Note: Descriptions are shown in the official language in which they were submitted.
DEMANDE OU BREVET VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVET COMPREND
PLUS D'UN TOME.
CECI EST LE TOME 1 DE 2
CONTENANT LES PAGES 1 A 337
NOTE : Pour les tomes additionels, veuillez contacter le Bureau canadien des
brevets
JUMBO APPLICATIONS/PATENTS
THIS SECTION OF THE APPLICATION/PATENT CONTAINS MORE THAN ONE
VOLUME
THIS IS VOLUME 1 OF 2
CONTAINING PAGES 1 TO 337
NOTE: For additional volumes, please contact the Canadian Patent Office
NOM DU FICHIER / FILE NAME
NOTE POUR LE TOME / VOLUME NOTE:
CA 02505322 2005-05-06
DESCRIPTION
RECEPTOR FUNCTION REC~JI~.TOR
Technical Field
The present invention relates to a GPR40 receptor
function regulator comprising carboxylic acid having an
aromatic ring or a derivative thereof and a novel compound
having a GPR40 receptor function regulating action.
Background Art
An amino acid sequence of GPR40 derived from human and
io DNA encoding same are described (W02000/22129 and Biochem.
Biophys. Res. Commun. 1997, Oct 20; 239 (2)).
It is known that carboxylic acid having an aromatic ring
and a derivative thereof have various physiological activities.
Alkanoic acid derivatives are known (JP-A-2002-265457).
15 Isoxazole derivatives having an insulin secretagogue
action and a hypoglycemic action, which are useful for the
prophylaxis or treatment of diabetes and the like, are known
(JP-A-2002-212171).
Nitrogen-containing 5-membered heterocyclic compounds
2o having a hypoglycemic action or a hypolipidemic action, which
are useful for the prophylaxis or treatment of diabetes and
the like, are known (JP-A-2001-226350).
Alkoxyiminoalkanoic acid derivatives having a
hypoglycemic action or a hypolipidemic action, which are
25 useful for the prophylaxis or treatment of diabetes and the
like, are known (JP-A-2001-199971).
Oxyiminoalkanoic acid derivatives having a hypoglycemic
action or a hypolipidemic action, which are useful for the
prophylaxis or treatment of diabetes and the like, are known
30 (Jp-A-2000-198772).
1,3-Azole derivatives having a retinoid-related receptor
function regulating action, which are useful for the
prophylaxis or treatment of diabetic complications and the
like, are known (JP-A-2000-80086).
1
CA 02505322 2005-05-06
Oxyiminoalkanoic acid derivatives having a hypoglycemic
action or a hypolipidemic action, which are useful for the
prophylaxis or treatment of diabetes and the like, are known
(JP-A-2000-34266).
Oxazole derivatives having an insulin secretagogue action
or a hypoglycemic action, which are useful for the prophylaxis
or treatment of diabetes and the like, are known (JP-A-09-
323983) .
Benzofuran derivatives having a hypoglycemic and
to hypolipidemic action are known (JP-A-08-311065).
Fatty acids have been reported to bind with GPR40
(W002/057783) .
Heretofore, non-peptidic low-molecular agonist or
antagonist to GPR40 receptor has not been known. Thus, there
15 is a demand on the development of a superior GRP40 receptor
function regulator.
Disclosure of the Invention
The present invention aims at providing a GPR40 receptor
function regulator useful as an insulin secretagogue or agent
2° for the prophylaxis or treatment of diabetes and the like and
a novel compound having a GPR40 receptor function regulating
action.
The present inventors have conducted various studies and
found that, a carboxylic acid having an aromatic ring and a
2s derivative thereof unexpectedly have a superior GPR40 receptor
agonist activity based on a specific chemical structure
thereof, and further have superior properties as
pharmaceutical products such as stability and the like, and
provide safe and useful pharmaceutical agents as agents for
so the prophylaxis or treatment of GPR40 receptor-related
pathology or diseases in mammal, based on which findings
completed the present invention.
Accordingly, the present invention relates to
[1] a GPR40 receptor function regulator comprising a compound
2
CA 02505322 2005-05-06
having an aromatic ring and a group capable of releasing
cation,
[2] the regulator of the above-mentioned [1] which comprises a
carboxylic acid having an aromatic ring, or a derivative
thereof,
[3] the regulator of the above-mentioned [1], which comprises
a carboxylic acid having two or more aromatic rings, or a
derivative thereof,
[4] the regulator of the above-mentioned [1], which comprises
io a compound represented by the formula
X
P D Y L (I')
wherein ring P is an aromatic ring optionally having
substituent(s), ring Q is an aromatic ring optionally further
having substituent(s) besides
i5 Y L
X and Y are each a spacer, and
L
is a group capable of releasing canon, or a salt thereof or a
prodrug thereof,
2° [5] the regulator of the above-mentioned [2], which comprises
a compound represented by the formula
X
P D Y-COOH ( I )
wherein ring P is an aromatic ring optionally having
substituent(s), ring Q is an aromatic ring optionally further
25 having substituent(s) besides -Y-COOH, X and Y are each a
spacer, and -Y-COOH is substituted at any position on ring Q,
3
CA 02505322 2005-05-06
or a salt thereof or a prodrug thereof,
[6] the regulator of the above-mentioned [1], wherein the
group capable of releasing cation is (1) a 5-membered
heterocyclic group capable of releasing cation, (2) a carboxyl
s group, (3) a sulfonic acid group, (4) a sulfamoyl group
optionally mono-substituted by a C1_q alkyl group, (5) a
phosphonic acid group, (6) a carbamoyl group optionally mono-
substituted by a C1-4 alkyl group, (7) a C
alkylsulfonylthiocarbamoyl group or (8) a
trifluoromethanesulfonic acid amido group (-NF~iS02CF3) ,
[7] the regulator of the above-mentioned [1), wherein the
group capable of releasing cation is
O O
~NH TNH
O N H S N H N~O~O NII~O~S O
. .
O ~ O '
O O I I N H N ~ O
S NH NH NH N,O~S O NH
S O
O
N H
N, \ O N,
N O HO N:~
H ' O H
[8] the regulator of the above-mentioned [1], which is an
is insulin secretion modulator, a hypoglycemic agent or a
pancreatic (3 cell protector,
[9] the regulator of the above-mentioned [1], which is an
agent for the prophylaxis or treatment of diabetes, impaired
glucose tolerance, ketosis, acidosis, diabetic neuropathy,
2o diabetic nephropathy, diabetic retinopathy, hyperlipidemia,
genital disorder, skin disease, arthropathy, osteopenia,
arteriosclerosis, thrombotic disease, dyspepsia, memory and
learning disorder, obesity, hypoglycemia, hypertension, edema,
4
CA 02505322 2005-05-06
insulin resistance syndrome, unstable diabetes, fatty atrophy,
insulin allergy, insulinoma, lipotoxicity, hyperinsulinemia,
or cancers,
[10] a compound represented by the formula
/ P
A >--Xa / (I-1)
s \ 4 R
I CH2COOH
Ra
wherein ring A is a benzene ring optionally having
substituent(s), ring R is a phenylene group optionally having
substituent(s), Xa is a spacer other than an alkylene group, p
and q are each a Co_9 carbon chain optionally having
1° substituent(s), and Ra is a hydrogen atom or a substituent, or
a salt thereof,
[11) a prodrug of the compound of the above-mentioned [10] or
a salt thereof,
[12] the compound of the above-mentioned [10], wherein the
Is partial structural formula
A I P,
--\
4
is
A I A
/ /
or
the substituent that ring A optionally has is (1) a halogen
2o atom, ( 2 ) a Cl_6 alkyl group, ( 3 ) a Cl_6 alkoxy group, ( 4 ) a C6-is
aryl group optionally substituted by a halogen atom, a C1_6
alkyl or a C1-6 alkoxy, (5) a C5-lq aryloxy group or (6) a C,-16
aralkyloxy group,
the substituent that ring R optionally has is a halogen atom
CA 02505322 2005-05-06
or a C1-6 alkyl group,
Ra is a hydrogen atom, and
the spacer represented by Xa is an oxygen atom,
[13] a compound represented by the formula
/ ~ ~ (I-2)
s ~ R
CH2COOH
Ra
wherein ring S1 is a benzene ring having substituent(s) having
a benzene ring, ring R is a phenylene group optionally having
substituent(s), and Ra is a hydrogen atom or a substituent, or
a salt thereof, except (i) 2-ethoxy-4-[[2-[(5-methyl-2-phenyl-
io 4-oxazolyl)methoxy]phenyl]methoxy]benzenepropanoic acid, (ii)
2-ethoxy-4-[[3-[(5-methyl-2-phenyl-4-
oxazolyl)methoxy]phenyl]methoxy]benzenepropanoic acid, (iii)
2-ethoxy-4-[[4-[(5-methyl-2-phenyl-4-
oxazolyl)methoxy]phenyl]methoxy]benzenepropanoic acid, and
is (iv) 4-[[4-[(5-methyl-2-phenyl-4-
oxazolyl)methoxy]phenyl]methoxy]benzenepropanoic acid,
[14] a prodrug of the compound of the above-mentioned [13] or
a salt thereof,
[15] the compound of the above-mentioned [13], wherein the
2° substituent(s) having a benzene ring is a substituent
represented by the formula: R11-EZ- (R11 is a phenyl group, an
indanyl group or a naphthyl group, each optionally having
substituent(s), and E2 is a bond or a spacer), and the spacer
represented by EZ is - (CHZ) ml-W1- (CH2) m2- (ml and m2 are each an
2s integer of 0 to 3, Wl is -0-, -N (RZ) -, -S-, -CO- or -CO-N (R3) -,
and R2 and R3 are each a hydrogen atom or a C1_6 alkyl group) ,
[16] the compound of the above-mentioned [13], which is
represented by the formula
6
CA 02505322 2005-05-06
Rlla Ea Sla
\ 0 \ R~s
(I-2A)
~COzH
R"
wherein Rlla is a phenyl group having 1 or 2 substituents, Ea
is a bond, an oxygen atom or an optionally substituted
methylene, ring Sla is a benzene ring optionally further having
substituent(s) selected from an optionally substituted C1-6
alkyl group, an optionally substituted C1_6 alkoxy group and a
halogen atom, and R16 and Rl' are the same or different and each
is a hydrogen atom, a halogen atom, a C1-6 alkyl group or a C1-s
alkoxy group,
so [17] the compound of the above-mentioned [16], wherein Rlia is
a phenyl group having two substituents selected from an
optionally substituted C1_6 alkyl group, an optionally
substituted C1_6 alkoxy group and a halogen atom; Ea is a bond,
an oxygen atom or a methylene; and R16 and R1' are the same or
i5 different and each is a hydrogen atom or a halogen atom,
[18] the compound of the above-mentioned [17], wherein Ea is a
bond,
[19] the compound of the above-mentioned [17], ~rherein R16 is a
hydrogen atom, and R1' is a fluorine atom,
20 [20] the compound of the above-mentioned [16], wherein the
partial structural formula
Rlla Ea /1a /1a
R»a Ea
[21] the compound of the above-mentioned [20], wherein Rlia is
a phenyl group having two substituents selected from an
25 optionally substituted C1_6 alkyl group, an optionally
substituted C1_6 alkoxy group and a halogen atom; Ea is a bond;
and ring Sla is a benzene ring without additional substituent,
7
CA 02505322 2005-05-06
[22] the compound of the above-mentioned [13], wherein the
substituent(s) having a benzene ring is a substituent
represented by the formula: R11-E2- (Rll is a phenyl group, an
indanyl group or a naphthyl group, each optionally having
substituent(s), and EZ is a bond or a spacer), ring S1 is
optionally further substituted by a C1-6 alkyl group, and R11
optionally forms a ring together with EZ and ring S1,
[23] the compound of the above-mentioned [22], wherein R11 is a
phenyl group or an indanyl group, each optionally having
Zo substituent(s) selected from the group consisting of a halogen
atom, a nitro, a carboxy, an optionally halogenated C1-6 alkyl,
a hydroxy-C1_6 alkyl, a carboxy-C1_6 alkyl-carbonylamino-C1-6
alkyl, an optionally halogenated Cl_6 alkoxy, a C6_14 aryl, a C6-
4 aryloxy and a C~_16 aralkyloxy,
is EZ is a bond, -0-, -CH2-0-, -CO-, -CONH-, -N (CH3) CH2-, -S-CH2-
or -C=C-,
ring S1 is optionally further substituted by a C1_6 alkyl group,
the ring formed by R11 together with EZ and ring S1 is
O \
\ /
2o the substituent that ring R optionally has is a'C1_6 alkyl
group, and Ra is a hydrogen atom,
[24] a compound represented by the formula
H
M N O
I -3)
E
H \ CH2COOH
Ra
wherein ring M is a benzene ring optionally having
25 substituent(s), ring N is a 5-membered heterocycle optionally
having substituent(s), ring E is a phenylene group optionally
having substituent(s), and Ra is a hydrogen atom or a
8
CA 02505322 2005-05-06
substituent, or a salt thereof, except 4-(1H-benzotriazol-1-
ylmethoxy)benzenepropanoic acid and 4-(1H-indol-3-
ylmethoxy)benzenepropanoic acid,
[25] a prodrug of the compound of the above-mentioned [24] or
s a salt thereof,
[26] the compound of the above-mentioned [24], wherein the
partial structural formula
M I N is
s s o , s~
each optionally having substituent(s) selected from a halogen
atom, an optionally substituted C1_6 alkyl group, an optionally
substituted Cl_6 alkoxy, a Cl_6 alkoxy-carbonyl and an
is optionally substituted C~_16 aralkyloxy,
[27] the compound of the above-mentioned [24], wherein the
partial structural formula
M I N is
I I
\ \ NH , \ or \ N
each optionally having substituent(s) selected from a halogen
atom and an optionally substituted C1_6 alkyl group,
ring E is an unsubstituted phenylene group, and Ra is a
hydrogen atom,
2s [2g] a compound represented by the formula
9
CA 02505322 2005-05-06
R's E' S
/ O .,~ (I-4)
R
CH2COOH
Ra
wherein ring SZ is a benzene ring optionally having
substituent(s), ring R is a phenylene group optionally having
substituent (s) , El is a bond or a spacer, R13 is a thiazolyl
s group optionally having substituent(s), and Ra is a hydrogen
atom or a substituent, or a salt thereof,
[29] a prodrug of the compound of the above-mentioned [28] or
a salt thereof,
[30] the compound of the above-mentioned [28], wherein ring SZ
to is a benzene ring, ring R is an unsubstituted phenylene group,
R13 is a thiazolyl group optionally having substituent(s)
selected from a Cg-14 aryl and a Cl_6 alkyl, E1 is -N (R1q ) -
(CH2) m2- or -S- (CHZ) m2- (R14 is a hydrogen atom or a C1-6 alkyl
group, and m2 is an integer of 0 to 3), and Ra is a hydrogen
is atom,
[31] the compound of the above-mentioned [28], wherein R13 is a
2-thiazolyl group optionally having substituent(s),
[32] the compound of the above-mentioned [28], which is
represented by the formula
Rz~ S
/~E~a ~ I 0 R~s
ao Rzi N I
(I-4A)
COzH
R~s
wherein Ela is -N (Rlq) -CH2-, -CH (R22) -0- or -CH (R22) -CHZ- (R14 and
R22 are a hydrogen atom or a C1_6 alkyl group) , Rle and R19 are
the same or different and each is a hydrogen atom, a halogen
atom, a C1_6 alkyl group or a C1-6 alkoxy group, and R2° and R21
2s are the same or different and each is a hydrogen atom, an
CA 02505322 2005-05-06
optionally substituted C6-14 aryl group or an optionally
substituted Cl_6 alkyl group, or Rz° and Rzl are bonded to form a
ring,
[33] the compound of the above-mentioned [32], wherein Ela is -
N (R19 ) -CHZ- (R14 is a hydrogen atom or a Cl_6 alkyl group) , and
Rle and R19 are the same or different and each is a hydrogen
atom or a halogen atom,
[34] a pharmaceutical agent comprising the compound of the
above-mentioned [10], [13], [24] or [28], or a salt thereof or
Zo a prodrug thereof,
[35] a method of regulating a GPR40 receptor function, which
comprises administering an effective amount of a compound
having an aromatic ring and a group capable of releasing
cation to a mammal,
is [3g] use of a compound having an aromatic ring and a group
capable of releasing cation for the production of a GPR40
receptor function regulator,
[37] a screening method for a ligand, agonist or antagonist to
GPR40, which comprises using GPR40 or a partial peptide
2° thereof or a salt thereof, and a compound having an aromatic
ring and a group capable of releasing cation, and
[38] a kit for screening a ligand, agonist or antagonist to
GPR40, which comprises GPR40 or a partial pepti8e thereof or a
salt thereof, and a compound having an aromatic ring and a
2s group capable of releasing cation.
Furthermore, the present invention provides
[39] the regulator of the above-mentioned [2], which comprises
a compound represented by the formula
P X~~O \
I a)
W5- Y' C O O H
so wherein ring P is an aromatic ring optionally having
substituent(s), ring R is a phenylene group optionally having
11
CA 02505322 2005-05-06
substituent(s), X1 is a bond or a C1_6 alkylene group optionally
having substituent (s) , WS is a bond, -O-, -N (R6) -, -CO-N (R') -
or -S-, R6 and R' are each a hydrogen atom or a C1-6 alkyl group,
and Y1 is a C1-6 alkylene group optionally having substituent(s),
or a salt thereof or a prodrug thereof,
[40] the regulator of the above-mentioned [2], which comprises
a compound represented by the formula
\ Z - O
( I b)
/ /
COOH
wherein ring S is a benzene ring optionally having
to substituent(s), ring R is a phenylene group optionally having
substituent(s), and Z is a chain formed by 4 linkages, or a
salt thereof or a prodrug thereof,
[41] the regulator of the above-mentioned [2], which comprises
a compound represented by the formula
A
/ X
(II)
Q~ Y-COOH
wherein ring A is a benzene ring optionally having
substituent(s), ring P1 is a ring optionally haling
substituent(s), ring Q1 is an aromatic ring optionally further
having substituent(s) besides -Y-COON, X and Y are each a
2o spacer, and -Y-COOH is substituted at any potition on ring Q1,
or a salt thereof or a prodrug thereof,
[42] the regulator of the above-mentioned [41], which
comprises a compound represented by the formula
A
/ X (I I a )
Pz Q' Y-COOH
ZS wherein ring P2 is a ring optionally having substituent(s), and
12
CA 02505322 2005-05-06
other symbols are as defined in the above-mentioned [30], or a
salt thereof or a prodrug thereof,
[43] the regulator of the above-mentioned [41], which
comprises a compound represented by the formula
X / (II b)
B C Y-COOH
wherein ring A is a benzene ring optionally having
substituent(s), ring B is a 5- to 7-membered ring optionally
having substituent(s), ring C is a benzene ring optionally
further having substituent(s) besides a -Y-COOH group, X and Y
to are each a spacer, and -Y-COOH is substituted at any position
on ring C, or a salt thereof or a prodrug thereof,
[44] the regulator of the above-mentioned [4], [5] or [39],
wherein ring P is a benzene ring optionally having
substituent(s) or a non-basic aromatic heterocycle optionally
15 having substituent(s),
(45] the regulator of the above-mentioned [4], [5] or [39],
wherein ring P is a benzene ring optionally having
substituent(s),
[46] the regulator of the above-mentioned [4], [5] or [39],
2° wherein ring P is a benzene ring optionally having
substituent(s) at the meta-position,
[47] the regulator of the above-mentioned [4], [5] or [39],
wherein the substituent of ring P is a substituent having an
aromatic ring,
2s [48] the regulator of the above-mentioned (47], wherein the
substituent having an aromatic ring is a substituent
represented by the formula: R1-E- (R1 is an aromatic group
optionally having substituent(s), and E is a bond or a spacer),
[49] the regulator of the above-mentioned [48], wherein -E- is
3o a bond, -0-, -CH2-O-, -CO-, -CONH-, -N ( RZ ) -CHZ- ( RZ i s a
hydrogen atom or a C1_6 alkyl group), -S-CH2- or -CH=CH-,
13
CA 02505322 2005-05-06
[50] the regulator of the above-mentioned [48], wherein -E- is
a bond, -O- or -CHZ-0-,
[51] the regulator of the above-mentioned [48], wherein R1 is
(i) a phenyl group optionally having substituent(s) selected
from the group consisting of a halogen atom, a nitro, a
carboxy, an optionally halogenated Cl_6 alkyl, a hydroxy-C1-6
alkyl, a carboxy-C1_6 alkyl-carbonylamino-Cl-6 alkyl, an
optionally halogenated Cl_6 alkoxy, a C6-1q aryl, a C6-14 aryloxy
and a C~-16 aralkyloxy or (ii) a 5- to 14-membered heterocyclic
zo group containing, besides carbon atom, 1 to 4 hetero atoms
selected from a nitrogen atom, an oxygen atom and a sulfur
atom, which optionally has substituent(s) selected from an
optionally halogenated Cl_6 alkyl, a C6-14 aryl and a C6-1q aryl-
CZ_6 alkenyl, and E is a bond or a spacer represented by -
i5 ( CHZ ) ml-W1- ( CH2 ) m2- (ml and m2 are each an integer o f 0 to 3, W1
is -0-, -N (Rz) -, -CO- or -CO-N (R3) -, and RZ and R3 are each a
hydrogen atom or a C1_6 alkyl group),
[52] the regulator of the above-mentioned [5], wherein ring Q
is a benzene ring optionally having substituent(s),
Zo [53] the regulator of the above-mentioned [4], [5], [41], [42]
or [43], wherein the spacer represented by X is
(i) -X1-WZ-X2- (X1 and Xz are each a bond or a C1_6 alkylene
group optionally having substituent (s) , W2 is -C~-, -N (R4) -, -
CO-N(RS)- or -S-, and Rq and R5 are each a hydrogen atom or a
2s Ci-6 al kyl group ) , or
( ii ) -W3-X3-W9- (X3 is a Cl_6 alkylene group optionally having
substituent (s ) , W3 and Wq are each -0-, -N (R9 ) -, -CO-N (R5) - or -
S-, and Rq and R5 are each a hydrogen atom or a Cl_6 alkyl
group),
so [54] the regulator of the above-mentioned [4], [5], [41], [42]
or [43], wherein the spacer represented by X is -X1-O-XZ- (X1
and X2 are each a bond or a C1_6 alkylene group optionally
having substituent(s)),
[55] the regulator of the above-mentioned [4], [5], [41], [42]
14
CA 02505322 2005-05-06
or [43], wherein the spacer represented by X is -X1-0- (X1
is a
bond or a C1_6 alkylene
group optionally
having substituent(s)),
[56] the regulator the above-mentioned [55], wherein X1
of is
(i) a bond or (ii) C1_6 alkylene group optionally having
a
s substituent (s) selected from a Cl_6 alkyl and a C6_14 aryl,
[57] the regulator the above-mentioned [4], [5], [41], [42]
of
or [43], wherein the spacer represented by X is
( i ) a bond,
(ii) -X1-0- (X1 is
a bond or a C1_6
alkylene group optionally
tohaving substituent(s)),
( iii) -N (R9 ) -X3-0-is a C1_6 alkylene group optionally
(X3
having substituent(s)and R9 is a C1_6 alkyl group),
(iv) -S-X3-0- (X3 C1-6 alkylene group optionally having
is a
substituent(s)),
is(v) -N (R9 ) -X3-
(X3 is a C1-6 alkylene
group optionally
having
substituent(s) and is a hydrogen atom or a C1_6 alkyl group),
R9
(vi ) -CO-N (RS) - a hydrogen atom or a C1_6 alkyl group)
(RS is ,
(vii) -X3-S- (X3 is Cl_6 alkylene group optionally having
a
substituent(s)), or
20(viii ) -S-X3-S- (X3 a Cl_6 alkylene group optionally having
is
substituent(s)),
[58] the regulator the above-mentioned [4], [5], [41], [42]
of
or [43] , wherein -W5-yl_ (Y1 is a Cl_6 alkyl~ne group
Y is
optionally having
substituent(s), W5
is a bond, -O-, -N(R6)-
-
,
2sCO-N (R' ) - or -S-, R6 and R' are each a hydrogen atom or
and a
C1_6 al kyl group
) ,
[59] the regulator the above-mentioned [4], [5], [41], [42]
of
or [43], wherein Y a C1_6 alkylene group optionally having
is
substituent(s),
30[60] the regulator the above-mentioned [4], [5], [41], [42]
of
or [43], wherein Y an ethylene group optionally having
is
substituent(s),
[61] the regulator the above-mentioned [4], [5], [41], [42]
of
or [43] , wherein -O-Y1- (Y1 is a C1_6 alkylene group
Y is
CA 02505322 2005-05-06
optionally having substituent(s)),
[62] the regulator of the above-mentioned [4], [5], [41], [42]
or [43], wherein -Y-COOH is substituted at para-position on
ring Q, ring Q' or ring C,
[63] the regulator of the above-mentioned [40], wherein Z is
( 1 ) a chain formed by 4 groups selected from -C (Re) (Re~ ) -, -0-,
-CO-, -N (Re~ ~ ) - (R8, Re~ and Re~ ~ are each a hydrogen atom or a
C1_6 al kyl group ) and -S-, or
(2) a chain formed by
and 2 groups selected from -C (Re) (Re~ ) -, -0-, -CO-, -N (R8~ ~ ) - (Re,
Re~ and Re~~ are each a hydrogen atom or a C1_6 alkyl group) and
-S-,
[64] the regulator of the above-mentioned [40], wherein Z is
( 1 ) - ( CH2 ) 9 -.
( 2 ) -0- ( CH2 ) 3-.
(3)
- O / \ C I-I 2
or
(4)
O-C HZ
[65] the regulator of the above-mentioned [43], wherein B ring
is a 5- to 7-membered ring optionally containing, besides
carbon atom, 1 to 3 hetero atoms selected from a nitrogen atom,
2s an oxygen atom and a sulfur atom, which optionally has
substituent ( s ) ,
[66] the regulator of the above-mentioned [43], wherein the
partial structural formula
16
CA 02505322 2005-05-06
A
B
is
\ \
or
[67] the regulator of the above-mentioned [43], wherein the
partial structural formula
A
B
is
\ \
IA IA
/ /
or
io [gg] the regulator of the above-mentioned [43],'wherein the
spacer represented by X is a methylene group optionally having
substituent(s), -0- or -S-, and the spacer represented by Y is
a C1_6 alkylene group optionally having substituent(s), -N(R6)-
Y1- (R6 is a hydrogen atom or a C1-6 alkyl group, and Y1 is a C1-
15 6 alkylene group optionally having substituent(s)), -O-Yl- (yl
is a C1-6 alkylene group optionally having substituent(s)) or -
S-Y1- (Y1 is a C1-6 alkylene group optionally having
substituent(s)),
[69] the regulator of the above-mentioned [1], which comprises
2o a carboxylic acid having a skeleton represented by the formula
17
CA 02505322 2005-05-06
pt X / (III)
wherein X is a spacer and ring P1 is a ring optionally having
substituent(s), or a derivative thereof,
[70] the regulator of the above-mentioned [2], which comprises
a compound represented by the formula
X
P3 Q Y-COOH (IV)
wherein ring P3 is an aromatic ring having substituent(s)
having a benzene ring, ring Q is an aromatic ring optionally
further having substituent(s) besides -Y-COON, X and Y are
1° each a spacer, and -Y-COOH is substituted at any position on
ring Q, or a salt thereof or a prodrug thereof, except (i) 2-
ethoxy-4-[[2-[(5-methyl-2-phenyl-4-
oxazolyl)methoxy]phenyl]methoxy]benzenepropanoic acid, (ii) 2-
ethoxy-4-[[3-[(5-methyl-2-phenyl-4-
is oxazolyl)methoxy]phenyl]methoxy]benzenepropanoic acid, (iii)
2-ethoxy-4-[[4-[(5-methyl-2-phenyl-4-
oxazolyl)methoxy]phenyl]methoxy)benzenepropanoi~ acid, and
(iv) 4-[[4-[(5-methyl-2-phenyl-4-
oxazolyl)methoxy)phenyl]methoxy]benzenepropanoic acid,
20 [~l] the regulator of the above-mentioned [2), which comprises
a compound represented by the formula
p3 XtiO \
(IVa)
W5-Y~ COOH
wherein ring P3 is an aromatic ring having substituent(s)
having a benzene ring, ring R is a phenylene group optionally
25 having substituent(s), X1 is a bond or a C1_6 alkylene group
18
CA 02505322 2005-05-06
optionally having substituent(s), WS is a bond, -0-, -N(R6)-, -
CO-N (R' ) - or -S-, R6 and R' are each a hydrogen atom or a C1-6
alkyl group, and Y1 is a C1_6 alkylene group optionally having
substituent(s), or a salt thereof or a prodrug thereof,
[72] the regulator of the above-mentioned [71], wherein X1 is a
C1_6 alkylene group optionally having substituent(s), WS is a
bond, and Y1 is a Cl_6 alkylene group optionally having
substituent (s) ,
[73] the regulator of the above-mentioned [71], wherein X1 is a
1o methylene group optionally having substituent(s), WS is a bond,
and Y1 is an ethylene group optionally having substituent(s),
[74] the regulator of the above-mentioned (70], which is
represented by the formula
t
S
O
(111b)
COOH
i5 wherein ring S1 is a benzene ring having substituent(s) having
a benzene ring, and ring R is a phenylene group optionally
having substituent(s),
[75] the regulator of the above-mentioned [70]-(74], wherein
the substituent(s) having a benzene ring is a substituent
2o represented by the formula: R11-E2- (Rll is a phenyl group, an
indanyl group or a naphthyl group, each optionally having
substituent(s), and E2 is a bond or a spacer),
[76] the compound of the above-mentioned [75], wherein -E2- is
a bond, -O-, -CH2-O-, -CO-, -CONH-, -N(CH3)CH2-, -S-CH2- or -
25 C=C-, preferably a bond, -0- or -CH2-0-, or a salt thereof or a
prodrug thereof,
[77] the compound of the above-mentioned [75], wherein R11 is a
phenyl group optionally having substituent(s) selected from
the group consisting of a halogen atom, a nitro, a carboxy, an
30 optionally halogenated Cl_6 alkyl, a hydroxy-C1-6 alkyl, a
19
CA 02505322 2005-05-06
carboxy-C1_s alkyl-carbonyl amino-Cl_6 alkyl, an optionally
halogenated Cl_6 lkoxy, a C6_l9 aryl, a C6-la aryloxy and a C,_16
aralkyloxy, or a salt thereof or a prodrug thereof,
[78] the regulator of the above-mentioned [2], which comprises
a compound represented by the formula
H
D
/ O / (A)
EI
COOH
wherein A1 is a substituent (except a hydrogen atom and a
chlorine atom), ring D is a benzene ring optionally further
having, besides A1, substituent(s) (except a nitro group and a
io hydroxy group), and ring E is a phenylene group optionally
having substituent(s), or a salt thereof or a prodrug thereof,
except 2-ethoxy-4-[[3-[(5-methyl-2-phenyl-4-
oxazolyl)methoxy]phenyl]methoxy]benzenepropanoic acid,
[79] the regulator of the above-mentioned [78], wherein A1 is a
is bromine atom,
[80] the regulator of the above-mentioned [2], which comprises
a compound represented by the formula
\ H
F ~ C O f(B)
/ /
E
COOH
wherein ring F is a ring optionally having substituent(s),
2o ring G is a benzene ring optionally having substituent(s), and
ring E is a phenylene group optionally having substituent(s),
provided that the partial structural formula
F I G
is not an unsubstituted naphthyl group, an unsubstituted 1H-
2s indazolyl group and a quinolyl group optionally having
CA 02505322 2005-05-06
substituent(s), or a salt thereof or a prodrug thereof,
[81] the regulator of the above-mentioned [2], which comprises
a compound represented by the formula
A I H O CC)
\ /
RI
COOH
wherein ring A is a benzene ring optionally having
substituent(s), ring H is a 5-membered ring optionally having
substituent(s), and ring R is a phenylene group optionally
having substituent(s), or a salt thereof or a prodrug thereof,
except 3,5-dibromo-4-[(5-chlorobenzo[b]thiophen-3-
1o yl)methoxy]benzenepropanoic acid, 4-(1H-benzotriazol-1-
ylmethoxy)benzenepropanoic acid and 4-(1H-indol-3-
ylmethoxy)benzenepropanoic acid,
[82] the regulator of the above-mentioned [81], wherein the
partial structural formula
A I H 15
\ \
NH . \ or ~ \ N
\ . \
each optionally having substituent(s) selected from a halogen
atom and an optionally halogenated C1-6 alkyl group,
2° [83] the regulator of the above-mentioned [2], which comprises
a compound represented by the formula
A
/ O ~ (D)
IJ
\K ~ \
COOH
21
CA 02505322 2005-05-06
wherein ring A is a benzene ring optionally having
substituent (s) , J is -O-, -S-, -CHz- or -NR12- (R12 is a
hydrogen atom or a C1-6 alkyl group), K is a bond or a Cl-3
alkylene group,
s
is a single bond or a double bond, ring R is a phenylene group
optionally having substituent(s), and ring I optionally has
substituent(s), or a salt thereof or a prodrug thereof,
[84] the compound of the above-mentioned [83], wherein the
to partial structural formula
A
IJ
~K
is
\ \
I A I A I j I j
or
0
the substituent of ring A is (i) a halogen atom, (ii) a Cl_6
is alkyl group, (iii) a C1-6 alkoxy group, (iv) a C6-i4 aryl group
optionally having substituent(s) selected from a halogen atom
and a C1_6 alkyl, (v) a C6_19 aryloxy group or (vi) a C~_ls
aralkyloxy group, and the substituent of ring R is a halogen
atom, or a salt thereof or a prodrug thereof, and
2° [85] the regulator of the above-mentioned [1], which comprises
the compound of the above-mentioned [10], [13], [24] or [28]
or a salt thereof or a prodrug thereof.
Brief Description of the Drawings
Fig. 1 shows the results of the insulin secretagogue
25 action from MINE of compound of Example 41, wherein the
concentration on the axis of abscissas shows the concentration
(~,~I) of the added compound of Example 41, **, p<0.01
22
CA 02505322 2005-05-06
(Student's t test).
Fig. 2 shows the results of the hypoglycemic action of
the compound of the present invention on rat, wherein ~ means
a control group (0.5% methyl cellulose administration group),
o means a compound administration group (Example 41 compound
administration group), the axis of abscissas shows time (min)
after glucose loading, the axis of ordinate shows blood
glucose level shift range (ng/dl), one group contained 6 rats,
and the value is mean ~ standard deviation.
so Fig. 3 shows the results of insulin secretion action of
the compound of the present invention in rat, wherein ~ means
a control group (0.5% methyl cellulose administration group),
o means a compound administration group (Example 41 compound
administration group), the axis of abscissas shows time (min)
ss after glucose loading, the axis of ordinate shows insulin
immunoactivity shift range (~U/ml), one group contained 6 rats,
and the value is mean ~standard deviation.
Best Mode for Carrying Out the Invention
The compound to be used in the present invention is a
2o compound having an aromatic ring and a group capable of
releasing cation, which is preferably a carboxylic acid having
an aromatic ring or a derivative thereof, more preferably a
carboxylic acid having 2 or more aromatic rings'or a
derivative thereof, specifically, the above-mentioned compound
2s (I~)~ compound (I), compound (I-1), compound (I-2), compound
(I-2A), compound (I-3), compound (I-4), compound (I-4A),
compound (Ia), compound (Ib), compound (II), compound (IIa),
compound (IIb), compound (III), compound (IV), compound (IVa),
compound (IVb), compound (A), compound (B), compound (C) and
3o compound (D). The compound (I-1), compound (I-2), compound
(I-2A), compound (I-3), compound (I-4) and compound (I-4A) are
novel compounds.
In the present specification, the aromatic ring means an
23
CA 02505322 2005-05-06
aromatic hydrocarbon ring or an aromatic heterocycle.
As the aromatic hydrocarbon ring, a hydrocarbon ring
having 6 to 14 carbon atoms, such as a benzene ring, a
naphthalene ring and the like, can be used, with preference
given to a benzene ring.
As the aromatic heterocycle, for example, a 5- to 14-
membered (monocyclic, bicyclic or tricyclic), preferably 5- to
10-membered, more preferably 5- or 6-membered aromatic
heterocycle containing, besides carbon atom, 1 or 2 kinds of 1
io to 4 hetero atoms selected from a nitrogen atom, a sulfur atom
and an oxygen atom can be used. As the above-mentioned "5- to
14-membered (preferably 5- to 10-membered) aromatic
heterocycle", for example, aromatic heterocycles such as
thiophene, furan, oxazole, benzo[b]thiophene, benzo[b]furan,
Zs benzimidazole, benzoxazole, benzothiazole, benzisothiazole,
naphtho [2, 3-b] thiophene, furan, pyrrole, imidazole, pyrazole,
pyridine, pyrazine, pyrimidine, pyridazine, indole, isoindole,
1H-indazole, purine, 4H-quinolizine, isoquinoline, quinoline,
phthalazine, naphthyridine, quinoxaline, quinazoline,
2o cinnoline, carbazole, (3-carboline, phenanthridine, acridine,
phenazine, thiazole, isothiazole, phenothiazine, isoxazole,
furazan, phenoxazine and the like, rings formed by
condensation of these rings (preferably monocycle) with one or
plural (preferably 1 or 2) aromatic rings (e. g., benzene ring
2s etc.) and the like can be used. Of these, a non-basic
aromatic heterocycle is preferable, for example, aromatic
heterocycles such as thiophene, benzo[b]thiophene,
benzo[b]furan, benzoxazole, benzothiazole, benzisothiazole,
naphtho[2,3-b]thiophene, furan, indole, carbazole, thiazole,
so isothiazole, isoxazole and the like, rings formed by
condensation of these rings (preferably monocycle) with one or
plural (preferably 1 or 2) non-basic aromatic rings (e. g.,
benzene ring etc.) and the like can be used.
In the present specification, the group capable of
24
CA 02505322 2005-05-06
releasing cation may be a group capable of releasing cation
chemically (e. g., by chemical reactions such as oxidation,
reduction, hydrolysis and the like, and the like) or
biologically, namely under physiological conditions (e.g., in
vivo reactions such as oxidation, reduction, hydrolysis and
the like due to biological enzymes, and the like), or a group
capable of converting to such group.
As the group capable of releasing cation, for example,
(1) a 5-membered heterocyclic group capable of releasing
io ration, (2) a carboxyl group, (3) a sulfonic acid group, (4) a
sulfamoyl group optionally mono-substituted by a C1_4 alkyl
group, (5) a phosphonic acid group, (6) a carbamoyl group
optionally mono-substituted by a C1-4 alkyl group (e. g., methyl,
ethyl, propyl, butyl, isobutyl, tert-butyl and the like), (7)
a C2-~ alkylsulfonylthiocarbamoyl group (e.g.,
methylsulfonylthiocarbamoyl, ethylsulfonylthiocarbamoyl etc.),
(8) a trifluoromethanesulfonic acid amido group (-NHSO2CF3) and
the like can be used.
As the above-mentioned 5-membered heterocyclic group
2o cap~le of releasing ration, a 5-membered heterocyclic group
comprising 1 to 4 selected from N, 0 and S as ring-
constituting atoms) and the like can be used. For example,
O O '
~NH ~NH
O N H S N H N~O~O N~O~S O
O ' O
O O ~NH N~O
S NH NH NH N,O~S O NH
, , , ,
S O
O
-~ ~NH
N, \ O N, ,N
N O HO N
H , OH
CA 02505322 2005-05-06
and the like can be mentioned.
Of these,
O O
O NH S NH ~NH
N, .N
and N
O O
are preferable, and
-~ N H
N, . N
N
is particularly preferable.
The group capable of releasing cation is particularly
preferably a carboxyl group.
In compounds (I'), (I) and (Ia), ring P is an aromatic
to ring optionally having substituent(s).
As the aromatic ring represented by ring P, a benzene
ring, and non-basic aromatic heterocycles such as thiophene,
benzo[b]thiophene, benzo[b]furan, benzoxazole, benzothiazole,
benzisothiazole, naphtho[2,3-b]thiophene, furan, indole,
15 carbazole, thiazole, isothiazole, isoxazole and the like are
preferable, and a benzene ring is particularly preferable.
In compound (I'), (I) and (IV), ring Q is an aromatic
ring optionally further having substituent(s) besides
Y L
20 or -Y-COOH.
As the aromatic ring represented by ring Q, a benzene
ring, and non-basic aromatic heterocycles such as thiophene,
benzo[b]thiophene, benzo[b]furan, benzoxazole, benzothiazole,
benzisothiazole, naphtho[2,3-b]thiophene, furan, indole,
2$ carbazole, thiazole, isothiazole, isoxazole and the like are
preferable, and a benzene ring is particularly preferable.
As the aforementioned substituent that the ring P may
26
CA 02505322 2005-05-06
have, and as the aforementioned substituent that the ring Q
may further have besides
Y L
or -Y-COOH, for example, a substituent selected from a
substituent selected from a oxo; a halogen atom (e. g.,
fluorine, chlorine, bromine, iodine etc.); a C1-3 alkylenedioxy
(e. g., methylenedioxy, ethylenedioxy etc.); a nitro; a cyano;
an optionally esterified carboxyl; an optionally substituted
lower (C1_6) alkyl; an optionally substituted lower (C2-6)
io alkenyl; an optionally substituted lower(C2_6) alkynyl; an
optionally substituted C3_8 cycloalkyl; an optionally
substituted lower(C1_6) alkoxy; a hydroxy; a mercapto; an
optionally substituted lower(C1_6) alkylthio; a formyl; an
optionally substituted lower(C1_6) alkyl-carbonyl; an
is optionally substituted C3_8 cycloalkyl-carbonyl; a lower (C1-6)
alkylsulfonyl (e.g., methylsulfonyl, ethylsulfonyl etc.); a
lower (C1-6) alkylsulfinyl (e.g., methylsulfinyl, ethylsulfinyl
etc.); a formylamino; an optionally substituted lower(C1_6)
alkyl-carbonylamino; an optionally substituted C3_e cycloalkyl-
2o carbonylamino; an optionally substituted lower(C1_6) alkoxy-
carbonylamino; an optionally substituted lower(~1-s)
alkylsulfonylamino; an optionally substituted lower(C1-6)
alkyl-carbonyloxy; an optionally substituted lower(C1-6)
alkoxy-carbonyloxy; an optionally substituted mono-lower(C1_s)
2s alkyl-carbamoyloxy; an optionally substituted di-lower(C1-6)
alkyl-carbamoyloxy; a sulfo; a sulfamoyl; a sulfinamoyl; a
sulfenamoyl; an optionally substituted 5 to 7-membered
heterocyclylcarbonyl containing, besides carbon atom, 1 or 2
kinds of 1 to 4 hetero atoms selected from a nitrogen atom, a
3o sulfur atom and an oxygen atom; an optionally substituted C6_la
aryloxy, an optionally substituted C,-16 aralkyloxy, an
optionally substituted C6_19 arylthio, an optionally substituted
27
CA 02505322 2005-05-06
C~_16 aralkylthio, an optionally substituted C6_14 aryl-carbonyl,
an optionally substituted C~_16 aralkyl-carbonyl, an optionally
substituted C6_19 aryl-carbonylamino, an optionally substituted
C6-14 aryl-carbonyloxy, an optionally substituted mono- or di-
s Cs-19 aryl-carbamoyloxy, an optionally substituted C6_lq
arylsulfonyl, an optionally substituted C6-19 arylsulfinyl, an
optionally substituted C6_19 arylsulfonylamino, an optionally
substituted aromatic heterocyclyloxy, an optionally
substituted C6_1a aryl, an optionally substituted C~_16 aralkyl
1° and an optionally substituted C6_14 aryl-CZ_6 alkenyl, which are
concrete examples of the substituent represented by the
formula: R1-E- to be mentioned below; an optionally substituted
heterocyclic group; a thiocarbamoyl; an optionally substituted
carbamoyl group; and an optionally substituted amino;
is a group wherein two or more (e. g., 2-3) of these substituents
are bonded; and the like (hereinafter to be abbreviated as
substituent group A) can be used. Ring P may have 1 to 5,
preferably 1 to 3, substituents mentioned above at
substitutable position(s), and when the number of the
Z° substituents is not less than 2, respective substituents may
be the same or different.
As the "optionally esterified carboxyl group" in the
substituent group A, for example, a carboxyl, a'C1_6 alkoxy-
carbonyl (e. g., methoxycarbonyl, ethoxycarbonyl,
2s propoxycarbonyl, tert-butoxycarbonyl etc . ) , a C6_lq aryloxy-
carbonyl (e. g., phenoxycarbonyl etc.), a C7_16 aralkyloxy-
carbonyl (e. g., benzyloxycarbonyl, phenethyloxycarbonyl etc.)
and the like can be used.
As the "lower(C1_6) alkyl" of the "optionally substituted
30 lower (C1_6) alkyl" in the substituent group A, for example,
methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl,
tert-butyl, pentyl, isopentyl, neopentyl, hexyl and the like
can be used.
As the "lower(CZ_6) alkenyl" of the "optionally
28
CA 02505322 2005-05-06
substituted lower(C2_6) alkenyl" in the substituent group A,
for example, vinyl, propenyl, isopropenyl, 2-buten-1-yl, 4-
penten-1-yl, 5-hexen-1-yl and the like can be used.
As the "lower (CZ_6) alkynyl" of the "optionally
substituted lower(CZ_6) alkynyl" in the substituent group A,
for example, 2-butyn-1-yl, 4-pentyn-1-yl, 5-hexyn-1-yl and the
like can be used.
As the "lower(C1_6) alkoxy" of the "optionally substituted
lower(C1_6) alkoxy" in the substituent group A, for example,
to methoxy, ethoxy, propoxy, isopropoxy, butoxy, isobutoxy, sec
butoxy, pentyloxy, hexyloxy and the like can be used.
As the "lower (C1-6) alkylthio" of the "optionally
substituted lower(C1_6) alkylthio" in the substituent group A,
for example, methylthio, ethylthio, propylthio, isopropylthio,
15 butylthio, sec-butylthio, tert-butylthio and the like can be
used.
As the "lower(C1_6) alkyl-carbonyl" of the "optionally
substituted lower(C1_6) alkyl-carbonyl" in the substituent
group A, for example, acetyl, propionyl, pivaloyl and the like
2° can be used.
As the "lower(C1-6) alkyl-carbonylamino" of the
"optionally substituted lower(C1_6) alkyl-carbonylamino" in the
substituent group A, for example, acetylamino, propionylamino,
pivaloylamino and the like can be used.
2s As the "lower(C1-6) alkoxy-carbonylamino" of the
"optionally substituted lower(C1_6) alkoxy-carbonylamino" in
the substituent group A, for example, methoxycarbonylamino,
ethoxycarbonylamino, propoxycarbonylamino, butoxycarbonylamino
and the like can be used.
3o As the "lower(C1_6) alkylsulfonylamino" of the "optionally
substituted lower(C1-6) alkylsulfonylamino" in the substituent
group A, for example, methylsulfonylamino, ethylsulfonylamino
and the like can be used.
As the "lower(C1_6) alkyl-carbonyloxy" of the "optionally
29
CA 02505322 2005-05-06
substituted lower(C1_6) alkyl-carbonyloxy" in the substituent
group A, for example, acetoxy, propionyloxy and the like can
be used.
As the "lower(C1-6) alkoxy-carbonyloxy" of the "optionally
substituted lower(C1_6) alkoxy-carbonyloxy" in the substituent
group A, for example, methoxycarbonyloxy, ethoxycarbonyloxy,
propoxycarbonyloxy, butoxycarbonyloxy and the like can be used.
As the "mono-lower(C1_6) alkyl-carbamoyloxy" of the
"optionally substituted mono-lower(C1_6) alkyl-carbamoyloxy" in
1o the substituent group A, for example, methylcarbamoyloxy,
ethylcarbamoyloxy and the like can be used.
As the "di-lower(C1-6) alkyl-carbamoyloxy" of the
"optionally substituted di-lower(C1_6) alkyl-carbamoyloxy" in
the substituent group A, for example, dimethylcarbamoyloxy,
15 diethylcarbamoyloxy and the like can be used.
These "lower alkyl group", "lower alkenyl", "lower
alkynyl", "lower alkoxy", "lower alkylthio", "lower alkyl-
carbonyl", "lower alkyl-carbonylamino", "lower alkoxy-
carbonylamino", "lower alkylsulfonylamino", "lower alkyl-
2o carbonyloxy", "lower alkoxy-carbonyloxy", "mono-lower alkyl-
carbamoyloxy" and "di-lower alkyl-carbamoyloxy" each
optionally have, at substitutable position(s), 1 to 5
substituents selected from, for example, a halogen atom (e. g.,
fluorine atom, chlorine atom, bromine atom, iodine atom);
25 hydroxy; amino; a mono- or di- 5- to 7-membered heterocyclic
group containing, besides carbon atom, 1 or 2 kinds of 1 to 4
hetero atoms selected from a nitrogen atom, a sulfur atom and
an oxygen atom (e. g., furyl, pyridyl, thienyl etc.) (said
heterocyclic group being optionally substituted by a halogen
so atom, hydroxy, amino, optionally halogenated lower(C1_6) alkyl,
mono- or di-lower (C~-6) alkyl amino, mono- or di-C6_19 arylamino,
C3-a cycloalkyl, lower (C1_6) alkoxy, lower (Cl_6) alkoxy-carbonyl,
lower (C1-6) alkylthio, lower (C1-6) alkylsulfinyl, lower (C1-6)
alkylsulfonyl, the above-mentioned optionally esterified
CA 02505322 2005-05-06
carboxyl, carbamoyl, thiocarbamoyl, mono-lower (C1_s) alkyl-
carbamoyl, di-lower (Cl-s) alkyl-carbamoyl, mono- or dl-Cs-14
aryl-carbamoyl and the like); mono- or di-lower(C1_s)
alkylamino; mono- or di-Cs-19 arylamino; C3-a cycloalkyl;
optionally halogenated lower (C1_s) alkoxy; lower (C1_s) alkoxy-
carbonyl; lower (Cl_s) alkylthio; lower (Cl_s) alkylsulfinyl;
lower(C1_s) alkylsulfonyl; the above-mentioned optionally
esterified carboxyl; carbamoyl; thiocarbamoyl; mono-lower(C1-s)
alkyl-carbamoyl (e. g., methylcarbamoyl, ethylcarbamoyl etc.);
so di-lower(Cl_s) alkyl-carbamoyl (e.g., dimethylcarbamoyl,
diethylcarbamoyl, ethylmethylcarbamoyl etc.); mono- or di-Cs-19
aryl-carbamoyl (e.g., phenylcarbamoyl, 1-naphthylcarbamoyl, 2-
naphthylcarbamoyl etc.); mono- or di- 5- to 7-membered
heterocyclylcarbamoyl containing, (besides carbon atom), 1 or
15 2 kinds of 1 to 4 hetero atoms selected from a nitrogen atom,
a sulfur atom and an oxygen atom (e.g., 2-pyridylcarbamoyl, 3-
pyridylcarbamoyl, 4-pyridylcarbamoyl, 2-thienylcarbamoyl, 3-
thienylcarbamoyl etc.); C1-s alkyl-carbonylamino (e. g.,
acetylamino, propionylamino) optionally substituted by
2o carboxy; and the like.
As the "C3-a cycloalkyl" of the "optionally substituted C3-
a cycloalkyl" in the substituent group A, for example,
cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl and the like
can be used.
2s As the "C3_e cycloalkyl-carbonyl" of the "optionally
substituted C3_a cycloalkyl-carbonyl" in the substituent group
A, for example, cyclopropylcarbonyl, cyclopentylcarbonyl,
cyclohexylcarbonyl and the like can be used.
As the "C3-a cycloalkyl-carbonylamino" of the "optionally
3o substituted C3_a cycloalkyl-carbonylamino" in the substituent
group A, for example, cyclopropylcarbonylamino,
cyclopentylcarbonylamino, cyclohexylcarbonylamino and the like
can be used.
As the "5 to 7-membered heterocyclylcarbonyl containing,
31
CA 02505322 2005-05-06
besides carbon atom, 1 or 2 kinds of 1 to 4 hetero atoms
selected from a nitrogen atom, a sulfur atom and an oxygen
atom" of the "optionally substituted 5 to 7-membered
heterocyclylcarbonyl containing, besides carbon atom, 1 or 2
kinds of 1 to 4 hetero atoms selected from a nitrogen atom, a
sulfur atom and an oxygen atom" in the substituent group A,
for example, nicotinoyl, isonicotinoyl, thenoyl, furoyl,
morpholinocarbonyl, thiomorpholinocarbonyl, piperazin-1-
ylcarbonyl, pyrrolidin-1-ylcarbonyl and the like can be used.
1o As the "C6_19 aryloxy" of the "optionally substituted C6_14
aryloxy" in the substituent group A, for example, phenyloxy,
1-naphthyloxy, 2-naphthyloxy and the like can be used.
As the "C~_16 aralkyloxy" of the "optionally substituted
C~_16 aralkyloxy" in the substituent group A, for example,
15 benzyloxy, phenethyloxy and the like can be used.
As the "C5-lq arylthio" of the "optionally substituted C6-19
arylthio" in the substituent group A, for example, phenylthio,
1-naphthylthio, 2-naphthylthio and the like can be used.
As the "C~_15 aralkylthio" of the "optionally substituted
aralkylthio" in the substituent group A, for example,
benzylthio, phenethylthio and the like can be used.
As the "C6_1q aryl-carbonyl" of the "optionally
substituted Cs-14 aryl-carbonyl" in the substituent group A, for
example, benzoyl, 1-naphthoyl, 2-naphthoyl and the like can be
2s used.
As the "C~_16 aralkyl-carbonyl" of the "optionally
substituted C~_16 aralkyl-carbonyl" in the substituent group A,
for example, phenylacetyl, 3-phenylpropionyl and the like can
be used.
3o As the "C6_14 aryl-carbonylamino" of the "optionally
substituted C6_14 aryl-carbonylamino" in the substituent group A,
for example, benzoylamino, naphthoylamino and the like can be
used.
As the "C6_14 aryl-carbonyloxy" of the "optionally
32
CA 02505322 2005-05-06
substituted C6-14 aryl-carbonyloxy" in the substituent group A,
for example, benzoyloxy, naphthylcarbonyloxy and the like can
be used.
As the "mono- or dl-C6-14 aryl-carbamoyloxy" of the
"optionally substituted mono- or di-C6-14 aryl-carbamoyloxy" in
the substituent group A, for example, phenylcarbamoyloxy,
naphthylcarbamoyloxy and the like can be used.
As the "C6_19 arylsulfonyl" of the "optionally substituted
C6_19 arylsulfonyl" in the substituent group A, for example,
to phenylsulfonyl, 1-naphthylsulfonyl, 2-naphthylsulfonyl and the
like can be used.
As the "C6-1q arylsulfinyl" of the "optionally substituted
C6_19 arylsulfinyl" in the substituent group A, for example,
phenylsulfinyl, 1-naphthylsulfinyl, 2-naphthylsulfinyl and the
15 like can be used.
As the "C5-14 arylsulfonylamino" of the "optionally
substituted C6_19 arylsulfonylamino" in the substituent group A,
for example, phenylsulfonylamino and the like can be used.
As the "aromatic heterocyclyloxy" of the "optionally
2o s~stituted aromatic heterocyclyloxy" in the substituent group
A, for example, a 5- to 10-membered aromatic heterocyclyl-oxy
containing, besides carbon atom, 1 or 2 kinds of 1 to 4 hetero
atoms selected from a nitrogen atom, a sulfur atom and an
oxygen atom, specifically, pyrazinyloxy and the like, can be
25 used.
These "C3_e cycloalkyl", "C3-a cycloalkyl-carbonyl", "C3-a
cycloalkyl-carbonylamino", "5 to 7-membered
heterocyclylcarbonyl containing, besides carbon atom, 1 or 2
kinds of 1 to 4 hetero atoms selected from a nitrogen atom, a
3o sulfur atom and an oxygen atom", "C6_14 aryloxy", "C
aralkyloxy", "C6_19 arylthio", "C~_16 aralkylthio", "C6_14 aryl-
carbonyl", "C~_16 aralkyl-carbonyl", "C6_l9 aryl-carbonyl amino",
"C6_l9 aryl-carbonyloxy", "mono- or di-C6_~4 aryl-carbamoyloxy",
"C6-1q arylsulfonyl", "C6_19 arylsulfinyl", "C6_1q
33
CA 02505322 2005-05-06
arylsulfonylamino" and "aromatic heterocyclyloxy" each
optionally have, at substitutable position(s), 1 to 5
substituents selected from, for example, a halogen atom (e. g.,
fluorine atom, chlorine atom, bromine atom, iodine atom);
s hydroxy; amino; the above-mentioned optionally substituted
lower alkyl; the above-mentioned optionally substituted lower
alkenyl; the above-mentioned optionally substituted lower
alkynyl; C6-19 aryl (said C6-14 aryl is optionally substituted by
a halogen atom, hydroxy, amino, optionally halogenated
io lower (C1_6) alkyl, mono- or di-lower (C1_6) alkyl amino, mono- or
dl-C6_lq arylamino, C3_e cycloalkyl, lower (Cl_6) alkoxy, lower (Cl_
6) alkoxy-carbonyl, lower (C1_6) alkylthio, lower (Cl-s)
alkylsulfinyl, lower(C1_6) alkylsulfonyl, the above-mentioned
optionally esterified carboxyl, carbamoyl, thiocarbamoyl,
is mono-lower (C1_6) alkyl-carbamoyl, di-lower (C1_6) alkyl-carbamoyl,
mono- or di-C6-~4 aryl-carbamoyl and the like); C6_14 aryloxy
(said C6_19 aryloxy is optionally substituted by a halogen atom,
hydroxy, amino, optionally halogenated lower(C1_6) alkyl, mono-
or di-lower (C1-6) alkylamino, mono- or di-C6-19 arylamino, C3_e
2o cycloalkyl, lower (Cl_6) alkoxy, lower (C1_6) alkoxy-carbonyl,
lower (C1_6) alkylthio, lower (Cl_6) alkylsulfinyl, lower (Cl-6)
alkylsulfonyl, the above-mentioned optionally esterified
carboxyl, carbamoyl, thiocarbamoyl, mono-lower(~1_6) alkyl-
carbamoyl, di-lower (C1_6) alkyl-carbamoyl, mono- or di-C6-14
2s aryl-carbamoyl and the like) ; C~_16 aralkyloxy (said C~-16
aralkyloxy is optionally substituted by a halogen atom,
hydroxy, amino, optionally halogenated lower(C1_6) alkyl, mono-
or di-lower (C1_6) alkylamino, mono- or di-C6-14 arylamino, C3_$
cycloalkyl, lower (C1-6) alkoxy, lower (Cl-6) alkoxy-carbonyl,
so lower (C1-6) alkylthio, lower (C1_6) alkylsulfinyl, lower (C1-6)
alkylsulfonyl, the above-mentioned optionally esterified
carboxyl, carbamoyl, thiocarbamoyl, mono-lower(C1-6) alkyl-
carbamoyl, di-lower (C1_6) alkyl-carbamoyl, mono- or dl-C6-19
aryl-carbamoyl and the like); a mono- or di- 5- to 7-membered
34
CA 02505322 2005-05-06
heterocyclic group containing, besides carbon atom, 1 or 2
kinds of 1 to 4 hetero atoms selected from a nitrogen atom, a
sulfur atom and an oxygen atom (e. g., furyl, pyridyl, thienyl
etc.) (said heterocyclic group is optionally substituted by a
halogen atom, hydroxy, amino, mono- or di-lower (C1-6)
alkyl amino, mono- or di-C6_14 arylamino, C3_a cycloalkyl,
lower (Cl_6) alkoxy, lower (C1_6) alkoxy-carbonyl, lower (Cl-6)
alkylthio, lower (C1_6) alkylsulfinyl, lower (Cl-6) alkylsulfonyl,
the above-mentioned optionally esterified carboxyl, carbamoyl,
1° thiocarbamoyl, mono-lower (C1_6) alkyl-carbamoyl, di-lower (C1-s)
alkyl-carbamoyl, mono- or di-C6_19 aryl-carbamoyl and the like);
mono- or di-lower (C1-6) alkyl amino; mono- or di-C6_14 arylamino;
C3-a cycloalkyl; the above-mentioned optionally substituted
lower (C1_6) alkoxy; lower (C1_6) alkoxy-carbonyl; lower (C1-6)
i5 alkylthio; lower (C1_6) alkylsulfinyl; lower (Cl_6) alkylsulfonyl;
the above-mentioned optionally esterified carboxyl; carbamoyl;
thiocarbamoyl; mono-lower(C1-6) alkyl-carbamoyl (e. g.,
methylcarbamoyl, ethylcarbamoyl etc.); di-lower(C1_6) alkyl-
carbamoyl (e. g., dimethylcarbamoyl, diethylcarbamoyl,
2° ethylmethylcarbamoyl etc.); mono- or di-C6_19 aryl-carbamoyl
(e.g., phenylcarbamoyl, 1-naphthylcarbamoyl, 2-
naphthylcarbamoyl etc.); mono- or di- 5- to 7-membered
heterocyclylcarbamoyl containing, besides carbon atom, 1 or 2
kinds of 1 to 4 hetero atoms selected from a nitrogen atom, a
2s Sulfur atom and an oxygen atom (e.g., 2-pyridylcarbamoyl, 3-
pyridylcarbamoyl, 4-pyridylcarbamoyl, 2-thienylcarbamoyl, 3-
thienylcarbamoyl etc.) and the like.
As the "C5-lq aryl" of the "optionally substituted C6-14
aryl" in the substituent group A, for example, phenyl, 1-
3o naphthyl, 2-naphthyl, 2-biphenylyl, 3-biphenylyl, 4-biphenylyl,
2-anthryl and the like can be used. The C6-19 aryl may be
partially saturated and as the partially saturated C6_14 aryl,
for example, tetrahydronaphthyl and the like can be mentioned.
As the "C~-16 aralkyl" of the "optionally substituted C~_16
CA 02505322 2005-05-06
aralkyl" in the substituent group A, for example, benzyl,
phenethyl, diphenylmethyl, 1-naphthylmethyl, 2-naphthylmethyl,
2,2-diphenylethyl, 3-phenylpropyl, 4-phenylbutyl, 5-
phenylpentyl, 2-biphenylylmethyl, 3-biphenylylmethyl, 4-
biphenylylmethyl and the like can be used.
As the "C6-19 aryl-C2-6 alkenyl" of the "optionally
substituted C6-19 aryl-C2_6 alkenyl" in the substituent group A,
for example, styryl and the like can be used.
These "C6-la aryl", "C~_16 aralkyl" and "C6_19 aryl-CZ-6
io alkenyl" each may have, at substitutable position(s), 1 to 5
substituents selected from, for example, a halogen atom;
hydroxy; nitro; cyano; the above-mentioned optionally
substituted lower alkyl; the above-mentioned optionally
substituted lower alkenyl; the above-mentioned optionally
is substituted lower alkynyl; the above-mentioned optionally
substituted C3-B cycloalkyl; the above-mentioned optionally
substituted lower alkoxy; the above-mentioned optionally
substituted lower alkylthio; the above-mentioned optionally
substituted lower alkylsulfinyl; the above-mentioned
Zo optionally substituted lower alkylsulfonyl; the above-
mentioned optionally esterified carboxyl; carbamoyl;
thiocarbamoyl; mono-lower (C1_6) alkyl-carbamoyl; di-lower (C1-6)
alkyl-carbamoyl; mono- or di-C6_19 aryl-carbamoyT'; mono- or di-
5- to 7-membered heterocyclylcarbamoyl containing, besides
2s carbon atom, 1 or 2 kinds of 1 to 4 hetero atoms selected from
a nitrogen atom, a sulfur atom and an oxygen atom (e.g., 2-
pyridylcarbamoyl, 3-pyridylcarbamoyl, 4-pyridylcarbamoyl, 2-
thienylcarbamoyl, 3-thienylcarbamoyl etc.); and the like.
As the "heterocyclic group" of the "optionally
3o substituted heterocyclic group" in the substituent group A,
for example, a 5- to 14-membered (monocycle, bicyclic or
tricyclic) heterocyclic group containing, besides carbon atom,
1 or 2 kinds of 1 to 4 hetero atoms selected from a nitrogen
atom, a sulfur atom and an oxygen atom, preferably (i) 5- to
36
CA 02505322 2005-05-06
14-membered (preferably 5- to 10-membered) aromatic
heterocyclic group, (ii) a 5- to 10-membered non-aromatic
heterocyclic group, (iii) a monovalent group obtained by
removing any one hydrogen atom from a 7- to 10-membered
crosslinked heterocycle, and the like can be used, with
preference given to a 5-membered aromatic heterocyclic group.
Specifically, for example, aromatic heterocyclic groups such
as thienyl (e. g., 2-thienyl, 3-thienyl), furyl (e. g., 2-furyl,
3-furyl), pyridyl (e. g., 2-pyridyl, 3-pyridyl, 4-pyridyl),
to thiazolyl (e. g., 2-thiazolyl, 4-thiazolyl, 5-thiazolyl),
oxazolyl (e.g., 2-oxazolyl, 4-oxazolyl), quinolyl (e.g., 2-
quinolyl, 3-quinolyl, 4-quinolyl, 5-quinolyl, 8-quinolyl),
isoquinolyl (e. g., 1-isoquinolyl, 3-isoquinolyl, 4-isoquinolyl,
5-isoquinolyl), pyrazinyl, pyrimidinyl (e. g., 2-pyrimidinyl,
is q-pyrimidinyl), pyrrolyl (e.g., 1-pyrrolyl, 2-pyrrolyl, 3-
pyrrolyl), imidazolyl (e.g., 1-imidazolyl, 2-imidazolyl, 4-
imidazolyl), pyrazolyl (e.g., 1-pyrazolyl, 3-pyrazolyl, 4-
pyrazolyl), pyridazinyl (e. g., 3-pyridazinyl, 4-pyridazinyl),
isothiazolyl (e.g., 3-isothiazolyl), isoxazolyl (e.g., 3-
2o isoxazolyl), indolyl (e. g., 1-indolyl, 2-indolyl, 3-indolyl),
2-benzothiazolyl, benzo[b]thienyl, (e. g., 2-benzo[b]thienyl,
3-benzo[b]thienyl), benzo[b]furanyl (e. g., 2-benzo[b]furanyl,
3-benzo[b]furanyl) and the like; non-aromatic heterocyclic
groups such as pyrrolidinyl (e.g., 1-pyrrolidinyl, 2-
2s pyrrolidinyl, 3-pyrrolidinyl), oxazolidinyl (e.g., 2-
oxazolidinyl), imidazolinyl (e.g., 1-imidazolinyl, 2-
imidazolinyl, 4-imidazolinyl), piperidinyl (e.g., 1-
piperidinyl, 2-piperidinyl, 3-piperidinyl, 4-piperidinyl),
piperazinyl (e. g., 1-piperazinyl, 2-piperazinyl), morpholino,
so thiomorpholino and the like; and the like can be used.
The heterocyclic group may have, at substitutable
position(s), 1 to 5 substituents selected from, for example, a
halogen atom; hydroxy; nitro; cyano; the above-mentioned
optionally substituted lower alkyl; the above-mentioned
37
CA 02505322 2005-05-06
optionally substituted lower alkenyl; the above-mentioned
optionally substituted lower alkynyl; the above-mentioned
optionally substituted C3_e cycloalkyl; the above-mentioned
optionally substituted C6_19 aryl; the above-mentioned
optionally substituted lower alkoxy; the above-mentioned
optionally substituted lower alkylthio; the above-mentioned
optionally substituted C6_1q arylthio; the above-mentioned
optionally substituted C~_16 aralkylthio; the above-mentioned
optionally substituted lower alkylsulfinyl; the above-
io mentioned optionally substituted C6_14 arylsulfinyl; the above-
mentioned optionally substituted C1_6 alkylsulfonyl; the above-
mentioned optionally substituted Cs-14 arylsulfonyl; the above-
mentioned optionally esterified carboxyl; carbamoyl;
thiocarbamoyl; mono-lower (C1_6) alkyl-carbamoyl; di-lower (C1-6)
i5 alkyl-carbamoyl; mono- or di-Cs-19 aryl-carbamoyl; mono- or di-
5- to 7-membered heterocyclylcarbamoyl containing, besides
carbon atom, 1 or 2 kinds of 1 to 4 hetero atoms selected from
a nitrogen atom, a sulfur atom and an oxygen atom (e.g., 2-
pyridylcarbamoyl, 3-pyridylcarbamoyl, 4-pyridylcarbamoyl, 2-
2o thienylcarbamoyl, 3-thienylcarbamoyl etc.); and the like.
As the ~~optionally substituted carbamoyl group" in the
substituent group A, a carbamoyl group optionally substituted
by 1 or 2 substituents selected from the above-mentioned
optionally substituted lower alkyl, the above-mentioned
2s optionally substituted lower alkenyl, the above-mentioned
optionally substituted lower alkynyl, the above-mentioned
optionally substituted C3_a cycloalkyl, the above-mentioned
optionally substituted C6_1q aryl, the above-mentioned
optionally substituted heterocyclic group, the above-mentioned
30 optionally substituted lower alkoxy and the like can be used,
and specifically, for example, carbamoyl; mono-C1_6 alkyl-
carbamoyl (e.g., methylcarbamoyl, ethylcarbamoyl etc.); di-C1-6
alkyl-carbamoyl (e. g., dimethylcarbamoyl, diethylcarbamoyl,
ethylmethylcarbamoyl etc. ) ; C1_6 alkyl (C1_6 alkoxy) -carbamoyl
38
CA 02505322 2005-05-06
(e. g. , methyl (methoxy) carbamoyl, ethyl (methoxy) carbamoyl) ;
mono- or di-C6_19 aryl-carbamoyl (e.g., phenylcarbamoyl, 1-
naphthylcarbamoyl, 2-naphthylcarbamoyl etc.); mono- or di- 5-
to 7-membered heterocyclylcarbamoyl containing, besides carbon
atom, 1 or 2 kinds of 1 to 4 hetero atoms selected from a
nitrogen atom, a sulfur atom and an oxygen atom (e.g., 2-
pyridylcarbamoyl, 3-pyridylcarbamoyl, 4-pyridylcarbamoyl, 2-
thienylcarbamoyl, 3-thienylcarbamoyl etc.); and the like can
be used. As the "optionally substituted carbamoyl group",
to moreover, 5 to 7-membered cyclylcarbamoyl (e.g., 1-
pyrrolidinylcarbonyl, 1-piperidinylcarbonyl,
hexamethyleneiminocarbonyl) and the like can be also used.
As the "optionally substituted amino" in the substituent
group A, an amino optionally substituted by 1 or 2
15 substituents selected from the above-mentioned optionally
substituted lower alkyl, the above-mentioned optionally
substituted lower alkenyl, the above-mentioned optionally
substituted lower alkynyl, the above-mentioned optionally
substituted C3-a cycloalkyl, the above-mentioned optionally
2° substituted C6-14 aryl, the above-mentioned optionally
substituted lower alkoxy and the like can be used.
As the substituent of ring P, a substituen~ having an
aromatic ring is preferable. Specifically, a substituent
25 represented by the formula: R1-E- (R1 is an aromatic group
optionally having substituent(s), and E is a bond or a spacer)
and the like can be used.
As the "aromatic group" of the "aromatic group optionally
having substituent(s)" represented by R1, an aromatic
3o hydrocarbon group and an aromatic heterocyclic group can be
used.
As the aromatic hydrocarbon group, a C6-19 aryl group such
as a phenyl group, a naphthyl group and the like can be used,
with preference given to a phenyl group.
39
CA 02505322 2005-05-06
As the aromatic heterocyclic group, for example, a 5- to
14-membered (monocycle, bicyclic or tricyclic) aromatic
heterocyclic group containing, besides carbon atom, 1 or 2
kinds of 1 to 4 hetero atoms selected from a nitrogen atom, a
s sulfur atom and an oxygen atom, preferably (i) a 5- to 14-
membered (preferably 5- to 10-membered) aromatic heterocyclic
group, (ii) a monovalent group obtained by removing any one
hydrogen atom from a 7- to 10-membered aromatic crosslinked
heterocycle, and the like can be mentioned, with preference
1° given to a monocyclic aromatic heterocyclic group.
Specifically, for example, thienyl (e.g., 2-thienyl, 3-
thienyl), furyl (e.g., 2-furyl, 3-furyl), pyridyl (e.g., 2-
pyridyl, 3-pyridyl, 4-pyridyl), thiazolyl (e. g., 2-thiazolyl,
4-thiazolyl, 5-thiazolyl), oxazolyl (e.g., 2-oxazolyl, 4-
is oxazolyl), quinolyl (e. g., 2-quinolyl, 3-quinolyl, 4-quinolyl,
5-quinolyl, 8-quinolyl), isoquinolyl (e.g., 1-isoquinolyl, 3-
isoquinolyl, 4-isoquinolyl, 5-isoquinolyl), pyrazinyl,
pyrimidinyl (e. g., 2-pyrimidinyl, 4-pyrimidinyl), pyrrolyl
(e. g., 1-pyrrolyl, 2-pyrrolyl, 3-pyrrolyl), imidazolyl (e. g.,
2° 1-imidazolyl, 2-imidazolyl, 4-imidazolyl), pyrazolyl (e.g., 1-
pyrazolyl, 3-pyrazolyl, 4-pyrazolyl), pyridazinyl (e.g., 3-
pyridazinyl, 4-pyridazinyl), isothiazolyl (e.g., 3-
isothiazolyl), isoxazolyl (e. g., 3-isoxazolyl),°indolyl (e. g.,
1-indolyl, 2-indolyl, 3-indolyl), 2-benzothiazolyl,
2s benzo[b]thienyl, (e. g., 2-benzo[b]thienyl, 3-benzo[b]thienyl),
benzo[b]furanyl (e. g., 2-benzo[b]furanyl, 3-benzo[b]furanyl)
and the like can be used.
As the "substituent" of the "aromatic group" represented
by R1, a substituent selected from the aforementioned
so substituent group A can be used. The number of the
substituents is, for example, 1 to 3.
As R1, (i) a phenyl group optionally having
substituent(s) selected from the group consisting of a halogen
atom, a nitro, a carboxy, an optionally substituted C1-6 alkyl
CA 02505322 2005-05-06
exemplified for the aforementioned substituent group A
[preferably, an optionally halogenated C1-6 alkyl, a hydroxy-C1_
alkyl, a carboxy-C1_6 alkyl-carbonyl amino-Cl_6 alkyl] , an
optionally substituted C1_6 alkoxy exemplified for the
aforementioned substituent group A [preferably, an optionally
halogenated Cl_6 alkoxy] , a C6_l9 aryl, a C6_l4 aryloxy, a C-,_16
aralkyloxy, a formyl, a cyano, a hydroxy, a Cl-6 alkylthio, a
C1_6 alkoxy-carbonyl, a carbamoyl, a mono-Cl_6 alkyl-carbamoyl,
a di-Cl_6 alkyl-carbamoyl and a C3_e cycloalkyl (preferably, a
1° phenyl group optionally having substituent(s) selected from a
halogen atom, an optionally halogenated C1_6 alkyl, an
optionally halogenated Cl_6 alkoxy, a C6_14 aryl, a C6-19 aryloxy
and a C~_16 aralkyloxy), or (ii) a 5- to 14-membered aromatic
heterocyclic group containing, besides carbon atom, 1 to 4
IS hetero atoms selected from a nitrogen atom, an oxygen atom and
a sulfur atom (e. g., thiazolyl (e. g., 2-thiazolyl, 4-thiazolyl,
5-thiazolyl), oxazolyl (e.g., 2-oxazolyl, 4-oxazolyl) and the
like), which optionally has substituent(s) selected from
optionally a halogenated Cl_6 alkyl, a C6_14 aryl and a C6_l9
2° aryl-CZ_6 alkenyl, is preferable.
As the spacer represented by E, an alkylene group
optionally having substituent(s) or an alkenylene group
optionally having substituent(s), wherein -C- in the alkylene
group or alkenylene group is optionally substituted by -0-, -
25 N- or -S-, can be used. The position at which -C- in the
alkylene group or alkenylene group is substituted by -0-, -N-
or -S- may be the terminal or chain of the alkylene group or
alkenylene group.
As the "alkylene group" of the "alkylene group optionally
3o having substituent(s)" for the spacer represented by E, for
example, a C1-13 alkylene group ( a . g. , methylene, ethylene,
propylene, butylene and the like) can be used, and a C1-s
alkylene group is particularly preferable.
As the "alkenylene group" of the "alkenylene group
41
CA 02505322 2005-05-06
optionally having substituent(s)" for the spacer represented
by E, for example, a Cz-13 al kenylene group (e . g . , vinylene,
propenylene, isopropenylene, 2-buten-1-ylene, 4-penten-1-ylene,
5-hexen-1-ylene) can be used, and a C2_6 alkenylene group (e.g.,
vinylene, propenylene, isopropenylene, 2-buten-1-ylene, 4-
penten-1-ylene, 5-hexen-1-ylene) is particularly preferable.
As the substituent of the "alkylene group" or "alkenylene
group", a C1_6 alkyl group (e . g. , methyl, ethyl, propyl,
isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl,
to isopentyl, neopentyl, hexyl) , an oxo group, a C6_14 aryl group
(e.g., phenyl) and the like can be preferably used, and an oxo
group is particularly preferable. The number of the
substituents is, for example, 1 to 3.
Specifically, as E, (i) a bond, or (ii) a spacer
15 represented by - (CH2 ) ml-W1- (CHz ) m2- (ml and m2 are each an
integer of 0 to 3, Wl is -0-, -N (R2) -, -S-, -CO- or -CO-N (R3) -,
and R2 and R3 are each a hydrogen atom or a C1-6 alkyl group) is
preferable, and
( i ) a bond,
20 (ii) a spacer represented by -(CHZ)ml-Wl- (each symbol is as
defined above),
(iii) a spacer represented by -W1-(CHZ)m2- (each symbol is as
defined above) or the like is particularly preferable.
As ml, 0 or 1 is preferable.
2s As m2, 0 or 1 is preferable.
As a combination of ml and m2, the both being 0, or one
being 0 and the other being 1 is preferable.
As the C1_6 alkyl group represented by R2 or R3, methyl,
ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert
so butyl, pentyl, isopentyl, neopentyl, hexyl can be used.
Particularly, as E, a bond, -O-, -CHZ-0-, -CO-, -CONH-, -
N (RZ) -CHZ- (RZ is a hydrogen atom or a C1_6 alkyl group,
preferably methyl), -S-CHZ- or -CH=CH- is preferable,
particularly, a bond, -0- or -CHz-O- is preferable.
42
CA 02505322 2005-05-06
When ring P is a benzene ring, a compound wherein ring P
has a substituent at the meta-position relative to X bonded to
ring P, is preferable.
In compound (I'), (I), (II), (IIa), (IIb), (III) and (IV),
X and Y are each a spacer, and as the spacer, "an alkylene
group optionally having substituent(s) or an alkenylene group
optionally having substituent(s), wherein -C- in the alkylene
group or alkenylene group is optionally substituted by -O-, -
io N- or -S-" can be used, like the aforementioned spacer
represented by E. Particularly an "alkylene group optionally
having substituent(s), wherein -C- in the alkylene group is
optionally substituted by -O-, -N- or -S-", is preferable.
In compound (I-1), Xa is a spacer other than an alkylene
ss group, and as the spacer, an "alkylene group optionally having
substituent(s), wherein -C- in the alkylene group is
substituted by -0-, -N- or -S-" or an "alkenylene group
optionally having substituent(s), wherein -C- in the
alkenylene group is substituted by -0-, -N- or -S-" can be
2o used. Of these an "alkylene group optionally having
substituent(s), wherein -C- in the alkylene group is
substituted by -0-, -N- or -S-" is preferable. Specifically,
of the aforementioned spacers represented by E,'those other
than the alkylene group can be used.
25 As the spacer represented by X or Xa,
(i) -X1-WZ-X2- (X1 and XZ are each a bond or a C1-6 alkylene
group optionally having substituent(s), W2 is -O-, -N(Rq)-, -
CO-N(RS)- or -S-, and R9 and R5 are each a hydrogen atom or a
C1_6 alkyl group) , or
30 ( ii ) -W3-X3-Wq- (X3 is a Cl_6 alkylene group optionally having
substituent (s ) , W3 and Wq are each -O-, -N (R9 ) -, -CO-N (RS) - or -
S-, and Rq and RS are each a hydrogen atom or a Cl_6 alkyl
group) is preferable.
As the "C1_6 alkylene group" of the "C1-6 alkylene group
43
CA 02505322 2005-05-06
optionally having substituent(s)" represented by X1, X2 or X3,
methylene, ethylene, propylene, butylene, pentylene and
hexylene can be used, and particularly, a C1_4 alkylene group
such as methylene, ethylene, propylene and butylene is
preferable.
As the substituents for the "C1_6 alkylene group", a Cl_6
alkyl group (e. g., methyl, ethyl, propyl, isopropyl, butyl,
isobutyl, sec-butyl, tert-butyl, pentyl, isopentyl, neopentyl,
hexyl), a C6_19 aryl group (e.g., phenyl) and the like can be
io preferably used. The number of the substituents is, for
example, 1 to 3.
As the C1-6 alkyl group represented by R4 or R5, methyl,
ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-
butyl, pentyl, isopentyl, neopentyl and hexyl can be used.
15 As W2, -O- or the like is preferable.
As W3 and W9, -S- or the like is preferable.
Particularly, the spacer represented by X or Xa, -X1-0-X2-
(X1 and X2 are each a bond or a C1_6 alkylene group optionally
having substituent(s)) is preferable, and particularly, -X1-0-
2° (X1 is a bond or a C1-s alkylene group optionally having
substituent(s)) is preferable.
As X1, a bond or a C1_6 alkylene group (particularly, a C1_
alkylene group) optionally having substituent(s) selected
from a Cl_6 alkyl and a C6_lq aryl is preferable.
25 As the combination of X1 and X2, the both being bonds, or
one of them being a bond is preferable.
More specifically, as the spacer represented by X or Xa,
( i ) a bond,
(ii) -X1-0- (X1 is a bond or a C1_6 alkylene group optionally
3o having substituent(s)),
( iii) -N (R9 ) -X3-O- (X3 is a C1_6 alkylene group optionally
having substituent(s), and Rq is a hydrogen atom or a Cl-6 alkyl
group),
( iv) -S-X3-O- (X3 is a C1_6 alkylene group optionally having
44
CA 02505322 2005-05-06
substituent(s)),
(v) -N (R9 ) -X3- (X3 is a C1_6 alkylene group optionally having
substituent(s), and R4 is a hydrogen atom or a C1_6 alkyl group),
(vi) -CO-N (Rs) - (Rs is a hydrogen atom or a Cl_s alkyl group) ,
(vii) -X3-S- (X3 is a Cl_6 alkylene group optionally having
substituent(s)), or
(viii) -S-X3-S- (X3 is a C1_6 alkylene group optionally having
substituent(s)) or the like is preferable.
As Xa, -0- is particularly preferable.
to As Y, -Ws-Y1- (Y1 is a C1-6 alkylene group optionally
having subs t i tuent ( s ) , Ws i s a bond, -0-, -N ( R6 ) -, -CO-N ( R' ) -
or -S-, and R6 and R' are each a hydrogen atom or a C1_6 alkyl
group) or the like is preferable.
As the "C1-6 alkylene group" of the "C1_6 alkylene group
is optionally having substituent(s)" represented by Yl, methylene,
ethylene, propylene, butylene, pentylene and hexylene can be
used, and particularly, a C1_q alkylene group such as methylene,
ethylene, propylene and butylene is preferable.
As the Cl_6 alkyl group represented by R6 or R', methyl,
2o ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-
butyl, pentyl, isopentyl, neopentyl and hexyl can be used.
As Ws, a bond or -0- is preferable, and a bond is
particularly preferable. '
Particularly, as Y, (i) a C1-6 alkylene group optionally
2s having substituent (s) or (ii) -0-Y1- (Y1 is a C1_6 alkylene
group optionally having substituent(s)) is preferable, and
particularly, a Cl_6 alkylene group (e.g., methylene, ethylene,
propylene) optionally having substituent(s) is preferable, and
an ethylene group optionally having substituent(s) is
3o particularly preferable. In addition, a C1_6 alkylene group
represented by Y or Y1 is preferably unsubstituted.
In the compounds (I), (II), (IIa), (IIb) and (IV), -Y-
COOH may be bonded at any position on ring Q, ring Q1 or ring C.
When ring Q, ring Q1 or ring C is a benzene ring (phenyl group),
CA 02505322 2005-05-06
these rings are preferably bonded at the para-position
relative to X bonded to these rings.
In compounds (I-1), (I-2), (I-4), (Ia), (Ib), (IVa),
(IVb), (C) and (D), ring R is a phenylene group optionally
having substituent(s). As the substituent that a phenylene
group represented by ring R may have, a substituent selected
from the aforementioned substituent group A can be used, and
particularly, a halogen atom, a hydroxy group, a Cl_6 alkyl, a
1° C1-6 alkoxy and the like can be preferably used. The number of
the substituents is, for example, 1 to 3, preferably 1 or 2.
In compounds (I-1), (I-2), (I-3) and (I-4), as the
substituent represented by Ra, a substituent selected from the
aforementioned substituent group A can be used. As the
i5 substituent, a halogen atom (e. g., fluorine, chlorine, bromine,
iodine) , a Cl_6 alkyl group (e. g. , methyl, ethyl, propyl) , a C1_
alkoxy group (e. g., methoxy, ethoxy, propoxy) and the like
are preferable.
In compound (Ib), ring S is a benzene ring optionally
2° having substituent(s). As the substituent that the benzene
ring represented by ring S may have, a substituent selected
from the aforementioned substituent group A can be used, and
particularly, a C1_6 alkyl and the like can be preferably used.
The number of the substituents is, for example, 1 to 3.
2s In compound (Ib), Z is a chain formed by 4 linkages. As
the chain represented by Z,
( 1 ) a chain formed by 4 groups selected from -C (Re) (Re~ ) -, -0-,
-CO-, -N (Ra~ ~ ) - (R8, Re~ and R8~ ~ are each a hydrogen atom or a
C1-6 alkyl group) and -S-,
30 (2) a chain formed by
and 2 groups selected from -C (R8 ) (R8~ ) -, -0-, -CO-, -N (Re~ ~ ) - (R8,
46
CA 02505322 2005-05-06
Re~ and Ra~~ are each a hydrogen atom or a C1_6 alkyl group) and
-S-, or the like can be used, and specifically,
(1) -(CHz)a-,
( 2 ) -~- ( CHZ ) 3-.
s (3)
-o
(4)
o-c H2
or the like can be used.
io As the Cl_6 alkyl group represented by Ra, R8~ or RB~~,
those exemplified for the aforementioned R6 can be used.
In compounds (I-1), (IIa), (IIb), (C) and (D), ring A is
a benzene ring optionally having substituent(s). As the
is substituent that the benzene ring represented by ring A may
have, a substituent selected from the aforementioned
substituent group A can be used. The number of the
substituents is, for example, 1 to 3.
Ring P1 in compounds ( I I ) and ( I I I ) and ring P2 in
2° compound (IIa) are rings optionally having substituent(s).
As the ring represented by ring P1 or ring P2, a carbon
ring or a heterocycle can be used.
As the carbon ring, (1) a cycloalkane having 5 to 7
carbon atoms such as cyclopentane, cyclohexane and the like,
25 (2) an aromatic hydrocarbon ring having 6 to 14 carbon atoms
such as a benzene ring, a naphthalene ring and the like can be
used, and particularly, a cycloalkane having 5 to 7 carbon
atoms such as cyclohexane and the like can be preferably used.
3o As the heterocycle, for example, a 5- to 14-membered
47
CA 02505322 2005-05-06
(monocycle, bicyclic or tricyclic) heterocycle containing,
besides carbon atom, 1 or 2 kinds of 1 to 4 hetero atoms
selected from a nitrogen atom, a sulfur atom and an oxygen
atom, (i) a 5- to 14-membered, preferably 5- to 10-membered,
s more preferably 5- or 6-membered, aromatic heterocycle, (ii) a
5- to 10-membered non-aromatic heterocycle, (iii) a 7- to 10-
membered crosslinked heterocycle and the like can be used.
As the above-mentioned "5- to 14-membered (preferably 5-
to 10-membered) aromatic heterocycle", for example, aromatic
io heterocycles such as thiophene, furan, oxazole,
benzo[b]thiophene, benzo[b]furan, benzimidazole, benzoxazole,
benzothiazole, benzisothiazole, naphtho[2,3-b]thiophene,
pyrrole, imidazole, pyrazole, pyridine, pyrazine, pyrimidine,
pyridazine, indole, isoindole, 1H-indazole, purine, 4H-
is quinolizine, isoquinoline, quinoline, phthalazine,
naphthyridine, quinoxaline, quinazoline, cinnoline, carbazole,
(3-carboline, phenanthridine, acridine, phenazine, thiazole,
isothiazole, phenothiazine, isoxazole, furazan, phenoxazine,
oxadiazole, thiadiazole and the like, rings formed by
2o condensation of these rings (preferably monocycle) with one or
plural (preferably 1 or 2) aromatic rings (e. g., benzene ring
etc.) and the like can be used.
As the above-mentioned "5- to 10-membered non-aromatic
heterocycle", for example, pyrrolidine, imidazoline,
2s pyrazolidine, pyrazoline, piperidine, piperazine, morpholine,
thiomorpholine, dioxazole, oxadiazoline, thiadiazoline,
triazoline, dithiazole and the like can be mentioned.
As the above-mentioned "7- to 10-membered crosslinked
heterocycle", for example, quinuclidine, 7-
3o azabicyclo[2.2.1]heptane and the like can be mentioned.
As ring P1 and ring P2, a carbon ring is preferable, and
particularly, a cycloalkane having 5 to 7 carbon atoms such as
cyclohexane or the like is preferable.
As the substituent that a ring represented by ring P1 or
48
CA 02505322 2005-05-06
ring PZ may have, a substituent selected from the
aforementioned substituent group A can be used. The number of
the substituents is, for example, 1 to 3.
In compounds (II) and (IIa), ring Q1 is an aromatic ring
optionally further having substituent(s) besides -Y-COOH.
As the aromatic ring represented by ring Q1, those
similar to the aforementioned aromatic ring represented by
ring Q can be used, and particularly, a benzene ring is
to preferable.
As the substituent that the ring represented by ring Q1
may have besides -Y-COOH, a substituent selected from the
aforementioned substituent group A can be used. The number of
the substituents is, for example, 1 to 3.
is
In compound (IIb), ring B is a 5- to 7-membered ring
optionally having substituent(s).
As the 5- to 7-membered ring represented by ring B, a 5
to 7-membered ring optionally containing, besides carbon atom,
20 1 to 3 hetero atoms selected from a nitrogen atom, an oxygen
atom and a sulfur atom and the like can be used. Particularly,
a 5 to 7-membered carbon ring is preferable.
Particularly, in compounds (IIa) and (IIb), as
A I A
/ /
B
or p2
\ \ \ \
A A
25 I j I j I /
is preferable,
49
CA 02505322 2005-05-06
A I A I A
/ /
or
is more preferable, and
A ( A
/ /
or
is particularly preferable.
As the substituent that the 5- to 7-membered ring
represented by ring B may have, a substituent selected from
the aforementioned substituent group A can be used. The
number of the substituents is, for example, 1 to 3.
io In compounds (IV) and (IVa), ring P3 is an aromatic ring
having substituent(s) having a benzene ring.
As the aromatic ring represented by ring P3, those
similar to the aromatic ring represented by ring P can be used,
and particularly, a benzene ring is preferable.
15 In compounds (I-2) and (IVb), ring S1 is a benzene ring
having substituent(s) having a benzene ring.
Ring S1 optionally further has substituent(s) besides the
substituent(s) having a benzene ring. As the substituent, a
substituent selected from the aforementioned substituent group
2° A can be used, and particularly, a substituent selected from
an optionally substituted C1_6 alkyl group, an optionally
substituted C1_6 alkoxy group, a halogen atom (e. g., fluorine,
chlorine, bromine, iodine) and a C~_16 aralkyloxy (e. g.,
benzyloxy) is preferable; and a C1_6 alkyl group is more
25 preferable. The number of the substituents is, for example, 1
to 3. Here, as the optionally substituted C1_6 alkyl group and
the optionally substituted C1_6 alkoxy group, a Cl_6 alkyl group
CA 02505322 2005-05-06
( a . g. , methyl ) and a Cl_6 alkoxy group ( a . g. , methoxy) are
preferable, respectively.
As the "substituent(s) having a benzene ring" that the
aforementioned aromatic ring represented by ring P3 and the
aforementioned benzene ring represented by ring S1 have, for
example, a substituent represented by the formula: R11-EZ- (R11
is a phenyl group, an indanyl group or a naphthyl group, each
optionally having substituent(s), and EZ is a bond or a spacer)
and the like can be used.
to As the "substituent" of the "phenyl group", "indanyl
group" and "naphthyl group" represented by R11, a substituent
selected from the aforementioned substituent group A can be
used. The number of the substituents is, for example, 1 to 3.
As R11, for example, a phenyl group, an indanyl group or a
is naphthyl group (preferably a phenyl group or an indanyl group),
each optionally having 1 to 3 substituents selected from the
group consisting of a halogen atom (e. g., fluorine, chlorine),
a nitro, a carboxy, an optionally substituted C1_6 alkyl
exemplified for the aforementioned substituent group A
2° [preferably, an optionally halogenated Cl_6 alkyl (e . g. , methyl,
ethyl, propyl, isopropyl, butyl, isobutyl, trifluoromethyl), a
hydroxy-C1_6 alkyl (e.g., hydroxymethyl, hydroxyethyl), a
carboxy-C1_6 alkyl-carbonyl amino-Cl_6 alkyl (e.g.;
carboxyethylcarbonylaminomethyl)], an optionally substituted
25 C1-s alkoxy exemplified for the aforementioned substituent
group A [preferably, an optionally halogenated C1_6 alkoxy
(e.g., methoxy, ethoxy, isopropoxy, trifluoromethoxy) ], a C6-14
aryl ( a . g . , phenyl ) , a C6_l9 aryloxy ( a . g . , phenoxy) , a C~-16
aralkyloxy (e. g. , benzyloxy) , a formyl, a cyano, a hydroxy, a
3o C1-6 alkylthio (e.g., methylthio), a Cl_6 alkoxy-carbonyl (e.g.,
methoxycarbonyl, ethoxycarbonyl), a carbamoyl, a mono-C1-6
alkyl-carbamoyl (e.g., methylcarbamoyl, ethylcarbamoyl), a di-
C1_6 alkyl-carbamoyl ( a . g . , dimethylcarbamoyl,
diethylcarbamoyl), a C3_8 cycloalkyl (e.g., cyclohexyl) and the
51
CA 02505322 2005-05-06
like, is preferable, particularly, a phenyl group optionally
having substituent(s) selected from the group consisting of a
halogen atom, a nitro, a carboxy, an optionally halogenated C1_
alkyl, a hydroxy-C1-6 alkyl, a carboxy-C1_6 alkyl-
carbonylamino-C1_6 alkyl, an optionally halogenated C1_6 alkoxy,
a C6_19 aryl, a C6-19 aryloxy and a C~-is aralkyloxy is preferable,
and a phenyl group optionally having 1 to 3 substituents
selected from a halogen atom and an optionally halogenated C1-6
alkyl is particularly preferable.
to As the spacer represented by E2, those exemplified for
the aforementioned E can be mentioned. Particularly,
( i ) a bond, or
(ii) a spacer represented by -(CH2)ml-Wl-(CHZ)m2- (ml and m2 are
each an integer of 0 to 3, W1 is -O-, -N(R2)-, -S-, -CO- or -
is CO-N (R3) -, and R2 and R3 are each a hydrogen atom or a C1_6
alkyl group) is preferable, and
( i ) a bond,
(ii) a spacer represented by -(CHZ)ml-Wl- (each symbol is as
deffined above),
20 (iii) a spacer represented by -W1- (CHZ) m2- (each symbol is as
defined above) or the like is more preferable.
Of these, a bond, -O-, -CHZ-0-, -CO-, -CONH-, -N(CH3)CHZ-,
-S-CH2- or -C=C- is preferable. '
Moreover, as the a spacer represented by E2, -SOZ-CHz-CHZ-
25 N ( RZ ) -CH2-, -0-CH ( CH3 ) -CH2-N ( RZ ) -CHZ-, -CH ( Ph ) -CHZ-N ( R2 )
-CHZ-, -
CH { Pyr ) -CHz-N ( RZ ) -CHZ-, -CH ( CHz-Pyr ) -N ( RZ ) -CHZ-, -CHZ-N ( Ph )
-CHZ-,
-CH2-N (CH2-Ph) -CH2-, -N (CHZ-CHz-CN) -CHZ-, -N (CHZ-CHZ-Imd) -CHZ- (RZ
is a hydrogen atom or a C1_6 alkyl group, Ph is a phenyl group,
Pyr is a pyrrolidinyl group and Imd is imidazopyridinyl) and
3o the like can be also mentioned.
As the spacer represented by E2, a bond, -0-, -CHZ-0-, -
CO-, -CONH-, -N ( R2 ) CH2-, -S-CHZ-, -C=C-, - ( CH2 ) 2-, - ( CH2 ) 20-, -
CH2 ) 30-. -C (=CHZ ) -, -N ( Rz ) -, -CHz-N ( Rz ) -, -CH2-N ( R2 ) -CHZ-, -
S02 _
CH2-CH2-N ( R2 ) -CH2-, -0-CH ( CH3 ) -CH2-N ( RZ ) -CH2-, -CH ( Ph ) -CHZ-N (
R2 ) -
52
CA 02505322 2005-05-06
CH2-, -CH ( Pyr ) -CHZ-N ( R2 ) -CHZ-, -CH ( CH2-Pyr ) -N ( R2 ) -CHZ-, -CHZ-
N (Ph) -CHZ-, -CHz-N (CH2-Ph) -CHZ-, -N (CHZ-CHZ-CN) -CH2-, -N (CHZ-CHz-
Imd) -CHz- (R2 is a hydrogen atom or a C1_6 alkyl group, Ph is a
phenyl group, Pyr is a pyrrolidinyl group and Imd is
imidazopyridinyl) or the like is preferable, and particularly,
a bond, -0- or -CHZ-O- is preferable.
In compound (I-2), when ring S1 has a substituent
represented by the formula: R11-E2- (the symbols are as defined
above), R11 may form a ring together with E2 and ring S1, and as
io such ring, for example,
/ ~ O \
and the like can be used.
In compound (IIb), ring C is a benzene ring optionally
15 further having substituent(s) besides a -Y-COOH group.
As the substituent that the benzene ring represented by
ring C may have besides -Y-COON, a substituent selected from
the aforementioned substituent group A can be used. The
number of the substituents is, for example, 1 to 3.
2o In compound (A), A1 is a substituent (except a hydrogen
atom and a chlorine atom).
As the substituent (except a hydrogen atom and a chlorine
atom) represented by A1, a substituent selected from the
aforementioned substituent group A (except a chlorine atom and
2s a C1_3 alkylenedioxy) can be used, and particularly, a bromine
atom is preferable.
Ring D is a benzene ring further having substituent(s)
(except a nitro group and a hydroxy group) besides A1.
As the substituent (except a nitro group and a hydroxy
3o group) that the benzene ring represented by ring D may have
besides A1, a substituent selected from the aforementioned
substituent group A (except a nitro group and a hydroxy group)
53
CA 02505322 2005-05-06
can be used. The number of the substituents is, for example,
1 to 3.
In compounds (I-3), (A) and (B), ring E is a phenylene
group optionally having substituent(s), and those similar to
the "phenylene group optionally having substituent(s)"
represented by ring R can be used. However, no substituent is
present at the position represented by -H.
In compound (B), ring F is a ring optionally having
substituent(s), and those similar to the "ring optionally
Io having substituent(s)" represented by ring P1 can be used.
In compound (B), ring G is a benzene ring optionally
having substituent(s), and those similar to the "benzene ring
optionally having substituent(s)" represented by ring A can be
used.
15 The partial structural formula:
F ~ G
is not an unsubstituted naphthyl group, an unsubstituted 1H-
indazolyl group and a quinolyl group optionally having
substituent (s) .
In compound (C), ring H is a 5-membered ring optionally
having substituent(s).
As the 5-membered ring represented by ring H, a 5-
membered carbon ring or heterocycle can be used.
2s As the 5-membered carbon ring, cyclopentane and the like
can be used.
As the 5-membered heterocycle, for example, a 5-membered
heterocycle containing, besides carbon atom, 1 or 2 kinds of 1
to 4 hetero atoms selected from a nitrogen atom, a sulfur atom
so and an oxygen atom and the like can be used. Specifically,
thiophene, dihydrothiophene, furan, dihydrofuran, thiazole,
isothiazole, oxazole, isoxazole, pyrrole, pyrroline, imidazole,
54
CA 02505322 2005-05-06
imidazoline, pyrazole, pyrrolidine, imidazoline, pyrazolidine,
pyrazoline, oxadiazole, thiadiazole and the like can be
mentioned.
As the ring H, thiophene, pyrrole and the like are
preferable.
As the substituent that the 5-membered ring represented
by ring H may have, a substituent selected from the
aforementioned substituent group A can be used. The number of
the substituents is, for example, 1 to 3.
to As the partial structural formula
,A I H
o s\ /
~ I I ~ I
N H . ~ or \ N
each optionally having substituent(s) selected from a halogen
is atom (e.g., chlorine atom) and an optionally halogenated C1-6
alkyl group (e.g., methyl, trifluoromethyl), and the like can
be preferable used.
In compound (D) , J is -O-, -S-, -CHZ- or -i4R12- (R12 is a
2o hydrogen atom or a C1-6 alkyl group) .
As the Cl-6 alkyl group represented by R12, methyl, ethyl,
propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl,
pentyl, isopentyl, neopentyl and hexyl can be used.
K is a bond or a C1_3 alkylene group.
zs As the C1-3 alkylene group represented by K, methylene,
ethylene and propylene can be used.
As K, a bond and methylene are preferable.
is a single bond or a double bond.
so As the substituent that ring I may have, a substituent
CA 02505322 2005-05-06
selected from the aforementioned substituent group A can be
used. The number of the substituents is, for example, 1 to 3.
As the partial structural formula
A
IJ
~K
s ~ A' ~ A ~ ~ ~ j
or
and the like are preferable. As the substituent for ring A in
this case, (i) a halogen atom, (ii) a C1_6 alkyl group (e. g.,
methyl, ethyl, propyl), (iii) a C1-6 alkoxy group (e. g.,
i o methoxy, ethoxy) , ( iv) a C6-14 aryl group ( a . g . , phenyl,
naphthyl) optionally having substituent(s) selected from a
halogen atom (e. g., fluorine atom, chlorine atom, bromine
atom) and a Cl_6 alkyl ( a . g . , methyl, ethyl, propyl ) , (v) a C6_l9
aryloxy group ( a . g . , phenyloxy) and (vi ) a C~-15 aral kyloxy
is group (e.g., naphthyloxy), are preferable, and as the
substituent of ring R, a halogen atom (e. g., fluorine atom,
chlorine atom, bromine atom) is preferable.
A compound (IIb), wherein the spacer represented by X is
2o a methylene group optionally having substituent(s), -0- or -S-
the spacer represented by Y is a C1_6 alkylene group
optionally having substituent (s) , -N (R6) -Y1- (R6 is a hydrogen
atom or a C1-6 alkyl group, and Yl is a Cl_6 alkylene group
optionally having substituent (s) ) , -0-Yl- (Yl is a Cl_6 alkylene
2s group optionally having substituent (s) ) or -S-Yl- (Yl is a C1_6
alkylene group optionally having substituent(s)); and ring B
is a 5 to 7-membered carbon ring, is preferable.
56
CA 02505322 2005-05-06
A compound (IVa) wherein ring P3 is a benzene ring having
"the substituent having a benzene ring" represented by the
formula: R11-EZ- (Rll is a phenyl group, an indanyl group or a
naphthyl group, each optionally having substituent(s), and EZ
is a bond or a spacer) is preferable. As E2, a bond, -0- or -
CH2-O- is preferable. As R11, a phenyl group optionally having
substituent(s) selected from a halogen atom and an optionally
halogenated C1_6 alkyl is preferable.
1° As X1, a Cl_6 alkylene group (particularly, a methylene
group) optionally having substituent(s) such as a C1_6 alkyl, a
aryl and the like is preferable.
As W5, a bond is preferable.
As Y1, a Cl_6 alkylene group (particularly, an ethylene
15 group) optionally having substituent(s) is preferable.
As ring R, a phenylene group optionally having a C1_s
alkoxy is preferable.
A compound (IVb) wherein ring S1 is a benzene ring having
2° "the substituent having a benzene ring" represented by the
formula: R11-Ez- (Rll is a phenyl group, an indanyl group or a
naphthyl group, each optionally having substituent(s), and EZ
is a bond or a spacer) is preferable. As Ez, a bond, -0-, -
CH2-0-, -CO-, -CONH-, -N (RZ) -CHZ- (RZ is a hydrogen atom or a
2s Ci-s alkyl group), -S-CH2- or -CH=CH- is preferable, and
particularly, a bond, -0- or -CHZ-0- is preferable. As R11, a
phenyl group, an indanyl group or a naphthyl group (preferably
a phenyl group or an indanyl group), each optionally having
substituent(s) selected from the group consisting of a halogen
3o atom, a nitro, a carboxy, an optionally halogenated C1_6 alkyl,
a hydroxy-C1_6 alkyl, a carboxy-C1_6 alkyl-carbonylamino-C1_6
alkyl, an optionally halogenated Cl_6 alkoxy, a C6_19 aryl, a C6_
aryloxy and a C~_16 aralkyloxy is preferable, and
particularly, a phenyl group optionally having substituent(s)
57
CA 02505322 2005-05-06
selected from a halogen atom, an optionally halogenated C1_6
alkyl, an optionally halogenated Cl_6 alkoxy, a C6_14 aryl, a C6_
14 aryloxy and a C~_16 aralkyloxy is preferable, and
particularly, a phenyl group optionally having substituent(s)
selected from a halogen atom and an optionally halogenated C1_6
alkyl is preferable.
A compound (A) wherein A1 is a bromine atom is preferable.
A compound (C) wherein the partial structural formula
io A I H
is
~ \ / ( °~ /
\ \ NH \ or \ N
each optionally having a substituent selected from a halogen
atom (e. g., chlorine atom) and an optionally halogenated C1_s
15 alkyl group (e. g., methyl, trifluoromethyl) is preferable.
A compound (D) wherein the partial structural formula
A
is
~K
A I A I ~ I /
/ /
or
2o wherein the substituent of ring A is (i) a halogen atom, (ii)
a C1-6 alkyl group, (iii) a C1_6 alkoxy group, (iv) a C6_l9 aryl
group optionally having substituent(s) selected from a halogen
atom and a Cl_6 alkyl, (v) a C6-14 aryloxy group or (vi) a C~-is
58
CA 02505322 2005-05-06
aralkyloxy group, and the substituent of ring R is a halogen
atom, is preferable.
In compound (I-1), p and q are each a Co_q carbon chain
s optionally having substituent(s).
Here, as the Co_9 carbon chain, a bond, a Cl_q alkylene
group (e. g., methylene, ethylene and the like) and the like
can be used, and particularly, a Cl_q alkylene group (e.g.,
methylene, ethylene and the like) is preferable, and methylene
io and ethylene are preferable, and particularly, methylene is
preferable.
As the partial structural formula
/
G
A I A
/ /
or
is and the like are preferable.
As the substituent that the Co_4 carbon chain may have, a
substituent selected from the aforementioned su~stituent group
A can be used. The number of the substituents is, for example,
1 to 3.
2° As the substituent that ring A optionally has, (1) a
halogen atom (e. g., fluorine atom, chlorine atom, bromine
atom), (2) a C1_6 alkyl group (e.g., a C1_3 alkyl group such as
methyl and the like), (3) a C1-6 alkoxy group (e.g., a Cl_3
alkoxy group such as methoxy and the like), (4) a C6-19 aryl
2s group (e. g., phenyl group) optionally substituted by a halogen
atom (e. g., fluorine atom, chlorine atom), a C1_6 alkyl (e. g.,
C1_3 alkyl such as methyl and the like) or a C1-6 alkoxy (e.g.,
C1_3 alkoxy such as methoxy and the like) , (5) a C6_1q aryloxy
59
CA 02505322 2005-05-06
group ( a . g . , phenoxy group ) and ( 6 ) a C-,_16 aralkyloxy group
(e. g., benzyloxy group, phenylethyloxy group, phenylpropyloxy
group, phenylbutyloxy group) are preferable. The number of
the substituents is, for example, 1 to 3.
As the substituent that ring R optionally has, a halogen
atom (e. g., a fluorine atom, a chlorine atom) and a C1-6 alkyl
group (e. g., a C1_3 alkyl group such as methyl and the like)
are preferable, but ring R is more preferably unsubstituted.
As Ra, a hydrogen atom is preferable.
1° As the spacer represented by Xa, an oxygen atom is
preferable.
In compound (I-2), as the substituent(s) having a benzene
ring, a substituent represented by the formula: R11-EZ- (Rll is
Zs a phenyl group, an indanyl group or a naphthyl group, each
optionally having substituent(s), and E2 is a bond or a spacer)
is preferable.
Ring S1 may further has substituent(s) selected from an
optionally substituted C1_6 alkyl group, an optionally
2o s~stituted C1-6 alkoxy group, a halogen atom (e.g., fluorine,
chlorine, bromine, iodine ) and a C~_16 aralkyloxy ( a . g. ,
benzyloxy); preferably a Cl-6 alkyl group. Here, as the
optionally substituted C1-6 alkyl group and the optionally
substituted C1_6 alkoxy group, those exemplified for the
25 aforementioned substituent group A can be used, wherein a C1_6
alkyl group (e. g., methyl) and a C1_6 alkoxy group (e. g.,
methoxy) are preferable, respectively.
The ring S1 is preferably a benzene ring without
additional substituent.
so As R11, a phenyl group optionally having substituent(s) is
preferable.
As R11, a phenyl group, an indanyl group or a naphthyl
group (preferably phenyl group or indanyl group), each
optionally having 1 to 3 substituents selected from the group
CA 02505322 2005-05-06
consisting of a halogen atom (e.g., fluorine, chlorine), a
nitro, a carboxy, an optionally substituted C1_6 alkyl
exemplified for the aforementioned substituent group A
[preferably, an optionally halogenated Cl_6 alkyl (e.g., methyl,
ethyl, propyl, isopropyl, butyl, isobutyl, trifluoromethyl), a
hydroxy-C1_6 alkyl (e.g., hydroxymethyl, hydroxyethyl), a
carboxy-C1_6 alkyl-carbonyl amino-Cl_6 alkyl (e.g.,
carboxyethylcarbonylaminomethyl)], an optionally substituted
C1_6 alkoxy exemplified for the aforementioned substituent
io group A [preferably, an optionally halogenated C1_6 alkoxy
(e.g., methoxy, ethoxy, isopropoxy, trifluoromethoxy) ), a C6-19
aryl ( a . g . , phenyl ) , a C6_14 aryloxy ( a . g . , phenoxy) , a C~_16
aralkyloxy (e.g., benzyloxy), a formyl, a cyano, a hydroxy, a
C1-6 alkylthio ( a . g . , methylthio ) , a C1_6 al koxy-carbonyl ( a , g . ,
i5 methoxycarbonyl, ethoxycarbonyl), a carbamoyl, a mono-Cl-s
alkyl-carbamoyl (e.g., methylcarbamoyl, ethylcarbamoyl), a di-
C1_6 alkyl-carbamoyl (e. g., dimethylcarbamoyl,
diethylcarbamoyl) and a C3_B cycloalkyl (e.g., cyclohexyl) is
preferable, particularly, a phenyl group optionally having
2o s~stituent(s) selected from the group consisting of a halogen
atom, a nitro, a carboxy, an optionally halogenated C1-6 alkyl,
a hydroxy-C1_6 alkyl (e.g., hydroxymethyl, hydroxyethyl), a
carboxy-C1-6 alkyl-carbonyl amino-Cl_6 alkyl (e.g.;
carboxyethylcarbonylaminomethyl), an optionally halogenated C1_
alkoxy, a Cs-19 aryl, a C6-14 aryloxy and a C~_16 aralkyloxy is
preferable.
As E2, a bond, -0-, -CHZ-0-, -CO-, -CONH-, -N (CH3) CHZ-, -
S-CHz-, -C=C-, - ( CHZ ) 2- , - ( CHz ) 20-, - ( CH2 ) s0-, -C (=CH2 ) -, -N (
RZ ) -,
-CHZ-N ( R2 ) -, -CH2-N ( R2 ) -CHZ-, -SOZ-CH2-CHz-N ( RZ ) -CHZ-, -0-CH ( CH3
)
3o CHZ-N (R2) -CH2-, -CH (Ph) -CHZ-N (R2) -CHz-, -CH (Pyr) -CH2-N (R2) -CHz-,
-CH ( CHZ-Pyr ) -N ( RZ ) -CH2-, -CHZ-N ( Ph ) -CH2-, -CHZ-N ( CH2-Ph ) -CH2-,
-
N (CHZ-CH2-CN) -CHZ-, -N (CHZ-CHZ-Imd) -CHZ- (R2 is a hydrogen atom
or a C1_6 alkyl group, Ph is a phenyl group, Pyr is a
pyrrolidinyl group and Imd is imidazopyridinyl) or the like is
61
CA 02505322 2005-05-06
preferable.
E2 is particularly preferably a bond, -O- or -CHZ-0-.
When ring S1 has a substituent represented by the
formula: R11-E2- (the symbols are as defined above), R11 may
form a ring together with EZ and ring S1.
As the ring formed by R11 together with EZ and ring S1,
O
and the like are preferable, but preferably, R11 does not form
a ring together with EZ and ring S1.
1° As the substituent that ring R optionally has, a C1_6
alkyl group (e.g., a C1_3 alkyl group such as methyl and the
like), a halogen atom (e. g., fluorine, chlorine, bromine,
iodine), a C1_6 alkoxy group (e.g., methoxy, ethoxy, propoxy),
a hydroxy group and the like are preferable.
As Ra, a hydrogen atom, a halogen atom (e. g., fluorine,
chlorine, bromine, iodine), a C1_6 alkyl group (e. g., methyl,
ethyl, propyl ) or a Cl_6 alkoxy group ( a . g . , methoxy, ethoxy,
propoxy) is preferable; and a halogen atom (preferably
fluorine) is more preferable.
2o Specific examples of compound (I-2) include,
a compound wherein the substituent(s) having a benzene ring is
a substituent represented by the formula: R11-EZ- (Rll is a
phenyl group or an indanyl group each optionally having
substituent (s) , and EZ is a bond or a spacer) , ring S1 is
25 optionally further substituted by a C1_6 alkyl group, Rll may
form a ring together with E2 and ring S1;
preferably, R1~ is a phenyl group, an indanyl group or a
naphthyl group (preferably a phenyl group or an indanyl group),
each optionally having substituent(s) selected from the group
3o consisting of a halogen atom, a nitro, a carboxy, an
optionally halogenated C1-6 alkyl, a hydroxy-C1-6 alkyl, a
carboxy-C1_6 alkyl-carbonyl amino-Cl_6 alkyl, an optionally
62
CA 02505322 2005-05-06
halogenated Cl_6 alkoxy, a C6_l9 aryl, a C6_l9 aryloxy and a C-,_16
aralkyloxy,
E2 is a bond, -0-, -CHZ-O-, -CO-, -CONH-, -N (CH3) CH2-, -S-CHZ-
or -C=C-,
ring S1 is optionally further substituted by a C1_6 alkyl group,
the ring formed by R11 together with E2 and ring S1 is
O
the substituent that ring R optionally has is a C1_6 alkyl
group, and Ra is a hydrogen atom, and the like, can be
to mentioned.
A compound (I-2) wherein the substituent(s) having a
benzene ring is a substituent represented by the formula: R11-
EZ- (R11 is a phenyl group, an indanyl group or a naphthyl
group, each optionally having substituent(s), and E2 is a bond
is or a spacer) , the spacer represented by EZ is - (CHZ)ml-Wi-
(CHZ)m2- (ml and m2 are each an integer of 0 to 3, Wl is -O-, -
N (RZ) -, -S-, -CO- or -CO-N (R3) -, and Rz and R3 are each a
hydrogen atom or a C1_6 alkyl group) is preferable.
The compound (I-2) is preferably a compound represented
2° by the formula
t
Rita Ea Sla
\ 0 \ R~s
(I-2A)
'COzH
R' ~
wherein Rlia is a phenyl group having 1 or 2 substituents, Ea
is a bond, an oxygen atom or an optionally substituted
methylene, ring Sla is a benzene ring optionally further having
25 substituent(s) selected from an optionally substituted C1_6
alkyl group, an optionally substituted C1_6 alkoxy group and a
halogen atom, and R16 and R17 are the same or different and each
63
CA 02505322 2005-05-06
is a hydrogen atom, a halogen atom, a Cl_6 alkyl group or a C1-6
alkoxy group.
Here, as the substituent of the "phenyl group having 1 or
2 substituents" represented by Rlla, those exemplified for the
substituent of the aforementioned R11 can be used. The
substituent is preferably an optionally substituted C1_6 alkyl
group, an optionally substituted C1-s alkoxy group, a halogen
atom and the like. Here, as the optionally substituted C1-6
alkyl group, the optionally substituted C1_6 alkoxy group and
to the halogen atom, those exemplified for the aforementioned
substituent group A can be respectively used.
Rlla is preferably a phenyl group having two substituents
selected from an optionally substituted C1-6 alkyl group, an
optionally substituted C1_6 alkoxy group and a halogen atom.
is As the "optionally substituted methylene" represented by
Ea, the aforementioned "optionally substituted alkylene group"
exemplified for E2, wherein the alkylene group is methylene,
can be mentioned. Ea is more preferably a bond, an oxygen
atom or methylene, and particularly preferably a bond.
2o The benzene ring represented by ring Sla may further have
substituent(s) selected from an optionally substituted C1_s
alkyl group, an optionally substituted C1_6 alkoxy group and a
halogen atom at substitutable position(s). Here, as the
optionally substituted C1_6 alkyl group, the optionally
2s s~stituted Cl_6 alkoxy group and the halogen atom, those
exemplified for the aforementioned substituent group A can be
respectively used. Ring Sla is preferably a benzene ring
without additional substituent.
R16 and R1' are the same or different and each is a
3o hydrogen atom, a halogen atom (e. g., fluorine, chlorine,
bromine, iodine), a C1_6 alkyl group (e. g., methyl, ethyl,
propyl ) , or a Cl_6 alkoxy group ( a . g. , methoxy, ethoxy,
propoxy). Particularly, R16 is preferably a hydrogen atom and
R1' is preferably a fluorine atom.
64
CA 02505322 2005-05-06
A compound (I-2A) wherein Rlia is a phenyl group having
two substituents selected from an optionally substituted C1_s
alkyl group, an optionally substituted C1-6 alkoxy group and a
halogen atoms Ea is a bond, an oxygen atom or methylene; and
Rls and R1' are the same or different and each is a hydrogen
atom or a halogen atom is preferable. In this compound, Ea is
preferably a bond; or R16 is preferably a hydrogen atom and R1'
is preferably a fluorine atom.
A compound (I-2A) wherein the partial structural formula
zo Rtta Ea Sta i Sta
\ is Rtt =Ea \
wherein the symbols in the formula are as defined above, is
preferable, and the compound wherein Rlla is a phenyl group
having two substituents selected from an optionally
substituted C1-6 alkyl group, an optionally substituted C1-6
i5 alkoxy group and a halogen atom; Ea is a bond; and ring Sla is
a benzene ring without additional substituent is more
preferable.
In compound (I-3), ring M is a benzene ring optionally
having substituent(s). As the substituent that the benzene
2° ring represented by ring M may have, a substituent selected
from the aforementioned substituent group A can"be used.
Ring N is a 5-membered heterocycle optionally having
substituent (s) .
As the 5-membered heterocycle represented by ring N, for
25 example, a 5-membered heterocycle containing, besides carbon
atom, 1 to 3 hetero atoms selected from a nitrogen atam, an
oxygen atom and a sulfur atom, and the like can be used, and
specifically, thiophene, furan, thiazole, oxazole, pyran,
pyrrole, imidazole, pyrazole, isothiazole, isoxazole and the
30 like can be used.
As the substituent that the 5-membered heterocycle
represented by ring N may have, a substituent selected from
CA 02505322 2005-05-06
the aforementioned substituent group A can be used. The
number of the substituents is, for example, 1 to 3.
As the substituent for ring M or ring N, a halogen atom,
an optionally substituted C1_6 alkyl group (e. g., an optionally
halogenated C1_6 alkyl group), an optionally substituted C1_6
alkoxy (e.g., a C1_6 alkoxy optionally substituted by a C1-6
alkoxy) , a C1-6 alkoxy-carbonyl, an optionally substituted C~_16
aralkyloxy (e.g., a C,_16 aralkyloxy optionally substituted by a
C1_6 alkyl) and the like are preferable,
I° In compound (I-3), the partial structural formula
M I N
is preferably
s s o s~
I
or
,each optionally having substituent(s) selected from a halogen
i5 atom (e.g., chlorine atom), an optionally substituted C1-6
alkyl group (e. g., an optionally halogenated C1_6 alkyl group
(e.g., methyl, trifluoromethyl)), an optionally substituted C1_
alkoxy (a. g., a Cl_6 alkoxy optionally substituted by a C1_6
alkoxy (e. g., methoxymethoxy)), a C1-6 alkoxy-carbonyl (e. g.,
tert-butoxycarbonyl) and an optionally substituted C~_ls
aralkyloxy (e. g., a C7_16 aralkyloxy (e. g., benzyloxy)
optionally substituted by a C1-6 alkyl); and more preferably
N H ' \ or \ N
each optionally having substituent(s) selected from a
25 halogen atom (e. g., chlorine atom) and an optionally
substituted C1_6 alkyl group (preferably an optionally
halogenated C1-6 alkyl group (e. g., methyl, trifluoromethyl)).
As ring E, an unsubstituted phenylene group is preferable.
66
CA 02505322 2005-05-06
As Ra, a hydrogen atom is preferable.
In compound (I-4), ring SZ is a benzene ring further
optionally having substituent(s), besides the substituent
represented by the formula: R13-E1- (the symbols are as defined
above ) .
As the substituent that ring SZ may further have, a
substituent selected from the aforementioned substituent group
A can be used, but ring S2 is preferably unsubstituted. That
io is, as ring S2, a benzene ring is preferable.
R13 is a thiazolyl group (preferably 2-thiazolyl group)
optionally having substituent(s). As the substituent that the
thiazolyl group may have, a substituent selected from the
aforementioned substituent group A can be used, particularly,
15 the aforementioned "optionally substituted C6_14 aryl group" and
the aforementioned "optionally substituted C1_6 alkyl group"
are preferable, and particularly (1) a C6-19 aryl group (e. g.,
phenyl), (the C6-14 aryl group may be partially saturated and as
the partially saturated C6_14 aryl group, for example,
2o tetrahydronaphthyl and the like can be mentioned) optionally
having 1 to 3 substituents selected from a halogen atom (e. g.,
fluorine, chlorine, bromine, iodine), an optionally
halogenated C1_6 alkyl group (e. g., methyl, trif~uoromethyl),
an optionally halogenated C1-6 alkoxy group (e. g., methoxy,
2s ethoxy), a C3_$ cycloalkyl group (e.g., cyclohexyl) and the
like; and ( 2 ) a Cl-6 alkyl group (e . g. , a Cl_3 alkyl group such
as methyl, ethyl, propyl, isopropyl and the like) optionally
substituted by optionally esterified carboxyl (e. g., carboxyl)
are preferable. The number of substituents is preferably 1 or
30 2.
The substituent of the thiazolyl group may form a ring
together with a part of the thiazolyl group, and as such ring,
for example, a C3-to cycloalkene (e. g., cyclopropene,
cyclobutene, cyclopentene, cyclohexene) optionally condensed
67
CA 02505322 2005-05-06
with a benzene ring and the like can be mentioned.
As R13, a thiazolyl group (preferably, 2-thiazolyl group)
optionally having 1 or 2 substituent(s) selected from (1) a C6_
14 aryl group ( a . g . , phenyl ) , ( the C6_14 aryl group i s
$ optionally partially saturated, and as the partially saturated
C6-14 aryl group, for example, tetrahydronaphthyl and the like
can be mentioned) optionally having 1 to 3 substituent
selected from a halogen atom (e. g., fluorine, chlorine,
bromine, iodine), an optionally halogenated C1_6 alkyl group
to (e. g., methyl, trifluoromethyl), an optionally halogenated C1_6
alkoxy group (e. g., methoxy, ethoxy), a C3_e cycloalkyl group
(e. g., cyclohexyl) and the like; and (2) a C1-6 alkyl group
(e. g., a C1_3 alkyl group such as methyl, ethyl, propyl,
isopropyl and the like) optionally substituted by optionally
i5 esterified carboxyl (e.g., carboxyl) is preferable; and a
thiazolyl group (preferably, 2-thiazolyl group) optionally
having 1 or 2 substituent(s) selected from a C6_14 aryl (e. g.,
phenyl ) and a C1_6 alkyl ( a . g . , a C1-3 al kyl such as methyl and
the like) is more preferable. The substituent of the
2o thiazolyl group may form a ring together with a part of the
thiazolyl group, and as such ring, for example, a C3_to
cycloalkene (e. g., cyclopropene, cyclobutene, cyclopentene,
cyclohexene) optionally condensed with a benzene ring and the
like can be mentioned.
2s As the spacer represented by E1, those similar to the
aforementioned spacer represented by E can be used.
As E1, for example,
(i) a bond, or
(ii) a spacer represented by -(CHZ)ml-W1-(CHZ)m2-
30 (ml, mz and Wl are as defined above) is preferable,
particularly,
( i ) a bond,
(ii) a Cl_6 alkylene group,
(iii) -N(Rl°)-(CH2)m2- (Rl9 is a hydrogen atom or a C1_6 alkyl
68
CA 02505322 2005-05-06
group and m2 is an integer of 0 to 3),
(iv) -S-(CHZ)m2- (m2 is an integer of 0 to 3) or the like is
preferable, and particularly,
(i) -N(R14)-(CHZ)m2- (R14 is a hydrogen atom or a Cl_6 alkyl
group and mz is an integer of 0 to 3),
(ii) -S-(CH2)m2- (m2 is an integer of 0 to 3) or the like is
preferable.
R19 is a hydrogen atom or a C1_6 alkyl group, and
particularly, a Cl_6 alkyl group is preferable.
to As the Cl_s alkyl group represented by R19, methyl, ethyl,
propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl,
pentyl, isopentyl, neopentyl and hexyl can be used, and
particularly, a C1_3 alkyl group such as methyl and the like
are preferable.
15 As m2, an integer of 1 to 3 is preferable, and 1 is
particularly preferable.
As E1, -N (R19) - (CH2) m2- or -S- (CHZ) m2- (R19 is a hydrogen
atom or a C1_6 alkyl group and m2 is an integer of 0 to 3) is
preferable, particularly, N (Rlq ) - (CH2) m2- is preferable .
Zo As Ra, a hydrogen atom, a halogen atom (e. g., fluorine,
chlorine, bromine, iodine), a C1_6 alkyl group (e. g., methyl,
ethyl, propyl ) or a C1_6 alkoxy group ( a . g . , methoxy, ethoxy,
propoxy) is preferable; a hydrogen atom or a halogen atom
(preferably fluorine) are more preferable.
25 The compound (I-4) is preferably a compound represented
by the formula
R~ S
/~E~a ~ , 0 R~s
Rz~ N
(I-4A)
/ COzH
R'9
wherein Ela is -N (R14) -CHZ-, -CH (R2z) -0- or -CH (Rz2) -CHZ- (Rlq and
R22 are a hydrogen atom or a C1-6 alkyl group) , R18 and Rl9 are
69
CA 02505322 2005-05-06
the same or different and each is a hydrogen atom, a halogen
atom, a C1-6 alkyl group or a C1_6 alkoxy group, and RZ° and RZi
are the same or different and each is a hydrogen atom, an
optionally substituted C6_14 aryl group or an optionally
substituted C1-6 alkyl group, or R2° and R21 are bonded to form a
ring) .
As the Cl_6 alkyl group represented by Rz2, those
exemplified for the aforementioned R19 can be mentioned.
R18 and R19 are the same or different and each is a
io hydrogen atom, a halogen atom (e. g., fluorine, chlorine,
bromine, iodine) , a Cl_s alkyl group (e. g. , methyl, ethyl,
propyl) or a C1_6 alkoxy group (e.g., methoxy, ethoxy, propoxy) .
Particularly, a compound wherein Rl8 and R19 are the same or
different and each is a hydrogen atom or a halogen atom
15 (preferably fluorine) is preferable.
As the "optionally substituted C6_la aryl group" and
"optionally substituted C1_s alkyl group" represented by R2° or
R21, those exemplified for the aforementioned substituent group
A can be respectively used.
The "optionally substituted a C6_1~ aryl group" is
preferably a C6-14 aryl group (e.g., phenyl) optionally having 1
to 3 substituents selected from a halogen atom (e. g., fluorine,
chlorine, bromine, iodine), an optionally halogenated C1_6
alkyl group (e. g., methyl, trifluoromethyl), an optionally
25 halogenated Cl_6 alkoxy group (e.g. , methoxy, ethoxy) , a C3_e
cycloalkyl group (e. g., cyclohexyl) and the like. The C6_19
aryl group is optionally partially saturated and as the
partially saturated C6_la aryl group, for example,
tetrahydronaphthyl and the like can be mentioned.
3o The "optionally substituted C1_s alkyl group" is
preferably a C1_6 alkyl group optionally substituted by an
optionally esterified carboxyl (e. g., carboxyl), (e. g., methyl,
carboxylmethyl, ethyl, propyl, isopropyl) and the like.
As the ring formed by RZ° and R21 in junction is, for
CA 02505322 2005-05-06
example, a C3_lo cycloalkene (e. g., cyclopropene, cyclobutene,
cyclopentene, cyclohexene) optionally condensed with a benzene
ring and the like can be mentioned.
Ela is preferably -N (R1q) -CHZ- (R14 is as defined above) .
s Further, R18 and Rl9 are preferably the same or different and
each is a hydrogen atom or a halogen atom (preferably
fluorine).
Specific examples of preferable compounds used in the
io present invention are shown in the following.
(R)-4-[(2,3-dihydro-1H-inden-1-yl)oxy]benzenepropanoic acid
(Example 41);
4-[[3-[(2,3-dihydro-1H-inden-1-
yl)oxy]phenyl]methoxy]benzenepropanoic acid (Example 136);
is 3-[4-[(2',6'-dimethylbiphenyl-3-yl)methoxy]-2-
fluorophenyl]propionic acid (Example 205);
3-[4-[[4-[[4,5-dihydronaphtho[1,2-d][1,3]thiazol-2-
yl(propyl)amino]methyl]benzyl]oxy]phenyl]propionic acid
(Example 223) ;
20 3-[4-[[4-(2,6-dimethylbenzyl)benzyl]oxy]phenyl]propanoic acid
(Example 253);
3-{4-[(4-{[isopropyl(4-phenyl-1,3-thiazol-2-
yl)amino]methyl}benzyl)oxy]phenyl}propanoic acid (Example
259) ;
2s 3- ( 4- ( ( 4- ( ( ( 2-
phenoxypropyl)amino)methyl)benzyl)oxy)phenyl)propanoic acid
(Example 312);
3-(4-((4-((dibenzylamino)methyl)benzyl)oxy)phenyl)propanoic
acid (Example 330);
30 3-(4-((4-(((2-imidazo[1,5-a]pyridin-3-
ylethyl)(phenyl)amino)methyl)benzyl)oxy)phenyl)propanoic acid
(Example 334);
3-(2-(4-((3-phenoxybenzyl)oxy)phenyl)ethyl)-1,2,4-oxadiazol-
5(4H)-one (Reference Example 213).
71
CA 02505322 2005-05-06
Further, as the compound used in the present invention,
the compounds described in JP-A-2002-265457, JP-A-2002-212171,
JP-A-2001-226350, JP-A-2001-199971, JP-A-2000-198772, JP-A-
s 2000-80086, JP-A-2000-34266, JP-A-09-323983, JP-A-08-311065
and the like can be also used.
As a salt of a compound used in the present invention,
for example, metal salts, ammonium salts, salts with organic
bases, salts with inorganic acids, salts with organic acids,
to salts with basic or acidic amino acids and the like.
Preferable examples of the metal salt include alkali metal
salts such as sodium salt, potassium salt and the like;
alkaline earth metal salts such as calcium salt, magnesium salt,
barium salt and the like; aluminum salt, and the like.
is preferable examples of the salt with organic base include a
salt with trimethylamine, triethylamine, pyridine, picoline,
2,6-lutidine, ethanolamine, diethanolamine, triethanolamine,
cyclohexylamine, dicyclohexylamine, N,N'-
dibenzylethylenediamine and the like. Preferable examples of
2o the salt with inorganic acid include a salt with hydrochloric
acid, hydrobromic acid, nitric acid, sulfuric acid, phosphoric
acid and the like. Preferable examples of the salt with
organic acid include a salt with formic acid, ac~'etic acid,
trifluoroacetic acid, phthalic acid, fumaric acid, oxalic acid,
Zs tartaric acid, malefic acid, citric acid, succinic acid, malic
acid, methanesulfonic acid, benzenesulfonic acid, p-
toluenesulfonic acid and the like. Preferable examples of the
salt with basic amino acid include a salt with arginine, lysin,
ornithine and the like. Preferable examples of the salt with
3o acidic amino acid include a salt with aspartic acid, glutamic
acid and the like.
Of these, a pharmacologically acceptable salt is
preferable. For example, when the compound has an acidic
functional group, inorganic salts such as alkali metal salts
72
CA 02505322 2005-05-06
(e. g., sodium salt, potassium salt etc.), alkaline earth metal
salts (e. g., calcium salt, magnesium salt, barium salt etc.)
and the like, ammonium salt and the like are preferable, and
when the compound has basic functional group, salts with
inorganic acid such as hydrochloric acid, hydrobromic acid,
nitric acid, sulfuric acid, phosphoric acid and the like; or
salts with organic acid such as acetic acid, phthalic acid,
fumaric acid, oxalic acid, tartaric acid, malefic acid, citric
acid, succinic acid, methanesulfonic acid, p-toluenesulfonic
1° acid and the like are preferable.
A prodrug of the compounds (I'), (I), compound (I-1),
compound (I-2), compound (I-2A), compound (I-3), compound (I-
4), compound (I-4A), compound (Ia), compound (Ib), compound
(II), compound (IIa), compound (IIb), compound (III), compound
is (IV), compound (IVa), compound (IVb), compound (A), compound
(B), compound (C), compound (D) and a salt thereof of the
present invention (hereinafter sometimes to be abbreviated as
compound (I) of the present invention) is a compound that
converts to compound (I) of the present invention due to the
2° reaction by enzyme, gastric acid and the like under the
physiological conditions in the body; that is, a compound that
converts to compound (I) of the present invention by enzymatic
oxidation, reduction, hydrolysis and the like, and a compound
that converts to compound (I) of the present invention by
zs hydrolysis and the like by gastric acid and the like.
Examples of a prodrug of compound (I) of the present
invention include a compound wherein an amino group of
compound (I) of the present invention is acylated, alkylated
or phosphorylated (e.g., compound where amino group of
so compound (I) of the present invention is eicosanoylated,
alanylated, pentylaminocarbonylated, (5-methyl-2-oxo-1,3-
dioxolen-4-yl)methoxycarbonylated, tetrahydrofuranylated,
pyrrolidylmethylated, pivaloyloxymethylated, tert-butylated
and the like); a compound wherein a hydroxy group of compound
73
CA 02505322 2005-05-06
(I) of the present invention is acylated, alkylated,
phosphorylated or borated (e. g., a compound where a hydroxy
group of compound (I) of the present invention is acetylated,
palmitoylated, propanoylated, pivaloylated, succinylated,
fumarylated, alanylated, dimethylaminomethylcarbonylated and
the like); a compound wherein a carboxyl group of compound (I)
of the present invention is esterified or amidated (e.g., a
compound where a carboxyl group of compound (I) of the present
invention is ethyl esterified, phenyl esterified,
1° carboxymethyl esterified, dimethylaminomethyl esterified,
pivaloyloxymethyl esterified, ethoxycarbonyloxyethyl
esterified, phthalizyl esterified, (5-methyl-2-oxo-1,3-
dioxolen-4-yl)methyl esterified, cyclohexyloxycarbonylethyl
esterified, methylamidated and the like) and the like. Of
is these, a compound wherein a carboxyl group of compound (I) of
the present invention is esterified by a C1_6 alkyl group such
as methyl, ethyl, tert-butyl and the like can be preferably
used. These compounds can be produced from compound (I) of
the present invention by a method known per se.
2° A prodrug of compound (I) of the present invention may be
a compound that converts to compound (I) of the present
invention under physiological conditions as described in
IYAKLTHIN NO KAIHATSU, vol. 7, BUNSHI SEKF~I, 163'-198, Hirokawa
Shoten (1990).
Hereinafter the production methods of the compound or a
salt thereof of the present invention are explained.
The production methods of compound (I-1), compound (I-2),
compound (I-3) and compound (I-4) of the present invention are
3o described in the following.
The compound (I-2A) and compound (I-4A) of the present
invention can be produced in the same manner as compound (I-2)
and compound (I-4), respectively.
Each symbol of the compounds in the schematic drawings
74
CA 02505322 2005-05-06
of the following reaction schemes is as defined above unless
otherwise specified. The compound in the reaction schemes
include salts, and as such salts, for example, those similar
to the salts of the above-mentioned compounds to be used in
the present invention and the like can be mentioned.
The resulting products can be used for the next reaction
in the form of a reaction mixture or as a crude product. They
can also be isolated from the reaction mixture by conventional
methods, and can be easily purified by separation means such as
to recrystallization, distillation, chromatography and the like.
The compound (I-1) of the present invention can be
produced by, for example, by the method shown in the following
Reaction Scheme 1 or a method analogous thereto.
For compounds (V), (VI), (VII) and (VIII), commercially
available ones can be easily obtained, or they can be also
produced by a method known per se or a method analogous
thereto.
Reaction Scheme 1
/ P / P / P
\ I ~ L \ I ~ O H E--- \ I ~ O
a
4 4
(vl I ~ (vl ) (v)
H Xa / (VI I I) ,
CHZCOOR75
Ra
/ I P A I P~--Xa
A ,--Xa
R I ~s \ q R I
\ CHZCOOR \ CHZCOOH
(IX)
Ra (I-1) Ra
2o The compound (VI) can be produced by reducing the
carbonyl group of compound (V).
As a reducing agent to be used for the reduction, for
example, metal hydrides such as aluminum hydride,
diisobutylaluminum hydride, tributyltin hydride and the like,
CA 02505322 2005-05-06
metal hydride complex compounds such as lithium aluminum
hydride, sodium borohydride and the like, borane complexes
such as a borane tetrahydrofuran complex, a borane dimethyl
sulfide complex and the like, alkylboranes such as
thexylborane, disiamylborane and the like, metals such as
diborane, zinc, aluminum, tin, iron and the like, alkali metal
(e. g., sodium, lithium and the like)/liquid ammonia (Birch
reduction) and the like can be mentioned. The amount of the
reducing agent to be used is, for example, about 1 to about 10
Io mol, preferably about 1 to about 5 mol, per 1 mol of compound
(V) in the case of metal hydrides or metal hydride complex
compounds, about 1 to about 10 mol, preferably about 1 to
about 5 mol, per 1 mol of compound (V) in the case of borane
complexes, alkylboranes or diborane, and about 1 to about 20
ss equivalent, preferably about 1 to about 5 equivalent in the
case of metals. In this reaction, a Lewis acid may be used
when desired. As the "Lewis acid", for example, aluminum
chloride, aluminum bromide, titanium (IV) chloride, tin (II)
chloride, zinc chloride, boron trichloride, boron tribromide,
2o boron trifluoride and the like can be used. The amount of the
Lewis acid to be used is about 1 to about 10 mol, preferably
about 1 to about 5 mol, per 1 mol of compound (V).
In addition, reduction can be performed by'hydrogenation
reaction, and in this case, for example, catalysts such as
ZS palladium carbon, platinum oxide (IV), Raney-nickel, Raney-
cobalt and the like, and the like can be used. The amount of
the catalyst to be used is about 5 to about 1000 wt~,
preferably about 10 to about 300 wt~, per 1 mol of compound
(V). Various hydrogen sources can be also used instead of the
3o gaseous hydrogen. As the "hydrogen sources", formic acid,
ammonium formate, triethylammonium formate, sodium phosphinate,
hydrazine and the like can be used. The amount of the
hydrogen sources to be used is about 1 to about 10 mol,
preferably about 1 to about 5 mol, per 1 mol of compound (V).
76
CA 02505322 2005-05-06
This reaction is advantageously carried out in a solvent
inert to the reaction. Such solvent is not particularly
limited as long as the reaction proceeds, but a solvent, for
example, alcohols such as methanol, ethanol, 1-propanol, 2-
propanol, tert-butyl alcohol and the like, ethers such as
diethyl ether, diisopropy ether, diphenyl ether,
tetrahydrofuran, 1,4-dioxane, 1,2-dimethoxyethane and the like,
hydrocarbons such as benzene, toluene, cyclohexane, hexane and
the like, amides such as N,N-dimethylformamide, N,N-
to dimethylacetamide, hexamethylphosphoric triamide and the like,
organic acids such as formic acid, acetic acid, propionic acid,
trifluoroacetic acid, methanesulfonic acid and the like, and
the like, a mixed solvent thereof and the like are preferable.
15 While the reaction time varies depending on the kind and
amount of the reducing agent to be used or activity and amount
of catalyst, it is generally about 1 hr to about 100 hr,
preferably about 1 hr to about 50 hr. The reaction
temperature is generally about -20 to about 120 °C, preferably
2° about 0 to about 80°C. When a hydrogenating catalyst is used,
the pressure of hydrogen is generally about 1 to about 100 atm.
The compound (VII) wherein L is a leaving group can be
produced by converting the hydroxy group of compound (VI) to a
25 "leaving group".
As the "leaving group" represented by L, for example, a
halogen atom such as fluorine, chlorine, bromine, iodine and
the like, an optionally halogenated C1_6 alkylsulfonyloxy group
such as methanesulfonyloxy, ethanesulfonyloxy,
so trichloromethanesulfonyloxy and the like, a Cs-to
arylsulfonyloxy group optionally having substituent(s) and the
like can be mentioned. As the "C6_lo arylsulfonyloxy group
optionally having substituent(s)", for example, a C6_lo
arylsulfonyloxy group (e. g., phenylsulfonyloxy,
77
CA 02505322 2005-05-06
naphthylsulfonyloxy and the like) optionally having 1 to 3
substituent selected from a Cl_6 alkyl group (e.g., methyl,
ethyl and the like), a Cl_6 alkoxy group (e.g., methoxy, ethoxy
and the like) and nitro, and the like can be mentioned, and
specific examples include phenylsulfonyloxy, m-
nitrophenylsulfonyloxy, p-toluenesulfonyloxy and the like can
be mentioned.
When the "leaving group" represented by L is a halogen
atom, as a halogenating agent to be used for halogenation, for
io example, thionyl halides such as thionyl chloride, thionyl
bromide and the like, phosphoryl halides such as phosphoryl
chloride, phosphoryl bromide and the like, phosphorus halides
such as phosphorus pentachloride, phosphorus trichloride,
phosphorous pentabromide, phosphorus tribromide and the like,
is oxalyl halides such as oxalyl chloride and the like, phosgene
and the like can be mentioned. A halogenating agent is used
in a proportion of about 0.1 to about 30 mol, preferably about
0.2 to about 10 mol, more preferably about 1 to about 10 mol,
per 1 mol of compound (VI).
2° When desired, this reaction is carried out in the
presence of a base. As the "base", tertiary amines such as
triethylamine, tripropylamine, tributylamine, N-
ethyldiisopropylamine, cyclohexyldimethylamine,'4-
dimethylaminopyridine, N,N-dimethylaniline, N-methylpiperidine,
25 N-methylpyrrolidine, N-methylmorpholine and the like, and the
like can be mentioned, which is used in about 1 to about 20
mol, preferably about 1 to about 10 mol, per 1 mol of compound
(VI) .
This reaction is advantageously carried out without
3o solvent or in a solvent inert to the reaction. Such solvent
is not particularly limited as long as the reaction proceeds,
but a solvent, for example, hydrocarbons such as benzene,
toluene, cyclohexane, hexane and the like, ethers such as
diethyl ether, diisopropy ether, diphenyl ether,
78
CA 02505322 2005-05-06
tetrahydrofuran, 1,4-dioxane, 1,2-dimethoxyethane and the like,
amides such as N,N-dimethylformamide, N,N-dimethylacetamide,
hexamethylphosphoric triamide and the like, halogenated
hydrocarbons such as dichloromethane, chloroform, carbon
tetrachloride, 1,2-dichloroethane and the like, and the like,
a mixed solvent thereof and the like are preferable.
The reaction time is generally about 10 min to about 12
hr, preferably about 10 min to about 5 hr. The reaction
temperature is generally about -10 to about 200°C, preferably
to about -10 to about 120°C.
When the "leaving group" represented by L is an
optionally halogenated C1_s alkylsulfonyloxy group or a C6_lo
arylsulfonyloxy group optionally having substituent(s), as the
sulfonylating agent, for example, halogenated C1-6
is alkylsulfonyl (e. g., methanesulfonyl chloride and the like),
halogenated C6-to arylsulfonyl (e. g., benzenesulfonyl chloride,
p-toluenesulfonyl chloride and the like), and the like can be
mentioned. The sulfonylating agent is used in about 1 to
about 20 mol, preferably about 1 to about 10 mol, per 1 mol of
2o compound (VI ) .
This reaction is advantageously carried out without
solvent or in a solvent inert to the reaction. Such solvent
is not particularly limited as long as the reaction proceeds,
but a solvent, for example, hydrocarbons such as benzene,
25 toluene, cyclohexane, hexane and the like, ethers such as
diethyl ether, diisopropy ether, diphenyl ether,
tetrahydrofuran, 1,4-dioxane, 1,2-dimethoxyethane and the like,
halogenated hydrocarbons such as dichloromethane, chloroform,
carbon tetrachloride, 1,2-dichloroethane and the like, esters
3o such as methyl acetate, ethyl acetate, butyl acetate and the
like, and the like, a mixed solvent thereof and the like are
preferable.
This reaction is carried out in the presence of a base
when desired. As the "base", tertiary amines such as
79
CA 02505322 2005-05-06
triethylamine, tripropylamine, tributylamine, N-
ethyldiisopropylamine, cyclohexyldimethylamine, 4-
dimethylaminopyridine, N,N-dimethylaniline, N-methylpiperidine,
N-methylpyrrolidine, N-methylmorpholine and the like,
inorganic bases such as sodium hydroxide, potassium hydroxide,
lithium hydroxide, barium hydroxide and the like, basic salts
such as sodium carbonate, potassium carbonate, cesium
carbonate, sodium hydrogencarbonate, sodium acetate, ammonium
acetate and the like, and the like can be mentioned. The base
io is used in about 1 to about 20 mol, preferably about 1 to
about 10 mol, per 1 mol of compound (VI).
The reaction time is generally about 10 min to about 12
hr, preferably about 10 min to about 5 hr. The reaction
temperature is generally about -30 to about 150°C, preferably
about -20 to about 100°C.
The compound (IX) wherein Rls is a hydrocarbon group
optionally having substituent(s) and Xa is an oxygen atom or a
sulfur atom, can be produced by condensing compound (VII) with
compound (VIII) in the presence of a base.
2o As the "hydrocarbon group optionally having
substituent(s)" represented by R15, "optionally substituted
lower (C1_6) alkyl", "optionally substituted lower (CZ_6) alkenyl",
"optionally substituted lower(C2_6) alkynyl", "optionally
substituted lower(CZ_s) alkynyl", "optionally substituted C3-a
2$ cycloalkyl", "optionally substituted C6_14 aryl", "optionally
substituted C~_16 aralkyl" and the like of the above-mentioned
substituent group A are preferable.
As the substituent that the "hydrocarbon group" of the
"hydrocarbon group optionally having substituent(s)"
3o represented by R15 may have, the above-mentioned substituent
group A and the like are preferable. The "hydrocarbon group"
of the "hydrocarbon group optionally having substituent(s)"
represented by R13 may have 1 to 5, preferably 1 to 3
substituents mentioned above at substitutable positions) of
CA 02505322 2005-05-06
the hydrocarbon group. When the number of substituents is not
less than 2, respective substituents may be the same or
different.
As the base to be used for this reaction, inorganic bases
such as sodium hydroxide, potassium hydroxide, lithium
hydroxide, barium hydroxide and the like, basic salts such as
sodium carbonate, potassium carbonate, cesium carbonate,
sodium hydrogencarbonate, sodium acetate, ammonium acetate and
the like, aromatic amines such as pyridine, lutidine and the
to like, tertiary amines such as triethylamine, tripropylamine,
tributylamine, N-ethyldiisopropylamine,
cyclohexyldimethylamine, 4-dimethylaminopyridine, N,N-
dimethylaniline, N-methylpiperidine, N-methylpyrrolidine, N-
methylmorpholine and the like, alkali metal hydrides such as
i5 sodium hydride, potassium hydride and the like, metal amides
such as sodium amide, lithium diisopropylamide, lithium
hexamethyldisilazide and the like, metal alkoxides such as
sodium methoxide, sodium ethoxide, sodium tert-butoxide,
potassium tert-butoxide and the like, and the like can be
2o mentioned. These bases are used in about 1-10 mol, preferably
about 1-3 mol, per 1 mol of compound (IX).
This reaction is advantageously carried out using a
solvent inert to the reaction. Such solvent is~not
particularly limited as long as the reaction proceeds, but a
2s solvent, for example, alcohols such as methanol, ethanol, 1-
propanol, 2-propanol, tert-butyl alcohol and the like, ethers
such as diethyl ether, diisopropy ether, diphenyl ether,
tetrahydrofuran, 1,4-dioxane, 1,2-dimethoxyethane and the like,
hydrocarbons such as benzene, toluene, cyclohexane, hexane and
3o the like, amides such as N,N-dimethylformamide, N,N-
dimethylacetamide, hexamethylphosphoric triamide and the like,
halogenated hydrocarbons such as dichloromethane, chloroform,
carbon tetrachloride, 1,2-dichloroethane and the like,
nitrites such as acetonitrile, propionitrile and the like,
81
CA 02505322 2005-05-06
esters such as methyl acetate, ethyl acetate, butyl acetate
and the like, sulfoxides such as dimethyl sulfoxide and the
like, water and the like, mixed solvent thereof and the like
are preferable.
The reaction time is generally about 10 min to about 12
hr, preferably about 20 min to about 6 hr. The reaction
temperature is generally about -50 to about 150°C, preferably
about -20 to about 100°C.
The compound (IX) wherein Xa is an oxygen atom or a
to sulfur atom can be also produced by condensing compound (VI)
with compound (VIII) in the presence of a dehydrating agent
when desired.
As the dehydrating agent usable for this reaction, for
example, acidic catalysts such as hydrochloric acid, sulfuric
15 acid, phosphoric acid, potassium hydrosensulfate, oxalic acid,
p-toluenesulfonic acid, 10-camphorsulfonic acid, borone
trifluoride ether complex and the like, basic catalysts such
as sodium hydroxide, potassium hydroxide and the like, and the
like can be mentioned, further, for example, carbodiimides
2° such as N,N'-dicyclohexylcarbodiimide and the like, alumina,
sodium dioxide, phosphorus oxychloride, thionyl chloride,
methanesulfonylchloride and the like may be used. These acid
and base are used in about 0.1-10 mol, preferably about 0.1-
5.0 mol, per 1 mol of compound (VIII).
25 This reaction is advantageously carried out without
solvent or in a solvent inert to the reaction. While the
solvent is not particularly limited as long as the reaction
proceeds, a solvent, for example, alcohols such as methanol,
ethanol, propanol and the like, ethers such as diethyl ether,
3o tetrahydrofuran, dioxane, 1,2-dimethoxyethane and the like,
organic acids such as formic acid, acetic acid and the like,
hydrocarbons such as benzene, toluene, cyclohexane, hexane and
the like, amides such as N,N-dimethylformamide, N,N-
dimethylacetamide and the like, sulfoxides such as dimethyl
82
CA 02505322 2005-05-06
sulfoxide and the like, and the like, a mixed solvent thereof
and the like are preferable.
The reaction time is generally 30 min-24 hr, preferably
30 min-5 hr. The reaction temperature is generally 0-200°C,
s preferably 0-150°C.
The compound (IX) wherein Xa is an oxygen atom can be
also produced by condensing compound (VI) with compound (VIII)
by Mitsunobu reaction (Synthesis, 1981, 1-27).
For this reaction, compound (VIII) is reacted with
to compound (VI) in the presence of azodicarboxylates such as
diethyl azodicarboxylate, diisopropyl azodicarboxylate, 1,1'-
(azodicarbonyl)dipiperidine and the like, and the like and
phosphines such as triphenylphosphine, tributylphosphine and
the like.
zs The amount of compound (VI) to be used is about 1 to
about 5 mol, preferably about 1 to about 2 mol, relative to 1
mol of compound (VIII).
The amount of the "azodicarboxylates" and "phosphines" to
be used is about 1 to about 5 mol, preferably about 1 to about
Zo 2 mol, relative to 1 mol of compound (VIII), respectively.
This reaction is advantageously carried out using a
solvent inert to the reaction. Such solvent is not
particularly limited as long as the reaction proceeds, but a
solvent, for example, ethers such as diethyl ether, diisopropy
2s ether, diphenyl ether, tetrahydrofuran, 1,4-dioxane, 1,2-
dimethoxyethane and the like, hydrocarbons such as benzene,
toluene, cyclohexane, hexane and the like, amides such as N,N-
dimethylformamide, N,N-dimethylacetamide, hexamethylphosphoric
triamide and the like, halogenated hydrocarbons such as
3o dichloromethane, chloroform, carbon tetrachloride, 1,2-
dichloroethane and the like, nitriles such as acetonitrile,
propionitrile and the like, ketones such as acetone, ethyl
methyl ketone and the like, sulfoxides such as dimethyl
sulfoxide and the like, and the like, a mixed solvent thereof
83
CA 02505322 2005-05-06
and the like are preferable.
The reaction time is generally about 5 min to about 48 hr,
preferably about 10 min to about 24 hr. The reaction
temperature is generally about -20 to about 200°C, preferably
about 0 to about 100°C.
The compound (I-1) is produced by hydrolyzing the ester
group of compound (IX) using an acid or a base. For acid
hydrolysis, mineral acids such as hydrochloric acid, sulfuric
acid and the like, Lewis acids such as boron trichloride,
to boron tribromide and the like, Lewis acid and thiol or sulfide
in combination, organic acids such as trifluoroacetic acid, p-
toluenesulfonic acid and the like can be generally used. For
alkaline hydrolysis, inorganic bases such as sodium hydroxide,
potassium hydroxide, barium hydroxide and the like, basic
is salts such as sodium carbonate, potassium carbonate and the
like, metal alkoxides such as sodium methoxide, sodium
ethoxide, potassium tert-butoxide and the like, organic bases
such as triethylamine, imidazole, formamidine and the like,
and the like can be used. These acid and base are used in
2o about 0.5-10 mol, preferably about 0.5-6 mol, per 1 mol of
compound (IX) .
This reaction is advantageously carried out without
solvent or in a solvent inert to the reaction. rSuch solvent
is not particularly limited as long as the reaction proceeds,
2s but a solvent, for example, alcohols such as methanol, ethanol,
propanol and the like, aromatic hydrocarbons such as benzene,
toluene and the like, saturated hydrocarbons such as
cyclohexane, hexane and the like, organic acids such as formic
acid, acetic acid and the like, ethers such as tetrahydrofuran,
3o dioxane, 1,2-dimethoxyethane and the like, amides such as N,N-
dimethylformamide, N,N-dimethylacetamide and the like,
halogenated hydrocarbons such as dichloromethane, chloroform,
carbon tetrachloride, 1,2-dichloroethane and the like,
nitriles such as acetonitrile, propionitrile and the like,
84
CA 02505322 2005-05-06
ketones such as acetone, methyl ethyl ketone and the like,
sulfoxides such as dimethyl sulfoxide and the like, water and
the like, a mixed solvent thereof and the like are preferable.
The reaction time is generally 10 min-60 hr, preferably
10 min-12 hr. The reaction temperature is generally -10-200°C,
preferably 0-120°C.
The compound (I-2) of the present invention can be
produced by, for example, the method represented by the
to following Reaction Scheme 2 or a method analogous thereto.
Reaction Scheme 2
\
i
\
H O \ (XI) ~ j O
/ CHZCOOR~S ~ \
/ CHZCOOR~S
Ra
(X) Ra
\ (XII)
O
% CHZCOOH
Ra
( 1 -2)
For compounds (X) and (XI), commercially available ones
can be easily obtained, or they can be also produced by a
is method known per se or a method analogous thereto.
The compound (XII) can be produced by condensing compound
(X) with compound (XI) wherein L1 is a leaving group.
As the "leaving group" represented by L1, those similar
to the aforementioned "leaving group" represented by L, a
2° hydroxy group and the like can be mentioned.
When the "leaving group" represented by L1 is a hydroxy
group, compound (XII) can be produced from compound (X) and
compound (XI) by a method similar to the method of producing
compound (IX) from compound (VI).
CA 02505322 2005-05-06
When the "leaving group" represented by L1 is a halogen
atom, an optionally halogenated C1_6 alkylsulfonyloxy group or
a C6_lo arylsulfonyloxy group optionally having substituent(s),
compound (XII) can be produced from compound (X) and compound
(XI) by a method similar to the method of producing compound
(IX) from compound (VII).
The compound (I-2) can be produced from compound (XII) by
a method similar to the method of producing compound (I-1)
from compound (IX).
to The compound (I-2) of the present invention can be also
produced by, for example, the method represented by the
following Reaction Scheme 3 or a method analogous thereto.
Reaction Scheme 3
M
Bz
\ ~ (XIV)
S O
% O \ ~ / \
R
CHzCOOR~s ~ / CHzCOOR~s
(X111) Ra Ra
(XV)
j O
CHzCOOH
r
( I -2) Ra
15 For compounds (XIII) and (XIV) , commercially available
ones can be easily obtained, or they can be also produced by a
method known per se or a method analogous thereto.
The compound (XV) can be produced by condensing compound
(XIII) (wherein B1 is a benzene ring optionally further having
2o s~stituent (s) besides L) with compound (XIV) (wherein M is a
metal and B2 is a benzene ring optionally further having
substituent(s) besides M or an aromatic ring further having,
besides M, substituent(s) having a benzene ring).
As the "benzene ring optionally having substituent(s)"
25 represented by B1 or B2, those similar to ring A and the like
86
CA 02505322 2005-05-06
can be mentioned. As the "metal" represented by M, potassium,
sodium, lithium, magnesium, mercury, zinc, thallium, tin,
boron and the like can be mentioned. They may be in the form
of complex.
As the substituent that the "benzene ring optionally
having substituent(s)" represented by B1 and BZ may have, a
substituent selected from the above-mentioned substituent
group A and the like can be mentioned.
This reaction is advantageously carried out in the
1° presence of a catalyst when desired. As the "catalyst",
nickel complex, palladium complex, copper and the like can be
mentioned. The catalyst is used in about 0.005 to about 2 mol,
preferably about 0.01 to about 1 mol, per 1 mol of compound
(XIII) .
I5 This reaction is advantageously carried out using a
solvent inert to the reaction. Such solvent is not
particularly limited as long as the reaction proceeds, but a
solvent, for example, hydrocarbons such as benzene, toluene,
cyclohexane, hexane and the like, ethers such as diethyl ether,
2o diisopropy ether, diphenyl ether, tetrahydrofuran, 1,4-dioxane,
1,2-dimethoxyethane and the like, halogenated hydrocarbons
such as dichloromethane, chloroform, carbon tetrachloride,
1,2-dichloroethane and the like, and the like, a mixed solvent
thereof and the like are preferable.
25 The reaction time is generally about 10 min to about 48
hr, preferably about 10 min to about 24 hr. The reaction
temperature is generally about -80 to about 250°C, preferably
about -20 to about 150°C.
The compound (I-2) can be also produced from compound
30 (XV) by a method similar to the method of producing compound
( I-1 ) f rom compound ( IX ) .
The compound (I-3) of the present invention can be
produced by, for example, the method represented by the
87
CA 02505322 2005-05-06
following Reaction Scheme 4 or a method analogous thereto.
Reaction Scheme 4
L~
M I N
H \ / H
H O (XVII) I O
M N
\ ~ CHZCOOR~3 ~ ~ CHZCOOR~3
H ~ v H
Ra Ra
(XVI)
(xv I I I )
H
M I N O /
E
H \ ( CH2COOH
Ra
( I -3)
For compounds (XVI) and (XVII), commercially available
ones can be easily obtained, or they can be also produced by a
method known per se or a method analogous thereto.
The compound (XVIII) can be produced by condensing
compound (XVI) with compound (XVII) by a method similar to
that of producing compound (XII) from compound (X) and
io compound (XI) .
The compound (I-3) can be produced from compound (XVIII)
by a method similar to the method of producing compound (I-1)
r
from compound (IX).
15 The compound (I-4) of the present invention can be
produced by, for example, the method represented by the
following Reaction Scheme 5 or a method analogous thereto.
D o ~ r.+- ; r, r, C r. l, o", o
88
CA 02505322 2005-05-06
HO
CHZCOOR~s
R ~3 E' S
Ra / O
(X) ~ / CHZCOOR~s
Ra
R~3 E~ S
~L~
(XIX)
R~3 Ey S
/ O \
/ CH2COOH
( t -4) Ra
For compounds (X) and (XIX), commercially available ones
can be easily obtained, or they can be also produced by a
method known per se or a method analogous thereto.
The compound (XX) can be produced by condensing compound
(X) with compound (XIX) by a method similar to that of
producing compound (XII) from compound (X) and compound (XI).
The compound (I-4) can be produced from compound (XX) by
a method similar to the method of producing compound (I-1)
1 ° from compound ( IX ) .
Of the compounds (I-4) of the present invention, a
compound wherein El is -N (R14) - (CHZ)m2- can be also produced by,
for example, the method represented by the following Reaction
Scheme 6 or a method analogous thereto.
1.5 Ro'~1-i nn Cr-homo G,
89
CA 02505322 2005-05-06
HO
CH2COOR~S
Ra \
(X) L-(CH2) m2 / L~
(XXI)
L-(CH2) m2 S2
/ O \
/ CHZCOOR~S
Ra
R is
(xxlll>
R ~4 N H
Rya E~ S
/ O \
% CH2COOR~S
(XX) Ra
[E~=-N (R~4) - (CHZ) m2-]
R~3 E~ S r
O \
CH2COOH
Ra
( 1 -4)
[E~=-N (R~4) - (CHZ) m2-]
For compounds(X), (XXI) and (XXIII), commercially
available ones can be easily obtained, or they can be also
produced by a method known per se or a method analogous
thereto.
The compound (XXII) can be produced by condensing
compound (X) with compound (XXI) by a method similar to that
of producing compound (XII) from compound (X) and compound
CA 02505322 2005-05-06
(XI). In addition, the compound can be also produced from
compound (X) by multi-step reactions including protection of
functional group and deprotection thereof.
Of the compounds (XX) , a compound wherein El is -N (Rla) -
(CHZ)m2- can be also produced from compound (XXII) and compound
(XXIII) by a method similar to that of producing compound (IX)
from compound (VII) and compound (VIII).
Of the compounds ( I-4 ) , a compound wherein E1 is -N (R1' ) -
(CHZ)m2- can be also produced from compound (XX) wherein E1 is
so _N (R1q ) - (CHZ) m2- by a method similar to the method of producing
compound (I-1) from compound (IX).
In each of the aforementioned reactions, when the
starting compound has amino group, a carboxyl group or hydroxy
i5 group as a substituent, a protecting group generally used in
peptide chemistry and the like may be introduced into these
groups. By removing the protecting group as necessary after
the reaction, the objective compound can be obtained.
As the amino-protecting group, for example, formyl, or
2o Ci-6 alkyl-carbonyl (e. g., acetyl, prpionyl and the like),
benzoyl, C1_6 alkoxy-carbonyl (e. g., methoxycarbonyl,
ethoxycarbonyl and the like), phenyloxycarbonyl, C~_lo
aralkyloxy-carbonyl (e. g., benzyloxycarbonyl andrthe like),
trityl or phthaloyl, each of which optionally has
2s substituent(s), can be mentioned. As the substituent, a
halogen atom (e.g., fluorine, chlorine, bromine, iodine and the
like), C1-6 alkyl-carbonyl (e.g., acetyl, propionyl, valeryl and
the like), nitro and the like can be used. The number of the
substituent is about 1 to 3.
3o As the carboxy-protecting group, for example, C1_6 alkyl
(e.g., methyl, ethyl, propyl, isopropyl, butyl, tert-butyl and
the like), phenyl, trityl or silyl and the like, each of which
optionally has substituent(s), can be mentioned. As the
substituent, a halogen atom (e. g., fluorine, chlorine, bromine,
91
CA 02505322 2005-05-06
iodine and the like), formyl, C1_6 alkyl-carbonyl (e. g., acetyl,
propionyl, butylcarbonyl and the 1 i ke ) , nitro, Cl_6 alkyl ( a . g . ,
methyl, ethyl, tert-butyl and the 1 ike ) , Cl_6 aryl ( a . g . , phenyl,
naphthyl and the like) and the like can be used. The number of
the substituent is about 1 to 3.
As the hydroxy-protecting group, for example, formyl, or
C1_6 alkyl (e. g., methyl, ethyl, propyl, isopropyl, butyl, tert-
butyl and the like), phenyl, C~-to aralkyl (e.g., benzyl and the
like), C1_6 alkyl-carbonyl (e.g., acetyl, propionyl and the
io like) , phenyloxycarbonyl, C~_lo aralkyloxy-carbonyl (e.g.,
benzyloxycarbonyl and the like), tetrahydropyranyl,
tetrahydrofuranyl or silyl and the like, each of which
optionally has substituent(s), can be mentioned. As the
substituent, a halogen atom (e. g., fluorine, chlorine, bromine,
Is iodine and the like), C1_6 alkyl (e. g., methyl, ethyl, tert-
butyl and the like), C~-to aralkyl (e. g., benzyl and the like),
Cs-to aryl (e.g., phenyl, naphthyl and the like), nitro and the
like can be used. The number of the substituent is about 1 to
4.
2o For elimination of the protecting group, a method known
per se or a method analogous thereto is used. For example,
treatment method with acid, base, ultraviolet rays, hydrazine,
phenylhydrazine, sodium N-methyldithiocarbamate,
tetrabutylammonium fluoride, palladium (II) acetate and the
2s like or reductive reaction can be used.
In any case, further if necessary, compound (I-1),
compound (I-2), compound (I-3) and compound (I-4) can be
synthesized by using known deprotection reactions, acylation
reactions, alkylation reactions, hydrogenation reactions,
30 oxidation reactions, reduction reactions, carbon chain
extension reactions, substituent exchange reactions, each
alone or in combination of two or more of them. As these
reactions, for example, methods described in SHINJIKKEN
KAGAKU KOUZA 14, vol. 15, 1977 (Maruzen Press), etc. are
92
CA 02505322 2005-05-06
adopted.
The compounds to be used in the present invention can be
produced by the above-mentioned production methods and the
methods described in JP-A-2002-265457, JP-A-2002-212171, JP-A-
2001-226350, JP-A-2001-199971, JP-A-2000-198772, JP-A-2000-
80086, JP-A-2000-34266, JP-A-09-323983, JP-A-08-311065 and the
like.
When the intended substance is obtained in the free
form by the above-mentioned reaction, it may be converted
to into a salt according to an ordinary method, while when
obtained in the form of a salt, it can also be converted into
a free form or other salt according to an ordinary method.
Thus obtained compound or a salt thereof can be isolated and
purified from a reaction solution by known means, for example,
IS rolling, concentration, solvent extraction, fractionation,
crystallization, recrystallization, chromatography and the
like.
When compound of the present invention is present as a
configurational isomer (stereoisomer), diastereomer, conformer
zo or the like, each can be isolated by the above separation and
purification methods on demand. In addition, when compound of
the present invention is in the form of racemates, they can be
separated into S- and R-forms by any conventional optical
resolution.
25 When compound of the present invention includes
stereoisomers, both the isomers alone and mixtures of each
isomers are included in the scope of the present invention.
In addition, compound of the present invention may be a
hydrate or non-hydrate.
3o The compound of the present invention may be labeled with
an isotope (e. g., 3H, 14C, 35S and the like) or the like.
The GPR40 receptor function regulating action of the
compounds of the present invention can be determined by the
method described in Experimental Example 4 to be mentioned
93
CA 02505322 2005-05-06
later or a method analogous thereto.
The compound of the present invention, a salt thereof
and a prodrug thereof (hereinafter sometimes to be abbreviated
as the compound of the present invention) show GPR40 receptor
function regulating action, particularly GPR40 receptor
agonist activity, show low toxicity and a fewer side effects.
Therefore, they are useful as a safe GPR40 receptor function
regulator, preferably GPR40 agonist.
A pharmaceutical agent containing the compound of the
io present invention shows a superior GPR40 receptor function
regulating action in mammal (e. g., mouse, rat, hamster, rabbit,
cat, dog, bovine, sheep, monkey, human etc.), and is useful as
a modulator of physiological function in which GPR40 receptor
is involved or an agent for the prophylaxis or treatment of
Is disease state or disease in which GPR40 receptor is involved.
To be specific, the pharmaceutical agent containing the
compound of the present invention is useful as an insulin
secretion modulator (preferably insulin secretagogue),
hypoglycemic agent and pancreatic (3 cell protector.
2° Moreover, the pharmaceutical agent containing the
compound of the present invention is useful as an agent for
the prophylaxis or treatment of diseases such as diabetes,
impaired glucose tolerance, ketosis, acidosis, diabetic
neuropathy, diabetic nephropathy, diabetic retinopathy,
25 hyperlipidemia, genital disorder, skin disease, arthropathy,
osteopenia, arteriosclerosis, thrombotic disease, dyspepsia,
memory and learning disorder, obesity, hypoglycemia,
hypertension, edema, insulin resistance, unstable diabetes,
fatty atrophy, insulin allergy, insulinoma, lipotoxicity,
3o hyperinsulinemia, cancers and the like, particularly, diseases
such as diabetes, impaired glucose tolerance, ketosis,
acidosis, diabetic neuropathy, diabetic nephropathy, diabetic
retinopathy, hyperlipidemia, genital disorder, skin disease,
arthropathy, osteopenia, arteriosclerosis, thrombotic disease,
94
CA 02505322 2005-05-06
dyspepsia, memory and learning disorder and the like. Here,
diabetes includes insulin-dependent (type I) diabetes, non-
insulin-dependent (type II) diabetes and gestational diabetes
can be mentioned. In addition, hyperlipidemia includes
hypertriglyceridemia, hypercholesterolemia, hypoHDL-emia,
postprandial hyperlipidemia and the like.
For diagnostic criteria of diabetes, Japan Diabetes
Society reported new diagnostic criteria in 1999.
According to this report, diabetes is a condition showing
to any of a fasting blood glucose level (glucose concentration of
intravenous plasma) of not less than 126 mg/dl, a 75 g oral
glucose tolerance test (75 g OGTT) 2 h level (glucose
concentration of intravenous plasma) of not less than 200 mg/dl,
and a non-fasting blood glucose level (glucose concentration of
intravenous plasma) of not less than 200 mg/dl. A condition
not falling under the above-mentioned diabetes and different
from "a condition showing a fasting blood glucose level
(glucose concentration of intravenous plasma) of less than 110
mg/dl or a 75 g oral glucose tolerance test (75 g OGTT) 2 h
20 level (glucose concentration of intravenous plasma) of less
than 140 mg/dl" (normal type) is called a "borderline type".
In addition, ADA (American Diabetes Association) reported
new diagnostic criteria of diabetes in 1997 and fIAHO in 1998.
According to these reports, diabetes is a condition
25 showing a fasting blood glucose level (glucose concentration of
intravenous plasma) of not less than 126 mg/dl and a 75 g oral
glucose tolerance test 2 h level (glucose concentration of
intravenous plasma) of not less than 240 mg/dl.
According to the above-mentioned reports, impaired
3o glucose tolerance is a condition showing a fasting blood
glucose level (glucose concentration of intravenous plasma) of
less than 126 mg/dl and a 75 g oral glucose tolerance test 2 h
level (glucose concentration of intravenous plasma) of not less
than 140 mg/dl and less than 200 mg/dl. According to the
CA 02505322 2005-05-06
report of ADA, a condition showing a fasting blood glucose
level (glucose concentration of intravenous plasma) of not less
than 110 mg/dl and less than 126 mg/dl is called IFG (Impaired
Fasting Glucose). According to the report of WHO, among the
IFG (Impaired Fasting Glucose), a condition showing a 75 g oral
glucose tolerance test 2 h level (glucose concentration of
intravenous plasma) of less than 140 mg/dl is called IFG
(Impaired Fasting Glycemia).
The compound of the present invention can be also used as
to an agent for the prophylaxis or treatment of diabetes,
borderline type, impaired glucose tolerance, IFG (Impaired
Fasting Glucose) and IFG (Impaired Fasting Glycemia), as
determined according to the above-mentioned new diagnostic
criteria. Moreover, the compound of the present invention can
is prevent progress of borderline type, impaired glucose tolerance,
IFG (Impaired Fasting Glucose) or IFG (Impaired Fasting
Glycemia) into diabetes.
The pharmaceutical agent comprising the compound of the
present invention shows low toxicity and can be safely
Zo administered orally or parenterally (e. g., topical, rectal,
intravenous administration etc.) as a pharmaceutical
preparation of the compound of the present invention as it is
or after admixing with a pharmacologically acceptable carrier
to give, for example, tablet (including sugar-coated tablet and
2s film-coated tablet), powder, granule, capsules (including soft
capsules), liquid, injection, suppository, sustained-release
preparation and the like, according to a methods known per se
used for the general production method for pharmaceutical
preparations.
3o The content of the compound of the present invention in
the pharmaceutical preparation of the present invention is
about 0.01 to about 100$ by weight relative to the whole
preparation. The dose varies depending on administration
subjects, administration route, diseases, condition and the
96
CA 02505322 2005-05-06
like. When the compound is orally administered to a patient
with diabetes (body weight about 60 kg), the dose is about
0.01 to about 30 mg/kg body weight per day, preferably about
0.1 to about 20 mg/kg body weight per day, more preferably
about 1 to about 20 mg/kg body weight per day, as an active
ingredient [the compound of the present invention], which may
be given at once or in several portions a day.
As pharmacologically acceptable carriers that can be used
for the production of the pharmaceutical agent of the present
io invention, various organic or inorganic carriers conventionally
used as materials for pharmaceutical preparations can be
mentioned. For example, excipient, lubricant, binder and
disintegrant for solid preparations; and solvent, dissolution
aids, suspending agent, isotonizing agent, buffer and soothing
Zs agent and the like for liquid preparations can be mentioned.
Where necessary, conventional additives such as preservative,
antioxidant, coloring agent, sweetening agent, adsorbing agent,
wetting agent and the like can be used.
As the excipient, for example, lactose, sucrose, D-
2° mannitol, starch, corn starch, crystalline cellulose, light
silicic anhydride and the like can be mentioned.
As the lubricant, for example, magnesium stearate,
calcium stearate, talc, colloidal silica and therlike can be
mentioned.
2s As the binder, for example, crystalline cellulose,
sucrose, D-mannitol, dextrin, hydroxypropylcellulose,
hydroxypropylmethylcellulose, polyvinylpyrrolidone, starch,
sucrose, gelatin, methylcellulose, carboxymethylcellulose
sodium and the like can be mentioned.
3o As the disintegrant, for example, starch,
carboxymethylcellulose, carboxymethylcellulose calcium,
carboxymethylstarch sodium, L-hydroxypropylcellulose and the
like can be mentioned.
As the solvent, for example, water for injection,
97
CA 02505322 2005-05-06
alcohol, propyleneglycol, macrogol, sesame oil, corn oil,
olive oil and the like can be mentioned.
As the dissolution aids, for example, polyethylene
glycol, propyleneglycol, D-mannitol, benzyl benzoate, ethanol,
trisaminomethane, cholesterol, triethanolamine, sodium
carbonate, sodium citrate and the like can be mentioned.
As the suspending agent, for example, surfactants such
as stearyltriethanolamine, sodium lauryl sulfate, lauryl
aminopropionate, lecithin, benzalkonium chloride, benzethonium
1o chloride, glycerol monostearate and the like; hydrophilic
polymers such as polyvinyl alcohol, polyvinylpyrrolidone,
carboxymethylcellulose sodium, methylcellulose,
hydroxymethylcellulose, hydroxyethylcellulose,
hydroxypropylcellulose and the like, and the like can be
Is mentioned.
As an isotonizing agent, for example, glucose, D-
sorbitol, sodium chloride, glycerin, D-mannitol and the like
can be mentioned.
As the buffer, for example, buffers such as phosphate,
zo acetate, carbonate, citrate and the like, and the like can be
mentioned.
As the soothing agent, for example, benzyl alcohol and
the like can be mentioned.
As the preservative, for example, p-hydroxybenzoates,
2s chlorobutanol, benzyl alcohol, phenethyl alcohol,
dehydroacetic acid, sorbic acid and the like can be mentioned.
As the antioxidant, for example, sulfite, ascorbic acid,
~,-tocopherol and the like can be mentioned.
Furthermore, the compound of the present invention can
so be used in combination with a drug other than the compound of
the present invention.
As the drug that can be used in combination with the
compound of the present invention (hereinafter sometimes to be
abbreviated as concomitant drug), for example, other
98
CA 02505322 2005-05-06
therapeutic agents for diabetes, therapeutic agents for
diabetic complications, therapeutic agent for hyperlipidemia,
antihypertensive agent, antiobesitic agent, diuretic,
chemotherapeutic agent, immunotherapeutic agent,
s immunomodulator, antiinflammatory drug, antithrombotic agent,
therapeutic agent for osteoporosis, antibacterial agent,
antifungal agent, antiprotozoal agent, antibiotic, antitussive
and expectorant drug, sedative, anesthetic, antiulcer drug,
tranquilizer, antipsychotic, antitumor drug, muscle relaxant,
io anticonvulsant, antidepressant, antiallergic drug, cardiac,
antiarrhythmic agent, vasodilator, vasoconstrictor,
antinarcotic, vitamin, vitamin derivative, antiasthmatic,
antidementia agent, therapeutic agent for incontinentia or
pollakiuria, therapeutic agent for dysuria, therapeutic agent
is for atopic dermatitis, therapeutic agent for allergic rhinitis,
hypertensor, endotoxin-antagonist or -antibody, signal
transduction inhibitor, inhibitor of inflammatory mediator
activity, antibody to inhibit inflammatory mediator activity,
inhibitor of anti-inflammatory mediator activity, antibody to
2° inhibit anti-inflammatory mediator activity and the like.
Specific examples thereof include the following.
As the other therapeutic agent for diabetes, insulin
preparations (e. g., animal insulin preparations extracted from
the pancreas of bovine and pig; human insulin preparations
Zs genetically synthesized using Escherichia coli, yeast; zinc
insulin; protamine zinc insulin; fragment or derivative of
insulin (e.g., INS-1 etc.), oral insulin preparation and the
like), insulin sensitizers (e. g., Pioglitazone or a salt
thereof (preferably hydrochloride), troglitazone, Rosiglitazone
30 or a salt thereof (preferably maleate), Reglixane (JTT-501),
Netoglitazone (MCC-555), YM-440, GI-262570, KRP-297, FK-614,
CS-011, (yE)-y-[[[4-[(5-methyl-2-phenyl-4-
oxazolyl)methoxy]phenyl]methoxy]imino]benzenebutanoic acid and
the like, compounds described in W099/58510 (e.g., (E)-4-[4-(5-
99
CA 02505322 2005-05-06
methyl-2-phenyl-4-oxazolylmethoxy)benzyloxyimino]-4-
phenylbutyric acid), compounds described in WO01/38325,
Tesaglitazar (AZ-242), Ragaglitazar (NN-622), BMS-298585, ONO-
5816, BM-13-1258, LM-4156, MBX-102, LY-519818, MX-6054, LY-
510929, Balaglitazone (NN-2344), T-131 or a salt thereof, THR-
0921 etc.), a-glucosidase inhibitors (e. g., voglibose, acarbose,
miglitol, emiglitate etc.), biguanides (e. g., phenformin,
metformin, buformin etc.), insulin secretagogues [sulfonylurea
(e. g., tolbutamide, glibenclamide, gliclazide, chlorpropamide,
to tolazamide, acetohexamide, glyclopyramide, glimepiride etc.),
repaglinide, senaglinide, mitiglinide or calcium salt hydrate
thereof, nateglinide, etc.], GLP-1 receptor agonists [e. g.,
GLP-l, GLP-1MR agent, NN-2211, AC-2993 (exendin-4), BIM-51077,
Aib(8,35)hGLP-1(7,37)NH2, CJC-1131 etc.], dipeptidyl peptidase
i5 IV inhibitor (e. g., NVP-DPP-278, PT-100, P32/98, P93/Ol, NVP-
DPP-728, LAF237, TS-021 etc.), (33 agonist (e.g., CL-316243, SR-
58611-A, UL-TG-307, AJ-9677, AZ40140 etc.), amylin agonists
(e. g., pramlintide etc.), phosphotyrosine phosphatase
inhibitors (e. g., vanadic acid etc.), gluconeogenesis
2o i~ibitors (e.g., glycogen phosphorylase inhibitor, glucose-6-
phosphatase inhibitor, glucagon antagonist etc.), SGLT (sodium-
glucose cotransporter) inhibitors (e. g., T-1095 etc.), 11(3-
hydroxysteroid dehydrogenase inhibitors (e. g., BVT-3498 etc.),
adiponectin or agonist thereof, IKK inhibitors (e. g., AS-2868
25 etc.), leptin resistance improving drugs, somatostatin
receptor agonists (compounds described in W001/25228,
W003/42204, W098/44921, W098/45285, W099/22735 etc.),
glucokinase activators (e.g., Ro-28-1675) and the like can be
mentioned.
3o Examples of the therapeutic agent for diabetic
complications include aldose reductase inhibitors (e. g.,
Tolrestat, Epalrestat, Zenarestat, Zopolrestat, Fidarestat
(SNK-860), Minalrestat (ARI-509), CT-112 etc.), neurotrophic
factors and increasing drugs thereof (e. g., NGF, NT-3, BDNF,
100
CA 02505322 2005-05-06
neurotrophin production-secretion promoters described in
W001/14372 (e. g., 4-(4-chlorophenyl)-2-(2-methyl-1-imidazolyl)-
5-[3-(2-methylphenoxy)propyl]oxazole etc.) and the like),
protein kinase C (PKC) inhibitors (e.g., LY-333531 etc.), AGE
inhibitors (e.g., ALT-945, pimagedine, pyratoxanthine, N-
phenacylthiazolium bromide (ALT-766), EXO-226, ALT-711,
Pyridorin, Pyridoxamine etc.), active oxygen scavengers (e. g.,
thioctic acid etc.), cerebral vasodilators (e. g., tiapride
etc.), somatostatin receptor agonists (BIM23190) and apoptosis
to signal regulating kinase-1 (ASK-1) inhibitors.
Examples of the therapeutic agent of hyperlipidemia
include statin compounds, which are cholesterol synthesis
inhibitors (e. g., pravastatin, simvastatin, lovastatin,
atorvastatin, fluvastatin, cerivastatin and salts thereof (e. g.,
15 sodium salt etc.) etc.), squalene synthase inhibitors (e. g.,
compounds described in W097/10224, such as N-[[(3R,5S)-1-(3-
acetoxy-2,2-dimethylpropyl)-7-chloro-5-(2,3-dimethoxyphenyl)-2-
oxo-1,2,3,5-tetrahydro-4,1-benzoxazepin-3-yl]acetyl]piperidine-
4-acetic acid etc.), fibrate compounds (e. g., bezafibrate,
2o clofibrate, simfibrate, clinofibrate etc.), antioxidant (e. g.,
lipoic acid, probucol) and the like.
Examples of the antihypertensive agent include
angiotensin converting enzyme inhibitors (e. g., captopril,
enalapril, delapril etc.), angiotensin II receptor antagonists
25 (e. g., losartan, candesartan cilexetil, eprosartan, valsartan,
telmisartan, irbesartan, tasosartan, 1-[[2'-(2,5-dihydro-5-oxo-
4H-1,2,4-oxadiazol-3-yl)biphenyl-4-yl]methyl]-2-ethoxy-1H-
benzimidazole-7-carboxylic acid etc.), calcium antagonist (e. g.,
manidipine, nifedipine, amlodipine, efonidipine, nicardipine
3o etc.), Clonidine and the like.
Examples of the antiobestic agent include antiobestic
agents acting on the central nervous system (e. g.,
Dexfenfluramine, fenfluramine, phentermine, Sibutramine,
amfepramone, dexamphetamine, Mazindol, phenylpropanolamine,
101
CA 02505322 2005-05-06
clobenzorex; MCH receptor antagonists (e. g., SB-568849; SNAP-
7941; compounds encompassed in WO01/82925 and W001/87834 etc.);
neuropeptide Y antagonists (e. g., CP-422935 etc.); cannabinoid
receptor antagonists (e. g., SR-141716, SR-147778 etc.); ghrelin
antagonist; 11~-hydroxysteroid dehydrogenase inhibitors (e. g.,
BVT-3498 etc.) and the like), pancreatic lipase inhibitors
(e. g., orlistat, ATL-962 etc.), ~3 agonists (e. g., CL-316243,
SR-58611-A, UL-TG-307, AJ-9677, AZ40140 etc.), peptidic
anorexiants (e. g., leptin, CNTF (Ciliary Neurotropic Factor)
Io etc.), cholecystokinin agonists (e. g., lintitript, FPL-15849
etc.), feeding deterrent (e. g., P-57 etc.) and the like.
Examples of the diuretic include xanthine derivatives
(e. g., sodium salicylate and theobromine, calcium salicylate
and theobromine etc.), thiazide preparations (e. g., ethiazide,
Is cyclopenthiazide, trichloromethiazide, hydrochlorothiazide,
hydroflumethiazide, benzylhydrochlorothiazide, penflutizide,
polythiazide, methyclothiazide etc.), antialdosterone
preparations (e. g., spironolactone, triamterene etc.),
carbonate dehydratase inhibitors (e.g., acetazolamide and the
20 like), chlorobenzenesulfonamide preparations (e. g.,
chlortalidone, mefruside, indapamide etc.), azosemide,
isosorbide, etacrynic acid, piretanide, bumetanide, furosemide
and the like.
Examples of the chemotherapeutic agent include alkylation
25 agents (e. g., cyclophosphamide, ifosfamide etc.), metabolic
antagonists (e. g., methotrexate, 5-fluorouracil etc.), anti-
cancer antibiotics (e. g., mitomycin, adriamycin etc.), plant-
derived anti-cancer agents (e. g., vincristin, vindesine, taxol
etc.), cisplatin, carboplatin, etoposide and the like. Of
so these, furtulon and neofurtulon, which are 5-fluorouracil
derivatives, and the like are preferable.
Examples of the immunotherapeutic agent include
microorganism or bacterial components (e. g., muramyl dipeptide
derivative, picibanil etc.), polysaccharides having immunity
102
CA 02505322 2005-05-06
potentiating activity (e. g., lentinan, sizofiran, krestin etc.),
cytokines obtained by genetic engineering techniques (e. g.,
interferon, interleukin (IL) etc.), colony stimulating factors
(e. g., granulocyte colony stimulating factor, erythropoietin
etc.) and the like, with preference given to interleukins such
as IL-1, IL-2, IL-12 and the like.
As the antiinflammatory drug, for example, non-steroidal
antiinflammatory agents such as aspirin, acetoaminofen,
indomethacin and the like can be mentioned.
io Examples of the antithrombotic agent include heparin
(e. g., heparin sodium, heparin calcium, dalteparin sodium etc.),
warfarin (e. g., warfarin potassium etc.), anti-thrombin drugs
(e. g., aragatroban etc.), thrombolytic agents (e. g., urokinase,
tisokinase, alteplase, nateplase, monteplase, pamiteplase etc.),
i5 platelet aggregation inhibitors (e. g., ticlopidine
hydrochloride, cilostazol, ethyl icosapentate, beraprost sodium,
sarpogrelate hydrochloride etc.) and the like.
Examples of the therapeutic agent of osteoporosis include
alfacalcidol, calcitriol, elcatonin, calcitonin salmon, estriol,
2o ipriflavone, pamidronate disodium, alendronate sodium hydrate,
incadronate disodium and the like.
As the vitamin, for example, vitamin B1, vitamin B12 and
the like can be mentioned. '
Examples of the antidementia agent include tacrine,
2s donepezil, rivastigmine, galanthamine and the like.
Examples of the therapeutic agent for incontinentia or
pollakiuria include flavoxate hydrochloride, oxybutynin
hydrochloride, propiverine hydrochloride and the like.
Examples of the therapeutic agent for dysuria include
3o acetylcholine esterase inhibitors (e.g., distigmine) and the
like.
Furthermore, drugs having a cachexia-improving action
established in animal models and clinical situations, such as
cyclooxygenase inhibitors (e. g., Indometacin etc. [Cancer
103
CA 02505322 2005-05-06
Research, vol. 49, 5935-5939, 1989], Progesterone derivatives
(e. g., Megesterol acetate) [Journal of Clinical Oncology, vol.
12, 213-225, 1994], glucosteroid (e. g., dexamethasone etc.),
metoclopramide agents, tetrahydrocannabinol agents (literatures
s are as mentioned above), fat metabolism improving agents (e. g.,
eicosapentaenoic acid etc.) [British Journal of Cancer, vol. 68,
314-318,1993], growth hormones, IGF-l, or antibodies to a
cachexia-inducing factor such as TNF-a, LIF, IL-6, Oncostatin M
and the like, can be used in combination with the compound of
1° the present invention.
Further, glycosylation inhibitors (e. g., ALT-711, etc.),
nerve regeneration promoting drugs (e. g., Y-128, VX853,
prosaptide, etc.), antidepressants (e. g., desipramine,
amitriptyline, imipramine, etc.), anticonvulsants (e. g.,
Is lamotrigine, Trileptal, Keppra, Zonegran, Pregabalin,
Harkoseride, carbamazepine), antiarrhythmic drugs (e. g.,
mexiletine), acetylcholine receptor ligands (e. g., ABT-594),
endothelin receptor antagonists (e. g., ABT-627), monoamine
uptake inhibitors (e. g., tramadol), narcotic analgesics (e. g.,
2o morphine), GABA receptor agonists (e. g., gabapentin,
gabapentin MR agent), a2 receptor agonists (e. g., clonidine),
local analgesics (e. g., capsaicin), antianxiety drugs (e. g.,
benzothiazepines), phosphodiesterase inhibitorsr(e.g.,
sildenafil), dopamine receptor agonists (e. g., apomorphine)
2s and the like can be also used in combination with the
compound of the present invention.
By combining the compound of the present invention and a
concomitant drug, a superior effect such as
30 (1) the dose of the compound of the present invention or a
concomitant drug can be reduced as compared to single
administration of the compound of the present invention or a
concomitant drug,
(2) the drug to be used in combination with the compound of the
104
CA 02505322 2005-05-06
present invention can be selected depending on the condition of
patients (mild, severe and the like),
(3) the period of treatment can be set longer by selecting a
concomitant drug having different action and mechanism from
those of the compound of the present invention,
(4) a sustained treatment effect can be designed by selecting a
concomitant drug having different action and mechanism from
those of the compound of the present invention,
(5) a synergistic effect can be afforded by a combined use of
to the compound of the present invention and a concomitant drug,
and the like, can be achieved.
In the following, use of the compound of the present
invention and a concomitant drug in combination is to be
referred to as the "concomitant agent of the present invention".
15 For the use of the concomitant agent of the present
invention, the administration time of the compound of the
present invention and the concomitant drug is not restricted,
and the compound of the present invention and the concomitant
drug can be administered to an administration subject
2° simultaneously, or may be administered at staggered times. The
dosage of the concomitant drug may be determined according to
the dose clinically used, and can be appropriately selected
depending on an administration subject, administration route,
disease, combination and the like.
25 The administration mode of the concomitant agent of the
present invention is not particularly restricted, as long as
the compound of the present invention and the concomitant drug
are combined in administration. Examples of such
administration mode include the following methods: (1) The
3o compound of the present invention and the concomitant drug are
simultaneously formulated to give a single preparation which
is administered. (2) The compound of the present invention
and the concomitant drug are separately formulated to give two
kinds of preparations which are administered simultaneously by
105
CA 02505322 2005-05-06
the same administration route. (3) The compound of the
present invention and the concomitant drug are separately
formulated to give two kinds of preparations which are
administered by the same administration route at staggered
times. (4) The compound of the present invention and the
concomitant drug are separately formulated to give two kinds
of preparations which are administered simultaneously by the
different administration routes. (5) The compound of the
present invention and the concomitant drug are separately
io formulated to give two kinds of preparations which are
administered by the different administration routes at
staggered times (for example, the compound of the present
invention and the concomitant drug are administered in this
order, or in the reverse order), and the like.
Is A concomitant agent of the present invention has low
toxicity, and for example, the compound of the present
invention and/or the above-mentioned concomitant drug can be
mixed, according to a method known per se, with a
pharmacologically acceptable carrier to give pharmaceutical
2o compositions, for example, tablets (including a sugar-coated
tablet, film-coated tablet), powders, granules, capsules
(including soft capsules), liquids, injections, suppositories,
sustained-release preparations and the like, which can be
safely administered orally or parenterally (e. g., topical,
25 rectal, intravenous administration, and the like). An injection
can be administered by intravenous, intramuscular, subcutaneous
or intraorgan route, or directly to the lesion.
As a pharmacologically acceptable carrier which may be
used for preparing the concomitant agent of the present
so invention, those similar to the aforementioned
pharmacologically acceptable carriers that can be used for the
production of the pharmaceutical agent of the present
invention can be mentioned. Farther, if needed, the
aforementioned additives that can be used for the production
106
CA 02505322 2005-05-06
of the pharmaceutical agent of the present invention, such as
preservative, antioxidant, coloring agent, sweetening agent,
adsorbing agent, wetting agent and the like, can be
appropriately used in an appropriate amount.
The compounding ratio of the compound of the present
invention to the concomitant drug in the concomitant agent of
the present invention can be appropriately selected depending
on an administration subject, administration route, diseases
and the like.
to For example, the content of the compound of the present
invention in the concomitant agent of the present invention
differs depending on the form of a preparation, and usually
from about 0.01 to 100 by weight, preferably from about 0.1 to
50~ by weight, further preferably from about 0.5 to 20~ by
15 weight, based on the preparation.
The content of the concomitant drug in the concomitant
agent of the present invention differs depending on the form of
a preparation, and usually from about 0.01 to 100s by weight,
preferably from about 0.1 to 50~ by weight, further preferably
2o from about 0.5 to 20~ by weight, based on the preparation.
The content of additives such as a carrier and the like in
the concomitant agent of the present invention differs
depending on the form of a preparation, and usually from about
1 to 99.99 by weight, preferably from about 10 to 90$ by
25 weight, based on the preparation.
In the case when the compound of the present invention and
the concomitant drug are separately prepared respectively, the
same contents may be adopted.
These preparations can be produced by a method known per
3o se usually used in a preparation process.
For example, the compound of the present invention and the
concomitant drug can be made into an aqueous injection together
with a dispersing agent (e. g., Tween 80 (manufactured by Atlas
Powder, US), HCO 60 (manufactured by Nikko Chemicals),
107
CA 02505322 2005-05-06
polyethylene glycol, carboxymethylcellulose, sodium alginate,
hydroxypropylmethylcellulose, dextrin and the like), a
stabilizer (e.g., ascorbic acid, sodium pyrosulfite, and the
like), a surfactant (e.g., Polysorbate 80, macrogol and the
like), a solubilizer (e.g., glycerin, ethanol and the like), a
buffer (e. g., phosphoric acid and alkali metal salt thereof,
citric acid and alkali metal salt thereof, and the like), an
isotonizing agent (e. g., sodium chloride, potassium chloride,
mannitol, sorbitol, glucose and the like), a pH regulator (e. g.,
1° hydrochloric acid, sodium hydroxide and the like), a
preservative (e. g., ethyl p-hydroxybenzoate, benzoic acid,
methyl p-hydroxybenzoate, propyl p-hydroxybenzoate, benzyl
alcohol and the like), a dissolving agent (e. g., conc. glycerin,
meglumine and the like), a dissolution aid (e. g., propylene
is glycol, sucrose and the like), a soothin a ent (e.
g g g., glucose,
benzyl alcohol and the like), and the like, or can be dissolved,
suspended or emulsified in a vegetable oil such as olive oil,
sesame oil, cotton seed oil, corn oil and the like or a
dissolution aid such as propylene glycol and molded into an
20 oily injection.
In addition, an excipient (e. g., lactose, sucrose, starch
and the like), a disintegrant (e. g., starch, calcium carbonate
and the like), a binder (e.g., starch, acacia,
carboxymethylcellulose, polyvinylpyrrolidone,
25 hydroxpropylcellulose and the like), a lubricant (e. g., talc,
magnesium stearate, polyethylene glycol 6000 and the like) and
the like, for example, can be added to the compound of the
present invention or the concomitant drug, according to a
method known per se, and the mixture can be compression-molded,
3o then if desirable, the molded product can be coated by a method
known per se for the purpose of masking of taste, enteric
property or durability, to obtain a preparation for oral
administration. As this coating agent, for example,
hydroxypropylmethylcellulose, ethylcellulose,
108
CA 02505322 2005-05-06
hydroxymethylcellulose, hydroxypropylcellulose, polyoxyethylene
glycol, Tween 80, Pluronic F68, cellulose acetate phthalate,
hydroxypropylmethylcellulose phthalate, hydroxymethylcellulose
acetate succinate, Eudragit (methacrylic acid~acrylic acid
s copolymer, manufactured by Rohm, DE), pigment (e. g., iron oxide
red, titanium dioxide, etc.) and the like can be used. The
preparation for oral administration may be any of a quick
release preparation and a sustained release preparation.
Furthermore, the compound of the present invention and
io the concomitant drug can be made into an oily or aqueous solid,
a semisolid or liquid suppository by admixing with an oily base,
aqueous base or aqueous gel base according to a method known
per se. As the oily base used in the above-mentioned, for
example, glycerides of higher fatty acids [e. g., cacao butter,
is Witepsols (manufactured by Dynamite Nobel, DE), etc.),
intermediate grade fatty acids [e.g., Miglyols (manufactured by
Dynamite Nobel, DE), etc.], or vegetable oils (e. g., sesame oil,
soy bean oil, cotton seed oil and the like), and the like are
mentioned. Further, as the aqueous base, for example,
2o polyethylene glycols, propylene glycol and the like are
mentioned, and as the aqueous gel base, for example, natural
gums, cellulose derivatives, vinyl polymers, acrylic acid
polymers and the like are mentioned. '
As the above-mentioned sustained release preparation,
2s sustained release microcapsules and the like are mentioned.
The sustained-release microcapsule can be produced by a method
known per se, such as the method shown in the following [2].
A compound of the present invention is preferably molded
into a preparation for oral administration such as a solid
3o preparation (e.g., powder, granule, tablet, capsule) and the
like, or molded into a preparation for rectal administration
such as a suppository. Particularly, a preparation for oral
administration is preferable.
The concomitant drug can be made into the above-mentioned
109
CA 02505322 2005-05-06
preparation form depending on the kind of the drug.
[1] An injection of the compound of the present invention or
the concomitant drug, and preparation thereof, [2] a sustained
release preparation or quick release preparation of the
compound of the present invention or the concomitant drug, and
preparation thereof, [3] a sublingual, buccal or intraoral
quick integrating agent of the compound of the present
invention or the concomitant drug, and preparation thereof,
will be described below specifically.
to [1] Injection and preparation thereof
An injection prepared by dissolving the compound of the
present invention or the concomitant drug into water is
preferable. This injection may be allowed to contain a
benzoate and/or salicylate.
The injection is obtained by dissolving the compound of
the present invention or the concomitant drug, and if desirable,
a benzoate and/or salicylate, into water.
As the above-mentioned benzoate and salicylate, for
example, salts of alkali metals such as sodium, potassium and
2o the like, salts of alkaline earth metals such as calcium,
magnesium and the like, ammonium salts, meglumine salts,
organic acid salts such as tromethamol etc., and the like are
mentioned.
The concentration of the compound of the present
invention or the concomitant drug in an injection is from 0.5
to 50~ (w/v), preferably from about 3 to 20~ (w/v). The
concentration of the benzoate or/and salicylate is from 0.5 to
50~ (w/v), preferably from 3 to 20~ (w/v).
Into a preparation of the present invention, additives
3o usually used in an injection, for example, a stabilizer (e. g.,
ascorbic acid, sodium pyrosulfite, and the like), a surfactant
(e. g., Polysorbate 80, macrogol and the like), a solubilizer
(e. g., glycerin, ethanol and the like), a buffer (e. g.,
phosphoric acid and alkali metal salt thereof, citric acid and
110
CA 02505322 2005-05-06
alkali metal salt thereof, and the like), an isotonizing agent
(e.g., sodium chloride, potassium chloride, and the like), a
dispersing agent (e. g., hydroxypropylmethylcellulose, dextrin,
and the like), a pH regulator (e. g., hydrochloric acid, sodium
hydroxide and the like), a preservative (e.g., ethyl p-
hydroxybenzoate, benzoic acid and the like), a dissolving agent
(e. g., conc. glycerin, meglumine and the like), a dissolution
aid (e. g., propylene glycol, sucrose and the like), a soothing
agent (e.g., glucose, benzyl alcohol and the like), and the
to like, can be appropriately compounded. These additives are
generally compounded in a proportion usually used in an
injection.
It is advantageous that pH of an injection is controlled
from 2 to 12, preferably from 2.5 to 8.0 by addition of a pH
is regulator.
An injection is obtained by dissolving the compound of
the present invention or the concomitant drug and if desirable,
a benzoate and/or a salicylate, and if necessary, the above-
mentioned additives into water. These may be dissolved in any
2° order, and can be appropriately dissolved in the same manner as
in a conventional method of producing an injection.
An aqueous solution for injection may be advantageously
be heated, alternatively, for example, filter sterilization,
high pressure heat sterilization and the like can be conducted
25 in the same manner as for a usual injection, to provide an
injection.
It may be advantageous that an aqueous solution for
injection is subjected to high pressure heat sterilization at
100 to 121°C for 5 to 30 minutes.
3o Farther, a preparation endowed with an antibacterial
property of a solution may also be produced so that it can be
used as a preparation which is divided and administered
multiple times.
[2] Sustained release preparation or quick release preparation,
111
CA 02505322 2005-05-06
and preparation thereof
A sustained release preparation is preferable which is
obtained, if desirable, by coating a nucleus containing the
compound of the present invention or the concomitant drug with
a film agent such as a water-insoluble substance, swellable
polymer and the like. For example, a sustained release
preparation for oral administration for a single administration
per day type is preferable.
As the water-insoluble substance used in a film agent,
to there are mentioned, for example, cellulose ethers such as
ethylcellulose, butylcellulose and the like, cellulose esters
such as cellulose acetate, cellulose propionate and the like,
polyvinyl esters such as polyvinyl acetate, polyvinyl butyrate
and the like, acrylic acid/methacrylic acid copolymers, methyl
is methacrylate copolymers, ethoxyethyl methacrylate/cinnamoethyl
methacrylate/aminoalkyl methacrylate copolymers, polyacrylic
acid, polymethacrylic acid, methacrylic acid alkylamide
copolymers, poly(methyl methacrylate), polymethacrylate,
polymethacrylamide, aminoalkyl methacrylate copolymers,
2o poly(methacrylic anhydride), glycidyl methacrylate copolymer,
particularly, acrylic acid-based polymers such as Eudragits
(Rohm Pharma) such as Eudragit RS-100, RL-100, RS-30D, RL-30D,
RL-PO, RS-PO (ethyl acrylate~methyl methacrylate~trimethyl
chloride methacrylate~ammoniumethyl copolymer), Eudragit NE-30D
25 (methyl methacrylate~ethyl acrylate copolymer), and the like,
hardened oils such as hardened castor oil (e.g., Lovery wax
(Freunt) and the like), waxes such as carnauba wax, fatty acid
glycerin ester, paraffin and the like, polyglycerin fatty acid
esters, and the like.
3o As the swellable polymer, polymers having an acidic
dissociating group and showing pH dependent swelling are
preferable, and polymers manifesting slight swelling in acidic
regions such as in the stomach and greater swelling in neutral
regions such as in the small intestine and the large intestine
112
CA 02505322 2005-05-06
are preferable.
As such a polymer having an acidic dissociating group and
showing pH dependent swelling, cross-linkable polyacrylic acid
copolymers such as, for example, Carbomer 934P, 940, 941, 974P,
s 980, 1342 and the like, polycarbophil, calcium polycarbophil
(all are manufactured by BF Goodrich), Hibiswako 103, 104, 105,
304 (all are manufactured by Wako Pure Chemical Co., Ltd.), and
the like, are mentioned.
The film agent used in a sustained release preparation
io may further contain a hydrophilic substance.
As the hydrophilic substance, for example,
polysaccharides which may contain a sulfate group such as
pullulan, dextrin, alkali metal alginate and the like,
polysaccharides having a hydroxyalkyl group or carboxyalkyl
is group such as hydroxypropylcellulose,
hydroxypropylmethylcellulose, carboxymethylcellulose sodium and
the like, methylcellulose, polyvinylpyrrolidone, polyvinyl
alcohol, polyethylene glycol and the like.
The content of a water-insoluble substance in the film
2° agent of a sustained release preparation is from about 30 to
about 900 (w/w), preferably from about 35 to about 80s (w/w),
further preferably from about 40 to about 75g (w/w), the
content of a swellable polymer is from about 3 to 30~ (w/w),
preferably from about 3 to about 15$ (w/w). The film agent may
Zs further contain a hydrophilic substance, and in which case, the
content of a hydrophilic substance in the film agent is about
500 (w/w) or less, preferably about 5 to about 40~ (w/w),
further preferably from about 5 to about 35~ (w/w). This o
(w/w) indicates ~ by weight based on a film agent composition
3o which is obtained by removing a solvent (e. g., water, lower
alcohols such as methanol, ethanol and the like) from a film
agent solution.
The sustained release preparation is produced by
preparing a nucleus containing a drug as exemplified below,
113
CA 02505322 2005-05-06
then, coating the resulting nucleus with a film agent solution
prepared by heat-solving a water-insoluble substance, swellable
polymer and the like or by dissolving or dispersing it in a
solvent.
I. Preparation of nucleus containing drug
The form of nucleus containing a drug to be coated with a
film agent (hereinafter, sometimes simply referred to as
nucleus) is not particularly restricted, and preferably, the
nucleus is formed into particles such as a granule or fine
to particle.
When the nucleus is composed of granules or fine
particles, the average particle size thereof is preferably from
about 150 to 2000 ~,m, further preferably, from about 500 to
about 1400 Vin.
is Preparation of the nucleus can be effected by a usual
production method. For example, a suitable excipient, binder,
disintegrant, lubricant, stabilizer and the like are mixed into
a drug, and the mixture is subjected to a wet extrusion
granulating method, fluidized bed granulating method or the
2° like, to prepare a nucleus.
The content of drugs in a nucleus is from about 0.5 to
about 95°s (w/w), preferably from about 5.0 to about 80~ (w/w),
further preferably from about 30 to about 70~ (w/w).
As the excipient contained in the nucleus, for example,
25 saccharides such as sucrose, lactose, mannitol, glucose and the
like, starch, crystalline cellulose, calcium phosphate, corn
starch and the like are used. Among them, crystalline
cellulose and cornstarch are preferable.
As the binder, for example, polyvinyl alcohol,
3o hydroxypropyl cellulose, polyethylene glycol, polyvinyl
pyrrolidone, Pluronic F68, gum Arabic, gelatin, starch and the
like are used. As the disintegrant, for example,
carboxymethylcellulose calcium (ECG505), crosscarmelose sodium
(Ac-Di-Sol), crosslinked polyvinylpyrrolidone (Crospovidone),
114
CA 02505322 2005-05-06
low-substituted hydroxypropylcellulose (L-HPC) and the like are
used. Among them, hydroxypropylcellulose, polyvinylpyrrolidone,
low-substituted hydroxypropylcellulose are preferable. As the
lubricant and coagulation inhibitor, for example, talc,
magnesium stearate and inorganic salts thereof are used, and as
the lubricant, polyethylene glycol and the like are used. As
the stabilizer, acids such as tartaric acid, citric acid,
succinic acid, fumaric acid, malefic acid and the like, are used.
A nucleus can also be prepared by, in addition to the
to above-mentioned, for example, a rolling granulation method in
which a drug or a mixture of a drug with an excipient,
lubricant and the like is added portionwise onto an inert
carrier particle which is the core of the nucleus while
spraying a binder dissolved in a suitable solvent such as water,
lower alcohol (e.g., methanol, ethanol and the like) and the
like, a pan coating method, a fluidized bed coating method or a
melt granulating method. As the inert carrier particle, for
example, those made of sucrose, lactose, starch, crystalline
cellulose, waxes can be used, and the average particle size
2o thereof is preferably from about 100 ~,m to about 1500 ~,m.
For separating a drug and a film agent contained in a
nucleus, the surface of the nucleus may be coated with a
protective agent. As the protective agent, for example, the
above-mentioned hydrophilic substances, water-insoluble
2s s~stances and the like are used. As the protective agent,
preferably polyethylene glycol, and polysaccharides having a
hydroxyalkyl group or carboxyalkyl group are used, more
preferably, hydroxypropylmethylcellulose and
hydroxypropylcellulose are used. The protective agent may
3o contain, as a stabilizer, acids such as tartaric acid, citric
acid, succinic acid, fumaric acid, malefic acid and the like,
and lubricants such as talc and the like. When the protective
agent is used, the coating amount is from about 1 to about 15%
(w/w), preferably from about 1 to about l00 (w/w), further
115
CA 02505322 2005-05-06
preferably from about 2 to about 8~ (w/w), based on the nucleus.
The protective agent can be coated by a usual coating
method, and specifically, the protective agent can be spray
coated on a nucleus by, for example, a fluidized bed coating
method, pan coating method and the like.
II. Coating of nucleus with film agent
A nucleus obtained in the above-mentioned step I is
coated with a film agent solution obtained by heat-solving the
Io above-mentioned water-insoluble substance and pH-dependent
swellable polymer, and a hydrophilic substance, or by
dissolving or dispersing them in a solvent, to give a sustained
release preparation.
As the method for coating a nucleus with a film agent
is solution, for example, a spray coating method and the like are
mentioned.
The composition ratio of a water-insoluble substance,
swellable polymer and hydrophilic substance in a film agent
solution is appropriately selected so that the contents of
2° these components in a coated film are the above-mentioned
contents, respectively.
The coating amount of a film agent is from about 1 to
about 90% (w/w), preferably from about 5 to about 50°s (w/w),
further preferably from about 5 to about 35~ (w/w), based on a
2s nucleus (not including coating amount of protective agent).
As the solvent in a film agent solution, water or an
organic solvent can be used alone or in admixture thereof. In
the case of use in admixture, the mixing ratio of water to an
organic solvent (water/organic solvent: by weight) can be
so varied in the range from 1 to 100$, and preferably from 1 to
about 30~. The organic solvent is not particularly restricted
providing it dissolves a water-insoluble substance, and for
example, lower alcohols such as methyl alcohol, ethyl alcohol,
isopropyl alcohol, n-butyl alcohol and the like, lower alkanone
116
CA 02505322 2005-05-06
such as acetone and the like, acetonitrile, chloroform,
methylene chloride and the like are used. Among them, lower
alcohols are preferable, and ethyl alcohol and isopropyl
alcohol are particularly preferable. Water, and a mixture of
water with an organic solvent are preferably used as a solvent
for a film agent. In this case, if necessary, an acid such as
tartaric acid, citric acid, succinic acid, fumaric acid, malefic
acid and the like may also be added into a film agent solution
for stabilizing the film agent solution.
io An operation of coating by spray coating can be effected
by a usual coating method, and specifically, it can be effected
by spray-coating a film agent solution onto a nucleus by a
fluidized bed coating method, pan coating method and the like.
In this case, if necessary, talc, titanium oxide, magnesium
is stearate, calcium stearate, light anhydrous silicic acid and
the like may also be added as a lubricant, and glycerin fatty
acid ester, hardened castor oil, triethyl citrate, cetyl
alcohol, stearyl alcohol and the like may also be added as a
plasticizer.
2° After coating with a film agent, if necessary, an
antistatic agent such as talc and the like may be mixed.
The quick release preparation may be liquid (e. g.,
solution, suspension, emulsion and the like) or "solid (e. g.,
particle, pill, tablet and the like). As the quick release
25 preparation, oral agents and parenteral agents such as an
injection and the like are used, and oral agents are preferable.
The quick release preparation, usually, may contain, in
addition to an active component drug, also carriers, additives
and excipients conventionally used in the production field
30 (hereinafter, sometimes abbreviated as excipient). The
excipient used is not particularly restricted providing it is
an excipient ordinarily used as a preparation excipient. For
example, as the excipient for an oral solid preparation,
lactose, starch, corn starch, crystalline cellulose (Avicel
117
CA 02505322 2005-05-06
PH101, manufactured by Asahi Chemical Industry Co., Ltd., and
the like), powder sugar, granulated sugar, mannitol, light
anhydrous silicic acid, magnesium carbonate, calcium carbonate,
L-cysteine and the like are mentioned, and preferably, corn
starch and mannitol and the like are mentioned. These
excipients can be used alone or in combination of two or more.
The content of the excipient is, for example, from about 4.5 to
about 99.4 (w/w), preferably from about 20 to about 98.50
(w/w), further preferably from about 30 to about 970 (w/w),
io based on the total amount of the quick release preparation.
The content of a drug in the quick release preparation
can be appropriately selected in the range from about 0.5 to
about 950 (w/w), preferably from about 1 to about 60~ (w/w)
based on the total amount of the quick release preparation.
15 When the quick release preparation is an oral solid
preparation, it usually contains, in addition to the above-
mentioned components, also a disintegrant. As this
disintegrant, there are used, for example,
carboxymethylcellulose calcium (ECG-505, manufactured by Gotoku
2o Yakuhin), crosscarmelose sodium (e. g., Ac-Di-Sol, manufactured
by Asahi Chemical Industry Co., Ltd.), Crospovidone (e. g.,
Kollidon CL, manufactured by HASF), low-substituted
hydroxypropylcellulose (manufactured by Shin-Etsu Chemical Co.,
Ltd.), carboxymethylstarch (manufactured by Matsutani Kagaku
25 K.K.), carboxymethylstarch sodium (Exprotab, manufactured by
Kimura Sangyo), partially pregelatinized starch (PCS,
manufactured by Asahi Chemical Industry Co., Ltd.), and the
like are used, and for example, those which disintegrate a
granule by adsorbing water in contact with water, causing
3o swelling, or making a channel between an effective ingredient
constituting the nucleus and an excipient, can be used. These
disintegrants can be used alone or in combination of two or
more. The amount of the disintegraent used is appropriately
selected depending on the kind and compounding amount of a drug
118
CA 02505322 2005-05-06
used, design of releasing property, and the like, and for
example, from about 0.05 to about 30$ (w/w), preferably from
about 0.5 to about 15~ (w/w), based on the total amount of the
quick releasing agent.
When the quick release preparation is an oral solid
preparation, it may further contain, in addition to the above-
mentioned composition, if desired, additives conventional in
solid preparations. As such an additive, there are used, for
example, a binder (e. g., sucrose, gelatin, gum Arabic powder,
io methylcellulose, hydroxypropylcellulose,
hydroxypropylmethylcellulose, carboxymethylcellulose,
polyvinylpyrrolidone, pullulan, dextrin and the like), a
lubricant (e. g., polyethylene glycol, magnesium stearate, talc,
light anhydrous silicic acid (e. g., aerosil (Nippon Aerosil)),
is a surfactant (e. g., anionic surfactants such as sodium
alkylsulfate and the like, nonionic surfactants such as
polyoxyethylene fatty acid ester and polyoxyethylene sorbitan
fatty acid ester, polyoxyethylene castor oil derivatives and
the like), a coloring agent (e. g., tar pigment, caramel, iron
2° oxide red, titanium oxide, riboflavins, and the like), if
necessary, an appetizing agent (e. g., sweetening agent, aroma
and the like), an adsorbing agent, preservative, wetting agent,
antistatic agent, and the like. E~rther, as the~stabilizer, an
organic acid such as tartaric acid, citric acid, succinic acid,
2s f~aric acid and the like may also be added.
As the above-mentioned binder, hydroxypropylcellulose,
polyethylene glycol and polyvinylpyrrolidone and the like are
preferably used.
The quick releasing preparation can be prepared by, based
30 on a usual technology of producing preparations, mixing the
above-mentioned components, and if necessary, further kneading
the mixture, and molding it. The above-mentioned mixing is
conducted by generally used methods, for example, mixing,
kneading and the like. Specifically, when a quick release
119
CA 02505322 2005-05-06
preparation is formed, for example, into a particle, it can be
prepared, according to the same methods as in the above-
mentioned method for preparing a nucleus of a sustained release
preparation, by mixing the components using a vertical
granulator, universal kneader (manufactured by Hata Tekkosho),
fluidized bed granulator FD-SS (manufactured by Powrex), and
the like, then, subjecting the mixture to a wet extrusion
granulation method, fluidized bed granulation method and the
like.
io Thus obtained quick releasing preparation and sustained
releasing preparation may be themselves made into products or
made into products appropriately together with preparation
excipients and the like, separately, by an ordinary method,
then, may be administered simultaneously or may be administered
is in combination at any administration interval, or they may be
themselves made into one oral preparation (e. g., granule, fine
particle, tablet, capsule and the like) or made into one oral
preparation together with preparation excipients and the like.
It may also be permissible that they are made into granules or
2o fine particles, and filled in the same capsule to be used as a
preparation for oral administration.
[3] Sublingual, buccal or intraoral quick disintegrating agent
and preparation thereof
Sublingual, buccal or intraoral quick disintegrating
25 agents may be a solid preparation such as tablet and the like,
or may be an oral mucosa membrane patch (film).
As the sublingual, buccal or intraoral quick
disintegrating agent, a preparation containing the compound of
the present invention or the concomitant drug and an excipient
3o is preferable. It may contain also auxiliary agents such as a
lubricant, isotonizing agent, hydrophilic carrier, water-
dispersible polymer, stabilizer and the like. Further, for
easy absorption and increase in in vivo use efficiency, (3-
cyclodextrin or ~3-cyclodextrin derivatives (e. g.,
120
CA 02505322 2005-05-06
hydroxypropyl-~3-cyclodextrin and the like) and the like may
also be contained.
As the above-mentioned excipient, lactose, sucrose, D-
mannitol, starch, crystalline cellulose, light anhydrous
silicic acid and the like are mentioned. As the lubricant,
magnesium stearate, calcium stearate, talc, colloidal silica
and the like are mentioned, and particularly, magnesium
stearate and colloidal silica are preferable. As the
isotonizing agent, sodium chloride, glucose, fructose, mannitol,
io sorbitol, lactose, saccharose, glycerin, urea and the like are
mentioned, and particularly, mannitol is preferable. As the
hydrophilic carrier, swellable hydrophilic carriers such as
crystalline cellulose, ethylcellulose, crosslinkable
polyvinylpyrrolidone, light anhydrous silicic acid, silicic
is acid, dicalcium phosphate, calcium carbonate and the like are
mentioned, and particularly, crystalline cellulose (e. g., fine
crystalline cellulose and the like) is preferable. As the
water-dispersible polymer, gums (e. g., gum tragacanth, acacia
gum, cyamoposis gum), alginates (e. g., sodium alginate),
2o cellulose derivatives (e. g., methylcellulose,
carboxymethylcellulose, hydroxymethylcellulose,
hydroxypropylcellulose, hydroxypropylmethylcellulose), gelatin,
water-soluble starch, polyacrylic acids (e. g., Carbomer),
polymethacrylic acid, polyvinyl alcohol, polyethylene glycol,
25 polyvinylpyrrolidone, polycarbofil, ascorbate palmitates and
the like are mentioned, and hydroxypropylmethylcellulose,
polyacrylic acid, alginate, gelatin, carboxymethylcellulose,
polyvinylpyrrolidone, polyethylene glycol and the like are
preferable. Particularly, hydroxypropylmethylcellulose is
3o preferable. As the stabilizer, cysteine, thiosorbitol,
tartaric acid, citric acid, sodium carbonate, ascorbic acid,
glycine, sodium sulfite and the like are mentioned, and
particularly, citric acid and ascorbic acid are preferable.
The sublingual, buccal or intraoral quick disintegrating
121
CA 02505322 2005-05-06
agent can be produced by mixing the compound of the present
invention or the concomitant drug and an excipient by a method
known per se. Further, if desirable, auxiliary agents such as
a lubricant, isotonizing agent, hydrophilic carrier, water-
dispersible polymer, stabilizer, coloring agent, sweetening
agent, preservative and the like may be mixed. The sublingual,
buccal or intraoral quick disintegrating agent is obtained by
mixing the above-mentioned components simultaneously or at a
time interval, then subjecting the mixture to tablet-making
io molding under pressure. For obtaining suitable hardness, it
may also be permissible that the materials are moistened by
using a solvent such as water, alcohol and the like if desired
before and after the tablet making process, and after the
molding, the materials are dried, to obtain a product.
is In the case of molding into a mucosa membrane patch (film),
the compound of the present invention or the concomitant drug
and the above-mentioned water-dispersible polymer (preferably,
hydroxypropylcellulose, hydroxypropylmethylcellulose),
excipient and the like are dissolved in a solvent such as water
2° and the like, and the resulted solution is cast, to give a film.
Further, additives such as a plasticizer, stabilizer,
antioxidant, preservative, coloring agent, buffer, sweetening
agent and the like may also be added. For imparting suitable
elasticity to the film, glycols such as polyethylene glycol,
25 propylene glycol and the like may be contained, or for
enhancing adhesion of the film to an intraoral mucosa membrane
lining, a bio-adhesive polymer (e. g., polycarbofil, carbopol)
may also be contained. In the casting, a solution is poured on
the non-adhesive surface, spread to uniform thickness
30 (preferably 10 to 1000 micron) by an application tool such as a
doctor blade and the like, then, the solution is dried to form
a film. It may be advantageous that thus formed film is dried
at room temperature or under heat, and cut into given area.
As the preferable intraoral quick disintegrating agent,
122
CA 02505322 2005-05-06
there are mentioned solid quick scattering dose agents composed
of a network body comprising the compound of the present
invention or the concomitant drug, and a water-soluble or
water-diffusible carrier which is inert to the compound of the
present invention or concomitant drug, are mentioned. This
network body is obtained by sublimating a solvent from the
solid composition constituted of a solution prepared by
dissolving the compound of the present invention or the
concomitant drug in a suitable solvent.
1° It is preferable that the composition of an intraoral
quick disintegrating agent contains a matrix forming agent and
a secondary component, in addition to the compound of the
present invention or the concomitant drug.
Examples of the matrix forming agent include animal
15 proteins or vegetable proteins such as gelatins, dextrins and,
soybean, wheat and psyllium seed protein and the like; rubber
substances such as gum Arabic, cyamoposis gum, agar, xanthan
gum and the like; polysaccharides; alginic acids;
carboxymethylcelluloses; carageenans; dextrans; pectins;
2o synthetic polymers such as polyvinylpyrrolidone and the like;
substances derived from a gelatin-gum Arabic complex, and the
like. E~rther, saccharides such as mannitol, dextrose, lactose,
galactose, trehalose and the like; cyclic saccharides such as
cyclodextrin and the like; inorganic salts such as sodium
2s phosphate, sodium chloride and aluminum silicate and the like;
amino acid s having 2 to 12 carbon atoms such as glycine, L-
alanine, L-aspartic acid, L-glutamic acid, L-hydroxyproline, L-
isoleucine, L-leucine, L-phenylalanine and the like, are
contained.
3o One or more of the matrix forming agents can be introduced
in a solution or suspension before solidification. Such matrix
forming agent may be present in addition to a surfactant, or
may be present while a surfactant being excluded. The matrix
forming agent aids to maintain the compound of the present
123
CA 02505322 2005-05-06
invention or the concomitant drug in the solution or suspension
in diffused condition, in addition to formation of the matrix.
The composition may contain secondary components such as
preservative, antioxidant, surfactant, thickening agent,
coloring agent, pH regulator, flavoring agent, sweetening
agent, food taste masking agent and the like. As the suitable
coloring agent, red, black and yellow iron oxides, and FD & C
dyes such as FD & C Blue 2, FD & C Red 40 and the like
manufactured by Elis and Eberald can be mentioned. Examples
1° of suitable flavoring agents include mint, raspberry, licorice,
orange, lemon, grape fruit, caramel, vanilla, cherry, grape
flavor and combinations thereof. Examples of suitable pH
regulators include citric acid, tartaric acid, phosphoric acid,
hydrochloric acid and malefic acid. Examples of suitable
15 sweetening agents include aspartame, acesulfame K and
thaumatin and the like. Examples of suitable food taste
masking agents include sodium bicarbonate, ion exchange resin,
cyclodextrin-containing compounds, adsorbent substances and
microcapsulated apomorphine.
2° The preparation contains the compound of the present
invention or a concomitant drug in an amount generally from
about 0.1 to about 50~ by weight, preferably from about 0.1 to
about 30~ by weight, and preferred are preparations (such as
the above-mentioned sublingual agent, buccal and the like)
2s which can dissolve 90~ or more of the compound of the present
invention or the concomitant drug (into water) within the time
range of about 1 to about 60 minutes, preferably about 1 to
about 15 minutes, more preferably about 2 to about 5 minutes,
and intraoral quick disintegrating preparations which are
3° disintegrated within the range of 1 to 60 seconds, preferably 1
to 30 seconds, further preferably 1 to 10 seconds, after
placement in an oral cavity.
The content of the above-mentioned excipient in the whole
preparation is from about 10 to about 99o by weight, preferably
124
CA 02505322 2005-05-06
from about 30 to about 90% by weight. The content of ~-
cyclodextrin or ~-cyclodextrin derivative in the whole
preparation is from 0 to about 30% by weight. The content of
the lubricant in the whole preparation is from about 0.01 to
about 10% by weight, preferably from about 1 to about 5% by
weight. The content of the isotonizing agent in the whole
preparation is from about 0.1 to about 90% by weight,
preferably, from about 10 to about 70% by weight. The content
of the hydrophilic carrier agent in the whole preparation is
1o from about 0.1 to about 50% by weight, preferably, from about
to about 30% by weight. The content of the water-
dispersible polymer in the whole preparation is from about 0.1
to about 30% by weight, preferably, from about 10 to about 25%
by weight. The content of the stabilizer in the whole
is preparation is from about 0.1 to about 10% by weight,
preferably, from about 1 to about 5% by weight. The above-
mentioned preparation may further contain additives such as a
coloring agent, sweetening agent, preservative and the like, if
necessary.
2o The dosage of a concomitant agent of the present invention
differs depending on the kind of the compound of the present
invention, age, body weight, condition, preparation form,
administration method, administration period and"the like, and
for example, for one diabetic patient (adult, body weight:
25 about 60 kg), the concomitant agent is administered
intravenously, at a dose of about 0.01 to about 1000 mg/kg/day,
preferably about 0.01 to about 100 mg/kg/day, more preferably
about 0.1 to about 100 mg/kg/day, particularly about 0.1 to
about 50 mg/kg/day, especially about 1.5 to about 30 mg/kg/day,
3o in terms of the compound of the present invention or the
concomitant drug, respectively, once or divided several times
in a day. Of course, since the dosage as described above
varies depending on various conditions, amounts smaller than
the above-mentioned dosage may sometimes be sufficient, further,
125
CA 02505322 2005-05-06
amounts over that range sometimes have to be administered.
The amount of the concomitant drug can be set at any value
unless side effects are problematical. The daily dosage in
terms of the concomitant drug differs depending on the severity,
age, sex, body weight, sensitivity difference of the subject,
administration period, interval, and nature, pharmacology, kind
of the pharmaceutical preparation, kind of effective ingredient,
and the like, and not particularly restricted, and the amount
of a drug is, in the case of oral administration for example,
io usually from about 0.001 to 2000 mg, preferably from about 0.01
to 500 mg, further preferably from about 0.1 to 100 mg, per 1
kg of a mammal and this is usually administered once to 4-times
divided in a day.
For administration of a concomitant agent of the present
Zs invention, the compound of the present invention may be
administered after administration of the concomitant drug or
the concomitant drug may be administered after administration
of the compound of the present invention, though they may be
administered simultaneously. When administered at a time
2o interval, the interval varies depending on the effective
ingredient, preparation form and administration method, and,
for example, when the concomitant drug is administered first, a
method in which the compound of the present invention is
administered within time range of from 1 minute to 3 days,
2s preferably from 10 minutes to 1 day, more preferably from 15
minutes to 1 hour, after administration of the concomitant drug
is exemplified. When the compound of the present invention is
administered first, a method in which the concomitant drug is
administered within time range of from 1 minute to 1 day,
3o preferably from 10 minutes to 6 hours, more preferably from 15
minutes to 1 hour after administration of the compound of the
present invention is exemplified.
In a preferable administration method, for example, the
concomitant drug which has been formed into an oral
126
CA 02505322 2005-05-06
administration preparation is administered orally at a daily
dose of about 0.001 to 200 mg/kg, and about 15 minutes after,
the compound of the present invention which has been formed
into an oral administration preparation is administered orally
at a daily dose of about 0.005 to 100 mg/kg.
The G-protein-coupled receptor protein (GPR40) of this
invention is a receptor protein containing an amino acid
sequence identical or substantially identical to the amino acid
sequence presented by SEQ ID N0:1, SEQ ID N0:3, SEQ ID N0:5,
1o SEQ ID N0:7 or SEQ ID N0:9.
GPR40 may be derived from any type of cells of humans and
mammals (e. g. guinea pigs, rats, mice, rabbits, pigs, sheep,
cattle, monkeys, others), for example, splenocytes, neurons,
glia cells, pancreatic ~3 cells, pancreatic islet, bone marrow
Is cells, mesangium cells, Langerhans cells, epidermal cells,
epithelial cells, endothelial cells, fibroblasts, fibre cells,
muscle cells, adipocytes, immune cells (e.g. macrophages, T
cells, B cells, natural killer cells, mast cells, neutrophils,
basophils, eosinophils, monocytes), megakaryocytes, synovial
2o cells, chondrocytes, osteocytes, osteoblasts, osteoclasts,
mammary cells, hepatocytes and interstitial cells, precursor
cells, stem cells and cancer cells of said cells, and cells in
the blood cell system. The receptor protein may'also derived
from any tissue in which said cells are present, for example,
ZS the brain, each region of the brain (e. g. olfactory bulbs,
amyglada, basal ganglia, hippocampus, thalamus, hypothalamus,
subthalamic nucleus, cerebral cortex, medulla oblongata,
cerebelleum, occipital lobes, frontal lobe, lateral lobe,
putamen, caudate nucleus, corpus callosum, substantia nigra),
3o spinal cord, pituitary gland, stomach, pancreas, kidneys, liver,
gonads, thyroid gland, gallbladder, bone marrow, adrenal glands,
skin, muscle, lung, digestive tract (e. g. large intestine,
small intestine), vascular vessels, heart, thymus, spleen,
submandibular gland, peripheral blood, peripheral blood cells,
127
CA 02505322 2005-05-06
prostate, orchis, testes, ovaries, placenta, uterus, bones,
joints, skeletal muscles and the like. The receptor protein
may also be synthetic. Particularly, GPR40 is highly expressed
in pancreatic islet.
Amino acid sequences substantially identical to the amino
acid sequence presented by SEQ ID N0:1, SEQ ID N0:3, SEQ ID
N0:5, SEQ ID N0:7 or SEQ ID N0:9 are amino acid sequences
having about 850 or more homology, preferably about 90~ or more
homology, more preferably about 95~ or more homology to the
ono acid sequences presented by SEQ ID NO:1, SEQ ID N0:3, SEQ
ID N0:5, SEQ ID N0:7 or SEQ ID N0:9 .
As proteins containing amino acid sequences substantially
identical to the amino acid sequence of this invention
presented by SEQ ID N0:1, SEQ ID N0:3, SEQ ID N0:5, SEQ ID N0:7
Is or SEQ ID N0:9, for example, proteins that contain amino acid
sequences that are substantially identical to the amino acid
sequence presented by SEQ ID NO:1, SEQ ID N0:3, SEQ ID N0:5,
SEQ ID N0:7 or SEQ ID N0:9 and have substantially the same
activity as that of the amino acid presented by SEQ ID NO:1,
2o SEQ ID N0:3, SEQ ID N0:5, SEQ ID N0:7 or SEQ ID N0:9 are
preferred.
As to the substantially same activity, ligand-binding
activity, signal transduction activity and the like are
included. 'Substantially same' means that the quality of the
25 activity is same. Therefore, although it is preferable that
the activities such as ligand-binding and signal transduction
activities are equivalent (e. g. about 0.01- to 100-fold,
preferably about 0.5- to 20-fold, more preferably about 0.5- to
2-fold), quantitative factors such as the level of activity and
3o the molecular weight of the protein may differ.
The activities such as the ligand-binding activity, signal
transduction activity and the like can be determined according
to methods known per se and, for example, these activities can
be measured according to the method for screening described
128
CA 02505322 2005-05-06
below.
Proteins containing the following amino acid sequences are
also used as GPR40: a) amino acid sequences presented by SEQ ID
NO:1, SEQ ID N0:3, SEQ ID N0:5, SEQ ID N0:7 or SEQ ID N0:9 in
s which one, two, or more amino acids (preferably 1 - 30 amino
acids, more preferably 1 - 10 amino acids, most preferably
several (1 - 5) amino acids) are deleted, b) amino acid
sequences presented by SEQ ID N0:1, SEQ ID N0:3, SEQ ID N0:5,
SEQ ID N0:7 or SEQ ID N0:9 in which one, two, or more amino
to acids (preferably 1 - 30 amino acids, more preferably 1 - 10
amino acids, and most preferably several (1 - 5) amino acids)
are added, c) amino acid sequences presented by SEQ ID NO:1,
SEQ ID N0:3, SEQ ID N0:5, SEQ ID N0:7 or SEQ ID N0:9 in which
one, two, or more amino acids (preferably 1 - 30 amino acids,
Is more preferably 1 - 10 amino acids, and most preferably several
(1 - 5) amino acids) are substituted by other amino acids; or
d) a protein containing a combination of such amino acid
sequences and the like.
GPR40 in the present specification is presented according
2° to the conventional presentation manner of peptides: the left
end presents the N terminal (amino terminal) and the right end
presents the C terminal (carboxyl terminal). In GPR40s
including GPR40 containing the amino acid sequence presented by
SEQ ID NO:1, the C terminal may be any of a carboxyl group (-
2s COOH) , carboxylate (-COO ) , amide (-CONH2) and ester (-COORx) .
For Rx in the esters, for example, a C1_6 alkyl groups such
as methyl, ethyl, n-propyl, isopropyl and n-butyl, for example,
C3_e cycloalkyl groups such as cyclopentyl and cyclohexyl, for
example, C6_12 aryl groups such as phenyl and a-naphthyl, for
so example, C~_14 aralkyl groups including phenyl-C1-2 alkyl groups
such as benzyl and phenethyl and a,-naphthyl-C1_z alkyl groups
such as a-naphthylmethyl are used, and pivaloyloxymethyl groups,
which are commonly used for oral esters, is also used.
When the GPR40 has a carboxyl group (or carboxylate) at a
129
CA 02505322 2005-05-06
site other than the C terminal, GPR40 having an amidated or
esterified carboxyl group are also included in GPR40 of this
invention. For the ester form in this case, for example, the
C-terminal esters described above are used.
Further, the GPR40 also includes proteins described above
in which the amino group of the N-terminal methionine residue
is protected by a protecting group (e.g. C1_6 acyl group such as
formyl group, CZ_6 alkanoyl group such as acetyl and the like,
and the like), those in which the N-terminal is cleaved in vivo
1° and the glutamyl group produced is converted to pyroglutamate,
those in which substituents on amino acid side chains in the
molecule (e. g. -OH, -SH, amino group, imidazole group, indole
group, guanidino group) are protected by appropriate protecting
groups (e.g. Cl_6 acyl group such as formyl group, CZ_6 alkanoyl
15 group such as acetyl and the like, and the like), or complex
proteins to which sugar chains are bound, that is glycoproteins.
As a specific example of GPR40, for example, mouse GPR40
containing an amino acid sequence presented by SEQ ID N0:1, rat
GPR40 containing an amino acid sequence presented by SEQ ID
2o N0:3, human GPR40 containing an amino acid sequence presented
by SEQ ID N0:5, cynomolgus GPR40 containing an amino acid
sequence presented by SEQ ID N0:7, hamster GPR40 containing an
amino acid sequence presented by SEQ ID N0:9 and~the like are
used. Of these, mouse GPR40, rat GPR40, cynomolgus GPR40 and
25 hamster GPR40 are novel proteins. Human GPR40 is a known
protein described in W02000-22129, Biochem Biophys Res Commun.
1997, Oct 20; 239 (2): 543-547.
For the partial peptides of GPR40 (hereinafter sometimes
to be abbreviated as partial peptides), any partial peptide of
3o the GPR40 described above may be used. For example, among the
protein molecules of GPR40, the region exposed to outside of
the cell membrane having substantially identical receptor-
binding activity is used.
Concretely, the partial peptides of GPR40 having amino
130
CA 02505322 2005-05-06
acid sequence presented by SEQ ID NO:1, SEQ ID N0:3, SEQ ID
N0:5, SEQ ID N0:7 or SEQ ID N0:9 are peptides containing the
regions that were shown to be the extracellular domains
(hydrophilic regions) by the hydrophobicity plot analysis.
s Part of peptides partially containing hydrophobic region may
also be used. Peptides containing individual domains can be
used, but peptides of a part containing multiple domains may
also be used.
The number of amino acids in the partial peptides of this
1° invention is preferably peptide having at least 20 or more,
preferably 50 or more, and more preferably 100 or more of the
constitutive amino acid sequence of the receptor protein of
this invention described above and the like.
The substantially identical amino acid sequences are amino
is acid sequences that have about 85$ or more, preferably about
900 or more, more preferably about 95$ or more homology to
these amino acid sequences.
Here, the 'substantially identical receptor activity'
means the same definition as described above. The
20 'substantially identical receptor activity' can be measured as
described above.
In the partial peptides of this invention, one, two, or
more amino acids (preferably about 1 - 10 amino acids, more
preferably several (1 - 5) amino acids) may be deleted, one,
2s two, or more amino acids (preferably about 1 - 20 amino acids,
preferably about 1 - 10 amino acids, and more preferably
several (1 - 5) amino acids) may be added, or one, two, or more
amino acids (preferably about 1 - 10 amino acids, more
preferably several amino acids, and most preferably about 1 - 5
3o amino acids) may be substituted by other amino acids.
In the partial peptides of this invention, the C-terminal
may be any of carboxyl group (-COOH), carboxylate (-C00-),
amide (-CONHZ) and ester (-COOR). When the partial peptide of
the present invention has a carboxyl group (or carboxylate)
131
CA 02505322 2005-05-06
besides C-terminal, the partial peptide of the present
invention also encompasses one wherein a carboxyl group is
amidated or esterified. As the ester in this case, for example,
an ester of the above-mentioned C-terminal and the like are
s used.
The partial peptides of this invention include peptides in
which the amino group of the N-terminal methionine residue is
protected by a protecting group, those in which the N-terminal
residue is cleaved in vivo and the glutamine residue is
to converted to pyroglutaminate, those in which substituents in
amino acid side chains in the molecule are protected by
appropriate protecting groups, or those in which sugar chains
are bound, that is glycopeptides, as in the GPR40 mentioned
above.
is The salts of the GPR40 or artial
p peptides include
physiologically acceptable salts formed with acids or bases,
especially physiologically acceptable salts formed with acids
are preferred. For examples, the salts formed with inorganic
acids (e. g. hydrochloric acid, phosphoric acid, hydrobromic
2o acid, sulfuric acid) and the salts formed with organic acids
(e. g. acetic acid, formic acid, propionic acid, fumaric acid,
malefic acid, succinic acid, tartaric acid, citric acid, malic
acid, oxalic acid, benzoic acid, methanesulfonic' acid,
benzenesulfonic acid) are used.
2s The GPR40 and its salts can be manufactured by the methods
known per se for purifying receptor protein from the human and
mammalian cells or tissues described above. They may also be
manufactured by culturing transformants containing the DNA
encoding the GPR40 described below, and by the protein
3o synthesis method described below or the method analogous
thereto.
When the receptor protein is produced from human or
mammalian tissues or cells, human or mammalian tissues or cells
are homogenized, followed by extracting with acid or the like,
132
CA 02505322 2005-05-06
and the extract is subjected to a combination of chromatography
such as reverse-phase chromatography and ion-exchange
chromatography to isolate and purify the receptor protein.
For the synthesis of GPR40 or a partial peptide thereof or
a salt thereof or an amide thereof, commercially available
resins for protein synthesis can be used. Such resins include
for example, chloromethyl resin, hydroxymethyl resin,
benzhydrylamine resin, aminomethyl resin, 4-benzyloxybenzyl
alcohol resin, 4-methylbenzhydrylamine resin, PAM resin, 4-
to hydroxymethylmethyl phenyl acetoamidomethyl resin,
polyacrylamide resin, 4-(2',4'-dimethoxyphenyl-
hydroxymethyl)phenoxy resin, and 4-(2',4'-dimethoxyphenyl-Fmoc
aminoethyl) phenoxy resin. Using these resins, amino acids in
which the a-amino groups and the side-chain functional groups
15 are appropriately protected are condensed in the order of the
sequence of the objective protein on the resin according to the
various condensation methods known per se. At the end of the
reaction, the protein is excised from the resin and the
protecting groups are simultaneously removed. Then,
2° intramolecular disufide bond-forming reaction is performed in a
highly diluted solution to obtain the objective protein or its
amide form.
For condensation of the protected amino acids described
above, various activation reagents for protein synthesis can be
2s used, but carbodiimides are particularly good. For
carbodiimides, DCC, N,N'-diisopropylcarbodiimide, and N-ethyl-
N'-(3-dimethylaminoprolyl)carbodiimide are used. For
activation by these reagents, the protected amino acids are
added with a racemization inhibitor (e. g. HOBt, HOOBt) directly
3o to the resin, or the protected amino acids are previously
activated as symmetric acid anhydrides, HOBt esters, or HOOBt
esters, then added to the resin.
The solvent used for activation of the protected amino
acids and condensation with the resin can be appropriately
133
CA 02505322 2005-05-06
selected from solvents known to be useful in protein
condensation reaction. For example, acid amides such as N,N-
dimethylformamide, N,N-dimethylacetoamide, and N-
methylpyrrolidone, halogenated hydrocarbons such as methylene
hydrochloride and chloroform, alcohols such as trifluoroethanol,
sulfoxide such as dimethylsufoxide, pyridine, ethers such as
dioxane and tetrahydrofuran, nitriles such as acetonitrile and
propionitrile, esters such as methyl acetate and ethyl acetate,
and appropriate mixtures of these solvents. The suitable
io reaction temperature is appropriately selected from the range
known to be used in protein bonding reaction, and usually
appropriately selected from the range from about -20~C to 50~C.
The activated amino acid derivatives are usually used in 1.5-
to 4-fold excess. The condensation is tested using ninhydrin
is reaction, and when the condensation is not sufficient,
sufficient condensation can be carried out by repeating the
condensation reaction without elimination of the protecting
groups. When sufficient condensation can not obtained even
after repeating the reaction, non-reacted amino acids can be
2o acetylated using acetic anhydride or acetylimidazole.
For the protecting groups for amino group of raw material,
for examples, Z, Boc, tert-pentyloxycarbonyl,
isobornyloxycarbonyl, 4-methoxybenzyloxycarbonyl~, C1-Z, Br-Z,
adamantyloxycarbonyl, trifluoroacetyl, phthaloyl, formyl, 2-
Zs nitrophenylsulfenyl, diphenylphosphinothioyl and Fmoc are used.
Carboxyl group can be protected by, for example, alkyl
esterification (straight-chain, branched and cyclic alkyl
esterification such as methyl, ethyl, propyl, butyl, tert-butyl,
cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl and 2-
3o adamantyl), aralkyl esterification (e.g. benzyl ester, 4-
nitrobenzyl ester, 4-methoxybenzyl ester, 4-chlorobenzyl ester,
benzhydryl ester), phenacyl esterification, benzyloxylcarbonyl
hydrazidation, tert-butoxycarbonyl hydrazidation and trityl
hydrazidation.
134
CA 02505322 2005-05-06
The hydroxyl group of serine can be protected, for example,
by esterification or etherification. Groups appropriate for
this esterification include, for example, lower alkanoyl groups
such as acetyl group, aroyl groups such as benzoyl group, and
groups derived from carbonic acid such as benzyloxycarbonyl
group and ethoxycarbonyl group. In addition, groups
appropriate for etherification include, for example, benzyl
group, tetrahydropyranyl group, and t-butyl group.
As a protecting group of the phenolic hydroxyl group of
io tyrosine, for example, Bzl, C12-Bzl, 2-nitrobenzyl, Br-Z, and
tert-butyl are used.
As a protecting group of the imidazole of histidine, for
example, Tos, 4-methoxy-2,3,6-trimethylbenzenesulfonyl, DNP,
benzyloxymethyl, Bum, Boc, Trt, and Fmoc are used.
Is As activated carboxyl groups in the raw material, for
example, corresponding acid anhydride, azide, active ester
[ester formed with alcohol (e. g. pentachlorophenol, 2,4,5-
trichlorophenol, 2,4-dinitrophenol, cyanomethyl alcohol,
paranitrophenol, HONB, N-hydroxysuccinimide, N-
2° hydroxyphthalimide, HOBt)] are used.
Activated amino groups in the raw material include, for
example, corresponding phosphoric amide.
For the method for eliminating the protecting groups, for
example, catalytic reduction in hydrogen gas flow in the
2s presence of a catalyst such as Pd-black and Pd-carbon, acid
treatment with hydrogen fluoride anhydride, methanesulfonic
acid, trifluoromethanesulfonic acid or trifluoroacetic acid, or
mixture of these acids, basic treatment with
diisopropylethylamine, triethylamine, piperidine and piperazine,
so and reduction by sodium in liquid ammonia are used. The
elimination reaction by the acid treatment described above is
generally performed at a temperature ranging from about -20~C
to 40~C. In acid treatment, addition of a cation scavenger such
as anisole, phenol, thioanisole, m-cresol, p-cresol,
135
CA 02505322 2005-05-06
dimethylsulfide, 1,4-butanedithiol, and 1,2-ethanedithiol and
the like is effective. 2,4-dinitrophenyl group used as the
protecting group of the imidazole of histidine is removed by
treatment with thiophenol. Formyl group used as the protecting
group of the indole of tryptophan is removed by the acid
treatment in the presence of the aforementioned 1,2-
ethanedithiol, 1,4-butanedithiol and the like, as well as
alkaline treatment with diluted sodium hydroxide solution and
diluted ammonia.
1° Protection of functional groups that should not be
involved in the reaction of the raw materials, protecting
groups, elimination of the protecting groups, and activation of
functional groups involved in the reaction may be appropriately
selected from known per se groups and means.
15 In another method for obtaining an amide form of protein,
for example, first, the a-carboxyl group of the carboxy
terminal amino acid is protected by amidation, and the peptide
(protein) chain is extended for a desired length from the amino
group side. Then, a protein in which only the protecting group
20 of the N-terminal a-amino group was removed from said peptide
chain and a protein in which only the protecting group of the
C-terminal carboxyl group is removed are produced. These two
proteins are condensed in the mixed solvent as described above.
The details of the condensation reaction are the same as
2s described above. After the protected protein obtained by
condensation is purified, all protecting groups are removed by
the method described above, and the desired crude protein is
obtained. The desired protein in amide form can be obtained by
purifying this crude protein using various known means for
so purification and by lyophilizing the major fraction.
To obtain esterified protein, for example, the a-carboxyl
group of the carboxy terminal amino acid is condensed with a
desired alcohol to prepare amino acid ester, and the desired
esterified protein can be obtained by the same procedure as in
136
CA 02505322 2005-05-06
the preparation of the amide form of protein.
The partial peptides of GPR40 or their salts can be
manufactured by a method for peptide synthesis known per se or
by cleaving GPR40 with appropriate peptidase. For the method
for peptide synthesis, for example, either solid phase
synthesis or liquid phase synthesis may be used. The partial
peptides or amino acids that may compose GPR40 are condensed
with the residual portion. When the product has protecting
groups, the objective peptide can be produced by eliminating
io the protecting groups. The condensation and elimination
methods known per se include the methods described in a) - e)
below.
a) M. Bodanszky and M.A. Ondetti: Peptide Synthesis.
Interscience Publishers, New York (1966)
15 b) Schroeder and Luebke: The Peptide. Academic Press, New York
(1965)
c) N. Izumiya, et al.: Basics and experiments of peptide
synthesis, Maruzen Co. (1975)
d) H. Yajima and S. Sakakibara: Biochemical Experiment 1,
2o Chemistry of Proteins IV, 205 (1977)
e) H. Yajima ed.: A sequel to Development of Pharmaceuticals
Vol. 14, Peptide Synthesis, Hirokawa Shoten
After the reaction, the partial peptides o~ this invention
are purified by a combination of conventional purification
25 methods for example, solvent extraction, distillation, column
chromatography, liquid chromatography, recrystallization and
the like. When the partial peptide obtained by the above
methods is free form, it can be converted to an appropriate
salt form by known methods. On the other hand, when a salt
3o form is obtained, it can be converted to the free form by known
methods.
For the polynucleotide encoding GPR40, any polynucleotide
containing the nucleotide sequence (DNA or RNA, preferably DNA)
encoding GPR40 described above can be used. Said
137
CA 02505322 2005-05-06
polynucleotide may be DNA and RNA including mRNA encoding GPR40,
which may be double-stranded or single-stranded. When the
polynucleotide is double-stranded, it may be double-stranded
DNA, double-stranded RNA, or DNA:RNA hybrid. When the
polynucleotide is single-stranded, it may be sense strand (i.e.
coding strand) or antisense strand (i.e. non-coding strand).
Using the polynucleotide encoding GPR40, mRNA of GPR40 can
be quantified by, for example, the known method described in
separate volume of Jikken Igaku 15 (7) 'New PCR and its
io application' (1997) or the method analogous thereto.
The DNA encoding GPR40 may be any DNA of genomic DNA,
genomic DNA library, cDNA and cDNA library derived from the
cells and tissues described above, and synthetic DNA. For the
vector used for library, bacteriophage, plasmid, cosmid, and
15 phagemid may be used. The DNA may be directly amplified by
Reverse Transcriptase Polymerase Chain Reaction (hereinafter to
be abbreviated as RT-PCR) using total RNA or mRNA fraction
prepared from the cells and tissues described above.
Concretely, the DNA encoding GPR40 may be, for example,
2o any DNA containing the nucleotide sequence presented by SEQ ID
N0:2, SEQ ID N0:4, SEQ ID N0:6, SEQ ID N0:8 or SEQ ID NO:10 or
DNA having the nucleotide sequence that hybridize to the
nucleotide sequence presented by SEQ ID N0:2, SEQ ID N0:4, SEQ
ID N0:6, SEQ ID N0:8 or SEQ ID NO:10 under a high stringent
25 condition, and encoding the receptor protein having
substantially identical activity (e. g. ligand-binding activity
and signal transduction activity) with that of GPR40 comprising
the amino acid sequence presented by SEQ ID N0:1, SEQ ID N0:3,
SEQ ID N0:5, SEQ ID N0:7 or SEQ ID N0:9.
so For the DNA that can hybridize to the nucleotide sequence
presented by SEQ ID N0:2, SEQ ID N0:4, SEQ ID N0:6, SEQ ID N0:8
or SEQ ID N0:10, for example, DNAs containing a nucleotide
sequence that have about 85~ or more homology, preferably about
90o or more homology, more preferably about 95o or more
138
CA 02505322 2005-05-06
homology to the nucleotide sequence presented by SEQ ID N0:2,
SEQ ID N0:4, SEQ ID N0:6, SEQ ID N0:8 or SEQ ID N0:10 are used.
Hybridization can be performed using a method known per se
or the method analogous thereto for example, the method
s described in Molecular Cloning, 2nd (J. Sambrook et al., Cold
Spring Harbor Lab. Press, 1989) and the like. When a
commercial library is used, hybridization may be performed
according to a method described in the attached instruction.
Preferably, hybridization may be performed according to a high
to stringent condition.
In said high stringent condition, for example, the sodium
concentration is about 19 - 40 mM, preferably about 19 - 20 mM,
and the temperature is about 50 - 70°C, preferably about 60 -
65°C. In the most preferred condition, the sodium concentration
is is about 19 mM and the temperature is about 65°C.
More concretely, for the DNA encoding mouse GPR40
containing an amino acid sequence presented by SEQ ID:1, the
DNAs encoding the nucleotide sequence presented by SEQ ID:2 are
used.
2o As the DNA encoding mouse GPR40 containing an amino acid
sequence presented by SEQ ID N0:3, a DNA containing a
nucleotide sequence presented by SEQ ID N0:4 and the like are
used.
As the DNA encoding mouse GPR40 containing an amino acid
2s sequence presented by SEQ ID N0:5, a DNA containing a
nucleotide sequence presented by SEQ ID N0:6 and the like are
used.
As the DNA encoding cynomolgus GPR40 containing an amino
acid sequence presented by SEQ ID N0:7, a DNA containing a
3o nucleotide sequence presented by SEQ ID N0:8 and the like are
used.
As the DNA encoding hamster GPR40 containing an amino
acid sequence presented by SEQ ID N0:9, a DNA containing a
nucleotide sequence presented by 5EQ ID N0:10 and the like are
139
CA 02505322 2005-05-06
used.
The DNAs encoding the partial peptides of this invention
may be any DNA that contains a nucleotide sequence encoding the
aforementioned partial peptide of this invention, and may be
s genomic DNA, genomic DNA library, cDNA and cDNA library derived
from the cells and tissues described above, and synthetic DNA.
Vectors used for library may be bacteriophage, plasmid, cosmid,
and phagemid. The DNA may be directly amplified using a mRNA
fraction prepared from the cells and tissues described above by
I° Reverse Transcriptase Polymerase Chain Reaction (hereinafter to
be abbreviated as RT-PCR method).
Concretely, as the DNA encoding the partial peptides of
this invention, for example: (1) DNA containing a partial
nucleotide sequence of the DNA presented by SEQ ID N0:2, SEQ ID
1s N0:4, SEQ ID N0:6, SEQ ID N0:8 or SEQ ID NO:10, and (2) DNA
containing a partial nucleotide sequence of the DNA that
contains a nucleotide sequence that hybridizes to the
nucleotide sequence presented by SEQ ID N0:2, SEQ ID N0:4, SEQ
ID N0:6, SEQ ID N0:8 or SEQ ID NO:10 under a high stringent
2o condition and encoding a receptor protein having substantially
identical activities (e. g., ligand binding activity, signal
transduction activity and the like) with those of GPR40 having
an amino acid sequence presented by SEQ ID N0:1,'SEQ ID N0:3,
SEQ ID N0:5, SEQ ID N0:7 or SEQ ID N0:9 and the like are used.
2s For the DNAs that hybridize to the nucleotide sequence
presented by SEQ ID N0:2, SEQ ID N0:4, SEQ ID N0:6, SEQ ID N0:8
or SEQ ID N0:10, for example, DNAs containing about 850 or more,
preferably about 900 or more, more preferably about 95~ or more
homology to the nucleotide sequence presented by SEQ ID N0:2,
3o SEQ ID N0:4, SEQ ID N0:6, SEQ ID N0:8 or SEQ ID N0:10 are used.
For the means for cloning the DNA completely encoding
GPR40 or its partial peptides (hereinafter sometimes to be
abbreviated as GPR40), the DNA is amplified by PCR using
synthetic DNA primers containing a partial nucleotide sequence
140
CA 02505322 2005-05-06
of GPR40, or the DNA inserted in an appropriate vector can be
selected by hybridization with the labeled DNA fragment
encoding a part or entire region of GPR40 or synthetic DNA.
Hybridization can be performed, for example, by the method
described in Molecular Cloning, 2nd (J. Sambrook et al., Cold
Spring Harbor Lab. Press, 1989) and the like. Hybridization
can also be performed when a commercial library is used
according to the method described in the attached instruction.
Conversion of the DNA nucleotide sequences can be
io performed by PCR or methods known per se such as ODA-LA PCR,
Gapped duplex method and Kunkel method or methods analogous
thereto using a known kit such as MutanT"'-super Express Km
(TAKARA SHUZO CO., LTD.), Mutan~''-K (TAKARA SHUZO CO., LTD.) and
the like.
1s The cloned DNAs encoding GPR40 can be used without
treatment or used after digestion with restriction enzymes or
addition of linkers when desired. Said DNA may contain the
translational initiation codon ATG at the 5'-end and
translational stop codon TAA, TGA, or TAG at the 3'-end. These
2° translational initiation codon and stop codon can be added
using an appropriate synthetic DNA adaptor.
Expression vectors for GPR40 can be manufactured, for
example, as follows: (i) The objective DNA fragment is excised
from the DNA encoding GPR40, and (ii) the DNA fragment is
2s ligated to downstream of the promoter in an appropriate vector.
For the vector, Escherichia coli-derived plasmid (e. g.
pBR322, pBR325, pUCl2, pUCl3), Bacillus subtilis-derived
plasmid (e. g. pUB110, pTPS, pC194), yeast-derived plasmid (e. g.
pSHl9, pSHlS), bacteriophages such as 1~ phage, animal viruses
3o such as retrovirus, vaccinia virus, baculovirus, and pAl-11,
pXTl, pRC/CMV, pRC/RSV, and pcDNAI/Neo are used.
Any promoter that is appropriate and corresponds to the
host used for the gene expression may be used as the promoter
used in this invention. For example, when animal cells are
141
CA 02505322 2005-05-06
used as the host, SRa, promoter, SV40 promoter, LTR promoter,
CMV promoter, and HSV-TK promoter are used.
Among them, CMV promoter and SRa, promoter are preferred.
When the host is bacteria of Escherichia genus, trp promoter,
lac promoter, recA promoter, ~,PL promoter, and lpp promoter and
the like are preferred. When the host is bacteria of Bacillus
genus, SPO1 promoter, SP02 promoter, penP promoter and the like
are preferred. When the host is yeast, PH05 promoter, PGK
promoter, GAP promoter, ADH promoter and the like are preferred.
io When the host is insect cells, polyhedrin promoter, P10
promoter and the like are preferred.
In addition to the vectors described above, expression
vectors containing enhancer, splicing signal, polyA addition
signal, selection marker, and SV40 replication origin
15 (hereinafter sometimes to be abbreviated as SV40ori) may be
used when desired. For the selection marker, for example,
dihydrofolate reductase (hereinafter sometimes to be
abbreviated as dhfr) gene [methotrexate (MTX)-resistant],
ampicillin resistance gene (hereinafter to be abbreviated as
2o pmpr), and neomycin resistance gene (hereinafter sometimes to
be abbreviated as Neor, 6418 resistant) are used. Especially,
when dhfr gene is used as a selection marker using CHO (dhfr-)
cells, the objective gene can be selected using a thymidine-
free medium.
2s Where necessar , moreover, a si
y final sequence appropriate
for the host is added to the N-terminal of the receptor protein
of this invention. When the host is bacteria of Escherichia
genus, PhoA signal sequence and OmpA signal sequence and the
like are used. When the host is bacteria of Bacillus genus, a-
3o amylase signal sequence and subtilisin signal sequence and the
like are used. When the host is yeast, MFa signal sequence and
SUC2 signal sequence are used. When the host is animal cells,
insulin signal sequence, a-interferon signal sequence, and the
signal sequence of antibody molecule and the like can be used.
142
CA 02505322 2005-05-06
Using the vectors containing the DNA encoding GPR40
constructed as described above, transformants can be
manufactured.
For the host, for example, Escherichia genus, Bacillus
genus, yeast, insect cells, insects, animal cells and the like
are used.
Specific examples of the host of Escherichia genus are
Escherichia coli K12 DH1 [Proceedings of the National Academy
of Sciences of the USA (Proc. Natl. Acad. Sci. USA) Vol. 60,
io 160 (1968)], JM103 [Nucleic Acids Research Vol. 9, 309 (1981)],
JA221 [Journal of Molecular Biology Vol. 120, 517 (1978)],
HB101 [Journal of Molecular Biology Vol. 41, 459 (1969)], C600
[Genetics Vol. 39, 440 (1954)] and the like.
For the host of Bacillus genus, for example, Bacillus
is subtilis MI114 [Gene Vol. 24, 255 (1983)] 207-21 [Journal of
Biochemistry Vol. 95, 87 (1984)] and the like are used.
For the host of yeast, for example, Saccharomyces
cerevisiae AH22, AH22R-, NA87-11A, DKD-5D, 20B-12,
Schizosaccharomyces pombe NCYC1913, NCYC2036, and Pichia
2° pastoris are used.
For the host of insect cells, for example, when the virus
is AcNPV, Spodoptera frugiperda cells (Sf cells), MGl cells
derived from the middle gut of Trichoplusia ni, High FiveT"'
cells derived from Trichoplusia ni eggs, Mamestra brassicae-
25 derived cells, or Estigmena acrea-derived cells are used. When
the virus is BmNPV, silkworm-derived cells Bombyx mori N (BmN
cells) are used. For said Sf cells, for example, SF9 cells
(ATCC CRL1711), Sf21 cells (Vaughn, J.L. et al., In Vivo 13,
213-217 (1977)) are used.
3o For the host of insect, for example, silkworm larvae are
used [Maeda et al., Nature, Vol. 315, 592 (1985)].
For the host of animal cells, for example, monkey COS-7
cells, Vero, Chinese hamster CHO cells (hereinafter to be
abbreviated as CHO cells), dhfr gene-deficient Chinese hamster
143
CA 02505322 2005-05-06
cells CHO (hereinafter to be abbreviated as CHO (dhfr-) cells),
mouse L cells, mouse AtT-20, mouse myeloma cells, rat GH3, and
human FL cells are used.
Bacteria of Escherichia genus can be transformed according
to, for example, the methods described in Proc. Natl. Acad. Sci.
USA Vol. 69, 2110 (1972) and Gene Vol. 17, 107 (1982) and the
like.
Bacteria of Bacillus genus can be transformed according to,
for example, the method described in Molecular & General
to Genetics Vol. 168, 111 (1979) and the like.
Yeast can be transformed according to, for example, the
methods described in Methods in Enzymology Vol. 194, 182-187
(1991) and Proc. Natl. Acad. Sci. USA Vol. 75, 1929 (1978) and
the like.
15 Insect cells and insects can be transformed according to,
for example, the method described in Bio/Technology, 6, 47-55
(1988) and the like.
Animal cells can be transformed by, for example, the
methods described in Cell Engineering (Saibo Kogaku) Separate
2o Vol. 8, New Cell Engineering Experimental Protocol, 263-267
(1995) (Shujun-sha) and Virology Vol. 52, 456 (1973).
As described above, the transformants transformed by the
expression vector containing the DNA encoding GPR40 can be
obtained.
2s For the medium for culturing the transformants wherein the
host is Escherichia or Bacillus host, liquid medium is suitable,
in which carbon source, nitrogen source, inorganic compounds,
and other substances necessary for the growth of the
transformants are contained. The carbon source includes for
3o example, glucose, dextrin, soluble starch, sucrose and the like.
The nitrogen source includes for example, inorganic and
organic compounds such as ammonium salts, nitrates, corn steep
liquor, peptone, casein, meat extract, soybean cake, potato
extract and the like. The inorganic compounds include for
144
CA 02505322 2005-05-06
example, calcium chloride, sodium dihydrogen phosphate,
magnesium chloride and the like. Yeast extract, vitamins, and
growth factors may be added. The pH of about 5 - 8 is
desirable for the culture.
For the culture medium for bacteria of Escherichia genus,
for example, M9 medium containing glucose and casamino acids
(Miller, Journal of Experiments in Molecular Genetics, 431-433,
Cold Spring Harbor Laboratory, New York, 1972) is preferred.
When more efficiency is required for the function of the
to promoter, reagent such as 3~-indolyl acrylate may be added.
When the host is bacteria of Escherichia genus, the
bacteria are generally cultured at about 15 - 43~C for about 3
- 24 hours, and aeration or agitation may be added to the
culture, when necessary.
is When the host is bacteria of Bacillus
genus, the bacteria
are generally cultured at about 30 - 40~C for about 6 - 24
hours, and aeration or agitation may be added to the culture,
when necessary.
For the medium for culturing the transformant of yeast
2o host, for example, Burkholder minimum medium [Bostian, K.L. et
al., Proc. Natl. Acad. Sci. USA Vol. 77, 4505 (1980)] and SD
medium containing 0.5$ casamino acid [Bitter, G.A. et al.,
Proc. Natl. Acad. Sci. USA Vol. 81, 5330 (1984)]'are used. The
pH of the medium is preferably adjusted to about 5 - 8. The
2s culture are generally performed at about 20 - 35~C for about 24
- 72 hours, and aeration or agitation may be added to the
culture, when necessary.
When transformants of insect cell host or insect host are
cultured, Grace's insect medium (Grace, T.C.C., Nature, 195,
30 7gg (1962)) containing appropriate supplements such as
inactivated 10~ bovine serum is used as a medium. The pH of
the medium is preferably adjusted to about 6.2 - 6.4. Usually,
the culture is performed at 27~C for about 3 - 5 days, and
aeration or agitation may be added to the culture, when
145
CA 02505322 2005-05-06
necessary.
When the transformants of animal cell host are cultured,
for example, MEM medium containing about 5 - 20o fetal calf
serum [(Science Vol. 122, 501 (1952)), DMEM medium [Virology
s Vol. 8, 396 (1959)], RPMI 1640 medium [The Journal of the
American Medical Association vol. 199, 519 (1967)], 199 medium
[Proceeding of the Society for the Biological Medicine Vol. 73,
1 (1950)] and the like are used as the medium. The pH is
preferably adjusted to about 6 - 8. Usually, the culture is
to performed at about 30 - 40°C for about 15 - 60 hours, and
aeration or agitation may be added to the culture, when
necessary.
As described above, GPR40 can be produced intracellularly,
on cell membrane or extracellularly of the transformants.
is GPR40 can be purified from the culture described above by,
for example, the methods described below.
When GPR40 is extracted from the cultured bacteria or
cells, the bacteria or cells are collected after culture by a
known method, and suspended in appropriate buffer. The
2o bacteria or cells are then disrupted using ultrasonication,
lysozymes, and/or by freezing-thawing and the like, and the
crude extract of GPR40 is obtained by centrifugation or
filtration. The buffer may contain protein-denaturants such as
urea and guanidine hydrochloride and a surfactant such as
2s Triton X-100"'. When GPR40 is secreted into the culture
supernatant, the supernatant is separated from the bacteria or
cells after the completion of culture and collected using a
method known per se.
For purification of GPR40 from the culture supernatant or
3o the extract obtained as described above, methods known per se
for separation and purification can be appropriately combined.
These methods known per se for separation and purification
include methods using solubility such as salting out and
solvent precipitation, methods mainly using differences in
146
CA 02505322 2005-05-06
molecular weight such as dialysis, ultrafiltration, gel
filtration, and SDS-polyacrylamide gel electophoresis, methods
using differences in electric charge such as ion-exchange
chromatography, methods using specific affinity such as
affinity chromatography, methods using differences in
hydrophobicity such as reverse-phase high performance liquid
chromatography, methods using differences in isoelectric point
such as isoelectric focusing and the like.
When GPR40 thus obtained is in a free form, the free form
io can be converted to salts by methods known per se or methods
analogous thereto. Conversely, when GPR40 is obtained in a
salt form, the salt form can be converted to the free form or
other salts by methods known per se or methods analogous
thereto.
i5 GPR40 produced by transformants can be optionally modified
or partially removed a polypeptide from GPR40 by treating GPR40
with an appropriate protein-modifying enzyme before or after
purification. For the protein-modifying enzyme, for example,
trypsin, chymotrypsin, arginylendopeptidase, protein kinase,
2° glycosidase and the like are used.
The activity of GPR40 thus produced can be measured by
binding assay using labeled ligands and by enzyme immunoassay
using specific antibody and the like.
25 In the following, a screening method for a compound that
changes the bindability between GPR40 and fatty acid, which is
a physiological ligand thereof (i.e., other ligand to GPR40,
GPR40 agonist, GPR40 antagonist and the like) is described in
detail.
3o As mentioned above, since the compound of the present
invention has a GPR40 activating activity, GPR40 ligand,
agonist or antagonist can be efficiently screened for from the
test compound by the use of a binding assay system using GPR40
(including cells expressing recombinant or endogenous GPR40,
147
CA 02505322 2005-05-06
cell membrane fraction thereof and the like) and the compound
of the present invention as a surrogate ligand.
The GPR40 ligand and agonist are physiological and non-
physiological compounds that bind with GPR40 to show a cell
stimulating activity (hereinafter to be generally referred to
as "GPR40 agonist").
As the cell stimulating activity, for example, an
activity promoting or suppressing arachidonic acid release,
acetylcholine release, intracellular Ca2+ release,
to intracellular cAMP production, intracellular cGMP production,
inositol phosphate production, cell membrane potential
variation, phosphorylation of intracellular protein, c-fos
activation, pH reduction and the like, and the like,
particularly intracellular Ca2+ concentration increasing
15 activity and intracellular cAMP production suppressing
activity can be mentioned.
The GPR40 antagonist is a compound that binds with GPR40
but does not show a cell stimulating activity, or shows an
activity reverse to the cell stimulating activity (reverse
2o activating activity). In the present specification, therefore,
the "GPR40 antagonist" is used as a concept encompassing not
only what is called neutral antagonists but also inverse
agonists.
In addition, by the screening method of the present
25 invention, a compound that potentiates binding force of fatty
acid and GPR40, or a compound that decreases the binding force
of fatty acid and GPR40 and the like can be screened for.
That is, the present invention provides a screening
method of a GPR40 agonist or a GPR40 antagonist, which
3o comprises comparing (i) when GPR40 and the compound of the
present invention are brought into contact and (ii) when GPR40,
the compound of the present invention and a test compound are
brought into contact.
The screening method of the present invention is
148
CA 02505322 2005-05-06
characterized in that, for example, binding amount, cell
stimulating activity and the like of the compound of the
present invention relative to GPR40 in the cases of (i) and
(ii) are determined and compared.
More specifically, the present invention provides
a) a screening method of GPR40 agonist or GPR40 antagonist,
which is characterized in that the amounts of the labeled
compound of the present invention bound to GPR40 in the cases
of when a labeled compound of the present invention is brought
io into contact with GPR40 and when a labeled compound of the
present invention and a test compound are brought into contact
with GPR40 are determined and compared,
b) a screening method of GPR40 agonist or GPR40 antagonist,
which is characterized in that the amounts of the labeled
Is compound of the present invention bound to a cell or a
membrane fraction in the cases of when a labeled compound of
the present invention is brought into contact with the cell
containing GPR40 or the membrane fraction of the cell and when
a labeled compound of the present invention and a test
2o compound are brought into contact with the cell containing
GPR40 or the membrane fraction of the cell are determined and
compared,
c) a screening method of GPR40 agonist or GPR40rantagonist,
which is characterized in that the amount of the labeled
25 compound of the present invention bound to GPR40 in the cases
of when a labeled compound of the present invention is brought
into contact with GPR40 expressed on a cell membrane by
culture of a transformant containing GPR40 DNA and when a
labeled compound of the present invention and a test compound
3o are brought into contact with GPR40 expressed on a cell
membrane by culture of a transformant containing GPR40 DNA are
determined and compared,
d) a screening method of GPR40 agonist or GPR40 antagonist,
which is characterized in that the cell stimulating activity
149
CA 02505322 2005-05-06
via GPR40 in cells containing GPR40 are determined in the
presence or absence of a test compound and compared,
e) a screening method of GPR40 agonist or GPR40 antagonist,
which is characterized in that the cell stimulating activity
via GPR40 expressed on a cell membrane by culture of a
transformant containing GPR40 DNA are determined in the
presence or absence of a test compound and compared,
f) a screening method of GPR40 agonist or GPR40 antagonist,
which is characterized in that the cell stimulating activity
io via GPR40 in the cases of when a compound of the present
invention is brought into contact with a cell containing GPR40
and when a compound of the present invention and a test
compound are brought into contact with a cell containing GPR40
are determined and compared, and
15 g) a screening method of GPR40 agonist or GPR40 antagonist,
which is characterized in that the cell stimulating activity
via GPR40 in the cases of when a compound of the present
invention is brought into contact with GPR40 expressed on a
cell membrane by culture of a transformant containing GPR40
2o D~ and when a compound of the present invention and a test
compound are brought into contact with GPR40 expressed on a
cell membrane by culture of a transformant containing GPR40
DNA are determined and compared. '
Since the compound of the present invention can be easily
25 labeled as compared to fatty acid which is a natural ligand,
it is suitable for screening.
As the test compound, for example, peptide, protein, non-
peptidic compound, synthetic compound, fermentation product,
cell extract, plant extract, animal tissue extract and the
30 like are used and these compounds may be novel compounds or
known compounds.
The test compound may form a salt, and as the salt of the
test compound, salts with physiologically acceptable acid
(e. g., inorganic acid and the like), base (e. g., organic acid
150
CA 02505322 2005-05-06
and the like) and the like are used, and physiologically
acceptable acid addition salts are particularly preferable.
As such salts, for example, salts with inorganic acid (e. g.,
hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric
acid and the like), salts with organic acid (e. g., acetic acid,
formic acid, propionic acid, fumaric acid, malefic acid,
succinic acid, tartaric acid, citric acid, malic acid, oxalic
acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid
and the like) and the like are used.
io As the test compound, a compound designed to bind with a
ligand binding pocket, based on the atomic coordinate of the
active site of GPR40 and the site of ligand binding pocket, is
preferably used. The atomic coordinate of the active site of
GPR40 and the site of ligand binding pocket can be determined
is by a known method or a method analogous thereto.
The screening method of the present invention is
concretely described in the following.
First, GPR40 to be used for the screening method of the
2o present invention may be any as long as it contains the above-
mentioned GPR40, but a cell membrane fraction of an organ of a
mammal containing GPR40 is preferable. Particularly, however,
since a human-derived organ is extremely difficult to obtain,
human-derived GPR40 expressed in large amounts using a
2s recombinant and the like are suitable for screening.
To manufacture GPR40, the methods described above are used,
and it is preferred to express GPR40 DNA in mammalian and
insect cells. For the DNA fragment encoding the objective
protein region, the complementary DNA, but not necessarily
30 limited thereto, is employed. For example, the gene fragments
and synthetic DNA may also be used. To introduce a GPR40 DNA
fragment into host animal cells and efficiently express the DNA
there, it is preferred to insert the DNA fragment downstream of
a polyhedrin promoter of nuclear polyhedrosis virus (NPV)
151
CA 02505322 2005-05-06
belonging to baculovirus hosted by insects, SV40-derived
promoter, retrovirus promoter, metallothionein promoter, human
heat shock promoter, cytomegalovirus promoter, SRa, promoter and
the like. The amount and quality of the expressed receptor
protein are examined by methods known per se, for example, the
method described in the literature [Nambi, P. et al., The
Journal of Biological Chemistry (J. Biol. Chem.), 267, 19555-
19559, 1992].
Therefore, in the screening method of the present
to invention, as a material that contains GPR40, GPR40 purified by
methods known per se or cells containing said GPR40 may be used.
In addition, a membrane fraction of cells containing GPR40 may
be used.
In the screening method of the present invention, when
is cells containing GPR40 are used, the cells may be fixed with
glutaraldehyde, formalin, etc. The cells can be fixed by a
method known per se.
The cells containing GPR40 are host cells that express
said GPR40. For the host cells, Escherichia coli, Bacillus
2o subtilis, yeast, insect cells, animal cells and the like are
preferred.
The cell membrane fraction is a fraction containing the
abundant cell membrane obtained after disruption'of the cells
by a method known per se. The cell disruption methods include
2s Crushing the cells using a Potter-Elvehjem homogenizer,
disruption using a blaring blender or polytron (Kinematica Co.),
disruption by ultrasonication, and disruption by passing the
cells through a narrow nozzle with compressing the cells using
a French Press. For the cell membrane fractionation method,
3o fractionation based on centrifugal force such as centrifugation
for fractionation and density gradient centrifugation are
mainly used. For example, disrupted cell suspension is
centrifuged at a low speed (500 - 3,000 rpm) for a short time
(usually about 1 - 10 minutes), the supernatant is then
152
CA 02505322 2005-05-06
centrifuged at a high speed (15,000 - 30,000 rpm) for usually
30 minutes - 2 hours, and the obtained precipitate is used as
the membrane fraction. The membrane fraction contains many
membrane components such as the expressed GPR40, and
phospholipids and membrane proteins derived from the cells.
The amount of GPR40 in the cells and membrane fractions
containing GPR40 is preferably 103-108 molecules and suitably
lOs-10' molecules per cell. A higher expression amount
enhances ligand binding activity (specific activity) per
to membrane fraction, which makes not only construction of a
highly sensitive screening system but also assay of a large
amount of specimen in a single lot possible.
To perform the above-mentioned a)- c) for screening for a
GPR40 agonist or antagonist, for example, a suitable GPR40
15 fraction and a labeled compound of the present invention are
necessary.
As the GPR40 fraction, natural type GPR40 fraction, a
recombinant type GPR40 fraction having an activity equivalent
thereto and the like are desirable. Here, the equivalent
2o activity means the same level of ligand binding activity,
signal transduction activity and the like.
As the labeled compound of the present invention, for
example, a compound of the present invention labeled with
radioisotope such as [3H] , [l2sI ] , [19C] , [3sS] or the like,
2s fluorescence substance, enzyme or the like, or the like is
used.
Concretely, to perform screening for a GPR40 agonist or
antagonist, firstly, GPR40 specimen is prepared by suspending
the cells or cell membrane fraction containing GPR40 into
3o buffer appropriate for the screening. For the buffer, any
buffer that does not inhibit the binding of ligands to GPR40
such as phosphate buffer and Tris-hydrochloride buffer and the
like having pH 4 - 10 (preferably pH 6 - 8) can be used. To
reduce non-specific binding, a surfactant such as CHAPS,
153
CA 02505322 2005-05-06
Tween-80~"' (Kao-Atras Co.), digitonin, deoxycholate and the
like may be added to the buffer. Further, to inhibit
degradation of GR40 and the test compound (peptidic compound)
by proteases, protease inhibitors such as PMSF, leupeptin, E-
64 (Peptide Research Laboratory, Co.), and pepstatin may be
added. To 0.01 - 10 ml of the receptor protein solution, a
specified amount (5,000 - 500,000 cpm) of labeled ligand is
added so that 10-9 M to 10-1° M of the test compound can be
exist simultaneously. To examine the amount of non-specific
to binding (NSB), reaction tubes containing a highly excessive
amount of non-labeled compound of the present invention are
also prepared. The reaction is performed at about O~C - 50~C,
preferably about 4°C - 37~C, for about 20 minutes - 24 hours,
preferably for about 30 minutes - 3 hours. After the reaction,
is the reaction solution is filtered through a glass fiber filter
and the like and the filter was washed with an appropriate
amount of the buffer. The radioactivity remaining on the
glass fiber filter is measured using a liquid scintillation
counter or Y-counter. A test compound showing a specific
Zo binding amount (B-NSB) of, for example, not more than 500,
wherein a count (B°-NSB) obtained by subtracting a non-specific
binding amount (NSB) from a count (B°) free of antagonistic
substance is taken as 100$, can be selected as a candidate
substance having an antagonistic inhibitory ability.
2s To perform the above-mentioned d)- g) of screening for a
GPR40 agonist or antagonist, GPR40 mediated cell stimulating
activity (e. g. activity promoting or suppressing arachidonic
acid release, acetylcholine release, intracellular Ca2+ release,
intracellular cAMP production, intracellular cGMP production,
3o inositol phosphate production, cell membrane potential
variation, phosphorylation of intracellular protein, c-fos
activation, pH reduction and the like, particularly
intracellular Ca2+ concentration increasing activity and
intracellular cAMP production suppressing activity) can be
154
CA 02505322 2005-05-06
measured using method known per se or commercial assay kits.
Concretely, first, cells containing GPR40 are cultured in
multiwell plates and the like. Before screening, the medium
is exchanged to fresh medium or an appropriate buffer that
exhibits no toxicity for the cells. After the cells are
incubated by adding a test compound and the like for a
specified time, the cells are extracted or the supernatant is
collected, and the product is quantified according to the
corresponding method. When detection of the production of a
to substance (e.g., Ca2+, cAMP and the like) to be used as an
index of cell stimulating activity is difficult due to
catabolic enzymes contained in the cell, an inhibitor of the
catabolic enzymes may be added before assay. As regards the
activity of CAMP production inhibition and the like, it can be
15 detected as a production inhibitory action on the cell made to
show increased basic production amount with forskolin and the
like.
To perform screening by determining the cell stimulating
activity, the cells expressing suitable GPR40 are necessary.
2o As the cells expressing GPR40, cell lines having natural type
GPR40, cell lines expressing the above-mentioned recombinant
type GPR40 and the like are desirable.
A specific evaluation method to determine whether the
compound obtained by screening is a GPR40 agonist or a GPR40
25 antagonist comprises the following (i) or (ii).
(i) Using the screening method of the aforementioned a)- c), a
compound that changes the bindability of the compound of the
present invention and GPR40 (particularly, binding is
inhibited) or a salt thereof is obtained, and whether the
3o compound or a salt thereof has the above-mentioned cell
stimulating activity or not is determined. The compound
having said cell stimulating activity or a salt thereof is an
agonist and the compound free of said cell stimulating
activity or a salt thereof is an antagonist.
155
CA 02505322 2005-05-06
(ii) (a) A test compound is brought into contact with a cell
containing GPR40 and the above-mentioned cell stimulating
activity is determined. A test compound having said cell
stimulating activity is an agonist of GPR40.
(b) The cell stimulating activity when the compound of the
present invention is brought into contact with a cell
containing GPR40 and when the compound of the present
invention and a test compound are brought into contact with a
cell containing GPR40 are determined and compared. A test
1o compound capable of decreasing the cell stimulating activity
of the compound of the present invention is an antagonist of
GPR40.
More specifically, the evaluation criterion described in
Example 202 can be used.
The screening kit for GPR40 agonist or GPR40 antagonist
comprises the compound of this invention, GPR40, a cell
containing GPR40 or a membrane fraction of a cell containing
GPR40 and the like.
2o Examples of the screening kit of this invention are as
follow.
1. Reagents for screening
a) Buffers for measurement and washing '
Hanks' Balanced Salt Solution (Gibco Co.) supplemented
with 0.05 bovine serum albumin (Sigma Co.).
The solution is sterilized by filtration through a 0.45 ~,m
filter, and stored at 4°C or may be prepared at use.
b) Standard GPR40
CHO cells expressing GPR40 are passed in 12-well plates at
3o a density of 5 X 105 cells/well and cultured at 37°C under 50
C02 and 95$ air for two days.
c) Labeled compound of the present invention (hereinafter to be
referred to as labeled compound)
The compound of the present invention labeled with
156
CA 02505322 2005-05-06
Commercial [3H] , [lzsl] , [19C] , [35S] or the like. The compound
in the form of aqueous solution is stored at 4~C or -20~C, and
the solution is diluted to 1 ~,~M with measurement buffer at use.
d) Standard solution of the compound of the present invention
(hereinafter to be referred to as non-labeled compound
standard solution)
The compound of the present invention is dissolved in PBS
containing 0.1~ bovine serum albumin (manufactured by SIGMA)
j° to 1 mM and preserved at -20°C.
2. Measurement methods
a) CHO cells expressing GPR40 are cultured in a 12-well tissue
culture plate and washed twice with 1 ml of measurement buffer,
and 490 ~1 of the measurement buffer is added to each well.
i5 b) A solution of a test compound (5 ~1) at 10-3-10-1° M is added,
5 ~,l of labeled test compound is added, and the cell are
reacted at room temperature for one hour. To measure the non-
specific binding, 5 ~l of the non-labeled compound standard
solution (10-3 M) is added in place of the test compound.
2o c) The reaction solution is removed, and the wells are washed
three times with 1 ml of washing buffer. The labeled ligand
bound to the cells is dissolved with 0.2N NaOH-1~ SDS, and
mixed with 4 ml of liquid scintillator A (Wako Pure Chemical
Industries, Ltd.)
2s d) The radioactivity is measured using a liquid scintillation
counter (Beckman Co.), and Percent Maximum Binding (PMB) is
determined by the following formula:
PMB= [ ( B-NSB ) / ( Bo-NSB ) ] x 10 0
PMB: Percent Maximum Binding
so g , value with addition of sample
NSB: Non-specific Binding (amount of non-specific
binding)
Bo . maximum binding amount
157
CA 02505322 2005-05-06
The screening method of the present invention is
characterized by screening for a GPR40 agonist or GPR40
antagonist using, as a surrogate ligand, the compound of the
present invention screened using GPR40 and its endogenous
ligand, fatty acid. Use of such synthetic ligand is
advantageous as compared to screening using an endogenous
ligand, which is a naturally occurring substance, in that
labeling of the ligand is easy and the screening can be
performed efficiently.
io The compound obtained by the screening method or
screening kit of the present invention, and a salt thereof are
GPR40 agonists or GPR40 antagonists.
The GPR40 agonist and GPR40 antagonist obtained using the
screening method or screening kit of the present invention may
Is form a salt, and as such salt, salts with physiologically
acceptable acids (e. g., inorganic acid and the like), base
(e. g., organic acid and the like) and the like are used,
physiologically acceptable acid addition salts are
particularly preferable. As such salts, for example, salts
2o with inorganic acid (e. g., hydrochloric acid, phosphoric acid,
hydrobromic acid, sulfuric acid and the like), salts with
organic acid (e. g., acetic acid, formic acid, propionic acid,
fumaric acid, malefic acid, succinic acid, tartafic acid,
citric acid, malic acid, oxalic acid, benzoic acid,
2s methanesulfonic acid, benzenesulfonic acid and the like) and
the like are used.
Since GPR40 agonist has a physiological activity similar
to that of fatty acid, which is a ligand to GPR40, it is
useful as a safe and low toxic pharmaceutical agent according
3o to the physiological activity of the fatty acid.
Since GPR40 antagonist can inhibit the physiological
activity of fatty acid, which is a ligand to GPR40, it is
useful as a safe and low toxic pharmaceutical agent to
suppress the physiological activity of fatty acid.
158
CA 02505322 2005-05-06
Since a compound that potentiates the binding force
between fatty acid and GPR40 can potentiate the physiological
activity of fatty acid, which is a ligand to GPR40, it is
useful as a safe and low toxic pharmaceutical agent according
to the physiological activity of the fatty acid.
Since a compound that decreases the binding force between
fatty acid and GPR40 can decrease the physiological activity
of fatty acid, which is a ligand to GPR40, it is useful as a
safe and low toxic pharmaceutical agent to suppress the
to physiological activity of fatty acid.
Specifically, the (i) GPR40 agonist and (ii) compound
potentiating the binding force between fatty acid and GPR40 or
a salt thereof, which are obtained using the screening method
or screening kit of the present invention, are useful as an
15 agent for the prophylaxis or treatment of, for example,
diseases such as diabetes, impaired glucose tolerance, ketosis,
acidosis, diabetic neuropathy, diabetic nephropathy, diabetic
retinopathy, hyperlipidemia, genital disorder, skin disease,
arthropathy, osteopenia, arteriosclerosis, thrombotic disease,
2° dyspepsia, memory and learning disorder and the like,
pancreatic function regulator (e. g., pancreatic function
improving agent), insulin secretagogue, a hypoglycemic agent
or pancreatic ~3 cell protector. Diabetes includes insulin-
dependent (type I) diabetes, non-insulin-dependent (type II)
25 diabetes, gestational diabetes and the like.
The (i) GPR40 antagonist and (ii) compound decreasing the
binding force between fatty acid and GPR40 or a salt thereof,
which are obtained using the screening method or screening kit
of the present invention, are useful as an agent for the
so prophylaxis or treatment of, for example, diseases such as
obesity, hyperlipidemia, type II diabetes, hypoglycemia,
hypertension, diabetic neuropathy, diabetic nephropathy,
diabetic retinopathy, edema, insulin resistance syndrome,
unstable diabetes, fatty atrophy, insulin allergy, insulinoma,
159
CA 02505322 2005-05-06
arteriosclerosis, thrombotic disease, lipotoxicity,
hyperinsulinemia, cancer and the like, pancreatic function
regulator (e. g., pancreatic function improving agent), insulin
secretion suppressing agent, pancreatic (3 cell protector,
hypoglycemic drug. Here, hyperlipidemia includes
hypertriglyceridemia, hypercholesterolemia, hypo-HDL-
cholesterolemia, postprandial hyperlipidemia and the like.
Particularly, an antagonist to GPR40 is effective for
hypoglycemia since it suppresses excess insulin secretion, and
io prevents fatigue of pancreatic ~3 cell caused by excessive
insulin secretion (protection of pancreatic (3 cells) and thus
effective for type II diabetes.
The GPR40 agonist or GPR40 antagonist obtained using the
screening method or screening kit of the present invention can
15 be used in combination with the aforementioned concomitant
drugs. In this case, the administration period of a GPR40
agonist or GPR40 antagonist obtained using the screening
method or screening kit of the present invention, and a
concomitant drug is not limited, and they may be
2o simultaneously administered to the administration subject, or
may be administered in a staggered manner. The dose of the
concomitant drug can be appropriately selected based on the
dose clinically employed. In addition, the mixing rate of the
GPR40 agonist or GPR40 antagonist obtained using the screening
2s method or screening kit of the present invention and a
concomitant drug can be appropriately determined according to
the administration subject, administration route, target
disease, condition, combination and the like. For example,
when the administration subject is a human, for example, 0.01
3o to 100 parts by weight of a concomitant drug is used per 1
part by weight of the GPR40 agonist.
When the GPR40 agonist or GPR40 antagonist obtained using
the screening method or screening kit of the present invention
is used as the above-mentioned pharmaceutical agent, it can be
160
CA 02505322 2005-05-06
prepared in the same manner as the aforementioned
pharmaceutical agent containing the compound of the present
invention.
Since the preparation obtained in this way is safe and
s low toxic, it can be administered to, for example, human and
mammals (e.g., rats, mice, rabbits, sheep, pigs, cattle, cats,
dogs, monkeys and the like).
While the dose of GPR40 agonist or GPR40 antagonist
varies depending on the administration subject, target organ,
io condition, administration method and the like, in the case of
oral administration, it is generally, for example, about 0.1
to 100 mg, preferably about 1.0 to 50 mg, more preferably
about 1.0 to 20 mg, of a GPR40 agonist for diabetic patients
(body weight 60 kg) for one day. For parenteral
Is administration, while the dose varies depending on the
administration subject, target organ, condition,
administration method and the like, it is generally
conveniently, for example, about 0.01 to about 30 mg,
preferably about 0.1 to about 20 mg, more preferably about 0.1
2o to about 10 mg of a GPR40 agonist for diabetic patients (body
weight 60 kg) by intravenous injection. For other animals, a
dose converted to the amount per on the body weight 60 kg can
be administered. '
2s The present invention is explained in detail in the
following by referring to Reference Examples, Examples,
Formulation Examples and Experimental Examples, which are
mere embodiments and do not limit the present invention.
They may be modified within the range that does not deviate
3o from the scope of the present invention.
In the following Reference Examples and Examples, the
"room temperature" generally means about 10°C to about 35°C.
As to o, yield means mol/molg, the solvent used for
chromatography means o by volume, and others mean wts. Those
161
CA 02505322 2005-05-06
that cannot be confirmed by proton NMR spectrum, such as OH
and NH protons that are broad, are not described in the data.
Other abbreviations used in the specification mean the
following.
s . singlet
d . doublet
t . triplet
q . quartet
m . multiplet
1° br . broad
J . coupling constant
Hz . Hertz
CDC13 . deuterated chloroform
DMSO-d6: deuterated dimethyl sulfoxide
is 1H NMR : proton nuclear magnetic resonance
When bases or amino acids are expressed in abbreviations
in the present specification and drawings, the following
abbreviations in accordance with IUPAC-IUB Commission on
Biochemical Nomenclature or based on customary abbreviations
2o in this field are used. If amino acids can occur as optical
isomers, L-isomers are referred to unless otherwise specified.
DNA . deoxyribonucleic acid
cDNA . complementary deoxyribonucleic acid
A . adenine
25 T . thymine
G . guanine
C . cytosine
U . uracil
RNA . ribonucleic acid
so mRNA , messenger ribonucleic acid
dATP . deoxyadenosine triphosphate
dTTP . deoxythymidine triphosphate
dGTP . deoxyguanosine triphosphate
dCTP . deoxycytidine triphosphate
162
CA 02505322 2005-05-06
ATP . adenosine triphosphate
EDTA . ethylenediamine tetraacetic acid
SDS . sodium dodecyl sulfate
Gly . glycine
Ala . alanine
Val . valine
Leu . leucine
Ile . isoleucine
Ser , serine
1 Thr . threonine
Cys . cysteine
Met . methionine
Glu . glutamic acid
Asp . aspartic acid
isLys . lysin
Arg . arginine
His . histidine
Phe . phenylalanine
Tyr . tyrosine
2 Trp . tryptophan
Pro . proline
Asn . asparagine
Gln . glutamine
pGlu . pyroglutamic acid
z5* . corresponds to termination codon
Me . methyl group
Et . ethyl group
Bu . butyl group
Ph . phenyl group
3oTC . thiazolidine-4(R)-carboxamide group
The substituent
groups,
protecting
groups
and reagents
appearing frequently in the present specification are
expressed in the following symbols.
Tos . p-toluenesulfonyl
163
CA 02505322 2005-05-06
CHO . formyl
Bzl . benzyl
C12Bz1 . 2,6-dichlorobenzyl
Bom . benzyloxymethyl
Z . benzyloxycarbonyl
C1-Z . 2-chlorobenzyloxycarbonyl
Br-Z . 2-bromobenzyloxycarbonyl
Boc . t-butoxycarbonyl
DNP . dinitrophenol
1 Trt . trityl
Bum . t-butoxymethyl
FYnoc . N-9-fluorenylmethoxycarbonyl
HOBt . 1-hydroxybenzotriazole
HOOBt . 3,4-dihydro-3-hydroxy-4-oxo-
15 1,2,3-benzotriazine
HONB . 1-hydroxy-5-norbornene-2,3-dicarboxyimide
DCC . N,N'-dicyclohexylcarbodiimide
In the following Examples, mass spectrum (MS) was measured
under the following conditions.
2o MS measurement tools: ZMD (Waters Corporation), ZQ2000 (Waters
Corporation) or Platform II (Micromass Ltd.).
Ionization method: Electron Spray Ionization (ESI) or
Atmospheric Pressure Chemical Ionization (APCI). Unless
specifically indicated, ESI was used.
ZS In Examples, purification by preparative HPLC was
performed under the following conditions.
preparative HPLC tools: high through-put purification system
(Gilson, Inc.)
column: YMC Combiprep ODS-A S-5 ~,m, 20 X 50 mm
so solvent:
Solution A; 0.1~ trifluoroacetic acid-containing water,
Solution B; O.lg trifluoroacetic acid-containing
acetonitrile
gradient cycle A: 0.00 min (Solution A/Solution B= 90/10),
164
CA 02505322 2005-05-06
1.20 min (Solution A/Solution B= 90/10), 4.75 min (Solution
A/Solution B= 0/100), 7.30 min (Solution A/Solution B= 0/100),
7.40 min (Solution A/Solution B= 90/10), 7.50 min (Solution
A/Solution B= 90/10).
gradient cycle B: 0.00 min (Solution A/Solution B= 95/5), 1.00
min (Solution A/Solution B= 95/5), 5.20 min (Solution
A/Solution B= 5/95), 6.40 min (Solution A/Solution B= 5/95),
6.50 min (Solution A/Solution B= 95/5), 6.60 min (Solution
A/Solution B= 95/5).
io flow rate: 25 ml/min,
detection method: W 220 nm
The sequence numbers in the Sequence Listing in the
present specification show the following sequences.
I5 SEQ ID N0: 1
Shows the amino acid sequence of mouse GPR40.
SEQ ID N0: 2
Shows the nucleotide sequence of cDNA encoding mouse
GPR40.
2o SEQ ID N0: 3
Shows the amino acid sequence of rat GPR40.
SEQ ID N0: 4
Shows the nucleotide sequence of cDNA encoding rat GPR40.
25 SEQ ID N0: 5
Shows the amino acid sequence of human GPR40.
SEQ ID N0: 6
Shows the nucleotide sequence of cDNA encoding human
GPR40.
3o SEQ ID N0: 7
Shows the amino acid sequence of Macaca fascicularis
GPR40.
SEQ ID NO: 8
Shows the nucleotide sequence of cDNA encoding Macaca
165
CA 02505322 2005-05-06
fascicularis GPR40.
SEQ ID NO: 9
Shows the amino acid sequence of hamster GPR40.
SEQ ID N0: 10
s Shows the nucleotide sequence of cDNA encoding hamster
GPR40.
SEQ ID NO: 11
Shows the nucleotide sequence of a sense strand primer
used for PCR reaction in Reference Example 129 below.
Io SEQ ID N0: 12
Shows the nucleotide sequence of an antisense strand
primer used for PCR reaction in Reference Example 129 below.
SEQ ID N0: 13
Shows the nucleotide sequence of primer 1 used for PCR
z5 reaction in Reference Example 130 below.
SEQ ID NO: 14
Shows the nucleotide sequence of primer 2 used for PCR
reaction in Reference Example 130 below.
SEQ ID NO: 15
2o Shows the nucleotide sequence of primer 3 used for PCR
reaction in Reference Example 131 below.
SEQ ID NO: 16
Shows the nucleotide sequence of primer 4 used for PCR
reaction in Reference Example 131 below.
25 SEQ ID NO: 17
Shows the nucleotide sequence of primer 1 used for PCR
reaction in Reference Example 132 below.
SEQ ID N0: 18
Shows the nucleotide sequence of primer 2 used for PCR
3o reaction in Reference Example 132 below.
SEQ ID N0: 19
Shows the nucleotide sequence of primer 3 used for PCR
reaction in Reference Example 132 below.
SEQ ID NO: 20
166
CA 02505322 2005-05-06
Shows the nucleotide sequence of primer 4 used for PCR
reaction in Reference Example 132 below.
SEQ ID NO: 21
Shows the nucleotide sequence of primer 1 used for PCR
s reaction in Reference Example 133 below.
SEQ ID NO: 22
Shows the nucleotide sequence of primer 2 used for PCR
reaction in Reference Example 133 below.
so The transformant Escherichia coli TOP10/Zero Blunt-mGPR40
obtained in Reference Example 130 below has been deposited
under FERM BP-7967 at National Institute of Advanced
Industrial Science and Technology, International Patent
Organism Depository, Central 6, 1-1-1 Higashi, Tsukuba-shi,
ss Ibaraki 305-8566 Japan from March 18, 2002, and under IFO
16762 with Institution Fermentation Organization (IFO), 17-85,
Juso-honmachi 2-chome, Yodogawa-ku, Osaka 532-8686, Japan from
February 14, 2002.
The transformant Escherichia coli JM109/pCR2.l-rGPR40
20 obtained in Reference Example 131 below has been deposited
under FERM BP-7968 at National Institute of Advanced
Industrial Science and Technology International Patent
Organism Depositary, from March 18, 2002, and udder IFO 16763
with Institution Fermentation Organization (IFO) from February
25 14, 2002.
The transformant Escherichia coli JM109/pCR2.l-monkey
GPR40 obtained in Reference Example 132 below has been
deposited under FERM BP-8125 at National Institute of Advanced
Industrial Science and Technology International Patent
3o Organism Depositary from July 23, 2002.
The transformant Escherichia coli JM109/pTA hamster GPR40
obtained in Reference Example 133 below has been deposited
under FERM BP-8258 with National Institute of Advanced
Industrial Science and Technology International Patent
167
CA 02505322 2005-05-06
Organism Depositary from December 11, 2002, as transformant
Escherichia coli JM109/pTA hamster GPR40.
Reference Example 1 methyl 4-(phenylmethoxy)benzenepropanoate
To an ice-cooled solution of methyl 4-
hydroxybenzenepropanoate (0.70 g, 3.9 mmol), benzyl alcohol
(0.48 mL, 4.7 mmol) and triphenylphosphine (1.2 g, 4.7 mmol)
in tetrahydrofuran (5 mL) was added dropwise diethyl
azodicarboxylate (0.73 mL, 4.7 mmol), and the mixture was
stirred under ice-cooling for 2 hr. Water was added to the
so reaction mixture, and the mixture was extracted with ethyl
acetate. The extract was washed with water and concentrated
under reduced pressure. The residue was purified by silica
gel column chromatography (hexane/ethyl acetate=17:3) to give
the title compound (0.62 g, yield 59~) as a powder.
~5 1H NMR (CDC13) $ 2. 59 (2H, t, J=7.5 Hz) , 2. 89 (2H, t, J=7.5 Hz) ,
3. 66 (3H, s) , 5.04 (2H, s) , 6. 90 (2H, d, J=8. 6 Hz) , 7.11 (2H,
d, J=8.6 Hz), 7.29-7.44 (5H, m).
Reference Example 2 4-(phenylmethoxy)benzenepropanoic acid
To a suspension of methyl 4-
Z° (phenylmethoxy)benzenepropanoate (0.60 g, 2.2 mmol) in
methanol (20 mL) was added 2N aqueous sodium hydroxide
solution (2 mL), and the mixture was stirred at 60°C for 15 hrs.
2N Hydrochloric acid (3 mL) was added to the ~'eaction mixture,
and the mixture was extracted with ethyl acetate. The extract
2s was washed with water and concentrated under reduced pressure.
The residue was recrystallized from ethyl acetate-hexane to
give the title compound (0.38 g, yield 67~).
melting point: 123-124°C.
1H NMR (CDC13) g 2 . 65 (2H, t, J=7. 5 Hz) , 2. 90 (2H, t, J=7.5 Hz) ,
30 5 . 04 ( 2H, s ) , 6 . 91 ( 2H, d, J=8 . 6 Hz ) , 7 .11 ( 2H, d, J=8 . 6 Hz
) ,
7.28-7.44 (5H, m).
Reference Example 3 methyl 4-(2-phenylethoxy)benzenepropanoate
The title compound was obtained from methyl 4-
hydroxybenzenepropanoate and phenethyl alcohol by a method
168
CA 02505322 2005-05-06
similar to that of Reference Example 1. yield 89%, oil.
1H NMR (CDC13) g 2. 58 (2H, t, J=7.5 Hz) , 2. 88 (2H, t, J=7.5 Hz) ,
3.08 (2H, t, J=7 .1 Hz) , 4 .14 (2H, t, J=7 .1 Hz) , 6.81 (2H, d,
J=8.6 Hz), 7.09 (2H, d, J=8.6 Hz), 7.20-7.34 (5H, m).
Reference Example 4 4-(2-phenylethoxy)benzenepropanoic acid
To a solution of methyl 4-(2-
phenylethoxy)benzenepropanoate (0.65 g, 2.3 mmol) in methanol
(3 mL) was added 2N aqueous sodium hydroxide solution (3 mL),
and the mixture was stirred at 50°C for 1 hr. 2N Hydrochloric
to acid (2.5 mlJ) was added to the reaction mixture, and the
mixture was extracted with ethyl acetate. The extract was
washed with water and concentrated under reduced pressure.
The residue was recrystallized from ethyl acetate-hexane to
give the title compound (0.50 g, yield 81%).
is melting point: 91-92°C.
1H NMR (CDC13) g 2. 63 (2H, t, J=7 .5 Hz) , 2. 89 (2H, t, J=7.5 Hz) ,
3.08 (2H, t, J=7.2 Hz) , 4 .15 (2H, t, J=7.2 Hz) , 6.82 (2H, d,
J=8.6 Hz), 7.10 (2H, d, J=8.6 Hz), 7.20-7.34 (5H, m).
Reference Example 5 ethyl 4-(3-phenylpropoxy)benzenepropanoate
2o To an ice-cooled solution of ethyl 4-
hydroxybenzenepropanoate (0.40 g, 2.1 mmol) in N,N-
dimethylformamide (15 mL) was added 60% sodium hydride (0.11 g,
2.7 mmol), and the mixture was stirred for 30 min. 1-Bromo-3-
phenylpropane (0.53 g, 2.7 mmol) was added, and the mixture
25 was stirred at room temperature for 3 hrs. Water was added to
the reaction mixture, and the mixture was extracted with ethyl
acetate. The extract was washed with water, dried and
concentrated. The residue was purified by silica gel column
chromatography (hexane/ethyl acetate=18:1) to give the title
3o compound (0.29 g, yield 46%). oil.
1H NMR (CDC13) g 1.23 (3H, t, J=7.1 Hz) , 2. 04-2.13 (2H, m) ,
2 .58 (2H, t, J=8 .1 Hz) , 2.88 (2H, t, J=8 .1 Hz) , 3.94 (2H, t,
J=6.3 Hz) , 4.12 (2H, q, J=7 .1 Hz) , 6.81 (2H, d, J=8. 6 Hz) ,
7.10 (2H, d, J=8.6 Hz), 7.19-7.31 (5H, m).
169
CA 02505322 2005-05-06
Reference Example 6 4-(3-phenylpropoxy)benzenepropanoic acid
The title compound was obtained from ethyl 4-(3-
phenylpropoxy)benzenepropanoate by a method similar to that of
Reference Example 4. yield 45~.
melting point: 109-110~C (recrystallized from diethyl ether-
hexane ) .
1H NMR (CDC13) 82.05-2.13 (2H, m) , 2. 65 (2H, t, J=7.8 Hz) , 2. 80
( 2H, t, J=7 . 8 Hz ) , 2 . 90 ( 2H, t, J=7 . 9 Hz ) , 3 . 94 ( 2H, t, J=6 . 3
Hz) , 6. 82 (2H, d, J=8.5 Hz) , 7.11 (2H, d, J=8.5 Hz) , 7.16-7.31
to ( 5H, m) .
Reference Example 7 ethyl 4-(4-phenylbutoxy)benzenepropanoate
The title compound was obtained from ethyl 4-
hydroxybenzenepropanoate by a method similar to that of
Reference Example 5. yield 55~, oil.
is 1H NMR (CDC13) $ 1.23 (3H, t, J=7.1 Hz) , 1. 76-1.85 (4H, m) ,
2.57 (2H, t, J=7.4 Hz), 2.66-2.70 (2H, m), 2.88 (2H, t, J=8.1
Hz), 3.92-3.96 (2H, m), 4.12 (2H, q, J=7.1 Hz), 6.79-6.82 (m,
2H), 7.08-7.11 (m, 2H), 7.18-7.20 (m, 3H), 7.26-7.30 (m, 2H).
Reference Example 8 4-(4-phenylbutoxy)benzenepropanoic acid
Zo The title compound was obtained from ethyl 4-(4-
phenylbutoxy)benzenepropanoate by a method similar to that of
Reference Example 4. yield 61~.
melting point: 79.5-80.O~C (recrystallized from'diethyl ether-
hexane ) .
25 1H NMR (CDC13) g 1.70-1.90 (4H, m), 2.61-2.70 (4H, m), 2.89 (2H,
t, J=7. 9 Hz) , 3. 92-3.96 (2H, m) , 6.81 (2H, d, J=8. 6 Hz) , 7.06
(2H, d, J=8.6 Hz), 7.12-7.31 (m, 5H).
Reference Example 9 ethyl 4-((4-
phenoxybenzoyl)amino]benzenepropanoate
3o To a solution of ethyl 4-aminobenzenepropanoate (0.70 g,
3.6 mmol) in N,N-dimethylformamide (25 mL) were added 4-
phenoxybenzoic acid (0.85 g, 4.0 mmol), 1-ethyl-3-(3-
dimethylaminopropyl)carbodiimide hydrochloride (0.76 g, 4.0
mmol) and 1-hydroxybenzotriazole monohydrate (0.61 g, 4.0
170
CA 02505322 2005-05-06
mmol), and the mixture was stirred at room temperature for 16
hrs. Water was added to the reaction mixture, and the mixture
was extracted with ethyl acetate. The extract was washed with
water, dried and concentrated. The residue was purified by
silica gel column chromatography (hexane/ethyl acetate=2:1) to
give the title compound (0.96 g, yield 68%) as a white powder.
1H NMR (CDC13)g 1.24 (3H, t, J=7.1 Hz), 2.61 (2H, t, J=8.0 Hz),
2.94 (2H, t, J=7. 9 Hz) , 4.13 (2H, q, J=7.1 Hz) , 7.03-7. 08 (4H,
m), 7.16-7.21 (3H, m), 7.36-7.43 (2H, m), 7.54 (2H, t, J=8.5
to Hz) , 7.73 (1H, s) , 7. 84 (2H, d, J=8.7 Hz) .
Reference Example 10 4-[(4-
phenoxybenzoyl)amino]benzenepropanoic acid
The title compound was obtained from ethyl 4-[(4-
phenoxybenzoyl)amino]benzenepropanoate by a method similar to
that of Reference Example 4. yield 76%.
melting point: 214-215~C (recrystallized from tetrahydrofuran-
hexane).
1H NMR (DMSO-d6) g 2. 52 (2H, t, J=7. 6 Hz) , 2.79 (2H, t, J=7. 6
Hz), 7.07-7.12 (4H, m), 7.18-7.25 (3H, m), 7.45 (2H, t, J=7.4
2o Hz ) , 7 . 65 ( 2H, d, J=8 . 4 Hz ) , 7 . 98 ( 2H, d, J=8 . 7 Hz ) , 10 .11
( 1H,
s) .
Reference Example 11 ethyl 4-[3-[methyl(4-phenyl-2-
thiazolyl)amino]propoxy]benzenepropanoate
To an ice-cooled solution of N-methyl-4-phenyl-2-
thiazolamine (0.30 g, 1.7 mmol) in N,N-dimethylformamide (5
mL) was added 60% sodium hydride (72 mg, 1.8 mmol), and the
mixture was stirred for 30 min. Ethyl 4-[(3-
bromopropyl)oxy]benzenepropanoate (0.57 g, 1.8 mmol), was
added, and the mixture was stirred at room temperature for 3
3o hrs. Water was added to the reaction mixture, and the mixture
was extracted with ethyl acetate. The extract was washed with
water, dried and concentrated. The residue was purified by
silica gel column chromatography (hexane/ethyl acetate=15:1)
to give the title compound (0.58 g, yield 80%). oil.
i71
CA 02505322 2005-05-06
1H NMR (CDC13) g 1.25 (3H, t, J=7.1 Hz), 2.10-2.30 (2H, m),
2.58 (2H, t, J=6.8 Hz), 2.88 (2H, t, J=6.8 Hz), 3.14 (3H, s),
3.73 (2H, t, J=6.8 Hz) , 4.03 (2H, t, J=6.0 Hz) , 4 .12 (2H, q,
J=7.1 Hz), 6.70 (1H, d, J=3.8 Hz), 6.83 (2H, d, J=8.6 Hz),
7 .10 (2H, d, J=8 . 6 Hz) , 7. 20-7 .30 (1H, m) , 7 . 30-7.38 (2H, m) ,
7.82-7.85 (2H, m).
Reference Example 12 4-[3-[methyl(4-phenyl-2-
thiazolyl)amino]propoxy]benzenepropanoic acid
The title compound was obtained from ethyl 4-[3-
z° [methyl(4-phenyl-2-thiazolyl)amino]propoxy]benzenepropanoate
by a method similar to that of Reference Example 4. yield 13%.
melting point: 89-90°C (recrystallized from diethyl ether-
hexane) .
1H NMR (CDC13) g 2.14-2.23 (2H, m), 2.64 (2H, t, J=7.9 Hz), 2.90
Z5 (2H, t, J=7 . 9 Hz) , 3.14 (3H, s) , 3. 73 (2H, d, J=6. 8 Hz) , 4 . 03
(2H, t, J=6.0 Hz) , 6. 69 ( 1H, s) , 6. 84 (2H, d, J=8. 5 Hz) , 7.11
(2H, d, J=8.5 Hz), 7.23-7.33 (1H, m), 7.35 (2H, t, J=7.7 Hz),
7.82 (2H, d, J=7.2 Hz) .
Reference Example 13 1-[(4-bromo-2,6-difluorophenyl)oxy]-2,3-
2° dihydro-1H-indene
The title compound was obtained from 1-indanol and 4-
bromo-2,6-difluorophenol by a method similar to that of
Reference Example 1. yield 74~. '
melting point: 46-46°C (recrystallized from ethyl acetate).
2s 1H ~ (CDC13) g 2.34-2.40 (2H, m), 2.83-2.92 (1H, m), 3.20-
3 . 31 ( 1H, m) , 5 . 64 ( 1H, t, J=4 . 4 Hz ) , 7 . 04-7 .13 ( 2H, m) , 7 .17-
7 . 22 ( 1H, m) , 7 . 28-7 . 32 ( 3H, m) .
Reference Example 14 ethyl 4-[[4-[[methyl(4-phenyl-2-
thiazolyl)amino]methyl]benzoyl]amino]benzenepropanoate
3o The title compound was obtained as a white powder from
ethyl 3-(4-aminophenyl)propionate and 4-[[methyl(4-phenyl-2-
thiazolyl)amino]methyl]benzoic acid by a method similar to
that of Reference Example 9. yield 89~.
1H NMR (CDC13) g 1.24 (3H, t, J=7 .1 Hz) , 2. 61 (2H, t, J=7. 9 Hz) ,
172
CA 02505322 2005-05-06
2.94 (2H, t, J=7.9 Hz) , 3.10 (3H, s) , 4.12 (2H, q, J=7. 1 Hz) ,
4.86 (2H, s) , 6.75 (1H, s) , 7.20 (2H, d, J=8.4 Hz) , 7.26-7.30
(2H, m) , 7.38 (2H, t, J=7.8 Hz) , 7.46 (2H, d, J=8.2 Hz) , 7.54
(2H, d, J=8.4 Hz), 7.75 (1H, s), 7.82-7.87 (3H, m) .
Reference Example 15 4-[[4-[[methyl(4-phenyl-2-
thiazolyl)amino]methyl]benzoyl]amino]benzenepropanoic acid
The title compound was obtained from ethyl 4-[[4-
[[methyl(4-phenyl-2-
thiazolyl)amino]methyl]benzoyl]amino]benzenepropanoate by a
to method similar to that of Reference Example 4. yield 790.
melting point: 183-184°C (recrystallized from ethyl acetate-
hexane ) .
1H NMR (CDC13) g 2. 66 (2H, t, J=7.5 Hz) , 2. 94 (2H, t, J=7.5 Hz) ,
3.08 (3H, s) , 4.84 (2H, s) , 6.75 (1H, s) , 7.20 (2H, d, J=8.5
15 Hz) , 7.22-7.30 (1H, m) , 7.30-7.44 (4H, m) , 7.55 (2H, d, J=8. 4
Hz) , 7. 80-7.87 (5H, m) .
Reference Example 16 methyl (E)-3-[4-[(2,3-dihydro-1H-inden-1-
yl)oxy]-3,5-difluorophenyl]-2-propenoate
The title compound was obtained from 1-[(4-bromo-2,6-
2o difluorophenyl)oxy]-2,3-dihydro-1H-indene by a method similar
to that of Reference Example 34. yield 40~.
melting point: 74-75°C (recrystallized from ethyl acetate-
diisopropyl ether).
1H NMR (CDC13) g 2 . 37-2 . 43 (2H, m) , 2 . 84-2. 93 ( 1H, m) , 2 . 32-
25 3 . 32 ( 1H, m) , 3 . 81 ( 3H, s ) , 5 . 74 ( 1H, t, J=4 . 5 Hz ) , 6 . 34
( 1H,
d, J=16 Hz), 7.03-7.12 (2H, m), 7.16-7.23 (1H, m), 7.28-7.35
( 2H, m) , 7 . 53 ( 1H, d, J=16 Hz ) .
Reference Example 17 methyl 4-[(2,3-dihydro-1H-inden-1-
yl)oxy]benzeneacetate
3o The title compound was obtained from methyl 4-
hydroxybenzeneacetate and 2,3-dihydro-1H-inden-1-of by a
method similar to that of Reference Example 1. yield 69~, oil.
1H NMR (CDC13) g 2.10-2.30 (1H, m), 2.45-2.65 (1H, m), 2.52-
2 . 57 ( 1H, m) , 3 . 09-3 .19 ( 1H, m) , 3 . 59 ( 2H, s ) , 3 . 70 ( 3H, s )
,
173
CA 02505322 2005-05-06
5.75 (1H, dd, J=6.6 Hz, 4.4 Hz), 6.95-6.98 (2H, m), 7.21-7.32
(5H, m) , 7.43 (1H, d, J=7.2 Hz) .
Reference Example 18 methyl 4-[(4-
nitrophenyl)methoxy]benzenepropanoate
The title compound was obtained as a yellow powder from
methyl 4-hydroxybenzenepropanoate and 4-nitrobenzylbromide by
a method similar to that of Reference Example 5. yield 410.
1H IVMR (CDC13) g 2. 60 (2H, t, J=8.0 Hz) , 2. 90 (2H, t, J=8.0 Hz) ,
3. 66 (3H, s) , 5.15 (2H, s) , 6.88 (2H, d, J=8. 6 Hz) , 7.13 (2H,
1o d~ J=8. 6 Hz) , 7. 60 (2H, d, J=8.7 Hz) , 8.23-8.28 (2H, m) .
Reference Example 19 4-[(4-
nitrophenyl)methoxy)benzenepropanoic acid
The title compound was obtained from methyl 4-[(4-
nitrophenyl)methoxy]benzenepropanoate by a method similar to
i5 that of Reference Example 4. yield 26~.
melting point: 179-181°C (recrystallized from ethyl acetate-
hexane ) .
1H NMR (CDC13) g 2. 65 (2H, t, J=7 .7 Hz) , 2.91 (2H, t, J=7.7 Hz) ,
.15 ( 2H, s ) , 6 . 89 ( 2H, d, J=8 . 5 Hz ) , 7 .15 ( 2H, d, J=8 . 5 Hz ) ,
20 7 , 60 (2H, d, J=8.5 Hz) , 8.24 (2H, d, J=8. 6 Hz) .
Reference Example 20 4-[(2,3-dihydro-1H-inden-1-
yl)oxy]benzeneacetic acid
The title compound was obtained from methyl 4-[(2,3-
dihydro-1H-inden-1-yl)oxy]benzeneacetate by a method similar
25 to that of Reference Example 4. yield 52~.
melting point: 121.0-121.5°C (recrystallized from ethyl
acetate-hexane).
1H NMR (CDC13) $ 2.10-2.26 (1H, m) , 2 .45-2. 60 (1H, m) , 2.80-
2 . 97 ( 1H, m) , 3 . 09-3 .14 ( 1H, m) , 3 . 61 (2H, s ) , 5. 74 ( 1H, dd,
3o J=6 . 7 Hz, 4 . 4 Hz ) , 6 . 97 ( 2H, d, J=8 . 6 Hz ) , 6 . 99-7 . 34 ( 5H,
m) ,
7.42 (1H, d, J=7.2 Hz) .
Reference Example 21 4-(4-phenoxyphenoxy)benzaldehyde
To a solution of 4-phenoxyphenol (1.0 g, 5.4 mmol) in
N,N-dimethylformamide (20 mL) were added 4-fluorobenzaldehyde
174
CA 02505322 2005-05-06
(0.67 g, 5.4 mmol) and potassium carbonate (0.75 g, 5.4 mmol),
and the mixture was stirred at 100°C for 15 hrs. Water was
added to the reaction mixture, and the mixture was extracted
with ethyl acetate. The extract was washed with water, dried
and concentrated. The residue was purified by silica gel
column chromatography (hexane/ethyl acetate=9:1) to give the
title compound (1.4 g, yield 89$).
1H NMR (CDC13) g 7.02-7.12 (9H, m) , 7.36 (2H, dd, J=7.5 Hz, 8.5
Hz) , 7. 85 (2H, d, J=8. 7 Hz) , 9.92 (1H, s) .
so g~erence Example 22 4-([l,1'-biphenyl]-4-yloxy)benzaldehyde
The title compound was obtained from 4-hydroxybiphenyl
and 4-fluorobenzaldehyde by a method similar to that of
Reference Example 21. yield 37~.
1H NMR (CDC13) g 7.10-7.19 (4H, m), 7.35-7.49 (3H, m), 7.58-
7,66 (4H, m), 7.87 (2H, d, J=8.7 Hz), 9.94 (1H, s).
Reference Example 23 4-[4-(phenylmethoxy)phenoxy]benzaldehyde
The title compound was obtained from 4-benzyloxyphenol
and 4-fluorobenzaldehyde by a method similar to that of
Reference Example 21. yield 57~.
2~ 1H NMR (CDC13) g 5.08 (2H, s) , 7.00-7.03 (6H, m) , 7.34-7.46 (5H,
m) , 7. 83 (2H, d, J=8.7 Hz) , 9. 91 (1H, s) .
Reference Example 24 4-(4-phenoxyphenoxy)benzyl alcohol
The title compound was obtained from 4-(4-'
phenoxyphenoxy)benzaldehyde by a method similar to that of
2s Reference Example 32. yield 82~.
1H NMR (CDC13) g 1.64 (1H, s), 4.66 (2H, s), 6.98-7.01 (8H, m),
7.09 (1H, t, J=7.3 Hz), 7.31-'7.36 (4H, m).
Reference Example 25 4-((1,1'-biphenyl]-4-yloxy)benzyl alcohol
The title compound was obtained from 4-((1,1'-biphenyl]-
30 4-yloxy)benzaldehyde by a method similar to that of Reference
Example 32. yield 660.
1H NMR (CDC13) g 1.64 (1H, s), 4.69 (2H, s), 7.03-7.08 (4H, m),
7.35-7.48 (5H, m), 7.54-7.58 (4H, m).
Reference Example 26 4-[[methyl(4-phenyl-2-
175
CA 02505322 2005-05-06
thiazolyl)amino]methyl]benzaldehyde
To a solution of 4-[[methyl(4-phenyl-2-
thiazolyl)amino]methyl]benzenemethanol (1.0 g, 3.2 mmol) in
ethyl acetate (40 mL) was added manganese dioxide (4.0 g), and
the mixture was stirred at room temperature for 3 hrs.
Insoluble material was filtered off, and the filtrate was
concentrated. The residue was purified by silica gel column
chromatography (hexane/ethyl acetate=5:1) to give the title
compound (0.80 g, yield 81~). oil.
1H NMR (CDC13) g 3.10 (3H, s) , 4.88 (2H, s) , 6.75 (1H, s) ,
7.25-7.30 (1H, m) , 7.35-7.40 (2H, m) , 7.51 (2H, d, J=8.0 Hz) ,
7 . 83-7 . 88 ( 4H, m) , 10 . 00 ( 1H, s ) .
Reference Example 27 ethyl (E)-3-[4-[[methyl(4-phenyl-2-
thiazolyl)amino]methyl]phenyl]propenoate
To an ice-cooled solution of ethyl
diethylphosphonoacetate (0.81 g, 3.6 mmol) in tetrahydrofuran
(10 mL) was added 60o sodium hydride (0.14 g, 3.4 mmol), and
the mixture was stirred for 30 min. A solution of 4-
[[methyl(4-phenyl-2-thiazolyl)amino]methyl]benzaldehyde (0.80
2o g~ 2_6 mmol) in tetrahydrofuran (10 mL) was added dropwise.
The mixture was stirred at room temperature for 3 hrs, water
was added, and the mixture was extracted with ethyl acetate.
The extract was dried and concentrated. The residue was
purified by silica gel column chromatography (hexane/ethyl
acetate=18:1) to give the title compound (0.96 g, yield 98~)
as a powder.
1H NMR (CDC13) g 1.33 (3H, t, J=7 .1 Hz) , 3. 08 (3H, s) , 4.26 (2H,
q, J=7.1 Hz), 4.80 (2H, s), 6.42 (1H, d, J=16.0 Hz), 6.74 (1H,
s), 7.25-7.39 (5H, m), 7.50 (2H, d, J=8.2 Hz), 7.67 (1H, d,
3o J=16 . 0 Hz ) , 7 . 8 6 ( 2H, d, J=7 . 2 Hz ) .
Reference Example 28 ethyl 4-[[methyl(4-phenyl-2-
thiazolyl)amino)methyl]benzenepropanoate
To a solution of ethyl (E)-3-[4-[[methyl(4-phenyl-2-
thiazolyl)amino]methyl)phenyl]propenoate (0.60 g, 1.6 mmol)
176
CA 02505322 2005-05-06
and nickel chloride hexahydrate (0.41 g, 3.2 mmol) in ethanol
(25 mL) was added sodium borohydride (0.30 g, 8.0 mmol), and
the mixture was stirred at room temperature for 2 hrs. Water
was added to the reaction mixture, and the mixture was
extracted with ethyl acetate. The extract was washed with
water, dried and concentrated. The residue was purified by
silica gel column chromatography (hexane/ethyl acetate=18:1)
to give the title compound (0.39 g, yield 640). oil.
1H NMR (CDC13) g 1.23 (3H, t, J=7 .1 Hz) , 2. 60 (2H, t, J=8.0 Hz) ,
2. g4 (2H, t, J=8.0 Hz), 3.06 (3H, s), 4.12 (2H, q, J=7.1 Hz),
4.73 (2H, s) , 6.72 (1H, s) , 7.17 (2H, d, J=8.0 Hz) , 7.25-7.30
(3H, m), 7.35-7.40 (2H, m), 7.85-7.88 (2H, m).
Reference Example 29 4-[[methyl(4-phenyl-2-
thiazolyl)amino]methyl]benzenepropanoic acid
i5 The title compound was obtained from ethyl 4-[[methyl(4-
phenyl-2-thiazolyl)amino]methyl]benzenepropanoate by a method
similar to that of Reference Example 4. yield 64~.
melting point: 109-110~C (recrystallized from ethyl acetate-
hexane).
1H NMR ( CDC13 ) $ 2 . 66 ( 2H, t, J=7 . 9 Hz ) , 2 . 94 ( 2H, t, J=7 . 9 Hz )
,
3.06 (3H, s) , 4. 73 (2H, s) , 6.71 (1H, s) , 7.17 (2H, d, J=8.0
Hz) , 7.25-7.34 (3H, m) , 7.37 (2H, t, J=7.8 Hz) , 7.86 (2H, d,
J=7.2 Hz).
Reference Example 30 4-[4-(phenylmethoxy)phenoxy]benzyl
alcohol
The title compound was obtained from 4-[4-
(phenylmethoxy)phenoxy]benzaldehyde by a method similar to
that of Reference Example 32. yield 88~.
1H NMR (CDC13) g 1.60(1H, s), 4.65 (2H, s), 5.05 (2H, s), 6.92-
6,96 (6H, m), 7.29-7.45 (7H, m).
Reference Example 31 2,3-dihydro-5-(phenylmethoxy)-1H-inden-1-
one
To a solution of 5-hydroxyindanone (1.0 g, 6.2 mmol),
benzyl alcohol (0.65 g, 5.6 mmol) and tributylphosphine (1.7 g,
177
CA 02505322 2005-05-06
8.4 mmol) in tetrahydrofuran (30 mL) was added 1, 1'-
(azodicarbonyl)dipiperidine (2.1 g, 8.4 mmol), and the mixture
was stirred at room temperature for 16 hrs. Insoluble
material was filtered off, and the filtrate was concentrated.
The residue was purified by silica gel column chromatography
(hexane/ethyl acetate=10:1) to give the title compound (1.3 g,
yield 97%) as a powder.
1H NMR (CDC13) g 2. 67 (2H, t, J=6.1 Hz) , 3.48 (2H, t, J=6.1 Hz) ,
5.15 (2H, s), 6.97 (2H, s), 7.30-7.45 (5H, m), 7.70 (1H, d,
io J=9.1 Hz) .
Reference Example 32 2,3-dihydro-5-(phenylmethoxy)-1H-inden-1-
ol
2,3-Dihydro-5-(phenylmethoxy)-1H-inden-1-one (1.3 g, 5.46
mmol) was dissolved in a mixture of tetrahydrofuran (20 mL)
zs and methanol (10 mL), sodium borohydride (0.41 g, 11 mmol) was
added, and the mixture was stirred at room temperature for 2
hrs. Water was added to the reaction mixture, and the mixture
was extracted with ethyl acetate. The extract was dried and
concentrated under reduced pressure. The residue was purified
2o by silica gel column chromatography (hexane/ethyl acetate=3:1)
to give the title compound (1.16 g, yield 89%) as a white
powder.
1H NMR (CDC13) g 1.70 (1H, d, J=5.0 Hz), 1.85-2.b5 (1H, m),
2.40-2.55 (1H, m), 2.70-2.85 (1H, m), 2.95-3.10 (1H, m), 5.05
z5 (2H, s), 5.10-5.20 (1H, m), 6.85-6.87 (1H, m), 7.25-7.45 (6H,
m) .
Reference Example 33 2-(4-bromophenoxy)-2,3-dihydro-1H-indene
The title compound was obtained from 2-indanol and 4-
bromophenol by a method similar to that of Reference Example 1.
3o yield 59%.
melting point: 83-84°C (recrystallized from ethyl
acetate-diisopropyl ether).
1H NMR (CDC13) g 3.13 (1H, d, J=3.0 Hz), 3.18 (1H, d, J=3.0 Hz),
3.33 (1H, d, J=6.2 Hz), 3.39 (1H, d, J=6.2 Hz), 5.09-5.15 (1H,
178
CA 02505322 2005-05-06
m) , 6.78 (2H, d, J=9.0 Hz) , 7.16-7.26 (4H, m) , 7. 37 (2H, d,
J=9.0 Hz).
Reference Example 34 methyl (E)-3-[4-[(2,3-dihydro-1H-inden-2-
yl)oxy]phenyl]-2-propenoate
To a solution of 2-(4-bromophenoxy)-2,3-dihydro-1H-indene
(1.4 g, 4.7 mmol) in N,N-dimethylformamide (4.7 mL) were added
sodium hydrogencarbonate (1.0 g, 12 mmol), methyl acrylate
(0.86 mL, 9.5 mmol), tetrabutylammonium chloride (2.0 g, 7.1
mmol) and palladium acetate (31 mg, 0.14 mmol), and the
to mixture was stirred at 100°C for 24 hrs. The reaction mixture
was allowed to return to room temperature and filtered. Water
was added, and the mixture was extracted with ethyl acetate.
The extract was washed with saturated brine, and dried over
anhydrous magnesium sulfate and concentrated. The residue was
15 recrystallized from ethyl acetate-hexane to give the title
compound (0.96 g, yield 690).
melting point: 115-116°C.
1H NMR (CDC13) g 3.16 (1H, d, J=2.9 Hz), 3.21 (1H, d, J=2.9 Hz),
3.37 (1H, d, J=6.4 Hz), 3.43 (1H, d, J=6.4 Hz), 3.80 (3H, s),
20 5 .17-5 . 23 ( 1H, m) , 6 . 31 ( 1H, d, J=16 Hz ) , 6 . 91 ( 2H, d, J=9 . 0
Hz ) , 7 .17-7 . 27 ( 4H, m) , 7 . 47 (2H, d, J=9 . 0 Hz ) , 7 . 65 ( 1H, d,
J=16 Hz).
Reference Example 35 ethyl (4-methoxyphenoxy)acetate
To a solution of 4-methoxyphenol (5.0 g, 40 mmol) in N,N-
2s dimethylformamide (50 mL) was added 60~ sodium hydride (1.6 g,
40 mmol) under ice-cooling, and the mixture was stirred for 30
min. Ethyl bromoacetate (7.4 g, 44 mmol) was added thererto,
and the mixture was stirred at room temperature for 1 hr.
Water was added to the reaction mixture, and the mixture was
so extracted with ethyl acetate. The extract was washed with
water and concentrated under reduced pressure. The residue
was purified by silica gel column chromatography (hexane/ethyl
acetate=7:1) to give the title compound (8.0 g, yield 940).
oil.
179
CA 02505322 2005-05-06
1H NMR (CDC13) g 1.30 (3H, t, J=7.1 Hz) , 3.77 (3H, s) , 4.26 (2H,
q, J=7 .1 Hz ) , 4 . 57 ( 2H, s ) , 6 . 81- 6 . 8 9 ( 4H, m) .
Reference Example 36 ethyl (4-hydroxyphenoxy)acetate
A solution of ethyl (4-methoxyphenoxy) acetate (2. 0 g, 9.5
mmol), ethanethiol (2.8 mL, 38 mmol) and aluminum chloride
(5.1 g, 38 mmol) in dichloromethane (20 mL) was stirred under
ice-cooling for 40 min.. The reaction mixture was poured into
a mixture of chloroform and saturated aqueous sodium
hydrogencarbonate, and filtered through celite. The organic
to layer was separated, washed with saturated brine, dried over
anhydrous magnesium sulfate, and concentrated under reduced
pressure. The residue was recrystallized from ethyl acetate-
diisopropyl ether to give the title compound (1.4 g, yield
75%).
is melting point: 123-124°C.
1H NMR (CDC13) g 1.30 (3H, t, J=7.1 Hz) , 4.26 (2H, q, J=7.1 Hz) ,
4 . 56 (2H, s ) , 6. 73-6. 84 ( 4H, m) .
Reference Example 37 ethyl [4-(4-phenylbutoxy)phenoxy]acetate
A solution of ethyl (4-hydroxyphenoxy)acetate (0.49 g,
20 2.5 mmol), 4-phenylbutyl bromide (0.59 g, 2.8 mmol), potassium
carbonate ( 0 . 69 g, 5 . 0 mmol ) and potassium iodide ( 30 mg, 0 . 50
mmol) in N,N-dimethylformamide (5 mL) was stirred at room
temperature for 30 min., and further at 50°C for 3 hrs. The
solvent was evaporated under reduced pressure, and the residue
25 was partitioned between ethyl acetate and saturated brine.
The organic layer was concentrated under reduced pressure.
The residue was purified by silica gel column chromatography
(hexane/ethyl acetate=4:1) to give the title compound (0.62 g,
yield 76$). oil.
30 1H I~ZR (CDC13) g 1. 30 ( 3H, t, J=7 . 1 Hz) , 1. 78-1 . 83 ( 4H, m) ,
2.66-2.71 (2H, m), 3.90-3.94 (2H, m), 4.26 (2H, q, J=7.1 Hz),
4.56 (2H, s), 6.79-6.87 (4H, m), 7.18-7.21 (3H, m), 7.27-7.31
( 2H, m) .
Reference Example 38 [4-(4-phenylbutoxy)phenoxy]acetic acid
180
CA 02505322 2005-05-06
A mixture of ethyl [4-(4-phenylbutoxy)phenoxy]acetate
(0.59 g, 1.8 mmol), lithium hydroxide monohydrate (0.15 g, 3.6
mmol), tetrahydrofuran (5 mL), methanol (1 mL) and water (3
mL) was stirred at room temperature for 48 hrs. The mixture
was acidified with 1N hydrochloric acid, and extracted with
ethyl acetate. The extract was washed with saturated brine,
and dried over anhydrous magnesium sulfate. The solvent was
evaporated under reduced pressure. The residue was
recrystallized from ethyl acetate to give the title compound
( 0. 48 g, yield 89~ ) .
melting point: 116-117°C.
1H NMR (CDC13) g 1.78-1.82 (4H, m), 2.66-2.71 (2H, m), 3.90-3.94
(2H, m), 4.62 (2H, s), 6.81-6.88 (4H, m), 7.16-7.21 (3H, m),
7.27-7.31 (2H, m) .
15 Reference Example 39 ethyl [(4-methoxyphenyl)thio]acetate
To an ice-cooled mixture of 4-methoxythiophenol (15 g,
0.11 mol), triethylamine (28 mL, 0.20 mol) and tetrahydrofuran
(150 mL) was added ethyl bromoacetate (21 g, 0.13 mol), and
the mixture was stirred overnight at room temperature.
2o Ethanol (10 mL) was added, the solvent was evaporated under
reduced pressure, and the residue was partitioned between
ethyl acetate and water. The organic layer was concentrated
under reduced pressure. The residue was purified by silica
gel column chromatography (hexane/ethyl acetate=10:1) to give
25 title compound (22 g, yield 92 0 ) . oil .
1H NMR (CDC13) $ 1.22 (3H, t, J=7.1 Hz) , 3.51 (2H, s) , 3.79 (3H,
s) , 4.14 (2H, q, J=7.1 Hz) , 6. 83 (2H, d, J=8.8 Hz) , 7.42 (2H,
d, J=8.8 Hz).
Reference Example 40 ethyl [(4-hydroxyphenyl)thio]acetate
3o The title compound was obtained from ethyl [(4-
methoxyphenyl)thio]acetate by a method similar to that of
Reference Example 36. yield 91~, oil.
1H NMR ( CDC13 ) g 1. 22 ( 3H, t, J=7 .1 Hz ) , 3 . 51 ( 2H, s ) , 4 .14 ( 2H,
q, J=7 . 1 Hz ) , 6 . 7 6 ( 2H, d, J=8 . 8 Hz ) , 7 . 37 ( 2H, d, J=8 . 8 Hz )
.
181
CA 02505322 2005-05-06
Reference Example 41 ethyl [[4-(4-
phenylbutoxy)phenyl]thio]acetate
The title compound was obtained from ethyl [(4-
hydroxyphenyl)thio]acetate by a method similar to that of
Reference Example 37. yield 88$, oil.
1H NMR (CDC13) g 1.22 (3H, t, J=7.1 Hz) , 1.76-1 . 84 (4H, m) ,
2 . 66-2 . 71 ( 2H, m) , 3 . 50 ( 2H, s ) , 3 . 93-3 . 97 ( 2H, m) , 4 .13 (
2H,
q, J=7.1 Hz), 6.82 (2H, d, J=8.8 Hz), 7.18-7.21 (3H, m), 7.26-
7.29 (2H, m), 7.39 (2H, d, J=8.8 Hz).
io Reference Example 42 [[4-(4-phenylbutoxy)phenyl]thio]acetic
acid
The title compound was obtained from ethyl [[4-(4-
phenylbutoxy)phenyl]thin]acetate by a method similar to that
of Reference Example 38. yield 750.
is melting point: 73.5-74.5°C (recrystallized from ethyl acetate).
1H NMR (CDC13) g 1.76-1. 82 (4H, m) , 2. 66-2. 71 (2H, m) , 3.55 (2H,
s ) , 3 . 93-3 . 97 ( 2H, m) , 6 . 83 ( 2H, d, J=8 . 8 Hz ) , 7 .16-7 . 21 (
3H,
m) , 7.26-7.31 (2H, m) , 7.43 (2H, d, J=8. 8 Hz) .
Reference Example 43 methyl 4-[(2,3-dihydro-1H-inden-2-
2o yl)oxy]benzenepropanoate
A mixture of methyl (E)-3-[4-[(2,3-dihydro-1H-inden-2-
yl)oxy]phenyl]-2-propenoate (0.76 g, 2.6 mmol),
tetrahydrofuran (10 mL), methanol (5 mL) and 10~ palladium
carbon (50~ water-containing product, 0.10 g) was stirred
2s overnight at room temperature under a hydrogen atmosphere.
The reaction mixture was filtered and concentrated. Water was
added, and the mixture was extracted with ethyl acetate. The
extract was washed with water, dried over anhydrous magnesium
sulfate and concentrated. The residue was recrystallized from
3o ethyl acetate-methanol to give the title compound (0.85 g,
yield 89~).
melting point: 73-74°C.
1H NMR (CDC13) g 2. 60 (2H, t, J=7.9 Hz) , 2. 90 (2H, t, J=7.9 Hz) ,
3.13 (1H, d, J=3.2 Hz) , 3.19 (1H, d, J=3.2 Hz) , 3.33 (1H, d,
182
CA 02505322 2005-05-06
J=6.3 Hz), 3.38 (1H, d, J=6.3 Hz), 5.11-5.17 (1H, m), 6.84 (2H,
d, J=8 . 6 Hz ) , 7 .12 ( 2H, d, J=6 . 6 Hz ) , 7 .17-7 . 2 5 ( 4H, m) .
Reference Example 44 4-[(2,3-dihydro-1H-inden-2-
yl)oxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[(2,3-
dihydro-1H-inden-2-yl)oxy]benzenepropanoate by a method
similar to that of Reference Example 38. yield 90%.
melting point: 138-139°C (recrystallized from ethyl
acetate-diisopropyl ether).
1H NMR (CDC13) g2. 66 (2H, t, J=7.9 Hz) , 2.91 (2H, t, J=7. 9 Hz) ,
3 .13 ( 1H, d, J=3 . 2 Hz ) , 3 .19 ( 1H, d, J=3 . 2 Hz ) , 3 . 33 ( 1H, d,
J=6.3 Hz) , 3.38 (1H, d, J=6.3 Hz) , 5.11-5.17 (1H, m) , 6.84 (2H,
d, J=8 . 6 Hz ) , 7 .12 ( 2H, d, J=6 . 6 Hz ) , 7 .16-7 . 2 5 ( 4H, m) .
Reference Example 45 methyl 4-[(4-
aminophenyl)methoxy]benzenepropanate
To a solution of methyl 4-[(4-
nitrophenyl)methoxy]benzenepropanoate (0.55 g, 1.67 mmol) and
bismuth (III) chloride (0.79 g, 2.5 mmol) in methanol (30 mL)
was added sodium borohydride (0.51 g, 13 mmol), and the
2° mixture was stirred at room temperature for 2 hrs. Insoluble
material was filtered off, and the filtrate was concentrated.
Water was added to the residue, and the mixture was extracted
with ethyl acetate. The extract was washed with saturated
aqueous sodium hydrogencarbonate, dried and concentrated. The
2s residue was purified by silica gel column chromatography
(hexane/ethyl acetate=5:1) to give the title compound (0.13 g,
yield 250) as a powder.
1H NMR (CDC13) g 2. 59 (2H, t, J=8.0 Hz) , 2. 89 (2H, t, J=8.0 Hz) ,
3.66 (5H, br s), 4.90 (2H, s), 6.69 (2H, d, J=8.6 Hz), 6.89
30 ( 2H, d, J=8 . 6 Hz ) , 7 .10 ( 2H, d, J=8 . 3 Hz ) , 7 . 21 ( 2H, d, J=8 .
3
Hz) .
Reference Example 46 methyl 4-(naphthalen-2-
ylmethoxy)benzenepropanoate
The title compound was obtained from methyl 4-
183
CA 02505322 2005-05-06
hydroxybenzenepropanoate and naphthalene-2-methanol by a
method similar to that of Reference Example 1. yield 83%.
melting point: 111-112°C (recrystallized from ethyl
acetate-diisopropyl ether).
1H NMR (CDC13) g 2. 60 (2H, t, J=7.4 Hz) , 2. 90 (2H, t, J=7.4 Hz) ,
3 . 8 6 ( 3H, s ) , 5 . 21 ( 2H, s ) , 6 . 94 ( 2H, d, J=8 . 6 Hz ) , 7 .12 (
2H,
d, J=8.6 Hz), 7.47-7.55 (3H, m), 7.82-7.88 (4H, m).
Reference Example 47 4-(naphthalen-2-
ylmethoxy)benzenepropanoic acid
io The title compound was obtained from methyl 4-
(naphthalen-2-ylmethoxy)benzenepropanoate by a method similar
to that of Reference Example 38. yield 96%.
melting point: 173-174°C (recrystallized from ethyl
acetate-diisopropyl ether).
is 1H NMR (CDC13) g 2. 65 (2H, t, J=7.4 Hz) , 2. 91 (2H, t, J=7.4 Hz) ,
5.21 (2H, s), 6.94 (2H, d, J=8.6 Hz), 7.13 (2H, d, J=8.6 Hz),
7.47-7.55 (3H, m), 7.82-7.88 (4H, m) .
Reference Example 48 methyl 4-(naphthalen-1-
ylmethoxy)benzenepropanoate
2° The title compound was obtained from methyl 4-
hydroxybenzenepropanoate and naphthalene-1-methanol by a
method similar to that of Reference Example 1. yield 84%, oil.
1H NMR (CDC13) g 2. 62 (2H, t, J=7.4 Hz) , 2. 92 (2'~i, t, J=7.4 Hz) ,
3.68 (3H, s) , 5.47 (2H, s) , 6.98 (2H, d, J=8. 6 Hz) , 6.99 (2H,
2s d, J=8.6 Hz), 7.44-7.60 (4H, m), 7.84-7.91 (2H, m), 8.03-8.06
( 1H, m) .
Reference Example 49 4-(naphthalen-1-
ylmethoxy)benzenepropanoic acid
The title compound was obtained from methyl 4-
30 (naphthalen-1-ylmethoxy)benzenepropanoate by a method similar
to that of Reference Example 38. yield 81%.
melting point: 105-106°C (recrystallized from ethyl
acetate-diisopropyl ether).
1H NMR (CDC13) g 2. 65 (2H, t, J=7.4 Hz) , 2. 91 (2H, t, J=7.4 Hz) ,
184
CA 02505322 2005-05-06
. 4 4 ( 2H, s ) , 6 . 97 ( 2H, d, J=8 . 6 Hz ) , 7 .13 ( 2H, d, J=8 . 6 Hz ) ,
7 . 42-7 . 58 ( 4H, m) , 7 . 82-7 . 90 (2H, m) , 8 . O1-8 . 05 ( 1H, m) .
Reference Example 50 1H-indole-2-methanol
To a mixture of indole-2-carboxylic acid (2.0 g, 12 mmol),
N,N-dimethylformamide (10 mL), tetrahydrofuran (20mL) and N-
hydroxysuccinimide (1.5 g, 13 mmol) was added 1-ethyl-3-(3-
dimethylaminopropyl)carbodiimide hydrochloride (2.9 g, 15
mmol), and the mixture was stirred overnight at room
temperature. 0.5 M Aqueous citric acid solution was added,
to and the mixture was extracted with ethyl acetate. The extract
was dried over anhydrous magnesium sulfate and concentrated.
Tetrahydrofuran (20 mL) and sodium tetrahydroborate (1.9 g, 50
mmol) were added to the residue under ice-cooling, and the
mixture was stirred at room temperature for 6 hrs. 0.5 M
Aq,~eous citric acid solution was added, and the mixture was
extracted with ethyl acetate. The extract was dried over
anhydrous magnesium sulfate and concentrated. The residue was
purified by silica gel column chromatography (hexane/ethyl
acetate=5:1) to give the title compound. yield 56o.
2o melting point: 73.5-74.4°C (recrystallized from ethyl
acetate-diisopropyl ether).
1H NMR (CDC13) g 1.79 (1H, br s), 4.83 (2H, s), 6.41 (1H, s),
7.07-7.13 (1H, m), 7.16-7.21 (1H, m), 7.34 (1H,°d, J=8.3 Hz),
7.58 (1H, d, J=7.9 Hz) , 8.33 (1H, br s) .
Reference Example 51 methyl 4-[(3-
bromophenyl)methoxy]benzenepropanoate
The title compound was obtained as a white powder from
methyl 4-hydroxybenzenepropanoate and 3-bromobenzyl alcohol by
a method similar to that of Reference Example 1. yield 68$.
1H NMR (CDC13) g 2. 60 (2H, t, J=8. 0 Hz) , 2. 90 (2H, t, J=8. 0 Hz) ,
3. 66 (3H, s) , 5. 00 (2H, s) , 6.88 (2H, d, J=8. 6 Hz) , 7.12 (2H,
d, J=8.6 Hz), 7.21-7.27 (1H, m), 7.34 (1H, d, J=7.5 Hz), 7.45
(1H, d, J=7.8 Hz), 7.59 (1H, s).
Reference Example 52 4-[(3-
185
CA 02505322 2005-05-06
bromophenyl)methoxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[(3-
bromophenyl)methoxy]benzenepropanoate by a method similar to
that of Reference Example 4. yield 430.
melting point: 97-98°C (recrystallized from diisopropyl ether-
hexane) .
1H NMR (CDC13) g 2. 65 (2H, t, J=7. 8 Hz) , 2. 91 (2H, t, J=7.8 Hz) ,
5.01 (2H, s) , 6.89 (2H, d, J=8. 5 Hz) , 7.13 (2H, d, J=8.5 Hz) ,
7 . 22-7 . 27 ( 1H, m) , 7 . 34 ( 1H, d, J=7 . 6 Hz ) , 7 . 45 ( 1H, d, J=7 .
8
1o Hz) , 7.59 (1H, s) .
Reference Example 53 methyl 4-[(2,3-dihydrobenzofuran-3-
yl)oxy]benzenepropanoate
To a solution of 3-coumaranone (0.50 g, 3.7 mmol) in
ethanol (20 mL) was added sodium tetrahydroborate (0.28 g, 7.5
15 mmol), and the mixture was stirred at room temperature for 1
hr. 0.5N Hydrochloric acid (10 mL) was added and the mixture
was stirred at room temperature for 10 min. Saturated brine
was added, and the mixture was extracted with ethyl acetate.
The extract was dried over anhydrous magnesium sulfate and
2o concentrated. Tetrahydrofuran (10 mL), methyl 4-
hydroxybenzenepropanoate (0.46 g, 2.6 mmol),
triphenylphosphine (0.98 g, 3.8 mmol) and diethyl
azodicarboxylate (0.91 mL, 4.7 mmol) were added" to the residue,
and the mixture was stirred at room temperature for 2 hrs.
2s Water was added to the reaction mixture, and the mixture was
extracted with ethyl acetate. The extract was washed with
water and concentrated under reduced pressure. The residue
was purified by silica gel column chromatography (hexane/ethyl
acetate=20:1) to give the title compound. yield 170, oil.
30 1H NMR (CDC13) g 2. 61 (2H, t, J=8.0 Hz) , 2. 91 (2H, t, J=8.0 Hz) ,
3. 67 (3H, s) , 4. 58-4.70 (2H, m) , 5. 85-5. 88 (1H, m) , 6.85 (2H,
d, J=8.6 Hz), 6.91-6.96 (2H, m), 7.14 (2H, d, J=8.6 Hz), 7.25-
7.33 (1H, m), 7.38-7.40 (1H, m).
Reference Example 54 4-[(2,3-dihydrobenzofuran-3-
186
CA 02505322 2005-05-06
yl)oxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[(2,3-
dihydrobenzofuran-3-yl)oxy]benzenepropanoate by a method
similar to that of Reference Example 38. yield 60$.
melting point: 106-107~C (recrystallized from ethyl
acetate-diisopropyl ether).
1H I~ZR ( CDC13 ) $ 2 . 67 ( 2H, t, J=8 . 0 Hz ) , 2 . 93 ( 2H, t, J=8 . 0 Hz
) ,
4.59-4.71 (2H, m) , 5.86-5.89 (1H, m) , 6. 85 (2H, d, J=8. 6 Hz) ,
6.91-6.96 (2H, m) , 7.15 (2H, d, J=8. 6 Hz) , 7.26-7.33 (1H, m) ,
io 7 . 3g-7 .40 ( 1H, m) .
Reference Example 55 methyl 4-[[3-(3-
thienyl)phenyl]methoxy]benzenepropanoate
Methyl 4-[(3-bromophenyl)methoxy]benzenepropanoate (0.96
g, 2.8 mmol) , bis (pinacolato) diboron (0.77 g, 3.0 mmol) and
potassium acetate (0.81 g, 8.3 mmol) were dissolved in N,N-
dimethylformamide (30 mL) and, after argon substitution, 1,1'-
bis(diphenyphosphino)ferrocenedichloropalladium (II) (0.067 g,
0.083 mmol) was added. The reaction mixture was heated
overnight under an argon atmosphere at 80°C. The reaction
2° mixture was cooled, and 3-bromothiophene (0.43 g, 2.6 mmol),
1,1'-bis(diphenyphosphino)ferrocenedichloropalladium (II)
(0.067 g, 0.083 mmol) and 2N aqueous sodium carbonate solution
(6.9 mh, 14 mmol) were added to the reaction mixture. The
reaction mixture was heated overnight under an argon
atmosphere at 80~C. The reaction mixture was cooled, and the
mixture was extracted with ethyl acetate. The extract was
washed with water, dried and concentrated. The residue was
purified by silica gel column chromatography (hexane/ethyl
acetate=15:1) to give the title compound (0.21 g, yield 22%)
3o as an oil.
1H NMR (CDC13) g 2. 60 (2H, t, J=8.0 Hz) , 2. 90 (2H, t, J=8.0 Hz) ,
3.66 (3H, s), 5.08 (2H, s), 6.89-6.94 (2H, m), 7.10-7.14 (2H,
m) , 7 . 33-7 . 44 ( 4H, m) , 7 . 47 ( 1H, t, J=2 . 2 Hz ) , 7 . 55 ( 1H, dt,
J=7.5 Hz, 1.6 Hz), 7.66 (1H, s).
187
CA 02505322 2005-05-06
Reference Example 56 4-[[3-(3-
thienyl)phenyl]methoxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[[3-(3-
thienyl)phenyl]methoxy]benzenepropanoate by a method similar
to that of Reference Example 4. yield 33~.
melting point: 153.0-153.5°C (recrystallized from diisopropyl
ether-hexane).
1H NMR (CDC13) $ 2.65 (2H, t, J=8.0 Hz), 2.91 (2H, t, J=8.0 Hz),
5.08 (2H, s) , 6. 93 (2H, d, J=8. 6 Hz) , 7.14 (2H, d, J=8. 6 Hz) ,
io 7 . 33-7 . 47 ( 5H, m) , 7 . 55 ( 1H, dt, J=7 . 5 Hz, 1. 5 Hz ) , 7 . 65 (
1H,
s) .
Reference Example 57 methyl 4-[[3-[[5-(trifluoromethyl)-2-
pyridinyl]oxy]phenyl]methoxy]benzenepropanoate
The title compound was obtained from methyl 4-
15 hydroxybenzenepropanoate and 3-[[5-(trifluoromethyl)-2-
pyridinyl]oxy]benzyl alcohol by a method similar to that of
Reference Example 1. yield 890, oil.
1H NMR (CDC13) $ 2. 60 (2H, t, J=8.0 Hz) , 2. 89 (2H, t, J=8.0 Hz) ,
3.66 (3H, s), 5.07 (2H, s), 6.89 (2H, d, J=8.6 Hz), 7.01 (1H,
2o d, J=8 . 7 Hz ) , 7 . 09-7 .13 ( 3H, m) , 7 . 2 3 ( 1H, br s ) , 7 . 31 (
1H, d,
J=7.6 Hz), 7.44 (1H, t, J=7.9 Hz), 7.90 (1H, dd, J=8.7 Hz, 2.4
Hz) , 8.44 (1H, br s) .
Reference Example 58 4-[[3-[[5-(trifluoromethylf-2-
pyridinyl]oxy]phenyl]methoxy]benzenepropanoic acid
2s The title compound was obtained from methyl 4-[[3-[[5-
(trifluoromethyl)-2-
pyridinyl]oxy]phenyl]methoxy]benzenepropanoate by a method
similar to that of Reference Example 4. yield 28$.
melting point: 112-113°C (recrystallized from diisopropyl
so ether-hexane) .
1H NMR (CDC1~) g 2. 60 (2H, t, J=8.0 Hz) , 2. 90 (2H, t, J=8.0 Hz) ,
. 07 ( 2H, s ) , 6 . 93 ( 2H, d, J=8 . 6 Hz ) , 7 . O1 ( 1H, d, J=8 . 7 Hz ) ,
7 . 09-7 .17 ( 3H, m) , 7 . 24 ( 1H, br s ) , 7 . 31 ( 1H, d, J=9 . 2 Hz ) ,
7.44 (1H, t, J=7.9 Hz), 7.90 (1H, dd, J=8.7 Hz, 2.5 Hz), 8.44-
188
CA 02505322 2005-05-06
8.45 (1H, m) .
Reference Example 59 methyl 4-[[3-(2-
thienyl)phenyl]methoxy]benzenepropanoate
The title compound was obtained as a white powder from 2-
thiopheneboronic acid by a method similar to that of Reference
Example 22. yield 33s.
1H NMR ( CDC13 ) g 2 . 60 ( 2H, t, J=8 .1 Hz ) , 2 . 90 ( 2H, t, J=8 .1 Hz ) ,
3. 66 (3H, s) , 5. 06 (2H, s) , 6.92 (2H, d, J=8. 6 Hz) , 7 .06-7.14
( 3H, m) , 7 . 28 ( 1H, dd, J=5 .1 Hz, 1.1 Hz ) , 7 . 30-7 . 41 ( 3H, m) ,
io 7.56 (1H, dt, J=7.4 Hz, 1.6 Hz) , 7.66 (1H, s) .
Reference Example 60 4-[[3-(2-
thienyl)phenyl]methoxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[[3-(2-
thienyl)phenyl]methoxy]benzenepropanoate by a method similar
is to that of Reference Example 4. yield 520.
melting point: 127-128~C (recrystallized from ethyl acetate-
hexane).
1H 1~IR (CDC13) g 2. 65 (2H, t, J=8.0 Hz) , 2. 91 (2H, t, J=8. 0 Hz) ,
. 07 (2H, s ) , 6 . 93 ( 2H, d, J=8 . 6 Hz ) , 7 . 08 ( 1H, dd, J=4 . 5 Hz,
20 3.5 Hz), 7.14 (2H, d, J=8.6 Hz), 7.27-7.41 (4H, m), 7.57 (1H,
dt, J=7 . 4 Hz, 1. 6 Hz ) , 7 . 66 ( 1H, s ) .
Reference Example 61 methyl 4-[[3-(2-
pyrimidinyl)phenyl]methoxy]benzenepropanoate '
Methyl 4-[(3-bromophenyl)methoxy]benzenepropanoate (0.70
25 g, 2. 0 mmol) , bis (pinacolato) diboron (0.56 g, 2.2 mmol) and
potassium acetate (0.59 g, 6.0 mmol) were dissolved in N,N-
dimethylformamide (20 mL) and, after argon substitution, l,l'-
bis(diphenyphosphino)ferrocenedichloropalladium (II) (0. 049 g,
0.060 mmol) was added. The reaction mixture was heated under
so an argon atmosphere at 80~C for 8 hrs. The reaction mixture
was cooled, water was added to the reaction mixture and the
mixture was extracted with ethyl acetate. The extract was
washed with water, dried and concentrated. The residue was
dissolved in toluene-methanol-water (5:1:1, 35 mL), sodium
189
CA 02505322 2005-05-06
carbonate (0.64 g, 6.0 mmol) was added and, after argon
substitution, tetrakistriphenylphosphinepalladium (0.12 g,
0.10 mmol) was added. The reaction mixture was heated under
reflux overnight under an argon atmosphere. The reaction
mixture was cooled, water was added to the reaction mixture
and the mixture was extracted with ethyl acetate. The extract
was washed with water, dried and concentrated. The residue
was purified by silica gel column chromatography (hexane/ethyl
acetate=5:1) to give the title compound (0.13 g, yield 16o) as
1° a colorless oil.
1H NMR (CDC13) g 2.59 (2H, t, J=8.1 Hz) , 2. 89 (2H, t, J=8.1 Hz) ,
3. 66 (3H, s) , 5.13 (2H, s) , 6. 92-6. 94 (2H, m) , 7. 09-7.13 (2H,
m) , 7.17-7.20 (1H, m) , 7.41-7.86 (2H, m) , 8.41 (1H, dt, J=7. 6
Hz, 1.6 Hz), 8.42-8.52 (1H, m), 8.80 (2H, d, 4.8 Hz).
is Reference Example 62 4- [ [ 3- ( 2-
pyrimidinyl)phenyl]methoxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[[3-(2-
pyrimidinyl)phenyl]methoxy]benzenepropanoate by a method
similar to that of Reference Example 4. yield 26~.
2o melting point: 152-153°C (recrystallized from ethyl acetate-
hexane ) .
1H NMR (CDC13) g 2. 65 (2H, t, J=7.9 Hz) , 2. 91 (2H, t, J=7.9 Hz) ,
5.14 (2H, s) , 6.94 (2H, d, J=8. 6 Hz) , 7.13 (2H, 'd, J=8. 6 Hz) ,
7.22 (1H, t, J=4.9 Hz) , 7.49-7.60 (2H, m) , 8.40 (1H, d, J=7. 6
25 Hz) , 8.50 (1H, s) , 8.83 (2H, d, J=4.8 Hz) .
Reference Example 63 methyl 4-[[3-(2-
pyridinyl)phenyl]methoxy]benzenepropanoate
Methyl 4-[(3-bromophenyl)methoxy]benzenepropanoate (0.70
g, 2.0 mmol) and 2-pyridyltrimethyltin (0.60 g, 2.4 mmol) were
so dissolved in N,N-dimethylformamide (15 mL) and, after argon
substitution, dichlorobistriphenylphosphinepalladium (II)
(0.10 g, 0.070 mmol) was added. The reaction mixture was
heated under reflux overnight under an argon atmosphere. The
reaction mixture was cooled, water was added to the reaction
190
CA 02505322 2005-05-06
mixture and the mixture was extracted with ethyl acetate. The
extract was washed with water, dried and concentrated. The
residue was purified by silica gel column chromatography
(hexane/ethyl acetate=5:1) to give the title compound (0.24 g,
s yield 35~) as a colorless oil.
1H I~IR ( CDC13 ) g 2 . 60 ( 2H, t, J=8 .1 Hz ) , 2 . 90 ( 2H, t, J=8 .1 Hz )
,
3. 66 (3H, s) , 5. 13 (2H, s) , 6.93 (2H, d, J=8. 6 Hz) , 7.12 (2H,
d, J=8.6 Hz), 7.22-7.27 (1H, m), 7.46-7.51 (2H, m), 7.73-7.79
( 2H, m) , 7 . 93 ( 1H, dt, J=1. 8 Hz, 5 . 0 Hz ) , 8 . 07 ( 1H, s ) , 8 . 70
to ( 1H, dt, J=4 . 7 Hz, 1. 4 Hz ) .
Reference Example 64 4- ( [3- (2-
pyridinyl)phenyl]methoxy]benzenepropanoic acid
The title compound was obtained from methyl 4-([3-(2-
pyridinyl)phenyl]methoxy]benzenepropanoate by a method similar
Is to that of Reference Example 4. yield 57s.
melting point: 160-161°C (recrystallized from ethyl acetate-
hexane).
1H NMR ( CDC13 ) g 2 . 63 ( 2H, t, J=8 . 0 Hz ) , 2 . 90 ( 2H, t, J=8 . 0 Hz )
,
.12 ( 2H, s ) , 6 . 93 ( 2H, d, J=8 . 6 Hz ) , 7 .12 ( 2H, d, J=8 . 6 Hz ) ,
20 7,24-7.29 (1H, m), 7.46-7.52 (2H, m), 7.71-7.81 (2H, m), 7.87-
7.91 (1H, m), 8.05 (1H, s), 8.72-8.75 (1H, m).
Reference Example 65 methyl 4-[[3-(2-
naphthyl)phenyl]methoxy]benzenepropanoate
The title compound was obtained as a white powder from 2-
2s naphthylboronic acid by a method similar to that of Reference
Example 22. yield 93~.
1H NMR (CDC13) $ 2. 60 (2H, t, J=8.0 Hz) , 2. 90 (2H, t, J=8.0 Hz) ,
3. 66 (3H, s) , 5.13 (2H, s) , 6.94 (2H, d, J=8. 6 Hz) , 7 .13 (2H,
d, J=8 . 6 Hz ) , 7 . 42-7 . 53 ( 4H, m) , 7 . 68 ( 1H, dt, J=7 . 4 Hz, 1. 5
3o Hz), 7.73-7.80 (2H, m), 7.85-7.93 (3H, m), 8.05 (1H, br s).
Reference Example 66 4-[[3-(2-
naphthyl)phenyl]methoxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[[3-(2-
naphthyl)phenyl]methoxy]benzenepropanoate by a method similar
191
CA 02505322 2005-05-06
to that of Reference Example 4. yield 52~.
melting point: 134-135~C (recrystallized from ethyl acetate-
hexane ) .
1H I~t (CDC13) g 2. 65 (2H, t, J=7. 9 Hz) , 2. 91 (2H, t, J=7. 9 Hz) ,
.13 ( 2H, s ) , 6 . 95 ( 2H, d, J=8 . 6 Hz ) , 7 .14 ( 2H, d, J=8 . 6 Hz ) ,
7.43-7.53 (4H, m), 7.68 (1H, dt, J=7.5 Hz, 1.5 Hz), 7.75 (1H,
dd, J=8. 6 Hz, 1.8 Hz) , 7.78 (1H, s) , 7.85-7. 93 (3H, m) , 8.05
( 1H, br s ) .
Reference Example 67 4-[[3-(5-
Zo pyrimidinyl)phenyl]methoxy]benzenepropanoic acid
Methyl 4-[(3-bromophenyl)methoxy]benzenepropanoate (0.70
g, 2.0 mmol), bis(pinacolato)diboron (0.56 g, 2.2 mmol) and
potassium acetate (0.59 g, 6.0 mmol) were dissolved in N,N-
dimethylformamide (20 mL) and, after argon substitution, 1,1'-
bis(diphenyphosphino)ferrocenedichloropalladium (II) (0.049 g,
0.060 mmol) was added. The reaction mixture was heated
overnight under an argon atmosphere at 80°C. The reaction
mixture was cooled, water was added to the reaction mixture
and the mixture was extracted with ethyl acetate. The extract
2o was washed with water, dried and concentrated. The residue
was dissolved in toluene-methanol-water (5:1:1, 35 mL), sodium
carbonate (0.64 g, 6.0 mmol) was added and, after argon
substitution, tetrakistriphenylphosphinepalladium (0.12 g,
0.10 mmol) was added. The reaction mixture was heated under
reflux overnight under an argon atmosphere. The reaction
mixture was cooled, water was added and the reaction mixture
was washed with ethyl acetate. Then the aqueous layer was
neutralized with 1N hydrochloric acid, and the mixture was
extracted with ethyl acetate. The extract was washed with
so water, dried and concentrated. The residue was recrystallized
from tetrahydrofuran-hexane to give the title compound (0.94 g,
yield 14~).
melting point: 166-167~C.
1H NMR (CDC13+DMSO-d6) $ 2. 60 (2H, t, J=8.1 Hz) , 2.91 (2H, t,
192
CA 02505322 2005-05-06
J=8 .1 Hz ) , 5 .13 ( 2H, s ) , 6 . 92 ( 2H, d, J=8 . 6 Hz ) , 7 .16 ( 2H, d,
J=8. 6 Hz) , 7.54 (3H, s) , 7. 65 (1H, s) , 8. 96 (2H, s) , 9.21 (1H,
s) .
Reference Example 68 5,6-dihydro-4H-cyclopenta[b]thien-4-one
To a solution of N,N-dimethylacrylamide (6.6 g, 71 mmol)
in dichloroethane (400 ml) was gradually added dropwise a
solution of trifluoromethanesulfonic acid anhydride (20 g, 71
mmol) in dichloroethane (50 mL) under ice-cooling. A solution
of thiophene (6.0 g, 71 mmol) in dichloroethane (50 mL) was
zo added to the mixture, and the mixture was heated under reflex
for 15 hrs. The reaction mixture was concentrated under
reduced pressure, saturated sodium hydrogencarbonate solution
was added, and the mixture was extracted with ethyl acetate.
The extract was washed with water and concentrated under
15 reduced pressure. The residue was purified by silica gel
column chromatography (hexane/ethyl acetate=9:5 to 4:1) to
give the title compound (3.8 g, yield 39%) as a white powder.
1H NMR (CDC13) g 3.00 (2H, t, J=4.7 Hz) , 3.19 (2H, t, J=4.7 Hz) ,
7.15 (1H, d, J=5.1 Hz) , 7.31 (1H, d, J=5.1 Hz) .
2o Reference Example 69 4-hydroxybenzenepropanamide
25% Aqueous ammonia (30 mL) was added to methyl 4-
hydroxybenzenepropanoate (1.5 g, 8.3 mmol), and the mixture
was stirred at room temperature for 15 hrs. Dif. hydrochloric
acid was added to the reaction mixture, and the mixture was
25 extracted with ethyl acetate. The extract was washed with
water and concentrated under reduced pressure. The residue
was recrystallized from ethyl acetate-hexane to give the title
compound (0.43 g, yield 31%).
1H NMR (CDC13) g 2.49 (2H, t, J=7. 9 Hz) , 2. 90 (2H, t, J=7.9 Hz) ,
30 4,65 (1H, s), 5.25 (2H, br s), 6.76 (2H, d, J=8.5 Hz), 7.08
( 2H, d, J=8 . 5 Hz ) .
Reference Example 70 4-[(5-chloro-2,3-dihydro-1H-inden-1-
yl)oxy]benzenepropanamide
5-Chloro-2,3-dihydro-1H-inden-1-of was obtained from 5-
193
CA 02505322 2005-05-06
chloro-1-indanone by a method similar to that of Reference
Example 32. This was condensed with 4-
hydroxybenzenepropanamide by a method similar to that of
Reference Example 1 to give the title compound. yield from 5-
chloro-1-indanone 21~.
melting point: 158-159°C (recrystallized from ethyl acetate-
hexane ) .
1H NMR (CDC13) 82.21 (1H, m) , 2.49-2. 61 (3H, m) , 2.83-2. 96 (3H,
m) , 3.11 (1H, m) , 5.36 (2H, br s) , 5.67 (1H, dd, J=4. 3 Hz, 6. 6
1o Hz) , 6. 91 (2H, d, J=8. 6 Hz) , 7.14-7.33 (5H, m) .
Reference Example 71 5-[[4-([1,1'-biphenyl]-3
ylmethoxy)phenyl]methyl]-2,4-thiazolidinedione
To a solution of 5-[(4-hydroxyphenyl)methyl]-2,4
thiazolidinedione (0.30 g, 1.3 mmol) in dimethyl sulfoxide (20
15 mL) were added 3-(chloromethyl)biphenyl (0.26 g, 1.3 mmol) and
60o sodium hydride (0.11 g, 2.6 mmol), and the mixture was
stirred at room temperature for 1 hr and further at 50°C for 1
hr. Water was added to the reaction mixture, and the mixture
was extracted with ethyl acetate. The extract was washed with
2° water and concentrated under reduced pressure. The residue
was purified by silica gel column chromatography (hexane/ethyl
acetate=8:2) to give the title compound (1.3 g, yield 96~).
melting point: 109-111°C (recrystallized from diethyl ether-
hexane) .
25 1H NMR (CDC13) g 3.11 (1H, dd, J=9.4 Hz, 14.1 Hz), 3.46 (1H, dd,
J=3.9 Hz, 14.1 Hz), 4.80 (1H, dd, J=3.9 Hz, 9.4 Hz), 5.11 (2H,
s ) , 6 . 95 (2H, d, J=8 . 7 Hz ) , 7 .16 (2H, d, J=8 . 7 Hz ) , 7 . 30-7 . 65
( 9H, m) , 7 . 99 ( 1H, s ) .
Reference Example 72 5-[[4-[(3-
30 phenoxyphenyl)methoxy]phenyl]methyl]-2,4-thiazolidinedione
The title compound was obtained from 5-(4-hydroxybenzyl)-
2,4-thiazolidinedione and 1-(chloromethyl)-3-phenoxybenzene by
a method similar to that of Reference Example 71. yield 230.
melting point: 101-102°C (recrystallized from diethyl ether-
194
CA 02505322 2005-05-06
hexane ) .
1H NMR ( CDC13 ) $ 3 .10 ( 1H, dd, J=9 . 5 Hz, 14 . 2 Hz ) , 3 . 45 ( 1H, dd,
J=3.8 Hz, 14.2 Hz) , 4.50 (1H, dd, J=3. 8 Hz, 9. 5 Hz) , 5. O1 (2H,
s), 6.89-7.19 (lOH, m), 7.31-7.36 (3H, m), 8.25 (1H, s).
Reference Example 73 4-[(5-chloro-2,3-dihydro-1H-inden-1-
yl)oxy]benzenepropanenitrile
5-Chloro-2,3-dihydro-1H-inden-1-of was obtained from 5-
chloro-1-indanone by a method similar to that of Reference
Example 32. This was condensed with 4-
io hydroxybenzenepropanenitrile by a method similar to that of
Reference Example 1 to give the title compound. yield from 5-
chloro-1-indanone 59$.
melting point: 97-98°C (recrystallized from diethyl ether-
hexane) .
is 1H NMR (CDC13) g 2.24 (1H, m) , 2.49-2.63 (3H, m) , 2.85-2.95 (3H,
m), 3.12 (1H, m), 5.69 (1H, dd, J=4.3 Hz, 6.6 Hz), 6.95 (2H, d,
J=8.6 Hz), 7.18 (2H, d, J=8.6 Hz), 7.22-7.34 (3H, m).
Reference Example 74 4-[(5-chloro-2,3-dihydro-1H-inden-1-
yl)oxy]-N-(methylsulfonyl)benzenepropanamide
2o To a solution of 4-[(5-chloro-2,3-dihydro-1H-inden-1-
yl)oxy]benzenepropanoic acid (0.3 g, 0.95 mmol) in
dichloromethane (10 mL) were added methanesulfonamide (90 mg,
0.95 mmol), N,N-dimethylaminopyridine (0.12 g, 6.95 mmol) and
1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride
2s (0.17 mL, 0.95 mmol), and the mixture was stirred at room
temperature for 15 hrs. Water was added to the reaction
mixture, and the mixture was extracted with ethyl acetate.
The extract was washed with water, concentrated under reduced
pressure to give the title compound (0.10 g, yield 30%).
3o melting point: 140-141°C (recrystallized from ethyl acetate-
hexane ) .
1H NMR (CDC13) g 2 . 22 ( 1H, m) , 2 . 54 ( 1H, m) , 2 . 62 (2H, d, J=7 . 4
Hz ) , 2 . 85-2 . 98 ( 3H, m) , 3 .10 ( 1H, m) , 3 . 25 ( 3H, s ) , 5 . 68 (
1H,
dd, J=4 . 3 Hz, 6 . 6 Hz ) , 6 . 93 ( 2H, d, J=8 . 6 Hz ) , 7 . 13 ( 2H, d,
195
CA 02505322 2005-05-06
J=8.6 Hz), 7.19-7.34 (3H, m), 7.67 (1H, br s).
Reference Example 75 N-[3-[4-[(5-chloro-2,3-dihydro-1H-inden-
1-yl)oxy]phenyl]propyl]acetamide
To a solution of 4-[(5-chloro-2,3-dihydro-1H-inden-1-
yl)oxy]benzenepropanenitrile (0.50 g, 1.7 mmol) in
tetrahydrofuran (25 mL) was added lithium aluminum hydride (77
mg, 2.0 mmol) under ice-cooling, and the mixture was stirred
in an ice bath for 3 hrs. Water was added to the reaction
mixture, and the mixture was extracted with ethyl acetate.
so The extract was washed with water and concentrated under
reduced pressure. The obtained oil was dissolved in pyridine
(20 mL), acetic anhydride (0.18 mL, 0.95 mmol) was added, and
the mixture was stirred at room temperature for 3 hrs. Water
was added to the reaction mixture, and the mixture was
is extracted with ethyl acetate. The extract was washed with
water and concentrated under reduced pressure. The residue
was purified by silica gel column chromatography (ethyl
acetate) to give the title compound (0.11 g, yield 18~).
melting point: 111-112°C (recrystallized from diethyl ether).
20 1H NMR (CDC13) $ 1 .85 (2H, m) , 1.95 (3H, s) , 2.24 (1H, m) , 2.50-
2 . 64 ( 3H, m) , 2 . 90 ( 1H, m) , 3 .12 ( 1H, m) , 3 . 28 ( 2H, dt, J=6 . 6
Hz, 6 . 7 Hz ) , 5 . 4 0 ( 1H, br s ) , 5 . 68 ( 1H, t, J=4 . 6 Hz ) , 6 . 90
( 2H,
d, J=8 . 4 Hz ) , 7 .11 ( 2H, d, J=8 . 4 Hz ) , 7 .19-7 . 34 '( 3H, m) .
Reference Exang~le 76 N-[3-[4-[(5-chloro-2,3-dihydro-1H-inden-
25 1-yl)oxy]phenyl]propyl]methanesulfonamide
To a solution of 4-[(5-chloro-2,3-dihydro-1H-inden-1-
yl)oxy]benzenepropanenitrile (1.0 g, 3.4 mmol) in
tetrahydrofuran (50 mL) was added lithium aluminum hydride
(0.16 g, 4.1 mmol) under ice-cooling, and the mixture was
so stirred in an ice bath for 1 hr. Water was added to the
reaction mixture, and the mixture was extracted with ethyl
acetate. The extract was washed with water and concentrated
under reduced pressure. The obtained oil was dissolved in
chloroform (20 mL) and ice-cooled. Triethylamine (0.47 mL,
196
CA 02505322 2005-05-06
3.4 mmol) and methanesulfonyl chloride (0.36 mL, 3.4 mmol)
were added thereto, and the mixture was stirred under ice-
cooling for 3 hrs. Water was added to the reaction mixture,
and the mixture was extracted with ethyl acetate. The extract
was washed with water and concentrated under reduced pressure.
The residue was purified by silica gel column chromatography
(hexane/ethyl acetate=7:3) to give the title compound (0.15 g,
yield 11~).
melting point: 89-90~C (recrystallized from diethyl ether).
l0 1H I~IR (CDC13) g 1. 89 (2H, m) , 2 .24 ( 1H, m) , 2. 55 ( 1H, m) , 2. 66
(2H, t, J=7.4 Hz), 2.90 (1H, m), 2.94 (3H, s), 3.07-3.19 (3H,
m) , 4.29 (1H, br) , 5. 67 (1H, dd, J=4 .4 Hz, 6.5 Hz) , 6. 90 (2H,
d, J=8 . 6 Hz ) , 7 .11 ( 2H, d, J=8 . 6 Hz ) , 7 .19-7 . 34 ( 3H, m) .
Reference Example 77 2,3-dihydro-2,2-dimethyl-1H-inden-1-one
is To a solution of 60$ sodium hydride (2.7 g, 68 mmol) in
1,2-dimethoxyethane (30 mL) was slowly added 1-indanone (3.0 g,
23 mmol). The mixture was stirred at room temperature for 10
min., methyl iodide (5.7 ml, 91 mmol) was added, and the
mixture was stirred at room temperature for 1 hr. Water was
2° added to the reaction mixture, and the mixture was extracted
with ethyl acetate. The extract was washed with water and
concentrated under reduced pressure. The residue was purified
by silica gel column chromatography (hexane) to'give the title
compound (4.0 g, yield 99~).
2s 1H NMR (CDC13) g 1. 24 ( 6H, s) , 3. O1 (2H, s) , 7. 35-7. 44 (2H, m) ,
7.59 (1H, dt, J=1.2 Hz, 7.6 Hz), 7.76 (1H, d, J=7.8 Hz).
Reference Example 78 methyl [4-([1,1'-biphenyl]-3-
ylmethoxy)phenoxy]acetate
The title compound was obtained as a white powder from
3o methyl (4-hydroxyphenoxy)acetate and [1,1'-biphenyl]-3-
methanol by a method similar to that of Reference Example 1.
yield 42~.
1H I~TMR (CDC13) g 3.80 (3H, s), 4.59 (2H, s), 5.08 (2H, s), 6.86
( 2H, d, J=9 . 2 Hz ) , 6 . 94 ( 2H, d, J=9 . 2 Hz ) , 7 . 33-7 . 64 ( 9H, m)
.
197
CA 02505322 2005-05-06
Reference Example 79 [4-([1,1'-biphenyl]-3-
ylmethoxy)phenoxy]acetic acid
The title compound was obtained from methyl [4-([1,1'-
biphenyl]-3-ylmethoxy)phenoxy]acetate by a method similar to
that of Reference Example 4. yield 88~.
melting point: 132-133°C (recrystallized from diethyl ether-
hexane) .
1H I~ll~IR (CDC13) g 4. 63 (2H, s) , 5.08 (2H, s) , 6.88 (2H, d, J=9.3
Hz ) , 6 . 95 ( 2H, d, J=9 . 3 Hz ) , 7 . 31-7 . 64 ( 9H, m) .
io Reference Example 80 ethyl 2- [ 4- ( [ 1, 1' -biphenyl ] -3-
ylmethoxy)phenoxy]-2-methylpropanoate
The title compound was obtained from ethyl 2-(4-
hydroxyphenoxy)-2-methylpropanoate and [1,1'-biphenyl]-3-
methanol by a method similar to that of Reference Example 1.
is yield 65~, oil.
1H NMR (CDC13) g 1.27 (3H, t, J=7.1 Hz) , 1.54 (6H, s) , 4.24 (2H,
q, J=7 .1 Hz ) , 5 . 06 ( 2H, s ) , 6 . 8 6 ( 4H, m) , 7 . 30-7 . 47 ( 5H, m)
,
7.53-7.64 (4H, m).
Reference Example 81 2-[4-((l,l'-biphenyl]-3-
2o ylmethoxy)phenoxy]-2-methylpropanoic acid
The title compound was obtained from ethyl 2-(4-([1,1'-
biphenyl]-3-ylmethoxy)phenoxy]-2-methylpropanoate by a method
similar to that of Reference Example 4. yield X30.
melting point: 114-115°C (recrystallized from diethyl ether-
25 hexane ) .
1H NMR (CDC13) g 1.55 (6H, s) , 5.08 (2H, s) , 6. 92 (4H, m) , 7.31-
7.45 (5H, m), 7.54-7.64 (4H, m).
Reference Example 82 methyl [4-[(3-
phenoxyphenyl)methoxy]phenoxy]acetate
3o The title compound was obtained as a white powder from
methyl (4-hydroxyphenoxy)acetate and (3-phenoxyphenyl)methanol
by a method similar to that of Reference Example 1. yield 470.
1H NMR (CDC13) g 3. 80 (3H, s) , 4 . 58 (2H, s) , 4. 98 (2H, s) , 6. 86
(4H, m), 6.90-7.18 (6H, m), 7.30-7.36 (3H, m).
198
CA 02505322 2005-05-06
Reference Example 83 [4-[(3-
phenoxyphenyl)methoxy]phenoxy]acetic acid
The title compound was obtained from methyl [4-[(3-
phenoxyphenyl)methoxy]phenoxy]acetate by a method similar to
that of Reference Example 4. yield 86g.
melting point: 115-116~C (recrystallized from ethyl acetate-
hexane ) .
1H NMR (CDC13) g 4. 63 (2H, s) , 4 . 98 (2H, s) , 6.81-7.16 (lOH, m) ,
7.31-7.36 (3H, m).
io Reference Example 84 ethyl 2-[4-[(2,3-dihydro-1H-inden-1-
yl)oxy]phenoxy]-2-methylpropanoate
The title compound was obtained from ethyl 2-(4-
hydroxyphenoxy)-2-methylpropanoate and 2,3-dihydro-1H-inden-1-
ol by a method similar to that of Reference Example 1. yield
1s 63$, oil.
1H NMR (CDC13) g 1.29 (3H, t, J=7.1 Hz), 1.56 (6H, s), 2.20 (1H,
m) , 2 . 51 ( 1H, m) , 2 . 91 ( 1H, m) , 3 .13 ( 1H, m) , 4 .25 (2H, q,
J=7 .1 Hz) , 5. 67 (1H, dd, J=4.3 Hz, 6.6 Hz) , 6.88 (4H, s) ,
7.20-7.31 (3H, m) , 7.40 (1H, d, J=7.2 Hz) .
2o Reference Example 85 2-[4-[(2,3-dihydro-1H-inden-1-
yl)oxy]phenoxy]-2-methylpropanoic acid
The title compound was obtained from ethyl 2-[4-[(2,3-
dihydro-1H-inden-1-yl)oxy]phenoxy]-2-methylpropanoate by a
method similar to that of Reference Example 4. yield 71~.
2s melting point: 107-108~C (recrystallized from diethyl ether-
hexane ) .
1H NMR (CDC13) g 1.56 (6H, s), 2.22 (1H, m), 2.53 (1H, m), 2.92
( 1H, m) , 3 .14 ( 1H, m) , 5 . 70 ( 1H, dd, J=4 . 3 Hz, 6. 6 Hz ) , 6 . 94
( 4H, s ) , 7 . 21-7 . 32 ( 3H, m) , 7 . 41 ( 1H, d, J=7 . 3 Hz ) .
so Reference Example 86 ethyl 2-methyl-2-[4-[(3-
phenoxyphenyl)methoxy]phenoxy]propanoate
The title compound was obtained from ethyl 2-(4-
hydroxyphenoxy)-2-methylpropanoate and (3-
phenoxyphenyl)methanol by a method similar to that of
199
CA 02505322 2005-05-06
Reference Example 1. yield 78~, oil.
1H 1~1MR (CDC13) $ 1.27 (3H, t, J=7. 1 Hz) , 1.54 (6H, s) , 4.23,
(2H, q, J=7.1 Hz) , 4.97 (2H, s) , 6.82 (4H, s) , 6.89-7.14 (6H,
m), 7.30-7.36 (3H, m).
Reference Example 87 2-methyl-2-[4-[(3-
phenoxyphenyl)methoxy]phenoxy]propanoic acid
The title compound was obtained from ethyl 2-methyl-2-[4-
[(3-phenoxyphenyl)methoxy]phenoxy]propanoate by a method
similar to that of Reference Example 4. yield 990, amorphous.
1H NMR (CDC13) $ 1.54 (6H, s) , 4.99 (2H, s) , 6.85-7.15 (lOH, m) ,
7.31-7.36 (3H, m).
Reference Example 88 methyl [4-[(2,3-dihydro-1H-inden-1-
yl)oxy]phenoxy]acetate
The title compound was obtained from ethyl 2-(4-
hydroxyphenoxy)-2-methylpropanoate and 2,3-dihydro-1H-inden-1-
ol by a method similar to that of Reference Example 1. yield
52~, oil.
1H NMR (CDC13) g 2 . 22 ( 1H, m) , 2 . 51 ( 1H, m) , 2 . 90 ( 1H, m) , 3 .14
(1H, m), 3.82 (3H, s), 4.61 (2H, s), 5.67 (1H, dd, J=4.4 Hz,
6.6 Hz), 6.86-6.96 (4H, m), 7.21-7.30 (3H, m), 7.40 (1H, d,
J=7.3 Hz).
Reference Example 89 [4-[(2,3-dihydro-1H-inden-1-
yl)oxy]phenoxy]acetic acid
The title compound was obtained from methyl [4-[(2,3-
dihydro-1H-inden-1-yl)oxy]phenoxy]acetate by a method similar
to that of Reference Example 4. yield 48~.
melting point: 99-100 °c (recrystallized from diethyl ether-
hexane ) .
1H NMR (CDC13) g 2 . 22 ( 1H, m) , 2 . 50 ( 1H, m) , 2 . 94 ( 1H, m) ,
3 .12 ( 1H, m) , 4 . 66 ( 2H, s ) , 5 . 68 ( 1H, dd, J=4 . 3 Hz, 6 . 6 Hz ) ,
6. 90 (2H, d, J=9.3 Hz) , 6. 95 (2H, d, J=7 .2 Hz) , 7 .20-7 . 30 (3H,
m) , 7.40 (1H, d, J=7.3 Hz) .
Reference Example 90 (2,3-dihydro-1H-inden-1-yl) 3-[(2,3-
dihydro-1H-inden-1-yl)oxy]benzeneacetate
200
CA 02505322 2005-05-06
The title compound was obtained from (3-
hydroxyphenyl)acetic acid and 2,3-dihydro-1H-inden-1-of by a
method similar to that of Example 105. yield 81~, oil.
1H NMR (CDC13) g 2.03-2.24 (2H, m), 2.44-2.59 (2H, m), 2.83-
2.96 (2H, m) , 3. 05-3.18 (2H, m) , 3. 61 (2H, s) , 5.71-5.75 (1H,
m), 6.21-6.24 (1H, m), 6.88-6.94 (3H, m), 7.18-7.31 (7H, m),
7.36-7.43 (2H, m) .
Reference Example 91 3-[(2,3-dihydro-1H-inden-1-
yl)oxy]benzeneacetic acid
to The title compound was obtained from (2,3-dihydro-1H-
inden-1-yl) 3-[(2,3-dihydro-1H-inden-1-yl)oxy]benzeneacetate
by a method similar to that of Example 106. yield 61~, oil.
1H NMR (CDC13) $ 2.14-2.25 (1H, m), 2.49-2.61 (1H, m), 2.85-
2 . 95 ( 1H, m) , 3 . 08-3 .18 ( 1H, m) , 3 . 62 ( 2H, s ) , 5 . 73-5 . 77 (
1H,
15 m) , 6.87-6. 94 (3H, m) , 7.20-7.30 (4H, m) , 7. 41 (1H, d, J=7.3
Hz ) , 9 . 65 ( 1H, br s ) .
Reference Example 92 2,3-dihydro-1-(3-iodophenoxy)-1H-indene
The title compound was obtained from 3-iodophenol and
2,3-dihydro-1H-inden-1-of by a method similar to that of
2o Example 105. yield 37s, oil.
1H NMR (CDC13) g 2.18-2.23 (1H, m) , 2.52-2. 57 (1H, m) , 2.93-
2.98 (1H, m), 3.10-3.14 (1H, m), 5.71-5.75 (1H, m), 6.97-7.02
(2H, m), 7.22-7.32 (4H, m), 7.37-7.40 (2H, m).
Reference Example 93 ethyl 3-(2,3-dihydro-1H-inden-1-
2s yloxy)benzenebutanoate
A mixture of 2,3-dihydro-1-(3-iodophenoxy)-1H-indene (1.5
g, 4.5 mmol), tetrahydrofuran (8 mL), 0.5 M 4-ethoxy-4-
oxobutylzinc bromide-tetrahydrofuran solution (13 mL, 6.5
mmol) and bis(triphenylphosphine)palladium chloride (28 mg,
3o p_04 mmol) was stirred at 60~C for 1 hr. The solvent was
evaporated, and the residue was diluted with ethyl acetate and
washed with water, and dried over anhydrous magnesium sulfate.
The solvent was evaporated, and the residue was purified by
silica gel column chromatography (hexane/ethyl acetate=5:1) to
201
CA 02505322 2005-05-06
give the title compound (0.70 g, yield 48~). oil.
1H I~ZR (CDC13) g 1.28 (3H, t, J=7. 1 Hz) , 1. 94-2.04 (2H, m) ,
2.18-2.36 (3H, m), 2.53-2.67 (3H, m), 2.87-2.97 (1H, m), 3.09-
3.19 (1H, m), 4.12 (2H, d, J=7.1 Hz), 5.74-5.78 (1H, m), 6.79-
6.87 (2H, m) , 7.21-7.30 (5H, m) , 7.43 (1H, d, J=7.2 Hz) .
Reference Example 94 3-(2,3-dihydro-1H-inden-1-
yloxy)benzenebutanoic acid
The title compound was obtained from ethyl 3-(2,3-
dihydro-1H-inden-1-yloxy)benzenebutanoate by a method similar
1o to that of Example 106. yield 80$, oil.
1H I~IMR (CDC13) g 1.93 (2H, m), 2.16-2.27 (1H, m), 2.39 (2H, t,
J=7 . 5 Hz ) , 2 . 57-2 . 62 ( 1H, m) , 2 . 67 ( 2H, t, J=7 . 5 Hz ) , 2 . 87-
2.97 (1H, m), 3.10-3.20 (1H, m), 5.74-5.78 (1H, m), 6.79-6.88
( 3H, m) , 7 . 21-7 . 31 ( 4H, m) , 7 . 4 3 ( 1H, d, J=7 . 2 Hz ) , 9 . 7 6 (
1H,
15 br s ) .
Reference Example 95 methyl 4-[(4-chloro-2-trifluoromethyl-5-
quinolinyl)methoxy]benzenepropanoate
The title compound was obtained from methyl 4-
hydroxybenzenepropanoate and 4-chloro-2-trifluoromethyl-5-
Zo quinolinemethanol by a method similar to that of Example 105.
yield 650.
melting point: 111-112°C (recrystallized from ethyl
acetate-diisopropyl ether).
1H NMR (CDC13) g 2. 61 (2H, t, J=7.5 Hz) , 2.91 (2H, t, J=7.5 Hz) ,
25 3 . 67 ( 3H, s ) , 5 . 30 ( 2H, s ) , 6 . 95 ( 2H, d, J=8 . 6 Hz ) , 7 .14
( 2H, d,
J=8.6 Hz), 7.84 (1H, s), 7.93-7.97 (1H, m), 8.26 (1H, d, J=8.7
Hz), 8.35 (1H, s).
Reference Example 96 4-(2-trifluoromethyl-4-chloroquinolin-5-
ylmethoxy)benzenepropanoic acid
3o The title compound was obtained from methyl 4-[(4-chloro-
2-trifluoromethyl-5-quinolinyl)methoxy]benzenepropanoate by a
method similar to that of Example 106. yield 90~.
melting point: 175-176~C (recrystallized from ethyl acetate-
hexane ) .
202
CA 02505322 2005-05-06
1H NMR (DMSO-d6) $ 2. 47 (2H, t, J=7.5 Hz) , 2.76 (2H, t, J=7.5
Hz), 5.33 (2H, s), 6.96-7.02 (2H, m), 7.15-7.17 (2H, m), 7.42
( 1H, s ) , 7 . 93 ( 1H, d, J=8 . 7 Hz ) , 8 . 07-8 .13 ( 1H, m) , 8 . 29 (
1H,
s ) , 12 . 08 ( 1H, br s ) .
Reference Example 97 methyl 4-[2-(1-
naphthatenyl)ethoxy]benzenepropanoate
The title compound was obtained from methyl 4-
hydroxybenzenepropanoate and 1-naphthalenethanol by a method
similar to that of Example 105. yield 63~.
io melting point: 112-114°C (recrystallized from ethyl
acetate-diisopropyl ether-hexane).
1H I~IR (CDC13) $ 2 .58 (2H, t, J=7. 5 Hz) , 2. 88 (2H, t, J=7.5 Hz) ,
3.57 (2H, t, J=7.4 Hz) , 3. 66 (3H, s) , 4.28 (2H, t, J=7.4 Hz) ,
6.82 (2H, t, J=8.6 Hz), 7.09 (2H, d, J=8.6 Hz), 7.42-7.56 (4H,
l5 m), 7.75-7.78 (1H, m), 7.86-7.89 (1H, m), 8.10-8.11 (1H, m).
Reference Example 98 4- [2- ( 1-
naphthalenyl)ethoxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[2-(1-
naphthalenyl)ethoxy]benzenepropanoate by a method similar to
2° that of Example 106. yield 890.
melting point: 111-112°C (recrystallized from ethyl
acetate-diisopropyl ether).
1H NMR (CDC13) g 2. 64 (2H, t, J=7.5 Hz) , 2. 89 (2rH, t, J=7.5 Hz) ,
3.57 (2H, t, J=7.4 Hz), 4.28 (2H, t, J=7.4 Hz), 6.83 (2H, t,
2s J=8.6 Hz), 7.10 (2H, d, J=8.6 Hz), 7.42-7.55 (4H, m), 7.73-
7.78 (1H, m), 7.86-7.89 (1H, m), 8.10-8.11 (1H, m), 9.85 (1H,
br s) .
Reference Example 99 methyl 4-hydroxy-3-iodobenzenepropanoate
and methyl 4-hydroxy-3,5-diiodobenzenepropanoate
30 2g$ Aqueous ammonia solution (10 mL) of methyl 4-
hydroxybenzenepropanoate (3.0 g, 17 mmol) was cooled with
water, and a mixture of iodine (4.7 g, 18 mmol), potassium
iodide (4.6 g, 28 mmol) and water (10 mL) was added dropwise.
The reaction mixture was stirred for 1.5 hrs, neutralized with
203
CA 02505322 2005-05-06
1N hydrochloric acid, and extracted with ethyl acetate. The
organic layer was washed with 1$ aqueous sodium thiosulfate
solution and saturated brine, and dried over anhydrous
magnesium sulfate. The solvent was evaporated, and the
residue was subjected to silica gel column chromatography to
give methyl 4-hydroxy-3,5-diiodobenzenepropanoate (3.0 g,
yield 59~) from the eluate of hexane/ethyl acetate=5:1.
melting point: 64-66°C (recrystallized from ethyl
acetate-petroleum ether).
io 1H I~IR (CDC13) g 2.57 (2H, t, J=7.5 Hz) , 2. 81 (2H, t, J=7.5 Hz) ,
3 . 68 ( 3H, s ) , 5 . 63 ( 1H, s ) , 7 . 52 ( 2H, s ) .
Further, methyl 4-hydroxy-3-iodobenzenepropanoate (1.6 g,
yield 22~) was obtained from the eluate of hexane/ethyl
acetate=5:1. oil.
I5 1H I~R (CDC13) g 2.58 (2H, t, J=7.5 Hz) , 2. 84 (2H, t, J=7.5 Hz) ,
3.67 (3H, s), 5.81 (1H, s), 6.86 (1H, d, J=8.3 Hz), 7.03-7.07
( 1H, m) , 7 . 50 ( 1H, s ) .
Reference Example 100 methyl 2-(4-methoxyphenyl)-7-iodo-5-
benzofuranpropanoate
2o A solution of methyl 4-hydroxy-3,5-
diiodobenzenepropanoate (0.89 g, 2.1 mmol) and 4-
methoxyethynylbenzenecopper (0.63 g) in N,N-dimethylformamide
(15 mL) was stirred overnight at 120°C. The solvent was
evaporated, and the residue was diluted with ethyl acetate,
25 and washed with water. The organic layer was dried over
anhydrous magnesium sulfate and concentrated. The residue was
purified by silica gel column chromatography (hexane/ethyl
acetate=6:1) to give the title compound (0.67 g, yield 740).
melting point: 103-104°C (recrystallized from ethyl
3o acetate-diisopropyl ether).
1H NMR (CDC13) g 2. 66 (2H, t, J=7.5 Hz) , 2. 99 (2H, t, J=7.5 Hz) ,
3. 68 (3H, s) , 3. 87 (3H, s) , 6.91 (1H, s) , 6. 98 (2H, d, J=8.8
Hz), 7.32 (1H, s), 7.44 (1H, s), 7.81 (2H, d, J=8.8 Hz).
Reference Example 101 methyl 2-(4-methoxyphenyl)-5-
204
CA 02505322 2005-05-06
benzofuranpropanoate
A mixture of methyl 2-(4-methoxyphenyl)-7-iodo-5-
benzofuranpropanoate (0.61 g, 1.4 mmol), zinc (0.92 g, 14
mmol), tetrahydrofuran (10 mL), methanol (30 mL) and 2N
hydrogen chloride-methanol solution (3.0 mL) was heated under
reflux overnight. The reaction mixture was filtered, and the
filtrate was concentrated. The residue was diluted with ethyl
acetate, washed with water, and dried over anhydrous magnesium
sulfate. After concentration under reduced pressure, and the
to residue was purified by silica gel column chromatography
(hexane/ethyl acetate=6:1) to give the title compound (0.11 g,
yield 26~).
melting point: 74-75°C (recrystallized from ethyl
acetate-diisopropyl ether).
s5 1H NMR (CDC13) g 2. 68 (2H, t, J=7.5 Hz) , 3.04 (2H, t, J=7.5 Hz) ,
3.67 (3H, s), 3.88 {3H, s), 6.88-6.91 (1H, m), 6.92 (1H, s),
7.10-7.13 (1H, m), 7.32-7.44 (5H, m).
Reference Example 102 2-(4-methoxyphenyl)-5-
benzofuranpropanoic acid
2o The title compound was obtained from methyl 2-(4-
methoxyphenyl)-5-benzofuranpropanoate by a method similar to
that of Example 106. yield 74~.
melting point: 211-212°C (recrystallized from ethyl
acetate-diisopropyl ether).
25 1H I~ll~IR (DMSO-d6) g 2. 58 (2H, t, J=7. 5 Hz) , 2. 91 (2H, t, J=7 .5
Hz ) , 3 . 82 ( 3H, s ) , 7 . 06 ( 2H, d, J=8 . 9 Hz ) , 7 .12-7 .16 ( 1H, m)
,
7.21 (1H, s) , 7. 44-7.50 (2H, m) , 7.84 (2H, d, J=8.8 Hz) , 12. 08
( 1H, br s ) .
Reference Example 103 methyl 2-(3-methoxyphenyl)-5-
3o benzofuranpropanoate
The title compound was obtained from methyl 4-hydroxy-3-
iodobenzenepropanoate and 3-methoxyethynylbenzenecopper by a
method similar to that of Reference Example 100. yield 190.
melting point: 74-75°C (recrystallized from ethyl
205
CA 02505322 2005-05-06
acetate-diisopropyl ether).
1H NMR (CDC13) g 2. 68 (2H, t, J=7.5 Hz) , 3.04 (2H, t, J=7.5 Hz) ,
3.67 (3H, s), 3.88 (3H, s), 6.88-6.91 (1H, m), 6.91 (1H, s),
7 .10-7 .13 ( 1H, m) , 7 . 32-7 . 44 (5H, m) .
Reference Example 104 2-(3-methoxyphenyl)-5-
benzofuranpropanoic acid
The title compound was obtained from methyl 2-(3-
methoxyphenyl)-5-benzofuranpropanoate by a method similar to
that of Example 106. yield 83$.
io melting point: 134-135°C (recrystallized from ethyl
acetate-diisopropyl ether).
1H NMR (DMSO-d6) g 2.58 (2H, t, J=7.5 Hz) , 2. 92 (2H, t, J=7.5
Hz), 3.85 (3H, s), 6.96-7.00 (1H, m), 7.17-7.21 (1H, m), 7.38-
7 . 54 ( 6H, m) , 12 .12 ( 1H, br s ) .
is Reference Example 105 4-methoxyethynylbenzenecopper
To an ice-cooled mixture of copper sulfate pentahydrate
(2.5 g, 10 mmol) , 28 o aqueous ammonia (10 mL) , water (100 mL)
and hydroxylamine hydrochloride (1.4 g, 20 mmol) was added a
solution of 4-methoxyethynylbenzene (1.3 g, 10 mmol) in
2o ethanol (60 mL), and the mixture was stirred for 5 min. The
precipitate was filtered, washed with water, ethanol and
diethyl ether and dried under reduced pressure to give the
title compound (1.8 g, yield 92$) as a yellow powder.
1H-NMR(DMSO-d6) g 3.77 (3H, s) , 6. 93 (2H, d, J=8.8 Hz) , 7.40
2s ( 2H, d, J=8 . 8 Hz ) .
Reference Example 106 3-methoxyethynylbenzenecopper
The title compound was obtained as a yellow powder from
3-methoxyethynylbenzene by a method similar to that of
Reference Example 105. yield 90$.
30 1H-NMR ( DMSO-d6 ) g 3 . 7 6 ( 3H, s ) , 6 . 97-7 . 07 ( 3H, m) , 7 . 3 0 (
1H, t,
J=8.1 Hz).
Reference Example 107 methyl 4-[[3-(3-
furyl)phenyl]methoxy]benzenepropanoate
The title compound was obtained from 3-furylboronic acid
206
CA 02505322 2005-05-06
by a method similar to that of Example 22. yield 83$, oil.
1H I~iR (CDC13) g 2. 60 (2H, t, J=8.0 Hz) , 2. 90 (2H, t, J=8. 0 Hz) ,
3.66 (3H, s), 5.06 (2H, s), 6.71 (1H, dd, J=1.8 Hz, 0.7 Hz),
6.92 (2H, d, J=8.7 Hz) , 7.12 (2H, t, J=8.7 Hz) , 7.31-7.48 (4H,
m) , 7 . 54 ( 1H, s ) , 7 . 74-7 . 75 ( 1H, m) .
Reference Example 108 4-[[3-(3-
furyl)phenyl]methoxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[[3-(3-
furyl)phenyl]methoxy]benzenepropanoate by a method similar to
to that of Reference Example 4. yield 26$.
melting point: 120-122~C (recrystallized from ethyl acetate-
hexane) .
1H NMR (CDC13) $ 2. 65 (2H, t, J=8.0 Hz) , 2. 91 (2H, t, J=8.0 Hz) ,
5.06 (2H, s) , 6. 70-6.71 (1H, m) , 6. 92 (2H, t, J=8. 6 Hz) , 7.13
15 (2H, d, J=8. 6 Hz) , 7.30-7.48 (4H, m) , 7. 54 ( 1H, s) , 7.74 (1H,
s) .
Reference Example 109 methyl 4-[[3-(1H-pyrrol-1-
yl)phenyl]methoxy]benzenepropanoate
Methyl 4-[(3-bromophenyl)methoxy]benzenepropanoate (0.80
2o g, 2.3 mmol), pyrrole (0.17 g, 2.5 mmol), tri-tert-
butylphosphine (19 mg, 0.092 mmol) and cesium carbonate (1.3 g,
3.9 mmol) were dissolved in toluene (25 mL) and, after argon
substitution, tris(dibenzylidenacetone)dipalladium(0) (84 mg,
0.092 mmol) was added. The reaction mixture was heated under
2s an argon atmosphere at 100~C for 18 hrs. The reaction mixture
was cooled, water was added to the reaction mixture and the
mixture was extracted with ethyl acetate. The extract was
washed with water, dried and concentrated. The residue was
purified by silica gel column chromatography (ethyl
3o acetate/hexane=15:1) to give the title compound (56 mg, yield
7$) as a yellow powder.
1H NMR ( CDC13 ) $ 2 . 60 ( 2H, t, J=8 .1 Hz ) , 2 . 90 ( 2H, t, J=8 .1 Hz ) ,
3.66 (3H, s) , 5.08 (2H, s) , 6.35 (2H, t, J=2.2 Hz) , 6.91 (2H,
d, J=8.6 Hz), 7.09-7.15 (4H, m), 7.24-7.36 (4H, m).
207
CA 02505322 2005-05-06
Reference Example 110 4-[[3-(1H-pyrrol-1-
yl)phenyl]methoxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[[3-(1H-
pyrrol-1-yl)phenyl]methoxy]benzenepropanoate by a method
s similar to that of Reference Example 4. yield 16~.
melting point: 120-122°C (recrystallized from diisopropyl
ether-hexane).
1H NMR (CDC13) g 2. 65 (2H, t, J=7.9 Hz) , 2. 91 (2H, t, J=7.9 Hz) ,
. 08 ( 2H, s ) , 6 . 35 ( 2H, t, J=2 . 1 Hz ) , 6 . 91 ( 2H, d, J=8 . 6 Hz ) ,
7.10 (2H, t, J=2.1 Hz) , 7.14 (2H, d, J=8.6 Hz) , 7.26-7. 47 (4H,
m) .
Reference Example 111 methyl 4-[[3-(2-
thiazolyl)phenyl]methoxy]benzenepropanoate
The title compound was obtained from 2-bromothiazole by a
is method similar to that of Reference Example 61. yield 380,
oil.
1H NMR (CDC13) g 2. 60 (2H, t, J=8.1 Hz) , 2. 90 (2H, t, J=8.1 Hz) ,
3.66 (3H, s), 5.10 (2H, s), 6.92 (2H, d, J=8.6 Hz), 7.12 (2H,
d, J=8 . 6 Hz ) , 7 . 35 ( 1H, d, J=3 . 3 Hz ) , 7 . 4 3-7 . 52 ( 2H, m) , 7 .
8 8
( 1H, d, J=3 . 3 Hz ) , 7 . 91 ( 1H, dt, J=7 . 2 Hz, 1. 7 Hz ) , 8 . 05 ( 1H,
s) .
Reference Example 112 4-[[3-(2-
thiazolyl)phenyl]methoxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[[3-(2-
2s thiazolyl)phenyl]methoxy]benzenepropanoate by a method similar
to that of Reference Example 4. yield 81°s.
melting point: 126-127°C (recrystallized from ethyl acetate-
hexane ) .
1H NMR ( CDC13 ) g 2 . 65 ( 2H, t, J=8 . 0 Hz ) , 2 . 91 ( 2H, t, J=8 . 0 Hz )
,
so 5 .10 ( 2H, s ) , 6 . 93 ( 2H, d, J=8 . 6 Hz ) , 7 .14 ( 2H, d, J=8 . 6 Hz
) ,
7.35 (1H, d, J=3.3 Hz), 7.43-7.52 (2H, m), 7.88-7.92 (2H, m),
8.04 (1H, s).
Reference Example 113 methyl 4-[[3-(2-
pyrazinyl)phenyl)methoxy]benzenepropanoate
208
CA 02505322 2005-05-06
The title compound was obtained from iodopyrazine by a
method similar to that of Reference Example 61. yield 540,
oil.
1H NMR (CDC13) $ 2. 60 (2H, t, J=8.0 Hz) , 2. 90 (2H, t, J=8.0 Hz) ,
3.66 (3H, s), 5.14 (2H, s), 6.93 (2H, d, J=8.6 Hz), 7.13 (2H,
d, J=8.6 Hz), 7.51-7.55 (2H, m), 7.95-7.99 (1H, m), 8.10 (1H,
s ) , 8 . 53 ( 1H, d, J=2 . 5 Hz ) , 8 . 64-8 . 67 ( 1H, m) , 9 . 05 ( 1H, d,
J=1.4 Hz).
Reference Example 114 4-[[3-(2-
Io pyrazinyl)phenyl]methoxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[[3-(2-
pyrazinyl)phenyl]methoxy]benzenepropanoate by a method similar
to that of Reference Example 4. yield 620.
melting point: 167.0-167.5°C (recrystallized from ethyl
1$ acetate-hexane).
1H I~IR (CDC13+DMSO-d6) $ 2.26 (2H, t, J=8.2 Hz) , 2. 90 (2H, t,
J=8 . 2 Hz ) , 5 .14 ( 2H, s ) , 6 . 92 ( 2H, d, J=8 . 6 Hz ) , 7 .15 ( 2H, d,
J=8.6 Hz), 7.51-7.58 (2H, m), 7.94-7.99 (1H, m), 8.10 (1H, s),
8.53 (1H, d, J=2.5 Hz), 8.65 (1H, dd, J=2.4 Hz, 1.6 Hz), 9.05
20 (1H, d, J=1.5 Hz).
Reference Example 115 methyl 4-[(5-bromo-2-
chlorophenyl)methoxy]benzenepropanoate
The title compound was obtained from 3-broino-2-
chlorobenzyl alcohol by a method similar to that of Reference
2s Example 1. yield 54~, oil.
1H NMR ( CDC13 ) g 2 . 61 ( 2H, t, J=8 .1 Hz ) , 2 . 91 ( 2H, t, J=8 .1 Hz ) ,
3. 69 (3H, s) , 5.09 (2H, s) , 6.91 (2H, d, J=8. 6 Hz) , 7.14 (2H,
d, J=8.6 Hz), 7.24-7.27 (1H, m), 7.38 (1H, dd, J=8.5 Hz, 2.3
Hz), 7.73 (1H, d, J=2.3 Hz) .
so Reference Example 116 4-[(5-bromo-2-
chlorophenyl)methoxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[(5-bromo-
2-chlorophenyl)methoxy]benzenepropanoate by a method similar
to that of Reference Example 4. yield 66~, yield 81$.
209
CA 02505322 2005-05-06
melting point: 120.0-120.5°C (recrystallized from ethyl
acetate-hexane).
1H NMR ( CDC13 ) g 2 . 66 ( 2H, t, J=7 . 8 Hz ) , 2 . 92 ( 2H, t, J=7 . 8 Hz )
,
5.09 (2H, s) , 6. 92 (2H, d, J=8. 6 Hz) , 7.16 (2H, d, J=8. 6 Hz) ,
7.24-7.27 (1H, m), 7.38 (1H, dd, J=8.5 Hz, 2.3 Hz), 7.73 (1H,
d, J=2 . 3 Hz ) .
Reference Example 117 methyl 4-[(3-bromo-4-
chlorophenyl)methoxy]benzenepropanoate
The title compound was obtained from 3-bromo-4-
io chlorobenzyl alcohol by a method similar to that of Reference
Example 1. yield 65~, oil.
1H I~IR (CDC13) g 2. 60 (2H, t, J=7. 6 Hz) , 2. 89 (2H, t, J=7. 6 Hz) ,
3.66 (3H, s), 5.04 (2H, s), 6.85-6.89 (2H, m), 7.10-7.13 (2H,
m) , 7.35 (3H, s) .
15 Reference Example 118 4-[(3-bromo-4-
chlorophenyl)methoxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[(3-bromo-
4-chlorophenyl)methoxy]benzenepropanoate by a method similar
to that of Reference Example 4. yield 810, yield 81$.
2° melting point: 156-158°C (recrystallized from ethyl acetate-
hexane).
1H I~IMR ( CDC13 ) g 2 . 65 ( 2H, t, J=7 . 9 Hz ) , 2 . 90 ( 2H, t, J=7 . 9 Hz
) ,
5.00 (2H, s) , 6.88 (2H, d, J=8. 6 Hz) , 7.13 (2H, rd, J=8. 6 Hz) ,
7.35 (3H, s) .
2s Reference Example 119 methyl 4-[[3-[5-(trifluoromethyl)-2-
pyridinyl]phenyl]methoxy]benzenepropanoate
The title compound was obtained from 2-chloro-5-
(trifluoromethyl)pyridine by a method similar to that of
Reference Example 61. yield 41°s, oil.
so 1H NMR ( CDC13 ) g 2 . 61 ( 2H, t, J=8 . 0 Hz ) , 2 . 90 ( 2H, t, J=8 . 0
Hz ) ,
3 . 6 6 ( 3H, s ) , 5 .14 ( 2H, s ) , 6 . 93 ( 2H, d, J=8 . 6 Hz ) , 7 .13 (
2H,
d, J=8.6 Hz), 7.50-7.60 (2H, m), 7.86 (1H, d, J=8.3 Hz), 7.97-
8.01 (2H, m) , 8.11 ( 1H, br s) , 8. 95 (1H, br s) .
Reference Example 120 4-[[3-[5-(trifluoromethyl)-2-
210
CA 02505322 2005-05-06
pyridinyl]phenyl]methoxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[[3-[5-
(trifluoromethyl)-2-pyridinyl]phenyl]methoxy]benzenepropanoate
by a method similar to that of Reference Example 4. yield 32%.
melting point: 155-156°C (recrystallized from ethyl acetate-
hexane ) .
1H NMR (CDC13) $ 2. 64 (2H, t, J=7.7 Hz) , 2. 90 (2H, t, J=7.7 Hz) ,
.12 ( 2H, s ) , 6 . 92 ( 2H, d, J=8 . 4 Hz ) , 7 . 13 ( 2H, d, J=8 . 4 Hz ) ,
7.49-7.54 (2H, m), 7.85 (1H, d, J=8.3 Hz), 7.90-8.00 (2H, m),
1° 8.10 (1H, s), 8.95 (1H, s).
Reference Example 121 methyl 4-[[2-methyl-5-[4-
(trifluoromethyl)phenyl]-3-furyl]methoxy]benzenepropanoate
The title compound was obtained from 2-methyl-5-[4-
(trifluoromethyl)phenyl]-3-furanmethanol by a method similar
to that of Reference Example 1. yield 740, oil.
1H 1~IMR (CDC13) g 2. 40 (3H, s) , 2. 61 (2H, t, J=8 .0 Hz) , 2. 91 (2H,
t, J=8 . 0 Hz ) , 3 . 67 ( 3H, s ) , 4 . 8 5 ( 2H, s ) , 6 . 7 8 ( 1H, s ) , 6
. 90
( 2H, d, J=8 . 6 Hz ) , 7 .14 ( 2H, d, J=8 . 6 Hz ) , 7 . 60 ( 2H, d, J=8 . 4
Hz ) , 7 . 71 ( 2H, d, J=8 . 4 Hz ) .
2o Reference Example 122 4-[[2-methyl-5-[4-
(trifluoromethyl)phenyl]-3-furyl]methoxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[[2-methyl-
5-[4-(trifluoromethyl)phenyl]-3-
furyl]methoxy]benzenepropanoate by a method similar to that of
2s Reference Example 4. yield 53~.
melting point: 182-183°C (recrystallized from ethyl acetate-
hexane ) .
1H NMR (CDC13) g 2.40 (3H, s), 2.66 (2H, t, J=7.8 Hz), 2.92 (2H,
t, J=7. 8 Hz) , 4. 85 (2H, s) , 6.78 (1H, s) , 6. 91 (2H, d, J=8. 6
3o Hz) , 7.15 (2H, d, J=8. 6 Hz) , 7. 60 (2H, d, J=8.4 Hz) , 7. 71 (2H,
d, J=8 . 4 Hz ) .
Reference Example 123 4-[[5-(2,6-dimethylphenyl)-2-
thienyl]methoxy]benzenepropanoic acid
Methyl 4-[[5-(2,6-dimethylphenyl)-2-
211
CA 02505322 2005-05-06
thienyl]methoxy]benzenepropanoate was obtained from methyl 4-
[(5-bromo-2-thienyl)methoxy]benzenepropanoate and 2,6-
dimethylphenylboronic acid by a method similar to that of
Example 22. yield 830. Then, the title compound was obtained
from methyl 4-[[5-(2,6-dimethylphenyl)-2-
thienyl]methoxy]benzenepropanoate by a method similar to that
of Reference Example 4. yield 26~.
melting point: 120-121°C (recrystallized from ethyl acetate-
hexane) .
1H I~IR (CDC13) g 2.17 ( 6H, s) , 2. 65 (2H, t, J=7.7 Hz) , 2. 91 (2H,
t, J=7.7 Hz), 5.20 (2H, s), 6.70 (1H, d, J=3.4 Hz), 6.94 (2H,
d, J=8.5 Hz), 7.08-7.20 (6H, m).
Reference Example 124 4-[[3-(2-
pyridinyloxy)phenyl]methoxy]benzenepropanoic acid
Methyl 4-[[3-(2-
pyridinyloxy)phenyl]methoxy]benzenepropanoate was obtained
from methyl 4-hydroxybenzenepropanoate and 3-(2-
pyridinyloxy)benzenemethanol by a method similar to that of
Reference Example 1. yield 77~. Farther, the title compound
2o was obtained from methyl 4-[[3-(2-
pyridinyloxy)phenyl]methoxy]benzenepropanoate by a method
similar to that of Reference Example 4. yield 55~.
melting point: 146-147 (recrystallized from ethyl acetate-
hexane) .
1H NMR (CDC13+DMSO-d6) g 2.57 (2H, t, J=7.5 Hz) , 2. 89 (2H, t,
J=7.5 Hz) , 5.05 (2H, s) , 6. 86-6.92 (3H, m) , 6. 99-7.14 (4H, m) ,
7.21-7.26 (2H, m), 7.40 (1H, t, J=7.8 Hz), 7.67-7.72 (1H, m),
8.19 (1H, d, J=4.3 Hz) .
Reference Example 125 methyl 4-[[4-
(bromomethyl)phenyl]methoxy]benzenepropanoate
a. . oc' -Dibromo-p-xylene ( 11 g, 40 mmol ) , methyl 4-
hydroxybenzenepropanoate (1.7 g, 10 mmol) and potassium
carbonate (1.6 g, 12 mmol) were dissolved in acetone (200 mL),
and the mixture was heated under reflux for 8 hrs. The
212
CA 02505322 2005-05-06
reaction mixture was cooled, water was added to the reaction
mixture and extracted with ethyl acetate and tetrahydrofuran.
The extract was washed with water, dried and concentrated.
The residue was purified by silica gel column chromatography
(ethyl acetate/hexane=18:1) to give the title compound (0.78 g,
yield 21~) as a white powder.
1H 1~~IR ( CDC13 ) g 2 . 60 ( 2H, t, J=8 . 0 Hz ) , 2 . 8 9 ( 2H, t, J=8 . 0
Hz ) ,
3. 66 (3H, s) , 4. 50 (2H, s) , 5.03 (2H, s) , 6. 86-6. 91 (2H, m) ,
7.11 (2H, d, J=8.6 Hz), 7.40 (4H, m).
.to Reference Example 126 methyl 3-bromo-4-
hydroxybenzenepropanoate
To a solution of methyl 4-hydroxybenzenepropanoate (1.0 g,
5.6 mmol) in acetic acid (10 mL) was added sodium acetate
(0.46 g, 6.1 mmol), and bromine (0.89 g, 5.6 mmol) was added
15 dropwise while cooling to prevent heat of the reaction mixture.
The mixture was stirred at room temperature for 30 min.,
water was added, and the mixture was extracted with ethyl
acetate. The extract was washed with water and concentrated
under reduced pressure. The residue was purified by silica
2° gel column chromatography (hexane/ethyl acetate=9:1) to give
the title compound (0.68 g, yield 470). oil.
1H I~IR (CDC13) g 2.59 (2H, t, J=7.5 Hz) , 2. 86 (2H, t, J=7.5 Hz) ,
3 . 67 ( 3H, s ) , 5 . 45 ( 1H, s ) , 6 . 93 ( 1H, d, J=8 . 3 Hz ) , 7 . 04 (
1H,
dd, J=1 . 9 Hz, 8 . 3 Hz ) , 7 . 30 ( 1H, d, J=1. 9 Hz ) .
25 Reference Example 127 methyl 4-(6-
benzothiazolylmethoxy)benzenepropanoate
The title compound was obtained from methyl 4-
hydroxybenzenepropanoate and 6-benzothiazolemethanol by a
method similar to that of Example 105. yield 66~.
3o melting point: 103-106~C (recrystallized from ethyl acetate-
diisopropyl ether-hexane).
1H NMR (CDC13) g 2. 60 (2H, t, J=7 .5 Hz) , 2. 90 (2H, t, J=7.5 Hz) ,
3. 66 (3H, s) , 5.20 (2H, s) , 6. 92 (2H, d, J=8.7 Hz) , 7.12 (2H,
d, J=8 . 7 Hz ) , 7 . 55-7 . 58 ( 1H, m) , 8 . 05 ( 1H, s ) , 8 . 13 ( 1H, d,
213
CA 02505322 2005-05-06
J=8.4 Hz), 9.00 (1H, s).
Reference Example 128 4-(6-
benzothiazolylmethoxy)benzenepropanoic acid
The title compound was obtained from methyl 4-(6-
benzothiazolylmethoxy)benzenepropanoate by a method similar to
that of Example 105. yield 88~.
melting point: 176-177°C (recrystallized from ethyl
acetate-diisopropyl ether).
1H I~IR (DMSO-d6) $ 2.48 (2H, t, J=7.5 Hz) , 2.75 (2H, t, J=7.5
i o Hz ) , 5 . 22 ( 2H, s ) , 6 . 95 ( 2H, d, J=8 . 7 Hz ) , 7 .14 ( 2H, d,
J=8 . 6
Hz) , 7.59-7.63 (1H, m) , 8.10 (1H, d, J=8.4 Hz) , 8.24 (1H, s) ,
9.40 (1H, s), 12.08 (1H, br s).
Example 1 4-[(2,3-dihydro-1H-inden-1-yl)oxy]benzenepropanoic
acid
is The title compound was obtained from methyl 4-[(2,3-
dihydro-1H-inden-1-yl)oxy]benzenepropanoate by a method
similar to that of Reference Example 4. yield 33~.
melting point: 103-104°C (recrystallized from ethyl acetate-
hexane ) .
20 1H NMR ( CDC13) g 2 .14-2 . 38 ( 1H, m) , 2 . 50-2 . 63 ( 1H, m) , 2 . 67 (
2H,
t, J=7.4 Hz), 2.87-2.96 (3H, m), 3.08-3.19 (1H, m), 5.73 (1H,
dd, J=4 . 9 Hz, 6 . 5 Hz ) , 6 . 94 ( 2H, d, J=8 . 5 Hz ) , 7 .15 ( 2H, d,
J=8.5 Hz), 7.21-7.33 (3H, m), 7.42 (1H, d, J=7.~ Hz).
Example 2 4-[(1,2,3,4-tetrahydronaphthalen-1-
2s yl)oxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[(1,2,3,4-
tetrahydronaphthalen-1-yl)oxy]benzenepropanoate by a method
similar to that of Reference Example 4. yield 51$.
melting point: 69-70°C (recrystallized from diisopropyl ether-
3o hexane) .
1H I~IR (CDC13) g 1.70-1.85 (1H, m), 1.98-2.16 (3H, m), 2.74-
2.89 (2H, m), 2.67 (2H, t, J=7.4 Hz), 2.93 (2H, t, J=7.4 Hz),
5.33 (1H, t, J=4.1 Hz), 6.96 (2H, d, J=8.6 Hz), 7.14-7.24 (5H,
m), 7.36-7.39 (1H, m).
214
CA 02505322 2005-05-06
Example 3 4-[[2,3-dihydro-5-(phenylmethoxy)-1H-inden-1-
yl]oxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[[2,3-
dihydro-5-(phenylmethoxy)-1H-inden-1-yl]oxy]benzenepropanoate
by a method similar to that of Reference Example 4. yield 330.
melting point: 99-100~C (recrystallized from ethyl acetate-
hexane ) .
1H NMR (CDC13) g 2.15-2.30 (1H, m), 2.45-2.60 (1H, m), 2.67 (2H,
t, J=7.8 Hz), 2.82-2.90 (1H, m), 2.92 (2H, t, J=7.8 Hz), 3.06-
1 ° 3 .14 ( 1H, m) , 5 . 07 ( 2H, s ) , 5 . 67 ( 1H, dd, J=6 . 5, 3 . 6
Hz ) ,
6.85-6.93 (4H, m), 7.14 (2H, d, J=8.5 Hz), 7.30-7.44 (6H, m).
Example 4 4-[[4-[[methyl(4-phenyl-2-
thiazolyl)amino]methyl]phenyl)methoxy]benzenepropanoic acid
The title compound was obtained from ethyl 4-[[4-
15 [[methyl(4-phenyl-2-
thiazolyl)amino]methyl]phenyl]methoxy]benzenepropanoate by a
method similar to that of Reference Example 4. yield 600.
melting point: 130-131°C (recrystallized from ethyl acetate-
hexane ) .
20 1H NMR ( CDC13 ) g 2 . 64 ( 2H, t, J=7 . 9 Hz ) , 2 . 90 ( 2H, t, J=7 . 9
Hz ) ,
3.07 (3H, s) , 4.78 (2H, s) , 5.02 (2H, s) , 6.72 (1H, s) , 6.89
( 2H, d, J=8 . 6 Hz ) , 7 .12 ( 2H, d, J=8 . 6 Hz ) , 7 . 2 6-7 . 3 0 ( 1H, m)
,
7.34-7.41 (6H, m), 7.85-7.88 (2H, m). '
Example 5 4-[(4-phenoxyphenyl)methoxy]benzenepropanoic acid
2s The title compound was obtained from methyl 4-[(4-
phenoxyphenyl)methoxy]benzenepropanoate by a method similar to
that of Reference Example 4. yield 510.
melting point: 144-145°C (recrystallized from ethyl acetate-
hexane ) .
30 1H NMR (CDC13) g 2. 65 (2H, t, J=7.9 Hz) , 2. 91 (2H, t, J=7.9 Hz) ,
5.00 (2H, s) , 6. 91 (2H, d, J=8. 6 Hz) , 7. 00-7.03 (4H, m) , 7.08-
7.15 (3H, m) , 7. 34 (2H, t, J=8. 3 Hz) , 7.39 (2H, d, J=8. 6 Hz) .
Example 6 4-[[4-(phenylmethoxy)phenyl]methoxy]benzenepropanoic
acid
215
CA 02505322 2005-05-06
The title compound was obtained as a powder from methyl
4-[[4-(phenylmethoxy)phenyl]methoxy]benzenepropanoate by a
method similar to that of Reference Example 4. yield llg.
1H NMR ( CDC13 ) g 2 . 65 ( 2H, t, J=7 . 9 Hz ) , 2 . 90 ( 2H, t, J=7 . 9 Hz )
,
4.96 (2H, s) , 5.07 (2H, s) , 6.90 (2H, d, J=8. 6 Hz) , 6.98 (2H,
d, J=8 . 6 Hz ) 7 .12 ( 2H, d, J=8 . 6 Hz ) , 7 . 30-7 . 50 ( 7H, m) .
Example 7 4-([1,1'-biphenyl]-4-ylmethoxy)benzenepropanoic acid
Methyl 4-([1,1'-biphenyl]-4-ylmethoxy)benzenepropanoate
was obtained from methyl 4-hydroxybenzenepropanoate and 4-
io phenylbenzyl bromide by a method similar to that of Reference
Example 5. This was led to the title compound by a method
similar to that of Reference Example 4. yield from methyl 4-
hydroxybenzenepropanoate 11~.
melting point: 187-189°C (recrystallized from tetrahydrofuran-
Is hexane) .
1H NMR (CDC13) $ 2. 66 (2H, t, J=7.7 Hz) , 2.91 (2H, t, J=7.7 Hz) ,
. 08 ( 2H, s ) , 6 . 93 ( 2H, d, J=8 . 4 Hz ) , 7 .14 ( 2H, d, J=8 . 4 Hz ) ,
7.30-7.50 (5H, m), 7.50-7.60 (4H, m).
Example 8 4-([1,1'-biphenyl]-3-ylmethoxy)benzenepropanoic acid
2o The title compound was obtained from methyl 4-([1,1'-
biphenyl]-3-ylmethoxy)benzenepropanoate by a method similar to
that of Reference Example 4. yield 48~.
r
melting point: 125-126°C (recrystallized from ethyl acetate-
hexane ) .
25 1H NMR (CDC13) $ 2. 65 (2H, t, J=7.9 Hz) , 2. 91 (2H, t, J=7.9 Hz) ,
5.10 (2H, s), 6.93 (2H, d, J=8.6 Hz), 7.13 (2H, d, J=8.6 Hz),
7.30-7.47 (5H, m), 7.50-7.61 (3H, m), 7.65 (1H, s).
Example 9 4-[(3-phenoxyphenyl)methoxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[(3-
3o phenoxyphenyl)methoxy]benzenepropanoate by a method similar to
that of Reference Example 4. yield 50~.
melting point: 94-95°C (recrystallized from ethyl acetate-
hexane ) .
1H NMR (CDC13) g 2 . 64 (2H, t, J=7. 9 Hz) , 2.90 (2H, t, J=7.9 Hz) ,
216
CA 02505322 2005-05-06
5.01 (2H, s), 6.86-6.90 (2H, m), 6.88-6.98 (1H, m), 7.00-7.03
(2H, m), 7.08-7.17 (5H, m), 7.30-7.36 (3H, m).
Example 10 4-([l,1'-biphenyl]-2-ylmethoxy)benzenepropanoic
acid
s The title compound was obtained from methyl 4-([1,1'-
biphenyl]-2-ylmethoxy)benzenepropanoate by a method similar to
that of Reference Example 4. yield 45~.
melting point: 103-104°C (recrystallized from ethyl acetate-
hexane ) .
io 1H 1~IR (CDC13) g 2. 63 (2H, t, J=7.9 Hz) , 2.88 (2H, t, J=7.9 Hz) ,
4.91 (2H, s), 6.79 (2H, d, J=8.6 Hz), 7.08 (2H, d, J=8.6 Hz),
7.33-7.50 (8H, m), 7.60-7.70 (1H, m).
Example 11 4-[(2-phenoxyphenyl)methoxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[(2
is phenoxyphenyl)methoxy]benzenepropanoate by a method similar to
that of Reference Example 4. yield 45%.
melting point: 114-115°C (recrystallized from ethyl acetate-
hexane ) .
1H NMR (CDC13) g 2. 63 (2H, t, J=7.9 Hz) , 2. 89 (2H, t, J=7.9 Hz) ,
20 5.13 (2H, s) , 6. 86-6.92 (3H, m) , 6.95-7. 00 (2H, m) , 7.06-7.12
(3H, m), 7.16 (1H, dd, J=7.5 Hz, 1.0 Hz), 7.24-7.36 (3H, m),
7.58 (1H, dd, J=7.5 Hz, 1.4 Hz) .
Example 12 4-[(4-benzoylphenyl)methoxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[(4
2s benzoylphenyl)methoxy]benzenepropanoate by a method similar to
that of Reference Example 4. yield 840.
melting point: 141-142°C (recrystallized from ethyl acetate-
hexane ) .
1H NMR (CDC13) g 2. 66 (2H, t, J=8 .0 Hz) , 2. 92 (2H, t, J=8.0 Hz) ,
30 5 .14 ( 2H, s ) , 6 . 92 ( 2H, d, J=8 . 6 Hz ) , 7 .15 ( 2H, d, J=8 . 6 Hz
) ,
7.42-7.65 (5H, m), 7.79-7.84 (4H, m).
Example 13 4-[[4-(4-
chlorobenzoyl)phenyl]methoxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[[4-(4
217
CA 02505322 2005-05-06
chlorobenzoyl)phenyl]methoxy]benzenepropanoate by a method
similar to that of Reference Example 4. yield 90~.
melting point: 177-178°C (recrystallized from ethyl acetate-
hexane ) .
1H NMR (CDC13) g 2. 66 (2H, t, J=7.9 Hz) , 2. 92 (2H, t, J=7.9 Hz) ,
5 .14 ( 2H, s ) , 6 . 91 ( 2H, d, J=8 . 6 Hz ) , 7 . 15 ( 2H, d, J=8 . 6 Hz )
,
7.46 (2H, d, J=8.5 Hz) , 7.55 (2H, d, J=8.2 Hz) , 7.74-7. 81 (4H,
m) .
Example 14 4-[(3-benzoylphenyl)methoxy]benzenepropanoic acid
io Methyl 4-[(3-benzoylphenyl)methoxy]benzenepropanoate was
obtained from methyl 4-hydroxybenzenepropanoate and 3-
(bromomethyl)benzophenone by a method similar to that of
Reference Example 43. Then, the title compound was obtained
from methyl 4-[(3-benzoylphenyl)methoxy]benzenepropanoate by a
is method similar to that of Reference Example 4. yield from
methyl 4-hydroxybenzenepropanoate 730.
melting point: 84-85°C (recrystallized from ethyl acetate-
hexane ) .
1H NMR (CDC13) g2. 65 (2H, t, J=8 . 0 Hz) , 2 . 91 (2H, t, J=8 . 0 Hz) ,
20 5 .11 ( 2H, s ) , 6 . 90 ( 2H, d, J=8 . 6 Hz ) , 7 .13 ( 2H, d, J=8 . 6 Hz
) ,
7.45-7.86 (9H, m).
Example 15 4-[[4-(benzoylamino)phenyl]methoxy]benzenepropanoic
acid
The title compound was obtained from methyl 4-[[4-
25 (benzoylamino)phenyl]methoxy]benzenepropanoate by a method
similar to that of Reference Example 38. yield 42~.
melting point: 204-205°C (recrystallized from tetrahydrofuran-
hexane ) .
1H NMR (CDC13+DMSO-d6) g 2.57 (2H, t, J=8. 1 Hz) , 2. 89 (2H, t,
3o J=g .1 Hz ) , 5 . 02 ( 2H, s ) , 6 . 8 9 ( 2H, d, J=8 . 6 Hz ) , 7 . 13 (
2H, d,
J=8.6 Hz), 7.40-7.60 (5H, m), 7.76 (2H, d, J=8.5 Hz), 7.96-
7.93 (2H, m), 9.04 (1H, s).
Example 16 methyl 4-[(4-
phenoxyphenyl)methoxy]benzenepropanoate
218
CA 02505322 2005-05-06
The title compound was obtained as a white powder from
methyl 4-hydroxybenzenepropanoate and 4-phenoxybenzyl alcohol
by a method similar to that of Reference Example 1. yield 92%.
1H NMR (CDC13) g 2. 60 (2H, t, J=8.0 Hz) , 2. 90 (2H, t, J=8.0 Hz) ,
3. 67 (3H, s) , 5. 00 (2H, s) , 6.90 (2H, d, J=8.5 Hz) , 6.97-7.03
( 4H, m) , 7 . 08-7 . 13 ( 3H, m) , 7 . 34 ( 1H, t, J=7 . 8 Hz ) , 7 . 39 (
2H,
d, J=8.5 Hz).
Example 17 methyl 4-[[4-
(phenylmethoxy)phenyl]methoxy]benzenepropanoate
to The title compound was obtained from methyl 4-
hydroxybenzenepropanoate and 4-(benzyloxy)benzyl alcohol by a
method similar to that of Reference Example 1. yield 27%, oil.
1H NMR (CDC13) g 2.59 (2H, t, J=8.0 Hz) , 2.89 (2H, t, J=8.0 Hz) ,
3. 66 (3H, s) , 4. 96 (2H, s) , 5.07 (2H, s) , 6. 89 (2H, d, J=8.5
1s Hz) , 6. 98 (2H, d, J=8.5 Hz) 7.11 (2H, d, J=8.5 Hz) , 7.26-7.44
( 7H, m) .
Example 18 methyl 4-[(2,3-dihydro-1H-inden-1-
yl)oxy]benzenepropanoate
The title compound was obtained from methyl 4-
2o hydroxybenzenepropanoate and 2,3-dihydro-1H-inden-1-of by a
method similar to that of Reference Example 1. yield 62%, oil.
1H NMR (CDC13) $ 2.15-2.28 (1H, m) , 2.51-2. 68 (3H, m) , 2.79-
2 . 95 ( 3H, m) , 3 . 07-3 . 23 ( 1H, m) , 3 . 69 ( 3H, s ) , ~ . 73 ( 1H, dd,
J=4 . 4 Hz, 4 . 8 Hz ) , 6 . 94 ( 2H, d, J=8 . 6 Hz ) , 7 .14 ( 2H, d, J=8 . 6
25 Hz ) , 7 . 22-7 . 31 ( 3H, m) , 7 . 42 ( 1H, d, J=7 . 2 Hz ) .
Example 19 methyl 4-[(1,2,3,4-tetrahydronaphthalen-1-
yl)oxy]benzenepropanoate
The title compound was obtained as a white powder from
methyl 4-hydroxybenzenepropanoate and 1,2,3,4-tetrahydro-1
3o naphthol by a method similar to that of Reference Example 1.
yield 63%.
1H NMR (CDC13) g 1.70-1.75 (1H, m) , 1. 98-2.16 (3H, m) , 2. 62 (2H,
t, J=8.2 Hz) , 2.77-2. 87 (2H, m) , 2.92 (2H, t, J=8.2 Hz) , 3. 68
(3H, s), 5.23 (1H, t, J=4.2 Hz), 6.95 (2H, d, J=8.6 Hz), 7.11-
219
CA 02505322 2005-05-06
7 .16 ( 3H, m) , 7 . 21 ( 2H, dt, J=2 . 2 Hz, 6 . 8 Hz ) 7 . 38-7 . 36 ( 1H,
m) .
Example 20 methyl 4-[(3'-formyl-[1,1'-biphenyl]-3-
yl)methoxy]benzenepropanoate
The title compound was obtained from methyl 4-[(3-
bromophenyl)methoxy]benzenepropanoate by a method similar to
that of Example 22. yield 92~, oil.
1H T~IR (CDC13) g 2. 60 (2H, t, J=7.1 Hz) , 2. 90 (2H, t, J=7.1 Hz) ,
3.66 (3H, s), 5.11 (2H, s), 6.93 (2H, d, J=8.6 Hz), 7.13 (2H,
io d, J=8.6 Hz), 7.43-7.53 (2H, m), 7.55-7.67 (2H, m), 7.69 (1H,
s) , 7.85-7. 88 (2H, m) , 8.11-8.12 (1H, m) , 10.10 (1H, s) .
Example 21 4-[(3'-formyl-[1,1'-biphenyl]-3-
yl)methoxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[(3'-
is formyl-[l,1'-biphenyl]-3-yl)methoxy]benzenepropanoate by a
method similar to that of Reference Example 4. yield 83~.
melting point: 81-82°C (recrystallized from ethyl acetate-
hexane ) .
1H NNlR (CDC13) g 2. 66 (2H, t, J=7.5 Hz) , 2. 91 (2H, t, J=7.5 Hz) ,
20 5 .12 ( 2H, s ) , 6, 93 ( 2H, d, J=8 . 4 Hz ) , 7 .14 ( 2H, d, 8 . 4 Hz ) ,
7 .45-7. 53 (2H, m) , 7. 57-7 . 64 (2H, m) , 7. 69 ( 1H, s) , 7 . 87 (2H,
d, J=7.6 Hz), 8.11 (1H, s), 10.09 (1H, s).
Example 22 methyl 4-([1,1'-biphenyl]-3- '
ylmethoxy)benzenepropanoate
2s Methyl 4-[(3-bromophenyl)methoxy]benzenepropanoate (0.60
g, 1.7 mmol), phenylboronic acid (0.25 g, 2.1 mmol) and sodium
carbonate (0.55 g, 5.2 mmol) was dissolved in toluene-
methanol-water (5:1:1, 35 mL) and, after argon substitution,
tetrakistriphenylphosphinepalladium (99 mg, 0.086 mmol) was
3o added. The reaction mixture was heated under reflux overnight
under an argon atmosphere. The reaction mixture was cooled,
water was added to the reaction mixture and the mixture was
extracted with ethyl acetate. The extract was washed with
water, dried and concentrated. The residue was purified by
220
CA 02505322 2005-05-06
silica gel column chromatography (hexane/ethyl acetate=18:1)
to give the title compound (0.55 g, yield 920) as a white
powder.
1H NMR (CDC13) g 2. 60 (2H, t, J=8.0 Hz) , 2. 90 (2H, t, J=8.0 Hz) ,
3. 66 (3H, s) , 5.10 (2H, s) , 6.92 (2H, d, J=8.5 Hz) , 7.12 (2H,
d, J=8.5 Hz), 7.35-7.47 (5H, m), 7.54-7.65 (4H, m).
Example 23 methyl 4-[(3-
phenoxyphenyl)methoxy]benzenepropanoate
The title compound was obtained from methyl 4-
io hydroxybenzenepropanoate and 3-phenoxybenzyl alcohol by a
method similar to that of Reference Example 1. yield 66~, oil.
1H NMR (CDC13) g 2. 59 (2H, t, J=8.1 Hz) , 2. 89 (2H, t, J=8.1 Hz) ,
3. 66 (3H, s) , 5. O1 (2H, s) , 6.90-7.20 (9H, m) , 7.20-7.36 (4H,
m) .
is Example 24 methyl 4-([1,1'-biphenyl]-2-
ylmethoxy)benzenepropanoate
The title compound was obtained from methyl 4
hydroxybenzenepropanoate and 2-phenylbenzyl bromide by a
method similar to that of Reference Example 5. yield 52~, oil.
20 1H I~IR (CDC13) g 2.58 (2H, t, J=8.1 Hz) , 2.87 (2H, t, J=8.1 Hz) ,
3.66 (3H, s), 4.91 (2H, s), 6.78 (2H, d, J=8.6 Hz), 7.06 (2H,
d, J=8.6 Hz), 7.33-7.40 (8H, m), 7.50-7.70 (1H, m).
Example 25 methyl 4-[[2,3-dihydro-5-(phenylmethoxy)-1H-inden-
1-yl]oxy]benzenepropanoate
25 The title compound was obtained as a white powder from
methyl 4-hydroxybenzenepropanoate and 2,3-dihydro-5-
(phenylmethoxy)-1H-inden-1-of by a method similar to that of
Reference Example 1. yield 65$.
1H NMR (CDC13) g 2.18-2.23 (1H, m), 2.45-2.60 (1H, m), 2.61 (2H,
3o t, J=8.0 Hz), 2.82-2.90 (1H, m), 2.91 (2H, t, J=8.0 Hz), 3.06-
3.20 (1H, m) , 3. 68 (3H, s) , 5.07 (2H, s) , 5. 67 (1H, dd, J=6.5
Hz, 3.7 Hz) , 6.84-6. 93 (4H, m) , 7.13 (2H, d, J=8. 5 Hz) , 7.26-
7.44 (6H, m).
Example 26 methyl 4-[(2-
221
CA 02505322 2005-05-06
phenoxyphenyl)methoxy)benzenepropanoate
The title compound was obtained as a white powder from
methyl 4-hydroxybenzenepropanoate and 2-phenoxybenzyl alcohol
by a method similar to that of Reference Example 1. yield 93%.
1H NMR (CDC13) g 2.59 (2H, t, J=8.1 Hz) , 2. 88 (2H, t, J=8.1 Hz) ,
3 . 6 6 ( 3H, s ) , 5 .13 ( 2H, s ) , 6 . 8 9 ( 3H, t, J=8 . 6 Hz ) , 6 . 9 8
( 2H,
d, J=8.1 Hz), 7.07-7.20 (4H, m), 7.25-7.40 (3H, m), 7.50-7.60
( 1H, m) .
Example 27 methyl 4-[(4-
io benzoylphenyl)methoxy)benzenepropanoate
To a solution of methyl 4-hydroxybenzenepropanoate (0.65
g, 3.6 mmol) in N,N-dimethylformamide (20 mL) were added 4-
(bromomethyl)benzophenone (1.0 g, 3.6 mmol) and potassium
carbonate (0.50 g, 3.6 mmol), and the mixture was stirred at
room temperature for 15 hrs. Water was added to the reaction
mixture, and the mixture was extracted with ethyl acetate.
The extract was washed with water and concentrated under
reduced pressure. The residue was purified by silica gel
column chromatography (hexane/ethyl acetate=9:1) to give the
2o title compound (1.3 g, yield 96%) as a powder.
1H I~1MR (CDC13) g 2. 60 (2H, t, J=8.0 Hz) , 2.90 (2H, t, J=8.0 Hz) ,
3 . 67 ( 3H, s ) , 5 .17 ( 2H, s ) , 6 . 91 ( 2H, d, J=8 . 7 Hz ) , 7 .13 (
2H,
d, J=8 . 7 Hz ) , 7 . 4 6-7 . 60 ( 5H, m) , 7 . 7 9-7 . 84 ( 4H, ~m) .
Example 28 methyl 4-[[4-(4-
2s chlorobenzoyl)phenyl)methoxy)benzenepropanoate
The title compound was obtained as a powder from methyl
4-hydroxybenzenepropanoate and [4-(bromomethyl)phenyl)(4-
chlorophenyl)ketone by a method similar to that of Example 27.
yield 57%.
30 1H NMR (CDC13 ) g 2 . 60 ( 2H, t, J=8 . 0 Hz ) , 2 . 90 ( 2H, t, J=8 . 0 Hz
) ,
3 . 67 ( 3H, s ) , 5 .13 ( 2H, s ) , 6 . 91 ( 2H, d, J=8 . 6 Hz ) , 7 .13 (
2H,
d, J=8 . 6 Hz ) , 7 . 4 6 ( 2H, d, J=8 . 5 Hz ) , 7 . 55 ( 2H, d, J=7 . 0 Hz )
,
7.74-7.80 (4H, m) .
Example 29 methyl 4-[[4-
222
CA 02505322 2005-05-06
(benzoylamino)phenyl]methoxy]benzenepropanoate
To a solution of methyl 4-[(4-
aminophenyl)methoxy]benzenepropanoate (0.13 g, 0.44 mmol) and
triethylamine (0.50 mL) in tetrahydrofuran (9 mL) was added
benzoyl chloride (74 mg, 0.53 mmol), and the mixture was
stirred at room temperature for 2 hrs. Water was added to the
reaction mixture, and the mixture was extracted with ethyl
acetate. The extract was washed with water, dried and
concentrated. The residue was purified by silica gel column
io chromatography (hexane/ethyl acetate=18:1) to give the title
compound (0.23 g, quantitative). oil.
1H NMR (CDC13) g 2. 60 (2H, t, J=8.0 Hz) , 2.90 (2H, t, J=8.0 Hz) ,
3 . 67 ( 3H, s ) , 5 .10 ( 2H, s ) , 6 . 90 ( 2H, d, J=8 . 6 Hz ) , 7 .11 (
2H,
d, J=8. 6 Hz) , 7.26-7.56 (5H, m) , 7. 66 (2H, d, J=8.5 Hz) , 7.84-
15 7,gg (3H, m) .
Example 30 methyl 4-[[4-[[methyl(4-phenyl-2-
thiazolyl)amino]methyl]phenyl]methoxy]benzenepropanoate
The title compound was obtained as a white powder from
methyl 4-hydroxybenzenepropanoate and 4-[[methyl(4-phenyl-1,3-
2o thiazol-2-yl)amino]methyl]benzenemethanol by a method similar
to that of Reference Example 1. yield 77~.
1H NMR (CDC13) g 2.59 (2H, t, J=8.1 Hz) , 2. 89 (2H, t, J=8.1 Hz) ,
3.08 (3H, s), 3.66 (3H, s), 4.79 (2H, s), 5.02 '(2H, s), 6.72
( 1H, s) , 6. 89 (2H, d, J=8. 6 Hz) , 7.11 (2H, d, J=8. 6 Hz) , 7.25-
2s 7,30 (1H, m), 7.34-7.41 (6H, m), 7.86 (2H, d, J=7.1 Hz).
Example 31 4-[(5,6-dihydro-4H-cyclopenta[b]thien-4-
yl)oxy]benzenepropanoic acid
5,6-Dihydro-4H-cyclopenta[b]thien-4-of was obtained from
5,6-dihydro-4H-cyclopenta[b]thien-4-one by a method similar to
3o that of Reference Example 32. This was condensed with methyl
4-hydroxybenzenepropanoate by a method similar to that of
Reference Example 1 to give methyl 4-[(5,6-dihydro-4H-
cyclopenta[b]thien-4-yl)oxy]benzenepropanoate. The title
compound was obtained from methyl 4-[(5,6-dihydro-4H-
223
CA 02505322 2005-05-06
cyclopenta[b)thien-4-yl)oxy]benzenepropanoate by a method
similar to that of Reference Example 4. yield from 5,6-
dihydro-4H-cyclopenta[b]thien-4-one 19~.
melting point: 87-88~C (recrystallized from diethyl ether-
s hexane ) .
1H NMR (CDC13) g 2.53-2.69 (3H, m), 2.85-3.01 (4H, m), 3.15 (1H,
m) , 5 . 64 ( 1H, dd, J=2 . 0 Hz, 5 . 8 Hz ) , 6 . 88-6 . 93 ( 3H, m) , 7 .13
( 2H, d, J=8 . 6 Hz ) , 7 . 2 0 ( 1H, d, J=5 . 0 Hz ) .
Example 32 methyl 4-[(4,5,6,7-tetrahydrobenzo[b]thien-4-
to yl)oxy]benzenepropanoate
4,5,6,7-Tetrahydrobenzo[b]thien-4-of was obtained from
6,7-dihydrobenzo[b]thien-4(5H)-one by a method similar to that
of Reference Example 32. This was condensed with methyl 4-
hydroxybenzenepropanoate by a method similar to that of
is Reference Example 1 to give the title compound. yield from
6,7-dihydrobenzo[b]thien-4(5H)-one 72~.
oil.
1H NMR (CDC13) g 1. 80-2.15 (4H, m) , 2. 61 (2H, t, J=7.4 Hz) ,
2 . 7 6 ( 1H, m) , 2 . 78-2 . 94 ( 3H, m) , 3 . 68 ( 3H, s ) , 5 . 33 ( 1H, t,
2o J=4.4 Hz) , 6.91-6. 95 (3H, m) , 7.08-7.15 (3H, m) .
Example 33 methyl 4-[(2,3-dihydro-1H-inden-1-yl)oxy]-3,5-
difluorobenzenepropanoate
To a mixture of methyl (E)-3-[4-[(2,3-dihydro-1H-inden-1-
yl)oxy]-3,5-difluorophenyl]-2-propenoate (0.52 g, 1.6 mmol),
2s s~arium (1.2 g, 7.9 mmol), tetrahydrofuran (3 mL) and
methanol (7 mL) was added iodine (0.80 g, 3.2 mmol), and the
mixture was stirred overnight at room temperature. 1N
Hydrochloric acid (20 mL) was added and the mixture was
stirred for 20 min. The mixture was diluted with water, and
3o extracted with ethyl acetate. The extract was washed with
water, dried over anhydrous sodium sulfate, and concentrated.
The residue was purified by silica gel column chromatography
(hexane/ethyl acetate=10:1) to give the title compound. yield
60 a, oil .
224
CA 02505322 2005-05-06
1H NMR (CDC13) g 2. 34-2 .40 (2H, m) , 2 . 61 (2H, t, J=7. 5 Hz) ,
2 . 81-2 . 91 ( 3H, m) , 3 . 2 0-3 . 3 0 ( 1H, m) , 5 . 61 ( 1H, t, J=4 . 4 Hz
) ,
6.72-6.78 (2H, m), 7.16-7.22 (1H, m), 7.29-7.31 (2H, m), 7.34
( 1H, d, J=7 . 4 Hz ) .
Example 34 3,5-difluoro-4-[(2,3-dihydro-1H-inden-1-
yl)oxy]benzenepropanoic acid
The title compound was obtained from methyl 3,5-difluoro-
4-[(2,3-dihydro-1H-inden-1-yl)oxy]benzenepropanoate by a
method similar to that of Reference Example 38. yield 75$.
1° melting point: 88-89°C (recrystallized from ethyl acetate-
hexane ) .
1H NMR (CDC13) g 2. 34-2.40 (2H, m) , 2. 67 (2H, t, J=7.5 Hz) ,
2 . 81-2 . 92 ( 3H, m) , 3 . 20-3 . 30 ( 1H, m) , 5 . 62 ( 1H, t, J=4 . 4 Hz )
,
6.72-6. 80 (2H, m) , 7.17-7.23 (1H, m) , 7.29-7.36 (3H, m) .
i5 Example 35 4-[[2,3-dihydro-4-(phenylmethoxy)-1H-inden-1-
yl]oxy]benzenepropanoic acid
Methyl 4-[[2,3-dihydro-4-(phenylmethoxy)-1H-inden-1-
yl]oxy]benzenepropanoate was obtained from methyl 4-
hydroxybenzenepropanoate and 2,3-dihydro-4-(phenylmethoxy)-1H-
2o inden-1-of by a method similar to that of Reference Example 1.
oil. The title compound was obtained from methyl 4-[[2,3-
dihydro-4-(phenylmethoxy)-1H-inden-1-yl]oxy]benzenepropanoate
by a method similar to that of Reference Example 4. yield
from methyl 4-hydroxybenzenepropanoate 270.
2s melting point: 111-111.5°C (recrystallized from diethyl ether-
hexane) .
1H NMR (CDC13) g, ,2.10-2.30 (1H, m), 2.50-2.60 (1H, m), 2.67
(2H, t, J=7 . 9 Hz) , 2 . 40-3 . 00 (3H, m) , 3. 09-3.14 ( 1H, m) , 5.12
(2H, s) , 5.74 (1H, dd, J=6.7 Hz, 4.4 Hz) , 6. 85 (1H, d, J=8.0
3o Hz) , 6. 94 (2H, d, J=8. 6 Hz) , 7. 05 (1H, d, J=7. 5 Hz) , 7.13-7.23
(3H, m), 7.29-7.45 (5H, m).
Example 36 methyl 4-[[2,3-dihydro-6-(phenylmethoxy)-1H-inden-
1-yl]oxy]benzenepropanoate
The title compound was obtained from methyl 4-
225
CA 02505322 2005-05-06
hydroxybenzenepropanoate and 2,3-dihydro-6-(phenylmethoxy)-1H
inden-1-of by a method similar to that of Reference Example 1.
yield 40%, oil.
1H NMR (CDC13) g 2 .10-2 . 30 ( 1H, m) , 2 . 53-2 . 55 (3H, m) , 2 . 75-
2 . 94 ( 3H, m) , 3 . Ol-3 .10 ( 1H, m) , 3 . 68 ( 3H, s ) , 5 . O1 ( 1H, d,
J=11. 7 Hz ) , 5 . 06 ( 1H, d, J=11. 7 Hz ) , 5 . 68 ( 1H, dd, J=6 . 5 Hz,
4.9 Hz) , 6. 91-6. 96 (3H, m) , 7.03 (1H, d, J=1.7 Hz) , 7.08-7.20
(3H, m), 7.31-7.43 (5H, m).
Example 37 4-[[2,3-dihydro-6-(phenylmethoxy)-1H-inden-1-
lo yl]oxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[[2,3-
dihydro-6-(phenylmethoxy)-1H-inden-1-yl]oxy]benzenepropanoate
by a method similar to that of Reference Example 4. yield 51%.
melting point: 106-107°C (recrystallized from diisopropyl
Is ether-hexane).
1H NMR ( CDC13) g 2 .14-2 . 25 ( 1H, m) , 2 . 51-2 . 63 ( 1H, m) , 2 . 67 (
2H,
t, 8 . 0 Hz ) , 2 . 79-2 . 95 ( 3H, m) , 3 . O1-3 .10 ( 1H, m) , 5 . O1 ( 1H,
d,
J=11. 8 Hz) , 5. 06 ( 1H, d, J=11. 8 Hz) , 5. 69 (1H, t, J=4 . 8 Hz) ,
6.92-6.96 (3H, m), 7.05 (1H, d, J=7.9 Hz), 7.14-7.20 (3H, m),
20 7.20-7.43 (5H, m) .
Example 38 methyl (S)-4-[(2,3-dihydro-1H-inden-1-
yl)oxy]benzenepropanoate
Methyl 4-hydroxybenzenepropanoate (4.1 g, 22 mmol) was
dissolved in tetrahydrofuran (50 mL) and the mixture was
2s stirred at -30°C. (R)-1-Indanol (98o ee) (3.0 g, 22 mmol),
l,1'-(azodicarbonyl)dipiperidine (5.66 g, 22 mmol) and
tributylphosphine (5.6 mL, 22 mmol) were added and the mixture
was stirred at -30°C for 23 hrs. Water was added and the
mixture was extracted with ethyl acetate. The organic layer
3o was washed with saturated brine and dried over sodium sulfate.
The mixture was concentrated under reduced pressure and the
obtained oil was purified by silica gel chromatography (hexane
to hexane/ethyl acetate=10:1) to give the title compound (4.4
g, yield 66~) as a yellow oil.
226
CA 02505322 2005-05-06
Example 39 methyl (R)-4-[(2,3-dihydro-1H-inden-1-
yl)oxy]benzenepropanoate
The title compound was obtained as an oil from (S)-1-
indanol and methyl 4-hydroxybenzenepropanoate by a method
similar to that of Example 38. yield 70~.
Example 40 (S)-4-[(2,3-dihydro-1H-inden-1-
yl)oxy]benzenepropanoic acid
(Synthetic Method 1)
4-[(2,3-Dihydro-1H-inden-1-yl)oxy]benzenepropanoic acid
io (100 mg) was separated by high performance liquid
chromatography (column:CHIRALCEL OJ (50 mmIDX500 mm,
manufactured by DAICEL CHEMICAL INDUSTRIES, LTD.), mobile
phase: hexane/ethanol/trifluoroacetic acid=90:10:0.1, flow
rate: 80 mL/min, column temperature: 50°C) to give the title
Is compound (36 mg). Optical rotation of this compound showed
(+) .
(Synthetic Method 2)
Methyl (S)-4-[(2,3-dihydro-1H-inden-1-
yl)oxy]benzenepropanoate (4.4 g, 15 mmol) was dissolved in
2o methanol (50 mL), 1N aqueous sodium hydroxide solution (25 mL)
was added and the mixture was stirred at room temperature for
18.5 hrs. 1N Hydrochloric acid (25 mL) was added thereto, and
r
the mixture was extracted with ethyl acetate. The organic
layer was washed with saturated brine, and dried over sodium
2s sulfate. The mixture was concentrated under reduced pressure
and the obtained crystals were washed with hexane to give
colorless crystals (4.2 g, 96~ ee). The crystals were
recrystallized from a mixed solvent of diisopropyl ether (70
mL) and hexane (70 mL) to give the title compound (2.3 g,
3o gg.4s ee, yield 560) as colorless crystals. As the secondary
crystals, 0.67 g (yield 16~, 97~ ee) of the title compound was
obtained and as the tertiary crystals, 0.16 g (yield 4~, 92~
ee) of the title compound was obtained.
melting point: 112-113°C (primary crystals).
227
CA 02505322 2005-05-06
fa] D 3 +28.9° (c 0.997, CHC13) .
IR (KBr) v ciri 1: 2938, 1694, 1510, 1232, 957, 829, 761.
1H NMR (CDC13) g 2 . 20 ( 1H, m) , 2 . 55 ( 1H, m) , 2 . 67 (2H, t, J=7 . 6
Hz), 2.92 (2H, t, J=7.6 Hz), 2.92 (1H, m), 3.13 (1H, m), 5.73
(1H, dd, J=4.4 Hz, 6.8 Hz), 6.94 (2H, dt J=2.6 Hz, 8.4 Hz),
7 .16 (2H, dt, J=2 . 6 Hz, 8 .4 Hz) , 7.23 (1H, m) , 7. 30 (2H, m) ,
7.42 (1H, d, J=7.2 Hz) , 11.0 (1H, br s) .
Example 41 (R)-4-[(2,3-dihydro-1H-inden-1-
yl)oxy]benzenepropanoic acid
io (Synthetic Method 1)
4-[(2,3-Dihydro-1H-inden-1-yl)oxy)benzenepropanoic acid
(100 mg) was separated by high performance liquid
chromatography (column:CHIRALCEL OJ (50 mmIDx500 mm,
manufactured by DAICEL CHEMICAL INDUSTRIES, LTD.), mobile
is phase: hexane/ethanol/trifluoroacetic acid=90:10:0.1, flow
rate: 80 mL/min, column temperature: 50°C) to give the title
compound (38 mg). Optical rotation of this compound showed (-
).
(Synthetic Method 2)
Zo The title compound was obtained from methyl (R)-4-[(2,3-
dihydro-1H-inden-1-yl)oxy]benzenepropanoate by a method
similar to that of Example 40. yield: primary crystals (99.0%
ee) 39%, secondary crystals (97% ee) 20%, tertiary crystals
(92% ee) 7%.
2s melting point: 110-111°C (primary crystals) .
[a]D23 -28.8° (c 0.997, CHC13) .
IR (KBr) v cm 1: 2938, 1694, 1510, 1232, 957, 829, 761.
1H NMR (CDC13) g 2. 20 ( 1H, m) , 2 . 55 ( 1H, m) , 2 . 67 (2H, t, J=7 . 6
Hz), 2.92 (2H, t, J=7.6 Hz), 2.92 (1H, m), 3.13 (1H, m), 5.73
30 (1H, dd, J=4.4 Hz, 6.8 Hz), 6.94 (2H, dt J=2.6 Hz, 8.4 Hz),
7.16 (2H, dt, J=2.6 Hz, 8.4 Hz), 7.23 (1H, m), 7.30 (2H, m),
7.42 (1H, d, J=7.6 Hz), 11.0 (1H, br s).
Example 42 4-[(4,5,6,7-tetrahydrobenzo[b]thien-4-
yl)oxy]benzenepropanoic acid
228
CA 02505322 2005-05-06
The title compound was obtained from methyl 4-[(4,5,6,7-
tetrahydrobenzo[b]thien-4-yl)oxy]benzenepropanoate by a method
similar to that of Reference Example 4. yield 54%.
melting point: 87-89°C (recrystallized from diethyl ether-
hexane).
1H NMR (CDC13) g 1. 79-2 .17 (4H, m) , 2 . 66 (2H, t, J=7 . 4 Hz) ,
2.76 (1H, m) , 2. 87-2.95 (3H, m) , 5.33 (1H, t, J=4 .4 Hz) , 6.91-
6 . 96 ( 3H, m) , 7 . 09 ( 1H, d, J=5 . 2 Hz ) , 7 . 14 ( 2H, d, J=8 . 6 Hz )
.
Example 43 methyl 4-[(6-bromo-2,3-dihydro-1H-inden-1-
io yl)oxy]benzenepropanoate
6-Bromo-1-indanol was obtained from 6-bromo-1-indanone by
a method similar to that of Reference Example 32. This
compound was condensed with methyl 4-hydroxybenzenepropanoate
by a method similar to that of Reference Example 1 to give the
I5 title compound. yield from 6-bromo-1-indanone 84%. oil.
1H NMR (CDC13) g 2.20 (1H, m), 2.51-2.64 (3H, m), 2.79-2.94 (3H,
m) , 3 . 0 6 ( 1H, m) , 3 . 68 ( 3H, s ) , 5 . 68 ( 1H, t, J=5 . 0 Hz ) , 6 .
91
(2H, d, J=8.6 Hz), 7.10-7.15 (3H, m), 7.40 (1H, dd, J=1.8 Hz,
8.0 Hz) , 7.53 (1H, d, J=1.3 Hz) .
2° Example 44 4-[(6-bromo-2,3-dihydro-1H-inden-1-
yl)oxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[(6-bromo-
2,3-dihydro-1H-inden-1-yl)oxy]benzenepropanoaterby a method
similar to that of Reference Example 4. yield 59%.
25 melting point: 108-109°C (recrystallized from diethyl ether-
hexane ) .
1H I~IR (CDC13) g 2. 20 ( 1H, m) , 2 . 57 ( 1H, m) , 2. 69 (2H, t, J=8 . 0
Hz), 2.85 (1H, m), 2.96 (2H, t, J=8.0 Hz), 3.06 (1H, m), 5.68
(1H, dd, J=4.9 Hz, 6.5 Hz), 6.92 (2H, d, J=8.6 Hz), 7.10-7.19
30 ( 3H, m) , 7 . 41 ( 1H, dd, J=1. 9 Hz, 8 .1 Hz ) , 7 . 54 ( 1H, d, J=1. 4
Hz) .
Example 45 4-[(2,3-dihydro-6-phenyl-1H-inden-1-
yl)oxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[(6-bromo-
229
CA 02505322 2005-05-06
2,3-dihydro-1H-inden-1-yl)oxy]benzenepropanoate and
phenylboronic acid by a method similar to that of Example 22.
yield 11$.
melting point: 121-122°C (recrystallized from diethyl ether-
s hexane ) .
1H NMR (CDC13) g 2 .25 ( 1H, m) , 2 . 60 ( 1H, m) , 2 . 68 (2H, t, J=8 . 0
Hz), 2.90-3.00 (3H, m), 3.17 (1H, m), 5.78 (1H, dd, J=4.5 Hz,
6.5 Hz) , 6. 97 (2H, d, J=8. 6 Hz) , 7.16 (2H, d, J=8. 6 Hz) , 7.27-
7.63 (8H, m).
1o Example 46 methyl 4-[(2-methyl[1,1'-biphenyl]-3-
yl)methoxy]benzenepropanoate
The title compound was obtained from methyl 4-
hydroxybenzenepropanoate and 2-methyl-3-biphenylmethanol by a
method similar to that of Reference Example 1. yield 51~,
is white powder.
1H NMR (CDC13) g 2.24 (3H, s) , 2. 61 (2H, t, J=8.1 Hz) , 2. 91 (2H,
t, J=8. 1 Hz) , 3. 67 (3H, s) , 5.06 (2H, s) , 6. 95 (2H, d, J=8. 6
Hz) , 7.14 (2H, d, J=8. 6 Hz) , 7.22-7.44 (8H, m) .
Example 47 4-[(2-methyl[1,1'-biphenyl]-3-
2o yl)methoxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[(2-
methyl[1,1'-biphenyl]-3-yl)methoxy]benzenepropanoate by a
method similar to that of Reference Example 4. ryield 530.
melting point: 154-155°C (recrystallized from ethyl acetate-
25 hexane) .
1H NMR (CDC13) $ 2.24 (3H, s), 2.66 (2H, t, J=7.9 Hz), 2.92 (2H,
t, J=7 . 9 Hz ) , 5 . 06 ( 2H, s ) , 6 . 95 ( 2H, d, J=8 . 6 Hz ) , 7 .15 (
2H,
d, J=8.6 Hz), 7.24-7.44 (8H, m).
Example 48 methyl 4-[(4-bromo-2,3-dihydro-1H-inden-1-
3o yl)oxy]benzenepropanoate
4-Bromo-1-indanol was obtained from 4-bromo-1-indanone by
a method similar to that of Reference Example 32. This was
condensed with methyl 4-hydroxybenzenepropanoate by a method
similar to that of Reference Example 1 to give the title
230
CA 02505322 2005-05-06
compound. yield from 4-bromo-1-indanone 31~.
1H NMR (CDC13) g 2.22 (1H, m), 2.51-2.64 (3H, m), 2.88-2.97 (3H,
m) , 3 .12 ( 1H, m) , 3 . 68 ( 3H, s ) , 5 . 78 ( 1H, dd, J=4 . 6 Hz, 6 . 8
Hz), 6.91 (2H, d, J=8.6 Hz), 7.09-7.16 (3H, m), 7.34 (1H, d,
J=7.5 Hz) , 7.46 (1H, d, J=7.8 Hz) .
Example 49 4-[(4-bromo-2,3-dihydro-1H-inden-1-
yl)oxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[(4-bromo-
2,3-dihydro-1H-inden-1-yl)oxy]benzenepropanoate by a method
to similar to that of Reference Example 4. yield 770.
melting point: 112-113°C (recrystallized from diethyl ether-
hexane ) .
1H NMR (CDC13) g 2.20 (1H, m) , 2.57 (1H, m) , 2. 67 (2H, t, J=8.0
Hz ) , 2 . 87-2 . 98 ( 3H, m) , 3 .14 ( 1H, m) , 5 . 78 ( 1H, dd, J=3 . 5 Hz,
is 6. 6 Hz) , 6. 92 (2H, d, J=8. 6 Hz) , 7.09-7.17 (3H, m) , 7.35 (1H,
d, J=7 . 5 Hz ) , 7 . 4 7 ( 1H, d, J=7 . 9 Hz ) .
Example 50 methyl 4-([4'-chloro-1,1'-biphenyl]-3-
ylmethoxy)benzenepropanoate
The title compound was obtained as a oil from 4-
2o chlorophenylboronic acid by a method similar to that of
Example 22. yield 59%.
1H NMR (CDC13) g 2.60 (2H, t, J=8.1 Hz), 2.90 (2H, t, J=8.1 Hz),
3 . 66 ( 3H, s ) , 5 . 09 ( 2H, s ) , 6 . 92 ( 2H, d, J=8 . 6 Hz ) , 7 .12 (
2H,
d, J=8.6 Hz), 7.38-7.54 (7H, m), 7.61 (1H, br s).
2s E~le 51 4- ( [ 4' -chloro-l, 1' -biphenyl ] -3-
ylmethoxy)benzenepropanoic acid
The title compound was obtained from methyl 4-([4'-
chloro-1,1'-biphenyl]-3-ylmethoxy)benzenepropanoate by a
method similar to that of Reference Example 4. yield 520.
so melting point: 147-148°C (recrystallized from ethyl acetate-
hexane) .
1H NMR (CDC13) g 2. 65 (2H, t, J=7.9 Hz) , 2. 91 (2H, t, J=7 .9 Hz) ,
5.09 (2H, s) , 6. 93 (2H, d, J=8. 6 Hz) , 7. 14 (2H, d, J=8. 6 Hz) ,
7.39-7.53 (7H, m), 7.61 (1H, s).
231
CA 02505322 2005-05-06
Example 52 methyl 4-[(2,3-dihydro-4-phenyl-1H-inden-1-
yl)oxy]benzenepropanoate
The title compound was obtained from methyl 4-[(4-bromo-
2,3-dihydro-1H-inden-1-yl)oxy]benzenepropanoate and
s phenylboronic acid by a method similar to that of Example 22.
yield 95$, oil.
1H NMR (CDC13) g 2.20 (1H, m), 2.51 (1H, m), 2.62 (2H, t, J=7.1
Hz ) , 2 . 90-3 . O1 ( 3H, m) , 3 .19 ( 1H, m) , 3 . 68 ( 3H, s ) , 5 . 7 7 (
1H,
dd, J=4 . 6 Hz, 6 . 5 Hz ) , 6 . 96 ( 2H, d, J=8 . 6 Hz ) , 7 . 15 ( 2H, d,
1° J=8 . 6 Hz ) , 7 . 33-7 . 45 ( 8H, m) .
Example 53 4-[(4-phenyl-2,3-dihydro-1H-inden-1-
yl)oxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[(2,3
dihydro-4-phenyl-1H-inden-1-yl)oxy]benzenepropanoate by a
is method similar to that of Reference Example 4. yield 650.
melting point: 137-138°C (recrystallized from diethyl ether-
hexane ) .
1H NMR (CDC13) g 2 . 20 ( 1H, m) , 2 . 52 ( 1H, m) , 2 . 68 (2H, t, J=8 . 0
Hz), 2.91-3.01 (3H, m), 3.20 (1H, m), 5.78 (1H, dd, J=4.6 Hz,
20 6.5 Hz), 6.98 (2H, d, J=8.6 Hz), 7.17 (2H, d, J=8.6 Hz), 7.33-
7.47 (8H, m) .
Example 54 methyl 4-([4'-trifluoromethyl-1,1'-biphenyl]-3-
r
ylmethoxy)benzenepropanoate
The title compound was obtained as a white powder from 4-
2s trifluoromethylphenylboronic acid by a method similar to that
of Example 22. yield 82~.
1H I~R~IR (CDClj) $ 2. 60 (2H, t, J=8.0 Hz) , 2. 91 (2H, t, J=8.0 Hz) ,
3. 66 (3H, s) , 5.11 (2H, s) , 6. 93 (2H, d, J=8.7 Hz) , 7.13 (2H,
d, J=8.7 Hz), 7.47-7.57 (3H, m), 7.66-7.70 (5H, m).
3o Example 55 4-([4'-trifluoromethyl-1,1'-biphenyl]-3
ylmethoxy)benzenepropanoic acid
The title compound was obtained from methyl 4-([4'-
trifluoromethyl-1,1'-biphenyl]-3-ylmethoxy)benzenepropanoate
by a method similar to that of Reference Example 4. yield 530.
232
CA 02505322 2005-05-06
melting point: 144°C (recrystallized from ethyl acetate-hexane).
1H NMR (CDC13) $ 2. 65 (2H, t, J=7.9 Hz) , 2. 91 (2H, t, J=7.9 Hz) ,
.11 ( 2H, s ) , 6 . 93 ( 2H, d, J=8 . 6 Hz ) , 7 .14 ( 2H, d, J=8 . 8 Hz ) ,
7.47-7.56 (3H, m), 7.66-7.09 (5H, m).
Example 56 methyl 4-([2',6'-dimethyl-1,1'-biphenyl]-3-
ylmethoxy)benzenepropanoate
The title compound was obtained as a oil from 2,6-
dimethylphenylboronic acid by a method similar to that of
to Example 22. yield 880.
1H NMR (CDC13) g 2.01 (6H, s) , 2.59 (2H, t, J=8.1 Hz) , 2.89 (2H,
t, J=8.1 Hz) , 3. 66 (3H, s) , 5.09 (2H, s) , 6.89 (2H, d, J=8. 6
Hz), 7.09-7.20 (7H, m), 7.38-7.44 (2H, m).
Example 57 4-([2',6'-dimethyl-l,l'-biphenyl]-3-
ylmethoxy)benzenepropanoic acid
The title compound was obtained from methyl 4-([2',6'-
dimethyl-l,l'-biphenyl]-3-ylmethoxy)benzenepropanoate by a
method similar to that of Reference Example 4. yield 510.
melting point: 136-137°C (recrystallized from ethyl acetate-
2o hexane) .
1H I~4R (CDC13) $ 2 . 00 ( 6H, s) , 2. 64 (2H, t, J=8. 0 Hz) , 2. 90 (2H,
t, J=8. 0 Hz) , 5. 09 (2H, s) , 6.90 (2H, d, J=8. 6 Hz) , 7.08-7.25
r
(7H, m), 7.35-7.50 (2H, m).
Example 58 methyl 4-[[3-
(phenylmethoxy)phenyl]methoxy]benzenepropanoate
The title compound was obtained from methyl 4-
hydroxybenzenepropanoate and 3-benzyloxybenzyl alcohol by a
method similar to that of Reference Example 1. yield 92~.
1H NMR (CDC13) g 2. 59 (2H, t, J=8.1 Hz) , 2. 89 (2H, t, J=8.1 Hz) ,
3_66 (3H, s), 5.01 (2H, s), 5.07 (2H, s), 6.86-6.94 (3H, m),
7.01 (1H, d, J=7.5 Hz), 7.07-7.12 (3H, m), 7.25-7.45 (6H, m).
Example 59 4-[[3-
(phenylmethoxy)phenyl]methoxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[[3-
233
CA 02505322 2005-05-06
(phenylmethoxy)phenyl]methoxy]benzenepropanoate by a method
similar to that of Reference Example 4. yield 73g.
melting point: 107-108~C (recrystallized from ethyl acetate-
hexane ) .
1H NMR ( CDC13 ) g 2 . 65 ( 2H, t, J=7 . 9 Hz ) , 2 . 90 ( 2H, t, J=7 . 9 Hz )
,
5.01 {2H, s), 5.07 (2H, s), 6.87-6.94 (3H, m), 7.01 (1H, d,
J=7.6 Hz), 7.06-7.13 (3H, m), 7.26-7.45 (6H, m).
Example 60 methyl 4-[(2,3-dihydro-2,2-dimethyl-1H-inden-1-
yl)oxy]benzenepropanoate
io 2,3-Dihydro-2,2-dimethyl-1H-inden-1-of was obtained from
2,3-dihydro-2,2-dimethyl-1H-inden-1-one by a method similar to
that of Reference Reference Example 32. This was condensed
with methyl 4-hydroxybenzenepropanoate by a method similar to
that of Reference Example 1 to give the title compound. yield
is from 2,3-dihydro-2,2-dimethyl-1H-inden-1-one 60~. oil.
1H NMR (CDC13) g 1.13 (3H, s) , 1.23, (3H, s) , 2 . 62 {2H, t,
J=7.5 Hz), 2.73 (1H, d, J=15.4 Hz), 2.86 (1H, d, J=15.4 Hz),
2.93 (2H, t, J=7.5 Hz) , 3.86 (3H, s) , 5.28 (1H, s) , 6. 98 (2H,
d, J=8.6 Hz), 7.11-7.27 (6H, m).
2° Example 61 4-[(2,3-dihydro-2,2-dimethyl-1H-inden-1-
yl)oxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[(2,3-
dihydro-2,2-dimethyl-1H-inden-1-yl)oxy]benzenepropanoate by a
method similar to that of Reference Example 4. yield 46~, oil.
2s 1H IVMR (CDC13) g 1.13 (3H, s) , 1.23, (3H, s) , 2.68 (2H, t,
J=7.3 Hz), 2.73 (1H, d, J=18.9 Hz), 2.87 (1H, d, J=18.9 Hz),
2.93 {2H, t, J=7.3 Hz), 5.28 (1H, s), 6.98 (2H, d, J=8.6 Hz),
7.00-7.27 (6H, m).
Example 62 methyl 4-[(2,3-dihydro-5-methyl-1H-inden-1-
so yl)oxy]benzenepropanoate
2,3-Dihydro-5-methyl-1H-inden-1-of was obtained from 2,3-
dihydro-5-methyl-1H-inden-1-one by a method similar to that of
Reference Example 32. This was condensed with methyl 4-
hydroxybenzenepropanoate by a method similar to that of
234
CA 02505322 2005-05-06
Reference Example 1 to give the title compound. yield from
2,3-dihydro-5-methyl-1H-inden-1-one 99~, oil.
1H NMR (CDC13) g 2.21 (1H, m), 2.36 (3H, s), 2.50 (1H, m), 2.61
( 2H, t, J=8 . 2 Hz ) , 2 . 82-2 . 91 ( 3H, m) , 3 . 10 ( 1H, m) , 3 . 68 (
3H,
s), 5.69 (1H, dd, J=4.0 Hz, 6.5 Hz), 6.92 (2H, d, J=8.6 Hz),
7.05 (2H, d, J=8.6 Hz), 7.14-7.16 (3H, m), 7.30 (1H, d, J=7.7
Hz) .
Example 63 4-[(2,3-dihydro-5-methyl-1H-inden-1-
yl)oxy]benzenepropanoic acid
io The title compound was obtained from methyl 4-[(2,3-
dihydro-5-methyl-1H-inden-1-yl)oxy]benzenepropanoate by a
method similar to that of Reference Example 4. yield 310.
melting point: 108-109°C (recrystallized from diethyl ether-
hexane ) .
i5 1H NMR (CDC13) g 2.20 (1H, m), 2.36 (3H, s), 2.51 (1H, m), 2.67
( 2H, t, J=8 . 2 Hz ) , 2 . 8 0-2 . 94 ( 3H, m) , 3 .14 ( 1H, m) , 5 . 69 (
1H,
dd, J=4.1 Hz, 6.4 Hz), 6.93 (2H, d, J=8.6 Hz), 7.04 (2H, d,
J=7.7 Hz), 7.11-7.16 (3H, m), 7.30 (1H, d, J=7.7 Hz).
Example 64 methyl 4-[(2,3-dihydro-7-methyl-1H-inden-1-
2° yl)oxy]benzenepropanoate
2,3-Dihydro-7-methyl-1H-inden-1-of was obtained from 2,3-
dihydro-7-methyl-1H-inden-1-one by a method similar to that of
Reference Example 32. This was condensed with methyl 4-
hydroxybenzenepropanoate by a method similar to that of
25 Reference Example 1 to give the title compound. yield from
2,3-dihydro-7-methyl-1H-inden-1-one 57~, oil.
1H I~R~IR (CDC13) g 2.21-2.49 (2H, m), 2.30 (3H, s), 2.62 (2H, t,
J=7 .4 Hz) , 2 . 85-2. 97 (3H, m) , 3 .18 ( 1H; m) , 3. 68 (3H, s) , 5. 74
( 1H, dd, J=2 . 0 Hz, 6 . 5 Hz ) , 6 . 91 ( 2H, d, J=8 . 6 Hz ) , 7 . 0 6 (
1H,
3o d, J=7 . 3 Hz ) , 7 . 13-7 . 2 3 ( 4H, m) .
Example 65 methyl 4-[[4-(4-
phenoxyphenoxy)phenyl]methoxy]benzenepropanoate
The title compound was obtained as a white powder from
methyl 4-hydroxybenzenepropanoate and 4-(4-
235
CA 02505322 2005-05-06
phenoxyphenoxy)benzyl alcohol by a method similar to that of
Reference Example 33. yield 26$.
1H I~4R (CDC13) g 2. 60 (2H, t, J=8.1 Hz) , 2. 90 (2H, t, J=8.1 Hz) ,
3. 66 (3H, s) , 4. 99 (2H, s) , 6.89 (2H, d, J=8.6 Hz) , 6.99-7.13
( 11H, m) , 7 .31-7 .40 (4H, m) .
Example 66 4-[[4-(4-
phenoxyphenoxy)phenyl]methoxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[[4-(4-
phenoxyphenoxy)phenyl]methoxy]benzenepropanoate by a method
io similar to that of Reference Example 4. yield 81$.
melting point: 167-168~C (recrystallized from ethyl acetate-
hexane ) .
1H NMR (CDC13) g 2. 65 (2H, t, J=8.0 Hz) , 2. 91 (2H, t, J=8.0 Hz) ,
4.99 (2H, s), 6.91 (2H, d, J=8.6 Hz), 6.99-7.15 (11H, m),
Is 7.31-7.40 (4H, m).
Example 67 methyl 4-[[4-[4-
(trifluoromethoxy)phenoxy]phenyl]methoxy]benzenepropanoate
4-[4-(Trifluoromethoxy)phenoxy]benzyl alcohol was
obtained as an oil from 4-[4-
2° (trifluoromethoxy)phenoxy]benzaldehyde by a method similar to
that of Reference Example 32. The title compound was obtained
as a white powder from methyl 4-hydroxybenzenepropanoate and
4-[4-(trifluoromethoxy)phenoxy]benzyl alcohol by a method
similar to that of Reference Example 33. yield from 4-[4-
2s (trifluoromethoxy)phenoxy]benzaldehyde 27$.
1H NMR (CDC13) $ 2. 60 (2H, t, J=8.1 Hz) , 2.90 (2H, t, J=8.1 Hz) ,
3 . 67 ( 3H, s ) , 5 . O1 ( 2H, s ) , 6 . 90 ( 2H, d, J=6 . 7 Hz ) , 6 . 92-7
. 03
(4H, m), 7.11-7.20 (4H, m), 7.41 (2H, d, J=8.6 Hz).
Example 68 4-[[4-[4-
30 (trifluoromethoxy)phenoxy]phenyl]methoxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[[4-[4-
(trifluoromethoxy)phenoxy]phenyl]methoxy]benzenepropanoate by
a method similar to that of Reference Example 4. yield 87$.
melting point: 137-138°C (recrystallized from ethyl acetate-
236
CA 02505322 2005-05-06
hexane ) .
1H NMR (CDC13) g 2. 66 (2H, t, J=8.0 Hz) , 2. 91 (2H, t, J=8.0 Hz) ,
5.01 (2H, s) , 6. 90 (2H, d, J=8. 6 Hz) , 6. 99-7.03 (4H, m) ,
7.12-7.20 (4H, m), 7.41 (2H, d, J=8.6 Hz).
Example 69 methyl 4-[[4-([1,1'-biphenyl]-4-
yloxy)phenyl]methoxy]benzenepropanoate
The title compound was obtained as a white powder from
methyl 4-hydroxybenzenepropanoate and 4-([1,1'-biphenyl]-4-
yloxy)benzyl alcohol by a method similar to that of Reference
to Example 33. yield 130.
1H NMR (CDC13) $ 2. 60 (2H, t, J=8.0 Hz) , 2. 90 (2H, t, J=8.0 Hz) ,
3 . 67 ( 3H, s ) , 5 . Ol ( 2H, s ) , 6 . 91 ( 2H, d, J=8 . 6 Hz ) , 7 . 05-7
.14
(6H, m), 7.30-7.48 (5H, m), 7.55-7.58 (4H, m).
Example 70 4-[[4-([1,1'-biphenyl]-4-
ss yloxy)phenyl]methoxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[[4-([1,1'-
biphenyl]-4-yloxy)phenyl]methoxy]benzenepropanoate by a method
similar to that of Reference Example 4. yield 84%.
melting point: 196-197~C (recrystallized from ethyl acetate-
2° hexane ) .
1H NMR (CDC13) g 2. 66 (2H, t, J=7.9 Hz) , 2. 92 (2H, t, J=7.9 Hz) ,
5.01 (2H, s), 6.92 (2H, d, J=8.6 Hz), 7.05-7.13 (6H, m), 7.31-
r
7 . 4 8 ( 5H, m) , 7 . 55-7 . 58 ( 4H, m) .
Example 71 methyl 4-[[4-[4-
25 (phenylmethoxy)phenoxy]phenyl]methoxy]benzenepropanoate
The title compound was obtained as a white powder from
methyl 4-hydroxybenzenepropanoate and 4-[4-
(phenylmethoxy)phenoxy]benzyl alcohol by a method similar to
that of Reference Example 33. yield 24~.
30 1H I~R (CDC13) g 2. 60 (2H, t, J=8 .0 Hz) , 2. 89 (2H, t, J=8.0 Hz) ,
3.66 (3H, s), 4.97 (2H, s), 5.05 (2H, s), 6.88-6.97 (8H, m),
7.11 (2H, d, J=8.6 Hz), 7.34-7.47 (7H, m).
Example 72 4-[[4-[4-
(phenylmethoxy)phenoxy]phenyl]methoxy]benzenepropanoic acid
237
CA 02505322 2005-05-06
The title compound was obtained from methyl 4-[[4-[4-
(phenylmethoxy)phenoxy]phenyl]methoxy]benzenepropanoate by a
method similar to that of Reference Example 4. yield 550.
melting point: 180-181°C (recrystallized from ethyl acetate-
hexane ) .
1H l~iR (CDC13) g 2. 65 (2H, t, J=8.0 Hz) , 2. 91 (2H, t, J=8.0 Hz) ,
4.98 (2H, s), 5.05 (2H, s), 6.89-6.97 (8H, m), 7.13 (2H, d,
J=8.6 Hz), 7.26-7.45 (7H, m).
Example 73 methyl 4-[(2,3-dihydro-5-methoxy-1H-inden-1-
to yl)oxy]benzenepropanoate
5-Methoxy-1-indanol was obtained from 5-methoxy-1-
indanone by a method similar to that of Reference Example 32.
oil. The title compound was obtained as a white powder from
methyl 4-hydroxybenzenepropanoate and 5-methoxy-1-indanol by a
is method similar to that of Reference Example 33. yield from 5-
methoxy-1-indanone 14~.
1H NMR (CDC13) $ 2.19-2.29 (1H, m) , 2.47-2.58 (1H, m) , 2. 61 (2H,
t, J=8.1 Hz), 2.82-2.88 (1H, m), 2.91 (2H, t, J=8.1 Hz), 3.08-
3 .19 ( 1H, m) , 3 . 68 ( 3H, s ) , 5 . 66 ( 1H, dd, J=3 . 6 Hz, 6 . 5 Hz) ,
20 6 . 7 8- 6 . 82 ( 2H, m) , 6 . 91 ( 2H, d, J=8 . 6 Hz ) , 7 .12 ( 2H, d,
J=8 . 6
Hz), 7.31 (1H, d, J=8.2 Hz) .
Example 74 4-[(2,3-dihydro-5-methoxy-1H-inden-1-
yl)oxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[(2,3
25 dihydro-5-methoxy-1H-inden-1-yl)oxy]benzenepropanoate by a
method similar to that of Reference Example 4. yield 67~.
melting point: 87-88°C (recrystallized from ethyl acetate
hexane) .
1H NMR (CDC13) $ 2.18-2.28 (1H, m), 2.46-2.59 (1H, m), 2.67 (2H,
3o t, J=8.0 Hz), 2.81-2.90 (1H, m), 2.92 (2H, t, J=8.0 Hz), 3.06-
3 .17 ( 1H, m) , 5. 68 ( 1H, dd, J=3 . 6 Hz, 6. 5 Hz ) , 6 . 74-6 . 82 (2H,
m) , 6.92 (2H, d, J=8. 6 Hz) , 7.14 (2H, d, J=8. 6 Hz) , 7.31 (1H,
d, J=8.2 Hz).
Example 75 methyl 4-[(5-chloro-2,3-dihydro-1H-inden-1-
238
CA 02505322 2005-05-06
yl)oxy]benzenepropanoate
5-Chloro-1-indanol was obtained from 5-chloro-1-indanone
by a method similar to that of Reference Example 32. oil. The
title compound was obtained as a white powder from methyl 4-
hydroxybenzenepropanoate and 5-chloro-1-indanol by a method
similar to that of Reference Example 33. yield from 5-chloro-
1-indanone 33~.
1H NMR (CDC13) g 2.16-2.27 (1H, m), 2.49-2.59 (1H, m), 2.62 (2H,
t, J=8.2 Hz), 2.83-2.90 (1H, m), 2.91 (2H, t, J=8.2 Hz), 3.05-
3 .17 ( 1H, m) , 3 . 68 ( 3H, s ) , 5 . 67 ( 1H, dd, J=4 . 3 Hz, 6 . 6 Hz ) ,
6.91 (2H, d, J=8. 6 Hz) , 7.14 (2H, d, J=8 . 6 Hz) , 7 .19-7. 33 (3H,
m) .
Example 76 4-[(5-chloro-2,3-dihydro-1H-inden-1-
yl)oxy]benzenepropanoic acid
is The title compound was obtained from methyl 4-[(5-chloro-
2,3-dihydro-1H-inden-1-yl)oxy]benzenepropanoate by a method
similar to that of Reference Example 4. yield 80~.
melting point: 136-137°C (recrystallized from ethyl acetate-
hexane ) .
1H NMR (CDC13) g 2.17-2.28 (1H, m), 2.51-2.62 (1H, m), 2.67 (2H,
t, J=7.9 Hz), 2.85-2.90 (1H, m), 2.93 (2H, t, J=7.9 Hz), 3.06-
3.17 (1H, m), 5.67 (1H, dd, J=4.4 Hz, 6.6 Hz), 6.91 (2H, d,
J=8.6 Hz), 7.14-7.33 (5H, m).
Example 77 4-[(5-fluoro-2,3-dihydro-1H-inden-1-
yl)oxy]benzenepropanoic acid
5-Fluoro-1-indanol was obtained from 5-fluoro-1-indanone
by a method similar to that of Reference Example 32. oil.
Methyl 4-[(5-fluoro-2,3-dihydro-1H-inden-1-
yl)oxy]benzenepropanoate was obtained from methyl 4-
3o hydroxybenzenepropanoate and 5-fluoro-1-indanol by a method
similar to that of Reference Example 33. oil. Then the title
compound was obtained from methyl 4-[(5-fluoro-2,3-dihydro-1H-
inden-1-yl)oxy]benzenepropanoate by a method similar to that
of Reference Example 4. yield from 5-fluoro-1-indanone 400.
239
CA 02505322 2005-05-06
melting point: 124-125°C (recrystallized from diethyl ether-
hexane ) .
1H NMR (CDC13) g 2.18-2.29 (1H, m), 2.50-2.62 (1H, m), 2.67 (2H,
t, J=8.0 Hz), 2.85-2.89 (1H, m), 2.93 (2H, t, J=8.0 Hz), 3.07-
3 .18 ( 1H, m) , 5 . 68 ( 1H, dd, J=4 .1 Hz, 6 . 5 Hz ) , 6. 90-6 . 98 ( 4H,
m) , 7 .15 (2H, d, J=8 . 6 Hz ) , 7 . 33-7 . 37 ( 1H, m) .
Example 78 4-[(2,3-dihydro-5-methyl-1H-inden-1-
yl)oxy]benzenepropanoic acid
5-Methyl-1-indanol was obtained from 5-methyl-1-indanone
to by a method similar to that of Reference Example 32. oil.
Methyl 4-[(2,3-dihydro-5-methyl-1H-inden-1-
yl)oxy]benzenepropanoate was obtained from methyl 4-
hydroxybenzenepropanoate and 5-methyl-1-indanol by a method
similar to that of Reference Example 33. oil. Then the title
is compound was obtained from methyl 4-[(2,3-dihydro-5-methyl-1H-
inden-1-yl)oxy]benzenepropanoate by a method similar to that
of Reference Example 4. yield from 5-methyl-1-indanone 29%.
melting point: 74-75°C (recrystallized from diethyl ether-
hexane ) .
20 1H NMR (CDC13) g 2.13-2.25 (1H, m), 2.34 (3H, s), 2.49-2.60 (1H,
m) , 2 . 68 (2H, t, J=8 . 0 Hz) , 2 . 80-2 . 91 (1H, m) , 2. 92 (2H, t,
J=8.0 Hz), 3.04-3.13 (1H, m), 5.69 (1H, dd, J=4.5 Hz, 6.5 Hz),
6.94 (2H, d, J=8.6 Hz), 7.10-7.19 (4H, m), 7.24~(1H, s).
Examiple 79 4-[(2,3-dihydro-6-methoxy-1H-inden-1-
2s yl)oxy]benzenepropanoic acid
6-Methoxy-1-indanol was obtained from 6-methoxy-1-
indanone by a method similar to that of Reference Example 32.
oil. Methyl 4-[(2,3-dihydro-6-methoxy-1H-inden-1-
yl)oxy]benzenepropanoate was obtained from methyl 4-
so hydroxybenzenepropanoate and 6-methoxy-1-indanol by a method
similar to that of Reference Example 33. oil. Then the title
compound was obtained from methyl 4-((2,3-dihydro-6-methoxy-
1H-inden-1-yl)oxy]benzenepropanoate by a method similar to
that of Reference Example 4. yield from 6-methoxy-1-indanone
240
CA 02505322 2005-05-06
41g, oil .
1H NMR (CDC13) g 2.14-2.25 (1H, m), 2.51-2.63 (1H, m), 2.67 (2H,
t, J=8.0 Hz), 2.79-2.88 (1H, m), 2.93 (2H, t, J=8.0 Hz), 3.01-
3.09 (1H, m), 3.79 (3H, s), 5.69 (1H, dd, J=4.8 Hz, 6.5 Hz),
6.86-6.97 (4H, m), 7.13-7.20 (3H, m).
Example 80 4-[(5-bromo-2,3-dihydro-1H-inden-1-
yl)oxy]benzenepropanoic acid
5-Bromo-1-indanol was obtained from 5-bromo-1-indanone by
a method similar to that of Reference Example 32. oil. Methyl
io 4-[(5-bromo-2,3-dihydro-1H-inden-1-yl)oxy]benzenepropanoate
was obtained from methyl 4-hydroxybenzenepropanoate and 5-
bromo-1-indanol by a method similar to that of Reference
Example 33. oil. Then the title compound was obtained from
methyl 4-[(5-bromo-2,3-dihydro-1H-inden-1-
is yl)oxy)benzenepropanoate by a method similar to that of
Reference Example 4. yield from 5-bromo-1-indanone 29~.
melting point: 133-134°C (recrystallized from diethyl ether-
hexane) .
1H NMR (CDC13) g 2.15-2.27 (1H, m), 2.47-2.59 (1H, m), 2.67 (2H,
2o t, J=8.0 Hz), 2.83-2.89 (1H, m), 2.92 (2H, t, J=8.0 Hz), 3.06-
3 .18 ( 1H, m) , 5 . 66 ( 1H, dd, J=4 . 5 Hz, 6 . 5 Hz ) , 6 . 91 ( 2H, d,
J=8.6 Hz), 7.15 (2H, d, J=8.6 Hz), 7.26 (1H, d, J=8.0 Hz),
r
7.36 (1H, d, J=8.6 Hz) , 7.44 (1H, s) .
Example 81 4-[(2,3-dihydro-5-phenoxy-1H-inden-1-
25 yl)oxy)benzenepropanoic acid
5-Phenoxy-1-indanol was obtained from 5-phenoxy-1-
indanone by a method similar to that of Reference Example 32.
oil. Methyl 4-[(2,3-dihydro-5-phenoxy-1H-inden-1-
yl)oxy]benzenepropanoate was obtained from methyl 4-
3o hydroxybenzenepropanoate and 5-phenoxy-1-indanol by a method
similar to that of Reference Example 33. oil. Then the title
compound was obtained from methyl 4-[(2,3-dihydro-5-phenoxy-
1H-inden-1-yl)oxy]benzenepropanoate by a method similar to
that of Reference Example 4. yield from 5-phenoxy-1-indanone
241
CA 02505322 2005-05-06
19~.
melting point: 92-93°C (recrystallized from diethyl ether-
hexane ) .
1H NMR (CDC13) g 2.18-2.29 (1H, m), 2.50-2.61 (1H, m), 2.67 (2H,
t, J=8.0 Hz), 2.81-2.90 (1H, m), 2.90 (2H, t, J=8.0 Hz), 3.05-
3 .18 ( 1H, m) , 5 . 70 ( 1H, dd, J=3 . 9 Hz, 6 . 5 Hz ) , 6 . 87-6 . 90 ( 4H,
m) , 7 .00-7. 17 (5H, m) , 7.29-7 . 38 (3H, m) .
Example 82 methyl 4-[(2,3-dihydro-4-methyl-1H-inden-1-
yl)oxy]benzenepropanoate
4-Methyl-1-indanol was obtained from 4-methyl-1-indanone
by a method similar to that of Reference Example 32. oil. The
title compound was obtained as a white powder from methyl 4-
hydroxybenzenepropanoate and 4-methyl-1-indanol by a method
similar to that of Reference Example 33. yield from 4-methyl-
1-indanone 4~.
1H NMR (CDC13) g 2.15-2.28 (1H, m) , 2.30 (3H, s) , 2.48-2.57 (1H,
m) , 2. 62 (2H, t, J=8.1 Hz) , 2 .78-2. 89 (1H, m) , 2. 91 (2H, t,
J=8.1 Hz), 2.99-3.09 (1H, m), 3.68 (3H, s), 5.73 (1H, dd,
J=4 .1 Hz, 6 . 7 Hz ) , 6 . 93 ( 2H, d, J=8 . 6 Hz ) , 7 .12-7 .19 ( 4H, m) ,
7.25-7.27 (1H, m).
Example 83 4-[(2,3-dihydro-4-methyl-1H-inden-1-
yl)oxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[(2,3-
dihydro-4-methyl-1H-inden-1-yl)oxy]benzenepropanoate by a
method similar to that of Reference Example 4. yield 65~.
melting point: 121-122°C (recrystallized from diethyl ether-
hexane ) .
1H NMR (CDC13) g 2.16-2.27 (1H, m), 2.29 (3H, s), 2.49-2.61 (1H,
m) , 2 . 68 ( 2H, t, J=8 .1 Hz ) , 2 . 7 9-2 . 92 ( 1H, m) , 2 . 92 ( 2H, t,
3o J=g ,1 Hz ) , 3 . 00-3 . 09 ( 1H, m) , 5 . 73 ( 1H, dd, J=4 .1 Hz, 6. 7 Hz
) ,
6.94 (2H, d, J=8.6 Hz), 7.11-7.19 (4H, m), 7.25-7.27 (1H, m).
Example 84 methyl 4-[(2,3-dihydro-5,6-dimethoxy-1H-inden-1-
yl)oxy]benzenepropanoate
5,6-Dimethoxy-1-indanol was obtained from 5,6-dimethoxy-
242
CA 02505322 2005-05-06
1-indanone by a method similar to that of Reference Example 32.
oil. Then the title compound was obtained as a white powder
from methyl 4-hydroxybenzenepropanoate and 5,6-dimethoxy-1-
indanol by a method similar to that of Reference Example 33.
yield from 5,6-dimethoxy-1-indanone 420.
1H NMR (CDC13) $ 2.14-2.26 (1H, m) , 2.49-2. 60 (1H, m) , 2.62 (2H,
t, J=8.2 Hz) , 2.79-2.89 (1H, m) , 2.91 (2H, t, J=8.2 Hz) , 3.04-
3.14 (1H, m) , 3. 68 (3H, s) , 3.86 (3H, s) , 3.89 (3H, s) , 5. 68
(1H, dd, J=3.6 Hz, 6.6 Hz), 6.81 (1H, s), 6.91-6.94 (3H, m),
io 7.14 (2H, d, J=8.5 Hz) .
Example 85 4-[(2,3-dihydro-5,6-dimethoxy-1H-inden-1-
yl)oxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[(2,3-
dihydro-5,6-dimethoxy-1H-inden-1-yl)oxy]benzenepropanoate by a
15 method similar to that of Reference Example 4. yield 43$.
melting point: 90-92~C (recrystallized from diethyl ether-
hexane ) .
1H NMR (CDC13) $ 2.16-2.25 (1H, m) , 2.49-2. 61 (1H, m) , 2.67 (2H,
t, J=8.0 Hz), 2.80-2.91 (1H, m), 2.93 (2H, t, J=8.0 Hz), 3.04-
20 3.15 (1H, m) , 3.89 (3H, s) , 3.91 (3H, s) , 5.69 (1H, dd, J=3.7
Hz, 6. 6 Hz) , 6.80 (1H, s) , 6. 89-6.96 (3H, m) , 7.15 (2H, d,
J=8.6 Hz).
Example 86 methyl 4-[[2,3-dihydro-5-(4-methylphenyl)-1H-inden-
1-yl]oxy]benzenepropanoate
2s 5-(4-Methylphenyl)-1-indanol was obtained from 5-(4-
methylphenyl)-1-indanone by a method similar to that of
Reference Example 32. oil. Then the title compound was
obtained as a white powder from methyl 4-
hydroxybenzenepropanoate and 5-(4-methylphenyl)-1-indanol by a
3o method similar to that of Reference Example 33. yield from 5-
(4-methylphenyl)-1-indanone 31~.
1H NMR (CDC13) g 2.21-2.32 (1H, m) , 2.40 (3H, s) , 2.52-2.62 (1H,
m), 2.63 (2H, t, J=8.0 Hz), 2.92 (2H, t, J=8.0 Hz), 2.96-3.03
(1H, m) , 3. 15-3.26 (1H, m) , 3.68 (3H, s) , 5.76 (1H, dd, J=4. 1
243
CA 02505322 2005-05-06
Hz, 6. 6 Hz) , 6.95 (2H, d, J=8 .6 Hz) , 7.15 (2H, d, J=8.6 Hz) ,
7.23-7.26 (2H, m), 7.43-7.49 (5H, m).
Example 87 4-[[2,3-dihydro-5-(4-methylphenyl)-1H-inden-1-
yl]oxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[[2,3-
dihydro-5-(4-methylphenyl)-1H-inden-1-yl]oxy]benzenepropanoate
by a method similar to that of Reference Example 4. yield 680.
melting point: 159-160~C (recrystallized from ethyl acetate-
hexane ) .
io 1H NMR (CDC13) g 2.20-2.31 (1H, m) , 2.40 (3H, s) , 2.51-2.62 (1H,
m), 2.68 (2H, t, J=8.0 Hz), 2.94 (2H, t, J=8.0 Hz), 2.95-3.00
( 1H, m) , 3 . 14-3 . 22 ( 1H, m) , 5 . 7 6 ( 1H, dd, J=4 . 2 Hz, 6 . 6 Hz ) ,
6.96 (2H, d, J=8.6 Hz), 7.16 (2H, d, J=8.6 Hz), 7.23-7.26 (2H,
m), 7.43-7.50 (5H, m).
i5 Example 88 methyl 4-[[5-(4-fluorophenyl)-2,3-dihydro-1H-inden-
1-yl]oxy]benzenepropanoate
5-(4-Fluorophenyl)-1-indanol was obtained from 5-(4-
fluorophenyl)-1-indanone by a method similar to that of
Reference Example 32. oil. The title compound was obtained as
2° a white powder from methyl 4-hydroxybenzenepropanoate and 5-
(4-fluorophenyl)-1-indanol by a method similar to that of
Reference Example 33. yield from 5-(4-fluorophenyl)-1-
indanone 31°s.
1H NMR (CDC13) g 2.19-2.31 (1H, m), 2.52-2.62 (1H, m), 2.63 (2H,
25 t, J=8.0 Hz), 2.92 (2H, t, J=8.0 Hz), 2.94-3.01 (1H, m), 3.14-
3.25 (1H, m) , 3. 68 (3H, s) , 5.76 (1H, dd, J=4.2 Hz, 6.6 Hz) ,
6.95 (2H, d, J=8.6 Hz), 7.09-7.16 (4H, m), 7.38-7.55 (5H, m).
Example 89 4-[[5-(4-fluorophenyl)-2,3-dihydro-1H-inden-1-
yl]oxy]benzenepropanoic acid
3o The title compound was obtained from methyl 4-[[5-(4-
fluorophenyl)-2,3-dihydro-1H-inden-1-yl]oxy]benzenepropanoate
by a method similar to that of Reference Example 4. yield 860.
melting point: 169-170°C (recrystallized from ethyl acetate-
hexane ) .
244
CA 02505322 2005-05-06
1H NMR (CDC13) $ 2.20-2.31 (1H, m), 2.53-2.64 (1H, m), 2.68 (2H,
t, J=8.0 Hz), 2.93 (2H, t, J=8.0 Hz), 2.95-3.01 (1H, m), 3.14-
3 . 2 5 ( 1H, m) , 5 . 77 ( 1H, dd, J=4 . 2 Hz, 6 . 6 Hz ) , 6 . 96 ( 2H, d,
J=8.6 Hz), 7.09-7.18 (4H, m), 7.39-7.54 (5H, m).
Example 90 methyl 4-(dibenzo[b,d]furan-2-
ylmethoxy)benzenepropanoate
The title compound was obtained as a white powder from
methyl 4-hydroxybenzenepropanoate and 2-
(chloromethyl)dibenzo[b,d]furan by a method similar to that of
to Reference Example 5. yield 35%.
1H NMR (CDC13) g 2. 60 (2H, t, J=8 .1 Hz) , 2. 90 (2H, t, J=8.1 Hz) ,
3. 66 (3H, s) , 5.17 (2H, s) , 6.94 (2H, d, J=8.6 Hz) , 7.13 (2H,
d, J=8 . 6 Hz ) , 7 . 32-7 . 58 ( 5H, m) , 7 . 95 ( 1H, d, J=7 . 8 Hz ) , 8 .
02
(1H, s) .
is Example 91 4-(dibenzo[b,d]furan-2-ylmethoxy)benzenepropanoic
acid
The title compound was obtained from methyl 4-
(dibenzo[b,d]furan-2-ylmethoxy)benzenepropanoate by a method
similar to that of Reference Example 4. yield 80~.
2o melting point: 175-176~C (recrystallized from ethyl acetate-
hexane ) .
1H NMR (CDC13) g 2. 66 (2H, t, J=8.0 Hz) , 2. 92 (2H, t, J=8.0 Hz) ,
.18 ( 2H, s ) , 6 . 94 ( 2H, d, J=8 . 6 Hz ) , 7 . 13 ( 2H, ' d, J=8 . 6 Hz )
,
7 . 32-7 . 58 ( 5H, m) , 7 . 96 ( 1H, d, J=7 . 4 Hz ) , 8 . 03 ( 1H, s ) .
25 Example 92 methyl 4-[(2,3-dihydro-5-phenyl-1H-inden-1-
yl)oxy]benzenepropanoate
5-Phenyl-1-indanol was obtained from 5-phenyl-1-indanone
by a method similar to that of Reference Example 32. oil.
Then the title compound was obtained as a white powder from
3o methyl 4-hydroxybenzenepropanoate and 5-phenyl-1-indanol by a
method similar to that of Reference Example 33. yield from 5-
phenyl-1-indanone 50~.
1H NMR (CDC13) g 2.20-2.31 (1H, m), 2.54-2.70 (1H, m), 2.62 (2H,
t, J=8 . 1 Hz ) , 2 . 92 ( 2H, t, J=8 . 1 Hz ) , 2 . 98-3 . 04 ( 1H, m) , 3
.14-
245
CA 02505322 2005-05-06
3.28 (1H, m), 3.68 (3H, s), 5.77 (1H, dd, J=4.2 Hz, 6.6 Hz),
6.95 (2H, d, J=8. 6 Hz) , 7 .15 (2H, d, J=8. 6 Hz) , 7.32-7. 60 (8H,
m) .
Example 93 4-[(2,3-dihydro-5-phenyl-1H-inden-1-
yl)oxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[(2,3-
dihydro-5-phenyl-1H-inden-1-yl)oxy)benzenepropanoate by a
method similar to that of Reference Example 4. yield 72%.
melting point: 148-149°C (recrystallized from ethyl acetate-
io hexane) .
1H NMR (CDC13) g 2 . 21-2 . 32 ( 1H, m) , 2 . 55-2 . 75 ( 1H, m) , 2 . 69 (
2H,
t, J=8.0 Hz), 2.94 (2H, t, J=8.0 Hz), 2.95-3.01 (1H, m), 3.16-
3.25 (1H, m), 5.78 (1H, dd, J=4.2 Hz, 6.6 Hz), 6.97 (2H, d,
J=8.6 Hz), 7.17 (2H, d, J=8.6 Hz), 7.32-7.60 (8H, m).
i5 Example 94 methyl 4-[[2,3-dihydro-5-(4-methoxyphenyl)-1H-
inden-1-yl)oxy)benzenepropanoate
5-(4-Methoxyphenyl)-1-indanol was obtained from 5-(4-
methoxyphenyl)-1-indanone by a method similar to that of
Reference Example 32. oil. The title compound was obtained as
2° a white powder from methyl 4-hydroxybenzenepropanoate and 5-
(4-methoxyphenyl)-1-indanol by a method similar to that of
Reference Example 33. yield from 5-(4-methoxyphenyl)-1-
indanone 380.
1H NMR (CDC13) g 2.20-2.29 (1H, m), 2.49-2.60 (1H, m), 2.62 (2H,
25 t, J=7.8 Hz), 2.92 (2H, t, J=7.8 Hz), 2.93-3.00 (1H, m), 3.15-
3.23 (1H, m) , 3. 68 (3H, s) , 3.85 (3H, s) , 5.75 (1H, dd, J=4.1
Hz, 6 . 6 Hz ) , 6 . 94-6 . 99 ( 4H, m) , 7 .14 ( 2H, d, J=8 . 6 Hz ) , 7 . 41-
7.53 (5H, m) .
Example 95 4-[[2,3-dihydro-5-(4-methoxyphenyl)-1H-inden-1-
3o yl)oxy)benzenepropanoic acid
The title compound was obtained from methyl 4-[[2,3-
dihydro-5-(4-methoxyphenyl)-1H-inden-1-
yl]oxy]benzenepropanoate by a method similar to that of
Reference Example 4. yield 94$.
246
CA 02505322 2005-05-06
melting point: 151-152°C (recrystallized from ethyl acetate-
hexane) .
1H NMR (CDC13) g 2.19-2. 30 ( 1H, m) , 2 .51-2. 65 ( 1H, m) , 2 . 68 (2H,
t, J=8.0 Hz), 2.94 (2H, t, J=8.0 Hz), 2.96-3.00 (1H, m), 3.14-
3.22 (1H, m), 3.85 (3H, s), 5.70 (1H, dd, J=4.1 Hz, 6.6 Hz),
6 . 94-7 . 00 ( 4H, m) , 7 .17 ( 2H, d, J=8 . 6 Hz ) , 7 . 41-7 . 53 ( 5H, m)
.
Example 96 methyl 4-[[5-(4-chlorophenyl)-2,3-dihydro-1H-inden-
1-yl]oxy]benzenepropanoate
5-(4-Chlorophenyl)-1-indanol was obtained from 5-(4-
lo chlorophenyl)-1-indanone by a method similar to that of
Reference Example 32. oil. The title compound was obtained as
a white powder from methyl 4-hydroxybenzenepropanoate and 5-
(4-chlorophenyl)-1-indanol by a method similar to that of
Reference Example 33. yield from 5-(4-chlorophenyl)-1-
15 indanone 430.
1H NMR (CDC13) g 2.16-2.30 (1H, m), 2.50-2.56 (1H, m), 2.62 (2H,
t, J=8.0 Hz), 2.92 (2H, t, J=8.0 Hz), 2.94-3.02 (1H, m), 3.14-
3 . 23 ( 1H, m) , 3 . 68 ( 3H, s ) , 5 . 7 6 ( 1H, dd, J=4 . 3 Hz, 6 . 5 Hz )
,
6.94 (2H, d, J=8. 6 Hz) , 7.15 (2H, d, J=8. 6 Hz) , 7.38-7.52 (7H,
2o m) .
Example 97 4-[[5-(4-chlorophenyl)-2,3-dihydro-1H-inden-1-
yl]oxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[(5-(4-
chlorophenyl)-2,3-dihydro-1H-inden-1-yl]oxy]benzenepropanoate
25 by a method similar to that of Reference Example 4. yield 93~.
melting point: 165-166°C (recrystallized from ethyl acetate-
hexane ) .
1H NMR ( CDC13) g 2 .18-2 . 31 ( 1H, m) , 2 . 51-2 . 63 ( 1H, m) , 2 . 68 (
2H,
t, J=7.8 Hz), 2.93 (2H, t, J=7.8 Hz), 2.97-3.02 (1H, m), 3.15-
30 3 .19 ( 1H, m) , 5 . 77 ( 1H, dd, J=4 . 3 Hz, 6. 4 Hz ) , 6 . 96 ( 2H, d,
J=8.4 Hz), 7.17 (2H, d, J=8.4 Hz), 7.38-7.55 (7H, m).
Example 98 (+)-4-[(5-chloro-2,3-dihydro-1H-inden-1-
yl)oxy]benzenepropanoic acid
4-[(5-Chloro-2,3-dihydro-1H-inden-1-
247
CA 02505322 2005-05-06
yl)oxy]benzenepropanoic acid (50 mg) was separated by high
performance liquid chromatography (column:CHIRALCEL OJ (50
mmIDX500 mm, manufactured by DAICEL CHEMICAL INDUSTRIES, LTD.),
mobile phase: hexane/ethanol=4:1, flow rate: 70 mL/min, column
temperature: 35°C) to give the title compound (24 mg).
[a] 023 +8. 2° (c 0. 45, CHC13) .
Example 99 (-)-4-[(5-chloro-2,3-dihydro-1H-inden-1-
yl)oxy]benzenepropanoic acid
4-[(5-Chloro-2,3-dihydro-1H-inden-1-
io yl)oxy]benzenepropanoic acid (50 mg) was separated by high
performance liquid chromatography (column:CHIRALCEL OJ (50
mmIDX500 mm, manufactured by DAICEL CHEMICAL INDUSTRIES, LTD.),
mobile phase: hexane/ethanol=4:1, flow rate: 70 mL/min, column
temperature: 35°C) to give the title compound (23 mg).
15 [a] Dzs _6. 2° (c 0 . 53, CHC13) .
Example 100 methyl 4-(benzo[b]thiophen-3-
ylmethoxy)benzenepropanoate
The title compound was obtained from 3-
benzo[b]thiophenecarboxaldehyde and methyl 4-
2o hydroxybenzenepropanoate by a method similar to that of
Reference Example 53. yield 79°s, oil.
1H I~IR (CDC13) g 2. 67 (2H, t, J=7.4 Hz) , 2. 90 (2H, t, J=7.4 Hz) ,
3.69 (3H, s), 5.27 (2H, s), 6.96 (2H, d, J=8.6 ~z), 7.15 (2H,
d, J=8.6 Hz), 7.33-7.40 (2H, m), 7.48 (1H, s), 7.80-7.90 (2H,
25 m) .
Example 101 4-(benzo[b]thiophen-3-ylmethoxy)benzenepropanoic
acid
The title compound was obtained from methyl 4-
(benzo[b]thiophen-3-ylmethoxy)benzenepropanoate by a method
3o similar to that of Reference Example 38. yield 86°s.
melting point: 125-126°C (recrystallized from ethyl
acetate-diisopropyl ether).
1H NMR ( CDC13 ) g 2 . 65 ( 2H, t, J=7 . 4 Hz ) , 2 . 90 ( 2H, t, J=7 . 4 Hz )
,
5.25 (2H, s), 6.95 (2H, d, J=8.6 Hz), 7.15 (2H, d, J=8.6 Hz),
248
CA 02505322 2005-05-06
7.30-7.40 (2H, m), 7.45 (1H, s), 7.81-7.89 (2H, m).
Example 102 methyl 4-(1H-indol-2-ylmethoxy)benzenepropanoate
The title compound was obtained from 1H-indole-2-methanol
and methyl 4-hydroxybenzenepropanoate by a method similar to
that of Reference Example 1. yield 12~.
melting point: 156-157°C (recrystallized from ethyl
acetate-diisopropyl ether).
1H NMR (CDC13) $ 2.59 (2H, t, J=7.4 Hz) , 2. 89 (2H, t, J=7.4 Hz) ,
3 . 6 6 ( 3H, s ) , 5 . 21 ( 2H, s ) , 6 . 52 ( 1H, s ) , 6 . 92 ( 2H, d, J=8
. 6
1o Hz), 7.08-7.21 (4H, m), 7.35 (1H, d, J=7.4 Hz), 7.59 (1H, d,
J=7.5 Hz), 8.33 (1H, br s).
Example 103 4-(1H-indol-2-ylmethoxy)benzenepropanoic acid
The title compound was obtained from methyl 4-(1H-indol-
2-ylmethoxy)benzenepropanoate by a method similar to that of
is Reference Example 38. yield 53$.
melting point: 131-133°C (recrystallized from ethyl
acetate-diisopropyl ether).
1H NMR (CDC13) g 2. 65 (2H, t, J=7.4 Hz) , 2. 91 (2H, t, J=7.4 Hz) ,
5.21 (2H, s) , 6.52 (1H, s) , 6.91 (2H, d, J=8.6 Hz) , 7.09-7.22
20 (4H, m) , 7.31 (1H, d, J=7.4 Hz) , 7.57 (1H, d, J=7.5 Hz) , 8.33
( 1H, br s ) .
Example 104 4-[(2,3-dihydro-7-methyl-1H-inden-1-
yl)oxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[(2,3-
25 dihydro-7-methyl-1H-inden-1-yl)oxy]benzenepropanoate by a
method similar to that of Reference Example 4. yield 38~.
melting point: 128-129°C (recrystallized from diethyl ether-
hexane ) .
1H NMR (CDC13) g 2.27-2.50 (2H, m) , 2.33 (3H, s) , 2. 67 (2H, t,
3o J=g . 0 Hz ) , 2 . 90 ( 1H, m) , 2 . 92 ( 2H, t, J=8 . 0 Hz ) , 3 . 15 (
1H, m) ,
5.74 (1H, dd, J=1.7 Hz, 3.5 Hz) , 6.92 (2H, d, J=8. 6 Hz) , 7.06
( 1H, d, J=7 . 3 Hz ) , 7 .12-7 . 23 ( 4H, m) .
Example 105 methyl 4-[(3-chlorobenzo[b]thien-2-
yl)methoxy]benzenepropanoate
249
CA 02505322 2005-05-06
A mixture of methyl 4-hydroxybenzenepropanoate (0.91 g,
5.0 mmol), 3-chloro-2-benzothiophenemethanol (1.0 g, 5.0 mmol),
tetrahydrofuran (50 mL), tributylphosphine (1.3 g, 6.5 mmol)
and azodicarbonyldipiperazine (1.7 g, 6.5 mmol) was stirred
overnight at room temperature. The reaction mixture was
concentrated, and filtered. The filtrate was diluted with
ethyl acetate, and washed with water. The organic layer was
dried over anhydrous magnesium sulfate, and the solvent was
evaporated under reduced pressure. The residue was purified
to by silica gel column chromatography (hexane/ethyl acetate=5:1)
to give the title compound (1.6 g, yield 870).
melting point: 97-98~C (recrystallized from ethyl
acetate-diisopropyl ether-hexane).
1H NMR (CDC13) g 2. 59 (2H, t, J=7.5 Hz) , 2. 89 (2H, t, J=7.5 Hz) ,
ss 3. 66 (3H, s) , 5.36 (2H, s) , 6.93 (2H, d, J=8. 6 Hz) , 7.12 (2H,
d, J=8.6 Hz), 7.37-7.48 (2H, m), 7.77-7.84 (2H, m).
Example 106 4-[(3-chlorobenzo[b]thien-2-
yl)methoxy]benzenepropanoic acid
A mixture of methyl 4-[(3-chlorobenzo[b]thien-2-
2o yl ) methoxy] benzenepropanoate ( 1. 5 g, 4 . 0 mmol ) ,
tetrahydrofuran (20 mL), methanol (5 mL), water (2 mL) and
lithium hydroxide monohydrate (0.34 g, 8.0 mmol) was stirred
overnight at room temperature. The reaction mixture was
neutralized with 0.5N hydrochloric acid, and the mixture was
25 extracted with ethyl acetate. The organic layer was washed
with saturated brine and dried over anhydrous magnesium
sulfate, and the solvent was evaporated under reduced pressure.
The residue was purified by silica gel column chromatography
(hexane/ethyl acetate=3:1) to give the title compound (1.3 g,
3o yield 94~).
melting point: 136-137~C (recrystallized from ethyl
acetate-diisopropyl ether).
1H NMR (CDC13) $ 2.65 (2H, t, J=7.5 Hz), 2.91 (2H, t, J=7.5 Hz),
. 37 ( 2H, s ) , 6 . 94 ( 2H, d, J=8 . 7 Hz ) , 7 . 13 ( 2H, d, J=8 . 7Hz ) ,
250
CA 02505322 2005-05-06
7.38-7.45 (2H, m), 7.77-7.83 (2H, m), 9.68 (1H, br s).
Example 107 methyl 4-[(3-methylbenzo[b]thien-2-
yl)methoxy]benzenepropanoate
The title compound was obtained from methyl 4-
hydroxybenzenepropanoate and 3-methyl-2-
benzo[b]thiophenemethanol by a method similar to that of
Example 105. yield 520.
melting point: 149-150°C (recrystallized from ethyl
acetate-diisopropyl ether-hexane).
1~ 1H NMR (CDC13) g 2. 43 (3H, s) , 2. 60 (2H, t, J=7.5 Hz) , 2. 90 (2H,
t, J=7. 5 Hz) , 3. 66 (3H, s) , 5.26 (2H, s) , 6. 93 (2H, d, J=8.7
Hz), 7.13 (2H, d, J=8.6 Hz), 7.31-7.41 (2H, m), 7.68-7.71 (1H,
m), 7.79-7.82 (1H, m) .
Example 108 4-[(3-methylbenzo[b]thien-2-
15 yl)methoxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[(3-
methylbenzo[b]thien-2-yl)methoxy]benzenepropanoate by a method
similar to that of Example 106. yield 790.
melting point: 155-156°C (recrystallized from ethyl
2° acetate-diisopropyl ether).
1H NMR (CDC13) g 2.42 (3H, s) , 2. 65 (2H, t, J=7.4 Hz) , 2.91 (2H,
t, J=7 . 4 Hz ) , 5 . 2 6 ( 2H, s ) , 6 . 94 ( 2H, d, J=8 . 7 Hz ) , 7 .14 (
2H,
d, J=8.6 Hz), 7.30-7.41 (2H, m), 7.68-7.71 (1H,'m), 7.78-7.82
( 1H, m) , 9 . 82 ( 1H, br s ) .
2s Example 109 methyl 4-(2-benzofuranylmethoxy)benzenepropanoate
The title compound was obtained from methyl 4-
hydroxybenzenepropanoate and 2-benzofuranmethanol by a method
similar to that of Example 105. yield 81°s.
melting point: 93-94°C (recrystallized from ethyl acetate-
3o hexane).
1H NMR (CDC13) g 2. 60 (2H, t, J=7.5 Hz) , 2. 90 (2H, t, J=7.5 Hz) ,
3. 66 (3H, s) , 5. 14 (2H, s) , 6.77 (1H, s) , 6. 94 (2H, d, J=8.7
Hz) , 7. 13 (2H, d, J=8.7 Hz) , 7.20-7. 32 (2H, m) , 7.48-7. 57 (2H,
m) .
251
CA 02505322 2005-05-06
Example 110 4-(2-benzofuranylmethoxy)benzenepropanoic acid
The title compound was obtained from methyl 4-(2
benzofuranylmethoxy)benzenepropanoate by a method similar to
that of Example 106. yield 790.
s melting point: 155-156°C (recrystallized from ethyl
acetate-diisopropyl ether).
1H I~IR ( CDC13 ) $ 2 . 65 ( 2H, t, J=7 . 5 Hz ) , 2 . 91 ( 2H, t, J=7 . 5 Hz
) ,
5.15 (2H, s) , 6.77 (1H, s) , 6.95 (2H, d, J=8.6 Hz) , 7.14 (2H,
d, J=8 . 6 Hz ) , 7 . 2 0-7 . 32 ( 2H, m) , 7 . 4 9-7 . 57 ( 2H, m) , 9 . 67 (
1H,
1o br s) .
Example 111 methyl 4-(benzo[b]thien-2-
ylmethoxy)benzenepropanoate
The title compound was obtained from methyl 4-
hydroxybenzenepropanoate and 2-benzo[b]thiophenemethanol by a
Is method similar to that of Example 105. yield 35$.
melting point: 154-156°C (recrystallized from petroleum ether).
1H NMR (CDC13) g 2. 59 (2H, t, J=7.5 Hz) , 2. 90 (2H, t, J=7.5 Hz) ,
3.66 (3H, s), 5.30 (2H, s), 6.93 (2H, d, J=8.7 Hz), 7.15 (2H,
2o d, J=8.7 Hz), 7.27-7.37 (3H, m), 7.72-7.80 (2H, m).
Example 112 4-(benzo[b]thien-2-ylmethoxy)benzenepropanoic acid
The title compound was obtained from methyl 4-
(benzo[b]thien-2-ylmethoxy)benzenepropanoate by~a method
similar to that of Example 106, yield 81$.
2s melting point: 190-191°C (recrystallized from ethyl
acetate-diisopropyl ether).
1H NMR ( CDC13 ) $ 2 . 65 ( 2H, t, J=7 . 5 Hz ) , 2 . 91 ( 2H, t, J=7 . 5 Hz )
,
5.30 (2H, s) , 6. 93 (2H, d, J=8.7 Hz) , 7.15 (2H, d, J=8.7 Hz) ,
7.28-7.37 (3H, m), 7.73-7.83 (2H, m), 9.82 (1H, br s).
3o Example 113 methyl 4-([1,1'-biphenyl]-3-ylmethoxy)-3-
bromobenzenepropanoate
The title compound was obtained from methyl 3-bromo-4-
hydroxybenzenepropanoate and [1,1'-biphenyl]-3-methanol by a
method similar to that of Reference Example 1. yield 96~, oil.
252
CA 02505322 2005-05-06
1H NMR (CDC13) g 2. 59 (2H, t, J=7.3 Hz) , 2. 87 (2H, t, J=7.3 Hz) ,
3. 66 (3H, s) , 5.19 (2H, s) , 6.88 (1H, d, J=8.4 Hz) , 7.06 (1H,
dd, J=1 . 8 Hz, 8 . 4 Hz ) , 7 . 33-7 . 37 ( 1H, m) , 7 . 41-7 . 47 ( 5H, m) ,
7 . 52-7 . 62 ( 3H, m) , 7 . 71 ( 1H, s ) .
Example 114 4-([1,1'-biphenyl]-3-ylmethoxy)-3-
bromobenzenepropanoic acid
The title compound was obtained from methyl 4-([1,1'-
biphenyl]-3-ylmethoxy)-3-bromobenzenepropanoate by a method
similar to that of Reference Example 4. yield 870.
to melting point: 83-84°C (recrystallized from ethyl acetate-
hexane ) .
1H IWR (CDC13) g 2. 64 (2H, t, J=7.4 Hz) , 2.88 (2H, t, J=7.4 Hz) ,
5.19 (2H, s) , 6.89 (1H, d, J=8.4 Hz) , 7.07 (1H, dd, J=2.0 Hz,
8 .4 Hz) , 7. 33-7 . 38 ( 1H, m) , 7 .42-7. 48 (5H, m) , 7. 53-7. 62 (3H,
i5 m) , 7.70 (1H, s) .
Example 115 methyl 4-(2-
benzothiazolylmethoxy)benzenepropanoate
The title compound was obtained from methyl 4-
hydroxybenzenepropanoate and 2-benzothiazolemethanol by a
2o method similar to that of Example 105. yield 91~.
melting point: °C (recrystallized from ethyl acetate-
diisopropyl ether).
1H NMR ( CDC13 ) g 2 . 59 ( 2H, t, J=7 . 5 Hz ) , 2 . 90 ( 2~I, t, J=7 . 5 Hz
) ,
3.66 (3H, s), 5.56 (2H, s), 6.96 (2H, d, J=8.7 Hz), 7.13 (2H,
2s d, J=8 . 7 Hz ) , 7 . 37-7 . 53 ( 2H, m) , 7 . 8 9 ( 1H, d, J=8 . 0 Hz ) ,
8 . 03
( 1H, d, J=8 . 0 Hz ) .
Example 116 4-(2-benzothiazolylmethoxy)benzenepropanoic acid
The title compound was obtained from methyl 4-(2-
benzothiazolylmethoxy)benzenepropanoate by a method similar to
3o that of Example 106. yield 93$.
melting point: 158-159°C (recrystallized from ethyl
acetate-diisopropyl ether).
1H NMR (DMSO-d6) $ 2.48 (2H, t, J=7.5 Hz) , 2.75 (2H, t, J=7.5
Hz ) , 5 . 56 ( 2H, s ) , 7 . O1 ( 2H, d, J=6 . 8 Hz ) , 7 . 16 ( 2H, d, J=6 .
8
253
CA 02505322 2005-05-06
Hz), 7.43-7.57 (2H, m), 8.01 (1H, d, J=7.7 Hz), 8.11 (1H, d,
J=7.7 Hz) , 12.01 (1H, br s) .
Example 117 methyl 4-[(1-methyl-1H-indol-2-
yl)methoxy]benzenepropanoate
The title compound was obtained from methyl 4-
hydroxybenzenepropanoate and 1-methyl-2-indolemethanol by a
method similar to that of Example 105. yield 28$.
melting point: 157-158°C (recrystallized from ethyl
acetate-diisopropyl ether).
io 1H I~IR (CDC13) g 2. 60 (2H, t, J=7.5 Hz) , 2. 90 (2H, t, J=7.5 Hz) ,
3. 67 (3H, s) , 3.80 (3H, s) , 5.16 (2H, s) , 6. 58 (1H, s) , 6.93
( 2H, d, J=8 . 6 Hz ) , 7 . 07-7 .15 ( 2H, m) , 7 . 21-7 . 2 5 ( 2H, m) , 7 .
31-
7 . 34 ( 1H, m) , 7 . 59 ( 1H, d, J=7 . 9 Hz ) .
Example 118 4-[(1-methyl-1H-indol-2-
15 yl)methoxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[(1-methyl-
1H-indol-2-yl)methoxy]benzenepropanoate by a method similar to
that of Example 106. yield 21%.
melting point: 151-152°C (recrystallized from ethyl
Zo acetate-diisopropyl ether).
1H NMR (DMSO-d6) $ 2.51 (2H, t, J=7.5 Hz), 2.75 (2H, t, J=7.5
Hz), 3.32 (3H, s), 5.26 (2H, s), 6.59 (1H, s), 7.00-7.05 (3H,
m) , 7 .14-7 . 19 ( 3H, m) , 7 . 45 ( 1H, d, J=8 . 3 Hz ) , '~ . 53 ( 1H, d,
J=8.3 Hz), 12.08 (1H, br s).
2s Example 119 methyl 4-[(6,7,8,9-tetrahydro-5H-benzocyclohepten-
5-yl)oxy]benzenepropanoate
The title compound was obtained from methyl 4-
hydroxybenzenepropanoate and 6,7,8,9-tetrahydro-5H-
benzocyclohepten-5-one by a method similar to that of Example
30 105. yield 360, oil.
1H NMR (CDC13) g 1.43-1.55 (1H, m), 1.79-1.21 (3H, m), 2.04-
2.15 (2H, m), 2.57 (2H, t, J=7.5 Hz), 2.76-3.00 (4H, m), 3.65
(3H, s) , 5.28 (1H, d, J=9. 1 Hz) , 6.79 (2H, d, J=8.6 Hz) , 7.05
(2H, d, J=8.6 Hz), 7.12-7.16 (3H, m), 7.33-7.35 (1H, m).
254
CA 02505322 2005-05-06
Example 120 4-[(6,7,8,9-tetrahydro-5H-benzocyclohepten-5-
yl)oxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[(6,7,8,9-
tetrahydro-5H-benzocyclohepten-5-yl)oxy]benzenepropanoate by a
method similar to that of Example 106. yield 65$.
melting point: 129-130°C (recrystallized from ethyl
acetate-diisopropyl ether).
1H I~IR (DMSO-d6) g 1. 39-1.48 ( 1H, m) , 1 . 67-2. 05 (5H, m) , 2. 46
( 2H, t, J=7 . 5 Hz ) , 2 . 72 ( 2H, t, J=7 . 5 Hz ) , 2 . 81-2 . 97 ( 2H, m)
,
io 5.46 (1H, d, J=8.4 Hz) , 6.84 (2H, d, J=8.6 Hz) , 7.07-7.16 (5H,
m), 7.24-7.30 (1H, m), 12.08 (1H, br s).
Example 121 methyl 4-[[4-(trifluoromethyl)benzo[b]thien-2-
yl]methoxy]benzenepropanoate
The title compound was obtained from methyl 4-
15 hydroxybenzenepropanoate and 4-(trifluoromethyl)-2-
benzo[b]thiophenemethanol by a method similar to that of
Example 105. yield 69~.
melting point: 76-77°C (recrystallized from petroleum ether).
1H I~IR (CDC13) $ 2. 60 (2H, t, J=7 .5 Hz) , 2. 90 (2H, t, J=7.5 Hz) ,
20 3_66 (3H, s), 5.34 (2H, s), 6.93 (2H, d, J=8.7 Hz), 7.14 (2H,
d, J=8.7 Hz), 7.36-7.41 (1H, m), 7.53-7.55 (1H, m), 7.65 (1H,
d, J=8 . 3 Hz ) , 7 . 98 ( 1H, d, J=8 . 3 Hz ) .
Example 122 4-[[4-(trifluoromethyl)benzo[b]thien-2-
yl]methoxy]benzenepropanoic acid
2s The title compound was obtained from methyl 4-[[4-
(trifluoromethyl)benzo(b]thien-2-yl]methoxy]benzenepropanoate
by a method similar to that of Example 106. yield 82o.
melting point: 151-152°C (recrystallized from ethyl
acetate-diisopropyl ether).
30 1H NMR (DMSO-d6) $ 2. 46 (2H, t, J=7.5 Hz) , 2.75 (2H, t, J=7.5
Hz ) , 5 . 50 ( 2H, s ) , 6 . 97 ( 2H, d, J=8 . 8 Hz ) , 7 .15 ( 2H, d, J=8 .
8
Hz ) , 7 . 53 ( 1H, t, J=7 . 7 Hz ) , 7 . 65 ( 1H, s ) , 7 . 77 ( 1H, d, J=7 .
5
Hz ) , 8 . 31 ( 1H, d, J=7 . 5 Hz ) , 12 . 08 ( 1H, br s ) .
Example 123 methyl 4-[(3'-chloro-[l,l'-biphenyl]-3-
255
CA 02505322 2005-05-06
yl)methoxy]benzenepropanoate
The title compound was obtained from methyl 4-[(3-
bromophenyl)methoxy]benzenepropanoate and 3-
chlorophenylboronic acid by a method similar to that of
Example 22. yield 860, oil.
1H NMR (CDC13) g 2. 60 (2H, t, J=8.0 Hz) , 2. 90 (2H, t, J=8.0 Hz) ,
3 . 6 6 ( 3H, s ) , 5 .10 ( 2H, s ) , 6 . 92 ( 2H, d, J=8 . 6 Hz ) , 7 .13 (
2H,
d, J=8.6 Hz), 7.30-7.39 (2H, m), 7.42-7.54 (4H, m), 7.58-7.62
( 2H, m) .
io Example 124 4-[(3'-chloro-[1,1'-biphenyl]-3-
yl)methoxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[(3'-
chloro-[1,1'-biphenyl]-3-yl)methoxy]benzenepropanoate by a
method similar to that of Reference Example 4. yield 340.
melting point: 109-110~C (recrystallized from ethyl acetate-
hexane ) .
1H NMR (CDC13) g 2. 65 (2H, t, J=7.8 Hz) , 2. 91 (2H, t, J=7.8 Hz) ,
5 .10 ( 2H, s ) , 6 . 93 ( 2H, d, J=8 . 4 Hz ) , 7 . 14 ( 2H, d, J=8 . 4 Hz )
,
7.31-7.53 (6H, m), 7.62 (1H, s), 7.58 (1H, s).
Zo Example 125 methyl 4- [ (2' -chloro- [l, 1' -biphenyl] -3-
yl)methoxy]benzenepropanoate
The title compound was obtained from methyl 4-[(3-
bromophenyl)methoxy]benzenepropanoate and 2- '
chlorophenylboronic acid by a method similar to that of
2s Example 22. yield 83~, oil.
1H NMR ( CDC13 ) g 2 . 60 ( 2H, t, J=8 .1 Hz ) , 2 . 90 ( 2H, t, J=8 .1 Hz ) ,
3 . 66 ( 3H, s ) , 5 . 09 ( 2H, s ) , 6 . 92 ( 2H, d, J=8 . 7 Hz ) , 7 .12 (
2H,
d, J=8.6 Hz), 7.27-7.50 (8H, m).
Example 126 4-[(2'-chloro-[l,l'-biphenyl]-3-
3o yl)methoxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[(2'-
chloro-[1,1'-biphenyl]-3-yl)methoxy]benzenepropanoate by a
method similar to that of Reference Example 4. yield 29~.
melting point: 127-128°C (recrystallized from ethyl acetate-
256
CA 02505322 2005-05-06
hexane ) .
1H NMR (CDC13) g 2.65 (2H, t, J=7.8 Hz), 2.91 (2H, t, J=7.8 Hz),
5.10 (2H, s), 6.93 (2H, d, J=8.5 Hz), 7.13 (2H, d, J=8.5 Hz),
7.28-7.50 (8H, m).
Example 127 methyl 4-[(3'-methyl-[1,1'-biphenyl]-3-
yl)methoxy]benzenepropanoate
The title compound was obtained from methyl 4-[(3-
bromophenyl)methoxy]benzenepropanoate and 3-
methylphenylboronic acid by a method similar to that of
to Example 22. yield 92$, oil.
1H NMR (CDC13) g 2.42 (3H, s) , 2. 60 (2H, t, J=8.0 Hz) , 2.90 (2H,
t, J=8 . 0 Hz ) , 3 . 66 ( 3H, s ) , 5 . 60 ( 2H, s ) , 6 . 93 ( 2H, d, J=8 .
6
Hz ) , 7 . 10-7 .18 ( 3H, m) , 7 . 30-7 . 47 ( 5H, m) , 7 . 54 ( 1H, dt, J=7 .
3
Hz, 1 .7 Hz) , 7. 64 (1H, s) .
is Example 128 4- [ ( 3' -methyl- [ 1, 1' -biphenyl ] -3-
yl)methoxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[(3'-
methyl-[1,1'-biphenyl]-3-yl)methoxy]benzenepropanoate by a
method similar to that of Reference Example 4. yield 62~.
2° melting point: 102-103°C (recrystallized from ethyl acetate-
hexane) .
1H NMR (CDC13) g 2. 42 (3H, s) , 2. 65 (2H, t, J=8.0 Hz) , 2. 91 (2H,
t, J=8 . 0 Hz ) , 5 .10 ( 2H, s ) , 6 . 93 ( 2H, d, J=8 . 6 I~z ) , 7 .12-7
.18
( 3H, m) , 7 . 30-7 . 47 ( 5H, m) , 7 . 54 ( 1H, dt, J=7 . 3 Hz, 1. 6 Hz ) ,
25 7 . 64 ( 1H, s ) .
Example 129 methyl 4-[(3'-fluoro-[1,1'-biphenyl]-3-
yl)methoxy]benzenepropanoate
The title compound was obtained from methyl 4-[(3-
bromophenyl)methoxy]benzenepropanate and 3-fluorophenylboronic
so acid by a method similar to that of Example 22. yield 89~,
oil.
1H NMR (CDC13) g 2. 60 (2H, t, J=8 .1 Hz) , 2. 90 (2H, t, J=8.1 Hz) ,
3.66 (3H, s), 5.10 (2H, s), 6.92 (2H, d, J=8.6 Hz), 7.01-7.08
(1H, m) , 7. 13 (2H, d, J=8. 6 Hz) , 7.27-7.31 (1H, m) , 7.36-7.55
257
CA 02505322 2005-05-06
( 5H, m) , 7 . 63 ( 1H, s ) .
Example 130 4-[(3'-fluoro-[l,l'-biphenyl)-3-
yl)methoxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[(3'-
fluoro-[l,1'-biphenyl]-3-yl)methoxy]benzenepropanoate by a
method similar to that of Reference Example 4. yield 620.
melting point: 113-114~C (recrystallized from ethyl acetate-
hexane ) .
1H NMR (CDC13) g 2.65 (2H, t, J=8.0 Hz), 2.91 (2H, t, J=8.0 Hz),
i o 5 .10 ( 2H, s ) , 6 . 93 ( 2H, d, J=8 . 6 Hz ) , 7 . O1-7 . 07 ( 1H, m) ,
7 .14
( 2H, d, J=8 . 6 Hz ) , 7 . 27-7 . 31 ( 1H, m) , 7 . 35-7 . 55 ( 5H, m) , 7 .
63
( 1H, m) .
Example 131 methyl 4-[(3'-methoxy-[l,l'-biphenyl]-3-
yl)methoxy]benzenepropanoate
i5 The title compound was obtained from methyl 4-[(3-
bromophenyl)methoxy]benzenepropanoate and 3-
methoxyphenylboronic acid by a method similar to that of
Example 22. yield 89°s.
1H NMR ( CDC13 ) g 2 . 60 ( 2H, t, J=8 .1 Hz ) , 2 . 90 ( 2H, t, J=8 .1 Hz ) ,
20 3.66 (3H, s), 3.87 (3H, s), 5.10 (2H, s), 6.89-6.94 (3H, m),
7.11-7.14 (3H, m), 7.17-7.19 (1H, m), 7.33-7.47 (3H, m), 7.54
(1H, dt, J=7.1 Hz, 1.7 Hz), 7.64 (1H, s).
Example 132 4-((3'-methoxy-[l,l'-biphenyl]-3- '
yl)methoxy]benzenepropanoic acid
2s The title compound was obtained from methyl 4-[(3'-
methoxy-(1,1'-biphenyl]-3-yl)methoxy]benzenepropanoate by a
method similar to that of Reference Example 4. yield 620.
1H NMR ( CDC13 ) g 2 . 65 ( 2H, t, J=7 . 9 Hz ) , 2 . 91 ( 2H, t, J=7 . 9 Hz )
,
3.86 (3H, s), 5.10 (2H, s), 6.88-6.95 (3H, m), 7.11-7.19 (4H,
3o m)~ 7,33-7.47 (3H, m), 7.54 (1H, dt, 7.1 Hz, 1.7 Hz), 7.64 (1H,
s) .
Example 133 methyl 4-[(3'-nitro-[l,l'-biphenyl]-3-
yl)methoxy]benzenepropanoate
The title compound was obtained from methyl 4-[(3-
258
CA 02505322 2005-05-06
bromophenyl)methoxy]benzenepropanoate and 3-nitrophenylboronic
acid by a method similar to that of Example 22. yield 74%,
oil.
1H NMR (CDC13) $ 2. 60 (2H, t, J=8.1 Hz) , 2.90 (2H, t, J=8.1 Hz) ,
3 . 6 6 ( 3H, s ) , 5 .12 ( 2H, s ) , 6 . 93 ( 2H, d, J=8 . 6 Hz ) , 7 .13 (
2H,
d, J=8.6 Hz), 7.48-7.65 (4H, m), 7.69 (1H, s), 7.91-7.94 (1H,
m), 8.19-8.23 (1H, m), 8.46 (1H, t, J=2.0 Hz).
Example 134 4-[(3'-nitro-[1,1'-biphenyl]-3-
yl)methoxy]benzenepropanoic acid
to The title compound was obtained from methyl 4-[(3'-nitro-
[1,1'-biphenyl]-3-yl)methoxy]benzenepropanoate by a method
similar to that of Reference Example 4. yield 51~.
melting point: 114-115~C (recrystallized from ethyl acetate-
hexane ) .
15 1H ~ (CDC13) $ 2. 66 (2H, t, J=7.8 Hz) , 2. 91 (2H, t, J=7.8 Hz) ,
.12 ( 2H, s ) , 6 . 94 ( 2H, d, J=8 . 6 Hz ) , 7 .15 ( 2H, d, J=8 . 6 Hz ) ,
7.48-7.64 (4H, m), 7.69 (1H, s), 7.90-7.94 (1H, m), 8.19-8.23
( 1H, m) , 8 . 4 6 ( 1H, t, J=1 . 9 Hz ) .
Example 135 methyl 4-[[3-[(2,3-dihydro-1H-inden-1-
Zo yl)oxy]phenyl]methoxy]benzenepropanoate
The title compound was obtained from methyl 4-
hydroxybenzenepropanoate and 3-[(2,3-dihydro-1H-inden-1-
yl)oxy]benzenemethanol by a method similar to that of
Reference Example 1. yield 82~, oil.
2s 1H I~IMR (CDC13) g 2. 10-2.30 (1H, m) , 2.50-2. 65 (3H, m) , 2.87-
3.00 (3H, m) , 3.09-3.20 ( 1H, m) , 3. 66 (3H, s) , 5.03 (2H, s) ,
5.78 (1H, dd, J=6. 6 Hz, 4.4 Hz) , 6.88-6.98 (3H, m) , 7.02 (1H,
d, J=7.6 Hz), 7.09-7.13 (3H, m), 7.19-7.35 (4H, m), 7.42 (1H,
d, J=7 . 3 Hz ) .
3o Example 136 4-[[3-[(2,3-dihydro-1H-inden-1-
yl)oxy]phenyl]methoxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[[3-[(2,3-
dihydro-1H-inden-1-yl)oxy]phenyl]methoxy]benzenepropanoate by
a method similar to that of Reference Example 4. yield 550.
259
CA 02505322 2005-05-06
melting point: 119-121°C (recrystallized from ethyl acetate-
hexane ) .
1H NMR (CDC13) g 2.15-2.26 (1H, m) , 2.50-2.59 (1H, m) , 2. 65 (2H,
t, J=8.1 Hz), 2.90 (2H, t, J=8.1 Hz), 2.88-2.97 (1H, m), 3.09-
3.19 (1H, m) , 5. 03 (2H, s) , 5.78 (1H, dd, J=6. 6 Hz, 4 .3 Hz) ,
6.88-6.98 (3H, m), 7.02 (1H, d, J=7.5 Hz), 7.09-7.17 (3H, m),
7 . 20-7 . 34 ( 4H, m) , 7 . 42 ( 1H, d, J=7 . 3 Hz ) .
Example 137 methyl 4-[[3-((E)-2-
phenylethenyl)phenyl]methoxy]benzenepropanoate
io Methyl 4-[(3-bromophenyl)methoxy]benzenepropanoate (1.0 g,
2.9 mmol), styrene (0.45 g, 4.3 mmol), sodium
hydrogencarbonate (0.60 g, 7.2 mmol), tetrabutylammonium
chloride (1.6 g, 5.7 mmol) were dissolved in N,N-
dimethylformamide (25 mL) and, after argon substitution,
15 palladium acetate (19 mg, 0.086 mmol) was added. The reaction
mixture was heated under an argon atmosphere at 100°C for 18
hrs. The reaction mixture was cooled, water was added to the
reaction mixture and the mixture was extracted with ethyl
acetate. The extract was washed with water, dried and
2o concentrated. The residue was purified by silica gel column
chromatography (ethyl acetate/hexane=15:1) to give the title
compound (0.63 g, yield 59~) as a white powder.
melting point: 100-101°C (recrystallized from ethyl acetate-
hexane) .
25 1H NMR (CDC13) g 2. 60 (2H, t, J=8.1 Hz) , 2. 90 (2H, t, J=8.1 Hz) ,
3 . 6 6 ( 3H, s ) , 5 . 06 ( 2H, s ) , 6 . 92 ( 2H, d, J=8 . 6 Hz ) , 7 .11-7
.14
(4H, m), 7.24-7.40 (5H, m), 7.46-7.58 (4H, m).
Example 138 4-[[3-((E)-2-
phenylethenyl)phenyl]methoxy]benzenepropanoic acid
3o The title compound was obtained from methyl 4-[[3-((E)-2-
phenylethenyl)phenyl]methoxy]benzenepropanoate by a method
similar to that of Reference Example 4. yield 640.
melting point: 155-156°C (recrystallized from ethyl acetate-
hexane) .
260
CA 02505322 2005-05-06
1H IVMR (CDC13) g 2.59 (2H, t, J=7.4 Hz) , 2.90 (2H, t, J=7.4 Hz) ,
5.06 (2H, s), 6.92 (2H, d, J=8.6 Hz), 7.13-7.16 (4H, m), 7.24-
7.40 (5H, m), 7.46-7.58 (4H, m).
Example 139 methyl 4-[(4-chloro-[l,l'-biphenyl]-3-
yl)methoxy]benzenepropanoate
The title compound was obtained from methyl 4-[(5-bromo-
2-chlorophenyl)methoxy]benzenepropanoate and phenylboronic
acid by a method similar to that of Example 22. yield 89%,
oil.
Z° 1H I~llKR (CDC13) g 2. 60 (2H, t, J=8.0 Hz) , 2. 90 (2H, t, J=8.
0 Hz) ,
3 . 6 6 ( 3H, s ) , 5 .19 ( 2H, s ) , 6 . 95 ( 2H, d, J=8 . 7 Hz ) , 7 .14 (
2H,
d, J=8.7 Hz), 7.30-7.57 (7H, m), 7.79 (1H, br s).
Example 140 4-[(4-chloro-[1,1'-biphenyl]-3-
yl)methoxy]benzenepropanoic acid
1s The title compound was obtained from methyl 4-[(4-chloro-
[l,l'-biphenyl]-3-yl)methoxy]benzenepropanoate by a method
similar to that of Reference Example 4. yield 62%.
melting point: 115-116°C (recrystallized from ethyl acetate-
hexane) .
20 1H NMR (CDC13) g 2. 65 (2H, t, J=8.0 Hz) , 2.91 (2H, t, J=8.0 Hz) ,
5.19 (2H, s), 6.95 (2H, d, J=8.6 Hz), 7.15 (2H, d, J=8.6 Hz),
7 . 32-7 . 50 ( 5H, m) , 7 . 54-7 . 57 ( 2H, m) , 7 . 78 ( 1H, br s ) .
r
Example 141 methyl 4-[[3-(2-
phenylethyl)phenyl]methoxy]benzenepropanoate
2s To a solution of methyl 4-[[3-((E)-2-
phenylethenyl)phenyl]methoxy]benzenepropanoate (0.35 g, 0.95
mmol) in methanol (15 mL) and tetrahydrofuran (25 mL) was
added platinum oxide (0.018 g, 0.078 mmol), and the mixture
was stirred under a hydrogen atmosphere at room temperature
3o for 18 hrs. The catalyst was filteref off, and the filtrate
was concentrated. The residue was purified by silica gel
column chromatography (ethyl acetate/hexane=15:1) to give the
title compound (0.21 g, yield 58%). oil.
1H NMR (CDC13) g 2. 60 (2H, t, J=8.1 Hz) , 2. 90 (2H, t, J=8.1 Hz) ,
261
CA 02505322 2005-05-06
2.93 (4H, s) , 3.67 (3H, s) , 5.00 (2H, s) , 6.90-6.95 (2H, m) ,
7.10-7.30 (11H, m).
Example 142 4- [ [3- (2-
phenylethyl)phenyl]methoxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[[3-(2-
phenylethyl)phenyl]methoxy]benzenepropanoate by a method
similar to that of Reference Example 4. yield 63g.
melting point: 105-106°C (recrystallized from ethyl acetate-
hexane ) .
1H 1~~R (CDC13) g 2. 65 (2H, t, J=8 .1 Hz) , 2. 91 (2H, t, J=8.1 Hz) ,
2.93 (4H, s) , 5.00 (2H, s) , 6.91 (2H, d, J=8.6 Hz) , 7.16-7.32
( 11H, m) .
Example 143 methyl 4-([1,1'-biphenyl]-3-ylmethoxy)-3-
chlorobenzenepropanoate
Zs The title compound was obtained from methyl 4-[(3-
bromophenyl)methoxy]-3-chlorobenzenepropanoate and
phenylboronic acid by a method similar to that of Example 22.
yield 44$, oil.
1H NMR (CDC13) g 2.59 (2H, t, J=7 .8 Hz) , 2.87 (2H, t, J=7.8 Hz) ,
3 . 6 6 ( 3H, s ) , 5 .19 ( 2H, s ) , 6 . 91 ( 1H, d, J=8 . 4 Hz ) , 7 . 02 (
1H,
dd, J=8.4 Hz, 2.1 Hz), 7.24 (1H, d, J=2.1 Hz), 7.33-7.38 (1H,
m), 7.42-7.49 (4H, m), 7.54-7.62 (3H, m), 7.68 (1H, m).
Example 144 4-([1,1'-biphenyl]-3-ylmethoxy)-3- "
chlorobenzenepropanoic acid
The title compound was obtained from methyl 4-([1,1'-
biphenyl]-3-ylmethoxy)-3-chlorobenzenepropanoate by a method
similar to that of Reference Example 4. yield 54~.
melting point: 77.0-77.5°C (recrystallized from diisopropyl
ether-hexane).
1H NMR (CDC13) g 2. 64 (2H, t, J=7.8 Hz) , 2. 88 (2H, t, J=7.8 Hz) ,
5 .19 ( 2H, s ) , 6 . 92 ( 1H, d, J=8 . 4 Hz ) , 7 . 03 ( 1H, dd, J=8 . 4 Hz,
2.1 Hz), 7.25-7.26 (1H, m), 7.32-7.38 (1H, m), 7.42-7.48 (4H,
m) , 7 . 53-7 . 62 ( 3H, m) , 7 . 68 ( 1H, m) .
Example 145 methyl 4-[(2'-fluoro-[l,l'-biphenyl)-3-
262
CA 02505322 2005-05-06
yl)methoxy]benzenepropanoate
The title compound was obtained from methyl 4-[(3-
bromophenyl)methoxy]benzenepropanoate and 2-
fluorophenylboronic acid by a method similar to that of
Example 22. yield 83~, oil.
1H I~R~IR ( CDC13 ) g 2 . 60 ( 2H, t, J=8 . 0 Hz ) , 2 . 90 ( 2H, t, J=8 . 0
Hz ) ,
3.66 (3H, s), 5.09 (2H, s), 6.92 (2H, d, J=8.6 Hz), 7.10-7.24
( 4H, m) , 7 . 29-7 . 36 ( 1H, m) , 7 . 42-7 . 54 ( 4H, m) , 7 . 61 ( 1H, s) .
Example 146 4-[(2'-fluoro-[1,1'-biphenyl]-3-
io yl)methoxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[(2'-
fluoro-[l,l'-biphenyl]-3-yl)methoxy]benzenepropanoate by a
method similar to that of Reference Example 4. yield 700.
melting point: 112-113°C (recrystallized from ethyl acetate-
Is hexane) .
1H NMR (CDC13) g 2. 66 (2H, t, J=7.9 Hz) , 2. 91 (2H, t, J=7. 9 Hz) ,
5.10 (2H, s), 6.93 (2H, d, J=8.6 Hz), 7.12-7.24 (4H, m), 7.29-
7 . 36 ( 1H, m) , 7 . 42-7 . 54 ( 4H, m) , 7 . 61 ( 1H, s ) .
Example 147 methyl 4-([1,1'-biphenyl]-3-ylmethoxy)-2-
2o methylbenzenepropanoate
The title compound was obtained from methyl 4-hydroxy-2-
methylbenzenepropanoate and [1,1'-biphenyl]-3-methanol by a
method similar to that of Reference Example 1.' yield 800, oil.
1H NMR (CDC13) g 2.30 (3H, s), 2.56 (2H, t, J=7.5 Hz), 2.89 (2H,
2s t~ J=7.5 Hz) , 3. 68 (3H, s) , 5.09 (2H, s) , 6.75-6.83 (2H, m) ,
7.05 (1H, d, J=8.3 Hz), 7.32-7.48 (5H, m), 7.53-7.65 (4H, m).
Example 148 4-([1,1'-biphenyl]-3-ylmethoxy)-2-
methylbenzenepropanoic acid
The title compound was obtained from methyl 4-([1,1'-
30 biphenyl]-3-ylmethoxy)-2-methylbenzenepropanoate by a method
similar to that of Reference Example 4. yield 70~.
melting point: 103.0-103.5°C (recrystallized from ethyl
acetate-hexane).
1H NMR (CDC13) g 2. 30 (3H, s) , 2. 61 (2H, t, J=8.4 Hz) , 2. 90 (2H,
263
CA 02505322 2005-05-06
t, J=8.4 Hz), 5.09 (2H, s), 6.76-6.83 (2H, m), 7.07 (1H, d,
J=8.3 Hz), 7.32-7.48 (5H, m), 7.54-7.65 (4H, m).
Example 149 methyl 4-[[2,3-dihydro-5-(4-phenylbutoxy)-1H-
inden-1-yl]oxy]benzenepropanoate
The title compound was obtained from methyl 4-
hydroxybenzenepropanoate and 2,3-dihydro-5-(4-phenylbutoxy)-
1H-inden-1-of by a method similar to that of Reference Example
1. yield 490, oil.
1H NMR (CDC13) g 1.75-1. 83 (4H, m) , 2 .16-2.27 ( 1H, m) , 2 .46-
2,71 (5H, m), 2.81-2.93 (3H, m), 3.06-3.16 (1H, m), 3.68 (3H,
s ) , 3 . 95-3 . 99 ( 2H, m) , 5 . 66 ( 1H, dd, J=6 . 5 Hz, 3 . 5 Hz ) , 6 .
75-
6.80 (2H, m), 6.89-6.93 (1H, m), 7.10-7.21 (5H, m), 7.26-7.31
( 4H, m) .
Example 150 4-[[2,3-dihydro-5-(4-phenylbutoxy)-1H-inden-1-
ls yl]oxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[[2,3-
dihydro-5-(4-phenylbutoxy)-1H-inden-1-yl]oxy]benzenepropanoate
by a method similar to that of Reference Example 4. yield 70°s.
melting point: 89-90°C (recrystallized from diisopropyl ether-
2o hexane) .
1H NMR (CDC13) g 1.78-1 . 83 (4H, m) , 2.17-2.27 ( 1H, m) , 2.46-
2.58 (1H, m), 2.64-2.71 (4H, m), 2.81-2.95 (3H, m), 3.06-3.16
(1H, m), 3.95-3.99 (2H, m), 5.66 (1H, dd, J=6.5'Hz, 3.5 Hz),
6.75-6.79 (2H, m), 6.92 (2H, d, J=8.6 Hz), 7.17-7.21 (5H, m),
z5 7 . 2 6-7 . 31 ( 3H, m) .
Example 151 methyl 2-methyl-4-[(3-
phenoxyphenyl)methoxy]benzenepropanoate
The title compound was obtained from methyl 4-hydroxy-2-
methyl-benzenepropanoate and 3-phenoxybenzyl alcohol by a
so method similar to that of Reference Example 1. yield 76o, oil.
1H NMR (CDC13) g 2.29 (3H, s) , 2. 55 (2H, t, J=8.4 Hz) , 2. 88 (2H,
t, J=8. 4 Hz) , 3. 68 (3H, s) , 4 .99 (2H, s) , 6.70-6. 77 (2H, m) ,
6.93-7. 17 (7H, m) , 7.30-7.36 (3H, m) .
Example 152 2-methyl-4-[(3-
264
CA 02505322 2005-05-06
phenoxyphenyl)methoxy]benzenepropanoic acid
The title compound was obtained from methyl 2-methyl-4-
[(3-phenoxyphenyl)methoxy]benzenepropanoate by a method
similar to that of Reference Example 4. yield 72~.
melting point: 82-83°C (recrystallized from diisopropyl ether-
hexane ) .
1H NMR (CDC13) g 2.29 (3H, s) , 2. 60 (2H, t, J=8.4 Hz) , 2.89 (2H,
t, J=8.4 Hz), 4.99 (2H, s), 6.71-6.78 (2H, m), 6.93-7.17 (7H,
m), 7.31-7.36 (3H, m).
to Example 153 methyl 3-chloro-4-[(2,3-dihydro-1H-inden-1-
yl)oxy]benzenepropanoate
The title compound was obtained from methyl 3-chloro-4-
hydroxybenzenepropanoate and 2,3-dihydro-1H-indan-1-of by a
method similar to that of Reference Example 1. yield 91~, oil.
is 1H NMR (CDC13) $ 2.20-2.31 (1H, m) , 2.50-2. 60 (1H, m) , 2. 61 (2H,
t, J=7.9 Hz), 2.87-2.97 (3H, m), 3.13-3.23 (1H, m), 3.68 (3H,
s), 5.71 (1H, dd, J=4.9 Hz, 6.6 Hz), 7.01-7.08 (2H, m), 7.22-
7.31 (4H, m), 7.43 (1H, d, J=7.3 Hz).
Example 154 3-chloro-4-((2,3-dihydro-1H-inden-1-
2o yl)oxy]benzenepropanoic acid
The title compound was obtained from methyl 3-chloro-4-
[(2,3-dihydro-1H-inden-1-yl)oxy]benzenepropanoate by a method
similar to that of Reference Example 4. yield ~6$.
1H NMR (CDC13) g 2.20-2.31 (1H, m) , 2.50-2. 61 (1H, m) , 2. 67 (2H,
2s t, J=7 . 7 Hz ) , 2 . 8 6-2 . 99 ( 3H, m) , 3 .12-3 . 22 ( 1H, m) , 5 . 71
( 1H,
dd, J=5.0 Hz, 6.5 Hz), 7.01-7.09 (2H, m), 7.20-7.31 (4H, m),
7.43 (1H, d, J=7.3 Hz).
Example 155 methyl 4-[(2,3-dihydro-1H-inden-1-yl)oxy]-2-
methylbenzenepropanoate
3o The title compound was obtained from methyl 4-hydroxy-2-
methylbenzenepropanoate and 2,3-dihydro-1H-indan-1-of by a
method similar to that of Reference Example 1. yield 650, oil.
1H NMR (CDC13) g 2 .10-2 . 30 ( 1H, m) , 2 . 31 ( 3H, s ) , 2 . 50-2 . 65 (
3H,
m) , 2.75-3. 00 (3H, m) , 3. 05-3.20 (1H, m) , 3. 69 (3H, s) , 5.72
265
CA 02505322 2005-05-06
(1H, dd, J=4.4 Hz, 6.6 Hz), 6.78-6.81 (2H, m), 7.07 (1H, d,
J=8 . 0 Hz ) , 7 . 21-7 . 33 ( 3H, m) , 7 . 42 ( 1H, d, J=7 . 2 Hz ) .
Example 156 4-[(2,3-dihydro-1H-inden-1-yl)oxy]-2-
methylbenzenepropanoic acid
s The title compound was obtained from methyl 4-[(2,3-
dihydro-1H-inden-1-yl)oxy]-2-methylbenzenepropanoate by a
method similar to that of Reference Example 4. yield 24°s.
melting point: 79-80~C (recrystallized from diisopropyl ether-
hexane).
1H NMR (CDC13) g 2.14-2.25 (1H, m) , 2.32 (3H, m) , 2.50-2.66 (3H,
m), 2.86-2.97 (3H, m) , 3.09-3.19 (1H, m), 5.73 (1H, dd, J=4.5
Hz, 6. 6 Hz) , 6.79-6. 82 (2H, m) , 7.09 (1H, d, J=7. 9 Hz) , 7.21-
7.31 (3H, m), 7.42 (1H, d, J=7.2 Hz).
Example 157 methyl 4-[[3-(2-
is phenylethoxy)phenyl]methoxy]benzenepropanoate
The title compound was obtained from methyl 4-
hydroxybenzenepropanoate and 2-phenylethanol by a method
similar to that of Reference Example 1. yield 58~, oil.
1H NMR (CDC13) $ 2. 59 (2H, t, J=7.1 Hz) , 2. 89 (2H, t, J=7.5 Hz) ,
Zo 3.09 (2H, t, J=7.1 Hz), 3.66 (3H, s), 4.18 (2H, t, J=7.1 Hz),
4.99 (2H, s), 6.83-6.91 (3H, m) , 6.97-6.99 (2H, m), 7.10 (2H,
d, J=8.6 Hz), 7.21-7.35 (6H, m).
Example 158 4- [ [ 3- ( 2-
phenylethoxy)phenyl]methoxy]benzenepropanoic acid
2s The title compound was obtained from methyl 4-[[3-(2-
phenylethoxy)phenyl]methoxy]benzenepropanoate by a method
similar to that of Reference Example 4. yield 630.
melting point: 79-80°C (recrystallized from ethyl acetate-
hexane ) .
30 1H NMR (CDC13) g 2. 64 (2H, t, J=8 .0 Hz) , 2. 90 (2H, t, J=8.0 Hz) ,
3. 09 (2H, t, J=7.1 Hz) , 4.18 (2H, t, J=7.1 Hz) , 5.00 (2H, s) ,
6.83-6. 92 (3H, m) , 6.97-7.00 (2H, m) , 7. 12 (2H, d, J=8. 6 Hz) ,
7.21-7.35 (6H, m).
Example 159 methyl 4-[[2,3-dihydro-5-(2-phenylethoxy)-1H-
266
CA 02505322 2005-05-06
inden-1-yl]oxy]benzenepropanoate
The title compound was obtained from methyl 4-
hydroxybenzenepropanoate and 2,3-dihydro-5-(2-phenylethoxy)-
1H-indan-1-of by a method similar to that of Reference Example
1. yield 65~, oil.
1H NMR (CDC13) g 2 . 16-2 . 2 6 ( 1H, m) , 2 . 4 6-2 . 64 ( 3H, m) , 2 . 78-
2 . 93 ( 3H, m) , 3 . 05-3 .15 ( 3H, m) , 3 . 67 ( 3H, s ) , 4 . 18 ( 2H, t,
J=6.9 Hz), 5.66 (1H, dd, J=6.5 Hz, 3.6 Hz), 6.72-6.84 (2H, m),
6.95 (2H, d, J=8. 6 Hz) , 7.12 (2H, d, J=8. 6 Hz) , 7.20-7.35 (6H,
to m) .
Example 160 4-[[2,3-dihydro-5-(2-phenylethoxy)-1H-inden-1-
yl]oxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[[2,3-
dihydro-5-(2-phenylethoxy)-1H-inden-1-yl]oxy]benzenepropanoate
Is by a method similar to that of Reference Example 4. yield 52~.
melting point: 96-97~C (recrystallized from ethyl acetate-
hexane ) .
1H NMR ( CDC13) $ 2 .17-2 . 27 ( 1H, m) , 2 . 4 6-2 . 57 ( 1H, m) , 2 . 67 (
2H,
t, J=8.0 Hz), 2.81-2.95 (3H, m), 3.05-3.15 (3H, m), 4.18 (2H,
2o t, J=7.1 Hz), 5.66 (1H, dd, J=6.5 Hz, 3.6 Hz), 6.77-6.81 (2H,
m) , 6. 92 (2H, d, J=8 . 3 Hz) , 7 .14 (2H, d, J=8 . 6 Hz) , 7 .21-7 . 35
( 6H, m) .
Example 161 methyl 4-[[3-(3- '
phenylpropoxy)phenyl]methoxy]benzenepropanoate
2s The title compound was obtained from methyl 4-
hydroxybenzenepropanoate and 3-phenylpropanol by a method
similar to that of Reference Example 1. yield 58~, oil.
1H NMR (CDC13) $ 2. 05-2 . 15 (2H, m) , 2. 60 (2H, t, J=8.1 Hz) ,
2.81 (2H, t, J=7.9 Hz), 2.89 (2H, t, J=8.1 Hz), 3.67 (3H, s),
30 3.97 (2H, t, J=6.2 Hz) , 5.00 (2H, s) , 6. 82-6.92 (3H, m) , 6.97-
7.00 (2H, m) , 7. 11 (2H, d, J=8. 6 Hz) , 7.17-7 .32 ( 6H, m) .
Example 162 4-[[3-(3-
phenylpropoxy)phenyl]methoxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[[3-(2-
267
CA 02505322 2005-05-06
phenylpropoxy)benzyl]oxy]benzenepropanoate by a method similar
to that of Reference Example 4. yield 53~.
melting point: 97-98~C (recrystallized from ethyl acetate-
hexane ) .
1H I~4R (CDC13) g 2. 06-2.15 (2H, m) , 2. 65 (2H, t, J=8.0 Hz) ,
2.81 (2H, t, J=8.0 Hz), 2.90 (2H, t, J=7.0 Hz), 3.97 (2H, t,
J=6.3 Hz) , 5.00 (2H, s) , 6. 83-6.92 (3H, m) , 6. 99 (2H, d, J=7.4
Hz ) , 7 . 11-7 . 31 ( 8H, m) .
Example 163 methyl 4-[(2'-methoxy-[1,1'-biphenyl]-3-
1° yl)methoxy]benzenepropanoate
The title compound was obtained from methyl 4-
hydroxybenzenepropanoate and 2-methoxyphenylboronic acid by a
method similar to that of Example 22. yield 65~, oil.
1H NMR (CDC13) g 2. 60 (2H, t, J=8 .0 Hz) , 2. 89 (2H, t, J=8.0 Hz) ,
is 3,66 (3H, s), 3.79 (3H, s), 6.92 (2H, d, J=8.5 Hz), 6.97-7.05
( 2H, m) , 7 .11 ( 2H, d, J=8 . 5 Hz ) , 7 . 30-7 . 50 ( 5H, m) , 7 . 58 ( 1H,
s) .
Example 164 4-[(2'-methoxy-[1,1'-biphenyl]-3-
yl)methoxy]benzenepropanoic acid
2o The title compound was obtained from methyl 4-[(2'-
methoxy-[1,1'-biphenyl]-3-yl)methoxy]benzenepropanoate by a
method similar to that of Reference Example 4. yield 69~.
melting point: 128-129°C (recrystallized from ef~yl acetate-
hexane ) .
2s 1H NMR (CDC13) g 2. 65 (2H, t, J=7.9 Hz) , 2.91 (2H, t, J=7.9 Hz) ,
3.79 (3H, s), 5.08 (2H, s), 6.90-7.05 (4H, m), 7.13 (2H, d,
J=8.6 Hz), 7.29-7.50 (5H, m), 7.58 (1H, s).
Example 165 methyl 4-[(2'-methyl-[1,1'-biphenyl]-3-
yl)methoxy]benzenepropanoate
so The title compound was obtained from methyl 4-
hydroxybenzenepropanoate and 2-methylphenylboronic acid by a
method similar to that of Example 22. yield 79~, oil.
1H NMR (CDC13) g 2.25 (3H, s) , 2. 60 (2H, t, J=8.2 Hz) , 2. 90 (2H,
t, J=8.2 Hz), 3. 66 (3H, s) , 5.08 (2H, s) , 6.91 (2H, d, J=8.6
268
CA 02505322 2005-05-06
Hz), 7.12 (2H, d, J=8.6 Hz), 7.22-7.30 (5H, m), 7.39-7.46 (3H,
m) .
Example 166 4-[(2'-methyl-[1,1'-biphenyl]-3-
yl)methoxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[(2'-
methyl-[1,1'-biphenyl]-3-yl)methoxy]benzenepropanoate by a
method similar to that of Reference Example 4. yield 52~.
melting point: 135-136~C (recrystallized from ethyl acetate-
hexane ) .
io 1H I~IR (CDC13) g 2.25 (3H, s) , 2. 65 (2H, t, J=7.9 Hz) , 2. 91 (2H,
t, J=7 . 9 Hz ) , 5 . 09 ( 2H, s ) , 6 . 92 ( 2H, d, J=8 . 5 Hz ) , 7 .13 (
2H,
d, J=8. 5 Hz) , 7.23-7.31 (5H, m) , 7.39-7. 45 (3H, m) .
Example 167 methyl 4-[(2-chloro-[l,l'-biphenyl]-5-
yl)methoxy]benzenepropanoate
is The title compound was obtained from methyl 4-[(3-bromo-
4-chlorophenyl)methoxy]benzenepropanoate and phenylboronic
acid by a method similar to that of Example 2z. yield 40$,
oil.
1H NMR (CDC13) g 2. 60 (2H, t, J=8.1 Hz) , 2. 90 (2H, t, J=8.1 Hz) ,
20 3 . 6 6 ( 3H, s ) , 5 . 03 ( 2H, s ) , 6 . 8 9 ( 2H, d, J=8 . 5 Hz ) , 7
.11 ( 2H,
d, J=8 . 5 Hz ) , 7 . 32-7 . 4 9 ( 8H, m) .
Example 168 4-[(2-chloro-[1,1'-biphenyl]-5-
yl)methoxy]benzenepropanoic acid '
The title compound was obtained from methyl 4-[(2-chloro-
25 [1,1'-biphenyl]-5-yl)methoxy]benzenepropanoate by a method
similar to that of Reference Example 4. yield 20$.
melting point: 116-117~C (recrystallized from ethyl acetate-
hexane ) .
1H NMR (CDC13) $ 2. 65 (2H, t, J=7.9 Hz) , 2. 91 (2H, t, J=7.9 Hz) ,
so 5.04 (2H, s) , 6. 90 (2H, d, J=8. 6 Hz) , 7.13 (2H, d, J=8. 6 Hz) ,
7.32-7.49 (8H, m).
Example 169 ethyl 4-([l,l'-biphenyl]-3-ylmethoxy)-2-
methoxybenzenepropanoate
The title compound was obtained from ethyl 4-hydroxy-2-
269
CA 02505322 2005-05-06
methoxybenzenepropanoate and [1,1'-biphenyl]-3-methanol by a
method similar to that of Reference Example 1. yield 860, oil.
1H NMR (CDC13) g 1.23 (3H, t, J=7.2 Hz) , 2.56 (2H, t, J=8.1 Hz) ,
2.87 (2H, t, J=8.1 Hz) , 3.79 (3H, s) , 4.12 (2H, q, J=7.2 Hz) ,
5.09 (2H, s), 6.48-6.54 (2H, m), 7.05 (1H, d, J=8.2 Hz), 7.30-
7.49 (5H, m), 7.54-7.66 (4H, m).
Example 170 4-([1,1'-biphenyl]-3-ylmethoxy)-2-
methoxybenzenepropanoic acid
The title compound was obtained from ethyl 4-([1,1'-
biphenyl]-3-ylmethoxy)-2-methoxybenzenepropanoate by a method
similar to that of Reference Example 4. yield 71~.
melting point: 71-73°C (recrystallized from diisopropyl ether-
hexane) .
1H NMR ( CDC13 ) $ 2 . 63 ( 2H, t, J=7 . 9 Hz ) , 2 . 8 8 ( 2H, t, J=7 . 9 Hz
) ,
i5 3.79 (3H, s), 5.09 (2H, s), 6.49-6.55 (2H, m), 7.06 (1H, d,
J=8.2 Hz), 7.33-7.49 (5H, m), 7.55-7.66 (4H, m).
Example 171 methyl 4-[[3-[[methyl(4-phenyl-2-
thiazolyl)amino]methyl]phenyl]methoxy]benzenepropanoate
The title compound was obtained from methyl 4-
hydroxybenzenepropanoate and 3-[[methyl(4-phenyl-1,3-thiazol-
2-yl)amino]methyl]benzenemethanol by a method similar to that
of Reference Example 1. yield 85~, oil.
1H NMR (CDC13) g 2. 59 (2H, t, J=8.1 Hz) , 2. 89 (2'~i, t, J=8.1 Hz) ,
3.07 (3H, s) , 3. 66 (3H, s) , 4 .79 (2H, s) , 5. 02 (2H, s) , 6.73
(1H, s) , 6. 88 (2H, d, J=8.7 Hz) , 7.10 (2H, d, J=8.7 Hz) ,
7.24-7.40 (7H, m), 7.85-7.88 (2H, m) .
Example 172 4-[(3-[[methyl(4-phenyl-2-
thiazolyl)amino]methyl]phenyl]methoxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[[3-
[[methyl(4-phenyl-2-
thiazolyl)amino]methyl]phenyl]methoxy]benzenepropanoate by a
method similar to that of Reference Example 4. yield 650.
melting point: 107.0-107.5°C (recrystallized from ethyl
acetate-hexane).
270
CA 02505322 2005-05-06
1H 1~~R (CDC13) $ 2. 63 (2H, t, J=7.8 Hz) , 2. 89 (2H, t, J=7. 8 Hz) ,
3.06 (3H, s) , 4.78 . (2H, s) , 5.03 (2H, s) , 6.72 (1H, s) , 6. 88
(2H, d, J=8.6 Hz), 7.10 (2H, d, J=8.6 Hz), 7.24-7.39, (7H, m),
7.88-7.84 (2H, m).
Example 173 ethyl 2-methoxy-4-[(3-
phenoxyphenyl)methoxy]benzenepropanoate
The title compound was obtained from ethyl 2-methoxy-4-
hydroxybenzenepropanoate and 3-phenoxybenzenemethanol by a
method similar to that of Reference Example 1. yield 75$, oil.
so 1H NMR (CDC13) g 1.23 (3H, t, J=7.1 Hz), 2.55 (2H, t, J=8.1 Hz),
2.86 (2H, t, J=8.1 Hz) , 3.78 (3H, s) , 4. 12 (2H, q, J=7.1 Hz) ,
5.00 (2H, s), 6.44 (1H, dd, J=8.2 Hz, 2.4 Hz), 6.49 (1H, d,
J=2.4 Hz), 6.95 (1H, dd, J=7.8 Hz, 1.8 Hz), 6.99-7.04 (3H, m),
7.09-7.17 (3H, m), 7.30-7.34 (3H, m).
is Example 174 2-methoxy-4-[(3-
phenoxyphenyl)methoxy]benzenepropanoic acid
The title compound was obtained from ethyl 2-methoxy-4-
[(3-phenoxyphenyl)methoxy]benzenepropanoate by a method
similar to that of Reference Example 4. yield 65~.
2o melting point: 77.0-77.5°C (recrystallized from diisopropyl
ether-hexane).
1H NMR (CDC13) g 2. 62 (2H, t, J=8 .0 Hz) , 2. 87 (2H, t, J=8.0 Hz) ,
3.77 (3H, s), 5.00 (2H, s), 6.44 (1H, dd, J=5.9~Hz, 2.4 Hz),
6 . 50 ( 1H, d, J=2 . 4 Hz ) , 6 . 93-7 .17 ( 7H, m) , 7 . 31-7 . 3 6 ( 3H, m)
.
2s Example 175 methyl 4-([1,1'-biphenyl]-3-ylmethoxy)-2-
chlorobenzenepropanoate
The title compound was obtained from methyl 2-chloro-4-
hydroxybenzenepropanoate and [l,l'-biphenyl]-3-methanol by a
method similar to that of Reference Example 1. yield 85~, oil.
30 1H NMR (CDC13) g 2. 62 (2H, t, J=8 .0 Hz) , 3. 00 (2H, t, J=8.0 Hz) ,
3. 68 (3H, s) , 5. 09 (2H, s) , 6.84 (1H, dd, J=8. 5 Hz, 2. 6 Hz) ,
7.02 (1H, d, J=2.6 Hz), 7.16 (1H, d, J=8.5 Hz), 7.33-7.49 (5H,
m), 7.55-7.64 (4H, m).
Example 176 4-([1,1'-biphenyl]-3-ylmethoxy)-2-
271
CA 02505322 2005-05-06
chlorobenzenepropanoic acid
The title compound was obtained from methyl 4-([1,1'-
biphenyl]-3-ylmethoxy)-2-chlorobenzenepropanoate by a method
similar to that of Reference Example 4. yield 464.
melting point: 84.0-84.5~C (recrystallized from diisopropyl
ether-hexane).
1H IVMR (CDC13) $ 2. 67 (2H, t, J=7.8 Hz) , 3. O1 (2H, t, J=7.8 Hz) ,
5.09 (2H, s) , 6.80-6.86 (1H, m) , 7.03 (1H, d, J=2.1 Hz) , 7.17
(1H, d, J=8.5 Hz), 7.36-7.46 (5H, m), 7.55-7.64 (4H, m).
to Example 177 methyl 4-[[2'-(1-methylethoxy)-[1,1'-biphenyl]-3-
yl]methoxy]benzenepropanoate
The title compound was obtained from 2-(1-
methylethoxy)phenylboronic acid by a method similar to that of
Example 22. yield 850, oil.
1s 1H NMR (CDC13) g 1.22-1.28 (6H, m) , 2. 60 (2H, t, J=8.1 Hz) ,
2.89 (2H, t, J=8.1 Hz), 3.60 (3H, s), 4.40-4.48 (1H, m), 5.07
(2H, s) , 6. 92 (2H, d, J=8. 6 Hz) , 6. 97-7. 03 (2H, m) , 7.11 (2H,
d, J=8 . 6 Hz ) , 7 . 2 6-7 . 4 3 ( 4H, m) , 7 . 51 ( 1H, d, J=7 . 2 Hz ) , 7
. 64
( 1H, s ) .
2o Example 178 4-[[2'-(1-methylethoxy)-[1,1'-biphenyl]-3-
yl]methoxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[[2'-(1-
methylethoxy)-[1,1'-biphenyl]-3-yl]methoxy]benzenepropanoate
by a method similar to that of Reference Example 4. yield 490.
2s melting point: 111.0-111.5~C (recrystallized from ethyl
acetate-hexane).
1H NMR (CDC13) g 1.23 ( 6H, d, J=6.0 Hz) , 2. 65 (2H, t, J=8.1 Hz) ,
2.91 (2H, t, J=8.1 Hz) , 4 .40-4. 48 (1H, m) , 5.08 (2H, s) , 6.91-
7.04 (4H, m), 7.13 (2H, d, J=8.6 Hz), 7.25-7.43 (4H, m), 7.51
30 ( 1H, dt, J=7 .1 Hz, 1 . 7 Hz ) , 7 . 64 ( 1H, s ) .
Example 179 methyl 4-[[2'-(trifluoromethyl)-[1,1'-biphenyl]-3-
yl]methoxy]benzenepropanoate
The title compound was obtained from 2-
(trifluoromethyl)phenylboronic acid by a method similar to
272
CA 02505322 2005-05-06
that of Example 22. yield 75~, oil.
1H I~4R (CDC13) $ 2. 60 (2H, t, J=8.1 Hz) , 2. 89 (2H, t, J=8.1 Hz) ,
3. 66 (3H, s) , 5. 08 (2H, s) , 6.90 (2H, d, J=8. 6 Hz) , 7.11 (2H,
d, J=8. 6 Hz) , 7.27-7.59 (7H, m) , 7.75 (1H, d, J=7. 6 Hz) .
Example 180 4-[[2'-(trifluoromethyl)-[1,1'-biphenyl]-3-
yl]methoxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[[2'-
(trifluoromethyl)-[1,1'-biphenyl]-3-
yl]methoxy]benzenepropanoate by a method similar to that of
1° Reference Example 4. yield 48~.
melting point: 143-144°C (recrystallized from ethyl acetate-
hexane).
1H NMR ( CDC13 ) $ 2 . 65 ( 2H, t, J=8 . 0 Hz ) , 2 . 90 ( 2H, t, J=8 . 0 Hz )
,
5.08 (2H, s), 6.91 (2H, d, J=8.6 Hz), 7.13 (2H, d, J=8.6 Hz),
7 . 2 6-7 . 58 ( 7H, m) , 7 . 7 5 ( 1H, d, J=7 . 6 Hz ) .
Example 181 methyl 4-[(2'-ethyl-[1,1'-biphenyl]-3-
yl)methoxy]benzenepropanoate
The title compound was obtained from 2-ethylphenylboronic
acid by a method similar to that of Example 22. yield 80~,
oil.
1H NMR (CDC13) g 1.08 (3H, t, J=7. 5 Hz) , 2.53-2. 62 (4H, m) ,
2.89 (2H, t, J=8.0 Hz), 3.66 (3H, s), 5.08 (2H, s), 6.91 (2H,
d, J=8 . 5 Hz ) , 7 .11 ( 2H, d, J=8 . 5 Hz ) , 7 . 21-7 . 31 " ( 5H, m) , 7 .
37-
7.42 (3H, m) .
Example 182 4-[(2'-ethyl-[1,1'-biphenyl]-3-
yl)methoxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[(2'-ethyl-
[1,1'-biphenyl]-3-yl)methoxy]benzenepropanoate by a method
similar to that of Reference Example 4. yield 51~.
3o melting point: 132.0-132.5°C (recrystallized from ethyl
acetate-hexane).
1H NMR (CDC13) g 1.07 (3H, t, J=7 .5 Hz) , 2. 57 (2H, q, J=7 .5 Hz) ,
2.65 (2H, t, J=7.9 Hz), 2.90 (2H, t, J=7.9 Hz), 5.09 (2H, s),
6. 91 (2H, d, J=8. 6 Hz) , 7.12 (2H, d, J=8. 6 Hz) , 7.18-7. 32 (5H,
273
CA 02505322 2005-05-06
m), 7.37-7.45 (3H, m).
Example 183 methyl 4-[(2',3'-dimethyl-[1,1'-biphenyl]-3-
yl)methoxy]benzenepropanoate
The title compound was obtained from 2,3-
dimethylphenylboronic acid by a method similar to that of
Example 22. yield 93~, oil.
1H NMR (CDC13) g 2.13 (3H, s), 2.34 (3H, s), 2.60 (2H, t, J=8.0
Hz), 2.89 (2H, t, J=8.0 Hz), 3.66 (3H, s), 5.08 (2H, s), 6.90-
6.92 (2H, m) , 7. 09-7.16 (5H, m) , 7.25-7.26 (1H, m) , 7.36-7.42
to ( 3H, m) .
Example 184 4-[(2',3'-dimethyl-[1,1'-biphenyl]-3-
yl)methoxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[(2',3'-
dimethyl-[1,1'-biphenyl]-3-yl)methoxy]benzenepropanoate by a
15 method similar to that of Reference Example 4. yield 47o.
melting point: 146-147°C (recrystallized from ethyl acetate-
hexane) .
1H NMR (CDC13) g 2.13 (3H, s) , 2 .33 (3H, s) , 2. 65 (2H, t, J=8 .0
Hz), 2.90 (2H, t, J=8.0 Hz), 5.08 (2H, s), 6.90-6.93 (2H, m),
2° 7. 09-7. 16 (5H, m) , 7.24-7.27 (1H, m) , 7.36-7.42 (3H, m) .
Example 185 methyl 4-[[4-[[(4-phenyl-2-
thiazolyl)propylamino]methyl]phenyl]methoxy]benzenepropanoate
The title compound was obtained from methyl 4-
hydroxybenzenepropanoate and 4-([(4-phenyl-2-
25 thiazolyl)propylamino]methyl]benzenemethanol by a method
similar to that of Reference Example 1. yield 90~, oil.
1H NMR (CDC13) g 0.93 (3H, t, J=7.4 Hz) , 1. 65-1 .75 (2H, m) ,
2.59 (2H, t, J=8.0 Hz) , 2.89 (2H, t, J=8.0 Hz) , 3.40 (2H, t,
J=7.7 Hz) , 3. 66 (3H, s) , 4.79 (2H, s) , 5. O1 (2H, s) , 6. 70 (1H,
3a s) , 6.89 (2H, d, J=8. 6 Hz) , 7.11 (2H, d, J=8. 6 Hz) , 7.24-7.28
(1H, m), 7.34-7.40 (6H, m), 7.84-7.87 (2H, m).
Example 186 4-([4-[[(4-phenyl-2-
thiazolyl)propylamino]methyl]phenyl]methoxy]benzenepropanoic
acid
274
CA 02505322 2005-05-06
The title compound was obtained from methyl 4-[[4-[[(4-
phenyl-2-
thiazolyl)propylamino]methyl]phenyl]methoxy]benzenepropanoate
by a method similar to that of Reference Example 4. yield 50~.
melting point: 110-111°C (recrystallized from ethyl acetate-
hexane ) .
1H NMR (CDC13) g 0. 93 (3H, t, J=7.4 Hz) , 1. 65-1.77 (2H, m) ,
2. 64 (2H, t, J=7 .3 Hz) , 2 . 90 (2H, t, J=7 .3 Hz) , 3.40 (2H, t,
J=9.2 Hz), 4.79 (2H, s), 5.01 (2H, s), 6.70 (1H, s), 6.89 (2H,
to d, J=8.4 Hz) , 7.12 (2H, d, J=8.4 Hz) , 7.24-7.37 (7H, m) , 7.84-
7.87 (2H, m) .
Example 187 methyl 4-[[4-[[(4-phenyl-2-
thiazolyl)thio]methyl]phenyl]methoxy]benzenepropanoate
The title compound was obtained from methyl 4-
15 hydroxybenzenepropanoate and 4-[[(4-phenyl-2-
thiazolyl)thio]methyl]benzenemethanol by a method similar to
that of Reference Example 1. yield 30%, oil.
1H NMR (CDC13) g 2. 59 (2H, t, J=8.1 Hz) , 2. 89 (2H, t, J=8.1 Hz) ,
3. 66 (3H, s) , 4.52 (2H, s) , 5.01 (2H, s) , 6. 88 (2H, d, J=8. 6
2o Hz), 7.11 (2H, d, J=8.6 Hz), 7.31-7.46 (8H, m), 7.89-7.92 (2H,
m) .
Example 188 4-[[4-[[(4-phenyl-2-
thiazolyl)thio]methyl]phenyl]methoxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[[4-[[(4-
25 phenyl-2-
thiazolyl)thio]methyl]phenyl]methoxy]benzenepropanoate by a
method similar to that of Reference Example 4. yield 380.
melting point: 156.0-156.5°C (recrystallized from
tetrahydrofuran-hexane).
30 1H NMR (DMSO-d6) g 2.38 (2H, t, J=7.7 Hz) , 2. 72 (2H, t, J=7.7
Hz) , 4. 56 (2H, s) , 5.02 (2H, s) , 6.87 (2H, d, J=8.5 Hz) , 7.11
( 2H, d, J=8 . 5 Hz ) , 7 . 33-7 . 4 9 ( 7H, m) , 7 . 94 ( 2H, d, J=7 . 3 Hz )
,
8.02 (1H, s).
Example 189 methyl 4-[[3-(1-
275
CA 02505322 2005-05-06
naphthyl)phenyl]methoxy]benzenepropanoate
The title compound was obtained from 1-naphthaleneboronic
acid by a method similar to that of Example 22. yield 93%,
oil.
1H NMR (CDC13) g 2. 60 (2H, t, J=8.0 Hz) , 2. 90 (2H, t, J=8. 0 Hz) ,
3 . 6 6 ( 3H, s ) , 5 .14 ( 2H, s ) , 6 . 95 ( 2H, t, J=8 . 6 Hz ) , 7 .13 (
2H,
t, J=8.6 Hz), 7.43-7.54 (4H, m), 7.68 (1H, dt, J=7.5 Hz, 1.5
Hz) , 7.75 (1H, dd, J=8.5 Hz, 1.8 Hz) , 7.78 (1H, m) , 7.85-7.93
( 3H, m) , 8 . 05 ( 1H, m) .
to Example 190 4-[[3-(1-naphthyl)phenyl]methoxy]benzenepropanoic
acid
The title compound was obtained from methyl 4-[[3-(1-
naphthyl)phenyl]methoxy]benzenepropanoate by a method similar
to that of Reference Example 4. yield 93%.
i5 melting point: 134-135~C (recrystallized from ethyl acetate-
hexane) .
1H NMR ( CDC13 ) g 2 . 65 ( 2H, t, J=8 . 0 Hz ) , 2 . 91 ( 2H, t, J=8 . 0 Hz )
,
.13 ( 2H, s ) , 6 . 95 ( 2H, t, J=8 . 6 Hz ) , 7 . 14 ( 2H, t, J=8 . 6 Hz ) ,
7.42-7.54 (4H, m), 7.66-7.78 (3H, m), 7.84-7.93 (3H, m), 8.05
20 ( 1H, m) .
Example 191 methyl 4-[[2'-(1-methylethyl)-[l,l'-biphenyl]-3-
yl]methoxy]benzenepropanoate
The title compound was obtained from 2-iodocumene by a
method similar to that of Reference Example 61. yield 12%,
25 oil.
1H NMR (CDC13) g 1.13 ( 6H, d, J=6.9 Hz) , 2. 59 (2H, t, J=7.4 Hz) ,
2.89 (2H, t, J=7.4 Hz), 2.97-3.06 (1H, m), 3.66 (3H, s), 5.09
(2H, s) , 6. 89-6. 92 (2H, m) , 7.10-7.26 {5H, m) , 7.35-7.42 (5H,
m) .
so Example 192 4-[[2'-(1-methylethyl)-[1,1'-biphenyl]-3-
yl]methoxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[[2'-(1-
methylethyl)-[l,l'-biphenyl]-3-yl]methoxy]benzenepropanoate by
a method similar to that of Reference Example 4. yield 27%.
276
CA 02505322 2005-05-06
melting point: 120-121~C (recrystallized from diethyl ether-
hexane ) .
1H I~KR (CDC13) g 1.13 ( 6H, d, J=6. 9 Hz) , 2. 65 (2H, t, J=8 . 0 Hz) ,
2.91 (2H, t, J=8.0 Hz) , 2.97-3. 06 (1H, m) , 5.09 (2H, s) , 6.91
(2H, d, J=8.6 Hz), 7.11-7.26 (5H, m), 7.31-7.45 (5H, m).
Example 193 methyl 4-[[4-[[methyl(5-methyl-4-phenyl-2-
thiazolyl)amino]methyl]phenyl]methoxy]benzenepropanoate
The title compound was obtained from methyl 4-
hydroxybenzenepropanoate and 4-[[methyl(5-methyl-4-phenyl-2-
to thiazolyl)amino]methyl]benzenemethanol by a method similar to
that of Reference Example 1. yield 86$, oil.
1H NMR (CDC13) g 2.42 (3H, s), 2.59 (2H, t, J=8.0 Hz), 2.89 (2H,
t, J=8 . 0 Hz ) , 3 . 02 ( 3H, s ) , 3 . 6 6 ( 3H, s ) , 4 . 69 ( 2H, s ) , 5
. 02
(2H, s) , 6. 89 (2H, d, J=8. 6 Hz) , 7.11 (2H, d, J=8. 6 Hz) , 7.25-
ls 7 . 41 ( 7H, m) , 7 . 63-7 . 66 ( 2H, m) .
Example 194 4-[[4-[[methyl(5-methyl-4-phenyl-2-
thiazolyl)amino]methyl]phenyl]methoxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[[4-
[[methyl(5-methyl-4-phenyl-2-
2° thiazolyl)amino]methyl]phenyl]methoxy]benzenepropanoate by a
method similar to that of Reference Example 4. yield 520.
melting point: 113-114°C (recrystallized from ethyl acetate-
hexane ) .
1H NMR (CDC13) g 2.41 (3H, s) , 2. 63 (2H, t, J=7.9 Hz) , 2. 89 (2H,
zs t, J=7.9 Hz), 3.02 (3H, s), 4.68 (2H, s), 5.01 (2H, s), 6.89
( 2H, d, J=8 . 6 Hz ) , 7 .12 ( 2H, d, J=8 . 6 Hz ) , 7 . 2 5-7 . 41 ( 7H, m)
,
7.63-7.66 (2H, m).
Example 195 methyl 4-[[4-
[(methylphenylamino)methyl]phenyl]methoxy]benzenepropanoate
3o N-Methylaniline (57 mg, 0.53 mmol) was dissolved in N,N-
dimethylformamide (5 mL), and 60~ sodium hydride (21 mg, 0.53
mmol) was added under ice-cooling. The reaction mixture was
stirred for 30 min., and methyl 4-[[4-
(bromomethyl)phenyl]methoxy]benzenepropanoate (0.15 g, 0.41
277
CA 02505322 2005-05-06
mmol) was added. The mixture was stirred at room temperature
for 3 hrs, water was added to the reaction mixture and the
mixture was extracted with ethyl acetate. The extract was
washed with water, dried and concentrated. The residue was
purified by silica gel column chromatography (ethyl
acetate/hexane=18:1) to give the title compound (74 mg, yield
45~) as a yellow powder.
1H NMR (CDC13) g 2.59 (2H, t, J=8.1 Hz) , 2. 89 (2H, t, J=8.1 Hz) ,
3.02 (3H, s) , 3. 66 (3H, s) , 4.54 (2H, s) , 5. 00 (2H, s) , 6. 69-
6, 76 (2H, m) , 6. 89 (2H, d, J=8. 6 Hz) , 7.11 (2H, d, J=8. 6 Hz) ,
7.20-7.26 (5H, m), 7.37 (2H, d, J=8.1 Hz).
Example 196 4-[[4-
[(methylphenylamino)methyl]phenyl]methoxy]benzenepropanoic
acid
The title compound was obtained from methyl 4-[[4-
[(methylphenylamino)methyl]phenyl]methoxy]benzenepropanoate by
a method similar to that of Reference Example 4. yield 450.
melting point: 122-124~C (recrystallized from ethyl acetate-
hexane ) .
1H I~ll~iR (CDC13) g 2. 65 (2H, t, J=8 .0 Hz) , 2. 90 (2H, t, J=8.0 Hz) ,
3.01 (3H, s), 4.53 (2H, s), 5.00 (2H, s), 6.69-6.76 (3H, m),
6. 90 (2H, d, J=8. 6 Hz) , 7.12 (2H, d, J=8. 6 Hz) , 7.18-7.26 (4H,
m) , 7.37 (2H, d, J=8 .l Hz) .
Example 197 methyl 4-[[3'-(hydroxymethyl)-[l,l'-biphenyl]-3-
2~ yl]methoxy]benzenepropanoate
A solution of methyl 4-[(3'-formyl-[1,1'-biphenyl]-3-
yl)methoxy]benzenepropanoate (0.80 g, 2.1 mmol) in methanol (5
mL) and tetrahydrofuran (2 mL) was ice-cooled, and sodium
borohydride (81 mg, 2.1 mmol) was added. The mixture was
3o stirred under ice-cooling for 30 min. The reaction mixture
was added to 0.2N hydrochloric acid (11 mL), and the mixture
was extracted with ethyl acetate. The extract was washed with
water and concentrated under reduced pressure to give the
title compound 0.80 g (quantitative). oil.
278
CA 02505322 2005-05-06
1H I~IR (CDC13) $ 1. 81 (1H, br s) , 2. 60 (2H, t, J=7.5 Hz) , 2.90
(2H, t, J=7.5 Hz) , 3. 66 (3H, s) , 4.77 (2H, d, J=4. 6 Hz) , 5.10
(2H, s) , 6. 92 (2H, d, J=8. 5 Hz) , 7.12 (2H, d, J=8 .5 Hz) , 7.34-
7.48 (4H, m), 7.52-7.66 (4H, m).
s Example 198 4-[[3'-(hydroxymethyl)-[1,1'-biphenyl]-3-
yl]methoxy]benzenepropanoic acid
The title compound was obtained from methyl 4-[[3'-
(hydroxymethyl)-[l,l'-biphenyl]-3-yl]methoxy]benzenepropanoate
by a method similar to that of Reference Example 4. yield 880.
to melting point: 99-100~C (recrystallized from ethyl acetate-
hexane ) .
1H I~R~R (CDC13) g 2. 64 (2H, t, J=7. 6 Hz) , 2. 90 (2H, t, J=7. 6 Hz) ,
4.76 (2H, s), 5.10 (2H, s), 6.92 (2H, d, J=8.5 Hz), 7.13 (2H,
d, J=8 . 5 Hz ) , 7 . 33-7 . 47 ( 4H, m) , 7 . 51-7 . 58 ( 3H, m) , 7 . 64 (
1H,
is s) .
Example 199 methyl 4-[[3'-[[(3-carboxy-1-
oxopropyl)amino]methyl]-[1,1'-biphenyl]-3-
yl]methoxy]benzenepropanoate
Methyl 4-[[3'-[(2,5-dioxo-1-pyrrolidinyl)methyl]-[1,1'-
Zo biphenyl]-3-yl]methoxy]benzenepropanoate was obtained from
methyl 4-[[3'-(hydroxymethyl)-[1,1'-biphenyl]-3-
yl]methoxy]benzenepropanoate and 2,5-pyrrolidinedione by a
method similar to that of Reference Example 1. The title
compound was obtained from methyl 4-[[3'-[(2,5-dioxo-1-
2s pyrrolidinyl)methyl]-[1,1'-biphenyl]-3-
yl]methoxy]benzenepropanoate by a method similar to that of
Reference Example 4. yield from methyl 4-[[3'-
(hydroxymethyl)-[1,1'-biphenyl]-3-yl)methoxy]benzenepropanoate
62%.
3° melting point: 185-188~C (recrystallized from ethyl acetate).
1H NMR (DMSO-d6) g 2. 41-2 . 51 ( 6H, m) , 2 .75 (2H, t, J=7 . 5 Hz) ,
4. 34 (2H, d, J=5.8 Hz) , 5.14 (2H, s) , 6. 94 (2H, d, J=8. 5 Hz) ,
7.14 (2H, d, J=8.5 Hz) , 7.26 (1H, d, J=7.5 Hz) , 7.38-7. 62 (6H,
m), 7.72 (1H, s), 8.41 (1H, t, J=5.8 Hz), 12.06 (2H, br s).
279
CA 02505322 2005-05-06
Example 200 3'-[[4-[2-(methoxycarbonyl)ethyl]phenoxy]methyl]-
[l,l'-biphenyl]-3-carboxylic acid
To a solution of methyl 4-[(3'-formyl-[1,1'-biphenyl]-3-
yl ) methoxy] benzenepropanoate ( 0 . 48 g, 1. 3 mmol ) in
tetrahydrofuran (5 mL) and water (2 mL) was added sulfamic
acid (0.15 g, 1.3 mmol), and a solution of sodium chlorite
(0.17 g, 1.5 mmol) in water (1.5 mL) was added. The mixture
was stirred at room temperature for 15 hrs., and water was
added. The mixture was extracted with ethyl acetate. The
so extract was washed with water and concentrated under reduced
pressure to give the title compound 0.50 g (quantitative).
melting point: 180-185~C (recrystallized from ethyl acetate-
hexane ) .
1H NMR (CDC13) g 2. 60 (2H, t, J=7.5 Hz) , 2. 90 (2H, t, J=7.5 Hz) ,
3.66 (3H, s), 5.10 (2H, s), 6.93 (2H, d, J=8.5 Hz), 7.12 (2H,
d, J=8 . 5 Hz ) , 7 . 42-7 . 54 ( 3H, m) , 7 . 59 ( 1H, d, J=7 . 0 Hz ) , 7 .
69
(1H, s) , 7.79 (1H, d, J=7. 8 Hz) , 8. 04 (1H, d, J=7.8 Hz) , 8.32
(1H, s) .
Example 201 3'-[[4-(2-carboxyethyl)phenoxy]methyl]-[1,1'-
2o biphenyl]-3-carboxylic acid
The title compound was obtained from 3'-[[4-[2-
(methoxycarbonyl)ethyl]phenoxy]methyl]-[l,l'-biphenyl]-3-
carboxylic acid by a method similar to that of Deference
Example 4. yield 75~.
melting point: 178-181~C (recrystallized from ethyl acetate-
hexane) .
1H NMR (DMSO-d6) $ 2.50 (2H, t, J=7.7 Hz) , 2. 75 (2H, t, J=7.7
Hz ) , 5 . 17 ( 2H, s ) , 6 . 95 ( 2H, d, J=8 . 5 Hz ) , 7 .14 ( 2H, d, J=8 .
5
Hz), 7.46-7.54 (2H, m), 7.58-7.68 (2H, m), 7.77 (1H, s), 7.92-
g.00 (2H, m), 8.20 (1H, s), 12.63 (2H, br s).
Example 202 Setting of screening method for GPR40 agonist and
GPR40 antagonist and criterion to select agonist candidates
(1) Setting of screening method for GPR40 agonist and GPR40
antagonist with changes in intracellular calcium concentration
280
CA 02505322 2005-05-06
as an indicator
To set the system for searching a GPR40 agonist and a
GPR40 antagonist, an assay system was set using the compound
of the present invention.
The CHO cell line (CHO-hGPR40 No.104), which was made to
express human GPR40 prepared by a method known per se, using
human GPR40 expression vector prepared in Reference Example 1
was diluted to contain 3x104 cells/100 ~,1, dispensed to a black
walled 96-well plate (Costar) at 100 ~,1 per well, incubated
to overnight in a C02 incubator. Changes in the intracellular
calcium concentration was measured using FLIPR (Molecular
Device). The method is described in the following.
Fluo-3AM (DOJIN) (50 fig) was dissolved in 21 ~,1 DMSO
(DOJIN), and an equal amount of 20~ pluronic acid (Molecular
is probes) was added and mixed, and the mixture was added to 10.6
ml of an assay buffer [prepared by adding 20 ml of 1M HEPES
(pH 7.4) (DOJIN) to HBSS (Invitrogen), and adding a mixed
solution (10 ml) obtained by dissolving probenecid (Sigma)
(710 mg) in 1N NaOH (5 ml) and adding and mixing with the
2o above-mentioned HBSS/HEPES solution (5 ml)] supplemented with
105 ~,1 of fetal calf serum to give a fluorescence dye solution.
The medium in the cell plate was removed, a fluorescence dye
solution was immediately dispensed at 100 ~,1 per well, and
incubated in a CO2 incubator at 37°C for 1 hr to incorporate
25 fluorescence dye into the cell. The incubated cells were
washed with the above-mentioned assay buffer. The compound of
the present invention to be added to the cell was diluted with
an assay buffer to each concentration and dispensed to a plate.
For antagonist measurement, 12 ~,~I Y-linolenic acid solution
30 (final concentration during reaction 3 ~,M) was dispensed to
the plate, and simultaneously set on FLIPR. After the above-
mentioned pretreatment, variation in the intracellular calcium
concentration after addition of the compound of the present
invention was measured by FLIPR, and the agonistic effect,
281
CA 02505322 2005-05-06
subsequently an antagonistic effect upon addition of Y-
linolenic acid were examined. Since the compound of the
present invention is an agonist, evaluation of the antagonist
is not established by an experiment using the compound of the
present invention, but when a compound having solely an
antagonistic effect is added, the activity to suppress
reaction of Y-linolenic acid to be added later can be observed.
EC50 value was calculated from a dose response curve based on
the changes in the fluorescence intensity value at 30 or 40
to sec after the start of the reaction.
(2) Criterion to select agonist candidates from the results of
FLIPR assay
A test compound used for selecting an agonist candidate
was diluted in advance with DMSO (Wako) to a concentration of
Is 10 mM, and diluted with the above-mentioned assay buffer when
used for the measurement. Using the test compound and by a
method similar to the above-mentioned method, the fluorescence
intensity values in CHO cell line (CHO-hGPR40 No.104), which
was made to express human GPR40 prepared by a method known per
Zo se, using human GPR40 expression vector prepared in Reference
Example l, CHO cell line (CHO-H1), which was made to express
human histamine H1 receptor prepared by a method known per se,
using human histamine Hl receptor expression vector, and CHO
cell line of Mock were measured at 30 or 40 sec after the
2s start of the reaction. Moreover, the relative value when
fluorescence strength of 30 ~M ~-linolenic acid to CHO-hGPR40
was 100 was calculated, and a test compound showing a value
of not less than 50 or 100 relative to CHO-hGPR40 and not
more than 25~ relative to both the human histamine H1 receptor
3o and CHO cell line of Mock were selected as human GPR40
specific agonist candidates.
Formulation Example 1
(1) Compound obtained in Example 1 10.0 g
282
CA 02505322 2005-05-06
(2) Lactose 60.0 g
(3) Cornstarch 35.0 g
(4) gelatin 3.0 g
(5) Magnesium stearate 2.0 g
A mixture of compound (10.0 g) obtained in Example 1,
lactose (60.0 g) and cornstarch (35.0 g) was granulated with
an aqueous solution (30 mL) of 10 wt~ gelatin (3.0 g as
gelatin) by passing through a 1 mm mesh sieve, dried at 40~C
and passing through the sieve again. The obtained granule was
to mixed with magnesium stearate (2.0 g) and the mixture was
compressed. The obtained core tablets were coated with
glycocalyx of an aqueous suspension of saccharose, titanium
dioxide, talc and gum arabic. The tablets after coating were
polished with bee wax to give 1000 coated tablets.
15 go~ulation Example 2
(1) Compound obtained in Example 1 10.0 g
(2) lactose 70.0 g
(3) cornstarch 50.0 g
(4) soluble starch 7.0 g
20 (5) magnesium stearate 3.0 g
The compound (10.0 g) obtained in Example 1 and magnesium
stearate (3.0 g) were granulated with an aqueous solution (70
mL) of soluble starch (7.0 g as soluble starch); dried, and
mixed with lactose (70.0 g) and cornstarch (50.0 g). The
2s mixture was compressed to give 1000 tablets.
Experimental Example 1 Confirmation of reactivity of fatty
acid to human-derived GPR40
Unless specifically indicated, CHO-Kl cell line was
cultured using Ham's F-12 medium (Invitrogen) containing loo
so fetal calf serum (Invitrogen). The day before transfection,
4.5X105 per 10 cm2 of cells were seeded, and incubated at 37~C
for not less than 15 hrs in a COZ incubator adjusted to 5o COz
concentration. The transfection was performed using a
lipofectamine reagent (Invitrogen) and according to the
283
CA 02505322 2005-05-06
reagent attached method. When a 6-well plate was used for a
culture plate, transfection was performed in the following
manner. First two 1.5 ml volume tubes were prepared, and 100
~1 of Opti-MEM-I medium (Invitrogen) was dispensed. Then, 1 ~g
of an expression vector was added to one tube and 6 ~,1 of a
lipofectamine reagent was added to the other tube. They were
mixed and stood still at room temperature for 20 min. A mixed
solution for transfection containing this solution and Opti-
MEM-I medium (800 ~,1) was added to CHO-Kl cell previously
io washed with Opti-MEM-I medium, and incubated in a COZ incubator
for 6 hrs. The incubated cells were rinsed with PBS
(Invitrogen), detached with 0.05 trypsin-EDTA solution
(Invitrogen), recovered by centrifugation. The obtained cells
were counted, diluted such that 5x109 cells were contained per
200 ~,l of the medium, dispensed to black walled 96-well plate
(Costar) at 200 ~1 per well, incubated overnight in a COZ
incubator. Various test samples were added to CHO-K1 cells
transiently expressing the receptor by the above-mentioned
transfection step, and changes in the intracellular calcium
2o concentration then was measured using FLIPR (Molecular Device).
For measurement of changes in intracellular calcium
concentration by FLIPR, the following pretreatment was applied.
First, an assay buffer for adding fluorescence"dye Fluo-3AM
(DOJIN) to the cell, or washing the cell immediately before
2s FLIPR assay was prepared. To a solution (hereinafter
HBSS/HEPES solution) obtained by adding 20 ml of 1M HEPES (pH
7.4) (DOJIN) to 1000 ml of HBSS (Invitrogen) was added a
solution (10 ml) obtained by dissolving probenecid (710 mg,
Sigma) in 1N NaOH (5 ml) and adding and mixing with HBSS/HEPES
3o solution (5 ml) and the obtained solution was used as an assay
buffer. Then, Fluo-3AM (50 ~,g) was dissolved in 21 ~,l of DMSO
(DOJIN), and an equal amount of 20~ pluronic acid (Molecular
Probes) was added. The mixture was added to an assay buffer
(10.6 ml) supplemented with 105 ~1 of fetal calf serum to give
284
CA 02505322 2005-05-06
a fluorescence dye solution. The medium of the CHO-K1 cell
after transfection treatment was removed, a fluorescence dye
solution was immediately dispensed at 100 ~1 per well and
incubated in a COz incubator for 1 hr to incorporate the
fluorescence dye into the cell. The incubated cells were
washed with the above-mentioned assay buffer and set on FLIPR.
The test sample to be added to receptor expressing CHO-Kl
cell was prepared using the assay buffer and simultaneously
set on FLIPR. After the above-mentioned pretreatment, changes
to in the intracellular calcium concentration after addition of
various test samples were measured by FLIPR. As a result, it
was found that CHO-K1 cell that expresses the GPR40 receptor
specifically responds (increase in intracellular calcium
concentration) when farnesoic acid, 5.8.11-eicosatriynoic acid,
15 5.8.11.14-eicosatetraynoic acid, oleic acid, linoleic acid,
linolenic acid, arachidonic acid, eicosapentaenoic acid (EPA),
eicosadienoic acid, eicosatrienoic acid, docosahexaenoic acid
(DHA), docosatrienoic acid, adrenic acid, lauric acid and the
like are added at 10-5M - 10-6M. CHO-K1 cell into which only
2o the control expression vector alone was introduced did not
show such response. In other words, it was clarified that an
endogenous ligand of GPR40 was fatty acid.
Experimental Example 2 Expression distribution]
(1) Cell and medium
2s NIH-3T3 and B104 cells were purchased from the ATCC. As
mouse pancreatic ~3 cell line, MINE described in a literature
(Jun-ichi Miyazaki et al. Endocrinology, Vol. 127, No. 1,
p126-132) was used. Respective cells were incubated in DMEM
medium (Invitrogen) containing loo FCS to preconfluent.
30 (2) Extraction of RNA and cDNA synthesis
The cDNA used for the expression distribution in human
and mouse tissues was obtained by reverse transcription
reaction from polyA+RNA (1 ~,g, Clontech) derived from various
tissues of human and mouse using random primer. Using reverse
285
CA 02505322 2005-05-06
transcriptase SuperScriptII (GIBCO BRL), the reaction was
carried out according to the attached protocol and ethanol
precipitation was performed and the precipitate was dissolved
in TE ( 100 ~,l ) .
As to cDNA from the mouse cell, the cells were detached
with Trypsin-EDTA, the number of the cells was counted, and
the total RNA was extracted and purified according to the
manual of RNeasy mini KIT (QIAGEN). 'The extracted RNA (1 ~,g)
was processed according to the manual of Superscript II
to (Invitrogen) using random to synthesize a first strand cDNA,
which was subjected to ethanol precipitation, and the
precipitate was dissolved in TE (10 ~1).
(3) Quantitation using TaqMan
The tissue-derived cDNA (corresponding to 5 ng of RNA)
is and cell line-derived cDNA (corresponding to 25 ng of RNA)
were adjusted to the total reaction mixture of 15 ~l with
amplification reaction reagent TaqMan (trademark) Universal
PCR Master Mix (Applied Biosystems Japan Ltd.) and TaqMan
(trademark) Probe Kit for GPR40 detection (sequence: 11-16,
2o Applied Biosystems Japan Ltd.), and the reaction was carried
out. The final concentration of each primer and probe
followed the manual.
TaqMan (trademark) PCR was performed in ABI PRISM
(trademark) 7900HT sequence detection system (Applied
25 Biosystems Japan Ltd.), and the temperature cycle used
followed the manual of TaqMan (trademark) Universal PCR Master
Mix (Applied Biosystems Japan Ltd.).
The quantitative TaqMan analysis of the amplified product
was performed using 7900HT SDS software (Applied Biosystems
3o Japan Ltd.). The analytical curve used for the calculation of
copy number was formed from CT values at 6 points in the
logarithm from 10' copies/well to 102 copies/well using a
concentration-known cDNA fragment (human GPR40) or Plasmid DNA
(mouse GPR40) containing full length amplified region.
286
CA 02505322 2005-05-06
In human tissues, relatively high expression was observed
in pancreas, lung, hippocampus, hypothalamus and spinal cord.
In mouse, extremely high expression was observed in pancreatic
cancer-derived cell.
Experimental Example 3 Insulin secretagogue effect of free
fatty acid in mouse insulinoma MINE cell
Unless otherwise specified, MINE cell was incubated in
DMEM (high glucose, Invitrogen) containing 15% FCS (Trace
Scientific Ltd.), 55 ~,M 2-mercaptoethanol, 100 U/ml penicillin,
to and 100 ~g/ml streptomycin. Min6 cells were seeded in a 96
well plate at 105 cells per well, and incubated at 37~C for 3
days in a COZ incubator adjusted to 5% C02 concentration. The
medium was exchanged to RPMI1640 (glucose-free, Invitrogen)
containing 10% FCS (Trace Scientific Ltd.), 5.5 mM glucose,
is 100 U/ml penicillin and 100 ~g/ml streptomycin and the cells
were further incubated for 24 hrs. The medium was aspirated,
free fatty acid-bovine serum albumin (BSA) mixed solution (4:1,
molar ratio) diluted with RPMI1640 (glucose-free, Invitrogen)
containing 10% FCS (Trace Scientific Ltd.), 11 mM glucose, 100
2o U/ml penicillin, and 100 ~,g/ml streptomycin was added to the
cells and reacted at 37°C for 90 min. (or 60 min.) in a C02
incubator adjusted to 5% COZ concentration. The 96 well plate
after reaction was centrifuged at 1500 rpm for ~ min. and the
culture supernatant was recovered. The insulin amount
25 secreted in this culture supernatant liquid was determined by
radioimmunoassay (RIA) using a rat insulin RIA system
(Amersham Pharmacia Biotech). As a result, it was found that
the insulin secretion by Min6 cell was promoted when 300 ~M-
1000 ~,M of free fatty acid such as palmitic acid, y-linolenic
3o acid, oleic acid and the like was added. That is, it was
clarified that the free fatty acid promotes insulin secretion
in mouse insulinoma MINE cell. Since MINE cell specifically
and extremely highly expresses GPR40, it is considered that
the added fatty acid insulin promotes secretion via GPR40.
287
CA 02505322 2005-05-06
Experimental Example 4 Effect of regulation of GPR40 receptor
function (agonistic effect)
CHO cell line (No.104) made to express human GPR40 was
diluted such that 3x104 cells/100 ~L were contained, dispensed
to a black walled 96-well plate (Costar) at 100 ~,L per well,
and incubated overnight in a CO2 incubator. The changes in the
intracellular calcium concentration were measured using FLIPR
(Molecular Device). The method is described in the following.
Fluo-3AM (DOJIN) (50 ~,g) was dissolved in 21 ~1 DMSO
so (DOJIN), and an equal amount of 20~ pluronic acid (Molecular
Probes) was added and mixed, and the mixture was added to 10.6
ml of an assay buffer [prepared by adding 20 ml of 1M HEPES
(pH 7.4) (DOJIN) to 1 L of HBSS (Invitrogen), and adding a
mixed solution (10 ml) obtained by dissolving probenecid
(Sigma) (710 mg) in 1N NaOH (5 ml) and adding and mixing with
the above-mentioned HBSS/HEPES solution (5 ml)] supplemented
with 105 ~1 of fetal calf serum to give a fluorescence dye
solution. The medium in the cell plate was removed, a
fluorescence dye solution was immediately dispensed at 100 ~l
2o per well, and incubated in a C02 incubator for 1 hr to
incorporate fluorescence dye into the cell. The incubated
cells were washed with the above-mentioned assay buffer. The
compound to be added to the cell was diluted with the assay
buffer to each concentration and dispensed to a test sample
plate. After the above-mentioned pretreatment, changes in the
intracellular calcium concentration after addition of the
compound was measured by FLIPR, and the agonistic effect was
examined. ECSO value was calculated from a dose response curve
based on the changes in the fluorescence intensity value at 30
3o sec after the start of the reaction. The results are shown in
Table 1.
[Table 1]
Effect of regulation of GPR40 receptor function
288
CA 02505322 2005-05-06
compound No . ECSO ( M)
Reference Example 2 0.32
Reference Example 6 0.46
Reference Example 15 1.2
Example 2 0.17
Example 6 0.16
Example 7 0.13
Example 10 0.88
Example 41 0.055
linolenic acid 2.0
From the results of Table 1, it was found that the
compound of the present invention has the superior effect of
regulation of GPR40 receptor function.
Reference Example 129 Construction of human GPR40 expression
vector
A DNA fragment (SEQ ID NO: 6) encoding human GPR40 was
io obtained by the following PCR. That is, using oligo DNA (SEQ
ID NO: 11) presented by
5'>CGTCGACCCGGCGGCCCCATGGACCTGCCCCCG<3'
as a sense strand primer, and oligo DNA (SEQ ID N0: 12)
presented by '
5~>CATCGATTAGCAGTGGCGTTACTTCTGGGACTT<3'
as an antisense strand primer, a mixed solution (50 ~,1)
containing 20 pmol of each primer, lOXAdvantage (trademark) 2
PCR Buffer (CLONTECH) 5 ~,1, 50XdNTP mix (CLONTECH) 1 ~,1,
50xAdvantage 2 Polymerase Mix (CLONTECH) 1 ~,1, and human
2~ pancreas cDNA SOLUTION (CLONTECH) 1 ~1 as template DNA was
prepared, and PCR was performed following a program comprising
35 cycles of 96°C, 1 min, then 96°C, 30 sec. ~ 61°C, 30
sec.
72°C, 120 sec. and elongation reaction at 72°C, 10 min was
performed using a thermal cycler (GeneAmp (trademark) PCR
ZS system model 9700 (Applied Biosystems)). After the completion
289
CA 02505322 2005-05-06
of the reaction, agarose gel electrophoresis was conducted to
give a single product, which was cloned using a TA cloning kit
(Invitrogen) to confirm the genetic sequence. The clone free
of PCR error was double digested with restriction enzymes SalI
(TAKARA SHUZO) and ClaI (TAKARA SHUZO), subjected to agarose
gel electrophoresis to cut out a single product. The obtained
fragment (about 1 kb) was introduced into a pAKKO-111 vector
and used for the transfection of CHO cell.
Reference Example 130 Cloning of cDNA encoding mouse spleen-
io derived GPR40 and determination of nucleotide sequence thereof
PCR was performed using mouse spleen cDNA (Marathon-
ReadyTM cDNA; Clontech) as a template and two primers: primer
1 (SEQ ID N0: 13) and primer 2 (SEQ ID NO: 14). For PCR,
Pyrobest DNA polymerase (TAKARA SHUZO) was used, and
i5 elongation reaction of (i) 98°C 1 min, thereafter (ii) 40
cycles of 98°C 10 sec, 55°C 30 sec, 72°C 60 sec, and then
(iii)
72°C 2 min was performed. After the reaction, the amplified
product was cloned to plasmid vector pCR-Blunt (Invitrogen)
according to the protocol of Zero Blunt PCR cloning kit
20 (Invitrogen). This was introduced into Escherichia coli TOP10
(Invitrogen), and clones having plasmid were selected in an LB
agar medium containing kanamycine. The nucleotide sequences
of respective clones were analyzed and cDNA sequence (SEQ ID
NO: 2) encoding novel G-protein-coupled receptor protein was
2s obtained. A novel receptor protein containing amino acid
sequence (SEQ ID N0: 1) derived from this cDNA was designated
as mGPR40. In addition, the transformant was designated as
Escherichia coli TOP10/Zero Blunt-mGPR40.
Reference Example 131 Cloning of cDNA encoding rat spleen-
3o derived GPR40 and determination of nucleotide sequence thereof
PCR was performed using rat spleen cDNA (Marathon-ReadyTM
cDNA; Clontech) as a template and two primers: primer 3 (SEQ
ID N0: 15) and primer 4 (SEQ ID NO: 16). For PCR, Advantage 2
Polymerase mix (Clontech) was used, and elongation reaction of
290
CA 02505322 2005-05-06
(i) 96°C 1 min, (ii) 5 cycles of 96°C 10 sec, 72°C 2 min,
(iii)
25 cycles of 96°C 10 sec, 70°C 2 min, then 72°C 5 min was
performed. After the reaction, the amplified product was
cloned to plasmid vector pCR2.1TOP0 (Invitrogen) according to
the protocol of TOPO TA Cloning Kit (Invitrogen). This was
introduced into Escherichia coli JM109 (TAKARA SHUZO), and
clones having plasmid were selected in an LB agar medium
containing ampicilin. The nucleotide sequences of respective
clones were analyzed and cDNA sequence (SEQ ID N0: 4) encoding
io novel G-protein-coupled receptor protein was obtained. A
novel receptor protein containing amino acid sequence (SEQ ID
N0: 3) derived from this cDNA was designated as rGPR40. In
addition, the transformant was designated as Escherichia coli
JM109/pCR2.1-rGPR40.
Is Reference Example 132 Cloning of cDNA encoding Macaca
fascicularis-derived GPR40 and determination of nucleotide
sequence thereof
PCR was performed using Macaca fascicularis DNA as a
template, primer 1 (SEQ ID N0: 17) and primer 2 (SEQ ID N0:
2° 18). For PCR, Pyrobest DNA Polymerase (TAKARA) was used, and
elongation reaction of (i) 95°C~1 min, (ii) 40 cycles of 95°C
sec, 58°C 20 sec, 72°C 1 min and 30 sec, then 72°C 7 min
was
performed. After the reaction, nested PCR was performed using
the 1/50 diluted amplified product as a template, primer 3
2s (SEQ ID NO: 19) and primer 4 (SEQ ID NO: 20). After the
reaction, the amplified product was cloned to plasmid vector
pCR2.1TOP0 (Invitrogen) according to the protocol of TOPO TA
Cloning Kit (Invitrogen). This was introduced into
Escherichia coli JM109 (TAKARA SHUZO), and clones having
3° plasmid were selected in an LB agar medium containing
ampicilin. The nucleotide sequences of respective clones were
analyzed and cDNA sequence (SEQ ID N0: 8) encoding novel G-
protein-coupled receptor protein was obtained. A novel
receptor protein containing amino acid sequence (SEQ ID NO: 7)
291
CA 02505322 2005-05-06
derived from this cDNA was designated as monkey GPR40. In
addition, the transformant was designated as Escherichia coli
JM109/pCR2.1-monkey GPR40.
Reference Example 133 Cloning of cDNA encoding hamster-derived
GPR40 and determination of nucleotide sequence thereof
PCR was performed using hamster cell line HIT-T15 cDNA as
a template, primer 1 (SEQ ID N0: 21) and primer 2 (SEQ ID NO:
22). For PCR, Klentaq DNA Polymerase (CLONTECH) was used, and
elongation reaction of (i) 95°C 2 min, (ii) 35 cycles of 98°C
10 sec, 63°C 20 sec, 72°C 1 min, then 72°C 7 min was
performed.
After the reaction, the amplified product was cloned to
plasmid vector pCR2.1TOP0 (Invitrogen) according to the
protocol of TOPO TA Cloning Kit (Invitrogen). This was
introduced into Escherichia coli JM109 (TAKARA SHUZO), and
is clones having plasmid were selected in an LB agar medium
containing ampicilin. The nucleotide sequences of respective
clones were analyzed and cDNA sequence (SEQ ID NO: 10)
encoding novel G-protein-coupled receptor protein was obtained.
A novel receptor protein containing amino acid sequence (SEQ
2o ID NO: 9) derived from this cDNA was designated as hamstar
GPR40. In addition, the transformant was designated as
Escherichia coli JM109/pTA hamsterGPR40.
Experimental Example 5 Suppression of expression of mouse
GPR40-GFP fused protein by introduction of siRNA specific to
2s mouse GPR40
CHO cell expressing fused protein of mouse GPR40 and GFP
prepared by a method known per se was seeded in a 96 well
plate at 3x109/well and incubated for one day. siRNA of
various sequences (Dharmacon) (concentration of 2.86 pmol/0.5
30 ~1 or 8.57 pmol/1.5 ~,1) prepared using HVJ Envelope VECTOR KIT
GenomONE~ (ISHIHARA SANGYO) and according to the report of
Elbasir et al. (Nature 411 (6836), 494-498 (2001)) was
introduced into the cells and the cells were further incubated
for one day. The expression amount of mouse GPR40-GFP was
292
CA 02505322 2005-05-06
detected by the following enzyme immunoassay. The culture
supernatant was discarded, washed with HBSS (Invitrogen),
fixed with 0.01 glutaraldehyde (Wako Pure Chemical Industries,
Ltd.) for 5 min., and blocked with PBS (TAKARA SHUZO)
containing 2~ BSA. 500-fold diluted anti-GFP monoclonal
antibody 3E6 (NIPPON GENE CO., LTD.) was added and the cells
were incubated at room temperature for 2 hrs., washed and 500-
fold diluted HRP-labeled anti-mouse IgG antibody (ICN) was
added, and the cells were incubated at room temperature for 2
1° hrs. After washing, TMB microwell peroxydase substrate
(Funakoshi) was added and, after incubation for 30 min.,
sulfuric acid was added to stop the color developing reaction,
and the absorbance at 450 nm was measured. As a result,
addition of m40i103, which is a mouse GPR40 specific siRNA
15 (sense strand is SEQ ID N0: 23, antisense strand is SEQ ID NO:
24), m40i256 (sense strand is SEQ ID N0: 25, antisense strand
is SEQ ID N0: 26) to mouse GPR40-GFP expressing CHO cell
caused lower GPR40-GFP expression amount. Therefrom it was
found that m40i103 and m40i256 specifically suppress mouse
2o GpR40 expression.
Experimental Example 6 Promotion by various fatty acids of
insulin secretion from MINE
Mouse pancreatic (3 cell line MINE cultured'in a flask was
detached with PBS containing 2.5 mM EDTA, and seeded and
2s incubated in a 96 well plate for 2 days. The medium used was
obtained by adding 15o fetal bovine serum (ThermoTrace), 5.5
~,~I 2-mercaptoethanol (Invitrogen), 20 mM HEPES pH 7.3, 100
U/ml penicillin and 100 ~,g/ml streptomycin to Dulbecco's
Modified Eagle Medium (DMEM, Invitrogen) containing 4.5 g/1 of
3o glucose. The cells were washed twice with modified Krebs-
Ringer bicarbonate buffer (KRBH, 116 mM NaCl, 4.7 mM KCl, 1.2
mM KH2P09, 1.2 mM MgSOq, 2.5 mM CaCl2, 25 mM NaHC03, 24 mM HEPES
pH 7.3) and preincubated at 37~C under 5g C02 conditions for 30
min. Fatty acid diluted and prepared with a buffer obtained
293
CA 02505322 2005-05-06
by adding 22 mM glucose to the above-mentioned KRBH was added
to the cell after preincubation and the cells were incubated
at 37~C under 5o C02 conditions for 90 min. After incubation,
the cell supernatant was recovered and cryopreserved. The
s insulin content of the supernatant was measured using a
commercially available insulin immunoassay kit (Amersham
Pharmacia Biotech). As a result, a significant insulin
secretion enhancing activity was found by oleic acid, linoleic
acid, a-linolenic acid, Y-linolenic acid, arachidonic acid and
io DHA, which are fatty acid that showed a remarkable activity in
an intracellular calcium ion mobilization assay using CHO cell
expressing GPR40. In contrast, methyl linolate (linoleic
methyl) and butyric acid that show no GPR40 agonistic activity
did not show a significant insulin secretion enhancing
Is activity. Since the GPR40 agonistic activity and the insulin
secretion enhancing activity are almost correlated, it was
demonstrated that GPR40 plays at least some role in insulin
secretion enhancing action by fatty acid.
Experimental Example 7 Glucose dependency of insulin
2o secretion enhancing activity via GPR40
The effect of glucose concentration on the addition of
fatty acid was examined based on the method of Experimental
Example 6. The concentration of glucose added to KRBH during
fatty acid addition was changed to 0, 5.5, 11, 22 mM and
2s examined. As a result, insulin secretion enhancing activity
of oleic acid and linoleic acid was found to be remarkable
under high glucose concentration conditions of not less than
11 mM. Therefrom the insulin secretion enhancing activity by
fatty acid showing GPR40 agonistic activity is expected to
3o show insulin secretion enhancing activity and effect on blood
glucose under hyperglycemia conditions.
Experimental Example 8 Inhibitory effect of fatty acid on
insulin secretion enhancing activity in siRNA-introduced MINE
In Experimental Example 5, m40i103, which is GPR40
294
CA 02505322 2005-05-06
specific siRNA, was confirmed to remarkably suppress
expression of mouse GPR40. Insulin secretion enhancing
activity in MINE cell, into which m40i103 was introduced using
HVJ Envelope VECTOR KIT GenomONE based on the method of
Experimental Example 5, was examined. The insulin secretion
enhancing activity by fatty acid was examined by the method of
Experimental Example 6. As a result, m40i103 introduced MINE
no longer showed insulin secretion enhancing activity by
linoleic acid and Y-linolenic acid. In contrast, MINE into
io which Scramble II duplex siRNA, which is a random sequence
siRNA, was introduced showed retention of the insulin
secretion enhancing activity by the above-mentioned fatty acid.
From these results, it was confirmed that GPR40 plays at
least some role in the insulin secretion enhancing mechanism
is by fatty acid.
Experimental Example 9 Promoting effect of insulin secretion
from MINE
Mouse pancreatic (3 cell line MINE cultured in a flask was
detached with PBS containing 2.5 mM EDTA, and seeded and
2o incubated in a 96 well plate for 2 days. The medium used was
obtained by adding 15~ fetal bovine serum (ThermoTrace), 5.5
~,~I 2-mercaptoethanol (Invitrogen), 20 mM HEPES pH 7.3, 100
U/ml penicillin and 100 ~,g/ml streptomycin to Dulbecco's
Modified Eagle Medium (DMENI, Invitrogen) containing 4.5 g/1 of
25 glucose. The cells were washed twice with modified Krebs-
Ringer bicarbonate buffer (KRBH, 116 mM NaCl, 4.7 mM KC1, 1.2
mM KHzPOq, 1.2 mM MgS09, 2.5 mM CaCl2, 25 mM NaHC03, 24 mM HEPES
pH 7.3) and preincubated at 37~C under 5~ COZ conditions for 30
min. The compound diluted and prepared with a buffer obtained
3o by adding 22 mM glucose to the above-mentioned KRBH was added
to the cell after preincubation and the cells were incubated
at 37~C under 5$ C02 conditions for 90 min. After incubation,
the cell supernatant was recovered and cryopreserved. The
insulin content of the supernatant was measured using a
295
CA 02505322 2005-05-06
commercially available insulin immunoassay kit (Amersham
Pharmacia Biotech). As a result, as shown in Fig. 1, a
significant insulin secretion enhancing activity was observed
by the addition of the compound of Example 41.
Experimental Example 10 In vivo insulin secretion promoting
effect and hypoglycemic action
Male SD rats (CLEA Japan, Inc, 7-week-old) were fasted
for one day, and divided into groups (6 per group) based on
blood glucose level and body weight. A suspension of the
to compound of Example 41 in 0.5o methyl cellulose was orally
administered at the dose of 30 mg/kg and glucose (2 g/kg) was
orally loaded at 30 min after administration. Only 0.5%
methyl cellulose was administered to the control group, and
similarly loaded with glucose. Plasma was taken before
Is glucose tolerance test, and 7, 30 and 60 minutes after glucose
tolerance test, and the blood glucose level and insulin
concentration were measured. The blood glucose level was
measured by HITACHI autoanalyzer 7070, and insulin was
measured by radioimmunoassay ([l2sL] Sionoria insulin, Shionogi
20 ~ Co., Ltd.). As a result, as compared to the control group,
the Example 41 compound administration group showed
significantly suppressed increase in the blood glucose level
at 30 minutes after glucose tolerance test (Fig: 2, Williams
test, p<=0.025), and significantly greater increase in insulin
2s at 7 minutes after glucose tolerance test (Fig. 3, Williams
test, p<=0.025). From these results, it was clarified that
the compound of Example 41 shows both the insulin secretion
promoting effect and hypoglycemic action in rat.
Reference Example 134 ethyl (2E)-3-(2-fluoro-4-
3o methoxyphenyl)acrylate
The title compound was obtained as a colorless oil in the
same manner as in Reference Example 27 from 2-fluoro-4-
methoxybenzaldehyde. yield 970.
1H NMR (CDC13) g 1.33 (3 H, t, J=7.1 Hz), 3.83 (3 H, s), 4.26
296
CA 02505322 2005-05-06
(2 H, q, J=7.1 Hz), 6.41 (1 H, d, J=16.2 Hz), 6.61-6.73 (2 H,
m) , 7 .45 (1 H, t, J=8. 6 Hz) , 7. 75 (1 H, d, J=16.2 Hz) .
Reference Example 135 ethyl 3-(2-fluoro-4-
methoxyphenyl)propionate
The title compound was obtained as a colorless oil in the
same manner as in Reference Example 43 from ethyl (2E)-3-(2-
fluoro-4-methoXyphenyl)acrylate and platinum oxide. yield 84o.
1H NMR (CDC13) g 1.23 (3 H, t, J=7.2 Hz) , 2.58 (2 H, t, J=7.6
Hz) , 2.90 (2 H, t, J=7.6 Hz) , 3.77 (3 H, s) , 4.12 (2 H, q,
to J=7.2 Hz) , 6.57-6. 63 (2 H, m) , 7.07-7.13 ( 1 H, m) .
Reference Example 136 ethyl 3-(2-fluoro-4-
hydroxyphenyl)propionate
The title compound was obtained as a colorless oil in the
same manner as in Reference Example 36 from ethyl 3-(2-fluoro
is 4-methoxyphenyl)propionate and 1-octanethiol. yield 830.
1H NMR (CDC13) $ 1.23 (3 H, t, J=7.2 Hz) , 2.58 (2 H, t, J=8.1
Hz) , 2. 89 (2 H, t, J=8.1 Hz) , 4.12 (2 H, q, J=7.2 Hz) , 6. 51-
6. 56 (2 H, m) , 7 . O1-7. 06 ( 1 H, m) .
Reference Example 137 methyl (2E)-3-(2-chloro-4-
2~ hydroxyphenyl)acrylate
The title compound was obtained as a colorless oil in the
same manner as in Reference Example 34 from 4-bromo-3-
chlorophenol. yield 170.
1H NMR (CDC13) g 3.83 (3 H, s) , 5. 99 (1 H, br s) , 6.33 (1 H, d,
25 J=16 .1 Hz ) , 6 . 7 9 ( 1 H, dd, J=8 . 6, 2 . 4 Hz ) , 6 . 94 ( 1 H, d,
J=2 . 4
Hz ) , 7 . 53 ( 1 H, d, J=8 . 6 Hz ) , 8 . 05 ( 1 H, d, J=16 . 1 Hz ) .
Reference Example 138 methyl 3-(2-chloro-4-hydroxyphenyl)
propionate
The title compound was obtained as a colorless oil in the
so same manner as in Reference Example 43 from methyl (2E)-3-(2-
chloro-4-hydroxyphenyl)acrylate and platinum oxide. yield 440.
1H NMR (CDC13) g 2. 62 (2 H, t, J=7 .9 Hz) , 2 .99 (2 H, t, J=7.9
Hz), 3.68 (3 H, s), 4.95 (1H, s), 6.67 (1 H, dd, J=8.3, 2.6
Hz ) , 6 . 87 ( 1 H, d, J=2 . 6 Hz ) , 7 .10 ( 1 H, d, J=8 . 3 Hz ) .
297
CA 02505322 2005-05-06
Reference Example 139 4-phenyl-N-propyl-1,3-thiazol-2-amine
To a solution of 2-chloroacetophenone (4.45 g, 28.8 mmol)
and N-propylthiourea (3.40 g, 28.8 mmol) in ethanol (50 mL)
was added sodium acetate (3.07 g, 37.4 mmol), and the mixture
was heated under reflux for 1.5 hrs. Water was added to the
reaction mixture, and crystals were collected by filtration.
The obtained crude crystals were recrystallized from diethyl
ether-hexane to give the title compound (5.64 g, 92~) as
colorless crystals.
io 1H I~IMR (CDC13) g 1.00 {3 H, t, J=7.2 Hz), 1.60-1.78 {2 H, m),
3.19-3.29 (2 H, m), 5.38 (1 H, br s), 6.70 (1 H, s), 7.25 -
7.41 (3 H, m) , 7.77 - 7.81 (2 H, m) .
Reference Example 140 N,5-dimethyl-4-phenyl-1,3-thiazol-2-
amine
The title compound was obtained as colorless crystals in
the same manner as in Reference Example 139 from 2-bromo-1-
phenylpropan-1-one and N-methylthiourea. yield 57%.
1H NMR (CDC13) g 2.40 (s, 3 H), 2.85 (d, J=3.3 Hz, 3 H), 5.79
(br s, 1 H), 7.26-7.31 (m, 1 H), 7.36-7.41 (m, 2 H), 7.56-7.58
{m, 2 H) .
Reference Example 141 4,5-dimethyl-N-propyl-1,3-thiazol-2-
amine
The title compound was obtained as yellow crystals in the
same manner as in Reference Example 139 from 3-bromobutan-2-
one and N-propylthiourea. yield 19~.
1H I~ll~IR (CDC13) g 0. 97 (3 H, t, J=7.0 Hz) , 1 .58 - 1.70 (2 H, m) ,
2.10 (3 H, s), 2.18 (3 H, s), 3.15 (2 H, t, J=7.0 Hz), 4.89 -
5.07 (1 H, m).
Reference Example 142 5-methyl-4-phenyl-N-propyl-1,3-thiazol-
2-amine
The title compound was obtained as yellow crystals in the
same manner as in Reference Example 139 from 2-bromo-1-
phenylpropan-1-one and N-propylthiourea. yield 230.
1H NMR (CDC13) g 0.97 (3 H, t, J=7.4 Hz) , 1 .57 - 1 .70 (2 H, m) ,
298
CA 02505322 2005-05-06
2 .40 (3 H, s) , 3.17 (2 H, q, J=7.4 Hz) , 5.23 (1 H, br s) , 7.25
- 7.31 (1 H, m) , 7.36-7.41 (2 H, m) , 7.55-7. 59 (2 H, m) .
Reference Example 143 methyl 4-[[methyl(4-phenyl-1,3-thiazol-
2-yl)amino]methyl]benzoate
To a solution of N-methyl-4-phenyl-1,3-thiazol-2-amine
(1.67 g, 8.8 mmol) in N,N-dimethylformamide (25 mL) was added
60o sodium hydride (350 mg, 8.8 mmol), and the mixture was
stirred for 30 min. Methyl 4-(bromomethyl)benzoate (2.1 g,
9.2 mmol) was added and the mixture was stirred at room
io temperature for 1.5 hrs. Water was added to the reaction
mixture, and the mixture was extracted with ethyl acetate.
The extract was washed with water and concentrated under
reduced pressure. The residue was purified by silica gel
column chromatography (hexane/ethyl acetate=3:1) to give the
15 title compound (2.6 g, yield 86~) as a yellow oil.
1H NMR (CDC13) g 3.08 (s, 3 H), 3.90 (s. 3 H), 4.85 (s. 2 H),
6.75 (s, 1 H), 7.27-7.43 (m, 5H), 7.86 (dd, J=8.4, 1.4 Hz, 2
H) , 8 . 02 (d, J=8 . 4 Hz, 2 H) .
Reference Example 144 [4-[[methyl(4-phenyl-1,3-thiazol-2-
2° yl)amino]methyl]phenyl]methanol
Under ice-cooling, to a solution of methyl 4-[[methyl(4-
phenyl-1,3-thiazol-2-yl)amino]methyl]benzoate (2.06 g, 6.1
mmol) in tetrahydrofuran (30 mL) was added 0.9 M
diisobutylaluminum hydride-hexane solution (30 mL, 27 mmol).
2s The reaction mixture was stirred at room temperature for 2 hrs,
sodium sulfate 10 hydrate (8.7 g, 27 mmol) was added and the
mixture was stirred at room temperature for 1 hr. Insoluble
material was filtered off, and the filtrate was concentrated.
The residue was purified by silica gel column chromatography
30 (hexane/ethyl acetate=1:1) to give the title compound (1.9 g,
yield 980) as a white powder.
1H NMR (CDC13) g 3.07 (s, 3 H), 4.67 (d, J=5.8 Hz, 2 H), 4.77
(s, 2 H), 6.72 (s, 1 H), 7.23-7.42 (m, 7H), 7.83-7.89 (m, 2H).
Reference Example 145 methyl 4-[[ethyl(4-phenyl-1,3-thiazol-2-
299
CA 02505322 2005-05-06
yl)amino]methyl]benzoate
The title compound was obtained as a yellow oil in the
same manner as in Reference Example 143 from N-ethyl-4-phenyl-
1,3-thiazol-2-amine. yield 60$.
1H NMR (CDC13) g 1.24 (t, J=7. 2 Hz, 3 H) , 3 . 52 (q, J=7 .2 Hz, 2
H) , 3. 91 (s, 3 H) , 4 . 83 (s, 2 H) , 6. 72 (s, 1 H) , 7. 24-7 .44 (m,
5 H) , 7 .82-7. 86 (m, 2 H) , 7 . 98-8. 02 (m, 2 H) .
Reference Example 146 [4-[[ethyl(4-phenyl-1,3-thiazol-2-
yl)amino]methyl]phenyl]methanol
io The title compound was obtained as a colorless oil in the
same manner as in Reference Example 144 from methyl 4-
[[ethyl(4-phenyl-1,3-thiazol-2-yl)amino)methyl]benzoate.
yield 69~.
1H NMR (CDC13) g 1.23 (t, J=7. 1 Hz, 3 H) , 3.51 (q, J=7.1 Hz, 2
H), 4.69 (d, J=4.8 Hz, 2 H), 4.76 (s, 2 H), 6.71 (s, 1 H),
7.24-7.39 (m, 7 H), 7.83-7.87 (m, 2 H).
Reference Example 147 methyl 4-[[(4-phenyl-1,3-thiazol-2-
yl)(propyl)amino]methyl]benzoate
The title compound was obtained as a colorless oil in the
2° same manner as in Reference Example 143 from 4-phenyl-N-
propyl-1,3-thiazol-2-amine. yield 75~.
1H NMR (CDC13) g 0. 93 (t, J=7. 7 Hz, 3 H) , 1 . 64-1.74 (m, 2 H) ,
3.40 (t, J=7.7 Hz, 2 H) , 3.91 (s, 3 H) , 4.85 (s~, 2 H) , 6.72 (s,
1 H), 7.23-7.42 (m, 5 H), 7.82-7.85 (m, 2 H), 7.99-8.01 (m, 2
H ) .
Reference Example 148 [4-[[(4-phenyl-1,3-thiazol-2-
yl)(propyl)amino]methyl]phenyl]methanol
The title compound was obtained as a colorless oil in the
same manner as in Reference Example 144 from methyl 4-[[(4-
3o phenyl-1,3-thiazol-2-yl)(propyl)amino]methyl]benzoate. yield
67$.
1H NMR (CDC13) g 0. 93 (t, J=7. 4 Hz, 3 H) , 1 . 62 (t, J=5.8 Hz, 1
H), 1.64-1.74 (m, 2 H), 3.40 (t, J=7.7 Hz, 2 H), 4.69 (d,
J=5.8 Hz, 2 H), 4.79 (s, 2 H), 6.70 (s, 1 H), 7.24-7.39 (m, 7
300
CA 02505322 2005-05-06
H), 7.84-7.87 (m, 2 H).
Reference Example 149 methyl 4-[[methyl(5-methyl-4-phenyl-1,3-
thiazol-2-yl)amino]methyl]benzoate
The title compound was obtained as a yellow powder in the
same manner as in Reference Example 143 from N,5-dimethyl-4-
phenyl-1,3-thiazol-2-amine. yield 96$.
1H NMR (CDC13) g 2. 42 (s, 3 H) , 3. 03 (s, 3 H) , 3.91 (s, 3 H) ,
4.75 (s, 2 H), 7.26-7.31 (m, 1 H), 7.36-7.41 (m, 4 H), 7.62-
7 . 65 (m, 2 H) , 8 . Ol (d, J=8 . 3 Hz, 2 H) .
to Reference Example 150 [4-[[methyl(5-methyl-4-phenyl-1,3-
thiazol-2-yl)amino]methyl]phenyl]methanol
The title compound was obtained as a white powder in the
same manner as in Reference Example 144 from methyl 4-
[[methyl(5-methyl-4-phenyl-1,3-thiazol-2-
ls yl)amino]methyl]benzoate. yield 92~.
1H NMR (CDC13) g 2. 42 (s, 3 H) , 3. 02 (s, 3 H) , 4. 68 (s, 4 H) ,
7.26-7.41 (m, 7 H), 7.64 (d, J=7.5 Hz, 2 H).
Reference Example 151 methyl 4-[[(5-methyl-4-phenyl-1,3-
thiazol-2-yl)(propyl)amino]methyl]benzoate
2o The title compound was obtained as a yellow oil in the
same manner as in Reference Example 143 from 5-methyl-4-
phenyl-N-propyl-1,3-thiazol-2-amine. yield 79~.
1H NMR (CDC13) g 0. 92 (t, J=7. 4 Hz, 3 H) , 1. 66-1:72 (m, 2 H) ,
2 . 41 (s, 3 H) , 3. 32-3. 37 (m, 2 H) , 3. 91 (s, 3 H) , 4 .77 (s, 2
2s H), 7.26-7.41 (m, 5 H), 7.61-7.63 (m, 2 H), 7.98-8.01 (m, 2 H).
Reference Example 152 [4-[[(5-methyl-4-phenyl-1,3-thiazol-2-
yl)(propyl)amino]methyl]phenyl]methanol
The title compound was obtained as a colorless oil in the
same manner as in Reference Example 144 from methyl 4-[[(5-
3o methyl-4-phenyl-1,3-thiazol-2-yl)(propyl)amino]methyl]benzoate.
yield 78~.
1H NMR (CDC13) g 0. 91 (t, J=7 . 4 Hz, 3 H) , 1 .57-1.72 (m, 2 H) ,
2.41 (s, 3 H), 3.32-3.37 (m, 2 H), 4.68 (d, J=5.8 Hz, 2 H),
4.70 (s, 2 H), 7.24-7.41 (m, 7 H), 7.63-7.65 (m, 2 H).
301
CA 02505322 2005-05-06
Reference Example 153 methyl 3-[[methyl(4-phenyl-1,3-thiazol-
2-yl)amino]methyl]benzoate
The title compound was obtained as a colorless oil in the
same manner as in Reference Example 143 from N-methyl-4-
phenyl-1,3-thiazol-2-amine and methyl 3-(bromomethyl)benzoate.
yield 72%.
1H NMR (CDC13) g 3. 08 (s, 3 H) , 3. 91 (s, 3 H) , 4. 83 (s, 2 H) ,
6.74 (s, 1 H) , 7.25-7. 44 (m, 4 H) , 7 .58 (d, J=7.7 Hz, 1 H) ,
7.85-7.88 (m, 2 H), 7.96-7.98 (m, 1 H), 8.03 (s, 1 H).
so Reference Example 154 [3-[[methyl(4-phenyl-1,3-thiazol-2-
yl)amino]methyl]phenyl]methanol
The title compound was obtained as a colorless oil in the
same manner as in Reference Example 144 from methyl 3-
[[methyl(4-phenyl-1,3-thiazol-2-yl)amino]methyl]benzoate.
15 yield 95%.
1H NMR (CDC13) g 3 . 09 ( s, 3 H) , 4 . 69 (d, J=5. 8 Hz, 2 H) , 4 . 78
(s, 2 H) , 6.73 (s, 1 H) , 7. 24-7 .40 (m, 7 H) , 7 .85-7 . 88 (m, 2
H) .
Reference Example 155 methyl 4-[[(4-phenyl-1,3-thiazol-2-
2° yl)thio]methyl]benzoate
The title compound was obtained as a white powder in the
same manner as in Reference Example 143 from 4-phenyl-1,3-
thiazole-2-thiol and methyl 4-(bromomethyl)benzdate. yield
79%.
2s 1H NMR (CDC13) g 3. 90 (s, 3 H) , 4. 54 (s, 2 H) , 7.31-7.45 (m, 4
H), 7.49 (d, J=8.3 Hz, 2 H), 7.86-7.90 (m, 2 H), 7.96-8.00 (m,
2 H) .
Reference Example 156 [4-[[(4-phenyl-1,3-thiazol-2-
yl)thio]methyl]phenyl]methanol
3o The title compound was obtained as a white powder in the
same manner as in Reference Example 144 from methyl 4-[[(4-
phenyl-1,3-thiazol-2-yl)thio]methyl]benzoate. yield 85%.
1H NMR (CDC13) g 1. 67 (t, J=5.4 Hz, 1 H) , 4 .51 (s, 2 H) , 4. 67
(d, J=5.3 Hz, 2 H) , 7.26-7. 44 (m, 8 H) , 7. 89 (d, J=8.1 Hz, 2
302
CA 02505322 2005-05-06
H) .
Reference Example 157 N-(4,5-dihydronaphtho[1,2-
d][1,3]thiazol-2-yl)propanamide
Under ice-cooling, to a solution of 4,5-
dihydronaphtho[1,2-d][1,3]thiazol-2-amine (1.50 g, 7.4 mmol)
in pyridine (20 mL) was added proptonyl chloride (1.03 g, 11
mmol), and the mixture was stirred at room temperature for 2
hrs. Water was added to the reaction mixture, and the mixture
was extracted with ethyl acetate. The extract was washed with
to water and concentrated under reduced pressure. The residue
was purified by silica gel column chromatography (hexane/ethyl
acetate=3:1) to give the title compound (1.75 g, yield 91%) as
a powder.
1H NMR (CDC13) g 1. 14 (t, J=7. 5 Hz, 3 H) , 2 . 33 (q, J=7 . 5 Hz, 2
15 H), 2.96-3.09 (m, 4 H), 7.18-7.28 (m, 3 H), 7.71 (d, J=7.5 Hz,
1 H) .
Reference Example 158 N-propyl-4,5-dihydronaphtho[1,2-
d] [1, 3] thiazol-2-amine
Under ice-cooling, to a solution of N-(4,5-
Zo dihydronaphtho[1,2-d][1,3]thiazol-2-yl)propanamide (1.70 g,
6.6 mmol) in tetrahydrofuran (30 mL) was added lithium
aluminum hydride (749 mg, 20 mmol), and the mixture was
stirred at room temperature for 3 hrs. Sodium sulfate 10
hydrate (9.6 g, 30 mmol) was added, and the mixture was
2s stirred at room temperature for 1 hr. Insoluble material was
filtered off, and the filtrate was concentrated. The residue
was purified by silica gel column chromatography (hexane/ethyl
acetate=4:1) to give the title compound (1.32 g, yield 82°s) as
a yellow powder.
so 1H NMR (CDC13) g 0. 99 (t, J=7.5 Hz, 3 H) , 1. 62-1.76 (m, 2 H) ,
2.83-2.88 (m, 2 H), 2.99-3.04 (m, 2 H), 3.20-3.26 (m, 2 H),
5.26 (s, 1 H), 7.10-7.26 (m, 3H), 7.70 (d, J=7.9 Hz, 1 H).
Reference Example 159 methyl 4-[[4,5-dihydronaphtho[1,2-
d] [ 1, 3] thiazol-2-yl (propyl ) amino] methyl] benzoate
303
CA 02505322 2005-05-06
The title compound was obtained as a oil in the same
manner as in Reference Example 143 from N-propyl-4,5-
dihydronaphtho[1,2-d][1,3]thiazol-2-amine. yield 780.
~H NMR (CDC13) g 0.93 (t, J=7.5 Hz, 3 H), 1.63-1.73(m, 2 H),
2 .82-2. 88 (m, 2 H) , 3 . 02 (t, J=7 . 8 Hz, 2 H) , 3.38 (t, J=7 .8 Hz,
2 H) , 3. 90 (s, 3 H) , 4 . 81 (s, 2 H) , 7. 09-7 .26 (m, 4 H) , 7.41
(d, J=8.1 Hz, 2 H), 7.99 (d, J=8.1 Hz, 2 H).
Reference Example 160 [4-[[4,5-dihydronaphtho[1,2-
d][1,3]thiazol-2-yl(propyl)amino]methyl]phenyl]methanol
io The title compound was obtained as a colorless oil in the
same manner as in Reference Example 144 from methyl 4-[[4,5-
dihydronaphtho[1,2-d][1,3]thiazol-2-
yl(propyl)amino]methyl]benzoate. yield 63~.
1H NMR (CDC13) g 0. 93 (t, J=7. 4 Hz, 3 H) , 1. 63-1.73 (m, 2 H) ,
i5 2.82-2.87 (m, 2 H), 2.99-3.04 (m, 2 H), 3.35-3.40 (m, 2 H),
4 . 68 (d, J=5.1 Hz, 2 H) , 4 . 75 ( s, 2 H) , 7. 09-7 . 40 (m, 7 H) ,
7.78 (d, J=7.5 Hz, 1 H) .
Reference Example 161 methyl 4-[[(4,5-dimethyl-1,3-thiazol-2-
yl)(propyl)amino]methyl]benzoate
2° The title compound was obtained as a yellow oil in the
same manner as in Reference Example 143 from 4,5-dimethyl-N-
propyl-1,3-thiazol-2-amine. yield 680.
1H NMR (CDC13) g 0. 88 (t, J=7. 4 Hz, 3 H) , 1. 56-1: 66 (m, 2 H) ,
2.12 (d, J=0.8 Hz, 3 H), 2.18 (d, J=0.8 Hz, 3 H), 3.25-3.30 (m,
25 2 H) , 3. 90 (s, 3 H) , 4 .71 (s, 2 H) , 7. 33 (d, J=8. 5 Hz, 2 H) ,
7.96-8.00 (m, 2H).
Reference Example 162 [4-[[(4,5-dimethyl-1,3-thiazol-2-
yl)(propyl)amino]methyl]phenyl]methanol
The title compound was obtained as a colorless oil in the
3o same manner as in Reference Example 144 from methyl 4-[[(4,5-
dimethyl-1,3-thiazol-2-yl)(propyl)amino]methyl]benzoate.
yield 63~.
1H NMR (CDC13) g 0.87 (t, J=7.4 Hz, 3 H), 1.56-1.66 (m, 2 H),
2 .13 (s, 3 H) , 2 .18 (s, 3 H) , 3.25-3. 30 (m, 2 H) , 4 . 64 (s, 2
304
CA 02505322 2005-05-06
H), 4.67 (s, 2 H), 7.24-7.33 (m, 4 H).
Reference Example 163 (2',6'-dimethylbiphenyl-4-yl)methanol
( 4-Bromophenyl ) methanol ( 5 . 00 g, 32 mmol ) , ( 2, 6-
dimethylphenyl)boronic acid (5.77 g, 39 mmol) and sodium
carbonate (10.2 g, 96 mmol) were dissolved in toluene-
methanol-water (5:1:1, 210 mL) and, after argon substitution,
tetrakistriphenylphosphinepalladium (1.85 g, 1.6 mmol) was
added. The reaction mixture was heated under reflux overnight
under an argon atmosphere. The reaction mixture was cooled,
to water was added to the reaction mixture and the mixture was
extracted with ethyl acetate. The extract was washed with
water, dried and concentrated. The residue was purified by
silica gel column chromatography (hexane/ethyl acetate=7:3) to
give the title compound (4.44 g, yield 65~) as a white powder.
1s 1H NMR (CDC13) $ 1.69 (1 H, t, J=6.0 Hz) , 2.03 (6 H, s) , 4.76
(2 H, d, J=6.0 Hz) , 7. 09 - 7.19 (5 H, m) , 7.43 (2 H, d, J=8.1
Hz) .
Reference Example 164 3-(4-((3-
phenoxybenzyl)oxy)phenyl)propanenitrile
Zo The title compound was obtained as a pale-yellow oil in
the same manner as in Reference Example 31 from 3-
phenoxybenzyl alcohol and 3-(4-hydroxyphenyl)propanenitrile.
yield 95~ . MS 330 .1 (MH+) .
Reference Example 165 (1Z)-N-hydroxy-3-(4-((3-
25 phenoxybenzyl)oxy)phenyl)propanimideamide
A suspension of hydroxyamine hydrochloride (1.05 g, 15.1
mmol) and triethylamine (3.0 ml, 21.5 mmol) in dimethyl
sulfoxide (30 ml) was stirred at room temperature for 30 min.,
and 3-(4-((3-phenoxybenzyl)oxy)phenyl)propanenitrile (0.5 g,
30 1.52 mmol) was added. The mixture was stirred at 70~C for 18
hrs, reaction solution was diluted with ethyl acetate, washed
successively with water and aqueous sodium chloride solution,
dried over magnesium sulfate, and concentrated under reduced
pressure. The obtained crystals were recrystallized from
305
CA 02505322 2005-05-06
ethyl acetate-tetrahydrofuran to give the title compound (0.49
g, 89~) as colorless needles.
MS 363.1 (MH+) .
Reference Example 166 1-(tert-butoxycarbonyl)-3-hydroxymethyl-
1H-indole
To a solution of methyl 1-(tert-butoxycarbonyl)-1H-
indole-3-carboxylate (2.5 g, 9.08 mmol) in anhydrous
tetrahydrofuran (40 ml) was added 1.5 M diisobutylaluminum
hydride-toluene solution (14 ml, 21 mmol) under ice-cooling,
io and the mixture was stirred for 2 hrs. An aqueous citric acid
solution was added, and the mixture was extracted with ethyl
acetate. The extract was washed successively with aqueous
sodium chloride solution, dried over magnesium sulfate and
concentrated under reduced pressure to give the title compound
15 (2.3 g, 100 0 as a pale-yellow oil.
1H-I~1MR (CDC13) g 1 . 67 ( 9H, s) , 4 . 84 (2H, d, J=6. OHz ) , 7 .14-7 . 38
(3H, m) ,
7 . 58 ( 1H, s ) , 7 . 64 ( 1H, d, J=7 . 5Hz ) , 8 .13 ( 1H, br d, J=8 .1Hz )
.
Reference Example 167 2-hydroxymethyl-3-methoxymethoxy-1-
benzothiophene
2° The title compound was obtained as a pale-yellow oil in
the same manner as in Reference Example 166 from methyl 3-
methoxymethoxy-1-benzothiophene-2-carboxylate (91~).
1H-I~ll~IR(CDC13) g 2.72(lH,t,J=6.6Hz), 3.68(3H,s), '
4.80(2H,d,J=6.6Hz), 5.11(2H,s), 7.30-7.43(2H,m), 7.66-
25 7.82 (2H,m) .
Reference Example 168 2-hydroxymethyl-3-(2-methylbenzyloxy)-1-
benzothiophene
The title compound was obtained as a pale-yellow oil in
the same manner as in Reference Example 166 from methyl 3-(2
3o methylbenzyloxy)-1-benzothiophene-2-carboxylate (58~).
1H-NMR(CDC13) g 2.42(3H,s), 4.50(2H,d,J=5.2Hz), 5.17(2H,s),
7 .10-7 . 82 ( 8H, m) .
Reference Example 169 (2',6'-dimethyl-6-methoxybiphenyl-3-
yl)methanol
306
CA 02505322 2005-05-06
The title compound was obtained as a colorless oil in the
same manner as in Reference Example 199 and Reference Example
200 to be mentioned later. yield 76~.
1H-NMR ( CDC13) g 2 . O 1 ( 6H, s ) , 3 . 74 ( 3H, s ) , 4 . 65 ( 2H, d, J=5 .
2Hz ) ,
6 . 97 ( 1H, d, J=8 . 4Hz ) , 7 . 03 ( 1H, d, J=2 . 2Hz ) , 7 . 06-7 . 24 (
3H, m) ,
7.35(lH,dd,J=2.6 & 8.4Hz).
Reference Example 170 (2',6'-dimethyl-4-methoxybiphenyl-3-
yl)methanol
The title compound was obtained as a colorless oil in the
io same manner as in Reference Example 199 and Reference Example
200 to be mentioned later. yield 820.
1H-NMR ( CDC13 ) g 2 . 03 ( 6H, s ) , 2 . 37 ( 1H, t, J=6 . 6Hz ) , 3 . 92 (
3H, s ) ,
4 . 71 ( 2H, d, J=6 . 6Hz ) , 6 . 94 ( 1H, d, J=8 . 8Hz ) , 7 . 02-7 . 22 (
5H, m) .
Reference Example 171 ethyl (2E)-3-(4-benzyloxy-2,6-
i5 dimethoxyphenyl)propenoate
To a solution of 4-hydroxy-2,6-dimethoxybenzaldehyde (1.0
g, 5 . 4 9 mmol ) , benzyl alcohol ( 0 . 65 g, 6 . O1 mmol ) and
tributylphosphine (1.5 g, 7.41 mmol) in tetrahydrofuran (120
ml ) was added l, 1' - ( azodicarbonyl ) dipiperidine ( 1. 8 g, 7 .13
2° mmol) by small portions, and the mixture was stirred at room
temperature for 18 hrs. Diethyl ether (120 ml) was added to
the reaction mixture, the precipitated insoluble material was
filtered off and the filtrate was concentrated under reduced
pressure. The residue was subjected to silica gel
2s chromatography (ethyl acetate:hexane=2:3-1:1) to give 4-
benzyloxy-2,6-dimethoxybenzaldehyde (1.2 g) as pale-yellow
crystals. Separately, a solution of ethyl diethylphosphono
acetate (1.1 g, 4.91 mml) and 60$ sodium hydride (0.17 g, 4.25
mmol) in tetrahydrofuran (40 ml) was stirred under ice-cooling
3o for 10 min. A solution of 4-benzyloxy-2,6-
dimethoxybenzaldehyde (1.2 g) was added, and the mixture was
stirred while elevating the temperature to room temperature
for 5 hrs. The reaction solution was diluted with ethyl
acetate, washed successively with aqueous citric acid solution,
307
CA 02505322 2005-05-06
water and aqueous sodium chloride solution, dried over
magnesium sulfate, and concentrated under reduced pressure.
The obtained residue was washed with diethyl ether-hexane to
give the title compound (1.2 g) as colorless crystals. yield
640. MS 343.1 (MH+).
Reference Example 172 ethyl (2E)-3-(4-hydroxy-2,6-
dimethoxyphenyl)propanoate
A mixed solution of ethyl 3-(4-benzyloxy-2,6-
dimethoxyphenyl)propenoate (1.2 g, 3.50 mmol) and 10~
io palladium-carbon (0.40 g) in a mixed solvent of ethanol (30
ml) and tetrahydrofuran (30 ml) was stirred under a hydrogen
atmosphere at room temperature for 18 hrs. The catalyst was
filtered off and the filtrate was concentrated under reduced
pressure to give the title compound (800 mg) as colorless
is crystals. yield 90~. MS 255.1 (MH+).
Reference Example 173 ethyl 3-(2,6-difluoro-4-
methoxyphenyl)propanoate
A solution of ethyl diethylphosphonoacetate (2.34 g, 10.4
mml ) and 60 o sodium hydride ( 0 . 38 g, 9 . 50 mmol ) in
2o tetrahydrofuran (40 ml) was stirred under ice-cooling for 10
min. 2,6-Difluoro-4-methoxybenzaldehyde (1.5 g, 8.71 mmol)
was added, and the mixture was stirred while elevating the
temperature to room temperature for 4 hrs. The'reaction
solution was diluted with ethyl acetate, washed successively
25 with aqueous citric acid solution, water and aqueous sodium
chloride solution, dried over magnesium sulfate, and
concentrated under reduced pressure. The obtained residue was
subjected to silica gel chromatography (ethyl
acetate: hexane=1:10-1:5), and then subjected to catalytic
3o reduction in the same manner as in Reference Example 172 to
give the title compound (1.17 g) as a colorless oil. yield
52~ . MS 245. 0 (MH+) .
Reference Example 174 ethyl 3-(2,6-difluoro-4-
hydroxyphenyl)propanoate
308
CA 02505322 2005-05-06
A solution (20 ml) of ethyl 3-(2,6-difluoro-4-
methoxyphenyl)propanoate (1.17 g, 4.79 mmol), aluminum
chloride (1.9 g, 14.2 mmol) and 1-octanethiol (1.7 ml, 9.80
mmol) in dichloromethane was stirred from ice-cooling to room
s temperature for 4 hrs. The reaction solution was poured into
ice water, and the mixture was stirred for 1 hr. The mixed
solution was extracted with dichloromethane, and the extract
was washed with aqueous sodium chloride solution, dried over
magnesium sulfate, and concentrated under reduced pressure.
1° The obtained residue was subjected to silica gel
chromatography (ethyl acetate:hexane=1:10-1:5) to give the
title compound (1.0 g) as a colorless oil. yield 91~. MS
230.9 (MH+) .
Reference Example 175 (6-benzyloxy-2',6'-dimethyl-biphenyl-3-
is yl ) methanol
The title compound was obtained as a colorless oil in the
same manner as in Reference Example 199 and Reference Example
200 to be mentioned later. yield 37~.
1H-NMR (CDC13) $ 1. 56 ( 1H, t, J=5. 6Hz) , 2 . 04 ( 6H, s) ,
20 4 . 65 ( 2H, d, J=5 . 6Hz ) , 5 . 03 ( 2H, s ) , 6 . 96-7 . 44 ( 11H, m) .
Reference Example 176 (2,6-dimethylphenyl)[4-(1,3-dioxolan-2-
yl)phenyl]methanol
Iodine (10 mg) was added to a mixture of magnesium (1.20
g) and tetrahydrofuran (50 mh) with vigorous stirring and 2-
2s (4-bromophenyl)-1,3-dioxolane (10.0 g) was added dropwise at
room temperature. After the completion of the dropwise
addition, the reaction mixture was stirred at room temperature
for 1 hr and a solution of 2,6-dimethylbenzaldehyde (5.0 g) in
tetrahydrofuran (20 mL) was added dropwise at O~C. After the
3o completion of the dropwise addition, the temperature of the
reaction mixture was allowed to return to room temperature and
the mixture was further stirred for 1 hr. The reaction
mixture was poured into saturated aqueous ammonium chloride,
and the mixture was extracted with ethyl acetate. The ethyl
309
CA 02505322 2005-05-06
acetate layer was concentrated and the residue was purified by
silica gel column chromatography. The residue was developed
with ethyl acetate-hexane (gradient of 1:9 to 7:3 by volume
ratio) to give the title compound (9.10 g, yield 73~) as a
yellow oil.
1H NMR (300 MHz, Chloroform-D) g: 2.14 - 2.23 (1 H, m), 2.26 (6
H, s), 3.97 - 4.19 (4 H, m), 5.79 (1 H, s), 6.35 (1 H, d,
J=4.1 Hz), 7.03 (2 H, d, J=7.5 Hz), 7.05 - 7.2(1 H, m), 7.29
(2 H, d, J=7.7 Hz) , 7.35 - 7.45 (2 H, m) .
1° Reference Example 177 (2, 6-dimethylphenyl) [3- (l, 3-dioxolan-2-
yl)phenyl]methanol
The title compound was obtained in the same manner as in
Reference Example 176. yield:74~ (a yellow oil).
1H I~~R (300 MHz, Chloroform-D) g: 2.17 (1 H, d, J=4.3 Hz) , 2.27
is (6 H, s), 3.87 - 4.23 (4 H, m), 5.77 (1 H, s), 6.25 - 6.4 (1 H,
m) , 7 . 0 - 7 . 55 ( 7 H, m) .
Reference Example 178 [4-(2,6-dimethylbenzyl)phenyl]methanol
A mixture of (2,6-dimethylphenyl)[4-(1,3-dioxolan-2-
yl)phenyl]methanol (7.10 g), chlorotrimethylsilane (10.8 g),
2° sodium iodide (15.0 g) and acetonitrile (50 mL) was stirred at
50°C for 1 hr. The reaction mixture was poured into water, and
the mixture was extracted with ethyl acetate. The ethyl
acetate layer was washed successively with 10$ aqueous sodium
hydrogencarbonate solution and saturated brine, dried over
25 anhydrous magnesium sulfate, and concentrated. The residue
was purified by silica gel column chromatography with ethyl
acetate-hexane (gradient of 1:9 to 7:3 by volume ratio) to
give 4-(2,6-dimethylbenzyl)benzaldehyde as pale-yellow
crystals.
30 1H ~R (300 MHz, Chloroform-D) g: 2.23 (6 H, s) , 4.13 (2 H, s) ,
7.05 - 7.2 (5 H, m), 7.76 (2 H, d, J=8.3 Hz), 9.95 (1 H, s).
This compound (3.70 g) was dissolved in tetrahydrofuran
(50 mL) and cooled to O~C, and lithium aluminum hydride (1.0 g)
was added with stirring. After stirring at 0°C for 1 hr,
310
CA 02505322 2005-05-06
sodium sulfate 10 hydrate (5.0 g) was added. The temperature
of the reaction mixture was allowed to return to room
temperature and the mixture was further stirred for 30 min.
The insoluble material was removed by filtration, and the
obtained organic layer was concentrated to give the title
compound (3.43 g, yield 61~) as pale-yellow crystals.
1H NMR (300 MHz, Chloroform-D) g: 1.54 (1 H, t, J=6 Hz), 2.23
(6 H, s), 4.05 (2 H, s), 4.64 (2 H, d, J=6 Hz), 7.00 (2 H, d,
J=7.9 Hz), 7.05 - 7.15 (3 H, m), 7.24 (2 H, d, J=8.1 Hz)
io Reference Example 179 [3-(2,6-dimethylbenzyl)phenyl)methanol
The title compound was obtained in the same manner as in
Reference Example 178 from (2,6-dimethylphenyl)[3-(1,3-
dioxolan-2-yl)phenyl]methanol. yield:52o (a yellow oil).
1H NMR (300 MHz, Chloroform-D) g: 2.24 (6 H, s), 4.06 (2 H, s),
15 4. 62 (2 H, s) , 6.8 - 7.4 (7 H, m) .
Reference Example 180 methyl 3-(4-{[4-
(chloromethyl)benzyl]oxy}phenyl)propanoate
4-(Chloromethyl)benzyl alcohol (4.68 g), methyl 3-(4-
hydroxyphenyl)propanoate (5.40 g) and triphenylphosphine (9.20
2° g) were dissolved in a mixed solvent of toluene-
tetrahydrofuran (60-30 mL) and cooled to O~C, and diethyl
azodicarboxylate (40$ toluene solution, 15.2 g) was added
dropwise with vigorously stirring. After the completion of
the dropwise addition, the temperature of the reaction mixture
25 was allowed to return to room temperature and the mixture was
further stirred for 1 hr. The reaction mixture was
concentrated and the residue was purified by silica gel column
chromatography with ethyl acetate-hexane (gradient of 1:19 to
1:1 by volume ratio) to give the title compound (5.19 g, yield
3° 540) as colorless crystals.
1H NMR (300 MHz, Chloroform-D) g: 2.59 (2 H, t, J=7.7 Hz), 2.89
(2 H, t, J=7.7 Hz) , 3. 66 (3 H, s) , 4.59 (2 H, s) , 5.04 (2 H,
s), 6.89 (2 H, d, J=8.7 Hz), 7.11 (2 H, d, J=8.7 Hz), 7.35 -
7.45 (4 H, m) .
311
CA 02505322 2005-05-06
Reference Example 181 N-isobutyl-4-phenyl-1,3-thiazol-2-amine
A mixture of 2-bromo-1-phenylethanone (4.0 g), N-
isobutylthiourea (2.60 g) and N,N-dimethylformamide (15 mL)
was stirred at room temperature for 1 hr. The reaction
mixture was poured into saturated aqueous sodium
hydrogencarbonate, and the mixture was extracted with ethyl
acetate. The ethyl acetate layer was concentrated, and the
residue was purified by silica gel column chromatography with
ethyl acetate-hexane (gradient of 1:9 to 2:1 by volume ratio)
io to give the title compound (3.30 g, 71~) as a yellow oil.
1H I~ll~IR (300 MHz, Chloroform-D) g: 1.01 (6 H, d, J=6. 6 Hz) , 1.89
- 2.04 (1 H, m), 3.05 - 3.15 (2 H, m), 5.26 (1 H, broad s),
6.69 (1 H, s), 7.25 - 7.3 (1 H, m), 7.3 - 7.4 (2 H, m), 7.75 -
7.85 (2 H, m) .
is The following compounds of Reference Examples 182-184
were synthesized in the same manner as in Reference Example
181.
Reference Example 182 N-isopropyl-4-phenyl-1,3-thiazol-2-amine
Yield 80~. a yellow oil. 1H NMR (300 MHz, Chloroform-D) g:
20 1. 31 ( 6 H, d, J=6 . 3 Hz ) , 3 . 65 - 3 . 80 ( 1 H, m) , 4 . 95-5 . 05 (
1 H,
m), 6.69 (1 H, s), 7.2 - 7.4 (3 H, m), 7.7 - 7.8 (2 H, m)
Reference Example 183 N-hexyl-4-phenyl-1,3-thiazol-2-amine
Yield 94%. a yellow oil. 1H NMR (300 MHz, Chloroform-D) g:
0 . 8 - 1. 0 ( 3 H, m) , 1. 1 - 1 . 5 ( 6 H, m) , 1. 5 - 1. 8 ( 2 H, m) ,
25 3.2 - 3.4 (2 H, m) , 5.20 (1 H, broad s) , 6.70 (1 H, s) , 7.15 -
7.5 (3 H, m) , 7. 7 - 7. 8 (2 H, m)
Reference Example 184 N-(3-methylbutyl)-4-phenyl-1,3-thiazol-
2-amine
Yield 910. a yellow oil. 1H NMR (300 MHz, Chloroform-D) g:
so 0.96 (6 H, d, J=6.6 Hz) , 1.40 - 1 .65 (2 H, m) , 1. 65 - 1 .8 (1 H,
m), 3.2 - 3.4 (2 H, m), 5.13 (1 H, broad s), 6.70 (1 H, s),
7.2 - 8.05 (5 H, m)
Reference Example 185 N-propyl-4-[4-(trifluoromethyl)phenyl]-
1,3-thiazol-2-amine hydrobromide
312
CA 02505322 2005-05-06
A mixture of 2-bromo-1-[4-
(trifluoromethyl)phenyl]ethanone (5.34 g), N-propylthiourea
(2.60 g) and ethanol (50 mL) was stirred for 1 hr while
heating under reflux. The reaction mixture was cooled and
diluted with isopropyl ether. The precipitated solid was
collected by filtration, washed with isopropyl ether and dried
to give the title compound (5.11 g, yield 70~) as colorless
crystals.
1H NMR (300 MHz, DMSO-D6) g: 0.96 (3 H, t, J=7. 4 Hz) , 1.45 -
io 1.8 (2 H, m) , 3.31 (2 H, t, J=7.0 Hz) , 7.30 (1 H, s) , 7.75 (2
H, d, J=8.5 Hz) , 8.00 (2 H, d, J=8.5 Hz)
The following compounds of Reference Examples 186 and 187
were synthesized in the same manner as in Reference Example
185.
i5 Reference Example 186 4-(4-chlorophenyl)-N-propyl-1,3-thiazol-
2-amine hydrobromide
Yield 71$. colorless crystals. 1H NMR (300 MHz, Ik~iSO-D6) g:
0 . 95 ( 3 H, t, J=7 . 4 Hz ) , 1. 4 - 1. 8 ( 2 H, m) , 3 . 30 ( 2 H, t,
J=7.1 Hz), 7.15 (1 H, s), 7.48 (2 H, d, J=8.5 Hz), 7.66 - 7.96
20 (2 H, m) .
Reference Example 187 4-(3-methoxyphenyl)-N-propyl-1,3-
thiazol-2-amine hydrobromide
yields 71~. pale-yellow crystals. 1H NMR (300 MHz, DMSO-D6)
g: 0. 95 (3 H, t, J=7. 4 Hz) , 1. 45 - 1. 7 (2 H, m) , 3.32 (2 H, t,
2s J=7.1 Hz), 3.81 (3 H, s), 6.85 - 7.0 (1 H, m), 7.1 - 7.2 (1 H,
m), 7.25 - 7.4 (3 H, m) .
Reference Example 188 N-propyl-5-phenyl-1,3-thiazol-2-amine
To a solution of phenylacetaldehyde (1.20 g) in
dichloromethane (10 mL) was added dropwise bromine (1.60 g) at
3o poC. The temperature was allowed to return to room temperature
and the mixture was stirred for 1 hr. The reaction mixture
was poured into aqueous sodium sulfite, and the mixture was
extracted with ethyl acetate. The ethyl acetate layer was
concentrated, N-propylthiourea (1.18 g) and ethanol (30 mL)
313
CA 02505322 2005-05-06
were added to the residue, and the mixture was stirred with
heating under reflex for 1 hr. The reaction mixture was
concentrated and poured into aqueous sodium hydrogencarbonate,
and the mixture was extracted with ethyl acetate. The ethyl
acetate layer was concentrated, and the residue was purified
by silica gel column chromatography with ethyl acetate-hexane
(gradient of 1:9 to 2:1 by volume ratio) to give the title
compound (120 mg, yield 5~) as colorless crystals.
1H NMR (300 MHz, Chloroform-D) g: 1.02 (3 H, t, J=7.4 Hz), 1.6
io - 1. g5 (2 H, m) , 3.28 (2 H, t, J=6.7 Hz) , 5. 30 (1 H, broad s) ,
7.20 (1 H, t, J=7.3 Hz), 7.25 - 7.4 (3 H, m), 7.4 - 7.45 (2 H,
m)
Reference Example 189 3-(3-methylphenoxy)benzaldehyde
A mixture of 3-bromobenzaldehyde (7.01 g, 37.9 mmol), m-
i5 cresol (4.51 g, 41.7 mmol), copper oxide (II) (4.53 g, 56.9
mmol), potassium carbonate (7.86 g, 56.9 mmol), pyridine (50
mL) and quinoline (25 mlJ) was stirred under a nitrogen
atmosphere at 170~C for 24 hrs. The reaction mixture was
cooled and pyridine was evaporated under reduced pressure.
2° Ethyl acetate was added to the residue, the insoluble material
was filtered off, and the filtrate was washed with 1 M
hydrochloric acid and saturated brine and dried over anhydrous
sodium sulfate. The solvent was evaporated under reduced
pressure and the residue was purified by silica gel column
25 chromatography (hexane-10~ ethyl acetate/hexane) to give the
title compound (5.80 g, 72~) as a pale-brown oil.
MS : m/ z 213 (MH+ ) .
Reference Example 190 [3-(3-methylphenoxy)phenyl]methanol
3-(3-Methylphenoxy)benzaldehyde (5.80 g, 27.3 mmol) was
3o dissolved in a mixture of 1,2-dimethoxyethane (30 mL) and
tetrahydrofuran (30 mL), sodium borohydride (0.567 g, 15.0
mmol) was added under ice-cooling and the mixture was stirred
at the same temperature for 4 hrs. Dil. hydrochloric acid was
added to the reaction mixture, and the mixture was extracted
314
CA 02505322 2005-05-06
with ethyl acetate. The extract was washed with saturated
brine, dried over anhydrous magnesium sulfate, and
concentrated under reduced pressure. The residue was purified
by silica gel column chromatography (200-60~ ethyl
acetate/hexane) to give the title compound (4.83 g, yield 830)
as a pale-yellow oil.
1H NMR (CDC13) g 1.66 {t, J=6.0 Hz, 1H), 2.33 (s, 3H), 4.67 (d,
J=6.0 Hz, 2H) , 6.79-6. 83 (m, 2H) , 6. 90-6. 94 (m, 2H) , 7. O1 (s,
1H) , 7. 09 (d, J=7. 5 Hz, 1H) , 7. 19-7. 34 (m, 2H) .
1° Reference Example 191 3-(4-methylphenoxy)benzaldehyde
The title compound was obtained as a yellow oil in the
same manner as in Reference Example 189 from 3-
bromobenzaldehyde and p-cresol. yield 83~.
MS : m/ z 213 {MH+ ) .
15 Reference Example 192 [3-(4-methylphenoxy)phenyl]methanol
The title compound was obtained as a colorless oil in the
same manner as in Reference Example 190 from 3-(4-
methylphenoxy)benzaldehyde. yield 86~.
1H NMR (CDClj) g 1.62 (t, J=6.1 Hz, 1H), 2.34 (s, 3H), 4.66 {d,
2° J=6.1 Hz, 2H) , 6. 88-6. 94 (m, 3H) , 6. 98 (s, 1H) , 7 .06 (d, J=7
.7
Hz, 1H), 7.14 (d, J=8.7 Hz, 2H), 7.30 (t, J=7.7 Hz, 1H).
Reference Example 193 (3-bromophenyl)(phenyl)methanone
Under ice-cooling, to a solution of 3-bromobenzoyl
chloride (9.50 g, 43.3 mmol) in benzene {30 mL) was added
2s aluminum chloride (III) (6.93 g, 52.0 mmol) by small portions,
and the mixture was heated to 50~C and stirred for 2 hrs. The
reaction mixture was poured into ice water, and the mixture
was extracted with ethyl acetate. The extract was washed with
saturated brine, dried over magnesium sulfate, and the solvent
3o was evaporated under reduced pressure. The residue was
purified by silica gel column chromatography (hexane-5~ ethyl
acetate/hexane) to give the title compound (10.7 g, yield 95~)
as pale-red crystals.
MS : m/ z 2 61 (MH+ ) .
315
CA 02505322 2005-05-06
Reference Example 194 1-bromo-3-(1-phenylvinyl)benzene
To a suspension of methyltriphenylphosphonium iodide
(13.3 g, 33.3 mmol) in tetrahydrofuran (80 mL) was added
potassium t-butoxide (3.37 g, 30.0 mmol) by small portions
under ice-cooling, and the mixture was stirred under a
nitrogen atmosphere at the same temperature for 4 hrs. To the
reaction mixture was added dropwise a solution of (3-
bromophenyl)(phenyl)methanone (5.22 g, 20.0 mmol) in
tetrahydrofuran (20 mL), and the mixture was further stirred
to under ice-cooling for 2 hrs. Water was added to the reaction
mixture, and the mixture was extracted with ethyl acetate,
washed with saturated brine, dried over magnesium sulfate, and
the solvent was evaporated under reduced pressure. The
residue was purified by silica gel column chromatography
is (hexane-loo ethyl acetate/hexane) to give the title compound
(5.18 g, yield 92%) as a colorless oil.
MS: m/z 259 (MH+) .
Reference Example 195 3-(1-phenylvinyl)benzaldehyde
A solution of 1-bromo-3-(1-phenylvinyl)benzene (1.00 g,
20 3,86 mmol) in tetrahydrofuran (5 mL) was stirred under a
nitrogen atmosphere at -78°C, and 1.6 M n-butyllithium/hexane
solution (3 mL, 4.8 mmol) was added dropwise. After 1 hr,
N,N-dimethylformamide (0.372 mL, 4.80 mmol) was~added, and the
mixture was further stirred at the same temperature for 2 hrs.
25 Aqueous ammonium chloride solution was added to the reaction
mixture, and the mixture was extracted with ethyl acetate.
The extract was washed with saturated brine, dried over
anhydrous magnesium sulfate, and concentrated under reduced
pressure. The residue was purified by silica gel column
3o chromatography (hexane-20~ ethyl acetate/hexane) to give the
title compound (0.626 g, yield 78~) as a colorless oil.
MS: m/z 209 (MH+) .
Reference Example 196 [3-(1-phenylvinyl)phenyl]methanol
The title compound was obtained as a colorless oil in the
316
CA 02505322 2005-05-06
same manner as in Reference Example 190 from 3-(1-
phenylvinyl)benzaldehyde. yield 840.
1H NMR (CDC13) g 1. 68 (t, J=5.3 Hz, 1H) , 4. 69 (d, J=5.3 Hz, 2H) ,
5.47 (s, 2H) , 7 .24-7 .34 (m, 9H) .
Reference Example 197 3-(2-methyl-1-naphthyl)benzaldehyde
1-Bromo-2-methylnaphthalene (3.32 g, 15.0 mmol) and (3-
formylphenyl)boronic acid (2.13 g, 15.0 mmol) was dissolved in
a mixture of 1 M sodium carbonate aqueous solution (30 mL),
ethanol (15 mL) and toluene (30 mL) and, after argon
1° substitution, tetrakis(triphenylphosphine)palladium (0) (0.867
g, 0.750 mmol) was added. The reaction mixture was stirred
under an argon atmosphere at 80~C for 24 hrs. The reaction
mixture was cooled, diluted with water and ethyl acetate, and
the insoluble material was filtered through celite. The
is organic layer of the filtrate was washed with saturated brine,
dried over anhydrous magnesium sulfate, and concentrated under
reduced pressure. The residue was purified by silica gel
column chromatography (hexane-20o ethyl acetate/hexane) to
give the title compound (2.39 g, yield 65~) as a pale-yellow
20 oil.
MS: m/z 247 (MH+) .
Reference Example 198 [3-(2-methyl-1-naphthyl)phenyl]methanol
The title compound was obtained as a color~.ess viscous
oil in the same manner as in Reference Example 190 from 3-(2-
2s methyl-1-naphthyl)benzaldehyde. yield 81~.
1H NMR (CDC13) g 1.74 (t, J=5. 3 Hz, 1H) , 2.24 (s, 3H) , 4 .78 (d,
J=5. 3 Hz, 2H) , 7 .20-7. 53 (m, 8H) , 7. 77-7 . 85 (m, 2H) .
Reference Example 199 2',6'-dimethylbiphenyl-3-carbaldehyde
3-Bromobenzaldehyde (18.5 g, 100 mmol) and 2,6-
3o dimethylphenylboronic acid (21.0 g, 140 mmol) were dissolved
in a mixture of 1 M sodium carbonate aqueous solution (200 mL),
ethanol (100 mL) and toluene (200 mL) and, after argon
substitution, tetrakis(triphenylphosphine)palladium (0) (5.78
g, 5.00 mmol) was added. The reaction mixture was stirred
317
CA 02505322 2005-05-06
under an argon atmosphere at 80~C for 20 hrs. The reaction
mixture was cooled, diluted with water and ethyl acetate, and
the insoluble material was filtered through celite. The
organic layer of the filtrate was washed with saturated brine,
dried over anhydrous magnesium sulfate, and concentrated under
reduced pressure. The residue was purified by silica gel
column chromatography (hexane-10~ ethyl acetate/hexane) to
give the title compound (20.4 g, yield 970) as a colorless oil.
MS: m/z 211 (MH+) .
to Reference Example 200 (2',6'-dimethylbiphenyl-3-yl)methanol
2',6'-Dimethylbiphenyl-3-carbaldehyde (18.5 g, 88.0 mmol)
was dissolved in a mixture of 1,2-dimethoxyethane (100 mL) and
tetrahydrofuran (100 mL), and sodium borohydride (1.66 g, 44.0
mmol) was added under ice-cooling and the mixture was stirred
15 at the same temperature for 3 hrs and then at room temperature
for 3 hrs. Dil. hydrochloric acid was added to the reaction
mixture, and the mixture was extracted with ethyl acetate.
The extract was washed with saturated brine, dried over
anhydrous magnesium sulfate, and concentrated under reduced
2° pressure. The residue was purified by silica gel column
chromatography (10~-50~ ethyl acetate/hexane) to give the
title compound (15.6 g, yield 83~) as a colorless oil.
1H NMR (CDC13) $ 1. 66 (t, J=5. 9 Hz, 1H) , 2.03 (s; 6H) , 4.74 (d,
J=5.9 Hz, 2H), 7.07-7.19 (m, 5H), 7.35 (d, J=7.5 Hz, 1H), 7.43
25 (t, J=7.5 Hz, 1H) .
Reference Example 201 [3-(2,6-dimethylphenoxy)phenyl]methanol
A mixture of 3-bromobenzaldehyde (6.1 g, 32.7 mmol), 2,6-
dimethylphenol (4.0 g, 32.7 mmol), copper oxide (II) (4.4 g,
55.6 mmol), potassium carbonate (9.0 g, 65.4 mmol), pyridine
30 (40 mL) and m-xylene (20 mL) was stirred under a nitrogen
atmosphere at 140°C for 16 hrs. The reaction mixture was
cooled, the insoluble material was filtered off, and the
filtrate was concentrated under reduced pressure. The residue
was partitioned between ethyl acetate and water. The organic
318
CA 02505322 2005-05-06
layer was washed with saturated brine, dried (anhydrous sodium
sulfate), and concentrated under reduced pressure to give
crude 3-(2,6-dimethylphenoxy)benzaldehyde (including side
product).
This compound was dissolved in methanol (74 mL), sodium
borohydride (0.62 g, 16.4 mmol) was added under ice-cooling,
and the mixture was stirred at the same temperature for 2 hrs.
The reaction mixture was concentrated, and the residue was
diluted with ethyl acetate, washed with 1N hydrochloric acid
to and saturated brine, dried, and concentrated under reduced
pressure. The residue was purified by silica gel column
chromatography (hexane/ethyl acetate=4/1-2/1) to give the
title compound (1.7 g, yield 23%) as yellow crystals.
1H NMR (CDC13 ) g : 1. 60 ( 1H, t, J = 6 . 0 Hz ) , 2 .12 ( 6H, s ) , 4 . 64
15 (2H, d, J = 6.0 Hz), 6.65 (1H, dd, J = 2.7, 8.1 Hz), 6.80 (1H,
s ) , 6 . 97 ( 1H, d, J = 7 . 5 Hz ) , 7 . 02-7 .13 ( 3H, m) , 7 . 22 ( 1H, d,
J = 7.5 Hz).
Reference Example 202 4-(benzyloxy)benzaldehyde
To a mixture of 4-hydroxybenzaldehyde (28.2 g, 231 mmol),
Zo potassium carbonate (47.9 g, 347 mmol), potassium iodide (3.84
g, 23.1 mmol) and N,N-dimethylformamide (280 mL) was added
benzyl bromide (27.5 mL, 231 mmol) with stirring at room
temperature, and the mixture was stirred at the'same
temperature for 24 hrs. The reaction mixture was diluted with
2s ethyl acetate, washed successively with water, 1N hydrochloric
acid and saturated brine, dried, and concentrated under
reduced pressure to give the title compound (48 g, yield 980)
as beige crystals.
1H NMR (CDC13) g: 5.16 (2H, s) , 7. 08 (2H, d, J = 8.7 Hz) , 7.31-
30 7.48 (5H, m), 7.84 (2H, d, J = 8.7 Hz), 9.89 (1H, s).
Reference Example 203 tert-butyl (2E)-3-(4-
(benzyloxy)phenyl]acrylate
To a solution (100 mL) of tert-butyl
diethylphosphonoacetate (13.8 g, 51.8 mmol) in tetrahydrofuran
319
CA 02505322 2005-05-06
was added 60$ sodium hydride (2.45 g, 61.2 mmol) with stirring
at 0°C, and the mixture was stirred at the same temperature for
15 min. Then, to this mixture was added dropwise a solution
(138 mL) of 4-(benzyloxy)benzaldehyde (10 g, 47.1 mmol) in
tetrahydrofuran with stirring at 0°C, and the mixture was
stirred at room temperature for 3 hrs. The reaction mixture
was concentrated, and the residue was diluted with ethyl
acetate, and washed with 5~ aqueous potassium hydrogensulfate
solution and saturated brine. The ethyl acetate layer was
to dried over magnesium sulfate, and concentrated under reduced
pressure to give the title compound (13.7 g, yield 94o) as
colorless crystals.
1H NMR (CDC13) g: 1.53 (9H, s), 5.09 (2H, s), 6.24 (1H, d, J =
15.9 Hz), 6.96 (2H, d, J = 9.0 Hz), 7.32-7.49 (7H, m), 7.54
(1H, d, J = 15.9 Hz) .
Reference Example 204 tert-butyl 3-(4-hydroxyphenyl)propanoate
A mixture of tert-butyl (2E)-3-[4-
(benzyloxy)phenyl]acrylate (13.3 g, 42.8 mmol), 10$ Pd carbon
(1.3 g), ethanol (100 mL) and tetrahydrofuran (30 mL) was
2o stirred under a hydrogen atmosphere for 2 hrs. The catalyst
was filtered off, and the filtrate was concentrated under
reduced pressure to give the title compound (7.5 g, yield 79~)
as colorless crystals. '
1H NMR (CDC13) g: 1.41 (9H, s) , 2. 50 (2H, t, J = 7.8 Hz) , 2.83
(2H, t, J = 7.8 Hz), 6.74 (2H, d, J = 8.7 Hz), 7.06 (2H, d, J
- 8.7 Hz) .
Reference Example 205 tert-butyl 3-[4-[(3-
bromobenzyl)oxy]phenyl]propanoate
To a solution (100 mL) of tert-butyl 3-(4-
3o hydroxyphenyl)propanoate (5.5 g, 24.7 mmol) in N,N-
dimethylformamide was added 60~ sodium hydride (1.09 g, 27.2
mmol) with stirring at 0°C, and the mixture was stirred at the
same temperature for 15 min. Then, 3-bromobenzylbromide (6.55
g, 25.91 mmol) was added to this mixture with stirring at 0°C,
320
CA 02505322 2005-05-06
and the mixture was stirred at room temperature for 12 hrs.
The reaction mixture was diluted with ethyl acetate, and
washed with water and saturated brine. The ethyl acetate
layer was dried over magnesium sulfate, and concentrated under
reduced pressure to give the title compound (7.5 g, yield 78~)
as a colorless powder.
1H NMR (CDC13) g: 1.41 (9H, s) , 2.50 (2H, t, J = 7.8 Hz) , 2.85
(2H, t, J = 7. 8 Hz) , 5.01 (2H, s) , 6.87 (2H, d, J = 8.7 Hz) ,
7.12 (2H, d, J = 8.7 Hz), 7.24 (1H, m), 7.34 (1H, d, J = 7.5
to Hz) , 7.44 (1H, m) , 7.59 (1H, s) .
Reference Example 206 2',6'-diethylbiphenyl-3-carbaldehyde
A mixture of 1,3-diethyl-2-bromobenzene (3.87 g, 18.2
mmol), 3-formylphenylboronic acid (3.0 g, 20.0 mmol),
tetrakistriphenylphosphinepalladium (0.84 g, 0.73 mmol),
is sodium carbonate (5.79 g, 54.6 mmol), water (20 mL), ethanol
(20 mL) and toluene (200 mL) was heated under reflux overnight
under an argon atmosphere. The reaction mixture was cooled,
diluted with ethyl acetate, washed with water, dried, and
concentrated under reduced pressure. The residue was purified
2o by silica gel column chromatography (hexane-hexane/ethyl
acetate=5/1) to give the title compound (3.48 g, yield 81°s) as
a yellow oil.
1H NMR (CDC13) g: 1.01 (6H, t, J = 7.5 Hz), 2.30' (4H, q, J =
7.5 Hz), 7.16 (2H, d, J = 7.5 Hz), 7.31 (1H, m), 7.47 (1H, dt,
25 J = 1.5, 7.5 Hz) , 7. 60 (1H, d, J = 7.5 Hz) , 7.71 (1H, t, J =
1.5 Hz), 7.89 (1H, dt, J = 1.5, 7.5 Hz), 10.06 (1H, s).
Reference Example 207 (2',6'-diethylbiphenyl-3-yl)methanol
To a solution of 2',6'-diethylbiphenyl-3-carbaldehyde
(3.48 g, 14.6 mmol) in a mixture of methanol (35 mL) and
so tetrahydrofuran (35 mL) was added sodium borohydride (0.28 g,
7.3 mmol) under ice-cooling, and the mixture was stirred at
the same temperature for 1 hr. The reaction mixture was
adjusted to pH 3 with 1N hydrochloric acid, diluted with ethyl
acetate, washed successively with water and saturated brine,
321
CA 02505322 2005-05-06
dried (magnesium sulfate), and concentrated under reduced
pressure. The residue was purified by silica gel column
chromatography (hexane/ethyl acetate=10/1-2/1) to give the
title compound (2.82 g, yield 80%) as a colorless oil.
1H NMR ( CDC13 ) $ : 1 . 02 ( 6H, t, J = 7 . 5 Hz ) , 1. 68 ( 1H, t, J =
5.7 Hz) , 2. 31 (4H, q, J = 7.5 Hz) , 4.74 (2H, d, J = 5.7 Hz) ,
7.08-7.21 (4H, m), 7.27 (1H, m), 7.33-7.46 (2H, m).
Reference Example 208 2',6'-difluorobiphenyl-3-carbaldehyde
The title compound was synthesized in the same manner as
to in Reference Example 206 from 1,3-difluoro-2-bromobenzene and
3-formylphenylboronic acid. colorless oil (3.0 g, yield 93$).
1H I~IR (CDC13) g: 6. 97-7 . 09 (2H, m) , 7 . 34 ( 1H, m) , 7 . 64 ( 1H, t,
J = 7 . 5 Hz ) , 7 . 75 ( 1H, m) , 7 . 93 ( 1H, dt, J = 1 . 5, 7 . 5 Hz ) ,
7.99 (1H, m), 10.08 (1H, s) .
i5 Reference Example 209 (2',6'-difluorobiphenyl-3-yl)methanol
The title compound was synthesized as a colorless oil in
the same manner as in Reference Example 207 from 2',6'-
difluorobiphenyl-3-carbaldehyde. colorless crystals (yield
90~).
20 1H NMR (CDC13) g: 1.72 (1H, br) , 4 .76 (2H, s) , 6.92-7.04 (2H,
m) , 7 . 2 9 ( 1H, m) , 7 . 35-7 . 51 ( 4H, m) .
Reference Example 210 methyl 3-anilinobenzoate
A mixture of methyl 3-bromobenzoate (5.87 g, 27.3 mmol),
aniline (3.73 mL, 41.0 mmol), cesium carbonate (12.5 g, 38.2
2s mmol), tris(dibenzylidenacetone)dipalladium (0) (1.0 g, 1.09
mmol), rac-2,2'-bis(diphenylphosphino)-1,1'-binaphthyl (1.02 g,
1.64 mmol) and toluene (60 mL) was stirred under a nitrogen
atmosphere at 80°C for 16 hrs. The reaction mixture was cooled,
washed with water and saturated brine, dried over magnesium
3o sulfate, and concentrated under reduced pressure. The residue
was purified by silica gel column chromatography (hexane/ethyl
acetate=10/1-4/1) to give the title compound (2.13 g, yield
34o) as pale-yellow crystalsitle compound.
1H NMR (CDC13) g: 3.90 (3H, s) , 5.79 (1H, s) , 6.98 (1H, t, J =
322
CA 02505322 2005-05-06
7.5 Hz), 7.09 (2H, d, J = 7.5 Hz), 7.21-7.36 (4H, m), 7.5? (1H,
dt, J = 1.5, 7.5 Hz), 7.72 (1H, t, J = 1.8 Hz).
Reference Example 211 (3-anilinophenyl)methanol
To a solution (22 mL) of methyl 3-anilinobenzoate (2.13 g,
9.37 mmol) in tetrahydrofuran was added lithium aluminum
hydride (0.36 g, 9.37 mmol) with stirring at O~C, and the
mixture was stirred at the same temperature for 2 hrs. Sodium
sulfate 10 hydrate (9.1 g, 28.1 mmol) was gradually added to
the reaction mixture and the mixture was stirred at room
to temperature for 5 hrs. The insoluble material was filtered
off, and the filtrate was concentrated under reduced pressure.
The residue was purified by silica gel column chromatography
(hexane/ethyl acetate=10/1-4/1) to give the title compound
(1.12 g, yield 60%) as a colorless oil.
1H NMR (CDC13) g: 1. 61 (1H, t, J = 5.4 Hz) , 4. 65 (2H, d, J =
3 . 6 Hz ) , 5 . 73 ( 1H, s ) , 6 . 88-7 . 04 ( 3H, m) , 7 . 05-7 . 13 ( 3H,
m) ,
7.22-7.33 (3H, m).
Reference Example 212 5- ( 2- ( 4- ( ( 3-
phenoxybenzyl)oxy)phenyl)ethyl)-1H-tetrazole
Zo A solution of 3- (4- ( (3-
phenoxybenzyl)oxy)phenyl)propanenitrile (0.5 g, 1.52 mmol),
sodium azide (0.49 g, 7.54 mmol) and ammonium chloride (0.41 g,
7.66 mmol) in N,N-dimethylformamide (20 ml) was~stirred at
110°C for 28 hrs. The reaction solution was diluted with ethyl
2s acetate, washed successively with aqueous citric acid solution,
water and aqueous sodium chloride solution, dried over
magnesium sulfate, and concentrated under reduced pressure.
The obtained residue was subjected to silica gel
chromatography (ethyl acetate: hexane=2:3-2:1) to give an oil,
3o which was crystallized from ethyl acetate-tetrahydrofuran to
give the title compound (0.24 g, 43%).
MS 373.1 (MH+) .
Reference Example 213 3- ( 2- ( 4- ( ( 3-
phenoxybenzyl) oxy) phenyl) ethyl) -1, 2, 4-oxadiazol-5 (4H) -one
323
CA 02505322 2005-05-06
A solution of (1Z)-N-hydroxy-3-(4-((3-
phenoxybenzyl)oxy)phenyl)propanimideamide (0.50 g, 1.38 mmol)
and carbonyldiimidazole (0.56 g, 3.45 mmol) in tetrahydrofuran
(20 ml) was stirred at room temperature for 5 hrs. The
reaction solution was diluted with ethyl acetate, washed
successively with aqueous citric acid solution, water and
aqueous sodium chloride solution, dried over magnesium sulfate,
and concentrated under reduced pressure. The obtained residue
was subjected to silica gel chromatography (ethyl
to acetate: hexane=1:1-ethyl acetate-ethyl acetate: methanol=10:1)
to give pale-yellow crystals (0.165 g). Then, the crystals
were dissolved in dioxane (6 ml) and stirred at 110~C for 1 hr.
The reaction solution was diluted with ethyl acetate, washed
successively with aqueous citric acid solution, water and
15 aqueous sodium chloride solution, dried over magnesium sulfate,
and concentrated under reduced pressure. The obtained residue
was subjected to silica gel chromatography (ethyl
acetate: hexane=l: l) and recrystallized from ethyl acetate-
hexane to give the title compound (94 mg, 740) as colorless
Zo prism crystals.
MS 389.2 (MH+) .
Reference Example 214 4-(2-{4-[(3-
phenoxybenzyl)oxy]phenyl}ethyl)-3H-1,2,3,5-oxat~iadiazole 2-
oxide
2s A solution of (1Z) -N-hydroxy-3- (4- ( (3-
phenoxybenzyl)oxy)phenyl)propanimideamide (0.50 g, 1.38 mmol)
and thionyl chloride (0.105 ml, 1.44 mmol) in
dimethylacetamide (20 ml) was stirred at room temperature for
hrs. The reaction solution was diluted with ethyl acetate,
3o washed successively with water and aqueous sodium chloride
solution, dried over magnesium sulfate, and concentrated under
reduced pressure. The obtained residue was subjected to
silica gel chromatography (ethyl acetate:hexane=1:2-2:3) to
give the title compound (75 mg, 130) as a pale-yellow oil.
324
CA 02505322 2005-05-06
MS 409.1 (MH+) .
Reference Example 215 4-isopropyl-N-(3-methylbutyl)-1,3-
thiazol-2-amine
A solution of 3-methyl-2-butanone (2.64 g) in methanol
(30 ml) was cooled to -30~C, bromine (4.8 g) was added, and
heated to room temperature with stirring. To the obtained
colorless solution were added N-(3-methylbutyl)thiourea (2.92
g) and sodium acetate (2.40 g) and the mixture was stirred
with heating under reflux for 2 hrs. The reaction mixture was
io concentrated, diluted with ethyl acetate and washed with water.
The ethyl acetate layer was concentrated, and the residue was
purified by silica gel column chromatography with ethyl
acetate-hexane (gradient of 1:9 to 2:1 by volume ratio) to
give the title compound (0.90 g, yield 21~) as a yellow oil.
1s 1H NMR (300 MHz, Chloroform-D) g: 0.94 (6 H, d, J=6.6 Hz), 1.23
(6 H, d, J=6.8 Hz), 1.45 - 1.8 (3 H, m), 2.75 - 2.9 (1 H, m),
3.1 - 3.25 (2 H, m) , 5.0 - 5.25 (1 H, m) , 6. 05 (1 H, d, J=0. 9
Hz) .
Reference Example 216 methyl 2'-formyl-6'-methylbiphenyl-3-
2° carboxylate
A mixture of 2-bromo-3-methylbenzaldehyde (0.30 g, 1.51
mmol), tris(dibenzylidenacetone)dipalladium (0) (0.055 g,
0.060 mmol), 2-(dicyclohexylphosphino)biphenyl (0.032 g, 0.091
mmol) , tripotassium phosphate ( 0. 64 g, 3. 0 mmol) , 3-
25 (methoxycarbonylphenyl)boronic acid (0.35 g, 1.96 mmol) and
toluene (6 mL) was stirred under an argon atmosphere at 90~C
for 17 hrs. The reaction mixture was cooled, diluted with
ethyl acetate, washed with water and saturated brine, dried
(anhydrous sodium sulfate), and concentrated under reduced
so pressure. The residue was purified by silica gel column
chromatography (hexane-hexane/ethyl acetate=4/1) to give the
title compound (0.25 g, yield 650) as a yellow oil.
1H NMR (CDC13)g: 2.12 (3H, s), 3.93 (3H, s), 7.39-7.48 (2H, m),
7 . 50-7 . 60 ( 2H, m) , 7 . 87 ( 1H, dd, J = 0 . 9, 7 . 8 Hz ) , 7 . 95 ( 1H,
t,
325
CA 02505322 2005-05-06
J = 1. 5 Hz ) , 8 .12 ( 1H, dt, J = 1. 5, 7 . 8 Hz ) , 9 . 68 ( 1H, s ) .
Reference Example 217 methyl 2'-methyl-6'-propylbiphenyl-3-
carboxylate
To a suspension (21 mL) of ethyltriphenylphosphonium
s bromide (1.55 g, 4.13 mmol) in tetrahydrofuran was added
sodium hydride (0.14 g, 3.58 mmol) at room temperature with
stirring, and the mixture was stirred at the same temperature
for 20 min. A solution (20 mL) of methyl 2'-formyl-6'-
methylbiphenyl-3-carboxylate (0.70 g, 2.75 mmol) in
tetrahydrofuran was added and the mixture was stirred at 70~C
for 3 hrs. The reaction mixture was cooled, diluted with
ethyl acetate, washed with water and saturated brine, dried,
and concentrated under reduced pressure. Then a mixture of
the obtained residue, 10~ Pd carbon (0.1 g) and methanol (14
is mL) was stirred under a hydrogen atmosphere for 2 hrs. The
catalyst was filtered off, and the filtrate was concentrated
under reduced pressure. The residue was purified by silica
gel column chromatography (hexane-hexane/ethyl acetate=4/1) to
give the title compound (0.63 g, yield 850) as a colorless oil.
1H NMR (CDC13)g: 0.75 (3H, t, J = 7.2 Hz) , 1.33-1.50 (2H, m) ,
1. 98 ( 3H, s ) , 2 . 23-2 . 32 ( 2H, m) , 3 . 92 ( 3H, s ) , 7 . 08-7 .16 (
2H,
m) , 7 . 22 ( 1H, t, J = 7 . 5 Hz ) , 7 . 36 ( 1H, m) , 7 . 5~ ( 1H, t, J =
7.5 Hz) , 7.86 (1H, t, J = 1.5 Hz) , 8.03 (1H, m) .
2s Reference Example 218 (2'-methyl-6'-propylbiphenyl-3-
yl)methanol
To a solution (6.3 mL) of methyl 2'-methyl-6'-
propylbiphenyl-3-carboxylate (0.63 g, 2.35 mmol) in
tetrahydrofuran was added lithium aluminum hydride (0.089 g,
2.35 mmol) with stirring at O~C, and the mixture was stirred at
the same temperature for 2 hrs. Sodium sulfate 10 hydrate
(1.5 g, 4.7 mmol) was gradually added to the reaction mixture,
and the mixture was stirred at room temperature for 5 hrs.
The insoluble material was filtered off, and the filtrate was
326
CA 02505322 2005-05-06
concentrated under reduced pressure. The residue was purified
by silica gel column chromatography (hexane/ethyl
acetate=10/1-2/1) to give the title compound (0.50 g, yield
88~) as a colorless oil.
1H NMR (CDC13) g: 0.77 (3H, t, J = 7.5 Hz) , 1.36-1. 51 (2H, m) ,
1.65 (1H, t, J = 5.4 Hz), 2.00 (3H, s), 2.25-2.34 (2H, m),
4.74 (2H, d, J = 5.4 Hz), 7.06-7.16 (4H, m), 7.20 (1H, t, J =
7 . 5 Hz ) , 7 . 35 ( 1H, m) , 7 . 42 ( 1H, t, J = 7 . 5 Hz ) .
Reference Example 219 methyl 2'-isobutyl-6'-methylbiphenyl-3-
to carboxylate
The title compound was synthesized in the same manner as
in Reference Example 217 from methyl 2'-formyl-6'-
methylbiphenyl-3-carboxylate and isopropyltriphenylphosphonium
iodide. colorless oil (yield 45%).
15 1H I~IR (CDC13) g: 0. 68-0.74 (6H, m) , 1. 61 (1H, m) , 1. 98 (3H, s) ,
2.20 (2H, d, J = 7.5 Hz), 3.91 (3H, s), 7.05-7.12 (2H, m),
7.19 (1H, t, J = 7.5 Hz) , 7.33 (1H, m) , 7.48 (1H, t, J = 7.5
Hz) , 7. 83 (1H, t, J = 1.8 Hz) , 8. O1 (1H, m) .
Reference Example 220 (2'-isobutyl-6'-methylbiphenyl-3-
2o yl)methanol
The title compound was synthesized in the same manner as
in Reference Example 218 from methyl 2'-isobutyl-6'-
methylbiphenyl-3-carboxylate. colorless oil (yield 900).
1H NMR (CDC13) g: 0. 69-0. 76 ( 6H, m) , 1.58-1. 72 (2H, m) , 2. 00 (3H,
2s s) , 2.22 (2H, d, J = 7.2 Hz) , 4.74 (2H, d, J = 4.2 Hz) , 7.04-
7 .15 ( 4H, m) , 7 .19 ( 1H, t, J = 7 . 2 Hz ) , 7 . 34 ( 1H, m) , 7 . 41 (
1H,
t, J = 7.2 Hz).
Reference Example 221 methyl 2'-ethyl-6'-methylbiphenyl-3-
carboxylate
3o The title compound was synthesized in the same manner as
in Reference Example 217 from methyl 2'-formyl-6'-
methylbiphenyl-3-carboxylate and methyltriphenylphosphonium
bromide. colorless oil (yield 82~).
1H NMR (CDC13) g: 1.01 (3H, t, J = 7.5 Hz) , 1.99 (3H, s) , 2.32
327
CA 02505322 2005-05-06
( 2H, q, J = 7 . 5 Hz ) , 3 . 92 ( 3H, s ) , 7 . 08-7 .18 ( 2H, m) , 7 . 24 (
1H,
t, J = 7.5 Hz), 7.37 (1H, m), 7.50 (1H, t, J = 7.5 Hz), 7.87
( 1H, m) , 8 . 03 ( 1H, m) .
Reference Example 222 (2'-ethyl-6'-methylbiphenyl-3-
yl ) methanol
The title compound was synthesized in the same manner as
in Reference Example 218 from methyl 2'-ethyl-6'-
methylbiphenyl-3-carboxylate. colorless oil (yield 910).
1H I~1MR (CDC13)g: 1.02 (3H, t, J = 7.5 Hz), 1.67 (1H, t, J = 6.0
1o Hz) , 2. 00 (3H, s) , 2.34 (2H, q, J = 7.5 Hz) , 4.74 (2H, d, J =
6 . 0 Hz ) , 7 . 07-7 .17 ( 4H, m) , ? . 22 ( 1H, t, J = 7 . 5 Hz ) , 7 . 36 (
1H,
m), 7.42 (1H, t, J = 7.5 Hz) .
Reference Example 223 (2,2',6'-trimethylbiphenyl-3-yl)methanol
The title compound was obtained as a colorless oil in the
is same manner as in Reference Example 199 and Reference Example
200. yield 190.
1H-1~IMR(CDC13) g 1.94(6H,s), 1.97(3H,s), 4.69(2H,d,J=6.OHz),
7.01(lH,s), 7.06-7.32(SH,m).
2o Example 202A methyl 3-[4-[(2',6'-dimethylbiphenyl-3-
yl)methoxy]-2-methylphenyl]propionate
The title compound was obtained in the same manner as in
Reference Example 31 from methyl 3-(4-hydroxy-2~
methylphenyl)propionate and (2',6'-dimethylbiphenyl-3-
2s yl)methanol. yield 67~. oil.
1H NMR (CDC13) g 2. Ol (s, 6 H) , 2.28 (s, 3 H) , 2.52-2. 57 (m, 2
H), 2.85-2.90 (m, 2 H), 3.67 (s, 3 H), 5.08 (s, 2 H), 6.70-
6.79 (m, 2 H), 7.02-7.20 (m, 6 H), 7.37-7.46 (m, 2 H).
Example 203 3-[4-[(2',6'-dimethylbiphenyl-3-yl)methoxy]-2-
3o methylphenyl]propionic acid
The title compound was obtained as colorless crystals in
the same manner as in Reference Example 38 from methyl 3-[4-
[(2',6'-dimethylbiphenyl-3-yl)methoxy]-2-
methylphenyl]propionate. yield 56s.
328
CA 02505322 2005-05-06
1H NMR (CDC13) g 2.01 (s, 6 H), 2.28 (s, 3 H), 2.60 (t, J=7.8
Hz, 2 H) , 2. 89 (t, J=7. 8 Hz, 2 H) , 5.08 (s, 2 H) , 6. 73-6. 80 (m,
2 H) , 7 . 04-7 . 20 (m, 6 H) , 7 . 38-7. 46 (m, 2 H) .
Example 204 ethyl 3-[4-[(2',6'-dimethylbiphenyl-3-yl)methoxy]-
2-fluorophenyl]propionate
The title compound was obtained in the same manner as in
Reference Example 31 from ethyl 3-(2-fluoro-4-
hydroxyphenyl)propionate and (2',6'-dimethylbiphenyl-3-
yl)methanol. yield 560. oil.
io 1H I~IR (CDC13) g 1.23 (t, J=7.2 Hz, 3 H) , 2.00 (s, 6 H) , 2.57
(t, J=7.7 Hz, 2 H), 2.90 (t, J=7.7 Hz, 2 H), 4.12 (q, J=7.2 Hz,
2 H) , 5. 07 (s, 2 H) , 6. 63-6. 70 (m, 2 H) , 7 . 06-7.19 (m, 6 H) ,
7.37-7.47 (m, 2 H) .
Example 205 3-[4-[(2',6'-dimethylbiphenyl-3-yl)methoxy]-2-
fluorophenyl]propionic acid
The title compound was obtained as colorless crystals in
the same manner as in Reference Example 38 from ethyl 3-[4-
[(2',6'-dimethylbiphenyl-3-yl)methoxy]-2-
fluorophenyl]propionate. yield 520.
1H NMR (CDC13) g 2.00 (s, 6 H) , 2.63 (t, J=7. 6 Hz, 2 H) 2. 90 (t,
J=7.6 Hz, 2 H), 5.06 (s, 2 H), 6.63-6.70 (m, 2 H), 7.06-7.18
(m, 6 H) , 7.36-7.46 (m, 2 H) .
Example 206 ethyl 3-[4-[(2',6'-dimethylbiphenyl~3-yl)methoxy]-
2-methoxyphenyl]propionate
The title compound was obtained as a colorless oil in the
same manner as in Reference Example 31 from ethyl 3-(4-
hydroxy-2-methoxyphenyl)propionate and (2',6'-
dimethylbiphenyl-3-yl)methanol. yield 24~. oil.
1H NMR (CDC13) $ 1. 23 (t, J=7.2 Hz, 3 H) , 2 . Ol (s, 6 H) , 2 .55
(t, J=7.7 Hz, 2 H), 2.86 (t, J=7.7 Hz, 2 H), 3.77 (s, 3H),
4 .12 (q, J=7.2 Hz, 2 H) , 5. 08 (s, 2 H) , 6. 45-6.51 (m, 2 H) ,
7.02 (d, J=8.1 Hz, 1 H), 7.09-7.14 (m, 5 H), 7.39-7.47 (m, 2
H).
Example 207 3-[4-[(2',6'-dimethylbiphenyl-3-yl)methoxy]-2-
329
CA 02505322 2005-05-06
methoxyphenyl]propionic acid
The title compound was obtained as a colorless oil in the
same manner as in Reference Example 38 from ethyl 3-[4-
[(2',6'-dimethylbiphenyl-3-yl)methoxy]-2-
s methoxyphenyl)propionate. yield 69~.
1H NMR (CDC13) g 2. O1 (s, 6 H) , 2. 62 (t, J=7. 6 Hz, 2 H) , 2.87
(t, J=7.6 Hz, 2 H), 3.77 (s, 3 H), 5.08 (s, 2 H), 6.45-6.52 (m,
2 H) , 7 . 02-7. 21 (m, 6 H) , 7 . 38-7. 47 (m, 2 H) .
Example 208 methyl 3-[2-chloro-4-[(2',6'-dimethylbiphenyl-3-
1o yl)methoxy]phenyl]propionate
The title compound was obtained as a colorless oil in the
same manner as in Reference Example 31 from methyl 3-(2-
chloro-4-hydroxyphenyl)propionate and (2',6'-dimethylbiphenyl-
3-yl)methanol. yield 690.
1s 1H NMR (CDC13) g 2.01 (6 H, s), 2.61 (2 H, t, J=7.7 Hz), 2.98
(2 H, t, J=7.7 Hz) , 3. 67 (3 H, s) , 5.08 (2 H, s) , 6. 81 (1 H,
dd, J=8 . 5, 2 . 6 Hz ) , 6 . 98 ( 1 H, d, J=2 . 6 Hz ) , 7 . 0? - 7 . 2 0 ( 6
H,
m), 7.35 - 7.47 (2 H, m).
Example 209 3-[2-chloro-4-[(2',6'-dimethylbiphenyl-3-
Zo yl)methoxy]phenyl]propionic acid
The title compound was obtained as a colorless oil in the
same manner as in Reference Example 38 from methyl 3-[2-
chloro-4-[(2',6'-dimethylbiphenyl-3- '
yl)methoxy]phenyl]propionate. yield 85~.
25 1H NMR (CDC13) g 2. O1 ( 6 H, s) , 2. 66 (2 H, t, J=7. 7 Hz) , 2.99
(2 H, t, J=7.7 Hz) , 5. 08 (2 H, s) , 6.80-6. 83 (1 H, m) , 6. 96 -
7 . O1 ( 1 H, m) , 7 . 09 - 7 .18 ( 6 H, m) , 7 . 37 - 7 . 47 (2 H, m) .
Example 210 methyl 3-[4-[(2',6'-dimethylbiphenyl-4-
yl ) methoxy] phenyl ] propionate
3o The title compound was obtained as a colorless oil in the
same manner as in Reference Example 31 from methyl 3-(4-
hydroxyphenyl)propionate and (2',6'-dimethylbiphenyl-4-
yl)methanol. yield 56~.
1H NMR (CDC13) g 2.04 (6 H, s), 2.62 (2 H, t, J=7.7 Hz), 2.91
330
CA 02505322 2005-05-06
(2 H, t, J=7.7 Hz) , 3. 67 (3 H, s) , 5.08 (2 H, s) , 6. 95 (2 H, d,
J=8.7 Hz), 7.07 - 7.20 (7 H, m), 7.49 (2 H, d, J=8.1 Hz).
Example 211 3-[4-[(2',6'-dimethylbiphenyl-4-
yl)methoxy]phenyl]propionic acid
The title compound was obtained as colorless crystals in
the same manner as in Reference Example 38 from methyl 3-[4-
[(2',6'-dimethylbiphenyl-4-yl)methoxy]phenyl]propionate.
yield 52~.
1H I~1MR (CDC13) $ 2.04 (6 H, s) , 2.67 (2 H, t, J=7. 6 Hz) , 2.93
io (2 H, t, J=7.6 Hz) , 5.08 (2 H, s) , 6.96 (2 H, d, J=8.7 Hz) ,
7.07 - 7.20 (7 H, m), 7.49 (2 H, d, J=8.1 Hz).
Example 212 ethyl 3-[4-[(2',6'-dimethylbiphenyl-4-yl)methoxy]-
2-fluorophenyl]propionate
The title compound was obtained as a colorless oil in the
15 same manner as in Reference Example 31 from ethyl 3-(2-fluoro-
4-hydroxyphenyl)propionate and (2',6'-dimethylbiphenyl-4-
yl)methanol. yield 37~
1H NMR (CDC13) g 1.24 (3 H, t, J=7.1 Hz), 2.03 (6 H, s), 2.60
( 2 H, t, J=7 . 6 Hz ) , 2 . 92 ( 2 H, t, J=7 . 6 Hz ) , 4 .13 ( 2 H, q,
2o J=7.1 Hz) , 5.07 (2 H, s) , 6. 64 - 6. 80 (2 H, m) , 7.07 - 7.22 (6
H, m) , 7 . 47 ( 2 H, d, J=7 . 9 Hz ) .
Example 213 3-(4-[(2',6'-dimethylbiphenyl-4-yl)methoxy]-2-
fluorophenyl]propionic acid '
The title compound was obtained as colorless crystals in
zs the same manner as in Reference Example 38 from ethyl 3-[4-
[ ( 2' , 6' -dimethylbiphenyl-4-yl ) methoxy] -2-
fluorophenyl]propionate. yield 33~.
1H NMR (CDC13) $ 2. 03 ( 6 H, s) , 2. 67 (2 H, t, J=7. 6 Hz) , 2 . 94
(2 H, t, J=7. 6 Hz) , 5. 07 (2 H, s) , 6. 68 - 6.79 (2 H, m) , 7.07
30 _ 7,21 (6 H, m), 7.48 (2 H, d, J=8.1 Hz) .
Example 214 methyl 3-[4-[(2-benzylbenzyl)oxy]phenyl]propionate
The title compound was obtained as an oil in the same
manner as in Reference Example 5 from 1-benzyl-2-
(bromomethyl)benzene and methyl 3-(4-hydroxyphenyl)propionate.
331
CA 02505322 2005-05-06
yield 16~.
1H NMR (CDC13) g 2.59 (t, J=7.8 Hz, 2 H), 2.89 (t, J=7.8 Hz, 2
H) , 3. 66 (s, 3 H) , 4 .09 (s, 2 H) , 4 . 95 (s, 2 H) , 6. 81 (d,
J=8 .1 Hz, 2 H) , 7. 07-7 .29 (m, 10 H) , 7 .46-7. 43 (m, 1 H) .
Example 215 3-[4-[(2-benzylbenzyl)oxy]phenyl]propionic acid
The title compound was obtained as colorless crystals in
the same manner as in Reference Example 38 from methyl 3-[4-
[(2-benzylbenzyl)oxy]phenyl]propionate. yield 52~.
1H I~IR (CDC13) 2. 64 (t, J=7. 7 Hz, 2 H) , 2. 90 (t, J=7. 7 Hz, 2 H) ,
io 4.09 (s, 2 H) , 4.95 (s, 2 H) , 6.78-6.83 (m, 2 H) , 7.08-7.32 (m,
H) , 7. 40-7. 46 (m, 1 H) .
Example 216 methyl 3-[4-[[4-[[ethyl(4-phenyl-1,3-thiazol-2-
yl)amino]methyl]benzyl]oxy]phenyl]propionate
The title compound was obtained in the same manner as in
is Reference Example 31 from methyl 3-(4-hydroxyphenyl)propionate
and [4-[[ethyl(4-phenyl-1,3-thiazol-2-
yl)amino]methyl]phenyl]methanol. yield 60~. oil.
1H NMR (CDC13) g 1.21-1.28 (m, 3 H), 2.59 (t, J=7.7 Hz, 2 H),
2.89 (t, J=7.7 Hz, 2 H), 3.51 (q, J=7.2 Hz, 2 H), 3.66 (s, 3
2o H) , 4.77 (s, 2 H) , 5.02 (s, 2 H) , 6.71 (s, 1 H) , 6. 88-6.91 (m,
2 H) , 7 . 08-7 .12 (m, 2 H) , 7 . 24-7 . 41 (m, 7 H) , 7 . 83-7 . 77 (m, 2
H) .
Example 217 3-[4-[[4-[[ethyl(4-phenyl-1,3-thiazol-2-
yl)amino]methyl]benzyl]oxy]phenyl]propionic acid
25 The title compound was obtained as colorless crystals in
the same manner as in Reference Example 38 from methyl 3-[4-
[(4-[[ethyl(4-phenyl-1,3-thiazol-2-
yl)amino]methyl]benzyl]oxy]phenyl]propionate. yield 63~.
MS: m/z 473.1 (M+1)+.
3o Example 218 methyl 3-[2-methyl-4-[[4-[[(4-phenyl-1,3-thiazol-
2-yl)(propyl)amino]methyl]benzyl]oxy]phenyl]propionate
The title compound was obtained in the same manner as in
Reference Example 31 from methyl 3-(4-hydroxy-2-
methylphenyl)propionate and [4-[[(4-phenyl-1,3-thiazol-2-
332
CA 02505322 2005-05-06
yl)(propyl)amino]methyl]phenyl]methanol. yield 580. oil.
1H 1~ZR (CDC13) g 0. 95 (t, J=7. 5 Hz, 3 H) 1. 60-1.75 (m, 2 H) ,
2.29 (s, 3 H), 2.55 (t, J=8.4 Hz, 2 H), 2.88 (t, J=8.4 Hz, 2
H) , 3.39-3.44 (m, 2 H) 3. 68 (s, 3 H) , 4. 80 (s, 2 H) , 5. 00 (s,
2 H) , 6. 69-6.78 (m, 3 H) , 7 . 04 (d, J=8 .4 Hz, 1 H) , 7.26-7.39
(m, 7 H), 7.84-7.87 (m, 2 H).
Example 219 3-[2-methyl-4-[[4-[[(4-phenyl-1,3-thiazol-2
yl)(propyl)amino]methyl]benzyl]oxy]phenyl]propionic acid
The title compound was obtained as a colorless crystals
io in the same manner as in Reference Example 38 from methyl 3-
[2-methyl-4-[[4-[[(4-phenyl-1,3-thiazol-2-
yl)(propyl)amino]methyl]benzyl]oxy]phenyl]propionate. yield
57~.
MS: m/z 501.1 (M+1)+.
15 gale 220 methyl 3-[4-[[4-[[(5-methyl-4-phenyl-1,3-thiazol-
2-yl)(propyl)amino]methyl]benzyl]oxy]phenyl]propionate
The title compound was obtained in the same manner as in
Reference Example 31 from methyl 3-(4-hydroxyphenyl)propionate
and [4-[[(5-methyl-4-phenyl-1,3-thiazol-2-
2o yl)(propyl)amino]methyl]phenyl]methanol. yield 32~. oil.
1H NMR (CDC13) g 0. 91 (t, J=7. 4 Hz, 3 H) , 1 . 60-1.72 (m, 2 H) ,
2.41 (s, 3 H), 2.59 (t, J=7.7 Hz, 2 H), 2.89 (t, J=7.7 Hz, 2
H) , 3.32-3.37 (m, 2 H) , 3. 66 (s, 3 H) , 4.71 (s,' 2 H) , 5.02 (s,
2 H), 6.88-6.92 (m, 2 H), 7.10-7.13 (m, 2 H) 7.25-7.40 (m, 7
25 H), 7.62-7.65 (m, 2 H).
Example 221 3-[4-[[4-[[(5-methyl-4-phenyl-1,3-thiazol-2-
yl ) (propyl ) amino ] methyl ] benzyl ] oxy] phenyl ] propionic acid
The title compound was obtained as a colorless crystals
in the same manner as in Reference Example 38 from methyl 3
30 [4-[[4-[[(5-methyl-4-phenyl-1,3-thiazol-2
yl)(propyl)amino]methyl]benzyl]oxy]phenyl]propionate. yield
59a.
MS: m/z 501.1 (M+1)+,
Example 222 methyl 3-[4-[[4-[[4,5-dihydronaphtho[1,2-
333
CA 02505322 2005-05-06
d][1,3]thiazol-2-
yl(propyl)amino]methyl]benzyl]oxy]phenyl]propionate
The title compound was obtained in the same manner as in
Reference Example 31 from methyl 3-(4-hydroxyphenyl)propionate
and [4-[[4,5-dihydronaphtho[1,2-d][1,3]thiazol-2
yl(propyl)amino]methyl]phenyl]methanol. yield 34~. oil.
1H NMR (CDC13) g 0.93 (t, J=7.4 Hz, 3 H) 1.66-1.74 (m, 2 H),
2 .59 (t, J=7.7 Hz, 2 H) , 2. 82-2. 91 (m, 4 H) , 3.02 (t, J=7 .7 Hz,
2 H), 3.35-3.40 (m, 2 H), 3.66 (s, 3 H), 4.76 (s, 2 H), 5.02
(s, 2 H) , 6.88-6.92 (m, 2 H) , 7 .09-7 .40 (m, 9 H) , 7 .78 (d,
J=7.5 Hz, 1 H) .
Example 223 3-[4-[[4-[[4,5-dihydronaphtho[1,2-d][1,3]thiazol-
2-yl(propyl)amino]methyl]benzyl]oxy]phenyl]propionic acid
The title compound was obtained as colorless crystals in
i5 the same manner as in Reference Example 38 from methyl 3-[4-
[[4-[[4,5-dihydronaphtho[1,2-d][1,3]thiazol-2-
yl(propyl)amino]methyl]benzyl]oxy]phenyl]propionate. yield
340.
MS: m/z 513.1 (M+1)+.
2o E~le 224 ethyl 3-[2-fluoro-4-[[4-[[(4-phenyl-1,3-thiazol-2-
yl)(propyl)amino]methyl)benzyl]oxy]phenyl]propionate
The title compound was obtained in the same manner as in
Reference Example 31 from ethyl 3-(2-fluoro-4-
hydroxyphenyl)propionate and [4-[[(4-phenyl-1,3-thiazol-2-
2s yl)(propyl)amino]methyl]phenyl]methanol. yield 32$. oil.
1H NMR (CDC13) g 0. 93 (t, J=7.2 Hz, 3 H) , 1 .26 (t, J=7.2 Hz, 3
H), 1.65-1.75 (m, 2 H), 2.58 (t, J=7.6 Hz, 2 H), 2.90 (t,
J=7 . 6 Hz, 2 H) , 3.40 (t, J=7 . 8 Hz, 2 H) , 4 .12 (q, J=7 .2 Hz, 2
H), 4.80 (m, 2 H), 5.00 (s, 2 H), 6.63-6.70 (m, 3 H), 7.06-
30 7 .12 (m, 1 H) , 7 .24-7. 29 (m, 1 H) , 7 . 34-7 . 41 (m, 6 H) , 7 . 84-
7.87 (m, 2 H) .
Example 225 3-[2-fluoro-4-[[4-[[(4-phenyl-1,3-thiazol-2-
yl)(propyl)amino]methyl]benzyl]oxy]phenyl]propionic acid
The title compound was obtained as a colorless crystals
334
CA 02505322 2005-05-06
in the same manner as in Reference Example 38 from ethyl 3-[2-
fluoro-4-[[4-[[(4-phenyl-1,3-thiazol-2-
yl)(propyl)amino]methyl]benzyl]oxy]phenyl]propionate. yield
290.
MS: m/z 505.0 (M+1)+.
Example 226 methyl 3-[4-[[4-[[(4,5-dimethyl-1,3-thiazol-2-
yl)(propyl)amino]methyl]benzyl]oxy]phenyl]propionate
The title compound was obtained in the same manner as in
Reference Example 31 from [4-[[(4,5-dimethyl-1,3-thiazol-2-
io yl)(propyl)amino]methyl]phenyl]methanol.
yield 56a. oil.
1H NMR (CDC13) 0. 88 (t, J=7 . 4 Hz, 3 H) , 1. 58-1. 67 (m, 2H) , 2. 13
(s, 3 H) , 2.18 (s, 3 H) , 2.59 (t, J=8.4 Hz, 2 H) , 2.89 (t,
J=8.4 Hz, 2 H) , 3.25-3.30 (m, 2H) , 3. 66 (s, 3 H) , 4. 65 (s, 2
is H) , 5. O1 (s, 2H) , 6. 87-6. 90 (m, 2 H) , 7. 09-7.12 (m, 2 H) ,
7.26-7.27 (m, 2 H), 7.35-7.38 (m, 2H).
Example 227 3-[4-[[4-[[(4,5-dimethyl-1,3-thiazol-2-
yl)(propyl)amino]methyl]benzyl]oxy]phenyl]propionic acid
The title compound was obtained as colorless crystals in
2o the same manner as in Reference Example 38 from methyl 3-[4-
[[4-[[(4,5-dimethyl-1,3-thiazol-2-
yl)(propyl)amino]methyl]benzyl]oxy]phenyl]propionate. yield
a
51~.
MS: m/z 513.1 (M+1)+.
2s Example 228 methyl 3-[4-[[4-[[(4-phenyl-1,3-thiazol-2-
yl)amino]methyl]benzyl]oxy]phenyl]propionate
To a solution of 4-phenyl-1,3-thiazol-2-amine (0.25 g,
1.4 mmol), methyl 3-[4-[(4-formylbenzyl)oxy]phenyl]propionate
(0.58 g, 2.0 mmol) and acetic acid (0.25 g, 4.2 mmol) in 1,2
3o dichloroethane (15 mL) was added triacetoxysodium borohydride
(0.83 g, 3.9 mmol), and the mixture was stirred at room
temperature for 2 days. The reaction mixture was poured into
aqueous sodium hydrogen carbonate, and the mixture was
extracted with ethyl acetate. The extract was washed with
335
CA 02505322 2005-05-06
water and concentrated under reduced pressure. The residue
was purified by silica gel column chromatography (hexane/ethyl
acetate=4:1) to give the title compound (0.31 g, yield 490) as
an oil.
1H NMR (CDC13) g 2. 60 (t, J=7.7 Hz, 2 H) , 2. 89 (t, J=7.7 Hz, 2
H), 3.66 (s, 3 H), 4.54 (d, J=5.5 Hz, 2 H), 5.04 (s, 2 H),
5.50 (br s, 1 H) , 6.71 (s, 1 H) , 6.87-6. 92 (m, 2 H) , 7. 09-7.14
(m, 2 H) 7.26-7.43 (m, 7 H), 7.78-7.82 (m, 2 H).
Example 229 3-[4-[[4-[[(4-phenyl-1,3-thiazol-2-
io yl)amino]methyl]benzyl]oxy]phenyl]propionic acid
The title compound was obtained as colorless crystals in
the same manner as in Reference Example 38 from methyl 3-[4-
[[4-[[(4-phenyl-1,3-thiazol-2-
yl)amino]methyl]benzyl]oxy]phenyl]propionate. yield 690.
15 MS: m/z 445.1 (M+1)+.
Example 230 3-[4-[(2'-methyl-6'-propylbiphenyl-3-
yl)methoxy]phenyl]propanoic acid
To a solution of methyl 3-(4-hydroxyphenyl)propanoate
(0.21 g, 1.14 mmol), (2'-methyl-6'-propylbiphenyl-3-
2o yl)methanol (0.25 g, 1.04 mmol) and tributylphosphine (0.39 mL,
1.56 mmol) in tetrahydrofuran (6 mL) was added 1,1'-
(azodicarbonyl)dipiperidine (0.39 g, 1.56 mmol) with stirring
at O~C, and the mixture was stirred at room temperature for 16
hrs. Diethyl ether was added to the reaction mixture, the
25 insoluble material was filtered off, and the filtrate was
concentrated under reduced pressure. The residue was purified
by silica gel column chromatography (hexane-hexane/ethyl
acetate=4/1) to give as a colorless oil. This product was
then dissolved in a mixed solution of methanol (4.0 mL) and
3o tetrahydrofuran (6.0 mL), 1N aqueous sodium hydroxide solution
(2.28 mL) was added at room temperature with stirring, and the
mixture was stirred at room temperature for 1 hr. The
reaction mixture was adjusted to pH 3 with 1N hydrochloric
acid and the mixture was extracted with ethyl acetate. The
336
CA 02505322 2005-05-06
organic layer was washed with water and saturated brine, dried
(anhydrous magnesium sulfate), and concentrated under reduced
pressure. The residue was purified by silica gel column
chromatography (hexane/ethyl acetate=4/1-1/2) to give the
title compound (0.24 g, yield 59~) as colorless crystals. MS
(APCI-) . 387 (M-H) .
Example 231 3-[4-[(2'-isobutyl-6'-methylbiphenyl-3-
yl)methoxy)phenyl]propanoic acid
The title compound was synthesized in the same manner as
io in Reference Example 230 from methyl 3-(4-
hydroxyphenyl)propanoate and (2'-isobutyl-6'-methylbiphenyl-3-
yl)methanol. colorless oil (yield 580) . MS (APCI-) :401 (M-H) .
Example 232 3-[4-[(2'-ethyl-6'-methylbiphenyl-3-
yl)methoxy]phenyl]propanoic acid
15 The title compound was synthesized in the same manner as
in Reference Example 230 from methyl 3-(4-
hydroxyphenyl)propanoate and (2'-ethyl-6'-methylbiphenyl-3-
yl)methanol. colorless crystals (yield 57~). MS (APCI-): 373
(M-H) .
2o Example 233 methyl 3-(4-((1-(tert-butoxycarbonyl)-1H-indol-3-
yl)methoxy)phenyl)propanoate
The title compound was obtained as a pale-yellow oil in
the same manner as in Reference Example 31 from~l-(tert-
butoxycarbonyl)-3-hydroxymethyl-1H-indole and methyl 3-(4-
zs hydroxyphenyl)propanoate. yield 74~.
1H-NMR ( CDC13 ) g 1. 67 ( 9H, s ) , 2 . 61 ( 2H, t, J=8 . OHz ) ,
2 . 91 ( 2H, t, J=8 . OHz ) , 3 . 67 ( 3H, s ) , 5 .17 ( 2H, s ) , 6 . 94 (
2H, d, J=8 . 8Hz ) ,
7.13(2H,d,J=8.8Hz), 7.20-7.70(4H, m), 8.14(lH,d,J=8.OHz) .
Example 234 3-(4-((1-(tert-butoxycarbonyl)-1H-indol-3-
3o yl)methoxy)phenyl)propanoic acid
The title compound was obtained as pale-brown crystals in
the same manner as in Reference Example 4 from methyl 3-(4-
((1-(tert-butoxycarbonyl)-1H-indol-3-
yl)methoxy)phenyl)propanoate. yield 11$.
337
DEMANDE OU BREVET VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVET COMPREND
PLUS D'UN TOME.
CECI EST LE TOME 1 DE 2
CONTENANT LES PAGES 1 A 337
NOTE : Pour les tomes additionels, veuillez contacter le Bureau canadien des
brevets
JUMBO APPLICATIONS/PATENTS
THIS SECTION OF THE APPLICATION/PATENT CONTAINS MORE THAN ONE
VOLUME
THIS IS VOLUME 1 OF 2
CONTAINING PAGES 1 TO 337
NOTE: For additional volumes, please contact the Canadian Patent Office
NOM DU FICHIER / FILE NAME
NOTE POUR LE TOME / VOLUME NOTE:
