Note: Descriptions are shown in the official language in which they were submitted.
DEMANDE OU BREVET VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVET COMPREND
PLUS D'UN TOME.
CECI EST LE TOME 1 DE 2
CONTENANT LES PAGES 1 A 331
NOTE : Pour les tomes additionels, veuillez contacter le Bureau canadien des
brevets
JUMBO APPLICATIONS/PATENTS
THIS SECTION OF THE APPLICATION/PATENT CONTAINS MORE THAN ONE
VOLUME
THIS IS VOLUME 1 OF 2
CONTAINING PAGES 1 TO 331
NOTE: For additional volumes, please contact the Canadian Patent Office
NOM DU FICHIER / FILE NAME
NOTE POUR LE TOME / VOLUME NOTE:
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
METHODS FOR DETECTION OF GENETIC DISORDERS
CROSS-REFERENCE TO RELATED APPLICATIONS
This application claims priority to U.S. Patent Application No. 10/093,618,
filed March 11,
2002; provisional U.S. Patent Application Nos. 60/360,232 and 60/378,354,
filed March 1, 2002,
and May 8, 2002, respectively; and to P.C.T. Application No. US03/06198, filed
February 28,
2003. The contents of these applications are hereby incorporated by reference
in their entirety
herein.
BACKGROUND OF THE INVENTION
FIELD OF THE INVENTION
The present invention is directed to a method for the detection of genetic
disorders
including chromosomal abnormalities and mutations. The present invention
provides a rapid,
non-invasive method for determining the sequence of DNA from a fetus. The
method is especially
useful for detection of chromosomal abnormalities in a fetus including
translocations, transversions,
monosomies, trisomies, and other aneuplodies, deletions, additions,
amplifications, translocations
and rearrangements.
BACKGROUND ART
Chromosomal abnormalities are responsible for a significant portion of genetic
defects in
liveborn humans. The nucleus of a human cell contains forty-six (46)
chromosomes, which contain
the genetic instructions, and determine the operations of the cell. Half of
the forty-six
chromosomes originate from each parent. Except for the sex chromosomes, which
are quite
different from each other in normal males, the chromosomes from the mother and
the chromosomes
from the father make a matched set. The pairs were combined when the egg was
fertilized by the
sperm. Occasionally, an error occurs in either the formation or combination of
chromosomes, and
the fertilized egg is formed with too many or too few chromosomes, or with
chromosomes that are
mixed in some way. Because each chromosome contains many genes, chromosomal
abnormalities
are likely to cause serious birth defects, affecting many body systems and
often including
developmental disability (e.g., mental retardation).
Cells mistakenly can rejoin broken ends of chromosomes, both spontaneously and
after
exposure to chemical compounds, carcinogens, and irradiation. When rejoining
occurs within a
chromosome, a chromosome segment between the two breakpoints becomes inverted
and is
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
classified as an inversion. With inversions, there is no loss of genetic
material; however, inversions
can cause disruption of a critical gene, or create a fusion gene that induces
a disease related
condition.
In a reciprocal translocation, two non-homologous chromosomes break and
exchange
fragments. In this scenario, two abnormal chromosomes result: each consists of
a part derived from
the other chromosome and lacks a part of itself. If the translocation is of a
balanced type, the
individual will display no abnormal phenotypes. However, during germ-cell
formation in the
translocation-bearing individuals, the proper distribution of chromosomes in
the egg or sperm
occasionally fails, resulting in miscarriage, malformation, or mental
retardation of the offspring.
In a Robertsonian translocation, the centromeres of two acrocentric (a
chromosome with a
non-centrally located centromere) chromosomes fuse to generate one large
metacentric
chromosome. The karyotype of an individual with a centric fusion has one less
than the normal
diploid number of chromosomes.
Errors that generate too many or too few chromosomes can also lead to disease
phenotypes.
For example, a missing copy of chromosome X (monosomy X) results in Turner's,
Syndrome, while .,
an additional copy of chromosome 21 results in Down's Syndrome. Other diseases
such as
Edward',s Syndrome, and Patau Syndrome are caused by an additional copy of
chromosome 18, and
chromosome 13, respectively.
One of the most common chromosome abnormalities is known as Down syndrome. The
estimated incidence of Down's syndrome is between 1 in 1,000 to 1 in 1,100
live births. -Each year
approximately 3,000 to 5,000 children are born in the U.S. with this
chromosomal disorder. The
vast majority of children with Down syndrome (approximately 95 percent) have
an extra
chromosome 21. Most often, the extra chromosome originates from the mother.
However, in about
3-4 percent of people with Down syndrome, a translocation between chromosome
21 and either 14
or 22 is responsible for the genetic abnormality. Finally, another chromosome
problem, called
mosaicism, is noted in about 1 percent of individuals with Down's syndrome. In
this case, some
cells have 47 chromosomes and others have 46 chromosomes. Mosiacism is thought
to be the
result of an error in cell division soon after conception.
Chromosomal abnormalities are congential, and therefore, prenatal diagnosis
can be used to
determine the health and condition of an unborn fetus. Without knowledge
gained by prenatal
diagnosis, there could be an untoward outcome for the fetus or the mother or
both. Congenital
anomalies account for 20 to 25% of perinatal deaths. Specifically, prenatal
diagnosis is helpful for
managing the remaining term of the pregnancy, planning for possible
complications with the birth
process, preparing for problems that can occur in the newborn infant, and
finding conditions that
may affect future pregnancies.
2
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
There are a variety of non-invasive and invasive techniques available for
prenatal diagnosis
including ultrasonography, amniocentesis, chorionic villus sampling (CVS),
fetal blood cells in
maternal blood, maternal serum alpha-fetoprotein, maternal serum beta-HCG, and
maternal serum
estriol. However, the techniques that are non-invasive are less specific, and
the techniques with
high specificity and high sensitivity are highly invasive. Furthermore, most
techniques can be ,
applied only during specific time periods during pregnancy for greatest
utility.
Ultrasonography
This is a harmless, non-invasive procedure. High frequency sound waves are
used to
generate visible images from the pattern of the echoes made by different
tissues and organs,
including the fetus in the amniotic cavity. The developing embryo can be
visualized at about 6
weeks of gestation. The major internal organs and extremities can be assessed
to determine if any
are abnormal at about 16 to 20 weeks gestation.
An ultrasound examination can be useful to determine the size and position of
the fetus, the
amount of amniotic fluid, and the appearance of fetal anatomy; however, there
are, limitations to this
procedure. Subtle abnormalities, such as Down syndrome, where the morphologic
abnormalities
are often not marked, but only subtle, may not be detected at~all.
Amniocentesis
This is a highly invasive procedure in which a needle is passed through the
mother's lower
abdomen into the amniotic cavity inside the uterus. This procedure can be
performed at about 14
weeks gestation. For prenatal diagnosis, most amniocenteses are performed
between 14 and 20
weeks gestation. However, an ultrasound examination is performed, prior to
amniocentesis, to
determine gestationaI age, position.of the fetus and placenta, and determine
if enough amniotic fluid
is present. Within the amniotic fluid are fetal cells (mostly derived from
fetal skin) which can be
grown in culture for chromosomal, biochemical, and molecular biologic
analyses.
Large chromosomal abnormalities, such as extra or missing chromosomes or
chromosome
fragments, can be detected by karyotyping, which involves the identification
and analysis of all 46
chromosomes from a cell and arranges them in their matched pairs, based on
subtle differences in
size and structure. In this systematic display, abnormalities in chromosome
number and structure
are apparent. This procedure typically takes 7-10 days for completion.
While amniocentesis can be used to provide direct genetic information, risks
are associated
with the procedure including fetal loss and maternal Rh sensitization. The
increased risk for fetal
mortality following amniocentesis is about 0.5% above what would normally be
expected. Rh
negative mothers can be treated with RhoGam.
3
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Chorionic Villus Sampling (CVS)
In this procedure, a catheter is passed via the vagina through the cervix and
into the uterus
to the developing placenta with ultrasound guidance. The introduction of the
catheter allows cells
from the placental chorionic villi to be obtained and analyzed by a variety of
techniques, including
chromosome analysis to determine the karyotype of the fetus. The cells can
also be cultured for
biochemical or molecular biologic analysis. Typically, CVS is performed
between 9.5 and 12.5
weeks gestation.
CVS has the disadvantage of being an invasive procedure, and it has a low but
significant
rate of morbidity for the fetus; this loss rate is about 0.5 to 1 % higher
than for women undergoing
amniocentesis. Rarely, CVS can be associated with limb defects in the fetus.
Also, the possibility
of maternal Rh sensitization is present. Furthermore, there is also the
possibility that maternal
blood cells in the developing placenta will be sampled instead of fetal cells
and confound
chromosome analysis.
Maternal Serum Alpha-Fetoprotein (MSAFP)
The developing fetus has two major blood proteins--albumin and alpha-
fetoprotein (AFP).
The mother typically has only albumin in her blood, and thus, the MSAFP test
can be utilized to
determine the levels of AFP from the fetus. Ordinarily, only a small amount of
AFP gains access to
the amniotic fluid and crosses the placenta to mother's blood. However, if the
fetus has a neural
tube defect, then more AFP escapes into the amniotic fluid. Neural tube
defects include
anencephaly (failure of closure at the cranial end of the neural tube) and
spina bifida (failure of
closure at the caudal end of the neural tube). The incidence of such defects
is about 1 to 2 births per
1000 in the United States. Also, if there are defects in the fetal abdominal
wall, the AFP from the
fetus will end up in maternal blood in higher amounts.
The amount of MSAFP increases with gestational age, and thus for the MSAFP
test to
provide accurate results, the gestational age must be known with certainty.
Also, the race of the
mother and presence of gestational diabetes can influence the level of MSAFP
that is to be
considered normal. The MSAFP is typically reported as multiples of the mean
(MoM): The greater
the MoM, the more likely a defect is present. The MSAFP test has the greatest
sensitivity between
16 and 18 weeks gestation, but can be used between 15 and 22 weeks gestation.
The MSAFP tends
to be lower when Down's Syndrome or other chromosomal abnormalities is
present.
While the MSAFP test is non-invasive, the MSAFP is not 100% specific. MSAFP
can be
elevated for a variety of reasons that are not related to fetal neural tube or
abdominal wall defects.
4
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
The most common cause for an elevated MSAFP is a wrong estimation of the
gestational age of the
fetus. Therefore, results from an MSAFP test are never considered definitive
and conclusive.
Maternal Serum Seta-HCG
Beginning at about a week following conception and implantation of the
developing
embryo into the uterus, the trophoblast will produce detectable beta-HCG (the
beta subunit of
human chorionic gonadotropin), which can be used to diagnose pregnancy. The
beta-HCG also can
be quantified in maternal serum, and this can be useful early in pregnancy
when threatened abortion
or ectopic pregnancy is suspected, because the amount of beta-HCG will be
lower than normal.
In the middle to late second trimester, the beta-HCG can be used
in.conjunction with the
MSAFP to screen for chromosomal abnormalities, in particular for Down
syndrome. An elevated
beta-HCG coupled with a decreased MSAFP suggests Down syndrome. High levels of
HCG
suggest trophoblastic disease (molar pregnancy). The absence of a fetus on
ultrasonography along
with an elevated HCG suggests a hydatidiform mole.
Maternal Serum Estriol .
The amount of estriol in maternal serum is dependent upon a viable fetus, a
properly
functioning placenta, and maternal well-being. Dehydroepiandrosterone (DHEA)
is made by the
fetal adrenal glands, and is metabolized in the placenta to estriol. The
estriol enters the maternal
circulation and is excreted by the maternal kidney in urine or by the maternal
liver in the bile.
Normal levels of estriol, measured in the third trimester, will give an
indication of general
well-being of the fetus. If the estriol level drops, then the fetus is
threatened and an immediate
delivery may be necessary. Estriol tends to be lower when Down syndrome is
present and when
there is adrenal hypoplasia with anencephaly.
The Triple Screen Test
The triple screen test comprises analysis of maternal serum alpha-feto-protein
(MSAFP),
human chorionic gonadotrophin (hCG), and unconjugated estriol (uE3). The blood
test is usually
performed 16-18 weeks after the last menstrual period. While the triple screen
test is non-invasive,
abnormal test results are not indicative of a birth defect. Rather, the test
only indicates an increased
risk and suggests that further testing is needed. For example, 100 out of
1,000 women will have an
abnormal result from the triple screen test. However, only 2-3 of the 100
women will have a fetus
with a birth defect. This high incidence of false positives causes tremendous
stress and unnecessary
anxiety to the expectant mother.
5
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Fetal Cells Isolated From Maternal Blood
The presence of fetal nucleated cells in maternal blood makes it possible to
use these cells
for noninvasive prenatal diagnosis (Walknowska, et al., Lancet 1:1119-1122,
1969; Lo et al., Lancet
2:1363-65, 1989; Lo et al., Blood 88:4390-95, 1996). The fetal cells can be
sorted and analyzed by
a variety of techniques to look for particular DNA sequences (Bianchi et al.,
Am. J. Hum. Genet.
61:822-29, (1997); Bianchi et al., PNAS 93:705-08, (1996)). Fluorescence in-
situ hybridization
(FISH) is one technique that can be applied to identify particular chromosomes
of the fetal cells
recovered from maternal blood and diagnose aneuploid conditions such as
trisomies and monosomy
X. Also, it has been reported that the number of fetal cells in maternal blood
increases in aneuploid
pregnancies.
The method of FISH uses DNA probes labeled with colored fluorescent tags that
allow
detection of specific chromosomes or genes under a microscope. Using FISH,
subtle genetic
abnormalities that cannot be detected by standard karyotyping are readily
identifiable. This
procedure typically takes 24-48 hours to complete. Additionally, using a panel
of.multi-colored
DNA FISH probes, abnormal chromosome copy numbers can be seen.
While improvements have been made for the isolation and enrichment of fetal
cells, it is
still difficult to get many fetal blood cells. There may not be enough to
reliably determine
anomalies of the fetal karyotype or assay for other abnormalities.
Furthermore, most techniques are
time consuming, require high-inputs of labor, and are difficult to implement
for a high throughput
fashion.
Fetal DNA From Maternal Blood
Fetal DNA has been detected and quantitated in maternal plasma and serum (Lo
et al.,
Lancet 350:485-487 (1997); Lo et al., Am. J. hum. Genet. 62:768-775 (1998)).
Multiple fetal cell
types occur in the maternal circulation, including fetal granulocytes,
lymphocytes, nucleated red
blood cells, and trophoblast cells (Pertl, and Bianchi, Obstetrics and
Gynecology 98: 483-490
(2001)). Fetal DNA can be detected in the serum at the seventh week of
gestation, and increases
with the term of the pregnancy. The fetal DNA present in the maternal serum
and plasma is
comparable to the concentration of DNA obtained from fetal cell isolation
protocols.
Circulating fetal DNA has been used to determine the sex of the fetus (Lo et
al., Am. J.
hum. Genet. 62:768-775 (1998)). Also, fetal rhesus D genotype has been
detected using fetal DNA.
However, the diagnostic and clinical applications of circulating fetal DNA is
limited to genes that
are present in the fetus but not in the mother (Pertl and Bianchi, Obstetrics
and Gynecology 98:
483-490 (2001)). Thus, a need still exists for a non-invasive method that can
determine the
sequence of fetal DNA and provide definitive diagnosis of chromosomal
abnormalities in a fetus.
6
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
BRIEF SUMMARY OF THE INVENTION
The invention is directed to a method for detection of genetic disorders
including mutations
and chromosomal abnormalities. In a preferred embodiment, the present
invention is used to detect
mutations, and chromosomal abnormalities including but not limited to
translocation, transversion,
monosomy, trisomy, and other aneuploidies, deletion, addition, amplification,
fragment,
translocation, and rearrangement. Numerous abnormalities can be detected
simultaneously. The
present invention also provides a non-invasive method to determine the
sequence of fetal DNA
from a sample of a pregnant female. The present invention can be used to
detect.any alternation in
gene sequence as compared to the wild type sequence including but not limited
to point mutation,
reading frame shift, transition, transversion, addition, insertion, deletion,
addition-deletion, frame-
shift, missense, reverse mutation, and microsatellite alteration. The present
invention also provides ..
a method for isolating free nucleic acid from a sample containing nucleic
acid.
In one embodiment, the present invention is directed to a method for detecting
chromosomal abnormalities said method comprising: (a) determining the sequence
of alleles of a
locus of interest on template DNA, and (b) quantitating a ratio for the
alleles at a heterozygous
locus of interest that was identified from the locus of interest of (a),
wherein said ratio indicates the
presence or absence of a chromosomal abnormality.
In another embodiment, the present invention provides a non-invasive method
for
determining the sequence of a locus of interest on fetal DNA, said method
comprising: (a) obtaining,
a sample from a pregnant female; (b) adding a cell lysis inhibitor, a cell
membrane stabilizer, or a
cross-linker to the sample of (a); (c) obtaining template DNA from the sample
of (b), wherein said
template DNA comprises fetal DNA and maternal DNA; and (d) determining the
sequence of a
locus of interest on template DNA.
In another embodiment, the template DNA is obtained from a sample including
but not
limited to a cell, tissue, blood, serum, plasma, saliva, urine, tears, vaginal
secretion, sweat,
umbilical cord blood, chorionic villi, amniotic fluid, embryonic tissue,
embryo, a two-celled
embryo, a four-celled embryo, an eight-celled embryo, a 16-celled embryo, a 32-
celled embryo, a
64-celled embryo, a 128-celled embryo, a 256-celled embryo, a 512-celled
embryo, a 1024-celled
embryo, lymph fluid, cerebrospinal fluid, mucosa secretion, peritoneal fluid,
ascitic fluid, fecal
matter, or body exudate.
In one embodiment, the template DNA is obtained from a sample from a pregnant
female.
In a preferred embodiment, the template DNA is obtained from a pregnant human
female.
In another embodiment, the template DNA is obtained from an embryo. In a
preferred
embodiment, the template DNA is obtained from a single cell from an embryo.
7
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
In another embodiment, a cell lysis inhibitor is added to the sample including
but not ,
limited to formaldehyde, and derivatives of formaldehyde, formalin,
glutaraldehyde, and derivatives
of glutaraldehyde, crosslinkers, primary amine reactive crosslinkers,
sulfhydryl reactive
crosslinkers, sulfhydryl addition or disulfide reduction, carbohydrate
reactive crosslinkers, carboxyl
reactive crosslinkers, photoreactive crosslinkers, cleavable crosslinkers,
AEDP, APG, BASED
BM(PEO)3, BM(PEO)4, BMB, BMDB, BMH, BMOE, BS3, BSOCOES, DFDNB, DMA, DMP,
DMS, DPDPB, DSG, DSP, DSS, DST, DTBP, DTME, DTSSP, EGS, HBVS, sulfo-BSOCOES,
Sulfo-DST, Sulfo-EGS or compounds listed in Table XXIII. In a preferred
embodiment, formalin
is present in the sample at a percentage including but not limited to 0.0001-
0.03%, 0.03-0.05%,
0.05-0.08%, 0.08-0.1%, 0.1-0.3%, 0.3-0.5%, 0.5-0.7%, 0.7-0.9%, 0.9-1.2%, 1.2-
1.5%, 1.5-2%, 2-
3%, 3-5%, and greater than 5%.
An agent that stabilizes cell membranes may be added to the maternal blood
sample to
reduce maternal cell lysis including but not limited to aldehydes, urea
formaldehyde, phenol
formaldehyde, DMAE (dimethylaminoethanol), cholesterol, cholesterol
derivatives,: high
concentrations of magnesium, vitamin E, and vitamin E derivatives, calcium,
calcium gluconate,
taurine, niacin, hydroxylamine derivatives, bimoclomol, sucrose, astaxanthin,
glucose,
amitriptyline, isomer A hopane tetral phenylacetate, isomer B hopane tetral
phenylacetate,
citicoline, inositol, vitamin B, vitamin B complex, cholesterol hemisuccinate,
sorbitol, calcium,
coenzyme Q, ubiquinone, vitamin K, vitamin K complex, menaquinone, zonegran,
zinc, ginkgo
biloba extract, diphenylhydantoin, perftoran, polyvinylpyrrolidone,
phosphatidylserine, tegretol,
PABA, disodium cromglycate, nedocromil sodium, phenytoin, zinc citrate,
mexitil, dilantin, sodium
hyaluronate, or polaxamer 188.
In another embodiment, an agent that prevents DNA destruction is added to the
sample
including but not limited to DNase inhibitors, zinc chloride,
ethylenediaminetetraacetic acid,
guanidine-HCI, guanidine isothiocyanate, N-lauroylsarcosine, and Na-
dodecylsulphate.
In a preferred embodiment, template DNA is obtained from the plasma of the
blood.from a
pregnant female. In another embodiment, the template DNA is obtained from the
serum of the
blood from a pregnant female.
In another embodiment, template DNA comprises fetal DNA and maternal DNA.
In another embodiment, the locus of interest on the template DNA is selected
from a
maternal homozygous locus of interest. In another embodiment, the locus of
interest on the
template DNA is selected from a maternal heterozygous locus of interest.
In another embodiment, the locus of interest on the template DNA is selected
from a
paternal homozygous locus of interest. In another embodiment, the locus of
interest on the template
DNA is selected from a paternal heterozygous locus of interest.
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
In one embodiment, the sequence of alleles of multiple loci of interest on a
single
chromosome is determined. In a preferred embodiment, the sequence of alleles
of multiple loci of
interest on multiple chromosomes is determined.
In another embodiment, determining the sequence of alleles of a locus of
interest comprises
a method including but not limited to allele specific PCR, gel
electrophoresis, ELISA, mass
spectrometry, hybridization, primer extension, fluorescence polarization,
fluorescence detection,
fluorescence resonance energy transfer (FRET), sequencing, DNA microarray, SNP-
IT, GeneChips,
HuSNP, BeadArray, TaqMan assay, Invader assay, MassExtend, MassCleaveT"" (hMC)
method,
southern blot, slot blot, dot blot, and MA.LDI-TOF mass spectrometry.
In a preferred embodiment, determining the sequence of alleles of a locus of
interest
comprises (a) amplifying the locus of interest using a first and second
primers, wherein the second
primer contains a recognition site for a restriction enzyme that generates a
5' overhang containing
the locus of interest; (b) digesting the amplified DNA with the restriction
enzyme that recognizes
the recognition site on the second primer; (c) incorporating a nucleotide into
the digested DNA of
(b) by using the 5' overhang containing the locus of interest as a template;
and (d) determining the
sequence of the locus of interest by determining the sequence of the DNA of
(c).
In one embodiment, the amplification can comprise polymerase chain reaction
(PCR). In a
further embodiment, the annealing temperature for cycle 1 of PCR can be about
the melting
temperature of the annealing length of the second primer. In another
embodiment, the annealing
temperature for cycle 2 of PCR can be about the melting temperature of the 3'
region, which
anneals to the template DNA, of the first primer. In another embodiment, the
annealing
temperature for the remaining cycles can be about the melting temperature of
the entire sequence of
the second primer.
In another embodiment, the recognition site on the second primer is for a
restriction enzyme
that cuts at a distance from its binding site and generates a 5' overhang,
which contains the locus of
interest. In a preferred embodiment, the recognition site on the second primer
is for a Type IIS
restriction enzyme. The Type IIS restriction enzyme includes but is not
limited to Alw I, A1w26 I,
r
Bbs I, Bbv I, BceA I, Bmr I, Bsa I, Bst71 I, BsmA I, BsmB I, BsmF I, BspM I,
Ear I, Fau I, Fok I,
Hga I, Ple I, Sap I, SSfaN I, and Sthi32 I, and more preferably BceA I and
BsmF I.
In one embodiment, the 3' end of the second primer is adjacent to the locus of
interest.
In another embodiment, the annealing length of the second primer is selected
from the
group consisting of 35-30, 30-25, 25-20, 20-15, 15, 14, 13, 12, 11, 10, 9, 8,
7, 6, 5, 4, and less than
4 bases.
In another embodiment, amplifying the loci of interest comprises using first
and second
primers that contain a portion of a restriction enzyme recognition site,
wherein said recognition site
9
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
contains at least one variable nucleotide, and after amplification the full
restriction enzyme
recognition site is generated, and the 3' region of said primers can contain
mismatches with the
template DNA, and digestion with said restriction enzyme generates a 5'
overhang containing the
locus of interest.
In a preferred embodiment, the recognition site for restriction enzymes
including but not
limited to BsaJ I (5' C~CNNGG 3'), BssK I (5'~CCNGG 3'), Dde I (5'C~TNAG 3'),
EcoN I
(5'CCTNN~NNNAGG 3'), Fnu4H I (5'GC~NGC 3'), Hinf I (5'G~ANTC 3'), PfIF 1(5'
GACN~NNGTC 3'), Sau96 I (5' G~GNCC 3'), ScrF I (5' CC~NGG 3'), Tthl 11 I (5'
GACN~NNGTC 3'), and more preferably Fnu4H I and EcoN I, is generated after
amplification.
In another embodiment, the 5' region of the first andlor second primer
contains a
recognition site for a restriction enzyme. In a preferred embodiment, the
restriction enzyme
recognition site is different from the restriction enzyme recognition site
that generates a 5' overhang
containing the locus of interest.
In a further embodiment, the method of the invention further comprises
digesting the DNA
with a restriction enzyme that recognizes the recognition site at the 5'
region of the first and/or
second primer.
The first and/or second primer can contain a tag at the 5' terminus.
Preferably, the first
primer contains a tag at the 5' terminus. The tag can be used to separate the
amplified DNA from
the template DNA. The tag can be used to separate the amplified DNA containing
the labeled
nucleotide from the amplified DNA that does not contain the labeled
nucleotide. The tag can be
any chemical moiety including but not limited to radioisotope, fluorescent
reporter molecule,
chemiluminescent reporter molecule, antibody, antibody fragment, hapten,
biotin, derivative of.
biotin, photobiotin, iminobiotin, digoxigenin, avidin, enzyme, acridinium,
sugar, enzyme;
apoenzyme, homopolymeric oligonucleotide, hormone, ferromagnetic moiety,
paramagnetic
moiety, diamagnetic moiety, phosphorescent moiety, luminescent moiety,
electrochemiluminescent
moiety, chromatic moiety, moiety having a detectable electron spin resonance,
electrical
capacitance, dielectric constant or electrical conductivity, or combinations
thereof. Preferably, the
tag is biotin. The biotin tag is used to separate amplified DNA from the
template DNA using a
streptavidin matrix. The streptavidin matrix is coated on wells of a
microtiter plate.
The incorporation of a nucleotide in the method of the invention is by a DNA
polymerase
including but not limited to E. coli DNA polymerase, Klenow fragment of E.
coli DNA polymerase
I, T7 DNA polymerase, T4 DNA polymerase, TS DNA polymerase, Klenow class
polymerases,
Taq polymerase, Pfu DNA polymerase, Vent polymerase, bacteriophage 29,
REDTaqT"~ Genomic
DNA polymerase, or sequenase. The incorporation of a nucleotide can further
comprise using a
mixture of labeled and unlabeled nucleotides. One nucleotide, two nucleotides,
three nucleotides,
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
four nucleotides, five nucleotides, or more than five nucleotides can be
incorporated. A
combination of labeled and unlabeled nucleotides can be incorporated. The
labeled nucleotide is
selected from the group consisting of a dideoxynucleotide triphosphate (also
referred to as
"dideoxy") and deoxynucleotide triphosphate (also referred to as "deoxy"). The
unlabeled
nucleotide is selected from the group consisting of a dideoxynucleotide
triphosphate and
deoxynucleotide triphosphate. The labeled nucleotide is labeled with a
molecule including but not
limited to radioactive molecule, fluorescent molecule, antibody, antibody
fragment, hapten,
carbohydrate, biotin, and derivative of biotin, phosphorescent moiety,
luminescent moiety,
electrochemiluminescent moiety, chromatic moiety, and moiety, having a
detectable electron spin ..
resonance, electrical capacitance, dielectric constant or electrical
conductivity. Preferably, the
labeled nucleotide is labeled with a fluorescent molecule. The incorporation
of a fluorescent
labeled nucleotide further comprises using a mixture of fluorescent and
unlabeled nucleotides.
In one embodiment, the determination of the sequence of the locus of interest
comprises
detecting the incorporated nucleotide. In one embodiment, the detection is by
a method selected
from the group consisting of gel electrophoresis, capillary electrophoresis,
.microchannel
electrophoresis, polyacrylamide gel electrophoresis, fluorescence detection,
fluorescence
polarization, DNA sequencing, Sanger dideoxy sequencing, ELISA, mass
spectrometry, time of
flight mass spectrometry, quadrupole mass spectrometry, magnetic sector mass
spectrometry,
electric sector mass spectrometry, fluorometry, infrared spectrometry,
ultraviolet spectrometry,
palentiostatic amperometry, DNA hybridization, DNA microarray, GeneChip
arrays, HuSNP
arrays, BeadArrays, MassExtend, SNP-IT, TaqMan assay, Invader assay,
MassCleave, southern
blot, slot blot, and dot blot.
In one embodiment, the sequence of alleles of one to tens to hundreds to
thousands of loci
of interest on a single chromosome on template DNA is determined. In a
preferred embodiment,
the sequence of alleles of one to tens to hundreds to thousands of loci of
interest on multiple
chromosomes is determined.
In a preferred embodiment, the locus of interest is suspected of containing a
single
nucleotide polymorphism or mutation. The method can be used for determining
sequences of
multiple loci of interest concurrently. The template DNA can comprise multiple
loci from a single
chromosome. The template DNA can comprise multiple loci from different
chromosomes. The
loci of interest on template DNA can be amplified in one reaction.
Alternatively, each of the loci of
interest on template DNA can be amplified in a separate reaction. The
amplified DNA can be
pooled together prior to digestion of the amplified DNA. Each of the labeled
DNA containing a
locus of interest can be separated prior to determining the sequence of the
locus of interest. In one
11
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
embodiment, at least one of the loci of interest is suspected of containing a
single nucleotide
polymorphism or a mutation.
In another embodiment, the ratio of alleles at a heterozygous locus of
interest on a
chromosome is compared to the ratio of alleles at a heterozygous locus of
interest on a different
chromosome. There is no limitation as to the chromosomes that can be compared.
The ratio for the
alleles at a heterozygous locus of interest on any chromosome can be compared
to the ratio for the
alleles at a heterozygous locus of interest on any other chromosome. In a
preferred embodiment,
the ratio of alleles at multiple heterozygous loci of interest on a chromosome
are summed and
compared to the ratio of alleles at multiple heterozygous loci of interest on
a different chromosome.
In another embodiment, the ratio of alleles at a heterozygous locus of
interest on a
chromosome is compared to the ratio of alleles at a heterozygous locus of
interest on two, three,
four or more than four chromosomes. In another embodiment, the ratio of
alleles at multiple loci of
interest on a chromosome is compared to the ratio of alleles at multiple loci
of interest on two,
three, four, or more than four chromosomes.
In another embodiment, the ratio of the alleles at a locus of interest on a
chromosome is
compared to the ratio of the alleles at a locus of interest on a different
chromosome, wherein a
difference in the ratios indicates the presence or absence of a chromosomal
abnormality. In another
embodiment, the ratio of the alleles at multiple loci of interest on a
chromosome is compared to the
ratio of the alleles at multiple loci of interest on a different chromosome,
wherein a difference in the
ratios indicates the presence or absence of a chromosomal abnormality.
In another embodiment, the sequence of one to tens to hundreds to thousands of
loci of
interest on the template DNA obtained from a sample of a pregnant female is
determined. In one
embodiment, the loci of interest are on one chromosome. In another embodiment,
the loci of
interest are on multiple chromosomes.
In another embodiment, the present invention provides a method for isolating
nucleic acid
said method comprising (a) obtaining a sample containing nucleic acid; (b)
adding a cell lysis
inhibitor, cell membrane stabilizer, or cross-linker to the sample of (a); and
(c) isolating nucleic
acid. In a preferred embodiment, the method is used for isolating free nucleic
acid. In a most
preferred embodiment, the method is used for isolating free fetal nucleic
acid.
In another embodiment, the presnt invention provides a method for isolating
free fetal
nucleic acid said method comprising (a) obtaining a sample containing nucleic
acid; (b) adding a
cell lysis inhibitor, cell membrane stabilizer, or cross-linker to the sample
of (a); (c) isolating the
plasma from the blood sample, wherein the plasma is isolated by centrifuging
the blood sample; and
(d) removing the supernatant, which contains the plasma, using procedures to
minimize disruption
of the "buffy-coat."
12
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
In another embodiment, the sample containing the nucleic acid is obtained from
any nucleic
acid containg source including but not limited to a cell, tissue, blood,
serum, plasma, saliva, urine,
tears, breast fluid, breast milk, vaginal secretion, sweat, umbilical cord
blood, chorionic villi,
amniotic fluid, embryonic tissue, embryo, a two-celled embryo, a four-celled
embryo, an
eight-celled embryo, a 16-celled embryo, a 32- celled embryo, a 64-celled
embryo, a 128-celled
embryo, a 256-celled embryo, a 512-celled embryo, a 1024-celled embryo, lymph
fluid,
cerebrospinal fluid, mucosa secretion, peritoneal fluid, ascitic fluid, fecal
matter, or body exudate.
In one embodiment, the sample containing the nucleic acid is obtained from a
pregnant
female. In a preferred embodiment, the sample is obtained from a pregnant
human female. In a
preferred embodiment, the sample is blood obtained from a pregnant female.
In another embodiment, a cell lysis inhibitor, a cell membrane stabilizer or a
cross-linker is
added to the sample including but not limited to formaldehyde, and derivatives
of formaldehyde,
formalin, glutaraldehyde, and derivatives of glutaraldehyde, crosslinkers,
primary amine reactive
crosslinkers, sulthydryl reactive crosslinkers, sulfliydryl addition or
disulfide reduction,
carbohydrate reactive crosslinkers, carboxyl reactive crosslinkers,
photoreactive crosslinkers,
cleavable crosslinkers, AEDP, APG, BASED, BM(PEO)3, BM(PEO)4, BMB, BMDB, BMH,
BMOE, BS3, BSOCOES, DFDNB, DMA, DMP, DMS, DPDPB, DSG, DSP, DSS, DST, DTBP,
DTME, DTSSP, EGS, HBVS, sulfo-BSOCOES, Sulfo-DST, Sulfo-EGS or compounds
listed in
Table XXIII.
An agent that stabilizes cell membranes may be added to the sample including
but not
limited to aldehydes, urea formaldehyde, phenol formaldehyde, DMAE
(dimethylaminoethanol),
cholesterol, cholesterol derivatives, high concentrations of magnesium,
vitamin E, and vitamin E
derivatives, calcium, calcium gluconate, tsarina, niacin, hydroxylamine
derivatives, bimoclomol,
sucrose, astaxanthin, glucose, amitriptyline, isomer A hopane tetral
phenylacetate, isomer B hopane
tetral phenylacetate, citicoline, inositol, vitamin B, vitamin B complex,
cholesterol hemisuccinate,
sorbitol, calcium, coenzyme Q, ubiquinone, vitamin K, vitamin K complex,
menaquinone,
zonegran, zinc, ginkgo biloba extract, diphenylhydantoin, perftoran,
polyvinylpyrrolidone,
phosphatidylserine, tegretol, PABA, disodium cromglycate, nedocromil sodium,
phenytoin, zinc
citrate, mexitil, dilantin, sodium hyaluronate, or polaxamer 188.
In another embodiment, an agent that prevents DNA destruction is added to the
sample
including but not limited to DNase inhibitors, zinc chloride,
ethylenediaminetetraacetic acid,
guanidine-HCI, guanidine isothiocyanate, N-lauroylsarcosine, and Na-
dodecylsulphate.
In a preferred embodiment, the nucleic acid is isolated from plasma obtained
from blood of
a pregnant female. In another embodiment, the nucleic acid is isolated from
plasma, which is
generated using procedures designed to minimize the amount of maternal cell
lysis. In another
13
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
embodiment, the nucleic acid is isolated from plasma by centrifuging blood
from a pregnant female,
and allowing the centrifuge to stop without applying a brake.
In a preferred embodiment, free nucleic acid is isolated from plasma obtained
from blood
from a pregnant female. In another embodiment, the free nucleic acid is
isolated from plasma,
which is generated by centrifuging blood obtained from a pregnant female, and
allowing the
centrifuge to stop without applying a brake (the centrifuge comes to a stop by
natural deceleration).
In another embodiment, the blood from a pregnant female is centrifuged at a
speed including but
not limited to 0-50 rpm, 50-100 rpm, 100-200 rpm, 200-300 rpm, 300-400 rpm,
400-500 rpm, 500-
600 rpm, 600-700 rpm, 700-800 rpm, 800-900 rpm, 900-1000 rpm, 1000-2000 rpm,
2000-3000
rpm, 3000-4000 rpm, 4000-5000 rpm, 5000-6000 rpm, 6000-7000 rpm, 7000-8000
rpm, and greater
than 8000 rpm. In a preferred embodiment, the blood from the pregnant female
is centrifuged at a
speed less than 4000 rpm. In another embodiment, the acceleration power of the
centrifuge is not
used.
BRIEF DESCRIPTION OF THE FIGURES
FI(i. lA. A Schematic diagram depicting a double stranded I~NA molecule. A
pair of
primers, depicted as bent arrows, flank the locus of interest, depicted as a
triangle symbol at base
N14. The locus of interest can be a single nucleotide polymorphism, point
mutation, insertion,
deletion, translocation, etc. Each primer contains a restriction enzyme
recognition site about 10 by
from the 5' terminus depicted as region "a" in the first primer and as region
"d" in the second
primer. Restriction recognition site "a" can be for any type of restriction
enzyme but recognition
site "d" is for a restriction enzyme, which cuts "n" nucleotides away from its
recognition site and
leaves a 5' overhang and a recessed 3' end. Examples of such enzymes include
but are not limited
to BceAI and BsmF I. The 5' overhang serves as a template for incorporation of
a nucleotide into
the 3' recessed end.
The first primer is shown modified with biotin at the 5' end to aid in
purification. The
sequence of the 3' end of the primers is such that the primers anneal at a
desired distance upstream
and downstream of the locus of interest. The second primer anneals close to
the locus of interest;
the annealing site, which is depicted as region "c," is designed such that the
3' end of the second
primer anneals one base away from the locus of interest. The second primer can
anneal any
distance from the locus of interest provided that digestion with the
restriction enzyme, which
recognizes the region "d" on this primer, generates a 5' overhang that
contains the locus of interest.
The first primer annealing site, which is depicted as region "b," is about 20
bases.
14
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
FIG. 1B. A schematic diagram depicting the annealing and extension steps of
the first
cycle of amplification by PCR. The first cycle of amplification is performed
at about the melting
temperature of the 3' region, which anneals to the template DNA, of the second
primer, depicted as
region "c," and is 13 base pairs in this example. At this temperature, both
the first and second
primers anneal to their respective complementary strands and begin extension,
depicted by dotted
lines. In this first cycle, the second primer extends and copies the region b
where the first primer
can anneal in the next cycle.
FIG. 1C. A schematic diagram depicting the annealing and extension steps
following ,
denaturation in the second cycle of amplification of PCR. The second cycle of
amplification is
performed at a higher annealing temperature (TM2), which is about the melting
temperature of the
by of the 3' region of the first primer that anneals to the template DNA,
depicted as region "b."
Therefore at TM2, the first primer, which contains region b' which is
complementary to region b,
15 can bind to the DNA that was copied in the first cycle of the reaction.
However, at TM2 the second
primer cannot anneal to the original template DNA or to DNA that was copied in
the first cycle of
the reaction because the annealing temperature is too high. The second primer
can anneal to 13
bases in the original template DNA but TM2 is calculated at about the melting
temperature of 20
bases.
FIG. 1D. A schematic diagram depicting the annealing and extension reactions
after
denaturation during the third cycle of amplification. In this cycle, the
annealing temperature, TM3,
is about the melting temperature of the entire second primer, including
regions "c" and "d." The
length of regions "c" + "d" is about 27-33 by long, and thus TM3 is
significantly higher than TM1
and TM2. At this higher TM the second primer, which contain regions c' and d',
anneals to the
copied DNA generated in cycle 2.
FIG. lE. A schematic diagram depicting the annealing and extension reactions
for the
remaining cycles of amplification. The annealing temperature for the remaining
cycles is TM3,
which is about the melting temperature of the entire second primer. At TM3,
the second primer
binds to templates that contain regions c' and d' and the first primer binds
to templates that contain
regions a' and b. By raising the annealing temperature successively in each
cycle for the first three
cycles, from TM1, TM2, and TM3, nonspecific amplification is significantly
reduced.
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
FIG. 1F. A schematic diagram depicting the amplified locus of interest bound
to a solid
matrix.
FIG. 1G. A schematic diagram depicting the bound, amplified DNA after
digestion with
restriction enzyme "d." The "downstream" end is released into the supernatant,
and can be
removed by washing with any suitable buffer. The upstream end containing the
locus of interest
remains bound to the solid matrix.
FIG. 1H. A schematic diagram depicting the bound amplified DNA, after "filling
in" with
a labeled ddNTP. A DNA polymerase is used to "fill in" the base (N' 14) that
is complementary to
the locus of interest (N14). In this example, only ddNTPs are present in this
reaction, such that
only the locus of interest or SNP of interest is filled in.
FIG. l I. A schematic diagram depicting the labeled, bound DNA after digestion
with
restriction enzyme "a." The labeled DNA is released into the supernatant,
which can be collected to
identify the base that was incorporated.
FIG. 2. A schematic diagram depicting double stranded DNA templates with n
number of
loci of interest and n number of primer pairs, xl, y, to x", y", specifically
annealed such that a primer
flanks each locus of interest. The first primers are biotinylated at the 5'
end, depicted by ~, and
contain a restriction enzyme recognition site, "a", which can be any type of
restriction enzyme. The
second primers contain a restriction enzyme recognition site, "d," where "d"
is a recognition site for
a restriction enzyme that cuts "n" nucleotides away from its recognition site,
and generates a 5'
overhang containing the locus of interest and a recessed 3' end. The second
primers anneal
adjacent to the respective loci of interest. The exact position of the
restriction enzyme site "d" in
the second primers is designed such that digesting the PCR product of each
locus of interest with
restriction enzyme "d" generates a 5' overhang containing the locus of
interest and a 3' recessed
end. The annealing sites of the first primers are about 20 bases long and are
selected such that each
successive first primer is further away from its respective second primer. For
example, if at locus 1
the 3' ends of the first and second primers are Z base pairs apart, then at
locus 2, the 3' ends of the
first and second primers are Z + K base pairs apart, where K = 1, 2, 3 or more
than three bases.
Primers for locus N are ZN_1 + K base pairs apart. The purpose of making each
successive first
primer further apart from their respective second primers is such that the
"ftlled in" restriction
fragments (generated after amplification, purification, digestion and labeling
as described in FIGS.
16
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
1B-lI) differ in size and can be resolved, for example by electrophoresis, to
allow detection of each
individual locus of interest.
FIG. 3. PCR amplification of SNPs using multiple annealing temperatures. A
sample
containing genomic DNA templates from thirty-six human volunteers was analyzed
for the
following four SNPs: SNP HC21S00340 (lane 1), identification number as
assigned in the Human
Chromosome 21 cSNP Database, located on chromosome 21; SNP TSC 0095512 (lane
2), located
on chromosome 1, SNP TSC 0214366 (lane 3), located on chromosome l; and SNP
TSC 0087315
(lane 4), located on chromosome 1. Each SNP was amplified by PCR using three
different
annealing temperature protocols, herein referred to as the low stringency
annealing temperature;
medium stringency annealing temperature; and high stringency annealing
temperature. Regardless
of the annealing temperature protocol, each SNP was amplified for 40 cycles of
PCR. The
denaturation step for each PCR reaction was performed for 30 seconds at
95°C.
FIG. 3A. Photograph of a gel demonstrating PCR amplification of the 4
different SNPs
using the low stringency annealing temperature protocol.
FIG. 3B. Photograph of a gel demonstrating PCR amplification of the 4
different SNPs
using medium stringency annealing temperature protocol.
FIG. 3C. Photograph of a gel demonstrating PCR amplification of the 4
different SNPs
using the high stringency annealing temperature protocol.
FIG. 4A. A depiction of the DNA sequence of SNP HC21500027, as assigned by the
Human Chromosome 21 cSNP database, located on chromosome 21. A first primer
and a second
primer are indicated above and below, respectively, the sequence of
HC21500027. The first primer
is biotinylated and contains the restriction enzyme recognition site for
EcoRI. The second primer
contains the restriction enzyme recognition site for BsmF I and contains 13
bases that anneal to the
DNA sequence. The SNP is indicated by R (A/G) and r (T/C) (complementary to
R).
FIG. 4B. A depiction of the DNA sequence of SNP HC2I 500027, as assigned by
the
Human Chromosome 21 cSNP database, located on chromosome 21. A first primer
and a second
primer are indicated above and below, respectively, the sequence of
HC21500027. The first primer
is biotinylated and contains the restriction enzyme recognition site for
EcoRI. The second primer
17
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
contains the restriction enzyme recognition site for BceA I and has 13 bases
that anneal to the DNA
sequence. The SNP is indicated by R (A/G) and r (TlC) (complementary to R).
FIG. 4C. A depiction of the DNA sequence of SNP TSC0095512 from chromosome 1.
The first primer and the second primer are indicated above and below,
respectively, the sequence of
TSC0095512. The first primer is biotinylated and contains the restriction
enzyme recognition site
for EcoRI. The second primer contains the restriction enzyme recognition site
for BsmF I and has
13 bases that anneal to the DNA sequence. The SNP is indicated by S (G/C) and
s (ClG)
(complementary to S).
FIG. 4D. A depiction of the DNA sequence of SNP TSC0095512 from chromosome 1.
The first primer and the second primer are indicated above and below,
respectively, the sequence of
TSC0095512. The first primer is biotinylated and contains the restriction
enzyme recognition site
for EcoRl. The second primer contains the restriction enzyme recognition site
for BceA I and has
13 bases that anneal to the DNA sequence. The SNP is indicated by S (G/C) and
s.(C/G)
(complementary to S).
FIGS. SA-SD. A schematic diagram depicting the nucleotide sequences of SNP
HC21500027 (FIGS. SA and SB) and SNP TSC0095512 (FIGS. SC and SD) after
amplification
with the primers described in FIGS. 4A-4D. Restriction sites in the primer
sequence are indicated
in bold.
FIGS. 6A-6D. A schematic diagram depicting the nucleotide sequences of each
amplified
SNP after digestion with the appropriate Type IIS restriction enzyme. FIGS. 6A
and 6B depict
fragments of SNP HC21S00027 digested with the Type IIS restriction enzymes
BsmF I and BceA I,
respectively. FIGS. 6C and 6D depict fragments of SNP TSC0095512 digested with
the Type IIS
restriction enzymes BsmF I and BceA I, respectively.
FIGS. 7A-7D. A schematic diagram depicting the incorporation of a
fluorescently labeled
nucleotide using the 5' overhang of the digested SNP site as a template to
"fill in" the 3' recessed
end. FIGS. 7A and 7B depict the digested SNP HC21S00027 locus with an
incorporated labeled
ddNTP (*R dd = fluorescent dideoxy nucleotide). FIGS. 7C and 7D depict the
digested SNP
TSC0095512 locus with an incorporated labeled ddNTP (*S-aa = fluorescent
dideoxy nucleotide).
The use of ddNTPs ensures that the 3' recessed end is extended by one
nucleotide, which is
complementary to the nucleotide of interest or SNP site present in the 5'
overhang.
18
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
FIG. 7E. A schematic diagram depicting the incorporation of dNTPs and a ddNTP
into the
5' overhang containing the SNP site. SNP HC21500007 was digested with BsmF I,
which
generates a four base 5' overhang. The use of a mixture of dNTPs and ddNTPs
allows the 3'
recessed end to be extended one nucleotide (a ddNTP is incorporated first);
two nucleotides (a
dNTP is incorporated followed by a ddNTP); three nucleotides (two dNTPs are
incorporated,
followed by a ddNTP); or four nucleotides (three dNTPs are incorporated,
followed by a ddNTP~.
All four products can be separated by size, and the incorporated nucleotide
detected (*R-aa -
fluorescent dideoxy nucleotide). Detection of the first nucleotide, which
corresponds to the SNP or
locus site, and the next three nucleotides provides an additional level of
quality assurance. The
SNP is indicated by R (A/G) and r (T/C) (complementary to R).
FIGS. 8A-8D. Release of the "filled in" SNP from the solid support matrix,
i.e.
streptavidin coated well. SNP HC21 S00027 is shown in FIGS. 8A and 8B, while
SNP
TSC0095512 is shown in FIGS. 8C and 8D. The "filled in" SNP is free in
solution, and can be
detected.
FIG. 9A. Sequence analysis of SNP HC21500027 digested with BceAI. Four "fill
in"
reactions are shown; each reaction contained one fluorescently labeled
nucleotide, ddGTP, ddATP,
ddTTP, or ddCTP, and unlabeled ddNTPs. The 5' overhang generated by digestion
with BceA I
and the expected nucleotides at this SNP site are indicated.
FIG. 9B. Sequence analysis of SNP TSC0095512. SNP TSC0095512 was amplified
with
a second primer that contained the recognition site for BceA I, and in a
separate reaction, with a
second primer that contained the recognition site for BsmF I. Four fill in
reactions are shown for
each PCR product; each reaction contained one fluorescently labeled
nucleotide, ddGTP, ddATP,
ddTTP, or ddCTP, and unlabeled ddNTPs. The 5' overhang generated by digestion
with BceA I
and with BsmF I and the expected nucleotides are indicated.
FIG. 9C. Sequence analysis of SNP TSC0264580 after amplification with a second
primer
that contained the recognition site for BsmF I. Four fill in reactions are
shown; each reaction
contained one fluorescently labeled nucleotide, which was ddGTP, ddATP, ddTTP,
or ddCTP and
unlabeled ddNTPs. Two different 5' overhangs are depicted: one represents the
DNA molecules
that were cut 11 nucleotides away on the sense strand and 15 nucleotides away
on the antisense
strand and the other represents the DNA molecules that were cut 10 nucleotides
away on the sense
19
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
strand and 14 nucleotides away on the antisense strand. The expected
nucleotides also are
indicated.
FIG. 9D. Sequence analysis of SNP HC21500027 amplified with a second primer
that
contained the recognition site for BsmF I. A mixture of labeled ddNTPs and
unlabeled dNTPs was
used to fill in the 5' overhang generated by digestion with BsmF I. Two
different 5' overhangs are
depicted: one represents the DNA molecules that were cut 11 nucleotides away
on the sense strand
and 15 nucleotides away on the antisense strand and the other represents the
DNA molecules that
were cut 10 nucleotides away on the sense strand and 14 nucleotides away on
the antisense strand.
The nucleotide upstream from the SNP, the nucleotide at the SNP site (the
sample contained DNA
templates from 36 individuals; both nucleotides would be expected to be
represented in the sample),
and the three nucleotides downstream of the SNP are indicated.
FIG. 10. Sequence analysis of multiple SNPs. SNPs HC21500131, and HC21500027,
which are located on chromosome 21, and SNPs TSC0087315, SNP TSC0214366, SNP
TSC0413944, and SNP TSC0095512, which are on chromosome 1, were amplified in
separate PCR
reactions with second primers that contained a recognition site for BsmF I.
The primers were
designed so that each amplified locus of interest was of a different size.
After amplification, the
reactions were pooled into a single sample, and all subsequent steps of the
method performed (as
described for FIGS. 1F-lI) on that sample. Each SNP and the nucleotide found
at each SNP are
indicated.
FIG. 11. Quantification of the percentage of fetal DNA in maternal blood.
Blood was
obtained from a pregnant human female with informed consent. DNA was isolated
and serial
dilutions were made to determine the percentage of fetal DNA present in the
sample. The SRY
gene, which is located on chromosome Y, was used to detect fetal DNA. The
cystic fibrosis gene,
which is located on chromosome 7, was used to detect both maternal and fetal
DNA.
FIG. 11 A. Amplification of the SRY gene and the cystic fibrosis gene using a
DNA
template isolated from a blood sample that was treated with EDTA.
FIG. 11B. Amplification of the SRY gene and the cystic fibrosis gene using a
DNA
template that was isolated from a blood sample that was treated with formalin
and EDTA.
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
FIG. 12. Genetic analysis ~'of an individual previously genotyped with Trisomy
21 (Down's
Syndrome). Blood was collected, with informed consent, from an individual who
had previously
been genotyped with trisomy 21. DNA was isolated and two SNPs on chromosome 21
and two
SNPs on chromosome 13 were genotyped. As shown in the photograph of the gel,
the SNPs at
chromosome 21 show disproportionate ratios of the two nucleotides. Visual
inspection of the gel
demonstrates that one nucleotide of the two nucleotides at the SNP sites
analyzed for chromosome
21 is of greater intensity, suggesting it is not present in a 50:50 ratio.
However, visual inspection of
the gel suggests that the nucleotides at the heterozygous SNP sites analyzed
on chromosome 13 are
present in the expected 50:50 ratio.
FIG. 13. Sequence determination of both alleles of SNPs TSC0837969,
TSC0034767,
TSC1130902, TSC0597888, TSC0195492, TSC0607185 using one fluorescently labeled
nucleotide. Labeled ddGTP was used in the presence of unlabeled dATP, dCTP,
dTTP to fill-in the
overhang generated by digestion with BsmF I. The nucleotide preceding the
variable site on the
strand that was filled-in was not guanine, and the nucleotide after the
variable site on the' strand that
was filled in was not guanine. The nucleotide two bases after the variable
site on the strand that
was filled-in was guanine. Alleles that contain guanine at variable site are
filled in with labeled
ddGTP. Alleles that do not contain guanine are filled in with unlabeled dATP,
dCTP, or dTTP, and
the polymerase continues to incorporate nucleotides until labeled ddGTP is
filled in at position 3
complementary to the overhang.
FIG. 14. Identification of SNPs with alleles that are variable within the
population. The
sequences of both alleles of seven SNPs located on chromosome 13 were
determined using a
template DNA comprised of DNA obtained from two hundred and forty five
individuals. Labeled
ddGTP was used in the presence of unlabeled dATP, dCTP, dTTP to fill-in the
overhang generated
by digestion with BsmF I. The nucleotide preceding the variable site on the
strand that was filled-in
was not guanine, and the nucleotide after the variable site on the strand that
was filled in was not
guanine. The nucleotide two bases after the variable site on the strand that
was filled-in was
guanine. Alleles that contain guanine at variable site are filled in with
labeled ddGTP. Alleles that
do not contain guanine are filled in with unlabeled dATP, dCTP, or dTTP, and
the polymerase
continues to incorporate nucleotides until labeled ddGTP is filled in at
position 3 complementary to
the overhang.
FIG. 15. Determination of the ratio for one allele to the other allele at
heterozygous SNPs.
The observed nucleotides for SNP TSC0607185 are cytosine (referred to as
allele 1) and thymidine
21
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
(referred to as allele 2) on the sense strand. The ratio of allele 2 to allele
1 was calculated using
template DNA isolated from five individuals. The ratio of allele 2 to allele 1
(allele 2 / allele 1) was
consistently 1:1.
The observed nucleotides for SNP TSC1130902 are guanine (referred to as allele
1) and
adenine (referred to as allele 2) on the sense strand. The ratio of allele 2
to allele 1 was calculated
using template DNA isolated from five individuals. The ratio of allele 2 to
allele 1 (allele 2 /
allelel) was consistently 75:25.
FIG. 16. The percentage of allele 2 to allele 1 at SNP TSC0108992 remains
linear when
calculated on template DNA containing an extra copy of chromosome 21. SNP
TSC0108992 was
amplified using template DNA from four individuals, and two separate fill-in
reactions (labeled as
A and B) were performed for each PCR reaction (labeled 1 through 4). The
calculated percentage
of allele 2 to allele 1 on template DNA from normal individuals was 0.47. The
deviation from the
theoretically predicted percentage of 0.50 remained linear on template DNA
isolated from an
individual with Down's syndrome.
FIG. 17A. Analysis of a SNP located on chromosome 21 from template DNA
isolated
from an individual with a normal genetic karyotype. SNP TSC0108992 was
amplified using the
methods described herein, and after digestion with the type IIS restriction
enzyme BsmF I, the 5'
overhang was filled in using labeled ddTTP, and unlabeled dATP, dCTP, and
dGTP. Three
separate PCR reactions were performed, and each PCR reaction was split into
two samples. The
percentage of allele 2 at the SNP site (allele 2 / (allele 2 + allele 1)) was
calculated, which resulted
in mean of 0.50.
FIG 17B. Analysis of a SNP located on chromosome 21 from template DNA isolated
from
an individual with a trisomy 21 genetic karyotype. SNP TSC0108992 was
amplified using the
methods described herein, and after digestion with the type IIS restriction
enzyme BsmF I, the 5'
overhang was filled in using labeled ddTTP, and unlabeled dATP, dCTP, and
dGTP. Three
separate PCR reactions were performed, and each PCR reaction was split into
two samples. The
percentage of allele 2 at the SNP site (allele 2 / (allele 2 + allele 1)) was
calculated, which resulted
in mean of 0.30.
FIG. 17C. Analysis of a SNP located on chromosome 21 from a mixture comprised
of
template DNA from an individual with Trisomy 21, and template DNA from an
individual with a
normal genetic karyotype in a ratio of 3:1 (Trisomy 21: Normal). SNP
TSC0108992 was amplified
22
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
from the mixture of template DNA using the methods described herein, and after
digestion with the
type IIS restriction enzyme BsmF I, the 5' overhang was filled in using
labeled ddTTP, and
unlabeled dATP, dCTP, and dGTP. Three separate PCR reactions were performed,
and each PCR
reaction was split into two samples. The percentage of allele 2 at the SNP
site (allele 2 / (allele 2 +
allele 1)) was calculated, which resulted in mean of 0.319.
FIG. 17D. Analysis of a SNP located on chromosome 21 from a mixture comprised
of
template DNA from an individual with Trisomy 21, and template DNA from an
individual with a
normal genetic karyotype in a ratio of 1:1 (Trisomy 21: Normal). SNP
TSC0108992 was amplified
from the mixture of template DNA using the methods described herein, and after
digestion with the
type IIS restriction enzyme BsmF I, the 5' overhang was filled in using
labeled ddTTP, and
unlabeled dATP, dCTP, and dGTP. Three separate PCR reactions were performed,
and each PCR
reaction was split into two samples. The percentage of allele 2 at the SNP
site (allele 2 / (allele 2 +
allele 1)) was calculated, which resulted in mean of 0.352.
FIG. 17E. Analysis of a SNP located on chromosome 21 from a mixture comprised
of
template DNA from an individual with Trisomy 21, and template DNA from an
individual with a
normal genetic karyotype in a ratio of 1:2.3 (Trisomy 21: Normal). SNP
TSC0108992 was
amplified from the mixture of template DNA using the methods described herein,
and after
digestion with the type IIS restriction enzyme BsmF I, the 5' overhang was
filled in using labeled
ddTTP, and unlabeled dATP, dCTP, and dGTP. Three separate PCR reactions were
performed, and
each PCR reaction was split into two samples. The percentage of allele 2 at
the SNP site (allele 2 /
(allele 2 + allele 1)) was calculated, which resulted in mean of 0.382.
FIG. 17F. Analysis of a SNP located on chromosome 21 from a mixture comprised
of
template DNA from an individual with Trisomy 21, and template DNA from an
individual with a
normal genetic karyotype in a ratio of 1:4 (Trisomy 21: Normal). SNP
TSC0108992 was amplified
from the mixture of template DNA using the methods described herein, and after
digestion with the
type IIS restriction enzyme BsmF I, the 5' overhang was filled in using
labeled ddTTP, and
unlabeled dATP, dCTP, and dGTP. Three separate PCR reactions were performed,
and each PCR
reaction was split into two samples. The percentage of allele 2 at the SNP
site (allele 2 / (allele 2 +
allele 1)) was calculated, which resulted in mean of 0.397.
FIG. 18A. Agarose gel analysis of nine (9) SNPs amplified from template DNA.
Each of
the nine SNPs were amplified from genomic DNA using the methods described
herein. Lane 1
23
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
corresponds to SNP TSC0397235, lane 2 corresponds to TSC0470003, lane 3
corresponds to
TSC1649726, lane 4 corresponds to TSC1261039, lane 5 corresponds to
TSC0310507, lane 6
corresponds to TSC1650432, lane 7 corresponds to TSC1335008, lane 8
corresponds to
TSC0128307, and lane 9 corresponds to TSC0259757.
FIG. 18B. The original template DNA was amplified using 12 base primers that
annealed
to various regions on chromosome 13. One hundred different primer sets were
used to amplify
regions throughout chromosome 13. For each of the nine SNPs, a primer that
annealed
approximately 130 bases from the locus of interest and 130 bases downstream of
the locus of
interest were used. This amplification reaction, which contained a total of
100 different primer sets,
was used to amplify the regions containing the loci of interest. The resulting
PCR product was used
in a subsequent PCR reaction, wherein each of the nine SNPs were individually
amplified using a
first primer and a second primer, wherein the second primer contained the
binding site for the type
Its restriction enzyme BsmF I. SNPs were loaded in the same order as FIG. 18A.
FIG. 19A. Quantification of the percentage of allele 2 to allele 1 for SNP
TSC047003 on
original template DNA (IA) and multiplexed template DNA (M1-M3), wherein the
DNA was first
amplified using 12 base primers that annealed 150 bases upstream and
downstream of the loci of
interest. Then, three separate PCR reactions were performed on the multiplexed
template DNA,
using a first and second primer.
FIG. 19B. Quantification of the percentage of allele 2 to allele 1 for SNP
TSC1261039 on
original template DNA (IA) and multiplexed template DNA (M1-M3), wherein the
DNA was first
amplified using 12 base primers that annealed 150 bases upstream and
downstream of the loci of
interest. Then, three separate PCR reactions were performed on the multiplexed
template DNA,
using a first and second primer.
FIG. 19C. Quantification of the percentage of allele 2 to allele 1 for SNP
TSC310507 on
original template DNA (IA) and multiplexed template DNA (Ml-M3), wherein the
DNA was first
amplified using 12 base primers that annealed 150 bases upstream and
downstream of the loci of
interest. Then, three separate PCR reactions were performed on the multiplexed
template DNA,
using a first and second primer.
FIG. 19D. Quantification of the percentage of allele 2 to allele 1 for SNP
TSC1335008 on
original template DNA (IA) and multiplexed template DNA (M1-M3), wherein the
DNA was first
amplified using 12 base primers that annealed 150 bases upstream and
downstream of the loci of
24
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
interest. Then, three separate PCR reactions were performed on the multiplexed
template DNA,
using a first and second primer.
FIG. 20. Detection of fetal DNA from plasma DNA isolated from a pregnant
female. Four
SNPs wherein the maternal DNA was homozygous were analyzed on the plasma DNA.
The
maternal DNA was homozygous for adenine at TSC0838335 (lane 1), while the
plasma DNA
displayed a heterozygous pattern (lane 2). The guanine allele represented the
fetal DNA, which was
clearly distinguished from the maternal signal. Both the maternal DNA and the
plasma DNA were
homozygous for adenine at TSC0418134 (lanes 3 and 4). The maternal DNA was
homozygous for
guanine at TSC0129188 (lane 5), while the plasma DNA displayed a heterozygous
pattern (lane 6).
The adenine allele represented the fetal DNA. Both the maternal DNA and the
plasma DNA were
homozygous for adenine at TSC0501389 (lanes 7 and 8).
DETAILED DESCRIPTION OF THE INVENTION
The present invention provides a method for detecting genetic disorders,
including but not
limited to mutations, insertions, deletions, and chromosomal abnormalities,
and is especially useful
for the detection of genetic disorders of a fetus. The method is especially
useful for detection of a
translocation, addition, amplification, transversion, inversion, aneuploidy,
polyploidy, monosomy,
trisomy, trisomy 21, trisomy 13, trisomy 14, trisomy 15, trisomy 16, trisomy
18, trisomy 22,
triploidy, tetraploidy, and sex chromosome abnormalities including but not
limited to XO, XXY,
XYY, and XXX. The method also provides a non-invasive technique for
determining the sequence
of fetal DNA and identifying mutations within the fetal DNA.
The invention is directed to a method for detecting chromosomal abnormalities,
the method
comprising: (a) determining the sequence of alleles of a locus of interest on
a template DNA; and
(b) quantitating a ratio for the alleles at a heterozygous locus of interest
that was identified from the
locus of interest of (a), wherein said ratio indicates the presence or absence
of a chromosomal
abnormality.
In another embodiment, the present invention provides a non-invasive method
for
determining the sequence of a locus of interest on fetal DNA, said method
comprising: (a) obtaining
a sample from a pregnant female; (b) adding a cell lysis inhibitor, cell
membrane stabilizer or cross-
linker to the sample of (a); (c) obtaining template DNA from the sample of
(b), wherein said
template DNA comprises fetal DNA and maternal DNA; and (d) determining the
sequence of a
locus of interest on template DNA.
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
In another emobodiment, th present invention is directed to a method for
isolating DNA,
said method comprising (a) obtaining a sample containing nucleic acid; (b)
adding a cell lysis
inhibitor, cell membrane stabilizer or cross-linker to sample of (a); and (c)
isolating the DNA.
In another emobodiment, th present invention is directed to a method for
isolating free
DNA, said method comprising (a) obtaining a sample containing nucleic acid;
(b) adding a cell lysis
inhibitor, cell membrane stabilizer or cross-linker to sample of (a); and (c)
isolating the DNA.
In another embodiment, the present invention is directed to a method for
isolating free
DNA from a sample containing nucleic acid to which a cell lysis inhibitor,
cell membrane stabilizer
or cross-linker has been added, said method cormprising isolating the DNA.
In another emobodiment, the present invention is directed to a method for
isolating free
fetal DNA, said method comprising (a) obtaining a sample containing nucleic
acid; (b) adding a cell
lysis inhibitor, cell membrane stabilizer or cross-linker to sample of (a);
and (c) isolating the DNA.
In another embodiment, the DNA is isolated using any technique suitable in the
art including but
not limited to cesium chloride gradients, gradients, sucrose gradients,
glucose gradients,
centrifugation protocols, boiling, Qiagen purification systems, QIA DNA blood
purification kit,
HiSpeed Plasmid Maxi Kit, QIAfilter plasmid kit, Promega DNA purification
systems, MangeSil
Paramagnetic Particle based systems, Wizard SV technology, Wizard Genomic DNA
purification
kit, Amersham purification systems, GFX Genomic Blood DNA purification kit,
Invitrogen Life
Technologies Purification Systems, CONCERT purification system, Mo Bio
Laboratories
purification systems, UltraClean BloodSpin Kits, and UlraClean Blood DNA Kit.
In another emobodiment, the present invention is directed to a method for
isolating free
fetal DNA from a sample containing nucleic acid to which a cell lysis
inhibitor, cell membrane
stabilizer or cross-linker has been added, said method comprising isolating
the DNA. In a preferred
embodiment, the free fetal DNA is isolated from plasma or serum obtained from
the blood of a
pregnant female.
In another embodiment, the DNA is isolated using techniques and/or protocols
that
substantially reduce the amount of maternal DNA in the sample including but
not limited to
centrifuging the samples, with the braking power for the centrifuge set to
zero (the brake on the
centrifuge is not used), transferring the supernatant to a new tube with
minimal or no disturbance of
the "buffy-coat," and transferring only a portion of the supernatant to a new
tube. In a preferred
embodiment, both acceleration power and braking power for the centrifuge are
set to zero.
In another embodiment, the DNA is isolated using techniques and/or protocols
that
substantially reduce the amount of maternal DNA in the sample including but
not limited to
centrifuging the samples, with the acceleration power for the centrifuge set
to zero, transferring the
26
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
supernatant to a new tube with minimal or no disturbance of the "huffy-coat,"
and transferring only
a portion of the supernatant to a new tube.
In another embodiment, the "huffy-coat" is removed from the tube prior to
removal of the
supernatant using any applicable method including but not limited to using a
syringe or needle to
withdraw the "huffy-coat."
In another embodiment, the braking power for the centrifuge is set at a
percentage including
but not limited to 1-5%, 5-10%, 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-
70%, 70-80%, 80-
90%, 90-95%, 95-99% of maximum braking power.
In another embodiment, the acceleration power for the centrifuge is set at a
percentage
including but not limited to 1-5%, 5-10%, 10-20%, 20-30%, 30-40%, 40-50%, 50-
60%, 60-70%,
70-80%, 80-90%,. 90-95%, 95-99% of maximum acceleration power.
In another embodiment, the present invention is directed to a composition
comprising free.
fetal DNA and free maternal DNA, wherein the composition comprises a
relationship of free fetal
DNA to free maternal DNA including but not limited to at least about 15% free
fetal DNA, at least
about 20% free fetal DNA, at least about 30% free fetal DNA, at least about
40% free fetal DNA,.at
least about 50% free fetal DNA, at least about 60% free fetal DNA, at least
about 70% free fetal
DNA, at least about 80% free fetal DNA, at least about 90% free fetal DNA, at
least about 91% free
fetal DNA, at least about 92% free fetal DNA, at least about 93% free fetal
DNA, at least about
94% free fetal DNA, at least about 95% free fetal DNA, at least about 96% free
fetal DNA, at least
about 97°lo free fetal DNA, at least about 98% free fetal DNA, at least
about 99% free fetal DNA,
and at least about 99.5% free fetal DNA.
In another embodiment, the present invention is directed to a method of using
a
composition comprising free fetal DNA and free maternal DNA for prenatal
diagnostics, wherein
the composition comprises a relationship of free fetal 'DNA to free maternal
DNA including but not
limited to at least about 15% free fetal DNA, at least about 20% free fetal
DNA, at least about 30%
free fetal DNA, at least about 40% free fetal DNA, at least about 50% free
fetal DNA, at least about
60% free fetal DNA, at least about 70% free fetal DNA, at least about 80% free
fetal DNA, at least
about 90% free fetal DNA, at least about 91% free fetal DNA, at least about
92% free fetal DNA, at
least about 93% free fetal DNA, at least about 94% free fetal DNA, at least
about 95% free fetal
DNA, at least about 96% free fetal DNA, at least about 97% free fetal DNA, at
least about 98% free
fetal DNA, at least about 99% free fetal DNA, and at least about 99.5% free
fetal DNA.
In another embodiment, the present invention is directed to a composition
comprising free
fetal DNA and free maternal DNA , wherein the composition comprises a
relationship of free fetal
DNA to free maternal DNA including but not limited to about 13-15% free fetal
DNA, about 15-
16% free fetal DNA, about 16-17% free fetal DNA, about 17-18% free fetal DNA,
about 18-19%
27
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
free fetal DNA, about 19-20% free fetal DNA, about 20-21% free fetal DNA,
about 21-22% free
fetal DNA, about 22-23% free fetal DNA, about 23-24% free fetal DNA, about 24-
25% free fetal
DNA, about 25-35% free fetal DNA, about 35-45% free fetal DNA, about 45-55%
free fetal DNA,
about 55-65% free fetal DNA, about 65-75% free fetal DNA, about 75-85% free
fetal DNA, about
85-90% free fetal DNA, about 90-91% free fetal DNA, about 91-92% free fetal
DNA, about 92-
93% free fetal DNA, about 93-94% free fetal DNA, about 94-95% free fetal DNA,
about 95-96%
free fetal DNA, about 96-97% free fetal DNA, about 97-98% free fetal DNA,
about 98-99% free
fetal DNA, and about 99-99.7% free fetal DNA.
In another embodiment, the present invention is directed to a method of using
a
composition comprising free fetal DNA and free maternal DNA for prenatal
diagnostics, wherein
the composition comprises a relationship of free fetal DNA to free maternal
DNA including but not
limited to about 13-15% free fetal DNA, about 15-16% free fetal DNA, about 16-
17% free fetal
DNA, about 17-18% free fetal DNA, about 18-19% free fetal DNA, about 19-20%
free fetal DNA,
about 20-21% free fetal DNA, about 21-22% free fetal DNA, about 22-23% free
fetal DNA, about ,
23-24% free fetal DNA, about 24-25% free fetal DNA, about 25-35% free fetal
DNA, about 35-
45% free fetal DNA, about 45-55% free fetal DNA, about 55-65% free fetal DNA,
about 65-75%
free fetal DNA, about 75-85% free fetal DNA, about 85-90% free fetal DNA,
about 90-91% free
fetal DNA, about 91-92% free fetal DNA, about 92-93% free fetal DNA, about 93-
94% free fetal
DNA, about 94-95% free fetal DNA, about 95-96% free fetal DNA, about 96-97%
free fetal DNA,
about 97-98% free fetal DNA, about 98-99% free fetal DNA, or about 99-99.7%
free fetal DNA.
In another embodiment, the present invention is directed to a composition
comprising free
fetal DNA and free maternal DNA, wherein the composition comprises a
relationship of free fetal
DNA to free maternal DNA including but not limited a maximum of 13%-15% free
fetal DNA, a
maximum of 15-18% free fetal DNA, a maximum of l8-20% free fetal DNA, a
maximum of 20-
40% free fetal DNA, a maximum of 40-50% free fetal DNA, a maximum of 50-60%
free fetal
DNA, a maximum of 60-70% free fetal DNA, a maximum of 70-80% free fetal DNA, a
maximum
of 80-90% free fetal DNA, a maxium of 90-92% free fetal DNA, a maxium of 92-
94% free fetal
DNA, a maximum of 94-95% free fetal DNA, a maxium of 95-96% free fetal DNA, a
maxium of
96-97% free fetal DNA, a maxium of 97-98% free fetal DNA, a maximum of 98-99%
free fetal
DNA, a maxium of 99-99.5% free fetal DNA, and a maxium of 99.5-99.9% free
fetal DNA.
In another embodiment, the present invention is directed to a method of using
a
composition comprising free fetal DNA and free maternal DNA for prenatal
diagnostics, wherein
the composition comprises a relationship of free fetal DNA to free maternal
DNA including but not
limited a maximum of 13%-15% free fetal DNA, a maximum of 15-18% free fetal
DNA, a
maximum of 18-20% free fetal DNA, a maximum of 20-40% free fetal DNA, a
maximum of 40-
28
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
50% free fetal DNA, a maximum of 50-60% free fetal DNA, a maximum of 60-70%
free fetal
DNA, a maximum of 70-80% free fetal DNA, a maximum of 80-90% free fetal DNA, a
maxium of
90-92% free fetal DNA, a maxium of 92-94% free fetal DNA, a maximum of 94-95%
free fetal
DNA, a maxium of 95-96% free fetal DNA, a maxium of 96-97% free fetal DNA, a
maxium of 97-
98% free fetal DNA, a maximum of 98-99% free fetal DNA, a maxium of 99-99.5%
free fetal
DNA, and a maxium of 99.5-99.9% free fetal DNA.
DNA Template
By a "locus of interest" is intended a selected region of nucleic acid that is
within a larger
region of nucleic acid. A locus of interest can include but is not limited to
1-100, 1-50, 1-20, or
1-10 nucleotides, preferably 1-6, 1-5, 1-4, 1-3, 1-2, or 1 nucleotide(s).
As used herein, an "allele" is one of several alternate forms of a gene or non-
coding regions
of DNA that occupy the same position on a chromosome. The term allele can be
used to describe
DNA from any organism including but not limited to bacteria, viruses, fungi,
protozoa, molds,
yeasts, plants, humans, non-humans, animals, and archeabacteria.
For example, bacteria typically have one large strand of DNA. The term allele
with respect
to bacterial DNA refers to the form of a gene found in one cell as compared to
the form of the same
r
gene in a different bacterial cell of the same species.
Alleles can have the identical sequence or can vary by a single nucleotide or
more than one
20' nucleotide. With regard to organisms that have two copies of each
chromosome, if both
chromosomes have the same allele, the condition is referred to as homozygous.
If the alleles at the
two chromosomes are different, the condition is referred to as heterozygous.
For example, if the
locus of interest is SNP X on chromosome l, and the maternal chromosome
contains an adenine at
SNP X (A allele) and the paternal chromosome contains a guanine at SNP X (G
allele), the
individual is heterozygous at SNP X.
As used herein, sequence means the identity of one nucleotide or more than one
contiguous
nucleotides in a polynucleotide. In the case of a single nucleotide, e.g., a
SNP, "sequence" and
"identity" are used interchangeably herein.
The term "chromosomal abnormality" refers to a deviation between the structure
of the
subject chromosome and a normal homologous chromosome. The term "normal"
refers to the
predominate karyotype or banding pattern found in healthy individuals of a
particular species. A
chromosomal abnormality can be numerical or structural, and includes but is
not limited to
aneuploidy, polyploidy, inversion, a trisomy, a monosomy, duplication,
deletion, deletion of a part
of a chromosome, addition, addition of a part of chromosome, insertion, a
fragment of a
chromosome, a region of a chromosome, chromosomal rearrangement, and
translocation. A
29
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
chromosomal abnormality can be correlated with presence of a pathological
condition or with a
predisposition to develop a pathological condition. As defined herein, a
single nucleotide
polymorphism ("SNP") is not a chromosomal abnormality.
