Note: Descriptions are shown in the official language in which they were submitted.
CA 02458953 2004-02-27
1
NOVEL GENETIC PRODUCTS OBTAINED FROM ASHBYA GOSSYPII, WHICH
ARE ASSOCIATED WITH TRANSCRIPTION MECHANISMS, RNA
PROCESSING AND/OR TRANSLATION
The present invention relates to novel polynucleotides from Ashbya gossypii;
to
oligonucleotides hybridizing therewith; to expression cassettes and vectors
which
comprise these polynucleotides; to microorganisms transformed therewith; to
polypeptides encoded by these polynucleotides; and to the use of the novel
poiypeptides and polynucleotides as targets for modulating the operations of
1 o transcription, RNA processing and/or translation and, in particular,
improving vitamin B2
production in microorganisms of the genus Ashbya.
Vitamin B2 (riboflavin, lactoflavin) is an alkali- and light-sensitive vitamin
which shows
a yellowish green fluorescence in solution. Vitamin B2 deficiency may lead to
ectodermal damage, in particular cataract, keratitis, corneal vascularization;
or to
autonomic and urogenital disorders. Vitamin B2 is a precursor for the
molecules FAD
and FMN which, besides NAD+ and NADP+, are important in biology for hydrogen
transfer. They are formed from vitamin B2 by phosphorylation (FMN) and
subsequent
adenylation (FAD).
Vitamin B2 is synthesized in plants, yeasts and many microorganisms from GTP
and
ribulose 5-phosphate. The reaction pathway starts with opening of the
imidazoie ring
of GTP and elimination of a phosphate residue. Deamination, reduction and
elimination
of the remaining phosphate result in 5-amino-6-ribitylamino-2,4-pyrimidinone.
Reaction
of this compound with 3,4-dihydroxy-2-butanone 4-phosphate leads to the
bicyclic
molecule 6,7-dimethyl-8-ribityllumazine. This compound is converted into the
tricyclic
compound riboflavin by dismutation, in which a 4-carbon unit is transferred.
Vitamin B2 occurs in many vegetables and in meat, and to a lesser extent in
cereal
products. The daily vitamin B2 requirement of an adult is about 1.4 to 2 mg.
The main
breakdown product of the coenzymes FMN and FAD in humans is in turn
riboflavin,
CA 02458953 2004-02-27
.-. 0000052814
which is excreted as such.
2
Vitamin B2 is thus an important dietary substance for humans and animals.
Efforts are
therefore being made to make vitamin B2 available on the industrial scale. It
has
therefore been proposed to synthesize vitamin B2 by a microbiological route.
Microorganisms which can be used for this purpose are, for example, Bacillus
subtilis,
the ascomycetes Eremothecium ashbyii, Ashbya gossypii, and the yeasts Candida
flareri and Saccharomyces cerevisiae. The nutrient media used for this purpose
comprise molasses or vegetable oils as carbon source, inorganic salts, amino
acids,
animal or vegetable peptones and proteins, and vitamin additions. In sterile
aerobic
submerged processes, yields of more than 10 g of vitamin B2 are obtained per
Titer of
culture broth within a few days. The requirements are good aeration of the
culture,
careful agitation and setting of temperatures below about 30°C. Removal
of the
biomass, evaporation and drying of the concentrate result in a product
enriched in
vitamin B2.
Microbiological production of vitamin B2 is described, for example, in WO-A-
92/01060,
EP-A-0 405 370 and EP-A-0 531 708.
A survey of the importance, occurrence, production, biosynthesis and use of
vitamin B2
is to be found, for example, in Ullmann's Encyclopaedia of Industrial
Chemistry, volume
A27, pages 521 et seq.
Transcription
Gene expression in fungi is mainly controlled at the transcription level. The
transcription
apparatus consists of a number of proteins which can be divided into two
groups: RNA
polymerase (the operative DNA-transcribing enzyme) and transcription factors
(which
control gene transcription by guiding the RNA polymerase to specific promoter
DNA
sequences which recognize these factors). Fungi such as Ashbya gossypii
contain a
number of different transcription factors which are specific for different
promoters,
growth phases, environmental conditions, substrates, oxygen levels and the
like,
CA 02458953 2004-02-27
_. 00ooo52s14
3
allowing the organism to adapt to various environmental and metabolic
conditions.
Promoters are specific DNA sequences which serve as docking sites for the RNA
polymerase complex and transcription factors. Many promoter elements have
conserved sequence elements which can be identified by homology searches; an
alternative possibility is to identify promoter regions for a particular gene
using standard
techniques such as primer extension. Many promoter regions of eukaryotes are
known
(Guarente, L (1987), Ann. Rev. Biochem., 21; 425-452).
Promoter transcription control is influenced by several repression or
activation
mechanisms. Specific regulatory proteins (transcription factors), which bind
to
promoters, have the ability to block the binding of the RNA holoenzyme
(repressors) or
assist the latter (activators) and thus control transcription. In addition,
certain enzymes
modify the histones bound to the DNA and thus make it possible for either
access of the
transcription factors to the promoter to be prevented or made possible for the
first time
(Loo, S.; Rine, J. (1995); Annu. Rev. Cell. Dev. Biol., 11, 519-548). The
binding of the
transcription factors is likewise controlled by their interactions with other
molecules such
as proteins or other metabolic compounds (Evans, R. (1989), Science, 240, 889-
895).
The ability to control the transcription of genes thus responds to a plurality
of
environmental or metabolic signs makes it possible for the cells to control
exactly when
a gene can be expressed and how much of a gene product can be present in the
cell
at a point in time. This in turn prevents unnecessary expenditure of energy or
unnecessary use of possibly rare intermediate compounds or cofactors.
RNAprocessing
RNA is synthesized as heterogeneous fragment, with the coding sequence (axons)
in
eukaryotes frequently being interrupted by noncoding sequences (introns).
During RNA
processing after transcription, the introns are cut out (splicing) so that the
coding
sequence (of mRNA) can be read off on the ribosomes (Sharp, P. (1987),
Science; 235,
766-771 ). Since the export of RNA from the cell is also controlled with the
splicing, it is
possible in this way to control the amount of mRNA available on the ribosomes.
CA 02458953 2004-02-27
0000052814
Translation
4
Translation is the process by which a polypeptide is synthesized from amino
acids in
accordance with the information contained in an RNA molecule. The main
components
of this process are ribosomes and specific initiation or elongation factors
such as eEF1
and eEF2 (Moidave (1985); Ann. Rev. Biochem., 54, 1109-1149). Ribosomes are
composed of RNA (rRNA) and specific proteins, They consist of a large and a
small
subunit, each of which can be characterized by its sedimentation behavior in
an
analytical ultracentrifuge. Synthesis of the ribosomes is controlled by
coordinated
production of the RNA and protein components depending on the physiological
state
of the cell.
Each codon of the mRNA molecule encodes a particular amino acid. The
conversion
of mRNA into amino acid is carried out by transfer RNA (tRNA) molecules. These
molecules consist of an RNA single strand (between 60 and 100 bases) which is
in the
form of an L-shaped three-dimensional structure with projecting regions or
"arms". One
of these arms forms base pairs with a particular codon sequence on the mRNA
molecule. A second arm interacts specifically with a particular amino acid
(which is
encoded by the codon). Other tRNA arms comprise the variable arm, the 'T't'C
arm
(which has thymidylate and pseudouridylate modifications) and the D arm (which
has
a dihydrouridine modification). The function of these latter structures is
still unknown,
but their conservation between tRNA molecules suggests a role in protein
synthesis.
In order that the nucleic acid-based tRNA molecule pairs with the correct
amino acid it
is necessary for a family of enzymes, referred to as aminoacyl-tRNA
synthetases, to
act. There are many different enzymes of this type, and each is specific for a
particular
tRNA and a particular amino acid. These enzymes bind the 3'-hydroxyl of the
terminal
tRNA adenosine ribose unit to the amino acid in a two-step reaction. Firstly,
the enzyme
is activated by reaction with ATP and the amino acid, resulting in an
aminoacyl-tRNA
synthetase/aminoacyl adenylate complex. Secondly, the aminoacyl group is
transferred
from the enzyme to the target tRNA, on which it remains in a high-energy
state. Binding
CA 02458953 2004-02-27
v 0000052814
of the tRNA molecule to its recognition codon on the mRNA molecule then brings
the
high-energy amino acid bound to the tRNA into contact with the ribosome.
Inside the
ribosome, the amino acid-Loaded tRNA (aminoacyl-tRNA) occupies a binding site
(the
A site) next to a second site (the P site) which carries a tRNA molecule whose
amino
5 acid is bound to the growing polypeptide chain (peptidyl-tRNA). The
activated amino
acid on the aminoacyl-tRNA is sufficiently reactive for a peptide bond to form
spontaneously between this amino acid and the next amino acid on the growing
polypeptide chain. GTP hydrolysis supplies the energy to transfer the tRNA,
which is
now loaded with the polypeptide chain, from the A site to the P site of the
ribosome, and
the process is repeated until a stop codon is reached.
There is a number of different steps at which translation can be controlled.
These
include binding of the ribosome to mRNA, the presence of mRNA secondary
structure,
the codon usage or the frequency of particular tRNAs.
The utilization of genes associated with the mechanisms of transcription, RNA
processing and/or translation for generating microorganisms, preferably of the
genus
Ashbya, in particular of Ashbya gossypii strains, with improved adaptability
to external
conditions such as environmental and metabolic conditions has not yet been
described.
It is an object of the present invention to provide novel targets for
influencing the
transcription and/or translation mechanisms and/or the mechanisms of RNA
processing
in microorganisms of the genus Ashbya, in particular in Ashbya gossypii. The
object in
particular is specific modulation of the transcription, RNA processing and/or
translation
in such microorganisms. A further object is to improve the vitamin B2
production by
such microorganisms.
We have found that this object is achieved by providing encoding nucleic acid
sequences which are upregulated or downregulated in Ashbya gossypii during
vitamin
B2 production (based on results found with the aid of the MPSS analytical
method
described in detail in the experimental part), in particular
CA 02458953 2004-02-27
0000052814
6
a) a, preferably upregulated, nucleic acid sequence which codes for a protein
having
the function of a 26 S proteasome subunit or of a TAT binding homolog 7.
In a preferred embodiment of this aspect of the invention there has been
isolation of a
DNA clone which codes for a characteristic part-sequence of the nucleic acid
sequence
of the invention and which bears the internal name "Oligo 28".
In a further preferred embodiment there has been isolation according to the
invention
of a DNA clone which codes for the complete sequence of the nucleic acid of
the
invention and which bears the internal name "Ofigo 28v".
A first aspect of the present invention relates to a poiynucleotide comprising
a nucleic
acid sequence as shown in SEQ ID NO: 1. A further aspect of the invention
relates to
a polynucleotide comprising a nucleic acid sequence as shown in SEQ ID NO: 4
or a
fragment thereof. The polynucleotides can be isolated preferably from a
microorganism
of the genus Ashbya, in particular A. gossypii. The invention additionally
relates to the
polynucleotides complementary thereto; and to the sequences derived from these
polynucleotides through the degeneracy of the genetic code.
The inserts of "Oligo 28" and "Oligo 28~' have significant homologies with the
MIPS tag
"Yta7" from S. cerevisiae. The inserts have a nucleic acid sequence as shown
in
SEQ ID NO: 1 or SEQ ID NO: 4. The amino acid sequences derived therefrom have
significant sequence homology with a 26 S proteasome subunit or a TAT-binding
homolog 7 (TBP-7) from S. cerevisiae.
b) a, preferably upreguiated, nucleic acid sequence which codes for a protein
having
the function of a translation initiation factor subunit.
In a preferred embodiment there has been isolation according to the invention
of a DNA
clone which codes for a characteristic part-sequence of the nucleic acid
sequence of
the invention and which bears the internal name "Oligo 45".
CA 02458953 2004-02-27
0000052814
7
In a further preferred embodiment there has been isolation according to the
invention
of a DNA clone which codes for the complete sequence of the nucleic acid of
the
invention and which bears the internal name "Oligo 45v".
A first aspect of the present invention relates to a polynucleotide comprising
a nucleic
acid sequence as shown in SEQ ID NO: 6. A further aspect of the invention
relates to
a polynucleotide comprising a nucleic acid sequence as shown in SEQ ID NO: 10
or a
fragment thereof. The polynucleotides can be isolated preferably from a
microorganism
of the genus Ashbya, in particular A. gossypii. The invention additionally
relates to the
polynucleotides complementary thereto; and to the sequences derived from these
polynucleotides through the degeneracy of the genetic code.
The inserts of "Oligo 45" and "Oligo 45~' have significant homologies with the
MIPS tag
"p39" or 'Tif34" from S. cerevisiae. The inserts have a nucleic acid sequence
as shown
in SEQ ID NO: 6 or SEQ ID NO: 70. An amino acid sequence derived therefrom has
significant sequence homology with a subunit (P39) of the translation
initiation factor
EiF3 (1F32) from S. cerevisiae.
c) a, preferably downregulated, nucleic acid sequence which codes for a
protein having
the function of a ribosomal protein.
In a preferred embodiment of this aspect of the invention there has been
isolation of a
DNA clone which codes for a characteristic part-sequence of the nucleic acid
sequence
of the invention and which bears the internal name "Oligo 85".
In a further preferred embodiment there has been isolation according to the
invention
of a DNA clone which codes for the complete sequence of the nucleic acid
of.the
invention and which bears the internal name "Oligo 85v".
34 A first aspect of the present invention relates to a polynucleotide
comprising a nucleic
acid sequence as shown in SEQ ID NO: 12. A further aspect of the invention
relates to
a polynucleotide comprising a nucleic acid sequence as shown in SEQ ID NO: 14
or a
CA 02458953 2004-02-27
0000052814
8
fragment thereof. The polynucleotides can be isolated preferably from a
microorganism
of the genus Ashbya, in particular A. gossypii. The invention additionally
relates to the
polynucleotides complementary thereto; and to the sequences derived from these
polynucleotides through the degeneracy of the genetic code.
The inserts of "Oligo 85" and "Oligo 85v" have significant homologies with the
MiPS tag
"Rpl35a" from S. cerevisiae. The inserts have a nucleic acid sequence as shown
in
SEQ ID NO: 12 or SEQ ID NO: 14. The amino acid sequence derived from the
coding
strand or amino acid part-sequence has significant sequence homology with a
ribosomal protein from S. cerevisiae.
d) a, preferably upregulated, nucleic acid sequence codes for a protein having
the
function of a nucleolar protein.
In a preferred embodiment of this aspect of the invention there has been
isolation of a
DNA clone which codes for a characteristic part-sequence of the nucleic acid
sequence
of the invention and which bears the internal name "Oligo 133".
In a further preferred embodiment there has been isolation according to the
invention
of a DNA clone which codes for the complete sequence of the nucleic acid of
the
invention and which bears the internal name "Oligo 133v".
A first aspect of the present invention relates to a polynucleotide comprising
a nucleic
acid sequence as shown in SEQ ID NO: 17. A further aspect of the invention
relates to
a polynucleotide comprising a nucleic acid sequence as shown in SEQ ID NO: 19
or a
fragment thereof. The polynucleotides can be isolated preferably from a
microorganism
of the genus Ashbya, in particular A. gossypii. The invention additionally
relates to the
polynucleotides complementary thereto; and to the sequences derived from these
polynucleotides through the degeneracy of the genetic code.
The inserts of "Oligo 133" and "Oligo 133v" have significant homologies with
the MIPS
tag "Nopl3" from S. cerevisiae. The inserts have a nucleic acid sequence as
shown in
CA 02458953 2004-02-27
0000052814
9
SEQ ID NO: 17 or SEQ iD NO: i9. The amino acid sequence or amino acid part-
sequence derived from the corresponding complementary strand of SEQ ID NO: 17
or
from the sequence shown in SEQ ID NO: 19 has significant sequence homology
with
a nucleolar protein from S. cerevisiae.
e) a, preferably upregulated, nucleic acid sequence which codes for a protein
having
the function of a translation initiation protein.
In a preferred embodiment of this aspect of the invention there has been
isolation of a
DNA clone which codes for a characteristic part-sequence of the nucleic acid
sequence
of the invention and which bears the internal name "Oligo 172".
In a further preferred embodiment there has been isolation according to the
invention
of a DNA clone which codes for the complete sequence of the nucleic acid of
the
invention and which bears the internal name "Oligo 172v".
A first aspect of the present invention relates to a polynucleotide comprising
a nucleic
acid sequence as shown in SEQ ID NO: 21. A further aspect of the invention
relates to
a polynucleotide comprising a nucleic acid sequence as shown in SEQ ID N0: 24
or a
fragment thereof. The polynucleotides can be isolated preferably from a
microorganism
of the genus Ashbya, in particular A. gossypii. The invention additionally
relates to the
polynucleotides complementary thereto; and to the sequences derived from these
polynucleotides through the degeneracy of the genetic code.
The inserts of "Oligo 172" and "Oligo 172' have significant homologies with
the MIPS
tag "SuaS" from S. cerevisiae. The inserts have a nucleic acid sequence as
shown in
SEQ ID NO: 21 or SEQ ID NO: 24. The amino acid sequence or amino acid part-
sequence derived from the coding strand has significant sequence homology with
a
translation initiation protein from S. cerevisiae.
f) a, preferably downregulated, nucleic acid sequence which codes for a
protein having
the function of a precursor of ribosomal protein S 31.
CA 02458953 2004-02-27
0000052814
In a preferred embodiment of this aspect of the invention there has been
isolation of a
DNA clone which codes for a characteristic part-sequence of the nucleic acid
sequence
of the invention and which bears the internal name "Oligo 63",
5 In a further preferred embodiment there has been isolation according to the
invention
of a DNA clone which codes for the complete sequence of the nucleic acid of
the
invention and which bears the internal name "Oligo 63v".
A first aspect of the present invention relates to a polynucleotide comprising
a nucleic
10 acid sequence as shown in SEQ ID NO: 26. A further aspect of the invention
relates to
a polynucleotide comprising a nucleic acid sequence as shown in SEQ ID NO: 29
or a
fragment thereof. The polynucleotides can be isolated preferably from a
microorganism
of the genus Ashbya, in particular A. gossypii. The invention additionally
relates to the
polynucleotides complementary thereto; and to the sequences derived from these
polynucieotides through the degeneracy of the genetic code.
The inserts of "Oligo 63" and "Oligo 63v" have significant homologies with the
MIPS tag
"Rps25a" from S. cerevisiae. The inserts have a nucleic acid sequence as shown
in
SEQ ID NO: 26 or SEQ ID NO: 29. The amino acid sequence or amino acid part-
sequence derived from the corresponding complementary strand of SEQ ID NO: 26
or
from the coding strand shown in SEQ ID NO: 29 has significant sequence
homology
with a precursor of the ribosomal protein S 31 from S. cerevisiae.
g) a, preferably downregulated, nucleic acid sequence which codes for a
protein having
the function of a cell nuclear pore protein.
In a preferred embodiment of this aspect of the invention there has been
isolation of a
DNA clone which codes for a characteristic part-sequence of the nucleic acid
sequence
of the invention and which bears the internal name "Oligo 132".
In a further preferred embodiment there has been isolation according to the
invention
of a DNA clone which codes for the complete sequence of the nucleic acid of
the
CA 02458953 2004-02-27
0000052814
11
invention and which bears the internal name "Oligo 132'.
A first aspect of the present invention relates to a polynucleotide comprising
a nucleic
acid sequence as shown in SEQ ID NO: 31. A further aspect of the invention
relates to
a polynucleotide comprising a nucleic acid sequence as shown in SEQ iD NO: 36
or a
fragment thereof. The polynucleotides can be isolated preferably from a
microorganism
of the genus Ashbya, in particular A. gossypii. The invention additionally
relates to the
polynucleotides complementary thereto; and to the sequences derived from these
polynucleotides through the degeneracy of the genetic code.
The inserts of "Oligo 132" and "Oligo 132v" have significant homologies with
the MIPS
tag "Nic96" from S. cerevisiae. The inserts have a nucleic acid sequence as
shown in
SEQ ID NO: 31 or SEQ ID NO: 36. An amino acid sequence derived therefrom
(corresponding to nucleotides 108 to 764 in SEQ ID NO: 31) has significant
sequence
homology with a cell nuclear pore protein from S. cerevisiae.
h) a, preferably upregulated, nucleic acid sequence which codes for a protein
having
the function of a constituent of the ADH-histone acetyltransferase complex.
In a preferred embodiment of this aspect of the invention there has been
isolation of a
DNA clone which codes for a characteristic part-sequence of the nucleic acid
sequence
of the invention and which bears the internal name "Oligo 174".
In a further preferred embodiment there has been isolation according to the
invention
of a DNA clone which codes for the complete sequence of the nucleic acid of
the
invention and which bears the internal name "Oligo 174v".
A first aspect of the present invention relates to a polynucleotide comprising
a nucleic
acid sequence as shown in SEQ ID NO: 38. A further aspect of the invention
relates to
a polynucleotide comprising a nucleic acid sequence as shown in SEQ ID NO: 40
or a
fragment thereof. The polynucleotides can be isolated preferably from a
microorganism
of the genus Ashbya, in particular A. gossypii. The invention additionally
relates to the
CA 02458953 2004-02-27
0000052814
12
polynucleotides complementary thereto; and to the sequences derived from these
polynucleotides through the degeneracy of the genetic code.
The inserts of "Oligo 174" and "Oligo 174v" have significant homologies with
the MIPS
tag "Ahc1" from S. cerevisiae. The inserts have a nucleic acid sequence as
shown in
SEQ ID NO: 38 or SEQ ID NO: 40. The amino acid sequence or amino acid part-
sequence derived from the corresponding complementary strand to SEQ ID NO: 38
or
from the coding strand shown in SEQ ID NO: 40 has significant sequence
homology
with a constituent of the ADH-histone acetyltransferase complex from S,
cerevisiae.
i) a, preferably downregulated, nucleic acid sequence which codes for a
protein having
the function of an RNA helicase involved in RNA processing.
In a preferred embodiment of this aspect of the invention there has been
isolation of a
DNA clone which codes for a characteristic part-sequence of the nucleic acid
sequence
of the invention and which bears the internal name "Oligo 51 ".
In a further preferred embodiment there has been isolation according to the
invention
of a DNA clone which codes for the complete sequence of the nucleic acid of
the
invention and which bears the internal name "Oligo 51 v".
A first aspect of the present invention relates to a polynucleotide comprising
a nucleic
acid sequence as shown in SEQ ID NO: 42. A further aspect of the invention
relates to
a polynucleotide comprising a nucleic acid sequence as shown in SEQ ID NO: 46
or a
fragment thereof. The polynucleotides can be isolated preferably from a
microorganism
of the genus Ashbya, in particular A. gossypii. The invention additionally
relates to the
polynucleotides complementary thereto; and to the sequences derived from these
polynucleotides through the degeneracy of the genetic code.
The inserts of "Oligo 51" and "Ofigo 51~' have significant homologies with the
MIPS tag
"Rok1" from S. cerevisiae. The inserts have a nucleic acid sequence as shown
in
SEQ ID NO: 42 or SEQ ID NO: 46. The amino acid sequence derived from the
CA 02458953 2004-02-27
0000052814
13
corresponding complementary strand to SEQ ID NO: 42 or from the coding strand
of
SEQ ID NO: 46 have significant sequence homology with a S. cerevisiae RNA
helicase
involved in RNA processing.
k) a, preferably upregulated, nucleic acid sequence which codes for a protein
having
the function of the non-essential constituent of RNA poll.
In a preferred embodiment of this aspect of the invention there has been
isolation of a
DNA clone which codes for a characteristic part-sequence of the nucleic acid
sequence
of the invention and which bears the internal name "Oligo 30".
In a further preferred embodiment there has been isolation according to the
invention
of a DNA clone which codes for the complete sequence of the nucleic acid of
the
invention and which bears the internal name "Oligo 30v".
A first aspect of the present invention relates to a polynucleotide comprising
a nucleic
acid sequence as shown in SEQ ID NO: 48. A further aspect of the invention
relates to
a polynucleotide comprising a nucleic acid sequence as shown in SEQ ID NO: 51
or a
fragment thereof. The polynucleotides can be isolated preferably from a
microorganism
of the genus Ashbya, in particular A. gossypii. The invention additionally
relates to the
polynucleotides complementary thereto; and to the sequences derived from these
polynucleotides through the degeneracy of the genetic code.
The inserts of "Oligo 30" and "Oligo 30~' have significant homologies with the
MIPS tag
"Rpa34" from S. cerevisiae. The inserts have a nucleic acid sequence as shown
in
SEQ ID NO: 48 or SEQ ID NO: 51. The amino acid sequences derived in each case
from the coding strand have significant sequence homology with the non-
essential
constituent of RNA poll from S. cerevisiae.
I) a, preferably downregulated, nucleic acid sequence which codes for a
protein having
the function of an RNA helicase.
CA 02458953 2004-02-27
0000052814
14
In a preferred embodiment of this aspect of the invention there has been
isolation of 3
DNA clone which codes for a characteristic part-sequence of the nucleic acid
sequence
of the invention and which bears the internal name "Oligo 124".
In a further preferred embodiment there has been isolation according to the
invention
of a DNA clone which codes for the complete sequence of the nucleic acid of
the
invention and which bears the internal name "Oligo 124v".
A first aspect of the present invention relates to a polynucleotide comprising
a nucleic
acid sequence as shown in SEQ ID NO: 53. A further aspect of the invention
relates to
a polynucleotide comprising a nucleic acid sequence as shown in SEQ ID NO: 56
or a
fragment thereof. The polynucleotides can be isolated preferably from a
microorganism
of the genus Ashbya, in particular A. gossypii. The invention additionally
relates to the
polynucleotides complementary thereto; and to the sequences derived from these
polynucleotides through the degeneracy of the genetic code.
The inserts of "Oligo 124" and "Oligo 124v" have significant homologies with a
MIPS tag
"Sub2" from S. cerevisiae. The inserts have a nucleic acid sequence as shown
in
SEQ iD NO: 53 or SEQ ID NO: 56. The amino acid sequence or amino acid part-
sequence derived from the coding strand has significant sequence homology with
an
RNA helicase from S. cerevisiae.
m) a, preferably downregulated, nucleic acid sequence which codes for a
protein having
the function of an mRNA decapping enzyme.
In a preferred embodiment of this aspect of the invention there has been
isolation of a
DNA clone which codes for a characteristic part-sequence of the nucleic acid
sequence
of the invention and which bears the internal name "Oligo 139".
In a further preferred embodiment there has been isolation according to the
invention
of a DNA clone which codes for the complete sequence of the nucleic acid of
the
invention and which bears the internal name "Oligo 139v".
CA 02458953 2004-02-27
0000052814
A first aspect of the present invention relates to a polynucleotide comprising
a nucleic
acid sequence as shown in SEO ID NO: 58. A further aspect of the invention
relates to
a polynucleotide comprising a nucleic acid sequence as shown in SEQ ID NO: 60
or a
5 fragment thereof. The polynucleotides can be isolated preferably from a
microorganism
of the genus Ashbya, in particular A. gossypii. The invention additionally
relates to the
polynucleotides complementary thereto; and to the sequences derived from these
polynucleotides through the degeneracy of the genetic code.
10 The inserts of "Oligo 139" and "Oligo 139' have significant homologies with
the MIPS
tag "DCP1" from S. cerevisiae. The inserts having nucleic acid sequence as
shown in
SEQ ID NO: 58 or SEQ ID NO: 60. The amino acid sequence or amino acid part-
sequence derived from the coding strand has significant sequence homology with
an
mRNA decapping enzyme from S. cerevisiae.
n) a, preferably downregulated, nucleic acid sequence which codes for a
protein having
the function of a subunit of the translation initiation factor eIF3.
In a preferred embodiment of this aspect of the invention there has been
isolation of a
DNA clone which codes for a characteristic part-sequence of the nucleic acid
sequence
of the invention and which bears the internal name "Oligo 144".
In a further preferred embodiment there has been isolation according to the
invention
of a DNA clone which codes for the complete sequence of the nucleic acid of
the
invention and which bears the internal name "Oligo 144v".
A first aspect of the present invention relates to a polynucleotide comprising
a nucleic
acid sequence as shown in SEQ ID NO: 63. A further aspect of the invention
relates to
a polynuc(eotide comprising a nucleic acid sequence as shown in SEQ ID NO: 65
or a
fragment thereof. The polynucleotides can be isolated preferably from a
microorganism
of the genus Ashbya, in particular A. gossypii. The invention additionally
relates to the
polynucleotides complementary thereto; and to the sequences derived from these
CA 02458953 2004-02-27
0000052814
16
polynucleotides through the degeneracy of the genetic code.
The inserts of "Oligo 144" and "Oligo 144v" have significant homologies with
the MIPS
tag "PRT1" from S. cerevisiae. The inserts have a nucleic acid sequence as
shown in
SEQ ID NO: 63 or SEQ !D NO: 65. The amino acid sequence or amino acid part-
sequence derives from the coding strand as significant sequence homology with
a
subunit of the translation initiation factor eiF3 from S. cerevisiae.
o) a, preferably upregulated, nucleic acid sequence which codes for a protein
having
the function of a U3 small nucleolar ribonucleoprotein-substituted protein
which is
involved in preribosomal RNA processing.
In a preferred embodiment of this aspect of the invention there has been
isolation of a
DNA clone which codes for a characteristic part-sequence of the nucleic acid
sequence
of the invention and which bears the internal name "Oligo 168".
In a further preferred embodiment there has been isolation according to the
invention
of a DNA clone which codes for the complete sequence of the nucleic acid of
the
invention and which bears the internal name "Oligo 168v".
A first aspect of the present invention relates to a polynucleotide comprising
a nucleic
acid sequence as shown in SEQ ID NO: 67. A further aspect of the invention
relates to
a polynucleotide comprising a nucleic acid sequence as shown in SEQ iD NO: 70
or a w
fragment thereof. The polynucleotides can be isolated preferably from a
microorganism
of the genus Ashbya, in particular A, gossypii. The invention additionally
relates to the
polynucleotides complementary thereto; and to the sequences derived from these
polynucleotides through the degeneracy of the genetic code.
The inserts of "Oligo 168" and "Oligo 168v" have significant homologies with
the MIPS
tag "Rrp9" from S. cerevisiae. The inserts have the nucleic acid sequence as
shown in
SEQ ID N0: 67 or SEQ ID N0: 70. The amino acid sequence or amino acid part-
sequence derived from the coding strand has significant sequence homology with
a
CA 02458953 2004-02-27
0000052814
17
S. cerevisiae U3 small nucleolar ribonucleoprotein-associated protein which is
involved
in preribosomal RNA processing.
p) a, preferably downregulated, nucleic acid sequence which codes for a
protein having
the function of the ribosomal protein L7a.e.B of the large 60 S subunit.
In a preferred embodiment of this aspect of the invention there has been
isolation of a
DNA clone which codes for a characteristic part-sequence of the nucleic acid
sequence
of the invention and which bears the internal name "Oligo 160".
A first aspect of the present invention relates to a polynucleotide comprising
a nucleic
acid sequence as shown in SEa ID NO: 72, which can be isolated preferably from
a
microorganism of the genus Ashbya, in particular A. gossypii. The invention
additionally
relates to the polynucleotide complementary thereto; and to the sequences
derived frarri
these polynucleotides through the degeneracy of the genetic code.
The insert of "Oligo 160" has significant homologies with the MIPS tag "RplBb"
from
S. cerevisiae. The insert has a nucleic acid sequence as shown in SEQ ID NO:
72. The
amino acid sequence derived from the corresponding complementary strand has
significant sequence homology with a ribosomal protein (L7a.e.B; large 60S
subunit)
from S. cerevisiae.
q) We have found that this object is achieved by providing an encoding nucleic
acid
sequence which is unregulated in Ashbya gossypii during vitamin B2 production
(based
on results found with the aid of the MPSS analytical method described in
detail in the
experimental part).
In a preferred embodiment of this aspect of the invention there has been
isolation of a
DNA clone which codes for a characteristic part-sequence of the nucleic acid
sequence
of the invention and which bears the internal name "Ofigo 18".
In a further preferred embodiment there has been isolation according to the
invention
CA 02458953 2004-02-27
0000052814
18
of a DNA clone which codes for the complete sequence of the nucleic acid of
the
invention and which bears the internal name "Oligo 18v".
A first aspect of the present invention relates to a polynucleotide comprising
a nucleic
acid sequence as shown in SEQ ID NO: 75 or the polynucleotide complementary
thereto as shown in SEQ ID NO: 74. A further aspect of the invention relates
to a
polynucleotide comprising a nucleic acid sequence as shown in SEQ ID NO: 77 or
a
fragment thereof. The polynucleotides can be isolated preferably from a
microorganism
of the genus Ashbya, in particular A. gossypii. The invention additionally
relates to the
polynucleotides complementary thereto; and to the sequences derived from these
polynucleotides through the degeneracy of the genetic code.
A further aspect of the invention relates to oligonucleotides which hybridize
with one of
the above polynucleotides, in particular under stringent conditions.
The invention additionally relates to polynucleotides which hybridize with one
of the
oligonucleotides of the invention and code for a gene product from
microorganisms of
the genus Ashbya or a functional equivalent of this gene product.
The invention further relates to polypeptides or proteins which are encoded by
the
polynucleotides described above; and to peptide fragments thereof which have
an
amino acid sequence which comprises at least 10 consecutive amino acid
residues as
shown in SEQ ID NO: 2, 3, 5, 7, 8, 9, 11, 13, 15, 16, 18, 20, 22, 23, 25, 27,
28, 30, 32,
33, 34, 35, 37, 39, 41, 43, 44, 45, 47, 49, 50, 52, 54, 55, 57, 59, 61, 62,
64, 66, 68, 69,
71, 73, 76, or SEQ ID NO: 78; and to functional equivalents of the
polypeptides or
proteins of the invention.
In this connection, functional equivalents differ from the products
specifically disclosed
in the invention by their amino acid sequence through addition, insertion,
substitution,
deletion or inversion at a minimum of one, such as, for example, 1 to 30 or 1
to 20 or
1 to 10, sequence positions without the originally observed protein function,
which can
be deduced by sequence comparison with other proteins, being lost. It is thus
possible
CA 02458953 2004-02-27
0000052814
19
for equivalents to have essentially identical, higher or lower activities
compared with the
native protein.
Further aspects of the invention relate to expression cassettes for the
recombinant
production of proteins of the invention, comprising one of the nucleic acid
sequences
defined above, operatively linked to at least one regulatory nucleic acid
sequence; and
to recombinant vectors comprising at least one such expression cassette of the
invention.
Also provided according to the invention are prokaryotic or eukaryotic hosts
which are
transformed with at least one vector of the above type. A preferred embodiment
provides prokaryotic or eukaryotic hosts in which the functional expression of
at least
one gene which codes for a polypeptide of the invention as defined above is
modulated
(e.g. inhibited or overexpressed}; or in which the biological activity of a
polypeptide as
defined above is reduced or increased. Preferred hosts are selected from
ascomycetes,
in particular those of the genus Ashbya and preferably strains of A. gossypii.
Modulation of gene expression in the above sense includes both inhibition
thereof, for
example through blockade of a stage in expression (in particular transcription
or
translation) or a specific overexpression of a gene (for example through
modification of
regulatory sequences or increasing the copy number of the coding sequence}.
A further aspect of the invention relates to the use of an expression cassette
of the
invention, of a vector of the invention or of a host of the invention for the
microbiological
production of vitamin B2 andlor precursors and/or derivatives thereof.
A further aspect of the invention relates to the use of an expression cassette
of the
invention, of a vector of the invention or of a host of the invention for the
recombinant
production of a polypeptide of the invention as defined above.
Also provided according to the invention is a method for detecting or for
validating an
effector target for modulating the microbiological production of vitamin B2
andlor
CA 02458953 2004-02-27
0000052814
precursors and/or derivatives thereof. This entails treating a microorganism
capable of
the microbiological production of vitamin B2 and/or precursors and/or
derivatives
thereof with an effector which interacts with (such as, for example, non-
covalentiy binds
to) a target selected from a pofypeptide of the invention as defined above or
a nucleic
5 acid sequence coding therefor, validating the influence of the effector on
the amount
of the microbiologically produced vitamin B2 and/or of the precursor and/or of
a
derivative thereof; and isolating the target where appropriate. The validation
in this case
takes place preferably by direct comparison with the microbiological vitamin
B2
production in the absence of the effector under otherwise identical
conditions.
A further aspect of the invention relates to a method for modulating (in
relation to the
amount and/or rate of) the microbiological production of vitamin B2 and/or
precursors
and/or derivatives thereof, where a microorganism capable of the
microbiological
production of vitamin B2 and/or precursors and/or derivatives thereof is
treated with an
effector which interacts with a target selected from a polypeptide of the
invention as
defined above or a nucleic acid sequence coding therefor.
Preferred examples of the abovementioned effectors which should be mentioned
are:
a) antibodies or antigen-binding fragments thereof;
b) polypeptide ligands which are different from a) and which interact with a
polypeptide of the invention;
c) low molecular weight effectors which modulate the biological activity of a
polypeptide of the invention;
d) antisense nucleic acid sequences which interact with a nucleic acid
sequence of
the invention.
The invention likewise relates to the abovementioned effectors having
specificity for at
least one of the targets, according to the invention, defined above.
A further aspect of the invention relates to a method for the microbiological
production
of vitamin B2 and/or precursors and/or derivatives thereof, where a host as
defined
above is cultivated under conditions favoring the production of vitamin B2
and/or
CA 02458953 2004-02-27
0000052814
21
precursors and/or derivatives thereof, and the desired products) is(are)
isolated from
the culture mixture. It is preferred in this connection that the host is
treated with an
effector as defined above before and/or during the cultivation. A preferred
host is in this
case selected from microorganisms of the genus Ashbya; in particular
transformed as
described above.
A final aspect of the invention relates to the use of a polynucleotide or
polypeptide of
the invention as target for modulating the production of vitamin B2 and/or
precursors
and/or derivatives thereof in a microorganism of the genus Ashbya.
Description of the figures:
Figure 1 shows an alignment between an amino acid sequence of the invention
based
on SEQ ID NO: 5 (middle sequence) and a part-sequence of the MIPS tag "Yta7"
from
S. cerevisiae (lower sequence). The consensus sequence is depicted above these
two.
Positions lacking homology are symbolized by black rectangles.
Figure 2 shows an alignment between an amino acid sequence of the invention
based
on SEQ ID NO: 11 (middle sequence) and a part-sequence of the MIPS tag 'Tif34"
from
S. cerevisiae (lower sequence). The consensus sequence is depicted above these
two.
Positions lacking homology are symbolized by black rectangles.
Figure 3 shows an alignment between an amino acid part-sequence of the
invention
(corresponding to the strand at position 469 to 825 in SEQ ID NO: 12 (upper
sequence)
and a part-sequence of the MIPS tag "Rpl25a" from S. cerevisiae (lower
sequence)
Identical sequence positions are indicated between the two sequences. Similar
sequence positions are labeled with "+".
Figure 4 shows an alignment between an amino acid part-sequence of the
invention
(corresponding to the complementary strand at position 114 to 1 in SE4 ID NO:
17
(upper sequence) and a part-sequence of the MIPS tag "Nopl3" from S.
cerevisiae
(lower sequence). identical sequence positions are indicated between the two
CA 02458953 2004-02-27
0000052814
22
sequences. Similar sequence positions are labeled with "+".
Figure 5A shows an alignment between an amino acid part-sequence of the
invention
(corresponding to the strand at position 2 to 349 in SEQ ID NO: 21 ) (upper
sequence)
and a part-sequence of the MIPS tag "SuaS" from S. cerevisiae (lower
sequence).
Figure 5B shows an alignment between an amino acid part-sequence of the
invention
(corresponding to the strand at position 336 to 947 in SEQ ID NO: 21 ) (upper
sequence) and a part-sequence of the MIPS tag "SuaS" from S. cerevisiae (lower
sequence).
Figure 6A shows an alignment between an amino acid part-sequence of the
invention
(corresponding to the complementary strand to position 609 to 562 in SEQ ID
NO: 26)
(upper sequence) and a part-sequence of the MIPS tag "Rps25a" from S.
cerevisiae
(lower sequence). Figure 6B shows an alignment between an amino acid part-
sequence
of the invention (corresponding to the complementary strand to position 556 to
401 in
SEQ ID NO: 26) (upper sequence) and a part-sequence of the MIPS tag "SuaS"
from
S, cerevisiae (lower sequence). Identical sequence positions are indicated
between the
two sequences. Similar sequence positions are labeled with "+".
Figure 7 shows an alignment between an amino acid sequence of the invention
based
on SEQ ID NO: 36 (middle sequence) and a part-sequence of the MIPS tag "Nic96"
from S. cerevisiae (lower sequence). The consensus sequence is depicted above
these
two. Positions lacking homology are symbolized by black rectangles.
Figure 8 shows an alignment between an amino acid part-sequence of the
invention
(corresponding to the complementary strand at position 174 to 1 in SEQ ID NO:
38)
(upper sequence) and a part-sequence of the MiPS tag "Ahc1" from S, cerevisiae
(lower sequence). Identical sequence positions are indicated between the two
sequences. Similar sequence positions are labeled with "+".
Figure 9A shows an alignment between an amino acid part-sequence of the
invention
(corresponding to the complementary strand to position 1086 to 1012 in SEQ ID
CA 02458953 2004-02-27
T 0000052814
23
N0:42) (upper sequence) and a part-sequence of the MiPS tag "Rok1" from
S. cerevisiae (lower sequence). Figure 9B shows an alignment between an amino
acid
part-sequence of the invention (corresponding to the complementary strand to
position
1022 to 915 in SEQ ID NO: 42) (upper sequence) and a part-sequence of the MIPS
tag
"Rok1" from S. cerevisiae (lower sequence). Figure 9C shows an alignment
between
an amino acid part-sequence of the invention (corresponding to the
complementary
strand to position 925 to 689 in SEQ ID NO: 42) (upper sequence) and a part-
sequence
of the MIPS tag "Rok1" from S. cerevisiae (lower sequence). Identical sequence
positions are in each case indicated between the two sequences. Similar
sequence
positions are labeled with "+".
Figure 1 OA shows an alignment between an amino acid part-sequence of the
invention
(corresponding to the strand at position 1 to 102 in SEQ ID NO: 48) (upper
sequence)
and a part-sequence of the MIPS tag "Rpa43" from S. cerevisiae (lower
sequence).
Figure 10B shows an alignment between an amino acid part-sequence of the
invention
(corresponding to the strand at position 122 to 400 in SEQ ID NO: 48) (upper
sequence) and a part-sequence of the MIPS tag "Rpa43" from S. cerevisiae
(lower
sequence). Identical sequence positions are indicated between the two
sequences.
Similar sequence positions are labeled with "+". Figure 10C shows the coding
part-
sequence as shown in SEQ ID NO: 48 and the part-sequence complementary
thereto.
Figure 11 A shows an alignment between an amino acid part-sequence of the
invention
(corresponding to the strand at position 2 to 148 in SEQ IS NO: 53) (upper
sequence)
and a part-sequence of the MIPS tag "Sub2" from S. cerevisiae (lower
sequence).
Figure 11 B shows an alignment between an amino acid part-sequence of the
invention
(corresponding to the strand at position 150 to 185 in SEQ IS NO: 53) (upper
sequence)
and a part-sequence of the MIPS tag "Sub2" from S. cerevisiae (lower
sequence).
Identical sequence positions are indicated between the two sequences. Similar
sequence positions are labeled with "+".
Figure 12 shows an alignment between an amino acid part-sequence of the
invention
(corresponding to the strand at position 2 to 82 in SEQ ID NO: 58 (upper
sequence) and
CA 02458953 2004-02-27
0000052814
24
a part-sequence of the MIPS tag "DCP1" from S. cerevisiae (lower sequence).
Identical
sequence positions are indicated between the two sequences. Similar sequence
positions are labeled with "+".
Figure 13 shows an alignment between an amino acid part-sequence of the
invention
(corresponding to the strand at position 21 to 695 in SEQ ID NO: 63) (upper
sequence)
and a part-sequence of the MIPS tag "PRT1" from S. cerevisiae (lower
sequence).
Identical sequence positions are indicated between the two sequences. Similar
sequence positions are labeled with "+".
Figure 14A shows an al'~nment between an amino acid part-sequence of the
invention
(corresponding to the strand at position 1 to 111 in SEQ ID NO: 67) (upper
sequence)
and a part-sequence of the MIPS tag "Rrp9" from S. cerevisiae (lower
sequence).
Figure 14B shows an alignment between an amino acid part-sequence of the
invention
(corresponding to the strand at position 144 to 887 in SEQ ID NO: 67) (upper
sequence) and a part-sequence of the MIPS tag "Rrp9" from S. cerevisiae (lower
sequence). Identical sequence positions are indicated between the two
sequences.
Similar sequence positions are labeled with "+".
Figure 15 shows an alignment between an amino acid part-sequence of the
invention
(corresponding to the complementary strand at position 508 to 176 in SEQ ID
NO: 72)
(upper sequence) and a part-sequence of the MIPS tag "Rpl8b" from S.
cerevisiae
(lower sequence). Identical sequence positions are indicated between the two
sequences. Similar sequence positions are labeled with "+".
Figure 16 shows the construction scheme for inserting an antibiotic resistance
cassette
(G418 resistance gene under the control of the Ashbya TEF promoter) behind the
open
reading frame (ORF) shown for "Oligo 18".
Detailed descriation of the invention:
The nucleic acid molecules of the invention encode polypeptides or proteins
which are
CA 02458953 2004-02-27
0000052814
referred to here as proteins of the transcription, RNA processing and/or
translation (for
example with activity in relation to transcription, RNA processing, splicing
or translation)
or for short as "TT proteins". These TT proteins have, for example, a function
in the
adaptation to various growth phases and environmental and metabolic conditions
such
5 as substrates, oxygen level and the like.
Owing to the availability of cloning vectors which can be used in Ashbya
gossypii, as
disclosed, for example, in W right and Philipsen (1991 ) Gene, 109, 99-105,
and of
techniques for genetic manipulation of A, gossypii and the related yeast
species, the
10 nucleic acid molecules of the invention can be used for genetic
manipulation of these
organisms, in particular of A. gossypii, in order to make them better and more
efficient
producers of vitamin B2 and/or precursors and/or derivatives thereof. This
improved
production or efficiency may result from a direct effect of the manipulation
of a gene of
the invention or result from an indirect effect of such a manipulation.
The present invention is based on the provision of novel molecules which are
referred
to here as TT nucleic acids and TT proteins and are involved in the
transcription, RNA
processing and/or translation, in particular in Ashbya gossypii (e.g. in the
regulation of
transcription, RNA processing and/or translation). The activity of the TT
molecules of
the invention in A. gossypii influences vitamin B2 production by this
organism. The
activity of the TT molecules of the invention is preferably modulated so that
the
metabolic and/or energy pathways of A. gossypii in which the TT proteins of
the
invention are involved are modulated in relation to the yield, production
and/or efficiency
of vitamin B2 production, which modulates either directly or indirectly the
yield,
production and/or efficiency of vitamin B2 production in A, gossypii.
The nucleic acid sequences provided by the invention can be isolated, for
example,
from the genome of an Ashbya gossypii strain which is freely available from
the
American Type Culture Collection under the number ATCC 10895.
CA 02458953 2004-02-27
0000052814
Improvement in vitamin B2 production:
26
There is a number of possible mechanisms by which the yield, production and/or
efficiency of production of vitamin B2 by an A. gossypii strain can be
influenced directly
through changing the amount and/or activity of a TT protein of the invention.
Thus, a more efficient transcription, RNA processing or translation, which
adapts
expression of the desired gene products to the external conditions, can
achieve
optimization of the formation of the desired products of value.
Mutagenesis of one or more TT proteins of the invention may also lead to TT
proteins
with altered (increased or reduced) activities which influence indirectly the
production
of the required product from A. gossypii. It is possible, for example, with
the aid of the
TT proteins for the progress of transcription, RNA processing and/or
translation to be
assisted (e.g by activators) or blocked (e.g. by repressors) at various
points, and thus
gene expression or protein synthesis to be influenced. The yield of target
product can
thus be increased or optimized in relation to external conditions.
