Note: Descriptions are shown in the official language in which they were submitted.
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
MULTIFUNCTIONAL MONOCLONAL ANTIBODIES DIRECTED TO
PEPTIDOGLYCAN OF GRAM-POSITIVE BACTERIA
CROSS REFERENCE TO RELATED APPLICATIONS
[001] This application is based on and claims the benefit of U.S.
Provisional Application S.N. 60/343,444, filed December 21, 2001 (Attorney
Docket No. 07787.6004). The entire disclosure of this provisional application
is relied upon and incorporated by reference herein. This application relates
to U.S. Patent Application Serial No. 09/097,055, filed June 15, 1998, which
is
specifically incorporated herein by reference, and to U.S. Patent Application
Serial Nos. 60/341,806, and the application entitled, Methods for Blocking or
Alleviating Staphylococcal Nasal Colonization by Intranasal Application of
Monoclonal Antibodies, filed herewith, and previously, on December 21, 2001,
and to U.S. Patent Nos. 5,571,511 and 5,955,074, which are all specifically
incorporated herein by reference.
DESCRIPTION OF THE INVENTION
Field of the Invention
[002] This invention in the fields of immunology and infectious
diseases relates to protective antibodies that are specific for Gram-positive
bacteria, particularly to bacteria bearing exposed peptidoglycan on the
surface. The invention includes monoclonal antibodies, as well as fragments,
regions and derivatives thereof.
Introduction
[003] Man has long battled infections caused by, bacteria, particularly
Gram-positive bacteria. The surface structures and cell wall of Gram-positive
bacteria form a complex matrix that performs functions essential in bacteria
and host interactions. The cell wall consists of a peptidoglycan
macromolecule (repeating units of N-acetylglucosamine and N-acetylmuramic
acid) and attached accessory molecules including teichoic acids, lipoteichoic
acids, and carbohydrates (see, e.g., (9) and (24)). In addition, there are
many
surface proteins anchored to the bacterial cell wall (see, e.g., (17)).
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
2
[004] To protect itself against such bacteria, the body employs a
variety of means. Mechanical barriers, such as the skin and mucous
membranes, are the body's first line of defense. If a pathogen is able to
circumvent these barriers and begin multiplying, then white blood cells called
polymorphonuclear leukocytes, or PMNs, are the next mechanism that the
body uses to respond to an infection. Finally, acquired immune mechanisms
step in, wherein circulating antibodies and complement (soluble plasma
proteins that can bind foreign targets non-specifically) bind to the invading
pathogen and attract phagocytic cells, which in turn engulf and digest the
pathogen. This latter mechanism is called phagocytosis, and the antibodies
and complement that bind to the pathogen and promote phagocytosis are
called opsonins. The enhancement of phagocytosis by opsonins is in turn
called opsonization. Opsonization may rely on a combination of antibodies
and complement (the "classical pathway"), or just on complement (the
"alternative pathway"). The systems for opsonization and phagocytosis are
significant because defective phagocytosis and killing of staphylococci (and
other Gram-positive bacteria) leads to host invasion, infection and
occasionally death.
[005] Because of the prevalence of these bacteria on the skin and
other surfaces, most mammals are exposed to Gram-positive bacteria. Thus,
the polyclonal serum from any mammal, including humans, is likely to contain
IgG that will bind to many different cell wall and surface components of Gram-
positive bacteria. Such a collection of IgGs may serve to protect against
Gram-positive bacteria because polyclonal IgG binding to many epitopes on
surface antigens or cell wall molecules (such as peptidoglycan, teichoic acid,
lipoteichoic acid, proteins and carbohydrates) may collectively be opsonic and
promote phagocytosis of Gram-positive bacteria. Thus, the composite
function of the antibodies in polyclonal serum may account for the serum's
functional activity. However, such polyclonal IgG is clearly not always
protective, as evidenced by the continued presence of infections due to such
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
3
bacteria. To augment the level of antibodies against Gram-positive bacteria,
clinicians administer vaccines based on these bacteria. However, many
bacterial cell extracts that are used for immunization are not pure for one
epitope or antigen, so the activity of the resulting antibodies may represent
activities against several different cell wall components. This is
particularly
problematic if the cell wall is the antibody target, and the purity of the
cell wall
preparation cannot be verified.
[006] Moreover, although perhaps protective in some individuals,
polyclonal serum cannot be used to elucidate the functional role of an
antibody to a single epitope because, by definition, a polyclonal serum
contains many different antibodies, which bind to multiple antigens and
epitopes. Each antibody may contribute to the composite functional activity.
Consequently, the ability of antibodies directed against specific epitopes on
the cell wall to act as opsonic factors for Gram-positive bacteria is not
defined.
[007] In addition, it is likely that some antibodies to an epitope will
promote phagocytosis, while others will have different functions, such as
blocking adherence of the bacteria to a cell. Thus, only monoclonal
antibodies to specific epitopes can elucidate the potential functions of
specific
antibodies, such as enhancing phagocytosis, blocking bacterial adherence, or
neutralizing toxic activities, and thereby form the basis of predictably
protective treatments.
[008] Moreover, until recently, determining the role of peptidoglycan or
of antibodies to peptidoglycan was complicated by the impurity of
peptidoglycan preparations. Teichoic acids and lipoteichoic acids are closely
associated with cell wall peptidoglycan. In addition, for some bacteria, such
as S. epidermidis, teichoic acid and lipoteichoic acid have the same glycerol
phosphate backbone. These teichoic acid moieties can easily contaminate
peptidoglycan preparations, which are prepared from cell wall extracts. Thus,
the activity of serum raised against these preparations may not result from
the
activity of antibodies to peptidoglycan, but instead from the activity of
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
4
antibodies to contaminates (see, e.g., (36)). Recently, we have developed
monoclonal antibodies to LTA that have multiple functional activities,
including
opsonic activity, against Gram-positive bacteria. These antibodies can be
used to confirm that peptidoglycan preparations are free of LTA
contamination.
[009] Furthermore, since peptidoglycan is ubiquitous in the bacterial
world, highly specific opsonic or protective antibodies to peptidoglycan seem
unlikely. In addition, the question about the role of protective antibody
remained. Peterson and colleagues showed that normal human serum
opsonized cell wall extracts and peptidoglycan (20). However, there were
clearly many different antibodies to many different epitopes in the serum. At
least three different antigenic sites have been distinguished on the
peptidoglycan matrix. When Peterson and colleagues cleaved the
peptidoglycan into small, soluble fragments with lysostaphin, the fragments
were no longer opsonized in the presence of normal human serum. One
explanation is that the smaller fragments could not support binding of a
sufficient number of different antibodies, and that antibodies to a single
epitope on peptidoglycan are not opsonic. Consequently, while peptidoglycan
can activate the alternative pathway, which promotes opsonization and
phagocytosis of S. aureus by complement alone, the role of antibodies and
the classical pathway in opsonization and phagocytosis remained difficult to
understand.
[010] The role of antibodies in these processes was further in doubt
when IgG deficient serum was found to be fully opsonic in studies by the
same group. This result was consistent with studies by others that showed a
normal level of killing by PMNs using serum that had been depleted of
antibodies, and after blocking neutrophil IgG Fc receptors. An additional
complication lies in the fact that many cell wall epitopes are deep under the
surface and may be covered by proteins and capsular polysaccharide in live
growing bacteria (18, 19).
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
[011 ] Thus it was not known whether or not a monoclonal antibody to
peptidoglycan that binds to a specific epitope could have functional activity
without working in concert with other antibodies having other antigen or
epitope specificities. It was also not known if an antibody with a single
specificity could perform several functions important for host immunity and
protection. Such monoclonal antibodies would be useful to prevent or treat
Gram-positive infections, and the epitopes or antigens to which they bind
would be useful as vaccines to induce protective immunity in a host.
SUMMARY OF THE INVENTION
[012] This invention relates to therapeutic compositions comprising
protective monoclonal antibodies (MAbs) to peptidoglycan (PepG) that
enhance phagocytosis, block colonization and/or inhibit PepG induced- or
facilitated-toxicity. As noted above, phagocytosis is important for effective
immunity against Gram-positive bacteria. This invention provides protective
opsonic MAbs to PepG that enhance phagocytosis and killing of Gram-
positive bacteria and thus can block or treat systemic infections. Nasal
colonization has been shown to be a primary reservoir for staphylococci, and
a strong correlation has been demonstrated between staphylococcal nasal
colonization and subsequent staphylococcal infections. This invention
provides protective anti-PepG MAbs that block and/or alleviate nasal
colonization by Gram-positive bacteria, such as staphylococci, and thereby
reduce the incidence and/or severity of associated infections. Given
intravenously, subcutaneously, intramuscularly, or through any other route of
administration, protective anti-PepG MAbs may reduce the toxic effects of cell
wall components. Thus, these therapeutic compositions both prevent and
treat infections by Gram-positive bacteria.
[013] The protective monoclonal antibodies of the invention include
both IgG and IgM anti-PepG MAbs specific for PepG and include mouse,
mouse/human chimeric, humanized or fully human MAbs specific for PepG.
The protective monoclonal antibodies of this invention are directed to any of
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
6
the multiple epitopes on PepG. They exhibit multiple binding characteristics
and functional activities.
[014] These protective monoclonal antibodies can be administered
singly or in combination into the nares of normal or colonized human subjects
or other mammals to block or alleviate bacterial colonization of the nasal
mucosa and to thereby preclude systemic infections or reduce the spread of
Gram-positive bacteria.
[015] The invention also includes methods of using both single
protective anti-PepG MAbs and combinations of MAbs to enhance
phagocytosis, inhibit bacterial infection, which may result from colonization
of
the nasal mucosa and reduce toxic effects of PepG and other cell wall
components or toxins.
[016] In addition, PepG epitopes or antigens and peptides that mimic
those epitopes and antigens would be useful as vaccines to elicit opsonic
antibodies to Gram-positive bacteria.
BRIEF DESCRIPTION OF THE DRAWINGS
[017] Figure 1 shows the cDNA cloning strategy for the heavy chain
and light chain variable regions of M130.
[018] Figure 2 shows the polypeptide and nucleic acid sequences of
(A) the M130 antibody light chain variable region (SEQ ID NO: 1 and SEQ ID
NO: 2) and (B) the M130 antibody heavy chain variable region (SEQ ID NO: 3
and SEQ ID NO: 4).
[019] Figure 3 is shows the pJSB22 heavy chain expression
plasmid.
[020] Figure 4 shows the pJSB6 light chain expression
plasmid.
[021] Figure 5 shows the pLG1 bi-cistronic expression
plasmid.
[022] Figure 6 shows the binding of anti-human IgG
to the
mouse/human
chimeric
antibody
A130.
[023] Figure 7 shows the binding activity of the mouse/human
chimeric body, A130, to S. aureus peptidoglycan.
anti
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
7
DETAILED DESCRIPTION OF THE INVENTION
Definitions
[024] The term "antibody", as used herein, includes full-length
antibodies and portions thereof. A full-length antibody has one pair or, more
commonly, two pairs of polypeptide chains, each pair comprising a light and a
heavy chain. Each heavy or light chain is divided into two regions, the
variable region (which confers antigen recognition and binding) and the
constant region (associated with localization and cellular interactions).
Thus,
a full-length antibody commonly contains two heavy chain constant regions
(HC or CH), two heavy chain variable regions (HV or VH), two light chain
constant regions (LC or CL), and two light chain variable regions (LV or VL)
(Figure 2). The light chains or chain may be either a lambda or a kappa
chain. Thus, in an embodiment of the invention, the antibodies include at
least one heavy chain variable region and one light chain variable region,
such that the antibody binds antigen.
[025] Another aspect of the invention involves the variable region that
comprises alternating complementarity determining regions, or CDRs, and
framework regions, or FRs. The CDRs are the sequences within the variable
region that generally confer antigen specificity.
[026] The invention also encompasses portions of antibodies which
comprise sufficient variable region sequence to confer antigen binding.
Portions of antibodies include, but are not limited to Fab, Fab', F(ab')2, Fv,
SFv, scFv (single-chain Fv), whether produced by proteolytic cleavage of
intact antibodies, such as papain or pepsin cleavage, or by recombinant
methods, in which the cDNAs for the intact heavy and light chains are
manipulated to produce fragments of the heavy and light chains, either
separately, or as part of the same polypeptide.
[027] MAbs of the present invention encompass antibody sequence
corresponding to human and non-human animal antibodies, and hybrids
thereof. The term "chimeric antibody," as used herein, includes antibodies
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
8
that have variable regions derived from an animal antibody, such as rat or
mouse antibody, fused to another molecule, for example, a constant region
domain derived from a human IgG, IgA, or IgM antibody.
[028] One type of chimeric antibody, a "Humanized antibody" has the
variable regions altered (through mutagenesis or CDR grafting) to match (as
much as possible) the known sequence of human variable regions. CDR
grafting involves grafting the CDRs from an antibody with desired specificity
onto the FRs of a human antibody, thereby replacing much of the non-human
sequence with human sequence. Humanized antibodies, therefore, more
closely match (in amino acid sequence) the sequence of known human
antibodies. By humanizing mouse monoclonal antibodies, the severity of the
human anti-mouse antibody, or HAMA, response is diminished. The invention
also includes fully human antibodies which would avoid the HAMA respose as
much as possible.
[029] The invention also encompasses "modified antibodies", which
include, for example, the proteins or peptides encoded by truncated or
modified antibody-encoding genes. Such proteins or peptides may function
similarly to the antibodies of the invention. Other modifications, such as the
addition of other sequences that may enhance an effector function, which
includes the ability to block or alleviate nasal colonization by
staphylococci,
are also within the present invention. Such modifications include, for
example, the addition of amino acids to the antibody's amino acid sequence,
deletion of amino acids in the antibody's amino acid sequence, substitution of
one or more amino acids in the antibody amino acid sequence with alternate
amino acids, isotype switching, and class switching.
[030] In certain embodiments, an antibody may be modified in its Fc
region to prevent binding to bacterial proteins. The Fc region normally
provides binding sites for accessory cells of the immune system. As the
antibodies bind to bacteria, and coat them, these accessory cells recognize
the coated bacteria and respond to infection. When a bacterial protein binds
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
9
to the Fc region near the places where accessory cells bind, the normal
function of these cells is inhibited. For example, Protein A, a bacterial
protein
found in the cell membrane of S. aureus, binds to the Fc region of IgG near
accessory cell binding sites. In doing so, Protein A inhibits the function of
these accessory cells, thus interfering with clearance of the bacterium. To
circumvent this interference with the antibacterial immune response, the Fc
portion of the antibody of the invention may be modified to prevent
nonspecific
binding of Protein A while retaining binding to accessory cells (see, e.g.,
(10)).
[031 ] In light of these various forms, the antibodies of the invention
include full-length antibodies, antibody portions, chimeric antibodies,
humanized antibodies, fully human antibodies, and modified antibodies and
will be referred to collectively as "MAbs" unless otherwise indicated.
[032] The term "epitope", as used herein, refers to a region, or
regions, of PepG that is bound by an antibody to PepG. The regions that are
bound may or may not represent a contiguous portion of the molecule.
[033] The term "antigen", as used herein, refers to a polypeptide
sequence, a non-proteinaceous molecule, or any molecule that can be
recognized by the immune system. An antigen may be a full-sized
staphylococcal protein or molecule, or a fragment thereof, wherein the
fragment is either produced from a recombinant cDNA encoding less than the
full-length protein, or a fragment derived from the full-sized molecule or
protein or a fragment thereof. Such fragments may be made by proteolysis.
An antigen may also be a polypeptide sequence that encompasses an
epitope of a staphylococcal protein, wherein the epitope may not be
contiguous with the linear polypeptide sequence of the protein. The DNA
sequence encoding an antigen may be identified, isolated, cloned, and
transferred to a prokaryotic or eukaryotic cell for expression by procedures
well-known in the art (25). An antigen may be 100% identical to a region of
the staphylococcal molecule or protein amino acid sequence, or it may be at
least 95% identical, or at least 90% identical, or at least 85% identical. An
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
antigen may also have less than 100%, 95%, 90% or 85% identity with the
staphylococcal molecule or protein amino acid sequence, provided that it still
is able to elicit antibodies that bind to a native staphylococcal molecule or
protein.
[034] The percent identity of a peptide antigen can be determined, for
example, by comparing the sequence of the target antigen or epitope to the
analagous portion of staphylococcal sequence using the GAP computer
program, version 6.0 described by Devereux et al. (Nucl. Acids Res. 12:387,
1984) and available from the University of Wisconsin Genetics Computer
Group (UWGCG) (40). The GAP program utilizes the alignment method of
Needleman and Wunsch (J. Mol. Biol. 48:443, 1970), as revised by Smith and
Waterman (Adv. Appl. Math 2:482, 1981 ), and is applicable to determining the
percent identity of protein or nucleotide sequences referenced herein (41,
42).
The preferred default parameters for the GAP program include: (1 ) a unary
comparison matrix (containing a value of 1 for identities and 0 for non-
identities) for nucleotides, and the weighted comparison matrix of Gribskov
and Burgess, Nucl. Acids Res. 14:6745, 1986, as described by Schwartz and
Dayhoff, eds., Atlas of Protein Sequence and Structure, National Biomedical
Research Foundation, pp. 353-358, 1979; (2) a penalty of 3.0 for each gap
and an additional 0.10 penalty for each symbol in each gap; and (3) no
penalty for end gaps (43, 44).
[035] Alternatively, for simple comparisons over short regions up to 10
or 20 units, or regions of relatively high homology, for example between
antibody sequences, or homologous portions thereof, the percent identity over
a defined region of peptide or nucleotide sequence may by determined by
dividing the number of matching amino acids or nucleotides by, the total
length
of the aligned sequences, multiplied by 100%. Where an insertion or gap of
one, two, or three amino acids occurs in a MAb chain, for example in or
abutting a CDR, the insertion or gap is counted as single amino acid
mismatch.
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
11
[036] Antigens may be bacterial surface antigens and/or virulence
and/or adherence antigens. Surface antigens are antigens that are
accessible to an antibody when the antigen is in the configuration of the
whole
intact bacterium, i.e., the antigen is not inside the cell cytoplasm.
Virulence
antigens are antigens that are involved in the pathogenic process, causing
disease in a host. Virulence antigens include, for example, LTA,
peptidoglycan, toxins, fimbria, flagella, and adherence antigens. Adherence
antigens mediate the ability of a staphylococcal bacterium to adhere to the
surface of the nares. An antigen may be a non-proteinaceous component of
staphylococci such as a carbohydrate or lipid. For example, peptidoglycan
and lipoteichoic acid are two non-proteinaceous antigens found in the cell
wall
of staphylococci. Antigens may comprise or include fragments of non-
proteinaceous molecules as long as they elicit an immune response.
[037] As used herein, antigens include molecules that can elicit an
antibody response to PepG. An antigen may be a PepG molecule, or a
fragment thereof, wherein the fragment may be enzymatically, or otherwise,
derived from the entire molecule or a fragment thereof. An antigen may also
be a fragment of PepG that encompasses an epitope of PepG, wherein the
epitope may not be contiguous with the macromolecular structure of the
molecule. An antigen may be 100% identical to a region of PepG, or it may
be 95% identical, or 90% identical, or 85% identical. An antigen may also
have less identity with the PepG molecule, provided that it is able to elicit
antibodies that bind to PepG. An antigen may also be an unrelated molecule,
which, through some structural similarity, is able to elicit antibodies that
bind
to PepG. In certain embodiments of the invention, an antigen elicits
antibodies that bind to PepG on the surface of bacteria. In certain
embodiments, an antigen is a peptide that elicits antibodies that bind to
PepG,
and can be encoded by a cDNA. Procedures are generally described in
Molecular Cloning: A Laboratory Manual, 2"d Ed., which is herein
incorporated by reference for any purpose (25).
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
12
[038] Particular antigens of the invention include antigens that bind to
any of the monoclonal antibodies produced by hybridomas 11-232.3, 11-
248.2, 11-569.3, 11-232.3 I E9, 99-11 OFC 12 I E4 (also referred to as MAb-11-
232.3, MAb-11-248.2, MAb-11-569.3, MAb-11-232.3 IE9, and MAb-99-
110FC12 IE4) , A130, or M130, described herein.
[039] An antibody is said to specifically bind to an antigen, epitope, or
protein, if the antibody gives a signal by protein ELISA or other assay that
is
at least two fold, at least three fold, at least five fold, and at least ten
fold
greater than the background signal, i.e., at least two fold, at least three
fold, at
least five fold, or at least ten fold greater than the signal ascribed to non-
specific binding. An antibody is said to specifically bind to a bacterium if
the
antibody gives a signal by, for example, methanol-fixed bacteria ELISA or live
bacteria ELISA that is at least 1.5 fold, 2 fold, or 3 fold greater than the
background signal.
[040] "Enhanced phagocytosis", as used herein, means an increase in
phagocytosis over a background level as assayed by the methods in this
application, or another comparable assay. The level deemed valuable may
well vary depending on the specific circumstances of the infection, including
the type of bacteria and the severity of the infection. For example, enhanced
phagocytic activity may be equal to or greater than 75%, 80%, 85%, 90%,
95%, or 100% over background phagocytosis. Enhanced phagocytosis may
also be equal to or greater than 50%, 55%, 60%, 65%, or 70% over
background phagocytosis. As used herein, opsonic activity may also be
assessed by assays that measure neutrophil mediated opsonophagocytotic
bactericidal activity.
[041] The MAb's of the invention are useful for the prophylaxis and
other treatment of systemic and local staphylococcal infections. In this
respect, a MAb of the invention is said to "alleviate" staphylococcal nasal
colonization if it is able to decrease the number of colonies in the nares of
a
mammal when the MAb is administered before, concurrently with, or after
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
13
exposure to staphylococci, whether that exposure results from the intentional
instillation of staphylococcus or from general exposure. For instance, in the
nasal colonization animal model described below, a MAb or collection of
MAbs is considered to alleviate colonization if the extent of colonization, or
the
number of bacterial colonies that can be grown from a sample of nasal tissue,
is decreased after administering the MAb or collection of MAbs. A MAb or
collection of MAbs alleviates colonization in the nasal colonization assays
described herein when it reduces the number of colonies by at least 25%, at
least 50%, at least 60%, at least 75%, at least 80%, or at least 90%. 100%
alleviation may also be referred to as eradication.
[042] A MAb is said to "block" staphylococcal colonization if it is able
to prevent the nasal colonization of a human or non-human mammal when it
is administered prior to, or concurrently with, exposure to staphylococci,
whether by intentional instillation or otherwise into the nares. A MAb blocks
colonization, as in the nasal colonization assay described herein, if no
staphylococcal colonies can be grown from a sample of nasal tissue taken
from a mammal treated with the MAb of the invention for an extended period
such as 12 hours or longer or 24 hours or longer compared to control
mammals. A MAb also blocks colonization in the nasal colonization assay
described herein if it causes a reduction in the number of animals that are
colonized relative to control animals. For instance, a MAb is considered to
block colonization if the number of animals that are colonized after
administering the material and the Gram-positive bacteria is reduced by at
least 25%, at least 50%, and at least 75%, relative to control animals or if
no
colonies can be grown from a sample taken from a treated individual for an
extended period such as 12 hours or 24 hours or longer.
[043] In a clinical setting, the presence or absence of nasal
colonization in a human patient is determined by culturing nasal swabs on an
appropriate bacterial medium. These cultures are scored for the presence or
absence of staphylococcal colonies. In this type of qualitative assay system,
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
14
it may be difficult to distinguish between blocking and alleviation of
staphylococcal colonization. Thus, for the purposes of qualitative assays,
such as nasal swabs, a MAb "blocks" colonization if it prevents future
colonization in human patients who show no signs of prior colonization for an
extended period such as 12 hours or 24 hours or longer. A MAb "alleviates"
colonization if it causes a discernable decrease in the number of positive
cultures taken from a human patient who is already positive for staphylococci
before the MAbs of the invention are administered.
[044] Thus, the MAbs of the invention may be administered
intranasally to block and/or alleviate staphylococcal nasal colonization.
Administration (instillation) of an "effective amount" of the MAb results in a
mammal that exhibits any of: 1 ) no nasal colonization by staphylococci for at
least 12 hours after administration, 2) discernable, medically meaningful, or
statistically significant decrease in the number of Gram-positive or
staphylococcal colonies in the pares, or 3) a discernable, medically
meaningful, or statistically significant decrease in the frequency of Gram-
positive or staphylococcal cultures taken from the pares, or 4) a discernable,
medically meaningful, or statistically significant decrease in the frequency
of
Gram-positive or staphylococcal infections.
[045] "Instillation" encompasses any delivery system capable of
providing a effective amount of a MAb to the mammalian pares.
[046] A goal of the invention is to reduce the frequency of
staphylococcal infections, including nosocomial infections. The administration
of an effective amount includes that sufficient to demonstrate a discernable,
medically meaningful, or statistically significant of decrease in the
likelihood of
staphylococcal infection involving a body site other than the pares, for
example systemic infection, or infections at the site of trauma or surgery.
Such demonstrations may encompass, for example, animal studies or clinical
trials of patients at risk of infection by Gram-positive bacteria, including,
but
not limited to: premature infants, persons undergoing inpatient or outpatient
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
surgery, burn victims, patients receiving indwelling catheters, stents, joint
replacements and the like, geriatric patients, and those with genetically,
chemically or virally suppressed immune systems.
[047] As used herein, a "treatment" of a patient encompasses any
administration of a composition of the invention that results in a
"therapeutically beneficial outcome," hereby defined as: 1 ) any discernable,
medically meaningful, or statistically significant reduction, amelioration, or
alleviation of existing Gram-positive bacterial infection or colonization, or
2)
any discernable, medically meaningful, or statistically significant blocking
or
prophylaxis against future bacterial challenge, infection, or colonization, or
3)
any discernable, medically meaningful, or statistically significant reduction
in
the likelihood of nosocomial infection. Treatment thus encompasses a
discernable, medically meaningful, or statistically significant reduction in
the
number of Gram-positive bacteria in a colonized or infected patient as well as
a reduction in likelihood of future colonization or infection. As used herein,
"colonized" refers to the subclinical presence of Gram-positive bacteria in
patient, most particularly in the nares, whereas "infected" refers to clinical
infection in any body site.
[048] As used herein, "medically meaningful" encompasses any
treatment that improves the condition of a patient; improves the prognosis for
a patient; reduces morbidity or mortality of a patient; or reduces the
incidence
of morbidity or rates of mortality from the bacterial infections addressed
herein, among a population of patients. The specific determination or
identification of a "statistically significant" result will depend on the
exact
statistical test used. One of ordinary skill in the art can readily recognize
a
statistically significant result in the context of any statistical test
employed, as
determined by the parameters of the test itself. Examples of these well-
known statistical tests include, but are not limited to, X2 Test (Chi-Squared
Test), Students t Test, F Test, M test, Fisher Exact Text, Binomial Exact
Test,
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
16
Poisson Exact Test, one way or two way repeated measures analysis of
variance, and calculation of correlation efficient (Pearson and Spearman).
[049] MAbs of the invention include "protective Mabs." Protective
MAbs 1 ) exhibit strong binding to PepG, 2) enhance the opsonization and
killing of Gram-positive bacteria (opsonophagocytic killing), and 3) reduce
bacterial colonization. Such MAbs may also inhibit the toxicity that is
induced
or facilitated by PepG. In another embodiment, these protective MAbs
encompass therapeutic compositions for the treatment of Gram-positive
infections.
[050] A vaccine is considered to confer a protective immune response
if it stimulates the production of protective opsonic antibodies to Gram-
positive
bacteria. Production of protective opsonic antibodies may be measured by
the presence of such antibodies in the serum of a test subject that has been
administered the vaccine, relative to a control that has not received the
vaccine. The presence of protective opsonic antibodies in the serum may be
measured by the activity assays described herein, or by other equivalent
assays. If an opsonophagocytic bactericidal assay is used, then killing by the
test serum of at least 50% more bacteria, 75% more bacteria, and at least
100% more bacteria, relative to the control serum, is considered to be
enhanced immunity.
Embodiments of the Invention
[051 ] One aspect of the invention relates to protective anti-PepG
MAbs that bind to whole bacteria. Bacteria include all Gram-positive bacteria,
and in particular, staphylococci and streptococci. Since many epitopes of
PepG may be unavailable on the surface of Gram-positive bacteria, this
invention provides protective MAbs that bind to whole bacteria as well as to
isolated PepG. By binding PepG, these protective MAbs may neutralize the
toxic effects of these molecules.
[052] Another aspect of the invention relates to protective MAbs that
function as opsonins, binding in a manner that allows interaction with
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
17
phagocytes, thereby promoting phagocytosis. Such protective MAbs may
block or alleviate Gram-positive bacterial infections. These protective anti-
PepG MAbs may be used either alone or in combination with MAbs of
different specificity, for example, MAbs specific for LTA, to treat diseases
caused by Gram-positive bacteria and/or other organisms. A further aspect of
the invention is protective anti-PepG MAbs that may block or alleviate
bacterial nasal colonization.
[053] Particular embodiments of the invention include protective MAbs
comprising the antigen-binding domains of the monoclonal antibodies MAb-
11-232.3, MAb-11-248.2, MAb-11-569.3, MAb-11-232.3 I E9, MAb-99-
110FC12 IE4, A130, or M130, described herein.
[054] The invention also includes protective chimeric anti-PepG MAbs,
in which the variable regions from a mouse monoclonal antibody are fused to
human constant regions, and the chimeric antibody is produced in mammalian
cell culture.
[055] For example, a chimeric heavy chain may comprise the antigen
binding region of the heavy chain variable region of a protective mouse anti-
PepG MAb of the invention linked to at least a portion of a human heavy chain
constant region. This chimeric heavy chain may be combined with a chimeric
light chain that comprises the antigen binding region of the light chain
variable
region of a protective mouse anti-PepG MAb linked to at least a portion of a
human light chain constant region.
[056] In certain embodiments of the invention, a protective chimeric
antibody is the human/mouse chimeric A130 antibody described herein. In
another embodiment, a protective chimeric antibody comprises the antigen-
binding domains of any of the monoclonal antibodies MAb-11-232.3, MAb-11-
248.2, MAb-11-569.3, MAb-11-232.3 IE9, MAb-99-110FC12 IE4, A130, or
M130, described herein.
[057] Epitopes and antigens that are bound by protective anti-PepG
monoclonal antibodies are also aspects of the invention. Further aspects of
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
18
the invention include epitopes and antigens that elicit opsonic antibodies
that
bind to PepG of Gram-positive bacteria in vertebrates. These epitopes and
antigens elicit protective opsonic antibodies when introduced into a human, a
mouse, a rat, a rabbit, a dog, a cat, a cow, a sheep, a pig, a goat, or a
chicken. Peptides that mimic those epitopes and antigens, and which can
elicit opsonic antibodies to PepG of Gram-positive bacteria are also
encompassed by the invention. These epitopes, antigens, peptides, and
fragments of PepG may be used as vaccines to protect against, or alleviate,
infections caused by Gram-positive bacteria.
[058] The present invention also discloses therapeutic compositions
comprising the protective anti-PepG MAbs of the invention, whether chimeric,
humanized, or fully human, as well as fragments, regions, and derivatives
thereof. These compositions may also include a pharmaceutically acceptable
carrier. The therapeutic compositions of the invention may alternatively
comprise the isolated antigen, epitope, or portions thereof, together with a
pharmaceutically acceptable carrier.
[059] In certain embodiments, a therapeutic composition of the
invention includes, but is not limited to, a protective antibody comprising
the
antigen-binding domains of any of the monoclonal antibodies MAb-11-232.3,
MAb-11-248.2, MAb-11-569.3, MAb-11-232.3 IE9, MAb-99-110FC12 IE4,
A130, or M130, described herein.
[060] Pharmaceutically acceptable carriers include, but are not limited
to, sterile liquids, such as water, oils, including petroleum oil, animal oil,
vegetable oil, peanut oil, soybean oil, mineral oil, sesame oil, and the like.
Saline solutions, aqueous dextrose, and glycerol solutions can also be
employed as liquid carriers. Suitable pharmaceutical carriers are described in
Remington's Pharmaceutical Sciences, 18th Edition (8), which is herein
incorporated by reference for any purpose.
[061 ] Additionally, the invention may be practiced with various delivery
vehicles and/or carriers. Such vehicles may increase the half-life of the Mabs
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
19
in storage and upon administration including, but not limited to, application
to
mucus membranes, for example, upon inhalation or instillation into into the
nares. These carriers comprise natural polymers, semi-synthetic polymers,
synthetic polymers, liposomes, and semi-solid dosage forms (8, 16, 22, 26,
29, 30, 37). Natural polymers include, for example, proteins and
polysaccharides. Semi-synthetic polymers are modified natural polymers
such as chitosan, which is the deacetylated form of the natural
polysaccharide, chitin. Synthetic polymers include, for example,
polyphosphoesters, polyethylene glycol, poly (lactic acid), polystyrene
sulfonate, and poly (lactide coglycolide). Semi-solid dosage forms include,
for
example, dendrimers, creams, ointments, gels, and lotions. These carriers
can also be used to microencapsulate the MAbs or be covalently linked to the
MAbs.
[062] In one embodiment, the MAbs of the invention comprise, or are
covalently or non-covalently bound to the outside of a carrier particle, which
may be formulated as a powder, spray, aerosol, cream, gel, etc for application
to the nares or infected area. In one embodiment, the MAbs are coated onto
a carrier particle core in a dissolvable film, which may comprise a
mucoadhesive. The carrier particle core may be inert, or dissolvable.
[063] The invention further comprises any delivery system capable of
providing a effective amount of a MAb to the mammalian nares or other
infected area. Representative and non-limiting formats include drops, sprays,
powders, aerosols, mists, catheters, tubes, syringes, applicators for creams,
particulates, pellets, and the like. Also encompassed within the invention are
kits comprising a composition containing one or more MAbs of the invention,
in connection with an appropriate delivery device or applicator for the
composition, for example: catheters, tubes, sprayers, syringes, atomizers, or
other applicator for creams, particulates, pellets, powders, liquids, gels and
the like.
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
[064] Finally, the present invention provides methods for treating a
patient infected with, or suspected of being infected with, a Gram-positive
bacteria. The method comprises administering to a patient a therapeutically
effective amount of a therapeutic composition comprising one or more of the
protective anti-PepG MAbs (including monoclonal, chimeric, humanized, fully
human, fragments, regions, and derivatives thereof) and a pharmaceutically
acceptable carrier. A patient can be any human or non-human mammal in
need of prophylaxis or other treatment. Representative patients include any
mammal subject to S. aureus, staphylococcal, or Gram-positive infection or
carriage, including humans and non-human animals such as mice, rats,
rabbits, dogs, cats, pigs, sheep, goats, horses, primates, ruminants including
beef and milk cattle, buffalo, camels, as well as fur-bearing animals, herd
animals, laboratory, zoo, and farm animals, kenneled and stabled animals,
domestic pets, and veterinary animals.
[065] A therapeutically effective amount is an amount reasonably
believed to provide measurable relief, assistance, prophylactive or preventive
effect in the treatment of the infection. Such therapy as above or as
described below may be primary or supplemental to additional treatment,
such as antibiotic therapy for a Gram-positive bacterial infection, an
infection
caused by a different agent, or an unrelated disease. Combination therapy
with other antibodies is expressly contemplated within the invention.
[066] A further embodiment of the present invention is a method of
blocking or alleviating such infections, comprising administering an effective
amount of a therapeutic composition comprising the protective anti-PepG
MAb (whether monoclonal or chimeric, humanized, or fully human, including
fragments, regions, and derivatives thereof) and a pharmaceutically
acceptable carrier.
[067] An effective amount may be reasonably believed to provide
some measure of blocking or alleviating infection by Gram-positive bacteria.
Such therapy as above or as described below may be primary or
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
21
supplemental to additional treatment, such as antibiotic therapy, for a
staphylococcal infection, an infection caused by a different Gram-positive
bacterial agent, or an unrelated disease. Indeed, combination therapy with
other antibodies is expressly contemplated within the invention.
[068] In another embodiment, a peptide that mimics any of the PepG
epitopes would be useful to block binding of Gram-positive bacteria to
epithelial cells and thereby inhibit colonization. For example, a therapeutic
composition containing one or more such peptides may be administered
intranasally to block or inhibit colonization, and therefore prevent or
alleviate
further infection.
[069] Yet another embodiment of the present invention is a vaccine
comprising one or more of the epitopes of the PepG antigen or one or more of
the peptides that mimic a PepG epitope in a pharmaceutically acceptable
carrier. Upon introduction into a host, the vaccine elicits an antibody
broadly
protective and opsonic against infection by Gram-positive bacteria. The
vaccine may include the epitope, a peptide that mimics an epitope, any
mixture of epitopes and peptides that mimic an epitope, the antigen, different
antigens, or any combination of epitopes, peptides that mimic epitopes, and
antigens. Standard techniques for immunization and analysis of the
subsequent antibody response are found in: Antibodies: A Laboratory Manual,
(Harlow & Lane eds., 1988), Cold Spring Harbor Laboratory Press; Coniuaate
Vaccines, (J.M. Cruse, R.E. Lewis, Jr. eds., 1989), Karger, Basel; U.S. Patent
Nos. 5,955,079, and 6,432,679 each of which is incorporated by reference.
[070] The protective anti-PepG MAbs, vaccines, and therapeutic
compositions of the invention are particularly beneficial for individuals
known
to be or suspected of being at risk of infection by Gram-positive bacteria,
such
as infant and elderly patients, immunocompromised patients, patients
undergoing invasive procedures, patients undergoing chemotherapy, patients
undergoing radiation therapy, and health care workers. This includes infants
with immature immune systems, patients receiving body implants, such as
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
22
valves, patients with indwelling catheters, patients preparing to undergo
surgery involving breakage or damage of skin or mucosal tissue, certain
health care workers, and patients expected to develop impaired immune
systems from some form of therapy, such as chemotherapy or radiation
therapy. Among non-human patients, those at risk include zoo animals, herd
animals, and animals maintained in close quarters.
[071 ] The MAbs of the invention may be administered in conjunction
with other antibiotic anti-staphylococcal drugs including antibiotics like
mupirocin and bacitracin; anti-staphylococcal agents like lysostaphin,
lysozyme, mutanolysin, and cellozyl muramidase; anti-bacterial peptides like
nisin; and lantibiotics, or any other lanthione-containing molecule, such as
nisin or subtilin.
[072] In view of the disclosure provided, the administration of the
MAbs of the invention is within the know-how and experience of one of skill in
the art in light of the particular formulation and delivery method selected.
In
particular, the amount of MAbs required, combinations with appropriate
carriers, the dosage schedule and amount may be varied within a wide range
based on standard knowledge in the field without departing from the claimed
invention. In one example, the MAbs of the invention may be given by
intravenous drip or in discrete doses, doses may range from 1 to 4 or more
times daily giving 0.1 to 20 mg per dose. In one embodiment, the amount of
MAb administered would be 2-4 times per day at 0.1-3 mg per dose, a dose
known to be effective with an inoculum of 108 S. aureus bacteria, an amount
of bacteria known to ensure 100% colonization in an animal model. Such a
dosing regimen would be effective on patients either admitted to the hospital
for surgical procedures, patients suffering from various conditions that
predispose them to staphylococcal infections, convalescing patients, infants
with immature immune systems, or prior to a patients' release from hospitals.
[073] The protective anti-PepG antibodies, vaccines, and the
therapeutic compositions of the invention may be administered by
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
23
intravenous, intraperitoneal, intracorporeal injection, intra-articular,
intraventricular, intrathecal, intramuscular, subcutaneous, intranasally,
dermally, intradermally, intravaginally, orally, or by any other effective
method
of administration. The composition may also be given locally, such as by
injection to the particular area infected, either intramuscularly or
subcutaneously. Administration can comprise administering the therapeutic
composition by swabbing, immersing, soaking, or wiping directly to a patient.
The treatment can also be applied to objects to be placed within a patient,
such as indwelling catheters, cardiac values, cerebrospinal fluid shunts,
joint
prostheses, other implants into the body, or any other objects, instruments,
or
appliances at risk of becoming infected with a Gram-positive bacteria, or at
risk of introducing such an infection into a patient.
[074] Particular aspects of the invention are now presented in the form
of the following "Materials and Methods" as well as the specific Examples. Of
course, these are included only for purposes of illustration and are not
intended to limit the present invention.
MATERIALS AND METHODS
Bacteria
[075] S. aureus, type 5, is deposited at the ATCC under Accession
No. 49521.
[076] S. aureus type 8, is deposited at the ATCC under Accession No.
12605.
[077] S. epidermidis strain Hay, was deposited at the ATCC on
December 19, 1990 under Accession No. 55133.
[078] S. hemolyticus is deposited at the ATCC under Accession No.
43252.
Hybridomas
[079] Hybridoma 96-105CE11 IF6 (M110) was deposited at the ATCC
on June 13, 1997 under Accession No. HB-12368.
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
24
[080] Hybridoma 99-110 FC12 IE4 was deposited at the ATCC on
September 21, 2000 under Patent Deposit PTA-2492.
[081] Hybridoma 11-232.3 IE9 (M130) was deposited at the ATCC on
August 21, 2001 under PTA-3659.
Isotope Determination Assay
[082] Isotype was determined using a mouse immunoglobulin isotype
kit obtained from Zymed Laboratories (Cat. No. 90-6550).
Binding Assays
[083] In the binding assays of the invention, immunoglobulin is
incubated with a preparation of whole cell staphylococci or with a preparation
of bacterial cell wall components such as LTA or PepG. The binding assay
may be an agglutination assay, a coagulation assay, a colorimetric assay, a
fluorescent binding assay, or any other suitable binding assay that is known
in
the art. A particularly suitable assay is either an enzyme-linked
immunosorbent assay (ELISA) or a radio-immunoassay (RIA). Binding is
detected directly and can also be detected indirectly by using competitive or
noncompetitive binding procedures known in the art.
[084] The whole cell staphylococcus preparation, LTA preparation,
PepG preparation, or a combination of those preparations, may be fixed using
standard techniques to a suitable solid support, including, but not limited
to, a
plate, a well, a bead, a micro-bead, a paddle, a propeller, or a stick. Solid
supports may be comprised of, for example, glass or plastic. In certain
embodiments of the invention, the solid support is a microtiter plate.
[085] Generally, a binding assay requires the following steps. First,
the fixed preparation is incubated with an immunoglobulin source. In one
embodiment of the assay, the immunoglobulin source is, for example, tissue
culture supernatant or a biological sample such as ascites, plasma, serum,
whole blood, or body tissue. In another embodiment, the immunoglobulin
may be further isolated or purified from its source by means known in the art,
and the purified or isolated immunoglobulin is subsequently used in the assay.
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
The amount of binding is determined by comparing the binding in a test
sample to the binding in a negative control. A negative control is defined as
any sample that does not contain antigen-specific immunoglobulin. In the
binding assay, a positive binding reaction results when the amount of binding
observed for the test sample is greater than the amount of binding for a
negative control. Positive binding may be determined from a single
positive/negative binding reaction or from the average of a series of binding
reactions. The series of binding reactions may include samples containing a
measured amount of immunoglobulin that specifically binds to the fixed
antigen, thereby creating a standard curve. This standard curve may be used
to quantitate the amount of antigen-specific immunoglobulin in an unknown
sample.
[086] In an alternate embodiment of the assay, antibodies are fixed to
a solid support and an unknown immunoglobulin sample is characterized by
its ability to bind a bacterial preparation. The other aspects of the assays
discussed above apply where appropriate.
[087] The specific binding assays used in the Examples are set forth
below:
[088] Live Bacteria ELISA (LBE): The I_BE assay was performed to
measure the ability of antibodies to bind to live bacteria. Various types of
bacteria may be used in this assay, including S. aureus type 5, type 5-USU,
type 8, S. epidermidis strain Hay, and S. hemolyticus. Bacteria from an
overnight plate culture was transferred to 35 ml of Tryptic Soy Broth (TSB)
and grown with gentle shaking for 1.5-2.0 hours at 37°C. The bacteria
were
then pelleted by centrifugation at 1800-2000 x g for 15 minutes at room
temperature. The supernatant was removed and the bacteria were
resuspended in 35-~45 ml of phosphate buffered saline containing 0.1
bovine serum albumin (PBS/BSA). The bacteria were again pelleted by
centrifugation, the supernatant discarded and the bacteria resuspended in
PBS/BSA to a percent transmittance (%T) of 65%-70% at 650 nm. From this
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
26
suspension the bacteria were further diluted 15-fold in sterile 0.9% sodium
chloride (Sigma cat. no. S8776, or equivalent), and 100p1 of this suspension
was added to replicate wells of a flat-bottomed, sterile 96-well plate.
[089] Each antibody to be tested was diluted to the desired
concentration in PBS/BSA containing 0.05% Tween-20 and horse radish
peroxidase-conjugated Protein A (Protein A-HRP, Zymed Laboratories) at a
1:10000 dilution (PBS/BSA/Tween/Prot A-HRP). The Protein A-HRP was
allowed to bind to the antibodies for 30-60 minutes at room temperature
before use, thereby generating an antibody-Protein A-HRP complex to
minimize the potential non-specific binding of the antibodies to the Protein A
found on the surface of S. aureus.. Generally, several dilutions of test
antibody were used in each assay. From each antibody dilution, 50 NI of the
antibody-Protein A-HRP complex was added to replicate wells and the
mixture of bacteria and antibody-Protein A-HRP complex was incubated at
37° C for 30-60 minutes with gentle rotation (50 - 75 rpm) on an
orbital
shaker.
[090] Following the incubation, the bacteria were pelleted in the plate
by centrifugation at 1800-2000 x g. The supernatant was carefully removed
from the wells and 200 pl of PBS/BSA containing 0.05% Tween-20
(PBS/BSA/Tween) was added to all wells to dilute unbound reagents. The
bacteria were again pelleted by centrifugation and the supernatant was
removed. One hundred microliters of TMB substrate (BioFx, Inc. cat. no.
TMBW-0100-01 ) was added to each well and the reactions were allowed to
proceed for 15 minutes at room temperature. The reactions were stopped by
adding 100 pl of TMB stop reagent (450 nm Stop Reagent; BioFx, Inc. catalog
no. STPR-0100-01 ). The absorbance of each well was determined using a
microplate reader fitted with a 450 nm filter.
[091] In this assay, the intensity of the color development was directly
proportional to the binding of the antibodies to the bacteria. Control wells
contained bacteria and Protein A-HRP without antibody.
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
27
[092] Immunoassay on Methanol-Fixed Bacteria: Heat-killed
bacteria were suspended in sterile 0.9% sodium chloride (Sigma cat. no.
S8776, or equivalent) at a % transmittance (%T) of 70-75% at 650 nm. Ten
milliliters the bacterial suspension was diluted 15-fold in sterile 0.9%
sodium
chloride and then pelleted by centrifugation at 1800 x g for 15 minutes at 10-
15~C. The supernatant was discarded and the pellet was resuspended in
1500 ml of methanol (MeOH). One hundred microliters of the bacteria-MeOH
suspension was distributed into each well of Nunc Maxisorp Stripwells (Nunc
catalog no. 469949). The MeOH was allowed to evaporate, fixing the bacteria
to the plastic wells. The bacteria-coated stripwells were stored in plastic
bags
in the dark at room temperature and used within 2 months of preparation.
[093] For evaluation of antibodies, the bacteria-coated plates were
washed four times with phosphate buffered saline containing 0.05% Tween-
20 (PBS-T) as follows. Approximately 250 p,l of PBS-T was added to each
well. The buffer was removed by flicking the plate over the sink and the
remaining buffer removed by inverting the plate and tapping it on absorbent
paper. The antibody was diluted in PBS-T and then added to the wells.
Supernatants, ascites, or purified antibodies were tested at the dilutions
indicated in the Examples. Control wells received PBS-T alone. After
addition of the antibody, the wells were incubated at room temperature for 30-
60 minutes in a draft-free environment. The wells were again washed four
times with PBS-T. Ninety-five microliters of detection antibody was then
added to each well. The detection antibody was one of the following: rabbit
anti-mouse IgG3, rabbit anti-mouse IgM, or goat anti-human IgG (gamma-
specific), all conjugated to horse radish peroxidase (HRP) and diluted 1:6000
in PBS-T (Zymed catalog numbers 61-0420, 61-6820 and 62-8420,
respectively).
[094] Following another 30-60 minute incubation at room temperature,
the wells were washed four times with PBS-T and each well received 100 NI of
TMB substrate solution (BioFx #TMBW-0100-01 ). Plates were incubated in
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
28
the dark at room temperature for 15 minutes and the reactions were stopped
by the addition of 100 pl of TMB stop solution (BioFx #STPR-0100-01 ). The
absorbance of each well was measured at 450 nm using a Molecular Devices
Vmax plate reader.
[095] Immunoassay with Protein A: In order to evaluate the binding
of the MAbs to S. aureus, the immunoassay procedure was modified for
methanol-fixed bacteria, described above. Because S. aureus expresses
Protein A on its surface, and Protein A binds strongly to the constant region
of
the heavy chains of gamma-globulins, it is possible that false positive
results
may be obtained from non-specific binding of the antibodies to Protein A. To
overcome this difficulty, the immunoassay wells were coated with bacteria as
described above, but prior to the addition of the antibodies to the bacteria-
coated wells, the MAbs were incubated with a solution of recombinant Protein
A conjugated to HRP (Zymed Laboratories Cat. No. 10-1123), diluted 1:8000
in PBS-T. The binding reaction was allowed to proceed for 30 minutes at
room temperature. The wells were washed four times with PBS-T and 100 ~I
of the solution of each Protein A-HRP-MAb combination was added to the
wells. The presence of the Protein A-HRP from the pretreatment blocked the
MAbs from binding to the Protein A on the S. aureus. Furthermore, the
binding of the Protein A-HRP to the constant region of the heavy chain did not
interfere with the antibody binding site on the MAbs, thereby allowing
evaluation of the MAbs on S. aureus and other bacteria.
[096) The Protein A-HRP-MAb solutions were allowed to bind in the
coated wells for 30-60 minutes at room temperature. The wells were then
washed with PBS-T and TMB substrate solution was added and the assay
completed as described above.
[097] Immunoassay on LTA and PepG: The binding of the MAbs to
LTA was measured by immunoassay on wells coated with S. aureus LTA
(Sigma Cat. No. 2515). One hundred microliters of a 1 Ng/ml LTA solution in
PBS was distributed into replicate Nunc Maxisorp Stripwells and incubated
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
29
overnight at room temperature. The unbound material was removed from the
wells by washing four times with PBS-T. Antibody, diluted in PBS-T, was then
added to the wells and the assay continued as described above for the
Immunoassay on Methanol-Fixed Bacteria.
[098] For immunoassays on PepG, Nunc Maxisorp Stripwell plates
were coated with 100 ~.I of a 5 Ng/ml solution of PepG (S. Foster; also can be
prepared by the procedure set forth in Example 2) in 0.1 M carbonate buffer
(pH 9.2 - 9.6) overnight at room temperature. Unbound antigen was removed
from the plate by washing four times with PBS-T. Sample supernatants,
ascites, or antibodies, diluted in PBS-T, were added to replicate wells. The
plate was covered with a plate sealer and incubated for 30-60 minutes at
room temperature in a draft-free environment. The plate was again washed
with PBS-T, and 95 pl of gamma-specific Rabbit anti-Mouse IgG, conjugated
to horseradish peroxidase (HRP) (Zymed Laboratories) was added to all
wells. The plate was again covered and incubated in a draft-free environment
for 30-60 minutes at room temperature. The plate was washed with PBS-T
and 100 NI of TMB substrate solution was added to each well. After a 15
minute incubation at room temperature in the dark, 100 NI of TMB stop
solution was added to all wells and the absorbance of each well was
measured using a Molecular Devices Vmax plate reader with a 450 nm filter.
Activity Assays
[099] Antibodies that bind to an antigen may not necessarily enhance
opsonization or enhance protection from infection. Therefore, an opsonization
assay was used to determine the functional activities of the antibodies.
[0100] An opsonization assay can be a colorimetric assay, a
chemiluminescent assay, a fluorescent or radiolabel uptake assay, a cell-
mediated bactericidal assay, or any other appropriate assay known in the art
which measures the opsonic potential of a substance and thereby identifies
reactive immunoglobulin. In an opsonization assay, an infectious agent, a
eukaryotic cell, and the opsonizing substance to be tested, or an opsonizing
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
substance plus a purported opsonizing enhancing substance, are incubated
together.
[0101 ] In certain embodiments, the opsonization assay is a cell-
mediated bactericidal assay. In this in vitro assay, an infectious agent such
as a bacterium, a phagocytic cell, and an opsonizing substance, such as
immunoglobulin, are incubated together. Any eukaryotic cell with phagocytic
or binding ability may be used in a cell-mediated bactericidal assay. In
certain
embodiments, phagocytic cells are macrophages, monocytes, neutrophils, or
any combination of these cells. Complement proteins may be included to
promote opsonization by both the classical and alternate pathways.
[0102] The amount or number of infectious agents remaining after
incubation determines the opsonic ability of an antibody. The fewer the
number of infectious agents that remain after incubation, the greater the
opsonic activity of the antibody tested. In a cell-mediated bactericidal
assay,
opsonic activity is measured by comparing the number of surviving bacteria
between two similar assays, only one of which contains the antibody being
tested. Alternatively, opsonic activity is determined by measuring the number
of viable organisms before and after incubation with a sample antibody. A
reduced number of bacteria after incubation in the presence of antibody
indicates a positive opsonizing activity. In the cell-mediated bactericidal
assay, positive opsonization is determined by culturing the incubation mixture
under appropriate bacterial growth conditions. Any reduction in the number of
viable bacteria comparing pre-incubation and post-incubation samples, or
between samples that contain immunoglobulin and those that do not, is a
positive reaction.
[0103] Neutraphil-Mediated Opsonophagocytic Bactericidal Assay:
The assay was performed using neutrophils isolated from adult venous blood
by sedimentation using PMN Separation Medium (Bobbins Scientific catalog
no. 1068-00-0). Forty microliters of antibody, serum, or other immunoglobulin
source, was added at various dilutions to replicate wells of a round-bottom
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
31
microtiter plate. Forty microliters of neutrophils (approximately 106 cells
per
well) was then added to each well, followed immediately by approximately 3 x
104 mid-log phase bacteria (S. epidermidis strain Hay, ATCC 55133 or S.
aureus type 5, ATCC 49521 ) in 10 NI Tryptic Soy Broth (Difco cat. no. 9063-
74, or equivalent). Finally, 10 NI of immunoglobulin-depleted human serum
was added as a source of active complement. (Immunoglobulins were
removed from human serum complement by preincubating the serum with
Protein G-agarose and Protein L-agarose before use in the assay. This
depletion of immunoglobulins minimized the concentrations of anti-
staphylococcal antibodies in the complement, thereby reducing bacterial
killing caused by inherent antibodies in the complement solution.)
[0104] The plates were incubated at 37°C with constant, vigorous
shaking. Aliquots of 10 NI were taken from each well at zero time, when the
sample antibody was first added, and after 2 hours of incubation. To
determine the number of viable bacteria in each aliquot harvested from each
sample well, each aliquot was diluted 20-fold in a solution of 0.1 % BSA in
water (to lyse the PMNs), mixed vigorously by rapid pipetting, and cultured on
blood agar plates (Remel, cat. no. 01-202, or equivalent) overnight at
37°C.
The opsonic activity was measured by comparing the number of bacterial
colonies observed from the sample taken at two hours with the number of
bacterial colonies observed from the sample taken at time zero. Colonies
were enumerated using an IPI Minicount Colony Counter.
[0105] This cell-mediated bactericidal assay has been correlated with in
vivo efficacy, as set forth in Examples 11 and 12 of U.S. Patent No.
5,571,511.
[0106] Nasal Colonization Assay: The mouse nasal colonization
model for S. aureus was based on the work of Kiser et al. (11 ). Briefly,
streptomycin resistant S. aureus type 5 is grown on high salt Columbia agar
(Difco) to promote capsule formation. The bacteria are washed with sterile
saline (0.9% NaCI in water) to remove media components and resuspended
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
32
at 108 bacteria/animal dose in saline (0.9% NaCI in water) containing various
concentrations and combinations of anti-staphylococcal or irrelevant control
MAbs. Following one hour preincubation, the bacteria are pelleted and
resuspended in a final volume of 10 pl per animal dose in either saline or
saline containing antibody. Mice that have been maintained on streptomycin-
containing water for 24 hours are sedated with anesthesia. Staphylococci are
instilled into the nares of the mice by pipetting without contacting the nose.
[0107] After four to seven days, during which the animals are
maintained on streptomycin-containing water, the animals are sacrificed and
the noses removed surgically and dissected. Nasal tissue is vortexed
vigorously in saline (0.9% NaCI in water) plus 0.5% Tween-20 to release
adherent bacteria and the saline is plated on Columbia blood agar (Remel)
and tryptic soy agar (Difco) containing streptomycin to determine
colonization.
[0108] The invention, having been described above, may be better
understood by reference to examples. The following examples are intended
for illustration purposes only, and should not be construed as limiting the
scope of the invention in any way.
EXAMPLES
EXAMPLE 1
The Production of Hybridomas and Monoclonal Antibodies to
S, aureus PepG Immunization of Mice
[0109] To produce monoclonal antibodies directed against S. aureus
PepG, immunizations were carried out using 5-6 week old female BALB/c
mice, obtained from Harlan Sprague Dawley (Indianapolis, IN). The
immunogen for the primary immunization was S. aureus PepG (gift from
Roman Dziarski; PepG can also prepared as described in Example 2). Five
microliters of PepG (7 mg/ml suspension) was mixed with 345 NI of PBS and
350 NI of RIBI adjuvant (RIBI Immunochemicals, Hamilton, NH). The resulting
suspension contained 50 Ng/ml of PepG. Each mouse was immunized with a
subcutaneous (sc) dose of 0.1 ml (5 Ng per mouse).
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
33
[0110] Approximately four weeks following the initial immunization, a
booster immunization was given. PBS (873 p.l) was mixed with 7.1 NI of PepG
(7 mg/ml suspension) and 120 NI of Alhydrogel (Accurate Chemical and
Scientific, Co., Westbury, NY). Each mouse received an sc dose of 0.1 ml (5
pg of PepG per mouse).
[0111 ] After an additional eight weeks, the mice were immunized with a
50 pg/ml solution containing 50% Alum adjuvant (Pierce Cat. No.77161 ) in
PBS (0.2 ml/mouse). Sera from the immunized mice were tested by ELISA
as described above. As shown in Table 1, serum from mouse 8813 bound
most strongly to PepG. This mouse was given a final, pre-fusion,
intraperitoneal boost of 10 pg PepG in PBS three days prior to the generation
of hybridomas.
Table 1
PepG ELISA of Sera from Mice Immunized with PepG
Mouse Serum DilutionSerum Sample Serum Sample
ID #1a #2b
Buffer 100 0.107 0.125
8810 100 0.341 0.339
8811 100 0.219 0.215
8812 100 0.267 0.249
8813 100 0.308 2.143
8814 100 0.223 0.296
a Sample was taken 9 weeks after the first immunization.
b Sample was taken 18 weeks after the first immunization.
Generation of Hybridomas
[0112] Hybridomas were prepared by the general methods of Shulman,
Wilde and Kohler and Bartal, A.H. and Hirshaut (2, 28). Spleen cells from
mouse 8813 were mixed with SP2/0 mouse myeloma cells (ATCC No.
CRL1581 ) at a ratio of 10 spleen cells per SP2/0 cell, pelleted by
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
34
centrifugation (400 x g, 10 minutes at room temperature) and washed in
serum free DMEM (Hyclone cat. no. SH30081.01, or equivalent). The
supernatant was removed and fusion of the cell mixture was accomplished in
a sterile 50 ml centrifuge conical by the addition of 1 ml of a 50% w/v
solution
of polyethylene glycol (PEG; mw 1500; Boehringer Mannheim cat. no.
783641 ) over a period of 60-90 seconds. Serum free medium was then
added slowly in successive volumes of 1, 2, 4, 8, 16 and 19 ml. The
hybridoma cell suspension was gently resuspended into the medium and the
cells pelleted by centrifugation (500 x g, 10 minutes at room temperature).
The supernatant was removed and the cells resuspended in RPMI 1640,
supplemented with 10% heat-inactivated fetal bovine serum, 0.05 mM
hypoxanthine and 16 NM thymidine (HT medium; Life Technologies cat. no.
11067-030, or equivalent). One hundred microliters of the hybridoma
suspension cells were plated into 96-well tissue culture plates. Eight wells
(column 1 of plate A) received approximately 2.5 X 104 SP2/0 cells in 100 p.l.
The SP2/0 cells served as a control for killing by the selection medium added
24 hours later.
[0113] Twenty-four hours after preparation of the hybridomas, 100 p.l of
RPMI 1640, supplemented with 10% heat-inactivated fetal bovine serum, 0.1
mM hypoxanthine, 0.8 pM aminopterin and 32 pM thymidine (HAT medium,
Life Technologies cat. no. 11067-030, or equivalent) was added to each well.
[0114] Ninety-six hours after the preparation of the hybridomas, the
SP210 cells in plate A, column 1 were dead, indicating that the HAT selection
medium had successfully killed the unfused SP2/0 cells. Twelve days after
the preparation of the hybridomas, supernatants from all wells were tested by
ELISA for the presence of antibodies that bind to PepG.
[0115] Based on the results of this preliminary assay, cells from 28 of
the original 760 wells were transferred to a 24-well culture dishes. Four days
later, supernatant from these cultures were retested by ELISA for the
presence of antibodies that bind to PepG, using isotype-specific testing
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
reagents. Briefly, supernatants from the cultures were added to 96-well plates
coated with PepG and allowed to bind. To simultaneously detect binding of
the antibodies to PepG, and the isotype of the antibodies, replicate wells
were
incubated with HRP-conjugated rabbit anti-mouse IgA, HRP-conjugated rabbit
anti-mouse IgG, and HRP-conjugated rabbit anti-mouse IgM. The wells were
then washed and developed by standard methods. As shown in Table 2, one
of the cultures (99-110CF10) produced an IgG antibody and was passaged
further. In addition, fifteen other cultures produced IgM antibodies and were
also passaged further.
Table 2
PepG ELISA Assay of 99-110 Supernatants
Supernatant
Supernatant DilutionIsotypeAbsorbance
ID
Buffer 2 M 0.077
II
99-110AD2 2 M 2.020
99-110AF5 2 M 1.741
99-110AA10 2 M 2.924
99-110BG8 2 M 3.702
99-110BA11 2 M 2.168
99-110CB2 2 M 3.747
99-110CG2 2 M 2.465
99-110DA4 2 M 2.606
99-110DF6 2 M 3.211
99-110DA10 2 M 3.570
99-110DA11 2 M 3.333
99-110EE4 2 M 1.131
99-110FC12 2 M 4.000
99-110GH4 2 M 4.000
99-110GC8 2 M 3.732
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
36
Supernatant
Supernatant DilutionIsotypeAbsorbance
ID
99-110CF10 2 G 0.102
[0116] Cultures 99-11 OCF10 and 99-110FC12 were subcloned by
limiting dilution, as follows. Hybridomas were enumerated using a
hemocytometer and adjusted to a concentration of 225 cells/ml. One ml of
the cell solution was then mixed with 36 ml of RPMI 1640 medium, 7.5 ml of
heat-inactivated fetal bovine serum, 0.5 ml of 10 mg/ml kanamycin solution
(GIBCO BRL cat # 15160-054), and 5 ml of Hybridoma Serum Free Medium
(Life Technologies Cat. No. 12045-084). The resulting suspension contained
4.5 cells/ml. Two hundred microliters of this suspension was then added to
each well of two 96-well culture dishes. As shown in Table 2 and Table 3,
culture 99-110CF10 did not produce antibodies that bound to PepG.
Subsequent subclones of culture 99-110CF10 likewise did not elicit PepG-
specific antibodies.
Table 3
PepG ELISA of 99-110CF10 Clones
Clone Supernatant
ID Dilution Absorbance
Buffer 0.067
CF 1 OIC 2 0.170
1
CFl0IE1 2 0.161
CF lOIG 2 0.161
1
CF10IH2 2 0.153
CF101D3 2 0.135
CFl0IC7 2 0.129
CF10IF10 2 0.129
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
37
[0117] The clones from culture 99-110FC12, shown in Table 4,
continued to produce IgM antibodies that bound to PepG. Thirty-two clones
from 99-110FC12 were tested by ELISA on plates coated with PepG. Of
these, 31 were strongly positive, producing absorbance values of 3.159 or
greater. Four clones, designated 99-110FC12 IE4, ID3, IIHS and IIC6 were
expanded and cryopreserved. Clone IE4 was selected for additional analysis.
Table 4
PepG ELISA 99-110FC12 Clones
Clone Supernatant
ID Dilution Absorbance
Buffer 0.039
FC 121 F 2 3.495
1
FC 12IE2 2 2.651
FC 121D3 2 4.000
FC 12IF3 2 3.159
FC 12IG3 2 3.811
FC 12IE4 2 4.000
FC 121D6 2 3.937
FC 12IE6 2 4.000
FC 12IC7 2 0.074
FC 12IH7 2 4.000
FC 12IF8 2 4.000
FC 12IG8 2 3.533
FC 12IF 2 4.000
11
FC 12IG 2 4.000
11
FC 12IA 2 4. 000
12
FC 12IIB 2 3.456
2
FC 12IID2 2 4.000
FC 12IIG2 2 4.000
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
38
Clone Supernatant
ID Dilution Absorbance
FC 12IIF3 2 4.000
FC 12IIG3 2 3.379
~i FC 12IIB42 4.000
FC 12IIG4 2 4.000
FC 12IIA5 2 3.887
FC 12IIH5 2 4.000
FC 12IIC6 2 4.000
FC 12IIE6 2 3.756
FC 12IIG6 2 4.000
FC 12IIA 2 3.844
FC 12IIC 2 3.450
10
FC 12IIH 2 3.980
10
FC 12IIH 2 4.000
11
[0118] Clone 99-110FC12 IE4 was grown in an Integra Biosystems
Culture system, designed to produce high quantities of immunoglobulin in
culture supernatants. Supernatant from the IE4 clone was tested by ELISA
on wells coated with methanol-fixed S. epidermidis strain Hay, PepG, and
LTA. As shown in Table 5, the antibody bound strongly to S. aureus PepG,
but not to the methanol-fixed bacteria, or to S. aureus LTA.
Table 5
Binding of 99-110FC12 IE4 supernatant by ELISA
Supernatant On methanol-
Dilution On S. aureus On S. aureus Fixed
PepG LTA S. epi. Strain
Hay
10 3.789 0.051 0.078
30 3.983 0.052 0.075
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
39
Supernatant On methanol-
Dilution On S. aureus On S. aureus Fixed
PepG LTA S. epi, Strain
Hay
90 3.974 0.048 0.073
270 4.00 0.047 0.069
810 3.858 0.044 0.065
PBS-T 0.044 0.045 0.056
EXAMPLE 2
Production of Hybridomas and Monoclonal Antibodies to B, subtilis
PepG Purification of peptidoglycan
[0119] Bacillus subtilis HR (gift of Howard Roger, University of Kent,
UK) vegetative cell walls were made as previously described under stringent
conditions, using lipopolysaccharide-free materials (6, 38), which are herein
incorporated for any purpose). Proteins were removed from the
peptidoglycan by treatment with pronase, and teichoic acid and other attached
polymers were removed by treatment with HF (48% v/v) for 24 h at 4°C.
The
insoluble peptidoglycan was pelleted by centrifugation (13,000 g, 5 min,
4°C)
and resuspended in distilled water to 2 mg/ml PepG. This step was repeated
once. The peptidoglycan was then pelleted and resuspended in 50 mM Tris
HCI pH7.5 to 2 mg/ml PepG, and this step was repeated once. Finally, the
peptidoglycan was pelleted and resuspended in distilled water to 2 mg/ml
PepG three more times. The peptidoglycan was resuspended at about 10
mg/ml in distilled water and stored at -20°C.
[0120] PepG preparations were analyzed as previously described by
sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE),
which revealed no evidence of contaminating protein (39). The purity of the
peptidoglycan was further verified by amino acid analysis of hydrolyzed PepG,
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
which gave only the expected amino acids, and by reverse phase
chromatography analysis of enzymatically digested material, both assays
performed as previously described (1 ). This level of purity had previously
not
been ensured during the production of anti-peptidoglycan antibodies.
Preparation of Muropeptide Conlupate for Immunization
[0121 ] Peptidoglycan conjugate was made as per the manufacturers
protocol for the Imject SuperCarrier EDC System for Peptides (Pierce, cat. no.
77152).
[0122] Muropeptides were made by Cellosyl digestion. Cellosyl is a
muramidase that cleaves the bond between N-acetylmuramic acid and N-
acetylglucosamine in the glycan backbone of PepG. Complete cellosyl
digestion of PepG results in the production of small, soluble muropeptides.
One milliliter of 11.5mg/ml purified peptidoglycan was harvested by
centrifugation (13,000 g, 5 min, 4°C) and resuspended in 1 ml
conjugation
buffer, supplied with the Imject SuperCarrier EDC System for Peptides
(Pierce, cat. no. 77152). Twenty-five microliters Cellosyl (2mg/ml; Hoechst)
was added to the PepG suspension and incubated at 37°C with rotary
mixing
for 7 hours. The sample was then boiled for 10 min and any insoluble
material removed by centrifugation as above. Three hundred microliters of
cellosyl-digested PepG was added to 200 pl of conjugation buffer.
[0123] Preparation of SuperCarrier (Pierce, cat. no. 77152),
conjugation and purification of conjugate were performed as per
manufacturers protocol. The PepG conjugate was stored at -20°C.
Immunization of Mice
[0124] To produce monoclonal antibodies directed against B. subtilis
PepG, immunizations were carried out using four 8-12 week old BALB/C
mice, obtained from Sheffield University Field Laboratories. The immunogen
for the primary immunization was B. subtilis PepG, prepared as muropeptide
conjugate (described above). For each mouse, 50 pg of conjugate in 50 NL of
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
41
PBS was mixed with 50 pl of Freund's complete adjuvant, and this mixture
was injected subcutaneously.
[0125] At about day 14, 29, 113, and 232 following the primary
immunization, each mouse was injected intraperitoneally with 50 pg of
conjugate in 50 pL of PBS, which had been mixed with 50 pl of Freund's
incomplete adjuvant. Hybridomas were generated four days after the final
boost of PepG conjugate.
Generation of Hybridomas
[0126] Hybridomas were prepared by the general methods of Shulman,
Wilde and Kohler and Bartal and Hirshaut (2, 28). Spleen cells from
immunized mice 1 and 2 were pooled and were mixed with SP2/0 mouse
myeloma cells at a ratio of 5 spleen cells per SP2/0 cell, pelleted by
centrifugation (770 xg, 5 minutes at 30°C) and washed in serum-free
RPMI.
One milliliter of PEG 1500 (50% in 75 mM HEPES, Boehringer cat. no. 783
641 ) was added over 1 minute, followed by 1 ml of RPMI over 1 minute, and
then 9 ml of RPMI over 2 minutes. Cells were then pelleted by centrifugation
at 430 xg for 15 minutes at 30°C. Cells were resuspended in RPMI-
1640/HAT
(1 ml of 50X HAT concentrate (Invitrogen cat no. 21060-017) in 50m1 RPMI-
1640) containing 20% FCS at approximately 1 x 106 cells/ml. One hundred
microliters of cell suspension was added to each well of ten 96-well plates
and
grown at 37°C. Unfused SP2/0 cells were used as a selection control and
died 5 days after plating.
[0127] Thirteen days after preparation of the hybridomas, supernatants
from all wells were assayed by ELISA for the presence of antibodies that bind
PepG. Thirteen of 829 wells tested were positive.
[0128] Based on the results of the ELISA, positive cells were expanded
in a 24-well culture plate and retested for stable antibody secretion by
ELISA.
Six lines were found to secrete antibodies to PepG. Line BB4 was found to
produce antibodies with the highest affinity to B. subtilis cell walls. At
about
75% confluence, BB4 was cloned by limiting dilution and the subclones
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
42
retested for anti-PepG antibody secretion. Two clones, BB4/A4 and BB4/A5,
were found to secrete antibodies to B. subtilis PepG. Isotype determination,
using Isotype Strips (Roche Diagnostics, cat. no. 1493027), showed that both
antibodies were IgG.
EXAMPLE 3
Substrate Affinities of PepG Antibodies
Cellosyl Digestion of PepG
[0129] PepG from Bacillus subtilis, Staphylococcus aureus,
Streptococcus mutans, Bacillus megaterium, Enterococcus faecalis,
Staphylococcus epidermidis, and Listeria monocytogenes was purified as
described in Example 2. One milliliter of each PepG (10 mg/ml) in 25 mM
sodium phosphate buffer pH5.6 was digested with 250 pg/ml cellosyl
(Hoechst AG) for 15 hours at 37°C. The samples were boiled for 3
minutes to
stop the reaction and insoluble material was removed by centrifugation
(14,000 xg for 8 minutes at room temperature). The soluble cellosyl-digested
PepG was stored at -20C.
[0130] Staphylococcal PepG has a unique pentaglycine crossbridge,
which can be cleaved by lysostaphin, a glycine-gycine endopeptidase.
Lysostaphin (25 pg/ml; Sigma Cat No. L0761 ) was added to the cellosyl
digestion of S. aureus and S. epidermidis PepG to cleave this peptide cross
bridge. S. aureus was also digested without lysostaphin.
ELISA to determine antibody affinities for PepG and cellosyl-digested PepG
[0131 ] Three hybridoma lines, identified as 11-232.3, 11-248.2, and 11-
569.3 (QED Biosciences), were produced by immunizing mice with UV-
inactivated whole S. aureus, and the MAbs they produce were subsequently
shown to bind to PepG. The affinities of the MAbs produced by 11-232.3
(when purified, the MAb is referred to as 702PG), 11-248.2, and 11-569.3,
BB4/A4, and BB4/A5 for PepG from various bacteria, and cellosyl-digested
PepG from various bacteria, were compared by ELISA as follows. 96-well
immunoassay plates (NUNC Immunoplate Maxisorp) were coated with 100
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
43
pg/ml poly-L-lysine (Sigma Chemicals, cat. no. P6407) in 0.05 M
carbonate/bicarbonate buffer pH 9.6 (0.015 M Na2C03, 0.035 M NaHC03, pH
9.6, hereafter referred to as carbonate buffer) for 1 hour at room
temperature.
The carbonate buffer was removed, and the wells were washed once with
carbonate buffer. The wells were then coated with 100 pl 5 pg/ml purified
PepG substrate, or cellosyl-digested PepG substrate, in carbonate buffer
overnight at 4°C. The substrate solution was removed, and the wells
were
washed twice with PBS-T. The wells were then blocked with 150 NI PBS-T
containing 0.2% w/v bovine gelatin (Sigma cat. no. A7030; blocking buffer) for
2 hours at 37°C. The blocking buffer was removed and the wells were
washed four times with PBS-T.
[0132] Fifty microliters of one of the MAbs listed above (diluted
appropriately in blocking buffer) was added to each well and the binding
reaction was incubated for 2 hours at 37°C. The monoclonal antibody was
removed and the wells were washed three times in PBS-T. Fifty microliters of
HRP-conjugated goat anti-mouse IgG (Biorad), diluted 1:20,000 in blocking
buffer, was added to each well and the binding reaction was incubated for 1
hour at 37°C. The secondary antibody was removed and the wells were
washed three times with PBS-T. Fifty microliters of TMB enzyme substrate
(Biorad cat. no. 172-1068) was added to each well and the color was
developed for fifteen minutes at room temperature. The reaction was stopped
by addition of 50 NI of 2M H2S04 to each well, and the absorbance was read
on a VICTOR plate reader (Wallac) at 450 nm. The results of the ELISA are
shown in Table 6.
[0133] Table 6 demonstrates that the PepG antibodies described are
not identical, as each shows a different range of specificity and affinity for
the
different PepG substrates. Specifically, 702PG, MAb-11-232.3, and MAb-11-
248.2 show high affinity for S. aureus PepG, and low affinity for 8. subtilis
PepG, while the antibodies produced by BB4/A4 and BB4/A5 (also called
MAb-BB4/A4 and MAb-BB4/A5) show the reverse specificity. MAb-BB4/A4
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
44
and MAb-BB4/A5 also show high affinity for S. epidermidis, while the others
do not.
Table 6
Binding of PepG antibodies to bacterial substrates
Conc.
of MAb
(p,g/ml)
that
gave
reading
>0.1
at 450
nm.
PepG from: 702 PG 11- 11- 11- BB4/A4 BB4/A5
*
232.3 248.2 569.3
Bacillus subtilis 1000 1000 > 1000 100 < 1 < 1
168 H R
Staphylococcus <1 <1 <1 100 100 100
aureus
8325/4
Streptococcus mutans>1000 1000 >1000 100 100 100
LTII
Bacillus megaterium>1000 >1000 >1000 1000 1000 1000
KM
spore cortex
Enterococcus faecalis>1000 >1000 >1000 100 100 1000
!I NCTC 775
Staphylococcus 100 100 100 100 <1 <1
epidermidis
138
Listeria monocytogenes>1000 >1000 >1000 1000 1000 1000
EGD
~ Bacillus subtilis>1000 1000 >1000 100 100 100
168 HR
Cellosyl digested
Staphylococcus >1000 1000 100 100 100 100
aureus
8325/4 Cellosyl
digested
'I Streptococcus >1000 1000 >1000 100 100 10
mutans LTII
Cellosyl digested
', Bacillus megaterium>1000 >1000 >1000 100 100 1000
KM
I spore cortex
Cellosyl
' digested
Enterococcus faecalis>1000 >1000 >1000 100 100 100
NCTC 775 Cellosyl
digested
Staphylococcus 100 >1000 100 1000 100 100
epidermidis138
Cellosyl and
lysostaphin digested
i ~ ~ ~ ~ ~ ~ a
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
Conc.
of MAb
(pg/ml)
that
gave
reading
>0.1
at 450
nm.
PepG from: 702 PG 11- 11- 11- BB4/A4 BB4/A5
*
232.3 248.2 569.3
Listeria monocytogenes>1000 >1000 >1000 100 100 1000
EGD Cellosyl digested
Staphylococcus 100 >1000 >1000 1000 1000 1000
aureus
8325/4 Cellosyl
and
lysostaphin digested
I
Bacillus subtilis 168 HR was a gift from Howard Roger, University of Kent,
U.K.
Staphylococcus aureus 8325/4 was a gift from Richard Novick, Skirball
Institute, NY,
U.S.A.
Streptococcus mutans LTII was a gift from Roy Russell, University of
Newcastle, U.K.
Bacillus megaterium KM was a gift from Keith Johnstone, University of
Cambridge,
U.K.
Staphylococcus epidermidis 138 was a gift from Paul Williams, University of
Nottingham, U.K.
Listeria monocytogenes EGD was a gift from W. Goebel, University of Wurzburg,
Germany
[0134] Cellosyl digestion, which cleaves glycan strands, of any of the
PepG substrates abrogates binding of antibodies 702PG, MAb-11-232.3,
MAb-11-248.2, MAb-BB4/A4, and MAb-BB4/A5. Thus, these antibodies may
interact with an epitope that requires an intact glycan strand. The affinity
of
MAb-11-569.3, on the other hand, is unaffected by cellosyl digestion,
indicating that it may interact with an epitope that is not associated with
the
bond that is cleaved. The cellosyl/lysostaphin results further confirm the
single digest results.
[0135] Finally, S. aureus PepG has a higher level of O-acetylation on
glucosamine residues than PepG from B. subtilis, suggesting that this O-
acetylation may be important for the binding of antibodies 702PG, MAb-11-
232.3, and MAb-11-248.2, and may negatively affect the binding of MAb-
BB4/A4 and MAb-BB4/A5.
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
46
EXAMPLE 4
Binding of the Monoclonal Antibodies to LTA, PepG and Staphylococci
[0136] MAb-11-232.3, MAb-11-248.2, MAb-11-569.3, and MAb-99-
110FC12 IE4 were assayed for binding to S. aureus PepG, S. aureus LTA,
and to methanol-fixed S. aureus and methanol-fixed S. epidermidis. In
addition to those MAbs, a human/mouse chimeric anti-LTA antibody, referred
to as A110, was included in the assays as a positive control for LTA and S.
epidermidis binding. A description of the production and chimerization of
A110 can be found in U.S. Patent Application Serial No. 09/097,055, filed
June 15, 1998.
[0137] As shown in Table 7, MAb-11-232.3, 11-248.2 ascites, and 99-
110FC12 IE4 supernatant all bound strongly to S. aureus PepG. As
expected, A110, the anti-LTA antibody, does not bind to PepG.
Table 7
Binding of MAbs on Wells Coated with S. aureus Peptidoglycan
Purified11-232.311-569.3*A110 11-248.2 99-110FC12
AntibodyPurifiedPurifiedPurifiedAscitesAscites SupernatantIE4 sup.
(Ng/ml)Ms IgG3Ms IgG3 Hu IgG, DilutionMs IgM Dilution Ms IgM
3 3.674 0.449 0.086 100 3.903 10 3.789
1 3.642 0.311 0.077 300 4.000 30 3.983
0.33 3.659 0.160 0.069 900 4.000 90 3.974
0.11 3.085 0.104 0.066 2700 4.000 270 4.000
0.037 2.113 0.086 0.068 8100 3.902 810 3.858
None 0.074 0.069 0.103 None 0.059 None 0.070
* Negative anti-LTA Control
[0138] When tested on LTA, as shown in Table 8, only A110 showed
strong binding. No binding was obtained with MAb-11-232.3, MAb-11-569.3,
and 99-110FC12 IE4 supernatant. Slight cross-reactivity was obtained with
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
47
11-248.2 ascites at a 1:100 dilution, which may be due to high concentrations
of non-specific immunoglobulins in the ascites.
Table 8
Binding of MAbs on Wells Coated with S. aureus LTA
Purified11-232.311-569.3*A110 11-248.2 99-110FC12
AntibodyPurifiedPurifiedPurifiedAscitesAscites SupernatantIE4 sup.
(Ng/ml)Ms IgG3 Ms IgG3 Hu IgG,DilutionMs IgM Dilution Ms IgM
3 0.055 0.087 3.357 100 0.404 10 0.051
1 0.046 0.071 3.083 300 0.206 30 0.052
0.33 0.052 0.061 1.996 900 0.131 90 0.048
0.11 0.043 0.049 1.077 2700 0.092 270 0.047
0.037 0.045 0.045 0.411 8100 0.067 810 0.044
None 0.048 0.045 0.081 None 0.054 None 0.045
*Positive control for LTA
[0139] These data indicated that MAb-11-232.3 and MAb-11-248.2,
which were raised to whole UV-killed S. aureus, are specific for PepG on the
surface of the bacteria. MAb-11-569.3, which was also raised to UV-killed S.
aureus, shows much weaker binding to PepG, and no binding to LTA,
indicating that it may be specific for PepG, although it may also be specific
for
another surface antigen, but cross-react with PepG. As expected, MAb-99-
110FC12 IE4, which was raised to purified S. aureus PepG, binds to PepG,
but not LTA, quite strongly.
[0140] Each of the MAbs was also tested on plates coated with
methanol-fixed S. epidermidis strain Hay and S. aureus, as shown in Tables 9
and 10, respectively.
[0141 ] All of the antibodies, except MAb-99-110FC12 IE4, bound to S.
epidermidis strain Hay. Interestingly, MAb-11-569.3 bound to S. epidermidis
strain Hay more strongly than did MAb-11-232.3, although MAb-11-569.3
bound less strongly to PepG and S. aureus than did the MAb-11-232.3. This
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
48
result indicates that the antigen on the surface of S. aureusto which MAb-11-
569.3 was raised, which may or may not be PepG, is likely conserved
between S. aureusand S. epidermidis, resulting in strong binding by MAb-11-
569.3 to both bacteria. The IgM antibodies (from hybridomas 11-248.2 and
99-110FC12 IE4) were not tested against S. aureus, because the
immunoassay Protein A method used for the S. aureus-coated plates does
not work with IgM antibodies, which do not bind to protein.
Table 9
Binding of MAbs on Wells Coated with
methanol-Fixed S, epidermidis Strain Hay
Purified11-232.311-569.3*A110 11-248.2 99-110FC12
Ascites Supernatant
AntibodyPurifiedPurifiedPurified Ascites IE4 sup.
Dilution Dilution
(Ng/ml)Ms IgG3Ms IgG3Hu IgG, Ms IgM Ms IgM
3 0.761 3.044 1.412 100 2.905 10 0.078
1 0.518 2.672 1.324 300 2.809 30 0.075
0.33 0.301 1.733 1.058 900 2.749 90 0.073
0.11 0.150 0.476 0.664 2700 2.699 270 0.069
0.037 0.087 0.147 0.324 8100 2.288 810 0.065
None 0.054 0.052 0.089 None 0.056 None ~ 0.056
~ ~ ~ ~ ~ ~
*Anti-LTA
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
49
Table 10
Binding of MAbs on Wells Coated with methanol-Fixed S. aureus Type 5
Purified11-232.311-569.3*A110 11-248.2 99-110FC72
Ascites Supernatant
AntibodyPurifiedPurifiedPurified Ascites IE4 sup.
Dilution Dilution
(Ng/ml)Ms IgG3Ms Hu IgG, Ms IgM Ms IgM
IgG3
3 2.687 2.233 4.000 ND ND ND ND
1 2.371 1.083 4.000 N D N D N D N D
0.33 1.541 0.330 4.000 N D N D N D N D
0.11 0.596 0.144 3.671 ND ND ND ND
0.037 0.201 0.087 1.095 N D N D N D N D
None 0.052 0.052 0.049 ND ND ND ND
ND = not determined *Anti-LTA
[0142] As noted above, peptidoglycan is a cell wall component found in
Gram-positive bacteria. These assays show MAb-11-232.3, MAb-11-248.2,
and MAb-99-110FC12 IE4 bind PepG strongly and do not bind LTA, another
cell wall component common to Gram-positive bacteria. MAb-11-569.3 binds
PepG less strongly in an ELISA (Table 7) than it binds S. aureus type 5 in a
methanol-fixed ELISA (Table 10). Differences observed in the binding of the
MAbs may be due to the specific epitope bound by the MAbs and the
presentation of that epitope in protein and whole-bacteria ELISAs.
Alternatively, MAb-11-569.3 may bind to a different antigen, but cross-react
with PepG. MAb-11-232.3, 11-248.2 ascites, and MAb-11-569.3 also bind in
an ELISA assay to S. epidermidis strain Hay. Furthermore, MAb-11-232.3
and MAb-11-569.3 also bind in an ELISA assay to S. aureus (binding of 11-
248.2 ascites in the ELISA to S. aureus could not be determined). The lack of
binding of 99-110FC12 IE4 supernatant to S. epidermidis strain Hay in the
ELISA suggests that this antibody binds an epitope found on S. aureus PepG,
but not expressed or available for binding in S. epidermidis strain Hay.
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
EXAMPLE 5
The Opsonophaaocytic Activity of the Monoclonal Antibodies
[0143] Antibodies that bind to an antigen may not necessarily enhance
opsonization or enhance protection from infection. Therefore, a neutrophil
mediated bactericidal assay was used to determine the functional activity of
anti-PepG MAb against S. aureus and S. epidermidis strain Hay. Neutrophils
(PMNs) were isolated from adult venous blood by using PMN separation
medium (Robbins Scientific Cat. No. 1068-00-0). Forty microliters of PMNs
were added to round-bottomed wells of micro titer plates (approximately 2 X
106 cells per well) with approximately 3 x 104 mid-log phase bacteria. Human
serum, treated with Protein G and Protein L to remove antibodies that bind to
S. aureus and S. epidermidis strain Hay, was used as a source of active
complement. Forty microliters of antibody was added to the wells at various
dilutions and the plates were incubated at 37°C with constant, vigorous
shaking. Samples of 10 pl were taken from each well at zero time and after 2
hours of incubation. Each was diluted, vigorously vortexed to disperse the
bacteria, and cultured on blood agar plates overnight at 37°C to
quantitate the
number of viable bacteria.
[0144] Results are presented as percent reduction in numbers of
bacterial colonies observed compared to control samples. In an
opsonophagocytic bactericidal assay, 99-110FC12 IE4 supernatant was
active against S. aureus type 5, but not against S. epidermidis strain Hay as
shown in Table 11.
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
51
Table 11
Opsonophagocytic Activity of 99-110FC12 IE4 supernatant
Percent Killed
Antibody S. aur. S. epi.
Dilution t a 5 Ha
neat+PMN+C 84 0
1:2 + PMN + C 80 N.D.
1:4+PMN+C 68 0
PMN + C 30 9
MAb alone - 0 0
N.D. = not determined
[0145] Hybridoma 99-110FC12 IE4 was produced by immunization of
mice with PepG, while hybridomas 11-232.3, 11-248.2, and 11-569.3, were
produced by immunizing mice with UV-inactivated whole S. aureus. Each of
the anti-PepG MAbs from the hybridoma lines was tested for activity in the
opsonophagocytic bactericidal assay. In addition, A110, which binds LTA,
was also included in the assay. The MAbs produced by 11-232.3 and 11-
569.3 are mouse IgGs, kappa light chain antibodies, and were purified before
use. A110, which is a human/mouse chimeric antibody with a human IgG1
and a kappa light chain, was also purified before use. MAb-99-110FC12 IE4
and MAb-11-248.2 are mouse IgM, kappa light chain antibodies and were
used as either cell culture supernatant (99-110FC12 IE4) or as ascites (11-
248.2). Opsonic studies were performed to determine if the MAbs enhanced
phagocytosis and killing of both groups of staphylococci.
[0146] As shown in Table 12A, each of the anti-PepG antibodies
demonstrated enhanced killing of S. aureus. When PMNs were mixed with
complement but without antibody, killing of the S. aureus was less than 20%.
However, addition of MAb-11-232.3 or MAb-11-569.3 at 100 pg/ml resulted in
killing of 76% and 82%, respectively. The use of undiluted ascites from 11-
248.2 (a mouse IgM) resulted in killing of 89%, while 75% killing was obtained
with neat supernatant from 99-110FC12 IE4 (also a mouse IgM).
Surprisingly, although A110 binds strongly to S. aureus LTA (Table 8), and to
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
52
methanol-fixed S. aureus (Table 10), it shows very weak opsonization of S.
aureus in this assay.
Table 12A
Opsonophagocytic Killing of S, aureus Type 5 By Monoclonal
Antibodies
Antibody or Conc. % Killed
Target
Hybridoma Isotype (Ng/ml) S.
Antigen I
ID or Dilutionaureus
I
A110 Human IgGi, LTA 300 9
kappa
100 23
33.3 20
MAb-11-232.3 Mouse IgG3, Peptidoglycan100 76
kappa
33.3 63
i
MAb-11-569.3 Mouse IgG~, Peptidoglycan100 82
kappa
' ~ ~ 33.3 53
11-248.2 Mouse IgM, PeptidoglycanNeat 89
kappa
ascites 1:4 49
1:16 49
99-110FC121E4 Mouse IgM, PeptidoglycanNeat 75
kappa
supernatant 1:2 51
Background killing (PMNs and complement without antibody) was less than 20%
for all
assays
[0147] Previous assays have demonstrated stronger opsonization of S.
aureus by M110, the mouse monoclonal antibody from which A110 is derived
(Table 12B and U.S. Patent Application Serial No. 09/097,055). We believe
that the difference in activity between A110 and M110 is due to dosage
effects in the assays, rather than activity differences between the chimeric
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
53
and nonchimeric antibodies. As demonstrated in Table 13, A110 retains its
activity against S. epidermidis.
Table 12B
Opsonophagocytic Killing of S, aureus Type 5 by M110
Group Ab % Killed % Killed
Description DilutionS. epidermidisS. aureus
C' only 0.0 0.0
PMN only 0.0 0.0
PMN + C' No 49.5 53.7
Ab
PMN+Ab+C' 10 - 83.3
40 - 78.9
80 100.0 61.0
(0148] When S. epidermidis strain Hay was used as the target
organism, the results for MAb-11-232.3, 11-248.2 ascites, and MAb-11-569.3
were similar to those obtained with S. aureus type 5, as shown in Table 13.
At 300 Ng/ml, 66% and 83% killing was obtained with MAb-11-232.3 and
MAb-11-569.3, respectively. 95% killing was obtained with neat ascites from
hybridoma 11-248.2. However, no killing was obtained with supernatant from
99-110FC12 IE4, which is consistent with its very poor binding to methanol-
fixed S. epidermidis in Table 9. Finally, strong killing (>98%) was obtained
with A110 at all doses tested (11.1 pg/ml - 300 Ng/ml), and background
killing, obtained by mixing PMNs with complement, but without antibody, was
22%.
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
54
Table 13
Opsonophagocytic Killing of S. epidermidis Strain Hay
By Monoclonal Antibodies
Antibody Conc. % Killed
or
Target
Hybridoma Isotype (pg/ml) Strain
Antigen
ID or DilutionHay
A110 Human IgG~, LTA 300 100
kappa
(S. epi. 100 99
strain Hay) 33.3 98
11.1 100
MAb-11-232.3Mouse IgG3, Peptidoglycan300 66
kappa
100 41
33.3 41
11.1 51
MAb-11-569.3Mouse IgG3, Peptidoglycan300 83
kappa
100 74
33.3 61
11.1 59
11-248.2 Mouse IgM, kappaPeptidoglycanneat 95.
ascites 1:2 31
1:4 24
99-110FC121E4Mouse IgM, kappaPeptidoglycanneat 0
supernatant 1:4 1
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
Background killing (PMNs and complement without antibody) was less than 22%
for all assays.
[0149] These data show that the MAb-11-232.3, 11-248.2 ascites, and
MAb-11-569.3 can enhance phagocytosis and killing of S. aureustype 5 and
S. epidermidis strain Hay. The data also show that A110 is less effective
against S. aureus than MAb-11-232.3, 11-248.2 ascites, and MAb-11-569.3,
but is highly active against S. epidermidis strain Hay. The 99-110FC12 IE4
supernatant is active against S. aureus, but not S. epidermidis strain Hay.
These data demonstrate a strong correlation between binding to methanol-
fixed bacteria and the ability to enhance opsonization of those bacteria, with
the notable exception of A110, which, although it binds strongly to methanol-
fixed S. aureus, is only weakly opsonic against live S. aureus.
EXAMPLE 6
Nasal Colonization Assay
[0150] Using a staphylococcal nasal colonization model in mice, we
demonstrated that intranasal instillation of the MAb-11-232.3 significantly
reduces nasal colonization.
[0151 ] To ensure that the blocking of nasal colonization obtained with
the test MAbs was specific for anti-staphylococcal antibodies, we examined
the capacity of an irrelevant control chimeric IgG to block staphylococcal
nasal colonization. The control was Medi 493, a chimeric IgGi MAb against
RSV (Medlmmune, Inc.). In the same experiment, we also tested MAb-11-
232.3 for its capacity to block colonization.
[0152] Streptomycin resistant S. aureus type 5 (SAS, 1 to 3x1 O8
bacteria/mouse) was preincubated for 1 hour in saline (0.9% NaCI in water),
saline containing MAb-11-232.3 (2-3 mg purified IgG per mouse dose of 1-
3x108 bacteria) or saline containing Medi 493 (2-3 mg purified IgG/mouse
dose of 1-3x108 bacteria). Following preincubation, the bacteria were pelleted
and resuspended in saline (10 pl/mouse dose), , in saline containing MAb-11-
232.3 (10 pl/mouse dose), or in saline containing Medi 493 (10 pl/mouse
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
56
dose). Eight or nine mice each were intranasally instilled with SA5 in saline,
SA5 in MAb-11-232.3, or SA5 in Medi 493. After seven days, the mice were
sacrificed and the nasal tissue dissected and plated on Columbia blood agar
and tryptic soy agar containing streptomycin to determine colonization. Table
14 shows that MAb-11-232.3 reduced staphylococcal nasal colonization in
mice, but that an anti-RSV MAb, Medi 493, had no effect.
Table 14
Nasal Colonization Assay against S, aureus Type 5
Number of mice Average number
of '~
2x10$ SA5 instilled
with:
colonized colonies recovered
Sterile Saline 9/9 70
MAb-11-232.3 (2 mg/mouse
3/8 8
dose)
Medi 493(2 mg/mouse '
9/9 137
dose)
[0153] Specifically, Table 14 shows that both the number of mice
colonized, and the number of colonies, are reduced in an antibody-specific
manner by anti-S. aureus surface antigen-specific MAb-11-232.3. All of the
mice in the saline and the irrelevant chimeric IgG control groups were
colonized with S. aureus, but only three out of eight mice were colonized in
the MAb-11-232.3 group. This reduction in the number of mice colonized
demonstrates that the administered MAb 11-232.3 is protective because five
of the - eight mice are free from bacterial colonization. The number of
colonies recovered per mouse in the MAb-11-232.3 group was also
dramatically reduced as compared with the other two groups. The saline
control group exhibited an average of 70 colonies in the nine mice colonized
and the irrelevant antibody control group exhibited even greater number of
average colonies, 187, in the nine mice colonized. In contrast, only three of
the eight animals in the treated group exhibited any sign of colonization and
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
57
that level of colonization, an average of 8 colonies per mouse nose, was
greatly reduced. Such a reduction in colonies recovered is similarly
profylactically beneficial in vivo. Therefore, the administered anti-PepG MAb
is protective from S. aureus nasal colonization. These data also demonstrate
that the effect is specific for anti-staphylococcal surface antigen MAbs, and
is
not just a general consequence of antibody binding through the Fc portion of
the antibody to surface Protein A on the staphylococci. Additional MAbs
against S. aureus peptidoglycan, MAb-11-248.2 and MAb-11-569.3, may
demonstrate similar inhibitory effects on S. aureus colonization as described
above. Studies are in progress to affirm the effectiveness of MAb-11-248.2
and MAb-11-569.3 in the in vivo mouse model described above.
EXAMPLE 7
Subclonina of Hybridoma 11-232.3 to Produce Hybridoma 11-232.3 IE9
[0154] QED cell culture 11-232.3 was cloned by limiting dilution.
Briefly, the cells were diluted to a concentration of 225 viable cells per ml.
One ml of this suspension was added to 36 ml of RPMI 1640. The cell
suspension was further diluted by the addition of 7.5 ml of FBS, 0.5 ml of 10
mg/ml kanamycin solution (Gibco BRL Cat #15160-054) and 5 ml of
Hybridoma SFM medium (Gibco BRL Cat #12045-084). The final volume of
the suspension was 50 ml, resulting in a cell concentration of 4.5 cells/ml.
Two hundred microliters of the cell suspension was added to each well of two
96-well tissue culture dishes. The cultures were incubated for 10 days at
37°C in a humidified atmosphere of 5% C02 in air. The presence of
clones
was verified by microscopic observation of single foci of cells in individual
wells. Approximately 40% of all wells had growing clones of 11-232.3. When
tested by ELISA, all supernatants bound peptidoglycan. Four cultures, 11-
232.3 -IG9, -IE9, -IH7 and -IB6 were expanded and cryopreserved. The
binding of these four clones to peptidoglycan and LTA is shown in Table 15.
The MAb produced by hybridoma 11-232.3 IE9 was subsequently designated
M 130.
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
58
TABLE 15
Binding of 11-232.3 subclones to LTA and PepG
Supernatant Absorbance Absorbance
Culture ID
Dilution of PepG on LTA
232.3 uncloned2 4.000 0.090
232.3 uncloned2 4.000 0.084
232.3169 2 3.384 0.084
232.31 E9 2 3.141 0.100
232.31 H7 2 2.863 0.092
232.31 B6 2 3.570 0.086
Buffer Only 0.090 0.075
[0155] As shown in Table 16, the monoclonal antibody produced by
hybridoma 11-232.3 IE9, M130, bound S. aureus in the LBE assay.
Surprisingly, M130 did not bind to S. epidermidis strain Hay in this assay,
although it shows opsonic activity against S. epidermidis strain Hay (Table
7).
The opsonic assay uses antibody at a concentration of up to 300 Ng/ml, while
the LBE assay uses concentrations of up to 3 frg/ml, so the difference in the
activity of M130 in the two assays may result from the large difference in
concentrations used.
Table 16
Binding of MAb M130 by LBE Assay
AntibodySA5 SA5 SA8 S. hemo S.
Ng/ml USU ATCC 49521 ATCC 12605 ATCC 43252 epi
Hay
3 2.981 2.319 2.365 0.133 0.101
1 1.765 1.457 1.313 0.120 0.082
0.33 0.633 0.641 0.441 0.120 0.072
0.11 0.252 0.248 0.155 0.112 0.076
I
Buffer 0.100 0.808 0.110 0.120 0.072
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
59
EXAMPLE 8
Cloning and Seguencing of the M130 Variable regions
[0156] Total RNA was isolated from 2x106 frozen IE9 (232-3)
hybridoma cells using the Midi RNA Isolation kit (Qiagen) following the
manufacturer's procedure. The RNA was dissolved in 10 mM Tris, 0.1 mM
EDTA (pH 8.4) containing of 0.25 p,g/p.l Prime RNase Inhibitor (0.03 U/p,g;
Sigma).
[0157] Figure 1 shows the strategy for cloning the variable region
genes. Table 17 shows the sequences of the oligonucleotide primers used for
the procedures (SEQ ID NOS: 5-12). The total RNA (2 p.g) was converted to
cDNA by using Superscript II-MMLV Reverse Transcriptase (Life
Technologies) and mouse Kappa-specific primer (JSBX-18; SEQ ID NO: 8;
Sigma-Genosys) and a mouse heavy chain-specific primer (JSBX-25A; SEQ
ID NO: 9; Sigma-Genosys) according to the manufacturer's procedures (see
Table 12 for primer sequences). The first strand cDNA synthesis products
were purified using a Centricon-30 concentrator device (Amicon). Of the 40 pl
of cDNA recovered, 5 p,l was used as template DNA for PCR. PCR
amplification reactions (50 p.l) contained template DNA, 30 pmoles of the
appropriate primers (JSBX-11A, -12A and -18 for light chains; SEQ ID NOS:
6-8; JSBX-5 and -25A for heavy chains; SEQ ID NO: 5 and SEQ ID NO: 9),
2.5 units of ExTaq polymerase (PanVera), 1 x ExTaq reaction buffer, 200 p,M
each dNTP, 2mM MgCl2. The template was denatured by an initial incubation
at 96°C for 3 min. The products were amplified by 30 thermal cycles of
96°C
for 1 min., 60°C for 30 sec., 72°C for 30 sec. The PCR products
from the
successful reactions were purified using the Nucleospin PCR Purification
system (Clontech) as per manufacturer's procedure.
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
TABLE 17
Oligonucleotide primers used
SE(~
ID
Name LengthDescription Oligo Sequence NO:
mouse HCV front
primer for
5
JSBX-S40 MegaVector TGTTTTCGTACGTCTTGTCCCAGGTHCARCTRMARSARTC
JSBX- mLCV Front
for
6
11A 32 MegaVector TACCGTACCGGTGAYATYMAGATGACMCAGWC
JSBX- mLCV Frost
for
7
12A 32 MegaVector TACCGTACCGGTSAAATTGV~1RCTSACYCAGTC
Mouse Rappa
Constant reverse
JSBX-1823 primer GCACCTCCAGATGTTAACTGCTC
JSBX- Mouse IgG reverse
25a 22 primer (123-144)CTGGACAGGGMTCCARAGTTCC
Mouse Back
Primer
1
JSBX-2738 for MegaVectorATAGGATTCGAAAAGTGTACTTMCGTTTCAGYTCCARC
M130 HCV front
primer for
11
JSHX-4423 MegaVector TGTTTTCGTACGTCTTGTCCCAG
M130 HCV back
primer for
12
JSHX-4535 MegaVector TTTTCTGAATTCTGCAGAGACAGTGACCAGAGTCC
Note: each of the following letters is used to denote an equal mixture of
nucleotides
in that position: B = C, G, or T; D = A, G, or T; K = G or T; M = A or C; R =
A or G; S
=Core; V=A, C, or G; W=AorT;Y=CorT.
[0158] The PCR products (approximately 400 base pairs) were then
cloned into bacterial vector pGEM T (Promega), a T/A style cloning vector,
following the manufacturer's procedures using a 3:1 insert to vector molar
ratio. One half (5 ~.I) of the ligation reactions were used to transform
Ultracompetent XL1 Blue cells (Stratagene) as per the manufacturer's
procedure. Bacterial clones containing plasmids with DNA inserts were
identified using diagnostic restriction enzyme digestions with Dralll and
BsiWl
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
61
(for heavy chain clones) or Dralll and EcoRV (for light chain clones) (New
England Biolabs). Plasmids containing inserts of the appropriate size 0400
bp) were then sequenced. The pGEM vector containing the M130 heavy
chain variable region is referred to as pJSBl8-6, and the pGEM vector
containing the M130 light chain variable region is referred to as pJSB4-4. The
final consensus DNA sequence of the light and heavy chain variable regions
is shown in Figure 2 (SEQ ID NO: 2 and SEQ ID NO: 4, respectively).
EXAMPLE 9
Cloning of Mouse/Human Chimeric Antibody A130
[0159] The heavy and light chain variable regions of M130 were then
subcloned into a mammalian expression plasmid vector for production of
recombinant chimeric mouse/human antibody molecules under the control of
CMV transcription promoters. The variable region of M130 is fused directly to
the human IgGi constant domain. The light chain of M130, on the other hand,
has a mouse Kappa intron domain 3' of the variable region coding sequence.
After splicing, the variable region becomes fused to a human Kappa constant
region exon. The selectable marker for both vectors in mammalian cells is
Neomycin (G418).
[0160] The variable region gene fragments were re-amplified by PCR
using primers that adapted the fragments for cloning into the expression
vector (Figure 1, Table 17). The heavy chain front primer (JSBX-44; SEQ ID
NO: 11 ) includes a 5' tail that encodes the C-terminus of the heavy chain
leader and a BsiUVI restriction site for cloning, while the heavy chain
reverse
primer (JSBX-45; SEQ ID NO: 12) adds a 3' EcoRl restriction site for cloning.
This results in the addition of two amino acids, glutamine (E) and
phenylalanine (F) between the heavy chain variable region and the human
IgGi constant region.
[0161 ] The light chain front primer (JSBX-11 A; SEQ ID N0: 6)
introduces a 5' tail that encodes the two C-terminal amino acids of the light
chain leader and an Agel restriction site for cloning purposes. The light
chain
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
62
reverse primer (JSBX-27; SEQ ID NO: 10) adds a 3' DNA sequence for the
joining region-Kappa exon splice junction followed by a BstBl restriction site
for cloning. PCRs were performed as described above, using pJSBl8-6 as a
template for the heavy chain and pJSB4-4 as a template for the light chain.
Following a three minute incubation at 96°C the PCR perimeters
were 30
thermal cycles of 58°C for 30 sec., 70°C for 30 sec., and
96°C for 1 min.
[0162] The heavy chain PCR product was digested with BsilM and
EcoRl (New England Biolabs), purified using a Nucleospin PCR Purification
column (Clontech), per the manufacturer's instructions, and ligated into
BsNVIlEcoRllPfIMI digested and gel-purified pJRS383, using the Takara
Ligation Kit (Panvera), per the manufacturer's procedure. The ligation mix
was then transformed into XL1 Blue cells (Stratagene); clones were selected
and screened for the correct insert, resulting in mammalian expression vector
pJSB22 (Figure 3).
[0163] The light chain PCR product (approximately 350 base pairs) was
digested with Agel and BstBl (New England Biolabs), purified using a
Nucleospin PCR Purification column (Clontech), as described by the
manufacturer. This fragment was then ligated into pJRS384 that had been
AgellBstBllXcml digested and gel-purified, using the Takara Ligation Kit
(Panvera), per the manufacturer's procedure. The ligation mix was then
transformed into XL1 Blue cells (Stratagene); clones were selected and
screened for the correct insert, resulting in mammalian expression plasmid
pJSB6.1 (see Figure 4).
[0164] Combining the two individual plasmids then made a single
expression construct containing both the light and heavy chain expression
cassettes. The plasmid pJSB6.1 was digested with BamM and Nhel (New
England Biolabs) and purified using a Nucleospin PCR Purification column
(Clontech), as described by the manufacturer. The plasmid pJSB22 was
digested with Bgnl and Nhel (New England Biolabs), separated on an agarose
gel and the fragment containing the heavy chain expression domain was
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
63
isolated using a Nucleospin Gel Fragment DNA Purification column
(Clontech). These fragments were ligated together using the Takara Ligation
Kit (Panvera) following the manufacturer's procedure and transformed into
XL1 Blue cells (Stratagene). The resulting bi-cistronic expression vector,
pLG1-MEGA, was then transfected into mammalian cells for A130 chimeric
antibody production, after sequence confirmation of the variable regions
(Figure 5).
Example 10
Transient Production of Recombinant Chimeric Mouse/human A130
Antibody
[0165] The plasmid pLG1-MEGA was transfected into COS-7 (ATCC
no. CRL 1651 ) cells using Superfect (Qiagen) in 6 well tissue culture dishes
as described by the manufacturer. After two days the supernatant was
assayed for the production of chimeric antibody and for the capability for the
expressed antibody to bind to S. aureus peptidoglycan antigen as follows.
[0166] 8-well strips (Maxisorp F8; Nunc, Inc.) were coated with a 1:500
dilution in PBS of goat anti-human Fc (Pierce). The plates were then covered
with pressure sensitive film and incubated overnight at 4°C. Plates
were then
washed once with 1 X Wash solution (KPL cat. no. 50-63-01 ). One hundred
microliters of culture supernatant dilutions were then applied to duplicate
wells
and allowed to incubate for 60 minutes on a plate rotator at room temperature.
The plates were washed seven times with Wash solution. A goat anti-human
kappa-HRP (Zymed) conjugate was diluted 1:800 in the sample/conjugate
diluent (0.02 M Tris pH 7.4, 0.25 M NaCl2, 2% gelatin, 0.1 % Tween-20). One
hundred microliters was added to the samples, and then incubated on a plate
rotator for 60 minutes at room temperature. The samples were washed seven
times, as above and then incubated with 100 pUwell of TMB substrate (BioFx,
cat. no. TMBW-0100-01 ) for <1 minute at room temperature. The reaction
was stopped with 100 p,Uwell of TMB Stop reagent (BioFx, cat. no. STPR-
0100-01 ) and the absorbance value at 450 nm was determined using an
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
64
automated microtiter plate ELISA reader (Spetramax Plus; Molecular Devices,
Inc.). Figure 6 shows that the mouse/human chimeric A130 antibody is bound
by a goat anti-human IgG kappa antibody, indicating that transfection of cells
with the pLG1-MEGA plasmid results in the cells producing a molecule
containing both human IgG and Kappa domains.
[0167] The supernatants were then assayed for the ability of the
expressed antibodies to bind to peptidoglycan. 8-well strips (Maxisorp F8;
Nunc, Inc.) were coated with a 5 pg/ml solution of S. aureus peptidoglycan
(prepared by the method set forth in Example 2) in carbonate coating buffer,
pH 9.5 (0.1 M sodium bicarbonate) overnight at 4°C. Plates were washed
once with PBS. One hundred microliters of culture supernatant dilutions were
applied to duplicate wells and allowed to incubate for 60 minutes on a plate
rotator at room temperature. The plates were washed seven times with Wash
solution. One hundred microliters of Goat anti-Human IgG H+L-HRP (Zymed)
diluted 1:4000 in sample/conjugate diluent was added to the samples, and the
plates were incubated on a plate rotator for 60 minutes at room temperature.
The samples were washed seven times with Wash buffer and then incubated
with 100 p,Uwell of TMB substrate (BioFx) for 10-15 minutes on a plate rotator
at room temperature. The reaction was stopped with 100 ~Uwell of TMB Stop
reagent (BioFx) and the absorbance value at 450 nm was determined using
an automated microtiter plate ELISA reader (Spectramax Plus, Molecular
Devices).
[0168] As a positive control, the original mouse monoclonal antibody
M130 was used, and assayed with a 1:2000 dilution of Goat anti-Mouse Fc-
HRP conjugate. Figure 7 shows that the transfection of cells with the pLG1-
MEGA plasmid results in the cells producing a molecule that binds to S.
aureus peptidoglycan. These results suggest that the mouse/human chimeric
antibody, A130, retains the peptidoglycan binding ability of the mouse
monoclonal antibody M130, from which it was derived.
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
EXAMPLE 11
Specific Binding of the Monoclonal Antibodies to PepG
[0169] To confirm that the monoclonal antibodies are specific for PepG,
and do not bind to a contaminant in the PepG preparation used for the ELISA
assay shown in Table 7, sandwich assays were conducted. In brief, multiwell
plates were coated with "capture" antibodies specific for PepG, LTA, or an
unknown antigen; PepG was then added to the wells and bound by the
antibodies; and then a "detection" antibody was added to measure its affinity
for the PepG captured by the capture antibody.
[0170] Specifically, monoclonal antibodies M110, M130, MAb-11-230.3,
MAb-11-232.3, MAb-11-391.4, MAb-11-557.3, MAb-11-564.4, MAb-11-580.5,
and MAb-11-586.3 were diluted to 3 pg/ml in PBS. Hybridomas 11-230.3, 11-
232.3, 11-391.4, 11-557.3, 11-564.4, 11-580.5, and 11-586.3 were derived
from mice that had been immunized with whole UV-killed S. aureus. As set
forth above, MAb-11-230.3, MAb-11-232.3, MAb-11-557.3, MAb-11-564.4,
and MAb-11-586.3 have been previously shown to bind to PepG, while MAb-
11-391.4 binds to LTA, and MAb-11-580.5 binds to an unknown epitope on S.
aureus. These MAbs were used to coat four columns of Nunc Maxisorp
Stripwells (Nunc Cat # 469949), and are referred to as "capture" antibodies.
Coating of each capture antibody was accomplished by adding 100 pl of the 3
Ng/ml solution to the appropriate wells and incubating overnight (18-26 hours)
at room temperature. The unbound material was then removed from the wells
by washing four times with PBS-T. For each capture antibody, S. aureus
peptidoglycan (prepared by S. Foster as described in Example 2), diluted to
10 Ng/ml in PBS-T, was added to the wells of two of the four columns, and
PBS-T without peptidoglycan was added to the wells of the other two
columns.
[0171 ] The wells were incubated for 30-60 minutes at room
temperature and washed four times with PBS-T. The wells then received 100
NI of A130 at the concentrations indicated in Table 17 (2-fold dilutions from
5
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
66
Ng/ml to 0.078 Ng/ml). An anti-PepG monoclonal antibody, A130, which is
described above, was the "detection" antibody and was diluted in PBS-T with
0.1 % human serum without IgG, IgA and IgM (Axell Cat BYA20341, Lot
H2415). The detection antibody was expected to react with any of the PepG
bound to the capture MAbs used for coating. Thus, it was expected that
PepG would not be captured in wells coated with MAbs M110 and 391.4,
which are specific for LTA, and in wells coated with MAb-11-580.5, a MAb of
unknown specificity.
[0172] Following another 30-60 minute incubation, the wells were
washed with PBS-T and each well received 95 NI of HRP-conjugated gamma-
specific goat anti-human IgG (Zymed Cat 62-8420), diluted 1:6000 in PBS-T.
After 30-60 minutes, the wells were washed with PBS-T and 100 pl of TMB
substrate solution was added to each well (BioFX Cat TMBW-0100-01 ). The
reaction was allowed to proceed for 15 minutes at room temperature in the
dark and was stopped by addition of 100 pl TMB Stop Reagent to each well
(BioFX Cat STPR-0100-01 ). The absorbance of each well was measured
using a Molecular Devices Vmax microplate reader with a 450 nm filter.
[0173] Table 18 shows the results of the capture assay using a battery
of capture MAbs, followed by PepG, and then A130 as the detection MAb.
After coating a well with MAb-11-230.2, MAb-11-232.3, MAb-11-557.3, MAb-
11-564.4, or MAb-11-586.3, and incubating with PepG, the detection antibody,
A130, binds to the captured PepG on the plate. If an anti-LTA antibody, such
as that produced by hybridoma 391.4, or M110, is used to capture, A130 does
not bind, presumably because the capture antibody failed to bind PepG.
Furthermore, MAb-11-580.5, which is of unknown specificity, also fails to
capture significant PepG, as evidenced by the lack of binding by A130. As a
positive control, if M130, which has identical variable regions as A130, is to
capture PepG, A130 binds strongly to the plate. These results suggest that
A130 binds to PepG, and not to a contaminant in the PepG preparation,
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
67
because capturing PepG with a battery of a different antibodies that are
believed to bind to PepG results in binding of A130 to the captured material.
Table 18
PepG Sandwich Assay:
Capture with anti-S, aureus MAbs and Detection with A130
ca ture MAb ~ MAb-11-230.3 MAb-11-232.3 MAb-11-391.4
-->
detection (anti-PepG) (anti-PepG) (anti- LTA)
MAb ~,
A130 (Ng/ml) +PepG -PepG +PepG -PepG +PepG -PepG
0.513 0.096 0.529 0.077 0.085 0.072
2.5 0.576 0.090 0.529 0.073 0.088 0.069
1.25 0.703 0.091 0.557 0.074 0.087 0.068
0.625 0.561 0.091 0.526 0.072 0.085 0.074
0.3125 0.493 0.093 0.450 0.072 0.084 0.072
0.158 0.420 0.091 0.499 0.066 0.085 0.072
0.078 0.322 0.090 0.303 0.071 0.078 0.068
Buffer 0.090 0.090 0.071 0.081 0.063 0.076
ca to re MAb MAb-11 -557.3MAb-11 -564.4MAb-11 -580.5
--~
detection (anti-PepG) (anti-PepG) (unknown)
MAb
A130 (Ng/ml) +PepG -PepG +PepG -PepG +PepG -PepG
5 0.599 0.079 0.530 0.095 0.151 0.079
2.5 0.610 0.076 0.564 0.093 0.159 0.082
1.25 0.588 0.079 0.560 0.095 0.158 0.086
0.625 0.612 0.079 0.522 0.093 0.163 0.086
0.3125 0.593 0.079 0.498 0.091 0.158 0.081
0.156 0.525 0.078 0.432 0.091 0.151 0.085
0.078 0.434 0.080 0.387 0.095 0.139 0.083
Buffer 0.081 0.078 0.093 0.090 0.080 0.088
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
68
ca ture MAb MAb-11-586.3 M 110 M 130
->
detection (anti-PepG) (anti- LTA) (anti-PepG)
MAb
A130 (Ng/ml) +PepG -PepG +PepG -PepG +PepG -PepG
0.635 0.088 0.182 0.172 0.723 0.072
2.5 0.661 0.085 0.172 0.161 0.666 0.072
1.25 0.636 0.096 0.172 0.163 0.633 0.071
0.625 0.524 0.085 0.169 0.156 0.568 0.070
0.3125 0.599 0.085 0.169 0.153 0.467 0.083
0.156 0.526 0.084 0.167 0.151 0.351 0.070
0.078 0.411 0.084 0.163 0.149 0.269 0.070
Buffer 0.083 0.084 0.146 0.146 0.067 0.068
[0174] To confirm that the anti-PepG antibodies do not bind to possible
LTA contamination in the PepG preparation, a similar sandwich assay was
conducted in which A110, which binds to LTA, was used as the capture
antibody, LTA was bound to the capture antibody, and detection antibodies
were then added to measure their binding to the captured LTA.
[069] Nunc Maxisorp Stripwells (Nunc Cat # 469949) were coated with
100 pl of 3 pg/ml A110 in PBS and incubated overnight (18-26 hours) at room
temperature. After overnight incubation, unbound material was removed from
the wells by washing four times with PBS-T. Replicate wells then received
100 pl of LTA solution (Sigma Cat #2515 diluted to 1 Ng/ml in PBS-T) or PBS-
T alone. The wells were then incubated for 30-60 minutes at room
temperature and washed four times with PBS-T.
[070] The wells received 100 NI of an antibody selected from
monoclonal antibodies M 110, M 130, MAb-11-230.3, MAb-11-232.3, MAb-11-
391.4, MAb-11-557.3, MAb-11-564.4, MAb-11-580.5, and MAb-11-586.3,
titrated in 2-fold dilutions from 5 Ng/ml to 0.078 Ng/ml in PBS-T with 0.1
human serum without IgG, IgA and IgM (Axell Cat BYA20341, Lot H2415).
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
69
Each MAb was titrated in four columns, two of which had received LTA and
two of which had received PBS-T alone. These mouse MAbs served as
detection antibodies, analogous to the A130 detection antibody used in Table
18.
[0175] Following another 30-60 minute incubation, the wells were again
washed with PBS-T and each well received 95 NI of HRP-conjugated gamma-
specific anti-mouse IgG (Jackson Immunoresearch Cat 115-035-164), diluted
1:10,000 in PBS-T. After 30-60 minutes, the wells were washed with PBS-T
and 100 pl of TMB substrate solution was added to each well (BioFX Cat
TMBW-0100-01 ). The reaction was allowed to proceed for 15 minutes at
room temperature in the dark and stopped by addition of 100 pl TMB Stop
Reagent to each well (BioFX Cat STPR-0100-01 ). The absorbance of each
well was, measured using a Molecular Devices Vmax microplate reader with a
450 nm filter.
[0176] Table 19 shows the results of the sandwich assay using A110
as the capture antibody, followed by LTA, and then a battery of detection
MAbs. This assay confirms that the antibodies that are believed to bind to
PepG do not in fact bind to possible LTA contaminants in the PepG
preparation. A110 was used as the capture antibody to capture LTA on the
plate. MAb-11-230.2, MAb-11-232.3, MAb-11-557.3, MAb-11-564.4, MAb-11-
586.3, and M130, all of which bind to PepG, fail to bind to the captured LTA
on the plate. As would be expected, the anti-LTA antibodies, including those
produced by hybridoma 391.4, and M110, show strong binding to the
captured LTA. Finally, MAb-11-580.5, which is of unknown specificity, does
not bind to the captured LTA. These results further confirm that the anti-PepG
monoclonal antibodies, including M130, do not bind to LTA.
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
Table 19
LTA Sandwich Assay: Capture with A110, Detection with anti-S. aureus
MAbs
detection MAb MAb-11-230.3 MAb-11-232.3 MAb-11-391.4
--> (anti-PepG) (anti-PepG) (anti-LTA)
detection MAb +PepG -PepG +PepG -PepG +PepG -PepG
conc. N /ml
5 0.063 0.063 0.066 0.066 1.751 0.118
2.5 0.059 0.080 0.073 0.065 0.930 0.090
1.25 0.059 0.061 0.064 0.067 0.479 0.082
0.625 0.057 0.058 0.063 0.065 0.277 0.072
0.3125 0.056 0.059 0.060 0.063 0.160 0.067
0.156 0.059 0.061 0.061 0.066 0.113 0.066
0.078 0.057 0.058 0.061 0.062 0.086 0.061
Buffer 0.055 0.058 0.066 0.064 0.060 0.063
detection MAb MAb-11-557.3 MAb-11-564.4 MAb-11-580.5
--> (anti-PepG) (anti-PepG) (unknown)
detection MAb +PepG -PepG +PepG -PepG +PepG -PepG
conc. /ml
5 0.064 0.058 0.072 0.074 0.066 0.066
2.5 0.056 0.056 0.065 0.067 0.064 0.063
1.25 0.058 0.057 0.086 0.066 0.062 0.065
0.625 0.056 0.061 0.063 0.063 0.059 0.061
0.3125 0.057 0.055 0.062 0.061 0.064 0.063
0.156 0.058 0.059 0.060 0.062 0.059 0.062
0.078 0.056 0.059 0.061 0.060 0.057 0.059
Buffer 0.054 0.056 0.084 0.061 0.054 0.059
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
71
detection MAb MAb-11-586.3 M 110 M 130
-~ (anti-PepG) (anti-LTA) (anti-PepG)
detection MAb +PepG -PepG +PepG -PepG +PepG -PepG
conc. p /ml
0.060 0.062 0.743 0.059 0.068 0.070
2.5 0.059 0.060 0.509 0.059 0.061 0.063
1.25 0.061 0.062 0.362 0.062 0.060 0.063
0.625 0.061 0.062 0.257 0.060 0.059 0.060
0.3125 0.060 0.059 0.179 0.060 0.055 0.058
0.156 0.061 0.061 0.133 0.060 0.057 0.057
0.078 0.058 0.057 0.100 0.058 0.054 0.057
Buffer 0.060 0.057 0.055 0.059 0.055 0.058
[0177] Finally, to further confirm that M110 does not capture a
contaminant in the PepG preparation that is recognized by M130, the
following sandwich assay was performed. M110 was bound to plates as the
capture antibody, LTA or PepG was then bound to the plates, followed by
either A110 or A130 as the detection antibody.
[0178] Nunc Maxisorp Stripwells (Nunc Cat # 469949) were coated
with 100 NI of M110 at 3 pg/ml and incubated overnight (18-26 hours) at room
temperature. The unbound material was then removed from the wells by
washing four times with PBS-T. Four columns of wells then received 100
NI/well of LTA solution (Sigma Cat #2515 diluted to 1 Ng/ml in PBS-T), four
columns received 100 NI/well of PepG solution (10 Ng/ml in PBS-T), and four
columns received PBS-T alone. The wells were incubated for 30-60 minutes
at room temperature and then washed four times with PBS-T. Two columns
of each LTA-bound, PepG-bound, and PBS-t received 100 pl of A130, titrated
in 2-fold dilutions from 5 Ng/ml to 0.078 Ng/ml in PBS-T with 0.1 % human
serum without IgG, IgA and IgM (Axell Cat BYA20341, Lot H2415). Two
columns of each LTA-bound, PepG-bound, and PBS-t received A110,
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
72
similarly diluted and titrated. These chimeric antibodies served as
"detection"
antibodies, analogous to the A130 detection antibody used in Table 18.
[0179] Following a 30-60 minute incubation, the wells were washed
with PBS-T and each well received 95 NI of HRP-conjugated gamma-specific
goat anti-human IgG (Zymed Cat 62-8420), diluted 1:6000 in PBS-T. After
30-60 minutes, the wells were washed with PBS-T and 100 pl of TMB
substrate solution was added to each well (BioFX Cat TMBW-0100-01 ). The
reaction was allowed to proceed for 15 minutes at room temperature in the
dark and stopped by the addition of 100 pl TMB Stop Reagent to each well
(BioFX Cat STPR-0100-01 ). The absorbance of each well was measured
using a Molecular Devices Vmax microplate reader with a 450 nm filter.
[0180] Table 20 shows the results of the sandwich assay using M110
as the capture antibody, followed by PepG or LTA, and then A110 or A130 as
the detection antibody. These results demonstrate again that M110 does not
capture an antigen that can be bound by A130. Furthermore, this result
demonstrates that the PepG preparation used in these assays does not
contain appreciable levels of LTA, as capture of the PepG with anti-LTA M110
antibody does not result in sufficient captured LTA to show binding of A110
above background levels.
Table 20
Capture with M110, Binding of LTA or PepG, Detection with A110 or
A130
detection -LTA detection -LTA
with +LTA +PepG - with +LTA +PepG -
A130 (pg/ml) PepG A110 (Ng/ml) PepG
0.1860.197 0.179 5 1.237 0.177 0.174
2.5 0.1810.197 0.180 2.5 1.119 0.172 0.168
1.25 0.2090.213 0.190 1.25 1.036 0.175 0.172
0.625 0.1980.223 0.200 0.625 0.961 0.189 0.180
i ~ ~ ~ n
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
73
detection -LTA detection -LTA
with +LTA +PepG - with +LTA +PepG -
A130 (Ng/ml) PepG A110 (pg/ml) PepG
0.3125 0.1920.224 0.200 0.3125 0.829 0.190 0.185
0.156 0.1920.229 0.199 0.156 0.688 0.200 0.197
0.078 0.1880.217 0.194 0.078 0.523 0.187 0.187
Buffer 0.1920.196 0.190 Buffer 0.180 0.179 0.182
EXAMPLE 12
Human Antibodies That Bind PepG
[0181 ] Rather than humanizing a mouse antibody to minimize the
HAMA response during treatment as described above, a skilled artisan can
isolate a protective anti-PepG antibody that is fully human. There are a
number of well-known alternative strategies one of ordinary skill in the art
may
use to produce completely human recombinant antibodies. One is the
generation of antibodies using phage display technologies (50, 54).
Specifically, human RNA is used to produce a cDNA library of antibody heavy
and light chain fragments expressed on the surface of bacteriophage. These
libraries can be used to probe against the antigen of interest (i.e., PepG)
and
the phage that bind, because of the antibody expressed on the surface, are
then isolated. The DNA encoding the variable regions is sequenced and
cloned for antibody expression.
[0182] Another method of producing human antibodies employs
"humanized" mice. These transgenic mice have had their own antibody
genes replaced with a portion of the human antibody gene complex so that
upon inoculation with antigen, they produce human antibodies (48, 50, 51, 52,
54). The antibody producing cells that result can then be incorporated into
the
standard hybridoma technology for the establishment of specific monoclonal
antibody producing cell lines.
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
74
[0183] Recombinant human antibodies are also produced by isolating
antibody-producing B cells from human volunteers that have a robust anti-
PepG response. Using fluorescence activated cell sorting (FACS) and
fluorescently labeled PepG, cells producing the anti-PepG antibodies can be
separated from the other cells. The RNA can then be extracted and the
sequence of the reactive antibody variable regions determined (49, 53). The
DNA sequence of the functional variable regions can be synthesized or
cloned into mammalian expression vectors for large-scale human
recombinant antibody production.
CONCLUSION
[0184] Monoclonal antibodies were raised in mice against S. aureus
PepG, an abundant cell surface molecule on Gram-positive bacteria. One
hybridoma clone, 99-110FC12 IE4, produces an IgM antibody that bound
strongly in ELISA assays to PepG, but not to S. epidermidis strain Hay, or to
LTA, another surface molecule common to Gram-positive bacteria (Example
1, Table 5).
[0185] Monoclonal antibodies were also raised against B. subtilis
PepG. Hybridomas BB4/A4 and BB4/A5 produce IgG antibodies that bind to
B. subtilis PepG (Example 2). The affinity of the monoclonal antibodies
produced by BB4/A4, BB4/A5, 11-232.3, 11-248.2, 11-569.3, and antibody
702 PG, which is purified from hybridoma 11-232.3, were tested for binding to
PepG from a number of different bacteria in an ELISA assay. MAb-BB4/A4
and MAb-BB4/A5, which were produced from the same mouse, bound
strongly to PepG from B. subtilis and S. epidermidis, while MAb-11-232.3 and
MAb-11-248.2 bound strongly to PepG S. aureus (Example 3, Table 6).
These results demonstrate that monoclonal antibodies raised against PepG
from one Gram positive bacteria may bind PepG from another Gram-positive
bacteria, which may indicate binding to a conserved epitope on PepG.
[0186]A110, MAb-11-232.3, MAb-11-248.2, MAb-99-110FC12 IE4,
and MAb-11-569.3 were tested for binding to S. aureus PepG in an ELISA
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
assay. MAb-11-232.3, MAb-11-248.2, and MAb-99-110FC12 IE4, which were
raised to either whole UV-killed S. aureus or to S. aureus PepG, bound
strongly to S. aureus PepG. MAb-11-569.3 bound weakly to PepG, although
it was also raised to whole UV-killed S. aureus, indicating that it may bind
to
an epitope other than PepG on the surface of the bacteria. The anti-LTA
antibody, A110, did not bind to S. aureus PepG (Example 4, Table 7). In a
similar assay to measure binding of the antibodies to S. aureus LTA, only
A110 showed appreciable binding (Example 4, Table 8). The results
demonstrate that antibodies raised to whole UV-killed S. aureus may in fact
be specific for PepG on the surface of the bacteria.
[0187] Each of the antibodies was then tested for binding to methanol-
fixed S. epidermidis strain Hay. A110, which was raised to S. epidermidis
LTA, bound most strongly to methanol-fixed S. epidermidis. MAb-11-569.3
and MAb-11-248.2 also bound strongly to the methanol-fixed S. epidermidis,
in spite of the fact that they were raised to UV-killed S. aureus. This
suggests
that these antibodies may bind to a conserved epitope on the surface of the
two bacterial strains. MAb-11-232.3, which was also raised to UV-killed S.
aureus bound less strongly to methanol-fixed S. epidermidis. Similarly, MAb-
99-110FC12 IE4, which was raised against S. aureus PepG, did not bind
methanol-fixed S. epidermidis (Example 4, Table 9).
[0188] Finally, A110, MAb-11-232.3, and MAb-11-569.3 were tested for
binding to methanol-fixed S. aureus. Not surprisingly, MAb-11-232.3 and
MAb-11-569.3 bound strongly, as they were raised to whole UV-killed S.
aureus. A110 also bound to methanol-fixed S. aureus, although it was raised
to heat-killed S. epidermidis, indicating that it may bind to an epitope that
is
conserved between the two bacteria (Example 4, Table 10).
[0189] Hybridoma 99-110FC12 IE4 supernatant was tested for opsonic
activity against S. aureus and S. epidermidis in the presence of PMNs and
complement, which was derived from human serum that had been depleted of
antibodies to S. aureus and S. epidermidis. MAb-99-11 OFC12 IE4 was
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
76
opsonic against S. aureus, but not against S. epidermidis (Example 5, Table
11 ). As discussed in the preceding paragraphs, MAb-99-110FC12 IE4 binds
to S. aureus PepG, but not to whole S. epidermidis, suggesting a correlation
between binding ability and opsonic activity.
[0190] MAb-11-232.2, MAb-11-569.3, MAb-11-248.2, each of which
was raised to whole UV-killed S. aureus, as well as MAb-99-110FC12 IE4,
which was raised to purified S. aureus PepG, and A110 were tested in a
similar opsonophagocytic assay against S. aureus type 5. The antibodies that
were raised against UV-killed S. aureus, MAb-11-232.2, MAb-11-569.3, and
MAb-11-248.2, as well as MAb-110FC12 IE4, which was raised against S.
aureus PepG, showed at least 75% killing of S. aureus in the assay. The anti-
LTA antibody, A110, which was raised against LTA from S. epidermidis,
showed only 23% killing (Example 5, Table 12). Surprisingly, although A110
bound strongly to both S. aureus LTA and whole methanol-fixed S. aureus, it
was not strongly opsonic against S. aureus. The non-chimerized version of
A110, M110, was somewhat more opsonic against S. aureus in a previous
assay (Example 5, Table 12B). This variation, however, is likely due to assay
to assay variations and dosage effects, rather than differences in activity
between the chimerized and non-chimerized antibodies, because A110
retains its activity against S. epidermidis (Example 5, Table 13). The
antibodies that were raised against S. aureus PepG, and against whole UV-
killed S. aureus, on the other hand, showed strong opsonic activity against
the
bacteria, as was expected.
[0191 ] In a similar assay against S. epidermidis strain Hay, MAb-11-
232.2, MAb-11-569.3, and MAb-11-248.2 showed at least 66% killing, while
MAb-99-110FC12 IE4 showed little or no killing. A110, in contrast with the
previous assay, showed at least 98% killing of S. epidermidis strain Hay
(Example 5, Table 13). These results, and those discussed above, show a
strong correlation between the ability to bind to methanol-fixed bacteria and
opsonic activity against that bacteria. A110 is a notable exception, however,
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
77
because it was able to bind to methanol-fixed S. aureus, but was not opsonic
against live S. aureus. Furthermore, these results demonstrate that
monoclonal antibodies that have been raised against UV-killed S. aureus can
have opsonic activity against S. epidermidis, suggesting a conserved
determinant between the two bacteria that allows a MAb raised against one to
be opsonic for the other. These results also indicate that weak binding may
be sufficient for opsonic activity, because MAb-11.232.3 was still somewhat
opsonic against S. epidermidis, in spite of its poor binding to those bacteria
in
the methanol-fixed bacteria ELISA.
[0192] MAb-11-232.3 was tested for its ability to block nasal
colonization in mice. After preincubation of S. aureus type 5 with MAb-11-
232.3, only 3 out of 8 mice were colonized by S. aureus, as compared to 9 out
of 9 mice in the control groups. Furthermore, of the mice that were colonized,
the mice that received S. aureus that had been preincubated with MAb-11-
232.3 had one-tenth the number of bacterial colonies as control mice
(Example 6, Table 14). These results suggest that MAb-11-232.3, which
binds to and is opsonic against S. aureus, is able to block nasal colonization
by the bacteria, and is also able to reduce the number of bacteria in mice
that
are colonized.
[0193] Hybridoma 11-232.3 was subcloned, and the antibody produced
by subclone 11-232.3 IE9, M130, was further analyzed. M130 was tested for
binding to a number of different bacteria in a live bacteria ELISA assay. M130
bound to three different strains of live S. aureus, but did not bind to S.
hemolyticus or S. epidermidis (Example 7, Table 16). These results are
consistent with the methanol-fixed bacteria ELISAs, in which MAb-11-232.3
bound strongly to S. aureus, but weakly to S. epidermidis. Therefore,
although MAb-11.232.3 and M130 are specific for S. aureus, they are broadly
reactive against different strains of bacteria, as MAb-11-232.3 was still
somewhat opsonic against S. epidermidis, in spite of its weaker binding.
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
78
[0194] The variable regions of M130 were cloned and human/mouse
chimeric antibodies were produced that have the M130 variable regions and
human constant regions (Examples 8 and 9). These chimeric antibodies,
referred to as A130, retained the ability to bind to S. aureus PepG (Example
10, Figure 7). These human/mouse chimeric antibodies are expected to have
a reduced HAMA response in humans, which may be therapeutically
advantageous.
[0195] Finally, sandwich assays were conducted to confirm that the
anti-PepG antibodies of the invention are in fact specific for PepG, and do
not
bind to contaminants in PepG preparations. In the first assay, a battery of
antibodies were used to capture PepG on a plate, and then A130 was used as
a detection antibody to detect the captured PepG (Example 11, Table 18). As
expected, antibodies that are known to bind to PepG were able to capture
PepG, as detected by binding of A130 antibody. Antibodies that bind to LTA
did not capture an antigen that could be detected by A130, indicating that
A130 does not bind to LTA. In the second assay, anti-LTA A110 antibody
was used to capture LTA on a plate, which was then detected with the same
battery of antibodies as was used for capture in the first assay (Example 11,
Table 19). As expected, the anti-LTA antibodies were able to detect the LTA
that was captured by A110. The anti-PepG antibodies, on the other hand,
were unable to detect an antigen captured by A110, suggesting that they do
not bind to LTA. Finally, M110 was used to capture either LTA or PepG on a
plate, and the captured antigen was then detected with either A110 or A130
(Example 11, Table 20). As expected, M110 was not able to capture an
antigen from either the PepG or LTA preparations that was detectable by
A130. M110 was able to capture LTA that was detectable by A110, however.
Significantly, M110 was not able to capture sufficient LTA from the PepG
preparation to allow measurable detection by A110, suggesting that the PepG
preparation is substantially free of LTA. This level of purity in a PepG
preparation has not previously been demonstrated.
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
79
[0196] Previously, it was unclear whether a monoclonal antibody could
enhance phagocytosis of Gram-positive bacteria, because the polyclonal sera
that were used contained many different antibodies that bound to many
different epitopes on the surface of the bacteria, and the sum of this
collective
binding and activities may have accounted for the overall activity of the
serum.
Here, we demonstrate that a monoclonal antibody, which binds to a single
epitope on the surface of bacteria, can be opsonic against that bacteria. We
have also demonstrated that monoclonal antibodies raised against PepG can
have that activity, and that those antibodies may be opsonic for a number of
different types of Gram-positive bacteria.
[0197] The antibodies of the invention can block or alleviate nasal
colonization. These antibodies may therefore be useful protective molecules
in the fight against antibiotic-resistant Gram-positive bacterial infections.
REFERENCES
1. Atrih, Abdelmadjid; Bacher, Gerold; Allmaier, Gunter; Williamson, Michael
P.; and Foster, Simon J. 1999. Analysis of Peptidoglycan Structure from
Vegetative Cells of Bacillus subtilis 168 and Role PBP 5 in Peptidoglycan
Maturation, Journal of Bacteriology 181: 3956-3966.
2. Bartal, Arie H.; Hirshaut, Yashar. 1987. Current Methods in Hybridoma
Formation Bartal, A.H. et al. (ed.) Methods of Hybridoma Formation,
Humana Press, Clifton, New Jersey.
3. Espersen, F.; Hertz, J. B.; and Hoiby, N. 1981. Cross-Reactions
Between Staphylococcus epidermis and 23 Other Bacterial Species,
Acta Path. Microbial. Scand., Sect. B. 89: 253-260.
4. Fischer, Gerald W. Broadly reactive opsonic antibodies that react with
common staphylococcal antigens, U.S. Patent No. 5,571,511, issued
November 5, 1996.
5. Fleer, A.; Senders R.C.; Visser M.R.; Bijlmer R.P.; Gerards L.J.;
Kraaijeveld C.A.; Verhoef J. 1983. Septicemia due to coagulase-negative
staphylococci in a neonatal intensive care unit: clinical and bacteriological
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
features and contaminated parenteral fluids as a source of sepsis,
Pediatr. Infect. Dis. 2: 426-431.
6. Foster, Simon J. 1992. Analysis of the Autolysins of Bacillus subtilis 168
during Vegetative Growth and Differentiation by Using Renaturin
Polyacrylamide Gel Electrophoresis, Journal of Bacteriology 174: 464-
470.
7. Fournier, Jean-Michel. 1991. Staphylococcus Aureus, Vaccines and
Immunotherapy, Ch. 13, pp.166 -171.
8. Genarro, A. (ed.) 1990. Remington's Pharmaceutical Sciences, 18t"
Edition, Mack Publishing, Easton, PA.
9. Hancock, I.C. 1997. Bacterial Cell Surface Carbohydrates: Structure
and Assembly, Biochem. Soc. Trans. 25: 183-187.
10. Jendeberg, Lena; Nilsson, Peter; Larsson, Antonella; Denker, Per; Uhlen,
Mathias; Nilsson, Bjorn; Nygren, Per-Ake. 1997. Engineering of Fc1 and
Fc3 from Human Immunoglobulin G to Analyse Subclass Specificity for
Staphylococcal Protein A, J. Immunol. Methods 201: 25-34.
11. Kiser, Kevin B.; Cantey-Kiser, Jean M.; Lee, Jean C. 1999. Development
and Characterization of a Staphylococcus Aureus Nasal Colonization
Model in Mice, Infection and Immunity 67: 5001-5006.
12. Krieger, Monty; Joiner, Keith A. Method for Treating Gram Positive
Septicemia, U.S. Patent No. 5,624,904, issued April 29, 1997.
13. Lee, J.C. 1996. The prospects for developing a vaccine against
Staphylococcus aureus, Trends in Micro. 4: 162-66.
14. LoBuglio A.F.; Wheeler R.H.; Trang J.; Haynes A.; Rogers K.; Harvey
E.B.; Sun L.; Ghrayeb J.; Khazaeli M.B. 1989. Mouse/human chimeric
monoclonal antibody in man: kinetics and immune response, P.N.A.S.
86: 4220-4224.
15. Nakamura, K. et al. 1999. Uptake and Release of Budesonide from
Mucoadhesive, pH-sensitive Copolymers and Their Application to Nasal
Delivery. J. Control. Release 61:329-335.
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
81
16. Natsume, H., S. Iwata, K. Ohtak, M. Miyamoto, M. Yamaguchi, K.
Hosoya, and D. Kobayashi. 1999. Screening of cationic compounds as
an absorption enhancer for nasal drug delivery. Int. J. Pharma. 185:1-12.
17. Navarre, William Wiley and Schneewind, Olaf. 1999. Surface Proteins of
Gram-Positive Bacteria and Mechanisms of Their Targeting to the Cell
Wall Envelope, Microbiology and Molecular Biology Reviews 63: 174-
229.
18. Peterson, Phillip K.; Verhoef, Jan; Sabath, L. D.; and Quie, Paul G. 1997.
Effect of Protein A on Staphylococcal Opsonization, Infection and
Immunity 15: 760-764.
19. Peterson, Phillip K.; Wilkinson, Brian J.; Kim, Youngki; Schmeling, David;
and Quie, Paul G. 1978. Influence of Encapsulation on Staphylococcal
Opsonization and Phagocytosis by Human Polymorphonuclear
Leukocytes, Infection and Immunity 19: 943-949.
20. Peterson, Phillip K.; Wilkinson, Brian J.; Kim, Youngki; Schmeling, David;
Douglas, Steven D.; Quie, Paul G.; and Verhoef, Jan. 1978. The Key
Role of Peptidoglycan in the Opsonization of Staphylococcus Aureus,
The Journal of Clinical Investigation 61: 597-609.
21. Quie, Paul G.; Hill, Harry R.; and Davis, Todd A. 1974. Defective
Phagocytosis of Staphylococci, Annals New York Academy of Sciences,
pp.233-243.
22. Ramkissoon-Ganorkar, C. et al. 1999. Modulating insulin-release profile
from pH/thermosensivite polymeric beads through polymer molecular
weight. J. Contr. Release 59:287-298.
23. Romero-Vivas J.; Rubio M.; Fernandez C.; Picazo J.J. 1995. Mortality
associated with nosocomial bacteremia due to methicillin-resistant
Staphylococcus aureus, Clin. Infect. Dis. 21: 1417-23.
24. Salton, M.R.J. 1994. The Bacterial Cell Envelope - A Historical
Perspective, in J.-M. Ghuyson and R. Hakenbeck (ed.), Bacterial Cell
Wall, Elsevier Science BV, Amsterdam, pp. 1-22.
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
82
25. Sambrook, Joseph; Russell, David W. 1989. Molecular Cloning: A
Laboratory Manual, 2"d Ed., Cold Spring Harbor Press, Cold Spring
Harbor, NY.
26. Schwab, U. E., A. E. Wold, J. L. Carson, M. W. Leigh, P.-W. Cheng, P. H.
Gilligan and T. F. Boat. 1993. Increased adherence of Staphylococcus
aureus from cystic fibrosis lungs to airway epithelial cells. Am. Rev.
Respir. Dis. 148:365-369.
27. Shockman, Gerald D.; Jackson, Dianne E.; Wong, William. Monoclonal
antibodies to Peptidoglycan and Methods of Preparing Same, U.S.
Patent No. 4,596,769, issued June 24, 1986.
28. Shulman, M.; Wilde, C.D.; Kohler, G. 1978. A Better Cell Line for Making
Hybridomas Secreting Specific Antibodies, Nature 276: 269-270.
29. Soto, N., A. Vaghjimal, A. Stahl-Avicolli, J. Protic, L. Lutwick and E.
Chapnick. 1999. Bacitracin versus mupirocin for Staphylococcus aureus
nasal colonization. Infect. Cont. Hosp. Epidem. 20: 351-353.
30. Suzuki, Y. and Y. Makino. 1999. Mucosal drug delivery using cellulose
derivative as a functional polymer. J. Control. Release. 62:101-107.
31. Timmerman C.P.; Besnier J.M.; De Graaf L.; Torensma R.; Verkley A.J.;
Fleer A.; Verhoef J. 1991. Characterisation and functional aspects of
monoclonal antibodies specific for surface proteins of coagulase-negative
staphylococci, J. Med. Micro. 35: 65-71.
32. Tomasz, Alexander. 2000. The Staphylococcal Cell Wall, in V.A.
Fischetti et al. (ed.) Gram-Positive Pathogens, Ch. 36, pp. 351-355.
33. Verbrugh, Henri A.; Peters, Roel; Rozenberg-Arska, Maja; Peterson,
Phillip K.; and Verhoef, Jan. 1981. Antibodies to Cell Wall Peptidoglycan
of Staphylococcus aureus in Patients with Serious Staphylococcal
Infections, The Journal of Infectious Disease 144: 1-9.
34. Verbrugh, Henri A.; Van Dijk, Willemien C.; Peters, Roel; Van Erne,
Marijke E.; Daha, Mohamed R.; Peterson, Phillip K. and Verhoeff, Jan.
1980. Opsonic Recognition of Staphylococci Mediated by Cell Wall
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
83
Peptidoglycan: Antibody-Independent Activation of Human Complement
and Opsonic Activity of Peptidoglycan Antibodies, The Journal of
Immunology 124: 1167-1173.
35. Waldvogel, Francis A. 1990. Staphylococcus Aureus (Including toxic
Shock Syndrome), Mandell, G.L. et al. (ed.), Principles and Practices of
Infectious Diseases, Third Edition, Churchill Livingstone, Philadelphia, PA,
pp. 1489-1510.
36. Waldvogel, Francis A. 2000. Staphylococcus Aureus (Including toxic
Shock Syndrome), Mandell, G.L. et al. (ed.) Principles and Practice of
Infectious Diseases, Fifth Edition, Churchill Livingstone, Philadelphia, PA,
pp. 1760-1775.
37. Merkus, F.W., J.C. Verhoef, N.G. Schipper, and E. Marttin. 1999.
Cyclodextrins in nasal drug delivery. Advan. Drug Deliv. Rev. 36: 41-57.
38. Kengatharan, K.M., De Kimpe, S., Robson, C., Foster, S.J. &
Thiemermann, C. 1998. Mechanism of Gram-positive shock:
Identification of peptidoglycan and lipoteichoic acid moieties essential in
the induction of nitric oxide synthase, shock and multiple organ failure.
Journal of Experimental Medicine 188: 305-315.
39. Foster, S.J. 1993. Molecular analysis of three major wall-associated
proteins of Bacillus subtilis 168: evidence for the processing the product
of a gene encoding a 258 kDa precursor two-domain ligand-binding
protein. Molecular Microbiology 8: 299-310.
40. Devereux, J., Haeberli, P. & Smithies, O. 1984. A comprehensive set of
sequence analysis programs for the VAX. Nucl. Acids Res. 12: 387-395.
41. Needleman, S.B. & Wunsch, C.D. 1970. A general method applicable to
the search for similarities in the amino acid sequence of two proteins. J.
Mol. Biol. 48: 443-453.
42. Smith, T.F. & Waterman, M.S. 1981. Comparison of biosequences. Adv.
Appl. Math 2: 482-489.
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
84
43. Gribskov, M. & Burgess, R.R. 1986. Sigma factors from E. coli, B.
subtilis, phage SP01, and phage T4 are homologous proteins. 14: 6745-
6763.
44. Schwartz, R.M. & Dayhoff, M.O. 1979. "Matrices for detecting distant
relationships", pp. 353-358 in: Atlas of Protein Sequence and Structure.
National Biomedical Research Foundation.
45. Ausubel et al. (ed.) 1989. Current Protocols in Molecular Biology, John
Wiley & Sons.
46. Borrebaeck, Carl A.K. 1995. Antibody Engineering, 2nd Ed., Oxford
University Press, NY.
47. Harlow, Ed; Lane, David. 1988. Antibodies: A Laboratory Manual, Cold
Spring Harbor Press, Cold Spring Harbor, NY.
48. Green, L. L., M. C. Hardy, et al. (1994). "Antigen-specific human
monoclonal antibodies from mice engineered with human Ig heavy and
light chain YACs." Nat Genet 7(1 ): 13-21.
49. Kantor, A. B., C. E. Merrill, et al. (1995). "Development of the antibody
repertoire as revealed by single-cell PCR of FACS-sorted B-cell subsets."
Ann N Y Acad Sci 764: 224-7.
50. Low, N. M., P. H. Holliger, et al. (1996). "Mimicking somatic
hypermutation: affinity maturation of antibodies displayed on
bacteriophage using a bacterial mutator strain." J Mol Biol 260(3): 359-68.
51. Wagner, S. D., A. V. Popov, et al. (1994). "The diversity of antigen-
specific monoclonal antibodies from transgenic mice bearing human
immunoglobulin gene miniloci." Eur J Immunol 24(11 ): 2672-81.
52. Wagner, S. D., G. T. Williams, et al. (1994). "Antibodies generated from
human immunoglobulin miniloci in transgenic mice." Nucleic Acids Res
22(8): 1389-93.
53. Wang, X. and B. D. Stollar (2000). "Human immunoglobulin variable
region gene analysis by single cell RT-PCR." J Immunol Methods 244(1-
2): 217-25.
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
54. Winter, G., A. D. Griffiths, et al. (1994). "Making antibodies by phage
display technology." Annu Rev Immunol 12: 433-55.
[0198] Having now fully described the invention, it will be appreciated
by those skilled in the art that the invention can be performed within a range
of equivalents and conditions without departing from the spirit and scope of
the invention and without undue experimentation. In addition, while the
invention has been described in light of certain embodiments and examples,
the inventors believe that it is capable of further modifications. This
application is intended to cover any variations, uses, or adaptations of the
invention which follow the general principles set forth above.
[0199] The specification includes recitation to the literature and those
literature references are herein specifically incorporated by reference.
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
1 /5
SEQUENCE LISTING
<110> BIOSYNEXUS, INC.
<120> MULTIFUNCTIONAL MONOCLONAL ANTIBODIES DIRECTED TO
PEPTIDOGLYCAN OF GRAM-POSITIVE BACTERIA
<130> 07787.0059-00304
<140>
<141>
<150> 60/343,444
<151> 2001-12-21
<150> 09/097,055
<151> 1998-06-15
<160> 12
<170> PatentIn Ver. 2.1
<210> 1
<211> 112
<212> PRT
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic M130
light chain antibody
<400> 1
Asp Ile Lys Met Thr Gln Ser Pro Leu Thr Leu Ser Val Thr Ile Gly
1 5 10 15
Gln Pro Ala Ser Ile Ser Cys Lys Ser Ser Gln Ser Leu Leu Asp Ser
20 25 30
Asp Gly Lys Thr Tyr Leu Asn Trp Leu Leu Gln Arg Pro Gly Gln Ser
35 40 45
Pro Lys Arg Leu Ile Tyr Leu Val Ser Lys Leu Asp Ser Gly Val Pro
50 55 60
Asp Arg Phe Ala Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Leu Gly Val Tyr Tyr Cys Trp Gln Gly
85 90 95
Thr His Phe Pro Leu Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys
100 105 110
<210> 2
<211> 336
<212> DNA
<213> Artificial Sequence
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
2/5
<220>
<221> CDS
<222> (1)..(336)
<220>
<223> Description of Artificial Sequence: Synthetic DNA encoding
M130 light chain antibody
<400> 2
gat att aag atg acc cag tct cca ctc act ttg tcg gtt acc att gga 48
Asp Ile Lys Met Thr Gln Ser Pro Leu Thr Leu Ser Val Thr Ile Gly
1 5 10 15
caa cca gcc tcc atc tct tgc aag tca agt cag agc ctc tta gat agt 96
Gln Pro Ala Ser Ile Ser Cys Lys Ser Ser Gln Ser Leu Leu Asp Ser
20 25 30
gat gga aag aca tat ttg aat tgg ttg tta cag cgg cca ggc cag tct 144
Asp Gly Lys Thr Tyr Leu Asn Trp Leu Leu Gln Arg Pro Gly Gln Ser
35 40 45
cca aag cgc cta atc tat ctg gtg tct aaa ctg gac tct gga gtc cct 192
Pro Lys Arg Leu Ile Tyr Leu Val Ser Lys Leu Asp Ser Gly Val Pro
50 55 60
gac agg ttc get ggc agt gga tca ggg aca gat ttc aca ctg aaa atc 240
Asp Arg Phe Ala Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
agc aga gtg gag get gag gat ttg gga gtt tat tat tgc tgg caa ggt 288
Ser Arg Val Glu Ala Glu Asp Leu Gly Val Tyr Tyr Cys Trp Gln Gly
85 90 95
aca cat ttt cct ctc acg ttc ggt get ggg acc aag ttg gaa ctg aaa 336
Thr His Phe Pro Leu Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys
100 105 110
<210> 3
<211> 119
<212> PRT
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic M130
heavy chain antibody
<400> 3
Gln Val Gln Leu Gln Gln Ser Gly Pro Gly Ile Leu Gln Pro Ser Gln
1 5 10 15
Thr Leu Ser Leu Thr Cys Ser Phe Ser Gly Phe Ser Leu Ser Thr Ser
20 25 30
Gly Met Ser Val Ser Trp Ile Arg Gln Pro Ser Gly Lys Gly Leu Glu
35 40 45
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
3/S
Trp Leu Ala His Ile Phe Trp Asp Asp Asp Lys Arg Tyr Asn Pro Ser
50 55 60
Leu Lys Ser Arg Leu Thr Val Ser Lys Asp Thr Ser Ser Asn Gln Val
65 70 75 80
Phe Leu Lys Ile Thr Ser Val Gly Thr Ala Asp Thr Ala Thr Tyr Tyr
85 90 95
Cys Ala Arg Asn Tyr Asp Tyr Asp Trp Phe Val Tyr Trp Gly Gln Gly
100 105 110
Thr Leu Val Thr Val Ser Ala
115
<210>
4
<211>
357
<212>
DNA
<213> Sequence
Artificial
<220>
<221>
CDS
<222>
(1)..(357)
<220>
<223> Sequence: DNAencoding
Description Synthetic
of Artificial
M130
heavy
chain
antibody
<400>
4
cag gtt ctg cagcagtct ggccctgggatattgcagccctcccag 48
cag
Gln Val Leu GlnGlnSer GlyProGlyIleLeuGlnProSerGln
Gln
1 5 10 15
acc ctc ctg acttgttct ttctctgggttttcactgagcacttct 96
agt
Thr Leu Leu ThrCysSer PheSerGlyPheSerLeuSerThrSer
Ser
20 25 30
ggt atg gtg agctggatt cgtcagccttcaggaaagggtctggag 144
agt
Gly Met Val SerTrpIle ArgGlnProSerGlyLysGlyLeuGlu
Ser
35 40 45
tgg ctg cac attttctgg gatgatgacaagcgctataacccatcc 192
get
Trp Leu His IlePheTrp AspAspAspLysArgTyrAsnProSer
Ala
50 55 60
ctg aag cga ctcacagtc tccaaggatacctccagcaaccaggtc 240
agc
Leu Lys Arg LeuThrVal SerLysAspThrSerSerAsnGlnVal
Ser
65 70 75 80
ttc ctc atc accagtgtg ggcactgcagatactgccacatactac 288
aag
Phe Leu Ile ThrSerVal GlyThrAlaAspThrAlaThrTyrTyr
Lys
85 90 95
tgt get aac tatgattac gactggtttgtttactggggccaaggg 336
cga
Cys Ala Asn TyrAspTyr AspTrpPheValTyrTrpGlyGlnGly
Arg
100 105 110
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
4/5
act ctg gtc act gtc tct gca 357
Thr Leu Val Thr Val Ser Ala
115
<210> 5
<211> 40
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Primer
<400> 5
tgttttcgta cgtcttgtcc caggtbcarc tkmar8artc 40
<210> 6
<211> 32
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Primer
<400> 6
taccgtaccg gtgayatyma gatgacmcag we 32
<210> 7
<211> 32
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Primer
<400> 7
taccgtaccg gtsaaattgw kctsacycag tc 32
<210> 8
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Primer
<400> 8
gcacctccag atgttaactg ctc 23
<210> 9
<211> 22
<212> DNA
<213> Artificial Sequence
CA 02469714 2004-06-08
WO 03/059259 PCT/US02/41032
5/S
<220>
<223> Description of Artificial Sequence: Primer
<400> 9
ctggacaggg mtccakagtt cc 22
<210> 10
<211> 38
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Primer
<400> 10
ataggattcg aaaagtgtac ttmcgtttca gytccarc 38
<210> 11
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Primer
<400> 11
tgttttcgta cgtcttgtcc cag 23
<210> 12
<211> 35
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Primer
<400> 12
ttttctgaat tctgcagaga cagtgaccag agtcc 35
