Note: Descriptions are shown in the official language in which they were submitted.
CA 02485203 2004-11-05
WO 03/102213 PCT/US03/16798
ERROR-PRONE DNA POLYMERASE I MUTANTS
AND METHODS FOR TARGETED RANDOM MUTAGENESIS IN
CONTINUOUS CULTURE USING ERROR-PRONE DNA POLYMERASE I
MUTANTS
CROSS-REFERENCE TO RELATED APPLICATION
This application claims the benefit of provisional patent application number
601384,944, filed May 31, 2002, now pending.
TECHNICAL FIELD
This invention relates to mutants of DNA polymerase I and methods for their
application, particularly to DNA Pol I mutants engineered to have decreased
fidelity
of replication and to methods for their application in random mutagenesis for
the
modification of target sequences in continuous culture.
STATEMENT OF GOVERNMENT INTEREST
This invention has been made with Government support under grant number
ROI CA 78885, awarded by the National Institute of Health. The government has
certain rights in the invention.
BACKGROUND OF THE INVENTION
Enzymes are routinely used in the pharmaceutical and biotechnology
industries, and are finding increasing applications as biocatalysts in
chemical
synthesis and bioremediation. Native enzymes seldom possess the properties
required
for direct industrial or medical application, because they have evolved to
perform
specific functions within specific biochemical environments generally
different from
the chemical environments of industrial and medical applications. Two general
approaches have been used to alter enzyme performance. One involves the
replacement of individual amino-acid residues based on detailed structural
information, and the other involves the production of large libraries of
randomly
substituted variants, or mutants. By modifying the structural features already
present
in the parent enzyme, mutagenesis followed by the identification of mutants
with
properties of interest allows for fine-tuning enzyme performance with respect
to
CA 02485203 2004-11-05
WO 03/102213 PCT/US03/16798
2
optimal conditions for catalysis and/or substrate specificity. This approach
has great
potential in improving complex biosynthetic and degradative pathways, and in
overcoming the rate-limiting steps for medical and industrial applications.
Unlike site-directed mutagenesis, random mutagenesis requires no prior
knowledge of the structure of the targeted enzyme or of the mechanistic
aspects of the
reaction. The main limitation of random mutagenesis is that only a small
fraction of
the sequence space can be effectively explored. This is due to the
astronomical
number of possible combinations of amino acid substitutions in an average
enzyme
(far exceeding the size of most libraries) and to the frequent generation of
functionally
deficient mutants. The diversity of random mutant libraries is also
constrained by the
error-correcting nature of the genetic code. Although a particular amino-acid
residue
within a protein may be replaced by one of 19 other, naturally occurring amino
acids,
a given single point mutation within the codon that encodes the particular
amino acid
results in an average of only 6 different amino-acid substitutions, and these
substitutions tend to be conservative, resulting in replacement of the
particular amino
acid with another amino acid having similar physicochemical properties.
Numerous methods have been developed for introducing random point
mutations in vitro, ranging from PCR-mediated chemical mutagenesis [Roufa, D.
J.,
Methods Mol. Biol. 57: 357-67 (1996)], to mutagenic PCR [Cadwell, R. C. and
Joyce,
G. F., PCR Methods Appl. 3: 5136-40 (1994)], and ligation of degenerate
oligonucleotides [Black, M. E. and Loeb, L. A., Methods Mol. Biol. 57: 335-49
(1996)]. These methods offer some control over the intensity of mutagenesis,
and can
achieve very high mutation loads. However, even under intense mutagenesis
conditions, the probability of generating, by mutagenesis, a specific
subsequence of
more than 2 or 3 amino acids within an enzyme is minimal. Moreover, high
mutation
loads increase the proportion of deficient mutants.
One strategy to increase the likelihood of generating mutants with altered
properties consists of restricting mutagenesis to areas of the target gene
that are
directly involved in catalysis [Suzuki et al., Mol. Divers. 2: 111-18 (1996)].
While
this strategy has been successful in some cases [Encell et al., Cancer Res.
58: 1013-20
(1998); Glick et al., Embo J. 20: 7303-12 (2001); Patel, P. H. and Loeb, L.
A., Proc.
Natl. Acad. Sci. U S A 97: 5095-100 (2000); Shinkai et al., J. Biol. Chem.
276:
18836-42 (2001 )], it leaves large portions of the protein unexplored,
requires
CA 02485203 2004-11-05
WO 03/102213 PCT/US03/16798
3
substantial knowledge of protein structure and structure-function
relationships, and
becomes difficult when the sequence of the active site is not contiguous or
readily
identifiable.
Finding the desired variants is usually a major challenge. This may be done
either by true selection or by screening. True selection consists of giving a
growth
advantage to the clones that show the desired activity, and is therefore
performed in
vivo. Depending on how strong the growth advantage is, selection-based
techniques
can be extremely effective for increasing the representation of desired
variants in
populations. Selection-based techniques have the added advantage of
eliminating
defective and inactive mutants. There are a number of ways of linking a
specific
enzymatic property with growth, including genetic complementation, auxotrophy,
or
drug resistance. Unfortunately, selection-based techniques are not available
for all
enzymes and desired properties. When selection-based techniques are not
available,
desired variants can be identified by screening. Screening is more versatile
than
selection-based techniques, because screening does not require biological
activity.
However, screening is more limited in throughput.
When selection-based techniques are available, in vivo mutagenesis offers
significant advantages over in vitro methods, because in vivo mutagenesis may
be
readily coupled to a positive genetic selection. This promotes the
accumulation of
beneficial mutations, a strategy known as "directed evolution". By the
stepwise
selection of mutations with a positive effect on the phenotype of interest, we
can
reach combinations of mutations that had a very low probability at the
beginning of
the experiment. This iterative process of mutagenesis and selection is greatly
facilitated by performing both mutagenesis and selection simultaneously in
vivo.
The efficacy of a given in vivo mutagenesis system relies predominantly on
the type of cellular hosts or "mutator strains" used, and the currently
available mutator
strains are inadequate for a number of reasons. For example, mutDS is a mutant
of
Pol III deficient in proofreading activity [Scheuermann, R. H. and Echols, H.,
Proc.
Natl. Acad. Sci. U S A 81: 7747-51 (1984)]. Under certain growth conditions,
errors
introduced by this polymerase, the main replicative polymerase in E. coli,
result in the
saturation of mismatch repair and a dramatic increase in mutagenesis
[Schaaper, R.
M. and Badman, M., Embo. J. 8: 3511-16 (1989)]. Other strains are based on
mismatch repair inactivation [Glickman, B. W. and Badman, M., Proc. Natl.
Acad.
CA 02485203 2004-11-05
WO 03/102213 PCT/US03/16798
4
Sci. U S A 77: 1063-67 (1980)], or combine mutations affecting mismatch repair
(mut
S), oxo-dGTP repair activity (mut T), and the 3'-5' exonuclease activity of
DNA Pol
III (mut D) [Greener et al., Methods Mol. Biol. 57: 375-85 (1996)]. The
inactivation
of major DNA repair pathways, however, severely limits the performance of
these
mutator strains [Greener et al., Mol. Biotechnol. 7: 189-95 (1997)]. Since
mutagenesis is not directed toward the targeted sequence, growing these
mutator
strains in culture invariably results in widespread mutagenesis. This leads to
substantial loss of fitness of the organism, which, in turn, limits the number
of
effective iterative cycles that can be performed [Fijalkowska, I. J. and
Schaaper, R.
M., Proc. Natl. Acad. Sci. U S A 93: 2856-61 (1996)]. Also, non-specific
mutations
may obscure phenotypic expression from mutations in the target gene [Long-
McGie
et al., Biotechnol. Bioeng. 68: 121-25 (2000); Negri et al., Antimicrob.
Agents
Chemother. 44: 2485-2491 (2000)] and decrease the efficiency of mutagenesis
with
prolonged passage in culture [Greener et al., Mol. Biotechnol. 7: 189-95
(1997)].
In summary, although random mutagenesis allows enzyme modification with
minimal structural or mechanistic information about the target protein, the
number of
mutants that need to be analyzed limits the efficacy of this technique.
Although high
mutation loads cannot be achieved in vivo, coupling in vivo mutagenesis to
positive
genetic selection expands the number of mutants that can be effectively
analyzed.
Well-characterized mutator strains exist, but have the following limitations
with
respect to enzyme modification by random mutagenesis: (1) the dependence on
specific defects in DNA polymerases and/or in DNA repair pathways of a host;
(2)
the unhealthy state of host cells resulting from widespread chromosomal
mutagenesis
and from defective DNA repair pathways; (3) the increase in phenotypic noise
resulting from non-specific chromosomal mutations that makes selection based
on
phenotypic properties less reliable; and (4) the progressive decrease in
mutagenesis
rates that occurs with prolonged culture. There is a clear need for improving
random
mutagenesis in culture. Specifically, healthier host strains and independence
from a
specific genetic background are desired.
SUMMARY OF THE INVENTION
One embodiment of the present invention relates to the engineering of error-
prone DNA polymerases within the Pol I family and methods for their use in
CA 02485203 2004-11-05
WO 03/102213 PCT/US03/16798
implementing random mutagenesis of exogenous target genes of interest in
continuous culture at frequencies that exceed those of chromosomal DNA.
Various
embodiments of the present invention relate to the engineering of DNA
polymerases
by introducing mutations in residues within their active sites that increase
the error
5 rates of the polymerases, collectively called "error-prone Pol I mutants".
These
mutations involve either motif A, or motif B, or both motifs A and B. The
compositions of various embodiments of the present invention comprise the DNA
sequences encoding any portion of the engineered sites of Pol I mutants having
low-
fidelity, any portion of the Pol I mutants containing the engineered sites
conferring
low-fidelity, and host strains comprising either the DNA or polypeptide
sequences
representing these error-prone Pol I mutants.
Other embodiments of the invention relate to a method of expressing these
error-prone polymerase mutants under carefully regulated, or "optimized",
culture
conditions to achieve an elevated frequency of mutagenesis preferentially
targeted to
an exogenously-introduced plasmid encoding a sequence of interest. The
compositions and methods provide for random mutagenesis performed in
continuous
culture, without plasmid recovery between selection steps, which greatly
facilitates
the accumulation of beneficial mutations. The compositions and methods can be
easily adapted for use in any existing strain suitable for complementation
with the
target gene because the critical reagents are encoded in transformable
vectors, and
mutagenesis is not contingent on any specific genetic defect in the host
strain.
