Note: Descriptions are shown in the official language in which they were submitted.
CA 02504720 2011-09-28
77684-23
- 1 -
CHIMERIC OLIGOMERIC COMPOUNDS
AND THEIR USE IN GENE MODULATION
Field of the Invention
[0002] The present invention provides modified oligomers that modulate
gene expression
via a RNA interference pathway. The oligomers of the invention include one or
more
modifications thereon resulting in differences in various physical properties
and attributes
compared to wild type nucleic acids. The modified oligomers are used alone or
in compositions
to modulate the targeted nucleic acids. In preferred embodiments of the
invention, the modified
oligomers are chimeric in nature.
Background of the Invention
[0003] In many species, introduction of double-stranded RNA (dsRNA)
induces potent
and specific gene silencing. This phenomenon occurs in both plants and animals
and has roles in
viral defense and transposon silencing mechanisms. This phenomenon was
originally described
more than a decade ago by researchers working with the petunia flower. While
trying to deepen
=
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
- 2 -
the purple color of these flowers, Jorgensen et al. introduced a pigment-
producing gene under the
control of a powerful promoter. Instead of the expected deep purple color,
many of the flowers
appeared variegated or even white. Jorgensen named the observed phenomenon
"cosuppression",
since the expression of both the introduced gene and the homologous endogenous
gene was
suppressed (Napoli et al., Plant Cell, 1990, 2, 279-289; Jorgensen et al.,
Plant MoL Biol., 1996,
31, 957-973).
[0004] Cosuppression has since been found to occur in many species of
plants, fungi, and
has been particularly well characterized in Neurospora crassa, where it is
known as "quelling"
(Cogoni and Macino, Genes Dev. 2000, 10, 638-643; Guru, Nature, 2000, 404, 804-
808).
[0005] The first evidence that dsRNA could lead to gene silencing in
animals came from
work in the nematode, Caenorhabditis elegans. In 1995, researchers Guo and
Kemphues were
attempting to use antisense RNA to shut down expression of the par-1 gene in
order to assess its
function. As expected, injection of the antisense RNA disrupted expression of
par-1, but
quizzically, injection of the sense-strand control also disrupted expression
(Guo and Kempheus,
Cell, 1995, 81, 611-620). This result was a puzzle until Fire et al. injected
dsRNA (a mixture of
both sense and antisense strands) into C. elegans. This injection resulted in
much more efficient
silencing than injection of either the sense or the antisense strands alone.
Injection of just a few
molecules of dsRNA per cell was sufficient to completely silence the
homologous gene's
expression. Furthermore, injection of dsRNA into the gut of the worm caused
gene silencing not
only throughout the worm, but also in first generation offspring (Fire et al.,
Nature, 1998, 391,
806-811).
[0006] The potency of this phenomenon led Timmons and Fire to explore the
limits of
the dsRNA effects by feeding nematodes bacteria that had been engineered to
express dsRNA
homologous to the C. elegans unc-22 gene. Surprisingly, these worms developed
an unc-22 null-
like phenotype (Timmons and Fire, Nature 1998, 395, 854; Timmons et al., Gene,
2001, 263,
103-112). Further work showed that soaking worms in dsRNA was also able to
induce silencing
(Tabara et al., Science, 1998, 282, 430-431). PCT publication WO 01/48183
discloses methods
of inhibiting expression of a target gene in a nematode worm involving feeding
to the worm a
food organism which is capable of producing a double-stranded RNA structure
having a
nucleotide sequence substantially identical to a portion of the target gene
following ingestion of
the food organism by the nematode, or by introducing a DNA capable of
producing the double-
stranded RNA structure (Bogaert et al., 2001).
=
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
=
- 3 -
[0007] The posttranscriptional gene silencing defined in Caenorhabditis
elegans
resulting from exposure to double-stranded RNA (dsRNA) has since been
designated as RNA
interference (RNAi). This term has come to generalize all forms of gene
silencing involving
dsRNA leading to the sequence-specific reduction of endogenous targeted mRNA
levels; unlike
co-suppression, in which transgenic DNA leads to silencing of both the
transgene and the
endogenous gene.
[0008] Introduction of exogenous double-stranded RNA (dsRNA) into
Caenorhabditis
elegans has been shown to specifically and potently disrupt the activity of
genes containing
homologous sequences. Montgomery et al. suggests that the primary interference
affects of
dsRNA are post-transcriptional. This conclusion being derived from examination
of the primary
DNA sequence after dsRNA-mediated interference and a finding of no evidence of
alterations,
followed by studies involving alteration of an upstream operon having no
effect on the activity of
its downstream gene. These results argue against an effect on initiation or
elongation of
transcription. Finally using in situ hybridization they observed that dsRNA-
mediated
interference produced a substantial, although not complete, reduction in
accumulation of nascent
transcripts in the nucleus, while cytoplasmic accumulation of transcripts was
virtually
eliminated. These results indicate that the endogenous mRNA is the primary
target for
interference and suggest a mechanism that degrades the targeted mRNA before
translation can
occur. It was also found that this mechanism is not dependent on the SMG
system, an mRNA
surveillance system in C. elegans responsible for targeting and destroying
aberrant messages.
The authors further suggest a model of how dsRNA might function as a catalytic
mechanism to
target homologous mRNAs for degradation. (Montgomery et al., Proc. Natl. Acad.
Sci. USA,
1998, 95, 15502-15507).
[0009] Recently, the development of a cell-free system from syncytial
blastoderm
Drosophila embryos, which recapitulates many of the features of RNAi, has been
reported. The
interference observed in this reaction is sequence specific, is promoted by
dsRNA but not single-
stranded RNA, functions by specific mRNA degradation, and requires a minimum
length of
dsRNA. Furthermore, preincubation of dsRNA potentiates its activity
demonstrating that RNAi
can be mediated by sequence-specific processes in soluble reactions (Tuschl et
al., Genes Dev.,
1999, 13, 3191-3197).
[0010] In subsequent experiments, Tuschl et al, using the Drosophila in
vitro system,
demonstrated that 21- and 22-nt RNA fragments are the sequence-specific
mediators of RNAi.
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
- 4 -
These fragments, which they termed short interfering RNAs (siRNAs), were shown
to be
generated by an RNase III-like processing reaction from long dsRNA. They also
showed that
chemically synthesized siRNA duplexes with overhanging 3' ends mediate
efficient target RNA
cleavage in the Drosophila lysate, and that the cleavage site is located near
the center of the
region spanned by the guiding siRNA. In addition, they suggest that the
direction of dsRNA
processing detelmines whether sense or antisense target RNA can be cleaved by
the siRNA-
protein complex (Elbashir et al., Genes Dev., 2001, 15, 188-200). Further
characterization of the
suppression of expression of endogenous and heterologous genes caused by the
21-23 nucleotide
siRNAs have been investigated in several mammalian cell lines, including human
embryonic
kidney (293) and HeLa cells (Elbashir et al., Nature, 2001, 411, 494-498).
[0011] The Drosophila embryo extract system has been exploited, using
green
fluorescent protein and luciferase tagged siRNAs, to demonstrate that siRNAs
can serve as
primers to transform the target mRNA into dsRNA. The nascent dsRNA is degraded
to eliminate
the incorporated target mRNA while generating new siRNAs in a cycle of dsRNA
synthesis and
degradation. Evidence is also presented that mRNA-dependent siRNA
incorporation to fowl
dsRNA is carried out by an RNA-dependent RNA polymerase activity (RdRP)
(Lipardi et al.,
Cell, 2001, 107, 297-307).
[0012] The involvement of an RNA-directed RNA polymerase and siRNA
primers as
reported by Lipardi et al. (Lipardi et al., Cell, 2001, 107, 297-307) is one
of the many intriguing
features of gene silencing by RNA interference. This suggests an apparent
catalytic nature to the
phenomenon. New biochemical and genetic evidence reported by Nishikura et al.
also shows that
an RNA-directed RNA polymerase chain reaction, primed by siRNA, amplifies the
interference
caused by a small amount of "trigger" dsRNA (Nishikura, Cell, 2001, 107, 415-
418).
[0013] Investigating the role of "trigger" RNA amplification during RNA
interference
(RNAi) in Caenorhabditis elegans, Sijen et al revealed a substantial fraction
of siRNAs that
cannot derive directly from input dsRNA. Instead, a population of siRNAs
(termed secondary
siRNAs) appeared to derive from the action of the previously reported cellular
RNA-directed
RNA polymerase (RdRP) on mRNAs that are being targeted by the RNAi mechanism.
The
distribution of secondary siRNAs exhibited a distinct polarity (5'-3'; on the
antisense strand),
suggesting a cyclic amplification process in which RdRP is primed by existing
siRNAs. This
amplification mechanism substantially augmented the potency of RNAi-based
surveillance,
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
- 5 -
while ensuring that the RNAi machinery will focus on expressed mRNAs (Sijen et
al., Cell,
2001, 107, 465-476).
[0014] Most recently, Tijsterman et al. have shown that, in fact, single-
stranded RNA
oligomers of antisense polarity can be potent inducers of gene silencing. As
is the case for co-
suppression, they showed that antisense RNAs act independently of the RNAi
genes rde-1 and
rde-4 but require the mutator/RNAi gene mut-7 and a putative DEAD box RNA
helicase, mut-
14. According to the authors, their data favor the hypothesis that gene
silencing is accomplished
by RNA primer extension using the mRNA as template, leading to dsRNA that is
subsequently
degraded suggesting that single-stranded RNA oligomers are ultimately
responsible for the
RNAi phenomenon (Tijsterman et al., Science, 2002, 295, 694-697).
[0015] Several recent publications have described the structural
requirements for the
dsRNA trigger required for RNAi activity. Recent reports have indicated that
ideal dsRNA
sequences are 21nt in length containing 2 nt 3'-end overhangs (Elbashir et al,
EMBO (2001), 20,
6877-6887, Sabine Brantl, Biochimica et Biophysica Acta, 2002, 1575, 15-25.)
In this system,
substitution of the 4 nucleosides from the 3'-end with 2'-deoxynucleosides has
been
demonstrated to not affect activity. On the other hand, substitution with 2'-
deoxynucleosides or
2'-0Me-nucleosides throughout the sequence (sense or antisense) was shown to
be deleterious to
RNAi activity.
[0016] Investigation of the structural requirements for RNA silencing in
C. elegans has
demonstrated modification of the internucleotide linkage (phosphorothioate) to
not interfere with
activity (Parrish et al., Molecular Cell, 2000, 6, 1077-1087.) It was also
shown by Parrish et al.,
that chemical modification like 2'-amino or 5-iodouridine are well tolerated
in the sense strand
but not the antisense strand of the dsRNA suggesting differing roles for the 2
strands in RNAi.
Base modification such as guanine to inosine (where one hydrogen bond is lost)
has been
demonstrated to decrease RNAi activity independently of the position of the
modification (sense
or antisense). Some "position independent" loss of activity has been observed
following the
introduction of mismatches in the dsRNA trigger. Some types of modifications,
for example
introduction of sterically demanding bases such as 5-iodoU, have been shown to
be deleterious
to RNAi activity when positioned in the antisense strand, whereas
modifications positioned in
the sense strand were shown to be less detrimental to RNAi activity. As was
the case for the 21
nt dsRNA sequences, RNA-DNA heteroduplexes did not serve as triggers for RNAi.
However,
CA 02504720 2011-09-28
77684-23
- 6 -
dsRNA containing 2'-F-2'-deoxynucleosides appeared to be efficient in
triggering RNAi
response independent of the position (sense or antisense) of the 2'-F-2'-
deoxynucleosides.
[0017] In one study the reduction of gene expression was studied using
electroporated
dsRNA and a 25mer morpholino oligomer in post implantation mouse embryos
(Mellitzer et al.,
Mehanisms of Development, 2002, 118, 57-63). The morpholino oligomer did show
activity but
was not as effective as the dsRNA.
[0018] A number of PCT applications have recently been published that
relate to the
RNAi phenomenon. These include: PCT publication WO 00/44895; PCT publication
WO
00/49035; PCT publication WO 00/63364; PCT publication WO 01/36641; PCT
publication WO
01/36646; PCT publication WO 99/32619; PCT publication WO 00/44914; PCT
publication WO
01/29058; and PCT publication WO 01/75164.
[0019] U. S. Patent Nos. 5,898, 031 and 6, 107,094 describe certain
oligonucleotide
having RNA like properties. When hybridized with RNA, these oligonucleotides
serve as
substrates for a dsRNase enzyme with resultant cleavage of the RNA by the
enzyme.
[0020] In another recently published paper (Martinez et al., Cell, 2002,
110, 563-574) it
was shown that single stranded as well as double stranded siRNA resides in the
RNA-induced
silencing complex (RISC) together with elF2C1 and elf2C2 Outman GERp950)
Argonaute
proteins. The activity of 5'-phosphorylated single stranded siRNA was
comparable to the double
stranded siRNA in the system studied. In a related study, the inclusion of a
5'-phosphate moiety
was shown to enhance activity of siRNA's in vivo in Drosophilia embryos
(Boutla, et al., Curr.
Biol., 2001, 11, 1776-1780). In another study, it was reported that the 5'-
phosphate was required
for siRNA function in human HeLa cells (Schwarz et al., Molecular Cell, 2002,
10, 537-548).
[0021] In yet another recently published paper (Chiu et al., Molecular
Cell, 2002, 10,
549-561) it was shown that the 5'-hydroxyl group of the siRNA is essential as
it is
phosphorylated for activity while the 3'-hydroxyl group is not essential and
tolerates substitute
groups such as biotin. It was further shown that bulge structures in one or
both of the sense or
antisense strands either abolished or severely lowered the activity relative
to the unmodified
siRNA duplex. Also shown was severe lowering of activity when psoralen was
used to cross
link an siRNA duplex.
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
- 7 -
,
[0022] Like the RNAse H pathway, the RNA interference pathway for
modulation of
gene expression is an effective means for modulating the levels of specific
gene products and,
thus, would be useful in a number of therapeutic, diagnostic, and research
applications involving
gene silencing. The present invention therefore provides oligomeric compounds
useful for
modulating gene expression pathways, including those relying on mechanisms of
action such as
RNA interference and dsRNA enzymes, as well as antisense and non-antisense
mechanisms.
One having skill in the art, once armed with this disclosure will be able,
without undue
experimentation, to identify preferred oligonucleotide compounds for these
uses.
Summary of the Invention
[0023] In certain aspects, the invention relates to compositions
comprising a first
oligomer and a second oligomer, each having linked nucleosidic bases. At least
a portion of the
first oligomer is capable of hybridizing with at least a portion of the second
oligomer, at least a
portion of the first oligomer is complementary to and capable of hybridizing
to a selected target
nucleic acid, and at least one of the oligomers is a chimeric oligomeric
compound.
[0024] In some embodiments, the chimeric oligomeric compound is a gapmer,
an
inverted gapmer, a 3 '-hemimer, a 5'-hemimer or a blockm.er. In certain
embodiments, the
chimeric oligomeric compound comprises at least two of DNA, RNA, PNA segments,
and
mixtures thereof.
[0025] The chimeric oligomeric compound may be a gapmer. In certain
compositions,
the gapmer comprises two terminal RNA segments having nucleotides of a first
type and an
internal RNA segment having nucleotides of a second type and where said
nucleotides of said
first type are different from said nucleotides of said second type. In other
compositions, the
nucleotides of the first type independently include at least one sugar
substituent which is
halogen, amino, trifluoroalkyl, trifiuoroalkoxy, azido, aminooxy, alkyl,
alkenyl, alkynyl, 0-, S-,
or N(R*)-alkyl; 0-, S-, or N(R*)-alkenyl; 0-, S- or N(R*)-alkynyl; 0-, S- or N-
aryl, 0-, S-, or
N(R*)-aralkyl; where the alkyl, alkenyl, alkynyl, aryl and aralkyl may be
substituted or
unsubstituted C1 to Cio alkyl, C2 to C10 alkenyl, C2 to C10 alkynyl, C5-C20
aryl or C6-C20 aralkyl;
and said substituted C1 to C10 alkyl, C2 to C10 alkenyl, C2 to CIO alkynyl, C5-
C20 aryl or C6-C20
aralkyl comprising substitution with alkoxy, thioalkoxy, phthalimido, halogen,
amino, keto,
carboxyl, nitro, intros , cyano, trifluoromethyl, trifluoromethoxy, imidazole,
azido, hydrazino,
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
- 8 -
,
aminooxy, isocyanato, sulfoxide, sulfone, disulfide, silyl, heterocycle,
carbocycle, an
intercalator, a reporter group, a conjugate, a polyamine, a polyamide, a
polyalkylene glycol, or a
polyether of the formula (-0-alkyl)õõ where m is 1 to about 10; and R* is
hydrogen, or a
protecting group.
[0026] In certain embodiments, the chimeric oligomeric compound is an
inverted
gapmer. In some embodiments, the inverted gapmer comprises two terminal RNA
segments
having nucleotides of a second type and an internal RNA segment having
nucleotides of a first
type and where said nucleotides of said first type are different from said
nucleotides of said
second type. In other embodiments, each of the nucleotides of said first type
independently have
at least one sugar substituent that is halogen, amino, trifiuoroalkyl,
trifluoroalkoxy, azido,
aminooxy, alkyl, alkenyl, alkynyl, 0-, S-, or N(R*)-alkyl; 0-, S-, or N(R*)-
alkenyl; 0-, S- or
N(R*)-alkynyl; 0-, S- or N-aryl, 0-, S-, or N(R*)-aralkyl; where the alkyl,
alkenyl, alkynyl, aryl
and aralkyl may be substituted or unsubstituted Ci to Cio alkyl, C2 to Cio
alkenyl, C2 to Clo
alkynyl, C5-C20 aryl or C6-C20 aralkyl; and said substituted C1 to Cio alkyl,
C2 to C10 alkenyl, C2
to Cio alkynyl, C5-C20 aryl or C6-C20 aralkyl comprising substitution with
alkoxy, thioalkoxy,
phthalimido, halogen, amino, keto, carboxyl, nitro, nitroso, cyano,
trifluoromethyl, trifluoro-
methoxy, imidazole, azido, hydrazino, aminooxy, isocyanato, sulfoxide,
sulfone, disulfide, silyl,
heterocycle, carbocycle, an intercalator, a reporter group, a conjugate, a
polyamine, a polyamide,
a polyalkylene glycol, or a polyether of the formula (-0-alkyl)m, where m is 1
to about 10; and
R* is hydrogen, or a protecting group.
[0027] In some compositions, the chimeric oligomeric compound is 3'-
hemimer. In
certain embodiments, the 3'-hemimer comprises a terminal RNA segment having
nucleotides of
a first type and a further RNA segment having nucleotides of a second type and
where said
nucleotides of said first type are different from said nucleotides of said
second type. In certain
compositions, each of the nucleotides of the first type independently includes
at least one sugar
substituent that is halogen, amino, trifluoroalkyl, trifluoroalkoxy, azido,
aminooxy, alkyl,
alkenyl, alkynyl, 0-, S-, or N(R*)-alkyl; 0-, S-, or N(R*)-alkenyl; 0-, S- or
N(R*)-alkynyl; 0-,
S- or N-aryl, 0-, S-, or N(R*)-aralkyl; where the alkyl, alkenyl, alkynyl,
aryl and aralkyl may be
substituted or unsubstituted Ci to Cio alkyl, C2 to C10 alkenyl, C2 to C10
alkynyl, C5-C20 aryl or
C6-C20 aralkyl; and said substituted C1 to Cio alkyl, C2 to C10 alkenyl, C2 to
C10 alkynyl, C5-C20
aryl or C6-C20 aralkyl comprising substitution with alkoxy, thioalkoxy,
phthalimido, halogen,
amino, keto, carboxyl, nitro, nitroso, cyano, trifluoromethyl,
trifluoromethoxy, imidazole, azido,
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
- 9 -
hydrazino, aminooxy, isocyanato,,sulfoxide, sulfone, disulfide, silyl,
heterocycle, carbocycle, an
intercalator, a reporter group, a conjugate, a polyamine, a polyamide, a
polyalkylene glycol, or a
polyether of the formula (-0-alkyl)m, where m is 1 to about 10; and R* is
hydrogen, or a
protecting group.
[0028] In certain aspects, the invention concerns compositions where
chimeric
oligomeric compound is 5'-hemimer. In some compositions, the 5'-hemimer
comprises a
terminal RNA segment having nucleotides of a first type and a further RNA
segment having
nucleotides of a second type and where said nucleotides of said first type are
different from said
nucleotides of said second type. Some embodiments have each of the nucleotides
of said first
type independently includes at least one sugar sub stituent that is halogen,
amino, trifluoroalkyl,
trifluoroalkoxy, azido, aminooxy, alkyl, alkenyl, alkynyl, 0-, S-, or N(R*)-
alkyl; 0-, S-, or
N(R*)-alkenyl; 0-, S- or N(R*)-alkynyl; 0-, S- or N-aryl, 0-, S-, or N(R*)-
aralkyl; where the
alkyl, alkenyl, alkynyl, aryl and aralkyl may be substituted or unsubstituted
C1 to C10 alkyl, C2 to
Cio alkenyl, C2 to C10 alkynyl, C5-C20 aryl or C6-C20 aralkyl; and said
substituted C1 to C10 alkyl,
C2 to C10 alkenyl, C2 to Cio alkynyl, C5-C20 aryl or C6-C20 aralkyl comprising
substitution with
alkoxy, thioalkoxy, phthalimido, halogen, amino, keto, carboxyl, nitro,
nitroso, cyano,
trifluoromethyl, trifluoromethoxy, imidazole, azido, hydrazino, aminooxy,
isocyanato,
sulfoxide, sulfone, disulfide, silyl, heterocycle, carbocycle, an
intercalator, a reporter group, a
conjugate, a polyamine, a polyamide, a polyalkylene glycol, or a polyether of
the formula (-0-
alkyl),õ where m is 1 to about 10; and R* is hydrogen, or a protecting group.
[0029] In other embodiments, the chimeric oligomeric compound comprises a
blockmer.
In some embodiments, the blockmer is an oligonucleotide having a block of at
least two
consecutive nucleotides of a first type located immediately adjacent at least
one nucleotide of a
second type and where said nucleotides of said first type are different from
said nucleotides of
said second type. In other compositions, each of the nucleotides of said first
type independently
includes at least one sugar sub stituent that is halogen, amino,
trifluoroalkyl, trifluoroalkoxy,
azido, aminooxy, alkyl, alkenyl, alkynyl, 0-, S-, or N(R*)-alkyl; 0-, S-, or
N(R*)-alkenyl; 0-, S-
or N(R*)-alkynyl; 0-, S- or N-aryl, 0-, S-, or N(R*)-aralkyl; where the alkyl,
alkenyl, alkynyl,
aryl and aralkyl may be substituted or unsubstituted CI to Cio alkyl, C2 to
C10 alkenyl, C2 to C10
alkynyl, C5-C20 aryl or C6-C20 aralkyl; and said substituted C1 to C10 alkyl,
C2 to C10 alkenyl, C2
to C10 alkynyl, C5-C20 aryl or C6-C20 aralkyl comprising substitution with
alkoxy, thioalkoxy,
phthalimido, halogen, amino, keto, carboxyl, nitro, nitroso, cyano,
trifluoromethyl, trifluoro-
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
- 10 -
methoxy, imidazole, azido, hydrazino, aminooxy, isocyanato, sulfoxide,
sulfone, disulfide, silyl,
heterocycle, carbocycle, an intercalator, a reporter group, a conjugate, a
polyamine, a polyamide,
a polyalkylene glycol, or a polyether of the formula (-0-alkyl)õõ where m is 1
to about 10; and
R* is hydrogen, or a protecting group. In some preferred embodiments, the
nucleotides of said
of said second type comprise 2'-OH nucleotides.
[0030] Some embodiments further comprise a plurality of blocks of at
least two
consecutive nucleotides of a first type and wherein each of said blocks of
nucleotides of said first
type is separated from others of said blocks of nucleotides of said first type
by a nucleotide of
said second type.
[0031] In other aspects of the invention, the chimeric oligomer compound
comprises a
gapmer of the formula PNA-RNA-PNA. In certain embodiments, the chimeric
oligomeric
compound comprises a 5'-hemimer the formula PNA-RNA or a 3'-hemimer of the
formula
RNA-PNA. In yet other embodiments, the chimeric oligomeric compound comprises
an inverted
gapmer of the formula RNA-PNA-RNA.
[0032] The compounds of the invention may be chimeric oligomeric compound
that are
divided into at least two regions: a first region comprising a-nucleosides
linked by charged or
neutral 3'-5' phosphorous linkages; a-nucleosides linked by charged or neutral
2'-5' phosphorous
linkages; a-nucleosides linked by non-phosphorous linkages; 4'-thionucleosides
linked by
charged or neutral 3'-5' phosphorous linkages; 4'-thionucleosides linked by
charged or neutral 2'-
5' phosphorous linkages; 4'-thionucleosides linked by non-phosphorous
linkages; carbocyclic-
nucleosides linked by charged or neutral 3'-5' phosphorous linkages;
carbocyclic-nucleosides
linked by charged or neutral 2'-5' phosphorous linkages; carbocyclic-
nucleosides linked by non-
phosphorous linkages; 0-nucleosides linked by charged or neutral 3'-5'
linkages; 13-nucleosides
linked by charged or neutral 2'-5' linkages; or 13-nucleosides linked by non-
phosphorous linkages;
and a second region consists of 2'-ribo-13-nucleosides linked by charged 3'-5'
phosphorous
linkages.
[0033] Some preferred embodiments, are divided into at least two regions:
a first region
comprising a-nucleosides linked by charged or neutral 3'-5' phosphorous
linkages, a-nucleosides
linked by charged or neutral 2'-5' phosphorous linkages, a-nucleosides linked
by non-
phosphorous linkages, 4'-thionucleosides linked by charged or neutral 3'-5'
phosphorous
linkages, 4'-thionucleosides linked by charged or neutral 2'-5' phosphorous
linkages, 4'-
thionucleosides linked by non-phosphorous linkages, carbocyclic-nucleosides
linked by charged
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
- 11 -
or neutral phosphorous linkages, carbocyclic-nucleosides linked by non-
phosphorous linkages,
0-nucleosides linked by charged or neutral 3'-5' linkages, 13-nucleosides
linked by charged or
neutral 2'-5' linkages, or 0-nucleosides linked by non-phosphorous linkages;
and a second region
comprising nucleobases linked by non-phosphorous linkages or nucleobases that
are attached to
phosphate linkages via a non-sugar tethering moiety.
[0034] In other embodiments, the chimeric oligomeric compound is divided
into at least
two regions: a first region comprising nucleobases linked by non-phosphorous
linkages and
nucleobases that are attached to phosphate linkages via non-sugar tethering
groups, and
nucleosides selected from a-nucleosides linked by charged or neutral 3'-5'
phosphorous linkages,
a-nucleosides linked by charged or neutral 2'-5' phosphorous linkages, a-
nucleosides linked by
non-phosphorous linkages, 4'-thionucleosides linked by charged or neutral 3'-
5' phosphorous
linkages, 4'-thionucleosides linked by charged or neutral 2'-5' phosphorous
linkages, 4'-
thionucleosides linked by non-phosphorous linkages, carbocyclic-nucleosides
linked by charged
or neutral 3'-5' phosphorous linkages, carbocyclic-nucleosides linked by
charged or neutral 2'-5'
phosphorous linkages, carbocyclic-nucleosides linked by non-phosphorous
linkages, 0-
nucleosides linked by charged or neutral 3'-5' linkages; 0-nucleosides linked
by charged or
neutral 2'-5' linkages, or 0-nucleosides linked by non-phosphorous linkages;
and a second region
comprising 2'-ribo-0-nucleosides linked by charged 3'-5' phosphorous linkages
wherein the 3'-5'
phosphorous linkages.
[0035] Certain embodiments comprise at least two segments, wherein at
least one
segment comprises non-naturally occurring internucleoside linkages.
[0036] Other embodiments comprise an oligomer mimetic.
[0037] In certain embodiments, the nucleotides of the first type comprise
nucleotides
having a 2' halogen sugar substituent. In some embodiments, the halogen is F.
In other
embodiments, the nucleotides of the first type comprise nucleotides having a
2' 0-alkyl sugar
substituent. In certain embodiments, the -0-alkyl is ¨0-CH3. In still other
embodiments, the
nucleotides of said first type comprise nucleotides having a 2' sugar
substituent and where said
2' sugar substituent is of the formula ¨X-Y, wherein:
X is 0, S, NR**, or CR* wherein each R** is independently H or C1_6 alkyl; and
Y is substituted or unsubstituted C1-20 alkyl, substituted or unsubstituted
C2_20 alkenyl, or
substituted or unsubstituted C6-20 aryl.
CA 02504720 2011-09-28
77684-23
- 12 -
[0038] In certain other embodiments, the invention is directed to
oligonucleomer/protein
compositions comprising an ofigomer complementary to and capable of
hybridizing to a selected
target nucleic acid, and at least one protein comprising at least a portion of
a RNA-induced
silencing complex (RISC). The oligomer is a chimeric oligomeric compound.
[0039] In other aspects, the invention relates to oligomers having at
least a first region
and a second region where the first region is complementary to and capable of
hybridizing with
the second region, and at least a portion of the ofigomer is complementary to
and is capable of
hybridizing to a selected target nucleic acid. At least one of the regions is
a chimeric oligomeric
composition.
[0040] The first and second oligomers preferably each have 10 to 40
nucleosidic bases.
In other embodiments, each of the first and second oligomers have 18 to 30
nucleosidic bases. In
yet other embodiments, the first and second oligomers have 21 to 24
nucleosidic bases.
[0041] Also provided by the present invention are pharmaceutical
compositions
comprising any of the above compositions or oligomeric compounds and a
pharmaceutically
acceptable carrier.
[0042] Methods for modulating the expression of a target nucleic acid in
a cell are also
provided, wherein the methods comprise contacting the cell with any of the
above compositions
or oligomeric compounds.
[0043] The invention also concerns methods of treating or preventing a
disease or
condition associated with a target nucleic acid are also provided, wherein the
methods comprise
administering to a patient having or predisposed to the disease or condition a
therapeutically
effective amount of any of the above compositions or oligomeric compounds.
=
CA 02504720 2012-11-05
=
-12a-
In another aspect, the invention relates to a composition comprising a first
oligomer and a second oligomer forming a complementary pair of siRNA
oligomers,
wherein: each oligomer is 18 - 29 nucleotides in length, at least a portion of
said first
oligomer is capable of hybridizing with at least a portion of said second
oligomer, at least
a portion of said first oligomer is complementary to and capable of
hybridizing to a
selected target nucleic acid, and said first oligomer is a chimeric oligomeric
compound
selected from a 3'-hemimer, and a 5'-hemimer, and said second oligomer is not
a
chimeric oligomeric compound; said 3' and 5' hemimer having an RNA segment
having
nucleotides of a second type and a 3' or 5'-terminal segment having
nucleotides of a first
type, where said nucleotides of a first type are different from said
nucleotides of a second
type, and wherein each of the nucleotides of the terminal segment
independently include
at least one 2'-sugar substituent group; wherein said first oligomer is an
antisense
oligomer and said second oligomer is a sense oligomer; wherein said 2'-sugar
substituent
groups in said 3'-hemimer, or 5'hemimer are selected from 0(CH2)20CH3 and 0-
CH3;
and wherein said pair of siRNA oligomers includes an overhang.
Detailed Description of the Invention
[0044]
The present invention provides oligomeric compounds useful in the
modulation of
gene expression. Although not intending to be bound by theory, oligomeric
compounds of the
invention are believed to modulate gene expression by hybridizing to a nucleic
acid target
resulting in loss of noinial function of the target nucleic acid. As used
herein, the term "target
nucleic acid" or "nucleic acid target" is used for convenience to encompass
any nucleic acid
capable of being targeted including without limitation DNA, RNA (including pre-
mRNA and
mRNA or portions thereof) transcribed from such DNA, and also cDNA derived
from such
DOCSTOR. 2553532\1
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
- 13 -
RNA. In a preferred embodiment of this invention modulation of gene expression
is effected via
modulation of a RNA associated with the particular gene RNA.
[0045] The invention provides for modulation of a target nucleic acid
that is a messenger
RNA. The messenger RNA is degraded by the RNA interference mechanism as well
as other
mechanisms in which double stranded RNA/RNA structures are recognized and
degraded,
cleaved or otherwise rendered inoperable.
[0046] The functions of RNA to be interfered with can include replication
and
transcription. Replication and transcription, for example, can be from an
endogenous cellular
template, a vector, a plasmid construct or otherwise. The functions of RNA to
be interfered with
can include functions such as translocation of the RNA to a site of protein
translation,
translocation of the RNA to sites within the cell which are distant from the
site of RNA
synthesis, translation of protein from the RNA, splicing of the RNA to yield
one or more RNA
species, and catalytic activity or complex formation involving the RNA which
may be engaged
in or facilitated by the RNA. In the context of the present invention,
"modulation" and
"modulation of expression" mean either an increase (stimulation) or a decrease
(inhibition) in the
amount or levels of a nucleic acid molecule encoding the gene, e.g., DNA or
RNA. Inhibition is
often the preferred form of modulation of expression and mRNA is often a
preferred target
nucleic acid.
Compounds of the Invention
[0047] The present invention concerns certain modified oligomeric
compounds that are
not uniform in chemical composition. Discussed herein are numerous
modifications that may be
made to oligomeric compounds. In certain embodiments, more than one of these
modifications
may be incorporated in a single oligomeric compound or even at a single
monomeric subunit
such as a nucleoside within a oligomeric compound.
[0048] Modified oligomeric compounds of the present invention include
chimeric
oligomeric compounds. "Chimeric" oligomeric compounds, or "chimeras," in the
context of this
invention, are oligomeric compounds that contain two or more chemically
distinct regions, each
made up of at least one monomer unit, e.g., a nucleotide in the case of a
nucleic acid based
oligomer.
[0049] Chimeric oligomeric compounds typically contain at least one
region modified so
as to confer increased resistance to nuclease degradation, increased cellular
uptake, and/or
= CA 02504720 2011-09-28
77684-23
- 14 -
increased binding affinity for the target nucleic acid. An additional region
of the oligomeric
compound may serve as a substrate for enzymes capable of cleaving RNA:DNA or
RNA:RNA
hybrids, By way of example, RNase H is a cellular endonuclease which cleaves
the RNA strand
of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of
the RNA
target, thereby greatly enhancing the efficiency of inhibition of gene
expression. Consequently,
comparable results can often be obtained with shorter oligomeric compounds
when chimeras are
used, compared to for example phosphorothioate deoxyoligonucleotides
hybridizing to the same
target region. Cleavage of the RNA target can be routinely detected by gel
electrophoresis and,
if necessary, associated nucleic acid hybridization techniques ',mown in the
art.
[0050] Chimeric oligomeric compounds of the invention may be formed
as composite
structures of two or more oligonucleofides, oligonucleotide analogs,
oligonucleosides and/or
oligonucleotide mimetics as described herein. Such oligomeric compounds have
also been
referred to in the art as hybrids, hernimers, gapmers or inverted gapmers.
Representative United
States patents that teach the preparation of such structures include, but are
not limited to, U.S.:
5,013,830; 5,149,797; 5,220,007; 5,256,775; 5,366,878; 5,403,711; 5,491,133;
5,565,350;
5,623,065; 5,652,355; 5,652,356; and 5,700,922.
[00511 The terms blocicmer, 3'-hemimer, 5'-hernimer, gapmer and
inverted gapmer are
used in this specification to identify certain motifs or positional placement
of types or segments
of nucleotides in an oligomer. Depending on the number of nucleotide or
nucleoside subunits
and their position in the oligomer, one or more than one of these terms might
apply to a
particular construction and could be used for identification purposes. A
blocicrner has at least
one block or segment of at least two consecutively located nucleotide or
nucleoside subunits of a
first type positioned adjacent to at least one nucleotide or nucleoside of a
second type. Thus for
instances if the nucleotides or nucleosides of the first type are represented
by "X" and those of
the second type are represented by "Y" and if "..." represent nucleotides or
nucleosides other
that the X or Y type nucleotides or the absence of any nucleotides then the
following structures
...XXY..; ...XXYXX...; ...)DCDOCYXX... on so on for higher
homologs are
possible where each X containing segment includes two members and each Y
containing
segment includes only one member. If each X containing segment includes two
members and
each Y subunit also includes two members other representational blocicmers
include
...XXYY...; ...XXYYXX...; and so on for
high
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
- 15 -
homologs. These can be extended to other representative structures having more
X and/or Y
members in the blocks or segments, as for instances the structures
YXXXXYYYXXXXY;
YYXXXYYXX<XXYY; and YYYY XXXX.
[0052] If a block or segment of the first type of nucleotides or
nucleoside resides at the 5'
or the 3' terminus and all of the remaining nucleotides or nucleosides of the
oligomer are of the
second type, then that blockmer is also a hemimer. Using the same X and Y
representation and
selecting five members for each segment and basing the hemimer designation on
the X members
then the representations XXXXXYYYYY and YYYYYXXXX represent, respectively, 5'
and 3'
hemimers.
[0053] In gapmers, a block or segment of one type of nucleotides or
nucleosides is
interspaced between first and second blocks of the second type. As before if
the designation is
based on the X members then XXXXYYYYXXXX represents a gapmer and
YYYY represents an invertered gapmer.
[0054] The chimric oligomeric compounds may contain any modification
known to those
skilled in the art. Examples of suitable modifications include modification of
the sugar moiety,
replacement of the sugar with a sugar surrogate, and modification to the
backbone.
[0055] In some embodiments, the chimeric compound comprises at least two
segments
that are DNA segments, RNA segments, oligomer mimetic segments, or mixtures
thereof. In
certain preferred embodiments, the oligomer mimetic is a peptide nucleic acid
(PNA). In one
preferred embodiment, a chimeric oligomeric compound according to the
invention contains
DNA and peptide nucleic acid (PNA) segments.
[0056] Oligonucleoside segments according to the invention are formed
from units that
have pentofuranosyl sugars and naturally-occurring or non-naturally occurring
nucleobases.
DNA segments are formed from nucleoside units that have 2'-deoxy-erythro-
pentofuranosyl
sugar moieties and such a nucleobase, while RNA segments are formed from
nucleoside units
that have 2'-hydroxy-erythro-pentofuranosyl sugar moieties and such a
nucleobase. Modified
oligonucleoside segments are formed from nucleoside units that have some other
type of
pentofuranosyl sugar. The nucleosides are linked together and/or to other
moieties by linkages
disclosed herein. Such linkages include phosphodiester linkages,
phosphorothioate linkages
and/or phosphorodithioate linkages. In certain preferred compounds of the
invention each of the
nucleosides of the 2'-deoxyoligonucleotide portion are linked together by
phosphorothioate
linkages. In other preferred embodiments,-they are linked together -by-
phosphodiester linkages
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
- 16 -
and in even further preferred embodiments, a mixture of phosphodiester and
phosphorothioate
linkages.
[0057] The peptide nucleic acid segments of the compounds typically
increase the
binding affinity of the compound to a complementary strand of nucleic acid.
They also typically
provide for nuclease stability of the compound against degradation by cellular
nucleases.
Selecting the 2'-deoxyoligonucleotide portion of the compound to include one
or more or all
phosphorothioate or phosphorodithioate linkages provides further nuclease
stability to the
compounds of the invention.
[0058] The PNA portions of the compounds of the invention are made up of
units
comprising a N-(2-aminoethyl)glycine or analogues thereof having a nucleobase
attached thereto
via a linker such as a carboxymethyl moiety or analogues thereof to the
nitrogen atom of the
glycine portion of the unit. The units are coupled together via amide bonds
formed between the
carboxyl group of the glycine moiety and the amine group of the aminoethyl
moiety. The
nucleobase can be one of the four common nucleobases of nucleic acids or they
can include other
natural or synthetic nucleobases. PNA compositions are discussed in more
detail below.
[0059] In one embodiment, the chimera is a PNA-RNA-PNA composition where
each
PNA and RNA segment comprises at least one PNA or RNA monomer (also referred
to herein as
a "subunit"). In another embodiment, the chimera is RNA-PNA-RNA. Some segments
may
contain at least two subunits. Other segments contain at least three subunits.
Yet other segments
may contain five or more subunits.
[0060] In some preferred compounds of the invention the PNA-DNA-PNA
structure is
formed by connecting together the respective N-(2-aminoethyl)glycine PNA units
and the
respective 2'-ribose sugar phosphate RNA units. Thus the nucleobases of the
PNA portion of the
compounds of the invention are carried on a backbone composed of N-(2-
aminoethyl)glycine
PNA units and the nucleobases of the RNA portion of the compounds of the
invention are carried
on a backbone composed of T-ribose sugar phosphate units. Together, the
nucleobases of the
PNA portions and the nucleobases of the RNA portion of the compounds of the
invention are
connected by their respective backbone units in a sequence that is
hybridizable to a
complementary nucleic acid, as for instance, a targeted RNA stand.
[0061] In some preferred compounds of the invention the PNA and the RNA
portions are
joined together with amide linkages. Such preferred compound of the invention
areof the
structure:
= CA 02504720 2011-09-28
77684-23
- 17 -
PNA-(amide link)-RNA-(amide link)-PNA.
[0062] The amide linkage may be oriented as ¨C(0)NH- or ¨NHC(0)-.
Other linkages
that can be used to join the PNA and the RNA portions include those
intemucleoside linkages
disclosed below. In some preferred embodiment, the linkages are amine ester
linkages.
[0063] In another embodiment, the chimera is a PNA-RNA or RNA-PNA
composition
wherein the PNA and DNA segments are as described above.
[0064] Mixed PNA and DNA compositions are discussed in detail in
U.S. Patent No.
5,700,922. Mixed RNA and PNA compositions may be made by analogous methods.
[0065] In some embodiments the chimeric oligomeric composition may
be a modified
RNA. In some embodiments, these chimeric oligomers may be gapmers, an inverted
gapmer, or
a hemimers. In certain embodiments, the modified segment of RNA comprises a 2'-
substituted-
oligoribonucleotide. For purposes of the invention, the term "2'-substituted"
means replacement
of the 2'-OH of the ribose molecule with a sugar substituent other than H. The
sugar substituent
may be any one of the sugar substituents disclosed herein. In some
embodiments, the sugar
substituent is -0-alkyl containing 1-6 carbon atoms, aryl or substituted aryl
or C2-6 ally!.
Examples of these substituents are T-OMe, 2'-0-allyl, T-0-aryl, 2'-0-alkyl, T-
halo, and 2'-
amino. In some preferred embodiments, the sugar substituent is ¨0-alkyl. In
other embodiments,
the sugar substituent is F. In certain embodiments, allyl, aryl, or alkyl
groups may be optionally
substituted with substituents that include one or more halo, hydroxy,
trifluoromethyl, cyano,
nitro, acyl, acyloxy, alkoxy, carboxyl, carbalkoxyl and amino groups. Modified
sugar
compositions are discussed in more detail in U.S. Patent Nos. 5,652,355 and
5,652,356.
[0066] In yet other embodiments, the chimeric oligomeric
compositions comprise
modified intemucleoside linkages and the use of a-nucleosides and II-
nucleosides. Such
modifications may produce segments that increase binding affinity of the
oligonucleotide to a
complementary strand of nucleic acid. See U.S. Patent No. 5,623,065.
[0067] In certain preferred embodiments, the nucleotide units that
bear such substituents
can be divided into a first nucleotide unit sub-sequence and a second
nucleotide unit sub-
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
- 18 -
sequence, with 2'-deoxy-erythro-pentofuranosyl structures being positioned
within the
oligonucleotide between the first nucleotide unit sub-sequence and the second
nucleotide unit
sub-sequence. In certain embodiments, it is preferred that all such
intervening nucleotide units be
2'-deoxy-erythro-pentofuranosyl units.
[0068] In further preferred oligomers of the invention, nucleotide units
bearing
sub stituents that increase binding affinity are located at one or both of the
3' or the 5' termini of
the oligomer. There can be from one to about eight nucleotide units that are
substituted with
substituent groups. Preferably, at least five sequential nucleotide units are
T-deoxy-erythro-
pentofuranosyl sugar moieties.
[0069] The present invention also provides compounds formed from a
plurality of linked
nucleosides selected from a-nucleosides, 13-nucleosides including 2'-deoxy-
erythro-
pentofuranosyl 13-nucleosides, 4'-thionucleosides, and carbocyclic-
nucleosides. These
nucleosides are connected by linkages in a sequence that is hybridizable to a
complementary
nucleic acid. The linkages are selected from charged phosphorous linkages,
neutral phosphorous
linkages, and non-phosphorous linkages. The sequence of linked nucleosides is
divided into at
least two regions. The first nucleoside region includes the following types of
nucleosides: a-
nucleosides linked by charged or neutral 3'-5' phosphorous linkages; a-
nucleosides linked by
charged or neutral 2'-5' phosphorous linkages; a-nucleosides linked by non-
phosphorous
linkages; 4'-thionucleosides linked by charged or neutral 3'-5' phosphorous
linkages; 4'-
thionucleosides linked by charged or neutral 2'-5' phosphorous linkages; 4'-
thionucleosides
linked by non-phosphorous linkages; carbocyclic-nucleosides linked by charged
or neutral 3'-5'
phosphorous linkages; carbocyclic-nucleosides linked by charged or neutral 2'-
5' phosphorous
linkages; carbocyclic-nucleosides linked by non-phosphorous linkages; 13-
nucleosides linked by
charged or neutral 3'-5' linkages; 13-nucleosides linked by charged or neutral
2'-5' linkages; and 0-
nucleosides linked by non-phosphorous linkages. A second nucleoside region
consists of 2'-ribo-
0-nucleosides linked by charged 3'-5' phosphorous linkages. In some
embodiments, the 3'-5'
phosphorous linkages have a negative charge at physiological pH. In preferred
embodiments, the
compounds include at least 3 of said 2'-deoxy-erythro-pentofuranosyl 0-
nucleosides, more
preferably at least 5 of said 2'-deoxy-erythro-pentofuranosyl 13-nucleotides.
In further preferred
embodiments there exists a third nucleoside region whose nucleosides are
selected from those
selectable for the first region. In preferred embodiments the second region is
positioned between
the first and third regions.
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
- 19 -
[0070] Certain preferred charged phosphorous linkages include
phosphodiester,
phosphorothioate, phosphorodithioate, phosphoroselenate and
phosphorodiselenate linkages;
phosphodiester and phosphorothioate linkages are particularly preferred.
Preferred neutral
phosphorous linkages include alkyl and aryl phosphonates, alkyl and aryl
phosphoroamidites,
alkyl and aryl phosphotriesters, hydrogen phosphonate and boranophosphate
linkages. Preferred
non-phosphorous linkages include peptide linkages, hydrazine linkages, hydroxy-
amine linkages,
carbamate linkages, morpholine linkages, carbonate linkages, amide linkages,
oxymethyleneimine linkages, hydrazide linkages, silyl linkages, sulfide
linkages, disulfide
linkages, sulfone linkages, sulfoxide linkages, sulfonate linkages,
sulfonamide linkages,
formacetal linkages, thioformacetal linkages, oxime linkages and ethylene
glycol linkages.
[0071] The invention also provides compounds formed from a plurality of
linked units,
each of which is selected from nucleosides and nucleobases. The nucleosides
include a-
nucleosides, (3-nucleosides including 2'-deoxy-erythro-pentofuranosyl 0-
nucleosides,
thionucleosides and carbocyclic-nucleosides. The nucleobases include purin-9-
y1 and pyrimidin-
1-y1 heterocyclic bases. The nucleosides and nucleobases of the units are
linked together by
linkages in a sequence wherein the sequence is hybridizable to a complementary
nucleic acid and
the sequence of linked units is divided into at least two regions. The
linkages are selected from
charged 3'-5' phosphorous, neutral 3'-5' phosphorous, charged 2'-5'
phosphorous, neutral 2'-5'
phosphorous or non-phosphorous linkages. A first of the regions includes
nucleobases linked by
non-phosphorous linkages and nucleobases that are attached to phosphate
linkages via non-sugar
tethering groups, and nucleosides selected from a-nucleosides linked by
charged or neutral 3'-5'
phosphorous linkages, a-nucleosides linked by charged or neutral 2'-5'
phosphorous linkages, a-
nucleosides linked by non-phosphorous linkages, 4'-thionucleosides linked by
charged or neutral
3'-5' phosphorous linkages, 4'-thionucleosides linked by charged or neutral 2'-
5' phosphorous
linkages, 4'-thionucleosides linked by non-phosphorous linkages, carbocyclic-
nucleosides linked
by charged or neutral 3'-5' phosphorous linkages, carbocyclic-nucleosides
linked by charged or
neutral 2'-5' phosphorous linkages, carbocyclic-nucleosides linked by non-
phosphorous linkages,
13-nucleosides linked by charged or neutral 3'-5' linkages; (3-nucleosides
linked by charged or
neutral 2'-5' linkages, and 0-nucleosides linked by non-phosphorous linkages.
A second of the
regions includes only 2'-ribo- 0-nucleosides linked by charged 3'-5'
phosphorous linkages. In
some embodiments the 3'-5' phosphorous linkages have a negative charge at
physiological pH.
CA 02504720 2011-09-28
77684-23
- 20 -
100721 In certain preferred embodiments, the first region includes at
least two
nucleobases joined by a non-phosphate linkage such as a peptide linkage. In
preferred
embodiments, the compounds include a third region that is selected from the
same groups as
described above for the first region. In preferred embodiments, the second
region is located
between the first and third regions.
100731 The invention also provides compounds that have a plurality of
linked units, each
of which is selected from nucleosides and nucleobases. The nucleosides are
selected from a-
nucleosides, 13-nucleosides, 4'-thionucleosides and carbocyclic-nucleosides
and the nucleobases
are selected from purin-9-yl and pyrimidin-l-yl heterocyclic bases. The
nucleosides and
nucleobases of said units are linked together by linkages in a sequence
wherein the sequence is
hybridizable to a complementary nucleic acid. The sequence of linked units is
divided into at
least two regions. The linkages are selected from charged phosphorous, neutral
phosphorous or
non-phosphorous linkages. A first of the regions include a-nucleosides linked
by charged or
neutral 3'-5' phosphorous linkages, a-nucleosides linked by charged or neutral
2'-5' phosphorous
linkages, a-nucleosides linked by non-phosphorous linkages, 4'-thionucleosides
linked by
charged or neutral 3'-5' phosphorous linkages, 4'-thionucleosides linked by
charged or neutral 2'-
5' phosphorous linkages, 4'-thionucleosides linked by non-phosphorous
linkages, carbocyclic-
nucleosides linked by charged or neutral phosphorous linkages, carbocyclic-
nucleosides linked
by non-phosphorous linkages, 13-nucleosides linked by charged or neutral 3'-5'
linkages, 13-
nucleosides linked by charged or neutral 2'-5' linkages, and 13-nucleosides
linked by non-
phosphorous linkages. A second of the regions include nucleobases linked by
non-phosphorous
linkages and nucleobases that are attached to phosphate linkages via a non-
sugar tethering
moiety.
[00741 In certain embodiments, two regions of the instant oligomers may
be linked by a
hinge region. Hinge regions consist of nucleosidic or non-nucleosidic polymers
which
preferably facilitate the specific binding of the monomers of the oligomer
regions with their
targets. Generally, the oligonucleotide regions may be connected to hinge
regions and/or binding
moieties in either 5'43' or 3'45' orientations. The hinge region is designed
to permit specific
hybridization of the oligomer regions to their respective target sequences
hinge regions
applicable to the instant invention include those disclosed in U.S. Patent No.
6,048,974.
= CA 02504720 2011-09-28
77684-23
- 21 -
[00751
In other embodiments, the invention concerns a composition comprising a gapmer
composition where the wings are a modified oligomeric composition that is
linked by a region of
unpaired monomers. In such compositions, the wing segments are complementary
to each other.
Such compositions may be made by methods disclosed in U.S. Patent No.
5,565,350.
100761 In certain chimeric oligomeric compositions, at least one
segment is modified to
comprise at least one non-naturally occurring intemucleoside linkages. In some
compositons,
the linkage is a phosphoramidate linkage. Suitable chimeric oligomeric
compositions include
gapmers, inverted gapmers, and hemimers. In some compositions, the
modification is at one or
both of the 5' and 3' terminus. Phosphoramidate compositions may be made by
methods
disclosed in U.S. Patent No. 5,256,775.
[00771
In yet other embodiments, the chimeric oligomeric composition is modified at
the
3'-terminal end to comprise linkages that are resistant to degradation within
cells and body
fluids. Such modifications include those where the modified 3'-terminal
intemucleotide
phosphodiester linkage is a phosphotriester, phosphonate, phosphoramidate,
phosphorothioate, or
phosphoroselenate linkage. Such linkages are discussed in U.S. Patent Nos.
5,491,133 and
5,920,007.
[00781
One preferred composition comprises chimeric phosphoramidate oligonucleotides
having both N3'-phosphoramidate linkages and phosphodiester linkages. In these
compositions,
at least one of the phosphodiester linkages is at the 3' end of the
oligonucleotide. These mixed
phosphodiester/phosphoramidate linkage compositions are described in U.S.
Patent No.
6,043,070.
[00791
The chimeric oligomeric composition may comprise a mixed phosphate backbone
oligonucleotide consisting essentially of an internal segment of modified
nucleotides which
activates RNase H and two modified nucleotide sequences which do not activate
RNAse H, in
which the two modified nucleotide sequences flank the internal segments, one
on each side of the
internal segment, wherein the intemucleoside bridging phosphate residues of
the internal
segment are modified phosphates which are phosphorothioates and the
internucleoside bridging
phosphate residues of the two flanking modified nucleotide sequences are
modified phosphate
selected from the group consisting of: methyl phosphonates,
phosphoromorpholidates,
= CA 02504720 2011-09-28
77684-23
- 22 -
phosphoropiperazidates, and phosphoramidates. Such linkages are discussed in
U.S. Patent No.
6,060,456.
100801 In certain embodiments, the present compounds incorporate
one or more
polynucleoside segments having chirally-pure or chirally-enriched modified
(non-
phosphodiester) internucleoside linkages. The chirally-selected linkage
segments are preferably
selected to include linkages having R chirality at the asymmetric phosphorus
atom of one or
more of the linkage structures ("Rp chirality"). Preferably, at least about
40% of the linkages in a
given chirally-selected segment will be Rrchiral. Also included are segments
selectively
including one or more Sp-chiral linkages. In one preferred embodiment,
chirally-selected
segments are situated at the terminal (3' and 5') portions of the compound,
surrounding (flanking)
a central RNaseH-activating region. The flanking chirally-selected segments
preferably are
substantially non-RNaseH-activating. The RNaseH-activating region, if linked
with asymmetric
(chiral) linkage groups, may alternatively or additionally be chirally
selected. In a related
embodiment, the RNaseH-activating region is situated at or near one terminus
of the compound,
and all or a portion of the remainder of the compound is chirally selected and
preferably is non-
RNaseH-activating.
100811 The chirally-selected Rrenriched segments of the invention
serve to increase the
binding affinity of the compound as compared to racemic compounds. In
addition, because the
chirally-selected modified linkage structures are more resistant to
degradation by endo- and/or
exonucleases than are non-modified phosphodiester linkages, the chirally-
selected segments will
tend to protect the compound from degradation in the in vivo environment. Such
linkages are
discussed in U.S. Patent No. 6,262,036.
100821 In certain embodiments, the internucleoside bridging
phosphate residues of the
two flanking modified nucleotide sequences are methyl phosphonates. In other
.embodiments,
the intemucleoside bridging phosphate residues of the two flanking modified
nucleotide
sequences are phosphoromorpholidates. In yet other embodiments, the
internucleoside bridging
phosphate residues of the two flanking modified nucleotide sequences are
phosphoropiperazidates. Still other embodiments are those where the
internucleoside bridging
phosphate residues of the two flanking modified nucleotide sequences are
phosphoramidates.
These compositions may be made by methods disclosed in U.S. Patent Nos.
5,149,797 and
5,366,878.
= CA 02504720 2011-09-28
77684-23
- 23 -
[0083] Some compositions of the invention have an abasic moiety at
the 3' end or at the
5' end or at both the 3' end and the 5' end of the molecule, wherein said
abasic moiety lacks a
nucleic acid base. Abasic moieties are discussed in U.S. Patent No. 6,117,657,
[0084] Other chimeric compounds of the invention comprise terminal 3'-
-3' and 5'--5'
linkages. These compounds are stable to nucleases. These linkages are
discussed in U.S. Patent
No. 5,750,669.
[0085J In yet another embodiment, the 3' and/or 5' end of the
ofigomer may be capped
with one or more guanines that are not complementary to the target sequence.
In some
embodiments, the number of non-complementary guanines is two to six, more
preferably from
three to five, and still more preferably four. Use of guanine caps is
discussed in U.S. Patent No.
6,121,434.
[0086] Certain embodiments comprise a composition with a terminal
modification that is
of the formula:
0
X>
^N
H2N N 0 0
0
HO OH OH
OH
where X is N or N(CH3)+. In a preferred embodiment, the modification is a 5'
terminal
modification. This terminal group can be made by methods taught in U.S. Patent
No. 5,837,852.
Hybridization
[OM] In the context of this invention, "hybridization" means the
pairing of
complementary strands of oligomeric compounds. In the present invention, the
preferred
mechanism of pairing involVes hydrogen bonding, which may be Watson-Crick,
Hoogsteen or
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
- 24 -
reversed Hoogsteen hydrogen bonding, between complementary nucleoside or
nucleotide bases
(nucleobases) of the strands of oligomeric compounds. For example, adenine and
thymine are
complementary nucleobases that pair through the formation of hydrogen bonds.
Hybridization
can occur under varying circumstances.
[0088] An oligomeric compound of the invention is believed to
specifically hybridize to
the target nucleic acid and interfere with its normal function to cause a loss
of activity. There is
preferably a sufficient degree of complementarity to avoid non-specific
binding of the oligomeric
compound to non-target nucleic acid sequences under conditions in which
specific binding is
desired, i.e., under physiological conditions in the case of in vivo assays or
therapeutic treatment,
and under conditions in which assays are performed in the case of in vitro
assays.
[0089] In the context of the present invention the phrase "stringent
hybridization
conditions" or "stringent conditions" refers to conditions under which an
oligomeric compound
of the invention will hybridize to its target sequence, but to a minimal
number of other
sequences. Stringent conditions are sequence-dependent and will vary with
different
circumstances and in the context of this invention; "stringent conditions"
under which oligomeric
compounds hybridize to a target sequence are determined by the nature and
composition of the
oligomeric compounds and the assays in which they are being investigated.
[0090] "Complementary," as used herein, refers to the capacity for
precise pairing of two
nucleobases regardless of where the two are located. For example, if a
nucleobase at a certain
position of an oligomeric compound is capable of hydrogen bonding with a
nucleobase at a
certain position of a target nucleic acid, then the position of hydrogen
bonding between the
oligomer and the target nucleic acid is considered to be a complementary
position. The
oligomeric compound and the target nucleic acid are complementary to each
other when a
sufficient number of complementary positions in each molecule are occupied by
nucleobases that
can hydrogen bond with each other. Thus, "specifically hybridizable" and
"complementary" are
terms which are used to indicate a sufficient degree of precise pairing or
complementarity over a
sufficient number of nucleobases such that stable and specific binding occurs
between the
oligomer and a target nucleic acid.
[0091] It is understood in the art that the sequence of the oligomeric
compound need not
be 100% complementary to that of its target nucleic acid to be specifically
hybridizable.
Moreover, an oligomeric compound may hybridize over one or more segments such
that
intervening or adjacent segments are not involved in the hybridization event
(e.g., a loop
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
- 25 -
structure or hairpin structure). It is preferred that the oligomeric compounds
of the present
invention comprise at least 70% sequence complementarity to a target region
within the target
nucleic acid, more preferably that they comprise 90% sequence complementarily
and even more
preferably comprise 95% sequence complementarity to the target region within
the target nucleic
acid sequence to which they are targeted. For example, an oligomeric compound
in which 18 of
20 nucleobases of the oligomeric compound are complementary to a target
region, and would
therefore specifically hybridize, would represent 90 percent complementarily.
In this example,
the remaining noncomplementary nucleobases may be clustered or interspersed
with
complementary nucleobases and need not be contiguous to each other or to
complementary
nucleobases. As such, an oligomeric compound which is 18 nucleobases in length
having 4
(four) noncomplementary nucleobases which are flanked by two regions of
complete
complementarity with the target nucleic acid would have 77.8% overall
complementarity with
the target nucleic acid and would thus fall within the scope of the present
invention. Percent
complementarity of an oligomeric compound with a region of a target nucleic
acid can be
determined routinely using BLAST programs (basic local alignment search tools)
and
PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990,
215, 403-410;
Zhang and Madden, Genome Res., 1997, 7, 649-656).
Targets of the invention
[0092] "Targeting" an oligomeric compound to a particular nucleic acid
molecule, in the
context of this invention, can be a multistep process. The process usually
begins with the
identification of a target nucleic acid whose function is to be modulated.
This target nucleic acid
may be, for example, a mRNA transcribed from a cellular gene whose expression
is associated
with a particular disorder or disease state, or a nucleic acid molecule from
an infectious agent.
[0093] The targeting process usually also includes determination of at
least one target
region, segment, or site within the target nucleic acid for the interaction to
occur such that the
desired effect, e.g., modulation of expression, will result. Within the
context of the present
invention, the term "region" is defined as a portion of the target nucleic
acid having at least one
identifiable structure, function, or characteristic. Within regions of target
nucleic acids are
segments. "Segments" are defined as smaller or sub-portions of regions within
a target nucleic
acid. "Sites," as used in the present invention, are defined as positions
within a target nucleic
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
- 26 -
acid. The terms region, segment, and site can also be used to describe an
oligomeric compound
of the invention such as for example a gapped oligomeric compound having 3
separate segments.
[0094] Since, as is known in the art, the translation initiation codon is
typically 5'-AUG
(in transcribed mRNA molecules; 5'-ATG in the corresponding DNA molecule), the
translation
initiation codon is also referred to as the "AUG codon," the "start codon" or
the "AUG start
codon". A minority of genes have a translation initiation codon having the RNA
sequence
5'-GUG, 5'-UUG or 5'-CUG, and 5'-AUA, 5'-ACG and 5'-CUG have been shown to
function in
vivo. Thus, the terms "translation initiation codon" and "start codon" can
encompass many
codon sequences, even though the initiator amino acid in each instance is
typically methionine
(in eukaryotes) or formylmethionine (in prokaryotes). It is also known in the
art that eukaryotic
and prokaryotic genes may have two or more alternative start codons, any one
of which may be
preferentially utilized for translation initiation in a particular cell type
or tissue, or under a
particular set of conditions. In the context of the invention, "start codon"
and "translation
initiation codon" refer to the codon or codons that are used in vivo to
initiate translation of an
mRNA transcribed from a gene encoding a nucleic acid target, regardless of the
sequence(s) of
such codons. It is also known in the art that a translation termination codon
(or "stop codon") of
a gene may have one of three sequences, i.e., 5'-UAA, 5'-UAG and 5'-UGA (the
corresponding
DNA sequences are 5'-TAA, 5'-TAG and 5'-TGA, respectively).
[0095] The terms "start codon region" and "translation initiation codon
region" refer to a
portion of such an mRNA or gene that encompasses from about 25 to about 50
contiguous
nucleotides in either direction (i.e., 5' or 3') from a translation initiation
codon. Similarly, the
terms "stop codon region" and "translation termination codon region" refer to
a portion of such
an mRNA or gene that encompasses from about 25 to about 50 contiguous
nucleotides in either
direction (i.e., 5' or 3') from a translation termination codon. Consequently,
the "start codon
region" (or "translation initiation codon region") and the "stop codon region"
(or "translation
termination codon region") are all regions which may be targeted effectively
with the antisense
oligomeric compounds of the present invention.
[0096] The open reading frame (ORF) or "coding region," which is known in
the art to
refer to the region between the translation initiation codon and the
translation termination codon,
is also a region which may be targeted effectively. Within the context of the
present invention, a
preferred region is the intragenic region encompassing the translation
initiation or termination
codon of the open reading frame (ORF) of a gene.
CA 02504720 2005-05-02
WO 2004/044138
PCT/US2003/035074
- 27 -
[0097] Other target regions include the 5' untranslated region (5'UTR),
known in the art
to refer to the portion of an mRNA in the 5' direction from the translation
initiation codon, and
thus including nucleotides between the 5' cap site and the translation
initiation codon of an
mRNA (or corresponding nucleotides on the gene), and the 3' untranslated
region (3'UTR),
known in the art to refer to the portion of an mRNA in the 3' direction from
the translation
termination codon, and thus including nucleotides between the translation
termination codon and
3' end of an mRNA (or corresponding nucleotides on the gene). The 5' cap site
of an mRNA
comprises an N7-methylated guanosine residue joined to the 5'-most residue of
the mRNA via a
5'-5' triphosphate linkage. The 5' cap region of an mRNA is considered to
include the 5' cap
structure itself as well as the first 50 nucleotides adjacent to the cap site.
It is also preferred to
target the 5' cap region.
[0098] Although some eukaryotic mRNA transcripts are directly translated,
many contain
one or more regions, known as "introns," which are excised from a transcript
before it is
translated. The remaining (and therefore translated) regions are known as
"exons" and are
spliced together to form a continuous mRNA sequence. Targeting splice sites,
i.e., intron-exon
junctions or exon-intron junctions, may also be particularly useful in
situations where aberrant
splicing is implicated in disease, or where an overproduction of a particular
splice product is
implicated in disease. Aberrant fusion junctions due to rearrangements or
deletions are also
preferred target sites. mRNA transcripts produced via the process of splicing
of two (or more)
mRNAs from different gene sources are known as "fusion transcripts". It is
also known that
introns can be effectively targeted using oligomeric compounds targeted to,
for example, pre-
mRNA.
[0099] It is also known in the art that alternative RNA transcripts can
be produced from
the same genomic region of DNA. These alternative transcripts are generally
known as
"variants". More specifically, "pre-mRNA variants" are transcripts produced
from the same
genomic DNA that differ from other transcripts produced from the same genomic
DNA in either
their start or stop position and contain both intronic and exonic sequences.
[00100]
Upon excision of one or more exon or intron regions, or portions thereof
during splicing, pre-mRNA variants produce smaller "mRNA variants".
Consequently, mRNA
variants are processed pre-mRNA variants and each unique pre-mRNA variant must
always
produce a unique mRNA variant as a result of splicing. These mRNA variants are
also known as
=
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
- 28 -
"alternative splice variants". If no splicing of the pre-mRNA variant occurs
then the pre-mRNA
variant is identical to the mRNA variant.
[00101] It is also known in the art that variants can be produced
through the use of
alternative signals to start or stop transcription and that pre-mRNAs and
mRNAs can possess
more that one start codon or stop codon. Variants that originate from a pre-
mRNA or mRNA
that use alternative start codons are known as "alternative start variants" of
that pre-mRNA or
mRNA. Those transcripts that use an alternative stop codon are known as
"alternative stop
variants" of that pre-mRNA or mRNA. One specific type of alternative stop
variant is the
"polyA variant" in which the multiple transcripts produced result from the
alternative selection of
one of the "polyA stop signals" by the transcription machinery, thereby
producing transcripts that
terminate at unique polyA sites. Within the context of the invention, the
types of variants
described herein are also preferred target nucleic acids.
[00102] The locations on the target nucleic acid to which preferred
compounds and
compositions of the invention hybridize are herein below referred to as
"preferred target
segments." As used herein the term "preferred target segment" is defined as at
least an 8-
nucleobase portion of a target region to which an active antisense oligomeric
compound is
targeted. While not wishing to be bound by theory, it is presently believed
that these target
segments represent portions of the target nucleic acid that are accessible for
hybridization.
[00103] Once one or more target regions, segments or sites have been
identified,
oligomeric compounds are chosen which are sufficiently complementary to the
target, i.e.,
hybridize sufficiently well and with sufficient specificity, to give the
desired effect.
[00104] In accordance with an embodiment of the this invention, a series
of nucleic acid
duplexes comprising the antisense strand oligomeric compounds of the present
invention and
their respective complement sense strand compounds can be designed for a
specific target or
targets. The ends of the strands may be modified by the addition of one or
more natural or
modified nucleobases to form an overhang. The sense strand of the duplex is
designed and
synthesized as the complement of the antisense strand and may also contain
modifications or
additions to either terminus. For example, in one embodiment, both strands of
the duplex would
be complementary over the central nucleobases, each having overhangs at one or
both termini.
[00105] For the purposes of describing an embodiment of this invention,
the combination
of an antisense strand and a sense strand, each of can be of a specified
length, for example from
18 to 29 nucleotides long, is identified as a complementary pair of siRNA
oligomers. This
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
- 29 -
complementary pair of siRNA oligomers can include additional nucleotides on
either of their 5'
or 3' ends. Further they can include other molecules or molecular structures
on their 3' or 5'
ends such as a phosphate group on the 5' end. A preferred group of compounds
of the invention
include a phosphate group on the 5' end of the antisense strand compound.
Other preferred
compounds also include a phosphate group on the 5' end of the sense strand
compound. Even
further preferred compounds would include additional nucleotides such as a two
base overhang
on the 3' end.
[00106] For example, a preferred siRNA complementary pair of oligomers
comprise an
antisense strand oligomeric compound having the sequence CGAGAGGCGGACGGGACCG
(SEQ ID NO:1) and having a two-nucleobase overhang of deoxythymidine(dT) and
its
complement sense strand. These oligomers would have the following structure:
5' c gagaggcggacgggac cgTT 3' Antisense Strand (SEQ ID NO:2)
1 1 1 1 1 1 1 1 1 1 1 1 1 1
1 1 1 1 1
3' TTgctctc cg cct gccctggc
5' Complement Strand (SEQ ID NO:3)
[00107] In an additional embodiment of the invention, a single oligomer
having both the
antisense portion as a first region in the oligomer and the sense portion as a
second region in the
oligomer is selected. The first and second regions are linked together by
either a nucleotide
linker (a string of one or more nucleotides that are linked together in a
sequence) or by a non-
nucleotide linker region or by a combination of both a nucleotide and non-
nucleotide structure.
In each of these structures, the oligomer, when folded back on itself, would
be complementary at
least between the first region, the antisense portion, and the second region,
the sense portion.
Thus the oligomer would have a palindrome within it structure wherein the
first region, the
antisense portion in the 5' to 3' direction, is complementary to the second
region, the sense
portion in the 3' to 5' direction.
[00108] In a further embodiment, the invention includes oligomer/protein
compositions.
Such compositions have both an oligomer component and a protein component. The
oligomer
component comprises at least one oligomer, either the antisense or the sense
oligomer but
preferably the antisense oligomer (the oligomer that is antisense to the
target nucleic acid). The
oligomer component can also comprise both the antisense and the sense strand
oligomers. The
protein component of the composition comprises at least one protein that forms
a portion of the
RNA-induced silencing complex, i.e., the RISC complex.
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
- 30 -
[00109] RISC is a ribonucleoprotein complex that contains an oligomer
component and
proteins of the Argonaute family of proteins, among others. While we do not
wish to be bound
by theory, the Argonaute proteins make up a highly conserved family whose
members have
been implicated in RNA interference and the regulation of related phenomena.
Members of this
family have been shown to possess the canonical PAZ and Piwi domains, thought
to be a region
of protein-protein interaction. Other proteins containing these domains have
been shown to
effect target cleavage, including the RNAse, Dicer. The Argonaute family of
proteins includes,
but depending on species, are not necessary limited to, e1F2C1 and e1F2C2.
e1F2C2 is also
known as human GERp95. While we do not wish to be bound by theory, at least
the antisense
oligomer strand is bound to the protein component of the RISC complex.
Additionally, the
complex might also include the sense strand oligomer. Carmen et al, Genes and
Development
2002, 16, 2733-2742.
[00110] Also, while we do not wish to be bound by theory, it is further
believe that the
RISC complex may interact with one or more of the translation machinery
components.
Translation machinery components include but are not limited to proteins that
effect or aid in the
translation of an RNA into protein including the ribosomes or polyribosome
complex.
Therefore, in a further embodiment of the invention, the oligomer component of
the invention is
associated with a RISC protein component and further associates with the
translation machinery
of a cell. Such interaction with the translation machinery of the cell would
include interaction
with structural and enzymatic proteins of the translation machinery including
but not limited to
the polyribosome and ribosomal subunits.
[00111] In a further embodiment of the invention, the oligomer of the
invention is
associated with cellular factors such as transporters or chaperones. These
cellular factors can be
protein, lipid or carbohydrate based and can have structural or enzymatic
functions that may or
may not require the complexation of one or more metal ions.
[00112] Furthermore, the oligomer of the invention itself may have one or
more moieties
which are bound to the oligomer which facilitate the active or passive
transport, localization or
compartmentalization of the oligomer. Cellular localization includes, but is
not limited to,
localization to within the nucleus, the nucleolus or the cytoplasm.
Compartmentalization
includes, but is not limited to, any directed movement of the oligomers of the
invention to a
cellular compat fluent including the nucleus, nucleolus, mitochondrion, or
imbedding into a
cellular membrane surrounding a compartment or the cell itself.
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
- 31 -
[00113] In a further embodiment of the invention, the oligomer of the
invention is
associated with cellular factors that affect gene expression, more
specifically those involved in
RNA modifications. These modifications include, but are not limited to
posttrascriptional
modifications such as methylation. Furthermore, the oligomer of the invention
itself may have
one or more moieties which are bound to the oligomer which facilitate the
posttranscriptional
modification.
[00114] The oligomeric compounds of the invention may be used in the form
of single-
stranded, double-stranded, circular or hairpin oligomeric compounds and may
contain structural
elements such as internal or terminal bulges or loops. Once introduced to a
system, the
oligomeric compounds of the invention may interact with or elicit the action
of one or more
enzymes or may interact with one or more structural proteins to effect
modification of the target
nucleic acid.
[00115] One non-limiting example of such an interaction is the RISC
complex. Use of the
RISC complex to effect cleavage of RNA targets thereby greatly enhances the
efficiency of
oligomer-mediated inhibition of gene expression. Similar roles have been
postulated for other
ribonucleases such as those in the RNase III and ribonuclease L family of
enzymes.
[00116] Preferred forms of oligomeric compound of the invention include a
single-
stranded antisense oligomer that binds in a RISC complex, a double stranded
antisense/sense pair
of oligomer or a single strand oligomer that includes both an antisense
portion and a sense
portion. Each of these compounds or compositions is used to induce potent and
specific
modulation of gene function. Such specific modulation of gene function has
been shown in
many species by the introduction of double-stranded structures, such as double-
stranded RNA
(dsRNA) molecules and has been shown to induce potent and specific antisense-
mediated
reduction of the function of a gene or its associated gene products. This
phenomenon occurs in
both plants and animals and is believed to have an evolutionary connection to
viral defense and
transposon silencing.
[00117] The compounds and compositions of the invention are used to
modulate the
expression of a target nucleic acid. "Modulators" are those oligomeric
compounds that decrease
or increase the expression of a nucleic acid molecule encoding a target and
which comprise at
least an 8-nucleobase portion that is complementary to a preferred target
segment. The screening
method comprises the steps of contacting a preferred target segment of a
nucleic acid molecule
encoding a target with one or more candidate modulators, and selecting for one
or more
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
- 32 -
candidate modulators which decrease or increase the expression of a nucleic
acid molecule
encoding a target. Once it is shown that the candidate modulator or modulators
are capable of
modulating (e.g. either decreasing or increasing) the expression of a nucleic
acid molecule
encoding a target, the modulator may then be employed in further investigative
studies of the
function of a target, or for use as a research, diagnostic, or therapeutic
agent in accordance with
the present invention.
Oligomeric Compounds
[00118] In the context of the present invention, the term "oligomeric
compound" refers to
a polymeric structure capable of hybridizing a region of a nucleic acid
molecule. This term
includes oligonucleotides, oligonucleosides, oligonucleotide analogs,
oligonucleotide mimetics
and combinations of these. Oligomeric compounds are routinely prepared
linearly but can be
joined or otherwise prepared to be circular, and may also include branching.
Oligomeric
compounds can hybridized to form double stranded compounds that can be blunt
ended or may
include overhangs. In general an oligomeric compound comprises a backbone of
linked
monomeric subunits where each linked monomeric subunit is directly or
indirectly attached to a
heterocyclic base moiety. The linkages joining the monomeric subunits, the
sugar moieties or
surrogates and the heterocyclic base moieties can be independently modified
giving rise to a
plurality of motifs for the resulting oligomeric compounds including hemimers,
gapmers and
chimeras.
[00119] As is known in the art, a nucleoside is a base-sugar combination.
The base
portion of the nucleoside is normally a heterocyclic base moiety. The two most
common classes
of such heterocyclic bases are purines and pyrimidines. Nucleotides are
nucleosides that further
include a phosphate group covalently linked to the sugar portion of the
nucleoside. For those
nucleosides that include a pentofuranosyl sugar, the phosphate group can be
linked to either the
2', 3' or 5' hydroxyl moiety of the sugar. In forming oligomers, the phosphate
groups covalently
link adjacent nucleosides to one another to form a linear polymeric compound.
The respective
ends of this linear polymeric structure can be joined to form a circular
structure by hybridization
or by formation of a covalent bond, however, open linear structures are
generally preferred.
Within the oligomer structure, the phosphate groups are commonly referred to
as forming the
internucleoside linkages of the oligomer. The normal intemucleoside linkage of
RNA and DNA
is a 3' to 5' phosphodiester linkage.
CA 02504720 2011-09-28
77684-23
- 33 -
[00120] In the context of this invention, the term "oligonucleotide"
refers to an oligomer
or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA). This term
includes
oligonucleotides composed of naturally-occurring nucleobases, sugars and
covalent
internucleoside linkages. The term "oligonucleotide analog" refers to
oligonucleotides that have
one or more non-naturally occurring portions which function in a similar
manner to
oligonulceotides. Such non-naturally occurring oligonucleotides are often
preferred over the
naturally occurring forms because of desirable properties such as, for
example, enhanced cellular
uptake, enhanced affinity for nucleic acid target and increased stability in
the presence of
nucleases.
[00121] In the context of this invention, the term" oligonucleoside"
refers to nucleosides
that are joined by intemucleoside linkages that do not have phosphorus atoms.
Intemucleoside
linkages of this type include short chain alkyl, cycloalkyl, mixed hetero atom
alkyl, mixed
heteroatom cycloallcyl, one or more short chain heteroatomic and one or more
short chain
heterocyclic. These intemucleoside linkages include but are not limited to
siloxane, sulfide,
sulfoxide, sulfone, acetal, formacetal, thioformacetal, methylene formacetal,
thioformacetal,
alkeneyl, sulfamate; methyleneimino, methylenehydrazino, sulfonate,
sulfonamide, amide and
others having mixed N, 0, S and CH2 component parts.
[00122] In addition to the modifications described above, the nucleosides
of the
oligomeric compounds of the invention can have a variety of other
modifications so long as these
other modifications either alone or in combination with other nucleosides
enhance one or more
of the desired properties described above. Thus, for nucleotides that are
incorporated into
oligomers of the invention, these nucleotides can have sugar portions that
correspond to
naturally-occurring sugars or modified sugars. Representative modified sugars
include
carbocyclic or acyclic sugars, sugars having substituent groups at one or more
of their 2', 3' or 4'
positions and sugars having substituents in place of one or more hydrogen
atoms of the sugar.
Additional nucleosides amenable to the present invention having altered base
moieties and or
altered sugar moieties are disclosed in United States Patent 3,687,808 and PCT
application
WO/1989/012060.
[001231 Altered base moieties or altered sugar moieties also include
other modifications
consistent with the spirit of this invention. Such oligomers are best
described as being
structurally distinguishable from, yet functionally interchangeable with,
naturally occurring or
synthetic wild type oligonucleotides. All such oligomers are comprehended by
this invention so
CA 02504720 2013-10-02
- 34 -
long as they function effectively to mimic the structure of a desired RNA or
DNA Strand. A class
of representative base modifications include tricyclic cytosine analog, tenned
"G clamp" (Lin, et
aL, I. Am. Chem. Soc. 1998, 120, 8531). This analog makes four hydrogen bonds
to a
complementary guanine (G) within a helix by simultaneously recognizing the
Watson-Crick and
Hoogsteen faces of the targeted G. This G clamp modification when incorporated
into
phosphorothioate oligomers, dramatically enhances antisense potencies in cell
culture. The
oh-garners of the invention also can include phenoxazine-substituted bases of
the type disclosed
by Flanagan, et aL, Nat. BiotechnoL 1999, 17(1), 48-52.
00124.1 The oligomeric compounds in accordance with this invention
preferably comprise
fe=
from about S to about 80 nucleobase,s (i.e. from about 8 to about 80 linked
nucleosides). One of
-,1-
ordinary skill in the art will appreciate that the invention embodies
oligomeric compounds of 8,
9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28,
29, 30, 31, 32, 33, 34,
35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46,47, 48, 49, 50, 51, 52, 53, 54,
55, 56, 57, 58, 59, 60,
61, 62, 63, 64, 65, 66, 67, 68, 69,70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or
80 nucleobases in
length.
(00125J In one preferred embodiment, the oligomeric compounds of the
invention are 12
to 50 nucleobases in length. One having ordinary skill in the art will
appreciate that this
embodies oligomeric compounds of 12, 13, 14, 15, 16, 17, 18, 19, 20,21, 22,
23, 24, 25, 26, 27,
28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44,45, 46, 47,
48, 49, or 50
nucleobases in length.
[001261 In another preferred embodiment, the oligomeric compounds of
the invention are
15 to 30 nudeobases in length. One having ordinary skill in the art will
appreciate that this
embodies oligomeric compounds of 15, 16, 17, 18, 19, 20, 21,22, 23, 24, 25,
26, 27, 28, 29, or
30 nucleobases in length.
(001271 Particularly preferred oligomeric compounds are oligorners
from about 15 to
about 30 nucleobases, even more preferably those comprising from about 21 to
about 24
nucleobases. Yet other preferred embodiments comprise 19 to 23 nucleobases. .
General Oligomer Synthesis.
f00128] Oligornerization of modified and unmodified nucleosides is
performed according
to literature procedures for DNA-like compounds (Protocols for
Oligonucleotides and Analogs,
Ed. Agrawal (1993), Humana Press) and/or RNA like compounds (Scaringe, Methods
(2001),
=
CA 02504720 2011-09-28
77684-23
- 35 -
23, 206-217. Gait et al., Applications of Chemically synthesized RNA in
RNA:Protein
. Interactions, Ed. Smith (1998), 1-36. Gallo et al., Tetrahedron (2001),
57, 5707-5713) synthesis
as appropriate. In addition specific protocols for the synthesis of oligomeric
compounds of the
invention are illustrated in the examples below.
1001291 RNA oligomers can be synthesized by methods disclosed herein or
purchased
from various RNA synthesis companies such as for example Dharmacon Research
Inc.,
(Lafayette, CO).
[00130] Irrespective of the particular protocol used, the oligomeric
compounds used in
accordance with this invention may be conveniently and routinely made through
the well-known
technique of solid phase synthesis. Equipment for such synthesis is sold by
several vendors
including, for example, Applied Biosystems (Foster City, CA). Any other means
for such
synthesis known in the art may additionally or alternatively be employed.
[00131] For double stranded structures of the invention, once
synthesized, the
complementary strands preferably are annealed. The single strands are
aliquoted and diluted to a
concentration of 50 uM. Once diluted, 30 tL of each strand is combined with
15uL of a 5X
solution of annealing buffer. The final concentration of the buffer is 100 mM
potassium acetate,
30 mM HEPES-KOH pH 7.4, and 2mIVI magnesium acetate. The final volume is 75
uL. This
solution is incubated for 1 minute at 90 C and then centrifuged for 15
seconds. The tube is
allowed to sit for 1 hour at 37 C at which time the dsRNA duplexes are used in
experimentation.
The final concentration of the dsRNA compound is 20 uM. This solution can be
stored frozen (-
20 C) and freeze-thawed up to 5 times.
[00132] Once prepared, the desired synthetic duplexes are evaluated for
their ability to
modulate target expression. When cells reach 80% confluency, they are treated
with synthetic
duplexes comprising at least one oligomeric compound of the invention. For
cells grown in 96-
well plates, wells are washed once with 200 i.tf, OPTI-MEM*-1 reduced-serum
medium (Gibco
BRL) and then treated with 130 pL of OPTI-MEM-1 containing 12 g/mL
LIPOFECT1N* (Gibco
BRL) and the desired dsRNA compound at a final concentration of 200 nM. After
5 hours of
treatment, the medium is replaced with fresh medium. Cells are harvested 16
hours after
treatment, at which time RNA is isolated and target reduction measured by RT-
PCR.
Oligomer and Monomer Modifications
=
*Trade -mark
CA 02504720 2005-05-02
WO 2004/044138
PCT/US2003/035074
- 36 -
[00133] As is known in the art, a nucleoside is a base-sugar combination.
The base
portion of the nucleoside is normally a heterocyclic base. The two most common
classes of such
heterocyclic bases are the purines and the pyrimidines. Nucleotides are
nucleosides that further
include a phosphate group covalently linked to the sugar portion of the
nucleoside. For those
nucleosides that include a pentofuranosyl sugar, the phosphate group can be
linked to either the
2', 3' or 5' hydroxyl moiety of the sugar. In forming oligomers, the phosphate
groups covalently
link adjacent nucleosides to one another to form a linear polymeric compound.
In turn, the
respective ends of this linear polymeric compound can be further joined to
form a circular
compound, however, linear compounds are generally preferred. In addition,
linear compounds
may have internal nucleobase complementarity and may therefore fold in a
manner as to produce
a fully or partially double-stranded compound. Within oligomers, the phosphate
groups are
commonly referred to as forming the internucleoside linkage or in conjunction
with the sugar
ring the backbone of the oligomer. The normal internucleoside linkage that
makes up the
backbone of RNA and DNA is a 3' to 5' phosphodiester linkage.
Modified Internucleoside Linkages
[00134] Specific examples of preferred antisense oligomeric compounds
useful in this
invention include oligomers containing modified e.g. non-naturally occurring
internucleoside
linkages. As defined in this specification, oligomers having modified
internucleoside linkages
include internucleoside linkages that retain a phosphorus atom and
internucleoside linkages that
do not have a phosphorus atom. For the purposes of this specification, and as
sometimes
referenced in the art, modified oligomers that do not have a phosphorus atom
in their
internucleoside backbone can also be considered to be oligonucleosides.
[00135] In the C. elegans system, modification of the internucleotide
linkage
(phosphorothioate) did not significantly interfere with RNAi activity. Based
on this observation,
it is suggested that certain preferred oligomeric compounds of the invention
can also have one or
more modified internucleoside linkages. A preferred phosphorus containing
modified
internucleoside linkage is the phosphorothioate internucleoside linkage.
[00136]
Preferred modified oligomer backbones containing a phosphorus atom therein
include, for example, phosphorothioates, chiral phosphorothioates,
phosphorodithioates,
phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl
phosphonates including 3'-
alkylene phosphonates, 5'-alkylene phosphonates and chiral phosphonates,
phosphinates,
CA 02504720 2011-09-28
= 77684-23
- 37 -
phosphoramidates including 3'-amino phosphoramidate and
aminoallcylphosphorarnidates,
thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters,
selenophosphates and boranophosphates having normal 3'-5' linkages, 2'-5'
linked analogs of
these, arid those having inverted polarity wherein one or more intemucleotide
linkages is a 3' to
3', 5' to 5' or 2' to 2' linkage. Preferred oligomers having inverted polarity
comprise a single 3' to
3' linkage at the 3'-most intemucleotide linkage i.e. a single inverted
nucleoside residue which
may be abasic (the nucleobase is missing or has a hydroxyl group in place
thereof). Various
salts, mixed salts and free acid forms are also included.
[00137] Representative United States patents that teach the
preparation of the above
phosphorus-containing linkages include, but are not limited to, U.S.:
3,687,808; 4,469,863;
4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302;
5,286,717;
5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925;
5,519,126;
5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,194,599;
5,565,555;
5.527.899; 5,721,218; 5,672,697 and 5,625,050.
[00138] In more preferred embodiments of the invention,
oligomeric compounds have one
or more phosphorothioate and/or heteroatom intemucleoside linkages, in
particular -CH2-NH-0-
CH2-, -CH2-N(CH3)-0-CH2- [known as a methylene (methylimino) or MMI backbone],
-CH2-0-
N(CH3)-CH2-, -C112-N(CH3)-N(CH3)-CH2- and -0-N(CH3)-CH2-CH2- [wherein the
native
phosphodiester intemucleotide linkage is represented as -0-P(=0)(OH)-0-CH2-].
The MNII
type internucleoside linkages are disclosed in the above referenced U.S.
patent 5,489,677.
Prefen-ed amide intemucleoside linkages are disclosed in the above referenced
U.S. patent
5,602,240.
[00139] Preferred modified oligomer backbones that do not include
a phosphorus atom
therein have backbones that are formed by short chain alkyl or cycloallcyl
intemucleoside
linkages, mixed heteroatom and alkyl or cycloalkyl intemucleoside linkages, or
one or more
short chain heteroatomic or heterocyclic intemucleoside linkages. These
include those having
morpholino linkages (formed in part from the sugar portion of a nucleoside);
siloxane
backbones; sulfide, sulfoxide and sulfone backbones; fomiacetal and
thioformacetal backbones;
methylene formacetal and thioformacetal backbones; riboacetal backbones;
alkene containing
backbones; sulfamate backbones; methyleneimino and methylenehydrazino
backbones; sulfonate
CA 02504720 2011-09-28
77684-23
- 38 -
and sulfonamide backbones; amide backbones; and others having mixed N, 0, S
and CH2
component parts.
1001401 Representative United States patents that teach the
preparation of the above
oligonucleosides include, but are not limited to, U.S.: 5,034,506; 5,166,315;
5,185,444;
5,214,134; 5,216,141; 5,235,033; 5.264,562; 5,264,564; 5,405,938; 5,434,257;
5,466,677;
5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,610,289;
5,602,240;
5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437;
5,792,608;
5,646,269 and 5,677,439.
Oligon2er Alimetics
[00141] Another preferred group of oligomeric compounds amenable to
the present
invention includes oligonucleotide mirnetics. The term mimetic as it is
applied to
oligonucleotides is intended to include oligomeric compounds wherein only the
furanose ring or
both the furanose ring and the internucleotide linkage are replaced with novel
groups,
replacement of only the furanose ring is also referred to in the art as being
a sugar surrogate. The
heterocyclic base moiety or a modified heterocyclic base moiety is maintained
for hybridization
with an appropriate target nucleic acid. One such oligomeric compound, an
oligonucleotide
mimetic that has been shown to have excellent hybridization properties, is
referred to as a
peptide nucleic acid (PNA). In PNA oligomeric compounds, the sugar-backbone of
an
oligonucleotide is replaced with an amide containing backbone, in particular
an
aminoethylglycine backbone. The nucleobases are retained and are bound
directly or indirectly
to aza nitrogen atoms of the amide portion of the backbone. Representative
United States patents
that teach the preparation of PNA oligomeric compounds include, but are not
limited to, U.S.:
5,539, 082; 5,714, 331; and 5,719, 262. Further teaching of PNA oligomeric
compounds
. =
can be found in Nielsen etal., Science, 1991, 254, 1497-1500.
[00142] One oligonucleotide mimetic that has been reported to have
excellent
hybridization properties is peptide nucleic acids (PNA). The backbone in PNA
compounds is
two or more linked aminoethylglycine units which gives PNA an amide containing
backbone.
The heterocyclic base moieties are bound directly or indirectly to aza
nitrogen atoms of the
amide portion of the backbone. Representative United States patents that teach
the preparation- =
CA 02504720 2005-05-02
WO 2004/044138
PCT/US2003/035074
- 39 -
of PNA compounds include, but are not limited to, U.S.: 5,539,082; 5,714,331;
and 5,719,262,
each of which is herein incorporated by reference. Further teaching of PNA
compounds can be
found in Nielsen et al., Science, 1991, 254, 1497-1500.
[00143] PNA
has been modified to incorporate numerous modifications since the basic
PNA structure was first prepared. The basic structure is shown below:
Bx Bx
0 c0 0
NN
T5
H¨ n
wherein
Bx is a heterocyclic base moiety;
T4 is hydrogen, an amino protecting group, -C(0)R5, substituted or
unsubstituted C1-C10
alkyl, substituted or unsubstituted C2-Cio alkenyl, substituted or
unsubstituted C2-C10 alkynyl,
alkylsulfonyl, arylsulfonyl, a chemical functional group, a reporter group, a
conjugate group, a D
or L a-amino acid linked via the a-carboxyl group or optionally through the a-
carboxyl group
when the amino acid is aspartic acid or glutamic acid or a peptide derived
from D, L or mixed D
and L amino acids linked through a carboxyl group, wherein the sub stituent
groups are selected
from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol,
thioalkoxy, halogen, alkyl,
aryl, alkenyl and alkynyl;
T5 is -OH, -N(Z1)Z2, R5, D or L a-amino acid linked via the a-amino group or
optionally
through the co-amino group when the amino acid is lysine or omithine or a
peptide derived from
D, L or mixed D and L amino acids linked through an amino group, a chemical
functional group,
a reporter group or a conjugate group;
Z1 is hydrogen, C1-C6 alkyl, or an amino protecting group;
Z2 is hydrogen, C1-C6 alkyl, an amino protecting group, -C(=0)-(CH2)n-J-Z3, a
D or L a-
amino acid linked via the a-carboxyl group or optionally through the w-
carboxyl group when the
amino acid is aspartic acid or glutamic acid or a peptide derived from D, L or
mixed D and L
amino acids linked through a carboxyl group;
Z3 is hydrogen, an amino protecting group, -C1-C6 alkyl, -C(=0)-CH3, benzyl,
benzoyl, or
-(CHOn-N(H)Zi;
each J is 0, S or NH;
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
- 40 -
R5 is a carbonyl protecting group; and
n is from 2 to about 50.
[00144] Another class of oligonucleotide mimetic that has been studied is
based on linked
morpholino units (morpholino nucleic acid) havingheterocyclic bases attached
to the
morpholino ring. A number of linking groups have been reported that link the
morpholino
monomeric units in a morpholino nucleic acid. A preferred class of linking
groups have been
selected to give a non-ionic oligomeric compound. The non-ionic morpholino-
based oligomeric
compounds are less likely to have undesired interactions with cellular
proteins. Morpholino-
based oligomeric compounds are non-ionic mimics of oligonucleotides which are
less likely to
form undesired interactions with cellular proteins (Dwaine A. Braasch and
David R. Corey,
Biochemistry, 2002, 41(14), 4503-4510). Morpholino-based oligomeric compounds
are
disclosed in United States Patent 5,034,506, issued July 23, 1991. The
morpholino class of
oligomeric compounds have been prepared having a variety of different linking
groups joining
the monomeric subunits.
[00145] Morpholino nucleic acids have been prepared having a variety of
different linking
groups (L2) joining the monomeric subunits. The basic formula is shown below:
T1 _______________________________ \(:)IBx
1-12 ________________________________________ nn(Bx
T5
wherein
T1 is hydroxyl or a protected hydroxyl;
T5 is hydrogen or a phosphate or phosphate derivative;
L2 is a linking group; and
n is from 2 to about 50.
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
-41 -
[00146] A further class of oligonucleotide mimetic is referred to as
cyclohexenyl nucleic
acids (CeNA). The furanose ring normally present in an DNA/RNA molecule is
replaced with a
cyclohenyl ring. CeNA DMT protected phosphoramidite monomers have been
prepared and
used for oligomeric compound synthesis following classical phosphoramidite
chemistry. Fully
modified CeNA oligomeric compounds and oligomers having specific positions
modified with
CeNA have been prepared and studied (see Wang et al., J. Am. Chem. Soc., 2000,
122, 8595-
8602). In general the incorporation of CeNA monomers into a DNA chain
increases its stability
of a DNA/RNA hybrid. CeNA oligoadenylates formed complexes with RNA and DNA
complements with similar stability to the native complexes. The study of
incorporating CeNA
structures into natural nucleic acid structures was shown by NMR and circular
dichroism to
proceed with easy conformational adaptation. Furthermore the incorporation of
CeNA into a
sequence targeting RNA was stable to serum and able to activate E. Coli RNase
resulting in
cleavage of the target RNA strand.
[00147] The general formula of CeNA is shown below:
Bx Bx
=
Ti =
11)T2
wherein
each Bx is a heterocyclic base moiety;
T1 is hydroxyl or a protected hydroxyl; and
T2 is hydroxyl or a protected hydroxyl.
[00148] Another class of oligonucleotide mimetic (anhydrohexitol nucleic
acid) can be,
prepared from one or more anhydrohexitol nucleosides (see, Wouters and
Herdewijn, Bioorg.
Med. Chem. Lett., 1999, 9, 1563-1566) and would have the general formula:
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
-42 -
Bx
Ti
____________________________________________________ 0
T2
[00149] A further preferred modification includes Locked Nucleic Acids
(LNAs) in which
the 2'-hydroxyl group is linked to the 4' carbon atom of the sugar ring
thereby forming a 2'-C,4'-
C-oxymethylene linkage thereby forming a bicyclic sugar moiety. The linkage is
preferably a
methylene (-CH2-). group bridging the 2' oxygen atom and the 4' carbon atom
wherein n is 1 or 2
(Singh et al., Chem. Commun., 1998, 4, 455-456). LNA and LNA analogs display
very high
duplex thermal stabilities with complementary DNA and RNA (Tm = +3 to +10 C),
stability
towards 3'-exonucleolytic degradation and good solubility properties. The
basic structure of
LNA showing the bicyclic ring system is shown below:
T1-0 = Bx
\O
Z1 = Bx
Z2 0
[00150] The conformations of LNAs determined by 2D NMR spectroscopy have
shown
that the locked orientation of the LNA nucleotides, both in single-stranded
LNA and in duplexes,
constrains the phosphate backbone in such a way as to introduce a higher
population of the N-
type conformation (Petersen et al., J. Mol. Recognit., 2000, 13, 44-53). These
conformations are
associated with improved stacking of the nucleobases (Wengel et al.,
Nucleosides Nucleotides,
1999, 18, 1365-1370).
[00151] LNA has been shown to form exceedingly stable LNA:LNA duplexes
(Koshkin et
al., J. Am. Chem. Soc., 1998, 120,13252-13253). LNA:LNA hybridization was
shown to be the -
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
-43 -
most thermally stable nucleic acid type duplex system, and the RNA-mimicking
character of
LNA was established at the duplex level. Introduction of 3 LNA monomers (T or
A)
significantly increased melting points (Tm = +15/+11) toward DNA complements.
The
universality of LNA-mediated hybridization has been stressed by the formation
of exceedingly
stable LNA:LNA duplexes. The RNA-mimicking of LNA was reflected with regard to
the N-
type conformational restriction of the monomers and to the secondary structure
of the LNA:RNA
duplex.
[00152] LNAs also form duplexes with complementary DNA, RNA or LNA with
high
thermal affinities. Circular dichroism (CD) spectra show that duplexes
involving fully modified
LNA (esp. LNA:RNA) structurally resemble an A-form RNA:RNA duplex. Nuclear
magnetic
resonance (NMR) examination of an LNA:DNA duplex confirmed the 3'-endo
conformation of
an LNA monomer. Recognition of double-stranded DNA has also been demonstrated
suggesting
strand invasion by LNA. Studies of mismatched sequences show that LNAs obey
the Watson-
Crick base pairing rules with generally improved selectivity compared to the
corresponding
unmodified reference strands.
[00153] Novel types of LNA-oligomeric compounds, as well as the LNAs, are
useful in a
wide range of diagnostic and therapeutic applications. Among these are
antisense applications,
PCR applications, strand-displacement oligomers, substrates for nucleic acid
polymerases and
generally as nucleotide based drugs.
[00154] Potent and nontoxic antisense oligomers containing LNAs have been
described
(Wahlestedt et al., Proc. Natl. Acad. Sci. U. S. A., 2000, 97, 5633-5638.) The
authors have
demonstrated that LNAs confer several desired properties to antisense agents.
LNA/DNA
copolymers were not degraded readily in blood serum and cell extracts. LNA/DNA
copolymers
exhibited potent antisense activity in assay systems as disparate as G-protein-
coupled receptor
signaling in living rat brain and detection of reporter genes in Escherichia
coli. Lipofectin-
mediated efficient delivery of LNA into living human breast cancer cells has
also been
accomplished.
[00155] The synthesis and preparation of the LNA monomers adenine,
cytosine, guanine,
5-methyl-cytosine, thymine and uracil, along with their oligomerization, and
nucleic acid
recognition properties have been described (Koshkin et al., Tetrahedron, 1998,
54, 3607-3630).
LNAs and preparation thereof are also described in WO 98/39352 and WO
99/14226.
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
- 44 -
[00156] The first analogs of LNA, phosphorothioate-LNA and 2'-thio-LNAs,
have also
been prepared (Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222).
Preparation of
locked nucleoside analogs containing oligodeoxyribonucleotide duplexes as
substrates for
nucleic acid polymerases has also been described (Wengel et al., PCT
International Application
WO 98-DK393 19980914). Furthermore, synthesis of 2'-amino-LNA, a novel
conformationally
restricted high-affinity oligonucleotide analog with a handle has been
described in the art (Singh
et al., J. Org. Chem., 1998, 63, 10035-10039). In addition, 2'-Amino- and 2'-
methylamino-
LNA's have been prepared and the thermal stability of their duplexes with
complementary RNA
and DNA strands has been previously reported.
[00157] Further oligonucleotide mimetics have been prepared to include
bicyclic and
tricyclic nucleoside analogs having the formulas (amidite monomers shown):
0 0
\)( \A
DMTO NH DMTO I 111
!
,C)0# ,ab,* N S
-
0\ 0\
0
NC,....õ.....----... ...P.-N-01,02 NC....õ....õ---
..... ,...-P---Nopo2
0
(see Steffens et al., Helv. Chim. Acta, 1997, 80, 2426-2439; Steffens et al.,
J. Am. Chem. Soc.,
1999, 121, 3249-3255; and Renneberg et al., J Am. Chem. Soc., 2002, 124, 5993-
6002). These
modified nucleoside analogs have been oligomerized using the phosphoramidite
approach and
the resulting oligomeric compounds containing tricyclic nucleoside analogs
have shown
increased thermal stabilities (Tm's) when hybridized to DNA, RNA and itself.
Oligomeric
compounds containing bicyclic nucleoside analogs have shown thermal
stabilities approaching
that of DNA duplexes.
[00158] Another class of oligonucleotide mimetic is referred to as
phosphonomonoester
nucleic acids incorporate a phosphorus group in a backbone the backbone. This
class of
oligonucleotide mimetic is reported to have useful physical and biological and
pharmacological
properties in the areas of inhibiting gene expression (antisense
oligonucleotides, ribozymes,
sense oligonucleotides and triplex-forming oligonucleotides), as probes for
the detection of
nucleic acids and as auxiliaries for use in molecular biology.
CA 02504720 2011-09-28
77684-23
- 45 -
[00159] The general formula (for definitions of variables see: United
States Patents
5,874,553 and 6,127,346) is shown below.
Z A Z A
I R5 I I R, I
D.-G. X.-
X II D X II 0'
R6 R6 n
1001601 Another oligonucleotide mimetic has been reported wherein the
furanosyl ring has
been replaced by a cyclobutyl moiety.
Modified sugars
1001611 Oligomeric compounds of the invention may also contain one or
more substituted
sugar moieties. Preferred oligomeric compounds comprise a sugar substituent
group selected
from: OH; F; 0-, S-, or N-alkyl; 0-, S-, or N-alkenyl; 0-, S- or N-alkynyl; or
0-alkyl-0-alkyl,
wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted CI
to C10 alkyl or C2
to C10 alk-enyl and allcynyl. Particularly preferred are ORCH2)nO1mCH3,
0(CH2)OCH3,
0(CH2).NH2, 0(CH2)nCH3, 0(CH2)IONH2, and 0(CH2)ONRCH2),CH3i2, where n and in
are
from 1 to about 10. Other preferred oligomers comprise a sugar substituent
group selected from:
C1 to C10 lower alkyl, substituted lower alkyl, allcenyl, allcynyl, alkaryl,
arallcyl, 0-alkaryl or 0-
aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, 0NO2, NO2, N3,
NI-12,
heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino,
substituted silyl, an
RNA cleaving group, a reporter group, an intercalator, a group for improving
the
pharmacokinetic properties of an oligomer, or a group for improving the
phamiacodynamic
properties of an oligomer, and other substituents having similar properties. A
preferred
modification includes T-methoxyethoxy (2'-0-CH2CH2OCH3, also known as 2'-0-(2-
= methoxyethyl) or T-M0E) (Martin et al., Hely. Chim. Acta, 1995, 78, 486-
504) i.e., an
alkoxyallcoxy group. A further preferred modification includes 2'-
dimethylaminooxyethoxy, i.e.,
a 0(CH2)20N(CH3)2 group, also known as 2'-DMA0E, as described in examples
herein below,
and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-0-dimethyl-amino-
ethoxy-ethyl
or 2'-DMAEOE), i.e., 2'-0-CH2-0-CH2-N(CH3)2.
[001621 Other preferred sugar substituent groups include methoxy (-0-
CH3),
aminopropoxy (-0CH2CH2CH2NH2), ally' -0-ally1(-0-CH2-CHH2) and
CA 02504720 2011-09-28
77684-23
- 46 -
fluoro (F). 2'-Sugar substituent groups may be in the arabino (up) position or
ribo (down)
position. A preferred 2'-arabino modification is 2'-F. Similar modifications
may also be made at
other positions on the oligomeric compound, particularly the 3' position of
the sugar on the 3'
terminal nucleoside or in 2'-5' linked oligomers and the 5' position of 5'
terminal nucleotide.
Oligomeric compounds may also have sugar mimetics such as cyclobutyl moieties
in place of the
pentofuranosyl sugar. Representative United States patents that teach the
preparation of such
modified sugar structures include, but are not limited to, U.S.: 4,981,957;
5,118,800; 5,319,080;
5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811;
5,576,427;
5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873;
5,670,633;
5,792,747; and 5,700,920.
1001631 Further representative sugar substituent groups include groups of
formula I. or lia:
Rh {(C 0N-(11k) me
__________________________________________________________ R-)
112)ma (CH2).d¨Rd-Re I Rh
mb R;
mc
Ia ila
wherein:
Rb is 0, S or NH;
Rd is a single bond, 0, S or
Re is C1-C10 alkyl, N(RO(Rrn), l`(Rk)(1(n), N=C(Rp)(111), N=CatlYR) or has
formula Ma;
/3\I¨Rt
`-\
Rs ljT¨Ru
Rv
Dia
Rp and Rq are each independently hydrogen or C1-C10 alkyl;
R, is -Rx-Ry;
each Rs, Rt, R. and R., is, independently, hydrogen, C(0)Rõ substituted or
unsubstituted
C1-C10 alkyl, substituted or unsubstituted C2-C10 alkenyl, substituted or
unsubstituted C2-C10
alkynyl, allcylsulfonyl, arylsulfonyl, a chemical functional group or a
conjugate group, wherein
the substituent groups are selected from hydroxyl, amino, alkoxy, carboxy,
benzyl, phenyl, nitro,
thiol, thioalkoxy, halogen, alkyl, aryl, allcenyl and alkynyl;
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
- 47 -
or optionally, Ru and Rv, together form a phthalimido moiety with the nitrogen
atom to
which they are attached;
each Rõ, is, independently, substituted or unsubstituted C1-C10 alkyl,
trifluoromethyl,
cyanoethyloxy, methoxy, ethoxy, t-butoxy, allyloxy, 9-fluorenyhnethoxy, 2-
(trimethylsily1)-
ethoxy, 2,2,2-trichloroethoxy, benzyloxy, butyryl, iso-butyryl, phenyl or
aryl;
Rk is hydrogen, a nitrogen protecting group or -R-R;
Rp is hydrogen, a nitrogen protecting group or -R-R;
R. is a bond or a linking moiety;
Ry is a chemical functional group, a conjugate group or a solid support
medium;
each Rin and Rn is, independently, H, a nitrogen protecting group, substituted
or
unsubstituted Ci-C10 alkyl, substituted or unsubstituted C2-C10 alkenyl,
substituted or
unsubstituted C2-C10 alkynyl, wherein the sub stituent groups are selected
from hydroxyl, amino,
alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl,
aryl, alkenyl, alkynyl;
NH3, N(Ru)(12,), guanidino and acyl where said acyl is an acid amide or an
ester;
or Rin and Rn, together, are a nitrogen protecting group, are joined in a ring
structure that
optionally includes an additional heteroatom selected from N and 0 or are a
chemical functional
group;
Ri is ORE, SRI, or N(R)2;
each Rz is, independently, H, C1-C8 alkyl, Ci-C8 haloalkyl, C(NH)N(H)R,
C(-0)N(H)R or OC(---0)N(H)Ru;
Rf, Rg and Rh comprise a ring system having from about 4 to about 7 carbon
atoms or
having from about 3 to about 6 carbon atoms and 1 or 2 hetero atoms wherein
said heteroatoms
are selected from oxygen, nitrogen and sulfur and wherein said ring system is
aliphatic,
unsaturated aliphatic, aromatic, or saturated or unsaturated heterocyclic;
Rj is alkyl or haloalkyl having 1 to about 10 carbon atoms, alkenyl having 2
to about 10
carbon atoms, alkynyl having 2 to about 10 carbon atoms, aryl having 6 to
about 14 carbon
atoms, N(Rk)(Rrn) ORk, halo, SRk or CN;
ma is 1 to about 10;
each mb is, independently, 0 or 1;
mc is 0 or an integer froml to 10;
md is an integer from 1 to 10;
me is from 0, 1 or 2; and
CA 02504720 2011-09-28
=
77684-23
- 48 -
provided that when mc is 0, md is greater than 1.
[00164] Representative substituent groups of Formula I are disclosed
in United States
Patent No. 6,127,209, filed August 7,1998, entitled "Capped T-Oxyethoxy
Oligonucleotides".
[00165] Representative cyclic substituent groups of Formula II are
disclosed in United
States Patent No. 6,271,358, filed July 27,1998, entitled "RNA Targeted 2'-
Oligomeric
compounds that are Conformationally Preorganized".
[00166] Particularly preferred sugar substituent groups include
ORCH2),,OLCH3,
0(CH2)nOCH3, 0(CH2)õNH2, 0(CH2).CH3, 0(CH2)ONH2, and 0(CH2),ONRCH2)CH3)12,
where n and m are from 1 to about 10.
[00167] Representative guanidino substituent groups that are shown in
formula HI and IV
are disclosed in co-owned United States Patent No. 6,593,466, entitled
"Functionalized
Oligomers", filed July 7,1999.
[00168] Representative acetarnido substituent groups are disclosed in
United States Patent
6,147, 200.
[00169] Representative dimethylaminoethyloxyethyl substituent groups
are disclosed in
International Patent Application No. WO/2000/08044, entitled "2'-0-
Dimethylaminoethyloxyethyl-
Oligomeric compounds", filed August 6, 1999.
Modified Nucleobases/Naturally occurring nucleobases
[00170] Oligomeric compounds may also include nucleobase (often
referred to in the art
simply as "base" or "heterocyclic base moiety") modifications or
substitutions. As used herein,
"unmodified" or "natural" nucleobases include the purine bases adenine (A) and
guanine (G),
and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified
nucleobases also
referred herein as heterocyclic base moieties include other synthetic and
natural nucleobases
such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine,
hypoxanthine, 2-
aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-
propyl and other
alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-
thiocytosine, 5-
halouracil and cytosine, 5-propynyl (-C=-C-CH3) uracil and cytosine and other
alkynyl
derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil
(pseudouracil), 4-
thiouracil, 8-halo, 8-amino; 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-
substituted adenines and
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
-49 -
guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-
substituted uracils and cyto-
sines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-
azaguanine and
8-azaadenine, 7-deazaguanMe and 7-deazaadenine and 3-deazaguanine and 3-
deazaadenine.
[00171] Heterocyclic base moieties may also include those in which the
purine or
pyrimidine base is replaced with other heterocycles, for example 7-deaza-
adenine, 7-
deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include
those disclosed
in United States Patent No. 3,687,808, those disclosed in The Concise
Encyclopedia Of Polymer
Science And Engineering, pages 858-859, Kroschwitz, J.I., ed. John Wiley &
Sons, 1990, those
disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991,
30, 613, and those
disclosed by Sanghvi, Y.S., Chapter 15, Antisense Research and Applications,
pages 289-302,
Crooke, S.T. and Lebleu, B. , ed., CRC Press, 1993. Certain of these
nucleobases are
particularly useful for increasing the binding affinity of the oligomeric
compounds of the
invention. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2,
N-6 and 0-6
substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-
propynylcytosine.
5-methylcytosine substitutions have been shown to increase nucleic acid duplex
stability by 0.6-
1.2 C (Sanghvi, Y.S., Crooke, S.T. and Lebleu, B., eds., Antisense Research
and Applications,
CRC Press, Boca Raton, 1993, pp. 276-278) and are presently preferred base
substitutions, even
more particularly when combined with 2'-0-methoxyethyl sugar modifications.
[00172] In one aspect of the present invention oligomeric compounds are
prepared having
polycyclic heterocyclic compounds in place of one or more heterocyclic base
moieties. A
number of tricyclic heterocyclic compounds have been previously reported.
These compounds
are routinely used in antisense applications to increase the binding
properties of the modified
strand to a target strand. The most studied modifications are targeted to
guanosines hence they
have been termed G-clamps or cytidine analogs. Many of these polycyclic
heterocyclic
compounds have the general formula:
CA 02504720 2011-09-28
77684-23
- 50 -
RI2
RI si R13
NH R14
R10
j
Ris N
[00173] Representative cytosine analogs that make 3 hydrogen bonds with a
guanosine in
a second strand include 1,3-diazaphenoxazine-2-one 0, Rii - R14= H)
[Kurchavov, etal.,
Nucleosides and Nucleotides, 1997, 16, 1837-1846], 1,3-diazaphenothiazine-2-
one (R10= S, Rii
- R14= H), [Lin, K.-Y.; Jones, R. J.; Matteucci, M. J. Am. Chem. Soc. 1995,
117, 3873-3874] and
6,7,8,9-tetrafluoro-1,3-diazaphenoxazine-2-one (Rio = 0, R11- R14 = F) [Wang,
J.; Lin, K.-Y.,
Matteucci, M. Tetrahedron Lett. 1998, 39, 8385-8388]. Incorporated into
oligomers these base
modifications were shown to hybridize with complementary guanine and the
latter was also
shown to hybridize with adenine and to enhance helical thermal stability by
extended stacking
interactions(also see U.S. Patent Application entitled "Modified Peptide
Nucleic Acids" filed
May 24, 2002, Serial number US2003-0207804 Al; and U. S. Patent Application
entitled
"Nuclease Resistant Chimeric Oligonucleotides" filed May 24, 2002, Serial
number
US2003-0175906 Al).
[00174] Further helix-stabilizing properties have been observed when a
cytosine
analog/substitute has an aminoethoxy moiety attached to the rigid 1,3-
diazaphenoxazine-2-one
scaffold (Rio = 0, R11 = -04a-12)2-NF2, R12-14=1-1 ) [Lin, K.-Y.; Matteucci,
M. J. Am. Chem.
Soc. 1998, 120, 8531-8532]. Binding studies demonstrated that a single
incorporation could
enhance the binding affinity of a model oligonucleotide to its complementary
target DNA or
RNA with a AT,, of up to 18 relative to 5-methyl cytosine (dC5me), which is
the highest known
affinity enhancement for a single modification, yet. On the other hand, the
gain in helical
stability does not compromise the specificity of the oligonucleotides. The Tõ,
data indicate an
even greater discrimination between the perfect match and mismatched sequences
compared to
dC5'. It was suggested that the tethered amino group serves as an additional
hydrogen bond
donor to interact with the Hoogsteen face; namely the 06, of a complementary
guanine thereby
CA 02504720 2011-09-28
77684-23
- 51 -
forming 4 hydrogen bonds. This means that the increased affinity of G-clamp is
mediated by the
combination of extended base stacking and additional specific hydrogen
bonding.
1001751 Further tricyclic heterocyclic compounds and methods of using them
that are
amenable to the present invention are disclosed in United States Patent Serial
Number 6,028,183,
which issued on May 22, 2000, and United States Patent Serial Number
6,007,992, which issued
on December 28, 1999.
1001761 The enhanced binding affinity of the phenoxazine derivatives
together with their
uncompromised sequence specificity make them valuable nucleobase analogs for
the
development of more potent antisense-based drugs. In fact, promising data have
been derived
from in vitro experiments demonstrating that heptanucleotides containing
phenoxazine
substitutions are capable to activate RNaseH, enhance cellular uptake and
exhibit an increased
antisense activity [Lin, K-Y; Matteucci, M. J. Am. Chem. Soc. 1998, 120, 8531-
8532]. The
activity enhancement was even more pronounced in case of G-clamp, as a single
substitution was
shown to significantly improve the in vitro potency of a 20mer 2'-
deoxyphosphorothioate
oligonucleotides [Flanagan, W. M.; Wolf, J.J.; Olson, P.; Grant, D.; Lin, K.-
Y.; Wagner, R. W.;
Matteucci, M. Proc. Natl. Acad. Sci. USA, 1999, 96, 3513-3518]. Nevertheless,
to optimize
oligomer design and to better understand the impact of these heterocyclic
modifications on the
biological activity, it is important to evaluate their effect on the nuclease
stability of the
oligomers.
100177] Further modified polycyclic heterocyclic compounds useful as
heterocycicic bases
are disclosed in but not limited to, the above noted U.S. 3,687,808, as well
as U.S.: 4,845,205;
5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,434,257; 5,457,187;
5,459,255;
5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091;
5,614,617;
5,645,985; 5,646,269; 5,750,692; 5,830,653; 5,763,588; 6,005,096; and
5,681,941, and Unites
States Patent Application Serial number 09/996,292 filed November 28, 2001.
Conjugates
1001781 A further preferred substitution that can be appended to the
oligomeric
-compounds of the invention involves the linkage of one or more moieties or
conjugates which
=
CA 02504720 2011-09-28
77684-23
- 52 -
enhance the activity, cellular distribution or cellular uptake of the
resulting oligomeric
compounds. In one embodiment such modified oligomeric compounds are prepared
by
covalently attaching conjugate groups to functional groups such as hydroxyl or
amino groups.
Conjugate groups of the invention include intercalators, reporter molecules,
polyamines,
polyamides, polyethylene glycols, polyethers, groups that enhance the
pharmacodynamic
properties of oligomers, and groups that enhance the pharmacokinetic
properties of oligorners.
Typical conjugates groups include cholesterols, lipids, phospholipids, biotin,
phenazine, folate,
phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, couniarins,
and dyes. Groups
that enhance the pharmacodynamic properties, in the context of this invention,
include groups
that improve oligomer uptake, enhance oligomer resistance to degradation,
and/or strengthen
sequence-specific hybridization with RNA. Groups that enhance the
pharmacokinetic properties,
in the context of this invention, include groups that improve oligomer uptake,
distribution,
metabolism or excretion. Representative conjugate groups are disclosed in
International Patent
Application PCT/US92/09196, filed October 23, 1992. Conjugate moieties include
but are not limited to
lipid moieties such as a cholesterol moiety (Letsinger et at., Proc. Natl.
Acad Sci. USA, 1989, 86,
6553-6556), cholic acid (Manoharan et at., Bioorg Med Chem. Let., 1994, 4,
1053-1060), a thioether, e.g.,
hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-
309; Manoharan et
al., Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), a thiocholesterol
(Oberhauser et al., NucL
Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., dodecandiol or
undecyl residues (Saison-
Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett.,
1990, 259, 327-
330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-
hexadecyl-rac-
glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate
(Manoharan et
al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., NucL Acids Res.,
1990, 18, 3777-3783),
a polyarnine or a polyethylene glycol chain (Manoharan et al., Nucleosides &
Nucleotides, 1995,
14, 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett.,
1995, 36, 3651-
3654), a palmityl moiety (Mishra et al., Bloc/urn. Biophys. Acta, 1995, 1264,
229-237), or an
octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J.
Pharmacol.
Exp. Ther., 1996, 277, 923-937.
[001791
The oligomeric compounds of the invention may also be conjugated to active
drug
substances, for example, aspirin, warfarin, phenylbutazone, ibuprofen,
suprofen, fenbufen,
ketoprofcn, (8)-( )-pranoprofen, carprofen, dansylsarcosine, 2,3,5-
triiodobenzoic acid,
CA 02504720 2011-09-28
77684-23
- 53 -
flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a
diazepine, indornethicin, a
barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial
or an antibiotic.
Oligomer-drug conjugates and their preparation are described in United States
Patent
Application 09/334,130 (filed June 15, 1999).
[00180] Representative United States patents that teach the preparation
of such oligomer
conjugates include, but are not limited to, U.S.: 4,828,979; 4,948,882;
5,218,105; 5,525,465;
5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,580,731; 5,591,584;
5,109,124;
5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046;
4,587,044;
4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335;
4,904,582;
4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136;
5,245,092;
5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241,
5,391,723;
5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810;
5,574,142;
5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and
5,688,941.
3 '-endo modifications
[00181] In one aspect of the present invention oligomeric compounds
include nucleosides
synthetically modified to induce a 3'-endo sugar conformation. A nucleoside
can incorporate
synthetic modifications Of the heterocyclic base, the sugar moiety or both to
induce a desired 3'-
endo sugar conformation. These modified nucleosides are used to mimic RNA like
nucleosides
so that particular properties of an oligomeric compound can be enhanced while
maintaining the
desirable 3'-endo conformational geometry. There is an apparent preference for
an RNA type
duplex (A form helix, predominantly 3'-endo) as a requirement (e.g. trigger)
of RNA interference
which is supported in part by the fact that duplexes composed of 2'-deoxy-2'-F-
nucleosides
appears efficient in triggering RNAi response in the C. elegans system.
Properties that are
enhanced by using more stable 3'-endo nucleosidesinclude but aren't limited to
modulation of
phamfacokinetic properties through modification of protein binding, protein
off-rate, absorption
and clearance; modulation of nuclease stability as well as chemical stability;
modulation of the
binding affinity and specificity of the oligomer (affinity and specificity for
enzymes as well as
for complementary sequences); and increasing efficacy of RNA cleavage. The
present invention
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
- 54 -
provides oligomeric triggers of RNAi having one or more nucleosides modified
in such a way as
to favor a C3'-endo type conformation.
Conformation Scheme
2,)( 4,7=1),
eq _ 3eq
4ecl 2eci
lax
C2'-endo/Southern C3'-endoNorthern
[00182] Nucleoside conformation is influenced by various factors including
substitution at
the 2', 3' or 4'-positions of the pentofuranosyl sugar. Electronegative
substituents generally
prefer the axial positions, while sterically demanding sub stituents generally
prefer the equatorial
positions (Principles of Nucleic Acid Structure, Wolfgang Sanger, 1984,
Springer-Verlag.)
Modification of the 2' position to favor the 3'-endo conformation can be
achieved while
maintaining the 2'-OH as a recognition element, as illustrated in Figure 2,
below (Gallo et al.,
Tetrahedron (2001), 57, 5707-5713. Harry-O'kuru et al., J. Org. Chem., (1997),
62(6), 1754-1759 and
Tang et al., J. Org. Chem. (1999), 64, 747-754.) Alternatively, preference for
the 3'-endo
conformation can be achieved by deletion of the 2'-OH as exemplified by
2'deoxy-2'F-
nucleosides (Kawasaki et al., J. Med. Chem. (1993), 36, 831-841), which adopts
the 3'-endo
conformation positioning the electronegative fluorine atom in the axial
position. Other
modifications of the ribose ring, for example substitution at the 4'-position
to give 4'-F modified
nucleosides (Guillerm et al., Bioorganic and Medicinal Chemistry Letters
(1995), 5, 1455-1460 and
Owen et al., J. Org. Chem. (1976), 41, 3010-3017), or for example modification
to yield
methanocarba nucleoside analogs (Jacobson et al., J. Med. Chem. Lett. (2000),
43, 2196-2203 and Lee
et al., Bioorganic and Medicinal Chemistry Letters (2001), 11, 1333-1337) also
induce preference for
the 3'-endo conformation. Along similar lines, oligomeric triggers of RNAi
response might be
composed of one or more nucleosides modified in such a way that conformation
is locked into a
C3'-endo type conformation, i.e. Locked Nucleic Acid (LNA, Singh et al, Chem.
Commun. (1998),
4, 455-456), and ethylene bridged Nucleic Acids (ENA, Morita et al, Bioorganic
& Medicinal
Chemistry Letters (2002), 12, 73-76.) Examples of modified nucleosides
amenable to the present
invention are shown below in Table I. These examples are meant to be
representative and not
exhaustive.
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
- 55 -
[00182] Table I
H0774 HO¨rc4 HO¨rc63
\__/... CH3 H3 d'\ __ 1.4CH3 ___4.4CF3
HO 6H HO OH Ho OH
HO¨Tol HO¨ro4 HO-Tol
es \
\ _______________________________________ /
E __________________________________________________________ E
HO N3 HO 0 CH3 HO 6H
HO¨rc4 HO 110¨q HOB
...\. / ,. , CH3 A ___ /
:
H3 -C. OH HO OH HO 0
HO-01 HO¨roi, HO-1. yo J
HO....\ ____________________________________ /
HO 61 OH 1100
HO B HO¨(1 HO-01
* CH2F
E E
i .
HO OH HO OH HO OMOE
HO-01 HOT s4 HO B
OH HO OH HO OH
HOT0)3
\ __ /
. .
HO. f\':TH2
[00183] The preferred conformation of modified nucleosides and their
oligomers can be
estimated by various methods such as molecular dynamics calculations, nuclear
magnetic
resonance spectroscopy and CD measurements. Hence, modifications predicted to
induce RNA
like conformations; A-form duplex geometry in an oligomeric context, are
selected for use in the -
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
- 56 -
modified oligonucleotides of the present invention. The synthesis of numerous
of the modified
nucleosides amenable to the present invention are known in the art (see for
example, Chemistry
of Nucleosides and Nucleotides Vol 1-3, ed. Leroy B. Townsend, 1988, Plenum
press., and the
examples section below.)
[00184] In one aspect, the present invention is directed to oligomers that
are prepared
having enhanced properties compared to native RNA against nucleic acid
targets. A target is
identified and an oligomer is selected having an effective length and sequence
that is
complementary to a portion of the target sequence. Each nucleoside of the
selected sequence is
scrutinized for possible enhancing modifications. A preferred modification
would be the
replacement of one or more RNA nucleosides with nucleosides that have the same
3'-endo
conformational geometry. Such modifications can enhance chemical and nuclease
stability
relative to native RNA while at the same time being much cheaper and easier to
synthesize
and/or incorporate into an oligonucleotide. The selected sequence can be
further divided into
regions and the nucleosides of each region evaluated for enhancing
modifications that can be the
result of a chimeric configuration. Consideration is also given to the 5' and
3'-termini as there
are often advantageous modifications that can be made to one or more of the
terminal
nucleosides. The oligomeric compounds of the present invention include at
least one 5'-modified
phosphate group on a single strand or on at least one 5'-position of a double
stranded sequence or
sequences. Further modifications are also considered such as internucleoside
linkages, conjugate
groups, substitute sugars or bases, substitution of one or more nucleosides
with nucleoside
mimetics and any other modification that can enhance the selected sequence for
its intended
target.
[00185] The terms used to describe the conformational geometry of
homoduplex nucleic
acids are "A Form" for RNA and "B Form" for DNA. The respective conformational
geometry
for RNA and DNA duplexes was determined from X-ray diffraction analysis of
nucleic acid
fibers (Arnott and Hukins, Biochem. Biophys. Res. Comm., 1970, 47, 1504.) In
general,
RNA:RNA duplexes are more stable and have higher melting temperatures (Tm's)
than
DNA:DNA duplexes (Sanger et al., Principles of Nucleic Acid Structure, 1984,
Springer-Verlag;
New York, NY.; Lesnik et al., Biochemistry, 1995, 34, 10807-10815; Conte et
al., Nucleic Acids
Res., 1997, 25, 2627-2634). The increased stability of RNA has been attributed
to several
structural features, most notably the improved base stacking interactions that
result from an A-
form geometry (Searle et al., Nucleic Acids Res., 1993, 21, 2051-2056). The
presence of the 2'
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
- 57 -
hydroxyl in RNA biases the sugar toward a C3' endo pucker, i.e., also
designated as Northern
pucker, which causes the duplex to favor the A-form geometry. In addition, the
2' hydroxyl
groups of RNA can form a network of water mediated hydrogen bonds that help
stabilize the
RNA duplex (Egli et al., Biochemistry, 1996, 35, 8489-8494). On the other
hand, deoxy nucleic
acids prefer a C2' endo sugar pucker, i.e., also known as Southern pucker,
which is thought to
impart a less stable B-form geometry (Sanger, W. (1984) Principles of Nucleic
Acid Structure,
Springer-Verlag, New York, NY). As used herein, B-form geometry is inclusive
of both CT-
endo pucker and 04'-endo pucker. This is consistent with Berger, et. al.,
Nucleic Acids
Research, 1998, 26, 2473-2480, who pointed out that in considering the
furanose conformations
which give rise to B-form duplexes consideration should also be given to a 04'-
endo pucker
contribution.
[00186] DNA:RNA hybrid duplexes, however, are usually less stable than
pure
RNA:RNA duplexes, and depending on their sequence may be either more or less
stable than
DNA:DNA duplexes (Searle et al., Nucleic Acids Res., 1993, 21, 2051-2056). The
structure of a
hybrid duplex is intermediate between A- and B-form geometries, which may
result in poor
stacking interactions (Lane et al., Eur..1 Biochem., 1993, 215, 297-306;
Fedoroff et al., J. MoL
Biol., 1993, 233, 509-523; Gonzalez et al., Biochemistry, 1995, 34, 4969-4982;
Horton et al., J.
Mol. Biol., 1996, 264, 521-533). The stability of the duplex formed between a
target RNA and a
synthetic sequence is central to therapies such as but not limited to
antisense and RNA
interference as these mechanisms require the binding of a synthetic oligomer
strand to an RNA
target strand. In the case of antisense, effective inhibition of the mRNA
requires that the
antisense DNA have a very high binding affinity with the mRNA. Otherwise the
desired
interaction between the synthetic oligomer strand and target mRNA strand will
occur
infrequently, resulting in decreased efficacy.
[00187] One routinely used method of modifying the sugar puckering is the
substitution of
the sugar at the 2'-position with a sub stituent group that influences the
sugar geometry. The
influence on ring conformation is dependant on the nature of the substituent
at the 2'-position. A
number of different substituents have been studied to determine their sugar
puckering effect. For
example, 2'-halogens have been studied showing that the 2'-fluoro derivative
exhibits the largest
population (65%) of the C3'-endo form, and the 2'-iodo exhibits the lowest
population (7%). The
populations of adenosine (2'-OH) versus deoxyadenosine (2'-H) are 36% and 19%,
respectively.
Furthermore, the effect of the 2'-fluoro group of adenosine dimers (2'-deoxy-
2'-fluoroadenosine -
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
- 58 -2'-deoxy-2'-fluoro-adenosine) is further correlated to the stabilization
of the stacked
conformation.
[00188] As expected, the relative duplex stability can be enhanced by
replacement of 2'-
OH groups with 2'-F groups thereby increasing the C3'-endo population. It is
assumed that the
highly polar nature of the 2'-F bond and the extreme preference for C3'-endo
puckering may
stabilize the stacked conformation in an A-form duplex. Data from UV
hypochromicity, circular
dichroism, and 1H NMR also indicate that the degree of stacking decreases as
the
electronegativity of the halo substituent decreases. Furthermore, steric bulk
at the 2'-position of
the sugar moiety is better accommodated in an A-form duplex than a B-form
duplex. Thus, a
2'-substituent on the 3'-terminus of a dinucleoside monophosphate is thought
to exert a number
of effects on the stacking conformation: steric repulsion, furanose puckering
preference,
electrostatic repulsion, hydrophobic attraction, and hydrogen bonding
capabilities. These
substituent effects are thought to be determined by the molecular size,
electronegativity, and
hydrophobicity of the substituent. Melting temperatures of complementary
strands is also
increased with the 2'-substituted adenosine diphosphates. It is not clear
whether the 3'-endo
preference of the conformation or the presence of the substituent is
responsible for the increased
binding. However, greater overlap of adjacent bases (stacking) can be achieved
with the 3'-endo
conformation.
[00189] One synthetic 2'-modification that imparts increased nuclease
resistance and a
very high binding affinity to nucleotides is the 2-methoxyethoxy (2'-M0E, 2'-
OCH2CH2OCH3)
side chain (Baker et al., I Biol. Chem., 1997, 272, 11944-12000). One of the
immediate
advantages of the 2'-MOE substitution is the improvement in binding affinity,
which is greater
than many similar 2' modifications such as 0-methyl, 0-propyl, and 0-
aminopropyl. Oligomers
having the 2'-0-methoxyethyl substituent also have been shown to be antisense
inhibitors of
gene expression with promising features for in vivo use (Martin, P., Helv.
Chim. Acta, 1995, 78,
486-504; Altmann et al., Chimia, 1996, 50, 168-176; Altmann et al., Biochem.
Soc. Trans., 1996,
24, 630-637; and Altmann et al., Nucleosides Nucleotides, 1997, /6, 917-926).
Relative to
DNA, the oligomers having the 2'-MOE modification displayed improved RNA
affinity and
higher nuclease resistance. Chimeric oligomers having 2'-MOE substituents in
the wing
nucleosides and an internal region of deoxy-phosphorothioate nucleotides (also
termed a gapped
oligomer or gapmer) have shown effective reduction in the growth of tumors in
animal models at
low doses. 2'-MOE substituted oligomers have also shown outstanding promise as
antisense
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
- 59 -
agents in several disease states. One such MOE substituted oligomer is
presently being
investigated in clinical trials for the treatment of CMV retinitis.
Chemistries Defined
[00190] Unless otherwise defined herein, alkyl means C1-C12, preferably C1-
C8, and more
preferably C1-C6, straight or (where possible) branched chain aliphatic
hydrocarbyl.
[00191] Unless otherwise defined herein, heteroalkyl means C1-C12,
preferably C1-C8, and
more preferably C1-C6, straight or (where possible) branched chain aliphatic
hydrocarbyl
containing at least one, and preferably about 1 to about 3, hetero atoms in
the chain, including
the terminal portion of the chain. Preferred heteroatoms include N, 0 and S.
[00192] Unless otherwise defined herein, cycloalkyl means C3-C12,
preferably C3-C8, and
more preferably C3-C6, aliphatic hydrocarbyl ring.
[00193] Unless otherwise defined herein, alkenyl means C2-C12, preferably
C2-C8, and
more preferably C2-C6 alkenyl, which may be straight or (where possible)
branched hydrocarbyl
moiety, which contains at least one carbon-carbon double bond.
[00194] Unless otherwise defined herein, alkynyl means C2-C12, preferably
C2-C8, and
more preferably C2-C6 alkynyl, which may be straight or (where possible)
branched hydrocarbyl
moiety, which contains at least one carbon-carbon triple bond.
[00195] Unless otherwise defined herein, heterocycloalkyl means a ring
moiety containing
at least three ring members, at least one of which is' carbon, and of which 1,
2 or three ring
members are other than carbon. Preferably the number of carbon atoms varies
from 1 to about
12, preferably 1 to about 6, and the total number of ring members varies from
three to about 15,
preferably from about 3 to about 8. Preferred ring heteroatoms are N, 0 and S.
Preferred
heterocycloalkyl groups include morpholino, thiomorpholino, pip eridinyl,
piperazinyl,
homopiperidinyl, homopiperazinyl, homomorpholino, homothiomorpholino,
pyrrolodinyl,
tetrahydrooxazolyl, tetrahydroimidazolyl, tetrahydrothiazolyl,
tetrahydroisoxazolyl,
tetrahydropyrrazolyl, furanyl, pyranyl, and tetrahydroisothiazolyl.
[00196] Unless otherwise defined herein, aryl means any hydrocarbon ring
structure
containing at least one aryl ring. Preferred aryl rings have about 6 to about
20 ring carbons.
Especially preferred aryl rings include phenyl, napthyl, anthracenyl, and
phenanthrenyl.
[00197] Unless otherwise defined herein, hetaryl means a ring moiety
containing at least
one fully unsaturated ring, the ring consisting of carbon and non-carbon
atoms. Preferably the
CA 02504720 2011-09-28
77684-23
- 60 -
ring system contains about Ito about 4 rings. Preferably the number of carbon
atoms varies
from 1 to about 12, preferably 1 to about 6, and the total number of ring
members varies from
three to about 15, preferably from about 3 to about S. Preferred ring
heteroatoms are N, 0 and S.
Preferred hetaryl moieties include pyrazolyl, thiophenyl, pyridyl, imidazolyl,
tetrazolyl, pyridyl,
pyrimidinyl, purinyl, quinazolinyl, quinoxalinyl, benzimidazolyl,
benzothiophenyl, etc.
[00198] The term haloalkyl is defined as an alkyl containing one or more
halogen atoms.
In some embodiments, the alkyl is fully halogenated. For example, the
haloalkyl may be
trifluoromethyl. Similarly, the term haloalkoxy is defined as an alkoxy group
where the alkyl
group is a haloalkyl. For example, the haloalkoxy may be trifluoroalkoxy.
[00199] Unless otherwise defined herein, where a moiety is defined as a
compound
moiety, such as hetarylalkyl (hetaryl and alkyl), aralkyl (aryl and alkyl),
haloalkyl, etc., each of
the sub-moieties is as defined herein.
[00200] Unless otherwise defined herein, an electron withdrawing group is a
group, such
as the cyano or isocyanato group that draws electronic charge away from the
carbon to which it
is attached. Other electron withdrawing groups of note include those whose
electronegativities
exceed that of carbon, for example halogen, nitro, or phenyl substituted in
the ortho- or para-
position with one or more cyano, isothiocyanato, nitro or halo groups.
[00201] Unless otherwise defined herein, the terms halogen and halo have
their ordinary
meanings. Preferred halo (halogen) substituents are Cl, Br, and I.
[00202] The aforementioned optional substituents are, unless otherwise
herein defined,
suitable substituents depending upon desired properties. Included are halogens
(Cl, Br, I), alkyl,
alkenyl, and alkynyl moieties, NO2, NH3 (substituted and unsubstituted), acid
moieties (e.g. ¨
CO2H, -0S03H2, etc.), heterocycloalkyl moieties, hetaryl moieties, aryl
moieties, etc.
[00203] In all the preceding formulae, the squiggle (¨) indicates a bond
to an oxygen or
sulfur of the 5'-phosphate.
[00204] Phosphate protecting groups include those described in US Patents
No. US
5,760,209, US 5,614,621, US 6,051,699, US 6,020,475, US 6,326,478, US
6,169,177, US
6,121,437, US 6,465,628.
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
- 61 -
Screening, Target Validation and Drug Discovery
[00205] For use in screening and target validation, the compounds and
compositions of the
invention are used to modulate the expression of a selected protein.
"Modulators" are those
oligomeric compounds and compositions that decrease or increase the expression
of a nucleic
acid molecule encoding a protein and which comprise at least an 8-nucleobase
portion which is
complementary to a preferred target segment. The screening method comprises
the steps of
contacting a preferred target segment of a nucleic acid molecule encoding a
protein with one or
more candidate modulators, and selecting for one or more candidate modulators
which decrease
or increase the expression of a nucleic acid molecule encoding a protein. Once
it is shown that
the candidate modulator or modulators are capable of modulating (e.g. either
decreasing or
increasing) the expression of a nucleic acid molecule encoding a peptide, the
modulator may
then be employed in further investigative studies of the function of the
peptide, or for use as a
research, diagnostic, or therapeutic agent in accordance with the present
invention.
[00206] The conduction such screening and target validation studies,
oligomeric
compounds of invention can be used combined with their respective
complementary strand
oligomeric compound to form stabilized double-stranded (duplexed) oligomers.
Double stranded
oligomer moieties have been shown to modulate target expression and regulate
translation as
well as RNA processing via an antisense mechanism. Moreover, the double-
stranded moieties
may be subject to chemical modifications (Fire et al., Nature, 1998, 391, 806-
811; Timmons and
Fire, Nature 1998, 395, 854; Timmons et al., Gene, 2001, 263, 103-112; Tabara
et al., Science,
1998, 282, 430-431; Montgomery et al., Proc. Natl. Acad. Sci. USA, 1998, 95,
15502-15507;
Tuschl et al., Genes Dev., 1999, 13, 3191-3197; Elbashir et al., Nature, 2001,
411, 494-498;
Elbashir et al., Genes Dev. 2001, 15, 188-200 ; Nishikura et al., Cell (2001),
107, 415-416; and
Bass et al., Cell (2000), 101, 235-238.) For example, such double-stranded
moieties have been
shown to inhibit the target by the classical hybridization of antisense strand
of the duplex to the
target, thereby triggering enzymatic degradation of the target (Tijsterman et
al., Science, 2002,
295, 694-697).
[00207] For use in drug discovery and target validation, oligomeric
compounds of the
present invention are used to elucidate relationships that exist between
proteins and a disease
state, phenotype, or condition. These methods include detecting or modulating
a target peptide
comprising contacting a sample, tissue, cell, or organism with the oligomeric
compounds and
compositions of the present invention, measuring the nucleic acid or protein
level of the target
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
- 62 -
and/or a related phenotypic or chemical endpoint at some time after treatment,
and optionally
comparing the measured value to a non-treated sample or sample treated with a
further
oligomeric compound of the invention. These methods can also be performed in
parallel or in
combination with other experiments to determine the function of unknown genes
for the process
of target validation or to determine the validity of a particular gene product
as a target for
treatment or prevention of a disease or disorder.
Kits, Research Reagents, Diagnostics, and Therapeutics
[00208] The oligomeric compounds and compositions of the present invention
can
additionally be utilized for diagnostics, therapeutics, prophylaxis and as
research reagents and
kits. Such uses allows for those of ordinary skill to elucidate the function
of particular genes or to
distinguish between functions of various members of a biological pathway.
[00209] For use in kits and diagnostics, the oligomeric compounds and
compositions of
the present invention, either alone or in combination with other compounds or
therapeutics, can
be used as tools in differential and/or combinatorial analyses to elucidate
expression patterns of a
portion or the entire complement of genes expressed within cells and tissues.
[00210] As one non-limiting example, expression patterns within cells or
tissues treated
with one or more Compounds or compositions of the invention are compared to
control cells or
tissues not treated with the compounds or compositions and the patterns
produced are analyzed
for differential levels of gene expression as they pertain, for example, to
disease association,
signaling pathway, cellular localization, expression level, size, structure or
function of the genes
examined. These analyses can be performed on stimulated or unstimulated cells
and in the
presence or absence of other compounds that affect expression patterns.
[00211] Examples of methods of gene expression analysis known in the art
include DNA
arrays or microarrays (Brazma and Vilo, FEBS Lett., 2000, 480, 17-24; Celis,
et al., FEBS Lett.,
2000, 480, 2-16), SAGE (serial analysis of gene expression)(Madden, et al.,
Drug Discov.
Today, 2000, 5, 415-425), READS (restriction enzyme amplification of digested
cDNAs)
(Prashar and Weissman, Methods Enzymol., 1999, 303, 258-72), TOGA (total gene
expression
analysis) (Sutcliffe, et al., Proc. Natl. Acad. Sci. U. S. A., 2000, 97, 1976-
81), protein arrays and
proteomics (Celis, et al., FEBS Lett., 2000, 480, 2-16; Jungblut, et al.,
Electrophoresis, 1999, 20,
2100-10), expressed sequence tag (EST) sequencing (Celis, et al., FEBS Lett.,
2000, 480, 2-16;
Larsson, et al., J. Biotechnol., 2000, 80, 143-57), subtractive RNA
fingerprinting (SuRF) (Fuchs,
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
- 63 -
et al., Anal. Biochem., 2000, 286, 91-98; Larson, et al., Cytometry, 2000, 41,
203-208),
subtractive cloning, differential display (DD) (Jurecic and Belmont, Curr.
Opin. Microbiol.,
2000, 3, 316-21), comparative genomic hybridization (Carulli, et al., J. Cell
Biochem. Suppl.,
1998, 31, 286-96), FISH (fluorescent in situ hybridization) techniques (Going
and Gusterson,
Eur. I Cancer, 1999, 35, 1895-904) and mass spectrometry methods (To, Comb.
Chem. High
Throughput Screen, 2000, 3, 235-41).
[00212] The compounds and compositions of the invention are useful for
research and
diagnostics, because these compounds and compositions hybridize to nucleic
acids encoding
proteins. Hybridization of the compounds and compositions of the invention
with a nucleic acid
can be detected by means known in the art. Such means may include conjugation
of an enzyme
to the compound or composition, radiolabelling or any other suitable detection
means. Kits
using such detection means for detecting the level of selected proteins in a
sample may also be
prepared.
[00213] The specificity and sensitivity of compounds and compositions can
also be
harnessed by those of skill in the art for therapeutic uses. Antisense
oligomeric compounds have
been employed as therapeutic moieties in the treatment of disease states in
animals, including
humans. Antisense oligomer drugs, including ribozymes, have been safely and
effectively
administered to humans and numerous clinical trials are presently underway. It
is thus
established that oligomeric compounds can be useful therapeutic modalities
that can be
configured to be useful in treatment regimes for the treatment of cells,
tissues and animals,
especially humans.
[00214] For therapeutics, an animal, preferably a human, suspected of
having a disease or
disorder that can be treated by modulating the expression of a selected
protein is treated by
administering the compounds and compositions. For example, in one non-limiting
embodiment,
the methods comprise the step of administering to the animal in need of
treatment, a
therapeutically effective amount of a protein inhibitor. The protein
inhibitors of the present
invention effectively inhibit the activity of the protein or inhibit the
expression of the protein. In
one embodiment, the activity or expression of a protein in an animal is
inhibited by about 10%.
Preferably, the activity or expression of a protein in an animal is inhibited
by about 30%. More
preferably, the activity or expression of a protein in an animal is inhibited
by 50% or more.
[00215] For example, the reduction of the expression of a protein may be
measured in
serum, adipose tissue, liver or any other body fluid, tissue or organ of the
animal. Preferably, the
CA 02504720 2011-09-28
77684-23
- 64 -
cells contained within the fluids, tissues or organs being analyzed contain a
nucleic acid
molecule encoding a protein and/or the protein itself.
[00216] The compounds and compositions of the invention can be utilized
in
pharmaceutical compositions by adding an effective amount of the compound or
composition to
a suitable pharmaceutically acceptable diluent or carrier. Use of the
oligomeric compounds and
methods of the invention may also be useful prophylactically.
Formulations
[00217] The compounds and compositions of the invention may also be
admixed,
encapsulated, conjugated or otherwise associated with other molecules,
molecule structures or
mixtures of compounds, as for example, liposomes, receptor-targeted molecules,
oral, rectal,
topical or other formulations, for assisting in uptake, distribution and/or
absorption.
Representative United States patents that teach the preparation of such
uptake, distribution
and/or absorption-assisting formulations include, but are not limited to,
U.S.: 5,108,921;
5,354,844; 5,416,016; 5,459,127; 5,521,291; 5,543,158; 5,547,932; 5,583,020;
5,591,721;
4,426,330; 4,534,899; 5,013,556; 5,108,921; 5,213,804; 5,227,170; 5,264,221;
5,356,633;
5,395,619; 5,416,016; 5,417,978; 5,462,854; 5,469,854; 5,512,295; 5,527,528;
5,534,259;
5,543,152; 5,556,948; 5,580,575; and 5,595,756.
[00218] The compounds and compositions of the invention encompass any
pharmaceutically acceptable salts, esters, or salts of such esters, or any
other compound which,
upon administration to an animal, including a human, is capable of providing
(directly or
indirectly) the biologically active metabolite or residue thereof.
Accordingly, for example, the
disclosure is also drawn to prodrugs and pharmaceutically acceptable salts of
the oligomeric
compounds of the invention, pharmaceutically acceptable salts of such
prodrugs, and other
bioequivalents.
[00219] The term "prodrug" indicates a therapeutic agent that is
prepared in an inactive
form that is converted to an active form (i.e., drug) within the body or cells
thereof by the action
of endogenous enzymes or other chemicals and/or conditions. In particular,
prodrug versions of
the oligomers of the invention are prepared as SATE [(S-acetyl-2-thioethyl)
phosphate]
derivatives according to the methods disclosed in WO 93/24510 to Gosselin et
al., published
December 9;1993 or in WO 94/26764 and U.S. 5,770,713 to Imbach etal.
CA 02504720 2005-05-02
WO 2004/044138
PCT/US2003/035074
- 65 -
[00220] The term "pharmaceutically acceptable salts" refers to
physiologically and
pharmaceutically acceptable salts of the compounds and compositions of the
invention: i.e., salts
that retain the desired biological activity of the parent compound and do not
impart undesired
toxicological effects thereto. For oligomers, preferred examples of
pharmaceutically acceptable
salts and their uses are further described in U.S. Patent 6,287,860, which is
incorporated herein
in its entirety.
[00221] The present invention also includes pharmaceutical compositions
and
formulations that include the compounds and compositions of the invention. The
pharmaceutical
compositions of the present invention may be administered in a number of ways
depending upon
whether local or systemic treatment is desired and upon the area to be
treated. Administration
may be topical (including ophthalmic and to mucous membranes including vaginal
and rectal
delivery), pulmonary, e.g., by inhalation or insufflation of powders or
aerosols, including by
nebulizer; intratracheal, intranasal, epidermal and transdermal), oral or
parenteral. Parenteral
administration includes intravenous, intraarterial, subcutaneous,
intraperitoneal or intramuscular
injection or infusion; or intracranial, e.g., intrathecal or intraventricular,
administration.
Pharmaceutical compositions and formulations for topical administration may
include
transdermal patches, ointments, lotions, creams, gels, drops, suppositories,
sprays, liquids and
powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases,
thickeners and
the like may be necessary or desirable. Coated condoms, gloves and the like
may also be useful.
[00222] The pharmaceutical formulations of the present invention, which
may
conveniently be presented in unit dosage form, may be prepared according to
conventional
techniques well known in the pharmaceutical industry. Such techniques include
the step of
bringing into association the active ingredients with the pharmaceutical
carrier(s) or excipient(s).
In general, the formulations are prepared by uniformly and intimately bringing
into association
the active ingredients with liquid carriers or finely divided solid carriers
or both, and then, if
necessary, shaping the product.
[00223] The
compounds and compositions of the present invention may be formulated
into any of many possible dosage forms such as, but not limited to, tablets,
capsules, gel
capsules, liquid syrups, soft gels, suppositories, and enemas. The
compositions of the present
invention may also be formulated as suspensions in aqueous, non-aqueous or
mixed media.
Aqueous suspensions may further contain substances which increase the
viscosity of the
= CA 02504720 2011-09-28
77684-23
- 66 -
suspension including, for example, sodium carboxymethylcellulose, sorbitol
and/or dextran. The
suspension may also contain stabilizers.
[00224] Pharmaceutical compositions of the present invention include,
but are not limited
to, solutions, emulsions, foams and liposome-containing formulations. The
pharmaceutical
compositions and formulations of the present invention may comprise one or
more penetration
enhancers, carriers, excipients or other active or inactive ingredients.
[00225] Emulsions are typically heterogenous systems of one liquid
dispersed in another
in the form of droplets usually exceeding 0.1 um in diameter. Emulsions may
contain additional
components in addition to the dispersed phases, and the active drug that may
be present as a
solution in either the aqueous phase, oily phase or itself as a separate
phase. Microemulsions are
included as an embodiment of the present invention. Emulsions and their uses
are well known in
the art and are further described in U.S. Patent 6,287,860.
[00226] Formulations of the present invention include liposomal
formulations. As used in
the present invention, the term "liposome" means a vesicle composed of
amphiphilic lipids
arranged in a spherical bilayer or bilayers. Liposomes are unilamellar or
multilamellar vesicles
which have a membrane formed from a lipophilic material and an aqueous
interior that contains
the composition to be delivered. Cationic liposomes are positively charged
liposomes which are
believed to interact with negatively charged DNA molecules to form a stable
complex.
Liposomes that are pH-sensitive or negatively-charged are believed to entrap
DNA rather than
complex with it. Both cationic and noncationic liposomes have been used to
deliver DNA to
cells.
[00227] Liposomes also include "sterically stabilized" liposomes, a
term which, as used
herein, refers to liposomes comprising one or more specialized lipids that,
when incorporated
into liposomes, result in enhanced circulation lifetimes relative to liposomes
lacking such
specialized lipids. Examples of sterically stabilized liposomes are those in
which part of the
vesicle-forming lipid portion of the liposome comprises one or more
glycolipids or is derivatized
with one or more hydrophilic polymers, such as a polyethylene glycol (PEG)
moiety. Liposomes
and their uses are further described in U.S. Patent 6,287,860.
[00228] The pharmaceutical formulations and compositions of the
present invention may
also include surfactants. The use of surfactants in drug products,
formulations and in emulsions
CA 02504720 2011-09-28
77684-23
- 67 -
is well known in the art. Surfactants and their uses are further described in
U.S. Patent 6287,860.
[00229] In one embodiment, the present invention employs various
penetration enhancers
to effect the efficient delivery of nucleic acids, particularly oligomers. In
addition to aiding the
diffusion of non-lipophilic drugs across cell membranes, penetration enhancers
also enhance the
permeability of lipophilic drugs. Penetration enhancers may be classified as
belonging to one of
five broad categories, i.e., surfactants, fatty acids, bile salts, chelating
agents, and non-chelating
non-surfactants. Penetration enhancers and their uses are further described in
U.S. Patent
6,287,860.
[00230] One of skill in the art will recognize that formulations are
routinely designed
according to their intended use, i.e. route of administration.
[00231] Preferred formulations for topical administration include those in
which the
oligomers of the invention are in admixture with a topical delivery agent such
as lipids,
liposomes, fatty acids, fatty acid esters, steroids, chelating agents and
surfactants. Preferred
lipids and liposomes include neutral (e.g. dioleoylphosphatidyl DOPE
ethanolamine,
dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl choline) negative
(e.g.
dimyristoylphosphatidyl glycerol DMPG) and cationic (e.g.
dioleoyltetramethylaminopropyl
DOTAP and dioleoylphosphatidyl ethanolamine DOTMA).
[00232] For topical or other administration, compounds and compositions of
the invention
may be encapsulated within liposomes or may form complexes thereto, in
particular to cationic
liposomes. Alternatively, they may be complexed to lipids, in particular to
cationic lipids.
Preferred fatty acids and esters, pharmaceutically acceptable salts thereof,
and their uses are
further described in U.S. Patent 6,287, 860. Topical formulations are
described in detail in United
States patent application 09/315,298 filed on May 20, 1999.
002331 Compositions and formulations for oral administration include
powders or
granules, microparticulates, nanoparticulates, suspensions or solutions in
water or non-aqueous
media, capsules, gel capsules, sachets, tablets or minitablets. Thickeners,
flavoring agents,
diluents, emulsifiers, dispersing aids or binders may be desirable. Preferred
oral formulations are
those in which oligomers of the invention are administered in conjunction with
one or more
penetration enhancers surfactants and chelators. Preferred surfactants include
fatty acids and/or
esters or salts thereof, bile acids and/or salts thereof. Preferred bile
acids/salts and fatty acids
CA 02504720 2011-09-28
77684-23
- 68 -
and their uses are further described in U.S. Patent 6,287,860. Also preferred
are
combinations of penetration enhancers, for example, fatty acids/salts
in combination with bile acids/salts. A particularly preferred combination is
the sodium salt of
lauric acid, capric acid and UDCA. Further penetration enhancers include
polyoxyethylene-9-
lauryl ether, polyoxyethylene-20-cetyl ether. Compounds and compositions of
the invention
may be delivered orally, in granular form including sprayed dried particles,
or complexed to
form micro or nanoparticles. Complexing agents and their uses are further
described in U.S.
Patent 6,287,860, which is incorporated herein in its entirety. Certain oral
formulations for
oligorners and their preparation are described in detail in United States
applications 09/108,673
(filed July 1, 1998), 09/315,298 (filed May 20, 1999) and 10/071,822, filed
February 8, 2002.
00,2341 Compositions and formulations for parenteral, intrathecal or
intraventricular
administration may include sterile aqueous solutions that may also contain
buffers, diluents and
other suitable additives such as, but not limited to, penetration enhancers,
carrier compounds and
other pharmaceutically acceptable carriers or excipients.
1002351 Certain embodiments of the invention provide pharmaceutical
compositions
containing one or more of the compounds and compositions of the invention and
one or more
other chemotherapeutic agents that function by a non-antisense mechanism.
Examples of such
chemotherapeutic agents include but are not limited to cancer chemotherapeutic
drugs such as
daunorubicin, daunomycin, dactinomycin, doxorubicin, epirubicin, idarubicin,
esorubicin,
bleomycin, rnafosfamide, ifosfamide, cytosine arabinoside, bis-
chloroethylnitrosurea, busulfan,
mitomycin C, actinomycin D, rnithramycin, prednisone, hydroxyprogesterone,
testosterone,
tamoxifen, dacarbazine, procarbazine, hexamethylmelamine, pentamethylmelamine,
mitoxantrone, amsacrine, chlorambucil, methylcyclohexylnitrosurea, nitrogen
mustards,
melphalan, cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-
azacytidine,
hydroxyurea, deoxycoformycin, 4-hydroxyperoxycyclophosphoramide, 5-
fluorouracil (5-FU), 5-
fiuorodeoxyuridine (5-FUdR), methotrexate (MTX), colchicine, taxol,
vincristine, vinblastine,
etoposide (VP-16), trimetrexate, irinotecan, topotecan, gemcitabine,
teniposide, cisplatin and
diethylstilbestrol (DES). When used with the oligomeric compounds of the
invention, such
chemotherapeutic agents may be used individually (e.g., 5-FU and oligomer),
sequentially (e.g.,
5-FU and oligomer for a period of time followed by MTX and oligomer), or in
combination with
one or more other such chemotherapeutic agents (e.g., 5-FU, MTX and oligomer,
or 5-FU,
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
- 69 -
radiotherapy and oligomer). Anti-inflammatory drugs, including but not limited
to nonsteroidal
anti-inflammatory drugs and cortico steroids, and antiviral drugs, including
but not limited to
ribivirin, vidarabine, acyclovir and ganciclovir, may also be combined in
compositions of the
invention. Combinations of compounds and compositions of the invention and
other drugs are
also within the scope of this invention. Two or more combined compounds such
as two
oligomeric compounds or one oligomeric compound combined with further
compounds may be
used together or sequentially.
[00236] In another related embodiment, compositions of the invention may
contain one or
more of the compounds and compositions of the invention targeted to a first
nucleic acid and one
or more additional compounds such as antisense oligomeric compounds targeted
to a second
nucleic acid target. Numerous examples of antisense oligomeric compounds are
known in the
art. Alternatively, compositions of the invention may contain two or more
oligomeric compounds
and compositions targeted to different regions of the same nucleic acid
target. Two or more
combined compounds may be used together or sequentially
Dosing
[00237] The formulation of therapeutic compounds and compositions of the
invention and
their subsequent administration (dosing) is believed to be within the skill of
those in the art.
Dosing is dependent on severity and responsiveness of the disease state to be
treated, with the
course of treatment lasting from several days to several months, or until a
cure is effected or a
diminution of the disease state is achieved. Optimal dosing schedules can be
calculated from
measurements of drug accumulation in the body of the patient. Persons of
ordinary skill can
easily determine optimum dosages, dosing methodologies and repetition rates.
Optimum
dosages may vary depending on the relative potency of individual oligomers,
and can generally
be estimated based on EC50s found to be effective in in vitro and in vivo
animal models. In
general, dosage is from 0.01 ug to 100 g per kg of body weight, and may be
given once or more
daily, weekly, monthly or yearly, or even once every 2 to 20 years. Persons of
ordinary skill in
the art can easily estimate repetition rates for dosing based on measured
residence times and
concentrations of the drug in bodily fluids or tissues. Following successful
treatment, it may be
desirable to have the patient undergo maintenance therapy to prevent the
recurrence of the
disease state, wherein the oligomer is administered in maintenance doses,
ranging from 0.01 ug
to 100 g per kg of body weight, once or more daily, to once every 20 years.
CA 02504720 2011-09-28
77684-23
- 70 -
[00238] While the present invention has been described with specificity in
accordance
with certain of its preferred embodiments, the following examples serve only
to illustrate the
invention and are not intended to limit the same.
Example 1
Synthesis of Nucleoside Phosphoramidites
[002401 The following compounds, including amidites and their intermediates
were
prepared as described in US Patent 6,426,220 and published PCT WO 02/36743; 5'-
0-
Dimethoxytrityl-thymidine intermediate for 5-methyl dC amidite, 5'-0-
Dimethoxytrity1-2'-
deoxy-5-methylcytidine intermediate for 5-methyl-dC amidite, 5'-0-
Dimethoxytrity1-2'-deoxy-
N4-benzoy1-5-methylcytidine penultimate intermediate for 5-methyl dC amidite,
[51-0-(4,4'-
Dimethoxytriphenylmethyl)-21-deoxy-N4-benzoyl-5-methylcytidin-T-0-y1]-2-
cyanoethyl-N,N-
diisopropylphosphoramidite (5-methyl dC amidite),. 2'-Fluorodeoxyadenosine, 2'-
Fluorodeoxyguanosine, 2'-Fluorouridine, 2'-Fluorodeoxycytidine, 2'-0-(2-
Methoxyethyl)
modified amidites, 2'-0-(2-methoxyethyl)-5-methyluridine intermediate, 5'-0-
DMT-2'-0-(2-
methoxyethyl)-5-methyluridine penultimate intermediate, [51-044,41-
Dimethoxytriphenylmethyl)-21-0-(2-methoxyethyl)-5-methyluridin-31-0-y1]-2-
cyanoethyl-N,N-
diisopropylphosphoramidite (MOE T amidite), 5'-0-Dimethoxytrity1-2'-0-(2-
methoxyethyl)-5-
methylcytidine intermediate, 5'-0-dimethoxytrity1-2'-0-(2-methoxyethyl)-N4-
benzoy1-5-methyl-
cytidine penultimate intermediate, [51-0-(4,41-Dimethoxytriphenylmethyl)-21-0-
(2-
methoxyethyl)-N4-benzoyl-5-methykytidin-31-0-y1]-2-cyanoethyl-N,N-
diisopropylphosphoramidite (MOE 5-Me-C amidite), [51-0-(4,4'-
Dimethoxytriphenylmethyl)-21-
0-(2-methoxyethyl)-N6-benzoyladenosin-3'-0-y1]-2-4anoethyl-N,N-
diisopropylphosphoramidite (MOE A amdite), [5'-0-(4,4'-
Dimethoxytriphenylmethyl)-2`-0-(2-
methoxyethyl)-N4-isobutyrylguanosin-31-0-y1]-2-cyanoethyl-N,N-
diisopropylphosphoramidite
(MOE G amidite), 2'-0-(Aminooxyethyl) nucleoside amidites and 2'-0-
(dimethylaminooxy-
ethyl) nucleoside amidites, 2'-(Dimethylaminooxyethoxy) nucleoside amidites,
5'-0-tert-
Butyldiphenylsily1-02-2'-anhydro-5-methyluridine , 5'-0-tert-
Butyldiphenylsily1-2'-0-(2-
. hydroxyethyl)-5-methyluridine, 21-042-phthalimidoxy)ethy11-51-t-
butyldiphenylsily1-5-
CA 02504720 2011-09-28
=
77684-23
- 71 -
methyluridine , 5'-0-tert-butyldiphenylsily1-2'-0-[(2-formadoximinooxy)ethy1]-
5-methyluridine,
5'-0-tert-Butyldiphenylsily1-2'-0-[N,N dimethylaminooxyethy1]-5-methyluridine,
2'-0-
.
(dimethylaminooxyethyl)-5-methyluridine, 5'-0-DMT-T-0-(dimethylaminooxyethyl)-
5-
methyluridine, 5'-0-DMT-2'-0-(2-N,N-dimethylaminooxyethyl)-5-methyluridine-3'-
[(2-
cvanoethyl)-N,N-diisopropylphosphoramidite], 2'-(Aminooxyethoxy) nucleoside
amidites, N2-
isobutyry1-6-0-diphenylcarbamoy1-21-0-(2-ethylacety1)-51-0-(4,4'-
dimethoxytritypguanosine-3'-
[(2-cyanoethyl)-N,N-diisopropylphosphoramidite], 2'-dimethylaminoethoxyethoxy
(2'-
DMAEOE) nucleoside amidites, 2'-0[2(2-N,N-dimethylaminoethoxy)ethy11-5-methyl
uridine,
5'-0-dimethoxytrity1-2'-0[2(2-N,N-dimethylaminoethoxy)-ethyl)]-5-methyl
uridine and 5'-0-
Dimethoxytrity1-2'-042(2-N,N-dimethylaminoethoxy)-ethyl)]-5-methyl uridine-3'-
0-
(cyanoethyl-N,N-diisopropyl)phosphorarnidite.
Example 2
Oligomer and oligonucleoside synthesis
[00241] Oligomers: Unsubstituted and substituted phosphodiester
(P=0) oligomers are
synthesized on an automated DNA synthesizer (Applied Biosystems model 394)
using standard
phosphoramidite chemistry with oxidation by iodine.
[00242] Phosphorothioates (P=S) are synthesized similar to
phosphodiester oligomers
with the following exceptions: thiation was effected by utilizing a 10% w/v
solution of 3,H-1,2-
benzodithiole-3-one 1,1-dioxide in acetonitrile for the oxidation of the
phosphite linkages. The
thiation reaction step time was increased to 180 sec and preceded by the
normal capping step.
After cleavage from the CPG column and deblocicing in concentrated ammonium
hydroxide at
55 C (12-16 hr), the oligomers were recovered by precipitating with >3 volumes
of ethanol from
a 1 M NH40Ac solution. Phosphinate oligomers are prepared as described in U.S.
Patent
5,508,270.
[00243] Alkyl phosphonate oligomers are prepared as described in
U.S. Patent 4,469,863.
[00244] 3'-Deoxy-3'-methylene phosphonate oligomers are prepared
as described in U.S.
Patents 5,610,289 or 5,625,050.
[00245] Phosphoramidite oligomers are prepared as described in
U.S. Patent, 5,256,775 or
U.S. Patent 5,366,878.
CA 02504720 2011-09-28
77684-23
- 72 -
[00246] Alkylphosphonothioate oligomers are prepared as described in
published PCT
applications PCT/US94/00902 and PCT/US93/06976 (published as WO 94/17093 and
WO
94/02499, respectively).
[002471 3'-Deoxy-3'-amino phosphoramidate oligomers are prepared as
described in U.S.
Patent 5,476,925.
[00248] Phosphotriester oligomers are prepared as described in U.S. Patent
5,023,243.
[00249] Borano phosphate oligomers are prepared as described in U.S.
Patents 5,130,302
and 5,177,198.
[00250] Oligonucleosides: Methylenemethylimino linked oligonucleosides,
also identified
as MMI linked oligonucleosides, methylenedimethylhydrazo linked
oligonucleosides, also
identified as MDH linked oligonucleosides, and methylenecarbonylamino linked
oligonucleosides, also identified as amide-3 linked oligonucleosides, and
methyleneaminocarbonyl linked oligonucleosides, also identified as amide-4
linked oligonucleo-
sides, as well as mixed backbone oligomeric compounds having, for instance,
alternating MMI
and P=0 or P=S linkages are prepared as described in U.S. Patents 5,378,825,
5,386,023,
5,489,677, 5,602,240 and 5,610,289.
[00251] Formacetal and thioformacetal linked oligonucleosides are prepared
as described
in U.S. Patents 5,264,562 and 5,264,564.
(00252] Ethylene oxide linked oligonucleosides are prepared as described
in U.S. Patent
5,223,618.
Example 3
RNA Synthesis
[00253] In general, RNA synthesis chemistry is based on the selective
incorporation of
various protecting groups at strategic intermediary reactions. Although one of
ordinary skill in
the art will understand the use of protecting groups in organic synthesis, a
useful class of
protecting groups includes silyl ethers. In particular bulky silyl ethers are
used to protect the 5"-
hydroxyl in combination with an acid-labile orthoester protecting group on the
2"-hydroxyl. This
set of protecting groups is then used with standard solid-phase synthesis
technology. It is
important to lastly remove the acid labile orthoester protecting group after
all other synthetic
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
- 73 -
steps. Moreover, the early use of the silyl protecting groups during synthesis
ensures facile
removal when desired, without undesired deprotection of 2' hydroxyl.
[00254] Following this procedure for the sequential protection of the 5'-
hydroxyl in
combination with protection of the 2'-hydroxyl by protecting groups that are
differentially
removed and are differentially chemically labile, RNA oligonucleotides were
synthesized.
[00255] RNA oligonucleotides are synthesized in a stepwise fashion. Each
nucleotide is
added sequentially (3'- to 5'-direction) to a solid support-bound
oligonucleotide. The first
nucleoside at the 3'-end of the chain is covalently attached to a solid
support. The nucleotide
precursor, a ribonucleoside phosphoramidite, and activator are added, coupling
the second base
onto the 5'-end of the first nucleoside. The support is washed and any
unreacted 5'-hydroxyl
groups are capped with acetic anhydride to yield 5'-acetyl moieties. The
linkage is then oxidized
to the more stable and ultimately desired P(V) linkage. At the end of the
nucleotide addition
cycle, the 5'-sily1 group is cleaved with fluoride. The cycle is repeated for
each subsequent
nucleotide.
[00256] Following synthesis, the methyl protecting groups on the
phosphates are cleaved
in 30 minutes utilizing 1 M disodium-2-carbamoy1-2-cyanoethylene-1,1-
dithiolate trihydrate
(S2Na2) in DIVIT. The deprotection solution is washed from the solid support-
bound
oligonucleotide using water. The support is then treated with 40% methylamine
in water for 10
minutes at 55 C. This releases the RNA oligonucleotides into solution,
deprotects the exocyclic
amines, and modifies the 2'- groups. The oligonucleotides can be analyzed by
anion exchange
HPLC at this stage.
[00257] The 2'-orthoester groups are the last protecting groups to be
removed. The
ethylene glycol mono acetate orthoester protecting group developed by
Dharmacon Research,
Inc. (Lafayette, CO), is one example of a useful orthoester protecting group
which, has the
following important properties. It is stable to the conditions of nucleoside
phosphoramidite
synthesis and oligomer synthesis. However, after oligomer synthesis the
oligomer is treated with
methylamine which not only cleaves the oligomer from the solid support but
also removes the
acetyl groups from the ortho esters. The resulting 2-ethyl-hydroxyl
substituents on the orthoester
are less electron withdrawing than the acetylated precursor. As a result, the
modified orthoester
becomes more labile to acid-catalyzed hydrolysis. Specifically, the rate of
cleavage is
approximately 10 times faster after the acetyl groups are removed. Therefore,
this orthoester
possesses sufficient stability in order to be compatible with oligomer
synthesis and yet, when
CA 02504720 2011-09-28
77684-23
- 74 -
subsequently modified, permits deprotection to be carried out under relatively
mild aqueous
conditions compatible with the final RNA oligonucleotide product.
[00258] Additionally, methods of RNA synthesis are well known in the art
(Scaringe, S.
A. Ph.D. Thesis, University of Colorado, 1996; Scaringe, S. A., et al., J. Am.
Chem. Soc., 1998,
120, 11820-11821; Matteucci, M. D. and Caruthers, M. H. J. A171. Chem. Soc.,
1981, 103, 3185-
3191; Beaucage, S. L. and Caruthers, M. H. Tetrahedron Lett., 1981,22, 1859-
1862; Dahl, B. J.,
et al., Acta chem. Scand,. 1990, 44, 639-641; Reddy, M. P., et al.,
Tetrahedrom Lett., 1994, 25,
4311-4314; Wincott, F. et al., Nucleic Acids Res., 1995, 23, 2677-2684;
Griffin, B. E., et al.,
Tetrahedron, 1967, 23, 2301-2313; Griffin, B. E., et al., Tetrahedron, 1967,
23, 2315-2331).
Example 4
Synthesis of Chimeric Oligomers
[00259] Chimeric oligomers, oligonucleosides or mixed
oligomers/oligonucleosides of the
invention can be of several different types. These include a first type
wherein the "gap" segment
of linked nucleosides is positioned between 5' and 3' "wing" segments of
linked nucleosides and
a second "open end" type wherein the "gap" segment is located at either the 3'
or the 5' terminus
of the oligomeric compound. Oligomers of the first type are also known in the
art as "gapmers"
or gapped oligomers. Oligomers of the second type are also known in the art as
"hemimers" or
"wingmers".
[2'-0-Me]-[2'-deoxyl¨[2'-0-Me] Chimeric Phosphorothioate Oligomers
[00260] Chimeric oligomers having 2'-0-alkyl phosphorothioate and 2'-
deoxy
phosphorothioate oligomer segments are synthesized using an Applied
Biosystems* automated
DNA synthesizer Model 394, as above. Oligomers are synthesized using the
automated
synthesizer and 2'-deoxy-5'-dimethoxytrity1-3'-0-phosphorarnidite for the DNA
portion and 5'-
dimethoxytrity1-2'-0-methy1-3'-0-phosphoramidite for 5' and 3' wings. The
standard synthesis
cycle is modified by incorporating coupling steps with increased reaction
times for the 5'-
dimethoxytrity1-21-0-methy1-3'-0-phosphoramidite. The fully protected oligomer
is cleaved from
the support and deprotected in concentrated ammonia (NH4OH) for 12-16 hr at 55
C. The
deprotected oligo is then recovered by an appropriate method (precipitation,
column
chromatography, volume reduced in vacuo and analyzed spetrophotometrically for
yield and for
purity by capillary electrophoresis and by mass spectrometry.
*Trademark
CA 02504720 2011-09-28
77684-23
- 75 -
12'-0-(2-Methoxyethyl)]-42'-deoxyl¨[2'-0-(Methoxyethyl)] Chimeric
Phosphorothioate Oligomers
1002611 [2'-0-(2-methoxyethyl)]-[2'-deoxy]-4-21-0-(methoxyethyl)] chimeric
phosphorothioate oligomers were prepared as per the procedure above for the
2%0-methyl
chimeric oligomer, with the substitution of 2%0-(methoxyethyl) amidites for
the 2%0-methyl
amidites.
[2'-0-(2-Methoxyethyl)Phosphodiester)--12'-deoxy Phosphorothioate1-42T-0-(2-
Methoxyethyl) Phosphodiester] Chimeric Oligomers
1002621 [2'-0-(2-methoxyethyl phosphodiester)-42%deoxy phosphorothioate]-
42'-0-
(methoxyethyl) phosphodiester] chimeric oligomers are prepared as per the
above procedure for
the 2%0-methyl chimeric oligomer with the substitution of 2'-0-(methoxyethyl)
amidites for the
2%0-methyl amidites, oxidation with iodine to generate the phosphodiester
internucleotide
linkages within the wing portions of the chimeric structures and sulfurization
utilizing 3,H-1,2
benzodithiole-3-one 1,1 dioxide (Beaucage Reagent) to generate the
phosphorothioate
internucleotide linkages for the center gap.
[00263] Other chimeric oligomers, chimeric oligonucleosides and mixed
chimeric
oligomers/oligonucleosides are synthesized according to United States patent
5,623,065.
Example 5
Low Load t-butyloxycarbonylglycyl Merrifield resin
[00264] t-Butyloxyearbonylglycyl Merrifield resin may be synthesized
methods detailed
in U.S. Patent No. 5,700,922.
Example 6
OligoMer Having 2'-Substituted Oligomer Regions Flanking A Central V-Deoxy
Phosphoroselenate Oligomer Region
[00265] The aforementioned composition may be synthesized methods
detailed in U.S.
Patent No. 5,623,065.
Example 7
T(5'-amino)-GAc -CPAC _APAC _
T-T(Y-carboxy)-T(p)-Cz(p)-Az(p)-Gz(p)-Gly-O-Resin
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
- 76 -
[00266] The aforementioned composition may be synthesized methods detailed
in U.S.
Patent No. 5,700,922.
Example 8
N-Acetylglycyl-T(p)-T(p)-Cz(p)-T(p)-Cz(p)-Gz(p)-Cz(p)-COOH
[00267] The aforementioned composition may be synthesized methods detailed
in U.S.
Patent No. 5,700,922.
'Example 9
N-Acetylglycyl-T(p)-T(p)-C(p)-T(p)-C(p)-G(p)-C(p)-T(5'-amino)-G-C-A-T-T(3'-
carboxy)-
T(p)-C(p)-A(p)-G(p)-Gly-COOH
[00268] The aforementioned composition may be synthesized methods detailed
in U.S.
Patent No. 5,700,922.
Example 10
Synthesis of Hybrid Oligomer Phosphorothioates
[00269] Hybrid oligomeric phosphorthioates may be made by methods
disclosed in U.S.
Patent No. 5,652,355.
Example 11
Oligomer Having a Oligomer Regions Flanking Central Beta Oligomer Region
A. a-13 Mixed oligomer having non-symmetrical 3'-3' and 5'-5' linkages
[00270] a-P Mixed oligomers having non-symmetrical 3'-3' and 5'-5'
linkages may be
synthesized by methods taught in U.S. Patent No. 5,623,065.
B. a-13 Mixed oligomer having symmetrical 4 atom linkages
[00271] a-P Mixed oligomers having symmetrical 4 atom linkages may be
synthesized by
methods taught in U.S. Patent No. 5,623,065.
Example 12
Oligomer Having 2'-5' Phosphodiester Oligomer Regions Flanking A Central 2'-
Deoxy 3'-
5' Phosphorothioate Oligomer Region
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
- 77 -
[00272] The aforementioned compositions may be synthesized by methods
taught in U.S.
Patent No. 5,623,065.
Example 13
Macromolecule Having Regions Of Cyclobutyl Surrogate Nucleosides Linked By
Phosphodiester Linkages Flanking A Central 2'-Deoxy 3'-5' Phosphorothioate
Oligomer
Region
[00273] The aforementioned compositions may be synthesized by methods
taught in U.S.
Patent No. 5,623,065.
Example 14
Oligomer Having 4'-Thionucleotide Regions Flanking A Central 2'-Deoxy
Phosphorothioate Oligomer Region
[00274] The aforementioned compositions may be synthesized by methods
taught in U.S.
Patent No. 5,623,065.
Example 15
Oligomer Having 2'-Substituted Methyl Phosphonate Linked Oligomer Regions
Flanking
A Central 2'-Deoxy Phosphorothioate Oligomer Region
[00275] The aforementioned compositions may be synthesized by methods
taught in U.S.
Patent No. 5,623,065.
Example 16
Oligomer Having Phosphoramidate Linkages At The 3' And 5' Terminal Segments
Flanking A Diester linked Segment
[00276] The aforementioned compositions may be synthesized by methods
taught in U.S.
Patent No. 5,256,775.
Example 17
Oligomer Having 2'-0-Methyl-Nucleotide Segments Flanking A Deoxynucleotide
Segment
[00277] The aforementioned compositions may be synthesized by methods
taught in U.S.
Patent No. 5,013,830.
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
- 78 -
Example 18
Design and screening of duplexed oligomeric compounds targeting a target
[00278] In accordance with the present invention, a series of nucleic acid
duplexes
comprising the antisense oligomeric compounds of the present invention and
their complements
can be designed to target a target. The ends of the strands may be modified by
the addition of one
or more natural or modified nucleobases to form an overhang. The sense strand
of the dsRNA is
then designed and synthesized as the complement of the antisense strand and
may also contain
modifications or additions to either terminus. For example, in one embodiment,
both strands of
the dsRNA duplex would be complementary over the central nucleobases, each
having
overhangs at one or both termini.
[00279] For example, a duplex comprising an antisense strand having the
sequence
CGAGAGGCGGACGGGACCG (SEQ ID NO:1) and having a two-nucleobase overhang of
deoxythymidine(dT) would have the following structure:
5' cgagaggeggacgggaccgTT 3' Antisense Strand (SEQ ID NO:2)
1 1 1 1 1 1 1 1 1 1 1 1 1 1
1 1 1 1 1
3' TTgctctc cg cct gccctggc
5' Complement Strand (SEQ ID NO:3)
[00280] RNA strands of the duplex can be synthesized by methods disclosed
herein or
purchased from Dharmacon Research Inc., (Lafayette, CO). Once synthesized, the
complementary strands are annealed. The single strands are aliquoted and
diluted to a
concentration of 50 uM. Once diluted, 30 uL of each strand is combined with
15uL of a 5X
solution of annealing buffer. The final concentration of said buffer is 100 mM
potassium
acetate, 30 mM HEPES-KOH pH 7.4, and 2mM magnesium acetate. The final volume
is 75 uL.
This solution is incubated for 1 minute at 90 C and then centrifuged for 15
seconds. The tube is
allowed to sit for 1 hour at 37 C at which time the dsRNA duplexes are used in
experimentation.
The final concentration of the dsRNA duplex is 20 uM. This solution can be
stored frozen (-
20 C) and freeze-thawed up to 5 times.
[00281] Once prepared, the duplexed antisense oligomeric compounds are
evaluated for
their ability to modulate a target expression.
[00282] When cells reached 80% confluency, they are treated with duplexed
antisense
oligomeric compounds of the invention. For cells grown in 96-well plates,
wells are washed
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
- 79 -
once with 200 L OPTI-MEM-1 reduced-serum medium (Gibco BRL) and then treated
with 130
I, of OPTI-MEM-1 containing 12 pg/mL LIPOFECTIN (Gibco BRL) and the desired
duplex
antisense oligomeric compound at a final concentration of 200 nM. After 5
hours of treatment,
the medium is replaced with fresh medium. Cells are harvested 16 hours after
treatment, at
which time RNA is isolated and target reduction measured by RT-PCR.
Example 19
Oligomer Isolation
[00283] After cleavage from the controlled pore glass solid support and
deblocking in
concentrated ammonium hydroxide at 55 C for 12-16 hours, the oligomers or
oligonucleosides
are recovered by precipitation out of 1 M NH40Ac with >3 volumes of ethanol.
Synthesized
oligomers were analyzed by electrospray mass spectroscopy (molecular weight
determination)
and by capillary gel electrophoresis and judged to be at least 70% full length
material. The
relative amounts of phosphorothioate and phosphodiester linkages obtained in
the synthesis was
determined by the ratio of correct molecular weight relative to the ¨16 amu
product (+1-32 +/-
48). For some studies oligomers were purified by HPLC, as described by Chiang
et al., J. Biol.
Chem. 1991, 266, 18162-18171. Results obtained with HPLC-purified material
were similar to
those obtained with non-HPLC purified material.
Example 20
Oligomer Synthesis - 96 Well Plate Format
[00284] Oligomers were synthesized via solid phase P(III) phosphoramidite
chemistry on
an automated synthesizer capable of assembling 96 sequences simultaneously in
a 96-well
format. Phosphodiester internucleotide linkages were afforded by oxidation
with aqueous
iodine. Phosphorothio ate intemucleotide linkages were generated by
sulfurization utilizing 3,H-
1,2 benzodithiole-3-one 1,1 dioxide (Beaucage Reagent) in anhydrous
acetonitrile. Standard
base-protected beta-cyanoethyl-diiso-propyl phosphoramidites were purchased
from commercial
vendors (e.g. PE-Applied Biosystems, Foster City, CA, or Phannacia,
Piscataway, NJ). Non-
standard nucleosides are synthesized as per standard or patented methods. They
are utilized as
base protected beta-cyanoethyldiisopropyl phosphoramidites.
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
- 80 -
[00285] Oligomers were cleaved from support and deprotected with
concentrated NH4OH
at elevated temperature (55-60 C) for 12-16 hours and the released product
then dried in vacuo.
The dried product was then re-suspended in sterile water to afford a master
plate from which all
analytical and test plate samples are then diluted utilizing robotic
pipettors.
Example 21
Oligomer Analysis ¨ 96-Well Plate Format
[00286] The concentration of oligomer in each well was assessed by
dilution of samples
and UV absorption spectroscopy. The full-length integrity of the individual
products was
evaluated by capillary electrophoresis (CE) in either the 96-well format
(Beckman P/ACETM
MDQ) or, for individually prepared samples, on a commercial CE apparatus
(e.g., Beckman
P/ACETM 5000, ABI 270). Base and backbone composition was confirmed by mass
analysis of
the oligomeric compounds utilizing electrospray-mass spectroscopy. All assay
test plates were
diluted from the master plate using single and multi-channel robotic
pipettors. Plates were
judged to be acceptable if at least 85% of the oligomeric compounds on the
plate were at least
85% full length.
Example 22
Cell Culture and Oligomer Treatment
[00287] The effect of oligomeric compounds on target nucleic acid
expression can be
tested in any of a variety of cell types provided that the target nucleic acid
is present at
measurable levels. This can be routinely determined using, for example, PCR or
Northern blot
analysis. The following cell types are provided for illustrative purposes, but
other cell types can
be routinely used, provided that the target is expressed in the cell type
chosen. This can be
readily determined by methods routine in the art, for example Northern blot
analysis,
ribonuclease protection assays, or RT-PCR.
T-24 cells:
[00288] The human transitional cell bladder carcinoma cell line T-24 was
obtained from
the American Type Culture Collection (ATCC) (Manassas, VA). T-24 cells were
routinely
cultured in complete McCoy's 5A basal media (Invitrogen Corporation, Carlsbad,
CA)
supplemented with 10% fetal calf serum (Invitrogen Corporation, Carlsbad, CA),
penicillin 100
units per mL, and streptomycin 100 micrograms per mL (Invitrogen Corporation,
Carlsbad, CA).
CA 02504720 2011-09-28
77684-23
- 81 -
Cells were routinely passaged by trypsinization and dilution when they reached
90% confluence.
Cells were seeded into 96-well plates (Falcon-Primaria* #353872) at a density
of 7000 cells/well
for use in RT-PCR analysis.
[00289] For Northern blotting or other analysis, cells may be seeded onto
100 mm or other
standard tissue culture plates and treated similarly, using appropriate
volumes of medium and
oligomer.
A549 cells:
[00290] The human lung carcinoma cell line A549 was obtained from the
American Type
Culture Collection (ATCC) (Manassas, VA). A549 cells were routinely cultured
in D1VIEM
basal media (Invitrogen Corporation, Carlsbad, CA) supplemented with 10% fetal
calf serum
(Invitrogen Corporation, Carlsbad, CA), penicillin 100 units per inL, and
streptomycin 100
micrograms per mL (Invitrogen Corporation, Carlsbad, CA). Cells were routinely
passaged by
trypsinization and dilution when they reached 90% confluence.
NILDF cells:
[00291] Human neonatal dermal fibroblast (NHDF) were obtained from the
Clonetics
Corporation (Walkersville, MD). NHDFs were routinely maintained in Fibroblast
Growth
Medium (Clonetics Corporation, Walkersville, MI)) supplemented as recommended
by the
supplier. Cells were maintained for up to 10 passages as recommended by the
supplier.
HEK cells:
[00292] Human embryonic keratinocytes (HEK) were obtained from the
Clonetics
Corporation (Walkersville, MD). HEKs were routinely maintained in Keratinocyte
Growth
Medium (Clonetics Corporation, Walkersville, MD) formulated as recommended by
the supplier.
Cells were routinely maintained for up to 10 passages as recommended by the
supplier.
Treatment with antisense oligomeric compounds:
[00293] When cells reached 65-75% confluency, they were treated with
oligomer. For
cells grown in 96-well plates, wells were washed once with 100 pi, OPTI-MEMTm-
1 reduced-
serum medium (Invitrogen Corporation, Carlsbad, CA) and then treated with 130
p1. of OPTI-
MEMTm-1 containing 3.75 g/mL LEPOFECTINTm (Invitrogen Corporation, Carlsbad,
CA) and
the desired concentration of oligomer. Cells are treated and data are obtained
in triplicate. After
4-7 hours of treatment at 37 C, the medium was replaced with fresh medium.
Cells were
harvested 16-24 hours after oligomer treatment.
*Trade-iflaLk
CA 02504720 2011-09-28
77684-23
-82-
1002941 The concentration of oligomer used varies from cell line to cell
line. To
determine the optimal oligomer concentration for a particular cell line, the
cells are treated with a
positive control oligomer at a range of concentrations. For human cells the
positive control
oligomer is selected from either ISIS 13920 (TCCGTCATCGCTCCTCAGGG, SEQ ID NO:
4)
which is targeted to human H-ras, or ISIS 18078, (GTGCGCGCGAGCCCGAAATC, SEQ ID
NO: 5) which is targeted to human Jun-N-terminal kinase-2 (JNK2). Both
controls are 21-0-
methoxyethyl gapmers (2'-0-methoxyethyls shown in bold) with a
phosphorothioate backbone.
For mouse or rat cells the positive control oligomer is ISIS 15770,
ATGCATTCTGCCCCCAAGGA (SEQ ID NO: 6) a 2'-0-methoxyethyl gapmer (2'-0-
methoxyethyls shown in bold) with a phosphorothioate backbone which is
targeted to both
mouse and rat c-raf. The concentration of positive control oligomer that
results in 80% inhibition
of c-H-ras (for ISIS 13920), JNK2 (for ISIS 18078) or c-raf (for ISIS 15770)
mRNA is then
utilized as the screening concentration for new oligomers in subsequent
experiments for that cell
line. If 80% inhibition is not achieved, the lowest concentration of positive
control oligomer that
results in 60% inhibition of c-H-ras, JNK2 or c-raf mRNA is then utilized as
the oligomer
screening concentration in subsequent experiments for that cell line. If 60%
inhibition is not
achieved, that particular cell line is deemed as unsuitable for oligomer
transfection experiments.
The concentrations of antisense oligomers used herein are from 50 nM to 300
nM.
Example 23
Analysis of Oligomer Inhibition of a Target Expression
[00295] Modulation of a target expression can be assayed in a variety of
ways known in
the art. For example, a target mRNA levels can be quantitated by, e.g.,
Northern blot analysis,
competitive polymerase chain reaction (PCR), or real-time PCR (RT-PCR). Real-
time
quantitative PCR is presently preferred. RNA analysis can be performed on
total cellular RNA
or poly(A)+ mRNA. The preferred method of RNA analysis of the present
invention is the use of
total cellular RNA as described in other examples herein. Methods of RNA
isolation are well
known in the art. Northern blot analysis is also routine in the art. Real-time
quantitative (PCR)
can be conveniently accomplished using the commercially available ABI PRISMTm
7600,7700,
or 7900 Sequence Detection System, available from PE-Applied Biosystems,
Foster City, CA
and used according to manufacturer's instructions.
*Trade -mark
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
- 83 - =
[00296] Protein levels of a target can be quantitated in a variety of ways
well known in the
art, such as immunoprecipitation, Western blot analysis (immunoblotting),
enzyme-linked
immunosorbent assay (ELISA) or fluorescence-activated cell sorting (FACS).
Antibodies
directed to a target can be identified and obtained from a variety of sources,
such as the MSRS
catalog of antibodies (Aerie Corporation, Birmingham, MI), or can be prepared
via conventional
monoclonal or polyclonal antibody generation methods well known in the art.
Example 24
Design of Phenotypic Assays and in vivo Studies for the Use of a Target
Inhibitors
Phenotypic assays
[00297] Once a target inhibitors have been identified by the methods
disclosed herein, the
oligomeric compounds are further investigated in one or more phenotypic
assays, each having
measurable endpoints predictive of efficacy in the treatment of a particular
disease state or
condition.
[00298] Phenotypic assays, kits and reagents for their use are well known
to those skilled
in the art and are herein used to investigate the role and/or association of a
target in health and
disease. Representative phenotypic assays, which can be purchased from any one
of several
commercial vendors, include those for determining cell viability,
cytotoxicity, proliferation or
cell survival (Molecular Probes, Eugene, OR; PerkinElmer, Boston, MA), protein-
based assays
including enzymatic assays (Panvera, LLC, Madison, 'WI; BD Biosciences,
Franklin Lakes, NJ;
Oncogene Research Products, San Diego, CA), cell regulation, signal
transduction,
inflammation, oxidative processes and apoptosis (Assay Designs Inc., Ann
Arbor, MI),
triglyceride accumulation (Sigma-Aldrich, St. Louis, MO), angiogenesis assays,
tube formation
assays, cytokine and hormone assays and metabolic assays (Chemicon
International Inc.,
Temecula, CA; Amersham Biosciences, Piscataway, NJ).
[00299] In one non-limiting example, cells determined to be appropriate
for a particular
phenotypic assay (i.e., MCF-7 cells selected for breast cancer studies;
adipocytes for obesity
studies) are treated with a target inhibitors identified from the in vitro
studies as well as control
compounds at optimal concentrations which are determined by the methods
described above. At
the end of the treatment period, treated and untreated cells are analyzed by
one or more methods
specific for the assay to determine phenotypic outcomes and endpoints.
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
- 84 -
Phenotypic endpoints include changes in cell morphology over time or treatment
dose as well as
changes in levels of cellular components such as proteins, lipids, nucleic
acids, hormones,
saccharides or metals. Measurements of cellular status which include pH, stage
of the cell cycle,
intake or excretion of biological indicators by the cell, are also endpoints
of interest.
[00300] Analysis of the geneotype of the cell (measurement of the
expression of one or
more of the genes of the cell) after treatment is also used as an indicator of
the efficacy or
potency of the target inhibitors. Hallmark genes, or those genes suspected to
be associated with
a specific disease state, condition, or phenotype, are measured in both
treated and untreated cells.
In vivo studies
[00301] The individual subjects of the in vivo studies described herein
are warm-blooded
vertebrate animals, which includes humans.
The clinical trial is subjected to rigorous controls to ensure that
individuals are not unnecessarily
put at risk and that they are fully informed about their role in the study.
[00302] To account for the psychological effects of receiving treatments,
volunteers are
randomly given placebo or a target inhibitor. Furthermore, to prevent the
doctors from being
biased in treatments, they are not infonned as to whether the medication they
are administering is
a a target inhibitor or a placebo. Using this randomization approach, each
volunteer has the same
chance of being given either the new treatment or the placebo.
[00303] Volunteers receive either the a target inhibitor or placebo for
eight week period
with biological parameters associated with the indicated disease state or
condition being
measured at the beginning (baseline measurements before any treatment), end
(after the final
treatment), and at regular intervals during the study period. Such
measurements include the
levels of nucleic acid molecules encoding a target or a target protein levels
in body fluids, tissues
or organs compared to pre-treatment levels. Other measurements include, but
are not limited to,
indices of the disease state or condition being treated, body weight, blood
pressure, serum titers
of phannacologic indicators of disease or toxicity as well as ADME
(absorption, distribution,
metabolism and excretion) measurements.
Information recorded for each patient includes age (years), gender, height
(cm), family history of
disease state or condition (yes/no), motivation rating (some/moderate/great)
and number and type
of previous treatment regimens for the indicated disease or condition.
[00304] Volunteers taking part in this study are healthy adults (age 18 to
65 years) and
roughly an equal number of males and females participate in the study.
Volunteers with certain
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
- 85 -
characteristics are equally distributed for placebo and a target inhibitor
treatment. In general, the
volunteers treated with placebo have little or no response to treatment,
whereas the volunteers
treated with the target inhibitor show positive trends in their disease state
or condition index at
the conclusion of the study.
Example 25
RNA Isolation
Poly(A)+ mRNA isolation
[00305] Poly(A)+ mR_NA was isolated according to Miura et al., (Clin.
Chem., 1996, 42,
1758-1764). Other methods for poly(A)+ mRNA isolation are routine in the art.
Briefly, for
cells grown on 96-well plates, growth medium was removed from the cells and
each well was
washed with 200 pi, cold PBS. 60 pL lysis buffer (10 mM Tris-HC1, pH 7.6, 1 mM
EDTA, 0.5
M NaC1, 0.5% NP-40, 20 mM vanadyl-ribonucleoside complex) was added to each
well, the
plate was gently agitated and then incubated at room temperature for five
minutes. 55 111_, of
lysate was transferred to Oligo d(T) coated 96-well plates (AGCT Inc., Irvine
CA). Plates were
incubated for 60 minutes at room temperature, washed 3 times with 2001.IL of
wash buffer (10
mM Tris-HC1 pH 7.6, 1 mM EDTA, 0.3 M NaC1). After the final wash, the plate
was blotted on
paper towels to remove excess wash buffer and then air-dried for 5 minutes. 60
L of elution
buffer (5 mM Tris-HC1 pH 7.6), preheated to 70 C, was added to each well, the
plate was
incubated on a 90 C hot plate for 5 minutes, and the eluate was then
transferred to a fresh 96-
well plate.
[00306] Cells grown on 100 mm or other standard plates may be treated
similarly, using
appropriate volumes of all solutions.
Total RNA Isolation
[00307] Total RNA was isolated using an RNEASY 96TM kit and buffers
purchased from
Qiagen Inc. (Valencia, CA) following the manufacturer's recommended
procedures. Briefly, for
cells grown on 96-well plates, growth medium was removed from the cells and
each well was
washed with 200 pL cold PBS. 150 lb Buffer RLT was added to each well and the
plate
vigorously agitated for 20 seconds. 150 L of 70% ethanol was then added to
each well and the
contents mixed by pipetting three times up and down. The samples were then
transferred to the
RNEASY 96TM well plate attached to a QIAVACTM manifold fitted with a waste
collection tray
CA 02504720 2011-09-28
77684-23
- 86 -
and attached to a vacuum source. Vacuum was applied for 1 minute. 500 pit of
Buffer RW1
was added to each well of the RNEASY 96TM plate and incubated for 15 minutes
and the vacuum
was again applied for I minute. An additional 500 )11_, of Buffer RW1 was
added to each well of
the RNEASY 96TM plate and the vacuum was applied for 2 minutes. 1 niL of
Buffer RPE was
then added to each well of the RNEASY 96TM plate and the vacuum applied for a
period of 90
seconds. The Buffer RPE wash was then repeated and the vacuum was applied for
an additional
3 minutes. The plate was then removed from the QIAVACTM manifold and blotted
dry on paper
towels. The plate was then re-attached to the QIAVACTm manifold fitted with a
collection tube
rack containing 1.2 mL collection tubes. RNA was then eluted by pipetting 140
lit of RNAse
free water into each well, incubating 1 minute, and then applying the vacuum
for 3 minutes.
4C
[00308] The repetitive pipetting and elution steps may be automated using
a QIAGEN
Bio-Robot 9604 (Qiagen, Inc., Valencia CA). Essentially, after lysing of the
cells on the culture
plate, the plate is transferred to the robot deck where the pipetting, DNase
treatment and elution
steps are carried out.
Example 26
Real-time Quantitative PCR Analysis of a Target mRNA Levels
[00309] Quantitation of a target mRNA levels was accomplished by real-
time quantitative
PCR using the ABI PRISMTm 7600, 7700, or 7900 Sequence Detection System (PE-
Applied
Biosystems, Foster City, CA) according to manufacturer's instructions. This is
a closed-tube,
non-gel-based, fluorescence detection system which allows high-throughput
quantitation of
polymerase chain reaction (PCR) products in real-time. As opposed to standard
PCR in which
amplification products are quantitated after the PCR is completed, products in
real-time
quantitative PCR are quantitated as they accumulate. This is accomplished by
including in the
PCR reaction an oligomer probe that anneals specifically between the forward
and reverse PCR
primers, and contains two fluorescent dyes. A reporter dye (e.g., FAM or JOE,
obtained from
either PE-Applied Biosystems, Foster City, CA, Operon Technologies Inc.,
Alameda, CA or
Integrated DNA Technologies Inc., Coralville, IA) is attached to the 5' end of
the probe and a
quencher dye (e.g., TAMRA, obtained from either PE-Applied Biosystems, Foster
City, CA,
Operon Technologies Inc., Alameda, CA or Integrated DNA Technologies Inc.,
Coralville, IA) is
attached to the 3' end of the probe. When the probe and dyes are intact,
reporter dye emission is
*Trade -mark
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
- 87 -
quenched by the proximity of the 3' quencher dye. During amplification,
annealing of the probe
to the target sequence creates a substrate that can be cleaved by the 5'-
exonuclease activity of
Taq polymerase. During the extension phase of the PCR amplification cycle,
cleavage of the
probe by Taq polymerase releases the reporter dye from the remainder of the
probe (and hence
from the quencher moiety) and a sequence-specific fluorescent signal is
generated. With each
cycle, additional reporter dye molecules are cleaved from their respective
probes, and the
fluorescence intensity is monitored at regular intervals by laser optics built
into the Al3I
PRISMTm Sequence Detection System. In each assay, a series of parallel
reactions containing
serial dilutions of mRNA from untreated control samples generates a standard
curve that is used
to quantitate the percent inhibition after antisense oligomer treatment of
test samples.
[00310] Prior to quantitative PCR analysis, primer-probe sets specific to
the target gene
being measured are evaluated for their ability to be "multiplexed" with a
GAPDH amplification
reaction. In multiplexing, both the target gene and the internal standard gene
GAPDH are
amplified concurrently in a single sample. In this analysis, mRNA isolated
from untreated cells
is serially diluted. Each dilution is amplified in the presence of primer-
probe sets specific for
GAPDH only, target gene only ("single-plexing"), or both (multiplexing).
Following PCR
amplification, standard curves of GAPDH and target mRNA signal as a function
of dilution are
generated from both the single-plexed and multiplexed samples. If both the
slope and correlation
coefficient of the GAPDH and target signals generated from the multiplexed
samples fall within
10% of their corresponding values generated from the single-plexed samples,
the primer-probe
set specific for that target is deemed multiplexable. Other methods of PCR are
also known in the
art.
[00311] PCR reagents were obtained from 1nvitrogen Corporation, (Carlsbad,
CA). RT-
PCR reactions were carried out by adding 201AL PCR cocktail (2.5x PCR buffer
minus MgC12,
6.6 mM MgCl2, 37511M each of dATP, dCTP, dCTP and dGTP, 375 nM each of forward
primer
and reverse primer, 125 nM of probe, 4 Units RNAse inhibitor, 1.25 Units
PLATINUM Taq, 5
Units MuLV reverse transcriptase, and 2.5x ROX dye) to 96-well plates
containing 301.1L total
RNA solution (20-200 ng). The RT reaction was carried out by incubation for 30
minutes at
48 C. Following a 10 minute incubation at 95 C to activate the PLATINUM Taq,
40 cycles of
a two-step PCR protocol were carried out: 95 C for 15 seconds (denaturation)
followed by 60 C
for 1.5 minutes (annealing/extension).
CA 02504720 2011-09-28
77684-23
- 88 -
[00312] Gene target quantities obtained by real time RT-PCR are normalized
using either
the expression level of GAPDH, a gene whose expression is constant, or by
quantifying total
RNA using RiboGreenTm (Molecular Probes, Inc. Eugene, OR). GAPDH expression is
quantified by real time RT-PCR, by being run simultaneously with the target,
multiplexing, or
separately. Total RNA is quantified using RiboGreenTM RNA quantification
reagent (Molecular
Probes, Inc. Eugene, OR). Methods of RNA quantification by RiboGreenTM are
taught in Jones,
L.J., et al, (Analytical Biochemistry, 1998, 265, 368-374).
[00313] In this assay, 170 !IL of RiboGreenTm working reagent (RiboGreenTM
reagent
diluted 1:350 in 10mM Tris-HC1, 1 mM EDTA, pH 7.5) is pipetted into a 96-well
plate
containing 30 tiL purified, cellular RNA. The plate is read in a
CytoFluor*4000 (PE Applied
Biosystems) with excitation at 485nm and emission at 530nm.
[00314] Probes and primers are designed to hybridize to a human a target
sequence, using
published sequence information.
Example 27
Northern Blot Analysis of a Target mRNA Levels
[00315] Eighteen hours after treatment, cell monolayers were washed twice
with cold PBS
and lysed in 1 inL RNAZOLTM (TEL-TEST "B" Inc., Friendswood, TX). Total RNA
was
prepared following manufacturer's recommended protocols. Twenty micrograms of
total RNA
was fractionated by electrophoresis through 1.2% agarose gels containing 1.1%
formaldehyde
using a MOPS buffer system (AMRESCO, Inc. Solon, OH). RNA was transferred from
the gel
to HYBONDTm-N+ nylon membranes (Arnersham Pharmacia Biotech, Piscataway, NJ)
by
overnight capillary transfer using a Northern/Southern Transfer buffer system
(TEL-TEST "B"
Inc., Friendswood, TX). RNA transfer was confirmed by UV visualization.
Membranes were
fixed by UV cross-linking using a STRATALINKERTm UV Crosslinker 2400
(Stratagene, Inc,
La Jolla, CA) and then probed using QUICKHYBTM hybridization solution
(Stratagene, La Jolla,
CA) using manufacturer's recommendations for stringent conditions.
[00316] To detect human a target, a human a target specific primer probe
set is prepared
by PCR To normalize for variations in loading and transfer efficiency
membranes are stripped
and probed for human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) RNA
(Clontech,
Palo Alto, CA).
*Trade-mark
CA 02504720 2005-05-02
WO 2004/044138 PCT/US2003/035074
- 89 -
[00317] Hybridized membranes were visualized and quantitated using a
PHOSPHORIMAGERTm and IMAGEQUANTTm Software V3.3 (Molecular Dynamics,
Sunnyvale, CA). Data was normalized to GAPDH levels in untreated controls.
Example 28
Inhibition of Human a Target Expression by Oligomers
[00318] In accordance with the present invention, a series of oligomeric
compounds are
designed to target different regions of the human target RNA. The oligomeric
compounds are
analyzed for their effect on human target mRNA levels by quantitative real-
time PCR as
described in other examples herein. Data are averages from three experiments.
The target
regions to which these preferred sequences are complementary are herein
referred to as
"preferred target segments" and are therefore preferred for targeting by
oligomeric compounds of
the present invention. The sequences represent the reverse complement of the
preferred
antisense oligomeric compounds.
[00319] As these "preferred target segments" have been found by
experimentation to be
open to, and accessible for, hybridization with the antisense oligomeric
compounds of the
present invention, one of skill in the art will recognize or be able to
ascertain, using no more than
routine experimentation, further embodiments of the invention that encompass
other oligomeric
compounds that specifically hybridize to these preferred target segments and
consequently
inhibit the expression of a target.
[00320] According to the present invention, antisense oligomeric compounds
include
antisense oligomeric compounds, antisense oligomers, ribozymes, external guide
sequence
(EGS) oligomers, alternate splicers, primers, probes, and other short
oligomeric compounds that
hybridize to at least a portion of the target nucleic acid.
Example 29
Western Blot Analysis of a Target Protein Levels
[00321] Western blot analysis (immunoblot analysis) is carried out using
standard
methods. Cells are harvested 16-20 h after oligomer treatment, washed once
with PBS,
suspended in Laemmli buffer (100 ul/well), boiled for 5 minutes and loaded on
a 16% SDS-
PAGE gel. Gels are run for 1.5 hours at 150 V, and transferred to membrane for
western
CA 02504720 2006-10-10
,63189-631
- 90 -
blotting. Appropriate primary antibody directed to a target is used, with a
radiolabeled or
fluorescently labeled secondary antibody directed against the primary antibody
species. Bands
are visualized using a PHOSPHORMAGERTm (Molecular Dynamics, Sunnyvale CA).
Example 30
Blockmer walk of 5 2'-0-methy modified nucleosides in the antisense strand of
siRNA's
assayed for PTEN mRNA levels against untreated control
[0319] The antisense (AS) strands listed below having SEQ ID NO: 8 were
individually
duplexed with the sense (S) strand having SEQ ID NO: 7 and the activity was
measured to
determine the relative positional effect of the 5 modifications.
SEQ ID NO:/ISIS NO Sequence
7/271790(S) 5'-CAAAUCCAGAGGCUAGCAG-dTdT-3'
8/271071(AS) 3'-dTdT-GUUUAGGUCUCCGAUCGTJC-5'
9/271072(AS) 3'-dTdT-GUUUAGGUCUCCGAUCGUC-5'
10/271073(AS) 3'-dTdT-GU1JUAGGUCUCCGAUCGUC-5'
11/271074(AS) 3'-dTdT-GUUUAGGUCUCCGAUCGUC-5'
12/271075(AS) 3'-dTdT-GUUUAGGUCUCCGAUCGUC-5'
[0320] Underlined nucleosides are 2'-0-methyl modified nucleosides, dT's
are deoxy
thymidines, all other nucleosides are ribonucleosides and all intemucleoside
linkages are
phosphodiester.
SEQ ID NO: Sequence (5'-3')
31 CAAAUCCAGAGGCUAGCAGYT
61 CUGCUAGCCUCUGGAUUUG'TT
[0321] The siRNA's having 5, 2'-0-methyl groups at least 2 positions
removed from the
5'-end of the antisense strand reduced PTEN mRNA levels to from 25 to 35% of
untreated
control. The remaining 2 constructs increased PTEN mRNA levels above untreated
control.
Example 31
CA 02504720 2013-10-02
91 -
Solid block of 2%0-methyl modified nucleosides in the antisense strand of
siRNA's assayed
for PTEN mRNA levels against untreated control
103221 The antisense strands listed below having SEQ to NO:9 were
individually
duplexed with the sense strand having SEQ ID NO:7 and the activity was
measured to determine
the relative effect of adding either 9 or 14, 2'4D-methyl modified nucleosides
at the 3'-end of the
resulting siRNA's.
SEQ ID NO/ISIS NO Sequence
7/271790 (S) 5'-CAAAUCCAGAGGCT.TAGCAG-dTdT-3'
13/271079(AS) 3'-U-LIOUTJUAGGUCUCCGAUCOUC-5'
14/271081(AS) 3'4.315GUUUAGGUCUMGA1JCGUC-5'
[0323] Underlined nucleosides are 2'-0-methyl modified nucleosides,
dT's are deoxy
thyrnidines, all other nucleosides are ribonucleosides and all intemucleoside
linkages are
phosphodiester.
SEQ ID NO: Sequence (5%3')
15 CUGCUAGCCUCUGGAUULTGUU
[0324] The siRNA having 9, 2'-0-methyl nucleosides reduced PTEN mRNA
levels to
about 40% of untreated control whereas the construct having 14, 2'-0-methyl
nucleosides only
reduced PTEN mRNA levels to about 98% of control.
Example 32
2%0-methy blockmers (siRNA vs asRNA)
[0325] A selies of blockmers were prepared as duplexed siRNA's and
also as single
strand asRNA's. The antisense strands were identical for the siRNA's and the
asRNA's.
, Underlined nucleosides are 2'-0-methyl modified nucleosides, all other
nucleosides are
ribonucleosides and all internucIeoside linkages for the AS strands are
phosphorothioate and the
internucleoside linkages for the S strand are phosphodiester.
SEQ ID NOilISIS NO Sequence 5'-3'
16/308746 (S) 5'-AAGUAAGGACCAGAGACAAA-3' (PO)
CA 02504720 2013-10-02
- 92 .
17/303912 (AS) 3'-UUCALTUCCUGGUCUCUGUUU-P 5' (PS)
18/316449 (AS) 3'-UUCAUUCCIJOGUCUCUGIJUU-P 5', (PS)
19/335223 (AS) 3'-'01TCAT_RiCCUGGUCTXUGUIX-P 5' (PS)
20/335224 (AS) 3'-UUCALTUCCUGGUCUCUGUIJU-P 5' (PS)
21/335225 (AS) 3'-TJUCAUUCCUGGUCUCUGUUTJ-P 5' (PS)
22/335226 (AS) 3c1JUCALTTJCCUGGUCUCUGUTJTJ-P 5' (PS)
23/335227 (AS) 3'-UUCAULTCCUGGUCUCUGUULT-P 5' (PS)
241335228 (AS) 3'4.113CAITUCCIJUGUCUCUGU1JU-P 5' (PS)
r SAO I":01µ10: Sequence (5'-3)
16 AAGUAAGGACCAGAGACAAA.
17 UUTIGUCUCUGGUCCUTACUU
[0326] The constructs were assayed for activity for measuring the
levels of PTEN niRNA
in T24 cells against untreated control levels. All of the asRNA's and siRNA's
showed activity
with the asRNA's having the best activity in each case. A clear dose response
was seen for all
the siRNA constructs (20, 40, 80 and 150 Inn doses). There was a good dose
response for the
asRNA's for 50, 100 and 200 am doses. In general the siRNA's were more active
in this system
at lower doses than the asRNA's and at the 150 am dose was able to reduce PTEN
rriRNA levels
rto from 15 to 40% of untreated control. The unmodified siRNA 303912 reduced
PTEN mRNA
levels to about 19% of the untreated control.
Example 33
3'-ilernimer 2'ØmetbyIsirea constructs
[03271 Blunt and overhanging siRNA constructs were prepared having a
block of 5, 2'-0-
methyl nucleosides at the 3'-terminus.
=
SEO ID NO:/ISIS NO Sequence (overhangs) . =
7/271790 (S) 5'-CAAAUCCAGAGGCLIAGCAG-dTdT-3'
25/xxxxxk (AS) 3'1JUGUUUAGGUCUCCGAUCGUC-5'
SEC) ID NOVISIS NO . Sequence (blunt)
CA 02504720 2006-10-10
,63189-631
- 93
26/xxxxx(S) 5'-GUCAAAUCCAGAGGCUAGCAG-3'
27/xxxxxx (AS) 3'-CAG1JUUA00UCUCCGAUCGUC-5'
[0328] Underlined nucleosides are 2'-0-methyl modified nucleosides, all
other
nucleosides are ribonucleosides and all intemucleoside linkages for the AS
strands are
phosphorothioate and the internucleoside linkages for the S strand are
phosphodiester.
SEQ ID NO: Sequence (5'-3')
26 GUCAAAUCCAGAGGCUAGCAG
28 CUGCUAGCCUCUGGAUUUGAC
[0329] The construct having overhangs was able to reduce PTEN mRNA levels
to about
36% of untreated control whereas the blunt ended construct was able to reduce
the PTEN mRNA
levels to about 27% of untreated control.
Example 34
siRNA hemimer constructs
[0330] Three siRNA hemimer constructs were prepared and examined in a
PTEN assay.
The hemimer constructs had 7, 2'-0-methyl nucleosides at the 3'-end. The
hemimer was put in
the sense strand only, the antisense strand only and in both strands to
compare the effects.
SEQ ID NOASIS NO Constructs (overhangs)
29/271068 (S) 5'-CAAAUCCAGAGGCUAGCAGUU-3'
30/ (AS) 3'-UUGUUUAGGUCUCCGAUCGUC-5'
29/271068 (S) 5'-CAAAUCCAGAGGCUAGCAGUU-3'
15/ (AS) 3'-UUGUUUAGGUCUCCGAUCGUC-5'
32/ (S) 5'-CAAAUCCAGAGGCUAGCAGUU-3'
30/ (AS) 3'-i_TUGUUUAGGUCUCCGAUCGUC-5'
[0331] Underlined nucleosides are 2'-0-methyl modified nucleosides, all
other
nucleosides are ribonucleosides and all internucleoside linkages for the AS
strands are
phosphorothioate and the intemucleoside linkages for the S strand are
phosphodiester.
SEQ ID NO: Sequence (5'-3')
32 CAAAUCCAGAGGCUAGCAGUU
CA 02504720 2006-10-10
6318-631
- 94
[0332] The construct having the 7, 2'-0-methyl nucleosides only in the
antisense strand
reduced PTEN mRNA levels to about 23% of untreated control. The construct
having the 7, 2'-
0-methyl nucleosides in both strands reduced the PTEN mRNA levels to about 25%
of untreated
control. When the 7, 2'-0-methyl nucleosides were only in the sense strand
PTEN mRNA levels
were reduced to about 31% of untreated control.
Example 35
siRNA vs asRNA hemimers
[0333] Four hemimers were prepared and assayed as the asRNA's and also as
the
siRNA's in a PEEN assay. The unmodified sequence was also tested as the asRNA
and as the
siRNA.
SEQ ID NO:/ISIS NO Constructs (overhangs)
16/308746 (S) 5'-AAGUAAGGACCAGAGACAAA-3'
17/303912 (AS) 3'-UUCAUUCCUGGUCUCUGUUU-P 5'
18/316449 (AS) 3'-UUCAUUCCUGGUCUCUGUIJU-P 5'
33/319013 (AS) 3'-UUCAUUCCUGGUCUCUGUUU-P 5'
34/319014 (AS) 3'-UUCAUUCCUGGUCUCUGLTUU-P 5'
35/319015 (AS) 3'-UUCAUUCCUGGUCUCUGUUU-P 5'
[0334] Underlined nucleosides are 21-0-methyl modified nucleosides, all
other
nucleosides are ribonucleosides and all intemucleoside linkages for the AS
strands are
phosphorothioate and the intemucleoside linkages for the S strand are
phosphodiester.
Construct siRNA (%mRNA) asRNA (%mlINA)
17/303912 21 32
18/316449 17 26
33/319013 34 32
34/319014 54 42
35/319015 51 42
[0335] Percent mRNA is relative to untreated control in PTEN assay.
CA 02504720 2013-10-02
-95 -
Example 36
Representative siRNA's prepared having 2'0-Me gapmers
[0336] The following antisense strands of siRNA's were hybridized to the
complementary full phosphodiester sense strand. Bolded monomers are 2'-0Me
containing
monomers. Underlined monomers have PS linkages. Monomers without underlines
have PO
linkages.
SEQ ID NO/ISIS NO
36/300852 5'-0H-CUG CUA GCC UCU GGA UUU GA
(0Me/P0)
36/300853 5'-P- CUG CUA GCC UCU GGA UM GA (0Me/P0)
37/300854 5'-0H- CUG CUA GCC UCU GGA UUU GA (0Me/P0)
38/300855 5'-P- CUG CUA GCC UCU GOA UUU GA (0Me/PO/PS)
39/300856 5'0H- CUA GCC UCU GGA UUU GA
10Me/PO/PS)
40/300858 5'-0H- CUG CUA GCC UCU GGA UUU GA (0Me/PS)
40/300859 5'-P- CUG CUA GCC UCU OGA UUU GA (0MeJPS)
41/300860 5'-01-l- CUA GCC UCU GGA UM GA
(0Me/PS)
42/303913 5'-0H- GUC UCTJ GGU CCU 'CAC UU
(0Me/PS)
43/303915 5'-0H- UUU UGU UCC UU (0Me/PS)
44/303917 5'-OH- CUG GUC CULT ACU UCC CC
(01v1eTPS)
45/308743
5'P- UUU GUC UCU GGU CCU UAC UU (0Me/a)
46/308744 5'-P- UCU CUG GUC CUU ACUUCC CC
(0Me/PS)
47/328795 UUU GUC UCU GGU CCU UAC UU_ (0Me/PS)
Example 38
Representative siRNA's prepared having T-F-methyl modified nucleosides and
Various
structural motifs
f0337] The following antisense strands of siRNA's were hybridized to the
complementary full phosphodiester sense strand. Bolded monomers are 2'-F
containing
monomers. Underlined monomers have PS linkages. Monomers without underlines
have Po
linkages. Sense stands (S) are listed 3' -> 5'. Antisense strands (AS) are
listed 5' -> 3'.
CA 02504720 2006-10-10
,63189-631
- 96
SEQ ID NO/ISIS NO Seauence Features
48/279471 AS niCUG 'CUA GmenC UmCU GGA UUU G dTdT (F/PO)
49/279467 S 'CAA AULT 'TAG AGG InCUA GinCA G dTdT (F/PO)
50/319018 AS UU UGU CUC UGG UCC UUA CUU (F/PO)
51/319019 S AAG UAA GGA CCA GAG ACA AA (F/PO)
52/319022 AS UU UGU CUC UGG UCC UUA CUU (F/PS)
53/333749 AS UT] UGU CUC UGG UCC U1JA CUU (F/OH/PS)
54/333750 AS UT] UGU CUC UGG UCC UUA CUU (F/OH/PS)
54/333751 AS UU UGU CUC UGG UCC UUA CUU (F/OH/PS)
55/333752 AS UU UGU CUC UGG UCC UUA CUU (F/OH/PS)
56/333753 AS UU UGU CUC UGG UCC UUA CUU (F/OH/PS)
57/333754 AS UU UGU CUC UGG UCC UUA CUU (F/OH/PS)
58/333756 AS UT] UGU CUC UGG UCC UUA CUU (F/OH/PS)
59/334253 AS UU UGU CUC UGG UCC UUA CUU (F/OH/PS)
60/334254 AS UU UGU CUC UGG UCC UUA CUU (F/OH/PS)
56/334255 AS UU UGU CUC UGG UCC UUA CUU (F/OH/PS)
62/334256 AS UU UGU CUC UGG UCC UUA CUU (F/OH/PS)
57/334257 AS UU UGU CUC UGG UCC UUA CUU (F/OH/PS)
63/317466 AS UUU GUC UCU GGU CCU UAC UU PS
64/317468 AS UUU GUC UCU GGU CCU UAC UU PO
65/317502 AS UUU GUC UCU GGU CCU UAC UU PS
[0338] Results from a PTEN assay are presented below. Percent mRNA is
relative to
untreated control in PTEN assay.
% mRNA
Construct 100 nM asRNA 100 nM siRNA
303912 35 18
317466 28
317408 18
317502 21
334254 33
CA 02504720 2006-10-10
63189-631
-97-
333756 42 19
334257 34 23
334255 44 21
333752 42 18
334253 38 15
333750 43 21
333749 34 21
Example 39
Representative siRNA's prepared having 2'-F and 2'-Orde modified nucleosides
[0339] The following antisense strands of siRNA's were hybridized to the
complementary full phosphodiester sense strand. Where the antisense strand has
a n. 3'-
terminus the corresponding sense strand also has a 3'-TT (deoxyT's). Bolded
monomers are 2'-F
containing monomers. Underlined monomers are 2'-0Me. Monomers that are not
bolded or
underlined do not contain a sugar surrogate. Linkages are shown in the
parenthesis after the
sequence.
SEQ ID NO./ ISIS NO. Composition (5' 3') Features
66/283546 CUG CUA GCC UCU GGAIRJU GU.dT-3' (0Me/F/P0)
67/336240 UUU GUC UCU GGU CCU UAC UU (0Me/F/PS)
Example 40
Representative siRNA's prepared having 2'-MOE modified nucleosides assayed for
PTEN
mRNA levels against untreated control
[0340] The following antisense strands of siRNA's were hybridized to the
complementary full phosphodiester sense strand. Bolded monomers are 2'-MOE (2'-
methoxyethoxy). Linkages are phosphothioate.
SEQ ID NO Composition PTEN mRNA level
(%UTC) 100 nM
oligomer
68. ITUC AUU CCU GOLJ CUC UGU
69 TJUCALTUCCUGGUCUCUGUUU 50
70 INC AUU CCU GGU CUC UGIT
CA 02504720 2006-10-10
6 3 1 8 9 6 3 1
-98-
71 UUC AUU CCU GGU CUC UGU UU 43
72 UUC AUU CCU GGU CUC UGU UU 42
73 UUC AUU CCU GGU CUC UGU UU 47
74 UUC AUU CCU GGU CUC UGU UU 63
75 UUC AUU CCU GGU CUC UGU UU 106
Example 41
Analysis of oligonucleotide inhibition of Survivin expression
[0341] Antisense modulation of Survivin expression can be assayed in
a variety
of ways known in the art. For example, Survivin mRNA levels can be quantitated
by,
e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or
real-time
PCR (RT-PCR). Real-time quantitative PCR is presently preferred. RNA analysis
can
be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation
are
taught in, for example, Ausubel, F.M. et al., Current Protocols in Molecular
Biology,
Volume 1, pp. 4.1.1-4.2.9 and 4.5.1-4.5.3, John Wiley & Sons, Inc., 1993.
Northern blot
analysis is routine in the art and is taught in, for example, Ausubel, F.M. et
al., Current
Protocols in Molecular Biology, Volume 1, pp. 4.2.1-4.2.9, John Wiley & Sons,
Inc.,
1996. Real-time quantitative (PCR)-can be conveniently accomplished using the
commercially available ABI PRISM 7700 Sequence Detection System, available
from
PE-Applied Biosystems, Foster City, CA and used according to manufacturer's
instructions. Other methods of PCR are also known in the art.
[0342] Survivin protein levels can be quantitated in a variety of
ways well known
in the art, such as immunoprecipitation, Western blot analysis
(immunoblotting), ELISA
or fluorescence-activated cell sorting (FACS). Antibodies directed to Survivin
can be
identified and obtained from a variety of sources, such as the MSRS catalog of
antibodies
(Aerie Corporation, Birmingham, MI), or can be prepared via conventional
antibody
generation methods. Methods for preparation of polyclonal antisera are taught
in, for
example, Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume
2, pp.
11.12.1-11.12.9, John Wiley & Sons, Inc., 1997. Preparation of monoclonal
antibodies is
taught in, for example, Ausubel, F.M. et al., Current Protocols in Molecular
Biology,
Volume 2, pp. 11.4.1-11.11.5, John Wiley & Sons, Inc., 1997
CA 02504720 2006-10-10
1
=
SEQUENCE LISTING
<110> ISIS Pharmaceuticals, Inc.
Baker, Brenda F.
Eldrup, Anne B.
Manoharan, Muthiah
Bhat, Balkrishen
Griffey, Richard H.
Swayze, Eric E.
Crooke, Stanley T.
<120> CHIMERIC OLIGOMERIC COMPOUNDS AND THEIR USE IN GENE MODULATION
<130> ISIS-5622
<140> 2,504,720
<141> 2003-11-04
<150> PCT/US2003/035074
<151> 2003-11-04
<150> US 10/078,949
<151> 2002-02-20
<150> US 09/479,783
<151> 2000-01-07
<150> US 08/870,608
<151> 1997-06-06
<150> US 08/659,440
<151> 1996-06-06
<150> US 60/423,760
<151> 2002-11-05
<150> US 60/503,271
<151> 2003-09-15
<160> 75
<170> PatentIn version 3.3
<210> 1
<211> 19
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<400> 1
cgagaggcgg acgggaccg 19
<210> 2
<211> 21
CA 02504720 2006-10-10
2
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<400> 2
cgagaggcgg acgggaccgt t 21
<210> 3
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<400> 3
cggtcccgtc cgcctctcgt t 21
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc_feature
<222> (1)..(3)
<223> 2'-0-methoxyethyl
<220>
<221> misc_feature
<222> (13)..(20)
<223> 2T-0-methoxyethyl
<400> 4
tccgtcatcg ctcctcaggg 20
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc_feature
<222> (1)..(5)
<223> 2'-0-methoxyethyl
<220>
<221> misc_feature
CA 02504720 2006-10-10
3
<222> (16)..(20)
<223> 2'-0-methoxyethyl
<400> 5
gtgcgcgcga gcccgaaatc 20
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc_feature
<222> (1)..(5)
<223> 2'-0-methoxyethyl
<220>
<221> misc_feature
<222> (16)..(20)
<223> 2T-0-methoxyethyl
<400> 6
atgcattctg cccccaagga 20
<210> 7
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc_feature
<222> (20)..(21)
<223> deoxy thymidines
<400> 7
caaauccaga ggcuagcagt t 21
<210> 8
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc_feature
<222> (1)..(5)
<223> 2'-0-methyl
CA 02504720 2006-10-10
4
<220>
<221> misc_feature
<222> (20)..(21)
<223> deoxy thymidines
<400> 8
cugcuagccu cuggauuugt t 21
<210> 9
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc_feature
<222> (2)..(6)
<223> 2'-0-methyl
<220>
<221> misc_feature
<222> (20)..(21)
<223> deoxy thymidines
<400> 9
cugcuagccu cuggauuugt t 21
<210> 10
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc_feature
<222> (3)..(7)
<223> 2'-0-methyl
<220>
<221> misc_feature
<222> (20)..(21)
<223> deoxy thymidines
<400> 10
cugcuagccu cuggauuugt t 21
<210> 11
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
CA 02504720 2006-10-10
<220>
<221> misc feature
<222> (4)..(8)
<223> 2'-0-methyl
<220>
<221> misc_feature
<222> (20)..(21)
<223> deoxy thymidines
<400> 11
cugcuagccu cuggauuugt t 21
<210> 12
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc feature
<222> (5)..(9)
<223> 2'-0-methyl
<220>
<221> misc feature
<222> (20)..(21)
<223> deoxy thymidines
<400> 12
cugcuagccu cuggauuugt t 21
<210> 13
<211> 21
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc_feature
<222> (13)..(21)
<223> 2'-0-methyl modified nucleoside
<400> 13
cugcuagccu cuggauuugu u 21
<210> 14
<211> 21
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
CA 02504720 2006-10-10
6
<220>
<221> misc feature
<222> (8)..(21)
<223> 2'-0-methyl modified nucleoside
<400> 14
cugcuagccu cuggauuugu u 21
<210> 15
<211> 21
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<400> 15
cugcuagccu cuggauuugu u 21
<210> 16
<211> 20
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<400> 16
aaguaaggac cagagacaaa 20
<210> 17
<211> 20
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<400> 17
uuugucucug guccuuacuu 20
<210> 18
<211> 20
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc_feature
<222> (18)..(20)
<223> 2'-0-methyl modified nucleoside
<400> 18
uuugucucug guccuuacuu 20
CA 02504720 2006-10-10
7
<210> 19
<211> 20
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc feature
<222> (15)..(17)
<223> 2'-0-methyl modified nucleoside
<400> 19
uuugucucug guccuuacuu 20
<210> 20
<211> 20
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc feature
<222> (12)..(14)
<223> 2'-0-methyl modified nucleoside
<400> 20
uuugucucug guccuuacuu 20
<210> 21
<211> 20
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc_feature
<222> (9)..(11)
<223> 2'-0-methyl modified nucleoside
<400> 21
uuugucucug guccuuacuu 20
<210> 22
<211> 20
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
CA 02504720 2006-10-10
8
<220>
<221> misc feature
<222> (6)..(8)
<223> 2'-0-methyl modified nucleoside
<400> 22
uuugucucug guccuuacuu 20
<210> 23
<211> 20
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc feature
<222> (3)..(5)
<223> 2'-0-methyl modified nucleoside
<400> 23
uuugucucug guccuuacuu 20
<210> 24
<211> 20
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc feature
<222> (1)..(3)
<223> 2'-0-methyl modified nucleoside
<400> 24
uuugucucug guccuuacuu 20
<210> 25
<211> 21
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc feature
<222> (1)..(5)
<223> 2'-0-methyl modified nucleoside
<400> 25
cugcuagccu cuggauuugu u 21
CA 02504720 2006-10-10
9
<210> 26
<211> 21
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<400> 26
gucaaaucca gaggcuagca g 21
<210> 27
<211> 21
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc feature
<222> (1)..(5)
<223> 2T-0-methyl modified nucleoside
<400> 27
cugcuagccu cuggauuuga c 21
<210> 28
<211> 21
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<400> 28
cugcuagccu cuggauuuga c 21
<210> 29
<211> 21
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc_feature
<222> (15)..(21)
<223> 2'-0-methyl modified nucleoside
<400> 29
caaauccaga ggcuagcagu u 21
<210> 30
<211> 21
CA 02504720 2006-10-10
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc feature
<222> (15)..(21)
<223> 2'-0-methyl modified nucleoside
<400> 30
cugcuagccu cuggauuugu u 21
<210> 31
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<400> 31
caaauccaga ggcuagcagt t 21
<210> 32
<211> 21
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<400> 32
caaauccaga ggcuagcagu u 21
<210> 33
<211> 20
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc feature
<222> (16)..(20)
<223> 2'-0-methyl modified nucleoside
<400> 33
uuugucucug guccuuacuu 20
<210> 34
<211> 20
<212> RNA
<213> Artificial Sequence
CA 02504720 2006-10-10
11
<220>
<223> Synthetic Construct
<220>
<221> misc_feature
<222> (14)..(20)
<223> 2'-0-methyl modified nucleoside
<400> 34
uuugucucug guccuuacuu 20
<210> 35
<211> 20
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc_feature
<222> (12)..(20)
<223> 2'-0-methyl modified nucleoside
<400> 35
uuugucucug guccuuacuu 20
<210> 36
<211> 20
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc feature
<222> (4)..(7)
<223> 2'-0-Me containing monomers
<220>
<221> misc feature
<222> (17)..(20)
<223> 2'-0-Me containing monomers
<400> 36
cugcuagccu cuggauuuga 20
<210> 37
<211> 20
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
CA 02504720 2006-10-10
12
<220>
<221> misc_feature
<222> (1)..(4)
<223> 2'-0-Me containing monomers
<220>
<221> misc_feature
<222> (17)..(20)
<223> 2'-0-Me containing monomers
<400> 37
cugcuagccu cuggauuuga 20
<210> 38
<211> 20
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc_feature
<222> (2)..(3)
<223> PS linkage
<220>
<221> misc_feature
<222> (4)..(7)
<223> 2'-0-Me containing monomers with PS linkages
<220>
<221> misc_feature
<222> (17)..(17)
<223> 2'-0-Me containing monomers
<220>
<221> misc_feature
<222> (18)..(20)
<223> 2'-0-Me containing monomers with PS linkages
<400> 38
cugcuagccu cuggauuuga 20
<210> 39
<211> 17
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc_feature
<222> (1)..(1)
<223> 2'-0-Me containing monomers
CA 02504720 2006-10-10
13
<220>
<221> misc_feature
<222> (2)..(4)
<223> 2'-0-Me containing monomers with PS linkages
<220>
<221> misc_feature
<222> (14)..(14)
<223> 2'-0-Me containing monomers
<220>
<221> misc_feature
<222> (15)..(17)
<223> 2'-0-Me containing monomers with PS linkages
<400> 39
cuagccucug gauuuga 17
<210> 40
<211> 20
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc_feature
<222> (2)..(20)
<223> PS linkages
<220>
<221> misc_feature
<222> (4)..(7)
<223> 2'-0-Me containing monomers
<220>
<221> misc_feature
<222> (17)..(20)
<223> 2'-0-Me containing monomers
<400> 40
cugcuagccu cuggauuuga 20
<210> 41
<211> 17
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc_feature
<222> (1)..(4)
<223> 2'-0-Me containing monomers
CA 02504720 2006-10-10
14
<220>
<221> misc_feature
<222> (2)..(17)
<223> monomers with PS linkages
<220>
<221> misc_feature
<222> (14)..(17)
<223> 2'-0-Me containing monomers
<400> 41
cuagccucug gauuuga 17
<210> 42
<211> 17
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc_feature
<222> (1)..(4)
<223> 2'-0-Me containing monomers
<220>
<221> misc_feature
<222> (2)..(17)
<223> monomers having PS linkages
<220>
<221> misc_feature
<222> (14)..(17)
<223> 2'-0-Me containing monomers
<400> 42
gucucugguc cuuacuu 17
<210> 43
<211> 17
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc_feature
<222> (1)..(4)
<223> 2'-0-Me containing monomers
<220>
<221> misc_feature
<222> (2)..(17)
<223> monomers with PS linkages
CA 02504720 2006-10-10
<220>
<221> misc feature
<222> (14)..(17)
<223> 2'-0-Me containing monomers
<400> 43
uuuugucucu gguccuu 17
<210> 44
<211> 17
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc_feature
<222> (1)..(4)
<223> 2'-0-Me containing monomers
<220>
<221> misc feature
<222> (2)..(17)
<223> monomers having PS linkages
<220>
<221> misc feature
<222> (14)..(17)
<223> 2'-0-Me containing monomers
<400> 44
cugguccuua cuucccc 17
<210> 45
<211> 20
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc feature
<222> (1)..(3)
<223> 2'-0-Me containing monomers
<220>
<221> misc feature
<222> (2)..(20)
<223> monomers having PS linkages
<220>
<221> misc feature
<222> (18)..(20)
<223> 2'-0-Me containing monomers
CA 02504720 2006-10-10
16
<400> 45
uuugucucug guccuuacuu 20
<210> 46
<211> 20
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc_feature
<222> (1)..(5)
<223> 2'-0-Me containing monomers
<220>
<221> misc_feature
<222> (2)..(20)
<223> monomers having PS linkages
<220>
<221> misc_feature
<222> (16)..(20)
<223> 2'-0-Me containing monomers
<400> 46
ucucuggucc uuacuucccc 20
<210> 47
<211> 20
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc_feature
<222> (2)..(20)
<223> monomers having PS linkages
<220>
<221> misc_feature
<222> (4)..(7)
<223> 2'-0-Me containing monomers
<220>
<221> misc_feature
<222> (17)..(20)
<223> 2'-0-Me containing monomers
<400> 47
uuugucucug guccuuacuu 20
<210> 48
<211> 21
CA 02504720 2006-10-10
17
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc feature
<222> (1)..(19)
<223> 2'-F containing monomers
<220>
<221> misc_feature
<222> (1)..(1)
<223> 5-methyl cytidine
<220>
<221> misc_feature
<222> (4)..(4)
<223> 5-methyl cytidine
<220>
<221> misc_feature
<222> (7)..(8)
<223> 5-methyl cytidine
<220>
<221> misc_feature
<222> (10)..(10)
<223> 5-methyl cytidine
<220>
<221> misc_feature
<222> (20)..(21)
<223> deoxy thymidines
<400> 48
cugcuagccu cuggauuugt t 21
<210> 49
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc_feature
<222> (1)..(2)
<223> deoxy thymidines
<220>
<221> misc_feature
<222> (3)..(21)
<223> 2'-F containing monomers
<220>
<221> misc_feature
CA 02504720 2006-10-10
18
=
<222> (5)..(5)
<223> 5-methyl cytidine
<220>
<221> misc feature
<222> (9)..(9)
<223> 5-methyl cytidine
<220>
<221> misc_feature
<222> (15)..(16)
<223> 5-methyl cytidine
<220>
<221> misc_feature
<222> (21)..(21)
<223> 5-methyl cytidine
<400> 49
ttgacgaucg gagaccuaaa c 21
<210> 50
<211> 20
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc_feature
<222> (1)..(20)
<223> 2'-F containing monomers
<220>
<221> misc_feature
<222> (1)..(20)
<223> 2'-F containing monomers
<400> 50
uuugucucug guccuuacuu 20
<210> 51
<211> 20
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc_feature
<222> (1)..(20)
<223> 2'-F containing monomers
<400> 51
aaacagagac caggaaugaa 20
CA 02504720 2006-10-10
19
<210> 52
<211> 20
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc_feature
<222> (1)..(20)
<223> 2'-F containing monomers with PS linkages
<400> 52
uuugucucug guccuuacuu 20
<210> 53
<211> 20
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc_feature
<222> (1)..(14)
<223> monomers with PS linkages
<220>
<221> misc feature
<222> (15)7.(17)
<223> 2'-F containing monomers with PS linkages
<220>
<221> misc feature
<222> (18)7.(20)
<223> monomers with PS linkages
<400> 53
uuugucucug guccuuacuu 20
<210> 54
<211> 20
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc_feature
<222> (1)..(11)
<223> monomers with PS linkages
<220>
<221> misc_feature
CA 02504720 2006-10-10
<222> (12)..(14)
<223> 2'-F containing monomers with PS linkages
<220>
<221> misc_feature
<222> (15)..(20)
<223> monomers with PS linkages
<400> 54
uuugucucug guccuuacuu 20
<210> 55
<211> 20
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc_feature
<222> (1)..(5)
<223> monomers with PS linkages
<220>
<221> misc_feature
<222> (6)..(8)
<223> 2'-F containing monomers with PS linkages
<220>
<221> misc_feature
<222> (9)..(20)
<223> monomers with PS linkages
<400> 55
uuugucucug guccuuacuu 20
<210> 56
<211> 20
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc_feature
<222> (1)..(2)
<223> monomers with PS linkages
<220>
<221> misc_feature
<222> (3)..(5)
<223> 2'-F containing monomers with PS linkages
<220>
<221> misc_feature
CA 02504720 2006-10-10
21
=
<222> (6)..(20)
<223> monomers with PS linkages
<400> 56
uuugucucug guccuuacuu 20
<210> 57
<211> 20
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc feature
<222> (1)..(3)
<223> 2'-F containing monomers with PS linkages
<220>
<221> misc feature
<222> (4)..(20)
<223> Monomers with PS linkages
<400> 57
uuugucucug guccuuacuu 20
<210> 58
<211> 20
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc feature
<222> (1)..(17)
<223> Monomers with PS linkages
<220>
<221> misc_feature
<222> (18)..(20)
<223> 2'-F containing monomers with PS linkages
<400> 58
uuugucucug guccuuacuu 20
<210> 59
<211> 20
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
CA 02504720 2006-10-10
22
=
<220>
<221> misc_feature
<222> (1)..(8)
<223> Monomers with PS linkages
<220>
<221> misc feature
<222> (9)..(11)
<223> 2'-F containing monomers with PS linkages
<220>
<221> misc_feature
<222> (12)..(20)
<223> Monomers with PS linkages
<400> 59
uuugucucug guccuuacuu 20
<210> 60
<211> 20
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc_feature
<222> (1)..(15)
<223> Monomers with PS linkages
<220>
<221> misc_feature
<222> (16)..(20)
<223> 2'-F containing monomers with PS linkages
<400> 60
uuugucucug guccuuacuu 20
<210> 61
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<400> 61
cugcuagccu cuggauuugt t 21
<210> 62
<211> 20
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
CA 02504720 2006-10-10
23
<220>
<221> misc_feature
<222> (1)..(2)
<223> Monomers with PS linkages
<220>
<221> misc_feature
<222> (3)..(5)
<223> 2'-F containing monomers with PS linkages
<220>
<221> misc_feature
<222> (6)..(11)
<223> Monomers with PS linkages
<220>
<221> misc feature
<222> (12)7.(14)
<223> 2'-F containing monomers with PS linkages
<220>
<221> misc_feature
<222> (15)..(20)
<223> Monomers with PS linkages
<400> 62
uuugucucug guccuuacuu 20
<210> 63
<211> 20
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc_feature
<222> (1)..(3)
<223> 2'-F containing monomers with PS linkages
<220>
<221> misc_feature
<222> (4)..(17)
<223> Monomers with PS linkages
<220>
<221> misc_feature
<222> (18)..(19)
<223> 2'-F containing monomers with PS linkages
<220>
<221> misc feature
<222> (20)7.(20)
<223> Monomers with PS linkages
<400> 63
uuugucucug guccuuacuu 20
CA 02504720 2006-10-10
24
=
<210> 64
<211> 20
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc feature
<222> (1)..(3)
<223> 2'-F containing monomers
<220>
<221> misc_feature
<222> (18)..(19)
<223> 2'-F containing monomers
<400> 64
uuugucucug guccuuacuu 20
<210> 65
<211> 20
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc_feature
<222> (1)..(3)
<223> 2'-F containing monomers with PS linkages
<220>
<221> misc_feature
<222> (4)..(4)
<223> Monomer with PS linkage
<220>
<221> misc_feature
<222> (5)..(7)
<223> 2'-F containing monomers with PS linkages
<220>
<221> misc_feature
<222> (8)..(13)
<223> Monomers with PS linkages
<220>
<221> misc_feature
<222> (14)..(16)
<223> 2'-F containing monomers with PS linkages
<220>
<221> misc_feature
<222> (17)..(17)
<223> Monomer with PS linkage
CA 02504720 2006-10-10
<220>
<221> misc_feature
<222> (18)..(19)
<223> 2'-F containing monomers with PS linkages
<220>
<221> misc feature
<222> (20)..(20)
<223> Monomer with PS linkage
<400> 65
uuugucucug guccuuacuu 20
<210> 66
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc_feature
<222> (1)..(2)
<223> 2'-F containing monomers
<220>
<221> misc_feature
<222> (3)..(3)
<223> 2'-0Me
<220>
<221> misc_feature
<222> (4)..(5)
<223> 2'-F containing monomers
<220>
<221> misc_feature
<222> (6)..(7)
<223> 2'-0Me
<220>
<221> misc_feature
<222> (8)..(12)
<223> 2'-F containing monomers
<220>
<221> misc_feature
<222> (13)..(15)
<223> 2'-0Me
<220>
<221> misc_feature
<222> (16)..(18)
<223> 2'-F containing monomers
<220>
<221> misc_feature
CA 02504720 2006-10-10
26
<222> (19)..(20)
<223> 2'-0Me
<400> 66
cugcuagccu cuggauuugu t 21
<210> 67
<211> 20
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc feature
<222> (1)..(20)
<223> PS linkages
<220>
<221> misc_feature
<222> (8)..(9)
<223> 2'-F containing monomers
<220>
<221> misc_feature
<222> (12)..(13)
<223> 2'-F containing monomers
<220>
<221> misc_feature
<222> (18)..(20)
<223> 2'-0Me
<400> 67
uuugucucug guccuuacuu 20 .
<210> 68
<211> 20
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<400> 68
uucauuccug gucucuguuu 20
<210> 69
<211> 20
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
CA 02504720 2006-10-10
_
27
.
<220>
<221> misc_feature
<222> (1)..(3)
<223> 2'-methoxyethoxy
<400> 69
uucauuccug gucucuguuu 20
<210> 70
<211> 20
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc_feature
<222> (4)..(6)
<223> 2'-methoxyethoxy
<400> 70
uucauuccug gucucuguuu 20
<210> 71
<211> 20
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc_feature
<222> (7)..(9)
<223> 2'-methoxyethoxy
<400> 71
uucauuccug gucucuguuu 20
<210> 72
<211> 20
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc_feature
<222> (10)..(12)
<223> 2'-methoxyethoxy
<400> 72
uucauuccug gucucuguuu 20
CA 02504720 2006-10-10
=
28
<210> 73
<211> 20
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc_feature
<222> (13)..(15)
<223> 2'-methoxyethoxy
<400> 73
uucauuccug gucucuguuu 20
<210> 74
<211> 20
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc_feature
<222> (16)..(18)
<223> 2'-methoxyethoxy
<400> 74
uucauuccug gucucuguuu 20
<210> 75
<211> 20
<212> RNA
<213> Artificial Sequence
<220>
<223> Synthetic Construct
<220>
<221> misc_feature
<222> (18)..(20)
<223> 2'-methoxyethoxy
<400> 75
uucauuccug gucucuguuu 20
