Note: Descriptions are shown in the official language in which they were submitted.
DEMANDES OU BREVETS VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVETS
COMPREND PLUS D'UN TOME.
CECI EST LE TOME 1 DE 2
NOTE: Pour les tomes additionels, veillez contacter le Bureau Canadien des
Brevets.
JUMBO APPLICATIONS / PATENTS
THIS SECTION OF THE APPLICATION / PATENT CONTAINS MORE
THAN ONE VOLUME.
THIS IS VOLUME 1 OF 2
NOTE: For additional volumes please contact the Canadian Patent Office.
CA 02561696 2006-09-28
-1-
NOVEL MODIFIED GALECTIN 9 PROTEINS AND USE THEREOF
FIELD OF THE INVENTION
The present invention relates to novel modified
galectin 9 proteins (galectin-9 muteins) and applications
thereof. Particularly, the present invention relates to
functional mutant galectin 9 proteins wherein said
functional mutant galectin 9 protein has a modified link
peptide region, and their practical applications in
biochemistry, medical diagnostics, therapy and pharmacology.
BACKGROUND OF THE INVENTION
Evidence indicating the following fact has been
found: specific saccharide chains and proteins that bind to
the same play a lot of various roles and functions in
physiological phenomena, events associated with
development/growth, and a variety of diseases in mammal's
living bodies. It has been found that there are animal
lectins, in living bodies, which specifically recognize
saccharide chains with 13-galactoside structure. Until now
at least 14 types of genes have been identified for
galectins which belong to the group of such lectins.
Although the galectin family is classified, based on their
structure, into three subgroups, i.e., prototype, chimera,
and tandem repeat groups, the in vivo functions have
scarcely been disclosed. Particularly, a study on tandem
repeat type galectins retaining two carbohydrate
recognition domains has only a short history. Since in
vivo saccharide chains (receptors) to be targeted are still
not revealed, the functions are not yet clarified. From
details including how galectins were found when a search
was made for proteins which recognize complicated sugar
CA 02561696 2006-09-28
- 2 -
chains on the surface of cells, it is forecasted that
they have functions such as involvement in cell adhesion,
cell-to-cell communication, cell activation, etc.
Therefore, galectins attract attention. In addition,
research results anticipating the following are being
obtained: the galectins retain, besides such functions, a
variety of other important functions.
Galectin 9, one of tandem repeat type galectins,
was first identified as an autoantigen in patients with
Hodgkin's disease (Non-Patent Documents 1 & 2), and
surmised to play an important role on cell-to-cell
interactions among immune cells. Mouse galectin 9 was
cloned from the mouse kidney cDNA library by 5'-RACE PCR
with degenerated primers which were designed on the basis
of sequences considered to be highly conservative among the
carbohydrate recognition domains of galectins (Non-Patent
Document 3). It has been found that antigen-stimulated T
cells produce in vivo and in vitro an eosinophil
chemoattractant, i.e., ecalectin.
Further, although ecalectin is structurally
different from other eosinophil chemoattractants known up
to that time, it has sugar-binding affinity to 0-
galactoside saccharide chains, whereby it may be classified
into the galectin family. Cloning of ecalectin has been a
success from mRNA obtained from human T cell-derived
leukemia cell lines. As a result, it has been verified
that ecalectin is one of galectin 9 variants, and galectin
9 and ecalectin are identical substances (Non-Patent
Document 4).
It has been reported at present that wild type
galectin 9 includes L-type galectin 9 (galectin-9 long
isoform or long type galectin-9: Gal-9L), M-type galectin 9
(galectin-9 medium isoform or medium type galectin-9: Gal-
and S-type galectin 9 (galectin-9 short isoform or
short type galectin-9: Gal-9S). Any of galectin 9 members
is a molecule consisting of two carbohydrate recognition
CA 02561696 2006-09-28
- 3 -
domains (CRDs) and a linker peptide that is a link region
between two CRDs. L-type galectin 9 is a molecule with the
longest link peptide region wherein the N-terminal domain
(NCRD) is linked to the C-terminal domain (CCRD) with the
aid of said link peptide region while S-type galectin 9 is
a molecule with the shortest link peptide region. M-type
galectin 9 is a molecule with a middle-length link peptide
region as compared to both, and it has been known that Gal-
9M is generally found to predominantly exist in body tissue
and cells in contrast with the former two. In addition, it
is perceivable that there is some evidence indicating the
presence of genetic polymorphism among galectin 9 genes
cloned from human cells and tissue.
Wild type galectin 9 consists of two carbohydrate
recognition domains (CRDs) and a link region that is a link
between said CRDs. It has been suggested that recombinant
galectin 9, produced in host E. coli, induces inhibition of
cancer metastasis and regression of cancers by direct
actions on tumor cells (activity of inducing intercellular
adhesion and apoptosis of tumor cells) and actions via the
immune system. It has been revealed that galectin 9 does
not act on non-activated lymphocytes while it induces
apoptosis of activated lymphocytes, inter alia CD4-positive
T cells which will cause hyperimmune reaction. It is also
disclosed that galectin 9 has a potent apoptosis-inducing
property of acting on synovial cells involved in deformity
of joints or other symptoms under rheumatism.
[Non-Patent Document 1] Sahin, U. et al., Proc. Natl. Acad.
Sci. USA, 92, 11810-11813 (1995)
[Non-Patent Document 2] TOreci, 0. et al., J. Biol. Chem.,
272(10), 6416-6422 (1997)
[Non-Patent Document 3] Wada, J. et al., J. Biol. Chem.,
272(9), 6078-6086 (1997)
[Non-Patent Document 4] Matsumoto, R. et al., J. Biol.
CA 02561696 2006-09-28
- 4 -
Chem . , 273(27), 16976-16984 (1998)
SUMMARY OF THE INVENTION
Utilization of such versatile properties
possessed by galectin 9 is expected to promise therapeutic
techniques for cancers, refractory autoimmune diseases
(including rheumatism), allergic disorders, and others.
However, recombinant galectin 9 (rGal 9) has a link area
susceptible to protease wherein said link area connects two
CRDs, and is therefore readily digestible with proteolytic
enzymes. The proteolytic cleavage of rGal 9 will result in
loss of the aforementioned activity.
The present inventors have conducted an extensive
research on various molecules in order to solve the above
problems. As a result, the present inventors have
succeeded in producing novel molecules having a more stable
molecular structure against the action of protease while
the carbohydrate recognizing activity of wild type galectin
9 is retained. The present inventors have succeeded in
constructing highly stabilized modified molecules without
adversely affecting the aforementioned activity wherein
said molecule has an altered Gal 9 link area that links two
CRDs of Gal 9. Therefore, the present invention has been
achieved.
The present invention provides the following:
(1) A protein, or a salt thereof, comprising a
functional mutant galectin 9 protein with an amino acid
sequence that differs from an amino acid sequence of wild
type galectin 9 or a protein with substantially equivalent
galectin 9 activity wherein said functional mutant galectin
CA 02561696 2006-09-28
-5-
9 protein has a modified link peptide or a modified site or
region in the neighborhood of the galectin 9 link peptide.