As used herein, incorporation of a nucleotide by a polymerase is referred to
as an
elongation reaction or a fill-in reaction interchangeably.
As used herein with respect to individuals, "mutant alleles" refers to variant
alleles that are
associated with a disease state.
The term "template" refers to any nucleic acid molecule that can be used for
amplification
in the invention. RNA or DNA that is not naturally double stranded can be made
into double
stranded DNA so as to be used as template DNA. Any double stranded DNA or
preparation
containing multiple, different double stranded DNA molecules can ~be used as
template DNA to
amplify a locus or loci of interest contained in the template DNA.
The template DNA can be obtained from any source including but not limited to
humans,
non-humans, mammals, reptiles, cattle, cats, dogs, goats, swine, pigs,
monkeys, apes, gorillas, bulls,
cows, bears, horses, sheep, poultry, mice, rats, fish, dolphins, whales, and
sharks.
The template DNA can be from any appropriate sample including but not limited
to, nucleic
acid-containing samples of tissue, bodily fluid (for example, blood, serum,
plasma, saliva, urine,
tears, peritoneal fluid, ascitic fluid, vaginal secretion, breast fluid,
breast milk, lymph fluid,
cerebrospinal fluid or mucosa secretion), umbilical cord blood, chorionic
villi, amniotic fluid, an
embryo, a two-celled embryo, a four-celled embryo, an eight-celled embryo, a
16-celled embryo, a
32- celled embryo, a 64-celled embryo, a 128-celled embryo, a 256-celled
embryo, a 512-celled
embryo, a 1024-celled embryo, embryonic tissues, lymph fluid, cerebrospinal
fluid, mucosa
secretion, or other body exudate, fecal matter, an individual cell or extract
of the such sources that
contain the nucleic acid of the same, and subcellular structures such as
mitochondria, using
protocols well established within the art.
In one embodiment, the template DNA can be obtained from a sample of a
pregnant female.
In another embodiment, the template DNA can be obtained from an embryo. In a
preferred
embodiment, the template DNA can be obtained from a single-cell of an embryo.
In one embodiment, the template DNA is fetal DNA. Fetal DNA can be obtained
from
sources including but not limited to maternal blood, maternal serum, maternal
plasma, fetal cells,
umbilical cord blood, chorionic villi, amniotic fluid, urine, saliva, cells or
tissues.
In another embodiment, a cell lysis inhibitor is added to the sample including
but not
limited to formaldehyde, formaldehyde derivatives, formalin, glutaraldehyde,
glutaraldehyde
derivatives, primary amine reactive crosslinkers, sulflrydryl reactive
crosslinkers, sulfhydryl
addition or disulfide reduction, carbohydrate reactive crosslinkers, carboxyl
reactive crosslinkers,
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
photoreactive crosslinkers, cleavable crosslinkers, AEDP, APG, BASED,
BM(PEO)3, BM(PEO)4,
BMB, BMDB, BMH, BMOE, BS3, BSOCOES, DFDNB, DMA, DMP, DMS, DPDPB, DSG, DSP,
DSS, DST, DTBP, DTME, DTSSP, EGS, HBVS, sulfo-BSOCOES, Sulfo-DST, Sulfo-EGS or
compounds listed in Table XXIII. In another embodiment, two, three, four, five
or more than five
cell lysis inhibitors can be added to the sample. In a preferred embodiment,
formalin is present in
the sample at a percentage including but not limited to 0.0001-0.03%, 0.03-
0.05%, 0.05-0.08%,
0.08-0.1%, 0.1-0.3%, 0.3-0.5%, 0.5-0.7%, 0.7-0.9%, 0.9-1.2%, 1.2-1.5%, 1.5-2%,
2-3%, 3-5%, and
greater than 5%. In another embodiment, any combination of cross-linker, cell
membrane
stabilizer, or cell lysis inhibitor can be added to the sample including but
not limited to a cross-
linker and a cell membrane stabilizer, a cross-linker and a cell lysis
inhibitor, and a cell membrane
stabilizer and a cell lysis inhibitor. More than one cross-linker can be used
with more than one cell
membrane stabilizer. More than one cross-linker can be used with more than one
cell lysis
inhibitor. More than one cell membrane stabilizer can be used with more than
cell lysis inhibitor.
In another embodiment, the cell lysis inhibitor is added to the sample such
that lysis is less
than about 10% of the cells. In a preferred embodiment, the cell lysis
inhibitor is added to the
sample such that lysis is less than about 5% of the cells. In a most preferred
embodiment, the cell
lysis inhibitor is added to the sample such that lysis is less than about 1 %
of the cells.
In another embodiment, a cell membrane stabilizer is added to the sample such
that lysis is
less than about 10% of the cells. In a preferred embodiment, the cell membrane
stabilizer is added
to the sample such that lysis is less than about 5% of the cells. In a most
preferred embodiment, the
cell membrane stabilizer is added to the sample such that lysis is less than
about 1 % of the cells.
In another embodiment, a cross-linker is added to the sample such that lysis
is less than
about 10% of the cells. In a preferred embodiment, the cross-linker is added
to the sample such that
lysis is less than about 5% of the cells. In a most preferred embodiment, the
cross-linker is added to
the sample such that lysis is less than about 1% of the cells.
In another embodiment, the cell lysis inhibitor, cross-linker or cell membrane
stabilizer is
added to the sample in an applicable time period including but not limited to
1-10 seconds, 10-30
seconds, 30-60 seconds,l-5 minutes, 5-10 minutes, 10-20 minutes, 20-30
minutes, 30-40 minutes,
40-50 minutes, 60-90 minutes, 90-180 minutes or greater than 180 minutes after
collection of the
sample. In another embodiment, the cell lysis inhibitor, cross-linker, or cell
membrane stabilizer is
present in the apparatus to which the sample is collected including but not
limited to a glass tube, a
plastic tube, a circular container, an eppendorf tube, an IV bag, or any other
appropriate collection
device. In another embodiment, after the addition of the cell lysis inhibitor,
cell membrane
stabilizer, or cross-linker, the sample is left at about room temperature for
the period of time to
31
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
allow the reagent to function, including but not limited to 1-5, 5-10, 10-20,
20-40, 40-60, 60-90, 90-
120, 120-150, 150-180, 180-240, 240-300 or greater than 300 minutes.
In another embodiment, the template DNA contains both maternal DNA and fetal
DNA. In
a preferred embodiment, template DNA is obtained from blood of a pregnant
female. Blood is
collected using any standard technique for blood-drawing including but not
limited to venipuncture.
For example, blood can be drawn from a vein from the inside of the elbow or
the back of the hand.
Blood samples can be collected from a pregnant female at any time during fetal
gestation. For
example, blood samples can be collected from human females at 1-4, 4-8, 8-12,
12-16, 16-20,
20-24, 24-28, 28-32, 32-36, 36-40, or 40-44 weeks of fetal gestation, and
preferably between 8-28
weeks of fetal gestation.
The blood sample is centrifuged to separate the plasma from the maternal
cells. The
plasma and maternal cell fractions are transferred to separate tubes and re-
centrifuged. The plasma
fraction contains cell-free fetal DNA and maternal DNA. Any standard DNA
isolation technique
can be used to isolate the fetal DNA and the maternal DNA including but not
limited to QIAamp
DNA Blood Midi Kit supplied by QIAGEN (Catalog number 51183).
In a preferred embodiment, blood can be collected into an apparatus containing
a
magnesium chelator including but not limited to EDTA, and is stored at
4°C. Optionally, a calcium
chelator, including but not limited to EGTA, can be added.
In another embodiment, a cell lysis inhibitor is added to the maternal blood
including but
not limited to formaldehyde, formaldehyde derivatives, formalin,
glutaraldehyde, glutaraldehyde
derivatives, a protein cross-linker, a nucleic acid cross-linker, a protein
and nucleic acid cross-
linker, primary amine reactive crosslinkers, sulflrydryl reactive
crosslinkers, sulfydryl addition or
disulfide reduction, carbohydrate reactive crosslinkers, carboxyl reactive
crosslinkers, photoreactive
crosslinkers, cleavable crosslinkers, AEDP, APG, BASED, BM(PEO)3, BM(PEO)4,
BMB, BMDB, .
BMH, BMOE, BS3, BSOCOES, DFDNB, DMA, DMP, DMS, DPDPB, DSG, DSP, DSS, DST,
DTBP, DTME, DTSSP, EGS, HBVS, sulfo-BSOCOES, Sulfo-DST, Sulfo-EGS, or
compounds
listed in Table XXIII.
In another embodiment, an agent that stabilizes cell membranes may be added to
the
maternal blood samples to reduce maternal cell lysis including but not limited
to aldehydes, urea
formaldehyde, phenol formaldehyde, DMAE (dimethylaminoethanol), cholesterol,
cholesterol
derivatives, high concentrations of magnesium, vitamin E, and vitamin E
derivatives, calcium,
calcium gluconate, taurine, niacin, hydroxylamine derivatives, bimoclomol,
sucrose, astaxanthin,
glucose, amitriptyline, isomer A hopane tetral phenylacetate, isomer B hopane
tetral phenylacetate,
citicoline, inositol, vitamin B, vitamin B complex, cholesterol hemisuccinate,
sorbitol, calcium,
coenzyme Q, ubiquinone, vitamin K, vitamin K complex, menaquinone, zonegran,
zinc, ginkgo
32
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
biloba extract, diphenylhydantoin, perftoran, polyvinylpyrrolidone,
phosphatidylserine, tegretol,
PABA, disodium cromglycate, nedocromil sodium, phenytoin, zinc citrate,
mexitil, dilantin, sodium
hyaluronate, or polaxamer 188.
in another embodiment, the template DNA is obtained from the plasma or serum
of the
blood of the pregnant female. The percentage of fetal DNA in maternal plasma
is between
0.39-11.9% (Pertl, and Biazzclzi, Obstetrics and Gynecology 98: 483-490
(2001)). The majority of
the DNA in the plasma sample is maternal, which makes using the DNA for
genotyping the fetus
di~cult. However, methods that increase the percentage of fetal DNA in the
maternal plasma
allow the sequence of the fetal DNA to be determined, and allow for the
detection of genetic
disorders including mutations, insertions, deletions, and chromosomal
abnormalities. The addition
of cell lysis inhibitors, cell membrane stabilizers or cross-linkers to the
maternal blood sample can
increase the relative percentage of fetal DNA. While lysis of both maternal
and fetal cells is
inhibited, the vast majority of cells are maternal; and thus by reducing the
lysis of maternal cells,
there is a relative increase in the percentage of free fetal DNA. See Example
4.
In another embodiment, any blood drawing technique, method, protocol, or
equipment that
reduce the amount of cell lysis can be used, including but not limited to a
large boar needle, a
shorter length needle, a needle coating that increases laminar flow, e.g.,
teflon, a modification of the
bevel of the needle to increase laminar flow, or techniques that reduce the
rate of blood flow. The
fetal cells likely are destroyed in the maternal blood by the mother's immune
system. However, it
is likely that a large portion of the maternal cell lysis occurs as a result
of the blood draw or
processing of the blood sample. Thus, methods that prevent or reduce cell
lysis will reduce the
amount of maternal DNA in the sample, and increase the relative percentage of
free fetal DNA.
W another embodiment, an agent that preserves or stabilizes the structural
integrity of cells
can be used to reduce the amount of cell lysis.
In another embodiment, any protocol that reduces the amount of free maternal
DNA in the
maternal blood can be used prior to obtaining the sample. In another
embodiment, prior to
obtaining the sample, the pregnant female rests without physical activity for
a period of time
including but not limited to 0-5, 5-10, 10-15, 15-20, 20-25, 25-30, 30-35, 35-
40, 40-45, 45-50, 50-
55, 55-60, 60-120, 120-180, 180-240, 240-300, 300-360, 360-420, 420-480, 480-
540, 540-600,
600-660, 660-720, 720-780, 780-840, 840-900, 900-1200, 1200-1500, 1500-1800,
1800-2100,
2100-2400, 2400-2700, 2700-3000, 3000-3300, 3300-3600, 3600-3900, 3900-4200,
4200-4500, and
greater than 4500 minutes. In another embodiment, the sample is obtained from
the pregnant
female after her body has reached a relaxed state. The period of rest prior to
obtaining the sample
may reduce the amount of maternal nucleic acid in the sample. In another
embodiment, the sample
33
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
is obtained from the pregnant female in the a.m., including but not limited to
4-5 am, 5-6 am, 6-7
am, 7-8 am, 8-9 am, 9-10 am, 10-11 am, and 11-12 am.
In another embodiment, the sample is obtained from the pregnant female after
she has slept
for a period of time including but not limited to 0-1, 1-2, 2-3, 3-4, 4-5, 5-
6, 6-7, 7-8, 8-9, 9-10, 10-
1 l, 11-12, or greater than 12 hours.
In another embodiment, prior to obtaining the sample, the pregnant female
exercises for a
period of time followed by a period of rest. In another embodiment, the period
of exercise includes
but is not limited to 0-15, 1S-30, 30-45, 45-60, 60-120, 120-240, or greater
than 240 minutes.
In another embodiment, agents that prevent the destruction of DNA, including
but not
limited to a DNase inhibitor, zinc chloride, ethylenediaminetetraacetic acid,
guanidine-HC 1;
guanidine isothiocyanate, N-lauroylsarcosine, and Na-dodecylsulphate, can be
added to the blood
sample.
In another embodiment, fetal DNA is obtained from a fetal cell, wherein said
fetal cell can
be isolated from sources including but not limited to maternal blood,
umbilical cord blood,
chorionic villi, amniotic fluid, embryonic tissues and mucous obtained from
the cervix or vagina of
the mother.
In a preferred embodiment, fetal cells are isolated from maternal peripheral
blood. An
antibody specific for fetal cells can be used to purify the fetal cells from
the maternal serum
(Mueller et al., Lancet 336: 197-200 (1990); Ganshirt-Ahlert et al., Ana. J.
Obstet. Gynecol. 166:
1350-1355 (1992)). Flow cytometry techniques can also be used to enrich fetal
cells (Herzenberg et
al., PNAS 76: 1453-1455 (1979); Bianchi et al., PNAS 87: 3279-3283 (1990);
Bruch et al., Prenatal
Diagnosis 11: 787-798 (1991)). U.S. Pat. No. 5,432,054 also describes a
technique for separation
of fetal nucleated red blood cells, using a tube having a wide top and a
narrow, capillary bottom
made of polyethylene. Centrifugation using a variable. speed program results
in a stacking of red
blood cells in the capillary based on the density of the molecules. The
density fraction containing
low density red blood cells, including fetal red blood cells, is recovered and
then differentially
hemolyzed to preferentially destroy maternal red blood cells. A density
gradient in a hypertonic
medium is used to separate red blood cells, now enriched in the fetal red
blood cells from
lymphocytes and ruptured maternal cells. The use of a hypertonic solution
shrinks the red blood
cells, which increases their density, and facilitate purification from the
more dense lymphocytes.
After the fetal cells have been isolated, fetal DNA can be purified using
standard techniques in the
art.
The nucleic acid that is to be analyzed can be any nucleic acid, e.g.,
genomic, plasmid,
cosmid, yeast artificial chromosomes, artificial or man-made DNA, including
unique DNA
sequences, and also DNA that has been reverse transcribed from an RNA sample,
such as cDNA.
34
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
The sequence of RNA can be determined according to the invention if it is
capable of being made
into a double stranded DNA form to be used as template DNA.
The terms "primer" and "oligonucleotide primer" are interchangeable when used
to discuss
an oligonucleotide that anneals to a template and can be used to prime the
synthesis of a copy of
that template.
"Amplified" DNA is DNA that has been "copied" once or multiple times, e.g. by
polymerase chain reaction. When a large amount of DNA is available to assay,
such that.a
sufficient number of copies of the locus of interest are akeady present in the
sample to be assayed,
it may not be necessary to "amplify" the DNA of the locus of interest into an
even larger number of
replicate copies. Rather, simply "copying" the template DNA once using a set
of appropriate
primers, which may contain hairpin structures that allow the restriction
enzyme recognition sites to
be double stranded, can suffice.
"Copy" as in "copied DNA" refers to DNA that has been copied once, or DNA that
has
been amplified into more than one copy.
In one embodiment, the nucleic acid is amplified directly in the original
sample containing
the source of nucleic acid. It is not essential that the nucleic acid be
extracted, purified or isolated;
it only needs to be provided in a form that is capable of being amplified.
Hybridization of the
nucleic acid template with primer, prior to amplification, is not required.
For example,
amplification can be performed in a cell or sample lysate using standard
protocols well known in
the art. DNA that is on a solid support, in a fixed biological preparation, or
otherwise in a
composition that contains non-DNA substances and that can be amplified without
first being
extracted from the solid support or fixed preparation or non-DNA substances in
the composition
can be used directly, without further purification, as long as the DNA can
anneal with appropriate
primers, and be copied, especially amplified, and the copied or amplified
products can be recovered
and utilized as described herein.
In a preferred embodiment, the nucleic acid is extracted, purified or isolated
from
non-nucleic acid materials that are in the original sample using methods known
in the art prior to
amplification.
In another embodiment, the nucleic acid is extracted, purified or isolated
from the original
sample containing the source of nucleic acid and prior to amplification, the
nucleic acid is
fragmented using any number of methods well known in the art including but not
limited to
enzymatic digestion, manual shearing, or sonication. For example, the DNA can
be digested with
one or more restriction enzymes that have a recognition site, and especially
an eight base or six base
pair recognition site, which is not present in the loci of interest.
Typically, DNA can be fragmented
to any desired length, including 50, 100, 250, 500, 1,000, 5,000, 10,000,
50,000 and 100,000 base
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
pairs long. In another embodiment, the DNA is fragmented to an average length
of about 1000 to
2000 base pairs. However, it is not necessary that the DNA be fragmented.
Fragments of DNA that contain the loci of interest can be purified from the
fragmented
DNA before amplification. Such fragments can be purified by using primers that
will be used in the
amplification (see "Primer Design" section below) as hooks to retrieve the
loci of interest, based on
the ability of such primers to anneal to the loci of interest. In a preferred
embodiment, tag-modified
primers are used, such as e.g. biotinylated primers.
By purifying the DNA fragments containing the loci of interest, the
specificity of the
amplification reaction can be improved. This will minimize amplification of
nonspecific regions of
the template DNA. Purification of the DNA fragments can also allow multiplex
PCR (Polymerise
Chain Reaction) or amplification of multiple loci of interest with improved
specificity.
The loci of interest that are to be sequenced can be selected based upon
sequence alone. In
humans, over 1.42 million single nucleotide polymorphisms (SNPs) have been
described (Nature
409:928-933 (2001); The SNP Consortium LTD). On the average, there is one SNP
every 1.9 kb of
human genome. However, the distance between loci of interest need not be
considered when
selecting the loci of interest to be sequenced according to the invention. If
more than one locus of
interest on genomic DNA is being analyzed, the selected loci of interest can
be on the same
chromosome or on different chromosomes.
In a preferred embodiment, the selected loci of interest can be clustered to a
particular
region on a chromosome. Multiple loci of interest can be located within a
region of DNA such that
even with any breakage or fragmentation of the DNA, the multiple loci of
interest remain linked.
For example, if the DNA is obtained and by natural forces is broken into
fragments of 5 Kb,
multiple loci of interest can be selected within the 5 Kb regions. This allows
each fragment, as
measured by the loci of interest within that fragments to serve as an
experimental unit, and will
reduce any possible experimental noise of comparing loci of interest on
multiple chromosomes.
The loci of interest on a chromosome can be any distance from each other
including but not
limited to 10-50, 50-100, 100-150, 150-200, 200-250, 250-500, 500-750, 750-
1000, 1000-1500,
1500-2000, 2000-2500, 2500-3000, 3000-3500, 3500-4000, 4000-4500, 4500-5000,
5000-10,000
and greater than 10,000 base pairs.
In a preferred embodiment, the length of sequence that is amplified is
preferably different
for each locus of interest so that the loci of interest can be separated by
size.
In fact, it is an advantage of the invention that primers that copy an entire
gene sequence
need not be utilized. Rather, the copied locus of interest is preferably only
a small part of the total
gene or a small part of a non-coding region of DNA. There is no advantage to
sequencing the entire
gene as this can increase cost and delay results. Sequencing only the desired
bases or loci of
36
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
interest maximizes the overall efficiency of the method because it allows for
the sequence of the
maximum number of loci of interest to be determined in the fastest amount of
time and with
minimal cost.
Because a large number of sequences can be analyzed together, the method of
the invention
is especially amenable to the large-scale screening of a number of loci of
interest.
Any number of loci of interest can be analyzed and processed, especially at
the same time,
using the method of the invention. The samples) can be analyzed to determine
the sequence at one
locus of interest or at multiple loci of interest at the same time. The loci
of interest can be present .
on a single chromosome or on multiple chromosomes.
Alternatively, 2, 3, 4, 5, 6, 7, 8, 9, 10-20, 20-25, 25-30, 30-35, 35-40, 40-
45, 45-50, 50-100,
100-250, 250-500, 500-1,000, 1,000-2,000, 2,000-3, 000, 3,000-5,000, 5,000-
10,000,
10,000-50,000 or more than 50,000 loci of interest can be analyzed at the same
time when a global
genetic screening is desired. Such a global genetic screening might be desired
when using the
method of the invention to provide a genetic fingerprint to identify an
individual or for SNP
genotyping.
The locus of interest to be copied can be within a coding sequence or outside
of a coding v
sequence. Preferably, one or more loci of interest that are to be copied are
within a gene. In a
preferred embodiment, the template DNA that is copied is a locus or loci of
interest that is within a
genomic coding sequence, either intron or exon. In a highly preferred
embodiment, exon DNA
sequences are copied. The loci of interest can be sites where mutations are
known to cause disease
or predispose to a disease state. The loci of interest can be sites of single
nucleotide
polymorphisms. Alternatively, the loci of interest that are to be copied can
be outside of the coding
sequence, for example, in a transcriptional regulatory region, and especially
a promoter, enhancer,
or repressor sequence.
Method for Determining the Sequence of a Locus of Interest
Any method that provides information on the sequence of a nucleic acid can be
used
including but not limited to allele specific PCR, PCR, gel electrophoresis,
ELISA, mass
spectrometry, MALDI-TOF mass spectrometry hybridization, primer extension,
fluorescence
detection, fluorescence resonance energy transfer (FRET), fluorescence
polarization, DNA
sequencing, Sanger dideoxy sequencing, DNA sequencing gels, capillary
electrophoresis on an
automated DNA sequencing machine, microchannel electrophoresis, microarray,
southern blot, slot
blot, dot blot, single primer linear nucleic acid amplification, as described
in U.S. Patent No.
6,251,639, SNP-IT, GeneChips, HuSNP, BeadArray, TaqMan assay, Invader assay,
MassExtend, or
MassCleaveT"~ (hMC) method.
37
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
The preferred method of determining the sequence has previously been described
in U.S.
Application No. 10/093,618, filed on March 11, 2002, hereby incorporated by
reference in its
entirety.
I. Primer Design
Published sequences, including consensus sequences, can be used to design or
select
primers for use in amplification of template DNA. The selection of sequences
to be used for the
construction of primers that flank a locus of interest can be made by
examination of the sequence of
the loci of interest, or immediately thereto. The recently published sequence
of the human genome
provides a source of useful consensus sequence information from which to
design primers to flank a
desired human gene locus of interest.
By "flanking" a locus of interest is meant that the sequences of the primers
are such that at
least a portion of the 3' region of one primer is complementary to the
antisense strand of the
template DNA and upstream from the locus of interest site (forward primer),
and at least a portion
of the 3' region of the other primer is complementary to the sense strand of
the template DNA and
downstream of the locus of interest (reverse primer). A "primer pair" is
intended a pair of forward
and reverse primers. Both primers of a primer pair anneal in a manner that
allows extension of the
primers, such that the extension results in amplifying the template DNA in the
region of the locus of
interest.
Primers can be prepared by a variety of methods including but not limited to
cloning of
appropriate sequences and direct chemical synthesis using methods well known
in the art (Narang
et al., Methods Enzyfnol. 68:90 (1979); Brown et al., Methods Enzymol. 68:109
(1979)). Primers
can also be obtained from commercial sources such as Operon Technologies,
Amersham Pharmacia
Biotech, Sigma, and Life Technologies. The primers can have an identical
melting temperature.
The lengths of the primers can be extended or shortened at the 5' end or the
3' end to produce
primers with desired melting temperatures. In a preferred embodiment, one of
the primers of the
prime pair is longer than the other primer. In a preferred embodiment, the 3'
annealing lengths of
the primers, within a primer pair, differ. Also, the annealing position of
each primer pair can be
designed such that the sequence and length of the primer pairs yield the
desired melting
temperature. The simplest equation for determining the melting temperature of
primers smaller
than 25 base pairs is the Wallace Rule (Td = 2(A+T) + 4(G+C)). Computer
programs can also be
used to design primers, including but not limited to Array Designer Software
(Arrayit Inc.),
Oligonucleotide Probe Sequence Design Software for Genetic Analysis (Olympus
Optical Co.),
NetPrimer, and DNAsis from Hitachi Software Engineering. The TM (melting or
annealing
temperature) of each primer is calculated using software programs such as Net
Primer (free web
38
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
based program at
http://premierbiosoft.com/netprimer/netprlaunch/netprlaunch.html; Internet
address as of April 17, 2002).
In another embodiment, the annealing temperature of the primers can be
recalculated and
increased after any cycle of amplification, including but not limited to cycle
l, 2, 3, 4, 5, cycles
6-10, cycles 10-15, cycles 15-20, cycles 20-25, cycles 25-30, cycles 30-35, or
cycles 35-40. After
the initial cycles of amplification, the 5' half of the primers is
incorporated into the products from
each loci of interest, thus the TM can be recalculated based on both the
sequences of the 5' half and
the 3' half of each primer.
For example, in FIG. 1B, the first cycle of amplification is performed at
about the melting
temperature of the 3' region,'which anneals to the template DNA, of the second
primer (region "c"),
which is 13 bases. After the first cycle, the annealing temperature can be
raised to TM2, which is
about the melting temperature of the 3' region, which anneals to the template
DNA, of the first
primer, which is depicted as region "b." The second primer cannot bind to the
original template
DNA because it only anneals to 13 bases in the original DNA template, and TM2
is about the
melting temperature of approximately 20 bases, which is the 3' annealing
region of the first primer
(FIG. 1 C). However, the first primer can bind to the DNA that was copied in
the first cycle of the
reaction. In the third cycle, the annealing temperature is raised to TM3,
which is about the melting
temperature of the entire sequence of the second primer, which is depicted as
regions "c" and "d."
The DNA template produced from the second cycle of PCR contains both regions
c' and d', and
therefore, the second primer can anneal and extend at TM3 (FIG. 1D). The
remaining cycles are
performed at TM3. The entire sequence of the first primer (a + b') can anneal
to the template from
the third cycle of PCR, and extend (FIG. lE). Increasing the annealing
temperature will decrease
non-specific binding and increase the specificity of the reaction, which is
especially useful if
amplifying a locus of interest from human genomic DNA, which is about 3x109
base pairs long.
As used herein, the term "about" with regard to annealing temperatures is used
to
encompass temperatures within 10 degrees celcius of the stated temperatures.
In one embodiment, one primer pair is used for each locus of interest.
However, multiple
primer pairs can be used for each locus of interest.
In one embodiment, primers are designed such that one or both primers of the
primer pair
contain sequence in the 5' region for one or more restriction endonucleases
(restriction enzyme).
As used herein, with regard to the position at which restriction enzymes
digest DNA, the
"sense" strand is the strand reading 5' to 3' in the direction in which the
restriction enzyme cuts.
For example, BsmF I recognizes the following sequences:
5' GGGAC(N)io 3' S' (N)14GTCCC 3'
3' CCCTG(N)14 5' 3'(N)IOCAGGG 5'
39
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
The sense strand is the strand containing the "GGGAC" sequence as it reads 5'
to 3' in the
direction that the restriction enzyme cuts.
As used herein, with regard to the position at which restriction enzymes
digest DNA, the
"antisense" strand is the strand reading 3' to 5' in the direction in which
the restriction enzyme cuts.
In another embodiment, one of the primers in a primer pair is designed such
that it contains
a restriction enzyme recognition site for a restriction enzyme that cuts "n"
nucleotides away from
the recognition site, and produces a recessed 3' end and a 5' overhang that
contains the locus of
interest (herein referred to as a "second primer"). "N" is a distance from the
recognition site to the.
site of the cut by the restriction enzyme. In other words, the second primer
of a primer pair contains
a recognition site for a restriction enzyme that does not cut DNA at the
recognition site but cuts "n','
nucleotides away from the recognition site. For example, if the recognition
sequence is for the
restriction enzyme BceA I, the enzyme will cut ten (10) nucleotides from the
recognition site on the
sense strand, and twelve (12) nucleotides away from the recognition site on
the antisense strand.
The 3' region and preferably, the 3' half, of the primers is designed to
anneal to a sequence
that flanks the loci of interest (FIG. lA). The second primer can anneal any
distance from the
locus of interest provided that digestion with the restriction enzyme that
recognizes the restriction
enzyme recognition site on this primer generates a 5' overhang that contains
the locus of interest.
The 5' overhangs can be of any size, including but not limited to 1, 2, 3, 4,
5, 6, 7, 8, and more than
8 bases.
In a preferred embodiment, the 3' end of the primer that anneals closer to the
locus of
interest (second primer) can anneal 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
14, or more than 14 bases
from the locus of interest or at the locus of interest.
In a preferred embodiment, the second primer is designed to anneal closer to
the locus of
interest than the other primer of a primer pair (the other primer is herein
referred to as a "first
primer"). The second primer can be a forward or reverse primer and the first
primer can be a
reverse or forward primer, respectively. Whether the first or second primer
should be the forward
or reverse primer can be determined by which design will provide better
sequencing results.
For example, the primer that anneals closer to the locus of interest can
contain a recognition
site for the restriction enzyme BsmF I, which cuts ten (10) nucleotides from
the recognition site on
the sense strand, and fourteen (14) nucleotides from the recognition site on
the antisense strand. In
this case, the primer can be designed so that the restriction enzyme
recognition site is 13 bases, 12
bases, 10 bases or 11 bases from the locus of interest. If the recognition
site is 13 bases from the
locus of interest, digestion with BsmF I will generate a 5' overhang (RX~~X),
wherein the locus of
interest (R) is the first nucleotide in the overhang (reading 3' to 5'), and X
is any nucleotide. If the
recognition site is 12 bases from the locus of interest, digestion with BsmF I
will generate a 5'
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
overhang (XRXX), wherein the locus of interest (R) is the second nucleotide in
the overhang
(reading 3' to 5'). If the recognition site is 11 bases from the locus of
interest, digestion with BsmF
I will generate a 5' overhang (XXRX), wherein the locus of interest (R) is the
third nucleotide in the
overhang (reading 3' to 5'). The distance between the restriction enzyme
recognition site and the
locus of interest should be designed so that digestion with the restriction
enzyme generates a 5'
overhang, which contains the locus of interest. The effective distance between
the recognition site
and the locus of interest will vary depending on the choice of restriction
enzyme.
In another embodiment, the primer that anneals closer to the locus of interest
site, relative
to the other primer, can be designed so that the restriction enzyme that
generates the 5' overhang,
which contains the locus of interest, will see the same sequence at the cut
site, independent of the
nucleotide at the locus of interest site. For example, if the primer that
anneals closer to the locus of
interest is designed so that the recognition site for the restriction enzyme
BsmF I (5' GGGAC 3') is
thirteen bases from the locus of interest, the restriction enzyme will cut the
antisense strand one
base from the locus of interest. The nucleotide at the locus of interest is
adjacent to the cut site, and
may vary from DNA molecule to DNA molecule. If it is desired that the
nucleotides adjacent to the
cut site be identical-, the primer can be designed so that the restriction
enzyme recognition site for
BsmF I is twelve bases away from the locus of interest site. Digestion with
BsmF I will generate a
5' overhang, wherein the locus of interest site is in the second position of
the overhang (reading 3'
to 5') and is no longer adjacent to the cut site. Designing the primer so that
the restriction enzyme
recognition site is twelve (12) bases from the locus of interest site allows
the nucleotides adjacent to
the cut site to be the same, independent of the nucleotide at the locus of
interest. Also, primers that
have been designed so that the restriction enzyme recognition site, BsmF I, is
eleven (11) or ten
(10) bases from the locus of interest site will allow the nucleotides adjacent
to the cut site to be the
same, independent of the nucleotide at the locus of interest. Similar
strategies of primer design can
be employed with other restriction enzymes so that the nucleotides adjacent to
the cut site will be
the same, independent of the nucleotide at the loci of interest.
The 3' end of the first primer (either the forward or the reverse) can be
designed to anneal
at a chosen distance from the locus of interest. Preferably, for example, this
distance is between 1-
10, 10-25, 25-50, 50-75, 75-100, 100-150, 150-200, 200-250, 250-300, 300-350,
350-400, 400-450,
450-500, 500-550, 550-600, 600-650, 650-700, 700-750, 750-800, 800-850, 850-
900, 900-950,
950-1000 and greater than 1000 bases away from the locus of interest. The
annealing sites of the
first primers are chosen such that each successive upstream primer is further
and further away from
its respective downstream primer.
For example, if at locus of interest 1 the 3' ends of the first and second
primers are Z bases
apart, then at locus of interest 2, the 3' ends of the upstream and downstream
primers are Z + K
41
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
bases apart, where K= 1, 2, 3, 4, 5-10, 10-20, 20-30, 30-40, 40-50, 50-60, 60-
70~ 70-80, 80-90,
90-100, 100-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-
900, 900-1000, or
greater than 1000 bases (FIG 2). The purpose of making the first primers
further and further apart
from their respective second primers is so that the PCR products of all the
loci of interest differ in
size and can be separated, e.g., on a sequencing gel. This allows for
multiplexing by pooling the
PCR products in later steps.
In one embodiment, the 5' region of the first or second primer can have a
recognition site
for any type of restriction enzyme. In a preferred embodiment, the 5' region
of the first and/or
second primer has at least one restriction enzyme recognition site that is
different from the
restriction enzyme recognition site that is used to generate the 5' overhang,
which contains the
locus of interest.
In one embodiment, the 5' region of the first primer, cam have a recognition
site for any type
of restriction enzyme. In a preferred embodiment, the first primer has at
least one restriction
enzyme recognition site that is different from the restriction enzyme
recognition site in the second
primer. In another preferred embodiment, the first primer anneals further away
from the locus of
interest than the second primer.
In a preferred embodiment, the second primer contains a restriction enzyme
recognition
sequence for a Type IIS restriction enzyme including but not limited to BceA I
and BsmF I, which
produce a two base 5' overhang and a four base 5' overhang, respectively.
Restriction enzymes that
are Type IIS are preferred because they recognize asymmetric base sequences
(not palindromic like
the orthodox Type II enzymes). Type IIS restriction enzymes cleave DNA at a
specified position
that is outside of the recognition site, typically up to 20 base pairs outside
of the recognition site.
These properties make Type IIS restriction enzymes, and the recognition sites
thereof, especially
useful in the method of the invention. Preferably, the Type IIS restriction
enzymes used in this
method leave a 5' overhang and a recessed 3'.
A wide variety of Type IIS restriction enzymes are known and such enzymes have
been
isolated from bacteria, phage, archeabacteria and viruses of eukaryotic algae
and are commercially
available (Promega, Madison WI; New England Biolabs, Beverly, MA; Szybalski W.
et al., Gene
100:13-26, 1991). Examples of Type IIS restriction enzymes that would be
useful in the method of
the invention include, but are not limited to enzymes such as those listed in
Table I.
Enzyme-Source Recognition/CleavageSupplier
Site
Alw I -Acinetobacter lwo~i GGATC(4/S) N~ Biolabs
A1w26 I -Acinetobacter lwo~ GTCTC( 1/5) Promega
Bbs I - Bacillus laterosporusGAAGAC(2/6) NE Biolabs
Bbv I - Bacillus brevis GCAGC(8/12) NE Biolabs
42
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
BceA I - Bacillus cereus 1315IACGGC(12/14) NE Biolabs
Bmr I - Bacillus megaterium CTGGG(5/4) NE Biolabs
Bsa I - Bacillus stearothermophilusGGTCTC(1/5) NE Biolabs
6-SS
Bst71 I - Bacillus stearothernaophilusGCAGC(8/12) Promega
71
BsmA I - Bacillus stearothermophilusGTCTC(1/5) NE Biolabs
A664
BsmB I - Bacillus stearothermophilusCGTCTC(1/5) NE Biolabs
B61
BsmF I - Bacillus stearothermophilusGGGAC(10/14) NE Biolabs
F
BspM I - Bacillus species ACCTGC(4/8) NE Biolabs
M
Ear I - Enterobacter aerogenesCTCTTC(1/4) NE Biolabs
Fau I - Flavobacteriuna aquatileCCCGC(4l6) NE Biolabs
Fok I - Flavobacterium okeonokoitesGGATG(9/13) NE Biolabs
Hga I - Haemophilus gallinarumGACGC(5/10) NE Biolabs
Ple I - Pseudomonas lemoigneiGAGTC(4/5) NE Biolabs
Sap I - Saccharopolyspora GCTCTTC(1/4) NE Biolabs
species
SfaN I - Streptococcus faecalisGCATC(5/9) NE Biolabs
ND547
Sth132I-Streptococcus thermophilusCCCG(4l8) No commercial
STl3 supplier
(Gene
195:201-20G
( 1997))
In one embodiment, a primer pair has sequence at the 5' region of each of the
primers that
provides a restriction enzyme recognition site that is unique for one
restriction enzyme.
In another embodiment, a primer pair has sequence at the 5' region of each of
the primers
that provide a restriction site that is recognized by more than one
restriction enzyme, and especially
for more than one Type IIS restriction enzyme. For example, certain consensus
sequences can be
recognized by more than one enzyme. For example, BsgI, Eco571 and BpmI all
recognize the
consensus (G/C)TGnAG and cleave 16 by away on the antisense strand and 14 by
away on the
sense strand. A primer that provides such a consensus sequence would result in
a product that has a
site that can be recognized by any of the restriction enzymes BsgI, Eco571 and
BpmI.
Other restriction enzymes that cut DNA at a distance from the recognition
site, and produce
a recessed 3' end and a 5' overhang include Type III restriction enzymes.
For example, the restriction enzyme EcoPlSI recognizes the sequence 5' CAGCAG
3' and
cleaves 25 bases downstream on the sense strand and 27 bases on the antisense
strand. It will be
further appreciated by a person of ordinary skill in the art that new
restriction enzymes are
continually being discovered and can readily be adopted for use in the subject
invention.
43
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
In another embodiment, the second primer can contain a portion of the
recognition
sequence for a restriction enzyme, wherein the full recognition site for the
restriction enzyme is
generated upon amplification of the template DNA such that digestion with the
restriction enzyme
generates a 5' overhang containing the locus of interest. For example, the
recognition site for BsmF
I is 5' GGGACNIO 3'. The 3' region, which anneals to the template DNA, of the
second primer
can end with the nucleotides "GGG," which do not have to be complementary with
the template
DNA. If the 3' annealing region is about 10-20 bases, even if the last three
bases do not anneal, the
primer will extend and, generate a BsmF I site.
Second primer: 5' GGAAATTCCATGATGCGTGGG-~
Template DNA 3' CCTTTAAGGTACTACGCANINzN3TG 5'
5' GGAAATTCCATGATGCCTN1N2>N3~AC 3'
The second primer can be designed to anneal to the template DNA, wherein the
next two
bases of the template DNA are thymidine and guanine, such that an adenosine
and cytosine are
incorporated into the primer forming a recognition site for BsmF I, 5'
GGGACNIO~ 3'. The second
primer can be designed to anneal in such a manner that digestion with BsmF I
generates a 5'
overhang containing the locus of interest.
In another embodiment, the second primer can contain an entire or full
recognition site for a
restriction enzyme or a portion of a recognition site, which generates a full
recognition site upon
primer-dependent replication of the template DNA such that digestion with a
restriction enzyme
that cuts at the recognition site and generates a 5' overhang that contains
the locus of interest. For
example, the restriction enzyme BsaJ I binds the following recognition site:
5' C~CN1NZGG 3'.
The second primer can be designed such that the 3' region, which anneals to
the template DNA of
the primer ends with "CC", the SNP of interest is represented by "NI", and the
template sequence
downstream of the SNP is "NZGG."
Second primer: 5' GGAAATTCCATGATGCGTACC->
Template DNA 3' CCTTTAAGGTACTACGCATGGN1NZCC 5'
5' GGAAATTCCATGATGCCTACCNI~Nz.GG 3'
After digestion with BsaJ I, a 5' overhang of the following sequence would be
generated:
5' C 3'
3' GGNINzCC 5'
If the nucleotide guanine is not reported at the locus of interest, the 3'
recessed end can be
filled in with unlabeled cytosine, which is complementary to the first
nucleotide in the overhang.
After removing the excess cytosine, labeled ddNTPs can be used to fill in the
next nucleotide, Nl,
which represents the locus of interest. Other restriction enzymes can be used
including but not
limited to BssK I (5' tCCNGG 3'), Dde I(5' C~TNAG 3'), EcoN I (5' CCTNN~NNNAGG
3'),
44
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Fnu4H I (5' GC~NGC 3'), Hinf I (5' G~ANTC 3') PfIF I (5' GACN~NNGTC 3'), Sau96
I(5'
G~GNCC 3'), ScrF I (5' CC~NGG 3'), and Tthl 11 I (S' GACN~NNGTC 3').
It is not necessary that the 3' region, which anneals to the template DNA, of
the second
primer be 100% complementary to the template DNA. For example, the last 1, 2,
or 3 nucleotides
of the 3' end of the second primer can be mismatches with the template DNA.
The region of the
primer that anneals to the template DNA will target the primer, and allow the
primer to extend.
Even if the last two nucleotides are not complementary to the template DNA,
the primer will extend
and generate a restriction enzyme recognition site. For example, the last two
nucleotides in the
second primer are "CC." The second primer anneals to the template DNA, and
allows extension
even if "CC" is not complementary to the nucleotides Na, and Nb, on the
template DNA.
Second primer: 5' GGAAATTCCATGATGCGTACC--~
Template DNA 3' CCTTTAAGGTACTACGCATNa.Nb>N1~NZ.CC 5'
5' GGAAATTCCATGATGCCTANaNbNIN2GG 3'
After digestion with BsaJ I, a 5' overhang of the following sequence would be
generated:
5' C 3'
3' GGNINzCC 5'
If the nucleotide guanine is not reported at the locus of interest, the 5'
overhang can be
filled in with unlabeled cytosine. The excess cytosine can be rinsed away, and
filled in with labeled
ddNTPs. The first nucleotide incorporated (Nl') corresponds to the locus of
interest. If guanine is
reported at the locus of interest, the loci of interest can be filled in with
unlabeled cytosine and a
nucleotide downstream of the locus of interest can be detected. For example,
assume NZ is adenine.
If the locus of interest is guanine, unlabeled cytosine can be used in the
fill in reaction. After
removing the cytosine, a fill in reaction with labeled thymidine can be used.
The labeled thymidine
will be incorporated only if the locus of interestwas a guanine. Thus, the
sequence of the locus of
interest can be determined by detecting a nucleotide downstream of the locus
of interest.
In another embodiment, the first and second primers contain a portion of a
recognition
sequence for a restriction enzyme, wherein the full recognition site for the
restriction enzyme is
generated upon amplification of the template DNA such that digestion with the
restriction enzyme
generates a 5' overhang containing the locus of interest. The recognition site
for any restriction
enzyme that contains one or more than one variable nucleotide can be generated
including but not
limited to the restriction enzymes BssK I (5'~CCNGG 3'), Dde I (5'C~TNAG 3'),
Econ I
(5'CCTNN~NNNAGG 3'), Fnu4H I (5'GC~NGC 3'), Hinf I (5'G~ANTC 3'), PflF I (5'
GACN~NNGTC 3'), Sau96 I (5' G~GNCC 3'), ScrF I (5' CClNGG 3'), and Tthl 11 I
(5'
GACN~NNGTC 3').
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
In a preferred embodiment, the 3' regions of the first and second primers
contain the partial
sequence for a restriction enzyme, wherein the partial sequence contains 1, 2,
3, 4 or more than 4
mismatches with the template DNA; these mismatches create the restriction
enzyme recognition
site. The number of mismatches that can be tolerated at the 3' end depends on
the length of the
primer. For example, if the locus of interest is represented by NI, a first
primer can be designed to
be complementary to the template DNA, depicted below as region "a." The 3'
region of the first
primer ends with "CC," which is not complementary to the template DNA. The
second primer is
designed to be complementary to the template DNA, which is depicted below as
region "b' ". The
3' region of the second primer ends with "CC," which is not complementary to
the template DNA.
First primer 5' a CC-~
Template DNA 3' a' AAN1~N2>TT b' S'
5' a TTNINZAA b 3'
E--CC b' - 5' Second primer
After one round of amplification the following products would be generated:
5' a CCN1NZAA b 3'
and
5' b CCNZ~N1.AA a' 3'.
In cycle two, the primers can anneal to the templates that were generated from
the first
cycle of PCR:
5' a CCN1N2AA b 3'
<-CC b' S'
E-CC a 5'
5' b' CCNZN1AA a' 3'
After cycle two of PCR, the following products would be generated:
5' a CCN1NZGG b 3'
3' a' GGN1NZCC b' S'
The restriction enzyme recognition site for BsaJ I is generated, and after
digestion with
BsaJ I, a 5' overhang containing the locus of interest is created. The locus
of interest can be
detected as described in detail below.
46
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
In another embodiment, a primer pair has sequence at the 5' region of each of
the primers
that provides two or more restriction sites that are recognized by two or more
restriction enzymes.
In a most preferred embodiment, a primer pair has different restriction enzyme
recognition
sites at the 5' regions, especially 5' ends, such that a different restriction
enzyme is required to
cleave away any undesired sequences. For example, the first primer for locus
of interest "A" can
contain sequence recognized by a restriction enzyme, "X," which can be any
type of restriction
enzyme, and the second primer for locus of interest "A," which anneals closer
to the locus of
interest, can contain sequence for a restriction enzyme, "Y," which is a Type
IIS restriction enzyme
that cuts "n" nucleotides away and leaves a 5'overhang and a recessed 3' end.
The 5' overhang
contains the locus of interest. After binding the amplified DNA to
streptavidin coated wells, one
can digest with enzyme "Y," rinse, then fill in with labeled nucleotides and
rinse, and then digest
with restriction enzyme "X," which will release the DNA fragment containing
the locus of interest
from the solid matrix. The locus of interest can be analyzed by detecting the
labeled nucleotide that
was "filled in" at the locus of interest, e.g. SNP site.
In another embodiment, the second primers for the different loci of interest
that are being
amplified according to the invention contain recognition sequence in the S'
regions for the same
restriction enzyme and likewise all the first primers also contain the same
restriction enzyme
recognition site, which is a different enzyme from the enzyme that recognizes
the second primers.
In another embodiment, the second primers for the multiple loci of interest
that are being
amplified according to the invention contain restriction enzyme recognition
sequences in the 5'
regions for different restriction enzymes.
In another embodiment, the first primers for the multiple loci of interest
that are being
amplified according to the invention contain restriction enzyme recognition
sequences in the 5'
regions for different restriction enzymes. Multiple restriction enzyme
sequences provide an
opportunity to influence the order in which pooled loci of interest are
released from the solid
support. For example, if 50 loci of interest are amplified, the first primers
can have a tag at the
extreme 5' end to aid in purification and a restriction enzyme recognition
site, and the second
primers can contain a recognition site for a type IIS restriction enzyme. For
example, several of the
first primers can have a restriction enzyme recognition site for EcoR I, other
first primers can have
a recognition site for Pst I, and still other first primers can have a
recognition site for BamH I.
After amplification, the loci of interest can be bound to a solid support with
the aid of the tag on the
first primers. By performing the restriction digests one restriction enzyme at
a time, one can
serially release the amplified loci of interest. If the first digest is
performed with EcoR I, the loci of
interest amplified with the first primers containing the recognition site for
EcoR I will be released,
and collected while the other loci of interest remain bound to the solid
support. The amplified loci
47
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
of interest can be selectively released from the solid support by digesting
with one restriction
enzyme at a time. The use of different restriction enzyme recognition sites in
the first primers
allows a larger number of loci of interest to be amplified in a single
reaction tube.
In a preferred embodiment, any region 5' of the restriction enzyme digestion
site of each
primer can be modified with a functional group that provides for fragment
manipulation,
processing, identification, and/or purification. Examples of such functional
groups, or tags, include
but are not limited to biotin, derivatives of biotin, carbohydrates, haptens,
dyes, radioactive
molecules, antibodies, and fragments of antibodies, peptides, and immunogenic
molecules.
In another embodiment, the template DNA can be replicated once, without being
amplified
beyond a single round of replication. This is useful when there is a large
amount of the DNA
available for analysis such that a large number of copies of the loci of
interest are already present in
the sample, and further copies are not needed. In this embodiment, the primers
are preferably
designed to contain a "hairpin" structure in the S' region, such that the
sequence doubles back and
anneals to a sequence internal to itself in a complementary manner. When the
template DNA is
replicated only once, the DNA sequence comprising the recognition site would
be single-stranded if
not for the "hairpin" structure. However, in the presence of the hairpin
structure, that region is
effectively double stranded, thus providing a double stranded substrate for
activity by restriction
enzymes.
To the extent that the reaction conditions are compatible, all the primer
pairs to analyze a
locus or loci of interest of DNA can be mixed together for use in the method
of the invention. In a
preferred embodiment, all primer pairs are mixed with the template DNA in a
single reaction vessel.
Such a. reaction vessel can be, for example, a reaction tube, or a well of a
microtiter plate.
Alternatively, to avoid competition for nucleotides and to minimize primer
dimers and
difficulties with annealing temperatures for primers, each locus of interest
or small groups of loci of
interest can be amplified in separate reaction tubes or wells, and the
products later pooled if desired.
For example, the separate reactions can be pooled into a single reaction
vessel before digestion with
the restriction enzyme that generates a 5' overhang, which contains the locus
of interest or SNP site,
and a 3' recessed end. Preferably, the primers of each primer pair are
provided in equimolar
amounts. Also, especially preferably, each of the different primer pairs is
provided in equimolar
amounts relative to the other pairs that are being used.
In another embodiment, combinations of primer pairs that allow efficient
amplification of
their respective loci of interest can be used (see e.g. FIG. 2). Such
combinations can be determined
prior to use in the method of the invention. Multi-well plates and PCR
machines can be used to
select primer pairs that work efficiently with one another. For example,
gradient PCR machines,
such as the Eppendorf Mastercycler~ gradient PCR machine, can be used to
select the optimal
4~
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
annealing temperature for each primer pair. Primer pairs that have similar
properties can be used
together in a single reaction tube.
In another embodiment, a mufti-sample container including but not limited to a
96-well or
more plate can be used to amplify a single locus of interest with the same
primer pairs from
multiple template DNA samples with optimal PCR conditions for that locus of
interest.
Alternatively, a separate mufti-sample container can be used for amplification
of each locus of
interest and the products for each template DNA sample later pooled. For
example, gene A from 96
different DNA samples can be amplified in microtiter plate 1, gene B from 96
different DNA
samples can be amplified in microtiter plate 2, etc., and then the
amplification products can be
pooled.
The result of amplifying multiple loci of interest is a preparation that
contains
representative PCR products having the sequence of each locus of interest. For
example, if DNA
from only one individual is used as the template DNA and if hundreds of
disease-related loci of
interest were amplified from the template DNA, the amplified DNA would be a
mixture of small,
PCR products from each of the loci of interest. Such a preparation could be
further analyzed at that
time to determine the sequence at each locus of interest or at only some loci
of interest.
Additionally, the preparation could be stored in a manner that preserves the
DNA and can be
analyzed at a later time. Information contained in the amplified DNA can be
revealed by any
suitable method including but not limited to fluorescence detection,
sequencing, gel electrophoresis,
and mass spectrometry (see "Detection of Incorporated Nucleotide" section
below).
II. Amplification of Loci of Interest
The template DNA can be amplified using any suitable method known in the art
including
but not limited to PCR (polymerise chain reaction), 3SR (self sustained
sequence reaction), LCR
(ligase chain reaction), RACE-PCR (rapid amplification of cDNA ends), PLCR (a
combination of
polymerise chain reaction and ligase chain reaction), Q-beta phage
amplification (Shah et al., J.
Medical Micro. 33: 1435-41 (1995)), SDA (strand displacement amplification),
SOE-PCR (splice
overlap extension PCR), and the like. These methods can be used to design
variations of the
releasable primer mediated cyclic amplification reaction explicitly described
in this application. In
the most preferred embodiment, the template DNA is amplified using PCR (PCR: A
Practical
Approach, M. J. McPherson, et al., IRL Press (1991); PCR Protocols: A Guide to
Methods and
Applications, Innis, et al., Academic Press (1990); and PCR Technology:
Principals and
Applications of DNA Amplification, H. A. Erlich, Stockton Press (1989)). PCR
is also described in
numerous U.S. patents, including U.S. Pat. Nos. 4,683,195; 4,683,202;
4,800,159; 4,965,188;
4,889,818; 5,075,216; 5,079,352; 5,104,792, 5,023,171; 5,091,310; and 5,066,5
84.
49
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
The components of a typical PCR reaction include but are not limited to a
template DNA,
primers, a reaction buffer (dependent on choice of polymerase), dNTPs (dATP,
dTTP, dGTP, and
dCTP) and a DNA polymerase. Suitable PCR primers can be designed and prepared
as discussed
above (see "Primer Design" section above). Briefly, the reaction is heated to
95°C for 2 min. to
separate the strands of the template DNA, the reaction is cooled to an
appropriate temperature
(determined by calculating the annealing temperature of designed primers) to
allow primers to
anneal to the template DNA, and heated to 72°C for two minutes to allow
extension.
In a preferred embodiment, the annealing temperature is increased in each of
the first three
cycles of amplification to reduce non-specific amplification. See also Example
1, below. The TM1
of the first cycle of PCR is about the melting temperature of the 3' region of
the second primer that
anneals to the template DNA. The annealing temperature can be raised in cycles
2-10, preferably in
cycle 2, to TM2, which is about the melting temperature of the 3' region,
which anneals to the
template DNA, of the first primer. If the annealing temperature is raised in
cycle 2, the annealing
temperature remains about the same until the next increase in annealing
temperature. Finally, in
any cycle subsequent to the cycle in which the annealing temperature was
increased to TM2,
preferably cycle 3, the annealing temperature is raised to TM3, which is about
the melting
temperature of the entire second primer. After the third cycle, the annealing
temperature for the
remaining cycles can be at about TM3 or can be further increased. In this
example, the annealing
temperature is increased in cycles 2 and 3. However, the annealing temperature
can be increased
from a low annealing temperature in cycle 1 to a high annealing temperature in
cycle 2 without any
further increases in temperature or the annealing temperature can
progressively change from a low
annealing temperature to a high annealing temperature in any number of
incremental steps. For
example, the annealing temperature can be changed in cycles 2, 3, 4, 5, 6,
etc.
After annealing, the temperature in each cycle is increased to an "extension"
temperature to
allow the primers to "extend" and then following extension the temperature in
each cycle is
increased to the denaturization temperature. For PCR products less than 500
base pairs in size, one
can eliminate the extension step in each cycle and just have denaturization
and annealing steps. A
typical PCR reaction consists of 25-45 cycles of denaturation, annealing and
extension as described
above. However, as previously noted, one cycle of amplification (one copy) can
be sufficient for
practicing the invention.
In another embodiment, multiple sets of primers wherein a primer set comprises
a forward
primer and a reverser primer, can be used to amplify the template DNA for 1-5,
5-10, 10-15, 15-20
or more than 20 cycles, and then the amplified product is further amplified in
a reaction with a
single primer set or a subset of the multiple primer sets. In a preferred
embodiment, a low
concentration of each primer set is used to minimize primer-dimer formation. A
low concentration
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
of starting DNA can be amplified using multiple primer sets. Any number of
primer sets can be
used in the first amplification reaction including but not limiting to 1-10,
10-20, 20-30, 30-40,
40-50, 50-60, 60-70, 70-80, 80-90, 90-100, 100-150, 150-200, 200-250, 250-300,
300-350,
350-400, 400-450, 450-500, 500-1000, and greater than 1000. In another
embodiment, the
amplified product is amplified in a second reaction with a single primer set.
In another
embodiment, the amplified product is further amplified with a subset of the
multiple primer pairs
including but not limited to 2-10, 10-20, 20-30, 30-40, 40-50, 50-60, 60-7o-,
70-80, 80-90, 90-100, ,
100-150, 150-200, 200-250, and more than 250.
The multiple primer sets will amplify the loci of interest, such that a
minimal amount of
template DNA is not limiting for the number of loci that can be detected. For
example, if template
DNA is isolated from a single cell or the template DNA is obtained from a
pregnant female, which
comprises both maternal template DNA and fetal template DNA, low
concentrations of each primer
set can be used in a first amplification reaction to amplify the loci of
interest. The low
concentration of primers reduces the formation of primer-dimer and increases
the probability that
the primers will anneal to the template DNA and allow the polymerise to
extend. The optimal
number of cycles performed with the multiple primer sets is determined by the
concentration of the
primers. Following the first amplification reaction, additional primers can be
added to further
amplify the loci of interest. Additional amounts of each primer set can be
added and further
amplified in a single reaction. Alternatively, the amplified product can be
further amplified using a
single primer set in each reaction or a subset of the multiple primers sets.
For example, if 150
primer sets were used in the first amplification reaction, subsets of 10
primer sets can be used to
further amplify the product from the first reaction.
Any DNA polymerise that catalyzes primer extension can be used including but
not limited
to E. coli DNA polymerise, Klenow fragment of E. coli DNA polymerise l, T7 DNA
polymerise,
T4 DNA polymerise, Taq polymerise, Pfu DNA polymerise, Vent DNA polymerise,
bacteriophage 29, REDTaqT"" Genomic DNA polymerise, or sequenase. Preferably,
a thermostable
DNA polymerise is used. A "hot start" PCR can also be performed wherein the
reaction is heated
to 95°C for two minutes prior to addition of the polymerise or the
polymerise can be kept inactive
until the first heating step in cycle 1. "Hot start" PCR can be used to
minimize nonspecific
amplification. Any number of PCR cycles can be used to amplify the DNA,
including but not
limited to 2, 5, 10, 15, 20, 25, 30, 35, 40, or 45 cycles. In a most preferred
embodiment, the number
of PCR cycles performed is such that equimolar amounts of each loci of
interest are produced.
III. Purification of Amplified DNA
Purification of the amplified DNA is not necessary for practicing the
invention. However,
in one embodiment, if purification is preferred, the 5' end of the primer
(first or second primer) can
51
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
be modified with a tag that facilitates purification of the PCR products. In a
preferred embodiment,
the first primer is modified with a tag that facilitates purification of the
PCR products. The
modification is preferably the same for all primers, although different
modifications can be used if
it is desired to separate the PCR products into different groups.
The tag can be any chemical moiety including buf not limited to a
radioisotope, fluorescent
reporter molecule, chemiluminescent reporter molecule, antibody, antibody
fragment, hapten,
biotin, derivative of biotin, photobiotin, iminobiotin, digoxigenin, avidin,
enzyme, acridinium,
sugar, enzyme, apoenzyme, homopolymeric oligonucleotide, hormone,
ferromagnetic moiety,
paramagnetic moiety, diamagnetic moiety., phosphorescent moiety, luminescent
moiety,
electrochemiluminescent moiety, chromatic moiety, moiety having a detectable
electron spin
resonance, electrical capacitance, dielectric constant or electrical
conductivity, or combinations
thereof.
As one example, the 5' ends of the primers can be biotinylated (Kandpal et
al., Nucleic
Acids Res. 18:1789-1795 (1990); Kaneoka et al., Biotechniques 10:30-34 (1991);
Green et al.,
Nucleic Acids Res. 18:6163-6164 (1990)). The biotin provides an affinity tag
that can be used to
purify the copied DNA from the genomic DNA or any other DNA molecules that are
not of interest.
Biotinylated molecules can be purified using a streptavidin coated matrix as
shown in FIG. 1F,
including but not limited to Streptawell, transparent, High-Bind plates from
Roche Molecular
Biochemicals (catalog number 1 645 692, as listed in Roche Molecular
Biochemicals, 2001
Biochemicals Catalog).
The PCR product of each locus of interest is placed into separate wells of a
Streptavidin
coated plate. Alternatively, the PCR products of the loci of interest can be
pooled and placed into a
streptavidin coated matrix, including but not limited to the Streptawell,
transparent, High-Bind
plates from Roche Molecular Biochemicals (catalog number 1 645 692, as
listed.in Roche
Molecular Biochemicals, 2001 Biochemicals Catalog).
The amplified DNA can also be separated from the template DNA using non-
affinity
methods known in the art, for example, by polyacrylamide gel.electrophoresis
using standard
protocols.
IV. Digestion of Amplified DNA
The amplified DNA can be digested with a restriction enzyme that recognizes a
sequence
that had been provided on the first or second primer using standard protocols
known within the art
(FIGS. 6A-6D). Restriction enzyme digestions are performed using standard
protocols well known
within the art. The enzyme used depends on the restriction recognition site
generated with the first
or second primer. See "Primer Design" section, above, for details on
restriction recognition sites
generated on primers.
52
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Type IIS restriction enzymes are extremely useful in that they cut
approximately 10-20 base
pairs outside of the recognition site. Preferably, the Type IIS restriction
enzymes used are those
that generate a 5' overhang and a recessed 3' end, including but not limited
to BceA I and BsmF I
(see e.g. Table 1 ). In a most preferred embodiment, the second primer (either
forward or reverse)
contains a restriction enzyme recognition sequence for BsmF I or BceA I. The
Type IIS restriction
enzyme BsmF I recognizes the nucleic acid sequence GGGAC, and cuts 14
nucleotides from the
recognition site on the antisense strand and 10 nucleotides from the
recognition site on the sense
strand. Digestion with BsmF I generates a 5' overhang of four (4) bases.
For example, if the second primer is designed so that after amplification the
restriction
enzyme recognition site is 13 bases from the locus of interest, then after
digestion, the locus of
interest is the first base in the 5' overhang (reading 3' to 5'), and the
recessed 3' end is one base
from the locus of interest. The 3' recessed end can be filled in with a
nucleotide that is
complementary to the locus of interest. One base of the overhang can be filled
in using
dideoxynucleotides. However, 1, 2, 3, or 4 bases of the overhang can be filled
in using
deoxynucleotides or a mixture of dideoxynucleotides and deoxynucleotides.
The restriction enzyme BsmF I cuts DNA ten (10) nucleotides from the
recognition site on
the sense strand and fourteen (14) nucleotides from the recognition site on
the antisense strand.
However, in a sequence dependent manner, the restriction enzyme BsmF I also
cuts eleven (11)
nucleotides from the recognition site on the sense strand and fifteen (15)
nucleotides from the ,
recognition site on the antisense strand. Thus, two populations of DNA
molecules exist after
digestion: DNA molecules cut at 10/14 and DNA molecules cut at 11/15. If the
recognition site for
BsmF I is 13 bases from the locus of interest in the amplified product, then
DNA molecules cut at
the 11/15 position will generate a 5' overhang that contains the locus of
interest in the second
position of the overhang (reading 3' to 5'). The 3' recessed end of the DNA
molecules can be filled
in with labeled nucleotides. For example, if labeled dideoxynucleotides are
used, the 3' recessed
end of the molecules cut at 11/15 would be filled in with one base, which
corresponds to the base
upstream from the locus of interest, and the 3' recessed end of molecules cut
at 10/14 would be
filled in with one base, which corresponds to the locus of interest. The DNA
molecules that have
been cut at the 10/14 position and the DNA molecules that have been cut at the
11/15 position can
be separated by size, and the incorporated nucleotides detected. This allows
detection of both the
nucleotide before the locus of interest, detection of the locus of interest,
and potentially the three
bases after the locus of interest.
Alternatively, if the base upstream from the locus of interest and the locus
of interest are
different nucleotides, then the 3' recessed end of the molecules cut at 11/15
can be filled in with
deoxynucleotide that is complementary to the upstream base. The remaining
deoxynucleotide is
53
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
washed away, and the locus of interest site can be filled in with either
labeled deoxynucleotides,
unlabeled deoxynucleotides, labeled dideoxynucleotides, or unlabeled
dideoxynucleotides. After
the fill in reaction, the nucleotide can be detected by any suitable method.
Thus, after the first fill in
reaction with dNTP, the 3' recessed end of the molecules cut at 10/14 and
11/15 is upstream from
the locus of interest. The 3' recessed end can now be filled in one base,
which corresponds to the
locus of interest, two bases, three bases or four bases.
The restriction enzyme BceA I recognizes the nucleic acid sequence ACGGC and
cuts 12
(twelve) nucleotides from the recognition site on the sense strand and 14
(fourteen) nucleotides
from the recognition site on the antisense strand. If the distance from the
recognition site for BceA.
I on the second primer is designed to be thirteen (13) bases from the locus of
interest (see FIGS.
4A-4D), digestion with BceA I will generate a 5' overhang of two bases, which
contains the locus
of interest, and a recessed 3' end that is upstream from the locus of
interest. The locus of interest is
the first nucleotide in the 5' overhang (reading 3' to 5').
Alternative cutting is also seen with the restriction enzyme BceA I, although
at a much
lower frequency than is seen with BsmF I. The restriction enzyme BceA I can
cut thirteen (13)
nucleotides from the recognition site on the sense strand and fifteen (15)
nucleotides from the
recognition site on the antisense strand. Thus, two populations of DNA
molecules exist: DNA
molecules cut at 12/14 and DNA molecules cut at 13/15. If the restriction
enzyme recognition site
is 13 bases from the locus of interest in the amplified product, DNA molecules
cut at the 13/15
position yield a 5' overhang, which contains the locus of interest in the
second position of the
overhang (reading 3' to 5'). Labeled dideoxynucleotides can be used to fill in
the 3' recessed end
of the DNA molecules. The DNA molecules cut at 13/15 will have the base
upstream from the
locus of interest filled in, and the DNA molecules cut at 12/14 will have the
locus of interest site
filled in. The DNA molecules cut at 13/15 and those cut at 12/14 can be
separated by size, and the
incorporated nucleotide detected. Thus, the alternative cutting can be used to
obtain additional
sequence information.
Alternatively, if the two bases in the 5' overhang are different, the 3'
recessed end of the
DNA molecules, which were cut at 13/15, can be filled in with the
deoxynucleotide complementary
to the first base in the overhang, and excess deoxynucleotide washed away.
After filling in, the 3'
recessed end of the DNA molecules that were cut at 12/14 and the DNA molecules
that were cut at
13/15 are upstream from the locus of interest. The 3' recessed ends can be
filled with either labeled
dideoxynucleotides, unlabeled dideoxynucleotides, labeled deoxynucleotides, or
unlabeled
deoxynucleotides.
If the primers provide different restriction sites for certain of the loci of
interest that were
copied, all the necessary restriction enzymes can be added together to digest
the copied DNA
54
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
simultaneously. Alternatively, the different restriction digests can be made
in sequence, for
example, using one restriction enzyme at a time, so that only the product that
is specific for that
restriction enzyme is digested.
Optimal restriction enzyme digestion conditions, including but not limited to
the
concentration of enzyme, temperature, buffer conditions, and the time of
digestion can be optimized
for each restriction enzyme. For example, the alternative cutting seen with
the type IIS restriction
enzyme BsmF I can be reduced, if desired, by performing the restriction enzyme
digestion at lower
temperatures including but not limited to 25-16°, 16-12°C, 12-
8°C, 8-4°C, or 4-0°C.
V. Incorporation of Labeled Nucleotides
Digestion with the restriction enzyme that recognizes the sequence on the
second primer
generates a recessed 3' end and a 5' overhang, which contains the locus of
interest (FIG. 1G). The
recessed 3' end can be filled in using the 5'. overhang as a template in the
presence of unlabeled or
labeled nucleotides or a combination of both unlabeled and labeled
nucleotides. The nucleotides
can be labeled with any type of chemical group or moiety that allows for
detection including but not
limited to radioactive molecules, fluorescent molecules, antibodies, antibody
fragments, haptens,
carbohydrates, biotin, derivatives of biotin, phosphorescent moieties,
luminescent moieties,
electrochemiluminescent moieties, chromatic moieties, and moieties having a
detectable electron
spin resonance, electrical capacitance, dielectric constant or electrical
conductivity. The
nucleotides can be labeled with one or more than one type of chemical group or
moiety. Each
nucleotide can be labeled with the same chemical group or moiety.
Alternatively, each different
nucleotide can be labeled with a different chemical group or moiety. The
labeled nucleotides can
be dNTPs, ddNTPs, or a mixture of both dNTPs and ddNTPs. The unlabeled
nucleotides can be
dNTPs, ddNTPs or a mixture of both dNTPs and ddNTPs.
Any combination of nucleotides can be used to incorporate nucleotides
including but not
limited to unlabeled deoxynucleotides, labeled deoxynucleotides, unlabeled
dideoxynucleotides,
labeled dideoxynucleotides, a mixture of labeled and unlabeled
deoxynucleotides, a mixture of
labeled and unlabeled dideoxynucleotides, a mixture of labeled
deoxynucleotides and labeled
dideoxynucleotides, a mixture of labeled deoxynucleotides and unlabeled
dideoxynucleotides, a
mixture of unlabeled deoxynucleotides and unlabeled dideoxynucleotides, a
mixture of unlabeled
deoxynucleotides and labeled dideoxynucleotides, dideoxynucleotide analogues,
deoxynucleotide
analogues, a mixture of dideoxynucleotide analogues and deoxynucleotide
analogues,
phosphorylated nucleoside analogues, 2'-deoxynucleotide-5'-triphosphate, and
modified
2'-deoxynucleotide-5'-triphosphate.
For example, as shown in FIG. 1H, in the presence of a polymerase, the 3'
recessed end
can be filled in with fluorescent ddNTP using the 5' overhang as a template.
The incorporated
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
ddNTP can be detected using any suitable method including but not limited to
fluorescence
detection.
All four nucleotides can be labeled with different fluorescent groups, which
will allow one
reaction to be performed in the presence of all four labeled nucleotides.
Alternatively, four separate
"fill in" reactions can be performed for each locus of interest; each of the
four reactions will contain
a different labeled nucleotide (e.g. ddATP*, ddTTP*, ddGTP*, or ddCTP*, where
* indicates a
labeled nucleotide). Each nucleotide can be labeled with different chemical
groups or the same
chemical groups. The labeled nucleotides can be dideoxynucleotides or
deoxynucleotides.
In another embodiment, nucleotides can be labeled with fluorescent dyes
including but not
limited to fluorescein, pyrene, 7-methoxycoumarin, Cascade Blue.TM., Alexa
Flur 350, Alexa Flur
430, Alexa Flur 488, Alexa Flur 532, Alexa Flur. 546, Alexa Flur 568, Alexa
Flur 594, Alexa Flur
633, Alexa Flur 647, Alexa Flur 660, Alexa Flur 680, AMCA-X,
dialkylaminocoumarin, Pacific
Blue, Marina Blue, BODIPY 4931503, BODIPY Fl-X, DTAF, Oregon Green 500, Dansyl-
X,
6-FAM, Oregon Green 488, Oregon Green 514, Rhodamine Green-X, Rhodol Green,
Calcein,
Eosin, ethidium bromide, NBD, TET, 2', 4', 5', 7'
tetrabromosulfonefluorescien, BODIPY-R6G,
BODIPY-Fl BR2, BODIPY 530/550, HEX, BODIPY 558/568, BODIPY-TMR-X., PyMPO,
BODIPY 564/570, TAMRA, BODIPY 576/589, Cy3, Rhodamine Red-x, BODIPY 581/591, '
carboxyXrhodamine, Texas Red-X, BODIPY-TR-X., CyS, SpectrumAqua, SpectrumGreen
#1,
SpectrumGreen #2, SpectrumOrange, SpectrumRed, or naphthofluorescein.
In another embodiment, the "fill in" reaction can be performed with
fluorescently labeled
dNTPs, wherein the nucleotides are labeled with different fluorescent groups.
The incorporated
nucleotides can be detected by any suitable method including but not limited
to Fluorescence
Resonance Energy Transfer (FRET).
In another embodiment, a mixture of both labeled ddNTPs and unlabeled dNTPs
can be
used for filling in the recessed 3' end of the SNP or locus of interest.
Preferably, the 5' overhang
consists of more than one base, including but not limited to 2, 3, 4, 5, 6 or
more than 6 bases. For
example, if the 5' overhang consists of the sequence "XGAA," wherein X is the
locus of interest,
e.g. SNP, then filling.in with a mixture of labeled ddNTPs and unlabeled dNTPs
will produce
several different DNA fragments. If a labeled ddNTP is incorporated at
position "X," the reaction
will terminate and a single labeled base will be incorporated. If however, an
unlabeled dNTP is
incorporated, the polymerase continues to incorporate other bases until a
labeled ddNTP is
incorporated. If the first two nucleotides incorporated are dNTPs, and the
third is a ddNTP, the 3'
recessed end will be extend by three bases. This DNA fragment can be separated
from the other
DNA fragments that were extended by l, 2, or 4 bases by size. A mixture of
labeled ddNTPs and
56
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
unlabeled dNTPs will allow all bases of the overhang to be filled in, and
provides additional
sequence information about the locus of interest, e.g. SNP (see FIGS. 7E and
9D).
After incorporation of the labeled nucleotide, the amplified DNA can be
digested with a
restriction enzyme that recognizes the sequence provided by the first primer.
For example, in FIG
lI, the amplified DNA is digested with a restriction enzyme that binds to
region "a," which releases
the DNA fragment containing the incorporated nucleotide from the streptavidin
matrix.
Alternatively, one primer of each primer pair for each locus of interest can
be attached to a
solid support matrix including but not limited to a well of a microtiter
plate. For example,
streptavidin-coated microtiter plates can be used for the amplification
reaction with a primer pair,
wherein one primer is biotinylated. First, biotinylated primers are bound to
the streptavidin-coated
microtiter plates. Then, the plates are used as the reaction vessel for PCR
amplification of the loci
of interest. After the amplification reaction is completes the excess primers,
salts, and template
DNA can be removed by washing. The amplified DNA remains attached to the
microtiter plate.
The amplified DNA can be digested with a restriction enzyme that recognizes a
sequence on the
second primer and generates a 5' overhang, which contains the locus of
interest. The digested
fragments can be removed by washing. After digestion, the SNP site or locus of
interest is exposed
in the 5' overhang. The recessed 3' end is filled in with a labeled
nucleotide, including but not
limited to, fluorescent ddNTP in the presence of a polymerise. The labeled DNA
can be released
into the supernatant in the microtiter plate by digesting with a restriction
enzyme that recognizes a
sequence in the 5' region of the first primer.
In another embodiment, one nucleotide can be used to determine the sequence of
multiple
alleles of a gene. A nucleotide that terminates the .elongation reaction can
be used to determine the
sequence of multiple alleles of a gene. At one allele, the terminating
nucleotide is complementary
to the locus of interest in the 5' overhang of said allele. The nucleotide is
incorporated and
terminates the reaction. At a different allele, the terminating nucleotide is
not complementary to the
locus of interest, which allows a non-terminating nucleotide to be
incorporated at the locus of
interest of the different allele. However, the terminating nucleotide is
complementary to a
nucleotide downstream from the locus of interest in the 5' overhang of said
different allele. The
sequence of the alleles can be determined by analyzing the patterns of
incorporation of the
terminating nucleotide. The terminating nucleotide can be labeled or
unlabeled.
In a another embodiment, the terminating nucleotide is a nucleotide that
terminates or
hinders the elongation reaction including but not limited to a
dideoxynucleotide, a
dideoxynucleotide derivative, a dideoxynucleotide analog, a dideoxynucleotide
homolog, a
dideoxynucleotide with a sulfur chemical group, a deoxynucleotide, a
deoxynucleotide derivative,
a deoxynucleotide homolog, a deoxynucleotide analog, a deoxynucleotide with a
sulfur chemical
57
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
group, arabinoside triphosphate, a arabinoside triphosphate analog, a
axabinoside triphosphate
homolog, or an arabinoside derivative.
In another embodiment, a terminating nucleotide labeled with one signal
generating moiety
tag, including but not limited to a fluorescent dye, can be used to determine
the sequence of the
alleles of a locus of interest. The use of a single nucleotide labeled with
one signal generating
moiety tag eliminates any difficulties that can arise when using different
fluorescent moieties. In
addition, using one nucleotide labeled with one signal generating moiety tag
to determine the
sequence of alleles of a locus of interest reduces the number of reactions,
and eliminates pipetting
errors.
For example, if the second primer contains the restriction enzyme recognition
site for
BsmFI, digestion will generate a 5' overhang of 4 bases. The second primer can
be designed such
that the locus of interest is located in the first position of the overhang. A
representative overhang
is depicted below, where R represents the locus of interest:
5' CAC
3' GTG R T G G
Overhang position 1 2 3 4
One nucleotide with one signal generating moiety tag can be used to determine
whether the
variable site is homozygous or heterozygous. For example, if the variable site
is adenine (A) or
guanine (G), then either adenine or guanine can be used to determine the
sequence of the alleles of
the locus of interest, provided that there is an adenine or guanine in the
overhang at position 2, 3, or
4.
For example, if the nucleotide in position 2 of the overhang is thymidine,
which is
complementary to adenine, then labeled ddATP, unlabeled dCTP, dGTP, and dTTP
can be used to
determine the sequence of the alleles of the locus of interest. The ddATP can
be labeled with any
signal generating moiety including but not limited to a fluorescent dye. Ifthe
template DNA is
homozygous for adenine, then labeled ddATP* will be incorporated at position 1
complementary to
the overhang at the alleles, and no nucleotide incorporation will be seen at
position 2, 3 or 4
complementary to the overhang.
Allele 1 5' CCC A*
3' GGG T T G G
Overhang position 1 2 3 4
58
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Allele 2 5' CCC A*
3' GGG T T G G
Overhang position 1 2 3 4
One signal will be seen corresponding to incorporation of labeled ddATP at
position 1
complementary to the overhang, which indicates that the individual is
homozygous for adenine at
this position. This method of labeling eliminates any difficulties that may
arise from using different
dyes that have different quantum coefficients.
Homozygous guanine:
If the template DNA is homozygous .for guanine, then no ddATP will be
incorporated at
position 1 complementary to the overhang, but ddATP will be incorporated at
the first available
position, which in this case is position 2 complementary to the overhang. For
example, if the
second position in the overhang corresponds to a thymidine, then:
Allele 1 5' CCC G AX
3' GGG C T G G
Overhang position 1 2 3 4
Allele 2 5' CCC G A*
3' GGG C T G G
Overhang position 1 2 3 4
One signal will be seen corresponding to incorporation of ddATP at position 2
complementary to the overhang, which indicates that the individual is
homozygous for guanine.
The molecules that are filled in at position 2 complementary to the overhang
will have a different
molecular weight than the molecules filled in at position 1 complementary to
the overhang.
Heterozygous condition:
Allele 1 5' CCC A*
3' GGG T T G G
Overhang position 1 2 3 4
Allele 2 5' CCC G A*
59
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
3' GGG C T G G
Overhang position 1 2 3 4
Two signals will be seen; the first signal corresponds to the ddATP filled in
at position one
complementary to the overhang and the second signal corresponds to the ddATP
filled in at position
2 complementary to the overhang. The two signals can be separated based on
molecular weight;
allele 1 and allele 2 will be separated by a single base pair, which allows
easy detection and
quantitation of the signals. Molecules filled in at position one can be
distinguished from molecules
filled in at position two using any method that discriminates based on
molecular weight including
but not limited to gel electrophoresis, capillary gel electrophoresis, DNA
sequencing, and mass
spectrometry. It is not necessary that the nucleotide.be labeled with a
chemical.moiety; the DNA
molecules corresponding to the different alleles can be separated based on
molecular weight.
If position 2 of the overhang is not complementary to adenine, it is possible
that positions 3
or 4 may be complementary to adenine. For example, position 3 of the overhang
may be
complementary to the nucleotide adenine, in which case labeled ddATP may be
used to determine
the sequence of both alleles.
Homozygous for adenine:
Allele 1 5' CCC A*
3' GGG T G T G
Overhang position 1 2 3 4
Allele 2 5' CCC A*
3' GGG T G T G
Overhang position 1 2 3 4
Homozygous for guanine:
Allele 1 5' CCC G C A*
3' GGG C G T G
Overhang position 1 2 3 4
Allele 2 5' CCC G C A*
3' GGG C G T G
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Overhang position 1 2 3 4
Heterozygous:
Allele 1 5' CCC A*
3' GGG T G T G
Overhang position 1 2 3 4
Allele 2 5' CCC G C A~
3' GGG C G T G
Overhang position 1 2 3 4
Two signals will be seen; the first signal corresponds to the ddATP filled in
at position 1
complementary to the overhang and the second signal corresponds to the ddATP
filled in at position
3 complementary to the overhang. The two signals can be separated based
on,molecular weight;
allele 1 and allele 2 will be separated by two bases, which can be detected
using any method that
discriminates based on molecular weight.
Alternatively, if positions 2 and 3 are not complementary to adenine (i. a
positions 2 and 3
of the overhang correspond to guanine, cytosine, or adenine) but position 4 is
complementary to
adenine, labeled ddATP can be used to determine the sequence of both alleles.
Homozygous for adenine:
Allele 1 5' CCC A*
3' GGG T G G T
Overhang position 1 2 3 4
Allele 2 5' CCC A*
3' GGG T G G T
Overhang position 1 2 3 4
One signal will be seen that corresponds to the molecular weight of molecules
filled in with
ddATP at position one complementary to the overhang, which indicates that the
individual is
homozygous for adenine at the variable site.
61
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Homozygous for guanine:
Allele 1 5' CCC G C C A*
3' GGG C G G T
Overhang position 1 2 3 4
Allele 2 5' CCC G C C Ax
3' GGG C G G T
Overhang position 1 2 3 4
One signal will be seen,that corresponds to the molecular weight of molecules
filled in at
position 4 complementary to the overhang, which, indicates that the individual
is homozygous for
guanine.
Heterozygous:
Allele 1 CCC A*
5'
3' GGG T G G T
Overhang 1 2 3 4
position
Allele 2 CCC G C C A'~
5'
3' GGG C G G T
Overhang 1 2 3 4
position
Two signals will be seen; the first signal corresponds to the ddATP filled in
at position one
complementary to the overhang and the second signal corresponds to the ddATP
filled in at position
4 complementary to the overhang. The two signals can be separated based on
molecular weight;
allele 1 and allele 2 will be separated by three bases, which allows detection
and quantitation of the
signals. The molecules filled in at position 1 and those filled in at position
4 can be distinguished
based on molecular weight.
As discussed above, if the variable site contains either adenine or guanine,
either labeled
adenine or labeled guanine can be used to determine the sequence of both
alleles. If positions 2, 3,
or 4 of the overhang are not complementary to adenine but one of the positions
is complementary to
a guanine, then labeled ddGTP can be used to determine whether the template
DNA is homozygous
or heterozygous for adenine or guanine. For example, if position 3 in the
overhang corresponds to a
62
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
cytosine then the following signals will be expected if the template DNA is
homozygous for
guanine, homozygous for adenine, or heterozygous:
Homozygous for guanine:
Allele 1 5' CCC G*
3' GGG C T C T
Overhang position 1 2 3 4
Allele 2 5' CCC G*
3' GGG C T C T
Overhang position 1 2 3 4
One signal will be seen that corresponds to the molecular weight of molecules
filled in with
ddGTP at position one complementary to the overhang, which indicates that the
individual is
homozygous for guanine.
Homozygous for adenine:
Allele 1 5' CCC A A G*
3' GGG T T C T
Overhang position 1 2 3 4
Allele 2 5' CCC A A G*
3' GGG T T C T
Overhang position 1 2 3 4
One signal will be seen that corresponds to the molecular weight of molecules
filled in at
position 3 complementary to the overhang, which indicates that the individual
is homozygous for
adenine at the variable site.
Heterozygous:
Allele 1 5' CCC G*
3' GGG C T C T
63
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Overhang position 1 2 3 4
Allele 2 S' CCC A A G*
3' GGG T T C T
S Overhang position 1 2 3 4
Two signals will be seen; the first signal corresponds to the ddGTP filled in
at position one
complementary to the overhang and the second signal corresponds to the ddGTP
filled in at position
3 complementary to the overhang. The two signals can be separated based on
molecular weight;
allele 1 and allele 2 will be separated by two bases, which allows easy
detection and quantitation of
the signals.
In another embodiment, the nucleotide labeled with a single chemical moiety,
which is used
to determine the sequence of alleles of interest, can be analyzed by a variety
of methods including
but not limited to fluorescence detection, DNA sequencing gel, capillary
electrophoresis on an
automated DNA sequencing machine, microchannel electrophoresis, and other
methods of
sequencing, mass spectrometry, time of flight mass spectrometry, quadrupole
mass spectrometry,
magnetic sector mass spectrometry, electric sector mass spectrometry infrared
spectrometry,
ultraviolet spectrometry, palentiostatic amperometry or by DNA hybridization
techniques including
Southern Blots, Slot Blots, Dot Blots, and DNA microarrays, wherein DNA
fragments would be
useful as both "probes" and "targets," ELISA, fluorimetry, Fluorescence
Resonance Energy
Transfer (FRET), SNP-IT, GeneChips, HuSNP, BeadArray, TaqMan assay, Invader
assay,
MassExtend, or MassCleaveT"" (hMC) method.
Some type IIS restriction enzymes also display alternative cutting as
discussed above. For
example, BsmFI will cut at 10/14 and 11/15 from the recognition site. However,
the cutting
2S patterns are not mutually exclusive; if the 11/15 cutting pattern is seen
at a particular sequence,
10/14 cutting is also seen. If the restriction enzyme BsmF I cuts at 10/14
from the recognition site,
the S' overhang will be X1XZX3X4. If BsmF I cuts 11/15 from the recognition
site, the S' overhang
will be XoXIXZX3. If position Xo of the overhang is complementary to the
labeled nucleotide, the
labeled nucleotide will be incorporated at position Xo and provides an
additional level of quality
assurance. It provides additional sequence information.
For example, if the variable site is adenine or guanine, and position 3 in the
overhang is
complementary to adenine, labeled ddATP can be used to determine the genotype
at the variable
site. If position 0 of the 11/1 S overhang contains the nucleotide
complementary to adenine, ddATP
will be filled in and an additional signal will be seen.
64
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Heterozygous:
10/14 Allele 1 5' CCA Ax
3' GGT T G T G
Overhang position 1 2 3 4
10/14 Allele 2 5' CCA G C A*
3' GGT C G T G
Overhang position 1 2 3 4
11/15 Allele 1 5' CC A~
3' GG T T G T
Overhang position 0 ~ 1 2 3
11/15 Allele 2 5' CC - A*
3' GG T C G T
Overhang position 0 1 2 3
Three signals are seen; one corresponding to the ddATP incorporated at
position 0
complementary to the overhang, one corresponding to the ddATP incorporated at
position 1
complementary to the overhang, and one corresponding to the ddATP incorporated
at position 3
complementary to the overhang. The molecules filled in at position 0, 1, and 3
complementary to
the overhang differ in molecular weight and can be separated using any
technique that discriminates
based on molecular weight including but not limited to gel electrophoresis,
and mass spectrometry.
For quantitating the ratio of one allele to another allele or when determining
the relative
amount of a mutant DNA sequence in the presence of wild type DNA sequence, an
accurate and
highly sensitive method of detection must be used. The alternate cutting
displayed by type IIS
restriction enzymes may increase the di~culty of determining ratios of one
allele to another allele
because the restriction enzyme may not display the alternate cutting (11/15)
pattern on the two
alleles equally. For example, allele 1 may be cut at 10/14 80% of the time,
and 11/15 20% of the
time. However, because the two alleles may differ in sequence, allele 2 may be
cut at 10/14 90% of
the time, and 11/15 20% of the time.
For purposes of quantitation, the alternate cutting problem can be eliminated
when the
nucleotide at position 0 of the overhang is not complementary to the labeled
nucleotide. For
example, if the variable site corresponds to adenine or guanine, and position
3 of the overhang is
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
complementary to adenine (i. e, a thymidine is located at position 3 of the
overhang), labeled ddATP
can be used to determine the genotype of the variable site. If position 0 of
the overhang generated
by the 11!15 cutting properties is not complementary to adenine, (i.e,
position 0 of the overhang
corresponds to guanine, cytosine, or adenine) no additional signal will be
seen from the fragments
that were cut 11/15 from the recognition site. Position 0 complementary to the
overhang can be
filled in with unlabeled nucleotide, eliminating any complexity seen from the
alternate cutting
pattern of restriction enzymes. This method provides a highly accurate method
for quantitating the
ratio of a variable site including but not limited to a mutation, or a single
nucleotide polymorphism.
For instance, if SNP X can be adenine or guanine, this method of labeling
allows
quantitation of the alleles that correspond to adenine and the alleles that
correspond to guanine,
without determining if the restriction enzyme displays any differences between
the alleles with
regard to alternate cutting patterns.
Heterozygous:
10/14 Allele 1 5' CCG A*
3' GGC T G T G
Overhang position 1 2 3 4
10/14 Allele 2 5' CCG G C A*
3' GGC C G T G
Overhang position 1 2 3 4
The overhang generated by the alternate cutting properties of BsmF I is
depicted below:
11115 Allele 1 5' CC
3' GG C T G T
Overhang position 0 1 2 3
11/15 Allele 2 5' CC
3' GG C C G T
Overhang position 0 1 2 3
After filling in with labeled ddATP and unlabeled dGTP, dCTP, dTTP, the
following
molecules would be generated:
66
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
11/15 Allele 1 5' CC G A*
3' GG C T G T
Overhang position 0 1 2 3
11/15 Allele 2 5' CC G G C A*
3' GG C C G T
Overhang position 0 1 2 3
Two signals are seen; one corresponding to the molecules filled in with ddATP
at position
one complementary to the overhang and one corresponding to the molecules
filled in with ddATP at
position 3 complementary to the overhang. Position 0 of the 11/15 overhang is
filled in with
unlabeled nucleotide, which eliminates any di~culty in quantitating a ratio
for the nucleotide at the
variable site on allele 1 and the nucleotide at the variable site on allele 2.
Any nucleotide can be used including adenine, adenine derivatives, adenine
homologues,
guanine, guanine derivatives, guanine homologues, cytosine, cytosine
derivatives, cytosine
homologues, thymidine, thymidine derivatives, or thymidine homologues, or any
combinations of
adenine, adenine derivatives, adenine homologues, guanine, guanine
derivatives, guanine
homologues, cytosine, cytosine derivatives, cytosine homologues, thymidine,
thymidine
derivatives, or thymidine homologues.
The nucleotide can be labeled with any chemical group or moiety, including but
not limited
to radioactive molecules, fluorescent molecules, antibodies, antibody
fragments, haptens,
carbohydrates, biotin, derivatives of biotin, phosphorescent moieties,
luminescent moieties,
electrochemiluminescent moieties, chromatic moieties, and moieties having a
detectable electron
spin resonance, electrical capacitance, dielectric constant or electrical
conductivity. The nucleotide
can be labeled with one or more than one type of chemical group or moiety.
In another embodiment, labeled and unlabeled nucleotides can be used. Any
combination
of deoxynucleotides and dideoxynucleotides can be used including but not
limited to labeled
dideoxynucleotides and labeled deoxynucleotides; labeled dideoxynucleotides
and unlabeled
deoxynucleotides; unlabeled dideoxynucleotides and unlabeled deoxynucleotides;
and unlabeled
dideoxynucleotides and labeled deoxynucleotides.
In another embodiment, nucleotides labeled with a chemical moiety can be used
in the PCR
reaction. Unlabeled nucleotides then are used to fill-in the 5' overhangs
generated after digestion
with the restriction enzyme. An unlabeled terminating nucleotide can be used
to in the presence of
unlabeled nucleotides to determine the sequence of the alleles of a locus of
interest.
67
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
For example, if labeled dTTP was used in the PCR reaction, the following 5'
overhang
would be generated after digestion with BsmF I:
10/14 Allele 1 5' CT*G A
3' GA C T G T G
Overhang position 1 2 3 4
10/14 Allele 2 5' CT*G G C A
3' GA C C G T G
Overhang position 1 2 3 4
Unlabeled ddATP, unlabeled dCTP, unlabeled dGTP, and unlabeled dTTP can be
used to
fill-in the 5' overhang. Two signals will be generated; one signal corresponds
to the DNA
molecules filled in with unlabeled ddATP at position 1 complementary to the
overhang and the
second signal corresponds to DNA molecules filled in with unlabeled ddATP at
position 3
complementary to the overhang. The DNA molecules can be separated based on
molecular weight
and can be detected by the fluorescence of the dTTP, which was incorporated
during the PCR
reaction.
The labeled DNA loci of interest sites can be analyzed by a variety of methods
including
but not limited to fluorescence detection, DNA sequencing gel, capillary
electrophoresis on an
automated DNA sequencing machine, microchannel electrophoresis, and other
methods of
sequencing, mass spectrometry, time of flight mass spectrometry, quadrupole
mass spectrometry,
magnetic sector mass spectrometry, electrie sector mass spectrometry infrared
spectrometry,
ultraviolet spectrometry, palentiostatic amperometry or by DNA hybridization
techniques including
Southern Blots, Slot Blots, Dot Blots, and DNA microarrays, wherein DNA
fragments would be
useful as both "probes" and "targets," ELISA, fluorimetry, Fluorescence
Resonance Energy
Transfer (FRET), SNP-IT, GeneChips, HuSNP, BeadArray, TaqMan assay, Invader
assay,
MassExtend, or MassCleaveT"~ (hMC) method.
This method of labeling is extremely sensitive and allows the detection of
alleles of a locus
of interest that are in various ratios including but not limited to 1:1, 1:2,
1:3, 1:4, 1:5, 1:6-1:10,
1:11-1:20, 1:21-1:30, 1:31-1:40, 1:41-1:50, 1:51-1:60, 1:61-1:70, 1:71-1:80,
1:81-1:90, 1:91:1:100,
1:101-1:200, 1:250, 1:251-1:300, 1:301-1:400, 1:401-1:500, 1:501-1:600, 1:601-
1:700, 1:701-
1:800, 1:801-1:900, 1:901-1:1000, 1:1001-1:2000, 1:2001-1:3000, 1:3001-1:4000,
1:4001-1:5000,
1:5001-1:6000, 1:6001-1:7000, 1:7001-1:8000, 1:8001-1:9000, 1:9001-1:10,000;
1:10,001-
1:20,000, 1:20,001:1:30,000, 1:30,001-1:40,000, 1:40,001-1:50,000, and greater
than 1:50,000.
68
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
For example, this method of labeling allows one nucleotide labeled with one
signal
generating moiety to be used to determine the sequence of alleles at a SNP
locus, or detect a
mutant allele amongst a population of normal alleles, or detect an allele
encoding antibiotic
resistance from a bacterial cell amongst alleles from antibiotic sensitive
bacteria, or detect an allele
from a drug resistant virus amongst alleles from drug-sensitive virus, or
detect an allele from a non-
pathogenic bacterial strain amongst alleles from a pathogenic bacterial
strain.
As shown above, a single nucleotide can be used to determine the sequence of
the alleles at
a particular locus of interest. This method is especially useful for
determining if an individual is
homozygous or heterozygous for a particular mutation or to determine the
sequence of the alleles at
a particular SNP site. This method of labeling eliminates any errors caused by
the quantum
coefficients of various dyes. It also allows the reaction to proceed in a
single reaction vessel
including but not limited to a well of a microtiter plate, or a single
eppendorf tube.
This method of labeling is especially useful for the detection of multiple
genetic signals in
the same sample. For example, this method is useful for the detection of fetal
DNA in the blood,
serum, or plasma of a pregnant female, which contains both maternal DNA and
fetal DNA. The
maternal DNA and fetal DNA may be present in the blood, serum or plasma at
ratios such as 97:3;
however, the above-described method can be used to detect the fetal DNA. This
method of labeling
can be used to detect two, three, four or more than four different genetic
signals in the sample
population
This method of labeling is especially useful for the detection of a mutant
allele that is
among a large population of wild type alleles. Furthermore, this method of
labeling allows the
detection of a single mutant cell in a large population of wild type cells.
For example, this method
of labeling can be used to detect a single cancerous cell among a large
population of normal cells.
Typically, cancerous cells have mutations in the DNA sequence. The mutant DNA
sequence can be
identified even if there is a large background of wild type DNA sequence. This
method of labeling
can be used to screen, detect, or diagnosis any type of cancer including but
not limited to colon,
renal, breast, bladder, liver, kidney, brain, lung, prostate, and cancers of
the blood including
leukemia.
This labeling method can also be used to detect pathogenic organisms,
including but not
limited to bacteria, fungi, viruses, protozoa, and mycobacteria. It can also
be used to discriminate
between pathogenic strains of microorganism and non-pathogenic strains of
microorganisms
including but not limited to bacteria, fungi, viruses, protozoa, and
mycobacteria.
For example, there are several strains of Eschericlaia coli (E. cola, and most
are non-
pathogenic. However, several strains, such as E. coli 0157 are pathogenic.
There are genetic
differences between non-pathogenic E. coli strains and pathogenic E. coli. The
above described
69
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
method of labeling can be used to detect pathogenic microorganisms in a large
population of non-
pathogenic organisms, which are sometimes associated with the normal flora of
an individual.
VI. Analysis of the locus of interest
The loci of interest can be analyzed by a variety of methods including but not
limited to
fluorescence detection, DNA sequencing gel, capillary electrophoresis on an
automated DNA
sequencing machine, (e.g. the ABI Prism 3100 Genetic Analyzer or the ABI Prism
3700 Genetic
Analyzer), microchannel electrophoresis, and other methods of sequencing,
Sanger dideoxy
sequencing, mass spectrometry, time of flight mass spectrometry, quadrupole
mass spectrometry,
magnetic sector mass spectrometry, electric sector mass spectrometry infrared
spectrometry,
ultraviolet spectrometry, palentiostatic amperometry or by DNA hybridization
techniques including
Southern Blot, Slot Blot, Dot Blot, and DNA microarray, wherein DNA fragments
would be useful
as both "probes" and "targets," ELISA, fluorimetry, fluorescence polarization,
Fluorescence
Resonance Energy Transfer (FRET), SNP-IT, GeneChips, HuSNP, BeadArray, TaqMan
assay,
Invader assay, MassExtend, or MassCleaveT"" (hMC) method.
The loci of interest can be analyzed using gel electrophoresis followed by
fluorescence
detection of the incorporated nucleotide. Another method to analyze or read
the loci of interest is to
use a fluorescent plate reader or fluorimeter directly on the 96-well
streptavidin coated plates. The
plate can be placed onto a fluorescent plate reader or scanner such as the
Pharmacia 9200 Typhoon
to read each locus of interest.
Alternatively, the PCR products of the loci of interest can be pooled and
after "filling in"
(FIG. 10), the products can be separated by size, using any method appropriate
for the same, and
then analyzed using a variety of techniques including but not limited to
fluorescence detection,
DNA sequencing gel, capillary electrophoresis on an automated DNA sequencing
machine,
microchannel electrophoresis, other methods of sequencing, Sanger dideoxy
sequencing, DNA
hybridization techniques including Southern Blot, Slot Blot, Dot Blot, and DNA
microarray, mass
spectrometry, time of flight mass spectrometry, quadrupole mass spectrometry,
magnetic sector
mass spectrometry, electric sector mass spectrometry infrared spectrometry,
ultraviolet
spectrometry, palentiostatic amperometry. For example, polyacrylamide gel
electrophoresis can be
used to separate DNA by size and the gel can be scanned to determine the color
of fluorescence in
each band (using e.g., ABI 377 DNA sequencing machine or a Pharmacia Typhoon
9200).
In another embodiment, the sequence of the locus of interest can be determined
by
detecting the incorporation of a nucleotide that is 3' to the locus of
interest, wherein said nucleotide
is a different nucleotide from the possible nucleotides at the locus of
interest. This embodiment is
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
especially useful for the sequencing and detection of SNPs. The e~ciency and
rate at which DNA
polymerases incorporate nucleotides varies for each nucleotide.
According to the data from the Human Genome Project, 99% of all SNPs are
binary. The
sequence of the human genome can be used to determine a nucleotide that is 3'
to the SNP of
interest. When a nucleotide that is 3' to the SNP site differs from the
possible nucleotides at the
SNP site, a nucleotide that is one or more than one base 3' to the SNP can be
used to determine the
sequence of the SNP site.
For example, suppose the sequence of SNP X on chromosome 13 is to be
determined. The
sequence of the human genome indicates that SNP X can either be adenosine or
guanine and that a
nucleotide 3' to the locus of interest is a thymidine. A primer that contains
a restriction enzyme
recognition site for BsmF I, which is designed to be 13 bases from the locus
of interest after
amplification, is used to amplify a DNA fragment containing SNP X. Digestion
with the restriction
enzyme BsmF I generates a 5' overhang that contains the locus of interest,
which can either be
adenosine or guanine. The digestion products can be split into two "fill in"
reactions: one contains
1 S dTTP, and the other reaction contains dCTP. If the locus of interest is
homozygous for guanine,
only the DNA molecules that were mixed with dCTP will be filled in. If the
locus of interest is
homozygous for adenosine, only the DNA molecules that were mixed with dTTP
will be filled in.
If the locus of interest is heterozygous, the DNA molecules that were mixed
with dCTP will be
filled in as well as the DNA molecules that were mixed with dTTP. After
washing to remove the
excess dNTP, the samples are filled in with labeled ddATP, which is
complimentary to the
nucleotide (thymidine) that is 3' to the locus of interest. The DNA molecules
that were filled in by
the previous reaction will be filled in with labeled ddATP. If the individual
is homozygous for
adenosine, the DNA molecules that were mixed with dTTP subsequently will be
filled in with the
labeled ddATP. However, the DNA molecules that were mixed with dCTP, would not
have
incorporated that nucleotide, and therefore, could not incorporate the ddATP.
Detection of labeled
ddATP only in the molecules that were mixed with dTTP indicates that the
nucleotide at SNP X on
chromosome 13 is adenosine.
In another embodiment, large scale screening for the presence or absence of
single
nucleotide polymorphisms or mutations can be performed. One to tens to
hundreds to thousands of
loci of interest on a single chromosome or on multiple chromosomes can be
amplified with primers
as described above in the "Primer Design" section. The primers can be designed
so that each
amplified loci of interest is of a different size (FIG. 2). The multiple loci
of interest can be of a
DNA sample from one individual representing multiple loci of interest on a
single chromosome,
multiple chromosomes, multiple genes, a single gene, or any combination
thereof.
71
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
When human data is being analyzed, the known sequence can be a specific
sequence that
has been determined from one individual (including e.g. the individual whose
DNA is currently
being analyzed), or it can be a consensus sequence such as that published as
part of the human
genome.
Ratio of Alleles at Heterozygous Locus of Interest
In one embodiment, the ratio of alleles at a heterozygous locus of interest
can be calculated.
The intensity of a nucleotide at the loci of interest can be quantified using
any number of computer
programs including but not limited to GeneScan and ImageQuant. For example,
for a heterozygous
SNP, there are two nucleotides , and each should be present in a 1:1 ratio. In
a preferred
embodiment, the ratio of multiple heterozygous SNPs can be calculated.
In one embodiment, the ratio for a variable nucleotide at alleles at a
heterozygous locus of
interest can be calculated. The intensity of each variable nucleotide present
at the loci of interest
can be quantified using any number of computer programs including but not
limited to GeneScan
and ImageQuant. For example, for a heterozygous SNP, there will be two
nucleotides present, and
each may be present in a 1:1 ratio. In a preferred embodiment, the ratio of
multiple heterozygous
SNPs can be calculated.
In another embodiment, the ratio of alleles at a heterozygous locus of
interest on a .
chromosome is summed and compared to the ratio of alleles at a heterozygous
locus of interest on a
different chromosome. In a preferred embodiment, the ratio of alleles at
multiple heterozygous loci
of interest on a chromosome is summed and compared to the ratio of alleles at
multiple
heterozygous loci of interest on a different chromosome. The ratio obtained
from SNP 1, SNP 2,
SNP 3, SNP 4, etc on chromosome 1 can be summed. This ratio can then be
compared to the ratio
obtained from SNP A, SNP ~, SNP C, SNP D, etc.
For example, 100 SNPs can be analyzed on chromosome 1. ~f these 100 SNPs,
assume 50
are heterozygous. The ratio of the alleles at heterozygous SNPs on chromosome
1 can be summed,
and should give a ratio of approximately 50:50. Likewise, of 100 SNPs analyzed
on chromosome
21, assume 50 are heterozygous. The ratio of alleles at heterozygous SNPs on
chromosome 21 is
summed. With a normal number of chromosomes, the ratio should be approximately
50:50, and
thus there should be no difference between the ratio obtained from chromosome
1 and 21.
However, if there is an additional copy of chromosome 21, an additional allele
will be provided,
and the ratio should be approximately 66:33. Thus, the ratio for nucleotides
at heterozygous SNPs
can be used to detect the presence or absence of chromosomal abnormalities.
Any chromosomal
abnormality can be detected including aneuploidy, polyploidy, inversion, a
trisomy, a monosomy,
duplication, deletion, deletion of a part of a chromosome, addition, addition
of a part of
chromosome, insertion, a fragment of a chromosome, a region of a chromosome,
chromosomal
72
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
rearrangement, and translocation. The method is especially useful for the
detection of trisomy 13,
trisomy 18, trisomy 21, XXY, and XYY.
The present invention provides a method to quantitate a ratio for the alleles
at a
heterozygous locus of interest. The loci of interest include but are not
limited to single nucleotide
polymorphisms, mutations. There is no need to amplify the entire sequence of a
gene or to
quantitate the amount of a particular gene product. The present invention does
not rely on
quantitative PCR.
Detection of Fetal Chromosomal Abnormalities
As discussed above in the section entitled "DNA template," the template DNA
can be
obtained from a sample of a pregnant female, wherein the template DNA
comprises maternal
template DNA and fetal template DNA. In one embodiment, the template DNA is
obtained from
the blood of a pregnant female. In a preferred embodiment, the template DNA is
obtained from the
plasma or serum from the blood of a pregnant female.
In one embodiment, the template DNA from the sample from the pregnant female
comprises both maternal template DNA and fetal template DNA. In another
embodiment, maternal
template DNA is obtained from any nucleic acid containing source including but
not limited to cell,
tissue, blood, serum, plasma, saliva, urine, tears, vaginal secretion, lymph
fluid, cerebrospinal fluid,>
mucosa secretion, peritoneal fluid, ascitic fluid, fecal matter, or body
exudates, and sequenced to
identify homozygous or heterozygous loci of interest, which are the loci of
interest analyzed on the
template DNA obtained from the sample from the pregnant female.
In a preferred embodiment, the sequence'of the alleles of multiple loci of
interest on
maternal template DNA is determined to identify homozygous loci of interest.
In another
embodiment, the sequence of the alleles of multiple loci of interest on
maternal template DNA is
determined to identify heterozygous loci of interest. The sequence of the
alleles of multiple loci of
interest on maternal template DNA can be determined in a single reaction or in
multiple reactions.
For example, if 100 maternal loci of interest on chromosome 21 and 100
maternal loci of
interest on chromosome 1 are analyzed, one would predict approximately 50 loci
of interest on each
chromosome to be homozygous and 50 to be heterozygous. The 50 homozygous loci
of interest, or
the 50 heterozygous loci of interest or the 50 homozygous and 50 heterozygous
loci of interest, or
any combination of the homozygous and heterozygous loci of interest on each
chromosome can be
analyzed using the template DNA from the sample from the pregnant female.
The locus of interest on the template DNA from the sample of the pregnant
female is
analyzed using the amplification, isolation, digestion, fill in, and detection
methods described
above. The same primers used to analyze the locus of interest on the maternal
template DNA are
used to screen the template DNA from the sample from the pregnant female. Any
number of loci of
73
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
interest can be analyzed on the template DNA from the sample from the pregnant
female. For
example, l, 1-5, 5-10, 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90,
90-100, 100-150,
150-200, 200-250, 250-300, 300-500, 500-1000, 1000-2000, 2000-3000, 3000-4000
or more than
4000 homozygous maternal loci of interest can be analyzed in the template DNA
from the sample
from the pregnant female. In a preferred embodiment, multiple loci of interest
on multiple
chromosomes are analyzed.
From the population of homozygous maternal loci of interest, there will be
both
heterozygous and homozygous loci of interest from the template DNA from the
sample from the
pregnant female; the heterozygous loci of interest can be further analyzed. At
heterozygous loci of
interest, the ratio of alleles can be used to determine the number of
chromosomes that are present.
The percentage of fetal DNA present in the sample from the pregnant female can
be
calculated by determining the ratio of alleles at a heterozygous locus of
interest on a chromosome
that is not typically associated with a chromosomal abnormality. In a
preferred embodiment, the
ratio of alleles at multiple heterozygous loci of interest on a chromosome can
be used to determine
the percentage of fetal DNA. For example, chromosome l, which is the largest
chromosome in the
human genome, can be used to determine the percentage of fetal DNA.
For example, suppose SNP X is homozygous at the maternal template DNA (A/A).
At
SNP X, the template DNA from the sample from the pregnant female, which can
contain both fetal
DNA and maternal DNA, is heterozygous (A/G). The nucleotide guanine represents
the fetal DNA
because at SNP X the mother is homozygous, and thus the guanine is attributed
to the fetal DNA.
The guanine at SNP X can be used to calculate the percentage of fetal DNA in
the sample.
Alternatively, multiple loci of interest on two or more chromosomes can be
examined to
determine the percentage of fetal DNA. For example, multiple loci of interest
can be examined on
chromosomes 13, and 18 to determine the percentage of fetal DNA because
organisms with
chromosomal abnormalities at chromosome 13 and 18 are not viable.
Alternatively, for a male fetus, a marker on the Y chromosome can be used to
determine the
amount of fetal DNA present in the sample. A panel of serial dilutions can be
made using the
template DNA isolated from the sample from the pregnant female, and
quantitative PCR analysis
performed. Two PCR reactions can be performed: one PCR reaction to amplify a
marker on the Y
chromosome, for example SRY, and the other reaction to amplify a region on any
of the autosomal
chromosomes. The amount of fetal DNA can be calculated using the following
formula:
Percent Fetal DNA: (last dilution Y chromosome detected l last dilution
autosomal
chromosome detected) *2 * 100.
If at SNP A, the mother is homozygous AIA, and the fetus is heterozygous AIG,
then the
ratio of A:G can be used to detect chromosomal abnormalities. If the fetal DNA
is fifty percent
74
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
(50%) of the DNA in the maternal blood, then at SNP A where the maternal
nucleotide is an
adenine and the other nucleotide is a guanine, one would expect the ratio of
adenine (two adenines
from the maternal template DNA and one from the fetal template DNA) to guanine
(from the fetal
template DNA) to be 25:75 or 0.33. However, if the fetus has a trisomy of this
particular
chromosome, and the additional chromosome is contributed by the mother, and
thus an additional
adenine nucleotide is present, then one would expect the ratio of 0.25 (50
(G)/ (2*50 maternal A +
2*50 fetal A). Thus, there is a difference of 8% between the ratio obtained
from a chromosome
present in two copies, and a chromosome present in a trisomy condition. On the
other hand, if the
additional chromosome is contributed by the father, and thus, an additional
guanine is present, then
one would expect the ratio of 0.66 (2*50 for G fetal allele / (2*50 maternal A
allele + 50 for fetal A
allele).
However, if the fetal DNA is 40% of the DNA in the maternal blood, the
expected ratio
without a trisomy is 0.25 (40 for fetal G allele/ 2*60 for maternal A allele +
1 *60 for fetal A allele).
If the fetus has a trisomy, and the additional chromosome is provided by the
mother, the expected
ratio would be 0.20 (40 for fetal G allele / (2*60 for maternal A allele + 2*
40 for fetal A allele). A
5% difference between the ratios obtained from a chromosome present in two
copies and a
chromosome present in the Trisomy condition is detected.
In another embodiment, multiple loci of interest on multiple chromosomes can
be
examined. The ratios for the alleles at each heterozygous locus of interest on
a chromosome can be
summed and compared to the ratios for the alleles at each locus of interest on
a different
chromosome. The chromosomes that are compared can be of human origin, and
include but are not
limited to chromosomes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, 20, 21, 22, X,
and Y. The ratio obtained from multiple chromosomes can be compared to the
ratio obtained for a
single chromosome or from multiple chromosomes.
In one embodiment, one of the chromosomes used in the comparison can be
chromosome
13, 15, 16; 18, 21, 22, X or Y. In a preferred embodiment, the ratios on
chromosomes 13, 18, and
21 are compared.
For example, assuming 40% fetal DNA in the sample from the pregnant female,
the ratio of
the alleles at a heterozygous locus of interest on chromosome 1 will be 0.25
(40 for fetal G allele/
(2*60 for maternal A allele + 40 for fetal A allele). Likewise, the ratio of
alleles at a heterozygous
locus of interest on chromosome 21 will be present in a ratio of 0.25.
However, in a fetus with
trisomy 21 where the additional chromosome is contributed by the mother, the
nucleotides at a
heterozygous locus of interest on chromosome 21 will be present in a ratio of
0.20 (40 for fetal G
allele/(60*2 for maternal A allele + 40* 2 for fetal A allele). By contrast,
the ratio for chromosome
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
1 will remain at 0.25, and thus the 5% difference in ratios will signify an
additional chromosome.
One to tens to hundreds to thousands of loci of interest can be analyzed.
In another embodiment, the loci of interest on the template DNA from the
sample from the
pregnant female can be genotyped without prior identification of the
homozygous maternal loci of
interest. It is not necessary to genotype the maternal template DNA prior to
analysis of the template
DNA containing both maternal and fetal template DNA.
The ratio of the alleles at the loci of interest can be used to determine the
presence or
absence of a chromosomal abnormality. The template DNA from the sample from
the pregnant
female contains both maternal template DNA and fetal template DNA. There are 3
possibilities at
each SNP for either the maternal template DNA or the fetal template DNA:
heterozygous,
homozygous for allele l, or homozygous for allele 2. The possible nucleotide
ratios for a SNP that
is either an adenine or a guanine are shown in Table II. The ratios presented
in Table II are
calculated with the fetal DNA at 50% of the DNA in the sample from the
pregnant female.
Table II. Ratios for nucleotides for a heterozygous SNP.
Fetal SNP
Maternal SNP A/A G/G A/G
A/A 100% A N/A 75% A, 25%G-
G/G N/A 100% G 25% A,75% G
-
A/G 75% A, 25%G I 50% A, 50%
25% A, 75% G G
There are three nucleotide ratios: 100% of a single nucleotide, 50:50, or
75:25. These
ratios will vary depending on the amount of fetal DNA present in sample from
the pregnant female.
However, the percentage of fetal DNA should be constant regardless of the
chromosome analyzed.
Therefore, if chromosomes are present in two copies, the above calculated
ratios will be seen.
On the other hand, these percentages will vary when an additional chromosome
is present.
For example, assume that SNP X can be adenine or guanine, and that the
percentage of fetal DNA
in the sample from the pregnant female is 50%. Analysis of the loci of
interest on chromosome 1
will provide the ratios discussed above: 100:0, 50:50, and 75:25. The possible
ratios for a SNP that
is A/G with an additional chromosome are provided in Table III.
Table III: Nucleotides ratios at a SNP when an additional
copy of a chromosome is present
Fetal SNP
MaternalA/AlA G/G/G A/G/G A/A/G
SNPX
76
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
A/A 100% A N/A 60% A, 40%G 80% A, 20%G
G/G N/A 100% G 20% A, 80% 40% A, 60%
G G
A/G 80% A, 20% 20% A, 80% 40% A, 60% 60% A, 40%
G G G G
The possible ratios for the alleles at a heterozygous SNP with an additional
copy of a
chromosome are: 0:100, 40:60, and 20:80. Two of these ratios, 40:60, and 20:80
differ from the
ratios of alleles at heterozygous SNPs obtained with two copies of a
chromosome. As discussed
above, the ratios for the nucleotides at a heterozygous SNP depend on the
amount of fetal DNA
present in the sample. However, the ratios, whatever they are, will remain
constant across
chromosomes unless there is a chromosomal abnormality.
The ratio of alleles at heterozygous loci of interest on a chromosome can be
compared to
the ratio for alleles at heterozygous loci of interest on a different
chromosome. For example, the
ratio for multiple loci of interest on chromosome 1 (the ratio at SNP 1, SNP
2, SNP 3, SNP 4, etc.)
can be compared to the ratio for multiple loci of interest on chromosome 21
(the ratio at SNP A,
SNP B, SNP C, SNP D, etc.). Any chromosome can be compared to any other
chromosome. There
is no limit to the number of chromosomes that can be compared.
Referring back to the data in Tables II and III, the ratios for nucleotides at
a heterozygous
SNP on chromosome l, which was present in two copies, were 25:75, and 50:50.
On the other, the
ratio for nucleotides at a heterozygous SNP on chromosome 21, which was
present in three copies,
were 40:60, and 20:80. The difference between these two ratios indicates a
chromosomal
abnormality. The ratios can be pre-calculated for the full range of varying
degrees of fetal DNA
present in the maternal serum. Tables II and III demonstrate that both
maternal homozygous and
heterozygous loci of interest can be used to detect the presence of a fetal
chromosomal abnormality.
The above example illustrates how the ratios for nucleotides at heterozygous
SNPs can be
used to detect the presence of an additional chromosome. The same type of
analysis can be used to
detect chromosomal rearrangements, translocations, mini-chromosomes,
duplications of regions of
chromosomes, monosomies, deletions of regions of chromosomes, and fragments of
chromosomes.
The method does not require genotyping of the mother or the father, however,
it may be done to
reduce the number of SNPs that need to be analyzed with the plasma sample.
The present invention does not quantitate the amount of a fetal gene product,
nor is the
utility of the present invention limited to the analysis of genes found on the
Y chromosome. The
present invention does not merely rely on the detection of a paternally
inherited nucleic acid, rather,
the present invention provides a method that allows the ratio of maternal to
fetal alleles at loci of
interest, including SNPs, to be calculated.
In another embodiment, a single allele at a locus of interest can be used to
determine the
presence or absence of a chromosomal abnormality and detect a genetic disorder
in the fetus. In a
77
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
preferred embodiment, the maternal allele at a locus of interest is used to
determine the presence or
absence of a chromosomal abnormality in the fetus. The biological mother can
be genotyped to
identify a homozygous locus of interest. Likewise, the biological father can
be genotyped to
identify a homozygous locus of interest. The locus of interest wherein the
maternal template DNA
is homozygous for one allele and the paternal template DNA is homozygous for
the other allele is
analyzed using the template DNA obtained from the plasma of the mother, which
contains both
maternal and fetal template DNA. Any number of loci of interest can be
analyzed including but not
limited to 1, 1-5, 5-10, 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-
90, 90-100, 100-150;
150-200, 200-250, 250-300, 300-500, 500-1000, 1000-2000, 2000-3000, 3000-4000,
4000-8,000,
8000-16000, 16000-32000 or greater than 32000 loci of interest.
In a preferred embodiment, the signal from the maternal genome and the fetal
allele, which
was inherited from the mother, at the locus of interest is quantitated. For
example, if the 5'
overhang, which is generated after digestion with the type IIS enzyme, is
filled in with a nucleotide
that is fluorescently labeled, the intensity of the incorporated dye can be
quantitated
Maternal Template DNA - - Homozygous for Adenine
Allele 1 5' CCG A
3' GGC T G T G
Overhang position 1 2 3 4
Allcle 2 5' CCG A°°
3' GGC T G T G
Overhang position 1 2 3 4
Paternal Template DNA - - Homozygous for Cytosine
Allele 1 5' CCG C*
3' GGC G G T G
Overhang position 1 2 3 4
Allele 2 5' CCG C~
3' GGC T G T G
78
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Overhang position 1 2 3 4
Template DNA in the plasma - - both maternal template DNA and fetal template
DNA
Maternal Template DNA - - Homozygous for Adenine
Allele 1 5' CCG A*
3' GGC T G T G
Overhang position 1 2 3 4
Allele 2 5' CCG A*
3' GGC T G T G
Overhang position 1 2 3 4
Fetal Template DNA - -Heterozygous
Allele 1 5' CCG A*
3' GGC T G T G
Overhang position 1 2 3 4
Allele 2 5' CCG ddC
3' GGC T G T G
Overhang position 1 2 3 4
The template DNA obtained from the plasma of the pregnant female is filled in
with labeled
ddATP, and unlabeled ddCTP (depicted as ddC above), ddGTP, and ddTTP. The
plasma DNA
contains two maternal adenine alleles, and one fetal adenine allele. By
filling in with labeled
ddATP and unlabeled ddCTP, only the maternal allele and the fetal allele
inherited from the mother
are detected. The paternal allele is not detected in this manner. The fill-in
reactions can be
performed as described in the Examples below.
A single locus of interest can be analyzed or multiple loci of interest. The
intensity of the
maternal allele at multiple loci of interest can be quantitated. An average
can be calculated for a
chromosome and compared to the average obtained for a different chromosome.
For example, the
average intensity of the maternal allele and the fetal allele inherited from
the mother at chromosome
79
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
1 can be compared to the average intensity of the maternal allele and the
fetal allele inherited from
the mother at chromosomes 13, 18, or 21. In a preferred embodiment,
chromosomes 13, 15, 18, 21,
22, X and Y, when applicable, are compared.
The signal from a locus of interest may be stronger than another locus of
interest.
However, there is no reason why the signal from the locus of interest on one
chromosome would be
stronger than the signal from the locus of interest on another chromosome.
While the signal from
various loci of interest may be variable, the variation should be seen across
the genome. The
average signal of the loci of interest should be the same when any chromosomes
are compared.
The conditions of the PCR reaction can be optimized so that an equivalent
amount of PCR
product is produced. For example, the concentration of the primers, the
concentration of
nucleotides, and the number of cycles for each loci of interest can be
optimized. In addition, the
fill-in reactions can be done under conditions such that any increase in a
specific allele can be
detected. The fill-in reaction conditions can be optimized to detect any
increase in the allele of
interest including but not limited to the concentration of reagents, the time
of the fill-in reaction,
and the temperature of the reaction.
With a normal genetic karyotype, the signal at each locus of interest comprise
signal from
the maternal genome, and signal from the fetal allele, which was inherited
from the mother. The
percent of fetal DNA in the sample remains constant, regardless of the
chromosome that is
analyzed. For example, if at SNP X, the maternal genome is A/A, and the
paternal genome is G/G,
then the fetal genome will be A/G, and the fetal adenine allele will comprise
a specified percentage
of the signal from the adenine allele. If the percentage of fetal DNA is 20%
in the maternal plasma,
then the fetal adenine allele will contribute 20% of the signal for the
adenine allele. The
contribution of the fetal allele, which was inherited from the mother, will be
constant for any locus
of interest that is analyzed.
When there is a chromosomal abnormality, the signal from the maternal genome
and the
fetal allele, which was inherited from the mother, at the loci of interest
will differ from the signal
observed for other chromosomes. For example, with a Trisomy, the signal at the
locus of interest
will comprise the maternal genome and two fetal alleles, which were inherited
from the mother.
The signal from the loci of interest for the chromosome that is present in
three copies will have the
contribution of an additional fetal allele, which will alter the signal of the
alleles at these loci of
interest.
In another embodiment, a ratio can be calculated using a single allele and a
standard DNA
of known quantity. In a preferred embodiment, a ratio is calculated using the
alleles of the maternal
genome, and the fetal allele, which was inherited from the mother, and a
standard DNA. The
biological mother can be genotyped to identify a homozygous locus of interest.
Likewise, the
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
biological father can be genotyped to identify a homozygous locus of interest.
The locus of interest
wherein the maternal template DNA is homozygous for one allele and the
paternal template DNA is
homozygous for the other allele is analyzed using the template DNA obtained
from the plasma of
the mother, which contains both maternal and fetal template DNA.
In a preferred embodiment, the signal from the maternal genome and the fetal
allele, which
was inherited from the mother, at the locus of interest is quantitated. For
example, if the 5'
overhang, which is generated after digestion with the type IIS enzyme, is
filled in with a nucleotide
that is fluorescently labeled, the intensity of the incorporated dye can be
quantitated.
Template DNA in the plasma - - both maternal template DNA and fetal template
DNA
Maternal Template DNA - - Homozygous for Adenine
Allele 1 S' CCG Ax
3' GGC T G T G
Overhang position 1 2 3 4
Allele 2 5' CCG A°~
3' GGC T G T G
Overhang position 1 2 3 4
Fetal Template DNA - -Heterozygous
Allele 1 5' CCG A°~
3' GGC T G T G
Overhang position 1 2 3 4
Allele 2 5' CCG ddC
3' GGC T G T G
Overhang position 1 2 3 4
The template DNA obtained from the plasma of the pregnant female is filled in
with labeled
ddATP, and unlabeled ddCTP (depicted as ddC above), ddGTP, and ddTTP. The
plasma DNA
contains two maternal adenine alleles, and one fetal adenine allele. By
filling in with labeled
81
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
ddATP and unlabeled ddCTP, only the maternal allele and the fetal allele
inherited from the mother
are detected.
A single locus of interest or multiple loci of interest can be analyzed. For
each locus of
interest, a DNA molecule is designed to migrate at about the same position as
the locus of interest.
In a preferred embodiment, the DNA molecule is of known quantity. A ratio is
calculated using the
alleles of the maternal genome and the fetal allele, which was inherited from
the mother, and the
DNA molecule designed to migrate at about the same position as the locus of
interest. For
example, if the locus of interest is designed to migrate at 30 base pairs, the
DNA molecule can be
designed to migrate at about 30 base pairs including but not limited to 20-
25., 25-30, 30-35, 35-45,
and greater than 45. The alleles of the maternal genome and the fetal allele,
which was inherited
from the mother, and the standard DNA molecule can be analyzed in the same
reaction or can be
analyzed in a separate reaction. The alleles of the maternal genome and the
fetal allele, which was
inherited from the mother, and the standard DNA molecule can be analyzed in
the same lane of a
gel or can be analyzed in separate lanes of a gel. The use of standard DNA
molecules of known
quantity, which are designed to migrate at the same position as the loci of
interest, will correct for
various factors including but not limited to the intensity of the bands
relative to the location on the
gel.
The ratio of multiple loci of interest on a chromosome can be quantitated, and
an average
calculated. The average can be compared to the average obtained for another
chromosome. The
ratio is used to indicate the presence or absence of a chromosomal
abnormality. Analysis of the
alleles of the maternal genome and the fetal allele also allows detection of
single gene or mufti-gene
genetic disorders.
Any chromosome of any organism can be analyzed using the methods of the
invention. For
example, in humans, chromosome 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20,
21, 22, X or Y can be analyzed using the methods of the invention. The ratio
for the alleles at a
heterozygous locus of interest on any chromosome can be compared to the ratio
for the alleles at a
heterozygous locus of interest on any other chromosome.
Thus, the present invention provides a non-invasive technique, which is
independent of
fetal cell isolation, for rapid, accurate and definitive detection of
chromosome abnormalities in a
fetus. The present invention also provides a non-invasive method for
determining the sequence of
DNA from a fetus. The present invention can be used to detect any alternation
in gene sequence as
compared to the wild type sequence including but not limited to point
mutation, reading frame shift,
transition, transversion, addition, insertion, deletion, addition-deletion,
frame-shift, missense,
reverse mutation, and microsatellite alteration.
82
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Detection of Fetal Chromosomal Abnormalities Using Short Tandem Repeats
Short tandem repeats (STRs) are short sequences of DNA, normally of 2-5 base
pairs in
length, which are repeated numerous times in a head-tail manner. Tandemly
repeated DNA
sequences are widespread throughout the human genome, and show sufficient
variability among the
individuals in a population. Minisatellites have core repeats with 9-80 base
pairs.
In another embodiment, short tandem repeats can be used to detect fetal
chromosomal
abnormalities. Template DNA can be obtained from a nucleic acid containing
sample including but
not limited to cell, tissue, blood, serum, plasma, saliva, urine, tears,
vaginal secretion, lymph fluid,
cerebrospinal fluid, mucosa secretion, peritoneal fluid, ascitic fluid, fecal
matter, or body exudates.
In another embodiment, a cell lysis inhibitor is added to the nucleic acid
containing sample. In a
preferred embodiment, the template DNA is obtained from the blood of a
pregnant female. In
another embodiment, the template DNA is obtained from the plasma or serum from
the blood of a
pregnant female.
The template DNA obtained from the blood of the pregnant female will contain
both fetal
DNA and maternal DNA. The fetal DNA comprises STRs from the mother and the
father. The
variation in the STRs between the mother and father can be used to detect
chromosomal
abnormalities.
Primers can be designed to amplify short tandem repeats. Any method of
amplification can
be used including but not limited to polymerise chain reaction, self sustained
sequence reaction,
ligase chain reaction, rapid amplification of cDNA ends, polymerise chain
reaction and ligase chain
reaction, Q-beta phage amplification, strand displacement amplification, and
splice overlap
extension polymerise chain reaction. In a preferred embodiment, PCR is used.
Any number of short tandem repeats can be analyzed including but not limited
to 1-5, 5-10,
__
10-50, 50-100, 100-200, 200-300, 300-400, 400-500, 500-1000, and greater than
1000. The short
1
tandem repeats can be analyzed in a single PCR reaction or in multiple PCR
reactions. In a '
preferred embodiment, STRs from multiple chromosomes are analyzed.
After amplification, the PCR products can be analyzed by any number of methods
including but not restricted to gel electrophoresis, and mass spectrometry.
The template DNA from
the pregnant female comprises STRs of maternal and paternal origin. The STRs
of paternal origin
represent the fetal DNA. The paternal and maternal STRs may be identical in
length or the
maternal and the paternal STRs may differ.
Heterozygous STRs are those of which the maternal and paternal differ in
length. The
amount of each PCR product can be quantitated for each heterozygous STR. With
a normal number
of chromosomes, the amount of each PCR product should be approximately equal.
However, with
an extra chromosome, one of the STR PCR products will be present at a greater
amount.
83
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
For example, multiple STRs on chromosome 1 can be analyzed on the template DNA
obtained from the blood of the pregnant female, Each STR, whether of maternal
or paternal origin,
should be present at approximately the same amount. Likewise, with two
chromosome 21 s, each
STR should be present at approximately the same amount. However, with a
trisomy 21, one of the
STR PCR products, when the maternal and paternal differ in length (a
heterozygous STR) should be
present at a higher amount. The ratio for each heterozygous STR on one
chromosome can be
compared to the ratio for each heterozygous STR on a different chromosome,
wherein a difference
indicates the presence or absence of a chromosomal abnormality.
Kits
The methods of the invention are most conveniently practiced by providing the
reagents
used in the methods in the form of kits. A kit preferably contains one or more
of the following
components: written instructions for the use of the kit, appropriate buffers,
salts, DNA extraction
detergents, primers, nucleotides, labeled nucleotides, 5' end modification
materials, and if desired,
water of the appropriate purity, confined in separate containers or packages,
such components
allowing the user of the kit to extract the appropriate nucleic acid sample,
and analyze the same
according to the methods of the invention. The primers that are provided with
the kit will vary,
depending upon the purpose of the kit and the DNA that is desired to be tested
using the kit.
A kit can also be designed to detect a desired or variety of single nucleotide
polymorphisms, especially those associated with an undesired condition or
disease. For example,
one kit can comprise, among other components, a set or sets of primers to
amplify one or more loci
of interest associated with Huntington's disease. Another kit can comprise,
among other
components, a set or sets of primers for genes associated with a
predisposition to develop type I or
type II diabetes. Still, another kit can comprise, among other components, a
set or sets of primers
for genes associated with a predisposition to develop heart disease. Details
of utilities for such kits
are provided in the "Utilities" section below.
Utilities
The methods of the invention can be used whenever it is desired to know the
genotype of an
individual. The method of the invention is especially useful for the detection
of genetic disorders.
The method of the invention is especially useful as a non-invasive technique
for the detection of
genetic disorders in a fetus. In a preferred embodiment, the method of the
invention provides a
method for identification of single nucleotide polymorphisms.
In a preferred embodiment, the method is useful for detecting chromosomal
abnormalities
including but not limited to trisomies, monosomies, duplications, deletions,
additions, chromosomal
rearrangements, translocations, and other aneuploidies. The method is
especially useful for the
detection of chromosomal abnormalities in a fetus.
~4
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
In a preferred embodiment, the method of the invention provides a method for
identification of the presence of a disease in a fetus, especially a genetic
disease that arises as a
result of the presence of a genomic sequence, or other biological condition
that it is desired to
identify in an individual for which it is desired to know the same. The
identification of such
sequence in the fetus based on the presence of such genomic sequence can be
used, for example, to
determine if the fetus is a carrier or to assess if the fetus is predisposed
to developing a certain
genetic trait, condition or disease. The method of the invention is especially
useful in prenatal
genetic testing of parents and child.
Examples of diseases that can be diagnosed by this invention are listed in
Table IV.
TABLE IV
Achondroplasia
Adrenoleukodystrophy, X-Linked
Agammaglobulinemia, X-Linked
Alagille Syndrome
Alpha-Thalassemia X-Linked Mental Retardation Syndrome
Alzheimer Disease
Alzheimer Disease, Early-Onset Familial
Amyotrophic Lateral Sclerosis Overview
Androgen Insensitivity Syndrome
Angelman Syndrome
Ataxia Overview, Hereditary
Ataxia-Telangiectasia
Becker Muscular Dystrophy also The Dystrophinopathies)
Beckwith-Wiedemann Syndrome
Beta-Thalassemia
Biotinidase Deficiency
Branchiootorenal Syndrome
BRCAl and BRCA2 Hereditary BreastlOvarian Cancer
Breast Cancer
CADASIL
Canavan Disease
Cancer
Charcot-Marie-Tooth Hereditary Neuropathy
Charcot-Marie-Tooth Neuropathy Type 1
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Charcot-Marie-Tooth Neuropathy Type 2
Charcot-Marie-Tooth Neuropathy Type 4
Charcot-Marie-Tooth Neuropathy Type X
Cockayne Syndrome
Colon Cancer
Contractural Arachnodactyly, Congenital
Craniosynostosis Syndromes (FGFR-Related)
Cystic Fibrosis
Cystinosis
Deafness and Hereditary Hearing Loss
DRPLA (Dentatorubral-Pallidoluysian Atrophy)
DiGeorge Syndrome (also 22q11 Deletion Syndrome)
Dilated Cardiomyopathy, X-Linked
Down Syndrome (Trisomy 21)
Duchenne Muscular Dystrophy (also The Dystrophinopathies)
Dystonia, Early-Onset Primary (DYT 1 )
Dystrophinopathies, The
Ehlers-Danlos Syndrome, Kyphoscoliotic Form
Ehlers-Danlos Syndrome, Vascular Type
Epidermolysis Bullosa Simplex
Exostoses, Hereditary Multiple
Facioscapulohumeral Muscular Dystrophy
Factor V Leiden Thrombophilia
Familial Adenomatous Polyposis (FAP)
Familial Mediterranean Fever
Fragile X Syndrome
Friedreich Ataxia
Frontotemporal Dementia with Parkinsonism-17
Galactosemia
Gaucher Disease
Hemochromatosis, Hereditary
Hemophilia A
Hemophilia B
Hemorrhagic Telangiectasia, Hereditary
86
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Hearing Loss and Deafness, Nonsyndromic, DFNA (Connexin 26)
Hearing Loss and Deafness, Nonsyndromic, DFNB 1 (Connexin 26)
Hereditary Spastic Paraplegia
Hermansky-Pudlak Syndrome
Hexosaminidase A Deficiency (also Tay-Sachs)
Huntington Disease
Hypochondroplasia
Ichthyosis, Congenital, Autosomal Recessive
Incontinentia Pigmenti
Kennedy Disease (also Spinal and Bulbar Muscular Atrophy)
Krabbe Disease
Leber Hereditary Optic Neuropathy
Lesch-Nyhan Syndrome Leukemias
Li-Fraumeni Syndrome
Limb-Girdle Muscular Dystrophy
Lipoprotein Lipase Deficiency, Familial
Lissencephaly
Marfan Syndrome
MELAS (Mitochondrial Encephalomyopathy, Lactic Acidosis, and
Stroke-Like Episodes)
Monosomies
Multiple Endocrine Ncoplasia Type 2
Multiple Exostoses, Hereditary Muscular Dystrophy, Congenital
Myotonic Dystrophy
Nephrogenic Diabetes Insipidus
Neurofibromatosis 1
Neurofibromatosis 2
Neuropathy with Liability to Pressure Palsies, Hereditary
Niemann-Pick Disease Type C
Nijmegen Breakage Syndrome Norrie Disease
Oculocutaneous Albinism Type 1
Oculopharyngeal Muscular Dystrophy
Ovarian Cancer
Pallister-Hall Syndrome
~7
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Parkin Type of Juvenile Parkinson Disease
Pelizaeus-Merzbacher Disease
Pendred Syndrome
Peutz-Jeghers Syndrome Phenylalanine Hydroxylase Deficiency
Prader-Willi Syndrome
PROP 1-Related Combined Pituitary Hormone Deficiency (CPHD)
Prostate Cancer
Retinitis Pigmentosa
Retinoblastoma
Rothmund-Thomson Syndrome
Smith-Lemli-Opitz Syndrome
Spastic Paraplegia, Hereditary
Spinal and Bulbar Muscular Atrophy (also Kennedy Disease)
Spinal Muscular Atrophy
Spinocerebellar Ataxia Type 1
Spinocerebellar Ataxia Type 2
Spinocerebellar Ataxia Type 3
Spinocerebellar Ataxia Type 6
Spinocerebellar Ataxia Type 7
Stickler Syndrome (Hereditary Arthroophthalmopathy)
Tay-Sachs (also GM2 Gangliosidoses)
Trisomies
Tuberous Sclerosis Complex
Usher Syndrome Type I
Usher Syndrome Type II
Velocardiofacial Syndrome (also 22q11 Deletion Syndrome)
Von Hippel-Lindau Syndrome
Williams Syndrome
Wilson Disease
X-Linked Adrenoleukodystrophy
X-Linked Agammaglobulinemia
X-Linked Dilated Cardiomyopathy (also The Dystrophinopathies)
X-Linked Hypotonic Facies Mental Retardation Syndrome
88
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
The method of the invention is useful for screening~an individual at multiple
loci of interest,
such as tens, hundreds, or even thousands of loci of interest associated with
a genetic trait or genetic
disease by sequencing the loci of interest that are associated with the trait
or disease state, especially
those most frequently associated with such trait or condition. The invention
is useful for analyzing
a particular set of diseases including but not limited to heart disease,
cancer, endocrine disorders,
immune disorders, neurological disorders, musculoskeletal disorders,
ophthalmologic disorders,
genetic abnormalities, trisomies, monosomies, transversions, translocations,
skin disorders, and
familial diseases.
The method of the invention can also be used to confirm or identify the
relationship of a
DNA of unknown sequence to a DNA of known origin or sequence, for example, for
use in,
maternity or paternity testing, and the like.
Having now generally described the invention, the same will become better
understood by
reference to certain specific examples which are included herein for purposes
of illustration only
and are not intended to be limiting unless other wise specified.
EXAMPLES
The following examples are illustrative only and are not intended to limit the
scope of the
invention as defined by the claims.
EXAMPLE 1
DNA sequences were amplified by PCR, wherein the annealing step in cycle 1 was
performed at a specified temperature, and then increased in cycle 2, and
further increased in cycle 3
for the purpose of reducing non-specific amplification. The TMl of cycle 1 of
PCR was
determined by calculating the melting temperature of the 3' region, which
anneals to the template
DNA, of the second primer. For example, in FIG. 1B, the TM1 can be about the
melting
temperature of region "c." The annealing temperature was raised in cycle 2, to
TM2, which was
about the melting temperature of the 3' region, which anneals to the template
DNA, of the first
primer. For example, in FIG. 1C, the annealing temperature (TM2) corresponds
to the melting
temperature of region "b." In cycle 3, the annealing temperature was raised to
TM3, which was
about the melting temperature of the entire sequence of the second primer. For
example, in FIG.
1D, the annealing temperature (TM3) corresponds to the melting temperature of
region "c" + region
"d". The remaining cycles of amplification were performed at TM3.
Preparation of Template DNA
The template DNA was prepared from a 5 ml sample of blood obtained by
venipuncture
from a human volunteer with informed consent. Blood was collected from 36
volunteers.
Template DNA was isolated from each blood sample using QIAamp DNA Blood Midi
Kit supplied
89
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
by QIAGEN (Catalog number 51183). Following isolation, the template DNA from
each of the 36
volunteers was pooled for further analysis.
Primer Design
The following four single nucleotide polymorphisms were analyzed: SNP
HC21S00340,
identification number as assigned by Human Chromosome 21 cSNP Database, (FIG.
3, lane 1)
located on chromosome 21; SNP TSC 0095512 (FIG. 3, lane 2) located on
chromosome 1, SNP
TSC 0214366 (FIG. 3, lane 3) located on chromosome 1; and SNP TSC 0087315
(FIG. 3, lane 4)
located on chromosome 1. The SNP Consortium Ltd database can be accessed at
http:llsnp.cshl.org/, website address effective as of February 14, 2002.
SNP HC21500340 was amplified using the following primers:
First primer:
5'TAGAATAGCACTGAATTCAGGAATACAATCATTGTCAC3'
Second primer:
5'ATCACGATAAACGGCCAAACTCAGGTTA3'
SNP TSC0095512 was amplified using the following primers:
First primer:
5'AAGTTTAGATCAGAATTCGTGAAAGCAGAAGTTGTCTG3'
Second primer:
5'TCTCCAACTAACGGCTCATCGAGTAAAG3'
SNP TSC0214366 was amplified using the following primers:
First primer:
5'ATGACTAGCTATGAATTCGTTCAAGGTAGAAAATGGAA3'
Second primer:
5'GAGAATTAGAACGGCCCAAATCCCACTC3'
SNP TSC 0087315 was amplified using the following primers:
First primer:
5'TTACAATGCATGAATTCATCTTGGTCTCTCAAAGTGC3'
Second primer:
5'TGGACCATAAACGGCCAAAAACTGTAAG 3'.
All primers were designed such that the 3' region was complementary to either
the
upstream or downstream sequence flanking each locus of interest and the 5'
region contained a
restriction enzyme recognition site. The first primer contained a biotin tag
at the 5' end and a
recognition site for the restriction enzyme EcoRI. The second primer contained
the recognition site
for the restriction enzyme BceA I.
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
PCR Reaction
All four loci of interest were amplified from the template genomic DNA using
PCR (U.S.
Patent Nos. 4,683,195 and 4,683,202). The components of the PCR reaction were
as follows: 40 ng
of template DNA, 5 pM first primer, 5 pM second primer, 1 X HotStarTaq Master
Mix as obtained
from Qiagen (Catalog No. 203443). The HotStarTaq Master Mix contained DNA
polymerase, PCR
buffer, 200 p,M of each dNTP, and 1.5 mM MgCl2.
Amplification of each template DNA that contained the SNP of interest was
performed
using three different series of annealing temperatures, herein referred to as
low stringency annealing
temperature, medium stringency annealing temperature, and high stringency
annealing temperature.
Regardless of the annealing temperature protocol, each PCR reaction consisted
of 40 cycles of
amplification. PCR reactions were performed using the HotStarTaq Master Mix
Kit supplied by
(~IAGEN. As instructed by the manufacturer, the reactions were incubated at
95°C for 15 min.
prior to the first cycle of PCR. The denaturation step after each extension
step was performed at
95°C for 30 sec. The annealing reaction was performed at a temperature
that permitted efficient
extension without any increase in temperature.
The low stringency annealing reaction comprised three different annealing
temperatures in
each of the first three cycles. The annealing temperature for the first cycle
was 37°C for 30 sec.;
the annealing temperature for the second cycle was 57°C for 30 sec.;
the annealing temperature for
the third cycle was 64°C for 30 sec. Annealing was performed at
64°C for subsequent cycles until
completion.
As shown in the photograph of the 'gel (FIG. 3A), multiple bands were observed
after
amplification of SNP TSC 0087315 (lane 4). Amplification of SNP HC21S00340
(lane 1), SNP
TSC0095512 (lane 2), and SNP TSC0214366 (lane 3) generated a single band of
high intensity and
one band of faint intensity, which was of higher molecular weight. When the
low annealing
temperature conditions were used, the correct size product was generated and
this was the
predominant product in each reaction.
The medium stringency annealing reaction comprised three different annealing
temperatures in each of the first three cycles. The annealing temperature for
the first cycle was
40°C for 30 seconds; the annealing temperature for the second cycle was
60°C for 30 seconds; and
the annealing temperature for the third cycle was 67°C for 30 seconds.
Annealing was performed at
67°C for subsequent cycles until completion. Similar to what was
observed under low stringency
annealing conditions, amplification of SNP TSC0087315 (FIG. 3B, lane 4)
generated multiple
bands under conditions of medium stringency. Amplification of the other three
SNPs (lanes 1-3)
produced a single band. These results demonstrate that variable annealing
temperatures can be used
91
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
to cleanly amplify loci of interest from genomic DNA with a primer that has an
annealing length of
13 bases.
The high stringency annealing reaction was comprised of three different
annealing
temperatures in each of the first three cycles. The annealing temperature of
the first cycle was 46°C
for 30 seconds; the annealing temperature of the second cycle was 65°C
for 30 seconds; and the
annealing temperature for the third cycle was 72°C for 30 seconds.
Annealing was performed at
72°C for subsequent cycles until completion. As shown in the photograph
of the gel (FIG. 3 C),
amplification of SNP TSC0087315 (lane 4) using the high stringency annealing
temperatures
generated a single band of the correct molecular weight. By raising the
annealing temperatures for
each of the first three cycles, non-specific amplification was eliminated.
Amplification of SNP
TSC0095512 (lane 2) generated a single band. SNPs HC21500340 (lane 1), and
TSC0214366 (lane
3) failed to amplify at the high stringency annealing temperatures, however,
at the medium
stringency annealing temperatures, these SNPs amplified as a single band.
These results
demonstrate that variable annealing temperatures can be used to reduce non-
specific PCR products,
as demonstrated for SNP TSC0087315 (FIG. 3, lane 4).
EXAMPLE 2
SNPs on chromosomes 1 (TSC0095512), 13 (TSC0264680), and 21 (HC21S00027) were
analyzed. SNP TSC0095512 was analyzed using two different sets of primers, and
SNP
HC21500027 was analyzed using two types of reactions for the incorporation of
nucleotides.
Preparation of Template DNA
The template DNA was prepared from a 5 ml sample of blood obtained by
venipuncture
from a human volunteer with informed consent. Template DNA was isolated using
the QIAmp
DNA Blood Midi I~it supplied by QIAGEN (Catalog number 51183). The template
DNA was
isolated as per instructions included in the kit. Following isolation,
template DNA from thirty-six
human volunteers were pooled together and cut with the restriction enzyme
EcoRI. The restriction
enzyme digestion was performed as per manufacturer's instructions.
Primer Design
SNP HC21500027 was amplified by PCR using the following primer set:
First primer:
5' ATAACCGTATGCGAATTCTATAATTTTCCTGATAAAGG 3'
Second primer:
5' CTTAAATCAGGGGACTAGGTAAACTTCA 3'.
The first primer contained a biotin tag at the extreme 5' end, and the
nucleotide sequence
for the restriction enzyme EcoRI. The second primer contained the nucleotide
sequence for the
restriction enzyme BsmF I (FIG. 4A).
92
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Also, SNP HC21500027 was amplified by PCR using the same first primer but a
different
second primer with the following sequence:
Second primer:
5' CTTAAATCAGACGGCTAGGTAAACTTCA 3'
This second primer contained the recognition site for the restriction enzyme
BceA I (FIG.
4B).
SNP TSC0095512 was amplified by PCR using the following primers:
First primer:
5'AAGTTTAGATCAGAATTCGTGAAAGCAGAAGTTGTCTG3'
Second primer:
5' TCTCCAACTAGGGACTCATCGAGTAAAG 3'.
The first primer had a biotin tag at the 5' end and contained a restriction
enzyme
recognition site for EcoRI. The second primer contained a restriction enzyme
recognition site for
BsmF I (FIG. 4C).
Also, SNP TSC0095512 was amplified using the same first primer and a different
second
primer with the following sequence:
Second primer:
5'TCTCCAACTAACGGCTCATCGAGTAAAG3'
This second primer contained the recognition site for the restriction enzyme
BceA I (FIG.
4D).
SNP TSC0264580, which is located on chromosome 13, was amplified with the
following
primers:
First primer:
5' AACGCCGGGCGAGAATTCAGTTTTTCAACTTGCAAGG 3'
Second primer:
5'CTACACATATCTGGGACGTTGGCCATCC3'.
The first primer contained a biotin tag at the extreme 5' end and had a
restriction enzyme
recognition site for EcoRI. The second primer contained a restriction enzyme
recognition site for
BsmF I.
PCR Reaction
All loci of interest were amplified from the template genomic DNA using the
polymerase
chain reaction (PCR, U.S. Patent Nos. 4,683,195 and 4,683,202, incorporated
herein by reference).
In this example, the loci of interest were amplified in separate reaction
tubes but they could also be
amplified together in a single PCR reaction. For increased specificity, a "hot-
start" PCR was used.
PCR reactions were performed using the HotStarTaq Master Mix Kit supplied by
QIAGEN (catalog
93
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
number 203443). The amount of template DNA and primer per reaction can be
optimized for each
locus of interest but in this example, 40 ng of template human genomic DNA and
5 wM of each
primer were used. Forty cycles of PCR were performed. The following PCR
conditions were used:
(1) 95°C for 15 minutes and 15 seconds;
(2) 37°C for 30 seconds;
(3) 95°C for 30 seconds;
(4) 57°C for 30 seconds;
(5) 95°C for 30 seconds;
(6) 64°C for 30 seconds;
(7) 95°C for 30 seconds;
(8) Repeat steps 6 and 7 thirty nine (39) times;
(9) 72°C for 5 minutes.
In the first cycle of PCR, the annealing temperature was about the melting
temperature of
the 3' annealing region of the second primers, which was 37°C. The
annealing temperature in the
second cycle of PCR was about the melting temperature of the 3' region, which
anneals to the
template DNA, of the first primer, which was 57°C. The annealing
temperature in the third cycle of
PCR was about the melting temperature of the entire sequence of the second
primer, which was
64°C. The annealing temperature for the remaining cycles was
64°C. Escalating the annealing
temperature from TMl to TM2 to TM3 in the first three cycles of PCR greatly
improves specificity.
These annealing temperatures are representative, and the skilled artisan will
understand the
annealing temperatures for each cycle are dependent on the specific primers
used.
The temperatures and times for denaturing, annealing, and extension, can be
optimized by
trying various settings and using the parameters that yield the best results.
The PCR products for
SNP HC21500027 and SNP TSC095512 are shown in FIGS. SA-SD.
Purification of Fragment of Interest
The PCR products were separated from the genomic template DNA. Each PCR
product
was divided into four separate reaction wells of a Streptawell, transparent,
High-Bind plate from
Roche Diagnostics GmbH (catalog number 1 645 692, as listed in Roche Molecular
Biochemicals,
2001 Biochemicals Catalog). The first primers contained a 5' biotin tag so the
PCR products bound
to the Streptavidin coated wells while the genomic template DNA did not. The
streptavidin binding
reaction was performed using a Thermomixer (Eppendorf) at 1000 rpm for 20 min.
at 37°C. Each
well was aspirated to remove unbound material, and washed three times with 1X
PBS, with gentle
mixing (Kandpal et al., Nucl. Acids Res. 18:1789-1795 (1990); Kaneoka et al.,
Biotechniques
10:30-34 (1991); Green et al., Nucl. Acids Res. 18:6163-6164 (1990)).
94
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Restriction Enzyme Digestion of Isolated Fragments
The purified PCR products were digested with the restriction enzyme that bound
the
recognition site incorporated into the PCR products from the second primer.
SNP HC21500027
(FIG. 6A and 6B) and SNP TSC0095512 (FIG. 6C and 6D) were amplified in
separate reactions
using two different second primers. FIG. 6A (SNP HC21500027) and FIG. 6C (SNP
TSC0095512) depict the PCR products after digestion with the restriction
enzyme BsmF I (New
England Biolabs catalog number R0572S). FIG. 6B (SNP HC21S00027) and FIG. 6D
(SNP
TSC0095512) depict the PCR products after digestion with the restriction
enzyme BceA I (New
England Biolabs, catalog number 80623 S). The digests were performed in the
Streptawells
following the instructions supplied with the restriction enzyme. SNP
TSC0264580 was digested
with BsmF I. After digestion with the appropriate restriction enzyme, the
wells were washed three
times with PBS to remove the cleaved fragments.
Incorporation of Labeled Nucleotide
The restriction enzyme digest described above yielded a DNA fragment with a 5'
overhang,
which contained the SNP site or locus of interest and a 3' recessed end. The
5' overhang
functioned as a template allowing incorporation of a nucleotide or nucleotides
in the presence of a
DNA polymerase.
For each SNP, four separate fill in reactions were performed; each of the four
reactions
contained a different fluorescently labeled dideoxynucleotide (ddATP, ddCTP,
ddGTP, or ddTTP).
