Note: Descriptions are shown in the official language in which they were submitted.
CA 02541836 2006-04-06
WO 2005/035784 PCT/AU2004/001399
- 1 -
A DIAGNOSTIC METHOD FOR NEONATAL OR INFANTILE EPILEPSY
a ~nmn nw~rs~ a
Technical Field
The present invention relates to a diagnostic method
for neonatal or infantile epilepsy syndromes.
Background Art
Epilepsies constitute a diverse collection of brain
disorders that affect about 3~ of the population at some
time in their lives (Annegers, 1996) . An epileptic seizure
can be defined as an episodic change in behaviour caused
by the disordered firing of populations of neurons in the
central nervous system. This results in varying degrees of
involuntary muscle contraction and often a loss of
consciousness. Epilepsy syndromes have been classified
into more than 40 distinct types based upon characteristic
symptoms, types of seizure, cause, age of onset and EEG
patterns (Commission on Classification and Terminology of
the International League Against Epilepsy, 1989). However
the single feature that is common to all syndromes is the
persistent increase in neuronal excitability that is both
occasionally and unpredictably expressed as a seizure.
A genetic contribution to the aetiology of epilepsy
has been estimated to be present in approximately 40~ of
affected individuals (Gardiner, 2000). As epileptic
seizures may be the end-point of a number of molecular
aberrations that ultimately disturb neuronal synchrony,
the genetic basis for epilepsy is likely to be
heterogeneous. There are over 200 Mendelian diseases which
include epilepsy as part of the phenotype. In these
diseases, seizures are symptomatic of underlying
neurological involvement such as disturbances in brain
structure or function. In contrast, there are also a
number of "pure" epilepsy syndromes in Which epilepsy is
the sole manifestation in the affected individuals. These
CA 02541836 2006-04-06
WO 2005/035784 PCT/AU2004/001399
- 2 -
are termed idiopathic and account for over 600 of all
epilepsy cases.
Idiopathic epilepsies have been further divided into
partial and generalized sub-types. Partial (focal or
local) epileptic fits arise from localized cortical
discharges, so that only certain groups of muscles are
involved and consciousness may be retained (Sutton, 1990).
However, in generalized epilepsy, EEG discharge shows no
focus such that all subcortical regions of the brain are
involved. Although the observation that generalized
epilepsies are frequently inherited is understandable, the
mechanism by which genetic defects, presumably expressed
constitutively in the brain,. give rise to partial seizures
is less clear. In neonates and infants, probably because
brain myelination is incomplete, the distinction between
generalized and partial epilepsies is less clear from
clinical and neurobiological standpoints.
Epilepsies in the first year of life were previously
viewed as largely due to acquired peri-natal factors.
However, two benign autosomal dominant epilepsy syndromes
are now well recognised in the first year of life. The
first is benign familial neonatal seizures (BFNS) which
usually presents around the third day of life and is
characterised by tonic or clonic seizures. These seizures
stop within a few weeks of age, with 5~S of individuals
having later febrile seizures and 11~ later epilepsy
(Plouin, 1994). Studies have shown that the genetic basis
for this syndrome in many cases is due to mutations in the
potassium channel genes KCNQ2 and KCNQ3.
The second is benign familial infantile seizures
(BFIS) which presents between 4 and 8 months of age, with
clusters of tonic or clonic partial or generalised
seizures over a few days. Seizures usually resolve by
around 1 year of age but it may be associated with
paroxysmal dyskinesias in later childhood in some
individuals. While no genes have been definitively
identified to be causative of BFIS, linkage to chromosomes
CA 02541836 2006-04-06
WO 2005/035784 PCT/AU2004/001399
- 3 -
19 and 16 have been reported (Szepetowski et al., 1997;
Guipponi et al., 1997).
In 1983, prior to the recognition of BFIS, an
American family was reported that had an intermediate
variant of BFNS and BFIS, termed benign familial neonatal
infantile seizures (BFNIS), where seizure onset varied
from 2 days to 3.5 months (Kaplan and Lacey, 1983).
Recently, genetic analysis of two BFNIS families lead to
the identification of two mutations in the SCN2A gene that
were responsible for the disorder (Heron et al, 2002).
The inventors have built on this study through the
analysis of affected individuals from additional families
with probable or possible BFNIS. This has lead to the
identification of further missense mutations in SCN2A in 6
families that result in changes in evolutionary conserved
amino acids. Both families clinically recognised as
probable BFNIS and four of nine families recognised as
possible BFNIS contained SCN2A mutations. This further
emphasizes the importance of genetic factors in epilepsies
of the neonatal and early infantile periods. Of 95
families with other forms of childhood epilepsy tested,
none contained mutations in SCN2A.
The inventors have established a method for the
diagnosis of BFNIS and other neonatal and infantile
epilepsies, based on testing for the presence of
alterations in the SCN2A, and, optionally, the KCNQ2
and/or KCNQ3 genes, in affected patients. The development
of a molecular diagnostic test strategy to aid in the
diagnosis of neonatal and infantile epilepsies is
important. Such a test strategy enables proper management
of the affected patient and avoids over-investigation and
over-treatment of the patient.
