Note: Descriptions are shown in the official language in which they were submitted.
DEMANDES OU BREVETS VOLUMINEUX
LA PRESENTE PARTIE I)E CETTE DEMANDE OU CE BREVETS
COMPRI~:ND PLUS D'UN TOME.
CECI EST ~.E TOME 1 DE 2
NOTE: Pour les tomes additionels, veillez contacter 1e Bureau Canadien des
Brevets.
JUMBO APPLICATIONS / PATENTS
THIS SECTION OF THE APPLICATION / PATENT CONTAINS MORE
THAN ONE VOLUME.
THIS IS VOLUME 1 OF 2
NOTE: For additional vohxmes please contact the Canadian Patent Oi~ice.
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
AN ANTI-INFLAMMATORY, CYTOPROTECTIVE FACTOR
DERIVABLE FROM A PROBIOTIC ORGANISM
The government owns rights in the invention pursuant to grant numbers
DK47722, DK42086, T32 GM07019, and KO8 DK064840-O1 from the National
Institutes of Health.
FIELD OF THE INVENTION
The invention relates generally to the field of inflammatory disorders. More
particularly, it concerns inflammatory bowel diseases, such as ulcerative
colitis and
Crohn's disease.
BACKGROUND OF THE INVENTION
Inflammatory bowel disease (IBD) is a group of chronic disorders, such as
ulcerative colitis and Crohn's disease, that cause inflammation or ulceration
of the
digestive tract. The unfortunate combination of genetic background, exposure
to
environmental factors, or colonization by certain inciting commensal bacteria,
can
result in the development of IBD in susceptible individuals.
Ulcerative colitis causes inflammation and ulceration of the inner lining of
the
colon and rectum. It rarely affects the small intestine except for the end
that connects
to the colon, called the terminal ileum. Ulcerative colitis may also be called
colitis or
proctitis. Ulcerative colitis may occur in people of any age, but most often
it starts
between ages 15 and 30. Ulcerative colitis affects men and women equally and
appears to run in some families. Theories about what causes ulcerative colitis
abound, but none have been proven. A popular theory is that the body's irmnune
system reacts to a virus or a bacterium by causing ongoing inflammation in the
intestinal wall.
The most common symptoms of ulcerative colitis are abdominal pain and
bloody diarrhea. Patients also may experience fatigue, weight loss, loss of
appetite,
1
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
rectal bleeding, and loss of body fluids and nutrients. About half of patients
have
mild symptoms. Others suffer frequent fever, bloody diarrhea, nausea, and
severe
abdominal cramps. Ulcerative colitis may also cause problems such as
arthritis,
inflammation of the eye, liver disease (hepatitis, cirrhosis, and primary
sclerosing
cholangitis), osteoporosis, skin rashes, and anemia. No one knows for sure why
problems occur outside the colon. Scientists think these complications may
occur
when the immune system triggers inflammation in other parts of the body. Some
of
these problems go away when the colitis is treated.
The extent and severity of mucosal injury in inflammatory bowel diseases are
determined by the disequilibrium between two opposing processes, reparative
and
cytoprotective mechanisms versus inflammation-induced injury.
Treatment for ulcerative colitis depends on the seriousness of the disease.
Most people are treated with medication. In severe cases, a patient may need
surgery
to remove the diseased colon. Some people whose symptoms are triggered by
certain
foods are able to control the symptoms by avoiding foods that upset their
intestines,
like highly seasoned foods, raw fruits and vegetables, or milk sugar
(lactose). Some
people have remissions that last for months or even years. However, most
patients'
symptoms eventually return.
The goal of therapy is to induce and maintain remission, and to improve the
quality of life for people with ulcerative colitis. Several types of drugs are
currently
available.
Aminosalicylate drugs, such as those that contain 5-aminosalicylic acid (5-
ASA), help control inflammation. Sulfasalazine is a combination of
sulfapyridine and
5-ASA and is used to induce and maintain remission. The sulfapyridine
component
carnes the anti-inflammatory 5-ASA to the intestine. However, sulfapyridine
may
lead to side effects such as nausea, vomiting, heartburn, diarrhea, and
headache.
Other 5-ASA agents such as olsalazine, mesalamine, and balsalazide, have a
different
Garner, offer fewer side effects, and may be used by people who cannot take
sulfasalazine. 5-ASAs are given orally, through an enema, or in a suppository,
depending on the location of the inflammation in the colon. Most people with
mild or
moderate ulcerative colitis are treated with this group of drugs first.
Corticosteroids, such as prednisone and hydrocortisone, also reduce
inflammation. They may be used by people who have moderate to severe
ulcerative
2
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
colitis or who do not respond to 5-ASA drugs. Corticosteroids can be given
orally,
intravenously, through an enema, or in a suppository. These drugs can cause
side
effects such as weight gain, acne, facial hair, hypertension, mood swings, and
an
increased risk of infection. For this reason, they are not recommended for
long-term
use.
Tinmunomodulators, such as azathioprine and 6-mercapto-purine (6-MP),
reduce inflammation by affecting the immune system. They are used for patients
who
have not responded to 5-ASAs or corticosteroids or who are dependent on
corticosteroids. However, immunomodulators are slow-acting and it may take up
to 6
months before the full benefit is seen. Patients taking these drugs are
monitored for
complications including pancreatitis and hepatitis, a reduced white blood cell
count,
and an increased risk of infection. Cyclosporine A may be used with 6-MP or
azathioprine to treat active, severe ulcerative colitis in people who do not
respond to
intravenous corticosteroids.
. In addition to the above; other drugs may be given to relax the patient or
to
relieve pain, diarrhea, or infection.
About 25-40% of ulcerative colitis patients must eventually have their colons
removed because of massive bleeding, severe illness, rupture of the colon, or
risk of
cancer. Sometimes the doctor will recommend removing the colon if medical
treatment fails or if the side effects of corticosteroids or other drugs
threaten the
patient's health.
Crohn's disease differs from ulcerative colitis in that it may affect any part
of
the digestive tract. It causes inflammation and ulcers that may affect the
deepest
layers of lining of the digestive tract. Anti-inflammatory drugs, such as 5-
aminosalicylates (e.g., mesalamine) or corticosteroids, are typically
prescribed, but
are not always effective. Immunosuppression with cyclosporine is sometimes
beneficial for patients resistant to or intolerant of corticosteroids.
Nevertheless, surgical correction is eventually required in 90% of patients
with Crohn's disease; 50% undergo colonic resection. (Leiper et al., 1998;
Makowiec
et al., 1998). The recurrence rate after surgery is high, with 50% requiring
further
surgery within 5 years. (Leiper et al., 1998; Besnard et al., 1998).
3
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
Current concepts regarding the etiopathogenesis of IBD suggest that there is a
disequilibrium between the processes of cytoprotection and wound healing and
the
pro-inflammatory pathways, the net result of which culminates in a state of
proinflammatory overactivity and resultant damage to the intestinal mucosa
(Chang,
1999; Podolsky, 2002). Central to preserving mucosal integrity is maintenance
of
epithelial barrier function, as evidenced by the fact that altered tight
junction structure
resulting in impaired barrier function is thought to contribute to the
clinical sequelae
of ulcerative colitis (Schmitz et al., 1999).
Through the use of sense and antisense transfection experiments, it has been
shown that heat shock proteins play a central role in providing cytoprotection
to
epithelial cells, as illustrated by their ability to protect epithelial
barrier function under
conditions of oxidative stress (Ropeleski et al, 2003; Urayama et al., 1998).
Inducible
heat shock proteins (Hsp) belong to a family of highly conserved proteins that
play an
important role in protecting cells against physiologic and pathogenic
stressors in the
environment. Under conditions of stress such as heat, exposure to heavy
metals, and
toxins, ischemia/reperfusion injury, or oxidative stress from inflammation,
Hsp
induction is both rapid and robust. Induction of heat shock proteins by a mild
"stress"
confers protection against subsequent insult or injury, which would otherwise
lead to
cell death. This well-described phenomenon is known as "stress tolerance"
(Parsell
and Lindquist, 1993).
In intestinal epithelial cells, inducible heat shock proteins convey a degree
of
cytoprotection against stressors such as inflammatory cell-derived oxidants
and
preserve the integrity of intestinal epithelial cell barner function under
hostile
conditions (Chang, 1999; Musch et al., 1996; Musch et al., 1999). The
induction of
heat shock proteins in intestinal epithelial cells prolongs viability under
conditions of
stress (Musch et al., 1996) and preserves tight junctions as measured by
transepithelial resistance (Musch et al., 1999).
Activation of the pro-inflammatory NF-xB pathway is thought to be a key
molecular event involved in the pathogenesis of IBD (Neurath et al" 1998;
Jobin and
Sartor, 2000; Schmid and Adler, 2000; Boone et al., 2002). Administration of
antisense oligonucleotides targeting the NF-xB subunit p65 was more effective
than
steroid treatment in reducing inflammation in two different murine models of
colitis
(Neurath et al., 1996). Immunohistochemical studies have shown that colonic
4
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
biopsies from Crohn's patients display increased levels of expression of the
NF-oB
subunit p65 in areas of active inflammation (Neurath et al., 1998). In the non-
inflammatory state, NF-oB is held in its inactive, cytosolic form complexed to
the
inhibitory protein IoB. Once a signal is received to activate NF-xB, its
inhibitor IoB
is phosphorylated and targeted for degradation by the ubiquitin proteasome
pathway.
The release of NF-oB from inhibition and its translocation to the nucleus,
results in
the transcriptional activation of a broad spectrum of cytokine and chemokine
genes,
cell adhesion molecules, and immunoreceptors, all important mediators of the
inflammatory response (Neurath et al" 1998; Jobin and Sartor, 2000; Schmid and
Adler, 2000; Boone et al., 2002).
There is growing interest in the use of probiotics, which are defined as
ingestible microorganisms having health benefit beyond their intrinsic
nutritive value,
in the treatment of a variety of gastrointestinal ailments including
inflammatory bowel
diseases (Gionchetti et al., 2000a), irntable bowel syndrome (Niedzielin et
al., 2001),
pouchitis (Gionchetti et al., 2000b; Gionchetti et al., 2003), as well as
rotavirus and
antibiotic-associated diarrhea (Isolauri et al., 1991; Majamaa et al., 1995;
Arvola et
al., 1999). Although little is known about their mechanisms of action,
probiotics
appear to have protective, trophic, and anti-inflammatory effects on bowel
mucosa.
Proposed mechanisms by which probiotics may act include the production of
ammonia, hydrogen peroxide (Kullisaar et al., 2002; Annuk et al., 2003; Ocana
et al.,
1999), and bacteriocins (Cleveland et al., 2001; Paraje et al., 2000; Braude
and
Siemienski, 1968), which inhibit the growth of pathogenic bacteria, the
competition
for adhesion sites on intestinal epithelia (Lee et al., 2000; Lee et al.;
2003), and an
adjuvant-like stimulation of the immune system against pathogenic organisms
(Maassen et al., 2000). However, the exact mechanisms by which probiotics act
to
protect against intestinal inflammation have yet to be fully elucidated.
The probiotic VSL#3 (comprised of Streptococcus ther~~aophilus, and several
species of Lactobacillus and Bifidobacteria) attenuates intestinal
inflammation in the
IL-..10 knockout mouse model of enterocolitis (Madsen et al., 2001) and has
been
shown to improve the clinical outcome of chronic intestinal inflammation in
clinical
trials (Gionchetti et al., 2000b). In a randomized, double-blinded, placebo-
controlled
trial of 40 patients suffering from at least 3 relapses per year of recurrent
pouchitis,
those patients assigned to receive placebo all relapsed within four months,
whereas
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
only 15% (3/20) of the patients assigned to the probiotic treatment arm
developed
relapse (Gionchetti et al:, 2000b). In addition to maintenance therapy, VSL#3
as
prophylactic treatment may help prevent the onset of acute pouchitis in the
year
following ileal pouch-anal anastomosis after colectomy for ulcerative colitis
(Gionchetti et al., 2003).
Changing the gut flora of IBD patients with probiotic agents is being
intensely
studied as a therapeutic strategy. However, the mechanisms of probiotic action
remain unclear. Moreover, the clinical efficacy ofprobiotics is highly
dependent on
the ability to establish and maintain bacterial colonization, and is limited
by
unregulated composition of formulations and homeopathic delivery of active
agents.
Thus, there is a need to elucidate the mechanisms of probiotic activity and
develop
more effective therapies for inflammatory bowel diseases
SUMMARY OF THE INVENTION
The invention disclosed herein satisfies at least one of the aforementioned
needs in the art by providing at least one soluble factor from the probiotic
VSL#3,
wherein the soluble factors) is useful in treating or preventing inflammatory
disorders, such as inflammatory bowel disease. The soluble factors) inhibits
the
chymotrypsin-like activity of the proteasome in, e.g., intestinal epithelial
cells.
Proteasome inhibition occurs relatively soon after exposure of the epithelial
cells to
the probiotic-conditioned medium containing the soluble factor(s). In
addition, the
conditioned medium has shown a capacity to inhibit the pro-inflammatory NF-xB
pathway, and does it through a mechanism different from type-III secretory
mechanisms that have been described. The soluble factors) also induces
expression
of cytoprotective heat shock proteins (Hsp, e.g., Hsp25 and Hsp72) in
intestinal
epithelial cells. Without wishing to be bound by theory, these effects appear
to be
mediated through the common unifying mechanism of proteasome inhibition. The
resulting inhibition of NF-~cB and increased expression of one or both of
Hsp25 and
Hsp72 are consistent with the anti-inflammatory and cytoprotective effects of
the
soluble factors) and reveal a new mechanism underlying microbial-epithelial
interaction. .
6
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
The invention provides bioactive compounds or agents secreted by probiotic
bacteria that attenuate the TNF-a-mediated induction of NF-~cB activation in
intestinal
epithelial cells and induce the expression of cytoprotective heat shock
proteins, thus
affecting at least one, and perhaps two, "arms" of current inflammatory bowel
disease
models. These beneficial effects on the gut mucosa appear to stem from a
common
mechanism mediated by proteasome inhibition. The compounds of the invention
provide the basis for therapies for the treatment of IBD that are superior to
those
currently available in the art.
In one aspect of the invention, a composition is provided that comprises an
isolated, anti-inflammatory, cytoprotective compound. In an embodiment, the
compound is present in a probiotic-conditioned medium. One suitable probiotic-
conditioned medium is medium conditioned by the probiotic, VSL#3. Preferably,
the
compound is present in an ether-extracted fraction of the probiotic-
conditioned
medium.
In some embodiments, the compound is an orgailic acid. In other
embodiments, the invention provides an isolated, anti-inflammatory,
cytoprotective
compound comprised in medium conditioned with one or more of Streptococcus
salivarius subsp. thennaophilus, Lactobacillus casei, Lactobacillus
planturufn,
Lactobacillus acidoplzilus, Lactobacillus delbrueckii subsp. bulgaricus,
Bifidobacte~ia longuna, Bifidobactef~ia infantis, and Bifidobactef~ia breve.
