is illustrated by the following non-limiting examples.
Materials and Methods
Plasmids and antibodies
To construct mSir2a expression constructs, the full-length cDNA was subcloned
from
pET28a-Sir2a (Imai et al., 2000) into pcDNA3 or pBabepuro vector. Site-
directed mutation was
generated in the plasmid pRS305-Sir2a using the Gene Edit system (Promega). To
construct the
human SIRT1 expression construct, DNA sequences corresponding to the full-
length hSIRTl
(Frye, 1999) were amplified by PCR from Marathon-Ready Hela cDNA (Clontech),
and initially
subcloned into pcDNA3.1/VS-His-Topo vector (Invitrogen), and then subcloned
with a Flag-tag
into a pCIN4 vector for expression (Gu et al., 1999). To prepare the Sir2a
antibody that can
recognize both human and mouse Sir2a, a polyclonal antibody against the highly
conserved C-
terminus of Sir2a was generated. DNA sequences corresponding to this region
(480-737) were
amplified by PCR and subcloned into pGEX-2T (Pharmacia). a-Sir2a antisera was
raised in
rabbits against the purified GST-Sir2a (480-737) fusion protein (Covance), and
further affinity-
purified on both protein-A and antigen columns. By Western blot analysis and
immunofluorescent staining, this antibody can detect both mouse Sir2a and
human SIRTI
proteins.
To construct hSir2 expression constructs, BamHI/SnaBI fragment of hSIR2SlRT1
cDNA
was inserted into pBabe-Y-Puro. The resulting plasmid was designated pYESir2-
puro. Similarly
a BamHI/SnaBI fragment of hSir2 that was mutated at residue 363 from Histidine
(H) to
Tyrosine (Y) by site-directed mutagenesis (Stratagene) was used to create the
retroviral vector
pYESir2HY. pBabe-hTERT-hygro contained an EcoRI/SaII fragment of hTERT cloned
into
58
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
EcoRI/SaII site of pBabe-Hygro. pCMVwtp53, pCMVK382R and pCMVK320R were a gift
from Dr. E. Appella (NITi).
Cell culture and derivation of cell lines
All cells were grown in presence of 20% OZ and 5% COZ at 37°C in
humidified
chambers. Human diploid fibroblast BJ cells, human epithelial breast carcinoma
cell line MCF7
and H1299 human epithelial carcinoma cell lines were grown in DME +10% FCS.
PBS(-/-)
(phosphate buffered saline) without magnesium or calcium was used for washing
cells and other
applications described herein.
Amphotrophic viruses were produced by transient co-transfection of pCL-pCL-
Ampho
with the LTR containing pBabe vectors (Morgenstern and Land, 1990), pYESir2 or
pYESir2HY
in to 293T cell line using Fugene6 (Ruche). Three days post transfection
supernatants were
collected and filtered with 0.4 micron filters. Primary BJ cells or MCF7 cells
were infected with
retrovirus containing media in presence of 8 mg/ml of polybrene overnight and
48 hours later
cells were selected in puromycin at 1 mg/ml.
Following selection and during the experimentation all the mass cultures were
maintained
in presence of puromycin. These selected BJ cells were subsequently infected
and selected with
a pBabe-hTERT virus carrying the hygromycin resistance gene (200mg/ml). The
resulting cells
were: BJT (carrying pYE-Puro backbone and pBabe-hTERT-hygro), BJThSir2wt
(carrying
pYESir2 wild type hSir2 and pBabe-hTERT hygro) and BJThSir2HY (pYESir2HY
mutant hSir2
and pBabe-hTERT-hygro). MCF7 cells were transfected with the vector p2lP-luc
(Vaziri et al.,
1997) and pCMVneo, clones were selected in 500 mg/ml of 6418 and the clone
designated
MCF73L was selected that was able to upregulate the p21WAF1 promoter-
luciferase in response
to treatment with 6 Gy of ionizing radiation. MCF7 cells or MCF73L were
infected with the
same viruses as described before to yield the following cell lines: MCF73LP
(carrying pBabe Y-
puro backbone), MCF73L-hSir2wt and MCF73L-hSir2HY. Cells were kept under
appropriate
selection throughout experiments.
ha vitro p53 deacetylation Assay
The Flag-tagged Sir2a-expressing cells were established and expanded in DMEM
medium, and cell extracts were prepared essentially as previously described
(Luo et al., 2000;
Gu et al., 1999; Ito et al., 1999). The proteins were purified under a very
high stringency
59
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
condition (300 mM NaCI and 0.5 % NP-40). The eluted proteins were resolved by
a SDS-PAGE
gel and analyzed by colloidal blue staining (Novex). Acetylated GST-p53 was
prepared by p53
acetylation assay as previously described (Gu and Roeder, 1997) and further
purified on
glutathione-Sepharose (Luo et al., 2000). The 14C-labeled acetylated p53 (2.5
~,g) was incubated
with purified Sir2a (10 ng) at 30 °C for 1 hr either in the presence of
50 ,uM NAD or as
indicated. The reactions were performed in a buffer containing 50 mM Tris-HCl
(pH 9.0),
SOmM NaCI, 4 mM MgClz, 0.5 mM DTT, 0.2 mM PMSF, 0.02% NP-40 and 5% glycerol.
The
reactions were resolved on SDS-PAGE and analyzed by Coornassie blue staining
and
autoradiography.
Immunoprecipitation and Immunofluorescence
H1299 cells transiently expressing p53 and hSir2 were lysed using the NP40
buffer and
lysates described above and immunoprecipitated with lul of anti-hSir2 antibody
overnight.
Protein G-sepharose beads (50 ml) were added to the lysates and rotated at
4°C for 3hrs. The
immune complexes were collected, washed 3 times, and resolved using the Nupage
gradient 4-
12% Bis-Tris MOPS (3-N-morpholino propane sulfonic acid) protein gel (Novex)
in the
presence of provided anti-oxidant (Novex).
The gels used were transferred to nitrocellulose and probed with anti-p53
antibody (pAb7
sheep anti human polyclonal antibody, Oncogene Science), signal detected using
a goat anti-
sheep HRP secondary antibody. The membranes were subsequently washed and
reprobed with
anti-hSir2 antibody.
For immunoprecipitation in BJ cells, lmg of protein per reaction were
incubated with lul
of Ab-6(anit-p53 monoclonal, Oncogene Science) and immunoprecipitation was
performed as
described above except that the time of incubation in primary antibody was
2hrs and 4 times
higher concentrations of protease inhibitors were used, due to the observed
high instability of
p53 protein in BJ cells. Immune complexes were resolved as previously
described using the
Novex system (Invitrogen) and membranes were exposed to a mix of polyclonal
antibodies at
1:1000 dilution (SC6432, polyclonal rabbit and CM1, polyclonal rabbit). A
secondary goat anti-
rabbit HRP was used at 1:30,000 concentration for detection. Membranes were
subsequently
blocked again and re-probed with anti-hSir2 antibody.
GO
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
hnmunofluorescence of U20S and BJ cells was undertaken by fixing the cells in
microchamber slides (LabTek) in 70% Ethanol and subsequent staining with anti-
hSir2 antibody
at 1:500 dilution. A secondary goat anti-rabbit FITC antibody at 0.5 ug/ml was
used for
detection of signal.
GST pull-down assay and co-immunoprecipitation assay ,
GST fusion proteins were expressed in E. coli, extracted with buffer BC500 (20
mM
Tris-HC1, pH 8.0, 0.5 mM EDTA, 20% glycerol, 1mM DTT and 0.5 mM PMSF)
containing 50
mM KC1 and 1% NP-40, and purified on glutathione-sepharose (Pharmacia). 35S-
labeled Sir2a
was in vitro translated by ~a TNT kit (Promega) using pcDNA3-Sir2a as a
template. 5 ~,l of 35S-
labeled Sir2a were incubated at 4°C for 60 min with each of the
different immobilized GST
fusion proteins in BC200 buffer containing 200 mM KCl and 0.2% NP-40. Beads
were then
washed five times in 0.5 ml of the same buffer. Bound proteins were eluted
with an equal
volume of SDS sample buffer, resolved by SDS-PAGE, and analyzed by Coomassie
blue
staining and autoradiography.
The co-immunoprecipitation assay was performed essentially as described
previously
(Luo et al., 2000). Cells were extracted with lysis buffer (25mM HEPES-KOH, pH
8.0, 150 mM
KCl, 2mM EDTA, 1mM DTT, 1mM PMSF, l0,ug/ml aprotinin, l0,ug/ml leupeptin,
l,ug/ml
pepstatin A, 20 mM NaF, 0.1% NP-40). After centrifugation, the supernatants
were incubated
with M2 beads (Sigma) for 4 hr at 4°C. The M2 beads were washed five
times with 0.5 ml lysis
buffer, after which the associated proteins were eluted with Flag peptides to
avoid the cross-
reaction from the mouse IgG in western blot analysis. In the case of the co-
immunoprecipitation
in normal cells, 50 million cells were extracted in the same lysis buffer. The
supernatants were
incubated with 20 ,ug a-Sir2a antibody or pre-immune antiserum from the same
rabbit and 40 ~.l
protein A/G plus-agarose (Santa Cruz) for overnight. The agarose beads were
washed five times
with 0.5 ml of lysis buffer, after which the associated proteins were eluted
with BC1000 (20 mM
Tris-HCl, pH 8.0, 0.5 mM EDTA, 20% glycerol, 1mM DTT and 0.5 mM PMSF)
containing 1 M
NaCI, 1% NP-40, 0.5% Deoxycholic Acid. The eluted proteins were resolved on 8%
SDS
PAGE and Western blot with a-Sir2a antibody and a-p53 (DO-1) for human cells
and a-p53
(421) for mouse cell.
61
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
Immunoblot analysis
For detection of acetylated forms of p53 in BJ cells and MCF7 cells, equal
numbers of
cells were plated 24 hrs before the experiment. l.SxlO~ BJ cells or 10' MCF7
cells exponentially
growing phase in 150 cm2 dishes were exposed to 6Gy of ionizing radiation
(137Cesium gamma
source at dose rate of 1 Gy/min). At the appropriate time point, cells were
washed and harvested
by trypsinization and subsequent neutralization with 10% serum. After washing
the cells once in
PBS(-/-), cell pellets were frozen on dry ice instantly at the appropriate
time point. Once all
time points were collected, cell pellets were all lysed on ice at once by
adding 0.5% NP40, 150
mM NaCI (in the presence of complete protease inhibitor mix, Roche), for 30
minutes and
vortexing. Cell lysates were prepared by centrifugation for 20 minutes at
4°C. Protein content
of lysates were measured using Lowry based assay (BioRad DC protein assay).
Protein (300
mg) was resolved on gradient 4-20% criterion Tris-HC gels (Biorad),
transferred to
nitrocellulose and blocked in 10% skim milk.
The resulting membrane was incubated overnight in 1:400 dilution of Ab-1
(Oncogene
Science, peptide based rabbit polyclonal anti K382 p53). This membrane was
then washed twice
in PBS(-/-) containing 0.05%Tween 20 for 15 minutes. Secondary Goat anti-
rabbit antibody
conjugated to HRP (Pierce) was used at a concentration of 1:30,000 for lhr in
1% Milk.
Membrane was subsequently washed twice for 30 minutes total time.
The membrane was incubated with Supersignal west femto maximum substrate
(Pierce)
for 2 minutes and exposed to X-GMAT sensitive film (Kodak) for up to 30
minutes. The
membrane was subsequently blotted with a monoclonal p21 WAF1 antibody (F5,
Santa Cruz
Biotech), p53 antibody (SC6243, polyclonal rabbit, Santa Cruz) (Ab-6, Oncogene
Science),
anti-hSir2 (polyclonal rabbit). ~3-actin was used (Abcam) for loading control.
96715 is an anti-
acetyl H3 Lys9 was a monoclonal antibody (Cell Signaling).
Virus infection and stress response
All MEF cells were maintained in DMEM medium supplemented with 10% fetal
bovine
serum, and the ftVIR-90 cells were maintained in Eagle's minimal essential
medium
supplemented with 10% fetal bovine serum and non-essential amino acids. The
virus infection
and selection were essentially as described previously (Ferbeyre et al.,
2000). After one-week
selection, the cells were either frozen for stock or immediately used for
further analysis. About
62
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
500,000 MEF cells were plated on a 10-cm dish 24 hr before treatment. The
cells were then
exposed to etoposide (20 Vim) for 12 hr. After treatment, the cells were
washed with PBS and
fed with normal medium. Another 36 hrs later, the cells were stained with PI
and analyzed by
flow cytometric analysis for apoptotic cells (SubGl) according to DNA content.
In case of the
Fas-mediated apoptosis assay, the cells were treated with actinomycin D (0.25
~g/ml) and Fas
antibody (100 ng/ml) as previously described (Di Cristofano et al., 1999). In
the case of
oxidative stress response, the IMR-90 cells were treated with HZOZ (200 ~.M)
for 24 hrs.
Luciferase and apoptosis assays
H1299 cells were transfected using the Fugene6 protocols (Roche) with
pCMVwtp53 in
presence or absence of pCMVp300 and 5 ~,g of p2lP-Luc (containing a 2.4kb
fragment of p21
Iinked to luciferase gene) as previously described (Vaziri et al., 1997). All
experiments were
performed in triplicates.
Apoptosis was measured at approximately 48 hrs post transfection using the
annexin V
antigen and propidium iodide exclusion (Clontech laboratories).
Radiation survival curves of BJ cells were performed as described previously
(Dhar et
al., 2000; Vaziri et al., 1999).
FAGS analysis for apoptosis assay
Both adherent and floating cells were combined and washed in cold PBS. For
SubGl/FACs analysis, cells were fixed in methanol for 2 hr at -20 °C,
rehydrated in PBS for 1 hr
at 4 °C, and then reacted with the primary antibody (DO-1) for 30 min
at room temperature.
Cells were washed twice in PBS and incubated with a goat anti-mouse FITC-
conjugated
secondary antibody for 30 min at room temperature. Following incubation, cells
were washed in
PBS and treated with RNase A (50 ,ug/ml) for 30 min at room temperature.
Propidum iodide (PI:
2.5 ,ug/ml) was added to the cells, and samples were then analyzed in a
FACSCalibur (BD). A
region defining high FITC fluorescence was determined, and the cells falling
into this region
were collected separately. The PI staining was recorded simultaneously in the
red channel.
Immunofluorescence Assay
63
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
Immmtmofluorescence was performed essentially as the standard protocol (Guo et
al.,
2000). After fixation, cells were exposed to two primary antibodies: p53
monoclonal antibody
DO-1 (Santa Cruz) and a-Sir2a for 1 hr at room temperature. The cells were
washed three times
with 1% BSA plus 0.2% Tween-20 in PBS and then treated with two secondary
antibodies [a
goat anti-rabbit IgG conjugated to Alexa 568 (Molecular Probes), and anti-
mouse IgG-FITC
(Santa-Cruz)]. DAPI was used for counter-staining to identify nuclei. The
cells were further
washed four times. Images were acquired from a Nikon Eclipse E600 fluorescent
microscope
(Hamamatsu Photonics).
Detecting acetylation levels of p53 in cells
The cells (human lung carcinoma cell lines H460 (wild-type p53) and H1299 (p53-
null),
human colon carcinoma HCT116 (wild-type p53), mouse embryonal carcinoma cell
line F9
(wild-type p53), mouse embryonic fibroblast MEFs or others) were maintained in
DMEM
medium supplemented with 10% fetal bovine serum. For DNA damage response,
about 1
million cells were plated on a 10-cm dish 24 hr before treatment. The cells
were then exposed to
etoposide (20~,M) and or other drugs (0.5 ~M of TSA, 5 mM of nicotinamide, and
50 ~,M of
LLNL) as indicated for 6 hr.
After treatment, the cells were harvested for Western blot analysis. The
rabbit polyclonal
antibody specific for p300-mediated acetylated p53 [a-p53(Ac)-C] was raised
and purified
against the acetylated human p53 C-terminal peptide [p53 (Ac)-C: H-
SSSGQSTSRHSSLMF-
OH SEQ. ID No:l (5 = acetylated Lysine)] as described before (Luo et al.,
2000).
This antibody recognizes the p300-mediated acetylated forms of both human and
mouse
p53. In the case of cotransfection assays testing for p53 acetylation levels,
H1299 cells were
transfected with 5 p,g of CMV-p53 plasmid DNA, 5 ~.g of CMV-p300 plasmid DNA,
and 10 ~g
of pcDNA2-Sir2a plasmid DNA as indicated. 24 hr after the transfection, the
cells were lysed in
a Flag-lysis buffer (50 mM Tris, 137 mM NaCI, 10 mM NaF, 1mM EDTA, 1% Triton X-
100
and 0.2% Sarkosyl, 1 mM DTT, 10% glycerol, pH 7.8) with fresh proteinase
inhibitors, 10 ~M
TSA and SmM nicotinamide (Sigma). The cell extracts were resolved by either 8%
or 4-20%
SDS-PAGE gels (Novex) and analyzed by Western blot with a-p53 (Ac)-C and a-p53
(DO-1).
Deacetylation assay of the p53 C-terminal peptide
64
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
The human p53 C-terminal peptide (residues 368-386+Cys;
HLKSK(AcK)GQSTSRHK(AcK)LMFKC); (SEQ m NO. 1) di-acetylated at positions 373
and
382 was synthesized and purified with HPLC. Deacetylation assays of tlus
peptide by Sir2 and
analyses of the reaction products were performed as described previously (Imai
et al., 2000).
EXAMPLES
Example 1. Mammalian Sir2a interacts with p53 both i~a vitro and i~z vivo.
Mouse Sir2a interacts with p53. The p53 protein can be divided into three
distinct
functional domains (Gu and Roeder, 1997): an amino-terminus that contains the
transcriptional
activation domain (NT: residues 1-73), a central core that contains the
sequence-specific DNA-
binding domain (M: residues 100-300), and the multifunctional carboxyl-
terminus (CT:
residues 300-393). The GST-p53 fusion proteins containing each domain as well
as the full-
length protein were expressed in bacteria and purified to near homogeneity on
gluthathione-
agrose beads. As shown in Figure 1A, 35S-labeled ira vitro translated Sir2a
strongly bound to
immobilized GST-p53 but not to immobilized GST alone (lane 1 vs. 6). Sir2a was
tightly bound
to the C-terminal domain of p53 (GST-p53CT) (lane 4, Figure 1A), also bound to
the central
DNA-binding domain (GST-p53M), but showed no binding to the N-terminal domain
of p53
(GST-p53NT) (lane 3 vs. 2, Figure 1A).
To test for the interactions between p53 and Sir2a in cells, extracts from
transiently-
transfected p53-null cells (H1299) were immunoprecipitated with anti-Flag
monoclonal antibody
(M2). As shown in Figure 1B, p53 was detected in the imtnunoprecipitate
obtained from H1299
cells cotransfected with constructs encoding Flag-Sir2a and p53 (lane 2), but
not from cells
transfected with the p53 construct alone (lane 4). Conversely, Sir2a was
detected in the
immunoprecipitates obtained from H1299 cells cotransfected with constructs
encoding Sir2a and
Flag-p53 (lane 6, Figure 1B), but not from cells transfected with the Sir2a
construct alone (lane
8, Figure 1B). p53 interacts similarly with human SIRTl (hSIRTl) (Figure 1C,
D), the human
ortholog of mouse Sir2a (Frye, 1999; 2000), showing that p53 and mammalian
Sir2a interact.
Since mouse Sir2a shares a highly conserved region at the C-terminus with
human
SIRT1 (Figure 1C), but not with any other mammalian Sir2 homologs (Frye, 1999;
2000), a
polyclonal antibody against the C-terminus (amino acid 480-737) of mouse Sir2a
was
developed. Anti-Sir2a antisera (a-Sir2a) was raised in rabbits against the
purified GST-
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
Sir2a(4S0-737) fusion protein. As shown in Western blots, this antibody can
detect both mouse
Sir2a and human SIRTl proteins, but not other human Sir2 homologs (Figure 2A,
B).
p53 interaction with Sir2a or hSlRT1 in normal cells without overexpression
was studied
employing this antibody. Cell extracts from human (H460) and mouse cells (F9),
which express
wild-type p53 proteins, were immunoprecipitated with a-Sir2a, or with the pre-
immune serum.
Western blot analysis revealed that this antibody immunoprecipitated both
Sir2a and hSIRTl
(lower panels, Figure 2A, 2B). Human and mouse p53 were detected in the
respective a-Sir2a
immunoprecipitations from cell extracts, but not in the control
irmnunoprecipitations with the
preimmune serum, showing that p53 interacts with mammalian Sir2a in normal
cells. In contrast
to abrogation of the Mdm2-p53 interaction by DNA damage as previously reported
(Shieh et al.,
1997), this interaction was stronger in cells after DNA damage treatment
(Figure 2C), which
shows mammalian Sir2a is involved in regulating p53 during the DNA-damage
response. Thus,
p53 interacts with mammalian Sir2a both ira vitro and ih vivo.
Example 2. Deacetylation of p53 by mammalian Sir2a
p53 was deacetylated by mammalian Sir2a i~r. vita°o. Mouse Sir2a
protein was expressed
with the N-terminal Flag epitope in cells and purified to near homogeneity on
the M2-agrose
affinity column (lane 3, Figure 3A to determine). The GST-p53 fusion protein
was acetylated by
p300 in the presence of [14C]-acetyl-CoA, and the acetylated p53 protein was
purified on the
GST affinity column. These highly purified recombinant proteins were used in
this assay in
order to avoid possible contamination by either inhibitory factors or other
types of deacetylases.
As shown in Figure 3B,14C-labeled acetylated p53 was efficiently deacetylated
by
purified Sir2a (lane 3), but not by a control eluate (lane 4). NAD is required
for Sir2a-mediated
deacetylation of p53 (lane 2 vs. 3, Figure 3B). Further, the deacetylase
inhibitor TSA, which
significantly abrogates HDAC1-mediated deacetylase activity on p53 (Luo et
al., 2000), had no
apparent effect on Sir2a-mediated p53 deacetylation (lane 5, Figure 3B). These
results show
that Sir2a can strongly deacetylate p53 ih vitro, and that this activity
depends on NAD.
A role for mammalian Sir2a in deacetylating p53 in cells was established using
acetylated p53-specific antibody to monitor the steady-state levels of
acetylated p53 ina vivo (Luo
et ezl., 2000). As shown in Figure 3C, a high level of acetylated p53 was
detected in the cells
cotransfected with p300 and p53 (lane 1). However, p53 acetylation levels were
significantly
66
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
abolished by expression of either Sir2a or hSIRTl (lanes 2, 4). In contrast, a
Sir2a mutant
(Sir2aH355A) containing a point mutation at the highly conserved core domain
causing
defective histone deacetylase activity ifz vitro had almost no effect (lane 3
vs. 2, Figure 3C).
Furthermore, neither SILtTS, another human Sir2 homolog, nor poly (ADP-ribose)
polymerise
(PARP), whose activity is also NAD-dependent (reviewed in Vaziri et al.,
1997), had any
significant effect on p53 acetylation (lanes 5, 6, Figure 3C). h1 addition, in
contrast to HDAC-
mediated deacetylation of p53 (Luo et al., 2000) Sir2a still strongly
deacetylated p53 in the
presence of TSA (lane 4 vs. 3, Fig. 3D) even though the steady state level of
acetylated p53 was
elevated when the cells were treated with TSA (lane 3 vs. 1, Fig. 3D). Thus,
mammalian Sir2a
has robust TSA-independent p53 deacetylation activity.
Example 3. Inhibition of Sir2a-mediated p53 deacetylation by nicotinamide
Sir2a-mediated deacetylase activity of p53 can be inhibited. Deacetylation of
acetyl-
lysine by Sir2a is tightly coupled to NAD hydrolysis, producing nicotinamide
and a novel
acetyl-ADP-ribose compound (1-O-acetyl-ADPribose) (Landry et al., 2000b;
Tanner et al.,
2000; Tinny and Moazed, 2001). The formation of an enzyme-ADP-ribose
intermediate through
NAD hydrolysis may be critical for this chemical reaction (Landry et al.,
2000b). Since
nicotinamide is the first product from hydrolysis of the pyridinium-N-
glycosidic bond of NAD, it
may function as an inhibitor for its deacetylase activity (Landry et al.,
2000b). Nicotinamide is
able to inhibit the deacetylase activity of Sir2a on acetylated p53 ih vitro.
Similar reactions as described above (Figure 3B), were set up by incubating
labeled p53
substrate, recombinant Sir2a and NAD (50 ~,M) alone, or in combination with
nicotinamide
(SmM). As shown in Figure 4A, 14C-labeled acetylated p53 was efficiently
deacetylated by
Sir2a (lane 2) however, the deacetylation activity was completely inhibited in
the presence of
nicotinamide (lane 3 vs. lane 2 Figure 4A). As a negative control, 3-AB (3-
aminobenzamide), a
strong inhibitor of PARP which is involved in another type of NAD-dependent
protein
modification (Vaziri et al., 1997), showed no significant effect on Sir2a
mediated deacetylation
(lane 4 vs. 3, Figure 4A).
To further investigate the role of mammalian Sir2et-mediated regulation in
vivo, the
effect of Sir2a expression on p53 acetylation levels during the DNA damage
response was
determined. Mouse embryonic fibroblast (MEF) cells, which express the wild
type of p53, were
67
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
infected with either a pBabe-puro retrovirus empty vector or a pBabe-puro
retrovirus containing
Sir2a, and cultured for a week under pharmacological selection. The protein
levels of p53
activation in response to DNA damage in these cells was determined by Western
blot analysis.
Similar protein levels of p53 activation were induced in the pBabe vector
infected cells and
pBabe-Sir2a infected cells after etoposide treatment for 6 hrs (lanes 3, 4 vs.
lanes 1, 2, lower
panel, Figure 4B).
Tn the mock-infected cells, the acetylation level of p53 was significantly
enhanced by
DNA damage (lane 2 vs. lane 1, Upper panel, Figure 4B). However, DNA damage
treatment
failed to stimulate the p53 acetylation in the pBabe-Sir2a infected cells even
in the presence of
TSA (lane 4 vs. lane 2, Upper panel, Figure 4B), showing that Sir2tx
expression results in
deacetylation of endogenous p53. This Sir2a-mediated effect was completely
abrogated by
nicotinamide treatment (lane 8 vs. lane 6, Figure 4B). Thus, Sir2a mediated
deacetylation of p53
can be inhibited by nicotinamide both ifa vitro and ifa vivo.
Example 4. Maximum induction of p53 acetylation levels in normal cells
requires
inhibition of endogenous Sir2a activity
Endogenous Sir2a in the regulation of p53 acetylation levels in nornlal cells
during the
DNA damage response was determined.
As shown in Figure 4C, after the wild-type p53 containing human lung carcinoma
cells
(H460) were treated by etoposide, acetylation of p53 was induced (lane 2 vs.
lane 1). No
significant p53 acetylation was detected in the cells treated with a
proteasorne inhibitor LLNL
(lane 6, Figure 4C), indicating that the observed stimulation of p53
acetylation is induced by
DNA damage, not through p53 stabilization.
p53 can be deacetylated by a PIDlMTA2lHDACI complex, whose activity is
completely
abrogated in the presence of TSA (Luo et al., 2000). The mild enhancement of
the acetylation
level of p53 by TSA during DNA damage response may be due mainly to its
inhibitory effect on
endogenous HDACl-mediated deacetylase activity (lane 3 vs. lane 2, Figure 4C).
A super
induction of p53 acetylation was showed when the cells were treated with both
TSA and
nicotinamide (lane 4 vs. lane 3, Figure 4C). In contrast, 3-AB treatment had
no effect on the
level of p53 acetylation (lane 5 vs. lane 3, Figure 4C), indicating that PARP-
mediated poly-ADP
ribosylation has no effect on p53 acetylation. Similar results were also
observed in other cell
68
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
types including either mouse cells (MEFs, F9) or human cells (BL2, HCT116).
Thus, maximum
induction of p53 acetylation requires inhibitors for both types of
deacetylases (HDAC1 and
Sir2a), and endogenous Sir2a plays a major role in the regulation of the p53
acetylation levels
induced by DNA damage.
Example 5. Repression of p53-mediated functions by mammalian Sir2a requires
its
deacetylase activity
The functional consequence of mammalian Sir2a-mediated deacetylation of p53
was
determined by testing its effect on p53-mediated transcriptional activation. A
mammalian p53
expression vector (CMV-p53), alone or in combination with different amounts of
mouse Sir2a
expressing vector (CMV-Sir2a), was cotransfected into MEF (p53-~-) cells along
with a reporter
construct containing synthetic p53 binding sites placed upstream of the
luciferase gene (PG13-
Luc).
As shown in Figure SA, Sir2a strongly repressed p53-mediated transactivation
in a dose-
dependent manner (up to 21 fold), but had no significant effect on the
transcriptional activity of
the control reporter construct (TIC-Luc) (Figure SB), which has no p53 binding
site at the
promoter region. Also, expression of human SIRT1 showed a similar effect on
the p53 target
promoter (Figure SC). Neither the Sir2aH355A mutant or SIRTS, both of which
are defective in
p53 deacetylation (Figure 3C), had any effect on the p53-mediated
transactivation (Figure SC,
D). Thus, mammalian Sir2a specifically represses p53-dependent
transactivation, and that this
repression requires its deacetylase activity.
The modulation of Sir2 on p53-dependent apoptosis was determined. p53 null
cells
(H1299) were transfected with p53 alone or cotransfected with p53 and Sir2a.
The transfected
cells were fixed, stained for p53, and analyzed for apoptotic cells (SubGl)
(Luo et al., 2000). As
indicated in Figure 6A, overexpression of p53 alone induced significant
apoptosis (32.3%
SubGl). However, co-transfection of p53 with Sir2a significantly reduced the
level of apoptosis
(16.4% SubGl), while the mutant Sir2aH355A was impaired in this effect (29.5%
SubGl)
(Figure 6A, B). Thus, mammalian Sir2a is involved in the regulation of both
p53 mediated
transcriptional activation and p53-dependent apoptosis, and deacetylase
activity is required for
these Sir2a-mediated effects on p53.
69
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
Example 6. The role of mammalian Sir2a in stress induced apoptotic response
Mammalian Sir2a can deacetylate p53 both i~z vitro and ifa vivo (Figure 3).
Sir2a can
bloclc the induction of endogenous p53 acetylation levels by DNA damage
(Figure 4B, 4C). To
elucidate the physiological significance for this Sir2a mediated regulation,
the effect on DNA
damage-induced apoptotic response was determined.
MEF (p53+~+) cells as described above (Figure 4B), were infected with either a
pBabe-
puro retrovirus empty vector or a pBabe-puro retrovirus containing Sir2cc.
After the DNA
damage treatment by etoposide, the cells were stained with PI and analyzed by
flow cytometric
analysis for apoptotic cells (SubGl) according to DNA content. As shown in
Figure 7A, the
cells mock infected with the pBabe-vector, were susceptible to etoposide-
induced cell death,
with about 48% of the cells apoptotic. after exposure to 20 ~,M of etoposide
(3 vs. 1, Figure 7A).
In contrast, the pBabe-Sir2a infected MEF (p53+~+) cells were more resistant
to apoptosis
induced by the same dose of etoposide, with only 16.4% apoptotic cells (4 vs.
3, Figure 7A).
Since no significant apoptosis was detected in MEF (p53-~-) cells by the same
treatment, the
induced apoptosis observed in MEF (p53+~*) cells is totally p53-dependent.
Thus, Sir2a
significantly inhibits p53-dependent apoptosis in response to DNA damage.
The role of mammalian Sir2a in the oxidative stress response was determined.
Recent
studies have indicated that oxidative stress-induced cell death is p53-
dependent (Yin et al., 1998;
Migliaccio et al., 1999). Early-passage normal human fibroblast (NHF) IMR-90
cells were
employed for this study since p53-dependent apoptosis can be induced by
hydrogen peroxide
treatment in these cells (Chen et al., 2000).
nVIR-90 cells were infected with either a pBabe-puro retrovirus empty vector
or a pBabe-
puro retrovirus containing Sir2a, and cultured for a week under
pharmacological selection. By
immunofluorescence staining, p53, in these infected cells, was induced
significantly after
hydrogen peroxide treatment, along with Sir2a localized in the nuclei detected
by
immunostaining with specific antibodies (Figure 7C). Sir2a expression
significantly promotes
cell survival under oxidative stress. As indicated in Figure 7D, the cells
mock infected with the
pBabe-vector, were susceptible to HZOZ-induced cell death, with more than 80%
of the cells
being killed after 24 hr exposure to 200 ~,M Ha02 (II vs. I). In contrast, the
pBabe-Sir2a
infected cells were much more resistant to death by the same dose of H202,
with about 70% of
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
the cells surviving after 24 hr of H202 treatment (IV vs. III, Figure 7D).
Mammalian Sir2a
promotes cell survival under stress by inhibiting p53-dependent apoptosis.
Example 7. Mammalian Sir2a has no effect on p53-independent cell death induced
by anti-Fas
The specificity of mammalian Sir2a-mediated protection of cells from apoptosis
was
examined by determining whether Sir2a has any effect of p53-independent, Fas-
mediated
apoptosis. The MEF (p53-~-) cells were first infected with either a pBabe-puro
retrovirus empty
vector or a pBabe-puro retrovirus containing Sir2a, then cultured for a week
under
pharmacological selection. After the treatment by anti-Fas (100 ng/ml) for 24
hrs, the cells were
harvested and further analyzed for apoptotic cells (SubGl).
Cells mock infected with the pBabe vector, were susceptible to anti-Fas
induced cell
death, with about 31.7% of the cells becoming apoptotic. However, in contrast
to the strong
protection of p53-dependent apoptosis by Sir2a during DNA damage response in
the MEF
(p53+~+) cells (Figure 7A, B), Sir2cx expression had no significant effect on
Fas-mediated
apoptosis in the MEF (p53-~-) cells. Thus, mammalian Sir2a regulates p53-
mediated apoptosis.
Mammalian Sir2a has no effect on the Fas mediated apoptosis. (A) Both mock
infected
cells and pBabe-Sir2a infected MEF p53(-/-) cells were either not treated (1
and 2) or treated
with 100 ng/ml Fas antibody in presence of actinomycin D (0.25 ~,g/ml) (3 and
4). The cells
were analyzed for apoptotic cells (subGl) according to DNA content (PI
staining). The
representative results depict the average of three experiments with standard
deviations indicated.
Example 8. Physical interaction of hSir2 with p53
p53 protein is acetylated in response to DNA damage and the acetylation
contributed to
the functional activation of p53 as a transcription factor (Abraham et al.,
2000; Sakaguchi et al.,
1998). Sir2 is a deacetylase of p53, thereby modulating functioning of p53 as
a transcription
factor:
In order to study the functional interaction between p53 and hSir2, a full
length human
hSir2SIRTl cDNA clone (obtained from the IMAGE consortium (Frye, 1999)) was
introduced
into a pBabe-based retroviral expression vector which also carries puromycin
resistance gene as
71
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
a selectable marker. The resulting construct was termed pYESirwt. A retroviral
construct
bearing a derived, mutant allele of Sir2 and ternied pYESirHY was constructed
and used in
parallel as control. This mutant allele encodes an amino acid substitution at
residue 363, at
which site the normally present histidine is replaced by tyrosine. This H to Y
substitution results
in an alteration of the highly conserved catalytic site of the hSir2 protein
and subsequent
neutralization of its deacetylase activity. These vector constructs were used
to transduce the
hSIR2SIRT1 gene both by transfection and retroviral infection.
A polyclonal rabbit antibody that specifically recognizes the C-terminal
portion of hSir2
was developed and its specificity validated by immunoprecipitation and Western
blotting (Figure
8A). Both the endogenous and the ectopically expressed hSir2 proteins were
detected as protein
species of 120 Kilodalton (Kd) rather than as 80Kd polypeptide predicted from
the known
primary sequence of hSIR2SIRT1(Figure 8A). Localization of hSir2 protein by
immunofluorescence using the hSir2 antibody showed a punctate nuclear staining
pattern (Figure
8B).
The physical interactions between hSir2 and p53 were evaluated by co-
transfecting the
pYESir2wt plasmid and a vector expressing wt p53 under the control of the
cytomegalovirus
promoter (pCMV-wtp53) transiently into H1299 human non-small cell lung
carcinoma cells
(Brower et al., 1986) which have a homozygous deletion of the p53 gene and
produce no p53
mRNA or protein (Mitsudomi et al., 1992). Cell lysates were subsequently mixed
with the rabbit
anti-hSir2 antibody and resulting immune complexes were collected by protein G
and analyzed
by SDS-PAGE electrophoresis and immunoblotting. The immunoblot was probed with
a sheep
anti-p53 antibody (Figure 8C) and reprobed it subsequently with an anti-hSir2
antibody (top
panel) to verify presence of hSir2 in the complex. As indicated in Figure 8C,
immunoprecipitation of hSir2 resulted in co-precipitation of p53.
hl the reciprocal experiment, lysates of BJT cells, human fibroblasts into
which the
telomerase gene has been introduced, were examined. In addition, these cells
express either the
wild type hSir2 vector or the hSir2HY mutant. Two cell populations were
created by infection
of mass cultures of BJT cells with the respective vectors and subsequent
selection in puromycin.
The anti-p53 antibody was employed to immunoprecipitate complexes and
subsequently probe
the resulting immunoblot with either polyclonal anti-p53 antibodies or an anti-
hSir2 antibody.
These immunoblots demonstrated a physical interaction between hSir2 and p53
proteins (Figure
72
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
8D). Formation of these complexes was unaffected by the H to Y mutation
introduced into the
hSir2 catalytic site (Figure 8D). Furthermore, radiation used to increase the
levels of p53 protein
in BJ cells had no effect on the levels of p53:hSir2 complexes. Comparison of
the
immunoprecipitated p53 to total input p53 resulted in an estimate of
approximately 1 % of the
cells complement of p53 protein was present in physical complexes with hSir2.
Example 9. Deacetylation of p53 by hSir2 i~a vits~o
Since hSir2 forms physical complexes with p53, the ability of Sir2 to
deacetylate human
p53 in vitro was evaluated. Since adequate quantities of bacterially produced
hSir2 were not
available, bacterially expressed mouse SIR2 (mSir2a) enzyme was used in in
vitYO assays (Imai
et al., 2000). A 20 residue-long oligopeptide that contains the sequence
corresponding to
residues 368-386+Cys of the human p53 protein was used as a substrate in these
reactions.
Lysine residues corresponding to residues 373 and 382 of the p53 protein were
synthesized in
acetylated form in this oligopeptide substrate. These two residues of p53 are
known.to be
acetylated by p300 (Gu and Roeder, 1997) following y or UV irradiation (Liu et
al., 1999;
Sakaguchi et al., 1998) with acetylation of lysine residue 382 being favored
in response to
ionizing radiation in vivo (Abraham et al., 2000). This p53 oligopeptide
serves as an excellent
surrogate p53 substrate in vitro for acetylation studies (Gu and Roeder,
1997).
The deacetylase activity of hSir2 utilizes NAD as a co-factor (Imai et al.,
2000; Moazed,
2001; Smith et al., 2000; Tanner et al., 2000; Tanny et al., 1999). Iii the
absence of added NAD,
incubation of mSir2 with p53 oligopeptide gave rise to a single prominent peak
(peak 1) and a
small, minor peak (peak 2) upon high pressure liquid chromatography (HPLC),
corresponding to
the monomeric and dimeric forms of the peptide, respectively (Figure 9A).
However, incubation
in the presence of 1mM NAD produced a singly deacetylated species as the major
product (peak
3, Figure 9B). Edman sequencing of this singly deacetylated species revealed
that mSir2
preferentially deacetylated the residue corresponding to Lys 382 of p53
(Figure 9, C-F), having
relatively weak effect on Lys 373. Thus, the acetylated p53 peptide acted as a
substrate for hSir2
and indicated that the de-acetylation of p53 at Lys 382 by mammalian Sir2 is
specific and not the
result of an indiscriminate deacetylase function.
Example 10. Deacetylation of p53 by hSir2 i~a vivo
73
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
The ability of hSir2 to deacetylate intact p53 protein in vivo was evaluated.
To produce
acetylated p53 in vivo, the p53 expression plasmid was co-transfected with one
expressing p300.
This protocol leads to acetylation of p53 in the absence of exposure to DNA-
damaging agents
(Luo et al., 2000). The ability of hSir2 to deacetylate the p53 protein at its
K382 residue in
H1299 cells that lack endogenous p53 gene was determined. The levels of
acetylation of p53 at
Lys382 were monitored by using a rabbit polyclonal antibody, termed Ab-1,
which had been
raised against the acetylated K382 of p53 protein. The specificity of the Ab-1
antibody has been
demonstrated (Sakaguchi et al., 1998).
Co-transfection of plasmids expressing wild-type p53 and p300 into H1299 cells
showed
that p53 protein is readily acetylated at K382, as detected by probing the
immunoblot with the
Ab-1 antibody (Figure 10A, lane 3). Recognition of this acetylated form of p53
by the Ab-1
antibody was specific, since a mutant p53 protein that was expressed in a
parallel culture of
H1299 cells and carries an arginine rather than a lysine at residue 382 was
not recognized by the
Ab-1 antibody, despite ectopic expression of the p300 acetylase. (Figure 10A,
lane 6).
Co-transfection of the hSir2-expression plasmid with the p53- and p300-
expressing
plasmids substantially decreased the acetylated p53 that could be detected by
the Ab-1 antibody.
(Figure 10A, Iane 5). The residual level of acetylated p53 could be further
reduced by increasing
the amount of co-transfected hSir2 expression plasmid. Thus, hSir2 can
deacetylate p53 protein
at the Lys382 residue ira vivo.
The hSir2HY vector, which expresses the mutant-catalytically inactive hSir2,
was
introduced into these H1299 cells. The mouse equivalent of this hSir2HY mutant
lacks 95% of
its deacetylase activity (Imai et al., 2000). The hSir2HY mutant failed to
deacetylate wt p53
efficiently, indicating that the catalytic activity of the introduced wild
type hSir2 gene product
was required for specific deacetylation of p53 Lys 382 (Figure 10A, lane 9).
The lysine 320 residue of p53 is also acetylated by PCAF in response to DNA
damage
(Sakaguchi et al., 1998). Whether the state of acetylation of residue 320
affected the ability of
hSir2 to deacetylate residue 382 was determined. A mutant p53 allele that
specifies a lysine-to-
arginine substitution at residue 320 was expressed. This amino acid
substitution did not affect
the ability of hSir2 to deacetylate the K382 residua in H1299 cells,
indicating that the action of
hSir2 on the acetylated K382 residue is independent of the state of
acetylation of the K320
residue (Figure 10A, lanes 7, 8).
74
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
As a measure of the substrate specificity of hSir2, the effects of hSir2 on
histone
acetylation, specifically the acetylated residue lysine 9 of histone H3, were
determined using cell
nuclei from the above experiments. H3 Lys9 acetylation was monitored through
the use of the
9671 S monoclonal antibody. The 9671 S antibody specifically recognizes
histone H3 that is
acetylated at this position.
Neither wildtype hSir2 nor the catalytically inactive hSir2HY altered the
acetylation of
histone H3 at this position (Figure 10A, bottom). Thus, de-acetylation of p53
Lys382 ih. vivo
reflects a defined substrate specificity of hSir2 and not a non-specific
consequence of its over-
expression.
Example 11. liSir2 and p53 acetylation in primary and tumor cell lines
Acetylation of lysine residue 382 of p53 accompanies and mediates the
functional
activation of p53 as a transcription factor following exposure of a cell to
ionizing radiation
(Sakaguchi et al., 1998). To determine whether hSir2 could antagonize and
reverse this
activation of p53, by its deacetylase function, either wildtype hSir2 or the
mutant form specified
by the hSir2HY vector was expressed in BJT human fibroblast cells. Ectopic
expression of the
telomerase enzyme in these BJT cells, undertaken to extend their lifespan, had
no effect on either
their activation of p53 protein or their responses to DNA damage (Vaziri et
al., 1999).
In order to facilitate detection of ifa vivo acetylated p53 protein, BJT cells
were expressed
to 6Gy of ionizing radiation in the presence of low trichostatin A (TSA)
concentrations. While
not directly inhibiting hSir2 catalytic activity (Imai et al., 2000), TSA
appears to increase the
stability of acetylated p53 protein (Sakaguchi et czl., 1998), perhaps by
inhibiting nori-hSir2
deacetylases that also recognize the acetylated p53 K382 residue. The
resulting immunoblot was
probed with the polyclonal rabbit antiserum (Ab-1) which specifically
recognizes the acetylated
K382 form of p53.
Following 6 Gy of ionizing radiation, a 1.5-2 fold increase in the level of
acetylated p53
protein was observed, as indicated by the levels of p53 protein recognized by
the Ab-1 antiserum
(Figure l OB). A four-fold increase in hSir2 levels, achieved through ectopic
expression of hSir2,
resulted in the reversal of the radiation-induced increase in acetylated K382
p53 protein (Figure
l OB). In contrast, expression of the catalytically inactive hSirHY protein at
comparable levels
increased the radiation-induced levels of p53 acetylated at residue K382
(Figure l OB) suggesting
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
that the hSir2HY mutant may act in a dominant negative fashion in BJT cells. A
re-probing of
this immunoblot with a polyclonal anti-p53 antibody showed normal
stabilization of p53 in
control cells in response to DNA damage and at most, slightly reduced levels
of stabilization in
the presence of ectopically expressed wild type hSir2 (Figure 10B). Hence,
while hSir2 is able to
reverse the radiation-induced acetylation of p53 in these cells, it has only
minimal effects on the
metabolic stabilization of p53 induced by exposure to radiation.
A similar phenomenon was observed in MCF-7 human breast carcinoma line cells,
which
have retained an apparently intact p53-dependent checkpoint in response to
ionizing radiation.
Irradiation of these cells led to a three-fold increase in acetylated p53
levels, while a four-fold
ectopic expression of wild type hSir2 in irradiated MCF-7 cells led to
deacetylation of p53
protein (Figure l OC). In contrast to BJT cells, no significant change in the
stability of total p53
protein was observed. However, MCF-7 cells expressing the hSirHY mutant showed
a level of
radiation-induced acetylation that was comparable to control irradiated cells
(Figure Z OC). Thus,
hSir2 is able to reverse the radiation-induced acetylation in both BJT and MCF-
7 cells,
suggesting that hSir2 acts as an antagonist of p53 function ih vivo.
The differences observed in deacetylation activities of hSir2HY in MCF7 and
BJT cells
may reflect the ability of hSir2HY to act as a dominant-negative allele in BJT
cells. BJT cells do
express significantly lower levels of endogenous hSir2 when compared with MCF7
cells. These
lower levels of hSir2 in BJT cells may enable hSir2HY to form inhibitory
complexes with
endogenous wild type hSir2 or with other proteins required for its function.
In tlus context,
evidence in yeast suggests that H363Y mutant does indeed act as a potent
dominant-negative
(Tanny et al., 1999).
Example 12. Effects of hSir2 on the transcriptional activity of p53 protein
The effects of hSir2 on the transcriptional activity of p53 were determined by
co-
transfecting H1299 cells transiently with a p53 expression plasmid and a
reporter construct in
which the promoter of the p21WAF1 gene (el-Deiry et al., 1993), a known target
of
transcriptional activity by p53, is able t~ drive expression of a luciferase
reporter gene (Vaziri et
al., 1997). As indicated in Figure 11A, luciferase activity increased in
response to increasing
amount of co-transfected wtp53 expression vector. Conversely, the
transcriptional activity of
p53 protein was suppressed by co-expression of wild type hSir2 in a dose-
dependent fashion.
76
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
The catalytically inactive hSir2HY mutant had no effect on p53 transcriptional
activity (Figure
1 1A). The specificity of hSir2 in affecting promoter activity was determined
using a
constitutively active SV40 promoter liuced to the luciferase gene. Expression
of this control
construct was not affected by increasing amounts of hSir2 expression vector at
any level (Figure
11B).
The above observations were confirmed in a more physiologic context using a
subline of
MCF-7L cells. The subline of MCF-7 cells was stably transfected with a p21WAF1
promoter-
reporter construct. In addition, these cells were infected stably with
retroviral vector constructs
expressing either the wild type hSir2 or the mutant hSir2HY. These cells were
expressed to 6 Gy
of ionizing radiation and subsequently measured total p53 and p21WAF1 protein
levels (Figure
11 C).
p53 protein levels increased normally in all cell populations in response to
irradiation of
these cells. However, the levels of p21 WAF1 protein were reduced in cells
expressing wild type
hSir2 (Figure 11C). Moreover, MCF-7L cells expressing the mutant hSir2HY
protein had a
higher level of p21 WAF 1 when compared with the irradiated controls and with
the wild type
hSir2-overexpressing cells (Figure 11 C) showing that the hSir2HY mutant may
act in a
dominant-negative fashion in these cells. Thus, hSir2 can antagonize the
transcriptional
activities of p53 that enable it to exert cytostatic effects via
transcriptional activation of the
p21WAF1 gene.
Example 13. Inhibition of p53-dependent apoptosis by hSir2
hSir2 can antagonize the ability of p53 to act in a cytostatic fashion through
induction of
p21 WAF1 synthesis. The ability of hSir2 to blunt the pro-apoptotic functions
of p53 was
determined. Restoration of wild-type p53 function in H1299 cells, achieved via
introduction of a
wt p53-expressing vector, induces apoptosis, as indicated by the expression of
the cell surface
annexin V antigen (Figure 12A). Co-transfection of a p300 vector with the p53
gene increased
this p53-dependent apoptosis (Figure 12A). This apoptotic response was
abolished in a dose-
dependent manner in cells co-transfected with increasing amounts of the wt
hSir2 expression
plasmid (Figure 12A). Hence, hSir2 antagonizes both the cytostatic effects of
p53 (as mediated
byp21WAF1) and its pro-apoptotic effects.
77
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
Example 14. Effects of mutant hSir2HY on radiosensitivity of human fibroblasts
In contrast to the behavior of many other murine or human cell lines, human
fibroblasts
become relatively radioresistant upon inactivation of p53 function (Tsang et
al., 1995). This
behavior suggested an additional test of the ability of hSir2 to antagonize
p53 function, which
depended on measuring the long-term survival of human BJT fibroblasts cells
following
exposure to various doses of low-level ionizing radiation.
Ectopic expression of wild type hSir2 in these cells led to a greater long-
term.survival
(Figure 12B, triangles), while expression of the mutant hSir2HY in BJT cells
led to a
radiosensitive phenotype (Figure 12B, diamonds) consistent with hSir2HY
constructs acting in a
dominant-negative fashion in BJT cells. A positive control cell line derived
from an individual
with ataxia telangiecstasia (AT) was highly radiosensitive (Figure 12B,
circles). The central role
of p53 in these various responses was also shown in the behavior of a subline
of BJT fibroblasts
that express a dominant-negative form of p53 and also have acquired a measure
of
radioresistance (Figure 12B, open square). Thus, wt hSir2 antagonizes p53
activity while the
hSir2HY mutant potentiates its activity.