The following components were added to each fill in reaction: 1 pl of a
fluorescently labeled
dideoxynucleotide, 0.5 p,l of unlabeled ddNTPs ( 40 pM), which contained all
nucleotides except
the nucleotide that was fluorescently labeled, 2 pl of l OX sequenase buffer,
0.25 pl of Sequenase,
and water as needed for a 20 p,l reaction. All of the fill in reactions were
performed at 40°C for 10
min. Non-fluorescently labeled nucleotides was purchased from Fermentas Inc.
(Hanover, MD).
All other labeling reagents were obtained from Amersham (Thermo Sequenase Dye
Terminator
Cycle Sequencing Core Kit, US 79565). In the presence of fluorescently labeled
ddNTPs, the 3'
recessed end was extended by one base, which corresponds to the SNP or locus
of interest (FIG
7A-7D).
A mixture of labeled ddNTPs and unlabeled dNTPs also was used for the "fill
in" reaction
for SNP HC21S00027. The "fill in" conditions were as described above except
that a mixture
containing 40 p,M unlabeled dNTPs, 1 ~,1 fluorescently labeled ddATP, 1 p.l
fluorescently labeled
ddCTP, 1 p.l fluorescently labeled ddGTP, and 1 p,l ddTTP was used. The
fluorescent ddNTPs
were obtained from Amersham (Thermo Sequenase Dye Terminator Cycle Sequencing
Core Kit,
US 79565; Amersham did not publish the concentrations of the fluorescent
nucleotides). SNP
HC21500027 was digested with the restriction enzyme BsmF I, which generated a
5' overhang of
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
four bases. As shown in FIG. 7E, if the first nucleotide incorporated is a
labeled
dideoxynucleotide, the 3' recessed end is filled in by one base, allowing
detection of the SNP or
locus of interest. However, if the first nucleotide incorporated is a dNTP,
the polymerise continues
to incorporate nucleotides until a ddNTP is filled in. For example, the first
two nucleotides can be
filled in with dNTPs, and the third nucleotide with a ddNTP, allowing
detection of the third
nucleotide in the overhang. Thus, the sequence of the entire 5' overhang can
be determined, which
increases the information obtained from each SNP or locus of interest.
After labeling, each Streptawell was rinsed with 1X PBS (100 pl) three times.
The "filled
in" DNA fragments were then released from the Streptawells by digestion with
the restriction
enzyme EcoRI, according to the manufacturer's instructions that were supplied
with the enzyme
(FIGS. 8A-8D). Digestion was performed for 1 hour at 37°C with shaking
at 120 rpm.
Detection of the Locus of Interest
After release from the streptavidin matrix, 2-3 p,l of the 10 p,l sample was
loaded in a 48
well membrane tray (The Gel Company, catalog number TAM48-O1). The sample in
the tray was
absorbed with a 48 Flow Membrane Comb (The Gel Company, catalog number AM48),
and
inserted into a 36 cm 5% acrylamide (urea) gel (BioWhittaker Molecular
Applications, Long
Ranger Run Gel Packs, catalog number 50691).
The sample was electrophoresed into the gel at 3000 volts for 3 min. The
membrane comb
was removed, and the gel was run for 3 hours on an ABI 377 Automated
Sequencing Machine. The
incorporated labeled nucleotide was detected by fluorescence.
As shown in FIG. 9A, from a sample of thirty six (36) individuals, one of two
nucleotides,
either adenosine or guanine, was detected at SNP HC21500027. These are the two
nucleotides
reported to exist at SNP HC21S00027 (http://snp.cshl.orglsnpsearch.shtml).
One of two nucleotides, either guanine or cytosine, was detected at SNP
TS00095512 (FIG.
9B). The same results were obtained whether the locus of interest was
amplified with a second
primer that contained a recognition site for BceA I or the second primer
contained a recognition site
for BsmF I.
As shown in FIG. 9C, one of two nucleotides was detected at SNP TSC0264580,
which
was either adenosine or cytosine. These are the two nucleotides reported for
this SNP site
(http://snp.cshl.org/snpsearch.shtml). In addition, a thymidine was detected
one base from the locus
of interest. In a sequence dependent manner, BsmF I cuts some DNA molecules at
the 10/14
position and other DNA molecules, which have the same sequence, at the 11/15
position. When the
restriction enzyme BsmF I cuts 11 nucleotides away on the sense strand and 15
nucleotides away on
the antisense strand, the 3' recessed end is one base from the SNP site. The
sequence of SNP
TSC0264580 indicated that the base immediately preceding the SNP site was a
thymidine. The
96
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
incorporation of a labeled ddNTP into this position generated a fragment one
base smaller than the
fragment that was cut at the 10/14 position. Thus, the DNA molecules cut at
the 11!15 position
provided sequence information about the base immediately preceding the SNP
site, and the DNA
molecules cut at the 10/14 position provided sequence information about the
SNP site.
SNP HC21500027 was amplified using a second primer that contained the
recognition site
for BsmF I. A mixture of labeled ddNTPs and unlabeled dNTPs was used to fill
in the 5' overhang
generated by digestion with BsmF I. If a dNTP was incorporated, the polymerase
continued to
incorporate nucleotides until a ddNTP was incorporated. A population of DNA
fragments, each
differing by one base, was generated, which allowed the full sequence of the
overhang to be
determined.
As seen in FIG. 9D, an adenosine was detected, which was complementary to the
nucleotide (a thymidine) immediately preceding the SNP or locus of interest.
This nucleotide was
detected because of the 11/15 cutting property of BsmF I, which is described
in detail above. A
guanine and an adenosine were detected at the SNP site, which are the two
nucleotides reported for
this SNP site (FIG. 9A). The two nucleotides were detected at the SNP site
because the molecular
weights of the dyes differ, which allowed separation of the two nucleotides.
The next nucleotide
detected was a thymidine, which is.complementary to the nucleotide immediately
downstream of
the SNP site. The next nucleotide detected was a guanine, which was
complementary to the
nucleotide two bases downstream of the SNP site. Finally, an adenosine was
detected, which was
complementary to the third nucleotide downstream of the SNP site. Sequence
information was
obtained not only for the SNP site but for the.nucleotide immediately
preceding the SNP site and
the next three nucleotides.
None of the loci of interest contained a mutation. However, if one of the loci
of interest
harbored a mutation including but not limited to a point mutation, insertion,
deletion, translocation
or any combination of said mutations, it could be identified by comparison to
the consensus or
published sequence. Comparison of the sequences attributed to each of the loci
of interest to the
native, non-disease related sequence of the gene at each locus of interest
determines the presence or
absence of a mutation in that sequence. The finding of a mutation in the
sequence is then
interpreted as the presence of the indicated disease, or a predisposition to
develop the same, as
appropriate, in that individual. The relative amounts of the mutated vs.
normal or non-mutated
sequence can be assessed to determine if the subject has one or two alleles of
the mutated sequence,
and thus whether the subject is a carrier, or whether the indicated mutation
results in a dominant or
recessive condition.
97
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
EXAMPLE 3
Four loci of interest from chromosome 1 and two loci of interest from
chromosome 21 were
amplified in separate PCR reactions, pooled together, and analyzed. The
primers were designed so
that each amplified locus of interest was a different size, which allowed
detection of the loci of
interest.
Preparation of Template DNA
The template DNA was prepared from a 5 ml sample of blood obtained by
venipuncture
from a human volunteer with informed consent. Template DNA was isolated using
the QIAmp
DNA Blood Midi Kit supplied by QIAGEN (Catalog number 51183). The template DNA
was
isolated as per instructions included in the kit. Template DNA was isolated
from thirty-six human
volunteers, and then pooled into a single sample for further analysis.
Primer Design
SNP TSC 0087315 was amplified using the following primers:
First primer:
~ 5'TTACAATGCATGAATTCATCTTGGTCTCTCAAAGTGC 3'
Second primer:
5'TGGACCATAAACGGCCAAAAACTGTAAG3'.
SNP TSC0214366 was amplified using the following primers:
First primer:
5'ATGACTAGCTATGAATTCGTTCAAGGTAGAAAATGGAA3'
Second primer:
5'GAGAATTAGAACGGCCCAAATCCCACTC 3'
SNP TSC 0413944 was amplified with the following primers:
First primer:
5'TACCTTTTGATCGAATTCAAGGCCAAAAATATTAAGTT3'
Second primer:
5' TCGAACTTTAACGGCCTTAGAGTAGAGA 3'
SNP TSC0095512 was amplified using the following primers:
First primer:
5'AAGTTTAGATCAGAATTCGTGAAAGCAGAAGTTGTCTG3'
Second primer:
5'TCTCCAACTAACGGCTCATCGAGTAAAG3'
SNP HC21500131 was amplified with the following primers:
First primer:
5'CGATTTCGATAAGAATTCAAAAGCAGTTCTTAGTTCAG3'
98
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Second primer:
5'TGCGAATCTTACGGCTGCATCACATTCA3'
SNP HC21S00027 was amplified with the following primers:
First primer:
5' ATAACCGTATGCGAATTCTATAATTTTCCTGATAAAGG 3'
Second primer:
5'CTTAAATCAGACGGCTAGGTAAACTTCA3'
For each SNP, the first primer contained a recognition site for the
restriction enzyme EcoRI
and had a biotin tag at the extreme 5' end. The second primer used to amplify
each SNP contained
a recognition site for the restriction enzyme BceA I.
PCR Reaction
The PCR reactions were performed as described in Example 2 except that the
following
annealing temperatures were used: the annealing temperature for the first
cycle of PCR was 37°C
for 30 seconds, the annealing temperature for the second cycle of PCR was
57°C for 30 seconds,
and the annealing temperature for the third cycle of PCR was 64°C for
30 seconds. All subsequent
cycles had an annealing temperature of 64°C for 30 seconds. Thirty
seven (37) cycles of PCR were
performed. After PCR, 1/4 of the volume was removed from each reaction, and
combined into a
single tube.
Purification of Fragment of Interest
The PCR products (now combined into one sample, and referred to as "the
sample") were
separated from the genomic template DNA as described in Example 2 except that
the sample was
bound to a single well of a Streptawell microtiter plate.
restriction Ena~ytne Ilige~tion of Isolated Fragment
The sample was digested with the restriction enzyme BceA I, which bound the
recognition
site in the second primer. The restriction enzyme digestions were performed
following the
instructions supplied with the enzyme. After the restriction enzyme digest,
the wells were washed
three times with 1X PBS.
Incorporation of Nucleotides
The restriction enzyme digest described above yielded DNA molecules with a 5'
overhang,
which contained the SNP site or locus of interest and a 3' recessed end. The
5' overhang
functioned as a template allowing incorporation of a nucleotide in the
presence of a DNA
polymerase.
The following components were used for the fill in reaction: 1 p.l of
fluorescently labeled
ddATP; 1 p.l of fluorescently labeled ddTTP; 1 pl of fluorescently labeled
ddGTP; 1 p,l of
fluorescently labeled ddCTP; 2 p,l of lOX sequenase buffer, 0.25 p,l of
Sequenase, and water as
99
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
needed for a 20 p,l reaction. The fill in reaction was performed at
40°C for 10 min. All labeling
reagents were obtained from Amersham (Thermo Sequenase Dye Terminator Cycle
Sequencing
Core I~it (US 79565); the concentration of the ddNTPS provided in the kit is
proprietary and not
published by Amersham). In the presence of fluorescently labeled ddNTPs, the
3' recessed end was
filled in by one base, which corresponds to the SNP or locus of interest.
After the incorporation of nucleotide, the Streptawell was rinsed with 1X PBS
(100 p,l)
three times. The "filled in" DNA fragments were then released from the
Streptawell by digestion
with the restriction enzyme EcoRI following the manufacturer's instructions.
Digestion was
performed for 1 hour at 37 °C with shaking at 120 rpm.
Detection of the Locus of Interest
After release from the streptavidin matrix, 2-3 pl of the 10 pl sample was
loaded in a 48
well membrane tray (The Gel Company, catalog:number TAM48-O1). The sample in
the tray was
absorbed with a 48 Flow Membrane Comb (The Gel Company, catalog number AM48),
and
inserted into a 36 cm 5% acrylamide (urea) gel (BioWhittaker Molecular
Applications, Long
Ranger Run Gel Packs, catalog number 50691).
The sample was electrophoresed into the gel at 3000 volts for 3 min. The
membrane comb
was removed, and the gel was run for 3 hours on an ABI 377 Automated
Sequencing Machine. The
incorporated nucleotide was detected by fluorescence.
The primers were designed so that each amplified locus of interest differed in
size. As
shown in FIG. 10, each amplified loci of interest differed by about 5-10
nucleotides, which allowed
the loci of interest to be separated from one another by gel electrophoresis.
Two nucleotides were
detected for SNP TSC0087315, which were guanine and cytosine. These are the
two nucleotides
reported to exist at SNP TSC0087315 (http://snp.cshl.org/snpsearch.shtml). The
sample comprised
template DNA from 36 individuals and because the DNA molecules that
incorporated a guanine
differed in molecular weight from those that incorporated a cytosine, distinct
bands were seen for
each nucleotide,
Two nucleotides were detected at SNP HC21500027, which were guanine and
adenosine
(FIG. 10). The two nucleotides reported for this SNP site are guanine and
adenosine
(http:/lsnp.cshl.org/snpsearch.shtml). As discussed above, the sample
contained template DNA
from thirty-six individuals, and one would expect both nucleotides to be
represented in the sample.
The molecular weight of the DNA fragments that incorporated a guanine was
distinct from the
DNA fragments that incorporated an adenosine, which allowed both nucleotides
to be detected.
The nucleotide cytosine was detected at SNP TSC0214366 (FIG. 10). The two
nucleotides
reported to exist at this SNP position are thymidine and cytosine.
100
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
The nucleotide guanine was detected at SNP TSC0413944 (FIG. 10). The two
nucleotides
reported for this SNP are guanine and cytosine
(http://spp.cshl.org/snpsearch.shtml}.
The nucleotide cytosine was detected at SNP TS00095512 (FIG. 10). The two
nucleotides
reported for this SNP site are guanine and cytosine
(http:llsnp.cshl.org/snpsearch.shtml).
The nucleotide detected at SNP HC21500131 was guanine. The two nucleotides
reported
for this SNP site are guanine and adenosine
(http://snp.cshl.org/snpsearch.shtml).
As discussed above, the sample was comprised of DNA templates from thirty-six
individuals and one would expect both nucleotides at the SNP sites to be
represented. For SNP
TSC0413944, TSC0095512, TSC0214366 and HC21S00131, one of the two nucleotides
was
detected. It is likely that both nucleotides reported for these SNP sites are
present in the sample but
that one fluorescent dye overwhelms the other. The molecular weight of the DNA
molecules that
incorporated one nucleotide did not allow efficient separation of the DNA
molecules that
incorporated the other nucleotide. However, the SNPs were readily separated
from one another,
and for each SNP, a proper nucleotide was incorporated. The sequences of
multiple loci of interest
from multiple chromosomes, which were treated as a single sample after PCR,
were determined.
A single reaction containing fluorescently labeled ddNTPs was performed with
the sample
that contained multiple loci of interest. Alternatively, four separate fill in
reactions can be
performed where each reaction contains one fluorescently labeled nucleotide
(ddATP, ddTTP,
ddGTP, or ddCTP) and unlabeled ddNTPs (see Example 2, FIGS. 7A-7D and FIGS. 9A-
C). Four
separate "fill in" reactions will allow detection of any nucleotide that is
present at the loci of.
interest. For example, if analyzing a sample that contains multiple loci of
interest from a single
individual, and said individual is heterozygous at one or more than one loci
of interest, four separate
"fill in" reactions can be used to determine the nucleotides at the
heterozygous loci of interest.
Also, when analyzing a sample that contains templates from multiple
individuals, four
separate "fill in" reactions will allow detection of nucleotides present in
the sample, independent of
how frequent the nucleotide is found at the locus of interest. For example, if
a sample contains
DNA templates from 50 individuals, and 49 of the individuals have a thymidine
at the locus of
interest, and one individual has a guanine, the performance of four separate
"fill in" reactions,
wherein each "fill in" reaction is run in a separate lane of a gel, such as in
FIGS. 9A-9C, will allow
detection of the guanine. When analyzing a sample comprised of multiple DNA
templates, multiple
"fill in" reactions will alleviate the need to distinguish multiple
nucleotides at a single site of
interest by differences in mass.
In this example, multiple single nucleotide polymorphisms were analyzed. It is
also
possible to determine the presence or absence of mutations, including but not
limited to point
mutations, transitions, transversions, translocations, insertions, and
deletions from multiple loci of
101
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
interest. The multiple loci of interest can be from a single chromosome or
from multiple
chromosomes. The multiple loci of interest can be from a single gene or from
multiple genes.
The sequence of multiple loci of interest that cause or predispose to a
disease phenotype
can be determined. For example, one could amplify one to tens to hundreds to
thousands of genes
implicated in cancer or any other disease. The primers can be designed so that
each amplified loci
of interest differs in size. After PCR, the amplified loci of interest can be
combined and treated as a
single sample. Alternatively, the multiple loci of interest can be amplified
in one PCR reaction or
the total number of loci of interest, for example 100, can be divided into
samples, for example 10
loci of interest per PCR reaction, and then later pooled. As demonstrated
herein, the sequence of
multiple loci of interest can be determined. Thus, in one reaction, the
sequence of one to ten to
hundreds to thousands of genes that predispose or cause a disease phenotype
can be determined.
EXAMPLE 4
The ability to determine the sequence or detect chromosomal abnormalities of a
fetus using
free fetal DNA in a sample from a pregnant female has been hindered by the low
percentage of free
fetal DNA. Increasing the percentage of free fetal DNA would enhance the
detection of mutation,
insertion, deletion, translocation, transversion, monosomy, trisomy, trisomy
21, trisomy 18, trisomy
13, XXY, ~:~, other aneuoplodies, deletion, addition, amplification,
translocation and
rearrangement. The percent of fetal DNA in plasma obtained from a pregnant
female was
determined both in the absence and presence of inhibitors of cell lysis. A
genetic marker on the Y
chromosome was used to calculate the percent of fetal DNA.
Preparation of Template DNA
The DNA template was prepared from a 5 ml sample of blood obtained by
venipuncture
from, a human volunteer with informed consent. The blood was aliquoted into
two tubes (Fischer
Scientific, 9 ml EDTA Vacuette tubes, catalog number NC9897284). Formaldehyde
(25 p,l/ml of
blood) was added to one of the tubes. The sample in the other tube remained
untreated, except for
the presence of the EDTA. The tubes were spun at 1000 rpm for ten minutes. Two
milliliters of the
supernatant (the plasma) of each sample was transferred to a new tube and spun
at 3000 rpm for ten
minutes. 800 p,l of each sample was used for DNA purification. DNA was
isolated using the
Qiagen Midi Kit for purification of DNA from blood cells (QIAmp DNA Blood Midi
Kit, Catalog
number 51183). DNA was eluted in 100 pl of distilled water. Two DNA templates
were obtained:
one from the blood sample treated with EDTA, and one from the blood sample
treated with EDTA
and formaldehyde.
102
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Primer Design
Two different sets of primers were used: one primer set was specific for the Y
chromosome, and thus specific for fetal DNA, and the other primer set was
designed to amplify the
cystic fibrosis gene, which is present on both maternal template DNA and fetal
template DNA.
In this example, the first and second primers were designed so that the entire
5' and 3'
sequence of each primer annealed to the template DNA. In this example, the
fetus had an XY
genotype, and the Y chromosome was used as a marker for the presence of fetal
DNA. The
following primers were designed to amplify the SRY gene on the Y chromosome.
First primer:
5' TGGCGATTAAGTCAAATTCGC 3'
Second primer:
SCCCCCTAGTACCCTGACAATGTATT3'
Primers designed to amplify any gene, or region of a region, or any part of
any
chromosome could be used to detect maternal and fetal DNA. In this example,
the following
primers were designed to amplify the cystic fibrosis gene:
First primer:
5'CTGTTCTGTGATATTATGTGTGGT3'
Second primer:
5' AATTGTTGGCATTCCAGCATTG 3'
PCR Reaction
The SRY gene and the cystic fibrosis gene were amplified from the template
genomic DNA
using PCR (U.S. Patent Nos. 4,683,195 and 4,683,202). For increased
specificity, a "hot-start"
PCR was used. PCR reactions were performed using the HotStarTaq Master Mix Kit
supplied by
Qiagen (Catalog No. 203443). For amplification of the SRY gene, the DNA eluted
from the
Qiagen purification column was diluted serially 1:2. For amplification of the
cystic fibrosis gene,
the DNA from the Qiagen purification column was diluted 1:4, and then serially
diluted 1:2. The
following components were used for each PCR reaction: 8 p,l of template DNA
(diluted or
undiluted), 1 p,l of each primer (5 p,M), 10 p,l of HotStar Taq mix. The
following PCR conditions
were used:
(1) 950C for 15'
(2) 94°C for 1'
(3) 54°C for 15"
(4) 72°C for 30"
(5) Repeat steps 2-4 for 45 cycles.
(6) 10' at 72°C
103
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Quantification of Fetal DNA
The DNA templates that were eluted from the Qiagen columns were serially
diluted to the
following concentrations: 1:2, 1:4, 1:8, 1:16, 1:32, 1:64, 1:128, 1:256,
1:512, 1:1024, 1:2048, and
1:4096. Amplification of the SRY gene was performed using the templates that
were undiluted,
1:2, 1:4, 1:8, 1:16, 1:32, 1:64, 1:128, 1:256, 1:512. Amplification of the
cystic fibrosis gene was
performed using the DNA templates that were diluted 1:4, 1:8, 1:16, 1:32,
1:64, 1:128, 1:256,
1:512, 1:1024, 1:2048, and 1:4096. The same dilution series was performed with
the DNA
templates that were purified from the plasma sample treated with EDTA alone
and the plasma
sample treated with EDTA and formaldehyde.
The results of the PCR reactions using the DNA template that was isolated from
the plasma
sample treated with EDTA are shown in FIG. 11A. The SRY gene was amplified
from the
undiluted DNA template, and also in the sample that was diluted 1:2 (FIG. 1
lA). .The SRY gene
was not amplified in the next seven serial dilutions. On the other hand, the
cystic fibrosis gene was
detected in the serial dilutions up to 1:256. A greater presence of the cystic
fibrosis gene was
expected because of the higher percentage of maternal DNA present in the
plasma. The last
dilution sample that provided for amplification of the gene product was
assumed to have one copy
of the cystic fibrosis gene or the SRY gene.
The results of the PCR reactions using the DNA template that was isolated from
the plasma
sample treated with formaldehyde and EDTA are shown in FIG. 11B. The SRY gene
was
amplified from the undiluted DNA template, and also in the sample that was
diluted 1:2 (FIG.
11B). The SRY gene was not amplified in the next six dilutions. However, in
the 1:256 dilution,
the SRY gene was detected. It is unlikely that the amplification in the 1:256
sample represents a
real signal because the prior six dilution series were all negative for
amplification of SRY.
Amplification of the SRY gene in this sample was likely an experimental
artifact resulting from the
high number of PCR cycles used. Thus, the 1:256 sample was not used in
calculating the amount of
fetal DNA present in the sample.
Amplification of the cystic fibrosis gene was detected in the sample that was
diluted 1:16
(FIG. 11B). The presence of the formalin prevents maternal cell lysis, and
thus, there is a lower
percentage of maternal DNA in the sample. This is in strong contrast to the
sample that was treated
with only EDTA, which supported amplification up to a dilution of 1:256.
The percent of fetal DNA present in the maternal plasma was calculated using
the
following formula:
fetal DNA = (amount of SRY gene/amount of cystic fibrosis gene)*2* 100.
The amount of SRY gene was represented by the highest dilution value in which
the gene was
amplified. Likewise, the amount of cystic fibrosis gene was represented by the
highest dilution
104
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
value in which it was amplified. The formula contains a multiplication factor
of two (2), which is
used to normalize for the fact that there is only one copy of the SRY gene
(located on the Y
chromosome), while there are two copies of the cystic fibrosis gene.
For the above example, the percentage of fetal DNA present in the sample that
was treated
with only EDTA was 1.56 % (2/256 * 2 * 100). The reported percentage of fetal
DNA present in
the plasma is between 0.39-11.9 % (Peru and Bianchi, Obstett~ics and
Gynecology, Yol. 98, No. 3,
483-490 (2001). The percentage of fetal DNA present in the sample treated with
formalin and
EDTA was 25% (2116 * 2 * 100). The experiment was repeated numerous times, and
each time the
presence of formalin increased the overall percentage of fetal DNA.
The percent fetal DNA from eighteen blood samples with and without formalin
was
calculated as described above with the exception that serial dilutions of 1:5
were performed. As 1:5
dilutions were performed, the last serial dilution that allowed detection of
either the SRY gene or
the cystic fibrosis gene may have had one copy of the gene or it may have had
4 copies of the gene.
The results from the eighteen samples with and without formalin are summarized
in Table V. The
I S low range assumes that the last dilution sample had one copy of the genes
and the high range
assumes that the last dilution had four copies of the genes.
Table V. li~Iean Percentage betel D1~A with and dvithout formaliaa.
Sample Lower Range Upper Range
Formalin 19.47 43.69
Without Formalin 7.71 22.1
An overall increase in fetal DNA was achieved by reducing the maternal cell
lysis, and
thus, reducing the amount of maternal DNA present in the sample. In this
example, formaldehyde
was used to prevent lysis of the cells, however any agent that prevents the
lysis of cells or increases
the structural integrity of the cells can be used. Two or more than two cell
lysis inhibitors can be
used. The increase in fetal DNA in the maternal plasma allows the sequence of
the fetal DNA to be
determined, and provides for the rapid detection of abnormal DNA sequences or
chromosomal
abnormalities including but not limited to point mutation, reading frame
shift, transition,
transversion, addition, insertion, deletion, addition-deletion, frame-shift,
missense, reverse
mutation, and microsatellite alteration, trisomy, monosomy, other
aneuploidies, amplification,
rearrangement, translocation, transversion, deletion, addition, amplification,
fragment,
translocation, and rearrangement.
105
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
EXAMPLE 5
A DNA template from an individual with a genotype of trisomy 21 was analyzed.
Three
loci of interest were analyzed on chromosome 13 and two loci of interest were
analyzed on
chromosome 21.
Preparation of Template DNA
The template DNA was prepared from a 5 ml sample of blood obtained by
venipuncture
from a human volunteer with informed consent. The human volunteer had
previously been
genotyped to have an additional chromosome 21 (trisomy 21). Template DNA was
isolated using
QIAamp DNA Blood Midi Kit supplied by QIAGEN (Catalog number 51183).
Primer Design
The following five single nucleotide polymorphisms were analyzed: SNP TSC
0115603
located on chromosome 21; SNP TSC 03209610 located on chromosome 21; SNP TSC
0198557
located on chromosome 13; and SNP TSC 0200347 located on chromosome 13. The
DNA
template from another individual was used as an internal control. The SNP TSC
0200347, which
was previously identified as being homozygous for guanine, was used as the
internal control. The
SNP Consortium Ltd database can be accessed at http://snp.cshl.org/, website
address effective as
of April l, 2002.
SNP TSC 0115603 was amplified using the following primers:
First Primer:
5' GTGCACTTACGTGAATTCAGATGAACGTGATGTAGTAG 3'
Second Primer:
5' TCCTCGTACTCAACGGCTTTCTCTGAAT 3'
The first primer was biotinylated at the 5' end, and contained the restriction
enzyme
recognition site for EcoR I. The second primer contained the restriction
enzyme recognition site for
the restriction enzyme BceA I.
SNP TSC 0309610 was amplified using the following primers:
First primer:
5' TCCGGAACACTAGAATTCTTATTTACATACACACTTGT 3'
Second primer:
5' CGAATAAGGTAGACGGCAACAATGAGAA 3'
The first primer contained a biotin group at the 5' end, and a restriction
enzyme recognition
site for the restriction enzyme EcoR I. The second primer contained the
restriction enzyme
recognition site for BceA I.
106
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Submitted SNP (ss) 813773 (accession number assigned by the NCBI Submitted SNP
(ss)
Database) was amplified with the following primers:
First primer:
5'CGGTAAATCGGAGAATTCAGAGGATTTAGAGGAGCTAA3'
Second primer:
5'CTCACGTTCGTTACGGCCATTGTGATAGC3'
The first primer contains a biotin group at the 5' end, and a recognition site
for the
restriction enzyme EcoR I. The second primer contained the restriction enzyme
recognition site for
BceA L
SNP TSC 0198557 was amplified with the following primers:
First primer:
5'GGGGAAACAGTAGAATTCCATATGGACAGAGCTGTACT3'
Second primer:
5'TGAAGCTGTCGGACGGCCTTTGCCCTCTC3'
15. The first primer contains a biotin group at the 5' end, and a recognition
site for the
restriction enzyme EcoR I. The second primer contained the restriction enzyme
recognition site for
BceA I.
SNP TSC 0197279 was amplified with the following primers:
First primer:
5'ATGGGCAGTTATGAATTCACTACTCCCTGTAGCTTGTT3'
Second primer:
5'TGATTGGCGCGAACGGCACTCAGAGAAGA3'
The first primer contained a biotin group at the 5' end, and a recognition
site for the
restriction enzyme for EcoR I. The second primer contained the recognition
site for the restriction
enzyme BceA I.
SNP TSC 0200347 was amplified with the following primers:
First primer:
5'CTCAAGGGGACCGAATTCGCTGGGGTCTTCTGTGGGTC3'
Second primer:
5'TAGGGCGGCGTGACGGCCAGCCAGTGGT3'
The first primer contained a biotin group at the 5' end, and the recognition
site for the
restriction enzyme EcoR I. The second primer contained the restriction enzyme
recognition site for
BceA I.
107
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
PCR Reaction
All five loci of interest were amplified from the template genomic DNA using
PCR (IT.S.
Patent Nos. 4,683,195 and 4,683,202). For increased specificity, a "hot-start"
PCR was used. PCR
reactions were performed using the HotStarTaq Master Mix Kit supplied by
QIAGEN (catalog
number 203443). The amount of template DNA and primer per reaction can be
optimized for each
locus of interest; in this example, 40 ng of template human genomic DNA and 5
pM of each primer
were used. Thirty-eight cycles of PCR were performed. The following PCR
conditions were used
for SNP TSC 0115603, SNP TSC 0309610, and SNP TSC 02003437:
( 1 ) 95°C for 15 minutes and 15 seconds;
(2) 42°C for 30 seconds;
(3) 95°C for 30 seconds;
(4) 60°C for 30 seconds;
(5) 95°C for 30 seconds;
(6) 69°C for 30 seconds;
(7) 95°C for 30 seconds;
(8) Repeat steps 6 and 7 thirty nine (37) times;
' (9) 72°C for 5 minutes.
The following PCR conditions were used for SNP ss813773, SNP TSC 0198557, and
SNP
TSC 0197279:
(1) 95°C for 15 minutes and 15 seconds;
(2) 37°C for 30 seconds;
(3) 95°C for 30 seconds;
(4) 57°C for 30 seconds;
(5) 95°C for 30 seconds;
(6) 64°C for 30 seconds;
(7) 95°C for 30 seconds;
(8) Repeat steps 6 and 7 thirty nine (37) times; and
(9) 72°C for 5 minutes.
In the first cycle of each PCR, the annealing temperature was about the
melting temperature
of the 3' annealing region of the second primer. The annealing temperature in
the second cycle of
PCR was about the melting temperature of the 3' region, which anneals to the
template DNA, of the
first primer. The annealing temperature in the third cycle of PCR was about
the melting
temperature of the entire sequence of the second primer. Escalating the
annealing temperature from
TMl to TM2 to TM3 in the first three cycles of PCR greatly improves
specificity. These annealing
108
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
temperatures are representative, and the skilled artisan will understand the
annealing temperatures
for each cycle are dependent on the specific primers used. The temperatures
and times for
denaturing, annealing, and extension, can be optimized by trying various
settings and using the
parameters that yield the best results.
Purification of Fragment of Interest
PCR products were separated from the components of the PCR reaction using
Qiagen's
MinElute PCR Purification Kit following manufacturer's instructions (Catalog
number 28006).
The PCR products were eluted in 20 p,l of distilled water. For each amplified
SNP, one microliter
of PCR product, 1 pl of amplified internal control DNA (SNP TSC 0200347), and
8 p,l of distilled
water were mixed. Five microliters of each sample was placed into two separate
reaction wells of a
Pierce StreptaWell Microtiter plate (catalog number 15501). The first primers
contained a 5' biotin
tag so the PCR products bound to the Streptavidin coated wells while the
genomic template DNA
did not. The streptavidin binding reaction was performed using a Thermomixer
(Eppendorf) at 150
rpm for 1 hour at 45°C. Each well was aspirated to remove unbound
material, and washed three
times with 1X PBS, with gentle mixing (Kandpal et al., Nucl. Acids Res.
18:1789-1795 (1990);
Kaneoka et al., Biotechniques 10:30-34 (1991); Green et al., Nucl. Acids Res.
18:6163-6164
( 1990)).
Restriction Enzyme Digestion of Isolated Fragments
The purified PCR products were digested with the restriction enzyme that bound
the
recognition site that was incorporated into the PCR products from the second
primer. The purified
PCR products were digested with the restriction enzyme BceA I (New,England
Biolabs, catalog
number R0623S). The digests were performed in the wells of the microtiter
plate following the
instructions supplied with the restriction enzyme. After digestion with the
appropriate restriction
enzyme, the wells were washed three times with PBS to remove the cleaved
fragments.
Incorporation of Labeled Nucleotide
The restriction enzyme digest described above yielded a DNA fragment with a 5'
overhang,
which contained the SNP and a 3' recessed end. The 5' overhang functioned as a
template allowing
incorporation of a nucleotide or nucleotides in the presence of a DNA
polymerase.
For each SNP, two fill in reactions were performed; each reaction contained a
different
fluorescently labeled dideoxynucleotide (ddATP, ddCTP, ddGTP, or ddTTP,
depending on the
reported nucleotides to exist at a particular SNP). For example, the
nucleotides adenine and
thymidine have been reported at SNP TSC 0115603. Therefore, the digested PCR
product for SNP
109
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
TSC 0115603 was mixed with either fluorescently labeled ddATP or fluorescently
labeled ddTTP.
Each reaction contained fluorescently labeled ddGTP for the internal control.
The following
components were added to each fill in reaction: 2 pl of a ROX-conjugated
dideoxynucleotide
(depending on the nucleotides reported for each SNP), 2 pl of ROX-conjugated
ddGTP (internal
control), 2.5 pl of l OX sequenase buffer, 2 p,l of Sequenase, and water as
needed for a 25 wl
reaction. All of the fill in reactions were performed at 45°C for 45
min. However, shorter time
periods of incorporation can be used. Non-fluorescently labeled ddNTPs were
purchased from
Fermentas Inc. (Hanover, MD). The ROX-conjugated ddNTPs were obtained from
Perkin Elmer.
In the presence of fluorescently labeled ddNTPs, the 3' recessed end was
extended by one base,
which corresponds to the SNP or locus of interest.
After labeling, each Streptawell was rinsed with 1X PBS (100 p,l) three times.
The "filled
in" DNA fragments were then released from the Streptawells by digestion with
the restriction
enzyme EcoR I following manufacturer's recommendations. Digestion was
performed for 1 hour at
37°C with shaking at 120 rpm.
Detection of the Locus of Interest
After release from the streptavidin matrix, 3 pl of the 10 p.l sample was
loaded in a 4~8 well
membrane tray (The Gel Company, catalog number TAM48-Ol). The sample in the
tray was
absorbed with a 48 Flow Membrane Comb (The Gel Company, catalog number AM48),
and
inserted into a 36 cm 5% acrylamide (urea) gel (BioWhittaker Molecular
Applications, Long
Ranger Run Gel Packs, catalog number 50691).
The sample was electrophoresed into the gel at 3000 volts for 3 min. The
membrane comb
was removed, and the gel was run for 3 hours on an ABI 377 Automated
Sequencing Machine. The
incorporated labeled nucleotide was detected by fluorescence.
As seen in FIG. 12, SNP TSC Ol 15603 was "filled in" with labeled ddTTP (lane
1) and in
a separate reaction with labeled ddATP (lane 3). The calculated ratio between
the nucleotides,
using the raw data, was 66:34, which is consistent with the theoretical ratio
of 66:33 for a SNP on
chromosome 21 in an individual with trisomy 21. Both the ddTTP and ddATP were
labeled with
the same fluorescent dye to minimize variability in incorporation efficiencies
of the dyes.
However, nucleotides with different fluorescent labels or any detectable label
can be used. It is
preferable to calculate the coefficients of incorporation when different
labels are used.
Each fill in reaction was performed in a separate well so it was possible that
there could be
variability in DNA binding between the wells of the microtiter plate. To
account for the potential
variability of DNA binding to the streptavidin-coated plates, an internal
control was used. The
internal control (SNP TSC 0200347), which is homozygous for guanine, was added
to the sample
110
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
prior to splitting the sample into two separate wells, and thus, an equal
amount of the internal
control should be present in each well. The amount of incorporated ddGTP can
be fixed between
the two reactions. If the amount of DNA in each well is equal, the amount of
incorporated ddGTP
should be equal because the reaction is performed under saturating conditions,
with saturating
conditions being defined as conditions that support incorporation of a
nucleotide at each template
molecule. Using the internal control, the ratio of incorporated ddATP to ddTTP
was 63.4:36.6.
This ratio was very similar to the ratio obtained with the raw data,
indicating that there are minor
differences in the two fill in reactions for a particular SNP.
Table VI. Allele Frequencies at Multiple SNPs on DNA Template from Individual
with
Trisomy 21
SNP AllelePeak AlleleInternal~ Normalized Peak ~
Area Allele
Area RatioControl Ratio
(%)
TSC A 5599 66 723 5599 63.4
~
0115603 T 2951 34 661 3227 ((723/661)*2951)36.6
TSC T 4126 64 1424 4126 66.8
0309610 C 2342 36 1631 2045 (1424/1631)*234233.2
ss813773 A 4199 46 808 4199 41
C 4870 54 64=7 6082 ((808/647)*487059
TSC T 3385 55 719 3385 49
0198557 C 2741 45 559 3525 719/559 *2741) 51
TSC T 8085 53 2752 8085 50.7
0197279 C 7202 47 2520 7865 (2752/2520 *720249.3
SNP TSC 0309610 was filled in with ddTTP (lane 3) or ddCTP (lane 4) (FIG. 12).
The
calculated ratio for the nucleotides, using the raw data, was 64:36. both
ddTTP and ddCTP were
labeled with the same fluorescent dye. After normalization to the internal
control, as discussed
above, the calculated allele ratio of ddTTP to ddCTP was 66.8:33.2 (Table VI).
Again, both the
calculated ratio from the raw data and the calculated ratio using the internal
control are very similar
to the theoretical ratio of 66.6:33.4 for a SNP on chromosome 21 in an
individual with trisomy.
To demonstrate that the 66:33 ratios for nucleotides at heterozygous SNPS
represented loci
on chromosomes present in three copies, SNPs on chromosome 13 were analyzed.
The individual
from whom the blood sample was obtained had previously been genotyped with one
maternal
chromosome 13, and one paternal chromosome 13.
Submitted SNP (ss) 813773 was filled in with ddATP (lane 5) or ddCTP (lane 6)
(FIG.
12). The calculated ratio for the nucleotides at this heterozygous SNP, using
the raw data, was
46:54. This ratio is within 10% of the expected ratio of 50:50. Importantly,
the ratio does not
approach the 66:33 ratio expected when there is an additional copy of a
chromosome.
111
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
After normalization to the internal control, the calculated ratio was 41:59.
Contrary to the
expected result, normalization to the internal control increased the
discrepancy between the
calculated ratio and the theoretical ratio. This result may represent
experimental error that occurred
in aliquoting the DNA samples.
Also, it is possible that the restriction enzyme used to generate the
overhang, which was
used as a template for the "fill-in" reaction, preferentially cut one DNA
template over the other
DNA template. The two templates differ, with respect to the nucleotide at the
SNP site, and this
may influence the cutting. The primers can be designed such that the
nucleotides adjacent to the cut
site are the same, independent of the nucleotide at the SNP site (discussed
further in the section
entitled "Primer Design").
SNP TSC 0198557, which is on chromosome 13, was filled in with ddTTP (lane 7)
in one
reaction and ddCTP (lane 8) in another (FIG. 12). The calculated ratio for the
nucleotides at this
SNP, using the raw data, was 55:45. After normalization to the internal
control, the calculated
allele ratio of T:C was 49:5-1. The normalized ratio was closer to the
theoretical ratio of 50:50 for
an individual with two copies of chromosome 13.
SNP TSC 0197279, which is on chromosome 13, was filled in with ddTTP (lane 9)
in one
reaction and ddCTP (lane 10) in another (FIG. 12). The calculated ratio for
the nucleotides at this
SNP, using the raw data, was 53:47. After normalization to the internal
control, the calculated
allele ratio of T:C was 50.7:49.3. This is consistent with the theoretical
ratio of 50:50 for an
individual with only two copies of chromosome 13.
The ratio for the nucleotides at two of the analyzed SNPs on chromosome 13 was
approximately 50:50. One SNP, ss813773, showed a ratio of 46:54, and when
normalized to the
internal control, the ratio was 41:59. These ratios deviate from the expected
50:50, but at the same
time, the ratios are not indicative of an extra chromosome, which is indicated
with a ratio of 66:33.
While the data from this particular SNP is inconclusive, it does not represent
a false positive. No
conclusion could be drawn on the data from this SNP. However, the other two
SNPs provided data
that indicated a normal number of chromosomes, It is preferable to analyze
multiple SNPs on a
chromosome including but not limited to 1-5, 5-10, 10-50, 50-100, 100-200, 200-
300, 300-400,
400-500, 500-600, 600-700, 700-800, 800-900, 900-1000, 1000-2000, 2000-3000,
and greater than
3000. Preferably, the average of the ratios for a particular chromosome will
be used to determine
the presence or absence of a chromosomal abnormality. However, it is still
possible to analyze one
locus of interest. In the event that inconclusive data is obtained, another
locus of interest can be
analyzed.
The individual from whom the DNA template was obtained had previously been
genotyped
with trisomy 21, and the allele frequencies at SNPs on chromosome 21 indicate
the presence of an
112
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
additional chromosome 21. The additional chromosome contributes an additional
nucleotide for
each SNP, and thus alters the traditional 50:50 ratio at a heterozygous SNP.
These results are
consistent for multiple SNPs, and are specific for those found on chromosome
21. The allele
frequencies for SNPs on chromosome 13 gave the expected ratios of
approximately 50:50. These
results demonstrate that this method of SNP detection can be used to detect
chromosomal
abnormalities including but not limited to translocations, transversions,
monosomies, trisomy 21,
trisomy 18, trisomy 13, other aneuplodies, deletions, additions,
amplifications, translocations and
rearrangements.
EXAMPLE 6
Genomic DNA was obtained from four individuals after informed consent was
obtained.
Six SNPs on chromosome 13 (TSC0837969, TSC0034767, TSC1130902, TSC0597888,
TSC0195492, TSC0607185) were analyzed using the template DNA. Information
regarding these
SNPs can be found at the following website www.snp.chsl.org/snpsearch.shtml;
website active as of
February 11, 2003).
A single nucleotide labeled with one fluorescent dye was used to genotype the
individuals
at the six selected SNP sites. The primers were designed to allow the six SNPs
to be analyzed in a
single reaction.
Preparation of Template DNA
The template DNA was prepared from a 9 ml sample of blood obtained by
venipuncture
from a human volunteer with informed consent. Template DNA was' isolated using
the QIAmp
DNA Blood T~idi Kit supplied by QIAGEN (Catalog number S 1183). The template
DNA was
isolated as per instructions included in the kit.
Design of Primers
SNP TSC0837969 was amplified using the following primer set:
First primer:
5'GGGCTAGTCTCCGAATTCCACCTATCCTACCAAATGTC3'
Second primer:
5' TAGCTGTAGTTAGGGACTGTTCTGAGCAC 3'
113
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
The first primer had a biotin tag at the 5' end and contained a restriction
enzyme recognition
site for EcoRI. The first primer was designed to anneal 44 bases from the
locus of interest. The
second primer contained a restriction enzyme recognition site for BsmF I.
SNP TSC0034?67 was amplified using the following primer set:
First primer:
5'CGAATGCAAGGCGAATTCGTTAGTAATAACACAGTGCA3'
Second primer:
5'AAGACTGGATCCGGGACCATGTAGAATAC3'
The first primer had a biotin tag at the 5' end and contained a restriction
enzyme recognition
site for EcoRI. The first primer was designed to anneal 50 bases from the
locus of interest. The
second primer contained a restriction enzyme recognition site for BsmF I.
SNP TSC1130902 was amplified using the following primer set:
First primer:
5'TCTAACCATTGCGAATTCAGGGCAAGGGGGGTGAGATC3'
Second primer:
5' TGACTTGGATCCGGGACAACGACTCATCC 3'
The first primer had a biotin tag at the 5' end and contained a restriction
enzyme recognition
site for EcoRI. The first primer was designed to anneal 60 bases from the
locus of interest. The
second primer contained a restriction enzyme recognition site for BsmF I.
114
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
SNP TSC0597888 was amplified using the following primer set:
First primer:
5'ACCCAGGCGCCAGAATTCTTTAGATAAAGCTGAAGGGA3'
Second primer:
5'GTTACGGGATCCGGGACTCCATATTGATC3'
The first primer had a biotin tag at the 5' end and contained a restriction
enzyme recognition
site for EcoRI. The first primer was designed to anneal 70 bases from the
locus of interest. The
second primer contained a restriction enzyme recognition site for BsmF I.
SNP TSC0195492 was amplified using the following primer set:
First primer:
5'CGTTGGCTTGAGGAATTCGACCAAAAGAGCCAAGAGAA
Second primer:
5' AAAAAGGGATCCGGGACCTTGACTAGGAC 3'
The first primer had a biotin tag at the 5' end and contained a restriction
enzyme recognition
site for EcoRI. The first primer was designed to anneal 80 bases from the
locus of interest. The
second primer contained a restriction enzyme recognition site for BsmF I.
SNP TSC0607185 was amplified using the following primer set:
First primer:
5'ACTTGATTCCGTGAATTCGTTATCAATAAATCTTACAT3'
115
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Second primer:
5'CAAGTTGGATCCGGGACCCAGGGCTAACC3'
The first primer had a biotin tag at the 5' end and contained a restriction
enzyme recognition
site for EcoRI. The first primer was designed to anneal 90 bases from the
locus of interest. The
second primer contained a restriction enzyme recognition site for BsmF I.
Alt loci of interest were amplified from the template genomic DNA using the
polymerase
chain reaction (PCR, U.S. Patent Nos. 4,683,195 and 4,683,202, incorporated
herein by reference).
In this example, the loci of interest were amplified iri separate reaction
tubes but they could also be.
amplified together in a single PCR reaction.. For increased specificity, a
"hot-start" PCR was used.
PCR reactions were performed using the HotStarTaq Master Mix Kit supplied by
QIAGEN (catalog
number 203443). The amount of template DNA and primer per reaction can be
optimized for each
locus of interest but in this example, 40 ng of template human genomic DNA and
5 pM of each
primer were used. Forty cycles of PCR were performed. The following PCR
conditions were used:
(1) 95°C for 15 minutes and 15 seconds;
(2) 37°C for 30 seconds;
(3) 95°C for 30 seconds;
(4) 57°C for 30 seconds;
(5) 95°C for 30 seconds;
(6) 64°C for 30 seconds;
(7) 95°C for 30 seconds;
(8) Repeat steps 6 and 7 thirty nine (39) times;
(9) 72°C for 5 minutes.
In the first cycle of PCR, the annealing temperature was about the melting
temperature of
the 3' annealing region of the second primers, which was 37°C. The
annealing temperature in the
second cycle of PCR was about the melting temperature of the 3' region, which
anneals to the
template DNA, of the first primer, which was 57°C. The annealing
temperature in the third cycle of
PCR was about the melting temperature of the entire sequence of the second
primer, which was
64°C. The annealing temperature for the remaining cycles was
64°C. Escalating the annealing
temperature from TM1 to TM2 to TM3 in the first three cycles of PCR greatly
improves specificity.
These annealing temperatures are representative, and the skilled artisan will
understand the
annealing temperatures for each cycle are dependent on the specific primers
used.
116
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
The temperatures and times for denaturing, annealing, and extension, can be
optimized by
trying various settings and using the parameters that yield the best results.
In this example, the first
primer was designed to anneal at various distances from the locus of interest.
The skilled artisan
understands that the annealing location of the first primer can be 5-10, 11-
15, 16-20, 21-25, 26-30,
31-35, 36-40, 41-45, 46-50, 51-55, 56-60, 61-65, 66-70, 71-75, 76-80, 81-85,
86-90, 91-95, 96-100,
101-105, 106-110, 111-115, 116-120, 121-125, 126-130, 131-140, 1410-160, 1610-
180, 1810-200,
2010-220, 2210-240, 2410-260,. 2610-280,. 2810-300, 3010-350, 3510-400, 4010-
450, 450-500, or
greater than 500 bases from the locus of interest.
Purification of Fragment of Interest
The PCR products were separated from the genomic template DNA. After the PCR
reaction, 1/J4 of the volume of each PCR reaction from one individual was
mixed together in a well
of a Streptawell, transparent, High-Bind plate from Roche Diagnostics GmbH
(catalog number 1
645 692, as listed in Roche Molecular Biochemicals, 2001 Biochemicals
Catalog). The first
primers contained a 5' biotin tag so the PCR products bound to the
Streptavidin coated wells while
the genomic template DNA did not. The streptavidin binding reaction was
performed using a
Thermomixer (Eppendorf) at 1000 rpm for 20 min. at 37°C. Each well was
aspirated to remove
unbound material, and washed three times with 1X PBS, with gentle mixing
(Kandpal et al., Nucl.
Acids Res. 18:1789-1795 (1990); Kaneoka et al., Biotechniques 10:30-34 (1991);
Green et al.,
Nucl. Acids Res. 18:6163-6164 (1990)).
Restriction Enzyme Digestion of Isolated Fragments
The purified PCR products were digested with the restriction enzyme BsmF I,
which binds
to the recognition site incorporated into the PCR products from the second
primer. The digests
were performed in the Streptawells following the instructions supplied with
the restriction enzyme.
After digestion, the wells were washed three times with PBS to remove the
cleaved fragments.
Incorporation of Labeled Nucleotide
The restriction enzyme digest with BsmF I yielded a DNA fragment with a 5'
overhang,
which contained the SNP site or locus of interest and a 3' recessed end. The
5' overhang functioned
as a template allowing incorporation of a nucleotide or nucleotides in the
presence of a DNA
polymerase.
Below, a schematic of the 5' overhang for SNP TSC0837969 is shown. The entire
DNA
sequence is not reproduced, only the portion to demonstrate the overhang
(where R indicates the
variable site).
117
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
5' TTAA
3' AATT R A C A
Overhang position 1 2 3 4
The observed nucleotides for TSC0837969 on the 5' sense strand (here depicted
as the top
strand) are adenine and guanine. The third position in the overhang on the
antisense strand
corresponds to cytosine, which is complementary to guanine. As this variable
site can be adenine
or guanine, fluorescently labeled ddGTP in the presence of unlabeled dCTP,
dTTP, and dATP was
used to determine the sequence of both alleles. The fill-in reactions for an
individual homozygous
for guanine, homozygous for adenine or heterozygous are diagrammed below.
Homozygous for guanine at TSC 0837969:
Allele 1 5' TTAA G*
3' AATT C A C A
Overhang position 1 2 3 4
Allele 2 5' TTAA G*
3' AATT C A C A
Overhang position 1 2 3 4
Labeled ddGTP is incorporated into the first position of the overhang. Only
one signal is
seen, which corresponds to the molecules filled in with labeled ddGTP at the
first position of the
overhang.
Homozygous for adenine at TSC 0837969:
Allele 1 5' TTAA A T G*
3' AATT T A C A
Overhang position 1 2 3 4
Allele 2 5' TTAA A T G*
3' AATT T A C A
Overhang position 1 2 3 4
118
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Unlabeled dATP is incorporated at position one of the overhang, and unlabeled
dTTP is
incorporated at position two of the overhang. Labeled ddGTP was incorporated
at position three of
the overhang. Only one signal will be seen; the molecules filled in with ddGTP
at position 3 will
have a different molecular weight from molecules filled in at position one,
which allows easy
identification of individuals homozygous for adenine or guanine.
Heterozygous at TSC0837969:
Allele 1 5' TTAA G*
3' AATT C A C A
Overhang position 1 2 3 4
Allele 2 5' TTAA A T G*
3' AATT T A C A
Overhang position 1 2 3 4 '
Two signals will be seen; one signal corresponds to the I~NA molecules filled
in with
ddGTP at position 1, and a second signal corresponding to molecules filled in
at position 3 of the
overhang. The two signals can be separated using any technique that separates
based on molecular
weight including but not limited to gel electrophoresis.
Below, a schematic of the 5' overhang for SNP TSC0034767 is shown. The entire
1~NA
sequence is not reproduced, only the portion to demonstrate the overhang
(where R indicates the
variable site).
A C A R GTGT 3'
CACA 5'
4 3 2 1 Overhang Position
The observed nucleotides for TSC0034767 on the 5' sense strand (here depicted
as the top
strand) are cytosine and guanine. The second position in the overhang
corresponds to adenine,
which is complementary to thymidine. The third position in the overhang
corresponds to cytosine,
which is complementary to guanine. Fluorescently labeled ddGTP in the presence
of unlabeled
dCTP, dTTP, and dATP is used to determine the sequence of both alleles.
119
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
In this case, the second primer anneals upstream of the locus of interest, and
thus the fill-in
reaction occurs on the anti-sense strand (here depicted as the bottom strand).
Either the sense strand
or the antisense strand can be filled in depending on whether the second
primer, which contains the
type IIS restriction enzyme recognition site, anneals upstream or downstream
of the locus of
interest.
Below, a schematic of the 5' overhang for SNP TSC1130902 is shown. The entire
DNA
sequence is not reproduced, only a portion to demonstrate the overhang (where
R indicates the
variable site).
5' TTCAT
3' AAGTA R T C C
Overhang position 1 2 3 4
The observed nucleotides for TSC1130902 on the 5' sense strand (here depicted
as the top
strand) are adenine and guanine. The second position in the overhang
corresponds to a thymidine,
and the third position in the overhang corresponds to cytosine, which is
complementary to guanine.
Fluorescently labeled ddGTP in the presence of unlabeled dCTP, dTTP, and dATP
is used
to determine the sequence of both alleles.
Below, a schematic of the 5' overhang for SNP TSC0597888 is shown. The entire
DNA
sequence is not reproduced, only the portion to demonstrate the overhang
(where R indicates the
variable site).
T C T R ATTC 3'
TAAG 5'
4 3 2 1 Overhang position
The observed nucleotides for TSC0597888 on the 5' sense strand (here depicted
as the top
strand) are cytosine and guanine. The third position in the overhang
corresponds to cytosine, which
is complementary to guanine. Fluorescently labeled ddGTP in the presence of
unlabeled dCTP,
dTTP, and dATP is used to determine the sequence of both alleles.
Below, a schematic of the 5' overhang for SNP TSC0607185 is shown. . The
entire DNA
sequence is not reproduced, only the portion to demonstrate the overhang
(where R indicates the
variable site).
3 5 C C T R TGTC 3'
120
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
ACAG 5'
4 3 2 1 Overhang position
The observed nucleotides for TSC0607185 on the 5' sense strand (here depicted
as the top
strand) are cytosine and thymidine. In this case, the second primer anneals
from the locus of
interest, which allows the anti-sense strand to be filled in. The anti-sense
strand (here depicted as
the bottom strand) will be filled in with guanine or adenine.
The second position in the 5' overhang is thymidine, which is complementary to
adenine,
and the third position in the overhang corresponds to cytosine, which is
complementary to guanine.
Fluorescently labeled ddGTP in the presence of unlabeled dCTP, dTTP, and dATP
is used to
determine the sequence of both alleles.
Below, a schematic of the 5' overhang for SNP TSC0195492 is shown. The entire
DNA
sequence is not reproduced, only the portion to demonstrate the overhang.
5' ATCT
3' TAGA R A C A
Overhang position 1 2 3 4
The observed nucleotides at this site are cytosine and guanine (here depicted
as the top
strand) . The second position in the 5' overhang is adenine, which is
complementary to thymidine,
and the third position in the overhang corresponds to cytosine, which is
complementary to guanine.
Fluorescently labeled ddGTP in the presence of unlabeled dCTP, dTTP, and dATP
is used to
determine the sequence of both alleles.
As demonstrated above, the sequence of both alleles of the six SNPs can be
determined by
labeling with ddGTP in the presence of unlabeled dATP, dTTP, and dCTP. The
following
components were added to each ftll in reaction: 1 ~,1 of fluorescently labeled
ddGTP, 0.5 pl of
unlabeled dNTPs ( 40 ~M), which contained all nucleotides except guanine, 2 pl
of lOX sequenase
buffer, 0.25 ~1 of Sequenase, and water as needed for a 20p1 reaction. The
fill in reaction was
performed at 40°C for 10 min. Non-fluorescently labeled dNTP was
purchased from Fermentas
Inc. (Hanover, MD). All other labeling reagents were obtained from Amersham
(Thermo
Sequenase Dye Terminator Cycle Sequencing Core Kit, US 79565).
After labeling, each Streptawell was rinsed with 1X PBS (100 ~,l) three times.
The "filled
in" DNA fragments were then released from the Streptawells by digestion with
the restriction
enzyme EcoRI, according to the manufacturer's instructions that were supplied
with the enzyme.
Digestion was performed for 1 hour at 37 °C with shaking at 120
rpm.
121
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Detection of the Locus of Interest
After release from the streptavidin matrix, the sample was loaded into a lane
of a 36 cm 5%
acrylamide (urea) gel (BioWhittaker Molecular Applications, Long Ranger Run
Gel Packs, catalog
number 50691). The sample was electrophoresed into the gel at 3000 volts for 3
min. The gel was
run for 3 hours on a sequencing apparatus (Hoefer SQ3 Sequencer). The gel was
removed from the
apparatus and scanned on the Typhoon 9400 Variable Mode Imager. The
incorporated labeled
nucleotide was detected by fluorescence.
As shown in FIG. 1 l, the template DNA in lanes 1 and 2 for SNP TSC0837969 is
homozygous for adenine. The following fill-in reaction was expected to occur
if the individual was
homozygous for adenine: ,
Homozygous for adenine at TSC 0837969:
5' TTAA A T G*
1 S 3' AATT T A C A
Overhang position 1 2 3 4
Unlabeled dATP was incorporated in the first position complementary to the
overhang.
Unlabeled dTTP was incorporated in the second position complementary to the
overhang. Labeled
ddGTP was incorporated in the third position complementary to the overhang.
Only one band was
seen, which migrated at about position 46 of the acrylamide gel. This
indicated that adenine was
the nucleotide filled in at position one. If the nucleotide guanine had been
filled in, a band would
be expected at position 44.
However, the template DNA in lanes 3 and.4 for SNP TSC0837969 was
heterozygous. The
following fill-in reactions were expected if the individual was heterozygous:
Heterozygous at TSC0837969:
Allele 15' TTAA G*
3' AATT C A C A
Overhang position 1 2 3 4
Allele 25' TTAA A T G*
3' AATT T A C A
Overhang position 1 2 3 4
122
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Two distinct bands were seen; one band corresponds to the molecules filled in
with ddGTP
at position 1 complementary to the overhang (the G allele), and the second
band corresponds to
molecules filled in with ddGTP at position 3 complementary to the overhang
(the A allele). The
two bands were separated based on the differences in molecular weight using
gel electrophoresis.
One fluorescently labeled nucleotide ddGTP was used to determine that an
individual was
heterozygous at a SNP site. This is the first use of a single nucleotide to
effectively detect the
presence of two different alleles.
For SNP TSC0034767, the template DNA in lanes 1 and 3 is heterozygous for
cytosine and
guanine, as evidenced by the two distinct bands. The lower band corresponded
to ddGTP filled in
at position 1 complementary to the overhang. The second band of slightly
higher molecular weight
corresponded to ddGTP filled in at position 3, indicating that the first
position in the overhang was
filled in with unlabeled dCTP, which allowed the polymerase to continue to
incorporate nucleotides
until it incorporated ddGTP at position 3 complementary to the overhang. The
template DNA in
lanes 2 and 4 was homozygous for guanine, as evidenced by a single band of
higher molecular
weight than if ddGTP had been filled in at the first position complementary to
the overhang.
For SNP TSC1130902, the template DNA in lanes 1, 2, and 4 is homozygous for
adenine at
the variable site, as evidenced by a single higher molecular weight band
migrating at about position
62 on the gel. The template DNA in lane 3 is heterozygous at the variable
site, as indicated by the
presence of two distinct bands. The lower band corresponds to molecules filled
in with ddGTP at
position 1 complementary to the overhang (the guanine allele). The higher
molecular weight band
corresponds to molecules filled in with ddGTP at position 3 complementary to
the overhang (the
adenine allele).
For SNP TSC0597888, the template DNA in lanes 1 and 4 was homozygous for
cytosine at
the variable site; the template DNA in lane 2 was heterozygous at the variable
site, and the template
DNA in lane 3 was homozygous for guanine. The expected fill-in reactions are
diagrammed below:
Homozygous for cytosine:
Allele 1 T C T G ATTC 3'
G* A C TAAG 5'
4 3 2 1 Overhang position
Allele 2 T C T G ATTC 3'
G* A C TAAG 5'
4 3 2 1 Overhang position
123
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Homozygous for guanine:
Allele 1 T C T C ATTC 3'
G* TAAG 5'
4 3 2 1 Overhang position
Allele 2 T C T C ATTC 3'
G* TAAG 5'
4 3 2 1 Overhang position
Heterozygous for guanine/cytosine:
Allele 1 T C T G ATTC 3'
G* A C TAAG 5'
4 3 2 1 Overhang position
Allele 2 T C ' T C ATTC 3'
G* TAAG 5'
4 3 2 1 Overhang position
Template DNA homozygous for guanine at the variable site displayed a single
band, which
corresponded to the DNA molecules filled in with ddGTP at position 1
complementary to the
overhang. These DNA molecules were of lower molecular weight compared to the
DNA molecules
filled in with ddGTP at position 3 of the overhang (see lane 3 for SNP
TSC0597888). The DNA
molecules differed by two bases in molecular weight.
Template DNA homozygous for cytosine at the variable site displayed a single
band, which
corresponds to the DNA molecules filled in with ddGTP at position 3
complementary to the
overhang. These DNA molecules migrated at a higher molecular weight than DNA
molecules filled
in with ddGTP at position 1 (see lanes 1 and 4 for SNP TSC0597888).
Template DNA heterozygous at the variable site displayed two bands; one band
corresponded to the DNA molecules filled in with ddGTP at position 1
complementary to the
overhang and was of lower molecular weight, and the second band corresponded
to DNA molecules
filled in with ddGTP at position 3 complementary to the overhang, and was of
higher molecular
weight (see lane 3 for SNP TSC0597888).
For SNP TSC0195492, the template DNA in lanes 1 and 3 was heterozygous at the
variable
site, which was demonstrated by the presence of two distinct bands. The
template DNA in lane 2
124
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
was homozygous for guanine at the variable site. The template DNA in lane 4
was homozygous for
cytosine. Only one band was seen in lane 4 for this SNP, and it had a higher
molecular weight than
the DNA molecules filled in with ddGTP at position 1 complementary to the
overhang (compare
lanes 2, 3 and 4).
The observed alleles for SNP TSC0607185 are reported as cytosine or thymidine.
For
consistency, the SNP consortium denotes the observed alleles as they appear in
the sense strand
www.snp.cshl.org/shpsearch.shtml; website active as of February 11, 2003). For
this SNP, the
second primer annealed upstream of the locus of interest, which allowed the
fill-in reaction to occur
on the antisense strand after digestion with BsmF I.
The template DNA in lanes 1 and 3 was heterozygous; the template DNA in lane 2
was
homozygous for thymidine, and the template DNA in lane 4 was homozygous for
cytosine. The
antisense strand was filled in with ddGTP, so the nucleotide on the sense
strand corresponded to
cytosine.
Molecular weight markers can be used to identify the positions of the expected
bands.
Alternatively, for each SNP analyzed, a known heterozygous sample can be used,
which will
identify precisely the position of the two expected bands.
As demonstrated in FIG. 11, one nucleotide labeled with one fluorescent dye
can be used to
determine the identity of a variable site including but not limited to SNPs
and single nucleotide
mutations. Typically, to determine if an individual is homozygous or
heterozygous at a SNP site,
multiple reactions are performed using one nucleotide labeled with one dye and
a second nucleotide
labeled with a second dye. However, this introduces problems in comparing
results because the
two dyes have different quantum coefficients. Even if different nucleotides
are labeled with the
same dye, the quantum coefficients are different. The use of a single
nucleotide labeled with one
dye eliminates any errors from the quantum coefficients of different dyes.
In this example, fluorescently labeled ddGTP was used. However, the method is
applicable
for a nucleotide tagged with any signal generating moiety including but not
limited to radioactive
molecule, fluorescent molecule, antibody, antibody fragment, hapten,
carbohydrate, biotin,
derivative of biotin, phosphorescent moiety, luminescent moiety,
electrochemiluminescent moiety,
chromatic moiety, and moiety having a detectable electron spin resonance,
electrical capacitance,
dielectric constant or electrical conductivity. In addition, labeled ddATP,
ddTTP, or ddCTP can be
used.
The above example used the third position complementary to the overhang as an
indicator
of the second allele. However, the second or fourth position of the overhang
can be used as well
(see Section on Incorporation of Nucleotides). Furthermore, the overhang was
generated with the
125
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
type IIS enzyme BsmF I; however any enzymes that cuts DNA at a distance from
its binding site
can be used including but not limited to the enzymes listed in Table I.
Also, in the above example, the nucleotide immediately preceding the SNP site
was not a
guanine on the strand that was filled in. This eliminated any effects of the
alternative cutting
properties of the type IIS restriction enzyme to be removed. For example, at
SNP TSC083?969, the
nucleotide from the SNP site on the sense strand was an adenine. If BsmF I
displayed alternate
cutting properties, the following overhangs would be generated for the adenine
allele and the
guanine allele:
G allele -11115 Cut 5' TTA
3' AAT T C A C
Overhang position 0 1 2 3
G allele after fill-in 5' TTA A G*
3' AAT T C A C
Overhang position 0 1 2 3
A allele 11/15 Cut 5' TTA
3' AAT T T A C
Overhang position 0 1 2 3
A allele after fill-in 5' TTA A A T G*
I
3' AAT T T A C
Overhang position 0 1 2 3
For the guanine allele, the first position in the overhang would be filled in
with dATP,
which would allow the polymerase to incorporate ddGTP at position 2
complementary to the
overhang. There would be no detectable difference between molecules cut at the
10/14 position or
molecules cut at the 11/15 position.
For the adenine allele, the first position complementary to the overhang would
be filled in
with dATP, the second position would be filled in with dATP, the third
position would be filled in
with dTTP, and the fourth position would be filled in with ddGTP. There would
be no difference in
the molecular weights between molecules cut at 10/14 or molecules cut at
11/15. The only
126
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
differences would correspond to whether the DNA molecules contained an adenine
at the variable
site or a guanine at the variable site.
As seen in FIG. 1 l, positioning the annealing region of the first primer
allows multiple
SNPs to be analyzed in a single lane of a gel. Also, when using the same
nucleotide with the same
dye, a single fill-in reaction can be performed. In this example, 6 SNPs were
analyzed in one lane.
However, ariy number of SNPs including but not limited to 1, 2, 3, 4, 5, 6, 7,
8, 9, 1 Q, 11, 12, 13,
14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 30-40, 40-
50, 51-60, 61-70, 71-80,
81-100, 101-120, 121-140, 141-160, 161-180, 181-200, and greater than 200 can
be analyzed in a
single reaction.
Furthermore, one labeled nucleotide used to detect both alleles can be mixed
with a second
labeled nucleotide used to detect a different set of SNPs provided that
neither of the nucleotides that
are labeled occur immediately before the variable site (complementary to
nucleotide at position 0 of
the 11115 cut). For example, suppose SNP X can be guanine or thymidine at the
variable site and
has the following 5' overhang generated after digestion with BsmF I:
SNP X 10/14 5' TTGAC
G allele 3'AACTG C A C T
Overhang position 1 2 3 4
SNP X 11/15 5' TTGA
G allele 3'AACT G C A C
Overhang position 0 1 2 3
SNP X 10/14 5' TTGAC
T allele 3'AACTG A A C T
Overhang position 1 2 3 4
SNP X 11115 5' TTGA
T allele 3'AACT G A A C
Overhang position 0 1 2 3
After the fill-in reaction with labeled ddGTP, unlabeled dATP, dCTP, and dTTP,
the
following molecules would be generated:
SNP X 10/14 5' TTGAC G*
127
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
G allele 3'AACTG C A C T
Overhang position 1 2 3 4
SNP X 11/15 5' TTGA C G*
G allele 3'AACT G C A C
Overhang position 0 1 2 3
SNP X 10/14 5' TTGAC T T G*
T allele 3'AACTG A A C T
10Overhang position 1 2 3 4
SNP X 11/15 5' TTGA C T T G*
T allele 3'AACT G A A C
Overhang position 0 1 2 3
Now suppose SNP Y can be adenine
or thymidine at the variable
site, and has the following
5' overhangs generated after
digestion with BsmF I.
SNP Y 10/14 5' GTTT
20A allele 3' CAAA T G T A
Overhang position 1 2 3 4
SNP Y 11/15 5' GTT
A allele 3' CAA A T G T
Overhang position 0 1 2 3
SNP Y 10114 S' GTTT
T allele 3' CAAA A G T A
Overhang position 1 2 3 4
SNP Y 11/15 S' GTT
T allele 3' CAA A A G T
Overhang position 0 1 2 3
128
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
After fill-in with labeled ddATP and unlabeled dCTP, dGTP, and dTTP, the
following
molecules would be generated:
SNP Y 10/14 5' GTTT A*
A allele 3' CAAA T G T A
Overhang position 1 2 3 4
SNP Y 11/15 5' GTT T A*
A allele 3' CAA A T G T
Overhang position 0 1 2 3
SNP Y 10/14 5' GTTT T C A*
T allele 3' CAAA A G T A
Overhang position 1 2 3 4
SNP Y 11/15 5' GTT T T C A*
T allele 3' CAA A A G T
Overhang position 0 1 2 3
In this example, labeled ddGTP and labeled ddATP are used to determine the
identity of
both alleles of SNP X and SNP Y respectively. The nucleotide immediately
preceding (the
complementary nucleotide to position 0 of the overhang from the 11/15 cut SNP
X is not guanine
or adenine on the strand that is filled-in. Likewise, the nucleotide
immediately preceding SNPY is
not guanine or adenine on the strand that is filled-in. This allows the fill-
in reaction for both SNPs
to occur in a single reaction with labeled ddGTP, labeled ddATP, and unlabeled
dCTP and dTTP.
This reduces the number of reactions that need to be performed and increases
the number of SNPs
that can be analyzed in one reaction.
The first primers for each SNP can be designed to anneal at different
distances from the
locus of interest, which allows the SNPs to migrate at different positions on
the gel. For example,
the first primer used to amplify SNP X can anneal at 30 bases from the locus
of interest, and the
first primer used to amplify SNP Y can anneal at 35 bases from the locus of
interest. Also, the
nucleotides can be labeled with fluorescent dyes that emit at spectrums that
do not overlap. After
running the gel, the gel can be scanned at one wavelength specific for one
dye. Only those
molecules labeled with that dye will emit a signal. The gel then can be
scanned at the wavelength
129
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
for the second dye. Only those molecules labeled with that dye will emit a
signal. This method
allows maximum compression for the number of SNPs that can be analyzed in a
single reaction.
In this example, the nucleotide preceding the variable site on the strand that
was filled-in
was not adenine or guanine, and the nucleotide following the variable site can
not be adenine or
guanine on the sense strand. This method can work with any combination of
labeled nucleotides,
and the skilled artisan would understand which labeling reactions can be mixed
and those that can
not. For instance, if one SNP is labeled with thymidine and a second SNP is
labeled with cytosine,
the SNPs can be labeled in a single reaction if the nucleotide immediately
preceding each variable
site is not thymidine or cytosine on the sense strand and the nucleotide
immediately after the
variable site is not thymidine or cytosine on the sense strand.
This method allows the signals from one allele to be compared to the signal
from a second
allele without the added complexity of determining the degree of alternate
cutting, or having to
correct for the quantum coefficients of the dyes. This method is especially
useful when trying to
quantitate a ratio for one allele to another. For example, this method is
useful for detecting
chromosomal abnormalities. The ratio of alleles at a heterozygous site is
expected to be about l :l
(one A allele and one G allele). However, if an extra chromosome is present
the ratio is expected to
be about 1:2 (one A allele and 2 G alleles or 2 A alleles and 1 G allele).
This method is especially
useful when trying to detect fetal DNA in the presence of maternal DNA.
In addition, this method is useful for detecting two genetic signals in one
sample. For
example, this method can detect mutant cells in the presence of wild type
cells (see Example 5). If
a mutant cell contains a mutation in the DNA sequence of a particular gene,
this method can be
used to detect both the mutant signal and the wild type signal. This method
can be used to detect
the mutant DNA sequence in the presence of the wild type DNA sequence. The
ratio of mutant
DNA to wild type DNA can be quantitated because a single nucleotide labeled
with one signal
generating moiety is used.
EXAMPLE 7
Non-invasive methods for the detection of various types of cancer have the
potential to
reduce morbidity and mortality from the disease. Several techniques for the
early detection of
colorectal tumors have been developed including colonoscopy, barium enemas,
and sigmoidoscopy;
however the techniques are limited in use because they are invasive, which
causes a low rate of
patient compliance. Non-invasive genetic tests may be useful in identifying
early stage colorectal
tumors.
130
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
In 1991, researchers identified the Adenomatous Polyposis Coli gene (APC),
which plays a
critical role in the formation of colorectal tumors (Kinzler et al., Science
253:661-665, 1991). The
APC gene resides on chromosome Sq21-22 and a total of 15 exons code for an RNA
molecule of
8529 nucleotides, which produces a 300 Kd APC protein. The protein is
expressed in numerous
cell types and is essential for cell adhesion.
Mutations in the APC gene generally initiate colorectal neoplasia (Tsao, J. et
al., Am, J.
Pathol. 145:531-534, 1994). Approximately 95% of the mutations in the APC gene
result in
nonsense/frameshift mutations. The most common mutations occur at codons 1061
and 1309;
mutations at these codons account for 1/3 of all germline mutations. With
regard to somatic
mutations, 60% occur within codons 1286-1513, which is about 10% of the coding
sequence. This
region is termed the mutation Cluster Region (MCR). Numerous types of
mutations have been
identified in the APC gene including nucleotide substitutions (see Table VII
), splicing errors (see
Table VIII), small deletions (see Table IX), small insertions (see Table X),
small,
insertions/deletions (see Table XI), gross deletions (see Table XII), gross
insertions (see Table
XIII), and complex rearrangements (see Table XIV).
Researchers have attempted to identify cells harboring mutations in the APC
gene in stool
samples (Traverso, G. et al., New England Journal of Medicine, Vol 346:311-
320, 2002). While
APC mutations are found in nearly all tumors, about 1 in 250 cells in the
stool sample has a
mutation in the APC gene; most of the cells are normal cells that have been
shed into the feces.
Furthermore, human DNA represents about one-billionth of the total DNA found
in stool samples;
the majority of DNA is bacterial. The technique employed by Traverso et al.
only detects
mutations that result in a truncated protein.
As discussed above, numerous mutations in the APC gene have been implicated in
the
formation of colorectal tumors. Thus, a need still exists for a highly
sensitive, non-invasive
technique for the detection of colorectal tumors. Below, methods are described
for detection of two
mutations in the APC gene. However, any number of mutations can be analyzed
using the methods
described herein.
Preparation of Template DNA
The template DNA is purified from a sample containing colon cells including
but not
limited to a stool sample. The template DNA is purified using the procedures
described by
Ahlquist et al. (Gastroenterology, 119:1219-1227, 2000). If stool samples are
frozen, the samples
are thawed at room temperature, and homogenized with an Exactor stool shaker
(Exact
Laboratories, Maynard, Mass.) Following homogenization, a 4 gram stool
equivalent of each
sample is centrifuged at 2536 x g for 5 minutes. The samples are centrifuged a
second time at 16,
131
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
500 x g for 10 minutes. Supernatants are incubated with 20 pl of RNase (0.5 mg
per milliliter) for 1
hour at 37°C. DNA is precipitated with 1/10 volume of 3 mol of sodium
acetate per liter and an
equal volume of isopropanol. The DNA is dissolved in 5 ml of TRIS-EDTA (0.01
mol of Tris per
liter (pH 7.4) and 0.001 mole of EDTA per liter.
Design of Primers
To determine if a mutation resides at codon 1370, the following primers are
used:
First primer:
5'GTGCAAAGGCCTGAATTCCCAGGCACAAAGCTGTTGAA3'
Second primer:
5' TGAAGCGAACTAGGGACTCAGGTGGACTT
The first primer contains a biotin tag at the extreme 5' end, and the
nucleotide sequence for
the restriction enzyme EcoRI. The second primer contains the nucleotide
sequence for the
restriction enzyme BsmF I.
To determine if a small deletion exists at codon 1302, the following primers
are used:
First primer:
5'GATTCCGTAAACGAATTCAGTTCATTATCATCTTTGTC3'
Second primer:
5'CCATTGTTAAGCGGGACTTCTGCTATTTG3'
The first primer has a biotin tag at the 5' end and contains a restriction
enzyme recognition
site for EcoRI. The second primer contains a restriction enzyme recognition
site for BsmF I.
PCR Reaction
The loci of interest are amplified from the template genomic DNA using the
polymerase
chain reaction (PCR, U.S. Patent Nos. 4,683,195 and 4,683,202, incorporated
herein by reference).
The loci of interest are amplified in separate reaction tubes; they can also
be amplified together in a
single PCR reaction. For increased specificity, a "hot-start" PCR reaction is
used, e.g. by using the
HotStarTaq Master Mix Kit supplied by QIAGEN (catalog number 203443). The
amount of
template DNA and primer per reaction are optimized for each locus of interest
but in this example,
ng of template human genomic DNA and 5 pM of each primer are used. Forty
cycles of PCR
35 are performed. The following PCR conditions are used:
132
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
(1) 95°C for 15 minutes and 15 seconds;
(2) 37°C for 30 seconds;
(3) 95°C for 30 seconds;
(4) 57°C for 30 seconds;
(5) 95°C for 30 seconds;
(6) 64°C for 30 seconds;
(7) 95°C for 30 seconds;
(8) Repeat steps 6 and 7 thirty nine (39) times;
(9) 72°C for 5 minutes.
In the first cycle of PCR, the annealing temperature is about the melting
temperature of the
3' annealing region of the second primers, which is 37°C. The annealing
temperature in the second
cycle of PCR is about the melting temperature of the 3' region, which anneals
to the template DNA,
of the first primer, which is 57°C. The annealing temperature in the
third cycle of PCR is about the
melting temperature of the entire sequence of the second primer, which is
64°C. The annealing
temperature for the remaining cycles is 64°C. Escalating the annealing
temperature from TM1 to
TM2 to TM3 in the first three cycles of PCR greatly improves specificity.
These annealing
temperatures are representative, and the skilled artisan understands that the
annealing temperatures
for each cycle are dependent on the specific primers used.
The temperatures and times for denaturing, annealing, and extension, are
optimized by
trying various settings and using the parameters that yield the best results.
Purification of Fragment of Interest
The PCR products are separated from the genomic template DNA. Each PCR product
is
divided into four separate reaction wells of a Streptawell, transparent, High-
Bind plate from Roche
Diagnostics GmbH (catalog number 1 645 692, as listed in Roche Molecular
Biochemicals, 2001
Biochemicals Catalog). The first primers contain a 5' biotin tag so the PCR
products bound to the
Streptavidin coated wells while the genomic template DNA does not. The
streptavidin binding
reaction is performed using a Thermomixer (Eppendor~ at 1000 rpm for 20 min.
at 37°C. Each
well is aspirated to remove unbound material, and washed three times with 1X
PBS, with gentle
mixing (Kandpal et al., Nucl. Acids Res. 18:1789-1795 (1990); Kaneoka et al.,
Biotechniques
10:30-34 (1991); Green et al., Nucl. Acids Res. 18:6163-6164 (1990)).
Alternatively, the PCR products are placed into a single well of a
streptavidin plate to
perform the nucleotide incorporation reaction in a single well.
133
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Restriction Enzyme Digestion of Isolated Fragments
The purified PCR products are digested with the restriction enzyme BsmF I (New
England
Biolabs catalog number R0572S), which binds to the recognition site
incorporated into the PCR
products from the second primer. The digests are performed in the Streptawells
following the
instructions supplied with the restriction enzyme. After digestion with the
appropriate restriction
enzyme, the wells are washed three times with PBS to remove the cleaved
fragments.
Incorporation of Labeled Nucleotide
The restriction enzyme digest described above yields a DNA fragment with a 5'
overhang,
which contains the locus of interest and a 3' recessed end. The 5' overhang
functions as a template
allowing incorporation of a nucleotide or nucleotides in the presence of a DNA
polymerase.
For each locus of interest, four separate fill in reactions are performed;
each ofthe.four
reactions contains a different fluorescently labeled ddNTP (ddATP, ddTTP,
ddGTP, or ddCTP).
The following components are added to each fill in reaction: 1 pl of a
fluorescently labeled ddNTP,
0.5 ~,1 of unlabeled ddNTPs ( 40 pM), which contains all nucleotides except
the nucleotide that is
fluorescently labeled, 2 ~.1 of l OX sequenase buffer, 0.25 p,l of Sequenase,
and water as needed for a
20p1 reaction. The fill are performed in reactions at 40°C for 10 min.
Non-fluorescently labeled
ddNTP are purchased from Fermentas Inc. (Hanover, MD). All other labeling
reagents are obtained
from Amersham (Thermo Sequenase Dye Terminator Cycle Sequencing Core Kit, US
79565). In
the presence of fluorescently labeled ddNTPs, the 3' recessed end is extended
by one base, which
corresponds to the locus of interest.
A mixture of labeled ddNTPs and unlabeled dNTPs also can be used for the fill-
in reaction.
The "fill in" conditions are as described above except that a mixture
containing 40 ~,M unlabeled
dNTPs, 1 pl fluorescently labeled ddATP, 1 p,l fluorescently labeled ddTTP, 1
p.l fluorescently
labeled ddCTP, and 1 ~,1 ddGTP are used. The fluorescent ddNTPs are obtained
from Amersham
(Thermo Sequenase Dye Terminator Cycle Sequencing Core Kit, US 79565; Amersham
does not
publish the concentrations of the fluorescent nucleotides). The locus of
interest is digested with the
restriction enzyme BsmF I, which generates a 5' overhang of four bases. If the
first nucleotide
incorporated is a labeled ddNTP, the 3' recessed end is filled in by one base,
allowing detection of
the locus of interest. However, if the first nucleotide incorporated is a
dNTP, the polymerase
continues to incorporate nucleotides until a ddNTP is filled in. For example,
the first two
nucleotides may be filled in with dNTPs, and the third nucleotide with a
ddNTP, allowing detection
of the third nucleotide in the overhang. Thus, the sequence of the entire 5'
overhang is determined,
which increases the information obtained from each SNP or locus of interest.
This type of fill in
134
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
reaction is especially useful when detecting the presence of insertions,
deletions, insertions and
deletions, rearrangements, and translocations.
Alternatively, one nucleotide labeled with a single dye is used to determine
the sequence of
the locus of interest. See Example 6. This method eliminates any potential
errors when using
different dyes, which have different quantum coefficients.
After labeling, each Streptawell is rinsed with 1X PBS (100 p,l) three times.
The "filled in"
DNA fragments are released from the Streptawells by digesting with the
restriction enzyme EcoRI,
according to the manufacturer's instructions that are supplied with the
enzyme. The digestion is
performed for 1 hour at 37 °C with shaking at 120 rpm.
Detection of the Locus of Interest
After release from the streptavidin matrix, the sample is loaded into a lane
of a 36 cm 5%
acrylamide (urea) gel (BioWhittaker Molecular Applications, Long Ranger Run
Gel Packs, catalog
number 50691). The sample is electrophoresed into the gel at 3000 volts for 3
min. The gel is run
for 3 hours using a sequencing apparatus (Hoefer SQ3 Sequencer). The
incorporated labeled
nucleotide is detected by fluorescence.
To determine if any cells contain mutations at codon 1370 of the APC gene when
separate
fill-in reactions are performed, the lanes of the gel that correspond to the
fill-in reaction for ddATP
and ddTTP are analyzed. If only normal cells are present, the lane
corresponding to the fill in
reaction with ddATP is a bright signal. No signal is detected for the "fill-
in" reaction with ddTTP.
However, if the patient sample contains cells with mutations at codon 1370 of
the APC gene, the
lane corresponding to the fill in reaction with ddATP is a bright signal, and
a signal is detected from
the lane corresponding to the fill in reaction with ddTTP. The intensity of
the signal from the lane
corresponding to the fill in reaction with ddTTP is indicative of the number
of mutant cells in the
sample.
Alternatively, one labeled nucleotide is used to determine the sequence of the
alleles at
codon 1370 of the APC gene. At codon 1370, the normal sequence is AAA, which
codes for the
amino acid lysine. However, a nucleotide substitution has been identified at
codon 1370, which is
associated with colorectal tumors. Specifically, a change from A to T (AAA-
TAA) typically is
found at codon 1370, which results in a stop codon. A single fill-in reaction
is performed using
labeled ddATP, and unlabeled dTTP, dCTP, and dGTP. A single nucleotide labeled
with one
fluorescent dye is used to determine the presence of both the normal and
mutant DNA sequence that
codes for codon 1370. The relevant DNA sequence is depicted below with the
sequence
corresponding to codon 1370 in bold:
135
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
5' CCCAAAAGTCCACCTGA
3' GGGTTTTCAGGTGGACT
After digest with BsmF I, the following overhang is produced:
5' CCC
3' GGG T T T T
Overhang position 1 2 3 4
If the patient sample has no cells harboring a mutation at codon 1370, one
signal is
seen corresponding to incorporation of labeled ddATP.
5' CCC A*
3' GGG T T T T
Overhang position 1 2 3 4
However, if the patient sample has cells with mutations at codon 1370 of the
APC
gene, one signal is seen, which corresponds to the normal sequence at codon
1370, and a second
signal is seen, which corresponds to the mutant sequence at codon 1370. The
signals clearly are
identified as they differ in molecular weight. '
Overhang of normal DNA sequence: CCC
GGG T T T T
Overhang position 1 2 3 4
Normal DNA sequence after fill-in: CCC A*
GGG T T T T
Overhang position 1 2 3 4
Overhang of mutant DNA sequence: CCC
GGG A T T T
Overhang position 1 2 3 4
Mutant DNA sequence after fill-in: CCC T A*
GGG A T T T
136
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Overhang position 1 2 3 4
Two signals are seen when the mutant allele is present. The mutant DNA
molecules are
filled in one base after the wild type DNA molecules. The two signals are
separated using any
method that discriminates based on molecular weight. One labeled nucleotide
(ddATP) is used to
detect the presence of both the wild type DNA sequence and the mutant DNA
sequence. This
method of labeling reduces the number of reactions that need to be performed
and allows accurate
quantitation for the number of mutant cells in the patient sample. The number
of mutant cells in the
sample is used to determine patient prognosis, the degree and the severity of
the disease. This
method of labeling eliminates the complications associated with using
different dyes, which have
distinct quantum coefficients. This method of labeling also eliminates errors
associated with
pipetting reactions.
To determine if any cells contain mutations at codon 1302 of the APC gene when
separate
fill-in reactions are performed, the lanes of the gel that correspond to the
fill-in reaction for ddTTP
and ddCTP are analyzed. The normal DNA sequence is depicted below with
sequence coding for
codon 1302 in bold type-face.
Normal Sequence: 5' ACCCTGCAAATAGCAGAA
3' TGGGACGTTTATCGTCTT
After digest, the following 5' overhang is produced:
5' ACCC ,
3' TGGG A C G T
Overhang position 1 2 3 4
After the fill-in reaction, labeled ddTTP is incorporated.
5' ACCC T*
3' TGGG A C G T
Overhang position 1 2 3 4
A deletion of a single base of the APC sequence, which typically codes for
codon 1302, has
been associated with colorectal tumors. The mutant DNA sequence is depicted
below with the
relevant sequence in bold:
137
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Mutant Sequence: 5' ACCCGCAAATAGCAGAA
3'TGGGCGTTTATCGTCTT
After digest:
5' ACC
3' TGG G C G T
Overhang position 1 2 3 4
After fill-in:
5' ACC C*
3' TGG G C G T
Overhang position 1 2 3 4
If there are no mutations in the APC gene, signal is not detected for the fill
in reaction with
ddCTP*, but a bright signal is detected for the fill-in reaction with ddTTP*.
However, if there are
cells in the patient sample that have mutations in the APC gene, signals are
seen for the fill-in
reactions with ddCTP*and ddTTP*.
Alternatively, a single fill-in reaction is performed using a mixture
containing unlabeled
dNTPs, fluorescently labeled ddATP, fluorescently labeled ddTTP, fluorescently
labeled ddCTP,
and fluorescently labeled ddGTP. If there is no deletion, labeled ddTTP is
incorporated.
5' ACCC T°'~
3' TGGG A C G T
Overhang position 1 2 3 4
However, if the T has been deleted, labeled ddCTP* is incorporated.
5' ACCC*
3' TGGG C G T
Overhang position 1 2 3 4
The two signals are separated by molecular weight because of the deletion of
the thymidine
nucleotide. If mutant cells are present, two signals are generated in the same
lane but are separated
by a single base pair (this principle is demonstrated in FIG 9D). The deletion
causes a change in
138
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
the molecular weight of the DNA fragments, which allows a single fill in
reaction to be used to
detect the presence of both normal and mutant cells.
In the above example, methods for the detection of a nucleotide substitution
and a small
deletion are described. However, the methods can be used for the detection of
any type of mutation
including but not limited to nucleotide substitutions (see Table VII),
splicing errors (see Table
VIII), small deletions (see Table IX), small insertions (see Table X), small
insertions/deletions (see
Table XI), gross deletions (see Table XII), gross insertions (see Table XIII),
and complex
rearrangements (see Table XIV).
In addition, the above-described methods are used for the detection of any
type of disease
including but not limited to those listed in Table IV. Furthermore, any type
of mutant gene is
detected using the inventions described herein including but not limited to
the genes associated with
the diseases listed in Table IV, BRCA1, BRCA2, MSH6, MSH2, MLH1, RET, PTEN,
ATM, H-
RAS, p53, ELAC2, CDHl, APC, AR, PMS2, MLH3, CYP1A1, GSTP1, GSTMl, AXIN2,
CYP19,
MET, NAT1, CDKN2A, NQOI, trc8, RAD51, PMS1, TGFBR2, VHL, MC4R, POMC, NROB2,
UCP2, PCSKl, PPARG, ADRB2, UCP3, glurl, cart, SORBS1, LEP, LEPR, SIM1, TNF, IL-
6, IL-
1, IL,-2, IL-3, IL1A, TAP2, THPO, THRB, NBS1, RBM15, LIF, MPL, RUNX1, Her-2,
glucocorticoid receptor, estrogen receptor, thyroid receptor, p21, p27, K-RAS,
N-RAS,
retinoblastoma protein, Wiskott-Aldrich (WAS) gene, Factor V Leiden, Factor II
(prothrombin),
methylene tetrahydrofolate reductase, cystic fibrosis, LDL receptor, HDL
receptor, superoxide
dismutase gene, SHOX gene, genes involved in nitric oxide regulation, genes
involved in cell cycle
regulation, tumor suppressor genes, oncogenes, genes associated with
neurodegeneration, genes
associated with obesity, . Abbreviations correspond to the proteins as listed
on the Human Gene
Mutation Database, which is incorporated herein by reference
we~w.archive.uwcm.ac.uk./uwcm;
website address active as of February 12, 2003).
The above-example demonstrates the detection of mutant cells and mutant
alleles from a
fecal sample. However, the methods described herein are used fox detection of
mutant cells from
any biological sample including but not limited to blood sample, serum sample,
plasma sample,
urine sample, spinal fluid, lymphatic fluid, semen, vaginal secretion, ascitic
fluid, saliva, mucosa
secretion, peritoneal fluid, fecal sample, body exudates, breast fluid, lung
aspirates, cells, tissues,
individual cells or extracts of the such sources that contain the nucleic acid
of the same, and
subcellular structures such as mitochondria or chloroplasts. In addition, the
methods described
herein are used for the detection of mutant cells and mutated DNA from any
number of nucleic acid
containing sources including but not limited to forensic, food, archeological,
agricultural or
inorganic samples.
139
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
The above example is directed to detection of mutations in the APC gene.
However, the
inventions described herein are used for the detection of mutations in any
gene that is associated
with or predisposes to disease (see Table XV).
For example, hypermethylation of the glutathione S-transferase P1 (GSTP1)
promoter is the
most common D~1A alteration in prostrate cancer. The methylation state of the
promoter is
determined using sodium bisulfate and the methods described herein.
Treatment with sodium bisulfate converts unmethylated cytosine residues into
uracil, and
leaving the methylated cytosines unchanged. Using the methods described
herein, a first and
second primer are designed to amplify the regions of the GSTP1 promoter that
are often
methylated. Below, a region of the GSTP 1 promoter is shown prior to sodium
bisulfate treatment:
Before Sodium Bisulfate treatment:
5'ACCGCTACA
3'TGGCGATCA
Below, a region of the GSTP1 promoter is shown after sodium bisulfate
treatment, PCR
amplification, and digestion with the type IIS restriction enzyme BsmF I:
Unmethylated
5' ACC
3' TGG U G A T
Overhang position 1 2 3 4
ll~Iethylated
5' ACC
3' TGG C G A T
Overhang position 1 2 3 4
Labeled ddATP, unlabeled dCTP, dGTP, and dTTP are used to fill-in the 5'
overhangs.
The following molecules are generated:
Unmethylated
5' ACC A*
3' TGG U G A T
Overhang position 1 2 3 4
140
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Methylated
5' ACC G C T A*
3' TGG C G A T
Overhang position1 2 3 4
Two signals are seen; one corresponds to DNA molecules filled in with ddATP at
position
one complementary to the overhang (unmethylated), and the other corresponds to
the DNA
molecules filled in with ddATP at position 4 complementary to the overhang
(methylated). The
two signals are separated based on molecular weight. Alternatively, the fill-
in reactions are
performed in separate reactions using labeled ddGTP in one reaction and
labeled ddATP in another
reaction.
The methods described herein are used to screen for prostate cancer and also
to monitor the
progression and severity of the disease. The use of a single nucleotide to
detect both the methylated
and unmethylated sequences allows accurate quantitation and provides a high
level of sensitivity for
the methylated sequences, which is a useful tool for earlier detection of the
disease.
The information contained in Tables VII-XIV was obtained from the Human Gene
Mutation Database. With the information provided herein, the skilled artisan
will understand how
to apply these methods for determining the sequence of the alleles for any
gene. A large number of
genes and there associated mutations can be found at the following website:
www.archive.uwcm.ac.uk./uwcm.
TABLE VII: NUCLEOTIDE SUBSTITUTIONS
C~donI~TUCIe~tideAaxii~n~ Phenotype
ueid
99 CGG-TGG Arg-Trp Adenomatous polyposis coli
121 AGA-TGA Arg-Term Adenomatous polyposis coli
157 TGG-TAG Trp-Term Adenomatous polyposis coli
159 TAC-TAG Tyr-Term Adenomatous polyposis coli
163 CAG-TAG Gln-Term Adenomatous polyposis coli
168 AGA-TGA Arg-Term Adenomatous polyposis coli
171 AGT-ATT Ser-Ile Adenomatous polyposis coli
181 CAA-TAA Gln-Term Adenomatous polyposis coli
190 GAA-TAA Glu-Term Adenomatous polyposis coli
202 GAA-TAA Glu-Term Adenomatous polyposis coli
208 CAG-CGG Gln-Arg Adenomatous polyposis coli
208 CAG-TAG Gln-Term Adenomatous polyposis coli
141
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
213 CGA-TGA Arg-Term Adenomatous polyposis coli
215 CAG-TAG Gln-Term Adenomatous polyposis coli
216 CGA-TGA Arg-Term Adenomatous polyposis coli
232 CGA-TGA Arg-Term Adenomatous polyposis coli
233 CAG-TAG Gln-Term Adenomatous polyposis coli
247 CAG-TAG Gln-Term Adenomatous polyposis coli
267 GGA-TGA Gly-Term Adenomatous polyposis coli
278 CAG-TAG ~Gln-TermAdenomatous polyposis coli
280 TCA-TGA Ser-Term Adenomatous polyposis coli
280 TCA-TAA Ser-Term Adenomatous polyposis coli
283 CGA-TGA Arg-Term Adenomatous polyposis coli
302 CGA-TGA Arg-Term Adenomatous polyposis coli
332 CGA-TGA Arg-Term Adenomatous polyposis coli
358 CAG-TAG Gln-Term Adenomatous polyposis coli
405 CGA-TGA Arg-Term Adenomatous polyposis coli
414 CGC-TGC Arg-Cys Adenomatous polyposis coli
~
422 GAG-TAG Glu-Term Adenomatous polyposis coli
423 TGG-TAG Trp-Term Adenomatous polyposis coli
424 CAG-TAG Gln-Term Adenomatous polyposis coli
433 CAG-TAG Gln-Term Adenomatous polyposis coli
443 GAA-TAA Glu-Term Adenomatous polyposis coli
457 TCA-TAA Ser-Term Adenomatous polyposis coli
473 CAG-TAG Gln-Term Adenomatous polyposis coli
486 TAC-TAG Tyr-Term Adenomatous polyposis coli
499 CGA-TGA Arg-Term Adenomatous polyposis coli
500 TAT-TAG Tyr-Term Adenomatous polyposis coli
541 CAG-TAG Gln-Term Adenomatous polyposis coli
553 TGG-TAG Trp-Term Adenomatous polyposis coli
554 CGA-TGA Arg-Term Adenomatous polyposis coli
564 CGA-TGA Arg-Term Adenomatous polyposis coli
577 TTA-TAA Leu-Term Adenomatous polyposis coli
586 AAA-TAA Lys-Term Adenomatous polyposis coli
592 TTA-TGA Leu-Term Adenomatous polyposis coli
593 TGG-TAG Trp-Term Adenomatous polyposis coli
142
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
593 TGG-TGA Trp-Term Adenomatous polyposis coli
622 TAC-TAA Tyr-Term Adenomatous polyposis coli
625 CAG-TAG Gln-Term Adenomatous polyposis coli
629 TTA-TAA Leu-Term Adenomatous polyposis coli
650 GAG-TAG Glu-Term Adenomatous polyposis coli
684 TTG-TAG Leu-Term Adenomatous polyposis coli
685 TGG-TGA Trp-Term Adenomatous polyposis coli
695 CAG-TAG Gln-Term Adenomatous polyposis coli
699 TGG-TGA Trp-Term Adenomatous polyposis coli
699 TGG-TAG Trp-Term Adenomatous polyposis coli
713 TCA-TGA Ser-Term Adenomatous polyposis coli
722 AGT-GGT Ser-Gly Adenomatous polyposis coli
~
747 TCA-TGA Ser-Term Adenomatous polyposis coli
764 TTA-TAA Leu-Term Adenomatous polyposis coli
784 TCT-ACT Ser-Thr Adenomatous polyposis coli
805 CGA-TGA Arg-Term Adenomatous polyposis coli
811 TCA-TGA Ser-Term Adenomatous polyposis coli
848 AAA-TAA Lys-Term Adenornatous polyposis coli
876 CGA-TGA Arg-Term Adenomatous polyposis coli
879 CAG-TAG Gln-Term Adenomatous polyposis coli
893 GAA-TAA Glu-Term Adenomatous polyposis coli
932 TCA-TAA Ser-Term Adenomatous polyposis coli
932 TCA-TGA Ser-Term Adenomatous polyposis coli
935 TAC-TAG Tyr-Term Adenomatous polyposis coli
935 TAC-TAA Tyr-Term Adenomatous polyposis coli
995 TGC-TGA Cys-Term Adenomatous polyposis coli
997 TAT-TAG Tyr-Term Adenomatous polyposis coli
999 CAA-TAA Gln-Term Adenomatous polyposis coli
1000 TAC-TAA Tyr-Term Adenomatous polyposis coli
1020 GAA-TAA Glu-Term Adenomatous polyposis coli
1032 TCA-TAA Ser-Term Adenomatous polyposis coli
1041 CAA-TAA Gln-Term Adenomatous polyposis coli
1044 TCA-TAA Ser-Term Adenomatous polyposis coli
1045 CAG-TAG Gln-Term Adenomatous polyposis coli
143
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
1049 TGG-TGA Trp-Term Adenomatous polyposis coli
1067 CAA-TAA Gln-Term Adenomatous polyposis coli
1071 CAA-TAA Gln-Term Adenomatous polyposis coli
1075 TAT-TAA Tyr-Term Adenomatous polyposis coli
1075 TAT-TAG Tyr-Term Adenomatous polyposis coli
1102 TAC-TAG Tyr-Term Adenomatous polyposis coli
1110 TCA-TGA Ser-Term Adenomatous polyposis coli
1114 CGA-TGA Arg-Term Adenomatous polyposis coli
1123 CAA-TAA Gln-Term Adenomatous polyposis coli
1135 TAT-TAG Tyr-Term Adenomatous polyposis coli
1152 CAG-TAG Gln-Term Adenomatous polypasis coli
.
1155 GAA-TAA Glu-Term Adenomatous polyposis coli
1168 GAA-TAA Glu-Term Adenomatous polyposis coli
1175 CAG-TAG Gln-Term Adenomatous polyposis coli
1176 CCT-CTT Pro-Leu Adenomatous polyposis coli
1184 GCC-CCC Ala-Pro Adenomatous polyposis coli
1193 CAG-TAG Gln-Term Adenomatous polyposis coli
1194 TCA-TGA Ser-Term Adenomatous polyposis coli
1198 TCA-TGA Ser-Term Adenomatous polyposis coli
1201 TCA-TGA Ser-Term Adenomatous polyposis coli
1228 CAG-TAG Gln-Term Adenomatous polyposis coli
1230 CAG-TAG Gln-Term Adenomatous polyposis coli
1244 CAA-TAA Gln-Term Adenomatous polyposis coli
1249 TGC-TGA Cys-Term Adenomatous polyposis coli
1256 CAA-TAA Gln-Term Adenomatous polyposis coli
1262 TAT-TAA Tyr-Term Adenomatous polyposis coli
1270 TGT-TGA Cys-Term Adenomatous polyposis coli
1276 TCA-TGA Ser-Term Adenomatous polyposis coli
1278 TCA-TAA Ser-Term Adenomatous polyposis coli
1286 GAA-TAA Glu-Term Adenomatous polyposis coli
1289 TGT-TGA Cys-Term Adenomatous polyposis coli
1294 CAG-TAG Gln-Term Adenomatous polyposis coli
1307 ATA-AAA Ile-Lys Colorectal cancer, predisposition
to, association
1309 GAA-TAA Glu-Term Adenomatous polyposis coli
144
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
1317 GAA-CAA Glu-Gln Colorectal cancer, predisposition
to
1328 CAG-TAG Gln-Term Adenomatous polyposis coli
1338 CAG-TAG Gln-Term Adenomatous polyposis coli
1342 TTA-TAA Leu-Term Adenomatous polyposis coli
1342 TTA-TGA Leu-Term Adenomatous polyposis coli
1348 AGG-TGG Arg-Trp Adenomatous polyposis coli
1357 GGA-TGA Gly-Term Adenomatous polyposis coli
1367 ~CAG-TAG Gln-Term Adenomatous polyposis coli
1370 AAA-TAA Lys-Term Adenomatous polyposis coli
1392 TCA-TAA Ser-Term Adenomatous polyposis coli
1392 TCA-TGA Ser-Term Adenomatous polyposis coli
1397 GAG-TAG Glu-Term Adenomatous polyposis coli
1449 AAG-TAG Lys-Term Adenomatous polyposis coli
1450 CGA-TGA Arg-Term Adenomatous polyposis coli
1451 GAA-TAA Glu-Term Adenomatous polyposis coli
1503 TCA-TAA Ser-Term Adenomatous polyposis coli
1517 CAG-TAG Gln-Term Adenomatous polyposis coli
1529 CAG-TAG Gln-Term Adenomatous polyposis coli
1539 TCA-TAA Ser-Term Adenomatous polyposis coli
1541 CAG-TAG Gln-Term Adenomatous polyposis coli
1564 TTA-TAA Leu-Term Adenomatous polyposis coli
1567 TCA-TGA Ser-Term Adenomatous polyposis coli
1640 CGG-TGG Arg-Trp Adenomatous polyposis coli
1693 GAA-TAA Glu-Term Adenomatous polyposis coli
1822 GAC-GTC Asp-Val Adenomatous polyposis coli, association
with ?
2038 CTG-GTG Leu-Val Adenomatous polyposis coli
2040 CAG-TAG Gln-Term Adenomatous polyposis coli
2566 AGA-AAA Arg-Lys Adenomatous polyposis coli
2621 TCT-TGT Ser-Cys Adenomatous polyposis coli
2839 CTT-TTT Leu-Phe Adenomatous polyposis coli
TABLE VIII: NUCLEOTIDE SUBSTITUTIONS
Donor/ Relative
SubstitutionPhenotype
Acceptorlocation
145
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
ds -1 G-C Adenomatous polyposis
coli
as -1 G-A Adenomatous polyposis
coli
as -1 G-C Adenomatous polyposis
coli
ds +2 T-A Adenomatous polyposis
coli
as -1 G-C Adenomatous polyposis
coli
as -1 G-T Adenomatous polyposis
coli
as -1 G-A Adenomatous polyposis
coli
as -2 A-C Adenomatous polyposis
coli
as -5 A-G Adenomatous polyposis
coli
ds +3 A-C Adenomatous polyposis
coli
as -1 G-A Adenomatous polyposis
coli
ds +1 G-A Adenomatous polyposis
coli
as -1 G-T Adenomatous polyposis
coli
ds +1 G-A Adenomatous polyposis
coli
as -1 G-A Adenomatous polyposis
coli
ds +1 G-A Adenomatous polyposis
coli
ds +3 A-G Adenomatous polyposis
coli
ds +5 G-T Adenomatous polyposis
coli
as -1 G-A Adenomatous polyposis
coli
as -6 A-G Adenomatous polyposis
coli
as -5 A-G Adenomatous polyposis
coli
as -2 A-G Adenomatous polyposis
coli
ds +2 T-C Adenomatous polyposis
coli
as -2 A-G Adenomatous polyposis
coli
ds +1 G-A Adenomatous polyposis
coli
ds +1 G-T Adenomatous polyposis
coli
ds +2 T-G Adenomatous polyposis
coli
TABLE IX: APC SMALL DELETIONS
Bold letters indicate the codon. Undercase letters represent the deletion.
Where deletions extend
beyond the coding region, other positional information is provided. For
example, the abbreviation
5' UTR represents 5' untranslated region, and the abbreviation E6I6 denotes
exon 6/intron 6
boundary.
146
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Location/
Deletion Phenotype
codon
Adenomatous
77 TTAgataGCAGTAATTT
polyposis
coli
Adenomatous
97 GGAAGccgggaagGATCTGTATC
polyposis
coli
Adenomatous
138 GAGAaAGAGAG E3I3 GTAA
polyposis
coli
139 AAAGAgag E3I3 Gtaacttttct Thyroid cancer
Adenomatous
139 AAAGagag E3I3 GTAACTTTTC
polyposis
coli
Adenomatous
142 TTTTAAAAAAaAAAAATAG I3E4 GTCA
polyposis
coli
Adenomatous
144 AAAATAG I3E4 GTCatTGCTTCTTGC
polyposis
coli
Adenomatous
149 GACAaaGAAGAAAAGG
polyposis
coli
Adenomatous
149 GACAAagaaGAAAAGGAAA
polyposis
coli
Adenomatous
155 AGGAA~AAAGActggtATTACGCTCA
polyposis
coli
Adenomatous
169 AAAAGA~ATAGatagTCTTCCTTTA
p0lyposis
coli
Adenomatous
172 AGATAGT~CTTcCTTTAACTGA
polyposis
coli
Adenomatous
179 TCCTTacaaACAGATATGA
polyposis
coli
Adenomatous
185 ACCaGAAGGCAATT
polyposis
coli
Adenomatous
196 ATCAGagTTGCGATGGA
polyposis
coli
Adenomatous
213 CGAGCaCAG ESIS GTAAGTT
polyposis
coli
Adenomatous
298 CACtcTGCACCTCGA
polyposis
coli
147
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Adenomatous
329 GATaTGTCGCGAAC
polyposis
coli
Adenomatous
365 AAAGActCTGTATTGTT
polyposis
coli
Adenomatous
397 GACaaGAGAGGCAGG
polyposis
coli
Adenomatous
427 CATGAacCAGGCATGGA
polyposis
coli
Adenomatous
428 GAACCaGGCATGGACC
polyposis
coli
Adenomatous
436 gTATGTTCTCT
AATCCaa E9I9
- polyposis
coli
Adenomatous
440 GCTCCtGTTGAACATC
polyposis
cali
Adenomatous
455 AAACTtTCATTTGATG
polyposis
coli
Adenomatous
455 AAACtttcaTTTGATGAAG
polyposis
coli
Adenomatous
472 CTAcAGGCCATTGC
polyposis
coli
Adenomatous
472 TAAATTAG I10E11 GGgGACTACAGGC
polyposis
coli
Adenomatous
478 TTATtGCAAGTGGAC
polyposis
coli
Adenomatous
486 TACGgGCTTACTAAT
polyposis
coli
Adenomatous
494 AGTATtACACTAAGAC
polyposis
coli
Adenomatous
495 ATTACacTAAGACGATA
polyposis
coli
Adenomatous
497 CTAaGACGATATGC
polyposis
coli
Adenomatous
520 TGCTCtaTGAAAGGCTG
polyposis
coli
526 ATGAGagcacttgtgGCCCAACTAA Adenomatous
148
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
polyposis
coli
Adenomatous
539 GACTTaCAGCAG E12I12 GTAC
polyposis
coli
Adenomatous
560 AAAAAgaCGTTGCGAGA
polyposis
coli
Adenomatous
566 GTTGgaagtGTGAAAGCAT
polyposis
coli
Adenomatous
570 AAAGCaTTGATGGAAT
polyposis
coli
Adenomatous
577 TTAGaagtTAAAAAG E13I13 GTA
polyposis
coli
Adenomatous
584 ACCCTcAAAAGCGTAT
polyposis
coli
Adenomatous
591 GCCTtATGGAATTTG
polyposis
coli
Adenomatous
608 GCTgTAGATGGTGC
polyposis
coli
Adenomatous
617 GTTggcactcttacttaccGGAGCCAGAC
polyposis
coli
Adenomatous
620 CTTACttacCGGAGCCAGA
polyposis
coli
Adenomatous
621 ACTTaCCGGAGCCAG
polyposis
coli
Adenomatous
624 AGCcaGACAAACACT
polyposis
coli
Adenomatous
624 AGCCagacAAACACTTTA
polyposis
coli
Adenomatous
626 ACAaacaCTTTAGCCAT
polyposis
coli
Adenomatous
629 TTAGCcATTATTGAAA
polyposis
coli
Adenomatous
635 GGAGgTGGGATATTA
polyposis
coli
Adenomatous
638 ATATtACGGAATGTG
polyposis
coli
149
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Adenomatous
639 TTACGgAATGTGTCCA
polyposis
coli
Adenomatous
657 AGAgaGAACAACTGT
polyposis
coli
Adenomatous
659 TATTTCAG I14E15 GCaaatcctaagagagAACAACTGTC
polyposis
coli
Adenomatous
660 AACTgtCTACAAACTT
polyposis
coli
~Adenomatous
665 TTAttACAACACTTA
polyposis
coli
Adenomatous
668 CACttAAAATCTCAT
polyposis
coli
Adenomatous
673 AGTttgacaatagtCAGTAATGCA
polyposis
coli
Adenomatous
768 CACTTaTCAGAAACTT
polyposis
coli
Adenomatous
769 TTATcAGAAACTTTT
polyposis
coli
Adenomatous
770 TCAGAaACTTTTGACA
polyposis
coli
Adenomatous
780 AGTCcCAAGGCATCT
polyposis
coli
Adenomatous
792 AAGCaAAGTCTCTAT
polyposis
coli
Adenomatous
792 AAGCAaaGTCTCTATGG
polyposis
coli
Adenomatous
793 CAAAgTCTCTATGGT
polyposis
coli
Adenornatous
798 GATTatGTTTTTGACA
polyposis
coli
Adenomatous
802 GACACcaatcgacatGATGATAATA
polyposis
coli
Adenomatous
805 CGACatGATGATAATA
polyposis
coli
811 TCAGacaaTTTTAATACT Adenomatous
150
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
polyposis
coli
Adenomatous
825 TATtTGAATACTAC
polyposis
coli
Adenomatous
827 AATAcTACAGTGTTA
polyposis
coli
Adenomatous
830 GTGTTacccagctcctctTCATCAAGAG
polyposis
coli
Adenomatous
833 AGCTCcTCTTCATCAA
polyposis
coli
Adenomatous
836 TCATcAAGAGGAAGC
,polyposis
coli
Adenomatous
848 AAAGAtaGAAGTTTGGA
polyposis
coli
Adenomatous
848 AAAGatagaagTTTGGAGAGA
polyposis
coli
Adenomatous
855 GAACgCGGAATTGGT
polyposis
coli
Adenomatous
856 CGCGgaattGGTCTAGGCA
polyposis
coli
Adenomatous
856 CGCGgAATTGGTCTA
polyposis
coli
Adenomatous
879 CAGaTCTCCACCAC
polyposis
cali
Adenomatous
902 GAAGAcagaAGTTCTGGGT
polyposis
coli
Adenomatous
907 GGGTcTACCACTGAA
polyposis
coli
Adenomatous
915 GTGACaGATGAGAGAA
polyposis
coli
Adenomatous
929 CATACacatTCAAACACTT
polyposis
coli
Adenomatous
930 ACACAttcaAACACTTACA
polyposis
coli
Adenomatous
931 CATtCAAACACTTA
polyposis
coli
151
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Adenomatous
931 CATTcAAACACTTAC
polyposis
coli
Adenomatous
933 AACacttACAATTTCAC
polyposis
coli
Adenomatous
935 TACAatttcactAAGTCGGAAA
polyposis
coli
~Adenomatous
937 TTCActaaGTCGGAAAAT
polyposis
coli
Adenomatous
939 AAGtcggAAAATTCAAA
polyposis
coli
Adenomatous
946 ACATgTTCTATGCCT
polyposis
coli
Adenomatous
954 TTAGaaTACAAGAGAT
polyposis
coli
Adenomatous
961 AATgATAGTTTAAA
polyposis
coli
Adenomatous
963 AGTTTaAATAGTGTCA
polyposis
coli
Adenomatous
964 TTAaataGTGTCAGTAG
polyposis
coli
Adenomatous
973 TATGgTAAAAGAGGT
polyposis
coli
Adenomatous
974 GGTAAaAGAGGTCAAA
polyposis
coli
975 AAAAgaGGTCAAATGA Thyroid cancer
992 AGTAAgTTTTGCAGTT Thyroid cancer
Adenomatous
993 AAGttttgcagttaTGGTCAATAC
polyposis
coli
Adenomatous
999 CAAtacccagCCGACCTAGC
polyposis
coli
Adenomatous
1023 ACACcAATAAATTAT
polyposis
coli
Adenomatous
1030 AAAtATTCAGATGA
polyposis
coli
152
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Adenomatous
1032 TCAGatgagCAGTTGAACT
polyposis
coli
Adenomatous
1033 GATGaGCAGTTGAAC
polyposis
coli
Adenomatous
1049 TGGGcAAGACCCAAA
polyposis
coli
Adenomatous
1054 CACAtaataGAAGATGAAA
polyposis
coli
Adenomatous
1055 ATAAtagaaGATGAAATAA
polyposis
coli
Adenomatous
1056 ATAGAaGATGAAATAA
polyposis
coli
Adenomatous
1060 ATAAAacaaaGTGAGCAAAG
polyposis
coli
Adenomatous
1061 AAAcaaaGTGAGCAAAG
polyposis
coli
Adenomatous
1061 AAACaaAGTGAGCAAA
polyposis
coli
Adenomatous
1062 CAAAgtgaGCAAAGACAA
polyposis
coli
Adenomatous
1065 CAAAGacAATCAAGGAA
polyposis
coli
Adenomatous
1067 CAAtcaaGGAATCAAAG
polyposis
coli
Adenomatous
1071 CAAAgtACAACTTATC
polyposis
coli
Adenomatous
1079 ACTGagAGCACTGATG
polyposis
coli
Adenomatous
1082 ACTGAtgATAAACACCT
polyposis
coli
Adenomatous
1084 GATaaacACCTCAAGTT
polyposis
coli
Adenomatous
1086 CACCtcAAGTTCCAAC
polyposis
coli
1093 TTTGgACAGCAGGAA Adenomatous
153
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
polyposis
coli
Adenomatous
1098 TGTgtTTCTCCATAC
polyposis
coli
1105 CGGgGAGCCAATGG Thyroid cancer
Adenomatous
1110 TCAGAaACAAATCGAG
polyposis
coli
Adenomatous
1121 ATTAAtcaaAATGTAAGCC
polyposis
coli
Adenomatous
1131 CAAgAAGATGACTA
polyposis
coli
Adenomatous
1134 GACTAtGAAGATGATA
polyposis
coli
Adenomatous
1137 GATgataaGCCTACCAAT
polyposis
coli
Adenomatous
1146 CGTTAcTCTGAAGAAG
polyposis
coli
Adenomatous
1154 GAAGaagaaGAGAGACCAA
polyposis
coli
Adenomatous
1155 GAAGaagaGAGACCAACA
polyposis
coli
Adenomatous
1156 GAAgagaGACCAACAAA
polyposis
coli
Adenomatous
1168 GAAgagaaACGTCATGTG
polyposis
coli
Adenomatous
1178 GATTAtagtttaAAATATGCCA
polyposis
coli
Adenomatous
1181 TTAAaATATGCCACA
polyposis
coli
Adenomatous
1184 GCCacagaTATTCCTTCA
polyposis
coli
Adenomatous
1185 ACAgaTATTCCTTCA
polyposis
coli
Adenomatous
1190 TCACAgAAACAGTCAT
polyposis
coli
154
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Adenomatous
1192 AAAcaGTCATTTTCA
polyposis
coli
Adenomatous
1198 TCAaaGAGTTCATCT
polyposis
coli
Adenomatous
1207 A.AAAcCGAACATATG
polyposis
coli
Adenornatous
1208 ACCgaacATATGTCTTC
polyposis
coli
Adenomatous
1210 CATatGTCTTCAAGC
polyposis
coli
Adenomatous
1233 CCAAGtTCTGCACAGA
polyposis
coli
Adenomatous
1249 TGCAaaGTTTCTTCTA
polyposis
coli
Adenomatous
1259 ATAcaGACTTATTGT
polyposis
coli
Adenomatous
1260 CAGACttATTGTGTAGA
polyposis
coli
Adenomatous
1268 CCAaTATGTTTTTC
polyposis
coli
Adenomatous
1275 AGTtCATTATCATC
polyposis
coli
Adenomatous
1294 CAGGAaGCAGATTCTG
polyposis
coli
Adenomatous
1301 ACCCtGCAAATAGCA
polyposis
coli
Adenomatous
1306 GAAAtaaaAGAAAAGATT
polyposis
coli
Adenomatous
1307 ATAaAAGAAAAGAT
polyposis
coli
Adenomatous
1308 AAAgaaaAGATTGGAAC
polyposis
coli
Adenomatous
1308 AAAGAaaagaTTGGAACTAG
polyposis
coli
1318 GATCcTGTGAGCGAA Adenomatous
155
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
polyposis
coli
Adenomatous
1320 GTGAGcGAAGTTCCAG
polyposis
coli
Adenomatous
1323 GTTCcAGCAGTGTCA
'polyposis
coli
Adenomatous
1329 CACCctagaaccAAATCCAGCA
polyposis
coli
Adenomatous
1336 AGACtgCAGGGTTCTA
polyposis
coli
Adenomatous
1338 CAGgGTTCTAGTTT
polyposis
coli
Adenomatous
1340 TCTAgTTTATCTTCA
polyposis
coli
Adenomatous
1342 TTATcTTCAGAATCA
polyposis
coli
Adenomatous
1352 GTTgAATTTTCTTC
polyposis
coli
Adenomatous
1361 CCCTcCAAAAGTGGT
polyposis
coli
Adenomatous
1364 AGTggtgCTCAGACACC
polyposis
coli
Adenomatous
1371 AGTCCacCTGAACACTA
polyposis
coli
Adenomatous
1372 CCACCtGAACACTATG
polyposis
coli
Adenomatous
1376 TATGttCAGGAGACCC
polyposis
coli
Adenomatous
1394 GATAgtTTTGAGAGTC
polyposis
coli
Adenomatous
1401 ATTGCcAGCTCCGTTC
polyposis
coli
Adenomatous
1415 AGTGGcATTATAAGCC
polyposis
coli
Adenomatous
1426 AGCCcTGGACAAACC
polyposis
coli
156
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Adenomatous
1427 CCTGGaCAAACCATGC
polyposis
coli
Adenomatous
1431 ATGCcACCAAGCAGA
polyposis
coli
Adenomatous
1454 AAAAAtAAAGCACCTA
polyposis
coli
Adenomatous
1461 GAAaAGAGAGAGAG
poIyposis
coli
Adenomatous
1463 AGAgagaGTGGACCTAA
polyposis
coli
Adenomatous
1464 GAGAgTGGACCTAAG
polyposis
coli
Adenomatous
1464 GAGAgtGGACCTAAGC
polyposis
coli
Adenomatous
1464 GAGagTGGACCTAAG
polyposis
coli
Adenomatous
1492 GCCaCGGAAAGTAC
polyposis
coli
Adenomatous
1493 ACGGAaAGTACTCCAG
polyposis
coli
Adenomatous
1497 CCAgATGGATTTTC
polyposis
coli
Adenomatous
1503 TCAtccaGCCTGAGTGC
polyposis
coli
Adenomatous
1522 TTAagaataaTGCCTCCAGT
polyposis
coli
Adenomatous
1536 GAAACagAATCAGAGCA
polyposis
coli
Adenomatous
1545 TCAAAtgaaaACCAAGAGAA
polyposis
coli
Adenomatous
1547 GAAaACCAAGAGAA
polyposis
coli
Adenomatous
1550 GAGAaagaGGCAGAAAAA
polyposis
coli
1577 GAATgtATTATTTCTG Adenomatous
157
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
polyposis
coli
Adenomatous
1594 CCAGCcCAGACTGCTT
polyposis
coli
Adenomatous
1596 CAGACtGCTTCAAAAT
polyposis
coli
Adenomatous
1823 TTCAaTGATAAGCTC
polyposis
coli
Adenomatous
1859 AATGAttctTTGAGTTCTC
polyposis
coli
1941 CCAGAcagaGGGGCAGCAA Desmoid tumours
Adenomatous
1957 GAAaATACTCCAGT
polyposis
coli
Adenomatous
1980 AACaATAAAGAAAA
polyposis
coli
Adenomatous
1985 GAACCtATCAAAGAGA
polyposis
coli
Adenomatous
1986 CCTaTCAAAGAGAC
polyposis
coli
Adenomatous
1998 GAACcAAGTAAACCT
polyposis
coli
Adenomatous
2044 AGCTCcGCAATGCCAA
polyposis
coli
Adenomatous
2556 TCATCccttcctcGAGTAAGCAC
polyposis
coli
Adenomatous
2643 CTAATttatCAAATGGCAC
polyposis
coli
TABLE X: SMALL INSERTIONS
Codon InsertionPhenotype
157 T Adenomatous polyposis
coli
170 AGAT Adenomatous polyposis
coli
172 T Adenomatous polyposis
coli
158
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
199 G Adenomatous polyposis
coli
243 AG Adenomatous polyposis
coli
266 T Adenomatous polyposis
coli
357 A Adenomatous polyposis
coli
405 C Adenomatous polyposis
coli
413 T Adenomatous polyposis
coli
416 A Adenomatous polyposis
cali
457 G Adenomatous polyposis
coli
473 A Adenomatous polyposis
coli
503 ATTC Adenomatous polyposis
coli
519 C Adenomatous polyposis
coli
528 A Adenomatous polyposis
coli
561 A Adenomatous polyposis
coli
608 A Adenomatous polyposis
coli
620 CT Adenomatous polyposis
coli
621 A Adenomatous polyposis
coli
623 TTAC Adenomatous polyposis
coli
627 A Adenomatous polyposis
coli
629 A Adenomatous polyposis
coli
636 GT Adenomatous polyposis
coli
639 A Adenomatous polyposis
coli
704 T Adenomatous polyposis
coli
740 ATGC Adenomatous polyposis
coli
764 T Adenomatous polyposis
coli
779 TT Adenomatous polyposis
coli
807 AT Adenomatous polyposis
coli
827 AT Adenomatous polyposis
coli
831 A Adenomatous polyposis
coli
841 CTTA Adenomatous polyposis
coli
865 CT Adenomatous polyposis
coli
865 AT Adenomatous polyposis
coli
900 TG Adenomatous polyposis
coli
921 G Adenomatous polyposis
coli
927 A Adenomatous polyposis
coli
159
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
935 A Adenomatous polyposis
coli
936 C Adenomatous polyposis
coli
975 A Adenomatous polyposis
coli
985 T Adenomatous polyposis
coli
997 A Adenomatous polyposis
coli
1010 TA Adenomatous polyposis
coli
1085 C Adenomatous polyposis
coli
1085 AT Adenomatous polyposis
coli
1095 A Adenomatous polyposis
coli
1100 GTTT Adenomatous polyposis
coli
1107 GGAG Adenomatous polyposis
coli
1120 G Adenomatous polyposis
coli
1166 A Adenomatous polyposis
coli
1179 T Adenomatous polyposis
coli
1187 A Adenomatous polyposis
coli
1211 T Adenomatous polyposis
coli
1256 A Adenomatous polyposis
coli
1265 T Adenomatous polyposis
coli
1267 GATA Adenomatous polyposis
coli
1268 T Adenomatous polyposis
coli
1301 A Adenomatous polyposis
coli
1301 C Adenomatous polyposis
coli
1323 A Adenomatous polyposis
coli
1342 T Adenomatous polyposis
coli
1382 T Adenomatous polyposis
coli
1458 GTAG Adenomatous polyposis
coli
1463 AG Adenomatous polyposis
coli
1488 T Adenomatous polyposis
coli
1531 A Adenomatous polyposis
coli
1533 T Adenomatous polyposis
coli
1554 A Adenomatous polyposis
coli
1555 A Adenomatous polyposis
coli
1556 T Adenomatous polyposis
coli
1563 GACCT Adenomatous polyposis
coli
160
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
1924 AA Desmoid tumours
TABLE XI: SMALL INSERTIONS/DELETIONS
Location/
Deletion InsertionPhenotype
codon
Adenomatous polyposis
538 GAAGAcTTACAGCAGG gaa
coli
Adenomatous polyposis
620 CTTACttaCCGGAGCCAG ct
coli
Adenomatous polyposis
728 AATctcatGGCAAATAGG ttgcagctttaa
coli
Adenomatous polyposis
971 GATGgtTATGGTAAAA taa
coli
TABLE XII: GROSS DELETIONS
2 kb including ex. 11
Adenomatous polyposis
coli
3 kb I10E11-1.5 kb to I12E13-170Adenomatous polyposis
by coli
335 by nt. 1409-1743 ex. Adenomatous polyposis
11-13 coli
6 kb incl. ex. 14 Adenomatous polyposis
coli
817 by I13E14-679 to I13E14+138Adenomatous polyposis
coli
ex. 11-15M Adenomatous polyposis
coli
ex. 11-3'UTR Adenomatous polyposis
coli
ex. 15A - ex. 15F Adenomatous polyposis
coli
ex. 4 Adenomatous polyposis
coli
ex. 7, 8 and 9
Adenomatous polyposis
coli
ex. 8 to beyond ex. 15F
Adenomatous polyposis
coli
ex. 8 - ex. 15F Adenomatous polyposis
coli
ex. 9 Adenomatous polyposis
coli
>lOmb (del Sq22) Adenomatous polyposis
coli
TABLE XIII: GROSS INSERTIONS AND DUPLICATIONS
161
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Description Phenotype
Insertion of 14 by nt. 3816 Adenomatous polyposis
coli
Insertion of 22 by nt. 4022 Adenomatous polyposis
coli
Duplication of 43 by cd. 1295 Adenomatous polyposis
coli
Insertion of 337 by of Alu I Desmoid tumours
sequence cd. 1526
TABLE X1V: COMPLEX REARRANGEMENTS (INCLUDING INVERSIONS)
A-T nt. 4893 Q1625H, Del C nt. 4897 Adenomatous polyposis
cd. 1627 coli
Del 1099 by I13E14-728 to E14I14+156,Adenomatous polyposis
ins 126 by coli
Del 1601 by E14I14+27 to E14I14+1627,Adenomatous polyposis
ins 180 by coli
Del 310 bp, ins. 15 by nt. 4394, Adenomatous polyposis
cd 1464 coli
Del A and T cd. 1395 Adenomatous polyposis
coli
Del TC nt. 4145, Del TGT nt. 4148 Adenomatous polyposis
coli
Del. T, nt. 983, Del. 70 bp, nt. Adenomatous polyposis
985 coli
Del. nt. 3892-3903, ins ATTT Adenomatous polyposis
coli
TABLE XV: DIAGNOSTIC APPLICATIONS
Cancer TypeMarker Application Reference
Breast Her2lNeu Using methods described D. Xie et
herein, al., .T.
Detection design second primer suchNatl. Cancer
- that after
polymorphism PCR, and digestion with Institute,92,
at restriction
codon 655 enzyme, a 5' overhang 412 (2000)
containing
(GTC/valine DNA sequence for codon
to 655 of
ATC/isoleucineHer2/Neu is generated. K.S. Wilson
et
[Val(655)Ile]) al., Arra.
J.
Her2/Neu can be detected Pathol.,161,11
and
quantified as a possible 71 (2002)
marker for
breast cancer. Methods
described
herein can detect both L. Newman,
mutant allele
and normal allele, even Cancer
when mutant
allele is small fraction Contr~ol,9,
of total DNA. 473
162
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
(2002)
Herceptin therapy for
breast cancer is
based upon screening for
Her2. The
earlier the mutant allele
can be
detected, the faster therapy
can be
provided.
BreastlOvarianHypermethylationMethods described herein M.Esteller
can be used et
of BRCA1 to differentiate between al., New
tumors
resulting from inherited England Jnl
BRCA1
mutations and those from Med., 344,
non- 539
inherited abnormal methylation(2001)
of .
the gene
Bladder MicrosatelliteMethods described herein W.G. Bas
can be et
analysis of applied to microsatelliteal., Clinical
free analysis and
tumor DNA FGFR3 mutation analysis Cancer
in for
Urine, Serum detection of bladder cancer.Res.,9,257
and Methods
Plasma described herein provide (2003)
a non-
invasive method for detection
of
bladder cancer. M. Utting
et
al., Clincal
Caneer Res.,
x,35 (2002)
L. Mao,
D.Sidransky
et
al.,
Sciehce,271,
669 (1996)
Lung MicrosatelliteMethods described herein T.Liloglou
can be used et
analysis of to detect mutations in al., Caficer
DNA sputum
from sputum samples, and can markedlyResearch,6l,
boost the
accuracy of preclinical 1624, (2001)
lung cancer
screening
M. Tockman
et
163
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
al., Cancer
Control,7,
19
(2000)
Field et
al.,
Cancer
Research,59,
2690 ( 1999)
Cervical ~alysis of Methods described herein N- Munoz
HPV can be used et
genotype to detect HPV genotype al., New
from a
cervical smear preparation.
England
Jnl
Med., 348,
518
(2003)
Head and T~or specific Methods described herein M~ Spafford
can be used et
Neck alterations to detect any of 23 microsatelliteal. Clinical
in
exfoliated markers, which are associated
oral with
mucosal cells Head and Neck Squamous Cancer
Cell
(microsatelliteCarcinoma (HNSCC). Researclz,l7,
markers)
607 (2001)
A. El-Naggar
et
al., J.
Mol.
Diag.,3,164
(2001 )
Colorectal Screening for Methods described herein B~ Ryan
can be used et al.
mutation in to detect K-ras 2 mutations,Gut,52,101
K-ras2 which
and APC genes.can be used as a prognostic
indicator
(2003)
for colorectal cancer.
APC (see Example 5).
Prostate GSTPl Methods described herein P~ Cairns
can be used et al.
Hypermethylationto detect GSTP1 hypermethylationClin. Can.
in
urine from patients with
prostate
Res.,7,2727
cancer; this can be a
more accurate
indicator than PSA. (2001)
HIV
164
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
AntiretroviralScreening Methods described herein J~ Durant
can be used for et al.
resistance individuals detection of mutations The
for in the HIV virus.
mutations Treatment outcomes are
in HIV improved in
~ay~cet,353,
virus - e.g. individuals receiving anti-retroviral
154V thera
mutation or based upon resistance screening.2195 (1999)
CCRS 0 32
allele.
Cardiology
Congestive Synergistic Methods described herein K.Small
can be used et al.
Heart Failurepolymorphismsto genotype these loci and New Ehg.
may help Jnl.
of betal identify people who are
and at a higher risk
alpha2c of heart failure. Med , 347,1135
adrenergic (2002)
receptors
EXAMPLE 8
Single nucleotide polymorphisms (SNPs) represent the most common form of
sequence
variation; three million common SNPs with a population frequency of over 5%
have been estimated
to be present in the human genome. A genetic map using these polymorphisms as
a guide is being
developed (http://research.marshfieldclinic.org/genetics/; Internet address as
of February 13, 2003).
The allele frequency varies from SNP to SNP; the allele frequency for one SNP
may be
50:50, while the allele frequency for another SNP may be 90:10. The closer the
allele frequency is
to 50:50, the more likely any particular individual will be heterozygous at
that SNP. The SNP
consortium provides allele frequency information for some SNPs but not for
others.
www.snp.chsl.org. The allele frequency for a particular SNP provides valuable
information as to
the utility of that SNP for the non-invasive prenatal screening method
described in Example 5.
While all SNPs can be used, SNPs with allele frequencies closer to 50:50 are
preferable.
Briefly, maternal blood contains fetal DNA. Maternal DNA can be distinguished
from fetal
DNA by examining SNPs wherein the mother is homozygous. For example, at SNP X,
the
maternal DNA may be homozygous for guanine. If template DNA obtained from the
plasma of a
pregnant female is heterozygous, as demonstrated by the detection of signals
corresponding to an
adenine allele and an guanine allele, the adenine allele can be used as a
beacon for the fetal DNA
(see Example 5). The closer the allele frequency of a SNP is to 50:50, the
more likely there will be
allele differences at a particular SNP between the maternal DNA and the fetal
DNA.
165
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
For example, if at SNP X the observed alleles are adenine and guanine, and the
SNP has an
allele frequency of 90(A):10(G), it is likely that both mother and father will
be homozygous for
adenine at that particular SNP. Thus, both the maternal DNA and the fetal DNA
will be
homozygous for adenine, and there is no distinct signal for the fetal DNA.
However, if at SNP X
the allele frequency is 50:50, and the mother is homozygous for adenine, the
probability is higher
that the paternal DNA will contain a guanine allele at SNP X.
Below, a method for determining the allele frequency for a SNP is provided.
Seven SNPs
located on chromosome 13 were analyzed. The method is applicable for any SNP
including but not
limited to the SNPs on human chromosomes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11,
12, 13, 14, 15, 16, 17,
18, 19, 20, 21, 22, X and Y.
Preparation of Template DNA
To determine the allele frequency of a particular SNP, DNA was obtained from
two
hundred and fifty individuals after informed consent had been granted. From
each individual, a 9
ml blood sample was collected into a sterile tube (Fischer Scientific, 9 ml
EDTA Vacuette tubes,
catalog number NC9897284). The tubes were spun at 1000 rpm for ten minutes.
The supernatant
(the plasma) of each sample was removed, and one milliliter of the remaining
blood sample, which
is commonly referred to as the "huffy-coat" was transferred to a new tube. ~ne
milliliter of 1X
PBS was added to each sample.
Template DNA was isolated using the QIAmp DNA Blood Midi Kit supplied by
QIAGEN
(Catalog number 51183). The template DNA was isolated as per instructions
included in the kit.
From each individual, 0.76 p,g of DNA was pooled together, and the pooled DNA
was used in all
subsequent reactions.
Design of Primers
SNP TSC0903430 was amplified using the following primer set:
First primer:
5' GTCTTGCATGTAGAATTCTAGGGACGCTGCTTTTCGTC 3'
Second primer:
5'CTCCTAGACATCGGGACTAGAATGTCCAC3'
166
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
The first primer contained a recognition site for the restriction enzyme
EcoRI, and was
designed to anneal eighty-two bases from the locus of interest. The second
primer contained the
recognition site for the restriction enzyme BsmF I.
SNP TSC0337961 was amplified using the following primer set:
First primer:
5'ACACAAGGCAGAGAATTCCAGTCCTGAGGGTGGGGGCC3'
Second primer:
5' CCGTGTTTTAACGGGACAAGCTGTTCTTC 3'
The first primer contained a recognition site for the restriction enzyme
EcoRI, and was
designed to anneal ninety-two bases from the locus of interest. The second
primer contained the
recognition site for the restriction enzyme BsmF I.
SNP TSC0786441 was amplified using the following primer set:
First primer:
5'GTAGCGGAGGTTGAATTCTATATGTTGTCTTGGACATT3'
Second primer:
5'CATCAGTAGAGTGGGACGAAAGTTCTGGC3'
The first primer contained a recognition site for the restriction enzyme
EcoRI, and was
designed to anneal one hundred and four bases from the locus of interest. The
second primer
contained the recognition site for the restriction enzyme BsmF I.
SNP TSC 1168303 was amplified using the following primer set:
First primer:
167
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
5'ATCCACGCCGCAGAATTCGTATTCATGGGCATGTCAAA3'
Second primer:
5'CTTGGGACTATTGGGACCAGTGTTCAATC3'
The first primer contained a recognition site for the restriction enzyme
EcoRI, and was
designed to anneal sixty-four bases from the locus of interest. The second
primer contained the
recognition site for the restriction enzyme BsmF I.
SNP TSC0056188 was amplified using the following primer set:
First primer:
5'CCAGAAAGCCGTGAATTCGTTAAGCCAACCTGACTCCA 3'
Second primer:
5'TCGGGGTTAGTCGGGACATCCAGCAGCCC3'
The first primer contained a recognition site for the restriction enzyme
EcoRI, and was
designed to anneal eighty-two bases from the locus of interest. The second
primer contained the
recognition site for the restriction enzyme BsmF I.
SNP TSC0466177 was amplified using the following primer set:
First primer:
5'CGAAGGTAATGTGAATTCCAAAACTTAGTGCCACAATT3'
Second primer:
5'ATACCGCCCAACGGGACAGATCCATTGAC 3'
168
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
The first primer contained a recognition site for the restriction enzyme
EcoRI, and was
designed to anneal ninety-two bases from the locus of interest. The second
primer contained the
recognition site for the restriction enzyme BsmF I.
SNP TSC0197424 was amplified using the following primer set:
First primer:
5'AGAAACCTGTAAGAATTCGATTCCAAATTGTTTTTTGG3'
Second primer:
5'CGATCATAGGGGGGGACAGGAGAGAGCAC3'
The first primer contained a recognition site for the restriction enzyme
EcoRI, and was
designed to anneal one hundred and four bases from the locus of interest. The
second primer
contained the recognition site for the restriction enzyme BsmF I.
The first primer was designed to anneal at various distances from the locus of
interest. The
skilled artisan understands that the annealing location of the first primer
can be any distance from
the locus of interest including but not limited to 5-10, 11-15, 16-20, 21-25,
26-30, 31-35, 36-40, 41-
45, 46-50, 51-55, 56-60, 61-65, 66-70, 71-75, 76-80, 81-85, 86-90, 91-95, 96-
100, 101-105, 106-
110, 111-115, 116-120, 121-125, 126-130, 131-140, 141-160, 161-180, 181-200,
201-220, 221-240,
241-260, 261-280, 281-300, 301-350, 351-400, 401-450, 451-500, 501-1000, 1001-
2000, 2001-
3000, or greater than 3000.
All loci of interest were amplified from the template genomic DNA using the
polymerise
chain reaction (PCR, U.S. Patent Nos. 4,683,195 and 4,683,202, incorporated
herein by reference).
In this example, the loci of interest were amplified in separate reaction
tubes but they can also be
amplified together in a single PCR reaction. For increased specificity, a "hot-
start" PCR was used.
PCR reactions were performed using the HotStarTaq Master Mix Kit supplied by
QIAGEN (catalog
number 203443). The amount of template DNA and primer per reaction can be
optimized for each
locus of interest. In this example, 40 ng of template human genomic DNA (a
mixture of template
DNA from 245 individuals) and 5 pM of each primer were used. Forty cycles of
PCR were
performed. The following PCR conditions were used:
(1) 95°C for 15 minutes and 15 seconds;
(2) 37°C for 30 seconds;
169
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
(3) 95°C for 30 seconds;
(4) S7°C for 30 seconds;
(S) 9S°C for 30 seconds;
(6) 64°C for 30 seconds;
(7) 95°C for 30 seconds;
(8) Repeat steps 6 and 7 thirty nine (39) times;
(9) 72°C for S minutes.
In the first cycle of PCR, the annealing temperature was about the melting
temperature of
the 3' annealing region of the second primers, which was 37°C. The
annealing temperature in the
second cycle of PCR was about the melting temperature of the 3' region, which
anneals to the
template DNA, of the first primer, which was S7°C. The annealing
temperature in the third cycle of
PCR was about the melting temperature of the entire sequence of the second
primer, which was
64°C. The annealing temperature for the remaining cycles was
64°C. Escalating the annealing
temperature from TM1 to TM2-to TM3 in the first three cycles of PCR greatly
improves specificity.
1 S These annealing temperatures are representative, and the skilled artisan
will understand the
annealing temperatures for each cycle are dependent on the specific primers
used.
The temperatures and times for denaturing, annealing, and extension, can be
optimized by
trying various settings and using the parameters that yield the best results.
Purification of Fragment of Interest
The PCR products were separated from the unused PCR reagents. After the PCR
reaction,
1/2 of the reaction volume for SNP TSC0903430, SNP TSC0337961, and SNP
TSC0786441 were
mixed together in a single reaction tube. One-halfthe reaction volumes for
SNPs TSC1168303,
TSC0056188, TSC0466177, and TSC0197424 were pooled together in a single
reaction tube. The
2S un-used primers, and nucleotides were removed from the reaction by using
Qiagen MinElute PCR
purification kits (Qiagen, Catalog Number 28004). The reactions were performed
following the
manufacturer's instructions supplied with the columns.
Restriction Enzyme Digestion of Isolated Fragments
The purified PCR products were digested with the restriction enzyme BsmF I,
which binds
to the recognition site incorporated into the PCR products from the second
primer. The digests
were performed in eppendorf tubes following the instructions supplied with the
restriction enzyme.
170
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Incorporation of Labeled Nucleotide
The restriction enzyme digest with BsmF I yielded a DNA fragment with a 5'
overhang,
which contained the SNP site or locus of interest and a 3' recessed end. The
5' overhang functioned
as a template allowing incorporation of a nucleotide or nucleotides in the
presence of a DNA
polymerase.
As discussed in detail in Example 6, the sequence of both alleles of a SNP can
be
determined with one labeled nucleotide in the presence of the other unlabeled
nucleotides. The
following components were added to each fill in reaction: 1 wl of
fluorescently labeled ddGTP, 0.5
pI of unlabeled ddNTPs ( 40 ~.M), which contained all nucleotides except
guanine, 2 ~,I of l OX
sequenase buffers 0.25 ~1 of Sequenase, and water as needed for a 20p1
reaction. The fill in
reaction was performed at 40°C for 10 min. Sequenase was the DNA
polymerase used in this
example. However, any DNA polymerase can be used for a fill-in reaction
including but not
limited to E. coli DNA polymerase, Klenow fragment of E. coli DNA polymerase
I, T7 DNA
polyrnerase, T4 DNA polymerase, Taq polymerase, Pfu DNA polymerase, Vent DNA
polymerase,
polymerase from bacteriophage 29, and REDTaqT"" Genomic DNA polymerase. Non-
fluorescently
labeled ddNTP was purchased, from Fermentas Inc. (Hanover, MD). All other
labeling reagents
were obtained from Amersham (ThermO Sequenase Dye Terminator Cycle Sequencing
Core Kit,
US 79565).
Detection of the Locus of Interest
The sample was loaded into a lane of a 36 cm 5% acrylamide (urea) gel
(BioWhittaker
Molecular Applications, Long Ranger Run Gel Packs, catalog number 50691). The
sample was
electrophoresed into the gel at 3000 volts for 3 min. The gel was run for 3
h~urs on a sequencing
apparatus (Hoefer SQ3 Sequencer). The gel was removed from he apparatus and
scanned on the
Typhoon 9400 Variable Mode Imager. The incorporated labeled nucleotide was
detected by
fluorescence.
Below, a schematic of the 5' overhang for SNP TSC0056188 is reproduced (where
R
indicates the variable site). The entire sequence is not shown, only a portion
of the overhang.
5'CCA
3'GGT R T C C
Overhang position 1 2 3 4
As discussed in detail in Example 6, one nucleotide labeled with one chemical
moiety can
be used to determine the sequence of the alleles of a locus of interest. The
observed nucleotides fox
171
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
TSC0056188 on the 5' sense strand (here depicted as the top strand) are
adenine and guanine. The
third position in the overhang on the antisense strand is cytosine, which is
complementary to
guanine. As the variable site can be adenine or guanine, fluorescently labeled
ddGTP in the
presence of unlabeled dCTP, dTTP, and dATP was used to determine the sequence
of both alleles.
The fill-in reactions for an individual homozygous for guanine, homozygous for
adenine or
heterozygous are diagrammed below.
Homozygous adenine:
5'CCA A A G*
' 3'GGT T T C C
Overhang position 1 2 3 4
Homozygous guanine:
5'CCA G*
3'GGT C T C C
Overhang position 1 2 3 4
Heterozygous:'
Allele 1 5'CCA G*
3'GGT C T C C
Overhang position 1 2 3 4
Allele 2 5'CCA A A G*
3'GGT T T C C
Overhang position 1 2 3 4
As seen in FIG. 14, two bands were detected for SNP TSC0056188. The lower band
corresponded to DNA molecules filled in with ddGTP at position one
complementary to the
overhang, which is representative of the guanine allele. The higher band,
separated by a single base
from the lower band, corresponded to DNA molecules filled in with ddGTP at
position 3
complementary to the overhang. This band represented the adenine allele. The
intensity of each
172
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
band was strong, indicating that each allele was well represented in the
population. SNP
TSC0056188 is representative of a SNP with high allele frequency.
Below, a schematic of the 5' overhang generated after digestion with BsmF I
for SNP
TSC0337961 is reproduced (where R indicates the variable site). The entire
sequence is not shown,
only a portion of the overhang.
5' GCCA
3' CGGT R G C T
Overhang position 1 2 3 4
The observed nucleotides for SNP TSC0337961 on the 5' sense strand (here
depicted as the
top strand? are adenine and guanine. The third position in the overhang on the
antisense strand was
cytosine, which is complementary to guanine. As the variable site can be
adenine or guanine,
fluorescently labeled ddGTP in the presence of unlabeled dCTP, dTTP, and dATP
was used to
determine the sequence of both alleles. The fill-in reactions for an
individual homozygous for
guanine, homozygous for adenine or heterozygous are diagrammed below.
Homozygous for guanine:
5' GCCA G*
3' CGGT C G C T
Overhang position 1 2 3 4
Homozygous for adenine:
5' GCCA A C G*
3' CGGT T G C T
Overhang position 1 2 3 4
Heterozygous
Allele 1 5' GCCA Gx
3' CGGT C G C T
Overhang position 1 2 3 4
173
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Allele 2 5' GCCA A C G*
3' GGGT T G C T
Overhang position 1 2 3 4
As seen in FIG. 14, one band migrating at the position of the expected lower
molecular
weight band was observed. This band represented the DNA molecules filled in
with ddGTP at
position one complementary to the overhang, which represents the guanine
allele. No band
corresponding to the DNA molecules filled in with ddGTP at position 3
complementary to the
overhang was detected. SNP TSC0337961 is representative of a SNP that is not
highly variable
within the population.
Of the seven SNPs analyzed, four of the SNPs (TSC 1168303, TSC0056188,
TSC0466177,
and TSG0197424 had high allele frequencies. Two bands of high intensity were
seen for each of
the four SNPs, indicating that both alleles were well represented in the
population.
However, it is not necessary that the SNPs have allele frequencies of 50:50 to
be useful.
All SNPs provide useful information. The methods described herein provide a
rapid technique for
determining the allele frequency of a SNP, or any variable site including but
not limited to point
mutations. Allele frequencies of 50:50, 51:49, 52:48, 53:47, 54:46, 55:45,
56:46, 57:43, 58:42,
59:41, 60:40, 61:39, 62:38, 63:37, 64:36, 65:35, 66:34, 67:33, 68:32, 69:31,
70:30, 71:29, 72:28,
73:27, 74:26, 75:25, 76:24, 77:23, 78:22, 79:21, 80:20, 81:19, 82:18, 83:17,
84:16, 85:15, 86:14,
87:13, 88:12, 89:11, 90:10, 91:9, 92:8, 93:7, 94:6, 95:5, 96:4, 97:3, 98:2,
99:1 and 100:0 can be
useful.
Two bands were seen for SNP TSC0903430. One band, the lower molecular weight
band
represented the DNA molecules filled in with labeled ddGTP. A band of weaker
intensity was seen
for the molecules filled in with labeled ddGTP at position 3 complementary to
the overhang, which
represented the cytosine allele. SNP TSC0903430 represents a SNP with low
allele frequency
variation. In the population, the majority of individuals carry the guanine
allele, but the cytosine
allele is still present.
One band of high intensity was seen for SNP TSC033796I and SNP TSC078644I. The
band detected for both SNP TSC0337961 and SNP TSC0786441 corresponded to the
DNA
molecules filled in with ddGTP at position 1 complementary to the overhang. No
signal was
detected from DNA molecules that would have been f fled in at position 3
complementary to the
overhang, which would have represented the second allele. SNP TSC0337961 and
SNP
TSC0786441 represent SNPs with little variability in the population.
As demonstrated in FIG 14., the first primer used to amplify each locus of
interest can be
designed to anneal at various distances from the locus of interest. This
allows multiple SNPs to be
174
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
analyzed in the same reaction, By designing the first primer to anneal at
specified distances from
the Ioci of interest, any number of loci of interest can be analyzed in a
single reaction including but
not limited to 1-10, I I-20, 21-30, 31-40, 41-50, 51-60, 61-70, 71-80, 81-90,
91-100, 101-110, 111-
120, 121-130, 131-140, 141-150, 151-160, 161-170, 171-180, 181-190, 191-200,
201-300, 30I-400,
401-500, and greater than 500.
As discussed in Example 6, some type Its restriction enzymes display alternate
cutting
patterns. For example, the type IIS restriction enzyme BsmF I typically cuts
10/14 from its binding
site; however, the enzyme also can cut 11/15 from the binding site. To
eliminate the effect of the
alternate cut, the labeled nucleotide used for the fill-in reaction should be
chosen such that it is not
complementary to position 0 of the overhang, generated by the 11/15 cut
(discussed in detail in
Example 6). For instance, if you label with ddGTP, the nucleotide preceding
the variable site on
the strand that is filled in should not be a guanine.
The 11/15 overhang generated by BsmF I for SNP TSC0056188 is depicted below,
with the
variable site in bold-typeface:
11/15 Overhang for TSC0056188
Allele 1 S'CC
3'GG T C T C
Overhang position 0 1 2 3
Allele 2 5'CC
3'GG T T T C
Overhang position 0 1 2 3
After the fill-in reaction with labeled ddGTP, unlabeled dATP, dTTP, and dCTP,
the
following molecules were generated:
11/15 Allele 1 5'CC A G*
3'GG T C T C
Overhang position 0 1 2 3
11/15 Allele 2 5'CC A A A G*
3'GG T T T C
Overhang position 0 1 2 3
175
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Two signals were seen; one band corresponded to molecules filled in with ddGTP
at
position one of the overhang, and the other band corresponded to the molecules
filled in with
ddGTP at position 3 complementary to the overhang. These are the same DNA
molecules
generated after the fill-in reaction of the 10/14 overhang. Thus, the two
bands can be compared
without any ambiguity from the alternate cut. This method of labeling with a
single nucleotide
eliminates any errors generated from the alternate cutting properties of the
enzymes.
The methods described herein is applicable to determining the allele frequency
of any SNP
including but not limited to SNPs on human chromosomes l, 2, 3, 4, 5, 6, 7, 8,
9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, X and Y.
EXAMPLE 9
Heterozygous SNPs, by definition, differ by one nucleotide. At a heterozygous
SNP, allele
1 and allele 2 may be present at a ratio of 1:1. However, it is possible that
DNA polymerases can
incorporate one nucleotide at a faster rate than other nucleotides, and thus
the observed ratio of a
heterozygous SNP may differ from the theoretically expected 1:1 ratio.
Below, methods are described that allow efficient and accurate quantitation
for the expected
ratio of allele 1 to allele 2 at a heterozygous SNP.
Preparation of Template DNA
Template DNA was obtained from twenty-four individuals after informed consent
had been
granted. From each individual, a 9 ml blood sample was collected into a
sterile tube (Fischer
Scientific, 9 ml EDTA Vacuette tubes, catalog number NC9897284). The tubes
were spun at 1000
rpm for ten minutes without brake. The supernatant (the plasma) of each sample
was removed, and
one milliliter of the remaining blood sample, which is commonly referred to as
the "buffy-coat"
was transferred to a new tube. One milliliter of 1X PBS was added to each
sample.
Template DNA was isolated using the QIAmp DNA Blood Midi Kit supplied by
QIAGEN
(Catalog number 51183). The template DNA was isolated as per instructions
included in the kit.
Design of Primers
SNP TSC0607185 was amplified using the following primer set:
First primer:
176
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
5'ACTTGATTCCGTGAATTCGTTATCAATAAATCTTACAT3'
Second primer:
5'CAAGTTGGATCCGGGACCCAGGGCTAACC3'
SNP TSC1130902 was amplified using the following primer set:
First primer:
5'TCTAACCATTGCGAATTCAGGGCAAGGGGGGTGAGATC3'
Second primer:
5'TGACTTGGATCCGGGACAACGACTCATCC3'
The first primer contained a biotin tag at the 5' end and a recognition site
for the restriction
enzyme EcoRI. The second primer contained the recognition site for the
restriction enzyme BsmF
I. The first primer was designed to anneal at various distances from the locus
of interest.
The first primer for SNP TSC0607185 was designed to anneal ninety bases from
the locus
of interest. The first primer for SNP TSC1130902 was designed to anneal sixty
bases from the
locus of interest.
All loci of interest were amplified from the template genomic DNA using the
polymerise
chain reaction (PCR, U.S. PatentNos. 4,683,195 and 4,683,202, incorporated
herein by reference).
In this example, the loci of interest were amplified in separate reaction
tubes but they could also be
amplified together in a single PCR reaction. For increased specificity, a "hot-
start" PCR was used.
PCR reactions were performed using the HotStarTaq Master Mix Kit supplied by
QIAGEN (catalog
number 203443). The amount of template DNA and primer per reaction can be
optimized for each
locus of interest but in this example, 40 ng of template human genomic DNA and
5 ~,M of each
primer were used. Forty cycles of PCR were performed. The following PCR
conditions were used:
(1) 95°C for 15 minutes and 15 seconds;
(2) 37°C for 30 seconds;
(3) 95°C for 30 seconds;
(4) 57°C for 30 seconds;
177
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
(5) 95°C for 30 seconds;
(6) 64°C for 30 seconds;
(7) 95°C for 30 seconds;
(8) Repeat steps 6 and 7 thirty nine (39) times;
(9) 72°C for 5 minutes.
In the first cycle of PCR, the annealing temperature was about the melting
temperature of
the 3' annealing region of the second primers, which was 37°C. The
annealing temperature in the
second cycle of PCR was about the melting temperature of the 3' region, which
anneals to the
template DNA, of the first primer, which was 57°C. The annealing
temperature in the third cycle of
PCR was about the melting temperature of the entire sequence of the second
primer, which was
64°C. The annealing temperature for the remaining cycles was
64°C. Escalating the annealing
temperature from TMl to TM2 to TM3 in the first three cycles of PCR greatly
improves specificity.
These annealing temperatures are representative, and the skilled artisan will
understand the
annealing temperatures for each cycle are dependent on the specific primers
used.
The temperatures and times for denaturing, annealing, and extension, can be
optimized by
trying various settings and using the parameters that yield the best results.
Purification of Fragment of Interest
The PCR products were separated from the genomic template DNA. One half of the
PCR
reaction was transferred to a well of a Streptawell, transparent, High-Bind
plate from Roche
Diagnostics GmbH (catalog number 1 645 692, as listed in Roche Molecular
Biochemicals, 2001
Biochemicals Catalog). The first primers contained a 5' biotin tag so the PCR
products bound to the
Streptavidin coated wells while the genomic template DNA did not. The
streptavidin binding
reaction was performed using a Thermomixer (Eppendorf) at 1000 ipm for 20 min.
at 37°C. Each
well was aspirated to remove unbound material, and washed three times with 1X
PBS, with gentle
mixing (Kandpal et al., Nucl. Acids Res. 18:1789-1795 (1990); Kaneoka et al.,
Biotechniques
10:30-34 (1991); Green et al., Nucl. Acids Res. 18:6163-6164 (1990)).
Restriction Enzyme Digestion of Isolated Fragments
The purified PCR products were digested with the restriction enzyme BsmF I,
which binds
to the recognition site incorporated into the PCR products from the second
primer. The digests
were performed in the Streptawells following the instructions supplied with
the restriction enzyme.
After digestion, the wells were washed three times with PBS to remove the
cleaved fragments.
178
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Incorporation of Labeled Nucleotide
The restriction enzyme digest with BsmF I yielded a DNA fragment with a 5'
overhang,
which contained the SNP site or locus of interest and a 3' recessed end. The
5' overhang functioned
as a template allowing incorporation of a nucleotide or nucleotides in the
presence of a DNA
polymerase.
As discussed in detail in Example 6, the sequence of both alleles of a SNP can
be
determined by using one labeled nucleotide in the presence of the other
unlabeled nucleotides. The
following components were added to each fill in reaction: 1 ~,1 of
fluorescently labeled ddGTP, 0.5
p,l of unlabeled ddNTPs ( 40 pM), which contained all nucleotides except
guanine, 2 p,l of l OX
sequenase buffer, 0.25 pl of Sequenase, and water as needed for a 20p1
reaction. The fill in
reaction was performed at 40°C for 10 min. Non-fluorescently labeled
ddNTP was purchased from
Fermentas Inc. (Hanover, MD). All other labeling reagents were obtained from
Amersham
(Thermo Sequenase Dye Terminator Cycle Sequencing Core Kit, US 79565).
After labeling, each Streptawell was rinsed with 1X PBS (100 wl) three times.
The "filled
in" DNA fragments were then released from the Streptawells by digestion with
the restriction
enzyme EcoRI, according to the manufacturer's instructions that were supplied
with the enzyme.
Digestion was performed for 1 hour at 37 °C with shaking at 120
rpm.
Detection of the Locus of Interest
The samples were loaded into a lane of a 36 cm 5% acrylamide (urea) gel
(BioWhittaker
Molecular Applications, Long Ranger Run Gel Packs, catalog number 50691). The
samples were
electrophoresed into the gel at 3000 volts for 3 min. The gel was run for 3
hours on a sequencing
apparatus (Hoefer SQ3 Sequencer). The gel was removed from the apparatus and
scanned on the
Typhoon 9400 Variable Mode Imager. The incorporated labeled nucleotide was
detected by
fluorescence. A box was drawn around each band and the intensity of the band
was calculated
using the Typhoon 9400 Variable Mode Imager software.
Below, a schematic of the 5' overhang for SNP TSC0607185 is shown. The entire
DNA
sequence is not reproduced, only the portion to demonstrate the overhang
(where R indicates the
variable site).
C C T R TGTC 3'
ACAG 5'
4 3 2 1 Overhang position
179
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
The observed nucleotides at the variable site for TSC0607185 on the 5' sense
strand (here
depicted as the top strand) are cytosine and thymidine (depicted here as R).
In this case, the second
primer anneals from the locus of interest, which allows the fill-in reaction
to occur on the anti-sense
strand (depicted here as the bottom strand). The antisense strand will be
filled in with guanine or
adenine.
The second position in the 5' overhang is thymidine, which is complementary to
adenine,
and the third position in the overhang corresponds to cytosine, which is
complementary to guanine.
Fluorescently labeled ddGTP in the presence of unlabeled dCTP, dTTP, and dATP
was used to
determine the sequence of both alleles. After the fill-in reaction, the
following DNA molecules
were generated:
C C T C TGTC 3' Allele 1
G* ACAG 5'
4 3 2 1 Overhang position
C C T T TGTC 3' Allele 1
G* A A ACAG 5'
4 3 2 1 Overhang position
The overhanggenerated by BsmF I cutting at 11/15 from the recognition site at
TSC0607185 is depicted below:
C T R T GTC 3' 11/15
CAG 5'
3 2 1 0 Overhang position
As labeled ddGTP is used for the fill-in reaction, no new~signal will be
generated from the
molecules cut 11/15 from the recognition site. Position 0 complementary to the
overhang was filled
in with unlabeled dATP. Only signals generated from molecules filled in with
labeled ddGTP at
position 1 complementary to the overhang or molecules filled in with labeled
ddGTP at position 3
complementary to the overhang were seen.
Five of the twenty-four individuals were heterozygous for SNP TSC0607185. As
shown in
FIG. 15, two bands were detected. The lower molecular weight band corresponded
to DNA
molecules filled in with ddGTP at position 1 complementary to the overhang.
The higher molecular
weight band corresponded to DNA molecules filled in with ddGTP at position 3
complementary to
3 S the overhang.
180
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
The ratio of the two alleles was calculated for each of the five heterozygous
samples (see
Table XVI). The average ratio of allele 2 to allele 1 was 1.000 with a
standard deviation of 0.044.
Thus, the allele ratio at SNP TSC0607185 was highly consistent. The
experimentally calculated
allele ratio for a particular SNP is hereinafter referred to as the "p" value
of the SNP. Analysis of
SNP TSC0607185 consistently will provide an allele ratio of 1:1, provided that
the number of
genomes analyzed is of sufficient quantity that no error is generated from
statistical sampling.
If the sample contained a low number of genomes, it is statistically possible
that the primers
will anneal to one chromosome over another chromosome. For example, if the
sample contains 40
genomes, which corresponds to a total of 40 chromosomes of allele 1 and 40
chromosomes of allele
2, the primers may anneal to 40 chromosomes of allele 1 but only 35 chromosome
of allele 2. This
would cause allele 1 to be amplified preferentially to allele 2, which would
alter the ratio of allele 1
to allele 2'. This problem is eliminated by having a sufficient number of
genomes in the sample.
SNP TSC0607185 represents a SNP where the difference in the nucleotide at the
variable
site does not affect the PCR reaction, or digestion with the restriction
enzyme or the fill-in reaction.
The use of one nucleotide labeled with one fluorescent dye assures that the
bands for one allele can
be accurately compared to the bands for the second allele. There is no added
complication of
having to compare between two different lanes, or having to correct for the
quantum coefficients of
the dyes. Additionally, any effect from the alternate cutting properties of
the type IIS restriction
enzymes has been removed.
TABLE XVI. Ratio of allele 2 to allele 1 at SNPs TSC0607185 and TSC1130902.
SNP TSC0607185 SNP TSC1130902
Sample Allele Allele Allele2/AlleleAllele Allele Allele2/Allele
1 2 1 1 2 1
1 2382 2313 0.971033 5877 4433 0.754296
2 1581 1533 0.969639 3652 2695 0.737952
3 1795 1879 1.046797 5416 3964 0.730059
4 1921 1855 0.f65643 3493 2663 0.762382
5 1618 1701 1.051298 3894 2808 0.721109
Average 1.000882 0.74116
STD 0.044042 0.017018'
181
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Below, a schematic of the 5' overhang for SNP TSC1130902 is shown. The entire
DNA
sequence is not reproduced, only the portion to demonstrate the overhang
(where R indicates the
variable site).
5' TTCAT
3' AAGTA R T C C
Overhang position 1 2 3 4
The observed nucleotides for TSC1130902 on the 5' sense strand (here depicted
as the top
strand) are adenine and guanine. The second position in the overhang
corresponds to a thymidine,
and the third position in the overhang corresponds to cytosine, which is
complementary to guanine.
Fluorescently labeled ddGTP in the presence of unlabeled dCTP, dTTP, and dATP
was used to
determine the sequence of both alleles. After the fill-in reaction, the
following DNA molecules
were generated:
Allele 1 5' TTCAT G*
3' AAGTA C T C C
Overhang position 1 2 3 4
Allele 2 5' TTCAT A A G*
3' AAGTA T T C C
Overhang position 1 2 3 4
As shown in FIG. 15, two bands were detected: The lower molecular weight band
corresponded to DNA molecules filled in with labeled ddGTP at position 1
complementary to the
overhang (the G allele). The higher molecular weight band, separated by a
single base from the
lower band, corresponded to DNA molecules filled in with ddGTP at position 3
complementary to
the overhang (the A allele).
Five of the twenty-four individuals were heterozygous for SNP TSC1130902. As
seen in
FIG. 15, the band corresponding to allele 1 was more intense than the band
corresponding to allele
2. This was seen for each of the five individuals. The actual intensity of the
band corresponding to
allele 1 varied from individual to individual but it was always more intense
than the band
corresponding to allele 2. For the five individuals, the average ratio of
allele 2 to allele 1 was
0.74116, with a standard deviation of 0.017018.
182
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Template DNA was prepared from five different individuals. Separate PCR
reactions,
separate restriction enzyme digestions, and separate fill-in reactions were
performed. However, for
each template DNA, the ratio of allele 2 to allele 1 was about 0.75. The "p"
value for this SNP was
highly consistent.
For example, for SNP TSC1130902, the "p" value was 0.75. Any deviation from
this
value, provided the sample contains an adequate number of genomes to remove
statistical sampling
errors, will indicate that there is an abnormal copy number of chromosome 13.
If there is an
additional copy of allele 2, the "p" value will be higher than the expected
0.75. However, if there is
an addition copy of allele 1, the "p" value will be lower than the expected
0.75. With the "p" value
quantitated for a particular SNP, that SNP can be used to determine the
presence or absence of a
chromosomal abnormality. An accurate "p" value measured for a single SNP will
be sufficient to
detect the presence of a chromosomal abnormality.
There are several possible explanations for why the ratio of one allele to the
other allele at
some SNPs varies from the theoretically expected ratio of l:l. First, it is
possible that the DNA
polymerase incorporates one nucleotide faster than the other nucleotide. As
the alleles are being
amplified by PCR, even a slight preference for one nucleotide over the other
may cause variation
from the expected 1:1 ratio. This potential preference for one nucleotide over
the other is not seen
during the fill-in reaction because a single nucleotide labeled with one dye
is used.
It is also possible that the variable nucleotide at the SNP site influences
the rate of
denaturation of the two alleles. If allele 1 contains a guanine and allele 2
contains an adenine, the
difference between the strength of the bonds for these nucleotides may affect
the rate at which the
DNA strands separate. Again, it is important to mention that the alleles are
being amplified by PCR
so very subtle differences can make a large impact on the final result. It is
also possible that the
variable nucleotide at the SNP site influences the rate at which the two
strands anneal after
separation.
Alternatively, it is possible that the type IIS restriction enzyme cuts one
allele
preferentially to the other allele. As discussed in detail above, type IIS
restriction enzymes cut at a
distance from the recognition site. It is possible that the variable
nucleotide at the SNP site
influences the efficiency of the restriction enzyme digestion. It is possible
that at some SNPs the
restriction enzyme cuts one allele with an e~ciency of 100%, while it cuts the
other allele with an
efficiency of 90%.
However, the fact that the ratio of allele 1 to allele 2 deviates from the
theoretically
expected ratio of 1:1, does not influence or reduce the utility of that SNP.
As demonstrated above,
the "p" value for each SNP is consistent among different individuals.
183
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
The "p" value for any SNP can be calculated by analyzing the template DNA of
any
number of heterozygous individuals including but not limited to 1-10, 11-20,
21-30, 31-40, 41-50,
51-60, 61-70, 71-80, 81-90, 91-100, 101-110, 111-120, 121-130, 131-140, 141-
150, 151-160, 161-
170, 171-180, 181-190, 191-200, 201-210, 211-220, 221-230, 231-240, 241-250,
251-260, 261-270,
271-280, 281-290, 291-300, and greater than 300.
The methods described herein allow the "p" value for any SNP to be determined.
It is
possible that some SNPs will behave more consistently than other SNPs. In the
human genome,
there are over 3 million SNPs; it is not possible to speculate on how each SNP
will behave. The
"p" value for each SNP will have to be experimentally determined. The methods
described herein
allow identification of SNPs that have highly consistent, and reproducible "p"
values.
EXAMPLE 10
As discussed in Example 9, the ratio of one allele to the other allele at a
particular SNP may
vary from the theoretically expected ratio of 50:50. These SNPs can be used to
detect the presence
of additional chromosomes provided that the ratio of one allele to the other
allele remains linear in
individuals with chromosomal disorders. For example, at SNP X if the
percentage of allele 1 to
allele 2 is 75:25, the expected percentage of allele 1 to allele 2 for an
individual with Down's
syndrome must be properly adjusted to reflect the variation from the expected
percentage at this
SNP.
The percentage of allele 1 to allele 2 for SNP TSC0108992 on chromosome 21 was
calculated using template DNA from four normal individuals and template DNA
from an individual
with Down's syndrome. As demonstrated below, the percentage of one allele to
the other allele was
consistent and remained linear in an individual with Down's syndrome.
Preparation of Template DNA
DNA was obtained from four individuals with a normal genetic karyotype and an
individual
identified as having an extra copy of chromosome 21 (Down's syndrome).
Informed consent was
obtained from all individuals. Informed consent also was obtained from the
parents of the
individual with Down's syndrome.
From each individual, a 9 ml blood sample was collected into a sterile tube
(Fischer
Scientific, 9 ml EDTA Vacuette tubes, catalog number NC9897284). Template DNA
was isolated
using the QIAmp DNA Blood Midi Kit supplied by QIAGEN (Catalog number 51183).
The
template DNA was isolated as per instructions included in the kit.
184
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Design of Primers
SNP TSC0108992 was amplified using the following primer set:
First primer:
5'CTACTGAGGGCTCGTAGATCCCAATTCCTTCCCAAGCT3'
Second primer: '
5'AATCCTGCTTTAGGGACCATGCTGGTGGA3'
The first primer contained a biotin tag at the 5' end and a recognition site
for the restriction
enzyme EcoRI. The second primer contained the recognition site for the
restriction enzyme BsmF
I.
SNP TSC0108992 was amplified from the template genomic DNA using the
polymerase
chain reaction (PCR, U.S. Patent Nos. 4,683,195 and 4,683,202, incorporated
herein by reference).
For increased specificity, a "hot-start" PCR was used. PCR reactions were
performed using
the HotStarTaq Master Mix I~it supplied by QIAGEN (catalog number 203443). The
amount of
template DNA and primer per reaction can be optimized for each locus of
interest. In this example,
50 ng of template human genomic DNA and 5 pM of each primer were used. Thirty-
eight cycles of
PCR were performed. The following PCR conditions were used:
(1) 95°C for 15 minutes and 15 seconds;
(2) 37°C for 30 seconds;
(3) 95°C for 30 seconds;
(4) 57°C for 30 seconds;
(5) 95°C for 30 seconds;
(6) 64°C for 30 seconds;
(7) 95°C for 30 seconds;
(8) Repeat steps 6 and 7 thirty-seven (37) times;
(9) 72°C for 5 minutes.
In the first cycle of PCR, the annealing temperature was about the melting
temperature of
the 3 ° annealing region of the second primers, which was 37°C.
The annealing temperature in the
second cycle of PCR was about the melting temperature of the 3' region, which
anneals to the
template DNA, of the first primer, which was 57°C. The annealing
temperature in the third cycle of
185
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
PCR was about the melting temperature of the entire sequence of the second
primer, which was
64°C. The annealing temperature for the remaining cycles was
64°C. Escalating the annealing
temperature from TM1 to TM2 to TM3 in the first three cycles of PCR greatly
improves specificity.
These annealing temperatures are representative, and the skilled artisan will
understand the
annealing temperatures for each cycle are dependent on the specific primers
used.
The temperatures and times for denaturing, annealing, and extension, can be
optimized by
trying various settings and using the parameters that yield the best results.
Purification of Fragment of Interest
The PCR products were separated from the genomic template DNA. Each PCR
reaction
was split into two samples and transferred to two separate wells of a
Streptawell, transparent, High-
Bind plate from Roche Diagnostics GmbH (catalog number 1 645 692, as listed in
Roche Molecular
Biochemicals, 2001 Biochemicals Catalog). For each PCR reaction, there were
two replicates; each
in a separate well of a microtiter plate. The first primer contained a 5'
biotin tag so the PCR
products bound to the Streptavidin coated wells while the genomic template DNA
did not. The
streptavidin binding reaction was performed using a Thermomixer (Eppendorf) at
1000 rpm for 20
min. at 37°C. Each well was aspirated to remove unbound material, and
washed three times with
1X PBS, with gentle mixing (I~andpal et al., Nucl. Acids Res. 18:1789-1795
(1990); I~aneoka et al.,
Biotechniques 10:30-34 (1991); Green et al., Nucl. Acids Res. 18:6163-6164
(1990)).
Restriction Enzyme Digestion of Isolated Fragments
The purified PCR products were digested with the restriction enzyme BsmF I,
which binds
to the recognition site incorporated into the PCR products from the second
primer. The digests
were performed in the Streptawells following the instructions supplied with
the restriction enzyme.
After digestion, the wells were washed three times with 1X PBS to remove the
cleaved fragments.
Incorporation of Labeled Nucleotide
The restriction enzyme digest with BsmF I yielded a DNA fragment with a 5'
overhang,
which contained the SNP site or locus of interest and a 3' recessed end. The
5' overhang functioned
as a template allowing incorporation of a nucleotide or nucleotides in the
presence of a DNA
polymerase.
As discussed in detail in Example 6, the sequence of both alleles of a SNP can
be
determined with one labeled nucleotide in the presence of the other unlabeled
nucleotides. The
following components were added to each fill in reaction: 1 pl of
fluorescently labeled ddTTP, 0.5
pl of unlabeled ddNTPs ( 40 ~M), which contained all nucleotides except
thymidine, 2 pl of lOX
186
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
sequenase buffer, 0.25 pl of Sequenase, and water as needed for a 20p.1
reaction. The fill in
reaction was performed at 40°C for 10 min. Non-fluorescently labeled
ddNTP was purchased from
Fermentas Inc. (Hanover, MD). All other labeling reagents were obtained from
Amersham
(Thermo Sequenase Dye Terminator Cycle Sequencing Core Kit, US 79565).
After labeling, each Streptawell was rinsed with 1X PBS (100 ~1) three times.
The "filled
in" DNA fragments were then released from the Streptawells by digestion with
the restriction
enzyme EcoRI, according to the manufacturer's instructions that were supplied
with the enzyme.
Digestion was performed for 1 hour at 37 °C with shaking at 120
rpm.
Detection of the Locus of Interest
The samples were loaded into the lanes of a 36 cm 5°lo acrylamide
(urea) gel (BioWhittaker
Molecular Applications, Long Ranger Run Gel Packs, catalog number 50691). The
samples were
electrophoresed into the gel at 3000 volts for 3 min. The gel was run for 3
hours on a sequencing
apparatus (Hoefer SQ3 Sequencer). The gel was removed from the apparatus and
scanned on the
Typhoon 9400 Variable Mode Imager. The incorporated labeled nucleotide was
detected by.
fluorescence. A box Was drawn around each band and the intensity of the band
was calculated
using the Typhoon 9400 Variable Mode Imager software.
Below, a schematic of the 5' overhang for SNP TSC0108992 is shown. The entire
DNA
sequence is not reproduced, only the portion to demonstrate the overhang
(where R indicates the
variable site).
GTCC 3'
G A C R CAGG 5'
4 3 2 1 Overhang Position
The observed nucleotides for SNP TSC0108992 are adenine and thymidine on the
sense
strand (here depicted as the top strand). Position 3 of the overhang
corresponds to adenine, which
is complementary to thymidine. Labeled ddTTP was used in the presence of
unlabeled dATP,
dCTP, and dGTP. After the fill-in reaction with labeled ddTTP, the following
DNA molecules
were generated:
T* G A GTCC 3' Allele 1
G A C T CAGG 5'
4 3 2 1 Overhang Position
187
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
T* GTCC 3' Allele 2
G A C A CAGG 5'
4 3 2 1 Overhang Position
There was no difficulty in comparing the values obtained from allele 1 to
allele 2 because
one labeled nucleotide was used for the fill-in reaction, and the fill-in
reaction for both alleles
occurred in a single tube. The alternate cutting properties of BsmF I would
not influence this
analysis because the 11/15 overhang would be filled in just as the 10/14
overhang. Schematics of
the filled-in 11/15 overhangs are depicted below:
T* G A G TCC 3' 11/15
Allele 1
A C T C AGG 5'
3 2 1 0 Overhang Position
T* G TCC 3' 11/15
Allele 2
A C A C AGG 5'
3 2 1 0 Overhang Position
As seen in FIG. 16, two bands were seen for each sample of template DNA., The
lower
molecular weight band corresponded to the DNA molecules filled in with ddTTP
at position one
complementary to the overhang, and the higher molecular weight band
corresponded to DNA
molecules filled in with ddTTP at position 3 complementary to the overhang.
The percentage of allele 2 to allele 1 was highly consistent. (see Table III).
In addition,
for any given individual, the replicates of the PCR reaction showed similar
results (see Table
XVII). The percentage of allele 2 to allele 1 was calculated by dividing the
value of allele 2 by the
sum of the values for allele 1 and allele 2 (allele 2/(allele 1+ allele 2)).
From four individuals, the
average percentage of allele 2 to allele 1 was 0.4773 with a standard
deviation of 0.0097. The
percentage of allele 2 to allele 1 on template DNA isolated from an individual
with Down's
syndrome was 0.3086.
The theoretically expected percentage of allele 2 to allele 1 using template
DNA from a
normal individual is 0.50. However, the experimentally determined percentage
was 0.4773. The
theoretically expected percentage of allele 2 to allele 1 for an individual
with an extra copy of
chromosome 21 is 0.33. The experimentally determined percentage of allele 2 to
allele 1 for SNP
TSC0108992 was 0.3086.
188
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
The deviation from the theoretically expected percentage is highly consistent
and remains
linear. The following formula demonstrates that the percentage of allele 2 to
allele 1 at SNP
TSC0108992 remains linear even on template DNA obtained from an individual
with an extra copy
of chromosome 21:
0.47 X
0.50 0.33
X = 0.3102
If the percentage of allele 2 to allele 1 using template . DNA obtained from a
normal
individual is determined to be 0.47, then the percentage of allele 2 to allele
1 using template DNA
from an individual with Down's syndrome should be 0.3102. The experimentally
determined ratio
was 0.3086, with a standard deviation of 0.00186. There is no difference
between the predicted
percentage and the experimentally determined percentage of allele 2 to allele
1 on template DNA
from an individual with Down's syndrome.
The percentage of one allele to the other allele at a particular SNP is highly
consistent,
reproducible, and linear. This demonstrates that any SNP, regardless of the
calculated percentage
for one allele to another, can be used to determine the presence or absence of
a chromosomal
disorder.
TABLE XVII. Percentage of Allele 2 to Allele 1 at SNP TSC0108992.
Sample Allele Allele 2/(2+1 )
2 1
1A 9568886 10578972 0.474933
1 B 8330864 9221381 0.474632
2A 9801053 10345444 0.486489
2B 8970942 9603102 0.482983
3A 8676718 9211085 0.485063
3B 1084702411420943 0.487113
4A 1051242012227107 0.462297
4B 7883584 9055289 0.465414
MEAN 0.477366
STDEV 0.009654
189
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
DS 6797400 151389590.309869
DS 6025753 135868900.307238
MEAN 0.308554
STDEV 0.00186
EXAMPLE 11
The percentage of allele 2 to allele 1 for a particular SNP is highly
consistent. Statistically
significant deviation from the experimentally determined ratio indicates the
presence of a
chromosomal abnormality. Below, the percentage of allele 2 to allele 1 at SNP
TSC0108992 on
chromosome 21 was calculated using template DNA from a normal individual and
template DNA
from an individual with Down's syndrome. Mixtures containing various amounts
of normal DNA
and Down's syndrome DNA were prepared and analyzed in a blind fashion.
Preparation of Template DNA
DNA was obtained from an individual with a normal genetic karyotype and an
individual
identified as having an extra copy of chromosome 21 (Down's syndrome).
Informed consent was
obtained from both individuals. Informed consent also was obtained from the
parents of the
individual with Down's syndrome.
From each individual, a 9 ml blood sample was collected into a sterile tube
(Fischer
Scientific, 9 ml EDTA Vacuette tubes, catalog number NC9897284). Template DNA
was isolated
using the QIAmp DNA Blood Midi Kit supplied by QIAGEN (Catalog number 51183).
The
template DNA was isolated as per instructions included in the kit.
Mixtures of Template DNA
The template DNA from the individual with the normal karyotype and the
template DNA
from the individual with an extra copy of chromosome 21 were diluted to a
concentration of 10
ng/p,l. Four mixtures of normal template DNA and Down's syndrome template DNA
were made in
the following fashion:
190
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Mixture 1: 32 p,l of Normal DNA + 8 pl of Down's syndrome DNA
Mixture 2: 28 p,l of Normal DNA + 12 p,l of Down's syndrome DNA
Mixture 3: 20 p,l of Normal DNA + 20 p,l of Down's syndrome DNA
Mixture 4: 10 p,l of Normal DNA + 30 p,l of Down's syndrome DNA
Three separate PCR reactions were set up for the normal template DNA and the
template
DNA from the individual with Down's syndrome. Likewise, for each mixture,
three separate PCR
reactions were set up.
Design of Primers
SNP TSC0108992 was amplified using the following primer set:
First primer:
5'CTACTGAGGGCTCGTAGATCCCAATTCCTTCCCAAGCT3'
Second primer:
5' AATCCTGCTTTAGGGACCATGCTGGTGGA 3'
The first primer contained a biotin tag at the 5' end and a recognition site
for the restriction
enzyme EcoRI. The second primer contained the recognition site for the
restriction enzyme EsmF
I.
SNP TSC0108992 was amplified from the template genomic DNA using the
polymerase
chain reaction (PCR, U.S. Patent Nos. 4,683,195 and 4,683,202, incorporated
herein by reference).
For increased specificity, a "hot-start" PCR was used. PCR reactions were
performed using
the HotStarTaq Master Mix Kit supplied by QIAGEN (catalog number 203443). The
amount of
template DNA and primer per reaction can be optimized for each locus of
interest but in this
example, 50 ng of template human genomic DNA and 5 ~.M of each primer were
used. Thirty-eight
cycles of PCR were performed. The following PCR conditions were used:
(1) 95°C for 15 minutes and 15 seconds;
(2) 37°C for 30 seconds;
(3) 95°C for 30 seconds;
(4) 57°C for 30 seconds;
191
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
(5) 95°C for 30 seconds;
(6) 64°C for 30 seconds;
(7) 95°C for 30 seconds;
(8) Repeat steps 6 and 7 thirty-seven (37) times;
(9) 72°C for S minutes.
In the first cycle of PCR, the annealing temperature was about the melting
temperature of
the 3' annealing region of the second primers, which was 37°C. The
annealing temperature in the
second cycle of PCR was about the melting temperature of the 3' region, which
anneals to the
template DNA, of the first primer, which was 57°C. The annealing
temperature in the third cycle of
PCR was about the melting temperature of the entire sequence of the second
primer, which was
64°C. The annealing temperature for the remaining cycles was
64°C. Escalating the annealing
temperature from TM1 to TM2 to TM3 in the first three cycles of PCR greatly
improves specificity.
These annealing temperatures are representative, and the skilled artisan will
understand the
annealing temperatures for each cycle are dependent on the specific primers
used.
The temperatures and times for denaturing, annealing, and extension, can be
optimized by
trying various settings and using the parameters that yield the best results.
Purification of Fragment of Interest
The PCR products were separated from the genomic template DNA. Each PCR
reaction
was split into two samples and transferred to two separate wells of a
Streptawell, transparent,, High-
Bind plate from Roche Diagnostics GmbH (catalog number 1 645 692, as listed in
Roche Molecular
Biochemicals, 2001 Biochemicals Catalog). For each PCR reaction, there were
two replicates, each
in a separate well of a microtiter plate. The first primer contained a 5'
biotin tag so the PCR
products bound to the Streptavidin coated wells while the genomic template DNA
did not. The
streptavidin binding reaction was performed using a Thermomixer (Eppendorf).at
1000 rpm for 20
min. at 37°C. Each well was aspirated to remove unbound material, and
washed three times with
1X PBS, with gentle mixing (Kandpal et al., Nucl. Acids Res. 18:1789-1795
(1990); Kaneoka et al.,
Biotechniques 10:30-34 (1991); Green et al., Nucl. Acids Res. 18:6163-6164
(1990)).
Restriction Enzyme Digestion of Isolated Fragments
The purified PCR products were digested with the restriction enzyme BsmF I,
which binds
to the recognition site incorporated into the PCR products from the second
primer. The digests
were performed in the Streptawells following the instructions supplied with
the restriction enzyme.
After digestion, the wells were washed three times with 1X PBS to remove the
cleaved fragments.
192
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Incorporation of Labeled Nucleotide
The restriction enzyme digest with BsmF I yielded a DNA fragment with a 5'
overhang,
which contained the SNP site or locus of interest and a 3' recessed end. The
5' overhang functioned
as a template allowing incorporation of a nucleotide or nucleotides in the
presence of a DNA
polymerase.
As discussed in detail in Example 6, the sequence of both alleles of a SNP can
be
determined with one labeled nucleotide in the presence of the other unlabeled
nucleotides. The
following components were added to each fill in reaction: 1 wl of
fluorescently labeled ddTTP, 0.5
pl of unlabeled ddNTPs ( 40 ~,M), which contained all nucleotides except
thymidine, 2 pl of lOX
sequenase buffer, 0.25 pl of Sequenase, and water as needed for a 20p1
reaction. The fill in
reaction was performed at 40°C for 10 min. Non-fluorescently labeled
ddNTP was purchased from
Fermentas Inc. (Hanover, MD). All other labeling reagents were obtained from
Amersham
(Thermo Sequenase Dye Terminator Cycle Sequencing Core Kit, US 79565).
After labeling, each Streptawell was rinsed with 1X PBS (100 pl) three times.
The "filled
in" DNA fragments were then released from the Streptawells by digestion with
the restriction
enzyme EcoRI, according to the manufacturer's instructions that were supplied
with the enzyme.
Digestion was performed for 1 hour at 37 °C with shaking at 120
rpm.
Detection of the Locus of Interest
The samples were loaded into the lanes of a 36 cm 5°/~ acrylamide
(urea) gcl (Bio~hittaker
Molecular Applications, Long Ranger Run Gel Packs, catalog number 50691). The
samples were
electrophoresed into the gel at 3000 volts for 3 min. The gel was run for 3
hours on a sequencing
apparatus (Hoefer SQ3 Sequencer). The gel was removed from the apparatus and
scanned on the
Typhoon 9400 Variable Mode Imager. The incorporated labeled nucleotide was
detected by
fluorescence. A box was drawn around each band and the intensity of the band
was calculated
using the Typhoon 9400 Variable Mode Imager software.
As seen in FIGS. 17 A-F, two bands were seen. The lower molecular weight band
corresponded to the DNA molecules ftlled in with ddTTP at position one
complementary to the
overhang. The higher molecular weight band corresponded to DNA molecules
filled in with ddTTP
at position 3 complementary to the overhang.
The experiment was performed in a blind fashion. The tubes were coded so that
it was not
known what tube corresponded to what template DNA. After the gels were
analyzed, each tube
was grouped into the following categories; normal template DNA, Down's
syndrome template
193
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
DNA, 3:1 mixture of Down's syndrome template DNA to normal DNA, 1:1 mixture of
normal
template DNA to Down's syndrome template DNA, 1:2.3 mixture of Down's syndrome
template
DNA to normal template DNA, and 1:4 mixture of Down's syndrome template DNA to
normal
template DNA. Each replicate of each PCR reaction successfully was grouped
into the appropriate
category, which demonstrates that the method can be used to detect abnormal
DNA even if it
represents only a small percentage of the total DNA.
The percentage of allele 2 to allele 1 for each replicate of the three PCR
reactions from
normal template DNA are displayed in Table XVIII (also see FIG. 17A). The
average percentage
of allele 2 to allele 1 was calculated by dividing the value of allele 2 by
the sum of the values for
allele 1 and allele 2 (allele 2 l (allele 1 + allele 2)}, which resulted in an
average of 0.50025 with a
standard deviation of 0.002897. Thus, allele 1 and allele 2 were present in a
ratio of 50:50. While
the intensity of the bands varied from one PCR reaction to another (compare
reaction 1 with
reaction 3), there was no difference in intensity within a PCR reaction.
Furthermore, the values
obtained for the two replicates of the PCR reactions were very similar. Most
of the variation was
between PCR reactions and was likely attributable to pipetting errors.
The percentage of , allele 2 to allele 1 for each replicate of the three PCR
reactions from
Down's syndrome template DNA are displayed in Table XVIII (see FIG. 17B). The
percentage of
allele 2 to allele 1 was calculated by dividing the value of allele 2 by the
sum of the values for allele
1 and allele 2 (allele 2/allele 1+ allele 2), which resulted in an average of
0.301314 with a standard
deviation of 0.012917. It is clear even upon analysis of the gel by the naked
eye that allele 1 is
present in a higher copy number than allele 2 (see FIG. 17B). Again, most of
the variation occurs
between PCR reactions and not within the replicate of a PCR reaction. The
majority of the
statistical variation likely resulted from pipetting errors.
Analysis of a single SNP was sufficient to detect the presence of the
chromosomal
abnormality. One SNP is sufficient provided that the "p" value of the SNP is
known and that there
are an adequate number of genomes so that statistical sampling error is not
introduced into the
analysis. In this experiment, there were approximately 5,000 genomes in each
reaction.
The reactions that consisted of a mixture of Down's syndrome template DNA to
normal
template DNA at a ratio of 3:1 were clearly distinguishable from the normal
template DNA, and the
other mixtures of DNA (see FIG. 17C). The calculated percentage of allele 2 to
allele 1 was
0.319089 with a standard deviation of 0.004346 (see Table XVIII). Likewise,
the reactions that
consisted of a mixture of Down's syndrome template DNA to normal template DNA
at ratios of
1:1, and 1:2.3 were distinguishable (see FIG. 17D and 17E) and the values were
statistically
significant from all other reactions (see Table XVIII).
194
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
As the amount of normal template DNA increased, the percentage of allele 2 to
allele 1
increased. With a mixture of Down's syndrome template DNA to normal template
DNA of 1:4, the
percentage of allele 2 to allele 1 was 0.397642, with a standard deviation of
0.001903 (see FIG
17F). The difference between this value and the value obtained from normal
template DNA is
statistically significant. Thus, the methods described herein allow the
detection of a chromosomal
abnormality even when the sample is not a homogeneous sample of abnormal DNA.
As described above, the presence of a small fraction of DNA with an abnormal
copy
number of chromosomes can be detected even among a large presence of normal
DNA. It was
clear, even by the naked eye, that as the amount of normal DNA increased and
the amount of
Down's syndrome DNA decreased, the intensities of the bands that corresponded
to alleles 1 and 2
equalized.
The above example analyzed a SNP located on chromosome 21. However, any SNP
may
be analyzed on any chromosome including but not limited to human chromosomes
1, 2, 3, 4, 5, 6, 7,
8, 9, 10, 1 l, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, X, and Y and fetal
chromosomes 1, 2, 3, 4, 5,
6, 7, 8, 9, 10, 11, 12, 13, '14, 15, 16, 17, 18, 19, 20, 21, 22, X, and Y. In
addition, chromosomes
from non-human organisms can be analyzed using the above methods. Any
combination of
chromosomes can be analyzed. In the above example, an extra copy of a
chromosome was
detected. However, the same methods can be used to detect monosomies.
TABLE XVIII. Percentage of allele 2 to allele 1 at SNP TSC0108992 using normal
template DNA
and Down's syndrome template DNA.
l~orm~l Template
DNA
Allele Allele 2 21(2+1)
1
1A 26021152604525 0.500231
1 28558462923860 0.505884
B
2A 19547651941929 0.498353
2B 20844762068106 0.498029
3A 20441472035719 0.498967
3B 17602911760543 0.500036
Mean 0.50025
STD 0.002897
Down's Syndrome
195
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Allele Allele 2 2l(2+1)
1
1A 40469261595581 0.282779
1 42753411736260 0.288818
B
2A 28756981299509 0.311244
2B 24536151069635 0.303593
3A 31693381426643 0.310411
3B 37374401687286 0.311036
Mean 0.301314
STD 0.012917
3:1 (Down's:
Normal)
Allele Allele 2 2/(2+1
1 )
1A 40676231980770 0.327487
1 ' 40585061899853 0.318855
B
2A 23150441085860 0.319286
2B 26869841243406 0.316357
3A 38803851790764 0.315767
3B 37186611724189 0.316781
Mean 0.319089
STD 0.004346
1:1 (Down's:
Normal)
Allele Allele 2 2/(2+1)
1
1A 35402551929840 0.352798
1 40040852161443 0.350569
B
2A 23580091282132 0.35222
2B 21581321238377 0.364603
3A 30523301648677 0.350707
3B 38526822024012 0.344413
Mean 0.352552
STD 0.006618
1:2.3 (Down's:
196
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Normal)
Allele Allele 2 2/(2+1)
1
1A 31093261942597 0.384526
1B 33924772118011 0.38436
2A 28242131758428 0.383715
2B 20698891249545 0.376433
3A 23351281433016 0.380298
3B 29167721797965 0.38135
Mean 0.38178
STD 0.003128
1:4 (Down's:
Normal)
Allele Allele 2 21(2+1
1 )
1A 30665242039636 0.399446
1B 30682842038770 0.399207
2A 23254771542526 0.398791
2B 23661221562218 0.397679
3A 21512051403120 0.394764
3B 23970461571360 0.395968
Mean 0.397642
STD 0.001903
EXAMPLE 12
As discussed above in Example 9, the ratio for allele 1 to allele 2 at a
heterozygous SNP is
constant. However, one factor that can influence the ratio of allele 1 to
allele 2 at a heterozygous
SNP is a low number of genomes. For example, if there are 40 genomes, which
means that there
are a total of 40 chromosomes of allele 1 and 40 chromosomes of allele 2, it
is statistically possible
that the primers may anneal to 40 of the chromosomes with allele 1 but only 30
of the chromosomes
with allele 2. This will affect the ratio of allele 1 to allele 2, and can
erroneously influence the "p"
value for a particular SNP.
Typically, whole genomic amplification, which employs degenerate
oligonucleotide PCR,
is used to increase low quantities of genomic DNA samples. Oligonucleotides of
8, 10, 12, or 14
bases are used to amplify the genome. It is thought that the primers anneal
randomly throughout
197
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
the genome, and will amplify a small genomic DNA sample into hundreds-fold
more DNA for
genetic analysis.
The methods described herein exploit the fact that typically the whole genome
is not of
interest. Particular loci of interest located on one chromosome, or on
multiple chromosomes or on
chromosomes that represent the entire genome are selected for analysis. Even
if the loci of interest
are located on chromosomes for the entire genome, it is preferential to
amplify the region of those
chromosomes that contain the loci of interest.
To overcome the limit of a low number of genomes, which is often seen with
fetal DNA
obtained from the plasma of a pregnant female, a multiplex method can be used
to increase the
number of genomes. The method described below preferentially amplifies the
chromosome or
chromosomes that contain the loci of interest.
Preparation of Template DNA
A 9 ml blood sample was collected into a sterile tube from a human volunteer
after
informed consent had been granted. (Fischer Scientific, 9 ml EDTA Vacuette
tubes, catalog number
NC9897284). The tubes were spun at 1000 rpm for ten minutes. The supernatant
(the plasma) of
each sample was removed, and one milliliter of the remaining blood sample,
which is commonly
referred to as the "huffy-coat" was transferred to a new tube. ~ne milliliter
of 1X PBS was added
to each sample. Template DNA was isolated using the QIAmp DNA Blood Midi I~it
supplied by
QIAGEN (Catalog number 51183).
Design of Multiplex Primers
Primers were designed to anneal at various regions on chromosome 21 to
increase the copy
number of the loci of interest located on chromosome 21. The primers were 12
bases in length.
However, primers of any length can be used including but not limited to 2, 3,
4, 5, 6, 7, 8, 9, 10, 11,
12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30,
31, 32, 33, 34, 35, 36-45,
46-55, 56-65, 66-75, 76-85, 86-95, 96-105, 106-115, 116-125, and greater than
125 bases. Primers
were designed to anneal to both the sense strand and the antisense strand.
Nine SNPs located on chromosome 21 were analyzed: TSC0397235, TSC0470003,
TSC1649726, TSC1261039, TSC0310507, TSC1650432, TSC1335008, TSC0128307, and
TSC0259757. Any number of SNPs can be analyzed including but not limited to 1-
10, 11-20, 21-
30, 31-40, 41-50, 51-60, 61-70, 71-80, 81-90, 91-100, 101-200, 201-300, 301-
400, 401-500, 501-
198
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
600, 601-700, 701-800, 801-900, 901-1000, 1001-2000, 2001-3000, 3001-4000,
4001-5000, 5001-
6000, 6001-7000, 7001-8000, 8001-9000, 9001-10,000 and greater than 10,000.
For each of the 9 SNPs, a 12 base primer was designed to anneal approximately
130 bases
upstream of the loci of interest, and a 12 base primer was designed to anneal
approximately 130
bases downstream of the loci of interest (herein referred to as the multiplex
primers). The multiplex
primers can be designed to anneal at any distance from the loci of interest
including but not limited
to 10-20, 21-30, 31-40, 41-50, 51-60, 61-70, 71-80, 81-90, 91-100, 101-110,
111-120, 121-130,
131-140, 141-150, 151-160, 161-170, 171-180, 181-190, 191-200, 201-210, 211-
220, 221-230,
231-240, 241-250, 251-260, 261-270, 271-280, 281-290, 291-300, 301-310, 311-
320, 321-330,
331-340, 341-350, 351-360, 361-370, 371-380, 381-390, 391-400, 401-410, 411-
420, 421-430,
431-440, 441-450, 451-460, 461-470, 471-480, 481-490, 491-500, 501-600, 601-
700, 701-800,
801-900, 901-1000, 1001-2000, 2001-3000, 3001-4000, 4001-5000, and greater
than 5000 bases.
In addition, more than one set of multiplex primers can be used for one SNP
including but not
limited to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 10-20, 21-30, 31-40, 41-50, and
greater than 50.
In addition, 91 sets of forward and reverse primers were used to amplify other
regions of
chromosome 21, for a total of 100 sets of primers (200 primers in the
reaction). These 91 primer
sets were used to demonstrate that a large number of primers can be used in a
single reaction
without producing a large number of non-specific bands. Any number of primers
can be used in the
reaction including but not limited to 1-10, 11-20, 21-30, 31-40, 41-50, 51-60,
61-70, 71-80, 81-90,
91-100, 101-200, 201-300, 301-400, 401-500, 501-600, 601-700, 701-800, 801-
900, 901-1000,
1001-2000, 2001-3000, 3001-4000, 4001-5000, 5001-6000, 6001-7000, 7001-8000,
8001-9000,
9001-10,000, 10,001-20,000, 20,001-30,000 and greater than 30,000.
The multiplex primers were designed to have the same nucleotides at the 3' end
of the
primer. In this case, the multiplex primers ended in "AA," wherein A indicates
adenine. The
primers were designed in this manner to minimize primer-dimer formation.
However, the primers
can terminate in any nucleotides including but not limited to adenine,
guanine, cytosine, thymidine,
any combination of adenine and guanine, any combination of adenine and
cytosine, any
combination of adenine and thymidine, any combination of guanine and cytosine,
any combination
of guanine and thymidine, or any combination of cytosine and thymidine. In
addition the multiplex
primers can have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 of the same
nucleotides at the 3' end.
The multiplex primers for SNP TSC0397235 were:
Forward Primer:
199
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
5' CAAGTGTCCTAA 3'
Reverse primer:
5' CAGCTGCTAGAA 3'
The multiplex primers for SNP TSC0470003 were:
Forward Primer:
5' GGTTGAGGGCAA 3'
Reverse primer:
5' CACAGCGGGTAA 3'
The multiplex primers for SNP TSC1649726 were:
Forward Primer:
5' TTGACTTTTTAA 3'
Reverse primer:
5' ACAGAATGGGAA 3'
The multiplex primers for SNP TSC1261039 were:
Forward Primer:
5' TGCAGGTCACAA 3'
Reverse primer:
5' TTCTTCTTATAA 3'
200
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
The multiplex primers for SNP TSC0310507 were:
Forward Primer:
5' AGGACAACCTAA 3'
Reverse primer:
5' TGGTGTTCAGAA 3'
The multiplex primers for SNP TSC~1650432 were:
Forward Primer:
5' TCAGCATATGAA 3'
Reverse primer:
5' GTTGCCACACAA 3'
The multiplex primers for SNP TSC1335008 were:
Forward Primer:
5' CCCAGCTAGCAA 3'
Reverse primer:
5' GGGTCACTGTAA 3'
The multiplex primers for SNP TSC0128307 were:
Forward Primer:
201
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
5' TTAAATACCCAA 3'
Reverse primer:
5' TTAGGAGGTTAA 3'
The multiplex primers for SNP TSC0259757 were:
Forward Primer:
5' ACACAGAATCAA 3'
Reverse primer:
5' CGCTGAGGTCAA 3'
Ninety-one (91) additional sets of primers, which annealed to various regions
along
chromosome 21, were included in the reaction:
Set 1:
Forward Primer:
5' AAGTAGAGTCAA 3'
Reverse primer:
5' CTTCCCATGGAA 3'
Set 2:
3 0 Forward Primer:
5' TTGGTTATTAAA 3'
Reverse primer:
202
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
5' CAACTTACTGAA 3'
Set 3:
Forward Primer:
5' CACTAAGTGAAA 3'
Reverse primer:
5' CTCACCTGCCAA 3'
Set 4:
Forward Primer:
5' ATGCATATATAA 3'
Reverse primer:
5' AGAGATCAGCAA 3'
Set 5:
Forward Primer:
5' TATATTTTTCAA 3'
Reverse primer:
5' CAGAAAGCAGAA 3'
Set 6:
Forward Primer:
5' GTATTGGGTTAA 3'
Reverse primer:
203
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
5' CTGACCCAGGAA 3'
Set 7:
Forward Primer:
5' CAGTTTTCCCAA 3'
Reverse primer:
5' AGGGCACAGGAA 3'
Set 8:
Forward Primer:
5' GTATCAGAGGAA 3'
Reverse primer:
5' GCATGAAAAGAA 3'
Set 9:
Forward Primer:
5' GATTTGACAGAA 3'
Reverse primer:
5' TACAGTTTACAA 3'
Set 10:
Forward Primer:
5' TGTGATTTTTAA 3'
Reverse primer:
204
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
5' TTATGTTCTCAA 3'
Set 11:
Forward Primer:
5' CAAGTACTTGAA 3'
Reverse primer:
5' CTTGTGTGGCAA 3'
Set 12:
Forward Primer:
5' AGACTTCTGCAA 3'
Reverse primer:
5' GTTGTCTTTCAA 3'
Set 13:
Forward Primer:
5' GGGACACTCCAA 3'
Reverse primer:
5' ATTATTATTCAA 3'
Set 14:
Forward Primer:
5'ACATGATGACAA3'
205
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Reverse primer:
5' TCAATTATAGAA 3'
Set 15:
Forward Primer:
5' CTATGGGCTGAA 3'
Reverse primer:
5' TGTGTGCCTGAA 3'
Set 16:
Forward Primer:
5' CCATTTGTTGAA 3'
Reverse primer:
5' TCTCCATCAAAA 3'
Set 17:
Forward Primer:
5' AATGCTGACAAA 3'
Reverse primer:
5' TTTCATGTCCAA 3'
Set 18:
Forward Primer:
5' GGCCTCTTGGAA 3'
206
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Reverse primer:
5' TCATTTTTTGAA 3'
Set 19:
Forward Primer:
5' GGACTACCATAA 3'
Reverse primer:
5' AGTCACTCAGAA 3'
Set 20:
Forward Primer:
5' CCTTGGCAGGAA 3'
Reverse primer:
5' TTTCTGGTAGAA 3'
Set 21:
Forward Primer:
5' CCCCCCCCCGAA 3'
Reverse primer:
5' GCCCAGGCAGAA 3'
Set 22:
Forward Primer:
207
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
5' GAATGCGAAGAA 3'
Reverse primer:
5' TTAGGTAGAGAA 3'
Set 23:
Forward Primer:
5' TGCTTTGGTCAA 3'
Reverse primer:
5' GCCCATTAATAA 3'
Set 24:
Forward Primer:
5' TGAGATCTTTAA 3'
Reverse primer:
5' CAGTTTGTTCAA 3'
Set 25:
Forward Primer:
5' GCTGGGCAAGAA 3'
Reverse primer:
5' AGTCAAAGTCAA 3'
Set 26:
Forward Primer:
20~
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
5' TCTCTGCAGTAA 3'
Reverse primer:
5' TGAATAACTTAA 3'
Set 27:
Forward Primer:
5' CGGTTAGAAAAA 3'
Reverse primer:
5' CATCCCTTTCAA 3'
Set 2~:
Forward Primer:
5' TCTCTTTCTGAA 3'
Reverse primer:
5' CTCAGATTGTAA 3'
Set 29:
Forward Primer:
5' TTTGCACCAGAA 3'
Reverse primer:
5' GGTTAACATGAA 3'
Set 30:
209
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Forward Primer:
5' ATTATCAACTAA 3'
Reverse primer:
5' GCCATTTTGTAA 3'
Set 31:
Forward Primer:
5' GATCTAGATGAA 3'
Reverse primer:
5' TTAATGTATTAA 3'
Set 32:
Forward Primer:
5' CTAGGGAGACAA 3'
Reverse primer:
5' TGGAGGAGACAA 3'
Set 33:
Forward Primer:
5' CATCACATTTAA 3'
Reverse primer:
5' GGGGTCCTGCAA 3'
210
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Set 34:
Forward Primer:
5' CAGTTGTGCTAA 3'
Reverse primer:
5' TCTGCAGCCTAA 3'
Set 35:
Forward Primer;
5' GAGTCATTTAAA 3'
Reverse primer:
5' TCTATGGATTAA 3'
Set 36:
Forward Primer:
5' CAAAAAGTAGAA 3'
Reverse primer:
5' AATATACTCCAA 3'
Set 37:
Forward Primer:
5' CGTCCAGCACAA 3'
Reverse primer:
5' GGATGGTGAGAA 3'
211
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Set 38:
Forward Primer:
5' TCTCCTTTGTAA 3'
Reverse primer:
5' TCGTTATTTCAA 3'
Set 39:
Forward Primer:
5' GATTTTATAGAA 3'
Reverse primer:
5' AGACATAAGCAA 3'
Set 40:
Forward Primer:
5' TTCACCTCACAA 3'
Reverse primer:
5' GGATTGCTTGAA 3'
Set 41:
Forward Primer:
5' ACTGCATGTGAA 3'
Reverse primer:
212
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
5' TTTATCACAGAA 3'
Set 42:
Forward Primer:
5' TCAGTAACACAA 3'
Reverse primer:
5' TACATCTTTGAA 3'
Set 43:
Forward Primer:
5' TTGTTTCAGTAA 3'
Reverse primer:
5' TATGAGCATCAA 3'
Set 44:
Forward Primer:
5' CTCAGCAGGCAA 3'
Reverse primer:
5' ACCCCTGTATAA 3'
Set 45:
Forward Primer:
5' TCTGCTCAGCAA 3'
3 5 Reverse primer:
213
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
5' GTTCTTTTTTAA 3'
Set 46:
Forward Primer:
5' GTGATAATCCAA 3'
Reverse primer:
5' GAGCCCTCAGAA 3'
Set 47:
Forward Primer:
5' TTTATTGGTTAA 3'
Reverse primer:
5' GGTACTGGGCAA 3'
Set 48:
Forward Primer:
5' AGTGTTTTTCAA 3'
Reverse primer:
5' TGTTATTGGTAA 3' a
Set 49:
Forward Primer:
5' GCGCATTCACAA 3'
214
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Reverse primer:
5'AAACAAAAGCAA3'
Set 50:
Forward Primer:
5' TATATGATAGAA 3'
Reverse primer:
5' TCCCAGTTCCAA 3'
Set 51:
Forward Primer:
5' AAAGCCCATAAA 3'
Reverse primer:
5' TGTCATCCACAA 3'
Set 52:
Forward Primer:
5' TTGTGAATGCAA 3'
Reverse primer:
5' GTATTCATACAA 3'
Set 53:
Forward Primer:
5' TGACATAGGGAA 3'
215
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Reverse primer:
5' AGCAAATTGCAA 3'
Set 54:
Forward Primer:
5' AGTAGATGTTAA 3'
Reverse primer:
5' AAAAGATAATAA 3'
Set 55:
Forward Primer:
5' ACCTCATGGGAA 3'
Reverse primer:
5' TGGTCGACCTAA 3'
Set 56:
Forward Primer:
5' TTTGCATGGTAA 3'
Reverse primer:
5' GCGGCTGCCGAA 3'
Set 57:
Forward Primer:
216
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
5' TCAGGAGTCTAA 3'
Reverse primer:
5' GCCTACCAGGAA 3'
Set 58:
Forward Primer:
5' ATCTTCTGTTAA 3'
Reverse primer:
5' AGGTAAGGACAA 3'
Set 59:
Forward Primer:
5' TGCTTTGAGGAA 3'
Reverse primer:
5' AACAGTTTTAAA 3'
Set 60:
Forward Primer:
5' TTAAATGTTTAA 3'
Reverse primer:
5' ATAGAAAATCAA 3'
Set 61:
Forward Primer:
217
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
5' GTGTTGTGTTAA 3'
Reverse primer:
5' GAGGACCTCGAA 3'
Set 62:
Forward Primer:
5' AGAGGCTGAGAA 3'
Reverse primer:
5' GGTATTTATTAA 3'
Set 63:
Forward Primer:
5' ATTTATCTGGAA 3'
Reverse primer:
5' AGTGCAAACTAA 3'
Set 64:
Forward Primer:
5' TGAACACCTTAA 3'
Reverse primer:
5' AATTTTTTCTAA 3'
Set 65:
218
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Forward Primer:
5' TTACTATTATAA 3'
Reverse primer:
5' TGCTATAGTGAA 3'
Set 66:
Forward Primer:
5' TGGACTATGGAA 3'
Reverse primer:
5' CTGCAGTCCGAA 3'
Set 67:
Forward Primer:
5' GCTACTGCCCAA 3'
Reverse primer:
5' TCACATGGTGAA 3'
Set 68:
Forward Primer:
5' GTGGCTCTGGAA 3'
Reverse primer:
5' GAATTCCATTAA 3'
219
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Set 69:
Forward Primer:
5' TGGGGTGTCCAA 3'
Reverse primer:
5' GCAAGCTCCGAA 3'
Set 70:
Forward Primer:
5' ATGTTTTTTCAA 3'
Reverse primer:
5' AGATCTGTTGAA 3'
Set 71:
Forward Primer:
5' AAGTGCTGTGAA 3' ,
Reverse primer:
5' ACTTTTTTGGAA 3'
Set 72:
Forward Primer:
5' AATCGGCAGGAA 3'
Reverse primer:
5' GGCATGTCACAA 3'
220
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Set 73:
Forward Primer:
5'AGGAAGAAAGAA3'
Reverse primer:
5' CAGTTTCACCAA 3'
Set 74:
Forward Primer:
5' CACAGAATTTAA 3'
Reverse primer:
5' AAGAATAAGTAA 3'
Set 75:
Forward Primer:
5' GGGATAGTACAA 3'
Reverse primer:
5' TTCCCATGATAA 3'
Set 76:
Forward Primer:
5' TGATTAGTTGAA 3'
Reverse primer:
221
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
5' GCATTCAGTGAA 3'
Set 77:
Forward Primer:
5' AGGGAATATTAA 3'
Reverse primer:
5' GACCTTAGGTAA 3'
Set 78:
Forward Primer:
5' TTCTTTTCACAA 3'
Reverse primer:
5' CCAAACTAAGAA 3'
Set 79:
Forward Primer:
5' GTGCTCTTAGAA 3'
Reverse primer:
5' ATGAGTTTAGAA 3'
Set 80:
Forward Primer:
5' ATGAGCATAGAA 3'
Reverse primer:
222
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
5' GACAAATGAGAA 3'
Set 81:
Forward Primer:
5' AAACCCAGAGAA 3'
Reverse primer:
5' CCTCACACAGAA 3'
Set 82:
Forward Primer:
5' CACACTGTGGAA 3'
Reverse primer:
5' CACTGTACCCAA 3'
Set 83:
Forward Primer:
5' GTAGTATTTCAA 3'
Reverse primer:
5' TGGATACACTAA 3'
Set 84:
Forward Primer:
5' CCCATGATTCAA 3'
223
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Reverse primer:
5' TCATAGGAGGAA 3'
Set 85:
Forward Primer:
5' AGGAAAGAGAAA 3'
Reverse primer:
5' ATATGGTGATAA 3'
Set 86:
Forward Primer:
5' GATGCCATCCAA 3'
Reverse primer:
5' ATACTATTTCAA 3'
Set 87:
Forward Primer:
5' GTGTGCATGGAA 3'
Reverse primer:
5' AGGTGTTGAGAA 3'
Set 88:
Forward Primer:
224
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
5' CAGCCTGGGCAA 3'
Reverse primer:
5' GGAGCTCTACAA 3'
Set S9:
Forward Primer:
5' AACTAAGGTTAA 3'
Reverse primer:
5' AACTTATGTTAA 3'
Set 90:
Forward Primer:
5' ATCTCAACAGAA 3'
Reverse primer:
5' TAACAATGTGAA 3'
Set 91:
Forward Primer:
5' AAGGATCAGGAA 3'
Reverse primer:
225
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
5' CTCAAGTCTTAA 3'
Multiplex PCR
Regions on chromosome 21 surrounding SNPs TSC0397235, TSC0470003, TSC1649726,
TSC1261039, TSC0310507, TSC1650432, TSC1335008, TSC0128307, and TSC0259757
were
amplified from the template genomic DNA using the polymerase chain reaction
(PCR, U.S. Patent
Nos. 4,683,195 and 4,683,202, incorporated herein by reference). This PCR
reaction used primers
that annealed approximately 130 bases upstream and downstream of the loci of
interest. It was used
to increases the number of copies of the loci of interest to eliminate any
errors that may result from
a low number of genomes.
For increased specificity, a "hot-start" PCR reaction was used. PCR reactions
were
performed using the HotStarTaq Master Mix Kit supplied by QIAGEN (catalog
number 203443).
The amount of template DNA and primer per reaction can be optimized for each
locus of interest.
In this example, 15 ng of template human genomic DNA and 5 ~,M of each primer
were used.
Two microliters of each forward and reverse primer, at concentrations of 5 mM
were
pooled into a single microcentrifuge tube and mixed. Eight microliters of the
primer mix was used
in a total PCR reaction volume of 40 p,l (1.5 p,l of template DNA, 10.5 p,l of
sterile water, 8 p,l of
primer mix, and 20 ~,1 of HotStar Taq). Twenty-five cycles of PCR were
performed. The following
PCR conditions were used:
(1) 95°C for 15 minutes;
(2) 95°C for 30 seconds;
(3) 4°C for 30 seconds;
(4) 37°C for 30 seconds;
(5) Repeat steps 2-4 twenty-four (24) times;
(6) 72°C for 10 minutes.
The temperatures and times for denaturing, annealing, and extension, can be
optimized by
trying various settings and using the parameters that yield the best results.
In another embodiment, the loci of interest are amplified using 6-base
oligonucleotides, 7-
base oligonucleotides, 8-base oligonucleotides, 9-base oligonucleotides, 10-
base oligonucleotides,
11-base oligonucleotides, 12-base oligonucleotides, 13- base oligonucleotides,
14-base
oligonucleotides, or greater than 14-base oligonucleotides. In a preferred
embodiment, 6-base
oligonucleotides, 7-base oligonucleotides, 8-base oligonucleotides, 9-base
oligonucleotides, 10-
base oligonucleotides, 11-base oligonucleotides, or 12-base oligonucleotides
are used to amplify the
226
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
loci of interest. In another embodiment, any number of oligonucleotides can be
used including but
not limited to 1-5, 5-10, 10-15, 15-20, 20-25, 25-30, 30-35, 35-40, 40-45, 45-
50, 50-100, 100-500,
500-1000, 1000-2000, 2000-4000, 4000-8000, 8000-10,000 or greater than 10,000.
With a small
number of random oligos, the concentration of the oligos is large enough to
allow efficient
amplification, and yet, the number of oligos is small enough that it does not
cause interference
between the oligos. This allows efficient amplification of the genome.
In another embodiment, the upstream and downstream sequences of the loci of
interest are
analyzed to identify a 6-base, 7-base, 8-base, 9-base, 10-base, 11-base, or 12-
base sequence that is
present in the sequence upstream or downstream for each of the loci of
interest, which is then used
to amplify the loci of interest. In another embodiment, any number of 6-base
oligonucleotides can
be used to amplify the loci of interest including but not limited to 1-10, 10-
50, 50-100, 100-200,
200-500, or greater than 500.
In another embodiment, the number of loci of interest from a small number of
genomes can
be increased by amplifying a limited number of the loci of interest, followed
by removal of the
. primers, and amplification of the remaining loci of interest. All the loci
of interest do not have to
be multiplexed in one reaction. Any number of experimentally determined loci
of interest can be
multiplexed in a single reaction including but not limited to 1-5, 5-10, 10-
25, 25-50, 50-100, 100-
200, 200-400, or greater than 400. After increasing the number of copies of
these loci of interest,
the sample can be passed through a column that allows the amplified products
to bind and the
primers and unused dNTPs to be removed. After eluting the bound products from
the column,
different loci of interest can be amplified in a single reaction. This reduces
the amount of
interaction between the primers.
Other methods of genomic amplification can also be used to increase the copy
number of
the loci of interest including but not limited to primer extension
preamplification (PEP) (Zhang et
al., PNAS, 89:5847-51, 1992), degenerate oligonucleotide primed PCR (DOP-PCR)
(Telenius, et
al., Genomics 13:718-25, 1992), strand displacement amplification using DNA
polymerase from
bacteriophage 29, which undergoes rolling circle replication (Dean et al.,
Genomic Research
11:1095-99, 2001), multiple displacement amplification (U.S. Patent
6,124,120), REPLI-gT"~ Whole
Genome Amplification kits, and Tagged PCR.
Purification of Fragment of Interest
The excess primers and nucleotides were removed from the reaction by using
Qiagen
MinElute PCR purification kits (Qiagen, .Catalog Number 28004). The reactions
were performed
227
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
following the manufacturer's instructions supplied with the columns. The DNA
was eluted in 100
pl of sterile water.
PCR Reaction Two
SNP TSC0397235 was amplified using the following primer set:
First Primer:
5'TTAGTCATCGCAGAATTCTACTTCTTTCTGAAGTGGGA3'
Second primer:
5'GGACAGCTCGATGGGACTAATGCATACTC3'
The first primer contained a biotin tag at the 5' end and a recognition site
for the restriction
enzyme EcoRI, and was designed to anneal 103 bases from the locus of interest.
The second primer
contained the recognition site for the restriction enzyme BsmF I. ,
SNP TSC0470003 was amplified using the following primer set:
First Primer:
5' GTAGCCACTGGTGAATTCGTGCCATCGCAAAAGAATAA3'
Second primer:
5'ATTAGAATGATGGGGACCCCTGTCTTCCC3'
The first primer contained a biotin tag at the 5' end and a recognition site
for the restriction
enzyme EcoRI, and was designed to anneal 80 bases from the locus of interest.
The second primer
contained the recognition site for the restriction enzyme BsmF I.
SNP TSC1649726 was amplified using the following primer set:
228
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
First Primer:
5'ACGCATAGGAAGGAATTCATTCTGACACGTGTGAGATA3'
Second primer:
5' GAAATTGACCACGGGACTGCACACTTTTC 3'
The first primer contained a biotin tag at the 5' end and a recognition site
for the restriction
enzyme EcoRI, and was designed to anneal 113 bases from the locus of interest.
The second primer
contained the recognition site for the restriction enzyme BsmF I.
SNP TSC1261039~was amplified using the following primer set:
First Primer:
5'CGGTAAATCGGAGAATTCAAGTTGAGGCATGCATCCAT3'
Second primer:
5'TCGGGGCTCAGCGGGACCACAGCCACTCC3'
The first primer contained a biotin tag at the 5' end and a recognition site
for the restriction
enzyme EcoRI, and was designed to anneal 54 bases from the locus of interest.
The second primer
contained the recognition site for the restriction enzyme BsmF I.
SNP TSC0310507 was amplified using the following primer set:
First Primer:
5'TCTATGCACCACGAATTCAATATGTGTTCAAGGACATT3'
Second primer:
229
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
5'TGCTTAATCGGTGGGACTTGTAATTGTAC3'
The first primer contained a biotin tag at the 5' end and a recognition site
for the restriction
enzyme EcoRI, and was designed to anneal 93 bases from the locus of interest.
The second primer
contained the recognition site for the restriction enzyme BsmF I.
SNP TSC 1650432 was amplified using the following primer set:
First Primer:
5' CGCGTTGTATGCGAATTCCCTGGGGTATAAAGATAAGA3'
Second primer:
5'CTCACGGGAACTGGGACACCTGACCCTGC3'
The first primer contained a biotin tag at the 5' end and a recognition site
for the restriction
enzyme EcoRI, and was designed to anneal 80 bases from the locus of interest.
The second primer
contained the recognition site for the restriction enzyme BsmF I.
SNP TSC1335008 was amplified using the following primer set:
First Primer:
5'GTCTTGCCGCTTGAATTCCCATAGAAGAATGCGCCAAA3'
Second primer:
5'TTGAGTAGTACAGGGACACACTAACAGAC3'
The first primer contained a biotin tag at the 5' end and a recognition site
for the restriction
enzyme EcoRI, and was designed to anneal 94 bases from the locus of interest.
The second primer
contained the recognition site for the restriction enzyme BsmF I.
230
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
SNP TSC0128307 was amplified using the following primer set:
First Primer:
5'AATACTGTAGGTGAATTCTTGCCTAAGCATTTTCCCAG3'
Second primer:
5'GTGTTGACATTCGGGACTGTAATCTTGAC3'
The first primer contained a biotin tag at the 5' end and a recognition site
for the restriction
enzyme. EcoRI, and was designed to anneal 54 bases from the locus of interest.
The second primer'
contained the recognition site fox the restriction enzyme BsmF T.
SNP TSC0259757 was amplified using the following primer set:
First Primer:
5'TCTGTAGATTCGGAATTCTTTAGAGCCTGTGCGCTGAG3'
Second primer:
5'CGTACCAGTACAGGGACGCAAACTGAGAC3'
The first primer contained a biotin tag at the 5' end and a recognition site
for the restriction
enzyme EcoRI, and was designed to anneal 100 bases from the locus of interest.
The second primer
contained the recognition site for the restriction enzyme BsmF I.
All loci of interest were amplified from the template genomic DNA using the
polymerise
chain reaction (PCR, U.S. Patent Nos. 4,683,195 and 4,683,202, incorporated
herein by reference).
In this example, the loci of interest were amplified in separate reaction
tubes but they can also be
amplified together in a single PCR reaction. For increased specificity, a "hot-
start" PCR was used.
PCR reactions were performed using the HotStarTaq Master Mix Kit supplied by
QIAGEN (catalog
number 203443).
One microliter of the elutate from the multiplex reaction (PCR product eluted
from the
MinElute column) was used as template DNA for each PCR reaction. Each SNP was
amplified in
231
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
triplicate when the multiplex sample was used as the template. As a control,
each SNP was
amplified from 15 ng of the original template DNA (DNA that did not undergo
the multiplex
reaction). The amount of template DNA and primer per reaction can be optimized
for each locus of
interest but in this example, 5 ~M of each primer was used. Forty cycles of
PCR were performed.
The following PCR conditions were used:
(1) 95°C for 15 minutes and 15 seconds;
(2) 37°C for 30 seconds;
(3) 95°C for 30 seconds;
(4) 57°C for 30 seconds;
(5) 95°C for 30 seconds;
(6) 64°C for 30 seconds;
(7) 95°C for 30 seconds;
(8) Repeat steps 6 and 7 thirty nine (39) times;
(9) 72°C for 5 minutes.
In the first cycle of PCR, the annealing temperature was about the melting
temperature of
the 3' annealing region of the second primers, which was 37°C. The
annealing temperature in the
second cycle of PCR was about the melting temperature of the 3' region, which
anneals to the
template DNA, of the first primer, which was 57°C. The annealing
temperature in the third cycle of
PCR was about the melting temperature of the entire sequence of the second
primer, which was
64°C. The annealing temperature for the remaining cycles was
64°C. Escalating the annealing
temperature from TMl to TM2 to TM3 in the first three cycles of PCR greatly
improves specificity.
These annealing temperatures are representative, and the skilled artisan will
understand the
annealing temperatures for each cycle are dependent on the specific primers
used.
The temperatures and times for denaturing, annealing, and extension, can be
optimized by
trying various settings and using the parameters that yield the best results.
Agarose Gel Analysis
Four microliters of a twenty microliter PCR reaction for each SNP from the
original
template DNA was analyzed by agarose gel electrophoresis (see FIG. 18A). Four
microliters of a
twenty microliter PCR reaction for each SNP that was amplified from the
multiplexed template was
analyzed on by agarose gel electrophoresis (see FIG. 18B).
As seen in FIG. 18A, for 8/9 of the SNPs amplified from the original template
DNA, a
single band of high intensity was seen (lanes 1-3, and 5-9). The band migrated
at the correct
position for each of the 8 SNPs. Amplification of TSC1261039 from the original
template DNA
232
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
produced a band of high intensity, which migrated at the correct position, and
a faint band of lower
molecular weight (lane 4). Only two bands were seen, and the bands could
clearly be distinguished
based on molecular weight. The PCR method described herein allows clean
amplification of the
loci of interest from genomic DNA without any concentration or enrichment of
the loci of interest.
As seen in FIG. 18B, the primers used to amplify SNPs TSC0397235, TSC0470003,
TSC0310507, and TSC0128307 from the multiplexed template DNA produced a single
band of
high intensity, which migrated at the correct position (lanes 1, 2, 5, and 8).
No additional bands
were introduced despite the fact that the multiplex reaction contained two
hundred primers. While
the multiplex primers were 12 bases in length and likely annealed to
additional sequences other than
those located on chromosome 21, the products were not seen because the bands
were not amplified
in the second PCR reaction. The second PCR reaction employed primers specific
for the loci of
interest and used asymmetric oligonucleotides and escalating annealing
temperatures, which allows
specific amplification from the genome (see Example 1).
Amplification of TSC 1649726 from the multiplex template DNA produced one band
of
. high intensity and two weaker bands, which could clearly be distinguished
based on molecular
weight (see FIG. 18B, lane 3). Amplification of TSC1261039 from the multiplex
template DNA
produced a high intensity band of the correct molecular weight and a faint
band of lower molecular
weight (see FIG. 188, lane 4). The low molecular weight band was the same size
as the band seen
from the amplification of TSC1261039 from the original template DNA (compare
FIG. 18A, lane 4
with FIG. 18B, lane 4). Thus, amplification of TSC1261039 on the multiplex
template DNA did
not introduce any additional non-specific bands
Amplification of SNPs TSC1650432, TSC1335008, and TSC0259757 from the
multiplex
template DNA produced one band of high intensity, which migrated at the
correct position, and one
weaker band (lanes 6, 7, and 9). For SNPs TSC 1650432 and TSC0259757, the
weaker band was of
lower molecular weight, and clearly was distinguishable from the band of
interest (see FIG. 18B,
lanes 6 and 9). For SNP TSC1335008, the weaker band was of slightly higher
molecular weight.
However, the correct band can be identified by comparing to the amplification
products of
TSC1335008 from the original template DNA, (compare FIG. 18A, lane 7 and FIG.
18B, lane 7).
The PCR conditions can also be optimized for TSC1335008. All 9 SNPs were
amplified under the
exact same conditions, which produced clearly distinguishable bands for the
amplified SNPs.
Purification of Fragment of Interest
The PCR products were separated from the genomic template DNA. One half of the
PCR
reaction was transferred to a well of a Streptawell, transparent, High-Bind
plate from Roche
233
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Diagnostics GmbH (catalog number 1 645 692, as listed in Roche Molecular
Biochemicals, 2001
Biochemicals Catalog). The first primers contained a 5' biotin tag so the PCR
products bound to the
Streptavidin coated wells while the genomic template DNA did not. The
streptavidin binding
reaction was performed using a Thermomixer (Eppendorf) at 1000 rpm for 20 min.
at 37°C. Each
well was aspirated to remove unbound material, and washed three times with 1X
PBS, with gentle
mixing (Kandpal et al., Nucl. Acids Res. 18:1789-1795 (1990); Kaneoka et al.,
Biotechniques
10:30-34 (1991); Green et al., Nucl. Acids Res. 18:6163-6164 (1990)).