(2) The protein, or a salt thereof, according to the
above (1), wherein said functional mutant galectin 9
protein has not only a modified sequence that differs from
an amino acid sequence of wild type galectin 9 or a protein
with substantially equivalent galectin 9 activity by the
deletion, substitution or addition of at least one or more
amino acid residues at a link peptide or a site or region
in the neighborhood of the galectin 9 link peptide but also
altered susceptibility to degradation of said galectin 9
link peptide as compared to wild type galectin 9.
(3) The protein, or a salt thereof, according to the
above (1) or (2), wherein said protein with substantially
equivalent galectin 9 activity is at least 70% or more
homologous to wild type galectin 9 at an amino acid level.
(4) The protein, or a salt thereof, according to any
of the above (1) to (3), wherein
[1] the N-terminal carbohydrate recognition domain
(NCRD) of wild type galectin 9 or a polypeptide with
substantially equivalent galectin 9 NCRD activity
is coupled with
[2] the C-terminal carbohydrate recognition domain
(CCRD) of wild type galectin 9 or a polypeptide with
substantially equivalent galectin 9 CCRD activity
via
[3] a modified link peptide with an amino acid sequence
that differs from an amino acid sequence of wild type
galectin 9 link peptide by the deletion, substitution or
addition of at least one or more amino acid residues at a
galectin 9 link peptide region.
(5) The protein, or a salt thereof, according to any
of the above (1) to (4), wherein
=
CA 02561696 2006-09-28
- 6 -
[1] a member selected from the group consisting of a
polypeptide having an amino acid sequence of SEQ ID NO: 3,
a polypeptide having not only substantially equivalent SEQ
ID NO: 3 polypeptide activity but also an amino acid
sequence at least 70% homologous to SEQ ID NO: 3, and a
polypeptide having a mutant amino acid sequence that
differs from an amino acid sequence of SEQ ID NO: 3 by the
deletion, substitution or addition of at least 1 to 8 amino
acid residues on the SEQ ID NO: 3 amino acid sequence
is coupled with
(2] a member selected from the group consisting of a
polypeptide having an amino acid sequence of SEQ ID NO: 4,
a polypeptide having not only substantially equivalent SEQ
ID NO: 4 polypeptide activity but also an amino acid
sequence at least 70-Q, homologous to SEQ ID NO: 4, and a
polypeptide having a mutant amino acid sequence that
differs from an amino acid sequence of SEQ ID NO: 4 by the
deletion, substitution or addition of at least 1 to 21
amino acid residues on the SEQ ID NO: 4 amino acid sequence
via
[3] a modified link peptide with an amino acid sequence
that differs from an amino acid sequence of a member
selected from the group consisting of SEQ ID NOs 7 to 9 by
the deletion, substitution or addition of at least one or
more amino acid residues on any amino acid sequence of SEQ
ID NOs 7 to 9, provided that the deletion of residues 1 to
32 and residues 1 to 44 on SEQ ID NO: 7 and residues 1 to
12 on SEQ ID NO: 8 is excluded.
(6) A nucleic acid molecule comprising a nucleotide
sequence encoding the protein according to any of the above
(1) to (5).
(7) The nucleic acid molecule according to the above
(6), wherein said molecule is a polynucleotide.
(8) The nucleic acid molecule according to the above
CA 02561696 2006-09-28
- 7 -
( 6 ) or (7), wherein said molecule is DNA or RNA.
(9) A recombinant vector comprising the nucleic acid
molecule according to any of the above (6) to (8).
(10) The recombinant vector according to the above
(9) wherein said vector comprises a nucleotide sequence
coding for a protein marker and/or a peptide marker in
combination with the nucleic acid molecule according to any
of claims 6 to 8.
(11) A transformed or transfected cell carrying the
nucleic acid molecule according to any of the above (6) to
(8) or the recombinant vector according to the above (9) or
(10).
(12) The transformed or transfected cell according
to the above (11), wherein said host cell is procaryotic or
eucaryotic.
(13) A pharmaceutical drug comprising an effective
amount of at least one member selected from the group
consisting of the protein according to any of the above (1)
to (5), the nucleic acid molecule according to any of the
above (6) to (8), the recombinant vector according to the
above (9) or (10), and the transformed or transfected cell
according to the above (11) or (12).
(14) The pharmaceutical drug according to the above
(13) which is an immunoregulator or immunomodulator.
(15) The pharmaceutical drug according to the above
(13) which is an antineoplastic or antitumor agent.
(16) The pharmaceutical drug according to the above
(15) which is an antineoplastic or antitumor agent for
preventing and/or treating at least one tumor selected from
CA 02561696 2006-09-28
-8-
the group consisting of sarcomas or cancers, including
brain tumors (glioblastoma multiforme, etc.), spinal tumors,
maxillary sinus carcinoma, pancreatic ductal adenocarcinoma,
gingival cancers, tongue cancers, lip cancers,
nasopharyngeal cancers, oropharyngeal cancers,
hypopharyngeal cancers, laryngeal cancers, thyroid cancers,
parathyroid cancers, lung cancers, pleural tumors,
carcinomatous peritonitis, carcinomatous pleurisy,
esophageal cancers, stomach cancers, colon cancers, bile
duct cancers, gall bladder cancers, pancreatic cancers,
liver cancers, renal cancers, urinary bladder cancers,
prostatic cancers, penile cancers, testicular tumors,
adrenal cancers, cervical cancers, endometrial cancers,
vaginal cancers, vulvar cancers, ovarian cancers,
chorioepithelioma, malignant bone tumors, soft part sarcoma,
breast cancers, skin cancers, malignant melanoma, basal
cell tumors, leukemia, myelofibrosis associated with
agnogenic myeloid metaplasia, malignant lymphoma, Hodgkin's
disease, plasmacytoma, glioma and others.
(17) The pharmaceutical drug according to the above
(13) which is for preventing and/or treating at least one
disorder, disease or pathological condition selected from
the group consisting of:
(A) a member selected from the group consisting of
inflammatory diseases and disorders: a variety of acute or
chronic inflammations occurring in various organs, allergic
or autoimmune inflammations, and infectious diseases;
(B) a member selected from the group consisting of acute
and chronic diseases and disorders: lung diseases or
disorders including bronchitis, bronchopneumonia,
interstitial pneumonia, pneumonitis, bronchiolitis, and
acute mediastinitis; diseases or disorders of miscellaneous
organs other than lung, including pericarditis,
endocarditis, myocarditis, stomatitis, angular stomatitis,
tonsillitis, pharyngitis, laryngitis, esophagitis,
peritonitis, acute gastritis, chronic gastritis, acute
CA 02561696 2006-09-28
- 9 -
enter it i s , appendicitis, ischemic colitis, drug induced
colitis, and proctitis; and inflammatory diseases and
disorders including hepatitis A, hepatitis B, hepatitis C,
fulminant hepatitis, acute or chronic hepatitis and
cirrhosis, cholecystitis, acute pancreatitis, chronic
pancreatitis, acute or chronic nephritis, membranous
glomerulonephritis, glomerulonephritis, IgA nephritis, a
variety of cystitis, encephalomyelitis, mastitis,
dermatitis, superficial keratitis, xerotic
keratoconjunctivitis, otitis media and rhinitis, paranasal
sinusitis and nasal polyp, gingivitis, periodontitis, and
other inflammatory disorders of the periodontium;
(C) a member selected from the group consisting of
neurogenic inflammations, such as neurogenic gastritis and
neurogenic cystitis, and pain associated with cancer and
inflammation;
(D) a member selected from the group consisting of
allergy associated inflammatory diseases including systemic
or generalized anaphylaxis, bronchial asthma,
hypersensitivity pneumonitis, pollenosis, allergic rhinitis,
allergic conjunctivitis, immune complex-induced allergic
diseases, and angioneurotic edema;
(E) a member selected from the group consisting of
autoimmune related inflammatory diseases (autoimmune
diseases): systemic diseases (chronic rheumatoid arthritis,
systemic lupus erythematosis, polyarteritis nodosa,
scleroderma, polymyositis/dermatomyositis, SjOgren's
syndrome, Behget's disease and others), nervous system
diseases (multiple sclerosis, myasthenia gravis, HAM (HTLV-
1 myelosis), amyotrophic lateral sclerosis and others),
endocrine diseases (Basedow's disease, Hashimoto's
thyroiditis, type 1 diabetes and others), blood diseases
(idiopathic thrombocytopenic purpura, autoimmune hemolytic
anemia, aplastic anemia and others), respiratory diseases
(sarcoidosis, idiopathic pulmonary fibrosis and others),
gastrointestinal diseases (ulcerative colitis, Crohn's
disease and others), hepatic diseases (autoimmune hepatitis,
CA 02561696 2006-09-28
-10-
primary biliary cirrhosis, primary sclerosing cholangitis,
autoimmune cholangitis and others), and renal/urinary tract
system diseases (anti-neutrophil cytoplasmic antibody
associated nephritis, angitis, Goodpasture's syndrome,
anti-glomerular basement membrane antibody disease and
others);
(F) a member selected from the group consisting of
infectious diseases: diseases and abnormal conditions
occurring when pathogens cause damage and/or injury to
cells, tissues and organs within the body, or diseases
resulting from the presence or activity of the pathogen
causing infection in human, wherein said pathogen is
selected from the group consisting of 1) bacteria
(including spirochaeta, chlamydia, and Rickettsia), 2)
viruses, 3) fungi, 4) plants (algae), 5) protozoa, 6)
parasites (Digenea (distomes or trematodes), cestodes
(tapeworms), nematodes), and 7) arthropods; including
bacterioses (cholera, pest, Escherichia coli infection,
etc.), spirochetoses (leptospirosis, etc.), chlamydioses
(psittacosis, etc.), rickettsial infections (Rickettsia
prowazekii, tetanus, etc.), viral infections (herpes zoster,
viral hemorrhagic fever, rabies, etc.), mycoses
(candidiasis, cryptococcosis, aspergillosis, etc.),
protozoal diseases (amebic dysentery, malaria,
toxoplasmosis, etc.), parasitoses (distomiasis,
nematodiasis, etc.), as well as mycoplasma infections
(mycoplasma pneumonia, etc.), mycobacterioses (tuberculosis,
atypical mycobacteriosis, etc.);
(G) a member selected from the group consisting of skin
diseases and abnormal skin conditions: i) skin infections,
skin inflammations including allergic inflammations and
autoimmune inflammations, and skin diseases with
inflammatory characteristics, such as psoriasis, hydroa,
pustulosis, keratinization, and keratonosis, and ii) skin
damages, and cosmetically disfiguring or age-related skin
conditions, including dermatological diseases and
cosmetically unpleasant conditions (including aging)
CA 02561696 2012-05-10
31162-5
- 11 -
associated with a) control of melanin metabolism (skin whitening), b) control
of hair
growth (trichogen), and c) control of collagen production;
(H) a member selected from the group consisting of life-style related
diseases including hypercholesterolemia, arteriosclerosis, hypertension and
diabetes.
(I) abnormal conditions with regard to the maintenance of a normal
bacterial flora;
(J) a member selected from the group consisting of those including
amyloidosis, Alzheimer's disease, osteoporosis, and bone fracture;
(K) inflammatory responses in brain and nervous areas: for example,
inflammations occurring in response to the development of ischemic lesions,
such as
cerebral infraction and myocardial infraction, and schizophrenia;
(L) gout;
(M) osteoporosis; and
(N) interstitial pneumonitis.
(18) An essay or test reagent comprising an effective amount of at least
one member selected from the group consisting of the protein according to any
of the
above (1) to (5), the nucleic acid molecule according to any of the above (6)
to (8),
the recombinant vector according to the above (9) or (10), and the transformed
or
transfected cell according to the above (11) or (12).
Specific aspects of the invention includes:
- a protein, or a salt thereof, comprising a mutant galectin 9 protein
having p-galactoside binding activity and having the structure (N-CRD)-Linker-
(C-CRD), wherein N-CRD (N-terminal Carbohydrate Recognition Domain) is a
polypeptide having the amino acid sequence of SEQ ID NO: 3, a variant thereof
14,
31162-5 CA 02561696 2013-04-17
- 11a
differing from the amino acid sequence of SEQ ID NO: 3 by a deletion,
substitution or
addition of 1 to 8 amino acid residues and maintaining a carbohydrate
recognition
activity of N-CRD of natural galectin 9, or a variant thereof having an amino
acid
sequence at least 70% identical to SEQ ID NO: 3 and maintaining a carbohydrate
recognition activity of N-CRD of natural galectin 9; C-CRD (C-terminal
Carbohydrate
Recognition Domain) is a polypeptide having the amino acid sequence of
SEQ ID NO: 4, a variant thereof differing from the amino acid sequence of SEQ
ID: 4
by a deletion, substitution or addition of 1 to 21 amino acid residues and
maintaining
a carbohydrate recognition activity of C-CRD of natural galectin 9, or a
variant thereof
having an amino acid sequence at least 70% identical to SEQ ID NO: 4 and
maintaining a carbohydrate recognition activity of C-CRD of natural galectin
9; and
Linker is an amino acid sequence consisting of 2 arbitrary natural amino acid
residues, or having the sequence Arg Ile Pro;
- a pharmaceutical drug comprising an effective amount of the protein,
or a salt thereof, as described herein;
- an assay kit for screening agonists or antagonists of galectin 9 protein,
comprising a test reagent and a detectable substrate, the test reagent
comprising an
effective amount of a protein, or a salt thereof, comprising a mutant galectin
9 protein
having f3-galactoside binding activity and having the structure (N-CRD)-Linker-
(C-CRD), wherein N-CRD (N-terminal Carbohydrate Recognition Domain) is a
polypeptide having the amino acid sequence of SEQ ID NO: 3, a variant thereof
differing from the amino acid sequence of SEQ ID NO: 3 by a deletion,
substitution or
addition of 1 to 8 amino acid residues and maintaining a carbohydrate
recognition
activity of N-CRD of natural galectin 9, or a variant thereof having an amino
acid
sequence at least 70% identical to SEQ ID NO: 3 and maintaining a carbohydrate
recognition activity of N-CRD of natural galectin 9; C-CRD (C-terminal
Carbohydrate
Recognition Domain) is a polypeptide having the amino acid sequence of
SEQ ID NO: 4, a variant thereof differing from the amino acid sequence of SEQ
ID: 4
by a deletion, substitution or addition of 1 to 21 amino acid residues and
maintaining
CA 02561696 2013-04-17
f 31162-5
- llb
a carbohydrate recognition activity of C-CRD of natural galectin 9, or a
variant thereof
having an amino acid sequence at least 70% identical to SEQ ID NO: 4 and
maintaining a carbohydrate recognition activity of C-CRD of natural galectin
9; and
Linker is an amino acid sequence consisting of 2 arbitrary natural amino acid
residues, or having the sequence Arg Ile Pro;
- use of a therapeutically effective amount of the pharmaceutical drug
as described herein for treating refractory autoimmune diseases, rheumatoid
arthritis,
allergic diseases, inflammatory diseases, and disorders related to bone
metabolism,
in a subject in need thereof; and
- use of a therapeutically effective amount of the pharmaceutical drug
as described herein for treating blood cell tumors, non-epithelial neoplasms
and
epithelial neoplasms, in a subject in need thereof.