Polvaeptides
The invention relates to polypeptides which comprise the abovementioned amino
acid
sequences or characteristic part-sequences thereof and/or are encoded by the
nucleic
acid sequences described herein.
The invention likewise encompasses "functional equivalents" of the
specifically
disclosed novel polypeptides.
"Functional equivalents" or analogs of the specifically disclosed poiypeptides
are for the
purposes of the present invention polypeptides which differ therefrom but
which still
have the desired biological activity (such as, for example, substrate
specificity).
"Functional equivalents" mean according to the invention in particular mutants
which
CA 02458953 2004-02-27
0000052814
27
have in at least one of the abovementioned sequence positions an amino acid
which
differs from that specifically mentioned but nevertheless have one of the
abovementioned biological activities. "Functional equivalents" thus comprise
the
mutants obtainable by one or more amino acid additions, substitutions,
deletions andJ
or inversions, it being possible for said modifications to occur in any
sequence position
as long as they lead to a mutant having the profile of properties of the
invention.
Functional equivalence exists in particular also when there is qualitative
agreement
between mutant and unmodified polypeptide in the reactivity pattern, i.e.
there are
differences in the rate of conversion of identical substrates, for example.
"Functional equivalents" in the above sense are also precursors of the
polypeptides
described, and functional derivatives and salts of the polypeptides. The term
"salts"
means both salts of carboxyl groups and acid addition salts of amino groups in
the
protein molecules of the invention. Salts of carboxyl groups can be prepared
in a
manner known per se and comprise inorganic salts such as, for example, sodium,
calcium, ammonium, iron and zinc salts, and salts with organic bases such as,
for
example, amines such as triethanolamine, arginine, lysine, piperidine and the
like. Acid
addition salts such as, for example, salts with mineral acids such as
hydrochloric acid
or sulfuric acid and salts with organic acids such as acetic acid and oxalic
acid are also
an aspect of the invention.
"Functional derivatives" of poiypeptides of the invention can also be prepared
at
functional amino acid side groups or at their N- or C-terminal end by known
techniques.
Such derivatives include, for example, aliphatic esters of carboxyl groups,
amides of
carboxyl groups obtainable by reaction with ammonia or with a primary or
secondary
amine; N-acyl derivatives of free amino groups prepared by reaction with acyl
groups;
or O-acyl derivatives of free hydroxyl groups prepared by reaction with acyl
groups.
"Functional equivalents" naturally also comprise polypeptides which are
obtainable
from other organisms, and naturally occurring variants. For example homologous
sequence regions can be found by sequence comparison, and equivalent enzymes
can
be established on the basis of the specific requirements of the invention.
CA 02458953 2004-02-27
0000052814
28
"Functional equivalents" likewise comprise fragments, preferably single
domains or
sequence motifs, of the polypeptides of the invention, which have, for
example, the
desired biological function.
"Functional equivalents" are additionally fusion proteins which have one of
the
abovementioned polypeptide sequences or functional equivalents derived
therefrom
and at least one other heterologous sequence functionally different therefrom
in
functional N- or C-terminal linkage (i.e. with negligible mutual impairment of
the
functions of the parts of the fusion proteins). Nonlimiting examples of such
heterologous
sequences are, for example, signal peptides, enzymes, immunoglobulins, surface
antigens, receptors or receptor ligands.
"Functional equivalents" include according to the invention homologs of the
specifically
disclosed proteins. These have at least 60%, preferably at least 75%, in
particular at
least 85%, such as, for example, 90%, 95% or 99%, homology to one of the
specifically
disclosed sequences, calculated by the algorithm of Pearson and Lipman, Proc.
Natl.
Acad. Sci. (USA) 85(8), 1988, 2444-2448.
In the case where protein glycosylation is possible, equivalents of the
invention include
proteins of the type defined above in deglycosylated or glycosylated form, and
modified
forms obtainable by altering the glycosyfation pattern.
Homologs of the proteins or polypeptides of the invention can be generated by
mutagenesis, for example by point mutation or truncation of the protein. The
term
"homolog" as used here relates to a variant form of the protein which acts as
agonist
or antagonist of the protein activity.
Homologs of the proteins of the invention can be identified by screening
combinatorial
libraries of mutants such as, for example, truncation mutants. It is possible,
for example,
to generate a variegated library of protein variants by combinatorial
mutagenesis at the
nucleic acid level, such as, for example, by enzymatic figation of a mixture
of synthetic
ofigonucleotides. There is a large number of methods which can be used to
produce
CA 02458953 2004-02-27
0000052814
29
libraries of potential homologs from a degenerate oligonucleotide sequence.
Chemical
synthesis of a degenerate gene sequence can be carried out in an automatic DNA
synthesizer, and the synthetic gene can then be ligated into a suitable
expression
vector. The use of a degenerate set of genes makes it possible to provide all
sequences
which encode the desired set of potential protein sequences in one mixture.
Methods
for synthesizing degenerate oligonucleotides are known to the skilled worker
(for
example Narang, S.A. (1983) Tetrahedron 39:3; Itakura et a1. (1984) Annu. Rev.
Biochem. 53:323; ltakura et al., (1984) Science 198:1056; lke et al. (1983)
Nucleic
Acids Res. 11:477).
In addition, libraries of fragments of the protein codon can be used to
generate a
variegated population of protein fragments for screening and for subsequent
selection
of homologs of a protein of the invention. In one embodiment, a library of
coding
sequence fragments can be generated by treating a double-stranded PCR fragment
of
a coding sequence with a nuclease under conditions under which nicking takes
place
only about once per molecule, denaturing the double-stranded DNA, renaturing
the
DNA to form double-stranded DNA, which may comprise sense/antisense pairs of
different nicked products, removing single-stranded sections from newly formed
duplices by treatment with S1 nuclease and ligating the resulting fragment
library into
an expression vector. It is possible by this method to derive an expression
library which
encodes N-terminal, C-terminal and internal fragments having different sizes
of the
protein of the invention.
Several techniques are known in the prior art for screening gene products from
combinatorial libraries which have been produced by point mutations or
truncation and
for screening cDNA libraries for gene products with a selected property. These
techniques can be adapted to rapid screening of gene libraries which have been
generated by combinatorial mutagenesis of homologs of the invention. The most
frequently used techniques for screening large gene libraries undergoing high-
throughput analysis comprise the cloning of the gene library into replicable
expression
vectors, transformation of suitable cells with the resulting vector library
and expression
of the combinatorial genes under conditions under which detection of the
required
CA 02458953 2004-02-27
0000052814
activity facilitates isolation of the vector which encodes the gene whose
product has
been detected. Recursive ensemble mutagenesis (REM), a technique which
increases
the frequency of functional mutants in the libraries, can be used in
combination with the
screening tests for identifying homologs (Arkin and Yourvan (1992) PNAS
89:7811-
5 7815; Delgrave et al. (1993) Protein Engineering 6(3):327-331).
Recombinant preparation of the polypeptides of the invention is possible (see
following
sections) or they can be isolated in native form from microorganisms,
especially those
of the genus Ashbya, by use of conventional biochemical techniques (see
Cooper, T.G.,
10 Biochemische Arbeitsmethoden, Verlag Walter de Gruyter, Berlin, New York or
in
Scopes, R., Protein Purification, Springer Verlag, New York, Heidelberg,
Berlin.
Nucleic acid seauences:
15 The invention also relates to nucleic acid sequences (single- and double-
stranded DNA
and RNA sequences such as, for example, cDNA and mRNA), coding for one of the
above polypeptides and their functional equivalents which are obtainable, for
example,
by use of artificial nucleotide analogs.
20 The invention relates both to isolated nucleic acid molecules which code
for
polypeptides or proteins of the invention or biologically active sections
thereof, and to
nucleic acid fragments which can be used, for example, for use as
hybridization probes
or primers for identifying or amplifying coding nucleic acids of the
invention.
25 The nucleic acid molecules of the invention may additionally comprise
untranslated
sequences from the 3' and/or 5' end of the coding region of the gene.
An "isolated" nucleic acid molecule is separated from other nucleic acid
molecules
which are present in the natural source of the nucleic acid and may moreover
be
30 essentially free of other cellular material or culture medium if it is
produced by
recombinant techniques, or free of chemical precursors or other chemicals if
it is
chemically synthesized.
CA 02458953 2004-02-27
0000052814
31
A nucleic acid molecule of the invention can be isolated by using standard
techniques
of molecular biology and the sequence information provided according to the
invention.
For example, cDNA can be isolated from a suitable cDNA library by using one of
the
specifically disclosed complete sequences or a section thereof as
hybridization probe
and standard hybridization techniques (as described, for example, in Sambrook,
J.,
Fritsch, E.F, and Maniatis, T. Molecular Cloning: A Laboratory Manual. 2nd
edition, Cold
Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring
Harbor,
NY, 1989). It is moreover possible for a nucleic acid molecule comprising one
of the
disclosed sequences or a section thereof to be isolated by polymerase chain
reaction
using the oligonucleotide primers constructed on the basis of this sequence.
The
nucleic acid amplified in this way can be cloned into a suitable vector and be
characterized by DNA sequence analysis. The oligonucleotides of the invention
which
correspond to a TT nucleotide sequence can also be produced by standard
synthetic
methods, for example using an automatic DNA synthesizer.
The invention additionally comprises the nucleic acid molecules which are
complementary to the specifically described nucleotide sequences, or a section
thereof.
The nucleotide sequences of the invention make it possible to generate probes
and
primers which can be used for identifying and/or cloning homologous sequences
in
other cell types and organisms. Such probes and primers usually comprise a
nucleotide
sequence region which hybridizes under stringent conditions onto at least
about 12,
preferably at least about 25, such as, for example, 40, 50 or 75, consecutive
nucleotides of a sense strand of a nucleic acid sequence of the invention or a
corresponding antisense strand.
Further nucleic acid sequences of the invention are derived from SEQ 1D NO: 1,
4, 6,
10, 12, 14, 17, 19, 21, 24, 26, 29, 31, 36, 38, 40, 42, 46, 48, 5 i , 53, 56,
58, 60, 63, 65,
67, 70, 72, 74, 75, or SEQ ID NO: 77 and differ therefrom through addition,
substitution,
insertion or deletion of one or more nucleotides, but still code for
polypeptides having
the desired profile of properties.
CA 02458953 2004-02-27
0000052814
32
The invention also encompasses nucleic acid sequences which comprise so-called
silent mutations or are modified, by comparison with a specifically mentioned
sequence,
in accordance with the codon usage of a specific source or host organism, as
well as
naturally occurring variants such as, far example, splice variants or allelic
variants,
thereof. It likewise relates to sequences which are obtainable by conservative
nucleotide substitutions (i.e. the relevant amino acid is replaced by an amino
acid with
the same charge, size, polarity and/or solubility).
The invention also relates to molecules derived from the specifically
disclosed nucleic
acids through sequence polymorphisms. These genetic polymorphisms may exist
because of the natural variation between individuals within a population.
These natural
variations normally result in a variance of from 1 to 5% in the nucleotide
sequence of
a gene.
The invention additionally encompasses nucleic acid sequences which hybridize
with
or are complementary to the abovementioned coding sequences. These
polynucleotides can be found on screening of genomic or cDNA libraries and,
where
appropriate, be amplified therefrom by means of PCR using suitable primers,
and then,
for example, be isolated with suitable probes. Another possibility is to
transform suitable
microorganisms with polynucleotides or vectors of the invention, multiply the
microorganisms and thus the polynucleotides, and then isolate them. An
additional
possibility is to synthesize polynucleotides of the invention by chemical
routes.
The property of being able to "hybridize" onto polynucleotides means the
ability of a
polynucleotide or oligonucleotide to bind under stringent conditions to an
almost
complementary sequence, while there are no nonspecific bindings between
noncomplementary partners under these conditions. For this purpose, the
sequences
should be 70-100%, preferably 90-100%, complementary. The property of
complementary sequences being able to bind specifically to one another is made
use
of, for example, in the Northern or Southern blot technique or in PCR or RT-
PCR in the
case of primer binding. Oligonucleotides with a length of 30 base pairs or
more are
CA 02458953 2004-02-27
0000052814
33
normally employed for this purpose. Stringent conditions mean, for example, in
the
Northern blot technique the use of a washing solution at 50 - 70°C,
preferably 60 -
65°C, for example 0.1 x SSC buffer with 0.1 % SDS (20x SSC: 3M NaCI,
0.3M Na citrate,
pH 7.0) for eluting nonspecifically hybridized cDNA probes or
oligonucleotides. In this
case, as mentioned above, only nucleic acids with a high degree of
complementarity
remain bound to one another. The setting up of stringent conditions is known
to the
skilled worker and is described, for example, in Ausubel et al., Current
Protocols in
Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6.
A further aspect of the invention relates to antisense nucleic acids. This
comprises a
nucleotide sequence which is complementary to a coding sense nucleic acid. The
antisense nucleic acid may be complementary to the entire coding strand or
only to a
section thereof. In a further embodiment, the antisense nucleic acid molecule
is
antisense to a noncoding region of the coding strand of a nucleotide sequence.
The
term "noncoding region" relates to the sequence sections which are referred to
as 5'-
and 3'-untranslated regions.
An antisense oligonucleotide may be, for example, about 5, 10, 15, 20, 25, 30,
35, 40,
45 or 50 nucleotides long. An antisense nucleic acid of the invention can be
constructed
by chemical synthesis and enzymatic ligation reactions using methods known in
the art.
An antisense nucleic acid can be synthesized chemically, using naturally
occurring
nucleotides or variously modified nucleotides which are configured so that
they increase
the biological stability of the molecules or increase the physical stability
of the duplex
formed between the antisense and sense nucleic acids. Examples which can be
used
are phosphorothioate derivatives and acridine-substituted nucleotides.
Examples of
modified nucleosides which can be used for generating the antisense nucleic
acid are,
inter alia, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil,
hypoxanthine,
xanthine, 4-acetylcytosine, 5-(carboxyhydroxymethyl)uracil, 5-carboxymethyl-
aminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil,
beta-D-
galactosylqueuosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methyl-
inosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-
methylcytosine,
5-methylcytosine, N6-methyladenine, 7-methylguanine, 5-
methylaminomethyluracil,
CA 02458953 2004-02-27
0000052814
34
5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueuosine, 5-methoxycarboxy-
methyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-
oxyacetic
acid (v), wybutoxosine, pseudouracil, queuosine, 2-thiocytosine, 5-methyl-2-
thiouracil,
2-thiouracil, 4-thiouracil, 5-methyluracil, methyl uracil-5-oxyacetate, 3-(3-
amino-
3-carboxypropyl)uracil, (acp3)w and 2,6-diaminopurine. The antisense nucleic
acid may
also be produced biologically by using an expression vector into which a
nucleic acid
has been subcloned in the antisense direction.
The antisense nucleic acid molecules of the invention are normally
administered to a
cell or generated in situ so that they hybridize with the cellular mRNA and/or
a coding
DNA or bind thereto, so that expression of the protein is inhibited for
example by
inhibition of transcription and/or translation.
The antisense molecule can be modified so that it binds specifically to a
receptor or to
an antigen which is expressed on a selected cell surface, for example through
linkage
of the antisense nucleic acid molecule to a peptide or an antibody which binds
to a cell
surface receptor or antigen. The antisense nucleic acid molecule can also be
administered to cells by using the vectors described herein. The vector
constructs
preferred for achieving adequate intracellular concentrations of the antisense
molecules
are those in which the antisense nucleic acid molecule is under the control of
a strong
bacterial, viral or eukaryotic promoter.
In a further embodiment, the antisense nucleic acid molecule of the invention
is an
alpha-anomeric nucleic acid molecule. An alpha-anomeric nucleic acid molecule
forms
specific double-stranded hybrids with complementary RNA, with the strands
running
parallel to one another, in contrast to normal alpha units (Gaultier et al.,
(1987) Nucleic
Acids Res. 15:6625-6641 ). The antisense nucleic acid molecule may
additionally
comprise a 2'-O-methylribonucleotide (Inoue et al., (1987) Nucleic Acids Res.
15:6131-
6148) or a chimeric RNA-DNA analog (Inoue et al. (1987) FEES Lett. 215:327-
330).
The invention also relates to ribozymes. These are catalytic RNA molecules
with
ribonuclease activity which are able to cleave a single-stranded nucleic acid
such as an
CA 02458953 2004-02-27
0000052814
mRNA to which they have a complementary region. It is thus possible to use
ribozymes
(for example hammerhead ribozymes (described in Haselhoff and Gerlach (1988)
Nature 334:585-591 )) for the catalytic cleavage of transcripts of the
invention in order
thereby to inhibit the translation of the corresponding nucleic acid. A
ribozyme with
5 specificity for a coding nucleic acid of the invention can be formed, for
example, an the
basis of a cDNA specifically disclosed herein. For example a derivative of a
tetrahymena-L-i 9 IVS RNA can be constructed, with the nucleotide sequence of
the
active site being complementary to the nucleotide sequence to be cleaved in a
coding
mRNA of the invention. (Compare, for example, US-A-4 987 071 and US-A-5 116
742).
10 Alternatively, mRNA can be used for selecting a catalytic RNA with specific
ribonuclease activity from a pool of RNA molecules (see, for example, Bartel,
D., and
Szostak, J.W. (1993) Science 261:1411-1418).
Gene expression of sequences of the invention can alternatively be inhibited
by
15 targeting nucleotide sequences which are complementary to the regulatory
region of a
nucleotide sequence of the invention (for example to a promoter and/or
enhancer of a
coding sequence) so that there is formation of triple helix structures which
prevent
transcription of the corresponding gene in target cells (Helene, C. (1991)
Anticancer
Drug Res. 6(6) 569-584; Helene, C. et al., (1992) Ann. N. Y. Acad. Sci. 660:27-
36; and
20 Maher., L.J. (1992) Bioassays 14(12):807-815).
Expression constructs and vectors:
The invention additionally relates to expression constructs comprising, under
the
25 genetic control of regulatory nucleic acid sequences, a nucleic acid
sequence coding
for a polypeptide of the invention; and to vectors comprising at least one of
these
expression constructs. Such constructs of the invention preferably comprise a
promoter
5'-upstream from the particular coding sequence, and a terminator sequence
3'-downstream, and, where appropriate, other usual regulatory elements, in
particular
30 each operatively linked to the coding sequence. "Operative linkage" means
the
sequential arrangement of promoter, coding sequence, terminator and, where
appropriate, other regulatory elements in such a way that each of the
regulatory
CA 02458953 2004-02-27
0000052814
36
elements is able to comply with its function as intended for expression of the
coding
sequence. Examples of sequences which can be operatively linked are targeting
sequences and enhancers, polyadenylation signals and the like. Other
regulatory
elements comprise selectable markers, amplification signals, origins of
replication and
the like. Suitable regulatory sequences are described, for example, in
Goeddel, Gene
Expression Technology: Methods in Enzymology 185, Academic Press, San Diego,
CA
(1990).
In addition to the artificial regulatory sequences it is possible for the
natural regulatory
sequence still to be present in front of the actual structural gene. This
natural regulation
can, where appropriate, be switched off by genetic modification, and
expression of the
genes can be increased or decreased. The gene construct can, however, also
have a
simpler structure, that is to say no additional regulatory signals are
inserted in front of
the structural gene, and the natural promoter with its regulation is not
deleted. Instead,
the natural regulatory sequence is mutated so that regulation no longer takes
place, and
gene expression is enhanced or diminished. The nucleic acid sequences may be
present in one or more copies in the gene construct.
Examples of promoters which can be used are: cos, tac, trp, tet, trp-let, Ipp,
lac,
Ipp-lac, laclq, T7, T5, T3, gal, trc, ara, SP6, ~.-PR or ~.-PL. promoter,
which are
advantageously used in Gram-negative bacteria; and the Gram-positive promoters
amy
and SP02, the yeast promoters ADC1, MFa, AC, P-60, CYC1, GAPDH or the plant
promoters CaMV/35S, SSU, OCS, lib4, usp, STLS1, B33, not or the ubiquitin or
phaseolin promoter. The use of inducible promoters is particularly preferred,
such as,
for example, light- and, in particular, temperature-inducible promoters such
as the PAP,
promoter. It is possible in principle for all natural promoters with their
regulatory
sequences to be used. In addition, it is also possible advantageously to use
synthetic
promoters.
Said regulatory sequences are intended to make specific expression of the
nucleic acid
sequences possible. This may mean, for example, depending on the host
organism,
that the gene is expressed or overexpressed only after induction or that it is
immediately
CA 02458953 2004-02-27
0000052814
expressed and/or overexpressed.
37
The regulatory sequences or factors may moreover preferably influence
positively, and
thus increase or reduce, expression. Thus, enhancement of the regulatory
elements
can take place advantageously at the level of transcription by using strong
transcription
signals such as promoters and/or enhancers. However, it is also possible to
enhance
translation by, for example, improving the stability of the mRNA.
An expression cassette is produced by fusing a suitable promoter to a suitable
nucleotide sequence of the invention and to a terminator signal or
polyadenylation
signal. Conventional techniques of recombination and cloning are used for this
purpose,
as described, for example, in T. Maniatis, E.F. Fritsch and J. Sambrook,
Molecular
Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring
Harbor, NY
(1982) and in T.J. Silhavy, M.L. Berman and L.W. Enquist, Experiments with
Gene
Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1984) and in
Ausubel, F.M. et al., Current Protocols in Molecular Biology, Greene
Publishing Assoc.
and Wiley Interscience (1987).
For expression in a suitable host organism, the recombinant nucleic acid
construct or
gene construct is advantageously inserted into a host-specific vector, which
makes
optimal expression of the genes in the host possible. Vectors are welt known
to the
skilled worker and can be found, for example, in "Cloning Vectors" (Pouwels P.
H. et
al., eds, Elsevier, Amsterdam-New York-Oxford, 1985). Vectors also mean not
only
plasmids but also all other vectors known to the skilled worker, such as, for
example,
phages, viruses, such as SV40, CMV, baculovirus and adenovirus, transposons,
IS
elements, phasmids, cosmids, and linear or circular DNA. These vectors may
undergo
autonomous replication in the host organism or chromosomal replication.
Examples of suitable expression vectors which may be mentioned are:
Conventional fusion expression vectors such as pGEX (Pharmacia Biotech lnc;
Smith,
D.B. and Johnson, K.S. (1988) Gene 67:31-40), pMAL (New England Biolabs,
Beverly,
CA 02458953 2004-02-27
0000052814
38
MA) and pRiT 5 (Pharmacia, Piscataway, NJ), with which respectively
glutathione S-
transferase (GST), maltose E-binding protein and protein A are fused to the
recombinant target protein.
Non-fusion protein expression vectors such as pTrc (Amann et ai., (1988) Gene
69:301-
315) and pET 1 i d (Studier et al. Gene Expression Technology: Methods in
Enzymology
185, Academic Press, San Diego, California (1990) 60-89).
Yeast expression vector for expression in the yeast S. cerevisiae, such as
pYepSecl
(Baldari et al., (1987) Embo J. 6:229-234), pMFa (Kurjan and Herskowitz (1982)
Cell
30:933-943), pJRY88 (Schultz et al. (1987) Gene 54:i 13-123) and pYES2
(Invitrogen
Corporation, San Diego, CA). Vectors and methods for constructing vectors
suitable for
the use in other fungi such as filamentous fungi comprise those which are
described in
detail in: van den Hondel, C.A.M.J.J. & Punt, P.J. (1991 ) "Gene transfer
systems and
vector development for filamentous fungi, in: Applied Molecular Genetics of
Fungi, J.F.
Peberdy et al., eds, pp. 1-28, Cambridge University Press: Cambridge.
Baculovirus vectors which are available for expression of proteins in cultured
insect
cells (for example Sf9 cells) comprise the pAc series (Smith et al., (1983)
Mol. Cell Biol.
3:2156-2165) and pVL series (Lucklow and Summers (1989) Virology 170:31-39).
Plant expression vectors such as those described in detail in: Becker, D.,
Kemper, E.,
Schell, J. and Masterson, R. (1992) "New plant binary vectors with selectable
markers
located proximal to the left border", Plant Mol. Biol. 20:1195-1197; and
Bevan, M.W.
(1984) "Binary Agrobacterium vectors for plant transformation", Nucl. Acids
Res.
12:8711-8721.
Mammalian expression vectors such as pCDM8 (Seed, B. (1987) Nature 329:840)
and
pMT2PC (Kaufman et ai. (1987) EMBO J. 6:187-195).
Further suitable expression systems for prokaryotic and eukaryotic cells are
described
in chapters 16 and 17 of Sambrook, J., Fritsch, E.F. and Maniatis, T.,
Molecular cloning:
CA 02458953 2004-02-27
0000052814
39
A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory, Cold Spring
Harbor
Laboratory Press, Coid Spring Harbor, NY, 1989.
Recombinant microorganisms:
The vectors of the invention can be used to produce recombinant microorganisms
which are transformed, for example, with at least one vector of the invention
and can
be employed for producing the pofypeptides of the invention. The recombinant
constructs of the invention described above are advantageously introduced and
expressed in a suitable host system. Cloning and transfection methods familiar
to the
skilled worker, such as, for example, coprecipitation, protoplast fusion,
eiectroporation,
retroviral transfection and the like, are preferably used to bring about
expression of said
nucleic acids in the particular expression system. Suitable systems are
described, for
example, in Current Protocols in Molecular Biology, F. Ausubel et al., eds,
Wlley
Interscience, New York 1997, or Sambrook et al. Molecular Cloning: A
Laboratory
Manual, 2nd edition, Cold Spring Harbor Laboratory, Cold Spring Harbor
Laboratory
Press, Cold Spring Harbor, NY, 1989.
It is also possible according to the invention to produce homologously
recombined
microorganisms. This entails production of a vector which contains at least
one section
of a gene of the invention or a coding sequence, in which, where appropriate,
at least
one amino acid deletion, addition or substitution has been introduced in order
to modify,
for example functionally disrupt, the sequence of the invention (knockout
vector). The
introduced sequence may, for example, also be a homolog from a related
microorganism or be derived from a mammalian, yeast or insect source. The
vector
used for homologous recombination may alternatively be designed so that the
endogenous gene is mutated or otherwise modified during the homologous
recombination but still encodes the functional protein (for example the
regulatory region
located upstream may be modified in such a way that this modifies expression
of the
endogenous protein). The modified section of the TT gene is in the homologous
recombination vector. The construction of suitable vectors for homologous
recombination is, for example, described in Thomas, K.R. and Capecchi, M.R.
(1987)
CA 02458953 2004-02-27
0000052814
Cell 51:503.
Suitable host organisms are in principle all organisms which enable expression
of the
nucleic acids of the invention, their allelic variants, their functional
equivalents or
5 derivatives. Host organisms mean, for example, bacteria, fungi, yeasts,
plant or animal
cells. Preferred organisms are bacteria, such as those of the genera
Escherichia, such
as, for example, Escherichia coli, Streptomyces, Bacillus or Pseudomonas,
eukaryotic
microorganisms such as Saccharomyces cerevisiae, Aspergillus, higher
eukaryotic cells
from animals or plants, for example Sf9 or CHO cells. Preferred organisms are
selected
10 from the genus Ashbya, in particular from A. gossypii strains.
Successfully transformed organisms can be selected through marker genes which
are
likewise present in the vector or in the expression cassette. Examples of such
marker
genes are genes for antibiotic resistance and for enzymes which catalyze a
color-
15 forming reaction which causes staining of the transformed cell. These can
then be
selected by automatic cell sorting. Microorganisms which have been
successfully
transformed with a vector and harbor an appropriate antibiotic resistance gene
(for
example 6418 or hygromycin) can be selected by appropriate antibiotic-
containing
media or nutrient media. Marker proteins present on the surface of the cell
can be used
20 for selection by means of affinity chromatography.
The combination of the host organisms and the vectors appropriate for the
organisms,
such as plasmids, viruses or phages, such as, for example, plasmids with the
RNA
polymerase/promoter system, phages ~, or w or other temperate phages or
transposons
25 and/or other advantageous regulatory sequences forms an expression system.
The
term "expression system" means, for example, the combination of mammalian
cells,
such as CHO cells, and vectors, such as pcDNA3neo vector, which are suitable
for
mammalian cells.
30 If desired, the gene product can also be expressed in transgenic organisms
such as
transgenic animals such as, in particular, mice, sheep or transgenic plants.
CA 02458953 2004-02-27
0000052814
41
Recombinant production of the pol~peptides:
The invention further relates to methods for the recombinant production of a
polypeptide
of the invention or functional, biologically active fragments thereof, wherein
a
polypeptide-producing microorganism is cultured, expression of the
polypeptides is
induced where appropriate, and they are isolated from the culture. The
polypeptides
can also be produced on the industrial scale in this way if desired.
The recombinant microorganism can be cultured and fermented by known methods.
Bacteria can be grown, for example, in TB or LB medium and at a temperature of
20
to 40°C and a pH of from 6 to 9. Details of suitable culturing
conditions are described,
for example, in T. Maniatis, E.F. Fritsch and J. Sambrook, Molecular Cloning:
A
Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
(1982).
If the polypeptides are not secreted into the culture medium, the cells are
then disrupted
and the product is obtained from the lysate by known protein isolation
methods. The
cells may alternatively be disrupted by high-frequency ultrasound, by high
pressure,
such as, for example, in a French pressure cell, by osmolysis, by the action
of
detergents, fytic enzymes or organic solvents, by homogenizers or by a
combination of
a plurality of the methods mentioned.
The polypeptides can be purified by known chromatographic methods such as
molecular sieve chromatography (gel filtration), such as Q-Sepharose
chromatography,
ion exchange chromatography and hydrophobic chromatography, and by other usual
methods such as ultrafiltration, crystallization, salting out, dialysis and
native gel
electrophoresis. Suitable methods are described, for example, in Cooper, T.G.,
Biochemische Arbeitsmethoden, Verlag Walter de Gruyter, Berlin, New York or in
Scopes, R., Protein Purification, Springer Verlag, New York, Heidelberg,
Berlin.
It is particularly advantageous for isolation of the recombinant protein to
use vector
systems or oligonucleotides which extend the cDNA by particular nucleotide
sequences
and thus code for modified polypeptides or fusion proteins which serve, for
example,
CA 02458953 2004-02-27
0000052814
42
for simpler purification. Suitable modifications of this type are, for
example, so-called
tags which act as anchors, such as, for example, the modification known as
hexa-
histidine anchor, or epitopes which can be recognized as antigens by
antibodies
(described, for example, in Harlow, E. and Lane, D., 1988, Antibodies: A
Laboratory
Manual. Cold Spring Harbor (N.Y.) Press). These anchors can be used to attach
the
proteins to a solid support, such as, for example, a polymer matrix, which
can, for
example, be packed into a chromatography column, or can be used on a
microtiter plate
or another support.
These anchors can at the same time also be used for recognition of the
proteins. It is
also possible to use for recognition of the proteins conventional markers such
as
fluorescent dyes, enzyme markers which form a detectable reaction product
after
reaction with a substrate, or radioactive labels, alone or in combination with
the anchors
for derivatizing the proteins.
The invention additionally relates to a method for the microbiological
production of
vitamin B2 and/or precursors and/or derivatives thereof.
If the conversion is carried out with a recombinant microorganism, the
microorganisms
are preferably initially cultured in the presence of oxygen and in a complex
medium,
such as, for example, at a culturing temperature of about 20°C or more,
and at a pH of
about 6 to 9 until an adequate cell density is reached. In order to be able to
control the
reaction better, it is preferred to use an inducible promoter. The culturing
is continued
in the presence of oxygen for 12 hours to 3 days after induction of vitamin B2
production.
The following nonlimiting examples describe specific embodiments of the
invention.
CA 02458953 2004-02-27
0000052814
General experimental details
a) General cloning methods
43
The cloning steps carried out for the purpose of the present invention, such
as, for
example, restriction cleavages, agarose gel electrophoresis, purification of
DNA
fragments, transfer of nucleic acids to nitrocellulose and nylon membranes,
linkage of
DNA fragments, transformation of E. coli cells, culturing of bacteria,
replication of
phages and sequence analysis of recombinant DNA, were carried out as described
by
Sambrook et al. (1989) loc. cit.
b) Polymerase chain reaction (PCR)
PCR was carried out in accordance with a standard protocol with the following
standard
mixture:
8 NI of dNTP mix (200 NM), 10 Nl of Taq polymerase buffer (10 x) without
MgCl2, 8 NI
of MgCl2 (25 mM), 1 NI of each primer (0.1 ,uM), 1 ,u1 of DNA to be amplified,
2.5 U of
Taq polymerase (MBI Fermentas, Vilnius, Lithuania), demineralized water ad
100,u1.
c) Culturing of E. coli
The recombinant E. coli DHSa strain was cultured in LB-amp medium (tryptone
10.0 g,
NaCI 5.0 g, yeast extract 5.0 g, ampicillin 100 g/ml, H20 ad 1000 ml) at
37°C. For this
purpose, in each case one colony was transferred, using an inoculating loop,
from an
agar plate into 5 ml of LB-amp. After culturing for about 18 hours shaking at
a frequency
of 220 rpm, 400 ml of medium in a 2 I flask were inoculated with 4 ml of
culture.
Induction of P450 expression in E. coli took place after the fJD578 reached a
value
between 0.8 and 1.0 by heat-shock induction at 42°C for three to four
hours.
CA 02458953 2004-02-27
0000052814
44
d) Purification of the required product from the culture
The required product can be isolated from the microorganism or from the
culture
supernatant by various methods known in the art. If the required product is
not secreted
by the cells, the cells can be harvested from the culture by slow
centrifugation, and the
cells can be lysed by standard techniques such as mechanical force or
ultrasound
treatment.
The cell detritus is removed by centrifugation, and the supernatant fraction
which
contains the soluble proteins is obtained for further purification of the
required
compound. If the product is secreted by the cells, the cells are removed from
the culture
by slow centrifugation, and the supernatant fraction is retained for further
purification.
The supernatant fraction from the two purification methods is subjected to a
chromatography with a suitable resin, with the required molecule either being
retained
on the chromatography resin, or passing through the latter, with greater
selectivity than
the impurities. These chromatography steps can be repeated if necessary, using
the
same or different chromatography resins. The skilled worker is proficient in
the selection
of suitable chromatography resins and their most effective use for a
particular molecule
to be purified. The purified product can be concentrated by filtration or
ultrafiltration and
be stored at a temperature at which the stability of the product is maximal.
Many purification methods are known in the art. These purification techniques
are
described, for example, in Bailey, J.E. & Ollis, D.F. Biochemical Engineering
Fundamentals, McGraw-Hill: New York (1986).
The identity and purity of the isolated compounds can be determined by prior
art
techniques. These comprise high performance liquid chromatography (HPLC),
spectroscopic methods, staining methods, thin layer chromatography, NIBS,
enzyme
assay or microbiological assays. These analytical methods are summarized in:
Patek
et al. (1994) Appl. Environ. Microbiol. 60:133-~ 40; Maiatcnova et ai. (~ X06)
Biotekhnologiya 11 27-32; and Schmidt et al. (1998) Bioprocess Engineer. 19:67-
70.
CA 02458953 2004-02-27
0000052814
Ullmann's Encyclopedia of Industrial Chemistry (1996j Vol. A27, VCH: Weinheim,
pp.89-90, pp. 521-540, pp. 540-547, pp. 559-566, pp. 575-581 and pp. 581-587;
Michal, G (1999) Biochemical Pathways: An Atlas of Biochemistry and Molecular
Biology, John Wiley and Sons; Fallon, A. et al. (1987) Applications of HPLC in
5 Biochemistry in: Laboratory Techniques in Biochemistry and Molecular
Biology, Vol. 17.
e) General description of the MPSS method, clone identification and homology
search
The MPSS technology (Massive Parallel Signature Sequencing as described by
10 Brenner et al, Nat. Biotechnol. (2000) 18, 630-634; to which express
reference is
hereby made) was applied to the filamentous, vitamin B2-producing fungus
Ashbya
gossypii. It is possible with the aid of this technology to obtain with high
accuracy
quantitative information about the level of expression of a large number of
genes in a
eukaryotic organism. This entails the mRNA of the organism being isolated at a
15 particular time X, being transcribed with the aid of the enzyme reverse
transcriptase into
cDNA and then being cloned into special vectors which have a specific tag
sequence.
The number of vectors with a different tag sequence is chosen to be high
enough
(about 1000 times higher) for statistically each DNA molecule to be cloned
into a vector
which is unique through its tag sequence.
The vector inserts are then cut out together with the tag. The DNA molecules
obtained
in this way are then incubated with microbeads which possess the molecular
counterparts of the tags mentioned. After incubation it can be assumed that
each
microbead is loaded via the specific tags or counterparts with only one type
of DNA
molecules. The beads are transferred into a special flow cell and fixed there
so that it
is possible to carry out a mass sequencing of all the beads with the aid of an
adapted
sequencing method based on fluorescent dyes and with the aid of a digital
color
camera. Although numerically high analysis is possible with this method, it is
limited by
a reading width of about 16 to 20 base pairs. The sequence length is, however,
sufficient to make an unambiguous correlation between sequence and gene
possible
for most organisms (20 by have a sequence frequency of -1 x 10'2; compared
with this,
the human genome has a size of "only" --3 x 109 bp).
CA 02458953 2004-02-27
0000052814
46
The data obtained in this way are analyzed by counting the number of identical
sequences and comparing their frequencies with one another. Frequently
occurring
sequences reflect a high level of expression, and sequences which occur singly
a low
level of expression. If the mRNA was isolated at two different time points (X
and Y), it
is possible to construct a chronological expression pattern of individual
genes.
Example 1:
Isolation of mRNA from Ashbya gossypii
Ashbya gossypii was cultured in a manner known per se (nutrient medium: 27.5
g/1
yeast extract; 0.5 g/1 magnesium sulfate; 50 m1/1 soybean oil; pH 7). Ashbya
gossypii
mycelium samples are taken at various times during the fermentation (24h, 48h
and
72h), and the corresponding RNA or mRNA is isolated therefrom according to the
protocol of Sambrook et al. (1989).
Example 2:
Application of the MPSS
Isolated mRNA from A, gossypii is then subjected to an MPSS analysis as
explained
above.
The sets of data found are subjected to a statistical analysis and categorized
according
to the significance of the differences in expression. This entailed
examination both in
relation to an increase and a reduction in the level of expression. A division
is made by
classifying the change in expression into a) monotonic change, b) change after
24 h,
and c) change after 48 h.
The 20 by sequences representing a change in expression and found by MPSS
analysis are then used as probes and hybridized with a gene library from
Ashbya
gossypii, with an average insert size of about 1 kb. The hybridization
temperature in this
case was in the range from about 30 to 57°C.
CA 02458953 2004-02-27
0000052814
47
Example 3:
Construction of a genomic gene library from Ashbya gossypii
To construct a genomic DNA library, initially chromosomal DNA is isolated by
the
method of Wright and Philippsen (Gene (1991) 109: 99-105) and Mohr (1995, PhD
Thesis, Biozentrum Universitat Basel, Switzerland).
The DNA is partially digested with Sau3A. For this purpose, 6 Ng of genomic
DNA are
subjected to a Sau3A digestion with various amounts of enzyme (0.1 to 1 U).
The
fragments are fractionated in a sucrose density gradient. The 1 kb region is
isolated
and subjected to a QiaEx extraction. The largest fragments are ligated to the
BamHl-cut
vector pRS416 (Sikorski and Hieter, Genetics (1988) 122; 19-27) (90 ng of
BamHl-cut,
dephosphorylated vector; 198 ng of insert DNA; 5 ml of water; 2 ,u1 of 10x
ligatiori
buffer; 1 U ligase). This ligation mixture is used to transform the E. coli
laboratory strain
XL-1 blue, and the resulting clones are employed for identifying the insert.
Example 4:
Preparation of an ordered gene library (CHIP technology)
About 25,000 colonies of the Ashbya gossypii gene library (this corresponds to
approximately a 3-fold coverage of the genome) were transferred in an ordered
manner
to a nylon membrane and then treated by the method of colony hybridization as
described in Sambrook et al. (1989). Oligonucleotides were synthesized from
the 20 by
sequences found by MPSS analysis and were radiolabeled with 32P. In each case
10
labeled oligonucleotides with a similar melting point are combined and
hybridized
together with the nylon membranes. After hybridization and washing steps,
positive
clones are identified by autoradiography and analyzed directly by PCR
sequencing.
In this way, a clone which harbors an insert with the internal name "Oligo 28"
and has
significant homology with the MIPS tag "Yta7" or TBP7 from S. cerevisiae was
identified. The insert has a nucleic acid sequence as shown in SEQ ID NO: 1.
CA 02458953 2004-02-27
0000052814
48
In this way, a further clone which harbors an insert with the internal name
"Oligo 45" and
has significant homology with the MIPS tag "p39" or "Tif34" from S. cerevisiae
was
identified. The insert has a nucleic acid sequence as shown in SEQ ID NO: 6.
In this way, a further clone which harbors an insert with the internal name
"Oligo 85" and
has significant homology with the MIPS tag "Rpl35a" from S. cerevisiae was
identified.
The insert has a nucleic acid sequence as shown in SEQ ID NO: 12.
In this way, a further clone which harbors an insert with the internal name
"Oligo 133"
and has significant homology with the MIPS tag "Nopl3" from S. cerevisiae was
identified. The insert has a nucleic acid sequence as shown in SEQ ID NO: 17.
In this way, a further clone which harbors an insert with the internal name
"Oligo 172"
and has significant homology with the MIPS tag "SuaS" from S. cerevisiae was
identified. The insert has a nucleic acid sequence as shown in SEQ 1D NO: 21.
In this way, a further clone which harbors an insert with the internal name
"Oligo 63" and
has significant homology with the MIPS tag "Rps25a" from S. cerevisiae was
identified.
The insert has a nucleic acid sequence as shown in SEQ !D NO: 26.
In this way, a further clone which harbors an insert with the internal name
"Oligo 132"
and has significant homology with the MIPS tag "Nic96" from S. cerevisiae was
identified. The insert has a nucleic acid sequence as shown in SEQ ID NO: 31.
in this way, a further clone which harbors an insert with the internal name
"Oligo 174"
and has significant homology with the MIPS tag "Ahc1" from S. cerevisiae was
identified. The insert has a nucleic acid sequence as shown in SEQ ID NO: 38.
In this way, a further clone which harbors an insert with the internal name
"Oligo 51" and
has significant homology with the MIPS tag "Rok1" from S. cerevisiae was
identified.
The insert has a nucleic acid sequence as shown in SEQ ID NO: 42.
CA 02458953 2004-02-27
0000052814
49
In this way, a further clone which harbors an insert with the internal name
"Oligo 30" and
has significant homology with the MIPS tag "Rpa34" from S. cerevisiae was
identified.
The insert has a nucleic acid sequence as shown in SEQ ID NO: 48.
In this way, a further clone which harbors an insert with the internal name
"Oligo 124"
and has significant homology with the MIPS tag "Sub2" from S. cerevisiae was
identified. The insert has a nucleic acid sequence as shown in SEQ ID NO: 53.
In this way, a further clone which harbors an insert with the internal name
"Oligo 139"
and has significant homology with the MIPS tag "DCP1" from S. cerevisiae was
identified. The insert has a nucleic acid sequence as shown in SEQ ID NO: 58.
In this way, a further clone which harbors an insert with the internal name
"Oligo 144"
and has significant homology with the MiPS tag "PRT1" from S. cerevisiae was
identified. The insert has a nucleic acid sequence as shown in SEQ ID NO: 63.
In this way, a further clone which harbors an insert with the internal name
"Oligo 168"
and has significant homology with the MIPS tag "Rrp9" from S. cerevisiae was
identified. The insert has a nucleic acid sequence as shown in SEQ ID NO: 67.
In this way, a further clone which harbors an insert with the internal name
"Oligo 160"
and has significant homology with the MIPS tag "RplBb" from S. cerevisiae was
identified. The insert has a nucleic acid sequence as shown in SEQ ID NO: 72.
In this way, a further clone which harbors an insert with the internal name
"Oligo 18"
was identified. The insert has a nucleic acid sequence as shown in SEQ ID NO:
75
(complementary strand with SEQ ID NO: 74). A potential ORF is located between
positions 958 and 1272 shown in SEQ ID NO: 75.
CA 02458953 2004-02-27
0000052814
Example 5:
Analysis of the sequence data by means of a BLASTX search
An analysis of the resulting nucleic acid sequences, i.e. their functional
assignment to
5 a functional amino acid sequence took place by means of a BLASTX search in
sequence databases. Almost all of the amino acid sequence homologies found
related
to Saccharomyces cerevisiae (baker's yeast). Since this organism had already
been
completely sequenced, more detailed information about these genes could be
referred
to under:
10 http~//www mips 4sf de/proLyeast/search/code search.htm .
The followindhomologies with amino acid fragments from S. cerevisiae were
found in
this wav The corresponding alignments are shown in figures 1 to 15.
15 a) Amino acid sequences (corresponding to nucleotides 3 to 374 and 373 to
1479)
derived from SEQ ID N0:1 have significant sequence homologies with a 26 S
proteasome subunit or the TAT-binding homolog 7 (TBP7) from S. cerevisiae. A
corresponding alignment is shown in figure 1. SEO ID NO: 2 and SEQ ID NO: 3 in
each
case show an amino acid part-sequence of the invention.
The A. gossypii nucleic acid sequence found could thus be assigned the
function of a
26 S proteasome subunit or a TAT-binding homolog 7 (TBP7).
b) An amino acid sequence derived from SEQ ID NO: 6 (cf. SEQ ID NO: 7;
corresponding to nucleotides 5 to 463 in SEO ID NO: 6) has significant
sequence
homology with a translation initiation factor (EIF3) subunit (P39) from S.
cerevisiae. A
corresponding alignment is shown in figure 2. SEQ ID NO: 8 and SEA ID NO: 9 in
each
case show a further amino acid part-sequence of the invention.
The A. gossypii nucleic acid sequence found could thus be assigned the
function of a
translation initiation factor subunit.
CA 02458953 2004-02-27
0000052814
51
c) The amino acid sequence derived from the coding strand to SEQ ID NO: 12 has
significant sequence homology with a ribosomal protein from S. cerevisiae. An
amino
acid part-sequence derived therefrom (corresponding to nucleotides 469 to 825
from
SEQ ID NO: 12) with a part-sequence of the S. cerevisiae protein is depicted
in figure 3.
5~ SEQ ID NO: 13 shows an N-terminally extended amino acid part-sequence.
The A. gossypii nucleic acid sequence found could thus be assigned the
function of a
ribosomal protein.
d) The amino acid sequence derived from the corresponding complementary strand
to
SEQ ID NO: 17 has significant sequence homology with a nucleolar protein from
S. cerevisiae. An amino acid part-sequence derived therefrom (corresponding to
nucleotides 114 to 1 from SEQ ID NO: 17) with a part-sequence of the S.
cerevisiae
protein is depicted in figure 4. SEQ ID NO: 18 shows an N-terminally extended
amino
acid part-sequence.
The A. gossypii nucleic acid sequence found could thus be assigned the
function of a
nucleolar protein.
e) The amino acid sequence derived from the coding strand to SEQ ID NO: 21 has
significant sequence homology with a translation initiation protein from S.
cerevisiae.
An amino acid part-sequence derived therefrom (corresponding to nucleotides 2
to 349
from SEQ 1D NO: 21) with a part-sequence of the S. cerevisiae protein is
depicted in
figure 5A. A further amino acid part-sequence derived therefrom (corresponding
to
nucleotides 336 to 947 from SE4 ID NO: 21 ) with a part-sequence of the S.
cerevisiae
protein is depicted in figure 5B. SEQ ID NO: 22 and SEQ ID NO: 23 in each case
show
an N-terminally extended amino acid part-sequence.
The A. gossypii nucleic acid sequence found could thus be assigned the
function of a
translation initiation protein.
f) The amino acid sequence derived from the corresponding complementary strand
to
CA 02458953 2004-02-27
0000052814
52
SEQ ID NO: 26 has significant sequence homology with a precursor of ribosomal
protein S 31 from S. cerevisiae. An amino acid part-sequence derived therefrom
(corresponding to nucleotides 609 to 562 from SEQ ID NO: 26) with a part-
sequence
of the S. cerevisiae protein is depicted in figure 6A. Another amino acid part-
sequence
derived therefrom (corresponding to nucleotides 556 to 401 from SEQ ID NO: 26)
with
a part-sequence of the S. cerevisiae protein is depicted in figure 6B. SEQ ID
NO: 27
and SEQ ID NO: 28 in each case show an N-terminally extended amino acid part-
sequence.
