Note: Descriptions are shown in the official language in which they were submitted.
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
CCT6s AS MODIFIERS OF THE RB PATHWAY AND METHODS OF USE
REFERENCE TO RELATED APPLICATIONS
This application claims priority to U.S. provisional patent application
60/428,872
filed 11/25/2002. The contents of the prior application are hereby
incorporated in their
entirety.
BACKGROUND OF THE INVENTION
Retinoblastoma, a pediatric eye tumor, has served as an important model for
the
heritable predisposition to cancer. The primary mechanism in the development
of
retinoblastoma is loss or inactivation of both alleles of this gene (Murphree,
A. L. and
Benedict, W. F. (1984) Science 223: 1028-1033). The high incidence of second
primary
tumors among patients who inherit one retinoblastoma gene suggests that this
cancer gene
plays a key role in the etiology of several other primary malignancies.
The retinoblastoma protein, RB, functions as a tumor suppressor by controlling
progression through the cell cycle which is achieved by sequestering a variety
of nuclear
proteins involved in cellular growth. Thus, it acts as a signal transducer
connecting the
cell cycle clock with the transcriptional machinery (Weinberg, R. A. (1995)
Cell 81: 323-
330). RB regulates cell proliferation by restricting cell cycle progression at
a specific
point in G1, by interaction with the E2F family of transcription factors to
arrest cells in G1
(Goodrich, D. W. et al. (1991) Cell 67: 293-302; Zhang, H. S. et al. (1999)
Cell 97: 53-
61).
RB function is regulated primarily by its phoaphorylatiori state, which is
determined by the complex interaction of multiple kinases and their inhibitors
that
together form the'Rb pathway' (DeCaprio, J. A. et aI (1989) Cell 58: 1085-
1095;
Buchkovich, K. et al (1989) Cell 58: 1097-1105; Chen, P.-L. et al. (1989) Cell
58: 1193-
1198). This pathway has been found to be functionally inactivated in almost
all types of
cancer.
RB sequence is conserved in evolution, and exists in mouse (Bernards R et al
(1989) Proc. Natl. Acad. Sci. U.S.A. 86:6474-6478), rat (Roy NK et al. (1993)
Nucleic
Acids Res. 21:170-170), Drosophila (Du W et aI (1996) Genes Dev 10:1206-18),
and C.
elegarzs (The C. elegans Sequencing Consortium (1998) Science 282:2012-2018).
CCT6A (Chaperonin containing T-complex 1 subunit 6A (zeta)) is a subunit of
the
TCP1 cytosolic hexadecamer structure involved in ATP-dependent folding of
actin,
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
tubulin and other proteins (Li WZ et al (1994) J Biol Chem 269:18616-22). CCT
plays
important roles in the recovery of cells from protein damage by assisting in
the folding of
proteins that are actively synthesized and/or renatured during this period
(Yokota SI et al
(2000) Eur J Biochem 267:1658-64). Decreased activity of CCT6A may result in
misfolded tubulin aggregates in Alzheimers disease (Schuller E et al (2001)
Life Sci
69:263-70). CCT6B is a testis-specific subunit of TCP1 and may function in the
folding
of testiscular proteins (Ozaki K et al (1996) Genomics 36:316-319).
The ability to manipulate the genomes of model organisms such as Drosophila
provides a powerful means to analyze biochemical processes that, due to
significant
evolutionary conservation, have direct relevance to more complex vertebrate
organisms.
Due to a high level of gene and pathway conservation, the strong similarity of
cellular
processes, and the functional conservation of genes between these model
organisms and
mammals, identification of the involvement of novel genes in particular
pathways and
their functions in such model organisms can directly contribute to the
understanding of the
correlative pathways and methods of modulating them in mammals (see, for
example,
Mechler BM et al., 1985 EMBO J 4:1551-1557; Gateff E. 1982 Adv. Cancer Res.
37: 33-
74; Watson KL., et al., 1994 J Cell Sci. 18: 19-33; Miklos GL, and Rubin GM.
1996 Cell
86:521-529; Wassarman DA, et al., 1995 Curr Opin Gen Dev 5: 44-50; and Booth
DR.
1999 Cancer Metastasis Rev. 18: 261-284). For example, a genetic screen can be
carried
out in an invertebrate model organism or cell having underexpression (e.g.
knockout) or
overexpression of a gene (referred to as a "genetic entry point") that yields
a visible
phenotype, such as altered cell growth. Additional genes are mutated in a
random or
targeted manner. When a gene mutation changes the original phenotype caused-by
the
mutation in the genetic entry point, the gene is identified as a "modifier"
involved in the
same or overlapping pathway as the genetic entry point. When inactivation of
either gene
is not lethal, but inactivation of both genes results in reduced viability or
death of the cell,
tissue, or organism, the interaction is defined as "synthetic lethal" (Bender,
A and Pringle
J, (1991) Mol Cell Biol, 11:1295-1305; Hartman J et al, (2001) Science
291:1001-1004;
US PAT No:6,489,127). In a synthetic lethal interaction, the modifier may also
be
identified as an "interactor". When the genetic entry point is an ortholog of
a human gene
implicated in a disease pathway, such as RB, modifier genes can be identified
that may be
attractive candidate targets for novel therapeutics.
2
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
All references cited herein, including patents, patent applications,
publications, and
sequence information in referenced Genbanlc identifier numbers, are
incorporated herein in
their entireties.
SUMMARY OF THE INVENTION
We have discovered genes that modify the RB pathway in Drosophila cells, and
identified their human orthologs, hereinafter referred to as Chaperonin
containing T-
complex 1 subunit 6 (CCT6). The invention provides methods for utilizing these
RB
modifier genes and polypeptides to identify CCT6-modulating agents that are
candidate
therapeutic agents that can be used in the treatment of disorders associated
with defective
or impaired RB function and/or CCT6 function. Preferred CCT6-modulating agents
specifically bind to CCT6 polypeptides and restore RB function. Other
preferred CCT6-
modulating agents are nucleic acid modulators such as antisense oligomers and
RNAi that
repress CCT6 gene expression or product activity by, for example, binding to
and
inhibiting the respective nucleic acid (i.e. DNA or mRNA).
CCT6 modulating agents may be evaluated by any convenient in vitro or in vivo
assay for molecular interaction with a CCT6 polypeptide or nucleic acid. In
one
embodiment, candidate CCT6 modulating agents are tested with an assay system
comprising a CCT6 polypeptide or nucleic acid. Agents that produce a change in
the
activity of the assay system relative to controls are identified as candidate
RB modulating
agents. The assay system may be cell-based or cell-free. CCT6-modulating
agents
include CCT6 related proteins (e.g. dominant negative mutants, and
biotherapeutics);
CCT6 -specific antibodies; CCT6 -specific antiserise oligoiners and other
nucleic acid
modulators; and chemical agents that specifically bind to or interact with
CCT6 or
compete with CCT6 binding partner (e.g. by binding to a CCT6 binding partner).
In one
specific embodiment, a small molecule modulator is identified using a binding
assay. In
specific embodiments, the screening assay system is selected from an apoptosis
assay, a
cell proliferation assay, an angiogenesis assay, and a hypoxic induction
assay.
In another embodiment, candidate RB pathway modulating agents are further
tested using a second assay system that detects changes in the RB pathway,
such as
angiogenic, apoptotic, or cell proliferation changes produced by the
originally identified
candidate agent or an agent derived from the original agent. The second assay
system may
use cultured cells or non-human animals. In specific embodiments, the
secondary assay
system uses non-human animals, including animals predetermined to have a
disease or
3
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
disorder implicating the RB pathway, such as an angiogenic, apoptotic, or cell
proliferation disorder (e.g. cancer).
The invention further provides methods for modulating the CCT6 function and/or
the RB pathway in a mammalian cell by contacting the mammalian cell with an
agent that
specifically binds a CCT6 polypeptide or nucleic acid. The agent may be a
small
molecule modulator, a nucleic acid modulator, or an antibody and may be
administered to
a mammalian animal predetermined to have a pathology associated the RB
pathway.
DETAILED DESCRIPTION OF THE INVENTION
The Rb co-RNAi synthetic lethal screen was designed to identify modifier genes
that are synthetic lethal with the Drosophila Rbf gene (Du W et al (1996)
supra), a
Drosophila homolog of the human retinoblastoma (RB) gene. In addition to
identifying
modifier genes with synthetic lethal interactions with Rbf, this screen
identified modifier
genes that, when inactivated, preferentially reduced the viability of Rbf-
deficient cells
relative to normal cells. The CG8231 gene was identified as a modifier of the
Rbf
pathway. Accordingly, vertebrate orthologs of these modifiers, and preferably
the human
orthologs, CCT6 genes (i.e., nucleic acids and polypeptides) are attractive
drug targets for
the treatment of pathologies associated with a defective RB signaling pathway,
such as
cancer.
In vitro and in vivo methods of assessing CCT6 function are provided herein.
Modulation of the CCT6 or their respective binding partners is useful for
understanding
the association of the RB pathway and its members in normal and disease
conditions and
for developing diagnostics and therapeutic modalities for RB related-
pathologies. CCT6-
modulating agents that act by inhibiting or enhancing CCT6 expression,
directly or
indirectly, for example, by affecting a CCT6 function such as binding
activity, can be
identified using methods provided herein. CCT6 modulating agents are useful in
diagnosis, therapy and pharmaceutical development.
Nucleic acids and polvneptides of the invention
Sequences related to CCT6 nucleic acids and polypeptides that can be used in
the
invention are disclosed in Genbank (referenced by Genbank identifier (GI)
number) as
GI#s 22095341 (SEQ ID NO:1), 14348899 (SEQ m N0:2), 14517631 (SEQ ll~ N0:3),
5729760 (SEQ ID N0:4), 14771917 (SEQ ll~ N0:5), 1655415 (SEQ ID N0:6), and
4
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
34783247 (SEQ ID N0:7) for nucleic acid, and GI#s 4502643 (SEQ ID N0:8) and
5729761 (SEQ ID N0:9) for polypeptides.
The term "CCT6 polypeptide" refers to a full-length CCT6 protein or a
functionally active fragment or derivative thereof. A "functionally active"
CCT6 fragment
or derivative exhibits one or more functional activities associated with a
full-length, wild-
type CCT6 protein, such as antigenic or immunogenic activity, ability to bind
natural
cellular substrates, etc. The functional activity of CCT6 proteins,
derivatives and
fragments can be assayed by various methods known to one skilled in the art
(Current
Protocols in Protein Science (1998) Coligan et al., eds., John Wiley & Sons,
Inc.,
Somerset, New Jersey) and as further discussed below. In one embodiment, a
functionally
active CCT6 polypeptide is a CCT6 derivative capable of rescuing defective
endogenous
CCT6 activity, such as in cell based or animal assays; the rescuing derivative
may be from
the same or a different species. For purposes herein, functionally active
fragments also
include those fragments that comprise one or more structural domains of a
CCT6, such as
a binding domain. Protein domains can be identified using the PFAM program
(Bateman
A., et al., Nucleic Acids Res, 1999, 27:260-2). For example, the TCP-1/cpn60
chaperonin
family domain (PFAM 00118) of CCT6 from GI#s 4502643 and 5729761 (SEQ ID NOs:8
and 9, respectively) are located at approximately amino acid residues 30 to
526 and 29-
525, respectively. Methods for obtaining CCT6 polypeptides are also further
described
below. In some embodiments, preferred fragments are functionally active,
domain-
containing fragments comprising at least 25 contiguous amino acids, preferably
at least 50,
more preferably 75, and most preferably at least 100 contiguous amino acids of
a CCT6.
In further preferred embodiments, the fragment comprises the entire
functionally active
domain.
The term "CCT6 nucleic acid" refers to a DNA or RNA molecule that encodes a
CCT6 polypeptide. Preferably, the CCT6 polypeptide or nucleic acid or fragment
thereof
is from a human, but can also be an ortholog, or derivative thereof with at
least 70%
sequence identity, preferably at least 80%, more preferably 85%, still more
preferably
90%, and most preferably at least 95% sequence identity with human CCT6.
Methods of
identifying orthlogs are known in the art. Normally, orthologs in different
species retain
the same function, due to presence of one or more protein motifs and/or 3-
dimensional
structures. Orthologs are generally identified by sequence homology analysis,
such as
BLAST analysis, usually using protein bait sequences. Sequences are assigned
as a
potential ortholog if the best hit sequence from the forward BLAST result
retrieves the
5
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
original query sequence in the reverse BLAST (Huynen MA and Bork P, Proc Natl
Acad
Sci (1990 95:549-556; Huynen MA et al., Genome Research (2000) 10:1204-1210).
Programs for multiple sequence alignment, such as CLUSTAL (Thompson JD et al,
1994,
Nucleic Acids Res 22:4673-460) may be used to highlight conserved regions
and/or
residues of orthologous proteins and to generate phylogenetic trees. In a
phylogenetic tree
representing multiple homologous sequences from diverse species (e.g.,
retrieved through
BLAST analysis), orthologous sequences from two species generally appear
closest on the
tree with respect to all other sequences from these two species. Structural
threading or
other analysis of protein folding (e.g., using software by ProCeryon,
Biosciences,
Salzburg, Austria) may also identify potential orthologs. In evolution, when a
gene
duplication event follows speciation, a single gene in one species, such as
I~rosophila,
may correspond to multiple genes (paralogs) in another, such as human. As used
herein,
the term "orthologs" encompasses paralogs. As used herein, "percent (%)
sequence
identity" with respect to a subject sequence, or a specified portion of a
subject sequence, is
defined as the percentage of nucleotides or amino acids in the candidate
derivative
sequence identical with the nucleotides or amino acids in the subject sequence
(or
specified portion thereof), after aligning the sequences and introducing gaps,
if necessary
to achieve the maximum percent sequence identity, as generated by the program
WU-
BLAST-2.Oa19 (Altschul et al., J. Mol. Biol. (1997) 215:403-410) with all the
search
parameters set to default values. The HSP S and HSP S2 parameters are dynamic
values
and are established by the program itself depending upon the composition of
the particular
sequence and composition of the particular database against which the sequence
of interest
is being searched. A % identity value is determined by the number of matching
identical
nucleotides or amino acids divided by the sequence length for which the
percent identity is
being reported. "Percent (%) amino acid sequence similarity" is determined by
doing the
same calculation as for determining % amino acid sequence identity, but
including
conservative amino acid substitutions in addition to identical amino acids in
the
computation.
A conservative amino acid substitution is one in which an amino acid is
substituted
for another amino acid having similar properties such that the folding or
activity of the
protein is not significantly affected. Aromatic amino acids that can be
substituted for each
other are phenylalanine, tryptophan, and tyrosine; interchangeable hydrophobic
amino
acids are leucine, isoleucine, methionine, and valine; interchangeable polar
amino acids
are glutamine and asparagine; interchangeable basic amino acids are arginine,
lysine and
6
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
histidine; interchangeable acidic amino acids are aspartic acid and glutamic
acid; and
interchangeable small amino acids are alanine, serine, threonine, cysteine and
glycine.
Alternatively, an alignment for nucleic acid sequences is provided by the
local
homology algorithm of Smith and Waterman (Smith and Waterman, 1981, Advances
in
Applied Mathematics 2:482-489; database: European Bioinformatics Institute;
Smith and
Waterman, 1981, J. of Molec.Biol., 147:195-197; Nicholas et al., 1998, "A
Tutorial on
Searching Sequence Databases and Sequence Scoring Methods" (www.psc.edu) and
references cited therein.; W.R. Pearson, 1991, Genomics 11:635-650). This
algorithm can
be applied to amino acid sequences by using the scoring matrix developed by
Dayhoff
(Dayhoff: Atlas of Protein Sequences and Structure, M. O. Dayhoff ed., 5
suppl. 3:353-
358, National Biomedical Research Foundation, Washington, D.C., USA), and
normalized
by Gribskov (Gribskov 1986 Nucl. Acids Res. 14(6):6745-6763). The Smith-
Waterman
algorithm may be employed where default parameters are used for scoring (for
example,
gap open penalty of 12, gap extension penalty of two). From the data
generated, the
"Match" value reflects "sequence identity."
Derivative nucleic acid molecules of the subject nucleic acid molecules
include
sequences that hybridize to the nucleic acid sequence of a CCT6. The
stringency of
hybridization can be controlled by temperature, ionic strength, pH, and the
presence of
denaturing agents such as formamide during hybridization and washing.
Conditions
routinely used are set out in readily available procedure texts (e.g., Current
Protocol in
Molecular Biology, Vol. 1, Chap. 2.10, John Wiley & Sons, Publishers (1994);
Sambrook
et al., Molecular Cloning, Cold Spring Harbor (1989)). In some embodiments, a
nucleic
acid molecule of the invention is capable of hybridizing to a nucleic acid
molecule
containing the nucleotide sequence of a CCT6 under high stringency
hybridization
conditions that are: prehybridization of filters containing nucleic acid for 8
hours to
overnight at 65° C in a solution comprising 6X single strength citrate
(SSC) (1X SSC is
0.15 M NaCI, 0.015 M Na citrate; pH 7.0), 5X Denhardt's solution, 0.05% sodium
pyrophosphate and 100 ,ug/ml herring sperm DNA; hybridization for 18-20 hours
at 65° C
in a solution containing 6X SSC, 1X Denhardt's solution, 100 ~Cglml yeast tRNA
and
0.05% sodium pyrophosphate; and washing of filters at 65° C for lh in a
solution
containing O.1X SSC and 0.1% SDS (sodium dodecyl sulfate).
In other embodiments, moderately stringent hybridization conditions are used
that
are: pretreatment of filters containing nucleic acid for 6 h at 40° C
in a solution containing
35% formamide, 5X SSC, 50 mM Tris-HCl (pH7.5), 5mM EDTA, 0.1% PVP, 0.1%
7
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
Ficoll, 1% BSA, and 500 ~ug/ml denatured salmon sperm DNA; hybridization for
18-20h
at 40° C in a solution containing 35% formamide, 5X SSC, 50 mM Tris-HCl
(pH7.5),
5mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.2% BSA, 100 ~,g/ml salmon sperm DNA, and
10% (wt/vol) dextran sulfate; followed by washing twice for 1 hour at
55° C in a solution
containing 2X SSC and 0.1% SDS.
Alternatively, low stringency conditions can be used that are: incubation for
8
hours to overnight at 37° C in a solution comprising 20% formamide, 5 x
SSC, 50 mM
sodium phosphate (pH 7.6), 5X Denhardt's solution, 10% dextran sulfate, and 20
~,glml
denatured sheared salmon sperm DNA; hybridization in the same buffer for 18 to
20
hours; and washing of filters in 1 x SSC at about 37° C for 1 hour.
Isolation, Production, Expression, and Mis-expression of CCT6 Nucleic Acids
and
Polyneutides
CCT6 nucleic acids and polypeptides are useful for identifying and testing
agents
that modulate CCT6 function and for other applications related to the
involvement of
CCT6 in the RB pathway. CCT6 nucleic acids and derivatives and orthologs
thereof may
be obtained using any available method. For instance, techniques for isolating
cDNA or
genomic DNA sequences of interest by screening DNA libraries or by using
polymerase
chain reaction (PCR) are well known in the art. In general, the particular use
for the
protein will dictate the particulars of expression, production, and
purification methods.
For instance, production of proteins for use in screening for modulating
agents may
require methods that preserve specific biological activities of these
proteins, whereas
production of proteins for antibody generation may require-structural
integrity of particular
epitopes. Expression of proteins to be purified for screening or antibody
production may
require the addition of specific tags (e.g., generation of fusion proteins).
Overexpression
of a CCT6 protein for assays used to assess CCT6 function, such as involvement
in cell
cycle regulation or hypoxic response, may require expression in eukaryotic
cell lines
capable of these cellular activities. Techniques for the expression,
production, and
purification of proteins are well known in the art; any suitable means
therefore may be
used (e.g., Higgins SJ and Hames BD (eds.) Protein Expression: A Practical
Approach,
Oxford University Press Inc., New York 1999; Stanbury PF et al., Principles of
Fermentation Technology, 2nd edition, Elsevier Science, New York, 1995; Doonan
S (ed.)
Protein Purification Protocols, Humana Press, New Jersey, 1996; Coligan JE et
al, Current
Protocols in Protein Science (eds.), 1999, John Wiley & Sons, New York). In
particular
8
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
embodiments, recombinant CCT6 is expressed in a cell line known to have
defective RB
function (e.g. SAOS-2 osteoblasts, BT549 breast cancer cells, and C33A
cervical cancer
cells, among others, available from American Type Culture Collection (ATCC),
Manassas, VA). The recombinant cells are used in cell-based screening assay
systems of
the invention, as described further below.
The nucleotide sequence encoding a CCT6 polypeptide can be inserted into any
appropriate expression vector. The necessary transcriptional and translational
signals,
including promoter/enhancer element, can derive from the native CCT6 gene
and/or its
flanking regions or can be heterologous. A variety of host-vector expression
systems may
be utilized, such as mammalian cell systems infected with virus (e.g. vaccinia
virus,
adenovirus, etc.); insect cell systems infected with virus (e.g. baculovirus);
microorganisms such as yeast containing yeast vectors, or bacteria transformed
with
bacteriophage, plasmid, or cosmid DNA. An isolated host cell strain that
modulates the
expression of, modifies, and/or specifically processes the gene product may be
used.
To detect expression of the CCT6 gene product, the expression vector can
comprise a promoter operably linked to a CCT6 gene nucleic acid, one or more
origins of
replication, and, one or more selectable markers (e.g. thymidine kinase
activity, resistance
to antibiotics, etc.). Alternatively, recombinant expression vectors can be
identified by
assaying for the expression of the CCT6 gene product based on the physical or
functional
properties of the CCT6 protein in in vitro assay systems (e.g. immunoassays).
The CCT6 protein, fragment, or derivative may be optionally expressed as a
fusion, or chimeric protein product (i.e. it is joined via a peptide bond to a
heterologous
protein sequence of a different protein), for eXample to facilitate
purification or detection.
A chimeric product can be made by ligating the appropriate nucleic acid
sequences
encoding the desired amino acid sequences to each other using standard methods
and
expressing the chimeric product. A chimeric product may also be made by
protein
synthetic techniques, e.g. by use of a peptide synthesizer (Hunkapiller et
al., Nature (1984)
310:105-111).
Once a recombinant cell that expresses the CCT6 gene sequence is identified,
the
gene product can be isolated and purified using standard methods (e.g. ion
exchange,
affinity, and gel exclusion chromatography; centrifugation; differential
solubility;
electrophoresis). Alternatively, native CCT6 proteins can be purified from
natural
sources, by standard methods (e.g. immunoaffinity purification). Once a
protein is
obtained, it may be quantified and its activity measured by appropriate
methods, such as
9
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
immunoassay, bioassay, or other measurements of physical properties, such as
crystallography.
The methods of this invention may also use cells that have been engineered for
altered expression (mis-expression) of CCT6 or other genes associated with the
RB
pathway. As used herein, mis-expression encompasses ectopic expression, over-
expression, under-expression, and non-expression (e.g. by gene knock-out or
blocking
expression that would otherwise normally occur).
Genetically modified animals
Animal models that have been genetically modified to alter CCT6 expression may
be used in in vivo assays to test for activity of a candidate RB modulating
agent, or to
further assess the role of CCT6 in a RB pathway process such as apoptosis or
cell
proliferation. Preferably, the altered CCT6 expression results in a detectable
phenotype,
such as decreased or increased levels of cell proliferation, angiogenesis, or
apoptosis
compared to control animals having normal CCT6 expression. The genetically
modified
animal may additionally have altered RB expression (e.g. RB knockout).
Preferred
genetically modified animals are mammals such as primates, rodents (preferably
mice or
rats), among others. Preferred non-mammalian species include zebrafish, C.
elegans, and
Drosoplzila. Preferred genetically modified animals are transgenic animals
having a
heterologous nucleic acid sequence present as an extrachromosomal element in a
portion
of its cells, i.e. mosaic animals (see, for example, techniques described by
Jakobovits,
1994, Curr. Biol. 4:761-763.) or stably integrated into its germ line DNA
(i.e., in the
genomic sequence of most or all of its cells). Heter~logous nucleic acid is
introduced into
the germ line of such transgenic animals by genetic manipulation of, for
example, embryos
or embryonic stem cells of the host animal.
Methods of making transgenic animals are well-known in the art (for transgenic
mice see Brinster et al., Proc. Nat. Acad. Sci. USA 82: 4438-4442 (1985), U.S.
Pat. Nos.
4,736,866 and 4,870,009, both by Leder et al., U.S. Pat. No. 4,873,191 by
Wagner et al.,
and Hogan, B., Manipulating the Mouse Embryo, Cold Spring Harbor Laboratory
Press,
Cold Spring Harbor, N.Y., (1986); for particle bombardment see U.S. Pat. No.,
4,945,050,
by Sandford et al.; for transgenic Drosophila see Rubin and Spradling, Science
(1982)
218:348-53 and U.S. Pat. No. 4,670,388; for transgenic insects see Berghammer
A.J. et
al., A Universal Marker for Transgenic Insects (1999) Nature 402:370-371; for
transgenic
Zebrafish see Lin S., Transgenic Zebrafish, Methods Mol Biol. (2000);136:375-
3830); for
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
microinjection procedures for fish, amphibian eggs and birds see Houdebine and
Chourrout, Experientia (1991) 47:897-905; for transgenic rats see Hammer et
al., Cell
(1990) 63:1099-1112; and for culturing of embryonic stem (ES) cells and the
subsequent
production of transgenic animals by the introduction of DNA into ES cells
using methods
such as electroporation, calcium phosphate/DNA precipitation and direct
injection see,
e.g., Teratocarcinomas and Embryonic Stem Cells, A Practical Approach, E. J.
Robertson,
ed., IRL Press (1987)). Clones of the nonhuman transgenic animals can be
produced
according to available methods (see Wilmut, I. et al. (1997) Nature 385:810-
813; and PCT
International Publication Nos. WO 97/07668 and WO 97/07669).
In one embodiment, the transgenic animal is a "knock-out" animal having a
heterozygous or homozygous alteration in the sequence of an endogenous CCT6
gene that
results in a decrease of CCT6 function, preferably such that CCT6 expression
is
undetectable or insignificant. Knock-out animals are typically generated by
homologous
recombination with a vector comprising a transgene having at least a portion
of the gene to
be knocked out. Typically a deletion, addition or substitution has been
introduced into the
transgene to functionally disrupt it. The transgene can be a human gene (e.g.,
from a
human genomic clone) but more preferably is an ortholog of the human gene
derived from
the transgenic host species. For example, a mouse CCT6 gene is used to
construct a
homologous recombination vector suitable for altering an endogenous CCT6 gene
in the
mouse genome. Detailed methodologies for homologous recombination in mice are
available (see Capecchi, Science (1989) 244:1288-1292; Joyner et al., Nature
(1989)
338:153-156). Procedures for the production of non-rodent transgenic mammals
and other
animals are also available (Houdebine and Chourrbut, supra; Purseret al.,
Science (1989)
244:1281-1288; Simms et al., Bio/Technology (1988) 6:179-183). In a preferred
embodiment, knock-out animals, such as mice harboring a knockout of a specific
gene,
may be used to produce antibodies against the human counterpart of the gene
that has been
knocked out (Claesson MH et al., (1994) Scan J Immunol 40:257-264; Declerck PJ
et
al., (1995) J Biol Chem. 270:8397-400).
In another embodiment, the transgenic animal is a "knock-in" animal having an
alteration in its genome that results in altered expression (e.g., increased
(including
ectopic) or decreased expression) of the CCT6 gene, e.g., by introduction of
additional
copies of CCT6, or by operatively inserting a regulatory sequence that
provides for altered
expression of an endogenous copy of the CCT6 gene. Such regulatory sequences
include
11
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
inducible, tissue-specific, and constitutive promoters and enhancer elements.
The knock-
in can be homozygous or heterozygous.
Transgenic nonhuman animals can also be produced that contain selected systems
allowing for regulated expression of the transgene. One example of such a
system that
may be produced is the cre/loxP recombinase system of bacteriophage P1 (Lakso
et al.,
PNAS (1992) 89:6232-6236; U.S. Pat. No. 4,959,317). If a cre/loxP recombinase
system
is used to regulate expression of the transgene, animals containing transgenes
encoding
both the Cre recombinase and a selected protein are required. Such animals can
be
provided through the construction of "double" transgenic animals, e.g., by
mating two
transgenic animals, one containing a transgene encoding a selected protein and
the other
containing a transgene encoding a recombinase. Another example of a
recombinase
system is the FLP recombinase system of Saccharomyces cerevisiae (O'Gorman et
al.
(1991) Science 251:1351-1355; U.S. Pat. No. 5,654,182). In a preferred
embodiment,
both Cre-LoxP and Flp-Frt are used in the same system to regulate expression
of the
transgene, and for sequential deletion of vector sequences in the same cell
(Sun X et al
(2000) Nat Genet 25:83-6).
The genetically modified animals can be used in genetic studies to further
elucidate
the RB pathway, as animal models of disease and disorders implicating
defective RB
function, and for in vivo testing of candidate therapeutic agents, such as
those identified in
screens described below. The candidate therapeutic agents are administered to
a
genetically modified animal having altered CCT6 function and phenotypic
changes are
compared with appropriate control animals such as genetically modified animals
that
receive placebo treatment, and/or animals with unaltered CCT6 expression that
receive
candidate therapeutic agent.
In addition to the above-described genetically modified animals having altered
CCT6 function, animal models having defective RB function (and otherwise
normal CCT6
function), can be used in the methods of the present invention. For example, a
mouse with
defective RB function can be used to assess, in vivo, the activity of a
candidate RB
modulating agent identified in one of the in vitro assays described below.
Transgenic
mice with defective RB function have been described in literature (Robanus-
Maandag E et
al. (1998) Genes Dev 12:1599-609; Windle, J. J. et al (1990) Nature 343: 665-
669).
Preferably, the candidate RB modulating agent when administered to a model
system with
cells defective in RB function, produces a detectable phenotypic change in the
model
12
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
system indicating that the RB function is restored, i.e., the cells exhibit
normal cell cycle
progression.
Modulating Agents
The invention provides methods to identify agents that interact with and/or
modulate the function of CCT6 andlor the RB pathway. Modulating agents
identified by
the methods are also part of the invention. Such agents are useful in a
variety of
diagnostic and therapeutic applications associated with the RB pathway, as
well as in
further analysis of the CCT6 protein and its contribution to the RB pathway.
Accordingly,
the invention also provides methods for modulating the RB pathway comprising
the step
of specifically modulating CCT6, activity by administering a CCT6-interacting
or
modulating agent.
As used herein, a "CCT6-modulating agent" is any agent that modulates CCT6
function, for example, an agent that interacts with CCT6 to inhibit or enhance
CCT6
activity or otherwise affect normal CCT6 function. CCT6 function can be
affected at any
level, including transcription, protein expression, protein localization, and
cellular or
extra-cellular activity. In a preferred embodiment, the CCT6 - modulating
agent
specifically modulates the function of the CCT6. The phrases "specific
modulating
agent", "specifically modulates", etc., are used herein to refer to modulating
agents that
directly bind to the CCT6 polypeptide or nucleic acid, and preferably inhibit,
enhance, or
otherwise alter, the function of the CCT6. These phrases also encompass
modulating
agents that alter the interaction of the CCT6 with a binding partner,
substrate, or cofactor
(e.g. by binding to a binding partner of a CCT6; or to a proteiri/binding
partner complex,
and altering CCT6 function). In a further preferred embodiment, the CCT6-
modulating
agent is a modulator of the RB pathway (e.g. it restores and/or upregulates RB
function)
and thus is also a RB-modulating agent.
Preferred CCT6-modulating agents include small molecule compounds; CCT6-
interacting proteins, including antibodies and other biotherapeutics; and
nucleic acid
modulators such as antisense and RNA inhibitors. The modulating agents may be
formulated in pharmaceutical compositions, for example, as compositions that
may
comprise other active ingredients, as in combination therapy, and/or suitable
carriers or
excipients. Techniques for formulation and administration of the compounds may
be
found in "Remington's Pharmaceutical Sciences" Mack Publishing Co., Easton,
PA, 19th
edition.
