Note: Descriptions are shown in the official language in which they were submitted.
DEMANDES OU BREVETS VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVETS
COMPRI~:ND PLUS D'UN TOME.
CECI EST L,E TOME 1 DE 2
NOTE: Pour les tomes additionels, veillez contacter 1e Bureau Canadien des
Brevets.
JUMBO APPLICATIONS / PATENTS
THIS SECTION OF THE APPLICATION / PATENT CONTAINS MORE
THAN ONE VOLUME.
THIS IS VOLUME 1 OF 2
NOTE: For additional valumes please contact the Canadian Patent Office.
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
1
DIAGNOSIS AND TREATMENT METHODS RELATED TO AGING (8A)
This application claims the benefit, under 35 USC
119(e), of U.S Provisional Appl. No. 60/485,222, filed July
8, 2003, which is hereby incorporated by reference in its
entirety.
Men t i on of Governmen t Gran t
Some of the work disclosed herein was funded by NIH grant
#AG19899. Consequently, the federal government may enjoy
certain rights in the invention.
Cross-Reference to Related Applications
Anti-Aging Applications. Mice with a disrupted growth
hormone receptor/binding protein gene enjoy an increased
lifespan. In U.S. Prov. Appl. 60/485,222, filed July 8,
2003 (Kopchick8) mouse genes differentially expressed in
comparisons of gene expression in growth hormone
receptor/binding protein gene-disrupted mouse livers and
normal mouse livers were identified, as were corresponding
human genes and proteins. It was suggested that the human
molecules, or antagonists thereof, could be used for
protection against faster-than-normal biological aging, or
to achieve slower-than-normal biological aging. It was also
taught that the human molecules may also be used as markers
of biological aging.
In provisional application Ser. No. 60/474,606, filed
June 2, 2003 (our docket Kopchick7-USA) , our research group
used a gene chip to study the genetic changes in the liver
of C57B1/6J mice that occur at frequent intervals of the
aging process. Differential hybridization techniques were
used to identify mouse genes that are differentially
expressed in mice, depending upon their age. The level of
gene expression of approximately 10,000 mouse genes (from
the Amersham Codelink UniSet Mouse I Bioarray, product
code: 300013)in the liver of mice with average ages of 35,
49, 56, 77, 118, 133, 207, 403, 558 and 725 days was
determined. In essence, complementary RNA derived from mice
of different ages was screened for hybridization with
RECTIFIED SHEET (RULE 91 )
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
2
oligonucleotide probes each specific to a particular mouse
gene, each gene in turn representative of a particular mouse
gene cluster (Unigene). Mouse genes which were
differentially expressed (younger vs. older), as measured by
different levels of hybridization of the respective cRNA
samples with the particular probe corresponding to that
mouse gene, were identified. Related human genes and
proteins were identified by sequence comparisons to the
mouse gene or protein. In the international appl.
Kopchick7A-PCT, filed June 2, 2004, we added some additional
studies of CII7E-A (see below) .
In a like manner, the effect of aging on the expression
of genes in mouse skeletal muscle was studied, see
provisional application Ser. No. 60/566,068, filed April 29,
2004 (our docket Kopchickl4-USA).
Anti-Diabetes Applications. In U.S. Provisional Appl.
Ser. No. 60/458,398 (our docket Kelderl-USA), filed March
31, 2003, members of our research. gr~up describe the
identification of genes differentially expressed in normal
vs. hyperinsulinemic, hyperinsulinemic vs. type II diabetic,
or normal vs. type II diabetic mouse liver. Forward- and
reverse-substracted cDNA libraries were prepared, clones
were isolated, and differentially expressed cDNA inserts
were sequenced and compared with sequences in publicly
available sequence databases. The corresponding mouse and
human genes and proteins were identified.
The purpose of~our research group's provisional
application Ser. No. 60/460,415 (our docket: Kopchick6-
USA), filed April 7, 2003, was similar, but complementary
RNA, derived from RNA of mouse liver, was screened against a
mouse gene chip. See also 60/506,716, filed Sept. 30, 2003
(Kopchick6.1).
Gene chip analyses have also been used to identify
genes differentially expressed in normal vs.
hyperinsulinemic, hyperinsulinemic vs. type II diabetic, or
normal vs. type II diabetic mouse pancreas, see U.S.
Provisional Appl. 60/517,376, filed Nov. 6, 2003
(Kopchickl2) and muscle, see U.S Provisional Appl.
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
3
60/547,512, filed Feb. 26, 2004 (Kopchickl5).
Other differential h~rbridization applications. The use
of differential hybridization to identify genes and proteins
is also described in our research group's Ser. No.
PCT/LTS00/12145 (Kopchick 3A-PCT), Ser. No. PCT/LTS00/12366
(Kopchick4A-PCT), and Ser. No. 60/400,052 (Kopchick5).
All of the foregoing applications are hereby
incorporated by reference in their entirety.
BACKGRfUND ~F THE INVENTI~N
Field of the Invention
The invention relates to various nucleic acid molecules
and proteins, and their use in (1) diagnosing aging, or
adverse conditions associated with the aging process, and
(2) protecting mammals (including humans) against the aging
process or adverse conditions associated with the aging
process.
Description of the Background Art
The mechanisms that cause aging (the decline in
survival and reproductive ability with advancing age) have
puzzled our society and scientific community for centuries.
The two major theories center on the question of whether
normal aging is an evolutionarily-genetically preprogrammed
pathway of internal changes or is a normal consequence of
existence where there is an accumulation of molecular and
cellular damages. Hypotheses of such accumulated damage
include free radical-oxidative damage, defective
mitochondria, somatic mutations, progressive shortening of
telomeres, programmed cell death, impaired cell
I proliferation and numerous others (1). The current belief is
that aging is not a programmed process in that, to date, no
genes are known to have evolved specifically to cause damage
and aging. The one factor that has been shown to extend the
lifespan in organisms from yeast to mice has been a
reduction in caloric intake (2, 3). Recent data suggests
that caloric restriction may also be relevant for primates,
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
4
including humans (4-6). Unfortunately, it is unlikely that
most people will be able to maintain the strict dietary
control required to reap the benefits of this finding.
Therefore, since the mechanisms) by which caloric
restriction extends lifespan are unknown, the elucidation of
such. mechanisms could lead to the development of alternative
strategies to yield similar benefits.
Numerous groups are presently engaged in identifying
genes and pathways that are involved in the aging process.
A growing list of genes that extend adult longevity have
been identified and a large proportion of these genes are
involved with hormonal signals. Many of these genes and the
corresponding endocrine systems are conserved among a wide
variety of eukaryotes. What is becoming clear, at least in
lower animal species, is that those pathways that provide
advantages to development and growth early in life may
impart negative consequences in later life. The clearest
example of a genetic pathway affecting adult lifespan has
been described in the nematode, Caenorha.~bditis elegar~s.
When food is abundant, C. elec~ans develops directly to the
reproductive adult through four larval stages in three days.
Under adverse conditions such as caloric restriction or high
population density, C. elegans enters the Dauer diapause, a
non-feeding, stress-resistant larval state. Genetic
analysis has identified that mutation of single genes
involved in dauer formation (Daf) greatly extend the adult
lifespan (7). These genes involve the~highly-conserved
insulin/IGF-like signal transduction pathway. Ligand
hinging to the daf-2 insulin-like receptor results in a
kinase signaling cascade to phosphorylate the forkhead
transcription factor, daf-16. This phosphorylation
sequesters daf-16 to the cytoplasm and results in
reproductive maturity and aging. In the absence of ligand
and signal transduction, the unphosphorylated, daf-16
localizes to the nucleus and regulates the transcription of
its target genes that promote dauer formation, stress
resistance and extended longevity (8). A similar pathway
has been described in Drosophilia melanogaster. Mutation of
the gene encoding insulin-like receptor (InR) or the gene
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
encoding insulin-receptor substrate (chico) also extends the
normal life-span (9,10). Vertebrate homologues of daf-16
down-regulate genes promoting cell progression, induce genes
involved in DNA-damage repair and up-regulate genes that
5 reduce intracellular reactive oxygen species (ROS) (11,12).
A second C. elegans gene, clk-1, has also been linked to the
reduction of ROS and an extended life-span. While the
effect of da.f-2 mutants result in a reduction of
mitochondrial ROS, clk-1 mutants reduce extramitochondrially
produced ROS. Since the majority of cellular ROS is produce
in the mitochondria during the process of electron
transport, it is not surprising that c1k-1 mutants have only
a moderately extended life-span. C. elegans containing daf-
2/c1k-1 d~uble mutations, however, exhibit a very long life-
span ( 13 ) .
Decreased IGF-1 signaling may also extend longevity in
mice. Four mouse models with deficiencies in pituitary
endocrine action have demonstrated retarded aging. In the
Prop1 and Pitt models, pituitary production of growth
hormone (GH), prolactin (PRL) and thyroid stimulating
hormone (TSH) are ablated. These mice have reduced growth
rates, reduced adult body size and live 40 to 600 longer
than normal mice (14,15). Unfortunately, it is not possible
to determine which. of the ablated hormones is responsible
for the increased longevity of the models.
A more straight-forward model was developed that
targeted the deletion of the growth hormone receptor (GHR-
.KO) (16). This mouse line was derived from a founder animal
by homologous recombination resulting in deletion and gene
substitution of most of the fourth exon and part of the
fourth intron of the GHR/BP gene. These mice also exhibit
reduced body size and extended life-span and more directly
implicates the GH/IGF-1 axis (17, 17a).
Recently, evidence for a direct role of IGF-1 receptor
signaling in affecting the aging process was provided by the
targeted disruption of the IGR-1 receptor (Igflr) (18).
Heterozygous females, but not males, possess 50o fewer
receptors for IGF-l, live 33% longer than wild-type females
and also display greater resistance to oxidative stress..
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
6
Tyrosine phosphorylation of the intracellular signaling
molecule, Shc, was also decreased in the Igflr +~- females.
Mice containing the targeted deletion of p66shc also have
increased resistance to oxidative stress and a 30o increase
in life span (19). While the IGF-1 axis appears to be
involved in the aging process, the mechanism by which it
does so remains unknown. However, these findings
demonstrate that it is possible to identify specific genetic
pathways that affect the aging process. The finding that
caloric restriction of these mouse models can further extend
their life-span suggests that multiple pathways exist that
affect the aging process (20). Therefore, research to
identify these pathways and the genes involved in the aging
process is of great importance.
Identification of e.,yene~ involsred in aging
Several groups have begun to utilize DNA microarrays to
measure differences in gene expression caused by the aging
process. However, these experiments are extremely limited
in regards to the number of aging time points or
experimental conditions. For example, gene expression
profiling has been performed on skeletal muscle tissue of
mice at 5 verses 30 months of age with or without caloric
restriction (21). In this analysis, the expression of 113
genes was found to be changed by at least two-fold in 5-
month old mice compared to 30-month old mice. Caloric
restriction of comparable mice caused a reversal of the
altered gene expression of 33 genes. Similar analyses have
also been performed on mouse brain and heart (22,23).
Differential Expression in Liver as a result of the aging
process
Cao, S.X., et al., "Genomic profiling of short- and
long-term caloric restriction effects in the liver of aging
mice", Proc. Natl. Acad. Sci. USA, 98:10630-10635 (2001)
used Affymetrix microarray technology to study the changes
in expression levels of 11,000 genes in liver tissue of 7
month-old mice compared to 27 month-old mice. In this
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
7
analysis, the expression of 20 genes increased at least 1.7-
fold with age while the expression of 26 genes decreased at
least 1.7-fold with age.
Tollet-Egnell, P., et al., "Gene expression profile of
the aging process in rat liver: normalizing effects of
growth hormone replacement, Mol. Endocrinol., 15(2):308-18
(2001) used microarray technology to study the effect of
aging and growth hormone treatment on the expression of
3,000 different genes in the rat liver. The proteins which
were over-expressed in the older rat were glucose-6-
phosphate isomerase (x1.8), pyruvate kinase (x4.8), hepatic
product spot 14 (2.4x), fatty acid synthase (1.9x), staryl
CoA desaturase (1.7x), enoyl CoA hyydratase (1.7x),
peroxisome proliferator activated receptor-~ (1.7x), 3-
ketoacyl-CoA thiolase (1.7x), 3-keto-aryl-CoA peroxisomal
thiolase (1.9x), CYP4A3 (3.3x), glycerol-3-phosphate
dehydrogenase (1.7x), NAPDH-cytochrome P450 oxidoreductase
(4.7x). CUP2C7 (1.9x), CYP3A2 (2.8x), O-aminoevulinate
synthase (2.3x). The under-expressed proteins were glucose-
6-phosphatase (0.3x), farnesyl pyrophosphate synthase
(0.5x), carnitine octanoyltransferase (0.5x), mitochrondrial
genome (16S ribosomal RNA)(0.3x), mitochondrial cytochrome c
oxidase II (0.4x), mitochondrial NADH dehydrogenase SU 5
(0.3x), mitochondrial cytochrome b (0.4x), mitochondrial
NADH dhydrogenase SU 3 '(0.5x), NADH-ubiquinone
oxidoreductase (SU CI-SGDH and SU 39kDa)(both 0.5x),
ubiquinol-cytochrome c reductase (Rieske iron-sulfur protein
and core 1)(both 0.5x), CYP2C12 (0.4x), cystathione Y-lyase
(0.3x), biphenyl hydrolase-related protein (0.5x),
glutathione S-transferase (class pi)(0.3x), C(-1
macroglobulin (0.5x), BRAK related protein (0.3x), CX-2u-
globulin (0.4x), cAMP-dependent transcription factor mATF4
(0.5x), DAP-like kinase (0.5x), PCTAIRE-1 (0.5x), collagen
0c-1 (0.4x), histone H2A (0.5x), and S-100 protein Cl (0.5x).
Differential/Subtractive Hybridization
Zhang, et al., Kidney International, 56:549-558 (1999)
identified genes up-regulated in 5/6 nephrectomized
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
8
(subtotal renal ablation) mouse kidney by a PCR-based
subtraction method. Ten known and nine novel genes were
identified. The ultimate goal was to identify genes
involved in glomerular hyperfiltration and hypertrophy.
Melia, et al., Endocrinol., 139:688-95 (1998) applied
subtractive hybridization methods for the identification of
androgen-regulated genes in mouse kidney. The treatment
mice were dosed with dihydrotestosterone, an androgen.
Kidney androgen-regulated protein gene was used as a
positive control, as it is l~nown to be up-regulated by DHT.
See also Holland, et al., Abstract 607, "Identification
of Genes Possibly Involved in Nephropathy of Bovine Growth
Hormone Transgenic Mice" (Endocrine Society Meeting, June
22, 2000) and Coschigano, et al., Abstract 333,
"Identification of Genes Potentially Involved in Kidney
Protection During Diabetes" (Endocrine Society Meeting, June
22, 2000) .
The following differential hybridization articles may
also be of interest: Wada, et al., "Gene expression
profile in streptozotocin-induced diabetic mice kidneys
undergoing glomerulosclerosis~', Kidney Int, 59:1363-73
(2001); Song, et al., "Cloning of a novel gene in the human
kidney homologous to rat muncl3S: its potential role in
diabetic nephropathy'°, Kidney Int., 53:1689-95 (1998); Page,
et al., "Isolation of diabetes-associated kidney genes using
differential display", Biochem. Biophys. Res. Comm., 232:49-
53 (1997); Peradi, "Subtractive hybridization claims: An
efficient technique to detect overexpressed mRNAs in
diabetic nephropathy," Kidney Int. 53:926-31 (1998);
Condorelli, EMBO J., 17:3858-66 (1998); See also WO00/66784
(differential hybridization screening for brown adipose
tissue); PCT/US00/12366, filed May 5, 2000 (differential
hybridization screening for liver).
For genes thought to have aging inhibitory activity,
see generally International Longevity Center, Workshop
Reports, "Longevity Genes: From Primitive Organisms to
Humans," and "Is there an 'Anti-Aging' Medicine?".
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
9
Inohara, et al., EMBO J., 17: 2526-33 (1998) describes
two proteins, CIDE-A and CIDE-B, which are believed to be
cell death activators with homology to the 45kDa subunit of
the DNA fragmentation factor (DFF). DFF is cleaved by
caspase-3 during apoptosis. CIDE-A and -B activate
apoptosis. The C-terminal region appears to contain the
effector domain. Inohara et al. reported that CIDE-A was
expressed in several human tissues, but not in the liver.
For the use of microarrays in the identification of aging-
related genes, see Miller, J. Gerontol., 56A: B52-57 (2001);
Lee et al., Science, 285 :1390-93 (1999) and Nature Genetics
25: 294-7 ( 2000) (bioarray study of changes in mouse
cerebellum and neocortex to detect age-associated genes).
Patents of possible interest include the following:
Kojima, USP 5,000,188 (1991)(an apparatus for measuring the
physiological age of a subject).
Lin, USP 6,303,768 (2001) ("Methuselah gene")
Lippman, USP 4,695,590 ("Method for retarding aging")
West, USP 6,368,789 (2002)("Screening methods to identify
inhibitors of telomerase activity")
Dimri, USP 5,795,728 (1998)("Biomarkers of cell senescence")
Jia, USP 6,326,209 (2001)("Measurement and quantification of
17 ketosteroid -sulfates as a biomarker of biological age")
Other articles of interest include Kayo, et al., Proc.
nat. Acad. Sci. (USA) 98:5093-98 (2001); Han, et al., Mch.
Ageing Dev. 115:157-74 (2000); Dozmorov, et al., J.
gerontol. A Biol. Sci. Med. Sci. 56:B72-B80 (2001);
Do~morov, et al., Id., 57: B99-B108 (2002); Miller, et al.,
Mol. Endocrinol., 16: 2657-66 (2002).
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
Apoptosis and CIDE-A
Apoptosis is a form of programmed cell death that
occurs in an active and controlled manner to eliminate
unwanted cells. Apoptotic cells undergo an orchestrated
5 cascade of morphological changes such as membrane blabbing,
nuclear shrinkage, chromatin condensation, and formation of
apoptotic bodies which then undergo phagocytosis by
neighboring cells. ~ne of the hallmarks of cellular
apoptosis is the cleavage of chromosomal DNA into discrete
10 oligonucleosomal size fragments. This orderly removal of
unwanted cells minimizes the release of cellular components
that may affect neighboring tissue. In contrast, membrane
rupture and release of cellular components during necrosis
often leads to tissue inflammation.
The process of apoptosis is highly conserved and '
involves the activation of the caspase cascade. Cohen, GM.
(1997) Caspases: the executioners of apoptosis. Biochem.
J. 326:1-16; Budihardjo, I., Oliver, H., Lutter, M., Luo,;
X.., Wang, X. (1999) Biochemical pathways of caspase
activation during apoptosis. Annnu. Rev. Cell. Dev.
Biol.l5:269-290; Jacobson, M.D., Weil, M., Raff, M.C.
(1997) Programmed cell death in animal development. Cell
88:347-354. Caspases are a family of serine proteases that
are synthesized as inactive proenzymes. Their activation by
apoptotic signals such as CD95 (Fas) death receptor
activation or tumor necrosis factor results in the cleavage
of specific target proteins and execution of the apoptotic
program. Apoptosis may occur by either an extrinsic pathway
involving the activation of cell surface death receptors
(DR) or by an intrinsic mitochondrial pathway. Yoon, J-H.
Gores G.J. (2002) Death receptor-mediated apoptosis and
the liver. J. Hepatology 37:400-410.
These pathways are not mutually exclusive and some cell
types require the activation of both pathways for maximal
apoptotic signaling. In type-I cells, death receptor
activation leads to the recruitment and activation of
caspases-8/10 and the rapid cleavage and activation of
caspase-3 in a mitochondrial-independent manner.
Hepatocytes are members of the Type-II cells in which
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
11
mitochondria are essential for DR-mediated apoptosis
Scaffidi, C., Fulda, S., Srinivasan, A., Friesen, C., Li,
F., Tomaselli, K.J., Debatin, K.M., Krammer, P.H., Peter,
M.E. (1998) Two CD95 (APO-1/Fas) signaling pathways. EMBO
J. 17:1675-1687. In this pathway, the pro-apoptotic protein
Bid is truncated by activated caspases-8/10 and translocates
to the mitochondria. Luo, X., Budihardjo, I., Zou, H.,
Slaughter, C., Wang, X. (1998) Bid, a Bcl2 interacting
protein, mediates cytochrome c release from mitochondria in
response to activation of cell surface death. receptors.
Cell 94:481-490; Li, H., Zhu, H., Xu, C.J., Yuan, J.
(1998) Cleavage of BID by caspase 8 mediates the
mitochondrial damage in the Fas pathway of apoptosis. Cell
94:491-501. This translocation leads to mitochondrial
cytochrome c release and eventual activation of caspases-3
and 7 via cleavage by activated caspase-9.
One of the substrates for activated caspase-3 is the
DNA fragmentation factor (DFF). DFF is composed of a 45 kDa
regulatory subunit (DFF45) and a 40 kDA catalytic subunit
(DFF40). Liu, X., Zou, H., Slaughter, C., Wang, X.
(1997) DFF, a heterodimeric protein that functions
downstream of caspase-3 to trigger DNA fragmentation during
apoptosis. Cell 89:175-184. DFF45 cleavage by activated
caspase-3 results in its dissociation from DFF40 and allows
the caspase-activated DNAse (CAD) activity of DFF40 to
cleave chromosomal DNA into oligonucleosomal sire fragments.
Liu, X., Li, P., Widlak, P., you, H., Luo, X., Garrard,
W.T., Wang, X. (1998) The 40-kDa subunit of DNA
fragmentation factor induces DNA fragmentation and chromatin
condensation during apoptosis. Proc. Natl. Acad. Sci. USA.
95:8461-8466; Halenbeck, R., MacDonald, H., Roulston, A.,
Chen, T.T., Conroy, L., Williams, L.T. (1998) CPAN, a human
nuclease regulated by the caspase-sensitive inhibitor
DFF45. Curr Biol. 8:537-540; Nagata, S. (2000) Apoptotic
DNA fragmentation. Exp. Cell Res. 256:12-8.
Recently, a novel family of cell-death-inducing DFF45-
like effectors (CIDEs) have been identified that includes
CIDE-A, CIDE-B and CIDE-3/FSP2. Inohara, N., Koseki, T.,
Chen, S., Wu, X., Nunez, G. (1998) CIDE, a novel family of
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
12
cell death activators with homology to the 45 kDa subunit of
the DNA fragmentation factor. EMBO J. 17:2526-2533;
Danesch, U., Hoeck, W., Ringold, G.M. (1992) Cloning and
transcriptional regulation of a novel adipocyte-specific
gene, FSP27. CAAT-enhancer-binding protein (C/EBP) and
C/EBP-like proteins interact with sequences required for
differentiation-dependent expression. J. Biol. Chem.
267:7135-7193; Liang, L., Zhao, M., Xu, Z., Yokoyama, K.K.,
Li, T. (2003) Molecular cloning and characterization of
CIDE-3, a novel member of the cell-death-inducing DNA-
fragmentation-factor (DFF45)-like effector family. Biochem.
J. 370:195-203.
The CIDEs contain an N-terminal domain that shares homology
with the N-terminal region of DFF45 and may represent a
regulatory region via protein interaction. See Inohara,
supra; Lugovskoy, A.A., Zhou, P., Chou, J.J., McCarty, J.S.,
Li, P., Wagner, G. (1999) Solution structure of the CIDE-N
domain of CIDE-B and a model for CIDE-N/CIDE-N interactions
in the DNA fragmentation pathway of apoptosis. Cell 9:747-
755. The family members also share a C-terminal domain that
is necessary and sufficient for inducing cell death and DNA
fragmentation; see Inohara supra. The overexpression of
CIDE-A induces cell death. that can be inhibited by DFF45.
However, CIDE-A-induced apoptosis is not inhibited by
caspase-3 inhibitors thereby suggesting the presence of
additional, caspase-independent, pathways) for the
induction of apoptosis, see Inohara supra. Previous reports
have indicated that human and mouse CIDE-A are expressed in
several tissues such as brown adipose tissue (BAT) and heart
and are localized to the mitochondria, Zhou, Z., Yon Toh,
S., Chen, Z., Guo, K., Ng, C.P., Ponniah, S., Lin, S.C.,
Hong, W., Li, P. (2003) Cidea-deficient mice have lean
phenotype and are resistant to obesity. Nat. Genet. 35:49-
56. . In addition to the ability to induce apoptosis, CIDE-
A can interact and inhibit UCP1 in BAT and may therefore
play a role in regulating energy balance, see Zhou supra.