In some
embodiments, the compound is present in a medium conditioned with
Lactobacillus
plantaf-una and in other embodiments, the conditioned medium is VSL#3-
conditioned
medium.
In another aspect of the invention, the compound induces the expression of at
least one heat shock protein. In a particular embodiment, the heat shock
protein is at
least one of Hsp25 and Hsp72. In another embodiment the compound is an
inhibitor
of NF-~cB activation, such as by inhibiting the NF-oB pathway. Preferably, the
compound inhibits the NF-oB pathway by stabilizing hcB, such as by stabilizing
unphosphorylated hcB, phosphorylated IxB, or both forms of IxB. In yet other
embodiments, the compound is both an inducer of heat shoclc protein expression
and
an inhibitor of the NF-xB pathway.
7
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
In another aspect of the invention, the compound is a proteasome inhibitor.
The compound may be a selective inhibitor of the proteasome. The selectivity
of the
proteasome inhibitor may be with regard to the protease activity of the
proteasome,
the type of cells in which it inhibits the proteasome, or both. In one
embodiment of
this aspect of the invention, the compound selectively inhibits the
chymotrypsin-like
activity of the proteasome. In other embodiments, the compound does not
significantly inhibit the trypsin-like activity of the proteasorrle. In yet
other aspects of
the invention the compound weakly inhibits the caspase-like activity of the
proteasome, wherein "weak inhibition" refers to a level of inhibition
equivalent to that
caused by 10 ~.M lactacystin. In still other embodiments, the compound
selectively
inhibits the proteasome in epithelial cells. Preferably, the compound
selectively
inhibits the proteasome in intestinal, or gut, epithelial cells.
Another aspect of the invention is drawn to a pharmaceutical composition
comprising an isolated, anti-inflammatory, cytoprotective compound derived
from a
probiotic-conditioned medium and at least one pharmaceutically acceptable
excipient.
An exemplary pharmaceutical composition comprises an isolated, anti-
inflammatory,
cytoprotective compound derived from an ether-extracted fraction of a
conditioned
medium, such as a VSL#3-conditioned medium. In some embodiments, the
compound is an organic acid. In some embodiments, the compound induces
expression of at least one heat shock protein, e.g., Hsp25 and/or Hsp72. In an
illustrative embodiment, the compound is an inhibitor of NF-xB activation,
such as by
stabilizing hcB, whether phosphorylated IKB or not. In other embodiments, the
compound is a proteasome inhibitor, such as a selective inhibitor of the
chymotrypsin-
like~ activity of a proteasome. An exemplary proteasome is an epithelial cell
proteasome, such as an intestinal epithelial cell proteasome.
Yet another aspect of the invention is a method for treating a patient with an
inflammatory disorder comprising administering to the patient an effective
amount of
an isolated, anti-inflammatory, cytoprotective compound derived from a
probiotic-
conditioned medium. Typically, the compound is administered in an amount
effective
to slow, halt or reverse the progress of axi inflammatory disorder, such as an
inflammatory disease or condition; however, also contemplated is the
administration
of a compound as described herein in an amount effective to ameliorate a
symptom
associated with an inflammatory disorder. Symptoms associated with
inflammatory
8
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
disorders, such as redness, swelling, heat and pain, are known in the art, as
are
methods for measuring or assessing such a symptom to determine whether that
symptom has been ameliorated. The inflammatory disorder may be an autoimmune
disorder. Examples of autoimmune disorders that may be treated according to
the
invention include rheumatoid arthritis, juvenile rheumatoid arthritis,
osteoarthritis,
psoriatic arthritis, atopic dermatitis, eczematous dermatitis, psoriasis,
Sjogren's
Syndrome, Crohn's disease, aphthous ulcer, iritis, conjunctivitis,
keratoconjunctivitis,
ulcerative colitis, asthma, allergic asthma, cutaneous lupus erythematosus,
scleroderma, vaginitis, leprosy reversal reactions, erythema nodosum leprosum,
autoimmune uveitis, polychondritis, Stevens-Johnson syndrome, lichen planus,
sarcoidosis, primary biliary cirrhosis, uveitis posterior, or interstitial
lung fibrosis.
In a preferred embodiment of this aspect of the invention, the inflammatory
disorder is an inflammatory bowel disease. In one aspect of the invention the
inflammatory bowel disease is Crohn's disease. In some embodiments, the
inflammatory bowel disease is ulcerative colitis. A preferred probiotic-
conditioned
medium for use in this aspect of the invention is a VSL#3-conditioned medium.
In
some embodiments of this aspect of the invention, the compound is derived from
an
ether-extracted fraction of the medium (i.e., the compound is extracted from
the
medium using ether). It is contemplated that compounds useful in the practice
of the
method will include organic acids and acid-stable proteins or peptides. In
some
embodiments, the compound induces the expression of at least one heat shock
protein,
such as Hsp25 and/or Hsp72. The compound may inhibit NF-~cB activation (e.g.,
by
stabilizing IoB in a phosphorylated or unphosphorylated form) without or,
preferably,
with the induction of at least one heat shock protein. In some embodiments,
the
compound used in the method is an inhibitor of a protease activity, such as a
protease
activity of a proteasome. For example, a compound used in the method may
selectively inhibit the chymotrypsin-like activity of a proteasome, such as an
epithelial cell proteasome (e.g., an intestinal epithelial cell proteasome).
Embodiments according to this aspect of the invention include the method of
treating
a patient with an inflammatory disorder wherein the anti-inflammatory,
cytoprotective
compound does not alter the ubiquitination level of at least one protein
amenable to
ubiquitination in an epithelial cell exposed to the compound.
9
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
A related aspect of the invention is directed to a method of preventing an
inflammatory disorder comprising administering an effective amount of an anti-
inflammatory, cytoprotective compound derived from a probiotic-conditioned
medium. This aspect of the invention includes embodiments analogous to the
above-
described embodiments of treatment methods, with apparent modification of
those
embodiments to suit the prophylactic use of a compound according to the
invention to
prevent, rather than to treat, a patient with an inflammatory disorder.
Yet another aspect of the invention is drawn to a kit for treating (including
ameliorating a symptom thereof) or preventing an inflammatory disorder
comprising. a
pharmaceutical composition as described above and instructions for
administration of
the composition to treat or prevent the disorder.
Another aspect of the invention provides a method of producing an isolated,
anti-inflammatory cytoprotective compound comprising obtaining a VSL#3-
conditioned medium; and isolating an anti-inflammatory, cytoprotective
compound
from the VSL#3-conditioned rnediuin, thereby producing an isolated, anti-
inflammatory, cytoprotective compound. In some embodiments, the method further
comprises characterizing the anti-inflammatory, cytoprotective compound. More
preferably, the method further comprises identifying the anti-inflammatory,
cytoprotective compound. In some embodiments, the method further comprises
obtaining more anti-inflammatory, cytoprotective compound. In certain
embodiments
the more anti-inflammatory, cytoprotective compound is obtained by isolation
from
VSL#3. In other embodiments the more anti-inflammatory, cytoprotective
compound
is obtained by chemical synthesis. In yet other embodiments the method further
comprises placing the more anti-inflammatory, cytoprotective compound in a
pharmaceutical composition. In a preferred embodiment the method further
comprises administering the pharmaceutical composition to a subject.
Preferably the
subject is a human. Also preferably, the subject has an inflammatory disorder.
More
preferably, the inflammatory disorder is an inflammatory bowel disease. In
some
embodiments the inflammatory bowel disease is Crohn's disease. In other
embodiments the inflammatory bowel disease is ulcerative colitis.
Another aspect of the invention is drawn to a method of screening for a
modulator of monocyte chemoattractant protein - 1 (MCP-1) release, comprising:
(a)
combining a candidate modulator, a probiotic-conditioned medium, and an
epithelial
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
cell; (b) measuring MCP-1 release by the cell; and (c) comparing the MCP-1
release
in the presence, and absence, of the candidate modulator, wherein a difference
in the
MCP-1 release identifies the candidate modulator as a modulator of MCP-1
release.
In a related aspect, the invention provides a method of screening for a
modulator of heat shock protein expression, comprising (a) combining a
candidate
modulator, a probiotic-conditioned medium, and an epithelial cell; (b)
measuring heat
shock protein expression in said cell; and (c) comparing the heat shoclc
protein
expression in the presence, and absence, of said candidate modulator, wherein
a
difference in said heat shock protein expression identifies the candidate
modulator as
a modulator of heat shock protein expression. In some embodiments, the method
will
identify a modulator of expression of Hsp25 and/or Hsp72. Also contemplated
are
screening methods wherein the modulator alters the activity of Heat Shock
Transcription Factor-1 (HSF-1).
Numerous additional aspects and advantages of the invention will become
apparent to those.skilled in the art upon consideration of the following
detailed
description of the invention, which describes presently preferred embodiments
thereof.
BRIEF DESCRIPTION OF THE DRAWINGS
The following drawings form part of the present specification and are included
to further demonstrate certain aspects of the invention. The invention may be
better
understood by reference to one or more of these drawings in combination with
the
detailed description of specific embodiments presented herein.
FIG.1: Probiotic-conditioned medium inhibits TNF-alpha stimulation of
NF-xB: YAMC (young adult mouse colon) cells were transfected with a NF-~cB
luciferase reporter gene and treated with VSL#3-conditioned medium (VSL#3-CM)
for 16 hours, then stimulated with TNF-a (50 ng/ml 6 hours prior to harvest).
Experimental conditions are as indicated below each column, "ctrl" column is
untreated control, i.e., baseline level of NF- 7cB activity in YAMC cells
prior to TNF-
a stimulation. Transfections were performed in triplicate for each
experimental
condition. Shown is a representative graph from one of these experiments
(n=8).
11
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
Activity is expressed in arbitrary huninescence units. Results are normalized
to the
TK-Renilla reporter gene internal control, which is co-transfected with the NF-
oB
luciferase reporter gene in each experiment.
FIG. 2: Probiotic-conditioned medium stabilizes and prevents
degradation of IxBa. Immunoblot of hcBa and the phosphorylated form of IoBa,
20 ~.g protein/lane. YAMC cells were treated with VSL#3-conditioned medium for
16
hours, then stimulated with TNF-a (50 ng/ml) and harvested at the times
indicated.
Shown in the upper two panels, TNF-a stimulates a transient phosphorylation of
IxBa
(5 minutes), is associated with decreased total IoBa (5-30 minutes) as IoBa is
targeted
for degradation. In the bottom panels, pretreatment of YAMC cells with VSL#3-
conditioned medium inhibits the effects of TNF-a on IoBa. and phosphorylated
hcBa;
preventing their degradation. Note the persistence of the phosphorylated form
of
IxBa (bottom panel).
FIG. 3: Global Ubiquitination is not inhibited by VSL#3-conditioned
medium. Immunoblot analysis of ubiquitinated proteins from YAMC cells
following
treatment with VSL#3-CM for 16 hours, demonstrating that global blockade of
ubiquitination does not occur when cells are treated with VSL#3-CM. MG132, a
compound known to inhibit proteasome function and increase accumulation of
ubiquitinated proteins, is also shown, as is thermal stress (HS) and untreated
control
cells (C). The pattern of ubiquitinated proteins observed after VSL#3-CM
treatment
most closely resembles the pattern seen with thermal stress. Molecular weight
,
markers (kDa) are indicated to the right.
FIG. 4: Probiotic-conditioned medium inhibits proteasome activity.
YAMC cells were treated with VSL#3-conditioned medium for 16 hours and then
harvested for proteasome assay using the fluorogenic substrate SLLVY-AMC,
which
measures the chymotrypsin-like activity of the proteasome. Fluorescence is
expressed
in arbitrary units over time. Untreated control cells (-o-), cells treated
with DHSa-
CM (-o-), VSL#3-CM (-~-), and MG132 (-~-) are indicated. As a positive
inhibitor
control MG132 was used at a concentration of 25 ~M. Experimental conditions
are as
indicated, with data expressed as means and error bars expressed as standard
errors of
the mean (n=6).
12
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
FIG. 5: Hsp25 and Hsp72 expression is induced by probiotics, does not
involve cell wall components, and is specific to epithelial cell types. FIG.
5A
shows immunoblot analysis of levels of Hsp25 and Hsp72 in YAMC cells following
exposure to VSL#3 bacteria for the times indicated, demonstrating a time-
dependent
increase in inducible Hsp expression. Last two lanes: 48h=untreated controls
harvested at 48h, HS = heat shocked cells (positive control). Hsc73 (heat
shock
cognate 73), serves as a loading control.
FIG. 5B shows immunoblot analysis of levels of Hsp25 and Hsp72 in YAMC
cells following exposure to VSL#3-conditioned medium or sonicated organisms at
the
concentrations of bacteria indicated (cfu/ml). Bacteria cultures were
separated into
either conditioned medium fraction (CM) ~r sonicated pellet (Pellet). A
concentration-dependent increase in Hsp expression can be seen upon exposure
to
VSL#3-conditioned medium, which is not seen with sonicated pellet, indicating
that
the active factors produced by the bacteria are .secreted into conditioned
medium and
are not cell wall components. Untreated cells are indicated (-), far left
lane, and HS =
heat shocked cells (positive control) are shown on far right lane. Hsc 73
serves as a
loading control.
FIG. SC sh~ws immunoblot analysis of Hsp72, comparing different cell lines
following exposure to VSL#3-conditioned medium for 16 hours, 20 ~,g
protein/lane
VSL#3-conditioned medium induces a robust Hsp72 response in both col0nic
(YAMC) and small intestinal (MSIE) epithelial cells which is not seen in 3T3
fibroblast cells, suggesting that the probiotic effect is specific to
epithelial cells.
Untreated cells are indicated (-), thermal stress (HS) serves as a positive
control.
FIG. 6: Probiotic compounds induce intestinal epithelial heat shock
proteins through an apical (luminal) membrane specific process. YAMC
intestinal epithelial cells exposed to VSL#3-conditioned medium from the
apical
(luminal) side demonstrate robust Hsp25 and Hsp72 protein expression. In
contrast,
cells exposed to VSL#3-conditioned medium from the basolateral side are not
stimulated to express Hsp25 and Hsp72 proteins. When added to both sides,
VSL#3-
CM has a similar effect to what is seen when it is added only to the apical
side. The
constitutive heat shock cognate Hsc73 was used as a control.
13
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
FIG. 7: Time course of Hsp induction by the proteasome inhibitor
MG132 is similar to that produced by VSL#3-conditioned medium. Immunoblot
analysis of Hsp25 and Hsp72 levels in YAMC cells (20 ~,g protein/lane)
following
exposure to the proteasome inhibitor MG132 (25 ~M) for the times indicated,
demonstrating a time-dependent increase in Hsp expression which parallels that
seen
with VSL#3-treated cells. First two lanes: C=untreated control cells harvested
at Oh,
V=DMSO vehicle-treated control harvested at 14 hours. HS = heat shocked cells
(positive control). MG132 is even more effective at inducing Hsp25 than heat
shock.
FIG. 8: Unlike MG132., treatment of epithelial cells with VSL#3-
conditioned medium does not cause major toxicity. Phase-contrast photographs
of
YAMC cells treated with either VSL#3-CM (bottom left panel), DHSa-CM ,(bottom
right panel), or MG132 at 25 ~,M (top right panel) for 16 hours, and untreated
control
cells (top left panel). Note the dramatic change in morphology and loss of
cell
viability in the MG132-treated cells. These changes are not seen in the VSL#3-
CM or
DHSa-CM treated cells, which look similar in appearance to untreated controls.
Bar
shown in top left panel equals 10 microns.
FIG. 9: The majority of bioactivity for the VSL#3-CM appears to reside
in fractions that are less than 10 kDa. Hsp25 and Hsp72 protein expression is
stimulated by components of VSL#3-CM that reside in fractions that were
prepared
through Centricon filters with a molecular weight cut-off of 10 kDa. The
constitutive
heat shock cognate Hsc73 was used as a control. Control (C), VSL#3-CM (CM),
VSL#3-CM passed through 10 kDa filter (<10 kDa), heat shock (HS).
FIG. 10: VSL#3 bioactivity is pH-dependent. The induction of Hsp25 and
Hsp72 by VSL#3-CM (CM) is influenced by the pH of the medium prior to its
addition to the luminal fluid of YAMC monolayers. The pH values shown in the
figure indicate the pH of the CM prior to its addition to the YAMC cells.
Typically,
the pH of the medium is 4.0 after being conditioned by the bacteria. The final
pH
after the 1:10 dilution in the huninal buffer is between 6.5 and 7.0, which is
the
approximate pH of the acid microclimate of intestinal epithelial cells ira
situ.
FIG.11: Ether-extracted compounds of VSL#3-CM inhibit TNF-a-
stimulated NF-KB activity. The effects of ether-extracted compounds (EEC) and
MG132 on NF-~cB activity were determined using an NF-KB ELISA assay (Active
14
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
Motif). TNF-a stimulation (30 ng/ml) alone caused a significant increase in NF-
oB
activation (second bar from left). Both MG132 and EEC significantly inhibited
TNF-
stimulated NF-xB activity (third and fourth bar from left). In contrast, the
remaining
aqueous phase following separation from the ether fraction was devoid of
activity (far
right bar).
FIG. 12: Ether-extracted compounds of VSL#3-CM directly inhibit
proteasomal function. The ira vitro activity of the 20S proteasomal component
(barrel) provided by the commercial proteasomal assay (Calbiochem) in the
presence
and absence of EEC from VSL#3 and E. coli (DHSa) was tested to determine ifEEC
directly inhibit proteasomal function. Proteasomal function was unaffected by
EEC
from DHSa (compare slopes). In contrast, there was significant inhibition of
in vitro
proteasomal activity by EEC from VSL#3 and MG132.
FIG. 13: Probiotic-conditioned medium displays differential inhibition of
proteasome activity. YAMC cells were treated. with VSL#3-conditioned medium
for
16 hours and then harvested for proteasome assay using the fluorogenic
substrate Bz-
val-gly-arg-AMC (FIG. 13A) or Z-leu-leu-glu-AMC (FIG. 13B). Fluorescence is
expressed in arbitrary units over time. Untreated control cells (-~~-), cells
treated with
VSL#3-CM (-1-), and lactacystin (-o-) are indicated. The data is expressed as
means
and error bars expressed as standard errors of the mean (n=3).
FIG.14: Figure 1. Probiotic-conditioned media inhibits TNF-alpha
stimulation of NF-KB. YAMC cells were transfected with a NF-xB luciferase
reporter gene and treated with VSL#3-conditioned media for 16 hours, 'then
stimulated with TNF-a (50 ng/ml 6 hours prior to harvest). Experimental
conditions
are as indicated below each column. Transfections were performed in triplicate
for
each experimental condition (n=8), with the exception of the column showing
VSL
treatment alone, where data is compiled from three separate experiments, also,
performed in triplicate for each experiment. Data is expressed as mean ~ SE (*
p<
0.05 compared to TNF-a-treated samples). Activity is expressed in arbitrary
luminescence units, normalized to the TK-Renilla internal control.
Figure 15: Probiotic-conditioned media inhibits MCP-1 release. YAMC
cells were treated with VSL#3-conditioned media (VSL-CM) for 16 hours then
stimulated with TNF-a (50 ng/ml) 6 hours prior to harvest and compared to
untreated
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
control (No Tx), TNF-a treatment alone (TNF-a only ), or cells pretreated with
conditioned media from the E.coli strain DHSa with and without TNF-a .
Supernatants were assayed for release of the chemokine MCP-~1 by ELISA (as
described herein). Experimental conditions are as indicated below each column.
YAMC cells pretreated with VSL-CM show a reduction in the amount of MCP-1
released in response to TNF-a stimulation compared to controls (mean ~ SE for
three
separate experiments, in each experiment each group was performed in
triplicate, * p<
0.05 compared to controls).
Figure 16: Probiotic-conditioned media stabilizes and prevents
degradation of hcBa. YAMC cells were treated with VSL#3-conditioned media for
16 hours, then stimulated with TNF-a (50 ng/ml) and harvested at the times
indicated.
Shown in the upper panel, TNF-a stimulates a transient phosphorylation of IoBa
(5
minutes) and is associated with decreased total hcBa (5-15 minutes) as IxBa is
targeted for degradation. In the bottom panel, pretreatment of YAMC cells with
VSL#3-conditioned media inhibits the ability of TNF-a to stimulate IxBa
degradation. Note the persistence of the phosphorylated form of hcBa.
Figure 17: Probiotic-conditioned media modulates proteasome activity.
VSL has a dramatic inhibitory effect on the chymotrypsin-like activity, no
inhibitory
effect on the trypsin-like activity, and a partial inhibitory effect on the
caspase-like
~ activity of the proteasome. Panel A: YAMC cells were treated with VSL#3-
conditioned media for 16 hours and then analyzed for chymotrypsin-like
proteasome
activity. Fluorescence is expressed in arbitrary units over time. As a
positive
inhibitor control MG132 was used at a concentration of 25 ~,M, as described
herein.
Experimental conditions are as indicated, with data expressed as means and
error bars
expressed as standard errors of the mean (n=6). For the trypsin-like (Panel B)
and
caspase-like activities (Panel C), YAMC cells were treated with VSL#3-
conditioned
. media for 16 hours and then analyzed as described but instead of MG132, the
proteasome inhibitor lactacystin was used at a concentration of 10 ~.M (use of
higher
concentrations of lactacystin was limited due to cell toxicity). Data is
expressed as
means for three separate experiments, with error bars expressed as standard
errors of
the mean.
Figure 18: Proteasome inhibition by probiotic-conditioned media is an
early event. Time course of VSL#3-CM treatment demonstrating that proteasome
16
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
inhibition by VSL#3-CM is an early event, occurring almost immediately after
exposure of the epithelial cells to the probiotic-conditioned media. YAMC
cells were
treated for 30 minutes, 60 minutes, and 6 hours, then harvested and assayed
for their
ability to inhibit the CTL-like activity of the proteasome. Slopes of each
assay, which
represent degree of proteasome activity, were determined for each time point
and
plotted over time. The most pronounced proteasome inhibition occurs early
after
treatment with VSL#3-CM, with most of the inhibition occurring within the
first 30
minutes. Shown is a graph representative of three separate experiments.
Figure 19: Hsp25 and Hsp72 expression is induced by probiotics, does
not involve cell wall components, and is specific to epithelial cell types.
Panel A:
T_mmunoblot analysis of levels of Hsp25 and Hsp72 in YAMC cells following
exposure to VSL#3 bacteria for the times indicated, demonstrating a time-
dependent
increase in Hsp expression. Last two lanes: 48h=untreated controls harvested
at 48
hours, HS = heat-shocked cells (positive control). Hsc73 (heat shock cognate
73),
serves as a loading control. Panel B: Immunoblot analysis of levels of Hsp25
and
Hsp72 in YAMC cells following exposure to VSL#3-conditioned media or sonicated
organisms at the concentrations of bacteria indicated (cfuJml). Bacteria were
grown
as described herein, then separated into either a conditioned media fraction
(CM) or a.
sonicated pellet fraction(Pellet). A concentration-dependent increase in Hsp
expression can be seen upon exposure to VSL#3-conditioned media which is not
seen
with the sonicated pellet, indicating that the active factors or agents
produced by the
bacteria are secreted into conditioned medium and are not cell wall
components. Hsc
73 serves as a loading control. Panel C: Immunoblot analysis of Hsp72,
comparing
different cell lines following exposure to VSL#3-conditioned media (CM) for 16
hours, 20 ~,g protein/lane. VSL#3-conditioned media induces a robust Hsp72
response in both colonic (YAMC) and small intestinal (MSIE) epithelial cells
which
is not seen in 3T3 fibroblast cells, suggesting that the probiotic effect is
specific to
epithelial cells. Thermal stress (HS) serves as a positive control.
Figure 20: Hsp induction by probiotics is at least partly transcriptional
and involves HSF-1. Panel A: Electrophoretic mobility shift assays (EMSA) show
that the induction of Hsp expression by VSL#3-CM was transcriptional in
nature.
YAMC cells were treated for the times indicated with VSL#3-CM and then
harvested,
EMSAs were performed as described herein. VSL#3-CM induces binding of the heat
17
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
shock transcription factor HSF, reaching a maximal signal around 4 or 5 hours
after
exposure and then tapering off after 6 hours, indicating that Hsp induction by
VSL#3-
CM is at least partly transcriptional in nature. Panel B: EMSA showing
specificity of
this binding by using antibodies against the transcription factors HSF-1 and
HSF-2
(panel B). The major transcription factor involved in Hsp induction by VSL#3-
CM is
HSF-1; HSF-2 does not appear to play a role in this Hsp induction.
Figure 21: Probiotic-conditioned media protects epithelial cells against
oxidant stress. Panel A: Chromium release assay demonstrating that VSL#3-CM
protects YAMC cells from oxidant injury. YAMC cells were treated with VSL#3-
CM for 16 hours. Cells were labeled with SICr for 60 minutes and stimulated
with
monochloramine (NH2C1, 0.6 mM) for 60 minutes and the ratio of released SICr
to
intracellular SICr was determined (mean ~ SE for three separate experiments,
in each
experiment each group was performed in triplicate, * p< 0.05 compared to
controls).
Panel B: VSL#3-CM prevents oxidant-induced actin depolymerization from the F-
actin to the G-actin form. YAMC cells were treated with VSL#3-CM' for 16
hours,
when appropriate, and then treated with the oxidant monochloramine (0.6 mM, 60
minutes) along with untreated control (Con) cells. Cells were processed for
globular
(G) and filamentous (F) actin as described herein. Images shown are
representative of
three separate experiments.
DETAILED DESCRIPTION
Inflammatory bowel diseases (IBDs) are a group of chronic disorders that
affect the digestive tract of susceptible individuals. The extent and severity
of
mucosal injury in IBD is determined by the disequilibrium between inflammation-
induced injury versus reparative and cytoprotective mechanisms. In recent in
vitro
and in vivo studies, various probiotics have been shown to be effective in
either
preventing or mitigating intestinal mucosal inflammation associated with
experimental colitis (Madsen et al., 2001; Gionchetti et al., ZOOOb; Campierei
et al.,
2000). Furthermore, probiotics appear to reduce the rate of malignant
transformation
of colonic mucosa in the setting of chronic inflammation (Wollowski et czl.,
2001). A
number of preliminary clinical trials have shown that probiotics are effective
in the
treatment of pouchitis and IBD. Several multicenter clinical trials are also
under way
to determine the effectiveness of these agents and to optimize dosage in IBD
patients.
18
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
The mechanisms) of probiotic action, however, remains unclear. It follows that
there
is no appreciation in the art that the beneficial effects of crude probiotic
materials,
such as unrefined probiotic-conditioned media, can be ascribed to, and hence
achieved, with one or more discrete compounds. Moreover, the therapeutic use
of
crude conditioned media of uncharacterized content presents significant health
concerns.
The probiotic VSL#3 is disclosed herein as producing soluble factors) with
anti-inflammatory and cytoprotective properties. More specifically, these
factors
inhibit the pro-inflarrunatory NF-~cB pathway and induce the expression of
cytoprotective heat shock proteins in intestinal epithelial cells. Moreover,
these
effects appear to be mediated through the common unifying mechanism of
proteasome inhibition, although the invention is not contemplated as being
limited by
such explanatory theorizing. To facilitate a more thorough understanding of
the
invention, the following term definitions are provided.
"Isolated" in the context of describing the invention disclosed herein means
that a given substance is separated from at least one other substance with
which i.t is
typically found in nature. By way of example, a bioactive agent "isolated"
.from a
conditioned medium is separated from at least one other component of the
relevant
crude conditioned medium.
"Selective inhibition," in the context of the selective inhibition of protease
functions of the proteasome, means that less than all, and preferably one,
protease
function of a proteasome is reduced to a level comparable to the level of that
protease
measured in the presence of up to 10 ~,M lactocystin. For example, reduction
of a
chymotrypsin-like activity of a proteasome to a level found in the presence of
no more
than 10 ~,M lactocystin, without the concomitant reduction in the activity of
at least
one of the trypsin-like or the caspase-like proteasome activities, is
illustrative of
selective inhibition.
"Anti-inflammatory" has a plain meaning well lcnown in the art as a substance
or process that reduces inflammation, a physiological process generally
characterized
by heat, redness, swelling and pain. "Anti-inflammatory" is given its plain
meaning
herein.
19
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
"Inflammatory disorder" means any disease, malady, or condition known in
the art to be characterized by involvement of inflammation. The term includes
diseases, maladies and conditions of epithelial cells and, by way of
particular
example, of intestinal (i.e., gut) epithelial cells.
"Cytoprotective" has a plain meaning well known in the art as a substance or
process that protects at least one cell or cell type, and it is this plain
meaning that is
given the term throughout this application.
"Probiotic-conditioned media" means a cell culture medium that has been
exposed to viable cells. Suitable culture media include all media known in the
art to
be suitable for the growth, and/or maintenance, of a cell amenable to
maintenance or
growth isa vitro and includes numerous media useful for maintaining or growing
a
variety of prokaryotic or eukaryotic cells.
"Media," and "medium," are given their plain meanings of compositions
containing compounds required for the maintenance and/or growth of at least
one cell
type. For example, a medium may contain an energy source, nutrients, growth
factors, and the like, as would be known in the art. These terms are used
throughout
this application without strict adherence to number and, accordingly, may be
used as
synonyms, as would be apparent to one of skill from the context of a
particular
recitation.
"VSL#3" is given the meaning it has acquired in the art of a group of gram-
positive bacterial species collectively known and marketed as a probiotic.
"Heat shock protein," as used herein, refers to any one of a group of proteins
known in the art to exhibit a detectable increase in activity, typically
reflective of an
increase in expression, upon exposure to a thermal stress in at least one cell
type.