Disclosure of the Invention
In a first aspect of the present invention there is
provided a method for the diagnosis of a neonatal or
infantile epilepsy syndrome as BFNIS in a patient with
CA 02541836 2006-04-06
WO 2005/035784 PCT/AU2004/001399
- 4 -
seizure onset in the first year of life, comprising
testing for the presence of an alteration in the SCN2A
gene, including in a regulatory region of the gene, in a
patient sample, and establishing a diagnosis which will
indicate a high probability of BFNIS when an SCN2A
alteration is detected or establishing a diagnosis which
will indicate a low probability of BFNIS when an SCN2A
alteration is not detected.
This information is important for initiating the
correct treatment regimen for a patient and avoids
unnecessary testing and associated trauma to the patient.
The nature of the alterations in the SCN2A gene may
encompass all forms of gene sequence variations including
deletions, insertions, rearrangements and point mutations
in the coding and non-coding regions such as the promoter,
introns or untranslated regions but, in particular,
missense mutations have been associated with BFNIS.
Deletions may be of the entire gene or only a portion of
the gene whereas point mutations may result in stop
codons, frameshifts or amino acid substitutions. Point
mutations occurring in the regulatory regions of SCN2A,
such as in the promoter, may lead to loss or a decrease of
expression of the mRNA or may abolish proper mRNA
processing leading to a decrease in mRNA stability or
translation efficiency.
The identification of SCN2A alterations in a patient
that have previously been associated with BFNIS, or which
are present in the patient' s affected parent or relatives
increases the likelihood that the patient has BFNIS.
Furthermore, information concerning the age of onset may
be used to suggest a diagnosis of BFIS or BFNS once BFNIS
is ruled out through failure to identify an SCN2A
alteration. The flow chart in Figure 1 illustrates an
embodiment of the present invention.
In an embodiment of the invention there is provided a
method for the diagnosis of a neonatal or infantile
epilepsy syndrome as BFNIS in a patient comprising
CA 02541836 2006-04-06
WO 2005/035784 PCT/AU2004/001399
- 5 -
performing one or more assays to test for the presence of
an SCN2A alteration and to identify the nature of the
alteration.
In a further embodiment there is provided a method
for the diagnosis of a neonatal or infantile epilepsy
syndrome as BFNIS in a patient comprising the steps of:
(1) performing one or more assays to test for the
presence of an alteration in the SCN2A gene of
the patient; and, if the results indicate the
presence of an alteration in the SCN2A gene,
(2) performing one or more assays to identify the
nature of the SCN2A alteration.
In a further aspect of the invention there is
provided a method for the diagnosis of a neonatal or
infantile epilepsy syndrome as one of BFNIS, BFNS or BFIS
in a patient with seizure onset in the first year of life
comprising:
(1) (a) testing for the presence of an
alteration in the SCN2A gene, including
in a regulatory region of the gene, in a
patient sample; and/or
(b) testing for the presence of an
alteration in the KCNQ2 and/or KCNQ3
genes, including in regulatory regions
of the genes, in the patient sample; and
(2) (a) establishing a diagnosis which will
indicate a high probability of BFNIS
when an SCN2A alteration a.s detected;
(b) establishing a diagnosis which will
indicate a high probability of BFNS when
a KCNQ2 or KCNQ3 alteration is detected;
or
(c) establishing a diagnosis which will
indicate a likelihood of BFIS when an
SCN2A, KCNQ2 or KCNQ3 alteration is not
detected.
CA 02541836 2006-04-06
WO 2005/035784 PCT/AU2004/001399
- 6 -
The flow chart in Figure 2 illustrates an embodiment
of the present invention. It will be appreciated that
screens to detect alterations in the various subunits may
be undertaken in a different order to what is illustrated
and yet ultimately provide the same clinical information.
For example, a screen for alterations in KCNQ2 could be
undertaken followed, if negative, by a screen for
alterations in KCNQ3 followed, if negative, by a screen
for alterations in SCN2A. Clinical observations involving
family history and clinical observations may be employed
in determining the order of the screens, and may also be
employed in reaching a diagnosis, particularly in reaching
a diagnosis of BFIS following negative genetic tests.
The nature of the alterations in the KCNQ2 and KCNQ3
genes may encompass all forms of gene sequence variations
as described above for the SCN2A gene.
In a further embodiment of the invention there is
provided a method for the diagnosis of a neonatal or
infantile epilepsy syndrome as BFNIS, BFNS or BFIS in a
patient comprising performing one or more assays to test
for the presence of an SCN2A, KCNQ2 or KCNQ3 alteration
and to identify the nature of the alteration.
In a further embodiment there is provided a method
for the diagnosis of a neonatal or infantile epilepsy
syndrome as BFNIS, BFNS or BFIS in a patient comprising
the steps of:
(1) performing one or more assays to test for the
presence of an alteration in the SCN2A, KCNQ2 or
KCNQ3 gene of the patient; and, if the results
indicate the presence of an alteration in any
one of these genes,
(2) performing one or more assays to identify the
nature of the alteration.
There exists a number of assay systems that can be
used to test for the presence of SCN2A, KCNQ2 or KCNQ3
alterations and the invention is not limited by the
examples that are provided below.
CA 02541836 2006-04-06
WO 2005/035784 PCT/AU2004/001399
In one embodiment an assay system employed may be the
analysis of SCN2A, KCNQ2 or KCNQ3 DNA from a patient
sample in comparison to wild-type SCN2A, KCNQ2 or KCNQ3
DNA. Genomic DNA may be used for the diagnostic analysis
and may be obtained from a number of sources including,
but not limited to, body cells, such as those present in
the blood or cheek, tissue biopsy, surgical specimen, or
autopsy material. The DNA may be isolated and used
directly for the diagnostic assays or may be amplified by
the polymerase chain reaction (PCR) prior to analysis.
Similarly, RNA or cDNA may also be used, with or without
PCR amplification. In addition, prenatal diagnosis can be
accomplished by testing fetal cells, placental cells or
amniotic fluid.
In a specific embodiment, a DNA hybridisation assay
may be employed. These may consist of probe-based assays
specific for the SCN2A, KCNQ2 or KCNQ3 genes. One such
assay may look at a series of Southern blots of DNA that
has been digested with one or more restriction enzymes.
Each blot may contain a series of normal individuals and a
series of patient samples. Samples displaying
hybridisation fragments that differ in length from normal
DNA when probed with sequences near or including the
SCN2A, KCNQ2 or KCNQ3 genes (SCN2A, KCNQ2 or KCNQ3 gene
probes) indicate a possible SCN2A, KCNQ2 or KCNQ3
alteration. If restriction enzymes that produce very large
restriction fragments are used then pulsed field gel
electropheresis (PFGE) may be employed.
SCN2A, KCNQ2 or KCNQ3 exon specific hybridisation
assays may also be employed. This type of probe-based
assay will utilize at least one probe which specifically
and selectively hybridises to an exon of the SCN2A, KCNQ2
or KCNQ3 gene in its wild-type form. Thus, the lack of
formation of a duplex nucleic acid hybrid containing the
nucleic acid probe is indicative of the presence of an
alteration in the relevant gene. Because of the high
specificity of probe-based tests, any negative result is
CA 02541836 2006-04-06
WO 2005/035784 PCT/AU2004/001399
_ g _
highly indicative of the presence of an alteration however
further investigational assays should be employed to
identify the nature of the alteration to determine the
likelihood it is disease-associated.
The exon specific assay approach could also be
adapted to identify previously determined SCN2A, KCNQ2 or
KCNQ3 alterations responsible for BFNIS or BFNS. In this
aspect, a probe which specifically and selectively
hybridises with any one of the SCN2A, KCNQ2 or KCNQ3 genes
in its altered form is used (allele specific probe). In
this case the formation of a duplex nucleic acid hybrid
containing the nucleic acid probe is indicative of the
presence of the alteration in the relevant gene. In each
variation of the exon specific assay approach, it is
important to take into account known polymorphisms in the
genes that are not associated with disease. A secondary
assay such as DNA sequencing should subsequently be
employed to ensure that any suspected alterations are not
known polymorphisms.
The exon specific probes used for each of the
abovementioned assays may be derived from: (1) PCR
amplification of each exon of the SCN2A, KCNQ2 or KCNQ3
genes using intron specific primers flanking each exon;
(2) cDNA probes specific for each exon; or (3) a series of
oligonucleotides that collectively represent a SCN2A,
KCNQ2 or KCNQ3 exon.
In a further embodiment, an assay to analyse
heteroduplex formation may be employed. By mixing
denatured wild-type SCN2A, KCNQ2 or KCNQ3 DNA with a DNA
sample from a patient, any sequence variations between the
two samples in the relevant gene being tested will lead to
the formation of a mixed population of heteroduplexes and
homoduplexes during reannealing of the DNA. Analysis of
this mixed population can be achieved through the use of
such techniques as high performance liquid chromatography
(HPLC) which are performed under partially denaturing
temperatures. In this manner, heteroduplexes will elute
CA 02541836 2006-04-06
WO 2005/035784 PCT/AU2004/001399
_ g -
from the HPLC column earlier than the homoduplexes because
of their reduced melting temperature.
In a further embodiment, patient samples may be
subject to electrophoretic-based assays. For example
electrophoretic assays that determine SCN2A, KCNQ2 or
KCNQ3 fragment length differences may be employed.
Fragments of each patient's genomic DNA are amplified with
intron specific primers to the relevant gene under
investigation. The amplified regions of the gene therefore
include the exon of interest, the splice site junction at
the exon/intron boundaries, and a short portion of intron
at either end of the amplification product. The
amplification products may be run on an electrophoresis
size-separation gel and the lengths of the amplified
fragments are compared to known and expected standard
lengths from the wild-type gene to determine if an
insertion or deletion mutation is found in the patient
sample. This procedure can advantageously be used in a
"multiplexed" format, in which primers for a plurality of
exons (generally from 2 to 8) are co-amplified, and
evaluated simultaneously on a single electrophoretic gel.
This is made possible by careful selection of the primers
for each exon of the gene. The amplified fragments
spanning each exon are designed to be of different sizes
and therefore distinguishable on an electrophoresis/size
separation gel. The use of this technique has the
advantage of detecting both normal and mutant alleles in
heterozygous individuals. Furthermore, through the use of
multiplexing it can be very cost effective.
In a further approach, diagnostic electrophoretic
assays for the detection of previously identified SCN2A,
KCNQ2 or KCNQ3 alterations responsible for BFNIS or BFNS
may utilise PCR primers which bind specifically to altered
exons of the genes. In this case, product will only be
observed in the electrophoresis gel if hybridization of
the primer occurred. Thus, the appearance of amplification
product is an indicator of the presence of the alteration,
CA 02541836 2006-04-06
WO 2005/035784 PCT/AU2004/001399
- 10 -
while the length of the amplification product may indicate
the presence of additional alterations.
Additional electrophoretic assays may be employed.
These may include the single-stranded conformational
polymorphism (SSCP) procedure (Orita et al., 1989). As
mentioned above, fragments of each patient's genomic DNA
are PCR amplified with intron specific primers to any one
of the SCN2A, KCNQ2 or KCNQ3 genes such that individual
exons of the genes are amplified and may be analysed
individually. Exon-specific PCR products are then
subjected to electrophoresis on non-denaturing
polyacrylamide gels such that DNA fragments migrate
through the gel based on their conformation as dictated by
their sequence composition. Exon-specific fragments that
vary in sequence from wild-type sequence will have a
different secondary structure conformation and therefore
migrate differently through the gel. Aberrantly migrating
PCR products in patient samples are indicative of an
alteration in the exon and should be analysed further in
secondary assays such as DNA sequencing to identify the
nature of the alteration.
Additional electrophoretic assays that may be
employed include RNase protection assays (Finkelstein et
al., 1990; Kinszler et al., 1991) and denaturing gradient
gel electrophoresis (DGGE)(Wartell et al., 1990; Sheffield
et al., 1989). RNase protection involves cleavage of a
mutant polynucleotide into two or more smaller fragments
whereas DGGE detects differences in migration rates of
mutant sequences compared to wild-type sequences, using a
denaturing gradient gel.
In the RNase protection assay a labelled riboprobe
which is complementary to the human wild-type SCN2A, KCNQ2
or KCNQ3 gene coding sequence is hybridised with either
mRNA or DNA isolated from the patient and subsequently
digested with the enzyme RNase A which is able to detect
some mismatches in a duplex RNA structure. If a mismatch
is detected by RNase A, it cleaves at the site of the
CA 02541836 2006-04-06
WO 2005/035784 PCT/AU2004/001399
- 11 -
mismatch. Thus, when the annealed RNA preparation is
separated on an electrophoretic gel matrix, if a mismatch
has been detected and cleaved by RNase A, an RNA product
will be seen which is smaller than the full length duplex
RNA for the riboprobe and the mRNA or DNA. The riboprobe
need not be the full length of the mRNA or gene under
investigation but can be a segment of either. If the
riboprobe comprises only a segment of the mRNA or gene, it
will be desirable to use a number of these probes to
screen the whole mRNA sequence for mismatches.
In a further embodiment, enzymatic based assays
(Taylor and Deeble, 1999) may be used in diagnostic
applications. Such assays include the use of S1 nuclease,
ribonuclease, T4 endonuclease VII, MutS (Modrich, 1991),
Cleavase and Mutt. In the MutS assay, the protein binds
only to sequences that contain a nucleotide mismatch in a
heteroduplex between mutant and wild-type sequences.
When an assay is to be based upon the SCN2A, KCNQ2 or
KCNQ3 protein, a variety of approaches are possible. For
example, diagnosis can be achieved by monitoring
differences in the electrophoretic mobility of wild-type
SCN2A, KCNQ2 or KCNQ3 protein and SCN2A, KCNQ2 or KCNQ3
protein isolated from a patient sample. Such an approach
will be particularly useful in identifying alterations in
which charge substitutions are present, or in which
insertions, deletions or substitutions have resulted in a
significant change in the electrophoretic migration of the
resultant protein. Alternatively, diagnosis may be based
upon differences in the proteolytic cleavage patterns of
normal and altered proteins, differences in molar ratios
of the various amino acid residues, or by functional
assays demonstrating altered function of the gene
products.
Further assays that are based on the SCN2A, KCNQ2 or
KCNQ3 protein include immunoassays. The procedures for
raising antibodies against specific gene products are well
described in the literature, for example in U.S. Pat. Nos.
CA 02541836 2006-04-06
WO 2005/035784 PCT/AU2004/001399
- 12 -
4,172,124 and 4,474,893 which are incorporated herein by
reference. Antibodies are normally raised which bind to
portions of the gene product away from common mutation
sites such that the same antibody binds to both mutant and
normal protein. Preferred antibodies for use in this
invention are monoclonal antibodies because of their
improved predictability and specificity. It will be
appreciated, however, that essentially any antibody which
possesses the desired high level of specificity can be
used, and that optimization to achieve high sensitivity is
not required.
For the diagnostic detection of SCN2A, KCNQ2 or KCNQ3
alterations previously identified to be involved in
neonatal or infantile epilepsies including BFNIS, BFNS and
BFIS, antibody raised against the defective gene product
is preferable. Antibodies are added to a portion of the
patient sample under conditions where an immunological
reaction can occur, and the sample is then evaluated to
see if such a reaction has occurred. The specific method
for carrying out this evaluation is not critical and may
include enzyme-linked immunosorbant assays (ELISA),
described in U.S. Pat. No. 4,016,043, which is
incorporated herein by reference; fluorescent enzyme
immunoassay (FEIA or ELFA), which is similar to ELISA,
except that a fluoregenic enzyme substrate such as 4-
methylumbelliferyl-beta-galactoside is used instead of a
chromogenic substrate, and radioinmunoassay (RIA).
