Note: Descriptions are shown in the official language in which they were submitted.
CA 02502981 2012-03-23
30073-2
-1-
TRANSGENIC GLYPHOSATE TOLERANT SUGAR BEET EVENT H7-1
DESCRIPTION
The invention relates to glyphosate tolerant sugar beet
plants, plant material and seeds.
Sugar beet (Beta vulgaris) is grown as a commercial crop in
many countries, with a combined harvest of over 240 million
metric tons.
N-phosphonomethyl-glycine, commonly referred to as
glyphosate, is a broad spectrum herbicide, which is widely
used due to its high efficiency, biodegradability, and low
toxicity to animals and humans. Glyphosate inhibits the
shikimic acid pathway which leads to the biosynthesis of
aromatic compounds including amino acids and vitamins.
Specifically, glyphosate inhibits the conversion of
phosphoenolpyruvic acid and 3-phosphoshikimic acid to 5-
enolpyruvyl-3-phosphoshikimic acid by inhibiting the enzyme
5-enolpyruvyl-3-phosphoshikimic acid synthase (EPSP synthase
or EPSPS). When conventional plants are treated with
glyphosate, the plants cannot produce the aromatic amino
acids (e.g. phenylalanine and tyrosine) needed to grow and
survive. EPSPS is present in all plants, bacteria, and fungi.
It is not present in animals, which do not synthesize their
own aromatic amino acids. Because the aromatic amino acid
biosynthetic pathway is not present in mammals, birds or
aquatic life forms, glyphosate has little if any toxicity for
CA 02502981 2005-04-21
- 2 -
these organisms. The EPSPS enzyme is naturally present in
foods derived from plant and microbial sources.
Glyphosate is the active ingredient in herbicides such as
Roundup, produced by Monsanto Company, USA. Typically, it is
formulated as a water-soluble salt such as an ammonium,
alkylamine, alkali metal or trimethylsulfonium salt. One of
the most common formulations is the isopropylamine salt of
glyphosate, which is the form employed in Roundup0 herbicide.
It has been shown that glyphosate tolerant plants can be
produced by inserting into the genome of the plant the
capacity to produce an EPSP synthase which is glyphosate
tolerant, e.g. the CP4-EPSPS from Agrobacterium sp. strain
CP4.
A glyphosate tolerant sugar beet plant may be produced by
Agrobacterium mediated transformation, introducing a gene
coding for a glyphosate tolerant EPSPS such as CP4-EPSPS into
the plant's genome. Such a sugar beet plant, expressing CP4-
EPSPS, has been described in WO 99/23232. However, sugar beet
plants grown from cells transformed with the gene for CP4-
EPSPS in this manner, differ widely in their characteristics,
due to the fact that the gene is inserted at a random
position in the plant genome. The insertion of a particular
transgene into a specific location on a chromosome is often
referred to as an "event". The term "event" is also used to
differentiate genetically engineered crop varieties.
Desirable events are very rare. By far the most events are
discarded because the transgene inserted into a plant gene
important for growth, causing the gene to be disrupted and
not expressed, or the transgene inserted into a portion of
CA 02502981 2005-04-21
- 3 -
the chromosome that does not allow for expression of the
transgene or expression that is too low. For this reason, it
is necessary to screen a large number of events in order to
identify an event characterized by sufficient expression of
the introduced gene. This procedure is very time and cost
consuming, and it is in no way guaranteed that a plant with
satisfactory properties may be found.
Therefore, it is the object of the present invention to
provide a sugar beet plant that shows a high level of
tolerance against glyphosate, but has no disadvantages with
respect to other important agronomic properties such as
growth, yield, quality, pathogen resistance etc.
The glyphosate tolerant sugar beet plant according to the
invention is characterized in that
a) the sugar beet plant is obtained from seed deposited with
the NCIMB, Aberdeen (Scotland, U.K.) and having the accession
number NCIMB 41158 or NCIMB 41159, and/or
b) a DNA fragment of between 630-700 bp, preferably 664 bp,
can be amplified from the genomic DNA of said sugar beet
plant, parts or seeds thereof, using polymerase chain
reaction with a first primer having the nucleotide sequence
of SEQ ID NO: 1 and a second primer having the nucleotide
sequence of SEQ ID NO: 2, and/or
c) a DNA fragment of 3500-3900, preferably 3706 bp, can be
amplified from the genomic DNA of said sugar beet plant,
parts or seeds thereof, using polymerase chain reaction with
a first primer having the nucleotide sequence of SEQ ID NO: 3
and a second primer having the nucleotide sequence of SEQ ID
NO: 4, and/or
CA 02502981 2005-04-21
4 -
d) a DNA fragment of 270-300 bp, preferably 288 bp, can be
amplified from the genomic DNA of said sugar beet plant,
parts or seeds thereof, using polymerase chain reaction with
a first primer having the nucleotide sequence of SEQ ID NO: 7
and a second primer having the nucleotide sequence of SEQ ID
NO: 8, and/or
e) a DNA fragment of 710-790 bp, preferably 751 bp, can be
amplified from the genomic DNA of said sugar beet plant,
parts or seeds thereof, using polymerase chain reaction with
a first primer having the nucleotide sequence of SEQ ID NO: 9
and a second primer having the nucleotide sequence of SEQ ID
NO: 10, and/or
f) a DNA fragment of 990-1100 bp, preferably 1042 bp, can be
amplified from the genomic DNA of said sugar beet plant,
parts or seeds thereof, using polymerase chain reaction with
a first primer having the nucleotide sequence of SEQ ID NO:
14 and a second primer having the nucleotide sequence of SEQ
ID NO: 16.
Polymerase chain reaction (PCR) is a well-known standard
method used to amplify nucleic acid molecules (see for
example US 4,683,202).
The sugar beet plant according to the invention (in the
following referred to as "event H7-1") shows a high tolerance
to glyphosate herbicide. In addition, growth characteristics
and other important agronomic properties of event H7-1 are
not affected by the transformation process. Event H7-1
expresses a high level of the Agrobacterium-CP4-EPSPS-gene,
which is stably incorporated within the plant genome, and
which confers glyphosate tolerance to the plant. The plant
has been produced by Agrobacterium mediated transformation
CA 02502981 2009-05-25
30073-2
-5-
technology using the binary vector PV-BGVT08. This vector contained between
the left and right border region the following sequences: a coding region
composed of a chloroplast transit peptide coding sequence from the Arabidopsis
thaliana EPSPS (designated ctp2) joined to the CP4-EPSPS coding sequence
and under the regulation of the Figwort mosaic virus promoter (pFMV) and the
E9-3' transcriptional termination sequence from Pisum sativum.
In a preferred embodiment of the invention the 3706 bp, 664 bp,
288 bp, 751 bp and 1042 bp DNA fragments show at least 95%, preferably at
least 99%, more preferably at least 99.9%, identity with the nucleotide
sequences
of SEQ ID NO: 6, SEQ ID NO: 13, SEQ ID NO: 11, SEQ ID NO: 12 or SEQ ID
NO: 17, respectively. 95% identity, for example, means that 95% of the
nucleotides of a given sequence are identical with the compared sequence. For
this purpose, the sequences may be aligned and compared using the BLAST
programme. Most preferably, the 3706 bp DNA fragment has the nucleotide
sequence of SEQ ID NO: 6, the 664 bp DNA fragment has the nucleotide
sequence of SEQ ID NO: 13, the 288 bp DNA fragment has the nucleotide
sequence of SEQ ID NO: 11, the 751 bp DNA fragment has the nucleotide
sequence of SEQ ID NO: 12, and/or the 1042 bp DNA fragment has the
nucleotide sequence of SEQ ID NO 17.
The present invention also refers to seed deposited with the NCIMB,
Aberdeen (Scotland, U.K.), and having the accession number NCIMB 41158 or
NCIMB 41159. Such seed can be used to
CA 02502981 2005-04-21
6 -
obtain a glyphosate tolerant sugar beet plant. The seed can
be sawn and the growing plant will be glyphosate tolerant.
The invention also relates to a cell, tissue or part of a
glyphosate tolerant sugar beet plant.
Another aspect of the present invention is a method for the
identification of a glyphosate tolerant sugar beet plant,
characterized in that the method comprises the step(s) of
a) amplifying a DNA fragment of between 630-700 bp,
preferably 664 bp, from the genomic DNA of said sugar beet
plant, parts or seeds thereof, using polymerase chain
reaction with a first primer having the nucleotide sequence
of SEQ ID NO: 1 and a second primer having the nucleotide
sequence of SEQ ID NO: 2, and/or
b) amplifying a DNA fragment of 3500-3900, preferably 3706
bp, from the genomic DNA of said sugar beet plant, parts or
seeds thereof, using polymerase chain reaction with a first
primer having the nucleotide sequence of SEQ ID NO: 3 and a
second primer having the nucleotide sequence of SEQ ID NO: 4,
and/or
c) amplifying a DNA fragment of 270-300 bp, preferably 288
bp, from the genomic DNA of said sugar beet plant, parts or
seeds thereof, using polymerase chain reaction with a first
primer having the nucleotide sequence of SEQ ID NO: 7 and a
second primer having the nucleotide sequence of SEQ ID NO: 8,
and/or
d) amplifying a DNA fragment of 710-790 bp, preferably 751
bp, from the genomic DNA of said sugar beet plant, parts or
seeds thereof, using polymerase chain reaction with a first
primer having the nucleotide sequence of SEQ ID NO: 9 and a
CA 02502981 2012-03-23
30073-2
-7-
second primer having the nucleotide sequence of SEQ ID NO: 10, and/ore)
amplifying a DNA fragment of 990-1100 bp, preferably 1042 bp, from the genomic
DNA of said sugar beet plant, parts or seeds thereof, using polymerase chain
reaction with a first primer having the nucleotide sequence of SEQ ID NO: 14
and a
second primer having the nucleotide sequence of SEQ ID NO: 16.
The method allows easy detection of a transgenic glyphosate tolerant
sugar beet plant with standard molecular biology techniques.
The invention further relates to a test kit for the identification of a
transgenic glyphosate tolerant sugar beet plant or its cells, tissue or parts.
The kit
comprises at least one primer pair with a first and a second primer for
polymerase
chain reaction, which allow to identify specifically event H7-1, its cells,
tissue or parts.
Preferably, the first primer has the nucleotide sequence of SEQ ID NO:
1 or SEQ ID NO: 7 or SEQ ID NO: 9 or SEQ ID NO: 14, and the second primer has
the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 8 or SEQ ID NO: 10 or
SEQ ID NO: 16.
According to a further embodiment of the present invention, the first and
second primer each recognize a nucleotide sequence which forms part of the
nucleotide sequence of SEQ ID NO: 5.
Another aspect of the invention relates to an event H7-1 sugar beet cell
comprising a transgenic insert that comprises a transgene which confers
glyphosate
tolerance, wherein the event H7-1 cell can be identified by using a pair of
primers, at
least one of which hybridizes to genomic DNA outside of the insert, and
wherein the
pair of primers can be used in polymerase chain reaction to amplify from the
DNA of
said cell a DNA fragment comprising genomic DNA and DNA of at least part of
the
insert, wherein the amplified fragment and pair of primers are at least one
of: (a) a
DNA fragment of 630-700 bp that can be amplified using a first primer having
the
nucleotide sequence of SEQ ID NO: 1 and a second primer having the nucleotide
sequence of SEQ ID NO: 2; (b) a DNA fragment of 3500-3900 bp that can be
I
CA 02502981 2012-03-23
30073-2
- 7a -
amplified using a first primer having the nucleotide sequence of SEQ ID NO: 3
and a
second primer having the nucleotide sequence of SEQ ID NO: 4; (c) a DNA
fragment
of 270-300 bp that can be amplified using a first primer having the nucleotide
sequence of SEQ ID NO: 7 and a second primer having the nucleotide sequence of
SEQ ID NO: 8; (d) a DNA fragment of 710-790 bp that can be amplified using a
first
primer having the nucleotide sequence of SEQ ID NO: 9 and a second primer
having
the nucleotide sequence of SEQ ID NO: 10; and (e) a DNA fragment of 990-1100
bp
that can be amplified using a first primer having the nucleotide sequence of
SEQ ID
NO: 14 and a second primer having the nucleotide sequence of SEQ ID NO: 16.
Another aspect of the invention relates to an event H7-1 sugar beet cell
comprising a transgene that confers glyphosate tolerance, wherein the event H7-
1
plant can be identified by using a pair of primers, at least one of which
hybridizes to
genomic DNA outside of the transgene, and wherein the two primers can be used
in
polymerase chain reaction to amplify from the DNA of said sugar beet cell, a
DNA
fragment comprising genomic DNA and DNA of at least part of the transgene,
wherein the amplified fragment and pair of primers are a DNA fragment of 630-
700
bp that can be amplified using a first primer having the nucleotide sequence
of SEQ
ID NO: 1 and a second primer having the nucleotide sequence of SEQ ID NO: 2.
Another aspect of the invention relates to an event H7-1 sugar beet cell
comprising a transgene that confers glyphosate tolerance, wherein the event H7-
1
plant can be identified by using a pair of primers, at least one of which
hybridizes to
genomic DNA outside of the transgene, and wherein the two primers can be used
in
polymerase chain reaction to amplify from the DNA of said sugar beet cell, a
DNA
fragment comprising genomic DNA and DNA of at least part of the transgene,
wherein the amplified fragment and pair of primers are a DNA fragment of 3500-
3900
bp that can be amplified using a first primer having the nucleotide sequence
of SEQ
ID NO: 3 and a second primer having the nucleotide sequence of SEQ ID NO: 4.
1
CA 02502981 2010-11-30
30073-2
- 7b -
Another aspect of the invention relates to an event H7-1 sugar beet
cell comprising a transgene that confers glyphosate tolerance, wherein the
event
H7-1 cell can be identified by using a pair of primers, at least one of which
hybridizes to genomic DNA outside of the transgene, and wherein the two
primers
can be used in polymerase chain reaction to amplify from the DNA of said sugar
beet cell, a DNA fragment comprising genomic DNA and DNA of at least part of
the transgene, wherein the amplified fragment and pair of primers are a DNA
fragment of 990-1100 bp that can be amplified using a first primer having the
nucleotide sequence of SEQ ID NO: 14 and a second primer having the
nucleotide sequence of SEQ ID NO: 16.
Another aspect of the invention relates to an event H7-1 sugar beet
seed cell comprising a transgene that confers glyphosate tolerance, wherein
the
event H7-1 seed cell can be identified by using a pair of primers, at least
one of
which hybridizes to genomic DNA outside of the transgene, and wherein the two
primers can be used in polymerase chain reaction to amplify from the DNA of
said
sugar beet seed cell, a DNA fragment comprising genomic DNA and DNA of at
least part of the transgene, wherein the amplified fragment and pair of
primers are
a DNA fragment of 630-700 bp that can be amplified using a first primer having
the nucleotide sequence of SEQ ID NO: 1 and a second primer having the
nucleotide sequence of SEQ ID NO: 2.
Another aspect of the invention relates to an event H7-1 sugar beet
seed cell comprising a transgene that confers glyphosate tolerance, wherein
the
event H7-1 seed cell can be identified by using a pair of primers, at least
one of
which hybridizes to genomic DNA outside of the transgene, and wherein the two
primers can be used in polymerase chain reaction to amplify from the DNA of
said
sugar beet seed cell, a DNA fragment comprising genomic DNA and DNA of at
least part of the transgene, wherein the amplified fragment and pair of
primers are
a DNA fragment of 3500-3900 bp that can be amplified using a first primer
having
the nucleotide sequence of SEQ ID NO: 3 and a second primer having the
nucleotide sequence of SEQ ID NO: 4.
CA 02502981 2010-11-30
30073-2
- 7c-
Another aspect of the invention relates to an event H7-1 sugar beet
seed cell comprising a transgene that confers glyphosate tolerance, wherein
the
event H7-1 seed cell can be identified by using a pair of primers, at least
one of
which hybridizes to genomic DNA outside of the transgene, and wherein the two
primers can be used in polymerase chain reaction to amplify from the DNA of
said
sugar beet seed cell, a DNA fragment comprising genomic DNA and DNA of at
least part of the transgene, wherein the amplified fragment and pair of
primers are
a DNA fragment of 990-1100 bp that can be amplified using a first primer
having
the nucleotide sequence of SEQ ID NO: 14 and a second primer having the
nucleotide sequence of SEQ ID NO: 16.
Another aspect of the invention relates to cell of the seed deposited
with the NCIMB and having the accession number NCIMB 41158 or NCIMB
41159.
Another aspect of the invention relates to method for identification of
a glyphosate tolerant sugar beet plant, the method comprising at least one of
the
following steps: a) amplifying a DNA fragment of between 630-700 bp,
preferably
664 bp, from the genomic DNA of said sugar beet plant, parts or seeds thereof,
using polymerase chain reaction with a first primer having the nucleotide
sequence of SEQ ID NO: 1 and a second primer having the nucleotide sequence
of SEQ ID NO: 2; b) amplifying a DNA fragment of 3500-3900, preferably 3706
bp,
from the genomic DNA of said sugar beet plant, parts or seeds thereof, using
polymerase chain reaction with a first primer having the nucleotide sequence
of
SEQ ID NO: 3 and a second primer having the nucleotide sequence of SEQ ID
NO: 4; c) amplifying a DNA fragment of 270-300 bp, preferably 288 bp, from the
genomic DNA of said sugar beet plant, parts or seeds thereof, using polymerase
chain reaction with a first primer having the nucleotide sequence of SEQ ID
NO: 7
and a second primer having the nucleotide sequence of SEQ ID NO: 8; d)
amplifying a DNA fragment of 710-790 bp, preferably 751 bp, from the genomic
DNA of said sugar beet plant, parts or seeds thereof, using polymerase chain
reaction with a first primer having the nucleotide sequence of SEQ ID NO: 9
and a
CA 02502981 2009-05-25
30073-2
- 7d -
second primer having the nucleotide sequence of SEQ ID NO: 10; e) amplifying a
DNA fragment of 990-1100 bp, preferably 1042 bp, from the genomic DNA of said
sugar beet plant, parts or seeds thereof, using polymerase chain reaction with
a
first primer having the nucleotide sequence of SEQ ID NO: 14 and a second
primer having the nucleotide sequence of SEQ ID NO: 16.
Another aspect of the invention relates to test kits for identifying a
transgenic glyphosate tolerant sugar beet plant, its cells, tissue or parts,
comprising at least one primer pair with a first and a second primer for
polymerase
chain reaction, the first primer recognizing a sequence within the foreign DNA
incorporated into the genome of said plant, and the second primer recognizing
a
sequence within the 3' or 5' flanking regions of said DNA, wherein: a) the
first
primer has the nucleotide sequence of SEQ ID NO: 1 and the second primer has
the nucleotide sequence of SEQ ID NO: 2; b) the first primer has the
nucleotide
sequence of SEQ ID NO: 7 and the second primer has the nucleotide sequence of
SEQ ID NO: 8; c) the first primer has the nucleotide sequence of SEQ ID NO: 9
and the second primer has the nucleotide sequence of SEQ ID NO: 10; or d) the
first primer has the nucleotide sequence of SEQ ID NO: 14 and the second
primer
has the nucleotide sequence of SEQ ID NO: 16.
The following figures serve to elucidate the invention. It shows:
CA 02502981 2005-04-21
- 8 -
Fig. 1 Map of the binary vector PV-BVGT08
Fig. 2 Identification of H7-1 by PCR analysis. DNA samples
from 18 plants have been analyzed. Neg. control = DNA from
non-transformed sugarbeet; pos. control = DNA from H7-1
original transformant.
Fig. 3 Identification of event H7-1 by Multiplex-PCR and
discrimination between transgenic event H7-1 and non-
transgenic plants. DNA samples from 54 plants have been
analyzed.
Fig. 4 The pFMV-ctp2-CP4-EPSPS-E9-3'-insert with cleavage
sites of restriction enzymes Hindlll, XbaI, Clal, PstI, and
BamHI.
Fig. 5 Insert/copy number analysis of event H7-1. For the
Southern blot analysis 10 g of H7-1 genomic DNA were
digested with PstI, Hindlll, XbaI, ClaI and BamHI (lane 3 to
7). Non-transformed genomic DNA as a negative control was
digested with BamHI (lane 8). Plasmid PV-BVGTO8 as a positive
control was digested by BamHI. Lanes 2 and 9 represent size
markers. The blot was probed with a 32P-labelled CP4-EPSPS
coding region. The probe is an internal sequence of the CP4-
EPSPS gene covering basepairs 447-1555.
Fig. 6 Southern blot analysis of event H7-1 to evaluate ctp2-
CP4-EPSPS coding region intactness. 10 g of H7-1 genomic
DNA, non-transgenic control DNA and non-transgenic control
DNA mixed with PV-BVGT08 were digested with XbaI and
CA 02502981 2005-04-21
- 9 -
Hindlll/BamHI. The blot was probed with a 32P-labelled CP4-
EPSPS-PCR fragment.
Fig. 7 Southern blot analysis of event H7-1 to evaluate
promoter region intactness. 10 g of H7-1 genomic DNA, non-
transgenic control DNA and non-transgenic control DNA mixed
with PV-BVGT08 were digested with Hindlll, XbaI and
SacI/XhoI. The blot was probed with a 32P-labelled promoter
fragment (Hindlll)(=PV-BVGTO8 sequence, bp 7972-8583) or with
the complete promotor-ctp2-CP4-EPSPS-E9-31-cassette
(PmeI/XhoI)(= PV-BVGTO8 sequence, bp 7935-2389).
Fig. 8 Southern blot analysis of event H7-1 to evaluate
polyadenylation region intactness. 10 g of H7-1 genomic DNA,
non-transgenic control DNA and non-transgenic control DNA
mixed with PV-BVGTO8 were digested with EcoRI/PstI, XbaI,
Hindlll, and PstI. The blot was probed with a 32P-labelled
E9-3' polyadenylation fragment (BamHI/XhoI)(=PV-BVGTO8
sequence, bp 1702-2389).
Fig. 9 Fragments used as probes to evaluate absence of
backbone vector DNA in event H7-1.
Fig. 10 Southern blot analysis of event H7-1 to evaluate
absence of backbone vector DNA in event H7-1. 10 g of H7-1
genomic DNA, non-transgenic control DNA and non-transgenic
control DNA mixed with PV-BVGTO8 were digested with XbaI. The
blots were probed with 32P-labelled probes encompassing the
entire backbone of PV-BVGTO8 (probe 1-4).
Fig. 11 Comparison between the PCR fragments and the PV-
BVGTO8 sequences on the left border region (left border, LB).
CA 02502981 2005-04-21
- 10 -
Fig. 12 Comparison between the PCR fragments and the PV-
BVGT08 sequences on the right border region (right border,
RB).
Fig. 13 Analysis of the genomic DNA outside the right
junction of the insert. Approximately 50 ng of either event
H7-1 genomic DNA, non-transgenic control DNA or water were
used for PCR reactions with the primer combinations P1, where
both primers are located outside of the insert, and P3, where
one primer is located within the insert and the other primer
lies outside the insert.
Fig. 14 Analysis of the genomic DNA outside the left junction
of the insert. Approximately 50 ng of H7-1 genomic DNA, non-
transgenic control DNA and water were used for PCR-reactions
with the primer combinations P2, where both primers are
located outside of the insert, and P4, where one primer is
located within the insert and the other primer lies outside
the insert.
Fig. 15 Progeny map of H7-1 seed lots.
Fig. 16 Southern blot analysis of event H7-1 to evaluate
whether the inserted DNA is stably integrated into the
genome. 10 g of H7-1 genomic DNAs (the original transformant
H7-1-1995 and three progenies, H7-1-1996 to 1998) and non-
transgenic control DNAs from different origins were digested
with BamHI, XbaI, and Hindlll. The blot was probed with a
32P-labelled CP4-EPSPS probe of PV-BVGT08 (= bp 447-1555).
CA 02502981 2005-04-21
- 11 -
The invention is further defined, by way of illustration
only, by reference to the following examples.
A list of abbreviations used is given below:
approximately
C degree Celsius
bidest double destillated sterile water
bp base pair (s)
CTAB cetyltrimethylammonium bromide
DNA deoxyribonucleic acid
E. coli Escherichia coli
EDTA ethylendiaminetetraacetic acid
Fig. Figure
h hour
HC1 hydrochloric acid
kb kilobase pair
kg kilogram
M, mm, molar, millimolar
min minutes
Na2HPO4/NaH2PO4 sodium phosphate
NaCl sodium chloride
NaOH sodium hydroxide
nt nucleotide
PCR polymerase chain reaction
pmol picomole
RNase ribonucleic acid nuclease
rpm revolutions per minute
RR Roundup Ready
RT room temperature
SDS sodium dodecyl sulfate
sec second
CA 02502981 2005-04-21
- 12 -
SEVAG Chloroform : Isoamylalcohol ( 24 : 1)
SSC standard saline citrate
TE Tris-EDTA buffer
TRIS tris(hydroxymethyl)-aminomethane
EXAMPLE 1: Identification of event H7-1
Sugar beet (Beta vulgaris) genotype 350057 has been
genetically modified to express a CP4-5-Enol-Pyruvyl-
Shikimate-3-Phosphate Synthase or CP4-EPSPS, which confers
tolerance to the herbicide glyphosate and is also used as a
selectable marker. This transgenic line was produced by
Agrobacterium -tumefaciens mediated transformation technology
using the binary vector PV-BVGT08. The T-DNA of the vector
used for sugar beet transformation contained between the left
and the right border region the following sequences: a coding
region composed of a chloroplast transit peptide coding
sequence from the Arabidopsis thaliana EPSPS (designated
ctp2) joined to the CP4-EPSPS coding sequence and under the
regulation of the 35S Figwort mosaic virus promoter (pFMV)
and the Pisum sativum rbcS-E9-gene 3'-transcriptional
termination sequence.
The following methods were used:
I. DNA Extraction:
Method 1:
Fresh leaf or other tissue was collected (20 to 100 mg in a
1.5 ml tube) and 400 l extraction buffer (see below) were
CA 02502981 2005-04-21
- 13 -
added. The tissue was ground with a small pestle. The mixture
was vortexed for 5 sec and incubated 30 min to 60 min at room
temperature. A centrifugation step at 13,000 rpm for 1 min
followed. The supernatant containing the DNA was poured into
a new 1.5 ml tube and mixed with 320 l isopropanol. The
mixture was incubated at room temperature for 2 min. A DNA
precipitate is formed after the addition of ethanol. After
centrifugation at 13,000 rpm for 5 min the ethanol was
decanted. The sample was allowed to air dry. The pellet was
redissolved in 400 l H2O or TE-buffer (see below)
Extraction buffer (100 ml):
ml 1 M Tris (pH 7.5)
15 5 ml 5 M NaC1
5 ml 0.5 M EDTA
2.5 ml 20% SDS
67.5 ml H2O
20 TE-buffer:
10 mM Tris-HC1 (pH 8.0)
1 mM EDTA
Method 2:
Fresh plant material (20 to 100 mg) was collected in a 1.5 ml
Eppendorf tube and 500 pl CTAB buffer (65 C) (see below) were
added. The mixture was incubated 1 to 1.5 h at 65 C, and
subsequently centrifuged for 5 sec. 5 l RNase A (10 mg/ml),
were added. The mixture was incubated 30 min at 37 C and
subsequently centrifuged for 5 sec. 200 l SEVAG were added.
CA 02502981 2005-04-21
- 14 -
After mixing and centrifugation at 13,000 rpm for 10 min the
supernatant was transferred to a new 1.5 ml tube. 1 volume
isopropanol (about 400 l) was mixed carefully with the
supernatant. A centrifugation step at 13,000 rpm for 10 min
followed. 600 pl 70% ethanol were added. The pellet was
washed by inverting the tube several times. Again, the
mixture was centrifuged at 13,000 rpm for 2 min. The ethanol
was carefully discarded. The tube was inverted and drained on
clean paper. The sample was allowed to air dry for 15 min.
The pellet was redissolved in 50 l H2O (see below)
CTAB buffer:
1.4 M NaCl
mM EDTA
15 100 mM Tris-HC1
2 % (w/v) CTAB
SEVAG:
Chloroform : Isoamylalcohol (24 : 1)
RNase-buffer:
10 mM Tris, 15 mM NaCl, pH 7.5
RNase A:
10mg RNase/ml RNase-buffer
(5 ml bidest + 50 mg RNase A, Aliquots in 1.5 ml tubes, boil
tubes 30 min at 100 C, storage at -20 C)
Normally, Method 1 was used. With this method it is possible
to extract a high number of DNA samples per day and the DNA
CA 02502981 2005-04-21
- 15 -
quality is acceptable. Method 2 was used, when the leaf
material was older or if there were problems with the DNA
quality. Method 2 is more complex, requires more time, and
gives a lower DNA yield, but of higher quality.
Normally, quantitation of DNA is not performed, and typically
in a PCR reaction 0.5 to 1 Al of the extracted DNA solution
is used.
II. PCR reaction:
For the PCR reaction, a lOx buffer mix of buffer + dNTP's was
prepared. The procedure is as follows:
Stock solution volume 10x buffer final PCR reaction
conc. conc.
1 M Tris-HCl, pH 8.3 100 l 0.1 M 10 mM Tris-HC1, pH 8.3
1 M KC1 500 Al 0.5 M 50 mM KCl
100 mM dATP 20 l 2 mM 0.2 mm dATP
100 mM dCTP 20 l 2 mM 0.2 mM dCTP
100 mM dTTP 20 l 2 mM 0.2 mM dTTP
100 mM dGTP 20 l 2 mM 0.2 mM dGTP
100 mM MgC12 150 1 15 mM 1.5 mM MgC12
HPLC water 170 l
1000 l total
PCR reaction (25 Al):
DNA 0.5 l
Primer 1 1 l(20 pmol)
Primer 2 1 l (20 pmol)
Taq polymerase 1 0.2 l (1 U, from Oncor Appligene S.A.,
Heidelberg, Germany)
CA 02502981 2005-04-21
16 -
Buffer 10 x conc. 2.5 Al
Water 18.8 l
III. Identification of H7-1 by PCR
The Identification of H7-1 was performed by PCR using event
specific primers:
Upper Primer (SEQ ID NO: 1):
H7-207U30: 5' TTA ATT TTT GCA GGC GAT GGT GGC TGT TAT 3'
Lower Primer (SEQ ID NO: 2):
H7-841L30: 5' CAT ACG CAT TAG TGA GTG GGC TGT CAG GAC 3'
The upper primer is located outside of the insert, and is
part of the sugar beet genomic DNA. The lower primer is
located within the inserted CP4-EPSPS gene.
PCR conditions:
94 C 4 min STEP 1
95 C 30 sec STEP 2a
55 C 30 sec STEP 2b
72 C 2 min STEP 2c
72 C 5 min STEP 3
4 C over night STEP 4
reaction complete
Steps 2a-c were repeated 34 times.
The expected PCR product is a DNA fragment of 664 bp (SEQ ID
NO: 13, see Fig. 2).
CA 02502981 2005-04-21
- 17 -
IV. Identification of H7-1 by Multiplex-PCR
For the discrimination of non-transgenic and transgenic
plants, whether homozygous or hemi/heterozygous, a Multiplex-
PCR with three different primers was performed. Following
primers were used:
H72 (SEQ ID NO: 14): 5' GCTCTGACACAACCGGTAAATGCATTGGCC 3'
H7S2 (SEQ ID NO: 15): 5' GACCCATAGTTTGATTTTAAGCACGACATG 3'
H7R2 (SEQ ID NO: 16): 5' GCAGATTCTGCTAACTTGCGCCATCGGAG 3'
PCR conditions:
94 C 2 min STEP 1
94 C 1 sec STEP 2a
60 C 45 sec STEP 2b
72 C 90 sec STEP 2c
72 C 5 min STEP 3
4 C over night STEP 4
reaction complete
Steps 2a-c were repeated 34 times.
Non-transgenic plants show only one PCR fragment of about 350
bp. Homozygous transgenic plants show one fragment of about
1.042 kb. Heterozygous plants show both fragments (see Fig.
3).
EXAMPLE 2: Characterization of event H7-1
Molecular analysis was performed to characterize the
integrated DNA present in the event H7-1. Specifically, the
CA 02502981 2005-04-21
- 18 -
insert number (number of integration sites within the sugar
beet genome), the copy number (the number of DNA fragments
within one locus), the integrity of the inserted coding
region and its regulatory elements, the pFMV promoter and E9-
3' transcriptional termination sequence, the absence of
backbone sequences of the vector used for transformation and
the stable inheritance of the insert were determined.
Further, the sequences flanking the DNA insert were
identified.
The inserted DNA of the sugar beet transformation event H7-1
was characterized by using Southern blot, PCR and Inverse-PCR
techniques. Positive and negative controls (PV-BVGTO8, non-
transgenic plant DNA) were included and were treated in the
same manner as the test substance (H7-1).
DNA was isolated from batch number 74903H of event H7-1
plants grown in 1997. DNA was also isolated from the original
transformant H7-1/3S0057 (= 6401VH) in 1995 and from three
additional progenies produced in 1996, 1997, and 1998. (H7-
1/64801H, H7-1/74922H, and H7-1/83002S).
The non-transgenic sugar beet line 3S0057 served as control.
In addition, sugar beet lines 5R7150, 8K1180, and 6S0085 were
used as a negative control. Those lines are common non-
transgenic lines used for breeding conventional sugar beet.
Reference substances correspond to the plasmid PV-BVGTO8 used
for the transformation. The plasmid DNA and DNA from the
control sugar beet line were mixed together, digested with
restriction enzyme and separated by electrophoresis on
agarose gels in parallel to the test substances. The plasmid
CA 02502981 2005-04-21
- 19 -
served as a size marker for the expected fragment and as a
positive hybridization control. The plasmid DNA was mixed
with the genomic plant DNA at a concentration representing
less than 1 copy of the element being analysed to demonstrate
the sensitivity of the Southern blot method (-10 g genomic
DNA and -28 pg PV-BVGTO8 DNA). For size estimations the
molecular size marker RAOULTM (ONCOR/Appligene, catalog
#160673) was used.
DNA isolation:
Plant tissue (1 to 3 g wet weight) from batch number 74903H
of event H7-1 was ground in liquid nitrogen to a fine powder
using a mortar and pestle. The powder was transferred to a 50
ml Oakridge tube, and 7.5 ml of preheated (60 C) CTAB buffer
(2 % CTAB, 100 mM Tris-HC1, 20 mM EDTA pH 8.0, 1.4 M NaCl and
0.2 % mercapto-ethanol) was added. The samples were incubated
at 65 C for approximately 30 min with intermittent mixing. An
equal volume (8 ml) of a mixture of RT chloroform :
isoamylalcohol (24:1 v/v) was added to the samples. The
suspension was mixed by inversion, and the two phases were
separated by centrifugation (10 min, 9000 rpm). The aqueous
phase was transferred to a new 50 ml Oakridge tube following
the precipitation of the DNA by adding 5 ml isopropanol. The
DNA was pelleted by centrifugation (2 min, 9000 rpm) and the
supernatant was removed. The precipitated DNA was incubated
with a wash solution of 76 % ethanol and 10 mM
ammoniumacetate for about 20 min. After centrifugation and
decanting of the supernatant the DNA was vacuum dried and
redissolved in TE, pH 8.0 at 4 C overnight.
CA 02502981 2005-04-21
- 20 -
As an alternative method, DNA was isolated by DNeasy Plant
Maxi Kit from Qiagen (Dusseldorf, Germany, catalog #68163).
DNA isolation was carried out according to the manufacturer's
manual.
As an additional alternative method, DNA was isolated by
DNeasy Plant Mini Kit from Qiagen (Dusseldorf, Germany,
catalog #69103). DNA isolation was carried out according to
the manufacturer's manual.
DNA quantification and restriction enzyme digestion:
DNA quantification was performed using a LKB Biochrom
UV/visible spectrophotometer (Amersham Pharmacia, Freiburg,
Germany) or, alternatively, DNA quantification was done after
agarose gel electrophoresis by scanning the DNA with the
RFLPscan program (MWG-Biotech, Ebersberg, Germany). As a
calibration standard the High DNA Mass Ladder from Gibco/Life
Technologies (Karlsruhe, Germany)(catalog # 10496-016) was
used. Restriction enzymes were purchased either from
Boehringer Mannheim (Mannheim, Germany), Stratagene
(Amsterdam, Netherlands) or New England Biolabs (Frankfurt,
Germany) and used according to the manufacturer's manual.
DNA probe preparation:
PV-BVGTO8 DNA was isolated from E. coli cultures. Probe
templates homologous to the CP4-EPSPS coding region, the 35S-
promoter, the E9-3'-polyadenylation region, the 35S-ctp2-CP4-
EPSPS-E9-3'-cassette, and the backbone regions were prepared
by digests with the corresponding restriction enzymes
following a separation by agarose gel electrophoresis or by
CA 02502981 2005-04-21
- 21 -
polymerase chain reaction (PCR). The products were purified
using the Gene Clean II Kit of BIO 101 (La Jolla, CA).
Labelling of the probes (25 pg) with 32P-dCTP or 32P-dATP was
achieved making use of the MegaprimeTM DNA labelling system of
Amersham-Pharmacia Biotech Europe (Freiburg, Germany).
Southern blot analyses:
The samples of DNA treated with restriction enzymes were
separated by agarose gel electrophoresis for -15 hours at -35
volts. After photographing the gel, the DNA was depurinated
by soaking the gel for 15 min in a 0.25 M HC1-solution,
denatured by incubating the gel for 30 min in a denaturing
solution of 0.5 M NaOH, 1.5 M NaCl with constant gentle
agitation and finally neutralized by soaking for 2 hours in
several volumes of a solution of 2 M NaCl and 1 M Tris-HC1,
pH 5.5. The DNAs from the agarose gels were transferred to
Hybond-NTM nylon membranes (Amersham Pharmacia Biotech
Europe, Freiburg, Germany) using a PosiBlot Pressure Blotter
from Stratagene according to manufacturers protocol. After
soaking the filter for 15 min in 2 x SSPE (20 x SSPE: 3.6 M
NaCl, 20 mM EDTA, 0.2 M NaH2PO4/Na2HPO4 pH 7.4) the DNA was
fixed to the membrane by illumination with UV-light
(Transilluminator Pharmacia, Freiburg, Germany) for 1 min and
by baking for 1 hour at 80 C in a vacuum oven. The blots
were prehybridized for 4 hours in an aqueous solution of 50 %
formamide, 5 x SSC, 0.1 % laurylsarcosine, 0.02 % SDS and 2 %
blocking reagent (Boehringer Mannheim, Germany, catalog #
1096176). Hybridisation with the radiolabelled probe was done
in fresh prehybridization solution for 16-18 hours at 42 C.
After hybridisation membranes were washed for 5 min in 2 x
SSC at 42 C, for 20 min in 2 x SSC, 1 % SDS at 65 C and for
CA 02502981 2005-04-21
- 22 -
two 15 min periods in 0.2 x SSC, 0.1 % SDS at 68 C.
Autoradiographic images of the blot were obtained by exposing
the blots using Kodak Biomax MSTM film in conjunction with
Kodak Biomax MSTM intensifying screens.
Identification of 5' and 3' genomic flanking sequences:
The transgene-to-plant genomic DNA junctions were identified
by using the Inverse-PCR technique. Genomic DNA was purified
as described above. Approximately 1 g of the DNA was
digested in separate reactions by the restriction nucleases
TaqI, Alul, NdeIII or RsaI. The digested DNA-fragments were
religated by T4-ligase over night, followed by the PCR
reaction. The various inverse-primer combinations were
obtained using the primer analysis software OLIGO from NBI
(National Biosciences, Inc., Plymouth, Michigan).
Fragments resulting from this Inverse-PCR amplification were
separated by gel electrophoresis, excised from the gel and
purified using the Gene Clean IITM kit. The purified
fragments were cloned into the vector pCR 2.l by using the
TOPOTMTA cloning Kit from Invitrogen (Groningen,
Netherlands). The inserts were submitted for sequencing by
MWG- Biotech (Ebersberg, Germany). Analysis of the resulting
sequence data were performed using Mac Molly Tetra DNA
analysis software (Soft Gene GmbH, Bochold, Germany).
PCR analysis:
Genomic DNA was prepared with the Plant DNAeasy Plant Mini
Kit (Qiagen, Dusseldorf, Germany) according to the
manufacturer's instructions. Approximately 50 ng of genomic
DNA were used for PCR. The reactions were subjected to 95 C
CA 02502981 2005-04-21
- 23 -
for 30 sec, 55 C for 30 sec, and 72 C for 2 min for 35
cycles. PCR was done in a PTC200 cycler (Biozym, Oldendorf,
Germany). PCR products were analysed by agarose gel
electrophoresis.
1. Insert number:
The insert number, the number of integration sites of
transgenic DNA into the sugar beet genome, was evaluated for
H7-l. In order to determine the insert number, the genomic
DNA was digested with the restriction enzymes HindIII, XbaI,
and BamHI. As a negative control DNA from a non transformed
control plant, representing the same genetic background, was
digested with Hind III. As a positive control transformation
vector DNA (PV-BVGT08) was used.
XbaI and BamHI cleave only once in PV-BVGT08 and do not
cleave inside the labelled CP4-EPSPS probe used (see Fig. 4).
Hindlll cleaves three times in PV-BVGT08, but all three sites
are located outside of the probe and on the same side, 5',
relative to the probe. Thus, each enzyme should release a
single DNA fragment that would hybridize to the CP4-EPSPS
probe, and would contain a part of the inserted DNA and
adjacent plant genomic DNA. The number of fragments detected
indicates the number of inserts present in the event. The
results are shown in Fig. 5.
After digestion with the enzymes Hindlll, XbaI, or BamHI only
a single hybridization fragment was found, respectively. The
fragments of 5.2 kb from the HindIII digest (lane 4), 4 kb
from the XbaI digest (lane 5) and approximately 11 kb from
the BamHI digest (lane 7) showed that the transformant H7-1
CA 02502981 2005-04-21
- 24 -
represents a single integration event (Fig. 4). The strong
signal in lane 1 represents the linearized PV-BVGTO8 plasmid.
Additional faint signals refer to small amounts of undigested
PV-BVGT08 or to unspecific hybridisation background signals.
2. Copy number
Theoretically, one integration site could consist of more
than one copy of the inserted DNA. But due to the fragment
sizes of the restriction analysis shown above, this was not
possible. If there was more than one copy of the inserted DNA
present in H7-l, additional fragments would be detected. This
was proved also by a digest with the restriction enzyme PstI.
PstI cleaves twice within the left and the right border
sequences. One of the restriction sites is within the CP4-
EPSPS coding region, so after digestion one would expect two
hybridizing fragments with the CP4-EPSPS probe. One of the
expected fragments corresponds to the internal fragment of
about 1.2 kb. The second fragment should be a border
fragment. Again, if there was more than one copy, additional
fragments should be detectable. But the results show that
PstI cuts the DNA as expected. The internal fragment of 1.2
kb and only one additional fragment of about 4.9 kb were
detected (Fig. 5: lane 3, Fig. 4).
As an additional internal control the DNA was cleaved with
Clal (Fig. 5: lane 6, Fig. 4). As expected, a single fragment
of 2.4 kb hybridized, since Clal cleaves twice but outside
left and right hand of the used CP4-EPSPS fragment. This
result is also a proof of the intactness of the integrated
DNA fragment and is in agreement with the results given in
the following.
CA 02502981 2005-04-21
- 25 -
The hybridization of the plasmid PV-BVGT08 with the CP4-EPSPS
fragment results in a 8.6 kb signal (lane 1) as expected (PV-
BVGTO8 = 8590 bp). A second smaller very faint band is due to
the incomplete restriction of PV-BVGTO8.
In summary the experiments show that the transformed sugar
beet line H7-1 contains a single copy integration of the T-
DNA of PV-BVGT08 in the plant genome.
3. Coding region intactness
The integrity of the CP4-EPSPS gene cassette, with respect to
the individual elements (P-FMV promoter, ctp2-CP4-EPSPS
coding region, and E9 3' non-translated region), was
determined by digestion with the enzymes Hindlll for P-FMV,
Hindlll plus BamHI for ctp2-CP4-EPSPS, and EcoRI plus PstI
for the E9 3' non-translated region. Additional experiments
were performed with Sacl plus XhoI for the P-FMV-ctp2-CP4
EPSPS region and for the E9 3' region. Plasmid DNA mixed with
non-transgenic sugar beet DNA and non-transgenic sugar beet
DNA alone were digested with the same enzymes, as positive
and negative controls, respectively.
These enzymes cleave within the intended DNA insert, between
the left and right T-DNA Borders (see the plasmid map in Fig.
1), so, if the respective elements are intact, the size of
the hybridized fragments should be identical in H7-1 DNA and
PV-BVGTO8 DNA.
As an additional control the DNAs were digested with XbaI.
XbaI cleaves once between the promoter and ctp2-CP4-EPSPS
CA 02502981 2005-04-21
- 26 -
coding region. Therefore, one would expect a 8.6 kb fragment
with the PV-BVGT08 DNA and in case of the H7-1 a border
fragment which differs in size compared with the PV-BVGT08
fragment. The results are shown in Fig. 6, 7, and 8.
Fig. 6: The digest with Hindlll and BamHI released the CP4-
EPSPS gene and the blot was probed with a CP4-EPSPS fragment
generated by PCR. The negative control (lane 6) did not show
any hybridisation bands. Genomic DNA from the event H7-1 and
plasmid PV-BVGT08 mixed with non-transgenic DNA both produced
an approximately 1.7 kb fragment which corresponds to the
expected size. The digest with XbaI resulted in the expected
8.6 kb fragment of the linearized PV-BVGTO8. For event H7-1
the digest resulted in the approximately 4.0 kb border
fragment (see also Fig. 4 and 5). Again, the negative control
did not show any signal.
Fig. 7: The digest with Hindlll released the Figwort mosaic
virus promoter and the blot was probed with a promoter
fragment generated by PCR. The negative control (lane 5) did
not show any hybridization signals. Genomic DNA from event
H7-1 and plasmid PV-BVGTO8 mixed with non-transgenic DNA both
produced a hybridizing fragment of 0.6 kb approximate size.
This fragment corresponds to the expected size (lane 4 and 6)
of the promoter.
The digest with XbaI resulted in the expected 8.6 kb fragment
of the linearized PV-BVGT08 and in the approximately 1.3 kb
left border fragment (lane 1 and 3) from event H7-1. This 1.3
kb fragment is also an additional proof that the event H7-1
contains only a single copy of the transgene. Again the
negative control (lane 2) did not show any signal.
CA 02502981 2005-04-21
- 27 -
The digest with SacI/XhoI released the promotor together with
the CP4-EPSPS coding region and the polyadenylation region.
Hybridization with the complete promotor-ctp2-CP4-EPSPS-
polyadenylation signal cassette (PmeI/XhoI fragment) produced
the expected 2.3 kb promotor-ctp2-CP4-EPSPS and the 0.7 kb
polyadenylation signal fragments both with the PV-BVGTO8 DNA
mixed with non-transgenic DNA and with H7-1 genomic DNA (lane
9 and 11).
Fig. 8: The digest with PstI and EcoRI released the E9-3'
polyadenylation signal and the blot was probed with a
polyadenylation signal fragment. The negative control (lane
3) did not show any hybridization bands. Plasmid PV-BVGTO8
mixed with non-transgenic DNA and genomic DNA from the event
H7-1 both produced an approximately 0.6 kb fragment which
corresponds to the expected size. The digest with XbaI
resulted in the expected 8.6 kb fragment of the linearized
PV-BVGT08 and in an approximately 4.0 kb border fragment with
event H7-1.
The digest with PstI released the E9-3'polyadenylation signal
combined with a 0.5 kb 3'portion of the CP4-EPSPS coding
region. The resulting 1.2 kb fragment was detectable as
expected either with the H7-1 genomic DNA and also with the
PV-BVGT08 DNA.
The digest with Hindlll resulted in the 8.0 kb fragment of
the linearized PV-BVGT08 minus the promoter fragment (lane
13) and in a 5.2 kb border fragment (lane 11) with H7-1. The
single 5.2 kb fragment from the Hindlll digest and the single
4.0 kb fragment from the XbaI digest are also an additional
CA 02502981 2005-04-21
- 28 -
proof that the event H7-1 contains only one copy of inserted
DNA. Again the negative controls did not show any signal.
In summary the results of the blots prove, that all elements
of the transferred DNA are intact and that the event H7-1
contains a single intact CTP2-CP4-EPSPS coding region with
its regulatory elements, the pFMV promoter and E9-3'
transcriptional termination sequence.
4. Analysis for the detection of backbone fragments
The backbone region of a Ti-plasmid is defined as the region
outside of the T-DNA bounded with left and right border
sequences, which consists of the on genes and selection
genes for bacterial replication and bacterial selection and
which is normally not transferred to the plant genome by
Agrobacterium mediated transformation. To confirm the absence
of the backbone vector DNA in the event H7-l, genomic DNA
from H7-1, from a non transformed control and genomic DNA
from H7-1 mixed with PV-BVGT08 DNA was digested with the
restriction enzyme XbaI and probed with three overlapping PCR
generated probes, that encompassed the entire backbone
sequence. A fourth probe consists of the whole backbone in
one fragment.
The probes used represent the backbone sequence (see Fig. 9):
1: bp 2730- 5370
2: bp 5278- 6419
3: bp 6302- 7851
4: bp 2730- 7851
CA 02502981 2005-04-21
- 29 -
Fig. 10 shows the result of the Southern blot analysis. Lanes
6, 10, 14, and 18: digest of H7-1 genomic DNA probed with the
backbone fragments of the whole backbone did not show any
hybridization bands. Only lanes 4, 8, 12, 16, and 20: H7-1
genomic DNA mixed with PV-BVGTO8 DNA showed bands of 8.6 kb,
as expected. The bands represent the linearized PV-BVGTO8
DNA.
Lanes 2 and 4: H7-1 genomic DNA, and H7-1 genomic DNA mixed
with PV-BVGT08, and hybridized with the CP4-EPSPS fragment,
showed hybridizing signals. The 4 kb band in lane 2
represents the right border fragment, the two bands of lane 4
represent again the 4.0 kb right border fragment and the 8.6
kb linearized PV-BVGTO8 plasmid. Both bands have the same
intensity. This is a clear indication that the concentration
of the added PV-BVGT08 DNA is comparable with the
concentration of the CP4-EPSPS element in the H7-1 DNA. The
concentration of the used plasmid DNA is equivalent to 0.5
copies. If there were backbone sequences integrated in the
H7-1 genome, clear signals should be detectable.
These results prove that H7-1 does not contain any detectable
backbone sequence of the plasmid used for the transformation.
This result was also supported by the data of the analysis of
the 5' and 3' genomic flanking regions (see below).
5. Identification of 5' and 3' genomic flanking sequences
Agrobacterium mediated transformation normally leads to the
integration of all sequences between the left and right
border into the plant genome. The 5' and 3' ends of the
integrated plasmid DNA should be within or near the left or
CA 02502981 2005-04-21
- 30 -
the right border sequences, respectively. Therefore an
Inverse-PCR technique was used to identify those regions. The
cloned PCR products were sequenced and the sequence data were
compared to PV-BVGTO8 sequence.
Fig. 11 shows the alignment for the sequence from the cloned
Inverse PCR fragment (D1U.RPT)(=genome H7-1, upper sequence),
obtained with primers for analysis of the left border region,
versus the PV-BVGTO8 sequence (lower sequence). The
comparison of both sequences showed that the homology stopped
exactly within the border sequence.
Fig. 12 shows the alignment for the sequence from the cloned
Inverse-PCR fragment (B3UNI.RPT)(=genome H7-l, upper
sequence), obtained with primers for analysis of the right
border region, versus the PV-BVGT08 sequence (lower
sequence). The comparison of both sequences showed that the
homology stopped already 18 nucleotides in front of border
sequence.
In total, this is a clear indication, that the sequence
between the left and right borders of the Ti-plasmid PV-
BVGT08 is integrated correctly. The sequence stopped within
or immediately in front of the borders. These data support
the results of the backbone analysis, that no sequences of
the backbone outside the border regions were integrated into
the H7-1 genome.
To determine whether the flanking sequences on the right or
left side of the insert in sugar beet event H7-1 are intact
plant genomic sequences, inverse PCR analysis with primer
combinations P1, P2, P3 and P4 were performed.
CA 02502981 2005-04-21
- 31 -
The primers of primer combinations P1 and P2 are located
outside of the insert. If the DNA of the insertion locus
within event H7-l is identical with DNA of a non-transformed
control, the PCR should result in two PCR fragments
representing synthesis from the two primer combinations. The
primers of primer combinations P3 and P4 are designed in a
way such that one of the respective primers is located inside
the CP4-EPSPS insert and the other primer is located outside
the insert, within the plant genomic DNA. So the PCR should
produce fragments from the H7-1 event DNA only.
Sequence data from Inverse-PCR-technique combined with data
from the PV-BVGTO8 vector results in a sequence which
includes the H7-1 insert (PV-BVGT08 sequence), the right and
left junction regions and additional sugar beet genomic DNA
(SEQ ID NO: 5).
For the identification of the transgene-to-plant genomic DNA
junctions (identification of event specificity) and for the
genomic DNA regions to the left and right sides of the insert
following primer combinations were used:
P1 combination (primer for analyzing genomic DNA outside the
right border region):
Upper primer: 5'CGG TAA ATG CAT TGG CCT TTG TT
Lower primer: 5'CAC CCA GAT CCC AAT AAA ACC GTA AT
Expected PCR-product 241 bp
P2 combination (primer for analyzing genomic DNA outside the
left border region, SEQ ID NO: 20, SEQ ID NO: 21):
CA 02502981 2005-04-21
- 32 -
Upper Primer: 5'AAA TGG TTG TAG ATA AAT AAG GAA ATC A
Lower primer: 5'ACA TGT TTG AGC ACT CTT CTT GT
Expected PCR-product 377 bp
P3 combination (primer for analyzing the transgene-to-plant
genomic DNA junction, SEQ ID NO: 7, SEQ ID NO: 8):
Upper Primer: 5'ATG CAT TGG CCT TTG TTT TTG AT
Lower Primer: 5'TGT CGT TTC CCG CCT TCA G
Expected PCR-product 288 bp (SEQ ID NO: 11)
P4 combination (primer for analyzing the transgene-to-plant
genomic DNA junction, SEQ ID NO: 9, SEQ ID NO: 10):
Upper Primer: 5'CGC TGC GGA CAT CTA CAT TTT TGA AT
Lower primer: 51AGT TAA CTT TCC ACT TAT CGG GGC ACT G
Expected PCR-product 751 bp (SEQ ID NO: 12)
PCR experiments with event H7-1 DNA and with DNA from a
non-transgenic control plant, using the primer combination
P3, which has one primer being located within the H7-1
insert, yields a fragment with the event H7-1 DNA only. In
contrast, PCR experiments using the primer combination P1,
homologous to sequences outside the insert, yield fragments
with both event H7-1 and non-transgenic control DNA. See Fig.
13 for these results.
The results indicate that the sequence next to the right
junction of the insert is present in the transgenic event H7-
1 DNA and in the DNA from non-transgenic plants. It can be
concluded that this DNA outside the event H7-1 insert is
CA 02502981 2005-04-21
- 33 -
non-transgenic genomic DNA.
PCR experiments conducted with event H7-1 DNA and DNA from a
non-transgenic control plant using primer combination P4,
which has one of the primers located inside the CP4-EPSPS
insert, yields a fragment with the event H7-1 DNA only. In
contrast, PCR experiments using the primer combination P2,
homologous to sequences outside the insert, yield fragments
with both event H7-1 and non-transgenic control DNA. See Fig.
14 for these results.
The results indicate that the sequence next to the left
junction of the insert is present both in the transgenic
event H7-1 DNA and in the DNA from non-transgenic plants. It
can be concluded that the DNA outside the left junction is
non-transgenic genomic DNA.
In summary, it can be stated that the sequences outside of
the sugar beet event H7-1 insert are identical with sequences
present in non-transgenic plants. It can be concluded that
these sequences are plant genomic sequences present in the
parental line used for transformation and in other
conventional sugar beet lines.
6. Stability over generations
To demonstrate the stability of the integrated DNA the
original transformation event H7-1 was compared with three
progenies (64801H, 74922H, and 83002S; see Fig. 15) of this
line resulting from self pollination with non-transgenic
sugar beet lines. The original transformed line and the
progenies were produced in 1995, 1996, 1997, and 1998.
CA 02502981 2005-04-21
- 34 -
As controls four different non-transgenic sugar beet lines
were analysed (350057, 5R7150, 8K1180, 6S0085). All DNAs were
digested with XbaI, Hindlll, and BamHI, respectively, and
hybridized with a labelled CP4-EPSPS fragment. To demonstrate
that the T-DNA is stably integrated in the plant genome, all
lanes of the H7-1 progenies digested with the same
restriction enzyme should show a band of exact the same size.
The DNAs from the progenies of H7-1 lanes 3 to 6 show the
expected fragments: DNA digested with BamHI resulted in bands
of approximately 11 kb, digests with XbaI produced fragments
of 4.0 kb and Hindlll restriction produced bands of 5.2 kb.
All bands from the same restriction but from different years
were identical in their size. All non-transgenic lines did
not show any signal (Fig. 16).
These results demonstrate that the introduced sequence is
stably integrated into the genomic DNA and stably inherited.
CA 02502981 2005-05-18
SEQUENCE LISTING
<110> KWS SAAT AG
<120> Glyphosate Tolerant Sugar Beet
<130> PCT 0079
<150> EP 03003866.5
<151> 2003-02-20
<150> US 10/376763
<151> 2003-02-28
<160> 21
<170> Patentln version 3.1
<210> 1
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Primer
<400> 1
ttaatttttg caggcgatgg tggctgttat 30
<210> 2
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Primer
<400> 2
catacgcatt agtgagtggg ctgtcaggac 30
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Primer
<400> 3
atgttatctt taccacagtt 20
<210> 4
<211> 24
CA 02502981 2005-05-18
36
<212> DNA
<213> Artificial Sequence
<220>
<223> Primer
<400> 4
gtccctaaat gaaatacgta aaac 24
<210> 5
<211> 3778
<212> DNA
<213> Artificial Sequence
<220>
<223> Inserted DNA with 3' and 5' flanking sequences
<400> 5
ctcgagcggc cgccagtgtg atggatatct gcagaattcg cccttatgtt atctttacca 60
cagtttgttg ctctgacaca accggtaaat gcattggcct ttgtttttga tggcatcaac 120
tttggagcat ctgattttgc atattcagcc ttttccatgg taattctttt acaagaattt 180
tcattctttc ttaagtataa acacttagct tgggacaaac ttctgatcct atttcttaat 240
ttttgcaggt gatggtggct gttatgagca ttttgtgttt gatgtttctt tcttctcatt 300
acggttttat tgggatctgg gtggctctaa ctatttacat gagcctccgc gcgtttgctg 360
aaggcgggaa acgacaatct gatccccatc aagcttgagc tcaggattta gcagcattcc 420
agattgggtt caatcaacaa ggtacgagcc atatcacttt attcaaattg gtatcgccaa 480
aaccaagaag gaactcccat cctcaaaggt ttgtaaggaa gaattctcag tccaaagcct 540
caacaaggtc agggtacaga gtctccaaac cattagccaa aagctacagg agatcaatga 600
agaatcttca atcaaagtaa actactgttc cagcacatgc atcatggtca gtaagtttca 660
gaaaaagaca tccaccgaag acttaaagtt agtgggcatc tttgaaagta atcttgtcaa 720
catcgagcag ctggcttgtg gggaccagac aaaaaaggaa tggtgcagaa ttgttaggcg 780
cacctaccaa aagcatcttt gcctttattg caaagataaa gcagattcct ctagtacaag 840
tggggaacaa aataacgtgg aaaagagctg tcctgacagc ccactcacta atgcgtatga 900
cgaacgcagt gacgaccaca aaagaattcc ctctatataa gaaggcattc attcccattt 960
gaaggatcat cagatactca accaatcctt ctagaagatc taagcttatc gataagcttg 1020
atgtaattgg aggaagatca aaattttcaa tccccattct tcgattgctt caattgaagt 1080
ttctccgatg gcgcaagtta gcagaatctg caatggtgtg cagaacccat ctcttatctc 1140
caatctctcg aaatccagtc aacgcaaatc tcccttatcg gtttctctga agacgcagca 1200
gcatccacga gcttatccga tttcgtcgtc gtggggattg aagaagagtg ggatgacgtt 1260
aattggctct gagcttcgtc ctcttaaggt catgtcttct gtttccacgg cgtgcatgct 1320
tcacggtgca agcagccgtc cagcaactgc tcgtaagtcc tctggtcttt ctggaaccgt 1380
ccgtattcca ggtgacaagt ctatctccca caggtccttc atgtttggag gtctcgctag 1440
cggtgaaacc cgtatcaccg gtcttttgga aggtgaagat gttatcaaca ctggtaaggc 1500
tatgcaagct atgggtgcca gaatccgtaa ggaaggtgat acttggatca ttgatggtgt 1560
tggtaacggt ggactccttg ctcctgaggc tcctctcgat ttcggtaacg ctgcaactgg 1620
ttgccgtttg actatgggtc ttgttggtgt ttacgatttc gatagcactt tcattggtga 1680
cgcttctctc actaagcgtc caatgggtcg tgtgttgaac ccacttcgcg aaatgggtgt 1740
gcaggtgaag tctgaagacg gtgatcgtct tccagttacc ttgcgtggac caaagactcc 1800
aacgccaatc acctacaggg tacctatggc ttccgctcaa gtgaagtccg ctgttctgct 1860
tgctggtctc aacaccccag gtatcaccac tgttatcgag ccaatcatga ctcgtgacca 1920
cactgaaaag atgcttcaag gttttggtgc taaccttacc gttgagactg atgctgacgg 1980
tgtgcgtacc atccgtcttg aaggtcgtgg taagctcacc ggtcaagtga ttgatgttcc 2040
aggtgatcca tcctctactg ctttcccatt ggttgctgcc ttgcttgttc caggttccga 2100
cgtcaccatc cttaacgttt tgatgaaccc aacccgtact ggtctcatct tgactctgca 2160
ggaaatgggt gccgacatcg aagtgatcaa cccacgtctt gctggtggag aagacgtggc 2220
tgacttgcgt gttcgttctt ctactttgaa gggtgttact gttccagaag accgtgctcc 2280
ttctatgatc gacgagtatc caattctcgc tgttgcagct gcattcgctg aaggtgctac 2340
cgttatgaac ggtttggaag aactccgtgt taaggaaagc gaccgtcttt ctgctgtcgc 2400
aaacggtctc aagctcaacg gtgttgattg cgatgaaggt gagacttctc tcgtcgtgcg 2460
CA 02502981 2005-05-18
37
tggtcgtcct gacggtaagg gtctcggtaa cgcttctgga gcagctgtcg ctacccacct 2520
cgatcaccgt atcgctatga gcttcctcgt tatgggtctc gtttctgaaa accctgttac 2580
tgttgatgat gctactatga tcgctactag cttcccagag ttcatggatt tgatggctgg 2640
tcttggagct aagatcgaac tctccgacac taaggctgct tgatgagctc aagaattcga 2700
gctcggtacc ggatcctcta gctagagctt tcgttcgtat catcggtttc gacaacgttc 2760
gtcaagttca atgcatcagt ttcattgcgc acacaccaga atcctactga gtttgagtat 2820
tatggcattg ggaaaactgt ttttcttgta ccatttgttg tgcttgtaat ttactgtgtt 2880
ttttattcgg ttttcgctat cgaactgtga aatggaaatg gatggagaag agttaatgaa 2940
tgatatggtc cttttgttca ttctcaaatt aatattattt gttttttctc ttatttgttg 3000
tgtgttgaat ttgaaattat aagagatatg caaacatttt gttttgagta aaaatgtgtc 3060
aaatcgtggc ctctaatgac cgaagttaat atgaggagta aaacacttgt agttgtacca 3120
ttatgcttat tcactaggca acaaatatat tttcagacct agaaaagctg caaatgttac 3180
tgaatacaag tatgtcctct tgtgttttag acatttatga actttccttt atgtaatttt 3240
ccagaatcct tgtcagattc taatcattgc tttataatta tagttatact catggatttg 3300
tagttgagta tgaaaatatt ttttaatgca ttttatgact tgccaattga ttgacaacat 3360
gcatcaatcg acctgcagcc actcgaagcg gccgccactc gagtggtggc cgcatcgatc 3420
gtgaagtttc tcatctaagc ccccatttgg acgtgaatgt agacacgtcg aaataaagat 3480
ttccgaatta gaataatttg tttattgctt tcgcctataa atacgacgga tcgtaatttg 3540
tcgttttatc aaaatgtact ttcattttat aataacgctg cggacatcta catttttgaa 3600
ttgaaaaaaa ttggtaatta ctctttcttt ttctccatat tgaccatcat actcattgct 3660
gatccatgta gatttcccgg acatgaagcc atttacaatt gaatatatcc taagtaaaac 3720
ctcataggtt ttacgtattt catttaggga caagggcgaa ttccagcaca ctggcggc 3778
<210> 6
<211> 3706
<212> DNA
<213> Artificial Sequence
<220>
<223> PCR product
<400> 6
atgttatctt taccacagtt tgttgctctg acacaaccgg taaatgcatt ggcctttgtt 60
tttgatggca tcaactttgg agcatctgat tttgcatatt cagccttttc catggtaatt 120
cttttacaag aattttcatt ctttcttaag tataaacact tagcttggga caaacttctg 180
atcctatttc ttaatttttg caggtgatgg tggctgttat gagcattttg tgtttgatgt 240
ttctttcttc tcattacggt tttattggga tctgggtggc tctaactatt tacatgagcc 300
tccgcgcgtt tgctgaaggc gggaaacgac aatctgatcc ccatcaagct tgagctcagg 360
atttagcagc attccagatt gggttcaatc aacaaggtac gagccatatc actttattca 420
aattggtatc gccaaaacca agaaggaact cccatcctca aaggtttgta aggaagaatt 480
ctcagtccaa agcctcaaca aggtcagggt acagagtctc caaaccatta gccaaaagct 540
acaggagatc aatgaagaat cttcaatcaa agtaaactac tgttccagca catgcatcat 600
ggtcagtaag tttcagaaaa agacatccac cgaagactta aagttagtgg gcatctttga 660
aagtaatctt gtcaacatcg agcagctggc ttgtggggac cagacaaaaa aggaatggtg 720
cagaattgtt aggcgcacct accaaaagca tctttgcctt tattgcaaag ataaagcaga 780
ttcctctagt acaagtgggg aacaaaataa cgtggaaaag agctgtcctg acagcccact 840
cactaatgcg tatgacgaac gcagtgacga ccacaaaaga attccctcta tataagaagg 900
cattcattcc catttgaagg atcatcagat actcaaccaa tccttctaga agatctaagc 960
ttatcgataa gcttgatgta attggaggaa gatcaaaatt ttcaatcccc attcttcgat 1020
tgcttcaatt gaagtttctc cgatggcgca agttagcaga atctgcaatg gtgtgcagaa 1080
cccatctctt atctccaatc tctcgaaatc cagtcaacgc aaatctccct tatcggtttc 1140
tctgaagacg cagcagcatc cacgagctta tccgatttcg tcgtcgtggg gattgaagaa 1200
gagtgggatg acgttaattg gctctgagct tcgtcctctt aaggtcatgt cttctgtttc 1260
cacggcgtgc atgcttcacg gtgcaagcag ccgtccagca actgctcgta agtcctctgg 1320
tctttctgga accgtccgta ttccaggtga caagtctatc tcccacaggt ccttcatgtt 1380
tggaggtctc gctagcggtg aaacccgtat caccggtctt ttggaaggtg aagatgttat 1440
caacactggt aaggctatgc aagctatggg tgccagaatc cgtaaggaag gtgatacttg 1500
gatcattgat ggtgttggta acggtggact ccttgctcct gaggctcctc tcgatttcgg 1560
taacgctgca actggttgcc gtttgactat gggtcttgtt ggtgtttacg atttcgatag 1620
CA 02502981 2005-05-18
38
cactttcatt ggtgacgctt ctctcactaa gcgtccaatg ggtcgtgtgt tgaacccact 1680
tcgcgaaatg ggtgtgcagg tgaagtctga agacggtgat cgtcttccag ttaccttgcg 1740
tggaccaaag actccaacgc caatcaccta cagggtacct atggcttccg ctcaagtgaa 1800
gtccgctgtt ctgcttgctg gtctcaacac cccaggtatc accactgtta tcgagccaat 1860
catgactcgt gaccacactg aaaagatgct tcaaggtttt ggtgctaacc ttaccgttga 1920
gactgatgct gacggtgtgc gtaccatccg tcttgaaggt cgtggtaagc tcaccggtca 1980
agtgattgat gttccaggtg atccatcctc tactgctttc ccattggttg ctgccttgct 2040
tgttccaggt tccgacgtca ccatccttaa cgttttgatg aacccaaccc gtactggtct 2100
catcttgact ctgcaggaaa tgggtgccga catcgaagtg atcaacccac gtcttgctgg 2160
tggagaagac gtggctgact tgcgtgttcg ttcttctact ttgaagggtg ttactgttcc 2220
agaagaccgt gctccttcta tgatcgacga gtatccaatt ctcgctgttg cagctgcatt 2280
cgctgaaggt gctaccgtta tgaacggttt ggaagaactc cgtgttaagg aaagcgaccg 2340
tctttctgct gtcgcaaacg gtctcaagct caacggtgtt gattgcgatg aaggtgagac 2400
ttctctcgtc gtgcgtggtc gtcctgacgg taagggtctc ggtaacgctt ctggagcagc 2460
tgtcgctacc cacctcgatc accgtatcgc tatgagcttc ctcgttatgg gtctcgtttc 2520
tgaaaaccct gttactgttg atgatgctac tatgatcgct actagcttcc cagagttcat 2580
ggatttgatg gctggtcttg gagctaagat cgaactctcc gacactaagg ctgcttgatg 2640
agctcaagaa ttcgagctcg gtaccggatc ctctagctag agctttcgtt cgtatcatcg 2700
gtttcgacaa cgttcgtcaa gttcaatgca tcagtttcat tgcgcacaca ccagaatcct 2760
actgagtttg agtattatgg cattgggaaa actgtttttc ttgtaccatt tgttgtgctt 2820
gtaatttact gtgtttttta ttcggttttc gctatcgaac tgtgaaatgg aaatggatgg 2880
agaagagtta atgaatgata tggtcctttt gttcattctc aaattaatat tatttgtttt 2940
ttctcttatt tgttgtgtgt tgaatttgaa attataagag atatgcaaac attttgtttt 3000
gagtaaaaat gtgtcaaatc gtggcctcta atgaccgaag ttaatatgag gagtaaaaca 3060
cttgtagttg taccattatg cttattcact aggcaacaaa tatattttca gacctagaaa 3120
agctgcaaat gttactgaat acaagtatgt cctcttgtgt tttagacatt tatgaacttt 3180
cctttatgta attttccaga atccttgtca gattctaatc attgctttat aattatagtt 3240
atactcatgg atttgtagtt gagtatgaaa atatttttta atgcatttta tgacttgcca 3300
attgattgac aacatgcatc aatcgacctg cagccactcg aagcggccgc cactcgagtg 3360
gtggccgcat cgatcgtgaa gtttctcatc taagccccca tttggacgtg aatgtagaca 3420
cgtcgaaata aagatttccg aattagaata atttgtttat tgctttcgcc tataaatacg 3480
acggatcgta atttgtcgtt ttatcaaaat gtactttcat tttataataa cgctgcggac 3540
atctacattt ttgaattgaa aaaaattggt aattactctt tctttttctc catattgacc 3600
atcatactca ttgctgatcc atgtagattt cccggacatg aagccattta caattgaata 3660
tatcctaagt aaaacctcat aggttttacg tatttcattt agggac 3706
<210> 7
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Primer
<400> 7
atgcattggc ctttgttttt gat 23
<210> 8
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> Primer
<400> 8
tgtcgtttcc cgccttcag 19
CA 02502981 2005-05-18
39
<210> 9
<211> 26
<212> DNA
<213> Artificial Sequence
<220>
<223> Primer
<400> 9
cgctgcggac atctacattt ttgaat 26
<210> 10
<211> 28
<212> DNA
<213> Artificial Sequence
<220>
<223> Primer
<400> 10
agttaacttt ccacttatcg gggcactg 28
<210> 11
<211> 288
<212> DNA
<213> Artificial Sequence
<220>
<223> PCR product
<400> 11
atgcattggc ctttgttttt gatggcatca actttggagc atctgatttt gcatattcag 60
ccttttccat ggtaattctt ttacaagaat tttcattctt tcttaagtat aaacacttag 120
cttgggacaa acttctgatc ctatttctta atttttgcag gcgatggtgg ctgttatgag 180
cattttgtgt ttgatgtttc tctcttctca ttacggtttt attgggatct gggtggctct 240
aactatttac atgagcctcc gcgcgtttgc tgaaggcggg aaacgaca 288
<210> 12
<211> 751
<212> DNA
<213> Artificial Sequence
<220>
<223> PCR product
<400> 12
cgctgcggac atctacattt ttgaattgaa aaaaaattgg taattactct ttctttttct 60
ccatattgac catcatactc attgctgatc catgtagatt tcccggacat gaagccattt 120
acaattgaat atatcctaag taaaacctca taggttttac gtatttcatt tagggactaa 180
aatggtttag gataattact ttagctaaca taagataata aataaataaa taaataaaaa 240
taaaatggtt gtagataaat aaggaaatca ataatgaata tgagtgtgag tgataggacg 300
ggaatgggaa acttttacac tactttaacg ctattgaacg agtatgagta tgttataaac 360
gtaaaatgtt ttatgtgtta gacaatggcc tcaagtgaaa gtgaccctat taatggagga 420
aatgcaaacc acgagtctga ggtcacgctc gaagaaatga gggcaaggat cgacgcattg 480
cgtagcgacc ctgtttttgg agatgccacg ggagatgcta gtgataaccg aatggattta 540
atgaggttga tgatgatgga gcttttacaa ggaaatcgac aaaggcctag aactgaacaa 600
gaagagtgct caaacatgtt caagaggttt tcggctcata agcccccaac ttatgatgga 660
CA 02502981 2005-05-18
aagccagacc ccactgagtt tgaagaatgg ctcaacggca tggaaaaatt gttcgatgcc 720
acccagtgcc ccgataagtg gaaagttaac t 751
<210> 13
<211> 664
<212> DNA
<213> Artificial Sequence
<220>
<223> PCR product
<400> 13
ttaatttttg caggcgatgg tggctgttat gagcattttg tgtttgatgt ttctctcttc 60
tcattacggt tttattggga tctgggtggc tctaactatt tacatgagcc tccgcgcgtt 120
tgctgaaggc gggaaacgac aatctgatcc ccatcaagct tgagctcagg atttagcagc 180
attccagatt gggttcaatc aacaaggtac gagccatatc actttattca aattggtatc 240
gccaaaacca agaaggaact cccatcctca aaggtttgta aggaagaatt ctcagtccaa 300
agcctcaaca aggtcagggt acagagtctc caaaccatta gccaaaagct acaggagatc 360
aatgaagaat cttcaatcaa agtaaactac tgttccagca catgcatcat ggtcagtaag 420
tttcagaaaa agacatccac cgaagactta aagttagtgg gcatctttga aagtaatctt 480
gtcaacatcg agcagctggc ttgtggggac cagacaaaaa aggaatggtg cagaattgtt 540
aggcgcacct accaaaagca tctttgcctt tattgcaaag ataaagcaga ttcctctagt 600
acaagtgggg aacaaaataa cgtggaaaag agctgtcctg acagcccact cactaatgcg 660
tatg 664
<210> 14
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Primer
<400> 14
gctctgacac aaccggtaaa tgcattggcc 30
<210> 15
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Primer
<400> 15
gacccatagt ttgattttaa gcacgacatg 30
<210> 16
<211> 29
<212> DNA
<213> Artificial Sequence
<220>
<223> Primer
CA 02502981 2005-05-18
41
<400> 16
gcagattctg ctaacttgcg ccatcggag 29
<210> 17
<211> 1042
<212> DNA
<213> Artificial Sequence
<220>
<223> PCR product
<220>
<221> misc_feature
<223> PCR product
<400> 17
gctctgacac aaccggtaaa tgcattggcc tttgtttttg atggcatcaa ctttggagca 60
tctgattttg catattcagc cttttccatg gtaattcttt tacaagaatt ttcattcttt 120
cttaagtata aacacttagc ttgggacaaa cttctgatcc tatttcttaa tttttgcagg 180
cgatggtggc tgttatgagc attttgtgtt tgatgtttct ctcttctcat tacggtttta 240
ttgggatctg ggtggctcta actatttaca tgagcctccg cgcgtttgct gaaggcggga 300
aacgacaatc tgatccccat caagcttgag ctcaggattt agcagcattc cagattgggt 360
tcaatcaaca aggtacgagc catatcactt tattcaaatt ggtatcgcca aaaccaagaa 420
ggaactccca tcctcaaagg tttgtaagga agaattctca gtccaaagcc tcaacaaggt 480
cagggtacag agtctccaaa ccattagcca aaagctacag gagatcaatg aagaatcttc 540
aatcaaagta aactactgtt ccagcacatg catcatggtc agtaagtttc agaaaaagac 600
atccaccgaa gacttaaagt tagtgggcat ctttgaaagt aatcttgtca acatcgagca 660
gctggcttgt ggggaccaga caaaaaagga atggtgcaga attgttaggc gcacctacca 720
aaagcatctt tgcctttatt gcaaagataa agcagattcc tctagtacaa gtggggaaca 780
aaataacgtg gaaaagagct gtcctgacag cccactcact aatgcgtatg acgaacgcag 840
tgacgaccac aaaagaattc cctctatata agaaggcatt cattcccatt tgaaggatca 900
tcagatactg aaccaatcct tctagaagat ctaagcttat cgataagctt gatgtaattg 960
gaggaagatc aaaattttca atccccattc ttcgattgct tcaattgaag tttctccgat 1020
ggcgcaagtt agcagaatct gc 1042
<210> 18
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Primer
<400> 18
cggtaaatgc attggccttt gtt 23
<210> 19
<211> 26
<212> DNA
<213> Artificial Sequence
<220>
<223> Primer
<400> 19
cacccagatc ccaataaaac cgtaat 26
CA 02502981 2005-05-18
42
<210> 20
<211> 28
<212> DNA
<213> Artificial Sequence
<220>
<223> Primer
<400> 20
aaatggttgt agataaataa ggaaatca 28
<210> 21
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Primer
<400> 21
acatgtttga gcactcttct tgt 23
