Note: Descriptions are shown in the official language in which they were submitted.
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
ANTIBODIES AND USES THEREOF
FIELD OF THE INVENTION
[Ol] The present invention relates to antibodies that bind to particular
epitopes
that are present on cells, such as cancer cells, metastatic cells, leukemia
cells, leukocytes,
and platelets, and that are important in such diverse physiological phenomena
as cell
rolling, metastasis, inflammation, and auto-immune diseases. Particularly, the
antibodies
may have anti-cancer activity, anti-metastatic activity, anti-leukemia
activity, anti-viral
activity, anti-infection activity, andlor activity against other diseases,
such as
inflammatory diseases, autoimmune diseases, cardiovascular diseases such as
myocardial
infarction, retinopathic diseases, and diseases caused by sulfated tyrosine-
dependent
protein-protein interactions.
BACKGROUND OF THE INVENTION
Antibodies, Phase Display= and Tissue Tar~etin~
[02] Tissue-selective targeting of therapeutic agents is an emerging
discipline in
the pharmaceutical industry. New cancer treatments based on targeting have
been
designed to increase the specificity and potency of the treatment while
reducing toxicity,
thereby enhancing overall efficacy. Mouse monoclonal antibodies (MAbs) to
tumor-
associated antigens have been employed in an attempt to target toxin,
radionucleotide, and
chemotherapeutic conjugates to tumors. In addition, differentiation antigens,
such as
CD 19, CD20, CD22, and CD25, have been exploited as cancer specific targets in
treating
hematopoietic malignancies.
[03] Although extensively studied, this approach has several limitations. One
limitation is the difficulty of isolating appropriate MAbs that display
selective binding. A
second limitation is the need for high antibody immunogenicity as a
prerequisite for
successful antibody isolation. A third limitation is that the final product
has non-human
sequences, which induce immune responses; e.g., when a mouse MAb is given to a
human, a human anti-mouse antibody (HAMA) response will be generated. The HAMA
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
response often results in a shorter serum half life and prevents repetitive
treatments, thus
diminishing the therapeutic value of the antibody. This latter limitation has
stimulated
interest both in engineering chimeric or humanized monoclonal antibodies of
murine
origin and in discovering human antibodies. Another limitation of this
approach is that it
enables the isolation of only a single antibody species directed against only
known and
purified antigens. Moreover, this method is not selective insofar as it allows
for the
isolation of antibodies against cell surface markers that are present on
normal, as well as
malignant, cells.
[04] There are many factors that influence the therapeutic efftcacy of MAbs
for
treating cancer. These factors include the specificity and level of antigen
expression on
tumor cells, antigenic heterogeneity, and accessibility of the tumor mass.
Leukemias and
lymphomas have been generally more responsive to treatment with antibodies
than solid
tumors, such as carcinomas. MAbs rapidly bind to leukemia and lymphoma cells
in the
bloodstream and easily penetrate to malignant cells in lymphatic tissue, thus
making
lymphoid tumors excellent candidates for MAb-based therapy. An ideal system
entails
identifying a MAb that recognizes a marker on the cell surface of stem cells
that are
producing malignant progeny cells.
[05] Phage libraries have been used to select random single chain variant
fragments (scFvs) that bind to isolated, pre-determined target proteins, such
as antibodies,
hormones, and receptors. The use of antibody display libraries in general, and
phage scFv
libraries in particular, facilitates an alternative means of discovering
unique molecules for
targeting specific, yet unrecognized and undetermined, cell surface moieties.
[06] Leukemia, lymphoma, and myeloma are cancers that originate in the bone
marrow and lymphatic tissues and are involved in uncontrolled growth of cells.
Acute
lymphoblastic leukemia (ALL) is a heterogeneous disease that is defined by
specific
clinical and immunological characteristics. Like other forms of ALL, the
definitive cause
of most cases of B cell ALL (B-ALL) is not known; although, in many cases, the
disease
results from acquired genetic alterations in the DNA of a single cell, causing
abnormalities
and continuous multiplication. Prognosis for patients afflicted with B-ALL is
significantly
worse than for patients with other leukemias, both in children and in adults.
Chronic
lymphocytic leukemia (CLL), one example of which is B cell CLL (B-CLL), is a
slowly
2
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
progressing form of leukemia, characterized by an increased number of
lymphocytes.
Acute myelogenous leukemia (AML) is a heterogeneous group of neoplasms having
a
progenitor cell that, under normal conditions, gives rise to terminally
differentiated cells of
the myeloid series (erythrocytes, granulocytes, monocytes, and platelets). As
in other
forms of neoplasia, AML is associated with acquired genetic alterations that
result in
replacement of normally differentiated myeloid cells with relatively
undifferentiated
blasts, exhibiting one or more type of early myeloid differentiation. AML
generally
evolves in the bone marrow and, to a lesser degree, in the secondary
hematopoietic organs.
Primarily, AML affects adults and peaks in incidence between the ages of 15-
40, but it is
also known to affect both children and older adults. Nearly all patients with
AML require
treatment immediately after diagnosis to achieve clinical remission, in which
there is no
evidence of abnormal levels of circulating undifferentiated blast cells.
[07] To date, a variety of MAbs have been developed that induce cytolytic
activity against tumor cells. The marine MAb muMab4D5 produced against the
extracellular domain of HER2 (P 185) and found to markedly inhibit the
proliferation of
human tumor cells over-expressing HER2 was humanized to produce the drug
HERCEPTIN~ (trastuzumab), which was approved by the FDA and is being used to
treat
human breast cancer (US Patent Nos. 5,821,337 and 5,720,954). Following
binding, the
antibody is capable of inhibiting tumor cell growth that is dependent on the
HER2 growth
factor receptor. In addition, a chimeric antibody against CD20, which causes
rapid
depletion of peripheral B cells, including those associated with lymphoma, was
recently
approved by the FDA (US Patent No. 5,843,439). The binding of this antibody to
target
cells results in complement-dependent lysis. This product has recently been
approved and
is currently being used in the clinic to treat low-grade B cell non-Hodgkin's
lymphoma.
[08] Several other humanized and chimeric antibodies are under development or
are in clinical trials. For example, a humanized immunoglobulin (Ig) that
specifically
reacts with CD33 antigen, expressed both on normal myeloid cells as well as on
most
types of myeloid leukemic cells, was conjugated to the anti-cancer drug
calicheamicin,
CMA-676 (Sievers et al., Blood Supp. 308: 504a (1997)). This conjugate, known
as the
drug MYLOTARG~, has recently received FDA approval (Caron et al., Cancer Supp.
73:
1049-56 (1994)). In light of its cytolytic activity, an additional anti-CD33
antibody
(HumM195), currently in clinical trials, was conjugated to several cytotoxic
agents,
3
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
including the gelonin toxin (McGraw et al., Cancer Imnaunol. Inamuraotlaer.
39: 367-74
(1994)) and radioisotopes 1311 (Caron et al., Blood 83: 1760-68 (1994)),
9°Y (Jurcic et al.,
Blood Supp. 92: 613a (1998)) and zl3Bi (Humtn et al., Blood Supplement 38:
231P
(1997)). A chimeric antibody against the leukocyte antigen CD45 (cHuLym3) is
also in
clinical studies for treatment of human leukemia and lymphoma (Sun et al.,
Cancer
Irnnzunol. Irnmunother. 48: 595-602 (2000)). In in vitro assays, specific cell
lysis was
observed in ADCC (antibody dependent cell-mediated cytotoxicity) assays
(Henkart,
Immunity 1: 343-46 (1994); Squier and Cohen, Current Opin. Irnmunol. 6: 447-52
(1994)).
[09] These therapeutic antibodies have also been specifically engineered to
have
higher affininity to their target, to be more stable, and for optimal
biodistribution. See,
e.g., Presta, Current Pharma. Biotechnol., 3: 237-56 (2002); Presta et al.,
Biochem.
Society Transactions, 30(4): 487-90 (2002).
[10] In contrast to mouse monoclonal humanization and construction of
chimeric antibodies, the use of phage display technology enables the isolation
of. scFvs
having fully human sequences. A fully human antibody against the human TGF(32
receptor was recently developed based on a scFv clone derived from phage
display
technology. This scFv, which was converted into a fully human IgG4 capable of
competing with the binding of TGF(32 (Thompson et al., J. Imrnunol. Meth. 227:
17-29
(1999)), has strong anti-proliferative activity. Phage display technology, as
known to one
skilled in the art, is more specifically described in the following
publications: Smith,
Science 228: 1315 (1985); Scott et al., Seience 249: 386-90 (1990); Cwirla et
al., PNAS
87: 6378-82 (1990); Devlin et al., Scie~ace 249: 404-06 (1990); Griffiths et
al., EMBO J.
13(14): 3245-60 (1994); Bass et al., Proteins 8: 309-14 (1990); McCafferty et
al., Nature
348: 552-54 (1990); Nissim et al., EMBO J. 13: 692-98 (1994); U.S. Patent Nos.
5,427,908, 5,432,018, 5,223,409 and 5,403,484, lib.
Ligand for Isolated scFv Antibody Molecules
[11] Platelets, fibrinogen, GPIb, selectins, and PSGL-1 (P-Selectin
Glycoprotein
Ligand-1) each play an important role in several pathogenic conditions or
disease states,
such as abnormal or pathogenic inflammation, abnormal or pathogenic immune
reactions,
autoimmune reactions, metastasis, abnormal or pathogenic adhesion, thrombosis
and/or
4
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
restenosis, and abnormal or pathogenic aggregation. Thus, antibodies that bind
to or
cross-react with platelets and with these molecules would be useful in the
diagnosis and
treatment of diseases and disorders involving these and other pathogenic
conditions.
Platelets
[12] Platelets are well-characterized components of the blood system and play
several important roles in hemostasis, thrombosis and/or restenosis. Damage to
blood
vessel sets in motion a process known as hemostasis, which is characterized by
a series of
sequential events. The initial reaction to damaged blood vessels is the
adhesion of
platelets to the affected region on the inner surface of the vessel. The next
step is the
aggregation of many layers of platelets onto the previously adhered platelets,
forming a
hemostatic plug and sealing the vessel wall. The hemostatic plug is further
strengthened
by the deposition of fibrin polymers. The clot or plug is degraded only when
the damage
has been repaired.
[13] Circulating platelets are cytoplasmic particles released from the
periphery
of megakaryocytes. Platelets play an important role in hemostasis. Upon
vascular injury,
platelets adhere to damaged tissue surfaces and attach to one another
(cohesion). This
sequence of events occurs rapidly, forming a structureless mass (commonly
called a
platelet plug or thrombus) at the site of vascular injury. The cohesion
phenomenon, also
known as aggregation, may be initiated iya vitro by a variety of substances,
or agonists,
such as collagen, adenosine-diphosphate (ADP), epinephrine, serotonin, and
ristocetin.
Aggregation is one of the numerous ira vitro tests performed as a measure of
platelet
function.
Importance of Platelets in Metastasis
[14] Tumor metastasis is perhaps the most important factor limiting the
survival
of cancer patients. Accumulated data indicate that the ability of tumor cells
to interact
with host platelets represents one of the indispensable determinants of
metastasis
(Oleksowicz, Thrombosis Res. 79: 261-74 (1995)). When metastatic cancer cells
enter the
blood stream, multicellular complexes composed of platelets and leukocytes
coating the
tumor cells are formed. These complexes, which may be referred to as
microemboli, aid
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
the tumor cells in evading the immune system. The coating of tumor cells by
platelets
requires expression of P-selectin by the platelets.
[15] It has been demonstrated that the ability of tumor cells to aggregate
platelets correlates with the tumor cells' metastasis potential, and
inhibition of tumor-
induced platelet aggregation has been shown to correlate with the suppression
of
metastasis in rodent models. It has been demonstrated that tumor cell
interaction with
platelets involves membrane adhesion molecules and agonist secretion.
Expression of
immuno-related platelet glycoproteins has been identified on tumor cell lines.
It was
demonstrated that platelet immuno-related glycoproteins, GPIb, GPIIb/IIIa,
GPIb/IX and
the integrin a,, subunit are expressed on the surface of breast tumor cell
lines (Oleksowicz,
(1995), supra; Kamiyama et al., J. Lab. Clin. Med. 117(3): 209-17 (1991)).
[16] Gasic et al. (PNAS 61:46-52 (1968)) showed that antibody-induced
thrombocytopenia markedly reduced the number and volume of metastases produced
by
CT26 colon adenocarcinoma, Lewis lung carcinoma, and B16 melanoma (Karpatkin
et al.,
J. Clin. Invest. 81(4): 1012-19 (1988); Clezardin et al., CancerRes. 53(19):
4695-700
(1993)). Furthermore, a single polypeptide chain (60kd) was found to be
expressed on
surface membrane of HEL cells that is closely related to GPIb and corresponds
to an
incompletely or abnormally O-glycosylated GPIba subunit (Kieffer et al., J.
Biol. Chem.
261(34): 15854-62 (1986)).
GPIb Complex
[17] Each step in the process of hemostasis requires the presence of receptors
on
the platelet surface. One receptor that is important in hemostasis is the
glycoprotein Ib-IX
complex (also known as CD42). This receptor mediates adhesion (initial
attachment) of
platelets to the blood vessel wall at sites of injury by binding von
Willebrand factor (vWF)
in the subendothelium. It also has crucial roles in two other platelet
functions important in
hemostasis: (a) aggregation of platelets induced by high shear in regions of
arterial
stenosis and (b) platelet activation induced by low concentrations of
thrombin.
[18] The GPIb-IX complex is one of the major components of the outer surface
of the platelet plasma membrane. This complex comprises three membrane-
spanning
polypeptides - a disulfide-linked 130 kDa a-chain and 25 kDa (3-chain of GPIb
and a
6
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
noncovalently associated GPIX (22 kDa). All of the subunits are presented in
equimolar
amounts on the platelet membrane for efficient cell-surface expression and
function of
CD42 complex, indicating that proper assembly of the three subunits into a
complex is
required for full expression on the plasma membrane. The a-chain of GPIb
consists of
three distinct structural domains: (1) a globular N-terminal peptide domain
containing
leucine-rich repeat sequences and Cys-bonded flanking sequences; (2) a highly
glycosylated mucin-like macroglycopeptide domain; and (3) a membrane-
associated C-
terminal region that contains the disulfide bridge to GPIba and transmembrane
and
cytoplasmic sequences.
[19] Several lines of evidence indicate that the vWF and thrombin-binding
domain of the GPIb-IX complex reside in a globular region encompasing
approximately
300 amino acids at the amino terminus of GPIba. As human platelet GPIb-IX
complex is
a key membrane receptor mediating both platelet function and reactivity,
recognition of
subendothelial-bound vWF by GPIb allows platelets to adhere to damaged blood
vessels.
Further, binding of vWF to GPIba also induces platelet activation, which may
involve the
interaction of a cytoplasmic domain of the GPIb-IX with cytoskeleton or
phospolipase A2.
Moreover, GPIba contains a high-affinity binding site for a-thrombin, which
facilitates
platelet activation by an as-yet poorly defined mechanism.
[20] The N-terminal globular domain of GPIba contains a cluster of negatively
charged amino acids. Several lines of evidence indicate that in transfected
CHO cells
expressing GPIb-IX complex and in platelet GPIba, the three tyrosine residues
contained
in this domain (Tyr-276, Tyr-278, and Tyr-279) undergo sulfation.
Protein Sulfation
[21] Protein sulfation is a widespread post-translational modification that
involves enzymatic covalent attachment of sulfate, either to sugar side chains
or to the
polypeptide backbone. This modification occurs in the traps-Golgi compartment.
Sulfated proteins include secretory proteins, proteins targeted for granules,
and the
extracellular regions of plasma membrane proteins. Tyrosine is an amino acid
residue
presently known to undergo sulfation. I~ehoe et al., Chem. Biol. 7: R57-61
(2000). Other
amino acids, e.g., threonine, may also undergo sulfation, particularly in
diseased cells.
7
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
[22] A number of proteins have been found to be tyrosine-sulfated, but the
presence of three or more sulfated tyrosines in a single polypeptide, as was
found on GPIb,
is not common. GPIba, (CD42), which is expressed by platelets and
megakaryocytes and
mediates platelet attachment to and rolling on subendothelium via binding with
vWF, also
contains numerous negative charges at its N-terminal domain. Such a highly
acidic and
hydrophilic environment is thought to be a prerequisite for sulfation, because
tyrosylprotein sulfotransferase specifically recognizes and sulfates tyrosines
adjacent to
acidic amino residues (Bundgaaxd et al., J. Biol. Chem. 272:21700-OS (1997)).
Full
sulfation of the acidic region of GPIboc yields a region with a remarkable
negative charge
density -13 negative charges within a 19 amino acid stretch - and is a
candidate site for
electrostatic interaction with other proteins.
[23] It is also thought that sulfated N-terminal tyrosines influence the role
of
CC-chemokine receptors, such as CCRS, which serve as co-receptors with related
seven
transmembered segment (7TMS) receptor for entry of human and simian
imrnunodeficiency viruses (HIV-l, HIV-2, and S1V) into target cells. For
example, it is
thought that sulfated N-terminal tyrosines contribute to the binding of CCRS
to MIP-la,
MIP-1(3, and HIV-1 gp1201CD4 complexes and to the ability of HIV-1 to enter
cells
expressing CCRS and CD4. CXCR4, another important HIV-1 co-receptor, is also
sulfated (Farzan et al., Cell 96(5): 667-76 (1999)). Tyrosine sulfation plays
a less
significant role in CXCR4-dependent HIV-1 entry than CCRS-dependent entry;
thus
demonstrating a possible role for tyrosine sulfation in the CXC-chemokine
family and
underscores a general difference in HIV-1 utilization of CCRS and CXCR4
(Farzan et al.,
J. Biol. Chem. 277(33): 29,484-89 (2002)).
Selectins and PSGL-1
[24] The P-, E-, and L- Selectins are members of a family of adhesion
molecules
that, among other functions, mediate rolling of leukocytes on vascular
endothelium. P-
Selectin is stored as granules in platelets and is transported to the surface
after activation
by thrombin, histamine, phorbol ester, or other stimulatory molecules. P-
Selectin is also
expressed on activated endothelial cells. E-Selectin is expressed on
endothelial cells, and
L-Selectin is expressed on neutrophils, monocytes, T cells, and B cells.
8
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
[25] PSGL-1 (also called CD162) is a mucin glycoprotein ligand for P-Selectin,
E-Selectin, and L-Selectin that shares structural similarity with GPIb (Afshar-
Kharghan et
al. (2001), supra). PSGL-1 is a disulfide-linked homodimer that has a PACE
(Paired
Basic Amino Acid Converting Enzymes) cleavage site. PSGL-1 also has three
potential
tyrosine sulfation sites followed by 10-16 decamer repeats that are high in
proline, serine,
and threonine. The extracellular portion of PSGL-1 contains three N-linked
glycosylation
sites and has numerous sialylated, fucosylated O-linked oligosaccharide
branches (Moore
et al., J. Biol. Che~z. 118: 445-56 (1992)). Most of the N-glycan sites and
many of the O-
glycan sites are occupied. The structures of the O-glycans of PSGL-1 from
human HL-60
cells have been determined. Subsets of these O-glycans are core-2, sialylated
and
fucosylated structures that are required for binding to selectins. Tyrosine
sulfation of an
amino-terminal region of PSGL-1 is also required for binding to P-Selectin and
L-Selectin.
Further, there is an N-terminal propeptide that is probably cleaved post-
translationally.
[26] PSGL-1 has 361 residues in HL60 cells, with a 267 residue extracellular
region, 25 residue trans-membrane region, and a 69 residue intracellular
region, and forms
a disulfide-bonded homodimer or heterodimer on the cell surface (Afshar-
Kharghan et al.,
Blood 97: 3306-12 (2001)). The sequence encoding PSGL-1 is in a single exon,
so
alternative splicing should not be possible. However, PSGL-1 in HL60 cells,
and in most
cell lines, has 15 consecutive repeats of a 10 residue consensus sequences
present in the
extracellular region, although there are 14 and 16 repeats of this sequence in
polymorphonuclear leukocytes, monocytes, and several other cell lines,
including most
native leukocytes.
