Note: Descriptions are shown in the official language in which they were submitted.
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
MUTANTS OF IgE PROTEINS AND USES THEREOF
FIELD OF THE INVENTION
The present invention relates to mutant immunoglobulin epsilon (IgE) proteins
and three-dimensional models of such proteins. The invention also relates to
the use of
the mutant proteins to identify compounds useful in the prevention and
treatment of
allergy and the regulation of immune responses in an animal.
BACKGROUND OF THE INVENTION
Antibody Fc-receptors (FcRs) play an important role in the immune response by
coupling the specificity of secreted antibodies to a variety of cells of the
immune system.
A number of cell types, including macrophages, mast cells, eosinophils, and
basophils,
express membrane-bound FcRs on their surfaces. The binding of allergen-bound
antibodies to FcRs provides antigen-specificity to these cells, which upon
activation
release further cell-specific mediators of the immune response, such as
interleukins,
initiators of inflammation, leukotrienes, prostaglandins, histamines, or
cytotoxic proteins.
The adoptive specificity of the FcRs allows a combinatorial approach to
pathogen
elimination, by coupling the diversity of antibody antigen-recognition sites
to the variety
of cell-types expressing these receptors.
FcR-initiated mechanisms are important in normal immunity to infectious
disease
as well as in allergies, antibody-mediated tumor recognition, autoimmune
diseases, and
other diseases in which immune responses are abnormal (i.e., not properly
regulated).
Recent experiments with transgenic mice have demonstrated that the FcRs
control key
steps in the immune response, including antibody-directed cellular
cytotoxicity and
inflammatory cascades associated with the formation of immune complexes; see,
for
example, Ravetch et al., 1998, Ayanu Rev Imfnunolo 16, 421-432. Receptors that
bind IgG
(FcgRI, FegRII, and FcgRIII, known collectively as FcgRs) mediate a variety of
inflammatory reactions, regulate B-cell activation, and also trigger
hypersensitivity
reactions. The high affinity Fc epsilon receptor (also known as the IgE
receptor or FceRI)
is associated with the activation of mast cells and the triggering of allergic
reactions and
anaphylactic shocle. Knockout mice for the FceRI alpha chain (FceRIa) are
unable to
mount IgE-mediated anaphylaxis (see for example, Dombrowicz et al., 1993, Cell
75,
969-976), although FcgRs are still able to activate mast cells (see, for
example,
Dombrowicz et al., 1997, J. Cli~z. Invest. 99, 915-925; Oettgen et al., 1994,
Nature 370,
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
367-370). FceRI has also been shown to trigger anti-parasitic reactions from
platelets and
eosinophils as well as deliver antigen into the MHC class II presentation
pathway for the
activation of T cells; see, for example, Gounni et al., 1994, Nature 367, 183-
186; Joseph
et al., 1997, Eur~. J. Inzzzzunol. 27, 2212-2218; Maurer et al., 1998, J.
Iznzzzunol. 161, 2731-
2739. The beta subunit of FceRI has been associated with asthma in genetic
studies; see,
for example, Hill et al., 1996, Huzn. Mol. Genet. 5, 959-962; Hill et al.,
1995, Bnzj 311,
776-779; Kim et al., 1998, Curr. Opin. Pulse. Med. 4, 46-48; Mao et al., 1998,
Clin.
Genet. 53, 54-56; Shirakawa et al., 1994, Nat. Genet. 7, 125-129. A
significant fraction
of the population (~20%) may be affected by allergies, and this century has
seen a
substantial increase in asthma. Since IgE binding to FceRI is a requisite
event in the
reaction to different allergens, therapeutic strategies aimed at inhibiting
FceRI/IgE
interactions could provide a useful treatment for these diseases. For example,
monoclonal
antibodies that target IgE and block receptor binding have shown therapeutic
potential;
see, for example, Heusser et al., 1997, Curz-. Opin. Inzmunol. 9, 805-813.
FceRI is found as a tetrameric (abg2) or trimeric (age) membrane bound
receptor
on the surface of mast cells, basophils, eosinophils, langerhans cells and
platelets. The
alpha chain, also referred to as FceRIa, of FceRI binds IgE molecules with
high affinity
(KA of about 10~ to 101° moles/liter (M)), and can be secreted as a 172-
amino acid
soluble, IgE-binding fragment by the introduction of a stop codon before the
single
C-terminal transmembrane anchor; see, for example, Blank et a1.,1991, E. J.
Biol. Clzenz.
266, 2639-2646, which describes the secretion of a soluble IgE-binding
fragment of 172
amino acids. The extracellular domains of the human FceRIa protein belong to
the
immunoglobulin (Ig) superfamily and contain seven N-linked glycosylation
sites.
Glycosylation of FceRIa affects the secretion and stability of the receptor,
but is not
required for IgE-binding; see, for example, LaCroix et al., 1993, Mol.
Inzfnunol. 3~,
321-330; Letourneur et a1.,1995, J. Biol. Clzenz. 270, 8249-8256; Robertson,
1993, J. Biol.
Chenz.. 268, 12736-12743; Scarselli et al., 1993, FEBS Lett 329, 223-226. The
beta and
gamma chains of FceRI are signal transduction modules.
Prior investigators have disclosed the nucleic acid sequence encoding the
proteins
for human FceRIa; see, for example, U.S. Patent No. 4,962,035, by Leder,
issued October
9, 1990; U.S. Patent No. 5,639,660, by Kinet et al., issued June 17, 1997;
Kochan et al.,
1988, Nucleic Acids Res. 16, 3584; Shimizu et al., 1988, Proc. Natl. Acad.
Sci. USA 85,
1907-1911; and Pang et al., 1993, J. Iznmunol. 151, 6166-6174. Nucleic acid
sequences
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
have also been reported for nucleic acid molecules encoding the human FceRI
beta and
gamma chains; see, respectively, Kuster et al., 1992, J. Biol. CIZem. 267,
12782-12787;
Kuster et al., 1990, J. Biol. Claem. 265, 6448-6452. Nucleic acid sequences
have also
been reported for nucleic acid molecules encoding canine FceRIa, murine
FceRIa, rat
FceRIa, feline FceRIa and equine FceRIa proteins; see, respectively, GenBankTM
accession number D16413; Swiss-Prot accession number P20489 (represents
encoded
protein sequence); GenBank accession number J03606; PCT Publication No. WO
98/27208, by Frank et al., published June 25, 1998, referred to herein as WO
98/27208;
and PCT Publication No. WO 99/38974, by Weber et al., published August 5,
1999,
referred to herein as WO 99/38974. In addition, methods to detect IgE
antibodies using a
FceRIa protein have been reported in PCT Publication No. WO 98/23964, by Frank
et al.,
published June 4, 1998, referred to herein as WO 98/23964; WO 98/27208, ibid.;
PCT
Publication No. WO 98/45707, by Frank et al., published October 15, 1998,
referred to
herein as WO 98/45707; and WO 99/38974, ibid.. WO 98/23964, WO 98/27208, WO
98/45707 and WO 99/38974 are each incorporated by reference herein in its
entirety.
IgE shares the general overall structure common to all immunoglobulin
molecules
in that it is composed of four polypeptide chains: two identical heavy chains
(H chains)
and two identical light chains (L chains) (reviewed in Immunobiology: The
Immune
System in Health and Disease, Janeway and Travers, 1996, Garland Publishing
Inc. New
York which is incorporated by reference in its entirety). The two heavy
chains, which
have a molecular weight of approximately 65 kDa each in their unglycosylated
form, are
linked by disulfide bonds. Each heavy chain is further linked to a light
chain, each light
chain having a molecular weight of approximately 25 kDa, resulting in the
final, four
chain molecule. Both the heavy and light chains contain distinct sequence
domains. The
light chains contain two domains, a variable domain (referred to as VL), with
the sequence
in this region varying between different antibodies of the same isotype, and a
constant
domain (referred to as CL), with the sequence in this region remaining
constant between
different antibodies of the same isotype. The number of sequence domains in
the heavy
chains varies between the different isotypes. The heavy chain polypeptide of
IgE has five
sequence domains consisting of one variable sequence domain (referred to as
VH), and
four constant sequence domains (referred to as Cel-Ce4). It is the VL and VH
domains
which are involved in antigen recognition whereas the constant domains of the
heavy
chains impart the distinctive functional properties (e.g., receptor binding)
of an
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
immunoglobulin class to the molecule and determine to which of the five main
immunoglobulin classes the molecule belongs.
In addition to the heavy and light protein components, all
immunoglobulins also contain significant amounts of carbohydrate in the form
of simple
and complex side chains covalently linked to amino acids in the polypeptide
chains. The
carbohydrate side chains are usually attached via an N-glycosidic linkage,
although O-
glycosidic linkages have been observed. In general, carbohydrate side chains
are attached
to the protein portion of the molecule via linkages located in one of the
constant domains
of the heavy chain although exceptions to this rule have been seen. The number
of
glycosidic linkages varies between and within immunoglobulin types, although
in
general, IgE is believed to have an average of 5 oligosaccharides per complete
immunoglobulin molecule
IgE antibodies interact with the cellular receptors FceRIa and FceRII (CD23)
through amino acid sequences present in the constant domains of the heavy
chains. There
have been several reports of the use of mutagenesis and swapping techniques to
attempt
to identify amino acids of either FceRIa or IgE involved in the binding of
(i.e., interaction
between) those respective proteins, reports attempting to model FceRIa
proteins based on
homology to other Ig-superfamily members, and reports that identify compounds
that
apparently inhibit such binding; see, for example, Cook et al., 1997,
Bioclzewistf~y 36,
l 5579-15588; Hulett et al., 1994, J. Biol. Clzerrz. 269, 15287-15293; Hulett
et al., 1995, J.
Biol. Cltem 270, 21188-21194; Mallamaci et al., 1993, J. Biol. Clzezn. 265,
22076-22083;
Robertson, 1993, ibid.; Scarselli et al., 1993, ibid. McDonnell et al., 1997,
Biochem. Soc.
Tran.s. 25, 387-392; McDonnell et al., 1996, Nat. Struc. Biol. 3, 419-426; PCT
Publication No. WO 97/40033, by Cheng et al., published October 30, 1997; U.S.
Patent
No. 5,180,805, by Gould et al., issued January 19, 1993; U.S. Patent No.
5,693,758, by
Gould et al., issued December 2, 1997; PCT Publication No. WO 96/01643, by
Gould et
al., published January 25, 1996; PCT Publication No. WO 95/14779, by Gould et
al.,
published June l, 1995. Recent crystallographic examination of the individual
molecules
as well as .the IgE/FceRIa complex has elucidated the specific amino acids
involved in the
interaction between IgE and FceRIa; see, for example, PCT Publication No. WO
00/26246, Jardetzky et al., published May 11, 2000; U.S. Patent Publication
No.
20030003502-A1, Jardetzky et al., published January 2, 2003; PCT Publication
No. WO
01/69253 A3, Jardetzky et al., published September 20, 2001; U.S. Patent
Publication No.
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
20010039479, Jardetzky et al., published November 8, 2001; and PCT Publication
No.
WO 01/68861 A3, Jardetzky et al., published September 20, 2001, each of which
is
incorporated herein by reference in its entirety. The three-dimensional models
generated
by these studies have shown that the binding of FceRIa to IgE is mediated by
interactions
of amino acids in FceRIa with amino acids in the Ce2/Ce3 linleer region (also
referred to
as the flexible linker region) and in the Ce3 domains of the IgE heavy chain.
Furthermore, the 3-dimensional models of IgE demonstrate that the heavy chains
of IgE
are flexible and can adopt at least two unique conformations, a closed
conformation and
an open conformation. The two conformations can be distinguished, in part, by
the
relative spatial orientation of the Ce3 domains which are fuuther apart in the
open
conformation and closer together in the closed conformation. In the closed
conformation,
the Ce3-Ce4 interdomain angle is more acute than that observed between
homologous
IgG-Fc domains (Deisenhofer et al., 1976; Harris et al., 1999) or in the FceRI-
bound IgE-
Fc (open conformation, Garman et al., 2000). Additionally, both the relative
disposition
of the two Ce3 domains with respect to each other and to the Ce4 domains is
altered. In
the closed structure, the IgE-Fc Ce3 domains are closer together and slightly
rotated with
respect to each other. In addition, the distance between the first residue
(the N-terminal
amino acid) of the Ce3 A strands is only about 13 A to about 22 A. The
distance
increases to 23 A in the open conformation of IgE-Fc, which is similar to the
22 A
observed between the Cy domains in the IgG2a-Fc (Harris et al., 1997). In the
change
between the open and closed conformations, the top of each Ce3 domain moves
about 10
A towards the other Ce3 domain across the diner axis and 8 ~ towards the Ce4
domain
of the same chain.
Studies of the IgE/FceRIa complex have revealed the IgE-Fc molecule is in the
open conformation when bound to FceRIa. The large conformational change of the
IgE-
Fc structure reorients loops in the Ce3 domain that interact with the high
affinity receptor,
FceRI. The large movement of the FceRI-binding loops suggests that they would
be
poorly positioned in the closed IgE-Fc structure to interact with the
receptor. In the open
form, the receptor-binding loops are exposed and the binding residues display
a large
concave surface that is available to interact with FceRIa. Based in part on
these data, it is
predicted that if IgE molecules are forced to adopt the closed configuration,
due to
binding of a compound for example, these closed IgE molecules would be unable
to bind
to FcsRIa. Further, using these data, it is possible to design tools (e.g.
mutant proteins)
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
useful for the production of compounds that bind IgE, locking it in the closed
conformation thereby preventing it from binding to its receptor.
While studies to date have provided information on the structure of IgE and
FceRIa as well as the nature of their interaction, the need remains for
specific tools useful
for the discovery and production of compounds with which to treat and diagnose
allergy
and to regulate immune responses. Also needed are safe and efficacious
compounds to
prevent or treat allergy and to regulate other immune responses in an animal.
SUMMARY OF THE INVENTION
The present invention generally relates to mutant, IgE heavy chain proteins,
IgE
proteins comprising mutant IgEH~ proteins and 3-dimensional models of such
mutant IgE
proteins. Specifically, the present invention relates to mutant IgE proteins
that have
reduced flexibility in their heavy chains in comparison to the native molecule
and are, as
a result, constrained in a particular conformational state. The present
invention also
relates to 3-dimensional models of IgE glycosylation mutants. IgE and IgEHC
mutants
can be used, for example, to isolate or produce compounds that regulate the
IgE-mediated
immune response in an animal. The present invention also relates to the use of
mutant
IgEHC and mutant IgE proteins of the instant invention to produce and isolate
compounds
that will inhibit the binding of IgE to FceRI or FceRIa. Included in the
present invention
are nucleic acid molecules encoding proteins of the instant invention as well
as cells and
recombinant viruses comprising such nucleic acid molecules. Also included are
compounds which inhibit the binding of IgE to FceRI or FceRIa. The present
invention
also includes therapeutic compositions and kits comprising proteins and/or
compounds of
the instant invention as well as methods of treating an animal using such
compositions
and kits. Accordingly, the present invention builds on the teaching of PCT
Publication
No. WO 00/26246, Jardetzky et al., published May 11, 2000; U.S. Patent
Publication No.
20030003502-A1, Jardetzky et al., published January 2, 2003; PCT Publication
No. WO
01/69253 A3, Jardetzky et al., published September 20, 2001; U.S. Patent
Publication No.
20010039479, Jardetzky et al., published November 8, 2001; and PCT Publication
No.
WO 01/68861 A3, Jardetzky et al., published September 20, 2001.
BRIEF DESCRIPTION OF THE DRAWINGS
Fig.l shows a comparison of the inter-chain and inter-residue distance in the
open
and closed conformations of IgE-Fc. Fig. la shows a side view of the Ce3 and
Ce4
domains in the closed conformation. Fig. 1b shows a top view of the Ce3
domains in the
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
closed conformation. The solid line indicates the 13 A gap between the N-
terminal amino
acids (residues 336) of each chain. Fig. 1b shows a side view of the Ce3 and
Ce4
domains in the open conformation. Fig. 1d shows a top view of the Ce3 domains
in the
open conformation. The solid line indicates the 23.5 A gap between the N-
terminal
amino acids (residues 336) of each chain.
Fig. 2 shows a schematic representation of the open and closed IgE
conformations, highlighting the potential disulfide bonds that could be formed
by the
cysteine residues created in the IgEHC mutants (e.g. disulfide bonds at amino
acid
positions 329 and 335 are shown) Fig. 2a shows the Ce4 domain and residues 329-
336 of
the Ce3 domain in the closed conformation. The solid line represents a
disulfide bond
between residues 335 of each heavy chain. Fig. 2b shows the Ce4 domain and
residues
329-336 of the Ce3 domain in the open conformation. The solid line represents
a
disulfide bond between residues 329 of each heavy chain.
Fig. 3 shows a western blot of the IgEHC cysteine mutant proteins separated by
PAGe under reducing and non-reducing conditions. Numbers above each lane
indicate
the amino acid residue in IgEHC changed to a cysteine with the potential to
form an
interchain disulfide bond. The position of protein monomers and diners are
indicated by
the arrows on the left side of the figure. Fig. 3a shows the proteins exist in
both
monomeric and dimeric forms when analyzed under non-reducing conditions. Fig.
3b
shows that when the IgE-Fc proteins are subjected to reducing conditions, they
all exist in
the monomeric form.
DETAILED DESCRIPTION OF THE INVENTION
The present invention generally relates to mutant IgE proteins, mutant IgEHc
proteins and 3-dimensional models of such mutant IgE proteins. In describing
the present
invention, certain terms used herein are defined as follows:
As used herein, the term "a" or "an" entity refers to one or more of that
entity; for
example, a protein refers to one or more proteins or at least one protein; as
another
example, a nucleic acid molecule refers to one or more nucleic acid molecules
or at least
one nucleic acid molecule. As such, the terms "a" or "an", "one or more", and
"at least
one" can be used interchangeably herein. It is also to be noted that the terms
"comprising", "including", and "having" can be used interchangeably herein.
As used herein, the terms "IgE heavy chain", "IgEHC" and "IgEHC protein" can
be
used interchangeably and refer to a protein from any animal that comprises an
IgE Fc
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
receptor binding site and, as such, contains at least a portion of Ce3, with
or without at
least a portion of Ce4. An IgEH~ protein can be full-length immunoglobulin
epsilon (IgE)
heavy chain, a full-length Fc region of an IgE heavy chain, a fragment of an
IgE Fc
region that binds to FceRI or FceRIa, or any protein comprising a fragment of
an IgE Fc
region that binds to FceRI or FceRIa.
As used herein, the terms "IgECe3", "Ce3" and "Ce3 domain" can be used
interchangeably and refer to the third constant region domain of the full
length IgE heavy
chain protein.
As used herein, the term "IgECe4", "Ce4" and "Ce4 domain" can be used
interchangeably and refer to the fourth constant region domain of the full
length IgE
heavy chain protein.
As used herein, the term "IgECe3/Ce4" refers to a protein comprising at least
a
portion of IgECe3 and at least a portion of IgECe4.
As used herein, the term "Ce2/Ce3 linker region" refers to the amino acid
segment
between the second and third constant domains.
As used herein, the term "IgE Fc region" refers to the region of the IgE heavy
chain consisting of the second, third and fourth constant domains, Ce2, Ce3
and Ce4.
As used herein, the term "IgE protein" refers to a molecule comprising at
least one
or more IgEH~ proteins, either alone or in combination with one or more IgE
light chains.
One example of an IgE protein is an IgE antibody comprising two heavy chains
and two
light chains, with another example being an IgEH~ dimer.
As used herein, the term "unmodified", as applied to IgE proteins, refers to
IgE
proteins having FceRI or FceRIa binding activity identical to the FceRI or
FceRIa
binding activity of an IgE protein comprising an IgEH~ that comprises the
amino acid
sequence of SEQ ID NO:11. As applied to IgEH~'s and related nucleic acid
molecules
(i.e. nucleic acid molecules encoding such IgEH~'s), the term "unmodified"
refers to
IgEH~'s and related nucleic acid molecules having functional characteristics
identical to
those possessed by an IgEH~ or a related nucleic acid molecule comprising
amino acid
sequence SEQ ID N0:11 or nucleotide sequence SEQ ID N0:10, respectively.
As used herein, the term "mutant" refers to IgE proteins, IgEH~ proteins and
related nucleic acid molecules having sequences similar to unmodified IgE
proteins,
IgEHC proteins and related nucleic acid molecules but that differ functionally
from their
unmodified counterparts. Specifically, mutant IgE proteins, mutant IgEHC's and
related
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
nucleic acid molecules (i.e. nucleic acid molecules encoding such IgEH~'s) do
not bind
FceRI in the same manner as an unmodified counterpart. Mutants may be isolated
from
nature or may be created as a result of manipulation.
As used herein, the term "isolated" refers to IgE proteins, IgEH~ proteins and
related nucleic acid molecules that have been removed from their natural
milieu. As
such, the term "isolated" does not necessarily reflect the extent to which the
IgE proteins,
IgEH~ proteins and related nucleic acid molecules have been purified. An
isolated IgE
protein, IgEH~ protein or related nucleic acid molecules can be obtained from
its natural
source or it can be produced using recombinant technology and/or through the
use of
chemical synthesis or modification.
As used herein, the term "closed conformation" refers to the 3-dimensional
conformation of an IgE protein in which the constant domains of the IgEH~
proteins are
oriented in such a way as to prevent binding of the IgE protein to an FceRI or
FceRIa.
IgE proteins in a closed conformation have IgEH~ proteins in which the N-
terminal amino
acid of the Ce3 domains are less than 23 angstroms (A) apart.
As used herein, the term "open conformation" refers to a 3-dimensional
conformation of an IgE protein in which the constant domains of the IgEH~
proteins are
oriented in such a way as to allow binding of the IgE molecule to a FceRI or
FceRIa. An
IgE protein in the open conformation is one in which the N-terminal amino acid
of the
Cs3 domains are at least 23 A apart.
As used herein, the term "spatial mobility" refers to the ability of the IgEHc
proteins to move or shift their position relative to one another and/or the
rest of the IgE
protein.
As used herein, the teen "reduced spatial mobility" refers to an IgE protein
that is
in one conformation, either open or closed, and in which the motion of the
IgEHC's are
restricted so that the IgE protein is unable to adopt the alternative
conformation. For
example, an IgE in the closed conformation having reduced spatial mobility is
unable to
alter it's conformation so that the N-terminal amino acids of the Ce3 domains
are at least
23A apart. Similarly, the term "constrained" refers to an IgE that is in one
conformation,
either open or closed, and is unable to adopt the alternative conformation.
As used herein, the term "IgE open form mutants" (IgEofr") refers to mutant
IgE
proteins that are constrained in the open conformation and have reduced
spatial mobility
such that they are unable to adopt the closed conformation.
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
As used herein, the term "IgE closed form mutants" (IgE~f,T,) refers to mutant
IgE
proteins that are constrained in the closed conformation and have reduced
spatial mobility
StlCh that they are unable to adopt the open conformation.
As used herein, the term "IgE glycosylation mutant" (IgE~",) refers to mutant
IgE
proteins in which the amino acid sequence of one or more N-linked
glycosylation sites
has been altered so that the site is no longer an N-linked glycosylation site
(i.e. the
mutated site can no longer be glycosylated by the N-linked glycosylation
method).
As used herein, the term "extracellular domain of a FceRIa protein" is the
portion
of the FceRI alpha chain that is exposed to the environment outside the cell
and that binds
to the Fc domain of an IgE antibody. Such an FceRIa extracellular domain can
be (a) a
complete extracellular domain which is a domain that extends from the first
amino acid of
a mature FcsRI alpha chain through the last amino acid prior to the start of
the
transmembrane region or an extracellular domain that is functionally
equivalent, in that
such a domain includes D1 and D2 domains, and displays a similar affinity for
the IgE
antibody to which such an FceRIa protein naturally binds or (b) a fragment of
any of the
extracellular domains of (a), wherein the fragment retains its ability to bind
to the Fc
domain of an IgE antibody.
In one aspect, the present invention provides isolated mutant IgE proteins
comprising IgEH~'s having reduced spatial mobility in comparison to the
spatial mobility
of the IgEH~'s in an unmodified IgE protein. Suitable mutant IgE proteins are
those in
which the spatial mobilities of the IgEH~ Ce3 and Ce4 domains within the IgE
protein
have been restricted due to modification of the IgEH~'s. Previous
crystallographic
analysis of the umnodified IgE protein Ce3 and Ce4 domains has demonstrated
these
domains can move within the IgE protein causing the IgE protein to adopt one
of at least
two conformations: an open conformation or a closed conformation. In the
closed
conformation, the N-terminal amino acid residues of the Ce3 domains of the two
heavy
chains, which correspond to the amino acid in position 9 of SEQ ID N0:11,
which itself
corresponds to position 336 of the full-length human IgE heavy chain protein,
have an
inter-residue distance of about 13 A whereas in the open conformation, the tvo
Ce3
domain N-terminal amino acid residues are positioned so that they have an
inter-residue
distance of at least 23 A. The IgE protein is in the open conformation when
bound to
FceRIa and, based on the structural data, it is predicted that IgE proteins in
the closed
conformation would be unable to bind an FceRI or FceRIa.
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
One embodiment of the present invention is a mutant IgE protein comprising an
IgEH~ that has been modified in such a way as to cause the IgE protein to be
constrained
in the closed conformation. IgE proteins constrained in the closed
conformation have
IgEH~'s in which the N-terminal amino acid residues of the Ce3 domains are
less than
23A apart; such mutant IgE proteins are unable to flex significantly enough to
allow an
inter-residue distance of 23~ or more. Suitable IgE proteins of the present
invention
include those in which the N-terminal amino acid residues of the IgEH~ Ce3
domains can
achieve an inter-residue distance of from about 13A to less than 23A. As such,
useful
mutant IgE proteins of the present invention include those in which the N-
terminal amino
acid residues of the IgEH~ Ce3 domains can achieve an inter-residue distance
of no
greater than about 13A, no greater than about 14A, no greater than about 15A,
no greater
than about 16A, no greater than about 17A, no greater than about 18A, no
greater than
about 19A, no greater than about 20A, no greater than about 21A or no greater
than about
22A or less than 23A. Such mutant IgE proteins can be isolated from natural
sources or
they can be produced by laboratory manipulation of unmodified IgE proteins,
IgEH~'s
andlor related nucleic acid molecules. Suitable methods to modify an IgE
protein are
known to those skilled in the art and include, but are not limited to,
chemical or
enzymatic modification of the IgEH~'s, alteration of the IgEH~ protein
sequences to
produce a mutant protein giving the desired conformation, alteration of a
nucleic acid
molecule encoding IgEH~ s and combinations thereof; examples of such methods
are
described in more detail herein. A particularly useful mutant IgE protein is
one that is
constrained in the closed conformation and is unable to adopt the open
conformation and
as a result, is unable,to bind to a FceRI or FceRIa.
One embodiment of the present invention is a mutant IgE protein comprising an
IgEH~ that comprises an amino acid sequence having at least 50% identity to
SEQ ID
N0:11, wherein the amino acid sequence of the mutant IgEH~ has been modified
to allow
the IgEH~'s to form cross-linking covalent bonds thereby constraining movement
of such
IgEH~'s in an IgE protein. A suitable type of bond to form is a disulfide
bond. Methods
to determine percent identities and similarities are well known to those
skilled in the art.
Examples of mutant IgE proteins include, but are nor limited to, those
comprising an
IgEH~ that comprises an amino acid sequence at least about 80%, at least about
85%, at
least about 90%, at least about 95%, at least about 98% or at least about 100%
identical to
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
SEQ ID N0:11, but wherein the amino acid residue in the IgEH~ corresponding to
position 2, 3, 4, 5, 6, 7, 8, or 9 of SEQ ID N0:11 is a cysteine or a
methionine.
In one embodiment, a mutant IgE protein of the present invention comprises an
IgEIjo that comprises an amino acid sequence at least about 80%, at least
about 85%, at
least about 90%, at least about 95%, at least about 98% or at least about 100%
identical to
an amino acid sequence selected from the group consisting of:
(a) SEQ ID N0:13, wherein the amino acid residue in said IgEH~ corresponding
to
position 2 of SEQ ID N0:13 is a cysteine or a methionine;
(b) SEQ ID N0:15, wherein the amino acid residue in said IgEH~ corresponding
to
position 3 of SEQ ID N0:15 is a cysteine or a methionine;
(c) SEQ ID N0:17, wherein the amino acid residue in said IgEH~ corresponding
to
position 4 of SEQ ID N0:17 is a cysteine or a methionine;
(d) SEQ ID N0:19, wherein the amino acid residue in said IgEH~ corresponding
to
position 5 of SEQ ID N0:19 is a cysteine or a methionine;
(e) SEQ ID N0:21, wherein the amino acid residue in said IgEH~ corresponding
to
position 6 of SEQ ID N0:21 is a cysteine or a methionine;
(f) SEQ ID N0:23, wherein the amino acid residue in said IgEH~ corresponding
to
position 7 of SEQ ID N0:23 is a cysteine or a methionine;
(g) SEQ ID N0:25, wherein the amino acid residue in said IgEH~ corresponding
to
position 8 of SEQ ID N0:25 is a cysteine or a methionine; and
(h) SEQ ID N0:27, wherein the amino acid residue in said IgEH~ corresponding
to
position 9 of SEQ ID N0:27 is a cysteine or a methionine.
In a particularly useful embodiment, a mutant IgE protein comprises an IgEH~
that
comprises an amino acid sequence selected from the group consisting of SEQ ID
N0:13,
SEQ ID N0:15, SEQ ID N0:17, S,EQ ID N0:19, SEQ ID N0:21, SEQ ID N0:23, SEQ
ID N0:25 and SEQ ID N0:27.
The present invention also provides an isolated mutant IgEH~ modified in such
a
way as to cause an IgE protein comprising the mutant IgEH~ to have reduced
spatial
mobility in comparison to the spatial mobility of an IgE protein comprising an
unmodified IgEH~. A suitable mutant IgEH~ is one which causes an IgE protein
to be
constrained in an open or closed conformation, with the closed conformation
being
preferred. Suitable mutant IgEH~'s of the present invention comprise an amino
acid
sequence having at least 50% identity to SEQ ID NO:11, but wherein the IgEH~
has been
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
modified, allowing the formation of covalent bonds between two or more IgEHO's
thereby
constraining the movement of such IgEH~'s in an IgE protein. Preferred mutant
IgEH~'s,
while they no longer bind FceRI or FceRIa with the affinity of an IgEH~
comprising SEQ
ID NO:11, do retain other functions of IgEH~'s, for example the ability to
elicit an
immune response to an unmodified IgEH~ and the ability to bind to antibodies
generated
using an unmodified IgEH~. Any unmodified or mutant IgE protein or IgEH~ or
related
nucleic acid molecule can be subjected to modification to produce a mutant IgE
or a
mutant IgEH~ or related nucleic acid molecule of the present invention.
Preferred
proteins or nucleic acid molecules to modify are mammalian, with human, non-
human
IO primate, feline, canine, equine, murine, ovine, bovine or porcine protein
or nucleic acid
molecules being preferred. Particularly preferred are human, feline, canine or
equine
proteins or nucleic acid molecules with human proteins or nucleic acid
molecules being
more preferred. Methods of modifying IgEH~'s to allow the formation of inter-
chain
covalent bonds, such as, but not limited to disulfide bonds, are known to
those skilled in
the art and include, but are not limited to, chemical and/or enzymatic
modification of the
IgEH~'s, alteration of the IgEH~ protein sequence through the use of protein
or
recombinant technologies, and combinations thereof. A suitable type of bond to
form is a
disulfide bond. Any method of modification that causes an IgE protein
comprising the
modified IgEH~ to be constrained in the closed conformation may be used to
produce
IgEH~'s and IgE proteins of the present invention. A particularly useful
embodiment is
one that modifies the IgEH~ in such a way as to result in the N-terminal amino
acids of the
Ce3 domains in an IgE protein comprising the modified IgEH~ being no more than
about
13A, no more than about 14A, no more than about 15A, no more than about 16A,
no
more than about 17A, no more than about 18 A,no more than about 19A , no more
than
about 20A , no more than about 21A, no more than about 22A apaxt, or less than
23A
apart.
One example of a useful method of modification is a chemical or enzymatic
treatment. Suitable chemical or enzymatic treatments are well known to those
skilled in
the art and include, but are not limited to, for example, glycosylation
reactions,
myristilation reactions, biotinylation reactions, reduction reactions,
oxidation reactions,
protease reactions and the like. A suitable treatment is one which cross-links
the IgEH~'s
thereby constraining an IgE protein comprising the modified IgEH~ in the
closed
conformation.
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
In one embodiment, an IgEIjc is modified by altering the amino acid sequence.
A
mutant IgEHC may have one or more sequence differences compared to the
unmodified
IgEHC sequence and these sequence differences may arise naturally or they may
be
introduced through laboratory manipulation (e.g. substitutions, insertions,
deletions) of an
IgEHC protein or a nucleic acid molecule encoding such an IgEHC. Any
alteration in the
IgEHC amino acid sequence that results in an IgE protein that comprises the
mutant IgEHc
being constrained to the closed conformation are suitable. Such sequence
alterations can
be made at any location in the IgEHC that results in the IgE protein being
constrained in
the closed conformation. Particularly suitable positions at which to make
modifications
are positions in the Ce2/Ce3 linker region, the Ce3 domain and/or the Ce4
domain. For
example, according to U.S. Patent Publication No. 20010039479-A1, Jardetzky et
al.,
published on November 8, 2001, and U.S. Patent Publication No. 20030003502-A1,
Jardetzky et al., published on January 2, 2003, the human IgEHC Ce3 domain
spans amino
acids 9 through 107 of SEQ ID N0:11, which correspond to amino acids 336
through 434
of full length human IgEHC , using the numbering system of Dorrington et al.,
1978,
Ir~zniuyzol Rev 41, 3-25, which is incorporated herein by reference in its
entirety, while the
Ce4 domain spans amino acids 114 through 220 of SEQ ID N0:11, which correspond
to
amino acids 441 through 547 of full length human IgEHC, using the numbering
system of
Dorrington et al., 1978, Immunol Rev 41, 3-25. As such, IgE Ce3/Ce4 extends
from
amino acids 9-220 of SEQ ID N0:11. A suitable embodiment is an IgEHC in which
the
amino acid sequence of the Ce2/Ce3 linker region.is altered by the addition,
substitution
or deletion of amino acids. For example, according to U.S. Patent Publication
No.
20010039479-A1, Jardetzky et al., published on November 8, 2001, and U.S.
Patent
Publication No. 20030003502-Al, Jardetzky et al., published on January 2,
2003, the
IgEHC Ce2/Ce3 linker region spans amino acids 1-8 of SEQ ID N0:11, which
correspond
to amino acids 328 through 335 of the full length human IgEHC, using the
numbering
system of Dorrington et al. Particularly preferred positions at which to
substitute or insert
a cross-linking amino acid include, but are not limited to, amino acid
position 2, 3, 4, 5, 6,
7, 8 or 9 of SEQ ID N0:11. While these position numbers refer to amino acid
positions
in SEQ ID N0:11, it should be noted that these amino acids are commonly
referred to as,
and correspond to, amino acids A329, D330, 5331, N332, P333, 8334, 6335 and
V336
of full-length IgEHC, using the numbering system of Dorrington et al., 1978,
Imn2urcol Rev
41, 3-25. The same mutations could be made at the corresponding amino acids in
the
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
full-length IgEH~ or within corresponding positions in IgE Fc-region fragments
either
alone or contained within other proteins.
A particularly useful type of modification is the introduction of a cysteine
residue
or a methionine residue into an IgEHC. Such an introduction can result from an
insertion
of an additional amino acid residue (i.e. cysteine or methionine) into the
sequence or from
the conversion of an existing amino acid residue into a cysteine or a
methionine.
Methods of producing such mutants are known to those skilled in the art. One
such
method is through the manipulation of an IgEH~ nucleic acid molecule (e.g. by
nucleotide
insertions, deletions andlor substitutions) to produce a nucleic acid molecule
encoding a
desired mutant IgEH~. Nucleic acid molecules can be modified using a variety
of
techniques known to one skilled in the art such as, for example, site-directed
mutagenesis,
chemical treatment, restriction enzyme cleavage, ligation of nucleic acid
fragments,
polymerase chain reaction (PCR) amplification, PCR mutagenesis, synthesis of
oligonucleotide mixtures and ligation of mixture groups to "build" a mixture
of nucleic
acid molecules, in-vitro or directed evolution and combinations thereof. The
use of such
techniques are known to those skilled in the art; see for example, Sambrook,
et al., 1989,
Molecular- Cloning: A Laboratory Manual, Cold Spring Harbor Labs Press which
is
incorporated herein by reference in its entirety.
In one embodiment a mutant IgEH~ comprises an amino acid sequence at least
about 80%, at least about 85%, at least about 90%, at least about 95%, at
least about 98%
or at least about 100% identical to SEQ ID NO:11, but wherein the amino acid
residue in
said IgEH~ corresponding to position 2, 3, 4, 5, 6, 7, 8, or 9 of SEQ ID N0:11
is a
cysteine or a methionine. In one embodiment, an IgEH~ of the present invention
comprises an amino acid sequence at least about 80%, at least about 85%, at
least about
90%, at least about 95%, at least about 98% or at least about 100% identical
to an amino
acid sequence selected from the group consisting of:
(a) SEQ ID N0:13, wherein the amino acid residue in said IgEH~ corresponding
to
position 2 of SEQ ID N0:13 is a cysteine or a methionine;
(b) SEQ ID N0:15, wherein the amino acid residue in said IgEH~ corresponding
to
position 3 of SEQ ID N0:15 is a cysteine or a methionine;
(c) SEQ ID N0:17, wherein the amino acid residue in said IgEH~ corresponding
to
position 4 of SEQ ID N0:17 is a cysteine or a methionine;
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
(d) SEQ ID N0:19, wherein the amino acid residue in said IgEHC corresponding
to
position 5 of SEQ ff~ N0:19 is a cysteine or a methionine;
(e) SEQ ID N0:21, wherein the amino acid residue in said IgEHC corresponding
to
position 6 of SEQ ID NO:21 is a cysteine or a methionine;
(f) SEQ ID N0:23, wherein the amino acid residue in said IgEHC corresponding
to
position 7 of SEQ ID N0:23 is a cysteine or a methionine;
(g) SEQ ID N0:25, wherein the amino acid residue in said IgEHC corresponding
to
position 8 of SEQ ID N0:25 is a cysteine or a methionine; and
(h) SEQ ID N0:27, wherein the amino acid residue in said IgEHC corresponding
to
position 9 of SEQ ID N0:27 is a cysteine or a methionine. Particularly useful
IgEHC's of
the present invention are IgEHC's comprising an amino acid sequence selected
from the
group consisting of SEQ ID N0:13, SEQ ID N0:15, SEQ ID N0:17, SEQ ID N0:19,
SEQ ID N0:21, SEQ ID N0:23, SEQ ID N0:25, SEQ ID N0:27, SEQ ID NO:29, SEQ
ID N0:31, SEQ ID N0:33, SEQ ID N0:35, SEQ ID N0:37, SEQ ID N0:39, SEQ ID
N0:41, SEQ ID N0:43, SEQ ID N0:45, SEQ ID N0:47, SEQ ID N0:49.
One embodiment of the present invention is a method to produce an IgE protein
that is constrained in the closed conformation, said method comprising: (a)
altering the
nucleic acid sequence of a nucleic acid molecule encoding an unmodified IgEHC;
and
(b) using the modified IgEHC nucleic acid molecule to produce a mutant IgE
protein
constrained in the closed conformation. In a preferred embodiment, the nucleic
acid
sequence is modified so that one or more cysteine residues are introduced into
the IgEHc
protein. In a more preferred embodiment, the nucleic acid sequence is altered
to encode a
protein which has cysteine residues in a position corresponding to position 2,
3, 4, 5, 6, 7,
8 and/or 9 of SEQ ID NO:11.
The present invention also provides isolated mutant IgEHC proteins lacking one
or
more N-linked glycosylation sites. The human IgEHC is known to have at least
three
potential N-linked glycosylation sites. For example,. the human IgEHC can
potentially be
glycosylated at amino acids 44, 56 and/or 67 of SEQ ID NO:11, which correspond
to
amino acids 371, 373 and 394 of the full-length IgE using the numbering system
of
Dorrington et al., 1978, Ifnmunol. Rev 41, 3-25. A useful embodiment of the
present
invention is an isolated mutant IgEHC in which the sequence of one or more of
the
potential N-linked glycosylation sites have been modified such that the
cellular
glycosylation mechanism does not attach a carbohydrate moiety at that site.
Suitable
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
modifications include amino acid substitutions, deletions and additions.
Methods of
malting such modifications are known to those skilled in the art and include,
for example,
altering a nucleic acid sequence encoding an IgEH~. A useful modification to
make is one
that modifies one or more amino acids from positions 44 through 46 of SEQ ID
N0:11
and/or positions 56 through 58 of SEQ ID N0:11. A particularly useful
embodiment is
an isolated mutant IgEH~ in which the asparagine at position 44 of SEQ ID
N0:11 and/or
the asparagine at position 56 of SEQ ID N0:11 has been replaced by an amino
acid other
than an asparagine. Suitable embodiments include isolated mutant IgEH~'s
comprising an
amino acid sequence at least about 85%, at least about 90%, at least about
95%, at least
about 98%, or at least about 100% identical to SEQ ID NO:1 l, but wherein the
amino
acid at position 44 and/or 56 of SEQ ID NO:11 is not an asparagine. A
particularly
suitable embodiment is an isolated mutant IgEH~ comprising the amino acid
sequence of
SEQ ID N0:8. Also contemplated are mutant IgE proteins comprising a mutant
IgEH~ in
which one or more glycosylation sites have been altered to prevent
glycosylation at the
modified site.
The present invention also provides 3-dimensional models of mutant IgE
proteins
comprising a mutant IgEH~ in which one or more glycosylation sites have been
altered to
prevent glycosylation at the modified site. Such models can describe a mutant
IgE
protein in the open or closed conformation and can be used to design or find
compounds
that inhibit the binding of IgE to an FceRI or FceRIa.
One embodiment of the present invention is a nucleic acid molecule that
encodes
a protein of the present invention. Useful nucleic acid molecules include
those that
encode an IgEH~ comprising an amino acid sequence at least about 80%, at least
about
85%, at least about 90%, at least about 95%, at least about 98% or at least
about 100%
identical to SEQ ID NO:11, but wherein the amino acid residue in said IgEHc
corresponding to position 2, 3, 4, 5, 6, 7, 8, or 9 of SEQ ID N0:11 is a
cysteine or a
methionine. Particularlyuseful nucleic acid molecules include those that
encode a mutant
IgEH~ comprising an amino acid sequence at least about 80%, at least about
85%, at least
about 90%, at least about 95%, at least about 98% or at least about 100%
identical to an
amino acid sequence selected from the group consisting of:
(a) SEQ ID N0:13, wherein the amino acid residue in said IgEH~ corresponding
to
position 2 of SEQ ID N0:13 is a cysteine or a methionine;
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
(b) SEQ ID N0:15, wherein the amino acid residue in said IgEH~ corresponding
to
position 3 of SEQ ID N0:15 is a cysteine or a methionine;
(c) SEQ ID N0:17, wherein the amino acid residue in said IgEH~ corresponding
to
position 4 of SEQ ID N0:17 is a cysteine or a methionine;
(d) SEQ ID N0:19, wherein the amino acid residue in said IgEH~ corresponding
to
position 5 of SEQ ID N0:19 is a cysteine or a methionine;
(e) SEQ ID N0:21, wherein the amino acid residue in said IgEH~ corresponding
to
position 6 of SEQ ID N0:21 is a cysteine or a methionine;
(f) SEQ ID NO:23, wherein the amino acid residue in said IgEH~ corresponding
to
position 7 of SEQ ID N0:23 is a cysteine or a methionine;
(g) SEQ ID N0:25, wherein the amino acid residue in said IgEH~ corresponding
to
position 8 of SEQ ID N0:25 is a cysteine or a methionine; and
(h) SEQ ID N0:27, wherein the amino acid residue in said IgEH~ corresponding
to
position 9 of SEQ ID N0:27 is a cysteine or a methionine.
Preferred nucleic acid molecules are those that encode an IgEH~ comprising an
amino
acid sequence at least about 80%, at least about 85%, at least about 90%, at
least about
95%, at least about 98% or at least about 100% identical to an amino acid
sequence
selected from the group consisting of SEQ ID N0:2, SEQ ID N0:8, SEQ ID N0:11,
SEQ
ID N0:13, SEQ ID N0:15, SEQ ID N0:17, SEQ ID N0:19, SEQ ID N0:21, SEQ ID
N0:23, SEQ ID NO:25 and SEQ ID N0:27.
Nucleic acid molecules useful in the present invention can be produced by, for
example, recombinant nucleic acid technology or by chemical synthesis. A
nucleic aid
molecule of the present invention can be DNA, RNA, or a derivative of DNA and
RNA.
Nucleic acid molecules of the present invention include natural forms,
including allelic
variants, nucleic acid molecules optimized for expression in a particular host
and other
nucleic acid molecules modified by nucleotide insertions, deletions,
substitutions and/or
inversions. A useful nucleic acid molecule of the present invention is a
nucleic acid
molecule comprising a nucleic acid sequence at least about 70%, at least about
75%, at
least about 80%, at least about 85%, at least about 90%, at least about 95% or
at least
about 100% identical in sequence to SEQ ID N0:1, SEQ ID N0:3, SEQ ID NO:4, SEQ
ID N0:5, SEQ ID N0:6, SEQ ID N0:7, SEQ ID N0:9, SEQ ID N0:10, SEQ ID N0:12,
SEQ ID N0:14, SEQ ID N0:16, SEQ ID N0:18, SEQ ID N0:20, SEQ ID N0:22, SEQ
ID NO:24 or SEQ ID N0:26, wherein the nucleic acid sequence encodes a protein
that
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
elicits an immune response to an IgEH~ protein that comprises the amino acid
sequence of
SEQ ID N0:11.
One embodiment of the present invention is a nucleic acid molecule comprising
a
nucleic acid sequence selected from the group consisting of:
(a) a nucleic acid sequence at least about 90%, at least about 95%, at least
about
98%, at least about 100% identical to SEQ ID N0:10, wherein the codon in said
nucleic
acid sequence corresponding to the codon at position 2 of SEQ ID NO:10 encodes
a
cysteine or a methionine;
(b) a nucleic acid sequence at least about 90%, at least about 95%, at least
about
98%, at least about 100% identical to SEQ ID NO:10, wherein the codon in said
nucleic
acid sequence corresponding to the codon at position 3 of SEQ ID NO:10 encodes
a
cysteine or a methionine;
(c) a nucleic acid sequence at least about 90%, at least about 95%, at least
about
98%, at least about 100% identical to SEQ ID NO:10, wherein the codon in said
nucleic
acid sequence corresponding to the codon at position 4 of SEQ ID NO:10 encodes
a
cysteine or a methionine;
(d) a nucleic acid sequence at least about 90%, at least about 95%, at least
about
98%, at least about 100% identical to SEQ ID N0:10, wherein the codon in said
nucleic
acid sequence corresponding to the codon at position 5 of SEQ ID N0:10 encodes
a
cysteine or a methionine;
(e) a nucleic acid sequence at least about 90%, at least about 95%, at least
about
98%, at least about 100% identical to SEQ ID NO:10, wherein the codon in said
nucleic
acid sequence corresponding to the codon at position 6 of SEQ ID NO:10 encodes
a
cysteine or a methionine;
(f) a nucleic acid sequence at least about 90%, at least about 95%, at least
about
98%, at least about 100% identical to SEQ ID NO:10, wherein the codon in said
nucleic
acid sequence corresponding to the codon at position 7 of SEQ ID NO:10 encodes
a
cysteine or a methionine;
(g) a nucleic acid sequence at least about 90%, at least about 95%, at least
about
98%, at least about 100% identical to SEQ ID NO:10, wherein the codon in said
nucleic
acid sequence corresponding to the codon at position 8 of SEQ ID NO:10 encodes
a
cysteine or a methionine; and
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
(h) a nucleic acid sequence at least about 90%, at least about 95%, at least
about
98%, at least about 100% identical to SEQ ID N0:10, wherein the codon in said
nucleic
acid sequence corresponding to the codon at position 9 of SEQ ID N0:10 encodes
a
cysteine or a methionine.
It should be noted that it is well known by those skilled in the art a codon
consists of 3
nucleotides and that references to a codon position in a SEQ ID NO. refers to
the 3
nucleotides making that make up that codon. For example, reference to the
codon at
position 2 of SEQ ID NO:10 refers to nucleotides 4-6 of SEQ ID N0:10.
A preferred nucleic acid molecule is one having the above characteristics and
which
encodes a protein having functions including, but not limited to antigen
binding, eliciting
an immune response to an IgE protein comprising an IgEHC that comprises an
amino acid
sequence of SEQ ID NO:11 and binding an antibody generated to an IgE protein
comprising an IgEH~ that comprises an amino acid sequence of SEQ ID NO:11.
A suitable nucleic acid molecule of the present invention is a nucleic acid
molecule comprising a nucleic acid sequence selected from SEQ ID NO:1, SEQ ID
N0:3, SEQ ID N0:4, SEQ ID N0:5, SEQ ID N0:6, SEQ ID N0:7, SEQ ID N0:9, SEQ
ID N0:10, SEQ ID N0:12, SEQ ID NO:14, SEQ ID N0:16, SEQ ID N0:18, SEQ ID
N0:20, SEQ ID N0:22, SEQ ff~ N0:24, SEQ ID N0:26, SEQ ID N0:28, SEQ ID
N0:30, SEQ ID N0:32, SEQ ID N0:34, SEQ ID N0:36, SEQ ID N0:38, SEQ ID
N0:40, SEQ ID N0:42, SEQ ID N0:44, SEQ ID N0:46, SEQ ID N0:48.
One embodiment of the present invention is a recombinant molecule that
comprises a nucleic acid molecule operatively linked to a transcriptional
control
sequence. The phrase operatively linked refers to joining of a nucleic acid
molecule to a
transcription control sequence in a manner such that the molecule is able to
be expressed
when transformed into a host organism. A suitable host organism is any
organism
capable of directing expression from a nucleic acid molecule of the present
invention. As
used herein, an expression vector is a DNA or RNA vector, typically either a
plasmid or
viral genome, that is capable of transforming a cell and of effecting
expression of a
specified nucleic acid molecule. A preferred recombinant molecule of the
present
invention contains regulatory sequences such as transcription control
sequences,
translation control sequences, origins of replication, and other regulatory
sequences that
axe compatible with the recombinant microorganism and that control the
expression of
nucleic acid molecules of the present invention. Transcription control
sequences are
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
sequences which control the initiation, elongation, and termination of
transcription.
Particularly important transcription control sequences are those which control
transcription initiation, such as promoter, enhancer, operator and repressor
sequences.
Suitable transcription control sequences include any transcription control
sequence that
can function in at least one of the recombinant microorganisms of the present
invention.
A variety of such transcription control sequences are known to those skilled
in the art;
examples included, but are not limited to, tac, lac, trp, tf-c, oxy-pro,
omp/Ipp, rrnB,
bacteriophage lambda (such as lambda pL, also referred to herein as lambda PL)
and
lambda pR (also referred to herein as lambda PR) and fusions that include such
promoters), bacteriophage T7, T7lae, bacteriophage T3, bacteriophage SP6,
SPO1, alpha-
mating factor, alcohol oxidase (AOX), antibiotic resistance gene, and other
sequences
capable of controlling gene expression in E. coli , methyltrophic yeast
microorganisms,
insect cells or other cells useful for expressing proteins; it is to be noted
that this list is not
intended to be limiting as many additional transcriptional control sequences
are known.
A preferred recombinant molecule includes a nucleic acid molecule that encodes
an IgEHc
of the present invention, operatively linked to an insect cell promoter.
Another embodunent of the present invention includes a recombinant vector,
which includes at least one isolated nucleic acid molecule of the present
invention,
inserted into any vector capable of delivering the nucleic acid molecule into
a host cell.
Such a recombinant vector contains heterologous nucleic acid sequences, that
is nucleic
acid sequences that are not naturally found adjacent to nucleic acid molecules
of the
present invention and that preferably axe derived from a species other than
the species
from which the nucleic acid molecules) axe derived. The vector can be either
RNA or
DNA, either prokaryotic or eukaryotic, and typically is a virus or a plasmid.
Recombinant vectors can be used in the cloning, sequencing, and/or otherwise
manipulation of IgE nucleic acid molecules of the present invention.
One embodiment of the present invention is a recombinant cell, which is a host
cell transformed with a nucleic acid molecule of the present invention. A
preferred
recombinant molecule comprises a recombinant molecule of the present
invention.
Recombinant DNA technologies can be used to improve expression of
transformed nucleic acid molecules by manipulating, for example, the number of
copies
of the nucleic acid molecules within a host cell, the efficiency with which
those nucleic
acid molecules are transcribed, the efficiency with which the resultant
transcripts are
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
translated, and the efficiency of post-translational modifications.
Recombinant
techniques useful for increasing the expression of nucleic acid molecules of
the present
invention include, but are not limited to, operatively linking nucleic acid
molecules to
high-copy number plasmids, integration of the nucleic acid molecules into one
or more
host cell chromosomes, addition of vector stability sequences to plasmids,
substitutions or
modifications of transcription control signals (e.g., promoters, operators,
enhancers),
substitutions or modifications of translational control signals (e.g.,
ribosome binding sites,
Shine-Dalgarno sequences), modification of nucleic acid molecules of the
present
invention to correspond to the codon usage of the host cell, deletion of
sequences that
destabilize transcripts, and use of control signals that temporally separate
recombinant
cell growth from recombinant enzyme production during fermentation. The
activity of an
expressed recombinant protein of the present invention may be improved by
fragmenting,
modifying, or derivatizing nucleic acid molecules encoding such a protein.
One embodiment of an IgEH~ of the present invention is a fusion protein.
Suitable
fusion segments for use with the present invention include, but are not
limited to,
segments that can: link two or more IgEH~ proteins of the present invention to
form
multimers; enhance a protein's stability; facilitate the purification of an
IgEHC protein;
and/or to affect the immune response to an IgE or IgEHO protein. A suitable
fusion
segment can be a domain of any size that has the desired function (e.g.,
imparts increased
stability, imparts increased immunogenicity to a protein, and/or simplifies
purification of
a protein). Fusion segments can be joined to amino and/or carboxyl termini of
an IgEHc
of the present invention and can be susceptible to cleavage in order to enable
straight-forward recovery of such protein. Fusion proteins are preferably
produced by
culturing a recombinant cell transformed with a fusion nucleic acid molecule
that encodes
a protein including the fusion segment attached to either the carboxyl and/or
amino
terminal end of an IgEHC protein. Preferred fusion segments include a metal
binding
domain (e.g., a poly-histidine segment); an immunoglobulin binding domain
(e.g., Protein
A; Protein G; T cell; B cell; Fc receptor or complement protein antibody-
binding
domains); a sugar binding domain (e.g., a maltose binding domain); and/or a
"tag"
domain (e.g., at least a portion of (3-galactosidase, a strep tag peptide, a
T7 tag peptide, a
FIagTM peptide, or other domains that can be purified using compounds that
bind to the
domain, such as monoclonal antibodies). More preferred fusion segments include
metal
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
binding domains, such as a poly-histidine segment; a maltose binding domain; a
strep tag
peptide, such as that available from Biometra in Tampa, FL; and an S10
peptide.
Effective culturing conditions to produce a mutant IgEH~ or a mutant IgE
protein
of the present invention include, but are not limited to, effective media,
bioreactor,
temperature, pH and oxygen conditions that permit protein production. An
effective
medium refers to any medium in which a cell is cultured to produce an a mutant
IgEHC or
a mutant IgE protein of the present invention. Such a medium typically
comprises an
aqueous medium having assimilable carbon, nitrogen and phosphate sources, and
appropriate salts, minerals, metals and other nutrients, such as vitamins.
Recombinant
cells of the present invention can be cultured in conventional fermentation
bioreactors,
shake flasks, test tubes, microtiter dishes, and petri plates. Culturing can
be carried out at
a temperature, pH and oxygen content appropriate for yeast, E. eoli, insect
cells or other
cells suitable for culture. Determining such culturing conditions are within
the expertise
of one of ordinary skill in the art.
Depending on the vector and host system used for production, resultant
proteins of
the present invention may either remain within the recombinant cell; be
secreted into the
culturing, or fermentation, medium; or be secreted into a space between two
cellular
membranes. In a preferred embodiment, the protein is in the medium and, hence,
can be
easily separated from the cell.
Proteins of the present invention can be purified using a variety of
purification
techniques, such as, but not limited to, affinity chromatography, ion exchange
chromatography, filtration, electrophoresis, hydrophobic interaction
chromatography, gel
filtration chromatography, reverse phase chromatography, concanavalin A
chromatography, chromatofocusing and differential solubilization. Proteins of
the present
invention are preferably retrieved in "substantially pure" form. As used
herein,
"substantially pure" refers to a purity that allows for the effective use of
the protein as a
diagnostic, therapeutic or prophylactic, or as a screening tool.
The ability of IgEHC or IgE proteins of the present invention as well as of
unmodified IgEH~ or IgE proteins to selectively bind to FceRI or FceRIa
protein can be
assayed by methods known in the art, such as, but not limited to, those
disclosed herein
and in PCT Publication No. WO 00/26246, Jardetzky et al., published May 11,
2000; U.S.
Patent Publication No. 20030003502-A1, Jardetzky et al., published January 2,
2003;
PCT Publication No. WO 01/69253 A3, Jardetzky et al., published September 20,
2001;
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
U.S. Patent Publication No. 20010039479, Jardetzky et al., published November
8, 2001;
and PCT Publication No. WO 01/68861 A3, Jardetzky et al., published September
20,
2001. As used herein, the term, selectively binds to FceRI or to FceRIa
protein refers to
the ability of a protein to preferentially bind to FceRI or FceRIa protein,
without being
able to substantially bind to other FcR proteins. Preferably, an FceRI or
FceRIa binds to
an IgE protein with an affinity (IAA) of at least about 10s liters/mole (M-1),
more
preferably of at least about 109 M-1, and even more preferably of at least
about 101° M-1.
Methods to compare binding activity of the mutant proteins of the present
invention with
the binding activity of unmodified proteins are also known in the art and
include, but are
not limited to, those methods disclosed herein and in PCT Publication No. WO
00/26246,
Jardetzky et al., published May 11, 2000; U.S. Patent Publication No.
20030003502-Al,
Jardetzky et al., published January 2, 2003; PCT Publication No. WO 01/69253
A3,
Jardetzky et al., published September 20, 2001; U.S. Patent Publication No.
20010039479, Jardetzky et al., published November 8, 2001; and PCT Publication
No.
WO 01/68861 A3, Jardetzky et al., published September 20, 2001.
The present invention also includes a method to identify a compound that binds
to
an IgE protein, thereby placing, restraining, maintaining or stabilizing that
IgE protein in
a closed form (i.e., such compound binds to an IgE protein either in or
resulting in a
closed conformation). Preferably such a compound inhibits an IgE protein from
binding
to Fc~RI. It is to be appreciated that methods to identify such a compound can
utilize
unmodified or mutant IgEH~ or IgE proteins of the present invention. As such,
although
the methods discussed below may cite the use of a mutant IgE protein, it is to
be
appreciated that mutant IgEH~ proteins of the present invention can also be
used.
One embodiment is a method to identify a compound that binds the closed form
of
an IgE protein, said method comprising: (a) contacting a mutant IgE protein
constrained
in the closed form with a candidate compound; and (b) determining if such
candidate
compound binds to the IgE closed form mutant. In a preferred embodiment, such
candidate compound, assuming it bound to the closed form of an IgE protein, is
then
contacted with IgE and an FcsRI or FcsRIa protein to determine whether such
candidate
compound inhibits binding between IgE and such FcsRI or FcaRIa protein. In
another
preferred embodiment, such candidate compound, assuming it bound to a closed
form of
an IgE protein, is also contacted with an IgE protein in the open conformation
to
determine if the candidate compound binds to IgE in the open conformation.
Another
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
embodiment is a method to identify a compound that inhibits the binding of IgE
to FcsRI
by a method comprising: (a) contacting a mutant IgE protein constrained in the
closed
form with a candidate compound in the presence of a FcsRI or FcsRIa protein;
and (b)
determining if such candidate compound inhibits binding of the IgE protein to
the FcsRI
or FcsRIa protein.
A preferred compound is one that selectively binds an IgE protein in the
closed
conformation. As used herein, the term, selectively binds to the closed
conformation of
an IgE protein, refers to the ability of a compound to preferentially bind to
the closed
conformation of an IgE protein, without being able to substantially bind to
other proteins
or molecules, including an IgE protein in the open conformation. A compound
that is
capable of selectively binding to an IgE protein is also referred to herein as
an IgE-
binding compound. A particularly preferred compound is a compound that binds
to an
IgE protein in the closed conformation, but not in the open conformation
(except to cause
such IgE to adopt a closed conformation) and that inhibits the binding of an
IgE protein to
FcsRI or FcERIa.
Suitable binding assays are known to those skilled in the art and are
conducted
under conditions suitable to form a binding complex; such conditions, e.g.,
appropriate
concentrations, buffers, temperatures, reaction times, as well as methods to
optimize such
conditions are known to those skilled in the art. See, for example Wingfiled,
et a1.,1996,
Current Protocols in Protein Science, Volume 1, John Wiley and Sons Publisher,
which is
incorporated herein in its entirety by reference, Sambrook et al., ibid., PCT
Publication
No. WO 00/26246, Jardetzky et al., published May 11, 2000; U.S. Patent
Publication No.
20030003502-A1, Jardetzky et al., published January 2, 2003; PCT Publication
No. WO
01/69253 A3, Jardetzky et al., published September 20, 2001; U.S. Patent
Publication No.
20010039479, Jardetzky et al., published November 8, 2001; and PCT Publication
No.
WO 01/68861 A3, Jardetzky et al., published September 20, 2001, and Example 1.
Examples of assays useful for detecting binding of a compound to an IgE
protein include,
but are not limited to, an enzyme-linked immunoassay, a radioimmunoassay, a
fluorescence immunoassay, a chemiluminescent assay, a lateral flow assay, an
agglutination assay, a particulate-based assay, e.g., using particulates such
as, but not
limited to, magnetic particles or plastic polymers, such as latex or
polystyrene beads, an
immunoprecipitation assay, a BioCoreTM assay, e.g., using colloidal gold, and
an
immunoblotting assay, e.g., a western blot. Such assays are well known to
those skilled
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
in the art. Assays can be used to give qualitative or quantitative results
depending on how
they are used. Some assays, such as agglutination, particulate separation, and
immunoprecipitation, can be observed visually, e.g., either by eye or by a
machine, such
as a densitometer or spectrophotometer, without the need for a detectable
marker. In
other assays, conjugation, i.e., attachment, of a detectable marker to one of
the binding
components of the assay aids in detecting complex formation. Examples of
detectable
markers include, but are not limited to, a radioactive label, an enzyme, a
fluorescent label,
a chemiluminescent label, a chromophoric label or a ligand. A ligand refers to
a molecule
that binds selectively to another molecule. Preferred detectable markers
include, but are
not limited to, fluorescein, a radioisotope, a phosphatase, e.g., alkaline
phosphatase,
biotin, avidin, a peroxidase, e.g., horseradish peroxidase, and biotin-related
compounds or
avidin-related compounds, e.g., streptavidin or ImmunoPureO NeutrAvidin
available
from Pierce, Rockford, IL. Such methods can be used to test one or more
compounds at a
time. Preferred methods test more than one compound at the same time and can
include
screening methods to analyze many candidate compounds simultaneously. It is
within the
ability of one skilled in the art to optimize such assays to determine which
compounds
bind an IgE protein in the closed conformation, which compounds bind an IgE
protein in
the open conformation, which compounds inhibit an IgE protein from binding to
its
receptor, which compounds do not bind an IgE protein in the closed
conformation, and
which compounds do not bind an IgE protein in the open conformation.
Suitable compounds that bind an IgE protein in the closed conformation can be
naturally produced compounds or synthetically produced compounds and include
proteins, carbohydrates, organic molecules, substrate analogs, and other large
or small
molecules. Such compounds may be identified, for example, by screening
chemical
libraries or phage display libraries and the like.
In one embodiment, a mixture of candidate compounds is applied to a column to
which IgE protein in the open conformation has been immobilized. Compounds
which
flow through the column (those that do not bind IgE in the open conformation)
are
collected and applied to a second column to which IgE in the closed
conformation has
been immobilized. Compounds that do not bind this form of the IgE protein will
flow
through the column. Compounds which do bind IgE in the closed conformation are
then
eluted from the column for further analysis.
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
The present invention also includes a therapeutic composition comprising at
least
one IgE-binding compound of the present invention, a protein of the present
invention or
some combination thereof. A preferred compound to include in a therapeutic
composition is one which binds the closed form of IgE and/or when bound to IgE
restrains the IgE from existing in an open conformation, thereby inhibiting
the IgE from
binding to a FcsRI. A particularly preferred compound to include in a
therapeutic
composition is one which inhibits binding of IgE to a FcsRI. Therapeutic
compositions
of the present invention can be formulated in an excipient that the animal to
be treated can
tolerate. Examples of such excipients include water, saline, Ringer's
solution, dextrose
solution, Hank's solution, and other aqueous physiologically balanced salt
solutions.
Nonaqueous vehicles, such as fixed oils, sesame oil, ethyl oleate, or
triglycerides may
also be used. Other useful formulations include suspensions containing
viscosity
enhancing agents, such as sodium carboxymethylcellulose, sorbitol, or dextran.
Excipients can also contain minor amounts of additives, such as substances
that enhance
isotonicity and chemical stability. Examples of buffers include phosphate
buffer,
bicarbonate buffer and Tris buffer, while examples of preservatives include
thimerosal, or
o-cresol, formalin and benzyl alcohol. Standard formulations can either be
liquid
injectables or solids which can be taken up in a suitable liquid as a
suspension or solution
for injection. Thus, in a non-liquid formulation, the excipient can comprise
dextrose,
human serum albumin, preservatives, etc., to which sterile water or saline can
be added
prior to administration.
hi one embodiment of the present invention, a therapeutic composition can
include a carrier. Carriers include compounds that increase the half-life of a
therapeutic
composition in the treated animal. Suitable carriers include, but are not
limited to,
polymeric controlled release vehicles, biodegradable implants, liposomes,
bacteria,
viruses, other cells, oils, esters, and glycols.
One embodiment of the present invention is a controlled release formulation
that
is capable of slowly releasing a composition of the present invention into an
animal. As
used herein, a controlled release formulation comprises a composition of the
present
invention in a controlled release vehicle. Suitable controlled release
vehicles include, but
are not limited to, biocompatible polymers, other polymeric matrices,
capsules,
microcapsules, microparticles, bolus preparations, osmotic pumps, diffusion
devices,
liposomes, lipospheres, and transdermal delivery systems. Other controlled
release
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
formulations of the present invention include liquids that, upon
administration to an
animal, form a solid or a gel ifa situ. Preferred controlled release
formulations are
biodegradable, i.e., bioerodible.
In one embodiment, a therapeutic composition of the present invention can be
used to protect an animal from a disease mediated by IgE by administering such
composition to such animal in order to prevent undesirable effects of IgE. An
example of
an IgE-mediated disease is an allergy. In one embodiment, the therapeutic
composition
of the present invention is administered to reduce the activity and or amount
of IgE in an
animal. Such administration can include, but is not limited to, oral,
intravenous,
intramuscular, intra ocular, mucosal, intranasal, subcutaneous, or transdennal
application.
A preferred route of administration is subcutaneous. In order to protect an
animal from a
disease mediated by IgE, a therapeutic composition of the present invention is
administered to the animal in an effective manner such that the composition is
capable of
protecting that animal from a disease mediated by IgE. Therapeutic
compositions of the
present invention can be administered to animals prior to disease in order to
prevent
disease and/or can be administered to animals after disease occurs. The exact
dose,
administration regimen, and administration route of therapeutic compositions
of the
present invention can be determined by one skilled in the art. Additional
teachings are
provided, for example, in PCT Publication No. WO 00/26246, Jardetzky et al.,
published
May 11, 2000; U.S. Patent Publication No. 20030003502-A1, Jardetzky et al.,
published
January 2, 2003; PCT Publication No. WO 01/69253 A3, Jardetzky et al.,
published
September 20, 2001; U.S. Patent Publication No. 20010039479, Jardetzky et al.,
published November 8, 2001; and PCT Publication No. WO 01/68861 A3, Jardetzky
et
al., published September 20, 2001.
One embodiment of the present invention is a kit comprising a mutant IgEH~ or
IgE protein of the present invention. Such a kit is used to identify a
compound that binds
to IgE protein, preferably IgE protein in the closed conformation or that when
such
compound binds to IgE, prevents or restrains it from maintaining or achieving
an open
conformation. Such a kit may also comprise tubes, bottles, reagents, syringes,
literature,
packaging and the like.
The following example is provided for the purpose of illustration and is not
intended to limit the scope of the present invention. The following example
includes a
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
number of recombinant DNA and protein chemistry techniques known to those
skilled in
the art; see for example Sambrook et al., ibid.
Example 1
This Example describes the construction and binding abilities of several
cysteine
mutants of IgEHC proteins or IgEHC's
A. Construction of IgEH~ cysteine mutants:
Several mutant IgEH~ proteins were created by substituting a cysteine into
an unmodified IgEH~ protein having SEQ ID N0:11 thereby enabling the potential
formation of interchain disulfide bonds. The mutant proteins were created
using
polymerise chain reaction (PCR) mutagenesis as follows:
Using an unmodified (unmod) IgEH~ nucleic acid molecule having SEQ ID NO:10
as a template, mutant IgEH~ nucleic acid molecules were amplified by PCR,
under
standard conditions, using a 5' primer that introduced mutations creating a
cysteine
residue at various position. The 5' primers are as follows:
20
30
40
C328A 5'T AGG GCG GAT CCC GCT GCA GAT TCG AAC CCG AGA GGG GTG AGC G 3'
(SEQ ID N0:28)
Arg Ala Asp Pro Ala Ala Asp Ser Asn Pro Arg Gly Val Ser
(SEQ ID N0:29)
C328S 5°T AGG GCG GAT CCC TCT GCA GAT TCG AAC CCG AGA GGG GTG AGC
G 3'
(SEQ ID N0:30)
Arg Ala Asp Pro Ser Ala Asp Ser Asn Pro Arg Gly Val Ser
(SEQ ID N0:31)
C328 5'T AGG GCG GAT CCC TGT GCG GAT TCG AAC CCG AGA GGG GTG AG 3'
(SEQ ID N0:32)
Arg Ala Asp Pro Cys Ala Asp Ser Asn Pro Arg G1y Val
(SEQ ID N0:33)
C329 5'T AGG GCG GAT CCC gcg tgt GAT TCG AAC CCG AGA GGG GTG AG 3'
(SEQ ID N0:34)
Arg Ala Asp Pro Ala Cys Asp Ser Asn Pro Arg Gly Val
(SEQ ID N0:35)
C330 5'T AGG GCG GAT CCC gcg GCG tgt TCG AAC CCG AGA GGG GTG AG 3'
(SEQ ID N0:36)
Arg Ala Asp Pro Ala Ala Cys Ser Asn Pro Arg Gly Val
(SEQ ID N0:37)
C331 5'T AGG GCG GAT CCC gcg GCG GAT tgt AAC CCG AGA GGG GTG AG 3'
(SEQ ID N0:38)
Arg Ala Asp Pro Ala A1a Asp Cys Asn Pro Arg Gly Val
(SEQ ID N0:28)
C332 5'T AGG GCG GAT CCC geg GCG GAT TCG tgt CCG AGA GGG GTG AG 3'
(SEQ ID N0:39)
Arg Ala Asp Pro Ala Ala Asp Ser Cys Pro Arg Gly Val
(SEQ ID N0:40)
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
C333 5'T AGG GCG GAT CCC gcg GCG GAT TCG AAC tgt AGA GGG GTG AG 3'
(SEQ IDN0:41)
Arg Ala AspProAla AlaAspSer CysArg G1yVal
Asn
S (SEQ IDNO:42)
C334 5'T AGG GATCCCgcg GCGGATTCG CCGtgt GGGGTG AG
GCG AAC 3'
(SEQ IDN0:43)
Arg Ala AspProAla AlaAspSer ProCys GlyVal
Asn
10(SEQ IDN0:44)
C335 5'T AGG GATCCCgcg GCGGATTCG CCGAGA tgtGTG AG
GCG AAC 3'
(SEQ IDNO:45)
Arg Ala AspProAla A1aAspSer ProArg CysVal
Asn
15(SEQ IDN0:46)
C336 5'T GATCCCgcg GCGGATTCG CCGAGA GGGtgt AG
AGG AAC 3'
GCG
(SEQ IDN0:47)
Arg Ala AspProAla AlaAspSer ProArg GlyCys
Asn
20(SEQ IDN0:48)
Each of the mutant IgEH~ nucleic acid molecules was ligated into the
expression vector
pAcGP67A (Catalog Number 221220P, Becton Dickinson Pharmingen, Franklin Lakes,
N.J.). The encoded sequence of the N-terminus of the mature (signal sequence
cleaved)
25 protein is ADPCAD with C corresponding to C328 of the mature IgE using the
numbering according to Dorrington and Bennich, 1978, Ini~nunol Rev 41, 3-25.
The
plasmids were transformed into insect (HI-5) insect cells using standard
protocols,
expressed and the resulting proteins analyzed using western blot analysis.
B. Western-blot analysis of unmodified and mutant IgEH~'s
30 Following expression in insect cells, the IgEH~ proteins were analyzed by
western-
blot analysis. Samples of infected cell supernatants were added to PAGe sample
buffer
either with or without reducing agent (e.g. 5 mM DTT). The samples were then
boiled
and separated by SDS-polyacrylamide gel electrophoresis (SDS-PAGe). Following
separation, the proteins were transferred to Immobilon membranes and
the,proteins
35 visualized using an alkaline-phosphatase conjugated, goat anti-human
polyclonal anti-IgE
antibody (Catalog 075-1004, Kirkegaard & Perry Labs, Gaithersburg, MD) using
standard western blotting protocol. The results of this analysis are shown in
Figure 3.
C. Ability of mutmt IgEH~ proteins to bind FceRIa
The ability of the unmodified and mutant IgEH~ proteins to bind the FceRIa
40 protein was compared using an ELISA assay as follows:
The wells of a microtiter plate were coated (50 ng/well) with human FceRIa
(produced as described in U.S. Patent Publication No. US-2001-0039479-A1) in
PBS and
the plate incubated overnight at 4°C. The plate was washed 3X with WASH
buffer (0.5%
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
Tween-20 in 10 rnM Tris, pH 7.5, 150 mM NaCL) and blocked for one hour at room
temperature (RT) using BLOCK buffer (5 °Io dried milk. in 10 mM Tris,
pH 7.5, 150 mM
NaCL). The plate was again washed 3X with WASH buffer and 100 ~,l of IgEHO
(either
unmodified IgEH~ or mutant IgEH~ diluted from 0.5 to 0.065 in BLOCK buffer)
was
added to various wells of the plate. To half of the samples was added 5 mM
DTT. The
plate was then incubated for one hour at RT, washed 3X with WASH buffer, and
100 ~,1
of alkaline-phosphatase conjugated, goat anti-human polyclonal anti-IgE
antibody
(Catalog 075-1004, Kirlcegaard & Perry Labs, Gaithersburg, MD)(use a 1:1000
dilution
of stock solution) was added to each well. The plate was incubated at RT for
one hour,
washed 3X with WASH buffer, rinsed three times with water, and 50 ~.1 of p-
nitrophenyl
phosphate (PNPP) was added to each well. The plate was incubated for 30-60
minutes at
RT and the reaction was stopped by the addition of I O ~,l of 0.5M EDTA. The
plate was
read at 450 nM using an ELISA plate reader. The results are shown below in
Table 1.
Table 1.
0328 C329 C330 C331
(unmod)
5 mM DTT 5 mM 5 mM 5 mM
DTT DTT DTT
Dilution+ - + - + - + -
0.5 0.224 0.257 0.14 0.2570.159 0.161 0.125 0.059
0.25 0.19 0.265 0.01550.1920.13 0.13 0.102 0.038
0.125 0.106 0.243 0 0.0650.039 0.075 0.08950.013
0.065 0.01150.195 -0.0030.0220.001 0.062 0.066 0.038
C332 C333 0334 0335
5 mM 5 mM 5 mM 5 mM
DTT DTT DTT DTT
Dilution+ - + - + - + -
0.5 0.11 0.032 0.16250.1090.0185-0.0040.003 -0.003
0.25 0.01850.012 0.126 0.0210.002 -0.0075-0.0025-0.0075
0.125 0.006 -0.00450.12 -0.01-0.0035-0.015-0.006-0.014
0.125 0.002 0.001 0.068 0.003-0.006-0.0055-0.0075-0.0075
C336
5 mM DTT
Dilution+ -
0.5 0.07050.039
0.25 0.028 0.014
0.125 0.003 -0.0195
0.125 -0.006-0.003
These data indicate that IgEH~ proteins that have cysteine residues
substituted into
their sequence, thereby allowing the formation of inter-chain disulfide bonds,
have a
reduced ability to bind to the human FceRIa protein.
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
Example 2.
This Example describes the production and analysis of crystals of a
glycosylation
mutant of the Ce3/Ce4 domain of human IgE.
A. Construction of a IgE Fc-Ce3/Ce4 CHO mutant
A new mutant IgE-Fc protein was created in which the sequence of the
glycosylation sites in the IgE-Fc-region Ce3/Ce4 domain protein were altered
in order to
prevent glycosylation at these sites. The CHO mutant was created using
polymerase
chain reaction (PCR) mutagenesis as follows:
Using a nucleic acid molecule encoding the IgE Ce3/Ce4 domains of IgE (SEQ ID
NO:10) as a template, 5' nucleic acid molecule and 3' nucleic acid molecule
were created
in two separate PCR reactions. The 5' nucleic acid molecule was synthesized
using the
primers HIGEFCIb and N371Q. The primer HIGEFClb, which has the sequence 5'
TAGGGCTACGTAGATTCCAACCCGAGAGG 3', (represented by SEQ ID N0:3)
contains a Snag I restriction site and encodes an a portion of the Fc protein
having an N-
terminal sequence (following restriction digest with Sna BI) of VDSNPR with D
corresponding to D330 of the mature sequence. The primer N371Q, which has the
sequence 5' ACTGGCTCGAGACCAGGTCAGCTGCACGGTCCCCTTGCTGGGT 3'
(represented by SEQ ID N0:4), introduces unique Xho I and Pvu II sites and
contains the
mutation which changes the asparagine at position 371 to a glutamine. The 3'
nucleic
acid molecule was synthesized using primers N383Q and HIGEFC2B. Primer N383Q,
which has the sequence 5'
CCTGGTCTCGAGCCAGTGGGAAGCCTGTGCAACACTCCACCAGAAAGGAGGA
G 3' (represented by SEQ ID N0:5), introduces a unique Xho I restriction site
and
contains the mutation that changes the asparagine at position 383 to a
glutamine. Primer
HIGEFC2B, which has the sequence 5'
TCTAGGCAGCGGCCGCTTATCATTTACCGGGATTTACAG 3' (represented by SEQ
ID N0:6), terminates the Fc sequence at Lys 547 and contains a Not I
restriction site.
The 5' and 3' nucleic acid molecules were generated using standard PCR
conditions, gel
purified and then digested with the restriction enzymes Snag I and Xho I (5'
fiagment ) or
Not I and Xho I ( 3' fragment). The digested nucleic acid molecules were then
ligated
together at their Xho I sites to yield a nucleic acid molecule encoding the
Ce3/Ce4
domains containing the glycosylation site mutations (represented by SEQ ID
N0:7).
Translation of the newly constructed nucleic acid molecule results in a
protein
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
(represented by SEQ ID N0:8) lacking glycosylation recognition sites at
positions 371
and 383.
For expression in insect cells, the newly constructed nucleic acid molecule
encoding the Ce3/Ce4 domains for the carbohydrate mutant was amplified using
primers
IgECABac and HIGEF2b. The primer IgECAbac, which has the sequence 5'
TAGGGCGGATCCCTGTGCAGATTCGAACCCGAGAGGGGTGAGCG3'
(represented by SEQ ID N0:9), contains a BamH I site for cloning the nucleic
acid
molecule behind a signal sequence in the expression vector pAcGP67A (Catalog
Number
221220P, Becton Dickinson Pharmingen, Franklin Lakes, N.J.). The encoded
sequence
of the N-terminus of the mature (signal sequence cleaved) protein is ADPCAD
with C
corresponding to C328 of the mature IgE. Following amplification, the nucleic
acid
molecule was digested with BamH I and Not I, gel purified and ligated into the
pAcGP67A vector.
B. Expression, purification and crystallization of the CHO mutant proteins
The IgE-Fc CHO mutant protein was expressed, purified to homogeneity and
crystallized. The expression, purification, crystallization, characterization
and data
collection and refinement of the mutant protein was performed as described in
Example 1
and Example 2 of U.S. Patent Publication No. US-2001-0039479-A. Three new
crystals
were generated and data obtained from these crystals are shown in Table 2.
Table 2. Data for the CHO mutant IgE Protein Crystals
S ace Groua b c Mol/as Resolution
m
Cr stal C2 158 108 50 102 1.5 2.3
l
Cr stal2P21 66 99 77 97 2.0 2
.45
Crystal P21 (Big) ~ ~ 150 96 3.0 ~ _
3 48 104 ~ _
2.8 ~~
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
The data collection and refinement statistics obtained from Crystal 1 are
shown
below in Table 3.
Statistics based on m10 bi50CH0 m25 bi5_m35 P+EBA.pdb
Table 3: Data Collection and Refinement
C2 (f5) (pH 4.6)
Data Collection Statistics
Source APS DND 5-ID
Wavelength (A) 1.008
Resolution (A) 30.0-2.30 (2.38 - 2.30)t
Completeness 98.8% (89.8%)fi
Unique reflections (Total) 36,675 (139,507)
Average redundancy 3.8 (3.7)t
<I/~I> 15.4 (2.4)t
Rmerge 6.2% (41.3%)1
Refinement
No. of Reflections (free)36,675 (1,866)
Rwork~free 27.4/29.3
Atoms (Total) 5059
Protein Atoms 4909
Water Molecules 0
Carbohydrate Atoms 150
Average B factor
Protein x59.6 AZ
RMS Deviations from Ideality
Bond angles 1.33 °
Bond lengths 0.008 A
Ramachandran (~'F
Favored 86.5 %
Allowed 12.2 %
Generous 0.9 %
Disallowed 0.4 %
fi Values for the highest resolution shell are shown in parentheses
Rmerge=EIh-<I>I/EIII, where Ii is the intensity of an individual reflection
and <I> is the
average intensity of that reflection.
RWOrufree= EIIFpI-IF~II/EIFPI, where F° is the calculated and FP is the
observed structure
factor amplitude. RWork and Rfree were calculated using the working set and
test set
reflections, respectively.
Cell a=158.8 b=108.5 c= 50.4 (3=102° [**These are Denzo ave (not
scalepack)
refined]
Refinement values based on m10 bi50CH0 m25 bi5_m35_p+EBA.pdb
Total # residues = 627
1.5 dimers/asu (=1.5 Fc molecules/asu)
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
The data collection and refinement statistics obtained from Crystal 2 are
shown
below in Table 4.
Statistics based on min300 c3l.pdb
Table 4: Data Collection
and Refinement
P21 (f8) (pH 4.6)
Data Collection Statistics
Source APS DND 5-ID
Wavelength (A) 1.000
Resolution (A) 30.0-2.45 (2.54 - 2.45)t
Completeness 98.2% (82.3%)~
Unique reflections 36,017 (128,258)
(Total)
Average redundancy 3.63 (2.3)x'
<Il6I> 22.2 ( 3.35)t
Rmerge 5.9% (24.1%)t
Refinement
No. of Reflections 34,123 (1,824)
(free)
Rwork~free 29.3/31.2
Atoms (Total) 6,345
Protein Atoms 6,345
Water Molecules 0
Carbohydrate Atoms 0
Average B factor
Protein 48.3 Aa
RMS Deviations from Ideality
Bond angles 3.06
Bond lengths 0.03 A
Ramachandran (~,yr)
Favored 85.7 %
Allowed 11.2 %
Generous 1.8 %
Disallowed 1.3 %
~ Values for the highest resolution shell are shown in parentheses
R",erge=E~II-<I>I/EIII, where I; is the intensity of an individual reflection
and <I> is the
average intensity of that reflection.
Rw°rx~free= EI~FPI-IF°I~/~IFPI, where F° is the
calculated and Fp is the observed structure
factor amplitude. RW°r~ and Rfree were calculated using the working set
and test set
reflections, respectively. ,
Cell a=65.7 b= 99.6 c=77.9 (3=97.1 °
Refinement values based on min300 c3l.pdb
Total # residues = 816
2 dimers/asu (= 2 Fc molecules/asu)
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
The data collection and refinement statistics obtained from Crystal 3 are
shown
below in Table 5.
Statistics based on m200 bi14v3 bgl0 bd8 m250 BE new.pdb
Table 5: Data Collection and Refinement
P21 "BIG" (f7) (pIi 4.6)
Data Collection Statistics
Source APS DND 5-ID
Wavelength (A) 1.000
Resolution (A) 30.0-2.80 (2.90
- 2.80)t
Completeness 98.9% (100%)t
Unique reflections 36,906 (139,248)
(Total)
Average redundancy 3.8 (3.8)t
<I/6I> 16.7 (4.9)t
Rmerge 7.3% (54.1%)~
Refinement
No. of Reflections 35,046 (1,860)
(free)
Rwork~free 31.3/36.0
Atoms (Total) 9,300
Protein Atoms 9,300
Water Molecules 0
Carbohydrate Atoms 0
Average B factor
Protein 72.3 A2
RMS Deviations from Ideality
Bond angles 1.41
Bond lengths 0.009 A
Ramachandran (~,~r)
Favored 82.9 %
Allowed 13.9 %
Generous 2.5 %
Disallowed 0.6 %
fi Values for the highest resolution shell are shown in parentheses
R,nerge=~~II-<I>I/EIII, where I; is the intensity of an individual reflection
and <I> is the
average intensity of that reflection.
Rwou~fuee= ~I~FPI-IF°I~/~IFpI, where F° is the calculated and Fp
is the observed structure
factor amplitude. RWOUx and Rfree were calculated using the working set and
test set
reflections, respectively.
Cell a=48.9 b=104.9 c=150.0 (3=96.2°
Refinement values based on m165 bi15v2 bgl0 bd28 m250 BE new.pdb
Total # residues = 1,182
3 dimers/asu (= 3 Fc molecule/asu)
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
C. Description of the IgE Fc-region Ce3/Ce4 domain mutant protein structure
The new crystal forms reveal additional information on the IgE-Fc
conformational
change, showing that the C3 domains can adopt a variety of intermediate
conformations
between the open and closed forms. Interestingly, the C3 domains that are in
the closed
conformation are generally more similar and therefore probably more restricted
in their
conformational flexibility. In contrast, those C3 domains that are closer to
the open
conformation adopt a wider variety of side-side conformations, suggesting that
there are
fewer restrictions on the movements of the domains in the open configuration.
These
differences may have an impact on drug design and binding to the different
forms and
could be important for docking experiments.
Analysis of the conformational ensemble revealed by the determination of these
additional crystal forms of the IgE-Fc suggest how dynamic motions within the
IgE-Fc
may be coupled to receptor binding and dissociation. For example,
conformational
changes of the IgE-Fc are likely important to the microscopic steps in
association and
release from the receptor Binding Sites 1 and 2. In addition, analysis of the
conformational ensemble suggests how interactions with the IgE Ce2 domain
could be
involved in restricting such conformational flexibility and influence the
rates of binding
and dissociation from the receptor. The range of motions and conformational
arrangements of the Ce3 domains observed in these multiple crystal forms
establish a set
of preferred arrangements which restrict possible models and approaches to
blocking IgE
binding to its receptor and to stimulating dissociation from the bound state.
While the various embodiments of the present invention have been described in
detail, it is apparent that modifications and adaptations of those embodiments
will occur
to those skilled in the art. It is to be expressly understood, however, that
such
modifications are adaptations are within the scope of the present invention,
as set forth in
the following claims.
CA 02494115 2005-O1-31
WO 2004/013158 PCT/U52003/024336
SEQUENCE LISTING
<110> Jardetzky, Theodore S.
Wurzburg, Beth A.
<120> MUTANTS OF IgE PROTEINS AND USES THEREOF
<130> AL-11-C1-PCT
<140> not yet assigned
<141> 2003-OB-01
<150> 60/319,446
<151> 2002-08-02
<150> 10/211,948
<151> 2002-08-O1
<160> 49
<170> PatentIn version 3.2
<210> 1
<211> 669
<212> DNA
<213> Homo sapiens
<220>
<221> CDS
<222> (1)..(666)
<400> 1
gcggat tgt gat tcc sac ccg aga ggg gtg agc gcc 48
ccc tac cta agc
AlaAsp Cys Asp Ser Asn Pro Arg Gly Val Ser Ala
Pro Tyr Leu Ser
2 5 10 15
cggccc ccg ttc gac ctg ttc atc cgc aag tcg ccc .
agc acg atc acc 96
ArgPro Pro Phe Asp Leu Phe Ile Arg Lys Ser Pro
Ser Thr Ile Thr
20 25 30
tgtctg gtg gac ctg gca ccc agc aag ggg acc gtg 144
gtg aac ctg acc
CysLeu Val Asp Leu Ala Pro Ser Lys Gly Thr Val
Val Asn Leu Thr
35 40 45
tggtcc gcc agt ggg aag cct gtg aac cac tcc acc 192
cgg aga aag gag
TrpSer Ala Ser Gly Lys Pro Val Asn His Ser Thr
Arg Arg Lys Glu
50 55 60
gagaag cgc aat ggc acg tta acc gtc acg tcc acc 240
cag ctg ccg gtg
GluLys Arg Asn Gly Thr Leu Thr Val Thr Ser Tlzt
Gln Leu Pro Val
65 70 75 80
ggcacc gac tgg atc gag ggg gag acc tac cag tgc 288
cga agg gtg acc
GlyThr Asp Trp Ile Glu G1y Glu Thr Tyr Gln Cys
Arg Arg Val Thr
85 90 95
cacccc ctg ccc agg gcc ctc atg cgg tcc acg acc 336
cac aag acc agc
HisPro Leu Pro Arg Ala Leu Met Arg Ser Thr Thr
His Lys Thr Ser
100 105 110
ggcccg get gcc ccg gaa gtc tat gcg ttt gcg acg 384
cgt ccg gag tgg
GlyPro Ala Ala Pro Glu Val Tyr Ala Phe Ala Thr
Arg Pro Glu Trp
115 120 125
Page 1
CA 02494115 2005-O1-31
WO 2004/013158 PCT/i1S2003/024336
ccg ggg agc cgg gac aag cgc acc ctc gcc tgc ctg 432
atc cag aac ttc
Pro Gly Ser Arg Asp Lys Arg Thr Leu Ala Cys Leu
Ile Gln Asn Phe
130 135 140
atg cct gag gac atc tcg gtg cag tgg ctg cac aac 480
gag gtg cag ctc
Met Pro Glu Asp Ile Ser Val Gln Trp Leu His Asn
Glu Val Gln Leu
145 150 155 160
ccg gac gcc cgg cac agc acg acg cag ccc cgc aag 528
acc aag ggc tcc
Pro Asp Ala Arg His Ser Thr Thr Gln Pro Arg Lys
Thr Lys Gly Set
165 170 175
ggc ttc ttc gtc ttc agc cgc ctg gag gtg acc agg 576
gcc gaa tgg gag
Gly Phe Phe Val Phe Ser Arg Leu Glu Val Thr Arg
Ala Glu Trp Glu
180 185 190
cag aaa gat gag ttc atc tgc cgt gca gtc cat gag 624
gca gcg agc ccc
Gln Lys Asp Glu Phe Ile Cys Arg Ala Va1 His Glu
Ala Ala Ser Pro
195 200 205
tca cag acc gtc cag cga gcg gtg tct gta aat ccc 669
ggt aaa tga
Ser Gln Thr Val Gln Arg Ala Val Ser Val Asn Pro
Gly Lys
210 215 220
<210> 2
<211> 222
<212> PRT
<213> Homo Sapiens
<400> 2
A1a Asp Pro Cys Asp Ser Asn Pro Arg Gly Val Ser Ala Tyr Leu Ser
1 5 10 15
Arg Pro Ser Pro Phe Asp Leu Phe Ile Arg Lys Ser Pro Thr Ile Thr
20 25 30
Cys Leu Val Val Asp Leu Ala Pro Ser Lys Gly Thr Val Asn Leu Thr
35 40 45
Trp Ser Arg Ala Ser Gly Lys Pro Val Asn His Ser Thr Arg Lys Glu
50 55 60
G1u Lys Gln Arg Asn Gly Thr Leu Thr Val Thr Ser Thr Ireu Pro Val
65 70 75 80
Gly Thr Arg Asp Trp Ile Glu G1y Glu Thr Tyr Gln Cys Arg Val Thr
85 90 95
His Pro His Leu Pro Arg Ala Leu Met Arg Ser Thr Thr Lys Thr Ser
100 105 110
Gly Pro Arg Ala Ala Pro Glu Val Tyr Ala Phe Ala Thr Pro Glu Trp
115 120 125
Page 2
CA 02494115 2005-O1-31
WO 2004/013158 PCTlUS20031024336
Pro Gly Ser Arg Asp Lys Arg Thr Leu Ala Cys Leu Ile Gln Asn Phe
130 135 140
Met Pro Glu Asp Ile Ser Val Gln Trp Leu His Asn Glu Val Gln Leu
145 150 155 160
Pro Asp Ala Arg His Ser Thr Thr Gln Pro Arg Lys Thr Lys Gly~Ser
165 170 175
Gly Phe Phe Val Phe Ser Arg Leu Glu Val Thr Arg Ala Glu Trp Glu
180 185 290
Gln Lys Asp Glu Phe Ile Cys Arg Ala Val His Glu Ala Ala Sex Pro
195 200 205
Ser Gln Thr Val Gln Arg Ala Val Ser Val Asn Pro Gly Lys
210 215 220
<210> 3
<211> 29
<212> DNA
<213> Artificial sequence
<220>
<223> Synthetic Primer
<400> 3
tagggctacg tagattccaa cccgagagg 29
<210> 4
<211> 43
<212> DNA
<213> Artificial sequence
<220>
<223> Synthetic Primer
<400> 4
actggctcga gaccaggtca gctgcacggt ccccttgctg ggt 43
<210> 5
<211> 53
<212> DNA
<213> Artificial sequence
<220>
<223> Synthetic Primer
<400> 5
cctggtctcg agccagtggg aagcctgtgc aacactccac cagaaaggag gag 53
<210> 6
<211> 39
<212> DNA
Page 3
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
<213> Artificial sequence
<220>
<223> Synthetic Primer
<400> 6
tctaggcagc ggccgcttat catttaccgg gatttacag 39
<210> 7
<211> 672
<212> DNA
<213> Homo Sapiens
<220>
<221> CDS
<222> (1)._(672)
<400> 7
gcg gat ccc gat tcc aac ccg aga ggg gtg agc 48
tgt gcg gcc tac cta
Ala Asp Pro Asp Ser Asn Pro Arg Gly Val Ser
Cys A1a Ala Tyr Leu
1 5 10 15
agc cgg ccc ttc gac ctg ttc atc cgc aag tcg 96
agc ccg ccc acg atc
Ser Arg Pro Phe Asp Leu Phe Ile Arg Lys 5er
Ser Pro Pro Thr Ile
20 25 30
acc tgt ctg gac ctg gca ccc agc aag ggg acc 144
gtg gtg gtg cag ctg
Thr Cys Leu Asp Leu Ala Pro Ser Lys Gly Thr
Val Val Val Gln Leu
35 40 45
acc tgg tcc agt ggg aag cct gtg caa cac tcc 192
cgg gcc acc aga aag
Thr Trp Ser 5er Gly Lys Pro Val Gln His Ser
Arg A1a Thr Arg Lys
50 55 60
gag gag aag aat ggc acg tta acc gtc acg tcc 240
cag cgc acc ctg ccg
Glu Glu Lys Asn Gly Thr Leu Thr Val Thr Ser
Gln Arg Thr Leu Pro
65 70 75 80
gtg ggc acc tgg atc gag ggg gag acc tac cag 288
cga gac tgc agg gtg
Val Gly Thr Ti-p Ile Glu Gly Glu Thr Tyr Gln
Arg Asp Cys Arg Val
85 90 95
acc cac ccc ccc agg gcc ctc atg cgg tcc acg 336
cac ctg acc aag acc
Thr His Pro Pro Arg Ala Leu Met Arg Ser Thr
His Leu Thr LyS Thr
200 105 110
agc ggc ccg gcc ccg gas gtc tat gcg ttt gcg 384
cgt get acg ccg gag
Ser Gly Pro Ala Pro Glu Val Tyr Ala Phe Ala
Arg Ala Thr Pro Glu
115 120 125
tgg ccg ggg gac aag cgc acc ctc gcc tgc ctg 432
agc cgg atc cag aac
Trp Pro Gly Asp Lys Arg Thr Leu Ala Cys Leu
Ser Arg Ile Gln Asn
130 135 140
ttc atg cct atc tcg gtg cag tgg ctg cac aac 480
gag gac gag gtg cag
Phe Met Pro Tle Ser Val Gln Trp Leu His Asn
Glu Asp Glu Val Gln
145 150 155 160
ctc ccg gac cac agc acg acg cag ccc cgc aag 528
gcc cgg acc aag ggc
Leu Pro Asp His Ser Thr Thr Gln Pro Arg Lys
Ala Arg Thr Lya Gly
165 170 175
Page 4
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
tcc ggc ttc ttc gtc ttc agc cgc ctg gag gtg acc agg gcc gaa tgg 576
5er Gly Phe Phe Val Phe Ser Arg Leu Glu Val Thr Arg Ala Glu Trp
180 185 . 190
gag cag aaa gat gag ttc atc tgc cgt gca gtc cat gag gca gcg agc 624
Glu Gln Lys Asp Glu Phe Ile Cys Arg Ala Val His Glu Ala Ala Ser
195 200 205
ccc tca cag acc gtc cag cga gcg gtg tct gta aat ccc ggt aaa tga 672
Pro Ser Gln Thr Val Gln Arg Ala Val Ser Val Asn Pro Gly Lys
210 215 220
<210> 8
<211> 223
<212> PRT
<213> Homo Sapiens
<400> 8
Ala Asp Pro Cys Ala Asp Ser Asn Pro Arg Gly Val Ser Ala Tyr Leu
1 5 SO 15
Ser Arg Pro Ser Pro Phe Asp Leu Phe Ile Arg Lys Ser Pro Thr Ile
20 25 30
Thr Cys Leu Val Val Asp Leu A1a Pro Ser Lys Gly Thr Val Gln Leu
35 40 45
Thr Trp Ser Arg Ala Ser Gly Lys Pro Val Gln His Ser Thr Arg Lys
50 55 60
Glu Glu Lys Gln Arg Asn Gly Thr Leu Thr Val Thr Ser Thr Leu Pro
65 70 75 80
val Gly Thr Arg Asp Trp Ile Glu Gly Glu Thr Tyr Gln Cys Arg Val
85 90 95
Thr His Pro His Leu Pro Arg Ala Leu Met Arg Ser Thr Thr Lys Thr
100 105 110
Ser Gly Pro Arg Ala Ala Pro Glu Val Tyr Ala Phe Ala Thr Pro Glu
115 120 125
Trp Pro Gly Ser Arg Asp Lys Arg Thr Leu Ala Cys Leu Ile Gln Asn
130 135 140
Phe Met Pro Glu Asp Ile Ser Va1 Gln Trp Leu His Asn Glu Val Gln
145 150 155 160
Leu Pro Asp Ala Arg His Ser Thr Thr Gln Pro Arg Lys Thr Lys Gly
165 170 175
Page 5
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
Ser Gly Phe Phe Val Phe Ser Arg Leu Glu Val Thr Arg Ala Glu Trp
180 185 190
Glu Gln Lys Asp Glu Phe Ile Cys I~:g Ala Val His Glu Ala Ala Ser
195 200 205
Pro Ser Gln Thr Val Gln Arg Ala Val Ser Val Asn Pro Gly Lys
210 215 220
<210> 9
<211> 44
<212> DNA
<213> Artificial sequence
<220>
<223> Synthetic Primer
<400> 9
tagggcggat ccctgtgcag attcgaaccc gagaggggtg agcg 44
<210> 10
<211> 663
<212> DNA
<213> Homo sapiens
<220>
<221> CDS
<222> (1)..(663)
<400> 10
tgtgcggat tccaacccgagaggggtgagcgcctacctaagccggccc 48
CysAlaAsp SerAsnProArgGlyValSerAlaTyrLeuSerArgPro
1 5 10 15
ageccgttc gacctgttcatccgcaagtcgcccacgatcacctgtctg 96
SerProPhe AspLeuPheIleArgLysSerProThrIleThrCysLeu
20 25 30
gtggtggac ctggcacccagcaaggggaccgtgaacctgacctggtcc 144
ValValAsp LeuAlaProSerLysGlyThrValAsnLeuThrTrpSer
35 40 45
cgggccagt gggaagcctgtgaaccactccaccagaaaggaggagaag 192
ArgAlaSer GlyLysProValAsnHisSerThrArgLysGluGluLys
50 55 6D
cagcgcaat ggcacgttaaccgtcacgtccaccctgccggtgggcacc 240
GlnArgAsn GlyThrLeuThrValThrSerThrLeuProValGlyThr
65 . 70 75 80
cgagactgg atcgagggggagacctaccagtgcagggtgacccacccc 288
ArgAspTrp IleG1uGlyGluThrTyrGlnCysArgValThrHisPro
85 90 95
cacctgccc agggccctcatgcggtccacgaccaagaccagcggcccg 336
HisLeuPro ArgAlaLeuMetArgSerThrThrLysThrSerGlyPro
100 1D5 110
cgt get gcc ccg gaa gtc tat gcg ttt gcg acg ccg gag tgg ccg ggg 384
Page 6
CA 02494115 2005-O1-31
WO 20041013158 PCT/U52003/024336
Arg Ala Ala Pro Glu Val Tyr Ala Phe Ala Thr Pro Glu Trp Pro Gly
115 120 125
agc gacaagcgcaccctcgcctgcctgatccagaacttcatgcct 432
cgg
Ser AspLysAxgThrLeuAlaCysLeuIleGlnAsnPheMetPro
Arg
130 135 140
gag atctcggtgcagtggctgcacaacgaggtgcagctcccggac 480
gac
Glu IleSerValGlnTrpLeuHisAsnGluValGlnLeuProAsp
Asp
145 150 155 160
gcc cacagcacgacgcagccccgcaagaccaagggctccggcttc 528
cgg
A1a HisSerThrThrGlnProArgLysThrLysGlySerGlyPhe
Arg
165 170 175
ttc ttcagccgcctggaggtgaccagggccgaatgggagcagaaa 576
gtc
Phe PheSerArgLeuGluValThrArgAlaGluTrpG1uGlnLys
Val
180~ 185 190
gat ttcatctgccgtgcagtccatgaggcagegagcccctcacag 624
gag
Asp PheTleCysArgAlaValHisGluAlaAlaSerProSerGln
Glu
195 200 205
acc cagcgagcggtgtctgtaaatcccggtaaatga 663
gtc
Thr GlnArgAlaValSerValAsnProGlyLya
Val
210 215 220
<210> 11
<211> 220
<212> PRT
<213> Homosapiens
<400> 11
Cys Als Asp Ser Asn Pro Arg Gly Val Ser Ala Tyr Leu Ser Arg Pro
1 5 10 15
Ser Pro Phe Asp Leu Phe Ile Arg Lys Ser Pro Thr Ile Thr Cys Leu
20 25 30
Val Val Asp Leu Ala Pro Ser Lys Gly Thr Val Asn Leu Thr Trp Ser
35 40 45
Arg Ala Ser Gly Lys Pro Val Asn His Ser Thr Arg Lys Glu Glu Lys
50 55 60
Gln Arg Asn Gly Thr Leu Thr Val Thr Ser Thr Leu Pro Val Gly Thr
65 70 75 80
Arg Asp Trp Ile Glu Gly Glu Thr Tyr Gln Cys Arg Val Thr His Pro
85 90 95
His Leu Pro Arg Ala Leu Met Arg Ser Thr Thr Lys Thr Ser Gly Pro
100 105 110
Arg Ala Ala Pro Glu Val Tyr Ala Phe Ala Thr Pro Glu Trp Pro Gly
Page 7
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
115 120 125
Ser Arg Asp Lys Arg Thr Leu Ala Cys Leu Ile Gln Asn Phe Met Pro
130 135 140
Glu Asp Ile Ser Val Gln Trp Leu His Asn G1u Val Gln Leu Pro Asp
145 150 155 160
Ala Arg His Ser Thr Thr Gln Pro Arg Lys Thr. Lys Gly Ser Gly Phe
165 170 175
Phe Val Phe Ser Arg Leu Glu Val Thr Arg Ala Glu Trp Glu Gln Lys
180 185 190
Asp Glu Phe Ile Cys Arg Ala Val His Glu Ala Ala Ser Pro Ser Gln
195 200 205
Thr Val Gln Arg Ala Val Ser Val Asn Pro Gly Lys
210 215 220
<210> 12
<211> 663
<212> DNA
<213> Homo sapiens
<220>
<221> CDS
<222> (1)..(663)
<400> 12
gcgtgtgattccaacccgagaggggtgagc gcctacctaagccggccc 48
AlaCysAspSerAsnProArgGlyValSer AlaTyrLeuSerArgPro
1 5 10 15
agcccgttcgacctgttcatccgcaagtcg cccacgatcacctgtctg 96
SerProPheAspLeuPheileArgLysSer ProThrIleThrCysLeu
20 25 30
gtggtggacctggcacccagcaaggggacc gtgaacctgacctggtcc 144
ValValAspLeuAlaProSerLysGlyThr ValAsnLeuThrTrpSer
35 40 45
cgggccagtgggaagcctgtgaaccactcc aceagaaaggaggagaag 192
ArgAlaSerGlyLysProValAsnHisSer ThrArgLysGluGluLys
50 55 60
cagcgcaatggcacgttaaccgtcacgtcc accctgccggtgggcaoc 240
GlnArgAsnGlyThrLeuThrValThrSer ThrLeuProValGlyThr
65 70 75 80
cgagactggatcgagggggagacctaccag tgcagggtgacccacccc 288
ArgAspTrpIleGluGlyGluThrTyrGln CysArgValThrHisPro
85 90 95
cacctgcccagggccctcatgcggtccacg accaagaccagcggcccg 336
HisLeuProArgAlaLeuMetArgSerThr ThrLysThrSerGlyPro
Page
8
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
100 105 110
cgt get gcc ecg gaa gtc tat gcg ttt gcg acg ccg gag tgg ccg ggg 384
Arg Ala Ala Pro Glu Val Tyr Ala Phe Ala Thr Pro Glu Trp Pro Gly
115 120 125
agc cgg gac aag cgc acc ctc gcc tgc ctg atc cag aac ttc atg cct 432
Ser Arg Asp Lys Arg Thr Leu Ala Cys Leu Ile Gln Asn Phe Met Pro
l30 135 140
gag gac tcg gtg cag tgg ctg cac aac gag gtg cag 480
atc ctc ccg gac
Glu Asp Sex Val Gln Trp Leu His Asn Glu Val Gln
Ile Leu Pro Asp
145 150 155 160
gc~ cgg agc acg acg cag ccc cgc aag acc aag ggc 528
cac tcc ggc ttc
Ala Arg Ser Thr Thr Gln Pro Arg Lys Thr Lys Gly
His Ser Gly Phe
165 170 175
ttc gtc agc cgc ctg gag gtg acc agg gcc gaa tgg 576
ttc gag cag aaa
Phe Val Ser Arg Leu Glu Val Thr Arg Ala Glu Trp
Phe Glu Gln Lys
180 185 190
gat gag atc tgc cgt gca gtc cat gag gca gcg agc 624
ttc ccc tca cag
Asp Glu Ile Cys Arg Ala Val His Glu Ala Ala Ser
Phe Pro Ser Gln
195 200 205
acc gtc cga gcg gtg tct gta aat ccc ggt aaa tga 663
cag
Thr Val Arg Ala Val Ser Val Asn Pro Gly Lys
Gln
27.0 215 220
<210> 13
<211> 220
<212> PRT
<213> Homo sapiens
<400> 13
Ala Cys Asp Ser Asn Pro Arg Gly Val Ser A1a Tyr Leu Ser Arg Pro
1 5 10 15
Ser Pro Pha Asp Leu Phe Ile Arg Lys Ser Pro Thr Ile Thr Cys Leu
20 25 30
Val Val Asp Leu Ala Pro Ser Lys Gly Thr Val Asn Leu Thr Trp Ser
35 40 45
Arg Ala Ser Gly Lys Pro Val Asn His Ser Thr Arg Lys Glu Glu Lys
50 55 60
Gln Arg Asn Gly Thr Leu Thr Val Thr Ser Thr Leu Pro Val Gly Thr
65 70 75 80
Arg Asp Trp Ile Glu Gly Glu Thr Tyr Gln Cys Arg Val Thr His Pro
85 90 95
His Leu Pro Arg Ala Leu Met Arg Ser Thr Thr Lys Thr Ser Gly Pro
100 105 110
Page 9
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
Arg Ala Ala Pro Glu Val Tyr Ala Phe Ala Thr Pro Glu Trp Pro Gly
115 120 125
Ser Arg Asp Lys Arg Thr Leu Ala Cys Leu Ile Gln Asn Phe Met Pro
130 135 140
Glu Asp Ile Ser Val Gln Trp Leu His Asn Glu Val Gln Leu Pro Asp
145 1S0 155 160
Ala Arg His Ser Thr Thr Gln Pro Arg Lys Thr Lys Gly Ser Gly Phe
165 170 175
Phe Val Phe Ser Arg Leu Glu Val Thr Arg Ala Glu Trp Glu Gln Lys
180 185 190
Asp Glu Phe Ile Cys Arg Ala Val His Glu Ala Ala 5er Pro 5er Gln
195 200 205
Thr Val Gln Arg Ala Val Ser Val Asn Pro Gly Lys
210 215 220
<210> 14
<211> 663
<212> DNA
<213> Homo Sapiens
<220>
<221> CDS
<222> (1)..(663)
<400> 14
gcg gcg tgy tcc aac ccg aga ggg gtg agc gcc tac 48
cta agc cgg ccc
Ala Ala Cys Ser Asn Pro Arg Gly Val Ser Ala Tyr
Leu Ser Arg Pro
1 5 10 15
agc ccg ttc gac ctg ttc atc cgc aag tcg ccc acg 96
atc acc tgt ctg
Ser Pro Phe Asp Leu Phe Ile Arg Lys Ser Pro Thr
Ile Thr Cys Leu
20 25 30
gtg gtg gac ctg gca ccc agc aag ggg acc gtg aac 144
ctg acc tgg tcc
Val Val Asp Leu Ala Pro Ser Lys Gly Thr Val Asn
Leu Thr Trp Ser
35 40 45
cgg gcc agt ggg aag cct gtg aac cac tcc acc aga 192
aag gag gag aag
Arg Ala Ser Gly Lys Pro Val Asn His Ser Thr Arg
Lys Glu Glu Lys
50 55 60
cag cgc aat ggc acg tta acc gtc acg tcc acc ctg 240
ccg gtg ggc acc
Gln Arg Asn Gly Thr Leu Thr Val Thr Ser.Thr Leu
Pro Val Gly Thr
65 70 75 80
cga gac tgg atc gag ggg gag ace tac cag tgc agg 288
gtg acc cac ccc
Arg Asp Trp Ile Glu Gly Glu Thr Tyr Gln Cys Arg
Val Thr His Pro
85 90 95
Page 10
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
cac cccagggccctcatgcggtccacgaccaagaccagcggcccg 336
ctg
His ProArgAlaLeuMetArgSerThrThrLysThr5erGlyPro
Leu
100 105 110
cgt gccccggaagtctatgcgtttgcgacgccggagtggccgggg 384
get
Arg AlaProGluValTyrAlaPheAlaThrProGluTrpProGly
Ala
115 120 125
agc gacaagcgcaccctcgcctgcctgatccagaacttcatgcct 432
cgg
Ser AspLysArgThrLeuAlaCysLeuIleGlnAsnPheMetPro
Arg
130 135 140
gag atctcggtgcagtggctgcacaacgaggtgcagctcccggac 480
gac
Glu IleSerValGlnTrpLeuHisAsnGluValGlnLeuProAsp
Asp
145 150 155 160
gcc cacagcacgacgcagccccgcaagaccaagggctccggcttc 528
cgg
Ala HisSerThrThrGlnProArgLysThrLysGlySerGlyPhe
Arg
165 170 175
ttc ttcagccgcctggaggtgaccagggccgaatgggagcagaaa 576
gtc
Phe Phe5erArgLeuGluValThrArgAlaGluTrpGluGlnLys
Val
180 185 190
gat ttcatctgccgtgcagtccatgaggcagcgagcccctcacag 624
gag
Asp PheIleCysArgAlaValHisGluAlaA1aSerProSerGln
Glu
195 200 205
acc cagcgagcggtgtctgtaaatcccggtaaatga 663
gtc
Thr G1nArgAlaVa1SerValAsnProGlyLys
Val
210 215 220
<210> 15
<211> 220
<212> PRT
<213> Homosapiens
<400> 15
Ala Ala Cys Ser Asn Pro Arg Gly Val Ser Ala Tyr Leu Ser Arg Pro
1 5 . 10 15
Ser Pro Phe Asp Leu Phe 21e Arg Lys Ser Pro Thr I1e Thr Cys Leu
20 25 30
Val Val Asp Leu Ala Pro Ser Lys Gly Thr Val Asn Leu Thr Trp Ser
35 40 45
Arg Ala Ser Gly Lys Pro Val Asn His Ser Thr Arg Lys Glu Glu Lys
50 55 60
Gln Arg Asn Gly Thr Leu Thr Val Thr Ser Thr Leu Pro Val Gly Thr
65 70 75 80
Arg Asp Trp Ile Glu Gly Glu Thr Tyr Gln Cys Arg Val Thr His Pro
85 90 95
Page 11
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
His Leu Pro Arg Ala Leu Met Arg Ser Thr Thr Lys Thr Ser Gly Pro
100 105 110
Arg Ala Ala Pro Glu Val Tyr Ala Phe Ala Thr Pro Glu Trp Pro Gly
115 120 125
Ser Arg Asp Lys Arg Thr Leu Ala Cys Leu Ile Gln Asn Phe Met Pro
130 135 140
Glu Asp Ile Ser Val Gln Trp Leu His Asn Glu Val Gln Leu Pro Asp
145 150 155 160
Ala Arg His Ser Thr Thr Gln Pro Arg Lys Thr Lys Gly Ser Gly Phe
165 170 175
Phe Val Phe Ser Arg Leu Glu Val Thr Arg Ala Glu Trp Glu Gln Lys
180 185 190
Asp Glu Phe I1e Cys Arg Ala Val His Glu Ala A1a Ser Pro Ser Gln
195 200 205
Thr Val Gln Arg Ala Val Ser Val Asn Pro Gly Lys
210 215 220
<210> 16
<211> 663
<212> DNA
<213> Homo Sapiens
<220>
<221> CDS
<222> (1)..(663)
<400> 16
gcg gcg gat tgy aac ccg aga ggg gtg agc gcc tac 48
cta agc cgg ccc
Ala Ala Asp Cys Asn Pro Arg Gly Va1 Ser Ala Tyr
Leu Ser Arg Pro
1 5 10 15
agc ccg ttc gac ctg ttc atc cgc aag tcg ccc acg 96
atc acc tgt ctg
Ser Pro Phe Asp Leu Phe Ile Arg Lys Sex Pro Thr
Ile Thr Cys Leu
20 25 30
gtg gtg gac ctg gca ccc agc aag ggg acc gtg aac 144
ctg acc tgg tcc
Val Val Asp Leu A1a Pro Ser Lys Gly Thr Val Asn
Leu Thr Trp Ser
35 40 45
cgg gcc agt ggg aag cct gtg aac cac tcc acc aga 192
aag gag gag aag
Arg Ala Ser Gly Lys Pro Val Asn His Ser Thr Axg
Lys Glu Glu Lys
50 55 60
cag cgc aat ggc acg tta acc gtc acg tcC acc ctg 240
ccg gtg ggc acc
Gln Arg Asn Gly Thr Leu Thr Val Thr Ser Thr Leu
Pro Val Gly Thr
65 70 75 80
Page 12
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
cgagactggatcgagggggagacctaccagtgcagggtgacccacccc 288
ArgAspTrpIleGluGlyGluThrTyrGlnCysArgValThrHisPro
85 90 95
cacctgcccagggccctcatgcggtccacgaccaagaccagcggcccg 336
HisLeuProArgAlaLeuMetArgSerThrThrLysThrSerGlyPro
100 105 110
cgtgetgccccggaagtctatgcgtttgcgacgccggagtggccgggg 384
ArgAlaAlaProGluValTyrAlaPheAlaThrProGluTrpProGly
115 120 125
agccgggacaagcgcaccctcgcctgcctgatccagaacttcatgcct 432
SerArgAspLysArgThrLeuAlaCysLeuIleGlnAsnPheMetPro
130 135 140
gaggacatctcggtgcagtggctgcacaacgaggtgcagctcccggac 480
GluAspIleSerValGlnTrpLeuHisAsnGluValGlnLeuProAsp
145 150 155 160
gcccggcacagcacgacgcagccccgcaagaccaagggctccggcttc 528
AlaArgHisSerThrThrGlnProArgLysThrLysGlySerGlyPhe
165 170 ' 175
ttcgtcttcagccgcctggaggtgaccagggccgaatgggagcagaaa 576
PheValPheSerArgLeuGluValThrArgA1aGluTrpGluGlnLys
180 185 190
gatgagttcatctgccgtgcagtccatgaggcagcgagcccctcacag 624
AspGluPheIleCysArgAlaValHisGluAlaAlaSerProSerGln
195 200 205
accgtccagcgagcggtgtctgtaaatcccggtaaatga 663
ThrValGlnArgAlaValSerValAsnProGlyLys
210 215 220
<210> 17
<211> 220
<212> PRT
<213> Homosapiens
<400> 17
Ala Ala Asp Cys Asn Pro Arg Gly Val Ser Ala Tyr Leu Ser Arg Pro
1 5 10 15
Ser Pro Phe Asp Leu Phe Ile Arg Lys Ser Pro Thr Ile Thr Cys Leu
20 25 30
Va1 Val Asp Leu Ala Pro Ser Lys Gly Thr Val Asn Leu Thr Trp Ser
35 40 45
Arg Ala Ser Gly Lys Pro Val Asn His Ser Thr Arg Lys Glu Glu Lys
50 55 60
Gln Arg Asn Gly Thr Leu Thr Val Thr Ser Thr Leu Pro Val Gly Thr
65 70 75 80
Page 13
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
Arg Asp Trp Ile Glu Gly Glu Thr Tyr Gln Cys Arg Val Thr His Pro
85 90 . 95
His Leu Pro Arg Ala Leu Met Arg Ser Thr Thr Lys Thr Ser Gly Pro
100 105 11D
Arg Ala Ala Pro Glu Val Tyr Ala Phe Ala Thr Pro Glu Trp Pro Gly
115 120 125
Ser Arg Asp Lys Arg Thr Leu Ala Cys Leu Ile Gln Asn Phe Met Pro
130 135 140
Glu Asp =1e Ser Val Gln Trp Leu His Asn Glu Val Gln Leu Pro Asp
145 150 155 160
Ala Arg His Ser Thr Thr Gln Pro Arg Lys Thr Lys Gly Ser G1y Phe
165 170 175
Phe Val Phe Ser Arg Leu Glu Val Thr Arg Ala Glu Trp Glu Gln Lys
180 185 l90
Asp Glu Phe Ile Cys Arg Ala Val His Glu Ala Ala Ser Pro Ser Gln
195 200 205
Thr Val Gln Arg Ala Val Ser Val Asn Pro Gly Lys
210 215 220
<210> 18
<211> 663
<212> DNA
<213> Homo Sapiens
<220>
<221> CDS
<222> (1)..(663)
<400> 18
gcggcg gattcctgy agaggggtgagcgcctacctaagccggCcc 48
ccg
AlaAla AspSerCysProArgGlyValSerAlaTyrLeuSerArgPro
1 5 1D 15
agcccg ttcgacctgttcatccgcaagtcgcccacgateacctgtctg 96
SerPro PheAspLeuPheIleArgLysSerProThrIIeThrCysLeu
20 25 30
gtggtg gacctggcacccagcaaggggaccgtgaacctgacctggtcc l44
ValVal AspLeuAlaProSerLysGlyThrValAsnLeuThrTrpSer
3S 40 45
cgggcc agtgggaagcctgtgaaccactccaccagaaaggaggagaag l92
ArgAla SerGlyLysProValAsnHisSerThrArgLysGluGluLys
50 55 60
cag cgc aat ggc acg tta acc gtc acg tcc acc ctg ccg gtg ggc acc 240
Page 14
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
Gln Arg Asn Gly Thr Leu Thr Val Thr Ser Thr Leu
Pro Val Gly Thr
65 70 75 80
cga gac tgg atc gag ggg gag acc tac cag tgc agg 288
gtg acc cac ccc
Arg Asp Trp Ile Glu Gly Glu Thr Tyr Gln Cys Arg
Val Thr His Pro
85 90 95
cac ctg ccc agg gcc ctc atg cgg tcc acg acc aag 336
acc agc ggc ccg
His Leu Pro Arg Ala Leu Met Arg Ser Thr Thr Lys
Thr Ser Gly Pro
100 105 110
cgt get gcc ccg gaa gtc tat gcg ttt gcg acg ccg 384
gag tgg ccg ggg
Arg Ala Ala Pro Glu Val Tyr Ala Phe Ala Thr Pro
Glu Trp Pro Gly
115 120 125
agc cgg gac aag cgc acc ctc gcc tgc ctg atc cag 432
aac ttc atg cct
Ser Arg Asp Lys Arg Thr Leu Ala Cys Leu Ile Gln
Asn Phe Met Pro
130 _ 135 140
gag gac atc tcg gtg cag tgg ctg cac aac gag gtg 480
cag ctc ccg gac
Glu Asp Ile Ser Val Gln Trp Leu His Asn Glu Val
G1n Leu Pro Asp
145 150 155 160
gcc cgg cac agc acg acg cag ccc cgc aag ace aag 528
ggc tcc ggc ttc
Ala Arg His Ser Thr Thr Gln Pro Arg Lys Thr Lys
Gly Ser Gly Phe
165 170 175
ttc gtc ttc agc cgc ctg gag gtg acc agg gcc gaa 576
tgg gag cag aaa
Phe Val Phe Ser Arg Leu Glu Val Thr Arg Als Glu
Trp Glu Gln Lys
180 185 190
gat gag ttc atc tgc cgt gca gtc cat gag gca gcg 624
agc ccc tca cag
Asp Glu Phe Ile Cys Arg Ala Val His Glu Ala Ala
Ser Pro Ser Gln
195 200 205
acc gtc cag cga gcg gtg tct gta aat ccc ggt aaa 663
tga
Thr Val Gln Arg Ala Val Ser Val Asn Pro Gly Lys
210 215 220
<210> 19
<211> 220
<212> PRT
<213> Homo Sapiens
<400> 19
Ala Ala Asp Ser Cys Pro Arg Gly Val Ser Ala Tyr Leu Ser Arg Pro
1 5 10 15
Ser Pro Phe Asp Leu Phe Ile Arg Lys Ser Pro Thr Ile Thr Cys Leu
20 25 30
Val Val Asp Leu Ala Pro Ser Lys Gly Thr Val Asn Leu Thr Trp Ser
35 40 45
Arg Ala Ser Gly Lys Pro Val Asn His Ser Thr Arg Lys Glu Glu Lys
50 . 55 60
Glri Arg Asn G1y Thr Leu Thr Val Thr Ser Thr Leu Pro Val Gly Thr
Page 15
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
65 70 75 80
Arg Asp Trp Ile Glu Gly Glu Thr Tyr Gln Cys Arg Val Thr His Pro
85 90 95
His Leu Pro Arg Ala Leu Met Arg Ser Thr Thr Lys Thr Ser Gly Pro
100 105 110
Arg Ala Ala Pro Glu Val Tyr Ala Phe Ala Thr Pro Glu Trp Pro Gly
115 120 125
Ser Arg Asp Lys Arg Thr Leu Ala Cys Leu Ile Gln Asn Phe Met Pro
130 135 140
Glu Asp Ile Ser Val Gln Trp Leu His Asn Glu Val Gln Leu Pro Asp
145 150 155 160
Ala Arg His Ser Thr Thr Gln Pro Arg Lys Thr Lys Gly Ser Gly Phe
165 170 175
Phe Val Phe Ser Arg Leu Glu Val Thr Arg Ala Glu Trp Glu Gln Lys
180 185 190
Asp Glu Phe Ile Cys Arg Ala Val His Glu Ala Ala Ser Pro Ser Gln
195 200 205
Thr Val Gln Arg Ala Va1 Ser Val Asn Pro Gly Lys
210 215 220
<210> 20
<211> 663
<212> DNA
<213> Homo Sapiens
<220>
<221> CDS
<222> (1)..(663)
<400> 20
gcg gcg gat tgyaga ggg gtg agc gcc tac cgg ccc 48
tcc aac cta agc
Ala A1a Asp CysArg Gly Val Sex Ala Tyr Arg Pro
Ser Asn Leu Ser
1 5 10 15
agc ccg ttc ttcatc cgc aag tcg ccc acg tgt ctg .
gac ctg atc acc 96
Ser Pro Phe PheI1e Arg Lys Ser Pro Thr Cys Leu
Asp Leu Ile Thr
20 25 30
gtg gtg gac cccagc aag ggg acc gtg aac tgg tcc 144
ctg gca ctg acc
Val Val Asp ProSer Lys Gly Thr Val Asn Trp Ser
Leu Ala Leu Thr
35 40 45
cgg gcc agt cctgtg aac cac tcc acc aga gag aag 192
ggg aag aag gag
Arg Ala Ser ProVal Asn His Ser Thr Arg Glu Lys
Gly Lys Lys Glu
Page 16
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
50 55 60
eag cgc aat ggc acg tta acc gtc acg tcc ace ctg 240
ccg gtg ggc acc
Gln Arg Asn Gly Thr Leu Thr Val Thr Ser Thr Leu
Pro Val Gly Thr
65 70 75 80
cga gac tgg atc gag ggg gag acc tac cag tgc agg 288
gtg acc cac ccc
Arg Asp Trp Ile Glu Gly Glu Thr Tyr Gln Cys Arg
Val Thr His Pro
85 90 95
cac ctg ccc agg gcc ctc atg cgg tcc acg acc aag 336
acc agc ggc ccg
His Leu Pro Arg Ala Leu Met Arg Ser Thr Thr Lys
Thr Ser Gly Pro
100 105 110
cgt get gcc ccg gaa gtc tat gcg ttt gcg acg ccg 384
gag tgg ccg ggg
Arg Ala Ala Pro G1u Val Tyr Ala Phe Ala Thr Pro
Glu Trp Pro Gly
115 120 125
agc cgg gac aag cgc acc ctc gcc tgc ctg atc cag 432
aac ttc atg cct
Ser Arg Asp Lys Arg Thr Leu Ala Cys Leu Ile Gln
Asn Phe Met Pro
130 l35 140
gag gac atc tcg gtg cag tgg ctg cac aac gag gtg 480
cag ctc ccg gac
Glu Asp Ile Ser Va1 Gln Trp Leu His Asn Glu Val
Gln Leu Pro Asp
145 150 155 160
gcc cgg cac agc acg acg cag ccc cgc aag acc aag 528
ggc tcc ggc ttc
Ala Arg His Ser Thr -Thr Gln Pro Arg Lys Thr Lys
Gly Ser Gly Phe
165 ' 170 175
ttc gtc ttc agc cgc ctg gag gtg acc agg gcc gaa 576
tgg gag cag aaa
Phe Val Phe Ser Arg Leu Glu Val Thr Arg Ala Glu
Trp Glu GIn Lys
180 185 190
gat gag ttC atc tgc cgt gca gtc cat gag gca gcg 624
agc ccc tca cag
Asp Glu Phe Ile Cys Arg Ala Val His Glu Ala Ala
Ser Pro Ser Gln
195 200 205
acc gtc cag cga gcg gtg tct gta aat ccc ggt aaa 663
tga
Thr Val Gln Arg Ala Va1 Ser Val Asn Pro Gly Lys
210 215 220
<210> 21
<211> 220
<212> PRT
<213> Homo sapiens
<400> 21
Ala Ala Asp Ser Asn Cys Arg Gly Val Ser Ala Tyr Leu Ser Arg Pro
2 5 10 15
Ser Pro Phe Asp Leu Phe Ile Arg Lys Ser Pro Thr Ile Thr Cys Leu
20 25 30
Val Val Asp Leu A1a Pro Ser Lys Gly Thr Val Asn Leu Thr Trp Ser
35 40 45
Arg Ala Ser Gly Lys Pro Val Asn His Ser Thr Arg Lys Glu Glu Lys
50 55 60
Page 17
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
Gln Arg Asn Gly Thr Leu Thr Val Thr Ser Thr Leu Pro Val Gly Thr
65 70 75 80
Arg Asp Trp Ile Glu Gly Glu Thr Tyr Gln Cys Arg Val Thr His Pro
85 90 95
His Leu Pro Arg Ala Leu Met Arg Ser Thr Thr Lys Thr Ser Gly Pro
100 105 110
Arg Ala Ala Pro Glu Val Tyr Ala Phe Ala Thr Pro Glu Trp Pro Gly
215 120 125
Ser Arg Asp Lys Arg Thr Leu A1a Cys Leu Ile Gln Asn Phe Met Pro
130 135 140
Glu Asp Ile Ser Val Gln Trp Leu His Asn Glu Val Gln Leu Pro Asp
145 150 155 160
Ala Arg His Ser Thr Thr Gln Pro Arg Lys Thr Lys Gly Ser Gly Phe
165 170 175
Phe Val Phe Ser Arg Leu Glu Val Thr Arg Ala Glu Trp Glu Gln Lys
180 185 190
Asp Glu Phe Ile Cys Arg Ala Val His Glu Ala Ala Ser Pro Ser Gln
195 200 205
Thr Val Gln Arg Ala Val Ser Val Asn Pro Gly Lys
210 . 215 220
<210> 22
<211> 663
<212> DNA
<213> Homo Sapiens
<220>
<221> CDS
<222> (1)..(663)
<400> 22
gcg gcg gat tcc aac ccg tgy ggg gtg agc gcc tac cta agc cgg ccc 48
Ala Ala Asp Ser Asn Pro Cys Gly Val Ser Ala Tyr Leu Ser Arg Pro
10 l5
agc ccg ttc gac ctg ttc atc cgc aag tcg ccc acg atc acc tgt ctg 96
Ser Pro Phe Asp Leu Phe Ile Arg Lys Ser Pro Thr Ile Thr Cys Leu
20 , 25 30
gtg gtg gac ctg gca ccc agc aag ggg acc gtg aac ctg acc tgg tcc 144
Val Val Asp Leu Ala Pro Ser Lys Gly Thr Val Asn Leu Thr Trp Ser
35 40 45
Page 18
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
cgggccagt gggaagcct gtgaaccac tccaccaga aaggaggag aag 192
ArgAlaSer GlyLysPro ValAsnHis SerThrArg LysGluGlu Lys
50 55 60
cagcgcaat ggcacgtta accgtcaog tccaccctg ccggtgggc acc 240
GlnArgAsn GlyThrLeu ThrValThr SerThrLeu ProValGly Thr
65 70 75 80
cgagactgg atcgagggg gagacctac cagtgcagg gtgacccac ccc 288
ArgAspTrp IleGluGly GluThrTyr GlnCysArg ValThrHis Pro
85 90 95
cacctgccc agggccctc atgcggtcc acgaccaag accagcggc ccg 336
HisLeuPro ArgAlaLeu MetArgSer ThrThrLys ThrSerGly Pro
100 105 110
cgtgetgcc ccggaagtc tatgcgttt gcgacgccg gagtggccg ggg 384
ArgAlaAla ProGluVal TyrAlaPhe AlaThrPro GluTrpPro Gly
115 120 125
agccgggac aagcgcacc ctcgcctgc ctgatccag aacttcatg cct 432
SerArgAsp LysArgThr LeuAlaCys LeuIleGln AsnPheMet Pro
130 135 140
gaggacatc tcggtgcag tggctgcac aacgaggtg cagctcccg gac 480
GluAspIle SerValGln TrpLeuHis AsnGluVal GlnLeuPro Asp
145 150 155 160
gcccggcac agcacgacg cagccccgc aagaccaag ggctccggc ttc 528
AlaArgHis SerThrThr GlnProArg LysThrLys GlySerGly Phe
165 170 175
ttcgtcttc agccgcctg gaggtgacc agggccgaa tgggagcag aaa 576
PheValPhe SerArgLeu GluValThr ArgAlaGlu TrpGluGln Lys
180 185 190
gatgagttc atctgccgt gcagtccat gaggcagcg agcccctca cag 624
AspGluPhe IleCysArg AlaValHis GluAlaAla SerProSer Gln
195 200 205
accgtccag cgagcggtg tctgtaaat cccggtaaa tga 663
ThrValGln ArgA1aVal SerValAsn ProGlyLys
210 215 220
<210> 23
<211> 220
<212> PRT
<213> HomoSapiens
<400> 23
Ala Ala Asp Ser Asn Pro Cys Gly Val Ser Ala Tyr Leu Ser Arg Pro
1 5 10 15
Ser Pro Phe Asp Leu Phe Ile Arg Lys Ser Pro Thr Ile Thr Cys Leu
20 25 30
Val Val Asp Leu Ala Pro Ser Lys Gly Thr Val Asn Leu Thr Trp Ser
35 40 45
Page 19
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
Arg Ala Ser Gly Lys Pro Val Asn His Ser Thr Arg Lys Glu Glu Lys
50 55 60
Gln Arg Asn Gly Thr Leu Thr Val Thr Ser Thr Leu Pro Val Gly Thr
65 70 75 80
Arg Asp Trp Ile Glu Gly Glu Thr Tyr Gln Cys Arg Val Thr His Pro
85 90 95
His Leu Pro Arg Ala Leu Met Arg Ser Thr Thr Lys Thr Ser Gly Pro
100 105 110
Arg Ala Ala Pro Glu Val Tyr Ala Phe Ala Thr Pro Glu Trp Pro Gly
115 120 125
Ser Arg Asp Lys Arg Thr Leu Ala Cys Leu Ile Gln Asn Phe Met Pro
13 0 135 140
Glu Asp Ile Ser Val Gln Trp Leu His Asn Glu Va1 Gln Leu Pro Asp
145 150 155 160
Ala Arg His Ser Thr Thr Gln Pro Arg Lys Thr Lys Gly Ser Gly Phe
165 170 175
Phe Val Phe Ser Arg Leu Glu Val Thr Arg Ala Glu Trp Glu Gln Lys
180 185 190
Asp Glu Phe Ile Cys Arg Ala Val His Glu Ala Ala Ser Pro Ser Gln
195 200 205
Thr Val Gln Arg Ala Val Ser Va1 Asn Pro Gly Lys
210 215 220
<210> 24
<211> 663
<212> DNA
<213> Homo sapiens
<220>
<22l> CDS
<222> (1)..(663)
<400> 24
gcg gcg gat tcc aac ccg aga tgy gtg agc gcc tac cta agc cgg ccc 48
Ala Ala Asp Ser Asn Pro Arg Cys Val Ser Ala Tyr Leu Ser Arg Pro
1 5 10 15
agc ccg ttc gac ctg ttc atc cgc aag tcg ccc acg atc aco tgt ctg 96
Ser Pro Phe Asp Leu Phe Ile Arg Lys Ser Pro Thr Ile Thr Cys Leu
20 25 30
Page 20
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
gtggtg gacctggca cccagcaag gggaccgtgaac ctgacc tggtcc 144
ValVal AspLeuAla ProSerLys GlyThrValAsn LeuThr TrpSer
35 40 45
cgggcc agtgggaag cctgtgaac cactccaccaga aaggag gagaag 192
ArgAla SerGlyLys ProValAsn HisSerThrArg LysGlu GluLys
50 55 60
cagcgc aatggcacg ttaaccgtc acgtccaccctg ccggtg ggcacc 240
GlnArg AsnGlyThr LeuThrVal ThrSerThrLeu ProVal GlyThr
65 70 75 80
cgagac tggatcgag ggggagacc taccagtgcagg gtgacc cacccc 288
ArgAsp TrpIleGlu GlyG1uThr TyrGlnCysArg ValThr HisPro
85 90 95
cacctg CCCagggCC CtCatgcgg tccacgaccaag accagc ggcccg 336
HisLeu ProArgAla LeuMetArg SerThrThrLys ThrSer GlyPro
100 105 110
cgtget gccccggaa gtctatgcg tttgcgacgccg gagtgg ccgggg 384
ArgAla AlaProGlu ValTyrAla PheAlaThrPro GluTrp ProGly
115 120 125
agccgg gacaagCgC aCCCtCgcc tgcctgatccag aacttc atgcct 432
SerArg AspLysArg ThrLeuAla CysLeuIleGln AsnPhe MetPro
130 135 140
gaggac atctcggtg cagtggctg cacaacgaggtg cagctc ccggac 480
GluAsp IleSerVal GlnTrpLeu HisAsnGluVal GlnLeu ProAsp
145 150 155 160
gcccgg cacagcacg acgcagccc cgcaagaccaag ggctcc ggcttc 528
AlaArg HisSerThr ThrGlnPro ArgLysThrLys GlySer GlyPhe
165 170 175
ttcgtc ttcagccgc ctggaggtg accagggccgaa tgggag cagaaa 576
PheVal PheSerArg LeuGluVal ThrArgAlaGlu TrpGlu GlnLys
180 185 190
gatgag ttcatctgc cgtgcagtc catgaggcagcg agcccc tcacag 624
AspGlu PheIleCys ArgAlaVal HisGluAlaAla SerPro SerGln
195 200 205
accgtc cagcgagcg gtgtctgta aatcccggtaaa tga 663
ThrVal GlnArgAla ValSerVal AsnProGlyLys
210 215 220
<210> 25
<211> 220
<212> PRT
<213> HomoSapiens
<400> 25
Ala Ala Asp Ser Asn Pro Arg Cys Val Ser Ala Tyr Leu Ser Arg Pro
1 5 10 15
Ser Pro Phe Asp Leu Phe Ile Arg Lys Ser Pro Thr Ile Thr Cys Leu
20 25 30
Page 21
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
Val Val Asp Leu Ala Pro Ser Lys Gly Thr Val Asn Leu Thr Trp Ser
35 40 45
Arg Ala Ser Gly Lys Pro Val Asn His Ser Thr Arg Lys Glu Glu Lys
50 55 60
Gln Arg Asn Gly Thr Leu Thr Val Thr Ser Thr Leu Pro Val Gly Thr
65 70 75 80
Arg Asp Trp Ile Glu Gly Glu Thr Tyr Gln Cys Arg Val Thr His Pro
85 90 95
His Leu Pro Arg Ala Leu Met Arg Ser Thr Thr Lys Thr Ser Gly Pro
100 105 110
Arg Ala Ala Pro Glu Val Tyr Ala Phe Ala Thr Pro Glu Trp Pro Gly
115 120 125
Ser Arg Asp Lys Arg Thr Leu Ala Cys Leu Ile Gln Asn Phe Met Pro
130 135 140
Glu Asp Ile Ser Val Gln Trp Leu His Asn Glu Val Gln Leu Pro Asp
145 150 155 160
Ala Arg His Ser Thr Thr Gln Pro Arg Lys Thr Lys Gly Ser Gly Phe
165 170 175
Phe Va1 Phe Ser Arg Leu Glu Val Thr Arg A1a Glu Trp Glu Gln Lys
180 185 190
Asp Glu Phe Ile Cys Arg Ala Val His G1u Ala Ala Ser Pro Ser Gln
195 200 205
Thr Val Gln Arg Ala Val Ser Val Asn Pro G1y Lys
210 215 220
<210> 26
<211> 663
<212> DNA
<213> Homo sapiens
<220>
<221> CDS
<222> (1)..(663)
<400> 26
gcg gcg gat tcc aac ccg aga ggg tgy agc gcc tac cta agc cgg ccc 48
Ala Ala Asp Ser Asn Pro Arg Gly Cys Ser Ala Tyr Leu Ser Arg Pro
1 5 10 15
agc ccg ttc gac ctg ttc atc cgc aag tcg ccc acg atc acc tgt ctg 96
Page 22
CA 02494115 2005-O1-31
WO PCT/US2003/024336
2004/013158
Ser ProPheAspLeu PheIle ArgLysSerPro ThrIleThr CysLeu
20 25 30
gtg gtggacctggca cccagc aaggggaccgtg aacctgacc tggtcc 144
Val ValAspLeuAla ProSer LysGlyThrVa1 AsnLeuThr TrpSer
35 40 45
cgg gccagtgggaag cctgtg aaccactccacc agaaaggag gagaag 192
Arg AlaSerGlyLys ProVal AsnHisSerThr ArgLysGlu GluLys
50 55 60
cag cgcaatggcacg ttaacc gtcacgtccacc ctgccggtg ggcacc 240
Gln ArgAsnGlyThr LeuThr ValThrSerThr LeuProVal GlyThr
65 70 75 80
cga gactggatcgag ggggag acctaccagtgc agggtgacc cacccc 288
Arg AspTrpIleGlu GlyGlu ThrTyrGlnCys ArgValThr HisPro
g5 90 95
cac ctgcccagggcc ctcatg cggtccacgacc aagaccagc ggcccg 336
His LeuProArgAla LeuMet ArgSerThrThr LysThrSer GlyPro
100 105 110
cgt getgccccggaa gtctat gcgtttgcgacg ccggagtgg ccgggg 384
Arg AlaAlaProGlu ValTyr AlaPheAlaThr ProGluTrp ProGly
115 120 125
agc cgggacaagcgc accctc gcctgcctgatc cagaacttc atgcct 432
Ser ArgAspLysArg ThrLeu AlaCysLeuIle GlnAsnPhe MetPro
130 135 140
gag gacatctcggtg cagtgg ctgcacaacgag gtgcagctc ccggac 480
Glu AspIleSerVal GlnTrp LeuHisAsnGlu ValGlnLeu ProAsp
145 150 155 160
gcc cggcacagcacg acgcag ccccgoaagacc aagggctcc ggcttc 528
Ala ArgHisSerThr ThrGln ProArgLysThr LysGlySer GlyPhe
165 170 175
ttc gtcttcagccgc ctggag gtgaccagggcc gaatgggag cagaaa 576
Phe ValPheSerArg LeuGlu ValThrArgAla GluTrpGlu GlnLys
180 185 190
gat gagttcatctgc cgtgca gtccatgaggca gcgagcccc tcacag 624
Asp GluPheIleCys ArgAla ValHisGluAla AlaSerPro SerGln
195 200 205
acc gtccagcgagcg gtgtct gtaaatcccggt aaatga 663
Thr ValGlnArgAla ValSer ValAsnProGly Lys
210 215 220
<21 0> 27
<21 1> 220
<21 2> PRT
<21 3> Homosapiens
<400> 27
Ala Ala Asp Ser Asn Pro Arg Gly Cys Ser Ala Tyr Leu Ser Arg Pro
1 5 10 15
Ser Pro Phe Asp Leu Phe Ile Arg Lys Ser Pro Thr Ile Thr Cys Leu
Page 23
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
20 25 30
Val Val Asp Leu Ala Pro Ser Lys Gly Thr Val Asn Leu Thr Trp Ser
35 40 45
Arg Ala Ser Gly Lys Pro Val Asn His Ser Thr Arg~Lys Glu Glu Lys
50 55 60
Gln Arg Asn Gly Thr Leu Thr Val Thr Ser Thr Leu Pro Val Gly Thr
65 70 75 80
Arg Asp Trp Ile Glu Gly Glu Thr Tyr Gln Cys Arg Va1 Thr His Pro
85 90 95
His Leu Pro Arg Ala Leu Met Arg Ser Thr Thr Lys Thr Ser Gly Pro
100 105 110
Arg Ala Ala Pro Glu Val Tyr Ala Phe Ala Thr Pr_o Glu Trp Pro G1y
115 120 125
Ser Arg Asp Lys Arg Thr Leu Ala Cys Leu Ile Gln Asn Phe Met Pro
130 135 140
Glu Asp Ile Ser Val Gln Trp Leu His Asn Glu Val Gln Leu Pro Asp
145 150 155 160
Ala Arg His Ser Thr Thr Gln Pro Arg Lys Thr Lys Gly Ser Gly Phe
165 170 175
Phe Val Phe Ser Arg Leu Glu Val Thr Arg Ala Glu Trp Glu Gln Lys
180 185 190
Asp Glu Phe Ile Cys Arg Ala Va1 His Glu Ala A1a Ser Pro Ser Gln
195 200 205
Thr Val Gln Arg Ala Val Ser Val Asn Pro Gly Lys
210 215 220
<210> 28
<211> 44
<212> DNA
<213> Artificial
<220>
<223> Synthetic Primer
<220>
<221> CDS
<222> (2)..(43)
Page 24
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
<400> 28
t agg gcg gat ccc get gca gat tcg aac ccg aga ggg gtg agc g 44
Arg Ala Asp Pro Ala Ala Asp Ser Asn Pro Arg Gly Val Ser
1 5 10
<210> 29
<211> 14
<212> PRT
<213> Artificial
<220>
<223> Synthetic Primer
<400> 29
Arg Ala Asp Pro Ala Ala Asp Ser Asn Pro Arg Gly Val Ser
1 5 10
<210> 30
<211> 44
<212> DNA
<213> Artificial
<220>
<223> Synthetic Primer
<220>
<221> CDS
<222> (2)..(43)
<400> 30
t agg gcg gat ccc tct gca gat tcg aac ccg aga ggg gtg agc g 44
Arg Ala Asp Pro Ser Ala Asp Ser Asn Pro Arg Gly Val Ser
1 5 10
<210> 31
<211> 14
<212> PRT
<213> Artificial
<220>
<223> Synthetic Primer
<400> 31
Arg Ala Asp Pro Ser Ala Asp Ser Asn Pro Arg Gly Val Ser
1 5 10
<210> 32
<211> 42
<212> DNA
<213> Artificial
<220>
<223> Synthetic Primer
<220>
<221> CDS
Page 25
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
<222> (2)..(40)
<400> 32
t agg gcg gat ccc tgt gcg gat tcg aac ccg aga ggg gtg ag 42
Arg Ala Asp Pro Cys Ala Asp Ser Asn Pro Arg Gly Val
1 5 10
<210> 33
<211> 13
<212> PRT
<213> Artificial
<220>
<223> Synthetic Primer
<400> 33
Arg Ala Asp Pro Cys Ala Asp Ser Asn Pro Arg Gly Val
1 5 10
<210> 34
<211> 42
<212> DNA
<213> Artificial
<220>
<223> Synthetic Primer
<220>
<221> CDS
<222> (2)..(40)
<400> 34
t agg gcg gat ccc gcg tgt gat tcg aac ccg aga ggg gtg ag 42
Arg Ala Asp Pro Ala Cys Asp Ser Asn Pro Arg Gly Val
1 5 10
<210> 35
<211> 13
<212> PRT
<213> Artificial
<220>
<223> Synthetic Primer
<400> 35
Arg Ala Asp Pro Ala Cys Asp Ser Asn Pro Arg Gly Val
1 5 10
<210> 36
<211> 42
<212> DNA
<213> Artificial
<220>
<223> Synthetic Primer
Page 26
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
<220>
<221> CDS
<222> (2)..(40)
<400> 36
t agg gcg gat ccc gcg gcg tgt tcg aac ccg aga ggg gtg ag 42
Arg Ala Asp Pro Ala Ala Cys Ser Asn Pro Arg Gly Val
1 5 10
<210> 37
<211> 13
<212> PRT
<213> Artificial
<220>
<223> Synthetic Primer
<400> 37
Arg Ala Asp Pro Ala Ala Cys Ser Asn Pro Arg Gly Val
1 5 10
<210> 38
<211> 42
<212> DNA
<213> Artificial
<220>
<223> Synthetic Primer
<220>
<221> CDS
<222> (2)..(40)
<400> 38
t agg gcg gat ccc gcg gcg gat tgt aac ccg aga ggg gtg ag 42
Arg Ala Asp Pro Ala Ala Asp Cys Asn Pro Arg Gly Val
1 5 10
<210> 39
<211> 13
<212> PRT
<213> Artificial
<220>
<223> Synthetic Primer
<400> 39
Arg Ala Asp Pro Ala Ala Asp Cys Asn Pro Arg Gly Val
1 5 10
<210> 40
<211> 42
<212> DNA
<213> Artificial
<220>
<223> Synthetic Primer
Page 27
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
<220>
<221> CDS
<222> (2)..(40)
<400> 40
t agg gcg gat CCC gcg gcg gat tcg tgt ccg aga ggg gtg ag 42
Arg Ala Asp Pro Ala Ala Asp Ser Cys Pro Arg Gly Val
1 5 10
<210> 41
<211> 13
<212> PRT
<213> Artificial
<220>
<223> Synthetic Primer
<400> 41
Arg Ala Asp Pro Ala Ala Asp Ser Cys Pro Arg Gly Val
1 5 10
<210> 42
<211> 42
<212> DNA
<213> Artificial
<220>
<223> Synthetic Primer
<220>
<221> CDS
<222> (2)..(40)
<400> 42
t agg gcg gat ccc gcg gcg gat tcg aac tgt aga ggg gtg ag 42
Arg Ala Asp Pro Ala Ala Asp Ser Asn Cys Arg Gly Val
1 5 10
<210> 43
<211> 13
<212> PRT
<213> Artificial
<220>
<223> Synthetic Primer
<400> 43
Arg Ala Asp Pro Ala Ala Asp Ser Asn Cys Arg Gly Val
1 5 10
<210> 44
<211> 42
<212> DNA
<213> Artificial
Page 28
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
<220>
<223> Synthetic Primer
<220>
<221> CDS
<222> (2)..(40)
<400> 44
t agg gcg gat ccc gcg gcg gat tcg aac ccg tgt ggg gtg ag 42
Arg Ala Asp Pro Ala Ala Asp Ser Asn Pro Cys Gly Val
1 5 10
<210> 45
<211> 13
<212> PRT
<213> Artificial
<220>
<223> Synthetic Primer
<400> 45
Arg Ala Asp Pro Ala A1a Asp Sex Asn Pro Cys Gly Va1
1 5 10
<210> 46
<211> 42
<212> DNA
<213> Artificial
<220>
<223> Synthetic Primer
<220>
<221> CDS
<222> (2)..(40)
<400> 46
t agg gcg gat ccc gcg gcg gat tcg aac ccg aga tgt gtg ag 42
Arg Ala Asp Pro Ala Ala Asp Ser Asn Pro Arg Cys Val
1 5 10
<210> 47
<211> 13
<212> PRT
<213> Artificial
<220>
<223> Synthetic Primer
<400> 47
Arg Ala Asp Pro Ala Ala Asp Ser Asn Pro Arg Cys Val
1 5 10
<210> 48
<211> 42
<212> DNA
Page 29
CA 02494115 2005-O1-31
WO 2004/013158 PCT/US2003/024336
<213> Artificial
<220>
<223> Synthetic Primer
<220>
<221> CDS
<222> (2)..(40)
<400> 48
t agg gcg gat ccc gcg gcg gat tcg aac ccg aga ggg tgt ag 42
Arg Ala Asp Pro Ala Ala Asp Ser Asn Pro Arg Gly Cys
1 5 10
<210> 49
<211> 13
<212> PRT
<213> Artificial
<220>
<223> Synthetic Primer
<400> 49
Arg Ala Asp Pro Ala A1a Asp Ser Asn Pro Arg Gly Cys
1 5 10
Page 30