Previous reports have indicated that CIDE-A is not
expressed in either adult human or mouse liver tissue, see
Inohara supra, Zhou 'supra.
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
13
The human protein cell death activator CIDE-A is of
particular interest because of its highly dramatic change in
liver expression with age, first demonstrated in our
Kopchick7 application, supra. CIDE-A expression is elevated
in older normal mice. CIDE-A expression was studied for
normal C57BI/6J mouse ages 35, 49, 77, 133, 207, 403 and 558
days. Expression is low at the first five data points,
then rises sharply at 403 days, and again at 558 days.
CIDE-A was therefore classified as an "unfavorable protein",
i.e., it was taught that an antagonist to CIDE-A could
retard biological aging.
In Kopchick7A-PCT we reported that CIDE-A is also
prematurely expressed in hyperinsulinemic and type-II
diabetic mouse liver tissue. CIDE-A expression also
correlates with liver steatosis in diet-induced obesity,
hyperinsulinemia and type-II diabetes. These observations
suggest an additional pathway of apoptotic cell death in
Non-Alcoholic Fatty Liver Disease (NAFLD) and that CIDE-A
may play a role in this serious disease and potentially in
liver dysfunction associated with. type-II diabetes.
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
14
SUi~lA,RY OF THE INVENTION
Our research group has previously reported that mice
with a disrupted growth hormone receptor/binding protein
gene enjoy an increased lifespan, as shown in the table
below (17a)
Bkgd Sex Type Mean Median % Surv
Lifespan Lifespan >1000d
C57BL/6j M C 756 68 866 5
M ISO *951 +50 941 43
F C 821 +49 850 18
F ISO t956 80 1023 63
Ola-BALB/cJ M C 656 67 698 0
M ISO **917 +55 888 27
F C 759 +41 765 13
~- - ~ F ~ HO--~ **921 41 981 43
* sig at 0.05 level. ** sig at 0.01 level t not sig, but
two KO females still alive at time of analysis and thus had
not reached maximum lifespan, affecting the analysis.
KO=knockout (GHR/BP -/-) mice, C=control (GHR/BP +/+) mice.
Our attention recently has focused on the generation of
liver mRI~TA expression profiles and the identification of
genes involved in the aging process. We have sought to
identify genes and proteins which affect aging by
determining which mouse genes are differentially expressed
when expression in GHR/BP knockout mice and control mice is
compared. Related human genes and proteins may then be
identified e.g., by comparison of the mouse sequences with
human sequences in sequence databanks.
After identifying related human genes and proteins, one
may formulate agents useful in estimating the biological age
of a human subject or in predicting the rate of biological
aging in a human subject. Tt is particularly desirable to
screen for individuals at risk for faster-than-normal
biological aging.
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
Thus, "favorable" human genes/proteins are defined as
those corresponding to mouse cDNAs which were less strongly
expressed in control mouse liver than in knockout mice
(longer lifespan) liver. Likewise, one may define
5 "unfavorable" human genes/proteins as those corresponding to
mouse cDNAs which were more strongly expressed in control
mouse liver than in knockout mice (longer lifespan) liver.
As used herein, the term "corresponding" does not mean
identical, taut rather implies the existence of a
10 statistically significant sequence similarity, such as one
sufficient to qualify the human protein or gene as a
homologous protein or DNA as defined below. The greater the
degree of relationship as thus defined (i.e., by the
statistical significance of each alignment used to connect
15 the mouse cDNA to the human protein or gene, measured by an
E value), the more close the correspondence. The 'connection
may be direct (mouse cDNA to human protein) or indirect
(e. g., mouse cDNA to mouse gene, mouse gene to human gene,
human gene to human protein).
In general, the human genes/proteins which. most closely
correspond, directly or indirectly, to the mouse cDNA are
preferred, such as the ones) with the highest, top two
highest, top three highest, top four highest, top five
highest, and top ten highest E values for the final
alignment in the connection process. The human
genes/proteins deemed to correspond to our mouse cDNA clones
are identified in the Master Tables.
Agents which bind the "favorable" and "unfavorable"
nucleic acids (e. g., the agent is a substantially
complementary nucleic acid hybridization probe), or the
corresponding proteins (e. g., an antibody vs. the protein)
may be used to evaluate whether a human subject is at
increased or decreased risk for faster-than-normal
biological aging. A subject with one or more elevated
"unfavorable" and/or one or more depressed "favorable"
genes/proteins is at increased risk, and one with one or
more elevated "favorable" and/or one or more depressed
"unfavorable" genes/proteins is at decreased risk.
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
16
The assay may be used as a preliminary screening assay
to select subjects for further analysis, or as a formal
diagnostic assay.
The identification of the related genes and proteins
may also be useful in protecting humans against faster-than-
normal or even normal aging (hereinafter, "the disorders").
Thus, Applicants contemplate:
(1) use of the "favorable",mouse DNAs (cDNAs or genes)
of the Master Tables (below) to isolate or identify related
human DNAs;
(2) use of human DNAs, related to favorable mouse DNAs,
to express the corresponding human proteins;
(3) use of the corresponding human proteins (and mouse
proteins, if biologically active in humans), to protect
against the disorder(s);
(4) use of the corresponding mouse or human proteins,
or nucleic acid probes derived from the mouse or human
genes, in diagnostic agents, in assays to measure biological
aging or the rate thereof; and
(5) use of the corresponding human or mouse genes
therapeutically in gene therapy, to protect against the
di sorder ( s ) .
Moreover Applicants contemplate:
(1) use of the "unfavorable" mouse DNAs of the Master
Tables to isolate or identify related human DNAs;
(2) use of the complement to the "unfavorable" mouse
DNAs or related human DNAs, as antisense molecules to
inhibit expression of the related human DNAs;
(3) use of the mouse or human DNAs to express the
corresponding mouse or human proteins;
(4) use of the corresponding mouse or human proteins,
in diagnostic agents, to measure biological aging or the
rate thereof;
(5) use of the corresponding mouse or human proteins in
assays to determine whether a substance binds to (and hence
may neutralize) the protein; and
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
17
(6) use of the neutralizing substance to protect
against the disorder (s) .
The related human DNAs may be identified by comparing
the mouse sequence (or its AA translation product) to known
human DNAs (and their AA translation products). If this is
unsuccessful, human cDNA or genomic DNA libraries may be
screened using the mouse DNA as a probe.
If there is no closely corresponding full-length mouse
gene in the sequence databank, and the cDNA is not full-
length, then the mouse cDNA may be used as a hybridization
probe to screen a mouse cDNA library to isolate the
corresponding full-length sequence. Alternatively, the
mouse cDNA may be used as a probe to screen a mouse genomic
DNA library.
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
18
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS OF THE
INVENTION
Subjects
For mice, infancy is defined as the period 0 to 21 days
after birth. Sexual maturity is reached, on average, at 42
days after birth. The average lifespan is 832 days.
In humans, infancy is defined as the period between
birth and two years of age. Sexual maturity in males can
occur between 9 and 14 years of age while the average age at
first menstrual period for females is 12.6 years. The
average human lifespan is 73 years for males and 79 years
for females. The maximum verified human lifespan was 122
years, five months and 14 days.
Chronological and Biological Aging
"Aging" is a process of gradual and spontaneous change,
resulting in maturation through childhood, puberty, and
young adulthood and then primarily a decline in function
through middle and late age. Aging thus has both the
positive component of development/maturation and the
negative component of decline.
"Senescence" refers strictly to the undesirable changes
that occur as a result of post-maturation aging. Some of the
changes which occur in post-maturation aging are not
deleterious to health (e. g., gray hair, baldness), and some
may even be desirable (e.g., increased wisdom and
experience). In contrast, the memory impairment that occurs
with age is considered senescence. However, we will
hereafter use "aging" per se to refer to "senescence", and
use "maturation" to refer to pre-maturation development.
There is increased mortality with age after maturation.
There is also a progressive decrease in physiological
capacity with age, but the rate of physiological decline
varies from organ to organ and from individual to
individual. The physiological decline results in a reduced
ability to respond adaptively to environmental stimuli, and
increased susceptibility and vulnerability to disease.
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
19
"Aging is the accumulation of diverse adverse changes
that increase the risk of death. These changes can be
attributed to development, genetic defects, the environment,
disease ,and the inborn aging process. The chance of death
at a given age serves as a measure of the number of
accumulated changes, that is, of physiologic age, and the
rate of change of this measure, as the rate of aging."
Harman, Ann. N.Y. Acad. Sci. 854:1-7 (1998).
Preferably, the agents of the present invention inhibit
1~ aging for at least a subpopulation of mature (post-puberty)
adult subjects.
The term "healthy aging" (sometimes called "successful
aging") refers to post-maturation changes in the body that
occur with increasing age even in the absence of an overt
disease. However, increased age is a risk factor for many
diseases ("age-related diseases"), and hence "total aging"
includes both the basal effects of healthy aging and the
effects of any age-related disease. (Most literature uses
the term "normal aging" as a synonym for "healthy aging",
but a minority use it to refer to "total aging°'. To
minimize confusion, we will try to avoid the term "normal
aging", but if we use it, it is as a synonym for "healthy
aging".) Some scientists have suggested that normal aging
changes should be defined as those which are universal,
degenerative, progressive and intrinsic.
Preferably, the agents of the present invention inhibit
healthy aging for at least a subpopulation of mature (post-
puberty) adult subjects.
In both aging and senescence, many physiologic
functions decline, but normal decline is not usually
considered the same as disease. The distinction between
normal decline and disease is often but not always clear and
may be due only to statistical distribution. Glucose
intolerance is considered consistent with healthy aging, but
diabetes is considered a disease, although a very common
one. Cognitive decline is nearly universal with advanced age
and is considered healthy aging; however, cognitive decline
consistent with dementia, although common in late life, is
considered a disease (as in the case of Alzheimer's, a
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
conclusion supported by analysis of brain tissue at
autopsy). A decline in maximal heart rate is typical of
healthy aging. In contrast, coronary heart disease is an
age-related disease. A decline in bone density is
5 considered healthy aging, but when it drops to 2.5 SD below
the young adult mean, it is called osteoporosis. Generally
speaking, the changes typical of healthy aging are gradual,
while those typical of a~disorder can be rapid.
10 The term average (median) "lifespan" is the
chronological age to which 500 of a given population
survive. The maximum lifespan potential is the maximum age
achievable by a member of the population. As a practical
matter, it is estimated as the age reached by the longest
15 lived member (or former member) of the population. The
(average) life expectancy is the number of remaining years
that an individual of a. given age can expect to live, based
on the average remaining lifespans of a group of matched
individuals. '
20 The most widely accepted method of measuring the rate
of aging is by reference to the average or the maximum
lifespan. If a drug treatment achieves a statistically
significant improvement in average or maximum lifespan in
the treatment group over the control group, then it is
inferred that the rate of aging was retarded in the
treatment group. Similarly, one can compare long-term
survival between the two groups.
Preferably, the agents of the present invention have
the effect of increasing the average lifespan and/or the
maximum lifespan for at least a subpopulation of mature
(post-puberty) adult subjects. This subpopulation may be
defined by sex and/or age. If defined in part by age,~then
it may be defined by a minimum age (e.g., at least 30, at
least 40, at least 50, at least 55, at least 60, at least
65, at least 70, at least 75, at least 80, at least 90,
etc.) or by a maximum age (not more than 40, not more than
50, not more than 55, not more than 60, not more than 65,
not more than 70, not more than 75, not more than 80, not
more than 90, not more than 100, etc.), or by a rational
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
21
combination of a minimum age and a maximum age so as to
define a preferred close-ended age range, e.g., 55-75.
The subpopulation may additionally be defined by race,
e.g., Caucasian, negroid or oriental, and/or by ethnic
group, and/or by place of residence (e. g., North America,
Europe).
The subpopulation may additionally be defined by non-
age risk factors for age-associated diseases, e.g., by blood
pressure, body mass index, etc.
Preferably, the subpopulation in which an agent of the
present invention is reasonably expected to be effective is
large, e.g., in the ITnited States, preferably at least
100,000 individuals, more preferably at least 1,000,000
individuals, still more preferably at least 10,000,000, even
more preferably at least 20,000,000, most preferably at
least 40,000,000.
Ey way of comparison, according to the 2000 U.S.
Census, the U.S. population, by age, was
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
Age Pop (mil)
15-19 20.2
20-24 19.0
25-29 19.4
30-34 20.5
35-39 22.7
40-44 22.4
45-49 20.1
50-54 17.6
55-59 13.5
60-64 10.8
65-69 9.5
70-74 8.9
75-79 7.4
80-84 4.9
85+ 4.2
22
For any given chronological age, statisticians can
define the probability of living to a particular later age.
These expectancies can be calculated for the entire age
cohort, or broken down by sex, race, country of residence,
etc. Individuals who live longer than expected can be
said, after the fact, to have biologically aged more slowly
than their peers. One definition of biological age is that
it is a measure of one's position in one's life span, i.e.,
biological age = position in own life span (as fraction in
range 0..1) X average life span for species. This simple
definition carries with it the implicit assumption that the
rate of biological aging is constant. It also has the
practical problem of determining one's own life span before
death. We will present a more practical definition shortly.
The problem with lifespan studies is that they are
extremely time-consuming. A maximum lifespan study in mice
can take 4-5 years. A maximum lifespan study in dogs or
cats would take 15-20 years, in monkeys, 30-40 years, and in
humans, over 100 years. Even if the human study group were
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
23
of sexagenarians, it would take 40-60 years to complete the
study.
Hence, scientists have sought to identify biological
markers (biomarkers) of biological aging, that is,
characteristics that can be measured while the subjects are
still alive, which correlate to lifespan. These biological
markers can be used to calculate a "biological age" (syn.
"Physiological~age"); it is the chronological age at which
an average member of the population (or relevant
subpopulation) would have the same value of a biomarker of
biological aging (or the same value of a composite measure
of biomarkers of biological aging) as does the subject. This
is the definition that will be used in this disclosure,
unless otherwise stated.
The effect of aging varies from system to system, organ
to organ, etc. For example, between ages 30 and 70 years,
nerve conduction velocity decreases by only about 100, but
renal function decreases on average by nearly 40%. Thus,
there isn't just one biological age for a subject. By a
suitable choice of biomarker, one may obtain a whole
organism, or a system-, organ- or tissue-specific measure
of biological aging, e.g., one can say that a person has the
nervous system of a 30 year old but the renal system of a 60
year old. Biomarkers may measure changes at the molecular,
cellular, tissue, organ, system or whole organism levels.
Generally speaking, in the absence of some form of
intervention (drugs, diet, exercise, etc.), biological ages
will increase with time. The agents of the present
invention preferably reduce the time rate of change of a
biological age of the subject. The term "a biological age"
could refer to the overall biological age of the subject,
to the biological age of a particular system, organ or
tissue of that subject, or to some combination of the
foregoing. More preferably, the agents of the present
cannot only reduce the rate of increase of a biological age
of the subject, but can actually reduce a biological age of
the subj ect .
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
24
A simple biologic marker (biomarker) is a single
biochemical, cellular, structural or functional indicator of
an event in a biologic system or sample. A composite
biomarker is a mathematical combination of two or more
simple biomarkers. (Chronological age may be one of the
components of a composite biomarker.)
A plausible biomarker of biological age would be a
biomarker which shows a cross-sectional and/or longitudinal
correlation with chronological age. Nakamura suggests that
it is desirable that a biomarker show (a)~significant cross-
sectional correlation with chronological age, (b)
significant longitudinal change in the same direction as the
cross-sectional correlation, (c) significant stability of
individual differences, and (d) rate of age-related change
proportional to differences in life span among related
species. Cp. Nakamura, Exp Gerontol. 29(2):151-77 (1994),
using desiderata (a)-(c). A superior biomarker of
biological age would be a better predictor of lifespan than
is chronological age (preferably for a chronological age at
which 90% of the population is still alive).
The biomarl~er preferably also satisfies one or more of
the following desiderata: a statistically significant age-
related change ~is apparent in humans after a period of at
most a few years; not affected dramatically by physical
conditioning (e. g., exercise), diet, and drug therapy
(unless it is possible to discount these confounding
influences, e.g., by reference to a second marker which
measures them); can be tested repeatedly without harming
the subject; works in lab animals as well as humans; simple
and inexpensive to use; does not alter the result of
subsequent tests for other biomarkers if it is to be used in
conjunction with them; monitors a basic process that
underlies the aging process, not the effects of disease.
Preferably, if the biomarker works in lab animals,
there is a statistically significant difference in the value
of the biomarker between groups of food-restricted and
normally-fed animals. It has been shown in some mammalian
species that dietary restriction without malnutrition (e. g.,
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
25 '
caloric decrease of up to 40o from ad libitum feeding)
increases lifespan.
A biomarker of aging may be used to predict, instead of
lifespan, the "Healthy Active Life Expectancy" (HALE) or the
"Quality Adjusted Life Years" (QALY), or a similar measure
which takes into account the quality of life before death as
well as the time of death itself. For HALE, see Jagger, in
Outcomes Assessment .for Healthcare in Elderly PeoZale, 67-76
(Farrand Press: 1997). For,QALY, see Rosser RM. A health
index and output measure, in Stewart SR and Rosser RM (eds)
Quality of Life: Assessment and Application. Lancaster: MTP,
1988.
A biomarker of aging may be used to predict, instead of
lifespan, the timing and/or severity of a change in one or
more age-related phenotypes as described below.
A biomarker of aging may be used to estimate, rather
than overall biological age for a subject, a biological age
for a specific body system or organ. The determination of
the biological age of the liver, alld the inhibition of
biological aging of the liver, are of particular interest.
Eody systems include the nervous system (including the
brain, the sensory organs, and the sense receptors of the
skin), the cardiovascular system (includes the heart, the
red blood cells and the reticuloendothelial system), the
respiratory system, the gastrointestinal system, the
endocrine system (pituitary, thyroid, parathyroid and
adrenal glands, gonads, pancreas, and parganglia), the
musculoskeletal system, the urinary system (kidneys,
bladder, ureters, urethra), the reproductive system and the
immune system (bone marrow, thymus, lymph nodes, spleen,
lymphoid tissue, white blood cells, and immunoglobulins). A
biomarker may be useful in estimating the biological age of
a system because the biomarker is a chemical produced by
that system, because it is a chemical whose activity is
primarily exerted within that system, because it is
indicative of the morphological character or functional
activity of that system, etc. A given biomarker may be thus
associated with more than one system. In a like manner, a
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
26
biotriarker may be associated with the biological age, and
hence the state, of a particular organ or tissue.
The prediction of lifespan, or of duration of system or
organ function at or above a particular desired level, may
require knowledge of the value of at least one biomarker of
aging at two or more times, adequately spaced, rather than
of the value at a single time. See McClearn, Biomarkers of
Age and Aging, Exp. Gerontol., 32:87-94 (1997).
The levels (or changes in levels) of the human proteins
identified in this specification, and their corresponding
mRNAs, may be used as simple biomarkers (direct or inverse)
of biological aging. They may be used in conjunction with
each other, or other simple biomarkers, in a composite
biomarker.
Once several plausible simple biomarkers have been
identified, a composite biomarker may be obtained by
standard mathematical techniques, such as multiple
regression, principal component analysis, cluster analysis,
neural net analysis, and so forth. As a preliminary to such
analysis, the values may be standardized, e.g., by
converting the raw scores into ~-scores based on the
distributions for each simple biomarl~er.
For example, principal component analysis can be used
to analyze the variation of lifespan with different
observables, and the factor score coefficients from the
first principal component can be used to derive an equation
for estimating a biological age score. Nakamura, Exp
Gerontol. 29(2):151-77 (1994). This approach was used to
obtain the following BAS (for healthy Japanese women aged
28-80): BAS=-4.37 -0.998FEVl.o +0.022SBP +0.133MCH +0.018GLU
-1.505 A/G RATIO, where FEVl.o is the forced expiratory
volume in 1 sec. (Liters), SBP is the systolic blood
pressure (mm Hg), MCH is the mean corpuscular hemoglobin
(pg), GLU is glucose (mg/dl), and A/G RATIO is the ratio of
albumin to globulin. The relative importance of these five
biomarkers was 33.70, 25.10, 17.1%, 14.80 and 8.9%,
respectively. Ueno, et al., "Biomarkers of Aging in Women
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
27
and the Rate of Longitudinal Changes," J. Physiol.
Anthropol. 22 (1) : 37-46 (Jan. 2003) .
It should be noted that particularly when evaluating
the overall biological age of the subject, it is not
necessarily most desirable to weight all systems or all
organs equally. One may find it more desirable to give
greater weight to the system or organ with the highest
biological age in calculating the overall biological age,
because it is presumably more likely to deteriorate or fail,
resulting in death. Appropriate statistical analysis can be
used to find the weighting scheme resulting in the best
prediction of lifespan.
In the H-SCAN (Hock Company) test, a composite of 12
simple biomarkers is used to measure human aging:
SENSORY
1. Highest audible pitch (kHz)
2. Visual accommodation (diopters)
3. Vibrotactile sensitivity (dB)
MOTOR
4. Muscle Movement time (sec)
5. Muscle Movement time with decision (sec)
6. Alternate button tapping time (sec)
COGNITIVE
7. Memory, length of sequence
8. Auditory reaction time (sec)
9. Visual reaction time (sec)
10. Visual Reaction time with decision (sec)
PULMONARY
11. Forced vital capacity (liters)
12. Forced expiratory Volume- 1 sec (liters)
See Hochschild, R., Journal of Gerontology [Biological
Science] 45 (6) :B187-214; 1990) .
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
28
According to a website discussing the H-SCAN test,
"Biomarkers of aging are characteristics of an organism that
correlate in large groups with chronological age and
mortality. Of particular value in human applications are
biomarkers of aging that also correlate with the quality of
life in later life in the sense that they involve functions
that are crucial to carrying out the activities of daily
living.... A single biomarker of aging is limited by the
fact that it measures only one isolated characteristic and
is hardly representative of the diversity of functional and
structural concomitants of aging.... Biological age, in
contrast to chronological age, is an individual's
hypothetical age calculated from scores obtained on a
battery of tests of biomarkers of aging. As a first step in
the calculation, the age of which. each biomarker score is
typical is determined by comparison with scores obtained by
a large representative group of persons (or organisms)
spanning a range of ages. Then one of a variety of averaging
techniques is employed (optionally with standardisation
steps) to obtain a single index of age, as described in
detail by Hochschild. This index varies with, and therefore
must be expressed with reference to, the measured biomarkers
and the mathematical method of combining scores.'°
htt~://www.lonaevityinstituteone.com/
Abbo, LTSP 6,547,729 teaches determining the biological
age (he calls it "performance age'°) of a subject by (1) for
a sample population, determining a regression curve relating
some set of observed values for an "indicator" of the
functionality of a bodily system to the chronological age of
the observed individuals, (2) solving the regression
equation to obtain a predicted performance age, given the
value of the indicator for the subject. The regression can
be based on more than one indicator, i.e., it can be a
multiple regression. The sample population can be defined
by sex, age range, ethnic composition, and geographic
location. The bodily system may be a molecular, cellular,
tissue or organ system. The following indicators are
suggested by Abbo: nervous system (memory tests, reaction
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
29
time, serial key tapping, digit recall test, letter fluency,
category fluency, nerve conduction velocity), arteries
(pulse wave velocity; ankle-brachial index), skeletal system
(bone mineral density); lungs (forced vital capacity), heart
(ejection fraction; length of time completed on a treadmill
stress test), kidneys (creatinine clearance), proteins
(glycosylation of hemoglobin), endocrine glands (load level
of bioactive testosterone; level of dehydroepiandrosterone
sulfate, ratio of urinary 17-ketosteroids/17-
hydroxycorticosteroids; growth hormone; IGF-1).
Preferably, the agents of the invention have a favorable
effect on the value of at least one simple biomarker of
biological aging, such as any of the plausible biomarkers
mentioned anywhere in this specification, other than the
level of one of the proteins of the present invention. More
preferably, they have a favorable effect on the value of at..
least two such. simple biomarkers of biological aging. Even
more preferably, at least one such pair is of markers which
are substantially non-correlated (R~ < 0.5) .
Desirably, if more than one simple biomarl~er is favorably
affected, the biomarkers in question reflect different
levels of organization, and/or different body components at
the same level of organization. For example, a visual
reaction time with decision test is on the whole organism
level, while a measurement of telomere length is on the
cellular level.
A biomarker may, but need not, be an indicator related to
one of the postulated causes or contributing factors of
aging. It may, but need not, be an indicator of the acute
health of a particular body system or organ.
A biomarker may measure behavior, cognitive or sensory
function, or motor activity, or some combination thereof.
It may measure the level of a type of cell (e. g., a T cell
subset, such as CD4, CD4 memory, CD4 naive, and CD4 cells
expressing P-glycoprotein) or of a particular molecule
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
(e. g., growth hormone, IGF-1, insulin, DHEAS, an elongation
factor, melatonin) or family of structurally or functionally
related molecules in a particular body fluid (especially
blood) or tissue. For example, lower serum IGF-1 levels are
5 correlated with increasing age, and IGF-1 is produced by
many different tissues. On the other hand, growth hormone
is produced by the pituitary gland.
A biomarker,may measure an indicator of stress
(particularly oxidative stress) and resistance thereto. It
10 has been theorized that free radicals damage biomolecules,
leading to aging.
A biomarker may measure protein glycation or other
protein modification (e.g., collagen crosslinking). It has
been theorized that such modifications contribute to aging.
15 The biomarker may measure changes in the lengths of
telomeres or in the rate of cell. division. It has been
theorized that telomere shortening beyond a critical length
leads the cell to stop proliferating. Average telomere
length therefore provides a biomarl~er as to how may
20 divisions the cell as previously undergone and how many
divisions the cell can undergo in the future.
Suggested biomarkers have also included resting heart
rate, resting blood pressure, exercise heart rate, percent
body fat, flexibility, grip strength, push strength,
25 abdominal strength, body temperature, and skin temperature.
The present invention does not require that all of the
biomarkers identified above be validated as indicative of
biological age, or that they be equally useful as measures
of biological age.
There is an overlap between biomarkers of aging and
indicators of functional status. An indicator of functional
status is an indicator that defines a functional ability
(e.g., physiological, cognitive or physical function). An
indicator of functional status may also be related to the
increase in morbidity and mortality with chronological age.
Such indicators preferably predict physiological, cognitive
and physical function in an age-coherent way, and do so
better than chronological age. Preferably, they can predict
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
31
the years of remaining functionality, and the trajectory
toward organ-specific illness in the individual. Also, they
are preferably minimally invasive.
Suggested indicators include anthropometric data (body
mass index, body composition, bone density, etc.),
functional challenge tests (glucose tolerance, forced vital
capacity), physiological tests (cholesterol/HDL,
glycosylated hemoglobin, homocysteine, etc.) and proteomic
tests.
A number of mouse models for human aging exist. See
Troen, supra, Table 3. The drugs identified by the present
invention may be further screened in one or more of these
models.
Age-Related Phen~t~spe
An age-related phenotype is an observable change which
occurs with age. An age-related phenotype may, but need
not, also be a biomarker of biological aging.
Preferably, the agent of the present invention
favorably affects at least one age-related phenotype. More
preferably, it favorably affects at least two age-related
phenotypes, more preferably phenotypes of at least two
different body systems.
The age-related phenotype may be a system level phenotype,
such as a measure of the condition of the nervous system,
respiratory system, immune system, circulatory system,
endocrine system, reproductive system, gastrointestinal
system, or musculoskeletal system.
The age-related phenotype may be an organ level phenotype,
such as a measure of the condition of the brain, eyes, ears,
lungs, spleen, heart, pancreas, liver, ovaries, testicles,
thyroid, prostate, stomach, intestines, or kidney.
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
32
The age-related phenotype may be a tissue level phenotype,
such as a measure of the condition of the muscle, skin,
connective tissue, nerves, or bones.
The age-related phenotype may be a cellular level phenotype,
such as a measure of the condition of the cell wall,
mitochondria or chromosomes.
The age-related phenotype may be a molecular level
phenotype, such as a measure of the condition of nucleic
acids, lipids, proteins, oxidants, and anti-oxidants.
The age-related phenotype may be manifested in a biological
fluid, such as blood, urine, saliva, lymphatic fluid or
cerebrospinal fluid. The biochemical composition of these
fluid may be an overall, system level, organ level, tissue
level, etc. phenotype, depending on the specific biochemical
and fluid involved.
PHYSIOLOGICAL AGING OF THE HUMAN BODY BY S'YSTEI~IS
SKIN, HAIR, Loss of subcutaneous fat, Thinning of skin,
NAILS Decreased collagen, Nails brittle and flake,
lvlucous membranes drier, Less sweat glands,
Temperature regulation difficult, Hair
pigment decreases, Hair thins. Eyelids baggy
and wrinkled.
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
33
EYES AND Eyes deeper in sockets; Conjunctiva thinner
VISION and yellow; Quantity of tears decreases; Iris
fades; Pupils smaller, let in less light;
Night and depth. vision less; "Floaters" can
appear
Lens enlarges; Lens becomes less transparent,
can actually become clouded, results in
cataracts; Accommodation decreases, results
in presbyopia; Impaired color vision, also
-
especially greens and blues-- because cones
degenerate; Predisposed to glaucoma
(Increased pressure in eye, decreased
absorption of intraocular fluid; can result
in blindness);
Macular degeneration becoming more frequent
(This is the patch of retina where lens
focuses light, Ultimately results in
blindness
EARS AND Irreversible, sensorineural loss
HEARING LOSS (presbycusis) with age (Men more affected
than women, Loss occurs in higher range of
sound, By 60 years, most adults have trouble
hearing above 4000Hz, Normal speech
500-2000Hz)
RESPIRATORY Lungs become more rigid, Pulmonary function
SYSTEM decreases, Number and size of alveoli
decreases, Vital capacity declines, Reduction
in respiratory fluid, Bony changes in chest
cavity
CARDIOVASCUL Heart smaller and less elastic with age, By
AR SYSTEM age 70 cardiac output reduced 70%, Heart
valves become sclerotic, Heart muscle more
irritable, More arrhythmias, Arteries more
rigid, Veins dilate
GASTROINTEST Reduced GI secretions, Reduced GI motility,
INAL SYSTEM Decreased weight of liver,
Reduced regenerative capacity of liver, Liver
metabolizes less efficiently
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
34
RENAL SYSTEM After 40 renal function decreases, By 90 lose
500 of function, Filtration and reabsorption
reduced, Site and number of nephrons
decrease,
Bladder muscles weaken, Less able to clear
drugs from system, Smaller kidneys and
bladder
REPRODUCTIVE Reduced testosterone level, Testes atrophy
SYSTEM and soften, Decrease in sperm production,
(MALE) Seminal fluid decreases and more viscous,
Erections take more time, Refractory period
after ejaculation may lengthen to days
REPRODUCTIVE Declining estrogen and progesterone levels,
SYSTEM Ovulation ceases, Introitus constricts and
(FEMALE) loses elasticity, Vagina atrophies - shorter
and drier,
Uterus shrinks, Breasts pendulous and lose
elasticity
NEUROLOGICAL Neurons of central and peripheral nervous
SYSTEM system degenerate, Nerve transmission~slows,
Hypothalamus less effective in regulating
body temperature, Reduced REM sleep,
decreased deep sleep, After age 50, lose 10
of neurons each year
MUSCULOSCELE Adipose tissue increases with age, Lean body
TAL SYSTEM mass decreases, Bone mineral content
diminished, Decrease in height from narrow
vertebral spaces, Less resilient connective
tissue, Synovial fluid more viscous,
May have exaggerated curvature of spine
IMMUNE Decline in immune function, Trouble
SYSTEM differentiating between self and non-self -
more auto-immune problems, Decreases antibody
response,
Fatty marrow replaced red marrow, Vitamin B12
absorption might decrease - decreased
hemoglobin and hematocrit
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
ENDOCRINE Decreased ability to tolerate stress - best
SYSTEM seen in glucose metabolism,
Estrogen levels decrease in women, Other
hormonal decreases include testosterone,
aldosterone, cortisol, progesterone
Adapted from http://www.tea~ashste.com/html/~papl~pt
5
The aging human liver appears to preserve its
morphology and function relatively well. The liver appears
to progressively decrease in both mass and volume. It also
appears browner (a condition called "brown atrophy'°), as a
10 result of accumulation of lipofuscin (ceroid) within
hepatocytes. Increases occur in the number of
macrohepatocytes, and in polyploidy, especially around the
terminal hepatic veins. The number of mitochondria declines,
and both the rough and smooth endoplasmic recticulum
15 diminish. The number of lysozymes increase.
The liver is the premiere metabolic organ of the body.
With regard to metabolism, hepatic glycerides and
cholesterol levels increase with age, at least up to age ~0.
On the other hand, phospholipids, aminotransferases, and
20 serum bilirubin appear t~ remain normal. There are
contradictory reports as to the effect of aging on albumin,
serum gamma-glutamyltransferase, and hepatic alkaline
phosphatase. It is worth noting that it has been shown that
the content of cytochrome oxidase exhibits a progressive
25 decline which correlates with age-associated decline in
mtRNA synthesis in brain, liver, heart, lungs and skeletal
muscle.
See generally Anaantharaju, Feller and Chedid, "Aging
Liver: A Review," Gerontology, 48: 343-53 (2002).
Quality of Life
Clinicians are interested, not only in simple prolongation
of lifespan, but also in maintenance of a high quality of
life (QOL) over as much as possible of that lifespan. QOL
can be defined subjectively in terms of the subject's
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
36
satisfaction with life, or objectively in terms of the
subject's physical and mental ability (but not necessarily
willingness) to engage in "valued activities", such as those
which are pleasurable or financially rewarding.
Flanagan has defined five domains of QOL, capturing 15
dimensions of life quality. The five domains, and their
component dimensions, are physical and material well being
(Material well-being and financial security; Health and
personal safety), Relations with other people (relations
with spouse; Having and rearing children; Relations with
parents, siblings, or other
relatives ; Relations with friends) Social, community,
civic activities (Helping and encouraging others;
Participating in local and governmental affairs ), Personal
development, fulfillment (Intellectual development;
Understanding and planning; Occupational role career;
Creativity and personal expression), and recreation
(Socialising with others; Passive and observational
recreational activities; Participating in active
recreation). See Flanagan JC,. "A research approach to
improving our quality of life." Am Psychol 33:138-147
(1978) .
"Health-related quality of life" (HRQL or HRQOL) is an
individual's satisfaction or happiness with domains of life
insofar as they affect or are affected by "health".
In a preferred embodiment, a pharmaceutical agent of the
present invention is able to achieve a statistically
significant improvement in the expected quality of life,
measured according to a commonly accepted measure of QOL, in
a treatment group over a control group.
While there is general acceptance of the notion that QOL is
important, quantifying QOL is not especially
straightforward. Also, QOL can only be measured in humans.
Measurements of QOL can be objective (e. g., employment
status, marital status, home ownership) or subjective (the
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
37
subject's opinion of his or her life), or some combination
of the two.
A simple approach to measuring subjective QOL is to simply
have the subjects rate their overall quality of life on a
scale, e.g., of 7 points. One can also use more elaborate
measure, such as the Older Adult Health and Mood
Questionaire (a 22 item test for assessing depression).
Objective QOL can be measured by, e.g., an activities
checklist.
There is a relationship between QOL assessment and so-called
ADL or IADL measures, which assess the need for assistance.
The Katz Index. of Independence in Activities of Daily Living
(Katz ADL) measures adequacy of independent performance of
bathing, dressing, toileting, transferring, continence, and
feeding. See Katz, S., "Assessing Self-Maintenance:
Activities of Daily Living, Mobility and Instrumental
Activities of Daily Living, Journal of the American
Geriatrics Society, 31(12); 721-726 (1983); Katz S., Down,
T.D., Cash, H.F2. et al. Progress in the Development of the
Index of ADL. Gerontologist,10:20-30 (1970).
Performance of a more sophisticated nature is measured by
the "Instrumental Activities of Daily Living" (IADL) scale.
This inquires into ability to independently use the
telephone, shop, prepare food, carry out housekeeping, do
laundry, travel locally, take medication and handle
finances. See Lawton, MP and Brody, EM, Gerontologist,
9:179-86 (1969) .
The 36 question Medical Outcomes Study Short Form
(SF-36)(Medical Outcomes Trust, Inc., 20 Park Plaza, Suite
1014, Boston, Massachusetts 02116) assesses eight health
concepts: 1) limitations in physical activities because of
health problems; 2) limitations in social activities because
of physical or emotional problems; 3) limitations in usual
role activities because of physical health problems; 4)
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
38
bodily pain; 5) general mental health (psychological
distress and well-being); 6) limitations in usual role
activities because of emotional problems; 7) vitality
(energy and fatigue); and 8) general health perceptions.
A low score on an ADL, IADL or SF-36 test is likely to be
associated with a low QOL, but a high score does not
guarantee a high Q~L because these tests do not explore
performance of "valued activities", only of more basic
activities. Nonetheless, these tests can be considered
commonly accepted measures of QQL for the purpose of this
invention.
Age-Related Diseases
Age-related (senescent) diseases include certain
cancers, atherosclerosis, diabetes (type 2), osteoporosis,
hypertension, depression, Alzheimer's, Parkinson's, glaucoma,
certain immune system defects, kidney failure, and liver
steatosis. In general, they are diseases for which the
relative risl~ (comparing a subpopulation over age 55 to a
suitably matched population under age 55) is at least 1.1.
Preferably, the agents of the present invention protect
against one or more age-related diseases for at least a
subpopulation of mature (post-puberty) adult subjects.
Diabetes
Type II diabetes is of particular interest. A
deficiency of insulin in the body results in diabetes
mellitus, which affects about 18 million individuals in the
United States. It is characterized by a high blood glucose
(sugar) level and glucose spilling into the urine due to a
deficiency of insulin. As more glucose concentrates in the
urine, more water is excreted, resulting in extreme thirst,
rapid weight loss, drowsiness, fatigue, and possibly
dehydration. Because the cells of the diabetic cannot use
glucose for fuel, the body uses stored protein and fat for
energy, which leads to a buildup of acid (acidosis) in the
blood. If this condition is prolonged, the person can fall
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
39
into a diabetic coma, characterized by deep labored
breathing and fruity-odored breath.
There are two types of diabetes mellitus, Type I and
Type II. Type II diabetes is the predominant form found in
the Western world; fewer than 80 of diabetic Americans have
the type I disease.
Type I diabetes. In Type I diabetes, formerly called
juvenile-onset or insulin-dependent diabetes mellitus, the
pancreas cannot produce insulin. People with Type I diabetes
must have daily insulin injections. But they need to avoid
taking too much insulin because that can lead to insulin
shock, which begins with a mild hunger. This is quickly
followed by sweating, shallow breathing, dizziness,
palpitations, trembling, and mental confusion. As the blood
sugar falls, the body tries to compensate by breaking down
fat and protein to make more sugar. Eventually, low blood
sugar leads to a decrease in the sugar supply to the brain,
resulting in a loss of consciousness. Eating a sugary food
can prevent insulin shock until appropriate medical measures
can be taken.
Type I diabetics are often characterized by their low
or absent levels of circulating endogenous insulin, i.e.,
hypoinsulinemia (1). Islet cell antibodies causing damage
to the pancreas are frequently present at diagnosis.
Injection of exogenous insulin is required to prevent
ketosis and sustain life.
Type II diabetes. Type II diabetes, formerly called
adult-onset or non-insulin-dependent diabetes mellitus
(NIDDM), can occur at any age. The pancreas can produce
insulin, but the cells do not respond to it.
Type II diabetes is a metabolic disorder that affects
approximately 17 million Americans. It is estimated that
another 10 million individuals are "prone" to becoming
diabetic. These vulnerable individuals can become resistant
to insulin, a pancreatic hormone that signals glucose (blood
sugar) uptake by fat and muscle. In order to maintain normal
glucose levels, the islet cells of the pancreas produce
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
more insulin, resulting in a condition called
hyperinsulinemia. When the pancreas can no longer produce
enough insulin to compensate for the insulin resistance, and
thereby maintain normal glucose levels, hyperglycemia
5 (elevated blood glucose) results, and type II diabetes is.
diagnosed.
Early Type II diabetics are often characterized by
hyperinsulinemia and resistance to insulin. Late Type II
diabetics may be normoinsulinemic or hypoinsulinemic. Type
10 II diabetics are usually not insulin dependent or prone to
ketosis under normal circumstances.
Little is known about the disease progression from the
normoinsulinemic state to the hyperinsulinemic state, and
from the hyperinsulinemic state to the Type II diabetic
15 state.
As stated above, type II diabetes is a metabolic
disorder that is characterized by insulin resistance and
impaired glucose-stimulated insulin secretion (2,3,4).
However, Type II diabetes and atherosclerotic disease are
20 viewed as consequences of having the insulin resistance
syndrome (IRS) for many years (5). The current theory of
the pathogenesis of Type II diabetes is often referred to as
the "insulin resistance/islet cell exhaustion" theory.
According to this theory, a condition causing insulin
25 resistance compels the pancreatic islet cells to
hypersecrete insulin in order to maintain glucose
homeostasis. However, after many years of hypersecretion,
the islet cells eventually fail and the symptoms of clinical
diabetes are manifested. Therefore, this theory implies
30 that, at some point, peripheral hyperinsulinemia will be an
antecedent of Type II diabetes. Peripheral hyperinsulinemia
can be viewed as the difference between what is produced by
the beta cell minus that which is taken up by the liver.
Therefore, peripheral hyperinsulinemia can be caused by
35 increased beta cell production, decreased hepatic uptake or
some combination of both. It is also important to note that
it is not possible to determine the origin of insulin
resistance once it is established since the onset of
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
41
peripheral hyperinsulinemia leads to a condition of global
insulin resistance.
Multiple environmental and genetic factors are involved
in the development of insulin resistance, hyperinsulinemia
and type II diabetes. An important risk factor for the
development of insulin resistance, hyperinsulinemia and type
II diabetes is obesity, particularly visceral obesity
(6,7,8). Type II diabetes exists world-wide, but in
developed societies, the prevalence has risen as the average
age of the population increases and the average individual
becomes more obese.
Diseases Characterised by Accelerated Aging
Several human diseases display some features of
accelerated aging. These include Werner's syndrome (class.ic
early-onset progeria), Hutchinson-Gilford syndrome (adult
progeria), and Down's syndrome (trisomy 21). Troen, Biology
of Aging, Mt. Sinai J. Med., 70(1): 3 (Jan. 2003). Thus,
the present invention may be useful in the treatment
(curative or ameliorative) of individuals with. these
diseases.
Genes/Proteins of Interest
Favorable genes/proteins are those corresponding to
genes less strongly expressed in longer lifespan (knockout
mice) liver than in shorter lifespan (control mice) liver.
Unfavorable genes/proteins are those corresponding to genes
more strongly expressed in control mice liver than in
knockout mice liver.
Mixed genes/proteins are those exhibiting a combination
of favorable and unfavorable behavior. A mixed gene/protein
can be used as would a favorable gene/protein if its
favorable behavior outweighs the unfavorable. It can be
used as would an unfavorable gene/protein if its unfavorable
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
42
behavior outweighs the favorable. Preferably, they are used
in conjunction with other agents that affect their balance
of favorable and unfavorable behavior. Use of mixed
genes/proteins is, in general, less desirable than use of
purely favorable or purely unfavorable genes/proteins.
For each of the differentially expressed cDNAs,
corresponding mouse and human proteins have been identified,
as set forth in Master Table 1. More than one human protein
may be identified as corresponding to a particular mouse
clone.
Direct and Indirect Utility of Identified Nucleic Acid
Sequences and Related M~lecules
The cDNAs of the disclosed clones may be used directly.
For diagnostic or screening purposes, they (or specific
binding fragments thereof) may be labeled and used as
hybridization probes. For therapeutic purposes, they (or
specific binding fragments thereof) may be used as antisense
reagents to inhibit the expression of the corresponding
gene, or of a sufficiently homologous gene of another
species.
If the cDNA appears to be a full-length cDNA, that is,
that it encodes an entire, functional protein, then it may
be used in the expression of that protein. Such expression
may be in cell culture, with the protein subsequently
isolated and administered exogenously to subjects who would
benefit therefrom, or in vivo, i.e., administration by gene
therapy. Naturally, any DNA encoding the same protein, or a
fragment or a mutant protein which retains the desired.
activity, may be used for the same purpose. The encoded
protein of course has utility therapeutically and, in
labeled or immobilized form, diagnostically.
The cDNAs of the disclosed clones may also be used
indirectly, that is, to identify other useful DNAs,
proteins, or other molecules. We have attempted to
determine whether the cDNAs disclosed herein have
significant similarity to any known DNA, and whether, in any
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
43
of the six possible combinations of reference frame and
strand, they encode a protein similar to a known protein.
If so, then it follows that the known protein, and DNAs
encoding that protein, may be used in a similar manner. In
addition, if the known protein is known to have additional
homologues, then those homologous proteins, and DNAs
encoding them; may be used in a similar manner.
There thus are several ways that a human protein
homologue of interest can be identified by database
searching, including but not limited to:
1) a DNA->DNA (BlastN) search for database DNAs closely
related to the mouse cDNA clone identifies a particular
mouse (or other nonhuman, e.g., rat) gene, and that nonhuman
gene encodes a protein for which there is a known human
protein homologue;
2) a DNA->Protein (BlastX) search. for database proteins
closely related to the translated DNA of the mouse cDNA
clone identifies a particular mouse (or other nonhuman)
protein, and that nonhuman protein has a l~nown human protein
homologue;
3) a DNA->DNA (BlastN) search of the database for human DNAs
closely related to the mouse cDNA clone identifies a
particular human DNA as a homologue of the mouse cDNA, and
the corresponding human protein is known (e.g., by
translation of the human DNA); and
4) a DNA->Protein (BlastX) search of the database for human
proteins closely related to the translated DNA of the mouse
cDNA clone identifies a particular human protein as a
homologue of the corresponding mouse protein.
Thus, if we have identified a mouse cDNA, and it
encodes a mouse protein which appears similar to a human
protein, then that human protein may be used (especially in
humans) for purposes analogous to the proposed use of the
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
44
mouse protein in mice. Moreover, a specific binding
fragment of an appropriate strand of the corresponding human
gene or cDNA could be labeled and used as a hybridization
probe (especially against samples of human mRNA or cDNA).
In determining whether the disclosed cDNAs have
significant similarities to known DNAs (and their translated
AA sequences to known proteins), one would generally use the
disclosed cDNA as a query sequence in a search of a sequence
database. The results of several such searches are set
forth .in the Examples. Such results are dependent, to some
degree, on the search parameters. Preferred parameters are
set forth. in Example 1. The results are also dependent on
the content of the database. While the raw similarity score
of a particular targetr (database) sequence will not vary
with content (as long as it remains in the database), its
informational value (in bits), expected value, and relative
ranking can change. Generally speaking, the changes are
small.
It is possible to use the sequence of the entire cDNA
insert to query the database. However, the error rate
increases as a sequencing run progresses. Hence, it may be
beneficial to search the database using a truncated
(presumably more accurate) sequence, especially if the
insert is quite long.
It will be appreciated that the nucleic acid and
protein databases keep growing. Hence a later search may
identify high scoring target sequences which were not
uncovered by an earlier search because the target sequences
were not previously~part of a database.
Hence, in a preferred embodiment, the cognate DNAs and
proteins include not only those set forth in the examples,
but those which would have been highly ranked (top ten, more
preferably top three, even more preferably top two, most
preferably the top one) in a search run with the same
parameters on the date of filing of this application.
If the cDNA appears to be a partial cDNA, it may be
used as a hybridization probe to isolate the full-length
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
cDNA. If the partial cDNA encodes a biologically functional
fragment of the cognate protein, it may be used in a manner
similar to the full length cDNA, i.e., to produce the
functional fragment.
5
If we have indicated that an antagonist of a protein or
other molecule is useful, then such an antagonist may be
obtained by preparing a combinatorial library, as described
below, of potential antagonists, and screening the library
10 members for binding to the protein or other molecule in
question. The binding members may then be further screened
for the ability to antagonize the biological activity of the
target. The antagonists may be used therapeutically, or, in
suitably labeled or immobilized form, diagnostically.
15 If the cDNA is related to a known protein, then
substances known to interact with that protein (e. g.,
agonists, antagonists, substrates, receptors, second
messengers, regulators, and so forth), and binding molecules
which. bind them, are also of utility. Such binding
20 molecules can likewise be identified by screening a
combinatorial library.
Isolation of Full Length cDNAs Using Partial cDNAs as probes
If it is determined that a cDNA of the present
25 invention is a partial cDNA, and the cognate full length
cDNA is not listed in a sequence database, the available
cDNA may be used as a hybridization probe to isolate the
full-length cDNA from a suitable cDNA library.
Stringent hybridization conditions are appropriate,
30 that is, conditions in which the hybridization temperature
is 5-10 deg. C. below the Tm of the cDNA as a perfect
duplex.
Identification and Isolation of Homologous Genes/cDNAs Using
35 a cDNA Probe
It may be that the sequence databases available do not
include the sequence of any homologous gene, or at least of
the homologous gene for a species of interest. However,
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
46
given the cDNAs set forth above, one may readily obtain the
homologous gene.
The possession of one cDNA (the "starting DNA")
greatly facilitates the isolation of homologous genes/cDNAs.
If the clone in question only features a partial cDNA, this
partial cDNA may first be used as a probe to isolate the
corresponding full length. cDNA for the same species, and
that the latter may be used as the starting DNA in the
search for homologous genes.
The starting DNA, or a fragment thereof, is used as a
hybridization probe to screen a cDNA or genomic DNA library
for clones containing inserts which encode either the entire
homologous protein, or a recognizable fragment thereof. The
minimum length of the hybridization probe is dictated by the
need for specificity. If the size of the library in bases
is L, and the GC content is 50%, then the probe should have
a length of at least l, where L = 41. This will yield,' on
average, a single perfect match in random DNA of L bases.
The human cDNA library is about 10$ bases and the human
genomic DNA library is about 101° bases.
The library is preferably derived from an organism
which is known, on biochemical evidence, to produce a
homologous protein, and more preferably from the genomic DNA
or mRNA of cells of that organism which are likely to be
relatively high producers of that protein. A cDNA library
(which is derived from an mRNA library) is especially
preferred.
If the organism in question is known to have
substantially different colon preferences from that of the
organism whose relevant cDNA or genomic DNA is known, a
synthetic hybridization probe may be used which encodes the
same amino acid sequence but whose colon utilization is more
similar to that of the DNA of the target organism.
Alternatively, the synthetic probe may employ inosine as a
substitute for those bases which are most likely to be
divergent, or the probe may be a mixed probe which mixes the
colons for the source DNA with the preferred colons
(encoding the same amino acid) for the target organism.
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
47
By routine methods, the Tm of a perfect duplex of
starting DNA is determined. One may then select a
hybridization temperature which is sufficiently lower than
the perfect duplex Tm to allow hybridization of the starting
DNA (or other probe) to a target DNA which is divergent from
the starting DNA. A 1o sequence divergence typically lowers
the Tm of a duplex by 1-2°C, and the DNAs encoding
homologous proteins of different species typically have
sequence identities of around 50-80%. Preferably, the
library is screened under conditions where the temperature
is at least 20°C., more preferably at least 50°C., below the
perfect duplex Tm. Since salt reduces the Tm, one
ordinarily would carry out the search for DNAs encoding
highly homologous proteins under relatively low salt
hybridization conditions, e.g., <1M NaCl. The higher the
salt concentration, and/or the lower the temperature, the
greater the sequence divergence which is tolerated.
For the use of probes to identify homologous genes in
other species, see, e.g., Schwinn, et al., J. Biol. Chem.,
265:8183-89 (1990) (hamster 67-by cDNA probe vs. human
leukocyte genomic library; human 0.321~b DNA probe vs. bovine
brain cDNA library, both with hybridization at 42°C in
6xSSC); Jenkins et al., J. Biol. Chem., 265:19624-31 (1990)
(Chicken 770-by cDNA probe vs. human genomic libraries;
hybridization at 40°C in 50% formamide and SxSSC); Murata et
al., J. Exp. Med., 175:3,41-51 (1992) (1.2-kb mouse cDNA
probe v. human eosinophil cDNA library; hybridization at
65°C in 6xSSC); Guyer et al., J. Biol. Chem., 265:17307-17
(1990) (2.95-kb human genomic DNA probe vs. porcine genomic
DNA library; hybridization at 42°C in 5xSSC). The
conditions set forth in these articles may each be
considered suitable for the purpose of isolating homologous
genes.
Homologous Proteins and DNAs
A human protein can be said to be identifiable as homologous
to a mouse cDNA clone if
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
48
(1) it can be aligned directly to the mouse cDNA clone by
BlastX. and/or
(2) it can be aligned to a human gene by BlastX, whose
genomic DNA (gDNA) or cDNA (DNA complementary to messenger
RNA) in turn can be aligned to the mouse cDNA clone by
BlastN, and/or
(3) it can be aligned to a mouse gene by BlastX, whose gDNA
or cDNA in turn can be aligned to the mouse cDNA clone by
BlastN, and/or
(4) it can be aligned to a mouse protein by BlastP, which in
turn can be aligned to the mouse cDNA clone by BlastX,
and/or
(5) it can be aligned to a mouse protein by BlastP, which in
turn can be aligned to a mouse gene by BlastX, whose gDNA or
cDNA can in turn be aligned to the mouse cDNA clone by
BlastN;
where any alignment by BlastN, BlastP, or BlastX is in
accordance with the default parameters set forth below, and
the expected value (E) of each alignment (the probability
that such. an alignment would have occurred by chance alone)
is less than e-10.
A human gene is homologous to a mouse cDNA clone if it
encodes a homologous human protein as defined above, or if
it can be aligned either directly to the mouse cDNA clone,
or indirectly through a mouse gene which can be aligned to
said clone, according to the conditions set forth above.
Preferably, two, three, four or all five of conditions (1)-
(5) are satisfied.
Preferably, for each of conditions (1)-(5), for at
least the final alignment (i.e., vs. the human protein), the
E value is less than e-15, more preferably less than e-20,
still more preferably less than e-40, further more
preferably less than e-50, even more preferably less than e-
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
49
60, considerably more preferably less than e-80, and most
preferably less than e-100. More preferably, for those
conditions in which the mouse cDNA clone is indirectly
connected to the human protein by virtue of two or more
successive alignments, the E value is so limited for all of
said alignments in the connecting chain.
BlastN and BlastX report very low expected values as
"0.0". This does not truly mean that the expected value is
r
exactly zero (since any alignment could occur by chance),
but merely that it is so infinitesimal that it is not
reported. The documentation does not state the cutoff
value, but alignments with explicit E values as low as e-178
(624 bits) have been reported as nonzero values, while a
score of 636 bits was reported as "0.0".
Functionally homologous human proteins are also of
interest. A human protein may be said to be functionally
homologous to the mouse cDNA clone if (1) there is a mouse
protein which is encoded by a mouse gene whose cDNA can be
aligned to the mouse cDNA clone, using BlastX with the
default parameters set forth below, and the E value of the
alignment is less than e-50, and (2) the human protein has
at least one biological activity in common with the mouse
protein.
The human proteins of interest also include those that
are substantially and/or conservatively identical (as
defined below) to the homologous and/or functionally
homologous human proteins defined above.
helevance of Favorable and TJnfavorable Genes
If a gene is down-regulated in more favored mammals, or
up-regulated in less favored mammals, (i.e., an "unfavorable
gene") then several utilities are apparent.
First, the complementary strand of the gene, or a portion
thereof, may be used in labeled form as a hybridization
probe to detect messenger RNA and thereby monitor the level
of expression of the gene in a subject. Elevated levels are
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
indicative of progression, or propensity to progression, to
a less favored state, and clinicians may take appropriate
preventative, curative or ameliorative action.
Secondly, the messenger RNA product (or equivalent
5 cDNA), the protein product, or a binding molecule specific
for that product (e.g., an antibody which binds the
product), or a downstream product which mediates the
activity (e. g., a signaling intermediate) or a binding
molecule (e. g., an antibody) therefor, may be used,
10 preferably in labeled or immobilized form, as an assay
reagent in an assay for said nucleic acid product, protein
product, or downstream product (e. g., a signaling
intermediate). Again, elevated levels are indicative of a
present or future problem.
15 Thirdly, an agent which down-regulates expression of
the gene may be used to reduce levels of the corresponding
protein and thereby inhibit further damage to the kidney.
This agent could inhibit transcription of the gene in the
subject, or translation of the corresponding messenger RNA.
20 Possible inhibitors of transcription and translation include
antiasnsa molecules and repressor molecules. The agent
could also inhibit a post-translational modification (e. g.,
glycosylation, phosphorylation, cleavage, GPI attachment)
required for activity, or post-translationally modify the
25 protein so as to inactivate it. Or it could be an agent
which down- or up-regulated a positive or negative
regulatory gene, respectively.
Fourthly, an agent which is an antagonist of the
messenger RNA product or protein product of the gene, or of
30 a downstream product through which its activity is
manifested (e.g., a signaling intermediate), may be used to
inhibit its activity. This antagonist could be an antibody.
Fifthly, an agent which. degrades, or abets the
degradation of, that messenger RNA, its protein product or a
35 downstream product which mediates its activity (e.g., a
signaling intermediate), may be used to curb the effective
period of activity of the protein.
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
51
If a gene is up-regulated in more favored mammals, or
down-regulated in less favored animals then the utilities
are converse to those stated above.
First, the complementary strand of the gene, or a
portion thereof, may be used in labeled form as a
hybridization probe to detect messenger RNA and thereby
monitor the level of expression of the gene in a subject.
Depressed levels are indicative of damage, or possibly of a
propensity to damage, and clinicians may take appropriate
preventative, curative or ameliorative action.
Secondly, the messenger RNA product, the equivalent
cDNA, protein product, or a binding molecule specific for
those products, or a downstream product, or a signaling
intermediate, or a binding molecule therefor, may be used,
preferably in labeled or immobilized form, as an assay
reagent in an assay f~r said protein product or downstream
product. Again, depressed levels are indicative of a
present or future problem.
Thirdly, an agent which up-regulates expression of the
gene may be used to increase levels of the corresponding
protein and thereby inhibit further progression to a less
favored state. By way of example, it could be a vector
which carries a copy of the gene, but which expresses the
gene at higher levels than does the endogenous expression
system. Or it could be an agent which up- or down-regulates
a positive or negative regulatory gene.
Fourthly, an agent which is an agonist of the protein
product of the gene, or of a downstream product through
which its activity (of inhibition of progression to a less
favored state) is manifested, or of a signaling intermediate
may be used to foster its activity.
Fifthly, an agent which inhibits the degradation of
that protein product or of a downstream product or of a
signaling intermediate may be used to increase the effective
period of activity of the protein.
Mutant Pr~teins
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
52
The present invention also contemplates mutant proteins
(peptides) which are substantially identical (as defined
below) to the parental protein_(peptide). In general, the
fewer the mutations, the more likely the mutant protein is
to retain the activity of the parental protein. The effect
of mutations is usually (but not always) additive. Certain
individual mutations are more likely to be tolerated than
others.
A proteiaz is more likely to tolerate a mutation which
(a) is a substitution rather than an insertion or
deletion;
(b) is an insertion or deletion at the terminus,
rather than internally, or, if internal, is at a domain
boundary, or a loop or turn, rather than in an alpha helix
or beta strand;
(c) affects a surface residue rather than an interior
residue;
(d) affects a part of the molecule distal to the
binding site;
(e) is a substitution of one amino acid for another of
similar size, charge, and/or hydrophobicity, and does not
destroy a disulfide bond or other crosslink; and
(f) is at a site which is subject to substantial
variation among a family of homologous proteins to which the
protein of interest belongs.
These considerations can be used to design functional
mutants.
,Surface vs. Interior Residues
Charged amino acid residues almost always lie on the
surface of the protein. For uncharged residues, there is
less certainty, but in general, hydrophilic residues are
partitioned to the surface and hydrophobic residues to the
interior. Of course, for a membrane protein, the membrane-
spanning segments are likely to be rich in hydrophobic
residues.
Surface residues may be identified experimentally by
various labeling techniques, or by 3-D structure mapping
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
53
techniques like X-ray diffraction and NMR. A 3-D model of a
homologous protein can be helpful.
Binding Site Residues
Residues forming the binding site may be identified by
(1) comparing the effects of labeling the surface residues
before and after complexing the protein to its target, (2)
labeling the binding site directly with affinity ligands,
(3) fragmenting the protein and testing the fragments for
binding activity, and (4) systematic mutagenesis (e. g.,
alanine-scanning mutagenesis) to determine which mutants
destroy binding. If the binding site of a homologous
protein is known, the binding site may be postulated by
analogy.
Protein libraries may be constructed and screened that
a large family (e.g., 108) of related mutants may be
evaluated simultaneously.
Hence, the mutations are preferably conservative
modifications as defined below.
"Substantially Identical"
A mutant protein (peptide) is substantially identical
to a reference protein (peptide) if (a) it has at least 10%
of a specific binding activity or a non-nutritional
biological activity of the reference protein, and (b) is at
least 50% identical in amino acid sequence to the reference
protein (peptide). It is "substantially structurally
identical" if condition (b) applies, regardless of (a).
Percentage amino acid identity is determined by
aligning the mutant and reference sequences according to a
rigorous dynamic programming algorithm which globally aligns
their sequences to maximize their similarity, the similarity
being scored as the sum of scores for each aligned pair
according to an unbiased PAM250 matrix, and a penalty for
each internal gap of -12 for the first null of the gap and -
4 for each additional null of the same gap. The percentage
identity is the number of matches expressed as a percentage
of the adjusted (i.e., counting inserted nulls) length of
the reference sequence.
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
54
A mutant DNA sequence is substantially identical to a
reference DNA sequence if they are structural sequences, and
encoding mutant and reference proteins which are
substantially identical as described above.
If instead they are regulatory sequences, they are
substantially identical if the mutant sequence has at least
10% of the regulatory activity of the reference sequence,
and is at least 50% identical in nucleotide sequence to the
reference sequence. Percentage identity is determined as
for proteins except that matches are scored +5, mismatches -
4, the gap open penalty is -12, and the gap extension
penalty (per additional null) is -4.
More preferably, the sequence is not merely
substantially identical but rather is at least 51%, at least
66%, at least 75%, at least 80%, at least 85%, at least
900, at least 95m, at least 96o, at least 970, at least
98e or at least 99o identical in sequence to the reference
sequence.
DNA sequences may also be considered "substantially
identical" if they hybridise to each other under stringent
conditions, i.e., conditions at which the Tm of the
heteroduplex of the one strand of the mutant DNA and the
more complementary strand of the reference DNA is not in
excess of 10°C. less than the Tm of the reference DNA
homoduplex. Typically this will correspond to a percentage
identity of 85-900.
"Conservative Modifications"
"Conservative modifications" are defined as
(a) conservative substitutions of amino acids as
hereafter defined; or
(b) single or multiple insertions (extension) or
deletions (truncation) of amino acids at the
termini.
Conservative modifications are preferred to other
modifications. Conservative substitutions are preferred to
other conservative modifications.
"Semi-Conservative Modifications" are modifications
which are not~conservative, but which are (a) semi-
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
conservative substitutions as hereafter defined; or (b)
single or multiple insertions or deletions internally, but
at interdomain boundaries, in loops or in other segments of
relatively high mobility. Semi-conservative modifications
5 are preferred to nonconservative modifications. Semi-
conservative substitutions are preferred to other semi-
conservative modifications.
Non-conservative substitutions are preferred to other
non-conservative modifications.
10 The term "conservative" is used here in an a priori
sense, i.e., modifications which. would be erected to
preserve 3D structure and activity, based on analysis of the
naturally occurring families of homologous proteins and of
past experience with the effects of deliberate mutagenesis,
15 rather than post facto, a modification already known to
conserve activity. ~f course, a modification which is
conservative a priori may, and usually is, also conservative
host facto.
Preferably, except at the termini, no more than about
20 five amino acids are inserted or deleted at a particular
locus, and the modifications are outside regions known to
contain binding sites important to activity.
Preferably, insertions or deletions are limited to the
termini.
25 A conservative substitution is a substitution of one
amino acid for another of the same exchange group, the
exchange groups being defined as follows
I Gly, Pro, Ser, Ala (Cys) (and any nonbiogenic,
neutral amino acid with a hydrophobicity not
30 exceeding that of the aforementioned a.a.'s)
II Arg, Lys, His (and any nonbiogenic, positively-
charged amino acids)
III Asp, Glu, Asn, Gln (and any nonbiogenic
negatively-charged amino acids)
35 IV Leu, Ile, Met, Val (Cys) (and any nonbiogenic,
aliphatic, neutral amino acid with a
hydrophobicity too high for I above)
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
56
V Phe, Trp, Tyr (and any nonbiogenic, aromatic
neutral amino acid with a hydrophobicity too high
for I above) .
Note that Cys belongs to both I and IV.
Residues Pro, Gly and Cys have special conformational
roles. Cys participates in formation of disulfide bonds.
Gly imparts flexibility to the chain. Pro imparts rigidity
to the chain and disrupts a helices. These residues may be
essential in certain regions of the polypeptide, but
substitutable elsewhere.
One, two or three conservative substitutions are more
likely to be tolerated than a larger number.
"Semi-conservative substitutions" are defined herein as
being substitutions within supergroup I/II/III or within
supergroup IV/V, but not within a single one of groups I-V.
They also include replacement of any other amino acid with
alanine. If a substitution is not conservative, it
preferably is semi-conservative.
"Non-conservative substitutions" are substitutions
which are not "conservative" or "semi-conservative".
"Highly conservative substitutions" are a subset of
conservative substitutions, and are exchanges of amino acids
within the groups Phe/Tyr/Trp, hfet/Leu/Ile/Val, His/Arg/Lys,
Asp/Glu and Ser/Thr/Ala. They are more likely to be
tolerated than other conservative substitutions. Again, the
smaller the number of substitutions, the more likely they
are to be tolerated.
"Conservatively Identical"
A protein (peptide) is conservatively identical to a
reference protein (peptide) it differs from the latter, if
at all, solely by conservative modifications, the protein
(peptide remaining at least seven amino acids long if the
reference protein (peptide) was at, least seven amino acids
long.
A protein is at least semi-conservatively identical to
a reference protein (peptide) if it differs from the latter,
if at all, solely by semi-conservative or conservative
modifications.
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
57
A protein (peptide) is nearly conservatively identical
to a reference protein (peptide) if it differs from the
latter, if at all, solely by one or more conservative
modifications and/or a single nonconservative substitution.
It is highly conservatively identical if it differs, if
at all, solely by highly conservative substitutions. Highly
conservatively identical proteins are preferred to those
merely conservatively identical. An absolutely identical
protein is even more preferred.
The core sequence of a reference protein (peptide) is
the largest single fragment which retains at least 10% of a
particular specific binding activity, if one is specified,
or otherwise of at least one specific binding activity of
the referent. If the referent has more than one specific
binding activity, it may have more than one core sequence,
and these may overlap or not.
If it is taught that a peptide of the present invention
may have a particular similarity relationship (e. g.,
marl~edly identical) to a reference protein (peptide),
preferred peptides are those which comprise a sequence
having that relationship to a core sequence of the reference
protein (peptide), but with internal insertions or deletions
in either sequence excluded. Even more preferred peptides
are those whose entire sequence has that relationship, with
the same exclusion, to a core sequence of that reference
protein (peptide).
Library
The term "library" generally refers to a collection of
chemical or biological entities which are related in origin,
structure, and/or function, and which can be screened
simultaneously for a property of interest.
Libraries may be classified by how they are constructed
(natural vs. artificial diversity; combinatorial vs.
noncombinatorial), how they are screened (hybridization,
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
58
expression, display), or by the nature of the screened
library members (peptides, nucleic acids, etc.).
In a "natural diversity" library, essentially all of
the diversity arose without human intervention. This would
be true, for example, of messenger RNA extracted from a non-
engineered cell.
In a "synthetic diversity" library, essentially all of
the diversity arose deliberately as a result of human
intervention. This would be true for example of a
combinatorial library; note that a small level of natural
diversity could still arise as a result of spontaneous
mutation. It would also be true of a noncombinatorial
library of compounds collected from diverse sources, even if
they were all natural products.
In a "non-natural diversity" library, at least some of
the diversity arose deliberately through human intervention.
In a "controlled origin" library, the source of the
diversity is limited in some way. A limitation might be to
cells of a particular individual, to a particular species,
or to a particular genus, or, more complexly, to individuals
of a particular species who are of a particular age, sex,
physical condition, geographical location, occupation and/or
familial relationship. Alternatively or additionally, it
might be to cells of a particular tissue or organ. Or it
could be cells exposed to particular pharmacological,
environmental, or pathogenic conditions. Or the library
could be of chemicals, or a particular class of chemicals,
produced by such cells.
In a "controlled structure" library, the library
members are deliberately limited by the production
conditions to particular chemical structures. For example,
if they are oligomers, they may be limited in length and
monomer composition, e.g. hexapeptides composed of the
twenty genetically encoded amino acids.
Hybridization Library
In a hybridization library, the library members are
nucleic acids, and are screened using a nucleic acid
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
59
hybridi2ation probe. Bound nucleic acids may then be
amplified, cloned, and/or sequenced.
Expression Library
In an expression library, the screened library members
are gene expression products, but one may also speak of an
underlying library of genes encoding those products. The
library is made by subcloning DNA encoding the library
members (or portions thereof) into expression vectors (or
into cloning vectors which subsequently are used to
construct expression vectors), each vector comprising an
expressible gene encoding a particular library member,
introducing the expression vectors into suitable cells, and
expressing the genes so the expression products are
produced.
In one embodiment, the expression products are
secreted, so the library can be screened using an affinity
reagent, such as an antibody or receptor. The bound
expression products may be sequenced directly, or their
sequences inferred by, e.g., sequencing at least the
variable portion of the encoding DNA.
In a second embodiment, the cells are lysed, thereby
exposing the expression products, and the latter are
screened with the affinity reagent.
In a third embodiment, the cells express the library
members in such a manner that they are displayed on the
surface of the cells, or on the surface of viral particles
produced by the cells. (See display libraries, below).
In a fourth embodiment, the screening is not for the
ability of the expression product to bind to an affinity
reagent, but rather for its ability to alter the phenotype
of the host cell in a particular detectable manner. Here,
the screened library members are transformed cells, but
there is a first underlying library of expression products
which mediate the behavior of the cells, and a second
underlying library of genes which encode those products.
Display Library
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
In a display library, the library members are each
conjugated to, and displayed upon, a support of some kind.
The support may be living (a cell or virus), or nonliving
(e. g., a bead or plate).
5 If the support is a cell or virus, display will
normally be effectuated by expressing a fusion protein which
comprises the library member, a.carrier moiety allowing
integration of the fusion protein into the surface of the
cell or virus, and optionally a lining moiety. In a
10 variation on this theme, the cell coexpresses a first fusion
comprising the library member and a linking moiety L1, and a
second fusion comprising a linking moiety L2 and the carrier
moiety. L1 and L2 interact to associate the first fusion
with the second fusion and hence, indirectly, the library
15 member with the surface of the cell or virus.
Soluble Librarlr
In a soluble library, the library members are free in
solution. A soluble library may be produced directly, or
20 one may first make a display library and then release the
library members from their supports.
Encapsulated Library
In an encapsulated library, the library members are
25 inside cells or liposomes. Generally speaking, encapsulated
libraries are used to store the library members for future
use; the members are extracted in some way for screening
purposes. However, if they differentially affect the
phenotype of the cells, they may be screened indirectly by
30 screening the cells.
cDNA Library
A cDNA library is usually prepared by extracting RNA
from cells of particular origin, fractionating the RNA to
35 isolate the messenger RNA (mRNA has a poly(A) tail, so this
is usually done by oligo-dT affinity chromatography),
synthesizing complementary DNA (cDNA) using reverse
transcriptase, DNA polymerise, and other enzymes, subcloning
the cDNA into vectors, and introducing the vectors into
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
I
61
cells. Often, only mRNAs or cDNAs of particular sizes will
be used, to make it more likely that the cDNA encodes a
functional polypeptide.
A cDNA library explores the natural diversity of the
transcribed DNAs of cells from a particular source. It is
not a combinatorial library.
A cDNA library may be used to make a hybridization
library, or it may be used as an (or to make) expression
library.
Genomic DNA Library
A genomic DNA library is made by extracting DNA from a
particular source, fragmenting the DNA, isolating fragments
of a particular size range, subcloning the DNA fragments
into vectors, and introducing the vectors into cells.
Like a cDNA library, a genomic DNA library is a natural
diversity library, and not a combinatorial library. A
genomic DNA library may be used the same way as a cDNA
library.
~0
Synthetic DNA library
A synthetic DNA library may be screened directly (as a
hybridization library), or used in the creation of an
expression or display library of peptides/proteins.
Combinatorial Libraries
The term "combinatorial library" refers to a library in
which the individual members are either systematic or random
combinations of a limited set of basic elements, the
properties of each member being dependent on the choice and
location of the elements incorporated into it. Typically,
the members of the library are at least capable of being
screened simultaneously. Randomization may be complete or
partial; some positions may be randomized and others
predetermined, and at random positions, the choices may be
limited in a predetermined manner. The members of a
combinatorial library may be oligomers or polymers of some
kind, in which the variation occurs through the choice of
monomeric building block at one or more positions of the
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
62
oligomer or polymer, and possibly in terms of the connecting
linkage, or the length of the oligomer or polymer, too. Or
the members may be nonoligomeric molecules with a standard
core structure, like the 1,4-benzodiazepine structure, with
the variation being introduced by the choice of substituents
at particular variable sites on the core structure. Or the
members may be nonoligomeric molecules assembled like a
jigsaw puzzle, but wherein each piece has both one or more
variable moieties (contributing to library diversity) and
one or more constant moieties (providing the functionalities
for coupling the piece in question to other pieces).
Thus, in a typical combinatorial library, chemical
building blocks are at least partially randomly combined
into a large number (as high as 105) of different compounds,
which are then simultaneously screened for binding (or
other) activity against one or more targets.
In a "simple combinatorial library", all of the members
belong to the same class of compounds (e.g., peptides) and
can be synthesized simultaneously. A "composite
combinatorial library" is a mixture of two or more simple
libraries, e.g., DNAs and peptides, or peptides, peptoids,
and PNAs, or benzodiazepines and carbamates. The number of
component simple libraries in a composite library will, of
course, normally be smaller than the average number of
members in each simple library, as otherwise the advantage
of a library over individual synthesis is small.
Libraries of thousands, even millions, of random
oligopeptides have been prepared by chemical synthesis
(Houghten et al., Nature, 354:84-6(1991)), or gene
expression (Marks et al., J Mol Biol, 222:581-97(1991)),
displayed on chromatographic supports (Lam et al., Nature,
354:82-4(1991)), inside bacterial cells (Colas et al.,
Nature, 380:548-550(1996)), on bacterial pili (Lu,
Bio/Technology, 13:366-372(1990)), or phage (Smith, Science,
228:1315-7(1985)), and screened for binding to a variety of
targets including antibodies (Valadon et al., J Mol Biol,
261:11-22(1996)), cellular proteins (Schmitz et al., J Mol
Biol, 260:664-677(1996)), viral proteins (Hong and
Boulanger, Embo J, 14:4714-4727(1995)), bacterial proteins
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
63
(Jacobsson and Frykberg, Biotechniques, 18:878-885(1995)),
nucleic acids (Cheng et al., Gene, 171:'1-8(1996)), and
plastic (Siam et al., J Chem Inf Comput Sci, 34:588-
593 (1994) ) .
Libraries of proteins (Ladner, USP 4,664,989), peptoids
(Simon et al., Proc Natl Acad Sci U S A, 89:9367-71(1992)),
nucleic acids (Ellington and Szostak, Nature,
246:818(1990)), carbohydrates, and small organic molecules
(Eichler et al., Med Res l2ev, 15:481-96(1995)) have also
been prepared or suggested for drug screening purposes.
The first combinatorial libraries were composed of
peptides or proteins, in which all or selected amino acid
positions were randomized. Peptides and proteins can exhibit
high and specific binding activity, and can act as
catalysts. In consequence, they are of great importance in
biological systems.
Nucleic acids have also been used in combinatorial
libraries. Their great advantage is the ease with. which a
nucleic acid with appropriate binding activity can be
amplified. As a result, combinatorial libraries composed of
nucleic acids can be of low redundancy and hence, of high
diversity.
There has also been much interest in combinatorial libraries
based on small molecules, which are more suited to
pharmaceutical use, especially those which, like
benzodiazepines, belong to a chemical class which has
already yielded useful pharmacological agents. The
techniques of combinatorial chemistry have been recognized
as the most efficient means for finding small molecules that
act on these targets. At present, small molecule
combinatorial chemistry involves the synthesis of either
pooled or discrete molecules that present varying arrays of
functionality on a common scaffold. These compounds are
grouped in libraries that are then screened against the
target of interest either for binding or for inhibition of
biological activity.
The size of a library is the number of molecules in it. The
simple diversity of a library is the number of unique
structures in it. There is no formal minimum or maximum
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
64
diversity. If the library has a very low diversity, the
library has little advantage over just synthesizing and
screening the members individually. If the library is of
very high diversity, it may be inconvenient to handle, at
least without automatizing the process. The simple
diversity of a library is preferably at least 10, 10E2,
10E3, 10E4, 10E6, 10E7, 10E8 or 10E9, the higher the better
under most circumstances. The simple,diversity is usually
not more than 10E15, and more usually not more than 10E10.
The average sampling level is the size divided by the simple
diversity. The expected average sampling level must be high
enough to provide a reasonable assurance that, if a given
structure were expected, as a consequence of the library
design, to be present, that the actual average sampling
level will be high enough so that the structure, if
satisfying the screening criteria, will yield a positive
result when the library is screened. Thus, the preferred
average sampling level is a function of the detection limit,
which in turn is a function of the strength. of the signal to
be screened.
There are more complex measures of diversity than simple
diversity. These attempt to take into account the degree of
structural difference between the various unique sequences.
These more complex measures are usually used in the context
of small organic compound libraries, see below.
The library members may be presented as solutes in solution,
or immobilized on some form of support. In the latter case,
the support may be living (cell, virus) or nonliving (bead,
plate, etc.). The supports may be separable (cells, virus
particles, beads) so that binding and nonbinding members can
be separated, or nonseparable (plate). In the latter case,
the members will normally be placed on addressable positions
on the support. The advantage of a soluble library is that
there is no carrier moiety that could interfere with the
binding of the members to the support. The advantage of an
immobilized library is that it is easier to identify the
structure of the members which were positive.
When screening a soluble library, or one with a separable
support, the target is usually immobilized. When screening ,
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
a library on a nonseparable support, the target will usually
be labeled.
Oligonucleotide Libraries
5 An oligonucleotide library is a combinatorial library,
at least some of whose members are single-stranded
oligonucleotides having three or more nucleotides connected
by phosphodiester or analogous bonds. The oligonucleotides
may be linear, cyclic or branched, and may include non-
10 nucleic acid moieties. The nucleotides are not limited to
the nucleotides normally found in DNA or RNA. For examples
of nucleotides modified to increase nuclease resistance and
chemical stability of aptamers, see Chart 1 in Osborne and
Ellington, Chem. Rev., 97: 349-70 (1997). For screening of
15 RNA, see Ellington and Szostak, Nature, 346: 818-22 (1990).
There is no formal minimum or maximum size for these
oligonucleotides. However, the number of conformations which
an oligonucleotide can assume increases exponentially with
its length in bases. Hence, a longer oligonucleotide is
20 more likely to be able to fold to adapt itself to a protein
surface. On the other hand, while very long molecules can
be synthesized and screened, unless they provide a much
superior affinity to that of shorter molecules, they are not
likely to be found in the selected population, for the
25 reasons explained by Osborne and Ellington (1997). Hence,
the libraries of the present invention are preferably
composed of oligonucleotides having a length of 3 to 100
bases, more preferably 15 to 35 bases. The oligonucleotides
in a given library may be of the same or of different
30 lengths.
Oligonucleotide libraries have the advantage that
libraries of very high diversity (e. g., 1015) are feasible,
and binding molecules are readily amplified in vitro by
polymerase chain reaction (PCR). Moreover, nucleic acid
35 molecules can have very high specificity and affinity to
targets.
In a preferred embodiment, this invention prepares and
screens oligonucleotide libraries by the SELEX method, as
described in King and Famulok, Molec. Biol. Repts., 20: 97-
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
66
107 (1994); L. Gold, C. Tuerk. Methods of producing nucleic
acid ligands, US#5595877; Oliphant et al. Gene 44:177
(1986) .
The term "aptamer" is conferred on those
oligonucleotides which bind the target protein. Such
aptamers may be used to characterize the target protein,
both directly (through identification of the aptamer and the
points of contact between the aptamer and the protein) and
indirectly (by use of the aptamer as a ligand to modify the
chemical reactivity of the protein).
In a classic oligonuclotide, each nucleotide (monomeric
unit) is composed of a phosphate group, a sugar moiety, and
either a purine or a pyrimidine base. In DNA, the sugar is
deoxyribose and in RNA it is ribose. The nucleotides are
linked by 5'-3' phosphodiester bonds.
The deoxyribose phosphate backbone of DNA can be
modified to increase resistance to nuclease and to increase
penetration of cell membranes. Derivatives such as mono- or
dithiophosphates, methyl phosphonates, boranophosphates,
formacetals, carbamates, siloxanes, and dimethylenethio- -
sulfoxideo- and-sulfono- linked species are known in the
art.
Peptide Library
A peptide is composed of a plurality of amino acid
residues joined together by peptidyl (-NHCO-) bonds. A
biogenic peptide is a peptide in which the residues are all
genetically encoded amino acid residues; it is not necessary
that the biogenic peptide actually be produced by gene
expression.
Amino acids are the basic building blocks with which
peptides and proteins are constructed. Amino acids possess
both an amino group (-NHS) and a carboxylic acid group (-
COON). Many amino acids, but not all, have the alpha amino
acid structure NHa-CHR-COOH, where R is hydrogen, or any of a
variety of functional groups.
Twenty amino acids are genetically encoded: Alanine,
Arginine, Asparagine, Aspartic Acid, Cysteine, Glutamic
Acid, Glutamine, Glycine, Histidine, Isoleucine, Leucine,
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
67
Lysine, Methionine, Phenylalanine, Proline, Serine,
Threonine, Tryptophan, Tyrosine, and Valine. Of these, all
save Glycine are optically isomeric, however, only the L-
form is found in humans. Nevertheless, the D-forms of these
amino acids do have biological significance; D-Phe, for
example, is a known analgesic.
Many other amino acids are also known, including: 2-
Aminoadipic acid; 3-Aminoadipic acid; beta-Aminopropionic
acid; 2-Aminobutyric acid; 4-Aminobutyric acid (Piperidinic
acid);6-Aminocaproic acid; 2-Aminoheptanoic acid; 2-
Aminoisobutyric acid, 3-Aminoisobutyric acid; 2-Aminopimelic
acid; 2,4-Diaminobutyric acid; Desmosine; 2,2'-
Diaminopimelic acid; 2,3-Diaminopropionic acid; N-
Ethylglycine; N-Ethylasparagine; Hydroxylysine; allo-
Hydroxylysine; 3-Hydroxyproline; 4-Hydroxyproline;
Isodesmosine; allo-Isoleucine; N-Methylglycine (Sarcosine);
N-Methylisoleucine; N-Methylvaline; Norvaline; Norleucine;
and Ornithine.
Peptides are constructed by condensation of amino acids
and/or smaller peptides. The amino group of one amino acid
(or peptide) reacts with the carboxylic acid group of a
second amino acid (or peptide) to form a peptide (-NHCO-)
bond, releasing one molecule of water. Therefore, when an
amino acid is incorporated into a peptide, it should,
technically speaking, be referred to as an amino acid
residue. The core of that residue is the moiety which
excludes the -NH and -CO linking functionalities which
connect it to other residues. This moiety consists of one
or more main chain atoms (see below) and the attached side
chains.
The main chain moiety of each amino acid consists of
the -NH and -CO linking functionalities and a core main
chain moiety. Usually the latter is a single carbon atom.
However, the core main chain moiety may include additional
carbon atoms, and may also include nitrogen, oxygen or
sulfur atoms, which together form a single chain. In a
preferred embodiment, the core main chain atoms consist
solely of carbon atoms.
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
68
The side chains are attached to the core main chain
atoms. For alpha amino acids, in which the side chain is
attached to the alpha carbon, the C-1, C-2 and N-2 of each
residue form the repeating unit of the main chain, and the
word "side chain" refers to the C-3 and higher numbered
carbon atoms and their substituents. It also includes H
atoms attached to the main chain atoms.
Amino acids may be classified according to the number
of carbon atoms which appear in the main chain between the
carbonyl carbon and amino nitrogen atoms which participate
in the peptide bonds. Among the 150 or so amino acids which
occur in nature, alpha, beta, gamma and delta amino acids
are known. These have 1-4 intermediary carbons. Only alpha
amino acids occur in proteins. Proline is a special case of
an alpha amino acid; its side chain also binds to the
peptide bond nitrogen.
For beta and higher order amino acids, there is a
choice as to which. main chain core carbon a side chain other
than H is attached to. The preferred attachment site is the
C-2 (alpha) carbon, i.e., the one adjacent to the carboxyl
carbon of the -CO linking functionality. It is also possible
for more than one main chain atom to carry a side chain
other than H. However, in a preferred embodiment, only one
main chain core atom carries a side chain other than H.
A main chain carbon atom may carry either one or two
side chains; one is more common. A side chain may be
attached to a main chain carbon atom by a single or a double
bond; the former is more common.
A simple combinatorial peptide library is one whose
members are peptides having three or more amino acids
connected via peptide bonds.
The peptides may be linear, branched, or cyclic, and
may covalently or noncovalently include nonpeptidyl
moieties. The amino acids are not limited to the naturally
occurring or to the genetically encoded amino acids.
A biased peptide library is one in which one or more
(but not all) residues of the peptides are constant
residues.
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
69
CyCliC Peptides
Many naturally occurring peptides are cyclic.
Cyclization is a common mechanism for stabilization of
peptide conformation thereby achieving improved association
of the peptide with its ligand and hence improved biological
activity. Cyclization is usually achieved by intra-chain
cystine formation, by formation of peptide bond between side
chains or between N- and C- terminals. Cyclization was
usually achieved by peptides in solution, but several
publications have appeared that describe cyclization of
peptides on beads.
A peptide library may be an oligopeptide library or a
protein library.
Oligopeptides
Preferably, the oligopeptides are at least five, six,
seven or eight amino acids in length. Preferably, they are
composed of less than 50, more preferably less than 20 amino
acids.
In the case of an oligopeptide library, all or just
some of the residues may be variable. The oligopeptide may
be unconstrained, or constrained to a particular
conformation by, e.g., the participation of constant
cysteine residues in the formation of a constraining
disulfide bond.
Proteins
Proteins, like oligopeptides, are composed of a
plurality of amino acids, but the term protein is usually
reserved for longer peptides, which are able to fold into a
stable conformation. A protein may be composed of two or
more polypeptide chains, held together by covalent or
noncovalent crosslinks. These may occur in a homooligomeric
or a heterooligomeric state.
A peptide is considered a protein if it (1) is at least
50 amino acids long, or (2) has at least two stabilizing
covalent crosslinks (e. g., disulfide bonds). Thus,
conotoxins are considered proteins.
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
Usually, the proteins of a protein library will be
characterizable as having.-both constant residues (the same
for all proteins in the library) and variable residues
(which vary from member to member). This is simply because,
5 for a given range of variation at each position, the
sequence space (simple diversity) grows exponentially with
the number of residue positions, so at some point it becomes
inconvenient for all residues of a peptide to be variable
positions. Since proteins are usually larger than
10 oligopeptides, it is more common for protein libraries than
oligopeptide libraries to feature variable positions.
In the case of a protein library, it is desirable to
focus the mutations at those sites which are tolerant of
mutation. These may be determined by alanine scanning
15 mutagenesis or by comparison of the protein sequence to that
of homologous proteins of similar activity. It is also more
likely that mutation of surface residues will directly
affect binding. Surface residues may be determined by
inspecting a 3D structure of the protein, or by labeling the
20 surface and then ascertaining which residues have received
labels. They may also be inferred by identifying regions of
high hydrophilicity within the protein.
Because proteins are often altered at some sites but
not others, protein libraries can be considered a special
25 case of the biased peptide library.
There are several reasons that one might screen a
protein library instead of an oligopeptide library,
including (1) a particular protein, mutated in the library,
has the desired activity to some degree already, and (2) the
30 oligopeptides are not expected to have a sufficiently high
affinity or specificity since they do not have a stable
conformation.
When the protein library is based on a parental protein
which does not have the desired activity, the parental
35 protein will usually be one which is of high stability
(melting point >= 50 deg. C.) and/or possessed of
hypervariable regions.
The variable domains of an antibody possess
hypervariable regions and hence, in some embodiments, the
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
71
protein library comprises members which comprise a mutant of
VH or VL chain, or a mutant of an antigen-specific binding
fragment of such a chain. VH and VL chains are usually each
about 110 amino acid residues, and are held in proximity by
a disulfide bond between the adjoing CL and CH1 regions to
form a variable domain. Together, the VH, VL, CL and CH1
form an Fab fragment.
In human heavy chains, the hypervariable regions are at
31-35, 49-65, 98-111 and 84-88, but only the first three are
involved in antigen binding. There is variation among VH
and VL chains at residues outside the hypervariable regions,
but to a much lesser degree.
A sequence is considered a mutant of a VH or VL chain
if it is at least 80o identical to a naturally occurring VH
or VL chain at all residues outside the hypervariable
region.
In a preferred embodiment, such antibody library
members comprise both at least one VH chain and at least one
VL chain, at least one of which is a mutant chain, and which
chains may be derived from the same or different antibodies.
The VH and VL chains may be covalently joined by a suitable
linker moiety, as in a "single chain antibody", or they may
be noncovalently joined, as in a naturally occurring
variable domain.
If the joining is noncovalent, and the library is
displayed on cells or virus, then either the VH or the VL
chain may be fused to the carrier surface/coat protein. The
complementary chain may be co-expressed, or added
exogenously to the library.
The members may further comprise some or all of an
antibody constant heavy and/or constant light chain, or a
mutant thereof.
Peptoid Library
A peptoid is an analogue of a peptide in which one or
more of the peptide bonds (-NH-CO-) are replaced by
pseudopeptide bonds, which may be the same or different. It
is not necessary that all of the peptide bonds be replaced,
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
72
i.e., a peptoid may include one or more conventional amino
acid residues, e.g., proline.
A peptide bond has two small divalent linker elements,
-NH- and -CO-. Thus, a preferred class of psuedopeptide
bonds are those which consist of two small divalent linker
elements. Each may be chosen independently from the group
consisting of amine (-NH-), substituted amine (-NR-),
carbonyl (-CO-), thiocarbonyl (-CS-),methylene (-CH2-),
monosubstituted methylene (-CHR-), disubstituted methylene
'10 (-CR1R2-), ether (-O-) and thioether (-S-). The more
preferred pseudopeptide bonds include:
N-modified -NRCO-
Carba ~ -CHa-CHz-
Depsi ~ -CO-O-
Hydroxyethylene ~ -CHOH-CHZ-
Ketomethylene ~ -CO-CH2-
Methylene-Oxy -CH2-O-
Reduced -CHI-NH-
Thiomethylene -CH2-S-
Thiopeptide -CS-NH-
Retro-Inverso -CO-NH-
A single peptoid molecule may include more than one
kind of pseudopeptide bond.
For the purposes of introducing diversity into a
peptoid library, one may vary (1) the side chains attached
to the core main chain atoms of the monomers linked by the
pseudopeptide bonds, and/or (2) the side chains (e.g., the -
R of an -NRCO-) of the pseudopeptide bonds. Thus, in one
embodiment, the monomeric units which are not amino acid
residues are of the structure -NR1-CR2-CO-, where at least
one of R1 and R2 are not hydrogen. If there is variability
in the pseudopeptide bond, this is most conveniently done by
using an -NRCO- or other pseudopeptide bond with an R group,
and varying the R group. In this event, the R group will
usually be any of the side chains characterizing the amino
acids of peptides, as previously discussed.
If the R group of the pseudopeptide bond is not
variable, it will~wusually be small, e.g., not more than 10
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
73
atoms (e. g., hydroxyl, amino, carboxyl, methyl, ethyl,
propyl ) .
If the conjugation chemistries are compatible, a simple
combinatorial library may include both peptides and
peptoids.
Peptide Nucleic Acid Library
A PNA oligomer is here defined as one comprising a
plurality of units, at least one of which is a PNA monomer
which comprises a side chain comprising a nucleobase. For
nucleobases, see USP 6,077,835.
The classic PNA oligomer is composed of (2-
aminoethyl)glycine units, with nucleobases attached by
methylene carbonyl linkers. That is, it has the structure
H- (-HN-CHI-CH2-N (-CO-CH2-B) -CH2-CO-) n -OH
where the outer parenthesized substructure is the PNA
monomer.
In this structure, the nucleobase B is separated from
the bacl~bone N by three bonds, and the points of attachment
of the side chains are separated by six bonds. The
nucleobase may be any of the bases included in the
nucleotides discussed in connection with oligonucleotide
libraries. The bases of nucleotides A, G, T, C and U are
preferred.
A PNA oligomer may further comprise one or more amino
acid residues, especially glycine and proline.
One can readily envision related molecules in which (1)
the -COCH2- linker is replaced by another linker, especially
one composed of two small divalent linkers as defined
previously, (2) a side chain is attached to one of the three
main chain carbons not participating in the peptide bond
(either instead or in addition to the side chain attached to
the N of the classic PNA); and/or (3) the peptide bonds are
replacedtby pseudopeptide bonds as disclosed previously in
the context of peptoids.
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
74
PNA oligomer libraries have been made; see e.g. Cook,
6,204,326.
Small Organic Compound Library
The small organic compound library ("compound library",
for short) is a combinatorial library whose members are
suitable for use as drugs if, indeed, they have the ability
to mediate a biological activity of the target protein.
Peptides have certain disadvantages as drugs. These
include susceptibility to degradation by serum proteases,
and difficulty in penetrating cell membranes. Preferably,
all or most of the compounds of the compound library avoid,
or at.least do not suffer to the same degree, one or more of
the pharmaceutical disadvantages of peptides.
In designing a compound library, it is helpful to bear
in mind the methods of molecular modification typically used
to obtain new drugs. Three basic kinds of modification may
be identified: disjunction, in which a lead drug is
simplified to identify its component pharmacophoric
moieties; conjunction, in which two or more known
pharmacophoric moieties, which may be the same or different,
are associated, covalently or noncovalently, to form a new
drug; and alteration, in which one moiety is replaced by
another which may be similar or different, but which is not
in effect a disjunction or conjunction. The use of the
terms "disjunction", "conjunction" and "alteration" is
intended only to connote the structural relationship of the
end product to the original leads, and not how the new drugs
are actually synthesized, although it is possible that the
two are the same.
The process of disjunction is illustrated by the
evolution of neostigmine (1931) and edrophonium (1952) from
physostigmine (1925). Subsequent conjunction is illustrated
by demecarium (1956) and ambenonium (1956).
Alterations may modify the size, polarity, or electron
distribution of an original moiety. Alterations include
ring closing or opening, formation of lower or higher
homologues, introduction or saturation of double bonds,
introduction of optically active centers, introduction,
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
removal or replacement of bulky groups, isosteric or
bioisosteric substitution, changes in the position or
orientation of a group, introduction of alkylating groups,
and introduction, removal or replacement of groups with a
5 view toward inhibiting or promoting inductive
(electrostatic) or conjugative (resonance) effects.
Thus, the substituents may include electron acceptors
and/or electron donors. Typical electron donors (+I)
include -CH3, -CH2R, -CHR2, -CR3 and -COO-. Typical electron
10 acceptors (-I) include -NH3+, -NR3+, -NO2, -CN, -COOH, -COOK,
-CHO, -COR, -COR, -F, -C1, -Br, -OH, -OR, -SH, -SR, -CH=CHI,
-CR=CR2, and -C=CH.
The substituents may also include those which increase
or decrease electronic density in conjugated systems. The
15 former (+R) groups include -CH3, -CR3, -F, -C1, -Br, -I, -OH,
-OR, -OCOR, -SH, -SR, -NH2, -NR~, and -NHCOR. The later (-R)
groups include -NO2, -CN, -CHC, -COR, -COOH, -COOR, -CONH2,
-SO2R and -CF3.
Synthetically spearing, the modifications may be
20 achieved by a variety of unit processes, including
nucleophilic and electrophilic substitution, reduction and
oxidation, addition elimination, double bond cleavage, and
C'yClization.