ADVANTAGEOUS PROFILES OF THE INVENTION
Modified galectin 9 molecules, which are designed on the basis of
galectin 9, are more stabilized against proteases as compared to wild type
galectin 9.
Therefore, the modified Gal 9 molecules can be expected to be useful in
eliciting and
revealing the in vivo functions of Gal 9. Said modified Gal 9 molecules are
also
applicable to
CA 02561696 2012-05-10
31162-5
- 12 -
studies on functions and actions of galectin 9 that may
contribute to the regulation and control of various
bioreactions including the regulation of tumorized cells,
immunoregulation, and the control of allergy and
inflammation. Further, said modified Gal 9 molecules and
related substances thereof have bright prospects for
reagents and agents in clinical, molecular biological
biochemical and medical applications.
The above objects and other objects, features,
advantages, and aspects of the present invention are
readily apparent to those skilled in the art from the
following disclosures. It should be understood, however,
that the disclosures in the specification including the
following best modes of carrying out the invention,
examples, and others are illustrating preferred embodiments
of the present invention and given for purposes of
illustration only. It will become apparent to the skilled
in the art that a great number of variations and/or
alterations (or modifications) of this invention may be
made based on knowledge from the disclosure in the
following parts and other parts of the specification
without departing from the scope thereof as
disclosed herein.
30
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is a scheme illustrating steps for construction
of modified galectin 9 mutein (G9NC(null)) expression
vector.
FIG. 2 is a photo showing electrophoretic patterns for
CA 02561696 2006-09-28
- 13 -
an expressed modified galectin 9 mutein (G9NC(null))
product and a purified expressed G9NC(null product.
FIG. 3 is a photo showing electrophoretic patterns
resulting from comparison for resistance against proteases
between wild type galectin 9 (G9(M)) and modified galectin
9 mutein (G9NC(null)). Purified samples were tested for
resistance against contaminated E. coli proteases.
FIG. 4 is a photo showing electrophoretic patterns
resulting from comparison for resistance against proteases
between wild type galectin 9 (G9(S)) and modified galectin
9 mutein (G9NC(null)). Purified samples were tested for
resistance against matrix metalloproteinase-3 (M4P-3).
FIG. 5 is a photo showing electrophoretic patterns
resulting from comparison for resistance against proteases
between wild type galectin 9 (G9(S)) and modified galectin
9 mutein (G9NC(null)). Purified samples were tested for
resistance against elastase.
FIG. 6 is a photo showing electrophoretic patterns
resulting from comparison for bioactivity between wild type
galectin 9 (G9(S)) and modified galectin 9 mutein
(G9NC(null)). The activity of inducing apoptosis of MOLT-4
cells (DNA laddering) was assayed.
FIG. 7 is a graph showing comparison results for
bioactivity between wild type galectin 9 (G9(S)) and
modified galectin 9 mutein (G9NC(null)). ECA activity on
peripheral blood eosinophils was assayed.
FIG. 8 is a list of amino acids at several positions
in galectin-9 EST. These putative galectin-9 EST clones
were identified by BLAST sequence search using the
ecalectin nucleotide sequence as query. The sequence
identity (homology) of these clones with the ecalectin is
CA 02561696 2006-09-28
- 14-
usually 97 to 99 %. The EST clones from different sources
are demonstrated without amino acids at positions 5, 88,
135, 238, and 281, respectively.
FIG. 9 is a graph showing that zymosan induces
pleurisy while modified galectin 9 mutein (h-gal9NC(null))
alone does not.
FIG. 10 is a graph showing assay results for the
FIG. 11 is a graph showing assay results for the
efficacy of galectin 9 mutein (Gal-9= G9NC(null)) on the
model of PMA-induced dermatitis (model susceptible to
steroid).
FIG. 12 is a graph showing assay results for the
efficacy of galectin 9 mutein (Gal-9= G9NC(null)) on the
model of AA-induced dermatitis (model non-susceptible to
steroid).
FIG. 13 is a graph showing assay results for the
efficacy of galectin 9 mutein (Gal-9= G9NC(null)) on the
model of capsaicin-induced dermatitis.
FIG. 14 is a graph showing assay results for the
efficacy of galectin 9 mutein (Gal-9= G9NC(null)) on the
model of DNFB-induced contact dermatitis.
FIG. 15 is a graph showing assay results for the
efficacy of galectin 9 mutein (Gal-9= G9NC(null)) on the
model of DNFB-induced contact dermatitis.
FIG. 16 is a graph showing assay results for the
efficacy of galectin 9 mutein (Gal-9= G9NC(null)) on the
model of FITC-induced atopic dermatitis.
CA 02561696 2006-09-28
-15-
FIG. 17 is a graph showing assay results for the
efficacy of galectin 9 mutein (Gal-9= G9NC(null)) on the
model of urticaria.
FIG. 18 is a graph showing assay results for the
efficacy of galectin 9 mutein (Gal-9= G9NC(null)) on the
model of urticaria.
FIG. 19 is a graph showing assay results for the
efficacy of galectin 9 mutein (Gal-9= G9NC(null)) on the
model of arthritis.
FIG. 20 shows assay results from examinations of
modified galectin 9 mutein's efficacy of inhibiting the
growth of tumor cells, i.e., anti-tumor activity (anti-
neoplastic) in the model of subcutaneously transplanted
tumor. Upper: control group Lower: modified Gal-9 mutein-
administered group (no tumor was observed for 5 weeks so
far).
FIG. 21 shows histopathological tissue photos from
assays for modified galectin 9 mutein's efficacy of
inhibiting the growth of tumor cells, i.e., anti-tumor
activity (anti-neoplastic) in the model of subcutaneously
transplanted tumor, wherein the 5-week skin states are
shown when LLC + Modified Gal-9 Mutein (Ga19) were
administered (lower photos): macroscopically white tone.
FIG. 22 shows assay results for modified galectin 9
mutein-mediated induction of apoptosis (cytotoxicity) in
cultured tumor cells (Meth A cells, 24 h).
FIG. 23 shows assay results for modified galectin 9
mutein-mediated induction of apoptosis (cytotoxicity) in
cultured tumor cells (B16/F10 cells, 24 h).
CA 02561696 2006-09-28
-16-
FIG. 24 is a graph of animal survival curves showing
that modified galectin 9 mutein has anti-tumor efficacy in
the model of cancerous peritonitis, induced by Meth A cells.
FIG. 25 shows photos showing animal states in the
model of cancerous peritonitis, induced by Meth A cells,
for modified galectin 9 mutein ((Ga19)-non-administered
(upper) and -administered (lower) groups.
FIG. 26 is a graph of animal survival curves showing
that modified galectin 9 mutein has anti-tumor efficacy in
the model of cancerous peritonitis, induced by B16/F10
cells.
FIG. 27 shows internal organ tissue (Day 14) photos
wherein the animal states of modified galectin 9 mutein
(Gal-9)-administered groups are compared to those of non-
administered groups in the model of cancerous peritonitis,
induced by B16/F10 cells (melanoma).
FIG. 28 shows infiltrated intra-abdominal B16/F10 cell
analysis results from examinations of modified galectin 9
mutein (Gal-9)-mediated actions in immune cells.
FIG. 29 shows assay results for modified galectin 9
mutein (Gal-9)-mediated inhibition of cell adhesion
(B16/F10 cell, 1 h). In the drawing, Collagen I indicates
collagen type I; Collagen IV, collagen type IV; Laminin,
laminin; Fibronectin, fibronectin; and Vitronectin,
vitronectin.
FIG. 30 shows graphs of assay results for actions of
modified galectin 9 mutein (Gal-9) and dexamethasone (Dex.)
on the model of mite antigen-induced asthma.
FIG. 31 shows graphs of cell numbers in BALF, assay
results for actions of modified galectin 9 mutein (Gal-9)
CA 02561696 2006-09-28
-17-
and dexamethasone (Dex.) on the model of mite antigen-
induced asthma.
FIG. 32 shows bronchial tube surrounding tissue photos
for assay results for actions of modified galectin 9 mutein
(Gal-9) on the model of mite antigen-induced asthma.
FIG. 33 shows graphs of assay results for actions of
modified galectin 9 mutein (Gal-9) and dexamethasone (Dex.)
on the model (mouse) of OVA-induced asthma.
FIG. 34 shows graphs of cell numbers in BALF, assay
results for actions of modified galectin 9 mutein (Gal-9)
and dexamethasone (Dex.) on the model (mouse) of OVA-
induced asthma.
FIG. 35 is a graph showing actions of modified
galectin 9 mutein (gal-9) on IAR/LAR in the model (mouse)
of OVA-induced asthma.
FIG. 36 is a graph showing cell numbers in BALF, assay
results for actions of modified galectin 9 mutein (gal-9)
on the model (mouse) of OVA-induced asthma.
FIG. 37 shows graphs of hematocrit values (%), as
assay results for actions of modified galectin 9 mutein
(Gal-9) on the model (mouse) of autoimmune hemolytic anemia.
FIG. 38 shows graphs of assay results for actions of
modified galectin 9 mutein (Gal-9) and dexamethasone (Dex.)
on the model (mouse) of Arthus reaction (angiitis).
FIG. 39 shows graphs of assay results for actions of
modified galectin 9 mutein (Gal-9) and dexamethasone (Dex.)
on the model (mouse) of ARDS.
FIG. 40 shows graphs of cell numbers in BALF, assay
CA 02561696 2006-09-28
-18-
results for actions of modified galectin 9 mutein (Gal-9)
and dexamethasone (Dex.) on the model (mouse) of ARDS.
FIG. 41 is a graph showing assay results for actions
of modified galectin 9 mutein (Gal-9, i.v.) on the model
(mouse) of capsaicin-induced inflammation.
FIG. 42 is a graph showing assay results for the
efficacy of modified galectin 9 mutein (Gal-9) on
osteoclast formation. It is apparent that Gal-9 exerts
inhibitory efficacy.
FIG. 43 shows assay results for apoptosis-induction
(in the presence of CSF) of mononuclear cells by modified
galectin 9 mutein (Gal-9) stimulation.
FIG. 44 is a graph showing assay results for the
efficacy of modified galectin 9 mutein (Gal-9) on
osteoblast proliferation.
FIG. 45 shows graphs of assay results for the efficacy
of modified galectin 9 mutein (Galectin-9) stimulation (8
hr) on the expression of human osteoblast proliferation
markers.
FIG. 46 is a graph showing survival proportions.
Modified galectin 9 mutein's actions on the model of
interstitial pneumonia were assayed.
FIG. 47 shows photos showing test results for the
action of modified galectin 9 mutein on the model of
interstitial pneumonia. The photos exhibit lung tissue
images of animals survived on Day 14 (stained with HE).
FIG. 48 is a graph showing animal survival curves.
It is revealed that modified galectin 9 muteins have anti-
tumor efficacy on the model of cancerous peritonitis,
CA 02561696 2006-09-28
- 19 -
induced by LLC cells (apoptosis (+)).
FIG. 49 shows photos showing test results for the
action of modified galectin 9 mutein on the model of
metastatic cancer, induced by B16/F10 cells. The photos
exhibit lung images (exterior views) of model animals.
FIG. 50 shows assay results for the action of modified
galectin 9 mutein (G9NC(null)) on the model of metastatic
cancer, induced by B16/F10 cells. The number of colonies
in each lung was counted.
FIG. 51 is a graph showing assay results for the
efficacy of modified galectin 9 mutein (gal-9) (i.v.
administration) on the model of carrageenan-induced
inflammatory disease.
FIG. 52 is a graph showing assay results for the
efficacy of positive control, dexamethasone (Dex.), on the
model of carrageenan-induced inflammatory disease, for
comparison.
FIG. 53 shows immunohistological staining results for
expression of galectin-9 in rheumatoid arthritis (RA)
synovium.
FIG. 54 shows microscopic photos of RA synovial cells.
The galectin-9 mediated activity of inducing apoptosis of
the RA synovial cells was observed.
FIG. 55 is a graph showing PI assay results for
galectin-9 mediated activity of inducing apoptosis of RA
synovial cells.
FIG. 56 is a graph showing assay results for galectin
mediated activity of inducing apoptosis of RA synovial
cells.
CA 02561696 2006-09-28
- 20 -
FIG. 57 is a graph showing assay results for galectin
mediated activity of inhibiting the growth of RA synovial
cells.
FIG. 58 shows graphs of assay results for modified
galectin 9 mutein's action in the model of adjuvant
arthritis (suppression of pain triggered by mechanical
stimulation).
FIG. 59 shows graphs of assay results for the action
of positive control, indomethacin, in the model of adjuvant
arthritis (suppression of pain triggered by mechanical
stimulation), for comparison.
FIG. 60 shows graphs of assay results for modified
galectin 9 mutein's action in the model of carrageenan-
induced acute inflammatory disease (suppression of pain
triggered by mechanical stimulation).
FIG. 61 shows graphs of assay results for the action
of positive control, dexamethasone, in the model of
carrageenan-induced acute inflammatory disease (suppression
of pain triggered by mechanical stimulation), for
comparison.
FIG. 62 shows SDS-PAGE results from examination of
modified galectin 9 mutein stability in human synovial
fluid.