13
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
Small molecule modulators
Small molecules are often preferred to modulate function of proteins with
enzymatic function, and/or containing protein interaction domains. Chemical
agents,
referred to in the art as "small molecule" compounds are typically organic,
non-peptide
molecules, having a molecular weight up to 10,000, preferably up to 5,000,
more
preferably up to 1,000, and most preferably up to 500 daltons. This class of
modulators
includes chemically synthesized molecules, for instance, compounds from
combinatorial
chemical libraries. Synthetic compounds may be rationally designed or
identified based
on known or inferred properties of the CCT6 protein or may be identified by
screening
compound libraries. Alternative appropriate modulators of this class are
natural products,
particularly secondary metabolites from organisms such as plants or fungi,
which can also
be identified by screening compound libraries for CCT6-modulating activity.
Methods
for generating and obtaining compounds are well known in the art (Schreiber
SL, Science
(2000) 151: 1964-1969; Radmann J and Gunther J, Science (2000) 151:1947-1948).
Small molecule modulators identified from screening assays, as described
below,
can be used as lead compounds from which candidate clinical compounds may be
designed, optimized, and synthesized. Such clinical compounds may have utility
in
treating pathologies associated with the RB pathway. The activity of candidate
small
molecule modulating agents may be improved several-fold through iterative
secondary
functional validation, as further described below, structure determination,
and candidate
modulator modification and testing. Additionally, candidate clinical compounds
are
generated with specific regard to clinical and pharmacological properties. For
example, the
reagents may be derivatized and re-screened using ifi vitro and in vivo assays
to optimize
activity and minimize toxicity for pharmaceutical development.
Protein Modulators
Specific CCT6-interacting proteins are useful in a variety of diagnostic and
therapeutic applications related to the RB pathway and related disorders, as
well as in
validation assays for other CCT6-modulating agents. In a preferred embodiment,
CCT6-
interacting proteins affect normal CCT6 function, including transcription,
protein
expression, protein localization, and cellular or extra-cellular activity. In
another
embodiment, CCT6-interacting proteins are useful in detecting and providing
information
about the function of CCT6 proteins, as is relevant to RB related disorders,
such as cancer
(e.g., for diagnostic means).
14
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
A CCT6-interacting protein may be endogenous, i.e. one that naturally
interacts
genetically or biochemically with a CCT6, such as a member of the CCT6 pathway
that
modulates CCT6 expression, localization, and/or activity. CCT6-modulators
include
dominant negative forms of CCT6-interacting proteins and of CCT6 proteins
themselves.
Yeast two-hybrid and variant screens offer preferred methods for identifying
endogenous
CCT6-interacting proteins (Finley, R. L. et al. (1996) in DNA Cloning-
Expression
Systems: A Practical Approach, eds. Glover D. & Hames B. D (Oxford University
Press,
Oxford, England), pp. 169-203; Fashema SF et al., Gene (2000) 250:1-14; Drees
BL Curr
Opin Chem Biol (1999) 3:64-70; Vidal M and Legrain P Nucleic Acids Res (1999)
27:919-29; and U.S. Pat. No. 5,928,868). Mass spectrometry is an alternative
preferred
method for the elucidation of protein complexes (reviewed in, e.g., Pandley A
and Mann
M, Nature (2000) 405:837-846; Yates JR 3rd, Trends Genet (2000) 16:5-8).
An CCT6-interacting protein may be an exogenous protein, such as a CCT6-
specific antibody or a T-cell antigen receptor (see, e.g., Harlow and Lane
(1988)
Antibodies, A Laboratory Manual, Cold Spring Harbor Laboratory; Harlow and
Lane
(1999) Using antibodies: a laboratory manual. Cold Spring Harbor, NY: Cold
Spring
Harbor Laboratory Press). CCT6 antibodies are further discussed below.
In preferred embodiments, a CCT6-interacting protein specifically binds a CCT6
protein. In alternative preferred embodiments, a CCT6-modulating agent binds a
CCT6
substrate, binding partner, or cofactor.
Antibodies
In another embodiment, the protein modulator is a CCT6 specific antibody
agonist
or antagonist. The antibodies have therapeutic and diagnostic utilities, and
can be used in
screening assays to identify CCT6 modulators. The antibodies can also be used
in
dissecting the portions of the CCT6 pathway responsible for various cellular
responses and
in the general processing and maturation of the CCT6.
Antibodies that specifically bind CCT6 polypeptides can be generated using
known methods. Preferably the antibody is specific to a mammalian ortholog of
CCT6
polypeptide, and more preferably, to human CCT6. Antibodies may be polyclonal,
monoclonal (mAbs), humanized or chimeric antibodies, single chain antibodies,
Fab
fragments, F(ab')2 fragments, fragments produced by a FAb expression
library, anti-
idiotypic (anti-Id) antibodies, and epitope-binding fragments of any of the
above.
Epitopes of CCT6 which are particularly antigenic can be selected, for
example, by routine
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
screening of CCT6 polypeptides for antigenicity or by applying a theoretical
method for
selecting antigenic regions of a protein (Hopp and Wood (1981), Proc. Nati.
Acad. Sci.
U.S.A. 78:3824-28; Hopp and Wood, (1983) Mol. Immunol. 20:483-89; Sutcliffe et
al.,
(1983) Science 219:660-66) to the amino acid sequence of a CCT6. Monoclonal
antibodies with affinities of 108 M-1 preferably 109 M-1 to 101° M-1,
or stronger can be
made by standard procedures as described (Harlow and Lane, supra; Goding
(1986)
Monoclonal Antibodies: Principles and Practice (2d ed) Academic Press, New
York; and
U.S. Pat. Nos. 4,381,292; 4,451,570; and 4,618,577). Antibodies may be
generated
against crude cell extracts of CCT6 or substantially purified fragments
thereof. If CCT6
fragments are used, they preferably comprise at least 10, and more preferably,
at least 20
contiguous amino acids of a CCT6 protein. In a particular embodiment, CCT6-
specific
antigens and/or immunogens are coupled to carrier proteins that stimulate the
immune
response. For example, the subject polypeptides are covalently coupled to the
keyhole
limpet hemocyanin KT.Hl( 1 carrier, and the conjugate is emulsified in
Freund's complete
adjuvant, which enhances the immune response. An appropriate immune system
such as a
laboratory rabbit or mouse is immunized according to conventional protocols.
The presence of CCT6-specific antibodies is assayed by an appropriate assay
such
as a solid phase enzyme-linked immunosorbant assay (ELISA) using immobilized
corresponding CCT6 polypeptides. Other assays, such as radioimmunoassays or
fluorescent assays might also be used.
Chimeric antibodies specific to CCT6 polypeptides can be made that contain
different portions from different animal species. For instance, a human
immunoglobulin
constant region may be linked to a variable region of a murine mAb, such that
the
antibody derives its biological activity from the human antibody, and its
binding
specificity from the murine fragment. Chimeric antibodies are produced by
splicing
together genes that encode the appropriate regions from each species (Morrison
et al.,
Proc. Natl. Acad. Sci. (1984) 81:6851-6855; Neuberger et al., Nature (1984)
312:604-608;
Takeda et al., Nature (1985) 31:452-454). Humanized antibodies, which are a
form of
chimeric antibodies, can be generated by grafting complementary-determining
regions
(CDRs) (Carlos, T. M., J. M. Harlan. 1994. Blood 84:2068-2101) of mouse
antibodies
into a background of human framework regions and constant regions by
recombinant
DNA technology (Riechmann LM, et al., 1988 Nature 323: 323-327). Humanized
antibodies contain ~10% murine sequences and ~90% human sequences, and thus
further
reduce or eliminate immunogenicity, while retaining the antibody specificities
(Co MS,
16
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
and Queen C. 1991 Nature 351: 501-501; Morrison SL. 1992 Ann. Rev. Immun.
10:239-265). Humanized antibodies and methods of their production are well-
known in
the art (U.S. Pat. Nos. 5,530,101, 5,585,089, 5,693,762, and 6,180,370).
CCT6-specific single chain antibodies which are recombinant, single chain
polypeptides formed by linking the heavy and light chain fragments of the Fv
regions via
an amino acid bridge, can be produced by methods known in the art (U.S. Pat.
No.
4,946,778; Bird, Science (1988) 242:423-426; Huston et al., Proc. Natl. Acad.
Sci. USA
(1988) 85:5879-5883; and Ward et al., Nature (1989) 334:544-546).
Other suitable techniques for antibody production involve in vitro exposure of
lymphocytes to the antigenic polypeptides or alternatively to selection of
libraries of
antibodies in phage or similar vectors (Ruse et al., Science (1989) 246:1275-
1281). As
used herein, T-cell antigen receptors are included within the scope of
antibody modulators
(Harlow and Lane, 1988, supra).
The polypeptides and antibodies of the present invention may be used with or
without modification. Frequently, antibodies will be labeled by joining,
either covalently
or non-covalently, a substance that provides for a detectable signal, or that
is toxic to cells
that express the targeted protein (Menard S, et al., Int J. Biol Markers
(1989) 4:131-134).
A wide variety of labels and conjugation techniques are known and are reported
extensively in both the scientific and patent literature. Suitable labels
include
radionuclides, enzymes, substrates, cofactors, inhibitors, fluorescent
moieties, fluorescent
emitting lanthanide metals, chemiluminescent moieties, bioluminescent
moieties,
magnetic particles, and the like (U.S. Pat. Nos. 3,817,837; 3,850,752;
3,939,350;
3,996,345; 4,277,437; 4,275,149; and 4,366,241): Also, recombinant
immunoglobulins
may be produced (U.S. Pat. No. 4,816,567). Antibodies to cytoplasmic
polypeptides may
be delivered and reach their targets by conjugation with membrane-penetrating
toxin
proteins (U.S. Pat. No. 6,086,900).
When used therapeutically in a patient, the antibodies of the subject
invention are
typically administered parenterally, when possible at the target site, or
intravenously. The
therapeutically effective dose and dosage regimen is determined by clinical
studies.
Typically, the amount of antibody administered is in the range of about 0.1
mg/lcg -to
about 10 mg/kg of patient weight. For parenteral administration, the
antibodies are
formulated in a unit dosage injectable form (e.g., solution, suspension,
emulsion) in
association with a pharmaceutically acceptable vehicle. Such vehicles are
inherently
nontoxic and non-therapeutic. Examples are water, saline, Ringer's solution,
dextrose
17
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
solution, and 5% human serum albumin. Nonaqueous vehicles such as fixed oils,
ethyl
oleate, or liposome carriers may also be used. The vehicle may contain minor
amounts of
additives, such as buffers and preservatives, which enhance isotonicity and
chemical
stability or otherwise enhance therapeutic potential. The antibodies'
concentrations in
such vehicles are typically in the range of about 1 mg/ml to aboutl0 mg/ml.
Immunotherapeutic methods are further described in the literature (US Pat. No.
5,859,206;
W00073469).
Nucleic Acid Modulators
Other preferred CCT6-modulating agents comprise nucleic acid molecules, such
as
antisense oligomers or double stranded RNA (dsRNA), which generally inhibit
CCT6
activity. Preferred nucleic acid modulators interfere with the function of the
CCT6 nucleic
acid such as DNA replication, transcription, translocation of the CCT6 RNA to
the site of
protein translation, translation of protein from the CCT6 RNA, splicing of the
CCT6 RNA
to yield one or more mRNA species, or catalytic activity which may be engaged
in or
facilitated by the CCT6 RNA.
In one embodiment, the antisense oligomer is an oligonucleotide that is
sufficiently
complementary to a CCT6 mRNA to bind to and prevent translation, preferably by
binding to the 5' untranslated region. CCT6-specific antisense
oligonucleotides,
preferably range from at least 6 to about 200 nucleotides. In some embodiments
the
oligonucleotide is preferably at least 10, 15, or 20 nucleotides in length. In
other
embodiments, the oligonucleotide is preferably less than 50, 40, or 30
nucleotides in
length. The oligonucleotide can be DNA or RNA or a chimeric mixture or
derivatives or
modified versions thereof, single-stranded or double-stranded. The
oligonucleotide can be
modified at the base moiety, sugar moiety, or phosphate backbone. The
oligonucleotide
may include other appending groups such as peptides, agents that facilitate
transport
across the cell membrane, hybridization-triggered cleavage agents, and
intercalating
agents.
In another embodiment, the antisense oligomer is a phosphothioate morpholino
oligomer (PMO). PMOs are assembled from four different morpholino subunits,
each of
which contain one of four genetic bases (A, C, G, or T) linked to a six-
membered
morpholine ring. Polymers of these subunits are joined by non-ionic
phosphodiamidate
intersubunit linkages. Details of how to make and use PMOs and other antisense
oligomers are well known in the art (e.g. see W099/18193; Probst JC, Antisense
18
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
Oligodeoxynucleotide and Ribozyme Design, Methods. (2000) 22(3):271-281;
Summerton
J, and Welter D. 1997 Antisense Nucleic Acid Drug Dev. :7:187-95; US Pat. No.
5,235,033; and US Pat No. 5,378,841).
Alternative preferred CCT6 nucleic acid modulators are double-stranded RNA
species mediating RNA interference (RNAi). RNAi is the process of sequence-
specific,
post-transcriptional gene silencing in animals and plants, initiated by double-
stranded
RNA (dsRNA) that is homologous in sequence to the silenced gene. Methods
relating to
the use of RNAi to silence genes in C. elegans, Drosoplzila, plants, and
humans are known
in the art (Fire A, et al., 1998 Nature 391:806-811; Fire, A. Trends Genet.
15, 358-363
(1999); Sharp, P. A. RNA interference 2001. Genes Dev. 15, 485-490 (2001);
Hammond,
S. M., et al., Nature Rev. Genet. 2, 110-1119 (2001); Tuschl, T. Chem.
Biochem. 2, 239-
245 (2001); Hamilton, A. et al., Science 286, 950-95'2 (1999); Hammond, S. M.,
et al.,
Nature 404, 293-296 (2000); Zamore, P. D., et al., Cell 101, 25-33 (2000);
Bernstein, E.,
et al., Nature 409, 363-366 (2001); Elbashir, S. M., et al., Genes Dev. 15,
188-200
, (2001); WO0129058; W09932619; Elbashir SM, et al., 2001 Nature 411:494-498).
Nucleic acid modulators are commonly used as research reagents, diagnostics,
and
therapeutics. For example, antisense oligonucleotides, which are able to
inhibit gene
expression with exquisite specificity, are often used to elucidate the
function of particular
genes (see, for example, U.S. Pat. No. 6,165,790). Nucleic acid modulators are
also used,
for example, to distinguish between functions of various members of a
biological pathway.
For example, antisense oligomers have been employed as therapeutic moieties in
the
treatment of disease states in animals and man and have been demonstrated in
numerous
clinical trials to be safe and effective (Milligan JF, et al; -Current
Concepts in Antisense
Drug Design, J Med Chem. (1993) 36:1923-1937; Tonkinson JL et al., Antisense
Oligodeoxynucleotides as Clinical Therapeutic Agents, Cancer Invest. (1996)
14:54-65).
Accordingly, in one aspect of the invention, a CCT6-specific nucleic acid
modulator is
used in an assay to further elucidate the role of the CCT6 in the RB pathway,
and/or its
relationship to other members of the pathway. In another aspect of the
invention, a CCT6-
specific antisense oligomer is used as a therapeutic agent for treatment of RB-
related
disease states.
Assay Systems
The invention provides assay systems and screening methods for identifying
specific modulators of CCT6 activity. As used herein, an "assay system"
encompasses all
19
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
the components required for performing and analyzing results of an assay that
detects
and/or measures a particular event. In general, primary assays are used to
identify or
confirm a modulator's specific biochemical or molecular effect with respect to
the CCT6
nucleic acid or protein. In general, secondary assays further assess the
activity of a CCT6
modulating agent identified by a primary assay and may confirm that the
modulating agent
affects CCT6 in a manner relevant to the RB pathway. In some cases, CCT6
modulators
will be directly tested in a secondary assay.
