Note: Descriptions are shown in the official language in which they were submitted.
DEMANDES OU BREVETS VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVETS
COMPREND PLUS D'UN TOME.
CECI EST LE TOME 1 DE 2
NOTE: Pour les tomes additionels, veillez contacter le Bureau Canadien des
Brevets.
JUMBO APPLICATIONS / PATENTS
THIS SECTION OF THE APPLICATION / PATENT CONTAINS MORE
THAN ONE VOLUME.
THIS IS VOLUME 1 OF 2
NOTE: For additional volumes please contact the Canadian Patent Office.
CA 02547750 2012-03-14
COMPOSITIONS, METHODS AND KITS FOR DETECTING THE NUCLEIC ACIDS
OF HIV-1 AND HIV-2
Field of the Invention
The present invention relates to the field of biotechnology. More
specifically, the
invention relates to individual assays that are capable of detecting the
nucleic acids of HIV-1,
HIV-2, or the combination of HIV-1 and HIV-2. The invention further relates to
multiplex
assays that are capable of detecting the nucleic acids of both HIV-1 and HIV-2
using a probe
and/or primers that cross-react with the two analytes.
Government Interest in Invention
Certain aspects of the invention disclosed herein were made with government
support
under contracts N01-HB-67130 and N01-HB-07148 with the National Heart, Lung
and Blood
Institute of the National Institutes of Health. The United States government
has certain rights
in these aspects of the invention.
Background of the Invention
Although the HIV/AIDS pandemic is principally due to infection by HIV-1, a
different
retrovirus has emerged as another cause of AIDS. This so-called "HIV-2" virus
was first
isolated from AIDS patients in West Africa in 1986, and was subsequently
detected as an
infectious agent for the first time in the United States the following year.
Fewer than 100
cases of HIV-2 had been reported in the United States through the end of 1994.
Despite this
seemingly low number, HIV-2 is being identified as the etiologic agent in
growing numbers of
immunosuppressive diseases that are clinically indistinguishable from AIDS
cases that result
from HIV-1 infection (Kanki et al., Science 232:238 (1986); Kanki et al.,
Science 236:827
(1987); Clavel et al., Science 233:343 (1986); Clavel et al., N EngL J. Med.
316:1180
(1987)). Although HIV-2 is related to HIV-1 by its morphology and tropism for
CD4+ cells, it
clearly is a distinct virus and not merely an envelope variant of HIV-1.
Indeed, since HIV-2 is only distantly related to HIV-1, with approximately 50%
amino
acid conservation in the gag and pol proteins and less than 30% conservation
in the env gene
products, its presence is not effectively detected by serologic assays used
for detecting HIV-1
infection (Constantine NT, AIDS 7:1 (1993); Markovitz DM, Ann. Intern. Med.
118:211
1
CA 02547750 2013-07-30
(1993)). As a result, attempts have been made to develop nucleic acid probes
that can be used
for specifically detecting HIV-2 viral nucleic acids.
Interestingly, the genomes of both HIV-1 and HIV-2 show substantial sequence
heterogeneity among different isolates. As a consequence of this
heterogeneity, it has been
impossible to find substantial regions of absolute sequence conservation
between all isolates of
HIV-1 or all isolates of HIV-2 (see published European Patent Application EP 0
887 427).
Indeed, numerous viral isolates with unique polynucleotide sequences have been
identified for
each of these viruses, a factor that further complicates the construction of
probes for reliable
and effective nucleic acid testing.
Since, like HIV-1, HIV-2 also is transmissible through exchange of body
fluids,
including blood and plasma, it is important to be able to detect infected body
fluids before
antibodies to the virus are detectable or symptoms are evident in an infected
individual. For
protection of patients who might otherwise receive an HIV-2-infected body
fluid (e.g., whole
blood or plasma during transfusion), or products derived from donated blood or
plasma, it is
particularly important to detect the presence of the virus in the donated body
fluid to prevent its
use in such procedures or products. It is also important that procedures and
reagents used for
detecting HIV-2 can detect relatively low numbers of viral copies which may be
present in an
infected individual, who may be a donor, during the early stages of infection.
Assays and reagents for detecting 14IV-2 have been previously disclosed in,
for
example, U.S. Patent Nos. 6,020,123, 5,688,637, 5,545,726 and 5,310,651;
European Patent
Nos. EP 0404625 B1 and EP 0239425 Bl; and published European Patent
Application Nos. EP
1026236 A2, EP 0887427 A2.
Summary of the Invention
Various embodiments of this invention provide a method of determining whether
a test
sample contains at least one of HIV-1 nucleic acid and HIV-2 nucleic acid,
said method
comprising the steps of: (a) combining said test sample with a pair of cross-
reactive primers to
form a reaction mixture, wherein said pair of cross-reactive primers co-
amplifies HIV-1 and
HIV-2 nucleic acid and comprises a first primer that consists of SEQ ID NO:14
or consists of
SEQ ID NO:14 and an upstream sequence that is not complementary to either HIV-
1 or HIV-2
nucleic acid; and, a second primer that consists of SEQ ID NO:2 or
2
CA 02547750 2012-03-14
SEQ ID NO:7 or consists of either SEQ ID NO:2 or SEQ ID NO:7 and an upstream
sequence
that is not complementary to either HIV-1 or HIV-2 nucleic acid; (b)
amplifying, in an in vitro
nucleic acid amplification reaction, nucleic acid present in said reaction
mixture of step (a);
and (c) detecting in a hybridization reaction an HIV-1 amplicon, an HIV-2
amplicon, or a
combination of both amplicons synthesized in step (b), thereby determining
that said test
sample contains at least one of HIV-1 nucleic acid and HIV-2 nucleic acid.
Various embodiments of this invention provide a composition for amplifying an
HIV-
1 analyte nucleic acid and an HIV-2 analyte nucleic acid that may be present
in a biological
sample, comprising: (a) a first primer that consists of SEQ ID NO:14 or which
consists of
SEQ ID NO:14 and a first primer upstream sequence that is not complementary to
either of
said HIV-1 or HIV-2 nucleic acid; and (b) a second primer that consists of SEQ
ID NO:2 or
SEQ ID NO:7; or which consists of SEQ ID NO:2 or SEQ ID NO:7 and a second
primer
upstream sequence that is not complementary to either of said HIV-1 or HIV-2
nucleic acid.
Various embodiments of this invention provide a composition for amplifying an
HIV-
1 analyte nucleic acid and an HIV-2 analyte nucleic acid that may be present
in a biological
sample, comprising: (a) a first primer that consists of SEQ ID NO:13, SEQ ID
NO:14 or SEQ
ID NO:15, or which consists of SEQ ID NO:13, SEQ ID NO:14 or SEQ ID NO:15 and
a first
primer upstream sequence that is not complementary to either of said HIV-lor
HIV-2 nucleic
acid; and (b) a second primer that consists of SEQ ID NO:2 or which consists
of SEQ ID
NO:2 and a second primer upstream sequence that is not complementary to either
of said HIV-
lor HIV-2 nucleic acid.
Various embodiments of this invention provide a composition for amplifying an
HIV-
1 analyte nucleic acid and an HIV-2 analyte nucleic acid that may be present
in a biological
sample, comprising: (a) a first primer that consists of SEQ ID NO:59 in which
position 14 is
occupied by C or T, or which consists of SEQ ID NO:59 in which position 14 is
occupied by
C or T and a first primer upstream sequence that is not complementary to
either of said HIV-
lor HIV-2 nucleic acid; and (b) a second primer that consists of SEQ ID NO:61
in which
position 13 is occupied by T or I, position 16 is occupied by C or T, and
position 20 is
occupied by A, C or I, or which consists of SEQ ID NO:61 in which position 13
is occupied
by T or I, position 16 is occupied by C or T, and position 20 is occupied by
A, C or I and a
2a
CA 02547750 2012-03-14
second primer upstream sequence that is not complementary to either of said
HIV-lor HIV-2
nucleic acid.
Various embodiments of this invention provide a composition for amplifying an
HIV-
1 analyte nucleic acid and an HIV-2 analyte nucleic acid that may be present
in a biological
sample, comprising: (a) a first primer that consists of SEQ ID NO:60 in which
positions 14
and 23 are independently occupied by C or T or which consists of SEQ ID NO:60
in which
positions 14 and 23 are independently occupied by C or T and a first primer
upstream
sequence that is not complementary to either of said HIV-lor HIV-2 nucleic
acid; and (b) a
second primer that consists of SEQ ID NO:61 in which position 13 is occupied
by T or I,
position 16 is occupied by C or T, and position 20 is occupied by A, C or I or
which consists
of SEQ ID NO:61 in which position 13 is occupied by T or I, position 16 is
occupied by C or
T, and position 20 is occupied by A, C or I and a second primer upstream
sequence that is not
complementary to either of said HIV-1or HIV-2 nucleic acid.
A first aspect of the invention relates to a method for determining whether a
test
sample contains an HIV-1 analyte nucleic acid or an HIV-2 analyte nucleic
acid. The invented
method includes a first step for combining the test sample with a pair of
cross-reactive
primers. Next, there is a step for amplifying in an in vitro nucleic acid
amplification reaction
any of a first sequence of the HIV-1 analyte nucleic acid that may be present
in the test sample
and any of a first sequence of the HIV-2 analyte nucleic acid that may be
present in the test
sample. This nucleic acid amplification reaction uses a pair of cross-reactive
primers that are
capable of co-amplifying HIV-1 and HIV-2 nucleic acids. Products of the
reaction may
include a first HIV-1
2b
CA 02547750 2006-05-31
WO 2005/061738
PCT/US2004/042899
amplicon and a first HIV-2 amplicon. Next, there is a step for detecting in a
single hybridization
reaction any of the first HIV-I amplicon and any of the first HIV-2 amplicon
that may have been
synthesized in the amplifying step. A positive result in the hybridization
reaction will indicate
that the test sample contained at least one of either the HIV-1 analyte
nucleic or the HIV-2
analyte nucleic acid. In a preferred embodiment, the in vitro nucleic acid
amplification reaction
in the amplifying step is either a TMA reaction, a NASBA reaction or a PCR
reaction. In
another preferred embodiment, the single hybridization reaction in the
detecting step involves the
use of a cross-reactive probe that can hybridize either to the first HIV-1
amplicon or to the first
HIV-2 amplicon.
0 More preferably, the hybridization reaction in the detecting step further
includes an HIV-1-
specific probe which hybridizes only to the first HIV-1 amplicon and not to
the first HIV-2
amplicon. When this is the case, a positive signal indicating hybridization of
the cross-reactive
probe together with the absence of a positive signal indicating hybridization
of the HIV-1-
specific probe indicates that the test sample contains the HIV-2 analyte
nucleic acid and does not
[5 contain the HIV-I analyte nucleic acid. In an alternative preferred
embodiment, there is an
additional step for detecting in a hybridization reaction that includes an HIV-
1-specific probe,
only the first HIV-I amplicon and not detecting the first HIV-2 amplicon. In
this instance, the
HIV-1-specific probe hybridizes only to the first HIV-1 amplicon and not to
the first HIV-2
amplicon. When this is the case, a positive signal indicating hybridization of
the cross-reactive
20 probe together with the absence of a positive signal indicating
hybridization of the HIV-1-
specific probe indicates that the test sample contains the HIV-2 analyte
nucleic acid and does not
contain the HIV-1 analyte nucleic acid. In accordance with another preferred
embodiment, the
cross-reactive probe used in the detecting step is labeled with a
honiogeneously detectable label.
The homogeneously detectable label can be, for example, a chemiluminescent
label. In a highly
25 preferred embodiment, when a chemiluminescent label is employed, the
detecting step involves
detecting with a luminometer, or performing luminometry. In certain other
embodiments of the
invented method, the in vitro nucleic acid amplification reaction conducted in
the amplifying
step does not include an analyte-specific pair of primers that amplify the
first sequence of the
HIV-2 analyte nucleic acid without also being capable of amplifying the first
sequence of the
30 HIV-1 analyte nucleic acid. In still other embodiments, a positive
result indicating probe
hybridization in the detecting step does not distinguish between the presence
of the first HIV-1
amplicon and the first HIV-2 amplicon. Stated differently, hybridization of
the probe to a
3
CA 02547750 2006-05-31
WO 2005/061738
PCT/US2004/042899
complementary target nucleic acid synthesized in the amplification reaction
indicates only that
HIV-1 or HIV-2 nucleic acids were present in the test sample, without
identifying which was
present. In yet other embodiments, the in vitro nucleic acid amplification
reaction in the
amplifying step can further amplify at least a first sequence of at least one
analyte nucleic acid
which is different from HIV-1 and HIV-2. In this instance the amplification
reaction would be a
"multiplex" amplification reaction. In a particularly preferred embodiment of
the invented
method, the nucleic acids of at least one of hepatitis B virus and hepatitis C
virus can be
amplified in the amplification reaction in addition to HIV-1 and HIV-2 nucleic
acids.
A second aspect of the invention relates to a method for particularly
determining whether
0 a test sample contains an HIV-1 analyte nucleic acid. The invented method
includes a first step
for combining the test sample with a pair of cross-reactive primers. Next,
there is a step for
amplifying in an in vitro nucleic acid amplification reaction any of a first
sequence of the HIV-1
analyte nucleic acid that may be present in the test sample, and any of a
first sequence of an HIV-
2 analyte nucleic acid that may be present in the test sample. This
amplification reaction is
5 carried out using a pair of cross-reactive primers that are capable of co-
amplifying HIV-1 and
HIV-2 nucleic acids. Products of the amplification reaction may include a
first HIV-1 amplicon
and a first HIV-2 amplicon. Next, there is a step for detecting any of the
first HIV-1 amplicon
that may have been synthesized in the amplifying step without detecting any of
the first HIV-2
amplicon. A positive result in the hybridization reaction will indicate that
the test sample
!O contained the HIV-1 analyte nucleic. In a preferred embodiment, the in
vitro nucleic acid
amplification reaction in the amplifying step is either a TMA reaction, a
NASBA reaction or a
PCR reaction. When one of these amplification reactions is employed, the
detecting step
preferably involves hybridizing an HIV-1 specific hybridization probe which is
labeled with a
homogeneously detectable label. Such labels advantageously do not require
physical separation
25 of unhybridized, free probe from specific probe:target duplexes to
determine that such duplexes
have formed in a hybridization reaction. In certain preferred embodiments, the
homogeneously
detectable label is a chemiluminescent label. When this is the case, the
detecting step may
involve detecting with a luminometer, or performing luminometry. In still
another embodiment,
the in vitro nucleic acid amplification reaction in the amplifying step does
not include an analyte-
30 specific pair of primers that amplify the first sequence of the HIV-2
analyte nucleic acid without
also being capable of amplifying the first sequence of the HIV-1 analyte
nucleic acid. In yet
other embodiments, the in vitro nucleic acid amplification reaction in the
amplifying step can
4
CA 02547750 2006-05-31
WO 2005/061738
PCT/US2004/042899
further amplify at least a first sequence of at least one analyte nucleic acid
which is different
from HIV-1 and HIV-2. In this instance the amplification reaction would be a
"multiplex"
amplification reaction. For example, in a particularly preferred embodiment of
the invented
method the nucleic acids of at least one of hepatitis B virus and hepatitis C
virus can be
amplified in the amplification reaction in addition to HIV-1 and HIV-2 nucleic
acids.
A third aspect of the invention relates to a method for particularly
determining whether a
test sample contains an HIV-2 analyte nucleic acid. The invented method
includes a first step for
combining the test sample with a pair of cross-reactive primers. Next, there
is a step for
amplifying in an in vitro nucleic acid amplification reaction any of a first
sequence of the HIV-I
[0 analyte nucleic acid that may be present in the test sample, and any of
a first sequence of an HIV-
2 analyte nucleic acid that may be present in the test sample. This
amplification reaction is
carried out using a pair of cross-reactive primers that are capable of co-
amplifying HIV-I and
HIV-2 nucleic acids. Products of the amplification reaction may include a
first HIV-1 amplicon
and a first HIV-2 amplicon. Next, there is a step for detecting any of the
first HIV-2 amplicon
that may have been synthesized in the amplifying step without detecting any of
the first HIV-I
amplicon. A positive result in the hybridization reaction will indicate that
the test sample
contained the HIV-2 analyte nucleic. In a preferred embodiment, the in vitro
nucleic acid
amplification reaction in the amplifying step is either a TMA reaction, a
NASBA reaction or a
PCR reaction. When one of these amplification reactions is employed, the
detecting step
preferably involves hybridizing an HIV-2 specific hybridization probe which is
labeled with a
homogeneously detectable label. Such labels advantageously do not require
physical separation
of unhybridized, free probe from specific probe:target duplexes to determine
that such duplexes
have formed in a hybridization reaction. In certain preferred embodiments, the
homogeneously
detectable label is a chemiluminescent label. When this is the case, the
detecting step may
involve detecting with a luminometer, or performing luminometry. In still
another embodiment,
the in vitro nucleic acid amplification reaction in the amplifying step does
not include an analyte-
specific pair of primers that amplify the first sequence of the HIV-2 analyte
nucleic acid without
also being capable of amplifying the first sequence of the HIV-I analyte
nucleic acid. In yet
other embodiments, the in vitro nucleic acid amplification reaction in the
amplifying step can
further amplify at least a first sequence of at least one analyte nucleic acid
which is different
from HIV-1 and HIV-2. In this instance the amplification reaction would be a
"multiplex"
amplification reaction. For example, in a particularly preferred embodiment of
the invented
5
CA 02547750 2006-05-31
WO 2005/061738
PCT/US2004/042899
method the nucleic acids of at least one of hepatitis B virus and hepatitis C
virus can be
amplified in the amplification reaction in addition to HIV-1 and HIV-2 nucleic
acids.
A fourth aspect of the invention relates to a method of determining whether a
test sample
contains an HIV-1 analyte nucleic acid. The invented method involves first
amplifying in a first
in vitro nucleic acid amplification reaction any of a first sequence of the
HIV-I analyte nucleic
acid that may be present in the test sample, and any of a first sequence of an
HIV-2 analyte
nucleic acid that may be present in the test sample. The first amplification
reaction uses a pair of
cross-reactive primers that are capable of co-amplifying HIV-I and HIV-2
nucleic acids.
Products of the first amplification reaction may include a first HIV-1
amplicon and a first HIV-2
0 amplicon. Next, there is a step for detecting in a single hybridization
reaction any of the first
HIV-1 amplicon and any of the first HIV-2 amplicon that may have been
synthesized in the first
amplification reaction. Detection of one of the amplicon species confirms that
the test sample
contains either HIV-I or HIV-2 nucleic acids. There is next a step for
amplifying in a second in
vitro nucleic acid amplification reaction any of a second sequence of the HIV-
I analyte nucleic
5 acid that may be present in the test sample, thereby resulting in the
synthesis of a second HIV-1
amplicon. Finally, there is a step for detecting the second HIV-1 amplicon
using a probe that
hybridizes to the second HIV-1 amplicon but not to any HIV-2 amplicon that may
have been
synthesized in the second amplifying step. Detection of the second HIV-I
amplicon will confirm
that the test sample contains the HIV-I analyte nucleic acid. In a preferred
embodiment, the in
vitro nucleic acid amplification reaction in the first amplifying step is
either a TMA reaction, a
NASBA reaction or a PCR reaction. When this is the case, the in vitro nucleic
acid
amplification reaction in the second amplifying step also can be either a TMA
reaction, a
NASBA reaction or a PCR reaction. In an alternative embodiment, the in vitro
nucleic acid
amplification reaction in the second amplifying step is either a TMA reaction,
a NASBA reaction
25 or a PCR reaction, regardless of the type of amplification reaction
employed in the first
amplifying step. In accordance with a different preferred embodiment, the
first in vitro nucleic
acid amplification reaction and the second in vitro nucleic acid amplification
reaction employ
different primers to synthesize the first HIV-I amplicon and the second HIV-I
amplicon. In
accordance with still a different preferred embodiment, the first and second
detecting steps do
30 not employ identical probes. However, it is preferred for the single
hybridization reaction of the
first amplifying step to include a cross-reactive probe which is capable of
hybridizing either to
the first HIV-I amplicon or to the first HIV-2 amplicon. Still more
preferrably, the cross-
6
CA 02547750 2006-05-31
WO 2005/061738
PCT/US2004/042899
reactive probe is labeled with a homogeneously detectable label. In certain
embodiments, the
homogeneously detectable label is, for example, a chemiluminescent label.
A fifth aspect of the invention relates to a method of amplifying an HIV-1
analyte nucleic
acid and an HIV-2 analyte nucleic acid that may be present in a test sample.
The invented
method begins with a step for combining the test sample with a pair of cross-
reactive primers.
These primers include a cross-reactive first primer that independently
hybridizes to any of a first
strand of the HIV-1 analyte nucleic acid and any of a first strand of the HIV-
2 analyte nucleic
acid, if present in the test sample. Also included in the pair of cross-
reactive primers is a cross-
reactive second primer that independently hybridizes to any of a second strand
of the HIV-1
[0 analyte nucleic acid and any of a second strand of the HIV-2 analyte
nucleic acid, if present in
the test sample. The primers have sequences such that an extension product of
the cross-reactive
first primer, using as a template either the first strand of the HI-1 analyte
nucleic acid or the
first strand of the HIV-2 analyte nucleic acid, hybridizes to the cross-
reactive second primer.
Next, there is a step for amplifying in an in vitro nucleic acid amplification
reaction any of a first
sequence of the HIV-1 analyte nucleic acid that may be present in the test
sample and any of a
first sequence of the HIV-2 analyte nucleic acid that may be present in the
test sample using the
pair of cross-reactive primers. This results in a first HIV-1 amplicon being
synthesized if the test
sample contains the HIV-1 analyte nucleic acid, and a first HIV-2 amplicon
being synthesized if
the test sample contains the HIV-2 analyte nucleic acid. In one embodiment,
the invented
method further includes a step for detecting at least one of the first HIV-1
amplicon and the first
HIV-2 amplicon. In a preferred embodiment, the detecting step involves
detecting both the first
HIV-1 amplicon and the first HIV-2 amplicon. More preferably, the detecting
step involves
performing a hybridization reaction that includes a cross-reactive probe that
hybridizes
independently to any of the first HIV-1 amplicon and any of the first HIV-2
amplicon
synthesized in the amplifying step. In another preferred embodiment, the
detecting step involves
detecting only the first HIV-1 amplicon and not detecting the first HIV-2
amplicon. In still
another preferred embodiment, the detecting step involves detecting only the
first HIV-2
amplicon and not detecting the first HIV-1 amplicon. In accordance with
another preferred
embodiment, when the invented method further includes a step for detecting at
least one of the
first HIV-1 amplicon and the first HIV-2 amplicon, it is preferred that either
(a) the first
sequence of the HIV-1 analyte nucleic acid is contained within the HIV-1 p31
integrase gene and
the first sequence of the HIV-2 analyte nucleic acid is contained within the
HIV-2 p31 integrase
7
CA 02547750 2006-05-31
WO 2005/061738
PCT/US2004/042899
gene, or (b) the first sequence of the HIV-1 analyte nucleic acid is contained
within the HIV-1
p51 reverse transcriptase gene and the first sequence of the HIV-2 analyte
nucleic acid is
contained within the HIV-2 p51 reverse transcriptase gene.
A sixth aspect of the invention relates to a composition for amplifying any of
an HIV-1 or
any of an HIV-2 analyte nucleic acid that may be present in a biological
sample. The invented
composition includes a cross-reactive first primer that independently
hybridizes to any of a first
strand of the HIV-1 analyte nucleic acid or any of a first strand of the HIV-2
analyte nucleic acid,
if present in the biological sample. Also included in the invented composition
is a cross-reactive
second primer that independently hybridizes to any of a second strand of the
HIV-1 analyte
0 nucleic acid and any of a second strand of the HIV-2 analyte nucleic
acid, if present in the
biological sample. The cross-reactive nature of the primers means that an
extension product of
the cross-reactive first primer, as may be mediated by the activity of a
template-dependent DNA
polymerase using the first strand of either of the HIV-1 or HIV-2 analyte
nucleic acid as a
template, is able to hybridize to the cross-reactive second primer. In a
preferred embodiment, the
5 HIV-1 and HIV-2 analyte nucleic acids that can be amplified by-the cross-
reactive first and
second primers encode either the viral p31 integrase of the viral p51 reverse
transcriptase.
Certain more preferred embodiments of the invented composition do not include
a pair of HIV-
2-specific primers for amplifying only the HIV-2 analyte nucleic acid without
also being able to
amplify the HIV-1 analyte nucleic acid, but may include a pair of HIV-1-
specific primers for
?.0 amplifying only the HIV-1 analyte nucleic acid without also amplifying
the HIV-2 analyte
nucleic acid. In accordance with still another embodiment, regardless of
whether the cross-
reactive first and second primers are useful for amplifying nucleic acids
encoding the p31
integrase or the p51 reverse transcriptase, the invented composition may
further include a pair of
HIV-1-specific primers for amplifying only the HIV-1 analyte nucleic acid
without also
25 amplifying the HIV-2 analyte nucleic acid. Generally speaking, when the
cross-reactive first and
second primers are useful for amplifying nucleic acids encoding the p51
reverse transcriptase,
the cross-reactive first primer includes a 3' terminal target-complementary
sequence and
optionally a cross-reactive first primer upstream sequence that is not
complementary to the
analyte nucleic acid sequence to be amplified. The 3' terminal target-
complementary sequence
30 of the cross-reactive first primer includes 22-28 contiguous bases
contained within SEQ ID
NO:60, allowing for the presence of RNA and DNA equivalent bases and
nucleotide analogs.
The invented composition further includes a cross-reactive second primer that
includes a 3'
CA 02547750 2006-05-31
WO 2005/061738
PCT/US2004/042899
terminal target-complementary sequence and optionally a cross-reactive second
primer upstream
sequence that is not complementary to the target nucleic acid sequence to be
amplified. The 3'
terminal target-complementary sequence of the cross-reactive second primer
includes SEQ ID
NO:61, allowing for the presence of RNA and DNA equivalent bases and
nucleotide analogs.
More preferrably, the the 3' terminal target-complementary sequence of the
cross-reactive first
primer consists of 22-28 contiguous bases contained within SEQ ID NO:60,
allowing for the
presence of RNA and DNA equivalent bases and nucleotide analogs, and the 3'
terminal target-
complementary sequence of the cross-reactive second primer consists of SEQ ID
NO:61,
allowing for the presence of RNA and DNA equivalent bases and nucleotide
analogs. In certain
0 preferred embodiments, the first primer and the second primer are each up
to 60 bases in length.
In certain other preferred embodiments, the first primer does not include the
optional first primer
upstream sequence, the first primer being up to 28 bases in length, and the
second primer is up to
60 bases in length. In still other preferred embodiments, the first primer is
up to 60 bases in
length, and the second primer does not include the optional second primer
upstream sequence,
5 the second primer being 26 bases in length. In yet still other preferred
embodiments, the first
primer does not include the optional first primer upstream sequence, the first
primer being up to
28 bases in length, and the second primer does not include the optional second
primer upstream
sequence, the second primer being 26 bases in length. When this is the case,
meaning that the
first primer is up to 28 bases in length and the second primer is 26 bases in
length, there are
?,0 certain preferred combinations of primers that can be used in the
invented combination. In a first
preferred combination, the 3' terminal target-complementary sequence of the
first primer is SEQ
ID NO:51, and the 3' terminal target-complementary sequence of the second
primer is any of
SEQ ID NO:47, SEQ ID NO:49 and SEQ ID NO:50. In a second preferred
combination, the 3'
terminal target-complementary sequence of the first primer is SEQ ID NO: 52,
and the 3' terminal
25 target-complementary sequence of the second primer is SEQ ID NO:48. In a
third preferred
combination, the 3' terminal target-complementary sequence of the first primer
is SEQ ID NO:53
and the 3' terminal target-complementary sequence of the second primer is any
of SEQ ID
NO:47, SEQ ID NO:49 and SEQ ID NO:50. In a fourth preferred combination, the
3' terminal
target-complementary sequence of the first primer is SEQ ID NO:54, and the 3'
terminal target-
30 complementary sequence of the second primer is SEQ ID NO:48. In a
different embodiment,
when the first primer and the second primer are each up to 60 bases in length,
the 3' terminal
target-complementary sequence of the first primer is any of SEQ ID Nos:51-54.
More
9
CA 02547750 2006-05-31
WO 2005/061738
PCT/US2004/042899
preferrably, the 3' terminal target-complementary sequence of the second
primer is any of SEQ
ID Nos:47-50. In still a different preferred embodiment, when the first primer
is up to 60 bases
in length, and when the second primer does not include the optional second
primer upstream
sequence, the second primer being 26 bases in length, the 3' terminal target-
complementary
sequence of the second primer is any of SEQ ID Nos:47-50. More preferably, the
first primer
includes the optional first primer upstream sequence, and the 3' terminal
target-complementary
sequence of the first primer is any of SEQ ID NO:51-54. When this is the case,
there are certain
preferred combinations of primers that can be used in the invented
combination. In a first
preferred combination, the 3' terminal target-complementary sequence of the
first primer is SEQ
0 ID NO:51, and the 3' terminal target-complementary sequence of the second
primer is any of
SEQ ID NO:47, SEQ ID NO:49 and SEQ ID NO:50. In a second preferred
combination, the 3'
terminal target-complementary sequence of the first primer is SEQ ID NO:52,
and the 3' terminal
target-complementary sequence of the second primer is SEQ ID NO:48. In a third
preferred
combination, the 3' terminal target-complementary sequence of the first primer
is SEQ ID
[5 NO :53, and the 3' terminal target-complementary sequence of the second
primer is any of SEQ
ID NO:47, SEQ ID NO:49 and SEQ ID NO:50. In a fourth preferred combination,
the 3'
terminal target-complementary sequence of the first primer is SEQ ID NO:54,
and the 3' terminal
target-complementary sequence of the second primer is SEQ ID NO:48. Again
generally
speaking, when the cross-reactive first and second primers are useful for
amplifying nucleic
20 acids encoding the p31 integrase, the cross-reactive first primer
includes a 3' terminal target-
complementary sequence and optionally a cross-reactive first primer upstream
sequence that is
not complementary to the analyte nucleic acid sequence to be amplified. The 3'
terminal target-
complementary sequence of the cross-reactive first primer consists of any of
SEQ ID NOs:13-15.
The invented composition further includes a cross-reactive second primer that
includes a 3'
25 terminal target-complementary sequence and optionally a cross-reactive
second primer upstream
sequence that is not complementary to the target nucleic acid sequence to be
amplified. The 3'
terminal target-complementary sequence of the cross-reactive second primer
includes the
sequence ACARYAGTACWAATGGC (SEQ ID NO:10), allowing for the substitution of up
to
two base analogs. In a preferred embodiment, the cross-reactive first primer
and the cross-
30 reactive second primer are each up to 75 bases in length. More
preferably, the 3' terminal target-
complementary sequence of the cross-reactive second primer is any of SEQ ID
NO:2, SEQ ID
NO:7, SEQ ID NO:8 and SEQ ID NO:9. Still more preferably, the cross-reactive
first primer is
CA 02547750 2006-05-31
WO 2005/061738
PCT/US2004/042899
SEQ ID NO:14, and the cross-reactive second primer is any of SEQ ID NO:2, SEQ
ID NO:7,
SEQ ID NO:8 and SEQ ID NO:9. In accordance with yet more preferred
embodiments, either
the cross-reactive first primer is SEQ ID NO:14, and the cross-reactive second
primer is SEQ ID
NO:7, or the cross-reactive first primer is SEQ ID NO:14, and the cross-
reactive second primer
is SEQ ID NO:2.
A seventh aspect of the invention relates to a probe for detecting an HIV-1 or
an HIV-2
nucleic acid. The invented probe includes a probe sequence that consists of a
target-
complementary sequence of bases, and optionally one or more base sequences
that are not
complementary to the nucleic acids that are to be detected. The target-
complementary sequence
[0 of bases can be of any of: (a) SEQ ID NO:42 or the complement thereof,
allowing for the
presence of RNA and DNA equivalent bases; (b) SEQ ID NO:43 or the complement
thereof,
allowing for the presence of RNA and DNA equivalent bases; or (c) SEQ ID NO:44
or the
complement thereof, allowing for the presence of RNA and DNA equivalent bases.
In all
instances the hybridization probe has a length of up to 60 bases. In a
preferred embodiment, the
probe further includes a detectable label. For example, the detectable label
can be a
chemiluminescent label. In accordance with a different embodiment, the length
of the
hybridization probe is up to 26 bases. In accordance with still a different
embodiment, the probe
does not include the optional one or more base sequences that are not
complementary to the
nucleic acids that are to be detected, and the probe sequence is any of SEQ ID
NO:42 or the
complement thereof, SEQ ID NO:43 or the complement thereof, and SEQ ID NO:44
or the
complement thereof.
An eighth aspect of the invention relates to another probe for detecting an
HIV-1 or an
HIV-2 nucleic acid. The invented probe includes a probe sequence that consists
of a target-
complementary sequence of bases, and optionally one or more base sequences
that are not
complementary to the nucleic acid that is to be detected. The target-
complementary sequence of
bases may be any of SEQ ID Nos:23-36.
Definitions
The following terms have the following meanings for the purpose of this
disclosure,
unless expressly stated to the contrary herein.
As used herein, a "biological sample" is any tissue or polynucleotide-
containing material
obtained from a human, animal or environmental sample. Biological samples in
accordance with
the invention include peripheral blood, plasma, serum or other body fluid,
bone marrow or other
11
CA 02547750 2006-05-31
WO 2005/061738
PCT/US2004/042899
organ, biopsy tissues or other materials of biological origin. A biological
sample may be treated
to disrupt tissue or cell structure, thereby releasing intracellular
components into a solution
which may contain enzymes, buffers, salts, detergents and the like.
As used herein, "polynucleotide" means either RNA or DNA, along with any
synthetic
nucleotide analogs or other molecules that may be present in the sequence and
that do not
prevent hybridization of the polynucleotide with a second molecule having a
complementary
sequence.
As used herein, a "detectable label" is a chemical species that can be
detected or can lead
to a detectable response. Detectable labels in accordance with the invention
can be linked to
[0 polynucleotide probes either directly or indirectly, and include
radioisotopes, enzymes, haptens,
chromophores such as dyes or particles that impart a detectable color (e.g.,
latex beads or metal
particles), luminescent compounds (e.g., bioluminescent, phosphorescent or
chemiluminescent
moieties) and fluorescent compounds.
A "homogeneous detectable label" refers to a label that can be detected in a
homogeneous fashion by determining whether the label is on a probe hybridized
to a target
sequence. That is, homogeneous detectable labels can be detected without
physically removing
hybridized from unhybridized forms of the label or labeled probe. Homogeneous
detectable
labels are preferred when using labeled probes for detecting either HIV-1 or
HIV-2 nucleic acids.
Examples of homogeneous labels include fluorescent labels, such as those
associated with
molecular beacons, and chemiluminescent labels such as those detailed by
Arnold et al., U.S.
Patent No. 5,283,174; Woodhead et al., U.S. Patent No. 5,656,207; and Nelson
et al., U.S. Patent
No. 5,658,737. Preferred labels for use in homogenous assays include
chemiluminescent
compounds (e.g., see Woodhead et al., U.S. Patent No. 5,656,207; Nelson et
al., U.S. Patent No.
5,658,737; and Arnold, Jr., et al., U.S. Patent No. 5,639,604). Preferred
chemiluminescent labels
are acridinium ester ("AE") compounds, such as standard AE or derivatives
thereof (e.g.,
naphthyl-AE, ortho-AE, 1- or 3-methyl-AE, 2,7-dimethyl-AE, 4,5-dimethyl-AE,
ortho-dibromo-
AE, ortho-dimethyl-AE, meta-dimethyl-AE, ortho-methoxy-AE, ortho-
methoxy(cinnamy1)-AE,
ortho-methyl-AE, ortho-fluoro-AE, 1- or 3-methyl-ortho-fluoro-AE, 1- or 3-
methyl-meta-
difluoro-AE, and 2-methyl-AE).
A "homogeneous assay" refers to a detection procedure that does not require
physical
separation of hybridized probe from non-hybridized probe prior to determining
the extent of
specific probe hybridization. Exemplary homogeneous assays, such as those
described herein,
12
CA 02547750 2006-05-31
WO 2005/061738
PCT/US2004/042899
can employ molecular beacons or other self-reporting probes which emit
fluorescent signals
when hybridized to an appropriate target, chemiluminescent acridinium ester
labels which can be
selectively destroyed by chemical means unless present in a hybrid duplex, and
other
homogeneously detectable labels that will be familiar to those having an
ordinary level of skill in
the art.
As used herein, "amplification" refers to an in vitro procedure for obtaining
multiple
copies of a target nucleic acid sequence, its complement or fragments thereof.
By "target nucleic acid" or "target" is meant a nucleic acid containing a
target nucleic
acid sequence. In general, a target nucleic acid sequence that is to be
amplified will be
0 positioned between two oppositely disposed primers, and will include the
portion of the target
nucleic acid that is fully complementary to each of the primers.
By "target nucleic acid sequence" or "target sequence" or "target region" is
meant a
specific deoxyribonucleotide or ribonucleotide sequence comprising all or part
of the nucleotide
sequence of a single-stranded nucleic acid molecule, and the
deoxyribonucleotide or
[5 ribonucleotide sequence complementary thereto.
By "transcription associated amplification" is meant any type of nucleic acid
amplification that uses an RNA polymerase to produce multiple RNA transcripts
from a nucleic
acid template. One example of a transcription associated amplification method,
called
"Transcription Mediated Amplification" (TMA), generally employs an RNA
polymerase, a DNA
20 polymerase, deoxyribonucleoside triphosphates, ribonucleoside
triphosphates, and a promoter-
template complementary oligonucleotide, and optionally may include one or more
analogous
oligonucleotides. Variations of TMA are well known in the art as disclosed in
detail in Burg et
al., U.S. Patent No. 5,437,990; Kacian et al., U.S. Patent Nos. 5,399,491 and
5,554,516; Kacian
et al., PCT No. WO 93/22461; Gingeras et al., PCT No. WO 88/01302; Gingeras et
al., PCT No.
25 WO 88/10315; Malek et al., U.S. Patent No. 5,130,238; Urdea et al., U.S.
Patent Nos. 4,868,105
and 5,124,246; McDonough et al., PCT No. WO 94/03472; and Ryder et al., PCT
No. WO
95/03430. The methods of Kacian et al. are preferred for conducting nucleic
acid amplification
procedures of the type disclosed herein.
As used herein, an "oligonucleotide" or "oligomer" is a polymeric chain of at
least two,
30 generally between about five and about 100, chemical subunits, each
subunit comprising a
nucleotide base moiety, a sugar moiety, and a linking moiety that joins the
subunits in a linear
spacial configuration. Common nucleotide base moieties are guanine (G),
adenine (A), cytosine
13
CA 02547750 2006-05-31
WO 2005/061738
PCT/US2004/042899
(C), thymine (T) and uracil (U), although other rare or modified nucleotide
bases able to
hydrogen bond are well known to those skilled in the art. Oligonucleotides may
optionally
include analogs of any of the sugar moieties, the base moieties, and the
backbone constituents.
Preferred oligonucleotides of the present invention fall in a size range of
about 10 to about 100
residues. Oligonucleotides may be purified from naturally occurring sources,
but preferably are
synthesized using any of a variety of well known enzymatic or chemical
methods.
As used herein, a "probe" is an oligonucleotide that hybridizes specifically
to a target
sequence in a nucleic acid, preferably in an amplified nucleic acid, under
conditions that promote
hybridization, to form a detectable hybrid. A probe optionally may contain a
detectable moiety
0 which either may be attached to the end(s) of the probe or may be
internal. The nucleotides of
the probe which combine with the target polynucleotide need not be strictly
contiguous, as may
be the case with a detectable moiety internal to the sequence of the probe.
Detection may either
be direct (i.e., resulting from a probe hybridizing directly to the target
sequence or amplified
nucleic acid) or indirect (i.e., resulting frOni a probe hybridizing to an
intermediate molecular
structure that links the probe to the target sequence or amplified nucleic
acid). The "target" of a
probe generally refers to a sequence contained within an amplified nucleic
acid sequence which
hybridizes specifically to at least a portion of a probe oligonucleotide using
standard hydrogen
bonding (i.e., base pairing). A probe may comprise target-specific sequences
and optionally
other sequences that are non-complementary to the target sequence that is to
be detected. These
non-complementary sequences may comprise a promoter sequence, a restriction
endonuclease
recognition site, or sequences that contribute to three-dimensional
conformation of the probe
(e.g., as described in Lizardi et al., U.S. Patent Nos. 5,118,801 and
5,312,728). Sequences that
are "sufficiently complementary" allow stable hybridization of a probe
oligonucleotide to a target
sequence that is not completely complementary to the probe's target-specific
sequence.
As used herein, an "amplification primer" is an oligonucleotide that
hybridizes to a target
nucleic acid, or its complement, and participates in a nucleic acid
amplification reaction. For
example, amplification primers, or more simply "primers," may be optionally
modified
oligonucleotides which are capable of hybridizing to a template nucleic acid
and may have a 3'
end that can be extended by a DNA polymerase activity. In general, a primer
will have a
downstream sequence capable of hybridizing to a target nucleic acid, and
optionally an upstream
sequence that is not complementary to the target nucleic acid. The optional
upstream sequence
may, for example, serve as an RNA polymerase promoter or contain restriction
endonuclease
14
CA 02547750 2006-05-31
WO 2005/061738
PCT/US2004/042899
cleavage sites.
As used herein, and with reference to oligonucleotide probes or primers, the
term "cross-
react" or "cross-reactive" or variants thereof means that the probes or
primers are not strictly
specific for a single species of target polynucleotide. A probe that
hybridizes to HIV-1 nucleic
acids but not to HIV-2 nucleic acids cannot be said to be cross-reactive.
Conversely, a probe that
is able to hybridize to both HIV-1 and HIV-2 target nucleic acids to form
detectable
hybridization complexes would be considered "cross-reactive." Similarly, cross-
reactive primers
are capable of participating in a nucleic acid amplification reaction using
either HIV-1 or HIV-2
nucleic acids as templates to result in the synthesis of HIV-1 amplicons and
HIV-2 amplicons.
0 By "substantially homologous," "substantially corresponding" or
"substantially
corresponds" is meant that the subject oligonucleotide has a base sequence
containing an at least
contiguous base region that is at least 70% homologous, preferably at least
80% homologous,
more preferably at least 90% homologous, and most preferably 100% homologous
to an at least
10 contiguous base region present in a reference base sequence (excluding RNA
and DNA
5 equivalents). Those skilled in the art will readily appreciate
modifications that could be made to
the hybridization assay conditions at various percentages of homology to
permit hybridization of
the oligonucleotide to the target sequence while preventing unacceptable
levels of non-specific
hybridization. The degree of similarity is determined by comparing the order
of nucleobases
making up the two sequences and does not take into consideration other
structural differences
?.0 which may exist between the two sequences, provided the structural
differences do not prevent
hydrogen bonding with complementary bases. The degree of homology between two
sequences
can also be expressed in terms of the number of base mismatches present in
each set of at least
10 contiguous bases being compared, which may range from 0-2 base differences.
By "substantially complementary" is meant that the subject oligonucleotide has
a base
25 sequence containing an at least 10 contiguous base region that is at
least 70% complementary,
preferably at least 80% complementary, more preferably at least 90%
complementary, and most
preferably 100% complementary to an at least 10 contiguous base region present
in a target
nucleic acid sequence (excluding RNA and DNA equivalents). (Those skilled in
the art will
readily appreciate modifications that could be made to the hybridization assay
conditions at
30 various percentages of complementarity to permit hybridization of the
oligonucleotide to the
target sequence while preventing unacceptable levels of non-specific
hybridization.) The degree
of complementarity is determined by comparing the order of nucleobases making
up the two
CA 02547750 2006-05-31
WO 2005/061738
PCT/US2004/042899
sequences and does not take into consideration other structural differences
which may exist
between the two sequences, provided the structural differences do not prevent
hydrogen bonding
with complementary bases. The degree of complementarity between two sequences
can also be
expressed in terms of the number of base mismatches present in each set of at
least 10
contiguous bases being compared, which may range from 0-2 base mismatches.
By "sufficiently complementary" is meant a contiguous nucleic acid base
sequence that is
capable of hybridizing to another base sequence by hydrogen bonding between a
series of
complementary bases. Complementary base sequences may be complementary at each
position
in the base sequence of an oligonucleotide using standard base pairing (e.g.,
G:C, A:T or A:U
0 pairing) or may contain one or more residues that are not complementary
using standard
hydrogen bonding (including abasic "nucleotides"), but in which the entire
complementary base
sequence is capable of specifically hybridizing with another base sequence
under appropriate
hybridization conditions. Contiguous bases are preferably at least about 80%,
more preferably at
least about 90%, and most preferably about 100% complementary to a sequence to
which an
[5 oligonucleotide is intended to specifically hybridize. Appropriate
hybridization conditions are
well known to those skilled in the art, can be predicted readily based on base
sequence
composition, or can be determined empirically by using routine testing (e.g.,
See Sambrook et
al., Molecular Cloning, A Laboratory Manual, 211(1 ed. (Cold Spring Harbor
Laboratory Press,
Cold Spring Harbor, NY, 1989) at 1.90-1.91, 7.37-7.57, 9.47-9.51 and 11.47-
11.57
20 particularly at 9.50-9.51, 11.12-11.13, 11.45-11.47 and 11.55-11.57).
By "capture oligonucleotide" is meant at least one nucleic acid
oligonucleotide that
provides means for specifically joining a target sequence and an immobilized
oligonucleotide
due to base pair hybridization. A capture oligonucleotide preferably includes
two binding
regions: a target sequenCe-binding region and an immobilized probe-binding
region, usually
25 contiguous on the same oligonucleotide, although the capture
oligonucleotide may include a
target sequence-binding region and an immobilized probe-binding region which
are present on
two different oligonucleotides joined together by one or more linkers. For
example, an
immobilized probe-binding region may be present on a first oligonucleotide,
the target sequence-
binding region may be present on a second oligonucleotide, and the two
different
30 oligonucleotides are joined by hydrogen bonding with a linker that is a
third oligonucleotide
containing sequences that hybridize specifically to the sequences of the first
and second
oligonucleotides.
16
CA 02547750 2006-05-31
WO 2005/061738
PCT/US2004/042899
By "immobilized probe" or "immobilized nucleic acid" is meant a nucleic acid
that joins,
directly or indirectly, a capture oligonucleotide to an immobilized support.
An immobilized
probe is an oligonucleotide joined to a solid support that facilitates
separation of bound target
sequence from unbound material in a sample.
By "separating" or "purifying" is meant that one or more components of the
biological
sample are removed from one or more other components of the sample. Sample
components
include nucleic acids in a generally aqueous solution phase which may also
include materials
such as proteins, carbohydrates, lipids and labeled probes. Preferably, the
separating or purifying
step removes at least about 70%, more preferably at least about 90% and, even
more preferably,
0 at least about 95% of the other components present in the sample.
By "RNA and DNA equivalents" or "RNA and DNA equivalent bases" is meant
molecules, such as RNA and DNA, having the same complementary base pair
hybridization
properties. RNA and DNA equivalents have different sugar moieties (i.e.,
ribose versus
deoxyribose) and may differ by the presence of uracil in RNA and thymine in
DNA. The
differences between RNA and DNA equivalents do not contribute to differences
in homology
because the equivalents have the same degree of complementarity to a
particular sequence.
By "consisting essentially of' is meant that additional component(s),
composition(s) or
method step(s) that do not materially change the basic and novel
characteristics of the present
invention may be included in the compositions or kits or methods of the
present invention. Such
characteristics include the ability to selectively detect HIV-1, HIV-2, or the
combination of HIV-
1 and HIV-2 nucleic acids in biological samples such as whole blood or plasma.
Any
component(s), composition(s), or method step(s) that have a material effect on
the basic and
novel characteristics of the present invention would fall outside of this
term.
Brief Description of the Drawings
Figure 1 is a schematic diagram illustrating the various polynucleotides that
can be used
for detecting a target region within the nucleic acid of HIV-1 or HIV-2
(represented by a thick
horizontal line). Positions of the following nucleic acids are shown relative
to the target region:
"Capture Oligonucleotide" refers to the nucleic acid used to hybridize to and
capture the target
nucleic acid prior to amplification, where "T" refers to a tail sequence used
to hybridize an
immobilized oligonucleotide having a complementary sequence (not shown); "Non-
T7 Primer"
and "T7 Promoter-Primer" represent two amplification primers used for
conducting TMA, where
"P" indicates the promoter sequence of the T7 promoter-primer; and "Probe"
refers to the probe
17
CA 02547750 2006-05-31
WO 2005/061738
PCT/US2004/042899
used for detecting amplified nucleic acid.
Detailed Description of the Invention
Disclosed herein are compositions, methods and kits for detecting the nucleic
acids of
HIV-1, HIV-2, or the combination of HIV-1 and HIV-2 in biological samples such
as blood,
serum, plasma or other body fluid or tissue. The probes, primers and methods
of the invention
can be used either in diagnostic applications or for screening donated blood
and blood products
or other tissues that may contain infectious particles.
Introduction and Overview
The present invention includes compositions (i.e., amplification
oligonucleotides or
0 primers, and probes), methods and kits that are particularly useful for
detecting the nucleic acids
of HIV-1, HIV-2, or the combination of HIV-1 and HIV-2 in a biological sample.
To design
oligonucleotide sequences appropriate for such uses, known HIV-1 and HIV-2
nucleic acid
sequences were first compared to identify candidate regions of the viral
genomes that could serve
as reagents in a diagnostic assay. As a result of these comparisons,
particular sequences were
5 selected and tested as targets for detection using the capture
oligonucleotides, primers and probes
shown schematically in Figure 1. Portions of sequences containing relatively
few variants were
chosen as starting points for designing synthetic oligonucleotides suitable
for use in capture,
amplification and detection of amplified sequences.
Based on these analyses, the amplification primer and probe sequences
presented below
?,0 were designed. Those having an ordinary level of skill in the art will
appreciate that any primer
sequences specific for HIV-1, HIV-2, or the combination of HIV-1 and HIV-2
targets, with or
without a T7 promoter sequence, may be used as primers in the various primer-
based in vitro
amplification methods described below. It is also contemplated that
oligonucleotides having the
sequences disclosed herein could serve alternative functions in assays for
detecting HIV-1 and/or
25 HIV-2 nucleic acids. For example, the capture oligonucleotides disclosed
herein could serve as
hybridization probes, the hybridization probes disclosed herein could be used
as amplification
primers, and the amplification primers disclosed herein could be used as
hybridization probes in
alternative detection assays.
The amplification primers disclosed herein are particularly contemplated as
components
30 of multiplex amplification reactions wherein several amplicon species
can be produced from an
assortment of target-specific primers. For example, it is contemplated that
certain preferred
primers disclosed herein can be used in multiplex amplification reactions that
are capable of
18
CA 02547750 2012-03-14
amplifying polynucleotides of unrelated viruses without substantially
compromising the
sensitivities of those assays. Particular examples of these unrelated viruses
include HCV and
HBV.
Useful Amplification Methods
Amplification methods useful in connection with the present invention include:
Transcription Mediated Amplification (TMA), Nucleic Acid Sequence-Based
Amplification
(NASBA), the Polymerase Chain Reaction (PCR), Strand Displacement
Amplification (SDA),
and amplification methods using self-replicating polynucleotide molecules and
replication
enzymes such as MDV-1 RNA and Q-beta enzyme. Methods for carrying out these
various
amplification techniques respectively can be found in U.S. Patent No.
5,399,491, published
European patent application EP 0 525 882, U.S. Patent No. 4,965,188, U.S.
Patent No.
5,455,166, U.S. Patent No. 5,472,840 and Lizardi et al., BioTechnology 6:1197
(1988). The
disclosures of these documents describe how to perform nucleic acid
amplification reactions.
In a highly preferred embodiment of the invention, analyte nucleic acid
sequences are
amplified using a TMA protocol. According to this protocol, the reverse
transcriptase which
provides the DNA polymerase activity also possesses an endogenous RNase H
activity. One
of the primers used in this procedure contains a promoter sequence positioned
upstream of a
sequence that is complementary to one strand of a target nucleic acid that is
to be amplified.
In the first step of the amplification, a promoter-primer hybridizes to the
target RNA at a
defined site. Reverse transcriptase creates a complementary DNA copy of the
target RNA by
extension from the 3' end of the promoter-primer. Following interaction of an
opposite strand
primer with the newly synthesized DNA strand, a second strand of DNA is
synthesized from
the end of the primer by reverse transcriptase, thereby creating a double-
stranded DNA
molecule. RNA polymerase recognizes the promoter sequence in this double-
stranded DNA
template and initiates transcription. Each of the newly synthesized RNA
amplicons re-enters
the TMA process and serves as a template for a new round of replication,
thereby leading to
an exponential expansion of the RNA amplicon. Since each of the DNA templates
can make
100-1000 copies of RNA amplicon, this expansion can result in the production
of 10 billion
amplicons in less than one hour. The entire process is autocatalytic and is
performed at a
constant temperature.
19
CA 02547750 2006-05-31
WO 2005/061738
PCT/US2004/042899
Structural Features of Primers
As indicated above, a "primer" refers to an optionally modified
oligonucleotide which is
capable of participating in a nucleic acid amplification reaction. Highly
preferred primers are
capable of hybridizing to a template nucleic acid and have a 3' end that can
be extended by a
DNA polymerase activity. The 5' region of the primer may be non-complementary
to the target
nucleic acid. If the 5' non-complementary region includes a promoter sequence,
it is referred to
as a "promoter-primer." Those skilled in the art will appreciate that any
oligonucleotide that can
function as a primer (i.e., an oligonucleotide that hybridizes specifically to
a target sequence and
has a 3' end capable of extension by a DNA polymerase activity) can be
modified to include a 5'
promoter sequence, and thus could function as a promoter-primer. Similarly,
any promoter-
primer can be modified by removal of, or synthesis without, a promoter
sequence and still
function as a primer.
Nucleotide base moieties of primers may be modified (e.g., by the addition of
propyne
groups), as long as the modified base moiety retains the ability to form a non-
covalent
association with G, A, C, T or U, and as long as an oligonucleotide comprising
at least one
modified nucleotide base moiety or analog is not sterically prevented from
hybridizing with a
single-stranded nucleic acid. As indicated below in connection with the
chemical composition of
useful probes, the nitrogenous bases of primers in accordance with the
invention may be
conventional bases (A, G, C, T, U), known analogs thereof (e.g., inosine or
"I" having
hypoxanthine as its base moiety; see The Biochemistry of the Nucleic Acids 5-
36, Adams et al.,
ed., 111h ed., 1992), known derivatives of purine or pyrimidine bases (e.g.,
N4-methyl
deoxygaunosine, deaza- or aza-purines and deaza- or aza-pyrimidines,
pyrimidine bases having
substituent groups at the 5 or 6 position, purine bases having an altered or a
replacement
substituent at the 2, 6 or 8 positions, 2-amino-6-methylaminopurine, 06-
methylguanine, 4-thio-
pyrimidines, 4-amino-pyrimidines, 4-dimethylhydrazine-pyrimidines, and 04-
alkyl-pyrimidines
(see, Cook, PCT Int'l Pub. No. WO 93/13121) and "abasic" residues where the
backbone
includes no nitrogenous base for one or more residues of the polymer (see
Arnold et al., U.S.
Patent No. 5,585,481). Common sugar moieties that comprise the primer backbone
include
ribose and deoxyribose, although 2'-0-methyl ribose (0Me), halogenated sugars,
and other
modified sugar moieties may also be used. Usually, the linking group of the
primer backbone is
a phosphorus-containing moiety, most commonly a phosphodiester linkage,
although other
linkages, such as, for example, phosphorothioates, methylphosphonates, and non-
phosphorus-
CA 02547750 2012-03-14
containing linkages such as peptide-like linkages found in "peptide nucleic
acids" (PNA) also are
intended for use in the assay disclosed herein.
Useful Probe Labeling Systems and Detectable Moieties
Essentially any labeling and detection system that can be used for monitoring
specific
nucleic acid hybridization can be used in conjunction with the present
invention. Included among
the collection of useful labels are radiolabels, enzymes, haptens, linked
oligonucleotides,
chemiluminescent molecules, fluorescent moieties (either alone or in
combination with "quencher"
moieties), and redox-active moieties that are amenable to electronic detection
methods. Preferred
chemiluminescent molecules include acridinium esters of the type disclosed by
Arnold et al., in
U.S. Patent No. 5,283,174 for use in connection with homogenous protection
assays, and of the
type disclosed by Woodhead et al., in U.S. Patent No. 5,656,207 for use in
connection with assays
that quantify multiple targets in a single reaction. Preferred electronic
labeling and detection
approaches are disclosed in U.S. Patent Nos. 5,591,578 and 5,770,369, and the
published
international patent application WO 98/57158. Redox active moieties useful as
labels in the
present invention include transition metals such as Cd, Mg, Cu, Co, Pd, Zn, Fe
and Ru.
Particularly preferred detectable labels for probes in accordance with the
present invention
are detectable in homogeneous assay systems (i.e., where, in a mixture, bound
labeled probe
exhibits a detectable change, such as stability or differential degradation,
compared to unbound
labeled probe). While other homogeneously detectable labels, such as
fluorescent labels and
electronically detectable labels, are intended for use in the practice of the
present invention, a
preferred label for use in homogenous assays is a chemiluminescent compound
(e.g., as described
by Woodhead et al., in U.S. Patent No. 5,656,207; by Nelson et al., in U.S.
Patent No. 5,658,737;
or by Arnold et al., in U.S. Patent No. 5,639,604). Particularly preferred
chemiluminescent labels
include acridinium ester ("AE") compounds, such as standard AE or derivatives
thereof, such as
naphthyl-AE, ortho-AE, 1- or 3-methyl-AE, 2,7-dimethyl-AE, 4,5-dimethyl-AE,
ortho-dibromo-
AE, ortho-dimethyl-AE, meta-dimethyl-AE, ortho-methoxy-AE, ortho-
methoxy(cinnamy1)-AE,
ortho-methyl-AE, ortho-fluoro-AE, 1- or 3-methyl-ortho-fluoro-AE, 1- or 3-
methyl-meta-difluoro-
AE, and 2-methyl-AE.
In some applications, probes exhibiting at least some degree of self-
complementarity are
desirable to facilitate detection of probe:target duplexes in a test sample
without first requiring the
removal of unhybridized probe prior to detection. By way of example,
structures referred to as
21
CA 02547750 2012-03-14
"molecular torches" are designed to include distinct regions of self-
complementarity (coined "the
target binding domain" and "the target closing domain") which are connected by
a joining region
and which hybridize to one another under predetermined hybridization assay
conditions. When
exposed to denaturing conditions, the two complementary regions (which may be
fully or partially
complementary) of the molecular torch melt, leaving the target binding domain
available for
hybridization to a target sequence when the predetermined hybridization assay
conditions are
restored. Molecular torches are designed so that the target binding domain
favors hybridization to
the target sequence over the target closing domain. The target binding domain
and the target
closing domain of a molecular torch include interacting labels (e.g.,
fluorescent/quencher)
positioned so that a different signal is produced when the molecular torch is
self-hybridized as
opposed to when the molecular torch is hybridized to a target nucleic acid,
thereby permitting
detection of probe:target duplexes in a test sample in the presence of
unhybridized probe having a
viable label associated therewith. Molecular torches are fully described in
U.S. Patent No.
6,361,945.
Another example of a self-complementary hybridization assay probe that may be
used in
conjunction with the invention is a structure commonly referred to as a
"molecular beacon."
Molecular beacons comprise nucleic acid molecules having a target
complementary sequence, an
affinity pair (or nucleic acid arms) holding the probe in a closed
conformation in the absence of a
target nucleic acid sequence, and a label pair that interacts when the probe
is in a closed
conformation. Hybridization of the target nucleic acid and the target
complementary sequence
separates the members of the affinity pair, thereby shifting the probe to an
open conformation.
The shift to the open conformation is detectable due to reduced interaction of
the label pair, which
may be, for example, a fluorophore and a quencher (e.g., DABCYL and EDANS).
Molecular
beacons are fully described in U.S. Patent No. 5,925,517. Molecular beacons
useful for detecting
specific nucleic acid sequences may be created by appending to either end of
one of the probe
sequences disclosed herein, a first nucleic acid arm comprising a fluorophore
and a second nucleic
acid arm comprising a quencher moiety. hi this configuration, the probe
sequence disclosed herein
serves as the target-complementary "loop" portion of the resulting molecular
beacon.
Molecular beacons preferably are labeled with an interactive pair of
detectable labels.
22
CA 02547750 2006-05-31
WO 2005/061738
PCT/US2004/042899
Examples of detectable labels that are preferred as members of an interactive
pair of labels
interact with each other by FRET or non-FRET energy transfer mechanisms.
Fluorescence
resonance energy transfer (FRET) involves the radiationless transmission of
energy quanta from
the site of absorption to the site of its utilization in the molecule, or
system of molecules, by
resonance interaction between chromophores, over distances considerably
greater than
interatomic distances, without conversion to thermal energy, and without the
donor and acceptor
coming into kinetic collision. The "donor" is the moiety that initially
absorbs the energy, and the
"acceptor" is the moiety to which the energy is subsequently transferred. In
addition to FRET,
there are at least three other "non-FRET" energy transfer processes by which
excitation energy
0 can be transferred from a donor to an acceptor molecule.
When two labels are held sufficiently close that energy emitted by one label
can be
received or absorbed by the second label, whether by a FRET or non-FRET
mechanism, the two
labels are said to be in "energy transfer relationship" with each other. This
is the case, for
example, when a molecular beacon is maintained in the closed state by
formation of a stem
5 duplex, and fluorescent emission from a fluorophore attached to one arm
of the probe is
quenched by a quencher moiety on the opposite arm.
Highly preferred label moieties for molecular beacons include a fluorophore
and a second
moiety having fluorescence quenching properties (i.e., a "quencher"). In this
embodiment, the
characteristic signal is likely fluorescence of a particular wavelength, but
alternatively could be a
ZO visible light signal. When fluorescence is involved, changes in emission
are preferably due to
FRET, or to radiative energy transfer or non-FRET modes. When a molecular
beacon having a
pair of interactive labels in the closed state is stimulated by an appropriate
frequency of light, a
fluorescent signal is generated at a first level, which may be very low. When
this same probe is
in the open state and is stimulated by an'appropriate frequency of light, the
fluorophore and the
25 quencher moieties are sufficiently separated from each other that energy
transfer between them is
substantially precluded. Under that condition, the quencher moiety is unable
to quench the
fluorescence from the fluorophore moiety. If the fluorophore is stimulated by
light energy of an
appropriate wavelength, a fluorescent signal of a second level, higher than
the first level, will be
generated. The difference between the two levels of fluorescence is detectable
and measurable.
30 Using fluorophore and quencher moieties in this manner, the molecular
beacon is only "on" in
the "open" conformation and indicates that the probe is bound to the target by
emanating an
easily detectable signal. The conformational state of the probe alters the
signal generated from
23
CA 02547750 2006-05-31
WO 2005/061738
PCT/US2004/042899
the probe by regulating the interaction between the label moieties.
Examples of donor/acceptor label pairs that may be used in connection with the
invention, making no attempt to distinguish FRET from non-FRET pairs, include
fluorescein/tetramethylrhodamine, IAEDANS/fluororescein, EDANS/DABCYL,
coumarin/DABCYL, fluorescein/fluorescein, BODIPY FL/BODIPY FL,
fluorescein/DABCYL,
lucifer yellow/DABCYL, BODIPY/DABCYL, eosine/DABCYL, erythrosine/DABCYL,
tetramethylrhodamine/DABCYL, Texas Red/DABCYL, CY5/BH1, CY5/BH2, CY3/BH1,
CY3/BH2 and fluorescein/QSY7 dye. Those having an ordinary level of skill in
the art will
understand that when donor and acceptor dyes are different, energy transfer
can be detected by
the appearance of sensitized fluorescence of the acceptor or by quenching of
donor fluorescence.
When the donor and acceptor species are the same, energy can be detected by
the resulting
fluorescence depolarization. Non-fluorescent acceptors such as DABCYL and the
QSY 7 dyes
advantageously eliminate the potential problem of background fluorescence
resulting from direct
(i.e., non-sensitized) acceptor excitation. Preferred fluorophore moieties
that can be used as one
member of a donor-acceptor pair include fluorescein, ROX, and the CY dyes
(such as CY5).
Highly preferred quencher moieties that can be used as another member of a
donor-acceptor pair
include DABCYL and the BLACK HOLE QUENCHER moieties which are available from
Biosearch Technologies, Inc., (Novato, CA).
Synthetic techniques and methods of bonding labels to nucleic acids and
detecting labels
are well known in the art (e.g., see Sambrook et al., Molecular Cloning, A
Laboratory Manual,
2nd ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989),
Chapter 10;
Nelson et al., U.S. Patent No. 5,658,737; Woodhead et al., U.S. Patent No.
5,656,207; Hogan et
al., U.S. Patent No. 5,547,842; Arnold et al., U.S. Patent No. 5,283,174;
Kourilsky et al., U.S.
Patent No. 4,581,333), and Becker et al., European Patent App. No. 0 747 706.
Chemical Composition of Probes
Probes in accordance with the invention comprise polynucleotides or
polynucleotide
analogs and optionally may carry a detectable label covalently bonded thereto.
Nucleosides or
nucleoside analogs of the probe comprise nitrogenous heterocyclic bases, or
base analogs, where
the nucleosides are linked together, for example by phospohdiester bonds to
form a
polynucleotide. Accordingly, a probe may comprise conventional ribonucleic
acid (RNA) and/or
deoxyribonucleic acid (DNA), but also may comprise chemical analogs of these
molecules. The
"backbone" of a probe may be made up of a variety of linkages known in the
art, including one
24
CA 02547750 2006-05-31
WO 2005/061738
PCT/US2004/042899
= or more sugar-phosphodiester linkages, peptide-nucleic acid bonds
(sometimes referred to as
"peptide nucleic acids" as described by Hyldig-Nielsen et al., PCT Intl Pub.
No. WO 95/32305),
phosphorothioate linkages, methylphosphonate linkages or combinations thereof.
Sugar moieties
of the probe may be either ribose or deoxyribose, or similar compounds having
known
substitutions, such as, for example, 2'-0-methyl ribose and 2' halide
substitutions (e.g., 2'-F).
The nitrogenous bases may be conventional bases (A, G, C, T, U), known analogs
thereof (e.g.,
inosine or "I"; see The Biochemistry of the Nucleic Acids 5-36, Adams et al.,
ed., 11th ed., 1992),
known derivatives of purine or pyrimidine bases (e.g., N4-methyl
deoxygaunosine, deaza- or aza-
purines and deaza- or aza-pyrimidines, pyrimidine bases having substituent
groups at the 5 or 6
position, purine bases having an altered or a replacement substituent at the
2, 6 or 8 positions, 2-
amino-6-methylaminopurine, 06-methylguanine, 4-thio-pyrimidines, 4-amino-
pyrimidines, 4-
dimethylhydrazine-pyrimidines, and 04-alkyl-pyrimidines (see, Cook, PCT Int'l
Pub. No. WO
93/13121) and "abasic" residues where the backbone includes no nitrogenous
base for one or
more residues of the polymer (see Arnold et al., U.S. Patent No. 5,585,481). A
probe may
comprise only conventional sugars, bases and linkages found in RNA and DNA, or
may include
both conventional components and substitutions (e.g., conventional bases
linked via a methoxy
backbone, or a nucleic acid including conventional bases and one or more base
analogs).
While oligonucleotide probes of different lengths and base composition may be
used for
detecting the nucleic acids of HIV-1, HIV-2, or the combination of HIV-1 and
HIV-2, preferred
probes in this invention have lengths of up to 100 nucleotides, and more
preferably have lengths
of up to 60 nucleotides. Preferred length ranges for the invented
oligonucleotides are from 10 to
100 bases in length, or more preferably between 15 and 50 bases in length, or
still more
preferably between 15 and 30 bases in length. However, the specific probe
sequences described
below also may be provided in a nucleic acid cloning vector or transcript or
other longer nucleic
acid and still can be used for detecting target nucleic acids. Thus, useful
probes in accordance
with the invention can include a target-complementary sequence of bases which
are of limited
length, and one or more appended sequences which are not complementary to the
target sequence
that is to be detected. For example, a molecular beacon would include a target-
complementary
loop sequence flanked by "arm" sequences which are not complementary to the
target that is to
be detected.
Selection of Amplification Primers and Detection Probes
Useful guidelines for designing amplification primers and probes with desired
CA 02547750 2012-03-14
characteristics are described herein. The optimal sites for amplifying and
probing HIV-1
and/or HIV-2 nucleic acids contain two, and preferably three, conserved
regions each greater
than about 10-15 bases in length, within about 200-300 bases of contiguous
sequence. The degree
of amplification observed with a set of primers or promoter-primers depends on
several factors,
including the ability of the oligonucleotides to hybridize to their
complementary sequences and
their ability to be extended enzymatically. Because the extent and specificity
of hybridization
reactions are affected by a number of factors, manipulation of those factors
will determine the
exact sensitivity and specificity of a particular oligonucleotide, whether
perfectly complementary
to its target or not. The effects of varying assay conditions are known to
those skilled in the art,
and are described by Hogan et al., in U.S. Patent No. 5,840,488.
The length of the target nucleic acid sequence and, accordingly, the length of
the primer
sequence or probe sequence can be important. In some cases, there may be
several sequences from
a particular target region, varying in location and length, which will yield
primers or probes having
the desired hybridization characteristics. While it is possible for nucleic
acids that are not perfectly
complementary to hybridize, the longest stretch of perfectly homologous base
sequence will
normally primarily determine hybrid stability.
Amplification primers and probes should be positioned to minimize the
stability of the
oligonucleotide:nontarget (i.e., nucleic acid with similar sequence to target
nucleic acid) nucleic
acid hybrid. It is preferred that the amplification primers and detection
probes are able to
distinguish between target and non-target sequences. In designing primers and
probes, the
differences in these Tm values should be as large as possible (e.g., at least
2 C and preferably
C).
The degree of non-specific extension (primer-dimer or non-target copying) can
also affect
amplification efficiency. For this reason, primers are selected to have low
self- or cross-
complementarity, particularly at the 3' ends of the sequence. Long homopolymer
tracts and high
GC content are avoided to reduce spurious primer extension. Commercially
available computer
software can aid in this aspect of the design. Available computer programs
include MacDNASISTM
2.0 (Hitachi Software Engineering American Ltd.) and OLIGO ver. 6.6 (Molecular
Biology
Insights; Cascade, CO).
Those having an ordinary level of skill in the art will appreciate that
hybridization involves
the association of two single strands of complementary nucleic acid to form a
hydrogen
26
CA 02547750 2006-05-31
WO 2005/061738
PCT/US2004/042899
bonded double strand. It is implicit that if one of the two strands is wholly
or partially involved
in a hybrid, then that strand will be less able to participate in formation of
a new hybrid. By
designing primers and probes so that substantial portions of the sequences of
interest are single
stranded, the rate and extent of hybridization may be greatly increased. If
the target is an
integrated genomic sequence, then it will naturally occur in a double stranded
form (as is the
case with the product of the polymerase chain reaction). These double-stranded
targets are
naturally inhibitory to hybridization with a probe and require denaturation
prior to the
hybridization step.
The rate at which a polynucleotide hybridizes to its target is a measure of
the thermal
stability of the target secondary structure in the target binding region. The
standard measurement
of hybridization rate is the Cotin which is measured as moles of nucleotide
per liter multiplied by
seconds. Thus, it is the concentration of probe multiplied by the time at
which 50% of maximal
hybridization occurs at that concentration. This value is determined by
hybridizing various
amounts of polynucleotide to a constant amount of target for a fixed time. The
CotIn is found
graphically by standard procedures familiar to those having an ordinary level
of skill in the art.
Preferred Amplification Primers
Primers useful for conducting amplification reactions can have different
lengths to
accommodate the presence of extraneous sequences that do not participate in
target binding, and
that may not substantially affect amplification or detection procedures. For
example, promoter-
primers useful for performing amplification reactions in accordance with the
invention have at
least a minimal sequence that hybridizes to the target nucleic acid, and a
promoter sequence
positioned upstream of that minimal sequence. However, insertion of sequences
between the
target binding sequence and the promoter sequence could change the length of
the primer
without compromising its utility in the amplification reaction. Additionally,
the lengths of the
amplification primers and detection probes are matters of choice as long as
the sequences of
these oligonucleotides conform to the minimal essential requirements for
hybridizing the desired
complementary sequence.
Tables 1 and 2 present specific examples of oligonucleotide sequences that
were used as
primers for amplifying HIV-1, HIV-2, or the combination of HIV-1 and HIV-2
nucleic acids in
the region encoding p31 integrase. Table 1 presents the sequences of primers
that were
substantially complementary to one strand of the different nucleic acid
targets. The illustrative
primers presented in Table 1 have target-complementary sequences that include
a 17-mer core
27
CA 02547750 2006-05-31
WO 2005/061738
PCT/US2004/042899
sequence of ACARYAGTACWAATGGC (SEQ ID NO:10) (where "R" represents A/G, and
"W" represents A or T/U), allowing for the substitution of up to one, or even
up to two base
analogs. Inosine is an example of a highly preferred base analog that can be
used for this
purpose, and position 5 and/or position 11 of the core sequence can be
substituted with this base
analog with very good results. It is preferred for one of the primers used in
the amplification
procedure to have a target-complementary sequence that contains this 17-mer
core. The primer
may further include several nucleotides appended to the upstream terminus of
the core sequence,
and may include a few nucleotides appended to the downstream terminus of the
core sequence.
For example, there can be five, or even more nucleotides appended to the
upstream terminus. It
0 is convenient to include one, two, or three nucleotides appended to the
downstream terminus, if
desired. Table 2 presents the sequences of the target-complementary primers
and the full
sequences for promoter-primers that were used during development of the
invention. Notably,
the oligonucleotide sequences in Table 1 and Table 2 are substantially
complementary to
opposite strands of the target nucleic acid to be amplified.
Primers useful for amplifying the HIV-1 and/or HIV-2 nucleic acid targets can
include
nucleotide analogs. For example, when compared with the basic primer sequence
of SEQ ID
NO:5, primers having SEQ ID NO:6, SEQ ID NO:7 and SEQ ID NO:9 differ by the
presence of
a single inosine residue at position 16, substitution of a T residue for a C
at position 10 and an
inosine residue at position 16, or inosine substitutions at positions 10 and
16, respectively. As
confirmed by the experimental findings presented herein, these base
differences conferred
beneficial properties that could not have been predicted in advance of the
discovery described
herein. More specifically, the results demonstrated that one of these mutant
primers, when
paired with a single opposite-strand primer, lost specificity for the HIV-1
template and acquired
the capacity for amplifying both HIV-1 and HIV-2 templates with substantially
equal efficiency.
This illustrates how certain positions in the primers may be substituted by
modified bases or base
analogs.
28
CA 02547750 2006-05-31
WO 2005/061738
PCT/US2004/042899
Table 1
Polynucleotide Sequences of Amplification Primers
Sequence Identifier
ACAGCAGTACAAATGGCAG SEQ ID NO:1
ACAACAGTACAAATGGCAGT SEQ ID NO:2
ACAATAGTACTAATGGCAGT SEQ ID NO:3
TTAAGACAGCAGTACAAATGGC SEQ ID NO:4
TAGAGACAGCAGTACAAATGGC SEQ ID NO:5
TAGAGACAGCAGTACIAATGGC SEQ ID NO:6
0 TAGAGACAGTAGTACIAATGGC SEQ ID NO:7
TAGAGACAGCAGTACTAATGGC SEQ ID NO:8
TAGAGACAGIAGTACIAATGGC SEQ ID NO:9
Table 2 presents target-complementary oligonucleotide sequences and the
corresponding
5 promoter-primer sequences that were used for amplifying HIV-1 and HIV-2
nucleic acid
sequences. As indicated above, all promoter-primers included sequences that
were substantially
complementary to, meaning that they were able to hybridize to, a target
sequence at their 3' ends,
and a T7 promoter sequence at their 5' ends. Primers identified by SEQ ID
NOs:17-22 in Table
2 are Promoter-primers corresponding to the primers identified as SEQ ID
NOs:11-16, =
W respectively. Bases corresponding to T7 promoter sequences in the table
are underlined.
29
CA 02547750 2006-05-31
WO 2005/061738
PCT/US2004/042899
Table 2
Polynucleotide Sequences of Amplification Primers
Feature Sequence
Identifier
Target- ATTTCTTGTTCTGTGGTAATCATGTTG SEQ ID
NO:11
complementary
Target- TTGTTTTTGTAATAGTTGTATTTCTTGTTCTG SEQ ID NO:12
complementary
Target- GTTTGTATGTCTGTTGCTATTATGTCTATTAG SEQ ID NO:13
complementary TCTTTCTGCTGG
Target- GTTTGTATGTCTGTTGCTATCATGTTGATTAT SEQ ID NO:14
complementary TCTTTC
Target- ATTTGTTTTTGTAATTCTTGTATTTCTATGTC SEQ ID NO:15
complementary TGT
Target- GTTTGTATGTCTGTTGCTATTATGTCTA SEQ ID
NO:16
complementary
T7 Promoter- AATTTAATACGACTCACTATAGGGAGAATTT SEQ ID NO:17
Primer CTTGTTCTGTGGTAATCATGTTG
T7 Promoter- AATTTAATACGACTCACTATAGGGAGATTGT SEQ ID NO:18
Primer TTTTGTAATAGTTGTATTTCTTGTTCTG
T7 Promoter- AATTTAATACGACTCACTATAGGGAGAGTTT SEQ ID NO:19
Primer GTATGTCTGTTGCTATTATGTCTATTAGTCTT
TCTGCTGG
T7 Promoter- AATTTAATACGACTCACTATAGGGAGAGTTT SEQ ID NO:20
Primer GTATGTCTGTTGCTATCATGTTGATTATTCTT
TC
T7 Promoter- AATTTAATACGACTCACTATAGGGAGAATTT SEQ ID'NO:21
Primer GTTTTTGTAATTCTTGTATTTCTATGTCTGT
T7 Promoter- AATTTAATACGACTCACTATAGGGAGAGTTT SEQ ID NO:22
Primer GTATGTCTGTTGCTATTATGTCTA
Preferred sets of primers for amplifying HIV-1, HIV-2, or the combination of
HIV-1 and
HIV-2 sequences in the region encoding the p31 integrase included a first
primer that hybridized
the target nucleic acid to be amplified (such as one of the primers listed in
Table 2) and a second
primer that is complementary to the sequence of an extension product of the
first primer (such as
one of the primer sequences listed in Table 1). In a highly preferred
embodiment, the first
CA 02547750 2006-05-31
WO 2005/061738
PCT/US2004/042899
primer is a promoter-primer that includes a T7 promoter sequence at its 5'
end.
Preferred Detection Probes
Another aspect of the invention relates to oligonucleotides that can be used
as
hybridization probes for detecting HIV-1, HIV-2, or the combination of HIV-1
and HIV-2
nucleic acids. Indeed, methods for amplifying a target sequence present in the
nucleic acid of
HIV-1 or HIV-2 can include an optional further step for detecting amplicons.
This procedure for
detecting HIV-1 and/or HIV-2 nucleic acids includes a step for contacting a
test sample with a
hybridization assay probe that hybridizes to the target nucleic acid sequence,
or the complement
thereof, under stringent hybridization conditions, thereby forming a
probe:target duplex that is
[0 stable for detection. Next there is a step for determining whether the
hybrid is present in the test
sample as an indication of the presence or absence of HIV-1 or HIV-2 nucleic
acid target in the
test sample. This may involve detecting the probe:target duplex, and
preferably involves
homogeneous assay systems.
Hybridization assay probes useful for detecting HIV-1, HIV-2, or the
combination of
HIV-1 and HIV-2 nucleic acids include a sequence of bases substantially
complementary to these
target nucleic acid sequences. Thus, probes of the invention hybridize one
strand of a target
nucleic acid sequence, or the complement thereof. These probes optionally may
have additional
bases outside of the targeted nucleic acid region which may or may not be
complementary to the
target nucleic acid that is to be detected.
Preferred probes are sufficiently homologous to the target nucleic acid to
hybridize under
stringent hybridization conditions corresponding to about 60 C when the salt
concentration is in
the range of 0.6-0.9 M. Preferred salts include lithium chloride, but other
salts such as sodium
chloride and sodium citrate also can be used in the hybridization solution.
Example high
stringency hybridization conditions are alternatively provided by 0.48 M
sodium phosphate
buffer, 0.1% sodium dodecyl sulfate, and 1 mM each of EDTA and EGTA, or by 0.6
M LiC1, 1%
lithium lauryl sulfate, 60 mM lithium succinate and 10 mM each of EDTA and
EGTA.
Probes in accordance with the invention have sequences substantially
complementary to,
or substantially corresponding to portions of the HIV-1 and HIV-2 genomes.
Certain probes that
are preferred for detecting HIV-1, HIV-2, or the combination of HIV-1 and HIV-
2 nucleic acid
sequences have a probe sequence which includes a target-complementary sequence
of bases, and
optionally one or more base sequences that are not complementary to the
nucleic acid that is to
be detected. The target-complementary sequence of bases preferably is in the
length range of
31
CA 02547750 2012-03-14
from 10-100 nucleotides and is able to hybridize to the amplified nucleic
acid. Certain
preferred probes that are capable of detecting HIV-1, HIV-2, or the
combination of HIV-1 and
HIV-2 nucleic acid sequences have target-complementary sequences in the length
range of
from 10-100, from 15-60, from 15-45 or from 20-30 nucleotides. Of course,
these target-
complementary sequences may be linear sequences, or may be contained in the
structure of a
molecular beacon, a molecular torch or other construct having one or more
optional nucleic
acid sequences that are non-complementary to the target sequence that is to be
detected. As
indicated above, probes may be made of DNA, RNA, a combination DNA and RNA, a
nucleic acid analog, or contain one or more modified nucleosides (e.g., a
ribonucleoside
having a 21-0-methyl substitution to the ribofuranosyl moiety).
Certain probes in accordance with the present invention include a detectable
label. In
one embodiment this label is joined to the probe by means of a non-nucleotide
linker. For
example, detection probes can be labeled with chemiluminescent acridinium
ester compounds
that are attached via a linker substantially as described in U.S. Patent No.
5,585,481; and in
U.S. Patent No. 5,639,604, particularly as described at column 10, line 6 to
column 11, line 3,
and in Example 8.
Table 3 presents the base sequences of some of the hybridization probes that
were used
for detecting HIV-1 target sequences, HIV-2 target sequences, or both HIV-1
and HIV-2 target
sequences. Since alternative probes for detecting these target nucleic acids
can hybridize to
opposite-sense strands, the present invention also includes oligonucleotides
that are
complementary to the sequences presented in the table.
32
CA 02547750 2006-05-31
WO 2005/061738
PCT/US2004/042899
Table 3
Polynucleotide Sequences of Detection Probes
Sequence Identifier
CCTGAATTTTAAAAGAAGGGGG SEQ ID NO:23
CCAGAATTTTAAAAGAAGGGGIGG SEQ ID NO:24
CCACAATTTTAAAAGAAGGGGIGG SEQ ID NO:25
CCTGAATTTTAAAAGAAGGGGIGG SEQ ID NO:26
CATGAATTTTAAAAGAAGGGGA SEQ ID NO:27
CCTGAATTTTAAAAGAAIGGGG SEQ ID NO:28
CCIGAATTTTAAAAGAAGGGGG SEQ ID NO:29
CCIIAATTTTAAAAGAAGGGGG SEQ ID NO:30
AAAGAAIGGIGGGGATIGGGIGG SEQ ID NO:31
AAAGAAIGGIGGGGATTGGGIGG SEQ ID NO:32
AATTTTAAAAGAAGAGGIGGGATTGGGGG SEQ ID NO:33
CAATTTTAAAAGAAGGGGIGGG SEQ ID NO:34
GAATTTTAAAAGAAGIGGGGIG SEQ ID NO:35
GAAUUUUAAAAGAAGGGGIGGG SEQ ID NO:36
As indicated above, any number of different backbone structures can be used as
a
scaffold for the base sequences of the invented hybridization probes. In
certain highly preferred
embodiments, the probe includes a methoxy backbone, or at least one methoxy
linkage in the
nucleic acid backbone.
Selection and Use of Capture Oligonucleotides
Preferred capture oligonucleotides include a first sequence that is
substantially
complementary to a target sequence (i.e., a "target-complementary" sequence)
covalently
attached to a second sequence (i.e., a "tail" sequence) that serves as a
target for immobilization
on a solid support. Any backbone to link the base sequence of a capture
oligonucleotide may be
used. In certain preferred embodiments the capture oligonucleotide includes at
least one
methoxy linkage in the backbone. The tail sequence, which is preferably at the
3' end of a
capture oligonucleotide, is used to hybridize to a complementary base sequence
to provide a
means for capturing the hybridized target nucleic acid in preference to other
components in the
33
CA 02547750 2006-05-31
WO 2005/061738
PCT/US2004/042899
biological sample.
Although any base sequence that hybridizes to a complementary base sequence
may be
used in the tail sequence, it is preferred that the hybridizing sequence span
a length of about 5-50
nucleotide residues. Particularly preferred tail sequences are substantially
homopolymeric,
containing about 10 to about 40 nucleotide residues, or more preferably about
14 to about 30
residues. A capture oligonucleotide according to the present invention may
include a first
sequence that hybridizes to a target polynucleotide, and a second sequence
that hybridizes to an
oligo(dT) stretch immobilized to a solid support.
Using the components illustrated in Figure 1, one assay for detecting HIV-1,
HIV-2, or
the combination of HIV-1 and HIV-2 sequences in a biological sample includes
the steps of
capturing the target nucleic acid using the capture oligonucleotide,
amplifying the captured target
region using at least two primers, and detecting the amplified nucleic acid by
first hybridizing a
labeled probe to a sequence contained in the amplified nucleic acid, and then
detecting a signal
resulting from the bound labeled probe.
The capturing step preferably uses a capture oligonucleotide where, under
hybridizing
conditions, one portion of the capture oligonucleotide specifically hybridizes
to a sequence in the
target nucleic acid and a tail portion serves as one component of a binding
pair, such as a ligand
(e.g., a biotin-avidin binding pair) that allows the target region to be
separated from other
components of the sample. Preferably, the tail portion of the capture
oligonucleotide is a
sequence that hybridizes to a complementary sequence immobilized to a solid
support particle.
Preferably, first, the capture oligonucleotide and the target nucleic acid are
in solution to take
advantage of solution phase hybridization kinetics. Hybridization produces a
capture
oligonucleotide:target nucleic acid complex which can bind an immobilized
probe through
hybridization of the tail portion of the capture oligonucleotide with a
complementary
immobilized sequence. Thus, a complex comprising a target nucleic acid,
capture
oligonucleotide and immobilized probe is formed under hybridization
conditions. Preferably, the
immobilized probe is a repetitious sequence, and more preferably a
homopolymeric sequence
(e.g., poly-A, poly-T, poly-C or poly-G), which is complementary to the tail
sequence and
attached to a solid support. For example, if the tail portion of the capture
oligonucleotide
contains a poly-A sequence, then the immobilized probe would contain a poly-T
sequence,
although any combination of complementary sequences may be used. The capture
oligonucleotide may also contain "spacer" residues, which are one or more
bases located
34
CA 02547750 2006-05-31
WO 2005/061738
PCT/US2004/042899
between the base sequence that hybridizes to the target and the base sequence
of the tail that
hybridizes to the immobilized probe. Any solid support may be used for binding
the target
nucleic acid:capture oligonucleotide complex. Useful supports may be either
matrices or
particles free in solution (e.g., nitrocellulose, nylon, glass, polyacrylate,
mixed polymers,
polystyrene, silane polypropylene and, preferably, magnetically attractable
particles). Methods
of attaching an immobilized probe to the solid support are well known. The
support is
preferably a particle which can be retrieved from solution using standard
methods (e.g.,
centrifugation, magnetic attraction of magnetic particles, and the like).
Preferred supports are
paramagnetic monodisperse particles (i.e., uniform in size about 5%).
[0 Retrieving the target nucleic acid:capture oligonucleotide:immobilized
probe complex
effectively concentrates the target nucleic acid (relative to its
concentration in the biological
sample) and purifies the target nucleic acid from amplification inhibitors
which may be present
in the biological sample. The captured target nucleic acid may be washed one
or more times,
further purifying the target, for example, by resuspending the particles with
the attached target
Useful capture oligonucleotides may also contain mismatches to the sequence of
the
' amplification can be achieved as long as the mismatched sequences
hybridize to the nucleic acid
molecule containing the sequence that is to be amplified. Indeed,
oligonucleotides for the
capture of HIV-1 nucleic acids, as described in the published international
patent application
identified by WO 03/106714, were used to practice the methods disclosed
herein, including
30 methods of detecting HIV-2.
Preferred Methods for Amplifying and Detecting Target Polynucleotide Sequences
Preferred methods of the present invention are described and illustrated by
the Examples
CA 02547750 2006-05-31
WO 2005/061738
PCT/US2004/042899
presented below. Figure 1 schematically illustrates one system that may be
used for detecting a
target region of the viral genome (shown by a thick solid horizontal line).
This basic system
includes four oligonucleotides (shown by the shorter solid lines): one capture
oligonucleotide
that includes a sequence that hybridizes to a sequence in the target region
and a tail ("T") that
hybridizes to a complementary sequence immobilized on a solid support to
capture the target
region present in a biological sample; one T7 promoter-primer which includes a
sequence that
hybridizes specifically to an HIV-1 or HIV-2 sequence in the target region and
a T7 promoter
sequence ("P") which, when double-stranded, serves as a functional promoter
for T7 RNA
polymerase; one non-T7 primer which includes a sequence that hybridizes
specifically to a first
.0 strand cDNA made from the target region sequence using the T7 promoter-
primer; and one
labeled probe which includes a sequence that hybridizes specifically to a
portion of the target
region that is amplified using the two primers.
As indicated above, amplifying the captured target region using the two
primers can be
accomplished by any of a variety of known nucleic acid amplification reactions
that will be
familiar to those having an ordinary level of skill in the art. In a preferred
embodiment, a
transcription-associated amplification reaction, such as TMA, is employed. In
such an
embodiment, many strands of nucleic acid are produced from a single copy of
target nucleic acid,
thus permitting detection of the target by detecting probes that are bound to
the amplified
sequences. Preferably, transcription-associated amplification uses two types
of primers (one
being referred to as a promoter-primer because it contains a promoter
sequence, labeled "P" in
Figure 1, for an RNA polymerase) two enzymes (a reverse transcriptase and an
RNA
polymerase), and substrates (deoxyribonucleoside triphosphates, ribonucleoside
triphosphates)
with appropriate salts and buffers in solution to produce multiple RNA
transcripts from a nucleic
acid template.
Referring to Figure 1, during transcription-mediated amplification, the
captured target
nucleic acid is hybridized to a first primer (shown as a T7 promoter-primer).
Using reverse
transcriptase, a complementary DNA strand is synthesized from the T7 promoter-
primer using
the target RNA as a template. A second primer, shown as a non-T7 primer,
hybridizes to the
newly synthesized DNA strand and is extended by the action of a reverse
transcriptase to form a
DNA duplex, thereby forming a double-stranded T7 promoter region. T7 RNA
polymerase then
generates multiple RNA transcripts by using this functional T7 promoter. The
autocatalytic
mechanism of TMA employs repetitive hybridization and polymerization steps
following a
36
CA 02547750 2006-05-31
WO 2005/061738
PCT/US2004/042899
cDNA synthesis step using the RNA transcripts as templates to produce
additional transcripts,
thereby amplifying target region-specific nucleic acid sequences.
The detecting step uses at least one detection probe that binds specifically
to the
amplified RNA transcripts or amplicons described above. Preferably, the
detection probe is
labeled with a label that can be detected using a homogeneous detection
system. For example,
the labeled probe can be labeled with an acridinium ester compound from which
a
chemiluminescent signal may be produced and detected, as described above.
Alternatively, the
labeled probe may comprise a fluorophore or a paired fluorophore and quencher
moiety set. A
molecular beacon is one embodiment of such a labeled probe that may be used in
a
0 homogeneous detection system.
Methods of Detecting HIV-1 and/or HIV-2 Nucleic Acids
Three distinct methods of detecting HIV-1 and HIV-2 nucleic acids in multiplex
assays
also have been invented. Each method is distinguished from the other by the
use of primers that
are cross-reactive or analyte-specific, and also by the use of probes that are
cross-reactive or
[5 analyte-specific.
In the first invented method, independent sets of analyte-specific primers,
meaning a first
set of primers specific for HIV-1 nucleic acids (but not HIV-2 nucleic acids)
and a second set of
primers specific for HIV-2 nucleic acids (but not HIV-1 nucleic acids), are
used for synthesizing
amplicons in a single amplification reaction. The synthesized amplicons are
subsequently
20 detected using a cross-reactive probe which is able to detect both HIV-I
amplicons and HIV-2
amplicons. Positive hybridization results obtained using this method indicate
that the test
sample which provided nucleic acid templates for amplification contains either
HIV-1 or HIV-2,
without distinguishing between the two analytes.
In the second invented method, a set of cross-reactive primers is used for
synthesizing
25 HIV-1 amplicons and/or HIV-2 amplicons in a single amplification
reaction. The synthesized
amplicons are subsequently detected using distinct, analyte-specific probes.
One of the probes is
specific for HIV-1 amplicons (but not HIV-2 amplicons) while another of the
probes is specific
for HIV-2 amplicons (but not HIV-1 amplicons). The step for detecting
amplicons synthesized
using the cross-reactive primers can involve either combining the analyte-
specific probes in a
30 single hybridization reaction, or separately hybridizing each of the
analyte-specific probes with
aliquots containing the products of the amplification reaction. If the probes
are combined in a
single hybridization reaction, then a positive result indicates that a test
sample contains either
37
CA 02547750 2006-05-31
WO 2005/061738
PCT/US2004/042899
HIV-1 or HIV-2, without distinguishing between the two analytes.
Alternatively, if the probes
are separately hybridized with independent aliquots of the amplification
reaction, then a positive
result in one of the hybridization reactions will indicate that the analyte
complementary to the
probe contained in the reaction was present in the test sample that provided
nucleic acid
templates for amplification.
In the third invented method, a set of cross-reactive primers is used for
synthesizing HIV-
1 amplicons and/or HIV-2 amplicons in a single amplification reaction. The
synthesized
amplicons are subsequently detected using a cross-reactive probe which is able
to detect both
HIV-1 amplicons and HIV-2 amplicons. Positive hybridization results obtained
using this
0 method indicate that the test sample which provided nucleic acid
templates for amplification
contains either HIV-1 or HIV-2, without distinguishing between the two
analytes.
The invented cross-reactive primers are particularly useful in multiplex
reactions for
amplifying HIV-1 and/or HIV-2. Conventional multiplex reactions typically
involve the use of a
few, or even several independent primer sets, with each set of primers being
capable of
[5 amplifying a different analyte nucleic acid that may be present in a
sample undergoing testing.
When the number of primers reaches a threshold value, there is the possibility
for undesirable
primer-primer interactions to occur. When this is the case, the primers can be
consumed in the
production of undesirable extension products, thereby inhibiting the efficient
synthesis of
analyte-specific amplicons. A solution to this problem is to use cross-
reactive primers that allow
20 amplification of multiple analytes, thereby reducing the number of
primer species that must be
included in the reaction.
Another benefit of the invented cross-reactive primers and probes also relates
to
multiplex amplification reactions. More particularly, the preferred use of at
least one cross-
reactive primer, and more preferably at least one set of two cross-reactive
primers, in a multiplex
25 amplification reaction affords redundancy in the detection of at least
one of the subject analytes.
This redundant detection is highly advantageous when one of the analytes is
prone to mutation or
exists in alternative forms that could be missed by the use of a single set of
amplification
primers. For example, if a multiplex amplification reaction is a capable of
detecting HIV-1 and
HIV-2, it is desirable, in accordance with the present invention, to carry out
amplification
30 reactions using at least one set of primers that are capable of
amplifying both HIV-1 and HIV-2.
When this is the case, the cross-reactive primers will provide a redundant
means for amplifying
the HIV-1 analyte polynucleotide. Similarly, a cross-reacting probe capable of
hybridizing HIV-
38
CA 02547750 2006-05-31
WO 2005/061738
PCT/US2004/042899
1 amplicons and HIV-2 amplicons provides a redundant means for detecting HIV-1
analyte
polynucleotides in a hybridization reaction that contains a probe specific for
HIV-1 and not HIV-
2.
Notably, the desired level of cross-reactivity among the primers of multiplex
assays
capable of amplifying portions of more than two analyte polynucleotides is
limited. For
example, when a multiplex reaction is capable of amplifying portions of three
different analyte
polynucleotides, a set of cross-reacting primers in accordance with the
invention should be
capable of amplifying portions of only two of the three analytes. When a
multiplex reaction is
capable of amplifying portions of four different analyte polynucleotides, a
set of cross-reacting
L 0 primers in accordance with the invention should be capable of
amplifying portions of either only
two of the four analytes or only three of the four analytes. Generally
speaking, a set of cross-
reacting primers in accordance with the invention should be capable of
amplifying portions of
fewer than the total number of analyte polynucleotides that can be amplified
in the multiplex
reaction. This clearly is distinct from a situation in which all
polynucleotide analytes of a
multiplex reaction are amplified, as may be the case when one of the primers
in a reaction is an
oligo dT primer.
Kits for Detecting HIV-1, HIV-2, or the Combination of HIV-1 and HIV-2 Nucleic
Acids
The present invention also embraces kits for performing polynucleotide
amplification
reactions using viral nucleic acid templates. Certain preferred kits include a
hybridization assay
probe that has a target-complementary sequence of bases, and optionally
include primers or other
ancilary oligonucleotides for amplifying the target that is to be detected by
the hybridization
assay probe. Other preferred kits contain a pair of oligonucleotide primers
that may be used for
amplifying target nucleic acids in an in vitro amplification reaction.
Exemplary kits include first
and second amplification oligonucleotides or primers that are complementary to
opposite strands
of a target nucleic acid sequence that is to be amplified. The kits may
further contain one or
more probes for detecting the amplification products synthesized by the action
of the primers
which are contained in the kit. Still other kits in accordance with the
invention may additionally
include capture oligonucleotides for purifying template nucleic acids away
from other species
prior to amplification.
The general principles of the present invention may be more fully appreciated
by
reference to the following non-limiting Examples.
Example 1 describes procedures that identified some of the hybridization
probes which
39
CA 02547750 2012-03-14
subsequently were used in assays for detecting HIV-1, HIV-2, or the
combination of HIV-1 and
HIV-2 nucleic acids. More particularly, the following procedures employed
synthetic
oligonucleotides as targets for hybridization probes. As indicated below, one
of the probes tested
in the procedure exhibited substantially equivalent specificity for HIV-1 and
HIV-2 targets.
Example 1
Oligonucleotide Probes for Detecting HIV-1 and/or HIV-2
Synthetic target oligonucleotides were prepared according to standard
laboratory
procedures using 2'-0Me nucleotide analogs to mimic RNA structures. The model
HIV-1 target
had the sequence of TCCCCCCTTTTCTTTTAAAATTGTGGATGA (SEQ ID NO:37), while the
model HIV-2 target had the sequence of TTCCTCCCCTTCTTTTAAAATTCATGCAAT (SEQ
ID NO: 38). Probes for hybridizing these synthetic targets had the sequences
given in Table 3, and
were also prepared using 2'-0Me nucleotide analogs.
Hybridization reactions included about 2 x 106 RLUs of AE-labeled probe having
a
specific activity of about 1-7 x 108 RLU/pmole, and about 0.5 pmoles of
synthetic target
oligonucleotide. Negative control reactions omitted the target
oligonucleotide. The probes listed
in Table 3 were each labeled with an AE moiety joined to the oligonucleotide
structure by an
internally disposed non-nucleotide linker according to procedures described in
U.S. Patent Nos.
5,585,481 and 5,639,604. The linkers on the probes of SEQ ID NO:23, SEQ ID
NO:30, SEQ ID
NO:27, SEQ ID NO:28 and SEQ ID NO:29 were located between positions 7 and 8.
The linkers
on the probes of SEQ ID NO:24 and SEQ ID NO:25 were located between positions
13 and 14.
The linker on the probe of SEQ ID NO:26 was located between positions 12 and
13. The linkers
on the probes of SEQ ID NO:31 and SEQ ID NO:32 were located between positions
17 and 18.
The linker on the probe of SEQ ID NO:33 was located between positions 26 and
27. The linker on
the probe of SEQ ID NO:34 was located between positions 9 and 10. The linker
on the probe of
SEQ ID NO:35 was located between positions 8 and 9. The linker on the probe of
SEQ ID NO:36
was located between positions 11 and 12. Use of all of these different linker
positions confirmed
the versatility of this labeling technique. Probe hybridizations were carried
out at 60 C for 15
minutes in 50 tl volumes of a Tris-buffered solution that included the
reagents used in the
amplification reaction described in Example 2. Hybridization reactions were
followed by addition
of an aliquot of 0.15 M sodium tetraborate (pH 8.5), and 1% TRITON X-100
(Union
CA 02547750 2006-05-31
WO 2005/061738
PCT/US2004/042899
Carbide Corporation; Danbury, CT). These mixtures were first incubated at 60 C
for 10 minutes
to inactivate the chemiluminescent label joined to unhybridized probe, and
cooled briefly to 4 C
prior to reading the hybridization signal. Chemiluminescence due to hybridized
probe in each
sample was assayed using a LUMISTAR GALAXY luminescence microplate reader (BMG
Labtechnologies Inc.; Durham, NC) configured for automatic injection of 1 mM
nitric acid and
0.1% (v/v) hydrogen peroxide, followed by injection of a solution containing 1
N sodium
hydroxide. Results for the chemiluminescent reactions were measured in
relative light units
(RLU). Representative results from this procedure are summarized in Table 4
for each of the
three different target regions. In this procedure, the signal/noise value
corresponded to the
0 chemiluminescent signal (measured in RLU) generated by label associated
with specifically
hybridized probe divided by a background signal measured in the absence of a
target nucleic
acid. Each value represents the average of 5 replicates.
41
CA 02547750 2006-05-31
WO 2005/061738
PCT/US2004/042899
Table 4
Probe Hybridization Results
HIV-1 Target HIV-2
Target
RLU Signal/Noise RLU Signal/Noise
remaining remaining
as % of To as % of To
value value
SEQ ID NO:23 2 1 101 58
SEQ ID NO:24 7 1 61
8
SEQ ID NO:25 110 12 107
11
SEQ ID NO:26 6 1 72
13
SEQ ID NO:27 7 1 70
11
SEQ ID NO:28 1 1 49 35
SEQ ID NO:29 3 1 57
18
SEQ ID NO:30 4 1 30
10
SEQ ID NO:31 80 7 42
4
SEQ ID NO:32 60 10 14
2
SEQ ID NO:33 50 34 2 1
SEQ ID NO:34 21 3 50
8
SEQ ID NO:35 2 1 54
31
SEQ ID NO:36 13 1 61
5
The results presented in Table 4 showed that some of the probes tested in the
procedure
gave a strong hybridization signal following interaction with the one or both
of the target
sequences. Only some of the probes used in the procedure gave S/N values
substantially greater
than 10 when hybridized with at least one of the synthetic targets.
Interestingly, very subtle differences distinguished useful probe sequences
from each
other. For example, when compared with the probe having the sequence of SEQ ID
NO:24, the
probe of SEQ ID NO:26 differed by only two out of twenty-four nucleotide
positions and
retained a strong specificity for the HIV-2 target. On the other hand, a probe
having the
sequence of SEQ ID NO:25 differed from the probe of SEQ ID NO:24 by only one
of these two
different nucleotide positions and did not exhibit specificity for the HIV-2
target. Indeed, the
42
CA 02547750 2006-05-31
WO 2005/061738
PCT/US2004/042899
probe of SEQ ID NO:25 failed to exhibit substantial specificity for either of
the two targets and
was found to be capable of hybridizing with substantially equal specificity to
the HIV-1 and
HIV-2 targets. In all three cases, the probes included a single inosine base
analog and so did not
correspond to any naturally occurring HIV-1 or HIV-2 nucleic acid sequence.
The unusual hybridization properties of the probe having the sequence of SEQ
ID NO:25
rendered it highly useful for detecting either HIV-1 or HIV-2. A positive
result indicating
hybridization of this probe to the products of a multiplex reaction that is
capable of amplifying
either HIV-1 or HIV-2 indicates that the test sample which provided the
nucleic acid templates
for amplification contained at least one of the two analytes. Use of the cross-
reactive probe of
0 SEQ ID NO:25 as a component in a hybridization probe reagent containing
a separate probe
specific for HIV-1 (but not HIV-2) advantageously provides a means for
redundantly detecting
the HIV-1 analyte while simultaneously providing a means for detecting an HIV-
2 analyte.
Although somewhat less preferred because of reduced signal recovery (see Table
4), a probe
having the sequence of SEQ ID NO:31 can be used in place of the probe of SEQ
ID NO:25 in
5 applications where it is desirable to employ a probe that is able to
hybridize with HIV-1 and
HIV-2 nucleic acids.
Highly preferred embodiments of the invention employ the cross-reactive probe
of SEQ
ID NO:25 for detection of either HIV-1 or HIV-2 nucleic acids. For example,
kits can include in
packaged combination: the probe of SEQ ID NO:25 and a set of oligonucleotide
primers that are
ZO specific for HIV-1 (but not HIV-2) and a set of oligonucleotide primers
that are specific for HIV-
2 (but not HIV-1). An alternative kit can include in packaged combination: the
probe of SEQ ID
NO:25 and a set of oligonucleotide primers that are cross-reactive with HIV-1
and HIV-2,
meaning that they are capable of amplifying both HIV-1 and HIV-2 nucleic
acids.
Probes that were useful for detecting HIV-2 nucleic acids, but not HIV-1
nucleic acids,
25 included: SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:27, SEQ ID
NO:28,
SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:35, and SEQ ID NO:36.
Preferred primer combinations for amplifying HIV-1, HIV-2, or the combination
of HIV-
1 and HIV-2 nucleic acids were identified in a series of procedures that
employed virions as the
source of nucleic acid templates. Promoter-primers and opposite strand primers
were screened
30 in combination using the method described below. Although these
procedures were particularly
carried out using a Transcription Mediated Amplification (TMA) protocol, the
primers disclosed
herein may be used to produce amplicons by alternative in vitro nucleic acid
amplification
43
CA 02547750 2012-03-14
methods that will be familiar to those having an ordinary level of skill in
the art.
Example 2 describes methods that identified primers useful for amplifying the
p31
integrase region of HIV-1 and/or HIV-2.
Example 2
Identification of Amplification Primers
A high-titer cell lysate containing HIV-2 B6 virus particles served as the
source of HIV-2
template sequences in amplification reactions that employed paired sets of
primers. Virus-negative
serum was used to prepare diluted stocks containing either 100 copies/ml of
the HIV-1 nucleic acid
template, or 300 copies/ml of the HIV-2 nucleic acid template. In a single
instance, a stock containing
100 copies/ml of the HIV-2 nucleic acid template was prepared. Nucleic acids
underwent specimen
processing and target capture prior to amplification essentially according to
the procedures disclosed in
published International Patent Application No. PCT/US2000/18685, except that
templates were
captured using oligonucleotides described in the published international
patent application identified by
WO 03/106714 for the capture of HIV-1 nucleic acids. Notably, capture
oligonucleotides do not
participate in the amplification or detection steps of the assay. Virus-
containing samples having
volumes of 0.5 ml were combined with a target-capture reagent to facilitate
nucleic acid release and
hybridization to capture oligonucleotides disposed on magnetic beads. TMA
reactions were carried out
essentially as described by Kacian et al., in U.S. Patent No. 5,399,491.
Promoter-primers included a T7
promoter sequence AATTTAATACGACTCACTATAGGGAGA (SEQ ID NO:39) upstream of a
target-complementary sequence. Amplification reactions were conducted for
various primer
combinations using 15 pmoles of each primer in 100 ul of reaction buffer.
Isolated target nucleic acids
were combined with primers in a standard nucleic acid amplification buffer,
heated to 60 C for 10
minutes and then cooled to 42 C to facilitate primer annealing. Moloney Murine
Leukemia Virus
(MMLV) reverse transcriptase (5,600 units/reaction) and T7 RNA polymerase
(3,500 units/reaction)
were then added to the mixtures. Amplification reactions were carried out in a
Tris-buffered solution
(pH 8.2 to 8.5) containing KC1, deoxyribonucleoside 5'-triphosphates,
ribonucleoside 5'-triphosphates,
N-Acetyl-L-Cysteine, and 5% (w/v) glycerol, as will be familiar to those
having an ordinary level of
skill in the art. After a one hour incubation at 42 C, the entire 100 ul
amplification reaction was
subjected to a hybridization assay essentially as described in Example 1 using
an independent HIV-1
specific probe which did not cross-
44
CA 02547750 2006-05-31
WO 2005/061738
PCT/US2004/042899
hybridize with HIV-2, and the HIV-2 specific probe of SEQ ID NO:23 which did
not cross-
hybridize with HIV-1. The probes were labeled with acridinium ester to
specific activities of
about 1-7 x 108RLU/pmol and then used in amounts equivalent to about 2 x 106
RLU for each
hybridization reaction. Specifically hybridized probe was quantified following
chemical
inactivation of the chemiluminescent label associated with non-hybridized
probe in a
homogeneous assay essentially as described in Example 1. Trials were conducted
using
replicates of 10. To be judged as a positive result, the chemiluminescent
signal indicating probe
hybridization must have exceeded 50,000 RLU in an assay.
Table 5 presents results from amplification procedures that were conducted
using
L 0 different combinations of amplification primers. Numerical values
appearing in the table
represent the percentage of positive trials.
=
CA 02547750 2006-05-31
WO 2005/061738
PCT/US2004/042899
Table 5
Amplification of HIV-1 and HIV-2 Polynucleotide Sequences Using
Various Primer Combinations
non-T7 primer Target (dm')
T7 Primer Target-Complementary Sequence
_
6 a " b a a
a
Z Z z z Z
Z
n r21 Q ci in
C21
0' 0' 0' CY 0'
0'
41 W cn W u.)
W
Cl) Cl) Cl) Cl)
Cl)
SEQ ID NO:1 HIV1 (100) 0% 0% 100% ND ND
100%
HIV2 (100) 100% 100% 0% ND ND
0%
SEQ ID NO:2 HIV1 (100) 0% 0% 100% 100% 100% 100%
HIV2 (100) 100% 100% 100% 100% 100%
ND
HIV2 (300) ND ND ND ND
ND 100%
SEQ ID NO:3 HIV1 (100) 0% ND ND ND ND ND
HIV2 (100) 100% 100% 100% ND ND
ND
SEQ ID NO:4 HIV1 (100) ND ND ND 100%
ND ND
HIV2 (300) ND ND ND 0% ND
ND
SEQ ID NO:5 HIV1 (100) ND ND ND 100%
ND ND
HIV2 (300) ND ND ND 0% ND
ND
SEQ ID NO:6 HIV1 (100) ND ND ND 100%
ND ND
HIV2 (300) ND ND ND 0% ND
ND
SEQ ID NO:7 HIV1 (100) ND ND ND 100%
ND ND
HIV2 (300) ND ND ND
100% ND ND
SEQ ID NO:8 HIV1 (100) ND ND ND 100%
ND ND
HIV2 (300) ND ND ND
57% ND ND
SEQ ID NO:9 HIV1 (100) ND ND ND 80% ND
ND
HIV2 (300) ND ND ND 50% ND ND
"ND" indicates "not done" (primer pair not tested)
The results presented in Table 5 showed that some of the primer combinations
gave very
46
CA 02547750 2006-05-31
WO 2005/061738
PCT/US2004/042899
high levels of HIV-1 and HIV-2 detectability, even at levels as low as 50
copies of the viral
template per reaction. More specifically, excellent results were obtained
using a primer having
the target-complementary sequence of SEQ ID NO:2 in combination with a primer
having the
target-complementary sequence of any of SEQ ID NO:13, SEQ ID NO:14, SEQ ID
NO:15, or
SEQ ID NO:16. Excellent results also were achieved using a primer having the
target-
complementary sequence of SEQ ID NO:14 in combination with a primer having the
target-
complementary sequence of any of SEQ ID NO:7, SEQ ID NO:8, or SEQ ID NO:9. The
target-
complementary portions of these latter three primers all confatmed to the
consensus sequence
TAGAGACAGNAGTACNAATGGC (SEQ ID NO:40), where position 10 is occupied by C, T
0 or I, and where position 16 is occupied by T or I. Primers conforming to
this consensus are
preferred for amplifying HIV-1 or HIV-2 target nucleic acids. A combination of
primers having
the target-complementary sequences of SEQ ID NO:14 and SEQ ID NO:7
advantageously is
capable of amplifying the largest number of genetic variants of HIV-1 and HIV-
2. Notably, no
false-positive reactions were observed in these procedures.
l5 Although the foregoing Example describes assays conducted using
independent probes
that Were specific for HIV-1 (but not for HIV-2) and HIV-2 (but not for HIV-
1), the invention
also embraces compositions, kits and methods employing probes that are cross-
reactive for HIV-
1 and HIV-2. Particular examples of cross-reactive probes that can be used in
conjunction with
any of the above-described primer combinations have the sequences of SEQ ID
NO:25 and SEQ
20 ID NO:31.
The ability of a selected set of oligonucleotides to amplify and detect a
variety of
different HIV-2 isolates was next demonstrated.
Example 3 describes procedures that demonstrated the invented primers and
probe were
useful for detecting a broad range of HIV-2 isolates.
25 Example 3
Broad Range of Detectability for HIV-2
Primers having the target-complementary sequences of SEQ ID NO:7 and SEQ ID
NO:14 were used in combination for amplifying HIV-2 template nucleic acids
from seven
different HIV-2 strains that were available as high-titer lysates. These
specimens were diluted in
30 virus-negative serum to produce stocks having viral template
concentrations of 300 copies/ml.
As in the previous Example, virus-containing samples having volumes of 0.5 ml
were combined
with a target-capture reagent to facilitate nucleic acid release and
hybridization to capture
47
CA 02547750 2006-05-31
WO 2005/061738
PCT/US2004/042899
oligonucleotides that were disposed on magnetic beads. Amplification reactions
were carried out
as described in the preceeding Example. Amplicons were detected essentially as
described in
Example 1, except that an AE-labeled, HIV-2 specific probe having the sequence
of SEQ ID
NO:23 was used, and the detection step was carried out using a LEADER HC+
luminometer
(Gen-Probe Incorporated, CA). Assays yielding specific hybridization signals
of at least 50,000
RLUs were judged as being positive. All assays were carried out in replicates
often. Results
from these procedures are presented in Table 6.
Table 6
Amplification and Detection of Different HIV-2 Isolates
[0 HIV-2 Strain % Positive (N=10)
HIV-2B2 100
HIV-2B3 100
HIV-2B4 100
HIV-2B5 100
HIV-2B7 100
HIV-2B8 100
HIV-2B9 100
The results presented in Table 6 showed that the cross-reactive primers having
the target-
complementary sequences of SEQ ID NO:7 and SEQ ID NO:14 were capable of
amplifying
nucleic acids from a variety of different strains of HIV-2, and similarly that
an HIV-2 specific
probe having the sequence of SEQ ID NO:23 was capable of detecting nucleic
acids from a
variety of different HIV-2 strains. These primers and this probe represent
preferred
embodiments of the invention.
Although the foregoing Example illustrated an assay based on the combined use
of cross-
reactive primers and an analyte-specific probe, the present invetion also
embraces embodiments
wherein cross-reactive primers are used in combination, or packaged in a kit,
with a probe that
also is cross-reactive, meaning that the probe is capable of independently
hybridizing to HIV-1
and HIV-2 nucleic acids or amplicons. Particular examples of cross-reactive
primers and cross-
reactive probes are disclosed herein. For instance, the illustrative HIV-2
specific probe used in
this Example could have been substituted by one of the cross-reactive probes
identified by SEQ
ID NO:25 or SEQ ID NO:31.
48
CA 02547750 2012-03-14
The following Example demonstrates that two different primer combinations were
capable of amplifying an HIV-2 template nucleic acid at an amount equal to 150
copies/reaction. Significantly, these amplification and detection procedures
were performed
in a reaction mixture that was capable of multiplex amplification of HIV-1,
HIV-2, HBV and
HCV. These results showed that the presence of primers specific for extraneous
targets did
not adversely impact detection of HIV-2.
Example 4 describes procedures that demonstrated how the invented primers
could be
combined in a multiplex nucleic acid amplification reaction capable of
detecting HIV-1, HIV-
2, HBV and HCV.
Example 4
Amplification of HIV-2 Nucleic Acids in a Multiplex Assay
Primers having the sequences of SEQ ID NO:20 (target-complementary sequence of
SEQ ID NO:14) and either SEQ ID NO:2 or SEQ ID NO:7 were added to a reaction
formulation that included primers capable of amplifying analytes that included
HIV-1, HBV
and HCV. Multiplex assay formulations for performing target capture,
amplification and
probe-based detection of these targets are disclosed in the published
international patent
application identified by WO 03/106714. As in Example 2, samples containing
HIV-1 virions
or HIV-2 virions were prepared by diluting high-titer stocks with virus-
negative serum.
Target capture and nucleic acid amplification reactions were performed using
0.5 ml of
diluted virus sample, as described herein. Detection of HIV-2 amplicons by the
procedures
described above was carried out using the HIV-2 specific probe of SEQ ID
NO:23, together
with probes specific for detecting HIV-1, HBV and HCV amplicons. Assays
yielding specific
hybridization signals of at least 50,000 RLUs were judged as being positive.
Results from
these procedures appear in Table 7.
49
CA 02547750 2006-05-31
WO 2005/061738
PCT/US2004/042899
Table 7
Detection of HIV-2 in a Multiplex Assay
Target-Complementary Primer Target %
Positive
Sequences
SEQ ID NO:2 HIV-1 Type B (100 c/ml) 100% (N=10)
SEQ ID NO:14 HIV-2 B8 (300 c/ml)
100% (N=10)
SEQ ID NO:7 HIV-1 Type B (100 c/ml)
100% (N=40)
0 SEQ ID NO:14 HIV-2 B7 (300 c/ml)
100% (N=40)
The results presented in Table 7 confirmed that different combinations of the
invented
primers were capable of efficiently detecting HIV-2 target nucleic acids in
multiplex reactions
that were also capable of amplifying and detecting HIV-1, HBV and HCV.
5 In addition to the above-described assay which detects HIV-1 and HIV-
2 sequences in the
regions encoding the p31 integrase, a second target region, located within the
gene encoding the
p51 reverse transciiptase (RT), was also found to be useful for detecting HIV-
1 and HIV-2
nucleic acids. Methods used to make this second demonstration were essentially
as described
above. Oligonucleotide probes used in the procedures for identifying cross-
reactive probes in the
?.0 p51 RT target region had the sequences presented in the Table 8.
Table 8
Sequences of Detection Probes
Sequence Identifier
AGGCAGUAUACUGCAUUUACCIUACC SEQ ID NO:41
25 GTATACTGCATTTACCCTACC SEQ ID NO:42
AGGAAGUAUACUGCAUUUACCIUACC SEQ ID NO:43
AGGAAGUAUACUGCAUUUACCAUACC SEQ ID NO:44
Example 5 describes procedures used to identify candidate cross-reactive
probes that
30 hybridized to the p51 RT regions of HIV-1 and HIV-2 nucleic acids.
Example 5
Oligonucleotide Probes for Detecting HIV-1 and/or HIV-2
Synthetic target oligonucleotides were prepared according to standard
laboratory
CA 02547750 2012-03-14
procedures. The model HIV-1 target had the sequence of
CUAGGUAUGGUAAAUGCAGUAUACUUC (SEQ ID NO:45), while the model HIV-2 target
had the sequence of GAUGGUAGGGUAAAUGCAGUAUACU (SEQ ID NO:46). The HIV-1
and HIV-2 targets were both synthesized using RNA precursors. Probes for
hybridizing these
synthetic targets had the sequences given in Table 8, and were prepared using
2'-0Me nucleotide
analogs.
Hybridization reactions included about 2 x 106 RLUs of AE-labeled probe having
a
specific activity of about 1-7 x 108 RLU/pmole, and about 0.5 pmoles of
synthetic target
oligonucleotide. Negative control reactions omitted the target
oligonucleotide. The probes listed
in Table 8 were each labeled with an AE moiety joined to the oligonucleotide
structure by an
internally disposed non-nucleotide linker according to procedures described in
U.S. Patent Nos.