The A. gossypii nucleic acid sequence found could thus be assigned the
function of a
precursor of ribosomal protein S 31.
g) An amino acid sequence derived from SEQ ID NO: 31 (cf. SEQ ID NO: 32,
corresponding to nucleotides 108 to 764 in SEQ ID NO: 31) has significant
sequence
homology with a cell nuclear pore protein from S. cerevisiae. Figure 7 shows a
corresponding alignment. The sequences SEQ ID NO: 33 to SEQ ID NO: 35 show
further amino acid part-sequences of the invention.
The A, gossypii nucleic acid sequence found could thus be assigned the
function of a
cell nuclear pore protein.
h) The amino acid sequence derived from the corresponding complementary strand
to
SEQ ID NO: 38 has significant sequence homology with a constituent of the ADH-
histone acetyltransferase complex from S. cerevisiae. An amino acid part-
sequence
derived therefrom (corresponding to nucleotides 174 to 1 from SEQ ID NO: 38)
with a
part-sequence of the S. cerevisiae protein is depicted in figure 8. SEQ ID NO:
39 shows
an N-terminally extended amino acid part-sequence.
The A. gossypii nucleic acid sequence found could thus be assigned the
function of a
constituent of the ADH-histone acetyltransferase complex.
i) The amino acid sequence derived from the corresponding complementary strand
to
CA 02458953 2004-02-27
0000052814
53
SEQ ID NO: 42 has significant sequence homology with an S. cerevisiae RNA
helicase
which is involved in RNA processing. An amino acid part-sequence derived
therefrom
(corresponding to nucleotides 1086 to 1012 from SEQ ID NO: 42) with a part-
sequence
of the S. cerevisiae enzyme is depicted in figure 9A. A second amino acid part-
sequence derived therefrom (corresponding to nucleotides 1022 to 915 from SEQ
ID
NO: 42) with a part-sequence of the S. cerevisiae enzyme is depicted in figure
9B. A
further amino acid part-sequence derived therefrom (corresponding to
nucleotides 925
to 689 from SEQ ID NO: 42) with a part-sequence of the S. cerevisiae enzyme is
depicted in figure 9C. SEQ ID NO: 43, SEQ ID NO: 44 and SEQ ID NO: 45 in each
case
show an N-terminally extended amino acid part-sequence.
The A. gossypii nucleic acid sequence found could thus be assigned the
function of an
RNA helicase which is involved in RNA processing.
k) The amino acid sequence derived from the coding strand to SEQ ID NO: 48 has
significant sequence homology with the nonessential constituent of RNA poll
from
S. cerevisiae. An amino acid part-sequence derived therefrom (corresponding to
nucleotides 1 to 102 from SEQ ID NO: 48) with a part-sequence of the S.
cerevisiae
protein is depicted in figure 10A. A further amino acid part-sequence derived
therefrom
(corresponding to nucleotides 122 to 400 from SEQ ID NO: 48) with a part-
sequence
of the S. cerevisiae protein is depicted in figure 10B. SEQ ID NO: 49 and SE4
ID
NO: 50 in each case show an amino acid part-sequence of the invention.
The A. gossypii nucleic acid sequence found could thus be assigned a function
of the
nonessential constituent of RNA poll.
I) The amino acid sequence derived from the coding strand to SEQ ID NO: 53 has
significant sequence homology with an RNA helicase from S. cerevisiae. An
amino acid
part-sequence derived therefrom (corresponding to nucleotides 2 to 148 from
SEQ ID NO: 53) with a part-sequence of the S. cerevisiae enzyme is depicted in
figure 11 A. A further amino acid part-sequence derived therefrom
(corresponding to
nucleotides 150 to 185 from SEQ ID NO: 53) with a part-sequence of the S.
cerevisiae
CA 02458953 2004-02-27
0000052814
54
enzyme is depicted in figure 11 B. SEQ ID NO: 54 and SEQ ID NO: 55 in each
case
show an N-terminal extended amino acid part-sequence.
The A. gossypii nucleic acid sequence found could thus be assigned the
function of an
RNA helicase.
m) The amino acid sequence derived from the coding strand to SEQ ID NO: 58 has
significant sequence homology with an mRNA decapping enzyme from S.
cerevisiae.
An amino acid part-sequence derived therefrom (corresponding to nucleotides 2
to 82
from SEQ ID NO: 58) with a part-sequence of the S. cerevisiae enzyme is
depicted in
figure 12. SEQ ID NO: 5.9 shows an N-terminally extended amino acid part-
sequence.
The A. gossypii nucleic acid sequence found could thus be assigned the
function of an
mRNA decapping enzyme.
n) The amino acid sequence derived from the coding strand to SEQ ID NO: 63 has
significant sequence hornology with an S. cerevisiae subunit to translation
initiation
factor eIF3. An amino acid part-sequence derived--therefrom (corre-sponding fo
nucleotides 21 to 695 from SEQ ID NO: 63) with a part-sequence of the S.
cerevisiae
protein is depicted in figure 13. SEQ ID NO: 64 shows an N-terminally extended
amino
acid part-sequence.
The A. gossypii nucleic acid sequence found could thus be assigned the
function of a
subunit of translation initiation factor eIF3.
o) The amino acid sequence derived from the coding strand to SEQ ID NO: 67 has
significant sequence homology with an S. cerevisiae U3 small nucleolar
ribonucleoprotein-associated protein which is involved in preribosomal RNA
processing.
An amino acid part-sequence derived therefrom (corresponding to nucleotides 1
to 111
from SEQ ID NO: 67) with a part-sequence of the S. cerevisiae protein is
depicted in
figure 14A. A further amino acid part-sequence derived therefrom
(corresponding to
nucleotides 144 to 887 from SEQ ID NO: 67) with a part-sequence of the S.
cerevisiae
CA 02458953 2004-02-27
0000052814
protein is depicted in figure 14B. SEQ ID NO: 68 and SEQ ID NO: 69 in each
test show
an N-terminally extended amino acid part-sequence.
The A. gossypii nucleic acid sequence found could thus be assigned the
function of a
5 U3 small nucleolar ribonucleoprotein-associated protein which is involved in
preribosomal RNA processing.
p) The amino acid sequence derived from the corresponding complementary strand
to
SEQ ID N0:72 has significant sequence homology with a ribosomal protein
10 (L7a.e.B/large 60 S subunit) from S. cerevisiae. An amino acid part-
sequence derived
therefrom (corresponding to nucleotides 508 to 176 from SEQ ID NO: 72) with a
part-
sequence of the S. cerevisiae protein is depicted in figure 15. SEQ ID NO: 73
shows
an N-terminally extended amino acid part-sequence.
15 The A. gossypii nucleic acid sequence found could thus be assigned the
function of the
ribosomal protein (L7a.e.B/large 60 S subunit).
Example 6:
Isolation of full-len4th DNA
a) Construction of an A. gossypii gene library
High molecular weight cellular complete DNA from A. gossypii was prepared from
a
2-day old 100 ml culture grown in a liquid MA2 medium (10 g of glucose, 10 g
of
peptone, 1 g of yeast extract, 0.3 g of myo-inositol ad 1000 ml). The mycelium
was
filtered off, washed twice with distilled H20, suspended in 10 ml of 1 M
sorbitol, 20 mM
EDTA, containing 20 mg of zymolyase 20T, and incubated at 27°C, shaking
gently, for
to 60 min. The protoplast suspension was adjusted to 50 mM Tris-HCI, pH 7.5,
150 mM NaCI, 100 mM EDTA and 0.5% strength sodium dodecyl sulfate (SDS) and
30 incubated at 65°C for 20 min. After two extractions with
phenol/chloroform (1:1 vol/vol),
the DNA was precipitated with isopropanol, suspended in TE buffer, treated
with
RNase, reprecipitated with isopropanol and resuspended in TE.
CA 02458953 2004-02-27
0000052814
56
An A. gossypii cosmid gene library was produced by binding genomic DNA which
had
been selected according to size and partially digested with Sau3A to the
dephosphorylated arms of the cosmid vector Super-Cos1 (Stratagene). The Super-
Cos1 vector was opened between the two cos sites by digestion with Xbal and
dephosphorylation with calf intestinal alkaline phosphatase (Boehringer),
followed by
opening of the cloning site with BamHl. The ligations were carried out in 20
,u1,
containing 2.5,ug of partially digested chromosomal DNA, 1 Ng of Super-Cost
vector
arms, 40 mM Tris-HCI, pH 7.5, 10 mM MgCl2, 1 mM dithiothreitol, 0.5 mM ATP and
2 Weiss units of T4-DNA lipase (Boehringer) at 15°C overnight. The
ligation products
were packaged in vitro using the extracts and the protocol of Stratagene
(Gigapack II
Packaging Extract). The packaged material was used to infect E. coli NM554
(recAl3,
araD139, a(ara,leu)7696, a(~ac)17A, galU, galK, hsrR, rps(st~'), mcrA, mcrB)
and
distributed on LB plates containing ampicillin (50,ug/m1). Transformants
containing an
A. gossypii insert with an average length of 30-45 kb were obtained.
b) Storage and screening of the cosmid gene library
In total, 4 x 104 fresh single colonies were inoculated singly into wells of
96-well
microtiter plates (Falcon, No. 3072) in 100 ,u1 of LB medium, supplemented
with the
freezing medium (36 mM K2HP04/13.2 mM KH2P04, 1.7 mM sodium citrate, 0.4 mM
MgS04, 6.8 mM (NH4)2S04, 4.4% (w/v) glycerol) and ampicillin 1,50 Ng/ml),
allowed to
grow at 37 °C overnight with shaking, and frozen at -70°C. The
plates were rapidly
thawed and then duplicated in fresh medium using a 96-well replicator which
had been
sterilized in an ethanol bath with subsequent evaporation of the ethanol on a
hot plate.
Before the freezing and after the thawing (before any other measures) the
plates were
briefly shaken in a microtiter shaker (Infors) in order to ensure a
homogeneous
suspension of cells. A robotic system (Bio-Robotics) with which it is possible
to transfer
small amounts of liquid from 96 wells of a microtiter plate to nylon membrane
(GeneScreen Plus, New England Nuclear) was used to place single clones on
nylon
membranes. After the culture had been transferred from the 96-well microtiter
plates
(1920 clones), the membranes were placed on the surface of LB agar with
ampicillin
CA 02458953 2004-02-27
0000052814
57
(50,ug/ml) in 22 x 22 cm culture dishes (Nunc) and incubated at 37°C
overnight. Before
cell confluence was reached, the membranes were processed as described by
Herrmann, B. G., Barlow, D. P. and Lehrach, H. (1987) in Cell 48, pp. 813-825,
including as additional treatment after the first denaturation step a 5-minute
exposure
of the filters to vapors on a pad impregnated with denaturation solution on a
boiling
water bath.
The random hexamer primer method (Feinberg, A. P, and Vogelstein, B. (1983),
Anal.
Biochem. 132, pp. 6-13) was used to label double-stranded probes by uptake of
[alpha-
32P]dCTP with high specific activity. The membranes were prehybridized and
hybridized
at 42°C in 50% (vol/vol) formamide, 600 mM sodium phosphate, pH 7.2, 1
mM EDTA,
10% dextran sulfate, 1 % SDS, and 10x Denhardt's solution, containing salmon
sperm
DNA (50 Ng/ml) with 32P-labeled probes (0.5-1 x 1 Oscpm/ml) for 6 to 12 h.
Typically,
. washing steps were carried out at 55 to 65°C in 13 to 30 mM NaCI, 1.5
to 3 mM sodium
citrate, pH 6.3, 0.1 % SDS for about 1 h and the filters were autoradiographed
at -70°C
with Kodak intensifying screens for 12 to 24 h. To date, individual membranes
have
been reused successfully more than 20 times. Between the autoradiographies,
the
filters were stripped by incubation at 95°C in 2 mM Tris-HCI, pH 8.0,
0.2 mM EDTA,
0.1 % SDS for 2 x 20 min.
c) Recovery of positive colonies from the stored gene library
Frozen bacterial cultures in microtiter wells were scraped out using sterile
disposable
lancets, and the material was streaked onto LB agar Petri dishes containing
ampicillin
(50,ug/ml). Single colonies were then used to inoculate liquid cultures to
produce DNA
by the alkaline lysis method (Birnboim, H. C. and Doly, J. (1979), Nucleic
Acids Res. 7,
pp. 1513-1523).
d) Full-length DNA
It was possible as described above to identify clones which harbor an insert
with the
appropriate complete sequence. These clones have the internal names given
below:
CA 02458953 2004-02-27
0000052814
58
"Oligo 28~'. The insert comprising the complete sequence has a nucleic acid
sequence
as shown in SEQ ID NO: 4.
"Oligo 45~'. The insert comprising the complete sequence has a nucleic acid
sequence
as shown in SEQ ID NO: 10.
"Oligo 85~'. The insert comprising the complete sequence has a nucleic acid
sequence
as shown in SEQ ID NO: 14. The protein encoded thereby preferably comprises at
least
one of the amino acid sequences shown in SEQ ID NO: 15 and 16.
"Oligo 133v". The insert comprising the complete sequence has a nucleic acid
sequence as shown in SEQ ID NO: 19.
"Oligo 172v". The insert comprising the complete sequence has a nucleic acid
sequence as shown in SEQ ID NO: 24.
"Oligo 63v". The insert comprising the complete sequence has a nucleic acid
sequence
as shown in SEQ ID NO: 29.
"Oligo 132v". The insert comprising the complete sequence has a nucleic acid
sequence as shown in SEQ ID NO: 36.
"Oligo 174'. The insert comprising the complete sequence has a nucleic acid
sequence as shown in SEQ ID NO: 40.
"Oligo 51 ~'. The insert comprising the complete sequence has a nucleic acid
sequence
as shown in SEQ ID NO: 46.
"Oligo 30~'. The insert comprising the complete sequence has a nucleic acid
sequence
as shown in SEQ ID NO: 51.
CA 02458953 2004-02-27
0000052814
59
"Oligo 124v". The insert comprising the complete sequence has a nucleic acid
sequence as shown in SEQ ID NO: 56.
"Oligo 139v". The insert comprising the complete sequence has a nucleic acid
sequence as shown in SEQ ID NO: 60. The protein encoded thereby preferably
comprises at least one of the amino acid sequences as shown in SEQ ID NO: 61
and
62.
"Oligo 144v". The insert comprising the complete sequence has a nucleic acid
sequence as shown in SEQ ID NO: 65.
"Oligo 168v". The insert comprising the complete -sequence has a nucleic acid
sequence as shown in SEQ ID NO: 70.
"Oligo 18v". The insert comprising the complete sequence has a nucleic acid
sequence
as shown in SEQ ID NO: 77.
Example 7:
Detection of a modulating effect of Oligo 18 on vitamin B2 production
In order to test whether integration of DNA in the vicinity of the potential
reading frame
of oligo 18 has adverse effects on riboflavin synthesis, a DNA fragment was
integrated
by means of homologous recombination into the genome of the Ashbya gossypii
strain
used (Ashbya TEF promoter + 6418 resistance gene - cf. figure 1 ).
Transformation took
place by electoporation in a manner known per se. Positive transformants were
identified by PCR using the primer pair shown in figure 1. One transformant in
which
specific integration into this locus was detectable was investigated for
vitamin B2
production both in shaken flask experiments and in laboratory fermentations.
It emerged
that integration of this DNA fragment brought about an increase (of about 3%)
in
riboflavin production. The information in the TEF-6418 construct cannot have
been the
reason. It is therefore concluded that there is a position effect.
CA 02458953 2004-02-27
0000052814
Shaken flask experiments for riboflavin determination:
10 ml of preculture medium (9.5 ml [9.5 g] of medium + 0.5 ml soybean oil) in
a 100-ml
2-baffle Erlenmeyer flask are inoculated with 0.5 ml of a glycerol culture or
with about
5 one inoculating loop of mycelium from a 5-day old, well grown SP agar plate,
and
shaken at 180 rpm (cabinet shaker, excursion 2.5 cm) and 28°C for 40
hours.
1.1 ml of this culture are used to inoculate 25.7 ml of main culture medium
(21.2 ml
[21.2 g] of medium, 1 ml of urea [10 g/45 ml] + 3.5 ml [3.2 g] of soybean oil,
final
10 volume = 26.8 ml, of which 4.4 ml compensates for evaporation during
shaking without
humidification) or 21.8 ml of main culture medium (17.3 ml [17.3 g] of medium,
1 ml of
urea [10 g/45 ml] + 3.5 ml [3.2 g] of soybean oil, final volume = 22.9 ml, of
which 0.5 ml
compensates for evaporation during shaking in an environment without
artificial
humidification) in a 250 ml Erlenmeyer flask and shaken at 220 rpm (industrial
shaker,
15 excursion 5 cm) or 300 rpm (cabinet shaker, excursion 2.5 cm) and
28°C for 5 days.
0.5 ml of the main culture is vigorously shaken with 4.5 ml [5 g] of a 40%
strength
nicotinamide solution (dilution factor 10) or 0.25 ml with 4.75 ml [5.27 g] of
a 40%
strength nicotinamide solution (dilution factor 20) in a test tube and
incubated in a water
20 bath at 70°C for about 2 x 20 minutes (cells lyzed, shaking in
between). After cooling,
40 ~I are put in a macro dispersible cuvette, mixed with 3 ml of deionized
water and
measured as quickly as possible in a photometer, because vitamin B2 decomposes
very
rapidly. This entails measurement of the extinctions at 402, 446 and 550 nm
and
calculation as follows:
V=(W1 -W2xC+W3x(C-1)):(B1 -B2xC)
with
B1 - 17.36 [constant]
B2 - 31.15 [constant]
K - cuvette volume in ml (standard = 3.04 mll
P _ sample volume in ml [standard = 0.04 mll
F - dilution factor [standard = 10, i.e. 0.5 ml : 5 rnlJ
CA 02458953 2004-02-27
0000052814
61
C - correction factor [(550-405)/(550-450) = 1.45]
W 1 - extinction at 402 nm
W2 - extinction at 446 nm
W3 - extinction at 550 nm
-> V = (W 1 - 1.45W2 + 0.45W3) : -27.8075
Vitamin B2 concentration = V x K : P x F
=Vx3.04:0.04x10
= V x 760
With these values it is also necessary to take account of the evaporation of
the medium
during the shaking:
G1 - weight of the flask immediately after inoculation
G2 - weight of the flask before sampling
KV1 = volume of the medium with compensation for evaporation
[22.4 m! + 4.4 ml = 26.8 ml]
KV2 = volume of the medium [22.4 ml]
BZ - the previously calculated, uncorrected vitamin B2 concentration
Vitamin B2 concentration (corrected) _ ((KV1 - (G1 - G2)) : KV2) x B2
= ((26.8 - (G1 - G2)) : 22.4) x B2
The A. gossypii nucleic acid sequence found could on the basis of the above
observations be assigned the function of a protein for modulating the vitamin
B2
productivity.
CA 02458953 2004-02-27
0000052814
62
Table 1: Seguence survey
SEQ OliooDescription of the sequence S eauence homolo
gv
ID
NO:
1 028 DNA part-sequence 26 S proteasome
2 028 Amino acid part-sequence derived subunit or TAT-binding
from homolog 7 (TBP7)
complementary strand to SEQ ID from
NO: 1
3 028 Amino acid part-sequence derived S. cerevisiae
from
complementary strand to SEO !D
NO: 1
4 028 DNA full-length sequence
028 Amino acid sequence corresponding
to the
coding region of SEQ ID NO: 4 from
position 245 to 4222
6 045 DNA part-sequence Translation initiation
7 045 Amino acid part-sequence derived factor subunit from
from the S. cerevisiae
complementary strand to SEQ ID
NO: 6
8 045 Amino acid part-sequence derived
from the
complementary strand to SEQ ID
NO: 6
9 045 Amino acid part-sequence derived
from the
complementary strand to SEQ ID
NO: 6
045 DNA full-length sequence
11 045 Amino acid sequence corresponding
to the
coding region of SEQ ID NO: 10
from
position 640 to 1674
12 085 DNA part-sequence Ribosomal protein
from
13 085 Amino acid part-sequence derived S. cerevisiae
from the
coding strand to SEQ ID NO: 12
14 085 DNA full-length sequence
CA 02458953 2004-02-27
0000052814
63
SEQ Oli Description of the sequence Seguence homolopy
o
ID NO:
15 085 Amino acid sequence corresponding
to the
coding region of SEQ ID NO: 14
from
position 92 to 307
16 085 Amino acid sequence corresponding
to the
coding region of SEQ ID NO: 14
from
position 403 to 858
17 133 DNA part-sequence Nucleolar protein
from
18 133 Amino acid part-sequence derived S. cerevisiae
from the
complementary strand to SEQ ID
NO: 17
19 133 DNA full-length sequence
20 133 Amino acid sequence corresponding
to the
coding region of SEQ ID NO: 19
from
position 1371 to 2495
21 172 DNA part-sequence Translation initiation
22 172 Amino acid part-sequence derived protein from
from the
coding strand to SEQ ID NO: 21 S. cerevisiae
23 172 Amino acid part-sequence derived
from the
coding strand to SEO ID NO: 21
24 172 DNA full-length sequence
25 172 Amino acid sequence corresponding
to the
coding region of SEQ ID NO: 24
from
position 277 to 1476
26 063 DNA part-sequence Ribosomal protein
S 31
27 063 Amino acid part-sequence derived rom S. cerevisiae
from the f
complementary strand to SEQ ID
NO: 26
CA 02458953 2004-02-27
0000052814
64
SEQ OliaoDescription of the sequence Sequence homology
ID NO:
28 063 Amino acid part-sequence derived
from the
complementary strand to SEQ ID
NO: 26
29 063 DNA full-length sequence
30 063 Amino acid sequence corresponding
to the
coding region of SEQ ID NO: 29
from
position 533 to 856
31 132 DNA part-sequence Cell nuclear pore
32 132 Amino acid part-sequence derived protein from
from the
complementary strand to SEQ ID S. cerevisiae
NO: 31
33 132 Amino acid part-sequence derived
from the
complementary strand to SEQ ID
NO: 31
34 132 Amino acid part-sequence derived
from the
complementary strand to SEQ ID
NO: 31
35 132 Amino acid part-sequence derived
from the
complementary strand to SEQ ID
NO: 31
36 132 DNA full-length sequence
37 132 Amino acid sequence corresponding
to the
coding region of SEQ ID NO: 36
from
position 629 to 3181
38 174 DNA part-sequence ADH-histone
39 174 Amino acid part-sequence derived acetyltransferase
from the
complementary strand SEQ ID NO: complex from
38
40 174 DNA full-length sequence S. cerevisiae
41 174 Amino acid sequence corresponding
to the
coding region of SEQ ID NO: 40
from
position 964 to 2589
CA 02458953 2004-02-27
0000052814
SEQ OliaoDescription of the sequence Seauence homology
ID
NO:
42 051 DNA part-sequence S. cerevisiae RNA
43 051 Amino acid part-sequence derived helicase which is
from the
complementary strand to SEQ ID involved in RNA
NO: 42
44 051 Amino acid part-sequence derived Processing
from the
complementary strand to SEQ ID
NO: 42
45 051 Amino acid part-sequence derived
from the
complementary strand to SEQ ID
NO: 42
46 051 DNA full-length sequence
47 051 Amino acid sequence corresponding
to the
coding region of SEQ ID NO: 46
from
position 502 to 2208
48 030 DNA part-sequence Nonessential
49 030 Amino acid part-sequence derived constituent of RNA
from the poll
coding strand to SEQ ID NO: 48 from S. cerevisiae
50 030 Amino acid part-sequence derived
from the
coding strand to SEQ ID NO: 48
51 030 DNA full-length sequence
52 030 Amino acid sequence corresponding
to the
coding region of SEQ ID NO: 51
from
position 198 to 1073
53 124 DNA part-sequence RNA helicase from
54 124 Amino acid part-sequence derived S. cerevisiae
from the
coding strand to SEQ ID NO: 53
55 124 Amino acid part-sequence derived
from the
coding strand to SEQ ID NO: 53
56 124 DNA full-length sequence
CA 02458953 2004-02-27
0000052814
66
SEQ Oli Description of the sequence Seauence hornoloav
ID o
NO:
57 124 Amino acid sequence corresponding
to the
coding region of SEQ ID NO: 56
from
position 465 to 1775
58 139 DNA part-sequence mRNA decapping
59 139 Arnino acid part-sequence derivedenzyme from
from the
coding strand to SEQ ID NO: 58 S. cerevisiae
60 139 DNA full-length sequence
61 139 Amino acid sequence corresponding
to the
coding region of SEQ ID NO: 60
from
position 402 to 638
62 139 Amino acid sequence corresponding
to the
coding region of SEQ ID NO: 60
from
position 663 to 974
63 144 DNA part-sequence Subunit of the
64 144 Amino acid part-sequence derived translation initiation
from the
coding strand to SEQ ID NO: 63 factor eIF3 from
65 144 DNA full-length sequence S. cerevisiae
66 144 Amino acid sequence corresponding
to the
coding region of SEQ ID NO: 65
from
position 468 to 2675
67 168 DNA part-sequence S. cerevisiae U3
small
68 168 Amino acid part-sequence derived nucleolar ribonucleo-
from the
coding strand to SEQ ID NO: 67 protein-associated
69 168 Amino acid part-sequence derived protein which is
from the involved
coding strand to SEQ ID NO: 67 n preribosomal RNA
i
70 168 DNA full-length sequence
processing
CA 02458953 2004-02-27
0000052814
67
SEQ OI_ Description of the seguence Sequence homoloav
ID ip0
NO:
71 168 Amino acid sequence corresponding
to the
coding region of SEQ ID NO: 70
from
position 660 to 2432
72 160 DNA part-sequence Ribosomal protein
73 160 Amino acid part-sequence derived ~~7a.e.B; large
from the 60 S
complementary strand to SEQ ID subunit) from
NO: 72
S. cerevisiae
74 018 DNA part-sequence Modulator of vitamin
B2
75 018 DNA full-length sequence production
76 018 Amino acid sequence corresponding
to the
coding region of SEQ ID NO: 75
from
position 958 to 1272
77 018 DNA full-length sequence
78 018 Amino acid sequence corresponding
to the
coding region of SEQ ID NO: 77
from
position 1531 to 1845
CA 02458953 2004-02-27
0050152814
1
SEQUENCE LTSTING
<110> BASF Aktiengesellschaft
<120> Novel polynucleotides for modulation of transcription/translation
<130> M/42319iPCT
<160> 78
<170> PatentIn version 3.1
<210> 1
<211> 1481
<212> DNA
<213> Ashbya gossypii
<220>
<221> misc_feature
<223> Oligo 28
<220>
<221> misc_feature
<222> (151)..(151)
<223> unknown amino acid
<400>
1
gatctttgaaaacgaatgaragagtgttacttttagctattgcggaaggcttcaccgaag60
aagagttacataacacacctttgtcgttatttggctttgacctgaatattgkctctatta120
gagaaccatytacttgcccaaagacacaacntacttcaaaactctkgaagagttacctga180
aaatgaagcccactaagtttcgagagaagaggaaaagaaaaaagccactgccggtcctac240
ccgtgtgcgatactcccagcaacgatgatatyggttctgatggtgaactmttaaccgaag300
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
2
acgaaaagtygaggaggaagttaaaatcataccatcaccaagacatgaaattgaagaata360
ctttgaagataaaagctttccggtctgatggatctatttaaggggcgttataaaagattt420
aggaaaccgcccattgaggattccttgcttattcatctatttgaaccagaagcctatgcc480
tcaaatcctgaatggcaaccggcttatgtaagagaagatgacatgattttagaagtttca540
accggcaggaagtactacaatatggatttggatattatagaagaaaggttgtggaacggg600
tattactctgaaccgaaacagtatttgaaggatatcgagttaatttaccgcgatgctaat660
acaactggtgaccgagagcgtataataaaagcgtcagagatgtttgcaaacgcacagatg720
ggcattgaagaaatatctacgcctgagcttatccaggagtgcagggatacacgtcaaaga780
gaactattaaggcagcagttgtatttacgcgaccagcagaaaaagatacacgaggaagaa840
gctaagctcgagcaggagaaaaaggatccgacttttccaaatgacgataatcatccagaa900
gaggccgacttaagcgttggggctggacagcaattgcatagcccatcacaaatgtctcat960
gaggcttgtgaaagccacgcagaagatggactgggggtaccacatggctttgaaaataac1020
acatatgctattggagataacacaccagagacgatcgataacgggtctcctaaacccyta1080
gaggacttttgcggggaagacaagactgtccctgacgacaaatccgtgccagaacgattt1140
gttcaagagggagaagcttctgagatgggctttatcccgaaaacaccttccgccagaccc1200
gtctccatgcactcaaatccatcaagcaaagaatccgtagttgctcctatgcaaaagact1260
gggttagaagtgaacagtatcgaggacacgtcagtcgctgttcaatcagaactgacccgc1320
gatgaagacttacccatgactcctgaaccggcctttatcctggatgaaaccgttttagcg1380
aaaataatctcgatgttgaaaacaaaaacacagggatttacagtcgaacagctggaaaca1440
tgctatgctgccgtactggagctagtatgggaggcgagatc 1481
<210> 2
<211> 124
<212> PRT
<213> Ashbya gossypii
<220>
<221> misc feature
<223> Oligo 28
<220>
<221> misc feature
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
3
<222> (37)..(37)
<223> unknown amino acid
<220>
<221> misc_feature
<222> (43)..(43)
<223> unknown amino acid
<220>
<221> misc feature
<222> (50)..(50)
<223> unknown amino acid
<220>
<221> misc_feature
<222> (55)..(55)
<223> unknown amino acid
<220>
<221> misc_feature
<222> (103)..(103)
<223> unknown amino acid
<400> 2
Ser Leu Lys Thr Asn Glu Arg Val Leu Leu Leu Ala Ile Ala Glu Gly
1 5 10 15
Phe Thr Glu Glu Glu Leu His Asn Thr Pro Leu Ser Leu Phe Gly Phe
20 25 30
Asp Leu Asn Ile Xaa Ser Ile Arg Glu Pro Xaa Thr Cys Pro Lys Thr
35 40 45
Gln Xaa Thr Ser Lys Leu Xaa Lys Ser Tyr Leu Lys Met Lys Pro Thr
50 55 60
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
4
Lys Phe Arg Glu Lys Arg Lys Arg Lys Lys Pro Leu Pro Val Leu Pro
65 70 75 80
Val Cys Asp Thr Pro Ser Asn Asp Asp Ile Gly Ser Asp Gly Glu Leu
85 90 95
Leu Thr Glu Asp Glu Lys Xaa Arg Arg Lys Leu Lys Ser Tyr His His
100 105 110
Gln Asp Met Lys Leu Lys Asn Thr Leu Lys Ile Lys
115 120
<210> 3
<211> 369
<212> PRT
<213> Ashbya gossypii
<220>
<221> misc_feature
<223> Oligo 28
<400> 3
Lys Leu Ser Gly Leu Met Asp Leu Phe Lys Gly Arg Tyr Lys Arg Phe
1 5 10 15
Arg Lys Pro Pro Ile Glu Asp Ser Leu Leu Ile His Leu Phe Glu Pro
20 25 30
Glu Ala Tyr Ala Ser Asn Pro Glu Trp Gln Pro Ala Tyr Val Arg Glu
35 40 45
Asp Asp Met Ile Leu Glu Val Ser Thr Gly Arg Lys Tyr Tyr Asn Met
50 55 60
Asp Leu Asp Ile Ile Glu Glu Arg Leu Trp Asn Gly Tyr Tyr Ser Glu
65 70 75 80
Pro Lys Gln Tyr Leu Lys Asp Ile Glu Leu Ile Tyr Arg Asp Ala Asn
85 90 95
Thr Thr Gly Asp Arg Glu Arg Ile I1e Lys Ala Ser Glu Met Phe Ala
M/42319-PCT
CA 02458953 2004-02-27
- 0050152814
100 105 110
Asn Ala Gln Met Gly Ile Glu Glu Ile Ser Thr Pro Glu Leu Ile Gln
115 120 125
Glu Cys Arg Asp Thr Arg Gln Arg Glu Leu Leu Arg Gln Gln Leu Tyr
130 135 140
Leu Arg Asp Gln Gln Lys Lys Ile His Glu Glu Glu Ala Lys Leu Glu
145 150 155 160
Gln Glu Lys Lys Asp Pro Thr Phe Pro Asn Asp Asp Asn His Pro Glu
165 170 175
Glu Ala Asp Leu Ser Val Gly Ala Gly Gln Gln Leu His Ser Pro Ser
180 185 190
Gln Met Ser His Glu Ala Cys Glu Ser His Ala Glu Asp Gly Leu Gly
195 200 205
Val Pro His Gly Phe Glu Asn Asn Thr Tyr Ala Ile Gly Asp Asn Thr
210 215 220
Pro Glu Thr Ile Asp Asn Gly Ser Pro Lys Pro Leu Glu Asp Phe Cys
225 230 235 240
Gly Glu Asp Lys Thr Val Pro Asp Asp Lys Ser Val Pro Glu Arg Phe
245 250 255
Val Gln Glu Gly Glu Ala Ser Glu Met Gly Phe Ile Pro Lys Thr Pro
260 265 270
Ser Ala Arg Pro Val Ser Met His Ser Asn Pro Ser Ser Lys Glu Ser
275 -. 280 285
Val Val Ala Pro Met Gln Lys Thr Gly Leu Glu Val Asn Ser Ile Glu
290 295 300
Asp Thr Ser Val Ala Val Gln Ser Glu Leu Thr Arg Asp Glu Asp Leu
305 310 315 320
Pro Met Thr Pro Glu Pro Ala Phe Ile Leu Asp Glu Thr Val Leu Ala
325 330 335
Lys Ile Ile Ser Met Leu Lys Thr Lys Thr Gln Gly Phe Thr Val Glu
340 345 350
M/42319-PCT
CA 02458953 2004-02-27
- 0050/52814
6
- Gln Leu Glu Thr Cys Tyr Ala Ala Val Leu Glu Leu Val Trp Glu Ala
355 360 365
Arg
<210> 4
<211> 4670
<212> DNA
<213> Ashbya gossypii
<220>
<221> CDS
<222> (245).-(4222)
<223>
<220>
<221> misc feature
<223> Oligo 28
<400> 4
tctcgttccgaagctgaggctggatacgaatatcaccatatacgaaggccccgccacccc 60
gagaaaggcatttttcccctttgaaatgggttatgtgacgatgttcatgagttgtgcaga 120
aaagcagggagggaaagacgagtcattagcatcgaagggcagcattgtgtagtcttagtg 180
tcgtatttttggatctgcaataggtttttgatttatctctcggtcttcgatttgatagag 240
aatc 289
atg
gcg
cgt
cat
aca
agg
aga
tcg
cat
cag
cac
gtg
aac
gac
gaa
Met
Ala
Arg
His
Thr
Arg
Arg
Ser
His
Gln
His
Val
Asn
Asp
Glu
1 5 10 15
gataca ggtagcgaa atatacgataaa aatgggatcaag cacacgacg 337
AspThr GlySerGlu IleTyrAspLys AsnGlyIleLys HisThrThr
20 25 30
ccgagg tcgctgaag aagatcaattac gcggaaatcgaa aacagttac 385
ProArg SerLeuLys LysIleAsnTyr AlaGluIleGlu AsnSerTyr
35 40 45
gattat atggaggac tacgatgaagga gacaaggaagag gagcctgca 433
AspTyr MetGluAsp TyrAspGluGly AspLysGluGlu GluProAla
50 55 60
gaactg gagaacaac gggcggagcaag ggactggtaggc cgcgagcgc 481
Glu Leu Glu Asn Asn Gly Arg Ser Lys Gly Leu Val Gly Arg Glu Arg
M/42319-PCT
°
0050/52814
CA 02458953 2004-02-27
7
65 ?0 75
gggcgggag ccggaggag gacgag gaggag gtc cgg 529
gac ggg ggg
cca
GlyArgGlu ProGluGlu AspGlu GluGlu Val Arg
Asp Gly Gly
Pro
80 85 90 g5
cggcgcagc cggaaacgc acttatgtg gatgtggag gac gag 577
gag agc
ArgArgSer ArgLysArg ThrTyrVal AspValGlu Asp Glu
Glu Ser
100 105 110
ttccacgag gaggaggcg gaggacgag gacgaggag ctg gac 625
gcg gac
PheHisGlu GluGluAla GluAspGlu AspGluGlu Leu Asp
Ala Asp
115 120 125
gatgaggac gaggacgag gaggagcgg aactggcgg cgg cgc 673
cgg gag
AspGluAsp GluAspGlu GluGluArg AsnTrpArg Arg Arg
Arg Glu
130 135 140
caccagttt gttgtagag gacgaggat gatgacgag gag gag 721
gac gac
HisGlnPhe ValValGlu AspGluAsp AspAspGlu Glu Glu
Asp Asp
145 150 155
gactatgga gcacagaaa aaacgcggc aggcggcgg cgg cgt 769
acc ggc
AspTyrGly AlaGlnLys LysArgGly ArgArgArg Arg Arg
Thr Gly
160 165 170 175
aggtcgcgg ctaacagag cggcgttcg ccgccacgc ctg cgg 817
aag aca
ArgSerArg LeuThrGlu ArgArgSer ProProArg Leu Arg
Lys Thr
180 185 190
cgccggacg cgatcgtct gtgaacatg tatgacagt cat gac 865
gag ggg
ArgArgThr ArgSerSer ValAsnMet TyrAspSer His Asp
Glu Gly
195 200 205
actggcgaa gcgttgacg ctggaggac gagattcgg ctg cag 913
gaa gag
ThrGlyGlu AlaLeuThr LeuGluAsp GluIleArg Leu Gln
Glu Glu
210 215 220
gattcgccc atccgcgag aaacggtcg ctgcgggag aca aag 961
cgc ccg
AspSerPro IleArgGlu LysArgSer LeuArgGlu Thr Lys
Arg Pro
225 230 235
gtaaattac acgctgccc ccacccctg actgataac atg aac 1009
caa gtt
ValAsnTyr ThrLeuPro ProProLeu ThrAspAsn Met Asn
Gln Val
240. 245 250 255
gatggcact getgcacca gcgtacggg agcttccat ccc aga 1057
tct ggc
AspGlyThr AlaAlaPro AlaTyrGly SerPheHis Pro Arg
Ser Gly
260 265 27p
aagcgtggg ctacactcg ggacaaagt tttggacct 1105
atc
agg
cga
ttg
LysArgGly LeuHisSer GlyGlnSer PheGlyPro
Ile
Arg
Arg
Leu
275 280 285
tttccaacg ggcggccct ttcggcgga gatgtg 1153
aac aca
get
ata
ttc
PheProThr GlyGlyPro PheGlyGly
Asn
Asp
Val
Thr
Ala
Ile
Phe
290 295 300
ggccacaac accaacttt tatgcaacg 1201
get
caa
gat
ccg
act
gtg
gcc
GlyHisAsn ThrAsnPhe Tyr Thr
Ala Ala
Gln
Asp
Pro
Thr
Val
Ala
305 310 315
aataacaag tttatc tcggactct 1249
gat tca
gat
gac
gaa
att
ttg
ccg
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
8
Asn Asn Lys Phe Ile Asp Ser Asp Ser Ser Asp Asp Glu Ile Leu Pro
32U 325 330 335
ctg gga agt acc cec aaa cca aaa agc tcc gaa get aag aaa aag aaa 1297
Leu Gly Ser Thr Pro Lys Pro Lys Ser Ser Glu Ala Lys Lys Lys Lys
340 345 350
aag ccg gag att gca gat ctg gat ccg tta gga gta gat atg aat att 1345
Lys Pro Glu Ile Ala Asp Leu Asp Pro Leu Gly Val Asp Met Asn Ile
355 360 365
aat ttt gat gac att ggc ggt ctg gat aac tac ata gac cag ctg aag 1393
Asn Phe Asp Asp Ile G1y Gly Leu Asp Asn Tyr Ile Asp Gln Leu Lys
370 375 380
gag atg gtt gcg ttg ccg tta ctc tat ccg gag ctc tat caa aat ttc 1441
Glu Met Val Ala Leu Pro Leu Leu Tyr Pro Glu Leu Tyr Gln Asn Phe
385 390 395
aac atc aca cct ccg cgt ggt gtg ctc ttc tat ggg cca cca ggt acg 1489
Asn Ile Thr Pro Pro Arg G1y Val Leu Phe Tyr Gly Pro Pro Gly Thr
400 405 410 415
ggt aag acg ctt atg get aga gcg ttg gca gcg agc tgc tca act gaa 1537
Gly Lys Thr Leu Met Ala Arg Ala Leu Ala Ala Ser Cys Ser Thr Glu
420 425 430
aag agg aag att acg ttc tat atg cgc aag ggg gcc gat atc ctg tcg 1585
Lys Arg Lys Ile Thr Phe Tyr Met Arg Lys Gly Ala Asp Ile Leu Ser
435 440 445
aaa tgg gtt ggc gaa get gag aga cag ctt cga ctg ctg ttt gag gag 1633
Lys Trp Val Gly Glu Ala Glu Arg Gln Leu Arg Leu Leu Phe Glu Glu
450 455 460
get aag aag cac cag cct tcg ata att ttc ttt gac gag att gat ggc 1681
Ala Lys Lys His Gln Pro Ser Ile Ile Phe Phe Asp Glu Ile Asp Gly
465 470 475
ctg gcc ccg gtt agg agt tca aag caa gaa caa atc cat gcc agc atc 1729
Leu Ala Pro Val Arg Ser Ser Lys Gln Glu Gln Ile His Ala Ser Ile
480 485 490 495
gta tct acc atg ttg gcg tta atg gat gga atg gac aat agg gga caa 1777
Val Ser Thr Met Leu Ala Leu Met Asp Gly Met Asp Asn Arg Gly Gln
500 505 510
gtg att gta atc ggt get act aat aga ccg gat gca gta gac cct get 1825
Val Ile Val Ile Gly Ala Thr Asn Arg Pro Asp Ala Val Asp Pro Ala
515 520 525
tta aga cga cca ggt aga ttt gac aga gag ttt tat ttc cct ctg cct 1873
Leu Arg Arg Pro Gly Arg Phe Asp Arg Glu Phe Tyr Phe Pro Leu Pro
530 535 540
gac ata cga gcc aga gcg aag att ctg gaa att cac acc agg aaa tgg 1921
Asp I1e Arg Ala Arg Ala Lys Ile Leu Glu Ile His Thr Arg Lys Trp
545 550 555
cat cct cca gta tca agt gcg ttt ata gaa aag ctt get tct ttg acg 1969
His Pro Pro Va1 Ser Ser Ala Phe Ile Glu Lys Leu Ala Ser Leu Thr
560 565 570 575
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
9
aaa gga tac ggt gga gca gat ctt aga gcg cta tgt aca gag gcg gcc 2017
Lys Gly Tyr Gly Gly Ala Asp Leu Arg Ala Leu Cys Thr Glu Ala Ala
580 585 590
tgg aat agc att cag cga aga ttc ccg caa ata tat caa agt gag gtc 2065
Trp Asn Ser Ile Gln Arg Arg Phe Pro Gln Ile Tyr Gln Ser Glu Val
595 600 605
aag ttg gcaataaaccca agggaagtg caggttaaa getaaagacttt 2113
Lys Leu AlaIleAsnPro ArgGluVal GlnValLys AlaLysAspPhe
610 615 620
atg att getatggaaaaa attacaccg tcttccgcg cggtcgagtggg 2161
Met Ile AlaMetGluLys IleThrPro SerSerAla ArgSerSerGly
625 630 635
aac ttg gccgaaccctta cctcgtacc atagcggtt ctgctaaacgat 2209
Asn Leu AlaGluProLeu ProArgThr IleAlaVal LeuLeuAsnAsp
640 645 650 655
cag ttc gaggaaataaaa caaaaattg aatagcatt ttgcctgaagcg 2257
Gln Phe GluGluIleLys GlnLysLeu AsnSerIle LeuProGluAla
660 665 670
tca agt aagtctcatcgc ggttcttcg ctaattaaa gaatacctggag 2305
Ser Ser LysSerHisArg GlySerSer LeuIleLys GluTyrLeuGlu
675 680 685
tac gaa gatgaagaagat gaagaagat ggagaagat aatatcgaaggc 2353
Tyr Glu AspGluGluAsp GluGluAsp GlyGluAsp AsnIleGluGly
690 695 700
aca ggt atccactcgtcg aacggcttc agcagacat gaatttttcaag 2401
Thr Gly IleHisSerSer AsnGlyPhe SerArgHis GluPhePheLys
705 710 715
atg ctt gatcaggetagg accgttaaa ccaaagttg ttaataacaggt 2449
Met Leu AspGlnAlaArg ThrValLys ProLysLeu LeuIleThrGly
720 725 730 735
ccg get ggcaatggccaa caatatatt ggttccgcg cttttgcatcat 2497
Pro Ala GlyAsnGlyGln GlnTyrIle GlySerAla LeuLeuHisHis
740 745 750
tta gag gattacaatatt cagaatctt gatttaggc acattactctcg 2545
Leu Glu AspTyrAsnIle GlnAsnLeu AspLeuGly ThrLeuLeuSer
755 760 765
gaa agt ttaaggacaatg gagtccget attgtgcag acatttattgag 2593
Glu Ser LeuArgThrMet GluSerAla IleValGln ThrPheIleGlu
770 775 780
gcg aaa aaacgacaacca tcagtaatc tacatccct aatgetgatatt 2641
Aia Lys LysArgGlnPro SerValIle TyrIlePro AsnAlaAspIle
785 790 795
tgg tca agaacggtcccc gaaagtgcc ataatgacc ttggcaagctta 2689
Trp Ser ArgThrValPro GluSerAla IleMetThr LeuAlaSerLeu
800 805 810 815
ttt aga tctttgaaaacg aatgagaga gtgttactt ttagetattgcg 2737
Phe Arg SerLeuLysThr AsnGluArg ValLeuLeu Leu IleAla
Ala
820 825 830
M/42319-PCT
0050/52814
CA 02458953 2004-02-27
gaa ggc ttcaccgaa gaagagtta cataacaca cctttgtcg ttattt 2785
Glu Gly PheThrGlu GluGluLeu HisAsnThr ProLeuSer LeuPhe
835 840 845
ggc ttt gacctgaat attgtctct attagagaa ccatctact gcccaa 2833
Gly Phe AspLeuAsn IleValSer IleArgGlu ProSerThr AlaGln
850 855 860
aga cac aactacttc aaaactctc gaagagtta ctgaaaatg aagccc 2881
Arg His AsnTyrPhe LysThrLeu GluGluLeu LeuLysMet LysPro
865 870 g75
act aag tttcgagag aagaggaaa agaaaaaag ccactgccg gtacta 2929
Thr Lys PheArgGlu LysArgLys ArgLysLys ProLeuPro ValLeu
880 885 890 895
ccc gtg tgcgatact cccagcaac gatgatatc ggttctgat ggtgaa 2977
Pro Val CysAspThr ProSerAsn AspAspIle GlySerAsp GlyGlu
900 905 910
cta tta accgaagac gaaaagttg aggaggaag ttaaaatca taccat 3025
Leu Leu ThrGluAsp GluLysLeu ArgArgLys LeuLysSer TyrHis
915 920 925
cac caa gacatgaaa ttgaagaat actttgaag ataaagctt tccggt 3073
His Gln AspMetLys LeuLysAsn ThrLeuLys IleLysLeu SerGly
930 935 940
cta gtg getctattt aaggggcgt tataaaaga tttaggaaa ccgccc 3121
Leu Val AlaLeuPhe LysGlyArg TyrLysArg PheArgLys ProPro
945 950 955
att gag gattccttg cttattcat ctatttgaa ccagaagcc tatgcc 3169
Ile Glu AspSerLeu LeuIleHis LeuPheGlu ProGluAla TyrAla
960 965 970 975
tca aat cctgaatgg caaccgget tatgtaaga gaagatgac atgatt 3217
Ser Asn ProGluTrp GlnProAla TyrValArg GluAspAsp Ile
Met
980 985 990
tta gaa gtt tca acc ggc agg aag tac tac aat atg gat ttg gat att 3265
Leu Glu Val Ser Thr Gly Arg Lys Tyr Tyr Asn Met Asp Leu Asp Ile
995 1000 1005
atagaagaa agg ttgtggaac ggg tattactct gaaccg aaacag 3310
IleGluGlu Arg LeuTrpAsn Gly TyrTyrSer GluPro LysGln
1010 1015 1020
tatttgaag gat atcgagtta att taccgcgat getaat acaact 3355
TyrLeuLys Asp IleGluLeu Ile TyrArgAsp AlaAsn ThrThr
1025 1030 1035
ggtgaccga gag cgtataata aaa gcgtcagag atgttt gcaaac 3400
GlyAspArg Glu ArgIleIle Lys AlaSerGlu MetPhe AlaAsn
1040 1045 1050
gcacagatg ggc attgaagaa ata tctacgcct gagctt atccag 3445
AlaGlnMet Gly IleGluGlu Ile SerThrPro GluLeu IleGln
1055 1060 1065
gagtgcagg gat acacgtcaa aga gaactatta aggcag cagttg 3490
Glu Cys Arg Asp Thr Arg Gln Arg Glu Leu Leu Arg Gln Gln Leu
M/42319-PCT
0050/52814
CA 02458953 2004-02-27
11
1070 1075 1080
tatttacgc gac cagcagaaa aag atacacgag gaa get 3535
gaa aag
'I'~,~rLeuArg Asp GlnGlnLys Lys IleHisGlu Glu Ala
Glu Lys
1085 1090 1095
ctcgagcag gag aaaaaggat ccg acttttcca aatgac gataat 3580
LeuGluGln Glu LysLysAsp Pro ThrPhePro AsnAsp AspAsn
1100 1105 1110
catccagaa gag gccgactta agc gttgggget ggacag caattg 3625
HisProGlu Glu AlaAspLeu Ser ValGlyAla GlyGln GlnLeu
1115 1120 1125
catagccca tca caaatgtct cat gaggettgt gaaagc cacgca 3670
HisSerPro Ser GlnMetSer His GluAlaCys GluSer HisAla
1130 1135 1140
gaagatgga ctg ggggtacca cat ggctttgaa aataac acatat 3715
GluAspGly Leu GlyValPro His GlyPheGlu AsnAsn ThrTyr
1145 1150 1155
getattgga gat aacacacca gag acgatcgat aacggg tctcct 3760
AlaIleGly Asp AsnThrPro Glu ThrIleAsp AsnGly SerPro
1160 1165 1170
aaaccccta gag gacttttgc ggg gaagacaag actgtc cctgac 3805
LysProLeu Glu AspPheCys Gly GluAspLys ThrVal ProAsp
1175 1180 1185
gacaaatcc gtg ccagaacga ttt gttcaagag ggagaa gettct 3850
AspLysSer Val ProGluArg Phe ValGlnGlu GlyGlu AlaSer
1190 1195 1200
gagatgggc ttt atcccgaaa aca ccttccgcc agaccc gtctcc 3895
GluMetGly Phe IleProLys Thr ProSerAla ArgPro ValSer
1205 1210 1215
atgcactca aat ccatcaagc aaa gaatccgta gttget cctatg 3940
MetHisSer Asn ProSerSer Lys GluSerVal ValAla ProMet
1220 1225 1230
caaaagact ggg ttagaagtg aac agtatcgag gacacg tcagtc 3985
GlnLysThr Gly LeuGluVal Asn SerIleGlu AspThr SerVal
1235 1240 1245
getgttcaa tca gaactgacc cgc gatgaagac ttaccc atgact 4030
AlaValGln Ser GluLeuThr Arg AspGluAsp LeuPro MetThr
1250 1255 1260
cctgaaccg gcc tttatcctg gat gaaaccgtt ttagcg aaaata 4075
ProGluPro Ala PheIleLeu Asp GluThrVal LeuAla LysIle
1265 1270 1275
atctcgatg ttg aaaacaaaa aca cagggattt acagtc gaacag 4120
IleSerMet Leu LysThrLys Thr GlnGlyPhe ThrVal GluGln
1280 1285 1290
ctggaaaca tgc tatgetgcc gta ctg cta gtatgg gaggcg 4165
gag
LeuGluThr Cys TyrAla Val Leu Leu Trp GluAla
Ala Glu Val
1295 1300 1305
agatcgtca tgg gataaaaca agt gtc ata gaa 4210
att aaa
aag
caa
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
12
Arg Ser Ser Trp Asp Lys Thr Val Ile Glu Lys
Ser Lys Gln
Ile
1310 1315 1320
tat ata ggc atg tgag cccgtt 4262
agtaggacca
agtgtatcta
acatttattt
Tyr Ile Gly Met
1325
acacgattaa agcctagagt cgatatatactagttcaattgttcttgcatgacgtcctcg4322
gctgcatcga gtaagccgta gtcatcggcaaactgtgcggtgagttggatacctactccc4382
ttcattccag caagaggaac agatatgcatggaagcccagcgagggacattggcaccgtg4442
aagacgtcgt tgatgtacga gttgactggactcttgttctccttgctagtgaaggcctcg4502
agactaggtg ggtggcgcca tgcaggtcagcgagagcagcacatccaccccagcaggatt4562
aggtttgttt ccggtgcaga tgttctcaaaggcaaatatcgagtcaaactggtttataag4622
ctcgactctc agtttctgcg ccctcatgtagttggtcttaaatgcgcc 4670
<210> 5
<211> 1326
<212> PRT
<213> Ashbya gossypii
<220>
<221> misc feature
<223> Oligo 28
<400> 5
Met Ala Arg His Thr Arg Arg Ser His Gln His Val Asn Asp Glu Asp
1 5 10 15
Thr Gly Ser Glu Ile Tyr Asp Lys Asn Gly Ile Lys His Thr Thr Pro
20 25 30
Arg Ser Leu Lys Lys Ile Asn Tyr Ala Glu Ile Glu Asn Ser Tyr Asp
35 40 45
Tyr Met Glu Asp Tyr Asp Glu Gly Asp Lys Glu Glu Glu Pro Ala Glu
50 55 60
Leu Glu Asn Asn Gly Arg Ser Lys Gly Leu Val Gly Arg Glu Arg Gly
65 70 75 80
Arg Glu Pro Glu Glu Asp Glu Asp Glu Glu Gly Pro Val Arg Gly Arg
85 90 95
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
.. 13
Arg Ser Arg Lys Arg Thr Tyr Val Asp Val Glu Glu Asp Glu Ser Phe
100 105 110
His Glu Glu Glu Ala Glu Asp Glu Asp Glu Glu Ala Leu Asp Asp Asp
115 120 125
Glu Asp Glu Asp Glu Glu Glu Arg Asn Trp Arg Arg Arg Arg Glu His
130 135 140
Gln Phe Val Val Glu Asp Glu Asp Asp Asp Glu Asp Glu Glu Asp Asp
145 150 155 160
Tyr Gly Ala Gln Lys Lys Arg Gly Arg Arg Arg Thr Arg Arg Gly Arg
165 170 175
Ser Arg Leu Thr Glu Arg Arg Ser Pro Pro Arg Lys Leu Arg Thr Arg
180 185 190
Arg Thr Arg Ser Ser Val Asn Met Tyr Asp Ser Glu His Asp Gly Thr
195 200 205
Gly Glu Ala Leu Thr Leu Glu Asp Glu Ile Arg Glu Leu Gln Glu Asp
210 215 220
Ser Pro Ile Arg Glu Lys Arg Ser Leu Arg Glu Arg Thr Lys Pro Val
225 230 235 240
Asn Tyr Thr Leu Pro Pro Pro Leu Thr Asp Asn Gln Met Asn Val Asp
245 250 255
Gly Thr Ala Ala Pro Ala Tyr Gly Ser Phe His Ser Pro Arg Gly Lys
260 265 270
Arg Gly Leu His Ser Gly Gln Ser Phe Gly Pro Ile Arg Arg Leu Phe
275 280 285
Pro Thr Gly Gly Pro Phe Gly Gly Asn Asp Val Thr Ala Ile Phe Gly
290 295 300
His Asn Thr Asn Phe Tyr Ala Thr Ala Gln Asp Pro Thr Val Ala Asn
305 310 315 320
Asn Lys Phe Ile Asp Ser Asp Ser Ser Asp Asp Glu Ile Leu Pro Leu
325 330 335
Gly Ser Thr Pro Lys Pro Lys Ser Ser Glu Ala Lys Lys Lys Lys Lys
340 345 350
M/42319-PCT
0050/52814
CA 02458953 2004-02-27
14
Pro Glu Ile Ala Asp Leu Asp Pro Leu Gly Val Asp Met Asn Ile Asn
355 360 365
Phe Asp Asp Ile Gly Gly Leu Asp Asn Tyr Ile Asp Gln Leu Lys Glu
370 375 380
-Met Val Ala Leu Pro Leu Leu Tyr Pro Glu Leu Tyr Gln Asn Phe Asn
385 390 395 400
Ile Thr Pro Pro Arg Gly Val Leu Phe Tyr Gly Pro Pro Gly Thr Gly
405 410 415
Lys Thr Leu Met Ala Arg Ala Leu Ala Ala Ser Cys Ser Thr Glu Lys
420 425 430
Arg Lys Ile Thr Phe Tyr Met Arg Lys Gly Ala Asp Ile Leu Ser Lys
435 440 445
Trp Val Gly Glu Ala Glu Arg Gln Leu Arg Leu Leu Phe Glu Glu Ala
450 455 460
Lys Lys His Gln Pro Ser Ile Ile Phe Phe Asp Glu Ile Asp Gly Leu
465 470 475 480
Ala Pro Val Arg Ser Ser Lys Gln Glu Gln Ile His Ala Ser Ile Val
485 490 495
Ser Thr Met Leu Ala Leu Met Asp Gly Met Asp Asn Arg Gly Gln Val
500 505 510
Ile Val Ile Gly Ala Thr Asn Arg Pro Asp Ala Val Asp Pro Ala Leu
515 520 525
Arg Arg Pro Gly Arg Phe Asp Arg Glu Phe Tyr Phe Pro Leu Pro Asp
530 535 540
Ile Arg Ala Arg Ala Lys Ile Leu Glu Ile His Thr Arg Lys Trp His
545 550 555 560
Pro Pro Val Ser Ser Ala Phe Ile Glu Lys Leu Ala Ser Leu Thr Lys
565 570 575
Gly Tyr Gly Gly Ala Asp Leu Arg Ala Leu Cys Thr Glu Ala Ala Trp
580 585 590
Asn Ser Ile Gln Arg Arg Phe Pro Gln Ile Tyr Gln Ser Glu Val Lys
M/42319-PCT
0050/52814
CA 02458953 2004-02-27
595 600 605
Leu Ala Ile Asn Pro Arg Glu Val Gln Val Lys Ala Lys Asp Phe Met
610 615 620
Ile Ala Met Glu Lys Ile Thr Pro Ser Ser Ala Arg Ser Ser Gly Asn
625 630 635 640
Leu Ala Glu Pro Leu Pro Arg Thr Ile Ala Val Leu Leu Asn Asp Gln
645 650 655
Phe Glu Glu Ile Lys Gln Lys Leu Asn Ser Ile Leu Pro Glu Ala Ser
660 665 670
Ser Lys Ser His Arg Gly Ser Ser Leu Ile Lys Glu Tyr Leu Glu Tyr
675 680 685
Glu Asp Glu Glu Asp Glu Glu Asp Gly Glu Asp Asn Ile Glu Gly Thr
690 695 700
Gly Ile His Ser Ser Asn Gly Phe Ser Arg His Glu Phe Phe Lys Met
705 710 715 720
Leu Asp Gln Ala Arg Thr Val Lys Pro Lys Leu Leu Ile Thr Gly Pro
725 730 735
Ala Gly Asn Gly Gln Gln Tyr Ile Gly Ser Ala Leu Leu His His Leu
740 745 750
Glu Asp Tyr Asn Ile Gln Asn Leu Asp Leu Gly Thr Leu Leu Ser Glu
755 760 765
Ser Leu Arg Thr Met Glu Ser Ala Ile Val Gln Thr Phe Ile Glu Ala
770 775 780
Lys Lys Arg Gln Pro Ser Val Ile Tyr Ile Pro Asn Ala Asp Ile Trp
785 790 795 800
Ser Arg Thr Val Pro Glu Ser Ala Ile Met Thr Leu Ala Ser Leu Phe
805 810 815
Arg Ser Leu Lys Thr Asn Glu Arg VaI Leu Leu Leu Ala Ile Ala Glu
820 825 830
Gly Phe Thr Glu Glu Glu Leu His Asn Thr Pro Leu Ser Leu Phe Gly
835 840 845
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
16
Phe Asp Leu Asn Ile Val Ser Iie Arg Glu Pro Ser Thr Ala Gln Arg
850 855 860
His Asn Tyr Phe Lys Thr Leu Glu Glu Leu Leu Lys Met Lys Pro Thr
865 870 875 880
Lys Phe Arg Glu Lys Arg Lys Arg Lys Lys Pro Leu Pro Val Leu Pro
885 890 895
Val Cys Asp Thr Pro Ser Asn Asp Asp Ile Gly Ser Asp Gly Glu Leu
900 905 910
Leu Thr Glu Asp Glu Lys Leu Arg Arg Lys Leu Lys Ser Tyr His His
915 920 925
Gln Asp Met Lys Leu Lys Asn Thr Leu Lys Ile Lys Leu Ser Gly Leu
930 935 940
Val Ala Leu Phe Lys Gly Arg Tyr Lys Arg Phe Arg Lys Pro Pro Ile
945 950 955 960
Glu Asp Ser Leu Leu Ile His Leu Phe Glu Pro Glu Ala Tyr Ala Ser
965 970 975
Asn Pro Glu Trp Gln Pro Ala Tyr Val Arg Glu Asp Asp Met Ile Leu
980 985 990
Glu Val Ser Thr Gly Arg Lys Tyr Tyr Asn Met Asp Leu Asp Ile Ile
995 1000 1005
Glu Glu Arg Leu Trp Asn Gly Tyr Tyr Ser Glu Pro Lys Gln Tyr
1010 1015 1020
Leu Lys Asp Ile Glu Leu Ile Tyr Arg Asp Ala Asn Thr Thr Gly
1025 1030 1035
Asp Arg Glu Arg Ile Ile Lys Ala Ser Glu Met Phe Ala Asn Ala
1040 1045 1050
Gln Met Gly Ile Glu Glu Ile Ser Thr Pro Glu Leu Ile Gln Glu
1055 1060 1065
Cys Arg Asp Thr Arg Gln Arg Glu Leu Leu Arg Gln Gln Leu Tyr
1070 10?5 1080
Leu Arg Asp Gln Gln Lys Lys Ile His Glu Glu Glu Ala Lys Leu
1085 1090 1095
M/42319-PCT
0050/52814
CA 02458953 2004-02-27
17
Glu Gln Glu Lys Lys Asp Pro Thr Phe Pro Asn Asp Asp Asn His
1100 1105 1110
Pro Glu Glu Ala Asp Leu Ser Val Gly Ala Gly Gln Gln Leu His
1115 1120 1125
Ser Pro Ser Gln Met Ser His Glu Ala Cys Glu Ser His Ala Glu
1130 1135 1140
Asp Gly Leu Gly Val Pro His Gly Phe Glu Asn Asn Thr Tyr Ala
1145 1150 1155
Ile Gly Asp Asn Thr Pro Glu Thr Ile Asp Asn Gly Ser Pro Lys
1160 1165 1170
Pro Leu Glu Asp Phe Cys Gly Glu Asp Lys Thr Val Pro Asp Asp
1175 - 1180 1185
Lys Ser Val Pro Glu Arg Phe Val Gln Glu Gly Glu Ala Ser Glu
1190 1195 1200
Met Gly Phe Ile Pro Lys Thr Pro Ser Ala Arg Pro Val Ser Met
1205 1210 1215
His Ser Asn Pro Ser Ser Lys Glu Ser Val Val Ala Pro Met Gln
1220 1225 1230
Lys Thr Gly Leu Glu Val Asn Ser Ile Glu Asp Thr Ser Val Ala
1235 1240 1245
Val Gln Ser Glu Leu Thr Arg Asp Glu Asp Leu Pro Met Thr Pro
1250 1255 1260
Glu Pro Ala Phe Ile Leu Asp Glu Thr Val Leu Ala Lys Ile Ile
1265 1270 1275
Ser Met Leu Lys Thr Lys Thr Gln Gly Phe Thr Val Glu Gln Leu
1280 1285 1290
Glu Thr Cys Tyr Ala Ala Val Leu Glu Leu Val Trp Glu Ala Arg
1295 1300 1305
Ser Ser Trp Asp Lys Thr Ser Val Ile Lys Gln Ile Glu Lys Tyr
1310 1315 1320
Ile Gly Met
1325
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
18
<210> 6
<211> 1049
<212> DNA
<213> Ashbya gossypii
<220>
<221> misc_feature
<223> Oligo 45
<400>
6
gatcgacgtggaccagcacacggagtacgcggtgaccgggagtgcggacttcaktgtgaa60
ggtctggcgcgtacgcgacggcagcatcgcgcactcgtgggacacagcgcacgcccgtgc120
aggcagcgtggagttttcgcccaccggcgaccgtgtgccttgcaggtgcctggataacgt180
gatgaactacgccggcgccatcgtggtgttcagcgtgacgcgggatgcgaacaaccagat240
cactggcttcaacagcggcctttcctgcgagatcctgacgcaggagggctgtgcgcccgt300
gcttgtggcgtcgtggtcgtatgacggcaagtacatcgtggccgggcaccaagacggcaa360
gatcagcaaatacaacggcgtcacgggcgaatgcctggaaatcaaggacctgcacaagca420
gcgcgtctccgacatccaattctcgcttgaccgcacctacttctcacgacctccagagac480
agctacgccaacctagtcgatgtcgagacattcgaggtcctgaagacctacgaaactgac540
tgtccgctgaacagcggttgcatcaccccgctaaaggagttcgtcattctgggcggtggc600
cagacgcgcgcgatgtcacgaccaccagtgcccgcgagggtaagttcgaggccaagttct660
accacaagcttttccaggtggaaatcggccgtgtggacgaccatttcggtcccgtcaact720
acatcgccgtttccccgcagggcacctcgtacgcctccggcggtgaggacggtttcgtgc780
gcctccatcacttcgacaagaggctacttcgacttcaagttcgacgtcgaaaaaagcgcc840
gacgcccagaagaaggtcgacactgctgaccgctgagctacatacctctgtaaactaccc900
tcttgaacagctattttctactgccctgcatcgtaccaggcaaggcctacacacctatac960
actacctgctggccttctcggccttcagccgctccagccgctcgcgctccttgcgctcgt1020
ccgccgcctgctgcttacgccgcaggatc 1049
<210> 7
<211> 153
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
w 19
<212> PRT
<213> Ashbya gossypii
<220>
<221> mist feature
<223> Oligo 45
<220>
<221> mist feature
<222> (17)..(17)
<223> unknown amino acid
<400> 7
Asp Val Asp Gln His Thr Glu Tyr Ala Val Thr Gly Ser Ala Asp Phe
1 5 10 15
Xaa Val Lys Val Trp Arg Val Arg Asp Gly Ser Ile Ala His Ser Trp
20 25 3p
Asp Thr Ala His Ala Arg Ala Gly Ser Val Glu Phe Ser Pro Thr Gly
35 40 45
Asp Arg Val Pro Cys Arg Cys Leu Asp Asn Val Met Asn Tyr Ala Gly
50 55 60
Ala Ile Val Val Phe Ser Val Thr Arg Asp Ala Asn Asn Gln Ile Thr
65 70 75 80
Gly Phe Asn Ser Gly Leu Ser Cys Glu Ile Leu Thr Gln Glu Gly Cys
85 90 95
Ala Pro Val Leu Val Ala Ser Trp Ser Tyr Asp Gly Lys Tyr Ile Val
100 105 110
Ala Gly His Gln Asp Gly Lys Ile Ser Lys Tyr Asn Gly Val Thr Gly
115 120 125
Glu Cys Leu Glu Ile Lys Asp Leu His Lys Gln Arg Val Ser Asp Ile
130 135 140
Gln Phe Ser Leu Asp Arg Thr Tyr Phe
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
,. 20
145 150
<210> 8
<211> 47
<212> PRT
<213> Ashbya gossypii
<220>
<221> misc_feature
<223> Oligo 45
<400> 8
Leu Thr Thr Ser Arg Asp Ser Tyr Ala Asn Leu Val Asp Val Glu Thr
1 5 10 15
Phe Glu Val Leu Lys Thr Tyr Glu Thr Asp Cys Pro Leu Asn Ser Gly
20 25 30
Cys Ile Thr Pro Leu Lys Glu Phe Val Ile Leu Gly Gly Gly Gln
35 40 45
<210> 9
<211> 70
<212> PRT
<213> Ashbya gossypii
<220>
<221> misc_feature
<223> Oligo 45
<400> 9
Gly Arg Trp Pro Asp Ala Arg Asp Val Thr Thr Thr Ser Ala Arg Glu
1 5 10 15
Gly Lys Phe Glu Ala Lys Phe Tyr His Lys Leu Phe Gln Val Glu Ile
20 25 30
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
. 21
Gly Arg Val Asp Asp His Phe Gly Pro Val Asn Tyr Ile Ala Val Ser
35 40 45
Pro Gln Gly Thr Ser Tyr Ala Ser Gly Gly Glu Asp Gly Phe Val Arg
50 55 60
Leu His His Phe Asp Lys
65 70
<210> 10
<211> 4389
<212> DNA
<213> Ashbya gossypii
<220>
<221> CDS
<222> (640)..(1674)
<223>
<400>
gattcgctggagcgcgtgtgcaaggaggccgcgccggggcaggaactgctgctcatcttc60
ggggacctgggacacccacgtgccgccggcgggccgcgacttgttgcgcagcagcctgcg120
cgaacacggcgtggccgcctccttcctggaactgcacgcggcccagcacgctttcgtgcg180
cgacgagttctccaagggccgcttcgacggggccgtcacctccagctgtctggggctgat240
gttcgagcagttcgaccgcctgctgaagcacaaccttggtccgcgcgaggcagacgccgg300
cgagctggagcacgtctgctaaaactacgtaactgccgcttcgatacataacacgccttg360
ggccctgctggccctgctggccctgctggccctgctggccctgctggccctgctggccct420
gctggccctgccggtacgccgcatctctgcacttctacctgcacctttgcaccgggtcat480
cgtggtctagcaagtggctcgccaatatgaaaaattttcgactagttcgcaggccttaga540
gcactatcacccaagtgaacggaccagccagagcgcatctaagtcacttggagggtatct600
gatcacatcacacgcttggccatataccatacttgaaag atc atg 654
atg aga
ccg
Met Arg Ile Met
Pro
1 5
ttg atg gga cac gag cgt tcg ctc acg cag gtg aaa tat aac cgc gag 702
Leu Met Gly His Glu Arg Ser Leu Thr Gln Val Lys Tyr Asn Arg Glu
10 15 20
gga gac cta atc ttc acg tcg ggg aag gat aac gtt gcg tcg gtg tgg 750
Gly Asp Leu Ile Phe Thr Ser Gly Lys Asp Asn Val Ala Ser Val Trp
M/42319-PCT
CA 02458953 2004-02-27
' 0050/52814
22
25 30 35
tat gcg atg aac ggc gag cgt ctg gga acg ctg gag ggt cac aat ggt 798
Tyr Ala Met Asn Gly Glu Arg Leu Gly Thr Leu Glu Gly His Asn Gly
40 45 50
tcg att tgg tcg atc gac gtg gac cag cac acg gag tac gcg gtg acc 846
Ser Ile Trp Ser Ile Asp Val Asp Gln His Thr Glu Tyr Ala Val Thr
55 60 65
ggg agt gcg gac ttc agt gtg aag gtc tgg cgc gta cgc gac ggc agc 894
Gly Ser Ala Asp Phe Ser Val Lys Val Trp Arg Val Arg Asp Gly Ser
70 75 80 85
atc gcg cac tcg tgg gac acg cgc acg ccc gtg cgg cgc gtg gag ttt 942
Ile Ala His Ser Trp Asp Thr Arg Thr Pro Val Arg Arg Val Glu Phe
90 95 100
tcg ccc acc ggc gac cgt gtg ctt gcg gtg ctg gat aac gtg atg aac 990
Ser Pro Thr Gly Asp Arg Val Leu Ala Val Leu Asp Asn Val Met Asn
105 110 115
tac gcc ggc gcc atc gtg gtg ttc agc gtg acg cgg gat gcg aac aac 1038
Tyr Ala Gly Ala Ile Val Val Phe Ser Val Thr Arg Asp Ala Asn Asn
120 125 130
cag atc act ggc ttc aac agc ggc ctt tcc tgc gag atc ctg acg cag 1086
Gln Ile Thr Gly Phe Asn Ser Gly Leu Ser Cys Glu Ile Leu Thr Gln
135 140 145
gag ggc tgt gcg ccc gtg ctt gtg gcg tcg tgg tcg tat gac ggc aag 1134
Glu Gly Cys Ala Pro Val Leu Va1 Ala Ser Trp Ser Tyr Asp Gly Lys
150 155 160 165
tac atc gtg gcc ggg cac caa gac ggc aag atc agc aaa tac aac ggc 1182
Tyr Ile Val Ala Gly His Gln Asp Gly Lys Ile Ser Lys Tyr Asn G1y
170 175 180
gtcacg ggcgaatgc ctggaaatcaag gacctgcac aagcagcgcgtc 1230
ValThr GlyGluCys LeuGluIleLys AspLeuHis LysGlnArgVal
185 190 195
tccgac atccaattc tcgcttgaccgc acctacttc ctcacgacctcc 1278
SerAsp IleGlnPhe SerLeuAspArg ThrTyrPhe LeuThrThrSer
200 205 210
agagac agctacgcc aacctagtcgat gtcgagaca ttcgaggtcctg 1326
ArgAsp SerTyrAla AsnLeuValAsp ValGluThr PheGluValLeu
215 220 225
aagacc tacgaaact gactgtccgctg aacagcggt tgcatcaccccg 1374
LysThr TyrGluThr AspCysProLeu AsnSerGly CysIleThrPro
230 235 240 245
ctaaag gagttcgtc attctgggcggt ggccaggac gcgcgcgatgtc 1422
LeuLys GluPheVal IleLeuGlyGly GlyGlnAsp AlaArgAspVal
250 255 260
acg acc acc agt gcc cgc gag ggt aag ttc gag gcc aag ttc tac cac 1470
Thr Thr Thr Ser Ala Arg G1u Gly Lys Phe Glu Ala Lys Phe Tyr His
265 270 275
aag ctt ttc cag gtg gaa atc ggc cgt gtg gac gac cat ttc ggt ccc 1518
M/42319-PCT
CA 02458953 2004-02-27
' 0050/52814
23
Lys Leu Phe Gln Val Glu Ile Gly Arg Val Asp Asp His Phe Gly Pro
280 285 290
gtc aac tac atc gcc gtt tcc ccg cag ggc acc tcg tac gcc tcc ggc 1566
Val Asn Tyr Ile Ala Val Ser Pro Gln Gly Thr Ser Tyr Ala Ser Gly
295 300 305
ggt gag gac ggt ttc gtg cgc ctc cat cac ttc gac aag agc tac ttc 1614
Gly Glu Asp Gly Phe Val Arg Leu His His Phe Asp Lys Ser Tyr Phe
310 315 320 325
gac ttc aag ttc gac gtc gaa aaa agc gcc gac gcc cag aag aag gtc 1662
Asp Phe Lys Phe Asp Val Glu Lys Ser Ala Asp Ala Gln Lys Lys Val
330 335 340
gac act get gac cgctgagcta catacctctg taaactaccc tcttgaacag 1714
Asp Thr Ala Asp
345
ctattttctacgcccgcatcgtaccaggcaagcctacacacctatacactacctgctggc1774
cttctcggccttcagccgctccagccgctcgcgctccttgcgctcgtccgccgcctgctg1834
cttacgccgcaggatctccgcgtcactctccatccgcttcagggggtccccagacttttt1894
ctgccccttggcgctctccttctgcttcttcaggttcttctgccgtgcgagctcgcgctg1954
gtttcctctagccatccttagctgaagagtgtcggaggggccgccacggtggcagcccgc2014
cttgcttatctttgtggccagccctccccacgtgaggtatcacgtggcctcctccgactc2074
ggcggtctgaccttcggaaaaatcggaaaattaagccggtccggaatctccgccggaccg2134
gtgttcttcccctctcgcggtactcgagaaaaatttactgcagctgtttaagttgcgtct2194
catgcgtgcggcgttgtgcgaaccgtcagtgaaaacgtggaaaaaaaatgcatcaacgca2254
ggcgcatactaaatacgaaatatatatagtgggaaagcgcaggcatcgcgagttgcacac2314
aacaggtcgtaatgtgtcttaagcaaaaacaagagcgggcgaaataactgagygraatcc2374
ccctatattcaacaacagtccgcagtatttcccagatctgaactatttatctccatggca2434
cagttattcaaacggtgtcggcaccccaataccaattaacagttccatgattgggaaccc2494
aaacctttccaacgtccccatgaccaagacgtacgatccctacgatgttccacagtcgag2554
ctttcctgcctattttaatccgcgcgcagcgctgaacatgccccaccgcgagaaggttaa2614
ccaatggatagaaaatgttccaatacatattgttcaccgaagagtaccctgactcacgac2674
tgctatagcattgacgagtacatgaactgggaggaggatgaatttgacatgtctttgttc2734
cagcgcggggagaagacccagattaatatggcaaccgtcgacgaactattacaattccag2794
ctgaaacggataacctccatggttttaagactatacgaggaaagcccggaggtcccattg2854
gacaactctgatgctacatcttactgaaatactgattccacatcatcatgattaatactt2914
aatagttttagtatttatatagtatattattaaatagccacggggtgcacatcaacgctg2974
acgccgtacaacggctttcgggccccgacaacattttagcgcatagtaaaactaagtccc3034
M/42319-PCT
CA 02458953 2004-02-27
0050152814
24
atacacagcg aataatcgcccccaagaaagcttcgatcaaaacataagttactctcgagc3094
ggcaagatag gctaacaggaagaggcagtactattggacggggttagcgctgaaaggtgc3154
aaatttgggg ccatgagtaaggaacccggaaagaaggttacgctgaaggaacgcatggta3214
agcgcctctg ctggctcgctggtcacgtcactgtttctcacgccactggacgtggtccgc3274
gtgcggcttc aacagcaagaaatgcttccaagttgtacatgtacaggacagctgtcgaaa3334
ccggcaggga aagtgttttggcaggatgagtgctttgcaaacgtcggctgccgagagcct3394
gctgcgaggc tgcagggaactctggaggggctcaggaagatagcccaactagagggtctg3454
ccgactctgt ggcgagggctggggattacgctcgtaatggcggtgccggctaacgtggtg3514
tacttttccg gctatgaagcactgcgtgataactcgcccttggcatcccggctacctgtg3574
gcaaacccac tagtgtgtggagcatttgcgcggatattggctgcaactactattgcgccg3634
ctggagctat tgcgcacacggctccagagtgtgccccgcgcaagagacacagagcgtaca3694
atatatctga taggcgacctgctgcgagagatgcggcatgaggtttcggttatgggttac3754
cgtgcgctat ttaaaggcttggagatcactttatggagggacgtgcccttcagcgcaatc3814
tattggggaa catacgagttctgtaaaacccagttctgggcccgccatgccgcaacccat3874
aatgcatcaa actgggaccatttcatcggcagttttgcctgcggtagcatgggcggtgct3934
gttgcagcac ttttgacacatccttttgatgtgggcaagacccgcatgcagattgcgatt3994
gccagtccac agcagctaactgtggggggaaaagctacgaaaactgatgactcaagaggc4054
atgttctcat ttttgaatgccattaggaaatcagaaggtattagagcgctatataccggc4114
ctattaccta gggtgatgaagattgcaccaagttgcgccataatgatctcgacttatgaa4174
ctgtcgaaga agttcttcactagttgaactttgtttcttcctgtatataccaagtaattc4234
acactgttga tacacgatacagcatttttcttaaaaccctgtgatatacgcttgctgtag4294
tacacgccca aacggtgaggtctataattttacatgtccgcgagatggtattggatcggc4354
agaattttag agctgccgctgtagcccatccgtcg 4389
<210> 11
<211> 345
<212> PRT
<213> Ashbya gossypii
<400> 11
Met Arg Pro Ile Met Leu Met Gly His Glu Arg Ser Leu Thr Gln Val
1 5 10 15
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
Lys Tyr Asn Arg Glu Gly Asp Leu Ile Phe Thr Ser Gly Lys Asp Asn
" 20 25 30
Val Ala Ser Val Trp Tyr Ala Met Asn Gly Glu Arg Leu Gly Thr Leu
40 45
G1u Gly His Asn Gly Ser Ile Trp Ser Ile Asp Val Asp Gln His Thr
50 55 60
Glu Tyr Ala Val Thr Gly Ser Ala Asp Phe Ser Val Lys Val Trp Arg
65 70 75 80
Val Arg Asp Gly Ser Ile Ala His Ser Trp Asp Thr Arg Thr Pro Val
85 90 95 ,
Arg Arg Val Glu Phe Ser Pro Thr Gly Asp Arg Val Leu Ala Val Leu
100 105 110
Asp Asn Val Met Asn Tyr Ala Gly Ala Ile Val Val Phe Ser Val Thr
115 120 125
Arg Asp Ala Asn Asn Gln Ile Thr Gly Phe Asn Ser Gly Leu Ser Cys
130 135 140
Glu Ile Leu Thr Gln Glu Gly Cys Ala Pro Val Leu Val Ala Ser Trp
145 150 155 160
Ser Tyr Asp Gly Lys Tyr Ile Val Ala Gly His Gln Asp Gly Lys Ile
165 170 175
Ser Lys Tyr Asn Gly Val Thr Gly Glu Cys Leu Glu Ile Lys Asp Leu
180 185 190
His Lys Gln Arg Val Ser Asp Ile Gln Phe Ser Leu Asp Arg Thr Tyr
195 200 205
Phe Leu Thr Thr Ser Arg Asp Ser Tyr Ala Asn Leu Val Asp Val Glu
210 215 220
Thr Phe Glu Val Leu Lys Thr Tyr Glu Thr Asp Cys Pro Leu Asn Ser
225 230 235 240
Gly Cys Ile Thr Pro Leu Lys Glu Phe Val Ile Leu Gly Gly Gly Gln
245 250 255
Asp Ala Arg Asp Val Thr Thr Thr Ser Ala Arg Glu Gly Lys Phe Glu
260 265 270
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
26
Ala Lys Phe Tyr His Lys Leu Phe Gln Val Glu Ile Gly Arg Val Asp
275 280 285
Asp His Phe Gly Pro Val Asn Tyr Ile Ala Val Ser Pro Gln Gly Thr
290 295 300
Ser Tyr Ala Ser Gly Gly Glu Asp Gly Phe Val Arg Leu His His Phe
.305 310 315 320
Asp Lys Ser Tyr Phe Asp Phe Lys Phe Asp Val Glu Lys Ser Ala Asp
325 330 335
Ala Gln Lys Lys Val Asp Thr Ala Asp
340 345
<210> 12
<211> 1042
<212> DNA
<213> Ashbya gossypii
<220>
<221> misc_feature
<223> Oligo 45
<220>
<221> misc_feature
<223> Oligo 85
<400>
12
gatctgccgaaatcgttaatttcacctgtaggtcacgtgattgtgaattgtgtttgactg60
ttgcatccgtacattcggaggtgtgtgggttgtatagctgaagattctgcgtcgtccgac120
agactcgctcgcgcacaccgagcggagcacagtcggtttccacagcaggccaacatcttc180
aacagaagaggcagttcatttggagtggctcttagtgcaaaatacagcaaaatcaatcat240
aatggtatgtgtcaggcggtgtatagcgtgggatgatggcatgcagccttttcgttgggt300
atcgaggtgaccgttagaggcttaaatccgtgggacagaagtgcgcgacagcagcgcata360
ccgggttagccagcgagcggtagccgaggggtagatgcggccccgcaggttgccagcaat420
gtcattccaagcttgataggtgcgcggagtactaacatctcatctcaggccggtgttaaa480
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
.. 27
gcttttgaattgagaaccaagtccaaggagcaactggagcaacagttgatctccttgaag540
caggagr_tggctgctttgaaggtccagaagctatccagaccatcctLgccaaagatcaac600
accgtcagaaagagcattgctcgtgtcttgaccgtcatcaaccagaaccagagacaggct660
gtcagagagttgtacaagggcaagaagtaccagccaaaggacttgagagcaaagaagacc720
agagctttgagaagagctttgacgaagttcgaggctgctcagatcactgagaagcagaga780
aagaagcagattgctttcccacaaagaaagtacgctattaaggcctaaacgtctacggta840
aaccgttgtatgttaatttagtttacttttaagaacccatctttagacccgcgggctcaa900
gcggcggcggcctgccagagggagtagcaggcgaggcgcttttttgatagtgtggaatct960
atacaggaaaggtgactacttattgtttaccttgtttctttgatgctttgaactcctcga1020
ttctctgtttcaactcatgatc 1042
<210> 13
<211> 119
<212> PRT
<213> Ashbya gossypii
<220>
<221> misc_feature
<223> Oligo 85
<400> 13
Ala Gly Val Lys Ala Phe Glu Leu Arg Thr Lys Ser Lys Glu Gln Leu
1 5 10 15
Glu Gln Gln Leu Ile Ser Leu Lys Gln Glu Leu Ala Ala Leu Lys Val
20 25 30
Gln Lys Leu Ser Arg Pro Ser Leu Pro Lys Ile Asn Thr Val Arg Lys
35 40 45
Ser Ile Ala Arg Val Leu Thr Val Ile Asn Gln Asn Gln Arg Gln Ala
50 55 60
Val Arg Glu Leu Tyr Lys Gly Lys Lys Tyr Gln Pro Lys Asp Leu Arg
65 70 75 80
Ala Lys Lys Thr Arg Ala Leu Arg Arg Ala Leu Thr Lys Phe Glu Ala
Ml42319-PCT
CA 02458953 2004-02-27
° 0050/52814
. 28
85 90 95
Ala Gln Ile Thr Glu Lys Gln Arg Lys Lys Gln Ile Ala Phe Pro Gln
100 105 110
Arg Lys Tyr Ala Ile Lys Ala
115
<210> 14
<211> 1072
<212> DNA
<213> Ashbya gossypii
<220>
<221> CDS
<222> (92)..(307)
<223>
<220>
<221> misc_feature
<223> Oligo 85
<220>
<221> CDS
<222> (403)..(858)
<223>
<220>
<221> misc_feature
<222> (279)..(501)
<223> Intron
<400> 14
cggtgttccg tcgcgccttt ggcgctcact ttgcgatctg ccgaaatcgt taatttcacc 60
tgtaggtcac gtgattgtga attgtgtttg a ctg ttg cat ccg tac att cgg I12
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
29
Leu Leu His Pro Tyr Ile Arg
1 5
agg tgt gtg ggt tgt ata get gaa gat tct gcg tcg tcc gac aga ctc 160
Arg Cys Val Gly Cys Ile Ala Glu Asp Ser Ala Ser Ser Asp Arg Leu
15 20
get cgc gca cac cga gcg gag cac agt cgg ttt cca cag cag gcc aac 208
Ala Arg Ala His Arg Ala Glu His Ser Arg Phe Pro Gln Gln Ala Asn
25 30 35
atc ttc aac aga aga ggc agt tca ttt gga gtg get ctt agt gca aaa 256
Ile Phe Asn Arg Arg Gly Ser Ser Phe Gly Val A1a Leu Ser Ala Lys
40 45 50 55
tac agc aaa atc aat cat aat ggt atg tgt cag gcg gtg tat agc gtg 304
Tyr Ser Lys Ile Asn His Asn Gly Met Cys Gln Ala Val Tyr Ser Val
60 65 70
gga tgatggcatg cagcttttcg ttgggtatcg aggtgaccgt tagaggctta 357
Gly
aatccgtggg acagaagtgc gcgacagcag cgcataccgg gttag cca gcg agc ggt 414
Pro Ala Ser Gly
agc cga ggg gta gat gcg gcc ccg cag gtt gcc agc aat gtc att cca 462
Ser Arg Gly Val Asp Ala Ala Pro Gln Val Ala Ser Asn Val Ile Pro
85 90
agc ttg ata ggt gcg cgg agt act aac atc tca tct cag gcc ggt gtt 510
Ser Leu Ile Gly Ala Arg Ser Thr Asn Ile Ser Ser Gln Ala Gly Val
95 loo los
aaa get ttt gaa ttg aga acc aag tcc aag gag caa ctg gag caa cag 558
Lys Ala Phe Glu Leu Arg Thr Lys Ser Lys Glu Gln Leu Glu Gln Gln
110 115 120
ttg atc tcc ttg aag cag gag ttg get get ttg aag gtc cag aag cta 606
Leu Ile Ser Leu Lys Gln Glu Leu Ala Ala Leu Lys Val Gln Lys Leu
125 130 135 140
tcc aga cca tcc ttg cca aag atc aac acc gtc aga aag agc att get 654
Ser Arg Pro Ser Leu Pro Lys Ile Asn Thr Val Arg Lys Ser Ile~Ala
145 150 155
cgt gtc ttg acc gtc atc aac cag aac cag aga cag get gtc aga gag 702
Arg Val Leu Thr Val Ile Asn Gln Asn Gln Arg Gln Ala Val Arg Glu
160 165 170
ttg tac aag ggc aag aag tac cag cca aag gac ttg aga gca aag aag 750
Leu Tyr Lys Gly Lys Lys Tyr Gln Pro Lys Asp Leu Arg Ala Lys Lys
175 180 185
acc aga get ttg aga aga get ttg acg aag ttc gag get get cag atc 798
Thr Arg Ala Leu Arg Arg Ala Leu Thr Lys Phe GIu A1a Ala Gln Ile
190 195 200
act gag aag cag aga aag aag cag att get ttc cca caa aga aag tac 846
Thr Glu Lys Gln Arg Lys Lys Gln Ile Ala Phe Pro Gln Arg Lys Tyr
205 210 215 220
M/42319-PCT
CA 02458953 2004-02-27
0050!52814
get att aag gcc taaacgtcta cgtaaaccgt tgtatgttaa tttagtttac 898
Ala Ile Lys Ala
ttttaagaacccatctttagacccgcgggctcaagcggcggcggcctgccagagggagta958
gcagcgagcgcttttttgatagtgtggaatctatacaggaaaggtgactacttattgttt1018
accttgtttctttgatgctttgaactcctcgattctctgtttcaactcatgatc 1072
<210> 15
<211> 72
<212> PRT
<213> Ashbya gossypii
<220>
<221> misc_feature
<223> Oligo 85
<220>
<221> misc_feature
<222> (279)..(501)
<223> Intron
<400> 15
Leu Leu His Pro Tyr Ile Arg Arg Cys Val Gly Cys Ile Ala Glu Asp
1 5 10 15
Ser Ala Ser Ser Asp Arg Leu Ala Arg Ala His Arg Ala Glu His Ser
20 25 30
Arg Phe Pro Gln Gln Ala Asn Ile Phe Asn Arg Arg Gly Ser Ser Phe
40 45
Gly Val Ala Leu Ser Ala Lys Tyr Ser Lys Ile Asn His Asn Gly Met
50 55 60
Cys Gln Ala Val Tyr Ser Val Gly
65 70
<210> 16
<211> 152
<212> PRT
Mi42319-PCT
CA 02458953 2004-02-27
0050/52814
31
<213> Ashbya gossypii
<220>
<221> misc feature
<223> Oligo 85
<220>
<221> misc_feature
<222> (279)..(501)
<223> Intron
<400> 16
Pro Ala Ser Gly Ser Arg Gly Val Asp Ala Ala Pro Gln Val Ala Ser
1 5 10 15
Asn Val Ile Pro Ser Leu Ile Gly Ala Arg Ser Thr Asn Ile Ser Ser
20 25 30
Gln Ala Gly Val Lys Ala Phe Glu Leu Arg Thr Lys Ser Lys Glu Gln
35 40 45
Leu Glu Gln Gln Leu Ile Ser Leu Lys Gln Glu Leu Ala Ala Leu Lys
50 55 60
Val Gln Lys Leu Ser Arg Pro Ser Leu Pro Lys Ile Asn Thr Val Arg
65 70 75 80
Lys Ser Ile Ala Arg Val Leu Thr Val I1e Asn Gln Asn Gln Arg Gln
85 90 95
Ala Val Arg Glu Leu Tyr Lys Gly Lys Lys Tyr Gln Prow Lys Asp Leu
100 105 110
Arg Ala Lys Lys Thr Arg Ala Leu Arg Arg Ala Leu Thr Lys Phe Glu
115 120 125
Ala Ala Gln Ile Thr Glu Lys Gln Arg Lys Lys Gln Ile Ala Phe Pro
130 135 140
Gln Arg Lys Tyr Ala Ile Lys Ala
145 150
<210> 17
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
32
<211> 1011
<212> DNA
<213> Ashbya gossypii
<220>
.<221> misc_feature
<223> Oligo 133
<220>
<221> misc_feature
<222> (439)..(439)
<223> unknown nucleotide
<400>
17
cttaccgcgtctcagcagacgtttctgcttctttgagaggggcactggttgagtcaagtc60
gatttcaatttcatcctcggcctttctcttcttggtggggtcgcttagcgctttagcttg120
catatcaacctttgctggccgtggccgattcttcgtctgacatagctccacgcagtagga180
atgtatgtagtgaccctatggattatggtcaagaagtgcgatgcgtgcggagaactatgc240
gttacaccatagctcatcgcatctcaaaaattttcgaatcaccgaaaattcaggtcacgt300
gatttataataggccctcacttgaaaatctcagtccaccagcagacaaacatatgtcggt360
tgctgaacggggcacgacaaaactggcggcatcccgtgtaacgctcgcaagattatttca420
gaaccaaattactctttcngkcgkatttttgtatctggtatataccatctacccattaaa480
taagccgagcccagtccgtgatttgcgcggcatcaacattgcatagtatggcggtactat540
catgtcacttgccttgtaaaccgatgattaattagctcgaattgctgaagcgggcgaccc600
ttgctaaacgtactaatcaacgtctctcttcattataggtaaaacgtcaggggatcggca660
cgcagatcttgaactaaaataaaataacgaaatgggatgaatgtataattagagcagtca720
gatagttccatgagaatatgagaataaccgagaacgaactagagttccctagatttcagg780
ccgtgggataagggcttcggtgtacggcgctttaagttcacctcaaaaatctcttcaacc840.