Restriction Enzyme Digestion of Isolated Fragments
The purified PCR products were digested with the restriction enzyme BsmF I,
which binds
to the recognition site incorporated into the PCR products from the second
primer. The digests
were performed in the Streptawells following the instructions supplied with
the restriction enzyme.
After digestion, the wells were washed three times with PBS to remove the
cleaved fragments.
Incorporation of Labeled Nucleotide
The restriction enzyme digest with BsmF I yielded a DNA fragment with a 5'
overhang,
which contained the SNP site or locus of interest and a 3' recessed end. The
5' overhang functioned
as a template allowing incorporation of a nucleotide or nucleotides in the
presence of a DNA
polymerase.
As discussed in detail in Example 6, the sequence of both alleles of a SNP can
be
determined by using one labeled nucleotide in the presence of the other
unlabeled nucleotides. The
following components were added to each fill in reaction: 1 wl of
fluorescently labeled ddGTP, 0.5
~1 of unlabeled ddNTPs ( 40 ~M), which contained all nucleotides except
guanine, 2 ~.1 of lOX
sequenase buffer, 0.25 ~.l of Sequenase, and water as needed for a 20.1
reaction. The fill in
reaction was performed at 40°C for 10 min. Non-fluorescently labeled
ddNTP was purchased from
Fermentas Inc. (Hanover, MD). All other labeling reagents were obtained from
Amersham
(Thermo Sequenase Dye Terminator Cycle Sequencing Core Kit, US 79565).
After labeling, each Streptawell was rinsed with 1X PBS (100 ~,1) three times.
The "filled
in" DNA fragments then were released from the Streptawells by digestion with
the restriction
enzyme EcoRI, according to the manufacturer's instructions that were supplied
with the enzyme.
Digestion was performed for 1 hour at 37 °C with shaking at 120
rpm.
234
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Detection of the Locus of Interest
The samples were loaded into a lane of a 36 cm 5% acrylamide (urea) gel
(BioWhittaker
Molecular Applications, Long Ranger Run Gel Packs, catalog number 50691). The
samples were
electrophoresed into the gel at 3000 volts for 3 min. The gel was run for 3
hours on a sequencing
apparatus (Hoefer SQ3 Sequencer). The gel was removed from the apparatus and
scanned on the
Typhoon 9400 Variable Mode Imager. The incorporated labeled nucleotide was
detected by
fluorescence. A box was drawn around each band and the intensity of the band
was calculated
using the ImageQuant software.
Below, a schematic of the 5' overhang for TSC0470003 after digestion with BsmF
I is
depicted:
5' CTCT
3' GAGA R A C C
Overhang position 1 2 3 4
The observed nucleotides for TSC0470003 are adenine and guanine on the sense
strand
(herein depicted as the top strand). The third position of the overhang
corresponds to cytosine,
which is complementary to guanine. Labeled ddGTP was used in the presence of
unlabeled dATP,
dCTP, and dTTP. Schematics of the DNA molecules after the fill-in reaction are
depicted below:
Allele 1 5' CTCT GX
3' GAGA C A C C
Overhang position 1 2 3 4
Allele 2 5' CTCT A T G*
3' GAGA T A C C
Overhang position 1 2 3 4
Two bands were seen; the lower molecular weight band corresponded to the DNA
molecules filled
in with ddGTP at position 1 complementary to the overhang and the higher
molecular weight band
corresponded to the DNA molecules filled in with ddGTP at position 3
complementary to the
overhang (see FIG. 19).
The percentage of allele 2 to allele 1 at TSC0470003 after amplification from
the original
template DNA and the multiplexed template DNA was calculated. The use of one
fluorescently
235
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
labeled nucleotide to detect both alleles in a single reaction reduces the
amount of error that is
introduced through pipetting reactions, and the error that is introduced
through the quantum
coe~cients of different dyes.
For SNP TSC047003, the percentage of allele 2 to allele 1 was calculated by
dividing the
value of allele 2 by the sum of the values for allele 2 and allele 1. The
percentage of allele 2 to
allele 1 for TSC047003 on the original template DNA was calculated to be 0.539
(see Table XIX).
Three PCR reactions were performed for each SNP on the multiplexed template
DNA. The average
percentage of allele 2 to allele 1 for TSC047003 on the multiplexed DNA was
0.49 with a standard
deviation of 0.0319 (see Table XIX). There was no statistically significant
difference between the
percentage obtained on the original template DNA and the multiplexed template
DNA.
For SNP TSC1261039, the percentage of allele 2 to allele 1 for TSC1261039 on
the
original template DNA was calculated to be 0.44 (see Table SIX). Three PCR
reactions .were
performed for each SNP on the multiplexed template DNA (see FIG. 19B). The
average percentage
of allele 2 to allele 1 for TSC1261039 on the multiplexed DNA was 0.468 with a
standard deviation
of 0.05683 (see Table XIX). There was no statistically significant difference
between the
percentages of allele 2 to allele 1 obtained on the original template DNA and
the multiplexed
template DNA.
The variation seen in the percentage of allele 2 to allele 1 for TSC1261039 on
the
multiplexed template DNA was likely due to pipetting reactions. The variation
can be reduced by
increasing the number of replicates. With a large number of replicates, a
percentage can be
obtained with minimum statistical variation.
Likewise, there was no statistical difference between the percentage of allele
2 to allele 1
on the original template DNA and on the multiplexed template DNA for SNPs
TSC0310507 and
TSC1335008 (see Table XIX, and FIGS. 19C and 19D). Thus, a multiplex reaction
can be used to
increase the number of chromosomal regions containing the loci of interest
without affecting the
percentage of one allele to the other at the variable sites.
TABLE XIX. Percentage of allele 2 to allele 1 at various SNPs with and without
multiplexing.
TSC047003
Allele Allele 2/(2+1)
1 2
IA 5535418 6487873 0.539608748
M1 4804358 4886716 0.504249168
M2 5549389 5958585 0.517778803
M3 1 83562757030245 1 0.45690936'
1
236
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Mean (M1-M3) 0.49297911
STDEV 0.031961429
TSC1261039
Allele Allele 2/(2+1 )
1 2
IA 3488765 2768066 0.442407027
M1 3603388 2573244 0.41660957
M2 4470423 5026872 0.529295131
M3 4306015 366940120.46008898
Mean (M1-M3) 0.46866456
STDEV 0.056830136
TSC0310507
Allele Allele 21(2+1)
1 2
IA 2966511 2688190 0.475390299
M1 4084472 2963451 0.420471535
M2 4509891 4052892 0.47331481
M3 7173191 4642069 0.39288759
Mean (M1-M3) 0.428891312
STDEV 0:040869352
TSC1335008
Allele Allele 2I(2+1)
1 2
IA 2311629 2553016 0.524810341
M1 794790 900879 0.531282343
M2 1261568 1780689 0.5853184
M3 1165156 1427840 0.550653
Mean (M1-M3) - ~ 0.555751248
237
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
STD EV 0.027376412
The methods described herein used two distinct amplification reactions to
amplify the loci
of interest. In the first PCR reaction, oligonucleotides were designed to
anneal upstream and
downstream of the loci of interest. Unlike traditional genomic amplification,
these primers were
not degenerate and annealed at a specified distance from the loci of interest.
However, due to the
length of the primers, it is likely that the primers annealed to other regions
of the genome. These
primers were used to increase the amount of DNA available for genetic
analysis.
The second PCR reaction employs the methods described in Examples 1-6. The
primers
are designed to amplify the loci of interest, and the sequence is determined
at the loci of interest.
The conditions of the second PCR reaction allowed specific amplification of
the loci of interest
from the multiplexed template DNA. If there were any non-specific products
from the multiplex
reaction, they did not impede amplification of the loci of interest. There was
no statistical
difference in the percentages of allele 2 to allele 1 at the four SNPs
analyzed, regardless of whether
the amplification was performed on original template DNA or multiplexed
template DNA.
The SNPs analyzed in this example were located on human chromosome 21.
However, the
methods can be applied to non-human and human DNA including but not limited to
chromosomes
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 1 ~, 17, 18, 19, 20, 21,
22, X, and Y. The multiplex
methods can also be applied to analysis of genetic mutations including but not
limited to nucleotide
substitutions, insertions, deletions, and rearrangements.
The above methods can be used to increase the amount of DNA available for
genetic
analysis whenever the starting template DNA is limiting in quantity. For
example, pre-malignant
and pre-invasive lesions with malignant cells usually constitute a small
fraction of the cells in the
specimen, which reduces the number of genetic analyses that can be performed.
The methods
described herein can be used to increase the amounts of malignant DNA
available for genetic
analysis. Also, the number of fetal genomes present in the maternal blood is
often low; the methods
described herein can be used to increase the amount of fetal DNA.
EXAMPLE 13
Plasma isolated from blood of a pregnant female contains both maternal
template DNA and
fetal template DNA. As discussed earlier, the percentage of fetal DNA in the
maternal plasma
varies for each pregnant female. However, the percentage of fetal DNA can be
determined by
analyzing SNPs wherein the maternal template DNA is homozygous and the
template DNA
obtained from the plasma displays a heterozygous pattern.
238
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
For example, assume SNP X can either be adenine or guanine, and the maternal
DNA for
SNP X is homozygous for guanine. The labeling method described in Example 6
can be used to
determine the sequence of the template DNA in the plasma sample. If the plasma
sample contains
fetal DNA, which is heterozygous at SNP X, the following DNA molecules are
expected after
digestion with the type IIS restriction enzyme BsmF I, and the fill-in
reaction with labeled ddGTP,
unlabeled dATP, dTTP, and dCTP.
Maternal Allele 1 5' GGGT G*
3'CCCA C T C A
Maternal Allele 2 5' GGGT G*
3'CCCA C T C A
Fetal Allele 1 5' GGGT G*
3'CCCA C T C A
Fetal Allele 2 5' GGGT A A G*
3'CCCA T T C A
Two signals are seen; one signal corresponds to the DNA molecules filled in
with ddGTP at
position one complementary to the overhang and the second signal corresponds
to the DNA
molecules filled in with ddGTP at position three complementary to the
overhang. However, the
maternal DNA is homozygous for guanine, which corresponds to the DNA molecules
filled in at
position one complementary to the overhang. The signal from the DNA molecules
filled in with
ddGTP at position three complementary to the overhang corresponds to the
adenine allele, which
represents the fetal DNA. This signal becomes a beacon for the fetal DNA, and
can used to
measure the amount of fetal DNA present in the plasma sample.
There is no difference in the amount of fetal DNA from one chromosome to
another. For
instance, the percentage of fetal DNA in any given individual from chromosome
1 is the same as
the percentage of fetal DNA from chromosome 2, 3, 4, 5, 6, 7, 8, 9, 10, 11,
12, 13, 14, 15, 16, 17,
18, 19, 20, 21, 22, X and Y. Thus, the allele ratio calculated for SNPs on one
chromosome can be
compared to the allele ratio for the SNPs on another chromosome.
For example, the allele ratio for the SNPs on chromosome 1 should be equal to
the allele
ratio for the SNPs on chromosomes 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 l, 12, 13, 14,
15, 16, 17, 18, 19, 20,
21, 22, X, and Y. However, if the fetus has a chromosomal abnormality,
including but not limited
239
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
to a trisomy or monosomy, the ratio for the chromosome that is present in an
abnormal copy
number will differ from the ratio for the other chromosomes.
Blood from a pregnant female was collected after informed consent had been
obtained. The
blood sample was used to demonstrate that fetal DNA can be detected in the
maternal plasma by
analyzing SNPs wherein the maternal DNA was homozygous, and the same SNP
displayed a
heterozygous pattern from DNA obtained from the plasma of a pregnant woman.
Preparation of Plasma from Whole Blood
Plasma was isolated from 4 tubes each containing 9 ml of blood (Fischer
Scientific, 9 ml
EDTA Vacuette tubes, catalog number NG9897284). The blood was obtained by
venipuncture
from a pregnant female who had given informed consent. After collecting the
blood, formaldehyde
(25 pl/ml of blood) was added to each of the tubes. The tubes were placed at
4°C until shipment.
The tubes were shipped via Federal Express in a foam container containing an
ice pack.
The blood was centrifuged at 1000 rpm for 10 minutes. The brake on the
centrifuge was
not used. This centrifugation step was repeated. The supernatant was
transferred to a new tube and
spun at 3,000 rpm for ten minutes. The brake on the centrifuge was not used.
The supernatant from
each of the four tubes was pooled and aliquoted into two tubes. The plasma was
stored at -80°C
until the DNA was purified.
Template DNA was isolated using the QIAmp DNA Blood Midi Kit supplied by
QIAGEN
(Catalog number 51183). The template DNA was isolated as per instructions
included in the kit.
The template DNA from the plasma was eluted in a final volume of 20
microliters.
Isolation of Maternal DNA
After the plasma was removed from the sample described above, one milliliter
of the
remaining blood sample, which is commonly referred to as the "huffy-coat," was
transferred to a
new tube. One milliliter of 1X PBS was added to the sample. Template DNA was
isolated using
the QIAmp DNA Blood Midi Kit supplied by QIAGEN (Catalog number 51183).
Identification of Homozygous Maternal SNPs
Example 8 describes a method for identifying SNPs that are highly variable
within the
population or for identifying heterozygous SNPs for a given individual. The
methods as described
in Example 8 were applied to the maternal template DNA to identify SNPs on
chromosome 13
240
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
wherein the maternal DNA was homozygous. Any number of SNPs can be screened.
The number
of SNPs to be screened is proportional to the number of heterozygous SNPs in
the fetal DNA that
need to be analyzed.
As described in detail in Example 6, one labeled nucleotide can be used to
determine the
sequence of both alleles at a particular SNP. SNPs for which the sequence can
be determined with
labeled ddGTP in the presence of unlabeled dATP, dTTP, and dCTP were chosen
for this example.
However, SNPs for which the sequence can be determined with labeled ddATP,
ddCTP or ddTTP
can also be used. Additionally, the SNPs to be analyzed can be chosen such
that all are labeled with
the same nucleotide or any combination of the four nucleotides. For instance,
if 400 SNPs are to be
screened, 100 can be chosen such that the sequence is determined with labeled
ddATP, 100 can be
chosen such that the sequence is determined with labeled ddTTP, 100 can be
chosen such that the
sequence is determined with labeled ddGTP, and 100 can be chosen such that the
sequence is
determined with labeled ddCTP, or any combination of the four labeled
nucleotides. .
Twenty-nine SNPs wherein the maternal DNA was homozygous were identified:
TSC0052277, TSC1225391, TSC0289078, TSC1349804, TSC0870209, TSC0194938,
TSC0820373,TSC0902859, TSCO501510, TSC1228234,TSC0082910,TSC0838335,
TSC0818982,TSC0469204, TSC 1084457, TSC0466177,TSC 1270598,TSC 1002017,
TSC1104200,TSC0501389, TSC0039960, TSC0418134,TSC0603688,TSC0129188,
TSC1103570,TSC0813449, TSC0701940, TSC0087962,TSC0660274.Heterozygous
and
SNPs will vary from individual to individual.
Design of Multiplex Primers
A low copy number of fetal genomes typically is present in the maternal
plasma. To
increase the copy number of the loci of interest located on chromosome 13,
primers were designed
to anneal at approximately 130 bases upstream and 130 bases downstream of each
loci of interest.
This was done to reduce statistical sampling error that can occur when working
with a low number
of genomes, which can influence the ratio of one allele to another (see
Example 11). The primers
were 12 bases in length. However, primers of any length can be used including
but not limited to 2,
3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23,
24, 25, 26, 27, 28, 29, 30, 31,
32, 33, 34, 35, 36-45, 46-55, 56-65, 66-75, 76-85, 86-95, 96-105, 106-115, 116-
125, and greater
than 125 bases. Primers were designed to anneal to both the sense strand and
the antisense strand.
The primers were designed to terminate at the 3' end in the dinucleotide "AA"
to reduce the
formation of primer-dimers. However, the primers can be designed to end in any
of the four
nucleotides and in any combination of the four nucleotides.
241
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
The multiplex primers for SNPTSC0052277 were
Forward primer:
5' GACATGTTGGAA 3'
Reverse primer:
~ 5' AGTTCCAGTTAA 3'
The multiplex primers for SNP TSC1225391 were:
Forward primer:
5' GTTTCCTGTTAA 3'
Reverse primer
5' CGATGATGACAA 3'
The multiplex primers for SNP TSC0289078 were:
Forward primer
5' GAGTAGAGACAA 3'
Reverse primer
5' TCCCGGATACAA 3'
The multiplex primes for SNP TSC 1349804 were:
Forward primer:
242
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
5' CATCCTCTAGAA 3'
Reverse primer:
5' TATTCCTGAGAA 3'
The multiplex primers for SNP TSC0870209 were:
Forward primer:
5' AGTTTGTTTTAA 3'
Reverse primer:
5' TATAAACGATAA 3'
The multiplex primers for SNP TSC0194938 were:
Forward primer:
5' TTTGACCGATAA 3'
Reverse primer:
5' TGACAGGACCAA 3'
The multiplex primers for SNP TSC0820373 were:
Forward primer:
5' TTATTCATTCAA 3'
Reverse primer:
3 5 5' AGTTTTTCACAA 3'
243
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
The multiplex primers for SNP TSC0902859 were:
Forward primer:
5' CACCTCCCTGAA 3'
Reverse primer:
5' CCAGATTGAGAA 3'
The multiplex primers for SNP TSCO501510 were:
Forward primer:
5' TGTGTCCACCAA 3'
Reverse primer:
5' CTTCTATTCCAA 3'
The multiplex primers for SNP TSC 1228234 were:
Forward primer:
5' TCACAATAGGAA 3'
Reverse primer:
5' TACAAGTGAGAA 3'
The multiplex primers for SNP TSC0082910 were:
Forward primer:
244
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
5' GAGTTTTCGTAA 3'
Reverse primer:
5' GTGTGCCCCCAA 3'
The multiplex primers for SNP TSC0838335 were:
Forward primer:
5' GCACCACTGCAA 3'
Reverse primer:
5' GAACACAATGAA 3'
The multiplex primers for SNP TSC0818982 were:
Forward primer:
5' TATCCTATTCAA 3'
Reverse primer:
5' CAACCATTATAA 3'
The multiplex primers for SNP TSC0469204 were:
Forward primer:
5' TATGCTTTACAA 3'
Reverse primer:
245
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
5' TTTGTTTACCAA 3'
The multiplex primers for SNP TSC1084457 were:
Forward primer:
5' AGGAAATTAGAA 3'
Reverse primer:
5' TGTTAGACTTAA 3'
The multiplex primers for SNP TSC0466177 were:
Forward primer:
5' TATTTGGAGGAA 3'
Reverse primer:
5' GGCATTTGTCAA 3'
The multiplex primers for SNP TSC1270598 were:
Forward primer:
5' ATACTCCAGGAA 3'
Reverse primer:
5' CAGCCTGGACAA 3'
The multiplex primers for SNP TSC 1002017 were:
Forward primer:
246
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
5' CCATTGCAGTAA 3'
Reverse primer:
5' AGGTTCTCATAA 3'
The multiplex primers for SNP TSC1104200 were:
Forward primer:
5' TGTCATCATTAA 3'
Reverse primer:
5' TGGTATTTGCAA 3'
The multiplex primers for SNP TSC0501389 were:
Forward primer:
5' TAGGGTTTGTAA 3'
Reverse primer:
5' CCCTAAGTAGAA 3'
The multiplex primers for SNP TSC0039960 were:
Forward primer:
5' GTATTTCTTTAA 3'
Reverse primer:
247
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
5' GAGTCTTCCCAA 3'
The multiplex primers for SNP TSC0418134 were:
Forward primer:
5' CAGGTAGAGTAA 3'
Reverse primer:
5' ATAGGATGTGAA 3'
The multiplex primers for SNP TSC0603688 were:
Forward primer:
5' CAATGTGTATAA 3'
Reverse primer:
5' AGAGGGCATCAA 3'
The multiplex primers for SNP TSC0129188 were:
Forward primer:
5' CCAGTGGTCTAA 3'
Reverse primer:
5' TAAACAATAGAA 3'
The multiplex primers for SNP TSC1103570 were:
248
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Forward primer:
5' GCACACTTTTAA 3'
Reverse primer:
5' ATGGCTCTGCAA 3'
The multiplex primers for SNP TSC0813449 were:
Forward primer:
5' GTCATCTTGTAA 3'
Reverse primer:
5' TGCTTCATCTAA 3'
The multiplex primers for SNP TSC0701940 were:
Forward primer:
5'AGAAAGGGGCAA3'
Reverse primer:
5' CTTTTCTTTCAA 3'
The multiplex primers for SNP TSC0087962 were:
Forward primer:
5' CTACTCTCTCAA 3'
Reverse primer:
249
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
5' ACAGCATTATAA 3'
The multiplex primers for SNP TSC0660274 were:
Forward primer:
5' ACTGCTCTGGAA 3'
Reverse primer:
5' GCAGAGGCACAA 3'
Multiplex PCR
Regions on chromosome 13 surrounding the above-mentioned 29 SNPs were
amplified
from the template genomic DNA using the polymerase chain reaction (PCR, LT.S.
Patent Nos.
4,683,195 and 4,683,202, incorporated herein by reference). This PCR reaction
used primers that
annealed approximately 150 bases upstream and downstream of each loci of
interest. The fifty-
eight primers were mixed together and used in a single reaction to amplify the
template DNA. This
reaction was done to increase the number of copies of the loci of interest,
which eliminates error
generated from a low number of genomes.
For increased specificity, a "hot-start" PCR reaction was used. PCR reactions
were
performed using the HotStarTaq Master Mix Kit supplied by QIAGEN (catalog
number 203443).
The amount of template DNA and primer per reaction can be optimized for each
locus of interest.
In this example, the 20 p,l of plasma template DNA was used.
Two microliters of each forward and reverse primer, at concentrations of 5 mM
were
pooled into a single microcentrifuge tube and mixed. Four microliters of the
primer mix was used
in a total PCR reaction volume of 50 p,l (20p.1 of template plasma DNA, 1 p,l
of sterile water, 4 p,l of
primer mix, and 25 pl of HotStar Taq. Twenty-five cycles of PCR were
performed. The following
PCR conditions were used:
(1) 95°C for 15 minutes;
(2) 95°C for 30 second;
(3) 4°C for 30 seconds;
(4) 37°C for 30 seconds;
250
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
(5) Repeat steps 2-4 twenty-four (24) times;
(6) 72°C for 10 minutes.
The temperatures and times for denaturing, annealing, and extension, can be
optimized by
trying various settings and using the parameters that yield the best results.
Other methods of genomic amplification can also be used to increase the copy
number of
the loci of interest including but not limited to primer extension
preamplification (PEP) (Zhang et
al., PNAS, 89:5847-51, 1992), degenerate oligonucleotide primed PCR (DOP-PCR)
(Telenius, et
al., Genomics 13:718-25, 1992), strand displacement amplification using DNA
polymerase from
bacteriophage 29, which undergoes rolling circle replication (Dean et al.,
Genomic Research
11:1095-99, 2001), multiple displacement amplification (U.S. Patent
6,124,120), REPLI-gT"" Whole
Genome Amplification kits, and Tagged PCR.
Purification of Fragment of Interest
The unused primers, and nucleotides were removed from the reaction by using
Qiagen
MinElute PCR purification kits (Qiagen, Catalog Number 28004). The reactions
were performed
following the manufacturer's instructions supplied with the columns. The DNA
was eluted in 100
p,l of sterile water.
PCR Reaction Two
Design of Primers
SNPTSC0052277 was amplified using the following primer set:
First primer:
5'CTCCGTGGTATGGAATTCCACTCAAATCTTCATTCAGA3'
Second primer:
5' ACGTCGGGTTACGGGACACCTGATTCCTC 3'
SNP TSC1225391 was amplified using the following primer set:
251
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
First primer:
5'TACCATTGGTTTGAATTCTTGTTTCCTGTTAACCATGC3'
Second primer:
5'GCCGAGTTCTACGGGACAGAAAAGGGAGC3'
SNP TSC0289078 was amplified using the following primer set:
First primer:
5'TGCAGTGATTTCGAATTCGAGACAATGCTGCCCAGTCA3'
Second primer:
5'TCTAAATTCTCTGGGACCATTCCTTCAAC3'
SNP TSC1349804 was amplified using the following primer set:
First primer:
5'ACTAACAGCACTGAATTCCATGCTCTTGGACTTTCCAT3'
Second primer:
5'TCCCCTAACGTTGGGACACAGAATACTAC3'
SNP TSC0870209 was amplified using the following primer set:
First primer:
5'GTCGACGATGGCGAATTCCTGCCACTCATTCAGTTAGC3'
Second primer:
252
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
5'GAACGGCCCACAGGGACCTGGCATAACTC3'
SNP TSC0194938 was amplified using the following primer set:
First primer:
5'TCATGGTAGCAGGAATTCTGCTTTGACCGATAAGGAGA3'
Second primer:
5'ACTGTGGGATTCGGGACTGTCTACTACCC3'
SNP TSC0820373 was amplified using the following primer set:
First primer:
5'ACCTCTCGGCCGGAATTCGGAAAAGTGTACAGATCATT3'
Second primer:
5'GCCGGATACGAAGGGACGGCTCGTGACTC3'
SNP TSC0902859 was amplified using the following primer set:
First primer:
5'CCGTAGACTAAAGAATTCCCTGATGTCAGGCTGTCACC3'
Second primer:
5'ATCGGATCAGTCGGGACGGTGTCTTTGCC3'
SNP TSCO501510 was amplified using the following primer set:
253
CA 02517017 2005-08-24
WO
2004/079011
PCT/US2003/027308
First primer:
5' GCATAGGCGGGAGAATTCCCTGTGTCCACCAAAGTCGG3'
Second primer:
5' CCCACATAGGGCGGGACAAAGAGCTGAAC3'
SNP TSC1228234 was amplified using the following primer
set:
First primer:
5' GGCTTGCCGAGCGAATTCTAGGAAAGATACGGAATCAA3'
Second primer:
5' TAACCCTCATACGGGACTTTCATGGAAGC3'
SNP TSC0082910 was amplified using the following primer
set:
First primer:
5' ATGAGCACCCGGGAATTCTGATTGGAGTCTAGGCCAAA3'
Second primer:
5' TGCTCACCTTCTGGGACGTGGCTGGTCTC3'
SNP TSC0838335 was amplified using the following primer
set:
First primer:
5' ACCGTCTGCCACGAATTCTGGAAAACATGCAGTCTGGT3'
Second primer:
254
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
5'TACACGGGAGGCGGGACAGGGTGATTAAC3'
SNP TSC0818982 was amplified using the following primer set:
First primer:
S'CTTAAAGCTAACGAATTCAGAGCTGTATGAAGATGCTT3'
Second primer:
5'AACGCTAAAGGGGGGACAACATAATTGGC3'
SNP TSC0469204 was amplified using the following primer set:
IS
First primer:
5'TTGTAAGAACGAGAATTCTGCAACCTGTCTTTATTGAA3'
Second primer:
5'CTTCACCACTTTGGGACACTGAAGCCAAC3'
SNP TSC1084457 was amplified using the following primer set:
First primer:
5'AACCATTGATTTGAATTCGAAATGTCCACCAAAGTTCA3'
Second primer:
5'TGTCTAGTTCCAGGGACGCTGTTACTTAC3'
SNP TSC0466177 was amplified using the following primer set:
255
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
First primer:
5'CGAAGGTAATGTGAATTCTGCCACAATTAAGACTTGGA3'
Second primer:
5' ATACCGGTTTTCGGGACAGATCCATTGAC 3'
SNP TSC1270598 was amplified using the following primer set:
First primer:
5'CCTGAAATCCACGAATTCCACCCTGGCCTCCCAGTGCA3'
Second primer:
5'TAGATGGTAGGTGGGACAGGACTGGCTTC 3'
SNP TSC 1002017 was amplified using the following primer set:
First primer:
5'GCATATCTTAGCGAATTCCTGTGACTAATACAGAGTGC3'
Second primer:
5'CCAAATATGGTAGGGACGTGTGAACACTC3'
SNP TSC 1104200 was amplified using the following primer set:
First primer:
5'TGCCGCTACAGGGAATTCATATGGCAGATATTCCTGAA3'
Second primer:
256
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
S'ACGTTGCGGACCGGGACTTCCACAGAGCC3'
SNP TSC0501389 was amplified using the following primer set:
S
First primer:
5'CTTCGCCCAATGGAATTCGGTACAGGGGTATGCCTTAT3'
Second primer:
5'TGCACTTCTGCCGGGACCAGAGGAGAAAC3'
SNP TSC0039960 was amplified using the following primer set:
First primer:
5'TGTGGGTATTCTGAATTCCACAAAATGGACTAACACGC3'
Second primer:
5'ACGTCGTTCAGTGGGACATTAAAAGGCTC3'
SNP TSC0418134 was amplified using the following primer set:
First primer:
5' GGTTATGTGTCAGAATTCTGAAACTAGTTTGGAAGTAC 3'
Second primer:
5' GCCTCAGTTTCGGGGACAGTTCTGAGGAC 3'
SNP TSC0603688 was amplified using the following primer set:
257
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
.__. ..... ...,. ...,. . ......, ,.. ."" t.", .a".
First primer:
5'TGTAACACGGCCGAATTCCTCATTTGTATGAAATAGGT3'
Second primer:
5'AATCTAACTTGAGGGACCGGCACACACAC3'
SNP TSC0129188 was amplified using the following primer set:
First primer:
5'AGTGTCCCCTTAGAATTCGCAGAGACACCACAGTGTGC3'
Second primer:
5'TTTGCTACAGTCGGGACCCTTGTGTGCTC3'
SNP TSC1103570 was amplified using the following primer set:
First primer:
5'AGCACATCAGTAGAATTCAATACCATGTGTGAGCTCAA3'
Second primer:
5' AATCCTGCTTCCGGGACCTAACTTTGAAC 3'
SNP TSC0813449 was amplified using the following primer set:
First primer:
5'TTTCATTTTCTGGAATTCCTCTAATGATTTTCTGGAGC3'
Second primer:
258
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
5'CGTCGCCGCGTAGGGACTTTTTCTTCCAC3'
SNP TSC0701940 was amplified using the following primer set:
First primer:
5'TTACTTAATCCTGAATTCGAGAAAAGCCATGTTGATAA3'
Second primer:
5'TCATGGGTCGCTGGGACTTTGCCCTCTGC3'
SNP TSC0087962 was amplified using the following primer set:
First primer:
5'ACTAACAGCACTGAATTCATTTTACTATAATCTGCTAC3'
Second primer:
5'GTTAGCCGAGAAGGGACTGTCTGTGAAGC3'
SNP TSC0660274 was amplified using the following primer set:
First primer:
5'AAATATGCAGCGGAATTCGTAAGTGACCTATTAATAAC3'
Second primer:
5'GCGATGGTTACGGGGACAGCCAGGCAACC3'
Each first primer had a biotin tag at the 5' end and contained a restriction
enzyme
recognition site for EcoRI, and was designed to anneal at a specified distance
from the locus of
interest. This allows a single reaction to be performed for the loci of
interest, as each loci of interest
259
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
will migrate at a distinct position (based on annealing position of first
primer). The second primer
contained a restriction enzyme recognition site for BsmF I.
All loci of interest were amplified from the multiplexed template DNA using
the
polymerase chain reaction (PCR, U.S. Patent Nos. 4,683,195 and 4,683,202,
incorporated herein by
reference). In this example, the loci of interest were amplified in separate
reaction tubes but they
could also be amplified together in a single PCR reaction. For increased
specificity, a "hot-start"
PCR was used. PCR reactions were performed using the HotStarTaq Master Mix Kit
supplied by
QIAGEN (catalog number 203443).
The amount of multiplexed template DNA and primer per reaction can be
optimized for
each locus of interest. One microliter of the multiplexed template DNA eluted
from the MinElute
column was used in the PCR reaction for each locus of interest, and 5 wM of
each primer was used.
The twenty-nine SNPs described above also were amplified from the maternal DNA
(15 ng of DNA
was used in the PCR reaction; primer concentrations were as stated above).
Forty cycles of PCR
were performed. The following PCR conditions were used:
(1) 95°C for 15 minutes and 15 seconds;
(2) 37°C for 30 seconds;
(3) 95°C for 30 seconds;
(4) 57°C for 30 seconds;
(5) 95°C for 30 seconds;
(6) 64°C for 30 seconds;
(7) 95°C for 30 seconds;
(8) Repeat steps 6 and 7 thirty nine (39) times;
(9) 72°C for 5 minutes.
In the first cycle of PCR, the annealing temperature was about the melting
temperature of
the 3' annealing region of the second primers, which was 37°C. The
annealing temperature in the
second cycle of PCR was about the melting temperature of the 3' region, which
anneals to the
template DNA, of the first primer, which was 57°C. The annealing
temperature in the third cycle of
PCR was about the melting temperature of the entire sequence of the second
primer, which was
64°C. The annealing temperature for the remaining cycles was
64°C. Escalating the annealing
temperature from TMl to TM2 to TM3 in the first three cycles of PCR greatly
improves specificity.
These annealing temperatures are representative, and the skilled artisan will
understand the
annealing temperatures for each cycle are dependent on the specific primers
used.
The temperatures and times for denaturing, annealing, and extension, can be
optimized by
trying various settings and using the parameters that yield the best results.
In this example, the first
primer was designed to anneal at various distances from the locus of interest.
The skilled artisan
260
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
understands that the annealing location of the first primer can be 5-10, 11-
15, 16-20, 21-25, 26-30,
31-35, 36-40, 41-45, 46-50, 51-55, 56-60, 61-65, 66-70, 71-75, 76-80, 81-85,
86-90, 91-95, 96-100,
101-105, 106-110, 111-115, 116-120, 121-125, 126-130, 131-140, 140-160, 160-
180, 180-200,
200-220, 220-240, 240-260. 260-280. 280-300, 300-350, 350-400, 400-450, 450-
500, or greater
than 500 bases from the locus of interest.
Purification of Fragment of Interest
The PCR products were separated from the genomic template DNA. Each PCR
product
was. placed into a well of a Streptawell, transparent, High-Bind plate from
Roche Diagnostics
GmbH (catalog number 1 645 692, as listed in Roche Molecular Biochemicals,
2001 Biochemicals
Catalog). Alternatively, the PCR products can be pooled into a single well
because the first primer
was designed to allow the loci of interest to separate based on molecular
weight. The first primers
contained a 5' biotin tag so the PCR products bound to the Streptavidin coated
wells while the
genomic template DNA did not. The streptavidin binding reaction was performed
using a
Thermomixer (Eppendorf) at 1000 rpm for 20 min. at 37°C. Each well was
aspirated to remove
unbound material, and washed three times with 1X PBS, with gentle mixing
(Kandpal et al., Nucl.
Acids Res. 18:1789-1795 (1990); Kaneoka et al., Bioteclmiques 10:30-34 (1991);
Green et al.,
Nucl. Acids Res. 18:6163-6164 (1990)).
Restriction Enzyme Digestion of Isolated Fragments
The purified PCR products were digested with the restriction enzyme BsmF I,
which binds
to the recognition site incorporated into the PCR products from the second
primer. The digests
were performed in the Streptawells following the instructions supplied with
the restriction enzyme.
After digestion, the wells were washed three times with PBS to remove the
cleaved fragments.
Incorporation of Labeled Nucleotide
The restriction enzyme digest with BsmF I yielded a DNA fragment with a 5'
overhang,
which contained the SNP site or locus of interest and a 3' recessed end. The
5' overhang functioned
as a template allowing incorporation of a nucleotide or nucleotides in the
presence of a DNA
polymerase.
As demonstrated in Example 6, the sequence of both alleles of a SNP can be
determined by
filling in the overhang with one labeled nucleotide in the presence of the
other unlabeled
nucleotides. The following components were added to each fill in reaction: 1
wl of fluorescently
261
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
labeled ddGTP, 0.5 wl of unlabeled ddNTPs ( 40 pM), which contained all
nucleotides except
guanine, 2 pl of lOX sequenase buffer, 0.25 p.l of Sequenase, and water as
needed for a 20p1
reaction. The fill in reaction was performed at 40°C for 10 min. Non-
fluorescently labeled ddNTP
was purchased from Fermentas Inc. (Hanover, MD). All other labeling reagents
were obtained
from Amersham (Thermo Sequenase Dye Terminator Cycle Sequencing Core Kit, US
79565).
After labeling, each Streptawell was rinsed with 1X PBS (100 p,l) three times.
The "filled
in" DNA fragments were then released from the Streptawells by digestion with
the restriction
enzyme EcoRI, according to the manufacturer's instructions that were supplied
with the enzyme.
Digestion was performed for 1 hour at 37 °C with shaking at 120
rpm.
Detection of the Locus of Interest
After release from the streptavidin matrix, the sample was loaded into a lane
of a 36 cm 5%
acrylamide (urea) gel (BioWhittaker Molecular Applications, Long Ranger Run
Gel Packs, catalog
number 50691). The sample was electrophoresed into the gel at 3000 volts for 3
min. The gel was
run for 3 hours on a sequencing apparatus (Hoefer SQ3 Sequencer). The gel was
removed from the
apparatus and scanned on the Typhoon 9400 Variable Mode Imager. The
incorporated labeled
nucleotide was detected by fluorescence.
Below a schematic of the 5' overhang for SNP TSC0838335 is depicted. The
entire
sequence is not reproduced, only a portion to depict the overhang (where R
indicates the variable
site).
10114 5' TAA
3' ATT R A C A
Overhang position 1 2 3 4
The observed nucleotides for TSC0838335 are adenine and guanine on the 5'
sense strand
(herein depicted as the top strand). The nucleotide in position three of the
overhang corresponded
to cytosine, which is complementary to guanine. Labeled ddGTP can be used to
determine the
sequence of both allele in the presence of unlabeled dATP, dCTP, and dTTP.
The restriction enzyme BsmF I was used to create the 5' overhang, which
typically cuts
10/14 from the recognition site. At times, BsmF I will cut 11/15 from the
recognition site and
generate the following overhang:
11/15 5' TA
262
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
3' AT T R A C
Overhang position 0 1 2 3
Position 0 in the overhang is thyrnidine, which is complementary to adenine.
Position 0
complementary to the overhang was filled in with unlabeled dATP, and thus
after the fill-in
reaction, the exact same molecules were generated whether the enzyme cut at
10/14 or 11115 from
the recognition site. The DNA molecules generated after the fill-in reaction
are depicted below:
G allele 10114 5' TAA G*
3' ATT C A C A ,
Overhang position 1 2 3 4
G allele 11/15 5' TA A G*
3'AT T C A C
Overhang position 0 1 2 3
A allele 10114 5' TAA A T G
3' ATT T A C A
Overhang position 1 2 3 4
A allele 11/15 5' TA A A T G*
3' AT T T A C
Overhang position 0 1 2 3
The maternal template DNA amplified for TSC0838335 displayed a single band
that
migrated at the expected position of the higher molecular weight band, which
corresponded to the
"A" allele (see FIG. 20, lane 1). The maternal template DNA was homozygous for
adenine at SNP
TSC0838335.
However, in lane 2, amplification of the multiplexed template DNA for
TSC0838335
isolated from the plasma of the same individual displayed two bands; a lower
molecular weight
band, which corresponded to the "G" allele, and the higher molecular weight
band, which
corresponded to the "A" allele. The template DNA isolated from the plasma of a
pregnant female
contains both maternal template DNA and fetal template DNA.
As seen in FIG. 20, lane 1, the maternal template DNA was homozygous for
adenine at this
SNP (compare lanes 1 and 2). The "G" allele represented the fetal DNA. Signals
from the
263
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
maternal template DNA and the fetal template DNA clearly have been
distinguished. The "G"
allele becomes a beacon fox the fetal DNA and can be used to measure the
amount of fetal DNA
present in the sample. Additionally, once the percentage of fetal DNA in the
maternal plasma for a
given sample has been determined, any deviation from this percentage indicates
a chromosomal
abnormality. This method provides the first non-invasive method for the
detection of fetal
chromosomal abnormalities.
As seen in FIG. 20, lane 3, analysis of the maternal DNA for SNP TSC0418134
generated a
single band that migrated at the expected position of the higher molecular
weight band, which
corresponded to the adenine allele. Likewise, analysis of the multiplexed
template DNA isolated
from the maternal plasma gave a single band, which migrated at the expected
position of the
adenine allele (see FIG. 20, lane 4). Both the maternal DNA and the fetal DNA
are homozygous
for adenine at TSC0418134.
Below, a schematic of the 5' overhang for TSC0129188 is depicted, wherein R
indicates
the variable site:
10/14 5' TCAT
3' AGTA R A C T
Overhang position 1 2 3 4
The nucleotide upstream of the variable site (R) does not correspond to
guanine on the
sense strand. Thus, the 5' overhang generated by the 11/15 cutting properties
of BsmF I will be
filled-in identically to the 5'overhang generated by the 10/14 cut. Labeled
ddGTP in the presence
of unlabeled dATP, dTTP, and dCTP was used for the fill-in reaction. The DNA
molecules
generated after the fill-in reaction are depicted below:
A allele 10/14 5' TCAT A T G*
3' AGTA T A C T
Overhang position 1 2 3 4
G allele 10/14 5' TCAT G*
3' AGTA C A C T
Overhang position 1 2 3 4
Analysis of the maternal DNA for SNP TSC0129188 gave a single band that
corresponded
to the DNA molecules filled in with ddGTP at position 1 complementary to the
overhang, which
264
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
represented the "G" allele (see FIG. 20, lane 5). No band was detected for
adenine allele, indicating
that the maternal DNA is homozygous for guanine.
In contrast, analysis of the multiplexed template DNA from the maternal
plasma, which
contains both maternal DNA, and fetal DNA, gave two distinct bands (see FIG.
20, lane 6). The
lower molecular weight band corresponded to the "G" allele, while the higher
molecular weight
corresponded to the "A" allele. The "A" allele represents the fetal DNA. Thus,
a method has been
developed that allows separation of maternal DNA and fetal DNA signals without
the added
complexity of having to isolate fetal cells. In addition, a sample of paternal
DNA is not required to
detect differences between the maternal DNA and the fetal DNA.
Analysis of the maternal DNA for SNP TSC0501389 gave a single band that
migrated at
the higher molecular weight position, which corresponded to the "A" allele. No
band was detected
that corresponded to the "G" allele. Similarly, analysis of the multiplexed
template DNA from the
maternal plasma for SNP TSC0501389 gave a single band that migrated at the
higher molecular
weight position, which~corresponded to the "A" allele. Both the maternal
template DNA and the
fetal template DNA were homozygous for adenine at SNP TSC0501389.
The maternal DNA and the template DNA from the plasma originated from the same
sample. One sample, which was obtained through a non-invasive procedure,
provided a genetic
fingerprint for both the mother and the fetus.
Of the twenty-nine SNPs for which the maternal template DNA was homozygous,
the fetal
template DNA was heterozygous at two of the twenty-nine SNPs. The fetal DNA
was homozygous
for the same allele as the maternal template DNA at the remaining 27 SNPs
(data not shown).
Comparing the homozygous allele of the maternal template DNA and the plasma
template DNA at
a given SNP provides an added level of quality control. It is not possible
that the maternal template
DNA and the plasma template DNA are homozygous for different alleles at the
same SNP. If this
is seen, it would indicate that an error in processing had occurred.
The methods described herein demonstrate that the maternal genetic signal can
be separated
and distinguished from the fetal genetic signal in a maternal plasma sample.
The above-example
analyzed SNPs located on chromosome 13, however any chromosome can be analyzed
including
human chromosome 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,
18, 19, 20, 21, 22, X and
Y and fetal chromosomes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, 20, 21, 22, X
and Y.
In addition, the methods described herein can be used to detect fetal DNA in
any biological
sample including but not limited to cell, tissue, blood, serum, plasma,
saliva, urine, tears, vaginal
secretions, umbilical cord blood, chorionic villi, amniotic fluid, embryonic
tissues, lymph fluid,
cerebrospinal fluid, mucosa secretions, peritoneal fluid, ascitic fluid, fecal
matter, or body exudates.
265
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
The methods described herein demonstrate that the percentage of fetal DNA in
the maternal
sample can be determined by analyzing SNPs wherein the maternal DNA is
homozygous, and the
DNA isolated from the plasma of the pregnant female is heterozygous. The
percentage of fetal
DNA can be used to determine if the fetal genotype has any chromosomal
disorders.
For example, if the percentage of fetal DNA present in the sample is
calculated to be 30%
by analysis of chromosome 1 (chromosomal abnormalities involving chromosome 1
terminate early
in the pregnancy), then any deviation from 30% fetal DNA is indicative of a
chromosomal
abnormality. For example, if upon analysis of a SNP or multiple SNPs on
chromosome 18, the
percentage of fetal DNA is higher than 30%, this would indicate that an
additional copy of
chromosome 18 is present. The calculated percentage of fetal DNA from any.
chromosome can be
compared to any other chromosome. In particular, the percentage of fetal DNA
on chromosome 13
can be compared to the percentage of fetal DNA on chromosomes .18 and 21.
This analysis is assisted by knowledge of the expected ratio of one allele to
the other allele
at each SNP. As discussed in Example 9, not all heterozygous SNPs display
ratios of 50:50.
Knowledge of the expected ratio of one allele to the other reduces the overall
number of variable
sites that must be analyzed. However, even without knowledge of the expected
ratios for the
various SNPs, the percentage of fetal DNA can be calculated by analyzing a
large number of SNPs.
When the sampling size of SNPs is large enough, the statistical variation
arising from the values of
the expected ratios will be eliminated.
In addition, heterozygous maternal SNPs also provide valuable information. The
analysis
is not limited to homozygous maternal SNPs. Fox example, if at a heterozygous
SNP on maternal
.DNA, the ratio of allele 1 to allele 2 is 1:1, then in the plasma template
DNA the ratio should remain
1:1 unless the fetal DNA carries a chromosomal abnormality.
The above methods can also be used to detect mutations in the fetal DNA
including but not
limited to point mutations, transitions, transversions, translocations,
insertions, deletions, and
duplications. As seen in FIG. 20, fetal DNA can readily be distinguished from
maternal DNA. The
above methods can be used to determine the sequence of any locus of interest
for any gene.
EXAMPLE 14
Plasma isolated from blood of a pregnant female contains both maternal
template DNA and
fetal template DNA. As discussed above, fetal chromosomal abnormalities can be
determined by
266
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
analyzing SNPs wherein the maternal template DNA is homozygous and the
template DNA
obtained from the plasma displays a heterozygous pattern.
For example, assume SNP X can either be adenine or guanine, and the maternal
DNA for
SNP X is homozygous for guanine. The labeling method described in Example 6
can be used to
determine the sequence of the DNA in the plasma sample. If the plasma sample
contains fetal
DNA, which is heterozygous at SNP X, the following DNA molecules are expected
after digestion
with the type IIS restriction enzyme BsmF I, and the fill-in reaction with
labeled ddGTP, unlabeled
dATP, dTTP, and dCTP.
Maternal Allele 1 5' GGGT G*
3'CCCA C T C A
Maternal Allele 2 5' GGGT G*
3'CCCA C T C A
Fetal Allele 1 5' GGGT GX
3'CCCA C T C A
Fetal Allele 2 5' GGGT A A G*
3'CCCA T T C A
Two signals are seen; one signal corresponds to the DNA molecules filled in
with ddGTP at
position one complementary to the overhang and the second signal corresponds
to the DNA
molecules filled in with ddGTP at position three complementary to the
overhang. However, the
maternal DNA is homozygous for guanine, which .corresponds to the DNA
molecules filled in at
position one complementary to the overhang. The signal from the DNA molecules
filled in with
ddGTP at position three complementary to the overhang corresponds to the
adenine allele, which
represents the fetal DNA. This signal becomes a beacon for the fetal DNA, and
can used to
measure the amount of fetal DNA present in the plasma sample.
There is no difference in the amount of fetal DNA from one chromosome to
another. For
instance, the percentage of fetal DNA in any given individual from chromosome
1 is the same as
the percentage of fetal DNA from chromosome 2, 3, 4, 5, 6, 7, 8, 9, 10, 11,
12, 13, 14, 15, 16, 17,
18, 19, 20, 21, 22, X and Y. Thus, the allele ratio calculated for SNPs on one
chromosome can be
compared to the allele ratio for the SNPs on another chromosome.
267
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
For example, the allele ratio for the SNPs on chromosome 1 should be equal to
the allele
ratio for the SNPs on chromosomes 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20,
21, 22, X, and Y. However, if the fetus has a chromosomal abnormality,
including but not limited
to a trisomy or monosomy, the ratio for the chromosome that is present in an
abnormal copy
number will differ from the ratio for the other chromosomes.
To recapitulate the in vivo scenario of blood from a pregnant female, maternal
DNA was
mixed with DNA isolated from her child, who previously was diagnosed with
Trisomy 21, in
various ratios to represent varying percentages of fetal DNA. For example, to
replicate the in vivo
scenario of 50% fetal DNA in maternal blood, equal amounts of maternal DNA
were mixed with
DNA isolated from her child with Down's syndrome. The maternal DNA was
analyzed to identify
homozygous SNPs, and these SNPs then were. analyzed using the mixture of 50%
maternal DNA
and 50% Down's syndrome DNA. The ratio of allele 1 to allele 2 at heterozygous
SNPs on
chromosome 13 was compared to the ratio of allele 1 to allele 2 at
heterozygous SNPs on
chromosome 21.
Four different samples were analyzed: a sample with 100% of the DNA from a
child with
Down syndrome; a sample with 75% DNA from the child with Down syndrome and 25%
DNA
from the child's mother; a sample with 50% DNA from the child with Down
syndrome and 50%
DNA from the child's mother; and a sample with 40% DNA from the child with
Down syndrome
and 60% DNA from the child's mother. The maternal DNA was analyzed to identify
homozygous
SNPs. The DNA isolated from the child with Down syndrome was genotyped to
identify
heterozygous SNPs. Then, the samples were genotyped at SNPs where the maternal
DNA was
homozygous and the DNA from the child was heterozygous. For each sample, these
SNPs were
analyzed ten times.
Collection of Blood Samples
An Internal Review Board approved study was designed to allow collection of
blood
samples from children afflicted with Down's syndrome and their parents. For
this study, blood was
collected from the mother, the father, and the child with Down's syndrome.
Informed consent to
collect blood from the child with Down's syndrome was granted by the parents
as well as the child.
Blood was collected into 9 mi EDTA 'Vacuette tubes (catalog number NC9897284).
The tubes
were stored at 4°C until ready for processing.
Isolation of Plasma and Maternal Cells
The blood was stored at 4°C until processing. The tubes were spun at
1000 rpm for ten
minutes in a centrifuge with braking power set to zero. The tubes were spun a
second time at 1000
268
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
rpm for ten minutes. The supernatant (the plasma) of each sample was
transferred to a new tube
and spun at 3000 rpm for ten minutes with the brake set to zero. The
supernatant was transferred to
a new tube and stored at -80°C. Approximately two milliliters of the
"huffy coat," which contains
maternal cells, was placed into a separate tube and stored at -80°C.
Isolation of DNA
DNA was isolated from the plasma sample using the Qiagen Midi Kit for
purification of
DNA from blood cells, following the manufacturer's instructions (QIAmp DNA
Blood Midi Kit,
Catalog number 51183). DNA was eluted in 100 pl of distilled water. The Qiagen
Midi Kit also
was used to isolate DNA from the maternal cells contained in the "huffy coat."
Maternal DNA and
the plasma DNA were isolated from the same tube of blood.
Identification of Maternal Homozygous SNPs
The maternal DNA was genotyped to identify homozygous SNPs. Seven hundred and
sixty-eight SNPs on chromosome 13 and 768 SNPs on chromosome 21 were genotyped
using the
methods described in Example 6. Any number of SNPs can be analyzed, and the
SNPs can be
located on human chromosome 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21,
22, X and Y. Preferably, the SNPs that are genotyped have allele frequencies
of 50:50, 60:40,
70:30, 80:20, or 90:10. As described in Example 8, the allele frequency of any
given SNP can be
determined.
Details regarding the SNPs located on chromosome 13 and 21 can be found at the
SNP
consortium database, which can be accessed via the Internet at
http://wruw.snp.cshl.org. The
primers were designed following the procedures set fourth in the Examples
described above, for
example, in Examples l, 2, 3, 5, and 6.
The ftrst primers were designed so that after digestion with a Type Its
enzyme, the products
had different molecular weights as described in Example 6. This allowed the
amplified products to
be pooled, and run in a single lane of a gel.
For example, the first primer can be designed such that after digestion a 30
base pair
product is generated. Likewise, the first primer of a different locus of
interest can be designed such
that after digestion a 40 base pair product is generated. The first primers
can be designed so that in
a single reaction, numerous loci can be analyzed in one lane of a gel (30, 40,
50, 60, 70, 80, 90, 100,
110, and 120 base pair products can be run in a single lane). The first primer
can be designed to
anneal any distance from the locus of interest including but not limited to
between 5-10, 10-25,
269
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
25-50, 50-75, 75-100, 100-150, 150-200, 200-250, 250-300, 300-350, 350-400,
400-450, 450-500,
500-550, 550-600, 600-650, 650-700, 700-750, 750-800, 800-850, 850-900, 900-
950, 950-1000 and
greater than 1000 bases.
Amplification of the Loci of Interest
For each SNP that was genotyped, a PCR reaction was used to amplify the loci
of interest.
The PCR reactions were performed in 96-well plates. The first and second
primer (3 pl of 1.25 p,M
stock concentration) for each SNP was distributed into a well of a microtiter
plate. Eight 96-well
PCR plates were set-up for chromosome 21 and eight 96-well plates were set-up
for chromosome
13. After the primers had been distributed into the wells of the microtiter
plates, a mixture
containing the genomic DNA and HotStar PCR,reagents was added to each well.
Each PCR
reaction contained 3 pl of each .primer, 7.5 p,l of HotStar Taq Master mix,
0.5 pl of water, and 1 p,l
of genomic DNA (10 ng/pl).
The PCR cycling conditions were as follows:
(1) 95°C for 15 minutes and 15 seconds;
(2) 37°C for 30 seconds;
(3) 95°C for 30 seconds;
(4) 52°C for 30 seconds;
(5) 95°C for 30 seconds;
(6) 58°C for 30 seconds;
(7) 95°C for 30 seconds;
(8) Repeat steps 6 and 7 thirty seven (37) times;
(9) 72°C for 5 minutes.
Purification of Fragment of Interest
After the PCR reaction, 3 pl of a PCR product generated with a first primer
designed to
produce a 30 base pair product, 3 pl of a PCR product generated with a first
primer designed to
produce a 40 base pair product, 3 pl of a PCR product generated with a first
primer designed to
produce a 50 base pair product, 3 pl of a PCR product generated with a first
primer designed to
produce a 60 base pair product, 3 p,l of a PCR product generated with a first
primer designed to
produce a 70 base pair product, 3 pl of a PCR product generated with a first
primer designed to
produce a 80 base pair product, 3 pl of a PCR product generated with a first
primer designed to
produce a 90 base pair product, 3 p,l of a PCR product generated with a first
primer designed to
produce a 100 base pair product were mixed together in a well of a
Streptawell, transparent, High-
270
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Bind plate from Roche Diagnostics GmbH (catalog number 1 645 692, as listed in
Roche Molecular
Biochemicals, 2001 Biochemicals Catalog). The first primers contained a 5'
biotin tag so the PCR
products bound to the Streptavidin coated wells while the genomic template DNA
did not. The
streptavidin binding reaction was performed using a Thermomixer (Eppendorf) at
1000 rpm for 20
min. at 37°C. Each well was aspirated to remove unbound material, and
washed three times with
1X PBS, with gentle mixing (Kandpal et al., Nucl. Acids Res. 18:1789-1795
(1990); Kaneoka et al.,
Biotechniques 10:3x-34 (1991); Green et al., Nucl. Acids Res. 18:6163-6164
(1990)).
Restriction Enzyme Digestion of Isolated Fragments
The purified PCR products were digested with the restriction enzyme BsmF I,
which binds
to the recognition site incorporated into the PCR producu from the second
primer. The digests
were performed in the Streptawells following the instructions supplied with
the restriction enzyme.
After digestion, the wells were washed three times with PBS to remove the
cleaved fragments.
Incorporation of Labeled Nucleotide
The restriction enzyme digest with BsmF I yielded a DNA fragment with a 5'
overhang,
which contained the SNP site or locus of interest and a 3' recessed end. The
5' overhang functioned
as a template allowing incorporation of a nucleotide or nucleotides in the
presence of a DNA
polymerise. As discussed in detail in Example 6, a single nucleotide labeled
with one chemical
moiety can be used to determine the sequence at a SNP.
The amplified loci of interest were pooled into the streptavidin-well based on
size, and on
the nucleotide used in the fill-in reaction. The sequence of SNPs that were
determined by using a
guanine nucleotide were pooled together. Likewise, the sequence of SNPs that
were determined by
using an adenine nucleotide were pooled together; the sequence of SNPs that
were determined by
using a thymidine nucleotide were pooled together; and the sequence of SNPs
that were determined
by using a cytosine nucleotide were pooled together.
Thus, a typical fill-in reaction contained 8 amplified loci, ranging in size
of 30-120 base
pair products; the sequence of all eight was determined using a single
nucleotide labeled with one
chemical moiety. Any number of amplified loci can be pooled together.
The following components were added to each fill in reaction: 1 ~,l of
fluorescently labeled
dideoxynucleotide (ddGTP for G fill-in reactions; ddATP for A fill-in
reactions; ddTTP for
thymidine fill-in reactions; and ddCTP for cytosine fill-in reactions), 0,5
~.l of unlabeled dNTPs
~.M), which contained all nucleotides except the labeled nucleotide, 2 ~,l of
l OX sequenase
buffer, 0.25 ~.l of Sequenase, and water as needed for a 201 reaction.
271
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
The fill in reaction was performed at 40°C for 10 min. Non-
fluorescently labeled dNTP
was purchased from Fermentas Inc. (Hanover, MD). All other labeling reagents
were obtained
from Amersham (Thermo Sequenase Dye Terminator Cycle Sequencing Core Kit, US
79565).
After labeling, each Streptawell was rinsed with 1X PBS (100 pl) three times.
The "filled
in" DNA fragments were then released from the Streptawells by digestion with
the restriction
enzyme EcoRI, according to the manufacturer's instructions that were supplied
with the enzyme.
Digestion was performed for 1 hour at 37 °C with shaking at 120
rpm.
Detection of the Locus of Interest
After release from the streptavidin matrix, the sample was loaded into a lane
of a 36 cm 5%
acrylamide (urea) gel (BioWhittaker Molecular Applications, Long Ranger Run
Gel Packs, catalog
number 50691). The sample was electrophoresed into the gel at 3000 volts for 3
min. The gel was
run for 3 hours on a sequencing apparatus (Hoefer SQ3 Sequencer). The gel was
removed from the
apparatus and scanned on the Typhoon 9400 Variable Mode Imager. The
incorporated labeled
nucleotide was detected by fluorescence. The homozygous SNPs were identified.
Identification of Heterozygous SNPs with the Trisomy 21 template
The DNA isolated from the individual with Down syndrome (the child of the
mother who
was genotyped above) was analyzed to identify heterozygous SNPs. The same
seven hundred and
sixty-eight SNPs on chromosome 13 and the same 768 SNPs on chromosome 21 that
were analyzed
with the maternal DNA were genotyped using the methods described in Example 6.
Any number of
SNPs can be analyzed, and the SNPs can be located on human chromosome 1, 2, 3,
4~ 5, 6, 7, 8, 9,
10, 11, 12, 13, 14=, 15, 16, 17, 18, 19, 20, 21, 22, X or Y. Preferably, the
SNPs that are genotyped
have allele frequencies of 50:50, 60:40, 70:30, 80:20, or 90:10. As described
in Example 8, the
allele frequency of any given SNP can be determined.
The process for genotyping the SNPS with the DNA isolated from the individual
with
Down syndrome was as described for the maternal DNA. The heterozygous SNPs
were identified.
SNPs that were homozygous for the maternal DNA and heterozygous for the DNA
isolated
from the individual with Down syndrome were further analyzed using samples
that contained
mixtures of maternal DNA and Down syndrome DNA.
Generation of Samples containing maternal DNA and Down syndrome DNA
The DNA and the DNA obtained from her child, who has Down's syndrome, were
quantitated using a spectrophotometer. The maternal DNA and the child's DNA
were mixed
together at various percentages to represent the situation of circulating
fetal DNA in the maternal
272
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
blood. The following percentages were analyzed: 100% Down's syndrome DNA, 75%
Down's
syndrome DNA, 50% Down's syndrome DNA, and 40% Down's syndrome DNA.
The ratio at each heterozygous SNP was calculated by dividing the value
obtained for allele
1 by the value obtained for allele 2. For example, if SNP X can either be
adenine (A) or guanine
(G), the ratio at SNP X was calculated by dividing the value obtained for
adenine by the value
obtained for guanine.
For the sample containing 100% Down syndrome DNA, sixty-two SNPs on chromosome
13, which were homozygous with the maternal DNA and heterozygous with the DNA
isolated from
the individual with Down syndrome, were analyzed. For chromosome 21, forty-
nine SNPs were
analyzed that were homozygous with the maternal DNA and heterozygous with the
DNA isolated
from the individual with Down syndrome.
The 62 SNPs on chromosome 13 and 49 SNPs on chromosome 21 were analyzed ten
separate times. As shown in Table XX, for each of the ten trials, the ratio of
allele 1 to allele 2 on
chromosome 13 was approximately 1.0 as expected. For chromosome 13, there is
one copy of
allele 1 and one copy of allele 2. The average of the ten trials was 1.051
with a standard deviation
of 0.085.
With a Trisomy 21, there are two copies of one allele, which are usually
inherited from the
mother, and one copy of the other allele. The expected ratio is approximately
0.5 (one copy of
allele 1/ two copies of allele 2). As shown in Table XX, the ratio for
chromosome 21 varied from a
low of 0.462 to a high of 0.634. For every trial, the ratio obtained for
chromosome 21 was
significantly distinct from the ratio obtained at chromosome 13. The average
ratio for the ten trials
was 0.531 with a standard deviation of 0.049.
The experiment was repeated ten times so that a true statistical measurement
could be
obtained. If ten different genetic samples were used, the SNPs that fit the
criteria (maternal
homozygous, Down syndrome child heterozygous) would be different, making it
difficult to .
compare from sample to sample.
Statistical analysis revealed a confidence value of 99.9% that the ratios
obtained on
chromosome 13 and on chromosome 21 represented true differences, rather than
random numerical
fluctuations in value. The Ravgen method identified the presence of the
chromosomal abnormality.
For the sample containing 75% Down syndrome DNA and 25% maternal DNA, sixty
two
SNPS on chromosome 13 and fifty SNPs on chromosome 21 were analyzed, unless
stated
otherwise. For various trials, not all the SNPS could be quantitated because
the bands
corresponding to certain SNPs were faint. This may have been caused by poor
PCR amplification,
poor binding to the streptavidin plate, or a weak fill-in reaction.
273
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
For trial 3, 61 SNPs on chromosome 13 were analyzed. For trail 4, 49 SNPs were
analyzed
on chromosome 21. With regard to trial 5, 47 SNPs on chromosome 21 were
analyzed and 61
SNPs on chromosome 13. For trial 7, 49 SNPs were analyzed on chromosome 21 and
61 SNPs on
chromosome 13. For trial 8, 49 chromosomes were analyzed on chromosome 21, and
59 SNPs
were analyzed on chromosome 13. For trials 9 and 10, 59 SNPs on chromosome 13
were analyzed.
The expected ratio on chromosome 13 for a heterozygous SNP is 0.6. If the
maternal
chromosomes both contain an adenine nucleotide, and the Down syndrome genome
is comprised of
one chromosome with an adenine nucleotide and one chromosome with a guanine
nucleotide, then
the ratio of G:A is 0.75/ (.75 (Down syndrome A allele ) +0 .25 + 0.25
(maternal A alleles)), which
is 0.6. For the ten trials, the ratios obtained for chromosome 13 varied from
0.567 to 0.645. The
average for the ten trials was 0.609 with a standard deviationof 0.032 (see
Table XX).
The expected ratio for chromosome 21 in a Trisomy condition is 0.375. If the
maternal
chromosomes both contain an adenine nucleotide, and the Down syndrome genome
is comprised of
two chromosomes with an adenine nucleotide and one chromosome with a guanine
nucleotide, then
the ratio of G:A is 0.75/(0.75 + 0.75 (Down syndrome A alleles) + 0.25 + 0.25
(maternal A
alleles)), which is 0.375.
For the ten trials, the ratios obtained for chromosome 21 varied from 0.350 to
0.4125, with
an average of 0.384 and a standard deviation of 0.017 (see Table XX).
Statistical analysis revealed
a confidence value of 99.9% that the ratios obtained on chromosome 13 and on
chromosome 21
represented true differences, rather than random numerical fluctuations in
value. The Ravgen
method identified the presence of the chromosomal abnormality in the presence
of 25% maternal
DNA.
With regard to the sample containing 50% Down syndrome DNA, 46 SNPs on
chromosome 13 and 35 SNPs on chromosome 21 were analyzed, unless stated
otherwise. For trial
1, 45 SNPs on chromosome 13 were analyzed. For trail 2, 44. SNPs on chromosome
13 were
analyzed. For trial 3, 42 SNPs on chromosome 13 were analyzed. For trial 4, 44
SNPs on
chromosome 13 and 34 SNPs on chromosome 21 were analyzed. For trial 5, 34 SNPs
on
chromosome 21 were analyzed. For trials 7 and 8, 44 and 41 SNPs on chromosome
13,
respectively, were analyzed. For trial 9, 44 SNPs on chromosome 13 and 34 SNPs
on chromosome
21 were analyzed. For trial 10, 44 SNPs on chromosome 13 were analyzed.
The expected ratio at a heterozygous SNP on chromosome 13 for the 50% sample
is 0.33.
If the maternal chromosomes both contain an adenine nucleotide, and the Down
syndrome genome
is comprised of one chromosome with an adenine nucleotide and one chromosome
with a guanine
nucleotide, then the ratio of G:A is 0.50/ (.50 (Down syndrome A allele ) +0
.50 + 0.50 (maternal A
alleles)), which is 0.33. For the ten trials, the ratios obtained for
chromosome 13 varied from 0.302
274
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
to 0.347. The average for the ten trials was 0.324 with a standard deviation
of 0.013 (see Table
XX).
The expected ratio for chromosome 21 in a Trisomy condition is 0.25. If the
maternal
chromosomes both contain an adenine nucleotide, and the Down syndrome genome
is comprised of
two chromosomes with an adenine nucleotide and one chromosome with a guanine
nucleotide, then
the ratio of G:A is 0.50/(0.50 + 0.50 (Down syndrome A alleles) + 0.50 + 0.50
(maternal A
alleles)), which is 0.25.
For the ten trials, the ratios obtained for chromosome 21 varied from 0.230 to
0.275, with
an average of 0.244 and a standard deviation of 0.015 (see Table XX).
Statistical analysis revealed
a confidence value of 99.1% that the ratios obtained on chromosome 13 and on
chromosome 21
represented true differences, rather than random numerical fluctuations in
value. The Ravgen
method identified the presence of the chromosomal abnormality in the presence
of 50% maternal
DNA.
For the sample containing 40% Down syndrome DNA, 60 SNPs on chromosome 13 and
48
SNPs on chromosome 21 were analyzed, unless stated otherwise. For trial 1, 47
SNPs on
chromosome 21 were analyzed. For trials 2-4, 59 SNPs on chromosome 13 and 47
SNPs on
chromosome 21 were analyzed. For trials 5 and 6, 46 SNPs on chromosome 21 were
analyzed. For
trail 7, 58 SNPs on chromosome 13 were analyzed. For trial 8, 46 SNPs on
chromosome 21 were
analyzed and for trials 9 and 10, 47 SNPs on chromosome 21 were analyzed.
The expected ratio at a heterozygous SNP on chromosome 13 for the 40% Down
syndrome
DNA sample is 0.25. If the maternal chromosomes both contain an adenine
nucleotide, and the
Down syndrome genome is comprised of one chromosome with an adenine nucleotide
and one
chromosome with a guanine nucleotide, then the ratio of G:A is 0.40/ (.40
(Down syndrome A
allele ) + 0.60 + 0.60 (maternal A alleles)), which is 0:25. For the
ten.trials, the ratios obtained for
chromosome 13 varied from 0.254 to 0.285. The average for the ten trials was
0.269 with a
standard deviation of 0.009 (See Table XX).
The expected ratio for chromosome 21 in a Trisomy condition is 0.20. If the
maternal
chromosomes both contain an adenine nucleotide, and the Down syndrome genome
is comprised of
two chromosomes with an adenine nucleotide and one chromosome with a guanine
nucleotide, then
the ratio of G:A is 0.40/(0.40 + 0.40 (Down syndrome A alleles) + 0.60 + 0.60
(maternal A
alleles)), which is 0.20.
For the ten trials, the ratios obtained for chromosome 21 varied from 0.216 to
0.249, with
an average of 0.23 and a standard deviation of 0.011 (see Table XX).
Statistical analysis revealed a
confidence value of 94.3% that the ratios obtained on chromosome 13 and on
chromosome 21
represented true differences, rather than random numerical fluctuations in
value. The Ravgen
275
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
method identified the presence of the chromosomal abnormality in the presence
of 60% maternal
DNA.
The presence of the Trisomy 21 condition was identified with the Ravgen method
in
numerous samples that contained various percentages of abnormal DNA. Each
percentage of
abnormal DNA was analyzed ten separate times and each time, the presence of
the abnormal
condition was identified. The ratio of allele 1 to allele 2 at multiple
heterozygous SNPs on
chromosome 13 was calculated, and the ratios were averaged. The same was done
with the SNPs
located on chromosome 21. The ratio obtained for the heterozygous SNPs on
chromosome 13 was
statistically different from the ratio obtained on chromosome 21. The ratios
obtained on both
chromosome 13 and 21 were near the mathematically predicted values.
In this example, the confidence interval for the samples with 100% Down
syndrome DNA
and 75% Down syndrome DNA was 99.9%, and the confidence interval for the
sample with 50%
Down syndrome DNA was 99.1%, which is about the accuracy reported for
amniocentesis. The
confidence interval for the sample containing 40% Down syndrome DNA was 94.3%,
which is
more accurate than currently marketed non-invasive tests for prenatal
diagnostics.
As discussed above, about 60 SNPs on chromosome 13 and 50 SNPs on chromosome
21
were analyzed. To increase the confidence interval for samples containing 40%
fetal DNA or
lower, a larger number of SNPs can be analyzed. The Ravgen method provides a
highly accurate,
cost-effective way to sequence DNA, so sequencing a larger number of SNPs is
not difficult. The
accuracy of the test is determined by the number of SNPs that are sequenced.
For higher accuracy
with samples that contain lower percentages of DNA, more SNPs can be analyzed.
Alternatively,
the methods described in this application can be used to ensure that the
samples contain a higher
percentage of fetal DNA.
In this example, a sample containing 40% Down syndrome.DNA, which represented
the
fetal DNA in the maternal blood, was analyzed. Maternal blood samples with any
percentage of
fetal DNA can be analyzed including but not limited to 0.0001-1%, 1-10%, 10-
20%, 20-30%, 30-
40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90%, and 90-100%.
Table XX. The Ravgen method identifies chromosomal abnormalities in
Samples containing 40% Down syndrome DNA
100% ~~
DS 75%
DNA DS
DNA
Ratio 13 21 Expected13 21 Expected
at 21 21
Chrom.
Triall0.9590.57080.49 0.637.37640.389
276
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Trial2 0.9160.50240.48 0.567.38940.362
Trial3 1029 0.46160.51 0.651.37070.394
Trial4 0.9670.51230.491 0.580.39010.367
Trials 1.0370.63390.51 0.645.41250.392
Trial6 1.1110.54250.53 0.645.37430.392
Trial 1.1540.4950.54 0.594.39740.373
?
Trial8 1.1350.52760.532 0.583.39010.368
Trial9 1.1480.5619Ø534 0.579.38990.367
Tria1101.0570.49760.52 0.609.350 0.378
AVG. x<O51:531 0.512 :609 0.3840'.378
STDEV .085 049 :032:~01'
~50%DSDNA ~40%DSDNA
Ratio 13 21 Expected13 21 Expected
at 21 21
Chrom.
Triall 0.3470.2750.258 0.2770.2390.217
Trial2 0.3160.2370.24 0.2650.2490.21
Trial3 0.3380.2470.253 0.2660.2270.21
Trial4 0.3310.2640.249 0.2540.2160.202
Trial 0.3300.2410.248 0.2740.2460.215
s
Trial6 0.3240.2400.244 0.2680.22 0.211
Trial 0.3180.2330.241 0.2750.2270.216
?
Trial8 0.3020.2300.231 0.2580.2280.21
Trial9 0.3150.2380.240 0.2850.2310.222
Tria1100.3180.2350.241 0.2660.2180.21
AVG. 0.3240.2440.244 0.2690.23 0.212
STDEV 0.0130.015 0.0090.011
EXAMPLE 15
As discussed in Example 4 above, the use of cell lysis inhibitors, cell
membrane stabilizers,
or cross-linking reagents can be used to increase the percentage of fetal DNA
in the maternal blood.
In this example, methods for the isolation of free fetal DNA are disclosed,
which minimize the
amount of maternal cell lysis. The effect of formalin on sixty-nine (69)
maternal blood samples
from twenty-seven clinical practices located in sixteen different states was
analyzed. Formalin was
277
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
added to all samples collected from the pregnant women, and the percentage of
fetal DNA was
calculated using serial dilution analysis followed by PCR. A genetic marker on
the Y chromosome
was used to calculate the percent of fetal DNA.
Collection of Blood Samples
In accordance with an 1RB approved study, blood samples were collected from
pregnant
women after informed consent had been granted. Blood samples were received
from 27 different
clinical sites operating in 16 different states located throughout the U.S.
Blood samples were
collected from both women carrying male and female fetuses, however, here, we
report results
obtained from woman carrying male fetuses, as the Y chromosome is the accepted
marker when
quantitating percentages of fetal DNA.
Blood is collected by any method or process that results in a substantial
increase in the ratio
of fetal DNA/maternal DNA in the resulting serum or plasma after appropriate
processing. As used
herein, a substantial increase in the ratio of fetal DNA/maternal DNA is that
which can be detected
by the methods as described herein. Such methods or processes typically result
in a substantial
increase in the ratio of fetal DNA/maternal DNA of about 5%, 10%, 15%, 20%,
30%, 50%, 70%,
80%, 100°/~ or more of the ratio of fetal DNA/maternal DNA found in
blood samples collected by
standard procedures.
In other embodiments, blood is collected by any method or process that results
in a
substantial increase in the amount of free fetal DNA compared to the amount of
total DNA
recovered or detected in the resulting serum or plasma after processing. Such
methods or processes
typically result in a substantial increase so the fetal DNA recovered or
detected is about 10%, 15%,
20°/~, 25%, 30%, 40%, 50% or more of the total DNA recovered or
detected in the processed
plasma or serum sample.
All clinical sites were provided with a kit used for the venipuncture
procedure, which
included 21 gauge needles, 9 ml EDTA Vacuette tubes (catalog number NC9897284)
a syringe
containing 0.225 ml of 10% neutral buffered solution containing formaldehyde
(4% w/v}, an
icepack, and a shipping container. The clinical sites were instructed to add
the formaldehyde
immediately after drawing the blood and to gently invert the tubes.
The methods or processes of collecting blood samples may also include other
steps that
result in lessened or reduced cell lysis. For instance, blood collection
devices may be modified to
decrease cell lysis due to sheer forces in the collection needle, syringe or
tubes used. For instance,
needles of large gauge may be employed to reduce cell sheering or vacutainer
tubes may be
modified to reduce the velocity of blood flow.
278
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Isolation of Plasma
Any method may be used to isolate plasma from the cell components of blood
after
collection but methods wherein cell lysis is substantially prevented, reduced
or inhibited are
preferred. The blood was stored at 4°C until processing. Methods for
isolation of the plasma were
implemented to reduce the amount of maternal cell lysis. The tubes were spun
at 1000 rpm for ten
minutes in a centrifuge with braking power and acceleration power set at zero
to substantially
prevent, reduce or inhibit cell lysis and or mixing of blood cell components
into the plasma. The
tubes were spun a second time at 1000 rpm for ten minutes with braking power
(centrifuge stopped
by natural deceleration) and acceleration power set to zero. The supernatant
(the plasma) of each
sample was transferred carefully to a new tube and spun at 3000 rpm for ten
minutes with the brake
and acceleration power set at zero. The supernatant (the plasma) of each
sample was collected via
procedures to substantially prevent mixing of. cell components into the
plasma. Great care was
taken to ensure that the bufFy-coat was not disturbed. A percentage of the
supernatant can be left in
the tube including but not limited to 0.001-1%, 1-10%, 10-20%, 20-30%, 30-40%,
40-50%, 50-
60%, 60-70%, 70-80% or greater than 80%. In this example, about 0.5 ml of the
supernatant was
left in the tube to ensure that the buffy-coat was not disturbed. The
supernatant was transferred to a
new tube and stored at -80°C.