[27] PSGL-1 is expressed on neutrophils as a dimer, with apparent molecular
weights of both 250 kDa and 160 kDa, whereas on HL60 the dimeric form is
approximately 220 kDa. When analyzed under reducing conditions, each subunit
is
reduced by half. Differences in molecular mass may be due to polymorphisms in
the
molecule caused by the presence of different numbers of decamer repeats
(Leukocyte
Typing VI. Edited by T. Kishimoto et al. (1997)).
[28] Most blood leukocytes, such as neutrophils, monocytes, leukocytes, subset
of B cells, and all T cells express PSGL-1 (Kishimoto et al. (1997), supYa).
PSGL-1
mediates rolling of leukocytes on activated endothelium, on activated
platelets, and on
9
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
other leukocytes and inflammatory sites and mediates rolling of neutropluls on
P-Selectin.
PSGL-1 may also mediate neutrophil-neutrophil interactions via binding with L-
Selectin,
thereby mediating inflammation (Snapp et al., Blood 91(1): 154-64 (1998)).
[29] Leukocyte rolling is important in inflammation, and interaction between P-
Selectin (expressed by activated endothelium and on platelets, which may be
immobilized
at sites of injury) and PSGL-1 is instrumental for tethering and rolling of
leukocytes on
vessel walls (Ramachandran et al., PNAS 98(18): 10166-71 (2001); Afshar-
Kharghan et al.
(2001), supra). Cell rolling is also important in metastasis, and P- and E-
Selectin on
endothelial cells is believed to bind metastatic cells, thereby facilitating
extravasation from
the blood stream into the surrounding tissues.
[30] Thus, PSGL-1 has been found on all leukocytes: neutrophils, monocytes,
lymphocytes, activated peripheral T cells, granulocytes, eosinophils,
platelets, and on
some CD34 positive stem cells and certain subsets of B cells. P-Selectin is
selectively
expressed on activated platelets and endothelial cells. Interaction between P-
Selectin and
PSGL-1 promotes rolling of leukocytes on vessel walls, and abnormal
accumulation of
leukocytes at vascular sites results in various pathological inflammations.
Stereo-specific
contributions of individual tyrosine sulfates on PSGL-1 are important for the
binding of P-
Selectin to PSGL-1. Charge is also important for binding: reducing NaCl (from
150 to 50
mM) enhanced binding (I~d ~75nM). Tyrosine-sulfation on PSGL-1 enhances, but
is not
ultimately required for PSGL-1 adhesion on P-Selectin. PSGL-1 tyrosine
sulfation
supports slower rolling adhesion at all shear rates and supports rolling
adhesion at much
higher shear rates (Rodgers et al., Biophys. J. 81: 2001-09 (2001)). Moreover,
it has been
suggested that PSGL-1 expression on platelets is 25-100 fold lower than that
of leukocytes
(Frenette et al., J. Exp. Med. 191(8): 1413-22 (2000)).
[31] A commercially available monoclonal antibody to human PSGL-l, KPLl,
has been shown to inhibit the interactions between PSGL-1 and P-selectin and
between
PSGL-1 and L-selectin. The I~PL1 epitope was mapped to the tyrosine sulfation
region of
PSGL-1 (YEYLDYD) (Snapp et al., Blood 91(1):154-64 (1998)).
[32] Pretreatment of tzunor cells with O-sialoglycoprotease, which removes
sialylated, fucosylated mucin ligands, also inhibited tumor cell- platelet
complex
formation. Ih vivo experiments indicate that either of these treatments
results in greater
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
monocyte association with circulating tumor cells, suggesting that reducing
platelet
binding increases access by immune cells to circulating tumor cells (Varki and
Varki,
Bf°az. J. Biol. Res. 34(6): 711-17 (2001)).
Fibrinogen
[33] There are two forms of normal human fibrinogen - normal (y) and y prime,
each of which is found in normal individuals. Normal fibrinogen, which is the
more
abundant form (approximately 90% of the total fibrinogen found in the body),
is
composed of two identical 55 kDa a chains, two identical 95 kDa (3 chains, and
two
identical 49.5 kDa y chains. Normal variant fibrinogen, which is the less
abundant form
(approximately 10% of the fibrinogen found in the body), is composed of two
identical 55
kDa oc chains, two identical 95 kDa [3 chains, one 49.5 kDa y chain, and one
variant 50.5
kDa y prime chain. The gamma and gamma prime chains axe both coded for by the
same
gene, with alternative splicing occurring at the 3' end. Normal gamma chain is
composed
of amino acids 1-411 and normal variant gamma prime chain is composed of 427
amino
acids, of which amino acids 1-407 are the same as those in the normal gamma
chain and
amino acids 40~-427 are VRPEHPAETEYDSLYPEDDL. This region is normally
occupied with thrombin molecules.
[34] Fibrinogen is converted into fibrin by the action of thrombin in the
presence of ionized calcium to produce coagulation of the blood. Fibrin is
also a
component of thrombi, and acute inflammatory exudates.
Objectives
[35] It is an object of the present invention to provide antibodies, fragments
thereof or complexes thereof, that bind to epitopes present on various
molecules
instrumental in processes such as cell rolling, inflammation, immune
reactions, infection,
autoimmune reactions, and metastasis, yet are not involved in processes such
as adhesion,
thrombosis and/or restenosis and aggregation, which epitopes are present on
diseased
cells, such as AML cells, T-ALL cells, Pre-B-ALL cells, B-leukemia, B-CLL
cells,
multiple myeloma cells, and metastatic cells.
11
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
[36] Another objective of the present invention includes the use of such
antibodies in the development and provision of medicaments for the inhibition
of cell
rolling, inflammation, immune reactions, infection, autoimmune reactions, and
metastasis,
yet are not involved in adhesion, thrombosis and/or restenosis and
aggregation, and for the
treatment of diseases, such as AML, T-ALL, B-leukemia, B-CLL, Pre-B-ALL,
multiple
myeloma, metastasis, cardiovascular diseases such as myocardial infarction,
retinopathic
diseases, diseases caused by sulfated tyrosine-dependent protein-protein
interactions, or
other diseases in which such cellular functions or actions play a significant
role.
[37] It is also an object of this invention to utilize the antibodies in
methods for
diagnosing, prognosing, or staging various disease states of an individual,
such as, e.g.,
AML, T-ALL, B-leukemia, B-CLL, Pre-B-ALL, multiple myeloma, and metastasis or
other diseases in which such cellular functions or actions as cell rolling,
inflammation,
immune reactions, infection, autoimmune reactions, metastasis, play a
significant role.
And another object of the present invention is to provide a method of purging
tumor cells.
[38] Yet another object of the invention is to provide methods of activating
ADCC or stimulating NK or T cells by administering the antibodies.
[39] These and other objectives of the invention are provided herein.
SUMMARY OF THE INVENTION
[40] The present invention provides antibodies or fragments thereof having the
binding capabilities of an scFv antibody fragment of SEQ ID NO:1. The present
invention
also provides antibodies or fragments thereof, wherein at least one antibody,
or binding
fragment thereof, has a first hypervariable region of SEA ID N0:2, a second
hypervariable
region of SEQ ID N0:3, and/or a third hypervariable region of SEQ ID N0:4. The
antibodies or fragments thereof, of the present invention preferably bind to,
or crossreact
with, an epitope of PSGL-1. Also, preferably, the antibodies or fragments
thereof of the
present invention bind to an epitope on at least one cell type selected from
the group
consisting of T-ALL, AML, B-leukemia, B-CLL and multiple myeloma leukemia
cells.
12
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
[41] The present invention also provides isolated epitopes having an amino
acid
sequence that binds to the antibodies or binding fragments thereof of the
present invention.
Preferably, the isolated epitope is located between amino acids 1 and 17 of
the mature
PSGL-1, which is within a cluster of negatively charged amino acids.
[42] Also provided are pharmaceutical compositions and processes for
production of such antibodies or fragments thereof. Methods utilizing such
pharmaceutical
compositions to treat various conditions are provided, including conditions
related to
inhibiting or treating cell rolling; inhibiting or treating inflammation;
inhibiting or treating
an auto-immune disease; inhibiting or treating an infection (e.g., a viral
infection such as
HIV); inhibiting or treating metastasis; inhibiting or treating growth and/or
replication of
tumor cells; increasing mortality of tumor cells; inhibiting growth and/or
replication of
leukemia cells; increasing the mortality rate of leukemia cells; alters the
susceptibility of
diseased cells to damage by anti-disease agents; increasing the susceptibility
of tumor cells
to damage by anti-cancer agents; increasing the susceptibility of leukemia
cells to damage
by anti-leukemia agents; inhibiting increase in number of tumor cells in a
patient having a
tumor; decreasing the number of tumor cells in a patient having cancer;
inhibiting increase
in number of leukemia cells in a patient having leukemia; and decreasing the
number of
leukemia cells in a patient having leukemia. Other methods are provided to
induce ADCC
or stimulate NK or T cells using the present antibodies or fragments thereof.
(43] The present invention also provides a method of purging tumor cells from
a
patient by providing a sample containing cells from the patient and incubating
the cells
from the patient with an antibody or polypeptide of the present invention.
DEFINITIONS
[44] Antibodies (Abs), or immunoglobulins (Igs), are protein molecules that
bind to antigen. Each functional binding unit of naturally occurnng antibodies
is
composed of units of four polypeptide chains (2 heavy and 2 light) linked
together by
disulfide bonds. Each of the chains has a constant and variable region.
Naturally
occurring antibodies can be divided into several classes including IgG, IgM,
IgA, IgD, and
IgE, based on their heavy chain component. The IgG class encompasses several
sub-
13
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
classes including, but not restricted to, IgGI, IgGa, IgG3, and IgG4.
hrununoglobulins are
produced ifa vivo by B lymphocytes, and each such molecule recognizes a
particular
foreign antigenic determinant and facilitates clearing of that antigen.
[45] Antibodies may be produced and used in many forms, including antibody
complexes. As used herein, the term "antibody complex" or "antibody complexes"
is used
to mean a complex of one or more antibodies with another antibody or with an
antibody
fragment or fragments, or a complex of two or more antibody fragments.
Examples of
antibody fragments include Fv, Fab, F(ab')~, Fc, and Fd fragments.
Accordingly, the term
"antibody or fragment thereof' as used herein includes an antibody complex or
antibody
complexes.
[46] As used herein in the specification and in the claims, an Fv is defined
as a
molecule that is made up of a variable region of a heavy chain of a human
antibody and a
variable region of a light chain of a human antibody, which may be the same or
different,
and in which the variable region of the heavy chain is connected, linked,
fused, or
covalently attached to, or associated with, the variable region of the light
chain. The Fv
can be a single chain Fv (scFv) or a disulfide stabilized Fv (dsFv). An scFv
is comprised
of the variable domains of each of the heavy and light chains of an antibody,
linked by a
flexible amino-acid polypeptide spacer, or linker. The linker may be branched
or
unbranched. Preferably, the linker is 0-15 amino acid residues, and most
preferably the
linker is (Gly4Ser)3.
[47] The Fv molecule, itself, is comprised of a first chain and a second
chain,
each chain having a first, second and third hypervariable region. The
hypervariable loops
within the variable domains of the light and heavy chains are termed
Complementary
Determining Regions (CDRs). There are CDRl, CDR2, and CDR3 regions in each of
the
heavy and light chains. These regions are believed to form the antigen binding
site and
can be specifically modified to yield enhanced binding activity. The most
variable of
these regions in nature is the CDR3 region of the heavy chain. The CDR3 region
is
understood to be the most exposed region of the Ig molecule and, as shown and
provided
herein, is the site primarily responsible for the selective and/or specific
binding
characteristics observed.
14
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
[48] A fragment of an Fv molecule is defined as any molecule smaller than the
original Fv that still retains the selective and/or specific binding
characteristics of the
original Fv. Examples of such fragments include but are limited to (1) a
minibody, which
comprises a fragment of the heavy chain only of the Fv, (2) a microbody, which
comprises
a small fractional unit of antibody heavy chain variable region (International
Application
No. PCT/IL99/00581), (3) similar bodies having a fragment of the light chain,
and
(4) similar bodies having a functional unit of a light chain variable region.
It should be
appreciated that a fragment of an Fv molecule can be a substantially circular
or looped
polypeptide.
[49] As used herein the term "Fab fragment" is a monovalent antigen-binding
fragment of an immunoglobulin. A Fab fragment is composed of the light chain
and part
of the heavy chain.
(50] An F(ab')Z fragment is a bivalent antigen binding fragment of an
immunoglobulin obtained by pepsin digestion. It contains both light chains and
part of
both heavy chains.
(51] An Fc fragment is a non-antigen-binding portion of an immunoglobulin. It
contains the carboxy-terminal portion of heavy chains and the binding sites
for the Fc
receptor.
[52] An Fd fragment is the variable region and Frst constant region of the
heavy
chain of an ixmnunoglobulin.
[53] Polyclonal antibodies are the product of an immune response and are
formed by a number of different B lymphocytes. Monoclonal antibodies are
derived from
one clonal B cell.
[54] A cassette, as applied to polypeptides and as defined in the present
invention, refers to a given sequence of consecutive amino acids that serves
as a
framework and is considered a single unit and is manipulated as such. Amino
acids can be
replaced, inserted into, removed, or attached at one or both ends. Likewise,
stretches of
amino acids can be replaced, inserted into, removed, or attached at one or
both ends.
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
[55] The term "epitope" is used herein to mean the antigenic determinant or
recognition site or antigen site that interacts with an antibody, antibody
fragment, antibody
complex or a complex having a binding fragment thereof or T cell receptor. The
term
epitope is used interchangeably herein with the terms ligand, domain, and
binding region.
[56] Selectivity is herein defined as the ability of a targeting molecule to
choose
and bind one entity or cell state from a mixture of entities or entity states,
all entities or
entity states of which may be specific for the targeting molecule.
[57] The term "affinity" as used herein is a measure of the binding strength
(association constant) between a binding molecule (e.g., one binding site on
an antibody)
and a ligand (e.g., antigenic determinant). The strength of the sum total of
noncovalent
interactions between a single antigen-binding site on an antibody and a single
epitope is
the affinity of the antibody for that epitope. Low affinity antibodies bind
antigen weakly
and tend to dissociate readily, whereas high-affinity antibodies bind antigen
more tightly
and remain bound longer. The term "avidity" differs from affinity, because the
former
reflects the valence of the antigen-antibody interaction.
[58] Specificity of antibody-antigen interaction: Although the antigen-
antibody
reaction is specific, in some cases antibodies elicited by one antigen can
cross-react with
another unrelated antigen. Such cross-reactions occur if two different
antigens share a
homologous or similar structure, epitope, or an anchor region thereof, or if
antibodies
specific for one epitope bind to an unrelated epitope possessing similar
structure
conformation or chemical properties.
[59] A platelet is a disc-like cytoplasmic fragment of a megakaryocyte that is
shed in the marrow sinus and subsequently circulates in the peripheral blood
stream.
Platelets have several physiological functions including a major role in
clotting. A platelet
contains centrally located granules and peripheral clear protoplasm, but has
no definite
nucleus.
[60] Agglutination as used herein means the process by which suspended
bacteria, cells, discs, or other particles of similar size are caused to
adhere and form into
clumps. The process is similar to precipitation but the particles are larger
and are in
suspension rather than being in solution.
16
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
[61] The term aggregation means a clumping of platelets induced in vitro, and
thrombin and collagen, as part of a sequential mechanism leading to the
formation of a
thrombus or hemostatic plug.
[62] Conservative amino acid substitution is defined as a change in the amino
acid composition by way of changing one or two amino acids of a peptide,
polypeptide or
protein, or fragment thereof. The substitution is of amino acids with
generally similar
properties (e.g., acidic, basic, aromatic, size, positively or negatively
charged, polarity,
non-polarity) such that the substitutions do not substantially alter peptide,
polypeptide or
protein characteristics (e.g., charge, isoelectric point, affinity, avidity,
conformation,
solubility) or activity. Typical substitutions that may be performed for such
conservative
amino acid substitution may be among the groups of amino acids as follows:
glycine (G), alanine (A), valine (V), leucine (L) and isoleucine (I)
aspartic acid (D) and glutamic acid (E)
alanine (A), serine (S) and threonine (T)
histidine (H), lysine (K) and arginine (R)
asparagine (I~ and glutamine (Q)
phenylalanine (F), tyrosine (Y) and tryptophan (~
[63] Conservative amino acid substitutions can be made in, e.g., regions
flanking the hypervariable regions primarily responsible for the selective
and/or specific
binding characteristics of the molecule, as well as other parts of the
molecule, e.g.,
variable heavy chain cassette. Additionally or alternatively, modification can
be
accomplished by reconstructing the molecules to form full-size antibodies,
diabodies
(dimers), triabodies (timers), and/or tetrabodies (tetramers) or to form
minibodies or
microbodies.
(64] A phagemid is defined as a phage particle that carries plasmid DNA.
Phagemids are plasmid vectors designed to contain an origin of replication
from a
filamentous phage, such as m13 of fd. Since it carries plasmid DNA, the
phagemid
particle does not have sufficient space to contain the full complement of the
phage
17
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
genome. The component that is missing from the phage genome is information
essential
for packaging the phage particle. In order to propagate the phage, therefore,
it is necessary
to culture the desired phage particles together with a helper phage strain
that complements
the missing packaging information.
[65] A promoter is a region on DNA at which RNA polymerase binds and
initiates transcription.
[66] A phage display library (also termed phage peptide/antibody library,
phage
library, or peptide/antibody library) comprises a large population of phages
(108 or larger),
each phage particle displaying a different peptide or polypeptide sequence.
These peptide
or polypeptide fragments may constructed to be of variable length. The
displayed peptide
or polypeptide can be derived from, but need not be limited to, human antibody
heavy or
light chains.
[67] A pharmaceutical composition refers to a formulation which comprises an
antibody or peptide or polypeptide of the invention and a pharmaceutically
acceptable
carrier, excipient or diluent thereof, or an antibody-pharmaceutical agent
(antibody-agent)
complex and a pharmaceutically acceptable carrier, excipient or diluent
thereof.
[68] A agent refers to an agent that is useful in the treatment of active
disease,
prophylactic treatment, or diagnosis of a mammal including, but not restricted
to, a human,
bovine, equine, porcine, marine, canine, feline, or any other warm-blooded
animal. The
agent is selected from the group of radioisotope, toxin, pharmaceutical agent,
oligonucleotide, recombinant protein, antibody fragment, anti-cancer agents,
anti-adhesion
agents, anti-thrombosis agents, anti-restenosis agents, anti-autoimmune
agents, anti-
aggregation agents, anti-bacterial agents, anti-viral agents, and anti-
inflammatory agents.
Other examples of such agents include, but are not limited to anti-viral
agents including
acyclovir, ganciclovir, and zidovudine; anti-thrombosis/restenosis agents
including
cilostazol, dalteparin sodium, reviparin sodium, and aspirin; anti-
inflammatory agents
including zaltoprofen, pranoprofen, droxicam, acetyl salicylic 17, diclofenac,
ibuprofen,
dexibuprofen, sulindac, naproxen, amtolinetin, celecoxib, indomethacin,
rofecoxib, and
nimesulid; anti-autoimmune agents including leflunomide, denileukin diftitox,
subreum,
WinRho SDF, defibrotide, and cyclophosphamide; and anti-adhesion/anti-
aggregation
agents including limaprost, clorcromene, and hyaluronic acid.
18
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
[69] An anti-leukemia agent is an agent with anti-leukemia activity. For
example, anti-leukemia agents include agents that inhibit or halt the growth
of leukemic or
immature pre-leukemic cells, agents that kill leukemic or pre-leukemic cells,
agents that
increase the susceptibility of leukemic or pre-leukemic cells to other anti-
leukemia agents,
and agents that inhibit metastasis of leukemic cells. In the present
invention, an anti-
leukemia agent may also be an agent with anti-angiogenic activity that
prevents, inhibits,
retards or halts vascularization of tumors.
[70] The expression pattern of a gene can be studied by analyzing the amount
of
gene product produced under various conditions, at specific times, in various
tissues, etc.
A gene is considered to be "over-expressed" when the amount of gene product is
higher
than that found in a normal control, e.g., non-diseased control.
[71] A given cell may express on its surface a protein having a binding site
(or
epitope) for a given antibody, but that binding site may exist in a cryptic
form (e.g., be
sterically hindered or blocked, or lack features needed for binding by the
antibody) in the
cell in a state, which may be called a first stage (stage I). Stage I may be,
e.g., a normal,
healthy, non-diseased status. When the epitope exists in cryptic form, it is
not recognized
by the given antibody, i.e., there is no binding of the antibody to this
epitope or to the
given cell at stage I. However, the epitope may be exposed by, e.g.,
undergoing
modifications itself, or being unblocked because nearby or associated
molecules are
modified or because a region undergoes a conformational change. Examples of
modifications include changes in folding, changes in post-translational
modifications,
changes in phospholipidation, changes in sulfation, changes in glycosylation,
and the like.
Such modifications may occur when the cell enters a different state, which may
be called a
second stage (stage II). Examples of second states, or stages, include
activation,
proliferation, transformation, or in a malignant status. Upon being modified,
the epitope
may then be exposed, and the antibody may bind.
[72] Peptido-mimetics (peptide mimetics) are molecules (e.g., antibodies) that
no longer contain any peptide bonds, i.e., amide bonds, between amino acids;
however, in
the context of the present invention, the term peptide mimetic is intended to
include
molecules that are no longer completely peptidic in nature, such as pseudo-
peptides, semi-
peptides and peptoids. Whether completely or partially non-peptide,
peptidomimetics
19
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
according to this invention provide a spatial arrangement of reactive chemical
moieties
that closely resembles the three-dimensional arrangement of active groups in
the peptide
on which the peptidomimetic is based. These molecules include small molecules,
lipids,
polysaccharides, or conjugates thereof.
ERIEF DESCRIPTION OF THE DRAWINGS
[73] FIG.1 depicts FACS analysis following TM3.13 scFv staining of T-ALL
cells.
[74] FIG. 2 depicts numerical data from Lumiaggregometer analysis of platelet
aggregation in the presence of scFv antibodies as a percent of control
aggregation of either
washed platelets or PRP.
[75] FIG. 3 depicts FAGS analysis comparing binding of various scFv
antibodies to platelets: Fig. 3A is AN51-PE (FSC), Fig. 3B is AN51-PE (FL2-H),
Fig. 3C
is a negative control, Fig. 3D is Y1-myc+, Fig. 3E is Y1, Fig. 3F is L32, and
Fig. 3G is
TMl.l.
[76] FIG. 4 depicts FAGS analyses that compare the ability of scFv antibodies
(NOl, Y1-myc+, and L32) to compete and interfere with the binding of labeled
Y1
antibody to KG-1 cells at different concentrations: Fig. 4A is 0 ng, Fig. 4B
is 100 ng, Fig.
4C is 250 ng, Fig. 4D is 500 ng, Fig. 4E is 1000 ng, Fig. 4F is 2500 ng, and
Fig. 4G is
5000 ng.
[77] FIG. 5 depicts numerical data from FAGS analyses that compare the ability
of scFv antibodies (N01, Y1-myc+, and L32) to compete and interfere with the
binding of
labeled Y1 antibody to KG-1 cells.
[78] FIG. 6 depicts numerical data from ELISA analyses providing comparisons
of the binding of different concentrations of scFv antibodies (TM1.1, Y1-myc+,
Y1, and
L32) to glycocalicin.
[79] FIG. 7 depicts Western analysis of L32 and Y1 scFv antibody binding to
GC, plasma, and membranal proteins from KG-1 and Raji cells.
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
[80] FIG. 8 depicts numerical data from ELISA analyses providing comparisons
of the binding of scFv antibodies (Y1-myc+, TM1.1, and L32) to fibrinogen,
PSGL-l, and
GPIba-related peptides.
[81] FIG. 9 depicts numerical data from FAGS analyses following staining of
platelets with Y17 scFv antibody, in the presence of varying concentrations of
GPIb-
derived peptides. The results are presented as percent reduction in the geo
mean of the
response obtained with the scFv antibody alone.
[82] FIG. 10 depicts numerical data from ELISA analyses following binding of
Yl and Y17 scFv antibody to PSGL1 sulfated at various different positions.
[83] FIG. 11 depicts numerical data from FAGS analyses providing
comparisons of the binding of scFv antibodies (Fig. 1 lA is TMl.l, Fig. 11B is
TM1.3, and
Fig. 11 C is L32) to T-ALL and normal peripheral blood cells (N-PBL) as a
function of the
concentration of each scFv antibody.
[84] FIG.12 depicts numerical data from an ih vivo study of the effects of L32
and Yl scFv antibody administration on livers weights (Fig. 12A) and tumor
prevalence
(Fig. 12B) in a SCID mice-Molt4 cells tumor model.
DETAILED DESCRIPTION OF THE INVENTION
[85] The present invention relates to an antibody or fragment thereof having
binding capabilities of an scFv antibody fragment of SEQ ID NO:1, that binds
PSGL-1.
Thus, these antibodies of the present invention have similar binding affinity
as SEQ ID
NO:1. The scFv fragment of SEQ ID NO:1 has been designated L32. Accordingly,
preferably, an antibody of the present invention is L32. This antibody was
identified by
screening a phage library, which has diversity only in the heavy chain CDR3
regions,
against a leukemia cell to select specific antibodies that recognize leukemia
cell surface
determinants, wherein the specific receptor was not previously known or
characterized.
Using this same method, another antibody, L31, was identified. Athough the
present
invention encompasses many antibodies, L32 will be used hereafter exemplarily.
21
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
[86] Previously, other antibodies that bind to leukemic cells were identified
in
U.S. Application Nos. 10/032,423; 10/032,037; 10/029,988; 10/029,926;
09/751,181; and
60/258,948 and International Application Nos. PCT/USO1/49442 and
PCT/LJSO1/49440
using the same phage library. Specific examples of antibodies disclosed in
these
applications include the Y1 and Y17 antibodies. The antibodies disclosed in
these
applications were discovered to specifically bind to an epitope, found on
proteins of the
hematopoetic cells, which is sulfated at an N-terminal tyrosine and is thought
to be
involved in cell migration, e.g., tumor metastasis.
[87] Both the L32 antibody and the antibodies disclosed in the Y1/Y17
applications bind leukemic cells, although L32 binds to leukemic cells with
approximately
five times greater affinity than Y1. Based on this fact, as well as the fact
that the
antibodies were isolated from a common germ line (DP32), comparison studies
were done
to determine the correlation between their respective binding epitopes. It was
subsequently determined that L32 appears to bind the same sulfated epitope as
Y1/Y17.
As the Y1/Y17 epitope is specifically present on platelets, although it has
been suggested
that the levels of expression are 25-100 fold lower than that of leukocytes
(Frenette et al.,
J. Exp. Med. 191 (8): 1413-22 (2000)), binding of L32 to platelets was also
evaluated.
However, it was found that L32 only negligably binds platelets and, moreover,
does not
affect platelet aggregation. Set forth in Table 1 is a summary of Yl scFv and
IgG as
compared to L32 scFv and IgG.
TABLE 1.
Yl scFv Yl IgG L32 scFv L32 IgG
WBC Binding Low High High Very High
Leukemia CellLove High High Very High
Binding
PSGL-1 Low High High Very High
Reactivity
Competition Somewhat Yes Yes Yes
with KPLl
Platelet BindingHigh High Low-None Low-None
Platelet
Aggregatio Inhibits Induction No Effect -
n
22
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
Yl scFv Yl IgG L32 scFv L32 IgG
GPIb Reactivity Binds Binds Very Low- Very Low-
None None
Plasma Fibrinogen 'y Fibrinogen 'y
Component prime prime Not Detected Very Low-
CCF4 CCF4 None
In. vitro Effect Not Detected ADCC Not Detected ADCC
[88] The sulfated epitopes previously identified as binding to Yl/Y17 are
characterized by the presence of sulfated moieties, such as sulfated tyrosine
residues or
sulfated carbohydrate or lipid moieties, preferably within a cluster of two or
more acidic
amino acids, which are found on ligands and receptors that play important
roles in such
diverse processes as inflammation, immune reactions, infection, autoimmune
reactions,
metastasis, adhesion, thrombosis and/or restenosis, cell rolling, and
aggregation. Such
epitopes are also found on diseased cells, such as B-leukemia cells, B-CLL
cells, AML
cells, multiple myeloma cells, and metastatic cells. These epitopes are useful
targets for
the therapeutic mediation of these processes and for diagnostic or prognostic
procedures,
including staging.
[89] The L32 scFv has enhanced selectivity for sulfated PSGL-1. White cells
involved in inflammation, such as monocytes, neutrophils, and lymphocytes, are
primarily
recruited by the four adhesion molecules, PSGL-l, P-selectin, VLA-4, and VCAM-
1 in
the inflammatory processes of diseases such as atherosclerosis (Huo and Ley,
Acta
Physiol. S'cand., 173: 35-43 (2001); Libby, Sci. Ana. May: 48-55 (2002); Wang
et al., J.
Am. Coll. Cardiol. 38: 577-582 (2001)). L32 interference with any of these
central
molecules may suggest a potential role for L32 in abrogating related diseases.
Specifically, P-selectin controls cell attachment and rolling. Additionally, P-
selectin -
PSGL-1 interactions activate a number of other molecules on cells which are
integrally
connected with tumorigenesis (when concerned with malignant cells) and
inflammatory
responses (when concerned with white blood cells) (Shebuski and Kilgore, J.
Pharnaacol.
Exp. They. 300: 729-735 (2002)). Based on this understanding of P-selectin's
ability to
regulate cellular processes, it is apparent that the enhanced L32 scFv
selectivity for
sulfated PSGL-1 may make it a superior molecule for treating a variety of
malignant and
inflammatory diseases. Moreover, models of malignant disease have shown that P-
23
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
selectin binding to malignant cells requires sulfation of PSGL-1 (Ma and Geng,
J.
Ir~znauyzol. 168: 1690-1696 (2002)). This requirement is similar to that for
L32 binding.
Thus, one can expect that L32 could abrogate P-selectin facilitation of
progressing
malignant disease.
[90] Moreover, it was found for these antibodies of the present invention that
binding is dependent on the stage of development of the cell (AML subtype is
classified
based on the French-American-British system using the morphology observed
under
routine processing and cytochemical staining): the antibodies bind to AML
cells that are of
subtype M3 or above, but not MO or Ml subtype cells. In addition, the
antibodies may or
may not bind M2 subtype cells. Accordingly, the antibodies of the present
invention do
not bind normal, healthy bone marrow (e.g., CD34+ cells). It is thought that
such
differences are based on alterations in PSGL-1 expression and/or sulfation, as
well as
possible conformational changes in PSGL-1 that expose a slightly different
epitope.
[91] Preferably, the L32 antibody of the present invention binds different
molecules or epitopes involved in inflammation, such as PSGL-1. Also
preferably, the
L32 antibody binds to an epitope present on at least one cell type involved in
inflammation
or tumorogenesis, including T-ALL cells, AML cells, and B-leukemia cells.
Further
preferably, the L32 antibody of the present invention binds to epitopes on a
lipid,
carbohydrate, peptide, glycolipid, glycoprotein, lipoprotein, and/or
lipopolysaccharide
molecule. Such epitopes preferably have at least one sulfated moiety.
Alternatively, but
also preferably, the L32 antibody cross-reacts with two or more epitopes, each
epitope
having one or more sulfated tyrosine residues, and at least one cluster of two
or more
acidic amino acids, an example of which is PSGL-1.
[92] Following binding to PSGL-1 present on the surface of a cell, some of
these antibodies or fragment thereof of the present invention may be
internalized into the
cell. Generally, full IgG antibodies are internalized, while smaller antibody
fragments
(such as scFvs) are not internalized. It should be appreciated that the
antibodies can be
internalized into any cell expressing PSGL-l, inlcuding AML cells, for
example. Such
internalization may occur via endocytosis, an active process that is manner,
time and
temperature dependent.
24
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
[93] It is the hypervariable regions of the L32 antibodies of the present
invention that participate in forming the antigen binding sites. The antigen-
binding site is
complementary to the structure of the epitopes to which the antibodies bind,
therefore
these binding sites are referred to as complementarity-determining regions
(CDRs). There
are three CDRs on each light and heavy chain of an antibody (CDRl, CDR2, and
CDR3),
each located on the loops that connect the [3 strands of the VH and VL
domains. The most
variable of these regions is the CDR3 region of the heavy chain. The CDR3
region is
understood to be the most exposed region of the Ig molecule and, as provided
herein, has a
central role in determining the selective and/or specific binding
characteristics observed.
[94] DP32, which is one of the 49 germ lines present in the phage display
library, is the specific germ line of the phage library from which the scFv
antibodies of the
present invention were isolated. Therefore, DP32 provides the antibodies of
the present
invention with at least the heavy and light chain framework variable regions,
light chain
CDRl, CDR2, and CDR3 regions, and/or heavy chain CDRl and CDR2. DP32 also
provides a three-dimensional structure on which the hypervariable regions were
conformed. It is well known that the specificity of an antibody is determined
by its three-
dimensional conformation. Thus, the limitations imposed by DP32 may have a
significant
role in determining the specificity of L32 antibodies. Moreover, DP32 has
various
charged amino acids, which may have a structural role in L32 antibody
recognition.
[95] According to the present invention, CDRs may be inserted into cassettes
to
produce antibodies. A cassette, as applied to polypeptides and as defined in
the present
invention, refers to a given sequence of consecutive amino acids that serves
as a
framework and is considered a single unit and is manipulated as such. Amino
acids can be
replaced, inserted into, removed, or attached at one or both ends. Likewise,
stretches of
amino acids can be replaced, inserted into, removed, or attached at one or
both ends.
[96] The amino acid sequence of the cassette may ostensibly be fixed, whereas
the replaced, inserted, or attached sequence can be highly variable. The
cassette can be
comprised of several domains, each of which encompasses a function crucial to
the final
construct.
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
[97] The cassette of a particular embodiment of the present invention
comprises,
from the N-terminus, framework region 1 (FRl), CDRl, framework region 2 (FR2),
CDR2, framework region 3 (FR3), and framework region 4 (FR4).
[98] In an embodiment of the invention, it is possible to replace distinct
regions
within the cassette. For example, the CDR2 and CDR1 hypervariable regions of
the
cassette may be replaced or modified by non-conservative or, preferably,
conservative
amino acid substitutions.
[99] In a preferred embodiment of the invention, the antibody or fragment
thereof has a heavy and a light chain, and each chain has a first, second, and
third
hypervariable region, which are the CDR3, CDR2, and CDR1 regions,
respectively.
Particularly, a CDR3 region of one chain, either the CDR3 region of the light
chain or,
preferably, the CDR3 region of the heavy chain and, more preferably, both
heavy and light
chain CDR3 regions determine binding selectivity and specificity. Secondarily,
the
binding selectivity and specificity are determined by the CDR2 and CDRl
regions of the
light chain and, preferably, of the heavy chain. The upstream or downstream
regions
flanking the first, second, and/or third hypervariable regions may also
secondarily
influence the binding selectivity and specificity.
[100] In one preferred embodiment of the present invention, at least one
antibody
or fragment thereof has a first hypervariable region (CDR3) of SEQ m N0:2. In
addition,
or alternatively, at least one antibody or fragment thereof has a second
hypervariable
region (CDR2) of SEQ m N0:3. Also, in addition, or alternatively, at least one
antibody
pr fragment thereof has a third hypervariable region (CDRl) of SEQ m N0:4.
More
preferably, at least one antibody or fragment thereof has a first
hypervariable region
(CDR3) of SEQ m N0:2 and a second hypervariable region (CDR2) of SEQ m N0:3
and
a third hypervariable region (CDRl) of SEQ E? N0:4.
[101] In a particularly preferred embodiment, at least one antibody, or
binding
fragment thereof, of the antibody or fragment thereof is an scFv having SEQ m
NO: l .
[102] For all of the amino acid sequences of <_25 amino acid residues
described
and detailed herein (e.g., CDR regions, CDR flanking regions), it is to be
understood and
considered as a further embodiment of the invention that these amino acid
sequences
26
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
include within their scope one or two amino acid substitutions) and that
preferably the
substitutions are conservative amino acid substitutions. For all of the amino
acid
sequences of >25 amino acid residues described and detailed herein, it is to
be understood
and considered as an embodiment of the invention that these amino acid
sequences include
within their scope an amino acid sequence with >- 90% sequence similarity to
the original
sequence (Altschul et al., Nucleic Acids Res. 25: 3389-402 (1997)). Similar or
homologous
amino acids are defined as non-identical amino acids which display similar
properties,
e.g., acidic, basic, aromatic, size, positively or negatively charged,
polarity, non-polarity.
[103] Percent amino acid similarity or homology or sequence similarity is
determined by comparing the amino acid sequences of two different peptides or
polypeptides. Antibody sequences were determined by DNA sequencing. The two
sequences are aligned, usually by use of one of a variety of computer programs
designed
for the purpose, and amino acid residues at each position are compared. Amino
acid
identity or homology is then determined. An algorithm is then applied to
determine the
percentage amino acid similarity. It is generally preferable to compare amino
acid
sequences, due to the greatly increased sensitivity to detection of subtle
relationships
between the peptide, polypeptide or protein molecules. Protein comparison can
take into
account the presence of conservative amino acid substitutions, whereby a
mismatch may
yet yield a positive score if the non-identical amino acid has similar
physical and/or
chemical properties (Altschul et al. (1997), supra).
[104] In an embodiment of the invention, the three hypervariable regions of
each
of the light and heavy chains can be interchanged between the two chains and
among the
three-hypervariable sites within and/or between chains. Moreover, the
sequences of the
hypervariable regions can be altered to span two or more of the CDRs. Also in
framework
variable regions - also so that may only partially be ine 1 CDR
[105] The present invention provides for a peptide or polypeptide having an
antibody or antigen binding fragment thereof, a construct thereof, or a
construct of a
fragment. According to the present invention, antibodies include IgG, IgA,
IgD, IgE, or
IgM antibodies. The IgG class encompasses several sub-classes including IgGI,
IgGa,
IgG3, and IgG4.
27
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
[106] Antibodies may be provided in many forms, such as fragments, complexes,
and multimers. According to the present invention, antibody fragments include
Fv, scFv,
dsFv, Fab, Fab2, and Fd molecules. Smaller antibody fragments, such as
fragments of Fvs
and fragments of Fabs, are also included in the term "fragments", as long as
they retain the
binding characteristics of the original antibody or larger fragment.
Constructs include, for
example, multimers such as diabodies, triabodies, and tetrabodies. The phrases
"antibody,
binding fragment thereof, or complex having an antibody or binding fragment
thereof' and
"antibody or fragment" are intended to encompass all of these molecules, as
well as
derivatives, combinations, modifications, homologs, mimetics, and variants
thereof, unless
it is specified otherwise or indicated otherwise based on context and/or
knowledge in the
art.
[107] It has been established that scFv penetrate tissues and are cleared from
the
blood more rapidly than a full size antibody because they are smaller in size
(Adams et al.,
Br. J. Cancer 77: 1405-12 (1988); Hudson, Curr. Opin. Inzznunol. 11(5): 548-
557 (1999);
Wu et al., Tufnor Targeting 4: 47 (1999)). Thus, scFv are often employed in
diagnostics
involving radioactive labels such as tumor imaging to allow for a more rapid
clearance of
the radioactive label from the body. A number of cancer targeting scFv
multimers have
recently undergone pre-clinical evaluation for in vivo stability and efficacy
(Adams et al.
(1988), supra; Wu (1999), supra).
[108] Typically, scFv monomers are designed with the C-terminal end of the VH
domain tethered by a polypeptide linker to the N-terminal residue of the VL.
Optionally an
inverse orientation is employed: the C-terminal end of the VL domain is
tethered to the N-
terminal residue of VH through a polypeptide linker (Power et al., J. Inzmun.
Meth. 242:
193-204 (2000)). The polypeptide linker is typically around fifteen amino
acids in length.
When the linker is reduced to about three to seven amino acids, the scFvs can
not fold into
a functional Fv domain and instead associate with a second scFv to form a
diabody.
Further reducing the length of the linker to less than three amino acids
forces the scFv
association into trimers or tetramers, depending on the linker length,
composition and Fv
domain orientations. (Powers (2000), supra).
[109] Recently, it has been discovered that multivalent antibody fragments
such
as scFv dimers, trimers, and tetramers often provide higher affinity over the
binding of the
28
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
parent antibody to the target. This higher affinity offers potential
advantages including
improved pharmaco-kinetics for tumor targeting applications. Additionally, in
studying P-
Selectin and its ligand PSGL-1, which are involved in tethering and rolling of
leukocytes,
scientists have concluded that cells expressing dimeric forms of PSGL-1
established more
stable rolling adhesions because of this higher binding affinity. These
adhesions are more
sheer resistant and exhibited less fluctuation in rolling velocities.
(Ramachandran et al.,
PNAS, 98(18): 10166-71 (2001)).
[110] Mulitvalent forms of scFv have been designed and produced by others.
One approach has been to link two scFvs with linkers. Another approach
involves using
disulfide bonds between two scFvs for the linkage. The simplest approach to
production
of dimeric or trimeric Fv was reported by Holliger et al., PNAS 90: 6444-48
(1993) and
Kortt et al., Protein Eng. 10: 423-33~ (1997). One such method was designed to
make
dimers of scFvs by adding a sequence of they FOS and JUN protein region to
form a
leucine zipper between them at the c-terminus of the scFv (Kostelny et al.,
Jlmmunol.
148(5): 1547-53 (1992); De Kruif et al., JBiol Chem. 271(13): 7630-34 (1996)).
Another
method was designed to make tetramers by adding a streptavidin coding sequence
at the c-
terminus of the scFv. Streptavidin is composed of 4 subunits, so when the scFv-
streptavidin is folded, 4 subunits accommodate themselves to form a tetramer
(Kipriyanov
et al., Hum Antibodies H~yb~idomas 6(3): 93-101 (1995)). In yet another
method, to make
dimers, trimers, and tetramers, a free cysteine is introduced in the protein
of interest. A
peptide-based cross linker with variable numbers (2 to 4) of maleimide groups
was used to
cross link the protein of interest to the free cysteines (Cochran et al.,
Immunity 12(3): 241-
50 (2000)).
[111] The greater binding affinity of these multivalent forms may be
beneficial in
diagnostics, prognostics, staging, and therapeutic regimens. For example, a
scFv may be
employed as a blocking agent to bind a target receptor and thus block the
binding of the
"natural" ligand. In such instances, it is desirable to have a higher affinity
association
between the scFv and the receptor to decrease chances for disassociation,
which may
allow an undesirable binding of the natural ligand to the target. In addition,
this higher
affinity may be useful when the target receptors are involved in adhesion and
rolling or
when the target receptors are on cells present in areas of high sheer flow,
such as platelets.
29
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
[112] In this system, the phage library (as described herein above) can be
designed to display scFvs, which can fold into the monovalent form of the Fv
region of an
antibody. Further, and also discussed herein above, the construct is suitable
for bacterial
expression. The genetically engineered scFvs comprise heavy chain and light
chain
variable regions joined by a contiguously encoded 15 amino acid flexible
peptide spacer.
The preferred spacer is (Gly4Ser)3. The length of this spacer, along with its
amino acid,
constituents provides for a nonbulky spacer, which allows the VH and the VL
regions to
fold into a functional Fv domain that provides effective binding to its
target.
[113] Varying the length of the spacers is yet another preferred method of
forming dimers, trimers, and triamers (often referred to in the art as
diabodies, triabodies,
and tetrabodies, respectively). Dimers are formed under conditions where the
spacer
joining the two variable chains of a scFv is shortened to generally 5-12 amino
acid
residues. This shortened spacer prevents the two variable chains from the same
molecule
from folding into a functional Fv domain. Instead, the domains are forced to
pair with
complimentary domains of another molecule to create two binding domains. In a
preferred method, a spacer of only 5 amino acids (Gly4Ser) was used for
diabody
construction. This dimer can be formed from two identical scFvs, or from two
different
populations of scFvs and retain the selective andlor specific enhanced binding
activity of
the parent scFv(s), and/or show increased binding strength or affinity.
[114] In a similar fashion, triabodies are formed under conditions where the
spacer joining the two variable chains of a scFv is shortened to generally
less than 5 amino
acid residues, preventing the two variable chains from the same molecule from
folding
into a functional Fv domain. Instead, three separate scFv molecules associate
to form a
trimer. In a preferred method, triabodies were obtained by completely removing
this
flexible spacer. The triabody can be formed from three identical scFvs, or
from two or
three different populations of scFvs, and retain the selective and/or specif c
enhanced
binding activity of the parent scFv(s), andlor show increased binding strength
or affinity.
[115] Tetrabodies are similarly formed under conditions where the spacer
joining
the two variable chains of a scFv is shortened to generally less than 5 amino
acid residues,
preventing the two variable chains from the same molecule from folding into a
functional
Fv domain. Instead, four separate scFv molecules associate to form a tetramer.
The
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
tetrabody can be formed from four identical scFvs, or from 1 - 4 individual
units from
different populations of scFvs and should retain the selective and/or specific
enhanced
binding activity of the parent scFv(s), and/or show increased binding strength
or affinity.
Whether triabodies or tetrabodies form, under conditions where the spacer is
generally less
than 5 amino acid residues long, depends on the amino acid sequence of the
particular
scFv(s) in the mixture and the reaction conditions.
[116] Once an antibody, fragment, or construct having desired binding
capabilities has been selected and/or developed, it is well within the ability
of one skilled
in the art using the guidance provided herein to produce constructs and
fragments which
retain the characteristics of the original antibody. For example, full
antibody molecules,
Fv fragments, Fab fragments, Fab2 fragments, dimers, trimers, and other
constructs can be
made which retain the desired characteristics of the originally selected or
developed
antibody, fragment, or construct.
[117] If it is desired to substitute amino acids, but still retain the
characteristics of
an antibody or fragment, it is well within the skill in the art to make
conservative amino
acid substitutions. Modifications such as conjugating to various agents may
also be made
to antibodies or fragments without altering their binding characteristics.
Other
modifications, such as those made to produce more stable antibodies or
fragments may
also be made to antibodies or fragments without altering their specificity.
For example,
peptoid modification, semipeptoid modification, cyclic peptide modification, N
terminus
modification, C terminus modification, peptide bond modification, backbone
modification,
and residue modification may be performed. It is also within the ability of
the skilled
worker following the guidance of the present specification to test the
modified antibodies
or fragments to assess whether their binding characteristics have been
changed.
[118] Likewise, it is within the ability of the skilled worker using the
guidance
provided herein to alter the binding characteristics of an antibody, fragment,
or construct
to obtain a molecule with more desirable characteristics. For example, once an
antibody
having desirable properties is identified, random or directed mutagenesis may
be used to
generate variants of the antibody, and those variants may be screened for
desirable
characteristics.
31
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
[119] Using conventional methods known in the art, one of skill would also be
able to determine addition antibodies or fragments thereof that have the
binding
capabilities of the L32 scFv. For example, additional antibodies can be
isolated using the
biopanning methods described herein, wherein the molecule or cell that L32
binds is used
to screen a particular phage display library, particularly a library prepared
from a
leukemia, lymphoma, and myeloma patient.
[120] Antibodies and fragments, according to the present invention, may also
have a tag that may be inserted or attached thereto to aid in the preparation
and
identification thereof, and in diagnostics or prognostics, including staging.
The tag can
later be removed from the molecule. Examples of useful tags include: AUl, AUS,
BTag,
c-myc, FLAG, Glu-Glu, HA, His6, HSV, HTTPHH, IRS, KT3, Protein C, S-TAG~, T7,
V5, and VSV-G (Jarvik and Teliner, Ahh. Rev. Gee., 32, 601-1 ~ (1990). The tag
is
preferably c-myc or I~AK.
[121] ' Antibodies, fragments thereof or constructs thereof, peptides,
polypeptides,
proteins, and fragments and constructs thereof can be produced in either
prokaryotic or
eukaryotic expression systems. Methods for producing antibodies and fragments
in
prokaryotic and eukaryotic systems are well-known in the art.
[122] A eukaryotic cell system, as defined in the present invention and as
discussed herein, refers to an expression system for producing peptides or
polypeptides by
genetic engineering methods, wherein the host cell is a eukaryote. A
eukaryotic
expression system may be a mammalian system, and the peptide or polypeptide
produced
in the mammalian expression system, after purification, is preferably
substantially free of
mammalian contaminants. Other examples of a useful eukaryotic expression
system
include yeast expression systems.
[123] A preferred prokaryotic system for production of the peptide or
polypeptide
of the invention uses E. coli as the host for the expression vector. The
peptide or
polypeptide produced in the E. coli system, after purification, is
substantially free of E.
coli contaminating proteins. Use of a prokaryotic expression system may result
in the
addition of a methionine residue to the N-terminus of some or all of the
sequences
provided for in the present invention. Removal of the N-terminal methionine
residue, after
32
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
peptide or polypeptide production to allow for full expression of the peptide
or
polypeptide, can be performed as is known in the art, one example being with
the use of
Aeromori.as aminopeptidase under suitable conditions (LJ.S. Patent No.
5,763,215).
[124] In a preferred embodiment of the present invention, the process for
producing an antibody or fragment thereof has the steps of (a) providing a
phage display
library; (b) providing a molecule or cell that an antibody or fragment thereof
having the
binding capabilities of an scFv antibody fragment of SEQ m NO:l may bind to;
(c)
panning the phage display library for a phage particle displaying an
oligopeptide or
polypeptide that binds to the molecule or cell; and (d) producing an antibody
or fragment
thereof having at least one antibody or binding fragment thereof having an
antibody or
binding fragment thereof, having the peptide or polypeptide that binds to the
molecule or
cell.
[125] The antibodies and polypeptides of the subject invention can be
complexed
with e.g. associated with, combined, fused, or linked to various
pharmaceutical agents,
such as drugs, toxins, and radioactive isotopes and optionally, with a
pharmaceutically
effective carrier, to form peptide-drug compositions comprising an
antibody/polypeptide
and a pharmaceutical agent having anti-disease and/or anti-cancer activity.
Such
compositions may also be used for diagnostic purposes
[126] Examples of carriers useful in the invention include dextran, HPMA (a
hydrophilic polymer), or any other polymer, such as a hydrophilic polymer, as
well as
derivatives, combinations and modifications thereof. Alternatively, decorated
liposomes
can be used, such as liposomes decorated with scFv Y1 molecules (e.g., Doxil,
a
commercially available liposome containing large amounts of doxorubicin). Such
liposomes can be prepared to contain one or more desired agents and be admixed
with the
antibodies of the present invention to provide a high drug to antibody ratio.
[127] Alternatively, the link between the antibody or fragment thereof and the
agent may be a direct link. A direct link between two or more neighboring
molecules may
be produced via a chemical bond between elements or groups of elements in the
molecules. The chemical bond can be, for example, an ionic bond, a covalent
bond, a
hydrophobic bond, a hydrophilic bond, an electrostatic bond, or a hydrogen
bond. The
bonds can be, for example, amide, carbon-sulfide, peptide, and/or disulfide
bonds. In
33
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
order to attach the the antibody to the agent or linker, amine, carboxy,
hydroxyl, thiol and
ester functional groups may be used, as is known in the art to form covalent
bonds.
[128] The link between the peptide and the agent or between the peptide and
carrier, or between the carrier and agent may be via a linker compound. As
used herein, in
the specification and in the claims, a linker compound is defined as a
compound that joins
two or more moieties. The linker can be straight-chained or branched. A
branched linker
compound may be composed of a double-branch, triple branch, or quadruple or
more
branched compound. Linker compounds useful in the present invention include
those
selected from the group having dicarboxylic acids, malemido hydrazides, PDPH,
carboxylic acid hydrazides, and small peptides.
[129] More specific examples of linker compounds useful, according to the
present invention, include: (a) dicarboxylic acids such as succinic acid,
glutaric acid, and
adipic acid; (b) maleimido hydrazides such as N-[maleimidocaproic acid]
hydrazide, 4-[N-
maleimidomethyl]cyclohexan-1-carboxylhydrazide, and N-[maleimidoundcanoic
acid]
hydrazide; (c) (3-[2-pyridyldithio]propionyl hydrazide); and (d) carboxylic
acid
hydrazides selected from 2-5 carbon atoms, and derivatives, combinations,
modifications,
and analogues thereof.
[130] Linking via direct coupling using small peptide linkers is also useful.
For
example, direct coupling between the free sugar of, for example, the anti-
cancer drug
doxorubicin and a scFv may be accomplished using small peptides. Examples of
small
peptides include AUl, AUS, BTag, c-myc, FLAG, Glu-Glu, HA, His6, HSV, HTTPHH,
IRS, KT3, Protein C, S-TAG~, T7, V5, VSV-G, and KAK.
[131] Antibodies, and fragments thereof, of the present invention may be bound
to, conjugated to, complexed with, or otherwise associated with imaging agents
(also
called indicative markers), such as radioisotopes, and these conjugates can be
used for
diagnostic, prognostic, or staging and imaging purposes. Kits having such
radioisotope-
antibody (or fragment) conjugates are provided.
[132] Examples of radioisotopes useful for diagnostics, prognostics, or
staging
include lllindium,113indium, 99"'rhenium, i°srhenium, lolrhenium,
99"'technetium,
lzl"'tellurium, lzz"'tellurium, lzsmtelluriunm lssthulium, l6~thulium
168thulium lz3iodine,
34
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
i26iodine, l3iiodine, 133iodine, 8lmkrypton, 33xenon, 9°yttrium,
al3bismuth, "bromine,
l8fluorine, 9sruthenium, 9~ruthenium, lo3ruthenium, losruthenium,
1°~mercury, 2°3mercury,
G~gallium, and 68gallium. Preferred radioactive isotopes, are opaque to X-rays
or any
suitable paramagnetic ions.
[133] The indicative marker molecule may also be a fluorescent marker
molecule.
Examples of fluorescent marker molecules include fluorescein, phycoerythrin,
or
rhodamine, or modifications or conjugates thereof.
[134] Antibodies or fragments conjugated to indicative markers may be used to
diagnose, prognose or stage disease states by providing a sample containing a
cell from the
patient and determining whether the antibodies of the present invention bind
to the cell of
the patient, thereby indicating that the patient is at risk for or has the
disease. Moreover,
the present invention also provides a method of purging tumor cells from a
patient by
providing a sample containing cells from the patient and incubating the cells
from the
patient with an antibody of the present invention. Such activities may be
carned out ih
vivo, in vitro, or ex vivo. Where carned out ih vivo or ex vivo, the imaging
agent is
preferably physiologically acceptable in that it does not harm the patient to
an
unacceptable level. Acceptable levels of harm may be determined by clinicians
using such
criteria as the severity of the disease and the availability of other options.
[135] With respect to cancer, staging a disease in a patient generally
involves
determining the classification of the disease based on the size, type,
location, and
invasiveness of the tumor. One classification system to classify cancer by
tumor
characteristics is the "TNM Classification of Malignant Tumours" (6th Edition)
(L.Ii.
Sobin, Ed.), which is incorporated by reference herein and which classifies
stages of
cancer into T, N, and M categories with T describing the primary tumor
according to its
size and location, N describing the regional lymph nodes, and M describing
distant
metastases. In addition, the numbers I, II, III and IV are used to denote the
stages and
each number refers to a possible combination of TNM factors. For example, a
Stage I
breast cancer is defined by the TMN group: T1, N0, MO which mean:Tl - Tumor is
2 cm
or less in diameter, NO - No regional lymph node metastasis, MO - No distant
metastasis.
Another system is used to stage AML, with subtypes of classified based on the
French-
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
American-British system using the morphology observed under routine processing
and
cytochemical staining.
[136] In addition, a recently proposed World Health Organization (WHO) staging
or classification of neoplastic diseases of the hematopoietic and lymphoid
tissues includes
(specifically for AMLs) traditional FAB-type categories of disease, as well as
additional
disease types that correlate with specific cytogenetic findings and AML
associated with
myelodysplasia. Others have also proposed pathologic classifications. For
example, one
proposal specific for AML includes disease types that correlate with specific
cytogenetic
translocations and can be recognized reliably by morphologic evaluation and
immunophenotyping and that incorporate the importance of associated
myelodysplastic
changes. This system would be supported by cytogenetic or molecular genetic
studies and
could be expanded as new recognizable clinicopathologic entities are described
(Arber,
Atn. J. Clih. Pathol. 115(4): 552-60 (2001)).
[137] The present invention provides for a diagnostic, prognostic, or staging
kit
for in vitro analysis of treatment efficacy before, during, or after
treatment, having an
imaging agent having a peptide of the invention linked to an indicative marker
molecule,
or imaging agent. The invention further provides for a method of using the
imaging agent
for diagnostic localization, prognostication of survival, and staging or
imaging of a cancer,
more specifically a tumor, having the following steps: (a) contacting the
cells with the
composition; (b) measuring the radioactivity bound to the cells; and hence (c)
visualizing
the tumor.
[138] Examples of suitable imaging agents include fluorescent dyes, such as
FITC, PE, and the like, and fluorescent proteins, such as green fluorescent
proteins. Other
examples include radioactive molecules and enzymes that react with a substrate
to produce
a recognizable change, such as a color change.
[139] In one example, the imaging agent of the kit is a fluorescent dye, such
as
FITC, and the kit provides for analysis of treatment efficacy of cancers, more
specifically
blood-related cancers, e.g., leukemia, lymphoma, and myeloma. FAGS analysis is
used to
determine the percentage of cells stained by the imaging agent and the
intensity of staining
at each stage of the disease, e.g., upon diagnosis, during treatment, during
remission and
during relapse.
36
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
[140] Antibodies, and fragments thereof, of the present invention may be bound
to, conjugated to, or otherwise associated with anti-cancer agents, anti-
neoplastic agents,
anti-viral agents, anti-metastatic agents, anti-inflammatory agents, anti-
thrombosis agents,
anti-restenosis agents, anti-aggregation agents, anti-autoimmune agents, anti-
adhesion
agents, anti-cardiovascular disease agents, pharmaceutical agents or other
anti-disease
agents. An agent refers to an agent that is useful in the prophylactic
treatment or diagnosis
of a mammal including, but not restricted to, a human, bovine, equine,
porcine, marine,
canine, feline, or any other warm-blooded animal.
[141] Examples of such agents include, but are not limited to, anti-viral
agents
including acyclovir, ganciclovir and zidovudine; anti-thrombosis/restenosis
agents
including cilostazol, dalteparin sodium, reviparin sodium, and aspirin; anti-
inflammatory
agents including zaltoprofen, pranoprofen, droxicam, acetyl salicylic 17,
diclofenac,
ibuprofen, dexibuprofen, sulindac, naproxen, amtolmetin, celecoxib,
indomethacin,
rofecoxib, and nimesulid; anti-autoimmune agents including leflunomide,
denileukin
diftitox, subreum, WinRho SDF, defibrotide, and cyclophosphamide; and anti-
adhesion/anti-aggregation agents including limaprost, clorcromene, and
hyaluronic acid.
[142] Exemplary pharmaceutical agents include the anthracyclines, such as
doxorubicin (adriamycin), daunorubicin (daunomycin), idarubicin, detorubicin,
carminomycin, epirubicin, esorubicin, as well as morpholino and substituted
derivates and
combinations thereof. Further exemplary pharmaceutical agents include cis-
platinum,
taxol, calicheamicin, vincristine, cytarabine (Ara-C), cyclophosphamide,
prednisone,
fludarabine, idarubicin, chlorambucil, interferon alpha, hydroxyurea,
temozolomide,
thalidomide and bleomycin, and derivatives, combinations and modifications
thereof.
[143] Inhibition of growth of a cancer cell includes, for example, (i)
prevention of
cancerous or metastatic growth, (ii) slowing down of the cancerous or
metastatic growth,
(iii) total prevention of the growth process of the cancer cell or the
metastatic process,
while leaving the cell intact and alive, (iv) interfering contact of cancer
cells with the
microenvironment, or (v) killing the cancer cell.
[144] Inhibition of growth of a leukemia cell includes, for example, the (i)
prevention of leukemic or metastatic growth, (ii) slowing down of the leukemic
or
metastatic growth, (iii) the total prevention of the growth process of the
leukemia cell or
37
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
the metastatic process, while leaving the cell intact and alive, (iv)
interfering contact of
cancer cells with the microenviromnent, or (v) killing the leukemia cell.
[145] Examples of anti-disease, anti-cancer, and anti-leukemic agents to which
antibodies and fragments of the present invention may usefully be linked
include toxins,
radioisotopes, and pharmaceuticals.
[146] Examples of toxins include gelonin, Pseudomonas exotoxin (PE), PE40,
PE38, diphtheria toxin, ricin, or derivatives, combinations and modifications
thereof.
[147] Examples of radioisotopes include gamma-emitters, positron-emitters, and
x-ray emitters that may be used for localization and/or therapy, and beta-
emitters and
alpha-emitters that may be used for therapy. The radioisotopes described
previously as
useful for diagnostics, prognostics and staging are also useful for
therapeutics.
[148] Non-limiting examples of anti-cancer or anti-leukemia agents include
anthracyclines such as doxorubicin (adriamycin),.daunorubicin (daunomycin),
idarubicin,
detorubicin, carminomycin, epirubicin, esorubicin, and morpholino and
substituted
derivatives, combinations and modifications thereof. Exemplary pharmaceutical
agents
include cis-platinum, taxol, calicheamicin, vincristine, cytarabine (Ara-C),
cyclophosphamide, prednisone, daunorubicin, idarubicin, fludarabine,
chlorambucil,
interferon alpha, hydroxyurea, temozolomide, thalidomide, and bleomycin, and
derivatives, combinations and modifications thereof. Preferably, the anti-
cancer or anti-
leukemia is doxorubicin, morpholinodoxorubicin, or morpholinodaunorubicin.
[149] In one embodiment, the present invention provides methods of inducing or
activating ADCC by administering the present antibodies. Accordingly, these
antibodies
may activate ADCC and/or stimulate natural killer (NK) cells (e.g. CD56+), T-
cytotoxic
cells (e.g. CD8+), and/or monocytes, which may result in cell lysis.
Generally, following
administration of an antibody comprising an Fc region or portion of the
antibody, said
antibody binds to an Fc receptor (FcR) on effector cells, for example, NK
cells, triggering
the release of perform and granzyme B, which then leads to apoptosis. Various
factors can
affect ADCC, including the type of effector cells involved, cytokines (IL-2
and G-CSF,
for example), incubation time, the number of receptors present on the surface
of the cells,
and antibody affinity.
38
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
[150] In one embodiment, the pharmaceutical compositions of the present
invention have an antibody or fragment thereof with the binding capabilities
of an scFv
antibody fragment of SEQ )D N0:1 and a pharmaceutically acceptable carrier.
The
antibody or fragment thereof can be present in an amount effective to inhibit
or treat cell
rolling, inflammation, infection, auto-immune disease, metastasis, growth
and/or
replication of tumor cells or leukemia cells, or increase in number of tumor
cells in a
patient having a tumor or leukemia cells in a patient having leukemia.
Alternatively, the
antibody or fragment thereof can be present in an amount effective to increase
mortality of
tumor cells or leukemia cells. Also alternatively, the antibody or fragment
thereof can be
present in an amount effective to alter the susceptibility of diseased cells
to damage by
anti-disease agents, tumor cells to damage by anti-cancer agents, or leukemia
cells to
damage by anti-leukemia agents. Further alternatively, the antibody or
fragment thereof
can be present in an amount effective to decrease number of tumor cells in a
patient
having a tumor or leukemia cells in a patient having leukemia.
[151] Antibodies, constructs, conjugates, and fragments of the subject
invention
may be administered to patients in need thereof via any suitable method.
Exemplary
methods include intravenous, intramuscular, subcutaneous, topical,
intratracheal,
intrathecal, intraperitoneal, intralymphatic, nasal, sublingual, oral, rectal,
vaginal,
respiratory, buccal, intradermal, transdermal, or intrapleural administration.
[152] For intravenous administration, the formulation preferably will be
prepared
so that the amount administered to the patient will be an effective amount
from about 0.1
mg to about 1000 mg of the desired composition. More preferably, the amount
administered will be in the range of about lmg to about 500 mg of the desired
composition.
The compositions of the invention are effective over a wide dosage range and
depend on
factors such as the particulars of the disease to be treated, the half life of
the peptide, or
polypeptide-based pharmaceutical composition in the body of the patient,
physical and
chemical characteristics of an agent complexed with the antibody or fragment
thereof and
of the pharmaceutical composition, mode of administration of the
pharmaceutical
composition, particulars of the patient to be treated or diagnosed, as well as
other
parameters deemed important by the treating physician.
39
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
[153] Pharmaceutical composition for oral administration may be in any
suitable
form. Examples include tablets, liquids, emulsions, suspensions, syrups,
pills, caplets, and
capsules. Methods of making pharmaceutical compositions are well known in the
art (See,
e.g., Remington, The Science and Practice of Pharmacy, Alfonso R. Gennaro
(Ed.)
Lippincott, Williams & Wilkins (pub)).
[154] The pharmaceutical composition may also be formulated so as to
facilitate
timed, sustained, pulsed, or continuous release. The pharmaceutical
composition may also
be administered in a device, such as a timed, sustained, pulsed, or continuous
release
device. The pharmaceutical composition for topical administration can be in
any suitable
form, such as creams, ointments, lotions, patches, solutions, suspensions,
lyophilizates,
and gels. Compositions having antibodies, constructs, conjugates, and
fragments of the
subject invention may comprise conventional pharmaceutically acceptable
diluents,
excipients, carriers, and the like. Tablets, pills, caplets, and capsules may
include
conventional excipients such as lactose, staxch, and magnesium steaxate.
Suppositories
may include excipients such as waxes and glycerol. Injectable solutions
comprise sterile
pyrogen-free media such as saline, and may include buffering agents,
stabilizing agents or
preservatives. Conventional enteric coatings may also be used.
[155] The antibody or fragment thereof and pharmaceutical compositions
thereof,
can be used in methods of treating a disease (e.g., treating can include
ameliorating the
effects of a disease, preventing a disease, or inhibiting the progress of a
disease) in patients
in need thereof. Such methods include inhibiting or treating cell rolling,
inflammation,
autoimmune disease, metastasis, growth and/or replication of tumor cells or
leukemia
cells, or increase in number of tumor cells in a patient having a tumor or
leukemia cells in
a patient having leukemia. In addition, such methods include increasing the
mortality rate
of tumor cells or leukemia cells or altering the susceptibility of diseased
cells to damage
by anti-disease agents, tumor cells to damage by anti-cancer agents, or
leukemia cells to
damage by anti-cancer agents. Such methods also include decreasing the number
of tumor
cells in a patient having tumor or leukemia cells in a patient having
leukemia.
[156] The present invention also provides a method of purging tumor cells from
a
patient by providing a sample containing cells from the patient and incubating
the cells
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
from the patient with an antibody of the present invention. In one embodiment,
the
purging occurs ex vivo.
EXAMPLES
[157] The following examples are set forth to aid in understanding and to
further
illustrate the invention, but are not intended and should not be construed to
limit its scope
in any way. Although specific reagents and reaction conditions are described,
modifications can be made that are encompassed by the scope of the invention.
Example 1
[158] The present example demonstrates selection, production, and initial
characterization of L32 scFv antibody fragments. Briefly, a phage display
library
displaying scFv antibody fragments was utilized to obtain and produce
targeting
molecules, and flow cytometry, particularly fluorescence-activated cell
sorting (FACS),
was used for identifying and isolating specific phage clones, the peptide or
polypeptide of
which recognizes target cells. The phage display library used herein was
constructed from
peripheral blood lymphocytes of 49 non-immunized human donors.
[159] Phage clones were selected by and identified through a mufti-step
procedure known as biopanning. Biopanning was carried out by incubating phage
displaying protein ligand variants (a phage display library) with target
cells, removing
unbound phage by a washing technique, and specifically eluting the bound
phage. The
eluted phage clones were optionally amplified before additional cycles of
binding and
optional amplification which enriched the pool of specific sequences in favor
of those
phage clones bearing antibody fragments which best bind to the target. After
several
rounds of panning, individual phage clones were characterized, and the
sequences of the
peptides displayed by the clones were determined by sequencing the
corresponding DNA
of the phage virion.
[160] In the present invention, screening of T-lymphoma cells was carned out
against non-defined epitopes for the initial biopanning steps, with subsequent
clone
selection performed with a desired target cell (e.g., B-leukemia cells, B-CLL
cells, AML
41
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
cells, multiple myeloma cells, and metastatic cells), the targeted cell
surface markers of
which are unknown.
[161] Using the L1 protocol, the L32 scFv antibody clone was discovered by
panning a phage display library on intact T-lymphoma cells. This protocol
began with
prewashing. One ml aliquots containing 2x10 frozen leukemia/lymphoma T cells
from
patients, stored at -70° C, were quick-thawed at 37° C, and
immediately diluted into 10 ml
cold 2% PBS-Milk (MPBS). Cells were spun S' at 120 x g at room temperature
(RT),
washed twice, suspended in MPBS, and counted with a hemocytometer. The scFv
display
phage library (Nissim et al., EMBO J., 13: 692-98 (1994)) was used with the
agreement of
the MRC. The library was originally constructed as a phagemid library
displaying scFv
fragments in which the VH and the VL domains were linked by a flexible
polypeptide. The
scFvs displayed in the phagemid library were fused to the N-terminus of the
minor coat
protein pIII of the phage, which was then subcloned into the pHENl vector.
Repertoires
of antibody fragments were first generated by PCR from rearranged V-genes of
peripheral
blood lymphocytes of unimmunized human (referred to as "naive repertoires").
To
diversify the repertoire, random nucleotide sequences encoding heavy chain
CDR3 lengths
of 4-12 residues were introduced into a bank of 49 cloned human VH gene
segments. The
fused VL fragment in all the clones it derived from was a single unmutated V
gene of
germline IGLV3S1, creating a single pot library of approximately 108 clones.
[162] Selection of the L32 scFv antibody clone was carried out in a final
volume
of 0.5 ml MPBS containing 106 T cells, 1011 Colony Forming Units (CFU) of
phagemids
(Nissim library), and 1013 wild-type bacteriophage M13, with slow agitation
for 1 hr at
4°C. Cell wash was then performed by suspending the cells with MPBS and
centrifuging
at 120 x g at 4° C, as above. The selection + cell wash procedure was
repeated three
times.
[163] After the first round of selection, bound phagemids were eluted from the
T-
lymphoma cells by incubating the cells for 5 rains at RT, with 150 ~,1 of O.1M
glycine, pH
2.2. After neutralization, cells were spun and discarded, and the supernatant
fluid
containing the eluted phage particles was collected and designated E1 stock.
This E1
stock was amplified by the addition of 1 ml of exponentially growing TG-1
cells and
incubating for 30 rains at 37° C. An aliquot was plated for titration
purposes, and the
42
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
remaining volume was plated on large plates (150mm) containing 2xTY/AMP (1.6%
Tryptone, 1% yeast extract, 0.5% NaCI and 100~.g/m1 ampicillin). Plates were
incubated
overnight at 30° C. To determine the output after each round of
panning, colonies on the
titration plate were enumerated, and the total output was calculated.
[164] Fresh bacterial cultures of the bacterial strains TG-1 and HB2151 were
prepared for infection (amplification) by growing the cells to A6oo of 0.5-0.9
(exponentially growing cells). E. coli TG-1 cells were used for phage
propagation and E.
coli HB2151 cells were used for scFv protein production. Colonies from the
large plates
were scraped and pooled. An aliquot (~10~) of ampicillin resistant E. coli TG-
1 cells was
grown in liquid culture to A6oo of ~0.5, then infected with helper phage (VSC-
M13,
Stratagene) to produce a large amplified phagemid stock. Phagemids were
recovered by a
PEG precipitation procedure (Harrison et al., Methods in Enzymology (1996)
267: 83-
109). Approximately 1012 phagemidslml of amplified E1 stock, described above,
was
used for subsequent rounds of panning against T cells.
[165] Second and third rounds of "sequential pannings" were carried out
essentially as described for the first panning procedure with the following
modifications:
(i) for the second sequential panning, 1011 phagemids were used, and (ii)
following
selection and wash, the bound phagemids were eluted by incubating the cells
for 15 mins
at RT, in 50 ~.1 of PBS/1% BSA+ATP (1 OmM). Cells were centrifuged and the
supernatant fluid was collected. The output containing the eluted phagemids
derived from
the second round of this procedure, designated E1AT1, was used for the third
round of
sequential panning, as described above, without amplification. Following ATP
elution, as
in the second round, phagemids were amplified in TG-1 cells, as described
above. The
final amplified stock was designated ElAT2. One aliquot (5 ~,1) was mixed with
TG-1
bacterial culture for infection, titration, and sequence analysis. The
remaining volume
(45,1) was incubated with 1.3 ml TG-1 cell suspension for amplification and
storage.
[166] The estimated number of phagmids used for panning (input) and the
estimated number of bound phagemids eluted (output) are summarized for the
three
consecutive steps of the Ll biopanning protocol in Table 2. The cell source
and elution
medium for each output result is listed, as well as the term used to
distinguish each
separate stock.
43
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
TABLE 2.
Input stock Cell sourceElution Outpu Amplified
t stock
Nissim 1 Acid 33610 E1
'~brary-
0 L homa
Ymp
E1-1011 500 E1AT1*
Lymphoma (lOmM)
ElATl-500 p 37 E1AT2
Lym (lOmM)
oma
* Eluted but not amplified
[167] The results shown in Table 1 indicate that, when ATP elution was used
for
the second and third rounds, the number of eluted phage was very low,
indicating a
possible increase in phage specificity.
[168] Following panning, several clones from each round were selected for
sequencing. The amino acid sequences presented in this section are as follows:
(a) sequences which appeared more than once among the selected clones, (b)
sequences of
the CDR3 region of the heavy chain only (VH-CDR3), and (c) the species of VH
germline
of each isolated clone.
TABLE 3.
VH-CDR3 Outpu Frequen
Clone size VH-CDR3 sequence Germline t cy
Leu Asn Pro Lys Val Lys His
L32 8 Met VH3- ElAT 4/15
DP32 2
(SEQ 1D N0:4)
Leu Arg Gly Gly Asn Ala Met ~3_ ElAT
L31 7 5/15
(SEQ ID NO:S) DP32 2
[169] Two types of clones, L32 and L31, were identified following the L1
biopanning protocol, and their sequences are presented in Table 3. The number
of amino
acid residues in the CDR3 region (VH-CDR3 size) and the specific CDR3
sequences,
together with the germline designation of each clone, are presented. In
addition, the
number of times that a specific clone type was isolated, as a function of the
total number
of clones sequenced for the L1 protocol (frequency), is presented.
Interestingly, although
44
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
the library contained VH from five different VH families (VH1, VH2, VH3, VH4,
and
VH6) with VH3 constituting ~47% of the genes utilized, both isolated clones
are of the
VH3 family (DP32). This is an advantage for the scFv purification process,
since Protein
A Sepharose is used to purify scFvs derived from the VH3 family and cannot be
used to
purify clones derived from VH families other than VH3.
Example 2
[170] The present example describes production of various scFv antibodies used
in comparison studies as controls.
[171] The isolation and characterization of the Y1 and Y17 scFv antibody
clones
is described in detail in U.S. Application Nos. 10/032,423; 10/032,037;
10/029,988;
10/029,926; 09/751,181; and 60/258,948 and International Application Nos.
PCTlLTS01/49442 and PCT/USO1/49440.
[172] In addition, negative control scFv clones were selected. For all binding
experiments, a single clone was picked from the naive library (before
selection). A phage
stock and a soluble scFv, designated N14, were prepared from this clone.
Sequence
analysis indicates that it belongs to the VH4-DP65 gene family. The sequence
of the 11-
mer VH-CDR3 encoded by this clone, designated N14 CDR3, is SEQ ID N0:6. An
additional negative clone, NO1, was used in the binding analysis experiments.
Clone NO1
(reactive to recombinant hepatitis B virus [HBV] particles) belongs to the VH3-
DP35
family, and the sequence of the 9-mer VH-CDR3 encoded by this clone,
designated NO1
CDR3, is SEQ ID N0:7.
[173] The TM scFv antibody clones (below) were isolated using the TM protocol
by panning a phage display library on T-lymphoma cell membranes. In this
protocol,
prewashing of T cells (2x100 was performed as described above in the L1
protocol.
Following prewashing of T cells, selection was carried out on the immobilized
T-
lylnphoma cell membranes by adding 2 ml MPBS containing 1012 phagemids from
the
original Nissim library. The tube was slowly agitated for 30 mins, then
incubated for an
extra 90 minx without agitation (both steps at RT). Excess unbound phagemids
were
removed by decanting the tube contents and washing the tube 10 times with PBS,
0.1%
Tween, followed by 10 washes with PBS. For elution, exponentially growing E.
coli TG-
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
1 cells (2 ml) were added directly to the tube and incubated with slow
agitation at 37° C.
As above, an aliquot was plated for titration, and the remaining volume was
plated for
amplification. In addition, amplification was performed as described in the L1
protocol.
The selection procedure was repeated for two additional rounds, using 1011
phagemids of
the previously amplified stock. The first clone of the amplified stock of the
third panning
procedure, on immobilized T cell membranes, was designated TMl.I-myc+/TM1.1.
Several scFv antibodies were prepared from this clone, in particular TM1.1 and
a variant
thereof with a myc tag (TM1.1-myc+).
[174] In addition to TMl.l-myc+ clone, the following additional clones were
isolated by using the TM protocol. The amplified stock of the third membrane
panning
was used to pan intact T-lymphoma cells. The procedure was carned out
essentially as
described for the L1 protocol above, using 2x10 cells and 101°
phagemids. Following 2
hrs of incubation at 4° C, bound phagemids were eluted from the washed
cell pellet with
50 lCl of Trypsin:EDTA (0.25%:0.05%), then neutralized by the addition of 50
~,1 of FCS.
For titration and amplification, 1 ml of an E. coli TG-1 culture (A6oo = 0.5)
was used. The
amplified stock, designated TM2, was used for an additional round of panning
on T-
lymphoma cells, as above. The final stock was designated TM3. The sequences of
scFv
isolated as a result of following the TM protocol are presented in Table 4.
Finding
activity following FITC labeling of the scFv was also assessed to verify
retention of scFv
specificity (see Example 7). For example, the specificity of TM3.13 binding to
T-ALL
cells was verified by its binding according to FAGS analysis (see FIG. 1).
TABLE 4.
CDR3 Germli Outpu Frequen
Clone size VH-CDR3 sequence ne t cy
TM2.3 7 Leu Thr His Arg Ser Ser VH3- TM2 2/10
Arg
1 DP46
TM2.2 7 Thr Gln Arg Arg Asp Leu VH3- TM2 5110
Gly
3 DP53
TM3.2 7 Lys Arg Val Ser Leu Leu VH3- TM3 1l7
Thr
0 DP70
TM3.1 7 Ser Tyr Arg Arg His Ser VH3- TM3 2/7
Arg
8 DP47
46
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
VH-
CDR3 Germli Outpu Frequen
Clone size VH-CDR3 sequence ne t cy
TM3.1 11 Arg Asp Lys Thr Thr Asn Phe Tyr VH3- TM3 1/7
3 Phe Met Lys DP26
Example 3
[175] The present example demonstrates production, purification, labeling and
characterization of L32 scFv clones
[176] For production of soluble scFv, pHENl, a vector used to construct the
original phagemid library, was designed with an amber stop codon encoded at
the junction
of the scFv gene and the pIII gene. Therefore, when the vectors of selected
clones are
introduced by phagemid infection into E. coli HB2151, which is a non-
suppressor strain,
this system enables production and secretion of soluble scFv into the
bacterial periplasm
(Harrison et al., Methods in Ehzymol. 267: 83-109 (1996)). The scFv is then
readily
retrievable from the culture broth. Soluble scFvs are produced under the
control of the
lacZ promoter (Gilbert and Muller-Hill, PNAS (US) 58: 2415 (1967)), which is
then
induced with IPTG (isopropylthiogalactoside).
[177] A sequence encoding a c-myc tag of 10 amino acids - SEQ ID N0:8 - is
contained in the vector upstream to the amber mutation. The C-terminus of the
expressed
scFv should carry the c-myc tag, which can be detected using mouse anti-myc
tag
antibodies (derived from the European Collection of Cell Culture (ECACC) 9E10-
hybridoma).
[l78] The scFvs of selected clones and of the control clone NO1 all belong to
the
VH3 family, allowing purification on a Protein A affinity column. Periplasmic
fractions
(100-250 ml), from induced cultures of each clone, were prepaxed and incubated
with
Protein A Sepharose beads. The bound scFvs were recovered from the column by
acid
elution (O.1M glycine, pH 3.0), followed by eluate neutralization with Tris,
pH.8Ø The
concentration of the recovered protein was determined by A28o measurement,
followed by
PBS buffer exchange by dialysis or on a G-25 Sepharose column.
47
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
[179] The scFv of a clone L32 derived from the Ll protocol also belongs to the
VH3 gene family (DP-32). However, following extraction from the periplasm, 5
mM
DTT was required and added prior to loading the sample onto the Protein-A
affinity
column, after which purification on and recovery from Protein-A Sepharose
beads and
PBS buffer exchange was performed as described above.
[180j The scFv of the negative clone N14 belongs to the VH4 gene family, which
cannot be purified on a Protein A affinity column, therefore it was purified
on a Sephacryl
S-200 column. ScFv N14 was purified by precipitating the total protein in the
periplasmic
fraction of a 200m1 induced culture using 60% ammonium sulfate. The pellet was
suspended in 2m1 O.IxPBS, SmM EDTA, SmM PMSF and loaded on a Sephacryl S-200
column (1.5 x 90cm) pre-equilibrated with the running buffer (O.IxPBS, SmM
EDTA).
Proteins were fractionated, and fractions containing the N14 scFv (as detected
by SDS-
PAGE and Western analysis) were pooled, lyophilized, and suspended in 1/10
volume
H2O. The N14 scFv (unlabeled and FITC-labeled) was then used as a negative
control in
FACS analysis experiments.
[181] Purified scFvs were then labelled with FITC. Approximately 1 mg of
purified scFv from each preparation was suspended in PBS and coupled to FITC
using a
Fluoro-Tag FITC conjugation commercial kit (Sigma-Aldrich Corp., St. Louis,
MO),
according to the manufacturer's instructions. Following purification and FITC
labeling,
the profile of each preparation (labeled and unlabeled) was analyzed by SDS-
PAGE,
Western blotting, HPLC using a Superdex-75 column (A2go and A49s), and
fluorometry.
The analyses indicated 80% purity of the N14 scFv, and 90% purity for the VH3
clones,
with approximately 2 molecules of FITC conjugated to each scFv molecule (F/P
ratio of
2:1).
Example 4
[182] The present example demonstrates the binding of L32 scFv to washed
platelets and platelet-rich-plasma (PRP) and the effects of L32 scFv on
platelet
aggregation.
48
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
[183] For platelet aggregation studies, blood was collected into a tube
containing
3.8% sodium citrate. PRP was prepared by centrifugation at 250 x g for 10
mins. Platelet
concentrate, in acid-citrate-dextrose (ACD), was obtained from a blood bank.
Platelets
were isolated, washed once with buffer containing ACD, and washed with saline
in a ratio
of 1:7. The platelets were centrifuged at 800 g for 10 min, after each wash,
and were
suspended in Tyrodes solution (2 mM MgCla, 137 mM NaCI, 2.68 mM KC1, 3 mM
NaH2P04, 0.1% glucose, 5 mM Hepes and 0.35% albumin, pH 7.35), and the number
of
cells was counted.
[184] PRP and washed platelets were stirred at 500 rpm at 37° C, in
whole blood,
in a Lumiaggregometer (Chronolog, Havertown, PA). The difference in light
transmission
through the platelet suspension and suspending medium was taken as 100%
aggregation.
The effect of L32 on platelet aggregation was evaluated by addition of
different
concentration of L32 before the addition of agonist, and the effect was
recorded for four
mins (FIG. 2).
[185] An aggregation assay was performed using washed platelets. The reaction
mixture contains 2x108 washed platelets/ml and 4 ~,g/ml of porcine von
Willebrand factor.
After a 3 min. incubation at 37° C, 0.4 mg/ml of ristocetin (an
aggreggation agonist) was
added, and the aggregation response was recorded for 4 wins. The effects of
L32 and
other scFv antibodies on platelet aggregation were evaluated by adding 50
pg/ml of the
scFv before addition of the agonist, and the effect was recorded for 4 wins.
The effect of
L32 on vWF-dependent agglutination of washed platelets was tested in two
samples of
washed platelets (n=2), and normal agglutination (90% agglutination) was
observed in
contrast to abrogation of agglutination by Yl, a scFv with known effects. The
effect of
TM1.1-myc+, isolated using the TM protocol, was also assessed as a control. At
the same
conditions, the Y1 scFv antibody inhibited Ristocitin-induced platelet
aggregation by
~70% (FIG. 2).
[186] For the aggregation assay using PRP, the reaction mixture contains PRP
(2x108 /ml). After 3 mins of incubation at 37° C, 1 mg/ml of ristocetin
(an aggregation
agonist) was added, and aggregation response was recorded for 4 mins. The
difference in
light transmission through the platelet suspension and PPP (plasma poor
platelet) was
taken as 100% aggregation. The effect of L32 on platelet aggregation was
evaluated in
49
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
PRP from three different donors (n=3) by adding 50 ~,g/ml L32 scFv before
addition of the
agonist, and the effect was recorded for 4 mins. Normal aggregation (90%
aggregation)
was observed after the addition of L32 scFv to PRP (FIG. 2). As mentioned
above, the
effect of L32 was compared with those of TM1.1 and Y1. Similar to washed
platelets, Y1
inhibited PRP platelet aggregation by ~70%.
[187] In conclusion, 50 ,ug/ml of clone L32 had no significant inhibitory
effect on
platelet aggregation of washed platelets or PRP.
[188] L32 scFv staining (binding) of platelets was also assessed by FAGS. This
method is useful for measurements based on the intensity of staining by
fluorescent
markers. As indicated in FIG. 3, staining with Yl and Yl-myc+ scFv (a
glycocalicin-
reactive Yl scFv antibody with a c-myc tag) resulted in stained platelets from
PRP. In
contrast, the fluorescent signal following staining of these platelets with
L32 scFv was
relatively unchanged, as compared with the staining with control antibodies
(compare the
histograms in FIG. 3, wherein TM1.1-myc+ is a scFv that does not bind to any
platelet-
associated epitopes).
Example 5
[189] The binding of scFv L32 to various different cell lines was analyzed by
FAGS. Analysis was carned out following three-step staining with (i) L32; (ii)
anti-single
chain antibody; and (iii) anti-Rabbit FITC-labeled antibody. The different
cell lines were
classified according to the ratio of the geo means of the cell population
following L32
binding over that the negative control, as shown in Table 5. Low binding was
assigned to
cells with a ratio of 1, medium binding was assigned to cells with a ratio
within the range
of 1-4, and high binding was assigned to cells with a ratio greater than 4.
TABLE 5.
L32 L32 L32
High Medium Low
I~G-1 Molt-4 Raji
Jurkat Hut78 Daudi
HEL UMUC3
I~562 Namalw
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
L32 L32 L32
High Medium Low
a
CCRF-
CEM
HL60
[190] Competition for the same binding site between Yl and L32 on these cells
by
these single chain antibodies was investigated. In one such experiment,
competition of
unlabeled antibodies for the biotin labeled Y1 (Y1-myc+) to KG-1 cells (a
human cell line
derived from an AML patient) was assessed. The results are shown in FIGS. 4
and 5. As
shown, L32 competes for Yl binding on KG-1 cells similar to the Y1 scFv,
itself. These
results were supported by preliminary radioreceptor assay studies in which L32
scFv
partially displaced the binding of lasl-labeled Yl scFv to KG-1 cells in a
dose-dependent
manner.
[191] The capacity of unlabeled antibodies to compete with biotin-labeled L32
scFv (0.5, 2 or 5 ~,g) in binding to KG-1 cells was assessed in competition
studies. Results
presented in U.S. Application Nos. 10/032,423; 10/032,037; 10/029,988;
10/029,926;
091751,181; and 60/258,948 and International Application Nos. PCT/LTSO1/49442
and
PCT/LTSOl/49440 demonstrate that Y1 and anti-CD162 antibodies compete for
binding to
CD162 antigen. FACS analysis was used to measure labeled antibody binding, and
the
results were expressed as the geometric mean values of binding. These results,
as
summarized in Table 6, demonstrate the concentration dependence of antibody
displacement by Y1 scFv and anti-CD162 antibodies. When the amount of
unlabeled
antibody is much greater than the labeled antibody, more than 70% of the
binding is
displaced by the specific antibodies, while the nonspecific TM1.1 scFv has no
significant
effect on L32 binding. While anti-CD162 had the greatest capacity for
displacing L32 (by
as much as 89%), Y1 and L32 scFv antibodies displaced L32 binding at different
degrees.
Based on the results presented and others, less L32 is required than Y1 to
compete for both
L32 and Y1 binding, suggesting that L32 has greater binding capacity then that
of the Y1
to the same site. Thus, these results further support the specificity of L32
binding and a
51
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
substantial relation between the L32 epitope and those recognized by Yl and
anti-CD162
antibodies.
TABLE 6.
L32 Biotin Concentration
Inhibitor p,g ~g L32-B 2 ~,g L32-B 5 ~g L32-B
Concentration
None 22.65
50 ,ug TM1.1 21.6 28.3 38.32
50 ~g Y1 6.36 12.99 21.99
50 ~.g L32 5.66 9.34 22.58
pg anti-CD162 4.06 3.95 4.4
[192] Competition between L32, Y1, and anti-CD162 antibodies 'was further
assessed by examining the degree of displacement of labeled anti-CD162
antibody binding
to KG-1 cells. Both L32 and Y1 scFv antibodies (50 ~.g) were found to reduce
the
geometric means of anti-CD162 (5 ~,g) labeling of KG-1 cells by approximately
82%.
Thus, the epitopes of these antibodies are apparently closely related.
Example 6
[193] The present example demonstrates L32 scFv antibody binding to
Glycocalicin (GC), a proteolytic fragment of GPIb, by ELISA.
[194] GG was purified from fresh human platelets as described by Michalson
(Blood 67: 19-26 (1986)). Before use in assays, the identity of GPIb was
confirmed by
EIA using two different commercial monoclonal antibody preparations; the first
antibody
(clone H1P1), purchased from Phannigen (San Diego, CA), inhibits ristocetin-
induced
platelet aggregation, and the second antibody preparation (clone PM6/40),
purchased from
Serotec Inc. (Raleigh, NC), does not inhibit platelet aggregation.
[195] Quantitative analysis of binding of L32 to GC was determined by ELISA.
GC diluted to l,ug/ml (PBS X 1) was used to coat Maxisorp plate wells by
overnight
incubation at 4° C. After removing excess GC, the plates were blocked
with PBSTM
(phosphate buffered saline solution containing 2% milk and 0.05% Tween) at RT
for 1 hr.
52
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
After extensive washing with PBST, the plates were incubated with various
concentrations
of scFv diluted in PBSTM. Subsequently, the plates were incubated with anti-
scFv diluted
1:250, or anti-VL 1:50, or anti-myc 1:100, followed by either anti-Rabbit HRP
(Jackson)
diluted 1:25,000 in PBSTM or anti mouse HRP 1:25,000 (as relevant). The
reaction was
developed with TMB and was stopped by the addition of O.SM HaS04. The plates
were
read at 450nm using an ELISA reader, and the results of duplicate samples were
averaged,
with the ELISA unit values calculated by subtracting the background (staining
without a
primary antibody) OD value from the average values. The results depicted in
FIG. 6
indicate that Yl binding to GC is about 3-4 fold greater that that of L32.
Example 7
[196] The present example demonstrates L32 scFv antibody binding to proteins
from various human derived sources by Western blot analysis.
[197] Cell extracts (lysate) were prepared. Cells (2x106) were harvested and
centrifuged in a microcentrifuge (1300 rpm, 4° C, 5 mins). The pellet
was washed with
0.5-1 ml PBS and gentle mixing, and the mixture was centrifuged as before.
Washing
with 0.5-1 ml PBS was repeated, and the pelleted cells were suspended in lysis
buffer
(200u1/20x 106 cell pellet). The lysis buffer used was 50 mM Tris pH 7.4, 1 mm
PMSF
1 % NP-40, and 1 mM EDTA, although other suitable lysis buffers may be used.
The
suspension was incubated for about 60 rains, on ice, and then centrifuged
(3000 rpm, 4° C,
rains). The supernatant was then collected and divided into aliquots.
[198] A crude membrane fraction and extraction of membrane proteins were also
prepared. Twenty volumes of homogenization buffer was added to one volume of
packed
cells. The homogenization buffer contained 2% (w/v) Tween 20, 1 mM MgS04, 2 mM
CaCl2, 150 mM NaCI, and 25 mM Tris-HCI, pH 7.4. The following protease
inhibitors
were also added: 1mM PMSF, 5 ~,g/ml Leupeptin, and 5 ~,g/ml Aprotonin. The
cells were
homogenized using a Potter-Elveh3em homogenizer with a rotating Teflon pestle
(Ultra-Torex) at a rate of three to five strokes. The sample was kept cold
during
homogenization, and then stirred for 1 hr in an ice bath. The sample was
subjected to a
few additional strokes in the homogenizer, and then centrifuged at 3000 g for
30 minx at
4° C. The supernatant was collected and centrifuged at 45000 g (19000
rpm rotor ss-34)
for 1 hr at 4° C. The supernatant from the 45000g centrifugation was
discarded. A
53
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
solution of 50 mM Tris 7.4, 1mM EDTA, 1% NP-40 and protease inhibitors was
added to
the pellet, and the dissolved pellet was put on ice for 1 hr.
[199] Plasma protein samples were prepared after diluting pooled plasma from a
blood bank of healthy individuals 1:10 (v/v) with PBS. The diluted solution
was filtered
through 0.45 ,um membranes, and aliquots were stored frozen (-20° C)
until they were
analyzed. Samples were then run on 10% SDS-PAGE at 140-160 Volts, for 3.5
hours at
Sigma Z37, 503-9 appliance. The electrophoresed samples were transferred in
Tris
Glycine buffer (20% MeOH, 192 mM glycine, 25 mM TRIS, pH 8.3) onto a
nitrocellulose
membrane overnight at 20 Volts at RT.
[200] The nitrocellulose membrane was blocked using 5% skim milk for one hr at
RT. The membrane was then washed 3 times for 5 mins each with 0.05% Tween 20
in
PBS at RT. The membrane was incubated with 5 ~,g/ml Y1-biotin, L32-biotin, or
TM1.1-
biotin in 2% skim milk, in PBS, for one hour at RT. The membrane was then
washed 3
times for 5 mins each with cold 0.05% Tween 20, in PBS, in the cold room
(about 4 to
about 10° ° C). The membrane was then incubated in the cold room
with a 1:1000 dilution
of SAV-HRP (streptavidin-HRP) (at a final concentration of 1 ~,g/ml), in 2%
skim milk,
0.05% Tween. The dilution was carried out at RT (about 25° C), and then
the diluted
SAV-HRP was cooled on ice for 10-15 mins before use. The incubation was
carried out
for 1 hour with gentle shaking.
[201] After the incubation with SAV-HRP, the membrane was washed, as above.
The membrane was then incubated with Super Signal mixture (Pierce) for 5 mins
as
directed in the commercial protocol, then the excess solution was dried. The
membrane
was exposed to X-ray film (Fuji), and the film was developed. The results of
these studies
(FIG. 7) indicate that L32 binds to a protein on leukemia cells with a
molecular weight of
that of PSGL-l, approximately 105kD. In addition, both L32 and Yl react with
the same
bands of GC and I~G-1 cells. However, L32 binding to plasma proteins is much
lower
than Y1, and Raji cell extract was negative to this >100 kDa band.
Example 8
[202] The present example demonstrates comparative binding to sulfated and
non-sulfated peptides to L32 and Y1 by ELISA.
54
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
(203] Sulfated and non-sulfated synthetic peptides based on the likely
epitopes
(amino acids 268 to 285 of GPIb and 1-17 of mature PSGL-1) were prepared and
used to
assess the binding specificity of L32 scFv antibody (ELISA). Sulfated and
nonsulfated
peptides (1 ~,M) were attached to microtiter plates suitable for ELISA
analysis, and
unattached peptides were thoroughly washed before nonspecific binding sites
were
blocked. The plates were incubated with scFv antibodies in the indicated
concentrations
(see FIG. 8) for one hour at RT. The attached scFvs were detected using
polyclonal rabbit
anti-VL antibodies, followed by horse raddish peroxidase (HRP) anti-rabbit
antiserum.
The samples were developed using the substrate TMB, and the peroxidase
reaction was
stopped, after approximately 10 mins, with O.SM HaS04. L32 binding to these
peptides
was compared with that of Y1 and TM1.1 (as a negative control) scFv
antibodies.
Background staining (in the absence of a primary antibody) was subtracted from
each
value to obtain the values presented in the bar graph. The peptides assessed
for binding,
and their essential structural properties are presented in Table 7.
TABLE 7.
Source of Peptidegn ati Sequence ~ Mw Sulfa
Desi do
o
Fibrinogen 'y A VRPEHPAETEYESLYPED 20 2389 -
prime
DL
Fibrinogen'yprimeB VRPEHPAETEY*ESLY*P 20 2549 Sulfated
EDDL
PSGL-1-n-terminusC QATEYEYLDYDFLPETE 17 2126 -
PSGL-1-n-terminusD QATEY*EYLDYDFLPETE 17 2206 Sulfated
PSGL-1-n-terminusE QATEY*EY*LDYDFLPET 17 2286 Sulfated
E
PSGL-1-n-terminusF QATEY*EYLDY*DFLPET 17 2286 Sulfated
E
PSGL-1-n-terminus,G QATEYEY*LDYDFLPETE 17 2286 Sulfated
PSGL-1-n-terminusH QATEYEY*LDY*DFLPET 17 2286 Sulfated
E
PSGL-1-n-terminusI QATEYEYLDY*DFLPETE 17 2286 Sulfated
PSGL-1-n-terminusJ QATEY*EY*LDY*DFLPE 17 2286 Sulfated
TE
GPIba K, Pl GDEGDTDLYDYYPEEDT 18 2126 -
E
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
Source of Peptidegn ati Sequence ~ Mw sulfa
Des'~ do
o
GPlba L, P1S GDEGDTDLY*DY*Y*PEE 18 2366Sulfated
DTE
GPIba P14S GDEGDTDLYDYY*PEED 18 1732Sulfated
TE
GPIba P28S TDLY*DYYPEEDTE 13 1732Sulfated
CCRS M MDYQVSSPIYDINYYTSE 19 2189-
CCRS N MDY*QVSSPIY*DINY*Y 18 2429 Sulfated
TSE
Y* designates sulfated Tyrosines.
[204] Significant, dose-dependent L32 scFv antibody binding was obtained with
peptides F, H, I and J, i.e. PSGL-1-related peptides sulfated at the third
tyrosine residue,
and with L and P28S, i.e., GPIba-related peptides sulfated at the first
tyrosine residue
(FIG. 8). L32 scFv antibody binding to J was very similar to its binding to I.
While
binding to the GPIb-related L (P1S) peptide was significant, it was
nonetheless
comparably lower than that obtained with the PSGL-1- related peptides. Neither
Y1 nor
L32 were found to significantly bind the sulfated PSGL-1-related peptides G
and D
(lacking sulfation at the third residue). Furthermore, neither of Y1 and L32
bound sulfated
(or non-sulfated) peptides related to the Fibrinogen 'y chain. Neither scFv
antibody binds
to the peptides in which the tyrosines are not sulfated, indicating that
sulfation is required
for binding. Moreover, data on the GPIb-related peptide, P28S, suggest that
sulfation of
the first tyrosine is significant for binding to GPIb, while data on the PSGL-
1 peptides I
and J, as compared to E, suggest that sulfation of the third tyrosine is
significant for
binding to PSGL-1. While Y1 and L32 display substantially identical patterns
of binding
behaviour with respect to the sulfated peptides (in this assay), Yl appears to
exhibit higher
affinity binding relative to L32 in each case.
[205] From the above experimental results and the data presented in U.S.
Application Nos. 10/032,423; 10/032,037; 10/029,988; 10/029,926; 09/751,181;
and
60/258,948 and hiternational Application Nos. PCT/LTSO1/49442 and
PCT/USO1/49440, it
was concluded that the epitope for the L32 scFv antibody is located between
amino acids 1
and 17 on mature PSGL-1 in which there is cluster of negatively charged amino
acids.
56
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
[206] PSGL-1, which is a receptor for E, L- and P- selectins, was identified
as a
ligand of the Yl antibody based on competition assays, wherein binding of the
Y1
antibody to KG-1 cells was carned out in the presence of different
commercially available
anti PSGL-1 antibodies. The N-terminal region of PSGL-1 contains sulfated
tyrosine
residues accompanied by a cluster of negatively charged amino acids. (U.S.