"Stabilizing IxB" means the act of preserving an InB protein for a
physiologically significant period of time, without regard to whether the
protein being
stabilized is unmodified or modified, for example by phosphorylation.
"NF-xB activation" means that intracellular NF-KB exhibits an increased level
of at least one activity characteristic of this protein, as would be known in
the art.
Such activation may result from a decreased rate of destruction of NF-~cB, an
increased rate of production (e.g., expression) of NF-KB, or a combination
thereof.
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
"Chymotrypsin-like" proteasome activity means a protease activity exhibiting
at least one characteristic in common with chymotrypsin, such as the common
recognition of a cleavage site or structurally related cleavage sites, as
would be known
in the art.
"Pharmaceutically acceptable excipient," is a phrase given.its plain meaning
of a substantially inert substance admixable with a pharmaceutical or
bioactive agent
as a vehicle to provide a consistency or form suitable for pharmaceutical
administration. Such vehicles typically do not produce an allergic or similar
untoward reaction when administered to a human.
"MCP-1 release" refers to the separation of Monocyte Chemoattractant
Protein-1 from a cell that had produced or harbored it, such as by secretion,
as would
be known in the art.
"Modulator" means a substance that affects a detectable activity,(e.g., of a
protein) or process (e.g., a physiological process such as MCP-1 release),
regardless
' of whether the effect is one of promotion (e.g., enhancement) or inhibition.
In view of these definitions, it will be appreciated that the compounds of the
invention provide therapies for the treatment of inflammatory disorders, such
as IBD,
that are superior to those currently available in the art. In one embodiment,
the
invention provides a composition comprising an isolated, anti-inflammatory.,
cytoprotective compound derivable from a probiotic-conditioned medium. In
addition, the invention provides methods for treating a patient with an
inflammatory
disorder comprising administering to the patient an isolated, anti-
inflammatory,
cytoprotective compound derivable from a probiotic-conditioned medium. In
other
aspects, the invention provides methods for isolating and characterizing at
least one
compound from a probiotic-conditioned medium that has anti-inflammatory and/or
cytoprotective properties, and preferably both types of properties.
The invention provides methods of identifying and characterizing compounds
derivable from cell cultures, such as bacterial cultures, that have anti-
inflammatory
and cytoprotective properties. The invention provides isolated, anti-
inflammatory,
cytoprotective compounds derivable from probiotic organisms. The invention
also
provides compositions and methods useful in treating, and/or preventing,
inflammatory diseases, particularly inflammatory disease of an epithelium.
21
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
I. Isolation of Anti-Inflammatory and Cytoprotective Compounds
Any bacterial strain or probiotic formulation may be screened for anti-
inflammatory and cytoprotective compounds. Preferably, the bacteria are non-
pathogenic, enteric bacteria. In the specific embodiments disclosed herein,
the
probiotic formulation, VSL#3 (VSL Pharmaceuticals, Gaithersburg, MD), was
used.
This formulation contains StYeptococcus saliva~ius subsp. thermophilus,
Lactobacillus casei, Lactobacillus plafatarum, Lactobacillus acidophilus,
Lactobacillus delb~ueckii subsp. bulgaricus, Bifidobacteria longurn,
Bifidobacteria
infantis, and Bifidobactef-ia bf-eve.
Methods of bacterial cell culture are well known to those of skill in the art.
In
a preferred method, VSL#3 is cultured in mammalian tissue culture medium.
VSL#3
grows readily in mammalian tissue culture medium (e.8., RPMI 1640 or DMEM)
under aerobic conditions. Growth in tissue culture medium makes the isolation
of
secreted factors much more straightforward than if a complex broth is used.
The anti-inflammatory; cytoprotective compounds ofthe invention are soluble
factors derivable from a cell-conditioned medium such as a VSL#3-conditioned
medium. To facilitate the identification and characterization of these
compounds it is
preferable to remove the bacterial cells from the medium. One of skill in the
art
would be familiar with methods of separating cells from the soluble factors in
the
medium. For example, the cells may be removed by centrifugation, filtration or
a
combination of both. In a preferred embodiment, overnight VSL#3 cultures grown
at
37°C in tissue culture medium (e.8., RPMI 1640) are prepared and then
centrifuged at
10,0008 for 5 min at 4°C. The medium is then removed and filtered
through a 0.2 ~,m
cellulose acetate filter to exclude all live and intact bacteria. This
"conditioned
medium" is then used as the source from which anti-inflammatory and
cytoprotective
compounds are identified.
A. Organic Extraction
The anti-inflammatory and cytoprotective compounds can be further isolated
from the conditioned medium by extraction with organic solvents. Organic
extraction
separates organic from aqueous compounds. Methods of extraction and suitable
organic solvents are well known to those of skill in the art. In a preferred
embodiment, the organic extraction is performed with ether. The ether
extraction
22
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
process generally removes organic acids and their derivatives, as well as
lipid and
phospholipid molecules, whereas inorganic salts, hydrophilic peptides,
hydrophilic
proteins, carbohydrates and polysaccharides tend to remain in the aqueous
phase.
The anti-inflammatory and cytoprotective compounds of the invention are
present in the ether-extracted fraction and many, if not all, have a molecular
weight of
less than. 10 kDa. It is expected that an anti-inflammatory and cytoprotective
compound of the invention is an organic acid.
B. Thin Layer Chromatography
Methods for the purification of organic acids are well known to those of skill
in the art. For example, the compounds of the invention rnay be purified from
the
ether-extracted fraction of the conditioned medium using thin layer
chromatography
(TLC), which-is a chromatographic technique that is useful for separating
organic
compounds such as organic acids and their derivatives.
In a preferred embodiment, ether extracts of VSL#3-conditioned medium will
be subjected'to thin layer chromatography (TLC) on a silica gel G TLC plate
that has
been activated at 150°C for 6 hours. The plate will be developed using
ethanol/ammonialwater in a ratio of 50:8:6 by volume for the first dimension,
and
benzene/methanol/acetic acid in a ratio of 45:8:4 for the second dimension.
Because
of differences in their partitioning behaviors .between the mobile liquid
phase and the
stationary phase, the different components in the ether-extracted mixture will
migrate
at different rates, allowing for their separation. The chromatogram will then
be
developed reversibly under iodine vapor, which binds to carbon double bonds
and
allows visualization of the individual components of the ether-extracted
mixture. The
separated components will be individually isolated by scraping the visualized
spots
off with a spatula, allowing the iodine vapor to evaporate, and then back
extracting
again with ether. Each fraction will then be tested for activity. To ensure
that the
ether extraction process itself is not exerting an effect on bioactivity,
conditioned
medium from the DHSa laboratory strain of E. coli will be treated in the same
manner
as above and used as a negative control for the ether extraction process.
C. Other Separation Techniques
Other separation techniques known to those of skill in the art may also be
employed in the invention to fractionate the conditioned medium. High
Performance
23
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
Liquid Chromatography (HPLC) is characterized by a very rapid separation with
extraordinary resolution of peaks. This is achieved by the use of very fine
particles
and high pressure to maintain an adequate flow rate. Separation can be
accomplished
in a matter of minutes, or at most an hour. Moreover, only a very small volume
of the
sample is needed because the particles are so small and close-packed that the
void
volume is a very small fraction of the bed volume. Also, the concentration of
the
sample need not be very great because the bands are so narrow that there is
very little
dilution of the sample.
Gel chromatography, or molecular sieve chromatography, is a special type of
partition chromatography that is based on molecular size. The theory behind
gel
chromatography is that the column, which is prepared with tiny particles of an
inert
substance that contain small pores, separates, larger molecules from smaller
molecules
as they pass through or around the pores, depending on their size. As long as
the
material of which the particles are made does not adsorb the molecules, the
sole factor
determining rate of flow is the size. Hence, molecules are eluted from the
column in
decreasing size, so long as the shape is relatively constant. Gel
chromatography is
unsurpassed for separating molecules of different size because separation is
independent of all other factors such as. pH, ionic strength, temperature, and
the like.
There also is virtually no adsorption, less zone spreading and the elution
volume is
related in a simple matter to molecular weight.
Separation techniques based on charge may also be used. One such technique
is ion exchange chromatography. With ion exchange chromatography, the sample
is
reversibly bound to a charged matrix. Matrices containing diethyl aminoethyl
(DEAE) and carboxymethyl (CM) celluloses are commonly used. Desorption is then
brought about by increasing the salt concentration or by altering the pH of
the mobile
phase. Another technique known to those skilled in the art for separating
compounds
based on charge is IEF (isoelectric focusing).
Additionally, the conditioned medium may be passed through filters with
specific molecular weight cutoffs. For example, some fractions of the
invention were
parsed by passage through Centricon filters with a 10 kDa molecular weight
cutoff.
During the course of purification or isolation, it may be desirable to assay
the
fractions in order to follow those fractions that retain anti-inflammatory and
24
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
cytoprotective activity. For example, the medium or fraction may be screened
for the
ability to induce cytoprotective heat shock proteins, inhibit NF-oB activity,
and
inhibit proteasomal function of intestinal epithelial cultured cells. These
assays are
described in more detail below. Preparations that have biological activity may
be
frozen in aliquots to be used later for identification, purification, and
future
production of anti-inflammatory and cytoprotective compounds.
D. Chemical Synthesis
W addition to isolating the anti-inflammatory, cytoprotective compounds of
the invention from probiotic-conditioned medium, it is also envisioned that
these
compounds may be created by chemical synthesis. Methods of chemical synthesis
are
well known to those of skill in the art.
II. Identification of Anti-Inflammatory and Cytoprotective
Compounds
The anti-inflammatory and cytoprotective compounds of the invention may be
identified by methods known to those of skill in the art Two preferred methods
of
identifying the compounds of the invention. are preparative TLC. (similar to
analytical
TLC described above but on a larger scale) and HPLC (high performance liquid
chromatography).
HPLC will be run using a C8 reversed-phase (RP) column with potassium
phosphate buffer (pH2.8)/methanol (95:5) to isolate each compound. Separation
of
components occurs through hydrophobic interactions with the stationary phase
(C8
column), and the mobile phase consisting of an aqueous acidic solution
followed by
an organic solvent then allows for elution of individual compounds in the
mixture.
Each compound will be retained on the column until the appropriate
concentration of
organic solvent displaces it from the C8 stationary phase. Each separated
peals will
then be collected, and the identification of the eluted compounds will be
carried out
by using suitable techniques known in the art, such as nuclear magnetic
resonance
imaging (NMR) and infrared spectroscopy (IR).
Exemplifying the identification of compounds) using the general technique of
HPLC, a RP-HPLC fractionation of VSL#3-conditioned medium was performed
using a C18 reverse-phase (RP) analytical column (3.9 mm x 300 mm). The mobile
phase contained buffer A (0.1% trifluoroacetic acid, i.e., 10 xnM TFA) and
buffer B
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
(60% acetonitrile in 0.1% TFA), with filtering and degassing of buffers before
use.
The injection volume was 200 ~,l of conditioned-medium supernatant, the flow
rate
was 1.0 ml/minute and the chromatography was performed at room temperature.
The
elution profile was: 5% Buffer B for 5 minutes, 5% Buffer B to 100% Buffer B
for 60
minutes, 100% Buffer B for 10 minutes, and 100% Buffer B to 5% Buffer B for 5
minutes. Detection was at 214 nm and 280 nm (UV) and fractions were collected,
frozen at -80°C and lyophilized. Lyophilized fractions were
subsequently dissolved
in a suitable solvent (e.g., a buffer compatible with cell viability), as
would be known
in the art. Fractions showing biological activity were used to identify the
bioactive
agent(s). U'se of RP-HPLC is particularly suitable for identification and/or
isolation
of a bioactive agent that is an organic acid or other relatively non-polar
compound as
would be recognized in the art.
In some embodiments, the compounds of the invention may be identified
using mass spectrometry. Mass spectrometry provides a means of "weighing"
individual molecules by ionizing the molecules ifa vacuo and making them "fly"
by
volatilization. Under the influence of combinations of electric and magnetic
fields,
the ions follow trajectories depending on their individual mass (m) and charge
(z).
Mass spectrometric methods are well-known to those of skill in the art,.and
axe
routinely used for the analysis and characterization of a variety of
molecules.
III. Characterization of Anti-inflammatory and Cytoprotective
Compounds
Compounds derivable from probiotic-conditioned medium, such as
compounds actually derived therefrom, can be assayed for the ability to induce
cytoprotective heat shock proteins, inhibit NF-oB activity, and inhibit
proteasomal
function of cells such as intestinal epithelial cells.
A. Heat Shock Proteins
Heat shock proteins are a family of proteins that protect a cell against
environmental stressors. VSL#3-conditioned medium induces the expression of
heat
shoclc proteins, specifically Hsp72 and Hsp25. Hsp72 binds and stabilizes
critical
cellular proteins, preventing their denaturation. It also has anti-apoptotic
actions
through preservation of mitochondria) integrity, inhibition of cytochrome C
leakage,
26
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
and blockade of caspase 8 activity (Liu et al., 2003). Hsp25/27 is an actin-
stabilizing
agent and preserves cytoskeletal and tight junction functions.
Methods of analyzing the induction of heat shock proteins are known to those
of skill in the art. For example, the induction of Hsp72 and Hsp25 can be
performed
by standard Western blot analysis using monoclonal antibodies specifically
recognizing and binding specific Hsp isoforms (Stressgen). Immunoblots for the
constitutive heat shock cognates, Hsp60 and Hsc73, can be performed to check
the
specificity of response and to ensure equal loading of lanes (the expression
ofthese
proteins usually remains constant). In addition, antibodies can be used to
detect the
expression of heat shock proteins by immunofluorescence and ELISA.
Other methods of analyzing the induction of heat shock proteins include
assaying Hsp mRNA levels using, for example, RT-PCR, genomic microarrays, and
real-time PCR. Another approach for analyzing the induction of heat shock
proteins
is the use of electrophoretic mobility shift assays, for example to look at
binding of
the transcription factor HSF-1. In addition, HSE-luciferase reporter assays
can be
employed to measure activity of the transcription factor HSF-1.
B. 'The NF-KB Pathway
A number of approaches are known to those of skill in the art to assess the
inhibition of NF-~cB activation, such as inhibition of the NF-~cB pathway. For
example, electrophoretic mobility shift assays (EMSA or gel shifts) using an
oligonucleotide labeled with 32P can be performed to determine activation of
NF-oB.
Activation of NF-icB and release from the inhibitor IKB results in binding to
this
mimic, which can be easily detected on polyacrylamide gels. At least two
additional
measures may be used to corroborate NF-~cB activation. First, activated NF-~cB
translocates into the nucleus of the cell and therefore detection of NF-KB in
the
nucleus by immunofluorescence or immunoblotting of nuclear fractions strongly
supports NF-xB activation. Second, transient transfections with a NF-xB-
sensitive
reporter construct, such as a construct having five copies of the NF-~cB
responsive
promoter element cloned in front of a firefly luciferase reporter, can be
performed.
Moreover, data from the three assays (EMSA, nuclear NF-xB translocation, and
NF-
~cB reporter) may help identify unique steps at which the compounds of the
invention
modulate, e.g., inhibit, NF-xB activity.
27
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
ELISA-based assays for the detection of NF-xB activation are also known in
the art. For example, an NF-~cB ELISA-based assay kit is commercially
available
from Vinci-Biochem (Vinci, Italy).
NF-~cB regulates a wide variety of genes encoding, for example, cytokines,
cytokine receptors, cell adhesion molecules, proteins involved in coagulation,
and
proteins involved in cell growth. Thus, another approach to the study of the
NF-~cB
pathway is through the analysis of the expression of genes known to be
regulated by
NF-oB. Those of skill in the art will be familiar with a variety of techniques
for the
analysis of gene expression. For example, changes in mRNA andlor protein
levels
may be measured. Changes in mRNA levels can be detected by numerous methods
including, but not limited to, real-time PCR and genomic microarrays. Changes
in
protein levels may be analyzed by a variety of immuno-detection methods known
in
the art.
It is also worthwhile to monitor changes in the NF-KB regulator, IjcB. As the
compounds of the invention are expected to affect the activity of IxB in more
than one
form, antibodies to both the native as well as the phosphorylated form of IoB
are
useful and may be used for Western blotting and immunohistochemical
localization.
C. The Proteasome
Finally, the compounds of the invention may be screened by assessing their
effects on cellular proteasomal function. The proteasome is a large complex,
which
contains several protease activities with different specificities. It exists
in two forms,
a 20S complex and a 26S complex. Cellular proteasomes play an important role
in
degrading cellular proteins as well as in providing viral and endogenous
peptide
fragments for loading of MHC I molecules for antigen presentation.
Inhibitors of the proteasome block the degradation of many cellular proteins.
Proteasome inhibitors are broadly categorized into two groups: synthetic
analogs and
natural products. Synthetic inhibitors are peptide-based compounds with
diverse
pharmacophores. These include peptide benzamides, peptide a-ketoamides,
peptide
aldehydes, peptide a -ketoaldehydes, peptide vinyl sulfones, and peptide
boronic
acids. Known natural product proteasome inhibitors include 'linear peptide
epoxyketones, peptide macrocycles, 'y-lactam thiol ester, and
epipolythiodioxopiperazine toxin. Some specific examples of proteasome
inhibitors
28
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
include MG132, ALLN, E64d, LLM, quinacrine, chloroquine, clioquinol, (R)-(-)-3-
hydroxybutyrate, dopamine, L-DOPA, PR39, gliotoxin, and green, tea (EGCG).
Additional examples of proteasome inhibitors are disclosed in I~isselev and
Goldberg
(2041) and Myung et al. (2001), both of which are incorporated herein by
reference in
their entireties.
Inhibition of.proteasomal function by VSL#3-conditioned medium provides a
potential unifying mechanism for the inhibition of NF-~cB and induction of
cytoprotective heat shock proteins. Such an action is consistent with the
accumulation of phospho- and ubiquitinated-IoB disclosed herein. Furthermore,
it has
been shown that inhibition. of proteasomal function is an extremely potent
stimulus of
the heat shock protein response, likely due to the accumulation of undegraded
proteins (Lee and Goldberg, 1998). Although not wishing to be bound by theory,
the
data disclosed herein indicate that the primary mechanism of action through
which
VSL#3-conditioned medium inhibits the NF-icB pathway and induces Hsp
expression
. appears to be direct inhibition of proteasomal function. This represents a
novel
mechanism of probiotic action differing from that reported by Neish, et al.
who had
reported inhibition of activated NF-~cB by non-pathogenic Salmonella organisms
through a type III secretion system, which requires intact bacteria and
bacterial
adherence.
Those of skill in the art are familiar with methods for assaying proteasome
function. In a preferred method, proteasome assays are performed using a
fluorometric assay by preparing crude cell lysates from YAMC cells treated
with
VSL#3-conditioned medium, then adding the proteasome substrate SLLVY-AMC and
measuring hydrolysis of this product over time (see FIG. 4). The substrate is
a five
amino acid peptide attached to a fluor (4-amino-7-methylcoumarin) which, upon
cleavage by the chymotrypsin-Iike activity of the proteasome, results in a
fluorescent
signal that can be measured and plotted over time. The activity of the
proteasome is
reflected by the rate, or slope of the line. In this assay, the inhibition of
proteasome
activity by a candidate molecule may be compared to that of a known proteasome
inhibitor, such as MG132.
Another method for assaying proteasome function is immunofluorescence
using antibodies that recognize active proteasomes. For example, LMP2
antibodies
29
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
specifically recognize the proteasome beta subunit. In addition, proteasome
assay kits
are commercially available from Biomol International LP.
D. Animal Models
The characterization of the compounds of the invention may involve the use of
various animal models, including transgenic animals that have been engineered
to
have specific defects, or to carry markers that can be used to measure the
ability of a
candidate substance to reach and affect different cells within the organism.
Due to
their size, ease of handling, and information on their physiology and genetic
make-up,
mice are a preferred animal model, especially for transgenics. However, other
animals are suitable as well, including rats, rabbits, hamsters, guinea pigs,
gerbils,
woodchucks, cats, dogs, sheep, goats, pigs, cows, horses, and monkeys
(including
chimps, gibbons and baboons). Assays may be conducted using an animal model
derived from any of these species."
Some examples of mouse models for colitis include the DSS-induced colitis
model, IL-1.0 knockout mouse, A20 kn.ockont mouse, TNBS-induced colitis model,
IL--2 knockout mouse, TCRalpha receptor lcnockeut mouse, and the E-cadheryn
knockout mouse.
Treatment of animals with test compounds will involve the administration of
the compound, in an appropriate form, to the animal. Any animal model of
inflammatory disease known to those of skill in the art can be used in the
practice of a
method according to the invention. Administration will be by any route that
could be
utilized for clinical or non-clinical purposes. For example, the compound may
be
delivered by gavage or by rectal administration. In addition, the protective
effects of
a compound may be assayed by administering a compound before inducing colitis
in
the animal model. Alternatively, the therapeutic effect of a compound may be
assayed by administering the compound after inducing colitis in the animal
model.
Determining the effectiveness of a compound in vivo may involve
consideration of a variety of different criteria. One of ordinary skill in the
art would
be familiar with the wide range of techniques available for assaying for
inflammation
in a subject, whether that subject is an animal or a human subject. For
example,
' inflammation can be measured by histological assessment and grading of the
severity
of colitis. Other methods for assaying inflammation in a subject include, for
example,
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
measuring myeloperoxidase (MPO) activity, transport activity, villin
expression, and
transcutaneous electrical resistance (TER) or transepithelial electrical
resistance
(TEER).
The effectiveness of a compound can also be assayed using tests that assess
cell proliferation. For example, cell proliferation may be assayed by
measuring 5-
bromo-2'-deoxyuridine (BrdU) uptake. Yet another approach to determining the
effectiveness of a compound would be to assess the degree of apoptosis.
Methods for
studying,apoptosis are well known in the art and include, for example, the
TUNEL
assay.
In addition, measuring toxicity and dose response can be performed in animals
rather than in ifz vitro or in cyto assays.
IV. Pharmaceutical Compositions
Compositions of the invention comprise an effective amount of an anti
inflammatory, cytoprotective compound, which may be dissolved andlor dispersed
in
a pharmaceutically acceptable excipient, such as a carrier and/or aqueous
medium..
The anti-inflammatory, cytoprotective compounds of the invention may be
delivered by any method known to those of skill in the art (see for example,
"Remington's Pharmaceutical Sciences" 15th Edition). For example, the
pharmaceutical compositions may be delivered orally, rectally, parenterally,
or
topically.
Solutions comprising -the compounds of the invention may be prepared in
water suitably mixed with a surfactant, such as polyethylene glycol (PEG) of
low (less
than 8 kDa) or high (greater than 8, and preferably greater than 15, kDa)
average
molecular weight, or hydroxypropylcellulose. Under ordinary conditions of
storage
and use, these preparations contain a preservative to prevent the growth of.
microorganisms. The pharmaceutical forms suitable for inj ectable use include
sterile
aqueous solutions or dispersions and sterile powders for the extemporaneous
preparation of sterile injectable solutions or dispersions. The form should
usually be
sterile amd must be fluid to the extent that effective syringability exists.
It must be
stable under the conditions of manufacture and storage and must be preserved
against
the contaminating action of microorganisms, such as bacteria and fungi.
31
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
For parenteral administration in an aqueous solution, for example, the
solution'
may be suitably buffered if necessary and the liquid diluent first rendered
isotonic
with sufficient saline or glucose. These particular aqueous solutions are
especially
suitable for intravenous, intramuscular, subcutaneous, intratumoral, and
intraperitoneal administration. In this connection, sterile aqueous media that
can be
employed will be known to those of skill in the art in light of the present
disclosure.
A suppository may also be used. Suppositories are solid dosage forms of
various weights and/or shapes for insertion into the rectum, vagina and/or the
urethra.
After insertion, suppositories soften, melt and/or dissolve in the cavity
fluids. In
general, for suppositories, traditional binders and/or carriers may include,
for
example, polyalkylene glycols and/or triglycerides; such suppositories may be
formed
from mixtures containing the active ingredient in the range of 0.5% to 10%,
preferably 1%-2%. The pharmaceutical compositions of the invention~may also be
delivered by enema.
Oral formulations include such normally employed excipients as, for example,
pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium
saccharine, cellulose, magnesium carbonate: and/or the like. These
compositions take
the form of solutions, suspensions, tablets, pills, capsules, sustained-
release
formulations and/or powders. In certain defined embodiments, oral
pharmaceutical
compositions will comprise an .inert diluent and/or assimilable edible
carrier, and/or
they may be enclosed in hard- and/or soft-shell gelatin capsule, and/or they
may be
compressed into tablets, and/or they may be incorporated directly with the
food of the
. diet. For oral therapeutic administration, the active compounds) may be
incorporated
with excipients and/or used in the form of ingestible tablets, buccal tables,
troches,
capsules, elixirs, suspensions, syrups, wafers, andlor the like. Such
compositions
and/or preparations should contain at least 0.1% of active compound. The
percentage
of the compositions and/or preparations may, of course, be varied and/or may
conveniently be between about 2 to about 75°~0 of the weight of the
unit, and/or
preferably between 25-60%. The amount of active compounds in such
therapeutically
useful compositions is such that a suitable dosage will be obtained.
The tablets, troches, pills, capsules and/or the like may also contain the
following: a binder, such as gum tragacanth, acacia, cornstarch, and/or
gelatin;
excipients, such as dicalcium phosphate; a disintegrating agent, such as corn
starch,
32
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
potato starch, alginic acid andlor the like; a lubricant, such as magnesium
stearate;
and/or a sweetening agent, such as sucrose, lactose andlor saccharin may be
added
and/or a flavoring agent, such as peppermints oil of wintergreen, and/or
cherry
flavoring. When the dosage unit form is a capsule, it may contain, in addition
to
materials of the above type, a liquid carrier. Various other materials may be
present
as coatings and/or to otherwise modify the physical form of the dosage unit.
For
instance, tablets, pills, and/or capsules may be coated with shellac, sugar
andlor both.
A syrup of elixir may contain the active compounds sucrose, as a sweetening
agent,
methyl and/or propylparabens as preservatives, and a dye and/or flavoring,
such as
cherry and/or orange flavor.
Topical formulations include, creams, ointments, jellies, gels, epidermal
solutions or suspensions, and the like, containing the active compound.
For human administration, preparations should meet sterility, pyrogenicity,
general safety and purity standards as required by the FDA Office of Biologics
standards.
The dosage of the anti-inflammatory, cytoprotective compounds and dosage
schedule may be varied on a subject-by-subject basis, talcing'into account,
for
example, factors such as the weight and age of the subj ect, the type of
disease being
treated, the severity of the disease condition,,. pr~vibus or concurrent
therapeutic
interventions, the manner of administration, and the like, which can be
readily
determined by one of ordinary skill in the art.
Administration is in any manner compatible with the dosage formulation, and
in such amount as will be therapeutically effective. The quantity to be
administered
depends on the subject to be treated. Precise amounts of an active ingredient
required
to be administered depend on the judgment ofthe practitioner and such
judgments
may involve routine procedures to determine an effective amount on a case-by-
ease
basis.
The following examples are included to demonstrate preferred embodiments
of the invention. It will be appreciated by those of skill in the art that the
techniques
disclosed in the examples which follow represent techniques disclosed herein
as
functioning well in the practice of the invention. However, those of skill in
the art
will, in light of the present disclosure, appreciate that many changes can be
made in
33
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
the specific embodiments which are disclosed and still obtain a like or
similar result
without departing from the spirit and scope of the invention. In brief, the
following
examples illustrate various embodiments of the invention: Example 1 describes
basic
techniques used in the work disclosed herein, including tissue culture and
cell lysate
preparation, NF-xB, SICr, G/F actin and proteasome activity assays,
electrophoretic
mobility shift assays, Western blot analysis of proteins, MCP-1. assays, and
statistical
analyses of the observed data; Example 2 discloses the inhibition of NF-xB
activity
by probiotic-conditioned medium; Example 3 describes the inhibition of
Monocyte
Chemoattractant Protein-1 (MCP-1) release by probiotic-conditioned medium;
1.0 Example 4 describes the inhibition of IoB degradation (including
phosphorylated IoB)
by probiotic-conditioned medium; Example 5 describes the failure of probiotic-
conditioned medium to universally inhibit protein ubiquitination; Example 6
shows
that probiotic-conditioned medium inhibits proteasome activity, and does so
more
rapidly thaal protein expression is induced; Example 7 addresses the induction
of heat
shock protein expression by probiotic-conditioned medium, including the time
course
of such induction, and provides evidence that the induction is mediated by HSF-
1
induction; Example 7 describes the properties of bioactive probiotic agents
(i.e., anti-
' inflammatory, cytoprotective compounds); Example 8 discloses that probiotic-
conditioned medium protects epithelial cells from oxidant stress; Example 9
discloses w
some properties of bioactive probiotic compounds or agents; and Example 10 .
establishes that probiotic agents differentially inhibit proteasome
activities.
EXAMPLE 1
General Methodologies
Probiotic Bacterial Culture and Generation of Conditioned Media
The probiotic formulation, VSL#3 (VSL Pharmaceuticals, Gaithersburg, MD),
contains Streptococcus salivar ius subsp. thef~mophilus, Lactobacillus casei,
Lactobacillus plantay~ujn, Lactobacillus acidophilus, Lactobacillus
delbruecltii subsp.
bulgaYicus, Bifzdobacterr.'a longufn, Bifidobacteria it fantis, and
Bifi~lobactet°ia brave
at a concentration of 5 x 1011 lyophilized bacteria/gram. VSL#3 (batch number
2034-
A2, VSL Pharmaceuticals, Gaithersburg, MD) was grown to a concentration of
approximately 2 x 1014 (as determined by colony counts) in phenol red-free
RPMI
1640 medium for 16 hours, then centrifuged at low speed in a tabletop Sorvall
34
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
centrifuge (3000 x g, 4°C, 10 minutes). The supernatant (conditioned
medium) was
then passed through a 0.22 micron low protein-binding filter (Millipore,
Bedford,
MA) to remove all bacterial cells and debris. Aliquots of conditioned medium
were
stored in sterile microcentrifuge tubes at -80°C until further use.
Tissue Culture
YAMC (young adult mouse colon) cells are a conditionally immortalized
mouse colonic intestinal epithelial cell line derived from the Immortimouse
that
express a transgene of a temperature-sensitive SV40 large T antigen (tsA58)
under
control of an interferon-gamma-sensitive portion of the MHC class II promoter
(Whitehead et al., 1993). YAMC cells were maintained under permissive
conditions
(33°C) in RPMI 1640 medium with 5% (vol/vol) fetal bovine serum, 5 U/ml
marine
IFN-y (GibcoBRL, Grand Island, NY), 50 ~.g/ml streptomycin, 50 U/ml
penicillin,
r supplemented with ITS+ Premix (BD Biosciences, Bedford, MA). Under non-
permissive (non-transformed) conditions at 37°C in the absence of IFN-
'y, these cells
undergo differentiation and develop mature epithelial cell functions and
properties
including tight junction formation, polarity, microvillar apical membranes,
and
transport functions.
Cells were plated at a density of 2 x 105 per 60 mm tissue culture dish (for
Western blot analysis and proteasome assays), or at 1 x 105 per well in 6-well
plates
(for NF-7cB luciferase transfection experiments). After 24 hours of growth at
33°C to
allow for cell attachment, the medium was replaced with IFN-free medium and
cells
were moved to 37°C (non-permissive conditions) for 24 hours to allow
the
development of the differentiated colonocyte phenotype for all experiments.
Cells
were treated with VSL#3-conditioned medium (1:10 dilution) overnight, and then
used the following day in various experiments. For NF-xB luciferase reporter
assays,
marine TNF-a (Peprotech, Rocky Hill, NJ) at a concentration of 50 ng/ml was
added
directly to the cells at this time and left for 6 hours before harvest. Heat
shock
controls were exposed to 42°C for 23 minutes and allowed to recover at
37°C for 2
hours before harvest. MG132-treated control cells were treated for 2 hours
with
25~M MG132 (Biomol, Plymouth Mtg, PA) at 37°C prior to harvest unless
otherwise
specified.
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
Two other cell lines, MSIE (a small intestine YAMC counterpart cell line) and
3T3 fibroblasts, were used in this study and maintained as previously
described
(Kojima, 2003), incorporated herein by reference.
Preparation of Cell Lysates
Cells were washed twice and then scraped in ice-cold HBS (150 mM NaCI, 5
mM KCI, 10 mM HEPES, pH 7.4). Cells were pelleted (14,000 x g for 20 seconds
at
room temperature), then resuspended in ice-cold lysis buffer.(10 mM Tris, pH
7.4, 5
mM MgCl2, 50 Ulml DNAse and RNAse, plus complete protease inhibitor cocktail
(Ruche Molecular Biochemicals, Indianapolis, IN)). Protein concentrations were
determined using the bicinchoninic acid procedure (Smith, 1985). For
proteasome
assays, samples were stored immediately at -80°C until use. For Western
blots,
samples were heated to 75°C for 5 minutes after addition of 3X Laemmli
Stop buffer,
then stored at -80°C until use.
Western Slot Analysis
1 ~ Twenty micrograms of protein per lane were resolved on 12.5% SDS-PAGE
and transferred in 1 X Towbin buffer (composition 25 mM Tris, 192. mM glycine;
pH
8.8, 15°/° vol/vol methanol) onto PVDF membranes (Polyscreen,
Perkin-Elmer NE:N,
Boston, MA) as previously described (Kojima, 2003), incorporated herein by
reference. Membranes were blocked in 5% (wt/vol) non-fat ri~ilk in TBS-T'ween
(Tris-buffered saline (150 mM NaCI, 5 mM KCI, 10 mM Tris, pH 7.4) with 0.05%
(vol/vol) Tween 20) for one hour at room temperature. For anti-ubiquitin
blots,
membranes were blocked in 3% bovine serum albumin (Fisher, Pittsburgh, PA).
Primary antibody was added to TBS-Tween and incubated overnight at 4°C
with a
specific anti-Hsp 25 antibody (SPA 801, Stressgen, Victoria, BC, Canada), anti-
Hsp
72 antibody (SPA 810, Stressgen), anti-Hsc 73 antibody (SPA 815, Stressgen),
anti-
IxB-a antibody (sc-1643, Santa Cruz Biotechnology, Santa Cruz, CA), anti-
phospho
hcB-a antibody (sc-8404, Santa Cruz), or anti-ubiquitin antibody (PW 8810,
Affiniti
Research Products Ltd, Exeter, U.K.). Blots were then washed in TBS-Tween five
times for 10 minutes each at room temperature before incubation with
peroxidase-
conjugated secondary antibodies (Jackson Tmmunoresearch Labs, Inc. Fort
Washington, PA) for 1 hour at room temperature. Membranes were then washed
(five
times, 10 minutes each) in TBS-Tween followed by a final wash in TBS (no
Tween).
36
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
Blots were visualized with an enhanced chemiluminescence system ECL reagent
(Supersignal, Pierce, Rockford, IL) and developed as per the manufacturer's
instructions.
Statistical Analysis
The luciferase assays were performed in triplicate and the proteasome assays
were performed in duplicate for each experiment. All experiments were repeated
a
minimum of three to six times each. All numerical values are expressed as mean
+/-
standard error of the mean unless otherwise indicated. Where multiple
comparisons
were made, ANOVA analysis using a Bonferroni's correction was used to assess
significance of differences between groups. P<0.05 was considered
statistically
significant. .
EXAMPLE 2
Probiotics Inhibit NF-mB Activation in Intestinal Epithelial Cells
To determine whether the bacteria in VSL#3 secrete factors possessing anti-
inflammatory activity, the effects of VSL#3-conditioned media (VSL#3-CM) on
the
NF-~cB pathway were investigated. The ability of VSL#3-CM to block
transcriptional
activity of NF-oB in intact epithelial cells stimulated by TNF-a was tested
using an
NF-~cB luciferase reporter assay.
NF-~cB luciferase assays were performed using the Promega Dual Luciferase
Reporter 1000 Assay System (Promega, Madison, WI) and plasmids were
transfected
using TransIT LT-1 transfection reagent (Minis, Madison WI) as per the
manufacturer's instructions. Briefly, 2 ~.g of NF-KB response element-driven
firefly
luciferase reporter plasmid (Clontech, Palo Alto, CA) and 0.2 ~,g Thymidine
Kinase
(TK) promoter-driven Renilla reporter plasmid (Promega, Madison WI) were mixed
with LT-1 polyamine transfection reagent. After formation of complexes, the
solution
was added to YAMC cells at 33°C and allowed to incubate overnight.
Cells were
then placed at 37°C in IFN-y-free medium. After cells were grown in non-
permissive
(non-transformed) conditions, VSL#3-conditioned medium (VSL#3-CM) was added
to each well at a dilution of 1:10 and left overnight, unless otherwise
specified.
Murine TNF-a was added at 50 ng/ml the next morning and cells were harvested 6
hours later. NF-~cB luciferase assays were performed as per the manufacturer's
37
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
instructions and luminescence measured in a Berthold Luminometer (Oakridge,
TN).
Co-transfection with TK-Renilla, which displays constitutive low levels of
activity, is
used as an internal control against which to normalize the NF-~cB luciferase
data.
Experiments were performed in triplicate.
Young adult mouse colon cells transiently transfected with the reporter gene
expressed a low level of baseline NF-oB activity, which increased upon
stimulation
with TNF-a, as reflected by an increase in luciferase activity (FIGS. 1 and
14).
Pretreatment with VSL#3-CM for 16 hours resulted in the attenuation of TNF-a-
induced NF-xB activity in epithelial cells by 45% compared to TNF-a treatment
alone
(FIG. 14, 1.80 +/- 0.41 for VSL#3-CM-treated cells vs. 3.25 +/- 0.41 with TNF-
a
alone, p<0.05). This effect was specific to VSL#3-CM, as pretreatment of
epithelial
cells with conditioned medium from the E. coli strain DHSa did not attenuate
TNF-a-
induced NF-oB activation (FIG. l, column 4; FIG. 14, column 5). Although not
wishing to be bound by any theoretical implications of studies into the
mechanisms)
underlying the influence of VSL#3-conditioned medium on :rNF-a-induced. NF-~cB
activation, both electrophoretic mobility shift assay and E~,ISA analyses did
not show
a significant impact of VSL .#3-CM on the binding of nuclear NF-xB (p65
subunit).
EXAMPLE 3
Probiotic-conditioned Medium Inhibits MCP-1 Release
Probiotics decrease release of Monocy-te Chemoattractant Protein 1 (MCP-1)
in response to NF-KB stimulation by TNF-a. MCP-1 is an endogenous immune
response gene that has been implicated in the pathogenesis of many
inflammatory, ,
. diseases such as multiple sclerosis, rheumatoid arthritis, and IF3D. Like IL-
8, studies
have shown that MCP-1 is highly expressed in areas of active inflammation in
Crohn's disease and its expression depends on NF-FCB activation.
YAMC cells were grown and treated with VSL#3-CM and subsequently
treated with TNF-a, as described herein, to stimulate NF-~eB activation.
Supernatants
were harvested and tested for the production of MCP-1 using a mouse MCP-1
ELISA
kit (Pierce Endogen, Rockford, IL) as per the manufacturer's instructions to
measure
MCP-1 release from the cells. Treatment of intestinal epithelial cells with
VSL#3-
CM attenuated the release of MCP-1 in response to NF-~B stimulation by TNF-a
38
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
(FIG. 15,'column 4). No significant difference in MCP-1 release was noted in
cells
treated with VSL#3-CM alone compared to untreated control cells (compare FIG.
15,
columns 1 and 3).
Consistent with the results of Example 2, demonstration that VSL#3-CM
inhibits release of MCP-1 establishes a role for an isolated, anti-
inflammatory
compound derivable from VSL#3-CM in the prevention and/or treatment of
inflammatory disorders, such as IBD (e.g., Crohn's disease, ulcerative
colitis).
EXAMPLE 4
Probiotics Inhibit Degradation of the NF-xB Inhibitor ImB in Intestinal
Epithelial Cells
To determine which steps) in the pathway of NF-~~eB activation is the steps)
at which VSL#3-CM exerts its effects, the regulation of the NF-xB inhibitory
molecule, hcBa, was investigated. The effects of VSL#3-CM. on total I~cBa and
phosphorylated hcBa protein in YAMC cells treated with TNF-a were; examined.
Pretreatment with VSh#3-CM inhibits degradation. of the phosphorylated form of
IoBa in TNF-a -treated cells (FIG. 16, bottom taro panels or rows). In the
absence. of
VSL -#3 treatment, TNF-a stimulates phosphorylation of Ir.Ba within
~=minutes.,
followed by rapid degradation of IoBa at 15 and 30 minutes (F'IG. 16, top two
panels
or rows). Subsequently, NF-oB stimulates IKBa expression, shutting down
further
NF- oB activation (FIG. 16, see lane on top panel or row at 60 minutes). In
contrast, .
when intestinal epithelial cells are treated with VSL#3-CM prior to TNF-a
stimulation, phosphorylated IxBa is stabilized and resists degradation for
over 2 hours
(FIG. 16, lower bottom panel or row). F'urthennore, the amount of total IxBa
never
declines throughout the period of TNF-a stimulation, thus indicating that
VSL#3-CM
inhibits pathways of IKBa degradation normally associated with TNF-a
stimulation of
intestinal (gut) epithelial cells. While VSL#3-CM had some basal yet undefined
regulatory effect at the level of IxB phosphorylation as shown in FIG. 16
(lane 1), no
effect of VSL#3-CM alone was seen on MCP-1 secretion or z°elease by
YAMG cells
in the absence of TNF-a as shown in FIG. 2 (column 3).
The results are consistent with a view that VSL#3-CM inhibits NF-xB
activation by protecting IoBa (i.e., by inhibiting its degradation), but the
data obtained
to date has not established a single, integrated mechanism for the effect that
VSL#3-
39
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
CM has on NF-nB activation. The invention, however, is not dependent on any
particular mechanism of action and the scope of the appended claims should not
be
limited by any theoretical consideration of such mechanism(s).
EXAMPLE 5
Probiotics Do Not Inhibit Ubiquitination in Intestinal Epithelial Cells
The lack of hcBa degradation in response to TNF-a in VSL#3-CM-treated
cells indicates that the probiotic-CM interferes with one or more downstream
activation events, namely the steps of ubiquitination and/or proteasomal
degradation
of IKBa. A nonpathogenic strain of Salrraonella tvphimuriuna has been reported
to
inhibit degradation of IoBa through blockade of ubiquitination (Neish, 2000).
These
effects of Salmonella typlaimuriunz mayrepresent one method by which
gastrointestinal flora are able to modulate the immune system and thus live in
symbiosis with a eukaryotic host. To test whether a similar mechanism is
involved in
the inhibition ofNF-~cB by VSL#3-CM, immunoblot analyses using anti-ubiquitin
antibodies were performed on total cell protein from intestinal epithelial
cells treated
with VSL#3-CM (hIG. 3). In contrast to what might have been expected based on
the
ability of nonpathogenic S. typhirnu~ium to inhibit epithelial ubiquitin
ligase,
treatment of epithelial cells with VSL#3-CM does not result in a decrease of
ubiquitinated proteins compared to untreated cells. In fact, VSL#3-CM
treatment
actually results in accumulation of certain ubiquitinated proteins.
One mechanism by which this could occur is through inhibition of proteasome
function, which results in accumulation of undegraded, ubiquitinated proteins
(Voges,
1999). While not as dramatic as the effects of the proteasome inhibitor MG132,
the
amount and the pattern of increase in ubiquitinated proteins upon VSL#3-CM
treatment is similar to what is seen with thermal stress.
EXAMPLE 6
Probiotics Inhibit Proteasome Activity in Intestinal Epithelial Cells
Proteasome inhibitors which block NF-oB activation through inhibition of
hcBa degradation have already been described (Gao, 2000). Since probiotic
treatment
results in both attenuation of NF-~cB activity and inhibition of hcBa
degradation, the
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
effect of VSL#3-CM on proteasome activity, as measured by cleavage of the
SLLVY-
AMC substrate, was investigated (FIG. 17).
Proteasome activity from cell lysates was determined using a 20S Proteasome
assay kit (Calbiochem, San Diego, CA). Briefly, ice-cold cell lysate
containing 20~g
protein was added to proteasome assay reaction buffer (25 mM HEPES, 0.5 mM
EDTA, pH 7.6) activated with 0.03% (wtlvol) SDS. The sample was allowed to
come
to room temperature, then placed in a, quartz cuvette and 10~.M of the
substrate suc-
leu-leu-val-tyr-AMC (SLLVY~-AMC), Bz-vaI-gly-arg-AMC, or Z-leu-leu-glu-AMC
was added. The SLLVY-AMC substrate is cleaved by the chymotrypsin-like
activity
of the proteasome, the Bz-val-gly-arg-AMC substrate is cleaved by the trypsin-
like
activity of the proteasome, and the Z-leu-leu-glu-AMC substrate is cleaved by
the
PGPH, or caspase-like, activity of the proteasome. Proteasome activity was
determined by measuring the fluorogenic signal generated by cleavage of AMC (7-
amino-4-methylcoumarin) from the peptide moiety of the proteasome substrate.
Fluorescence (excitation at 380 nor, emission at 460 nor) was measured every
minute
for the first 10 minutes, then every 15 minutes thereafter in a Hitachi F-2000
fluorometer (Hitachi, Japan). Cells were treated with either MG 132 (2 S ~,M)
or
lactacystin (10~,M) as a positive inhibitor control. Untreated cells were
treated with
DMSO as a vehicle control for MG132 and lactacystin. Experiments were
performed
in triplicate. For each experiment, all time points were performed in
duplicate.
Extracts from cells treated with VSL#3-CM were compared with untreated
controls, cells treated with MG132 (a potent proteasome inhibitor), and DHSa
(E.
coli)-CM for proteasome activity. Epithelial cells treated with VSL#3-CM
displayed
markedly lower levels of proteasome activity as compared to untreated
controls, and
inhibition by VSL#3-CM was almost as pronounced as what was seen with the
synthetic proteasome inhibitor MG132. This effect is specific to VSL#3, as
DHSa -
CM (E. coli) does not exert any inhibitory effects on proteasome function.
The modest accumulation of ubiquitinated proteins upon VSL#3-CM
treatment relative to the accumulation in response to the known proteasome
inhibitor
MG132 is consistent with the fording that VSL#3-CM is less toxic than MG132.
Accordingly, an isolated, anti-inflammatory compound derivable from VSL#3-CM
is
expected to be more therapeutically acceptable than such known proteasome
inhibitors as MG132.
41
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
a. Time Course of Proteasome Activity Inhibition
A time course of VSL#3-CM treatment was performed in order to determine
the speed with which VSL#3-CM is able to elicit the proteasome inhibition
described
above. Cells were treated for 30 minutes, 60 minutes, and 6 hours, then
harvested and
assayed for their ability to inhibit the CTL-like activity of the proteasome
(FIG. 18).
It was found that the most pronounced proteasome inhibition occurs early after
probiotic treatment, with over 50% of the inhibition occurnng within the first
30
minutes, consistent with what is reported with other proteasome inhibitors.
This
indicates that proteasome inhibition by VSL#3-CM is an early event, occurnng
almost
immediately after exposure of the epithelial cells to the probiotic-
conditioned
medium. This finding, considered in view of the relative lack of toxicity of
VSL#3-
CM, indicates that an. isolated, anti-inflammatory compound derivable from
VSL#3-
CM would be a safe and quiclc-acting, i.e., an effective, prophylactic; and/or
therapeutic for inflammatory disorders such as IBD.
EXAMPLE 7
Probiotics Display Differential Inhibition of Proteasome Activities
In addition to its effects on the chymotrypsin-like activity of the proteasome
as
described herein, VSL#3-CM possesses some weak inhibitory activity against the
caspase-like proteolytic function of the proteasome and has no inhibitory
effect on its .
trypsin-like activity.
YAMC cells were treated with VSL#3-conditioned medium for 16 hours and
then harvested for proteasome assay. Proteasome activity was measured ire cell
lysates
using either the fluorogenic substrate Bz-Val-Gly-Arg-AMC, which measures the
trypsin-like protease activity (FIG. 13A), or the substrate Z-Leu-Leu-Glu-AMC,
which is cleaved by the PGPH, .or caspase-like, activity of the proteasome
(FIG. 13B).
As a positive inhibitor control, lactacystin was used at a concentration of 10
~.M.
Lactacystin inhibits both the trypsin-like and chymotrypsin-like activities
but is only a
wealc inhibitor of the caspase-like activity of the proteasome.
The results show that VSL#3-conditioned medium has no inhibitory effect on
the trypsin-like activity (FIG. 13A) and has only a weakly inhibitory effect
on the
caspase-like activity of gut epithelial proteasomes, about equivalent to 10 ~M
42
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
lactacystin (FIG. 13B). This indicates that VSL#3-CM does not globally inhibit
all
proteolytic functions of the proteasome, but rather displays some specificity
or
affinity for some functions.
Treatment with VSL#3-CM is well tolerated by the epithelial cells, which is
not the case with most of the synthetic proteasome inhibitors. The lower
toxicity of
VSL#3-CM may be due to its differential affinity, which likely allows some
normal
functioning of the proteasome to continue while the degradation of certain
proteins
such as IfcB is blocked. Without wishing to be bound by theory, this may in
part
explain why the pattern of accumulated ubiquitinated proteins is different inn
cells
treated with VSL#3 from what is observed with the more powerful and toxic
synthetic
inhibitors such as MG132.
EXAMPLE 8
Probiotics Induce Heat Shock Proteins in Intestinal Epithelial Cells
It has been shown that enteric flora (luminal bacteria of the colon) in the
gut
influence expression of epithelial heat shock proteins (Kojima; 2003; Beck,
1995).
Proteasome inhibitors are potent inducers of heat shock protein expression
through
activation of the heat shock transcription factor, HSF-1 (Pirkkala, 2000).
Accordingly, experiments were conducted to determine whether heat shock
protein
expression occurred concomitantly with proteasome inhibition.
YAMC cells were co-cultured with the probiotic VSL#3 to test its ability to
induce heat shock protein expression. By immunoblot analysis, VSL#3 was shown
to
induce Hsp25 and Hsp72 expression in YAMC cells beginning at 6 to 12 hours
(FIG.
19 panel A). Expression of the constituti~ely expressed heat shock protein
Hsc73,
serving as a loading control, was not affected by VSL#3. Untreated cells left
in
culture for 48 hours do not mount an Hsp response, demonstrating that the
effect is
specific to the probiotic treatment and not a time-dependent characteristic of
the cells
grown in culture.
Further, YAMC cells were either treated with VSL#3-CM (for times varying
from 15 minutes to 6 hours), or heat shocked as described herein. Whole cell
extracts
were prepared in lysis buffer (25% vol/vol glycerol, 420 mM NaCI, 1.5 mM MgCh,
0.2 mM EDTA, 0.5 mM DTT, 20 mM HEPES, pH 7.4, with the Complete Protease
43
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
Inhibitor Cocktail) by freezing once in a dry ice/alcohol bath, thawing on
ice, shearing
gently with a pipette tip, and centrifugation at 50,000 x g for 5 minutes at
4°C. Cell
extract containing ten micrograms protein was mixed with 32P-labeled HSE
oligonucleotide (containing four tandem inverted repeats of the heat shock
element
(nGAAn): CTAGAAGCTTCTAGAAGCTTCTAG (SEQ ID NO: 1)) and O.Swg poly
(dI-dC) in binding reaction buffer (final concentrations 20 mM Tris, pH 7.4,
100 mM
NaCl, 1 mM EDTA, 10% vol/vol glycerol). The binding reaction was allowed to
incubate for 25 minutes at 25°C and then analyzed on a 4% non-
denaturing
polyacrylamide gel run in O.SX TBE buffer. Gels were dried and
autoradiographed to
detect DNA-protein complexes. For supershift experiments, YAMC cells were
incubated with VSL#3-CM for 6 hours before harvest and 1 dug of specific
antibody to
either HSF-1 (SPA-950, Stressgen, Victoria, BC, Canada) or HSF-2 (sc-8062X,
Santa
Cruz Biotechnology, Santa Cruz, CA) were pre-incubated with cell extracts at
25°C
for 30 minutes prior to the HSE-binding reaction. After this preincubation,
the
binding reaction and analysis were performed as described above.
To determine whether the effects produced by the VSL#3 bacteria require
viable bacteria and direct physical contact (e.g.; as is necessary for type
III secretion
mechanisms) or are secreted products, VSL#3 was added to YAMC cells, as filter-
sterilized conditioned medium or sonicated bacterial pellets, in a
concentration-
dependent manner (FIG. 19 panel B). Although live grarrr-negative bacteria and
lipopolysaccharide (LPS), a cell wall component found only in gram-negative
bacteria, can induce Hsp expression in epithelial cells (Kojima, 2003), the
bacteria
which comprise VSL#3 are all gram-positive organisms and thus none of them
contain LPS. It was therefore of interest to discern whether any cell wall
components
of these gram-positive organisms possess Hsp-inducing potential. The Hsp
induction
produced by VSL#3 could be elicited in a dose-response fashion with the
conditioned
medium ("CM") alone, indicating that neither direct contact nor live bacteria
are
necessary to elicit this response. Sonicated organisms ("pellet") are unable
to induce
the heat shock response, indicating that the inducing factors are secreted
products and
not cell wall components.
Examination of two other cell lines revealed that the ability of probiotic-CM
to
induce Hsp72 expression is specific to epithelial cells (FIG. 19 panel C).
MSIE is a
murine small intestine epithelial cell line; these cells respond in a similar
fashion as
44
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
YAMC cells. In contrast, although 3T3 fibroblasts are able to mount a heat
shock
response to thermal stress, they do not respond to treatment with VSL#3-CM,
indicating that the effects of VSL#3-CM are specific to epithelial cell types.
Attempts
to induce heat shock protein expression in all of these cell lines using E.
coli DHScr,-
CM were unsuccessful.
In addition, it was determined that the probiotic compounds induce intestinal
epithelial heat shock proteins through apical (luminal) membrane-specific
processes
(see FIG. 6). When YAMC intestinal epithelial cells are grown on a permeable
support, they form tight junctions and exhibit a high degree of polarity.
Cells exposed
to conditioned medium from the luminal side demonstrate robust Hsp25 and Hsp72
protein expression. Basolateral addition fails to stimulate a response. When
added to
both sides, VSL#3-CM has a similar effect to what is seen when it is added
only to the
apical side. These data suggest the presence of specific receptors or entry
pathways
for the probiotic-derived bioactive factors or agents.
~ The proteasome inhibitor MG132 was then used to determine whether the time
curse of Hsp induction following proteasomal inhibition in epithelial cells
would
parallel the induction attributable to VSL#3-CM treatment. 'rreatrnent with
R~iGI32
results in a very strong induction of both Hsp25 and Hsp'72 that is mcrYe
robust than
thermal stress (FIG. 7). A. comparison of FIG. 7 with the time course of FIG.
19A
shows that the appearance of a signal by 7 to 14 hours more closely parallels
what is
seen with VSL#3-CM than the time course normally observed with thernal stress,
which induces Hsp expression by two hours in this cell line (K.ojima, 2003).
VSL#3-
CM acting through a mechanism of proteasome inhibition would be expected to
display a time course comparable to a known proteasome inhibitor such as MGI32
and not as comparable to a mere physical stress such as heat shock.
Unlike VSL#3-CM, which did not result in any change in viability compared
to untreated control cells even after 24 hours of treatment, prolonged
exposure of
YAMC cells to MG132 resulted in markedly increased cell death, suggesting that
MG132 is significantly more toxic than VSL#3-CM (FIG. 8).
a. Time Course of Heat Shock Protein Expression Induction
Probiotics induce heat shock proteins in intestinal epithelial cells: It has
been
shown that enteric flora (luminal bacteria of the colon) in the gut influence
expression
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
of epithelial heat shock proteins. Proteasome inhibitors are potent inducers
of heat
shock protein expression through activation of the heat shock transcription
factor,
HSF-1. Based on these observations, corroboration of the above findings was
sought
by determining whether induction of heat shock protein expression occurred.
YAMC
cells were co-cultured with the probiotic VSL#3 to test its ability to induce
heat shock
protein expression. By immunoblot analysis, VSL#3 was shown to induce Hsp25
and
Hsp72 expression in YAMC cells beginning at 6 to 12 hours (FIG. 5 panel A).
Expression of the constitutively expressed heat shock protein Hsc73, serving
as a .
loading control, was not affected by VSL#3. Untreated cells left in culture
for 48
hours do not mount an Hsp response, demonstrating that the effect is specific
to the
probiotic treatment and not a time-dependent characteristic of the cells grown
in
culture.
To determine whether the effects produced by the VSL#3 bacteria require
viable bacteria and direct physical contact (e.g., as is necessary for type
III secretion
15, mechanisms) or are secreted bacterial products, VSL#3 was added to YAMC
cells, as
filter-sterilized conditioned medium or sonicated bacterial pellets, in a.
concentration-
dependent.manner (FIG. 5 panel B). .hlthough live gram-negative bacteria and.
lipopolysaccharide (LPS), a cell wall component found only in gram-negative .
bacteria, can induce Hsp expression in epithelial cells, the bacteria which
comprise
VSL#3 are all gram-positive organisms and, thus, lack LPS. It was therefore of
interest to discern whether any cell wall components of these gram-positive
organisms
possess Hsp-inducing potential. The Hsp induction produced by VSL#3 could be .
elicited in a dose-response fashion with the conditioned medium ("CM") alone,
indicating that neither direct contact nor the presence of live bacteria are
necessary to
elicit this response. Sonicated organisms ("pellet") are unable to induce the
heat
shock response, leading to the expectation that the inducing factors are
secreted
products and not cell wall components. Examination of two other cell lines
revealed
that the ability of probiotic-CM to induce Hsp72 expression is specific to
epithelial
cells (FIG. 5 panel C). MSIE is a murine small intestine epithelial cell line;
these
cells respond in a fashion similar to YAMC cells. In contrast, although 3T3
fibroblasts are able mount a heat shock response to thermal stress, they do
not respond
to treatment with VSL#3-CM. Thus, it is expected that the effects of VSL#3-CM
are
46
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
specific to epithelial cell types. Attempts to induce heat shock protein
expression in
aII of these cell lines using E. coli DHSa -CM were unsuccessful.
The data establish that a compound derivable from VSL#3-CM exhibits a
cytoprotective function by inducing the expression of heat shock proteins, in
addition
to exhibiting an anti-inflammatory function. Accordingly, the invention
contemplates
an isolated, anti-inflammatory, cytoprotective compound derivable from VSL#3-
CM,
related compositions such as pharmaceutical compositions and kits comprising
the
compound(s), as well as methods of producing the compounds) and methods of
using
the compounds) to prevent or treat an inflammatory disorder such as IBD or to
I O ameliorate a symptom of such a disorder.
b. Hsp Expression Induction is Mediated by HSF-1 Activation
Electrophoretic mobility shift assays were performed to determine whether or
not the induction of Hsp expression by VSL#3-CM was transcriptional in nature.
From FIG. 20 it can be seen that VSL#3-CM induces binding of the heat shock
transcription factor HSF, reaching a maximal binding signal around 4 or 5
hours after
exposure and then tapering off after 6 hours (panel A). Specificity of this
binding was
confirmed using antibodies against the transcription factors HSF-1 and HSF'-2
(panel
B), which demonstrates that the major transcription factor involved in Hsp
induction
by VSL#3-CM is HSF-1; HSF-2 does not appear to play a role. The time course of
Hsp induction by the proteasome inhibitor MG132 is similar to that produced by
probiotics, but MG132 is more toxic. As the proteasome time course data
indicated
that VSL#3-CM acted quickly like other proteasome inhibitors such as MG132
(see
FIG. 18), we determined, using MG132, whether the time course of Hsp induction
following proteasomal inhibition in epithelial cells would parallel the same
kinetics as
observed with VSL#3-CM treatment. Treatment with MG132 resulted in a very
strong induction of both Hsp25 and Hsp72 and the induction was more robust
than
that resulting from thermal stress (FIG. 7). A comparison of FIG. 7 with the
time
course of FIG. 19A shows that the appearance of a signal by 7 to 14 hours more
closely parallels what is seen with VSL#3 than the time course normally
observed
with thermal stress, which induces Hsp expression by two hours in this cell
line. If
VSL#3-CM were acting through a mechanism of proteasome inhibition, it would
display a time course more comparable to a known proteasome inhibitor such as
MG132 and less similar to a mere physical stress such as heat shock. Unlike
VSL#3,
47
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
which did not result in any change in viability compared to untreated control
cells
even after 24 hours of treatment, prolonged exposure of YAMC cells to MG132
resulted in markedly increased cell death, suggesting that MG132 is
significantly
more toxic than VSL#3-CM.
EXAMPLE 9
Probiotics Protect Intestinal Epithelial Cells Against Oxidant Stress
To determine whether VSL#3-CM protects gut epithelial cells from injury, the
oxidant monochloramine (NH2C11 was used. Monochloramine is a
pathophysiologically relevant oxidant produced in large quantities when
hypochlorous
acid, released from innate immune cells within inflamed tissues, reacts with
ammonia
in vivo. Once formed, monochloramine causes loss of tight junction barrier
function,
mitochondrial injury, cytoskeletal disruption, impaired membrane transport
functions,
and eventual cell death. Cells were treated with VSL#3-CM awernight and, after
exposure to monochloramirie, cell viability was assessed using S~Cr release
(FIG. 21,
panel A).
YAMC cells were grown in 24-well plates and either left untreated (contral),
or treated with VSL#3-CM overnight. Cells were loaded with SICr (50 ~Ci/ml;
Sigma
Chemical Co.; 250 ~.l/well in a 24-well plate format, or 12.5 ~,Ci per well)
for 60
minutes, washed, and incubated in medium with 0.6 mM of the oxidant
monochloramine to induce cell injury. Medium was harvested after 60 minutes
and
the 5'Cr remaining in the cells extracted with lI'~T HN03 for 4.hours. S~Cr in
the
released and cellular fractions was counted by liquid scintillation
spectroscopy. SICr
released was calculated as amount released divided by released plus cellular
remainder.
At 0.6 mM NH2C1, VSL#3-CM pretreatment results in a mild but statistically
significant protective effect, decreasing the NH2Cl-stimulated SICr release
and
improving epithelial cell viability in the facie of oxidant injury by about
one-third
compared to control cells treated with monochloramine alone (P< 0.05).
As another functional readout, the ability of VSL#3-CM treatment to protect
epithelial cells against cytoskeletal damage from oxidant stress was
determined using
F/G actin assays. Filamentous actin (F-actin) carries out important functions
involved
48
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
in the maintenance of cellular scaffolding and shape, as well as acting as an
anchoring
point for numerous integral membrane proteins. Neveutheless, the actin
cytoskeleton
is particularly vulnerable to injury which can result in cellular compromise.
Exposure
to monochloramine causes rapid dissociation of filamentous actin. Hence, we
determined whether VSL#3-CM treatment would protect the integrity of
cytoskeletal
filamentous actin in the face of oxidant stress.
F/G actin assays were conducted by initially shifting confluent YAMC cell
monolayers to 37°C in IFN-y'-free medium and treating with VSL#3-CM
overnight.
Prior to assessment, cells were treated with phalloidin (30~.g/ml for 2 hours;
Molecular probes, Eugene, OR), cytochalasin D (10~,g/ml for 15 min), or the
oxidant
monochloramine (0.6 mM for 30 minutes). Cells were rinsed in PBS, harvested,
centrifuged (14,000 x g for 20 seconds at room temperature) and the pellets
resuspended in 2001 of 30°C lysis buffer (1 mM ATP, 50 mM PIPES, pH
6.9, 50
mM NaCI, 5 mM MgCl2, 5 mM EGTA, 5% (vol/vol) glycerol, 0.1% (vol/vol) Nonidet
P-40, Tween 20, and Triton X-100, containing complete protease inhibitor
cocktail).
Cells were homogenized by gently pipetting up and down ten times and.
incubated at
30°C for 1'0 minutes. Samples were centrifuged at 100,000 x g for 60
minutes at
30°C and the supernatants were removed for determination of G actin
content. Pellets
containing F-actin were resuspended in 200,1 of 4°C distilled water
with 1 ~.M
cytochalasin D and left on ice for 60 minutes. Then, 20.1 of each extraction
was
removed, 6~13X Laemmli stop solution was added and the samples were heated to
65°C for 10 minutes. Samples were resolved by 12.5% SDS-PAGE and
immediately
transferred to PVDF membranes. After transfer, analysis of actin was performed
using a polyclonal anti-actin antiserum by Western blotting (Cytoskeleton,
Denver,
CO). Since the F-actin fraction has been depolymerized, only the monomeric 45
kDa
form is observed on the Western blots.
Monochloramine treatment alone (0.6 mM) causes a disruption of F-actin
filaments, as demonstrated by a decrease in F-actin and an increase in G-actin
(FIG.
21, panel B). By itself, VSL#3-CM has little effect on the F/G actin
distribution.
However, YAMC cells pretreated with VSL#3-CM prior to NH2Cl exposure
demonstrated significantly less change in the F/G actin distribution, again
indicating
that this probiotic provides some protection against oxidant injury. As
positive and
negative controls, phalloidin, (which binds and stabilizes the barbed ends of
F-actin
49
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
filaments, thus increasing the amount of F-actin) and cytochalasin D (an F-
actin
disrupting agent which greatly increases the amount of globular (G) actin)
were used
(panel B).
The results of the experiment disclosed in this example are consistent with
VSL#3-CM exhibiting reduced toxicity relative to known proteasome inhibitors
such
as MG132, and also are consistent with the disclosure herein that VSL#3-CM
induces
the expression of at least one heat shock protein in epithelial cells, in
establishing a
cytoprotective role for at least one compound derivable from VSL#3-CM.
EXAMPLE 10
Properties of Bioactive Probiotic Agents
As shown in FIG. 9, the majority of bioactivity found in, or derived from,
VSL#3-CM appears to reside in fractions that are less than 10 kDa. Fractions
were
prepared through Centricon filters with specific molecular v~~eight cutoffs.
Another property of the bioactivity of the VSL#3-CM is its pH-sensitivity
(F IG. l 0). T he pH of conditioned medium prior to addition to the apical
side of
YA.MC cells (which results in a 1:10 dilution) is critical. This ultimately
affects the
final pH of the bathing medium, lowering it to between 6.5 and 7Ø The data,
therefore, indicate that any active probiotic protein factors are more active
in the acid
microclimate that exists in the unstirred water layer above the luminal
membrane of
intestinal epithelial cells where pH ranges between 6.5-7Ø
Additionally, the bioactive agents) in VSL#3-CM were subjected to protease
assay by exposure of VSL#3-CM to pepsin using a standard protocol known in the
art. The results revealed that pepsin did not affect the bioactivity of VSL#3-
CM,
indicating that the bioactive agents) were not peptides or proteins
susceptible to
pepsin digestion. It is expected that the bioactive agents) are non-
proteinaceous
compounds, such as non-polar compounds like organic acids; of course, the
bioactive
agents) could be peptides, such as relatively small peptides, that are
refractory to
pepsin digestion or that retain an active peptide fragment following exposure
to
pepsin.
The proteasome inhibitors in VSL#3 may be small organic molecules. Some
proteasome inhibitors found in nature are small molecular weight organic
esters or
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
organic acid derivatives, such as those in green tea. ~1n ether extraction of
the
VSL#3-CM was undertaken to determine if bioactive factors could be
concentrated to
produce a more consistent and robust response. As shown in FIG. 11, the
effects of
ether-extracted compounds (EEC) and MG132 on NF-~cB activity were determined
using an NF-oB ELISA assay (Active Motif). TNF-a stimulation (30 ng/ml) alone
caused a significant increase in NF-oB activation (second bar from left). Both
MG132 and EEC significantly inhibited TNF-a-stimulated NF- xB activity (third
and
fourth bars from left). In contrast, the remaining aqueous phase following
separation
from the ether fraction was devoid of activity (far right bar).
'To determine if EEC directly inhibit proteasomal function, the ifs vitro
activity
of the 20S proteasomal component (barrel) provided by the commercial
proteasomal
assay (Calbiochem) was examined in the presence and absence of EEC from VSL#3
and E. coli (DHSa). As shown in FIG. 12, proteasomal function was unaffected
by
EEC from DHSa (compare slopes). In contrast, there was significant inhibition
of ih
vitro proteasomal activity by EEC from VSL#3 and by MG132. These data support.
the expectation that VSL#3 EEC enter the cell intact through a specific apical
membrane process, subsequently acting directly on cellular proteasomal
function
All of the compositions and methods disclosed and claimed herein can be
made and executed without undue experimentation in light of the present
disclosure.
While the compositions and methods of this invention have been described in
terms of
preferred embodiments, it will be apparent to those of skill in the art that
variations
may be applied to the compositions and methods and in the steps or in the
sequence of
steps of the methods described herein without departing from the concept,
spirit and
scope of the invention. More specifically, it will be apparent that certain
agents which
are both chemically and physiologically related may be substituted for the
agents
described herein with the same or similar results being achieved. All such
similar
substitutes and modifications apparent to those skilled in the art are deemed
to be
within the spirit, scope and concept of the invention as defined by the
appended
claims.
51
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
REFERENCES
The following references, to the extent that they provide exemplary procedural
or other details supplementary to those set forth herein, are specifically
incorporated
herein by reference.
Annuk et al., J. Appl. Microbiol., 94:403-412, 2003..
Arvola et al., Pediatrics, 104:e64, 1999.
Beck, Shock, 3:398-402, 1995.
Besnard et al., Gut, 43(5):634-638, 1998.
Boone et al., Inflamm. Bowel Dis., 8:201-212, 2002.
Braude and Siemienski, J. Clin. Invest., 47:1763-1773, 1968.
Campierei et al., Gastroenterology, 118:A4179, 2000.
Chang, In: Inflammatory Bowel Diseases, Kirsner (Ed.), Philadelphia, W. B.
Saunders Company, 3-19, 1999.
Cleveland et al., Int. J. Food Microbiol., 71:1-20, 2001.
Gao, .1. Clin. Invest,. 106:439-448, 2000.
Gionchetti et al., Gastroenterology, 119:305-309, 2000b.
Gionchetti et al., Gastroenterology, 124:1202-1209, 2003.
Gionchetti et al., J. Gastroenterol. Hepatol., 15:489-493, 2000a.
Isolauri et al., Pediatrics, 88:90-97. 1001.
Jobin and Sartor, Inflamm. Bowel Dis., 6:206-213, 2000.
Kisselev and Goldberg, Chem. & Biol., 8:739-758, 2001.
Kojima, Gastroenterology, 124:1395-1407, 2003.
Kullisaar et al., Int. J. Food Microbiol., 72:215-224, 2002.
Lee and Goldberg, Mol. Cell. Biol., 18:30-38, 1998.
Lee et al., Appl. Environ. Microbiol., 66:3692-3697, 2000.
Lee et al., J. Med. Microbiol., 52:925-930, 2003.
Leiper et al., Baillieres Clin. Gastroenterol., 12(1):179-99, 1998.
Liu et al., Am. J. PhysioL, 284:C1073-1082, 2003.
52
CA 02558618 2006-09-O1
WO 2005/077389 PCT/US2005/003765
Maassen et al., Vaccine, 18:2613-2623, 2004.
Madsen et aL, Gastroenterology, 121:580-591, 2001.
Majamaa et al., J. Pediatr. Gastroenterol. Nutx., 20:333-338, 1995.
Makowiec et al., Z. Gastroenterol., 36(8):619-24, 1998.
Musch et al., Am. J. Physiol., 270:C429-436, 1996.
Musch et al., Gastroenterology, 117:115-122, 1999.
Myung et al., Med. Res. Rev., 21(4):245-273 (2001).
Neish, Science, 289:1560-1563, 2000.
Neurath et al., Ann. NY Acad. Sci., 859:149-159, 1998.
Neurath et a.L, Gut, 43:856-860, 1998.
Neurath et al., Nat. Med., 2:998-1004, 1996.
Niedzielin et al., Eur. J. Gastroenterol. Hepatol., 13:1143-1147, 2001.
Ocana et al., Curr. Microbiol., 38:279-284, 1999.
Paraje et al., New Microbiol., 23:423-43 J , 2000.
Parsell and Lindquist, Annu. Rev. Genet., 27:437-496, 1993.
Pirlikala, Mol. Cell Biol., 20:2670-2675, 2000.
Podolsky, N. Engl. J. Med., 347:417-429, 2002.
Rernington's Pharmaceutical Sciences, 15th ed., pages 1035-1038 and 1570-1580,
Mack Publishing Company, Easton, PA, 1980.
Ropeleslci et al., Gastroenterology, 124:1358-1368, 2003.
Schmid and Adler, Gastroenterology, 118:1208-1228, 2000.
Schmitz et a.1., Gastroenterology, 116:301-309, 1999.
Smith, Anal. Biochem., 150:76-85, 1985.
Urayama et al., J. Clin. Invest., 102:1864-1865, 1998.
Voges, Annu. Rev. Biochem., 68:1015-1068, 1999.
Whitehead et aL, Proc. Natl. Acad. Sci. USA, 90:587-591, 1993.
Wollowshi et al., Amer. J. Clinical Nutrition, 73:4515-455S, 2001.
53
DEMANDES OU BREVETS VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVETS
COMPRI~:ND PLUS D'UN TOME.
CECI EST L,E TOME 1 DE 2
NOTE: Pour les tomes additionels, veillez contacter 1e Bureau Canadien des
Brevets.
JUMBO APPLICATIONS / PATENTS
THIS SECTION OF THE APPLICATION / PATENT CONTAINS MORE
THAN ONE VOLUME.
THIS IS VOLUME 1 OF 2
NOTE: For additional valumes please contact the Canadian Patent Office.
