Note: Descriptions are shown in the official language in which they were submitted.
CA 02488006 2004-11-30
WO 03/102130 PCT/IB03/02256
-1-
A HUMAN CELL ASSAY TO DETERMINE EFFECT OF SAMPLE COMPOUNDS
ON COL2 ENHANCER EXPRESSION
FIELD OF THE INVENTION
This invention relates to human chondrocyte activity
(growth)/differentiation/production of extracellular matrix)and to the effect
of Sox9
transcription factor and Col2 enhancer as a measure for such activity. It also
relates to a
chimeric cell and assay utilizing such cell useful in predicting the effect of
sample compounds
on chondrocyte activity as measured by Sox9 and Col2 expression/activity.
BACKGOUND OF THE INVENTION
The progressive destruction of articular cartilage is common to osteoarthritis
and
rheumatoid arthritis. This tissue provides the lubrication and compressibility
needed for joint
function. Therefore, the loss of articular cartilage results in increasing
pain and morbidity.
Articular cartilage is composed of a collagen and proteoglycan rich
extracellular matrix and
the chondrocytes that produce it. Thus, the chondrocyte is central to
understanding normal
cartilage function as well as the arthritic and degenerative disease affecting
it. Isolated
chondrocytes have little proliferative capacity and tend to de-differentiate
to fibroblast-like
cells when placed in cell cultures. Sources of human cells for study,
particularly from non-
diseased tissue, are extremely scarce for obvious ethical and practical
reasons. Thus, much
of our knowledge of chondrocyte biology is derived from animal studies or
their cultured
tissues and cells.
Genetic studies from human subjects suffering from severe skeletal
abnormalities
have contributed to our understanding of chondrocyte biology. Mutations
leading to the loss
of function/expression of a single allele of the human Sox9 gene were
identified as the cause
of a rare and severe skeletal malformation syndrome known as camptomelic
dysplasia
(Wagner T, Wirth J, Meyer J, Zabel 8, Held M, Zimmer J, Pasantes J, Bricarelli
FD, Keutel J,
Hustert E, .: Autosomal sex reversal and camptomelic dysplasia are caused by
mutations in
and around the SRY related gene SOX9. Cell 79:1111-1120, 1994; Wright E,
Hargrave MR,
Christiansen J, Cooper L, Kun J, Evans T, Gangadharan U, Greenfield A, Koopman
P: The
Sry-related gene Sox9 is expressed during chondrogenesis in mouse embryos. Nat
Genet
9:15-20, 1995)
Male patients present with XY sex reversal ( Wagner T, Wirth J, Meyer J, Zabel
8,
Held M, ZimmerJ, Pasantes J, Bricarelli FD, Keutel J, Hustert E.: Autosomal
sex reversal and
camptomelic dysplasia are caused by mutations in and around the SRY-related
gene SOX9.
Cell 79:1111-1120, 1994) confirming the other major role of Sox9 in
development, male sex
determination.
Mice engineered to express only one allele of the Sox9 gene (Sox9 +/-),
represent a
near phenocopy of the human skeletal syndrome (Bi W, Huang W, Whitworth DJ,
Deng JM,
CA 02488006 2004-11-30
WO 03/102130 PCT/IB03/02256
_2_
Zhang Z, Behringer RR, de Crombrugghe 8: Haploinsufficiency of Sox9 results in
defective
cartilage primordia and premature skeletal mineralization. Proc Natl Acad Sci
U S A 98:6698-
6703, 2001), displaying hypoplasia of all cartilage primordia and bones
derived therefrom.
Furthermore, mice derived by chimerism of wild-type and Sox9 -/- ES cells
(expressing B-
galactosidase) showed that Sox9 expression is a obligatory for cells to be
incorporated into
mesenchymal condensations that give rise to cartilage structures (Bi W, Deng
JM, Zhang Z,
Behringer RR, de Crombrugghe 8: Sox9 is required for cartilage formation. Nat
Genet 22:85-
89, 1999).
Genetically modified mice having impaired or enhanced Sox9 expression showed
XY
or XX sex reversal, respectively (Bishop CE, Whitworth DJ, Qin Y, Agoulnik AI,
Agoulnik IU,
Harrison WR, Behringer RR, Overbeek PA: A transgenic insertion upstream of
sox9 is
associated with dominant XX sex reversal in the mouse. Nat Genet 26:490-494,
2000; Vidal
VP, Chaboissier MC, de Rooij DG, Schedl A: Sox9 induces testis development in
XX
transgenic mice. Nat Genet 28:216-217, 2001); confirming the role of Sox9 in
sex
determination in mice as well as humans.