REFERENCES
Appella E. and Anderson C.W. (2000) Signaling to p53: brealcing the
posttranslational
modification code. Pathol. Biol., 48:227-245.
Avantaggiati M.L., Ogryzko V., Gardner K., Giordano A., Levine A.S. and Kelly
K.
(1997) Recruitment of p300/CBP in p53-dependent signal pathways. Cell, 89:1175-
1184.
Bernstein B.E., Tong J.K. and Schreiber S.L. (2000) Genomewide studies of
histone
deacetylase function in yeast. Proc. Natl. Acad. Sci. USA, 97:13708-13713.
Butler L.M., Agus D.B., Scher H.L, Higgins B., Rose A., Cordon-Cardo C.,
Thaler H.T.,
Rifkind R.A., Marks P.A, and Richon V.M. (2000) Suberoylanilide hydroxamic
acid, an
inhibitor of histone deacetylase suppresses the growth of prostate cancer
cells in vitro and in
vivo. Cancer Res., 60:5165-5170.
7s
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
Campisi J. (2000) Aging, chromatin, and food restriction-coimecting the dots.
Science,
289:2062-2063.
Chao C., Saito S., Kang J., Anderson C.W., Appella E. and Xu Y. (2000) p53
transcriptional activity is essential fox p53-dependent apoptosis following
DNA damage. EMBO
J., 19:4967-4975.
Chen Q.M., Liu J. and Merrett J.B. (2000) Apoptosis or senescence-like growth
arrest:
influence of cell-cycle position, p53, p21 and bax in H2O2 response of normal
human
fibroblasts. Biochem. J., 347:543-551.
Chresta C.M. and Hickman J.A. (1996) Oddball p53 in testicular tumors. Nat.
Med.,
2:745-746.
Di Cristofano A., Kotsi P., Peng Y.F., Cordon-Cardo C., Elkon K.B. and
Pandolfi P.P.
(1999) Impaired Fas response and autoimmunity in Pten+/- mice. Science,
285:2122-2125.
Ferbeyre G., de Stanchina E., Querido E., Baptiste N., Prives C. and Lowe S.W.
(2000)
PML is induced by oncogenic ras and promotes premature senescence. Genes Dev.,
14:2015-
2027.
Frye R.A. (1999) Characterization of five human cDNAs with homology to the
yeast
SIR2 gene: Sir2-like proteins (sirtuins) metabolize NAD and may have protein
ADP-.
ribosyltransferase activity. Biochem. Biophys. Res. Commun., 260:273-279.
Frye R.A. (2000) Phylogenetic classification of prokaryotic and eukaryotic
Sir2-like
proteins. Biochem. Biophys. Res. Commun., 273:793-798.
Gu W. and Roeder R.G. (1997) Activation of p53 sequence-specific DNA binding
by
acetylation of the p53 C-terminal domain. Cell, 90:595-606.
79
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
Gu W., Shi X.L. and Roeder R.G. (1997) Synergistic activation of transcription
by CBP
and p53. Nature, 387:819-823.
Gu W., Malik S., Ito M., Yuan C.X., Fondell J.D., Zhang X., Martinez E., Qin
J. and
Roeder R.G. (1999) A novel human SRB/MED-containing cofactor complex, SMCC,
involved
in transcription regulation. Mol. Cell, 3:97-108.
Guarente L. (2000) Sir2 links chromatin silencing, metabolism, and aging.
Genes Dev.,
14:1021-1026.
Guo A., Salomoni P., Luo J., Shih A., Zhong S., Gu W. and Pandolfi P.P. (2000)
The
function of PML in p53-dependent apoptosis. Nat. Cell Biol., 2:730-736.
Imai S., Armstrong C.M., Kaeberlein M. and Guarente L. (2000) Transcriptianal
silencing and longevity protein Sir2 is an NAD-dependent histone deacetylase.
Nature, 403:795-
800.
Ito A., Lai C., Zhao X., Saito S., Hamilton M., Appella E. and Yao T. (2001)
p300/CBP-
mediated p53 acetylation is commonly induced by p53-activating agents and
inhibited by
MDM2. EMBO J., 20:1331-1340.
Jimenez G.S., Nister M., Stommel J.M., Beeche M., Barcarse E.A., Zhang X.Q.,
O'Gorman S. and Wahl G.M. (2000) A transactivation-deficient mouse model
provides insights
into Trp53 regulation and function. Nat. Genet., 26:37-43.
Kouzarides T. (2000) Acetylation: a regulatory modification to rival
phosphorylation?
EMBO J., 19:1176-1179.
Landry J., Slama J.T. and Sternglanz R. (2000) Role of NAD(+) in the
deacetylase
activity of the SIR2-like proteins. Biochem. Biophys. Res. Commun., 278:685-
690.
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
Landry J., Sutton A., Tafrov S.T., Heller R.C., Stebbins J., Pillus L. and
Sternglanz R.
(2000) The silencing protein SIR2 and its homologs are NAD-dependent protein
deacetylases.
Proc. Natl. Acad. Sci. USA, 97:5807-5811.
Levine A.J. (1997) p53, the cellular gatekeeper for growth and division. Cell,
88:323-
331.
LiII N.L., Grossman S.R., Ginsberg D., DeCaprio J. and Livingston D.M. (1997)
Binding
and modulation of p53 by p300/CBP coactivators. Nature, 387:823-827.
Lin S.J., Defossez P.A. and Guarente L. (2000) Requirement of NAD and SIR2 for
life-
span extension by calorie restriction in Saccharomyces cerevisiae. Science,
289:2126-2128.
Luo J., Su F., Chen D., Shiloh A. and Gu W. (2000) Deacetylation of p53
modulates its
effect on cell growth and apoptosis. Nature, 408:377-381.
Lutzker S.G. and Levine A.J. (1996) A functionally inactive p53 protein in
teratocarcinoma cells is activated by either DNA damage or cellular
differentiation. Nat. Med.,
2:804-810.
Marks P.A., Rifkind R.A., Richon V.M. and Breslow R. (2001) hlhibitors of
histone
deacetylase are potentially effective anticancer agents. Clin. Cancer Res.,
7:759-760.
Maya R., Balass M., Kim S.T., Shkedy D., Leal J.F., Shifman O., Moas M.,
Buschmann
T., Ronai Z. and Shiloh Y. et al. (2001) ATM-dependent phosphorylation of Mdm2
on serine
395: role in p53 activation by DNA damage. Genes Dev., 15:1067-1077.
Migliaccio E., Giorgio M., Mele S., Pelicci G., Reboldi P., Pandolfi P.P.,
Lanfrancone L.
and Pelicci P.G. (1999) The p66shc adaptor protein controls oxidative stress
response and life
span in mammals. Nature, 402:309-313.
81
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
Nakamura S., Roth J.A. and Mukhopadhyay T. (2000) Multiple lysine mutations in
the
C-terminal domain of p53 interfere with MDM2-dependent protein degradation and
ubiquitination. Mol. Cell. Biol., 20:9391-9398.
Nakano K. and Vousden K. (2001) PUMA, a novel proapoptotic gene, is induced by
p53.
Mol. Cell, 7:683-694.
Pearson M., Carbone R., Sebastiani C., Cioce M., Fagioli M., Saito S.,
Higashimoto Y.,
Appella E., Minucci S., Pandolfi P.P. and Pelicci P.G. (2000) PML regulates
p53 acetylation and
premature senescence induced by oncogenic Ras. Nature, 406:207-210.
Prives C. and Hall P.A. (1999) The p53 pathway. Pathol. J., 187:112-126.
Rodriguez M.S., Desterro J.M., Lain S., Lane D.P. and Hay R.T. (2000) Multiple
C-
terminal lysine residues target p53 for ubiquitin-proteasome-mediated
degradation. Mol. Cell.
Biol., 20:8458-8467.
Shieh S.Y., Ikeda M., Taya Y. and Prives C. (1997) DNA damage-induced
phosphorylation of p53 alleviates inhibition MDM2. Cell, 91:325-334.
Shore D. (2000) The Sir2 protein family: A novel deacetylase for gene
silencing and
more. Proc. Natl. Acad. Sci. USA, 97:14030-14032.
Smith J.S., Brachmann C.B., Celic L, Kenna M.A., Muhammad S., Starai V.J.,
Avalos
J.L., Escalante-Semerena J.C., Grubmeyer C., Wolberger C. and Boeke J.D.
(2000) A
phylogenetically conserved NAD-dependent protein deacetylase activity in the
Sir2 protein
family. Proc. Natl. Acad. Sci. USA, 97:6658-6663.
Sterner D.E. and Berger S.L. (2000) Acetylation of histones and transcription-
related
factors. Microbiol. Mol. Biol., 64:435-459.
82
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
Tanner K.G., Landry J., Sternglanz R. and Denu J.M. (2000) Silent information
regulator
2 family of NAD-dependent histone/protein deacetylases generates a unique
product, 1-O-acetyl-
ADP-ribose. Proc. Natl. Acid. Sci. USA, 97:14178-14182.
Tinny J.C. and Moazed D. (2001) Coupling of histone deacetylation to NAD
breakdown
by the yeast silencing protein Sir2: Evidence for acetyl transfer from
substrate to am NAD
breakdown product. Proc. Natl. Acid. Sci. USA, 98:415-420.
Tissenbaum H.A. and Guarente L. (2001) Increased dosage of a sir-2 gene
extends
lifespan in Caenorhabditis elegans. Nature, 410:227-230.
Vaziri H., West M.D., Allsopp R.C., Davison T.S., Wu Y.S., Arrowsmith C.H.,
Poirier
G.G. and Benchimol S. (1997) ATM-dependent telomere loss in aging human
diploid fibroblasts
and DNA damage lead to the post-translational activation of p53 protein
involving poly(ADP-
ribose) polymerise. EMBO J., 16:6018-6033.
Vaziri H., Dessain S.K., Ng-Eaton E., Tinai S.L, Frye R.A., Pandita T.K.,
Guarente L. and
Weinberg R.A. (2001) hSIR2S1RT1 functions as an NAD-dependent p53 deacetylase.
Cell,
107:149-159.
Vogelstein B., Lane D. and Levine A.J. (2000) Surfing the p53 network. Nature,
408:307-310.
Yin Y., Terauchi Y., Solomon G.G., Aizawa S., Rangarajan P.N., Yazaki Y.,
Kadowaki
T. and Barrett J.C. (1998) Involvement of p85 in p53-dependent apoptotic
response to oxidative
stress. Nature, 391:707-710.
Yoshida M., Horinouchi S. and Beppu T. (1995) Trichostatin A and trapoxin:
novel
chemical probes for the role of histone acetylation in chromatin structure and
function.
Bioessays, 5:423-430.
83
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
Yu A., Fan H., Lao D., Bailey A.D. and Weiner A.M. (2000) Activation of p53 or
loss of
the Cockayne syndrome group B repair protein causes metaphase fragility of
human Ul, U2, and
SS genes. Mol. Cell, 5:801-810.
Yu J., Zhang L., Hwang P., Kinzler K. and Vogelstein B. (2001) PUMA induces
the
rapid apoptosis of colorectal cancer cells. Mol. Cell, 7:673-682.
All patents, patent applications, and published references cited herein are
hereby
incorporated by reference.
A number of embodiments of the invention have been described. Nevertheless, it
will be
understood that various modifications may be made without departing from the
spirit and scope
of the invention. Accordingly, other embodiments are within the scope of the
following claims.
84
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
SEQUENCE LISTING
<110> Guarente, Leonard
Vaziri, Homayoun
Imai, Shin-Ichiro
Gu, Wei
<120> Sir2 and p53 Deacetylation
<130> 13407-015001
<150> US 60/303,456
<151> 2001-07-06
<150> US60/303,370
<151> 2001-07-06
<160> 18
<170> PatentIn version 3.1
<210>1
<211>18
<212>PRT
<213>homo Sapiens
<400> 1
His Leu Lys Ser Lys Gly Gln Ser Thr Ser Arg His Lys Leu Met Phe
1 5 10 15
Lys Cys
1
CA 02453195 2004-O1-06
WO PCT/US02/21461
03/004621
<210> 2
<211> 1546
<212> DNA
<213> homoSapiens
<400> 2
atggaggagccgcagtcagatcctagcgtcgagccccctctgagtcaggaaacattttca
60
gacctatggaaactacttcctgaaaacaacgttctgtcccccttgccgtcccaagcaatg
15120
gatgatttgatgctgtccccggacgatattgaacaatggttcactgaagacccaggtcca
180
gatgaagctcccagaatgccagaggctgctccccccgtggcccctgcaccagcagctcct
240
acaccggcggcccctgcaccagccccctcctggcccctgtcatcttctgtcccttcccag
300
aaaacctaccagggcagctacggtttccgtctgggcttcttgcattctgggacagccaag
360
tctgtgacttgcacgtactcccctgccctcaacaagatgttttgccaactggccaagacc
30420
tgccctgtgcagctgtgggttgattccacacccccgcccggcacccgcgtccgcgccatg
480
gccatctacaagcagtcacagcacatgacggaggttgtgaggcgctgcccccaccatgag
540
cgctgctcagatagcgatggtctggcccctcctcagcatcttatccgagtggaaggaaat
600
2
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
ttgcgtgtgg agtatttgga tgacagaaac acttttcgac atagtgtggt ggtgccctat
660
gagccgcctg aggttggctc tgactgtacc accatccact acaactacat gtgtaacagt
720
tcctgcatgg gcggcatgaa ccggaggccc atcctcacca tcatcacact ggaagactcc
780
agtggtaatc tactgggacg gaacagcttt gaggtgcatg tttgtgcctg tcctgggaga
840
gaccggcgca cagaggaaga gaatctccgc aagaaagggg agcctcacca cgagctgccc
900
ccagggagca ctaagcgagc actgcccaac aacaccagct cctctcccca gccaaagaag
960
aaaccactgg atggagaata tttcaccctt cagatccgtg ggcgtgagcg cttcgagatg
1020
ttccgagagc tgaatgaggc cttggaactc aaggatgccc aggctgggaa ggagccaggg
loso
gggagcaggg ctcactccag ccacctgaag tccaaaaagg gtcagtctac ctcccgccat
1140
aaaaaactca tgttcaagac agaagggcct gactcagact gacattctcc acttcttgtt
1200
ccccactgac agcctcccac ccccatctct ccctcccctg ccattttggg ttttgggtct
1260
ttgaaccctt gcttgcaata ggtgtgcgtc agaagcaccc aggacttcca tttgctttgt
1320
3
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
cccggggctc cactgaacaa gttggcctgc actggtgttt tgttgtgggg aggaggatgg
1380
ggagtaggac ataccagctt agattttaag gtttttactg tgagggatgt ttgggagatg
1440
taagaaatgt tcttgcagtt aagggttagt ttacaatcag ccacattcta ggtagggacc
1500
cacttcaccg tactaaccag ggaagctgtc cctcactgtt gaattc
1546
<210> 3
<211> 393
<212> PRT
<2l3> homo Sapiens
<400> 3
Met Glu Glu Pro Gln Ser Asp Pro Ser Val Glu Pro Pro Leu Ser Gln
1 5 10 15
Glu Thr Phe Ser Asp Leu Trp Lys Leu Leu Pro Glu Asn Asn Val Leu
20 25 30
Ser Pro Leu Pro Ser Gln Ala Met Asp Asp Leu Met Leu Ser Pro Asp
40 45
Asp Zle Glu Gln Trp Phe Thr Glu Asp Pro Gly Pro Asp Glu Ala Pro
50 55 60
4
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
Arg Met Pro Glu Ala Ala Pro Pro Val Ala Pro Ala Pro Ala Ala Pro
65 70 75 80
Thr Pro Ala Ala Pro Ala Pro Ala Pro Ser Trp Pro Leu Ser Ser Ser
85 90 95
Val Pro Ser Gln Lys Thr Tyr Gln Gly Ser Tyr Gly Phe Arg Leu Gly
100 105 110
Phe Leu His Ser Gly Thr Ala Lys Ser Val Thr Cys Thr Tyr Ser Pro
115 120 125
Ala Leu Asn Lys Met Phe Cys Gln Leu Ala Lys Thr Cys Pro Val Gln
130 135 140
Leu Trp Val Asp Ser Thr Pro Pro Pro Gly Thr Arg Val Arg Ala Met
145 150 155 160
Ala Ile Tyr Lys Gln Ser Gln His Met Thr Glu Val Val Arg Arg Cys
165 170 175
Pro His His Glu Arg Cys Ser Asp Ser Asp Gly Leu Ala Pro Pro Gln
180 185 190
His Leu Ile Arg Val Glu Gly Asn Leu Arg Val Glu Tyr Leu Asp Asp
195 200 205
5
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
Arg Asn Thr Phe Arg His Ser Val Val Val Pro Tyr Glu Pro Pro Glu
210 215 220
Val Gly Ser Asp Cys Thr Thr I1e His Tyr Asn Tyr Met Cys Asn Ser
225 230 235 240
Ser Cys Met Gly Gly Met Asn Arg Arg Pro Ile Leu Thr Ile Ile Thr
245 250 255
Leu Glu Asp Ser Ser Gly Asn Leu Leu Gly Arg Asn Ser Phe Glu Val
260 265 270
His Val Cys Ala Cys Pro Gly Arg Asp Arg Arg Thr G1u Glu Glu Asn
275 280 285
Leu Arg Lys Lys Gly Glu Pro His His G1u Leu Pro Pro Gly Ser Thr
290 295 300
Lys Arg Ala Leu Pro Asn Asn Thr Ser Ser Ser Pro Gln Pro Lys Lys
305 310 315 320
Lys Pro Leu Asp G1y G1u Tyr Phe Thr Leu G1n Ile Arg G1y Arg Glu
325 330 335
Arg Phe Glu Met Phe Arg Glu Leu Asn Glu Ala Leu Glu Leu Lys Asp
340 345 350
6
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
Ala Gln Ala Gly Lys Glu Pro Gly Gly Ser Arg Ala His Ser Ser His
355 360 365
Leu Lys Ser Lys Lys Gly Gln Ser Thr Ser Arg His Lys Lys Leu Met
370 375 380
Phe Lys Thr Glu Gly Pro Asp Ser Asp
385 390
<210> 4
<211> 1760
<212> DNA
<2l3> Homo Sapiens
<400> 4
gtcgaccctt tccacccctg gaagatggaa ataaacctgc gtgtgggtgg agtgttagga
25
caaaaaaaaa aaaaaaaaag tctagagcca ccgtccaggg agcaggtagc tgctgggctc
120
cggggacact ttgcgttcgg gctgggagcg tgctttccac gacggtgaca cgcttccctg
30 180
gattggcagc cagactgcct tccgggtcac tgccatggag gagccgcagt cagatcctag
240
35 cgtcgagccc cctctgagtc aggaaacatt ttcagaccta tggaaactac ttcctgaaaa
300
caacgttctg tcccccttgc cgtcccaagc aatggatgat ttgatgctgt ccccggacga
360
7
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
tattgaacaa tggttcactg aagacccagg tccagatgaa gctcccagaa tgccagaggc
420
tgctcccccc gtggcccctg caccagcagc tcctacaccg gcggcccctg caccagcccc
480
ctcctggccc ctgtcatctt ctgtcccttc ccagaaaacc taccagggca gctacggttt
540 ,
ccgtctgggc ttcttgcatt ctgggacagc caagtctgtg acttgcacgt actcccctgc
600
cctcaacaag atgttttgcc aactggccaa gacctgccct gtgcagctgt gggttgattc
660
cacacccccg cccggcaccc gcgtccgcgc catggccatc tacaagcagt cacagcacat
720
gacggaggtt gtgaggcgct gcccccacca tgagcgctgc tcagatagcg atggtctggc
780
ccctcctcag catcttatcc gagtggaagg aaatttgcgt gtggagtatt tggatgacag
840
aaacactttt cgacatagtg tggtggtgcc ctatgagccg cctgaggttg gctctgactg
900
taccaccatc cactaca~act acatgtgtaa cagttcctgc atgggcggca tgaaccggag
960
gcccatcctc accatcatca cactggaaga ctccagtggt aatctactgg gacggaacag
1020
ctttgaggtg catgtttgtg cctgtcctgg gagagaccgg cgcacagagg aagagaatct
1080
8
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
ccgcaagaaa ggggagcctc accacgagct gcccccaggg agcactaagc gagcactgcc
1140
caacaacacc agctcctctc cccagccaaa gaagaaacca ctggatggag aatatttcac
1200
ccttcagatc cgtgggcgtg agcgcttcga gatgttccga gagctgaatg aggccttgga
1260
actcaaggat gcccaggctg ggaaggagcc aggggggagc agggctcact ccagccacct
1320
gaagtccaaa aagggtcagt ctacctcccg ccataaaaaa ctcatgttca agacagaagg
1380
gcctgactca gactgacatt ctccacttct tgttccccac tgacagcctc ccacccccat
1440
ctctccctcc cctgccattt tgggttttgg gtctttgaac ccttgcttgc aataggtgtg
1500
cgtcagaagc acccaggact tccatttgct ttgtcccggg gctccactga acaagttggc
1560
ctgcactggt gttttgttgt ggggaggagg atggggagta ggacatacca gcttagattt
1620
taaggttttt actgtgaggg atgtttggga gatgtaagaa atgttcttgc agttaagggt
1680
tagtttacaa tcagccacat tctaggtagg gacccacttc accgtactaa ccagggaagc
1740
tgtccctcac tgttgaattc
1760
9
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
<210> 5
<211> 3869
<212> DNA
<213> Mus musculus
<400> 5
gcggagcagaggaggcgagggcggagggccagagaggcagttggaagatggcggacgagg
60
tggcgctcgcccttcaggccgccggctccccttccgcggcggccgccatggaggccgcgt
120
cgcagccggcggacgagccgctccgcaagaggccccgccgagacgggcctggcctcgggc
180
gcagcccgggcgagccgagcgcagcagtggcgccggcggccgcggggtgtgaggcggcga
240
gcgccgcggccccggcggcgctgtggcgggaggcggcaggggcggcggcgagcgcggagc
300
gggaggccccggcgacggccgtggccggggacggagacaatgggtccggcctgcggcggg
360
agccgagggcggctgacgacttcgacgacgacgagggcgaggaggaggacgaggcggcgg
420
cggcagcggcggcggcagcgatcggctaccgagacaacctcctgttgaccgatggactcc
480
tcactaatggctttcattcctgtgaaagtgatgacgatgacagaacgtcacacgccagct
540
ctagtgactggactccgcggccgcggataggtccatatacttttgttcagcaacatctca
600
10 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
tgattggcaccgatcctcgaacaattcttaaagatttattaccagaaacaattcctccac
660
ctgagctggatgatatgacgctgtggcagattgttattaatatcctttcagaaccaccaa
720
agcggaaaaaaagaaaagatatcaatacaattgaagatgctgtgaagttactgcaggagt
780
gtaaaaagataatagttctgactggagctggggtttctgtctcctgtgggattcctgact
840
tcagatcaagagacggtatctatgctcgccttgcggtggacttcccagacctcccagacc
900
ctcaagccatgtttgatattgagtattttagaaaagacccaagaccattcttcaagtttg
960
caaaggaaatatatcccggacagttccagccgtctctgtgtcacaaattcatagctttgt
1020
cagataaggaaggaaaactacttcgaaattatactcaaaatatagataccttggagcagg
1080
ttgcaggaatccaaaggatccttcagtgtcatggttcctttgcaacagcatcttgcctga
1140
tttgtaaatacaaagttgattgtgaagctgttcgtggagacatttttaatcaggtagttc
1200
ctcggtgccctaggtgcccagctgatgagccacttgccatcatgaagccagagattgtct
1260
tctttggtgaaaacttaccagaacagtttcatagagccatgaagtatgacaaagatgaag
1320
11 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
ttgacctcct cattgttatt ggatcttctc tgaaagtgag accagtagca ctaattccaa
1380
gttctatacc ccatgaagtg cctcaaatat taataaatag ggaacctttg cctcatctac
1440
attttgatgt agagctcctt ggagactgcg atgttataat taatgagttg tgtcataggc
1500
taggtggtga atatgccaaa ctttgttgta accctgtaaa gctttcagaa attactgaaa
1560
aacctccacg cccacaaaag gaattggttc atttatcaga gttgccacca acacctcttc
1620
atatttcgga agactcaagt tcacctgaaa gaactgtacc acaagactct tctgtgattg
1680
ctacacttgt agaccaagca acaaacaaca atgttaatga tttagaagta tctgaatcaa
1740
gttgtgtgga agaaaaacca caagaagtac agactagtag gaatgttgag aacattaatg
1800
tggaaaatcc agattttaag gctgttggtt ccagtactgc agacaaaaat gaaagaactt
1860
cagttgcaga aacagtgaga aaatgctggc ctaatagact tgcaaaggag cagattagta
1920
agcggcttga gggtaatcaa tacctgtttg taccaccaaa tcgttacata ttccacggtg
1980
ctgaggtata ctcagactct gaagatgacg tcttgtcctc tagttcctgt ggcagtaaca
2040
12 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
gtgacagtgg cacatgccag agtccaagtt tagaagaacc cttggaagat gaaagtgaaa
2100
ttgaagaatt ctacaatggc ttggaagatg atacggagag gcccgaatgt gctggaggat
2160
ctggatttgg agctgatgga ggggatcaag aggttgttaa tgaagctata gctacaagac
2220
aggaattgac agatgtaaac tatccatcag acaaatcata acactattga agctgtccgg
2280
attcaggaat tgctccacca gcattgggaa ctttagcatg tcaaaaaaat gaatgtttac
2340
ttgtgaactt gaacaaggaa atctgaaaga tgtattattt atagactgga aaatagattg
2400
tcttcttgga taatttctaa agttccatca tttctgtttg tacttgtaca ttcaacactg
2460
ttggttgact tcatcttcct ttcaaggttc atttgtatga tacattcgta tgtatgtata
2520
attttgtttt ttgcctaatg agtttcaacc ttttaaagtt ttcaaaagcc attggaatgt
2580
taatgtaaag ggaacagctt atctagacca aagaatggta tttcacactt ttttgtttgt
2640
aacattgaat agtttaaagc cctcaatttc tgttctgctg aacttttatt tttaggacag
2700 .
ttaacttttt aaacactggc attttccaaa acttgtggca gctaactttt taaaatcaca
2760
13 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
gatgacttgt aatgtgagga gtcagcaccg tgtctggagc actcaaaact tgggctcagt
2820
gtgtgaagcg tacttactgc atcgtttttg tacttgctgc agacgtggta atgtccaaac
2880
aggcccctga gactaatctg ataaatgatt tggaaatgtg tttcagttgt tctagaaaca
2940
atagtgcctg tctatatagg tccccttagt ttgaatattt gccattgttt aattaaatac
3000
ctatcactgt ggtagagcct gcatagatct tcaccacaaa tactgccaag atgtgaatat
3060
gcaaagcctt tctgaatcta ataatggtac ttctactggg gagagtgtaa tattttggac
3120
tgctgttttt ccattaatga ggaaagcaat aggcctctta attaaagtcc caaagtcata
3180
agataaattg tagctcaacc agaaagtaca ctgttgcctg ttgaggattt ggtgtaatgt
3240
atcccaaggt gttagccttg tattatggag atgaatacag atccaatagt caaatgaaac
3300
tagttcttag ttatttaaaa gcttagcttg ccttaaaact agggatcaat tttctcaact
3360
gcagaaactt ttagcctttc aaacagttca cacctcagaa agtcagtatt tattttacag
3420
acttctttgg aacattgccc ccaaatttaa atattcatgt gggtttagta tttattacaa
3480
14 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
aaaaatgatt tgaaatatag ctgttcttta tgcataaaat acccagttag gaccattact
3540
gccagaggag aaaagtatta agtagctcat ttccctacct aaaagataac tgaatttatt
3600
tggctacact aaagaatgca gtatatttag ttttccattt gcatgatgtg tttgtgctat
3660
agacaatatt ttaaattgaa aaatttgttt taaattattt ttacagtgaa gactgttttc
3720
agctcttttt atattgtaca tagactttta tgtaatctgg catatgtttt gtagaccgtt
3780
taatgactgg attatcttcc tccaactttt gaaatacaaa aacagtgttt tatactaaaa
3840
aaaaaaaaag tcgacgcggc cgcgaattc
3869
<210> 6
<211> 737
<212> PRT
<213> Mus musculus
<400> 6
Met Ala Asp Glu Val Ala I~eu Ala Zeu Gln Ala Ala Gly Ser Pro Ser
1 5 10 15
Ala Ala Ala Ala Met Glu Ala Ala Ser Gln Pro Ala Asp Glu Pro Leu
20 25 30
15 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
Arg Lys Arg Pro Arg Arg Asp Gly Pro Gly Leu Gly Arg Ser Pro Gly
35 40 45
Glu Pro Ser Ala Ala Val Ala Pro Ala Ala Ala Gly Cys Glu Ala Ala
50 55 60
Ser Ala Ala Ala Pro Ala Ala Leu Trp Arg Glu Ala Ala Gly Ala Ala
65 70 75 80
Ala Ser Ala Glu Arg Glu Ala Pro Ala Thr Ala Val Ala Gly Asp Gly
85 90 95
Asp Asn Gly Ser Gly Leu Arg Arg Glu Pro Arg Ala A1a Asp Asp Phe
l00 105 l10
Asp Asp Asp Glu Gly Glu Glu Glu Asp Glu Ala Ala Ala Ala Ala A1a
115 l20 125
Ala A1a A1a Ile Gly Tyr Arg Asp Asn Leu Leu Leu Thr Asp Gly Leu
130 135 140
Leu Thr Asn Gly Phe His Ser Cys Glu Ser Asp Asp Asp Asp Arg Thr
145 150 155 16.0
Ser His Ala Ser Ser Ser Asp Trp Thr Pro Arg Pro Arg Ile Gly Pro
165 170 175
16 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
Tyr Thr Phe Val Gln Gln His Leu Met Ile Gly Thr Asp Pro Arg Thr
180 185 190
Ile Leu Lys Asp Leu Leu Pro Glu Thr Ile Pro Pro Pro Glu Leu Asp
195 200 205
Asp Met Thr Leu Trp Gln Ile Val Ile Asn Ile Leu Ser Glu Pro Pro
210 2l5 220
Lys Arg Lys Lys Arg Lys Asp Ile Asn Thr Ile Glu Asp Ala Val Lys
225 230 235 240
Leu Leu Gln Glu Cys Lys Lys Ile Ile Val Leu Thr Gly Ala Gly Val
245 250 255
Ser Val Ser Cys Gly Ile Pro Asp Phe Arg Ser Arg Asp Gly Ile Tyr
260 265 270
Ala Arg Leu Ala Val Asp Phe Pro Asp Leu Pro Asp Pro G1n Ala Met
275 280 285
Phe Asp Ile Glu Tyr Phe Arg Lys Asp Pro Arg Pro Phe Phe Lys Phe
290 295 300
Ala Lys Glu Ile Tyr Pro Gly Gln Phe Gln Pro Ser Leu Cys His Lys
305 310 315 32'0
17 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
Phe Ile Ala Leu Ser Asp Lys Glu Gly Lys Leu Leu Arg Asn Tyr Thr
325 330 335
Gln Asn Ile Asp Thr Leu Glu Gln Val Ala Gly Ile Gln Arg Ile Leu
340 345 350
Gln Cys His Gly Ser Phe Ala Thr Ala Ser Cys Leu Ile Cys Lys Tyr
355 360 365
Lys Val Asp Cys Glu Ala Val Arg Gly Asp Ile Phe Asn Gln Va1 Val
370 375 380
Pro Arg Cys Pro Arg Cys Pro Ala Asp Glu Pro Leu Ala Ile Met Lys
385 390 395 400
Pro Glu Ile Val Phe Phe Gly Glu Asn Leu Pro Glu Gln Phe His Arg
405 410 415
Ala Met Lys Tyr Asp Lys Asp Glu Val Asp Leu Leu Ile Val Ile Gly
420 425 430
Ser Ser Leu Lys Val Arg Pro Val Ala Leu Ile Pro Ser Ser Ile Pro
435 440 445
His Glu Val Pro Gln Ile Leu Ile Asn Arg Glu Pro Leu Pro His Leu
450 455 460
18 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
His Phe Asp Val Glu Leu Leu Gly Asp Cys Asp Val Ile Ile Asn Glu
465 470 475 480
Leu Cys His Arg Leu Gly Gly Glu Tyr Ala Lys Leu Cys Cys Asn Pro
485 490 495
Val Lys Leu Ser Glu Ile Thr G1u Lys Pro Pro Arg Pro Gln Lys Glu
500 505 510
Leu Val His Leu Ser Glu Leu Pro Pro Thr Pro Leu His Ile Ser Glu
515 520 525
Asp Ser Ser Ser Pro Glu Arg Thr Val Pro Gln Asp Ser Ser Val Ile
530 535 540
Ala Thr Leu Val Asp Gln Ala Thr Asn Asn Asn Val Asn Asp Leu Glu
545 550 555 560
Val Ser Glu Ser Ser Cys Val Glu Glu Lys Pro G1n Glu Val Gln Thr
565 570 575
Ser Arg Asn Val Glu Asn Ile Asn Va1 Glu Asn Pro Asp Phe Lys Ala
580 ' 585 590
Val Gly Ser Ser Thr Ala Asp Lys Asn Glu Arg Thr Ser Val Ala Glu
595 600 605
19 .
gca
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
Thr Val Arg Lys Cys Trp Pro Asn Arg Leu Ala Lys Glu Gln Ile Ser
610 615 620
Lys Arg Leu Glu G1y Asn Gln Tyr Leu Phe Val Pro Pro Asn Arg Tyr
625 630 635 640
Ile Phe His Gly Ala Glu Val Tyr Ser Asp Ser Glu Asp Asp Val Leu
645 650 655
Ser Ser Ser Ser Cys Gly Ser Asn Ser Asp Ser Gly Thr Cys Gln Ser
660 665 670
Pro Ser Leu Glu Glu Pro Leu Glu Asp Glu Ser G1u Ile Glu G1u Phe
675 680 685
Tyr Asn Gly Leu Glu Asp Asp Thr Glu Arg Pro Glu Cys Ala Gly Gly
690 695 700
Ser Gly Phe Gly Ala Asp Gly Gly Asp Gln Glu Val Val Asn Glu Ala
705 710 715 720
Ile A1a Thr Arg Gln Glu Leu Thr Asp Val Asn Tyr Pro Ser Asp Lys
725 730 735
Ser
20 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
<210> 7
<211> 3849
<212> DNA
<213> Mus musculus
<400> 7
gcggagcaga ggaggcgagg gcggagggcc agagaggcag ttggaagatg gcggacgagg
15
tggcgctcgc ccttcaggcc gccggctccc cttccgcggc ggccgccatg gaggccgcgt
120
cgcagccggc ggacgagccg ctccgcaaga ggccccgccg agacgggcct ggcctcgggc
20 180
gcagcccgggcgagccgagcgcagcagtggcgccggcggccgcggggtgtgaggcggcga
240
25 gcgccgcggccccggcggcgctgtggcgggaggcggcaggggcggcggcgagcgcggagc
300
gggaggccccggcgacggccgtggccggggacggagacaatgggtccggcctgcggcggg
360
30
agccgagggcggctgacgacttcgacgacgacgagggcgaggaggaggacgaggcggcgg
420
cggcagcggcggcggcagcgatcggctaccgagacaacctcctgttgaccgatggactcc
35 480
tcactaatggctttcattcctgtgaaagtgatgacgatgacagaacgtcacacgccagct
540
21 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
ctagtgactg,gactccgcgg ccgcggatag gtccatatac ttttgttcag caacatctca
600
tgattggcac cgatcctcga acaattctta aagatttatt accagaaaca attcctccac
660
ctgagctgga tgatatgacg ctgtggcaga ttgttattaa tatcctttca gaaccaccaa
720
agcggaaaaa aagaaaagat atcaatacaa ttgaagatgc tgtgaagtta ctgcaggagt
780
gtaaaaagat aatagttctg actggagctg gggtttctgt ctcctgtggg attcctgact
840
tcagatcaag agacggtatc tatgctcgcc ttgcggtgga cttcccagac ctcccagacc
900
ctcaagccat gtttgatatt gagtatttta gaaaagaccc aagaccattc ttcaagtttg
960
caaaggaaat atatcccgga cagttccagc cgtctctgtg tcacaaattc atagctttgt
1020
cagataagga aggaaaacta cttcgaaatt atactcaaaa tatagatacc ttggagcagg
1080
ttgcaggaat ccaaaggatc cttcagtgtc atggttcctt tgcaacagca tcttgcctga
1140
tttgtaaata caaagttgat tgtgaagctg ttcgtggaga catttttaat caggtagttc
1200
ctcggtgccc taggtgccca gctgatgagc cacttgccat catgaagcca gagattgtct
1260
22 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
tctttggtga aaacttacca gaacagtttc atagagccat gaagtatgac aaagatgaag
1320
ttgacctcdt ~cattgttatt ggatcttctc tgaaagtgag accagtagca ctaattccaa
1380
gttctatacc ccatgaagtg cctcaaatat taataaatag ggaacctttg cctcatctac
1440
attttgatgt agagctcctt ggagactgcg atgttataat taatgagttg tgtcataggc
1500
taggtggtga atatgccaaa ctttgttgta accctgtaaa gctttcagaa attactgaaa
1560
aacctccacg cccacaaaag gaattggttc atttatcaga gttgccacca acacctcttc
1620
atatttcgga agactcaagt tcacctgaaa gaactgtacc acaagactct tctgtgattg
1680
ctacacttgt agaccaagca acaaacaaca atgttaatga tttagaagta tctgaatcaa
1740
gttgtgtgga agaaaaacca caagaagtac agactagtag gaatgttgag aacattaatg
1800
tggaaaatcc agattttaag gctgttggtt ccagtactgc agacaaaaat gaaagaactt
1860
cagttgcaga aacagtgaga aaatgctggc ctaatagact tgcaaaggag cagattagta
1920
agcggcttga gggtaatcaa tacctgtttg taccaccaaa tcgttacata ttccacggtg
1980
23 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
ctgaggtata ctcagactct gaagatgacg tcttgtcctc tagttcctgt ggcagtaaca
2040
gtgacagtgg cacatgccag agtccaagtt tagaagaacc cttggaagat gaaagtgaaa
2100
ttgaagaatt ctacaatggc ttggaagatg atacggagag gcccgaatgt gctggaggat
2160
ctggatttgg agctgatgga ggggatcaag aggttgttaa tgaagctata gctacaagac
2220
aggaattgac agatgtaaac tatccatcag acaaatcata acactattga agctgtccgg
2280
attcaggaat tgctccacca gcattgggaa ctttagcatg tcaaaaaaat gaatgtttac
2340
ttgtgaactt gaacaaggaa atctgaaaga tgtattattt atagactgga aaatagattg
2400
tcttcttgga taatttctaa agttccatca tttctgtttg tacttgtaca ttcaaca'ctg
2460
ttggttgact tcatcttcct ttcaaggttc atttgtatga tacattcgta tgtatgtata
2520
attttgtttt ttgcctaatg agtttcaacc ttttaaagtt ttcaaaagcc attggaatgt
2580
taatgtaaag ggaacagctt atctagacca aagaatggta tttcacactt ttttgtttgt
2640
aacattgaat agtttaaagc cctcaatttc tgttctgctg aacttttatt tttaggacag
2700
24 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
ttaacttttt aaacactggc attttccaaa acttgtggca gctaactttt taaaatcaca
27 60
gatgacttgt aatgtgagga gtcagcaccg tgtctggagc actcaaaact tgggctcagt
2820
gtgtgaagcg tacttactgc atcgtttttg tacttgctgc agacgtggta atgtccaaac
2880
aggcccctga gactaatctg ataaatgatt tggaaatgtg tttcagttgt tctagaaaca
2940
atagtgcctg tctatatagg tccccttagt ttgaatattt gccattgttt aattaaatac
3000
ctatcactgt ggtagagcct gcatagatct tcaccacaaa tactgccaag atgtgaatat
3060
gcaaagcctt tctgaatcta ataatggtac ttctactggg gagagtgtaa tattttggac
3120
tgctgttttt ccattaatga ggaaagcaat aggcctctta attaaagtcc caaagtcata
3180
agataaattg tagctcaacc agaaagtaca ctgttgcctg ttgaggattt ggtgtaatgt
3240
atcccaaggt gttagccttg tattatggag atgaatacag atccaatagt caaatgaaac
3300
tagttcttag ttatttaaaa gcttagcttg ccttaaaact agggatcaat tttctcaact
3360
gcagaaactt ttagcctttc aaacagttca cacctcagaa agtcagtatt tattttacag
3420
25 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
acttctttgg aacattgccc ccaaatttaa atattcatgt gggtttagta tttattacaa
3480
aaaaatgatt tgaaatatag ctgttcttta tgcataaaat acccagttag gaccattact
3540
gccagaggag aaaagtatta agtagctcat ttccctacct aaaagataac tgaatttatt
3600
tggctacact aaagaatgca gtatatttag ttttccattt gcatgatgtg tttgtgctat
3660
agacaatatt ttaaattgaa aaatttgttt taaattattt ttacagtgaa gactgttttc
3720
agctcttttt atattgtaca tagactttta tgtaatctgg catatgtttt gtagaccgtt
3780
taatgactgg attatcttcc tccaactttt gaaatacaaa aacagtgttt tatactaaaa
3840
aaaaaaaaa
3849
<210> 8
<211> 737
<212> PRT
<213> Mus musculus
<400> 8
Met Ala Asp Glu Val Ala Zeu Ala Zeu Gln Ala Ala Gly Ser Pro Ser
1 5 10 15
26 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
Ala Ala Ala Ala Met Glu Ala Ala Ser Gln Pro A1a Asp Glu Pro Leu
20 25 30
Arg Lys Arg Pro Arg Arg Asp Gly Pro Gly Leu Gly Arg Ser Pro Gly
35 40 45
Glu Pro Ser Ala Ala Val Ala Pro Ala Ala Ala Gly Cys Glu Ala Ala
50 55 60
Ser Ala Ala Ala Pro Ala A1a Leu Trp Arg Glu Ala Ala Gly Ala Ala
65 70 75 80
Ala Ser Ala Glu Arg Glu A1a Pro Ala Thr Ala Val Ala Gly Asp Gly
85 90 95
Asp Asn Gly Ser G1y Leu Arg Arg Glu Pro Arg Ala Ala Asp Asp Phe
100 105 110
Asp Asp Asp Glu Gly G1u Glu Glu Asp Glu Ala Ala Ala Ala A1a Ala
115 120 125
Ala Ala Ala Ile Gly Tyr Arg Asp Asn Leu Leu Leu Thr Asp Gly Leu
130 135 140
Leu Thr Asn Gly Phe His Ser Cys Glu Ser Asp Asp Asp Asp Arg Thr
145 150 155 160
27 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
Ser His Ala Ser Ser Ser Asp Trp Thr Pro Arg Pro Arg Ile Gly Pro
165 170 175
Tyr Thr Phe Val Gln Gln His Leu Met Ile Gly Thr Asp Pro Arg Thr
180 185 190
Ile Leu Lys Asp Leu Leu Pro Glu Thr Ile Pro Pro Pro Glu Leu Asp
195 200 205
Asp Met Thr Leu Trp G1n Ile Val Ile Asn Ile Leu Ser G1u Pro Pro
2l0 215 220
Lys Arg Lys Lys Arg Lys Asp Ile Asn Thr Ile Glu Asp Ala Val Lys
225 230 235 240
Leu Leu Gln Glu Cys Lys Lys Ile Ile Val Leu Thr Gly Ala Gly Val
245 250 255
Ser Val Ser Cys Gly Ile Pro Asp Phe Arg Ser Arg Asp Gly Ile Tyr
260 265 270
Ala Arg Leu Ala Val Asp Phe Pro Asp Leu Pro Asp Pro Gln Ala Met
275 280 285
Phe Asp Ile Glu Tyr Phe Arg Lys Asp Pro Arg Pro Phe Phe Lys Phe
290 295 300
28 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
Ala Lys Glu Ile Tyr Pro Gly Gln Phe Gln Pro Ser Leu Cys His Lys
305 310 315 320
Phe Ile Ala Leu Ser Asp Lys Glu Gly Lys Leu Leu Arg Asn Tyr Thr
325 330 335
Gln Asn Ile Asp Thr Leu Glu Gln Val Ala Gly Ile Gln Arg Ile Leu
340 345 350
Gln Cys His Gly Ser Phe Ala Thr Ala Ser Cys Leu Ile Cys Lys Tyr
355 360 365
Lys Val Asp Cys Glu Ala Val Arg Gly Asp Ile Phe Asn Gln Val Val
370 375 380
Pro Arg Cys Pro Arg Cys Pro Ala Asp Glu Pro Leu Ala Ile Met Lys
385 390 395 400
Pro Glu Ile Val Phe Phe Gly Glu Asn Leu Pro Glu G1n Phe His Arg
405 410 415
Ala Met Lys Tyr Asp Lys Asp Glu Val Asp Leu Leu Ile Val Ile Gly
420 425 430
Ser Ser Leu Lys Val Arg Pro Val Ala Leu Ile Pro Ser Ser Ile Pro
435 440 445
29 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
His Glu Val Pro Gln Ile Leu Ile Asn Arg Glu Pro Leu Pro His Leu
450 455 460
His Phe Asp Val Glu Leu Leu Gly Asp Cys Asp Val Ile Ile Asn Glu
465 470 475 480
Leu Cys His Arg Leu Gly Gly Glu Tyr Ala Lys Leu Cys Cys Asn Pro
485 490 495
Val Lys Leu Ser Glu Ile Thr Glu Lys Pro Pro Arg Pro Gln Lys Glu
500 505 510
Leu Val His Leu Ser Glu Leu Pro Pro Thr Pro Leu His Ile Ser Glu
515 520 525
Asp Ser Ser Ser Pro Glu Arg Thr Val Pro Gln Asp Ser Ser Val Ile
530 535 540
Ala Thr Leu Val Asp Gln Ala Thr Asn Asn Asn Val Asn Asp Leu Glu
545 550 555 560
Val Ser Glu Ser Ser Cys Val Glu Glu Lys Pro Gln Glu Val Gln Thr
565 570 575
Ser Arg Asn Val Glu Asn Ile Asn Val Glu Asn Pro Asp Phe Lys Ala
580 585 590
30 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
Val Gly Ser Ser Thr Ala Asp Lys Asn Glu Arg Thr Ser Val Ala Glu
595 600 605
Thr Val Arg Lys Cys Trp Pro Asn Arg Leu Ala Lys Glu Gln Ile Ser
610 615 620
Lys Arg Leu Glu Gly Asn Gln Tyr Leu Phe Val Pro Pro Asn Arg Tyr
625 630 635 640
Ile Phe His~Gly Ala Glu Val Tyr Ser Asp Ser Glu Asp Asp Val Leu
645 650 655
Ser Ser Ser Ser Cys Gly Ser Asn Ser Asp Ser Gly Thr Cys Gln Ser
660 665 670
Pro Ser Leu Glu Glu Pro Leu Glu Asp Glu Ser Glu Ile Glu Glu Phe
675 680 685
Tyr Asn Gly Leu Glu Asp Asp Thr Glu Arg Pro Glu Cys Ala Gly Gly
690 695 700
Ser Gly Phe G1y Ala Asp Gly Gly Asp Gln Glu Val Val Asn Glu Ala
705 710 715 720
2le Ala Thr Arg Gln Glu Leu Thr Asp Val Asn Tyr Pro Ser Asp Lys
725 730 735
31 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
Ser
<2l0> 9
<211> 1963
<212> DNA
<213> Homo
Sapiens
<400> 9
gtgttgtacgaaagcgcgtctgcggccgcaatgtctgctgagagttgtagttctgtgccc
60
tatcacggccactcccatttctggtgccgtcacgggacagagcagtcggtgacaggacag
120
agcagtcggtgacgggacacagtggttggtgacgggacagagcggtcggtgacagcctca
180
agggcttcagcaccgcgcccatggcagagccagacccctctcaccctctggagacccagg
240
cagggaaggtgcaggaggctcaggactcagattcagactctgagggaggagccgctggtg
300
gagaagcagacatggacttcctgcggaacttattctcccagacgctcagcctgggcagcc
360
agaaggagcgtctgctggacgagctgaccttggaaggggtggcccggtacatgcagagcg
420
aacgctgtcgcagagtcatctgtttggtgggagctggaatctccacatccgcaggcatcc
480
ccgactttcgctctccatccaccggcctctatgacaacctagagaagtaccatcttccct
540
32 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
acccagaggccatctttgagatcagctatttcaagaaacatccggaacccttcttcgccc
600
tcgccaaggaactctatcctgggcagttcaagccaaccatctgtcactacttcatgcgcc
660
tgctgaaggacaaggggctactcctgcgctgctacacgcagaacatagataccctggagc
720
gaatagccgggctggaacaggaggacttggtggaggcgcacggcaccttctacacatcac
780
actgcgtcagcgccagctgccggcacgaatacccgctaagctggatgaaagagaagatct
840
tctctgaggtgacgcccaagtgtgaagactgtcagagcctggtgaagcctgatatcgtct
900
tttttggtgagagcctcccagcgcgtttcttctcctgtatgcagtcagacttcctgaagg
960
tggacctcctcctggtcatgggtacctccttgcaggtgcagccctttgcctccctcatca
1020
gcaaggcacccctctccacccctcgcctgctcatcaacaaggagaaagctggccagtcgg
1080
accctttcctggggatgattatgggcctcggaggaggcatggactttgactccaagaagg
1140
cctacagggacgtggcctggctgggtgaatgcgaccagggctgcctggcccttgctgagc
1200
tccttggatggaagaaggagctggaggaccttgtccggagggagcacgccagcatagatg
1260
33 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
cccagtcggg ggcgggggtc cccaacccca gcacttcagc ttcccccaag aagtccccgc
1320
cacctgccaa ggacgaggcc aggacaacag agagggagaa accccagtga cagctgcatc
1380
tcccaggcgg gatgccgagc tcctcaggga cagctgagcc ccaaccgggc ctggccccct
1440
cttaaccagc agttcttgtc tggggagctc agaacatccc ccaatctctt acagctccct
1500
ccccaaaact ggggtcccag caaccctggc ccccaacccc agcaaatctc taacacctcc
1560
tagaggccaa ggcttaaaca ggcatctcta ccagccccac tgtctctaac cactcctggg
1620
ctaaggagta acctccctca tctctaactg cccccacggg gccagggcta ccccagaact
1680
tttaactctt ccaggacagg gagcttcggg cccccactct gtctcctgcc cccgggggcc
1740
tgtggctaag taaaccatac ctaacctacc ccagtgtggg tgtgggcctc tgaatataac
1800
ccacacccag cgtaggggga gtctgagccg ggagggctcc cgagtctctg ccttcagctc
1860
ccaaagtggg tggtgggccc ccttcacgtg ggacccactt cccatgctgg atgggcagaa
1920
gacattgctt attggagaca aattaaaaac aaaaacaact aac
1963
34 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
<210> 10
<211> 389
<212> PRT
<213> Homo Sapiens
<400> 10
Met Ala Glu Pro Asp Pro Ser His Pro Leu G1u Thr Gln Ala Gly Lys
1 5 10 15
Val Gln Glu Ala Gln Asp Ser Asp Ser Asp Ser Glu Gly Gly Ala Ala
25 30
Gly Gly Glu Ala Asp Met Asp Phe Leu Arg Asn Leu Phe Ser Gln Thr
35 40 45
Leu Ser Leu Gly Ser Gln Lys Glu Arg Leu Leu Asp Glu Leu Thr Leu
50 55 60
Glu Gly Va1 Ala Arg Tyr Met Gln Ser G1u Arg Cys Arg Arg Val Ile
65 70 75 80~
Cys Leu Val G1y Ala Gly Ile Ser Thr Ser Ala Gly Ile Pro Asp Phe
85 90 95
Arg Ser Pro Ser Thr Gly Leu Tyr Asp Asn Leu Glu Lys Tyr His Leu
100 105 110
35 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
Pro Tyr Pro Glu Ala Ile Phe Glu Ile Ser Tyr Phe Lys Lys His Pro
115 120 125
Glu Pro Phe Phe Ala Leu Ala Lys Glu Leu Tyr Pro Gly Gln Phe Lys
130 135 140
Pro Thr I1e Cys His Tyr Phe Met Arg Leu Leu Lys Asp Lys Gly Leu
145 150 155 l60
Leu Leu Arg Cys Tyr Thr Gln Asn Ile Asp Thr Leu Glu Arg Ile Ala
165 170 175
Gly Leu Glu Gln Glu Asp Leu Val Glu Ala His Gly Thr Phe Tyr Thr
180 185 190
Ser His Cys Val Ser Ala Ser Cys Arg His Glu Tyr Pro Leu Ser Trp
195 200 205
Met Lys Glu Lys Ile Phe Ser Glu Val Thr Pro Lys Cys Glu Asp Cys
210 215 220
Gln Ser Leu Val Lys Pro Asp Ile Val Phe Phe Gly Glu Ser Leu Pro
225 230 235 240
Ala Arg Phe Phe Ser Cys Met Gln Ser Asp Phe Leu Lys Val Asp Leu
245 250 255
36 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
Leu Leu Val Met Gly Thr Ser Leu Gln Val Gln Pro Phe Ala Ser Leu
260 265 270
Ile Ser Lys Ala Pro Leu Ser Thr Pro Arg Leu Leu Ile Asn Lys Glu
275 280 285
Lys Ala Gly Gln Ser Asp Pro Phe Leu Gly Met Tle Met Gly Leu Gly
290 295 300
Gly Gly Met Asp Phe Asp Ser Lys Lys Ala Tyr Arg Asp Val Ala Trp
305 310 315 320
Leu Gly Glu Cys Asp Gln Gly Cys Leu Ala Leu Ala Glu Leu Leu Gly
325 330 335
Trp Lys Lys Glu Leu Glu Asp Leu Val Arg Arg G1u His Ala Ser Ile
340 345 350
Asp Ala Gln Ser G1y Ala Gly Val Pro Asn Pro Ser Thr Ser Ala Ser
355 360 365
Pro Lys Lys Ser Pro Pro Pro Ala Lys Asp Glu Ala Arg Thr Thr Glu
370 375 380
Arg Glu Lys Pro Gln
385
37 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
<210> 11
<2l1> 4086
<2l2> DNA
<213> Homo
sapiens
<400> 11
gtcgagcgggagcagaggaggcgagggaggagggccagagaggcagttggaagatggcgg
60
acgaggcggccctcgcccttcagcccggcggctccccctcggcggcgggggccgacaggg
120
aggccgcgtcgtcccccgccggggagccgctccgcaagaggccgcggagagatggtcccg
180
gcctcgagcggagcccgggcgagcccggtggggcggccccagagcgtgaggtgccggcgg
240
cggccaggggctgcccgggtgcggcggcggcggcgctgtggcgggaggcggaggcagagg
300
cggcggcggcaggcggggagcaagaggcccaggcgactgcggcggctggggaaggagaca
360
atgggccgggcctgcagggcccatctcgggagccaccgctggccgacaacttgtacgacg
420
aagacgacgacgacgagggcgaggaggaggaagaggcggcggcggcggcgattgggtacc
480
gagataaccttctgttcggtgatgaaattatcactaatggttttcattcctgtgaaagtg
540
atgaggaggatagagcctcacatgcaagctctagtgactggactccaaggccacggatag
600
38 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
gtccatatac ttttgttcag caacatctta tgattggcac agatcctcga acaattctta
660
aagatttatt gccggaaaca atacctccac ctgagttgga tgatatgaca ctgtggcaga
720
ttgttattaa tatcctttca gaaccaccaa aaaggaaaaa aagaaaagat attaatacaa
780
ttgaagatgc tgtgaaatta ctgcaagagt gcaaaaaaat tatagttcta actggagctg
840
gggtgtctgt ttcatgtgga atacctgact tcaggtcaag ggatggtatt tatgctcgcc
900
ttgctgtaga cttcccagat cttccagatc ctcaagcgat gtttgatatt gaatatttca
960
gaaaagatcc aagaccattc ttcaagtttg caaaggaaat atatcctgga caattccagc
1020
catctctctg tcacaaattc atagccttgt cagataagga aggaaaacta cttcgcaact
1080
atacccagaa catagacacg ctggaacagg ttgcgggaat ccaaaggata attcagtgtc
1140
atggttcctt tgcaacagca tcttgcctga tttgtaaata caaagttgac tgtgaagctg
1200
tacgaggaga tatttttaat caggtagttc ctcgatgtcc taggtgccca gctgatgaac
1260
cgcttgctat catgaaacca gagattgtgt tttttggtga aaatttacca gaacagtttc
1320
39 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
atagagccat gaagtatgac aaagatgaag ttgacctcct cattgttatt gggtcttccc
1380
tcaaagtaag accagtagca ctaattccaa gttccatacc ccatgaagtg cctcagatat
1440
taattaatag agaacctttg cctcatctgc attttgatgt agagcttctt ggagactgtg
1500
atgtcataat taatgaattg tgtcataggt taggtggtga atatgccaaa ctttgctgta
1560
accctgtaaa gctttcagaa attactgaaa aacctccacg aacacaaaaa gaattggctt
1620
atttgtcaga gttgccaccc acacctcttc atgtttcaga agactcaagt tcaccagaaa
1680
gaacttcacc accagattct tcagtgattg tcacactttt agaccaagca gctaagagta
1740
atgatgattt agatgtgtct gaatcaaaag gttgtatgga agaaaaacca caggaagtac
1800
aaacttctag gaatgttgaa agtattgctg aacagatgga aaatccggat ttgaagaatg
1860
ttggttctag tactggggag aaaaatgaaa gaacttcagt ggctggaaca gtgagaaaat
1920
gctggcctaa tagagtggca aaggagcaga ttagtaggcg gcttgatggt aatcagtatc
1980
tgtttttgcc accaaatcgt tacattttcc atggcgctga ggtatattca gactctgaag
2040
40 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
atgacgtctt atcctctagt tcttgtggca gtaacagtga tagtgggaca tgccagagtc
2100
caagtttaga agaacccatg gaggatgaaa gtgaaattga agaattctac aatggcttag
2160
aagatgagcc tgatgttcca gagagagctg gaggagctgg atttgggact gatggagatg
2220
atcaagaggc aattaatgaa gctatatctg tgaaacagga agtaacagac atgaactatc
2280
catcaaacaa atcatagtgt aataattgtg caggtacagg aattgttcca ccagcattag
2340
gaactttagc atgtcaaaat gaatgtttac ttgtgaactc gatagagcaa ggaaaccaga
2400
aaggtgtaat atttataggt tggtaaaata gattgttttt catggataat ttttaacttc
2460
attatttctg tacttgtaca aactcaacac taactttttt ttttttaaaa aaaaaaaggt
2520
actaagtatc ttcaatcagc tgttgggtca agactaactt tcttttaaag gttcatttgt
2580
atgataaatt catatgtgta tatataattt tttttgtttt gtctagtgag tttcaacatt
2640
tttaaagttt tcaaaaagcc atcggaatgt taaattaatg taaagggaca gctaatctag
2700
accaaagaat ggtattttca cttttctttg taacattgaa tggtttgaag tactcaaaat
2760
41 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
ctgttacgct aaacttttga ttctttaaca caattatttt taaacactgg cattttccaa
2820
aactgtggca gctaactttt taaaatctca aatgacatgc agtgtgagta gaaggaagtc
2880
aacaatatgt ggggagagca ctcggttgtc tttactttta aaagtaatac ttggtgctaa
2940
gaatttcagg attattgtat ttacgttcaa atgaagatgg cttttgtact tcctgtggac
3000
atgtagtaat gtctatattg gctcataaaa ctaacctgaa aaacaaataa atgctttgga
3060
aatgtttcag ttgctttaga aacattagtg cctgcctgga tccccttagt tttgaaatat
3120
ttgccattgt tgtttaaata cctatcactg tggtagagct tgcattgatc ttttccacaa
3180
gtattaaact gccaaaatgt gaatatgcaa agcctttctg aatctataat aatggtactt
3240
ctactgggga gagtgtaata ttttggactg ctgttttcca ttaatgagga gagcaacagg
3300
cccctgatta tacagttcca aagtaataag atgttaattg taattcagcc agaaagtaca
3360
tgtctcccat tgggaggatt tggtgttaaa taccaaactg ctagccctag tattatggag
3420
atgaacatga tgatgtaact tgtaatagca gaatagttaa tgaatgaaac tagttcttat
3480
42 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
aatttatctt tatttaaaag cttagcctgc cttaaaacta gagatcaact ttctcagctg
3540
caaaagcttc tagtctttca agaagttcat actttatgaa attgcacagt aagcatttat
3600
ttttcagacc atttttgaac atcactccta aattaataaa gtattcctct gttgctttag
3660
tatttattac aataaaaagg gtttgaaata tagctgttct ttatgcataa aacacccagc
3720
taggaccatt actgccagag aaaaaaatcg tattgaatgg ccatttccct acttataaga
3780
tgtctcaatc tgaatttatt tggctacact aaagaatgca gtatatttag ttttccattt
3840
gcatgatgtt tgtgtgctat agatgatatt ttaaattgaa aagtttgttt taaattattt
3900
ttacagtgaa gactgttttc agctcttttt atattgtaca tagtctttta tgtaatttac
3960
tggcatatgt tttgtagact gtttaatgac tggatatctt ccttcaactt ttgaaataca
4020
aaaccagtgt tttttacttg tacactgttt taaagtctat taaaattgtc atttgacttt
4080
tttctg
4086
<210> 12
43 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
<211> 747
<212> PRT
<213> Homo Sapiens
<400> 12
Met Ala Asp Glu Ala Ala Leu Ala Leu Gln Pro Gly Gly Ser Pro Ser
1 5 10 15
Ala Ala Gly Ala Asp Arg Glu Ala Ala Ser Ser Pro Ala Gly Glu Pro
25 30
Leu Arg Lys Arg Pro Arg Arg Asp Gly Pro Gly Leu Glu Arg Ser Pro
20 35 40 45
Gly Glu Pro Gly Gly Ala Ala Pro Glu Arg Glu Val Pro Ala Ala Ala
50 55 60
Arg G1y Cys Pro Gly Ala Ala Ala Ala Ala Leu Trp Arg Glu Ala Glu
65 70 75 80
Ala Glu Ala Ala Ala Ala Gly G1y Glu G1n Glu Ala Gln Ala Thr Ala
85 90 95
Ala Ala Gly Glu Gly Asp Asn Gly Pro Gly Leu Gln G1y Pro Ser Arg
100 105 110
Glu Pro Pro Leu Ala Asp Asn Leu Tyr Asp Glu Asp Asp Asp Asp Glu
115 120 125
44 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
Gly Glu Glu Glu Glu Glu Ala Ala Ala Ala Ala Ile Gly Tyr Arg Asp
130 135 140
Asn Leu Leu Phe Gly Asp Glu Ile Ile Thr Asn Gly Phe His Ser Cys
145 150 155 160
Glu Ser Asp Glu Glu Asp Arg Ala Ser His Ala Ser Ser Ser Asp Trp
165 170 175
Thr Pro Arg Pro Arg Ile Gly Pro Tyr Thr Phe Val Gln Gln His Leu
180 185 190
Met Ile Gly Thr Asp Pro Arg Thr Ile Leu Lys Asp Leu Leu Pro Glu
195 200 205
Thr Ile Pro Pro Pro Glu Leu Asp Asp Met Thr Leu Trp G1n Ile Va1
210 215 220
Ile Asn Ile Leu Ser Glu Pro Pro Lys Arg Lys Lys Arg Lys Asp Ile
225 230 235 240
Asn Thr Ile Glu Asp Ala Val Lys Leu Leu Gln Glu Cys Lys Lys Ile
245 250 255
Ile Val Leu Thr Gly Ala Gly Val Ser Val Ser Cys Gly Ile Pro Asp
260 265 270
.
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
Phe Arg Ser Arg Asp Gly Ile Tyr Ala Arg Leu Ala Val Asp Phe Pro
275 280 285
Asp Leu Pro Asp Pro G1n Ala Met Phe Asp 2le Glu Tyr Phe Arg Lys
290 295 300
Asp Pro Arg Pro Phe Phe Lys Phe Ala Lys Glu Ile Tyr Pro Gly Gln
305 3l0 315 320
Phe Gln Pro Ser Leu Cys His Lys Phe Ile Ala Leu Ser Asp Lys Glu
325 330 335
Gly Lys Leu Leu Arg Asn Tyr Thr Gln Asn Ile Asp Thr Leu Glu Gln
340 345 350
Val Ala Gly Ile Gln Arg Ile Ile Gln Cys His Gly Ser Phe Ala Thr
355 360 365
Ala Ser Cys Leu 21e Cys Lys Tyr Lys Val Asp Cys G1u Ala Val Arg
370 375 380
Gly Asp Ile Phe Asn Gln Val Va1 Pro Arg Cys Pro Arg Cys Pro A1'a
385 390 395 400
Asp Glu Pro Leu Ala Ile Met Lys Pro Glu Ile Val Phe Phe Gly Glu
4 0 5 410 4 l 5
46 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
Asn Leu Pro Glu Gln Phe His Arg Ala Met Lys Tyr Asp Lys Asp Glu
. 420 425 430 '
Val Asp Leu Leu Ile Val Ile Gly Ser Ser Leu Lys Val Arg Pro Val
435 440 445
Ala Leu Ile Pro Ser Ser Ile Pro His Glu Val Pro Gln Ile Leu Ile
450 455 460
Asn Arg Glu Pro Leu Pro His Leu His Phe Asp Val Glu Leu Leu Gly
465 470 475 480
Asp Cys Asp Val Ile Ile Asn Glu Leu Cys His Arg Leu Gly Gly Glu
485 490 495
Tyr A1a Lys Leu Cys Cys Asn Pro Va1 Lys Leu Ser Glu Ile Thr Glu
500 505 510
Lys Pro Pro Arg Thr Gln Lys Glu Leu Ala Tyr Leu Ser Glu Leu Pro
515 520 525
Pro Thr Pro Leu His Val Ser Glu Asp Ser Ser Ser Pro Glu Arg Thr
530 535 540
Ser Pro Pro Asp Ser Ser Va1 Ile Val Thr Leu Leu Asp Gln Ala Ala
545 550 555 560
47 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
Lys Ser Asn Asp Asp Leu Asp Val Ser Glu Ser Lys Gly Cys Met Glu
565 570 575
Glu Lys Pro Gln Glu Val Gln Thr Ser Arg Asn Val Glu Ser Ile A1a
580 585 590
Glu Gln Met Glu Asn Pro Asp Leu Lys Asn Val Gly Ser Ser Thr Gly
595 600 605
Glu Lys Asn Glu Arg Thr Ser Val Ala Gly Thr Val Arg Lys Cys Trp
610 615 620
Pro Asn Arg Val Ala Lys Glu Gln Ile Ser Arg Arg Leu Asp Gly Asn
625 630 635 640
Gln Tyr Leu Phe Leu Pro Pro Asn Arg Tyr Ile Phe His Gly Ala Glu
645 650 655
Val Tyr Ser Asp Ser Glu Asp Asp Val Leu Ser Ser Ser Ser Cys Gly
660 665 670
Ser Asn Ser Asp Ser Gly Thr Cys Gln Ser Pro Ser Leu Glu Glu Pro
675 680 685
Met Glu Asp Glu Ser Glu Ile Glu Glu Phe Tyr Asn Gly Leu Glu Asp
690 695 700
48 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
10
Glu Pro Asp Val Pro Glu Arg Ala Gly Gly Ala Gly Phe Gly Thr Asp
705 710 715 720
Gly Asp Asp Gln Glu Ala Ile Asn Glu Ala Ile Ser Val Lys Gln Glu
725 730 735
Val Thr Asp Met Asn Tyr Pro Ser Asn Lys Ser
740 745
<210> 13
<211> 1869
<212> DNA
<213> Homo sapiens
<400> 13
ggcgccgggg gcgggggtgg gaggcggagg cggggccggg gcgccgcggg cggggcgccg
120
180
240
300
ggggcggggc gagtccggag gactcctcgg actgcgcgga acatggcgtt ctggggttgg
cgcgccgcgg cagccctccg gctgtggggc cgggtagttg aacgggtcga ggccggggga
ggcgtggggc cgtttcaggc ctgcggctgt cggctggtgc ttggcggcag ggacgatgtg
agtgcggggc tgagaggcag ccatggggcc cgcggtgagc ccttggaccc ggcgcgcccc
49 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
ttgcagaggc ctcccagacc cgaggtgccc agggcattcc ggaggcagcc gagggcagca
360
gctcccagtt tcttcttttc gagtattaaa ggtggaagaa ggtccatatc tttttctgtg
420
ggtgcttcaagtgttgttggaagtggaggcagcagtgacaaggggaagctttccctgcag
480
gatgtagctgagctgattcgggccagagcctgccagagggtggtggtcatggtgggggcc
540
ggcatcagcacacccagtggcattccagacttcagatcgccggggagtggcctgtacagc
600
aacctccagcagtacgatctcccgtaccccgaggccatttttgaactcccattcttcttt
660
cacaaccccaagccctttttcactttggccaaggagctgtaccctggaaactacaagccc
720
aacgtcactcactactttctccggctgcttcatgacaaggggctgcttctgcggctctac
780
acgcagaacatcgatgggcttgagagagtgtcgggcatccctgcctcaaagctggttgaa
840
gctcatggaacctttgcctctgccacctgcacagtctgccaaagacccttcccaggggag
900
gacattcgggctgacgtgatggcagacagggttccccgctgcccggtctgcaccggcgtt
960
gtgaagcccgacattgtgttctttggggagccgctgccccagaggttcttgctgcat.gtg
1020
.
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
gttgatttcc ccatggcaga tctgctgcte atccttggga cctccctgga ggtggagcct
1080
tttgccagct tgaccgaggc cgtgcggagc tcagttcccc gactgctcat caaccgggac
1140
ttggtggggc ccttggcttg gcatcctcgc agcagggacg tggcccagct gggggacgtg
1200
gttcacggcg tggaaagcct agtggagctt ctgggctgga cagaagagat gcgggacctt
1260
gtgcagcggg aaactgggaa gcttgatgga ccagacaaat aggatgatgg ctgcccccac
1320
acaataaatg gtaacatagg agacatccac atcccaattc tgacaagacc tcatgcctga
1380
agacagcttg ggcaggtgaa accagaatat gtgaactgag tggacacccg aggctgccac
1440
tggaatgtct tctcaggcca tgagctgcag tgactggtag ggctgtgttt acagtcaggg
1500 .
ccaccccgtc acatatacaa aggagctgcc tgcctgtttg ctgtgttgaa ctcttcactc
1560
tgctgaagct cctaatggaa aaagctttct tctgactgtg accctcttga actgaatcag
1620
accaactgga atcccagacc gagtctgctt tctgtgccta gttgaacggc aagctcggca
1680
tctgttggtt acaagatcca gacttgggcc gagcggtccc cagccctctt catgttccga
1740
51 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
agtgtagtct tgaggccctg gtgccgcact tctagcatgt tggtctcctt tagtggggct
1800
atttttaatg agagaaaatc tgttctttcc agcatgaaat acatttagtc tcctcaaaaa
18 60
aaaaaaaca
1869
<210> 14
<211> 399
<212> PRT
<213> Homo Sapiens
<400> 14
Met Ala Phe Trp G1y Trp Arg Ala Ala Ala Ala Leu Arg Leu Trp Gly
1 5 10 15
Arg Va1 Val Glu Arg Val Glu Ala Gly Gly Gly Val Gly Pro Phe Gln
25 30
30 Ala Cys Gly Cys Arg Leu Val Leu Gly Gly Arg Asp Asp Val Ser Ala
40 45
Gly Leu Arg Gly Ser His Gly Ala Arg Gly Glu Pro Leu Asp Pro Ala
35 50 55 60
Arg Pro Leu Gln Arg Pro Pro Arg Pro G1u Val Pro Arg A1a Phe Arg
65 70 75 80
52 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
Arg Gln Pro Arg Ala Ala Ala Pro Ser Phe Phe Phe Ser Ser Ile Lys
85 90 95
Gly Gly Arg Arg Ser Ile Ser Phe Ser Val Gly Ala Ser Ser Val Val
l00 105 1l0
Gly Ser Gly Gly Ser Ser Asp Lys Gly Lys Leu Ser Leu Gln Asp Val
115 120 125
Ala Glu Leu Ile Arg Ala Arg Ala Cys Gln Arg Val Val Val Met Val
130 135 140
Gly Ala Gly Ile Ser Thr Pro Ser Gly Tle Pro Asp Phe Arg Ser Pro
145 150 155 160
Gly Ser Gly Leu Tyr Ser Asn Leu Gln Gln Tyr Asp Leu Pro Tyr Pro
165 170 175
Glu Ala Ile Phe Glu Leu Pro Phe Phe Phe His Asn Pro Lys Pro Phe
180 185 190
Phe Thr Leu Ala Lys Glu Leu Tyr Pro Gly Asn Tyr Lys Pro Asn Va1
195 200 205
Thr His Tyr Phe Leu Arg Leu Leu His Asp Lys Gly Leu Leu Leu Arg
210 215 220
53 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
Leu Tyr Thr Gln Asn Ile Asp Gly Leu Glu Arg Val Ser Gly Ile Pro
225 230 235 240
Ala Ser Lys Leu Val Glu Ala His Gly Thr Phe Ala Ser Ala Thr Cys
245 250 255
Thr Val Cys Gln Arg Pro Phe Pro Gly Glu Asp Ile Arg Ala Asp Val
260 265 270
Met Ala Asp Arg Val Pro Arg Cys Pro Val Cys Thr Gly Val Val Lys
275 280 285
Pro Asp Ile Val Phe Phe Gly Glu Pro Leu Pro Gln Arg Phe Leu Leu
290 295 300
His Val Val Asp Phe Pro Met Ala Asp Leu Leu Leu Ile Leu Gly Thr
305 310 315 320
Ser Leu Glu Val Glu Pro Phe Ala Ser Leu Thr Glu Ala Va1 Arg Ser
325 330 335
Ser Val Pro Arg Leu Leu Ile Asn Arg Asp Leu Va1 Gly Pro Leu Ala
340 345 350
Trp His Pro Arg Ser Arg Asp Val Ala Gln Leu Gly Asp Val Val His
355 360 365
54 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
Gly Val Glu Ser Leu Val Glu Leu Leu Gly Trp Thr G1u Glu Met Arg
370 375 380
Asp Leu Val Gln Arg Glu Thr Gly Lys Leu Asp Gly Pro Asp Lys
385 390 395
<210> 15
<211> 1174
<212> DNA
<213> Homo Sapiens
<400> l5
gtccgtagag ctgtgagaga atgaagatga gctttgcgtt gactttcagg tcagcaaaag
gccgttggat cgcaaacccc agccagccgt gctcgaaagc ctccattggg ttatttgtgc
120
cagcaagtcc tcctctggac cctgagaagg tcaaagagtt acagcgcttc atcacccttt
180
ccaagagact ccttgtgatg actggggcag gaatctccac cgaatcgggg ataccagact
240
acaggtcaga aaaagtgggg ctttatgccc gcactgaccg caggcccatc cagcatggtg
300
attttgtccg gagtgcccca atccgccagc ggtactgggc gagaaacttc gtaggctggc
360
ctcaattctc ctcccaccag cctaaccctg cacactgggc tttgagcacc tgggagaaac
420
55 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
tcggaaagct gtactggttg gtgacccaaa atgtggatgc tttgcacacc aaggcgggga
480
gtcggcgcct gacagagctc cacggatgca tggacagggt cctgtgcttg gattgtgggg
540
aacagactcc ccggggggtg ctgcaagagc gtttccaagt cctgaacccc acctggagtg
600
ctgaggccca tggcctggct cctgatggtg acgtctttct ctcagaggag caagtccgga
660
gctttcaggt cccaacctgc gttcaatgtg gaggccatct gaaaccagat gtcgttttct
720
tcggggacac agtgaaccct gacaaggttg attttgtgca caagcgtgta aaagaag.ccg
780
actccctctt ggtggtggga tcatccttgc aggtatactc tggttacagg tttatcctca
840
ctgcctggga gaagaagctc ccgattgcaa tactgaacat tgggcccaca cggtcggatg
900
acttggcgtg tctgaaactg aattctcgtt gtggagagtt gctgcctttg atagacccat
960
gctgaccaca gcctgatatt ccagaacctg gaacagggac tttcacttga atcttgctgc
1020
taaatgtaaa tgccttctca aatgacagat tccagttccc attcaacaga gtagggtgca
1080 .
ctgacaaagt atagaaggtt ctaggtatct taatgtgtgg atattcttaa ttaaaactca
1140
56 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
ttttttttaa ataaaaaatt gttcagcttt aaaa
1174
<2l0> 16
<2l1> 314
<212> PRT
<213> Homo sapiens
<400> 16
Met Lys Met Ser Phe Ala Leu Thr Phe Arg Ser Ala Lys Gly Arg Trp
1 5 10 15
Ile A1a Asn Pro Ser Gln Pro Cys Ser Lys Ala Ser Ile Gly Leu Phe
20 25 30
Val Pro Ala Ser Pro Pro Leu Asp Pro Glu Lys Val Lys Glu Leu Gln
35 40 45
Arg Phe Ile Thr Leu Ser Lys Arg Leu Leu Val Met Thr Gly Ala Gly
50 55 60
Ile Ser Thr Glu Ser Gly Ile Pro Asp Tyr Arg Ser Glu Lys Val Gly
65 70 75 80
Leu Tyr Ala Arg Thr Asp Arg Arg Pro Ile Gln His Gly Asp Phe Val
85 90 95
Arg Ser A1a Pro Ile Arg Gln Arg Tyr Trp Ala Arg Asn Phe Val Gly
57 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
100 105 110
Trp Pro Gln Phe Ser Ser His Gln Pro Asn Pro Ala His Trp Ala Leu
115 120 125
Ser Thr Trp Glu Lys Leu Gly Lys Leu Tyr Trp Leu Val Thr Gln Asn
130 135 140
Val Asp Ala Leu His Thr Lys Ala Gly Ser Arg Arg Leu Thr Glu Leu
145 150 155 160
His Gly Cys Met Asp Arg Val Leu Cys Leu Asp Cys Gly Glu Gln Thr
165 170 175
Pro Arg Gly Val Leu Gln Glu Arg Phe Gln Val Leu Asn Pro Thr Trp
180 185 190
Ser Ala Glu Ala His Gly Leu Ala Pro Asp Gly Asp Val Phe Leu Ser
195 200 205
Glu G1u Gln Val Arg Ser Phe Gln Val Pro Thr Cys Val Gln Cys Gly
210 215 220
Gly His Leu Lys Pro Asp Val Val Phe Phe Gly Asp Thr Val Asn Pro
225 230 235 240
Asp Lys Val Asp Phe Val His Lys Arg Val Lys Glu A1a Asp Ser Leu
58 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
. 245 250 255
Leu Val Val Gly Ser Ser Leu Gln Val Tyr Ser Gly Tyr Arg Phe Ile
260 265 270
1L
Leu Thr Ala Trp Glu Lys Lys Leu Pro Ile Ala Ile Leu Asn Ile Gly
275 280 285
Pro Thr Arg Ser Asp Asp Leu Ala Cys Leu Lys Leu Asn Ser Arg Cys
290 295 300
Gly G1u Leu Leu Pro Leu Ile Asp Pro Cys
305 310
<2l0> 17
<2l1> 1633
<212> DNA
<213> Homo Sapiens
<400> 17
cgcctctagg agaaagcctg gaacgcgtac cggagggtac cagagctctt agcgggccgg
cagcatgtgc ggggccaagt aaatggaaat gttttctaac atataaaaac ctacagaaga
120
agaaaataat tttctggatc aaattagaag tctgtattat attgatgtct ccagattcaa
180
atatattaga aagcagccgt ggagacaacc atcttcattt tgggagaaat aactaaagcc
240
59 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
cgcctcaagc attagaactacagacaaaccctgatgcgacctctccagattgtcccaagt
300
cgattgattt cccagctatattgtggcctgaagcctccagcgtccacacgaaaccagatt
360
tgcctgaaaa tggctcggccaagttcaagtatggcagattttcgaaagttttttgcaaaa
420
gcaaagcaca tagtcatcatctcaggagctggtgttagtgcagaaagtggtgttccgacc
480
ttcagaggag ctggaggttattggagaaaatggcaagcccaggacctggcgactcccctg
540
gcctttgccc acaacccgtcccgggtgtgggagttctaccactaccggcgggaggtcatg
600
gggagcaaggagcccaacgccgggcaccgcgccatagccgagtgtgagacccggctgggc
660
aagcagggccggcgagtcgtggtcatcacccagaacatcgatgagctgcaccgcaaggct
720
ggcaccaagaaccttctggagatccatggtagcttatttaaaactcgatgtacctcttgt
780
ggagttgtggctgagaattacaagagtccaatttgtccagctttatcaggaaaaggtgct
840
ccagaacctggaactcaagatgccagcatcccagttgagaaacttccccggtgtgaagag
900
gcaggctgcgggggcttgctgcgacctcacgtcgtgtggtttggagaaaacctggatcct
960
60 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
gccattctgg aggaggttga cagagagctc gcccactgtg atttatgtct agtggtgggc
1020
acttcctctg tggtgtaccc agcagccatg tttgcccccc aggtggctgc caggggcgtg
1080
ccagtggctg aatttaacac ggagaccacc ccagctacga acagattcag gtttcat.ttc
1140
cagggaccct gtggaacgac tcttcctgaa gcccttgcct gtcatgaaaa tgaaactgtt
1200
tcttaagtgt cctggggaag aaagaaatta cagtatatct aagaactagg ccacacgcag
1260
aggagaaatg gtcttatggg tggtgagctg agtactgaac aatctaaaaa tagcctctga
1320
ttccctcgct ggaatccaac ctgttgataa gtgatggggg tttagaagta gcaaagagca
1380
cccacattca aaagtcacag aactggaaag ttaattcata ttatttggtt tgaactgaaa
1440
cgtgaggtat ctttgatgtg tatggttggt tattgggagg gaaaaatttt gtaaattaga
1500
ttgtctaaaa aaaatagtta ttctgattat atttttgtta tctgggcaaa gtagaagtca
1560
aggggtaaaa accctactat tctgattttt gcacaagttt tagtggaaaa taaaatcaca
1620
ctctacagta ggt
1633
61 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
<210> 18
<2l1> 310
<212> PRT
<213> Homo Sapiens
<400> 18
Met Arg Pro Leu Gln Ile Val Pro Ser Arg Leu Ile Ser Gln Leu Tyr
1 5 10 15
Cys Gly Leu Lys Pro Pro Ala Ser Thr Arg Asn Gln I1e Cys Leu Lys
25 30
Met Ala Arg Pro Ser Ser Ser Met Ala Asp Phe Arg Lys Phe Phe Ala
35 40 45
Lys Ala Lys His Tle Val Ile Ile Ser Gly Ala Gly Val Ser Ala Glu
50 55 60
Ser Gly Val Pro Thr Phe Arg Gly Ala Gly Gly Tyr Trp Arg Lys Trp
65 70 75 80
Gln Ala Gln Asp Leu Ala Thr Pro Leu Ala Phe Ala His Asn Pro Ser
85 90 95
Arg Val Trp Glu Phe Tyr His Tyr Arg Arg Glu Val Met Gly Ser Lys
100 105 110
62 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
Glu Pro Asn Ala Gly His Arg Ala Ile Ala Glu Cys Glu Thr Arg Leu
115 120 125
Gly Lys Gln Gly Arg Arg Val Val Val Ile Thr Gln Asn I1e Asp Glu
l30 135 140
Leu His Arg Lys Ala Gly Thr Lys Asn Leu Leu Glu Ile His Gly Ser
145 150 155 160
Leu Phe Lys Thr Arg Cys Thr Ser Cys Gly Val Val Ala Glu Asn Tyr
165 170 175
Lys Ser Pro Tle Cys Pro Ala Leu Ser Gly Lys Gly Ala Pro Glu Pro
180 185 190
Gly Thr Gln Asp Ala Ser Ile Pro Val Glu Lys Leu Pro Arg Cys Glu
195 200 205
Glu Ala Gly Cys Gly Gly Leu Leu Arg Pro His Val Val Trp Phe Gly
210 215 220
Glu Asn Leu Asp Pro Ala Ile Leu Glu Glu Val Asp Arg Glu Leu Ala
225 230 235 240
His Cys Asp Leu Cys Leu Val Val Gly Thr Ser Ser Val Val Tyr Pro
245 250 255
63 .
CA 02453195 2004-O1-06
WO 03/004621 PCT/US02/21461
Ala Ala Met Phe Ala Pro Gln Val Ala Ala Arg Gly Val Pro Val Ala
260 265 270
Glu Phe Asn Thr Glu Thr Thr Pro Ala Thr Asn Arg Phe Arg Phe His
275 280 285
Phe Gln Gly Pro Cys Gly Thr Thr Zeu Pro Glu Ala Leu Ala Cys His
290 295 300
Glu Asn Glu Thr Val Ser
305 310
64 .