FIG. 63 is a graph showing assay results for the
efficacy of modified galectin 9 mutein (stabilized galectin
9) (i.v. administration) on the model of arthritis (Ab
cocktail-induced arthritis).
FIG. 64 is a graph showing assay results for the
efficacy of modified galectin 9 mutein (stabilized galectin
CA 02561696 2012-05-10
= 31162-5
- 21 -
9) (i.p. administration) on the model of arthritis
(collagen-induced arthritis).
FIG. 65 is a graph showing assay results for the
efficacy of modified galectin 9 mutein (stabilized galectin
9) (i.v. administration) on the model of arthritis
(collagen-induced arthritis).
FIG. 66 shows graphs of assay results for the efficacy
of modified galectin 9 mutein (i.v. administration) on the
model of adjuvant arthritis.
FIG. 67 shows graphs of assay results for the efficacy
of positive control, indomethacin, on the model of adjuvant
arthritis, for comparison.
FIG. 68 is a graph showing assay results for the
efficacy of modified galectin 9 mutein (i.v.
administration) on the rat model of collagen-induced
arthritis (CIA).
BEST MODES OF CARRYING OUT THE INVENTION
The invention described herein draws on
previously published work and pending patent applications.
The "modified galectin 9 mutein", "modified
galectin 9 variant", "modified galectin 9", or "modified
galectin 9 protein" refers to a substance provided with an
activity to specifically bind to a specific saccharide
chain wherein said activity is retained by the carbohydrate
recognition domain of galectin 9, or its analogous activity
CA 02561696 2006-09-28
- 22 -
( including qualitative or/and quantitative). It is noted
that galectin 9 has an activity to induce apoptosis of a
specific cell. The modified galectin 9 mutein may be a
substance having an apoptosis-inducing activity, owned by
wild type galectin 9, or an analogous activity thereof, and
a substance wherein the bioactivity retained by wild type
galectin 9 is altered or modified, which is preferable in
some cases. The particularly preferred modified galectin 9
mutein herein is a molecule retaining a more desirable
property in order to serve as a biologically active reagent
in diagnostic, analytic, medical, or pharmaceutical
applications than wild type galectin 9.
The modified galectin 9 mutein may be, for
example, a mutant galectin 9 protein, or a salt thereof,
wherein the link peptide of wild type (native) galectin 9
or a protein with substantially equivalent galectin 9
activity is modified, or the site or region in the
neighborhood of said link peptide is modified; a modified
galectin 9 protein, or a salt thereof, not only having a
modified sequence that differs from an amino acid sequence
of wild type galectin 9 or a protein with substantially
equivalent galectin 9 activity by at least one deletion,
substitution or addition of one or more amino acid residues
at a link peptide or a site or region in the neighborhood
of the galectin 9 link peptide but also altered
susceptibility to degradation of said galectin 9 link
peptide as compared to wild type galectin 9; a protein, or
a salt thereof, not only retaining substantially equivalent
galectin 9 activity but also being at least 70%, still at
least 75%, yet at least 80%, also at least 85, at least
90%, or at least 95% or higher homologous to the amino acid
sequence of wild type galectin 9; a protein, or a salt
thereof, having the formula:
NCRD Peptide (1)-Link Peptide (3)-CCRD Peptide (2)
in which (1) the NCRD Peptide (1) is selected from the
group consisting of the N-terminal carbohydrate recognition
domain (NCRD) of wild type galectin 9 and polypeptides with
CA 02561696 2006-09-28
- 23 -
substantially equivalent Gal-9 NCRD activity, (2) the CORD
Peptide (2) is selected from the group consisting of the C-
terminal carbohydrate recognition domain (CORD) of wild
type galectin 9 and polypeptides with substantially
equivalent Gal-9 CORD activity, (3) the Link Peptide (3) is
a modified link peptide that differs from the link peptide
amino acid sequence of wild type galectin 9 by at least one
deletion, substitution or addition of one or more amino
acid residues in the galectin 9 link peptide amino acid
sequence, and the NCRD Peptide (1) is linked to the CORD
Peptide (2) via the Link Peptide (3); etc.
By the way, it was reported in J. Biol. Chem.,
272 (10): pp. 6416-6422 (1997) that a novel galectin was
found in cDNA derived from the spleen of a patient with
Hodgkin's disease and named "galectin 9", its sequence was
reconfirmed with cDNA from normal peripheral blood in order
to exclude mutations of the Hodgkin's disease tumor-derived
human galectin-9 transcript, and finally the sequence of
galectin 9 was determined as shown in FIG. 1 on page 6418
of said document. For galectin 9, it was further reported
in J. Biol. Chem., 273 (27): pp. 16976-16984 (1998) that a
novel eosinophil chemoattractant "ecalectin" was isolated
from cDNA prepared from eosinophil chemoattractant-
producing T-cell line STO-2, and its amino acid sequence
was apparently different at amino acid residues 5, 88, 135,
238, and 281 from the amino acid sequence of the previously
reported, above-described galectin 9 though it was highly
homologous to the above-described galectin 9. Said
ecalectin sequence is shown in FIG. 8 on page 16983 of this
document wherein ecalectin is surmised to be a variant form
of galectin 9.
Also, in J. Biol. Chem., 275 (12): pp. 8355-8360
(2000), galectin 9 was isolated from cDNA prepared from T-
cell line Jurkat and recombinant galectin 9 proteins were
produced. Since this recombinant galectin 9 exhibited
CA 02561696 2006-09-28
=
- 24 -
eosinophil chemoattractant activity, Hirashima et al.
decided to use galectin 9 with T-cell line Jurkat cell-
derived sequence for their study henceforth, wherein the
amino acid sequence of Jurkat cell-derived galectin 9 had
Gly, Lys, Ser, Pro, and Glu at positions 5, 88, 135, 238,
and 281, respectively, while it was different at amino acid
residue 5 from the sequence of ecalectin reported in the
aforementioned Matsumoto et al. (J. Biol. Chem., 273 (27):
pp. 16976-16984 (1998)), i.e., Gly at position 5 of Jurkat
cell-derived galectin 9 was replaced with Ser in the
ecalectin amino acid sequence. It was disclosed that the
Ser to Gly substitution at position 5 did not affect the
eosinophil chemoattractant activity, and it was naturally
considered in light of 17 putative galectin 9 ETS clones
(including partial sequences) identified by sequence search
using the galectin 9 sequence as query on the EST database
that Gly, Lys, Ser, Pro, and Glu were set as the amino
acids for positions 5, 88, 135, 238, and 281, respectively.
Amino acid mutations in the galectin 9 sequence are also
disclosed in Table II on page 8359 of said document (see
FIG. 8). In FIG. 8, Gly (G), Lys (K), Ser (S), Pro (P),
and Glu (E) are at positions 5, 88, 135, 238, and 281,
respectively.
In J. Biol. Chem., 272 (9): pp. 6078-6086 (1997:
Non-Patent Document 3), the regions for two carbohydrate
recognition domains (CRDs) and a linker, 26 amino acids
(for galectin 9M), between the two CRDs, were determined
(see FIG. 1 in this document). In other words, when
attention was given to the amino acid sequence of SEQ ID
NO: 5, it was defined that the C-terminal carbohydrate
recognition domain (CCRD) started from Met175. Based on
that, the CRD and link regions of human galectin 9 have
been registered as Accession Number NP 033665 in the NCBI
database.
By the way, galectins 4 and 6 were reported in J.
CA 02561696 2006-09-28
- 25 -
Biol. Chem., 273 (5): pp. 2954-2960 (1998), wherein
definitions to the CRD and link regions thereof were given
on the basis of their amino acid sequences and gene
sequences, as shown in FIG. 2 on page 2956 of this document.
When the configuration of galectin 9 reflects the
aforementioned definitions, it is different in the link
region and C-terminal CRD from the former configuration (J.
Biol. Chem., 272 (9): pp. 6079-6086 (1997)), i.e., when the
amino acid sequence of SEQ ID NO: 5 is based, the CCRD is
defined to start from Phe195.
The present inventor group takes into
consideration the following: borders for exon splicing
exist at positions closer by 3 amino acids to the C-
terminal side than in the configuration set forth in Non-
Patent Document 3, such as between G1n148-Pro149, between
160161 177 178
, and between Ser-Thr
Ile -Thr . In addition, from
examinations for the carbohydrate-binding property of the
C-terminal CRD, i.e., on the basis of the amino acid
sequence of SEQ ID NO: 5, the expression of full-length
CCRD initiated from Thr178 resulted in occurrence of its
lactose-binding property, and further the deletion of 22
amino acids (CCRD fragment initiated from Leu200 ) resulted
in non-expression in E. coli while both the deletion of 6
amino acids (CCRD fragment initiated from Met184) and the
deletion of 12 amino acids (CCRD fragment initiated from
Ala190) did not cause a loss of lactose-binding activity,
the present inventor group takes into consideration that it
can be viewed that the configuration of CCRD initiated from
Phe195 is unprejudiced. Therefore, the region, Thr178 to
Thr323, in the amino acid sequence of SEQ ID NO: 5 is
defined herein as the C-terminal CRD. The N-terminal CRD
(NCRD) of galectin 9 is examined on the basis of the amino
acid sequence of SEQ ID NO: 5 as follows: when full-length
NCRD terminated at Gln148 was expressed, the resultant
product had a lactose-binding property. Where 9 amino
acids were removed (NCRD fragment of the sequence, Met to
CA 02561696 2012-05-10
31162-5
- 26 -
Ser139), however, the expression of proteins took place but
the lactose-binding property was not observed. Therefore,
Met1 to Gln148 in the amino acid sequence of SEQ ID NO: 5 is
defined herein as the N-terminal CRD.
In preferred embodiments, the modified galectin 9
mutein include, for example, molecules wherein
(1) the NCRD of galectin 9 is selected from the group
consisting of the amino acid sequence of SEQ ID NO: 3, a
mutant amino acid that differs from the amino acid sequence
of SEQ ID NO: 3 by at least one deletion, substitution, or
addition of one or more amino acid residues in the SEQ ID
NO: 3 amino acid sequence, and an amino acid sequence which
not only is at least 70%, still at least 75%, yet at least
80%, also at least 85%, at least 90%, or at least 95% or
higher homologous to the amino acid sequence of SEQ ID NO:
3, but also retains lactose binding activity;
(2) the CCRD of galectin 9 is selected from the group
consisting of the amino acid sequence of SEQ ID NO: 4, a
mutant amino acid that differs from the amino acid sequence
of SEQ ID NO: 4 by at least one deletion, substitution, or
addition of one or more amino acid residues in the SEQ ID
NO: 4 amino acid sequence, and an amino acid sequence which
not only is at least 70%, still at least 75%, yet at least
80%, also at least 85%, at least 90%, or at least 95% or
higher homologous to the amino acid sequence of SEQ ID NO:
4, but also retains lactose binding activity; and
(3) the link region that is a link between the above
(1) and (2) is selected from the group consisting of the
amino acid sequence of SEQ ID NO: 9, and a mutant amino
acid that differs from the amino acid sequence of SEQ ID
NO: 9 by at least one deletion, substitution, or addition
of one or more amino acid residues in the SEQ ID NO: 9
amino acid sequence;
preferably those which are more stabilized against
proteolytic enzymes, such as matrix metalloproteinases,
than native galectin 9 (wild type galectin 9). Said link
CA 02561696 2006-09-28
- 27 -
peptide region (3) includes deletion analogues with at
least one amino acid deletion of one or more (for example,
from 1 to 2, preferably from 3 to 4, still preferably from
to 6, more preferably from 7 to 8, and inter alia from 1
to 9) amino acid residues in the amino acid sequence of SEQ
ID NO: 9; substitution analogues where one or more (for
example, from 1 to 9, preferably from 1 to 8, still
preferably from 1 to 6, more preferably from 1 to 4, and
inter alia from 1 to 2) amino acid residues in said amino
acid sequence are substituted with other residues; and
addition analogues with at least one amino acid addition
(or insertion) of one or more (for example, from 1 to 60,
preferably from 1 to 40, still preferably from 1 to 20,
more preferably from 1 to 10, and inter alia from 1 to 5)
amino acid residues, provided that residual portions
derived by removing SEQ ID NO: 9 from SEQ ID NO: 7 or 8 are
excluded. In representative embodiments, said link region
(3) includes those having a deleted amino acid sequence
that differs from the amino acid sequence of SEQ ID NO: 9
by amino acid substitution with HM, RIP, or any of
sequences consisting of 2 amino acids. The substitution,
deletion or insertion (addition) of amino acids may or may
not cause a great alteration in physiological or chemical
properties of a polypeptide. In some cases, a desirable
modification will be provided. Substituents of amino acids
in the amino acid sequence can be selected from other amino
acids in the class to which the amino acid belongs. For
instance, non-polar (hydrophobic) amino acids include
alanine, phenylalanine, leucine, isoleucine, valine,
proline, tryptophan, methionine and the like; polar
(neutral) amino acids include glycine, serine, threonine,
cysteine, tyrosine, asparagine, glutamine and the like;
amino acids having a positive charge (basic amino acids)
include arginine, lysine, histidine and the like; and amino
acids having a negative charge (acidic amino acids) include
aspartic acid, glutamic acid and the like.
CA 02561696 2006-09-28
- 28 -
Further, the link region (3) includes those
having a substituted amino acid sequence that differs from
the sequence of SEQ ID NO: 7 or 8 by replacement with HM,
RIP, or any of sequences consisting of 2 amino acids,
provided that the area corresponding to SEQ ID NO: 9 is
excluded for this replacement; those having a deleted amino
acid sequence that differs from the sequence of SEQ ID NO:
7 or 8 by retention of 6 amino acid residues and deletion
of all the residual amino acid residues, excluding the area
corresponding to SEQ ID NO: 9; and others. The link region
(3) also includes deletion analogues with amino acid
deletions of one or more (for example, from 1 to 5,
preferably from 3 to 10, still preferably from 5 to 15,
more preferably from 7 to 20, and inter alia from 1 to 32)
amino acid residues in the amino acid sequence of SEQ ID
NO: 7 or 8, excluding the portion corresponding to, for
example, SEQ ID NO: 9, or SEQ ID NO: 8 in case of SEQ ID
NO: 7; substitution analogues where one or more (for
example, from 1 to 9, preferably from 1 to 8, still
preferably from 1 to 6, more preferably from 1 to 4, and
inter alia from 1 to 2) amino acid residues in said amino
acid sequence are substituted with other residues; and
addition analogues with amino acid additions (or
insertions) of one or more (for example, from 1 to 60,
preferably from 1 to 40, still preferably from 1 to 20,
more preferably from 1 to 10, and inter alia from 1 to 5)
amino acid residues, provided that residual portions
derived by removing SEQ ID NO: 9 from SEQ ID NO: 7 or 8 are
excluded.
