Note: Descriptions are shown in the official language in which they were submitted.
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
PLANT LIMIT DEXTR1NASE INHIBITOR.
1 FIELD OF INVENTION
The present invention is based upon the identification of a protein, limit
dextrinase
inhibitor {LDI), which modifies starch metabolism in plants, especially the
number, size and
composition of starch granules in plants. In particular, the invention relates
to plant limit
dextrinase inhibitor nucleic acid molecules, plant limit dextrinase inhibitor
gene products,
antibodies to plant limit dextrinase inhibitor gene products, plant limit
dextrinase inhibitor
regulatory regions, vectors and expression vectors with plant limit dextrinase
inhibitor genes,
cells, plants and plant parts with plant limit dextrinase inhibitor genes,
modified starch from
such plants and the use of the foregoing to improve agronomically valuable
plants.
2BACKGROUND
Starch consists of two glucose polymers, essentially linear amylose and highly
branched amylopectin, arranged into a three dimensional, semicrystalline
structure ' - the
starch granule. The starch granule consists of alternate semicrystalline and
amorphous layers
which contain different amounts of branched and unbranched polymer. Starch is
the product
of carbon fixation during photosynthesis in plants, and is the primary
metabolic energy
reserve stored in seeds and fruit. For example, up to .75°~0 of the dry
weight of grain in
cereals is made up of starch. The importance of starch as a food source is
reflected by the
fact that two thirds of the world's food consumption (in terms of calories) is
provided by the
starch in grain crops such as wheat, rice and maize.
Starch is the product of photosynthesis, and is analogous to the storage
compound
glycogen found in bacteria, fungi and animals. It is produced in the
chloroplasts or
amyloplasts of plant cells, these being the plastids of photosynthetic cells
and
non-photosynthetic cells, respectively. The biochemical pathway leading to the
production of
starch in leaves has been well characterised, and considerable progress has
also been made in
elucidating the pathway of starch biosynthesis in storage tissues.
The biosynthesis of starch molecules is dependent on a complex interaction of
numerous enzymes, including several essential enzymes such as ADP-Glucose
pyrophosphorylase, a series of starch syntheseswhich use ADP glucose as a
substrate for
forming chains of glucose linked by alpha-1-4 linkages, and a series of starch
branching
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
2
enzymes that link sections of polymers with alpha-I-6 Linkages to generate
branched
structures (Smith et al., 1995, Plant Physiology, 107:673-677). Further
modification of the
starch by yet other enzymes, i.e. debranching enzymes (isoamylases or limit
dextrinases) or
disproportionating enzymes, can be specific to certain species.
The fine structure of starch is a complex mixture of D-glucose polymers that
consist
essentially of linear chains (amylose) and branched chains (amylopectin)
glucans. Typically,
amylose makes up between 10' and 25% of plant starch, but varies significantly
among
species. Amylose is composed of linear D-glucose chains typically 250-670
glucose units in
length (Tester, 1997, in: Starch Stnzcture and Functionality, Frazier et al.,
eds., Royal Society
of Chemistry, Cambridge; UK). The linear regions of amylopectin are composed
of Low
molecular weight and high molecular weight chains, with the low ranging from 5
to 30
glucose units and the high molecular weight chains from 30 to 100 or more. The
amylose/amylopectin ratio and the distribution of low and high molecular
weight D-glucose
chains can affect starch granule properties such as gelatinization
temperature, retrogradation,
and viscosity (Blanshard, 1987). The characteristics of the fine structure of
starch mentioned
above have been examined at length and are well known in the art of starch
chemistry.
It is known that starch granule size and amylose percentage change during
kernel
development in maize and during tobacco Leaf development ~(Boyer et al., 1976,
Cereal Chem
53:327-337). In their classic study Boyer et al. concluded the amylose
percentage of starch
decreases with decreasing granule size in later stages of maize kernel
development.
Starch is the most significant form of carbon reserve in plants in terms of
the ariiount
made and the universality of its distribution among different plant species.
Starch is also
highly significant to man. Firstly, it forms a major component of animal
diets, supplying
man and his domestic animals with a large portion of their carbohydrate
intake. Secondly,
purified starch is used industrially in the production of paper, textiles,
plastics and adhesives,
as well as providing the raw material for some bio-reactors. Starches from
different species
have preferred uses. On a world scale, starch producing crops are
agriculturally and
economically by far the most important, and these crops include wheat, barley,
maize, rice
and potatoes. Typically, staxch is mixed with water and cooked to form a
thickening agent or
gel. Of central importance are the temperature at which the starch cooks, the
viscosity that
the agent or gel reaches, and the stability of the gel viscosity over time. ,
The physical
properties of unmodified starch limit its usefulness in many applications., As
a result,
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
3
considerable effort and expenditure is allocated to chemically modify starch
(i.e. cross-
Iinking and substitution) in order to overcome the numerous limitations of
unmodified starch
and to expand industrial usefulness. Modified starches can be used in foods,
paper, textiles,
and adhesives.
The size and uniformity of the starch granule present in the harvested organ
of a plant
will affect the processing efficiency of the crop, the quality of a processed
product and the
profitability of the process.
Each species produces starch granules with a range of sizes. Potato starch,
for
example, comprises- granules of all sizes withui a certain range. By contrast,
wheat or barley
starch is composed of granules which may be either large (A type) or small (B
type). The
production of starch comprising granules of a more uniform size would reduce
the need for,
and cost of, post harvest processing. Such starch would have more uniform
gelling properties.
In wheat or barley the elimination of the B granules would improve starch
extractability.
Furthermore, it has recently been discovered that the proportion of B granules
influences'
water ~ absorption and hence the water content of dough, an important quality
in
breadmaking.The starch debranching enzyme limit dextrinase (LD) (EC 3.2.1.41)
(also
known as R-enzyme, pullulanase, a -dextrin 6-glucanohydrolase) hydrolyses
specifically a
1-6 glucosidic links in branched dextrins. In cereals, LD is primarily
synthesised in the
aleurone during germination. Gene expression is stimulated by embryo-derived
gibberellins,
and the enzyme is exported to the endosperm (Manners and Yellowlees, 1971;
Manners and
Yellowlees 1973; Hardie, 1975; (Schroeder & MacGregor, 1998). Here, LD helps
to break
down starch during germination, or during the malting of barley, by releasing
dextrins from
amylopectin .which can be further hydrolysed by a- and (3-amylase to provide
sugars to be
used as a carbon source for the germinating embryo. LD is also synthesised and
active in the
embryo and endosperm during early grain development (up to four weeks post
anthesis),
albeit at much lower levels; about one tenth of that found during germination
(Lenoir et al.,
1984; Sissons et al., 1993; (Burton et al., 1999); (Kristensen et al., 1999)).
The timing and
location of LD activity during grain development suggests that LD may also
play a role in
starch formation.
A ~rnodel of amylopectin synthesis, the glucan trimming model, is proposed to
function through the coordinated action of starch syntheses, starch branching
enzyme, which
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
4
introduces the oc 1-6 linkages, and starch debranching enzymes. Debranching
enzyme is
thought to remove outer-branched chains from the growing molecule but cannot
access inner
branches (Ball et al., 1996; Myers et al., 2000). An alternative model for
arnylopectin
synthesis has been proposed whereby it has been argued that the starch
degrading enzymes
are not required for amylopectin synthesis, but serve to prevent the
accumulation of non-
amylopectin phytoglycogen-Iike polymers (Zeeman et aI I99~). Furthermore, the
roles of the
two 'classes of debranching enzymes, LD and isoamylase, has been a matter of
some debate.
Barley isoamylase is also expressed in the endosperm during grain development
(Sun et aL,
1999). In the absence of debranching activity, a very highly branched form of
starch, known
as phytoglycogen is formed, as is seen in the SUGARY mutants of maize and
rice. Both the
maize (James et al., 1995) and rice (Nakamura et al., 1996a) SUI genes were
found to encode
isoamylase, however the sul mutations in maize and rice are pleiotropic, both
have reduced
LD activity (Nakamura et al. 1996b, 1997). Isoamylase mutants of maize
(Creech, 1965) and
barley (Burton et al'., 2002) have changes in the number and structure of
starch granules.
Recently a null mutation in maize LD (zpul ) has been described, in which
apparently normal
starch quality and quantity accumulates in the endosperm. However, the
'zpullsul double
maize mutant, having reduced activity of isoamylse and pullulanase showed
reduced starch
levels compared to sul alone, arguing for a compensatory role of LD in the sul
mutant for
amylopectin biosynthesis (binges et al., 2003). In addition it was observed
that there was an
increase in the number of starch granules in the double mutant and a decrease
in the average
size of the granules (binges et al., 2003).
Although the biochemical pathway leading to the production of starch in leaves
and
storage organs has been extensively studied, the processes involved in the
initiation and
control of granule size are not understood. There is therefore an interest in,
and a need for, a
method of modifying the number and/or size of starch granules in plants which
has not been
met by the prior art.
During germination, LD is found in a "free" and an inactive "bound" form,
which can
be released and activated by treatment with reducing agents, which may
activate proteases
(Longstaff and Bryce, 1993). It is thought that bound LD may be a limiting
factor in the
conversion of starch to sugars during malting (Sissons et al., 1995) and hence
contribute to
the efficiency of the conversion of starch to alcohol in brewing. Bound LD is
thought to be
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
complexed with limit dextrinase inhibitor (LDI), two heat stable low molecular
weight
(approximately 12.5 kD) proteins of differing pI (7.2 and 6.7) (Macri et al.,
1993);
(MacGregor et al., 1994). Peptide sequencing of these LDIs showed them both to
have the
same amino acid sequence, and to be identical to the deduced sequence of a
barley cDNA
thought to encode an a-amylase/trypsin inhibitor, with a proposed structure
consisting of four
a-helices joined by Ioops with four intramolecular disulphide bonds and one
free cysteine.
The isoforms of the inhibitors were found to differ through a glutathione
residue bound to the
free thiol group of the Iow pI form, and cysteine to the high pI form and were
found to be
specific in their inhibitory effect for LD, not inhibiting a-amylase or
trypsin (MacGregor et
al., 2000). The nascent protein is predicted to possess a cleaved N-terminal
signalling peptide
of 24 amino acids, and a mature length of 123 amino acids. Modification of
this inhibitor
activity may alter the malting quality of barley, but to date this has not
been demonstrated
(MacGregor et al., 2000). There is, furthermore, no indication or suggestion
in the prior art
that any limit dextrinase inhibitor gene can be used to alter the number
and/or size'of starch
granules in plants. .
3 SUMMARY OF THE INVENTION
In a first aspect of the invention, there is provided a method for producing
plants with
starch granule modification comprising introducing into a plant a nucleotide
sequence
comprising a limit dextrinase inhibitor gene as shown in SECT ID No.l, or a
fragment or
variant thereof, or a sequence having at least 40% identity thereto.
Preferably, the starch granule modification is one or more of the following:
altered
number and/or size of starch granules or granules of a more uniform size, or
altered structure
or composition of starch:
In a second aspect of the invention, there is provided a method for producing
plants
with altered ability to degrade starch comprising introducing into a plant a
nucleotide
sequence comprising a limit dextrinase inhibitor gene as shown in SEQ ID No.l,
or a
fragment or variant thereof, or a sequence having at least 40% identity
thereto.
In the present application, a limit dextrinase inhibitor gene is defined as:
(l) a nucleotide sequence encoding a limit dextrinase inhibitor protein; or
(ii) a nucleotide sequence encoding a protein which is substantially
homologous to a
limit dextrinase inhibitor protein, the sequence having at least 60% identity
thereto;
or
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
6
(iii) a nucleotide sequence encoding a polypeptide comprising an amino acid
sequence
which is substantially homologous to a limit dextrinase inhibitor protein, the
sequence
having at Least 60% identity thereto; or
(iv) a nucleotide sequence which hybridises under stringent conditions to a
sequence of
(i), (ii) or (iii) or its complement.
The nucleotide sequence may be an isolated.nucleotide sequence.
Preferably the limit dextrinase inhibitor gene is a plant gene. Suitable genes
include
the Ho~deurri vulgare sequence given in~SEQ ID No. 3; the T~iticum aestivu~
sequence given
in SEQ m No. 5; the Ho~deum spohtaneum sequence given in SEQ m No. 7; the
O~yza
sativa sequence given in SEQ m No. 9; the TYiticum du~urn sequence given in
SEQ ID No.
11 or the Zea ways sequence given in SEQ ID No. 13. Particularly preferred
nucleotide
sequences comprising limit dextrinase inhibitor genes include the barley limit
dextrinase
inhibitor sequence shown in SEQ ID No. 1. Suitably a fragment or .variant of
any one of the
above sequences or a sequence substantially homologous thereto may also be
used in the
present invention. Further nucleotide sequences comprising limit dextrinase
inhibitor genes
may be identified by sequence homology, for example by designing degenerate
PCR primers
using known limit dextrinase inhibitor genes as described in the Examples
herein. '
Nucleotide sequences comprising limit dextrinase inhibitor genes may also be
identified within database collections of nucleic acid or protein sequences
by, for example
performing a BLAST with a known limit dextrinase inhibitor sequence in order
to recover
homologous sequences. Preferred nucleotide sequences according to this
embodiment of the
invention include the barley,limit dextrinase inhibitor sequence shown in SEQ
m No. 1.
A nucleotide sequence comprising a limit dextrinase inhibitor gene, as defined
above,
may additionally comprise regulatory elements controlling its expression. The
regulatory
elements may be homologous or heterologous to the nucleotide sequence. The
nucleotide
sequence comprising a limit dextrinase inhibitor gene, and/or the regulatory
elements, may be
native or foreign to the plant into which it is introduced.
The nucleotide sequences of the invention may be DNA, RNA or any other option.
The present invention provides a method for producing plants with an altered
number,
size or composition of starch granules. Starch degradation may be altered by
augmenting or
disrupting the expression of the endogenous gene or genes involved in starch
degradation,
particularly debranching enzymes. Enzyme activity may be up-regulated or down-
regulated.
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
7
Over expression of the introduced nucleotide sequence comprising a Iimit
dextrinase inhibitor
gene, i.e. increasing the copy number of the introduced sequence such that
more Iimit
dextrinase inhibitor protein is produced will Iead to there being less limit
dextrinase activity
and less starch degradative capacity. Decreasing the amount of limit
dextrinase inhibitor,
which may be achieved, for example, by antisense down regulation, co-
suppression (e.g. by
introduction of partial sense sequences), or double stranded RNA technology
(also known as
duplex technology), all techniques well known in the art, will lead to there
being more limit
dextrinase activity and more starch degradative capacity
As far as antisense nucleic acid is .concerned, introducing the coding region
in the
reverse orientation to that found in nature can result in the down-regulation
of the gene and
hence the production of less or none of the gene product. The RNA transcribed
from
antisense DNA is capable of binding to, and destroying the function of, a
sense RNA of the
sequence normally found in the cell, thereby disrupting function. Examples of
suitable
antisense DNA's are the antisense DNA's of the sense sequence shown in SEQ )D
No. 1.
Double stranded RNA technology also acts via the formation of stable double
stranded RNA
molecules.
The invention also encompasses plants produced by the method of the invention,
and
propagating material of said plants such as seeds and tubers. The present
invention also
provides a plant cell from a plant produced by the method of the invention. In
each case, the
plant, propagating material or plant cell contains therein a nucleotide
sequence encoding a
limit dextrinase inhibitor according to the invention. The invention further
provides starch of
said plants.
In a further aspect of the invention there are provided novel nucleotide
sequences
comprising limit dextrinase inhibitor genes, or fragments thereof, useful in
the method of the
invention. These sequences include the barley sequence shown in SEQ m NO 1, or
part
thereof, or a homologous sequence having at least 60% identity thereto.
In a further aspect of the invention is provided limit dextrinase inhibitor
gene
products. The invention includes a protein comprising an amino acid sequence
as shown in
SEQ >D No.2, a fragment thereof, or an amino acid sequence having at least 99%
identity
thereto.
The degree to which the number and/or size of the starch granules of the plant
is
affected will depend at least upon the nature of the nucleotide sequence
introduced into the
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
8
plant, and the amount present. By altering these variables, a person skilled
in the art can
regulate the degree to which starch granule number and/or size is altered
according to the
desired end result.
Preferably the sequence is under the control of a promoter, which promoter
preferably
directs expression in the starch storage tissue or is a constitutive promoter
which is expressed
in a starch storage tissue. A suitable promoter in potato would-be the
promoter of the patatin
gene, for example. A suitable promoter in cereals would be an endosperm
specific promoter
such as the promoter of the wheat high molecular weight glutenin (HMWG) gene,
or the
maize ubiquitin promoter, for example.
The nucleotide sequences of the invention are preferably in the form of a
vector.
Such vectors form an additional aspect of the invention. The vector may be,
for example, a
plasmid, cosmid or phage. Vectors will frequently include one or more
selectable markers to
enable selection of cells that have been transfected or transformed and to
enable the selection
of cells harbouring vectors incorporating heterologous DNA. Alternatively the
selectable
marker gene may be in a different vector to be used simultaneously with a
vector containing
the gene of interest.
Examples of suitable marker genes include antibiotic resistance genes such as
those
conferring resistance to kanamycin, 6418 and hygromycin (npt II, hyg-B);
herbicide
resistance genes such as those conferring resistance to phosphinothricin and
sulphonamide
based herbicides (bar and sul respectively; EP-A-242246, EP-A- 0369637) and
screenable
markers such as beta-glucuronidase (GB2197653), luciferase and green
fluorescent protein.
The marker gene is preferably controlled by a second promoter which allows
expression in
cells other than the seed, thus allowing selection of cells or tissue
containing the marker at
any stage of development of the plant. Preferred second promoters are the
promoter of the
nopaline synthase gene of Agrobacterium and the promoter derived from the gene
which
encodes the 35S subunit of cauliflower mosaic virus (CaMV) coat protein. In
cereals, the
promoters of the rice actin gene and the maize ubiquitin gene axe preferred.
However, any
other suitable second promoter may be used.
The present invention is applicable to all plants which produce or store
starch.
Examples of such plants are cereals such as maize, wheat, rice, sorghum,
barley; fruit
producing species such as banana, apple, tomato or pear; root crops such as
cassava, potato,
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
9
yam or turnip; oilseed crops such as rape seed, canola, sunflower, oiI palm,
coconut, linseed
or groundnut; meal crops such as soya bean or pea; and any other suitable
species.
In a preferred embodiment of the present invention, the method comprises the
additional step of growing the plant, and harvesting the starch therefrom. In
order to harvest
the starch, it is preferred that the plant is grown until it begins to yield
fruit, seed or tubers
which may then be removed. In a further preferred embodiment, the propagating
material
from the plant may be removed, for example the seeds. The plant part can be an
organ such
as a stem, root, leaf, or reproductive body. Alternatively, the plant part may
be a modified
organ such as a tuber, or the plant part is a tissue such as endosperm.
The present invention also provides a plant cell harbouring a suitable
sequence, such
as a sequence disclosed in the present invention, under the control of a
suitable promoter as
described above.
In a still further aspect the invention provides the use of a nucleotide
sequence
comprising a limit dextrinase inhibitor gene to produce plants with altered
number, size or
composition of starch granules. '
Preferred features of each aspect of the invention are as for each other
aspect nautatis
mutahdis.
3.1 SEQUENCE IDENTIFIERS
The present invention will now be illustrated by way of non-limiting examples,
with
reference to the sequence identifiers and Figures, in which:
SEQ ID NO 1 shows the nucleotide and derived amino acid sequence for the
isolated
Hordeum vulgare cDNA clone.
SEQ ID NO 2 shows the derived amino acid sequence for the isolated Hordeum
vulgate
cDNA clone.
SEQ D7 NO 3 shows the nucleotide and derived amino acid sequence for the
Hordeum
vulgare cDNA clone for an alpha-amylase/trypsin inhibitor Genbank accession
number
X13443.
SEQ >D NO 4 shows the derived amino acid sequence for the Hordeum vulgare cDNA
clone
for an alpha-amylaseltrypsin inhibitor Genbank accession number X13443.
SEQ ID NO 5 shows the nucleotide and derived amino acid sequence for the
Triticum
aestivum cDNA for the PUP88 protein Genbank accession number X99982.
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
SEQ ID NO 6 shows the derived amino acid sequence for the Triticum aestivuna
cDNA for
the PUP88 protein Genbank accession number X99982.
SEQ ID NO 7 shows the nucleotide and derived amino acid sequence for the
HoYdeum
spohteneum cDNA for the Itrl gene for BTI-Cme2.2 protein Genbank accession
number
AJ222975.
SEQ 1D NO 8 shows the derived amino acid sequence for the Hordeum spofZteneum
cDNA
for the Itrl gene for BTI-Cme2.2 protein Genbank accession number AJ222975.
SEQ ID NO 9 shows the nucleotide and derived amino acid sequence for the O~yza
sativa
cDNA for the putative hageman factor inhibitor protein Genbank accession
number
AP005I97.
SEQ ID NO 10 shows the derived amino acid sequence for the Or'yza sativa cDNA
for the
putative hageman factor inhibitor protein Genbank accession number AP005197.
SEQ 1D NO 11 shows the nucleotide and derived amino acid sequence for the
Triticum
durum cDNA for the alpha amylase inhibitor protein Genbank accession number
X61032.
SEQ ID NO 12 shoal s the derived amino acid sequence for the Ti~itieum durum
cDNA for the
alpha amylase inhibitor protein Genbank accession number X61032.
SEQ ID NO 13 shows the nucleotide and derived amino acid sequence for the Zea
mat's
cDNA for the Hageman factor inhibitor protein Genbank accession number X54064.
SEQ lD NO 14 shows the derived amino acid sequence for the Zea mat's cDNA for
the
Hageman factor inhibitor protein Genbank accession number X54064.
SEQ 117 NO 15 shows the amino acid sequence for the Eleusine coracana alpha
amylase/trypsin inhibitor protein accession number WILAI.
SEQ ID NO 16 shows the amino acid sequence for the Secale cereale trypsin
inhibitor
protein accession number 529002.
SEQ ID NO 17 shows the nucleotide sequence for a PCR primer InhibS.
SEQ ID NO 18 shows the nucleotide sequence for a PCR primer Inhib6.
SEQ ID NO 19 shows the nucleotide sequence for a PCR primer OCSF.
SEQ lD NO 20 shows the nucleotide sequence for a PCR primer OCS-R.
SEQ ID NO 21 shows the nucleotide sequence for a PCR primer BarI.
SEQ ID NO 22 shows the nucleotide sequence for a PCR primer BarII.
SEQ ID NO 23 shows the nucleotide sequence for a PCR primer OCSII.
SEQ ID NO 24 shows the nucleotide sequence for a PCR primer TUBF.
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
11
SEQ ID NO 25 shows the nucleotide sequence for a PCR primer TUBR.
4. BRIEF DESCRIPTION OF THE FIGURES
Figure 1 shows an alignment of limit' dextrinase inhibitor amino acid
sequences.
Figure 2 shows the transformation vector pYSUanti. pYSUanti consists of the
maize
ubiquitin (Ubi-1) promoter, the LDI gene (LDI) in antisense direction and the
OCS terminator
(OCS). I: primer site Inhib-6, O: primer site OCS-II.
Figure 3 shows PCR of genomic DNA from To transformed plants of different
lines
transformed with pYSUanti. (A) primers Inhib-6 + OCS-II for the LDI gene in
antisense
direction (~ 17 bp). (B) primers BAR-I + BAR-II for the bar gene (534 bp). (C)
primers TUB-
F+ TUB-R for the tubuliu gene (217 bp). U1-7: independent transgenic lines;
wt: wildtype
barley plant; ~,: ~,lHihd III molecular weight marker; -ve: negative control
of PCR.
Figure 4 shows the analysis of six single segregating Tl seeds of transgenic
line U3.
Figure 5 shows an immunoblot of LDI extracts of mature transgenic and wildtype
grain.
Figure 6 shows the limit dextrinase inhibitor activity of mature wildtype and
homozygous
transgenic grain. The control (100%) represents the amount of LD used for each
assay. LDI
extracts corresponding to 10 ~.g protein were mixed with LD and assayed for LD
activity. wt:
wildtype; U3: homozygous TZ generation transgenic line U3; U4: homozygous Ta
generation
transgenic line U4. Each value represents the mean ~'SE of three replicate
experiments.
Figure 7 shows environmental scanning electron micrographs of the outer
endosperm region
of cross-sections of four single barley grains.
Figure S shows the separation of total a -glucan by Sepharose CL2B
chromatography. (A)
wildtype and homozygous T2 generation transgenic line U3. (B) wildtype and
homozygous
T2 generation transgenic line U4. Samples of total a-glucans were prepared
from mature
endosperms of wildtype and transgenic barley grains as described in
experimental
procedures. After chromatography, the fractions were stained with Iodine
solution and the
absorbance at 595nm measured. The absorbance is expressed as percentages of
maximum
absorbance. Each value represents the mean ~ SE of three replicate
experiments. Whore
absent, the error bars are smaller than the symbols.
Figure 9 shows the nucleotide and amino acid percentage identities of the
sequences hereof.
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
12
5. DETAILED DESCRIPTION OF THE INVENTION
The' invention relates to a family of plant Iimit dextrinase inhibitor genes.
In various
embodiments, the invention provides plant Iimit dextrinase inhibitor nucleic
acid molecules;
plant limit dextrinase inhibitor regulatory regions; plant limit dextrinase
inhibitor promoters;
and vectors incorporating sequences encoding plant limit dextrinase inhibitor
nucleic acid
molecules of the invention. Also provided are plant limit dextrinase inhibitor
gene products,
including, but not limited to, transcriptional products such as mRNAs,
antisense and
ribozyme molecules, and translational products such as the plant limit
dextrinase inhibitor
protein, polypeptides, peptides and fusion proteins related thereto;
genetically engineered
host cells that contain any of the foregoing nucleic acid molecules and/or
coding sequences
or compliments, variants, or fragments thereof operatively associated with a
regulatory
element that directs the expression of the gene and/or coding sequences in the
host cell;
genetically-engineered plants derived from host cells; modified starch and
starch granules
produced by genetically-engineered host cells and plants; and the use of the
foregoing to
improve agronomically valuable plants.
In the context of the present invention, "plant limit dextrinase inhibitor
protein" includes any limit dextrinase inhibitor protein which is capable of
changing starch
granule production in a plant. By definition, the plant limit dextrinase
inhibitor protein will
be of plant origin. Preferred fragments of plant limit dextrinase inhibitor
proteins are those
which retain the ability to change starch granule synthesis.
For purposes ~ of clarity, and not by way of limitation, the invention is
described in the subsections below in terms of (a) plant limit dextrinase
inhibitor nucleic acid
molecules; (b) plant limit dextrinase inhibitor gene products; (c) transgenic
plants that
ectopically express plant limit dextrinase inhibitor protein; (d); transgenic
plants in which
endogenous plant limit dextrinase inhibitor .protein expression is suppressed;
(e) starch
characterized by altered structure and physical properties produced by the
methods of the
invention.
5.1 PLANT LIMIT DEXTRINASE INHIBITOR NUCLEIC ACIDS
The nucleic acid molecules of the invention may be DNA, RNA and comprises the
nucleotide sequences of a plant limit dextrinase inhibitor gene, or fragments
or variants
thereof. A polynucleotide is intended to include DNA molecules (e.g., cDNA,
genomic
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
13
DNA), RNA molecules (e.g., hnRNA, pre-mRNA, mRNA, double-stranded RNA), and
DNA
or RNA analogs generated using nucleotide analogues. The polynucleotide can be
single-stranded or double-stranded:
The nucleic acid molecules are characterized by their homology to known limit
dextrinase inhibitor genes, such as those from barley, wheat, maize, rice,
ragi, rye and durum
wheat.
The present invention provides:
(i) an isolated nucleotide sequence of SEQ. ID. No. 1, or a sequence having at
least
80% identity thereto;
(ii) an isolated nucleotide sequence that is more than 66%, 66%, 4~7% and 50%
identical to SEQ. ID. Nos. 5, 7, 9 and 13 respectively, or a fragment or
variant
thereof; or
(iii) an isolated nucleotide sequence encoding a polypeptide comprising an
amino acid
sequence that is more than 82%, 80%, 68%, 35%, 55%, 68% and 81% identical to
SEQ. m. Nos. 2, 6, 8, 10, 14, 15 and 16 respectively, or a fragment or variant
thereof; or
(iv) a nucleotide sequence which hybridises under stringent conditions to a
sequence
of (i), (ii) or (iii), or its complement.
As used herein the phrase nucleic acid sequence refers to the sequence of a
nucleic
acid molecule.
A preferred nucleic acid molecule of this embodiment is one that encodes the
amino
acid sequence of SEQ ID NO: 2, or a fragment or variant thereof. In a most
preferred
embodiment, the nucleic acid molecule comprises the nucleotide sequence shown
in SEQ 1D
NO: 1, or a fragment or variant thereof, or a sequence substantially similar
to SEQ ID NO: 1.
The percentage identity to SEQ. m. No. 1 or 2 may be as high as 99%.
The variants may be an allelic variant. Allelic variants are multiple forms of
a
particular gene or protein encoded by a particular gene. Fragments of a plant
limit dextrinase
inhibitor gene may include regulatory elements of the gene such as promoters,
enhancers,
transcription factor binding sites, and/or segments of a coding sequence for
example, a
conserved domain, exon, or transit peptide.
In a preferred embodiment, the isolated nucleic acid molecules of the
invention are
comprised of full length sequences in that they encode an entire plant limit
dextrinase
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
14
inhibitor protein as it would occur in nature. Examples of such sequences
include SEQ 1D
NOs: I and 3. The corresponding amino acid sequences of full length limit
dextrinase
inhibitor proteins are SEQ m NOs: 2 and 4.
In alternative~embodiments, the nucleic acid molecules of the invention
comprise a
nucleotide sequence of SEQ 117 NOs: 1, 3, 5, 7, 9, I 1 or 13.
The nucleic acid molecules and their variants can be identified by several
approaches
including but not limited to analysis of sequence similarity and hybridization
assays.
In the context of the present invention the term "substantially homologous,"
"substantially identical," or "substantial similarity," when used herein with
respect to
sequences of nucleic acid molecules, means that the sequence has either at
least 40%
sequence identity with the reference sequence, preferably 50% sequence
identity, more
preferably at least 60%, 70%, 80%, 90% and most preferably at least 95%
sequence identity
with said sequences, in some cases the sequence identity may be 98% or, more
preferably
99%, or above, or the term means that the nucleic acid molecule is capable of
hybridizing to
the complement of the nucleic acid molecule having the reference sequence
under stringent
conditions.
' Where homology is determined on the basis of percentage identity between the
two
sequences, the homologous sequences are those which have at least 45% sequence
identity,
preferably 50% sequence identity, more preferably at least 60%, 65%, 70%, 75%,
80%, 81%,
82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%
sequence identity with said sequences. In some cases the sequence identity may
be 98% or more
preferably 99%, or above.
"% identity", as known in the art, is a measure of the relationship between
two
polynucleotides or two polypeptides, as determined by comparing their
sequences. In
general, the two sequences to be compared are aligned to give a maximum
correlation
between the sequences. The alignment of the two sequences is examined and the
number of
positions giving an exact amino acid or nucleotide correspondence between the
two
sequences determined, divided by the total length of the alignment and
multiplied by 100 to
give a % identity figure. This % identity figure may be determined over the
whole length of
the sequences to be compared, which is particularly suitable for sequences of
the same or
very similar length and which are highly homologous, or over shorter defined
lengths, which
is more suitable for sequences of unequal length or which have a lower level
of homology.
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
1S
For example, sequences can be aligned with the software clustalw under Unix
which
generates a file with a ".aln" extension, this file can then be imported into
the Bioedit program
(Hall, T.A. 1999. BioEdit: a user-friendly biological sequence alignment
editor and analysis
program for Windows 9S/98/NT. Nucl. Acids. Symp. Ser. 41:95-98) which opens
the .aln file.
In the Bioedit window, one can choose individual sequences (two at a time) and
alignthem. This
method allows for comparison of entire sequences.
Methods for comparing the identity of two or more sequences are well known in
the art.
Thus, for instance, programs available in the Wisconsin Sequence Analysis
Package, version 9.1
(Devereux J et al, Nucleic Acids'Res. 12:387-395, 1984, available from
Genetics Computer
Group, Madison, , Wisconsin, USA). The determination of percent identity
between two
sequences can be accomplished using a mathematical algorithm. For example, the
programs
BESTFIT and GAP, may be used to determine the % identity between two
polynucleotides and
the % identity between two polypeptide sequences. BESTFIT uses the "local
homology"
algorithm of Smith and Waterman (Advances in Applied Mathematics, 2:482-489,
1981) and
fords the best single region of similarity between two sequences. BESTFIT is
more suited to
comparing two polynucleotide or two polypeptide sequences which are dissimilar
in length, the
program assuming that the shorter sequence represents a portion of the longer.
Tn comparison,
GAP aligns two sequences fording a "maximum similarity" according to the
algorithm of
Neddleman and Wunsch (J. Mol. Biol. 48:443-354, 1970). GAP is more suited to
comparing
sequences which axe approximately the same length and an alignment is expected
over the entire
length. Preferably the parameters "Gap Weight" and "Length Weight" used in
each program are
SO and 3 for polynucleotides and 12 and 4 for polypeptides, respectively.
Preferably % identities
and similarities are determined when the two sequences being compared are
optimally aligned.
Other programs for determining identity and/or similarity between sequences
are also
known in the art, for instance the BLAST family of programs (Karlin &
Altschul, 1990, Proc.
Natl. Read. Sci. USA 87:2264-2268, modified as in Karlin & Altschul, 1993,
Proc. Natl. Aced.
Sci. USA 90:5873-5877, available from the National Center for Biotechnology
Information
(NCB), Bethesda, Maryland, USA and accessible through the home page of the
NCBI at
www.ncbi.nlin.nih.gov). These programs exemplify a preferred, non-limiting
example of a
mathematical algorithm utilized for the comparison of two sequences. Such an
algorithm is
incorporated into the NBLAST and XBLAST programs of Altschul, et al., 1990, J.
Mol. Biol.
215:403-410. BLAST nucleotide searches can be performed with the NBLAST
program, score
= 100, wordlength = 12 to obtain nucleotide sequences homologous to a nucleic
acid molecules
of the invention. BLAST protein searches can be performed with the XBLAST
program, score =
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
16
50, wordlength = 3 to obtain amino acid sequences homologous to a protein
molecules of the
invention. To obtain gapped alignments for comparison purposes, Gapped BLAST
can be
utilized as described in Altschul et~ al., 1997, Nucleic Acids Res. 25:3389-
3402. Alternatively,
PSI-Blast can be used to perform an iterated search which detects distant
relationships between
molecules (Id.). When utilizing BLAST, Gapped BLAST, and PSI-Blast programs,
the default
parameters of the respective programs (e.g., XBLAST and NBLAST) can be used.
See
http://www.ncbi.nlin.nih.gov. Another preferred, non-limiting example of a
mathematical
algorithm utilized for the comparison of sequences is the algorithm of Myers
and Miller, 1988,
C.ABI~S 4:11-17. Such an algorithm is incorporated into the ALTGN program
(version 2.0)
which is part of the GCG sequence alignment software package. When utilizing
the ALIGN
program for comparing amino acid sequences, a PAM120 weight residue table, a
gap length
penalty of 12, and a gap penalty of 4 can be used.
Another non-limiting example of a program for determining identity and/or
similarity
between sequences known in the art is FASTA (Pearson W.R. and,Lipman D.J.,
Proc. Nat. Acac.
Sci., USA, 85.:2444-2448, 1988, available as part of the Wisconsin Sequence
Analysis Package).
Preferably the BLOSUM62 amino acid substitution rriatrix (Henikoff S. and
Henikoff J.G., Proc.
Nat. Acad. Sci., USA, 89:10915-10919, 1992) is used in polypeptide sequence
comparisons
including where nucleotide sequences are first translated into amino acid
sequences before
comparison.
Yet another non-limiting example of a program known in the art for determining
identity
and/or similarity between amino acid sequences is SeqWeb Software (a web-based
interface to
the GCG Wisconsin Package: Gap program) which is utilized with the default
algorithm and
parameter settings of the program: blosum62, gap weight 8, length weight 2.
The percent identity between two sequences can be determined using techniques
similar
to those described above, with or without allowing gaps. In calculating
percent identity,
typically exact matches are counted. '
Preferably the program BESTFIT is used to determine the % identity of a query
polynucleotide or a polypeptide sequence with respect to a polynucleotide or a
polypeptide
sequence of the present invention, the query and the reference sequence being
optimally aligned
and the parameters of the program set at the default value.
Alternatively, variants and fragments of the nucleic acid molecules of the
invention can
be identified by hybridization to SEQ ID NOs: 1, 3, 5, 7, 9, 11 or 13. In the
context of the
present invention "stringent conditions" are defined as those given in Martin
et al (EMBO J
4:1625-1630 (1985)) and Davies et al (Methods in Molecular Biology Vol 28:
Protocols for
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
17
nucleic acid analysis by non-radioactive probes, Isaac, P.G. (ed) pp 9=15,
Humana Press Inc.,
Totowa N.J, USA)). The conditions under which hybridization andlor washing can
be carned out
can range from 42°C to 68°C and the washing buffer can comprise
from 0.1 x SSC, 0.5 % SDS
to 6 x SSC, 0.5 % SDS. Typically, hybridization can be carried out overnight
at 65°C (high
stringency conditions), 60°C (medium stringency conditions), or
55°C (low stringency
conditions). The filters can be washed for 2 x 15 minutes with 0.1 x SSC, 0.5
% SDS at 65°C
(high stringency washing). The filters were washed for 2 x 15 minutes with 0.1
x SSC, 0.5
SDS at 63°C (medium stringency washing). ~ For Iow stringency washing,
the filters were washed
at 60°C for 2 x 15 minutes at 2 x SSC, 0.5% SDS.
In instances wherein the nucleic acid molecules are oligonucleotides
("oligos"), highly
stringent conditions may refer, e.g., to washing in 6xSSC / 0.05% sodium
pyrophosphate at 37°C
(for 14-base oligos), 48°C (for 17-base oligos), SS°C (for 20-
base oligos), and 60°C (for 23-base
oligos). These nucleic acid molecules may act as plant limit dextrinase
inhibitor gene antisense
molecules, useful, for example, in plant limit dextrinase inhibitor gene
regulation, and/or as
antisense primers in amplification reactions of plant limit dextrinase
inhibitor gene and/or
nucleic acid molecules. Further, such nucleic acid molecules may be used as
part of ribozyme
and/or triple helix sequences, also useful for plant limit dextrinase
inhibitor gene regulation. Still
further, such molecules may be used as components in probing methods whereby
the presence of
a plant limit dextrinase inhibitor allele may be detected. .
. In one embodiment, a nucleic acid molecule of the invention may be used to
identify
other plant limit dextrinase. inhibitor genes by identifying homologues. This
procedure may be
performed using standard techniques known in the art, for example screening of
a cDNA library
by probing; amplification of candidate nucleic acid molecules; complementation
analysis, and
yeast two-hybrid system (Fields and Song Nature 340 245-246 (1989); Green and
Hannah Plant
Cell 10 1295-1306 (1998)). .
The invention.also includes nucleic acid.rnolecules, preferably DNA molecules,
that are
amplified using the polymerase chain reaction and that encode a gene product
functionally
equivalent to a plant limit dextrinase inhibitor gene product.
In another embodiment of the invention, nucleic acid molecules which hybridize
under
stringent conditions to the nucleic acid molecules comprising a plant limit
dextrinase inhibitor
gene and its complement are used in altering starch synthesis in a plant. Such
nucleic acid
molecules may hybridize to any part of a plant limit dextrinase inhibitor
gene, including the
regulatory elements. Preferred nucleic acid molecules are those which
hybridize under stringent
conditions to a nucleic acid molecule comprising the nucleotide sequence
encoding the amino
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
1g
acid sequence of SEQ TD NO: 2, 15 or 16 and/or a nucleotide sequence of any
one of SEQ 1T?
NOs: 1, 3, 5, 7, 9, 11 or 13, or their complement sequences. Preferably the
nucleic acid molecule
which hybridizes under stringent conditions to a nucleic acid molecule
comprising the sequence
of a plant limit dextrinase inhibitor gene or its complement are complementary
to the nucleic
acid molecule to which they hybridize.
In another embodiment of the invention, nucleic acid molecules which hybridize
under
stringent conditions to the nucleic acid molecules of SEQ m NOs: 1, 3, 5, 7,
9, 11 or 13
hybridize over the full length of the sequences of the nucleic acid molecules
are provided.
Alternatively, nucleic acid molecules of the invention or their expression
products may
be used in. screening for agents which alter the activity of a plant limit
dextrinase inhibitor
protein of a plant. Such a screen will typically comprise contacting a
putative agent with a
nucleic acid molecule of the invention or expression product thereof and
monitoring the reaction
there between. The reaction may be monitored by expression of a reporter gene
operably linked
to a nucleic acid molecule of the invention, or by binding assays which will
be known to persons
skilled in the art.
Fragments of a plant limit dextrinase inhibitor nucleic acid molecule of the
invention
preferably comprise or consist of at least 40 continuous or consecutive
nucleotides of the plant
limit dextrinase inhibitor nucleic acid molecule of the invention, more
preferably at least 60
nucleotides, at least ~0 nucleotides, or most preferably at least 100 or 150
nucleotides in length.