Suitable strains include cells endogenously expressing wild-type DNA
polymerase
and/or wild type DNA repair function. The compositions and methods can
introduce
a broad spectrum of mutations in any DNA target sequence, prokaryotic or
eukaryotic, resulting in the identification of sequences encoding polypeptides
with
altered properties.
BRIEF DESCRIPTION OF THE DRAWINGS
FIGS. 1 A-B provide a general overview of the 2-plasmid mutagenesis system,
involving the co-expression of an error-prone Pol I and an exogenously
introduced
DNA template.
CA 02485203 2004-11-05
WO 03/102213 PCT/US03/16798
6
FIG. 2 illustrates residues within motif A and motif B in the active site of
E.
coli DNA polymerase that are critical for the fidelity of replication during
nucleotide
incorporation.
FIG. 3A illustrates embodiments of template DNA, including prokaryotic and
eukaryotic DNA, to be targeted for in vivo mutagenesis by error-prone Pol I.
FIG. 3B illustrates, in particular, several target plasmids having variable
distances between the origin of replication (ori) and the ochre stop codon
within the
(3-lactamase gene used as a reporter for mutagenesis.
FIG. 4 illustrates the chemical structure of three classes of (3-lactamase
substrates: penicillin, cephalosporin, and aztreonam. Aztreonam served as a
selective
agent in Example 7.
FIG. SA illustrates the initial conditions and a method for inducing
mutagenesis in culture by the expression of error-prone Pol I in the presence
of a
target plasmid, as discussed in Example 2.
FIG. SB illustrates the optimized conditions and a method for inducing
mutagenesis in culture by the expression of error-prone Pol I in the presence
of a
target plasmid, as discussed in Example 2.
FIG. 6 illustrates the effect of culture conditions on mutagenesis by the
expression of error-prone Pol I mutants, as discussed in Example 3.
FIG. 7 illustrates the copy number of the target plasmid when D424A I709N
A759R error-prone Pol I is expressed under optimized conditions.
FIG. 8A shows the location of mutations identified within a 650 by interval
beginning at a distance of 100bp from the ColEl origin of replication (ori),
as
discussed in Example 5.
FIG. 8B shows how distance affects the frequency of mutations in a target
plasmid, as discussed in Example 5.
FIG. 9 illustrates the effect of error-prone Pol I expression on plasmid
mutagenesis rates in a host that is wild type for Pol I and proficient in
major pathways
of DNA repair, as discussed in Example 6.
FIG. 10 shows dose-response curves of aztreonam resistance conferred by a
representative subset of mutations identified following selection with
aztreonam, as
discussed in Example 7.
CA 02485203 2004-11-05
WO 03/102213 PCT/US03/16798
7 ,.
DETAILED DESCRIPTION OF THE INVENTION
Embodiments of the present invention are directed to a generation of Pol I
mutants, collectively referred to as "error-prone Pol I mutants," that have
been altered
from the wild-type DNA polymerase at specific residues that form the active
domain,
resulting in increased misincorporation by these Pol I mutants during
catalysis. These
low-fidelity Pol I mutants are potentially useful in any industry that employs
enzymes
to perform a biochemical reaction, where any improvement in the activity of
such
enzymes is desirable. Embodiments of the present invention are useful for
broad
applications in the pharmaceutical/medical industry as well as any industry
that
engages in a process that is enzyme-dependent.
FIG. 1 A provides an overview of the random mutagenesis approach in
continuous culture mediated by error-prone Pol I mutants. A prokaryotic host
cell
containing a first vector encoding a target gene of interest and a second
vector
encoding an error-prone Pol I mutant is represented. A suitable host cell may
or may
not express the wild type Pol I endogenously. By using the present mutagenesis
system, iterative cycles of mutagenesis and selection result in the directed
evolution
of a gene of interest.
FIG. 1 B illustrates an example of how the expression of low-fidelity Pol 1
mutants in host cells promote plasmid-specific mutagenesis, without
substantially
modifying the chromosome of a prokaryotic host when expressed in vivo. As
shown,
a host cell that has wild type Pol 1I1 (the major DNA polymerase) and
temperature-
sensitive Pol I activities can be transformed with two plasmids. When
mutagenesis
occurs at a restrictive temperature, the endogenous temperature-sensitive Pol
I can be
inactivated. Within a first ("target") plasmid, a target gene of interest can
be inserted
downstream of a ColEl origin of replication ("ori"), which is specifically
recognized
by Pol I. A second plasmid ("pSC101 on") can express a mutant DNA polymerase
that is engineered within the active site to erroneously replicate substrate
DNA, such
as the first plasmid containing the target gene. Since DNA synthesis by Pol I
is very
limited in the chromosome, mutagenesis is largely restricted to the target
plasmid
upon expression of the error-prone Pol I mutants in vivo.
The following paragraphs cover two general embodiments of the invention,
the compositions relating to the mutagenesis system, and the methods for using
the
CA 02485203 2004-11-05
WO 03/102213 PCT/US03/16798
8
present compositions for implementing directed evolution by continuous culture
in
vivo.
Components of the Muta~enesis System
With respect to the mutagenesis system that includes compositional
embodiments directed to error-prone Pol I mutants, the following provides
descriptions of: ( 1 ) the development and characterization of motif A and/or
B Pol I
mutants, (2) the host strains that can be used to express motif A and/or B Pol
I
mutants, and (3) the types of target sequences that can be used by the motif A
and/or
B Pol I mutants. Specific Examples relating to these compositions are
referenced and
provided in the following section.
Development and Characterization of Error-prone Pol I Mutants
Type I polymerases consist of a single polypeptide with 3 distinct domains
[Kornberg, A. and Baker, T. A., DNA replication, second edition, Vol. 1, p.
931. New
York: W.H. Freeman and Company (1992)]. 1n particular, 3 residues (I614, A661,
and T664) that are critical for fidelity in one such polymerase, Thermus
aquaticus
(Taq) polymerase, were previously identified by the present inventors [Suzuki
et al., J.
Biol. Chem. 272: 11228-35 (1997); Patel et al., J. Biol. Chem. 276: 5044-51
(2001)].
It has been shown that, upon dNTP binding, motifs A and B create a pocket in
the
catalytic site that accommodates an incoming nucleotide. Certain amino acid
substitutions at specific positions in these motifs favor misincorporations,
due to an
enlargement of the active site cavity and/or to a more stable "closed"
conformation
[Suzuki et al., J. Biol. Chem. 272: 11228-35 (1997); Patel et al., J. Biol.
Chem. 276:
5044-51 (2001)].
One embodiment of the present invention provides compositions relating to
variants of E. coli DNA polymerases, i.e., error-prone Pol I mutants, that are
engineered within the active site, particularly in motif A and/or motif B, to
produce an
elevated frequency of replication mistakes within substate DNA. FIG. 2
illustrates the
positions within motifs A and B that are identified and characterized by the
invention,
which are critical for the fidelity of E. coli polymerases. In particular,
position I709
of motif A and positions 5756 and A759 of motif B of E. coli DNA Pol I are
engineered to increase incorporation of mismatched residues. These mutants are
CA 02485203 2004-11-05
WO 03/102213 PCT/US03/16798
9
further described in the following sections. Methods for the construction of
error-
prone Pol I mutants are provided below in Example 1.
One embodiment is directed to E. coli error-prone Pol I mutants bearing
amino-acid substitutions in both the motif A and 3' --~ 5' exonuclease
domains, which
exhibit an elevated frequency of misincorporation during replication of target
DNA.
Motif A mutants were altered by substituting wild type aspartic acid (D) at
position
424 with alanine (A) to inactivate the exonuclease function essential for
proof
reading. FIG. 2 provides examples of motif A mutants, lacking exonuclease
activity,
including the D424A 1709N and D424A I709F mutants, in which the wild type
isoleucine at position 709 is substituted with an asparagine (N), or a
phenylalanine
(F). The biochemical characterization of these two mutants was conducted by
the
present inventors, and the following publication representing their work is
herein
incorporated by reference [Shinkai, A. and Loeb, L., J. Biol. Chem. 276: 46759-
64
(2001)]. These error-prone Pol I mutants, bearing one or more mutations in
motif A
of the active site, more frequently produce errors during template replication
both in
vitro and in vivo, and thus may be used in vitro and in vivo.
Another embodiment is directed to E. coli error-prone Pol I mutants, bearing
mutations in both the motif B and the 3' ->5' exonuclease domains, that
produce an
elevated frequency of misincorporation during replication of target DNA. Motif
B
mutants were altered by substituting wild type aspartic acid (D) at position
424 with
alanine (A) to inactivate the exonuclease function essential for proof
reading. F1G. 2
provides examples of motif B mutants, lacking exonuclease activity, that
include the
D424A S756E and D424A A759R mutants, in which the wild type serine (S) in
position 756 is substituted with glutamic acid (E) and the wild type alanine
(A) in
position 759 is substituted with arginine (R). These error-prone Pol I
mutants,
bearing one or more mutations in motif B of the active site, may be used in
vitro and
in vrvo.
A further embodiment is directed to E. coli error-prone Pol I mutants, bearing
amino-acid substitutions in both motif A and motif B, that produce highly
elevated
frequencies of misincorporation during replication of target DNA. These motifs
A
and B mutants were altered to inactivate their 3'~S' exonuclease activity by
substituting wild type aspartic acid (D) at position 424 with alanine (A),
although this
CA 02485203 2004-11-05
WO 03/102213 PCT/US03/16798
modification doesn't appear to have a significant impact on mutagenesis in
these
mutants (see Table 2). FIG. 2 provides examples of error-prone Pol I mutants
carrying amino-acid substitutions in motif A and motif B. One such mutant is
the
"D424A I709N A759R," in which the wild type isoleucine (I) at position 709 is
5 substituted with an asparagine (N) and the wild type alanine (A) in position
759 is
substituted with arginine (R). Another mutant in both motifs is referred to as
the
"D424A I709F A759R," in which the wild type isoleucine (I) at position 709 is
substituted with a phenylalanine (F) and the wild type alanine (A) in position
759 is
substituted with arginine (R). These error-prone Pol I mutants, bearing a
single or
10 more amino-acid substitution in each motif A and motif B of the active
site, may be
used in vitro and in vivo.
Additional embodiments, related to the above-discussed E.coli error-prone Pol
I mutants carrying motif A, motif B, and the combination of motif A and motif
B
mutations, include homologous mutations that may be engineered into other
members
of the Pol I family of DNA polymerises, including the DNA polymerise of
Staphylococcus aureus, Streptococcus pneumoniae, Bacillus subtillis, or
Salmonella
enteritidis.
Unrestricted Selection in Host Strains Used for Mutagenesis Mediated by Error-
prone
Pol I Mutants
Suitable hosts for the expression of mutant motif A and/or motif B Pol I genes
are not restricted to strains with inactivated DNA repair mechanisms or to
strains with
defective chromosomal Pol I. The mutagenesis system is therefore uniquely
adaptable to a variety of strains imaginable. Various embodiments that employ
cells
with or without endogenous wild type Pol I activity may be used to express
mutators.
Other embodiments are directed to strains with or without inactivated DNA
repair
mechanisms. Examples of host strains that may provide the appropriate cellular
environment for supporting mutagenesis mediated by error-prone Pol I
expression
include E. coli strains such as the JS200 and XL1-Blue. The JS200 strain
represents a
strain having a temperature-sensitive allele of Pol I (polA72) in the
chromosome
[Monk, M. and Kinross, J., J. Bacteriol. 109: 971-78 (1972)]. The XL1-Blue
strain
represents a strain having endogenous wild type Pol I activity and substantial
proficiency in DNA repair, and therefore able to support the co-expression of
CA 02485203 2004-11-05
WO 03/102213 PCT/US03/16798
11
exogenous error-prone Pol I mutants. Another embodiment is directed to a
number of
existing strains that are deficient in specific enzymes that can be
functionally
complemented, permitting the exploitation of the system to its fullest extent.
When used in vivo, the error-prone Pol I mutants encoding either motif A
and/or motif B amino-acid substitutions can be delivered into a prokaryotic
host as
part of a circular vector such as a plasmid or in a linear form, such as in a
bacterial
phage. In one embodiment, the vehicle encoding the motif A and/or motif B Pol
I can
remain in an unintegrated form, as an exogenous plasmid for example. In
another
embodiment, single or multiple copies of genes encoding any portion of motif A
and/or motif B mutator sequences may be integrated into the chromosome of the
prokaryotic host, generating stable lines of mutator prokaryotic strains or
cell lines.
One example for generating a stable mutator cell line is described as follows.
A double-stranded DNA fragment consisting of 3000 by of the PolAl locus
encoding
a low-f delity mutant that is flanked on the 5' and 3' sides by approximately
1000 by
of the native genomic sequence, can be subcloned into a plasmid with a
temperature
sensitive origin of replication. Chloramphenicol can be used as a marker for
positive
selection and sucrose can be used for negative selection. For example, the
resulting
plasmid can be used to transform JS200 cells and can be selected for
chloramphenicol
resistance under permissive conditions at 30°C. The culture can be
switched to 37°C
in order to block plasmid replication by the temperature-sensitive Pol I
allele. These
conditions confer a dramatic growth advantage to cells that have integrated
the error-
prone Pol I mutants in their chromosome, such that most of the colonies that
grow at
37°C are expected to be stable integrants that can be confirmed by PCR.
When this
method does not yield desirable results, sucrose can be added in the selection
step to
actively select against the presence of the plasmid. A number of other methods
for
generating allelic substitutions that are currently practiced by those skilled
in the art
are contemplated.
Unrestricted Selection in Target DNA Used for Mutaeenesis Mediated by Error-
prone
Pol I Mutants
The in vivo mutagenesis system contemplates a plurality of suitable templates,
as diagrammed in FIG. 3. As one embodiment, the targeted template can be a
prokaryotic gene (FIG. 3A) encoding a full-length protein or any fragments
thereof.
CA 02485203 2004-11-05
WO 03/102213 PCT/US03/16798
12
As another embodiment, the targeted template can be a eukaryotic gene (FIG.
3A)
that may be in the form of a cDNA or genomic DNA without introns, or any
fragments thereof. For example, an eukaryotic gene in any of these forms may
be
exogenously introduced and unfaithfully replicated in prokaryotic strains that
express
endogenously temperature-sensitive or wild type Pol I. Subsequently, a library
of
mutated eukaryotic DNA may be isolated from their prokaryotic hosts by using,
for
example, conventional methods for plasmid preparation or for phage recovery.
Once
the plasmid library is isolated, it may be subjected to restriction-enzymatic
digestion
with one or more endonucleases that are commercially available to once skilled
in the
art of molecular biology to dissociate the targeted gene of interest from the
vector.
This can be easily done using gel electrophoresis to separate DNA fragments
based on
shape and size differences. Upon isolation and repurification, the gene
library may be
used for subcloning into eukaryotic expression vectors. The mutated versions
of the
target gene of interest may be transformed into eukaryotic cells or
conventional cell-
lines to screen for a desired property or function. Other procedures for
manipulating
DNA that are within the scope of a person skilled in the art are also
contemplated. As
one example, the x2913recA strain, which is defective in thymidine synthase
(dthyA572), may be co-transformed with a vector encoding the human TS cDNA
placed downstream from on and a vector expressing an error-prone Pol I mutant.
Selection may be conducted in increasing concentrations of 5-flourouracyl
("SFU"), a
potent inhibitor of thymidine synthase. Clones having increased resistance to
SFU
can be isolated and their mutations characterized using materials and methods
practiced by persons skilled in the art [Landis et al., Cancer Res. 61: 666-72
(2000)].
The template that is subjected to in vivo mutagenesis by Pol I mutators may be
delivered in a circular form, such as a plasmid, or in a linear form. In one
embodiment, the template may be delivered by a bacteriophage that can inject
phage
genomic material into a prokaryotic host expressing one error-prone Pol I
mutant.
When the bacteriophage depends on Pol I for replication, like for example,
bacteriophage T4 in a RNAseH-deficient background [Hobbs, L.S. and Nossal,
N.G.
J. Bacteriol 178: 6772-6777 (1996)], viral replication in the host results in
expansion
and mutagenesis of the template, generating a library of mutants.
As another embodiment, the targeted genes) can be exogenously introduced
in a Pol I-dependent plasmid, including the plasmids ColEl, pBR322, plSA, pMB,
CA 02485203 2004-11-05
WO 03/102213 PCT/US03/16798
13
pNT7, pVH5l, RSF1030, CloDFl3, ColE2, pLMV158, pLSI, and their derivatives.
The target plasmid is distinct from the plasmid encoding the error-prone Pol I
mutant,
which is Pol I-independent. In its simplest form, the system comprises one
plasmid
encoding an error-prone Pol I mutant and another plasmid or phage encoding the
targeted gene. Other methods of gene delivery that are known and practiced by
persons skilled in the art are included in these embodiments.
As an example of the efficacy of error-prone Pol I random mutagenesis for
enzyme modification, an isoform of the (3-lactamase gene ("TEM-1 ")
representing a
hypothetical gene of interest in place of any prokaryotic or eukaryotic gene,
was
inserted into a plasmid as a target for in vivo mutagenesis, as described in
Example 2
provided below. For measuring the frequency of in vivo mutagenesis associated
with
error-prone Pol I expression, a (3-lactamase reversion assay decribed below,
can be
used. As illustrated in FIG. 3B, the (3-lactamase gene was inserted into
template
plasmids at an increasing distance from the position of ori, i.e. from the
origin of
ColEl plasmid replication ("pLA230," "pLA700," "pLA1400," "pLA2800," and
"pLA3700"). In all constructs, an ochre stop codon (TAA) replaces glutamic
acid
(GAA) 26 codons downstream from the translation start of the TEM-1 [3-
lactamase
gene. For example, in the reporter plasmid pLA230, the ochre stop codon is
positioned approximately 230 by downstream of the ori. Because most mutations
within the ochre stop codon result in its reversion to a codon encoding an
amino acid
and thus allow for (3-lactamase expression, mutations can be scored as
carbenicillin-
resistant colonies. These may be confirmed by sequencing plasmids isolated
from
these colonies. To assess the mutagenic effect of error-prone Pol I on a ColEl
plasmid sequence, the frequency of ochre reversion in cells expressing error-
prone Pol
I can be compared to the frequency in cells expressing wild type Pol I. To
establish
the mutation frequency within the chromosomal DNA, rifampicin resistance,
arising
from point mutations in the RNA Pol II gene encoded in the chromosome, can be
scored [Ovchinnikov et al., Mol. Gen. Genet. 190: 344-348 (1983)].
The (3-lactamase gene can be subjected to in vivo mutagenesis in the presence
of increasing concentrations of aztreonam, to select mutations that improve
the (3-
lactamase substrate recognition of aztreonam. The TEM-1 isoform of (3-
lactamase is
the most frequently occurring (3-lactamase found in Gram-negative clinical
isolates,
CA 02485203 2004-11-05
WO 03/102213 PCT/US03/16798
14
functioning in the catalytic degradation of (3-lactams by amide-bond
hydrolysis
[Wiedemann et al., J. Antimicrob. Chemother. 24 Suppl. B: I-22 (1989)]. The
catalytic efficiency of [3-lactamase varies greatly depending on the (3-lactam
used as a
substrate. Whereas (3-lactamase degrades pencillin with high efficiency,
hydrolysis of
cephalopsorins by [3-lactamase is poor, and it has only residual activity
against newer,
extended-spectrum antibiotics. Extended-spectrum antibiotics include aztreonam
and
third-generation cephalosporins, such as cefotaxime and ceftazidime, that
carry bulky
adducts specifically designed to minimize recognition by (3-lactamase. FIG. 4
illustrates the structure of representatives of each of these (3-lactam
substrates
including penicillin, cephalosporin, and aztreonam. Aztreonam was used as a
selective agent in Examples 4 and 7.