Sox9 is a member of a family of HMG-box proteins. This family of proteins is
unusual
in that they bind to the minor groove of DNA and usually cooperate with a
protein partners) to
regulate gene expression (reviewed in Kamachi Y, Uchikawa M, Kondoh H: Pairing
SOX off.'
with partners in the regulation of embryonic development. Trends Genet 16:182-
187, 2000).
hLSox5 and Sox6 appear to play a partly overlapping role in collaborating with
Sox9
to regulate the expression of chondrocyte target genes including the Col2a1
and aggrecan
(Smits P, Li P, Mandel J, Zhang Z, Deng JM, Behringer RR, de Croumbrugghe B,
Lefebvre V:
The transcription factors L-SoxS and Sox6 are essential for cartilage
formation. Dev Cell
1:277-290, 2001; Lefebvre V, Behringer RR, de Crombrugghe 8: L-SoxS, Sox6 and
Sox9
control essential steps of the chondrocyte differentiation pathway.
Osteoarthritis Cartilage 9
Suppl A: S69-S75, 2001.
Sox9 also regulates the "minor cartilage collagen", Co111a2, by interactions
with
HMG-like sites in both the promoter (Bridgewater LC, Lefebvre V, de
Crombrugghe 8:
Chondrocyte-specific enhancer elements in the Co111a2 gene resemble the Col2a1
tissue-
specific enhancer. J Biol Chem 273:14998-15006, 1998) and within an intronic
enhancer ( Liu
Y, Li H, Tanaka K, Tsumaki N, Yamada Y: Identification of an enhancer sequence
within the
first intron required for cartilage-specific transcription of the alpha2(XI)
collagen gene. J Biol
Chem 275:12712-12718, 2000).
Sox9 appears to integrate the many signaling pathways regulating the
expression of
cartilage matrix proteins. This includes signals that positively regulate the
cartilage
phenotype, such as a FGFs, and BMP-2, as well as parathyroid hormone in
prehypertrophic
chondrocytes (Murakami S, Kan M, McKeehan WL, de Crombrugghe 8: Up-regulation
of the
CA 02488006 2004-11-30
WO 03/102130 PCT/IB03/02256
-3-
chondrogenic Sox9 gene by fibroblast growth factors is mediated by the mitogen-
activated
protein kinase pathway. Proc Natl Acad Sci U S A 97:1113-1118, 2000; Uusitalo
H, Hiltunen
A, Ahonen M, Gao TJ, Lefebvre V, Harley V, Kahari VM, Vuorio E: Accelerated up-
regulation
of L-SoxS, Sox6, and Sox9 by BMP-2 gene transfer during murine fracture
healing. J Bone
Miner Res 16:1837-1845, 2001 ).
Inhibition of matrix expression by cytokines and retinoic acid also involves
inhibition of
Sox9 (Murakami S, Lefebvre V, de Crombrugghe 8: Potent inhibition of the
master
chondrogenic factor Sox9 gene by interleukin-1 and tumor necrosis factor-
alpha. J Biol Chem
275:3687-3692, 2000); Sekiya I, Koopman P, Tsuji K, Mertin S, Harley V, Yamada
Y,
Shinomiya K, Niguji A, Noda M: Transcriptional suppression of Sox9 expression
in
chondrocytes by retinoic acid. J Cell Biochem 81: 71-78, 2001).
Studies have shown that Sox9 activity is regulated by both the level of
expression
and by post-translational modification ( Huang W, Zhou X, Lefebvre V, de
Crombrugghe B:
Phosphorylation of SOX9 by Cyclic AMP-Dependent Protein Kinase A Enhances
SOX9's
Ability To Transactivate a Col2a1 Chondrocyte-Specific Enhancer. Mol Cell Biol
20:4149-
4158, 2000).
Sox9 has been termed the " Master Chondrogenic Transcription Factor" (Murakami
S,
Lefebvre V, de Crombrugghe 8: Potent inhibition of the master chondrogenic
factor Sox9
gene by interleukin-1 and tumor necrosis factor-alpha.( J Biol Chem 275:3687-
3692, 2000).
Therefore, understanding Sox9 function in cartilage development, tissue
maintenance, and
disease processes is important in considering strategies to halt cartilage
destruction and
induce repair.
The Sox 9 transcription factor has emerged as an important determinant of
chondrocyte development and the regulation of type II collagen and aggrecan
gene
expression. The Sox9 transcription factor is known to play a role in the
expression/activity of
Col2 by chondrocytes.
It would be useful to construct a model that could correlate the level of Sox9
presence
to the expression/activity of Col2. It would also be useful to develop a model
that would permit
the testing of various compounds to determine whether they have an effect on
Sox9
expression/activity.
Much of our understanding is based on studies of genetically modified mice and
on
the functional analysis of mouse chondrocytes in vitro. The murine cell lines
that have been
developed in which some of the properties of chondrocyte development have been
mimicked
are useful but the advantages of a human cell line which can be used to
determine the effect
of different compounds on the expression of Col2 would be highly useful. Thus,
to better
characterize the potential role of Sox9 in human chondrocyte function and in
disease
CA 02488006 2004-11-30
WO 03/102130 PCT/IB03/02256
-4-
processes, it would be desirable to identify a human cell line that conserves
the Sox9
regulatory pathways identified in mouse.
It is desirable to increase the Col2 enhancer activity in chondrocytes to
facilitate the
regeneration of collagen. It would be useful to screen different compounds to
determine their
effect on Col2 expression. Unfortunately it is not possible to use
chondrocytes to test the
compounds because chondrocytes have little proliferative capacity in vitro and
tend to
differentiate into fibroblast like cells.
Thus, it is an object of this invention to provide a cell line and an assay
procedure that
is capable of screening compounds to determine their ability to modify Col2
enhancer activity
in chondrocytes.
SUMMARY OF THE INVENTION
The present invention relates to a method of predicting the effect of a test
compound
on human chondrocyte activity. The method comprises the steps of transfecting
SW 1353
human chondrosarcoma cells with a reporter plasmid comprising Sox9 DNA binding
sites;
contacting the transfected cells with a test compound for a period of from
about 2 to about 24
hours; and determining the activity of the reporter.
The present invention also provides a chimeric cell line that is capable of
mimicking
the effect of various compounds on Col2 expression/activity. The cell line
comprises a
SW1353 cell transfected with a plasmid containing Sox9 DNA reporter binding
sites.
It has been determined that the SW1353 cell line is capable of modeling
chondrocyte
behavior in response the regulation of Col2 expression by various compounds.
When
SW1353 cells are transfected with a reporter plasmid containing Sox9 DNA
binding sites, the
cells can be used as an assay to determine the effectiveness of the introduced
compound in
changing the level of Sox9 and indirectly the level of Col2a
expression/activity, and thereby
acting as a tool to a lesser or greater degree predictive of the effect of the
introduced
compound on chondrocyte differentiation.
Transient transfection studies demonstrate that the basal expression of a Sox9-
dependent Colt enhancer reporter construct could be increased by co-expression
of a Sox9
expression vector. A panel of known regulators of murine Sox9
expression/activity were
tested in the enhancer assay and results were correlated with expression of
the endogenous
Sox9 gene using real-time PCR.
The SW1353 cell line recapitulates many of the effects of cytokines and growth
factors on Col2 enhancer activity observed with primary mouse chondrocytes
including
stimulation by FGF-1 and FGF-2 and repression by IL-1a and TNFa. These effects
have
been correlated with changes in Sox9 mRNA levels. We have discovered that FGF-
9
stimulates Sox9 expression and Col2 enhancer activity. In addition, a careful
examination of
the effect of IL-1/3 dose on Col2 enhancer activity shows that very low levels
of cytokines
CA 02488006 2004-11-30
WO 03/102130 PCT/IB03/02256
-5-
actually stimulate enhancer activity while higher doses, sufficient to
stimulate IL-8 expression,
are inhibitory.
This discovery has relevance to the natural progression of osteoarthritic
disease.
Since Chondrocytes respond to early osteoarthritic disease with attempted
repair by
increasing expression of Col2 and correlates with autocrine expression of IL-
1, these results
suggest a causal link between the two. We show that SW1353 cells can respond
to a
dynamic range of IL-1 levels, from Col2 stimulation at low levels to
repression to induction of
catabolic responses at higher levels.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1A shows the stimulation of basal expression of the 48bp Co12a1Luc
enhancer
reporter by co-expression of Sox9 in transiently transfected SW 1353 cells.
Figure 1 B shows western blot of SW 1353 cells transfected with the Sox9
expression
plasmid.
Figure 2 shows the response of SW 1353 cells to growth factors and cytokines
with
activation or repression of the 48bp Col2a1 enhancer reporter.
Figure 3 shows the opposing effects of FGFs and cytokines on the expression of
Sox9 in SW 1353 cells.
Figure 4 shows the dynamic range of SW1353 biological response as a function
of IL-
1 (3 concentration.
DETAILED DESCRIPTION OF THE INVENTION
The present invention relates to a method of predicting the effect of a test
compound
on human chondrocyte differentiation. The method comprises the steps of
transfecting
SW1353 human chondrosarcoma cells with a reporter plasmid comprising Sox9 DNA
binding
sites; contacting the transfected cells with a test compound for a period of
from about 2 to
about 24 hours; and determining the activity of the reporter. The present
invention also
provides a chimeric cell line that is capable of mimicking the effect of
various compounds on
Col2 expression/activity. The cell line comprises a SW1353 cell transfected
with a plasmid
containing Sox9 DNA reporter binding sites.
The present invention demonstrates that SW1353 cells model many of the
signaling
pathways identified in primary murine chondrocytes and are therefore useful in
translating
experimental results obtained in murine systems to human systems.
FGF-1 and FGF-2 were found to increase Sox9 mRNA levels and the corresponding
activity of the Sox9-dependent 48bp Col2a1 enhancer construct. This has
relevance to joint
repair either by the normal response of chondrocytes in attempting the normal
repair of
damaged cartilage or when considering strategies for therapeutic intervention.
For example,
Sox9 expression is elevated in the joints of mice attempting to repair damage
induced by the
expression of a mutant Type IIA collagen gene (Salminen H, Vuorio E, Saamanen
AM:
CA 02488006 2004-11-30
WO 03/102130 PCT/IB03/02256
-6-
Expression of Sox9 and type IIA procollagen during attempted repair of
articular cartilage
damage in a transgenic mouse model of osteoarthritis. Arthritis Rheum 44:947-
955, 2001).
In situ analysis showed that Sox9 expression corresponds with the most
proliferative
and metabolically active chondrocytes present in the repair tissue of this
model. The
expression of endogenous FGF-2 is also correlated with the repair of joint
damage, as a
neutralizing antibody to FGF-2 blocks the repair of full-thickness cartilage
defects in a rabbit
model, while the infusion of FGF-2 leads to improved repair (Salminen H,
Vuorio E,
Saamanen AM: Expression of Sox9 and type IIA procollagen during attempted
repair of
articular cartilage damage in a transgenic mouse model of osteoarthritis.
Arthritis Rheum
44:947-955, 2001). Thus Sox9 provides a direct link between the input of
prochondrogenic
growth factors and the expression of chondrocytic genes needed for repair.
The present invention discloses that FGF-9 stimulates Sox9 expression and
activity in
a human chondrocyte-like cell line. In agreement with these findings, FGF-9
and FGF-2 were
found to be the most potent of all the FGF family members in terms of
stimulating the growth
and matrix production of chicken chondrocyte cultures (Praul CA, Ford BC,
Leach RM: Effect
of fibroblast growth factors 1, 2, 4, 5, 6, 7, 8, 9, and 10 on avian
chondrocyte proliferation. J
Cell Biochem 84:359-366, 2002). As mentioned previously, FGF-9 expression is
associated
with the growth of benign cartilage nodules in the joints of chondromatosis
patients. These
results demonstrate stimulation or the FGF-9/FGFR/Sox-9 signaling pathway has
value in
stimulating the repair of cartilage damage.
FGF-9 signals through both FGFR2c and FGFR3b (Santos-Ocampo S, Colvin JS,
Chellaiah A, Ornitz DM: Expression and biological activity of mouse fibroblast
growth factor-9.
J Biol Chem 271:1726-1731, 1996), and mice lacking FGFR3 have severe
achondroplasia
(Colvin JS, Bohne BA, Harding GIN, McEwen DG, Ornitz DM: Skeletal overgrowth
and
deafness in mice lacking fibroblast growth factor receptor 3. Nat Genet 12:390-
397, 1996)).
However, mice lacking FGF9 have normal cartilage-derived structures, but
instead
show XY sex reversal and lung hypoplasia ( Colvin JS, Green RP, Schmahl J,
Capel 8, Ornitz
DM: Male-to-female sex reversal in mice lacking fibroblast growth factor 9.
Cell 104:875-889,
200; Colvin JS, White AC, Pratt SJ, Ornitz DM: Lung hypoplasia and neonatal
death in Fgf9-
null mice identify this gene as an essential regulator of lung mesenchyme.
Development
128:2095-2106, 2001 ).
This suggests that other FGF's can compensate for the loss of FGF-9 and
restore
normal cartilage development, but the reciprocal is not true; other FGF
receptors are not able
to functionally replace the loss of FGFR3 in the developing cartilage.
The similarities between SW1353 cells and primary murine chondrocytes includes
catabolic responses induced by inflammatory cytokines that lead to the
destruction of
cartilage in the rheumatoid joint. Although this is itself not a novel
observation in this cell line,
CA 02488006 2004-11-30
WO 03/102130 PCT/IB03/02256
_7_
the connection to the repression of Sox9 level/activity is. We discovered that
very low levels
of IL-1b stimulate expression of the 48bp Co12a1 enhancer and may offer an
explanation for
the paradoxical results found in osteoarthritic joints, where chondrocyte IL-1
expression
correlates with increased type II collagen synthesis. Thus, the low level
autocrine expression
of IL-1 may actually drive a beneficial response by the chondrocytes to
attempt repair in the
degenerating joint. Although the repression of Col2 expression by IL-1a has
been reported in
an immortalized human chondrocyte cell line, the discovery of the ability of
SW1353 to
respond specifically to a dynamic range of IL-1 levels is novel and
particularly useful for a
human chondrocyte cell model.
The functional response of the SW 1353 cells suggest they may be more
representative of chondrocytes making up hyaline cartilages than those
chondrocytes
comprising developing or repairing bone. Postnatal functions of Sox9 include
the
maintenance of prehypertrophic chondrocytes in the growing bone. Such studies
have shown
that Sox9 activity is controlled both at the level of expression and by
posttranslational
modifications. In the prehypertrophic chondrocyte, Sox9 activity is stimulated
by protein
kinase A (PKA) in response to treatment with PTHrP ( Huang IN, Chung UI,
Kronenberg HM,
de Crombrugghe 8: The chondrogenic transcription factor Sox9 is a target of
signaling by the
parathyroid hormone-related peptide in the growth plate of endochondral bones.
Proc Natl
Acad Sci U S A 98:160-165, 2001; Huang LN, Zhou X, Lefebvre V, de Crombrugghe
8:
Phosphorylation of SOX9 by Cyclic AMP-Dependent Protein Kinase A Enhances
SOX9's
Ability To Transactivate a Col2a 1 Chondrocyte-Specific Enhancer. Mol Cell
Biol 20:4149-
4158, 200014).
Although we have not seen an effect of PTHrP on Sox9 activity in SW 1353 cells
transfected with the 48bp Co12a1 enhancer, they do respond to cAMP analogs
with about a 2
fold increase in enhancer expression (LB and JS, unpublished observations).
SW1353 cells
also appear unresponsive to TGFa, BMPs-2, -4, and -6 (data not shown), and is
consistent
with their phenotype being more cartilage-like and less bone-like. Therefore,
SW1353 cells
are considered to be a useful model for studying the Sox9 signaling pathways,
especially
those most relevant to cartilage.
FGFIFGF receptor signaling has a profound effect on the growth and
differentiation of
chondrocytes in vitro. However, determining the physiologically relevant
interactions is made
enormously complex since there are four FGF receptors and 22 ligands in this
family. In
murine chondrocytes and immortal chondrocyte model cell-lines (ATDCS and
C3H10T1/2),
the 48bp Luc reporter is induced by pro-chondrogenic factors including FGF-1
and FGF-2, but
not by FGF-7 which signals exclusively through the epithelial-cell restricted
FGFRIIIb receptor
(Murakami S, Kan M, McKeehan INL, de Crombrugghe 8: Up-regulation of the
chondrogenic
CA 02488006 2004-11-30
WO 03/102130 PCT/IB03/02256
_g_
Sox9 gene by fibroblast growth factors is mediated by the mitogen-activated
protein kinase
pathway. Proc Natl Acad Sci U S A 97:1113-1118, 2000).
This reporter plasmid includes five tandem repeats of the 48bp Co12a1 enhancer
and
encompasses the minimal sequence, including Sox 9 binding sites, sufficient to
direct
chondrocyte specific expression in vivo (Zhou G, Lefebvre V, Zhang Z,
Eberspaecher H, de
Crombrugghe B: Three high mobility group-like sequences within a 48-base pair
enhancer of
the Co12a1 gene are required for cartilage-specific expression in vivo. J Biol
Chem
273:14989-14997, 1998).
While additional proteins bind to this enhancer fragment, including LSox5 and
Sox6
and assist to drive chondrocyte specific expression (Lefebvre V, Behringer RR,
de
Crombrugghe B: L-SoxS, Sox6 and Sox9 control essential steps of the
chondrocyte
differentiation pathway. Osteoarthritis Cartilage 9 Suppl A:S69-S75, 2001),
Sox9 binding is
necessary for full activity (Zhou G, et al. J Biol Chem 273:14989-14997,
1998).
FGF-9 is potent chondrogenic factor and signals through FGFR3b and FGFR2c.
Mutations that result in a constitutively active FGFR3 cause skeletal
malformations including
achondroplasia, hypochondroplasia and thanatorphoric dysplasia and disturb the
balance
between chondrocyte growth and differentiation (Weksler NB, Lunstrum GP, Reid
ES, Horton
WA: Differential effects of hbroblast growth factor (FGF) 9 and FGF2 on
proliferation,
differentiation and terminal differentiation of chondrocytic cells in vitro.
Biochem J 342 Pt
3:677-682, 1999).
Furthermore, FGF-9 over-expression was implicated in a rare disease,
chondromatosis, characterized by cartilaginous nodule formation of the
synovium. These
studies suggest a central role for FGF-9 in controlling the differentiation of
stem cells into
chondrocytes.
Previous studies showed that Col2 enhancer activity correlates with Sox9
expression.
For instance, FGF-2 stimulates and cytokines repress the expression of Sox9
mRNA and
protein in primary mouse chondrocytes results that point to Sox9 as being a
key intermediate
for in regulating expression of Col2 and aggrecan expression.
EXPERMENTAL
1. Sox9 expression construct
To generate the human Sox-9 mammalian expression construct, mRNA from cultures
of immortalized human chondrocyte-like cells T/C-28a4 was purified by RNeasy
kit (Qiagen).
The entire 1.5 Kb coding region (GenBank database, accession No. 246629) was
obtained by
reverse transcription (Clontech Advantage RT Kit) followed by PCR reaction
(Roche Expand
High Fidelity PCR Kit) using primers: sense 5'-
CGGGATCCGCCACCATGAATCTCCTGGACCCCTTCATG-3' and antisense 5'-
CA 02488006 2004-11-30
WO 03/102130 PCT/IB03/02256
_g_
CGGAATTCCTCAAGGTCGAGTGAGCTGT-3'. The PCR product was subcloned into
pcDNA3.1(+) (Invitrogen) and sequence verified.
2. Cell culture
Reagents were obtained from Invitrogen unless otherwise noted. SW1353 human
chondrosarcoma cells (ATCC #HTB-94) were grown in DMEM 10% FBS 10 ug/ml
Gentamicin
and passaged (2 times a week) using with 0.25% Trypsin-EDTA.
3. Transfection experiments
Cells were plated at -106 cells per flask into a T-75 in 10 ml growth media or
an
equivalent based on culture vessel surface area, 24 hours prior to
transfection. For each
transfection, 24 ul of Transit (PanVera) was diluted into 250 ul OptiMEM and
12 ug of reporter
plasmid Col2a1 enhancer construct (48bp Col2a1, was added. After 15-30 minute
incubation,
growth media was removed from the cells, and the DNA-transfection reagent
complexes
diluted to a final volume of 10 ml with OptiMEM and added to the cells.
Transfection media
was replaced with fresh media after 7 hours. 24 hours post transfection the
cells were treated
with media alone or indicated factors. Cells were harvested 48 hours post-
transfection and
luciferase activity measured using the LucLite and the TopCount LSC plate
reader (Packard).
4. lNestern blotting
Cell lysates were prepared from monolayer cultures in 24 well dishes by the
addition
of Tris Glycine sample buffer (Invitrogen). Equivalent volumes of lysate were
loaded on a 4
20% polyacrylamide gradient gel(Invitrogen) and electrophoresed. Gels were
transferred to
nitrocellulose (Invitrogen) using a semi-dry apparatus (BioRad). Western
blocking reagent
(Roche) was used to block the membrane. Sox9 antibody was used at 1:1000 in
50%
Western blocking reagent 50% TBS-T ~ The secondary antibody was rabbit anti-
mouse IgG
conjugated to HRP (Pierce). ECL reagents from Pierce were used to develop the
blots.
Chemiluminescence was imaged with a Lumi-Imager (Roche).
5. Taxman RNA Analysis
RNA was prepared from 75 cm dishes using RNeasy Kits with DNAse treatment
(Qiagen) according to the manufacturer's protocol except a second application
of DNase was
used. cDNA was prepared from 10-20u1 of RNA (1-4 ug) using random hexamer
primers and
PE Biosystems Reverse Transcription reagents. Taqman reactions used 8 ul cDNA
and 2x
PE Universal PCR Master Mix (PE Biosystems), 900 nM PCR primers and 200nM FAM-
TAMRA probe. Reactions (50 ul) were cycled and quantified using the PE 5700
with standard
conditions for 45 cycles. The data was analyzed using GeneAmp5700 software Mix
(PE
Biosystems), adjusting the threshold to linear range for all samples. The OCt
is calculated by
subtracting normalizer (GAPDH) from corresponding gene-specific values. The
04Ct is
calculated by subtracting treated 4Ct from control ~Ct. Fold induction is
determined by
calculating 2°°~' Data is reported as % increase over control
sample.