For the purpose of constructing a library, a compound,
25 or a family of compounds, having one or more pharmacological
activities (which need not be related to the known or
suspected activities of the target protein), may be
disjoined into two or more known or potential pharmacophoric
moieties. Analogues of each of these moieties may be
30 identified, and mixtures of these analogues reacted so as to
reassemble compounds which have some similarity to the
original lead compound. It is not necessary that all
members of the library possess moieties analogous to all of
the moieties of the lead compound.
35 The design of a library may be illustrated by the
example of the benzodiazepines. Several benzodiazepine
drugs, including chlordiazepoxide, diazepam and oxazepam,
have been used as anti-anxiety drugs. Derivatives of
benzodiazepines have widespread biological activities;
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
76
derivatives have been reported to act not only as
anxiolytics, but also as anticonvulsants; cholecystokinin
(CCK) receptor subtype A or B, kappa opioid receptor,
platelet activating factor, and HIV transactivator Tat
antagonists, and GPIIbIIa, reverse transcriptase and ras
farnesyltransferase inhibitors.
The benzodiazepine structure has been disjoined into a
2-aminobenzophenone, an amino acid, and an alkylating agent.
See Bunin, et al., Proc. Nat. Acad. Sci. USA, 91:4708
(1994). Since only a few 2-aminobenzophenone derivatives
are commercially available, it was later disjoined into 2-
aminoarylstannane, an acid chloride, an amino acid, and an
alkylating agent. Bunin, et al., Meth. Enzymol., 267:448
(1996). The arylstannane may be considered the core
structure upon which the other moieties are substituted, or
all four may be considered equals which are conjoined to
make each library member.
A basic library synthesis plan and member structure is
shown in Figure 1 of Fowlkes, et al., U.S. Serial No.
08/740,671, incorporated by reference in its entirety. The
acid chloride building block introduces variability at the R1
site. The R~ site is introduced by the amino acid, and the
R3 site by the all~ylating agent . The R4 site is inherent in
the arylstannane. Bunin, et al. generated a 1, 4-
benzodiazepine library of 11,200 different derivatives
prepared from 20 acid chlorides, 35 amino acids, and 16
alkylating agents. (No diversity was introduced at R4; this
group was used to couple the molecule to a solid phase.)
According to the Available Chemicals Directory (HDL
Information Systems, San Leandro CA), over 300 acid
chlorides, 80 Fmoc-protected amino acids and 800 alkylating
agents were available for purchase (and more, of course,
could be synthesized). The particular moieties used were
chosen to maximize structural dispersion, while limiting the
numbers to those conveniently synthesized in the wells of a
microtiter plate. In choosing between structurally similar
compounds, preference was given to the least substituted
compound.
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
77
The variable elements included both aliphatic and
aromatic groups. Among the aliphatic groups, both acyclic
and cyclic (mono- or poly-) structures, substituted or not,
were tested. (While all of the acyclic groups were linear,
it would have been feasible to introduce a branched
aliphatic). The aromatic groups featured either single and
multiple rings, fused or not, substituted or not, and with
heteroatoms or not. The secondary substitutents included -
NH~, -OH, -OMe, -CN, -C1, -F, and -COOH. While not used,
spacer moieties, such as -0-, -S-, -00-, -CS-, -NH-, and -
NR-, could have been incorporated.
Benin et al. suggest that instead of using a 1, 4-
benzodiazepine as a core structure, one may instead use a 1,
4-benzodiazepine-2, 5-dione structure.
As noted by Benin et al., it is advantageous, although
not necessary, to use a linkage strategy which leaves no
trace of the linking functionality, as this permits
construction of a more diverse library.
Other combinatorial nonoligomeric compound libraries
l~nown or suggested in the art have been based on carbamates,
mercaptoacylated pyrrolidines, phenolic agents, aminimides,
N-acylamino ethers (made from amino alcohols, aromatic
hydroxy acids, and carbo~.ylic acids), N-alkylamino ethers
(made from aromatic hydroxy acids, amino alcohols and
aldehydes) 1, 4-piperazines, and 1, 4-piperazine-6-ones.
I7eWitt, et al., Proc. Nat. Acad. Sci. (USA), 90:6909-13
(1993) describe the simultaneous but separate, synthesis of
40 discrete hydantoins and 40 discrete benzodiazepines.
They carry out their synthesis on a solid support (inside a
gas dispersion tube), in an array format, as opposed to
other conventional simultaneous synthesis techniques (e. g.,
in a well, or,on a pin). The hydantoins were synthesized by
first simultaneously deprotecting and then treating each of
five amino acid resins with each of eight isocyanates. The
benzodiazepines were synthesized by treating each of five
deprotected amino acid resins with each of eight 2-amino
benzophenone imines.
Chen, et al., J. Am. Chem. Soc., 116:2661-62 (1994)
described the preparation of a pilot (9 member)
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
78
combinatorial library of formate esters. A polymer bead-
bound aldehyde preparation was "split" into three aliquots,
each reacted with one of three different glide reagents..
The reaction products were combined, and then divided into
three new aliquots, each of which was reacted with a
different Michael donor. Compound identity was found to be
determinable on a single bead basis by gas
chromatography/mass spectroscopy analysis.
Holmes, USP 5,549,974 (1996) sets forth methodologies
for the combinatorial synthesis of libraries of
thiazolidinones and metathiazanones. These libraries are
made by combination of amines, carbonyl compounds, and
thiols under cyclization conditions.
Ellman, USP 5,545,568 (1996) describes combinatorial
synthesis of benzodiazepines, prostaglandins, beta-turn
mimetics, and glycerol-based compounds. See also Ellman,
USP 5,288,514.
Summerton, USP 5,506,337 (1996) discloses methods of
preparing a combinatorial library formed predominantly of
morpholino subunit structures.
Heterocylic combinatorial libraries are reviewed
generally in Nefzi, et al., Chem. Rev., 97:449-472 (1997).
For pharmacological classes, see, e.g., Goth, Medical
Pharmacology: Principles and Concepts (C.V. Mosby Co.: 8th
ed. 1976); Korolkovas and Burckhalter, Essentials of
Medicinal Chemistry (John Wiley & Sons, Inc.: 1976). For
synthetic methods, see, e.g., Warren, Organic Synthesis: The
Disconnection Approach (John Wiley & Sons, Ltd.: 1982);
Fuson, Reactions of Organic Compounds (John Wiley & Sons:
1966); Payne and Payne, How to do an Organic Synthesis
(Allyn and Bacon, Inc.: 1969); Greene, Protective Groups in
Organic Synthesis (Wiley-Interscience). For selection of
substituents, see e.g., Hansch and Leo, Substituent
Constants for Correlation Analysis in Chemistry and Bioloay
(John Wiley & Sons: 1979).
The library is preferably synthesized so that the
individual members remain identifiable so that, if a member
is shown to be active, it is not necessary to analyze it.
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
79
Several methods of identification have been proposed,
including:
(1) encoding, i.e., the attachment to each member of
an identifier moiety which is more readily
identified than the member proper. This has the
disadvantage that the tag may itself influence the
activity of the conjugate.
(2) spatial addressing, e.g., each member is
synthesized only at a particular coordinate on or
in a matrix, or in a particular chamber. This
might be, for example, the location of a
particular pin, or a particular well on a.
microtiter plate, or inside a "tea bag".
The present invention is not limited to any particular form
of identification.
However, it is possible to simply characterize those
members of the library which are found to be active, based
on the characteristic spectroscopic indicia of the various
building blocks.
Solid phase synthesis permits greater control over
which derivatives are formed. However, the solid phase
could interfere with activity. To overcome this problem,
some or all of the molecules of each member could be
liberated, after synthesis but before. screening.
Examples of candidate simple libraries which might be
evaluated include derivatives of the following:
Cyclic Compounds Containing One Hetero Atom
Heteronitrogen
pyrroles
pentasubstituted pyrroles
pyrrolidines
pyrrolines
prolines
indoles
beta-carbolines
pyridines
dihydropyridines
1,4-dihydropyridines
pyrido [2, 3-d] pyrimidines
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
tetrahydro-3H-imidazo[4,5-c] pyridines
Isoquinolines
tetrahydroisoquinolines
quinolones
5 beta-lactams
azabicyclo[4.3.0]nonen-8-one amino acid
Heterooxygen
furans
tetrahydrofurans
10 2,5-disubstituted tetrahydrofurans
pyrans
hydroxypyranones
tetrahydroxypyranones
gamma-butyrolactones
15 Heterosulfur
sulfolenes
Cyclic Compounds with Two or More Hetero atoms
Multiple heteronitrogens
imidazoles
20 pyrazoles
piperazines
diketopiperazines
arylpiperazines
benzylpiperazines
25 benzodiazepines
1,4-benzodiazepine-2,5-diones
hydantoins
5-alkoxyhydantoins
dihydropyrimidines
1,3-disubstituted-5,6-dihydopyrimidine-2,4-
diones
cyclic ureas
cyclic thioureas
quinazolines
chiral 3-substituted-quinazoline-2,4-
diones
triazoles
1,2,3-triazoles
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
81
purines
Heteronitrogen and Heterooxygen
dikelomorpholines
isoxazoles
S isoxazolines
Heteronitrogen and Heterosulfur
thiazolidines
N-axylthiazolidines
dihydrothia~oles
~-methylene-2,3-dihydrothiazates
2-aminothiazoles
thiophenes
3-amino thiophenes
4-thiazolidinones
4-melathiazanones
benzisothiazolones
For details on synthesis of libraries, see Nef~i, et
al., Chem. Rev., 97:449-72 (1997), and references cited
therein.
Ph~.a,ceutic~.l et~.oo~.s arid Prepa~ati~ns
The preferred animal subject of the present invention
is a mammal. By the term "mammal" is meant an individual
belonging to the class Mammalia. The invention is
particularly useful in the treatment of human subjects,
although it is intended for veterinary and nutritional uses
as well. Preferred nonhuman subjects are of the orders
Primata (e.g., apes and monkeys), Artiodactyla or
Perissodactyla (e. g., cows, pigs, sheep, horses, goats),
Carnivora (e. g., cats, dogs), Rodenta (e. g., rats, mice,
guinea pigs, hamsters), Lagomorpha (e. g., rabbits) or other
pet, farm or laboratory mammals.
The term "protection", as used herein, is intended to
include "prevention," "suppression" and "treatment."
"Prevention!!, strictly speaking, involves administration of
the pharmaceutical prior to the induction of the disease (or
other adverse clinical condition). "Suppression" involves
administration of the composition prior to the clinical
at~t~earance of the disease. "Treatment" involves
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
82
administration of the protective composition after the
at~pearance of the disease.
It will be understood that in human and veterinary
medicine, it is not always possible to distinguish between
"preventing" and "suppressing" since the ultimate inductive
event or events may be unknown, latent, or the patient is
not ascertained until well after the occurrence of the event
or events. Therefore, unless qualified, the term
"prevention" will be understood to refer to both prevention
in the strict sense, and to suppression.
The preventative or prophylactic use of a
pharmaceutical involves identifying subjects who are at
higher risk than the general population of contracting the
disease, and administering the pharmaceutical to them in
advance of the clinical appearance of the disease. The
effectiveness of such use is measured by comparing the
subsequent incidence or severity of the disease, or of
particular symptoms of the disease, in the treated subjects
against that in untreated subjects of the same high. risk
group.
While high risk factors vary from disease to disease,
in general, these include (1) prior occurrence of the
disease in one or more members of the same family, or, in
the case of a contagious disease, in individuals with whom
the subject has come into potentially contagious contact at
a time when the earlier victim was likely to be contagious,
(2) a prior occurrence of the disease in the subject, (3)
prior occurrence of a related disease, or a condition known
to increase the likelihood of the disease, in the subject;
(4) appearance of a suspicious level of a marker of the
disease, or a related disease or condition; (5) a subject
who is immunologically compromised, e.g., by radiation
treatment, HIV infection, drug use " etc., or (6) membership
in a particular group (e. g., a particular age, sex, race,
ethnic group, etc.) which has been epidemiologically
associated with that disease.
A prophylaxis or treatment may be curative, that is,
directed at the underlying cause of a disease, or
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
83
ameliorative, that is, directed at the symptoms of the
disease, especially those which reduce the quality of life.
It should also be understood that to be useful, the
protection provided need not be absolute, provided that it
is sufficient to carry clinical value. An agent which
provides protection to a lesser degree than do competitive
agents may still be of value if the other agents are
ineffective for a particular individual, if it can be used
in combination with other agents to enhance the level of
protection, or if it is safer than competitive agents. It is
desirable that there be a statistically significant (p=0.05
or less) improvement in the treated subject relative to an
appropriate untreated control, and it is desirable that this
improvement be at least 10~, more preferably at least 250,
still more preferably at least 500, even more preferably at
least 100%, in some indicia of the incidence or severity of
the disease or of at least one symptom of the disease.
At least one of the drugs of the present invention may
be administered, by any means that achieve their intended
purpose, to protect a subject against a disease or other
adverse condition. The form of administration may be
systemic or topical. For example, administration of such a
composition may be by various parenteral routes such as
subcutaneous, intravenous, intradermal, intramuscular,
intraperitoneal, intranasal, transdermal, or buccal routes.
Alternatively, or concurrently, administration may be by the
oral route. Parenteral administration can be by bolus
injection or by gradual perfusion over time.
A typical regimen comprises administration of an
effective amount of the drug, administered over a period
ranging from a single dose, to dosing over a period of
hours, days, weeks, months, or years.
It is understood that the suitable dosage of a drug of
the present invention will be dependent upon the age, sex,
health, and weight of the recipient, kind of concurrent
treatment, if any, frequency of treatment, and the nature of
the effect desired. However, the most preferred dosage can
be tailored to the individual subject, as is understood and
determinable by one of skill in the art, without undue
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
84
experimentation. This will typically involve adjustment of
a standard dose, e.g., reduction of the dose if the patient
has a low body weight.
Prior to use in humans, a drug will first be evaluated
for safety and efficacy in laboratory animals. In human
clinical studies, one would begin with a dose expected to be
safe in humans, based on the preclinical data for the drug
in question, and on customary doses for analogous drugs (if
any). If this dose is effective, the dosage may be
decreased, to determine the minimum effective dose, if
desired. If this dose is ineffective, it will be cautiously
increased, with the patients monitored for signs of side
effects. See, e.g., Berkow et al, eds., The Merck Manual,
15th edition, Merck and Co., Rahway, N.J., 1987; Goodman et
al., eds., Goodman and Gilman's The Pharmacological Dasis of
Therapeutics, 8th edition, Pergamon Press, Inc., Elmsford,
N.Y., (1990); Avery's Drug Treatment: Principles and
Practice of Clinical Ph~.rmacol~c~y anew Therapeutics, 3rd
edition, ADIS Press, LTD., Williams and Wilkins, Baltimore,
MD. (1987), Ebadi, Pharmacol~gy, Little, Brown and Co.,
Boston, (1985), which references and references cited
therein, are entirely incorporated herein by reference.
The total dose required for each treatment may be
administered by multiple doses or in a single dose. The
protein may be administered alone or in conjunction with
other therapeutics directed to the disease or directed to
other symptoms thereof.
The appropriate dosage form will depend on the disease,
the pharmaceutical, and the mode of administration;
possibilities include tablets, capsules, lozenges, dental
pastes, suppositories, inhalants, solutions, ointments and
parenteral depots. See, e.g., Berker, supra, Goodman,
supra, Avery, supra and Ebadi, supra, which are entirely
incorporated herein by reference, including all references
cited therein.
In the case of peptide drugs, the drug may be
administered in the form of an expression vector comprising
a nucleic acid encoding the peptide; such a vector, after
incorporation into the genetic complement of a cell of the
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
patient, directs synthesis of the peptide. Suitable vectors
include genetically engineered poxviruses (vaccinia),
adenoviruses, adeno-associated viruses, herpesviruses and
lentiviruses which are or have been rendered nonpathogenic.
5 In addition to at least one drug as described herein, a
pharmaceutical composition may contain suitable
pharmaceutically acceptable carriers, such as excipients,
carriers and/or auxiliaries which facilitate processing of
the active compounds into preparations which can be used
10 pharmaceutically. See, e.g., Berker, supra., Goodman, supra,
Avery, supra and Ebadi, supra, which are entirely
incorporated herein by reference, included all references
cited therein.
15 Assay Compositions and Methods
Target Organism
The invention contemplates that it may be appropriate
to ascertain or to mediate the biological activity of a
substance of this invention in a target organism.
20 The target organism may be a plant, animal, or
microorganism.
In the case of a plant, it may be an economic plant, in
which case the drug may be intended to increase the disease,
weather or pest resistance, alter the growth
25 characteristics, or otherwise improve the useful
characteristics or mute undesirable characteristics of the
plant. Or it may be a weed, in which case the drug may be
intended to kill or otherwise inhibit the growth of the
plant, or to alter its characteristics to convert it from a
30 weed to an economic plant. The plant may be a tree, shrub,
crop, grass, etc. The plant may be an algae (which are in
some cases also microorganisms), or a vascular plant,
especially gymnosperms (particularly conifers) and
angiosperms. Angiosperms may be monocots or dicots. The
35 plants of greatest interest are rice, wheat, corn, alfalfa,
soybeans, potatoes, peanuts, tomatoes, melons, apples,
pears, plums, pineapples, fir, spruce, pine, cedar, and oak.
If the target organism is a microorganism, it may be
algae, bacteria, fungi, or a virus (although the biological
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
86
activity of a virus must be determined in a virus-infected
cell). The microorganism may be human or other animal or
plant pathogen, or it may be nonpathogenic. It may be a
soil or water organism, or one which normally lives inside
other living things.
If the target organism is an animal, it may be a
vertebrate or a nonvertebrate animal. Nonvertebrate animals
are chiefly of interest when they act as pathogens or
parasites, and the drugs are intended to act as biocidic or
biostatic agents. Nonvertebrate animals of interest include
worms, mollusks, and arthropods.
The target organism may also be a vertebrate animal,
i.e., a mammal, bird, reptile, fish or amphibian. Among
mammals, the target animal preferably belongs to the order
Primate (humans, apes and monkeys), Artiodactyla (e. g.,
cows, pigs, sheep, goats, horses), Rodenta (e. g., mice,
rats) Lagomorpha (e. g., rabbits, hares), or Carnivore (e. g.,
cats, dogs). Among birds, the target animals are preferably
of the orders Anseriformes (e.g., ducks, geese, swans) or
Galliformes (e.g., quails, grouse, pheasants, turkeys and
chickens). Among fish, the target animal is preferably of
the order Clupeiformes (e. g., sardines, shad, anchovies,
whitefish, salmon) .
Target Tissues
The term "target tissue" refers to any whole animal,
physiological system, whole organ, part of organ,
miscellaneous tissue, cell, or cell component (e.g., the
cell membrane) of a target animal in which biological
activity may be measured.
Routinely in mammals one would choose to compare and
-contrast the biological impact on virtually any and all
tissues which express the subject receptor protein. The
main tissues to use are: brain, heart, lung, kidney, liver,
pancreas, skin, intestines, adipose, stomach, skeletal
muscle, adrenal glands, breast, prostate, vasculature,
retina, cornea, thyroid gland, parathyroid glands, thymus,
bone marrow, bone, etc.
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
87
Another classification would be by cell type: B cells,
T cells, macrophages, neutrophils, eosinophils, mast cells,
platelets, megakaryocytes, erythrocytes, bone marrow stomal
cells, fibroblasts, neurons, astrocytes, neuroglia,
microglia, epithelial cells (from any organ, e.g. skin,
breast, prostate, lung, intestines etc), cardiac muscle
cells, smooth muscle cells, striated muscle cells,
osteoblasts, osteocytes, chondroblasts, chondrocytes,
keratinocytes, melanocytes, etc.
Of course, in the case of a unicellular organism, there
is no distinction between the "target organism" and the
"target tissue".
Screening Assays
Assays intended to determine the binding or the
biological activity of a substance are called preliminary
screening assays.
Screening assays will typically be either in vitro
(cell-free) assays (for binding to an immobilized receptor)
or cell-based assays (for alterations in the phenotype of
the cell). They will not involve screening of whole
multicellular organisms, or isolated organs. The comments
on diagnostic biological assays apply mutatis mutandis to
screening cell-based assays.
In Vitro vs. In Vivo Assays
The term in uivo is descriptive of an event, such as
binding or enzymatic action, which occurs within a living
organism. The organism in question may, however, be
genetically modified. The term in vitro refers to an event
which occurs outside a living organism. Parts of an
organism (e.g., a membrane, or an isolated biochemical) are
used, together with artificial substrates and/or conditions.
For the purpose of the present invention, the term in vitro
excludes events occurring inside or on an intact cell,
whether of a unicellular or multicellular organism.
In vivo assays include both cell-based assays, and
organismic assays. The cell-based assays include both assays
on unicellular organisms, and assays on isolated cells or
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
88
cell cultures derived from multicellular organisms. The
cell cultures may be mixed, provided that they are not
organized into tissues or organs. The term organismic assay
refers to assays on whole multicellular organisms, and
assays on isolated organs or tissues of such organisms.,
In vitro Diagnostic Methods and Reactants
The in vitro assays of the present invention may be
applied to any suitable analyte-containing sample, and may
be qualitative or quantitative in nature.
,Sampl a
The sample will normally be a biological fluid, such as
blood, urine, lymph, semen, milk, or cerebrospinal fluid, or
'a fraction or derivative thereof, or a biological tissue, in
the form of, e.g., a tissue section or homogenate. However,
the sample conceivably could be (or derived from) a food or
beverage, a pharmaceutical or diagnostic composition, soil,
or surface or ground water. If a biological fluid or
tissue, it may be taken from a human or other mammal,
vertebrate or animal, or from a plant. The preferred sample
is blood, or a fraction or derivative thereof.
Binding and Reaction t~ssa~rs
The assay may be a binding assay, in which one step
involves the binding of a diagnostic reagent to the analyte,
or a reaction assay, which involves the reaction of a
reagent with the analyte. The reagents used in a binding
assay may be classified as to the nature of their
interaction with analyte: (1) analyte analogues, or (2)
analyte binding molecules (.AHM). They may be labeled or
insolubilized.
In a reaction assay, the assay may look for a direct
reaction between the analyte and a reagent which is reactive
with the analyte, or if the analyte is an enzyme or enzyme
inhibitor, for a reaction catalyzed or inhibited by the
analyte. The reagent may be a reactant, a catalyst, or an
inhibitor for the reaction.
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
89
An assay may involve a cascade of steps in which the
product of one step acts as the target for the next step.
These steps may be binding steps, reaction steps, or a
combination thereof.
,Signal Producing System (SPS)
In order to detect the presence, or measure the amount,
of an analyte, the assay must provide for a signal producing
system (SPS) in which there is a detectable difference in
the signal produced, depending on whether the analyte is
present or absent (or, in a quantitative assay, on the
amount of the analyte). The detectable signal may be one
which is visually detectable, or one detectable only with
instruments. Possible signals include production of colored
or luminescent products, alteration of the characteristics
(including amplitude or polarization) of absorption or
emission of radiation by an assay component or product, and
precipitation or agglutination of a component or product.
The term "signal" is intended to include the discontinuance
of an existing signal, or a change in the rate of change of
an observable parameter, rather than a change in its
absolute value. The signal may be monitored manually or
automatically.
In a reaction assay, the signal is often a product of
the reaction. In a binding assay, it is normally provided
by a label borne by a labeled reagent.
Labels
The component of the signal producing system which is
most intimately associated with the diagnostic reagent is
called the "label". A label may be, e.g., a radioisotope, a
fluorophore, an enzyme, a co-enzyme, an enzyme substrate, an
electron-dense compound, an agglutinable particle.
The radioactive isotope can be detected by such means
as the use of a gamma counter or a scintillation counter or
by autoradiography. Isotopes which are particularly useful
for the purpose of the present invention include 3H, 1~5I,
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
131I' ass, l4Cr' azp and Sap _ '-~sI is preferred for antibody
labeling.
The label may also be a fluorophore. When the
fluorescently labeled reagent is exposed to light of the
5 proper wave length, its presence can then be detected due to
fluorescence. Among the most commonly used fluorescent
labelling compounds are fluorescein.isothiocyanate,
rhodamine, -phycoerythrin, phycocyanin, allophycocyanin, o-
phthaldehyde and fluorescamine.
10 Alternatively, fluorescence-emitting metals such as
lzsEu, or others of the lanthanide series, may be
incorporated into a diagnostic reagent using such metal
chelating groups as diethylenetriaminepentaacetic acid
(DTPA)"of ethylenediamine-tetraacetic acid (EDTA).