The most definitive diagnostic assay that may be
employed is DNA sequencing, and ultimately may be the only
assay that is needed to be performed. Comparison of the
SCN2A, KCNQ2 or KCNQ3 DNA wild-type sequence with the
SCN2A, KCNQ2 or KCNQ3 sequence of a test patient provides
both high specificity and high sensitivity. The general
methodology employed involves amplifying (for example with
PCR) the DNA fragments of interest from patient DNA;
combining the amplified DNA with a sequencing primer which
may be the same as or different from the amplification
CA 02541836 2006-04-06
WO 2005/035784 PCT/AU2004/001399
- 13 -
primers; extending the sequencing primer in the presence
of normal nucleotide (A, C, G, and T) and a chain-
terminating nucleotide, such as a dideoxynucleotide, which
prevents further extension of the primer once
incorporated; and analyzing the product for the length of
the extended fragments obtained. While such methods, which
are based on the original dideoxysequencing method
disclosed by Sanger et al., 1977 are useful in the present
invention, the final assay is not limited to such methods.
For example, other methods for determining the sequence of
the gene of interest, or a portion thereof, may also be
employed. Alternative methods include those described by
Maxam and Gilbert (1977) and variations of the dideoxy
method and methods which do not rely on chain-terminating
nucleotides at all such as that disclosed in U.S. Pat. No.
4,971,903, which is incorporated herein by reference. Any
sequence differences (other than benign polymorphisms) in
exons of a test patient when compared to that of the wild
type sequence indicate a potential disease-causing
alteration.
In specific embodiments of the invention, there is
provided a method for testing patients for BFNIS-
associated mutations in the SCN2A gene comprising the
steps of
a) quantitatively amplifying at least one exon of the
SCN2A gene from a body sample of each patient to
produce amplified fragments;
b) comparing the properties of the amplified fragments
to standard values based upon the fragments produced
by amplification of the same exon in a non-mutant
SCN2A gene; and
c) determining the nucleic acid sequence of each exon
identified in b) that has different properties in the
patient compared to the corresponding non-mutant
SCN2A exon.
CA 02541836 2006-04-06
WO 2005/035784 PCT/AU2004/001399
- 14 -
In further specific embodiments there is provided a
method for testing patients for BFNIS-associated mutations
in the SCN2A gene comprising the steps of:
a) quantitatively amplifying, from a body sample of each
patient at least one exon of the SCN2A gene using
primers complementary to intron regions flanking each
amplified exon;
b) comparing the length of the amplification products
for each amplified exon to the length of the
amplification products obtained when a wild-type
SCN2A gene is amplified using the same primers,
whereby differences in length between an amplified
sample exon and the corresponding amplified wild-type
exon reflect the occurrence of a truncating mutation
in the sample SCN2A gene; and
c) determining the nucleic acid sequence of each exon
identified in b) to contain a truncating mutation.
In even further specific embodiments there is
provided a method for testing patients for BFNIS
associated mutations in the SCN2A gene comprising the
steps of
a) quantitatively amplifying, from a body sample of each
patient at least one exon of the SCN2A gene using
primers complementary to intron regions flanking each
amplified exon;
b) hybridising the fragments from a) with fragments
produced by amplification of the same exon in a non-
mutant SCN2A gene;
c) determining the nucleic acid sequence of each patient
exon identified a.n b) that either does not hybridise
to corresponding wild-type fragments or forms a
mismatched heteroduplex.
Throughout this specification and the claims, the
words "comprise", "comprises" and "comprising" are used in
a non-exclusive sense, except where the context requires
otherwise.
It will be apparent to the person skilled in the art
CA 02541836 2006-04-06
WO 2005/035784 PCT/AU2004/001399
- 15 -
that while the invention has been described in some detail
for the purposes of clarity and understanding, various
modifications and alterations to the embodiments and
methods described herein may be made without departing
from the scope of the inventive concept disclosed in this
specification.
Modes for Performing the Invention
Prior to the current study, mutations in the SCN2A
gene were seen in 2 families with BFNIS . This finding has
been expanded upon by the analysis of additional families
with early childhood epilepsies so as to refine the
molecular-clinical correlation of SCN2A mutations in these
epilepsy types.
Example 1: SCN2A mutation analysis in neonatal and
infantile epilepsies
The current study examined three sets of subjects for
SCN2A mutations using SSCP analysis and sequencing. These
included 2 families with probable BFNIS based on a
clinical assessment, nine families with possible BFNIS
based on the fact that most individuals had seizures
before 4 months of age and in some families neonatal
seizures were observed, and 103 additional families
constituting other early childhood epilepsies. In these
103 families, 10 had BFIS, 59 had generalised epilepsy
with febrile seizures plus (GEFS+) in whom mutations in
SCN1A, SCN1B and GABRG2 were not detected, and 32
constituted unrelated cases with benign childhood epilepsy
with centrotemporal spikes.
The results of the mutation analysis of SCN2A in
these families showed that missense mutations resulting in
changes in evolutionary conserved amino acids were found
in a total 6 families. Both families categorized as
probable BFNIS, and four of the nine families regarded as
possible BFNIS were positive. The mutations in these
families were not found in the controls.
CA 02541836 2006-04-06
WO 2005/035784 PCT/AU2004/001399
- 16 -
No mutations were found in the 59 GEFS+ families.
Neither of the two families with exclusively neonatal
onset had SCN2A mutations. Of the 10 families with BFIS,
an A1822V change was seen in two members of one family,
while one child from the benign childhood epilepsy with
centrotemporal spikes group had a T1200A alteration in
SCN2A that was not seen in the normal population.
From the current work, the clinical and molecular
characterisation of additional families with SCN2A
mutations now establishes BFNIS as an important sodium
channelopathy of the early infantile period (Berkovic et
al., 2004).
Example 2: Diagnostic method - assay system examples
Based on the findings of this study, a method for the
diagnosis of BFNIS, BFNS or BFIS in a patient has been
established. The flowchart in Figure 1 illustrates a
strategy based on the invention that can be used to
determine the likelihood that an alteration in the SCN2A
gene is responsible for BFNIS, and further to make a
diagnosis of BFNS or BFIS. In addition, the flowchart in
Figure 2 illustrates a molecular biology-based strategy
that can be used to establish the likelihood that a
neonatal or infantile seizure patient has BFNIS, BFNS or
BFIS. This is based on the fact that BFNIS is associated
with SCN2A alterations, BFNS is associated with KCNQ2 or
KCNQ3 alterations and BFIS is not associated with
alterations in any of these genes.
The assay combination chosen for the diagnostic
method is preceded by selecting the patient population to
be examined and obtaining DNA from the sample population.
The sample population may encompass any individual with
epilepsy but would likely focus on patients where seizure
onset is before 6 months of age.
DNA from a test patient may be obtained in a number
of ways. The most common approach is to obtain DNA from
blood samples taken from the patient, however DNA may also
CA 02541836 2006-04-06
WO 2005/035784 PCT/AU2004/001399
- 17 -
be obtained using less invasive approaches such as from
cheek cell swabs.
For the current study DNA was extracted from
collected blood using the QIAamp DNA Blood Maxi kit
(Qiagen) according to manufacturer's specifications or
through procedures adapted from Wyman and White (1980).
For DNA samples obtained using the QIAamp kit, a final
ethanol precipitation step was employed with DNA pellets
being resuspended in sterile water. Stock DNA samples were
kept at a concentration of 200 ng/ul and 100 ng/ul
dilutions were prepared for subsequent PCR reactions.
Any combination of assay systems described above may
be employed using the method. Provided below are examples
of assays that were employed for the detection of
alterations in the SCN2A gene and a determination of their
nature in the present study. Assays that may be employed
for the detection of alterations a.n KCNQ2 and/or KCNQ3 are
described in W099/21875, the contents of which are
incorporated herein by reference.
SCN2A electrophoretic assay using SSCP - identifying the
existence of an SCN2A alteration
Once DNA from a patient had been obtained, PCR
amplification of individual exons of the SCN2A gene was
employed prior to analysis by single strand conformation
polymorphism (SSCP) analysis. Table 1 provides a list of
primers that may be employed to analyse each exon of the
SCN2A gene and which were used in the present study.
In this specific example, primers used for SSCP were
labelled at their 5' end with HEX and typical PCR
reactions were performed in a total volume of 10 ~~1. All
PCR reactions contained 67 mM Tris-HC1 (pH 8.8); 16.5 mM
(NH4) 2504; 6 . 5 ~.~M EDTA; 1 . 5 mM MgCl2; 200 EiM each dNTP; 10~
DMSO; 0.17 mg/ml BSA; 10 mM ~3-mercaptoethanol; 5 Etg/ml each
primer and 100 U/ml Taq DNA polymerise. PCR reactions were
typically performed using 10 cycles of 94°C for 30 seconds,
60°C for 30 seconds, and 72°C for 30 seconds followed by 25
CA 02541836 2006-04-06
WO 2005/035784 PCT/AU2004/001399
- 18 -
cycles of 94°C for 30 seconds, 55°C for 30 seconds, and
72°C for 30 seconds. A final extension reaction for 10
minutes at 72°C followed.
Ten to twenty ~1 of loading dye comprising 50~ (v/v)
formamide, 12.5 mM EDTA and 0.020 (w/v) bromophenol blue
were added to completed reactions which were subsequently
run on non-denaturing 4~ polyacrylamide gels with a cross
linking ratio of 35:1 (acrylamide:bis-acrylamide) and
containing 2~ glycerol. Gel thickness was 100~.un, Width
168mm and length 160mm. Gels were run at 1200 volts and
approximately 20mA, at 18°C and analysed on the GelScan
2000 system (Corbett Research, Australia) according to
manufacturers specifications.
DNA sequencing assay - identifying the nature of an SCN2A
alteration
PCR products from the SSCP analysis that showed a
conformational change were subject to secondary assays
such as DNA sequencing to determine the nature of the
change. In the example provided here, this first involved
re-amplification of the amplicon displaying a band-shift
from the relevant patient (primers used in this instance
did not contain 5' HEX labels) followed by purification of
the PCR amplified templates for sequencing using QiaQuick
PCR preps (Qiagen) based on manufacturer's procedures. The
primers used to sequence the purified amplicons were
identical to those used for the initial amplification
step. For each sequencing reaction, 25 ng of primer and
100 ng of purified PCR template were used. The BigDye
sequencing kit (ABI) was used for all sequencing reactions
according to the manufacturer's specifications. The
products were run on an ABI 377 Sequencer and analysed
using the EditView program.
A comparison of the DNA sequence obtained from the
patient sample can then be made directly to that of the
wild-type SCN2A sequence in order to detect the DNA
alteration that lead to the conformational change detected
CA 02541836 2006-04-06
WO 2005/035784 PCT/AU2004/001399
- 19 -
by SSCP. If the DNA change is not a known polymorphism in
the SCN2A gene, it is likely that it may be a disease
causing mutation essentially providing a diagnosis that
can be investigated further through the analysis of
additional family members.
Additional assays - dHPLC assay
In addition to the assays described above, other
assays may be employed to test for the existence of
alterations in the SCN2A gene that are associated with
BFNIS. One such assay is high performance liquid
chromatography (dHPLC). In this technique, DNA obtained
from the patient is first PCR amplified for individual
exons of the SCN2A gene. The primers employed for SSCP
analysis (see Table 1) may also be used for dHPLC
analysis.
dHPLC PCR reactions and cycling conditions can be
performed as described above for SSCP analysis, however
any PCR reaction and cycling conditions may be employed
provided that the amplification produces a distinct
product specific for the amplicon under investigation
only.
An example of alternative PCR reaction conditions are
where the reaction is performed in a total volume of 20 ~1
containing 1X PCR buffer (Invitrogen), 200 uM dNTPs, 300
ng of each primer, 1.5 mM MgCl2, 100 ng DNA and 0.5 units
of Taq DNA polymerase (Invitrogen). PCR cycling conditions
will vary depending on the nature of the amplicon and
primer sequence but typically may involve 1 cycle of 94°C
for 2 minutes, followed by 10 cycles of 60°C for 30
seconds, 72°C for 30 seconds, and 94°C for 30 seconds,
followed by 25 cycles of 55°C for 30 seconds, 72°C for 30
seconds, and 94°C for 30 seconds. A final annealing
reaction at 55°C for 30 seconds followed by an extension
reaction for 10 minutes at 72°C usually completes the
cycling.
Prior to dHPLC analysis, PCR products are heated to
CA 02541836 2006-04-06
WO 2005/035784 PCT/AU2004/001399
- 20 -
95°C for 5 minutes and are then slowly cooled at -3°C
increments for 1.5 minutes (until 25°C is reached). This is
to allow the formation of hetero- and homoduplexes
depending upon the nucleotide constitution of the PCR
product.
Various dHPLC systems can be used for heteroduplex
analysis and mutation detection. One example is the
Transgenomic WAVE° System. In order to detect mutations on
the dHPLC each product is required to be run under
partially denaturing conditions. Due to each amplicon of
the SCN2A gene having a different sequence, the
temperatures) at which each product is partially
denatured needs to be first calculated.
Amplicons are fed through the dHPLC column and
computer generated chromatograms are compared between
patient samples and wild-type samples. The analysis may be
done by visual inspection of the chromatograms or, in the
case of the Transgenomic WAVE° System, using software
supplied with the system. Those patient samples showing
different peak patterns to wild-type are considered to
contain alterations in the SCN2A amplicon under
investigation and the DNA from those individuals- can be
subjected to a further assay, namely DNA sequencing (see
example above), to determine the nature of the SCN2A
alteration and to predict the likelihood that the
alteration is responsible for BFNIS.
CA 02541836 2006-04-06
WO 2005/035784 PCT/AU2004/001399
- 21 -
TABLE 1
Primer Seauences Used for Mutation Analysis of SCN2A
Exon Forward Primer Reverse Primer Size
(bp)
5'UTR ACAGGAAGTTAGGTGTGGTC GAGAAGCATCACAGAG 206
la TGCTGTATCTCAGTGCTCAG TCATCATCCTCATCCTTGCG 281
lb GCTAAGAGACCCAAAC TAGGCAGTGAAGGCAACTTG 201
2 GCACTATTTTACAGGGC CATAACATTGCCAACCACAG 325
3 TGGTGAAGGCATGGTAGT ATTGAGGAGGTCTCAAGGTG 239
4 ACCAACCTGGAAGTGTCT ATAGTATAGGCTCCCACCAG 300
AGGCCCCTTATATCTCCAAC TAGCAACAAGGCTTCTGCAC 294
5n GATGAAAGACCAAGGAAGAC TGGAGATATAAGGGGCCTAG 200
6a TTCCAGGACAAGCTCATG GGAAGAATTATCTGGAGGCCA 249
6b TTGTTCATGGGCAACCTACG GTCTAAGTCACTTGATTCAC 271
7 GTGAGCTTTGCCACCTAAAC TGAGAGTCACCGTGAAGTAG 280
8 ACCAATTAGCAGACTTGCCG CTACAGCAATTCTCTTGAG 264
9 CTCAAGAGAATTGCTGTAG AGGACCGTATGCTTGTTCAC 326
l0a TTCCACATACTTTGCGCCCTTC GCTGTCTTCAGATTCCGA 235
lOb CAGAAAGAACAGTCTGG.AG CTCTGAAAGCATTGTGCCA 256
lla CCACATGTCCAATGAC CACGAACAGAGAGTCTCTTC 296
11b TGATGAGCACAGCACCTTTG CACCAGTCACAACTCTCTTC 281
12 CTTTGGGCTTTGCTGCTTTC AAGTAACTGTGACGCAGGAC 222
13a CCTCCAGCAGATTAACCCAT CAGGTCAACAAATGGGTCCA 268
13b ACACCTTGTCAACCTGGTTG GATGTCAAGATATACATGGCC 258
14 C'ICGTGTTTCAAGAGTATTTGCTC';CTTATGAACACTCCCAG 252
15a GCAGAGCATTAACACTGTTC AGCGTGGGAGTTCACAATCA 241
15b GCATGCAGCTCTTTGGTAAG C;CCTTCAGTTGAACACAC 299
16a CCTGTTTTTCCTGCTGTGTTTC GCCACTAGTAGTTCCATTTCCGTC336
16b GACAGCTGTATTTCCAACC AACAGGAAGGAAACACGC 346
17 CTGACCTTTACCAAAGCGGA GAGGATACTCAAGACCAC 318
18 TGAATCTCCCACCAACAC GAGTGGATCATGCATCACCT 252
19 CTTAGGCACCTGATAAGAGC AAAGCAGCAAAGTGCAGC 302
20 CATTGCATAGAGCAAGGC GGTACAAAGTGTCAGTCTGCTCTC263
21a TTTCCTTCTCATCCTGTGCC CTGGCAGTTTGATTGCTCTC 240
21b AGCGTGGTCAACAACTACAG GCCATTCTAACAGGTGGA 217
22 GCCCCAAAAGTGAATAC (;C~,:~:CAATTTCCCTCTAACTAGAC224
23 GGG~~CCAGAGATTAAAACATGCCAGAGCAAGGATGAAG 272
24 GAATGAAATGTGGGAGCC TTCGGGCTGTGAAACGGTTA 266
25a TTACCTCAGCTCTCCAATCACTGGTGGTCATCGGTTTCCACCAT 292
25b TCATCTGCCTTAACATGGTC GGGAGTTTGGGATGAATG 311
26a GTACCTAACTGTCCTGTTCAC TAAACAACGCAGGAAGGGAC 270
26b CACGCTGCTCTTTGCTTTGA GATCTTTGTCAGGGTCACAG 269
26c GGATGGATTGCTAGCACCTA TCGCATCGGGATCAAACTTC 281
26d AGCCTCTGAGTGAGGATGAC TCCATCTG'rATTCGAAGGGC 277
26e GTGAGAGTGGAGAGATGGAT TATCATACGAGGGTGGAGAC 330
26f AACCGATATGACGCCTTCCA GGTCTCTGTCTTGTTATAGGC 288
Note: Primer sequences are listed 5' to 3'. Due to the large size of
exons 1, 6, 10, 11, 13, 15, 16, 21, 25 and 26, the exons were split
5into two or more overlapping amplicons. The neonatally expressed
exon 5 is represented as exon 5n.
CA 02541836 2006-04-06
WO 2005/035784 PCT/AU2004/001399
- 22 -
References
References cited herein are listed on the following
pages, and are incorporated herein by this reference.
Annegers, JF. (1996). The treatment of epilepsy:
Principles and practice. Second Edition. (Wyllie E
(Ed) Williams and Wilkins).
Berkovic, SF. et al. (2004). Ann. Neurol. 55: 550-557.
Commission on Classification and Terminology of the
International League against Epilepsy. (1989).
Epilepsia 30: 389-399.
Gardiner, M. (2000). J Neurol. 247: 327-334.
Guipponi, M. Rivier, F. Vigevano, F. Beck, C. Crespel, A.
Echenne, B. Lucchini, P. Sebastianelli, R. Baldy
Moulinier, M and Malafosse, A. (1997). Hum. Mol. Genet.
6: 473-477.
Heron, SE. Crossland, KM. Andermann, E. Phillips, HA.
Hall, AJ. Bleasel, A. Shevell, M. Mercho, S. Seni, M.
Guiot, M. Mulley, JC. Berkovic, SF. Scheffer, IE.
(2002). Lancet 360:851-52.
Kaplan, RE. and Lacey, DJ. (1983). Am. J. Med. Genet. 16:
595-599.
Maxam, AM. and Gilbert, W. (1977). Proc. Natl. Acad. Sci.
USA 74: 560-564.
Plouin, P. (1994). In: Malafosse, A. Genton, P. Hirsch, E.
Marescaux, C. Broglin, D. and Bernasconi, R. eds.
Idiopathic generalised epilepsies: clinical,
experimental, and genetic aspects. London: John Libbey
and Company. 39-44.
Stinger, F. Nicklen, S. and Coulson, AR. (1977). Proc.
Natl. Acad. Sci. USA 74: 5463-5467.
Sutton, GC. (1990) . The principles and practice of medical
genetics. Second Edition. (Churchill Livingstone, NY).
Szepetowski, P. Rochette, J. Berquin, P. Piussan, C.
Lathrop, GM. And Monaco, AP. (1997). Am. J. Hum.
Genet. 61: 889-898.
CA 02541836 2006-04-06
WO 2005/035784 PCT/AU2004/001399
- 23 -
Wyman, AR. and White, R. (1980). Proc. Natl. Acad. Sci.
77: 6754-6758.