CA 02488006 2004-11-30
WO 03/102130 PCT/IB03/02256
-10-
6. Tagman Primers and Probes
246629
CACACAGCTCACTCGACCTTG
Sox 9 (+1868) forward primer
TTCGGTTATTTTTAGGATCATCTCG
Sox 9 (-1943) reverse primer ,
FRET probe: FAM-CCCACGAAGGGCGACGATGG-TAMRA
Results
1. Col2 enhancer activity is responsive to increasing levels of Sox9
We analyzed the activity of the 48bp Col2a1 enhancer construct (48bp Col2a1)
in
transfected SW1353 cells. SW1353 cells were transfected with a constant amount
of reporter
(0.25 ug), with or without increasing amounts of the Sox9 expression construct
or empty
vector.
Basal luciferase activity was detected with the 48bp Col2a1 reporter alone
(Fig. 1A ),
as an enhancerless control construct, containing the same Col2 derived minimal
promoter
(p89). It was essentially inactive (<5% activity), demonstrating that SW 1353
cells likely
normally express transcription factors that stimulate enhancer activity.
To determine the effect of the Sox9 expression plasmid, co-transfection with
increasing amounts of the Sox9 expression plasmid (20:1, 10:1, 2:1 and 1:1 )
was undertaken.
The results demonstrate that enhancer activity was increased in a dose
dependent manner
and that Sox9 levels were limiting. Including large amounts of the Sox9
expression plasmid
(1:1 ) resulted in a slight reduction of reporter activity.
Sox9 expression was confirmed by preparing Western blots from cell extracts
prepared from duplicate transfections (Fig 1 B). At the highest DNA
concentration (0.25ug),
an immunoreactive band appeared, migrating with the 66 kD marker, in good
agreement with
68 kD size predicted for Sox9 (lane 5). Protein of the same size was observed
in
transfections having 2 and 10 fold less expression plasmid (lanes 4 and 3). On
longer
exposures, anti-Sox9 immunoreactive proteins were detected faintly with the
20:1 transfection
and for those cells receiving no Sox9 expression plasmid.
2. SW1353 cells are responsive to pro-chondroqenic Fibroblast Growth Factors.
We analyzed the responsiveness of SW 1353 cells to these fibroblast growth
factors
using the 48bp Col2a1 enhancer transfection assay. Addition of FGF-1 (200
ng/ml), FGF-2
(5.9 ng/ml) to the cultures increased expression of the 48bp enhancer between
3 and 4 fold,
whereas FGF-7 (200ng/ml) expression had no effect (Fig 2). These results
demonstrate the
conservation of FGF-1 and FGF-2 signaling pathways in SW1353 cells.
To examine the effect of FGF-9 on enhancer activity, FGF-9 was added to
cultures of
SW1353 cells that had been transfected with the Col2 reporter. FGF-9 (200
ng/ml) stimulated
CA 02488006 2004-11-30
WO 03/102130 PCT/IB03/02256
-11-
enhancer expression up to 4 fold (Fig 2). This result suggests that the SW
1353 cells express
functional FGFR3b and/or FGFR2c receptors and further validates their utility
in studying
chondrocyte biology.
3. Pro-inflammatory cytokines repress Col2 enhancer activity in SW1353
The ability of IL-1,8 and TNFa to repress Col2 enhancer activity in primary
murine
chondrocytes is NFkB dependent and coincides with reduced Sox9 expression.
SW1353 cells were transfected with the 48bp Col2a1 reporter and then treated
with
vehicle, TNFa (10 ng/ml) or IL-1/3 (10 ng/ml) (Fig. 2A). The results
demonstrate that SW1353
cells express functional TNF and IL-1 receptors by showing these agents can
stimulate the
expression of IL-8 (shown) and matrix metalloproteases (not shown).
Enhancer driven luciferase expression was reduced approximately 60% by TNFa
and
50% by IL-1,8 treatment. The cytokine mediated inhibition of enhancer
expression could be
partially relieved by co-treating the cells with either FGF-1, FGF-2 or FGF-9
(Fig 2B). These
results are consistent with the potential for pro-chondrogenic growth factors
to diminish or
reverse the cartilage damage in animal or human joint inflammation.