The evolution of the (3-lactamase, which occurs in nature under pressure from
widespread use of extended-spectrum antibiotics in the clinics [reviewed in
Medeiros,
A., Clin. Infect. Dis. 24 Suppl. 1: S19-45 (1997)] can be simulated in the
laboratory
[Long-McGie et al, Biotechnol. Bioeng. 68: 121-5 (2000); Zaccolo, M. and
Gherardi,
E., J Mol. Biol. 285: 775-83 (1999); Orencia et al., Nat. Struct. Biol. 8: 238-
42
(2001)]. From clinical isolates and laboratory selections, it is known that at
least two
specific amino-acid substitutions are required for substantial resistance to
extended-
spectrum (3-lactams [reviewed in Knox Antimicrob. Agents Chemoth. 39: 2543-
2601
(1995)]. Resistance mutations have been identified in a total of 37 different
positions,
which are listed in http://www.lahey.org~Jstudies/temtable/htm. These
mutations fall
broadly into two categories: one group of mutations, including the 8164 S/H
(arginine to serine or histidine) and the G238S (glycine to serine), occurs
near the
active site and increases the catalytic efficiency of the (3-lactamase enzyme.
Mutations belonging to the second group that include the E104K (glutamic acid
to
lysine) and the M182T (methionine to threonine), are typically positioned
distantly
from the active site. They are most likely selected in response to mutations
in the
catalytic site to suppress destabilizing effects resulting from these
mutations
[Petrosino J. et al., Trends Microbiol. 8: 323-327 (1998)].
Mutagenesis of the [3-lactamase gene coupled with aztreonam selection was
chosen to validate the use of error-prone Pol I random mutagenesis for enzyme
modification. The following two considerations were critical in this choice of
target:
CA 02485203 2004-11-05
WO 03/102213 PCT/US03/16798
(1) studies of clinical isolates and selections in the laboratory establish
that the (3-
lactamase gene can be modified through mutation to recognize aztreonam as a
substrate; and (2) at least two specific amino-acid substitutions are required
to achieve
substantial aztreonam resistance. This reduces the potential background
contributed
5 by spontaneous mutations, as they are highly unlikely to generate more than
one
amino acid substitution because of its low frequency (10-~ in JS200 cells).
Method for in vivo Muta~enesis of Target DNA, Mediated by Error-prone Pol I
Mutants, in Combination with Selection or Screenine
10 With respect to the methods embodied for implementing in vivo mutagenesis
mediated by error-prone Pol I mutants, the following provides descriptions of:
(1) the
advantages and applications of error-prone Pol I-mediated mutagenesis in
continuous
culture, and (2) the parameters of the optimized culture conditions. Specific
Examples relating to these embodiments are referenced and provided in the
following
15 section.
Advantages and Applications of Error-prone Pol I-Mediated Muta~enesis in
Culture
for Enzyme Modification
A method of random mutagenesis, followed by selection or screening allows
the simultaneous exploration of sequence, structure, and functional space of
an
enzyme without any detailed mechanistic or structural information [Skandalis
et al.,
Chem. Biol. 4: 889-98 (1997)]. Mutagenesis and selection/screening may be
repeated
in an iterative fashion so that the sequence space is directed toward changes
that
improve performance, in an approach referred to as "directed evolution."
Performing
mutagenesis and selection simultaneously in continuous culture eliminates the
need
for recovering target DNA between selection steps.
Directed evolution still explores only a small fraction of the sequence space,
so it is unlikely to achieve optimal solutions or to evolve new catalytic
functions.
Larger leaps in sequence can be achieved by shuffling sequences within a
library of
mutants that has been prescreened for activity or within a family of enzymes
[Smith,
G. P., Nature. 370: 324-5 (1994); Crameri, A. et al., Nature. 391: 288-91
(1998)]. In
one embodiment, the invention can also be used in combination with these
shuffling
CA 02485203 2004-11-05
WO 03/102213 PCT/US03/16798
16
technologies. The error-prone DNA Pol I mutants may produce additional
mutations
during these processes of shuffling in vitro and in vivo.
The error-prone DNA polymerases of the present invention have potential
applications in the medical field, both in drug development and in gene
therapy. For
example, random mutagenesis has been instrumental in generating modified
enzymes
for the management of cancer [Encell L. P. et al., Nat. Biotechnol. 17: 143-7
(1999)].
These include mutants designed to reduce the side-effects of cancer therapy
and
mutants with improved pro-drug-activating properties. Examples of the former
include: thymidylate synthase resistant to 5-flourouracil; 6-methyguanine-
methyl
transferase resistant to alkylating agents and to 6-benzoguanine; and
dihydrofolate
reductase resistant to metrotrexate. Examples of the latter include
thymidylate kinase
with enhanced specificity for gancyclovir or acyclovir, deoxycytidine-kinase
mutants
specific for Ara-C, and a cytosine deaminase specific for 5-fluorocytosine.
The error-prone Pol I mutants of the invention also have potential
applications
in promoting enzyme modification by random mutagenesis in areas as diverse as
chemical synthesis, bioremediation, and food processing [reviewed in
Chirumamilla
et al., Mol. Cell Biochem. 224: 159-68 (2001); Schmidt-Dannert et al., Trends
Biotechnol. 17: 135-6 (1999)]. The Pol I mutants of the invention may be used
to
generate enzymes with altered substrate specificity, including altered
esterases,
lipases, cytochrome oxidases, and dioxygenases, and enzymes with improved
catalysis in non-natural environments, such as alkaline conditions, heat,
cold, and/or
presence of metal chelators. For example, Pol I mutants may be used to
generate
enzymes with altered substrate specificity to improve the efficiency and
enantiomeric
purity of chemical synthesis. Enzymes resistant to heat and to the presence of
metal
chelators may be obtained by the error-prone Pol I mutagenesis to improve
rates of
biocatalysis in chemical synthesis. Pol I mutants may be also used to generate
enzymes that confer resistance to alkaline conditions for degradation of dyes
in
laundry, or resistance to cold conditions in food processing applications.
The present invention has foreseeable applications in emerging fields,
including biotechnology, gene therapy, and bioremediation. The customization
of
substrate recognition by DNA-specific reagents, such as recombinases and
restriction
enzymes [Buchholz et al., Nature Biotechnol. 19: 1047-52 (2001); Santoro et
al.,
Proc. Natl. Acad. Sci. U S A, 99: 4185-90 (2002)], or the improvement of
enzymes
CA 02485203 2004-11-05
WO 03/102213 PCT/US03/16798
17
for alkane degradation [Belhaj et al., Res. Microbiol. 153: 339-344 (2002)],
are two
examples of emerging areas that can benefit from the use of the embodiments of
the
present invention.
In vivo Muta~enesis and Selection/Screenin~ Under Optimized Culture Conditions
A method for generating enhanced mutagenesis that can be targeted to a
sequence of interest is provided, in which error-prone Pol 1 mutants bearing
amino-
acid substitutions in the motif A and/or B, for example, including amino-acid
substitutions at positions I709N/F and A759R, are expressed in host strains
under
carefully controlled culture conditions, as described below in Example 2. In
one
embodiment, the method comprises transforming a prokaryotic host strain with
an
expression vector having any of numerous forms that encodes one or more error-
prone Pol I mutants, and transforming a second vector, such as a plasmid that
encodes
one or more target genes. In another embodiment, the method comprises
incorporating one or more copies of genes or fragments that encode error-prone
Pol I
within the chromosomes of cell lines or host strains, and subsequently
transforming
the population of cells expressing the mutants with a vector, such as a
plasmid, that
encodes one or more target genes. In one embodiment, controlled conditions
comprise growing a culture of transformed cells in a rich media and letting
the culture
reach and maintain a stationary growth phase, such as a growth stage obtained
15
hours after inoculation. As a preferred embodiment, culture conditions by
which
error-prone Pol I achieves optimal mutagenic performance include: (1) growing
the
transformed host strain cultures at a cell density indicative of exponential
growth
(e.g., OD600~0.5); (2) diluting the culture to a low concentration (e.g.,
1:105) in
nutrient-rich medium (e.g., 2XYT) pre-warmed at 37 °C; (3) incubating
the culture
for an additional time (e.g., 15 min. at 37 °C); and (4) placing the
culture in a 37 °C
shaker to reach a point of saturation (e.g., 15 hours).
As another embodiment, the error-prone Pol I mutants may be used to produce
labeled plasmid DNA or fragments thereo, in vivo. For example, one or more
labeled
nucleotide or nucleoside analogs may be added to the culture medium to be
incorporated into the replicated copies of target plasmid DNA. As a related
embodiment, the error-prone Pol I mutants may be purified from cell extracts
as
recombinant proteins, and added to in vitro reactions containing a target
sequence for
CA 02485203 2004-11-05
WO 03/102213 PCT/US03/16798
18
microarray analysis or other high-throughput DNA labelling procedures or for
sequencing purposes. Modified deoxynucleoside triphosphates ("dNTPs") or
nucleotide analogs, including dATPs, dGTPs, dCTPs, dTTPs, dUTPs, and dITPs,
and
related analogs may be added in any combination in in vitro DNA polymerization
reactions [click et al., Biotechniques 33(5): 1136-42 (2002)]. These
nucleotides and
nucleosides may be modified by covalent attachment of groups for detection by
fluorescence (rhodamine green, fluorescein), chemiluminescence (biotin), or
radioactivity (y[32P]). The nucleoside and nucleotide analogs may be
synthesized by
known methods in the art.
Using the compositions and methods provided, error-prone Pol I mutants
bearing mutations in motif A and/or motif B can increase the frequency of
mutagenesis, between 4 and 5 orders of magnitude above that of wild type Pol
I, with
up to a 400-fold differential relative to the chromosome, as shown in Example
3
provided below. The compositions and methods permit mutagenesis targeting
nucleotides located distantly from the on including a distance of 3700 bp, far
exceeding the 400 by limit reported by previous investigators. Thus, a broad
variety
of prokaryotic and eukaryotic genes can be targeted by the present invention.
The compositions and methods of the invention permit the targeting of the
sequence of interest, resulting in a diverse mutation spectrum and a wide
distribution
of mutations, as shown in Example 4 provided below. The mutagenesis system of
the
present invention provides the additional advantage, with respect to existing
mutator
strains, so that the mutagenesis system representing one embodiment of the
current
invention may be readily adapted to different strains, as shown in Example 6
provided
below. Suitable host strains include: (1) strains endogenously expressing a
temperature-sensitive DNA Pol I allele, (2) a wild type DNA polymerase; and
(3)
both wild type DNA pol and wild type DNA repair phenotypes. To adjust the
optimal
expression level of error-prone Pol I in various strains for achieving random
mutagenesis, inducible promoters may be used. Other embodiments of the in vivo
mutagenesis system are directed to a large number of existing strains known to
be
deficient in specific enzymes and amenable to complementation such as the
x2913recA strain defective in thymidine synthase described above.
The embodiments of the compositions and methods permit the accumulation
of beneficial mutations within the target gene, in a continuous culture. Two
CA 02485203 2004-11-05
WO 03/102213 PCT/US03/16798
19
independent selections with increasing concentrations of aztreonam were
carried out
under optimized mutagenic conditions to obtain 23 sequences representing (3-
lactamase variants from each selection, as shown in Example 4 and 7, provided
below. Two known amino acid substitutions were identified in these selections:
E104K (glutamic acid changed to lysine at position 104) and R164H (arginine
changed to histidine at position 164) in selection 1 and to S (arginine
changed to
serine at position 164) in selection 2. In addition, a novel mutation, the
G267R
(glycine changed to arginine at position 267) was identified in selection 1.
The
mutations can occur sequentially in this system as exemplified by the
introduction of
the G267R mutation following the E 104K and R 164H mutations, which can be
found
in a single clone that encoded a silent mutation also present in all the other
plasmids
carrying the E104K and R164H mutations that were sequenced. No other silent
mutations were found. Table 4 in Example 7 presents the aztreonam phenotypes
corresponding to different combinations of these amino acid substitutions
after
subcloning into vectors that have not been replicated by error-prone Pol I
mutants to
ensure that no other mutations were present. FIG. 10 shows dose-response
curves of
aztreonam resistance conferred by a representative subset of these aztreonam
resistance mutations. All non-synonymous mutations contributed to aztreonam
resistance. The almost complete absence of irrelevant mutations is consistent
with an
estimated low mutation load and suggests that each mutation arises
sequentially, in a
process that simulates natural evolution of resistance to (3-lactamase
antibiotics [Negri
et al., Antimicrob. Agents Chemother. 44: 2485-2491 (2000); Vuye et al.,
Antimicrob.
Agents Chemother. 33: 757-761 (1989)]. Relatively mild mutagenesis conditions
are
more than offset by the large size of the pool (approximately 10' ~ plasmids)
and by
the discriminating power of iterative functional selection. Finding three
relevant
mutations in a single (3-lactamse sequence, with probability of 10-~°
[Long-McGie et
al., Biotechnol. Bioeng. 68: 121-5 (2000)], is an illustration of the
efficient
exploration of sequence space allowed by the embodiments of the present
invention.
The compositions and methods can be used for prognostic purposes in
predicting the evolution of novel resistance mutations, such as the G267R,
based on
the fact that the selection step can identify the most common mutations found
in
clinical isolates. The embodiments of the invention are unlike most other
CA 02485203 2004-11-05
WO 03/102213 PCT/US03/16798
mutagenesis approaches that yield a more biased representation relative to
naturally
occuring mutants [See Orencia et al., Nat. Struct. Biol. 8: 238-242 (2001)].
Mutations
at positions E104 and 8164 are the most frequently found in naturally-
occurring
clinical isolates (http://www.lahey.or~/studies/temtable.htm). This is
consistent with
5 a diverse and well-distributed mutation spectrum that approximates the
endogenously
occuring mutations [Schaaper R., R.M. and Dunn, R. L. Genetics 129, 317-326
(1991)]. No mutation had been previously reported at position 6267, thus the
G267R
represents a novel determinant that confers aztreonam resistance. This
mutation is
located in the loop connecting the BS (3-sheet to the N-terminal >-I11 helix,
that
10 undergoes a shift in the presence of the third most frequent mutation in
clinical
isolates, the G238S (glycine changed to serine at position 238).
To provide support for these embodiments, experimental data are provided in
Examples 2 through 7, which follow at the end of this section. It should be
appreciated that, although specific embodiments of the invention are described
herein
15 for purposes of illustration, various modifications may be made without
departing
from the spirit and scope of the invention. Accordingly, the invention is not
limited
except as by the appended claims.
EXAMPLES
20 The following Examples demonstrate the embodiments of the invention in
various contexts. In Example 1, methods for constructing low-fidelity E. coli
Pol I
mutants engineered in motif A and/or B are provided. In Example 2, culture
conditions optimized for elevated frequency of plasmid-specific in vivo
mutagenesis
are provided. In Example 3, the synergistic effect on the efficacy of plasmid
targeting
in vivo mediated by the D424A I709N A759R Pol I mutant and its sensitivity to
culture conditions is provided. In Example 4, the spectrum and frequency of
mutations introduced into target sequence/(3-lactamase upon D424A I709N A759R
Pol I mutant expression are provided. In Example 5, the frequency of mutations
in a
target plasmid as a function of the distance from the origin of replication
(ori) is
provided. In Example 6, the effect of D424A 1709N A759R Pol expression on the
frequency of in vivo mutagenesis in host cells that endogenously produce wild
type
Pol I and are proficient in DNA repair is provided. In Example 7, an example
of
CA 02485203 2004-11-05
WO 03/102213 PCT/US03/16798
21
directed evolution under selective pressure such as increasing concentration
of
aztreonam is provided.
EXAMPLE 1
Construction of Error-prone Pol I Mutants
Construction of plasmids encoding error-prone Pol I mutants of the present
invention used in Examples 1-7 were made in the following way. E. coli
DHSapolA
was amplified by colony polymerase chain reaction with 59-
ATATATATAAGCTTATGGTTCAGATCCCCCAAAATCCACTTATC-39 and 59-
ATATATATGAATTCTTAGTGCGCCTGATCCCAGTTTTCGCCACT-39 as
primers. To create pECpol I, the 3-kilobase pair amplified fragment was
digested
with Hindlll and EcoRl, and then cloned under the lactose promoter into
pHSG576, a
low copy-number plasmid that has a pol 1-independent origin and
chloramphenicol as
a selectable marker. Site-directed mutagenesis was performed on pECpol I to
introduce silent mutations C to A at position 2,067 and G to C at position
2,214 of the
polA gene to create Accl and Eagl sites, respectively, that flank the sequence
encoding motif A. The resulting plasmid was named pECpol IS.
Plasmids encoding the I709N and I709F motif A mutants of DNA polymerase
were isolated from a Pol I library by genetic selection. A random library was
constructed by annealing two single-stranded DNA oligonucleotides containing
segments with random sequences: Oligo 1 was a 104-mer corresponding to the
sense
nucleotides 2,053-2,156, and containing an AccI site for cloning (5'
GAAGGTCGTCGTATACGCCAGGCGTTTATTGCGCCAGAGGATTAT
[GTGATTGTCTCAGCGGACTACTCGCAGATTGAACTGCGC]ATTATGGCGC
ATCTTTCGCG-3'); Oligo 2 was a 89-mer corresponding to anti-sense strand
nucleotides 2,225-2,137 and containing an EagI site (5'-AACACTTC
TGCGGCCGTTGCCCGGTGGATATCTTTTCCTTCCGCGAATGCGGTCAGCAA
GCCTTTGTCACGCGAAAGATGCGCCATAAT-3'). The bracketed nucleotides in
Oligo 1 were synthesized to contain 88% wild-type nucleotide and 4% each of
the
other three nucleotides at every position. The 20-base pair complementary
regions of
hybridization are underlined. Oligo 1 and Oligo 2 were annealed at their
nonrandom
complementary regions by mixing 250 pmol of each in 20 pl of H20 and heating
to
CA 02485203 2004-11-05
WO 03/102213 PCT/US03/16798
22
95 °C for 5 min, followed by cooling for 2 h to room temperature. The
partially
duplex oligonucleotide was extended by incubation with 50 units of E. coli pol
I
Klenow fragment (New England BioLabs, Beverly, MA) for 2 h at 37 °C in
a 0.3-ml
reaction mixture containing 10 mM Tris-HCI, Ph 7.5, 5 mM MgCl2, 7.5 mM DTT,
and 0.5 mM of all four dNTPs. The resulting DNA was digested with Accl and
Eagl,
purified, and inserted into pECpoldum in place of the stuffer fragment.
Plasmids
containing the random library were transformed into E. coli XLl-Blue, and the
number of transformed cells was determined by plating an aliquot onto LB agar
plates
containing 30 pg/ml of chloramphenicol. The remainder of the library was
amplified
by growing the transformed E. coli XL1-Blue in 3 liters of 2XYT medium for 16
h at
37 °C, and the random library, pECpolLib, was then purified. The
pECpolLib was
transformed into JS200 cells (with plasmids pHSG576, pECpollS, pECpoldum as
controls) and selected for survival on nutrient agar plates at 37 °C
overnight. Only
paired samples containing less than 1,500 colonies at 30 °C were
analyzed because
dense plating of the cells leads to elevated background at 37 °C.
Approximately, 280
colonies that grew at 37 °C were randomly picked and sequenced and
found to
contain between 1 and 2 amino acid substitutions.
The A759R and S756E amino acid substitutions in motif B were introduced by
site-directed mutagenesis into plasmids I709N, 1709F, D424A I709N and D424A
I709F to generate the mutants I709N A759R, D424A I709F A759R, D424A DI709N
A759R, and D424A I709F A759R. For site-directed mutagenesis, QuickchangeT"~
(Stratagene~ La Jolla, CA) was used with the following mutagenic primers: Pol
I
S756E-F S'-CCAGCGAGCAA CGCCGTGAGGCGAAAGCGATCAACTTTGG-3 ;
Pol I S756E-R 5'-CCAAAGT
TGATCGCTTTCGCCTCACGGCGTTGCTCGCTGG-3'; Pol I A759R-F 5'-
CGCCGTAGCGCGAAACGGATCAACTTTGGTCTGATTTATGGC-3'; Pol I
A759R-R 5'- GCCATAAATCAGACCAAAGTTGATCCGTTT
CGCGCTACGGCG-3'.
To deplete exonuclease function, site-directed mutagenesis on pECpol I to
introduce an A-to-C transversion at position 1271, thus changing Asp424 to Ala
and
inactivating the 3'-5' exonuclease activity was performed [Derbyshire et al.,
Science
240: 199-201 (1988)]. In the same manner, the 3'-~5' exonuclease domain-
CA 02485203 2004-11-05
WO 03/102213 PCT/US03/16798
23
inactivating mutation was introduced into the plasmids encoding the I709N and
I709F
mutations to generate D424A I709N and D424A I709F mutants, respectively.
EXAMPLE 2
Optimization of Culture Conditions
FIG. SA provides an example of "initial" culture conditions and a method for
inducing in vivo mutagenesis by expression of error-prone Pol I that is
representative
of one conventional method used by those skilled in the art prior to the
development
of "optimal" culture conditions and methods embodied in the invention. There
are
two previous reports of a 3-10 fold increase in plasmid mutagenesis relative
to
chromosomal mutagenesis using culture conditions similar to initial
conditions. In
one case, the polymerase used was Pol I containing an inactivated proofreading
domain [Fabret et al., Nucleic Acids Res. 28: E95 (2000)]. The other example
developed by the present inventors used the D424A I709F as an error-prone Pol
I
[Shinkai, A., and Loeb, L.A. J. Biol. Chem. 276: 46759-64 (2001)]. The
improvement in the frequency and in the targeting of mutagenesis were
attributed to
the following four variables: (1 ) dilution of the initial inoculum (to at
least 1:105), (2)
growth of cells in 2XYT, (3) pre-warming cells to 37 °C, and (4)
continued growth of
the cultures past the point of saturation (typically I S-17h).
RESULTS: Example 2 illustrates the individual culture parameters found to
have an effect on mutagenesis by error-prone Pol I expression. Ideally, a
system for
random in vivo mutagenesis should exhibit frequent mutations throughout a
targeted
gene, from the 5'end to the 3'end, and as few mutations that are non-target
specific.
Culture conditions were varied to achieve optimal mutagenic performance
according
to these criteria. Cultures should be allowed to reach saturation. Other
variables that
contributed to the efficacy of random mutagenesis included the type of culture
medium, the temperature of the medium at the time of inoculation, and the
initial
inoculum concentration. Careful optimizations of culture conditions achieved
by trial
and error are critical for obtaining mutagenesis resulting in a high target
specificity
and broad distribution of mutations.
CA 02485203 2004-11-05
WO 03/102213 PCT/US03/16798
24
The JS200 strain was initially described as SC18-12 [Witkin, E. M. and
Roegner-Maniscalco, V., J. Bacteriol. 174: 4166-8 (1992)], and has the
following
genotype: SC-18 recA718 polAl2 uvrA155 trpE65 lon-11 sulAl. SC-18 carries
tetracycline resistance and is insensitive to ~, phage. PolAl2 is a
temperature sensitive
allele of Pol I [Monk, M. and Kinross, J., J. Bacteriol. 109: 971-8 (1972)].
It appears
that polAl2 is misfolded in a way that perturbs the spatial arrangement of
polymerase
and 5'-~3' exonuclease functional sites, resulting in miscoordination between
these
two activities (as seen in a nick translation assay). Elevated temperatures
further
increase misfolding and completely disrupt effective polymerization at a nick
[Uyemura et al., J. Biol. Chem. 251: 4085-9 (1976)]. Rec718 allele originated
from
an unstable recombinant obtained in a conjugation between a recA441 K12 donor
and
a rec A+ B/r-derived recipient [Witkin, E. M., Mol. Gen. Genet. 185: 43-50
(1982)]. It
carries two base substitutions, one that allows the RecA protein to become
constitutively activated, and one partial suppressor [(McCall et al., J.
Bacteriol. 169:
728-34 [1987)].
Preparation of reporter plasmids can be described as follows. The reporter
plasmids to measure the reversion frequency of the (3-lactamase gene were
modifications of plasmid pGPS3 (New England Biolabs Inc., Beverly, MA). This
plasmid contains a pUCl9 (ColEl-type) origin of replication and the npt and
amp
genes for kanamycin and carbenicillin selection. To measure reversion
frequencies, a
G-to-T transversion at position 76 of the (3-lactamase gene was introduced by
site-
directed mutagenesis, changing the codon GAA for G1u26 to the ochre stop codon
TAA. The reporter plasmids used to measure (3-lactamase reversion frequency
were
pLA230, and pLA2800, carried 230 by and 2800 by downstream from the pUC 19
origin of replication [Shinkai, A. & Loeb, L.A., J.Biol. Chem. 276, 46759-
46764
(2001)]. Plasmid pGPSori corresponds to pLA230 but with the wild-type (3-
lactamase
gene instead of the interrupted version. It was obtained in the same manner as
pLA200, but in this case pGPS3 was used as the template for primers 5'-
GCACCCGACATACATGTCCTATTTGTTTATT-3' and
5'AAACTTGGTCGGTACCTTACCAATGCTTAATC-3.' The pLA2800
corresponds to pGPS3 encoding an ochre stop codon at position 76 of the [i-
lactamase
gene (2748 by from the origin of replication).
CA 02485203 2004-11-05
WO 03/102213 PCT/US03/16798
Preparation of competent cells can be described as follows. Single colonies
growing on LB plates with appropriate antibiotic selection were picked and
incubated
overnight without shaking at 30 °C in 50 ml of LB plus antibiotic.
After the bacterial
culture was shaken for 1 h at 30 °C, it is transferred to a flask
containing 450 ml LB
5 antibiotic, and left in the 30 °C shaker for 3-4 hours (to an OD6oo
of 0.5-1). Cells
were chilled on ice for 20 minutes, pelleted in a Sorval~ RC SB Plus
centrifuge and
washed twice in 10% glycerol. The pellet was resuspended in ~2m1 10% glycerol,
aliquoted in 120 pl aliquots, and quick-frozen on dry ice. To avoid outgrowth
of
revenants and/or suppressors, competent cells were made using the PoII plasmid
first,
10 and subsequently transformed with the reporter plasmids.
Transformations were performed using a A Biorad Gene Pulser TM apparatus
(set to 400 S2, 2.20 V and 2.5 pFD). After the electric shock, cells were
resuspended
in 1 ml LB media, left to shake for lh at 30 °C, and plated in LB
plates with the
appropriate antibiotics for plasmid selection. Single colonies were picked
into Sml
15 LB with the appropriate antibiotics and grown overnight at 30 °C
with no shaking. In
the case of XL1 Blue cells, since temperature or media is not an issue, a more
standard protocol involving the resuspension in 2XYT medium, shaking at 37
°C for
minutes, and growth of single colonies in LB media in a 37 °C shaker
for 16h is
followed. Transformation with a reporter gene results most frequently in the
loss of
20 the temperature-sensitive phenotype. Replication of reporter plasmids (that
are Pol (
dependent and multicopy) likely depletes the limited Pol I functional reserves
of
JS200 cells even under permissive conditions, favoring the outgrowth of
revenants
and/or suppressors. Hence, the plasmid carrying Pol I was used for the first
transformation to make competent cells, which were used subsequently to
transform
25 the reporter plasmids.
The (3-Lactamase reversion assay was performed in the following way. E. coli
JS200 transformant strains carrying Pol I (wild type or different low-fidelity
mutants)
in the pHSG576 plasmid (chloramphenicol-resistant (cm')) were retransformed
with a
reporter plasmid (kanamycin (kan')). Single colonies exhibiting double
resistance
30 (cm', kan') were picked into 5 ml LB (plus tet, kan, cm) and grown
overnight without
shaking. After 1 hour shaking at 30 °C, the cultures (OD~ 0.5) were
diluted 1:105 in 5
ml 2XYT media pre-warmed at 37 °C. These new cultures were maintained
at 37 °C
CA 02485203 2004-11-05
WO 03/102213 PCT/US03/16798
26
for 15 minutes and incubated for 15 hours in a 37 °C shaker. The (3-
lactamase stop
codon reversion was detected by plating (in duplicate at least) the
appropriate dilution
of the saturated cultures onto plates containing SOpg/ml carbenicillin (Island
Scientific, Bainbridge Island, WA), in addition to kanamycin and
chloramphenicol.
For rifampin resistance, cells were plated in 25 pg/ml rifampin. The results
are
expressed as frequency relative to viable colonies (grown on kan cm alone) and
represent the average of at least two clones that are carried independently.
EXAMPLE 3
Synergistic Effect of Motif A and Motif B Mutations
in vivo and Significant Targeting of Plasmid Sequences
Table 1 below summarizes the results of assays characterizing the frequency
and the degree of mutagenesis targeting (results shown in FIG. 6). JS200 cells
were
transformed with either wild type Pol I or respective Pol I mutators, and
reporter
plasmid pLA230. The frequency of (3-lactamase reversion (normalized to wild
type)
is indicative of the frequency of mutagenesis in a given target gene. The
ratio of
rifampicin resistance relative to carbenicillin resistance reflects the
frequency of
chromosomal mutagenesis.
Initial conditions represent cultures grown at 30 °C to OD600~0.5
that were
diluted 1:50 in nutrient broth and allowed to reach OD=0.7 in the 37 °C
shaker
[Shinkai, A. and Loeb, L.A., J. Biol. Chem. 276: 46759-64 (2001)]. Optimized
conditions represent cultures grown under permissive conditions to OD600~0.5
that
were diluted 1:105 in 2XYT pre-warmed at 37 °C, incubated an additional
15 min. at
37 °C, and placed in the 37 °C shaker for 15 hours (saturation).
Mutagenesis
frequencies were determined by (3-lactamase reversion assay (target within
plasmid)
or by scoring rifampin-resistant colonies (target within chromosome), and the
reported values have been normalized against the wild type. The relative
frequency of
plasmid versus chromosomal mutagenesis for each mutant polymerase was obtained
after normalizing to that found for the wild type polymerase. This
incorporates
variable such as the different nature of the assays (forward assay (Rif )
versus (3-
CA 02485203 2004-11-05
WO 03/102213 PCT/US03/16798
27
lactamase reversion assay), and the difference in target numbers (single copy
(Riir)
versus a multicopy [3-lactamase).
Table 1
MutagenesisTargeting
PoII Initial OptimizedInitialOptimized
wild type 1 1 1 1
D424A I709N 4.4 x 1 2.5 x 12.5 413
OZ 103
A759R l.SxlO~ ND 14.2 ND
D424A A759R 3.0 x102 5.8 x102 4.9 68
I709N A759R 1.8 x103 ND 0.54 ND
D424A1709N A759R3.6 x103 1.5x104 1.0 390
RESULTS: Example 3 characterizes mutagenesis associated with expression
of different error-prone Pol I mutants and its sensitivity to culture
conditions (FIG. SA
and SB). To establish the effect of low-fidelity mutations in motif A and in
motif B,
alone and in combination the following Pol I mutants were tested: D424A 1709N,
A759R, D424A A759R, I709N A759R and D424A I709N A759R (a subset of which
is presented in FIG. 6). Table 1 summarizes these results. The effect of D424A
I709N expression under initial conditions is comparable to published data
[Shinkai,
A., and Loeb, L.A. J. Biol. Chem. 50: 46759-64 (2001)]. The expression of the
D424D A759R mutation results in a frequency of mutagenesis that compares to
that
of D424A I709N. Similar to motif A mutations, elevated mutagenesis is
dependent
on the simultaneous inactivation of the proofreading domain. These results
confirm
that position A759 in motif B is a critical determinant of fidelity in E.
coli. Strikingly,
expression of the 1709N A759R D424A triple mutant results in mutation
frequencies
that are more than additive, 6 to 26 times above those of each double mutant
(same
applies to I709F A759R D424A). Unlike single motif A or motif B mutants, the
mutagenesis by double motif A and motif B Pol I mutants shows little depence
on
inactivation of proofreading. This suggests that the combination of mutations
at
positions I709F and A759R leads to the functional inactivation of
proofreading.
Under optimized conditions, frequencies of mutagenesis 15,000 times above wild
type
CA 02485203 2004-11-05
WO 03/102213 PCT/US03/16798
28
were achieved (in other experiments, up to a 100,000-fold increase has been
observed
(FIG. 8B)). This represents a substantial increase over the frequency achieved
under
"initial" conditions (3,600-fold). Optimized conditions also further restrict
mutagenesis to the target plasmid. In the case of the I709N A759R D424A triple
mutant, plasmid specificity increases by 400-fold. In sum, I709 (motif A) and
A759
(motifB) mutations synergistically enhance target plasmid mutagenesis and both
the
frequency and targeting of mutations are sensitive to growth conditions.
EXAMPLE 4
Determinations of the Spectrum and Frequency of Mutations
Introduced in a Target Sequence upon Expression of D424A 1709N A759R Pol I
Table 2 below shows the mutation spectrum of mutations located outside the
ochre stop codon in the (3-lactamase gene identified in cells expressing D424A
I709N
IS A759R Pol I. The numbers within the heading represent the location of the
sequence
relative to the origin of replication. Given the nature of the assay, which
required
functional expression, frameshifts and deletions were not determined.
Table 2
Mutations 100-750
Transitions
AT~GC 16 34.7
GOAT 21 44.9
Transversions
AT~TA 6 14.3
AT-~CG 1 2.0
GC~TA 2 4.1
GC-~CG 0 0
RESULTS: Example 4 provides an illustration of the mutagenic spectrum
resulting from error-prone Pol I expression. To characterize the nucleotide
changes
associated with I709N A759R D424A Pol I expression, 158 carbenicillin-
resistant
clones were sequenced. All 155 of these clones showed mutations in the ochre
codon.
Of these, only 2 changed to another stop codon (both to opal), which gives an
overall
specificity of 96.8% for the reversion assay. Wild type sequence was present
in 148
CA 02485203 2004-11-05
WO 03/102213 PCT/US03/16798
29
of the remaining 153 sequences, in varying amounts, from trace amounts to
about
90%, which is consistent with mutations encoded in a multicopy plasmid with
diverse
degrees of dominance. To establish a complete spectrum of base pair
substitutions,
good-quality sequence of at least 650 by for all these 158 clones was
obtained. A
total of 46 secondary mutations were detected within this 650 by interval. Of
these,
40 were located within the open reading frame (ORF), of which 22 were silent.
Only
2 mutations were detected more than once in this analysis, indicating a high
degree of
diversity. Table 2 shows the mutation spectrum of these 46 secondary
mutations.
The expression of D424A I709N A759R Pol I results in a diverse mutation
spectrum
within the 650 nucleotides of this analysis, although a bias toward
transitions (80%)
was detected, with a predominance of GC-SAT mutations (56%).
The number of target plasmids present in cells expressing I709N A759R
D424A Pol I was determined in order to estimate the mutation load and found to
be of
only 10 copies/cell (FIG. 7). This is in contrast with 100 copies/cell in
cultures
IS expressing the wild type Pol I. This effect of the Pol I point mutations on
target
plasmid copy number decreases the size of the mutant libraries by 10-fold.
However,
this reduction in the number of targets per cell may have improved the
selection
efficiency, as each new mutation is expected to represent a larger fraction of
expressed protein, and is therefore more likely to have a larger impact on the
phenotype.
Under optimized mutagenesis conditions, the frequency of stop codon
reversion was in the order of one in 500 cells (FIG. 6). Given that 10 target
,
plasmids/cell were estimated, this translates into one reversion in 5000
codons. Since
2 of the 9 possible base pair substitutions at the ochre codon are not
permissible, that
is the equivalent of 1 mutation in 3,900 codons. Assuming an even distribution
of
mutations, i.e., that mutations at the ochre stop codon are representative of
those of
every other codon in the protein, results an estimated mutation frequency of 1
mutation in I 1,500 by (3 x 3900). The highest mutation frequency reported in
vivo is
0.5 mutations/Kbp [Greener, A. et al., 7: 189-95 Mol. Biotechnol. (1997)], but
this
mutagenesis was unstable upon continued culture and had severe deleterious
effects
on the host [Greener, A. et al., 7: 189-95 Mol. Biotechnol. (1997)].
JS200 cells expressing the D424A I709N A759R polymerase and with the
reporter plasmid pLA230 were grown under optimal conditions for mutagenesis
and
CA 02485203 2004-11-05
WO 03/102213 PCT/US03/16798
plated on plates containing 50 pg/ml carbenicillin. Single carbenicillin-
resistant
colonies were grown. Their plasmids were extracted and the sequence at the
ochre
codon was determined using oligonucleotide Blac-5. Secondary mutations were
confirmed using the following oligonucleotides:
5 Blac-5 5'-TTACGGTTCCTGGCCTTTTGC-3';
Blac-6 5'-GGTTGAGTACTCACCAGTCAC-3';
Blac-7 5'-TCCGATCGTTGTCAGAAGTAA-3'; and
Blac-8 5'-CCATTTCCACCCCTCCCAGTT-3'. The sequence was analyzed using
SequencherT"~ software.
EXAMPLE 5
In vivo Mutagenesis by Error-prone Pol I Mutants as a Function of Distance
from the Origin of Replication
FIG. 8B demonstrates the frequency of mutagenesis as a function of distance
from the origin of replication (ori), determined to assess the level of
mutagenic
coverage by error-prone Pol 1 mutants containing single and double mutations
in the
active site. The JS200 cells were transformed with either wild type or with
different
error-prone Pol 1 mutants and one of the following reporters with increasing
distance
between the on and the position of the ochre stop codon: pLA230, pLA700,
pLA1400, pLA2800, and pLA3700. Cultures grown under permissive conditions to
OD600~0.5 were diluted 1:105 in 2XYT, pre-warmed at 37 °C,
incubated an
additional 15' at 37 °C, and placed in the 37 °C shaker for 15h
(saturation). Results
show one representative experiment. Each point represents the average of two
independent cultures, each plated in duplicate.
RESULTS: Pol I has been reported to synthesize 400 by in the leading
strand downstream of ColEl origin [Sakakibara, Y. & Tomizawa, J., Proc. Natl.
Acad. Sci. U S A 71: 1403-1407 (1974)], at which point, replication of both
leading
and lagging strands is taken over by the Pol III replisome [Staudenbauer,
W.L., Mol.
Gen. Genet. 149: 151-158 (1976)]. Thus, most Pol I-dependent mutations were
expected to cluster in the 5' end of the target gene. Contrary to this
expectation, a
similar frequency of hits and a comparable spectrum was detected when
mutations
CA 02485203 2004-11-05
WO 03/102213 PCT/US03/16798
31
further downstream than 500 by were compared to mutations in the sequence
corresponding to initiating leader. A decrease in mutagenesis became apparent,
however, if the ochre stop codon in the reporter gene was placed further from
the
origin of replication as shown in FIG. 3B (also Example 5, illustrated in FIG.
8),
resulting from the absence of leading-strand synthesis by error-prone Pol I at
longer
distances. The observed decrease in plasmid mutagenesis at the 700 by point,
however, was only moderate and in the case of the triple Pol I mutant mutation
frequency remained constant four orders of magnitude above background for
another
3 Kb. Significant plasmid mutagenesis by Pol I beyond the sequence
corresponding
to the initiating leader strand in the plasmid sequence was not expected by a
person
skilled in the art. Thus, Example 5 demonstrates that target sequences at a
distance of
at least 3700 by from the on are amenable to mutagenesis by error-prone Pol I
expression.
The preparation of pLA230 and pLA2800 are provided in Example 2, and the
1 S other reporters were derived from plasmids pLA2800 and pGPS~ as follows:
The pLA3800 was generated by amplification of the entire npt (kan~) gene using
the
synthetic oligonucleotides 5'-
CATCGGTACCTTAACCAATTCTGATTAGAAAAAC-3' and 5'-
GATGGGTACCCTAGATTTAAATGATATCGGATCC-3' containing flanking Kpnl
restriction sites. The 980 by amplified fragment was cloned into the Kpnl site
of
plasmid pLA2800, adding one extra copy of npt and moving the stop codon to
3691
by of the plasmid origin of replication. The pLA2200 resulted from excising of
a Sal
I 1517 by fragment from plasmid pLA3800 and religating the plasmid backbone.
This brought the stop codon to 2174 by of the plasmid origin of replication.
The
pLA1400 was generated by cloning a PCR-amplified npt gene into the Sacl and
Aflll
sites of pLA2800, bringing the (3-lactamase ochre codon to 1403 by from the
ori. The
oligonucleotides containing Sacl and AfIIII adapters used for amplification
were
5'-CATCGAGCTCTTAACCAATTCTGATTAGAAAAAC-3' and
5'-GATGACATGTCTAGATTTAAATGATATCGGATCC-3'.
The pLA700 resulted from subcloning the PCR-amplified (3-lactamase reporter
into
Swal and Spel sites of pGPS 0. The oligonucleotides used were
5'-CATCGATATCTTACCAATGCTTAATCAGTG-3' and
CA 02485203 2004-11-05
WO 03/102213 PCT/US03/16798
32
5'-GATGACTAGTCCCTATTTGTTTATTTTTCT-3', containing EcoRV and Spel
adapters respectively. This places the ochre stop codon in the (3-lactamase
gene only
709 nucleotides away from the origin of replication.
EXAMPLE 6
The Effect of Error-prone Pol I mutants on in vivo Mutagenesis in
Cells Expressing Wild-type Pol I
FIG. 9 (graphical illustration of data in Table 3) demonstrates the plasmid-
specific mutation frequency mediated by error-prone Pol I mutants in a Pol I
proficient strain, to determine if expression of chromosomal wild type Pol I
interferes
with error-prone Pol I mutagenesis. XLl-Blue cells, a strain that expresses
wild type
Pol I, were transformed with Pol I mutator (D424 I709N A759R) and reporter
plasmid
pLA230. They were grown at 30 °C to OD~0.5 and a 10-5 dilution of which
was
grown for 17 hours in 2XYT medium with or without 100 pg/ml IPTG, and plated
in
triplicate on carbenicillin plates. The frequencies of (3-lactamase reversion
in XL1-
Blue cells and in JS200 cells, with or without the same concentration of IPTG,
were
plotted for comparison.
Table
3
Strain Pol I IPTG Frequency of Carb'Normalized
per l Ox
cells frequencyb
JS200 wild type no 4.20x1012.82 x10 1.00
JS200 D424A I709Nno 3.08 x10510.61 7.4 x103
x105
A759R
JS200 wild type Yes 2.70x100.45 x10 0.66
JS200 D424A I709NYes 2.88 x1050.42 x1056.9 x103
A759R
XLI-Blue wild type No 1.00 x104 (1.9x1032.4 x102
XL1-Blue D424A I709NNo 1.07 x10514.0 x1042.6 x103
A759R
XL1-Blue wild type Yes 2.13 xl OSt9.0 5.1 x102
x103
XL1-Blue D424A 1709NYes 1.36x10612.6 x104 3.3x104
A759R
RESULTS: The critical genetic material is provided in a vector and
expression of wild-type Pol I and/or intact DNA repair in the host do not
significantly
interfere with mutagenesis. Thus, random mutagenesis may be performed in
strains
CA 02485203 2004-11-05
WO 03/102213 PCT/US03/16798
33
specifically designed for complementation by a targeted gene. FIG. 9 and Table
3 (in
Example 6) illustrates this point demonstrating that error-prone Pol I mutants
are co-
dominant in a host expressing wild-type Pol I and proficient in DNA repair (XL-
1
Blue). Pol I overexpression of error-prone Pol I increases target plasmid
mutagenesis
in these cells, by competing with the wild type Pol I for replication of the
target
plasmid. If overexpressed, error-prone Pol I can be expected to outcompete the
wild
type. This is illustrated in Fig. 9, which shows that overexpression of of
D424A
I709N A759R Pol I in XL-1 Blue cells (by inducing expression from the tac
promoter
with IPTG) further increases plasmid mutagenesis to frequencies comparable to
those
obtained in JS200. The higher background relative to JS200 that was observed
may
be due to the GInV mutation (an amber suppressor with some activity against
ochre)
and therefore should not affect this conclusion. Rifampicin resistance was
comparable between the two strains, indicating Pol I mutagenesis is still
plasmid-
restricted in XL1-Blue cells.
XL1-Blue cells are F'::TnlO proA+B+ laclq d(lacZ) M15/recAl endAl
~rA96(Nalr) thi hsdRl7 (rk mk+) glnv44 relAl lac and are commercially
available
(can be purchased from Statagene~ for example). Cells were grown under
appropriate
antibiotic selection: tetracycline (Sigma~ St.Louis MO) at 12.5 pg/ml,
chloramphenicol (Sigma~ St.Louis MO) at 30 Pg/ml, and/or kanamycin (Island
Scientific, Bainbridge Island, WA) at a concentration of 50 pg/ml.
EXAMPLE 7
Phenotypic Analysis of Aztreonam Resistant Mutations
Produced by Directed Evolution
Table 4 presents the phenotypes of the TEM-I mutations that were identified as
a result of the selections performed to establish the applicability of the
system to
directed evolution of enzymes. JS200 cells that were co-transformed with a
plasmid
encoding D424A 1709N A759R Pol I and a second plasmid encoding the target TEM-
1 (3-lactamase, were subjected to selective pressure under increasing
concentrations of
aztreonam. Controls included the following transformations: (a) wild type Pol
I with
wild type (3-lactamase; (b) D424A I709N A759R Pol I with a plasmid devoid of
(3-
lactamase; and (c) wild type Pol I with a plasmid devoid of (3-lactamase. Two
CA 02485203 2004-11-05
WO 03/102213 PCT/US03/16798
34
independent selections were carried out under optimized mutagenic conditions.
After
one round of mutagenesis without selection, a 1:10 inoculum was incubated with
0.5
pg/ml aztreonam (IC99 =0.2 pg/ml). Viable cells were expanded by growing a
1:10
dilution at the same concentration of drug, after which another 1:10 dilution
was
selected in 32 pg/ml aztreonam. At this concentration, none of the controls
showed
significant growth. Surviving cells were plated at 64 pg/ml aztreonam.
Plasmids
were obtained from single colonies and the TEM-1 (3-lactamase was directly
sequenced using specific primers.
To eliminate the possible effects of mutations elsewhere in the vector and to
generate single, double, and triple amino acid substitutions, subcloned the
relevant
mutations were subcloned into the wild type target plasmid. For phenotypic
analysis,
the mutants were retransformed into JS200 cells containing the wild type Pol I
(avoiding further mutagenesis). Dose-response curves of selected mutants for
aztreonam are shown in FIG. 10 and ICsos (average of two individual
transformants)
for all mutants are presented in Table 4. Fold aztreonam resistancea
represents ICso
based on an average of two experiments, normalized against wild type =100.
CA 02485203 2004-11-05
WO 03/102213 PCT/US03/16798
Table 4
(3-lactamase Fold aztreonam
resistancea
Deletion 0.57
Wild type 1.00
E 104K 2.70
R164H 2.18
R164S 2.53
G267R 0.84
E104K R164H 43.7
E104K R164S 74.7
E104K G267R 2.87
R164H G267R 2.70
E104K R164H G267R 67.8
E104K R164S G267R 160.0
5 Aztreonam was purchased from the Drug Services of the University of
Washington and resuspended in water to a concentration of 50 mg/ml. The
aztreonam
dose-response curve for JS200 was obtained under the conditions used for Pol I
mutagenesis (1:105 inoculum, pre-warmed 2XYT, 37 °C shaker for 15h).
The
inhibitory concentration of Aztreonam that kills >99% of the cells (IC99) was
10 0.2~g/ml. This was true for both JS200 cells transformed with pGPS3ori and
cells
transformed with pGPS30, confirming that wild-type [3-lactamase does not
confer
significant aztreonam resistance.
JS200 cells were transformed with a plasmid enconding D424A I709N A759R
Pol I and pGPSori, a plasmid encoding wild type (3-lactamase starting 1 SObp
15 downstream from the ori. Controls included cells expressing the following:
(a) Wild
type Pol I and wild type (3-lactamase; (b) D424A I709N A759R Pol I and a
target
plasmid carrying a large (3-lactamase deletion; and (c) wild type Pol I and
the deleted
(3-lactamase. Two independent selections were carried out under "optimized"
mutagenic conditions. After one round of mutagenesis without selection, a 1:10
20 dilution of the culture was incubated with 0.5 pg/ml aztreonam (IC99 =0.2
pg/ml).
Viable cells were expanded by growing a 1:10 dilution at the same
concentration of
drug, after which another 1:10 dilution was selected in 32 pg/ml aztreonam.
None of
CA 02485203 2004-11-05
WO 03/102213 PCT/US03/16798
36
the controls survived at this point, indicating that the presence of both
error-prone Pol
I and (3-lactamase was essential for resistance under these conditions.
Surviving cells
were plated at 64 pg/ml aztreonam. Plasmids were obtained from single colonies
and
the TEM (3-lactamase was directly sequenced using specific primers.
Individual colonies were picked from aztreonam plates and grown under
permissive conditions (30°C, no shaking) to avoid further mutagenesis
in the presence
of 10 pg/ml aztreonam. Plasmids were extracted from 3 ml of each of these
clones
using the Perfectprep~ miniprep kit from Eppendorf AG and resuspended in 50 pl
water. They were sequenced by using the primers Blac-5,-6,-7,-8 (Example 4).
The sites HaelII, Scal and Fspl (unique within the target plasmid) were used
to subclone the mutations identified in the (3-lactamase ORF by aztreonam
selection
into the vector encoding (3-lactamase and to generate all possible mutant
combinations. These constructs were transformed into JS200 cells carrying the
wild-
type Pol I plasmid to maintain the same genetic background without inducing
further
mutagenesis, and grown in the absence of any (3-lactam. Cells were diluted to
the
standard inoculum of 105 cfu/ml and grown for 16h in the presence of
increasing
concentrations of aztreonam. The ICSOS were established by plotting OD6oo
against
drug concentration and finding the concentration that reduces survival by 50%.
To
account for variations in expression in individual clones, two independent
experiments were performed and averaged. The standard deviation between the
two
experiments was in the order of 30%.