15 The label may also be a chemiluminescent compound. The
presence of the chemiluminescently labeled reagent is then
determined by detecting the presence of luminescence that
arises during the course of a chemical reaction. Examples
a
of particularly useful chemiluminescent labeling compounds
~0 are luminol, isolumino, theromatic acridinium ester,
imidazole, acridinium salt and oxalate ester.
~'Lil~ewise, a bioluminescent compound may be used for
labeling. Bioluminescence is a type of chemiluminescence
found in biological systems in which. a catalytic protein
25 increases the efficiency of the chemiluminescent reaction.
The presence of a bioluminescent protein is determined. by
detecting the presence of luminescence. Important
bioluminescent compounds for purposes of labeling are
luciferin, luciferase and aequorin.
30 Enzyme labels, such as horseradish peroxidase and
alkaline phosphatase, are preferred. When an enzyme label
is used, the signal producing system must also include a
substrate for the enzyme. If the enzymatic reaction product
is not itself detectable, the SPS will include one or more
35 additional reactants so that a detectable product appears.
An enzyme analyte may act as its own label if an enzyme
inhibitor is used as a diagnostic reagent.
Binding Assay Formats
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
91
Binding assays may be divided into two basic types,
heterogeneous and homogeneous. In heterogeneous assays, the
interaction between the affinity molecule and the analyte
does not affect the label, hence, to determine the amount or
presence of analyte, bound label must be separated from free
label. In homogeneous assays, the interaction does affect
the activity of the label, and therefore analyte levels can
be deduced without the need for a separation step.
In one embodiment, the ABM is insolubilized by coupling
1~ it to a macromolecular support, and analyte in the sample is
allowed to compete with a known quantity of a labeled or
specifically labelable analyte analogue. The "analyte
analogue" is a molecule capable of competing with analyte
for binding to the ABM, and the term is intended to include
analyte itself. It may be labeled already, or it may be
labeled subsequently by specifically binding the label to a
moiety differentiating th,e analyte analogue from analyte.
The solid and liquid phases are separated, and the labeled
analyte analogue in one phase is quantified. The higher the
level of analyte analogue ,in the solid phase, i.e.,
sticking to the ABM, the lower the level of analyte in the
sample.
In a "sandwich assay", both an insolubili~ed ABM, and a
labeled ABM are employed. The analyte is captured by the
insolubili~ed ABM and is tagged by the labeled ABM, forming
a ternary complex. The reagents may be added to the sample
in either order, or simultaneously. The ABMs may be the
same or different. The amount of labeled ABM in the ternary
complex is directly proportional to the amount of analyte in
the sample.
The two embodiments described above are both
heterogeneous assays. However, homogeneous assays are
conceivable. The key is that the label be affected by
whether or not the complex is formed.
Conjugation Methods
A label may be conjugated, directly or indirectly
(e. g., through a labeled anti-ABM antibody), covalently
(e.g., with SPDP) or noncovalently, to the ABM, to produce a
diagnostic reagent. Similarly, the ABM may be conjugated to
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
92
a solid phase support to form a solid phase ("capture")
diagnostic reagent.
Suitable supports include glass, polystyrene,
polypropylene, polyethylene, dextran, nylon, amylases,
natural and modified celluloses, polyacrylamides, agaroses,
and magnetite. The nature of the carrier can be either
soluble to some extent or insoluble for the purposes of the
present invention.
The support material may have virtually any possible
structural configuration so long as the coupled molecule is
capable of binding to its target. Thus the support
configuration may be spherical, as in a bead, or
cylindrical, as in the inside surface of a test tube, or the
external surface of a rod. Alternatively, the surface may
be flat such as a sheet, test strip, etc.
~ioloaical Assays
A biological assay measures or detects a biological
response of a biological entity to a substance.
The biological entity may be a whole organism, an
isolated organ or tissue, freshly isolated cells, an
immortalized cell line, or a subcellular component (such as
a membrane; this term should not be construed as including
an isolated receptor). The entity may be, or may be derived
from, an organism which occurs in nature, or which is
modified in some way. Modifications may be genetic
(including radiation and chemical mutants, and genetic
engineering) or somatic (e. g., surgical, chemical, etc.).
In the case of a multicellular entity, the modifications may
affect some or all cells. The entity need not be the target
organism, or a derivative thereof, if there is a reasonable
correlation between bioassay activity in the assay entity
and biological activity in. the target organism.
The entity is placed in a particular environment, which
may be more or less natural. For example, a culture medium
may, but need not, contain serum or serum substitutes, and
it may, but need not, include a support matrix of some kind,
it may be still, or agitated. It may contain particular
biological or chemical agents, or have particular physical
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
93
parameters (e. g., temperature), that are intended to nourish
or challenge the biological entity.
There must also be a detectable biological marker for
the response. At the cellular level, the most common
markers are cell survival and proliferation, cell behavior
(clustering, motility), cell morphology (shape, color), and
biochemical activity (overall DNA synthesis, overall protein
synthesis, and specific metabolic activities, such as
utilization of particular nutrients, e.g., consumption of
oxygen, production of COZ, production of organic acids,
uptake or discharge of ions).
The direct signal produced by the biological marker may
be transformed by a signal producing system into a different
signal which is more observable, for example, a fluorescent
or colorimetric signal.
The entity, environment, marker and signal producing
system are chosen to achieve a clinically acceptable level
of sensitivity, specificity and accuracy.
In some cases, the goal will be to identify substances
which mediate the biological activity of a natural
biological entity, and the assay is carried out directly
with that entity. In other cases, the biological entity is
used simply as a model of some more complex (or otherwise
inconvenient to work with) biological entity. In that
event, the model biological entity is used because activity
in the model system is considered more predictive of
activity in the ultimate natural biological entity than is
simple binding activity in an in vitro system. The model
entity is used instead of the ultimate entity because the
former is more expensive or slower to work with, or because
ethical considerations forbid working with the ultimate
entity yet.
The model entity may be naturally occurring, if the
model entity usefully models the ultimate entity under some
conditions. Or it may be non-naturally occurring, with
modifications that increase its resemblance to the ultimate
entity.
Transgenic animals, such as transgenic mice, rats, and
rabbits, have been found useful as model systems.
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
94
In cell-based model assays, where the biological
activity is mediated by binding to a receptor (target
protein), the receptor may be functionally connected to a
signal (biological marker) producing system, which may be
endogenous or exogenous to the cell.
There are a number of techniques of doing this.
"hero-Hybrid" Systems
In these systems, the binding of a peptide to the
target protein results in a screenable or selectable
phenotypic change, without resort to fusing the target
pr~tein (or a ligand binding moiety thereof) to an
endogenous protein. It may be that the target protein is
endogenous to the host cell, or is substantially identical
to an endogenous receptor so that it can take advantage of
the letter's native signal transduction pathway. Or
sufficient elements of the signal transduction pathway
normally associated with the target protein may be
engineered into the cell so that the cell signals binding to
~0 the target protein.
"One-Hybrid" Systems
In these systems, a chimera receptor, a. hybrid of the
target protein and an endogenous receptor, is used. The
chimeric receptor has the ligand binding characteristics of
the target protein and the signal transduction
characteristics of the endogenous receptor. Thus, the
normal signal transduction pathway of the endogenous
receptor is subverted.
Preferably, the endogenous receptor is inactivated, or
the conditions of the assay avoid activation of the
endogenous receptor, to improve the signal-to-noise ratio.
See Fowlkes USP 5,789,184 for a yeast system.
Another type of "one-hybrid" system combines a peptide:
DNA-binding domain fusion with an unfused target receptor
that possesses an activation domain.
"Two-Hybrid" System
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
In a preferred embodiment, the cell-based assay is a
two hybrid system. This term implies that the ligand is
incorporated into a first hybrid protein, and the receptor
into a second hybrid protein. The first hybrid also
5 comprises component A of a signal generating system, and the
second hybrid comprises component B of that system.
Components A and B, by themselves, are insufficient to
generate a signal. However, if the ligand binds the
receptor, components A and B are brought into sufficiently
10 close proximity so that they can cooperate to generate a
signal.
Components A and B may naturally occur, or be
substantially identical to moieties which naturally occur,
as components of a single naturally occurring biomolecule,
15 or they may naturally occur, or be substantially identical
to moieties which naturally occur, as separate naturally
occurring biomolecules which interact in nature.
Two-Hybrid System: Transcription Factor Type
20 In a preferred "two-hybrid" embodiment, one member of a
peptide ligand:receptor binding pair is expressed as a
fusion to a DNA-binding domain (DBD) from a transcription
factor (this fusion protein is called the "bait"), and the
other is expressed as a fusion to a transactivation domain
25 (TAD) (this fusion protein is called the "fish", the "prey",
or the "catch"). The transactivation domain should be
complementary to the DNA-binding domain, i.e., it should
interact with the latter so as to activate transcription of
a specially designed reporter gene that carries a binding
30 site for the DNA-binding domain. Naturally, the two fusion
proteins must likewise be complementary.
This complementarity may be achieved by use of the
complementary and separable DNA-binding and transcriptional
activator domains of a single transcriptional activator
35 protein, or one may use complementary domains derived from
different proteins. The domains may be identical to the
native domains, or mutants thereof. The assay members may
be fused directly to the DBD or TAD, or fused through an
intermediated linker.
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
- 96
The target DNA operator may be the native operator
sequence, or a mutant operator. Mutations in the operator
may be coordinated with mutations in the DBD and the TAD.
An example of a suitable transcription activation system is
one comprising the DNA-binding domain from the bacterial
repressor LexA and the activation domain from the yeast
transcription factor Gal4, with the reporter gene operably
linked to the LexA operator.
It is not necessary to employ the intact target
receptor; just the ligand-binding moiety is sufficient.
The two fusion proteins may be expressed from the same!
or different vectors. Likewise, the activatable reporter
gene may be expressed from the same vector as either fusion
protein (or both proteins), or from a third vector.
Potential DNA-binding domains include Gal4, LexA, and
mutant domains substantially identical to the above.
Potential activation domains include E. coli 842, Gal4
activation domain II, and HSV VP16, and mutant domains
substantially identical to the above.
Potential operators include the native operators for
the desired activation domain, and mutant domains
substantially identical to the native operator.
The fusion proteins may comprise nuclear localization
signals.
The assay system will include a signal producing
system, too. The first element of this system is a reporter
gene operably linked to an operator responsive to the DBD
and TAD of choice. The expression of this reporter gene
will result, directly or indirectly, in a selectable or
screenable phenotype (the signal). The signal producing
system may include, besides the reporter gene, additional
genetic or biochemical elements which cooperate in the
production of the signal. Such an element could be, for
example, a selective agent in the cell growth medium. There
may be more than one signal producing system, and the system
may include more than one reporter gene.
The sensitivity of the system may be adjusted by, e.g.,
use of competitive inhibitors of any step in the activation
or signal production process, increasing or decreasing the
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
97
number of operators, using a stronger or weaker DBD or TAD,
etc.
When the signal is the death or survival of the cell in
question, or proliferation or nonproliferation of the cell
in question, the assay is said to be a selection. When the
signal merely results in a detectable phenotype by which the
signaling cell may be differentiated from the same cell in a
nonsignaling state (either way being a living cell), the
assay is a screen. However, the term "screening assay" may
be used in a broader sense to include a selection. When the
narrower sense is intended, we will use the term
"nonselective screen".
Various screening and selection systems are discussed
in Ladner, USP 5,198,346.
Screening and selection may be for or against the
peptide: target protein or compound: target protein
interaction.
Preferred assay cells are microbial (bacterial, yeast,
algal, proto~ooal), invertebrate, vertebrate (esp.
mammalian, particularly human). The best developed two-
hybrid assays are yeast and mammalian systems.
Normally, two hybrid assays are used to determine
whether a protein X and a protein Y interact, by virtue of
their ability to reconstitute the interaction of the DBD and
the TAD. However, augmented two-hybrid assays have been
used to detect interactions that depend on a third, non-
protein ligand.
For more guidance on two-hybrid assays, see Brent and
Finley, Jr., Ann. Rev. Genet., 31:663-704 (1997); Fremont
Ravine, et al., Nature Genetics, 277-281 (16 July 1997);
Allen, et al., TIBS, 511-16 (Dec. 1995); LeCrenier, et al.,
BioEssays, 20:1-6 (1998); Xu, et al., Proc. Nat. Acad. sci.
(USA), 94:12473-8 (Nov. 1992); Esotak, et al., Mol. Cell.
Biol., 15:5820-9 (1995); Yang, et al., Nucleic Acids Res.,
23:1152-6 (1995); Bendixen, et al., Nucleic Avids Res.,
22:1778-9 (1994); Fuller, et al., BioTechniques, 25:85-92
(July 1998); Cohen, et al., PNAS (USA) 95:14272-7 (1998);
Kolonin and Finley, Jr., PNAS (USA) 95:14266-71 (1998). See
also Vasavada, et al., PNAS (USA), 88:10686-90 (1991)
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
98
(contingent replication assay), and Rehrauer, et al., J.
Biol. Chem., 271:23865-73 91996) (LexA repressor cleavage
assay) .
Two-Hybrid Systems: reporter Enzyme type
In another embodiment, the components A and B
reconstitute an enzyme which is not a transcription factor.
As in the last example, the effect of the
reconstitution of the enzyme is a phenotypic change which
may be a screenable change, a selectable change, or both.
In vivo Diagnostic Uses
Radio-labeled ABM may be administered to the human or
animal subject. Administration is typically by injection,
e.g., intravenous or arterial or other means of
administration in a quantity sufficient to permit subsequent
dynamic and/or static imaging using suitable radio-detecting
devices. The dosage is the smallest amount capable of
providing a diagnostically effective image, and may be
determined by means conventional in the art, using known
radio-imaging agents as a guide.
Typically, the imaging is carried out on the whole body
of the subject, or on that portion of the body or organ
relevant to the condition or disease under study. The
amount of radio-labeled ABM accumulated at a given point in
time in relevant target organs can then be quantified.
A particularly suitable radio-detecting device is a
scintillation camera, such as a gamma camera. A
scintillation camera is a stationary device that can be used
to image distribution of radio-labeled ABM. The detection
device in the camera senses the radioactive decay, the
distribution of which can be recorded. Data produced by the
imaging system can be digitized. The digitized information
can be analyzed over time discontinuously or continuously.
The digitized data can be processed to produce images,
called frames, of the pattern of. uptake of the radio-
labelled ABM in the target organ at a discrete point in
time. In most continuous (dynamic) studies, quantitative
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
99
data is obtained by observing changes in distributions of
radioactive decay in target organs over time. In other
words, a time-activity analysis of the data will illustrate
uptake through clearance of the radio-labeled binding
protein by the target organs with time.
Various factors should be taken into consideration in
selecting an appropriate radioisotope. The radioisotope
must be selected with a view to obtaining good quality
resolution upon imaging, should be safe for diagnostic use
in humans and animals, and should preferably have a short
physical half-life so as to decrease the amount of radiation
received by the body. The radioisotope used should
preferably be pharmacologically inert, and, in the
quantities administered, should not have any substantial
physiological effect.
The ABM may be radio-labeled with different isotopes of
iodine, for example 1231, lzsl s or 1311 (see for example, LT. S .
Patent 4,609,725). The extent of radio-labeling must,
however be monitored, since it will affect the calculations
~0 made based on the imaging results (i.e. a diiodinated ABM
will result in twice the radiation count of a similar
monoiodinated ABM over the same time frame).
In applications to human subjects, it may be desirable
to use radioisotopes other than lzSl for labeling in order to
decrease the total dosimetry exposure of the human body and
to optimize the detectability of the labeled molecule
(though this radioisotope can be used if circumstances
require). Ready availability for clinical use is also a
factor. Accordingly, for human applications, preferred
radio-labels are for example, 99'"Tc, 6'Ga, 68Ga, 9°y, 111In,
msmln~ izal ~ iesRe ~ iaaRe or 2iiAt .
The radio-labelled ABM may be prepared by various
methods. These include radio-halogenation by the chloramine
- T method or the lactoperoxidase method and subsequent
purification by HPLC (high pressure liquid chromatography),
for example as described by J. Gutkowska et al in
"Endocrinology and Metabolism Clinics of America: (1987) 16
(1):183. Other known methods of radio-labeling can be used,
such as IODOBEADST"' .
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
100
There are a number of different methods of delivering
the radio-labeled ABM to the end-user. It may be
administered by any means that enables the active agent to
reach the agent's site of action in the body of a mammal.
Because proteins are subject to being digested when
administered orally, parenteral administration, i.e.,
intravenous, subcutaneous, intramuscular, would ordinarily
be used to optimise absorption of an ABM, such as an
antibody, which is a protein.
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
EXAMPLES
101
By disrupting the GHR/BP gene we are able to
investigate the role GH signaling plays in a variety of
disease states and in various stages of growth, development
and aging. The lack of GH signaling in these mice produces
a phenotype which is dwarf, long-lived, insulin sensitive,
protected from type 1 diabetic kidney damage and resistant
to high-fat diet induced hyperglycemia.
Another model of altered GH signaling, the dwarf GHA
mouse, does not have an altered lifespan but does show
protection from diabetic-induced kidney damage and
resistance to diet-induced hyperglycemia (List et al., 2001;
Coschigano et al., 2002;,Coschigano et al., 2003).
Conversely, overexpression of bGH in mice significantly
shortens lifespan (Doi et al., 1985).
The objective of this study was to examine gene
expression differences between livers of GHR/BP -/- and +/+
mice in an attempt to account for some of the physiological
changes and to identify cDNAs that are regulated by GH
signaling.
A~.ix~al M~del.s ~,nd Meth~d,s
~nia~s.l. tai~de7.~ 60 day old male growth hormone
receptor/binding protein gene disrupted (GHR-BP -/-) mice
and their respective controls in a BalbC/129 Ola genetic
background were sacrificed and total liver RNA was isolated.
Table A. Summary of physiological alterations of GHR/BP -/-
mice.
Physiological Parameter % of +/+
Body Weight 52%
Body Length 76%
3 Liver Weight 42%
5
Plasma GH Levels 1000%
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
102
Plasma IGF-1 Levels 20%
Blood Glucose 75%
Plasma Insulin 25%
Insulin Sensitivity Increased
Glucose Tolerance Impaired
Food Consumption 52%
Food Consumption (normalized to
body 137%
weight)
Lifespan 126-140% ~
~= varies with genetic background
RNA isolation For identification of differentially
expressed genes, total RNA was isolated from the livers of
60 day old male GHR/BP -/- mice and +/+ controls using the
RNA STAT-60 Total RNA/mRNA Isolation Reagent according to
the manufacturer's instructions (Tel-Test, Friendswood, TX).
For further characterization of the identified genes,
expression in mice of other ages, in female mice, in other
tissues, and in other mouse models, was considered as
described below.
cDNA synthesis for subtraction library Prior to cDNA
synthesis, a portion (50 fag) of RNA was further purified to
remove small RNAs using the RNeasy Mini protocol for RNA
clean up as instructed-by the manufacturer (Qiagen Inc.,
Santa Clarita, CA). The cDNA was synthesised using 1 ia.g of
total RNA from GHR/BP -/- and wildtype control mice using
the SMART PCR cDNA Synthesis Kit according to the
manufacturer's instructions (CLONTECH, Palo Alto, CA).
Generation of cDNA subtraction libraries Forward- and
reverse-subtracted cDNA libraries were generated using the
PCR-Select cDNA Subtraction Kit (CLONTECH, Palo Alto, CA)
and the L-9, H-34 and H43 samples. The forward library (4)
was of clones up-regulated in -/- mice compared to control
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
103
mice, The reverse library (5) was of clones down-regulated
in -/- mice compared to control mice.
Isolation of individual clones After generating the cDNA
subtraction libraries, the PCR product ends were made blunt
by treatment with Pfu DNA polymerase (Stratagene, La Jolla,
CA) and subCloned into a bacterial plasmid vector using the
Zero Blunt TOPO PCR Cloning Kit as instructed by the
manufacturer (Invitrogen Corp., Carlsbad, CA). Individual
clones were obtained by plating on selective media.
Screening by differential hybridization CDNA arrays of
clones from the forward and reverse subtracted libraries
were screened with probes made from each. library using the
PCR-Select Differential Screening Kit according to the
manufacturer's instructions (CLONTECH, Palo Alto, CA).
Individual clones from each library were spotted in
duplicate on each of two separate nylon membranes and
hybridized with random-primed 32P-labeled probes generated
from each library pool using the Clontech PCR-Select
Differential Screening kit. Potential differentially
expressed clones were selected based on difference in signal
between the two blots upon exposure to autoradiography film.
1~3'ucleotide sec~a.ence determination Plasmid DNA from
bacterial colonies carrying the differentially expressed
CDNA inserts was isolated using the QIAprep Spin Miniprep
Kit according to the manufacturer's instructions (Qiagen
Inc., Santa Clarita, CA). Nucleotide sequences were
determined by use of the ABI PRISM BigDye Terminator Cycle
Sequencing Ready Reaction Kit with electrophoresis on the
ABI PRISM 377 DNA Sequencer (PE Applied Biosystems, Foster
City, CA.). Nucleotide sequences and predicted amino acid
sequences were compared to public domain databases using the
Blast 2.0 program (National Center for Biotechnology
Information, National Institutes of Health).
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
104
Northern analysis Positive clones, identified by the
differential hybridization screen, were used as probes in
Northern hybridization analyses to confirm their
differential expression. Total RNA (5-15 ug) isolated from
GHR/BP -/- orwild-type control mice was resolved by agarose
gel electrophoresis through a to agarose, 1 % formaldehyde
denaturing gel, transferred to positively charged nylon
membrane, and hybridized to a probe labeled with [32P] dCTP
that was generated from the cDNA insert using the Random
Primed DNA Labeling Kit (Roche, Palo Alto, CA), or to an
asymmetric PCR amplified, digoxigenin (DIG) labeled probe
synthesized from each clone of interest. In the latter
case, blots were hybridized in DIG EasyHybe (Roche) and
detection was performed following the manufacturer's
guidelines (The DIG System User's Guide for Filter
Hybridization, Roche).
Database Searches Nucleotide sequences and predicted amino
acid sequences were compared to public domain databases
using the Blast 2.0 program (National Center for
Biotechnology Information, National Institutes of Health).
Nucleotide sequences were displayed using ABI prism Edit
View 1Ø1 (PE Applied Biosystems, Foster City, CA) or
Vector NT 6.0 (Informax) .
Nucleotide database searches were conducted with the
then current version of BLASTN 2Ø12, see Altschul, et al.,
"Gapped BLAST and PSI-BLAST: a new generation of protein
database search programs", Nucleic Acids Res., 25:3389-3402
(1997). Searches employed the default parameters, unless
otherwise stated.
For blastN searches, the default was the blastN matrix
(1,-3), with gap penalties of 5 for existence and 2 for
extension.
Protein database searches were conducted with the then-
current version of BLAST X., see Altschul et al. (1997),
supra. Searches employed the default parameters, unless
otherwise stated. The scoring matrix was BLOSUM62, with gap
costs of 11 for existence and 1 for extension. The standard
low complexity filter was used.
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
105
"ref" indicates that NCBI's RefSeq is the source
database. The identifier that follows is a RefSeq accession
number, not a GenBank accession number. "RefSeq sequences
are derived from GenBank and provide non-redundant curated
data representing our current knowledge of known genes. Some
records include additional sequence information that was
never submitted to an archival database but is available in
the literature. A small number of sequences are provided
through collaboration; the underlying primary sequence data
is available in GenBank, but may not be available in any one
GenBank record. RefSeq sequences are not submitted primary
sequences. RefSeq records are owned by NCBI and therefore
can be updated as needed to maintain current annotation or
to incorporate additional sequence information." See also
htt_p~//www ncbi nlm nih aov/LocusLink/refsea.html
It will be appreciated by those in the art that the
exact results of a database search will change from day to
day, as new sequences are added. Also, if you query with a
longer version of the original sequence, the results will
change. The results given here were obtained at one time
and no guarantee is made that the exact same hits would be
obtained in a search on the filing date. However, if an
alignment between a particular query sequence and a
particular database sequence is discussed, that alignment
should not change (if the parameters and sequences remain
unchanged) .
Construction and Synthesis of eDNA Libraries for Isolation
of Longer cDNAs Using Differentially Expressed Partial cDNAs
as Probes. RNA was isolated from the liver of a 60 day old
male GHR/BP homozygous knockout (-/-) animal using the RNA
Stat-60 reagent and protocol (Tel-Test, Friendswood, TX).
mRNA was isolated from the RNA sample using the Poly (A) Pure'j'r''
kit and protocol from Ambion (Austin, TX). cDNA synthesis
was performed as per the manufacturer's protocol using ZAP
Express cDNA Synthesis Kit (Stratagene, La Jolla, CA). The
cDNA library was screened using previously isolated partial
fragments obtained from the PCR-Select cDNA Subtraction Kit
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
106
(Clontech, Palo Alto, CA) and labeled with DIG using
asymmetric PCR as described for Northern blot analysis.
Rapid Amplification. of cDNA Ends (RACE). 5' Rapid
Amplification of cDNA Ends (RACE) was performed with the
following primers in pursuit of the full-length clones for
5-9 and 5-61. RNA for the RACE reactions was isolated from ._
a 60 day old GHR/BP homozygous knockout male mouse using the
RNA Stat-60 reagent and protocol (Tel-Test, Friendswood,
TX). RACE was performed as per protocol using the 5'/3'
RACE Kit, 2nd Generation (Roche Applied Science, Penzberg,
Germany). Annealing temperatures used for the 5-9 primers
were 55 degrees Celsius and for the 5-61 primers were 65
degrees Celsius.
Primer Sequence SEQ ID NO:
5-9 SP1 GCTCTTTTCCTCTCACGGTAA
5-9 SP2 GGCTGCAAATGGTTCTGTAA ~3
5-9 SP3 ACAGCCAGTAATGGACTCTTC 24
5-61 SP1 AGCTGTTCAGGGCATTTTCC
5-61 SP2 TCAGCAAATGTCCACCAGTGCACA
5-61 SP3 GGAGTGAAGGCCATGACAGAGT
Derivation of ~lon~ a-43~ 5-61 and 5-9 defences
CI~ne .5-4.3. The sequence for Clone 5-43 was derived
entirely from the clone obtained from the cDNA library. The
full-length clone 5-43 was obtained by screening the cDNA
library using a partial fragment corresponding to
nucleotides 481 through 1068.
Clone 5-6Z. The sequence for Clone 5-61 was derived
from a cDNA clone followed by 5' RACE. The cDNA clone was
obtained by screening a cDNA library using a partial
fragment corresponding to nucleotides 838 through 1377 that
was previously isolated from a cDNA subtraction library.
Clone .5-9. The sequence for Clone 5-9 was derived from
a partial cDNA clone followed by 5'RACE. The partial cDNA
clone was obtained by differential hybridization of two cDNA
subtraction libraries as described in the Methods section.
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
107
Results
Of 192 total clones screened, ten clones appear to be
differentially expressed, of which three are novel. The
latter show increased expression in the livers of GHR/BP
mice. Each of these clones appears to be regulated in a
unique fashion, thus they represent diverse gene regulation
events that occur as a consequence of disrupted GH
signaling.
Additi~nal Analysis of C1~nes 5-43~ 5-9 and 5-61
Expression in Alternatiire Mouse Models
Using northern analysis, we compared the expression
profiles of these clones in livers isolated from two
additional mouse models of altered GH action. One line
expressed the bovine GH (bGH) transgene, resulting in a
giant phenotype. The other expressed a bGH antagonist (GHA)
transgene, resulting in a dwarf phenotype. Northern analysis
was also performed on multiple tissues of GHR/BP -/- mice
and livers of GHR/BP -/- mice at various ages.
Total RNA was isolated from the livers of 60 day old
mice; two male GHR/BP -/-, two female GHR/BP -/- , two male
GHA, two male bGH mice and their respective controls.
Hybridization was with each respective clone as probe.
Clone 5-43 mRNA expression is evident in all liver samples
tested and is elevated in the GHR/BP -/- male mice. A
smaller transcript for clone 5-9 appears in all livers
tested while a second, larger transcript appears only in the
GHR/BP -/- mice. mRNA expression of clone 5-61 was only
detected in GHR/BP -/- mice (both male and female).
Expression in Other Tissues
Total RNA was isolated from 60 day old male liver,
kidney, muscle, heart, lung, spleen, brain, white adipose
tissue (WAT), testis, intestine, stomach, and pancreas
tissues. Clone 5-43 mRNA expression was detected at highest
levels in liver, lung, WAT, intestine and stomach of both
GHR/BP +/+ and -/- mice. Expression of the smaller
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
108
transcript of clone 5-9 mRNA is seen only in the livers of
GHR/BP +/+ and -/- mice whereas the larger transcript is
expressed in the liver, kidney and WAT of GHR/BP -/- mice.
mRNA expression of clone 5-61 was limited to tissues of
GHR/BP -/- mice with greatest expression detected in liver,
kidney and WAT.
Ex~aression a.s a function of age
Total RNA was isolated from livers of 2, 5, 12 and 24
month old female GHR/BP -/- and +/+ mice. Liver RNA was
also isolated from these mice toward the end of their
lifespan: 30 months for GHR/BP +/+ and 36 months for -/-
mice. Hybridization was with each respective clone as
probe. Clone 5-43 mRNA expression was detected in all
samples of both GHR/BP +/+ and -/- mice. The smaller
transcript for clone 5-9 mRNA was expressed in all samples
of both GHR/BP +/+ and -/- mice while expression of the
larger transcript was only apparent in the GHR/BP -/- mice.
mRNA expression of clone 5-61 was detected throughout the
lifespan of GHR/BP -/- mice and was not detected at any time
point in +/+ mice. No significant age-dependent regulation
of expression was evident for any of these clones.
C~nclusi~n
Thus, Clone 5-43 mRNA is expressed in the liver of all
three mouse models tested, in all tissues tested, as well as
all non-transgenic controls. Highest expression was seen in
the liver, kidney, intestine and brain. Clone 5-43 mRNA
appears to be up-regulated in the livers of GHR/BP -/- males
compared to controls. This up-regulation was not observed in
GHR/BP -/- females.
Also, Clone 5-9 mRNA expression was seen in the liver
of all three mouse models tested as well as all controls. A
second larger transcript was detected in the GHR/BP -/-
liver but was not present in other mouse models or controls.
This larger transcript was also seen in kidney and white
adipose tissue (WAT) of GHR/BP -/- mice but not controls.
Interestingly, the smaller transcript was not detected in
the kidney or WAT of the GHR/BP -/- mice.
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
109
The mRNA for our third clone, 5-61, was only detected
in GHR/BP -/- males and females. Clone 5-61 mRNA appears to
be expressed in the liver, kidney and WAT of GHR/BP -/-
mice. In summary, these clones represent a diversity of gene
regulation events that may be responsible for the
physiological alterations that occur when the GHR/BP gene is
disrupted.
In conclusion, we have identified three clones whose
mRNA expression is differentially regulated in GHR/BP -/
mice. Clone 5-43 mRNA expression appears to be up
regulated in male GHR/BP -/- mice but is detected in every
mouse model tested. The larger transcript for clone 5-9 is
only present in the GHR/BP -/- mice. Similarly, clone 5-61
mRNA is only detected in GHR/BP -/- mice. Clone 5-43 mRNA,
the larger transcript for 5-9, and 5-61 mRNA all appear to
be expressed at relatively high levels in the liver, kidney
and WAT of GHR/BP -/- mice, all significant organs of
glucose metabolism and/or action.
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
110
References Cited by Reference Number:
1. Semsei I. (2000) On the nature of aging. Mech Aging
Dev 117:93-108.
2. Sohal, RS, Weindruch, R. (1998) Oxidative stress,
caloric restriction, and aging. Science 273:59-63.
3. Finch, CE, Revkun, G. (2001) The genetics of aging.
Annu. Rev. Genom. Hum. Genet. 2:435-462.
4. Roth, GS, Lasnikov, V, Lesnikov, M, Ingram, DK, Land,
MA (2001) Dietary caloric restriction prevents the age-
related decline in plasma melatonin levels of rhesus
monkeys. J Clin Endocrinol Metab. 86:3.292-5.
5. Roth GS, Lane MA, Ingram DK, Mattison JA, Elahi D,
Tobin JD, Muller D, Metter EJ (2002) Biomarkers of caloric
restriction may predict longevity in humans. Science.
297:811-813.
6. Walford RL, Mock D, Verdery R, MacCallum T. (2002)
Calorie restriction in biosphere 2: alterations in
physiologic, hematologic, hormonal, and biochemical
parameters in humans restricted for a 2-year period. J
Gerontol A Biol Sci Med Sci 57:211-24.
7. Kenyon C, Chang J, Gensch E, Rudner A, Tabtiang R.
(1993) A C. elegans mutant that lives twice as long as wild
type. Nature 366:461-464.
8. Lin, K, Dorman, JB, Rodan, A, Kenyon, C. (1997). daf-
16: an HNF-3/Forkhead family member that can function to
double the life-span of Caenorhabditis elegans. Science 278,
1319-1322.
9. Clancy DJ, Gems D, Harshman LG, Oldham S, Stocker H,
Hafen E, Leevers SJ, Partridge L. (2001) Extension of life-
span by loss of CHICO, a Drosophila insulin receptor
substrate protein. Science 292:104-106.
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
111
10. Tatar, M, Bartke, A, Antebi. (2003) The endocrine
regulation of aging by insulin-like signals. Science
299:1346-1351.
11. Tran H, Brunet A, Grenier JM, Datta SR, Furnace AJ Jr,
DiStefano PS, Chiang LW, Greenberg ME. (2002) DNA repair
pathway stimulated by the forkhead transcription factor
FOX.O3a through the Gadd45 protein. Science 296:530-534.
12. Ramaswamy S, Nakamura N, Sansal I, Bergeron L, Sellers
WR. (2002) A novel mechanism of gene regulation and tumor
suppression by the transcription factor FKHR. Cancer Cell
2002 2:81-91.
13. Hekimi, S, Guarente, L. (2003) Genetics and the
specificity of the aging process. Science 299:1351-1354.
14. Brown-Burg, HM, Burg, KE, Melisl~a, CJ, Bartke, A.
(1996) Dwarf mice and the aging process. Nature 384:33.
15. Flurkey K, Papaconstantinou J, Miller RA, Harrison DE.
(2001) Lifespan extension and delayed immune and collagen
aging in mutant mice with defects in growth hormone
production. Proc Natl Acad Sci USA 98:6736-6741.
16. Zhou, Y, Xu, BC, Maheshwari, HG, He, L, Reed, M,
Lozykowski, M, Okada, S, Cataldo, L, Coschigano, K, Wagner,
TE, Baumann, G, Kopchick, JJ. (1997) A mammalian model for
Laron syndrome produced by targeted disruption of the mouse
growth hormone receptor/binding protein gene (the Laron
mouse). Proc. Nat. Acad. Sci. USA 94:13215-13220.
17. Coschigano, K, Clemmons, D, Bellush, LL, Kopchick, JJ.
(2000) Assessment of growth parameters and life-span of
GHR/BP gene-disrupted mice. Endocrinology 141:2608-2613.
17a. Coschigano, KT, Holland, AN, Riders, ME, List, EO,
Flyvberg, A, Kopchick, JJ, Deletion, but not antagonism, of
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
112
the mouse growth hormone receptor results in severely
decreased body weights, insulin and IGF-1 levels and
increased lifespan, Endocrinology (electronically published
May 30, 2003 as doi:10.1210/en.2003-0374).
18. Holzenberger M, Dupont J, Ducos B, Leneuve P, Geloen A,
Even PC, Cervera P, Le Bouc Y. (2003) IGF-1 receptor
regulates lifespan and resistance to oxidative stress in
mice. Nature 421:182-187.
19. Migliaccio E, Giorgio M, Mele S, Pelicci G, Reboldi P,
Pandolfi PP, Lanfrancone L, Pelicci PG. (1999) The p66shc
adaptor protein controls oxidative stress response and life
span in mammals. Nature 402:309-313.
20. Bartke A, Wright JC, Mattison JA, Ingram DK, Miller RA,
Roth GS. (2001) Extending the lifespan of long-lived mice.
Nature 414:412.
21. Weindruch R, Kayo T, Lee CK, Prolla TA. (2002) Gene
expression profiling of aging using DNA microarrays. Mech
Aging Dev 123:177-193.
22. Lee CK, Allison DB, Brand J, Weindruch R, Prolla TA.
(2002) Transcriptional profiles associated with aging and
middle age-onset caloric restriction in mouse hearts. Proc
Natl Acad Sci USA 99:14988-14993.
23. Prolla TA. (2002) DNA microarray analysis of the aging
brain. Chem Senses 27299-306.
Additional References
Coschigano KT, Riders ME, Holland AN, Kopchick JJ 2002
Altered growth hormone signaling in two lines of dwarf mice
results in diet-induced obesity and hyperinsulinemia but not
diabetes. 84t'' Annual Endocrine Society Meeting, San
Francisco, CA, p. 561 (abstract P3-302)
Doi T, Striker LJ, Quaife C, Conti FG, Palmiter R, Behringer
R, Brinster R, Striker GE 1988 Progressive
glomerulosclerosis develops in transgenic mice chronically
expressing growth hormone and growth hormone releasing
factor but not in those expressing insulin like growth
factor-1. Am J Pathol 131:398-403
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
113
List E, Coschigano KT, Kopchick JJ 2001 Growth Hormone
Receptor/Binding Protein (GHR/BP) Knockout Mice: A 3-Year
Update. Mol Genet Metab 73(1):1-10
Citation of documents herein is not intended as an admission
that any of the documents cited herein is pertinent prior
art, or an admission that the cited documents is considered
material to the patentability of any of the claims of the
present application. All statements as to the date or
representation as to the contents of these documents is
based on the information available to the applicant and does
not constitute any admission as to the correctness of the
dates or contents of these documents.
The appended claims are to be treated as a non-limiting
recitation of preferred embodiments.
In addition to those set forth elsewhere, the following
references are .hereby incorporated by reference, in their
most recent editions as of the time of filing of this
application: .FCay, Phage Display of Peptides and Proteins: A
Laboratory Manual; the John Wiley and Sons Current Protocols
series, including Ausubel, Current Protocols in Molecular
Biology; Coligan, Current Protocols in Protein Science;
Coligan, Current Protocols in Immunology; Current Protocols
in Human Genetics; Current Protocols in Cytometry; Current
Protocols in Pharmacology; Current Protocols in
Neuroscience; Current Protocols in Cell Biology; Current
Protocols in Toxicology; Current Protocols in Field
Analytical Chemistry; Current Protocols in Nucleic Acid
Chemistry; and Current Protocols in Human Genetics; and
the following Cold Spring Harbor Laboratory publications:
Sambrook, Molecular Cloning: A Laboratory Manual; Harlow,
Antibodies: A Laboratory Manual; Manipulating the Mouse
Embryo: A Laboratory Manual; Methods in Yeast Genetics: A
Cold Spring Harbor Laboratory Course Manual; Drosophila
Protocols; Imaging Neurons: A Laboratory Manual; Early
Development of Xenopus laevis: A Laboratory Manual; Using
Antibodies: A Laboratory Manual; At the Bench: A Laboratory
Navigator; Cells: A Laboratory Manual; Methods in Yeast
Genetics: A Laboratory Course Manual; Discovering Neurons:
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
114
The Experimental Basis of Neuroscience; Genome Analysis: A
Laboratory Manual Series ; Laboratory DNA Science;
Strategies for Protein Purification and Characterisation: A
Laboratory Course Manual; Genetic Analysis of Pathogenic
Bacteria: A Laboratory Manual; PCR Primer: A Laboratory
Manual; Methods in Plant Molecular Biology: A Laboratory
Course Manual ; Manipulating the Mouse Embryo: A Laboratory
Manual; Molecular Probes of the Nervous System; Experiments
with Fission Yeast: A Laboratory Course Manual; A Short
Course in Bacterial Genetics: A Laboratory Manual and
Handbook for Escherichia coli and Related Bacteria; DNA
Science: A First Course in Recombinant DNA Technology;
Methods in Yeast Genetics: A Laboratory Course Manual;
Molecular Biology of Plants: A Laboratory Course Manual.
A11 references cited herein, including journal articles
or abstracts, published, corresponding, prior or otherwise
related IL S. or foreign patent applications, issued U.S. or
.foreign patents, or any other references, are entirely
incorporated by reference herein, including all data,
tables, figures, and text presented in the cited references.
Additionally, the entire contents of the references cited
within the references cited herein are also entirely
incorporated by reference.
Reference to known method steps, conventional methods
steps, known methods or conventional methods is not in any
way an admission that any aspect, description or embodiment
of the present invention is disclosed, taught or suggested
in the relevant art.
The foregoing description of the specific embodiments
will so fully reveal the general nature of the invention
that others can, by applying knowledge wi thin the skill of
the art (including the contents of the references cited
herein), readily modify and/or adapt for various
applications such specific embodiments, without undue
experimentation, without departing from the general concept
of the present invention. Therefore, such adaptations and
modifications are intended to be within the meaning and
range of equivalents of the disclosed embodiments, .based on
the teaching and guidance presented herein. It is to be
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
115
understood that the phraseology or terminology herein is for
the purpose of description and not of limitation, such that
the terminology or phraseology of the present specification
is to be interpreted by the skilled artisan in light of the
teachings and guidance presented herein, in combination with
the knowledge of one of ordinary skill in the art.
Any description of a class or range as .being useful or
preferred in the practice of the invention shall be deemed a
description of any subclass (e. g., a disclosed class with
one or more disclosed members omitted) or subrange contained
therein, as well as a separate description of each
individual member or value in said class or range.
The description of preferred embodiments individually
shall be deemed a description of any possible combination of
such preferred embodiments, except for combinations which
are impossible (e.g, mutually exclusive choices for an
element of the invention) or which are expressly excluded by
this specification.
If an embodiment of this invention is disclosed in the
prior art, the description of the invention shall be deemed
to include the invention as herein disclosed with such
embodiment excised.
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
CLONE DESCRIPTIONS
122
4-11 is not full length but the mouse homolog is. The human
homolog is not full length.
4-29 is not full length but it is matching with a portion of
the mitochondrial genome, specifically the 16s ribosomal
RNA. There is no corresponding protein match for this
reason.
4-97 is not full length but the mouse and human homologs
are.
4-130 is not full length but the mouse and human protein
homologs are.
5-105 is not full length but the mouse homolog is and the
potential human protein homolog is not.
5-38 is full length. The potential human homolog is not
full length.
5-41 is not full length but the mouse and human homologs
are. z~The human and mouse protein homologs are listed by
inference since the 5-41 sequence is predominantly in the 3'
non-coding region.
5-43 is a novel 1542 by full length CDNA isolated from a
GHR/BP -/- liver CDNA library. This CDNA encodes a 247
amino acid protein of unknown function.
5-61 is a novel partial clone.
5-9 is a novel clone. Clone 5-9 shows two different sized
transcripts via Northern analysis. The larger transcript
only shows up in the GHR/BP -/- mice. The databases show
several mRNA sequences that increase in size, all at the 5'
end. The 2766 by mRNA BC030852 is used here as a reference
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
123
for nucleotide numbers. Our original clone fragment matches
the nucleotide sequence of BC030852 from 2367 to 2683. We
believe we have isolated the full length transcript for the
larger and smaller transcript. From GHR/BP +/+ liver RNA we
isolated a 1321 by cDNA clone encoding a 194 amino acid
protein. This clone matches the nucleotide sequence from
1430 to 2766 on BC030852. From GHR/BP homozygous knockout
(-/-) kidney RNA we have isolated a 1782 by cDNA clone
encoding a 342 amino acid protein. This clone matches the
nucleotide sequence from 969 to 2766 on BC030852. The
following sequences showing homology to clone 5-9 have been
reported in GenBank. Their only difference is that they get
progressively shorter from their 5' end: BC030852,
BC038038, BC049257, BC032094, BC026624, AK009425.
5-138 is full length. The potential human homolog is not
full length.
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
124
Introduction to Master Table
Col. 1: The internal designation for the clone. The
sequences for the clones appear in tables 1-11.
Col. 2: There are three pieces of information here: (1)
The database accession number for the mouse gene
"corresponding" to the clone as determined by database
searching, (2) in parentheses, the E value for the alignment
of the clone sequence to the mouse gene. It is the expected
number of matches with the same or better alignment score
that would have occurred through chance. The lower the E
value, the more statistically significant the alignment. (3)
the database accession number for the mouse protein
corresponding to the mouse gene above.
Col. 3. "U/F". "U" means an unfavorable differential
pattern of expression, "F", a favorable one. "F" means -/-
expression greater than +/+ (control) expression. Master
table 1 is divided into subtables 1A ('F") and 1B ("U) on
the basis of this entry.
Col. 4: A human protein deemed to correspond to the
clone, identified by database accession number and by name.
Note that more than one human protein may be so identified.
The human proteins are listed in order of correspondence to
the Clone, from most to least closely corresponding.
Col. 5: The E value for the alignment of the query
sequence set forth in Col. 6 to the human protein set forth
in Col. 4. There is one entry for each human protein in col.
4.
Col. 6. The database accession number of the
corresponding human gene. There is one entry for each human
protein in Col. 4.
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
c ~ ~ ~ u~ t
v
V V /
-n
r r t t T
1
L
~P
L
L
~ L
~ C L
~ ~
~
g
~
~ I~ I
~.
~ ~ ~' s~l c~a
~ ~ ~ I
L L
~ ~ ~ ~
~ ~
,
'
Q0 t O
'!
~ ~ ~ ~ N 'r
_ T r t
~ ' !
I z _
ca G!O
L
L 't'r .CZ .Q
N ~ ~ L
w ~ L
r
v
T
I1f~ a M
~0
~ ~ r
I ~ ~ I
~
p I ~ ~
l
L d . ~ ~ o
p" d
u~.I a ~ ~' .~ ~ c~
z r ...
7C
c~o ~ . .
v , ,
0
c-I N
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
r N r
r O r flr N r
C N pp
~Li~ t~t> r Q M 'd' O
r 0 M
O r
_ O
~ N O ~ O
~ rG ~
c
O u.
Z Z Z
M r r r !'a
L
N N N N r r
r r ~ r ~ O
O
O
O
O
O
O.
a O
s.
O
O O
L
O r O O
G~ ~
L
~e
M M
~ ~ ~
~ ~ ~ ~ ~
_ _ _ _
~
~ ~7
~ G~ ~ g ~ ~
'
GJ ~1~ ~_ ~ ~_~ ~ N
tta N C7~' O ~ (/~ O
M O N ~ pipr M
I' O ~C f!7
LNL ... d'
I-. o r ~ ~ 01 ~ N M
I I I
Z ~ O Z
01 Q.
Z m
M
fl 0 ~ '
c 0 ~ d
0
N O ~ CO O '
~ ~ d O
O r M N ~ N ~ M O
O O O O
~
O
r .r Z Z Z
r
L C~
C
O Ln O L!1
r1 N N
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
N
r N r
r O
O
p ~ OI i O
C~ u.! ~ p Y
e p
~
00 ei~ Z ~
~ ~ c~
N N r t1~
~ !~ r r
~ M
L
N
C~
IJJ
S~
N
C8
~
~
r s.. r COd'
- ~ ~
N ~ e~
M
a ~ ~ ~
~r
a z u m m
cn
r
N
M
r
O
m
Ln
CA 02531420 2006-O1-04
WO 2005/005668 PCT/US2004/021944
~ v
C
N
I
t? ~ 4-
a r v .
s
~
.
+a
~r
1 W
.
d~
N ~' ~ ~ ~3 ~ S~
fL1
~ ~
~ ~ . ~ _~
~ ~ Sr
~ ~ ~ ~
I c~
I I
~I
~
_
EJt
fla ~. ~
r
'~~'_ ~ ~ f/~ -~ l~?~
I ~ ~ ~ ~ ~ ~
a~
0
a
3
T
V
.N
a N n E ~ a~ ~ ~ a
-
~ _ ' . ~- ~ c c
I .
~ ~
_ L_
'
r .~ ~ Q% ~ ~ ~
~ f6
~ ~ C? V Z
- ~ ~
N ' O M
~ O ~ O? ~
tfa Z Z m d' ~n~n ~n
o u7 0
c-I c-I N
DEMANDES OU BREVETS VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVETS
COMPRI~:ND PLUS D'UN TOME.
CECI EST L,E TOME 1 DE 2
NOTE: Pour les tomes additionels, veillez contacter 1e Bureau Canadien des
Brevets.
JUMBO APPLICATIONS / PATENTS
THIS SECTION OF THE APPLICATION / PATENT CONTAINS MORE
THAN ONE VOLUME.
THIS IS VOLUME 1 OF 2
NOTE: For additional valumes please contact the Canadian Patent Office.