Isolation of DNA
DNA was isolated from the plasma sample using the Qiagen Midi Kit for
purification of
DNA from blood cells, following the manufacturer's instructions (QIAmp DNA
Blood Midi Kit,
Catalog number 51183). DNA was eluted in 100 p,l of distilled water. However,
any method of
DNA isolation can be used including cesium chloride gradients, gradients,
sucrose gradients,
glucose gradients, centrifugation protocols, boiling, Qiagen purification
systems, QIA DNA blood
purification kit, HiSpeed Plasmid Maxi Kit, QIAfilter plasmid kit,.Promega DNA
purification
systems, MangeSil Paramagnetic'Particle based systems, Wizard SV technology,
Wizard Genomic
DNA purification kit, Amersham purification systems, GFX Genomic Blood DNA
purification kit,
Invitrogen Life Technologies Purification Systems, CONCERT purification
system, Mo Bio
Laboratories purification systems, UltraClean BloodSpin Kits, and UlraClean
Blood DNA Kit. The
skilled artisan understands that the manufacturer's protocols can modified to
increase the yield of
DNA. For example, the Qiagen Midi Kit for purification of DNA recommends the
use of 1X AL
buffer. However, any concentration of AL buffer may be used if the yield of
DNA increases
including but not limited to 0.1-O.SX AL buffer, 0.5-1X AL buffer, 1X-2X AL
buffer, 2-3X AL
buffer, 3-4X AL buffer, 4-SX AL buffer, and greater than SX AL buffer. The
skilled artisan
understands that the modifications and manipulations of the reagents are not
limited to AL buffer.
279
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Quantification of Percentage of Fetal DNA
The percentage of fetal DNA present in the maternal plasma sample was
calculated using
serial dilution analysis followed by PCR. Two different sets of primers were
used: one primer set
was specific for the Y chromosome, and thus specific for fetal DNA, and the
other primer set was
designed to amplify the cystic fibrosis gene, which is present on both
maternal template DNA and
fetal template DNA.
Primer Design:
The following primers were designed to amplify the SRY gene on the Y
chromosome:
Upstream primer:
5'TGGCGATTAAGTCAAATTCGC3'
Downstream primer: ,
5'CCCCCTAGTACCCTGACAATGTATT3'
The following primers were designed to amplify the cystic fibrosis gene:
Upstream primer:
5'CTGTTCTGTGATATTATGTGTGGT3'
Downstream primer:
5' AATTGTTGGCATTCCAGCATTG 3'
PCR Reaction
The SRY gene and the cystic fibrosis gene were amplified from the template
genomic DNA
using PCR (U.S. Patent Nos. 4,683,195 and 4,6832202). For increased
specificity, a "hot-start"
PCR was used. PCR reactions were performed using the HotStarTaq Master Mix Kit
supplied by
Qiagen (Catalog No. 203443). For amplification of the SRY gene, the DNA eluted
from the
Qiagen purification column was diluted serially 1:2. For amplification of the
cystic fibrosis gene,
the DNA eluted from the Qiagen purification column was diluted 1:4, and then
serially diluted 1:2.
The following components were used for each PCR reaction: 8 pl of template DNA
(diluted or
undiluted), 1 p,l of each primer (5 pM), 10 p,l of HotStar Taq mix. The
following PCR conditions
were used:
280
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
(1) 95°C for 15'
(2) 94°C for 1'
(3) 54°C for 15"
(4) 72°C for 30"
(5) Repeat steps 2-4 for 45 cycles.
(6) 10' at 72°C
Amplification of the SRY gene was performed using the following templates:
undiluted,
diluted 1:2, diluted 1:4, diluted 1:8, diluted 1:16, diluted 1:32, diluted
1:64, diluted 1:128, diluted
1:256, and diluted 1:512. .Amplification of the cystic.fibrosis gene was
performed using the
following templates: diluted 1:4, diluted 1:8, diluted 1:16, diluted 1:32,
diluted 1:64, diluted 1:128,
diluted 1:256, diluted 1:5.12, diluted 1:1024, diluted 1:2048, and diluted
1:4096.
The percent of fetal DNA present in the maternal plasma was calculated using
the
following formula:
% fetal DNA = (amount of SRY genelamount of cystic fibrosis gene)*2* 100.
The amount of SRY gene was represented by the highest dilution value in which
the gene was
amplified. Likewise, the amount of cystic fibrosis gene was represented by the
highest dilution
value in which it was amplified. The formula contains a multiplication factor
of two (2), which is
used to normalize for the fact that there is only one copy of the SRY gene
(located on the Y
chromosome), while there are two copies of the cystic fibrosis gene.
The effect of formalin on sixty-nine (69) maternal blood samples collected
from twenty-
seven clinical practices located in sixteen different states, spanning from
~'Jashington to
Massachusetts is shown in Table XXI. In this study, formalin was added to all
samples collected
from the pregnant women, and the percentage of fetal DNA was calculated using
serial dilution
analysis followed by PCR. The serial dilutions and PCR amplifications were
performed by four
different scientists over a period of five months. The samples were collected
from women at
gestational ages ranging from 11 weeks to 28 weeks, with the majority of women
between 16-19
weeks of gestation. A summary is provided in Table XXIII.
The average percentage of free fetal DNA for the 69 samples analyzed in the
maternal
blood was 33.6%. Lo et al. reported fetal DNA concentrations of 3.4% in woman
in late first to
mid-second trimester, which was the gestational age of the majority of women
in this study. Thus,
the addition of formalin led to approximately a ten-fold increase in the
average percentage of fetal
DNA.
281
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
While the calculated percentage of fetal DNA in maternal blood is impressive,
it is also
informative to examine the range of the percentages of fetal DNA observed in
this study. About six
percent of the women (4/69) had 3.125% of free fetal DNA in the maternal
blood, which was the
lowest percentage of fetal DNA observed in this study. Another 10.2% of women
had 6.25% fetal
DNA, which represents a two-fold increase over the reported average in the
literature. The total
number of women who had less than 10% fetal DNA in the maternal blood was only
16.0%.
Fifty-eight percent of the women in this study had a percentage of fetal DNA
of 25% or
greater. Importantly, 26.0% of the women had fifty percent or greater fetal
DNA in the maternal
blood. Fetal DNA percentages of this magnitude have not been reported, and
represent a new tool
to the field of prenatal genetics.
There were four samples collected from women at the gestational age of eleven
weeks. The
percentages of fetal DNA in the maternal blood samples were as follows: two
samples at 12.5%;
one sample at 25%; and one sample at greater than 50%. Thus, the effect of
formalin on the
percentages of fetal DNA was observed with samples collected from women in
early as well as later
gestational periods.
The effect of stabilizing cell membranes and reducing the release of free DNA
was not
limited to formalin. We have tested several different types of agents, and
combinations of agents,
that prevent cell lysis and/or stabilize cell membranes, such as
glutaraldehyde, and have seen that
these agents also reduce the amount of free DNA in the blood sample (data not
shown).
The above described methods may also include steps of adding an agent to the
blood
sample at the time or near to the time of collection to substantially inhibit
or impede cell lysis or
stabilize cell membranes. Any number of agents that impede cell lysis or
stabilize cell membranes
or cross-link cell membranes can be added to the maternal blood samples
including but not limited
to formaldehyde, and derivatives of formaldehyde, formalin, glutaraldehyde,
and derivatives of
glutaraldehyde, crosslinkers, primary amine reactive crosslinkers, sulfliydryl
reactive crosslinkers,
sulthydryl addition or disulfide reduction, carbohydrate reactive
crosslinkers, carboxyl reactive
crosslinkers, photoreactive crosslinkers, cleavable crosslinkers, AEDP, APG,
BASED, BM(PEO)3,
BM(PEO)4, BMB, BMDB, BMH, BMOE, BS3, BSOCOES, DFDNB, DMA, DMP, DMS, DPDPB,
DSG, DSP, DSS, DST, DTBP, DTME, DTSSP, EGS, HBVS, sulfo-BSOCOES, Sulfo-DST,
Sulfo-EGS or the compounds listed in Table XXIII. Additional cross-linkers
that can be used are
found at the following website: www.piercenet.com/productsl.
An agent that stabilizes cell membranes may be added to the maternal blood
sample to
reduce maternal cell lysis including but not limited to aldehydes, urea
formaldehyde, phenol
formaldehyde, DMAE (dimethylaminoethanol), cholesterol, cholesterol
derivatives, high
concentrations of magnesium, vitamin E, and vitamin E derivatives, calcium,
calcium gluconate,
282
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
taurine, niacin, hydroxylamine derivatives, bimoclomol, sucrose, astaxanthin,
glucose,
amitriptyline, isomer A hopane tetral phenylacetate, isomer B hopane tetral
phenylacetate,
citicoline, inositol, vitamin B, vitamin B complex, cholesterol hemisuccinate,
sorbitol, calcium,
coenzyme Q, ubiquinone, vitamin K, vitamin K complex, menaquinone, zonegran,
zinc, ginkgo
biloba extract, diphenylhydantoin, perftoran, polyvinylpyrrolidone,
phosphatidylserine, tegretol,
PABA, disodium cromglycate, nedocromil sodium, phenytoin, zinc citrate,
mexitil, dilantin, sodium
hyaluronate, or polaxamer 188.
Any concentration of agent that stabilizes cell membranes, impedes cell lysis
or cross-link
cell membranes can be added. In a preferred embodiment, the agent that
stabilizes cell membranes,
impedes cell lysis, or cross-links cell membranes is added at a concentration
that does not impede
or hinder subsequent reactions.
While impressive percentages of free fetal DNA in maternal blood samples have
been
reported, it is thought that higher percentages can be achieved by carefully
explaining the
importance of the formalin to the physicians. Samples randomly were checked
for the presence of
formalin and found that about ten percent of the samples did not receive
formalin. In addition,
aggregates were observed in another ten percent of the samples suggesting that
the formalin had not
been thoroughly mixed with the collected blood. Thus, while the addition of
formalin produced an
impressive effect, it is likely that under controlled conditions, the
percentage of free fetal DNA may
be higher.
In addition, we believe that procedures to minimize hemolysis during the
venipuncture
procedure and temperature controlled shipping containers (specimens were
shipped in a Styrofoam
container with ice pack, but there was variation in temperature because
samples were shipped from
varying distances) may cause a further increase in the percentage of free
fetal DNA. Needles
designed to reduce hemolysis can be used during the venipuncture procedure.
Also, we hypothesized that procedures for carefully isolating the plasma would
help to ~
ensure a minimal amount of maternal DNA in the sample. We implemented
procedures, as
described above, to reduce cell lysis, such as gentle centrifugation
parameters, and allowed the
rotors to stop without external force (no brake). Also, we carefully removed
the supernatant
containing the plasma DNA from the huffy-coat, which contains maternal DNA.
These procedures
coupled with the addition of formalin to prevent cell lysis resulted in a
tremendous increase in the
percentage of fetal DNA.
Table XXI. Formalin increases the percentage of free fetal DNA in blood
samples collected at
numerous clinical sites from women at various stages of gestation.
283
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
SampleWks Fetal Genomes/ % Fetal DNA
Gestationml
1 16 80 25
2 19 1066 >50
3 17 52 50
4 22 166 25
32 457 50
6 19 400 100
7 18 800 100
8 17 100 50
9 16 50 25
17 25 12.5
11 16 94.74 12.5
12 16 34.60 50
13 16 22.5 25
14 17 50 12.5
17 26.48 12.5
16 17 45.00 25
17 .. 17 94.7 100
18 17 28.13 6.25
~
19 19 28.13 25
20 11.25 12.5
21 15 11.25 12.5
22 11 16.66 12.5
23 18 13.23 25
24 18 12.50 ' 6.25
16 112.50 100
26 17 124.13 25
27 .14 90.00 50
28 11 loo.oo loo
29 ~ 18 232.00 100
19 626.00 100
31 19 112.50 100
32 16 423.50 100
33 16 423.50 25
34 11 105.88 25
16 49.60 3.1
36 11 11.84 12.5
37 16 120.00 25
38 18 342.90 100
39 17 51.43 25
18 225.00 6.25
41 17 400.00 12.5
42 28 180.00 25
43 17 20.45 12.5
44 18 25.73 25
16 68.68 3.1
46 17 218.18 25
47 15 75.00 6.25
48 16 40.58 3.1
49 17 100.00 25
17 14,06 12.5
51 22 22.50 12.5
52 15 28,13 12.5
53 17 50.00 3.125
54 18 58.00 50
14 100.00 25
56 16 58,08 25
57 16 13.64 12.5
58 16 25.00 6.25
59 20 45.00 25
16 23.69 12.5
61 18 5.92 6.25
62 15 28,13 6.25
63 17 50.00 25
64 16 360.00 50
16 25.00 12.5
66 16 48.65 25
67 16 47.38 12.5
68 14 26.45 50
69 17 124.15 25
Avers 17 131.15 33.6
a
284
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Table XXII. Formalin increases the percentage of free fetal DNA in blood
samples collected at
numerous clinical sites from women at various stages of gestation.
Fetal DNA 3.125 6.25 12.5 25 50 Over 50%
Number 4 7 18 22 7 11
Women (69)
5.8 10.1 26.1 31.9 10.2 15.9
Table XXIII. A representative list of cross-linkers that can be used to impede
maternal cell lysis.
Cross-Linker Abbreviation
succinimidyl acetylthioacetate SATA
succinimidyl trans-4-(maleimidylmethyl)SMCC
cyclohexane-1-carboxylate
succinimidyl 3-(2-pyridyldithio)propionateSPDP
N ((2-pyridyldithio)ethyl)-4-azidosalicylamidePEAS; AET
4-azido-2,3,5,6-tetrafluorobenzoicATFB, SE
acid,
succinimidyl ester
4-azido-2,3,5,6-tetrafluorobenzoicATFB, STP ester
acid, STP
ester, sodium salt
4-azido-2,3,5,6-tetrafluorobenzyl
amine,
hydrochloride
benzophenone-4-isothiocyanate
benzophenone-4-maleimide
4-benzoylbenzoic acid, succinimidyl
ester
Disuccinimidylsuberate DS S
Dithiobis(succinimidylpropionate)DSP
3,3'-Dithiobis(sulfosuccinimidylpropionate)DTSSP
Bis[2-
SULFO BSOCOES
(sulfosuccinimdooxycarbonyloxy)ethyl]sulfone
Bis[2-
BSOCOES
(succinimdooxycarbonyloxy)ethyl]
sulfone
285
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Disulfosuccinimdyltartrate SULFO DST
Disuccinimdyltartrate DST
Ethylene glycolbis(succinimidylsuccinate)~ SULFO EGS
Ethylene glycolbis(sulfosuccinimidylsuccinate)EGS
1,2-Di[3'-(2'-
DPDPB
pyridyldithio)propionamido]butane
Bis(sulfosuccinimdyl)suberate BSSS
Succinimdyl-4-(p-maleimidophenyl)butyrateSMPB
Sulfosuccinimdyl-4-(p-
SULFO SMPB
maleimidophenyl)butyrate
3-Maleimidobenzoyl-N-hydroxysuccinimide
MBS
ester
3-Maleimidobenzoyl-N-
SULFO MBS
hydroxysulfosuccinimide ester
N-Succinimidyl(4-iodoacetyl)aminobenzoate' SIAB
N-Sulfosuccinimidyl(4-
SULFO SIAB
iodoacetyl)aminobenzoate
Succinimidyl-4-(N-
SMCC
maleimidomethyl)cyclohexane-1-carboxylate
Sulfosuccinimidyl-4-(N-
SULFO SMCC
maleimidomethyl)cyclohexane-1-carboxylate
Succinimidyl-6-[3-(2-
NHS LC SPDP
pyridyldithio)propionamido)hexanoate
Sulfosuccinimidyl-6-[3-(2-
SULFO NHS LC SPDP
pyridyldithio)propionamido)hexanoate
N-Succinimdyl-3-(2-pyridyldithio)propionateSPDP
N-HydroxysuccinimidylbromoacetateNHS BROMOACETATE
N-HydroxysuccinimidyliodoacetateNHS IODOACETATE
4-(N-Maleimidophenyl)butyric
acid hydrazide
MPBH
hydrochloride
4-(N-Maleimidomethyl)cyclohexane-1-
MCCH
carboxylic acid hydrazide hydrochloride
m-Maleimidobenzoic acid
MBH
hydrazidehydrochloride
286
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
N-(epsilon-
SULFO EMCS
Maleimidocaproyloxy)sulfosuccinimide
N-(epsilon-Maleimidocaproyloxy)succinimideEMCS
N-(p-Maleimidophenyl)isocyanatePMPI
N-(kappa-Maleimidoundecanoic
acid) I~MUH
hydrazide
Succinimidyl-4-(N-maleimidomethyl)-
LC SMCC
cyclohexane-1-carboxy(6-amidocaproate~
N-(gamma-
SULFO GMBS
Maleimidobutryloxy)sulfosuccinimide
ester
Succinimidyl-6-(beta-
SMPH
maleimidopropionamidohexanoate)
N-(kappa-
Maleimidoundecanoyloxy)sulfosuccinimideSULFO KMUS
ester
N-(gamma-Maleimidobutyrloxy)succinimideGMB S
Dimethyladipimidate hydrochlorideDMA
Dimethylpimelimidate hydrochlorideDMP
Dimethylsuberimidate hydrochlorideDMS
Methyl-p-hydroxybenzimidate
hydrochloride, MHBH(Wood's Reagent)
98%
Amine Reactive
Bis[sulfosuccinimidyl] suberateBS3
Bis[2- BSOCOES
(succinimidooxycarbonyloxy)ethyl]sulfone
Disuccinimidyl glutarate DSG
DSP (Lomant's Reagent)
1,5-Difluoro-2,4-dinitrobenzeneDFDNB
Dithiobis[succinimidylpropionateDTBP
Bis-[b-(4-Azidosalicylamido)ethyl]disulfideBASED
Sulfhydryl Reactive
287
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
BM[PEO]3(1,8-bis-MaleimidotriethyleneglycolBM[PEO]3
BM[PEO]4( 1,11-bis- BM[PEO]4
Maleimidotetraethyleneglycol
1,4-bis-Maleimidobutane BMB
1,4 bis-Maleimidyl-2,3-dihydroxybutaneBMDB
Bis-Maleimidohexane BMH
Bis-Maleimidoethane BMOE
1,4-Di-[3'-(2 -pyridyldithio)-DPDPB
propionamido]butane
Dithio-bis-maleimidoethane DTME
1,6-Hexane-bis-vinylsulfone HBVS
p-Azidobenzoyl hydrazide ABH
Amine-Sulfhydryl Reactive
N [a-Maleimidoacetoxy]succinimideAMAS
ester
N [4-(p-Azidasalicylamido) APDP
butyl]-3'-(2'-
pyridyldithio)propionamide
N [13-Maleimidopropyloxy]succinimideBMPS
ester
N-e-Maleimidocaproic acid EMCA
N-e-Maleimidocaproyloxy]succinimideEMCS
ester
N-[g-Maleimidobutyryloxy]succinimideGMBS
ester
N-le-Maleimidoundecanoic acid KMUA
Succinimidyl-4-(N- LC-SMCC
Maleimidomethyl)cyclohexane-1-carboxy-(6-
amidocaproate
Succinimidyl 6-(3-[2-pyridyldithio]-LC-SPDP
propionamido)hexanoate
m-Maleimidobenzoyl-N-lrydroxysuccinimideMB S
ester
Succinimidyl 3-[bromoacetamido]propionateSBAP
N Succinimidyl iodoacetate SIA
N Succinimidyl[4-iodoacetyl]aminobenzoateSIAB
Succinimidyl 4-[N SMCC
maleimidomethyl]cyclohexane-1-carboxylate
288
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Succinimidyl 4-[p-maleimidophenyl]butyrateSMPB
Succinimidyl-6-[13- SMPH
maleimidopropionamido]hexanoate
4-Succinimidyloxycarbonyl-methyl-a-[2-SMPT
pyridyldithio]toluene
N Succinimidyl 3-[2-pyridyldithio]-SPDP
propionamido
N-e-Maleimidocaproyloxy]sulfosuccinimideSulfo-EMCS
ester
N-[g-Maleimidobutyryloxy]sulfosuccinimideSulfo-GMBS
ester
N [k- , Sulfo-KMITS
Maleimidoundecanoyloxy] sulfosuccinimide
ester
4-Sulfosuccinimidyl-6-methyl-a-(2-Sulfo-LC-SMPT
pyridyldithio)toluamido]hexanoate
Sulfosuccinimidyl 6-(3'-[2-pyridyldithio]-Sulfo-LC-SPDP
propionamido)hexanoate
m-Maleimidobenzoyl-N- Sulfo-MB S
hydroxysulfosuccinimide ester
N Sulfosuccinimidyl[4- Sulfo-SIAB
iodoacetyl}aminobenzoate
Sulfosuccinimidyl 4-[N Sulfo-SMCC
maleimidomethyl]cyclohexane-1-carboxylate
Sulfosuccinimidyl-4-(P-Maleimidophenyl)Sulfo-SMPB
Butyrate
Amino Groups
N-5-Azido-2-nitrobenzoyloxysuccinimideANB-NOS
Methyl N-succinimidyl adipate MSA
N-Hydroxysuccinimidyl-4-azidosalicylicNHS-ASA
acid
N Succinimidyl(4-azidophenyl)-1,SADP
3'-
dithiopropionate
Sulfosuccinimidyl 2-[7-amino-4-SAED
methylcoumarin-3-acetamido]ethyl-
289
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
1,3 'dithiopropionate
Sulfosuccinimidyl 2[m-azido-o- SAND
nitrobenzamido]-ethyl-1,3'-dithiopropionate
N Succinimidyl-6-[4'-azido-2'- SANPAH
nitrophenylamino] hexanoate
Sulfosuccinimidyl-2-[p- SASD
azidosalicylamido]ethyl-1,3'-dithiopropionate
Sulfosuccinimidyl- SFAD
[perfluoroazidobenzamido]ethyl-1,3'-
dithiopropionate
N Hydroxysulfosuccinimidyl-4-azidobenzoateSulfo-HSAB
Sulfosuccinimidyl[4-azidosalicylamido]-Sulfo-NHS-LC-ASA
hexanoate
N Sulfosuccinimidyl(4-azidophenyl)-1,Sulfo-SADP
3'-
dithiopropionate
N Sulfosuccinimidyl-6-[4-azido-2'-Sulfo-SANPAH
nitrophenylamino] hexanoate
p-Azidophenyl glyoxal monohydrateAPG
N-13-Maleimidopropionic acid BMPA
Carbohydrate Reactive-Photoreactive
N Succinimidyl-S-acetylthiopropionateSATP
Sulfhydryl-Carbohydrate Reactive
4-(4-N-Maleimidophenyl)butyric MPBH
acid
hydrazide hydrochloride
3-(2-Pyridyldithio)propionyl PDPH
hydrazide
Sulfhydryl-carbonyl (aldehyde)/carboxyl
reactive
N [13-Maleimidopropionic acid]hydrazideTFABMPH
N-e-Maleimidocaproic acid]hydrazideEMCH
N-[k-Maleimidoundecanoic acid]hydrazideKMUH
N-[p-Maleimidophenyl] isocyanatePMPI
TFCS
290
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
EXAMPLE 16
Fetal chromosomal abnormalities are determined by analyzing SNPs wherein 'the
maternal
template DNA is homozygous and the template DNA obtained from the plasma is
heterozygous.
Plasma that is isolated from blood of a pregnant female contains both maternal
template DNA and
fetal template DNA. Any number of SNP detection methods can be used to analyze
the maternal
and plasma DNA. Any DNA microarray may be used including but not limited to
commercially
available and non-commercially available arrays.
A DNA microarray can be designed to contain SNPs located on the chromosome or
chromosomes of interest including but not limited to a DNA microarray
containing SNPs located on
chromosomes 13, 18, and 21, a DNA microarray containing SLAPS located on
chromosomes 13 and
18, a DNA microarray containing SLAPS located on chromosomes 13 and 21, a DNA
microarray
containing SLAPS located on chromosomes 18 and 21, a DNA microarray containing
SLAPS located
on chromosomes 13, 18, 21, 15, 22, X, Y, a DNA microarray containing SLAPS
located on each of
the autosomal chromosomes and each of the sex chromosomes, a DNA microarray
containing
SLAPS located on chromosome 13, a DNA microarray containing SLAPS located on
chromosome 18,
a DNA microarray containing SLAPS located on chromosome 21, a DNA microarray
containing
SLAPS located on chromosome 15, a DNA microarray containing SLAPS located on
chromosome 17,
a DNA microarray containing SLAPS located on chromosome 22, a DNA microarray
containing
SLAPS located on a single chromosome, and a DNA microarray containing SLAPS
located on
multiple chromosomes.
In this example, SNPs are analyzed by GeneChip HuSNP Arrays from Affymetrix,
however any number of DNA arrays, including but not limited to GeneChip
arrays, GenFlex Tag
arrays, Mapping l OK Array, other Affymetrix arrays, and other DNA arrays can
be used.
Collection of Blood Samples
In accordance with an IRB approved study, blood samples are collected from
pregnant
women after informed consent is granted. Blood is collected into 9 ml EDTA
Vacuette tubes
(catalog number NC9897284) and 0.225 ml of 10% neutral buffered solution
containing
formaldehyde (4% w/v), is added to each tube, and each tube gently is
inverted. The tubes are
stored at 4°C until ready for processing.
Any number of agents that impede cell lysis or stabilize cell membranes or
cross-link cell
membranes can be added to the tubes including but not limited to formaldehyde,
and derivatives of
formaldehyde, formalin, glutaraldehyde, and derivatives of glutaraldehyde,
crosslinkers, primary
amine reactive crosslinkers, sulfhydryl reactive crosslinkers, sulfhydryl
addition or disulfide
291
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
reduction, carbohydrate reactive crosslinkers, carboxyl reactive crosslinkers,
photoreactive
crosslinleers, cleavable crosslinkers, AEDP, APG, BASED, BM(PEO)3, BM(PEO)4,
BMB, BMDB,
BMH, BMOE, BS3, BSOCOES, DFDNB, DMA, DMP, DMS, DPDPB, DSG, DSP, DSS, DST,
DTBP, DTME, DTSSP, EGS, HBVS, sulfo-BSOCOES, Sulfo-DST, Sulfo-EGS or compounds
listed in Table XXITI. Any concentration of agent that stabilizes cell
membranes, impedes cell lysis
or cross-link cell membranes can be added. In a preferred embodiment, the
agent that stabilizes cell
membranes, impedes cell lysis, or cross-links cell membranes is added at a
concentration that does
not impede or hinder subsequent reactions.
An agent that stabilizes cell membranes may be added to the maternal blood
sample to
reduce maternal cell lysis including but not limited to aldehydes, urea
formaldehyde, phenol
formaldehyde, DMAE (dimethylaminoethanol), cholesterol, cholesterol
derivatives, high
concentrations of magnesium, vitamin E, and vitamin E derivatives, calcium;
calcium gluconate,
taurine, niacin, hydroxylamine derivatives, biinoclomol, sucrose, astaxanthin,
glucose,
amitriptyline, isomer A hopane tetral phenylacetate, isomer B hopane tetral
phenylacetate,
citicoline, inositol, vitamin B, vitamin B complex, cholesterol hemisuccinate,
sorbitol, calcium,
coenzyme Q, ubiquinone, vitamin K, vitamin K complex, menaquinone, zonegran,
zinc, ginkgo
biloba extract, diphenylhydantoin, perftoran, polyvinylpyrrolidone,
phosphatidylserine, tegretol,
PABA, disodium cromglycate, nedocromil sodium, phenytoin, zinc citrate,
mexitil, dilantin, sodium
hyaluronate, or polaxamer 188.
Isolation of Plasma and Maternal Cells
The blood is stored at 4°C until processing. The tubes are spun at 1000
rpm for ten minutes
in a centrifuge with braking power set at zero. The tubes are spun a second
time at 1000 rpm for
ten minutes. The supernatant (the plasma) of each sample is transferred to a
new tube and spun at
3000 rpm for ten minutes with the brake set at zero. The supernatant is
transferred to a new tube
and stored at -80°C. Approximately two milliliters of the "huffy coat,"
which contains maternal
cells, is placed into a separate tube and stored at -80°C.
Tsolation of DNA
DNA is isolated from the plasma sample using the Qiagen Midi Kit for
purification of DNA
from blood cells, following the manufacturer's instructions (QIAmp DNA Blood
Midi Kit, Catalog
number 51183). DNA is eluted in 100 pl of distilled water. The Qiagen Midi Kit
also is used to
isolate DNA from the maternal cells contained in the "huffy coat."
292
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Identification of Homozygous Maternal SNPs
HuSNP Assay
The HuSNP assay is done as described by K. Lindblad-Toh et al. (Nature
Biotechnology,
Vol. 18, 1001-1005). The GeneChip~ HuSNPT"" Array is thought to enable whole
genome surveys
by simultaneously tracking nearly 1,500 SNPs dispersed throughout the genome.
In this example,
HuSNP array is used as a representative Affymetrix array, and is not meant to
limit the use of other
arrays including but not limited to GeneChip CYP450, and Affynnetrix custom
arrays that are
designed to meet specific user requirements.
PCR Amplification
Maternal DNA is assayed according to the HuSNP protocol supplied by Affymetrix
Inc.
For each sample, 24 pools of primer pairs (50-100 loci/pool at 50 nM each) are
mixed with 5 ng of
maternal DNA., 5 mM MgClz, 0.5 mM dNTPs, 1.25 U Amplitaq Gold (PE Biosystems,
Foster City,
CA), and the supplied buffer in 12.5 pl per pool. Samples are denatured for 5
min at 95°C followed
by 30 cycles of 95°C for 30 s, 52°C + 0.2°C/cycle for
55s, and 72°C for 30s; 5 cycles of 95°C for
30 s, 58°C for 55s, and 72°C for 30s and a final extension of
72°C for 7 min. A 1:1000 dilution of
each pool is made by adding 1 p.l of the amplification product to 999 pl of
ddH20. After, 2.5p,1 of
the 1:1000 dilution is transferred to a new plate and amplified with 0.8~M
biotinylated T7 and 0.8
p,M biotinylated T3 primers, 4mM MgCl2, 0.4 mM dNTPs, 2.5 U Taq and the
supplied buffer in 25
p,l for 8 min at 95°C, followed by 40 cycles of 95°C for 30 s,
55°C for 90s, and 72°C fox 30 s, and a
final extension of 72°C for 7 min. Then 1.5p.1 from each pool is tested
for amplification on a 3%
agarose gel. For each sample, the remainder of each the 24 pools is mixed and
loaded on a
Microcon-10 spin column (Amicon Bioseparations, Bedford, MA). Samples are
concentrated by
spinning the column for 20 min at 13,000 g at room temperature and are eluted
by inverting the
column and centrifuging for 3 min at 3,000 g. Volumes are adjusted to 60 pl.
A custom array can be designed using only the SNPs that are of interest. For
example, a
custom array may be designed that contains SNPs that are located on
chromosomes l, 13, 21, 18,
15, X, and Y.
Additionally, any number of SNPs can be amplified including SNPs located on
any human
chromosome including chromosome 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20,
21, 22, X or Y. Two representative SNPs on chromosome 13 and two
representative SNPs on
chromosome 21 are chosen. The genomic location and sequence of SNPs may be
found at the SNP
293
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
consortium (http://snp.cshl.or~). If these SNPs are not present on the array,
different SNPs can be
chosen.
SNP TSC0466917 (C/G), which is located on chromosome 13, is amplified using
the
following primers:
Upstream Primer:
5' CCAGCTGGTAGAACTT 3'
Downstream Primer:
5' CCCAATAGACCTATAG 3'
SNP TSC 1172576 (T/A), which is located on chromosome 13, is amplified using
the
following primers:
Upstream Primer:
5' TAGCAGAATCTCTCAT 3'
Downstream Primer:
5' AGAGTATCTCATTTGTT 3'
SNP TSC0271628 (A/G), which is located on chromosome 21, is amplified using
the
following primers:
Upstream Primer:
5' AGGAAATTGTGAAGTA 3'
Downstream Primer:
5' TAACTCACTCACTATC 3'
SNP TSC0069805 (C/T), which is located on chromosome 21, is amplified using
the
following primers:
Upstream Primer:
5' CTGCTGAGTCATAGTC 3'
294
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Downstream Primer:
5' TGTTCTTTGAATCAAC 3'
Hybridization to GeneChip Probe Arrays, Washing and Staining
5-30 ~1 of the sample (depending on the intensity of the chip lot) is diluted
in 3 M
tetramethylammonium chloride (TMACI), 2mM control oligonucleotide B 1
(supplied by
Affymetrix), SX Denhardt's solution, 100 pg/ml herring sperm DNA, 5 mM EDTA pH
8.0, 10 mM
Tris pH7.8, and 0.01% Tween 20 in a volume of 135 pl and is denatured for 10
min at 95°C. After
two minutes on ice, the samples are loaded into HuSNP chips and hybridized for
16 h at 44°C and
40 r.p.m.
Each chip is washed and stained on the Affymetrix fluidics. Chips are washed
for two
cycles of two mixes with 6X SSPET (Bio Whitaker, Walkersville, MD) (6X SSPE
(sodium
chloride, sodium phosphate, sodium EDTA) + 0.01% Triton-X-100) at 25°C,
and for six cycles of
five mixes with 4X SSPET (4X SSPE + 0.01% Triton X-100) at 35°C. Chips
are stained for 30 min
at 25°C with 50 pg/ml streptavidin-phycoerhthrin and 0.25 mg/ml
biotinylated anti-streptavidin
antibody in 6X SSPE, 1X Denhardt's solution, and 0.01% Tween 20 in a volume of
500 pl. The
chip is filled with 6X SSPET following six washes of four mixes with 6X SSPET
at 25°C.
After the hybridization, washing, and staining procedures, the HuSNP probe
arrays are
scanned using the HP GeneArray Scanner (HuSNP Mapping Assay Manual Affymetrix
P/N
700308).
Scanning
The HuSNP probe arrays are scanned using the HP GeneArray Scanner according to
the
HuSNP Mapping Assay Manual (Affymetrix P/N 700308). Other scanners may be used
including
but not limited to the AlphaArrayT"~ Reader. Genotype calls are made
automatically from the
collected hybridization signal intensities by the Affymetrix Microarray Suite
version 5.0 software.
Each allele of a SNP is represented by four or five complementary probes with
different locations
of the SNP base position within the 20-nucleotide probes. Each of these
probes, in turn, is paired
with a probe of the same sequence except for a central mismatch at or near a
SNP position, intended
to correct the fluorescence value for non-specific binding to the probe.
Each SNP is genotyped. SNPs located on chromosomes 13 and 21, wherein the
maternal
DNA is homozygous, are analyzed with the DNA isolated from the plasma.
295
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Analysis of DNA Isolated from Maternal Plasma
After the maternal DNA is analyzed and homozygous SNPs are identified, these
SNPs are
analyzed with the DNA isolated from the plasma. A low copy number of fetal
genomes typically is
present in the maternal plasma. To increase the copy number of the loci of
interest, which are the
SNPs at which the maternal DNA is homozygous, primers are designed to anneal
at approximately
130 bases upstream and 130 bases downstream of each loci of interest. This is
done to reduce
statistical sampling error that can occur when working with a low number of
genomes, which can
influence the ratio of one allele to another (see Example 11 ).
Design of Multiplex Primers
The primers are 12 bases in lengtli. However, primers of any length can be
used including
but not limited to 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18,
19, 20, 21, 22, 23, 24, 25,
26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36-45, 46-55, 56-65, 66-75, 76-85, 86-
95, 96-105, 106-115,
116-125, and greater than 125 bases. Primers are designed to anneal t~ both
the sense strand and
the antisense strand.
The maternal homozygous SNPs vary from sample to sample so defined sequences
are not
provided here. Primers are designed to anneal about 130 bases upstream and
downstream of the
maternal homozygous SNPs. The primers are designed to terminate at the 3' end
in the dinucleotide
"AA" to reduce the formation of primer-dimers. However, the primers can be
designed to end in
any of the four nucleotides and in any combination of the four nucleotides.
Multiplex PCR
Regions upstream and downstream of the maternal homozygous SNPs are amplified
from
the template genomic DNA using the polymerase chain reaction (PCR, U.S. Patent
Nos. 4,683,195
and 4,683,202, incorporated herein by reference). This PCR reaction uses
primers that anneal
approximately 130 bases upstream and downstream of each loci of interest. The
primers are mixed
together and are used in a single reaction to amplify the template DNA. This
reaction is done to
increase the number of copies of the loci of interest, which eliminates error
generated from a low
number of genomes.
For increased specificity, a "hot-start" PCR reaction is used. PCR reactions
are performed
using the HotStarTaq Master Mix Kit supplied by QIAGEN (catalog number
203443). The amount
296
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
of template DNA and primer per reaction is optimized for each locus of
interest. In this example,
the 20 pl of plasma template DNA is used.
Two microliters of each forward and reverse primer, at concentrations of 5 mM
are pooled
into a single microcentrifuge tube and mixed. Four microliters of the primer
mix is used in a total
PCR reaction volume of 50 pl (20p1 of template plasma DNA, 1 p,l of sterile
water, 4 pl of primer
mix, and 25 wl of HotStar Taq. Twenty-five cycles of PCR are performed. The
following PCR
conditions are used:
(1) 95°C for 15 minutes;
(2) 95°C for 30 second;
(3) 4°C for 30 seconds;
(4) 37°C for 30 seconds;
(5) Repeat steps 2-4 twenty-four (24) times;
(6) 72°C for 10 minutes.
The temperatures and times for denaturing, annealing, and extension, are
optimized by
trying various settings and using the parameters that yield the best results.
Other methods of genomic amplification can also be used to increase the copy
number of
the loci of interest including but not limited to primer extension
preamplification (PEP) (Zhang et
al., PNAS, 89:5847-51, 1992), degenerate oligonucleotide primed PCR (DOP-PCR)
(Telenius, ~t
al., Genomics 13:718-25, 1992), strand displacement amplification using DNA
polymerase from
bacteriophage 29, which undergoes rolling circle replication (Dean et al.,
Genomic Research
11:1095-99, 2001 ), multiple displacement amplification (U. S. Patent
6,124,120), REPLI-gT"" Whole
Genome Amplification kits, and Tagged PCR.
It is important to ensure that the region amplified contains annealing
sequences for the
primers that are used with the HuSNP assay. Upon purchase of the HuSNP array,
each SNP and the
primers used to amplify each SNP can be identified. With this knowledge, the
multiplex primers
are designed to encompass annealing regions for the primers in the HuSNP
Array.
Purification of Fragment of Interest
The unused primers, and nucleotides are removed from the reaction by using
Qiagen
MinElute PCR purification kits (Qiagen, Catalog Number 28004). The reactions
are performed
following the manufacturer's instructions supplied with the columns. The DNA
is eluted in 100 pl
of sterile water. 5 pl of each amplified loci is mixed together
HuSNP Assay, Washing, Staining and Scanning
297
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
The pooled DNA is assayed with the HuSNP Array as described above. Washing,
staining,
and scanning procedures are as described above.
Each SNP is genotyped. SNPs located on chromosomes 13 and 21, wherein the
maternal
DNA is homozygous, and DNA isolated from the plasma is heterozygous are
quantitated.
Quantification
The intensity of the signal for each allele at a heterozygous is SNP is
quantitated. As
discussed above, the expected ratio of allele 1 to allele 2 can be used to
determine the presence or
absence of a chromosomal abnormality. If the maternal genome is homozygous at
SNP X (AlA),
and the plasma DNA is heterozygous at SNP X (A/G), then the G represents the
distinct fetal
signal. The ratio of G:A depends on the percentage of fetal DNA present in the
maternal blood.
For example, ifthe sample contains 50% fetal DNA, then the expected ratio is
0.33 (1 fetal
G allele/(2 maternal A alleles + 1 fetal A allele)). This ratio should be
constant for all
chromosomes that are present in two copies. The ratio that is obtained for
SNPs on chromosome 13
should be the same as the ratio that is obtained for chromosome 21.
However, if the fetal genome contains an additional copy of chromosome 21,
then the ratio
for this chromosome will deviate from the expected ratio. The expected ratio
for a Trisomy
condition with 50% fetal DNA in the maternal blood is 0.25. Thus, by analyzing
SNPs wherein the
maternal genome is homozygous, and the DNA that is isolated from the plasma is
heterozygous,
fetal chromosomal abnormalities can be detected.
This example explained the use of Affymetrix HuSNP Arrays, but it not intended
to limit
the use of arrays. Any DNA array may be used including but not limited to the
DNA arrays listed
in Table XXIV, or DNA arrays available from any of the companies listed in
Table XX1V, or XXV.
Custom DNA arrays can be made for detecting fetal chromosomal abnormalities in
maternal blood
using any number of products or services including but not limited to those
listed in Tables XXIV,
XXV, XXVI and XXVII.
Table XXIV: Features of some hybridization microarray formats.
Company Product Array Method HybridizationReadout
Name
Step
Af metrix GeneChiu~' hi situ (on-chip)10,000-260,000Fluorescence
Inc., photolithographicoligo features
298
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
synthesis probed with
of ~20-
25-mer oligoslabeled 30-40
onto siliconnucleotide
wafers, whichfragments
are of
cut into sample cDNA
1.25
cm2or 5.25 or antisense
cmZ
chips RNA
Agilent DNA Custom Designed
TechnologiesMicroarray Arrays
Access
Program
Amersham CodeLink
BiosciencesArrays
BD RiboScreen
PharMimgenHuman-1
Membrane
CL~NTECH Atlas Glass Variable Variable Variable
Human
Atlas Glass
Human 1.2
Atlas Glass
Human 1.2
II
Atlas Glass
Human 1.2
III
Atlas Human
Cancer
Atlas Human
Apoptosis
Atlas Human
Cancer cDNA
Atlas Human
Cardiovascular
Atlas Human
cDNA
Atlas Human
299
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
cell cycle
Atlas Human
Cell Interaction
Atlas Human
Cytokine
Receptor
Atlas Human
Hematology
array
Atlas Human
Neurobiology
Atlas Human
Oncogene
Atlas Human
Stress array
Atlas Human
Toxicology '
Atlas Human
Tumor array
Atlas Human
Oncogene
Custom Atlas
arrays
Custom Atlas
select arrays
Brax, 1000 oligos
on
Short synthetic
a "universal
oligo, Mass
chip" probed
synthesized spectrometry
off
with tagged
chip
nucleic acid
300
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Display discoveryArrayUses restriction
Systems Human Gene fragment
Biotech Display slidedifferential
display PCR
Gene L~ READS1'"' Flow-thru Chips with
o, Chip
Inc.. Probe Arraysmicroscopic
channels
with
probesattached
to their
walls
Star Profiler
Genmed
Arrays
SNP screening
GenometrixUniversal services,
96-well
Inc.. ArraysTM X 250 proprietary
array
Genomic GenMAP Cancer related
Solutions Cancer Chipssequences
spotted
in duplicate
H~eIInc., HyChipTM 500-2000 64 sample Radioisotope
nt
DNA samples cDNA spots
printed ontoprobed with
0.6
cm2 (HyGnostics)8,000 7-mer
or ~18 cm2 oligos
(Gene
Discovery) (HyGnostics)
membranes
<=55,000
sample cDNA
spots probed
with 300
7-mer
oligo (Gene
Discovery)
Fabricated Universal Fluorescence
5-mer 1024
oligos printedoligo spots
as
1,15 cma probed 10
arrays kb
301
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
onto glass sample cDNAs,
(HyChip) labeled
5-mer
oligo, and
ligase
Inc a GEM Piezoelectric<=1000 Fluorescence
and
Pharmaceutica printing (eventuallyradioisotope
for
ls, Inc. spotting 10,000)
PCR
fragments oligo/PCR
and
on-chip synthesisfragment
spots
of oligos probed with
labeled
RNA
INTERACTI Gold affinity
VIA. array
Mergen ExpressChip
DNA microarray
system
Molecular Storm~ 500-5000 10,000 cDNAFluorescence
nt
Dynamics, FluorImager~cDNAs printedspots probed
Inc
by pen onto with 200-400
~10
cm2 on glassnt labeled
slide
sample cDNAs
Motorola CodeLink
Array
MWG- Biochip
Biotech service,
licensed
by
Affymatrix
NEN Life MICROMAX
Science Human cDNA
Products MICROMAX
Human Kinases
and
phosphatases
MICROMAX
human
302
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
transcription
factors
MICROMAX
human
oncogene
and
tumor
suppressor
genes
Operon OpArray
TechnologiesHuman
Collagen
OpArray
Human
apoptosis
OpArray
Human stress
and aging
Origene SmartArray
TechnologiesHuman
Smartest
1
SmartArray
Human
Smartest
2
SmartArray
Human
Smartest
3
SmartArray
Human
Smartset
4
Nanogen SemiconductorPrefabricated25, 64, 400 Fluorescence
Microchip ~20-mer oligos,(and eventually
captured 10,000) oligo
onto
electroactivespots polarized
spots on to enhance
silicon
wafers, whichhybridization
are to
303
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
diced into 200-400
<=1 nt
cmz chips labeled
sample
cDNAs
Phase-1 Human 350
Molecular Gene Array
Toxicology
ProtoGene DNA FlexChipSurface tension Fluorescence
Laboratoriestechnology based arraying;
<=8,000
oligo
On-chip synthesisspots probed
of 40-50-mer with 200-400
oligos onto nt labeled
9 cm2
glass chip sample nucleic
via
printing to acids
a
surface-tension
array
R&D SystemsHuman
Cytokine
Expression
Array
Human
Apoptosis
Expression
Array
Research Human
Genetics Genefilters
Micorarray
Releases
I-VII
Human
"Named
Genes"
Genefilters
Micorarray
Releases
I
Human
304
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Prostate
specific
Genefilters
Micorarray
Releases
I
Human Ovary
Specific
Genefilters
Micorarray
Human Breast
specific
Genefilters
Micorarray
Human Colon
specific
Genefilters
Micorarray
Releases
I
Dermarray
Human Skin
Genefilters
Micorarray
Radius Custom
BiosciencesArraying
Services
Rosetta FlexJet
DNA
ImpharmaticsMicroarrays;
ResolverTM
Sequenom MassArray Off set printing250 locationsMass
SpectroChipof array; per spectrometry
. around
20-25-mer SpectroChip
oligos
interrogated
by
laser desorbtion
and mass
spectrometry
305
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
SEQWRIGHT Arraying
Services
Sigma- Panorama
Genosys Human
Cytokine
Gene
Arrays
Panorama
Human
Apoptosis
Gene Arrays
Stratagene GeneConnectio
n Discovery
Microarray
Human
SuperArray
Apoptosis-1,
2,
3, GEArray
Kit
Human
Apoptosis-4,
Bcl-2 Family
and Regulators
GEArray
Kit
Human
Apoptosis-
5/TNF and
Ras
Network
GEArray
Kit
Human p53
GEArray
Kit
Human
Toxicity/Stress
GEArray
Kit
Human Cell
Cycle 1,
2
GEArray
Kit
Human Cancer
306
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Metastasis
GEArray
Kit
Human
Cancer/Oncoge
ne GEArray
Kit
Human
Cancer/Tumor
Suppressor
GEArray
Kit
Human
Cancer/Angiog
enesis GE
Array Kit
Human
Cancer/Radiati
on Sensitivity
Marker
GEArray
Kit
Human
PathwayFinder
GEArray
Kit
Human Jak-
Stat Pathway
GEArray
Kit
Human P
13
Kinase and
AKT Pathway
GEArray
Kit
Human NFkB
Pathway
GEArray
Kit
Human
Common
Cytokine
307
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
GEArray
Kit
Human
Interleukin
Receptor
GEArray
Kit
Human
Inflammatory
Response
GEArray
Kit
Human Choice
GEArrays
UniGEMTM 500-5,000 <=10,000 Fluorescence
nt
~nteni,
Inc.,
cDNAs printedcDNA spots
(acquired by tip onto probed with
by ~4
Inc a cmz glass 200-400 nt
chip
Pharmaceutica
labeled sample
ls, Inc.) cDNAs
TeleChem Flex-Chips
International,Custom Arrays
Inc. eChips Custom
Arrays
Discovery
Chip
Arrays
Vysis Inc. AmpliOnc
Microarray
kit
The German Prototypic Around 1,000Fluorescence/mas
PNA
Cancer macrochip spots on s spectrometry
with a 8 x
Institute on-chip synthesis12 cm chip
of probes
using f
moc or t-moc
chemistry
Table XXV: Companies that produce arrays, or devices and instrumentations
involved in the
production of arrays.
308
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
COMPANY PRODUCT/RESEARCH Website Address
ACLARA Plastic chips and
BioSciences, microfluidic systems
Inc. based
on "Lab-On-A-Chip"
microfluidics US
Patent
5,750,015: "Method
and
device for moving
molecules by the
application of a
plurality of
electrical fields").
Advanced Array BIO-CDTM: compact http://www.aat-array.com
disc
Technology S.A.platform for DNA
detection
Affymetrix, GeneChip~'arrays, http://www.affymetrix.com
Inc.,
including HIV, p450,
p53,
Rat Toxicology U34
arrays,
Agilent A subsidiary of http://www.agilent.com
Hewlett-
Technologies, Packard Company,
Inc plans to
expand its presence
in the
life science market
through
the introduction
of a new
DNA microarray program.
It uses inkjet printing
technology to manufacture
its oligo-based
DNA
microarrays. Licensed
from
Ed Southern/OGT.
LabChipTM-based
DNA and
RNA bioanalyzer
Alpha Innotech Alpha Innotech provideshttp://www.alpha-tec.net
Corp. innovation bioinformatic
imaging solutions
for
genetic discovery
designed
to acquire, manage,
and
analyze fluorescence,
chemiluminescence,
or
309
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
colorimetric microarray
slides, plates,
gels, blots, or
films.
Amersham Lucidea array spotter,http://www.apbiotech.com
Biosciences automated slide
processor,
scanner, spo~nder,
scoring
system
AlphaGene, Inc.Full length cDNA
FLEXTM
and MicroFLEX library
construction; High
Throughput Gene
Expression Profiling;
High
Throughput DNA
Sequencing; Bioinformatics
Applied Precision,~.t.ayWoRx is a
wide field
light source based
microarray scanner,
combines limitless
wavelength possibilities
with automation
and image
processing software.
Asper Ltd. Arrayed Primer
Extension
(APEX) and Asper
ChipReader 003
AVIVA BiosciencesDedicated to the
Corp. application of
breakthrough
multiple-force
biochip
technology for
genomics
and proteomics.
The
company is developing
an
integrated sample-to-result
AVIChipTM system
with an
emphasis on biological
sample preparation
and
310
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
chip-based molecular
manipulation. The
AVIChipTM system
will
separate and transport
a
variety of mRAIA,
or other
molecules from crude
biological samples
and
simultaneously perform
a
wide range of biological
and biochemical
analyses.
AVIVA's technology
allows fast, accurate,
automated, and high-
throughput biological
analysis on integrated
biochip systems
and
provides novelapproaches
to both drug development
and clinical diagnostics
Axon Instruments,Integrated Microarray
Scanner and Analysis
Software, simultaneously
scans microarray
slides at
two wavelengths
using a
dual laser scanning
system,
displays images
from two
wavelengths and
a ratio
image as they are
acquired
in real time; US$50,000)
BioArray Solutions,Light-controlled
LLC Electrokinetic Assembly
of
Particles near Surfaces
(LEAPS), enables
computer controlled
311
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
assembly of beads
and cells
into planar arrays
within a
miniaturized, enclosed
fluid
compartment on the
surface
of a semiconductor
wafer.
BioCat Distributor of cataloguehttp://biocat.de
and custom arrays
bioDevice Partners,Provides consulting
services to the
microarraying community
in the area of optics
and
instrumentation
BioDiscovery, ImaGeneTM, special
Inc. image
processing and data
extraction software;
CloneTracker: Databases
clones, plates,
and slides,
and offers array
design tool
and interfaces to
arrayers;
GeneSight: Powerful
expression analysis
software which features
statistical methods
as well a
visualization tools.
Biomedical MACROscopeTM for
Photometrics, reading genetic
Inc.,
microarrays, in
collaboration with
Canadian Genetic
Microarray Consortium
BioRobotics MicroGrid, for arraying
Ltd.
oligonucleotides
or cDNA
clones on glass
slides and
plastic chips)
Caliper LabChipsTM based
on
312
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Technologies microfluidics
Corp
Capital BiochipCreated to develop
Corp and
commercialize various
biochip technologies.
Cartesian PixSys PA Series:
for
Technologies, Automated liquid
Inc. handling
system for creating
high-
density arrays for
genomics
research. Scan Array
3000:
A Fluorescent Imaging
System for microarray
biochips
Cellomics, ArrayScanTM, cell-based
Inc.
"High Content Screening"
(HCS) for drug discovery
Cepheid Microfluidics
Clinical MicroDNA microchip-based
Sensors, Inc. medical diagnostics;
detection of directly
detect
DNA via electron
transfer.
Clondiag Chip Working on generation
and
Technologies application of DNA
microarrays
Clontech's Sells various humanhttp:l/www.clontech.com
Atlas"v' arrays
human cDNA
array
CombiMatrix CombiMatrix' core
Corporation technology is the
Lab-on-a-
Chip integrated
circuit.
These integrated
circuits
contain arrays of
microelectrodes
that are
individually addressable
using logic circuitry
on the
chip.
313
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Compugen LEADS""' drug discovery
platform for identifying
drug targets based
on the
analysis of EST
(Expressed
Sequence Tag) and
genomic databases,
expression results
from
chips and proteomics,
and
polymorphism detection
and qualification;
DNA
chip design and
analysis.
Corning ScienceProvides the Corning
Products DivisionMicroarray Technology
CMT-GAPS amino silane
coated slides and
CMT-
Hybridization chamber.
Cruachem Ltd, Manufactures the
U.I~
phosphoramidite
building
blocks for the synthesis
of
DNA.
CuraGen Corp. GeneCallingTM and
Quantitative Expression
Analysis (QEATM),
CuraMode, CuraTox
diaDexus, LLC Specialized in using
microarray technology
for
molecular diagnostics
Display SystemsdiscoveryARRAY slides
Biotech, Inc, (over 2400 expressed
cDNA fragments);
will
soon offer over
40,000
arrayed mouse and
human
genes
DNAmicroarray.comOffers complete
"made to
314
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
order" high density
DNA
microarray synthesis
and
analysis services.
Erie ScientificManufactures microslides
Company for microarrays.
Exiqon Microarray slides http://www.exiqon.com
and chips
Expression AnalysisCompany was formed
to
Inc provide GeneChip
processing and
gene
expression analysis
using
Affymetrix GeneChip
microarrays
Febit System for gene http://febit.com
expression
profiling or genotyping
Gene Logic, Flow-thru ChipT
Inc. : has
hundreds of thousands
of
discrete microscopic
channels that pass
completely through
it.
Probe molecules
are
attached to the
inner
surface of these
channels,
and target molecules
flow
through the channels,
coming into close
proximity to the
probes.
This proximity
facilitates
hybridization.
READSTM,
Restriction Enzyme
Analysis of Differentially-
expressed Sequences,
for
capturing and analyzing
the
overall gene expression
profile of a given
cell or
tissue type to
identify drug
315
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
targets
Geneka Oligonucleotide-based
Biotechnology microarray slide,
Inc. the
P.R.O.M. (Proteomic
Regulatory Oligonucleotide
Microarray). 35-45-mers
Genemachines OmniGrid, glass
slides or
Genomic nylon membranes
Instrumentation
Services, Inc.
GeneScan Biochip technology;http:llwww.~enescan-europe.com
high
throughput production
of
biochips
General ScanningLaser scanning
and
Inc micropositioning,
manufactures MicroArray
Biochip Scanning
System:
ScanArray~). Now
called
GSI Lumonics
Genisphere Provides fluorescently-http:~lwww. enisphere.com
labeled kits for
gene
expression arrays.
Uses
highly branched
nucleic
acids - dendrimer
technology.
Genetic Instrumentation
for DNA
Microsystems microarray-based
Inc. analysis.
Acquired by Affymetrix
Genicon SciencesDeveloped an ultra-
Corp sensitive signal
generation
and detection platform
technology based
on
Resonance Light
Scattering
(RLS) for the simple
and
316
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
efficient detection,
measurement and
analysis
of biological interactions
Genometrix Inc.BioscannerTM,
GeneView~, Universal
ArraysTM, Risk-Tox
Genomic Solutions,FlexysTM modular httn://www.~enomicsolutions.com
robotic
system, GeneTACTM
and
Genomic IntegratorTM
array
analysis products
automates
the imaging and
analysis of
gene microarrays
GENPAK Inc genpakARRAY 21
robotic
microarrayer system
and
genSTATION 3XL
manual
microarrayer system.
GeSiM The Nano-Plotter
is based
on piezoelectric
pipetting
principle
Genzyme MolecularSAGE': Serial Analysis
of
Oncology Gene Expression
Greiner Bio-oneReady to use biochiphttn://www.~inerbioone.com
kits
for genotyping
and SNP
detection, modified
slides
for microarraying
HP GeneArray Used by Affymetrix
and
Scanner others
Hypromatrix, Hypromatrix
Inc.
AntibodyArray TM
is
designed to detect
protein-
protein interactions,
post-
translational modification
and protein expression.
Hyseq Inc. Sequencing By
Hybridization.
HyX
317
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
platform and Gene
Discovery, HyGnostics,
and HyChipTM modules
Illumina, Inc. Utilizes fiber httn-.--/lwww.illumina.com
optics,
microfabrication,
and
advanced information
processing to create
arrays
where 250;000 discrete
sensors fit on
a probe the
diameter of the
head of a
pin. Technology:
"BeadArray."
Incyte Genomics,GEM Microarrays,
Inc. GeneJet'z"i array,
LifeSeq~
Database with estimated
100,000 genes,
and
LifeArray Microarray
Software.
IntegriDerm, Produces DermArray
Inc DNA
microarrays for
dermatologic research
JMAR's PrecisionDesigner and manufacturer
Systems, Inc of U~ exposure
and mask
aligner systems
specifically
designed for bio-chip
manufacturers.
Also
produces custom
micropositioning
systems
for micro-spotting
equipment and high
resolution dimensional
metrology and defect
inspection systems
for
quality assurance
of bio-
chips and DNA
318
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
microarrays
Lab-on-a-Chip.comProvides focused
information on all
Lab-on-
a-Chip technologies.
It
includes published
papers,
news, events, new
products,
suppliers, research
links,
jobs and discussion
forums.
Labman AutomationHDMS: Labman High-
Ltd., Density Microarray
Spotter
Lambda Ready to use biochiphttp://www.lambda.at
kits
for genotyping and
SNP
detection
Lifecodes Corp.Lifecodes MicroArray
System: LMAS
Lynx MegasortTM is a
bead-based
process providing
differential DNA
analysis
Medway MEDWAY designs,
develops, manufactures
and
commercialises medical
devices for diagnostics,
robotic systems,
optical
instruments, fluorescent
molecular markers,
sieving
microchips
Mergen Ltd ExpressChipTM
oligonucleotide
microarray
Memorec StoffelPIQOR technology http://www.memorec.com
for
producing custom
and
generic murine and
human
cDNA arrays
MetriGenix The 4D Array utilizes
Inc a
patented flow through
design that optimizes
the
319
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
surface area to
volume
ratio, has shorter
hybridization times,
provides larger
binding/signal capacity,
and is more readily
automated than flat.
biochips
Micralyne Inc.Fabricates micromachined
glass, silicon and
thin film
components for use
in
microfluidics.
MicroFab Manufactures piezoelectric
Technologies, drop-on-demand ink
Inc. jet
printing technology
for
microdispensing
fluids.
Micronics, Microfluidics based
Inc
systems for application
to
clinical laboratory
diagnostics:
MicrocytometerTM,
H-
FilterTM, T-SensorTM,
and
O.R.C.A. ~.Fluidics
Molecular Storm~ and FluorImager~
Dynamics, Inc
Molecular Tool,Genetic Bit Analysis,
Inc
GBA~ GenomaticTM.
Acquired by Orchid
Biocomputer on September
14, 1998.
Mosaic EZ-RAYS 1'"i activated
slide
Technologies, kits for DNA microarrays
Inc.,
Motorola BioChipLi h~pv//www.motorola.com/lifescien
d
3
D
l
d
cense
a
-
ge
pa
Systems technology from ces
Argonne
National Laboratory;
320
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
CodeLink Array System.
MWG Biotech Oligo-based microarrays,http:/lmwgatccn.mw~~:dna.com
custom chips, automated
systems
Nanolytics Developing Custom
Array
Synthesis Technology
Nanogen Electronic Addressing,hitp://www.nan~a~en.com
Concentration, and
Hybridization; NanoChip
automated workstations
for
SNP and STR analysis
NEN Life Science~CROMAXTM Human
Products cDNA Microarray
System I
for differential
gene
expression analysis
Operon Low density (320
or 370
Technologies, genes, 70-mers)
Inc.
OpArrays~ microarrays.
Orchid BioSciences,SNP-IT technology; http://www.orchid.com
Inc. Microfluidic chips;
applying microfabrication
processes in glass,
silicon,
and other materials
to
create three dimensional
structures. Contained
within these devices
are
small capillary
channels
less than a millimeter
wide.
OriGene Offers SmartArrayTM
chips
Technologies (Huamn), including
Inc. nuclear
hormone receptors,
homeobox/b-zip/HI,H
transciption factors,
tissue-
321
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
specific/inducible
transcription factors
, and
phosphotyrosine
Kinases
Oxford Gene Oligo-based microarrayhttp://www.o~t.co.uk
Technology
Ltd
Packard Bioscienced http:l/www~ackardbioscience.com
l
d
l
gy
roge
-coate
s
ides,
(Division of arrayers, scanner
and data
PerkinElmer) analysis software
Packard InstrumentBioChip Arrayer
Company
PamGene B.V. Flow-through technologyhttn://www.pam,~ene.com
for microarray
PanVera Intelligence Microarrayshttp://www.panvera.com
PE Applied TaqMan Assay, SYBERhttp://lifesciences.perkinelmer.com
Biosystems Green I dye Assay;
Integrated, Micro-Sample
Preparation System
for
Genetic Analysis
PharmaSeq, Multiplex DNA Diagnostic
Inc
Assay Based on
Microtransponder
Phase-1 MolecularMolecular and high
Toxicology, throughput toxicology
Inc.
using gene chips
(Licensed
from Xenometrix)
PicoRapid Picoarrays. PicoSlideshW//wpicorapid.de
and
Technologie microarray spotting
service
Protogene Surface tension
array on
Laboratories glass substrate;
"Printing"
reagents using drop-on-
demand technology.
Qiagen Operon Custom arrays and http:/lwww.operon.com
Array-
Ready oligo sets
322
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
R&D Systems Cytokine Expression
Array
allows one to determine
the
RNA level for
approximately 400
cytokines and related
factors in one standard
hybridization experiment.
(charged nylon membrane)
Radius BiosciencesCustom DNA, RNA,
PNA,
and Protein MicroArray
Chips
RELAB AG Developing BioChip
arrays
for diagnostic applications
(oncology). The
GeneStick
platform with arrays
on
plastic sticks and
a new
chemiluminescence
imager.
ResGen GeneFilters http://www.res~en.com
Invitrogen microarrays/VastArray
tissue arrays! GeneStorm
Expression Ready
full-
length clones
RoboDesign Its RoboArrayer
is
International integrated with
Inc. a vision
system to allow
for real-
time quantification
of spot
size and spot volume
during the printing
process.
Rosetta InpharmaticsFlexJetTM DNA
oligonucleotides
microarrays (in-situ
synthesized on a
glass
support via ink
jet printing
323
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
process); ResolverTM
Expression Data
Analysis
System. ,
Scienion Generic and customizedhttp://www.scienion.de
arrays
SciMatrix,
Inc Offers ArrayWorks
, a
complete line of
custom
microarray services,
for the
production, processing,
and
analysis of microarrays,
using PixSysTM arrayers
from Cartesian
Technologies. It
also
provides customized
ArrayEngine~ microarray
systems.
Sequenom DNA MassArray,
BiomassPROBE, Biomass
SIZE,
BiomassSEQUENCE,
BiomassSCAN,
BiomasslNDEX, and
SpectroChip
Sigma-Genosys PanoramaTME. coli http:/lwww.si ia-genosys.com
Ltd Gene
Arrays, 4,290 genes
per
array
SmartBead 3D UltraPlexTM microarrayhttp://www.smartbead.com
Technologies technology for applications
in SNP genotyping
and
gene expression
SuperArray Their gene expressionhttp://www.superarra,
Inc array .com
(GEArrayTM ) systems
(Human and mouse)
are
32~
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
designed for pathway-
specific gene expression
profiling
SurModics, Manufactures 3D-Linkl'"1
Inc
activated slides
for the
production of microarrays.
Uses amine-modified
DNA
to hybridize on
the surface
of the slide
Synteni, Inc. UniGEMTM Gene
Expression Microarray
TeleChem Offers whole system
parts:
International ChipMaker, SmartChips,
ArrayIt, Hybridization
Cassette, ScanArray
3000,
ImaGene Quantification
Software, and Super
Microarray Substrates
Third Wave Develops and
Technologies, commercializes simple,
Inc
low-cost nucleic
acid
platform technologies
to
fundamentally alter
disease
discovery, diagnosis
and
treatment. Invader~
assay
and CFLP~' Technology
Tissue Array Expression study
of protein
and in situ screening
of
mRNA.
VBC Genomics Custom oligonucleotidehttp://www.vbc-genomics.com
microarrays and
Affymetrix
GeneChip Services
V&P Scientific,Supplies replicators
Inc that
will make macroarrays
on
membranes, or microarrays
325
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
on slides.
Virtek Vision ChipReaderTM is
a high-
International sensitivity laser
Inc confocal
system for rapid
imaging of
the DNA microarrays.
Vysis, Inc. CGH-Comparative http:/lwww.vxsis.com
Genomic Hybridization;
The GenoSensor
Microarray System
includes genomic
microarrays, reagents,
instrumentation
and
analysis software.
Xanthon Developed a multiplexed,
microplate-based
electrochemical
detection
system for high-throughput
screening of compounds
for
their effects on
gene
expression. Based
on
measurement of
the
oxidation of guanine
on an
electrode
Xenometrix, Gene Profile Assay
Inc. and
bioinformatics
for gene
induction profile
analysis.
XENOPORE Corp Manufacturer of -
coated
microscope slides,
including silanated,
silylated, epoxy,
streptavidin, nickel
chelate,
and many other
surfaces.
Table XXVI: Array Databases and On-line Tools
326
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
Database Overview
GeneX A comprehensive list of is
gene expression
database and anal, sy's tools
is available at
NCGR's GeneX site
Microarray Gene Expression DatabaseMicroarray Gene Expression
MGED Database
Group (MGED Group, was formed to
facilitate the
adoption of standards for DNA-array
experiment annotation and data
representation, as well as
the introduction of
standard experimental controls
and data
normalisation methods.
Gene Expression Omnibus (GEO NCBI's Gene Expression Omnibus~GEO)
public gene expression repository
in
development.
ArrayDB
(htt~:/~enome.nh~,ri.nih. ov~ydb/schema.html)
at the National Human Genome Research
Institute
p,Array Center National Cancer Institute's
array schema.
expressDB. George Church Lab's at Harvard
Medical
School: a relational database
containing yeast
RNA expression data.
MAT Microarray Analysis Tool) at
Albert Einstein
College of Medicine: based
on Java, JDBC,
and Sybase SQL.
GATC consortium's published schema
GeneX: A Collaborative Internet Database
and
Toolset fox Gene Expression
Data at the
National Center for Genome
Resources
327
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
GenEx~ GenEx '"' of Silicon Genetics
is a public web
database that allows scientists
to freely
distribute and visualize gene
expression data
(text and image) from microarrays,
Affymetrix chips, and related
technologies. It
can also dynamically generate
several graphs
from the data being viewed,
such as: scatter
plots, trees, overlays, ordered
lists, line
graphs, or physical position
graphs. It is
designed to store annotations
and
interpretations on finished
experiments, and
can access data from SQI, databases
like
GATC or even from flat text
files.
Stanford MicroArray Database
(Oracle)
Arabidopsis cDNA Microarray Th
Results A
bid
i
i
l
e
ra
ops
s Funct
Genomics
ona
Consortium (AFGC)'s Arabidopsis
cDNA
Microarray Results
ArrayExpress ArrayExpress, being developed
at the
European Bioinformatics Institute,
will be a
public array-based gene expression
data
repository. An international
meeting on
Microarray Gene Expression Databases,
November 14-15, 1999.
MicroArray Explorer (MAExplorer), Dr. Peter Lemkin at the NCI
developed a Java
applet, MicroArray Explorer
(MAEx lorer),
which is currently being used
in the
Mammar'~ Genome Anatomy Program
CLUSFAVOR Dr. Leif Peterson's CLUSFAVOR:
Partitioning Large-sample Microarray-based
Gene Expression Profiles Using
Principal
Components Analysis
328
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
SAGEman SAGEmap: A Public Gene Expression
Resource, Alex E. Lash et al.,
Genome Res.
2000 July 1; 10(7): p. 1051-1060
J-Express Java program for analyzing
microarray data.
SOM and PCA implemented, by
Bjarte
Dysvik.
MicroArray Informatics at the
EBI
Table XXVII: Microarray Databases on the World Wide Web
___..
Project Name
..._.__.._.._. _~.._._. -MaeFDM
'' Abberdeen university
_ ~.
Af _ Consorsium
etrix ~ GATC
& Molecular dynamics ~ ~
.-, ~' ..._... . ........._..__._.........m.
H
. .__._......_....................................._................
... .... _._.._...._..._._.........._._.__-.
F Albert Einstein College of Medicine MAT
i
..._ _.. _.._...._..._.............__..........~.._._..........._........
_......._.._ ........
._~...~_._..._.........._..........................._..._._ _
....._ ... _ _. .
Another Microarray Database. (Jan AMAD
1, 2000 - v1.01)
~~ . ~
~~ ~nY
Ecole Normale Superieure private LGM
database) database
'
Ecole Normale Superieure (public
database)
__~ ,. ....~.._ ~... ~ ._. _ _ ..~...
..~.~..~..
European Bioinformatique Institute Arra~press
i ..M ~
~ _
George Church Lab's (Harvard) ExpressDB
Pevsner Lab's (Kennedy Krieger I
Institute) Dragon
~
~ -~
Manchester bioinformatics maxd I~
National center for Biotechnoloey Geo
Information (NCBI)
NCI-LECB MAExplorer
~
.._._
_~...__.._....................._............__................_...._..._._.___.
...___...__................_............._..._.._........._.._._.__._...._..__.
....._.......................................
National Human Genome Research .._...................._......_
Institute (NHi) _......
ArrayDB
y~~~
~~~~
1
....._..._._............._.~......__.......................____........._.~....
.................~~..............................
............................................_....~._.....__...._...............
..
_.._...~_.....~..............~...._..........~.......... p.Array Database
e......_..._._....._~_......~.... i
National Cancer
Institute Array
Center server (NIfI-CIT)
y
._..._..............._.._......._......_.......r.._.__.....;
m
NIEHS-NIH MApS
~!
San Diee~o Su ercomputer Center 2HAPI
(SDSC)
~
__~...~..~ .__..~
Silicon Genetics GenEx
329
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
EXAMPLE 17
Fetal chromosomal abnormalities are determined by analyzing SNPs wherein the
maternal
template DNA is homozygous and the template DNA obtained from the plasma is
heterozygous.
Plasma that is isolated from blood of a pregnant female contains both maternal
template DNA and
fetal template DNA. Any number of SNP detection methods can be used to analyze
the maternal
and plasma DNA. In this example, SNPs are analyzed by the CodeLink SNP
Bioarray System,
which is manufactured in a collaborative effort by Motorola and Amersham
Biosciences, however
other microarrays may be used. Amersham sells the CodeLink P450 Bioarray,
which is designed to
genotype various regions of the P450, which is located on chromosome 6.
However, Amersham may produce custom CodeLink arrays, which can be designed to
analyze regions of any chromosome including chromosome 1, 2, 3, 4, 5, 6, 7, 8,
9, 10, 1 l, 12, 13,
14, 15, 16, 17, 18, 19, 20, 21, 22, X or Y.
Collection of Blood Samples
In accordance with an IRB approved study, blood samples are collected from
pregnant
women after informed consent is granted. Blood is collected into 9 ml EDTA
Vacuette tubes
(catalog number NC9897284) and 0.225 ml of 10% neutral buffered solution
containing
formaldehyde (4% w/v), is added to each tube, and each tube gently is
inverted. The tubes are
stored at 4°C until ready for processing.
Any number of agents that impede cell lysis, stabilize cell membranes, or
cross-link cell
membranes can be added to the tubes including but not limited to formaldehyde,
and derivatives of
formaldehyde, formalin, glutaraldehyde, and derivatives of glutaraldehyde,
crosslinkers, primary
amine reactive crosslinkers, sulfhydryl reactive crosslinkers, sulfhydryl
addition or disulfide
reduction, carbohydrate reactive crosslinkers, carboxyl reactive crosslinkers,
photoreactive
crosslinkers, cleavable crosslinkers, AEDP, APG, BASED, BM(PEO)3, BM(PEO)4,
BMB, BMDB,
BMH, BMOE, BS3, BSOCOES, DFDNB, DMA, DMP, DMS, DPDPB, DSG, DSP, DSS, DST,
DTBP, DTME, DTSSP, EGS, HBVS, sulfo-BSOCOES, Sulfo-DST, Sulfo-EGS or compounds
listed in Table XXIII. Any concentration of agent that stabilizes cell
membranes, impedes cell
330
CA 02517017 2005-08-24
WO 2004/079011 PCT/US2003/027308
lysis, or cross-links cell membranes can be added. In a preferred embodiment,
the agent that
stabilizes cell membranes or impedes cell lysis is added at a concentration
that does not impede or
hinder subsequent reactions.
An agent that stabilizes cell membranes may be added to the maternal blood
sample to
reduce maternal cell lysis including but not limited to aldehydes, urea
formaldehyde, phenol
formaldehyde, DMAE (dimethylaminoethanol), cholesterol, cholesterol
derivatives, high
concentrations of magnesium, vitamin E, and vitamin E derivatives, calcium,
calcium gluconate,
taurine, niacin, hydroxylamine derivatives, bimoclomol, sucrose, astaxanthin,
glucose,
amitriptyline, isomer A hopane tetral phenylacetate, isomer B hopane tetral
phenylacetate,
citicoline, inositol, vitamin B, vitamin B complex, cholesterol hemisuccinate,
sorbitol, calcium,
coenzyme Q, ubiquinone, vitamin K, vitamin K complex, menaquinone, zonegran,
zinc, ginkgo
biloba extract, diphenylhydantoin, perftoran, polyvinylpyrrolidone,
phosphatidylserine, tegretol,
PABA, disodium cromglycate, nedocromil sodium, phenytoin, zinc citrate,
mexitil, dilantin, sodium
hyaluronate, or polaxamer 188.
' 15
Isolation of Plasma and Maternal Cells
The blood is stored at 4°C until processing. The tubes are spun at 1000
rpm for ten minutes
in a centrifuge with braking power set at zero. The tubes are spun a second
time at 1000 rpm for
ten minutes. The supernatant (the plasma) of each sample is transferred to a
new tube and spun at
3000 rpm for ten minutes with the brake set at zero. The supernatant is
transferred to a new tube
and stored at -80°C. Approximately two milliliters of the "huffy coat,"
which contains maternal
cells, is placed into a separate tube and stored at -80°C.
Isolation of DNA
DNA is isolated from the plasma sample using the Qiagen Midi Kit for
purification of DNA
from blood cells, following the manufacturer's instructions (QIAmp DNA Blood
Midi Kit, Catalog
number 51183). DNA is eluted in 100 p,l of distilled water. The Qiagen Midi
Kit also is used to
isolate DNA from the maternal cells contained in the "huffy coat."
Identification of Homozygous Maternal SNPs
CodeLink SNP Bioarray
331
DEMANDE OU BREVET VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVET COMPREND
PLUS D'UN TOME.
CECI EST LE TOME 1 DE 2
CONTENANT LES PAGES 1 A 331
NOTE : Pour les tomes additionels, veuillez contacter le Bureau canadien des
brevets
JUMBO APPLICATIONS/PATENTS
THIS SECTION OF THE APPLICATION/PATENT CONTAINS MORE THAN ONE
VOLUME
THIS IS VOLUME 1 OF 2
CONTAINING PAGES 1 TO 331
NOTE: For additional volumes, please contact the Canadian Patent Office
NOM DU FICHIER / FILE NAME
NOTE POUR LE TOME / VOLUME NOTE:
