Note: Descriptions are shown in the official language in which they were submitted.
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
REGULATED ETHYLENE SENSITIVITY TO CONTROL
FLOWER LONGEVITY IN A PLANT
REFERENCE TO RELATED APPLICATIONS
This application is a Continuation-in-Part of PCT Application No.
PCT/LTS02/34566,
filed October 28, 2002, which further claims priority to US Provisional
Application
60/339,596, filed October 26, 2001. This application also claims priority to
US Provisional
Application 60/ 374,555, filed April 22, 2002, which is herein incorporated by
reference in
its entirety.
1o BACKGROUND OF THE INVENTION
The plant hormone ethylene regulates a wide range of developmental processes,
including seed germination, abscission of leaves and flowers, stem elongation,
and fruit
ripening. Ethylene signal transduction is controlled by a complex
multicomponent pathway
(Kieber, Annu. Rev. Plant Physiol. Plant Mol. Biol. 48:277-296 (1997). To
address the
15 ethylene signaling mechanisms, a molecular/genetic approach has been
applied using the
ethylene-evoked triple response phenotype of Arabidopsis thaliana seedlings.
In Arabidopsis, the "triple response" typically involves inhibition of root
and stem
elongation, radial swelling of the stem and absence of normal geotropic
response
(diageotropism). Etiolated morphology of a plant can be dramatically altered
by stress
20 conditions that induce ethylene production, so that, for example, the
ethylene-induced triple
response provides a seedling with the additional strength required to
penetrate compacted
soils. Based upon the triple response, a dozen Arabidopsis mutants have been
isolated into
two classes (Ecker, Science 268:667-675 (1995); U.S. Pat. Nos. 5,367,065;
5,444,166;
5,602,322 and 5,650,553, each of which is herein incorporated by reference).
One class of
25 mutants, the ein Lthylene insensitive) mutants, showed reduced or complete
insensitivity to
exogenous ethylene. The other class of mutants, the constitutive hormone
response mutants,
display constitutive ethylene response phenotypes in the absence of
exogenously applied
hormones.
The first component of the ethylene signal transduction pathway to be
identified was
30 an ethylene receptor gene from Arabidopsis, ETR 1. This gene encodes a
histidine kinase
with homology to bacterial two-component systems as reported by Chang et al.,
Science
262:539-544 (1993).
-1-
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
To date, a total of five ethylene receptor genes have been cloned from
Arabidopsis,
ETR1, ETR2, ERSl, ERS2, and EIN4 (Hua et al., Science 269:1712-1714 (1995);
Hua et al.,
Plant Cell 10:1321-1332 (1998); Sakai et al., Proc. Natl. Acad. Sci. USA
95:5812-5817
(1998)). Loss-of function mutations in multiple ethylene receptors increase
sensitivity to
ethylene, indicating that the receptors are negative regulators of ethylene
response (Hua et
al., Cel194:261-271 (1998)).
Downstream components of the pathway have also been identified in Arabidopsis.
These include CTR1 (constitutive triple response), which is homologous to the
Raf family of
serine/threonine kinases (Kieber et al., Cell 72: 427-441 (1993)), and which
interacts with
the two ethylene receptor proteins ETR1 (ethylene receptorl) and ERS1 in a
yeast two-
hybrid system (Clark et al., Proc. Natl. Acad. Sci. USA 95:5401-5406 (1998)).
Loss-of
function mutations in CTR1 cause a constitutive ethylene signaling phenotype
of severe leaf
epinasty and reduced leaf expansion, indicating that, like the receptor
proteins, CTR1 is a
negative regulator of ethylene response.
EIN2, a key component of the ethylene signal transduction pathway, is an
integral
membrane spanning protein with 12 membrane spanning regions. It is homologous
to the
Nramp metal-ion transport proteins (Alonso et al., Science 284:2148-2152
(1999)).
Epistasis analyses indicate that EIN2 acts downstream of CTRL. EIN2 loss-of
function
mutants are insensitive to ethylene, indicating that these proteins are
positive regulators of
2o ethylene response.
Several transcription factors that control the expression of ethylene-
regulated genes
have also been identified. The Arabidopsis EIN3 family contains several
proteins that bind
to an ethylene response element in the promoter of the Ethylene Response
Factor 1 (ERFI )
gene. ERF1 binds to the promoters of pathogenesis-related (PR) genes and
regulates their
expression (Solano et al., Genes & Development 12:3703-3714 (1998)). Loss-of
function
mutations in EIN3 reduce sensitivity to ethylene. Over-expression of wild-type
EIN3 results
in constitutive ethylene response (Chao et al., Cell 89:1133-1144 (1997)).
Therefore, EIN3
is a positive regulator of ethylene response.
Isolation of several components of the ethylene signal transduction pathway
has
made it possible to genetically engineer crop species with altered ethylene
sensitivity. In
tomato, antisense expression of the tomato ethylene receptor LeETR4 resulted
in constitutive
ethylene responses, including leaf epinasty, premature flower senescence, and
accelerated
fruit ripening (Tieman et al., Proc. Natl. Acad. Sci. 97:5663-5668 (2000)).
Over-expression
of the tomato ethylene receptor protein NR resulted in tomato plants with
reduced ethylene
-2-
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
sensitivity as evidenced by increased stem and seedling elongation and reduced
necrosis in
response to a bacterial pathogen (Ciardi et al., Plant Phys. 123:81-92
(2000)). Heterologous
expression of mutant receptor proteins can also decrease sensitivity. For
example, over-
expression of the mutant Arabidopsis ethylene receptor protein ETR1-1 in both
petunia and
tomato resulted in delayed flower abscission, flower senescence, and fruit
ripening
(Wilkinson et al., Nature Biotech. 15:444-447 (1997)).
Nevertheless, until the present invention there has remained a need for an
understanding of the two ethylene-regulated developmental processes in flower
and/or leaf
abscission. Premature flower abscission results in early flower drop in the
floraculture
l0 industry, resulting in significant reduction in dollar value, or it can
greatly reduce fruit set,
e.g., in tomatoes and other fruit or vegetable crops. Reduced boll set in
cotton potentially
means a substantially loss in total yield. Thus, there has remained a need for
commercially
useful transgenic plants having reduced ethylene sensitivity in flowers to
control and prevent
premature flower abscission as well as to control the effect of senescence in
other tissues.
SUMMARY OF THE INVENTION
The present invention is directed to methods and compositions for controlled
regulation of flower longevity or abscission in transformed plants. In a
preferred
embodiment, flower longevity is enhanced and flower abscission is reduced as
compared
with untreated wild type plants. The preferred method comprises overexpressing
EIN2
and/or EIN3 in the plant, although other methods may be suitable if it results
in the same
level of enhanced flower longevity or other disclosed activity. In each case,
whenever the
term 'EIN3 gene' is used or 'EIN3 polypeptide,' it is also intended to include
EIN3-like
genes and EIN3-like polypeptides, respectively, as they are defined herein.
Accordingly the
additional phrase, specifically restating that EIN3 includes the EIN3-like
genes for the
purposes of this invention or that EIN3 is intended to include EIN3-like
polypeptides, is not
and need not be repeated, but will be understood to be present herein at each
occurrence of
EIN3 or EIN3.
In a particularly preferred embodiment, the methods comprise overexpression of
the
EIN2 and/or EIN3 genes in selected transgenic commercially useful plants, such
as flower
3o crops, including but not limited to, petunia or geranium or begonia; food
crops, including but
not limited to, lettuce and tomato; or in a plant in which the plant tissue is
useful for other
commercial purposes, such as in the fiber (e.g., cotton) or drug or
pharmaceutical industries
(e.g., cone flower) or the like; preferably to enhance flower longevity by the
regulation of
-3-
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
abscission. In an alternative embodiment, the trait of inducible premature
leaf abscission is
selected; while in yet another embodiment the selected trait comprises
enhanced leaf
longevity and reduced premature leaf abscission.
In at least one embodiment of the invention, the overexpression of the EIN2
gene is
driven or controlled by a flower abscission zone-specific promoter. In another
embodiment,
the overexpression of the EIN3 gene is driven or controlled by an inducible
promoter. In yet
another embodiment in which EIN2 and EIN3 are both overexpressed, the
overexpression of
the EIN2 gene is driven or controlled by a flower abscission zone-specific
promoter and the
overexpression of the EIN3 gene is driven or controlled by an inducible
promoter.
to It is an object of the invention to further provide a method for producing
at least one
cell line in which EIN2 is overexpressed comprising: transforming tissue from
a first
commercially useful plant with an exogenous EIN2 gene or active fragment
thereof, selected
to provide overexpression of EIN2 in a cell line displaying a strong phenotype
of enhanced
flower longevity and/or reduced flower abscission, thereby stably effecting
the
overexpression of EIN2 in that cell line of plants.
It is also an object to provide a method for producing at least one cell line
in which
EIN3 is overexpressed comprising: transforming a first commercially useful
plant tissue with
an exogenous EIN3 gene or active fragment thereof, selected to provide
overexpression of
EIN3 in a cell line displaying a strong phenotype of enhanced flower longevity
and/or
2o reduced flower abscission, thereby stably effecting the overexpression of
EIN3 in that cell
line of plants.
It is another object of the invention to provide a method for producing at
least one
cell line in which EIN2 and EIN3 together, are overexpressed comprising:
transforming a
first tissue from a commercially useful plant with an exogenous EIN2 gene or
active
fragment thereof, selected to provide overexpression of EIN2 and transforming
a second
tissue from a commercially useful plant with an exogenous EIN3 gene or active
fragment
thereof, selected to provide inducible overexpression of EIN3; then
genetically crossing the
EIN2 and EIN3 overexpressing transformed cell lines; and selecting at least
one crossed
EIN2/EIN3 overexpressing cell line displaying a strong phenotype of enhanced
flower
longevity and/or reduced flower abscission, thereby stably effect the
overexpression of
EIN2/EIN3 in that cell line of plants. In an alternative embodiment, the trait
of inducible
premature leaf abscission is selected; while in yet another embodiment the
selected trait
comprises enhanced leaf longevity and reduced premature leaf abscission.
-4-
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
In a preferred embodiment the EIN2 or EIN3 or crossed EIN2 and/or EIN3
overexpressing cell line is in a commercially useful flowering plant, such as
but not limited
to petunia, geranium or begonia; or in a commercially useful food crop, such
as but not
limited to tomato or lettuce; or in a plant in which the plant tissue is
useful for other
commercial purposes, such as in the fiber (e.g., cotton) or drug industries
(e.g., cone flower)
or the like.
It is also an object to provide a transformed plant or plant part, in which
the cells,
organs, flowers, tissues, seeds or progeny, comprise the EIN2 overexpressing
gene or active
fragment thereof; the EIN3 overexpressing gene or active fragment thereof; or
in an
to alternative embodiment, the combined EIN2 and EIN3 overexpressing genes or
active
fragments thereof. In addition, a cotton cell line produced by the foregoing
methods is
provided. The transformed plant or cell line is further provided, wherein the
genes or active
fragments thereof, comprise recombinant nucleic acids.
It is a further object to provide a transformed plant or plant part, in which
the cells,
15 organs, flowers, tissues, seeds or progeny comprise the controlled
overexpression of EIN2 or
EIN3 polypeptides, or in an alternative embodiment, the combined EIN2/EIN3
polypeptides,
encoded by EIN2 or EIN3 genes or active fragments thereof, or by combined EIN2
and EIN3
genes or active fragments thereof.
Additional objects, advantages and novel features of the invention will be set
forth in
2o part in the description, examples and figures which follow, and in part
will become apparent
to those skilled in the art on examination of the following, or may be learned
by practice of
the invention.
BRIEF DESCRIPTION OF THE FIGURES
FIG. 1 is an amino acid sequence comparison of EIN2 proteins from petunia,
tomato,
25 lettuce, and Arabidopsis. Amino acids that are conserved among all four
proteins are shown
as the consensus sequence in the bottom row.
FIG. 2 is an amino acid sequence comparison of petunia EIN3-like proteins
(PEIL-1,
PEIL-2 and PEIL-3) and Arabidopsis EIN3 protein. Amino acids that are
conserved among
all four proteins are shown as the consensus sequence in the bottom row.
3o FIGS. 3A and 3B depict two petunia flowers 8 days after treatment with 5
ppm
ethylene. The flower on the left (FIG. 3A) is overexpressing a 1.1 kb segment
of the petunia
EIN2 gene; the flower on the right (FIG. 3B) is wildtype.
-5-
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
FIGs. 4A and 4B depicts two petunia flowers 9 days after pollination. The
flower on
the left (FIG. 4A) is wildtype; the flower on the right (FIG. 4B) is
overexpressing a 1.1 kb
segment of the petunia EIN2 gene.
FIG. 5 is a photograph showing delayed flower senescence in two independent
lines
(EIN2-1 and EIN2-2) of EIN2 co-suppressed tomato plants and a wild type plant
as labeled.
Flower clusters were cut from the plant, placed in a vial of water, and
treated with 10 ppm
ethylene for 16 hours. Flowers are shown 48 hours after ethylene treatment.
FIG. 6 is a photograph of a gel showing overexpression of the TGV
transcription
factor in leaves of transgenic tomato plants. The chimeric transcription
factor TGV was
to overexpressed in tomato under transcriptional control of a constitutive
promoter. TGV
expression was quantified by RT-PCR in To plants from 10 independent
transgenic lines.
DETAILED DESCRIPTION OF THE INVENTION
The present invention is based upon the tissue specific manipulation of
several
ethylene-signaling genes, permitting the controlled regulation of flower
and/or leaf
15 abscission. As a result of the present invention, new insights into the
mechanisms involved
in the ethylene signaling pathway are evident. In a particularly preferred
embodiment of the
invention, the methods comprise overexpression of the EIN2 and/or EIN3 genes
in selected
transgenic commercially useful plants, such as flower crops, including but not
limited to,
petunia or geranium or begonia; food crops, including but not limited to,
lettuce and tomato;
20 or in a plant in which the plant tissue is useful for other commercial
purposes, such as in the
fiber (e.g., cotton) or drug industries (e.g., cone flower) or the like;
preferably to enhance
flower longevity by the regulation of abscission. In an alternative
embodiment, the trait of
inducible premature leaf abscission is selected; while in yet another
embodiment the selected
trait comprises enhanced leaf longevity and reduced premature leaf abscission
25 In wild type plants, ethylene binding to its receptor inactivates the
activity of
ethylene receptors (presumably causing a reduction in the histidine kinase
activity), and
consequently causing induction of the ethylene response through activation (de-
repression)
of the signaling pathway. Loss-of function ethylene receptor mutants have been
shown to
function as negative regulators of the signaling pathway and show significant
functional
30 overlap. Moreover, binding of ethylene to the receptors) presumably
inhibits biochemical
activity.
A number of biological stresses are known to induce ethylene production in
plants,
including wounding, abscission, bacterial, viral or fungal infection, and
treatment with
-6-
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
elicitors, such as glycopeptide elicitor preparations from fungal pathogen
cells. In the case
of abscission, a particular layer of cells in a zone located between the base
of the leaf stalk
and the stem (the abscission zone) responds to a complex combination of
ethylene and other
endogenous plant growth regulators by a process that is, to date, not fully
understood.
However, the effect of "abscission" is the controlled loss of part of the
plant, typically
localized; the result of which is visible as a dead leaf or flower, or as
softening or "ripening"
of fruit, ultimately leaving the plant wounded at the point of separation.
"Senescence" refers
to aging of a plant part, such as a flower, but it does not necessarily
involve separation of
that part from the plant. Often senescence is associated with chlorophyll
degradation, loss of
l0 nutrients from the tissue, and loss of turgor.
By "plant," as used herein, means any whole plant, or any part thereof, of
wild type,
treated, genetically manipulated or recombinant plant or plant part, including
transgenic
plants. The term broadly refers to any and all parts of the plant, including
the plant cell,
tissue, flower, leaf, stem, root, organ, and the like, and also including
seeds, progeny and the
like, whether such part is specifically named or not.
EIN2. Homologs of the EIN2 gene, as it was originally identified in
Arabidopsis
(e.g., Alonso et al., 1999), were cloned by the inventors in three diverse
species, petunia
(Petunia x hybrida) lettuce (Lactuca sativa) and geranium (Pelargonium x
hortorum). Full-
length cDNAs of the petunia and lettuce EIN2 genes shared 56 and 57%
nucleotide identity,
respectively, with Arabidopsis EIN2. An isolated 450 by region of the geranium
EIN2 gene
was found to share 67% nucleotide identity with Arabidopsis EIN2.
In a preferred embodiment of the invention, the petunia EIN2 gene is shown to
play a
critical role in regulating flower senescence. Thus, manipulating EIN2
expression, as
described herein, causes significant increases in flower longevity and flower
number in
greenhouse and field trials in a representative plant species. The increased
flower longevity
was also shown to be heritable in the progeny of primary transformants.
Consequently, the
gene manipulation provides a stable, heritable trait.
Significantly, the methods utilizing overexpression of EIN2, as demonstrated
in the
preferred embodiment in petunia, has proven to be much more effective than
antisense
expression methods described in the prior art for increasing flower life in a
commercially
useful plant species by suppressing premature or early flower abscission.
EIN3. As originally noted in Arabidopsis, the EIN3 genes comprise a small
family of
transcription factors that regulate the expression of ethylene-responsive
genes (see, e.g.,
Chao et al., 1997). Three homologs of the Arabidopsis EIN3 genes were isolated
by the
_7_
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
inventors from petunia, designated PEILI (Petunia x hybrida EIN3-like), PEIL2,
and PEIL3.
These genes share 50-59% nucleotide identity with Arabidopsis EIN3 and the
proteins share
50-73% amino acid sequence similarity. Moreover, in a preferred embodiment of
the
invention, manipulating expression of one of these EIN3 homologs, PEIL2, by
the methods
defined herein, increases flower longevity in a commercially useful plant
species by
suppressing premature or early flower abscission, as exemplified by petunia.
Significantly, as demonstrated in a preferred embodiment, it has been
demonstrated
that only overexpression of PEIL2 is effective in increasing flower longevity.
Antisense
expression of PEIL2 had no effect on flower senescence and abscission.
Moreover,
antisense expression of the other two petunia EIN3 genes, PEILI and PEIL3,
also proved to
have no effect on flower longevity.
The term "homolog," meaning biological molecules that are "homologous" to each
other, refers to the subunit sequence similarity between two polymeric
molecules, e.g.,
between two nucleic acid molecules, e.g., two DNA molecules or two RNA
molecules, or
between two polypeptide molecules. This similarity can occur either within the
same
species (e.g., PEIL1 and PEIL2 are homologs) or among different species (e.g.,
Arabidopsis
EIN2, tomato EIN2, and petunia EIN2 are also homologs). The more formal
definition is to
refer to homologs between species as "orthologs," which are chromosomal DNA
carrying
the same genetic loci. When carried on a diploid cell there is a copy of the
homolog from
2o each parent but both terms are used. When a subunit position in both of the
two molecules is
occupied by the same monomeric subunit, e.g., if a position in each of two DNA
molecules
is occupied by adenine, then they share identity at that position. The
identity between two
sequences is a direct function of the number of matching or homologous
positions, e.g., if
half (e.g., five positions in a polymer ten subunits in length) of the
positions in two
compound sequences are the same, then the two sequences share 50% identity. If
90% of
the positions, e.g., 9 of 10, are matched or homologous, the two sequences
share 90%
identity.
"Identity" refers to the percent of bases or amino acids that are identical
between two
sequences, it refers to either DNA or proteins. "Similarity" is only used in
reference to
proteins, it refers to the percent of amino acids that are similar (i. e.,
have similar structures
and polarity), but are not necessarily identical. The percent similarity of
two proteins is
always greater than or equal to the percent identity. The biological
significance of identity
and similarity is that they predict the probability that two genes or proteins
have similar
_g_
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
functions, i. e., the more similar the sequences are, the more similar the
functions are likely to
be to each other.
In an alternative embodiment of the invention, the research focussed on
cotton, with
two major goals: to reduce early-season flower abscission and accelerate late-
season leaf
abscission. Abscission of cotton flower buds ("squares") is caused by biotic
and abiotic
stress, and can significantly reduce cotton yields. Leaf abscission is
necessary to clear the
cotton plant of debris before mechanical harvesting. This is currently induced
by herbicide
application. Since cotton flower and leaf abscission are positively regulated
by the plant
hormone ethylene, these responses are, in a preferred embodiment, manipulated
by altering
to expression of ethylene signaling genes.
Square abscission is reduced through co-suppression of the cotton EIN2 gene.
Promoters were evaluated for driving EIN2 expression, e.g., a constitutive
promoter and a
flower pedicel specific promoter from a cotton chitinase gene, although the
invention is not
intended to be so limited. Other promoters suitable for this purpose would
also be known to
one of skill in the art, and their use is encompassed by the present
invention.
Preliminary work was conducted in tomato to test the efficacy of these
approaches.
Constitutive over-expression of the tomato EIN2 gene was found to effectively
delay flower
abscission by at least five-fold (SX) over that of normal wild-type plants.
For example,
wild-type tomato flowers treated with ethylene abscised 24 hours after
treatment, while the
transgenic flowers remained attached to the pedicel for at least 5 days after
treatment (see
FIG. 5, and as disclosed in greater detail in the examples that follow).
Moreover, when
progeny of the primary transformants were grown, it was confirmed that the
controlled,
delayed flower abscission trait is heritable in subsequent generations.
Consequently, to extend the foregoing work into cotton. The cotton EIN2 gene
was
cloned and the clones sequenced, to permit the construct for constitutive co-
suppression to
be assembled and to be transformed into Agrobacterium. The cotton chitinase
promoter,
when evaluated in tomato, has been shown to drive pedicel-specific expression
of a marker
gene.
Cotton leaf abscission is accelerated through over-expression of the
Arabidopsis
3o EIN3 (AtEIN3) gene. Plants are developed in which chemically-inducible
promoters are
evaluated for their ability to drive AtEIN3 expression. By determining the
optimal
expression pattern for AtEIN3, developmentally-regulated promoters are
selected, although
one of ordinary skill in the art could adapt other promoters for this purpose
by following the
examples that follow herein below.
-9-
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
Since one of the promoters is inducible by ethanol, leaf abscission is
accelerated in
such plants by ethanol treatment, it becomes possible to control leaf removal
from the plants
by less expensive compositions, using methods in the field that were less
toxic to the plants
and the environment than herbicides.
Using a tomato model system, a glucocorticoid-inducible gene system was
developed
for regulating leaf abscission. In plants produced in which a glucocorticoid-
inducible
transcription factor (such as, but not limited to, TGV) was over-expressed
(FIG. 6), no
negative effects on plant growth and/or development was detected. Screening of
these plants
by recognized reverse transcriptase-polymerase chain reaction (RT-PCR)
techniques,
identified a series of transgenic lines having high levels of overexpression,
which when
crossed with a second set of transgenic plants containing the AtEIN3 gene
under
transcriptional control of a glucocorticoid-inducible promoter, demonstrate
the controlled
regulation of leaf abscission in accordance with a preferred embodiment of the
invention. In
yet another alternative embodiment, the construct comprises the transcription
factor and
AtEIN3 over-expression cassette on the same transfer DNA (tDNA).
In sum, preferred embodiments of the invention should be construed to include
nucleic acid comprising isolated EIN2 having >_ 50% identity to Arabidopsis
EIN2, which
when placed under the control of a promoter acceptable to the selected plant
species, results
in the over-expression of EIN2 in the selected plant species as demonstrated
by delayed
flower abscission. Also included is nucleic acid embodiment comprising
isolated EIN3 (or
EIN3-like gene), having >_ SO% identity to Arabidopsis EIN3, which when placed
under the
control of a promoter acceptable to the selected plant species, results in the
over-expression
of EIN3 in the selected plant species as demonstrated by inducible leaf
abscission.
In another preferred embodiment, the resulting plant lines are crossed,
resulting in
the combined effect of the over-expression of both EIN2 and EIN3, which
produces plants
having delayed flower abscission and inducible leaf abscission. Further
included within the
present invention is any mutant, derivative, or homologue of the foregoing, or
fragment
thereof, which encodes the regulated EIN2-controlled delayed flower abscission
or the
regulated EIN3-controlled inducible leaf abscission, or in a preferred
embodiment, the
3o combination thereof.
In accordance with the present invention, nucleic acid sequences include, but
are not
limited to DNA, including and not limited to cDNA and genomic DNA; RNA,
including and
not limited to mRNA and tRNA, and may include chiral or mixed molecules.
-10-
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
Preferred nucleic acid sequences include, for example, those set forth in
petunia EIN2
(SEQID NO:1), lettuce EIN2 (SEQID N0:2), tomato EIN2 (SEQID N0:3), geranium
partial
EIN2 (SEQID N0:4), begonia partial EIN2 (SEQID NO:S), and cotton EIN2 (SEQID
N0:6),
as well as modifications in those nucleic acid sequences, including
alterations, insertions,
deletions, mutations, homologues and fragments thereof encoding the regulatory
protein,
EIN2 in the ethylene response pathway resulting in plants exhibiting EIN2-
controlled
delayed flower abscission. Also provided are homologs of the Arabidopsis EIN3
genes, as
represented by those EIN3-like genes isolated from petunia, and designated
PEILI (Petunia
x hybrida EIN3-like) (SEQID N0:7), PEIL2 (SEQID N0:8), and PEIL3 (SEQID N0:9),
as
to well as those isolated nucleic acids encoding a combination of regulatory
proteins,
EIN2/EIN3. The PEIL1, PEIL2, PEIL3, and petunia, begonia and geranium EIN2
full
length or nearly full length sequences herein are novel, although partial
sequences were
available for tomato, cotton, and lettuce EIN2 in at least one public
database, such
information was previously incomplete or contained errors.
A "fragment" of a nucleic acid is included within the present invention if it
encodes
substantially the same expression product as the isolated nucleic acid, or if
it encodes
peptides) disclosed herein having the desired regulatory effects) on flower
and/or leaf
abscission.
The invention should also be construed to include peptides, polypeptides or
proteins
2o comprising EIN2 and/or EIN3 (or EIN3-like, e.g., as defined by those
encoded by PEILI, 2,
or 3) alone or in EIN2/EIN3 (or EIN3-like) combination, as encoded by the
foregoing
defined nucleic acid sequences (SEQID Nos:l-9) or any mutant, derivative,
variant, analog,
homolog or fragment thereof, having flower (and/or leaf) abscission
controlling activity in
the ethylene signaling pathway. The terms "protein," "peptide," "polypeptide,"
and "protein
sequences" are used interchangeably within the scope of the present invention,
and include,
but are not limited to the amino acid sequences corresponding to nucleic acid
SEQID NOs:
1-9, as well as those sequences representing mutations, derivatives, analogs
or homologs or
fragments thereof having having flower and/or leaf abscission controlling
activity in the
ethylene response pathway.
3o The invention also provides for analogs of proteins, peptides or
polypeptides encoded
by EIN2 or EIN3 (or EIN3-like, e.g., as defined by those encoded by PEILl, 2,
or 3) alone or
in EIN2/EIN3 (or EIN3-like) combination. "Analogs" can differ from naturally
occurring
proteins or peptides by conservative amino acid sequence differences or by
modifications
which do not affect sequence, or by both. "Homolog" as previously defined
refers to the
-ll-
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
subunit sequence similarity between two polymeric molecules, e.g., between two
polypeptide molecules.
For example, conservative amino acid changes may be made, which although they
alter the primary sequence of the peptide, do not normally alter its function.
Conservative
amino acid substitutions of this type are known in the art, e.g., changes
within the following
groups: glycine and alanine; valine, isoleucine and leucine; aspartic acid and
glutamic acid;
asparagine and glutamine; serine and threonine; lysine and arginine; or
phenylalanine and
tyrosine. Modifications (which do not normally affect the primary sequence)
include in vivo
or in vitro chemical derivatization of the peptide, e.g., acetylation or
carbonation. Also
l0 included are modifications of glycosylation, e.g., modifications made to
the glycosylation
pattern of a polypeptide during its synthesis and processing, or further
processing steps.
Also included are sequences in which amino acid residues are phosphorylated,
e.g.,
phosphotyrosine, phosphoserine or phosphothreonine.
Also included in the invention are polypeptide embodiments which have been
modified using ordinary molecular biology techniques to improve their
resistance to
proteolytic degradation or to optimize solubility or to render them more
effective as a
regulatory agent. Analogs of such peptides include those containing residues
other than the
naturally occurring L-amino acids, e.g., D-amino acids or non-naturally
occurring synthetic
molecules. However, the polypeptides of the present invention are not intended
to be limited
to products of any specific exemplary process defined herein.
"Derivative" is intended to include both functional and chemical derivatives,
including fragments, segments, variants or analogs of a molecule. A molecule
is a "chemical
derivative" of another, if it contains additional chemical moieties not
normally a part of the
molecule. However for the purposes of this invention, the derivative molecule
must still
demonstrate EIN2 or EIN3 activity or a combination thereof. Nevertheless, such
moieties
may improve the molecule's solubility, absorption, biological half life, and
the like, or they
may decrease toxicity of the molecule, eliminate or attenuate any undesirable
side effect of
the molecule, and the like. Moieties capable of mediating such effects are
disclosed, for
example, in Remington's Pharmaceutical Sciences, 18th Edition (1990), Martin
ed., Mack
Publishing Co., Pa. Procedures for coupling such moieties to a molecule are
well known in
the art. Included within the meaning of the term "derivative," as used in the
present
invention, are "alterations," "insertions," and "deletions" of either
nucleotides or peptides,
polypeptides or the like.
-12-
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
A "variant" or "allelic or species variant" of a protein refers to a molecule
substantially similar in structure and biological activity to the protein.
Thus, if two
molecules possess a common activity and may substitute for each other, it is
intended that
they are "variants," even if the composition or secondary, tertiary, or
quaternary structure of
one of the molecules is not identical to that found in the other, or if the
amino acid or
nucleotide sequence is not identical. A fragment of a polypeptide is included
within the
present invention if it retains substantially the same activity as the
purified peptide, or if it
has EIN2 or EIN3 (or EIN3-like, e.g., as defined by those encoded by PEILI, 2,
or 3) alone
or combined controlled EIN2BIN3 (or EIN3-like) activity resulting in delayed
flower
to abscission andJor with inducible leaf abscission.
In accordance with the invention, the EIN2 or EIN3 (or EIN3-like, e.g., as
defined by
those encoded by PEILI, 2, or 3) nucleic acid sequences employed in certain
embodiments
may be exogenous sequences. Exogenous or heterologous, as used herein, denotes
a nucleic
acid sequence which is not obtained from and would not normally form a part of
the genetic
makeup of the plant, cell, organ, flower or tissue to be transformed, in its
untransformed
state.
Transformed plant cells, tissues and the like, comprising nucleic acid
sequences of
EIN2 and/or EIN3 (or EIN3-like, e.g., as defined by those encoded by PEIL1, 2,
or 3), such
as, but not limited to, the nucleic acid sequence of SEQID NOs: 1-9, are
within the scope of
2o the invention. Transformed cells of the invention may be prepared by
employing standard
transformation techniques and procedures, such as, but not limited to, those
set forth in
Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring
Harbor
Laboratory Press, Cold Spring Harbor, N.Y. (1989).
By the term "nucleic acid encoding" the resulting plant cell and the like
having
controlled flower and/or leaf abscission activity, as used herein, is meant a
gene encoding a
polypeptide capable of controlling the abscission as described above. The term
is meant to
encompass DNA, RNA, and the like.
As described in the following Examples, EIN2 and EIN3 genes (including EIN3-
like
genes, e.g., as defined by PEILl, 2, or 3) encode proteins having specific
domains located
therein, for example, terminal extensions, transmembrane spans, TM1 and TM2,
nucleotide
binding folds, a putative regulatory domain, and the C-terminus. A mutant,
derivative,
homolog or fragment of the subject gene is, therefore also one in which
selected domains in
the expressed protein share significant identity (at least about 50% identity
to that of
Arabidopsis) with the same domains in the preferred embodiment of the present
invention so
-13-
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
long as the activity of the expression product is that of EIN2 or EIN3,
including EIN3-like
protein as it is herein defined. It will be appreciated that the definition of
such~a nucleic acid
encompasses those genes) having at least about 45-50% identity to
corresponding genes) in
Arabidopsis, in any of the described domains contained therein.
In addition, when the term "identity" is used herein to refer to the domains
of these
proteins, it should be construed to be applied to identity at both the nucleic
acid and the
amino acid levels. Significant identity between similar domains in such
nucleic acids or
their protein products is considered to be at least about 45-50%, preferably
the identity
between domains is at least about 50%, more preferably at least about 60%,
more preferably,
l0 at least about 70%, even more preferably, at least about 80%, yet more
preferably, at least
about 90% and most preferably the identity is about 99%, or in the protein
expression
products thereof.
According to the present invention, preferably, the isolated nucleic acid
encoding the
EIN2 or EIN3 polypeptide(or EIN3-like,polypeptide, e.g., as encoded by PEILl,
2, or 3)
I S alone or as combined, or fragment thereof, is full length or of sufficient
length to effect
controlled regulation over flower longevity and abscission, as well as in some
embodiments,
leaf abscission, in resulting plant(s). In one embodiment the nucleic acid is
at least about
500, in another it is at least about 1000 nucleotides in length. More
preferably, it is at least
2000 nucleotides, even more preferably, at least 3500 nucleotides, yet more
preferably, at
20 least 4000 nucleotides, and even more preferably, at least 4900 nucleotides
in length. In
another embodiment, preferably, the putative or purified preparation of the
isolated
polypeptide(s) having abscission-controlling activity in the ethylene signal
system is at least
about 160 amino acids in length, in another it is at least 300 amino acids in
length. More
preferably, it is at least 500 amino acids, even more preferably, at least
1000 amino acids, yet
25 more preferably, at least 1200 amino acids, and even more preferably, at
least 1600 amino
acids in length. In an additional embodiment the polypeptide encodes the full
length EIN2
protein (e.g., as encoded by SEQID Nos:l-6) or EIN3 protein (including EIN3-
like protein,
e.g., as encoded by PEILI, 2, or 3) or a regulated combined EIN2/EIN3 version
thereof.
The invention further includes a vector or vectors comprising a gene encoding
EIN2
30 and/or EIN3 (or EIN3-like, e.g., as defined by those encoded by PEILl, 2,
or 3). DNA
molecules composed of a protein gene or a portion thereof, can be operably
linked into an
expression vector and introduced into a host cell to enable the expression of
these proteins
by that cell. Alternatively, a protein may be cloned in viral hosts by
introducing a "hybrid"
gene operably linked to a promoter into the viral genome. The protein may then
be
-14-
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
expressed by replicating such a recombinant virus in a susceptible host. A DNA
sequence
encoding a protein molecule may be recombined with vector DNA in accordance
with
conventional techniques. When expressing the protein molecule in a virus, the
hybrid gene
may be introduced into the viral genome by techniques well known in the art.
Thus, embodiments of the present invention encompass the expression of the
desired
proteins in either prokaryotic or eukaryotic cells, or viruses, which
replicate in prokaryotic or
eukaryotic cells. Procedures for generating a vector for delivering the
isolated nucleic acid
or a fragment thereof, are well known, and are described for example in
Sambrook et al.,
supra. Suitable vectors include, but are not limited to, disarmed
Agrobacterium tumor
l0 inducing (Ti) plasmids (e.g., pBINl9) containing a target gene under the
control of a vector,
such as the cauliflower mosaic (CaMV) 35S promoter (Lagrimini et al, Plant
Cell 2:7-18
(1990)) or its endogenous promoter (Bevan, Nucl. Acids Res. 12:8711-
8721(1984)), tobacco
mosaic virus and the like.
Once the vector or DNA sequence containing the constructs has been prepared
for
15 expression, the DNA constructs may be introduced or transformed into an
appropriate host.
Various techniques may be employed, such as protoplast fusion, calcium
phosphate
precipitation, electroporation, or other conventional techniques. As is well
known, viral
sequences containing a "hybrid" protein gene may be directly transformed into
a susceptible
host, or first packaged into a viral particle, and then introduced into a
susceptible host by
2o infection. After the cells have been transformed with the recombinant DNA
(or RNA)
molecule, or the virus or its genetic sequence is introduced into a
susceptible host, the cells
are grown in media and screened for appropriate activities. Expression of the
sequence
results in the production of the protein of preferred embodiments of the
present invention.
Procedures for generating a plant cell, tissue, flower, organ or a fragment
thereof, are
25 well known in the art, and are described, for example, in Sambrook et al.,
supra. Suitable
cells include, but are not limited to, cells from yeast, bacteria, mammal,
baculovirus-infected
insect, and plants, with applications either in vivo, or in tissue culture.
Also included are
plant cells transfornled with the gene of interest for the purpose of
producing cells and
regenerating plants having modulated flower and/or leaf abscission capability.
Suitable
30 vector and plant combinations will be readily apparent to those skilled in
the art and can be
found, for example, in Maliga et al., 1994, Methods in Plant Molecular
Biology: A
Laboratory Manual, Cold Spring Harbor, New York).
Transformation of plants may be accomplished, e.g., using Agrobacterium-
mediated
leaf disc transformation methods described by Horsch et al., 1988, Leaf Disc
-15-
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
Transformation: Plant Molecular Biology Manual) or other methods known in the
art.
Numerous procedures are known in the art to assess whether a transgenic plant
comprises
the desired DNA, and need not be reiterated at this point.
The expression of the desired protein in eukaryotic hosts requires the use of
eukaryotic regulatory regions. Such regions will, in general, include a
promoter region
sufficient to direct the initiation of RNA synthesis. Preferred eukaryotic
promoters include,
but are not limited to, the SV40 early promoter (Benoist et al., Nature
(London) 290:304-310
(1981)); the yeast gal4 gene promoter (Johnston et al., Proc. Natl. Acad. Sci.
(USA)
79:6971-6975 (1982)) and the exemplified pYES3 PGK1 promoter. In addition,
inducible
promoters are used as described below. As is widely known, translation of
eukaryotic
mRNA is initiated at the codon encoding the first methionine. For this reason,
it is
preferable to ensure that the linkage between a eukaryotic promoter and a DNA
sequence
which encodes the desired protein does not contain any intervening codons
which are
capable of encoding a methionine (i.e., AUG).
The desired protein encoding sequence and one or more operably linked
promoters
may be introduced into a recipient prokaryotic or eukaryotic cell either as a
non-replicating
DNA (or RNA) molecule, which may either be a linear molecule or, more
preferably, a
closed covalent circular molecule. Since such molecules are incapable of
autonomous
replication, the expression of the desired protein may occur through the
transient expression
of the introduced sequence. Alternatively, permanent expression may occur
through the
integration of the introduced sequence into the host chromosome. For
expression of the
desired protein in a virus or plant, the hybrid gene operably linked to a
promoter is typically
integrated into the viral genome, be it RNA or DNA. Cloning into plants is
well known and
thus, one of skill in the art will know numerous techniques to accomplish such
cloning.
Cells that have stably integrated the introduced DNA into their chromosomes
can be
selected by also introducing one or more reporter genes or markers which allow
for selection
of host cells which contain the expression vector. The reporter gene or
marker, such as
kanamycin resistance, may complement an auxotrophy in the host (such as leu2,
or ura3,
which are common yeast auxotrophic markers), biocide resistance, e.g.,
antibiotics, or the
effect can be seen as a physical response, such as flower or leaf abscission
or the like. A
selectable marker gene, such as kanamycin resistance, can either be directly
linked to the
DNA gene sequences to be expressed, or introduced into the same cell by co-
transfection.
Additional elements may also be needed for optimal synthesis of mRNA. These
elements may include splice signals, as well as transcription promoters,
enhancers, and
-16-
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
termination signals. The cDNA expression vectors incorporating such elements
include
those described by Okayama, H., Mol. Cell. Biol. 3:280 (1983), and others.
In another embodiment, the introduced sequence is incorporated into a plasmid
or
viral vector capable of autonomous replication in the recipient host cell. Any
of a wide
variety of vectors may be employed for this purpose. Factors of importance in
selecting a
particular plasmid or viral vector include: the ease with which recipient
cells that contain the
vector may be recognized and selected from those recipient cells which do not
contain the
vector; the number of copies of the vector which are desired in a particular
host; and whether
it is desirable to be able to "shuttle" the vector between host cells of
different species.
1o The invention further defines methods for manipulating the nucleic acid in
a plant to
permit the regulation, control or modulation of abscission, flower or leaf
senescence, flower
maturation, fruit ripening, or response to stress. In a preferred embodiment
the method
initiates or enhances one or more of the above responses; whereas, in another
preferred
embodiment the method inhibits or prevents one or more of the above responses.
Thus, methods of the present invention define embodiments in which controlled
flower abscission activity is prevented or inhibited. By "prevention" is meant
the cessation
of flower drop for a period of time beyond which ethylene pathway-controlled
flower
abscission (or in the alternative leaf abscission) normally occurs in the
selected plant species.
By "inhibition" is meant a statistically significant reduction in flower
abscission activity (or
in the alternative leaf abscission), as compared with plants, plant cells,
organs, flowers or
tissues grown without the inhibitor or disclosed method of inhibition.
Preferably, the
inhibitor reduces flower abscission by at least 20 %, more preferably by at
least 50%, even
more preferably by 80% or greater, and also preferably, in a dose-dependent
manner. Once
inhibitors satisfying these requirements are identified, the utilization of
assay procedures to
identify the manner in which flower abscission is inhibited are particularly
useful.
Similarly, methods of the present invention are defined in which leaf
abscission
activity is "induced," "initiated," "stimulated" or "enhanced" if there is a
statistically
significant increase in the amount of controlled leaf abscission activity, as
compared with
plants, plant cells, organs, flowers or tissues grown without the enhancer or
disclosed
method of enhancement. Preferably, the enhancer increases controlled flower
and/or leaf
abscission by at least 20 %, more preferably by at least 50%, even more
preferably by 80%
or greater, and also preferably, in a dose-dependent manner. Once enhancers
satisfying these
requirements are identified, the utilization of assay procedures to identify
the manner in
which controlled leaf abscission is enhanced are particularly useful.
-17-
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
In a preferred embodiment of the invention the enhanced leaf abscission is
under the
control of an inducing composition. For example, encompassed are EIN3 cDNA
sense and
antisense constructs (including EIN3-like cDNA as defined herein), wherein
inducible
promoters, such as a glucocorticoid-inducible promoter (Bohner et al., Plant
J. 19:87-95
(1999)) or an ethanol-inducible promoter (Salter et al., Plant J. 16:127-132
(1998)), or an
ecdysone agonist-inducible promoter (Martinez et al., Plant J. 19:97-106
(1999)) or others,
are incorporated to regulate the expression of the gene. Over-expression of
EIN3 in
Arabidopsis was shown to induce several ethylene responses, including
inhibition of leaf
expansion. Since growth was severely reduced in EIN3 over-expressing
Arabidopsis lines,
l0 an inducible promoter was used to prevent undesirable pleiotropic effects
of the transgene.
When leaves were treated, for example in the glucocorticoid inducible promoter
model,
treatment involves the application of a solution of glucocorticoid
dexamethasone, and the
result is severe leaf epinasty of the transgenic plants.
A selected glucocorticoid-inducible transcription factor is TGV, which is
essential
for the operation of EIN3. TGV (a chimeric gene comprising a tetracylene
repressor, a
~lucocorticoid receptor, and the transcriptional activator VP16) allows
chemical induction of
EIN3 expression, which in turn accelerates leaf abscission. The DNA samples
from 10
independent transgenic lines (a portion of the TGV gene that was amplified
from RNA
isolated from leaves of the transgenic tomato plants by RT PCR), were run in a
1 % agarose
gel in TBE buffer at 120 V for 1 hour as shown in FIG. 6. The ladder is a 1 kb
DNA ladder
from Invitrogen (Carlsbad, CA).
Similar inducible effects were seen for the other constructs, such as when the
selected
transgenic plants were sprayed with ethanol solution or the ecdysone agonist,
muristeroneA.
However, for cost and efficiency purposes, the ethanol-inducer is a good
selection for field
use. By comparison, treatment of wild type plants with each of the chemical
inducers had no
visible effects on growth or development.
Selected embodiments of the invention further contain constructs comprising
other
regulatory genes in a sense or antisense direction, in addition to EIN2 and/or
EIN3, alone or
in EIN2/EIN3 combination. For example, when the constructs further contained
an
antisense copy of CTRL (a negative regulator of ethylene response), the
transcriptional
control of the inducible promoters, the ethylene response and resulting leaf
abscission was as
previously noted. However, the effect of treatment of the CTRL antisense
plants with
dexamethasone, ethanol, and muristeroneA resulted in a rate of leaf abscission
that was less
rapid as compared with that which was seen in plants in which EIN3 was over-
expressed.
- ~8 -
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
The invention further features an isolated preparation of a nucleic acid that
is
antisense in orientation to a portion or all of a plant gene, such as is
described for constructs
comprising the antisense CTR 1 gene. The antisense nucleic acid should be of
sufficient
length as to inhibit expression of the target gene of interest. The actual
length of the nucleic
acid may vary, depending on the target gene, and the region targeted within
the gene.
Typically, such a preparation will be at least about 15 contiguous
nucleotides, more typically
at least 50 to even more than 500 contiguous nucleotides in length.
As used herein, a sequence of nucleic acid is considered to be antisense when
the
sequence being expressed is complementary to, and essentially identical to the
non-coding
l0 DNA strand of the selected gene, but which does not encode the expression
product of the
gene, such as CTRL. "Complementary" refers to the subunit complementarity
between two
nucleic acids, e.g., two DNA molecules. When a nucleotide position in both
molecules is
occupied by nucleotides normally capable of base pairing with each other, then
the nucleic
acids are said to be complementary to each other. Thus two nucleic acids are
considered to
be complementary when a substantial number (at least SO%) of the corresponding
positions
in each of the molecules are occupied by nucleotides which normally base-pair
with each
other (e.g., A:T and G:C nucleotide pairs).
By "transgenic plant" as used herein, is meant a plant, plant cell, tissue,
flower,
organ, including seeds, progeny and the like, or any part of a plant, which
comprise a gene
inserted therein, which gene has been manipulated to be inserted into the
plant cell by
recombinant DNA technology. The manipulated gene is designated a "transgene."
The
"non-transgenic," but substantially homozygous "wild type plant," as used
herein, means a
non-transgenic plant from which the transgenic plant was generated. The
transgenic
transcription product may also be oriented in an antisense direction as
describe above.
The generation of transgenic plants comprising modified or exogenous sense or
antisense DNA encoding EIN2 and/or EIN3 of the ethylene signaling pathway, may
be
accomplished by transforming the plant with a plasmid, liposome, or other
vector encoding
the desired DNA sequence. Such vectors would, as described above, include, but
are not
limited to the disarmed Agrobacterium tumor-inducing (Ti) plasmids containing
a sense or
antisense strand placed under the control of a strong constitutive promoter,
such as 35CaMV
35S or under an inducible promoter. Methods of generating such constructs,
plant
transformation and plant regeneration methods are well known in the art once
the sequence
of the gene of interest is known, for example as described in Ausubel et al.,
1993, Current
Protocols in Molecular Biology, Greene & Wiley, New York.
- 19-
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
In accordance with the present invention, plants included within its scope
include
both higher and lower plants of the Plant Kingdom. Mature plants, including
rosette stage
plants, and seedlings are included in the scope of the invention. A mature
plant, therefore,
includes a plant at any stage in development beyond the seedling. A seedling
is a very
young, immature plant in the early stages of development. Transgenic plants
are also
included within the scope of the present invention, having a phenotype
characterized by
EIN2- and/or EIN3-controlled flower and/or leaf abscission. Preferred plants
of the present
invention include, but are not limited to, high yield crop species for which
cultivation
practices have already been perfected (including monocots and dicots), or
engineered
endemic species.
Preferred plants in which the EIN2-control of flower abscission is exhibited
include
any commercially useful or valuable home-grown flowering species, e.g., roses,
carnations,
or chrysanthemums, and many others, or leafy ornamental plants, such a
geranium and many
others. Preferred plants in which the EIN3-control of leaf abscission is
exhibited include any
commercially valuable or home-grown leafy green ornamental plant, such as
Ficus, palms,
and the like, in which longevity of the leaf stem on the plant (delayed
abscission) is of
particular relevance, as are harvested plants in which inducing premature leaf
abscission
facilitates mechanical or other means of harvesting. Delayed flowering in such
plants may
also be advantageous. However, a particularly preferred advantage of the
present invention
is seen in plants, particularly including commercially valuable flowering
plants, such as
cotton and the like, in which longevity of the flower on the stem (delayed
abscission) is of
particular relevance, e.g., harvested flowers or flower parts, such as in food
crops, e.g.,
broccoli, cauliflower, etc. or certain flowering herbs or spices, and wherein
harvesting, such
as by a mechanical harvester, is facilitated by the early removal of plant
leaves and plant
debris by inducing premature leaf abscission.
The present invention is further described in the following examples. These
examples are not to be construed as limiting the scope of the appended claims.
EXAMPLES
Example 1 - Homolo~s of Arabidonsis EIN2 in commercially useful species.
To isolate homologs of the Arabidopsis EIN2 gene in commercially useful plant
species, nucleotide sequences of EIN2 genes from several different species
were compared
to identify conserved regions.
-20-
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
RNA extraction and cDNA synthesis: RNA was extracted from petunia and lettuce
leaves according to the method of Reuber and Ausubel (Plant Cell 8:241-249
(1996); see
also Ausubel et al., eds, 1987; Sambrook et al., 1989, and the various
references cited
therein 1989). Briefly, approximately 500 mg of tissue was pulverized in ESPE
buffer
(ESPE buffer = 100 mM Tris, pH 8.0; SO mM EDTA; 250 mM NaCI; 1% (w/v) SDS) by
rapid mixing with glass beads. CTAB buffer (CTAB buffer = 200 mM Tris, pH
8.0;50 mM
EDTA; 2 M NaCI; 2% (w/v) CTAB available from Sigma, St. Louis, MO) was added
and
the mixture was then extracted with equal volumes of phenol and chloroform.
Nucleic acids
were ethanol precipitated, and RNA was then isolated by precipitation in 2M
LiCI. RNA
was ethanol precipitated, washed with 80% ethanol, and then resuspended in
water.
Concentration and quality of the RNA was determined by spectrophotometry and
denaturing
gel electrophoresis as outlined by Maniatis et al., 1989 and Sambrook et al.,
1989 and the
various references cited therein.
First strand cDNA synthesis was performed using a "SUPERSCRIPT"
Preamplification System in accordance with manufacturer's instruction
(Invitrogen,
Carlsbad,CA). RNA was isolated from geranium by extraction in SDS-phenol and
purification by LiCI precipitation (Kneissl and Deikman, Plant Physiol. 112:
537-547
(1996)). Geranium cDNA was synthesized by the Advantage RT for PCR Kit
(Clontech,
Palo Alto, CA).
2o Primer design for cloning of EIN2 genes: To identify sequences with
homology to
Arabidopsis EIN2, the GENBANK nucleotide sequence database was searched with
the
amino acid sequence of the EIN2 carboxyl terminus. The carboxy-terminal
sequence of
EIN2 was used to avoid isolating Nramp proteins that share strong identity
with the EIN2
amino-terminus. A number of sequences with homology to the deduced amino acid
sequence of Arabidopsis EIN2 were identified, including genes from soybean
(Glycine max),
loblolly pine (Pinus radiata), maize (Zea mays), tomato (Lycopersicon
esculentum), petunia
(Petunia hybrida), lotus (Lotus japonicus), and cotton (Gossypium hirsutum).
These
sequences were aligned using a clustal program, and areas of strong homology
between
sequences were identified.
Nucleotide sequences of these homologous regions were compared to isolate the
areas of greatest nucleotide identity. Degenerate primers were then designed
to hybridize to
these areas of strong nucleotide identity. A total of 38 degenerate primers
were used. Once
the petunia and lettuce EIN2 cDNAs were isolated and sequenced, new degenerate
primers
were designed for amplification of geranium EIN2 homologs. These primers were
designed
-21-
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
by identifying regions of strong homology among the lettuce, petunia, tomato
(Lycopersicon
esculentum) and Arabidopsis EIN2 genes.
Amplification of EIN2: Using first strand cDNA as template, the petunia and
lettuce
EIN2 genes were amplified using the Expand High Fidelity PCR System (Roche,
Indianapolis, IN) (see, e.g., PCR: The Polymerase Chain Reaction, (Mullis et
al., eds,
1994)). Several combinations of degenerate oligos were used in the preliminary
experiments
to identify pairs that lead to amplification of a product with an expected
size (see, e.g.,
Oligonucleotide Synthesis (Gait, ed., 1984)).
To determine the optimal hybridization temperature for the degenerate oligos,
amplifications were performed at 12 different annealing temperatures. The PCR
conditions
were as follows: an initial denaturation step at 94° C for 2 minutes,
followed by 40 cycles of
94° C for 30 seconds, a gradient of 47-56° C for 2 minutes, and
then 72° C for 90 seconds.
The reactions were run in a DNA Engine PTC 200 equipped with an alpha unit 96
well
assembly (MJ Research, Incline Village, NV).
Based on these experiments the degenerate primers:
YTNGAYGARTTYTGGGG (5' end)(SEQID NO:10) and
GCCTGAANGAYTGAAGAAGCT (3' end)(SEQID NO:11)
were used to generate a 1.1 kb PCR product from petunia cDNA.
For lettuce, the degenerate primers:
2o CTWGATGARTTYTGGGG (5' end) (SEQID N0:12) and
CCAHACTCCAAAGCTTATTATCAATCVGGTTTCCA (3'end)(SEQID N0:13)
were used to amplify a 1.1 kb region from lettuce cDNA.
The PCR conditions for the final experiments were as follows: an initial
denaturation
step at 94° C for 2 minutes followed by 40 cycles of 94° C for
30 seconds, 53.5° C for 45
seconds, 72° C for 90 seconds, followed by 72° C for 10 minutes.
For geranium, a total of 4
degenerate primers were evaluated. The degenerate primers:
GARCARTTTGGTGTAGC (5' end)(SEQID N0:28) and
CTCHGGCCKRCTYTCCAT (3' end)(SEQID N0:29)
were used to amplify 0.5 kb regions of the geranium EIN2 gene. The PCR
conditions were
95° C for 7 minutes followed by 40 cycles of 95° C for 1 minute,
55° C for 1 minute, and
72° C for 1 minute, and then 72° C for 10 minutes.
PCR products were cloned into a TOPO TA cloning vector according to
manufacturer's instructions (Invitrogen, Carlsbad, CA). Plasmid DNA was
isolated from
several positive colonies using the Perfect Plasmid Mini-prep kit (Eppendorf
Scientific Inc.,
-22-
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
Westbury NY). 400 ng of purified plasmid DNA was sequenced in an automated DNA
sequencer (Model # 377, PE Biosystem) using Big Dye terminator (PE Biosystems,
Foster
City, CA). Both strands were completely sequenced at least twice.
Identification of full-length cDNA sequences by RACE: A total of 38 degenerate
primers were designed, and multiple combinations of these primers were used to
amplify
regions of EIN2 cDNAs from petunia and lettuce. The remaining 5' and 3' ends
of the
cDNAs were isolated by random amplification of cDNA ends (RACE), and full-
length
cDNAs were then amplified by PCR.
Once partial cDNA sequences were identified by PCR with degenerate primers,
the
1o remaining S' and 3' cDNA sequences of the lettuce and petunia EIN2 genes
were isolated by
(RACE). The Gene Racer amplification system (Invitrogen, Carlsbad, CA) and
EXPAND
Taq polymerase (Perkin Elmer) were used for all RACE experiments. The primers
used for
RACE are listed in Table 1 (lettuce) and Table 2 (petunia). Once the sequence
of the 5' and
3' ends of each cDNA had been determined, full-length cDNAs were isolated by
RT-PCR
using the primers listed in Tables 1 and 2.
Table 1. Primers used for amplification of Lettuce EIN2 cDNA
Lettuce EIN2 SEQID NO:
Partial cDNACTWGATGARTTYTGGGG SEQID N0:12
5'
Partial cDNACCAHACTCCAAAGCTTATTATCAATCVGGTTTC SEQID N0:13
3' CA
RACE 5'-1 CCCGGTGAACCACGTAAATCGAATC SEQID N0:14
RACE S'-2 CCTGCGTTGGTTCACCATGGAAAT SEQID NO:15
RACE 3'-1 CCCAATTGTGGGGAAGGTTGTGTCT SEQID N0:16
RACE 3'-2 CCAATTGTGGGGAAGGTTGTGTCTGGAA SEQID N0:17
Full-length ATGATCTATACCCCTTCCTCTCCCCATCTCTGA SEQID N0:18
5'
Full-length CTTTCTAATCTCGACTCCCAAACCC AAACA ~ SEQID N0:19
3'
Table 2. Primers used for amplification of Petunia EIN2 cDNA
Petunia EIN2 SEQID NO:
Partial cDNAYTNGAYGARTTYTGGGG SEQID N0:20
5'
Partial cDNAGCCTGAANGAYTGAAGAAGCT SEQID N0:21
3'
RACE 5'-1 TGCTCTCGATATGACTCTGGCATAGGTTGTT SEQID N0:22
RACE 5'-2 GAACCTGGAACTTGCAGATTTCAGCGGAGT SEQID N0:23
RACE 3'-1 CTGGTGGTCCTCCAAGGTTTGAACA SEQID N0:24
RACE 3'-2 TGCAGAGATGCCTTCACCTTGCAGT SEQID N0:25
Full-length ATCCCGGGATGGAATCTGAAACTCAGACT SEQID N0:26
5'
Full-length ATCCCGGGTACAAGGGAGTGGGTGAATTAACAT SEQID N0:27
3'
-23-
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
Comparison of the lettuce and petunia EIN2 genes with Arabidopsis EIN2: The
petunia EIN2 gene shares 56-86 % nucleotide identity (Table 3) and 60-88%
amino acid
sequence similarity (Table 4 and FIG. 1 ) with Arabidopsis, lettuce, and
tomato EIN2. The
lettuce EIN2 gene is 57-58% identical to the other EIN2 genes and the lettuce
EIN2 protein
shares 61-66% amino acid sequence similarity with the other EIN2s.
Table 3. Nucleic Acid Sequence Identity (%) of EIN2 cDNAs
ArabidopsisLettuce Tomato Petunia Geranium
Arabidopsis100 57 57 56 67
Lettuce 57 100 58 58 65
Tomato 57 58 100 86 68
Petunia 56 58 86 100 69
Geranium 67 65 68 69 100
Table 4. Amino Acid Sequence Similarity (%) of ElN2 Proteins
Lettuce Tomato Petunia Geranium
Arabidopsis
100 61 58 60 79
Arabidopsis
Lettuce 61 100 66 66 71
Tomato 58 66 100 88 74
Petunia 60 66 88 100 73
Geranium 79 71 74 73 100.
A 464 by region near the 3'end of the geranium EIN2 gene was isolated by RT-
PCR
using degenerate primers as described above. This region shares from 65-69%
nucleotide
identity and 71-79% amino acid sequence similarity with Arabidopsis, lettuce,
tomato, and
petunia EIN2.
FIG. 1 presents a consensus sequence comparing the amino acid sequence of EIN2
in
petunia (SEQID N0:30), tomato (SEQID N0:31), lettuce (SEQID N0:32) and
Arabidopsis
(SEQID N0:33). A "consensus sequence" offers a comparison of three or more
amino acid
sequences either within a species or among different species. Consensus
sequences are used
2o to show regions of high similarity among several sequences. Consequently,
they are used to
predict similarity of function. If several different proteins share the same
amino acid
sequence, then it is likely that they also share the same function.
As shown in the present invention, the consensus sequences (SEQID N0:34) among
the EIN2 gene expression products of the various species are strong, thus
confirming that
they are homologs of the Arabidopsis EIN2 genes. Even the lowest levels of
nucleotide
-24-
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
identity in the petunia EIN2 (56%) are still considered to be high, providing
evidence that
these genes are homologs of Arabidopsis EIN2.
Cloning of petunia EIN3 (PEIL) genes: Segments of the PEILI and PEIL2 genes
were isolated by RT-PCR using the methods described above. A third gene,
PEIL3, was
isolated from a petunia flower cDNA library by screening with radio-labeled
probes made
from the Arabidopsis EIN3 gene and three tomato EIN3 homologs (Tieman et al.,
Plant J.
26:47-58 (2001)). A full-length PEIL2 cDNA was also isolated through screening
of this
library. The remaining segments of the PEILl and PEIL3 cDNAs were cloned by
RACE as
described above.
Production of transgenic petunia plants: The function of EIN2 in regulating
petunia
flower senescence was analyzed by antisense expression and overexpression of a
1.1 kb
region of the petunia EIN2 gene under transcriptional control of the
constitutive CAMV 35S
promoter. A 1.1 kb segment of the petunia EIN2 cDNA spanning from nucleotide
2824 to
3940 was cloned into a vector downstream from a cauliflower mosaic virus
promoter
(CAMV 35S) and upstream of the Agrobacterium nopaline synthase (nos) terminus
region.
Two separate constructs were made with the EIN2 eDNA fragment in either the
sense or
antisense orientation. For the petunia EIN3 constructs, all cDNAs were under
transcriptional control of the figwort mosaic virus promoter (Richins et al.,
Nucleic Acid
Res. 15: 8451-8466 (1987)) and were followed by the nos terminus region. Three
constructs
were made containing each of the three PEIL cDNAs in antisense orientation.
These
contained a 1.9 kb segment from the 3' end of PEILI, a full length (2.7 kb)
cDNA of
PEIL2, and a 1.1 kb segment from the 3' end of PEIL3. A fourth EIN3 construct
was made
with the PEIL2 cDNA in sense orientation.
Each of the constructs was then cloned into a transformation vector containing
a gene
for kanamycin resistance within the transgene. The transformation vector was
transferred to
Agrobacterium through triparental mating. Petunia plants (cv Mitchell Diploid)
were
transformed with this construct through Agrobacterium-mediated transformation.
Analysis of transgenic plants: Approximately 100 transgenic petunia lines were
generated for each construct and evaluated for changes in flower longevity.
All plants were
grown under standard greenhouse conditions. Presence of the transgene was
confirmed in To
plants through PCR by amplifying a segment of the kanamycin resistance gene.
Two
different assays were used to determine differences in ethylene sensitivity.
Using the first screening method, flowers were cut from the plant on the day
before
anthesis and placed in vials of water. The flowers were then sealed in a glass
container and
-25-
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
treated overnight with 2-5 ppm ethylene for 16 hours. The flowers were then
placed in a
growth room and the day on which the flowers completely wilted was recorded.
Using the second screening assay, flowers were pollinated on the plant in the
greenhouse on the day before anthesis and the number of days to wilting was
recorded. Seed
was collected from plants that displayed increased flower longevity and these
plants were
also analyzed for presence of the transgene and flower longevity in subsequent
generations.
Wildtype flowers lasted an average of 1.5 days after ethylene treatment,
whereas by
comparison, overexpression of EIN2 extended flower life up to 11 days (Table 5
and FIGS.
3A and 3B). Overexpression of EIN2 also extended flower longevity after
pollination,
to increasing flower life from 2 days after pollination in wildtype plants to
up to 11 days in the
transgenic lines (Table 5 and FIGS. 4A and 4B).
Table 5. Increased flower longevity in petunia plants overexpressing the
petunia EIN2 gene.
Line Days after gassingDays after pollination
Wildtype 1.5 2
115 11 10
144 ~ 8 4
150 6 11
155 5 4
161 4 5
162 5 5
182 5 10
183 2 7
i5
Comparison with the antisense method for expression EIN2: It was also found
that
antisense expression of EIN2 did increased flower longevity, but the effect
was not as strong
as in the overexpressing lines. Antisense flowers lasted up to 5 days after
ethylene treatment
(Table G). A total of eight overexpressing and four antisense lines exhibited
enhanced flower
20 longevity. Therefore overexpression of EIN2 was more effective than
antisense expression
in extending flower life.
Table G. Increased flower longevity in petunia plants with antisense
expression
of the petunia EIN2 gene.
Line Days after gassingDays after pollination
Wildtype 1.5 2
157 3 4
158 4 4
226 4 5
231 5 4
-26-
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
Inheritance of the enhanced flower longevity phenotype: To study the
inheritance of
the enhanced flower longevity phenotype, the pollination assay was repeated on
12 plants
from each line in the subsequent (T1) generation. For two of the
overexpressing lines, 182
and 183, each plant that contained a transgene also displayed a phenotype,
indicating that the
trait was heritable (Table 7). For two of the other lines, 144 and 150, none
of the 12 plants
displayed increased flower longevity, although several plants in each line had
inherited a
transgene. In the remaining lines, some of the plants that contained a
transgene also
displayed a phenotype, while others did not, indicating that the transgene was
silenced in
some plants. In the EIN2 antisense lines, none of the T1 plants exhibited a
phenotype,
indicating that the transgene was also silenced in these plants.
Table 7. Inheritance of flower longevity phenotype ~in petunia plants
overexpressing
the petunia EIN2 gene: T1 generation.
Line % displaying phenotype% containing transgene
expected 75 75
115 27 80
144 0 70
150 0 50
155 8 NA
161 17 NA
162 17 NA
182 83 83
183 58 58
Comparison of Petunia EIN3 homologs with Arabidopsis EIN3: Two homologs of
the Arabidopsis EIN3 gene were cloned from petunia by screening a petunia
flower cDNA
library with Arabidopsis EIN3 and tomato EIN3 homologs. A third gene was
isolated by
RT-PCR. The three petunia genes share 50-59 % nucleotide identity and 50-73 %
amino
acid sequence similarity with Arabidopsis EIN3 (Table 8). The areas of
strongest homology
occurred in the amino terminal half of the protein (FIG. 2), which is the area
that seems to be
involved in DNA binding.
-27-
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
Table 8. Sequence comparison of Petunia EIN3 homologs with Arabidopsis EIN3.
Petunia Nucleotide Identity Amino Acid Similarity
PEIL1 50 50
PEIL2 59 73
PEIL3 ~ 58 70
FIG. 2 presents a consensus sequence comparing the amino acid sequence of
three
petunia EIN3-like polypeptides (PEIL1 (SEQID N0:35), PEIL2 (SEQID N0:36) and
PEIL3
(SEQID N0:37)) with Arabidopsis EIN3 (SEQID N0:38). As shown in the present
invention, the consensus sequences (SEQID N0:39) among the EIN3 (and EIN3-
like) genes
of the various species are strong, thus confirming that they are homologs of
the Arabidopsis
EIN3 gene. Even the lowest levels of nucleotide identity (50%) are considered
to be high,
l0 indicating a high probability that these genes are homologs of Arabidopsis
EIN3.
Role of petunia EIN3 genes in regulating flower senescence: To analyze the
function
of the petunia EIN3 (or EIN3-like) genes in regulating flower senescence, each
gene was
antisensed in petunia under transcriptional control of the constitutive CAMV
35S promoter.
One of the genes, PEIL2, was also overexpressed under control of the CAMV 35S
promoter.
15 Over 70 transgenic lines were produced for each construct. Only plants that
were
overexpressing PEIL2 displayed an increase in flower longevity (Table 9);
whereas by
comparison, the antisense expression of each gene had no effect.
Table 9. Petunia plants with antisense expression or overexpression of petunia
EIN3 genes.
Construct Number of lines Lines with increased
tested flower longevity
PEILI antisense 136 0
PEIL2 antisense 73 0
PEIL2 sense 117 9
PEIL3antisense 71 0
The absence of a phenotype in the EIN2 and EIN3 antisense plants demonstrates
that
overexpression is more effective in altering gene expression in petunia.
Overexpression of
PEIL2 increased flower longevity up to 9 days after gassing and 6 days after
pollination
compared to 1.5 days and 2 days, respectively, for wildtype flowers (Table
10). Therefore,
while effective, overexpression of PEIL2 was not quite as effective as
overexpression of
-28-
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
EIN2 in increasing flower longevity after pollination, since EIN2
overexpressing flowers
lasted up to 11 days.
Table 10. Increased flower longevity in petunia plants overexpressing PEIL2.
Line Days after gassing Days after pollination
wildtype 1.5 2
244 6 3
254 9 5
255 6 2
267 5 3
282 6 6
284 6 6
360 8 4
381 2 6
419 8 5
Evaluation of field-grown petunia Tl plants: Tl plants with altered expression
of
petunia EIN2 and EIN3 genes were also evaluated in field trials. Two EIN2
overexpressing
lines, 115 and 182, exhibited a three-fold increase in total flower number in
the field (Table
11), likely as a result of the greater flower longevity observed in these
lines in greenhouse
trials. EIN2 antisense and PEIL2 sense lines displayed no difference in flower
number.
_Table 11. Flower number of petunia EIN2 and PEIL2 overexpressing plants
grown in the field, T 1 generation.
Construct Flower number
Line
Wildtype - 6 ~ 1
115 EIN2 sense 18 ~ 6
144 EIN2 sense 7 t 2
157 EIN2 antisense 5 t 2
158 EIN2 antisense 4 t 2
175 EIN2 sense 9 ~ 4
182 EIN2 sense 20 ~ 5
183 EIN2 sense 9 ~ 2
226 EIN2 antisense 3 t 1
231 EIN2 antisense 7 ~ 3
282 EIN3 sense 4 ~ 2
284 EIN3 sense 8 ~ 3
In sum, as shown in variety of commercially useful plant species, the EIN2
gene
plays a critical role in regulating flower senescence. Manipulating EIN2
expression resulted
-29-
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
in significant increases in flower longevity and flower number in greenhouse
and field trials,
and the trait was shown to be heritable in the progeny of primary
transformants.
Example 2 - Enhance flower longevity and enhanced leaf abscission in cotton.
Initial work was done in tomato to evaluate the effectiveness of each
construct. Once
the construct is proven to be effective, the experiment is repeated in cotton
using an
analogous construct.
Regulation of EIN2
Plant material. Tomato (Lycopersicon esculentum cv. Pearson) and cotton
(Gossypium hirsutum cv. Coker 312) plants were grown under standard greenhouse
conditions. Flower and leaf tissue for RNA extraction was harvested, frozen in
liquid
nitrogen, and stored at -80° C.
Isolation of the cotton EIN2 genomic clone. The Arabidopsis EIN2 cDNA was used
to screen a cotton genomic library. Several cotton genomic clones were
isolated, from which
HindIII and BamHI fragments were subcloned and sequenced. Coding regions from
one of
the clones was found to have 70% nucleotide identity with the Arabidopsis EIN2
cDNA.
This clone is used for transformation of cotton.
Delay offlower abscissiora in tomato. Flower abscission was delayed in tomato
by
manipulating EIN2 gene expression. Transgenic plants over-expressing a 2.1 kb
partial
cDNA encoding the 3' end of the EIN2 gene were produced through Agrobacterium-
mediated transformation. This partial EIN2 cDNA was under transcriptional
control of
either the constitutive figwort mosaic virus promoter (Richins et al., 1987)
or an abscission
zone specific promoter from a cotton pathogenesis-related gene. Primary
transformants were
self pollinated and lines that were homozygous for the transgene were selected
from
subsequent generations.
Production of transgenic plants. Transgenic tomato (Lycopersicon esculentum
cv.
Pearson) and cotton (Gossypium hirsutum cv. Coker 312) were produced using
Agrobacterium-mediated transformation with kanamycin resistance as a
selectable marker.
Introduction and inheritance of the transgenes was confirmed by PCR using
primers specific
for the selectable marker or, for the crosses, primers specific to each
transgene. All
experiments were performed on plants that were homozygous for the transgene.
RNA isolation. Total RNA was isolated, as previously described by Ciardi et
al.,
2000. For real-time quantitative PCR, RNA samples were treated with Dnase I
(Ambion,
-30-
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
Austin, TJ~ followed by purification with a Rneasy RNA extraction kit (Qiagen,
Valencia,
CA).
Lines with Delayed Flower Abscission. To identify lines with delayed flower
abscission, flowers were tagged on the day of anthesis, and the number of days
until
abscission was recorded. Both the constitutive promoter construct and the
abscission
specific construct had similar effects on flower longevity. Unfertilized
wildtype flowers
abscised an average of 4 days after anthesis, while many of the transgenic
lines still
contained turgid unfertilized flowers for more than 20 days after anthesis.
Fertilized
wildtype flowers also abscised from the developing fruit an average of 4 days
after anthesis,
l0 while flowers on the EIN2 sense lines remained attached to the fruit for at
least 21 days after
anthesis (FIG. 1)
Based upon quantitative real-time PCR, transgenic lines with the greatest
flower
longevity also exhibited the lowest EIN2 expression levels in flowers,
indicating co-
suppression of the native EIN2 gene.
Regulation of EIN3
Induction of leaf abscission in tomato. Six different constructs are evaluated
for the
promotion of premature leaf abscission in tomato. The first construct contain
the
Arabidopsis EIN3 cDNA in sense orientation under control of a glucocorticoid-
inducible
promoter (Bohner et al., Plant J. 19:87-95 (1999)). The second and third
constructs contain
the same Arabidopsis EIN3 cDNA under control of an ethanol-inducible promoter
(Salter et
al., Plant J. 16:127-132 (1998)), or an ecdysone agonist-inducible promoter
(Martinez et al.,
Plant J. 19:97-106 (1999)). Over-expression of EIN3 in Arabidopsis is shown to
induce
several ethylene responses, including inhibition of leaf expansion. Since
growth is severely
reduced in EIN3 over-expressing Arabidopsis lines, an inducible promoter is
used in tomato
to prevent undesirable pleiotropic effects of the transgene.
Homozygous EIN3 lines are isolated as described above for EIN2, and are then
evaluated for inducible leaf abscission. Leaves are treated with the synthetic
glucocorticoid
dexamethasone by painting the upper surface of each leaf with a 10 mg/L
solution.
Dexamethasone treatment of the transgenic plants result in severe leaf
epinasty of the
transgenic plants and leaf abscission rates ranging from 2 to 4 days after
treatment. Similar
effects are seen for the other constructs when the plants are sprayed with a
10% ethanol
solution or a 1.5 mM solution of the ecdysone agonist muristeroneA. Treatment
of wildtype
plants with each.of the chemical inducers have no visible effects on growth
and
development.
-31-
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
Three additional constructs are assembled containing an antisense copy of
TCTRI,
the tomato homologue of the Arabidopsis CTR 1 gene, under transcriptional
control of the
three promoters mentioned above. Since CTR1 is a negative regulator of
ethylene response,
antisense expression of CTRL is not expected to increase ethylene response.
Leaf abscission
rates are evaluated by the methods described above.
Although treatment of TCTRl antisense plants with dexamethasone, ethanol, and
muristeroneA also induced leaf abscission, abscission is not as rapid as it
was for those
plants in which EIN3 was over-expressed, wherein abscission occurs S to 7 days
after
treatment. Since ethanol is the least expensive and least toxic of the three
chemical inducers,
to plants containing the ethanol-inducible promoter are the most easily
adaptable to field
production. Therefore, the plants over-expressing EIN3 that contain the
ethanol-inducible
promoter are the focus of further evaluation.
Combined Regulation of EIN2 and EIN3
Combining delayed flower abscission and accelerated leaf abscission. To
produce
plants with delayed flower abscission and accelerated leaf abscission, the
EIN2 over-
expressing and EIN3 over-expressing tomato lines are crossed, and plants which
are
homozygous for both transgenes (EIN2/EIN3) are selected from subsequent
generations.
The resulting EIN2/EIN3 over-expressing plants maintain the characteristics of
each line,
and exhibit delayed flower abscission along with glucocorticoid-inducible leaf
abscission.
Delayed flower abscission in cotton. A 4.9 kb genomic clone was isolated from
a
cotton genomic library. It contains approximately 2.5 kb of the cotton EIN2
coding region
set forth in SEQ ID N0:6, having 70% identity with the EIN2 gene of
Arabidopsis, that was
used for over-expression to induce co-suppression.
To delay flower abscission, a flower abscission zone specific promoter from a
cotton
chitinase gene is selected to drive expression of the cotton EIN2 gene. Cotton
is transformed
with each of these constructs and lines displaying the strongest phenotypes
are selected.
Based upon the foregoing effectiveness of the controlled over-expression of
EIN2,
independently in tomato and in cotton, to produce plant lines characterized by
greatly
reduced flower abscission, the methods and constructs of the present invention
are shown to
be applicable to any plant in which the disclosed characteristics are desired.
For example,
the disclosed methods and compositions were effective to produce commercially
useful
plants in which one wishes to cause EIN2-controlled reduction of flower
abscission.
The disclosures of each patent, patent application and publication cited or
described
in this document are hereby incorporated herein by reference, in their
entirety.
-32-
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
While the foregoing specification has been described with regard to certain
preferred
embodiments, and many details have been set forth for the purpose of
illustration, it will be
apparent to those skilled in the art that the invention may be subject to
various modifications
and additional embodiments, and that certain of the details described herein
can be varied
considerably without departing from the basic principles of the invention.
Such
modifications and additional embodiments are also intended to fall within the
scope of the
appended claims.
-33-
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
SEQUENCE LISTING
<110> CIARDI, Joseph
CLARK, David
NOURIZADEH, Saeid
TIEMAN, Denise
CIBULSKY, Robert J.
<120> Regulated Ethylene Sensitivity
to Control Flower Longevity
in a
Plant
<130> 23772-70998PCT
<140> To Be Assigned
<141> 2003-04-22
<150> 60/374,555
<151> 2002-04-22
<150> PCT/US02/34566
<151> 2002-10-28
<160> 39
<170> PatentIn version 3.2
<210> 1
<211> 4997
<212> DNA
<213> Petunia x hybrida
<400> 1
gggaaaatcc tattatgtac agagagtctt ctcttctatc
ctctctcaaa
gaaagatatg
60
tctttttcag tagatattag tgcttattct gatctgaact 1
taaatataaa
tatatattta
20
tctgagcact gcaacttttt acatacatat ttaaggacgc 1
gaaatataga
gaaagaagaa
80
ttgtgatgtc gaaagatcca attttgttct gttggatagt 2
atgatgatgt
tttaagttgt
40
taattcactt cagcattttt gtcttcttac tagtaattgg tctacaaatt ttggacattt 3
00
1/so
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
gcctgaagct tttgatattc cacttgatca gaaatcagat cagcaatctt gttgatggtg 3
aatgagtagg tgttgctgtg gtgtacttgt ttggagtttg ttgattgagt tggcagctcg 4
agaagactat catcgtgata agccgcgctt gacagatttc ttgaatatct cctataatta 4
tgtaaaagtt atggtatcct aatgcacctg ctgtgtcacc actttttctt tgtgtccatt 5
ggttttggat gcaaagtttc tcataactct ccagagatta cgaggttttt gatatcccgt 6
00
tttacccgcg ctacactgtg ctgcagtcca cagtaggagc tgcaactttg gatattaaat 6
agctgtgagg cagagcttca ctgattggca ttgtaattac tgaccttgtt ctagtcaaac 7
aggttgctta gtcatgtggt agagctagtt gactgctatc tctggggctt gctaactatt 7
taaatcaaac tatggaatct gaaactcaga ctatagctta taggcagccc agcatgcttc 8
40 -
aacgaatact ttctgcttct atgcctatgc tactgattgc aattggctat gttgatcctg 9
00
gaaaatgggc tgcaatggtt gatggaggag cccgttttgg atttgatttg atcatgctag 9
cacttctatt caattttgct gccattctgt gccagtatct ctcagcttgt atagccttgg 10
ttacagacca agatcttgcc cagatttgca gtgaagaata tggcaaagtt acatgcatat 10
tcctaggaat tcaagctgag gtttcgatga ttgccttgga cctcacaatg gttttgggta 11
ctgcacatgg gcttaatgtt gtgtttggag ttgacctttt tagctgtgtt tttctggctg 12
00
caactggtgc cattttgttt ccactgcttg catctctctt ggacaatggc agtgcaaaat 12
2/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
tcatatgcat tggctgggca agctctatac tgctctctta tgtttttgga gtggtcataa 13
gtcaacctga aagtccattc tccattggtg ggatgctgaa taagttcagt ggagagagtg 13
catttgcatt gatgagtctt cttggagcaa gtattatgcc tcacaatttt taccttcatt 14
cttctattgt acagcaaggt aaggaatcaa caaacctttc caggggagcc ctgtgtcagg 15
00
accatttttt tgccattgtt ttcgtattca gtggcatttt cctggtcaac tatgccataa 15
tgaattcagc agctaacgtg tctttcagca ctggcctttt attgcttaca tttcaggact 16
cattgtcatt gctcgatcag gtgttcagaa gttcagtggc accattcagc ataatgctag 16
ttacgtttat ttccaatcaa attacgccac taacttggga tcttggtaga caagcagttg 17
tgcacgactt attcggaatg gacattccgg gctggcttca tcatgtgaca atcagagtta 18
00
tttccgttgt tccagccctt tattgcgtat ggaactcagg agctgaagga ctatatcagc 18
tactaatagt tacacaggtt gtggttgctc ttgtgcttcc gtcttctgtc atacccctgt 19
tcagagttgc ttcttcccgg tcaataatgg gtatccataa aatttctcaa ttaatggagt 19
tcttatctct tggcacattt atcggcttac tcggcttaaa gattatattt gtcatagaga 20
tgatatttgg aaatagtgat tgggttaata atttgaagtg gagtatcggg agtggcgtat 21
00
ctactccata tgtttttcta ctcattgcag cctctttatc tctttgtctg atgctgtggt 21
tagcagttac tccgctgaaa,tctgcaagtt ccaggttcga tgctcaggca tttctccaaa 22
3/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
cacctatgcc agagtcatat cgagagcata atcaagttga tgtgagtgat actacctttg 22
gtctagaaag gtccacccaa aagcaagaac ctgcatttca tgtggaaaaa tccttgggaa 23
gccatcctga tttgtcaact tcagaccctg atgaaatctt gcccgaatca ctcttggatt 24
00
ttgagaaggt ccatcatttg actaccattg atgagagcaa atctgaaact acattttcaa 24
ccccttcttt cagctgtcct gaggtatctg catcagcagg agaaactgcg aaaagtgttc 25
tcaatgaggt gtctggtggt gaatctgtgg ataccaggga tttcaatgct gcatctgtgg 25
atgtagtaga gaagacactc agaattgaag gggacacgcc aaccgacaag gatgacgatg 26
gagattcatg ggagcctgat gacgtaccta aagatgtatc tgagaacacc caatcttata 27
00
cttctgatgg tccggaatca ttcaagagtc ttagtgtcag gtcagaagac acagggagtg 27
gtacaggaag tctatcaaga ttagcaggtc ttggtcgtgc agctaggagg cagttaacag 28
tagttctaga tgagttttgg ggacagcttt ttgattacca tgggatgccc acatcacaag 28
caaagttcaa gaaactggat gtaatactcg gtctggatac aaaagtggat ccaaaacctg 29
ccccagtgtc attaaaactg gagaacagca ggggtgattc taatgcgtat attccatctg 30
00
gtagtgcaag ggtacctgag tcatggatca actcgaatat atactctccc aagcagcaat 30
gtgcatcagg tgctctggac tctggttata gagtcccgaa ggagccagct tcatggtcta 31
gccatatgaa attattagat gcatatgtgc aaagttccag cggcaacaca cttgactcgg 31
4/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
gtgagaggcg ctatccagca tgcggattcc tgcgtcttct gctggctatg atcagcagcc 32
tgcgactgtg catggatatc agatctccgc ttacctaagt caaattgcta aaggaagagg 33
00
atctgattat ttaaatgggc aactggagtc agcatcccct cgttctgtat catcattgac 33
gtcaaaccat gctgaaccat tagctcgtgc tttggggcaa aaacctcaga gtggagtgag 34
tagtcgagca ccacctggtt ttggaagtgt ccctgcccga aataactcga tgcagcccgt 34
taacacttct actgacctta gctctacgga aaatgctgag agcgtagctg gctcagccaa 35
ctcgaagaag tattacagct tgcctgatat atcaggacgc tatgttcctc gccaagattc 36
00
ttcactccca gatgggagag ctcaatggta caattccatg ggatatggac aatctattgg 36
ccgatctgcg tacgaacaac cctatatgac tggtccaatg agggctggtg gtcctccaag 37
gtttgaacat tctccttcta aagtctgcag agatgccttc accttgcagt acagttccaa 37
ttcggggact ggatccctgt ggtctagaca gccttttgag caatttggtg tagctggtaa 38
ggctgatgtt agcagtgatc atggaactgt gcagagttca tctactcagg agagcacatc 39
00
tttggttgat ttggaagcta agctgcttca gtctttcaga agttgtattg tgaaactttt 39
gaaactggaa ggatctgagt ggttatttag gcaagatgat ggtgctgatg aggaccttat 40
agatcggatt gctgcaagag aaaaatttct ctatgaagct gaaaccaggg agataagcag 40
attgaccaat attggtgaat cacagttctc ttctaacagg aaacctggtt ctgcccaaaa 41
5/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
accagaagag atggattaca ccaagttctt agtgatgtca gttcctcact gtggggaagg 42
00
ctgtgtttgg aaagtagatc tggttgtaag cttcggtgta tggtgcattc acagaattct 42
tgagctttca ctcatggaaa gtcggccaga gctgtggggt aaatatacct attgtctcaa 43
tcgtcttcag ggcatagtag atctggcatt ttccaaaccc cgttctccaa caagtcattg 43
tttttgtctt caaattccaa ttggccggca gcaaaagtca agccccactc ccatttcaaa 44
tggaagtttg ccaccacaag caaaacaggg ccgaggaaaa tgcacaactg caccgatgct 45
00
cttagatatg atcaaagacg tggagatggc aatctcttgt cgaaagggac gaacaggcac 45
tgcagcaggg gacgtggctt ttcctaaagg gaaagaaaac ttagcatctg tcctcaaacg 46
ctataaacgt cgactatcaa ataagccagt agggaaccag gaggctggtg gaggtccaca 46
acgcaaagta acgtcaccct cgtccacatc ttttggcttg taacacttgt ttctgggttc 47
atagcaactg aattatgatc actagtgtta gagacgtgct aagttgctat gaattttttc 48
00
tgtgtctgta ctttcccttg tctccccctc atgtgtattt gaatcttgca tgttaattca 48
cccactccct tgtacctcaa atcttgtata cgtaggatat aagttgtaac gaggttgtgt 49
aactgcagca gtgaaaaatg aaacgggctg aaaggcggga aaagatatta tgcaaaattg 49
cagttttctc tcctaaa 49
97
<210> 2
<211> 4099
6/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
<212> DNA
<213> Lactuca sativa
<400> 2
ggacactgac atggactgaa ggagtagaaa ctcttcttct tctcataggc tctcagttcc
ctttctccga ctacaagata tagcttccct aggccactgt atatcttata tatacataca 1
cccatctata tctatacccc ttcctctccc catctctgaa acatcttttc ctttctttcc 1
tacgatcttt aaaccccatc tgatcggctc tgaacatatg acagattctt ggttttctca 2
agctttcatc ggaacccaaa aagcgggagt tcctattatg tgaccttcta attgatcatc 3
00
aggcgactcc aaatttataa tttaattttc gttacaaaag tttcggaaat ggacacggat 3
gccctaatct caaaacccaa atccagcgtc ctacagagac gtttcctgct gttttaccag 4
tacttttcat agcaattaca tatatcgatc ctggaaaatg,ggttgcatca atcgaaggtg 4
gggcccgttt tgggtacgat ctaatcaacc catgtctgtc tttagtttat ctgctgttct 5
ttgtcaatac ctctcagctt ccattgcagt ggtcactgga aaagatcttg cacagatatg 6
00
tagttcagag tacgatgcat taacgtgtac cttcttaggg atcgaagccg aactttccat 6
gattgcttta gatctttcta tgattttggg cgtggcacat ggacttaact tgatgttcgg 7
catggggttg ttcacttgtg ttttcttgac ttctttcgat gcgtttctct tccctatttt 7
ctccaatttg ttggagagtg gtaaagctaa gtttatgtgc atgtgtttgg caacggttgc 8
gttactttct tatctttttg gtgtggtggt gagtcaaccg gatacatcac tctccatgag 9
00
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
tggtggtatg ctaacaagat tcaatggtga aagtgttttg gcattgatta gtcttcttgg 9
tgcaagtatt atgcctcata atttttatct tcattcatct attgtgaagc aaaataaggg 10
acaagaacat gtttcaaaag gagcattgtg tcttgatcat cttttcgcca tttcgggtgt 10
tttcagtggt gtttttcttg taaattatgt tctaatgaac tcagcagcaa atgttttcta 11
cagttctggg cttgatttgc ttacttttca agatgctttg tctttaatgg atcaggtatt 12
00
taggggtgtg atgggatctt ttgcgttgat agtgatcttg ttgctttcaa atcatactac 12
agcgttgacc tggaaattcg gtggtcaacc tattcttcat aatttcttca aaatcaacat 13
cccaggatgg tttcatcact caacaatcag attcatcacc attattctag ctctcttatg 13
ttcatggcaa tctggggcag agggtacata tcagctccta atcttcactc agatattggc 14
ggcgcttttg cttccatcat ctgtgattcc cctttttcgg attgcaacat caagatcagt 15
00
aatgggggtg aataaaattt ctagggttct cgagtttttt gtgttgatca cgtttattgg 15
gatgctcagt ctagcaattg tgtttgtggt tgaaatgatg tttggaaaca gcgattgggc 16
aagtaatatc agatggaatt taggcagtgg tggatcgatt tcaagtcctt attctgtcct 16
tCttCtCdCt gCgtCtCttt cattctttct tatgctttgg cttgtggtaa cgcctttgca 17
gtctgcaagt tcgaaaccag aaattgttca cgattcatca ctgaaagaga gaacccaaca 18
00
tggaattgag caggaaacat caccggagta ccattcagat ttacaaaaat ccactcgtca 18
8/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
gcttgatttg cctgaagaaa tcatagaacc tgagaagggt tctcgtttga ctaccataga 19
tgaacagtca tctgatatct tattaccatc atcgccacca gaggaatcag gaacaggaac 19
agctgttcca ggcgttgaag atagaagcaa cttgcagaac caagaatctg aatcgatcga 20
aaagacgttg agtatagacg ggaattcaca gaaagaacat tcaccaaatc catggcagat 21
00
agaagaatca cccaaagtag tctctgaaac gaaccattta gctgtatcac ccgaaggacc 21
aggatcgttt agaagtctcg gtttgaaaca cgacgatgtg ggtagcggca ccggaagttg 22
gtcaaagttg ccggattggg ccgggctgca aggcggcaat tagctgcagt tcttgacgaa 22
ttctggggcc aacttttcga tttccatggt gaaccaacgc aggaagcaaa agcaagaaaa 23
cttgacaaat tactcggaat aaattctaag acgaacatga attcgaaggc aacaccacat 24
00
cagagtgtgc aaacgactac cgattcgatt tacgtggttc accggggccc aagctcgtct 24
tcattgttat cgaaccaaaa gcaaatacta gacgcttatg cacagaggtc aaacctcaat 25
gtgatggacc ctggtgaaaa gcgataccat agcctccgtc ttcaatcatc ttctaatggt 25
cttcgaattc ctcaagcttc tgttgggttc gatgatcaac cagctactgt tcatgggtat 26
caaatcaagt cttatatgaa tcaaatggag tcattaaccc caaaatcacc atcgtttggt 27
00
tcttcagcaa actataaagc tccgtattct ttaacgaaag gtctgcaaaa cggggtgagt 27
ccggcaaagc cacctgggtt tccggatccg gttgtgtcca ggaacagctc aatgcaaccg 28
9/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
gaaagatcat accagaatca gtatcctgaa acaatgcata gcactgtaaa cgagaagaga 28
tattacagta tgccctccct tcctcgtgat ggaactcttg gccggaaaat gcatgatatg 29
tcgatttatt caggcccttc gtataataga tccgggactc cttcagccta taccggttct 30
00
taccagttga attcaggagc agacacatgg tccatttggt ccagacaacc ttacgaacaa 30
tttggtgtag ctgaaaaatc aaacagtaga atgagtttaa acagtcaaga aattggttct 31
ggggttgatt tagaagcaaa tcttctgaaa tctttgagac tttgtatcgt gaagctgtta 31
aaacttgaag gatccgattg gttgtttcag cagaacagtg gtcttgacga agaccttgtt 32
gaccgtgtag ccgctaggga gcggttcctg tatgaagtcg agagtaagga gatgaacggg 33
00
gcggctcacg gcggcgattc ggggatgaaa atcgatctgg tgacctcgat tcccaattgt 33
ggggaaggtt gtgtctggaa ggctgatttg ataacaagct ttggtgtgtg gtgtatacat 34
agggttcttg agctttcgct catggaaagc cggccggagc tttgggggaa atacacttac 34
gttcttaatc gtcttcaggg tatactagag ctagcgttct ccaaaccacg ggccgcaatg 35
aatccatgtt tctgtctgca acttccgact tcctatcagc agcgaagggt gtctccgcct 36
00
aaatcagcca ccagtcttcc gccgccggcg aaacagagca agggtaaatg cacgacggcc 36
gccagtctgt tggatatagt gaaggatgtg gagattgcga tttcttgtag aaaaggtcga 37
acagggactg cggcgggtga cgtggcgttc ccgaaaggaa aagagaactt ggcgtctgtt 37
10/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
ctaaagcgat ataaacggcg gttgtcgaat aagccggcgg taactccaga tggagtaaat 38
gggccccaca agactgccat gtcagcatct tatgggttgt gattgtgatt gaccctaaat 39
00
gcccaatttt gtttgggttt gggagtcgag attagaaagg aggttgttgt cgttatgtgg 39
tttgtaaatg tttttacgtg gacgacaaaa gggaatcgat ggttgatttt ctttcttttg 40
agttttgatg ttgttgaagg ggttattgga ggaatggaat tggaaaccaa acattatgcc 40
aaaaaaaaaa aaaaaaaaa 40
99
<210> 3
<211> 4452
<212> DNA
<213> Lycopersicon esculentum
<400> 3
tcttcatgtc cattgctttt gggtgcaaac ttgctcaaaa ttctccagag ataacgaggg
gttttggtat cctgttctaa ccgtgctaca ttgagctaca gtctacagtt ggagctgcag 1
ctgctacata gaaaagctgt gtggtcggaa cttggaactt cactggttgg attgtgagct 1
tgttcatgtc aaatgggttg ctaagtgatg ctgtagtgct agtttactgc gatctctggg 2
cttgctaacc atttaaatca aataatggag tctgaaactc tgactagaga atataggcag 3
00
cccagcatgc ttcagcgagt actttctgct tctgtgccaa tgctgttgat tgcagttggc 3
tatgttgatc ctgggaaatg ggctgcaatg gttgatggag gagcccgatt tgggtttgat 4
ttggtcatgc tagtactctt gttcaatttt gctaccattc tgtgccagta tctgtctgct 4
11/so
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
tgtatagcct tggttacaga ccgagatctt gcgcagattt gcagtgaaga atatgacaaa 5
gttacatgca tattcctagg aattcaagct gaggtttcga tgattgcttt ggacctcaca 6
00
atggttttgg gcactgccca tgggcttaat gttgtgtttg gagttgacct gtttagctgt 6
gttttcctga ctgcaaccgg tgccattttg tttccactgc ttgcttctct ctttgacaat 7
ggcagtgcaa aattcttatg tattggctgg gcaagctctg tactgctctc ttatgttttt 7
ggagtggtta taactctacc tgaaactcca ttctccattg gtggtgtgct gaataagttt 8
agtggagaga gtgcatttgc attgatgagt cttcttggag caagtattat gcctcacaat 9
00
ttttacctcc attcttctat tgtacagcaa ggtaaggaat caacagagct ttccagggga 9
gctctgtgtc aggaccattt ttttgccatt gttttcatat tcagtggcat tttcctggtc 10
aactatgccg cgatgaattc agcagcgaat gtgtcttaca gtactggcct tttgttgctg 10
acatttcagg acacattgtc attgctcgat caggttttca gaagctcagt tgcaccattc 11
accataatgc tggttacatt tatttccaat caagttacac cactaacttg ggatcttggt 12
00
agacaagcag ttgtgcatga cttatttgga atggacatcc caggctggct tcatcatgtg 12
acgatcagag ttatttccat tgtcccagct ctttattgtg tatggagttc aggagctgaa 13
ggcctatatc agttacttat actgacacag gttgtggtgg ctcttgtcct tccatcttct 13
gtcatacccc tgttcagagt tgcttcttcc agatcaatta tgggtatcca caaaatttct 14
12/so
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
cagttaatgg agttcttatc tcttggcaca tttattggct tacttggcct aaagattata 15
00
tttgtcatag agatgatatt tggaaatagt gattgggtta ataatttgaa gtggaatatt 15
gggagtagtg tgtctactcc atatgttttt ctcctcatcg cagcctcttt atgtctttgt 16
ctgatgctgt ggttagcagt tactcctctg aaatctgcaa gttccaggtt cgatgctcag 16
gcgtttctgc aaacgcatgt gcctgagcca tattcagagt gtaatcaact tggtgcgatt 17
aatgctatgt ttggtctagt agaaggatcc tcccaaaagc aagaaggtgc atttcatgtg 18
00
gaaaaatcct tggtaaccca tccagattta tcaactaaag atcctgatca actcttgcca 18
gaatctctct tggattttga aaaggtccat cagttggcta ctattgatga gagcaaatct 19
gaaacaacat tttcagctcc tgctgtcgtt catcctgagg tacctgtatc agcaggagca 19
agtcccagtg tgaaaagtgt ttgtaatgag gtttctggtg ttgtatcagt ggataccagt 20
gtcttcaata ctgaaactgt ggatgtcgca gagaagactc tcagaattga aggggacatg 21
00
gcaaatgaca gggatgatgg agattcgtgg gaagagcctg aagaggcaat caaaggagta 21
tctgagaacg ctcaatcttt tatttctgat ggtccggggt catacaaaag tctaagtgga 22
aaactagagg acacggggag tggtacagga agtctatcaa gattagcagg tcttggtcgt 22
gcagctagga ggcagttaac agaagctcta aatgagtttt gggggcagct ttttgattac 23
catggcatgg caacagcaga agcgaagtcc aagaaactgg atataatact tggtctggat 24
13/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
00
23772-70998.ST25.txt
tcaaagatga atccaaaacc tgcccctgca tcattaaaag ttgaaagcag tgcgtatatt 24
ccatcgggga gtgcaaggat accagagcct ctgatcaact cgcatgtgta ctctcccaag 25
cagcaatttg cgtctaacat tgtggactct gcttatagag tcccaaagga gccatcttcg 25
acatcttcta tgtggtctaa ccatatgaaa ttagtaggtg catatgtgca aagttccaac 26
agcaacatgc ttgactcagg ggagaggcgc tattctagta tgcggattcc agcgacttct 27
00
gctggctatg atcagcagcc tgccactgtg catggatatc agattactgc ttaccttaat 27
caacttgcga aagaaagagg atctgattat ttaaatgggc aactggagtc accatctcct 28
cgttctgtat catcactgac gtcaaactat gcagaaccat tggctcgtgt ttcggggcaa 28
aaacctcaga gtggagtcag tagtcgagca ccacctggtt ttggaaatgt ccctgtaggc 29
cgaaataatt cgatgcagcc cactaacact acttctgtcg accatagctc tactgaaact 30
00
gctgaaagcg tggctggttc agccaactct aagaagtact acagcttgcc tgatatctca 30
gggcgctatg ttcctcgcca agattctata gtgtcagatg cgagagctca atggtacaat 31
tccatgggat tcggacaatc tggtggtcga tctacatacg aacaagccta tatgagtggt 31
tcactaaggg caggtggtcc tcagaggtat gaacattctc ctaaagtctg cagagatgca 32
ttctccttgc agtacagctc caattcaggg aatggatccc tgtggtctag acagcctttt 33
00
gagcaatttg gtgtagctgg taagccagat gttggtagcg gcgatcatgg aactgtgctg 33
14/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
agttcctctg ctcaagagag tacatctacg gttgacttgg aagctaagct gcttcagtct 34
ttcagaagtt gtattgtgaa acttttgaaa ctggaaggat ctgagtggtt atttaggcaa 34
gatgatgggg ctgatgagga tcttataggt cggattgctg caagagagaa atttctctat 35
gaagctgaaa ctagggagat aagtagattg accaacattg gtgaatcaca cttctcttcc 36
00
aacaggaaac ccggttctgc cccaaaacct gaagagatgg attacaccaa gttcttggtg 36
atgtcagttc cccactgcgg agaaggttgt gtttggaaag tagatctgat tataagcttc 37
ggtgtgtggt gcattcacag aattcttgag ctttcactta tggaaagtag gccagagttg 37
tggggcaaat atacctatgt tctcaaccgt cttcagggca tagtagatct ggcattttca 38
aagccccatt ctccgacgag ccattgtttt tgtcttcaaa ttccggctgg ccgccagcaa 39
00
aaggcaagcc cccctccaat ttctaatgga aacttgccgc cacaagcaaa acagggtcga 39
ggaaaatgca cgactgcagc aatgctctta gagatgatca aagacgtgga gacagcaatt 40
tcctgtcgaa agggacgaac gggcactgca gcaggggatg tagcctttcc taaaggaaaa 40
gagaacctgg catccgtcct caagcgctat aaacgtcgat tatccaataa gccggtagga 41
aaccaggagg tggctggagt cgccggaccg cgcaaagtaa cgctgtctgc ctcatcaccc 42
00
cctttcgtct tgtaacgctc ttttctcagt tcatagcaaa tgactggtga gatcaccatt 42
gttagacttg ttcttagttt ctgtgaatta tCCCCCCCtC CCCaaCtata CCtCCCttgC 43
15/so
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
acctcatgtg tattttgaat ctttgcagct tattcacccc catcccttgt acctcaatct 43
gtatacatag gataaaatgt tgtaacgagg ttactgtaaa actgcaatgg tgaaatgaaa 44
cgggctaaaa gg 44
52
<210> 4
<211> 449
<212> DNA
<213> Pelargonium x hortorum
<400> 4
ggtgtagcag ataaaattag tgttgggact gggagtgaag ggactgaaag taggtcaggt
tcaatagctc ttgagacgac tgtagattca gaggcaaagc ttctacaatc cttcagaact 1
tgtatattga agcttttaaa attggaaggt tctgactggt tgtttaagca aaatgatgga 1
tctgacgagg atcttattga ccgcgttgct gcaagggaga ggtttcttta tgaagctgaa 2
actcgtgaga ttagccaagt cacacacacg ggggagtctc agtatctata ttctgataga 3
00
aagttcagtt cttctgtttc ttctgttccc aattgtgggg aaggctgcat ctggagagca 3
gatttgatag taagttttgg ggtatggtgc attcatcgga ttcttgttct gtcccttatg 4
gaaagccggc cggagaaggg cgaattcca 4
49
<210> 5
<211> 510
<212> DNA
<213> Begonia herbacea
16/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
<400> 5
ttctccggcc tgctttccat aagagatagg ttgagaattc ggtgaatgca ccacactcca
aaacttgtga tcagatctga cttccaaata cagtcatctc cacaatgagg aacactagaa 1
attgataaat ctctggagca agcttcggta gtcataccaa aacccgactt ttggtcagat 1
gacaagtatc taggctccgt cgattgaacc acccgattca tctccctagt ttcaacatca 2
taaagaaatc tctctctcat agctacagaa tttatgagtt cctcatcggc cccctcgttc 3
00
tgcctgaaca accaatcgga tccttccaac tttataagcc tcacaatgca atgtctgaga 3
gactgaagaa gccgcgcttc taaatccacg atcgaagcag cttcttgact gatcgaattc 4
agcatttcaa ctgcttctgt tccagaagta tgacttttat tagctacacc aaactgttca 4
agggcgaatt ccagcacact ggcggccgtt 5
<210> 6
<211> 3751
<212> DNA
<213> Gossypium hirsutum
<220>
<221> misc_feature
<222> (304)..(2866)
<223> a, c, g, or t
<400> 6
gcttattaat cttttataaa gtgcttatat ataaccagaa tgtcatgtgc aaaggtgctt
gtgcttattt gtggacttgt gttttaccct ttgcatgaaa catatatatt tcttaattta 1
20 '
tggcgataga tttgcagcga agagtatgac aagtccactc gtttattcct tggagttcaa 1
17/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
gcagagcttt ctgtggttgc gttggacctt accatggtag ctataattct ttttatttgc 2
acttaatata gtgatatttg ttctattctc atgaaaaatg tctatatttt cccaggtcct 3
00
gggngccgca catgggatta atcttctctt cggggtggat ctctccactg gtgtttttct 3
agctgctctt gatgctgttt tattcccagt ttttgcctcc accttggtat gttaaactgc 4
tttgttttat tgcacaatgt ctcccttgca acatcatagc agtctaaaca attttcaaca 4
ttaggatcac tgcagggcaa gtttcctatg catctatgca gcaggtttca tattgctttc 5
ttatgttttt ggagtgctcc tcagtcaacc agaaatttct atttccatgc ttgggatgcc 6
00
aacaaagttg agtggggaga gtgcatttgc cctgatgagt cttcttggag caagcatcat 6
gcctcacaat ttttatctac attcttctat tgttcaggta tctgcgattg gacttgtata 7
tgcatgtatg tacatgagtc ttgtatatgg gcctttatat ttcagtttta atggaggggg 7
gactcctgta ttatctgtaa atttatttca actaagaatt tgacattttc tttgtcaata 8
cttggatttt agaagcctct ttaggatctt tgcatgtgga tgctgtcctt gtagattcac 9
00
tacaatctga gtcaaatgca tgtataattt tcctcaatta gtggtcttct atagttatga 9
cattgttctc aaatataggg tcggctgatg ttcattgcac catgcttaaa tgttatgggg 10
catacaattc ttgaactgcg ggacaaattg gtgcacctta tatcttttat gcttgcaata 10
tcatttggtt tttttttatg gtcctgcctt tttacttttt ggagttcaat tttatgctat 11
18/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
tcattctcaa ctctctgaag ttttgttctt ctgtccacag gagcatctgg gaccaccaaa 12
00
tacttctaag agtgccttat gtcacaacca tctttttgcc atcttaggcg tctttggtgg 12
aatttatcta gtaaattatg tgctgatgaa ttcagctgca aatgtgttct acaatgctgg 13
ccttgtcttg gttacttttc atgatgcaat ggagcaggtt aatttctttc gcttttctga 13
taagctattg tttatgatgg ctttcaagaa tcatgtttaa atatttctca acaattgagt 14
taatatgtgg atattaataa attccttttg gaaatgatta aaacaggtat tcaggaatgg 15
00
tatactgccc ctagtctttt tgttggttat gttcttatct aatcaactta ctgcatcaac 15
ctggaatctt ggcgggcaag ttgtcttgca taatttcctt gggcttgaca taccgggttg 16
gcttcatcgt gcaacaatca aaattgtagc aattgttcca gctctttatt gtgtgtggac 16
ttctggacct gagggggtat accagatgtt tatccttgcg caggtgatgg tagcccttct 17
gttgccatct tcagtgatcc ccctttttcg ggttgcctca tcaagatcaa ttatgggtgt 18
00
ttacaaagtt tctccaattt tggagttcct atcactggta acattcatgg gaattctggg 18
tttaaagata atctttgtgg tagaaatgat atttgggagt agtgattggg ctgggaattt 19
gagattgaat gctgggatta gcatgtctgt tccttttgtt gtgcttctgg ctactgcttg 19
tgcatcgttt tctttgatgc tttggctggc agctactcct ttaaaatctg ccagttctga 20
aagtaaagct catgcatgga aatgggatat gaacagaact gtttctgaga cagctataga 21
19/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
00
23772-70998.ST25.txt
gagagaggga aatgagttaa gtgaaactag atattgtgga gaggaacctg ctcatataca 21
ggaaagatca ttagcaccag aaaactccat tgaaagtcat tcagatttat cttttccaaa 22
ttataatctg gatttgcctg agacaatcat ggagtctgag caggaaatac gtctgacaac 22
tgttaatgcg aactcttcta gtggtgaata tcctagcccc ccattctgtg gcactgagga 23
accagcatcc atacctgagt tagcttctgc tgtagttgat gaggtaacag atgatgtgcc 24
00
gggcacaaag actctgaaga ttgaatcaat gaactctctg gagaaaacag tgagttttga 24
gggagatctg catatcgaaa aagatgatga tggagattct tgggagcctg aagagccatc 25
caaacctcct ggaagtattt cctctttggc accggatgga cctccttcat tcaggagcct 25
cagcgggaaa agtgatgatg gtggcaatgg tactggaagt ctctctagat tggcaggatt 26
aggtcgtgct gcaaggcgtc aattagctgc cattcttgat gaattttggg gccaattgta 27
00
tgattttcat gggcaaccta cccaagaagc aaaggtgaag aaattagatg tactattggg 27
tgttgattca aaaccattaa aagtagatac aactgggaag gagtatggtg ggtatttccc 28
ttcggtggga ggaagaggat ctgatgcact taatggttca agcctntatg actctccaaa 28
gcatttgaag atgcaaaata gtattgattt atcacgtggg tatcctagag gatcatcatt 29
gtggtcaagc cagatgcaac aattagatgc ttatgctcaa aattctagct gtaatgtcat 30
00
ttctggtgaa aggaggtact ttagtttgcg tgctgcacca tctgctgagg catgggatta 30
2o/so
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
tcaaccagct actgtgcatg gatatcagat tgcatcttac cttaatcgaa ttgctaaaga 31
tagaagctcc aattgtttga atgatcaaat tgaattacca gcatcagatt ctcctgccat 31
gggtcctaca aattatcgag gctccctggc ttctgcatta aggcaaaaat cgcaaaatgg 32
ggtaactcct gctcagcccc ctggatttga gaatgttgca gttgctagaa gtagtgcact 33
00
acaatccgaa aggtcttatc atgacaagaa cttatctggg ataaatgata attctgggat 33
atcagtgaat acaaagaagt atcatagctt accggacata tctgggctgt ctgttcctca 34
tcgagtgccc gagaagagtg gccagtggga cagttccatt ggatatgggt tgtccattgg 34
tcggacaaat tatggaacac ccatgtattc aaatgctggg tcaagggtag gtgttccatt 35
ttcctttgat gagctttctc atttaaaggg ttatagagat gctttgcctt tacagttggg 36
00
ttcaggttct ggcactggat ccctttggtc tagacagcct tttgagcagt ttggtgtagc 36
tgacaaaagt cacactgctg gcaatgaagc agttggaagt gggttgaact cagtaactcg 37
ggatactgct tctggtgtgg atttagagtc c 37
51
<210> 7
<211> 2755
<212> DNA
<213> Petunia x hybrida
<400> 7
ctaatacgac tcactatagg gcaagcagtg gtaacaacgc agagtacgcg ggggtcccat
21/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
tttgctgtgt ataaccattt ttgacaaaag aaggaaataa aatcttacac cctttttagg 1
gtcatcaaat aaataaataa ataaatctgc tgcatttgtt gtatagagag acatggctgt 1
aatagatgat attggagttg atatcagctc ggacattgaa gtcgatgaca taagaggtgg 2
tgacatagca gaaaaggatg tcagtgatga ggagattgag ccagaagaat tggagagacg 3
00
gatgtggaag gaccgtatca agcttaagcg gctcaaggaa agacagaaac ttgcagccct 3
gcaagctgct gagaagcaga acaataagca agttagtgat caggctaggc ggaaaaaaga 4
tgtcaagagc tcaagatggg attttgaagt atatgttgaa gatgatggag gtctgcaatg 4
ctcgaggatt tgtttatggc ataattcctg ataagggtaa acctgtgagt ggtgcatcgg 5
ataacataag agcttggtgg aaggagaagg tgaagtttga taagaatggt cctgctgcaa 6
00
tagcgaagta tgaagcagag tgtcttgcaa gagaagagcg agtaggcagc caaaatggga 6
acccacaaag tgttctgcaa gacttgcaag atgctacctt aggttccctt ttgtcttctt 7
tgatgcaaca ttgtgatcca cctcaacgga agtacccgct ggagaaaggt gtctcaccac 7
cgtggtggcc aacagggaat gaggagtggt gggctaaaac gggactacct aagggccaga 8
aaccgccata taaaaagcca catgatttga agaagatgtg gaaagttggc gttctaacag 9
00
ctgtcataaa gcatatgtca cctgatattg caaagatcag gagattagtc cgacaatcaa 9
agtgtttgca ggacaagatg actgctaagg agagctcaat ttggttggct gttttaagca 10
22/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
gagaggaatc aatactccag caaccaggca gtgagaaccg atcatctagc ctagagccac 10
ctcctagaag ccgtggtgaa aagaagaaac cttccagtag cagtgacagt gactatgacg 11
ttgatggctt tgatgatggt attggctctg tttcgtctag agatgagagg agaaatcaac 12
00
cgctggatgt tcgtcctcta aatgttgttc ctccatctca ccaaagtaag gaacaaggag 12
atggacgcta tcgcaggaga aaacgtgcta ggtcaaaccc tactgagcaa cagatccaac 13
cgtctctgat acatggtgac gagcatagta acacaatact tgatataaac agttcacaaa 13
cgctgtttgt tggatgcata acaaatgaaa gcctactgct aaatgacaag agcgaagcac 14
caaagcgtgc agaaaatgaa agtgagagtc aaccagagtt gccattgcaa gactcaaacc 15
00
tttccttcgt tccgtcagct aatgtagtct ctatagagga tgcatatata ggcgctgggc 15
catcacttaa tataatgtct caaaactctg cagttgtccc gtacgaatca gggatgcatc 16
ttggtagtca agattctgct attcaacatc aatttcaaga tactcagttc catggatgcc 16
ataaagtctc tgggatgaat aatggaccac aaagttcctc attgcattat ggaactccaa 17
acaatgggtt gcattatgga cctcataatt ctgttgtacg cactgaattg caggattctg 18
00
catttgttca tggatctgaa tattctaaca tcaatcaacc tcccatgtat cactcttatt 18
cttcagctga atttgggtcc gcgcatgaag aaacacagtc ccacttggca tgcaatgaac 19
ttcagattag gccaatcaat tctggagttg gttcgtcagt gcttaatgga actggaaatg 19
23/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
atattattgg agacaatcac cattatggaa aagacatata tcagaataac catgataggc 20
aaattgagat gccttttcca tctccactta ctattggttc accagattat gcactcggca 21
00
gcccatttaa tttggggctt gatatccaaa gtcatctaga ttctcctgat tatgatttag 21
attttgacaa agagtttatg tcattctttg cctcatagac aactataagg ggaagagaaa 22
cttttagaat gagtgtgata caggtggatc ctgtttcaag gtggaacaag tctttctatc 22
agaaaatcag aagttcgact gtaagtgatg aacttagttt tcttggcaag atgtcaaatg 23
tcaattcagc gacaacaaaa tcaacttttt cctatgttgg cctaccttta catgttgaag 24
00
aaaagtgcct catgtaaatg agttatagtt tcgagattag taaaggcagg aatccagagt 24
tcttcccgtc ttatttagag gttgttagct tgctcatcat gcttaatttg tgctcgactg 25
tggtgtagca ttttggtgtt aagggtagca tgtctgtaaa gtgaaggcct aacagatggc 25
ccaatttatg acatgtcaaa tttttttccc cccttctaat attgttgtca tcattcattt 26
attatttgat tctcttttaa tcattgtaaa ttatacacat gctgagctaa cttttacgaa 27
00
ttcttttgaa atgtaacctc tacatttctt gaaaaaaaaa aaaaaaaaaa aaaaa 27
<210> 8
<211> 2670
<212> DNA
<213> Petunia x hybrida
<400> 8
ggcacgaggg aagagttgaa cagacttttt gtagcaaaaa gaaaaaaaag tatctctttt
24/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
gaggagggaa ggttgtatac ttgtccaact gcggtagttc ttggtgcttg ctgctttctt 1
ttttgaattt tagaaccgaa attcagagtt gtcaagatga tgatgtttga agaaatgggg 1
ttctgtggag atcttgattt cttccctgct ccgttaaagg aagtggaagg agctaatata 2
ctgactgagc tggagccgga accattggtg gatgatgatt atagtgatga ggagattgat 3
00
gtggatgagc ttgagaggag gatgtggagg gacaagatga agctgaaaag gctgaaagaa 3
atgactaagg gtaaggaagg cgttgatgca gtcaaacaac gccagtctca ggagcaagcg 4
aggaggaaga agatgtcgag ggcacaagat gggatcttga agtacatgtt gaagatgatg 4
gaagtatgta aagctcaggg ttttgtttat ggaattatcc cggagaaagg caaaccagtg 5
acgggggcat ctgataatct cagggagtgg tggaaggata aagtaaggtt tgatcgcaat 6
00
ggacctgcag ccatagcaaa gtaccaagct gataatgcga tccctggcaa gaatgaggga 6
tctaatccga ttggacctac ccctcacacc ttgcaagagc ttcaagatac cactcttggt 7
tctttattgt cagctttgat gcagcactgt gatcctcctc agaggcgatt tcctttggaa 7
aaaggcgttt cacctccttg gtggcccact ggacaggagg agtggtggcc tcaattgggt 8
cttccaaagg atcaaggtgc tccaccttat aagaagcctc atgatctgaa gaaggcctgg 9
00
aaggttggtg tcctcacagc ggttatcaag cacatgtctc ctgatattgc taaaattcgc 9
aagctggtaa ggcaatcaaa gtgcttgcag gacaagatga cggccaagga aagtgcaact 10
25/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
tggcttgcca tcatcaatca ggaggaggtt gtggctcgag aactttatcc tgatcactgt 10
80
ccacctttgt cctcagctgg tggtagtgga actttcacta tgaatgacag cagtgagtat 11
40
gatgttgaag gtgttgtaga tgagcctgac tttgatgttc aagagcaaaa accaaaccat 12
00
ctcgatttgc tgaatgctaa tgttgatata ttcaacgaga tgctgcccct gcaacaacaa 12
60
tctcatccaa tcaaggatga gattatctcc aacttagatt tcagtcggaa gaggaagaca 13
20
tcagatgact tggctttcat gatggatcag aagatatata cttgtgagtg tcttgaatgt 13
80
ccgcacagtg agcttcgcca tggttttcag gacagatctt ccagagacaa tcatcaatta 14
40
acttgtcttt tcagaaattc tccgcaattt ggaatttcaa attttcatat tgatgaggta 15
00
aagccggctg ccttccctca acaatacgtt cagccaaagc cagcttctct gccggttagc 15
60
gcagctccac cctcctttga tatatcagga cttggggttc ctgaagatgg gcagaggatg 16
20
atcaatgagc tcatgtcgtt ctatgataat aatgtacaag gaaataaaag ctcaatgggg 16
80
gggaatgttg tgctgtccaa agagcagcct cgtcaacagt ctaccgttca acagaacaat 17
40
tacctacaca accaagggat tgtgttggag ggtaatatct ttggagacac caatgtttct 18
00
gctaatcatg cagtgttccc acaaggagac cggtttgatc agtgcaaggt tttaacttca 18
60
ccattcaatg caggctctaa cgacaatttc catttcatgt ttgggtctcc attcaattta 19
20
caatccactg attacactga aggtctttct gtgattgcac atgataacat gccgaagcaa 19
80
26/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
gatgtcccag tgtggtacta gcaaggagat tgctcaatgt acatcaagta gccaagactt 20
tggggcacat ggatatcact tgtttcaaga gggaagatct actcataatt gatctggcct 21
00
aatcaggtgg atcttaattg ccctacaggt ctctctcagt ttggtgtttc tgttaccatg 21
tagttgtaga ggttggggga gtctgcatgg tgtaataaac aaggagtaag agacgtcctc 22
gggtatttgc catgctgggt agaacgaact tgtagatgtt ttaagtaagg tagcttttgt 22
tttgttttat gtacttctgt ataggttagc tttgtctgat attcaatctg tttaagtttc 23
tcaaataact gtacttcatc gttggctcgg agacttgtca accttttttg cgccaactgt 24
00
tacagttata ttgcaggtgc aggtgttctt gtctagtgct attgtcatgg ttgtttttag 24
aggtctacct tgtttaagtc gagcatcatg atggttgtgt gaaatcatat gttttagcat 25
cctgtatgga ttaataatga agtgttgtaa cttctatcag atgttctgtt ttattgccct 25
cctccaaatt tgtttccatg taaattgttg atttgttgaa attgaatggt tggtttgcta 26
aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 26
<210> 9
<211> 2351
<212> DNA
<213> Petunia x hybrida
<400> 9
agtattaaaa attctagtag agtagttcta tttctataac tccctctaca gtctaaaggg
tcaattattc tcaaataaga gaaacagttg aattaacttc attttgagga cggaagatca. 1
27/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
tgtgatttga ttgatttcat agatttgacg ctgcatattg gataatctgt agatttttgc 1
tatagctgct ttatcctgtt tgaattgtta gtgtcttagg gagtgctctt cctgtcaaga 2
tgatgatgtt tgatgaaatg gggttttgtg gtggcgatct tgattttttt cctgctccgc 3
00
taaaggaagt ggaaacgact gctcctttga ctgagccaga gccagagccg gtggtggatg 3
atgattatag tgatgatgag attgatgtgg atgagctgga gaggagaatg tggagggaca 4
agatgaagct gaagaggctg aaagagacca ctaaaagtaa ggaaggtgtt gatcctgcaa 4
aacaccgtca gtctcaggag caggcgagga ggaagaagat gtcaagggca caggatggga 5
tcttgaagta catgttgaaa atgatggaag tatgtaaagc tcagggtttt gtttatggta 6
00
tcattccgga aaaaggcaag ccagttggtg gggcatctga taatctaagg gagtggtgga 6
aggataaagt gaggtttgat cgcaatggcc ctgcagccat agccaagtac caagctgatc 7
atgctatccc aggcatgaat gagggatcta atccagttgg tcctacacct cacaccttgc 7
aggagctaca ggataccacc cttggttcat tattatcggc attgatgcag cactgtgatc 8
ctcctcagag aagatttcca ttggagaaag gtgttccccc gccatggtgg cctactggac 9
00
aggaggattg gtggcctcaa ttgggtttgc agaaggatca aggtcctcct ccttataaga 9
agcctcatga tctgaagaag gcgtggaagg ttggcgtcct cacagcagtg atcaagcaca 10
tgttccccga tattgctaaa atccgcaagc tggtaaggca gtcaaagtgc ttgcaggata 10
28/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
agatgacagc caaggaaagt gcaacttggc ttgccatcat cagtcaggag gaagctttgg 11
ctcgagaact ctatcctgat cgctgcccac ctttgtcctc agctggtggc agtggaactt 12
00
tcactttgaa tgacagcagt gagtatgatg ttgaaggtgc tcaagatcct aactttgaca 12
ttcaagagca aaaaccggac catctcactt tgtttaatat aagtgcggag agattcatgg 13
aaaggctgcc actgcagcaa caatctcatc caaacaatga tgaaataatc accaacttag 13
attttactcg gaagaggaag caagcaaatg aaccgactgt tgtgatggat caaaagatct 14
atacatgtga gtttcttcaa tgtcctcaca acgaacttcg acatggtttt caggacagat 15
00
ctgccagaga caatcatcaa tttgcttgcc cttttagtaa ttcttcccga tttggagttt 15
caaactttca catcaatgat gtcaaaccag ctgtctttcc tcaccattat ggccagccaa 16
aatcagctgc tcagcctgtt aatcaaggtc caccttcctt tgatctatct ggtgcaggag 16
ttcctgaaga cggacaaaag atgattaatg agcttatgtc attctatgat tgtaatatac 17
aaggaaataa aaaccaaatt gcagggaata ttacactgac caaagagcag cctcatcaac 18
00
aacctcgtgt acaccaggac aattacctac accaagggat agtggatgga aatatcttca 18
aagatgctaa tgtatctgca agtcactcta tactcccaca aggcgatctg tttgatcagt 19
gcaaggctct aaattcacca ttcaatggag gctctaatga caatttccat tttacgtttg 19
ggtctccgtt caatttacag actaccaatt acactggaaa tctacctggc attggatatg 20
29/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
ataccacacc gaagcaaaat gctccaattt ggttctaagc agtagattat tgacatgtat 21
00
atcaagtagt caagtgggga agacccccat atatttggtc tgctatgtca ggtggatttt 21
atatcactta tagttctctt agttatggtg tttctagtta cctctgtgta gaggttgaag 22
aactaggcat ggtgtaacaa acgagggtga agctaaccct caaatatttg ccatgtttct 22
tatagaacat gtagatatct tataaataag ttagactgtt tgtgttatct gtaaaaaaaa 23
aaaaaaaaaa a 23
51
<210> 10
<211> 17
<212> DNA
<213> Artificial
<220>
<223> artificial
<220>
<221> feature
misc
<222> _
(3). (3)
<223> a, c, g, or
t
<400> 10
ytngaygart tytgggg
17
<210> 11
<211> 21
<212> DNA
<213> Artificial
<220>
<223> artificial
30/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
<220>
<221> misc_feature
<222> (8) . (8)
<223> a, c, g, or t
<400> 11
gcctgaanga ytgaagaagc t
21
<210> 12
<211> 17
<212> DNA
<213> Lactuca sativa
<400> 12
ctwgatgart tytgggg
17
<210> 13
<211> 35
<212> DNA
<213> Lactuca sativa
<400> 13
ccahactcca aagcttatta tcaatcvggt ttcca
<210> 14
<211> 25
<212> DNA
<213> Lactuca sativa
<400> 14
cccggtgaac cacgtaaatc gaatc
<210> 15
<211> 24
<212> DNA
<213> Lactuca sativa
<400> 15
cctgcgttgg ttcaccatgg aaat
31/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
24
<210> 16
<211> 25
<212> DNA
<213> Lactuca sativa
23772-70998.ST25.txt
<400> 16
cccaattgtg gggaaggttg tgtct
<210> 17
<211> 28
<212> DNA
<213> Lactuca sativa
<400> 17
ccaattgtgg ggaaggttgt gtctggaa
28
<210> 18
<211> 33
<212> DNA
<213> Lactuca sativa
<400> 18
atgatctata ccccttcctc tccccatctc tga
33
<210> 19
<211> 30
<212> DNA
<213> Lactuca sativa
<400> 19
ctttctaatc tcgactccca aacccaaaca
<210> 20
<211> 17
<212> DNA
<213> Petunia x hybrida
32/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
<220>
<221> misc_feature
<222> (3). (3)
<223> a, c, g, or t
<400> 20
ytngaygart tytgggg
17
<210> 21
<211> 21
<212> DNA
<213> Petunia x hybrida
<220>
<221> misc_feature
<222> (8). (8)
<223> a, c, g, or t
<400> 21
gcctgaanga ytgaagaagc t
21
<210> 22
<211> 31
<212> DNA
<213> Petunia x hybrida
<400> 22
tgctctcgat atgactctgg cataggttgt t
31
<210> 23
<211> 30
<212> DNA
<213> Petunia x hybrida
<400> 23
gaacctggaa cttgcagatt tcagcggagt
<210> 24
33/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
<211> 25
<212> DNA
<213> Petunia x hybrida
<400> 24
ctggtggtcc tccaaggttt gaaca
<210> 25
<211> 25
<212> DNA
<213> Petunia x hybrida
<400> 25
tgcagagatg ccttcacctt gcagt .
<210> 26
<211> 29
<212> DNA
<213> Petunia x hybrida
<400> 26
atcccgggat ggaatctgaa actcagact
29
<210> 27
<211> 33
<212> DNA
<213> Petunia x hybrida
<400> 27
atcccgggta caagggagtg ggtgaattaa cat
33
<210> 28
<211> 17
<212> DNA
<213> Artificial
<220>
<223> artificial
<400> 28
34/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
garcartttg gtgtagc
17
<210> 29
<211> 18
<212> DNA
<213> Artificial
<220>
<223> artificial
<400> 29
ctchggcckr ctytccat
18
<210> 30
<211> 1310
<212> PRT
<213> Petunia x hybrida
<400> 30
Met Glu Ser Glu Thr Gln Thr Ile Ala Tyr Arg Gln Pro Ser Met Leu
1 5 10 15
Gln Arg Ile Leu Ser Ala Ser Met Pro Met Leu Leu Ile Ala Ile Gly
20 25 30
Tyr Val Asp Pro Gly Lys Trp Ala Ala Met Val Asp Gly Gly Ala Arg
35 40 45
Phe Gly Phe Asp Leu Ile Met Leu Ala Leu Leu Phe Asn Phe Ala Ala
50 55 60
Ile Leu Cys Gln Tyr Leu Ser Ala Cys Ile Ala Leu Val Thr Asp Gln
65 70 75 80
Asp Leu Ala Gln Ile Cys Ser Glu Glu Tyr Gly Lys Val Thr Cys Ile
85 90 95
35/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
Phe Leu Gly Ile Gln Ala Glu Val Ser Met Ile Ala Leu Asp Leu Thr
100 105 110
Met Val Leu Gly Thr Ala His Gly Leu Asn Val Val Phe Gly Val Asp
115 120 125
Leu Phe Ser Cys Val Phe Leu Ala Ala Thr Gly Ala Ile Leu Phe Pro
130 135 140
Leu Leu Ala Ser Leu Leu Asp Asn Gly Ser Ala Lys Phe Ile Cys Ile
145 150 155 160
Gly Trp Ala Ser Ser Ile Leu Leu Ser Tyr Val Phe Gly Val Val Ile
165 170 175
Ser Gln Pro Glu Ser Pro Phe Ser Ile Gly Gly Met Leu Asn Lys Phe
180 185 190
Ser Gly Glu Ser Ala Phe Ala Leu Met Ser Leu Leu Gly Ala Ser Ile
195 200 205
Met Pro His Asn Phe Tyr Leu His Ser Ser Ile Val Gln Gln Gly Lys
210 215 220
Glu Ser Thr Asn Leu Ser Arg Gly Ala Leu Cys Gln Asp His Phe Phe
225 230 235 240
Ala Ile Val Phe Val Phe Ser Gly Ile Phe Leu Val Asn Tyr Ala Ile
245 250 . 255
Met Asn Ser Ala Ala Asn.Val Ser Phe Ser Thr Gly Leu Leu Leu Leu
260 265 270
Thr Phe Gln Asp Ser Leu Ser Leu Leu Asp Gln Val Phe Arg Ser Ser
275 280 285
36/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
Val Ala Pro Phe Ser Ile Met Leu Val Thr Phe Ile Ser Asn Gln Ile
290 295 300
Thr Pro Leu Thr Trp Asp Leu Gly Arg Gln Ala Val Val His Asp Leu
305 310 315 320
Phe Gly Met Asp Ile Pro Gly Trp Leu His His Val Thr Ile Arg Val
325 330 335
Ile Ser Val Val Pro Ala Leu Tyr Cys Val Trp Asn Ser Gly Ala Glu
340 345 350
Gly Leu Tyr Gln Leu Leu Ile Val Thr Gln Val Val Val Ala Leu Val
355 360 365
Leu Pro Ser Ser Val Ile Pro Leu Phe Arg Val Ala Ser Ser Arg Ser
370 375 380
Ile Met Gly Ile His Lys Ile Ser Gln Leu Met Glu Phe Leu Ser Leu
385 390 395 400
Gly Thr Phe Ile Gly Leu Leu Gly Leu Lys Ile Ile Phe Val Ile Glu
405 410 415
Met Ile Phe Gly Asn Ser Asp Trp Val Asn Asn Leu Lys Trp Ser Ile
420 425 430
Gly Ser Gly Val Ser Thr Pro Tyr Val Phe Leu Leu Ile Ala Ala Ser
435 440 445
Leu Ser Leu Cys Leu Met Leu Trp Leu Ala Val Thr Pro Leu Lys Ser
450 455 460
Ala Ser Ser Arg Phe Asp Ala Gln Ala Phe Leu Gln Thr Pro Met Pro
465 470 475 480
37/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
Glu Ser Tyr Arg Glu His Asn Gln Val Asp Val Ser Asp Thr Thr Phe
485 490 495
Gly Leu Glu Arg Ser Thr Gln Lys Gln Glu Pro Ala Phe His Val Glu
500 505 510
Lys Ser Leu Gly Ser His Pro Asp Leu Ser Thr Ser Asp Pro Asp Glu
515 520 525
Ile Leu Pro Glu Ser Leu Leu Asp Phe Glu Lys Val His His Leu Thr
530 535 540
Thr Ile Asp Glu Ser Lys Ser Glu Thr Thr Phe Ser Thr Pro Ser Phe
545 550 555 560
Ser Cys Pro Glu Val Ser Ala Ser Ala Gly Glu Thr Ala Lys Ser Val
565 570 575
Leu Asn Glu Val Ser Gly Gly Glu Ser Val Asp Thr Arg Asp Phe Asn
580 585 590
Ala Ala Ser Val Gly Val Val Glu Lys Thr Leu Arg Ile Glu Gly Asp
595 600 605
Thr Pro Thr Asp Lys Asp Asp Asp Gly Asp Ser Trp Glu Pro Asp Asp
610 615 620
Val Pro Lys Asp Val Ser Glu Asn Thr Gln Ser Tyr Thr Ser Asp Gly
625 630 635 640
Pro Glu Ser Phe Lys Ser Leu Ser Val Arg Ser Glu Gly Thr Gly Ser
645 650 655
Gly Thr Gly Ser Leu Ser Arg Leu Ala Gly Leu Gly Arg Ala Ala Arg
660 665 670
38/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
Arg Gln Leu Thr Val Val Leu Asp Glu Phe Trp Gly Gln Leu Phe Asp
675 680 685
Tyr His Gly Met Pro Thr Ser Gln Ala Lys Phe Lys Lys Leu Asp Val
690 695 700
Ile Leu Gly Leu Asp Thr Lys Val Asp Pro Lys Pro Ala Pro Val Ser
705 710 715 720
Leu Lys Leu Glu Asn Ser Arg Gly Asp Ser Asn Ala Tyr Ile Pro Ser
725 730 735
Gly Ser Ala Arg Val Pro Glu Ser Trp Ile Asn Ser Asn Ile Tyr Ser
740 745 750
Pro Lys Gln Gln Cys Ala Ser Gly Ala Leu Asp Ser Gly Tyr Arg Val
755 760 765
Pro Lys Glu Pro Ala Ser Trp Ser Ser His Met Lys Leu Leu Asp Ala
770 775 780
Tyr Val Gln Ser Ser Ser Gly Asn Thr Leu Asp Ser Gly Glu Arg Arg
785 790 795 800
Tyr Ser Ser Met Arg Ile Pro Ala Ser Ser Ala Gly Tyr Asp Gln Gln
805 810 815
Pro Ala Thr Val His Gly Tyr Gln Ile Ser Ala Tyr Leu Ser Gln Ile
820 825 830
Ala Lys Glu Arg Gly Ser Asp Tyr Leu Asn Gly Gln Leu Glu Ser Ala
835 840 845
Ser Pro Arg Ser Val Ser Ser Leu Thr Ser Asn His Ala Glu Pro Leu
850 855 860
39/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
Ala Arg Ala Leu Gly Gln Lys Pro Gln Ser Gly Val Ser Ser Arg Ala
865 870 875 880
Pro Pro Gly Phe Gly Ser Val Pro Ala Arg Asn Asn Ser Met Gln Pro
885 890 895
Val Asn Thr Ser Thr Asp Leu Ser Ser Thr Glu Asn Ala Glu Ser Val
900 905 910
Ala Gly Ser Ala Asn Ser Lys Lys Tyr Tyr Ser Leu Pro Asp Ile Ser
915 920 925
Gly Arg Tyr Val Pro Arg Gln Asp Ser Ser Leu Pro Asp Gly Arg Ala
930 935 940
Gln Trp Tyr Asn Ser Met Gly Tyr Gly Gln Ser Ile Gly Arg Ser Ala
945 950 955 960
Tyr Glu Gln Pro Tyr Met Thr Gly Pro Met Arg Ala Gly Gly Pro Pro
965 970 975
Arg Phe Glu His Ser Pro Ser Lys Val Cys Arg Asp Ala Phe Thr Leu
980 985 990
Gln Tyr Ser Ser Asn Ser Gly Thr Gly Ser Leu Trp Ser Arg Gln Pro
995 1000 1005
Phe Glu Gln Phe Gly Val Ala Gly Lys Ala Asp Val Ser Ser Asp
1010 1015 1020
His Gly Thr Val Gln Ser Ser Ser Thr Gln Glu Ser Thr Ser Leu
1025 1030 1035
Val Asp Leu Glu Ala Lys Leu Leu Gln Pro Phe Arg Ser Cys Ile
1040 1045 1050
40/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
Val Lys Leu Leu Lys Leu Glu Gly Ser Glu Trp Leu Phe Arg Gln
1055 1060 1065
Asp Asp Gly Ala Asp Glu Asp Leu Ile Asp Arg Ile Ala Ala Arg
1070 1075 1080
Glu Lys Phe Leu Tyr Glu Ala Glu Thr Arg Glu Ile Ser Arg Leu
1085 1090 1095
Thr Asn Ile Gly Glu Ser Gln Phe Ser Ser Asn Arg Lys Pro Gly
1100 1105 1110
Ser Ala Gln Lys Pro Glu Glu Met Asp Tyr Thr Lys Phe Leu Val
1115 1120 1125
Met Ser Val Pro His Cys Gly Glu Gly Cys Val Trp Lys Val Asp
1130 1135 1140
Leu Val Val Ser Phe Gly Val Trp Cys Ile His Arg Ile Leu Glu
1145 1150 1155
Leu Ser Leu Met Glu Ser Arg Pro Glu Leu Trp Gly Lys Tyr Thr
1160 1165 1170
Tyr Cys Leu Asn Arg Leu Gln Gly Ile Val Asp Leu Ala Phe Ser
1175 1180 1185
Lys Pro Arg Ser Pro Thr Ser His Cys Phe Cys Leu Gln Ile Pro
1190 1195 1200
Ile Gly Arg Gln Gln Lys Ser Ser Pro Thr Pro Ile Ser Asn Gly
1205 1210 1215
Ser Leu Pro Pro Gln Ala Lys Gln Gly Arg Gly Lys Cys Thr Thr
1220 1225 1230
41/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
Ala Pro Met Leu Leu Asp Met Ile Lys Asp Val Glu Met Ala Ile
1235 1240 1245
Ser Cys Arg Lys Gly Arg Thr Gly Thr Ala Ala Gly Asp Val Ala
1250 1255 1260
Phe Pro Lys Gly Lys Glu Asn Leu Ala Ser Val Leu Lys Arg Tyr
1265 1270 1275
Lys Arg Arg Leu Ser Asn Lys Pro Val Gly Asn Gln Glu Ala Gly
1280 1285 1290
Gly Gly Pro Gln Arg Lys Val Thr Ser Pro Ser Ser Thr Ser Phe
1295 1300 1305
Gly Leu
1310
<210> 31
<211> 1315
<212> PRT
<213> Lycopersicon esculentum
<400> 31
Met Glu Ser Glu Thr Leu Thr Arg Glu Tyr Arg Gln Pro Ser Met Leu
1 5 10 15
Gln Arg Val Leu Ser Ala Ser Val Pro Met Leu Leu Ile Ala Val Gly
20 25 30
Tyr Val Asp Pro Gly Lys Trp Ala Ala Met Val Asp Gly Gly Ala Arg
35 40 45
Phe Gly Phe Asp Leu Val Met Leu Val Leu Leu Phe Asn Phe Ala Thr
50 55 60
Ile Leu Cys Gln Tyr Leu Ser Ala Cys Ile Ala Leu Val Thr Asp Arg
42/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
65 70 75 80
Asp Leu Ala Gln Ile Cys Ser Glu Glu Tyr Asp Lys Val Thr Cys Ile
85 90 95
Phe Leu Gly Ile Gln Ala Glu Val Ser Met Ile Ala Leu Asp Leu Thr
100 105 110
Met Val Leu Gly Thr Ala His Gly Leu Asn Val Val Phe Gly Val Asp
115 120 125
Leu Phe Ser Cys Val Phe Leu Thr Ala Thr Gly Ala Ile Leu Phe Pro
130 135 140
Leu Leu Ala Ser Leu Phe Asp Asn Gly Ser Ala Lys Phe Leu Cys Ile
145 150 155 160
Gly Trp Ala Ser Ser Val Leu Leu Ser Tyr Val Phe Gly Val Val Ile
165 170 175
Thr Leu Pro Glu Thr Pro Phe Ser Ile Gly Gly Val Leu Asn Lys Phe
180 185 190
Ser Gly Glu Ser Ala Phe Ala Leu Met Ser Leu Leu Gly Ala Ser Ile
195 200 205
Met Pro His Asn Phe Tyr Leu His Ser Ser Ile Val Gln Gln Gly Lys
210 215 220
Glu Ser Thr Glu Leu Ser Arg Gly Ala Leu Cys Gln Asp His Phe Phe
225 230 235 240
Ala Ile Val Phe Ile Phe Ser Gly Ile Phe Leu Val Asn Tyr Ala Ala
245 250 255
Met Asn Ser Ala Ala Asn Val Ser Tyr Ser Thr Gly Leu Leu Leu Leu
43/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
260 265 270
Thr Phe Gln Asp Thr Leu Ser Leu Leu Asp Gln Val Phe Arg Ser Ser
275 280 285
Val Ala Pro Phe Thr Ile Met Leu Val Thr Phe Ile Ser Asn Gln Val
290 295 300
Thr Pro Leu Thr Trp Asp Leu Gly Arg Gln Ala Val Val His Asp Leu
305 310 315 320
Phe Gly Met Asp Ile Pro Gly Trp Leu His His Val Thr Ile Arg Val
325 330 335
Ile Ser Ile Val Pro Ala Leu Tyr Cys Val Trp Ser Ser Gly Ala Glu
340 345 350
Gly Leu Tyr Gln Leu Leu Ile Leu Thr Gln Val Val Val Ala Leu Val
355 360 365
Leu Pro Ser Ser Val Ile Pro Leu Phe Arg Val Ala Ser Ser Arg Ser
370 375 380
Ile Met Gly Ile His Lys Ile Ser Gln Leu Met Glu Phe Leu Ser Leu
385 390 395 400
Gly Thr Phe Ile Gly Leu Leu Gly Leu Lys Ile Ile Phe Val Ile Glu
405 410 415
Met Ile Phe Gly Asn Ser Asp Trp Val Asn Asn Leu Lys Trp Asn Ile
420 425 430
Gly Ser Ser Val Ser Thr Pro Tyr Val Phe Leu Leu Ile Ala Ala Ser
435 440 445
Leu Cys Leu Cys Leu Met Leu Trp Leu Ala Val Thr Pro Leu Lys Ser
44/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
450 455 460
Ala Ser Ser Arg Phe Asp Ala Gln Ala Phe Leu Gln Thr His Val Pro
465 470 475 480
Glu Pro Tyr Ser Glu Cys Asn Gln Leu Gly Ala Ile Asn Ala Met Phe
485 490 495
Gly Leu Val Glu Gly Ser Ser Gln Lys Gln Glu Gly Ala Phe His Val
500 505 510
Glu Lys Ser Leu Val Thr His Pro Asp Leu Ser Thr Lys Asp Pro Asp
515 520 525
Gln Leu Leu Pro Glu Ser Leu Leu Asp Phe Glu Lys Val His Gln Leu
530 535 540
Ala Thr Ile Asp Glu Ser Lys Ser Glu Thr Thr Phe Ser Ala Pro Ala
545 550 555 560
Val Val His Pro Glu Val Pro Val Ser Ala Gly Ala Ser Pro Ser Val
565 570 575
Lys Ser Val Cys Asn Glu Val Ser Gly Val Val Ser Val Asp Thr Ser
580 585 590
Val Phe Asn Thr Glu Thr Val Asp Val Ala Glu Lys Thr Leu Arg Ile
595 600 605
Glu Gly Asp Met Ala Asn Asp Arg Asp Asp Gly Asp Ser Trp Glu Glu
610 615 620
Pro Glu Glu Ala Ile Lys Gly Val Ser Glu Asn Ala Gln Ser Phe Ile
625 630 635 640
Ser Asp Gly Pro Gly Ser Tyr Lys Ser Leu Ser Gly Lys Leu Glu Asp
45/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
_ 23772-70998.ST25.txt
645 650 655
Thr Gly Ser Gly Thr Gly Ser Leu Ser Arg Leu Ala Gly Leu Gly Arg
660 665 670
Ala Ala Arg Arg Gln Leu Thr Glu Ala Leu Asn Glu Phe Trp Gly Gln
675 680 685
Leu Phe Asp Tyr His Gly Met Ala Thr Ala Glu Ala Lys Ser Lys Lys
690 695 700
Leu Asp Ile Ile Leu Gly Leu Asp Ser Lys Met Asn Pro Lys Pro Ala
705 710 715 720
Pro Ala Ser Leu Lys Val Glu Ser Ser Ala Tyr Ile Pro Ser Gly Ser
725 730 735
Ala Arg Ile Pro Glu Pro Leu Ile Asn Ser His Val Tyr Ser Pro Lys
740 745 750
Gln Gln Phe Ala Ser Asn Ile Val Asp Ser Ala Tyr Arg Val Pro Lys
755 760 765
Glu Pro Ser Ser Thr Ser Ser Met Trp Ser Asn His Met Lys Leu Val
770 775 780
Gly Ala Tyr Val Gln Ser Ser Asn Ser Asn Met Leu Asp Ser Gly Glu
785 790 795 800
Arg Arg Tyr Ser Ser Met Arg Ile Pro Ala Thr Ser Ala Gly Tyr Asp
805 810 815
Gln Gln Pro Ala Thr Val His Gly Tyr Gln Ile Thr Ala Tyr Leu Asn
820 825 830
Gln Leu Ala Lys Glu Arg Gly Ser Asp Tyr Leu Asn Gly Gln Leu Glu
46/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
835 840 845
Ser Pro Ser Pro Arg Ser Val Ser Ser Leu Thr Ser Asn Tyr Ala Glu
850 855 860
Pro Leu Ala Arg Val Ser Gly Gln Lys Pro Gln Ser Gly Val Ser Ser
865 870 875 880
Arg Ala Pro Pro Gly Phe Gly Asn Val Pro Val Gly Arg Asn Asn Ser
885 890 895
Met Gln Pro Thr Asn Thr Thr Ser Val Asp His Ser Ser Thr Glu Thr
900 905 910
Ala Glu Ser Val Ala Gly Ser Ala Asn Ser Lys Lys Tyr Tyr Ser Leu
915 920 925
Pro Asp Ile Ser Gly Arg Tyr Val Pro Arg Gln Asp Ser Ile Val Ser
930 935 940
Asp Ala Arg Ala Gln Trp Tyr Asn Ser Met Gly Phe Gly Gln Ser Gly
945 950 955 960
Gly Arg Ser Thr Tyr Glu Gln Ala Tyr Met Ser Gly Ser Leu Arg Ala
965 970 975
Gly Gly Pro Gln Arg Tyr Glu His Ser Pro Lys Val Cys Arg Asp Ala
980 985 990
Phe Ser Leu Gln Tyr Ser Ser Asn Ser Gly Asn Gly Ser Leu Trp Ser
995 1000 1005
Arg Gln Pro Phe Glu Gln Phe Gly Val Ala Gly Lys Pro Asp Val
1010 1015 1020
Gly Ser Gly Asp His Gly Thr Val Leu Ser Ser Ser Ala Gln Glu
47/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
1025 1030 1035
Ser Thr Ser Thr Val Asp Leu Glu Ala Lys Leu Leu Gln Ser Phe
1040 1045 1050
Arg Ser Cys Ile Val Lys Leu Leu Lys Leu Glu Gly Ser Glu Trp
1055 1060 1065
Leu Phe Arg Gln Asp Asp Gly Ala Asp Glu Asp Leu Ile Gly Arg
1070 1075 1080
Ile Ala Ala Arg Glu Lys Phe Leu Tyr Glu Ala Glu Thr Arg Glu
1085 1090 1095
Ile Ser Arg Leu Thr Asn Ile Gly Glu Ser His Phe Ser Ser Asn
1100 1105 1110
Arg Lys Pro Gly Ser Ala Pro Lys Pro Glu Glu Met Asp Tyr Thr
1115 1120 1125
Lys Phe Leu Val Met Ser Val Pro His Cys Gly Glu Gly Cys Val
1130 1135 1140
Trp Lys Val Asp Leu Ile Ile Ser Phe Gly Val Trp Cys Ile His
1145 1150 1155
Arg Ile Leu Glu Leu Ser Leu Met Glu Ser Arg Pro Glu Leu Trp
1160 1165 1170
Gly Lys Tyr Thr Tyr Val Leu Asn Arg Leu Gln Gly Ile Val Asp
1175 1180 1185
Leu Ala Phe Ser Lys Pro His Ser Pro Thr Ser His Cys Phe Cys
1190 1195 1200
Leu Gln Ile Pro Ala Gly Arg Gln Gln Lys Ala Ser Pro Pro Pro
48/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
1205 1210 1215
Ile Ser Asn Gly Asn Leu Pro Pro Gln Ala Lys Gln Gly Arg Gly
1220 1225 1230
Lys Cys Thr Thr Ala Ala Met Leu Leu Glu Met Ile Lys Asp Val
1235 1240 1245
Glu Thr Ala Ile Ser Cys Arg Lys Gly Arg Thr Gly Thr Ala Ala
1250 1255 1260
Gly Asp Val Ala Phe Pro Lys Gly Lys Glu Asn Leu Ala Ser Val
1265 1270 1275
Leu Lys Arg Tyr Lys Arg Arg Leu Ser Asn Lys Pro Val Gly Asn
1280 1285 1290
Gln Glu Val Ala Gly Val Ala Gly Pro Arg Lys Val Thr Leu Ser
1295 1300 1305
Ala Ser Ser Pro Pro Phe Val
1310 1315
<210> 32
<211> 1178
<212> PRT
<213> Lactuca sativa
<220>
<221> MISC_FEATURE
<222> (18) .(54)
<223> a, c, g, or t
<400> 32
Met Asp Thr Asp Ala Leu Ile Ser Lys Pro Lys Ser Ser Val Leu Gln
1 5 10 15
49/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
Arg Xaa Phe Pro Ala Val Leu Pro Val Leu Phe Ile Ala Ile Thr Tyr
20 25 30
Ile Asp Pro Gly Lys Trp Val Ala Ser Ile Glu Gly Gly Ala Arg Phe
35 40 45
Gly Tyr Asp Leu Ile Xaa Pro Met Ser Val Phe Ser Leu Ser Ala Val
50 55 60
Leu Cys Gln Tyr Leu Ser Ala Ser Ile Ala Val Val Thr Gly Lys Asp
65 70 75 80
Leu Ala Gln Ile Cys Ser Ser Glu Tyr Asp Ala Leu Thr Cys Thr Phe
85 90 95
Leu Gly Ile Glu Ala Glu Leu Ser Met Ile Ala Leu Asp Leu Ser Met
100 105 110
Ile Leu Gly Val Ala His Gly Leu Asn Leu Met Phe Gly Met Gly Leu
115 120 125
Phe Thr Cys Val Phe Leu Thr Ser Phe Asp Ala Phe Leu Phe Pro Ile
130 135 140
Phe Ser Asn Leu Leu Glu Ser Gly Lys Ala Lys Phe Met Cys Met Cys
145 150 155 160
Leu Ala Thr Val Ala Leu Leu Ser Tyr Leu Phe Gly Val Val Val Ser
165 170 175
Gln Pro Asp Thr Ser Leu Ser Met Ser Gly Gly Met Leu Thr Arg Phe
180 185 190
Asn Gly Glu Ser Val Leu Ala Leu Ile Ser Leu Leu Gly Ala Ser Ile
195 200 205
50/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
Met Pro His Asn Phe Tyr Leu His Ser Ser Ile Val Lys Gln Asn Lys
210 215 220
Gly Gln Glu His Val Ser Lys Gly Ala Leu Cys Leu Asp His Leu Phe
225 230 235 240
Ala Ile Ser Gly Val Phe Ser Gly Val Phe Leu Val Asn Tyr Val Leu
245 250 255
Met Asn Ser Ala Ala Asn Val Phe Tyr Ser Ser Gly Leu Asp Leu Leu
260 265 270
Thr Phe Gln Asp Ala Leu Ser Leu Met Asp Gln Val Phe Arg Gly Val
275 280 285
Met Gly Ser Phe Ala Leu Ile Val Ile Leu Leu Leu Ser Asn His Thr
290 295 300
Thr Ala Leu Thr Trp Lys Phe Gly Gly Gln Pro Ile Leu His Asn Phe
305 310 315 320
Phe Lys Ile Asn Ile Pro Gly Trp Phe His His Ser Thr Ile Arg Phe
325 330 335
Ile Thr Ile Ile Leu Ala Leu Leu Cys Ser Trp Gln Ser Gly Ala Glu
340 345 350
Gly Thr Tyr Gln Leu Leu Ile Phe Thr Gln Ile Leu Ala Ala Leu Leu
355 360 365
Leu Pro Ser Ser Val Ile Pro Leu Phe Arg Ile Ala Thr Ser Arg Ser
370 375 380
Val Met Gly Val Asn Lys Ile Ser Arg Val Leu Glu Phe Phe Val Leu
385 390 395 400
51/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
Ile Thr Phe Ile Gly Met Leu Ser Leu Ala Ile Val Phe Val Val Glu
405 410 415
Met Met Phe Gly Asn Ser Asp Trp Ala Ser Asn Ile Arg Trp Asn Leu
420 425 430
Gly Ser Gly Gly Ser Ile Ser Ser Pro Tyr Ser Val Leu Leu Leu Thr
435 440 445
Ala Ser Leu Ser Phe Phe Leu Met Leu Trp Leu Val Val Thr Pro Leu
450 455 460
Gln Ser Ala Ser Ser Lys Pro Glu Ile Val His Asp Ser Ser Leu Lys
465 470 475 480
Glu Arg Thr Gln His Gly Ile Glu Gln Glu Thr Ser Pro Glu Tyr His
485 490 495
Ser Asp Leu Gln Lys Ser Thr Arg Gln Leu Asp Leu Pro Glu Glu Ile
500 505 510
Ile Glu Pro Glu Lys Gly Ser Arg Leu Thr Thr Ile Asp Glu Gln Ser
515 520 525
Ser Asp Ile Leu Leu Pro Ser Ser Pro Pro Glu Glu Ser Gly Thr Gly
530 535 540
Thr Ala Val Pro Gly Val Glu Asp Arg Ser Asn Leu Gln Asn Gln Glu
545 550 555 560
Ser Glu Ser Ile Glu Lys Thr Leu Ser Ile Asp Gly Asn Ser Gln Lys
565 570 575
Glu His Ser Pro Asn Pro Trp Gln Ile Glu Glu Ser Pro Lys Val Val
580 585 590
52/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
Ser Glu Thr Asn His Leu Ala Val Ser Pro Glu Gly Pro Gly Ser Phe
595 600 605
Arg Ser Leu Gly Leu Lys His Asp Asp Val Gly Ser Gly Thr Gly Ser
610 615 620
Trp Ser Lys Leu Ala Gly Leu Gly Arg Ala Ala Arg Arg Gln Leu Ala
625 630 635 640
Ala Val Leu Asp Glu Phe Trp Gly Gln Leu Phe Asp Phe His Gly Glu
645 650 655
Pro Thr Gln Glu Ala Lys Ala Arg Lys Leu Asp Lys Leu Leu Gly Ile
660 665 670
Asn Ser Lys Thr Asn Met Asn Ser Lys Ala Thr Pro His Gln Ser Val
675 680 685
Gln Thr Thr Thr Asp Ser Ile Tyr Val Val His Arg Gly Pro Ser Ser
690 695 700
Ser Ser Leu Leu Ser Asn Gln Lys Gln Ile Leu Asp Ala Tyr Ala Gln
705 710 715 720
Arg Ser Asn Leu Asn Val Met Asp Pro Gly Glu Lys Arg Tyr His Ser
725 730 735
Leu Arg Leu Gln Ser Ser Ser Asn Gly Leu Arg Ile Pro Gln Ala Ser
740 745 750
Val Gly Phe Asp Asp Gln Pro Ala Thr Val His Gly Tyr Gln Ile Lys
755 760 765
Ser Tyr Met Asn Gln Met Glu Ser Leu Thr Pro Lys Ser Pro Ser Phe
770 775 780
53/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
Gly Ser Ser Ala Asn Tyr Lys Ala Pro Tyr Ser Leu Thr Lys Gly Leu
785 790 795 800
Gln Asn Gly Val Ser Pro Ala Lys Pro Pro Gly Phe Pro Asp Pro Val
805 810 815
Val Ser Arg Asn Ser Ser Met Gln Pro Glu Arg Ser Tyr Gln Asn Gln
820 825 830
Tyr Pro Glu Thr Met His Ser Thr Val Asn Glu Lys Arg Tyr Tyr Ser
835 840 845
Met Pro Ser Leu Pro Arg Asp Gly Thr Leu Gly Arg Lys Met His Asp
850 855 860
Met Ser Ile Tyr Ser Gly Pro Ser Tyr Asn Arg Ser Gly Thr Pro Ser
865 870 875 880
Ala Tyr Thr Gly Ser Tyr Gln Leu Asn Ser Gly Ala Asp Thr Trp Ser
885 890 895
Ile Trp Ser Arg Gln Pro Tyr Glu Gln Phe Gly Val Ala Glu Lys Ser
900 905 910
Asn Ser Arg Met Ser Leu Asn Ser Gln Glu Ile Gly Ser Gly Val Asp
915 920 925
Leu Glu Ala Asn Leu Leu Lys Ser Leu Arg Leu Cys Ile Val Lys Leu
930 935 940
Leu Lys Leu Glu Gly Ser Asp Trp Leu Phe Gln Gln Asn Ser Gly Leu
945 950 955 960
Asp Glu Asp Leu Val Asp Arg Val Ala Ala Arg Glu Arg Phe Leu Tyr
965 970 975
54/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
Glu Val Glu Ser Lys Glu Met Asn Gly Ala Ala His Gly Gly Asp Ser
980 985 990
Gly Met Lys Ile Asp Leu Val Thr Ser Ile Pro Asn Cys Gly Glu Gly
995 1000 1005
Cys Val Trp Lys Ala Asp Leu Ile Thr Ser Phe Gly Val Trp Cys
1010 1015 1020
Ile His Arg Val Leu Glu Leu Ser Leu Met Glu Ser Arg Pro Glu
1025 1030 1035
Leu Trp Gly Lys Tyr Thr Tyr Val Leu Asn Arg Leu Gln Gly Ile
1040 1045 1050
Leu Glu Leu Ala Phe Ser Lys Pro Arg Ala Ala Met Asn Pro Cys
1055 1060 1065
Phe Cys Leu Gln Leu Pro Thr Ser Tyr Gln Gln Arg Arg Val Ser
1070 1075 1080
Pro Pro Lys Ser Ala Thr Ser Leu Pro Pro Pro Ala Lys Gln Ser
1085 1090 1095
Lys Gly Lys Cys Thr Thr Ala Ala Ser Leu Leu Asp Ile Val Lys
1100 1105 1110
Asp Val Glu Ile Ala Ile Ser Cys Arg Lys Gly Arg Thr Gly Thr
1115 1120 1125
Ala Ala Gly Asp Val Ala Phe Pro Lys Gly Lys Glu Asn Leu Ala
1130 1135 1140
Ser Val Leu Lys Arg Tyr Lys Arg Arg Leu Ser Asn Lys Pro Ala
1145 1150 1155
55/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
Val Thr Pro Asp Gly Val Asn Gly Pro His Lys Thr Ala Met Ser
1160 1165 1170
Ala Ser Tyr Gly Leu
1175
<210> 33
<211> 1321
<212> PRT
<213> Arabidopsis sp.
<400> 33
Met Glu Ala Glu Ile Val Asn Val Arg Pro Gln Leu Gly Phe Ile Gln
1 5 10 15
Arg Met Val Pro Ala Leu Leu Pro Val Leu Leu Val Ser Val Gly Tyr
20 25 30
Ile Asp Pro Gly Lys Trp Val Ala Asn Ile Glu Gly Gly Ala Arg Phe
35 40 45
Gly Tyr Asp Leu Val Ala Ile Thr Leu Leu Phe Asn Phe Ala Ala Ile
50 55 60
Leu Cys Gln Tyr Val Ala Ala Arg Ile Ser Val Val Thr Gly Lys His
65 70 75 80
Leu Ala Gln Ile Cys Asn Glu Glu Tyr Asp Lys Trp Thr Cys Met Phe
85 90 95
Leu Gly Ile Gln Ala Glu Phe Ser Ala Ile Leu Leu Asp Leu Thr Met
100 105 110
Val Val Gly Val Ala His Ala Leu Asn Leu Leu Phe Gly Val Glu Leu
115 120 125
Ser Thr Gly Val Phe Leu Ala Ala Met Asp Ala Phe Leu Phe Pro Val
56/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
130 135 140
Phe Ala Ser Phe Leu Glu Asn Gly Met Ala Asn Thr Val Ser Ile Tyr
145 150 155 160
Ser Ala Gly Leu Val Leu Leu Leu Tyr Val Ser Gly Val Leu Leu Ser
165 170 175
Gln Ser Glu Ile Pro Leu Ser Met Asn Gly Val Leu Thr Arg Leu Asn
180 185 190
Gly Glu Ser Ala Phe Ala Leu Met Gly Leu Leu Gly Ala Ser Ile Val
195 200 205
Pro His Asn Phe Tyr Ile His Ser Tyr Phe Ala Gly Glu Ser Thr Ser
210 215 220
Ser Ser Asp Val Asp Lys Ser Ser Leu Cys Gln Asp His Leu Phe Ala
225 230 235 240
Ile Phe Gly Val Phe Ser Gly Leu Ser Leu Val Asn Tyr Val Leu Met
245 250 255
Asn Ala Ala Ala Asn Val Phe His Ser Thr Gly Leu Val Val Leu Thr
260 265 270
Phe His Asp Ala Leu Ser Leu Met Glu Gln Val Phe Met Ser Pro Leu
275 280 285
Ile Pro Val Val Phe Leu Met Leu Leu Phe Phe Ser Ser Gln Ile Thr
290 295 300
Ala Leu Ala Trp Ala Phe Gly Gly Glu Val Val Leu His Asp Phe Leu
305 310 315 320
Lys Ile Glu Ile Pro Ala Trp Leu His Arg Ala Thr Ile Arg Ile Leu
57/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
325 330 335
Ala Val Ala Pro Ala Leu Tyr Cys Val Trp Thr Ser Gly Ala Asp Gly
340 345 350
Ile Tyr Gln Leu Leu Ile Phe Thr Gln Val Leu Val Ala Met Met Leu
355 360 365
Pro Cys Ser Val Ile Pro Leu Phe Arg Ile Ala Ser Ser Arg Gln Ile
370 375 380
Met Gly Val His Lys Ile Pro Gln Val Gly Glu Phe Leu Ala Leu Thr
385 390 395 400
Thr Phe Leu Gly Phe Leu Gly Leu Asn Val Val Phe Val Val Glu Met
405 410 415
Val Phe Gly Ser Ser Asp Trp Ala Gly Gly Leu Arg Trp Asn Thr Gly
420 425 430
Met Gly Thr Ser Ile Gln Tyr Thr Thr Leu Leu Val Ser Ser Cys Ala
435 440 445
Ser Leu Cys Leu Ile Leu Trp Leu Ala Ala Thr Pro Leu Lys Ser Ala
450 455 460
Ser Asn Arg Ala Glu Ala Gln Ile Trp Asn Met Asp Ala Gln Asn Ala
465 470 475 480
Leu Ser Tyr Pro Ser Val Gln Glu Glu Glu Ile Glu Arg Thr Glu Thr
485 490 495
Arg Arg Asn Glu Asp Gln Ser Ile Val Arg Leu Glu Ser Arg Val Lys
500 505 510
Asp Gln Leu Asp Thr Thr Ser Val Thr Ser Ser Val Tyr Asp Leu Pro
58/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
515 520 525
Glu Asn Ile Leu Met Thr Asp Gln Glu Ile Arg Ser Ser Pro Pro Glu
530 535 540
Glu Arg Glu Leu Asp Val Lys Tyr Ser Thr Ser Gln Val Ser Ser Leu
545 550 555 560
Lys Glu Asp Ser Asp Val Lys Glu Gln Ser Val Leu Gln Ser Thr Val
565 570 575
Val Asn Glu Val Ser Asp Lys Asp Leu Ile Val Glu Thr Lys Met Ala
580 585 590
Lys Ile Glu Pro Met Ser Pro Val Glu Lys Ile Val Ser Met Glu Asn
595 600 605
Asn Ser Lys Phe Ile Glu Lys Asp Val Glu Gly Val Ser Trp Glu Thr
610 615 620
Glu Glu Ala Thr Lys Ala Ala Pro Thr Ser Asn Phe Thr Val Gly Ser
625 630 635 640
Asp Gly Pro Pro Ser Phe Arg Ser Leu Ser Gly Glu Gly Gly Ser Gly
645 650 655
Thr Gly Ser Leu Ser Arg Leu Gln Gly Leu Gly Arg Ala Ala Arg Arg
660 665 670
His Leu Ser Ala Ile Leu Asp Glu Phe Trp Gly His Leu Tyr Asp Phe
675 680 685
His Gly Gln Leu Val Ala Glu Ala Arg Ala Lys Lys Leu Asp Gln Leu
690 695 700
Phe Gly Thr Asp Gln Lys Ser Ala Ser Ser Met Lys Ala Asp Ser Phe
59/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
705 710 715 720
Gly Lys Asp Ile Ser Ser Gly Tyr Cys Met Ser Pro Thr Ala Lys Gly
725 730 735
Met Asp Ser Gln Met Thr Ser Ser Leu Tyr Asp Ser Leu Lys Gln Gln
740 745 750
Arg Thr Pro Gly Ser Ile Asp Ser Leu Tyr Gly Leu Gln Arg Gly Ser
755 760 765
Ser Pro Ser Pro Leu Val Asn Arg Met Gln Met Leu Gly Ala Tyr Gly
770 775 780
Asn Thr Thr Asn Asn Asn Asn Ala Tyr Glu Leu Ser Glu Arg Arg Tyr
785 790 795 800
Ser Ser Leu Arg Ala Pro Ser Ser Ser Glu Gly Trp Glu His Gln Gln
805 810 815
Pro Ala Thr Val His Gly Tyr Gln Met Lys Ser Tyr Val Asp Asn Leu
820 825 830
Ala Lys Glu Arg Leu Glu Ala Leu Gln Ser Arg Gly Glu Ile Pro Thr
835 840 845
Ser Arg Ser Met Ala Leu Gly Thr Leu Ser Tyr Thr Gln Gln Leu Ala
850 855 860
Leu Ala Leu Lys Gln Lys Ser Gln Asn Gly Leu Thr Pro Gly Pro Ala
865 870 875 880
Pro Gly Phe Glu Asn Phe Ala Gly Ser Arg Ser Ile Ser Arg Gln Ser
885 890 895
Glu Arg Ser Tyr Tyr Gly Val Pro Ser Ser Gly Asn Thr Asp Thr Val
60/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
900 905 910
Gly Ala Ala Val Ala Asn Glu Lys Lys Tyr Ser Ser Met Pro Asp Ile
915 920 925
Ser Gly Leu Ser Met Ser Ala Arg Asn Met His Leu Pro Asn Asn Lys
930 935 940
Ser Gly Tyr Trp Asp Pro Ser Ser Gly Gly Gly Gly Tyr Gly Ala Ser
945 950 955 960
Tyr Gly Arg Leu Ser Asn Glu Ser Ser Leu Tyr Ser Asn Leu Gly Ser
965 970 975
Arg Val Gly Val Pro Ser Thr Tyr Asp Asp Ile Ser Gln Ser Arg Gly
980 985 990
Gly Tyr Arg Asp Ala Tyr Ser Leu Pro Gln Ser Ala Thr Thr Gly Thr
995 1000 1005
Gly Ser Leu Trp Ser Arg Gln Pro Phe Glu Gln Phe Gly Val Ala
1010 1015 1020
Glu Arg Asn Gly Ala Val Gly Glu Glu Leu Arg Asn Arg Ser Asn
1025 1030 1035
Pro Ile Asn Ile Asp Asn Asn Ala Ser Ser Asn Val Asp Ala Glu
1040 1045 1050
Ala Lys Leu Leu Gln Ser Phe Arg His Cys Ile Leu Lys Leu Ile
1055 1060 1065
Lys Leu Glu Gly Ser Glu Trp Leu Phe Gly Gln Ser Asp Gly Val
1070 1075 1080
Asp Glu Glu Leu Ile Asp Arg Val Ala Ala Arg Glu Lys Phe Ile
61/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
1085 1090 1095
Tyr Glu Ala Glu Ala Arg Glu Ile Asn Gln Val Gly His Met Gly
1100 1105 1110
Glu Pro Leu Ile Ser Ser Val Pro Asn Cys Gly Asp Gly Cys Val
1115 1120 1125
Trp Thr Ala Asp Leu Ile Val Ser Phe Gly Leu Trp Cys Ile His
1130 1135 1140
Arg Val Leu Asp Leu Ser Leu Met Glu Ser Arg Pro Glu Leu Trp
1145 1150 1155
Gly Lys Tyr Thr Tyr Val Leu Asn Arg Leu Gln Gly Val Ile Asp
1160 1165 1170
Pro Ala Phe Ser Lys Leu Arg Thr Pro Met Thr Pro Cys Phe Cys
1175 1180 1185
Leu Gln Ile Pro Ala Ser His Gln Arg Ala Ser Pro Thr Ser Ala
1190 1195 1200
Asn Gly Met Leu Pro Pro Ala Ala Lys Pro Ala Lys Gly Lys Cys
1205 1210 1215
Thr Thr Ala Val Thr Leu Leu Asp Leu Ile Lys Asp Val Glu Met
1220 1225 1230
Ala Ile Ser Cys Arg Lys Gly Arg Thr Gly Thr Ala Ala Gly Asp
1235 1240 1245
Val Ala Phe Pro Lys Gly Lys Glu Asn Leu Ala Ser Val Ser Lys
1250 1255 1260
Arg Tyr Lys Arg Arg Leu Ser Asn Lys Pro Val Arg Tyr Glu Ser
62/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
1265 1270 1275
Gly Trp Thr Arg Phe Lys Lys Lys Arg Asp Cys Val Arg Ile Ile
1280 1285 1290
Gly Leu Lys Lys Lys Asn Ile Val Thr Asn Leu Met Ile Lys Val
1295 1300 1305
Thr Ser Arg Gly Lys Pro Lys Asn Gln Asn Ser Arg Phe
1310 1315 1320
<210> 34
<211> 437
<212> PRT
<213> Artificial
<220>
<223> artificial
<400> 34
Met Gln Arg Ala Pro Leu Ile Tyr Asp Pro Gly Lys Trp Ala Gly Gly
1 5 10 15
Ala Arg Phe Gly Asp Leu Phe Ile Leu Cys Gln Tyr Ala Ile Val Thr
20 25 30
Leu Ala Gln Ile Cys Glu Tyr Thr Cys Phe Leu Gly Ile Ala Glu Ser
35 40 45
Ile Leu Asp Leu Met Val Gly Ala His Leu Asn Phe Gly Leu Val Phe
50 55 60
Leu Ala Leu Phe Pro Leu Val Asn Tyr Met Asn Ala Ala Asn Val Ser
65 70 75 80
Gly Leu Leu Thr Phe Asp Leu Ser Leu Gln Val Phe Ser Thr Leu Trp
85 90 95
63/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
Gly Val His Ile Pro Trp His Thr Ile Arg Ala Leu Cys Trp Ser Gly
100 105 110
Ala Gly Tyr Gln Leu Leu Ile Thr Gln Val Ala Leu Pro Ser Val Ile
115 120 125
Pro Leu Phe Arg Ala Ser Arg Ile Met Gly Lys Ile Glu Phe Leu Thr
130 135 140
Phe Gly Leu Leu Ile Phe Val Glu Met Phe Gly Ser Asp Trp Trp Gly
145 150 155 160
Tyr Leu Leu Leu Leu Trp Leu Thr Pro Leu Ser Ala Ser Glu Glu Asp
165 170 175
Leu Pro Glu Glu Glu Lys Trp Lys Asn Gly Pro Ser Phe Ser Leu Gly
180 185 190
Ser Gly Thr Gly Ser Ser Leu Gly Leu Gly Arg Ala Ala Arg Arg Leu
195 200 205
Leu Glu Phe Trp Gly Leu Phe Asp His Gly Ala Lys Leu Asp Gly Lys
210 215 220
Ser Gln Asp Ser Tyr Ser Ala Tyr Asn Glu Arg Tyr Ser Arg Pro Ser
225 230 235 240
Gly Gln Pro Ala Thr Val His Gly Tyr Gln Tyr Glu Ser Gln Gly Pro
245 250 255
Gly Phe Arg Ser Gln Asn Lys Tyr Ser Pro Gly Arg Arg Gly Pro Tyr
260 265 270
Ser Ser Trp Ser Arg Gln Pro Phe Glu Gln Phe Gly Val Ala Ser Val
275 280 285
64/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
Asp Glu Ala Leu Leu Arg Cys Ile Lys Leu Lys Leu Glu Gly Ser Trp
290 295 300
Leu Phe Gln Gly Asp Glu Leu Ile Arg Ala Ala Arg Glu Phe Tyr Glu
305 310 315 320
Glu Glu Gly Leu Val Ser Val Pro Cys Gly Gly Cys Val Trp Asp Leu
325 330 335
Ile Ser Phe Gly Trp Cys Ile His Arg Leu Leu Ser Leu Met Glu Ser
340 345 350
Arg Pro Glu Leu Trp Gly Lys Tyr Thr Tyr Leu Asn Arg Leu Gln Gly
355 360 365
Ile Ala Phe Ser Lys Cys Phe Cys Leu Gln Pro Gln Leu Pro Pro Ala
370 375 380
Lys Gly Lys Cys Thr Thr Ala Leu Leu Ile Lys Asp Val Glu Ala Ile
385 390 395 400
Ser Cys Arg Lys Gly Arg Thr Gly Thr Ala Ala Gly Asp Val Ala Phe
405 410 415
Pro Lys Gly Lys Glu Asn Leu Ala Ser Val Lys Arg Tyr Lys Arg Arg
420 425 430
Leu Ser Asn Lys Pro
435
<210> 35
<211> 643
<212> PRT
<213> Petunia x hybrida
<400> 35
65/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
Met Ser Val Met Arg Arg Leu Ser Gln Lys Asn Trp Arg Asp Gly Cys
1 5 10 15
Gly Arg Thr Val Ser Ser Leu Ser Gly Ser Arg Lys Asp Arg Asn Leu
20 25 30
Gln Pro Cys Lys Leu Leu Arg Ser Arg Thr Ile Ser Lys Leu Val Ile
35 40 45
Arg Leu Gly Gly Lys Lys Met Ser Arg Ala Gln Asp Gly Ile Leu Lys
50 55 60
Tyr Met Leu Lys Met Met Glu Val Cys Asn Ala Arg Gly Phe Val Tyr
65 70 75 80
Gly Ile Ile Pro Asp Lys Gly Lys Pro Val Ser Gly Ala Ser Asp Asn
85 90 95
Ile Arg Ala Trp Trp Lys Glu Lys Val Lys Phe Asp Lys Asn Gly Pro
100 105 110
Ala Ala Ile Ala Lys Tyr Glu Ala Glu Cys Leu Ala Arg Glu Glu Arg
115 120 125
Val Gly Ser Gln Asn Gly Asn Pro Gln Ser Val Leu Gln Asp Leu Gln
130 135 140
Asp Ala Thr Leu Gly Ser Leu Leu Ser Ser Leu Met Gln His Cys Asp
145 150 155 160
Pro Pro Gln Arg Lys Tyr Pro Leu Glu Lys Gly Val Ser Pro Pro Trp
165 170 175
Trp Pro Thr Gly Asn Glu Glu Trp Trp Ala Lys Thr Gly Leu Pro Lys
180 185 190
66/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
Gly Gln Lys Pro Pro Tyr Lys Lys Pro His Asp Leu Lys Lys Met Trp
195 200 205
Lys Val Gly Val Leu Thr Ala Val Ile Lys His Met Ser Pro Asp Ile
210 215 220
Ala Lys Ile Arg Arg Leu Val Arg Gln Ser Lys Cys Leu Gln Asp Lys
225 230 235 240
Met Thr Ala Lys Glu Ser Ser Ile Trp Leu Ala Val Leu Ser Arg Glu
245 250 255
Glu Ser Ile Leu Gln Gln Pro Gly Ser Glu Asn Arg Ser Ser Ser Leu
260 265 270
Glu Pro Pro Pro Arg Ser Arg Gly Glu Lys Lys Lys Pro Ser Ser Ser
275 280 285
Ser Asp Ser Asp Tyr Asp Val Asp Gly Phe Asp Asp Gly Ile Gly Ser
290 295 300
Val Ser Ser Arg Asp Glu Arg Arg Asn Gln Pro Leu Asp Val Arg Pro
305 310 315 320
Leu Asn Val Val Pro Pro Ser His Gln Ser Lys Glu Gln Gly Asp Gly
325 330 335
Arg Tyr Arg Arg Arg Lys Arg Ala Arg Ser Asn Pro Thr Glu Gln Gln
340 345 350
Ile Gln Pro Ser Leu Ile His Gly Asp Glu His Ser Asn Thr Ile Leu
355 360 365
Asp Ile Asn Ser Ser Gln Thr Leu Phe Val Gly Cys Ile Thr Asn Glu
370 375 380
67/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
Ser Leu Leu Leu Asn Asp Lys Ser Glu Ala Pro Lys Arg Ala Glu Asn
385 390 395 400
Glu Ser Glu Ser Gln Pro Glu Leu Pro Leu Gln Asp Ser Asn Leu Ser
405 410 415
Phe Val Pro Ser Ala Asn Val Val Ser Ile Glu Asp Ala Tyr Ile Gly
420 425 430
Ala Gly Pro Ser Leu Asn Ile Met Ser Gln Asn Ser Ala Val Val Pro
435 440 445
Tyr Glu Ser Gly Met His Leu Gly Ser Gln Asp Ser Ala Ile Gln His
450 455 460
Gln Phe Gln Asp Thr Gln Phe His Gly Cys His Lys Val Ser Gly Met
465 470 475 480
Asn Asn Gly Pro Gln Ser Ser Ser Leu His Tyr Gly Thr Pro Asn Asn
485 490 495
Gly Leu His Tyr Gly Pro His Asn Ser Val Val Arg Thr Glu Leu Gln
500 505 510
Asp Ser Ala Phe Val His Gly Ser Glu Tyr Ser Asn Ile Asn Gln Pro
515 520 525
Pro Met Tyr His Ser Tyr Ser Ser Ala Glu Phe Gly Ser Ala His Glu
530 535 540
Glu Thr Gln Ser His Leu Ala Cys Asn Glu Leu Gln Ile Arg Pro Ile
545 550 555 560
Asn Ser Gly Val Gly Ser Ser Val Leu Asn Gly Thr Gly Asn Asp Ile
565 570 575
68/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
Ile Gly Asp Asn His His Tyr Gly Lys Asp Ile Tyr Gln Asn Asn His
580 585 590
Asp Arg Gln Ile Glu Met Pro Phe Pro Ser Pro Leu Thr Ile Gly Ser
595 600 605
Pro Asp Tyr Ala Leu Gly Ser Pro Phe Asn Leu Gly Leu Asp Ile Gln
610 615 620
Ser His Leu Asp Ser Pro Asp Tyr Asp Leu Asp Phe Asp Lys Glu Phe
625 630 635 640
Met Ser Phe
<210> 36
<211> 614
<212> PRT
<213> Petunia x hybrida
<400> 36
Met Met Met Phe Glu Glu Met Gly Phe Cys Gly Asp Leu Asp Phe Phe
1 5 10 15
Pro Ala Pro Leu Lys Glu Val Glu Gly Ala Asn Ile Leu Thr Glu Leu
20 25 30
Glu Pro Glu Pro Leu Val Asp Asp Asp Tyr Ser Asp Glu Glu Ile Asp
35 40 45
Val Asp Glu Leu Glu Arg Arg Met Trp Arg Asp' Lys Met Lys Leu Lys
50 55 60
Arg Leu Lys Glu Met Thr Lys Gly Lys Glu Gly Val Asp Ala Val Lys
65 70 75 80
Gln Arg Gln Ser Gln Glu Gln Ala Arg Arg Lys Lys Met Ser Arg Ala
69/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
85 90 95
Gln Asp Gly Ile Leu Lys Tyr Met Leu Lys Met Met Glu Val Cys Lys
100 105 110
Ala Gln Gly Phe Val Tyr Gly Ile Ile Pro Glu Lys Gly Lys Pro Val
115 120 125
Thr Gly Ala Ser Asp Asn Leu Arg Glu Trp Trp Lys Asp Lys Val Arg
130 135 140
Phe Asp Arg Asn Gly Pro Ala Ala Ile Ala Lys Tyr Gln Ala Asp Asn
145 150 155 160
Ala Ile Pro Gly Lys Asn Glu Gly Ser Asn Pro Ile Gly Pro Thr Pro
165 170 175
His Thr Leu Gln Glu Leu Gln Asp Thr Thr Leu Gly Ser Leu Leu Ser
180 185 190
Ala Leu Met Gln His Cys Asp Pro Pro Gln Arg Arg Phe Pro Leu Glu
195 200 205
Lys Gly Val Ser Pro Pro Trp Trp Pro Thr Gly Gln Glu Glu Trp Trp
210 215 220
Pro Gln Leu Gly Leu Pro Lys Asp Gln Gly Ala Pro Pro Tyr Lys Lys
225 230 235 240
Pro His Asp Leu Lys Lys Ala Trp Lys Val Gly Val Leu Thr Ala Val
245 250 255
Ile Lys His Met Ser Pro Asp Ile Ala Lys Ile Arg Lys Leu Val Arg
260 265 270
Gln Ser Lys Cys Leu Gln Asp Lys Met Thr Ala Lys Glu Ser Ala Thr
70/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
275 280 285
Trp Leu Ala Ile Ile Asn Gln Glu Glu Val Val Ala Arg Glu Leu Tyr
290 295 300
Pro Asp His Cys Pro Pro Leu Ser Ser Ala Gly Gly Ser Gly Thr Phe
305 310 315 320
Thr Met Asn Asp Ser Ser Glu Tyr Asp Val Glu Gly Val Val Asp Glu
325 330 335
Pro Asp Phe Asp Val Gln Glu Gln Lys Pro Asn His Leu Asp Leu Leu
340 345 350
Asn Ala Asn Val Asp Ile Phe Asn Glu Met Leu Pro Leu Gln Gln Gln
355 360 365
Ser His Pro Ile Lys Asp Glu Ile Ile Ser Asn Leu Asp Phe Ser Arg
370 375 380
Lys Arg Lys Thr Ser Asp Asp Leu Ala Phe Met Met Asp Gln Lys Ile
385 390 395 400
Tyr Thr Cys Glu Cys Leu Glu Cys Pro His Ser Glu Leu Arg His Gly
405 410 415
Phe Gln Asp Arg Ser Ser Arg Asp Asn His Gln Leu Thr Cys Leu Phe
420 425 430
Arg Asn Ser Pro Gln Phe Gly Ile Ser Asn Phe His Ile Asp Glu Val
435 440 445
Lys Pro Ala Ala Phe Pro Gln Gln Tyr Val Gln Pro Lys Pro Ala Ser
450 455 460
Leu Pro Val Ser Ala Ala Pro Pro Ser Phe Asp Ile Ser Gly Leu Gly
71/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
465 470 475 480
Val Pro Glu Asp Gly Gln Arg Met Ile Asn Glu Leu Met Ser Phe Tyr
485 490 495
Asp Asn Asn Val Gln Gly Asn Lys Ser Ser Met Gly Gly Asn Val Val .
500 505 510
Leu Ser Lys Glu Gln Pro Arg Gln Gln Ser Thr Val Gln Gln Asn Asn
515 520 525
Tyr Leu His Asn Gln Gly Ile Val Leu Glu Gly Asn Ile Phe Gly Asp
530 535 540
Thr Asn Val Ser Ala Asn His Ala Val Phe Pro Gln Gly Asp Arg Phe
545 550 555 560
Asp Gln Cys Lys Val Leu Thr Ser Pro Phe Asn Ala Gly Ser Asn Asp
565 570 575
Asn Phe His Phe Met Phe Gly Ser Pro Phe Asn Leu Gln Ser Thr Asp
580 585 590
Tyr Thr Glu Gly Leu Ser Val Ile Ala His Asp Asn Met Pro Lys Gln
595 600 605
Asp Val Pro Val Trp Tyr
610
<210> 37
<211> 612
<212> PRT
<213> Petunia x hybrida
<400> 37
Met Met Met Phe Asp Glu Met Gly Phe Cys Gly Gly Asp Leu Asp Phe
1 5 10 15
72/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
Phe Pro Ala Pro Leu Lys Glu Val Glu Thr Thr Ala Pro Leu Thr Glu
20 25 30
Pro Glu Pro Glu Pro Val Val Asp Asp Asp Tyr Ser Asp Asp Glu Ile
35 40 45
Asp Val Asp Glu Leu Glu Arg Arg Met Trp Arg Asp Lys Met Lys Leu
50 55 60
Lys Arg Leu Lys Glu Thr Thr Lys Ser Lys Glu Gly Val Asp Pro Ala
65 70 75 80
Lys His Arg Gln Ser Gln Glu Gln Ala Arg Arg Lys Lys Met Ser Arg
85 90 95
Ala Gln Asp Gly Ile Leu Lys Tyr Met Leu Lys Met Met Glu Val Cys
100 105 110
Lys Ala Gln Gly Phe Val Tyr Gly Ile Ile Pro Glu Lys Gly Lys Pro
115 120 125
Val Gly Gly Ala Ser Asp Asn Leu Arg Glu Trp Trp Lys Asp Lys Val
130 135 140
Arg Phe Asp Arg Asn Gly Pro Ala Ala Ile Ala Lys Tyr Gln Ala Asp
145 150 155 160
His Ala Ile Pro Gly Met Asn Glu Gly Ser Asn Pro Val Gly Pro Thr
165 170 175
Pro His Thr Leu Gln Glu Leu Gln Asp Thr Thr Leu Gly Ser Leu Leu
180 185 190
Ser Ala Leu Met Gln His Cys Asp Pro Pro Gln Arg Arg Phe Pro Leu
195 200 205
73/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
Glu Lys Gly Val Pro Pro Pro Trp Trp Pro Thr Gly Gln Glu Asp Trp
210 215 220
Trp Pro Gln Leu Gly Leu Gln Lys Asp Gln Gly Pro Pro Pro Tyr Lys
225 230 235 240
Lys Pro His Asp Leu Lys Lys Ala Trp Lys Val Gly Val Leu Thr Ala
245 250 255
Val Ile Lys His Met Phe Pro Asp Ile Ala Lys Ile Arg Lys Leu Val
260 265 270
Arg Gln Ser Lys Cys Leu Gln Asp Lys Met Thr Ala Lys Glu Ser Ala
275 280 285
Thr Trp Leu Ala Ile Ile Ser Gln Glu Glu Ala Leu Ala Arg Glu Leu
290 295 300
Tyr Pro Asp Arg Cys Pro Pro Leu Ser Ser Ala Gly Gly Ser Gly Thr
305 310 315 320
Phe Thr Leu Asn Asp Ser Ser Glu Tyr Asp Val Glu Gly Ala Gln Asp
325 330 335
Pro Asn Phe Asp Ile Gln Glu Gln Lys Pro Asp His Leu Thr Leu Phe
340 345 350
Asn Ile Ser Ala Glu Arg Phe Met Glu Arg Leu Pro Leu Gln Gln Gln
355 360 365
Ser His Pro Asn Asn Asp Glu Ile Ile Thr Asn Leu Asp Phe Thr Arg
370 375 380
Lys Arg Lys Gln Ala Asn Glu Pro Thr Val Val Met Asp Gln Lys Ile
385 390 395 400
74/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
Tyr Thr Cys Glu Phe Leu Gln Cys Pro His Asn Glu Leu Arg His Gly
405 410 415
Phe Gln Asp Arg Ser Ala Arg Asp Asn His Gln Phe Ala Cys Pro Phe
420 425 430
Ser Asn Ser Ser Arg Phe Gly Val Ser Asn Phe His Ile Asn Asp Val
435 440 445
Lys Pro Ala Val Phe Pro His His Tyr Gly Gln Pro Lys Ser Ala Ala
450 ~ 455 460
Gln Pro Val Asn Gln Gly Pro Pro Ser Phe Asp Leu Ser Gly Ala Gly
465 470 475 480
Val Pro Glu Asp Gly Gln Lys Met Ile Asn Glu Leu Met Ser Phe Tyr
485 490 495
Asp Cys Asn Ile Gln Gly Asn Lys Asn Gln Ile Ala Gly Asn Ile Thr
500 505 510
Leu Thr Lys Glu Gln Pro His Gln Gln Pro Arg Val His Gln Asp Asn
515 52~ 525
Tyr Leu His Gln Gly Ile Val Asp Gly Asn Ile Phe Lys Asp Ala Asn
530 535 540
Val Ser Ala Ser His Ser Ile Leu Pro Gln Gly Asp Leu Phe Asp Gln
545 550 555 560
Cys Lys Ala Leu Asn Ser Pro Phe Asn Gly Gly Ser Asn Asp Asn Phe
565 570 575
His Phe Thr Phe Gly Ser Pro Phe Asn Leu Gln Thr Thr Asn Tyr Thr
580 585 590
75/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
Gly Asn Leu Pro Gly Ile Gly Tyr Asp Thr Thr Pro Lys Gln Asn Ala
595 600 605
Pro Ile Trp Phe
610
<210> 38
<211> 628
<212> PRT
<213> Arabidopsis sp.
<400> 38
Met Met Phe Asn Glu Met Gly Met Cys Gly Asn Met Asp Phe Phe Ser
1 5 10 15
Ser Gly Ser Leu Gly Glu Val Asp Phe Cys Pro Val Pro Gln Ala Glu
20 25 30
Pro Asp Ser Ile Val Glu Asp Asp Tyr Thr Asp Asp Glu Ile Asp Val
35 40 45
Asp Glu Leu Glu Arg Arg Met Trp Arg Asp Lys Met Arg Leu Lys Arg
50 55 60
Leu Lys Glu Gln Asp Lys Gly Lys Glu Gly Val Asp Ala Ala Lys Gln
65 70 75 80
Arg Gln Ser Gln Glu Gln Ala Arg Arg Lys Lys Met Ser Arg Ala Gln
85 90 95
Asp Gly Ile Leu Lys Tyr Met Leu Lys Met Met Glu Val Cys Lys Ala
100 105 110
Gln Gly Phe Val Tyr Gly Ile Ile Pro Glu Asn Gly Lys Pro Val Thr
115 120 125
76/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
Gly Ala Ser Asp Asn Leu Arg Glu Trp Trp Lys Asp Lys Val Arg Phe
130 135 140
Asp Arg Asn Gly Pro Ala Ala Ile Thr Lys Tyr Gln Ala Glu Asn Asn
145 150 155 160
Ile Pro Gly Ile His Glu Gly Asn Asn Pro Ile Gly Pro Thr Pro His
165 170 175
Thr Leu Gln Glu Leu Gln Asp Thr Thr Leu Gly Ser Leu Leu Ser Ala
180 185 190
Leu Met Gln His Cys Asp Pro Pro Gln Arg Arg Phe Pro Leu Glu Lys
195 200 205
Gly Val Pro Pro Pro Arg Trp Pro Asn Gly Lys Glu Asp Trp Trp Pro
210 215 220
Gln Leu Gly Leu Pro Lys Asp Gln Gly Pro Ala Pro Tyr Lys Lys Pro
225 230 235 240
His Asp Leu Lys Lys Ala Trp Lys Val Gly Val Leu Thr Ala Val Ile
245 250 255
Lys His Met Phe Pro Asp Ile Ala Lys Ile Arg Lys Leu Val Arg Gln
260 265 270
Ser Lys Cys Leu Gln Asp Lys Met Thr Ala Lys Glu Ser Ala Thr Trp
275 280 285
Leu Ala Ile Ile Asn Gln Glu Glu Ser Leu Ala Arg Glu Leu Tyr Pro
290 295 300
Glu Ser Cys Pro Pro Leu Ser Leu Ser Gly Gly Ser Cys Ser Leu Leu
305 310 315 320
77/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
Met Asn Asp Cys Ser Gln Tyr Asp Val Glu Gly Phe Glu Lys Glu Ser
325 330 335
His Tyr Glu Val Glu Glu Leu Lys Pro Glu Lys Val Met Asn Ser Ser
340 345 350
Asn Phe Gly Met Val Ala Lys Met His Asp Phe Pro Val Lys Glu Glu
355 360 365
Val Pro Ala Gly Asn Ser Glu Phe Met Arg Lys Arg Lys Pro Asn Arg
370 375 380
Asp Leu Asn Thr Ile Met Asp Arg Thr Val Phe Thr Cys Glu Asn Leu
385 390 395 400
Gly Cys Ala His.Ser Glu Ile Ser Arg Gly Phe Leu Asp Arg Asn Ser
405 410 415
Arg Asp Asn His Gln Leu Ala Cys Pro His Arg Asp Ser Arg Leu Pro
420 425 430
Tyr Gly Ala Ala Pro Ser Arg Phe His Val Asn Glu Val Lys Pro Val
435 440 445
Val Gly Phe Pro Gln Pro Arg Pro Val Asn Ser Val Ala Gln Pro Ile
450 455 460
Asp Leu Thr Gly Ile Val Pro Glu Asp Gly Gln Lys Met Ile Ser Glu
465 470 475 480
Leu Met Ser Met Tyr Asp Arg Asn Val Gln Ser Asn Gln Thr Ser Met
485 490 495
Val Met Glu Asn Gln Ser Val Ser Leu Leu Gln Pro Thr Val His Asn
500 505 510
78/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
His Gln Glu His Leu Gln Phe Pro Gly Asn Met Val Glu Gly Ser Phe
515 520 525
Phe Glu Asp Leu Asn Ile Pro Asn Arg Ala Asn Asn Asn Asn Ser Ser
530 535 540
Asn Asn Gln Thr Phe Phe Gln Gly Asn Asn Asn Asn Asn Asn Val Phe
545 550 555 560
Lys Phe Asp Thr Ala Asp His Asn Asn Phe Glu Ala Ala His Asn Asn
565 570 575
Asn Asn Asn Ser Ser Gly Asn Arg Phe Gln Leu Val Phe Asp Ser Thr
580 585 590
Pro Phe Asp Met Ala Ser Phe Asp Tyr Arg Asp Asp Met Ser Met Pro
595 600 605
Gly Val Val Gly Thr Met Asp Gly Met Gln Gln Lys Gln Glu Asp Val
610 615 620
Ser Ile Trp Phe
625
<210> 39
<211> 182
<212> PRT
<213> Artificial
<220>
<223> artificial
<400> 39
Val Leu Trp Arg Asp Leu Lys Lys Ser Lys Lys Met Ser Arg Ala Gln
1 5 10 15
Asp Gly Ile Leu Lys Tyr Met Leu Lys Met Met Glu Val Cys Ala Gly
79/80
CA 02482460 2004-10-21
WO 03/088738 PCT/US03/12409
23772-70998.ST25.txt
20 25 30
Phe Val Tyr Gly Ile Ile Pro Gly Lys Pro Val Gly Ala Ser Asp Asn
35 40 45
Arg Trp Trp Lys Lys Val Phe Asp Asn Gly Pro Ala Ala Ile Lys Tyr
50 55 60
Ala Gly Pro Leu Gln Leu Gln Asp Thr Leu Gly Ser Leu Leu Ser Leu
65 70 75 80
Met Gln His Cys Asp Pro Pro Gln Arg Pro Leu Glu Lys Gly Val Pro
85 90 95
Pro Trp Pro Gly Glu Trp Trp Gly Leu Lys Gln Pro Tyr Lys Lys Pro
100 105 110
His Asp Leu Lys Lys Trp Lys Val Gly Val Leu Thr Ala Val Ile Lys
115 120 ~ 125
His Met Pro Asp Ile Ala Lys Ile Arg Leu Val Arg Gln Ser Lys Cys
130 135 140
Leu Gln Asp Lys Met Thr Ala Lys Glu Ser Trp Leu Ala Glu Glu Pro
145 ~ 150 155 160
Pro Gly Ser Tyr Asp Val Gly Glu Asn Asp Cys Glu Asp Ser Ser Pro
165 170 175
Gly Gly Asn Ser Asn Asp
180
80/80