5,585,481 and 5,639,604. The linker on the probe of SEQ ID NO:42 alternatively
was located
between nucleotides 7 and 8, between nucleotides 11 and 12, or between
nucleotides 12 and 13.
The linkers on the probes of SEQ ID NO:41, SEQ ID NO:43, and SEQ ID NO:44 were
all located
between nucleotides 12 and 13. Use of these different linker positions
confirmed the versatility of
this labeling technique. Probe hybridizations were carried out at 60 C for 15
minutes in 50 i_t1
volumes of a Tris-buffered solution that included the reagents used in the
amplification reaction
described in Example 2. Hybridization reactions were followed by addition of
an aliquot of 0.15
M sodium tetraborate (pH 8.5), and 1% TRITON X-100 (Union Carbide Corporation;
Danbury,
CT). These mixtures were first incubated at 60 C for 10 minutes to inactivate
the
chemiluminescent label joined to unhybridized probe, and cooled briefly to 4 C
prior to reading
the hybridization signal. Chemiluminescence due to hybridized probe in each
sample was assayed
using a LUMISTAR GALAXY luminescence microplate reader (BMG Labtechnologies
Inc.;
Durham, NC) configured for automatic injection of 1 mM nitric acid and 0.1%
(v/v) hydrogen
peroxide, followed by injection of a solution containing 1 N sodium hydroxide.
Results for the
chemiluminescent reactions were measured in relative light units (RLU).
Representative results
from this procedure are summarized in Table 9 for each of the three different
probe sequences. In
this procedure, the signal/noise value corresponded to the chemiluminescent
signal (measured in
RLU) generated by label associated with specifically hybridized probe divided
by a background
signal measured in the absence of a target nucleic acid. Each value represents
the average of 5
replicates.
51
CA 02547750 2006-05-31
WO 2005/061738
PCT/US2004/042899
Table 9
Probe Hybridization Results
HIV-1 Target HIV-2 Target
p51 RT Region Probe (SEQ ID NO:45) (SEQ ID NO:46)
RLU Signal/Noise RLU
Signal/Noise
remaining as remaining as
% of TO value % of To value
SEQ ID NO:41 66.7 5.1 66.1 5.0
SEQ ID NO:42 111.4 296.2 101.5
269.8
SEQ ID NO:43 103.7 159.9 97.7
150.7
SEQ ID NO:44 112.8 162.8 114.1
164.6
0
The results presented in Table 9 showed that most of the probes tested in
the procedure
gave strong hybridization signals and signal/noise ratios following
interaction with each of the
different target sequences. Notably, the result presented for the probe of SEQ
ID NO:42 was
obtained using the probe having its label positioned between nucleotides 12
and 13. However,
excellent results were also achieved using the same probe sequence with
alternatively positioned
[5 labels. More specifically, the signal/noise values for the collection of
three probes of SEQ ID
NO:42 ranged from about 218 up to about 296 for the HIV-1 target, and from
about 220 to about
282 for the HIV-2 target. In addition to probes having the sequence of SEQ ID
NO:42, the
probes of SEQ ID NO:43 and SEQ ID NO:44 are also highly preferred for the
detection of either
or both of the HIV-1 and HIV-2 target nucleic acids. Of course, the
complements of these
20 sequences also are preferred alternatives.
Interestingly, the probes which performed well in the above-described assay
all included
target-complementary sequences of 21-26 contiguous bases contained within a
consensus
sequence given by AGGAAGTATACTGCATTTACCNTACC (SEQ ID NO:62), allowing for
RNA and DNA equivalent bases, where "N" is any of A, C or I. The 26-mer probe
of SEQ ID
25 NO:41 did not perform well in the hybridization assay (see Table 9), and
does not conform with
the consensus. Notably, this poor-performing probe differed from the cross-
reactive probe of
SEQ ID NO:43, which performed well in the assay, by only a single base change.
This illustrates
the unusual and unexpected nature of the advantageously cross-reactive probes
described above.
Highly preferred embodiments of the invention employ one or more of the cross-
reactive
30 probes of SEQ ID NO:42, SEQ ID NO:43 or SEQ ID NO:44 for detection of
either HIV-1 or
52
CA 02547750 2006-05-31
WO 2005/061738
PCT/US2004/042899
HIV-2 nucleic acids. However, kits in accordance with the invention can
include in packaged
combination: any probe having the sequence of SEQ ID NO:42, SEQ ID NO:43 or
SEQ ID
NO:44 and a set of oligonucleotide primers that are specific for HIV-1 (but
not HIV-2) and/or a
set of oligonucleotide primers that are specific for HIV-2 (but not HIV-1). An
alternative kit can
include in packaged combination: any probe having the sequence of SEQ ID
NO:42, SEQ ID
NO:43 or SEQ ID NO:44 and a set of oligonucleotide primers that are cross-
reactive with HIV-1
and HIV-2, meaning primers that are capable of amplifying both HIV-1 and HIV-2
nucleic acids.
The cross-reactive probe reagents are particularly preferred for use in
methods wherein HIV-1 or
HIV-2 amplicons synthesized using the cross-reactive amplification primers
described in the
0 following Example are detected.
Notably, in certain embodiments it will be desirable to employ probes having
sequences
appended to the 5' or 3' ends of the target-complementary probe sequences,
which sequences are
not complementary to, meaning that they do not hybridize to, the HIV-1 or HIV-
2 amplicons. In
these instances it is preferred for the overall length of the probe molecule
to be up to 60, More
preferrably up to 26, bases in length. Examples of appended sequences which
are not
complementary to the HIV-1 or HIV-2 amplicons include the "arm" sequences
which comprise
the "stem" portions of molecular beacons.
Preferred primer combinations for amplifying HIV-1 or HIV-2, or the
combination of
HIV-1 and HIV-2 nucleic acids were identified in a series of procedures that
employed virions as
2.0 the source of nucleic acid templates. Promoter-primers and opposite
strand primers were
screened in combination using the method described below. Although these
procedures were
particularly carried out using a Transcription Mediated Amplification (TMA)
protocol, the
primers disclosed herein may be used to produce amplicons by alternative in
vitro nucleic acid
amplification methods that will be familiar to those having an ordinary level
of skill in the art.
Tables 10 and 11 present the sequences of amplification primers that were used
in the procedures
described under Example 6. Notably, the primers of SEQ ID NOs:51 - 54
correspond to the
primers of SEQ ID NOs:55 - 58, respectively, but further include upstream
promoter sequences
that are not complementary to the HIV-1 and HIV-2 targets.
53
CA 02547750 2006-05-31
WO 2005/061738
PCT/US2004/042899
Table 10
Sequences of Amplification Primers
Sequence Identifier
CTTAGATAAAGAITTCAGGAAGTATA SEQ ID NO:47
CTTAGATAAAGATTTTAGGAAGTATA SEQ ID NO:48
CTTAGATAAAGATTTTAGGCAGTATA SEQ ID NO:49
CTTAGATAAAGATTTTAGGIAGTATA SEQ ID NO:50
Table 11
Sequences of Amplification Primers
Feature Sequence
Identifier
Target-complementary TTGCTGGTGATCCCTTCCATCCTTGTGG SEQ ID NO:51
Target-complementary TTGCTGGTGATCCCTTCCATCCCTGTGG SEQ ID NO:52
Target-complementary TTGCTGGTGATCCTTTCCATCC
SEQ ID NO:53
Target-complementary TTGCTGGTGATCCCTTCCATCC SEQ ID
NO:54
T7 Promoter-Primer
AATTTAATACGACTCACTATAGGGAGA SEQ ID NO:55
TTGCTGGTGATCCCTTCCATCCTTGTGG
T7 Promoter-Primer
AATTTAATACGACTCACTATAGGGAGA SEQ ID NO:56
TTGCTGGTGATCCCTTCCATCCCTGTGG
T7 Promoter-Primer
AATTTAATACGACTCACTATAGGGAGA SEQ ID NO:57
TTGCTGGTGATCCTTTCCATCC
T7 Promoter-Primer
AATTTAATACGACTCACTATAGGGAGA SEQ ID NO:58
TTGCTGGTGATCCCTTCCATCC
Example 6 describes methods that identified primers useful for amplifying the
p51 RT
region of HIV-1 and/or HIV-2.
Example 6
Identification of Amplification Primers
Tissue culture-derived HIV-2 B6 virus particles served as the source of HIV-2
template
sequences in amplification reactions that employed paired sets of primers.
Virus-negative serum
was used to prepare diluted stocks containing either 100 copies/ml of the HIV-
1 nucleic acid
54
CA 02547750 2012-03-14
template, or 300 copies/ml of the HIV-2 nucleic acid template. Nucleic acids
underwent specimen
processing and target capture prior to amplification essentially according to
the procedures
disclosed in published International Patent Application No. PCT/US2000/18685,
except that
templates were captured using oligonucleotides described in the published
international patent
application identified by WO 03/106,714 for the capture of HIV-1 nucleic
acids. Notably, capture
oligonucleotides do not participate in the amplification or detection steps of
the assay. Virus-
containing samples having volumes of 0.5 ml were combined with a target-
capture reagent to
facilitate nucleic acid release and hybridization to capture oligonucleotides
disposed on magnetic
beads. TMA reactions were carried out essentially as described by Kacian et
al., in U.S. Patent
No. 5,399,491. Promoter-primers included a T7 promoter sequence given by SEQ
ID NO :39
upstream of a target-complementary sequence. Amplification reactions were
conducted for
various primer combinations using 15 pmoles of each primer in 100 I of
reaction buffer. Isolated
target nucleic acids were combined with primers in a standard nucleic acid
amplification buffer,
heated to 60 C for 10 minutes and then cooled to 42 C to facilitate primer
annealing. Moloney
Murine Leukemia Virus (MMLV) reverse transcriptase (5,600 units/reaction) and
T7 RNA
polymerase (3,500 units/reaction) were then added to the mixtures.
Amplification reactions were
carried out in a Tris-buffered solution (pH 8.2 to 8.5) containing KC1,
deoxyribonucleoside 5'-
triphosphates, ribonucleoside 5'-triphosphates, N-Acetyl-L-Cysteine, and 5%
(w/v) glycerol, as
will be familiar to those having an ordinary level of skill in the art. After
a one hour incubation at
42 C, the entire 100 I amplification reaction was subjected to a
hybridization assay essentially as
described in Example 1 using a mixture of the above-described probe having the
sequence of SEQ
ID NO :42. For the purpose of this demonstration, a mixture of probes having
the sequence of
SEQ ID NO:42 with labels positioned between nucleotides 7 and 8, 11 and 12,
and 12 and 13 were
used in a ratio of 2:1:1, respectively. The probes were labeled with
acridinium ester to specific
activities of about 1-7 x 108 RLU/pmol and then used in amounts equivalent to
about 2 x 106 RLU
for each hybridization reaction. Specifically hybridized probe was quantified
following chemical
inactivation of the chemiluminescent label associated with non-hybridized
probe in a
homogeneous assay essentially as described in Example 1. Trials were conducted
using replicates
of 10. To be judged as a positive result, the chemiluminescent signal
indicating probe
hybridization must have exceeded 50,000 RLU in an assay.
CA 02547750 2006-05-31
WO 2005/061738
PCT/US2004/042899
Table 12 presents results from amplification procedures that were conducted
using
different combinations of amplification primers. Numerical values appearing in
the table
represent the percentage of positive trials.
Table 12
Amplification of HIV-1 and HIV-2 Polynucleotide Sequences Using
Various Primer Combinations
non-T7 primer
Target (dm') T7 Primer Target-Complementary Sequence
,7,'
a a a a
Z Z Z Z
Q
a a a a
w w W W
ci) ci) ci) cn
0 SEQ ID NO:47 HIV1 (100) 100% ND 100% ND
HIV2 (300) 100% ND 100% ND
SEQ ID NO:48 HIV1 (100) ND 100% ND 100%
HIV2 (300) ND 100% ND 100%
SEQ ID NO:49 HIV1 (100) 100% ND 100% ND
HIV2 (300) 100% ND 100% ND
SEQ ID NO:50 HIV1 (100) 100% ND 100% ND
HIV2 (300) 100% ND 100% ND
"ND" indicates "not done" (primer pair not tested)
[5 The results presented in Table 12 showed that all of the selected
primer combinations
were useful for detecting HIV-1 and HIV-2. The target-complementary portions
of useful
primers complementary to one strand of the target to be amplified included a
sequence ,
conforming to the consensus TTGCTGGTGATCCYTTCCATCC (SEQ ID NO:59), where
position 14 is occupied by C or T, and had a length of up to 28 bases. In a
preferred
20 embodiment, the primer conformed to the consensus sequence
TTGCTGGTGATCCYTTCCATCCYTGTGG (SEQ ID NO:60), where positions 14 and 23 are
independently occupied by C or T. The preferred primers can further include
optional 5'
sequences which are non-complementary to the HIV-1 or HIV-2 target to be
amplified. The
target-complementary portions of useful opposite strand primers conformed to
the consensus
25 sequence CTTAGATAAAGANTTYAGGNAGTATA (SEQ ID NO:61), where position 13 is
56
CA 02547750 2012-03-14
occupied by T or I, where position 16 is occupied by C or T, and where
position 20 is occupied by
A, C or I. Primers conforming to this consensus are also preferred for
amplifying HIV-1 or HIV-2
target nucleic acids, and can further include optional 5' sequences which are
non-complementary to
the HIV-1 or HIV-2 target to be amplified. Notably, no false-positive
reactions were observed in
the procedures described above.
Although the foregoing Example illustrated an assay based on the combined use
of cross-
reactive primers and cross-reactive probes, the present invention also
embraces embodiments
wherein cross-reactive primers are used in combination, or packaged in a kit,
with independent,
analyte-specific HIV-1 and HIV-2 probes.
The following Example demonstrates that the cross-reactive p51 RT region
primers
disclosed herein were capable of amplifying HIV-1 and HIV-2 templates even
when the
procedures were performed in a reaction mixture that was capable of multiplex
amplification of
HIV-1, HIV-2, HBV and HCV. These results showed that the presence of primers
specific for
extraneous targets did not adversely impact detection of HIV-2.
Example 7 describes procedures that demonstrated how the invented primers
could be
combined in a multiplex nucleic acid amplification reaction capable of
detecting HP/-1, HIV-2,
HBV and HCV.
Example 7
Amplification of HIV-2 Nucleic Acids in a Multiplex Assay
Primers having the sequences of SEQ ID NO:57 (target-complementary sequence of
SEQ ID
NO:53) and SEQ ID NO:49 were added to a reaction formulation that included
primers capable of
amplifying analytes that included either the combination of HBV and HCV, or
the combination of HIV-
1, HBV and HCV. Multiplex assay formulations for performing target capture,
amplification and
probe-based detection of these targets are disclosed in the published
international patent application
identified by WO 03/106714. As in Example 2, samples containing HIV-1 virions
or HIV-2 virions
were prepared by diluting high-titer stocks with virus-negative serum. Target
capture and nucleic acid
amplification reactions were performed using 0.5 ml of diluted virus sample,
as described herein.
Detection of HIV-2 amplicons was carried out using the probe reagent described
in the preceding
Example. Detection of HBV and HCV amplicons was carried out using labeled
hybridization probes
specific for those targets. Assays yielding specific hybridization signals of
at least 50,000 RLUs were
judged as being positive. Results from these
57
CA 02547750 2006-05-31
WO 2005/061738
PCT/US2004/042899
procedures appear in Table 13.
Table 13
Detection of HIV-2 in a Multiplex Assay
Target-Complementary Target % Positive
Primer Sequences
HIV-1 Type B (100 c/ml) 100%
SEQ ID NO:53
HIV-2 Type A (300 c/m1) 100%
SEQ ID NO:49 HCV (60 c/ml) 100%
HBV (15 IU/m1) 100%
The results presented in Table 13 confirmed that the invented primers were
capable of
efficiently amplifying HIV-1 and HIV-2 target nucleic acids in multiplex
reactions that were also
capable of amplifying and detecting other viral targets. Also as shown in the
table, low levels of
the HBV (15 IU/m1) and HCV subtype 2b (60 copies/m1) targets were efficiently
detected in the
multiplex reactions capable of amplifying HIV-1 and HIV-2. Significantly,
identical results were
obtained using reaction conditions that included or omitted HIV-1 specific
amplification primers.
Thus, the disclosed HIV-1/-2 cross-reactive primers efficiently detected both
HIV-1 and HIV-2,
and did not interfere with amplification and detection of the remaining viral
targets in the
multiplex reaction.
This invention has been described with reference to a number of specific
examples and
embodiments thereof. Of course, a number of different embodiments of the
present invention
will suggest themselves to those having ordinary skill in the art upon review
of the foregoing
detailed description. Thus, the true scope of the present invention is to be
determined upon
reference to the appended claims.
58
DEMANDES OU BREVETS VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVETS
COMPREND PLUS D'UN TOME.
CECI EST LE TOME 1 DE 2
NOTE: Pour les tomes additionels, veillez contacter le Bureau Canadien des
Brevets.
JUMBO APPLICATIONS / PATENTS
THIS SECTION OF THE APPLICATION / PATENT CONTAINS MORE
THAN ONE VOLUME.
THIS IS VOLUME 1 OF 2
NOTE: For additional volumes please contact the Canadian Patent Office.