4. Col2 enhancer activity correlates with relative Sox9 mRNA expression in
SW1353
The effect of chondrocyte growth factors as well as inhibitory cytokines on
the
expression of Sox9 RNA in SW1353 cells using real time quantitative PCR
(TaqMan, PE
Applied Biosystems) was determined. Cells were cultured and treated with
growth factors or
cytokines as described above. After 48 hours cells were harvested and RNA
prepared. A
custom Sox9 primer probe set was validated by an efficiency plot over several
logs and
relative Sox 9 expression was quantified relative to GAPDH.
The expression of Sox9 mRNA increased approximately 1.5 fold by FGF-2 and 2-
fold
by FGF1 and FGF-9, while TNFa and IL-1~ decreased Sox9 expression by 45% and
60%,
respectively (Fig. 3). These data are consistent with Col2 enhancer expression
in SW1353
being regulated, at least in part, at the level of Sox9 expression.
5. Expression of the Col2 Enhancer Reporter is stimulated by the presence of
low
levels of IL-1,8
An increase in type II collagen (Col2) expression has been observed in both
man and
dogs during the course of osteoarthritic disease (8urfon-Wurster N, Hui-Chou
CS, Greisen
HA, Lust G: Reduced deposition of collagen in the degenerated articular
cartilage of dogs with
degenerative joint disease. Biochim Biophys Acta 718:74-84, 1982; Uusitalo H,
Hiltunen A,
Ahonen M, Gao TJ, Lefebvre V, Harley V, Kahari VM, Vuorio E: Accelerated up-
regulation of
L-SoxS, Sox6, and Sox9 by BMP-2 gene transfer during murine fracture healing.
J Bone
Miner Res 16:1837-1845, 2001 ).
Col2 expression appears to be greatest in early to moderate disease and this
appears to reflect a response by the chondrocytes to attempt repair of the
degenerating
CA 02488006 2004-11-30
WO 03/102130 PCT/IB03/02256
-12-
cartilage. Coincidentally, chondrocytes from OA patients with early to
moderate disease also
express increased levels of IL- ~3 and IL-1/3 and these also decline with
disease progression
(Towle CA, Hung HH, Bonassar LJ, Treadwell BV, Mangham DC: Detection of
interleukin-1 in
the cartilage of patients with osteoarthritis: a possible autocrinelparacrine
role in
pathogenesis. Osteoarthritis Cartilage 5:293-300, 199.
Thus, IL-1 expression appears to overlap with Col2 expression. Although this
appears to be paradoxical, it should be noted that the IL-1 levels found in
osteoarthritic joints
is derived from chondrocytes and these levels are distinguished from the very
high levels of
cytokines found in the rheumatoid joint and principally derived macrophages.
Unlike
rheumatoid joints, IL-1 levels are lowest in OA when cartilage degradation is
highest,
suggesting that IL-1 does not play the same role in cartilage destruction in
the two diseases.
The effect of low IL-1~ doses on expression of the 48bp Co12a1 enhancer in
transfected SW1353 cells was determined. Surprisingly, very low levels of IL-
1/3 (0.1-1 pg/ml)
stimulated enhancer activity about 150% (Fig. 4); although the magnitude of
induction was
modest, this response was consistently observed. Col2 enhancer activity was
decreased as
the concentration of IL-1~ was increased above 1pg/ml, with maximal inhibition
occurring
between 20 and 100 pg/ml.
The effect of increasing IL-1/3 doses on the two response was determined. As
shown
in Fig. 4, induction of IL-8 was not detected with IL-1 concentrations below
20 pg/ml, a
concentration that caused maximal repression of the 48bp Col2a1 enhancer.
Therefore,
SW1353 cells appear to respond to a dynamic range of IL-1~ levels with
selective functional
responses, making them potentially useful in models of both osteoarthritis and
rheumatoid
diseases.
CA 02488006 2004-11-30
WO 03/102130 PCT/IB03/02256
SEQUENCE LISTING
<110> PFIZER PRODUCT INC.
<120> A HUMAN CELL ASSAY TO DETERMINE EFFECT OF SAMPLE
COMPOUNDS ON COL2 ENHANCER EXPRESSION
<130> PC25156A
<140>
<141>
<160> 4
<170> PatentIn Ver. 2.1
<210> 1
<211> 38
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Sense Probe
<400> 1
cgggatccgc caccatgaat ctcctggacc ccttcatg 38
<210> 2
<211> 28
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Anti-sense
Probe
<400> 2
cggaattcct caaggtcgag tgagctgt 28
<210> 3
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Forward Primer
1
CA 02488006 2004-11-30
WO 03/102130 PCT/IB03/02256
<400> 3
cacacagctc actcgacctt g 21
<210> 4
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Reverse Primer
<400> 4
ttcggttatt tttaggatca tctcg 25
2