tagcaaagaatccggaccttctctttggttcagtggaagagcggctagggctagaattgc900
tgttcttgctagaaggcctgccgttgtgagcatcaaagctctgcttcgtgcttggagcgg960
tagccatactagcagcatccttagaatgacgtgactgcgttacagaagatc 1011
M/42319-PCT
CA 02458953 2004-02-27
' 0050/52814
33
<210> I8
<211> 38
<212> PFT
<213> Ashbya gossypii
<220>
<221> misc_feature
<223> Oligo 133
<400> 18
Lys Ala Leu Ser Asp Pro Thr Lys Lys Arg Lys Ala Glu Asp Glu Ile
1 5 10 15
Glu Ile Asp Leu Thr Gln Pro Val Pro Leu Ser Lys Lys Gln Lys Arg
20 25 30
Leu Leu Arg Arg Gly Lys
<210> 19
<211> 3091
<212> DNA
<213> Ashbya gossypii
<220>
<221> CDS
<222> (1371)..(2495)
<223>
<220>
<221> misc_feature
<223> Oligo 133
<400> 19
ttctgaggct catgtgacac cggtaactaa cgttccagta tctgagcaga tattcttcgc 60
M/42319-PCT
CA 02458953 2004-02-27
' 0050/52814
34
cgaaggtgac tcagccagtt gtcgaatcaa gccctgccac tgaatcggag aaggtaatta 120
aggcacctgc tgttgctgct cacgagatat tcccacctca tgtggtcaag ctaacaccgg 180
tgtcgcctaagaagaagacgtccaccgggagcttgaagaagcagattattgcgcctagag240
aagaggagcagccacagcctgttcacgcagtgacaggtactgccattgagctcgaggagg300
ttccatcgacggtggaacttgtcgaggtacctccatctgaagtgcccacgactcattccc360
ctattgtcgtcggaataccactatcaaatgacaagattgtcgtcgcccctgtgcagatac420
aaggagatatcacgacacagacgtctgctccaagtactcagtacactgacacatatgctg480
ctcccgtccgccaggatgtgcctcttgctacgaccgctggcagatcttctgtaacgcagt540
cacgtcattctaaggatgctgctagtatggctaccgctccaagcacgaagcagagctttg600
atgctcacaacggcaggccttctagcaagaacagcaattctagccctagccgctcttcca660
ctgaaccaaagagaaggtccggattctttgctaggttgaagagatttttgaggtgaactt720
aaagcgccgtacaccgaagcccttatcccacggcctgaaatctagggaactctagttcgt780
tctcggttattctcatattctcatggaactatctgactgctctaattatacattcatccc840
atttcgttattttattttagttcaagatctgcgtgccgatcccctgacgttttacctata900
atgaagagagacgttgattagtacgtttagcaagggtcgcccgcttcagcaattcgagct960
aattaatcatcggtttacaaggcaagtgacatgatagtaccgccatactatgcaatgttg1020
atgccgcgcaaatcacggactgggctcggcttatttaatgggtagatggtatataacaga1080
tacaaaaatacgaccgaaagagtaatttggttctgaaataatcttgcgagcgttacacgg1140
gatgccgccagttttgtcgtgccccgttcagcaaccgacatatgtttgtctgctggtgga1200
ctgagattttcaagtgagggcctattataaatcacgtgacctgaattttcggtgattcga1260
aaatttttgagatgcgatgagctatggtgtaacgcatagttctccgcacgcatcgcactt1320
cttgaccataatccatagggtcactacatacattcctactgcgtggagctatg tca 1376
Met Ser
'. 1
gac gaa atg caa aaa gcg 1424
gaa tcg get
gcc acg
gcc agc
aaa gtt
gat
Asp Glu Met Gln Lys Ala
Glu Ser Ala
Ala Thr
Ala Ser
Lys Val
Asp
10 15
cta agc ccc acc gat gaa gaa atc 1472
gac aag aag att
aga aag
gcc gag
Leu Ser Asp Glu Glu Ile
Asp Pro Ile
Thr Lys
Lys Arg
Lys Ala
Glu
20 25 30
gac ttg caa cca g ccc cag aaa ctg ctg 1520
act gt ctc tca cgt
aag aag
Asp Leu Gln Pro l Pro Gln Lys Leu Leu
Thr Va Leu Ser Arg
Lys Lys
35 40 45 50
aga cgc aag atc c ctc ag ctc gag aag aac atc 1568
ggt ac gaa c agc ttc
Arg Arg Glu Lys Asn Ile
Gly Lys Phe
Ile Thr
Leu Glu
Gln Leu
Ser
55 60 65
gat caa tcc atc g gag ag aac caa aag aca gca 1616
aag ga tac a gag gaa
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
Asp Gln Lys Ser Ile Glu Glu Tyr Lys Asn Glu Gln Lys Glu Thr Ala
70 75 80
gag aac gac gat gcc gaa cca get gcc gag gag gag cca aag cct gcg 1664
Glu Asn Asp Asp Ala Glu Pro Ala Ala Glu Glu Glu Pro Lys Pro Ala
85 90 95
ccc cgc aaa gag aag aag ttc ggc gtc tgg atc ggt aac atg get ttc 1712
Pro Arg Lys Glu Lys Lys Phe Gly Val Trp Ile Gly Asn Met Ala Phe
100 105 110
gac acc acg cag gag gag ctt cgc cgc ttt gtt gtt tcc aag acc get 1760
Asp Thr Thr Gln Glu Glu Leu Arg Arg Phe Val Val Ser Lys Thr Ala
115 120 125 130
ggc atg gag gca ggc gag gtc aca gac get gac atc gtg cgt gtg aat 1808
Gly Met Glu Ala Gly G1u Val Thr Asp Ala Asp Ile Val Arg Val Asn
135 140 145
atg ccg ctg gcc aag aac gac ggc aaa cag atc aaa aac aag ggc ttt 1856
Met Pro Leu Ala Lys Asn Asp Gly Lys Gln Ile Lys Asn Lys Gly Phe
150 155 160
gcg tac gtg gac ttt gcg act agt gcg cag atg gat gca gta atc ggc 1904
Ala Tyr Val Asp Phe Ala Thr Ser Ala Gln Met Asp Ala Val Ile Gly
165 170 175
ctc agc gaa gca cag ctc aac gga cgc aac ttg ctg atc aag aac gcc 1952
Leu Ser Glu Ala Gln Leu Asn Gly Arg Asn Leu Leu Ile Lys Asn Ala
180 185 190
aag agc tac gac ggc cgc ccg gcg aag aac gac ctc atc tcg atg tcc 2000
Lys Ser Tyr Asp Gly Arg Pro Ala Lys Asn Asp Leu Ile Ser Met Ser
195 200 205 210
aaa aac cct cct tct cgc att ttg ttt gtc ggc aac ctc tcc ttc gac 2048
Lys Asn Pro Pro Ser Arg Ile Leu Phe Val Gly Asn Leu Ser Phe Asp
215 220 225
acc acc gat gag ctg ctg aaa aag cat ttc cag cac tgc ggc gag atc 2096
Thr Thr Asp Glu Leu Leu Lys Lys His Phe Gln His Cys Gly Glu Ile
230 235 240
gtc aaa atc cgc atg gcc acc ttc cag gac tcc ggc aag tgc aag ggt 2144
Val Lys Ile Arg Met Ala Thr Phe Gln Asp Ser Gly Lys Cys Lys Gly
245 250 255
ttc gcc ttc gtt gac ttc cgc gac gag gcc ggt gcc acc gcc gcc ctc 2192
Phe Ala Phe Val Asp Phe Arg Asp Glu Ala Gly Ala Thr Ala Ala Leu
260 265 270
aca gac cgc tcc tgt cgc gcc ata gca ggt cgc ccg ctc cgg atg gag 2240
Thr Asp Arg Ser Cys Arg Ala Ile Ala Gly Arg Pro Leu Arg Met Glu
275 280 285 290
tac ggc gag gac cgc agc aag cgc cac gtc cgc agc cgc ccg gcg ccc 2288
Tyr Gly Glu Asp Arg Ser Lys Arg His Val Arg Ser Arg Pro Ala Pro
295 300 305
tcg ctc gtc gac gcc gag cct cat gcg cct gcc ccc get gac cca gca 2336
Ser Leu Val Asp Ala Glu Pro His Ala Pro Ala Pro Ala Asp Pro Ala
310 315 320
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
36
_ ccc gcg ccc gcg ccc gcg cct gcc cct agg gcg ccc cgg ccc cgc aag 2384
Pro Ala Pro Ala Pro Ala Pro Ala Pro Arg Ala Pro Arg Pro Arg Lys
325 330 335
ccc acg cgc aat gac cac cac agc cgc cct aag agc agc gtc gcc ctc 2432
Pro Thr Arg Asn Asp His His Ser Arg Pro Lys Ser Ser Val Ala Leu
340 345 350
gcc tcc gcc cag cgc gcc tca gcc gcc atc gtt ccc tct cag ggt aag 2480
Ala Ser Ala Gln Arg Ala Ser Ala Ala Ile Val Pro Ser Gln Gly Lys
355 360 365 370
aag gtc aag ttt gat tagcatgcat ctctacatac cgaatgtaca ttagttattg 2535
Lys Val Lys Phe Asp
375
tgcccgctgcgttgctcggtctgctaccctacgcccgcataccgtccgttctttcgactc2595
tcgcctcggcgtatgtgatgcagcacactgcatgcagcatcgaccccggggaacatgaac2655
aaccacgtactgccaacatactagccggccaatgcaaggcaaaaaggaccaagatcgagg2715
tcagggatgtcacaagatgatatgcccttgtgtgaaagtatttttggtcaacctggttgc2775
tacgttgagtacctaaaaaaggaaggatccattaggctcgataggttctacggtacaatt2835
atattctcgacacggcattggatgcaagactctgaggaagcggaggtgtaactactagga2895
gagttaagcatggggtataacaatacgagctctccaataggctcagggcatgggagttcg2955
ggggtggaaaaggcatccaggcccagttcggtgcagtcgacgacgcagatgggagcacgt3015
cattccgagagcatgaatctgtccgtgagctggctctcgacggatgcgtggagcgcggcg3075
gagtttgcgacactgg 3091
<210> 20
<211> 375
<212> PRT
<213> Ashbya gossypii
<220>
<221> misc_feature
<223> Oligo 133
<400> 20
Met Ser Asp Glu Glu Ser Ala Thr Ala Ser Lys Val Asp Met Gln Ala
1 5 10 15
Lys Ala Leu Ser Asp Pro Thr Lys Lys Arg Lys Ala Glu Asp Glu Ile
20 25 30
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
37
Glu Ile Asp Leu Thr Gln Pro Val Pro Leu Ser Lys Lys Gln Lys Arg
35 40 45
Leu Leu Arg Arg Gly Lys Ile Thr Leu Glu Gln Leu Ser Glu Lys Phe
50 55 60
Asn Ile Asp Gln Lys Ser Ile Glu Glu Tyr Lys Asn Glu Gln Lys Glu
65 70 75 g0
Thr Ala Glu Asn Asp Asp Ala Glu Pro Ala Ala Glu Glu Glu Pro Lys
85 90 95
Pro Ala Pro Arg Lys Glu Lys Lys Phe Gly Val Trp Ile Gly Asn Met
100 105 110
Ala Phe Asp Thr Thr Gln Glu Glu Leu Arg Arg Phe Val Val Ser Lys
115 120 125
Thr Ala Gly Met Glu Ala Gly Glu Val Thr Asp Ala Asp Ile Val Arg
130 135 140
Val Asn Met Pro Leu Ala Lys Asn Asp Gly Lys Gln Ile Lys Asn Lys
145 150 155 160
Gly Phe Ala Tyr Val Asp Phe Ala Thr Ser Ala Gln Met Asp Ala Val
165 170 175
Ile Gly Leu Ser Glu Ala Gln Leu Asn Gly Arg Asn Leu Leu Ile Lys
180 185 190
Asn Ala Lys Ser Tyr Asp Gly Arg Pro Ala Lys Asn Asp Leu Ile Ser
195 200 205
Met Ser Lys Asn Pro Pro-Ser Arg Ile Leu Phe Val Gly Asn Leu Ser
210 215 220
Phe Asp Thr Thr Asp Glu Leu Leu Lys Lys His Phe Gln His Cys Gly
225 230 235 240
Glu Ile Val Lys I1e Arg Met Ala Thr Phe Gln Asp Ser Gly Lys Cys
245 250 255
Lys Gly Phe Ala Phe Val Asp Phe Arg Asp Glu Ala Gly Ala Thr Ala
260 265 270
Ala Leu Thr Asp Arg Ser Cys Arg Ala Ile Ala Gly Arg Pro Leu Arg
275 280 285
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
- 38
Met Glu Tyr Gly Glu Asp Arg Ser Lys Arg His Val Arg Ser Arg Pro
290 295 300
Ala Pro Ser Leu Val Asp Ala Glu Pro His Ala Pro Ala Pro Ala Asp
305 310 315 320
Pro Ala Pro Ala Pro Ala Pro Ala Pro Ala Pro Arg Ala Pro Arg Pro
325 330 335
Arg Lys Pro Thr Arg Asn Asp His His Ser Arg Pro Lys Ser Ser Val
340 345 350
Ala Leu Ala Ser Ala Gln Arg Ala Ser Ala Ala Ile Val Pro Ser Gln
355 360 365
Gly Lys Lys Val Lys Phe Asp
370 375
<210> 21
<211> 1687
<212> DNA
<213> Ashbya gossypii
<220>
<221> misc feature
<223> Oligo 172
<400>
21
gatcagccatgtgtcatctattgcacagctaaaccgtcgcatataccagcaggatagaga60
gggcgatgttctgcggaatattcctgtagtgtaccacagagctagttcgtcaacctgtgg120
cctggtccacctcactatccttctccctatcaacgaggagaccgctctatctgtactcac180
gacagcaggccagccaacctttgctgttcgcatccccgcagatccagtagcgagggcact240
gattgctcttagcgacacccccattgctgcgccgtcggctaacgtctcaactaggccttc300
tccgacggccgctgagcatgtataccatgacttaaagggaaagataccacctaattctag360
atggtggaagttgccgtgttggggttgagtctactgtcatcgatggcttggtaaatccgc420
caatgttgttacgtcctggaggatttacgtatgaagaaatcatcgaactaggcggggagc480
aatggtcccattgtaaagttgagaataggatgactgtagggagtggggaaaaggttagaa540
ctcccggtatgaagtacaaacattactctcctagggcctccactgtagcatttgccccaa600
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
39
ttaacgatga tcttccaacg agcgaaagga tgaagattgt gacctccgaa ataatgaaat 660
acatgacaag ccatggcacc gataagcgcc aaaaagtggg gctactgaca agcattatgt 720
tccccaataa cttactggaa tccattacgg acgaagttga tgttgtggtt tattcattgg 780
gctcctctgg gaaagaagtt caatcgaatt tgtttgccat gctgcgaagg ctggacgagg 840
aagatgaggt ggatttgata tttgttgaag gtattagcga taggaatgag ggactggcag 900
tgatgaatag attaagaaaa gccgctgggg ggaacgtagt gtcattttaa tgaaccgggt 960
agtcgcacat ttcatcgtca atagaaacag ccggtgggca atattgatcg atcgttttgt 1020
gtcgcttgtt ggataacttt atctgataaa tacaccctat atgcttgtgt atatgtttag 1080
tatataaatg actttatcat ctctggatga aaaaataaga gaaaacaaca tacgcactct 1140
gtgaattaaa ccatggaaaa gtaatatgcg tcttgatggg tattcttttt ggcgtaatac 1200
tttcgaactt catctgcaat gaaaacactg ctactgatta caatcaaata aatgagatcc 1260
cccaggctca ggcgctctgt cttgaagata ttctggaaaa atggaatgta aatagcgcac 1320
aactgaccta gtaatgagaa accaacagca tagttaaaca tcttattatt gaagatacca 1380
atttcgaaaa tggacttcgt aggcatgcct acacgctaga ggctgctgaa catatcaaaa 1440
aacacgaaac aggtaaacgt cattgtggtg tctctcgcag taacctgtcc atcctcagtc 1500
atttccttga tgaacacgta gatagtacca ccaatgataa aggctgcatt gataaggagt 1560
ctccgcataa cttggggagg tcaagatctt gtctgaacgt tttcttggag gcttcctcat 1620
tacttcgtgg tcaactggct ccacacctag ggattgcgcg ggtggaccgt ccatcaatat 1680
gttgatc
1687
<210> 22
<211> 116
<212> PRT
<213> Ashbya gossypii
<220>
<221> misc feature
<223> Oligo 172
<400> 22
Ile Ser His Val Ser Ser Ile Ala Gln Leu Asn Arg Arg I1e Tyr Gln
1 5 10 15
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
Gln Asp Arg Glu Gly Asp Val Leu Arg Asn Ile Pro Val Val Tyr His
20 25 30
Arg Ala Ser Ser Ser Thr Cys Gly Leu Val His Leu Thr Ile Leu Leu
35 40 45
Pro Ile Asn Glu Glu Thr Ala Leu Ser Val Leu Thr Thr Ala Gly Gln
55 60
Pro Thr Phe Ala Val Arg Ile Pro Ala Asp Pro Val Ala Arg Ala Leu
65 70 75 80
Ile Ala Leu Ser Asp Thr Pro Ile Ala Ala Pro Ser Ala Asn Val Ser
85 90 95
Thr Arg Pro Ser Pro Thr Ala Ala Glu His Val Tyr His Asp Leu Lys
100 105 110
Gly Lys Ile Pro
115
<210> 23
<211> 204
<212> PRT
<213> Ashbya gossypii
<220>
<221> misc_feature
<223> Oligo 172
<400> 23
Arg Glu Arg Tyr His Leu Ile Leu Asp Gly Gly Ser Cys Arg Val Gly
1 5 10 15
Val Glu Ser Thr Val Ile Asp Gly Leu Val Asn Pro Pro Met Leu Leu
20 25 30
Arg Pro Gly Gly Phe Thr Tyr Glu Glu Ile Ile Glu Leu Gly Gly Glu
35 40 45
Gln Trp Ser His Cys Lys Val Glu Asn Arg Met Thr Val Gly Ser Gly
50 55 60
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
41
Glu Lys Val Arg Thr Pro Gly Met Lys Tyr Lys His Tyr Ser Pro Arg
65 70 75 80
Ala Ser Thr Val Ala Phe Ala Pro Ile Asn Asp Asp Leu Pro Thr Ser
85 90 95
Glu Arg Met Lys Ile Val Thr Ser Glu Ile Met Lys Tyr Met Thr Ser
100 105 110
His Gly Thr Asp Lys Arg Gln Lys Val Gly Leu Leu Thr Ser Ile Met
115 120 125
Phe Pro Asn Asn Leu Leu Glu Ser Ile Thr Asp Glu Val Asp Val Val
130 135 140
Val Tyr Ser Leu Gly Ser-Ser Gly Lys Glu Val Gln Ser Asn Leu Phe
145 150 155 160
Ala Met Leu Arg Arg Leu Asp Glu Glu Asp Glu Val Asp Leu Ile Phe
165 170 175
Val Glu Gly Ile Ser Asp Arg Asn Glu Gly Leu Ala Val Met Asn Arg
180 185 190
Leu Arg Lys Ala Ala Gly Gly Asn Val Val Ser Phe
195 200
<210> 24
<211> 2641
<212> DNA
<213>~ Ashbya gossypii
<220>
<221> CDS
<222> (277)..(1476)
<223>
<220>
<221> mist feature
<223> Oligo 172
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
42
<400> 24
caagaccaat ccggtcccat tctatcgga acgttgttgttcggagca ccataccgtt 60
c ga
tgatggggcg gcaaaggcgt t cgatcacg tgacataact gagaaaaatc
120
gaattacat tt
gctgcgtctt cgaactgctc tggcatccg gttgtatgtctataatgaactgatgccg
180
g cc
cagaacacaa gtgtatttgg ttgacagt ttatgcagag gtccttctct
240
tggcctcgaa
tt
tttcttcgga ggtcaggttt gtcatataacact aaggtactg 294
tcatagcgca
at
TyrAsnThr LysValLeu
1 5
agggtagaccca agtgcg atacacttctcg gcaactgcg catattgat 342
ArgValAspPro SerAla IleHisPheSer AlaThrAla HisIleAsp
10 15 20
gggtccctgccg cggatt tcggacccagag acggagaaa cacttactc 390
GlySerLeuPro ArgIle SerAspProGlu ThrGluLys HisLeuLeu
25 30 35
gaggetgccaga cttatc cgggatgatggc gagacggtt gcgtttccg 438
GluAlaAlaArg LeuIle ArgAspAspGly GluThrVal AlaPhePro
40 45 50
acagaaactgta tatgga ctgggggggtcg tctctgaat gatacttcg 486
ThrGluThrVal TyrGly LeuGlyGlySer SerLeuAsn AspThrSer
55 60 65 70
gtgcgcaatatc tacaag gcaaagaacaga cccagtgac aatccactg 534
ValArgAsnIle TyrLys AlaLysAsnArg ProSerAsp AsnProLeu
75 80 85
atcagccatgtg tcatct attgcacagcta aaccgtcgc atataccag 582
IleSerHisVal SerSer IleAlaGlnLeu AsnArgArg IleTyrGln
90 95 100
caggatagagag ggcgat gttctgcggaat attcctgta gtgtaccac 630
GlnAspArgGlu GlyAsp ValLeuArgAsn IleProVal ValTyrHis
105 110 115
-gagctagttcgt caactg tggcctggtcca ctcactatc cttctccct 678
GluLeuValArg GlnLeu TrpProGlyPro LeuThrIle LeuLeuPro
120 125 130
atcaacgaggag accget ctatctgtactc acgacagca ggccagcca 726
IleAsnGluGlu ThrAla LeuSerValLeu ThrThrAla GlyGlnPro
135 140 145 150
acctttgetgtt cgcatc cccgcagatcca gtagcgagg gcactgatt 774
ThrPheAlaVal ArgIle ProAlaAspPro ValAlaArg AlaLeuIle
155 160 165
getcttagcgac accccc attgetgcgccg tcggetaac gtctcaact 822
AlaLeuSerAsp ThrPro IleAlaAlaPro SerAlaAsn ValSerThr
170 175 180
aggccttctccg acggcc getgagcatgta taccatgac ttaaaggga 870
ArgProSerPro ThrAla AlaGluHisVal TyrHisAsp LeuLysGly
185 190 195
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
43
aag ata cca cta att cta gat ggt gga agt tgc cgt gtt ggg gtt gag 918
Lys Ile Pro Leu Ile Leu Asp Gly Gly Ser Cys Arg Val Gly Val Glu
200 205 210
tct act gtc atc gat ggc ttg gta aat ccg cca atg ttg tta cgt cct 966
Ser Thr Val Ile Asp Gly Leu Val Asn Pro Pro Met Leu Leu Arg Pro
215 220 225 230
gga gga ttt acg tat gaa gaa atc atc gaa cta ggc ggg gag caa tgg 1014
Gly Gly Phe Thr Tyr Glu Glu Ile Ile Glu Leu Gly Gly Glu Gln Trp
235 240 245
tcc cat tgt aaa gtt gag aat agg atg act gta ggg agt ggg gaa aag 1062
Ser His Cys Lys Val Glu Asn Arg Met Thr Val Gly Ser Gly Glu Lys
250 255 260
gttagaactcccggt atgaagtac aaacattac tctcctagggcc tcc 1110
ValArgThrProGly MetLysTyr LysHisTyr SerProArgAla Ser
265 270 275
actgtagcatttgcc ccaattaac gatgatctt ccaacgagcgaa agg 1158
ThrValAlaPheAla ProIleAsn AspAspLeu ProThrSerGlu Arg
280 285 290
atgaagattgtgacc tccgaaata atgaaatac atgacaagccat ggc 1206
MetLysIleValThr SerGluIle MetLysTyr MetThrSerHis Gly
295 300 305 310
accgataagcgccaa aaagtgggg ctactgaca agcattatgttc ccc 1254
ThrAspLysArgGln LysValGly LeuLeuThr SerIleMetPhe Pro
315 320 325
aataacttactggaa tccattacg gacgaagtt gatgttgtggtt tat 1302
AsnAsnLeuLeuGlu SerIleThr AspGluVal AspValValVal Tyr
330 335 340
tcattgggctcctct gggaaagaa gttcaatcg aatttgtttgcc atg 1350
SerLeuGlySerSer GlyLysGlu ValGlnSer AsnLeuPheAla Met
345 350 355
ctgcgaaggctggac gaggaagat gaggtggat ttgatatttgtt gaa 1398
LeuArgArgLeuAsp GluGluAsp GluValAsp LeuIlePheVat.Glu
360 365 370
ggt att agc gat agg aat gag gga ctg gca gtg atg aat aga tta aga 1446
Gly Ile Ser Asp Arg Asn Glu Gly Leu Ala Val Met Asn Arg Leu Arg
375 380 385 390
aaa gcc get ggg ggg aac gta gtg tca ttt taatgaaccg ggtagtcgca 1496
Lys Ala Ala Gly Gly Asn Val Val Ser Phe
395 400
catttcatcgtcaatagaaacagccggtgggcaatattgatcgatcgttttgtgtcgctt1556
gttggataactttatctgataaatacaccctatatgcttgtgtatatgtttagtatataa1616
atgactttatcatctctggatgaaaaaataagagaaaacaacatactgcactctgtgaat1676
taaaccatggaaaagtaatatgcgtcttgatgggtattctttttggcgtaatactttcga1736
acttcatctgcaatgaaaacactgctactgattacaatcaaataaatgagatcccccagg1796
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
44
ctcaggcgct ctgtcttgaagatattctggaaaaatggaatgtaaatagcgcacaactga1856
cctagtaatg agaaaccaacagcatagttaaacatcttattattgaagataccaatttcg1916
aaaatggact tcgtaggcatgcctacacgctagaggctgctgaacatatcaaaaaacacg1976
aaacaggtaa acgtcattgtggtgtctctcgcaggtaacctgtccatcctcagtcatttc2036
cttgatgaac acgtagatagtaccaccaatgataaaggctgcattgataaggagtctccg2096
-cataacttggggagtcaagatcttgtctgaacgttttcttggaggcttcctcattacttc2156
gtggtcaact ggctccacacctagggattgcgcgggtggaccgtccatcaatatgttgat2216
ccataatatc tgcatggcatttaacggattttgaagcttaaatgcagtagctatggcgac2276
aagtgacaag gctgcgacagaggtagacaattgaaacgttagaaaactctgaatattgtt2336
aaaaataccc ttgccttcttcaatagcggttaggatggtgctgaagtcatcatcagttaa2396
taccatatca aaagcttctttcgcaacatcagtacccatatggcccatggcgacaccgat2456
atcagccaat ttcaatgcaggtgcgtcgttaacaccatctcctgtcatagcgacaatgtc2516
gcccctcttc tgcaaagcacgcacaatattcagcttgtgttcacgtgtagcccgagcaaa2576
aatattcaca tgatcgatccgccggccagatggtccatcaatcctttggtcaagtctatc2636
accgg 2641
<210> 25
<211> 400
<212> PRT
<213> Ashbya gossypii
<220>
<221> mist feature
<223> Oligo 172
<400> 25
Tyr Asn Thr Lys Val Leu Arg Val Asp Pro Ser Ala Ile His Phe Ser
1 5 10 15
Ala Thr Ala His Ile Asp Gly Ser Leu Pro Arg Ile Ser Asp Pro Glu
20 25 30
Thr Glu Lys His Leu Leu Glu Ala Ala Arg Leu Ile Arg Asp Asp Gly
35 40 45
Glu Thr Val Ala Phe Pro Thr Glu Thr Val Tyr Gly Leu Gly Gly Ser
50 55 60
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
.. 45
Ser Leu Asn Asp Thr Ser Val Arg Asn Ile Tyr Lys Ala Lys Asn Arg
65 70 75 80
Pro Ser Asp Asn Pro Leu Ile Ser His Val Ser Ser Ile Ala Gln Leu
85 90 95
Asn Arg Arg Ile Tyr Gln Gln Asp Arg Glu Gly Asp Val Leu Arg Asn
100 105 110
Ile Pro Val Val Tyr His Glu Leu Val Arg Gln Leu Trp Pro Gly Pro
115 120 125
Leu Thr Ile Leu Leu Pro Ile Asn Glu Glu Thr Ala Leu Ser Val Leu
130 135 140
Thr Thr Ala Gly Gln Pro Thr Phe Ala Val Arg Ile Pro Ala Asp Pro
145 150 155 160
Val Ala Arg Ala Leu Ile Ala Leu Ser Asp Thr Pro Ile Ala Ala Pro
165 . 170 175
Ser Ala Asn Val Ser Thr Arg Pro Ser Pro Thr Ala Ala Glu His Val
180 185 190
Tyr His Asp Leu Lys Gly Lys Ile Pro Leu Ile Leu Asp Gly Gly Ser
195 200 205
Cys Arg Val Gly Val Glu Ser Thr Val Ile Asp GIy Leu Val Asn Pro
210 215 220
Pro Met Leu Leu Arg Pro Gly Gly Phe Thr Tyr Glu Glu Ile Ile Glu
225 230 235 240
Leu Gly Gly Glu Gln Trp Ser His Cys Lys Val Glu Asn Arg Met Thr
245 250 255
Val Gly Ser Gly Glu Lys Val Arg Thr Pro Gly Met Lys Tyr Lys His
260 265 270
Tyr Ser Pro Arg Ala Ser Thr Val Ala Phe Ala Pro Ile Asn Asp Asp
275 280 285
Leu Pro Thr Ser Glu Arg Met Lys Ile Val Thr Ser Glu Ile Met Lys
290 295 300
Tyr Met Thr Ser His Gly Thr Asp Lys Arg Gln Lys Va1 Gly Leu Leu
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
46
305 310 315 320
Thr Ser Ile Met Phe Pro Asn Asn Leu Leu Glu Ser Ile Thr Asp Glu
325 330 335
Val Asp Val Val Val Tyr Ser Leu Gly Ser Ser Gly Lys Glu Val Gln
340 345 350
Ser Asn Leu Phe Ala Met Leu Arg Arg Leu Asp Glu Glu Asp Glu Val
355 360 365
Asp Leu Ile Phe Val Glu Gly Ile Ser Asp Arg Asn Glu Gly Leu Ala
370 375 380
Val Met Asn Arg Leu Arg Lys Ala Ala Gly Gly Asn Val Val Ser Phe
385 390 395 400
<210> 26
<211> 609
<212> DNA
<213> Ashbya gossypii
<220>
<221> misc feature
' <223> Oligo 63
<220>
<221> misc feature
<222> (470)..(470)
<223> unknown nucleotide
<220>
<221> misc feature
<222> (518)..(518)
<223> unknown nucleotide
<220>
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
47
<221> misc_feature
<222> (536)..(536)
<223> unknown nucleotide
<400>
26
gatcataaacgaagaattcctaattaacaatttgtcctgcatgtacttcctcagtgagaa 60
atagcagatataatcattagaaagcttccccgagcactttagcagcaccgcatgccagca 120
taaccccctggactcagggcagtatgccaggctggcacctcggcacctcatcgcaggcga 180
gacagtccaccactgcgagcaccgtagtatttatacttttccaggttgaaaaattttcga 240
ccgccccacgccgcagagggctggacgcgcattagggctcacagcggtcgactgccactg 300
ctgccccaacagcgccgcgcatgtaacgtgaaatgatatattataccttctgactacaat 360
gtgaaatatacaaaggtggctcataggcgcattgcatttattcagacgcagtagctctgg 420
tgtagatagcctgcttggagtgcttggagattggcttgatgatgccctcngtctccaagt 480
gtctcatagcaactctggccatggaaccgccgatcttnaatctgtcgaccaacacngaca 540
cagagacgtatctgtagggttgggaccctcctttaagattctgtcaagcttgtcctggtc 600
caagatgac 609
<210> 27
<211> 16
<212> PRT
<213> Ashbya gossypii
<220>
<221> misc_feature
<223> Oligo 63
<400> 27
Val Ile Leu Asp Gln Asp Lys Leu Asp Arg Ile Leu Lys Glu Gly Pro
1 5 10 15
<210> 28
<211> 52
<212> PRT
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
48
<213> Ashbya gossypii
<220>
<221> misc feature
<223> Oligo 63
<220>
<221> misc feature
<222> (13)..(13)
<223> unknown amino acid
<400> 28
Tyr Arg Tyr Val Ser Val Ser Val Leu Val Asp Arg Xaa Lys Ile Gly
1 5 10 15
Gly Ser Met Ala Arg Val Ala Met Arg His Leu Glu Thr Glu Gly Ile
20 25 30
Ile Lys Pro Ile Ser Lys His Ser Lys Gln Ala Ile Tyr Thr Arg Ala
35 40 45
Thr Ala Ser Glu
<210>29
<211>1850
<212>DNA
<213>Ashbya gossypii
<220>
<221> CDS
<222> (533)..(856)
<223>
<220>
M/42319-PCT
CA 02458953 2004-02-27
0050!52814
. 49
<221> misc_feature
<223> Oligo 63
<400>
29
tagccgcgatctaccaagcgctgccggtacccttacagcccgcctccaacacgtccgtgt60
gccgtcttgtctccgcagccgctgctcttcccattagtttctccgctccgcttcgaaccc120
cagccctcaacgggcggcggcgctagccgctgcaccaccaaagcgaaaattgtaaatcgt180
cgcttacgaaagagggtaccccttctgtgactgcacatccgtacatccatggactccgcc240
aaatctgagttcggaccgacgcaatactggttccgcaacgggccctgctcaccactgaat300
cctcccacgctctattgattaaagcagaagagctaagtaagtcgctgaagtctggcaaag360
tagaaaccagctaggaacatttagagtatgtgagaggacatgtgggaccaacgccgttga420
ggcgcgtaggcgttcaggcgcgcaggaggctaccggcacgcctgcagccacgcctgccgc480
cagaagagcggccagctcgctgccggacagctactaacgagcacacagtaat atg 538
cca
Met Pro
1
ccaaaa caacaattatct aaggcccag aaggccgcc gccgccatg gcc 586
ProLys GlnGlnLeuSer LysAlaGln LysAlaAla AlaAlaMet Ala
10 15
ggtggt aagaagtccaag aagaagtgg tccaagaag tcccacaag gac 634
GlyGly LysLysSerLys LysLysTrp SerLysLys SerHisLys Asp
20 25 30
aaggcc cagcacgccgtc atcttggac caggacaag cttgacaga atc 682
LysAla GlnHisAlaVal IleLeuAsp GlnAspLys LeuAspArg Ile
35 40 45 50
ctaaag gaggtcccaacc tacagatac gtctctgtg tccgtgttg gtc 730
LeuLys GluValProThr TyrArgTyr ValSerVal SerValLeu Val
55 60 65
gacaga ttgaagatcggc ggttccatg gccagagtt getttgaga cac 778
AspArg LeuLysIleGly GlySerMet AlaArgVal AlaLeuArg His
70 75 80
ttggag accgagggcatc atcaagcca atctccaag cactccaag cag 826
LeuGlu ThrGluGlyIle IleLysPro IleSerLys HisSerLys Gln
85 90 95
get atc acc aga get act tct gaa 876
tac gcg taaatgcaat
gcgcctatga
Ala Ile Thr Arg Ala Thr Ser Glu
Tyr Ala
100 105
gccacctttgtatatttcac attgtagtcagaaggtataatatatcatttcacgttacat936
gcgcggcgctgttggggcag cagtggcagtcgaccgctgtgagccctaatgcgcgtccag996
ccctctgcggcgtggggcgg tcgaaaatttttcaacctggaaaagtataaatactacggt1056
gctcgcagtggtggactgtc tcgcctgcgatgaggtgccgaggtgccagccggcatactg1116
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
.. 50
ccctgagtccagggggttatgctggcatgcggtgctgctaaagtgctcggggaagctttc1176
taatgattatatcgctatttctcactgaggaagtacatgcaggacaaattgttaattagg1236
aattcttcgtttatgatcggagagcacctcccccagcgcagcactgcgcagcccaaccat1296
gagaccatggtgtccgacagaaggtgtgcttcgccgttctatgatgaatagcttccacag1356
ctctcgatccggcgatgattctcaggaatatgtgccaggatatatcatgcatcaccatct1416
gagattcgaacaggtaaagtcttctgctggattggccgtatgcgttcttctagatgatga1476
taaaactttttattcagttctgcttctgaacatctaggaagataactctattaccaaagc1536
tcaaaactctgacaggaggaacgcataacggtctgggctgctagtgccaaagagtaacgt1596
aaaatctaacgaaagtacttagtgggcagggccgcctgctcagagcctcttgcgggcctc1656
ttcctgagtgaccttctgctcccgtagtttccggagcaggaagtcttgcacggcgtccca1716
gcgttcgcgctggctcgcggggaaccacacgcttcagcttggaaagaatccgcaccacgg1776
ttgtctgcacgtaaaagggaaaagttcagctttgagccagtagatggcccagtagaagaa1836
cagcgcgaaccccc 1850
<210> 30
<211> 108
<212> PRT
<213> Ashbya gossypii
<220>
<221> misc_feature
<223> Oligo 63
<400> 30
Met Pro Pro Lys Gln Gln Leu Ser Lys A1a Gln Lys Ala Ala Ala Ala
1 5 10 15
Met Ala Gly Gly Lys Lys Ser Lys Lys Lys Trp Ser Lys Lys Ser His
20 25 30
Lys Asp Lys Ala Gln His Ala Val Ile Leu Asp Gln Asp Lys Leu Asp
35 40 45
Arg Ile Leu Lys Glu Val Pro Thr Tyr Arg Tyr Val Ser Val Ser Val
50 55 60
Leu Val Asp Arg Leu Lys Ile Gly Gly Ser Met Ala Arg Val Ala Leu
65 70 75 80
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
51
Arg His Leu Glu Thr Glu Gly Ile Ile Lys Pro Ile Ser Lys His Ser
85 90 95
Lys Glri Ala Ile Tyr Thr Arg Ala Thr Ala Ser Glu
100 105
<210> 31
<211> 933
<212> DNA
<213> Ashbya gossypii
<220>
<221> misc feature
<223> Oligo 132
<400>
31
gatcctagaattgcggtggaatatcttctcctaatcgctttagcgcacgaagactcacaa 60
attgaacttgctcacgaagcattgagggagcctggtcctagatactaaagagttcaccat 120
acctcctcggaaaaatcaacagggatggcaccaggataccgggcattatcgaggagagac 180
agcctctgctttacttggccgacaaagaggactttttgcataagattacggagcaggcag 240
cgcgcagagcagatgaaaatggcagagtctacgacagtctgctactgtatcagctggcgg 300
aagagtacgatattgtcattagcattgttaataagctgctgagcgaaatgttgagcaaca 360
ctgacctggcgcaacccctgatgcggcaggacgacaatagcgagactaaccctgttctaa 420
tcgccaagaagctcattgatgtctatatcaagaacttggaaatttcaaagaaggtacaca 480
ggaaaaacaaggaaacatgcattctgctcctgaaactcgtggatataaggagaacatata 540
ttgcaagacagtggcaaaacaccctgcagcagatagaggagctggatctgcttccatctg 600
tcgaagactcttccccaaggaagaaggcgcaggaattccacaacctggacgactgtatca 660
taaagaatgtccccaacctgttgatcatcgccatgacctgcgtttctaacctcatcaagc 720
agttgagcaagggccccttctccaacggggccacgcaagctcaaggtcgaggctctgaag 780
aaggtcgccaacaactacatgatctacagaggcatgatccagtacaagatgcctcgggag 840
gtgtacaacaccctcataaacatcgaggtggacctctgaccgctcgtcagaccacgatgc 900
agtgtgtaccagaccagtattatagattagatc 933
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
52
<210> 32
<211> 30
<222> PRT
<213> Ashbya gossypii
<220>
<221> mist feature
<223> Oligo 132
<400> 32
Asp Pro Arg Zle Ala Val Glu Tyr Leu Leu Leu Ile Ala Leu Ala His
1 5 10 15
Glu Asp Ser Gln Ile Glu Leu Ala His Glu Ala Leu Arg Glu
20 25 30
<210> 33
<211> 10
<212> PRT
<213> Ashbya gossypii
<220>
<221> mist feature
<223> Oligo 132
<400> 33
Leu Val Leu Asp Thr Lys Glu Phe Thr Ile
1 5 10
<210> 34
<211> 219
<212> PRT
<213> Ashbya gossypii
<400> 34
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
53
Lys Ser Ser Pro Tyr Leu Leu Gly Lys Ile Asn Arg Asp Gly Thr Arg
1 5 10 15
Ile Pro Gly Ile Ile Glu Glu Arg Gln Pro Leu Leu Tyr Leu Ala Asp
20 25 30
Lys Glu Asp Phe Leu His Lys Ile Thr Glu Gln Ala Ala Arg Arg Ala
35 40 45
Asp Glu Asn Gly Arg Val Tyr Asp Ser Leu Leu Leu Tyr Gln Leu Ala
50 55 60
Glu Glu Tyr Asp Ile Val Ile Ser Ile Val Asn Lys Leu Leu Ser Glu
65 70 75 80
Met Leu Ser Asn Thr Asp Leu Ala Gln Pro Leu Met Arg Gln Asp Asp
85 90 95
Asn Ser Glu Thr Asn Pro Val Leu Ile Ala Lys Lys Leu Ile Asp Val
100 105 110
Tyr Ile Lys Asn Leu Glu Ile Ser Lys Lys Val His Arg Lys Asn Lys
115 120 125
Glu Thr Cys Ile Leu Leu Leu Lys Leu Val Asp Ile Arg Arg Thr Tyr
130 135 140
Ile Ala Arg Gln Trp Gln Asn Thr Leu Gln Gln Ile Glu Glu Leu Asp
145 150 155 160
Leu Leu Pro Ser Val Glu Asp Ser Ser Pro Arg Lys Lys Ala Gln Glu
165 170 175
Phe His Asn Leu Asp Asp Cys Ile Ile Lys Asn Val Pro Asn Leu Leu
180 185 190
Ile Ile Ala Met Thr Cys Val Ser Asn Leu Ile Lys Gln Leu Ser Lys
195 200 205
Gly Pro Phe Ser Asn Gly Ala Thr Gln Ala Gln
210 215
<210> 35
<211> 38
<212> PRT
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
54
<213> Ashbya gossypii
<220>
<221> misc_feature
<223> Oligo 132
<400> 3S
Lys Val Glu Ala Leu Lys Lys Val Ala Asn Asn Tyr Met Ile Tyr Arg
1 5 10 15
Gly Met Ile Gln Tyr Lys Met Pro Arg Glu Val Tyr Asn Thr Leu Ile
20 25 30
Asn Ile Glu Val Asp Leu
<210> 36
<2I1> 3969
<212> DNA
<213> Ashbya gossypii
<220>
<221> CDS
<222> (629)..(3181)
<223>
<220>
<221> misc_feature
<223> Oligo 132
<400> 36
catgacagctgtgccacttatcccacggaagactagtggcagacgactaccacgatttag60
tagctttaaatccagctattcgacgagctcaggtccaagatttactgtgtgagagacgat120
caattcactgcggcctacaataatccggatacgagggctattccaaacggtttaactgtc180
gagctaaatgatgggactaccttggaagaggttgttgtcgagtaccctattggccataag240
M/42319-PCT
CA 02458953 2004-02-27
0050152814
actagacgtg cagaggcagaaccgaagctg cttgagaagttctacaggcatttgtcaggg 30U
cactttgagg gcgacattactaaggtcgag caagtaatgacaatgtccactgacccagag 360
tttgagtcct atagtatcgaccagtatgta gacactttctgtcgttgacggtatctagat 420
ccaacaaatg tactaagttacgtaacagtt ttatgatgatgttacataatcttcccagtc 480
gccggagctt cgcgtcaatgatatccgggt aatacttttctgtcaacaaaattttctcta 540
-gggatgaatg aagttttcatctatcagcaa gtacagtataagcagtttgttattataaga 600
agtacggcag ctgccttcttcgtctaac atg aat gca tcg 652
aac tcc atc aat
Met Asn Asn Ser Ala Ser
Ile Asn
1 5
gat tta cgg agc gtc tta aag gtg tcg 700
agc ccg ggc
cac gaa
gcc ccc
Asp Leu Arg Ser Val Leu Lys Val Ser
Ser Pro Gly
His Glu
Ala Pro
10 15 20
aagacctttaat gatttg attgaaacgtcc aagaat ctgccttctaca 748
LysThrPheAsn AspLeu IleGluThrSer LysAsn LeuProSerThr
25 30 35 40
tcatccgagttg ggttcc gtactattgaat gtcaat gaactcaagaag 796
SerSerGluLeu GlySer ValLeuLeuAsn ValAsn GluLeuLysLys
45 50 55
cgggetgcagag ttaaga getaaaaatgtc aagaac aaatctcctcac 844
ArgAlaAlaGlu LeuArg AlaLysAsnVal LysAsn LysSerProHis
60 65 70
catacccgggca cactat ttgttggcagga agtgga ctggcgattcaa 892
HisThrArgAla HisTyr LeuLeuAlaGly SerGly LeuAlaIleGln
75 80 85
gatgttgaatct tctttgaaa acccttgaa tcgagacag ctgttggag 940
AspValGluSer SerLeuLys ThrLeuGlu SerArgGln LeuLeuGlu
90 95 100
cagaatgtccaa aataaggtt cccgatgga gatcttgac acctacctg 988
GlnAsnValGln AsnLysVal ProAspGly AspLeuAsp ThrTyrLeu
105 110 115 120
cgcaataaaaaa gatgaaaac atcctctcc tctattgag cagtccttg 1036