Fragments of a plant limit dextrinase inhibitor nucleic ~ acid molecule of the
invention
encompassed by the invention may include elements involved in regulating
expression of the
gene or may encode functional plant limit dextrinase inhibitor proteins.
Fragments of the nucleic
acid molecules of the invention encompasses fragments of SEQ ~ NOs: 1, 3, 5,
7, 9, 11 or 13,
as well as fragments of the variants of those sequences identified as defined
above by percent
homology or hybridization.
Further, a plant limit dextrinase inhibitor nucleic acid molecule of the
invention can
comprise two or more of any above-described sequences, or variants thereof,
linked together to
form a larger subsequence.
In certain embodiments, the plant limit dextrinase inhibitor nucleic acid
molecules and
polypeptides do not include sequences consisting of those sequences known in
the art. For
example, in one embodiment, the plant limit dextrinase inhibitor nucleic acid
molecules do not
include EST sequences.
An isolated nucleic acid molecule encoding a variant protein can be created by
introducing one or more nucleotide substitutions, additions or deletions into
the plant limit
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
19
dextrinase inhibitor nucleic acid molecule, such that one or more amino acid
substitutions,
additions or deletions are introduced into the encoded protein. Mutations can
be introduced by
standard techniques, such as, ethyl methane sulfonate, X-rays, gamma rays, T-
DNA
mutagenesis, site-directed mutagenesis, or PCR-mediated mutagenesis. Briefly,
PCR primers
are designed that delete the trinucleotide codon of the amino acid to be
changed and replace it~
with the trinucleotide codon of the amino acid to be included. This primer is
used in the PCR
amplification of DNA encoding the protein of interest. This fragment is then
isolated and
inserted into the full length cDNA encoding the protein of interest and
expressed recombinantly.
An isolated nucleic acid molecule encoding a variant protein can be created by
any of the
methods described in section 5.1. Either conservative or non-conservative
amino acid
substitutions can be made at one or more amino acid residues. Both
conservative and non-
conservative substitutions can be made. Conservative replacements are those
that take place
within a family of amino acids that are related in their side chains.
Genetically encoded amino
acids can be divided into four families: (1) acidic = aspartate, glutamate;
(2) basic = lysine,
arginine, histidine; (3) nonpolar = alanine, valine, leucine, isoleucine,
proline; phenylalanine,
methionine, tryptophan; and (4) uncharged polar = glycine, asparagine,
glutamine, cysteine,
serine, threonine, tyrosine. In similar fashion, the amino acid repertoire can
be grouped as (1)
acidic = aspartate, glutamate; (2) basic = lysine, arginine histidine, (3)
aliphatic = glycine,
alanine, valine, leucine, isoleucine, serine; threonine, with serine and
threonine optionally be
grouped separately as aliphatic-hydroxyl; (4) aromatic = phenylalanine,
tyrosine, tryptophan; (5)
amide = asparagine, glutamine; and (6) sulfur -containing = cysteine and
methionine. (See, for
example, Biochemistry, 4th ed., Ed. by L. Stryer, WH Freeman and Co.: 1995).
Alternatively, mutations can be introduced randomly along all or part of the
coding
sequence, such as by saturation mutagenesis, and the resultant mutants can be
screened for
biological activity to identify mutants that retain activity. Following
mutagenesis, the encoded
protein can be expressed recombinantly and the activity of the protein can be
determined.
The invention also encompasses (a) DNA vectors that contain any of the
foregoing
nucleic acids and/or coding sequences (i.e. fragments and variants) and/or
their complements
(i.e., antisense molecules); (b) DNA expression vectors that contain any of
the foregoing nucleic
acids and/or coding sequences operatively associated with a regulatory region
that directs the
expression of the nucleic acids and/or coding sequences; and (c) genetically
engineered host cells
that contain any of the foregoing nucleic acids and/or coding sequences
operatively associated
with a regulatory region that directs the expression of the gene and/or coding
sequences in the
host cell. As used herein, regulatory regions include, but are not limited to,
inducible and non-
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
inducible genetic elements known to those skilled in the art that drive and
regulate expression of
a nucleic acid. The nucleic acid molecules of the invention may be under the
control of a
promoter, enhancer, operator, cis-acting sequences, or trans-acting factors,
or other regulatory
sequence. The nucleic acid molecules. encoding regulatory regions of the
invention may also be
functional fragments of a promoter or enhancer. The nucleic acid molecule
encoding a
regulatory region is preferably one which will target expression to desired
cells, tissues, or
developmental stages.
Examples of highly suitable nucleic acid molecules encoding regulatory regions
are
endosperm specific promoters, such as that of the high molecular weight
glutenin (IEIiIWG) gene
of wheat, prolamin or ITRl, or other suitable promoters available to the
skilled person such as
gliadin, branching enzyme, ADPG pyrophosphorylase, patatin, starch synthase,
and actin, for
example.
Other suitable promoters include the stem organ specific promoter gSPO-A, the
seed
specific promoters Napin, KTI 1, 2, & 3, beta-conglycinin, beta-phaseolin,
heliathin,
phytohemaglutinin, legumin, zero, lectin, leghemoglobin c3, ABI3, PvAlf, SH-
EP, EP-C1, 251,
EM 1, and ROM2.
Constitutive promoters, such as CaMV promoters, including CaMV 35S and CaMV
19S
may also be suitable. Other examples of constitutive promoters include Actin
1, Ubiquitin 1, and
HMG2.
In addition, the regulatory region of the invention may be one which is
environmental
factor-regulated such as promoters that respond to heat, cold, mechanical
stress, light, ultra-
violet light, drought, salt and pathogen attack. The regulatory region of the
invention may also
be one which is a hormone-regulated promoter that induces' gene expression in
response to
phytohormones at different stages of plant growth. Useful inducible promoters
include, but are
not limited to, the promoters of ribulose bisphosphate carboxylase (RUBISCO)
genes,
chlorophyll a/b binding protein (CAB) genes, heat shock genes, the defense
responsive genes
(e.g., phenylalanine ammonia lyase genes), wound induced genes (e.g.,
hydroxyproline rich cell
wall protein genes), chemically-inducible genes (e.g., nitrate reductase
genes, gluconase genes,
chitinase genes, PR-1 genes etc.), dark-inducible genes (e.g., asparagine
synthetase gene as
described by U.S. Patent 5,256,558), and developmental-stage specific ,genes
(e.g., Shoot
Meristemless gene, ABI3 promoter and the 2S 1 and Em 1 promoters for seed
development
(Devic et a1.,1996, Plant Journal 9(2):205-215), and the kinl and cor6.6
promoters for seed
development (Wang et al., 1995, Plant Molecular Biology, 28(4):619-634).
Examples of other
inducible promoters and developmental-stage specific promoters can be found in
Datla et al., in
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
21 4
particular in Table ~ 1 of that publication (Datla et al., 1997, Biotechnology
annual review 3:269-
296).
A vector of the invention may also contain a sequence encoding a transit
peptide which
can be fused in-frame such that it is expressed as a fusion protein.
Methods which are well known to those skilled in the art can be used to
construct vectors
and/or expression vectors containing plant limit dextrinase inhibitor protein
coding sequences
and appropriate transcriptional/translational control signals. These methods
include, for
example, iu vitro recombinant DNA techniques, synthetic techniques and ih vivo
recombination/genetic recombination. See, for example, the techniques
described in Sambrook
et al., 1989, and Ausubel et al., 1989. Alternatively, RNA capable of encoding
plant limit
dextrinase inhibitor protein sequences may be chemically synthesized using,
for example,
synthesizers. See, for example, the techniques described in Gait, 1984,
Oligonucleotide
Synthesis, IRI, Press, Oxford. In a preferred embodiment of the invention, the
techniques
described in section 6, example 6, and illustrated in figure 6 are used to
construct a vector.
A variety of host-expression vector systems may be utilized to express the
plant limit
dextrinase inhibitor gene products of the invention. ~ Such host-expression
systems represent
vehicles by which the plant limit dextrinase inhibitor gene products of
interest may be produced
and subsequently recovered and/or purified from the culture or plant (using
purification methods
well known to those skilled in the art), but also represent cells which may,
when transformed or
transfected with the appropriate nucleic acid molecules, exhibit the plant
limit dextrinase
inhibitor protein of the invention in situ. These include but are not limited
to microorganisms
such.as bacteria (e.g., E. coli, B. subtilis) transformed with
recombinant,bacteriophage DNA,
plasmid DNA or cosmid DNA expression vectors containing plant limit dextrinase
inhibitor
protein coding sequences; yeast (e.g., Saccharomyces, Pichia) transformed with
recombinant
yeast expression vectors containing the plant limit dextrinase inhibitor
protein coding sequences;
insect cell systems infected with recombinant virus expression vectors (e.g.,
baculovirus)
containing the plant limit dextrinase inhibitor protein coding sequences;
plant cell systems
infected with recombinant virus expression vectors (e.g., cauliflower mosaic
virus, CaMV;
tobacco mosaic virus, TMV); plant cell systems transformed with recombinant
plasmid expres-
sion vectors (e.g., Ti plasmid) containing plant limit dextrinase inhibitor
protein coding
sequences; or mammalian cell systems (e.g., COS, CHO, . BHK, 293, 3T3)
harboring
recombinant expression constructs containing promoters derived from the genome
of
mammalian cells (e.g., metallothionein promoter) or from mammalian .viruses
(e.g., the
adenovirus late promoter; the vaccinia virus 7.5K promoter; the
cytomegalovirus
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
22
.promoter/enhancer; etc.). In a preferred embodiment of the invention, an
expression vector
comprising a plant limit dextrinase inhibitor nucleic acid molecule operably
linked to at least one
suitable regulatory sequence is incorporated into a plant by one of the
methods described in this
section, section 5.3, 5.4 and 5.5 or in examples 5, 6, 7, and 8.
In bacterial systems, a number of expression vectors may be .advantageously
selected
depending upon the use intended for the plant limit dextrinase inhibitor
protein being expressed.
For example, when a large quantity of, such a protein is to be produced, for
the generation of
antibodies. or to screen peptide libraries, for example, vectors which direct
the expression of high
levels of fusion protein products that axe readily purified may be desirable.
Such vectors include,
but are not limited, to the E. coli expression vector pUR278 (Ruther et al.,
1983, EMBO J.
2:1791), in which the plant limit dextrinase inhibitor coding sequence may be
ligated
individually into the vector in frame with the lac Z coding region so that a
fusion protein is
produced; pIN vectors (Inouye & Inouye, 1985, Nucleic Acids Res. 13:3101-9;
Van Heeke &
Schuster, 1989, J. Biol. Chem. 264:5503-9); and the like. pGEX vectors may
also be used to
express foreign polypeptides as fusion proteins with glutathione S-transferase
(GST). In general,
such fusion proteins are soluble and can easily be purified from lysed cells
by adsorption to
glutathione-agarose beads followed by elution in the presence of free
glutathione. The pGEX
vectors are designed to include thrombin or factor Xa protease cleavage sites
so that the cloned
target gene protein can be released from the GST moiety.
In one such embodiment of a bacterial system, full length cDNA nucleic acid
molecules
are appended with in-frame Bam HI sites at the amino terminus and Eco RI sites
at the carboxyl
terminus using standard PCR methodologies (Innis et al., 1990, supra) and
ligated into the
pGEX-2TK vector (Pharmacia, Uppsala, Sweden). The resulting cDNA construct
contains a
kinase recognition site at the , amino terminus for radioactive labelling and
glutathione S-
transferase sequences at the carboxyl terminus for affinity purification
(Nilsson, et al., 1985,
EMBO J. 4:1075; Zabeau and Stanley, 1982, EMBO J. 1: 1217)..
The recombinant constructs of the present invention may include a selectable
marker for
propagation of the construct. For example, a construct to be propagated in
bacteria preferably
contains an antibiotic resistance gene, such as one that confers resistance to
kanamycin,
tetracycline, streptomycin, or chloramphenicol. Examples of other suitable
marker genes include
antibiotic resistance genes such as those conferring resistance to G4 18 and
hygromycin (hpt-II,
hyg-B); herbicide resistance genes such as those conferring resistance to
phosphinothricin and
sulfonamide based herbicides (bar and suI respectively; EP-A-242246, EP-A-
0369637) and
screenable markers such as beta-glucoronidase (GB2 197653), luciferase and
green fluorescent
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
' 23
protein. Suitable vectors for propagating the construct include, but are not
limited to,' plasmids,
cosmids, bacteriophages or viruses.
The marker gene is preferably controlled by a second promoter which allows
expression
in cells other than the seed, thus allowing selection of cells or tissue
containing the marker at any
stage of development of the plant. Preferred second promoters are the promoter
of nopaline
synthase gene of Agrobacteriur~i and the promoter derived from the gene which
encodes the 35S
subunit of cauliflower mosaic virus (CalYIV) coat protein. However, any other
suitable second
promoter may be used.
The nucleic acid molecule encoding a plant limit dextrinase inhibitor protein
may be
native or foreign to the plant into which it is introduced. One of the effects
of introducing a
nucleic acid molecule encoding a plant limit. dextrinase inhibitor gene into a
plant is to increase
the amount of. plant limit dextrinase inhibitor protein present by increasing
the copy number of
the nucleic acid molecule. Foreign plant limit dextrinase inhibitor nucleic
acid molecules may in
addition have different temporal and/or spatial specificity for plastid
division and starch granule
synthesis compared to the native plant limit dextrinase inhibitor protein of
the plant, and so may
be useful in altering when and where or what type of starch is produced.
Regulatory elements of
the plant limit dextrinase inhibitor genes may also be used in altering
plastid division and starch
granule synthesis in a plant, for example by replacing the native regulatory
elements in the plant
or providing additional control mechanisms. The regulatory regions of the
invention may confer
expression of a plant limit dextrinase inhibitor gene product in a chemically-
inducible, dark-
inducible, developmentally regulated, developmental-stage specific, wound-
induced,
environmental factor-regulated, organ-specific, cell-specific, tissue-
specific, or constitutive
manner. Alternatively, the expression conferred by a regulatory region may
encompass more
than one type of expression selected from the group consisting of chemically-
inducible, dark-
inducible, developmentally regulated, developmental-stage specific, wound-
induced,
environmental factor-regulated, organ-specific, cell-specific, tissue-
specific, and constitutive.
Further, any of the nucleic acid molecules and/or polypeptides and proteins
described
herein, can be used as markers for qualitative trait loci in breeding programs
for crop plants. To
this end, the nucleic acid molecules, including, but not limited to, full
length plant limit
dextrinase inhibitor genes coding sequences, and/or partial sequences, can be
used in
hybridization and/or DNA amplification assays to identify the endogenous plant
limit dextrinase
inhibitor genes, plant limit dextrinase inhibitor gene mutant alleles and/or
plant limit dextrinase
inhibitor gene expression products in cultivars as compared to wild-type
plants. They can also
be used as markers for linkage analysis of qualitative trait loci. It is also
possible that the plant
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
24
limit dextrinase inhibitor genes may encode a product responsible for a
qualitative trait that is
desirable in a crop breeding program. Alternatively, the plant limit
dextrinase inhibitor protein
and/or peptides can be used as diagnostic reagents in immunoassays to detect
expression of the
plant limit dextrinase inhibitor genes in cultivars and wild-type plants.
Genetically-engineered plants containing constructs comprising the plant limit
dextrinase
inhibitor nucleic acid and a reporter gene can be generated using the methods
described herein
for each plant limit dextrinase inhibitor nucleic acid gene variant, to screen
for loss-of function
variants induced by mutations, including but not limited to, deletions, point
mutations,
rearrangements, translocation, etc. The constructs can encode for fusion
proteins comprising a
plant limit dextrinase inhibitor protein fused to a protein product encoded by
a reporter gene.
Alternatively, the constructs can encode for a plant limit dextrinase
inhibitor protein and a
reporter gene product that are not fused. The constructs may be transformed
into the
homozygous recessive plant limit dextrinase inhibitor gene mutant background,
and the
restorative phenotype examined, i.e. quantity and quality of starch, as a
complementation test to .
confirm the functionality of the variants isolated.
5.2 PLANT LIMIT DEXTRINASE INHIBITOR GENE PRODUCTS
The invention encompasses the polypeptides of SEQ ID NOs: 2, 4, 6, 8, 10, 12,
14, 15 or
16, or sequences that are at least 70% identical thereto, as described above.
Plant limit
dextrinase inhibitor proteins, polypeptides and peptide fragments, variants,
allelic variants,
mutated, truncated or deleted forms of plant limit dextrinase inhibitor
proteins andlor plant limit
dextrinase inhibitor fusion proteins can be prepared for a variety of uses,
including, but not
limited to, the generation of antifodies, as reagents in assays, the
identification of other cellular
gene products involved in plastid division and/or starch granule synthesis,
etc.
Plant limit dextrinase inhibitor translational products include, but are not
limited to those ~J
proteins and polypeptides encoded by the sequences of the plant limit
dextrinase inhibitor
nucleic acid molecules of the invention. The invention encompasses proteins
that are
functionally equivalent to the plant limit dextrinase inhibitor gene products
of the invention.
The primary use of the plant limit dextrinase inhibitor gene products of the
invention is to
alter starch synthesis via changing plastid division
The present invention also provides variants of the polypeptides of the
invention. Such
variants have an altered amino acid sequence which can function as either
agonists (mirnetics) or
as antagonists. Variants can be generated by mutagenesis, e.g., discrete point
mutation or
truncation. An agonist can retain substantially the same, or ~a subset, of the
biological activities
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
of the naturally occurring form of the protein. An antagonist of a protein can
inhibit one or more
of the activities of the naturally occurring form of the protein by, for
example, deleting one or
more of the receiver domains. Thus, specif c biological effects can be
elicited by addition of a
variant of limited function.
Modification of the structure of the subject polypeptides can be fox such
purposes as
enhancing eff cacy, stability, or post-translational modifications (e.g., to
alter the
phosphorylation pattern of the protein). Such modified peptides, when designed
to retain at least
one activity of the naturally-occurring form of the protein, or to produce
specific antagonists
thereof, are considered functional equivalents of the polypeptides. Such
modified peptides can
be produced, for instance, by amino acid substitution, deletion, or addition.
For example, it is reasonable to expect that an isolated replacement of a
leucine with an
isoleucine or valine, an aspartate with a glutamate, a threonine with a
serine, or a similar
replacement of an amino acid with a structurally related amino acid (i.e.
isosteric andlor
isoelectric mutations) will not have a major effect on the biological activity
of the resulting
molecule.
Whether a change in the amino acid sequence of a peptide results in a
functional homolog
(e.g., functional in the sense that the resulting polypeptide mimics or
antagonizes the wild-type
form) can be readily determined by assessing the ability of the variant
peptide to produce a
response in cells in a fashion similar to the wild-type protein, or
competitively inhibit such a
response. Polypeptides in which more than one replacement has taken place can
readily be
tested in the same manner.
In a preferred embodiment, a mutant polypeptide that is a variant of a
polypeptide of the
invention can be assayed for: (1) the ability to complement limit dextrinase
inhibitor function in
a plant system in which the native limit dextrinase inhibitor genes have been
knocked out; (2) the
ability to inhibit limit dextrinase; or (3) the ability to alter starch
granule synthesis.
The invention encompasses functionally equivalent mutant plant limit
dextrinase
inhibitor proteins and. polypeptides. The invention also encompasses mutant
plant limit
dextrinase inhibitor proteins and polypeptides that are not functionally
equivalent to the gene
products. Such a mutant plant limit dextrinase inhibitor protein or
polypeptide may contain one
or more deletions, additions or substitutions of plant limit dextrinase
inhibitor amino acid
residues within the amino acid sequence encoded by any one of the plant limit
dextrinase
inhibitor nucleic acid molecules described above in Section 5.1, and which
result in loss of one
or more functions of the plant limit dextrinase inhibitor protein, thus
producing a plant limit
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
26
dextrinase inhibitor gene product not functionally equivalent to the wild-type
plant limit
dextrinase inhibitor protein.
Plant limit dextrinase inhibitor proteins and polypeptides bearing mutations
can be made
to plant limit dextrinase inhibitor DNA (using techniques discussed above as
well as those well
known to one of skill in the art) and the resulting mutant plant limit
dextrinase inhibitor proteins
tested for activity. Mutants can be isolated that display increased function,
(e.g., resulting in
improved root formation), or decreased function (e.g., resulting in suboptimal
root function). In
particular, mutated plant limit dextrinase inhibitor proteins in which any
exons are deleted or
mutated are within the scope of the invention. Additionally, peptides
corresponding to one or
more exons of the plant limit dextrinase inhibitor protein, a truncated or
deleted plant limit
dextrinase inhibitor protein are also within the scope of the invention.
Fusion proteins in which
the full length plant limit dextrinase inhibitor protein or a plant limit
dextrinase inhibitor
polypeptide or peptide fused to an unrelated. protein are also within the
scope of the invention
and can be designed on the basis of the plant limit dextrinase inhibitor
nucleotide and plant limit
dextrinase inhibitor amino acid sequences disclosed herein.
While the plant limit dextrinase inhibitor polypeptides and peptides' can be
chemically
synthesized (e.g., see Creighton, 1983, Proteihs: Structures and Molecular
Principles, W.H.
Freeman & Co., NY) large polypeptides derived from plant limit dextrinase
inhibitor genes and
the full length plant limit dextrinase inhibitor gene may advantageously be
produced by
recombinant DNA technology using techniques well known to those skilled in the
art for
expressing nucleic acid molecules.
Nucleotides encoding fusion proteins may include, but are not limited to,
nucleotides
encoding full length plant limit dextrinase inhibitor proteins, truncated
plant limit dextrinase
inhibitor proteins, or peptide fragments of plant limit.dextrinase inhibitor
proteins fused to an
unrelated protein or peptide, such as for example, an enzyme, fluorescent
protein, or luminescent
protein that can be used as a marker or an epitope that facilitates affinity-
based purificaiton.
Alternatively, the fusion protein can further comprise a heterologous protein
such as a transit
peptide or fluorescence protein.
In an embodiment of the invention, the percent identity between two
polypeptides of the
invention is at least 25%. In a preferred embodiment of the invention, the
percent identity
between two polypeptides of the invention is at least 30%. In another
embodiment, the percent
identity between two polypeptides of the invention is at least 40%, 50%, 60%,
70%, 80%, 90%,
95%, 96%, 97%, or at least 98%. Determining whether two sequences are
substantially similar
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
27
may be carried out using any methodologies known to one skilled in the art,
preferably using
computer assisted analysis as described in section 5.1.
Further, it may be desirable to include additional DNA sequences in the
protein
expression constructs. Examples of additional DNA sequences include, but are
not limited to,
those encoding: a 3' untranslated region; a transcription termination and
polyadenylation signal;
an intron; a signal peptide (which facilitates the secretion of the protein);
or a transit peptide .
(which targets the protein to a particular~cellular compartment such as the
nucleus, chloroplast,
mitochondria or vacuole). The nucleic acid molecules of the invention will
preferably comprise
a nucleic acid molecule encoding a transit peptide, to ensure delivery of any
expressed protein to
the plastid. Preferably the transit peptide will be selective for plastids
such as amyloplasts or
chloroplasts, and can be native to the nucleic acid molecule of the invention
or derived from
known plastid sequences, such as those from the small suliunit of the ribulose
bisphosphate
carboxylase enzyme (ssu of rubisco) from pea, maize or sunflower for example.
The transit
peptide comprising amino acid residues 1-198 of SEQ >D NO: 4 is an example of
a transit
peptide native to the polypeptide of the invention. Where an agonist or
antagonist which
modulates activity of the plant limit dextrinase inhibitor protein is a
polypeptide, the polypeptide
itself must be appropriately targeted to the plastids, for example by the
presence of a plastid
targeting signal at the N terminal end of the protein (Castro Silva Filho et
al Plant Mol Biol 30
769-780 (1996) or by protein-protein interaction (Schenke PC et al, Plant
Physiol 122 235-241
(2000) and Schenke et al PNAS 98(2) 765-770 (2001). The transit peptides of
the invention are
used to target transportation of plant limit dextrinase inhibitor proteins as
well as agonists or
antagonists thereof to plastids, the sites of starch synthesis, thus altering
the plastid division and
starch synthesis processes and resulting starch characteristics.
The plant limit dextrinase inhibitor proteins and transit peptides associated
with the plant
limit dextrinase inhibitor genes of the present invention have a number of
important agricultural
uses. The transit peptides associated with the plant limit dextrinase
inhibitor genes of the
invention may be used, for example, in transportation of desired heterologous
gene products to a
plastid in cells of a root, a root modified through evolution, tuber, stem, a
stem modified through
evolution, seed, and/or endosperm of transgenic plants transformed with such
constructs.
The invention encompasses methods of screening for agents (i.e., proteins,
small
molecules, peptides) capable of altering the activity of a plant limit
dextrinase inhibitor protein in
a plant. Variants of a protein of the invention which function as either
agonists (mimetics) or as
antagonists can be identified by screening .combinatorial libraries of
mutants, e.g., trimcation
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
28
mutants, of the protein of the invention for agonist or antagonist activity.
In one embodiment, a
variegated library of variants is generated by combinatorial mutagenesis at
the nucleic acid level
and is encoded by a variegated gene library. A variegated library of variants
can be produced by,
for example, enzymatically ligating a mixture of synthetic oligonucleotides
into nucleic acid
molecules such that a degenerate set of potential protein sequences is
expressible as individual
polypeptides, or alternatively, as a set of larger fusion proteins (e.g., for
phage display). There
are a variety of methods which can be used to produce libraries of potential
variants of the
polypeptides of the invention from a degenerate oligonucleotide sequence.
Methods for
synthesizing degenerate oligonucleotides are known in the art (see, e.g.;
Narang, 1983,
Tetrahedron 39:3; Itakura et al., 1984, Anuu. Rev. Biochem. 53:323; Itakura et
al., 1984, Science
198:1056; Ike et al., 1983, Nueleic Acid Res.11:477).
In addition, libraries of fragments of the coding sequence of a polypeptide of
the
invention can be used to generate a variegated population of polypeptides for
screening and
subsequent selection of variants. F~r example, a library of coding sequence
fragments can be
generated by treating a double stranded PCR fragment of the coding sequence of
interest with a
nuclease under conditions wherein nicking occurs only about once per molecule,
denaturing the
double stranded DNA, . renaturing the DNA to form double stranded DNA which
can include
sense/antisense' pairs from different nicked products, removing single
stranded portions from
reformed duplexes by treatment with S1 nuclease, and ligating the resulting
fragment library into
an expression vector. By this method, an expression library can be derived
which encodes N-
terminal and internal fragments of various izes of the protein of interest.
Several techniques are known in the art for screening gene products of
combinatorial
libraries made by point mutations or truncation, and for screening cDNA
libraries for gene
products having a selected property. The most widely used techniques, which
are amenable to
high through-put analysis, for screening large gene libraries typically
include cloning the gene
library into replicable expression vectors, transforming appropriate cells
with the resulting
library of vectors, and expressing the combinatorial genes under conditions in
which detection of
a desired activity facilitates isolation of the vector encoding the gene whose
product was
detected. Recursive ensemble mutagenesis (REM), a technique which enhances the
frequency of
functional mutants in the libraries, can be used in combination with the
screening assays to
identify variants of a protein of the invention (Arkin and Yourvan, 1992,
Pf°oc. Natl. Aced. Sci.
USA 89:7811-7815; Delgrave et al., 1993, Protein Engineering 6(3):327-331).
An isolated polypeptide of the invention, or a fragment thereof, can be used
as an
immunogen to generate antibodies using standard techniques for polyclonal .and
monoclonal
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
29
antibody~preparation. The full-length polypeptide or protein can be used or,
alternatively, the
invention provides antigenic peptide fragments for use as immunogens. In one
embodiment, the
antigenic peptide of a protein of the invention or fragments or immunogenic
fragments of a
protein of the invention comprise at least 8 (preferably 10, 15, 20, 30 or 35)
consecutive amino
acid residues of the amino acid sequence of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14,
15 or 16 and
encompasses an epitope of the protein such that an antibody raised against the
peptide forms a
specific immune complex with the protein.
Exemplary amino acid sequences of the polypeptides of the invention can be
used to
generate antibodies against plant limit dextrinase inhibitor genes. In one
embodiment, the
immunogenic polypeptide is conjugated to keyhole limpet hemocyanin ("KhH") and
injected
into rabbits. Rabbit IgG polyclonal antibodies can be purified, for example,
on a peptide affinity
column. The antibodies can then be used to bind to and identify the
polypeptides of the invention
that have been extracted and separated via gel electrophoresis or other means.
One aspect of the invention pertains to isolated plant limit dextrinase
inhibitor
polypeptides of the invention, variants thereof, as well as variants suitable
for use as
immunogens to raise antibodies directed against a plant limit dextrinase
inhibitor polypeptide of
the invention. In one embodiment, the native polypeptide can be isolated,
using standard
protein purification techniques, from cells or tissues expressing a plant
limit dextrinase inhibitor
polypeptide. In a preferred embodiment, plant limit dextrinase inhibitor
polypeptides of the
invention are produced from expression vectors by recombinant DNA techniques.
In another
preferred embodiment, a polypeptide of the invention is synthesized chemically
using standard
peptide synthesis techniques. .
An isolated or purified protein or biologically active portion thereof is
substantially free
of cellular material or other contaminating proteins from the cell or tissue
source from which the
protein is derived, or substantially free of chemical precursors or other
chemicals when
chemically synthesized. The language "substantially free" indicates protein
preparations in
which the protein is separated from cellular components of the cells from
which it is isolated or
recombinantly produced. Thus, protein that is substantially free of cellular
material includes
protein preparations having less than 5%, 10% or 20% (by dry weight) of a
contaminating
protein. Similarly, when an isolated plant limit dextrinase inhibitor
polypeptide of the invention
is recombinantly produced, it is substantially free of culture medium. When
the plant limit
dextrinase inhibitor polypeptide is produced by chemical synthesis, it is
preferably substantially
free of chemical precursors or other chemicals.
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
Biologically active portions of a polypeptide of the invention include
polypeptides
comprising amino acid sequences ~ identical to or derived from the amino acid
sequence of the
protein, such that the variants sequences comprise conservative substitutions
or truncations (e.g.,
amino acid sequences comprising fewer amino acids than those shown in any of
SEQ II? NOs: 2,
4, 6, 8, 10, 12, 14, 15 or 16 but which maintain a high degree of homology to
the remaining
amino acid sequence). Typically, biologically active portions comprise a
domain or motif with
at least one activity of the corresponding protein. Domains or motifs include,
but are not limited
to, a biologically active portion of a protein of the invention can be a
polypeptide which is, for
example, at least 10, 2S, 50, or 100 amino acids in length, Polypeptides of
the invention can
comprise, for example, a glycosylation domain or site for complexing with
polypeptides or other
proteins involved in plastid division.
5.3 PRODUCTION OF TRANSGENIC PLANTS AND PLANT CELLS
The invention also encompasses transgenic or genetically-engineered plants,
and progeny
thereof, transformed using the sequences of the invention hereof. As used
herein, a transgenic or
genetically-engineered plant refers to ~a plant and a portion of its progeny
which comprises a
nucleic acid molecule which is not native to the initial parent plant. The
introduced nucleic acid
molecule may originate from the same species e.g., if the desired result is
over-expression of the
endogenous gene, or from a different species. A transgenic or genetically-
engineered plant may
be easily identified by a, person skilled in the art by comparing the genetic
material from a
non-transformed plant, and a plant produced by a methbd of the present
invention for example, a
transgenic plant may comprise multiple copies of plant limit dextrinase
inhibitor genes, and/or
foreign nucleic acid molecules. Transgenic plants are readily distinguishable
from
non-transgenic plants by standard techniques. For example a ' PCR test may be
used to
demonstrate the presence or absence of introduced genetic material. Transgenic
plants may also
be distinguished from non-transgenic plants at the DNA level by Southern blot
or at the RNA
level by Northern blot or at the protein level by western blot, by measurement
of enzyme activity
or by starch composition or properties.
The nucleic acids of the invention may be introduced into a cell by any
suitable means.
Preferred means include use of a disarmed Ti-plasmid vector carried by
Agrobacterium
according to procedures known in the art, for example as described in EP-A-01
16718 and
EP-A-0270822. Agrobacterium mediated transformation methods are now available
for
monocots, for example as described in EP 0672752 and WO00/633.98.
Alternatively, the nucleic
acid may be introduced directly into plant cells using a particle gun. A
further method would be
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
31
to transform a plant protoplast, which involves first removing the cell wall
and introducing the
nucleic acid molecule and then~reforming the cell wall. The transformed cell
can then be grown
into a plant:
In an embodiment of the present invention, Ag~obacterium is employed to
introduce the
gene constructs into plants. Such transformations preferably use binary
Ag~obacterium T-DNA
vectors (Bevan, 1984, Nuc. Acid Res. 12:8711-21), and the co-cultivation
procedure (Horsch et
al., 1985, Science 227:1229-31). Generally, the Agrobacterium transformation
system is used to
engineer dicotyledonous plants (Bevan et al., 1982, Ann. Rev. Genet. 16:357-
84; Rogers et al.,
1986, Methods Enzymol. 118:627-41). The Ag~~obacterium transformation system
may also be
used to transform, as well as transfer, DNA to monocotyledonous plants and
plant cells (see
Hernalsteen et al., 1984, EMBD J. 3:3039-41; Hooykass-Van Slogteren et al.,
1984, Nature
311:763-4; Grimsley et al., 1987, Nature 325:1677-79; Boulton et al., 1989,
Plant Mol. Biol.
12:31-40.; Gould et al., 1991, Plant Physiod. 95:426-34).
Various alternative methods for introducing recombinant nucleic acid
constructs into
plants and plant cells may also be utilized. These other methods are
particularly useful where the
target is a monocotyledonous plant or plant cell. Alternative gene transfer
and transfoi~nation
methods include, but are not limited to, protoplast transformation through
calcium-, polyethylene
glycol (PEG)- or electroporation-mediated uptake of naked DNA (see Paszkowski
et al., 1984,
EMBO J. 3:2717-22; Potrykus et al., 1985, Mol. Gen. Genet. 199:169-177; Fromm
et al., 1985,
Proc. Natl. Acad. Sci. USA 82:5824-8; Shimamoto, 1989, Nature 338:274-6), and
electroporation of plant tissues (D'Halluin et al., 1992, Plant Cell 4:1495-
1505). Additional
methods for plant cell transformation include microinjection, silicon carbide
mediated DNA
uptake (Kaeppler et al., 1990, Plant Cell Repo~te~ 9:415-8), and
microprojectile bombardment
(Klein et al., 1988, Proc. Natl. Acad. Sci. USA 85:4305-9; Gordon-Kamm et al.,
1990, Plant Cell
2:603-18).
According to the present invention, desired plants and plant cells may be
obtained by
engineering the gene constructs described herein into a variety of plant cell
types, including, but
not limited to, protoplasts, tissue culture cells, tissue and organ explants,
pollen, embryos as well
as whole plants. In an embodiment of the present invention, the engineered
plant material is
selected or screened for transformants (i.e., those that have incorporated, or
integrated the
introduced gene construct or constructs) following the approaches and methods
described below.
An isolated transformant may then be regenerated into a plant. Alternatively,
the engineered
plant material may be regenerated into a plant, or plantlet, before subjecting
the derived plant, or
plantlet, to selection .or screening for the marker gene traits. Procedures
for regenerating plants
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
32
from plant cells, tissues or organs, either before or after selecting or
screening for marker gene or
genes, are well known to those skilled in the art.
A transformed plant cell, callus, tissue or plant may be identified and
isolated by
selecting or screening the engineered plant material for traits encoded by the
marker genes
present on the transforming DNA. For instance, selection may be performed by
growing the
engineered plant material on media containing inhibitory amounts of the
antibiotic or herbicide
to which the transforming marker gene construct confers resistance. Further,
transformed plants
and plant cells may also be identified by screening for the activities of any
visible marker genes
(e.g., the 13-glucuronidase, luciferase, green fluorescent protein, B or Cl
anythocyanin genes)
that may be preserxt on the recombinant nucleic acid constructs of the present
invention. Such
selection and screening methodologies are well known to those skilled in the
art.
5.4 TRANSGENIC PLANTS THAT ECTOPICALLY EXPRESS PLANT LIMIT
DEXTRINASE INHIBITOR PROTEIN
According to one aspect of the invention, the nucleic acid molecule expressed
in the plant
cell, plant or part of a plant comprises a nucleotide sequence encoding ~a
plant limit dextrinase
inhibitor protein, a fragment or variant thereof. The nucleic acid molecule
expressed in the plant
cell can comprise a nucleotide sequence encoding a full length plant limit
dextrinase inhibitor
protein. Examples of such sequences include SEQ ID NO: 1, or variants thereof
and the
corresponding the amino acid sequences of SEQ ID NO: 2 or variants thereof.
In an embodiment of the invention, the nucleic acid molecules of the invention
are
expressed in a plant cell and are transcribed only in the sense orientation. A
plant that expresses
a recombinant plant limit dextrinase inhibitor nucleic acid may be engineered
by transforming a
plant cell with a nucleic acid construct comprising a regulatory region
operably associated with a
nucleic acid molecule, the sequence of which encodes a plant limit dextrinase
inhibitor protein or
a fragment thereof. In plants derived from such cells, starch synthesis is
altered in ways
described in section 5.6. The term "operably associated" is used herein to
mean that transcription
controlled by the associated regulatory region would produce a functional
mRNA, whose
translation would produce the plant limit dextrinase inhibitor protein. Starch
may be altered in
particular parts of a plant, including but not limited to seeds, tubers,
leaves, roots and stems or
modifications thereof.
In an embodiment of the invention, a plant is engineered to constitutively
express a plant
limit dextrinase inhibitor protein in order to alter the maximum starch
granule size of the plant.
In a preferred embodiment, the maximum starch granule size is at least 2%, 5%,
10%, 20%,
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
33
30%, 40% or 50% greater than that of a non-engineered control plant(s). In
another preferred
embodiment, the maximum starch granule size is at least 2%, 5%, 10%, 20%, 30%,
40% or 50%
less than that of a non-engineered control plant(s).
In an embodiment of the invention, a plant is engineered to constitutively
express a plant
limit dextrinase inhibitor protein in order to alter the starch granule size
distribution of the plant.
In a preferred embodiment, the average of the starch granule size distribution
is at least 2%, 5%,
10%, 20%, 30%, 40% or 50% greater than that of a non-engineered control
plant(s). In another.
preferred embodiment, the average starch granule size content is at least 2%,
5%, 10%, 20%,
30%, 40% or SO% less than that of a non-engineered control plant(s). The
average starch granule
size includes the mean, median or mode.
In an embodiment of the invention, a plant is engineered to constitutively
express a plant
limit dextrinase inhibitor protein in order to alter the starch content of the
plant. In a preferred
embodiment, the starch content is at least 2%, 5%, 10%, 20%, 30% or 40%
greater than that of a
non-engineered control plant(s). In another preferred embodiment, the starch
content is at least
2%, 5%, 10%, 20%, 30% or 40% less than that of a non-engineered control
plant(s).
In' another aspect of the invention, where the nucleic acid mblecules of the
invention are
expressed in a plant cell and are transcribed only in the sense orientation,
the starch content of
the plant cell and plants derived from such a cells exhibit altered starch
composition. The altered
starch composition comprises an increase in the ratio of amylose to
amylopectin. In one
embodiment of the invention, the ratio of amylose to amylopectin increases by
at least 2%, 5%,
10%, 20%, 30%, 40%, or 50% in comparison to a non-engineered control plant(s).
In yet another embodiment of the present invention, it may be advantageous to
transform
a plant with a nucleic acid construct operably linking a modified or
artificial promoter to a
nucleic acid molecule having a sequence encoding a plant limit dextrinase
inhibitor protein or a
fragment thereof. Such promoters typically have unique expression patterns
andlor expression
levels not found in natural promoters because they are constructed by
recombining structural
elements from different promoters. See, e.g., Saline et al., 1992, Plant Cell
4:1485-93, for
examples of artificial promoters constructed from combining cis-regulatory
elements with a
promoter core.
In a preferred embodiment of the present invention, the associated promoter is
a strong
endosperm and/or embryo-specific plant promoter such that the plant limit
dextrinase inhibitor
protein is overexpressed in the transgenic plant.
In yet another preferred embodiment of the present invention, the
overexpression of
plant limit dextrinase inhibitor protein in starch producing organs and
organelles may be
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
34
engineered by increasing the copy number of the plant limit dextrinase
inhibitor gene. One
approach to producing such transgenic plants is to transform with nucleic acid
constructs that
contain multiple copies of the complete plant limit dextrinase inhibitor gene
with native or
heterologous promoters. Another approach is to repeatedly transform successive
generations of
a plant line with one or more copies of the complete plant limit dextrinase
inhibitor gene
constructs. Yet another approach is to place a complete plant limit dextrinase
inhibitor gene in a
nucleic acid construct containing an amplification-selectable marker (ASM)
gene such as the
glutamine synthetase or dihydrofolate reductase gene. Cells transformed with
such constructs
are subjected to culturing regimes that select cell lines with increased
copies of complete plant
limit dextrinase inhibitor gene. See, e.g., Donn et al., 1984, J. Mol. Appl.
Genet. 2:549-62, for a
selection protocol used to isolate a plant cell line containing amplified
copies of the GS gene.
Cell lines with amplified copies of the plant limit dextrinase inhibitor gene
can then be
regenerated into transgenic plants.
5.5 TRANSGENIC PLANTS THAT SUPPRESS ENDOGENOUS PLANT LIMIT
DEXTRlNASE INHIBITOR PROTEIN EXPRESSION
The nucleic acid molecules of the invention may also be used to alter activity
of the plant limit
dextrinase inhibitor protein of a plant cell, plant, or part of a plant by
modifying transcription or
translation of the plant limit dextrinase inhibitor gene. In an embodiment of
the invention, an
antagonist which is capable of altering the expression of a nucleic acid
molecule of the invention
is introduced into a plant in order to alter the plastid division process and
hence the synthesis of
starch. The antagonist may be protein, nucleic acid, chemical antagonist, or
any other suitable
moiety. In an embodiment of the invention, an antagonist which is capable of
altering the
expression of a nucleic acid molecule of the invention is provided to alter
the plastid division
process and hence the synthesis of starch. The antagonist may be protein;
nucleic acid, chemical
antagonist, or any other suitable moiety. Typically, the antagonitst will
function by inhibiting or
enhancing transcription from the plant limit dextrinase inhibitor gene, either
by affecting
regulation of the promoter or the transcription process; inhibiting or
enhancing translation of any
RNA product of the plant limit dextrinase inhibitor gene; inhibiting or
enhancing the activity of
the plant limit deXtrinase inhibitor protein itself or inhibiting or enhancing
the protein-protein
interaction of the plant limit dextrinase inhibitor protein and downstream
enzymes of the staxch
biosynthesis pathway. For example, where the antagonist is a protein it may
interfere with
transcription factor binding to the plant limit dextrinase inhibitor gene
promoter, mimic the
activity of a transcription factor, compete with or mimic the plant limit
dextrinase inhibitor
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
protein, or interfere with translation of the plant limit dextrinase inhibitor
RNA, interfere with
the interaction of the plant Limit dextrinase inhibitor protein and downstream
enzymes.
Antagonists which are nucleic acids may encode proteins described above, or
may be
transposons which interfere with expression of the plant Limit dextrinase
inhibitor gene.
The suppression may be engineered by transforming a plant with a nucleic acid
construct
encoding an antisense RNA or ribozyme complementary to a segment or the whole
of plant limit
dextrinase inhibitor gene RNA transcript, including the mature target mRNA. In
another
embodiment, plant limit dextrinase inhibitor gene suppression may be
engineered by
transforming a plant cell with a nucleic acid construct encoding a ribozyme
that cleaves the plant
limit dextrinase inhibitor gene mRNA transcript.
In another embodiment, the plant Limit dextrinase inhibitor mRNA transcript
can be
suppressed through the use of RNA interference, referred to herein as RNAi.
RNAi allows for
selective knock out of a target gene in a highly effective and specific
manner. The RNAi
technique involves introducing into a cell double-stranded RNA (dsRNA) which
corresponds to
exon portions of a target gene such as an endogenous plant limit dextrinase
inhibitor gene. The
dsRNA causes the rapid destruction of the target gene's messenger RNA, i.e. an
endogenous
plant limit dextrinase inhibitor gene mRNA, thus preventing the production of
the plant limit
dextrinase inhibitor protein encoded by that gene. The RNAi constructs of the
invention confer
expression of dsRNA which correspond to exon portions of an endogenous plant
limit dextrinase
inhibitor gene. The strands of RNA that form the dsRNA are complimentary
strands encoded by
a coding region, i.e., exons encoding sequence, on the 3' end of the plant
limit dextrinase
inhibitor gene.
The dsRNA has an effect on the stability of the mRNA. The mechanism of how
dsRNA
results in the loss of the targeted homologous mRNA is still not well
understood (Cogoni and
Macino, 2000, Genes Dev 10: 638-643; Guru, 2000, Nature 404, 804-808; Hammond
et al.,
2001, Nature Rev Gen 2: 110-119). Current theories suggest a catalytic or
amplification process
occurs that involves an initiation step and an effector step.
In the initiation step, input dsRNA is ' digested into 21-23 nucleotide "guide
RNAs".
These guide RNAs are also referred to as siRNAs, or short interfering RNAs.
Evidence indicates
that siRNAs are produced when a nuclease complex, which recognizes the 3' ends
of dsRNA,
cleaves dsRNA (introduced directly or via a transgene or virus) ~22
nucleotides from the 3' end.
Successive cleavage events, either by one complex or several complexes,
degrade the RNA to
19-20 by duplexes (siRNAs), each with 2-nucleotide 3' overhangs. RNase III-
type endonucleases
cleave dsRNA to produce dsRNA fragments with 2-nucleotide 3' tails, thus an
RNase III-like
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
36
activity appears to be involved in the RNAi mechanism. Because of the potency
of RNAi in
some organisms, it has been proposed that siRNAs are replicated by an RNA-
dependent RNA
polymerise (Hammond et al., 2001, Nature Rev Gen 2:110-119; Sharp, 2001, Genes
Dev 15:
485-490).
In the effector step, the siRNA duplexes bind to a nuclease complex to form
what is
known as the RNA-induced silencing complex, or RISC. The nuclease complex
responsible for
digestion of mRNA may be identical to the nuclease activity that processes
input dsRNA to
siRNAs, although its identity is currently unclear. In either case, the RISC
targets the
homologous transcript by base pairing interactions between one of the siRNA
strands and the
endogenous mRNA. It then cleaves the mRNA ~l2 nucleotides from the 3' terminus
of the
siRNA (Iiammond et al., 2001, Nature Rev Gen 2:110-119; Sharp, 2001, Genes Dev
15:
485-490).
Methods and.procedures for successful use of RNAi technology in post-
transcriptional
gene silencing in plant systems has been described by Waterhouse et al.
(Waterhouse et al.,
1998, Proc Natl Acad Sci U S A, 95(23):13959-64).
For all of the aforementioned suppression ox antisense constructs, it is
preferred that such
nucleic acid constructs express specifically in organs where starch synthesis
occurs (i.e. tubers,
seeds, stems roots and leaves) and/or~the plastids where starch synthesis
occurs. Alternatively, it
may be preferred to have the suppression or antiserise constructs expressed
constitutively. Thus,
constitutive promoters, such as the nopaline, CaMV 35S promoter, may also be
used to express
the suppression constructs. A most preferred promoter for these suppression or
antisense
constructs is a maize ubiquitin promoter. Alternatively, a co-suppression
construct promoter can
be one that expresses with the same tissue and developmental specificity as
the plant limit
dextrinase inhibitor gene.
In accordance with the present invention, desired plants with suppressed
target gene
expression may also be engineered by transforming a plant cell with a co-
suppression construct.
A co-suppression construct comprises a functional promoter operatively
associated with a
complete or partial plant limit dextrinase inhibitor nucleic acid molecule.
According to the
present invention, it is preferred that the co-suppression construct encodes
fully functional plant
limit dextrinase inhibitor gene mRNA or enzyme, although a construct encoding
an incomplete
plant limit dextrinase inhibitor gene mRNA may also be useful in effecting co-
suppression.
In accordance with the present invention, desired plants with suppressed
target gene
expression may also be engineered by transforming a plant cell with a
construct that can effect
site-directed mutagenesis of the plant limit dextrinase inhibitor gene. For
discussions of nucleic
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
37
acid constructs for effecting site-directed mutagenesis of target genes in
plants see, e.g.,
Mengiste et al., 1999, Biol. Chem. 380:749-758; Offringa et al., 1990, EMBO J.
9:3077-84; and
Kanevskii et al., 1990, Dokl. Akad. Nauk. SSSR 312:1505-7. It is preferred
that such constructs
effect suppression of plant limit dextrinase inhibitor genes by replacing the
endogenous plant
limit dextrinase inhibitor gene nucleic acid molecule through homologous
recombination with
either an inactive or deleted plant limit dextrinase inhibitor protein coding
nucleic acid molecule.
In yet another embodiment, antisense technology can be used to inhibit plant
limit
dextrinase inhibitor gene mRNA expression. Alternatively, the plant can be
engineered, e.g., via
targeted homologous recombination, to inactivate or "knock-out" expression of
the plant's
endogenous plant limit.dextrinase inhibitor protein. The plant can be
engineered to express an
antagonist that hybridizes to one or more regulatory elements of the gene to
interfere with
control of the gene, such as binding of transcription factors, or disrupting
protein-protein
interaction. The plant can also be engineered to express a co-suppression
construct. The
suppression technology may also be useful in down-regulating the native plant
limit dextrinase
inhibitor gene of a plant where a foreign plant limit dextrinase inhibitor
gene has been
introduced. To be effective in altering the activity of a~plant limit
dextrinase inhibitor protein in
a plant, it is preferred that the nucleic acid molecules are at least 50,
preferably at least 100 and
more preferably at least 150 nucleotides in length. In one aspect of the
invention, the nucleic
acid molecule expressed in the plant cell can comprise a nucleotide sequence
of the invention
which encodes a full length plant limit dextrinase inhibitor protein and
wherein the nucleic acid
molecule has been transcribed only in the antisense direction.
In another aspect of the invention, the nucleic acid molecules of the
invention are
expressed in a plant cell engineered expressing an antisense RNA homologous to
the coding
region of an endogeneous limit dextrinase inhibitor gene or using the dsRNA
technology
described herein and the starch of the plant cell and plants derived from such
cells exhibit altered
properties. The altered starch content comprises a decrease in the ratio of
amylose to
amylopectin. In one embodiment of the invention, the ratio of amylose to
amylopectin decreases
by at least 10%, 20%, 30%, 40%, or SO% in comparison to a non-engineered
control plant(s).
In a particular embodiment, the nucleic acid molecules of the invention are
expressing an
antisense RNA homologous to a portion of the coding region of an endogeneous
limit dextrinase
inhibitor or using the dsRNA technology described herein, in conjunction with
a developmental
specific promoter directed towards later stages of seed development, in
cereals crops. In this
embodiment, the ratio of small starch granules to large starch granules
decreases. A decreased
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
38
ratio of small ~to large starch granules results in greater accessibility of
starch granules, which has
certain industrial and commercial advantages related to extraction and
processing of starch.
The progeny of the transgenic or genetically-engineered plants of the
invention
containing the nucleic acids of the invention are also encompassed by the
invention
5.6 MODIFIED STARCH
The invention encompasses methods of altering starch synthesis in a plant and
the
resulting modified starch produced using limit dextrinase inhibitor genes in
accordance with the
invention. In the context of the present invention, "altering starch
synthesis" means altering any
aspect of starch production in the plant, from initiation by the starch primer
to downstream
aspects of starch production such as elongation, branching and storage, such
that it differs from
starch synthesis in the native plant. In the invention, this is achieved by
altering the activity of
limit dextrinase by changing the expression of the limit dextrinase inhibitor,
which includes, but
is not limited to, its function in initiating starch synthesis, its temporal
and spatial distribution
and specificity, and its interaction with downstream factors in the synthesis
pathway. The effects
of altering the activity of the limit dextrinase, inhibitor may include, for
example, increasing of
decreasing the starch yield of the plant; increasing or decreasing the rate of
starch production;
altering temporal or spatial aspects of starch production in the plant;
altering the initiation sites
of starch synthesis; changing the optimum conditions for starch production;
and altering the type
of starch produced, for example in terms of the ratio of its different
components. For example,
the endosperm of mature wheat and barley grains contain two major classes of
starch granules:
large, early formed "A" granules and small, later formed "B" granules. Type A
starch granules
in wheat are about 20 ~,m diameter and type B around 5 ~,m in diameter
(Tester, 1997, in : Starch
Structure and Functionality, Frazier et al., eds., Royal Society of Chemistry,
Cambridge, UK).
Rice starch granules are typically less than 5 ~m in diameter, while potato
starch granules can be
greater than 80 ~.m in diameter. The quality of starch in wheat and barley is
greatly influenced
by the ratio of A-granules to B-granules. Altering the activity of the limit
dextrinase inhibitor
will influence the number of granule initiation sites, which will be an
important factor in
determining the number and size of formed starch granules. The degree to which
the granule
initiation activity of the plant is affected will depend at least upon the
nature and of the nucleic
acid molecule,or antagonist introduced into the plant, and the amount present.
By altering these
variables, a person skilled in the art can regulate the degree to which starch
synthesis is altered
according to the desired end result.
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
39
The methods of the invention (i.e. engineering-a plant to express a construct
comprising a
plant limit dextrinase inhibitor nucleic acid) can, in addition to altering
the total quantity of
starch, alter the fine structure of starch in several ways including but not
limited to, altering the
ratio of amylose to amylopectin, altering the length of amylose chains,
altering the length of
chains of arnylopectin fractions of low molecular weight or high molecular
weight fractions, or
altering the ratio of low molecular weight or high molecular weight chains of
amylopectin. The
methods of the invention can also be utilized to alter the granule structure
of starch, i.e. the ratio
of large to small starch granules from a plant or a portion of a plant. The
alteration in the
structure of starch can in turn affect the functional characteristics of
starch such as viscosity,
elasticity or rheological properties of the starch as measured using
viscometric analysis. The
modified starch can ~ also be characterised by an alteration of more than one
of the above-
mentioned properties.
In an embodiment the length of amylose chains in starch extracted from a plant
engineered to express a construct comprising a plant limit dextrinase
inhibitor nucleic acid is
decreased by at least 50, 100, 150, 200, 250, or 300 glucose units in length
in comparison to
amylose from non-modified starch from a plant of the same genetic background.
In another
embodiment, the length of amylose chains in starch is increased by at least
50, 100, 150, 200,
250, or 300 glucose units in length in comparison to amylose from non-modified
starch from a
plant of the same genetic background.
In an embodiment of the invention, the ratio of amylose to amylopectin
decreases by at
least 10%, 20%, 30%, 40%, or 50% in comparison to a non-engineered control
plant(s).
In a preferred embodiment, the ratio of low molecular weight chains to high
molecular
weight chains of amylopectin is altered by at least 10%, 20%, 30%, 40%, or 50%
in icomparison
to a non-engineered control plant(s).
In another preferred embodiment the average length of low molecular weight
chains of
amylopectin is altered by at least 5, 10, 1 S, 20, or 25 glucose units in
length in comparison to a
non-engineered control plant(s). In yet another preferred embodiment the
average length of high
molecular weight chains of amylopectin is altered by at least 10, 20, 30, 40,
50, 60, 70 or 80
glucose units in length in comparison to a non-engineered control plant(s).
According to one aspect of the invention, the ratio of small starch granules
to large
granules is altered by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or
more in
comparison to a non-engineered control plant(s).
The embodiments described in each section above apply to the other aspects of
the
invention, mutatis mutandis.
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
6 EXAMPLES
Example 1. Identification of limit dextrinase inlzibitor homologous gene
sequences.
The sequence comparison and identification program tblastn was used with the
limit
dextrinase inhibitor gene amino acid sequence from Hordeum vulgate var Bomi
((MacGregor et
al., 2000) against the Genbank database. A number of possible cDNA sequences
were obtained
including those for Triticum aestivum, Hordeum spotateneum, Oryza sativa,
Triticum duf~zcm and
Zea mat's In addition, a BLASTP search also identified two amino acid
sequences for limit
dextrinase inhibitor-like proteins from Eleusine coracaraa and Secale ce~eale.
The amino acid
sequences were aligned using ClustalW and the alignment is shown in Figure 1.
All of the
sequences except for those from Eleusine coracana and Secale cereals have an
approximately 20
amino acid signal peptide at the N-terminal end, which is cleaved off to give
the mature protein.
Example 2. Isolation of barley lifnit dextrinase inhibitor cDNA fragments.
Cloning ofLDxgene by RT PCR
Total RNA was extracted from barley (var. Golden Promise) grains 2 and 4 weeks
post
anthesis with a LiCI method as described by (Cathala et al., 1983).
2 ~.g of RNA was treated with Rnase-free DNase I (Amersham Pharmacia Biotech)
and
used to synthesize 30 ~,1 first strand cDNA using random hexamer primers
(Roche) and M-MLV
reverse transcriptase (Promega) using the reaction conditions recommended by
the manufacturer.
It will be recognised by one skilled in the art that other mRNA extraction and
cDNA
synthesis methods exist which could be employed to produce cDNA from tissue of
Hordeum
vulgare.
A 3 ~,l aliquot of the cDNA product was used in a standard PCR reaction
containing 2
mM MgClz, 8% (vlv) DMSO and primers Inhib-5 (5'-
ACCAATAAACTAGTATCAACAATGGCATCCGACCA-3' SEQ ID No 17) and Inhib-6 (5'-
CCAACCTTTTTTATTCATCAATCGGCCACA-3' SEQ ID No 18), which were designed
against the Hordeum vulgare Limit dextrinase inhibitor sequence (SEQ ID No
3.), using Taq
polymerase (Bioline) as recommended by the manufacturer. The PCR program used
was 5 min
at 94 °C, followed by 35 cycles of 94 °C for 30 sec, 63.5
°C for 30 sec and 72 °C for 1 min,
finalized by 7 min at 72 °C. The product length was. 623 bp. The
amplified product was cloned
into a pGEM-T Easy vector (Promega) and verified by sequencing.
It will be recognised by one skilled in the art that other methods exist which
could be
employed to produce cloned DNA fragments.
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
41
The sequence of this cDNA clone is shown in SEQ ID No 1. Compared to the
published
sequence (SEQ m No. 3) there are five single base pair substitutions, wluch in
turn lead to two
amino acid substitutions as shown in a comparison of SEQ II? No. 2 and SEQ ID
No. 4.
Example 3. Construction of vectors for barley transformation.
The antisense expression vector pYSUanti was constructed using the ubiquitin
promoter
(promoter, 5'-untranslated exon, and first intron of the maize ubiquitin (Ubi-
1) 'gene) of the
pAHC20 vector (Christensen & Quail, 1996), the cloned LDI gene and an OCS-
terminator
(octopine synthase). The OCS-terminator was PCR amplified using the BinAR
vector (Hofgen &
Willmitzer, 1990) as a template and primers OCSF (5'-
TCGGATTCCATTGCCCAGCTATCTGTC-3' SEQ ID No 19) and OCS-R (5'-
ATGGGCCCTAACAATCAGTAAATTGAACG-3' SEQ ID No 20) with an introduced Apa I
site (underlined). The PCR was carried out using~Pfu polymerase (Stratagene)
as recommended
by the manufacturer. The 544 by PCR product was purified using a High Pure PCR
product
purification Kit (Ruche), digested with the appropriate restriction enzymes
(see Figure 1) and
ligated into the pCR2.1-TOPO cloning vector (Invitrogen). The LDI genie was
cut and cloned in
an antisense direction with respect to the promoter. Restriction enzymes used
are shown in
Figure 1. All DNA cloning and manipulations were performed using standard
protocols (Ausubel
et al., 1989).
Example 4. Transformation of barley
Stable barley transformation of half immature embryos (IEs) of the spring
barley variety
"Golden Promise" was performed with a biolistic device (Biolistic. PDS-
1000/He, BioRad)
using DNA coated gold particles (1 Vim), as described by (Wan & Lernaux,
1994). Gold particles
were coated with 25 ~,g DNA using a protocol according to (Lemaux et al.,
1999) using a 1:1
molar ratio of pYSUanti and pAHC20 (Christensen & Quail, 1996). The latter
carries the bar
gene (encoding phosphinotricin acetyltransferase), giving resistance to the
herbicides BASTA
(PPT) and bialaphos (Murakami et al., 1986; Thompson et al., 1987) under the
control of the
maize ubiquitin (Ubi-1) promoter and first intron and terminated by the nos
terminator (Bevan et
al., 1983). Preparation of IEs for bombardment was carried out as described in
(Wan & Lemaux,
1994). Each plate with around 100 half IEs was bombarded once using a.1100 psi
rupture disc
anal 28-29 mm Hg vacuum using bombardment conditions as published previously
(Lemaux et
al., 1999). Selection against bialaphos and regeneration procedures were
performed as described .
in (Cho et al., 1998; Lemaux et al., 1999).
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
42
Example 5. Analysis of transformed plants for presence of the limit dextrinase
inhibitor
construct.
Analysis of regenerated Barley transformants.
Total genomic DNA was isolated from either leaf material of primary
transformants
and/or isolated embryos of mature grains (T1 and T2 generations) using a
modified method
described by (Dellaporta et al., 1983). The presence of transgenes was
determined by PCR using
the genomic DNA as a template. The oligonucleotide primers used Were BAR-I (5'-
CGGTACCGGCAGGCTGAAGTCGA-3' SEQ ID No 21) and BAR-II (5'-
CCGGGGATCTACCATGAGCCCAGA-3' SEQ ID ~ No 22) for the bar gene, Inhib-6 (5'-
CCAACCTTTTTTATTCATCAATCGGCCACA-3' SEQ ID No 18) and OCS-II (5'-
GAATGAACCGAAACCGGCGGTA-3' SEQ ID No 23) for the LDI gene in antisense
direction
(see Figure 2). As a control of the DNA quality primers TUB-F (5'-
TACCACCTCCCTGAGGTTTG-3' SEQ ID No 24) and TUB-R (5'-
CCATGCCTAGGGTCACACTT3' SEQ ID ~No 25) were used to amplify the tubulin gene.
The
PCR conditions used were the same as for cloning of the LDI gene, but DMSO was
omitted from
the PCR reactions for the tubulin gene. PCR products were 534 (bar), 817 (LDI
antisense) and
217 by (tubulin) respectively.
The presence of the LDI gene in the antisense direction and the bar gene was
confirmed
in regenerated transgenic barley plants using PCR analysis as shown in Figure
3. In total seven
independent transgenic lines were produced, of which five carried both the
LDl,gene in antisense
direction and the bar gene (L11-5), one carned only the LDI gene in antisense
directiom(U7) and
one showed the bar gene only (U6). Two lines (U2, US) were found to be sterile
and therefore
could not be analyzed further.
Primary transgenic plants (To generation) were also tested by BASTA°
painting. A 2 cm
section of a barley leaf blade was treated with a 0.5 % (v/v) BASTA solution
(Bayer, contains
150 g/1 glufosinate ammonium) in 0.1 % Tween 20.~ Plants were examined 7-14
days after
application.
All lines positive .in the PCR reactions for the bar gene as expected also
showed
resistance to BASTA° painting.
Table 1 gives an overview ~of the analysis of To, Tl and TZ generation
tiansgenic lines.
The transgenic lines did not show any obvious morphological phenotypic
changes. PCR analysis
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
43
of DNA derived from embryos of single mature grains resulted in the
identification of two
r
independent homozygous lines (LT3, U4) in the T2 generation.
Table 1. Analysis of To, Tl, and T2 generation barley plants transformed with
plasmid
pYSUanti.
Transgenic To T1 T2
barley
lines .
PCR BASTA~ PCR PCR
LDI liar LDI bar LDI bar
(+/-) (+/-) (r/s) (+/-) (+/-)
Ul + + r n.d. n.d.
U2* + + r - -
U3 + + r 24/8 24/8 12/0 12/0
U4 + + r 5/0 5l0 22/0 22/0
U5* + + r - -
U6 - + r n.d. n.d.
U7 + - s 6/0 0/0
LDI: PCR analysis with primers Inhib-6 and OCS-II for the LDI gene in
antisense direction; bar. PCR
analysis with primers BAR-I and BAR-II for the bar gene; (+l-): positive or
negative amplification; (r/s):
resistant or sensitive to BASTA~ painting; ~: sterile lines; n.d.: not
determined; T2 generation plants
derived from positive T~ generation plants.
Example 6. Detailed analysis of succeeding generations of transformed plants
Partial purification of lirhit dextrinase (LD)
LD was partially purified using 500 g of green 9 days old barley malt from
variety Alexis
with a protocol as described by (Kristensen et al., 1998) up to the ion
exchange chromatography
step by using a fast protein liquid chromatography system (FPLC; Amersham
Pharmacia
Biotech). The activity of the partially purified LD was determined using the
Limit Dextrizyme
method (Megazyme) according to manufacturer's recommendations.
Assay of LDI activity .
15 mg of ground endosperm was extracted with 0.5 ml 0.1 M NaOAc (pH 5.5) at 4
°C for
30 min. The extract was heated to 70°C for 40 min, centrifuged at 1000
.g for 5 min and the
supernatant retained (LDI extract) and 1,10-phenanthroline to 10 mM added. The
protein content
of the LDI extracts was measured using a Bradford assay (BioRad) according to
manufacturer's
instructions. 10 p.g protein of the LDI extract were mixed with 4.3 mU of
partially purified LD
and the volume made up to 0.5 ml in 0.1 M malefic acid, 0.02% (w/v) Na azide
(pH 5.5). The
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
44
mixture was left to stand for 1 h at room temperature and then assayed with
the Limit
Dextrizyme method (Megazyme) according to manufacturers recommendations.
LD activity in developing ehdospe~m
Five endosperms (2 wpa) were extracted with 1 m1/100 mg 0.1 M malefic acid,
0.02%
(w/v) Na azide (pH 5.5). After 5 h at 40 °C, 250 ~l of each extract
were assayed for LD activity
using the Limit Dextrizyme method as recommended by the manufacturer
(Megazyme).
Analysis ofprotein expressioya by Western blotting.
Proteins were separated by SDS-PAGE on a resolving gel (6 . 9 . 0.1 cm) of 10%
or 12%
(w/v) polyacrylamide by the method of (Laemmli, 1970) and silver stained. The
proteins were
transferred from the gel to a nitrocellulose membrane (Amersham Pharmacia
Biotech) with a
transblotter (BioRad) and the membrane was incubated with rabbit antiserum
that contained
polyclonal antibodies raised against purified LDI from mature barley grains
(kind gift from
Canadian Grain Research Laboratory, Winnipeg, Canada). The immunoreactive
protein bands
were detected by incubation with alkaline phosphatase=conjugated antibodies
against rabbit IgG
(Sigma) and detected with nitroblue tetrazolium salt and 5-bromo-4-chloro-3-
indolyl phosphate
(Sigma).
Results.
T1 generation grains of line U3 showed a Mendelian segregation ratio 'of 1:3
on 32 grains
tested by PCR as shown in Table 1, suggestive of a single locus insertion. Six
of these grains
were also individually tested for LDI activity by LD assays and presence of
LDI by
immunoblotting of LDI extracts. The results are shown in Figure 4. Four out of
the six grains
analyzed (1, 2, 3 and 5) showed the LDI and bar genes in the PCR analysis
(Figure 4C and D).
These findings correlated with less LDI protein present as shown by Western
analysis (Figure
4A and B) and less LDI activity as shown by enhanced % LD activity after
incubation with grain
extracts (Figure 4F). The two grains negative in the PCR reactions (4 and 6)
showed wildtype
levels of LDI protein presence in the imriiunoblot and LDI activity in the LD
assay.
The homozygous T2 generation lines U3 and U4 were also analyzed for LDI levels
and
activity. For this purpose starch from 5-10 grains of each line and wildtype
grains was used to
make LDI extracts that were then subjected to immunoblotting and LDI activity
assays. The
results of the latter experiments are shown in Figure 5 and 6 respectively.
Both lines contained
significantly less LDI protein present in comparison to wildtype levels (see
Figure 5A and B).
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
These results correlate with the reduced LDI activity of these lines as shown
in Figure 6. Lines
U3 showed 34% and U4 29% less LDI activity in the developing grain compared to
non
transformed wildtype grain. '
Free LD activity in developing endosperm two weeks post anthesis was measured
in
wildtype and TZ generation transgenic lines U3 and U4 and found to be up to
50% higher than in
wildtype endosperm~(Table 2).
Table 2. Free Limit Dextrinase activity in developing endosperm 2 weeks post
anthesis.
sample mU LD/I00 mg
wt 2.06 0.14
U3 2.94 0.15
U4 3.04 0.29
Free LD activity in mU per 100 mg endosperm. wt: wildtype; U3/U4: T~
generation grains of homozygous
line U3 or U4. Each value represents the mean ~ SE of three replicate
experiments.
Example 7. Microscopic analysis of starch granule size and number.
Mature barley grains were fractured using a razor blade to initiate the
fracture. The
resulting cross-sections of wildtype and transgenic barley grains (outer
endosperm regions) were
viewed under an environmental scanning electron microscope (model Philips XL
30
Environmental Scanning Electron Microscope) at 0,4 Torr and 1600 x
magnification. ,
Ratio of A to B starch granules .
Starch from the endosperm of wildtype and transgenic barley grains was stained
with a
0.1% Il 1% ICI solution and the A and B starch granules were counted under a
light microscope
(Axiophot Photomicroscope, Zeiss) using a gridded ocular.
Environmental scanning electron microscopy of the outer endosperm region of
single
transgenic and wildtype grains was carried out. A much-reduced level of the
small B granules
was present in the transgenic grains of homozygous Ta generation line U4 and
positive Tl
generation line U3 (see Figure 7B and D) in comparison to wildtype and
transformation negative
segregants (Figure 7A and C). The ratio of A to B granules was also counted in
wildtype and
transgenic grains, and it was found to be lower in the transgenic grains thus
confirming the
electron microscopy findings. Wildtype and negative segregants of Tl
generation line U3 showed
a ratio of 1 : 17.08 ~ 1.24 and 1 : 16.08 ~ 1.92 respectively, whereas in
transgenic grains the ratio
dropped as low as 1 : 1.36 ~ 0.56 in homozygous T2 generation line U4 as shown
in Table 3.
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
46
Table 3. Ratio of A to B starch granules in mature endosperms of wildtype and
transgenic
barley grains.
sample A : B granules ratio Total number of starch
granules per grain
wt I : 17.08 I.24 278 x106 38.8 x I06
U3 Tl- , 1 : 16.08 .1.92 Not determined
U3 Tl+ 1 : 5.60 0.19 Not determined
U3 1 : 2.13 0.25 92.7 x106 10.2 x
106
U4 1 : 1.360.56 22.1 x1064x 106
wt: wildtype; U3 T~ /+: wildtype/transgenic T~ generation grain of
heterozygous transgenic line U3.
U3/U4: homozygous transgenic TZ generation grains of lines U3 or U4. Each
value represents the mean
~ SE of six replicate experiments.
Example 8. Analysis of starch structure.
Determination of distribution of lengths of a-1,4-glucan chains by HPAEC-PAD
(Analysis of a-polyglucan structure II)
Barley starch samples were taken into boiling tubes with S mM sodium acetate
pH 4.8
(lmg starch to 0.130 ml of buffer) and gelatinised by heating in a boiling
water bath with
periodic vortex mixing and then cooled. Isoamylase (15 p1) was added and
digestion allowed to
take place by incubating at 37 °C for 4 hours. The digest was stopped
by boiling for 2 min and
the debranched starch analysed by HPLC using a Dionex system equipped with a
pulsed
electrochemical detector. The solvents were 150 mM NaOH and 150mM NaOH, 1.0M
Sodium
Acetate. The HPLC conditions used were as follows:
HPLC Conditions
Column: Dionex PA 100
Detection:PED - Integrated Amperometry
Flow rate:1.0 ml/min
Solvents:1) 150mM NaOH
2) 150mM NaOH, 1.0M Sodium
Acetate
3) Not used
4) Not used
Gradient Profile
TIME % 1 %2
0 100 0
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
47
PED Parameters
WAVEFOItM TABLE:
INTEGRATION:
1 100 0.
6 89 11
130 65 35
135 0 I00
150 100 0
165 100 0
TIME (SEC) POTENTIAL
(V)
0.00 0.10
0.50 O.IO
0.51 0.60
0.59 0.60
0.60 -0.60
0.65 -0.60
BEGIN (SEC) END (SEC)
0.30 0.50
Results of this analysis shows that the starch profiles of starch from the
transgenic plants are
significantly different to starch from control plants
Example 9. Analysis of starch amylose content.
Molecular size separation of a polyglucans by Sepharose CL2B chromatography
(Analysis of a polyglucah structure I)
Sepharose CL2B analysis was in principle performed as described by (Denver et
al.,
1995), except that 0.39 ml fractions were collected at a rate of one fraction
par min. 5 mg starch
from 5-10 ground endosperms was dissolved in 0.5 ml 0.51VI NaOH and
centrifuged at 13000 x
g for 1 min. 50 ~,1 of the supernatant was applied to a 12 ml Sepharose CL2B
(Sigma) column
and eluted with 0.1 M NaOH. The absorbance of fractions after the addition of
iodine solution
was measured at 595 nm. Additionally ~,max values of the peak fractions were
measured in the
range of 450-700 nm.
Determination of amyloselamylopectira ratio and total starch content of barley
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
48
g~aahs
Approximately 1S mg of ground endosperm of S-IO mature grains was assayed
using the
amyloselamylopectin.assay Kit (Megazyme) based on the glucose oxidase-
peroxidase method as
recommended by the manufacturer and total starch calculated in relation to a
glucose standard as
described by Megazyme.
Starch derived from homozygous lines U3 and U4 was subjected to Sepharose CL
2B
chromatography, and fractions identified and quantified by staining with
iodine. The resulting
profiles are shown in Figure 8 and statistical analysis of this data in Table
4. The fractionation of
wildtype a-glucan showed two distinct peaks of which the first one (fractions
14-24) is likely to
be the amylopectin peak, as~ it has a 7~,",~ of SS8 ~ 1.8 in fraction 17. The
second peak was
broader and considered to be predominantly amylose, because of a higher
7~",~,~ of 605.83 ~ 4.65
(fraction 38).
Table 4. Percentage composition of the amylopectin fraction (I) and amylose
fraction (II)
separated by Sepharose CL 2B chromatography in mature endosperms of wildtype
and
transgenic barley grains of homozygous T2 generation lines.
sample I (%) II (%) II/I ~"aXi ~,."a,~
wt 3I.97 .2.0953.73 0.621.68 558.00 1.80605.83 4.65
U3 44.06 3.5043.0S O.S 0.98 S8S.83 5.39S96.S0 1.80
1
U4 39.32 4.8446.39 0.371.18 580.17 4.54590.33 4.51
The amylopectin (I) and amylose (II) fraction correspond to fractions 14-24
and 25-45 respectively, in the
Sepharose CL 2B chromatogram, as shown in Figure 7. The amount of
carbohydrates in fractions I and II
were expressed as percentages of total carbohydrates in the chromatogram. The
data was that shown in
'Figure 3. ~,max~ and 7~ma~z values were measured using fractions 17 and 38 in
each chromatogram
In the two homozygous transgenic lines U3 and U4, starch subjected to
Sepharose CL 2B
fractionation showed a different profile; the amylose peak was reduced (see
Figure 7). Also the
~,~ values for fractions 17 in each chromatogram increased to S8S.83 ~ 5.39
(U3) and 580.17 ~
4.54 (U4). The ~l,max values for fraction 38 decreased to 596.50 ~ 1.8 (U3)
and 590.33 ~ 4.51
(U4). This suggests that less amylose is present in starch of the transgenic
lines and a change in
the shucture of the starch, because the spectral properties of starch-bound
iodine depend on the
physical nature of the starch.
In view of this finding, the total starch content and the relative amounts of
amylose and
amylopectin in starch from the two homozygous transgenic lines was measured
and compared to
wildtype starch values (Table S). The starch content (as a percentage of flour
weight) of the
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
49
transgenic lines was reduced from 63.72 ~ 4,20 % (wildtype) to 29.32 ~ 2.07 %
(U3) and 40.11
~ 5.25 % (IT4). Also the amylose content.decreased from 17.44 ~ 0.67 %
(wildtype) to 11.36 ~
0.58 % (IJ3) and 4.20 ~ 1.31 % (IJ4).
Table 5. Total starch content and composition of amylose and amylopectin in
starch from
mature endosperms of wildtype and transgenic barley grains.
sample total starch content (%) amylose (%) amylopectin (%) SE
wt 63.72 ~ 4.20 17.44 82.56 ~ 0.67
U3 29.32 ~ 2.07 11.36 88.64 ~ 0.58
U4 40.11 ~ 5.25 4.20 95.80 ~ 1.31
Total starch content in percent of weight of ground endosperms used. Amylose
and amylopectin
represent percentage of total starch (9 00%). wt: wildtype; U3/U4: T2
generation grains of homozygous
line U3 or U4. Each value represents the mean ~ SE of three replicate
experiments.
Example 10. Analysis of stairch functionality.
Preparation of starch from barley grain
Starch was extracted from barley using 1% Sodium bisulphite solution. The
starch was
allowed to settle, the supernatant decanted off and the starch washed by
resuspending in 200 ml
of ice-cold water. The resulting starch pellet was left to air dry. Once dried
the starch was stored
at -20 °C.
Viscometric analysis of starch.
Starch samples were analysed for functionality by testing rheological
properties using
viscometric analysis.
Example 11. Arabidopsis transformation.
Arabidopsis thaliana c.v. Columbia plants were transformed according to the
method of Clough
and Brent 1998P1ant J. 16(6):735-743 (1998) with slight modification.
Growing Plants
Plants were grown to a stage at which bolts were just emerging. Phytagar 0.1 J
was added to the
seeds and these were vernalized overnight at 4°C. About 10-15 seeds
were added per 3x5 inch
pot. Seed was added onto the soil with a pipette, about 4-5 seeds per ml was
dispersed. Seeds
were germinated as usual (ie under humidity pots were covered until first
leaves appeared and
then over a two day period the lid was cracked and then removed). Plants were
grown for about 4
weeks in the greenhouse (long day condition) until bolts emerged. The first
bolts were cut to
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
encourage growth of multiple secondary bolts. Bolts containing many unopened
flower buds
were chosen for dipping.
Growing the Agr~bacterium culture
Aliquots of the Agrobacterium strain, carrying the constructs contaiung the
limit dextrinase
inhibitor gene were grown first as a Sml culture in YEP containing Gentamycin
(l5ug/ml) and
Kanamycin 20ug/ml. Next day, 2m1 freshly grown culture was added to 400m1 YEP
media (10g
Yeast Extract, lOg peptone Sg NaCl, pH 7.0) in a 2litre flask. and the flask
was incubated at
28°C incubator with shaking overnight. Next day OD 600 of the cells was
measured and found to
be 1.8. Cells were divided into 2X Oakridge bottles and harvested by
centrifugation at SOOOrpm
for 10 min in a GSA rotor at room temperature The Pellet was resuspended in 3
volumes of
infiltration media so that the. final concentration of the culture was 0.6.
Infiltration media was
prepared by adding the following: 1/a Murashige and Skoog Salts, lx Gamborg's
Vitamins and
0.44uM Benzylamino Purine (10u1 per L of a lmg/ml stock), pH was adjusted to
5.7 with NaOH.
Then 0.02% Silwet (200u1 per 1L) was added and mixed into the solution.
Arabidopsis transformation by Dipping
500 ml of resuspended Agrobacterium was poured into a tray and plants were
inverted into
Agrobacterium solution in batches of 10 for 1 S minutes. After I S minutes the
plants were lifted
and the excess solution drained. The plants were transferred on their sides to
a fresh tray
containing tissue paper to allow further soaking of the solution and then
transferred to
propagating trays. The plants were immediately covered with lids to maintain
humidity. After
two days the lid was removed and the plants allowed to grow normally. They
were not watered
for one week until the soil looked dry. After flowering was complete and the
siliques on the
plants were dry, all the seeds from one pot were harvested. The seeds were
completely dried by
keeping harvested seed in an envelope for one week
Transformed plants were analysed for effects on starch metabolism in the
leaves.
Example 12. Transformation of potato.
Solahum tuberosum was transformed with constructs containing limit dextrinase
inhibitor
using the method of leaf disc cocultivation essentially as described by Horsch
et al. (Science
227: 1229-1231, 1985). The youngest two fully-expanded leaves from a 5-6 week
old soil
grown potato plant were excised and surface sterilised by immersing the leaves
in 8% 'Domestos'
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
Sl
for IO minutes. The leaves were then rinsed four times in sterile distilled
water. Discs were cut
from along the lateral vein of the leaves using a No. 6 cork borer. The discs
were placed in a
suspension of Agrobacterium, containing one of the four plasmids listed above
for approximately
2 minutes. The leaf discs were removed from the suspension, blotted cliy and
placed on petri
dishes (10 leaf discs/plate) containing callusing medium (Murashige and Skoog
agar containing
Z.Sp,g/ml BAP, 1 ~.g/ml dimethylaminopurine, 3% (w/v).glucose). After 2 days
the discs were
transferred onto callusing medium containing SOO~g/ml Claforan and SO~.g/ml
Kanamycin. After
a further 7 days the discs were transferred (5 leaf discs/plate) to shoot
regeneration medium
consisting of Murashige and Skoog agar containing 2.S~,g/ml BAP, 10 ~,g/ml
GA3, SOO~,g/ml
Claforan, SO~g/ml Kanamycin and 3% (w/v) glucose. The discs were transferred
to fresh shoot
regeneration media every 14 days until shoots appeared. The callus and shoots
were excised and
placed in liquid Murashige and Skoog medium containing SOO~g/ml Claforan and
3% (w/v)
glucose. Rooted plants were weaned into soil and grown up under greenhouse
conditions to
provide tuber material for analysis. Alternatively microtubers were produced
by taking nodal
pieces of tissue culture grown plants onto Murashige and Skoog agar containing
2.Sp.g/ml
Kanamycin and 6% ~(w/v) sucrose. These were placed in the dark at 19° C
for 4-6 weeks when
microtubers were produced in the leaf axils.
Transformed plants were analysed for effects on starch metabolism in the
tubers
Example 13. Transformation of wheat
Wheat was transformed with Agrobacterium including the limit dextrinase
inhibitor
containing plasmid using the seed inoculation method described in WO 00/63398
(RhoBio S.A.).
Transformed plants were analysed for effects on starch metabolism in the
endosperm.
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
52
Reference List
Ausubel F.M., Bent R., Kingston R.E., Moore D.D., Seidmann J.G., Smith J.A.
&Struhl K.
(1989) Current protocols in molecular biology. New York: Greene and Willy
Interscience.
Ball, S. Guars, H.P., James, M., Keeling, P., Mouille, G., Buleon, A Colonna,
P. and Preiss, J.
(1996) From glycogen to amylopectin: amodel for the biogeesis of the plant
starch.granule. Cell
86, 349-352.
Bevan M., Barnes W.M. & Chilton M. (1983) Structure and transcription of the
nopalin synthase
gene region of T-DNA. Nucleic Acid Research 11, 369-385
Burton R.A., Zhang X.-Q., Hrmova M. & Fincher G.B. (1999) A single limit
dextrinase
gene is expressed both in the developing endosperm and in germinated grains of
barley. Plant
Physiology 119, 859-871.
Burton R.A., Zhang, X.-Q., Hrmova, M. and Fincher, G.B (1999). A single limit
dextrinase gene
is expressed both in the developing endosperm and in germinated grains of
barley. Plant
Physiology 119; 859-871.
Cathala G., Savouret J., Mendez B., West B.L., Karin M., Martial J.A. & Baster
J.D. (1983) A
method for isolation of intact, translationally active ribonucleic acid. DNA
2, 329-335.
Cho M.J., Jiang W. & Lemaux P.G. (1998) Transformation of recalcitrant barley
cultivars
through improvement of regenerability and decreased albinism. Plant Scie~zce
138, 229-244.
Christensen A.H. & Quail P.H. (1996) Ubiquitin promoter-based vectors for high-
level
expression of selectable and/or screenable marker genes in monocotyledonous
plants. Transgehic
research 5, 213-218.
Dellaporta S.L., Wood J.R. & Hicks J.B. (1983) A plant DNA minipreparation:
version 2. Plant
Molecular Biology Reporter 1, 19-22.
Denyer K., Barber L.M., Burton R., Hedley C.L., Hylton C.M., Johnson S., Jones
D.A., Marshall
J., Smith A.M., Tatge H., Tornlinson K. & Wang T.L. (1995) The isolation and
characterization
of novel low-amylose mutants of Pisum sativum L. Plant Cell Environ. 18, 1019-
1026.
Dinges, J.R., Colleoni, C., James, M.G., and Myers, A.M (2003) Mutational
analysis of the
pullulanase-type debranching enzyme of maize indicates multiple functions in
starch
metabolism. Plant Cell 15, 666-680.
Hardie, D.G. (1975). Control of carbohydrates formation by gibberellic acid in
barley
endosperms. Phytochemistry 14, 1719-1722.
Hofgen R. & Willmitzer L. (1990) Biochemical and genetic analysis of different
patatin isoforms
expressed in various organs of potato (Solarium tuberosum). Plant Science 66,
221- 230.
James, M.G., Robertson, D.S., and Myers, A.M. (1995). Characterisation of the
maize gene
sugaryl, a determinant of starch composition in kernels. Plant Cell 7, 417-
429.
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
53
Jane, J.-L., Kasemsuwan, T., Leas, S., Ames, LA., Zobel, H., Darien, LL., and
Robyt, J.F. (1994)
Anthology of granule morphology by scanning electron microscopy. Starch 46;
121-129.
Kristensen M., Lok F., Planchot V., Svendsen L, Leah R. & Svensson B. (1999)
Isolation and
characterization of the gene encoding the starch debranching enzyme limit
dextrinase from
germinating barley. Biochim.Biophys.Aeta 1431, 538-546.
Kristensen M., Planchot V., Abe J. & Svensson B. (1998) Large-scale
purification and
characterization of barley limit dextrinase, a member of the a-amylase
structural family. Cereal
Chemistry 75, 473-479.
Kubo, A., Fujita, N., Harada, K., Matsuda, T., Satoh, H., and Nakamura, Y.
(1999). The starch-
debranching enzymes isoamylase and pullulanase are both involved in
amylopectin biosynthesis
in rice endosperm. Plant Physiology 121, 399-410.
Laemmli TJ.K. (1970) Cleavage of structural proteins during the assembly of
the head of
bacteriophage T4. Nature 227, 680-685.
Lenoir, P., MacGregor, A.W., Moll, M and Daussant, J. (1984). Tdentification
of debranching
enzyme from barley and malt by isoelectric focussing. CR Acad. Sci. Paris 298,
243-248.
Longstaff, M.A. and Bryce, J.H. (1993). Development of limit dextrinase in
germinated barley
.(Hordeum vulgare). Plant Physiol. 101, 881-889.
Lemaux P.G., Cho lYl.J., Louwerse J., Williams R. & Wan Y. (1999) Bombardmen
tmediated
transformation methods for barley. BioRAD ZISlEG Bulletin 2007,
Macgregor A.W., Macri L.J., Schroeder S.W. & Bazin S.L. (1994) Purification
and
characterisation of limit dextrinase inhibitors from barley. Journal of Cereal
Science 20, 33- 41.
Macgregor E.A., Bazin S.L., Ens E.W., Lahnstein J., Macri L.J., Shirley N.J. &
Macgregor A.W.
(2000) Structural models of limit dextrinase inhibitors from barley. Journal
of Cereal Science
31, 79-90. ~ '
Macri L.J., Macgregor A.W., Schroeder S.W. & Bazin S.L. (19.93) Detection of a
limit
dextrinase inhibitor in barley. Journal of Cereal Science 18, 103-106.
Manners, D. J., and Yellowlees, D. (1973) Studies on debranching enzymes. Part
1. The limit .
dextrinase activity of extracts of certain higher plants and commercial malts.
J. Inst. Brew. 79,
377-385.
McDonald, A.M.L., Stark, J.R., Mornson, W.R., and Ellis, R.P. (1991). The
composition of
starch granules from developing barley genotypes. Journal of Cereal Science
13, 93-112.
Murakami T., Anzai H., Imai S., Satoh A., Nagaoka K. & Thompson C.J. (1986)
The bialaphos
biosynthetic genes of Streptomyces hygroscopicus: molecular cloning and
characterization of the
gene cluster. Mol. Gen. Genet. 205, 42-50.
Myers, A.M., Morell, M.K., James, M. G., and Ball, S.G. (2000). Recent
progress toward
understanding biosynthesis of the amylopectin crystal. Plant Physiol 122, 989-
997.
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
S4
Nakamura, Y., Kubo, A., Schimamune, T., Matsuda, T., Harada, K., and Satoh, H.
(1997).
Correlation between activities of starch debranching enzyme and alpha-
polyglucan structure in
endosperms of sugary-1 mutants of rice. Plant J. 12, 143-153.
Nakamura, Y., Umemoto, T., Ogata, N.,-Kuboki, Y., Yano, M. and Sasaki, T.
(1996a). Starch
debranching enzyme (R-enzyme or pullulanase) from developing rice endosperm:
purification,
cDNA and chromosomal localisation of the gene. Planta. 199, 209-218.
Nakamura, Y., Umernoto, T., Takahata, T., komae, K., Amano, E., and Satoh, H.
(1996b).
Changes in structure of starch and enzyme activities affected by sugary
mutations in developing
rice endosperm: Possible role of starch debranching enzyme (R-enzyme) in,
amylopectin
biosynthesis. Physiol. Plant. 97, 491-498.
Peng, M., Gao, M., Baga, M., hucl, P., and Chibbar, R.N.. (2000) starch-
branching enzymes
preferentially associated with A-type starch granules in wheat endosperm.
Plant Physiol 124,
26S-272.
Schroeder S.W. & Macgregor A.W. (1998) Synthesis of limit dextrinase in
germinated barley
kernels and aleurone tissues. J.Am.Soc.Br~ew.Chem. 56, 32-37.
Schulman, A.H., and Akokas, H. (1990). A novel shrunken endosperm mutant of
barley. Physiol.
Plant. 78, S83-589.
Sissons, M. J., Lance, R.C.M., and Sparrow, D.H.B. (1993) studies on limit
dextrinase in barley.
3. Limit dextrinase in developing kernels. Journal of Cereal Science 17, 19-
24.
Sissons, M. J.,Taylor, M and Proudlove, M. (1995), Barley malt limit
dextrinase: Its extraction,
heat stability, and activity during malying and mashing. J. Am. Soc. Brew.
Chem. S3, 104-110.
Smith et al., 1995, Plant Physiology, 107:673-677 ,
Smith, A. M., Denver, K. and Martin, C. (1997) The synthesis of the starch
granule. Annu.Rev.
Plant Physiol. Plant Mol. Biol. 48, 67-87.
Sun, C., Sathish, P., Ahlandsberg, S., and Jansson, C. (1999). Analyses of
isoamylase gene
activity in wild type barley indicate its involvement in starch synthesis.
Plant Mol. Biol. 40, 431-
443.
Tester, 1997, in: Starch Structure and Functionality, Frazier et al., eds.,
Royal Society of
Chemistry, Cambridge, UK
Thompson C.J., Nowa N.R., Tizard R., Crameri R., Davies J.E., Lauwereys M. &
Botterman J.
(1987) Characterization of the herbicide-resistance gene bar from
Streptorrayces laygroscopicus.
EMBO.Iourraal 6, 2519-2523.
Wan Y. & Lemaux P.G. (1994) Generation of large numbers of independently
transformed
fertile barley plants. Plant Playsiol 104, 37-48.
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
Zeeman, S.C., TJmemoto, T., Lue, W.L., Au-Yeung, P., Martin, C., Smith, A.M,
and Chen, J.
(1998). A mutant of Arabidopsis lacking a chloroplastic isoamylase accumulates
both starch and
phytoglycogen. Plant Cell 10, 1699-1712.
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
1
SEQUENCE LISTING
<110> Advanced Technologies (Cambridge) Ltd
<120> Plant Limit Dextrinase Inhibitor
<130> RD-ATC-32
<140>
<141>
<160> 25
<170> PatentIn Ver. 2.1
<210> 1
<211> 517
<212> DNA
<213> Hordeum vulgare
<220>
<221> CDS
<222> (14)..(457)
<400> 1
actagtatca aca atg gca tcc gac cat cgt cgc ttc gtc ctc tcc ggc 49
Met Ala Ser Asp His Arg Arg Phe Val Leu Ser Gly
1 5 10
gcc gtc ttg ctc tcg gtc ctc gcc gtc gcc gcc gcc acc ctg gag agc 97
Ala Val Leu Leu Ser Val Leu Ala Val Ala Ala Ala Thr Leu Glu Ser
15 20 25
gtc aag gac gag tgc caa cca ggg gtg gac ttc ccg cat aac ccg tta 145
Val Lys Asp Glu Cys Gln Pro Gly Val Asp Phe Pro His Asn Pro Leu
30 35 40
gcc acc tgc cac acc tac gtg ata aaa cgg gtc tgc ggc cgc ggt ccc 193,
Ala Thr Cys His Thr Tyr Val Ile Lys Arg Val Cys Gly Arg Gly Pro
45 50 55 60
agc cgg ccc atg ctg gtg aag gag cgg tgc tgc cgg gag ctg gcg gcc 241
Ser Arg Pro Met Leu Val Lys Glu Arg Cys Cys Arg Glu Leu: Ala Ala
65 70 75
gtc ccg gat cac tgc cgg tgc gag gcg ctg cgc atc ctc,atg gac ggg 289
Val Pro Asp His Cys Arg Cys Glu Ala Leu Arg Ile Leu Met Asp Gly
80 85 90
gtg cgc acg ccg gag ggc cgc gtg gtt gag gga cgg ctc ggt gac agg 337
Val Arg Thr Pro Glu Gly Arg Val Val Glu Gly Arg Leu Gly Asp Arg
95 100 105
cgt gac tgc ccg agg gag gag cag agg gcg ttc gcc gcc acg ctt gtc 385
Arg Asp Cys Pro Arg Glu Glu Gln Arg Ala Phe Ala Ala Thr Leu Val
110 115 120
acg gcg gcg gag tgc aac cta tcg tcc gtc cag gag ccg gga gta cgc 433
Thr Ala Ala Glu Cys Asn Leu Ser Ser Val Gln Glu Pro Gly Val Arg
125 130 135 140
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
2
ttg gtg cta ctg gca gat gga tga cgatcgaaat gcgccaaggt aatgaagcgg 487
Leu Val Leu Leu Ala Asp Gly
145
agtactgtat acagaataaa agtactcgag 517
<210> 2
<211> 147
<212> PRT
<213> Hordeum vulgare
<400> 2
Met Ala Ser Asp His Arg Arg Phe Val Leu Ser Gly Ala Val Leu Leu
1 5 10 15
Ser Val Leu Ala Val Ala Ala Ala Thr Leu Glu Ser Val Lys Asp Glu
20 25 30
Cys Gln Pro Gly Val Asp Phe Pro His Asn Pro Leu Ala Thr Cys His
35 40 45
Thr Tyr Val Ile Lys Arg Val Cys Gly Arg Gly Pro Ser Arg Pro Met
50 ' 55 60
Leu Val Lys Glu Arg Cys Cys Arg Glu Leu Ala Ala Val Pro Asp His
65 70 75 80
Cys Arg Cys Glu Ala Leu Arg Ile Leu Met Asp Gly Val Arg Thr Pro
85 90 95
Glu Gly Arg Val Val Glu Gly Arg Leu Gly Asp Arg Arg Asp Cys Pro
100 105 110
Arg Glu Glu Gln Arg Ala Phe Ala Ala.Thr Leu Val Thr Ala Ala,Glu
115 ~ , 120 125
Cys Asn Leu Ser Ser Val Gln Glu Pro Gly Val Arg Leu Val Leu Leu
130 135 140
Ala Asp Gly
145
<210> 3
<211> 672
<212> DNA
<213> Hordeum vulgare
<220>
<221> CDS
<222> (39) . . (482)
<400> 3
aagagattga accaacgacc aataaactag tatcaaca atg gca tcc gac cat cgt 56
Met Ala Ser Asp His Arg
1 5
cgc ttc gtc ctc tcc ggc gcc gtc ttg ctc tcg gtc ctc gcc gtc gcc 104
Arg Phe Val Leu Ser Gly Ala Val Leu Leu Ser Val Leu Ala Val Ala
15 20
cc cc acc tt a a c tc as ac a t c caa cta t ac 152
g g g g g g g g g g g g ggg g g g
Ala Ala Thr Leu Glu Ser Val Lys Asp Glu Cys Gln Leu Gly Val Asp
25 ~ 30 35
ttc ccg cat aac ccg tta gcc acc tgc cac acc tac gtg ata aaa cgg 200
Phe Pro His Asn Pro Leu Ala Thr Cys His Thr Tyr Val Ile Lys Arg
40 45 50
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
3
gtc tgc ggc cgc ggt ccc agc cgg ccc atg ctg gtg aag gag cgg tgc 248
Val Cys Gly Arg Gly Pro Ser Arg Pro Met Leu Val Lys Glu Arg Cys
55 60 65 70
tgc cgg gag ctg gcg gcc gtc ccg gat cac tgc cgg tgc gag gcg ctg 296
Cys Arg Glu Leu Ala Ala Val Pro Asp His Cys Arg Cys Glu Ala Leu
75 80 85
cgc atc ctc atg gac ggg gtg cgc acg ccg gag ggc cgc gtg gtt gag 344
Arg Ile Leu.Met Asp Gly Val Arg Thr Pro Glu Gly Arg Val Val Glu
90 95 100
gga cgg ctc ggt gac agg cgt gac tgc ccg agg gag gag cag agg gcg 392
Gly Arg Leu Gly Asp Arg Arg Asp Cys Pro Arg Glu Glu Gln Arg Ala
105 110 115
ttc gcc gcc acg ctt gtc acg gcg gcg gag tgc aac cta tcg tcc gtc 440
Phe Ala Ala Thr Leu Val Thr Ala Ala Glu Cys Asn Leu Ser Ser Val
120 125 130
cag gcg ccg gga gta cgc ttg gtg cta ctg gca gat gga tga 482
Gln Ala Pro Gly Val Arg Leu Val Leu Leu Ala Asp Gly
135 140 145
cgatgcaaat gcgccaaggt aatgaagcgg agtactgtat acagaataaa agtactcgag 542
tgaaaacaaa ctcataaata aaccttgtga gatgtatgcg tatgatctat ggtgtggaca 602
gttaaattgt ggccgattga tgaataaaaa aggttggaac aaattaaatt gttgtgggtt 662
catatactat 672
<210> 4
<211> 147
<212> PRT
<213> Hordeum vulgare
<400> 4
Met Ala Ser Asp His Arg Arg Phe Val Leu Ser Gly Ala Val Leu Leu
1 5 10 15
Ser Val Leu Ala Val Ala Ala Ala Thr Leu Glu Ser Val Lys Asp Glu
20 25 30
Cys Gln Leu Gly Val Asp Phe Pro His Asn Pro Leu Ala Thr Cys His
35 40 45
Thr Tyr Val Ile Lys Arg Val Cys Gly Arg Gly Pro Ser Arg~Pro Met
50 55 60
Leu Val Lys Glu Arg Cys Cys Arg Glu Leu Ala Ala Val Pro Asp His
65 70 75 80
Cys Arg Cys Glu Ala Leu Arg Ile Leu Met Asp Gly Val Arg Thr Pro
85 90 95
Glu Gly Arg Val Val Glu Gly Arg Leu Gly Asp Arg Arg Asp Cys Pro
100 105 110
Arg Glu Glu Gln Arg Ala Phe Ala Ala Thr Leu Val Thr Ala Ala Glu
115 120 125
Cys Asn Leu Ser Ser Val Gln Ala Pro Gly Val Arg Leu Val Leu Leu
130 . 135 140
Ala Asp Gly
145
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
4
<210>5
<211>621
<212>DNA
<213>Triticum aestivum
<220>
<221>CDS
<222>(45)..(506)
<400> 5
ggatgaggag gagatgcaac ttgtcaacga caaataaact atca atg gca tcc aac 56.
Met Ala Ser Asn
1
Cat Cgt CgC ttC CCC CtC tCC ggC gCC gtC ttg CtC tca gtC CtC gCC 104
His Arg Arg Phe Leu Leu Ser Gly Ala Val Leu Leu: Ser Val Leu Ala
10 15 20
gcc gtg gcc gcc ctg gag agc gtt gag gac gag tgc cag cca ggg gtg 152
Ala Val Ala Ala Leu Glu Ser Val Glu Asp Glu Cys Gln Pro Gly Val
25 30 35
gcc ttc ccg cac aac gca tta gcc acc tgc cac acc tac gtg atc aaa 200
Ala Phe Pro His Asn Ala Leu Ala Thr Cys His Thr Tyr Val Ile Lys
40 45 50
cgg gtc tgc ggc cgc ggt ccc agc cgg ccc atg ctg gtg aag gag cgg 248
Arg Val Cys Gly Arg Gly Pro Ser Arg Pro Met Leu Val Lys Glu Arg
55 60 65
tgt tgc cgg gag ctg gcg gtc gtc ccg gat tac tgc cgg tgc gag gca 296
Cys Cys Arg Glu Leu Ala Val Val Pro Asp Tyr Cys Arg Cys Glu Ala
70 75 80
ctg cgc gtc ctc atg gat ggg gtg cgc gcg gag gag ggc cac gtg gtg 344
Leu Arg Val Leu Met Asp Gly Val Arg Ala Glu Glu Gly His Val Val
85 90 95 100
gag ggc cgc ctt ggt gac aga cgt gac tgc ccg agg gag gcg cag cgg 392
Glu Gly Arg Leu Gly Asp Arg Arg Asp Cys Pro Arg Glu Ala Gln Arg
105 110 115
gag ttc gcc gcc acg ctg gtc acg gcg gcg gag tgc aac ctg ccg acc 440
Glu Phe Ala Ala Thr Leu Val Thr Ala Ala Glu Cys Asn Leu Pro Thr
120 125 130
gtc tcg gga gtc ggg agt aca ctt ggt gcg acc ggc aga tgg atg acg 488
Val Ser Gly Val Gly Ser Thr Leu Gly Ala Thr Gly Arg Trp Met Thr
135 140 145
atc gaa ttg ccc aag taa tgaagcgatc aagcgaagta ctctactggc 536
Ile Glu Leu Pro Lys
150
agatggagta ctgcatgtag aataaaagta ctcaagtgaa aacaaataaa taaagcttgt 596
gagctgtatg cgtatgaaaa aaaaa 621
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
<210> 6
<211> 153
<212> PRT
<213> Triticum aestivum
<400> 6
Met Ala Ser Asn His Arg Arg Phe Leu Leu Ser Gly Ala Val Leu Leu
1 5 10 15
Ser Val Leu Ala Ala Val Ala Ala Leu Glu Ser Val Glu Asp Glu Cys
20 25 30
Gln Pro Gly Val Ala Phe Pro His Asn Ala Leu Ala Thr Cys His Thr
35 40 45
Tyr Val Ile Lys Arg Val Cys Gly Arg Gly Pro Ser Arg Pro Met Leu
50 55 60
Val Lys Glu Arg Cys Cys Arg Glu Leu Ala Val Val Pro Asp Tyr Cys
65 70 75 80
Arg Cys Glu Ala Leu Arg Val Leu Met Asp Gly Val Arg Ala Glu Glu
. 85 90 95
Gly His Val Val Glu Gly Arg Leu Gly Asp Arg Arg Asp Cys Pro Arg
100 105 110
Glu Ala Gln Arg Glu Phe Ala Ala Thr Leu Val Thr Ala Ala Glu Cys
115 120 125
Asn Leu Pro Thr Val Ser Gly Val Gly Ser Thr Leu Gly Ala Thr Gly
130 135 140
Arg Trp Met Thr Ile Glu Leu Pro Lys
145 150
<210> 7
<211> 444
<212> DNA
<213> Hordeum spontaneum
<220>
<221> CDS
<222> (1) . . (444)
<400> 7
atg gcg ttc aag tac cag ctc CtC CtC tcg gcc gcc gtc atg ctc gcc 48
Met Ala Phe Lys Tyr Gln Leu Leu Leu Ser Ala Ala Val Met Leu Ala
1 5 10 15
att ctc gcc gCC aCt gtC aCC agt ttC ggg gat atg tgt get cca ggg 96
Ile Leu Ala Ala Thr Val Thr Ser Phe Gly Asp Met Cys Ala Pro Gly
20 25 30
gat gcg ttg cca gcc aac cct ctc aga gcc tgc cgc acc tat gtg gtt 144
Asp Ala Leu Pro Ala Asn Pro Leu Arg Ala Cys Arg Thr Tyr Val. Val
35 40 45
a t caa atc t c'cat to c cct a a cta tcc acc t ac at as 192
g g g gg g gg g g g
Ser Gln Ile Cys His Val Gly Pro Arg Leu Ser Thr Trp Asp Met Lys
50 55 60
agg cgg tgc tgc,gac gag ctg tcg gcc atc ccg gcg tac tgc aga tgc 240
Arg Arg Cys Cys Asp Glu Leu Ser Ala Ile Pro Ala Tyr Cys Arg Cys
65 70 75 80
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
6
gag gcg ctg cgt atc atc atg gat ggg aca gta act tgg cag ggt gtg 288
Glu Ala Leu Arg Ile Ile Met Asp Gly Thr Val Thr Trp Gln Gly Val
85 90 95
ttc ggt gcc tac ttc aag gac atg ccc aac tgc CCt agg gtg atg caa 336
Phe Gly Ala Tyr Phe Lys Asp Met Pro Asn Cys Pro Arg Val Met Gln
100 105 110
acg agc tac gcc gcc aac ctc gtc aac ccg cag gag tgc aac cta tgg 384
Thr Ser Tyr Ala Ala Asn Leu Val Asn Pro Gln Glu Cys Asn Leu Trp
115 120 125
act atc cac ggc agc ccg tcc tgc ccc gaa ctg cag ccc gga tat gaa 432
Thr Ile His Gly Ser Pro Ser Cys Pro Glu Leu Gln Pro Gly Tyr Glu
130 135 140
gtg gtc ttg taa 444
Val Val Leu
145
<210> 8
<211> 147
<212> PRT
<213> Hordeum spontaneum
<400> 8
Met Ala Phe Lys Tyr Gln Leu Leu Leu Ser Ala~Ala Val Met Leu Ala
1 5 10 15
Ile Leu Ala Ala Thr Val Thr Ser Phe Gly Asp Met Cys Ala Pro Gly
20 25 30
Asp Ala Leu Pro Ala Asn Pro Leu Arg Ala Cys Arg Thr Tyr Val Val
35 ' 40 45
Ser Gln Ile Cys His Val Gly Pro Arg Leu Ser Thr Trp Asp Met Lys
50 55 60
Arg Arg Cys Cys Asp Glu Leu Ser Ala Ile Pro Ala Tyr Cys Arg Cys
65 70 75 80
Glu Ala Leu Arg Ile Ile Met Asp Gly Thr Val Thr Trp Gln Gly Val
85 90 95
Phe Gly Ala Tyr.Phe Lys Asp Met Pro Asn Cys Pro Arg Val Met Gln
100 105 110
Thr Ser Tyr Ala Ala Asn Leu Val Asn Pro Gln Glu Cys Asn Leu Trp
115 120 125
Thr Ile His Gly Ser Pro Ser Cys Pro Glu Leu Gln Pro Gly Tyr Glu
130 135 140
Val Val Leu
145'
<210> 9
<211> 483
<212> DNA
<213> Oryza sativa
<220>
<221> CDS
<222> (1)..(483)
<400> 9
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
7
atg get tcc aac aag gta gtg ttc tca gtg ttg ctt ctc gcc gtc gtc 48
Met Ala Ser Asn Lys Val Val Phe Ser Val Leu Leu Leu Ala Val Val
1 5 10 15
tcc gtg ctc gcg gcg acg gcg acc atg gcg gag tac cac cac caa gac 96
Ser Val Leu Ala Ala Thr Ala Thr Met Ala Glu Tyr His His Gln Asp
' 20 25 30
cag gtg gtc tac acc ccg ggc ccg ctc tgt cag cca gga atg ggc tac 144
Gln Val Val Tyr Thr Pro Gly Pro Leu Cys Gln Pro Gly Met Gly Tyr
35 40 45
ccg atg tac ccg ctc ccg cgt tgc cgg gcg ttg gtg'aag cgc cag tgc 192
Pro Met Tyr Pro Leu Pro Arg Cys Arg Ala Leu Val Lys Arg Gln Cys
50 55 60
gtc ggc cgt ggc acg gcc gcc gcc gcc gag cag gtc cgg cga gac tgc 240
Val Gly Arg Gly Thr Ala Ala Ala Ala Glu Gln Val Arg Arg Asp Cys
65 70 75 80
tgc cgg cag ctc gcc gcc gtc gac gac agc tgg tgc agg tgc gag gcg 288
Cys Arg Gln Leu Ala Ala Va1 Asp Asp Ser Trp Cys Arg Cys Glu Ala
85 90 95
atc agc cac atg ctg gga ggc atc tac agg gag ctc ggc gcc ccc gat 336
Ile Ser His Met Leu Gly Gly Ile Tyr Arg Glu Leu Gly Ala Pro Asp
100 105 110
gtc ggg cac ccc atg tcc gag gtg ttc cgc ggc tgc cgg aga ggg gac 384
Val Gly His Pro Met Ser Glu Val Phe Arg Gly Cys Arg Arg Gly Asp
115 120 125
ttg gag cgc gcg gcg gcg agC CtC CCg gCg ttC tgc aac gtg~gac atc 432
Leu Glu Arg Ala Ala Ala Ser Leu Pro Ala Phe Cys Asn Val Asp Ile
130 135 140
ccc aac ggc gga ggt ggt gtc tgc tac tgg ctg gcg aga tct ggc tac 480
Pro Asn Gly Gly Gly Gly Val Cys Tyr Trp Leu Ala Arg Ser Gly Tyr
145 150 155 160
I tag 483
<210> 10
<211> 160
<212> PRT
<213> Ory~a sativa
<400> 10
Met Ala Ser Asn Lys Val Val Phe Ser Val Leu Leu Leu Ala Val Val
1 5 10 15
Ser Val Leu Ala Ala Thr Ala Thr Met Ala Glu Tyr His His Gln Asp
20 25 30
Gln Val Val Tyr Thr Pro Gly Pro Leu Cys Gln Pro Gly Met Gly Tyr
35 40 45
Pro Met Tyr Pro Leu Pro Arg Cys Arg Ala Leu Val Lys Arg Gln Cys
50 55 60
Val Gly Arg Gly Thr Ala Ala Ala Ala Glu Gln Val Arg Arg Asp Cys
65 70 75 80
Cys Arg Gln Leu Ala Ala Val Asp Asp Ser Trp Cys Arg Cys Glu Ala
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
8 ,
85 , 90 95
Ile Ser His Met Leu Gly Gly Ile Tyr Arg Glu Leu Gly Ala Pro Asp
100 105 110
Val Gly His Pro Met Ser Glu Val Phe Arg Gly Cys Arg Arg Gly Asp
115 l20 125
Leu Glu Arg Ala Ala Ala Ser Leu Pro Ala Phe Cys Asn Val Asp Ile
130 135 140
Pro Asn Gly Gly Gly Gly Val Cys Tyr Trp Leu Ala Arg Ser Gly Tyr
145 ° 150 155 160
<210> 11
<211> 707
<212> DNA
<213> Triticum durum
<220>
<221> CDS
<222> (27)..(533)
<400> 11
agcgaaccag acttggctag aatacc atg gcg tgc aag tcc agc tgc agc ctc 53
Met Ala Cys Lys Ser Ser Cys Ser Leu
1 5
ctc ctc ttg gcc gcc gtc ctg ctc tcc gtc ttg gcc get get tcc gcc 101
Leu Leu Leu Ala Ala Val Leu Leu Ser Val Leu Ala Ala Ala Ser Ala
~ 15 20 25
tcc ggc agc tgc gtc eca ggg gtg get ttt cgg acc aat ctt ctg cca 149
Ser Gly Ser Cys Val Pro Gly Val Ala Phe Arg Thr Asn Leu Leu Pro
30 35 40
cac tgc cgc gac tat gtg tta caa caa act tgt ggc acc ttc acc cct 197
His Cys Arg Asp Tyr Val Leu Gln Gln Thr Cys Gly Thr Phe Thr Pro
45 50 55
ggg tca aag tta ccc gaa tgg atg aca tct geg tcg ata tac tcc cct 245
Gly Ser Lys Leu Pro Glu Trp Met Thr Ser Ala Ser Ile Tyr Ser Pro
60 ~ 65 70
ggg aaa ccg tac ctc gcc aag ttg tat tgc tgc cag gag ctc gca gaa 293
Gly Lys Pro Tyr Leu Ala Lys Leu Tyr Cys Cys Gln Glu Leu Ala Glu
75 ~ 80 85
att tct cag cag tgc cgg tgc gag gcg ctg cgc tac ttc ata gcg ttg 341
Ile Ser Gln Gln Cys Arg Cys Glu Ala Leu Arg Tyr Phe Ile Ala Leu
90 95 100 105
ccg gta ccg tct cag cct gtg gac ccg agg tcc ggc aat gtt ggt gag 389
Pro Val Pro Ser Gln Pro Val Asp Pro Arg Ser Gly Asn Val Gly Glu
110 115 120
agc ggc ctc atc gat ctg CCC gga tgc ecc agg gag atg caa tgg gac 437
Ser Gly Leu Ile Asp Leu Pro Gly Cys Pro Arg Glu Met Gln Trp Asp
125 130 135
ttc gtc aga tta etc gtc gcc ccg ggg cag tgc aac ttg gcg acc att 485
Phe Val Arg Leu Leu Val Ala Pro Gly Gln Cys Asn Leu Ala Thr Ile
140 145 150
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
g
cac aat gtt cga tac tgc ccc gcc gtg gaa cag cct ctg tgg atc tag 533
His Asn Val Arg Tyr Cys Pro Ala Val Glu Gln Pro Leu Trp Ile
155 ' 160 165
agataaaatc agtcgctcgt,gaataagcat gcatgttgca tccataggcg tgtggtgtgc 593
atgtatacat atgtgagctc cgcgcgctca acatgtgtgg gctatctgct atgaatgaga 653
ataaagagaa tcattctgtg gttctttaat ttcaactaaa aaaaaaaaaa aaaa 707
<210> 12
<211> 168
<212> PRT
<213> Triticum durum a
<400> 12
Met Ala Cys Lys Ser Ser Cys ~Ser Leu Leu Leu Leu Ala Ala Val Leu
1 5 10 15
Leu Ser Val Leu Ala Ala Ala Ser Ala Ser Gly Ser Cys Val Pro Gly
20 25 30
Val Ala Phe Arg Thr Asn Leu Leu Pro His Cys Arg Asp Tyr Val Leu
35 40 45
Gln Gln Thr Cys Gly Thr Phe Thr Pro Gly Ser Lys Leu'Pro Glu Trp
50 55 60
Met Thr Ser Ala Ser Ile Tyr Ser Pro Gly Lys Pro Tyr Leu Ala Lys
65 70 75 80
Leu Tyr Cys Cys Gln Glu Leu Ala Glu Ile Ser Gln Gln Cys Arg Cys
85 90 95
Glu Ala Leu Arg Tyr Phe Ile Ala Leu Pro Val Pro~Ser Gln Pro Val
100 105 110
Asp Pro Arg Ser Gly Asn Val Gly Glu Ser Gly Leu Ile Asp Leu Pro
115 120 125
Gly Cys Pro Arg Glu Met Gln Trp Asp Phe Val Arg Leu Leu Val Ala
130 135 140 ,
Pro Gly Gln Cys Asn Leu Ala Thr Ile His Asn Val Arg Tyr Cys Pro
145 150 155 160
Ala Val Glu Gln Pro Leu Trp Ile
165
<210> 13
<211> 712
<212> DNA
<213> Zea mays ,
<220>
<221> CDS
<222> (33) .. (500)
<400> 13
catccatcga gaggccgtcg acaggggaat to atg gcg tcg tcg tct agc agc 53
Met Ala Ser Ser Ser Ser Ser
1 5
agc cac cgc cgc ctc atc ctc gca gcc gcc gtc ctg ctc tcc gtg ctc 101
Ser His Arg Arg Leu Ile Leu Ala Ala Ala Val Leu Leu Ser Val Leu
15 20
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
gcg get gcc agc gcc agc gcc ggg acc tcc tgc gtg ccg ggg tgg gcc 149
Ala Ala Ala Ser Ala Ser Ala Gly Thr Ser Cys Val Pro Gly Trp Ala
25 30 35
atc ccg cac aac ccg ctc ccg agc tgc cgc tgg tac gtg acc agc cgg 197
Ile Pro His Asn Pro Leu Pro Ser Cys Arg Trp Tyr Val Thr Ser Arg
40 ' 45 50 55
acc tgc ggc atc ggg ccg cgc ctc ccg tgg ccg gag ctg aag agg aga 245
Thr Cys Gly Ile Gly Pro Arg Leu Pro Trp Pro Glu Leu Lys Arg Arg
60 65 70
tgc tgc cgg gag ctg gcg gac atc ccg gcg tac tgc cgg tgc acg gcg 293
Cys Cys Arg Glu Leu Ala Asp Ile Pro Ala Tyr Cys Arg Cys Thr Ala
75 80 85
ctg agc atc ctc atg gac ggc gcg atc ccg cct ggc ccg gac gcg cag 341
Leu Ser Ile Leu Met Asp Gly Ala Ile Pro Pro Gly Pro Asp Ala Gln
90 95 100
ctg gag ggc cgc cta gag gac ctg ccg ggc tgc ccg cgg gag gtg cag 389
Leu Glu Gly Arg Leu Glu Asp Leu Pro Gly Cys Pro Arg Glu Val Gln
105 110 115
agg gga ttc gcc gcc acc ctc gtc acg gag gcc gag tgc aac ctg gcc 437
Arg Gly Phe Ala Ala Thr Leu Val Thr Glu Ala Glu Cys Asn Leu Ala
120 125 130 135
acc atc agc ggc gtc gcc gaa tgc ccc tgg att ctc ggc ggc gga acg 485
Thr Ile Ser Gly Val Ala Glu Cys Pro Trp Ile Leu Gly Gly Gly Thr
140 145 150
atg ccc tcc aag taa ctgcgaagag catagtgcat gaggaatgag cttgtagcta 540
Met Pro Ser Lys
155
gctcatatgt ctgaataata agcacagcaa gaagatgaat gcatttctcg gatcgttcat 600
ccggaacaat aattaaaggg gatccggatt tgttcttgtg atataattaa cgattcctgt 660
tatacttgga agtagctagg ctcgtcccca tccaatgcaa gcaaaaaaaa as 712
<210> 14
<211> 155
<212> PRT
<213> Zea mays
<400> 14
Met Ala Ser Ser Ser Ser Ser Ser His Arg Arg Leu Ile Leu Ala Ala
1 5 10 . 15
Ala Val Leu Leu Ser Val Leu Ala Ala Ala Ser Ala Ser Ala Gly Thr
25 30
Ser Cys Val Pro Gly Trp Ala Ile Pro His Asn Pro Leu Pro Ser Cys
35 40 45
Arg Trp Tyr Val Thr Ser Arg Thr Cys Gly Ile Gly Pro Arg Leu Pro
50 55 60
Trp Pro Glu Leu~Lys Arg Arg Cys Cys Arg Glu Leu Ala Asp Ile Pro
65 70 75 80
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
11
Ala Tyr Cys Arg Cys Thr Ala Leu Ser Ile Leu Met Asp Gly Ala Ile
85 90 95
Pro Pro Gly Pro Asp Ala Gln Leu Glu Gly Arg Leu Glu Asp Leu Pro
100 105 110
Gly Cys Pro~Arg Glu Val Gln Arg Gly Phe Ala Ala Thr Leu Val Thr
115 120 125
Glu Ala Glu Cys Asn Leu Ala Thr Ile Ser Gly Val Ala Glu Cys Pro
130 135 140
Trp Ile Leu Gly Gly Gly Thr Met Pro Ser Lys
145 150 155
<210> 15
<211> 122
<212> PRT
<213> Eleusine coracana
<400> 15
Ser Val Gly Thr Ser Cys Ile Pro Gly Met Ala Ile Pro His Asn Pro
1 5 10 15
Leu Asp Ser Cys Arg Trp Tyr Val Ala Lys Arg Ala Cys Gly Val Gly
20 25 30
Pro Arg Leu Ala Thr Gln Glu Met Lys Ala Arg Cys Cys Arg Gln Leu
35 40 45
Glu Ala Ile Pro~Ala Tyr Cys Arg Cys Glu Ala Val Arg Ile Leu Met
50 55 60
Asp Gly Val Val Thr Pro Ser Gly Gln His Glu Gly Arg Leu Leu Gln
6.5 70 75 80
Asp Leu Pro Gly Cys Pro Arg Gln Val Gln Arg Ala Phe Ala Pro Lys
85 90 95
Leu Val Thr Glu Val Glu Cys Asn Leu Ala Thr Ile His Gly Gly Pro
100 105 110
Phe Cys Leu Ser Leu Leu Gly Ala Gly Glu
115 120
<210> 16
<211> 121
<212> PRT
<213> Secale cereale
<400> 16
Ser Val Gly Gly Gln Cys Val Pro Gly Leu Ala Met Pro His Asn Pro
1 5 10 15
Leu Gly Ala Cys Arg Thr Tyr Val Val Ser Gln Ile Cys His Val Gly
20 ~ ' 25 30
Pro Arg Leu Phe Thr Trp Asp Met Lys Arg Arg Cys Cys~Asp Glu Leu
35 40 45
Leu Ala Ile Pro Ala Tyr Cys Arg Cys Glu Ala Leu Arg Ile Leu Met
50 . 55 ~ 60
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
12
Asp Gly Val Val Thr Gln Gln Gly Val Phe Glu Gly Gly Tyr Leu Lys
65 70 75 80
Asp Met Pro Asn Cys Pro Arg Val Thr Gln Arg Ser Tyr Ala Ala Thr
85 90 95
Leu Val Ala Pro Gln Glu Cys Asn Leu Pro Thr Ile His Gly Ser Pro
100 10.5 110
Tyr Cys Pro Thr Leu Gln Ala Gly Tyr
115 120
<210> 17
<211> 35
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR primer
<400> 17
accaataaac tagtatcaac aatggcatcc gacca 35
<210> 18
<211> 30
<212> DNA
<213> Artificial Sequence
<220>.
<223~> Description of Artificial Sequence: PCR primer
<400> 18
ccaacctttt ttattcatca atcggccaca 30
<210> 19
<211> 27
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR primer
<400> 19
tcggattcca ttgcccagct atctgtc , 27
<210> 20
<211> 29
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR primer
<400> 20
atgggcccta acaatcagta aattgaacg 29
CA 02529455 2005-12-14
WO 2004/112468 PCT/GB2004/002583
13
<210> 21
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR primer a
<400> 21 .
cggtaccggc aggctgaagt cca 23
<210> 22
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR primer
<400> 22.
ccggggatct accatgagcc saga 24
<210> 23
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR primer
<400> 23
gaatgaaccg aaaccggcgg to 22
<210> 24
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR primer
<400> 24
taCCa.CCtCC ctgaggtttg 20
<210> 25
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PCR primer
<400> 25
ccatgcctag ggtcacactt 20