In a preferred embodiment, the screening method comprises contacting a
suitable
assay system comprising a CCT6 polypeptide or nucleic acid with a candidate
agent under
conditions whereby, but for the presence of the agent, the system provides a
reference
activity (e.g. binding activity), which is based on the particular molecular
event the
screening method detects. A statistically significant difference between the
agent-biased
activity and the reference activity indicates that the candidate agent
modulates CCT6
activity, and hence the RB pathway. The CCT6 polypeptide or nucleic acid used
in the
assay may comprise any of the nucleic acids or polypeptides described above.
Primary Assays
The type of modulator tested generally determines the type of primary assay.
Primary assays for small molecule »zodulators
For small molecule modulators, screening assays are used to identify candidate
modulators. Screening assays may be cell-based or may use a cell-free system
that
recreates or retains the relevant biochemical reaction of the target protein
(reviewed in
Sittampalam GS et al., Curr Opin Chem Biol (1997) 1:34-91 and accompanying
references). As used herein the term "cell-based" refers to assays using live
cells, dead
cells, or a particular cellular fraction, such as a membrane, endoplasmic
reticulum, or
mitochondria) fraction. The term "cell free" encompasses assays using
substantially
purified protein (either endogenous or recombinantly produced), partially
purified or crude
cellular extracts. Screening assays may detect a variety of molecular events,
including
protein-DNA interactions, protein-protein interactions (e.g., receptor-ligand
binding),
transcriptional activity (e.g., using a reporter gene), enzymatic activity
(e.g., via a property
of the substrate), activity of second messengers, immunogenicty and changes in
cellular
morphology or other cellular characteristics. Appropriate screening assays may
use a wide
range of detection methods including fluorescent, radioactive, colorimetric,
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
spectrophotometric, and amperometric methods, to provide a read-out for the
particular
molecular event detected.
Cell-based screening assays usually require systems for recombinant expression
of
CCT6 and any auxiliary proteins demanded by the particular assay. Appropriate
methods
for generating recombinant proteins produce sufficient quantities of proteins
that retain
their relevant biological activities and are of sufficient purity to optimize
activity and
assure assay reproducibility. Yeast two-hybrid and variant screens, and mass
spectrometry
provide preferred methods for determining protein-protein interactions and
elucidation of
protein complexes. In certain applications, when CCT6-interacting proteins are
used in
screens to identify small molecule modulators, the binding specificity of the
interacting
protein to the CCT6 protein may be assayed by various known methods such as
substrate
processing (e.g. ability of the candidate CCT6-specific binding agents to
function as
negative effectors in CCT6-expressing cells), binding equilibrium constants
(usually at
least about 10' M-1, preferably at least about 10$ M-1, more preferably at
least about 109 M-
1), and immunogenicity (e.g. ability to elicit CCT6 specific antibody in a
heterologous host
such as a mouse, rat, goat or rabbit). For enzymes and receptors, binding may
be assayed
by, respectively, substrate and ligand processing.
The screening assay may measure a candidate agent's ability to specifically
bind to
or modulate activity of a CCT6 polypeptide, a fusion protein thereof, or to
cells or
membranes bearing the polypeptide or fusion protein. The CCT6 polypeptide can
be full
length or a fragment thereof that retains functional CCT6 activity. The CCT6
polypeptide
may be fused to another polypeptide, such as a peptide tag for detection or
anchoring, or to
another tag. The CCT6 polypeptide is preferably humanCCT6, or is an ortholog
or
derivative thereof as described above. In a preferred embodiment, the
screening assay
detects candidate agent-based modulation of CCT6 interaction with a binding
target, such
as an endogenous or exogenous protein or other substrate that has CCT6 -
specific binding
activity, and can be used to assess normal CCT6 gene function.
Suitable assay formats that may be adapted to screen for CCT6 modulators are
known in the art. Preferred screening assays are high throughput or ultra high
throughput
and thus provide automated, cost-effective means of screening compound
libraries for lead
compounds (Fernandes PB, Curr Opin Chem Biol (1998) 2:597-603; Sundberg SA,
Curr
Opin Biotechnol 2000, 11:47-53). In one preferred embodiment, screening assays
uses
fluorescence technologies, including fluorescence polarization, time-resolved
fluorescence, and fluorescence resonance energy transfer. These systems offer
means to
21
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
monitor protein-protein or DNA-protein interactions in which the intensity of
the signal
emitted from dye-labeled molecules depends upon their interactions with
partner
molecules (e.g., Selvin PR, Nat Struct Biol (2000) 7:730-4; Fernandes PB,
supra;
Hertzberg RP and Pope AJ, Curr Opin Chem Biol (2000) 4:445-451).
A variety of suitable assay systems may be used to identify candidate CCT6 and
RB pathway modulators (e.g. U.S. Pat. Nos. 5,550,019 and 6,133,437 (apoptosis
assays);
and U.S. Pat. Nos. 5,976,782, 6,225,118 and 6,444,434 (angiogenesis assays),
among
others). Specific preferred assays are described in more detail below.
Apoptosis assays. Assays for apoptosis may be performed by terminal
deoxynucleotidyl transferase-mediated digoxigenin-11-dUTP nick end labeling
(TUNEL)
assay. The TUNEL assay is used to measure nuclear DNA fragmentation
characteristic of
apoptosis ( Lazebnik et al., 1994, Nature 371, 346), by following the
incorporation of
fluorescein-dUTP (Yonehara et al., 1989, J. Exp. Med. 169, 1747). Apoptosis
may further
be assayed by acridine orange staining of tissue culture cells (Lucas, R., et
al., 1998, Blood
15:4730-41). Other cell-based apoptosis assays include the caspase-3/7 assay
and the cell
death nucleosome ELISA assay. The caspase 3/7 assay is based on the activation
of the
caspase cleavage activity as part of a cascade of events that occur during
programmed cell
death in many apoptotic pathways. In the caspase 3/7 assay (commercially
available Apo-
ONES Homogeneous Caspase-317 assay from Promega, cat# 67790), lysis buffer and
caspase substrate are mixed and added to cells. The caspase substrate becomes
fluorescent
when cleaved by active caspase 3/7. The nucleosome ELISA assay is a general
cell death
assay known to those skilled in the art, and available commercially -(Roche;
Cat#
1774425). This assay is a quantitative sandwich-enzyme-immunoassay which uses
monoclonal antibodies directed against DNA and histones respectively, thus
specifically
determining amount of mono- and oligonucleosomes in the cytoplasmic fraction
of cell
lysates. Mono and oligonucleosomes are enriched in the cytoplasm during
apoptosis due
to the fact that DNA fragmentation occurs several hours before the plasma
membrane
breaks down, allowing for accumalation in the cytoplasm. Nucleosomes are not
present in
the cytoplasmic fraction of cells that are not undergoing apoptosis. An
apoptosis assay
system may comprise a cell that expresses a CCT6, and that optionally has
defective RB
function (e.g. RB is over-expressed or under-expressed relative to wild-type
cells). A test
agent can be added to the apoptosis assay system and changes in induction of
apoptosis
relative to controls where no test agent is added, identify candidate RB
modulating agents.
22
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
In some embodiments of the invention, an apoptosis assay may be used as a
secondary
assay to test a candidate RB modulating agents that is initially identified
using a cell-free
assay system. An apoptosis assay may also be used to test whether CCT6
function plays a
direct role in apoptosis. For example, an apoptosis assay may be performed on
cells that
over- or under-express CCT6 relative to wild type cells. Differences in
apoptotic response
compared to wild type cells suggests that the CCT6 plays a direct role in the
apoptotic
response. Apoptosis assays are described further in US Pat. No. 6,133,437.
Cell proliferation and cell cycle assays. Cell proliferation may be assayed
via
bromodeoxyuridine (BRDU) incorporation. This assay identifies a cell
population
undergoing DNA synthesis by incorporation of BRDU into newly-synthesized DNA.
Newly-synthesized DNA may then be detected using an anti-BRDU antibody
(Hoshino et
al., 1986, Int. J. Cancer 38, 369; Campana et al., 1988, J. Immunol. Meth.
107, 79), or by
other means.
Cell proliferation is also assayed via phospho-histone H3 staining, which
identifies
a cell population undergoing mitosis by phosphorylation of histone H3.
Phosphorylation
of histone H3 at serine 10 is detected using an antibody specfic to the
phosphorylated form
of the serine 10 residue of histone H3. (Chadlee,D.N. 1995, J. Biol. Chem
270:20098-
105). Cell Proliferation may also be examined using [3H]-thymidine
incorporation (Chen,
J., 1996, Oncogene 13:1395-403; Jeoung, J., 1995, J. Biol. Chem. 270:18367-
73). This
assay allows for quantitative characterization of S-phase DNA syntheses. In
this assay,
cells synthesizing DNA will incorporate [3H]-thymidine into newly synthesized
DNA.
Incorporation can then be measured by standard techniques such as-bycountirig
of
radioisotope in a scintillation counter (e.g., Beckman LS 3800 Liquid
Scintillation
Counter). Another proliferation assay uses the dye Alamar Blue (available from
Biosource International), which fluoresces when reduced in living cells and
provides an
indirect measurement of cell number (Voytik-Harbin SL et al., 1998, In Vitro
Cell Dev
Biol Anim 34:239-46). Yet another proliferation assay, the MTS assay, is based
on in
vitro cytotoxicity assessment of industrial chemicals, and uses the soluble
tetrazolium salt,
MTS. MTS assays are commercially available, for example, the Promega CellTiter
96~
AQueous Non-Radioactive Cell Proliferation Assay (Cat.# G5421).
Cell proliferation may also be assayed by colony formation in soft agar
(Sambrook
et al., Molecular Cloning, Cold Spring Harbor (1989)). For example, cells
transformed
23
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
with CCT6 are seeded in soft agar plates, and colonies are measured and
counted after two
weeks incubation.
Cell proliferation may also be assayed by measuring ATP levels as indicator of
metabolically active cells. Such assays are commercially available, for
example Cell
Titer-GIoTM, which is a luminescent homogeneous assay available from Promega.
Involvement of a gene in the cell cycle may be assayed by flow cytometry (Gray
JW et al. (1986) Int J Radiat Biol Relat Stud Phys Chem Med 49:237-55). Cells
transfected with a CCT6 may be stained with propidium iodide and evaluated in
a flow
cytometer (available from Becton Dickinson), which indicates accumulation of
cells in
different stages of the cell cycle.
Accordingly, a cell proliferation or cell cycle assay system may comprise a
cell
that expresses a CCT6, and that optionally has defective RB function (e.g. RB
is over-
expressed or under-expressed relative to wild-type cells). A test agent can be
added to the
assay system and changes in cell proliferation or cell cycle relative to
controls where no
test agent is added, identify candidate RB modulating agents. In some
embodiments of the
invention, the cell proliferation or cell cycle assay may be used as a
secondary assay to test
a candidate RB modulating agents that is initially identified using another
assay system
such as a cell-free assay system. A cell proliferation assay may also be used
to test
whether CCT6 function plays a direct role in cell proliferation or cell cycle.
For example,
a cell proliferation or cell cycle assay may be performed on cells that over-
or under-
express CCT6 relative to wild type cells. Differences in proliferation or cell
cycle
compared to wild type cells suggests that the CCT6 plays a direct role in cell
proliferation
or cell cycle.
Angiogenesis. Angiogenesis may be assayed using various human endothelial cell
systems, such as umbilical vein, coronary artery, or dermal cells. Suitable
assays include
Alamar Blue based assays (available from Biosource International) to measure
proliferation; migration assays using fluorescent molecules, such as the use
of Becton
Dickinson Falcon HTS FluoroBlock cell culture inserts to measure migration of
cells
through membranes in presence or absence of angiogenesis enhancer or
suppressors; and
tubule formation assays based on the formation of tubular structures by
endothelial cells
on Matrigel~ (Becton Dickinson). Accordingly, an angiogenesis assay system may
comprise a cell that expresses a CCT6, and that optionally has defective RB
function (e.g.
RB is over-expressed or under-expressed relative to wild-type cells). A test
agent can be
24
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
added to the angiogenesis assay system and changes in angiogenesis relative to
controls
where no test agent is added, identify candidate RB modulating agents. In some
embodiments of the invention, the angiogenesis assay may be used as a
secondary assay to
test a candidate RB modulating agents that is initially identified using
another assay
system. An angiogenesis assay may also be used to test whether CCT6 function
plays a
direct role in cell proliferation. For example, an angiogenesis assay may be
performed on
cells that over- or under-express CCT6 relative to wild type cells.
Differences in
angiogenesis compared to wild type cells suggests that the CCT6 plays a direct
role in
angiogenesis. U.S. Pat. Nos. 5,976,782, 6,225,118 and 6,444,434, among others,
describe
various angiogenesis assays.
Hypoxic induction. The alpha subunit of the transcription factor, hypoxia
inducible factor-1 (IiIF-1), is upregulated in tumor cells following exposure
to hypoxia in
vitro. Under hypoxic conditions, IilF-1 stimulates the expression of genes
known to be
important in tumour cell survival, such as those encoding glyolytic enzymes
and VEGF.
Induction of such genes by hypoxic conditions may be assayed by growing cells
transfected with CCT6 in hypoxic conditions (such as with 0.1% 02, 5% C02, and
balance N2, generated in a Napco 7001 incubator (Precision Scientific)) and
normoxic
conditions, followed by assessment of gene activity or expression by Taqman~.
For
example, a hypoxic induction assay system may comprise a cell that expresses a
CCT6,
and that optionally has defective RB function (e.g. RB is over-expressed or
under-
expressed relative to wild-type cells). A test agent can be added to the
hypoxic induction
assay system and changes in hypoxic response relative to controls where no
test agent is
added, identify candidate RB modulating agents. In some embodiments of the
invention,
the hypoxic induction assay may be used as a secondary assay to test a
candidate RB
modulating agents that is initially identified using another assay system. A
hypoxic
induction assay may also be used to test whether CCT6 function plays a direct
role in the
hypoxic response. For example, a hypoxic induction assay may be performed on
cells that
over- or under-express CCT6 relative to wild type cells. Differences in
hypoxic response
compared to wild type cells suggests that the CCT6 plays a direct role in
hypoxic
induction.
Cell adhesion. Cell adhesion assays measure adhesion of cells to purified
adhesion proteins, or adhesion of cells to each other, in presence or absence
of candidate
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
modulating agents. Cell-protein adhesion assays measure the ability of agents
to modulate
the adhesion of cells to purified proteins. For example, recombinant proteins
are
produced, diluted to 2.5g/mL in PBS, and used to coat the wells of a
microtiter plate. The
wells used for negative control are not coated. Coated wells are then washed,
blocked
with 1% BSA, and washed again. Compounds are diluted to 2x final test
concentration
and added to the blocked, coated wells. Cells are then added to the wells, and
the unbound
cells are washed off. Retained cells are labeled directly on the plate by
adding a
membrane-permeable fluorescent dye, such as calcein-AM, and the signal is
quantified in
a fluorescent microplate reader.
Cell-cell adhesion assays measure the ability of agents to modulate binding of
cell
adhesion proteins with their native ligands. These assays use cells that
naturally or
recombinantly express the adhesion protein of choice. In an exemplary assay,
cells
expressing the cell adhesion protein are plated in wells of a multiwell plate.
Cells
expressing the ligand are labeled with a membrane-permeable fluorescent dye,
such as
BCECF , and allowed to adhere to the monolayers in the presence of candidate
agents.
Unbound cells are washed off, and bound cells are detected using a
fluorescence plate
reader.
High-throughput cell adhesion assays have also been described. In one such
assay,
small molecule ligands and peptides are bound to the surface of microscope
slides using a
microarray spotter, intact cells are then contacted with the slides, and
unbound cells are
washed off. In this assay, not only the binding specificity of the peptides
and modulators
against cell lines are determined, but also the functional cell signaling of
attached cells
using immunofluorescerice techniques in situ on the microchip is measured
(Falsey JR et
al., Bioconjug Chem. 2001 May-Jun;l2(3):346-53).
Tubulogenesis. Tubulogenesis assays monitor the ability of cultured cells,
generally endothelial cells, to form tubular structures on a matrix substrate,
which
generally simulates the environment of the extracellular matrix. Exemplary
substrates
include Matrigel~ (Becton Dickinson), an extract of basement membrane proteins
containing laminin, collagen IV, and heparin sulfate proteoglycan, which is
liquid at 4° C
and forms a solid gel at 37° C. Other suitable matrices comprise
extracellular components
such as collagen, fibronectin, and/or fibrin. Cells are stimulated with a pro-
angiogenic
stimulant, and their ability to form tubules is detected by imaging. Tubules
can generally
be detected after an overnight incubation with stimuli, but longer or shorter
time frames
26
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
may also be used. Tube formation assays are well known in the art (e.g., Jones
MK et al.,
1999, Nature Medicine 5:1418-1423). These assays have traditionally involved
stimulation with serum or with the growth factors FGF or VEGF. Serum
represents an
undefined source of growth factors. In a preferred embodiment, the assay is
performed
with cells cultured in serum free medium, in order to control which process or
pathway a
candidate agent modulates. Moreover, we have found that different target genes
respond
differently to stimulation with different pro-angiogenic agents, including
inflammatory
angiogenic factors such as TNF-alpa. Thus, in a further preferred embodiment,
a
tubulogenesis assay system comprises testing a CCT6's response to a variety of
factors,
such as FGF, VEGF, phorbol myristate acetate (PMA), TNF-alpha, ephrin, etc.
Cell Migration. An invasion/migration assay (also called a migration assay)
tests
the ability of cells to overcome a physical barrier and to migrate towards pro-
angiogenic
signals. Migration assays are known in the art (e.g., Paik JH et al., 2001, J
Biol Chem
276:11830-11837). In a typical experimental set-up, cultured endothelial cells
are seeded
onto a matrix-coated porous lamina, with pore sizes generally smaller than
typical cell
size. The matrix generally simulates the environment of the extracellular
matrix, as
described above. The lamina is typically a membrane, such as the transwell
polycarbonate
membrane (Corning Costar Corporation, Cambridge, MA), and is generally part of
an
upper chamber that is in fluid contact with a lower chamber containing pro-
angiogenic
stimuli. Migration is generally assayed after an overnight incubation with
stimuli, but
longer or shorter time frames may also be used. Migration is assessed as the
number of
cells that crossed the lamina, and may be detected by staining cells with
hemotoXylin
solution (VWR Scientific, South San Francisco, CA), or by any other method for
determining cell number. In another exemplary set up, cells are fluorescently
labeled and
migration is detected using fluorescent readings, for instance using the
Falcon HTS
FluoroBlok (Becton Dickinson). While some migration is observed in the absence
of
stimulus, migration is greatly increased in response to pro-angiogenic
factors. As
described above, a preferred assay system for migrationlinvasion assays
comprises testing
a CCT6's response to a variety of pro-angiogenic factors, including tumor
angiogenic and
inflammatory angiogenic agents, and culturing the cells in serum free medium.
Sprouting assay. A sprouting assay is a three-dimensional ira vitro
angiogenesis
assay that uses a cell-number defined spheroid aggregation of endothelial
cells
27
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
("spheroid"), embedded in a collagen gel-based matrix. The spheroid can serve
as a
starting point for the sprouting of capillary-like structures by invasion into
the
extracellular matrix (termed "cell sprouting") and the subsequent formation of
complex
anastomosing networks (Korff and Augustin, 1999, J Cell Sci 112:3249-58). In
an
exemplary experimental set-up, spheroids are prepared by pipetting 400 human
umbilical
vein endothelial cells into individual wells of a nonadhesive 96-well plates
to allow
overnight spheroidal aggregation (Korff and Augustin: J Cell Biol 143: 1341-
52, 1998).
Spheroids are harvested and seeded in 9001 of methocel-collagen solution and
pipetted
into individual wells of a 24 well plate to allow collagen gel polymerization.
Test agents
are added after 30 min by pipetting 100 ~,1 of 10-fold concentrated working
dilution of the
test substances on top of the gel. Plates are incubated at 37°C for
24h. Dishes are fixed at
the end of the experimental incubation period by addition of paraformaldehyde.
Sprouting
intensity of endothelial cells can be quantitated by an automated image
analysis system to
determine the cumulative sprout length per spheroid.
Primary assays for antibody modulators
For antibody modulators, appropriate primary assays test is a binding assay
that
tests the antibody's affinity to and specificity for the CCT6 protein. Methods
for testing
antibody affinity and specificity are well known in the art (Harlow and Lane,
1988, 1999,
supra). The enzyme-linked immunosorbant assay (ELISA) is a preferred method
for
detecting CCT6-specific antibodies; others include FACS assays,
radioimmunoassays, and
fluorescent assays.
In some cases, screening assays described for small molecule modulators may
also
be used to test antibody modulators.
Primary assays for nucleic acid modulators
For nucleic acid modulators, primary assays may test the ability of the
nucleic acid
modulator to inhibit or enhance CCT6 gene expression, preferably mRNA
expression. In
general, expression analysis comprises comparing CCT6 expression in like
populations of
cells (e.g., two pools of cells that endogenously or recombinantly express
CCT6) in the
presence and absence of the nucleic acid modulator. Methods for analyzing mRNA
and
protein expression are well known in the art. For instance, Northern blotting,
slot blotting,
ribonuclease protection, quantitative RT-PCR (e.g., using the TaqMan~, PE
Applied
Biosystems), or microarray analysis may be used to confirm that CCT6 mRNA
expression
28
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
is reduced in cells treated with the nucleic acid modulator (e.g., Current
Protocols in
Molecular Biology (1994) Ausubel FM et al., eds., John Wiley & Sons, Inc.,
chapter 4;
Freeman WM et al., Biotechniques (1999) 26:112-125; Kallioniemi OP, Ann Med
2001,
33:142-147; Blohm DH and Guiseppi-Elie, A Curr Opin Biotechnol 2001, 12:41-
47).
Protein expression may also be monitored. Proteins are most commonly detected
with
specific antibodies or antisera directed against either the CCT6 protein or
specific
peptides. A variety of means including Western blotting, ELISA, or in situ
detection, are
available (Harlow E and Lane D, 1988 and 1999, supra).
In some cases, screening assays described for small molecule modulators,
particularly in assay systems that involve CCT6 mRNA expression, may also be
used to
test nucleic acid modulators.
Secondary Assays
Secondary assays may be used to further assess the activity of CCT6-modulating
agent identified by any of the above methods to confirm that the modulating
agent affects
CCT6 in a manner relevant to the RB pathway. As used herein, CCT6-modulating
agents
encompass candidate clinical compounds or other agents derived from previously
identified modulating agent. Secondary assays can also be used to test the
activity of a
modulating agent on a particular genetic or biochemical pathway or to test the
specificity
of the modulating agent's interaction with CCT6.
Secondary assays generally compare like populations of cells or animals (e.g.,
two
pools of cells or animals that endogenously or recombinantly express CCT6) in
the
presence and absence of the candidate modulator. In general, such assays test
whether
treatment of cells or animals with a candidate CCT6-modulating agent results
in changes
in the RB pathway in comparison to untreated (or mock- or placebo-treated)
cells or
animals. Certain assays use "sensitised genetic backgrounds", which, as used
herein,
describe cells or animals engineered for altered expression of genes in the RB
or
interacting pathways.
Cell-based assays
Cell based assays may use a variety of mammalian cell lines known to have
defective RB function (e.g. SAOS-2 osteoblasts, BT549 breast cancer cells, and
C33A
cervical cancer cells, among others, available from American Type Culture
Collection
(ATCC), Manassas, VA). Cell based assays may detect endogenous RB pathway
activity
29
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
or may rely on recombinant expression of RB pathway components. Any of the
aforementioned assays may be used in this cell-based format. Candidate
modulators are
typically added to the cell media but may also be injected into cells or
delivered by any
other efficacious means.
Azzimal Assays
A variety of non-human animal models of normal or defective RB pathway may be
used to test candidate CCT6 modulators. Models for defective RB pathway
typically use
genetically modified animals that have been engineered to mis-express (e.g.,
over-express
or lack expression in) genes involved in the RB pathway. Assays generally
require
systemic delivery of the candidate modulators, such as by oral administration,
injection,
etc.
In a preferred embodiment, RB pathway activity is assessed by monitoring
neovascularization and angiogenesis. Animal models with defective and normal
RB are
used to test the candidate modulator's affect on CCT6 in Matrigel~ assays.
Matrigel~ is
an extract of basement membrane proteins, and is composed primarily of
laminin, collagen
IV, and heparin sulfate proteoglycan. It is provided as a sterile liquid at
4° C, but rapidly
forms a solid gel at 37° C. Liquid Matrigel~ is mixed with various
angiogenic agents,
such as bFGF and VEGF, or with human tumor cells which over-express the CCT6.
The
mixture is then injected subcutaneously(SC) into female athymic nude mice
(Taconic,
Germantown, NY) to support an intense vascular response. Mice with Matrigel~
pellets
may be dosed via oral (PO), intraperitoneal (IP), or intravenous (IV) routes
with the
candidate modulator. Mice are euthanized 5 -12 days post-injection, and the
Matrigel~
pellet is harvested for hemoglobin analysis (Sigma plasma hemoglobin kit).
Hemoglobin
content of the gel is found to correlate the degree of neovascularization in
the gel.
In another preferred embodiment, the effect of the candidate modulator on CCT6
is
assessed via tumorigenicity assays. Tumor xenograft assays are known in the
art (see,
e.g., Ogawa K et al., 2000, Oncogene 19:6043-6052). Xenografts are typically
implanted
SC into female athymic mice, 6-7 week old, as single cell suspensions either
from a pre-
existing tumor or from in vitro culture. The tumors which express the CCT6
endogenously are injected in the flank, 1 x 105 to 1 x 10~ cells per mouse in
a volume of
100 ~,L using a 27gauge needle. Mice are then ear tagged and tumors are
measured twice
weekly. Candidate modulator treatment is initiated on the day the mean tumor
weight
reaches 100 mg. Candidate modulator is delivered IV, SC, IP, or PO by bolus
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
administration. Depending upon the pharmacokinetics of each unique candidate
modulator, dosing can be performed multiple times per day. The tumor weight is
assessed
by measuring perpendicular diameters with a caliper and calculated by
multiplying the
measurements of diameters in two dimensions. At the end of the experiment, the
excised
tumors maybe utilized for biomarker identification or further analyses. For
immunohistochemistry staining, xenograft tumors are fixed in 4%
paraformaldehyde,
O.1M phosphate, pH 7.2, for 6 hours at 4°C, immersed in 30% sucrose in
PBS, and rapidly
frozen in isopentane cooled with liquid nitrogen.
In another preferred embodiment, tumorogenicity is monitored using a hollow
fiber
assay, which is described in U.S. Pat No. US 5,698,413. Briefly, the method
comprises
implanting into a laboratory animal a biocompatible, semi-permeable
encapsulation device
containing target cells, treating the laboratory animal with a candidate
modulating agent,
and evaluating the target cells for reaction to the candidate modulator.
Implanted cells are
generally human cells from a pre-existing tumor or a tumor cell line. After an
appropriate
period of time, generally around six days, the implanted samples are harvested
for
evaluation of the candidate modulator. Tumorogenicity and modulator efficacy
may be
evaluated by assaying the quantity of viable cells present in the
macrocapsule, which can
be determined by tests known in the art, for example, MTT dye conversion
assay, neutral
red dye uptake, trypan blue staining, viable cell counts, the number of
colonies formed in
soft'agar, the capacity of the cells to recover and replicate in vitro, etc.
In another preferred embodiment, a tumorogenicity assay use a transgenic
animal,
usually a mouse, carrying a dominant oncogene or tumor suppressor gene
knockout under
the control of tissue specific regulatory sequences; these assays are
generally referred to as
transgenic tumor assays. In a preferred application, tumor development in the
transgenic
model is well characterized or is controlled. In an exemplary model, the "R1P1-
Tag2"
transgene, comprising the SV40 large T-antigen oncogene under control of the
insulin
gene regulatory regions is expressed in pancreatic beta cells and results in
islet cell
carcinomas (Hanahan D, 1985, Nature 315:115-122; Parangi S et al, 1996, Proc
Natl Acad
Sci USA 93: 2002-2007; Bergers G et al, 1999, Science 284:808-812). An
"angiogenic
switch," occurs at approximately five weeks, as normally quiescent capillaries
in a subset
of hyperproliferative islets become angiogenic. The RIPl-TAG2 mice die by age
14
weeks. Candidate modulators may be administered at a variety of stages,
including just
prior to the angiogenic switch (e.g., for a model of tumor prevention), during
the growth of
small tumors (e.g., for a model of intervention), or during the growth of
large and/or
31
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
invasive tumors (e.g., for a model of regression). Tumorogenicity and
modulator efficacy
can be evaluating life-span extension and/or tumor characteristics, including
number of
tumors, tumor size, tumor morphology, vessel density, apoptotic index, etc.
Diagnostic and therapeutic uses
Specific CCT6-modulating agents are useful in a variety of diagnostic and
therapeutic applications where disease or disease prognosis is related to
defects in the RB
pathway, such as angiogenic, apoptotic, or cell proliferation disorders.
Accordingly, the
invention also provides methods for modulating the RB pathway in a cell,
preferably a cell
pre-determined to have defective or impaired RB function (e.g. due to
overexpression,
underexpression, or misexpression of RB, or due to gene mutations), comprising
the step
of administering an agent to the cell that specifically modulates CCT6
activity.
Preferably, the modulating agent produces a detectable phenotypic change in
the cell
indicating that the RB function is restored. The phrase "function is
restored", and
equivalents, as used herein, means that the desired phenotype is achieved, or
is brought
closer to normal compared to untreated cells. For example, with restored RB
function, cell
proliferation and/or progression through cell cycle may normalize, or be
brought closer to
normal relative to untreated cells. The invention also provides methods for
treating
disorders or disease associated with impaired RB function by administering a
therapeutically effective amount of a CCT6 -modulating agent that modulates
the RB
pathway. The invention further provides methods for modulating CCT6 function
in a cell,
preferably a cell pre-determined to have defective or impaired CCT6 function,
by
administering a CCT6 -modulating agent. Additionally, the invention provides a
method
for treating disorders or disease associated with impaired CCT6 function by
administering
a therapeutically effective amount of a CCT6 -modulating agent.
The discovery that CCT6 is implicated in RB pathway provides for a variety of
methods that can be employed for the diagnostic and prognostic evaluation of
diseases and
disorders involving defects in the RB pathway and for the identification of
subjects having
a predisposition to such diseases and disorders.
Various expression analysis methods can be used to diagnose whether CCT6
expression occurs in a particular sample, including Northern blotting, slot
blotting,
ribonuclease protection, quantitative RT-PCR, and microarray analysis. (e.g.,
Current
Protocols in Molecular Biology (1994) Ausubel FM et al., eds., John Wiley &
Sons, Inc.,
chapter 4; Freeman WM et al., Biotechniques (1999) 26:112-125; Kallioniemi OP,
Ann
32
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
Med 2001, 33:142-147; Blohm and Guiseppi-Elie, Curr Opin Biotechnol 2001,
12:41-47).
Tissues having a disease or disorder implicating defective RB signaling that
express a
CCT6, are identified as amenable to treatment with a CCT6 modulating agent. In
a
preferred application, the RB defective tissue overexpresses a CCT6 relative
to normal
tissue. For example, a Northern blot analysis of mRNA from tumor and normal
cell lines,
or from tumor and matching normal tissue samples from the same patient, using
full or
partial CCT6 cDNA sequences as probes, can determine whether particular tumors
express
or overexpress CCT6. Alternatively, the TaqMan~ is used for quantitative RT-
PCR
analysis of CCT6 expression in cell lines, normal tissues and tumor samples
(PE Applied
Biosystems).
Various other diagnostic methods may be performed, for example, utilizing
reagents such as the CCT6 oligonucleotides, and antibodies directed against a
CCT6, as
described above for: (1) the detection of the presence of CCT6 gene mutations,
or the
detection of either over- or under-expression of CCT6 mRNA relative to the non-
disorder
state; (2) the detection of either an over- or an under-abundance of CCT6 gene
product
relative to the non-disorder state; and (3) the detection of perturbations or
abnormalities in
the signal transduction pathway mediated by CCT6.
Thus, in a specific embodiment, the invention is drawn to a method for
diagnosing
a disease or disorder in a patient that is associated with alterations in CCT6
expression, the
method comprising: a) obtaining a biological sample from the patient; b)
contacting the
sample with a probe for CCT6 expression; c) comparing results from step (b)
with a
control; and d) determining whether step (c) indicates a likelihood of the
disease or
disorder. Preferably, the disease is cancer, most preferably a cancer as shown
in TABLE
1. The probe may be either DNA or protein, including an antibody.
EXAMPLES
The following experimental section and examples are offered by way of
illustration
and not by way of limitation.
I. Drosophila RB RNAi screen
RNA interference (RNAi) was used to create Rbf-deficient cultured Drosophila
cells (Schneider S2 cells (Schneider, I. (1972) J. Embryol. Exp. Morph. 27,
363), adapted
to serum-free media, from Invitrogen Corp., Carlsbad, CA). Cells were treated
for 3 days
with Rbf double stranded RNA (dsRNA) or a control dsRNA representing sequences
from
33
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
an EGFP luciferase cDNA. Following pretreatment with Rbf or control dsRNA,
cells
were plated in 96-well format and dsRNA representing approximately 6000
different
Drosophila genes were added to individual wells. A cell proliferation assay
(ProCheckTM
assay - Serological Corporation, Norcross, GA) was used to quantify cell
viability after a
96-hour incubation. For each of the greater than 6000 dsRNA sequences tested
in this
manner, cell viability data was obtained on Rbf deficient cells (Rbf dsRNA-
treated) and
control cells (EGFP luciferase dsRNA-treated). Comparison of this data for
each dsRNA
identified dsRNA sequences that preferentially reduced the viability of Rbf-
deficient cells.
Modifiers that reduced the viability of Rbf deficient cells were identified.
Human
orthologs of the modifiers are referred to herein as CCT6.
BLAST analysis (Altschul et al., supra) was employed to identify orthologs of
Drosophila modifiers. For example, representative sequences from CCT6, GI#
4502643
(SEQ ID NO:B), and GI# 5729761 (SEQ ID NO:9) share 69% and 66% amino acid
identity, respectively, with the Drosoplaila CG8231.
Various domains, signals, and functional subunits in proteins were analyzed
using
the PSORT (Nakai K., and Horton P., Trends Biochem Sci, 1999, 24:34-6; Kenta
Nakai,
Protein sorting signals and prediction of subcellular localization, Adv.
Protein Chem. 54,
277-344 (2000)), PFAM (Bateman A., et al., Nucleic Acids Res, 1999, 27:260-2),
SMART (Ponting CP, et al., SMART: identification and annotation of domains
from
signaling and extracellular protein sequences. Nucleic Acids Res. 1999 Jan
1;27(1):229-
32), TM-HMM (Erik L.L. Sonnhammer, Gunnar von Heijne, and Anders Krogh: A
hidden
Markov model for predicting transmembrane helices in protein sequences. In
Proc. of
Sixth Int. Conf. on Intelligent Systems for Molecular Biology; p 175-182 Ed J.
Glasgow,
T. Littlejohn, F. Major, R. Lathrop, D. Sankoff, and C. Sensen Menlo Park, CA:
AAAI
Press, 1998), and clust (Remm M, and Sonnhammer E. Classification of
transmembrane
protein families in the Caenorhabditis elegans genome and identification of
human
orthologs. Genome Res. 2000 Nov;lO(11):1679-89) programs. For example, the TCP-
1/cpn60 chaperonin family domain (PFAM 00118) of CCT6 from GI#s 4502643 and
5729761 (SEQ ll~ NOs:B and 9, respectively) are located at approximately amino
acid
residues 30 to 526 and 29-525, respectively.
II. High-Throughput In Vitro Fluorescence Polarization Assay
Fluorescently-labeled CCT6 peptide/substrate are added to each well of a 96-
well
microtiter plate, along with a test agent in a test buffer (10 mM HEPES, 10 mM
NaCI, 6
34
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
mM magnesium chloride, pH 7.6). Changes in fluorescence polarization,
determined by
using a Fluorolite FPM-2 Fluorescence Polarization Microtiter System (Dynatech
Laboratories, Inc), relative to control values indicates the test compound is
a candidate
modifier of CCT6 activity.
III. High-Throughput In Vitro Binding Assay
ssP-labeled CCT6 peptide is added in an assay buffer (100 mM KCI, 20 mM
HEPES pH 7.6, 1 mM MgCh, 1% glycerol, 0.5% NP-40, 50 mM beta-mercaptoethanol,
1
mg/ml BSA, cocktail of protease inhibitors) along with a test agent to the
wells of a
Neutralite-avidin coated assay plate and incubated at 25°C for 1 hour.
Biotinylated
substrate is then added to each well and incubated for 1 hour. Reactions are
stopped by
washing with PBS, and counted in a scintillation counter. Test agents that
cause a
difference in activity relative to control without test agent are identified
as candidate RB
modulating agents.
IV. Immunoprecipitations and Immunoblottin~
For coprecipitation of transfected proteins, 3 x 106 appropriate recombinant
cells
containing the CCT6 proteins are plated on 10-cm dishes and transfected on the
following
day with expression constructs. The total amount of DNA is kept constant in
each
transfection by adding empty vector. After 24 h, cells are collected, washed
once with
phosphate-buffered saline and lysed for 20 min on ice in 1 ml of lysis buffer
containing 50
mM Hepes, pH 7.9, 250 mM NaCI, 20 mM -glycerophosphate, 1 mM sodium
orthovanadate, 5 mM p-riitrophenyl phosphate, 2 mM dithiothreitol, protease
inhibitors
(complete, Roche Molecular Biochemicals), and 1% Nonidet P-40. Cellular debris
is
removed by centrifugation twice at 15,000 x g for 15 min. The cell lysate is
incubated
with 25 ,ul of M2 beads (Sigma) for 2 h at 4 °C with gentle rocking.
After extensive washing with lysis buffer, proteins bound to the beads are
solubilized by boiling in SDS sample buffer, fractionated by SDS-
polyacrylamide gel
electrophoresis, transferred to polyvinylidene difluoride membrane and blotted
with the
indicated antibodies. The reactive bands are visualized with horseradish
peroxidase
coupled to the appropriate secondary antibodies and the enhanced
chemiluminescence
(ECL) Western blotting detection system (Amersham Pharmacia Biotech).
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
V. Expression analysis
All cell lines used in the following experiments are NCI (National Cancer
Institute)
lines, and are available from ATCC (American Type Culture Collection,
Manassas, VA
20110-2209). Normal and tumor tissues were obtained from Impath, UC Davis,
Clontech,
Stratagene, Ardais, Genome Collaborative, and Ambion.
TaqMan° analysis was used to assess expression levels of the disclosed
genes in
various samples.
RNA was extracted from each tissue sample using Qiagen (Valencia, CA) RNeasy
kits, following manufacturer's protocols, to a final concentration of
50ng/~,1. Single
stranded cDNA was then synthesized by reverse transcribing the RNA samples
using
random hexamers and 500ng of total RNA per reaction, following protocol
4304965 of
Applied Biosystems (Foster City, CA).
Primers for expression analysis using TaqMan~ assay (Applied Biosystems,
Foster City, CA) were prepared according to the TaqMan~ protocols, and the
following
criteria: a) primer pairs were designed to span introns to eliminate genomic
contamination,
and b) each primer pair produced only one product. Expression analysis was
performed
using a 7900HT instrument.
TaqMan~ reactions were carried out following manufacturer's protocols, in 25
~.l
total volume for 96-well plates and 10 ~,1 total volume for 384-well plates,
using 300nM
primer and 250 nM probe, and approximately 25ng of cDNA. The standard curve
for
result analysis was prepared using a universal pool of human cDNA samples,
which is a
mixture of cDNAs from a wide variety of tissues so that the chance that a
target will be
present in appreciable amounts is good. The raw data were normalized using 18S
rRNA
(universally expressed in all tissues and cells).
For each expression analysis, tumor tissue samples were compared with matched
normal tissues from the same patient. A gene was considered overexpressed in a
tumor
when the level of expression of the gene was 2 fold or higher in the tumor
compared with
its matched normal sample. In cases where normal tissue was not available, a
universal
pool of cDNA samples was used instead. In these cases, a gene was considered
overexpressed in a tumor sample when the difference of expression levels
between a
tumor sample and the average of all normal samples from the same tissue type
was greater
than 2 times the standard deviation of all normal samples (i.e., Tumor -
average(all normal
samples) > 2 x STDEV(all normal samples) ).
36
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
Results are shown in Table 1. Number of pairs of tumor samples and matched
normal tissue from the same patient are shown for each tumor type. Percentage
of the
samples with at least two-fold overexpression for each tumor type is provided.
A
modulator identified by an assay described herein can be further validated for
therapeutic
effect by administration to a tumor in which the gene is overexpressed. A
decrease in
tumor growth confirms therapeutic utility of the modulator. Prior to treating
a patient with
the modulator, the likelihood that the patient will respond to treatment can
be diagnosed
by obtaining a tumor sample from the patient, and assaying for expression of
the gene
targeted by the modulator. The expression data for the genes) can also be used
as a
diagnostic marker for disease progression. The assay can be performed by
expression
analysis as described above, by antibody directed to the gene target, or by
any other
available detection method.
TABLE1
GCT~ ~T# 220953415729760
,'
Seq IDNO. 1 4
"; =
Breast 36% 14%
>' '.~
of Pairs 36 36
h . a
Colon'; 37% 29%
# of Pairs41 41
Head And 23% 0%
Neck
# of Pairs13 13
t. ~~
.
~dney ' 5% 9%
~ ' ~
# of Pairs22 22
~WecN"~ 75% 12%
~.>
# of Pairs8 8 . _
~~~' -
Lung :- 44% 7%
ti ,
of ;Pairs 41 41
ILyinplioma67% 0%
= a
I
# of Pairs3 3
. '.
Ova~'y~ 42% 16%
, ~ ~
#,ofvPairs19 19
Pancreas 54% 31
~ ' ' %
' -~:
# of Pairs13 13
' ~
Prostate 12% 8%
#'of Pairs25 25
Skm- ' S7% 14%
# of Pairs7 7
Stomach 73% 0%
_ '
# of Pairs11 11
Testis= 38% 0%
x
37
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
ofrPairs, 8 8
_a _
Thyroid 14% 7%
Gland
# of Pairs14 14
Uterus 17% 17%
-
#.of Pairs.24 24
':
VI. CCT6 functional assays
RNAi experiments were carried out to knock down expression of CCT6 (SEQ ID
NOs 1 and 4) in various cell lines using small interfering RNAs (siRNA,
Elbashir et al,
supra).
Effect of CCT6 RNAi on cell proliferation and growth. BrdU and Cell Titer-
GIoTM
assays, as described above, were employed to study the effects of decreased
CCT6
expression on cell proliferation. The results of these experiments indicated
that RNAi of
CCT6 of both SEQ ID N0:1 and SEQ D7 N0:4 decreased proliferation in LX1 lung
cancer and HCT116 colon cancer cells. MTS cell proliferation assay, as
described above,
was also employed to study the effects of decreased CCT6 expression on cell
proliferation.
The results of this experiment indicated that RNAi of CCT6 of SEQ ID N0:1
decreased
proliferation in LX1 lung cancer and SW480 colon cancer cells. RNAi of CCT6 of
SEQ
ID NO:4 decreased proliferation in LX1 lung cancer, 231T breast cancer, A549
lung
cancer, HCT116 colon cancer, and SW480 colon cancer cells. Standard colony
growth
assays, as described above, were employed to study the effects of decreased
CCT6
expression on cell growth. Effect of CCT6 RNAi on apoptosis. Nucleosome ELISA
apoptosis assay, as described above, was employed to study the effects of
decreased CCT6
expression on apoptosis. Results indicated that RNAi_of.CCT6 of SEQ m NO:1
increased
apoptosis in A549 lung cancer and LX1 lung cancer cells. RNAi of CCT6 of SEQ ~
N0:4 increased apoptosis in LXl lung cancer cells.
Effect of CCT6 RNAi on cell cycle. Propidium iodide (PI) cell cycle assay, as
described above, was employed to study the effects of decreased CCT6
expression on cell
cycle. RNAi of CCT6 of both SEQ ID N0:1 and SEQ ID N0:4 increased the sub-G1
peak in A549 lung cancer, 231 breast cancer, and LXl lung cancer cells. The
region of
subGl represents cells undergoing apoptosis-associated DNA degradation
CCT6 overexpression analysis. CCT6 (SEQ ID N0:4) was overexpressed and
tested in colony growth assays as described above. Overexpressed CCT6 of SEQ
ID N0:4
had some morphological effects on cells, and strong effects on colony growth.
Effects of
overexpressed CCT6 on expression of various transcription factors was also
studied.
38
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
Overexpressed CCT6 caused an increased expression of the following
transcription
factors: SRE (Serum response element), ETS 1 (ETS oncogene; v-ets avian
erythroblastosis virus e26 oncogene homolog 1), and EGR (Early growth
response).
39
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
SEQUENCE LISTING
<110> EXELIXIS, INC.
<120> CCT6s AS MODIFIERS OF THE RB PATHWAY AND METHODS OF USE
<130> EX03-086C-PC
<150> US 60/428,872
<151> 2002-11-25
<160> 9
<170> PatentIn version 3.2
<210> 1
<211> 2562
<212> DNA
<213> Homo Sapiens
<400> 1
gccgcgccgg ctctgggcactcagcatcgtttccttttcctccgctggagcagctatggc 60
ggcggtgaag accctgaaccccaaggccgaggtggcccgagcgcaggcggcgctggcggt 120
caacatcagc gcagcgcggggtctgcaggacgtgctaaggaccaacctggggcccaaggg 180
caccatgaag atgctcgtttctggcgctggagacatcaaacttactaaagacggcaatgt 240
~
gctgcttcac gaaatgcaaattcaacacccaacagcttccttaatagcaaaggtagcaac 300
agcccaggat gatataactggtgatggtacgacttctaatgtcctaatcattggagagct 360
gctgaaacag gcggatctctacatttctgaaggccttcatcctagaataatcactgaagg 420
atttgaagct gcaaaggaaaaggcccttcagtttttggaagaagtcaaagtaagcagaga 480
gatggacagg gaaacacttatagatgtggccagaacatctcttcgtactaaagttcatgc 540
tgaacttgca gatgtcttaacagaggctgtagtggactccattttggccattaaaaagca 600
agatgaacct attgatctcttcatgattgagatcatggagatgaaacataaatctgaaac 660
tgatacaagcttaatcagagggcttgttttggaccacggagcacggcatcctgatatgaa720
gaaaagggtggaggatgcatacatcctcacttgtaacgtgtcattagagtatgagaaaac780
agaagtgaattctggctttttttacaagagtgcagaagagagagaaaaactcgtgaaagc840
tgaaagaaaattcattgaagatagggttaaaaaaataatagaactgaaaaggaaagtctg900
tggcgattcagataaaggatttgttgttattaatcaaaagggaattgaccccttttcctt960
agatgctctttcaaaagaaggcatagtcgctctgcgcagagctaaaaggagaaatatgga1020
gaggctgactcttgcttgtggtggggtagccctgaattcttttgacgacctaagtcctga1080
ctgcttgggacatgcaggacttgtatatgagtatacattgggagaagagaagtttacctt1140
tattgagaaatgtaacaaccctcgttctgtcacattattgatcaaaggaccaaataagca1200
cacactcactcagatcaaagatgcagtgagggacggcttgagggctgtcaaaaatgctat1260
1
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
tgatgatggc tgtgtggttccaggtgctggtgccgtggaagtggcaatggcagaagccct1320
gattaaacat aagcccagtgtaaagggcagggcacagcttggagtccaagcatttgctga1380
tgcattgctc attattcccaaggttcttgctcagaactctggttttgaccttcaggaaac1440
attagttaaa attcaagcagaacattcagaatcaggtcagcttgtgggtgtggacctgaa1500
cacaggtgag ccaatggtggcagcagaagtaggcgtatgggataactattgtgtaaagaa1560
acagcttctt cactcctgcactgtgattgccaccaacattctcttggttgatgagatcat1620
gcgagctgga atgtcttctctgaaaggttgaattgaagcttcctctgtatctgaatcttg1680
aagactgcaa agtgatcctgaggattacagctgtggaatttttgtccaagcttcaaataa1740
ttttgaaaga aattttcccatatgaaaaaaggagagaacactggcatctgttgaaatttg1800
gaagttctga aattatagtatttttaaaaattgcactgaagtgtatacacataaagcagg1860
tcttttatcc agtgaacaggatgttttgctttagcagcagtgacataaaattccatgtta1920
gataagcata tgttacttaccttgttattaaatatttcttgaaaagcaaattttaatggt1980
taattttatg tggacgtatgttaaattatccaaactaccctattgttaagcatttggttt2040
taaaattttt atgctaatataaatgctcaagtaatttaaaatattgaaagcatccctgtt2100
ggtataaatt tctgagtaaatgcattggatcagttggactttgaacgccctttgaaatgg2160
ctttgctaaa atgctcccgccacaaagttgtaggaaatgggaagaggagtcaactagagg2220
caagggagtt gagagagctgcaactgtaaagggcaagaacaggcagaggtaaaaagatga2280
tggaaggtgt ggtgactaagggccacggttattgggtgaaatttgagatgtaggccaact2340
gtattttcaa gcttctgaacttaaggcaaaatattcatcgcaaagtctctagcgtcatat2400
ttttctcacc caaattacgtttccacgagttattatatatagttggtctatctctgcagt2460
ccttgaaggt gaagttgtgtgttactaggctgtgttttgggatgtcagcagtggcctgaa2520
gtgagttgtg caataaatgttaagttgaaacctcaaaaaaas 2562
<210> 2
<211> 2562
<212> DNA
<213> Homo Sapiens
<400> 2
gccgcgccgg ctctgggcac tcagcatcgt ttccttttcc tccgctggag cagctatggc 60
ggcggtgaag accctgaacc ccaaggccga ggtggcccga gcgcaggcgg cgctggcggt 120
caacatcagc gcagcgcggg gtctgcagga cgtgctaagg accaacctgg ggcccaaggg 180
caccatgaag atgctcgttt ctggcgctgg agacatcaaa cttactaaag acggcaatgt 240
gctgcttcac gaaatgcaaa ttcaacaccc aacagcttcc ttaatagcaa aggtagcaac 300
2
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
agcccaggatgatataactggtgatggtacgacttctaatgtcctaatcattggagagct360
gctgaaacaggcggatctctacatttctgaaggccttcatcctagaataatcactgaagg420
atttgaagctgcaaaggaaaaggcccttcagtttttggaagaagtcaaagtaagcagaga480
gatggacagggaaacacttatagatgtggccagaacatctcttcgtactaaagttcatgc540
tgaacttgcagatgtcttaacagaggctgtagtggactccattttggccattaaaaagca600
agatgaacctattgatctcttcatgattgagatcatggagatgaaacataaatctgaaac660
tgatacaagcttaatcagagggcttgttttggaccacggagcacggcatcctgatatgaa720
gaaaagggtggaggatgcatacatcctcacttgtaacgtgtcattagagtatgagaaaac780
agaagtgaattctggctttttttacaagagtgcagaagagagagaaaaactcgtgaaagc840
tgaaagaaaattcattgaagatagggttaaaaaaataatagaactgaaaaggaaagtctg900
tggcgattcagataaaggatttgttgttattaatcaaaagggaattgaccccttttcctt960
agatgctctttcaaaagaaggcatagtcgctctgcgcagagctaaaaggagaaatatgga1020
gaggctgactcttgcttgtggtggggtagccctgaattcttttgacgacctaagtcctga1080
ctgcttgggacatgcaggacttgtatatgagtatacattgggagaagagaagtttacctt1140
tattgagaaatgtaacaaccctcgttctgtcacattattgatcaaaggaccaaataagca1200
cacactcactcagatcaaagatgcagtgagggacggcttgagggctgtcaaaaatgctat1260
tgatgatggctgtgtggttccaggtgctggtgccgtggaagtggcaatggcagaagccct1320
gattaaacataagcccagtgtaaagggcagggcacagcttggagtccaagcatttgctga1380
tgcattgctcattattcccaaggttcttgctcagaactctggttttgaccttcaggaaac1440
attagttaaaattcaagcagaacattcagaatcaggtcagcttgtgggtgtggacctgaa1500
eacaggtgagccaatggtggeagcagaagt-aggegtatgg-gataactattgtgtaaagaa1560
acagcttcttcactcctgcactgtgattgccaccaacattctcttggttgatgagatcat1620
gcgagctggaatgtcttctctgaaaggttgaattgaagcttcctctgtatctgaatcttg1680
aagactgcaaagtgatcctgaggattacagctgtggaatttttgtccaagcttcaaataa1740
ttttgaaagaaattttcccatatgaaaaaaggagagaacactggcatctgttgaaatttg1800
gaagttctgaaattatagtatttttaaaaattgcactgaagtgtatacacataaagcagg1860
tcttttatccagtgaacaggatgttttgctttagcagcagtgacataaaattccatgtta1920
gataagcatatgttacttaccttgttattaaatatttcttgaaaagcaaattttaatggt1980
taattttatgtggacgtatgttaaattatccaaactaccctattgttaagcatttggttt2040
taaaatttttatgctaatataaatgctcaagtaatttaaaatattgaaagcatccctgtt2100
ggtataaatttctgagtaaatgcattggatcagttggactttgaacgccctttgaaatgg2160
3
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
ctttgctaaaatgctcccgccacaaagttgtaggaaatgggaagaggagtcaactagagg2220
caagggagttgagagagctgcaactgtaaagggcaagaacaggcagaggtaaaaagatga2280
tggaaggtgtggtgactaagggccacggttattgggtgaaatttgagatgtaggccaact2340
gtattttcaagcttctgaacttaaggcaaaatattcatcgcaaagtctctagcgtcatat2400
ttttctcacccaaattacgtttccacgagttattatatatagttggtctatctctgcagt2460
ccttgaaggtgaagttgtgtgttactaggctgtgttttgggatgtcagcagtggcctgaa2520
gtgagttgtgcaataaatgttaagttgaaacctcaaaaaaas 2562
<210> 3
<211> 2647
<212> DNA
<213> Homo sapiens
<400> 3
gggcggcggc gcgcgggcacgctgggggccggccagacgggccgacttttccagaagacc 60
cggatagttc ctcccggccacgccgcgccggctctgggcactcagcatcgtttccttttc 120
ctccgctgga gcagctatggcggcggtgaagaccctgaaccccaaggccgaggtggcccg 180
agcgcaggcg gcgctggcggtcaacatcagcgcagcgcggggtctgcaggacgtgctaag 240
gaccaacctg gggcccaagggcaccatgaagatgctcgtttctggcgctggagacatcaa 300
acttactaaa gacggcaatgtgctgcttcacgaaatgcaaattcaacacccaacagcttc 360
cttaatagca aaggtagcaacagcccaggatgatataactggtgatggtacgacttctaa 420
tgtcctaatc attggagagctgctgaaacaggcggatctctacatttctgaaggccttca 480
tcctagaata atcactgaaggatttgaagctgcaaaggaaaaggcccttcagtttttgga 540
agaagtcaaa gtaagcagagagatggacagggaaacacttatagatgtggccagaacatc 600
tcttcgtact aaagttcatgctgaacttgcagatgtcttaacagaggctgtagtggactc 660
cattttggccattaaaaagcaagatgaacctattgatctcttcatgattgagatcatgga720
gatgaaacataaatctgaaactgatacaagcttaatcagagggcttgttttggaccacgg780
agcacggcatcctgatatgaagaaaagggtggaggatgcatacatcctcacttgtaacgt840
gtcattagagtatgagaaaacagaagtgaattctggctttttttacaagagtgcagaaga900
gagagaaaaactcgtgaaagctgaaagaaaattcattgaagatagggttaaaaaaataat960
agaactgaaaaggaaagtctgtggcgattcagataaaggatttgttgttattaatcaaaa1020
gggaattgacccctttcccttaagtgctctttcaaaagaaggcatagtcgctctgcgcag1080
agctaaaaggagaaatatggagaggctgactcttgcttgtggtggggtagccctgaattc1140
ttttgacgacctaagtcctgactgcttgggacatgcaggacttgtatatgagtatacatt1200
gggagaagagaagtttacctttattgagaaatgtaacaaccctcgttctgtcacattatt1260
4
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
gatcaaaggaccaaataagcacacactcactcagatcaaagatgcagtgagggacggctt1320
gagggctgtcaaaaatgctattgatgatggctgtgtggttccaggtgctggtgccgtgga1380
agtggcaatggcagaagccctgattaaacataagcccagtgtaaagggcagggcacagct1440
tggagtccaagcatttgctgatgcattgctcattattcccaaggttcttgctcagaactc1500
tggttttgaccttcaggaaacattagttaaaattcaagcagaacattcagaatcaggtca1560
gcttgtgggtgtggacctgaacacaggtgagccaatggtggcagcagaagtaggcgtatg1620
ggataactattgtgtaaagaaacagcttcttcactcctgcactgtgattgccaccaacat1680
tctcttggttgatgagatcatgcgagctggaatgtcttctctgaaaggttgaattgaagc1740
ttcctctgtatctgaatcttgaagactgcaaagtgatcctgaggattacagctgtggaat1800
ttttgtccaagcttcaaataattttgaaagaaattttcccatataaaaaaaggagagaac1860
actggcatctgttgaaatttggaagttctgaaattatagtatttttaaaaattgcactga1920
agtgtatacacataaagcaggtcttttatccagtgaacaggatgttttgctttagcagca1980
gtgacataaaattccatgttagataagcatatgttacttaccttgttattaaatatttct2040
tgaaaagcaaattttaatggtttaattttatgtggacgtatgttaaattatccaactacc2100
ctattgttaagcatttggttttaaaatttttatgctaatataaatgctcaagtaatttaa2160
aatattgaaagcatccctgttggtataaatttctgagtaaatgcattggatcagttggac2220
tttgaacgcctttgaaatggctttgctaaaatgctcccgccacaaagttgtaggaaatgg2280
gaagaggagtcaactagaggcaagggagttgagagagctgcaactgtaaagggcaagaac2340
aggcagaggtaaaaagatgatggaaggtgtggtgactaagggccacggttattgggtgaa2400
atttgagattgtaggccaactgtattttcaagcttctgaacttaggcaaaatattcatcg2460
caaagtctctagcgtcatatttttctcacccaaattacgtttccacgagattatttatat2520
atagttggtctatctctgcagtccttgaaggtgaagttgtgtgttactaggctgtgtttt2580
gggatgtcagcagtggcctgaagtgagttgtgcaataaatgttaagttgaaacctcaaaa2640
aaaaaaa 2647
<210> 4
<211> 1759
<212> DNA
<213> Homo Sapiens
<400> 4
cgcgactaag gctttttttt tttctccctc tgaacggtta ggctatggct gcgataaagg 60
ccgtcaactc caaggctgag gtggcgcggg ccaggcagct ttggctgtca atatatgcgc 120
cgccgagggt gcaggatgtg ctgcggacca acttgggtcc taaaggcacc atgaaaatgc 180
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
ttgtttctggtgcaggtgacatcaaactcaccaaagatggcaatgtgctgctcgatgaga240
tgcaaattcaacatccaacagcttccttgatagcaaaagtagcaacagctcaggatggcg300
tcacaggagatggtactacaacaaatgttctaattattggagagttattaaaacaagctg360
acctgtacatttctgagggcctgcaccctagaataatagctgaaggatttgaagctgcaa420
agataaaagcacttgaagttttggaggaagttaaagtgacaaaggagatgaaaagaaaaa480
tcctcttagatgtagctagaacatcattacaaactaaagttcatgctgaactggctgatg540
tcttaacagaggttgtggtggattctcttttccctgttagaagaccaccttaccctattg600
atctcttcatggtagaaataatggagatgaagcataaattaggaacagatacaaagttga660
tccaaggattagttttggatcatggtgcccgtcatccagatatgaagaagcgagtagaag720
atgcatttatccttatttgcaacgtttcactggaatatgaaaaaacagaggtgaactctg780
ctttcttttataagactgcagaagagaaagagaaattggtaaaagctgaaagaaaattta840
ttgaagatagagtacaaaaaataatagacctgaaggacaaagtctgtgctcagtcaaata900
aaggatttgtcgtcattaatcaaaagggaattgatccattttccttagattctcttgcaa960
aacatggaatagtagctcttcgcagagcaaaaagaagaaatatggaaagactctctcttg1020
cttgtggtggaatggccgtgaattcttttgaagatctcactgtagattgcttgggacatg1080
ctggtcttgtgtatgagtatacattaggtgaagaaaagttcacttttattgaggagtgtg1140
ttaacccttgctctgttaccttgttggttaaaggaccaaataagcatactctcacacaag1200
tcaaggatgccataagagatggacttcgtgctatcaaaaatgccattgaagatggttgta1260
tggttcctggagctggtgcaattgaagtggcaatggctgaagctcttgttacatataaga1320
acagtataaaaggaagagctcgtcttggagtccaagcttttgctgatgccttactcatta1380
ttcccaaggttcttgctcagaatgctggtt-atgacccaca-ggaaacattagtaaaagttc1440
aggctgagcatgtcgagtcaaaacaacttgtgggcgtagatttgaatacaggtgagccaa1500
tggtagcagcagatgcaggagtttgggataattattgtgtaaaaaaacaacttcttcact1560
cttgcacagtgattgccaccaacattctcctggttgatgaaattatgcgagctgggatgt1620
cttctcaaatgatgattgaattcaaaatcaacccttctagaagatgaaatttagtacact1680
ttacatctgactactattgtgtagcctgagccattctgaatttctacacaataaatgcag1740
tttatgtcttttgggtcgt 1759
<210>
<211>
1762
<212>
DNA
<213>
Homo
sapiens
<400> 5
cgcgactaag gctttttttt tttctccctc tgaacggtta ggctatggct gcgataaagg 60
6
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
ccgtcaactccaaggctgaggtggcgcgggcccgggcagctttggctgtcaatatatgcg120
ccgcccgagggctgcaggatgtgctgcggaccaacttgggtcctaaaggcaccatgaaaa180
tgcttgtttctggtgcaggtgacatcaaactcaccaaagatggcaatgtgctgctcgatg240
agatgcaaattcaacatccaacagcttccttgatagcaaaagtagcaacagctcaggatg300
acgtcacaggagatggtactacttcaaatgttctaattattggagagttattaaaacaag360
ctgacctgtacatttctgagggcctgcaccctagaataatagctgaaggatttgaagctg420
caaagataaaagcacttgaagttttggaggaagttaaagtgacaaaggagatgaaaagaa480
aaatcctcttagatgtagctagaacatcattacaaactaaagttcatgctgaactggctg540
atgtcttaacagaggttgtggtggattctgttttggctgttagaagaccaggttacccta600
ttgatctcttcatggtagaaataatggagatgaagcataaattaggaacagatacaaagt660
tgatccaaggattagttttggatcatggtgcccgtcatccagatatgaagaagcgagtag720
aagatgcatttatccttatttgcaacgtttcactggaatatgaaaaaacagaggtgaact780
ctggtttcttttataagactgcagaagagaaagagaaattggtaaaagctgaaagaaaat840
ttattgaagatagagtacaaaaaataatagacctgaaggacaaagtctgtgctcagtcaa900
ataaaggatttgtcgtcattaatcaaaagggaattgatccattttccttagattctcttg960
caaaacatggaatagtagctcttcgcagagcaaaaagaagaaatatggaaagactctctc1020
ttgcttgtggtggaatggccgtgaattcttttgaagatctcactgtagattgcttgggac1080
atgctggtcttgtgtatgagtatacattaggtgaagaaaagttcacttttattgaggagt1140
gtgttaacccttgctctgttaccttgttggttaaaggaccaaataagcatactctcacac1200
aagtcaagga tgccataagagatggacttcgtgctatcaaaaatgccattgaagatggtt1260
gtatggttcc tggagctggtgcaattgaagtggcaatggctgaagctcttgttacatata1320
agaacagtat aaaaggaagagctcgtcttggagtccaagcttttgctgatgccttactca1380
ttattcccaa ggttcttgctcagaatgctggttatgacccacaggaaacattagtaaaag1440
ttcaggctga gcatgtcgagtcaaaacaacttgtgggcgtagatttgaatacaggtgagc1500
caatggtagc agcagatgcaggagtttgggataattattgtgtaaaaaaacaacttcttc1560
actcttgcac agtgattgccaccaacattctcctggttgatgaaattatgcgagctggga1620
tgtcttctct caaatgatgattgaattcaaaatcaacccttctagaagatgaaatttagt1680
acactttaca tctgactactattgtgtagcctgagccattctgaatttctacacaataaa1740
tgcagtttat gtcttttgggtc 1762
<210> 6
<211> 1759
7
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
<212>
DNA
<213>
Homo
sapiens
<400>
6
cgcgactaaggctttttttttttctccctctgaacggttaggctatggctgcgataaagg 60
ccgtcaactccaaggctgaggtggcgcgggccaggcagctttggctgtcaatatatgcgc 120
cgccgagggtgcaggatgtgctgcggaccaacttgggtcctaaaggcaccatgaaaatgc 180
ttgtttctggtgcaggtgacatcaaactcaccaaagatggcaatgtgctgctcgatgaga 240
tgcaaattcaacatccaacagcttccttgatagcaaaagtagcaacagctcaggatggcg 300
tcacaggagatggtactacaacaaatgttctaattattggagagttattaaaacaagctg 360
acctgtacatttctgagggcctgcaccctagaataatagctgaaggatttgaagctgcaa 420
agataaaagcacttgaagttttggaggaagttaaagtgacaaaggagatgaaaagaaaaa 480
tcctcttagatgtagctagaacatcattacaaactaaagttcatgctgaactggctgatg 540
tcttaacagaggttgtggtggattctcttttccctgttagaagaccaccttaccctattg 600
atctcttcatggtagaaataatggagatgaagcataaattaggaacagatacaaagttga 660
tccaaggattagttttggatcatggtgcccgtcatccagatatgaagaagcgagtagaag 720
atgcatttatccttatttgcaacgtttcactggaatatgaaaaaacagaggtgaactctg 780
ctttcttttataagactgcagaagagaaagagaaattggtaaaagctgaaagaaaattta 840
ttgaagatagagtacaaaaaataatagacctgaaggacaaagtctgtgctcagtcaaata 900
aaggatttgtcgtcattaatcaaaagggaattgatccattttccttagattctcttgcaa 960
aacatggaat agtagctcttcgcagagcaaaaagaagaaatatggaaagactctctcttg1020
cttgtggtgg aatggccgtgaattcttttgaagatctcactgtagattgcttgggacatg1080
ctggtettgt gtatgagtat-acattaggtgaagaaaagtt-cacttttattgaggagtgtg1140
ttaacccttg ctctgttaccttgttggttaaaggaccaaataagcatactctcacacaag1200
tcaaggatgc cataagagatggacttcgtgctatcaaaaatgccattgaagatggttgta1260
tggttcctgg agctggtgcaattgaagtggcaatggctgaagctcttgttacatataaga1320
acagtataaa aggaagagctcgtcttggagtccaagcttttgctgatgccttactcatta1380
ttcccaaggt tcttgctcagaatgctggttatgacccacaggaaacattagtaaaagttc1440
aggctgagca tgtcgagtcaaaacaacttgtgggcgtagatttgaatacaggtgagccaa1500
tggtagcagc agatgcaggagtttgggataattattgtgtaaaaaaacaacttcttcact1560
cttgcacagt gattgccaccaacattctcctggttgatgaaattatgcgagctgggatgt1620
cttctcaaat gatgattgaattcaaaatcaacccttctagaagatgaaatttagtacact1680
ttacatctga ctactattgtgtagcctgagccattctgaatttctacacaataaatgcag1740
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
tttatgtctt ttgggtcgt 1759
<210> 7
<211> 1735
<212> DNA '
<213> Homo Sapiens
<400> 7
ggttaggcta tggctgcgataaaggccgtcaactccaaggctgaggtggcgcgggcccag60
gcagctttgg ctgtcaatatatgcgccgcccgagggctgcaggatgtgctgcggaccaac120
ttgggtccta aaggcaccatgaaaatgcttgcttctggtgcaggtgacatcaaactcacc180
aaagatggca atgtactgctcgatgagatgcaaattcaacatccaacagcttccttgata240
gcaaaagtag caacagctcaggatgacgtcacaggagatggtactacttcaaatgttcta300
attattggag agttattaaaacaagctgacctgtacatttctgagggcctgcaccctaga360
ataatagctg aaggatttgaagctgcaaagataaaagcacttgaagttttggaggaagtt420
aaagtgacaa aggagatgaaaagaaaaatcctcttagatgtagctagaacatcattacaa480
actaaagttc atgctgaactggctgatgtcttaacagaggttgtggtggattctgttttg540
gctgttagaa gaccaggttaccctattgatctcttcatggtagaaataatggagatgaag600
cataaattag gaacagatacaaagttgatccaaggattagttttggatcatggtgcccgt660
catccagata tgaagaagcgagtagaagatgcatttatccttatttgcaacgtttcactg720
gaatatgaaa aaacagaggtgaactctggtttcttttataagactgcagaagagaaagag780
aaattggtaa aagctgaaagaaaatttattgaagatagagtacaaaaaataatagacctg840
aaggacaaag tctgtgctcagtcaaataaaggatttgtcgtcattaatcaaaagggaatt900
gatccatttt ccttagattctcttgcaaaacatggaatagtagctcttcgcagagcaaaa960
agaagaaata tggaaagactctctcttgcttgtggtggaatggccgtgaattcttttgaa1020
gatctcactgtagattgcttgggacatgctggtcttgtgtatgagtatacattaggtgaa1080
gaaaagttcacttttattgaggagtgtgttaacccttgctctgttaccttgttggttaaa1140
ggaccaaataagcatactctcacacaagtcaaggatgccataagagatggacttcgtgct1200
atcaaaaatgccattgaagatggttgtatggttcctggagctggtgcaattgaagtggca1260
atggctgaagctcttgttacatataagaacagtataaaaggaagagctcgtcttggagtc1320
caagcttttgctgatgccttactcattattcccaaggttcttgctcagaatgctggttat1380
gacccacaggaaacattagtaaaagttcaggctgagcatgtcgagtcaaaacaacttgtg1440
ggcgtagatttgaatacaggtgagccaatggtagcagcagatgcaggagtttgggataat1500
tattgtgtaaaaaaacaacttcttcactcttgcacagtgattgccaccaacattctcctg1560
gttgatgaaattatgcgagctgggatgtcttctctcaaatgatgattgaattcaaaatca1620
9
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
acccttctag aagatgaaat ttagtacact ttacatctga ctactattgt gtagcctgag 1680
ccattctgaa tttctacaca ataaatgcag tttatgtcga aaaaaaaaaa aaaaa 1735
<210> 8
<211> 531
<212> PRT
<213> Homo sapiens
<400> 8
Met Ala Ala Val Lys Thr Leu Asn Pro Lys Ala Glu Val Ala Arg Ala
1 5 10 15
Gln Ala Ala Leu Ala Val Asn Ile Ser Ala Ala Arg Gly Leu Gln Asp
20 25 30
Val Leu Arg Thr Asn Leu Gly Pro Lys Gly Thr Met Lys Met Leu Val
35 40 45
Ser Gly Ala Gly Asp Ile Lys Leu Thr Lys Asp Gly Asn Val Leu Leu
50 55 60
His Glu Met Gln Ile Gln His Pro Thr Ala Ser Leu Ile Ala Lys Val
65 70 75 80
Ala Thr Ala Gln Asp Asp Ile Thr Gly Asp Gly Thr Thr Ser Asn Val
85 90 95
Leu Ile Ile Gly Glu Leu Leu Lys Gln Ala Asp Leu Tyr Ile Ser Glu
100 105 110
Gly Leu His Pro Arg Ile Ile Thr Glu Gly Phe Glu Ala Ala Lys Glu
115 120 125
Lys Ala Leu Gln Phe Leu Glu Glu Val Lys Val Ser Arg Glu Met Asp
130 135 140
Arg Glu Thr Leu Ile Asp Val Ala Arg Thr Ser Leu Arg Thr Lys Val
145 150 155 160
His Ala Glu Leu Ala Asp Val Leu Thr Glu Ala Val Val Asp Ser Ile
165 170 175
Leu Ala I1e Lys Lys Gln Asp Glu Pro Ile Asp Leu Phe Met Ile Glu
180 185 190
Ile Met Glu Met Lys His Lys Ser Glu Thr Asp Thr Ser Leu Ile Arg
1~
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
195 200 205
Gly Leu Val Leu Asp His Gly Ala Arg His Pro Asp Met Lys Lys Arg
210 215 220
Val Glu Asp Ala Tyr Ile Leu Thr Cys Asn Val Ser Leu Glu Tyr Glu
225 230 235 240
Lys Thr Glu Val Asn Ser Gly Phe Phe Tyr Lys Ser Ala Glu Glu Arg
245 250 255
Glu Lys Leu Val Lys Ala Glu Arg Lys Phe Ile Glu Asp Arg Val Lys
260 265 270
Lys Ile Ile Glu Leu Lys Arg Lys Val Cys Gly Asp Ser Asp Lys Gly
275 280 285
Phe Val Val Ile Asn Gln Lys Gly Ile Asp Pro Phe Ser Leu Asp Ala
290 295 300
Leu Ser Lys Glu Gly Ile Val Ala Leu Arg Arg Ala Lys Arg Arg Asn
305 310 315 320
Met Glu Arg Leu Thr Leu Ala Cys Gly Gly Val Ala Leu Asn Ser Phe
325 330 335
Asp Asp Leu Ser Pro Asp Cys Leu Gly His Ala Gly Leu Val Tyr Glu
340 345 350
Tyr Thr Leu Gly Glu Glu Lys Phe Thr Phe Ile Glu Lys Cys Asn Asn
355 360 365-
Pro Arg Ser Val Thr Leu Leu Ile Lys Gly Pro Asn Lys His Thr Leu
370 375 380
Thr Gln Ile Lys Asp Ala Val Arg Asp Gly Leu Arg Ala Val Lys Asn
385 390 395 400
Ala Ile Asp Asp Gly Cys Val Val Pro Gly Ala Gly Ala Val Glu Va1
405 410 415
Ala Met Ala Glu Ala Leu Ile Lys His Lys Pro Ser Val Lys Gly Arg
420 425 430
Ala Gln Leu Gly Val Gln Ala Phe Ala Asp Ala Leu Leu Ile Ile Pro
435 440 445
11
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
Lys Val Leu Ala Gln Asn Ser Gly Phe Asp Leu Gln Glu Thr Leu Val
450 455 460
Lys Ile Gln Ala Glu His Ser Glu Ser Gly Gln Leu Val Gly Val Asp
465 470 475 480
Leu Asn Thr Gly Glu Pro Met Val Ala Ala Glu Val Gly Val Trp Asp
485 490 495
Asn Tyr Cys Val Lys Lys Gln Leu Leu His Ser Cys Thr Val Ile Ala
500 505 510
Thr Asn Ile Leu Leu Val Asp Glu Ile Met Arg Ala Gly Met Ser Ser
515 520 525
Leu Lys Gly
530
<210> 9
<211> 540
<212> PRT
<213> Homo Sapiens
<400> 9
Met Ala Ala Ile Lys Ala Val Asn Ser Lys Ala Glu Val Ala Arg Ala
1 5 10 15
Arg Gln Leu Trp Leu Ser Ile Tyr Ala Pro Pro Arg Val Gln Asp Val
20 25 30
Leu Arg Thr Asn Leu Gly Pro-Lys Gly-Thr Met Lys Met Leu-Val Ser
35 40 45
Gly Ala Gly Asp Ile Lys Leu Thr Lys Asp Gly Asn Val Leu Leu Asp
50 55 60
Glu Met Gln Ile Gln His Pro Thr Ala Ser Leu Ile Ala Lys Val Ala
65 70 . 75 80
Thr Ala Gln Asp Gly Val Thr Gly Asp Gly Thr Thr Thr Asn Val Leu
85 90 95
Ile Ile Gly Glu Leu Leu Lys Gln Ala Asp Leu Tyr Ile Ser Glu Gly
100 105 110
Leu His Pro Arg Ile Ile Ala Glu Gly Phe Glu Ala Ala Lys Ile Lys
115 120 125
12
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
Ala Leu Glu Val Leu Glu Glu Val Lys Val Thr Lys Glu Met Lys Arg
130 135 140
Lys Ile Leu Leu Asp Val Ala Arg Thr Ser Leu Gln Thr Lys Val His
145 150 155 160
Ala Glu Leu Ala Asp Val Leu Thr Glu Val Val Val Asp Ser Leu Phe
165 170 175
Pro Val Arg Arg Pro Pro Tyr Pro Ile Asp Leu Phe Met Val Glu Ile
180 185 190
Met Glu Met Lys His Lys Leu Gly Thr Asp Thr Lys Leu Ile Gln Gly
195 200 205
Leu Val Leu Asp His Gly Ala Arg His Pro Asp Met Lys Lys Arg Val
210 215 220
Glu Asp Ala Phe Ile Leu Ile Cys Asn Val Ser Leu Glu Tyr Glu Lys
225 230 235 240
Thr Glu Val Asn Ser Ala Phe Phe Tyr Lys Thr Ala Glu Glu Lys Glu
245 250 255
Lys Leu Val Lys Ala Glu Arg Lys Phe Ile Glu Asp Arg Val Gln Lys
260 265 270
Ile Ile Asp Leu Lys Asp Lys Val Cys Ala Gln Ser Asn Lys Gly Phe
275 280 285
Val Val Ile Asn Gln Lys Gly Ile Asp Pro Phe Ser Leu Asp Ser Leu
290 295 300
Ala Lys His Gly Ile Val Ala Leu Arg Arg Ala Lys Arg Arg Asn Met
305 310 315 320
Glu Arg Leu Ser Leu Ala Cys Gly Gly Met Ala Val Asn Ser Phe Glu
325 330 335
Asp Leu Thr Val Asp Cys Leu Gly His Ala Gly Leu Val Tyr Glu Tyr
340 345 350
Thr Leu Gly Glu Glu Lys Phe Thr Phe Ile Glu Glu Cys Val Asn Pro
355 360 365
13
CA 02506686 2005-05-19
WO 2004/048541 PCT/US2003/037548
Cys Ser Val Thr Leu Leu Val Lys Gly Pro Asn Lys His Thr Leu Thr
370 375 380
Gln Val Lys Asp Ala Ile Arg Asp Gly Leu Arg Ala Ile Lys Asn Ala
385 390 395 400
Ile Glu Asp Gly Cys Met Val Pro Gly Ala Gly Ala Ile Glu Val Ala
405 410 415
Met Ala Glu Ala Leu Val Thr Tyr Lys Asn Ser Ile Lys Gly Arg Ala
420 425 430
Arg Leu Gly Val Gln Ala Phe Ala Asp Ala Leu Leu Ile Ile Pro Lys
435 440 445
Val Leu Ala Gln Asn Ala Gly Tyr Asp Pro Gln Glu Thr Leu Val Lys
450 455 460
Val Gln Ala Glu His Val Glu Ser Lys Gln Leu Val Gly Val Asp Leu
465 470 475 480
Asn Thr Gly Glu Pro Met Val Ala Ala Asp Ala Gly Val Trp Asp Asn
485 490 495
Tyr Cys Val Lys Lys Gln Leu Leu His Ser Cys Thr Val Ile Ala Thr
500 505 510
Asn Ile Leu Leu Val Asp Glu Ile Met Arg Ala Gly Met Ser Ser Gln
515 520 525
Met'-Met file Glu Phe Lys 2le Asn Pro Ser Arg Arg --
530 535 540
14