Application
Nos. 10/032,423; 10/032,037; 10/029,988; 10/029,926; 09/751,181; and
60/258,948 and
International Application Nos. PCT/LTSO1/49442 and PCT/USO1/49440).
[207] Although the Yl antibody binds to several molecules, such as the
glycocalicin molecule on platelets, fibrinogen-gamma prime, the complement
compound 4
of human plasma, and the PSGL-1 molecule, its affinity to primary leukemia
cells derived
from either AML or multiple myeloma (MM) patients is higher relative to the
previously
mentioned epitopes.
[208] While not wishing to be bound by any particular theory, the greater
relative
affinity of Yl (as compared to that of L32) to sulfated peptides, as compared
to the greater
relative affinity of L32 (as compared to that of Y1) for leukemic cell lines
and malignant
cells, as shown in Examples 10, 16 and 17 below, may be due to factors such as
possible
differences in the conformation or exposure of the pertinent peptide sequences
in the
context of the full native proteins on cells. For example, the peptides used
in the
experiments were linear and did not have secondard and tertiary structure, as
they would
have in their native state. Such differences may not be evident in synthetic
peptides,
which are non-constrained linear peptides. Thus, the potential therapeutic
application of
L32 antibody binding may not be perceptible in the artificial synthetic
peptide system,
which is suggested by the cellular systems.
Example 9
[209] Results in U.S. Application Nos. 10/032,423; 10/032,037; 10/029,988;
10/029,926; 09/751,181; and 60/258,948 and International Application Nos.
PCT/LJSO1/49442 and PCT/US01/49440 have demonstrated that Yl and Y17
antibodies
have similar recognition profiles on platelets. The present example
demonstrates the
effects of GPIb-derived peptide tyrosine sulfation and mutations on Y17 scFv
antibody
binding to washed platelets, and the dependence on tyrosine sulfation for Yl7
binding to
PSGL-1-derived peptides.
57
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
[210] GPIb-derived peptides selected from Table 6 and two additional N-
terminus-abbreviated GPIb-derived peptides with the following sequences were
used in
these studies: P2S - TDLY*DY*Y*PEEDTE and P25S - TDLYDY*Y*PEEDTE
(211] Y17 scFv antibody binding to washed platelets was examined by FAGS as
described in Example 4. The effects of the various peptides on Y17 binding to
platelets
were evaluated by first incubating Yl7 together with the indicated
concentration of
peptide (see FIG. 9), before addition to the platelet preparation.
[212] Of all of the peptides tested, GPIb-derived peptide containing sulfated
tyrosine at position 276 (P28S) caused the greatest inhibition of Y17 binding
to washed
platelets. GPIb-derived peptides, containing amino acid changes were prepared
and tested
to confirm the consensus sequence requirements for Y17 recognition. These
results
suggest that the first sulfated tyrosine is important for Y17 binding to wash
platelets.
However, sulfation of the second Tyrosine apparently does not have a role in
Y17
recognition: The negative charge amino acid residues of Aspartate (D) at
positions 277
and 275 are also important for Y17 binding. The results were similar to those
observed
with Y1.
[213] In order to verify what conditions determine Y17 scFv antibody binding
to
PSGLl, ELISA analysis was done using PSGL1-derived peptides bound to plates.
Five
and 20 ~,g/ml Y17 scFv antibody strongly bound to both PSGLl-derived peptides,
I
containing sulfated tyrosine at the third position and to J that contains
three sulfated
peptides. FIG. 10 indicates that Y17 scFv binding to J was slightly greater
than Yl
binding to J, and both scFvs bound similarly to I. Their binding to I was
greater than their
binding to J. Neither Y1 nor Y17 significantly bound to G (PSGL1 peptide
without
sulfation).
[214] In summary, at the peptide level, all three clones, Y1, Y17, and L32,
have
similar specificity profiles.
58
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
Example 10
[215] The present example demonstrates binding of L32 to primary cells from
normal volunteers and leukemia patients.
[216] All of the procedures for bacterial clone culturing, induction protocol,
scFv
antibody fragment harvesting, and antibody fragment purification were carried
out in
accordance with Harrison et al., (1996), supra. Basically, any two or more
individual scFv
clones can be selected from the Nissim I antibody phage display library in
order to prepare
rabbit derived polyclonal antibodies that recognize any individual scFv
antibody present in
the Nissim library or any IgG or fragment thereof provided that it contains
the same VL or
a fragment thereof.
[217] Polyclonal antibodies were raised against VL derived from scFv antibody
clone (Yl) derived from the Nissim I antibody phage display library. The DNA
fragment
encoding the VL domain of human antibody was PCR-cloned from the Y1 clone (the
identical DNA fragment can be obtained from any other clone in the Nissim T
library
(Nissim et al., (1994), supy~a) or even from the human genome using the same
methodology) with the following synthetic oligonucleotide primers: oligo 5'-
Nde1
(TTTCATATGGAGCTGACTCAGGACCCTGCT) and oligo 3'-EcoRI
(TTTGAATTCCTATTTTGCTTTTGCGGC), After amplification by polymerase chain
reaction (PCR conditions: 94° C 1', 56° C 2', 72° C 2'
x30 then 65° C 5'), the obtained
DNA fragment was digested with NdeI and EcoRI restriction enzymes and cloned
into
NdeI and EcoRI restriction enzyme sites of a pre-digested plasmid, which is an
IPTG
inducible expression vector used for prokaryotic expression of recombinant
proteins in E.
c~li.
[218] E. coli cells were transformed with the ligation mixture, and positive
clones
were selected by PCR amplification using the above oligonucleotide primers.
Cells
harboring this plasmid were grown and induced for expression by IPTG.
Following
induction with IPTG, bacterial cells were harvested by centrifugation after
having been
grown for 16 hours at 22° C, from 1 L of culture. Inclusion bodies were
isolated and
solubilized in guanidine-HCl + DTE and refolded by dilution in a buffer
containing TRIS-
ARGININE-EDTA. After refolding for 48 hrs at 5-10° C, the solution
containing protein
59
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
was dialyzed and concentrated in 20mM Glycine, pH 9. The dialyzed solution
containing
proteins was re-purified using an ionic exchange column, HiTrapQ, and eluted
with a
gradient of NaCI. The main peak was analyzed by SDS-PAGE and by gel
filtration. At
least 10 mg of purified VL were obtained from the original 1-L culture.
[219] Rabbits were then immunized with VL (400mg) in the presence of CFA
(complete Fruend's adjuvant), then by VL (200mg) in the presence of IFA
(incomplete
Fruend's adjuvant) at 2 to 4 week intervals. The titers obtained were low
(1:50-1:100),
probably due to the high homology between the VLS from human and rabbit.
[220] Polyclonal anti-scFv antibodies were used, either directly from the
serum of
the immunized rabbits or after purification on a Protein A-Sepharose column,
to detect
scFv antibody binding to either cells analyzed by FAGS or to various protein
fractions
separated by SDS-PAGE (Western blot analysis).
[221] Generally, one of three FACS analyses was performed to test and confirm
the specificity of the selected clones. A "three-step staining" procedure was
established,
using crude extracts or purified unlabeled seFv, followed by mouse anti-myc
antibodies
and, finally, FITC- or PE-conjugated anti-mouse antibodies. This procedure was
alternatively done using rabbit anti-VL, as the second reagent, followed by
FITC-labeled
anti-rabbit antibodies. FACS analysis of cells, from blood or bone marrow
samples,
requires 5-Sx105 white blood cells, which have been suspended in PBS
containing 1%
BSA. Binding was carned out for 1 hr at 4°C. After each step, cells
were washed and
suspended in PBS containing 1% BSA. After the final staining step, lysis of
red blood
cells was the final step in the assay and was followed by suspending cells in
PBS, then
read by FACS (Becton-Dickinson). Analysis of cells stained by the "two-step
staining"
procedure was done as an alternative to the three-step procedure by first
exposing cells to
either myc- or biotin-labeled primary antibodies and subsequently staining
them with
either FITC-labeled anti-myc antibodies or PE-labeled strepavidin,
respectively. A
procedure for direct cell staining with scFv-FITC was established for
subsequent FACS
analyses. This new method requires only one incubation step for scFv -FITC
labeling. In
addition, the high intrinsic background, due to reactivity of the anti-myc
with normal PBL,
was much lower when scFv-FITC was used for FACS analysis. The results obtained
with
both direct FITC- scFv labeling and "three step staining" were very similar,
indicating that
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
the biological activity of the labeled scFv was not destroyed by the FITC
labeling
procedure. Thus, the labeled scFvs retain binding activity similar to that of
the unlabeled
antibodies.
[222] The FACS protocol was carned out to analyze blood and bone marrow
samples. Samples were provided from hospitals, with informed patient consent.
Initially,
cell samples were stained using the 3-step staining procedure in which
detection of bound
scFv antibodies was accomplished by mouse anti-myc tag antibodies followed by
fluorescently labeled anti-mouse Ig antibodies. In this analysis, the results
of which are
presented in FIG. 11, the test scFvs (TM1.1, TM3.13, and L32 derived from T
cell
pannings) consistently exhibited high levels of binding to T-lymphoma/leukemia
cells, as
compared to normal peripheral blood lymphocytes (N-PBL) . In contrast, B-CLL
cells
exhibited relatively low levels of staining with the scFvs, similar to that
exhibited byN-
PBL (Table 8). When 1/50 scFv dilution was used for FACS analysis, only
background
binding was detected.
TABLE 8.
Cell type ControlL32
T
1.4 40
lymphoma/leukemia
B-CLL 0.2 5
N-PBL** 4.9 5
* Only anti-myc and anti-mouse-FITC were used
** Normal peripheral blood lymphocytes
[223] In subsequent studies, patient whole blood or bone marrow samples (and
samples from normal individuals) were adjusted to 30~,1/tube. Five microliters
of CD33-
APC (for AML) or CD19-APC (for B-CLL) or CD38-APC (for Multiple Myeloma) were
added per tube, and 5 ,ul of CD45-PerCp and 5~,1 of scFv Y1 or control scFv
TMl.l or
CD162-PE (KPLl) were also added per tube. Tubes were incubated 30 mins at
4° C, with
gentle shaking. Excess reagents were washed out by adding 2ml PBS and spinning
for 5
mins at 1200rpm. The supernatant was discarded. In one-step assays, a lysis
step was
then performed. Five hundred microliters of BD Lysine solution was diluted
1:10 with
ddH2O, and 300,1 were added to each patient sample. The samples were vortexed
at high
speed, incubated for 12 mins at 4° C, and washed as above. After
discarding the
61
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
supernatant, 5001 PBS were added. The samples were read with a FACS using
blood
sample acquisition setup according to international standards. For assays
involving two or
three steps, working buffer contained PBS + 1%BSA+ 4.05% sodium azide, and
incubations and washes were done as described above.
[224] For blood samples from normal individuals, analysis was done to
determine
the selectivity of L32 binding to subpopulations of blood cells using FAGS
analysis as
compared to Y1 selectivity. Binding was measured following staining with
labeled second
or third antibodies. There is between-donor variability in both Y1 and L32
binding.
Accordingly, the results representing most of the cases are summarized
qualitatively in
Table 9. L32 scFv binding to granulocytes, lymphocytes, and monocytes was
generally
greater that Y1 scFv binding to these cells. In contrast, L32 scFv binding to
platelets was
similar to the background and generally less than that by Y1 scFv. These
results further
support those presented in Example 6 (see FIG. 2), which describe low effect
on platelet
aggregation in PRP and washed platelet agglutination.
TABLE 9.
Binding Relative
to Negative Control
Cell type Y1 L32
Lymphocyt Background - Low Low+/-
es
Monocytes +/-Low Medium+/++
Granulocyte Low - Medium+ Medium - High++
s
Platelets +/-Low Background-
[225] Scaling is based on the following criteria (this is not an absolute
scale - a
2x ratio might really be translated to several-fold higher binding):
- background staining
+/- up to 2x the ratio of mean flow between negative scFv and tested
scFv
+ 2x - 3x the ratio of mean flow between negative scFv and tested
scFv
++ 4x - 6x the ratio of mean flow between negative scFv and tested
scFv
62
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
+++ 6x - 8x the ratio of mean flow between negative scFv and tested
scFv
++++ >1 Ox the ratio of mean flow between negative scFv and tested scFv
[226] It is important to note that all of the results in this table are
derived using
the two- or three-step staining procedure involving amplification of the
signal. In
addition, when more than one staining step is used, platelets are activated,
and the signal
resulting from a procedure-related effect is amplified. In such procedures,
the labeled
antibody binds to both GPIb and newly exposed PSGL-1 exposed on the activated
platelets.
[227] For blood/bone marrow samples from cancer patients, analysis was done to
determine the selectivity of L32 binding using FACS analysis as compared to Y1
selectivity. Binding was measured as the result of binding by labeled second
antibodies.
The results, as presented in Table 10, indicate that L32 generally binds to
diseased cells to
a greater extent than does Y1. Concomitantly, L32 binding to granulocytes,
lymphocytes,
and monocytes was greater than that of Yl. This increased binding suggests
reduced
interactions with normal cells, which may translate into lower antibody doses
for
treatment.
TABLE 10.
Binding relative to negative control
Disease Cell type ~~ yl --....__....__.._.___.__._..___..__..._L32 _..__._._
AML (4
samples)
Disease Ranged + to +++ ++++
Lymphocytes Ranged + to ++ +++
Granulocytes +/- ++
MM (2
samples)
Disease +++ ++++
Lymphocytes ++ +++
Monocytes ++ +++
Granulocytes ++ +-H-
B-Leukemia (2 samples)
63
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
Binding relative to negative control
Disease Cell type Y1 L32
Disease Ranged - to ++ +
Lymphocytes Ranged + to ++ -H-+
Monocytes +++ ++++
Granulocytes ++ ++++
[228] It should be noted that the commercial CD162-specific monoclonal
antibody, anti-human PSGL1, displaced the binding of L32 in all tested
samples, including
AML, hairy cell leukemia, and B-cell malignancies (e.g. Pre-B-ALL, B-ALL, B-
CLL, B-
PLL, and multiple myeloma).
[229] Full IgG, diabodies, triabodies, and Fab fragments all shared the
specificity
of the scFv antibodies, and anti-CD162 displaced binding of each antibody
form.
Example 11
[230] The present example demonstrates binding of L32 to primary cells from
animals of various species.
[231] The selectivity of L32 binding to subpopulations of blood cells was
assessed for blood samples from animals of various species. Whole blood
samples were
stained with either L32 or Y1 scFv, followed by PE-labeled rabbit anti-scFv (2-
step
staining). The samples were subsequently analyzed by FAGS analysis. The
results, as
presented in Table 1 l, indicate that variation in binding by both antibodies
exists between
species. Nevertheless, Y1 generally stained granulocytes to a greater extent
than L32, and
Yl was generally found to stain platelets, while L32 did not stain them,
indicating that Y1,
indeed, has broader specificity than L32.
TABLE 11.
Binding According to FACS
Analysis
_._._......._.._._.__.______.__..__....._._.___....._._.__.~..__
Species/Cell
population Yl L32
Mouse (Balb/c)
granulocytes +/- -
64
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
Binding According to FAGS
Analysis
Species/Cell
population Y 1 L32
Platelets ++ -
other cell
populations - -
Rat
all cell populations - -
Rabbit
granulocytes + +
other cell
populations - -
Guinea pig
lymphocyte +
Monocyte ++ -
granulocyte ++
Platelet + -
Dog
lymphocytes - -
monocytes ++ +/-
granulocytes + -
Platelets +++ -
Example 12
[232] The present example demonstrates the effects of administration of L32 to
mice bearing malignant cells of human origin.
[233] SLID mice (Jackson) were pretreated with 100mg/kg CTX, and Molt-4 (T
leukemia) cells were inoculated intravenously (i.v.) through the tail vein 5
days after CTX
inj ection. Mice were randomly divided into treatment groups (6 per group),
and they were
treated 5 days later, for three weeks, with PBS, Molt-4, Y1 and two weeks with
L32. The
mice of the Molt-4 group were not treated. On Day 33, the mice were
sacrificed, and their
livers weighed. FIG. 12 demonstrates that the liver weight of mice with Molt-4
growths
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
was doubled, and the tumor prevalence as measured by histology was ~65%.
Treatment
with either Y1 or L32 scFv antibodies substantially reduced the tumor load of
treated
mice.
Example 13
[234] The present example demonstrates construction, expression and
purification of L32 diabodies and triabodies.
[235] The vector pHEN-L32 encoding the original L32 is amplified using PCR
for both the VL and the VH regions, individually. The sense oligonucleotide
and the anti-
sense oligonucleotide are used for the VL PCR reaction. The cDNA product with
the
expected size is purified, sequenced, and digested with restriction enzymes.
The same
procedure is employed to amplify the VH region. The VH PCR product is digested
with
restriction enzymes. A triple ligation procedure into the pHEN vector, pre-
digested, is
employed. The final vector is designated pTria-L32. Following E. coli
transformation,
several clones are picked for further analysis, which includes DNA sequencing,
protein
expression, and extraction from the periplasmic space of the bacteria. SDS-
PAGE under
reducing conditions and Western blot analysis are performed to confirm the
size of the
L32 triabodies.
[236] The pTria-L32 vector is linearized with a restriction enzyme, and
synthetic
complimentary double stranded oligonucleotides are pre-annealed and ligated
into the
restriction site between the L32-heavy and L32-light chains. This new vector
is
designated pDia-L32. As described for the triabodies, the DNA sequence and
protein
expression are confirmed.
[237] Expression in E coli is essentially as described for the scFv L32.
However,
the purification of L32 diabodies and triabodies from the periplasm of the
transformed E.
coli cells is different. The scFv L32 monomer form can be purified on an
affinity column
of Protein-A Sepharose beads. Multimeric forms of L32 are, however,
ineffectually
purified by this procedure, therefore periplasmic proteins extracted from the
bacteria are
precipitated overnight with 60% ammonium sulfate, suspended in H20, and loaded
onto a
Sephacryl-200 (Pharmacia) size exclusion column pre-equilibrated with
O.l.xPBS.
66
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
Fractions are collected and analyzed by HPLC, and separate fractions
containing either the
dimer or timer forms are collected for FITC labeling and FAGS analysis.
Example 14
[238] The present example shows production of L32-cys-kak (cysteine dimer).
[239] One liter of ~,pL-L32-cys-kak bacterial culture was induced for 2-3 hrs
at
42°C. This culture was centrifuged at 5000 RPM for 30 mins and the
pellet suspended in
180 ml of TE (SOmM Tris-HCl pH 7.4, 20mM EDTA), and 8 ml of lysozyme (from a S
mg/ml stock) was added and incubated for 1 hr. Twenty ml of SM NaCl and 25 ml
of
25% Triton were added and incubated for another hour. This mixture was
centrifuged at
13000 RPM for 60 mins at 4° C and the supernatant discarded. The pellet
was suspended
in TE with the aid of a tissuemiser (or homogenizer). This process was
repeated 3 to 4
times until the inclusion bodies (pellet) are gray/light brown in color.
[240] The inclusion bodies were solubilized in 6M Guanidine-HCI, O.1M Tri.s
(pH 7.4), 2 mM EDTA (1.5 grams of inclusion bodies in 10 ml solubilization
buffer
provided ~10 mg/ml soluble protein). This was incubated for at least 4 hrs.
The protein
concentration was measured and brought to a concentration of 10 mg/ml. DTE was
added
to a final concentration of 65 mM and incubated overnight at RT. Re-folding
was initiated
by dilution of 10 ml of protein (drop by drop) to a solution containing 0.5 M
Arginine, 0.1
M Tris pH 8, 2 mM EDTA, 0.9 mM GSSG. The re-folding solution was incubated for
48
hrs at ~10° C. The re-folding solution containing the protein was
dialyzed in a buffer
containing 25 mM Phosphate buffer pH 6, 100 mM Urea, and concentrated to 500
ml.
The concentrated/dialyzed solution was bound to an SP-sepharose column, and
the protein
was eluted by a gradient of NaCI (up to 1M).
Example 15
[241] Production of full L32 IgG antibody and Fabl and F(ab')2 fragments is to
be
performed as follows, as has been done for Yl IgG.
[242] CHO- cells are cultivated in F-12 medium supplemented with 10% fetal
calf serum and 40 ~,glml gentamicin at 37° C, in 5% C02 atmosphere. One
day before
transfection, l-1.5-1x106 cells are seeded on 90mm dishes. The cultures are co-
transfected
67
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
with 10 ~,g of DNA encoding for the light and heavy chains of the L32
antibody.
Transfection is carried out with the FuGene (Roche) transfection reagent
technique. After
2 days of growth in nonselective growth media, the cells are cultured for 10-
12 days in F-
12 medium containing 550 ~.g/ml neomycin and 3 pg/ml puromycin. The cells are
trypsinized and cloned by limiting dilution of 0.5 cell/well in Costar 96-well
plastic plates.
Individual colonies are picked, grown in six-well dishes and transferred to
flasks for
further selection (to determine level of expression and antibody secretion to
the growth
media).
[243] CHO- cells are cultivated in F-12 medium supplemented with 10% fetal
calf serum and 40 ~,g/ml gentamicin at 37° C in 5% COZ atmosphere. One
day before
transfection 0.8-1x106 cells are seeded on 90mm dishes. The cultures are
transfected with
~.g of DNA encoding for the light and heavy chains of the L32 antibody cloned
under
the CMV (cytomegalo virus) promoter and the dhfr gene under the sv-40
promoter.
Transfection is carried out using the FuGene (Roche) transfection reagent
technique.
After 2 days of growth in nonselective grov~~th media, the cells are cultured
in a media
containing 100nM-5 ,uM of methotrexate (MTX) and dialyzed fetal calf serum in
order to
select for clones (after limiting dilution) that express increased levels of
the full L32
antibody.
[244] A sandwich ELISA assay is established to determine the antibody
concentration that is secreted into the supernatant of transfected CHO cells.
In order to
quantify the antibody concentration, the following reagents are used: a
monoclonal anti-
human IgGl (Fc) (Sigma) as the coated antibody, a goat anti-human IgG ('y
chain specific)
biotin conjugate as the detector (Sigma), and a purified human IgGl, lambda
(Sigma) as
standard.
[245] Cells are grown in roller bottles to a final concentration of 1-2x10$
cells per
bottle in F-12 medium supplemented with 10% fetal calf serum, neomycin and
puromycin
(as indicated above). For antibody production, cells are cultured in the same
medium, but
with 2% of fetal calf serum for additional two days. The secreted antibody is
purified on a
protein G sepharose column (Pharmacia) and ion exchange colmnn-Q sepharose
(Pharmacia). Binding is in 20mM sodium phosphate buffer pH 7.0, while elution
is in
68
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
0.1M glycine buffer, pH 2.5-3Ø The quantity of the purified antibody is
determined by
UV absorbance and ELISA, while its purity is analyzed by SDS-PAGE and HPLC.
[246] Fragmentation of L32 IgG into Fabi and F(ab')~. Initially, monovalent
and
divalent antibody fragments are prepared by using immobilized Ficin (Pierce).
Ficin
cleavage produces F(ab')~ fragments in the presence of 1mM cysteine.
Similarly, by
increasing the concentration of cysteine activator in the digestion buffer to
lOmM, Fab
fragments can be created from the original IgG. After digestion, the fragments
are
purified on an immobilized Protein A column. The F(ab')2 and Fabl fragments
are
concentrated using a microconcentrator with either a 10,000 or 30,000 Dalton
molecular
weight cutoff. Protein recovery is determined using absorbance at 280 nm.
Fragment
purity is determined using gel electrophoresis.
[247] Further, 10 mg of purified L32 antibody is applied to a 0.5 ml of
immobilized Papain slurry in digestion buffer at 37° C, for 16 hrs.
Reaction is terminated
by eluting the digest with 1.5 ml of binding buffer. Separation of Fabl from
undigested
IgG and Fc fragments is done using Protein A column with Binding buffer. The
Fabl is
contained in the flow through. By reading the absorbance at 280nm, the peak
fractions
containing the fragments are pooled, concentrated and dialyzed against PBS, pH
7.4,
overnight. Protein recovery, purity and characterization is determined by
absorbance at
280nm and gel electrophoresis.
Example 16
[248] The effect of scFv L32 on the binding of scFv Y1 (Table 11) or IgG Y1
(Table 12) antibodies to ML2 cells was assessed by competition assays using
FACS
analysis.
[249] One microgram of competing antibody (L32 scFv, Y1 scFv (P03), KPL-1
or control N06 scFv) was added to ML2 cells (0.5 x 106 cells per assay). After
30 minutes
of incubation, Y1-PE labeled scFv or IgG was added for an additional 30
minutes of
incubation at 37° C. Post incubation the samples were washed once with
FACS buffer and
analyzed.
69
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
[250] The results are given in Geo mean number as a median average of two
duplicate tubes analyzed. Geo mean value is an exponential and not linear
expression of
binding affinity.
[251] The results shown in Table 12 indicate that L32 scFv effectively
inhibits
(by about 80%) binding of scFv Y1-PE to ML2 cells, i.e., L32 scFv inhibits in
a manner
similar to Y1 scFv. In contrast, the non-related negative control antibody
scFv N06
inhibits the binding by only 20%.
TABLE 12.
Sample Median Percent Inhibition
Control 5 -
KPL-1-PE 700 -
Y1-PE 240 -
Y1 PE + N06 190 20
Yl PE + P03 48 80
Y1-PE + L32 40 83
TABLE 13.
Median Percent
Inhibition
Sample ~ ~T~~~ ~~~T500ng~~~ 1000ng~~~ ~200ng~~--~~ ~~ -~~~1000ng-
200ng - ~~~~500ng
Control 3 ND ND - ND ND
Y1 12.5 ND Nib - ND ND
Y1-PE + Y1 3 ND ND 100% ND ND
Y1-PE + KPL-1 2 ND ND 100% ND ND
Y1 PE + P03 7.5 6 5 40% 52% 60%
Y1-PE + L32 5.5 3.8 3.7 54% 79% 80%
ND=not done
since complete
inhibition
achieved at
lower concentration.
[252] The results shown in Table 13 indicate that while IgG Y1 alone (final
concentration 200 ng) bound to the cells with a Geo Mean of 12.5, competition
with 200
ng of either "cold" IgG Y1 or KPL-1 (commercially available marine monoclonal
antibody against PSGL1) reduced the Geo Means of.IgG Y1 binding to 3 and 2
respectively. The binding of IgG Yl to ML2 cells was inhibited (competed) by
the scFv
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
Y1 antibody in a dose dependent manner, i.e., 200 ng of scFv Y1 antibody
reduced the
binding of IgG Y1 to a Geo Mean of 7.5 while1000 ng reduced it to a Geo Mean
of 5. The
binding of IgG Y1 to ML2 cells was also inhibited (competed) by the scFv L32
antibody
in a dose dependent manner, but to an even greater extent than that exerted by
scFv Y1,
i.e., 200 ng of scFv L32 antibody reduced the binding of IgG Y1 to a Geo Mean
of S.5
while1000 ng reduced it to a Geo Mean of 3.7.
[253] While both scFv Yl and scFv L32 inhibited the binding of IgG Yl to ML2
cells, at identical antibody concentrations, inhibition exerted by scFv L32 is
more
pronounced than that exerted by scFv Yl. Moreover, both IgG antibodies tested
(IgG Y1
and KPL-1) have higher affinity to the ML2 cells relative to the two scFv
antibodies tested
as they reduce the Geo Mean of IgG Y1 binding to a Geo Mean of 3 and 2
respectively.
Examule 17
[254] The present example demonstrates binding of L32 to various
subpopulations of blood cells, including both normal (Table 14) and diseased
cells (Table
15), using FAGS analysis.
[255] First, analysis was carried out to determine the selectivity of L32 scFv
binding to CD34+ precursor cells, isolated from normal human bone marrow (NBM)
samples, as compared to Y1 scFv. Binding was measured following staining with
labeled
antibodies (anti-scFv-PE). Each NBM sample was tested with both antibodies in
identical assays.
[256] The criteria used to evaluate binding axe as follows:
Geo Mean (GM) below 10 - Negative
Geo Mean (GM) between 11 and 20 - Low Affinity Binding
Geo Mean (GM) between 21 and 40 - Medium Affinity Binding
Geo Mean (GM) between 41 and above - High Affinity Binding
[257] As shown in Table 14, of 32 NBM samples tested, 24 (75%) did not bind
either L32 or Y1. Six samples (19%) showed low affinity binding for L32, 1
(3%) showed
medium affinity binding for L32, and 1 (3%) showed medium affinity binding for
both
L32 and Yl. Overall, the binding profiles of L32 and Yl to CD34+ cells were
similar.
71
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
TABLE 14.
Number Code P03 L32 Number Code P03 L32
Nl 105351 neg.neg. N17 AHSBM24 neg.neg.
N2 AH/NBMOl neg.13 N18 AHJBM26 neg.neg.
N3 AH/NBM03 neg.neg. N19 AHSBM27 9.6 22
N4 AH/NBM04 neg.neg. N20 AHSBM28 neg.17
NS KBM33 neg.14 N21 AHJBM31 26 28
N6 AH/NBM08 neg.neg. N22 AHJBM36 neg.neg.
N7 AH/NBM09 10 13 N23 AHJBM37 neg.neg.
N8 AH/NBM10 10 14 N24 AHJBM38 neg.neg.
N9 AH/NBM11 neg.neg. N25 AHJBM39 neg.neg.
N10 AH/NBM12 neg.neg. N26 AHJBM40 neg.neg.
Nll AH/NBM13 neg.neg. N27 AHJBM41 neg.neg.
N12 105377 neg.neg. N28 AHJBM42 neg.neg.
N13 AHlNBMI4 neg.neg. N29 AHJBM43 neg.neg.
N14 AH/NBM20 9 16 N30 AHJBM44 neg.neg.
N15 AH/NBM22 neg.neg. N31 AHJBM45 neg.neg.
N16 AH/NBM23 neg.neg. N32 102546 neg.neg.
The numbers
in the table
represent
the geometric
mean of
the sample
[258] In addition, comparative FACS analysis of binding of L32 scFv and Yl
scFv (P03) to human primary leukemia cells (AML, MM, B-CLL, and B-ALL)
isolated
from patient's blood samples was carned out. The binding of L32 was compared
to that of
the Yl in the same samples in identical assays. The binding criteria are as
set forth
immediately above.
[259] Table 15 shows the data obtained from all of the patient samples tested,
and
Table 16 summarizes the affinity data for L32 and Y1 affinity in AML and B-CLL
samples.
TABLE 15.
Cell Population
Lymphocy Monocyt Granulocyt
Code Type Disease to a a
Binding of L32 to Leukemia Patients
72
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
Cell
Population
Lymphocy
Monocyt
Granulocyt
Code Type Diseaseto a a
1 42824 AML/M2 53/100068 - -
2 42841 AML/M4 330 123 900a 280
3 42868 AML/M2 43 120 1000 345
4 42873 AML/M4 24 94 - 80
42874 AML/M4 negative73 35 negative
6 42902 AML/M6 26 78 - -
7 42933 AML/MS 200 18
8 42939 AML/M2 57 110 - 160
9 42946 AML/MO negative98 - -
80298 AML/MO 23 260 - -
12 89849 AML/M4 470 260 - 340
13 I~AM095RAEB 30 83 - 240
14 85440-7AML/M3 200 140 - -
AML/M
1 /M
80376 2 102 65 295 186
16 KAM096 AML/M2 36 41 - -
Relapse
17 KAM108 AML 943 143 360 280
18 KAM109 AML/MS 91 18 - 38
19 I~MM097MM 100 27 - -
42934 MM 650 130 560 150
21 42938 MM S50 110 360 160
Plasmacyto
22 I~PC105ma 340 330 - 280
23 I~BC098B-CLL 37 154 - 240
24 KBC100 B-CLL 10 46 - 68
KBC101 B-CLL negative4140 280 190
26 I~BC102B-CLL negative- - 110
27 KBC103 B-CLL 13 46 300 230
28 KBC104 B-CLL negative460 260 negative
29 KBC105 B-CLL 70 250 - 260
KBC106 B-CLL negative68 200 140
73
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
Cell Population
Lymphocy
Monocyt
Granulocyt
Code Type Diseaseto a a
31 I~BC107B-CLL 17 165 420 270
32 83093-7B-ALL negative41 490 90
33 8313-0 B-ALL negative26 - 100
Binding
of
Yl
scFv
to
Leukemia
Patients
1 42824 AML/M2 neg./87150
2 42841 AML/M4 125 59 2702 126
3 42868 AML/M2 15 53 100 180
4 42873 AML/M4 12 38 - 43
42874 AML/M4 negative36 30 negative
6 42902 AML/M6 19 24 - -
7 42933 AML/1VI5 62 10
8 42939 AML/M2 8 18 - 51
9 42946 AML/MO negative27 - -
80298 AML/MO negative43
12 89849 AML/M4 230 160 - 225
13 KAM095 RAEB 12 20 - 74
14 85440-7AML/M3 95 43
80376 AML/M1/M
29 18 100 63
16 KAM096 AML/M2 17 15 - -
KAM108 Relapse
1 1
0
17 ~L 5 20 110 2
18 KAM109 AML/MS 40 14 - 18
19 KMM097 MM 70 13 - -
42934 MM 170 30 160 50
21 42938 MM 184 30 128 68
~C105 Plasmacyto
22 117 116 - 100
ma
23 KBC098 B-CLL 21 70 - 140
24 I~BC100B-CLL 19 17 - 27
KBC101 B-CLL negative429 84 47
26 KBC102 B-CLL negative- - 60
27 KBC103 B-CLL negative20 86 110
74
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
Cell Population
Lymphocy Monocyt Granulocyt
Code Type Disease to a a
28 KBC104 B-CLL negative'' 10 84 negative
29 KBC105 B-CLL 46 117 - 133
30 I~BC106 B-CLL negative 41 98 65
31 KBC107 B-CLL 9.5 79 126
32 83093-7 B-ALL negative
33 8313-0 B-ALL negative
1 Two disease populations
2 Of the disease cells
3 Peripheral blood contains 2.5% CD34+ cells
4 The cells are CD19+/CD5-
[260] Of the seventeen AML samples tested, fifteen (88%) were positive for
binding by L32 with ten samples (59%) showing high affinity binding (avr. Geo
mean
165) and five samples (29%) showing medium affinity binding (avr. Geo mean
28).
Thirteen (76%) of the AML samples were also positive for Yl binding, but
comparative
analysis (Table 16) indicates that L32 average binding affinity is always
markedly higher
than that of Y1 in the same sample population. In general, about 50% of AML
patient
samples at stage M2 exhibit binding by both L32 and Yl. At stage M3 and
greater, about
90% of samples bind both antbodies, with varying degrees of affinity (data not
shown).
[261] Of the nine B-CLL samples tested, four (44%) were positive for binding
by
L32 with one sample (11%) showing high afininty binding (Geo mean 70), one
sample
(11 %) showing medium afininty binding (Geo mean 37) and two samples (22%)
showing
low affinity binding (avr. Geo mean 15). Three (33%) of the B-CLL samples
tested were
also positive for Y1 binding, but comparative analysis (Table 16) indicates
that L32
average binding affinity is always markedly higher than that of Y1 in the same
sample
population.
[262] Of the four MM and plastmacytoma samples tested, all showed high
afininty binding to both L32 and Y1, but affinity of L32 was greater than that
of Y1 (avr.
Geo mean 410 vs. avr. Geo mean 135, respectively). Of the two B-ALL samples
tested,
both were negative for binding of both L32 and Yl .
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
TABLE 16.
AML B-CLL
_
..._.............._........_...._.___....._._..._......_..__._._...__...._.....
_.._....._.__....____..__...___..._....___..._..._...___
L32 Y1 L32 Y1
High Geo Mean
Disease 165 61 70 46
Lymphocyt 117 50 107 42
es
Monocytes 638 145 323 58
Granulocyte 239 110 169 70
s
Medium Geo Mean
Disease 28 12 37 21
Lymphocyt 41 15 26 9
es
Monocytes 35 30 Neg. Neg.
Granulocyte Neg. Neg. Neg. Neg.
s
Low Geo Mean
Disease None None 13 9
Lymphocyt 18 12 Neg. Neg.
es
Monocytes Neg. Neg. Neg. Neg.
Granulocyte Neg. Neg. Neg. Neg.
s
* The numbers are average
Geo Means based on the
results depicted in Table
14. High,
medum and low affinity to L32
group was determined data.
according
[263] The results in Tables 15 and 16 clearly indicate that in the diseased
population as well as in the other mature subpopulations (lymphocytes,
monocytes and
granulocytes) in primary AML and B-CLL blood samples L32 antibody binding is
always
markedly higher than that of Y1.
76
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
Sequence Listing.txt
SEQUENCE LISTING
<1l0> Bio-Technology General Corp
<120> L32 ANTIBODIES AND USES THEREOF
<130> 10793/63
<140> 10/189,032
<141> 07/01/2002
<160> 8
<170> FastSEQ for Windows Version 3.0
<210> 1
<211> 280
<212> PRT
<213> Homo sapiens
<400> L
Met Lys Tyr Leu Leu Pro Thr Ala Ala Ala Gly Leu Leu Leu Leu
10 15
Ala Ala G1n Pro Ala Met Ala Glu Val Gln Leu Val Glu Ser Gly
20 25 30
Gly GIy Val Val Arg Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala
35 40 45
Ala Ser Gly Phe Thr Phe Asp Leu Asn Pro Lys Val Lys His Met
50 55 60
Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Gly
65 70 75
Ile~Asn Trp Asn Gly Gly Ser Thr Gly Tyr Ala Asp Ser Val Lys
80 85 90
Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr
95 100 105
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr
110 115 120
Cys Ala Arg Met Arg Ala Pro Val Ile Trp G1y Gln Gly Thr Leu
125 130 135
Val Thr val Ser Arg Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser
140 245 150
Page 1
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
Sequence Listing.txt
Gly Gly Gly Gly Ser Ser Glu Leu Thr Gln Asp Pra Ala Val Ser
155 160 165
Val Ala Leu Gly Gln Thr Val Arg Ile Thr Cys Gln Gly Asp Ser
170 175 180
Leu Arg Ser Tyr Tyr Ala Ser Trp Tyr Gln Gln Lys Pro Gly Gln
185 190 l95
Ala Pro VaI Leu Val Ile Tyr Gly Lys Asn Asn Arg Pro Ser Gly
200 205 210
Ile Pro Asp Arg Phe Ser GIy Ser Ser Ser Gly Asn Thr Ala Ser
215 220 225
Leu Thr Ile Thr Gly Ala Gln Ala Glu Asp Glu Ala Asp Tyr Tyr
230 235 240
Cys Asn Ser Arg Asp Ser Ser Gly Asn His Val Val Phe Gly Gly
245 250 255
Gly Thr Lys Leu Thr Val Leu Gly Ala Ala Ala Glu Gln Lys Leu
260 265 270
Ile Ser Glu Glu Asp Leu Asn GIy Ala Ala
275
<210> 2
<211> 6
<212> PRT
<213> Homo sapiens
<400> 2
Met Arg Ala Pro Val Ile
<210> 3
<211> 16
<212> PRT
<213> Homo sapieris
<400> 3
Gly Ile Asn Trp Asn Gly Gly Ser Thr Gly Tyr Ala Asp Ser Val Lys
5 . 10 15
Page 2
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
Sequence Listing.txt
<210> 4
<211> 8
<212> PRT
<213> Homo Sapiens
<400> 4
Leu'Asn Pro Lys Val Lys His Met
<210> 5
<211> ?
<212> PRT
<213> Homo sapiens
<400> 5
Leu Arg Gly Gly Asn Ala Met
5
<210> 6~
<21I> 11
<212> PRT
<213> Homo Sapiens
<400> 6
Phe Leu Thr Tyr~Asn Ser Tyr Glu Val Pro Thr
5 10
<210> ?
<211> 9
<212> PRT
<213> Homo Sapiens
<400> ?
Thr Asn Trp Tyr Leu Arg Pro Leu Asn
5
Page 3
CA 02491363 2004-12-30
WO 2004/003166 PCT/US2003/020602
Sequence Listing.txt
<210> 8
<211> 10
<212> PRT
<213> Homo sapiens
<400> 8
Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu
Page 4
