Note: Descriptions are shown in the official language in which they were submitted.
CA 02546401 2006-05-17
WO 2005/050203 PCT/GB2004/004795
~I~L~GICAL 1VIATERIALS ANNA USES THEIaEOF
s
The presently claimed invention relates to methods of identifying and/or
making compounds for use in the reduction and/or prevention of fibrosis.
The invention also relates to compounds for reducing and/or preventing
fibrosis and to the use of such compounds.
to
When biological tissue is injured, both the injury and the associated
inflammatory response can cause the death of cells. When cell death occurs,
new tissue is synthesised to replace the dead or dying cells. The synthesis of
new tissue falls under two categories, the regeneration of specialised cells
~s and an increase in connective tissue. In some pathological conditions, the
connective tissue increase dominates the healing process, leading to the
formation of fibrotic tissue. In fibrosis, the new tissue has repaired any
structural defect in the tissue, but has impaired its own function by
replacing the specialised cells by connective tissue and connective tissue-
2o producing cells.
Whether fibrosis occurs, or indeed the extent of the fibrosis, is influenced
by a variety of factors, including the nature, severity and location of the
injury to be healed. Fibrosis is most commonly known as scars on the
2s surface of the skin, where it is relatively un-troublesome, except in
scarring
over large areas. However, fibrosis can also occur in the tissues of internal
organs e.g. liver, lung and kidney. In most cases, it is fibrosis in these
areas
that is most serious because the specialised activity of that organ is
impaired. In the most extreme cases organ failure or death can occur
3o because of that impairment.
CA 02546401 2006-05-17
WO 2005/050203 PCT/GB2004/004795
An example of the importance of fibrosis in the disease-state is
demonstrated by the occurrence of fibrosis of the kidney (diabetic
nephropathy) in diabetes mellitus, a disease now reaching epidemic
s proportions worldwide.
The incidence of diabetes mellitus has undergone a global increase in recent
years. In particular this is due to a dramatic increase in type 2 diabetes
(late-
onset diabetes) (Silink M (2002), Horm. Res. 57 (Suppl 1) pp. 1-5).
1o Diabetes mellitus is closely linked to a number of secondary complications,
especially microvascular related complications. These complications,
including the fibrotic condition nephropathy, usually develop a number of
years after the onset of diabetes.
1s Diabetic nephropathy is characterised by excessive deposition of
extracellular matrix proteins in the mesangium and basement membrane of
the glomerulus and in the renal tubulointerstitium.
Genetic background is thought to be important in determining susceptibility
2o to diabetic nephropathy (DN) (Quinn M et al., (1996) Diabetologica 39 pp
940-945), but the crucial initiating factor is believed to be exposure of
tissues to chronic hyperglycaemia (UI~PDS Group, (1998) Lancet 352 pp.
837-853). The prevalence of nephropathy varies according to geographical
location, type of diabetes, and the length of time since diagnosis.
2s Notwithstanding influencing factors, the prevalence of diabetic nephropathy
is predicted to increase in the decades ahead (Bagust A et al. (2002)
Diabetes Med 9.9 (Suppl 4): ppl-5). Diabetic nephropathy is a major cause
of end-stage renal disease, and new therapeutic approaches are required to
limit its development.
2
CA 02546401 2006-05-17
WO 2005/050203 PCT/GB2004/004795
The pathology of diabetic nephropathy is similar in types 1 and 2 diabetes.
Both types of diabetes are associated with similar ultrastructural changes
occurring in kidney glomeruli (Osterby R, (1992) Diabetologica 35 pp 803-
812). The glomerular basement membrane increases in thickness, and the
s extracellular matrix of the inesangium expands.
It is expansion of the mesangium that is thought to be the main cause of
reduced renal function in diabetic nephropathy (Steffes M et al. (1989)
Diabetes 38 pp1077-1081). As the mesangial matrix expands, it impinges
on glomerular capillaries, reducing the surface available for filtration and
narrowing or occluding the lumen. Tubulointerstitial fibrosis also occurs in
diabetic nephropathy, in addition to glomerulosclerosis. The progressive
loss of renal function correlates with the occurrence of advancing
interstitial
fibrosis in other renal disorders (Risdon R et al. (1968) Lancet 2 7564
is pp363-366).
Fibrotic disease is commonly associated with an imbalance in growth
factors and hormones, which in turn influence the production of protein
expression. The abnormal protein expression in turn leads to the formation
of fibrosis. For example, fibrosis is commonly influenced by an increase in
transforming growth factor-(~ present in the fibrotic tissue.
Fibrosis is one of the largest groups of disorders for which there is no
effective therapy, in part because the mechanism underlying these disorders
2s is influenced by a variety of factors and exact cellular mechanisms have
not
been elucidated. Therefore, there is a laclc of understanding of which, or the
nature of molecular targets which may provide targets around which anti-
fibrotic therapies may be based.
3
CA 02546401 2006-05-17
WO 2005/050203 PCT/GB2004/004795
In the case of diabetic nephropathy, studies have shown that glucose can
induce matrix synthesis, at least in part, by the actions of transforming
growth factor-(3 (TGF-Vii) (Ziyadeh F et al. (2000) P~oc Natl Acad Sci USA
97 pp. 8015-8020).
s
However, TGF-~i has a number of physiological roles including
involvement in immunity and epithelial proliferation (McCartney-Francis N
et al. (1998) Iut. Rev. If~zmuhol. 16 pp. 553-580). These varying
physiological effects mean that TGF-~ is unlikely to be a clinically
1o advantageous target. Blocking the actions of TGF-~i may have multiple
effects on the organism, causing unwanted and potentially serious side
effects.
Transforming growth factor-~i causes fibrosis by the direct induction of
is collagen and matrix synthesis. Additionally, TGF-~i is also able to induce
the expression of other molecules that take part in andlor influence the
pathways causing fibrosis. One such protein is connective tissue growth
factor (CTGF), which induces proliferation, collagen synthesis and
chemotaxis in mesenchymal cells (Moussad E et al. (2000) Molec Genet
2o Metab. 71 pp.276-292). CTGF (CCN2) is a 38 kDa secreted protein with
multiple domains, encoded by an immediate-early gene and is a member of
the CCN protein family (Bork et al. (1993) Feb,r Lett. 327 pp 125-130;
Perbal et al. (2001) Mol. Pathol. 54 pp 57-79). However, the molecular
mechanisms) by which it functions have not been fully elucidated. The
25 presence of multiple domains in CTGF suggests that it interacts with a
plurality of other factors. CTGF has been shown to directly bind BMP4 and
TGF-~3 through its von Willebrand type C domain, leading to inhibition of
BMP and enhancement of TGF-~ signalling (Abreu et al. (2002) Nat. Cell.
Biol. 4 pp. 599-604).
4
CA 02546401 2006-05-17
WO 2005/050203 PCT/GB2004/004795
CTGF has also been shown to bind to integrins (Babic et al. (1999) Mol.
Cell Biol. 19 pp.3811-3815) and it is possible that this interaction is
important in mediating some of the cellular phenomena that CTGF induces.
s
CTGF is over-expressed in a variety of fibrotic disorders, including diabetic
nephropathy (Wahab N et al. (2001) Biochefn J. 359 pp.77-87). In fact,
increasing levels of CTGF expression have been shown to correlate with
increasing severity and speed of progression of diabetic nephropathy (Ito Y
to et al. (1998) .Kidney hZt. 53 pp.853-886).
Hence, CTGF may be a potentially useful molecular indicator of the fibrotic
response. CTGF has not yet been shown to directly induce renal fibrosis in
vivo, but, when injected subcutaneously along with TGF-~, induces
1s sustained dermal fibrosis in rats (Mori T et al. (1999) J. Cell. Physiol.
181
pp 153-159).
In the process of developing this invention, the inventors have demonstrated
that CTGF interacts with a cellular receptor, the TrkA receptor, in order to
2o induce intracellular signalling cascades related to the formation of
fibrosis.
There axe three Trk receptor tyrosine lcinase genes (TrkA, TrkB and TrkC).
On binding its ligand, the Trk receptor dimerizes and autophosphorylates,
leading to the activation of several small G proteins, including Ras, Rap-l,
~s and the Cdc 42-Rac-Rho family, as well as of pathways regulated by MAP
kinase, PI3-kinase, and phospholipase C-y (PLC y) (Segal, 2003). Activated
Trk receptors also interact, directly or indirectly, with a variety of
cytoplasmic adaptor proteins to produce a number of biological responses
including, cell proliferation and survival; axonal and dendritic growth, and
CA 02546401 2006-05-17
WO 2005/050203 PCT/GB2004/004795
remodelling; assembly and remodelling of cytoskeleton; membrane
trafficking and fusion; and synapse formation, function, and plasticity
(Huang E and Reichardt L, (2003) Afzuu. Rev. Biochem. 72 pp. 609-642).
s The work by the inventors described in the examples, has shown that Trk
tyrosine kinase activity is required for the CTGF-dependent induction of
intracellular signalling molecules implicated in fibrosis. This work has led
to the establishment of a method of identifying and making compounds that
can interact with the CTGF receptor and/or an agonist of the CTGF receptor
1o in order to reduce or prevent fibrosis.
Therefore, in a first aspect of the invention is provided a method for
identifying and/or making compounds for use in reducing and/or preventing
fibrosis, comprising the steps:
(a) providing a CTGF receptor
(b) providing a test sample
(c) providing a CTGF receptor agonist
(d) exposing the CTGF receptor to the test sample
(e) subsequently or simultaneously exposing the CTGF receptor to the
2s CTGF receptor agonist
(f) detecting and/or measuring the amount of CTGF receptor activation
6
CA 02546401 2006-05-17
WO 2005/050203 PCT/GB2004/004795
(g) comparing the amount of CTGF receptor activation in the presence of a
test sample to the amount of CTGF receptor activation detected and/or
measured in the absence of a test sample;
s (h) determining if a compound reduces and/or prevents fibrosis on the basis
that it causes no increase or a decrease in CTGF receptor activation.
By "CTGF receptor agonist" we mean a compound acting at the CTGF
receptor to produce an effect that is substantially the same as that of the
1o effect produced by CTGF interacting with the receptor. We also include
derivatives, analogues and fragments of CTGF receptor agonists that are
capable of producing substantially the same effect as CTGF interacting with
the CTGF receptor. CTGF receptor agonists, other than CTGF itself, can be
readily identified by measurement and/or detection of CTGF receptor
1s autophosphorylation, receptor induced protein phosphorylation and TIEG
expression using the methods presented in Example 1.
By "derivative" we mean a CTGF receptor agonist compound, additionally
having at least one chemical modification of one or more of its amino acid
2o side groups, a-carbon atoms, terminal amino group, or terminal carboxylic
acid group. A chemical modification includes adding chemical moieties,
creating new bonds, and removing chemical moieties. Modifications at
amino acid side groups include acylation of lysine e-amino groups, N-
allcylation of arginine, histidine, or lysine, alkylation of glutamic or
aspartic
2s carboxylic acid groups, and deamidation of glutamine or asparagine.
Modifications of the terminal amino include the des-amino, N-lower alkyl,
N-di-lower alkyl, and N-acyl modifications. Modifications of the terminal
carboxy group include the amide, lower alkyl amide, dialkyl amide, and
lower alkyl ester modifications. A lower alkyl is a C 1 -C4 alkyl.
3o Furthermore, one or more side groups, or terminal groups, may be protected
7
CA 02546401 2006-05-17
WO 2005/050203 PCT/GB2004/004795
by protective groups l~n.own to the ordinarily spilled protein chemist. The a-
carbon of an. amino acid may be mono- or di-methylated.
By "analogue" we mean a CTGF receptor agonist having a modification
s including one or more amino acid substitutions, deletions, inversions, or
additions and capable of producing an effect that is substantially the same as
that of the effect produced by CTGF interacting with the receptor.
By "fragment" we mean a portion of a CTGF receptor agonist capable of
1o producing an effect that is substantially the same as that of the effect
produced by CTGF interacting with the receptor.
Optionally the method further comprises the step of isolating the compound
which is capable of reducing and/or preventing fibrosis. The isolated
15 compound may then optionally be formulated into a composition further
comprising a pharmaceutically acceptable carrier, excipient and/or diluent.
Preferably, CTGF receptor activation is detected and/or measured by
detecting andlor measuring at least one of the following activities: CTGF
2o receptor autophosphorylation, CTGF receptor-induced protein
phosphorylation or CTGF induced expression of TIEG. Typical methods of
measuring these activities are provided in Examples 1 and 2.
Preferably the CTGF receptor agonist is CTGF.
Preferably the CTGF receptor is the TrlcA receptor.
Conveniently the compound affects directly the interaction between the
CTGF receptor and an agonist thereof. In other words, the compound
8
CA 02546401 2006-05-17
WO 2005/050203 PCT/GB2004/004795
interacts directly with the CTGF receptor or agonist thereof in order to
reduce the activation of the CTGF receptor.
Alternatively, the compound affects indirectly the interaction between the
s CTGF receptor and an agonist thereof. In other words, the compound
interacts with the CTGF receptor or agonist thereof indirectly via at least
one further compound in order to reduce the activation of the CTGF
receptor.
1o Conveniently, the compound identified and/or made by the method
described above is an antagonist of a tyrosine kinase.
By "antagonist" we mean a compound acting at the CTGF receptor to
inhibit and/or prevent the effect produced by CTGF or a CTGF receptor
1s agonist interacting with the receptor. We also include derivatives,
analogues
and fragments of CTGF receptor antagonists that are capable of preventing
and/or inhibiting the effect of CTGF and/or a CTGF receptor agonist
interacting with the CTGF receptor. CTGF receptor antagonists, can be
readily identified by measurement and/or detection of CTGF receptor
2o autophosphorylation, receptor induced protein phosphorylation and TIEG
expression using the methods presented in Example 1.
In a second aspect of the invention there is provided a compound for use in
the reduction and/or prevention of fibrosis characterised in that it inhibits
2s and/or prevents CTGF receptor activation; and more preferably inhibits
and/or prevents at least one of the following activities: CTGF receptor
autophosphorylation; CTGF receptor-induced protein phosphorylation;
and/or induction of TIEG.
9
CA 02546401 2006-05-17
WO 2005/050203 PCT/GB2004/004795
Preferably the compound is identified and/or made by the method of the
first aspect of the invention.
Conveniently, the compound is at least one selected from polypeptides,
antibody molecules and antisense nucleotides. Preferably the compound is
an antibody molecule.
The term "antibody molecule" shall be talcen to refer to any one of an
antibody, an antibody fragment, or antibody derivative. It is intended to
to embrace wildtype antibodies, synthetic antibodies, recombinant antibodies
or antibody hybrids, such as, but not limited to, a single-chain modified
antibody molecule produced by phage-display of immunoglobulin light
and/or heavy chain variable and/or constant regions, or other
immunointeractive molecule capable of binding to an antigen in an
is immunoassay format that is known to those skilled in the art.
The term "antibody derivative" refers to any modified antibody molecule
that is capable of binding to an antigen in an immunoassay format that is
known to those skilled in the art, such as a fragment of an antibody (e.g. Fab
20 or Fv fragment), or a modified antibody molecule that is modified by the
addition of one or more amino acids or other molecules to facilitate
coupling the antibodies to another peptide or polypeptide, to a large carrier
protein or to a solid support (e.g. the amino acids tyrosine, lysine, glutamic
acid, aspartic acid, cysteine and derivatives thereof, NHZ-acetyl groups or
2s COOH-terminal amido groups, amongst others).
By "antisense oligonucleotides" we mean single-stranded nucleic acids,
which can specifically bind to a complementary nucleic acid sequence. By
binding to the appropriate target sequence, an RNA-RNA, a DNA-DNA, or
3o RNA-DNA duplex is formed. These nucleic acids are often termed
CA 02546401 2006-05-17
WO 2005/050203 PCT/GB2004/004795
"antisense" because they are complementary to the sense or coding strand
of the gene. Recently, formation of a triple helix has proven possible where
the oligonucleotide is bound to a DNA duplex. It was found that
oligonucleotides could recognise sequences in the major groove of the DNA
s double helix. A triple helix was formed thereby. This suggests that it is
possible to synthesise sequence-specific molecules which specifically bind
double-stranded DNA via recognition of major groove hydrogen binding
sites.
to By binding to the target nucleic acid, the above oligonucleotides can
inhibit
the function of the target nucleic acid. This could, for example, be a result
of blocking the transcription, processing, poly(A)addition, replication,
translation, or promoting inhibitory mechanisms of the cells, such as
promoting RNA degradations.
Antisense oligonucleotides are prepared in the laboratory and then
introduced into cells, for example by microinjection or uptake fiom the cell
culture medium into the cells, or they are expressed in cells after
transfection with plasmids or retroviruses or other vectors carrying an
antisense gene.
Alternatively, the compound is a tyrosine kinase receptor inhibitor.
Preferably the tyrosine kinase inhibitor is selected from the group consisting
of BSF-466895, AP-23451, AP-23464, AP-23485, AZD-0530, AP-22408,
2s RG-13022, RG-13291, RG-14620, RP 53801, CEP-075, CEP-2563
dihydrochloride, CHIR-200131, CHIR-258, c jun kinase, I~ST-638, KF-
250706, MNAC- .13, anti-EphA2 Mabs, MLN-608, AG-957, lavendustin A
analogues, NSC-330507, NSC-680410, phenylalanine derivatives, SH2
inhibitors, AG-1295, EGF-genistein, erbstatin, genistein, neuT Mab, PPl,
3o TT-232, CGP-52411, CGP-53716, CGP-57148, imatinib, NVP-AAK980-
11
CA 02546401 2006-05-17
WO 2005/050203 PCT/GB2004/004795
NX, NV-50, phenoxodiol, FAK inhibitors, IGF-1 , Met receptor inhibitors,
TIE-2 inhibitors, CP-X64959, PN-355, CP-127374, FCE-26806, FGFR-3
inhibitors, Met RTK antagonists, PD-171026, PD-173956, PD-180970, Src
non-RTK antagonists, kahalalide F, CCX2, celastrol, TAK-165 ,TG-100-13,
s TG-100-96, desmal, U3-1566 and SKI-606.
Preferably the compound is a CTGF receptor antagonist.
In a third aspect of the invention there is provided a compound of the
to second aspect of the invention for use in the treatment and/or prevention
and/or diagnosis of a fibrotic disease.
Preferably the compound of the second aspect of the invention is used in the
manufacture of a medicament for the treatment and/or prevention and/or
is diagnosis of a fibrotic disease.
Conveniently the fibrotic disease is one selected from diabetic nephropathy,
non-diabetic kidney fibrosis, lung fibrosis, liver fibrosis (cirrhosis),
skeletal
muscle fibrosis, cardiac muscle fibrosis, atherosclerosis, systemic sclerosis,
2o scleroderma, retinal fibrosis, radiation fibrosis, keloid scar formation
and
cancer-associated fibrosis
Preferably the disease is diabetic nephropathy.
25 In a fourth aspect of the invention there is provided a method of treating
and/or preventing fibrotic disease comprising administering a
therapeutically or prophylactically effective dose, or plurality of doses, of
a
compound identified and/or made according to the method of the first
aspect of the invention.
12
CA 02546401 2006-05-17
WO 2005/050203 PCT/GB2004/004795
Conveniently the fibrotic disease is one selected from diabetic nephropathy,
non-diabetic kidney fibrosis, lung fibrosis, liver fibrosis (cirrhosis),
skeletal
muscle fibrosis, cardiac muscle fibrosis, atherosclerosis, systemic sclerosis,
scleroderma, retinal fibrosis, radiation fibrosis, keloid scar formation and
s cancer-associated fibrosis
Preferably the disease is diabetic nephropathy.
In a fifth aspect of the invention there is provided a use of an agent capable
Io of binding to a CTGF receptor agonist in the treatment and/or prevention
and/or diagnosis of a fibrotic disease.
In a sixth aspect of the invention there is provided a use of an agent capable
of binding to a CTGF receptor agonist in the manufacture of a medicament
1s for the treatment and/or prevention and/or diagnosis of a fibrotic disease.
Preferably, the fibrotic disease is selected from one or more of diabetic
nephropathy, no-diabetic kidney fibrosis, lung fibrosis, liver fibrosis
(cirrhosis), skeletal muscle fibrosis, cardiac muscle fibrosis,
atherosclerosis,
2o systemic sclerosis, scleroderma, retinal fibrosis, radiation induced
fibrosis
keloid scar formation and cancer-associated fibrosis.
In a seventh aspect of the invention there is provided a use of an agent
capable of binding to a CTGF receptor agonist in a method of reducing
2s and/or preventing binding of a CTGF receptor agonist to a CTGF receptor
i~c vivo or ih vita°o.
By "an agent capable of binding to a CTGF receptor agonist" we include a
compound, nucleic acid, polypeptide or antibody that is capable of
3o physically associating with a CTGF receptor agonist. Binding between
13
CA 02546401 2006-05-17
WO 2005/050203 PCT/GB2004/004795
such an agent and a CTGF receptor agonist may occur by ionic, electrostatic
and/or covalent interaction. Preferably, the binding of an agent to a CTGF
receptor agonist will reduce and/or prevent the ability of the CTGF receptor
agonist to bind to and/or associate with and/or activate a CTGF receptor.
s
Preferably, in the seventh aspect of the invention the agent capable of
binding to a CTGF receptor agonist is a GTGF receptor. Alternatively, the
agent capable of binding to a CTGF receptor agonist is a CTGF receptor
joined to the Fc-region of an iinmunoglobulin.
By "Fc-region" we include the "fragment crystallisable" region of an
antibody. By "immunoglobulins" we include polypeptides comprising one
or more immunoglobulin complementarity-determining region (CDR), such
as antibodies, B cell receptors or T cell receptors, or fragments thereof.
Is Preferably, the immunoglobulin is an antibody. More preferably, the
immunoglobulin is IgG.
Preferably, in the seventh aspect of the invention there is provided a use
wherein the CTGF receptor is the TrkA receptor. Alternatively, the CTGF
2o receptor is a soluble form of the TrkA receptor.
It will be understood that the term "soluble form" includes a form a form of
a polypeptide that is not associated with or inserted in the membrane of a
cell and which can exist in solution without aggregating.
Preferably, in the fifth, sixth and seventh aspects of the invention the CTGF
agonist is CTGF.
In an eighth aspect of the invention there is provided a nucleic acid
encoding the Trl~A receptor joined to an Fc-region of an im~nunoglobulin.
14
CA 02546401 2006-05-17
WO 2005/050203 PCT/GB2004/004795
In a ninth aspect of the invention there is provided a vector containing a
nucleic acid according to the eighth aspect of the invention.
s In a tenth aspect of the invention there is provided a polypeptide
comprising
the TrkA receptor joined to an Fc-region of an immunoglobulin.
In an eleventh aspect of the invention there is provided a cell containing a
nucleic acid according to the eighth aspect of the invention and/or a vector
to according to the ninth aspect of the invention and/or a polypeptide
according to the tenth aspect of the invention.
In a twelfth aspect of the invention there is provided a pharmaceutical
composition comprising a nucleic acid according to the eighth aspect of the
1s invention and/or a vector according to the ninth aspect of the invention
and/or a polypeptide according to the tenth aspect of the invention and/or a
cell according to the eleventh aspect of the invention, and a
pharmaceutically acceptable carrier or exipient, the nucleic acid and/or the
vector and/or the polypeptide and/or the cell being present in an effective
2o amount to treat and/or prevent and/or diagnose a fibrotic disease.
By "effective amount" we include an amount that is sufficient to treat
and/or prevent and/or diagnose a fibrotic disease. An effective amount may
be determined by use of methods known to those in the art.
Examples embodying certain preferred aspects of the invention will now be
described with reference to the following figures in which:-
Figure 1 - CTGF activates intracellular signalling pathways
15
CA 02546401 2006-05-17
WO 2005/050203 PCT/GB2004/004795
Serum-starved human mesangial cells (HMC) incubated in the presence of
CTGF/VS fusion protein for the periods of time indicated. Equal amounts of
cellular lysate protein were subjected to SDS=PAGE and analysed by
Western blotting using phospho-specific antibodies against the constituent
s proteins of (A) the MAPK pathway, (B) JNK, and (C) PKB and CamKII. (3-
actin is shown as a marker for equal protein loading. D) Cells were grown
on coverslips and serum-starved for 48 hours prior to incubation in medium
in the absence (a) and (c), or presence of 40 ng/ml CTGF-fusion protein (b)
and (d) for 30 min. Cells were fixed, permeabilized, probed with anti-
1o phospho PKC 8 (a) and (b) and PKC a (c) and (d) primary antibodies, and
then with fiuorescein-conjugated secondary antibody. Results are
representative of three separate experiments.
Figure 2 - CTGF induces tyrosine phosphorylation of different proteins
1s
Serum-starved HMC were incubated in the presence of 40 ng/ml CTGF/VS
fusion protein for the periods of time indicated. Equal amounts of cellular
lysate protein were subjected to SDS-PAGE and analysed by Western
blotting using anti-phosphotyrosine antibody. Results are representative of
2o three separate experiments.
Figure 3 - CTGF interacts with I~MfC surface proteins
CTGF/VS fusion protein was allowed to bind to the cell surface, and then
25 chemically cross-linked to its ligands with BS3, after which a membrane-
enriched fraction was prepared from the cells. Cross-linked CTGF
complexes were immunoprecipitated using rabbit anti-CTGF antibody,
resolved by SDS-PAGE, and analysed by Western blotting using chiclcen
anti-CTGF antibody (lane 2). The cross-linking step was omitted for some
3o cultures (lane 1). Results are representative of three sepaxate
experiments.
16
CA 02546401 2006-05-17
WO 2005/050203 PCT/GB2004/004795
Figure 4 - CTGJF interacts with TrkA and p75NTR in IBC
(A) Serum-starved HMC were incubated in the absence (lane 1) or presence
s (lane 2) of CTGF/VS fusion protein (40 ng/ml) for 15 min, after which
cell lysates were prepared in RIPA buffer. Equal amounts of lysate
protein were immunoprecipitated using anti-phosphotyrosine beads.
Bound proteins were resolved by SDS-PAGE and analysed by Western
blotting using an antibody against TrkA.
to
(B) HMC were incubated in the absence (lane 1) or presence (lane 2) of His
tagged-CTGF/VS fusion protein (200 ng/ml) for 2 h at 4°C to allow
binding to cell surface receptors, after which the protein was chemically
cross-linked with DTSSP. A membrane-enriched fraction was prepared
1s and solubilised. Equal amounts of solubilised protein were incubated
with metal affinity beads. Bound proteins were subjected to SDS-PAGE
under reducing conditions, and Western blotting using an antibody
against TrkA
20 (C) HMC were incubated with 200 ng/ml rCTGF (FibroGen Inc.) for 2
hours at 4°C. Bound CTGF was cross-linked as above, and a
membrane-enriched fraction prepared and solubilised. Cross-linked
CTGF-complexes in the solubilised fraction were captured on anti-C-
tenninus-CTGF antibody affinity beads (lane 1), or the fraction was
2s incubated with control IgG affinity beads (lane 2). Bound proteins were
analysed by Western blotting using anti-TrkA antibody.
(D) The sample shown in lane 1 of Figure 4C, was boiled for a longer time
and then Western blotted using anti-TrkA antibody.
17
CA 02546401 2006-05-17
WO 2005/050203 PCT/GB2004/004795
(E) Blot (D) was stripped and re-probed using anti-p75NTR antibody.
Results are representative of 4 separate experiments.
s Figure 5 - ~C expresses Trk receptors
Total RNA was extracted from I3MC and used for RT-PCR. After
amplification, 10 ~.l of each PCR reaction product was electrophoresed
through a 1.2% (w/v) agarose gel containing ethidium bromide (0.5 ~.g/ml).
to Results are representative of three separate experiments.
Figure 6 - CTGF activates TrkA in IIIVIC
Serum-starved HMC were incubated in the absence (lane 1) or the presence
15 (lane 2) of CTGF/VS (40 ng/ml) for 15 min. Equal amounts of cellular
lysate protein were subjected to SDS-PAGE and analysed by Western
blotting. Blot A was probed with anti-TrkA antibody. Blot B was probed
with anti-phospho-TrkA. (Tyr490) antibody, while blot C was probed with
anti-phospho-TrkA (Tyr674/675). Results are representative of three
2o separate experiments.
Figure 7 - Stimulation of TIED levels by CTGF in I~NdC
Serum-starved HMC were exposed to rCTGF/VS fusion protein for
25 different periods of time, after which cell lysates were prepared and the
TIEG and b-actin levels analysed by Western blotting. A representative blot
of the three independent experiments (three replicate cultures per condition
per experiment) that were performed is shown.
18
CA 02546401 2006-05-17
WO 2005/050203 PCT/GB2004/004795
Figure 8 - TIED mediates C'fGF-dependent down-regulation of Stead 7
expression level.
Serum-starved HMC were exposed to the conditions indicated in the figure.
s After 24 h, cell lysates were prepared, and the TIEG, Smad 7, and b-actin
levels analysed by Western blotting. A representative blot of the three
independent experiments (three replicate cultures per condition per
experiment) that were performed is shown.
to
19
CA 02546401 2006-05-17
WO 2005/050203 PCT/GB2004/004795
EXAMPLES
Exczrnpde 1-Identificcztiosz of CTGF- TrkA itzteraction
Materials and Methods
Cell cultures antibodies and reagents
Primary normal adult human mesangial cells (HMC) (CC-2259, lot 3F1510)
to (Biowhittaker, Wokingham, Berkshire, U.K.) were maintained in culture as
described previously (Wahab N et al. (1996) Bioclzetn J. 316 pp.985-992).
Confluent post-exponential-phase cultures of HMCs (passage 6-8) were
maintained in culture medium containing 10% (v/v) foetal calf serum and 4
is mM (normoglycaemic), 11, 15 or 30 mM (hyperglycaemic) d-glucose for
periods of up to 4 weeks. At the end of each week cultures were washed
extensively with ' PB S and were used either for RNA extraction or for
culture for 24 h in glucose supplemented medium in the absence of serum.
2o Phospho-Akt antibody (P-Ser 472/473/474) (Pharmingen, San Diego; CA,
USA), Phospho-Akt (P-Thr 30~) (Sigma, Gillingham, Dorset, UK) and
ERKS antibodies (Sigma, Gillingham, Dorset, UK) were used.
Phospho-ERK1/2 pathway sampler, phospho-JNK pathway sampler,
2s phospho P3 8 MA PK pathway sampler, phospho-PKC d, phospho-PKC a,
phospho-TrkA (Tyr674/675), phospho-TrkA (Tyr490) antibodies were from
New England BioLabs (Hitchen, Herts., UK). Phospho-CaMKII (P-Thr286)
antibody was from Promega (Southampton, Hants., UK) and anti-phospho-
tyrosine antibody was from Santa Cruz (Autogen Bioclear, Calne, Wilts.,
3o UK). Anti-TrkA antibody was obtained from Upstate Biotechnology
CA 02546401 2006-05-17
WO 2005/050203 PCT/GB2004/004795
(Milton Keynes, UK). Anti-TIEG-1 antibody was a gift from Dr. Steven
Johnson (Mayo Foundation, Minnesota, USA). K-252a was purchased from
Calbiochem (Nottingham, UK). Recombinant CTGF (CTGF/V5 fusion
protein) was expressed in transformed HMC and purified from the medium
s using Talon metal affinity resin, (Wahab N et al. (2001) Biochern J. 359
pp.77-87). Alternatively, r-CTGF (non-fusion protein) was expressed in the
baculovirus system and was a gift from FibroGen Inc. (South San
Francisco, CA, USA). Rabbit anti-CTGF (pAb2) and chicken anti-CTGF
(pIgY3) were also supplied by FibroGen Inc.
to
Cross linking and membrane preparation
Cell layers were washed twice with cold binding buffer (PBS and
0.5°l°
glucose) and incubated with CTGF in binding buffer for 2 h at 4°C.
After
15 incubation, the cell layers were washed five times with cold binding buffer
and incubated with 1mM 3,3'-dithiobis(sulfosuccinilmidylpropionate)
(DTSSP) or disuccinimidyl suberate (DSS) (Pierce Biotechnology,
Tattenhall, Cheshire, UK) in PBS for 30 min at room temperature. The
reaction was halted for 15 min at room temperature by the addition of 50
ao mM Tris buffer pH 7.5.
Cell layers were washed with wash buffer (10 mM Tris buffer (pH 7.5),
5mM MgCl, 150 mM NaCI), scraped in an homogenising buffer (10 mM
Tris buffer (pH 7.5), 250 mM Sucrose, 1 mM EDTA, 5 mM MgCI, 150 mM
2s NaCI, and lx protease inhibitor cocktail (Roche Applied Science,
Mannheim, Germany), passed through a 25 gauge needle, and homogenised
on ice with 30-40 cycles in a Dounce homogeniser.
The homogenate was centrifuged for 10 min at 2500 x g at 4°C. The
3o resulting supernatant was centrifuged for 90 min at 45000 x g at
4°C. The
21
CA 02546401 2006-05-17
WO 2005/050203 PCT/GB2004/004795
membrane-enriched pellet was solubilised for 1 h in solubilising buffer (10
mM Tris buffer (pH 7.5), 5 mM MgCl, 150 mM NaCI, 1% Triton-X100, 1x
protease inhibitor cocktail (Roche, see above)). Soluble~membrane proteins
were collected after further centrifugation for 1 hour at 45000 x g at
4°C.
s
Where rCTGF/VS fusion protein was used, CTGF-cross linked proteins
were either immunoprecipitated with rabbit anti CTGF antibody, or
captured on a Pull-Down PolyHis column (Pierce Biotechnology,
Tattenhall, Cheshire, UK).
to
Where rCTGF was used, CTGF-cross linked proteins were captured on a
goat anti-CTGF-C terminal domain-Sepharose immunoaffinity column,
using an IgG-Sepharose column as a control (FibroGen Inc.). After
extensive washing of the columns with solubilising buffer, bound proteins
1s were solubilised in reducing SDS-PAGE loading buffer, boiled for 5 min
and resolved on 4-12% gradient gels by SDS-PAGE. Gels were either
stained with Coomassie blue, or were used for Western blotting.
RNA extraction and RT-PCR analysis
Total RNA was extracted from 6 x 106 mesangial cells using the RNAzoI B
method (AMS Biotechnology (UK) Ltd., Oxfordshire, UI~). Equal amounts
of total RNA (2 ~.g) from each sample were reverse transcribed into cDNAs
using Superscript II RNase H+ reverse transcriptase (Gibco BRL, Paisley,
2s Scotland, UK) and random primers.
Equal amounts (0.5 ~l) of the reverse transcription reaction (20 ~l) were
subjected to PCR amplification in a 100 ~.l volume containing 10 ~l of 10 x
PCR buffer, 16 ~l dNTPs (1.25 mM each), 2 mM MgCl2, 5 M betaine
(Sigma), 0.5 ~.M of each specific primer and 1.25 U Amplitaq DNA
22
CA 02546401 2006-05-17
WO 2005/050203 PCT/GB2004/004795
polymerase (Gibco BRL). Amplification was started with 5 min of
denaturation at 94°C followed by 30 PCR cycles for all genes. Each
cycle
consisted of 60 s at 94°C, 60 s at SS°C and 60 s at 72°C.
The final extension
was for 10 min at 72°C. The sequences of primers to amplify TrkA, TrkB
s and TrkC p75NTR, NGF, BDGF were as described by Anderson et al. (2002)
J. Clip. Ehdocf°inol. Metab. 87 pp. 890-897 and shown in Table 1
(adapted
from Table I in Anderson et al. (2002)).
TABLE 1
to
Target Prirraer Sequence 5'-3'
TrkA. Forward TCTTCACTGAGTTCCTGGAG
TrkA Reverse TTCTCCACCGGGTCTCCAGA
TrkB Forward AGTCCAGACACTCAGGATTTGTAC
TrkB Reverse CTCCGTGTGATTGGTAACATG
trTrkB Forward CATGTTACCAATCACACGGAGTA
trTrkB Reverse CCATCCAGTGGGATGTTATGAAA
TrkC Forward CATCCATGTGGAATACTACC
TrlcC Reverse TGGGTCACAGTGATAGGAGG
Western blotting
Cells were lysed in reducing SDS-PAGE loading buffer and immediately
15 scraped off the plate. Cell lysates were sonicated for 10 seconds to shear
the
DNA. Samples were then boiled for 5 minutes and resolved on 4-12%
gradient gels by SDS-PAGE. Proteins were transferred onto a
polyvinylidene difluoride membrane filter (Immobilin-P, Millipore,
Bedford, LTK) using a BioRad transfer apparatus. Blots were incubated in
2o blocking buffer containing 1Y TBS, 0.1% Tween-20 with 5% (wlv) non-fat
dry milk, for 1 h.
23
CA 02546401 2006-05-17
WO 2005/050203 PCT/GB2004/004795
Immunodetection was performed by incubating the blots in primary
antibody at the appropriate dilution in antibody dilution buffer (lx TBS,
0.1% Tween-20 with 5% BSA), overnight at 4°C. Blots were then washed 3
times with washing buffer (1x TBS, 0.1 % Tween-20) and incubated with
secondary horseradish peroxidase (HRP)-conjugated antibodies for 1 h at
room temperature.
Bound antibodies were visualised using the enhanced chemi-luminescence
to reagent Luminol (Autogen Bioclear UI~ Ltd, Wiltshire, UK). Pre-stained
molecular weight standards (Amersham International PLC, Amersham, UK)
were used to monitor protein migration.
Immunofluorescence staining
1s
Cells were fixed with 3.7% paraformaldehyde and permeabilized with 0.5%
Triton X-100 in PBS for 10 min at room- temperature. Coverslips were then
incubated overnight at 4°C with serum (5°l° in PBS) from
the same species
as that in which the secondary antibody was raised. After the first
2o incubation, the coverslips were incubated with primary antibodies (at
optimum dilution in PBS containing 3% BSA) for 1 h at 37°C.
The coverslips were then washed and incubated in the dark for 1 h with
fluorescein-conjugated secondary antibody (Sigma Aldrich, Dorset, UK).
2s After staining, the coverslips were mounted on glass slides with anti-fade
mounting media (Vector Labs, Peterborough, U.K.) and examined using a
fluorescence microscope.
24
CA 02546401 2006-05-17
WO 2005/050203 PCT/GB2004/004795
~~Sd3~$S
CTGF activates several intracellular si~,nallin~ pathways
Purified rCTGF-VS fusion protein was used to identify the intracellular
signal pathways which are activated in response to the growth factor in
HMC. CTGF was found to rapidly trigger the activation of the classical
MAPK (ERKI/2) and JNK pathways (Figures 1A and B) but not the p38
MAPK. Figure 1 shows the maximal activation of these l~inases after 15
min of CTGF stimulation.
CTGF stimulation also led to the activation of Alct, also known as protein
kinase B (PKB), at both the known phosphorylation sites; Thr-308 and Ser-
fs 473 (Figure 1C). The activation of Thr-308 appears to be rapid and
sustained in comparison to the activation of ser- 473.
Activation of Thr-308 is influenced by a phosphoinositide-dependent kinase
1, or PDKl, whose activity is strictly dependent on 3-phosphorylated
2o inositol lipids (Downward J (1998) Curr. Opin. Cell Biol. 10 ppl262-267).
Phosphorylation of Ser-473 is conducted by integrin-linked kinase (ILK)
(Attyvell et al. (2000) ~hcogehe 19 pp. 3 811-3 815), and appears to be
transient with a maximal level at 15 min, and return to a level close to the
basal one within 30 min of CTGF exposure.
CTGF stimulation also led to the transient activation of Cam KII (Figure
1C). ~ther kinases which are activated in response to CTGF are PKC ~ and
PKC a (Figure 1D).
CA 02546401 2006-05-17
WO 2005/050203 PCT/GB2004/004795
CTGF interaction with a receptor
Figure 1 demonstrates that CTGF provides a signal to downstream
signalling proteins through a receptor that activates the above-mentioned
s kinases. These kinases are normally activated by a receptor tyrosine kinase
(RTK).
The possibility of CTGF acting through a receptor tyrosine kinase (RTK)
was tested by exposing HMC to CTGF for different periods of time. Cell
lysates were prepared from the HMC cells and Western Blot analysis
performed using an anti-phospho-tyrosine antibody.
The results showed that CTGF fusion protein (40 ng/ml) stimulated tyrosine
phosphorylation within 10 min of at least two major proteins with apparent
1s ~MW of about 75-~0 and 140-150 kDa in HMC (Figure 2).
Another phosphotyrosine protein (MW 45 kDa) was detected in control cell
lysates but was reduced in response to the CTGF treatment.
2o CTGF interacts with Human Mesangial Cell (HMC) surface proteins
The interaction of CTGF with HMC surface proteins was investigated by
allowing CTGF to bind to the cell surface. A subsequent cross-linking
procedure was performed and a membrane-enriched fraction isolated from
2s the cells. After solubilisation this fraction was immunoprecipitated with a
rabbit-anti-CTGF antibody. Covalently linked CTGF complexes were then
analysed by PAGE and Western blotting with a chiclcen anti-CTGF
antibody.
26
CA 02546401 2006-05-17
WO 2005/050203 PCT/GB2004/004795
In Figure 3, CTGF appears to be cross-linked with membrane proteins to
form complexes of apparent molecular weight 85 kDa, 180 kDa and >220
kDa, the latter being a large diffused band (lane 2). These complexes were
not immunoprecipitated from the membrane-enriched fraction when the
s cross-linking step was eliminated (lane 1).
To ascertain whether CTGF activates an RTK a serum-starved HMC was
incubated in both the presence and absence of CTGF for 15 min. The cells
were lysed and phospho-tyrosine proteins immunoprecipitated. The
to immunoprecipitated proteins were analysed by Western blotting using
antibodies against a plurality of known tyrosine kinase receptors.
Figure 4A shows the cross-reacted anti-TrkA antibody (a band of about 140
kDa). The intensity of this band was stronger when cells were iilcubated
is with CTGF (lane 2), indicating activation by CTGF.
The interaction of CTGF with the TrkA receptor was confirmed by different
experiments in which either His-tagged CTGF/VS fusion protein, or rCTGF
expressed in the baculovirus system, was allowed to bind to the cell surface
2o and then cross-linked to its ligand(s) using the reversible cross-linker
DTSSP. The latter is then cleaved by reducing agents.
Subsequently, a membrane fraction was prepared and any cross-linked
CTGF complexes were captured on affinity metal beads, or on anti-C-
2s terminus CTGF antibody affinity beads. The captured complexes were
subjected to SDS-PAGE under reducing conditions and analysed by
Western blots.
Figures 4B, 4C, and 4D demonstrate that CTGF interacts with the TrkA
3o receptor.
27
CA 02546401 2006-05-17
WO 2005/050203 PCT/GB2004/004795
Trk receptors have previously been shown to interact with the pan
neurotrophin receptor p75NTR. Therefore, blots were stripped and re-
probed using an anti-p75NTR antibody. Figure 4E shows that the antibody
s cross-reacted with a protein of the correct molecular weight for P75NTR.
Thus the results demonstrate that CTGF interacts with the TrkA and
p75NTR receptors.
1o HMC ex~aress Trk receptors
The expression of Trk receptors by HMC was investigated by extraction of
total RNA from HMC for RT-PCR analysis to be performed on. Figure 5
shows that HMC express all three members of the Trk receptor family:
1s TrkA, TrkB, and TrlcC, as well as the pan receptor p75NTR.
CTGF activates TrkA in HMC
TrkA autophosphorylates several tyrosine residues on binding by its ligand,
20 leading to the association and activation of multiple effector molecules.
Phosphorylation at Tyr490 is required for Shc association and activation of
the Ras-MAP kinase cascade. Phosphorylations at Tyr674/675 lie within the
catalytic domain and reflect Trlc l~inase activity. Therefore we tested
whether stimulating cells with CTGF leads to the phosphorylation of TrlcA
2s at these residues. The results in Figure 6 clearly indicate that CTGF
induces
the phosphorylation of the receptor at these residues.
Inhibition of CTGF-induced signalling by K252a
28
CA 02546401 2006-05-17
WO 2005/050203 PCT/GB2004/004795
K252a is an alkaloid-like kinase inhibitor known to selectively inhibit
tyrosine l~inases. K252a blocked the protein phosphorylation of ERK1/2,
JNK and ERKS in HMC cells stimulated with CTGF. This indicted that the
phosphorylation of these kinases is induced by the tyrosine kinase receptor,
s trkA, and that a tyrosine kinase inhibitor is capable of inhibiting CTGF
mediated signalling.
CTGF induces expression of TIEG
1o Figure 7 shows that CTGF exposure causes a rapid increase in the
expression level of TIEG.
The ability of TIED to directly mediates the CTGF-dependent down-
regulation of Smad 7 levels was investigated by treating cells with TIEG
1s antisense and control oligonucleotides. Figure 8 shows that the
constitutive
levels of both TIEG and Smad 7 proteins in HMC are low (lane 1).
Incubating the cells with CTGF for 24 hours markedly increases the TIEG
level whilst reducing Smad 7 to an almost undetectable level (lane 2). This
2o effect is completely abolished in the presence of TIEG antisense
oligonucleotide (lane 5), but not by the control oligonucleotide (lane 6).
Incubating the cells with TGF-b alone for the same period of time led to a
moderate increase of both TIEG and Smad 7 (lane 3). However, incubating
2s the cells with TGF-b in the presence of CTGF antisense oligonucleotide
completely abolished the moderate induction of TIEG and led to the
increased induction of Smad 7 (lane 7). This was not observed in the
presence of the control antisense oligonucleotide (lane 8) and is consistent
with TGF-b-induced CTGF being responsible for the observed moderate
3o increase in TIEG expression level.
29
CA 02546401 2006-05-17
WO 2005/050203 PCT/GB2004/004795
Similar results were also obtained by treating the cells with TIEG antisense
and control antisense oligonucleotides (lanes 9 and 10). Incubating the cells
with both TGF-b and CTGF (lane 4) marl~edly increases the expression
level of TIED whilst reducing the expression level of Smad 7. These results
clearly show that TIEG mediates CTGF-dependent down-regulation of
Smad 7 expression.
Example 2 - ~S'creening method for identifying compounds i~alzibiting
to CTGF induced~brosas
Screening for compounds possessing fibrosis inhibitory properties
dependent on the CTGF-CTGF receptor interaction is conducted by testing
the ability of each compound to bloclc, for example, the induction of TIEG
is in HMC treated with CTGF.
The screening method is conducted using human mesangial cells (HMC)
pre-incubated fox 30 minutes with or without the potential inhibitor. These
cells are then stimulated with CTGF-VS fusion protein (40 ng/ml) in the
2o presence or absence of the potential inhibitor for 2 hours. After washing
the
cell layer with cold PBS, the cells are lysed in RIPA buffer and the lysate
assayed for TIEG by ELISA.
For the ELISA assay (Voller A et al., (1976) in Manual of Clinical
2s Immunology (Rose, N and Fishman H, eds.) pp 506-512, American Society
of Microbiology, Washington, DC.), NUNC microtitre plates axe coated
overnight at 4°C with either lysate or with standard dilutions of r-
TIEG to
provide a standard curve.
CA 02546401 2006-05-17
WO 2005/050203 PCT/GB2004/004795
After removing the coating solutions and washing the wells briefly with
PBS, non-specific proteins are blocked by incubating the wells for 1 hour
withl% (w/v) bovine serum albumin in PBS at 37°C. Wells are then
incubated with anti-TIEG antibody at optimal dilution for 60 minutes,
s followed by peroxidase conjugated secondary antibody for 60 minutes at
37°C. After washing the wells three times with PBS, bound antibody is
detected with the substrate 2,2'-azinobis-3-ethylbenzthazoline 6-sulphonic
acid and absorbance read at 405 nm.
to Recombinant TIED protein is created from full length TIEG cDNA by
cloning into the PcDNA 3.1/VS-His Topo vector (InVitrogen). This vector
can be transfected into a mammalian cell line to express TIEG-fusion
protein.
Is The TIEG fusion protein is purified from cell lysates using probond nickel=
chelating resin. Anti-TIEG antibody is available from Dr. Steven Johnson
(Mayo Foundation, Minnesota, USA) or can be raised in rabbits against the
TIEG fusion protein using conventional methods.
2o Example 3 - reducing the development of diabetic nepha opathy ih diabetic
mice by bl~cking CTGF ag onist access to cell surface f~eceptors
By blocking CTGF agonist access to cell-surface receptors it should be
possible to prevent and/or reduce the development of diabetic nephropathy
2s in diabetic mice. This could be done by using an agent that is capable of
binding to a CTGF receptor agonist, thereby preventing the agonist from
binding to the cell-surface receptors. For example, soluble mouse TrkA
receptor (sTrkA) could be used.
31
CA 02546401 2006-05-17
WO 2005/050203 PCT/GB2004/004795
cDNA sequence representing the extracellular region of the CTGF receptors
can be generated by RT-PCR, using total RNA extracted from mouse
kidneys and specifically-designed oligonucleotide primers. The PCR
product can be cloned in-frame into the pSecTag2 mammalian expression
s vector (Invitrogen), designed for efficient secretion of expressed proteins.
It
has been shown that the fusion of the Fc portion of immunoglobulin G (IgG)
slows the ifz vivo clearance of other soluble receptors (Zhou A, Ueno H,
Sbimomura M, Tanalca R, Shirakawa T, Nalcamura H, Matsuo M, Iijima K.
Kidney Int. 2003, 64:92101), so cDNA of the Fc portion of mouse IgG can
1o be amplified by RT-PCR and cloned in-frame with the 3' end of CTGF.
The antisense primer of the mouse Fc should contain a stop-codon to
prevent its fusion with the 3~ayc epitope that is present in the pSecTag2
vector. These constructs can be used to generate stably-transfected mouse
1s fibroblast cell lines according to standard techniques, and by using the
Zeocin resistant gene present in the pSecTag2 vector for selection.
Cell lines that efficiently express and secrete the receptor can be grown
routinely on a large scale (T150 flasks). Expressed recombinant proteins
2o can be purified from media using FPLC Mono S (Pharmacia), and purified
proteins can be checked by Coomassie blue-stained SDS-PAGE and
dialysed against phosphate-buffered saline (PBS). Dialysed proteins can be
passed through Detox-igel columns (Pierce), checlced for endotoxin by
using Lilrmlus amebocyte assay (Sigma), and sterile-filtered (0.2~,m).
To test this ifs vivo, four groups of mice can be set up: (a), (b) and (c)
db/db
mice (n=10 each), and (d) db/m mice (n=10). For these experiments we can
use diabetic db/db and non-diabetic db/m mice (Jackson Laboratory). The
db/db mouse is a genetically-engineered mouse model that represents type 2
3o diabetes and develops hyperglycaemia associated with obesity and insulin
32
CA 02546401 2006-05-17
WO 2005/050203 PCT/GB2004/004795
resistance a few weelcs after birth. We would choose this model because it
exhibits glomerular mesangial expansion by age 16 weeks (Chen H, Charlat
O, Tartaglia LA, Woolf EA, Weng X, Ellis SJ, Lakey ND, Culpepper J,
Moore KJ, Breitbart RE, Duyk GM, Tepper RI, Morgenstern JP. Cell. 1996,
s 84:491-5; Like AA, Lavine RL, Poffenbarger PL, Chick WL. Am J Pathol.
1972, 66:193-224.).
Immediately after onset of diabetes, group (a) will receive daily
subcutaneous injections of 50 ~g sTrkA. We would choose this dose on the
1o basis of successful experiments of similar design by other investigators
(Park L, Raman KG, Lee KJ, Lu Y, Ferran LJ Jr, Chow WS, Stem D,
Schmidt AM. Nat Med. 1998, 4:1025-31; Wendt TM, Tanji N, Guo J,
Kislinger TR, Qu W, Lu Y, Bucciarelli LG, Rong LL, Moser B, Marlcowitz
GS, Stein G, Bierhaus A, Liliensiek B, Arnold B, Nawroth PP, Stern DM,
is D'Agati VD, Schmidt AM. Am J Pathol. 2003, 162:1123-37; Holash J,
Davis S, Papadopoulos N, Croll SD, Ho L, Russell M, Boland P, Leidich R,
Hylton D, Burova E, Ioffe E, Huang T, Radziejewsl~i C, Bailey K, Fandl JP,
Daly T, Wiegand SJ, Yancopoulos GD, Rudge JS. Proc Natl Acad Sci U S
A. 2002, 99:11393-8.).
A subcutaneously injected s-receptor-Fc decoy for VEGF has a serum half
life (t1/2) of approximately 2 days. Group (b) should receive equal volumes
of vehicle. Group (c) and (d) should receive no treatment. Mice can be
sacrificed at 20 weelcs of age to assess the development of diabetic
2s nephropathy.
Development of diabetic nephropathy can be assessed by urine albumin,
serum and urine creatinine, changes in the glomerular histology and
accumulation of ECM in the glomerulus. Mice should be housed in
3o individual metabolic cages for 24h urine collections. Urinary albumin
33
CA 02546401 2006-05-17
WO 2005/050203 PCT/GB2004/004795
concentration can be determined with an ELISA using a murine
microalbuminuria kit (Albuwell M; Exocell, Philadelphia ). Renal function
can be evaluated by calculating creatinine clearance (ml/min/100 g body
weight). Serum and urine creatinine levels can be measured by an
enzymatic method using the picric acid colorimetric procedure (Sigma).
.Exaa°raple 4 - Pharmaceutical foruaulatioaas aaad adraaifaistration.
The compounds of the invention will normally be administered orally or by
to any parenteral route, in the form of a pharmaceutical formulation
comprising the active ingredient, optionally in the form of a non-toxic
organic, or inorganic, acid, or base, addition salt, in a pharmaceutically
acceptable dosage form. Depending upon the disorder and patient to be
treated, as well as the route of administration, the compositions may be
1s administered at varying doses.
In human therapy, the compounds of the invention can be administered
alone but will generally be administered in admixture with a suitable
pharmaceutical excipient diluent or carrier selected with regard to the
2o intended route of administration and standard pharmaceutical practice.
For example, the compounds of the invention can be administered orally,
buccally or sublingually in the form of tablets, capsules, ovules, elixixs,
solutions or suspensions, which may contain flavouring or colouring agents,
2s for immediate-, delayed- or controlled-release applications. The
compounds of invention may also be administered via intracavernosal
inj ection.
Such tablets may contain excipients such as microcrystalline cellulose,
.;o lactose, sodium citrate, calcium carbonate, dibasic calcium phosphate and
3 A
CA 02546401 2006-05-17
WO 2005/050203 PCT/GB2004/004795
glycine, disintegrants such as starch (preferably coin, potato or tapioca
starch); sodium starch glycollate, croscarmellose sodium and certain
complex silicates, and granulation binders such as polyvinylpyrrolidone,
hydroxypropylmethylcellulose (HPMC), hydroxy-propylcellulose (HPC),
s sucrose, gelatin and acacia. Additionally, lubricating agents such as
magnesium stearate, stearic acid, glyceryl behenate and talc may be
included.
Solid compositions of a similar type may also be employed as fillers in
1o gelatin capsules. Preferred excipients in this regard include lactose,
starch,
a cellulose, milk sugar or high molecular weight polyethylene glycols. For
aqueous suspensions and/or elixirs, the compounds of the invention may be
combined with various sweetening or flavouring agents, colouring matter or
dyes, with emulsifying and/or suspending agents and with diluents such as
~s water, ethanol, propylene glycol and glycerin, and combinations thereof.
The compounds of the invention can also be administered parenterally, for
example, intravenously, intra-arterially, intraperitoneally, iiltrathecally,
intraventricularly, intrasternally, intracranially, intra-muscularly or
2o subcutaneously, or they may be administered by infusion techniques. They
are best used in the form of a sterile aqueous solution which may contain
other substances, for example, enough salts or glucose to make the solution
isotonic with blood. The aqueous solutions should be suitably buffered
(preferably to a pH of from 3 to 9), if necessary. The preparation of suitable
2s parenteral formulations under sterile conditions is readily accomplished by
standard pharmaceutical techniques well-known to those skilled in the art.
Formulations suitable for parenteral administration include aqueous and non-
aqueous sterile injection solutions which may contain anti-oxidants, buffers,
3o bacteriostats and solutes which render the formulation isotonic with the
blood
CA 02546401 2006-05-17
WO 2005/050203 PCT/GB2004/004795
of the intended recipient; and aqueous and non-aqueous sterile suspensions
which may include suspending agents and thickening agents. The
formulations may be presented in unit-dose or mufti-dose containers, for
example sealed ampoules and vials, and may be stored in a freeze-dried
s (lyophilised) condition requiring only the addition of the sterile liquid
carrier,
fox example water for injections, immediately prior to use. Extemporaneous
injection solutions and suspensions may be prepared from sterile powders,
granules and tablets of the kind previously described.
1o For oral and parenteral administration to human patients, the daily dosage
level of the compounds of the invention will usually be from 1mg/kg to 30
mg/kg. Thus, for example, the tablets or capsules of the compound of the
invention may contain a dose of active compound for administration singly
or two or more at a time, as appropriate. The physician in any event will
1s determine the actual dosage which will be most suitable for any individual
patient and it will vary with the age, weight and response of the particular
patient. The above dosages are exemplary of the average case. There can,
of course, be individual instances where higher or lower dosage ranges are
merited and such are within the scope of this invention.
The compounds of the invention can also be administered intranasally or by
inhalation and are conveniently delivered in the form of a dry powder
inhaler or an aerosol spray presentation from a pressurised container, pump,
spray or nebuliser with the use of a suitable propellant, e.g.
2s dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoro-
ethane, a hydrofluoroalkane such as 1,1,1,2-tetrafluoroethane (HFA 134A3
or l,1,1,2,3,3,3-heptafluoropropane (HFA 227EA3), carbon dioxide or other
suitable gas. In the case of a pressurised aerosol, the dosage unit may be
determined by providing a valve to deliver a metered amount. The
36
CA 02546401 2006-05-17
WO 2005/050203 PCT/GB2004/004795
pressurised container, pump, spray or nebuliser may contain a solution or
suspension of the active compound, e.g. using a mixture of ethanol and the
propellant as the solvent, which may additionally contain a lubricant, e.g.
sorbitan trioleate. Capsules and cartridges (made, for example, from
s gelatin) for use in an inhaler or insufflator may be formulated to contain a
powder mix of a compound of the invention and a suitable powder base
such as lactose or starch.
Aerosol or dry powder formulations are preferably arranged so that each
1o metered dose or "puff' delivers an appropriate dose of a compound of the
invention for delivery to the patient. It will be appreciated that the overall
daily dose with an aerosol will vary from patient to patient, and may be
administered in a single dose or, more usually, in divided doses throughout
the day.
is
Alternatively, the compounds of the invention can be administered in the
form of a suppository or pessary, or they may be applied topically in the
form of a lotion, solution, cream, ointment or dusting powder. The
compounds of the invention may also be transdermally administered, for
2o example, by the use of a slcin patch. They may also be administered by the
ocular route, particularly for treating diseases of the eye.
Fox ophthalmic use, the compounds of the invention can be formulated as
micronised suspensions in isotonic, pH adjusted, sterile saline, or,
2s preferably, as solutions in isotonic, pH adjusted, sterile saline,
optionally in
combination with a preservative such as a benzylallconium chloride.
Alternatively, they may be formulated in an ointment such as petrolatum.
For application topically to the skin, the compounds of the invention can be
3o formulated as a suitable ointment containing the active compound
37
CA 02546401 2006-05-17
WO 2005/050203 PCT/GB2004/004795
suspended or dissolved in, for example, a mixture with one or more of the
following: mineral oil, liquid petrolatum, white petrolatum, propylene
glycol, polyoxyethylene polyoxypropylene compound, emulsifying wax and
water. Alternatively, they can be formulated as a suitable lotion or cream,
s suspended or dissolved in, for example, a mixture of one or more of the
following: mineral oil, sorbitan monostearate, a polyethylene glycol, liquid
paraffin, polysorbate 60, cetyl esters wax, cetearyl alcohol, 2-
octyldodecanol, benzyl alcohol and water.
to Formulations suitable for topical administration in the mouth include
lozenges
comprising the active ingredient in a flavoured basis, usually sucrose and
acacia or tragacanth; pastilles comprising the active ingredient in an inert
basis
such as gelatin and glycerin, or sucrose and acacia; and mouth-washes
comprising the active ingredient in a suitable liquid carrier:
is
Generally, in humans, oral or topical administration of the compounds of
the invention is the preferred route, being the most convenient. In
circumstances where the recipient suffers from a swallowing disorder or
from impairment of drug absorption after oral administration, the drug may
2o be administered parenterally, e.g. sublingually or buccally.
For veterinary use, a compound of the invention is administered as a
suitably acceptable formulation in accordance with normal veterinary
practice and the veterinary surgeon will determine the dosing regimen and
2s route of administration which will be most appropriate for a particular
animal.
3$