ArgAsnLysLys AspGluAsn IleLeuSer SerIleGlu GlnSerLeu
125 130 135
tctttggcggca aaggatttt gataatttt gtcaatgcg aacttcaat 1084
SerLeuAlaAla LysAspPhe AspAsnPhe ValAsnAla AsnPheAsn
140 145 150
ctggactggaag aagcataag gaggaagtg aagaggagc tttttgggt 1132
LeuAspTrpLys LysHisLys GluGluVal LysArgSer PheLeuGly
155 160 165
ctcgtatggaag tcggatcca aaccacaag agtccaact tctgtgtct 1180
LeuValTrpLys SerAspPro AsnHisLys SerProThr SerValSer
170 175 180
gaa cca tca ttt atg acc tgg ccc aag aaa ggt agc gga ata ttg gat 1228
Glu Pro Ser Phe Met Thr Trp Pro Lys Lys Gly Ser Gly Ile Leu Asp
185 190 195 200
M/42319-PCT
0050/52814
CA 02458953 2004-02-27
56
ggt gaa tca aag ctg aat atc aac gaa aac tac gtt gtg aga gag aag 1276
Gly Glu Ser Lys Leu Asn Ile Asn Glu Asn Tyr Val Val Arg Glu Lys
205 210 215
tttgaaaaatac gccagaata atcaatcgg ttcaacaat gccaga 1324
cag
PheGluLysTyr AlaArgIle IleAsnArg PheAsnAsn AlaArg
Gln
220 225 230
ctgcataataat ttccctttg acgacagag tttattact ctattccaa 1372
LeuHisAsnAsn PheProLeu ThrThrGlu PheIleThr LeuPheGln
235 240 245
aattccgcagac tacaaacag aggcagctg ctcgaagca tggaagatc 1420
AsnSerAlaAsp TyrLysGln ArgGlnLeu LeuGluAla TrpLysIle
250 255 260
cttgataattac cgcttgtgt tcggattct atgaatatt gtggatatt 1468
LeuAspAsnTyr ArgLeuCys SerAspSer MetAsnIle ValAspIle
265 270 275 280
tcaaaagggtat cttgaaaac caattcatg gactacgtc gacaatcta 1516
SerLysGlyTyr LeuGluAsn GlnPheMet AspTyrVal AspAsnLeu
285 290 295
taccccaaaaat ggaaatgaa ggattgcct actaacatt aataagatc 1564
TyrProLysAsn GlyAsnGlu GlyLeuPro ThrAsnIle AsnLysIle
300 . 305 310
aaatccttcatt gattgtaaa ttaaaaaat ccaaataac acttggaag 1612
LysSerPheIle AspCysLys LeuLysAsn ProAsnAsn ThrTrpLys
315 320 325
tttggcaacttg acgatcgtc aatggtgtt cctgtgtgg gccttgatc 1660
PheGlyAsnLeu ThrIleVal AsnGlyVal ProValTrp AlaLeuIle
330 335 340
ttttatctatta agggccggt aagttccag gaagetttg gaggtcgcc 1708
PheTyrLeuLeu ArgAlaGly LysPheGln GluAlaLeu GluValAla
345 350 355 360
ataaacaataag ctaagttta aaaaaggtg gagcagtct ttcctggta 1756
IleAsnAsnLys LeuSerLeu LysLysVal GluGlnSer PheLeuVal
365 370 375
tacttcaaagca tatgtctcc tctaaagac aagcggctg ccacaggag 1804
TyrPheLysAla TyrValSer SerLysAsp LysArgLeu ProGlnGlu
380 385 390
ttcattactaga ttgcacacg gagtacaat caacacatt aaaaactcc 1852
PheIleThrArg LeuHisThr GluTyrAsn GlnHisIle LysAsnSer
395 400 405
ctcgatggcgac cccttcaga ctcgccgtt tacaagatc attggaaga 1900
LeuAspGlyAsp ProPheArg LeuAlaVal TyrLysIle IleGlyArg
410 415 420
tgtgatctgacg agaaagaat atttccget ataacgctg agtgttgaa 1948
CysAspLeuThr ArgLysAsn IleSerAla IleThr SerValGlu
Leu
425 430 435 440
gactggctatgg gtccacttc atgttgata aaagac tccagc 1996
ggc
atc
Asp Trp Leu Trp Val His Phe Met Leu Ile Lys Asp Gly Ile Ser Ser
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
57
445 450 455
gac gac cca gtt tat gag aga tat agc ctg gtc gac ttc caa aac atc 2044
Asp Asp Pro Val Tyr Glu Arg Tyr Ser Leu Val Asp Phe Gln Asn Ile
460 465 470
atc acg tct tat ggc tct tcc agc ttc aat aac cac tac ttg caa gtc 2092
Ile Thr Ser Tyr Gly Ser Ser Ser Phe Asn Asn His Tyr Leu Gln Val
475 480 485
ctactt ctcagcggt caatatgaacta getgtccaa tatgcctac act 2140
LeuLeu LeuSerGly GlnTyrGluLeu AlaValGln TyrA1aTyr Thr
490 495 500
attaac gaaattgac getgttcatttg gegatcget etggcggat tat 2188
IleAsn GluIleAsp AlaValHisLeu AlaIleAla LeuAlaAsp Tyr
505 510 515 520
aaatta ttgaaggtg gcagetaatgtg actgacgat gagtttgtc acg 2236
LysLeu LeuLysVal AlaAlaAsnVal ThrAspAsp GluPheVal Thr
525 530 535
tcgccc actggcgag agaaagatcaac tttgcaaag attctgggg aac 2284
SerPro ThrGlyGlu ArgLysIleAsn PheA1aLys IleLeuGly Asn
540 545 . 550
tataca aagtccttc aagttctctgat cctagagtt gcggtggaa tat 2332
TyrThr LysSerPhe LysPheSerAsp ProArgVal AlaValGlu Tyr
555 560 565
cttctc ctaatcgettta gegcacgaa gactcacaa attgaacttget 2380
LeuLeu LeuIleAlaLeu AlaHisGlu AspSerGln IleGluLeuAla
570 575 580
cacgaa gcattgagggag ctggtccta gatactaaa gagttcaccata 2428
HisGlu AlaLeuArgGlu LeuValLeu AspThrLys GluPheThrIle
585 590 595 600
ctcctc ggaaaaatcaac agggatggc accaggata ccgggcattatc 2476
LeuLeu GlyLysIleAsn ArgAspGly ThrArgIle ProGlyIleIle
605 610 615
gaggag agacagcctctg ctttacttg gccgacaaa gaggactttttg 2524
GluGlu ArgGlnProLeu LeuTyrLeu AlaAspLys GluAspPheLeu
620 625 630
cataag attacggagcag gcagcgcgc agagcagat gaaaatggcaga 2572
HisLys IleThrGluGln AlaAlaArg ArgAlaAsp GluAsnGlyArg
635 640 645
gtctac gacagtctgcta ctgtatcag ctggcggaa gagtacgatatt 2620
ValTyr AspSerLeuLeu LeuTyrGln LeuAlaGlu GluTyrAspIle
650 655 660
gtcatt agcattgttaat aagctgctg agcgaaatg ttgagcaacact 2668
ValIle SerIleValAsn LysLeuLeu SerGluMet LeuSerAsnThr
665 670 675 680
gacctg gcgcaacccctg atgcggcag gacgacaat agcgagactaac 2716
AspLeu AlaGlnProLeu MetArgGln AspAspAsn SerGluThrAsn
685 690 695
cct gtt cta atc gcc aag aag ctc att gat gtc tat atc aag aac ttg 2764
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
58
Pro Val Leu Ile Ala Lys Lys Leu Ile Asp Val Tyr Ile Lys Asn Leu
700 705 710
gaa att tca aag aag gta cac agg aaa aac aag gaa aca tgc att ctg 2812
Glu Ile Ser Lys Lys Val His Arg Lys Asn Lys Glu Thr Cys Ile Leu
715 720 725
ctc ctg aaa ctc gtg gat ata agg aga aca tat att gca aga cag tgg 2860
Leu Leu Lys Leu Val Asp Ile Arg Arg Thr Tyr Ile Ala Arg Gln Trp
730 735 740
caaaacacc ctgcagcag atagaggag ctggatctgctt ccatctgtc 2908
GlnAsnThr LeuGlnGln IleGluGlu LeuAspLeuLeu ProSerVal
745 750 755 760
gaagactct tccccaagg aagaaggcg caggaattccac aacctggac 2956
GluAspSer SerProArg LysLysAla GlnGluPheHis AsnLeuAsp
765 770 775
gactgtatc ataaagaat gtccccaac ctgttgatcatc gccatgacc 3004
AspCysIle IleLysAsn ValProAsn LeuLeuIleIle AlaMetThr
780 785 790
tgcgtttct aacctcatc aagcagttg agcaagggcccc ttctccaac 3052
CysValSer AsnLeuIle LysGlnLeu SerLysGlyPro PheSerAsn
795 800 805
ggggccacg caagetcaa gtcgagget ctgaagaaggtc gccaacaac 3100
GlyAlaThr GlnAlaGln ValGluAla LeuLysLysVal AlaAsnAsn
810 815 820
tac atg atc tac aga ggc atg atc cag tac aag atg cct cgg gag gtg 3148
Tyr Met Ile Tyr Arg Gly Met Ile Gln Tyr Lys Met Pro Arg Glu Val
825 830 835 840
tac aac acc ctc ata aac atc gag gtg gac ctc tgaccgctcg tcagaccacg 3201
Tyr Asn Thr Leu Ile Asn Ile Glu Val Asp Leu
845 850
atgcagtgtg taccagacca gtattataga ttagatccta cgaactttac ctgctattta 3261
tccccgtgca gatacttctg cctgtactga ctgtagtccg gctggtactc gtacgcgttc 3321
ggactactgg atctcttccg ttcgagtttc tgccgacgtc tggcgattcg agcctgccgc 3381
ctcgcttcaa agtccatgct agtgtcgttt tcggattccg aagacgagct cgacgaggca 3441
ctcgacgatg cgtgctcgca ctcacccccg tcctcgtcgt caaagttctg ctgcgggtgg 3501
aaaatgcagc atatctttgt cttcttctta ttcatatgct cgttatctac cacattctca 3561
tcccatctga ctttcgactt ctgctctttc ttggctaact ttggcacctg ttccgtttga 3621
tttgcccgga gctgaaggat ctgcgatgtc tccgaaacag ttacagtgtg tgacctgtta 3681
gcaagtgact cctggttgtt gcttgacatc ggaacagctc ttcccacttc cagaccaatc 3741
taatagtctt aacgttgttt gctcctgatt gtgtaccgct tacatacctt ccagctatta 3801
tacagaataa ccccttcgta actggtgata tcagcttgta tgggtggcaa attcaagggc 3861
cttttggcgt attatggttt acaacagcca taatctgaac agcggttaca gagaactgat 3921
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
59
cagatacact agccccttat tcgacgtgga tgggatagat tacagaga 3969
<210> 37
<211> 851
<212> PRT
<213> Ashbya gossypii
<220>
<221> mist feature
<223> Oligo 132
<400> 37
Met Asn Asn Ser Ile Asn Ala Ser Asp Leu Arg Ser Val Ser Pro His
1 5 10 15
Glu Ala Pro Leu Lys Gly Val Ser Lys Thr Phe Asn Asp Leu Ile Glu
20 25 30
Thr Ser Lys Asn Leu Pro Ser Thr Ser Ser Glu Leu Gly Ser Val Leu
35 40 45
Leu Asn Val Asn Glu Leu Lys Lys Arg Ala Ala Glu Leu Arg Ala Lys
50 55 60
Asn Val Lys Asn Lys Ser Pro His His Thr Arg Ala His Tyr Leu Leu
65 70 75 g0
Ala Gly Ser Gly Leu Ala Ile Gln Asp Val Glu Ser Ser Leu Lys Thr
85 90 95
Leu Glu Ser Arg Gln Leu Leu Glu Gln Asn Val Gln Asn Lys Val Pro
100 105 110
Asp Gly Asp Leu Asp Thr Tyr Leu Arg Asn Lys Lys Asp Glu Asn Ile
115 120 125
Leu Ser Ser Ile Glu Gln Ser Leu Ser Leu Ala Ala Lys Asp Phe Asp
130 135 140
Asn Phe Val Asn Ala Asn Phe Asn Leu Asp Trp Lys Lys His Lys Glu
145 150 155 160
Glu Val Lys Arg Ser Phe Leu Gly Leu Val Trp Lys Ser Asp Pro Asn
165 170 175
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
His Lys Ser Pro Thr Ser Val Ser Glu Pro Ser Phe Met Thr Trp Pro
180 185 190
Lys Lys Gly Ser Gly Ile Leu Asp Giy Glu Ser Lys Leu Asn Ile Asn
195 200 205
Glu Asn Tyr Val Val Arg Glu Lys Phe Glu Lys Tyr Ala Arg Ile Ile
210 215 220
Asn Arg Phe Asn Asn Ala Arg Gln Leu His Asn Asn Phe Pro Leu Thr
225 230 235 240
Thr Glu Phe Ile Thr Leu Phe Gln Asn Ser Ala Asp Tyr Lys Gln Arg
245 250 255
Gln Leu Leu Glu Ala Trp Lys Ile Leu Asp Asn Tyr Arg Leu Cys Ser
260 265 270
Asp Ser Met Asn Ile Val Asp Ile Ser Lys Gly Tyr Leu Glu Asn Gln
275 280 285
Phe Met Asp Tyr Val Asp Asn Leu Tyr Pro Lys Asn Gly Asn GIu Gly
290 295 300
Leu Pro Thr Asn Ile Asn Lys Ile Lys Ser Phe Ile Asp Cys Lys Leu
305 310 315 320
Lys Asn Pro Asn Asn Thr Trp Lys Phe Gly Asn Leu Thr Ile Val Asn
325 330 335
Gly Val Pro Val Trp Ala Leu Ile Phe Tyr Leu Leu Arg Ala Gly Lys
340 345 350
Phe Gln Glu Ala Leu Glu Val Ala Ile Asn Asn Lys Leu Ser Leu Lys
355 360 365
Lys Val Glu Gln Ser Phe Leu Val Tyr Phe Lys Ala Tyr Val Ser Ser
370 375 380
Lys Asp Lys Arg Leu Pro Gln Glu Phe Ile Thr Arg Leu His Thr Glu
385 390 395 400
Tyr Asn Gln His Ile Lys Asn Ser Leu Asp Gly Asp Pro Phe Arg Leu
405 410 4I5
Ala Val Tyr Lys Ile Ile Gly Arg Cys Asp Leu Thr Arg Lys Asn Ile
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
61
420 425 430
Ser Ala Ile Thr Leu Ser Val Glu Asp Trp Leu Trp Val His Phe Met
435 440 445
Leu Ile Lys Asp Gly Ile Ser Ser Asp Asp Pro Val Tyr Glu Arg Tyr
450 455 460
Ser Leu Val Asp Phe Gln Asn Ile Ile Thr Ser Tyr Gly Ser Ser Ser
465 470 475 480
Phe Asn Asn His Tyr Leu Gln Val Leu Leu Leu Ser Gly Gln Tyr Glu
485 490 495
Leu Ala Val Gln Tyr Ala Tyr Thr Ile Asn Glu Ile Asp Ala Val His
500 505 510
Leu Ala Ile Ala Leu Ala Asp Tyr Lys Leu Leu Lys Val Ala Ala Asn
515 520 525
Val Thr Asp Asp Glu Phe Val Thr Ser Pro Thr Gly Glu Arg Lys Ile
530 535 540
Asn Phe Ala Lys Ile Leu Gly Asn Tyr Thr Lys Ser Phe Lys Phe Ser
545 550 555 560
Asp Pro Arg Val Ala Val Glu Tyr Leu Leu Leu Ile Ala Leu Ala His
565 570 575
Glu Asp Ser Gln Ile Glu Leu Ala His Glu Ala Leu Arg Glu Leu Val
580 585 590
Leu Asp Thr Lys Glu Phe Thr Ile Leu Leu Gly Lys Ile Asn Arg Asp
595 600 . 605
Gly Thr Arg Ile Pro Gly Ile Ile Glu Glu Arg Gln Pro Leu Leu Tyr
610 615 620
Leu AIa Asp Lys Glu Asp Phe Leu His Lys Ile Thr Glu Gln Ala Ala
625 630 635 640
Arg Arg Ala Asp Glu Asn Gly Arg Val Tyr Asp Ser Leu Leu Leu Tyr
645 650 655
Gln Leu Ala Glu Glu Tyr Asp Ile Val Ile Ser Ile Val Asn Lys Leu
660 665 670
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
62
_ Leu Ser Glu Met Leu Ser Asn Thr Asp Leu Ala Gln Pro Leu Met Arg
675 680 685
Gln Asp Asp Asn Ser Glu Thr Asn Pro Val Leu Ile Ala Lys Lys Leu
690 695 700
Ile Asp Val Tyr Ile Lys Asn Leu Glu Ile Ser Lys Lys Val His Arg
705 710 715 720
Lys Asn Lys Glu Thr Cys Ile Leu Leu Leu Lys Leu Val Asp Ile Arg
725 730 735
Arg Thr Tyr Ile Ala Arg Gln Trp Gln Asn Thr Leu Gln Gln Ile Glu
740 745 750
Glu Leu Asp Leu Leu Pro Ser Val Glu Asp Ser Ser Pro Arg Lys Lys
755 760 765
Ala Gln Glu Phe His Asn Leu Asp Asp Cys Ile Ile Lys Asn Val Pro
770 775 780
Asn Leu Leu Ile Ile Ala Met Thr Cys Val Ser Asn Leu Ile Lys Gln
785 790 795 800
Leu Ser Lys Gly Pro Phe Ser Asn Gly Ala Thr Gln Ala Gln Val Glu
805 810 815
Ala Leu Lys Lys Val Ala Asn Asn Tyr Met Ile Tyr Arg Gly Met Ile
820 825 830
Gln Tyr Lys Met Pro Arg Glu Val Tyr Asn Thr Leu Ile Asn Ile Glu
835 840 845
Val Asp Leu
850
<210> 38
<211> 997
<212> DNA
<213> Ashbya gossypii
<220>
<221> misc_feature
<223> Oligo 174
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
63
<400>
38
gatcatgacctgcagatggagctgctccagaatctcgcgcttcgctatctcgtattttat 60
ccgctccgtctcctcgctctcacgccccagcggcccctcctccgcacgcagcccgctgta 120
ttcgtcgtcgcccagggaaagctcgtgcggcgacttcggtgtcgccacctggtaatatgc 180
cggccctgcgccgatgtgtgggcgccccgtgatatcctccgagtccatgagtaatacttg 240
cggagatgatattagctgaccgctgtcgctatgtgcaatgggctcctctgccccgtggaa 300
ttcttccgagcttcgatgctgaatcctgctatgttgtctcttgttccgaagcgtccccgt 360
taatgtcattgcacccggcgttctgtagtataaccgcgttcctgcgtcgtgctgcccagc 420
gcctcaaatttgatgttcccgactgttcctgcaagtaattaccgaagactgcgcccgctt 480
agtctccaggatagaatacgctcatataaacccggtcctgactatagagagtgtgcagag 540
agtgcgaagagcttcgcttgccctgctcctacgcttgaagagccccatagaaaaaagcgg 600
aaacgagaagcctcttcctttgatgcatttcagccgttcccgcagtcacgcgaccgcaac 660
tctcagatatttacagcttttcagtgcttcatttcattagtggcaacatggccgagcggt 720
taaggcgaaagattagaaatcttttgggctatgcccgcgcaggttcgagtcctgctgttg 780
tcgttattttttgccgaatccatgtatacatggtcacgtgcatgagaggtcacaccacgt 840
atgtaagtatagtaaagattccgttagagtaaggattacatattcttctgagcctcaagc 900
tccgcaaggaggtcgtcgagcagcgcaaccgtttcctgtggcgacgatatccacgctgtg 960
cagcctgcgagccgtgccttgaagtcattcgcagatc g97
<210> 39
<211> 58
<212> PRT
<213> Ashbya gossypii
<220>
<221> misc_feature
<223> Oligo 174
<400> 39
Tyr Gln Val Ala Thr Pro Lys Ser Pro His Glu Leu Ser Leu Gly Asp
1 5 10 15
M/42319-PCT
0050/52814
CA 02458953 2004-02-27
64
Asp Glu Tyr Ser Gly Leu Arg Ala Glu Glu Gly Pro Leu Gly Arg Glu
20 25 30
Ser Glu Glu Thr Glu Arg Ile Lys Tyr Glu Ile Ala Lys Arg Glu Ile
35 40 45
Leu Glu Gln Leu His Leu Gln Val Met Ile
50 55
<210> 40
<211> 3197
<212> DNA
<213> Ashbya gossypii
<220>
<221> CDS
<222> (964)..(2589)
<223>
<220>
<221> misc feature
<223> Oligo 174
<400>
40
tgcgcctgcctgcggagaccccagatcatccgcaaggtgcgcgcagtggccattgtaccg60
ggggcagcgctttgaccgggagtgggccgcgaaattcggcgtgccgctgttgcgcgagac120
gctggaggaaatcgttcttacagtccagggtcggctcgagaacttcccacccgcgcagcg180
tgtgcaattcagctgtttcgacggcggcagcgacgtgtggtgcgacatcggcggcaagga240
cctcggtgtagccttcctgcagcggttctactcgccggagcgtccaatccgccctgagca300
gtccttgcatgtcggtgaccagttcgcccccgtcggatctgcgaatgacttcaaggcacg360
gctcgcaggctgcacagcgtggatatcgtcgccacaggaaacggttgcgctgctcgacga420
cctccttgcggagcttgaggctcagaagaatatgtaatccttactctaacggaatcttta480
ctatacttacatacgtggtgtgacctctcatgcacgtgaccatgtatacatggattcggc540
aaaaaataacgacaacagcaggactcgaacctgcgcgggcatagcccaaaagatttctaa600
tctttcgccttaaccgctcggccatgttgccactaatgaaatgaagcactgaaaagctgt660
M/42319-PCT
0050/52814
CA 02458953 2004-02-27
y, aaatatctga gagttgcggt cgcgtgactg cgggaacggc tgaaatgcat caaaggaaga 720
ggcttctcgtttccgcttttttctatggggctcttcaagcgtaggagcagggcaagcgaa780
gctcttcgcactctctgcacactctctatagtcaggaccgggtttatatgagcgtattct840
atcctggagactaagcgggcgcagtcttcggtaattacttgcaggaacagtcgggaacat900
caaatttgaggcgctgggcagcacgacgcaggaacgcggttatactacagaacgccgggt960
gca atgacattaacg gggacgctt cggaacaag agacaacatagc agg 1008
MetThrLeuThr GlyThrLeu ArgAsnLys ArgGlnHisSer Arg
1 5 10 15
att cagcatcgaagc tcggaagaa ttccacggg gcagaggagccc att 1056
Ile GlnHisArgSer SerGluGlu PheHisGly AlaGluGluPro Ile
20 25 30
gca catagcgacagc ggtcagcta atatcatct ccgcaagtatta ctc 1104
Ala HisSerAspSer GlyGlnLeu IleSerSer ProGlnValLeu Leu
35 40 45
atg gactcggaggat atcacgggg cgcccacac atcggcgcaggg ccg 1152
Met AspSerGluAsp IleThrGly ArgProHis IleGlyAlaGly Pro
50 55 60
gca tattaccaggtg gcgacaccg aagtcgccg cacgagctttcc ctg 1200
Ala TyrTyrGlnVal AlaThrPro LysSerPro HisGluLeuSer Leu
65 70 75
ggc gacgacgaatac agcgggctg cgtgcggag gaggggccgctg ggg 1248
Gly AspAspGluTyr SerGlyLeu ArgAlaGlu GluGlyProLeu Gly
80 85 90 95
cgt gagagcgaggag acggagcgg ataaaatac gagatagcgaag cgc 1296
Arg GluSerGluGlu ThrGluArg IleLysTyr GluIleAlaLys Arg
100 105 110
gag attctggagcag ctccatctg caggtcatg atcaagcatcga gaa 1344
Glu IleLeuGluGln LeuHisLeu GlnValMet IleLysHisArg Glu
115 120 125
atg gacgacctggaa gccgagtca cgtggctta ggggcgaaattg gag 1392
Met AspAspLeuGlu AlaGluSer ArgGlyLeu GlyAlaLysLeu Glu
130 135 140
gtg ctggagatgttg catgatgat ccggagctc ttggccaaggtg gac 1440
Val LeuGluMetLeu HisAspAsp ProGluLeu LeuAlaLysVal Asp
145 150 155
gcg cac cag gag caa cag gca cag ctg cgt ttg gca cag tta gaa gca 1488
Ala His Gln Glu Gln Gln Ala Gln Leu Arg Leu Ala Gln Leu Glu Ala
160 165 170 175
cgt cgc agg agg gaa caa cag atg gca gcg cta ccc cct get ccg ctt 1536
Arg Arg Arg Arg Glu Gln Gln Met Ala Ala Leu Pro Pro Ala Pro Leu
180 185 190
tcg tcg agc agt ggt ggt gag tac tat tac cac acc cgc agt aag agc 1584
Ser Ser Ser Ser Gly Gly Glu Tyr Tyr Tyr His Thr Arg Ser Lys Ser
195 200 205
atg aac tcc cat cag ggg agg tct tct acc ctc cgg ccg get gac ggg 1632
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
66
Met Asn Ser His Gln Gly Arg Ser Ser Thr Leu Arg Pro Ala Asp Gly
210 215 220
aat gta atc ggc ctc cgt gtt ttg ggc tca aag acg gtt gca gac get 1680
Asn Val Ile Gly Leu Arg Val Leu Gly Ser Lys Thr Val Ala Asp Ala
225 230 235
agt agt ccc gga acc acg tca cca cct ttc agc tcc ttt cag cag gca 1728
Ser Ser Pro Gly Thr Thr Ser Pro Pro Phe Ser Ser Phe Gln Gln Ala
240 245 250 255
gac cct ttc gcg ccg caa cat ttc aac cag cat cac agg agg aac tac 1776
Asp Pro Phe Ala Pro Gln His Phe Asn Gln His His Arg Arg Asn Tyr
260 265 270
agc agt aat tgt att tca agc aac agc ggc gta gtc ggg aaa acc gac 1824
Ser Ser Asn Cys Ile Ser Ser Asn Ser Gly Val Val Gly Lys Thr Asp
275 280 285
agc ggg gat gcg att ttt agg cgc ctt gat ggg ctc ctg atc gtt atc 1872
Ser Gly Asp Ala Ile Phe Arg Arg Leu Asp Gly Leu Leu Ile Val Ile
290 295 300
acg tgc tgc aag tgc ggt aag tcg gga ttt acg tct gca caa ggc atc 1920
Thr Cys Cys Lys Cys Gly Lys Ser Gly Phe Thr Ser Ala Gln Gly Ile
305 310 315
gtcaaccactcc aggctgaaa catgccaat tcttattcc agtcagcca 1968
ValAsnHisSer ArgLeuLys HisAlaAsn SerTyrSer SerGlnPro
320 325 330 335
ctagetgtactt cataaccag sgaattctt ccggaagag cagcaaaat 2016
LeuAlaValLeu HisAsnGln XaaIleLeu ProGluGlu GlnGlnAsn
340 345 350
aaaattgtcatg gataaattt aaggaactg catcttgac cctcagacg 2064
LysIleValMet AspLysPhe LysGluLeu HisLeuAsp ProGlnThr
355 360 365
gagtacctgccg aatcccaca gtggtctcc caaagccca tcctctagt 2112
GluTyrLeuPro AsnProThr ValValSer GlnSerPro SerSerSer
370 375 380
get aat tca aat gca tgt ata aca get act gaa ggg cgc gat ata tca 2160
Ala Asn Ser Asn Ala Cys Ile Thr Ala Thr Glu Gly Arg Asp Ile Ser
385 390 395
cca aca cat atc tca tcg tcc tta tcg cct acc tgc gtg cag cca gtt 2208
Pro Thr His Ile Ser Ser Ser Leu Ser Pro Thr Cys Val Gln Pro Val
400 405 410 415
tcc caa ttt cac tca act aaa cat ctg gag aag ctc tat ggc aaa gag 2256
Ser Gln Phe His Ser Thr Lys His Leu Glu Lys Leu Tyr Gly Lys Glu
420 425 430
gga ttc cag cag ata gtg gac tat gtc aag gag tct aaa gat gat ttg 2304
Gly Phe Gln Gln Ile Val Asp Tyr Val Lys Glu Ser Lys Asp Asp Leu
435 440 445
ggc ccc ccc atg cgg gtc gat tcg gat atc gat aac gat acg aat tcg 2352
Gly Pro Pro Met Arg Val Asp Ser Asp Ile Asp Asn Asp Thr Asn Ser
450 455 460
M142319-PCT
0050/52814
CA 02458953 2004-02-27
67
ctg cac ccg ggg gat caa tcg gat ttg ctt tca caa cat aat tcg gag 2400
Leu His Pro Gly Asp Gln Ser Asp Leu Leu Ser Gln His Asn Ser G1u
465 470 475
cgt tca acc gac cta aag cgt cgc gca tcg cct aat atg gac aaa get 2448
Arg Ser Thr Asp Leu Lys Arg Arg Ala Ser Pro Asn Met Asp Lys Ala
480 485 490 495
ctt cgt gaa cga atg cgg cct get gag aag cgg gtg agg ccc gac get 2496
Leu Arg Glu Arg Met Arg Pro Ala Glu Lys Arg Val Arg Pro Asp Ala
. 500 505 510
atg gca ctc gtc gag ctc cct get gaa gag aag aga tca tcg cat tac 2544
Met Ala Leu Val Glu Leu Pro Ala Glu Glu Lys Arg Ser Ser His Tyr
515 520 525
aac tta agg gcc agg tca aag cta aaa tca ctc tcg aaa cat gaa 2589
Asn Leu Arg Ala Arg Ser Lys Leu Lys Ser Leu Ser Lys His Glu
530 535 540
taatatgtaa gtattgttga gacctcattt cccttcgcat ataagtacta tgtattaata 2649
tcatagattc tggacggatc atcacttgtt tgctcggact ctctcaggaa acgcttgggc 2709
gacataggga aatatgtaac gtaccctaac ttcgcgcata ctaaatcaca gccgaaaaca 2?69
ctggggctga acagcatata acacatgttc ctttcgcaac acaagaggag tatagttcga 2829
aggatttgtt ggccctcggc taagcgctac cattcggaac tggtgcgctg gttctacgcc 2889
acggattcgc ccttggaaaa gccgtacgaa ccgaactata agcctgtaaa gcctccggta 2949
aactttatac cgttctctaa aagcgattcc gaccgtttag agcggttcta tagccttgaa 3009
aggccctctg agaatcccat ttcggtcaat gaggattatc tgttcgaagt atacttggaa 3069
gcaagacgtc tgaagcccgc gtattgggat ggccctgttt acgaggtccg gagaggcacc 3129
tggcttaata gcgatggcat gcctctaagt gaagacctga gcgccgagcc actgagctat 3189
cggccaag 3197
<210> 41
<211> 542
<212> PRT
<213> Ashbya gossypii
<220>
<221> misc feature
<222> (343)..(343)
<223> The 'Xaa' at location 343 stands for Gly, or Arg.
<220>
M/42319-PCT
0050/52814
CA 02458953 2004-02-27
- 68
<221> misc feature
<223> Oligo 174
<400> 41
Met Thr Leu Thr Gly Thr Leu Arg Asn Lys Arg Gln His Ser Arg Ile
1 5 10 15
Gln His Arg Ser Ser Glu Glu Phe His Gly Ala Glu Glu Pro Ile Ala
20 25 30
His Ser Asp Ser Gly Gln Leu Ile Ser Ser Pro Gln Val Leu Leu Met
35 40 45
Asp Ser Glu Asp Ile Thr Gly Arg Pro His Ile Gly Ala Gly Pro Ala
50 55 60
Tyr Tyr Gln Val Ala Thr Pro Lys Ser Pro His Glu Leu Ser Leu Gly
65 70 75 g0
Asp Asp Glu Tyr Ser Gly Leu Arg Ala Glu Glu Gly Pro Leu Gly Arg
85 . 90 95
Glu Ser Glu Glu Thr Glu Arg Ile Lys Tyr Glu Ile Ala Lys Arg Glu
100 105 110
Ile Leu Glu Gln Leu His Leu Gln Val Met Ile Lys His Arg Glu Met
115 120 125
Asp Asp Leu Glu Ala Glu Ser Arg Gly Leu Gly Ala Lys Leu Glu Val
130 135 140
Leu Glu Met Leu His Asp Asp Pro Glu Leu Leu Ala Lys Val Asp Ala
145 150 155 160
His Gln Glu Gln Gln Ala Gln Leu Arg Leu Ala Gln Leu Glu Ala Arg
165 170 175
Arg Arg Arg Glu Gln Gln Met Ala Ala Leu Pro Pro Ala Pro Leu Ser
180 185 190
Ser Ser Ser Gly Gly Glu Tyr Tyr Tyr His Thr Arg Ser Lys Ser Met
195 200 205
Asn Ser His Gln Gly Arg Ser Ser Thr Leu Arg Pro Ala Asp Gly Asn
210 215 220
Val Ile Gly Leu Arg Val Leu Gly Ser Lys Thr Val Ala Asp Ala Ser
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
69
225 230 235 240
Ser Pro Gly Thr Thr Ser Pro Pro Phe Ser Ser Phe Gln Gln Ala Asp
245 250 255
Pro Phe Ala Pro Gln His Phe Asn Gln His His Arg Arg Asn Tyr Ser
260 265 270
Ser Asn Cys Ile Ser Ser Asn Ser Gly Val Val Gly Lys Thr Asp Ser
275 280 285
Gly Asp Ala Ile Phe Arg Arg Leu Asp Gly Leu Leu Ile Val Ile Thr
290 295 300
Cys Cys Lys Cys Gly Lys Ser Gly Phe Thr Ser Ala Gln Gly Ile Val
305 310 315 320
Asn His Ser Arg Leu Lys His Ala Asn Ser Tyr Ser Ser Gln Pro Leu
325 330 , 335
Ala Val Leu His Asn Gln Xaa Ile Leu Pro Glu Glu Glri Gln Asn Lys
340 345 350
Ile Val Met Asp Lys Phe Lys Glu Leu His Leu Asp Pro Gln Thr Glu
355 360 365
Tyr Leu Pro Asn Pro Thr Val Val Ser Gln Ser Pro Ser Ser Ser Ala
370 375 380
Asn Ser Asn Ala Cys Ile Thr Ala Thr Glu Gly Arg Asp Ile Ser Pro
385 390 395 400
Thr His Ile Ser Ser Ser Leu Ser Pro Thr Cys Val Gln Pro Val Ser
405 410 415
Gln Phe His Ser Thr Lys His Leu Glu Lys Leu Tyr Gly Lys Glu Gly
420 425 430
Phe Gln Gln Ile Val Asp Tyr Val Lys Glu Ser Lys Asp Asp Leu Gly
435 440 445
Pro Pro Met Arg Val Asp Ser Asp Ile Asp Asn Asp Thr Asn Ser Leu
450 455 460
His Pro Gly Asp Gln Ser Asp Leu Leu Ser Gln His Asn Ser Glu Arg
465 470 475 480
M/42319-PCT
0050/52814
CA 02458953 2004-02-27
r Ser Thr Asp Leu Lys Arg Arg Ala Ser Pro Asn Met Asp Lys Ala Leu
485 490 495
Arg Glu Arg Met Arg Pro Ala Glu Lys Arg Val Arg Pro Asp Ala Met
500 505 510
Ala Leu Val Glu Leu Pro Ala Glu Glu Lys Arg Ser Ser His Tyr Asn
515 520 525
Leu Arg Ala Arg Ser Lys Leu Lys Ser Leu Ser Lys His Glu
530 535 540
<210> 42
<211> 1086
<212> DNA
<213> Ashbya gossypii
<220>
<221> misc_feature
<223> Oligo 51
<400>
42
gatctagtaccagctgagactctctagttgcgtagtaactgtcgagcatacagcaggtga60
ttaaaaatggcatctcgggtacaagcattcattaactgtgctagtcagaaggcctccttt120
tttgtttcgaagaccgtctactgcggcaaggttgccggtgaattgaccaagacggtgtac180
ttcaaagagggcttgcagcctccaaacatatctgacttcgagatggtatactggagacta240
ctaaagcagttcaagaatgcggctgcacacccacagcaaacattggcatctgtgaagagc300
ctagggaagaatgacctggtgaagtacggtgccgtcggtgtgcagatgctcggactgtac360
tcgctaggcgaggcgatcggtagaagacaccttgtcggctacacaaactactcctcgcac420
cactagatattccgcgcggcggacggagcgggccgggattgcgcccattgtgtggggaag480
ccaacctagaaaacgaattgatgaagcattgattcgcagatctcarggatctgatgatac540
atctataaataacaactctaaactagttatcaatcttatatattcgtactatttgtgttc600
atactatgatacagtacgcgcgcgacacttgggcgccggcgagttatgcatgctcttcct660
cgctggcgtcgccggcttgctgggccagtttgcgcttcttagatgcctctatcatttctt720
tttgctgtcgtttcttctgcttcagtatctttggaaccgtgctgatctgcttcctgtcca780
cgaatgccttgcccttcttaatcatctccttttccctcttggtcatcttcgcgatattct840
M/42319-PCT
0050/52814
CA 02458953 2004-02-27
71
ccatccaagc ggcgacctcgcacccactctgcttcatgacgttgacaatcggtttcacag900
caawtgcgtc ctgctttgtaaagaaaggtcactgctgtacctttccgtccgcctctgcct960
gtacggccga tcctgtggacgtaagcctgtgctgagcgaggaacgtcataggttgataac1020
aagattgatg cccttgaaatctataccacgtgccagaacatcggtacagatgaggcacca1080
tagatc
1086
<210> 43
<211> 25
<212> PRT
<213> Ashbya gossypii
<220>
<221> misc feature
<223> Oligo 51
<400> 43
Asp Leu Trp Cys Leu Ile Cys Thr Asp Val Leu Ala Arg Gly Ile Asp
1 5 10 15
Phe Lys Gly Ile Asn Leu Val Ile Asn
20 25
<210> 44
<211> 36
<212> PRT
<213> Ashbya gossypii
<220>
<221> misc feature
<223> Oligo 51
<400> 44
Leu Leu Ser Thr Tyr Asp Val Pro Arg Ser Ala Gln Ala Tyr Val His
1 5 10 15
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
72
Arg Ile Gly Arg Thr Gly Arg Gly Gly Arg Lys Gly Thr Ala Val Thr
20 25 30
Phe Leu Tyr Lys
<210> 45
<211> 100
<212> PRT
<213> Ashbya gossypii
<220>
<221> misc feature
<223> Oligo 51
<220>
<221> misc feature
<222> !29)..(29)
<223> unknown amino acid
<400> 45
His Arg Leu Thr Ser Thr Gly Ser Ala Val Gln Ala Glu Ala Asp Gly
1 5 10 15
Lys Val Gln Gln Pro Phe Phe Thr Lys Gln Asp Ala Xaa Ala Val. Lys
20 25 30
Pro Ile Val Asn Val Met Lys Gln Ser Gly Cys Glu Val Ala Ala Trp
35 40 45
Met Glu Asn Ile Ala Lys Met Thr Lys Arg Glu Lys Glu Met Ile Lys
50 55 60
Lys Gly Lys Ala Phe Val Asp Arg Lys Gln Ile Ser Thr Val Pro Lys
65 70 75 80
Ile Leu Lys Gln Lys Lys Arg Gln Gln Lys Glu Met Ile Glu Ala Ser
85 90 95
Lys Lys Arg Lys
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
73
loo
<210> 46
<211> 3296
<212> DNA
<213> Ashbya gossypii
<220>
<221> CDS
<222> (502)..(2208)
<223>
<220>
<221> misc feature
<223> Oligo 51
<400> 46
atcgtcgggaatctgcaacccgtacttatctagattgaatgcttgcttaaatttcgcctg60
gtgccttgctgggtccccctcgttgtagtgcagccccgccgggttcttaagatcttcatt120
ggggttcttcaggcctcggactttgataccattaacgatgtaagatgcatggcgcgtaga180
ctgtctagtgcctatcgatatcttagaacacaacatggtgctatagacggcaactacagc240
agattaaccacggctggtcgctcttgaaggtggcctaagccaagagatgagcatccgcta300
agctatcaaaattttcaaactaccccgggtaacaagttatccgggtaaccacgtacaaaa360
cgatatttgaaaattttgtattcacattgctttttggtcattagcctgcccggtgcgcga420
tgaggtccctacttgtcagtcagatcgtatccgagctagtgagactgggtcaggccaata480
aggacattgagactcgaagtt atg att ttc gtt ctg cgt ggc 531
gat agg aca
Met Asp Ile Phe Val Leu Arg Gly
Arg Thr
1 5 10
gca tcg gtg aag aag gac ggg aag cag gtg gac ttc tcc aga gtg cag 579
Ala Ser Val Lys Lys Asp Gly Lys Gln Val Asp Phe Ser Arg Val Gln
15 20 25
agc cag cga aca gcg cgg cct gga cag cgc ggg aag gac gag gac gaa 627
Ser Gln Arg Thr Ala Arg Pro Gly Gln Arg Gly Lys Asp Glu Asp Glu
30 35 40
gag caa ttc tcg cgc gag ctg gat ttc ttt cgc acg agg cgg tct gtg 675
Glu Gln Phe Ser Arg Glu Leu Asp Phe Phe Arg Thr Arg Arg Ser Val
45 50 55
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
- 74
cct get gcc gca gag agg cca gcg gaa gag acc ggg gat gtt cat agg 723
Pro Ala Ala Ala Glu Arg Pro Ala Glu Glu Thr Gly Asp Val His Arg
60 55 70
gacgag accgagcag gacgagggc gcagaggacgtg gcaccaccg ccc 771
AspGlu ThrGluGln AspGluGly AlaGluAspVal AlaProPro Pro
?5 80 85 90
cggatc acgacagca gaagaagcg tcgcagctacgg cgctcgtac cgg 819
ArgIle ThrThrAla GluGluAla SerGlnLeuArg ArgSerTyr Arg
95 100 105
ggcaag gtcacaggc gcggatgcg cctctccccatt gggtcgttt gag 867
GlyLys ValThrGly AlaAspAla ProLeuProIle GlySerPhe Glu
110 115 120
gacctg gtgacacgc ttcaagctg gacaagaggctg ctatcgaac ctg 915
AspLeu VaiThrArg PheLysLeu AspLysArgLeu LeuSerAsn Leu
125 130 135
attgag aacaacttt acggagccg acgcccatccag tgcgaggcc atc 963
IleGlu AsnAsnPhe ThrGluPro ThrProIleGln CysGluAla Ile
140 145 150
cccatc agtctgcag aaccgggac atagtggcgtgt gcgccgacc ggt 1011
ProIle SerLeuGln AsnArgAsp IleValAlaCys AlaProThr Gly
155 160 165 170
agtggt aagactctg gcctttttg atacctctttta cagcaggtg ata 1059
SerGly LysThrLeu AlaPheLeu IleProLeuLeu GlnGlnVal Ile
175 180 185
tccgac aaggccgtt ggcaccggc gtgaagggcttg attatctcg ccc 1107
SerAsp LysAlaVal GlyThrGly ValLysGlyLeu IleIleSer Pro
190 195 200
acaaaa gaacttgcc aaccagatc tttgacgagtgc tcgaagctt get 1155
ThrLys GluLeuAla AsnGlnIle PheAspGluCys SerLysLeu Ala
205 210 215
cagcgg atcttcctc gagaaaaag cgcccgttgtca gtggcattg ctc 1203
GlnArg IlePheLeu GluLysLys ArgProLeuSer ValA1aLeu Leu
220 225 230
tcc aag tct ctc gcg gcg aag ctg aaa aac cag atc gtg agc gac aag 1251
Ser Lys Ser Leu Ala Ala Lys Leu Lys Asn Gln Ile Val Ser Asp Lys
235 240 245 250
aaa tat gat atc atc ata tcg act cct ctg cga ctc ata gat ata gtg 1299
Lys Tyr Asp Ile Ile I1e Ser Thr Pro Leu Arg Leu Ile Asp Ile Val
255 260 265
aag agc gaa tcg ctt gac cta agc get gtc aag tac ctg atc ttt gat 1347
Lys Ser Glu Ser Leu Asp Leu Ser Ala Val Lys Tyr Leu Ile Phe Asp
270 275 280
gaa gcc gac aag cta ttt gac aaa acc ttt gtg gaa cag acg gac gac 1395
Glu Ala Asp Lys Leu Phe Asp Lys Thr Phe Val Glu Gln Thr Asp Asp
285 290 295
atc cta agc gca tgt agc cac cca aat att agc aag gtg ctg ttc tcg 1443
Ile Leu Ser Ala Cys Ser His Pro Asn Ile Ser Lys Val Leu Phe Ser
Ml423 i 9-PCT
CA 02458953 2004-02-27
0050152814
300 305 310
gcc acc ctg ccc tcc agt gtc gaa gag ctt gca cag tcg atc atg acc 1491
Ala Thr Leu Pro Ser Ser Val Glu Glu Leu Ala Gln Ser Ile Met Thr
315 320 325 330
gac ccc gtc aga gta atc att ggc cac aag gag gcc get aat acg aac 1539
Asp Pro Val Arg Va1 Ile I1e Gly His Lys Glu Ala Ala Asn Thr Asn
335 340 345
att gaa cag aaa tta gta ttc tgc gga aac gaa gaa ggt aag ttg gtt 1587
Ile Glu Gln Lys Leu Val Phe Cys Gly Asn Glu G1u Gly Lys Leu Val
350 355 360
gcc atc agg cag cta ata cag gaa ggg atg ttc cgc cct ccc gta ata 1635
Ala Ile Arg Gln Leu Ile Gln Glu Gly Met Phe Arg Pro Pro Val Ile
365 370 375
atc ttt ttg gaa tcc atc acc aga gcc aaa gca tta ttc cat gag cta 1683
Ile Phe Leu Glu Ser Ile Thr Arg Ala Lys Ala Leu Phe His Glu Leu
380 385 390
ttg tac gat aaa cta aat gtt gat gtt atc cac get gag cgt acc caa 1731
Leu Tyr Asp Lys Leu Asr~ Val Asp Val Ile His Ala Glu Arg Thr Gln
395 400 405 , 410
gtt caa agg gag aag atc atc gaa cga ttc aag agc ggt gat cta tgg 1779
Val Gln Arg Glu Lys I1e Ile G1u Arg Phe Lys Ser Gly Asp Leu Trp
415 420 425
tgcctcatctgt accgatgttctg gcacgtggt atagatttc aagggc 1827
CysLeuIleCys ThrAspValLeu AlaArgGly IleAspPhe LysGly
430 435 440
atcaatcttgtt atcaactatgac gttcctcgc tcagcacag gettac 1875
IleAsnLeuVal IleAsnTyrAsp ValProArg SerAlaGln AlaTyr
445 450 455
gtccacaggatc ggccgtacaggc agaggcgga cggaaaggt acagca 1923
ValHisArgIle GlyArgThrGly ArgGlyGly ArgLysGly ThrAla
460 465 470
gtgactttcttt acaaagcaggac gcaattget gtgaaaccg attgtc 1971
ValThrPhePhe ThrLysGlnAsp AlaIleAla ValLysPro IleVal
475 480 485 490
aac gtc atg aag cag agt ggg tgc gag gtc gcc get tgg atg gag aat 2019
Asn Val Met Lys Gln Ser Gly Cys Glu Val Ala A1a Trp Met Glu Asn
495 500 505
atc gcg aag atg acc aag agg gaa aag gag atg att aag aag ggc aag 2067
Ile Ala Lys Met Thr Lys Arg Glu Lys Glu Met Ile Lys Lys Gly Lys
510 515 520
gca ttc gtg gac agg aag cag atc agc acg gtt cca aag ata ctg aag 2115
Ala Phe Val Asp Arg Lys Gln Ile Ser Thr Val Pro Lys Ile Leu Lys
525 530 535
cag aag aaa cga cag caa aaa gaa atg ata gag gca tct aag aag cgc 2163
Gln Lys Lys Arg Gln Gln Lys Glu Met Ile Glu Ala Ser Lys Lys Arg
540 545 550
aaa ctg gcc cag caa gcc ggc gac gcc agc gag gaa gag cat gca 2208
M/42319-PCT
0050/52814
CA 02458953 2004-02-27
76
Lys Leu Glu Glu
Ala Gln His Ala
Gln Ala
Gly Asp
Ala Ser
Glu
- 555 560 565
taactcgccg gcgcccaagtgtcgcgcgcgtactgtatcatagtatgaacacaaatagta2268
cgaatatata agattgataactagtttagagttgttatttatagatgtatcatcagatcc2328
ctgagatctg cgaatcaatgcttcatcaattcgttttctaggttggcttccccacacaat2388
gggcgcaatc ccggcccgctccgtccgccgcgcggaatatctagtggtgcgaggagtagt2448
ttgtgtagcc gacaaggtgtcttctaccgatcgcctcgcctagcgagtacagtccgagca2508
tctgcacacc gacggcaccgtacttcaccaggtcattcttccctaggctcttcacagatg2568
ccaatgtttg ctgtgggtgtgcagccgcattcttgaactgctttagtagtctccagtata2628
ccatctcgaa gtcagatatgtttggaggctgcaagccctctttgaagtacaccgtcttgg2688
tcaattcacc ggcaaccttgccgcagtagacggtcttcgaaacaaaaaaggaggccttct2748
gactagcaca gttaatgaatgcttgtacccgagatgccatttttaatcacctgctgtatg2808
ctcgacagtt actacgcaactagagagtctcagctggtactagatcgcttatatcgtcaa2868
aattttcaaa ggtggcagcattcaggatatccgggtaacaatataccaatggccaatcag2928
atgccggttt ttagcacggagagtggtcttataccggtgatggactttgatggccaggcg2988
gaaggcgata tacggccgaaaagtagtgattgagcgcgcggtagtgtaatcgtttacttg3048
cgtctgtcta ttcggcgaacgcggcgagcatagagctgtttatcgcgcgtacaaagtccg3108
aaacaattac gctaaaacagtgagaatagctgagtgtgggcgcgcgagcaaactagacac3168
ggccgttcag gcgtatcgatctccggacgccgtcgccgaggaccactatcttgtcttcct3228
gctgcaggcg attcagagcgtctgaaatcgtcatgttgtccaggcgggcctgagagttct3288
cgttcagc 3296
<210> 47
<211> 569
<212> PRT
<213> Ashbya gossypii
<220>
<221> misc_feature
<223> Oligo 51
<400> 47
Met Asp Ile Phe Arg Val Leu Thr Arg Gly Ala Ser Val Lys Lys Asp
1 5 10 15
Mi42319-PCT
CA 02458953 2004-02-27
0050/52814
- 77
- Gly Lys Gln Val Asp Phe Ser Arg Val Gln Ser GIn Arg Thr Ala Arg
20 25 30
Pro Gly Gln Arg Gly Lys Asp Glu Asp Glu Glu Gln Phe Ser Arg Glu
35 40 45
Leu Asp Phe Phe Arg Thr Arg Arg Ser Val Pro Ala Ala Ala Glu Arg
50 55 60
Pro Ala Glu Glu Thr Gly Asp VaI His Arg Asp Glu Thr Glu Gln Asp
65 70 75 80
Glu Gly AIa Glu Asp Val Ala Pro Pro Pro Arg Ile Thr Thr Ala Glu
85 90 95
Glu Ala Ser Gln Leu Arg Arg Ser Tyr Arg Gly Lys Val Thr GIy Ala
100 105 110
Asp Ala Pro Leu Pro Ile Gly Ser Phe Glu Asp Leu Val Thr Arg Phe
115 120 125
Lys Leu Asp Lys Arg Leu Leu Ser Asn Leu Ile Glu Asn Asn Phe Thr
130 135 140
Glu Pro Thr Pro Ile Gln Cys Glu Ala Ile Pro Ile Ser Leu Gln Asn
145 150 155 160
Arg Asp Ile Val Ala Cys Ala Pro Thr Gly Ser Gly Lys Thr Leu Ala
165 170 175
Phe Leu Ile Pro Leu Leu Gln Gln Val Ile Ser Asp Lys Ala Val Gly
180 185 190
Thr Gly Val Lys Gly Leu Ile Ile Ser Pro Thr Lys Glu Leu Ala Asn
195 200 205
Gln Ile Phe Asp Glu Cys Ser Lys Leu Ala Gln Arg Ile Phe Leu Glu
210 215 220
Lys Lys Arg Pro Leu Ser Val Ala Leu Leu Ser Lys Ser Leu Ala Ala
225 230 235 240
Lys Leu Lys Asn Gln Ile Val Ser Asp Lys Lys Tyr Asp Ile Ile Ile
245 250 255
Ser Thr Pro Leu Arg Leu Ile Asp Ile Val Lys Ser G1u Ser Leu Asp
260 265 270
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
- 78
Leu Ser Ala Val Lys Tyr Leu Ile Phe Asp Glu Ala Asp Lys Leu Phe
275 280 285
Asp Lys Thr Phe Val Glu Gln Thr Asp Asp Ile Leu Ser Ala Cys Ser
290 295 300
His Pro Asn Ile Ser Lys Val Leu Phe Ser Ala Thr Leu Pro Ser Ser
305 310 315 320
Val Glu Glu Leu Ala Gln Ser Ile Met Thr Asp Pro Val Arg Val Ile
325 330 335
Ile Gly His Lys Glu Ala Ala Asn Thr Asn Ile Glu Gln Lys Leu Val
340 345 350
Phe Cys Gly Asn Glu Glu Gly Lys Leu Val Ala Ile Arg Gln Leu Ile
355 360 365
Gln Glu Gly Met Phe Arg Pro Pro Val Ile Ile Phe Leu Glu Ser Ile
370 375 380
Thr Arg Ala Lys Ala Leu Phe His Glu Leu Leu Tyr Asp Lys Leu Asn
385 390 395 400
Val Asp Val Ile His Ala Glu Arg Thr Gln Val Gln Arg Glu Lys Ile
405 410 415
Ile Glu Arg Phe Lys Ser Gly Asp Leu Trp Cys Leu Ile Cys Thr Asp
420 425 430
Val Leu Ala Arg Gly Ile Asp Phe Lys Gly Ile Asn Leu Val Ile Asn
435 440 445
Tyr Asp Val Pro Arg Ser Ala Gln Ala Tyr Val His Arg Ile Gly Arg
450 455 460
Thr Gly Arg Gly Gly Arg Lys Gly Thr Ala Val Thr Phe Phe Thr Lys
465 470 475 480
Gln Asp Ala Ile Ala Val Lys Pro Ile Val Asn Val Met Lys Gln Ser
485 490 495
Gly Cys Glu Val Ala Ala Trp Met Glu Asn Ile Ala Lys Met Thr Lys
500 505 510
Arg Glu Lys Glu Met Ile Lys Lys Gly Lys Ala Phe Val Asp Arg Lys
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
79
515 520 525
Gln Ile Ser Thr Val Pro Lys Ile Leu Lys Gln Lys Lys Arg Gln Gln
530 535 540
Lys Glu Met Ile Glu Ala Ser Lys Lys Arg Lys Leu Ala Gln Gln Ala
545 550 555 560
Gly Asp Ala Ser Glu Glu Glu His Ala
565
<210> 4B
<211> 528
<212> DNA
<213> Ashbya gossypii
<220>
<221> misc_feature
<223> Oligo 30
<220>
<221> misc_feature
<222> (1131..(1131
<223> unknown nucleotide
<400>
48
gacgctttcaacgcatccattaagaaaaataacattccggatgattggacctttattcat60
aacgaagagagtaccaacgggagcagcgaaaacgattcttccacaggaatgcngcaaggc120
ccggtctctaggccactgggttgacggcaacggtaagcagctggacggaaaactcaaatt180
tactgttaaaaatgtctacactgcgggcagaatggtgtccctcgaggggtcactgctaag240
tgaaggctatcacaggtcgcaagcagaaaacctgcctgtcgtttccaacaccaagatcat300
ctttgatgacgaggtctctcaagagaacaaggaatctcataaggacttggaacttagcgt360
tctaaaagaagataatggcgacgagatcatgtatgaaaaagattccagcgattcaaacag420
cgacagcgacagcgactaagttgcctctcatatttagttgccttctacgtccgcatatta480
catatataaaacatgttttgaatactgaagcacaatgagtcgcatcgc 528
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
<210> 49
<2i1> 34
<212> PPT
<213> Ashbya gossypii
<220>
<221> misc_feature
<223> Oligo 30
<400> 49
Asp Ala Phe Asn Ala Ser Ile Lys Lys Asn Asn Ile Pro Asp Asp Trp
1 5 10 15
Thr Phe Ile His Asn Glu Glu Ser Thr Asn Gly Ser Ser Glu Asn Asp
20 25 30
Ser Ser
<210> 50
<211> 105
<212> PRT
<213> Ashbya gossypii
<220>
<221> misc_feature
<223> Oligo 30
<400> 50
Arg Ser Leu Gly His Trp Val Asp Gly Asn Gly Lys Gln Leu Asp Gly
1 5 10 15
Lys Leu Lys Phe Thr Val Lys Asn Val Tyr Thr Ala GIy Arg Met Val
20 25 30
Ser Leu Glu Gly Ser Leu Leu Ser Glu Gly Tyr His Arg Ser Gln Ala
35 40 45
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
81
G1u Asn Leu Pro Val Val Ser Asn Thr Lys Ile Ile Phe Lsp Asp Glu
50 55 60
Val Ser Gln Glu Asn Lys Glu Ser His Lys Asp Leu Glu Leu Ser Val
65 70 75 80
Leu Lys Glu Asp Asn Gly Asp Glu Ile Met Tyr Glu Lys Asp Ser Ser
85 90 95
Asp Ser Asn Ser Asp Ser Asp Ser Asp
100 105
<210> 51
<211> 1489
<212> DNA
<213> Ashbya gossypii
<220>
<221> CDS
<222> (198)..(1073)
<223>
<220>
<221> misc_feature
<223> Oligo 30
<400> 51
caatttttgt atcacgtgac acataccatg gaagttttgt atccattttt tacgttacaa 60
tacgtacaga aaattttcac attagacgcc agtcctcatg cgatgagatg agcttcaaga 120
gcagtagctg tcgctgaacg gacatcaacg tggttatact gtcctgcttg ctaaggtagt 180
tacgcaaatt ggttaga atg ggt gtc aaa aaa agc ccg ctc aaa cgg tcc 230
Met Gly Val Lys Lys Ser Pro Leu Lys Arg Ser
1 5 10
aag acc gcc gag ttc atc aac aag cat cgc aag cta tgc aag aac ccc 278
Lys Thr Ala Glu Phe Ile Asn Lys His Arg Lys Leu Cys Lys Asn Pro
15 20 25
atc agc agt gaa gat aac aca tca cag tgc atc acg cgg ctt cca gtg 326
Ile Ser Ser Glu Asp Asn Thr Ser Gln Cys Ile Thr Arg Leu Pro Val
30 35 40
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
- 82
tct atg tac gtc tcg cta get ccc ctt tac cag caa cat cct ctg gag 374
Ser Met Tyr Val Ser Leu Ala Pro Leu Tyr Gln Gln His Pro Leu Glu
45 50 55
ggc ata aaa cgg caa cat ctg aat ccc atg gtc atg aaa tac aac gga 422
Gly Ile Lys Arg Gln His Leu Asn Pro Met Val Met Lys Tyr Asn Giy
60 65 70 75
gat gtt gga ggt gta ata ctg gga tat gag aat gtg gcg att atg aat 470
Asp Val Gly Gly Val Ile Leu Gly Tyr Glu Asn Val Ala Ile Met Asn
so as 90
gaaggcgetgcg aaagatgaa gaactgcta gtcaagttg acgccagat 518
GluGlyAlaAla LysAspGlu GluLeuLeu ValLysLeu ThrProAsp
95 100 105
accccttttgcg tttacctgg tgcagcgta gatcttgtg gtatggtcg 566
ThrProPheAla PheThrTrp CysSerVal AspLeuVal ValTrpSer
110 115 120
ccacatatcggc gatgtgctc gagggatgg atcttcata cagtcagcc 614
ProHisIleGly AspVal-LeuGluGlyTrp IlePheIle GlnSerAla
125 130 135
tcacacattggt ctgctgatc cacgacget ttcaacgca tccattaag 662
SerHisIleGly LeuLeuIle HisAspAla PheAsnAla SerIleLys
140 145 150 155
aaaaataacatt ccggatgat tggaccttt attcataac gaagagagt 710
LysAsnAsnIle ProAspAsp TrpThrPhe IleHisAsn GluGluSer
160 165 170
accaacgggagc agcgaaaac gattcttcc acaggaatg cgcaaggcc 758
ThrAsnGlySer SerGluAsn AspSerSer ThrGlyMet ArgLysAla
175 180 185
cggtctctaggc cactgggtt gacggcaac ggtaagcag ctggacgga 806
ArgSerLeuGly HisTrpVal AspGlyAsn GlyLysGln LeuAspGly
190 195 200
aaactcaaattt actgttaaa aatgtctac actgcgggc agaatggtg 854
LysLeuLysPhe ThrValLys AsnValTyr ThrAlaGly ArgMetVal
205 210 215
tccctcgagggg tcactgcta agtgaaggc tatcacagg tcgcaagca 902
SerLeuGluGly SerLeuLeu SerGluGly TyrHisArg SerGlnAla
220 225 230 235
gaaaacctgcct gtcgtttcc aacaccaag atcatcttt gatgacgag 950
GluAsnLeuPro ValValSer AsnThrLys IleIlePhe AspAspGlu
240 245 250
gtctctcaagag aacaaggaa tctcataag gacttggaa cttagcgtt 998
ValSerGlnGlu AsnLysGlu SerHisLys AspLeuGlu LeuSerVal
255 260 265
ctaaaagaagat aatggcgac gagatcatg tatgaaaaa gattccagc 1046
LeuLysGluAsp AsnGlyAsp GluIleMet TyrGluLys AspSerSer
270 275 280
gattcaaacagc gacagcgac agcgactaagttgcct 1093
ctcatattta
AspSerAsnSer AspSerAsp SerAsp
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
- 83
285 290
gttgccttct acgtccgcatattacatatataaaacatgttttgaatact gaagcacaat1153
gagtcgcatc gcagttagtgtatagatagaacatgaaagtccaattgaga caatttacat1213
ccatatttta gtgagttaaaagcgacattaaacttggaagcaatatatat accttatttc1273
cacgcaataa ctaaattccaaaatgtcgattattttaaggctaggctaca acgggtaccc1333
aatagcttat gatcgtgaatacaacgacgtaaatacctaataatatgctc tttttatgtc1393
caaattcact actcattacctggtataatcattatatacgaaaatacttt atatatgtca1453
tctgaagact gtctctctaccaatcattgcaccaag 1489
<210> 52
<211> 292
<212> PRT
<213> Ashbya gossypii
<220>
<221> misc_feature
<223> Oligo 30
<400> 52
Met Gly Val Lys Lys Ser Pro Leu Lys Arg Ser Lys Thr Ala Glu Phe
1 5 10 15
Ile Asn Lys His Arg Lys Leu Cys Lys Asn Pro Ile Ser Ser Glu Asp
20 25 30
Asn Thr Ser Gln Cys Ile Thr Arg Leu Pro Val Ser Met Tyr Val Ser
35 40 45
Leu Ala Pro Leu Tyr Gln Gln His Pro Leu Glu Gly Ile Lys Arg Gln
50 55 60
His Leu Asn Pro Met Val Met Lys Tyr Asn Gly Asp Val Gly Gly Val
65 70 75 80
Ile Leu Gly Tyr Glu Asn Val Ala Ile Met Asn Glu Gly Ala Ala Lys
85 90 95
Asp Glu Glu Leu Leu Val Lys Leu Thr Pro Asp Thr Pro Phe Ala Phe
100 105 110
M/42319-PCT
CA 02458953 2004-02-27
0050/5287 4
84
_ Thr Trp Cys Ser Va1 Asp Leu Val Val Trp Ser Pro His Ile Gly Asp
115 120 125
Val Leu Glu Gly Trp Ile Phe Ile Gln Ser Ala Ser His Ile Gly Leu
130 135 140
Leu Ile His Asp Ala Phe Asn Ala Ser Ile Lys Lys Asn Asn Ile Pro
145 150 155 160
Asp Asp Trp Thr Phe Ile His Asn Glu Glu Ser Thr Asn Gly Ser Ser
165 170 175
Glu Asn Asp Ser Ser Thr Gly Met Arg Lys Ala Arg Ser Leu Gly His
180 185 190
Trp Val Asp Gly Asn Gly Lys Gln Leu Asp Gly Lys Leu Lys Phe Thr
195 200 205
Val Lys Asn Val Tyr Thr Ala Gly Arg Met Val Ser Leu Glu Gly Ser
210 215 220
Leu Leu Ser Glu Gly Tyr His Arg Ser Gln Ala Glu Asn Leu Pro Val
225 230 235 240
Val Ser Asn Thr Lys Ile Ile Phe Asp Asp Glu Val Ser Gln Glu Asn
245 250 255
Lys Glu Ser His Lys Asp Leu Glu Leu Ser Val Leu Lys Glu Asp Asn
260 265 270
Gly Asp Glu Ile Met Tyr Glu Lys Asp Ser Ser Asp Ser Asn Ser Asp
275 280 285
Ser Asp Ser Asp
290
<210> 53
<211> 1289
<212> DNA
<213> Ashbya gossypii
<220>
<22I> misc_feature
<223> Oligo 124
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
<400>
53
gatcaactacgatatgcctagtgaggcagaccaatacctccacagagtcggtagagcggg60
cagattcggtaccaaaggtctggctatttcccttgtgtcctcaaaagatgatgaggaggt120
tttagctaagatccaagaacgttttgaccgtgaagatcaccgaatttccagaagaaggtg180
tcgacccatctacctatttgaacacttgaacaacaccgcttctccccatttccgatacta240
tatacgaaaagggctaacgtaaataagagaagaactcaacaaagggaaattttaaccttt300
ttcttggttttttgtatctaatataatcatcaaggactgggacgtatggtttagcctagt360
ctagctgaatactattagcgtcgcttctccgtcggaaagtactgatctaataaaccttcc420
aaaatgttttactgacattgatggcctagctctagaatttcttgtactcgtgacttcttt480
acacccagtcgcttttgcttttacgtaaaaccaaaactgaatgttttacttctcatataa540
aactgcatctttaaatcttaaatcgggcctcatattacatatgtgattttttttcccgga600
aagtgcatcgaacttcaatgcaggagtggtaatacgccaagagcaatgacgggatcttca660
gcgttccttgcggatgcgcaagtaaaacataaacttagaatatcactacaaataaacagc720
aactaggttacaagcactattataaacggccacatgaagacatctctcggctgtaaccca780
gcgctcatgtttgctctggggtgtcgcgtgcgctgacgtcaggaggctgcggtaagatga840
tctgcatatcttgctgtgcactgggcttttcgttagacttggatgatagaaccttggaaa900
ctttctctagacctttggtggaattaggcatgctgtttaaatgatgtgcatgaatattac960
ttaacgggagttccttggggagttcttcaatgtggcttcgggccttcaaagcacgagggg102.0
cagcagctaacaatgacggagaactatcatgccaattggagtgatcagactcagcaatat1080
tagttacaggcgttgaatctgattcctcgtctaggacgcgcgatgccaggatcccaaggg1140
tggttagcatatgggaaccgtttttgcttccgctgtcgctgcaagttattccactattaa1200
cagagccactgttactttttgccttcacactaggcgttgtgggcatgtactgggcagtct1260
tattcagaatgcgcatgagcctgttgatc 1289
<210> 54
<211> 49
<212> PRT
<213> Ashbya gossypii
<220>
<221> misc_feature
M/42319-PCT
CA 02458953 2004-02-27
0050!52814
86
<223> Oligo 124
<400> 54
Ile Asn Tyr Asp Met Pro Ser Glu Ala Asp Gln Tyr Leu His Arg Val
1 5 10 15
Gly Arg Ala Gly Arg Phe Gly Thr Lys Gly Leu Ala Ile Ser Leu Val
20 25 30
Ser Ser Lys Asp Asp Glu Glu Val Leu Ala Lys Ile Gln Glu Arg Phe
35 40 45
Asp
<210> 55
<211> 18
<212> PRT
<213> Ashbya gossypii
<220>
<221> misc_feature
<223> Oligo 124
<400> 55
Val Lys Ile Thr Glu Phe Pro Glu Glu Gly Val Asp Pro Ser Thr Tyr
1 5 10 15
Leu Asn
<210> 56
<211> 3228
<212> DNA
<213> Ashbya gossypii
<220>
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
87
<221> CDS
<222> (465)..(1775)
<223>
<220>
<221> misc feature
<223> Oligo 124
<400>
56
ccagacgaggatgatgccccggactcccgccgctgcagatgttgctgtcgctattctggg60
gcattcgcctccgctggaacgaacgccatccgcagaacgcgcatcaacagatccgcagac120
tatgcatgcccaattgaaggcgttggtggctaccattgatgaccatgagccacagcttta180
taacaatatggcagatcccgcatcaaaagttctactgaataacatcttcaaccgtcttcg240
agccatggtgagtgatgatgcgtcctagtctcgatcacgtgattcaaaagcgtatcctgt300
tacccggccctctaaaggtggcaaactgtcgaaaattgaaagcgtaatgaaaaatcagcg360
aaaagaacaggatttgtttggaacgccatattatctttcattctttgaaagcataaagcg420
ctattttagctgtcaggtcattctttagttaatcgattatcagg atg 476
tca cac
gaa
Met Ser
His Glu
1
ggc gag gaa gat tta ttg gaa tat tcc gat aac gaa cag gaa atc cag 524
Gly Glu Glu Asp Leu Leu Glu Tyr Ser Asp Asn Glu Gln Glu Ile Gln
10 15 20
gtt gac aac acg aag gcc act gag gta gcc ggt aac gga gaa gag gca 572
Val Asp Asn Thr Lys Ala Thr Glu Va1 Ala Gly Asn Gly Glu Glu Ala
25 30 35
get gac gga aag gat gga gac aag aag gga tcg tac gta ggt att cac 620
Ala Asp Gly Lys Asp Gly Asp Lys Lys Gly Ser Tyr Val Gly Ile His
40 45 50
tcg aca ggt ttt aag gat ttt ctg ttg aag cca gag ctt tcc cgg gcc 668
Ser Thr Gly Phe Lys Asp Phe Leu Leu Lys Pro Glu Leu Ser Arg Ala
55 60 65
att att gac tgt ggt ttg gaa cat cca tgt gag gtc caa caa cac acc 716
Ile Iie Asp Cys Gly Leu Glu His Pro Cys Glu Val Gln Gln His Thr
70 75 80
atc cca caa tca att cac ggt acg gac gtt cta tgt cag gca aag tcc 764
Ile Pro Gln Ser I1e His Gly Thr Asp Val Leu Cys Gln Ala Lys Ser
85 90 95 100
ggt ctc ggg aaa act get gtg ttt gtg ttg tca acg ctg cag caa ttg 812
Gly Leu Gly Lys Thr Ala Val Phe Val Leu Sex Thr Leu Gln Gln Leu
105 110 115
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
88
_ gac cct gtt cca ggc gag gta tca gtg gtc gtt ctg tgc aat gcc aga 860
Asp Pro Val Pro Gly Glu Val Ser Val Val Val Leu Cys Asn Ala Arg
120 125 130
gaa ttg get tat cag atc aga aac gag tac ttg aga ttc tcg aaa tat 908
Glu Leu Ala Tyr Gln Ile Arg Asn Glu Tyr Leu Arg Phe Ser Lys Tyr
135 140 145
atg ccg gac gtg aaa aca get gtt ttc tat ggt ggc aca gac act agg 956
Met Pro Asp Val Lys Thr Ala Val Phe Tyr Gly Gly Thr Asp Thr Arg
150 155 160
aag gac att gag ttg tta aaa aac aaa gat act gcg cca cat att gta 1004
Lys Asp Ile Glu Leu Leu Lys Asn Lys Asp Thr A1a Pro His IIe Val
165 170 175 180
gtt gca acg ccg gga cgg ttg aag gcg ctg gta cgg gac aac aat att 1052
Val Ala Thr Pro Gly Arg Leu Lys Ala Leu Va1 Arg Asp Asn Asn Ile
185 190 195
gac ttg tct cac gtt aag aac ttt gtt atc gat gag tgt gac aag gtg 1100
Asp Leu Ser His Val Lys Asn Phe Val Ile Asp Glu Cys Asp Lys Val
200 - 205 210
ttg gag gag ctc gat atg aga aga gat gtg caa gac att ttc agg gca 1148
Leu Glu Glu Leu Asp Met Arg Arg Asp Val Gln Asp Ile Phe Arg Ala
215 220 225
act cct aga gat aag cag gtg atg atg ttc tct get acg cta tct caa 1196
Thr Pro Arg Asp Lys Gln Val Met Met Phe Ser Ala Thr Leu Ser Gln
230 235 240
gag atc aga ccg atc tgt aga cgt ttc ttg caa aac cct ctg gag att 1244
Glu Ile Arg Pro Ile Cys Arg Arg Phe Leu Gln Asn Pro Leu Glu Ile
245 250 255 260
ttt gtt gat gac gaa get aag ttg acc ttg cac ggt ttg cag cag tac 1292
Phe Val Asp Asp Glu Ala Lys Leu Thr Leu His Gly Leu Gln Gln Tyr
265 270 275
tat atc agg ctt gag gaa cgt gag aag aac cgt aag ctg get caa ttg 1340
Tyr Ile Arg Leu Glu Glu Arg Glu Lys Asn Arg Lys Leu Ala Gln Leu
280 285 290
ttg gat gat ttg gaa ttt aac cag gtt att atc ttc gta aaa tcg aca 1388
Leu Asp Asp Leu Glu Phe Asn Gln Val Ile Ile Phe Val Lys Ser Thr
295 300 305
ctt aga gca aac gaa ttg act aag ctg ttg aat get tcc aac ttc cct 1436
Leu Arg Ala Asn Glu Leu Thr Lys Leu Leu Asn Ala Ser Asn Phe Pro
310 315 320
gca att act gtt cac ggt cac atg aga cag gaa gag cgt att gcc cgc 1484
Ala Ile Thr Val His Gly His Met Arg Gln Glu Glu Arg Ile Ala Arg
325 330 335 340
tac aag gcc ttc aag gaa ttt gaa aag cgt atc tgt gtg tca aca gac 1532
Tyr Lys Ala Phe Lys Glu Phe Glu Lys Arg Ile Cys Va1 Ser Thr Asp
345 350 355
gtt ttc ggt agg ggt att gat atc gag cgt atc aac cta gcg atc aac 1580
Val Phe Gly Arg Gly Ile Asp Ile Glu Arg Ile Asn Leu Ala Ile Asn
360 365 370
M/42319-PCT
CA 02458953 2004-02-27
0050152814
89
tac gat atg cct agt gag gca gac caa tac ctc cac aga gtc ggt aga 1628
Tyr Asp Met Pro Ser Glu Ala Asp Gln Tyr Leu His Arg Val Gly Arg
375 380 385
gcg ggc aga ttc ggt acc aaa ggt ctg get att tcc ctt gtg tcc tca 1676
Ala Gly Arg Phe Gly Thr Lys Gly Leu Ala Ile Ser Leu Val Ser Ser
390 395 400
aaa gat gat gag gag gtt tta get aag atc caa gaa cgt ttt gac gtg 1724
Lys Asp Asp Glu Glu Val Leu Ala Lys Ile Gln Glu Arg Phe Asp Val
405 410 415 420
aag atc acc gaa ttt cca gaa gaa ggt gtc gac cca tct acc tat ttg 1772
Lys Ile Thr Glu Phe Pro Glu Glu Gly Val Asp Pro Ser Thr Tyr Leu
425 430 435
aac acttgaacaa caccgcttct ccccatttcc gatactatat acgaaaaggg 1825
Asn
ctaacgtaaataagagaagaactcaacaaagggaaattttaacctttttcttggtttttt1885
gtatctaatataatcatcaaggactgggacgtatggtttagcctagtctagctgaatact1945
attagcgtcgcttctccgtcggaaagtactgatctaataaaccttccaaaatgttttact2005
gacattgatggcctagctctagaatttcttgtactcgtgacttctttacacccagtcgct2065
tttgcttttacgtaaaaccaaaactgaatgttttacttctcatataaaactgcatcttta2125
aatcttaaatcgggcctcatattacatatgtgattttttttcccggaaagtgcatcgaac2185
ttcaatgcaggagtggtaatacgccaagagcaatgacgggatcttcagcgttccttgcgg2245
atgcgcaagtaaaacataaacttagaatatcactacaaataaacagcaactaggttacaa2305
gcactattataaacggccacatgaagacatctctcggctgtaacccagcgctcatgtttg2365
ctctggggtgtcgcgtgcgctgacgtcaggaggctgcggtaagatgatctgcatatcttg2425
ctgtgcactgggcttttcgttagacttggatgatagaaccttggaaactttctctagacc2485
tttggtggaattaggcatgctgtttaaatgatgtgcatgaatattacttaacgggagttc2545
cttggggagttcttcaatgtggcttcgggccttcaaagcacgaggggcagcagctaacaa2605
tgacggagaactatcatgccaattggagtgatcagactcagcaatattagttacaggcgt2665
tgaatctgattcctcgtctaggacgcgcgatgccaggatcccaagggtggttagcatatg2725
ggaaccgtttttgcttccgctgtcgctgcaagttattccactattaacagagccactgtt2785
actttttgccttcacactaggcgttgtgggcatgtactgggcagtcttattcagaatgcg2845
catgagcctgttgatctgtttattcttctccataatggtatcacgatattttgagatttt2905
atgatctctagtgcgaatctgttccttcaactcttgcttatctatattgagcttgcattt2965
cacgtgttcgtacatatgcttggacaaattaagctcaacttcagaacgggaatccacatt3025
ctttaacgttgaattcagcaccaggtttttgaacttgagttgccggatctgctcttgtga3085
MJ42319-PCT
CA 02458953 2004-02-27
0050/52814
- 90
ctttgaaagc aggcttaccaacaattctaa ggtcttcgag agttcatcyt tggatgggac3145
aaacagttcg agtggtgtctgttgcctcga ctctgatggt tccgtcctat caaattcgtt3205
acatcgccgt gtcgacaagttgt 3228
<210> 57
<211> 437
<212> PRT
<213> Ashbya gossypii
<220>
<221> misc_feature
<223> Oligo 124
<400> 57
Met Ser His GIu Gly Glu Glu Asp Leu Leu Glu Tyr Ser Asp Asn Glu
1 5 10 15
Gln Glu Ile Gln Val Asp Asn Thr Lys Ala Thr Glu Val Ala Gly Asn
20 25 30
Gly Glu Glu Ala AIa Asp Gly Lys Asp Gly Asp Lys Lys Gly Ser Tyr
35 40 45
Val Gly Ile His Ser Thr Gly Phe Lys Asp Phe Leu Leu Lys Pro Glu
50 55 60
Leu Ser Arg Ala Ile Ile Asp Cys Gly Leu GIu His Pro Cys Glu Val
65 70 75 80
Gln Gln His Thr Ile Pro Gln Ser Ile His Gly Thr Asp Val Leu Cys
85 90 95
Gln Ala Lys Ser Gly Leu Gly Lys Thr Ala Val Phe Val Leu Ser Thr
100 105 110
Leu Gln Gln Leu Asp Pro Val Pro Gly G1u Val Ser Val Val VaI Leu
17.5 120 125
Cys Asn Ala Arg Glu Leu Ala Tyr Gln Ile Arg Asn Glu Tyr Leu Arg
130 135 140
Phe Ser Lys Tyr Met Pro Asp Val Lys Thr AIa Val Phe Tyr Gly Gly
145 150 155 160
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
- 91
Thr Asp Thr Arg Lys Asp Ile Glu Leu Leu Lys Asn Lys Asp Thr Ala
165 170 175
Pro His Ile Val Val Ala Thr Pro Gly Arg Leu Lys Ala Leu VaI Arg
180 185 190
Asp Asn Asn Ile Asp Leu Ser His Val Lys Asn Phe Val Ile Asp Glu
195 200 205
Cys Asp Lys Val Leu Glu Glu Leu Asp Met Arg Arg Asp Val Gln Asp
210 215 220
Ile Phe Arg Ala Thr Pro Arg Asp Lys Gln Val Met Met Phe Ser Ala
225 230 235 240
Thr Leu Ser Gln Glu Ile Arg Pro Ile Cys Arg Arg Phe Leu Gln Asn
245 250 255
Pro Leu Glu Ile Phe Val Asp Asp Glu Ala Lys Leu Thr Leu His Gly
260 265 270
Leu Gln Gln Tyr Tyr Ile Arg Leu Glu Glu Arg Glu Lys Asn Arg Lys
275 280 285
Leu Ala Gln Leu Leu Asp Asp Leu Glu Phe Asn Gln Val Ile Ile Phe
290 295 300
Val Lys Ser Thr Leu Arg Ala Asn Glu Leu Thr Lys Leu Leu Asn Ala
305 310 315 320
Ser Asn Phe Pro Ala Ile Thr Val His Gly His Met Arg Gln Glu Glu
325 330 335
Arg Ile Ala Arg Tyr Lys Ala Phe Lys Glu Phe Glu Lys Arg Ile Cys
340 345 350
Val Ser Thr Asp Val Phe Gly Arg Gly Ile Asp Ile Glu Arg Ile Asn
355 360 365
Leu Ala Ile Asn Tyr Asp Met Pro Ser Glu Ala Asp Gln Tyr Leu His
370 375 380
Arg VaI Gly Arg Ala Gly Arg Phe Gly Thr Lys Gly Leu Ala Ile Ser
385 390 395 400
Leu Val Ser Ser Lys Asp Asp Glu Glu Val Leu Ala Lys Ile Gln Glu
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
92
405 410 415
Arg Phe Asp Val Lys Ile Thr Glu Phe Pro Glu Glu Gly Val Asp Pro
420 425 430
Ser Thr Tyr Leu Asn
435
<210> 58
<211> 545
<212> DNA
<213> Ashbya gossypii
<220>
<221> misc feature
<223> Oligo 139
<220>
<221> misc feature
<222> (358)..(358)
<223> unknown nucleotide
<220>
<221> misc_feature
<222> (418)..(418)
<223> unknown nucleotide
<220>
<221> misc feature
<222> (461)..(461)
<223> unknown nucleotide
<220>
<221> misc feature
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
93
<222> (506)..(506)
<223> unknown nucleotide
<220>
<221> misc_feature
<222> (539)..(539)
<223> unknown nucleotide
<400>
58
gatccacacgccaaccgacaggcagaacatctacgatttactgaaatatctcctggagaa 60
cgagccgaargattcgttwgcctgagtcatgtactatattattacactttgagtwgttta 120
tgtataggttgggacaacatgcagacaggcacctacacacctggattggacagcgtagcc 180
gctgccgcggcctgttgcttcttagtaaccctctttttggggactgccgccccatctgcc 240
tttttggtgggcttccgctgccttttcggtttggatttgtcgtcgctgtccgcggtgccg 300
gcgcgcttgccgtttgcctcgctcggcgcggtgtgcgcactgcccatccccataccgncc 360
ggcccaacattctgcagcatggccccggcctgctgcttcacaggctgtgtagtaagangg 420
gtcgacatcgagatgcggtgattataccccggcggggccangttcgcgttgagtgcctgc 480
tgcttcttcttctctttggtcaagcngaactgctcgacgaattttagtctgctgaaccng 540
gtatt
545
<210> 59
<211> 27
<212> PRT
<213> Ashbya gossypii
<220>
<221> misc_feature
<223> Oligo 139
<220>
<221> misc_feature
<222> (26)..(26)
<223> unknown amino acid
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
94
<400> 59
Ile His Thr Pro Thr Asp Arg Gln Asn Ile Tyr Asp Leu Leu Lys Tyr
1 5 10 15
Leu Leu Glu Asn Glu Pro Lys Asp Ser Xaa Ala
20 25
<210> 60
<211> 1396
<212> DNA
<213> Ashbya gossypii
<220>
<221> CDS
<222> (402)..(638)
<223>
<220>
<221> misc_feature
<223> Oligo 139
<220>
<221> CDS
<222> (663)..(974)
<223>
<400>
60
cttccccggaatgaaagccgggctcacgctgagttgcaggcgtggcagccgcgcggcaat60
atttgcacggttctctcagcactgcgccagtcaaccccttaactctcgagggtgccgccc120
ctcccgtaggcgcagtcggccaaggaggaagcggcggcacatggtgccggccgccaccgc180
ggagcaggatcaccggaatgacggatgtcacgtgcaggccgagggaccgactaagcgcgg240
tgttcgacagcgcgctcgtggcggcaggcacagccgtcggttaatgtgcacacacgtgat300
ggtcacgtgcgcaacggccgggcctttttgtgtggtcaaagccagagcacactcgggcag360
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
- atccacagca tacacaccat agagggacag tgccgatgac g acc gcg cgt gac aat 416
Thr Ala Arg Asp Asn
1 5
agc gcg acg acg ctc gag ctg tat cgc aag acg ctg aat ttc aat gtg 464
Ser Ala Thr Thr Leu Glu Leu Tyr Arg Lys Thr Leu Asn Phe Asn Va1
10 15 20
atcggc agatatgac cccaaaata aagcagctg ctgttccac acgccg 512
IleGly ArgTyrAsp ProLysIle LysGlnLeu LeuPheHis ThrPro
25 30 35
catgcg acggtgtac aagtgggag gccggcgag aacaagtgg aacaag 560
HisAla ThrValTyr LysTrpGlu AlaGlyGlu AsnLysTrp AsnLys
40 45 50
ctggag taccagggc gtgctgget atatatcta cgcgatgtg cgcgag 608
LeuGlu TyrGlnGly ValLeuAla IleTyrLeu ArgAspVal ArgGlu
55 60 65
caggcg gagctgccg gtgccgcac caggaggcgagtgcag 658
gcgcggaggg
GlnAla GluLeuPro ValProHis GlnGlu
70 75
gcgg 707
tgc
ggc
gag
gtg
ctc
agc
ggg
cgc
gac
atc
tac
aac
tac
gcg
ctg
Cys
Gly
Glu
Val
Leu
Ser
Gly
Arg
Asp
Ile
Tyr
Asn
Tyr
Ala
Leu
80 85 90
atcgtgctcaaccgg atcaacccc gagaacttc tcgattgca attgcg 755
IleValLeuAsnArg IleAsnPro GluAsnPhe SerIleAla IleAla
95 100 105 110
ccgaacagcgttgtg aacaagcgg cgtctcttt tcgccggag gagaac 803
ProAsnSerValVal AsnLysArg ArgLeuPhe SerProGlu GluAsn
115 120 125
gtgcagcagccgctg gagccaatg gacgttgag gtcaaagat gaactg 851
ValGlnGlnProLeu GluProMet AspValGlu ValLysAsp GluLeu
130 135 140
gtgatcatcaaaaac ctgcggaag gaggtgtac ggcatctgg atccac 899
ValIleIleLysAsn LeuArgLys GluValTyr GlyIleTrp IleHis
145 150 255
acgccaaccgacagg cagaacatc tacgattta ctgaaatat ctcctg 947
ThrProThrAspArg GlnAsnIle TyrAspLeu LeuLysTyr LeuLeu
160 165 170
gag aac gag ccg aag gat tcg ttt gcc tgagtcatgt actatattat 994
Glu Asn Glu Pro Lys Asp Ser Phe Ala
175 lao
tacactttgagttgtttatgtataggttgggacaacatgcagacaggcacctacacacct1054
ggattggacagcgtagccgctgccgcggcctgttgcttcttagtaaccctctttttgggg1114
actgccgccccatctgcctttttggtgggcttccgctgccttttcggtttggatttgtcg1174
tcgctgtccgcggtgccggcgcgcttgccgtttgcctcgctcggcgcggtgtgcgcactg1234
cccatccccataccgcccggcccaacattctgcagcatggccccggcctgctgcttcaca1294
M/42319-PCT
CA 02458953 2004-02-27
0050152814
~ 96
ggctgtgtag taagaggggt cgacatcgag atgcggtggt tataccccgg cggggccagg 1354
ttcgcgttga gtgcctgctg ctcttcttct ctttggtcaa gc 1396
<210> 61
<211> 79
<2I2> PRT
<213> Ashbya gossypii
<220>
<221> mist feature
<223> Oligo 139
<400> 61
Thr Ala Arg Asp Asn Ser Ala Thr Thr Leu Glu Leu Tyr Arg Lys Thr
1 5 10 15
Leu Asn Phe Asn Val Ile Gly Arg Tyr Asp Pro Lys Ile Lys Gln Leu
20 25 30
Leu Phe His Thr Pro His Ala Thr Val Tyr Lys Trp Glu Ala Gly Glu
35 40 45
Asn Lys Trp Asn Lys Leu Glu Tyr Gln Gly Val Leu Ala Ile Tyr Leu
50 55 60
Arg Asp Val Arg Glu Gln Ala Glu Leu Pro Val Pro His Gln Glu
65 70 75
<210> 62
<211> 104
<212> PRT
<213> Ashbya gossypii
<220>
<221> mist feature
<223> Oligo 139
<400> 62
Cys Gly Glu Val Leu Ser Gly Arg Asp Ile Tyr Asn Tyr Ala Leu Ile
1 5 10 15
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
97
Val Leu Asn Arg Ile Asn Pro Glu Asn Phe Ser Ile Ala Ile Ala Pro
2p 25 30
Asn Ser Val Val Asn Lys Arg Arg Leu Phe Ser Pro Glu Glu Asn Val
35 40 45
-Gln Gln Pro Leu Glu Pro Met Asp Val Glu Val Lys Asp Glu Leu Val
50 55 60
Ile Ile Lys Asn Leu Arg Lys Glu Val Tyr Gly Ile Trp Ile His Thr
65 70 75 80
Pro Thr Asp Arg Gln Asn Ile Tyr Asp Leu Leu Lys Tyr Leu Leu Glu
85 90 95
Asn Glu Pro Lys Asp Ser Phe Ala
100
<210> 63
<211> 944
<212> DNA
<213> Ashbya gossypii
<220>
<221> misc_feature
<223> Oligo 144
<400> 63
gatctgagaatgttaacgataaccctgctattgcgaagaacgttgtgagcttctacgcgc 60
ctgagaagaaggtcgacaagaagggtgtcatcattgacaaagagctcagcatcttcaaga 120
agtggaaacttgtgcgtgccatcgacggcaagttctccaacgaaattacctggtcacctg 180
ctggacgttttgtatgcgtcgctgctattggtaagattggttcccgtaacgagaacattg 240
atttctacgatatggactatccaaacactgaaaagatcattaacactgctactgacgtta 300
acgctaccctgagagacgttgcccacatcaactacgccagtgccactgattacgaatggg 360
acccaagtggacggtaccttgccttctggtcttccgcgtggaagcacaaggccgaaaatg 420
gatacaaggtattcaacttggccggtgccatcgtgcgtgaggagctcatcaccgacttta 480
acaacttcttctggagaccaagaccagactctctactatccaactctgagaagaagaagg 540
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
gg
- tcagaaagaacctcaaggaatggtccgcgcactttgaagagcaggatgctatggaggcgg600
acagtgctac aagagagttaatcctaaagagacgcaactggttggatgaatggtccaagt660
acagagaggc ttgcaagcaaaccctatccgaaagtggattgtccatttgcgattgtgtcg72D
aactgtcaac taaggatgaggactgtgagcttgtcgaggagattagagagactgtggttg780
aggagtccac cgaggaagtgccatttttcgaggagtaatcgggtttcggctgttgttgta840
taatagtggc aacactggtaattgattatgtatatatacaagtactacatccagcgtata900
atgttttctt ttccgcagcagcgtctcgtcgcactcatgcgatc 944
<210> 64
<211> 260
<212> PRT
<213> Ashbya gossypii
<220>
<221> misc feature .
<223> Oligo 144
<400> 64
Asn Pro Ala Ile Ala Lys Asn Val Val Ser Phe Tyr Ala Pro Glu Lys
1 5 10 15
Lys Val Asp Lys Lys Gly Val Ile Ile Asp Lys Glu Leu Ser Ile Phe
20 25 30
Lys Lys Trp Lys Leu Val Arg Ala Ile Asp Gly Lys Phe Ser Asn Glu
35 40 . 45
Ile Thr Trp Ser Pro Ala Gly Arg Phe Val Cys Val Ala Ala Ile Gly
50 55 60
Lys Ile Gly Ser Arg Asn Glu Asn Ile Asp Phe Tyr Asp Met Asp Tyr
65 70 75 80
Pro Asn Thr Glu Lys Ile Ile Asn Thr Ala Thr Asp Val Asn Ala Thr
85 90 95
Leu Arg Asp Val Ala His Ile Asn Tyr Ala Ser Ala Thr Asp Tyr Glu
100 105 110
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
99
Trp Asp Pro Ser Gly Arg Tyr Leu Ala Phe Trp Ser Ser Ala Trp Lys
115 120 125
His Lys A1a Glu Asn Gly Tyr Lys Val Phe Asn Leu Ala Gly Ala Ile
130 135 140
Val Arg Glu Glu Leu Ile Thr Asp Phe Asn Asn Phe Phe Trp Arg Pro
145 150 155 160
Arg Pro Asp Ser Leu Leu Ser Asn Ser Glu Lys Lys Lys Val Arg Lys
165 170 175
Asn Leu Lys Glu Trp Ser Ala His Phe Glu Glu Gln Asp Ala Met Glu
180 185 190
Ala Asp Ser Ala Thr Arg Glu Leu Ile Leu Lys Arg Arg Asn Trp Leu
195 200 205
Asp Glu Trp Ser Lys Tyr Arg Glu Ala Cys Lys Gln Thr Leu Ser Glu
210 215 220
Ser Gly Leu Ser Ile Cys Asp Cys Val Glu Leu Ser Thr Lys Asp Glu
225 230 235 240
Asp Cys Glu Leu Val Glu Glu Ile Arg Glu Thr Val Val Glu Glu Ser
245 250 255
Thr Glu Glu Val
260
<210> 65
<211> 3397
<212> DNA
<213> Ashbya gossypii
<220>
<221> CDS
<222> (468)..(2675)
<223>
<220>
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
- 100
<221> misc_feature
<223> Oligo 144
<400>
65
actccattgccctcttgcgctgccatcgtctcactttcgcctgcaaatatccactttggt60
cccgtcgcctgctccattcagcacagattggattatcgcctctaacacctccatgagtct120
tgctgaagcttgcttggtgctttgcgcgtactgtttttggacatctatgtaaacaagcga180
aaatacccacttctgtgtcgcgtggataaggtgcgcgcccacattgcgaatcccacggca240
cggccacttgctagtaaaccccaaagcgtaacgctagttctctagccgggcactgagacc300
gttaatgcagcagccaatggcctgcatttgggatgaggttggtcagatggaatcacgtga360
tatagatgcttggcgaggtcaaggtgaaaaattgttaagttaaaattttggacgcatcac420
cagttccagcgagagaagatcagtcaagcagcaggtatagagcgaag gca gcg 476
atg
- Met Ala Ala
1
gtattc gacgatata aggcttgag gacatccctgtg gatgatgtg gat 524
ValPhe AspAspIle ArgLeuGlu AspIleProVal AspAspVal Asp
10 15
atgcag gaccttgag gagacgtat getgtagagcgg agcatcgaa ttt 572
MetGln AspLeuGlu GluThrTyr AlaValGluArg SerIleGlu Phe
20 25 30 35
gacaga tacgtggtt gtcgacggg gcgccggtggcg ccggaggcg aag 620
AspArg TyrValVal ValAspGly AlaProValAla ProGluAla Lys
40 45 50
gtgggc gcgctgcag aaggtgctg acgaagctattt tcgcaggcg ggg 668
ValGly AlaLeuGln LysVal~Leu ThrLysLeuPhe SerGlnAla Gly
55 60 65
tcagtg gtggacatg gatgtgcct gtcgaagagggg cggacgaag gga 716
SerVal ValAspMet AspValPro ValGluGluGly ArgThrLys Gly
70 75 80
cacctt ttcattgagttt gaggacgcc ggcgetgcg cggcgggcg atc 764
HisLeu PheIleGluPhe GluAspAla GlyAlaAla ArgArgAla Ile
85 90 95
aagatg ttcaacgggaag aagttggac gtcaagcac cgcctgtgg gtg 812
LysMet PheAsnGlyLys LysLeuAsp ValLysHis ArgLeuTrp Val
100 105 110 115
aacgga ctagacgacatg gagcgctac gggcggccg gacttttca acg 860
AsnGly LeuAspAspMet GluArgTyr GlyArgPro AspPheSer Thr
120 125 130
gaatac cgggagcctgtg gtgccggag ttcgaggcg acggaatac cca 908
GluTyr ArgGluProVal ValProGlu PheGluAla ThrGluTyr Pro
135 140 145
cggtcg tggttgcaggac gagacgggt cgggaccag tttgtgctg cag 956
ArgSer TrpLeuGlnAsp GluThrGly ArgAspGln PheValLeu Gln
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
101
150 155 160
aag ggc gag atg acg get gta ttc tgg aac cgg aac aac ctg cag ceg 1004
Lys Gly Glu Met Thr Ala Val Phe Trp Asn Arg Asn Asn Leu Gln Pro
165 170 175
gag aac gtt gtc gaa ccg cgc cgc aac tgg tcg aac tct atc ttg aac 1052
Glu Asn Val Val Glu Pro Arg Arg Asn Trp Ser Asn Ser Ile Leu Asn
180 185 190 195
ttc tcg cct cac ggt acg tac cta ttc tcg ttc cac gac cag ggc att 1100
Phe Ser Pro His Gly Thr Tyr Leu Phe Ser Phe His Asp Gln Gly Ile
200 205 210
gcg tcc tgg ggt ggg ccg cag ttc aag cgt ctc cgt cgg ttt gcg cac 1148
Ala Ser Trp Gly Gly Pro Gln Phe Lys Arg Leu Arg Arg Phe Ala His
215 220 225
cct gat gtt aag gcg atc tcc atg tcc tcg acc gag aag tac ctg gtt 2196
Pro Asp Val Lys Ala Ile Ser Met Ser Ser Thr Glu Lys Tyr Leu Val
230 235 240
acc ttt tcg tcg gaa cct eta gaa gtc teg gat gaa cct aac gag get 1244
Thr Phe Ser Ser Glu Pro Leu Glu Val Ser Asp Glu Pro Asn Glu Ala
245 250 255
tgtcca ttcgggccc gagtcgcgg ggccaccagcta tgtatatgg gat 1292
CysPro PheGlyPro GluSerArg GlyHisGlnLeu CysIleTrp Asp
260 265 270 27S
gtggca acaggtgtc tgcgtgaag acctttgcgctg ccgcctcag cag 1340
ValAla ThrGlyVal CysValLys ThrPheAlaLeu ProProGln Gln
280 285 290
cagctg caatggcct atggtcaag tggtcctttgac gacaagttc tgc 1388
GlnLeu GlnTrpPro MetValLys TrpSerPheAsp AspLysPhe Cys
295 300 305
getegt cttggccct ggegcaatt getgtgtacgag acegagaag aac 1436
AlaArg LeuGlyPro GlyAlaIle AlaValTyrGlu ThrGluLys Asn
310 315 320
ttc cag ctg ttg ggc ggt aag gtg atg aag atc gag gat gtt cag gac 1484
Phe Gln Leu Leu Gly Gly Lys Val Met Lys Ile Glu Asp Val Gln Asp
325 330 335
ttc tcc ttt get cet aag ggc ate aag ttg gcg tca aae aga cce aac 1532
Phe Ser Phe Ala Pro Lys Gly Ile Lys Leu Ala Ser Asn Arg Pro Asn
340 345 350 355
gac cca cca tct act gtc atg gta tac tgg act cca gag tcg aac aac 1580
Asp Pro Pro Ser Thr Val Met Val Tyr Trp Thr Pro Glu Ser Asn Asn
360 365 370
cag tcg tgt aaa get gtc ctg att gag cta ccg aac cge cgt gtt ctg 1628
Gln Ser Cys Lys Ala Val Leu Ile Glu Leu Pro Asn Arg Arg Val Leu
375 380 385
cgt acc atc aac ttg gtg cag gtt act gat gtc tcc ttc cat tgg cag 1676
Arg Thr Ile Asn Leu Val Gln Val Thr Asp Val Ser Phe His Trp Gln
390 395 400
aac cag gca gag ttc ctc tgt gta cag gtg gac cgt cac acg aag tct 1724
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
102
a Asn Gln Ala Glu Phe Leu Cys Val Gln Val Asp Arg His Thr Lys Ser
405 410 415
agg aag acc atc ttc acc aac atg gag att tgc tct ttg act gcc aga 1772
Arg Lys Thr Ile Phe Thr Asn Met Glu Ile Cys Ser Leu Thr Ala Arg
420 425 430 435
gagttt ccatttgag aaggtggag attaaggac cgctgtatg cgcttt 1820
GluPhe ProPheGlu LysValGiu IleLysAsp ArgCysMet ArgPhe
440 445 450
gcatgg gaacctaat agcgaccgt ttcgtgatc atttcgaga tctgag 1868
AlaTrp GluProAsn SerAspArg PheValIle IleSerArg SerGlu
455 460 465
aatgtt aacgataac cctgetatt gcgaagaac gttgtgagc ttctac 1916
AsnVal AsnAspAsn ProAlaIle AlaLysAsn ValValSer PheTyr
470 475 480
gcgcct gagaagaag gtcgacaag aagggtgtc atcattgac aaagag 1964
AlaPro GluLysLys ValAspLys LysGlyVal IleIleAsp LysGlu
485 490 495
ctcagc atcttcaag aagtggaaa cttgtgcgt gccatcgac ggcaag 2012
LeuSer IlePheLys LysTrpL~ysLeuValArg AlaIleAsp GlyLys
500 505 510 515
ttctcc aacgaaatt acctggtca cctgetgga cgttttgta tgcgtc 2060
PheSer AsnGluIle ThrTrpSer ProAlaGly ArgPheVal CysVal
520 525 530
getget attggtaag attggttcc cgtaacgag aacattgat ttctac 2108
AlaAla IleGlyLys IleGlySer ArgAsnGlu AsnIleAsp PheTyr
535 540 545
gatatg gactatcca aacactgaa aagatcatt aacactget actgac 2156
AspMet AspTyrPro AsnThrGlu LysIleIle AsnThrAla ThrAsp
550 555 560
gttaac getaccctg agagacgtt gcccacatc aactacgcc agtgcc 2204
ValAsn AlaThrLeu ArgAspVal AlaHisIle AsnTyrAla SerAla
565 570 575
actgat tacgaatgg gacccaagt ggacggtacctt gccttctgg tct 2252
ThrAsp TyrGluTrp AspProSer GlyArgTyrLeu AlaPheTrp Ser
580 585 590 595
tccgcg tggaagcac aaggccgaa aatggatacaag gtattcaac ttg 2300
SerAla TrpLysHis LysAlaGIu AsnGlyTyrLys ValPheAsn Leu
600 605 610
gccggt gccatcgtg cgtgaggag ctcatcaccgac tttaacaac ttc 2348
AlaGly AlaIleVal ArgGluGlu LeuIleThrAsp PheAsnAsn Phe
615 620 625
ttctgg agaccaaga ccagactct ctactatccaac tctgagaag aag 2396
PheTrp ArgProArg ProAspSer LeuLeuSerAsn SerGluLys Lys
630 635 640
aaggtc agaaagaac ctcaaggaa tggtccgcgcac tttgaagag cag 2444
LysVal ArgLysAsn LeuLysGlu TrpSerAlaHis PheGluGlu Gln
645 650 655
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
103
gat get atg gag gcg gac agt get aca aga gag tta atc cta aag aga 2492
Asp Ala Met Glu Ala Asp Ser Ala Thr Arg Glu Leu Ile Leu Lys Arg
660 665 670 675
cgc aac tgg ttg gat gaa tgg tcc aag tac aga gag get tgc aag caa 2540
Arg Asn Trp Leu Asp Glu Trp Ser Lys Tyr Arg Glu Ala Cys Lys Gln
680 685 690
acc cta tcc gaa agt gga ttg tcc att tgc gat tgt gtc gaa ctg tca 2588
Thr Leu Ser Glu Ser Gly Leu Ser Ile Cys Asp Cys Val Glu Leu Ser
695 700 705
act aag gat gag gac tgt gag ctt gtc gag gag att aga gag act gtg 2636
Thr Lys Asp Glu Asp Cys Glu Leu Val Glu Glu Ile Arg Glu Thr Val
710 715 720
gtt gag cca ttt gag gag 2685
gag ttc taatcgggtt
tcc
acc
gag
gaa
gtg
Val Glu Pro Phe Glu Glu
Glu Phe
Ser
Thr
Glu
Glu
Val
725 730 735
tcggctgttgttgtataatagtggcaacactggtaattgattatgtatatatacaagtac2745
tacatccagcgtataatgttttcttttccgcagcagcgtctcgtcgcactcatgcgatct2805
ggctgcggccgccaccacgcagaccgcggaccgccttcggtgagatcattaccatacaat2865
ctagagaagcaataaataggtttttcgtttattcagctttggtacgcagctgcagcccat2925
gccagcgtttgatgtcgtccgcaagcacgcggttgacgagcttgtgctgctgcaccatgc2985
tcttgcccttgaagtgtgtgctccggatatcgatcgtgaacatcgaaccacaacccccgc3045
tcacatcagtgactttcacataccccggcgcaagcgcgtcggttagcttttgcgtaatga3105
gcgcctcttccggcgtgctagtataatagcgcgcgaagagacgggagtaagagcccacaa3165
gccgacctctagctaacatggggtcgtttgagcggcaaataatgaaacgggagcagcaga3225
tgaagtttaaatctgcgtgatctgcagatatacgtgtgtgcgcgtgagcagtcagcctga3285
gaacttttcggaacatcgcttttgccggcaacgtgggggaagccctacttgccttacaag3345
tcaactcatggcacaccggctacccttctgatgtttgcattcccagccaaga 3397
<210> 66
<211> 736
<212> PRT
<213> Ashbya gossypii
<220>
<221> misc feature
<223> Oligo 144
<400> 66
M/42319-PCT
CA 02458953 2004-02-27
0050/528'i 4
104
Met Ala Ala Val Phe Asp Asp Ile Arg Leu Glu Asp Ile Pro Val Asp
" 1 5 10 15
Asp Val Asp Met Gln Asp Leu Glu Glu Thr Tyr Ala Val Glu Arg Ser
20 25 30
Ile Glu Phe Asp Arg Tyr Val Val Val Asp Gly A1a Pro Val Ala Pro
35 40 45
Glu Ala Lys Val Gly Ala Leu Gln Lys Val Leu Thr Lys Leu Phe Ser
50 55 60
Gln Ala Gly Ser Val Val Asp Met Asp Val Pro Val Glu Glu Gly Arg
65 70 75 80
Thr Lys Gly His Leu Phe Ile Glu Phe Glu Asp Ala Gly Ala Ala Arg
85 90 95
Arg Ala Ile Lys Met Phe Asn Gly Lys Lys Leu Asp Val Lys His Arg
100 105 110
Leu Trp Val Asn Gly Leu Asp Asp Met Glu Arg Tyr Gly Arg Pro Asp
115 120 125
Phe Ser Thr Glu Tyr Arg Glu Pro Val Val Pro Glu Phe Glu Ala Thr
130 135 140
Glu Tyr Pro Arg Ser Trp Leu Gln Asp Glu Thr Gly Arg Asp Gln Phe
145 150 155 160
Val Leu Gln Lys Gly Glu Met Thr Ala Val Phe Trp Asn Arg Asn Asn
165 170 175
Leu Gln Pro Glu Asn Val Val Glu Pro Arg Arg Asn Trp Ser Asn Ser
180 185 190
Ile Leu Asn Phe Ser Pro His Gly Thr Tyr Leu Phe Ser Phe His Asp
195 200 205
Gln Gly Ile Ala Ser Trp Gly Gly Pro Gln Phe Lys Arg Leu Arg Arg
210 215 220
Phe Ala His Pro Asp Val Lys Ala Ile Ser Met Ser Ser Thr Glu Lys
225 230 235 240
Tyr Leu Val Thr Phe Ser Ser Glu Pro Leu Glu Val Ser Asp Glu Pro
245 250 255
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
105
Asn Glu Ala Cys Pro Phe Gly Pro Glu Ser Arg Gly His Gln Leu Cys
260 265 270
Ile Trp Asp Val Ala Thr Gly Val Cys Val Lys Thr Phe Ala Leu Pro
275 280 285
Pro Gln Gln Gln Leu Gln Trp Pro Met Val Lys Trp Ser Phe Asp Asp
290 295 300
Lys Phe Cys Ala Arg Leu Gly Pro Gly Ala Ile Ala Val Tyr Glu Thr
305 310 315 320
Glu Lys Asn Phe Gln Leu Leu Gly Gly Lys Val Met Lys Ile Glu Asp
325 330 335
Val Gln Asp Phe Ser Phe Ala Pro Lys Gly Ile Lys Leu Ala Ser Asn
340 345 350
Arg Pro Asn Asp Pro Pro Ser Thr Val Met Val Tyr Trp Thr Pro Glu
355 360 365
Ser Asn Asn Gln Ser Cys Lys Ala Val Leu Ile Glu Leu Pro Asn Arg
370 375 380
Arg Val Leu Arg Thr Ile Asn Leu Val Gln Val Thr Asp Val Ser Phe
385 390 39S 400
His Trp Gln Asn Gln Ala Glu Phe Leu Cys Val Gln Val Asp Arg His
405 410 415
Thr Lys Ser Arg Lys Thr Ile Phe Thr Asn Met Glu Ile Cys Ser Leu
420 425 430
Thr~Ala Arg Glu Phe Pro Phe Glu Lys Val Glu Ile Lys Asp Arg Cys
435 440 445
Met Arg Phe Ala Trp Glu Pro Asn Ser Asp Arg Phe Val Ile Ile Ser
450 455 460
Arg Ser Glu Asn Val Asn Asp Asn Pro Ala Ile Ala Lys Asn Val Val
465 470 475 480
Ser Phe Tyr Ala Pro Glu Lys Lys Val Asp Lys Lys Gly Val Ile Ile
485 490 495
Asp Lys Glu Leu Ser Ile Phe Lys Lys Trp Lys Leu Val Arg Ala Ile
500 505 510
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
106
Asp Gly Lys Phe Ser Asn Glu Ile Thr Trp Ser Pro Ala Gly Arg Phe
515 520 525
Val Cys Val Ala Ala IIe Gly Lys Ile Gly Ser Arg Asn Glu Asn Ile
530 535 540
Asp Phe Tyr Asp Met Asp Tyr Pro Asn Thr Glu Lys Ile Ile Asn Thr
545 550 555 560
Ala Thr Asp Val Asn Ala Thr Leu Arg Asp Val Ala His Ile Asn Tyr
565 570 575
Ala Ser Ala Thr Asp Tyr Glu Trp Asp Pro Ser Gly Arg Tyr Leu Ala
580 585 590
Phe Trp Ser Ser Ala Trp.Lys His Lys Ala Glu Asn Gly Tyr Lys Val
595 600 605
Phe Asn Leu Ala Gly Ala Ile Val Arg Glu Glu Leu Ile Thr Asp Phe
610 615 620
Asn Asn Phe Phe Trp Arg Pro Arg Pro Asp Ser Leu Leu Ser Asn Ser
625 630 635 640
Glu Lys Lys Lys Val Arg Lys Asn Leu Lys GIu Trp Ser AIa His Phe
645 650 655
Glu Glu GIn Asp Ala Met Glu Ala Asp Ser Ala Thr Arg Glu Leu Ile
660 665 670
Leu Lys Arg Arg Asn Trp Leu Asp Glu Trp Ser Lys Tyr Arg Glu Ala
675 680 685
Cys Lys Gln Thr Leu Ser Glu Ser Gly Leu Ser Ile Cys Asp Cys Val
690 695 700
Glu Leu Ser Thr Lys Asp Glu Asp Cys Glu Leu Val Glu Glu Ile Arg
705 710 715 ?20
Glu Thr VaI VaI GIu GIu Ser Thr GIu Glu Val Pro Phe Phe Glu Glu
725 730 735
<210> 67
<211> 1136
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
107
<212> DNA
<213> Ashbya gossypii
<220>
<221> misc_feature
<223> Oligo 168
<400> 67
gatcggaggg gtgaagtgctcgggttggctttcaggagaaacacggaccaactgtatgcg60
gcctgtgccg attataaaatacgtacgttcgcaattaaccaattttcgcagcctggaggt120
tctatatggt caccaagatatcwgtcgcagatatttcggccctgaatatggagcgctgcg180
ttacggtcgg gtccagggataggacctgtatgctgtggaagattgcagacgaaacacgct240
tgaccttcag aggcggtgacgatcctgaaaagctgctcagaagatggcagaaggcgaaca300
gtgaacagga aaacaaggatgcagacgacaatactccagcggagccgcccgtcttttacg360
gcgagggaag catagactgcatcaccatgctcgacgattcacacttcatctcgggctcgg420
acaatggaaa catatcgctttggtccctatccaagaaaaagccgctcttcgttcagcgag480
ttgcccatgg agtgcagccacagccagataataccaagatcagcggcgagcgggacccag540
ctgtgcgtac gcagcaggcccaaggcaaccgtctcgcgcagccgtactggataactgccc600
tgcacgccgt cccctacagcaatgtattcttcagtgggtcctggaacggaaccatgaagg660
tctggaagct gcacgaaaacatgcgctctttcgagccactcggcgaactggatggctgca?20
agggcctggt gacgaagatccagacggtggaggccggtaagagcggcagggaaacacttc780
gcgtcctcgc cagtgtcagcaaggagcaccggcttggtcggtggatgggcaagcttcccg840
gcgccagaaa cggactgttttccgcagtcatcgaccaggctggcttctgagcaccagtcg900
cctgaagaac actcgacacactgcagcttgcacacacaccgttccaacagtctctctgca960
agcgagctgc tatcggcattatgtttgtatggatacatagacagacatagaagcaataaa1020
aaaaggcgca ccatggcgctacgaactaatcgcaaaagggaagcctgctgggctccacat1080
gtctagagaa cttcggattttgcattcgctcgcacctttcgcgctcaacatagatc 1136
<210> 68
<211> 34
<212> PRT
<213> Ashbya gossypii
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
° 108
<220>
<221> misc_feature
<223> Oligo 168
<400> 68
Arg Gly Glu Val Leu Gly Leu Ala Phe Arg Arg Asn Thr Asp Gln Leu
1 5 10 15
Tyr Ala Ala Cys Ala Asp Tyr Lys Ile Arg Thr Phe Ala Ile Asn Gln
20 25 30
Phe Ser
<210> 69
<211> 239
<212> PRT
<213> Ashbya gossypii
<220>
<221> misc_feature
<223> Oligo 168
<400> 69
_ Sex VaI Ala Asp IIe Ser Ala Leu Asn Met Glu Arg Cys Val Thr Val
1 5 10 15
Gly Ser Arg Asp Arg Thr Cys Met Leu Trp Lys Ile Ala Asp Glu Thr
20 25 30
Arg Leu Thr Phe Arg Gly Gly Asp Asp Pro Glu Lys Leu Leu Arg Arg
35 40 45
Trp Gln Lys Ala Asn Ser Glu Gln Glu Asn Lys Asp Ala Asp Asp Asn
50 55 60
Thr Pro Ala Glu Pro Pro Val Phe Tyr Gly Glu Gly Ser Ile Asp Cys
65 70 75 80
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
109
- Ile Thr Met Leu Asp Asp Ser His Phe Ile Ser Gly Ser Asp Asn Gly
95 90 95
Asn Ile Ser Leu Trp Ser Leu Ser Lys Lys Lys Pro Leu Phe Val Gln
100 105 110
Arg Val Ala His Gly Val Gln Pro Gln Pro Asp Asn Thr Lys Ile Ser
115 120 125
Gly Glu Arg Asp Pro Ala Val Arg Thr Gln Gln Ala Gln Gly Asn Arg
130 135 140
Leu Ala Gln Pro Tyr Trp Ile Thr Ala Leu His Ala Val Pro Tyr Ser
145 150 155 160
Asn Val Phe Phe Ser Gly Ser Trp Asn Gly Thr Met Lys Val Trp Lys
165 170 175
Leu His Glu Asn Met Arg Ser Phe Glu Pro Leu Gly Glu Leu Asp Gly
180 185 190
Cys Lys Gly Leu Val Thr Lys Ile Gln Thr Val Glu Ala Gly Lys Ser
195 200 205
Gly Arg Glu Thr Leu Arg Val Leu Ala Ser Val Ser Lys Glu His Arg
210 215 220
Leu Gly Arg Trp Met Gly Lys Leu Pro Gly Ala Arg Asn Gly Leu
225 230 235
<210> 70
<211> 2681
<212> DNA
<213> Ashbya gossypii
<220>
<22I> CDS
<222> (660)..(2432)
<223>
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
° 110
<220>
c221> misc_feature
<223> Oligo 168
<400> 70
acagccagaagacattcatg tctggccact cggcctgaactatgacatgttaaattacat60
tctaatcaaaggcaagaatc tgtggcccgg cttccccttgccgctgccttcagaaatgga.120
aatcaggcttccacttctcg ataaaacgca ggtgctgaaaaacgacacatctcccgacga180
agaagtggtgatccctcccg cactagcagc agaagaggaattcctccgctctcaggtcct240
tgcaggactccttgcagata cactaaagta tgatggagagttttttgggaatgagaatga300
gatactggcgaacttgaatg gggttcgtga caaatcgttgctacgcctctttgcctccgc360
ttgttcagaccacaacaccg agaaggcgct atcactggtgaaggaattgaagcaagataa420
agcattgaatgccgctcaaa aaatagcaga acgcgctgaattattaagactggtaagcag480
catcaacgacatcagaaact ctcgtttcga gtcagaattgaacaacttatagcactgaac540
caacactgtaactagtcctg tcgcttagtt aatatagttttttttgaaggttcgcggaat600
cgtttctttttatatgaaaa ttttgaaggt cctttggaaggcgatgagaagaaacgccg 659
atg agg get tta tct cca ctg gtt aac tct ata gca 707
aag agt agg cat
Met Arg Ala Leu Ser Pro Leu Val Asn Ser Ile Ala
Lys Ser Arg His
1 5 10 15
cgc acc gca cgg ggt tcg gat agc cgc aag act agg 755
atg gcg tct aga
Arg Thr Ala Arg Gly Ser Asp Ser Arg Lys Thr Arg
Met Ala Ser Arg
20 25 30
cag aag acg gaa aag aat aat gtt gag gaa tcg ggt 803
act gtg gac att
Gln Lys Thr Glu Lys Asn Asn Val Glu GIu Ser Gly
Thr Val Asp Ile
35 40 45
gtg tca aac gag gaa gga tca tcg gaa caa tta gag 851
tct tca gat gaa
Val Ser Asn Glu Glu Gly Ser Ser Glu Gln Leu Glu
Ser Ser Asp Glu
50 55 60
gat gta gac get gag ttg gat tct gaa ttt aat gag 899
get gat gag gcg
Asp Val Asp Ala Glu Leu Asp Ser Glu Phe Asn Glu
Ala Asp Glu Ala
65 70 75 80
aac ccc gac aag cgg agg cga ctc caa tac gaa aat 947
get gcc aaa cta
Asn Pro Asp Lys Arg Arg Arg Leu Gln Tyr Glu Asn
Ala Ala Lys Leu
85 90 95
att aag gag get aat gaa att atg gat tct gca cat 995
gaa cat ggc gag
Ile Lys Glu Ala Asn Glu Ile Met Asp Ser Ala His
Glu His Gly Glu
100 105 110
gca gac gcc caa ggt caa ggt ttt gca tac aac ttt 1043
gat get gat aat
Ala Asp AIa GIn GIy GIn Gly Phe Ala Tyr Asn Phe
Asp Ala Asp Asn
115 120 125
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
° 111
., gac gcgcgcgacctg gatcgtgac attatctca gcaagattg caa 1091
aag
Asp AlaArgAspLeu AspArgAsp IleIleSer AlaArgLeu LysGIn
130 135 140
gac gttgetgagcaa aggggatct gtgtaccgc tggategcc gataag 1139
Asp ValA1aGluGln ArgGlySer ValTyrArg TrpIleAla AspLys
145 150 155 160
ctg ctactatctgag gccaagaag tccttcacc agggtcggg gagaag 1187
Leu LeuLeuSerGlu AlaLysLys SerPheThr ArgValGly GluLys
165 170 175
aac ctgactgcgctc agctgctat cagcaagca atgaataaa ttttca 1235
Asn LeuThrAlaLeu SerCysTyr GlnGlnAla MetAsnLys PheSer
180 185 190
cat agggaaatccaa agcaaaagc aagggacta atgtttgcc tatact 1283
His ArgGluIleGln SerLysSer LysGlyLeu MetPheAla TyrThr
195 200 205
gtc agtaaggacatg caactgacg aaatacgat atcaccgac ttcaat 1331
Val SerLysAspMet GlnLeuThr LysTyrAsp IleThrAsp PheAsn
210 215 220
get agaccgacgaag gtaaagtac actaaggga gggcgcaaa tacatc 1379
AIa ArgProThrLys ValLysTyr ThrLysGly GlyArgLys TyrIle
225 230 235 240
cca gagggtaaccag ggctttcag aacacgacg gagggacac tatgat 1427
Pro GluGlyAsnGln GlyPheGln AsnThrThr GluGlyHis TyrAsp
245 250 255
gag attctgacggtt gcagettct ccagatggt aagtaegtt gtcacg 1475
Glu IleLeuThrVal AlaAlaSer ProAspGly LysTyrVal ValThr
260 265 270
gga gggagagacaaa aagcttatc gtgtggagc actgagtcg ttggca 1523
' Gly GlyAr5AspLys LysLeuIle ValTrpSer ThrGluSer LeuAla
275 280 285
cca gttaaagttata ccaaccaaa gatcggagg ggtgaagtg ctcggg 1571
Pro ValLysValIle ProThrLys AspArgArg GlyGluVal LeuGly
290 295 300
ttg getttcaggaga aacacggac caactgtat gcggcctgt gccgat 1619
Leu AlaPheArgArg AsnThrAsp GlnLeuTyr AlaA1aCys AlaAsp
305 310 315 320
tat aaaatacgtacg ttcgcaatt aaccaattt tcgcagctg gaggtt 1667
Tyr LysIleArgThr PheAIaIIe AsnGlnPhe SerGlnLeu GluVal
325 330 33S
cta tatggtcaccaa gatatcgtc gcagatatt tcggccctg aatatg 1715
Leu TyrGlyHisGln AspIleVaI AlaAspIle SerAlaLeu AsnMet
340 345 350
gag cgctgcgttacg gtcgggtcc agggatagg acctgtatg ctgtgg 1763
Glu ArgCysValThr ValGlySer ArgAspArg ThrCysMet LeuTrp
355 360 365
aag attgcagacgaa acacgcttg accttcaga ggcggtgac gat 1811
cct
Lys IleAlaAspGlu ThrArgLeu ThrPheArg GlyGlyAsp AspPro
370 375 380
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
112
gaa aag ctg ctc aga aga tgg cag aag gcg aac agt gaa cag gaa aac 1859
Glu Lys Leu Leu Arg Arg Trp Gln Lys Ala Asn Ser Glu Gln Glu Asn
395 390 395 400
aag gat gca gac gac aat act cca gcg gag ccg ccc gtc ttt tac ggc 1907
Lys Asp Ala Asp Asp Asn Thr Pro Ala Glu Pro Pro Val Phe Tyr Gly
405 410 415
gag gga agc ata gac tgc atc acc atg ctc gac gat tca cac ttc atc 1955
Glu Gly Ser Ile Asp Cys Ile Thr Met Leu Asp Asp Ser His Phe Ile
420 425 430
tcg ggc tcg gac aat gga aac ata tcg ctt tgg tcc cta tcc aag aaa 2003
Ser Gly Ser Asp Asn Gly Asn Ile Ser Leu Trp Ser Leu Ser Lys Lys
435 440 445
aagccgctc ttcgttcag cgagttgcc catggagtg cagccacagcca 2051
LysProLeu PheValGln ArgValAla HisGlyVal GlnProGlnPro
450 455 460
gataatacc aagatcagc ggcgagcgg gacccaget gtgcgtacgcag 2099
AspAsnThr LysIleSer~Gly GluArg AspProAla ValArgThrGln
465 470 475 480
caggcccaa ggcaaccgt ctcgcgcag ccgtactgg ataactgccctg 2147
GlnAlaGln GlyAsnArg LeuAlaGln ProTyrTrp IleThrAlaLeu
485 490 495
cacgccgtc ccctacagc aatgtattc ttcagtggg tcctggaacgga 2195
HisAlaVal ProTyrSer AsnValPhe PheSerGly SerTrpAsnGly
500 505 510
acc atg aag gtc tgg aag ctg cac gaa aac atg cgc tct ttc gag cca 2243
Thr Met Lys Val Trp Lys Leu His Glu Asn Met Arg Ser Phe Glu Pro
515 520 525
ctc ggc gaa ctg gat ggc tgc aag ggc ctg gtg acg aag atc cag acg 2291
Leu Gly Glu Leu Asp Gly Cys Lys Gly Leu Val Thr Lys Ile Gln Thr
530 535 540
gtg gag gcc ggt aag agc ggc agg gaa aca ctt cgc gtc ctc gcc agt 2339
Val Glu Ala Gly Lys Ser Gly Arg Glu Thr Leu Arg Val Leu Ala Ser
545 550 555 560
gtc agc aag gag cac cgg ctt ggt cgg tgg atg ggc aag ctt ccc ggc 2387
Val Ser Lys Glu His Arg Leu Gly Arg Trp Met Gly Lys Leu Pro Gly
565 570 575
gcc aga aac gga ctg ttt tcc gca gtc atc gac cag get ggc ttc 2432
Ala Arg Asn Gly Leu Phe Ser Ala Val Ile Asp Gln Ala Gly Phe
580 585 590
tgagcaccagtcgcctgaagaacactcgacacactgcagcttgcacacacaccgttccaa2492
cagtctctctgcaagcgagctgctatcggcattatgtttgtatggatacatagacagaca2552
tagaagcaataaaaaaaggcgcaccatggcgctacgaactaatcgcaaaagggaagcctg2612
ctgggctccacatgtctagagaacttcggattttgcattcgctcgcacctttcgcgctca2672
acatagatc 2681
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
113
<210> 71
<211> 591
<212> PRT
<213> Ashbya gossypii
<220>
<221> misc_feature
<223> Oligo 168
<400> 71
Met Arg Lys Ala Leu Ser Pro Leu Val Ser Arg Asn Ser His Ile Ala
1 5 10 15
Arg Thr Met Ala Arg Gly Ser Asp Ser Ala Ser Arg Lys Arg Thr Arg
20 25 30
Gln Lys Thr Thr Glu Lys Asn Asn Val Val Asp Glu Glu Ile Ser Gly
35 40 45
Val Ser Ser Asn Glu Glu Gly Ser Ser Ser Asp Glu Gln Glu Leu Glu
50 55 60
Asp Val Ala Asp Ala Glu Leu Asp Ser Asp Glu Glu Phe Ala Asn Glu
65 70 75 80
Asn Pro Ala Asp Lys Arg Arg Arg Leu Ala Lys Gln Tyr Leu Glu Asn
85 90 95
Ile Lys Glu Glu Ala Asn GIu Ile Met His Gly Asp Ser GIu Ala His
100 105 110
Ala Asp Asp Ala Gln Gly Gln Gly Phe Ala Asp Ala Tyr Asn Asn Phe
115 120 125
Asp Ala Arg Asp Leu Asp Arg Asp Ile Ile Ser Ala Arg Leu Lys Gln
130 135 140
Asp Val Ala Glu Gln Arg Gly Ser Val Tyr Arg Trp Ile Ala Asp Lys
145 150 155 160
Leu Leu Leu Ser Glu Ala Lys Lys Ser Phe Thr Arg Val Gly Glu Lys
165 170 175
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
'' 114
Asn Leu Thr Ala Leu Ser Cys Tyr Gln Gln Ala Met Asn Lys Phe Ser
180 185 190
His Arg Glu Ile Gln Ser Lys Ser Lys Gly Leu Met Phe Ala Tyr Thr
195 200 205
Val Ser Lys Asp Met Gln Leu Thr Lys Tyr Asp Ile Thr Asp Phe Asn
210 215 220
Ala Arg Pro Thr Lys Val Lys Tyr Thr Lys Gly Gly Arg Lys Tyr Ile
225 230 235 240
Pro Glu Gly Asn Gln Gly Phe Gln Asn Thr Thr Glu Gly His Tyr Asp
245 250 255
Glu Ile Leu Thr Val Ala Ala Ser Pro Asp Gly Lys Tyr Val Val Thr
260 265 270
Gly Gly Arg Asp Lys Lys Leu Ile Val Trp Ser Thr Glu Ser Leu Ala
275 280 285
Pro Val Lys Val Ile Pro Thr Lys Asp Arg Arg Gly Glu Val Leu Gly
290 295 300
Leu Ala Phe Arg Arg Asn Thr Asp Gln Leu Tyr Ala Ala Cys Ala Asp
305 310 315 320
Tyr Lys Ile Arg Thr Phe Ala Ile Asn Gln Phe Ser Gln Leu Glu Val
325 330 335
Leu Tyr Gly His Gln Asp Ile Val Ala Asp Ile Ser Ala Leu Asn Met
340 345 350
Glu Arg Cys Val Thr Val Gly Ser Arg Asp Arg Thr Cys Met Leu Trp
355 360 365
Lys Ile Ala Asp Glu Thr Arg Leu Thr Phe Arg Gly Gly Asp Asp Pro
370 375 380
Glu Lys Leu Leu Arg Arg Trp Gln Lys Ala Asn Ser Glu Gln Glu Asn
385 390 395 400
Lys Asp Ala Asp Asp Asn Thr Pro Ala Glu Pro Pro Val Phe Tyr Gly
405 410 415
Glu Gly Ser Ile Asp Cys Ile Thr Met Leu Asp Asp Ser His Phe Ile
420 425 430
M/42319-PCT
CA 02458953 2004-02-27
0050152814
115
Ser Gly Ser Asp Asn Gly Asn Ile Ser Leu Trp Ser Leu Ser Lys Lys
435 440 445
Lys Pro Leu Phe VaI GIn Arg Vai Ala His Gly Val Gln Pro Gln Pro
450 455 460
Asp Asn Thr Lys Ile Ser Gly Glu Arg Asp Pro Ala Val Arg Thr Gln
465 470 475 480
Gln Ala Gln Gly Asn Arg Leu Ala Gln Pro Tyr Trp Ile Thr Ala Leu
485 490 495
His Ala VaI Pro Tyr Ser Asn Val Phe Phe Ser Gly Ser Trp Asn Gly
500 505 510
Thr Met Lys Val Trp Lys Leu His Glu Asn Met Arg Ser Phe Glu Pro
515 520 525
Leu Gly Glu Leu Asp Gly Cys Lys Gly Leu Val Thr Lys Tle Gln Thr
530 535 540
Val Glu Ala Gly Lys Ser Gly Arg Glu Thr Leu Arg Val Leu Ala Ser
545 550 555 560
Val Ser Lys Glu His Arg Leu Gly Arg Trp Met Gly Lys Leu Pro Gly
565 570 575
Ala Arg Asn Gly Leu Phe Ser Ala Val Ile Asp Gln Ala Gly Phe
580 585 590
<210> 72
<211> 510
<212> DNA
<213> Ashbya gossypii
<220>
<221> misc_feature
<223> Oligo 160
<400> 72
gatctgcgtg ggcctcgctg ggcgggcggc gggcttcaac aacatgtggg ccggggtaga 60
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
116
gagcaaagtcggttagaggatataaacgtaggtaggggcagcagcctcargcaggcctcc 120
gaggccttggatctcttggctagccttggcctgggccttggggcccatgacaccagccac 180
cccagtgctttctggattcgtcgtacttctcgatgaagttggcgttgacggcggagacga 240
gcttggcaagggcagcctcgtcctcggcgcggacctcggtgagggcggcgacggcggagg 300
tcttctggttgaccagggtgcctaggcgggccttgcccttgacgatggcgtatgggacgc 360
ccatcttcttgcacagcgcaggcaggaagatgacaagctcgatggggtcgacgtcgttgg 420
cgatgagcacgagcttggccttcttgttctcgacgagggagacgacgtggttcaagccga 480
acttgacggcgtatggcttaagcgaagcct 510
<210> 73
<211> 111
<212> PRT
<213> Ashbya gossypii
<220>
<221> misc feature
<223> Oligo 160
<400> 73
Ala Ser Leu Lys Pro Tyr Ala Val Lys Phe Gly Leu Asn His Val Val
1 5 10 15
Ser Leu Val Glu Asn Lys Lys Ala Lys Leu Val Leu Ile Ala Asn Asp
20 25 30
Val Asp Pro Ile Glu Leu Val Ile Phe Leu Pro Ala Leu Cys Lys Lys
35 40 45
Met Gly Val Pro Tyr Ala Ile Val Lys Gly Lys Ala Arg Leu Gly Thr
50 55 60
Leu Val Asn Gln Lys Thr Ser Ala Val Ala Ala Leu Thr Glu Val Arg
65 70 75 80
Ala Glu Asp Glu Ala Ala Leu Ala Lys Leu Val Ser Ala Val Asn Ala
85 90 95
Asn Phe Ile Glu Lys Tyr Asp Glu Ser Arg Lys His Trp Gly G1y
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
117
," 100 105 110
<210> 74
<211> 1437
<212> DNA
<213> Ashbya gossypii
<220>
<221> misc_feature
<223> Oligo 18
<400>
74
gatcagtgaattttcatcattatggccaaaactgcgtctggggctttaatcgaagtcatc60
ttcatcataatcatcaccataagcccgatattgcaagtccctgtcaacgccaccatagct120
gcgctcatacagcagatcctcagcgccgagatcaagccttgctcatctgagtgagatagt180
tgaattcagattcctcatcattgttgcgcctagtttcaattttccgggcctgctcgcgac240
tctgctcataattaggcacgcgcctacgagtctgacccccattgccaccaaagtcgcgcc300
tacgctgacccgagccgtactcgtcgcggccactgcgtctgcgttcttgccccgatccac360
caaagtcgcgcctacgctgaccccagccgtactcgtcgcggccactgcgtctgcgttctt420
gccccgatccaccaaagtcgtgctgacgttcttgcccctaactgggattgccaccatcat480
aaggctttggctctgcaccctctatttcctcttgcaaagccggctccaaagcaaggatag540
agcttgcacctgttaacaaacaaataatactggataattttatcttgctgatggttatta600
ggctattcaatgtagaaacctattccacaaataacatagagtgcttttatatgccacatt660
tcatatccttccgcaagcttgatggcaaaatgctgagtcataataaggatagagtaaagt720
ggcccatctgatacactcttaatgacttcgcatttttagtaactttgcccaggcatatca780
tatattctaccccttcataaaagttatgtaacgaataatttgaaggagcctattatttcc840
tggaagagtataaccgtctttttattccaagtatccaaaacatcactataggaacatata900
ctaaaaagtgggaacgttccgatattcacataactactgttgttttagatcaaaaaattg960
tctattttattggcgttggatggatcctttgtatcacgaaatacgcaaatgttggaattt1020
ttaactttggaatacctattgaagcaacatatgtcattttacaaggagcatcactttaca1080
ggcaccgagaaagaaagaaattgacaaaaaagaagggataagtgaaggcagttgcacagg1140
caccgaccaagacagtgatttacaatagttacaggtcaataataagaaagacaactatgt1200
ggcattatgcagtacgctctaagggcgcagttccgatgaCtgtttcacccagctacacca1260
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
118
gtagctcgca ctgccattta tttacagtgc ttgtgtcaca gacccaaaat ggataagtgt 1320
gagagcgact gtcgcttctg tatagctcaa cgccaatgtg tgtctgcact gggacaacac 1380
cggatttagt acattgacac caacyttcgc cgcctgctga cagatgcagc wccgatc 1437
<210>75
<211>1437
<212>DNA
<213>Ashbya gossypii
<220>
<221> CDS
<222> (958)..(1272)
<223>
<220>
<221> misc_feature
<223> Oligo 18
<400>
75
gatcggwgctgcatctgtcagcaggcggcgaargttggtgtcaatgtactaaatccggtg60
ttgtcccagtgcagacacacattggcgttgagctatacagaagcgacagtcgctctcaca120
cttatccattttgggtctgtgacacaagcactgtaaataaatggcagtgcgagctactgg180
tgtagctgggtgaaacaatcatcggaactgcgcccttagagcgtactgcataatgccaca240
tagttgtctttcttattattgacctgtaactattgtaaatcactgtcttggtcggtgcct300
gtgcaactgccttcacttatcccttcttttttgtcaatttctttctttctcggtgcctgt360
aaagtgatgctccttgtaaaatgacatatgttgcttcaataggtattccaaagttaaaaa420
ttccaacatttgcgtatttcgtgatacaaaggatccatccaacgccaataaaatagacaa480
ttttttgatctaaaacaacagtagttatgtgaatatcggaacgttcccactttttagtat540
atgttcctatagtgatgttttggatacttggaataaaaagacggttatactcttccagga600
aataataggctccttcaaattattcgttacataacttttatgaaggggtagaatatatga660
tatgcctgggcaaagttactaaaaatgcgaagtcattaagagtgtatcagatgggccact720
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
' 119
ttactctatc cttattatgactcagcattttgccatcaagcttgcggaaggatatgaaat780
gtggcatata aaagcactctatgttatttgtggaataggtttctacattgaatagcctaa840
taaccatcag caagataaaattatccagtattatttgtttgttaacaggtgcaagctcta900
tccttgcttt ggagccggctttgcaagaggaaatagagggtgcagagccaaagcctt 95?
atg atg gca atc ggc aag gtc agc act ttg 1005
gtg cca gtt aac acg
agg
Met Met Ala Ile Gly Lys Val Ser Thr Leu
Val Pro Val Asn Thr
Arg
1 5 10 15
gtg gat cgg ggc aag aac gca gac gca gtg gcc gcg acg agt acg get 1053
Val Asp Arg Gly Lys Asn Ala Asp Ala Val Ala Ala Thr Ser Thr Ala
20 25 30
ggg gtc agc gta ggc gcg act ttg gtg gat cgg ggc aag aac gca gac 1101
Gly Val Ser Val G1y Ala Thr Leu Val Asp Arg Gly Lys Asn Ala Asp
35 40 45
gca gtg gcc gcg acg agt acg get cgg gtc agc gta ggc gcg act ttg 1149
Ala Val Ala Ala Thr Ser Thr Ala Arg Val Ser Val Gly Ala Thr Leu
50 55 60
gtg gca atg ggg gtc aga ctc gta ggc gcg tgc cta att atg agc aga 1197
Val Ala Met Gly Val Arg Leu Val Gly Ala Cys Leu Ile Met Ser Arg
65 70 75 80
gtc gcg agc agg ccc gga aaa ttg aaa cta ggc gca aca atg atg agg 1245
Val Ala Ser Arg Pro Gly Lys Leu Lys Leu Gly Ala Thr Met Met Arg
85 90 95
aat ctg aat tca act atc tca ctc aga tgagcaaggc ttgatctcgg 1292
Asn Leu Asn Ser Thr Ile Ser Leu Arg
100 105
cgctgaggatctgctgtatgagcgcagcta tggtggcgtt gacagggact tgcaatatcg1352
ggcttatggtgatgattatgatgaagatga cttcgattaa agccccagac gcagttttgg1412
ccataatgatgaaaattcactgatc 1437
<210> 76
<21I> 105
<212> PRT
<213> Ashbya gossypii
<220>
<221> mist feature
<223> Oligo 18
<400> 76
Met Met Val Ala Ile Pro Val Arg Gly Lys Asn Val Ser Thr Thr Leu
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
120
1 5 20 15
Val Asp Arg Gly Lys Asn Ala Asp Ala Val Ala Ala Thr Ser Thr Ala
20 25 30
Gly Val Ser Val Gly Ala Thr Leu Val Asp Arg Gly Lys Asn Ala Asp
35 40 45
Ala Val Ala Ala Thr Ser Thr Ala Arg Val Ser Val Gly Ala Thr Leu
50 55 60
Val Ala Met Gly Val Arg Leu Val Gly Ala Cys Leu Ile Met Ser Arg
65 70 75 80
Val Ala Ser Arg Pro Gly Lys Leu Lys Leu Gly Ala Thr Met Met Arg
85 90 95
Asn Leu Asn Ser Thr Ile Ser Leu Arg
100 105
<210> 77
<211> 2602
<212> DNA
<213> Ashbya gossypii
<220>
<221> CDS
<222> (1531)..(1845?
<223>
<220>
<221> misc_feature
<223> Oligo 18
<400> 77
tcagcggtgt ggtgtatggg tctctcagcg gtgtggtgta tgggtctctc agcggtgtgg 60
tgtatgggtc tctcagcggt gtggtgtatg gtctctcagc ggtgtggtgt atgggtctct 120
cagcggtgtg gtgtatgggt ctctcagcgg tgtggtgtat gggtctctca gcggtgtggt 180
gtatgggtct ctcagcggtg tggtgtatgg gtctctcagc ggtgtggtgt atcagagggt 240
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
' 121
tttaaacctaaatctgacgccttaaccactcggccaaactctcttatatgcttttatatg300
aaaggcgtgcaatacgtacgagcaggttggccacgtgaactggctgcccagggtcagagc360
tgtatccgcgagtatcccaaaacccgtacagtacgaaatacccacaccagtttcgcggta420
atgtcagttagcactcgccacggtgatgactgaactcgcggctggcacgatcaacaacgt480
agggcccgagccttcagcagaggaggatcgtattattcatataaaatgctcacacaagca540
aacatggaggccaggaagggcaccgtggtcggtgatcggtgctgcatctgtcagcaggcgb00
gcgaaggttggtgtcaatgtactaaatccggtgttgtcccagtgcagacacacattggcg660
ttgagctatacagaagcgacagtcgctctcacacttatccattttgggtctgtgacacaa720
gcactgtaaataaatggcagtgcgagctactggtgtagctgggtgaaacaatcatcggaa780
ctgcgcccttagagcgtactgcataatgccacatagttgtctttcttattattgacctgt840
aactattgtaaatcactgtcttggtcggtgcctgtgcaactgccttcacttatcccttct900
tttttgtcaatttctttctttctcggtgcctgtaaagtgatgctccttgtaaaatgacat960
atgttgcttcaataggtattccaaagttaaaaattccaacatttgcgtatttcgtgatac1020
aaaggatccatccaacgccaataaaatagacaattttttgatctaaaacaacagtagtta1080
tgtgaatatcggaacgttcccactttttagtatatgttcctatagtgatgttttggatac1140
ttggaataaaaagacggttatactcttccaggaaataataggctccttcaaattattcgt1200
tacataacttttatgaaggggtagaatatatgatatgcctgggcaaagttactaaaaatg1260
cgaagtcattaagagtgtatcagatgggccactttactctatccttattatgactcagca1320
ttttgccatcaagcttgcggaaggatatgaaatgtggcatataaaagcactctatgttat1380
ttgtggaataggtttctacattgaatagcctaataaccatcagcaagataaaattatcca1440
gtattatttgtttgttaacaggtgcaagctctatccttgctttggagccggctttgcaag1500
aggaaatagagggtgcagagccaaagccttatg atg a gtt 1554
gtg gca agg
atc cc
Met Met o Val
Val Ala Arg
Ile Pr
1 5
ggc aag gtc agc g act ggc aag gca gac 1602
aac ac ttg gtg aac
gat cgg
GIy Lys Val Ser r Thr Gly Lys Ala Asp
Asn Th Leu Val Asn
Asp Arg
15 20
gca gtg gcg acg t acg gta ggc act ttg 1650
gcc ag get ggg gcg
gtc agc
Ala Val Ala Thr r Thr Val Gly Thr Leu
Ala Se Ala Gly Ala
Val Ser
25 30 35 40
gtg gat ggc aag c gca gcg acg acg get 1698
cgg aa gac gca agt
gtg gcc
Val Asp GIy Lys n Ala Ala Thr Thr Ala
Arg As Asp Ala Ser
Val Ala
45 50 55
cgg gtc gta ggc g act ggg gtc ctc gta 1746
agc gc ttg gtg aga
gca atg
Arg Val Val Gly a Thr Gly Val Leu Va1
Sex Al Leu Val Arg
Ala Met
60 65 70
M/42319-PCT
CA 02458953 2004-02-27
0050/52814
122
ggc gcg tgc cta att atg agc aga gtc gcg agc agg ccc gga aaa ttg 1794
Gly Ala Cys Leu Ile Met Ser Arg Val Ala Ser Arg Pro Gly Lys Leu
75 80 85
aaa cta ggc gca aca atg atg agg aat ctg aat tca act atc tca ctc 1842
Lys Leu Gly Ala Thr Met blet Arg Asn Leu Asn Ser Thr Ile Ser Leu
90 95 100
aga tgagcaaggc ttgatctcgg cgctgaggat ctgctgtatg agcgcagcta 1895
Arg
105
tggtggcgttgacagggacttgcaatatcgggcttatggtgatgattatgatgaagatga1955
cttcgattaaagccccagacgcagttttggccataatgatgaaaattcactgatcagact2015
ataaagttgctttggaaaataagtcatattggcgatggactcgtggcaagacacttagat2075
acttgaatttcttcagtattaaatgacatgacaactatccacagtgaattctgaaaaata2135
aacataaaaacaataatcttatgacccattttcatgtaaactgaatatagacgatagcaa2195
tacattttctctatattttgtactctggaagcttctgcgagtgactaccatttgatggcc2255
acgtttacctccttcgtcagcaggtatccaggtacttaaattaatcacttcacagcacta2315
aatgtggcttttattcggttttattccaagaatacggatctctgagacacttgagccccc2375
tagtttagttacaacagtagcttccgaaagctacgaataatagttatagattttctgctc2435
tcacgtgattcgcttacataaataacccgataaaaccatgagaaatatgtccatgtagct2495
gtgtgacgtatatatgggataaggctgggtaggcctctagccatctatttgcccgctgtc2555
ttttggtacaatagcccaacgaaaatccgagcgtacctctacgtgtg 2602
<210> 78
<211> 105
<212> PRT
<213> Ashbya gossypii
<220>
<221> misc_feature
<223> Oligo 18
<400> 78
Met Met Val Ala Ile Pro Val Arg Gly Lys Asn Val Ser Thr Thr Leu
1 5 10 15
Val Asp Arg Gly Lys Asn Ala Asp Ala Val AIa Ala Thr Ser Thr Ala
20 25 30
M/42319-PCT
0050/52814
CA 02458953 2004-02-27
123
Gly Val Ser Val Gly Ala Thr Leu Val Asp Arg Gly Lys Asn Ala Asp
35 40 45
Ala Val Ala Ala Thr Ser Thr Ala Arg Val Ser Val Gly AIa Thr Leu
50 55 60
Val Ala Met Gly VaI Arg Leu Val Gly Ala Cys Leu Ile Met Ser Arg
65 70 75 80
Val Ala Ser Arg Pro Gly Lys Leu Lys Leu Gly Ala Thr Met Met Arg
85 90 95
Asn Leu Asn Ser Thr Ile Ser Leu Arg
100 105
M/42319-PCT