The mutants as aforementioned are all included in
the present invention as long as they retain the domain
structure or active carbohydrate binding structure
characteristic of native human galectin 9 (or wild type
human galectin 9). Also, it is thought that the peptides
or polypeptides of the present invention may include those
having all or part of substantially equivalent primary
CA 02561696 2006-09-28
- 29 -
structure conformations to those of native human galectin 9
proteins. Furthermore, it is also thought that the
inventive peptides or polypeptides may include those having
substantially equivalent biological activity as compared to
said native human galectin 9 proteins. Moreover, they can
be one derived from the mutants which naturally occur. The
human-derived proteins (or peptides or polypeptides)
according to the present invention include, for example,
those having an amino acid sequence which is at least 60%
or more, and in some cases at least 70% or more homologous
to at least one sequence selected from SEQ ID NOs: 1 to 3
in the Sequence Listing of WO 02/37114 Al at an amino acid
level, and more preferably those having an 80, or 90%, or
more homologous amino acid sequence to any amino acid
sequence of said SEQ ID NOs: 1 to 3. The peptide fragments
(partial peptides) derived from the inventive human-derived
protein may be any as long as they are part of said human-
derived proteins (that is, partial peptides or fragmented
peptides of said proteins) and have substantially
equivalent activity to the inventive galectin 9 protein.
For example, the partial peptides (or peptide fragments) of
the protein according to the present invention include
peptides having a sequence with at least 5 or more,
preferably 20 or more, still preferably 50 or more, more
preferably 70 or more, still more preferably 100 or more,
and, in some cases, 200 or more amino acid residues
contained in the modified Gal-9 variant-constituent amino
acid sequence, preferably wherein said amino acid residues
are contiguous. Preferable examples thereof are those
having the same homology as aforementioned, with respect to
homology to the region corresponding to any amino acid
sequence of SEQ ID NOs: 1 to 3 in the Sequence Listing of
WO 02/37114 Al.
The term "substantially equivalent" used herein
means that proteins of interest are substantially
equivalent or equal one another in view of activity, for
CA 02561696 2006-09-28
- 30 -
example, cytotoxic, apoptosis-inducing, anti-inflammatory,
anti-allergic, immunoregulatory (or immunomodulatory),
saccharide chain-binding, physiological or biological
activity. Further, the meanings of that term may include a
case having the substantially same quality of activity.
The substantially same quality of activity can include, for
example, a binding activity, a cytotoxity, an apoptosis-
inducing activity, etc. The substantially same quality of
activity indicates that these activities are qualitatively
homogeneous; for example, they are physiologically,
pharmacologically or biologically homogeneous. For
instance, it is preferable that the activities such as the
binding activity, the cytotoxity and the apoptosis-inducing
activity are equivalent (for example, from about 0.001 to
1000 fold, preferably from about 0.01 to 100 fold, more
preferably from about 0.1 to 20 fold, and still preferably
from about 0.5 to 2 fold), but quantitative elements such
as the extents of these activities, molecular weights of
the proteins etc. may be different.
The "modified galectin 9 polypeptide", "modified
Gal-9 variant polypeptide" or "modified Gal-9 mutein
polypeptide" embodies modified variants, derivatives,
analogues, fragments, chimeras and mutants of the native
sequence of wild type galectin 9. The polypeptides are
encoded by recombinantly produced polynucleotides sequences
designed to encode the specific modified galectin 9
polypeptide intended for expression in a host cell. The
"modified galectin 9 variant therapeutic agent" includes
molecules derived from modified Gal-9 variant-coding
polynucleotide (modified galectin 9 mutein polynucleotide)
or modified Gal-9 polypeptide sequence, and variants,
mutants, analogues, chimeras, and fragments of such
modified Gal-9 polynucleotide or polypeptide.
Polynucleotide modified galectin 9 mutein therapeutic
agents are generally sequences encoding a modified galectin
9 polypeptide that can be recombinantly expressed in a host
CA 02561696 2006-09-28
- 3 1 -
ce 11 . Additionally, a modified galectin 9 mutein
therapeutic agent can be a small molecule agonist of
galectin 9 activity. Other modified Gal-9 mutein
therapeutic agents may include substances providing a
modified Gal 9 mutein, and modulators of galectin 9
activity that have modified galectin 9 mutein activity and
cause a prophylactic and/or therapeutic effect on disorders,
diseases, and abnormal conditions associated with the
insufficiency or absence of galectin 9 activity.
modulator of galectin 9 activity can be, for example, a
polynucleotide, a polypeptide, or a small molecule.
The term "diagnostic agent" as used herein refers
to any agent that contributes to one or more diagnostic
actions used in diagnostic applications of the invention.
These diagnostic applications include methods for
determining the presence of galectin 9-producing cells, or
methods for determining the presence of galectin 9-binding
substance presenting cells. The diagnostic agents include
the following: DNA encoding a modified galectin 9 mutein, a
stabilized galectin 9 variant, and cells or cell
homogenates having the stabilized galectin 9 mutein.
The term "therapeutic agent" as used herein can
be any agent that accomplishes or contributes to the
accomplishment of one or more therapeutic actions or
elements used in therapeutic applications of the invention.
For example, where the therapeutic agent is a
polynucleotide designed to express a modified galectin 9
mutein polypeptide, that agent is a polynucleotide that can
be administered to and expressed in a cell in the mammal.
Thus, the active form of the agent will initially be the
expressed polypeptide. The modified galectin 9 variant
therapeutic agent is a therapeutic agent with the
bioactivity of galectin 9, or a therapeutic agent derived
from modified galectin 9, such as a polypeptide capable of
binding on a certain saccharide chain longer than native
CA 02561696 2006-09-28
- 32 -
galectin 9 or a polynucleotide encoding a modified galectin
9 mutein polypeptide that is more stabilized against
proteolytic enzymes such as metalloproteinase than native
galectin 9. The therapeutic agent achieves a therapeutic
goal, alone or in combination with other agents (for
example, an agent used in other known treatments for a
particular tumor or autoimmunity in conjunction with
administration of modified galectin 9 mutein, or a gene
delivery vehicle capable of facilitating expression of
modified galectin 9 mutein in the mammal). The therapeutic
agents may include for example modified galectin 9 variant-
containing drugs developed for other purposes, agonists of
galectin 9, and further drugs that modulate or regulate
galectin 9 activity. The therapeutic agent can be, for
example, a small organic molecule, a peptide, a peptoid or
peptidic compound, a polynucleotide encoding a modified
galectin 9 mutein polypeptide, a modified galectin 9
variant polypeptide, or a transformed or transfected cell
expressing a chimera or mutant of the modified galectin 9
mutein that is stabilized toward protease more than native
galectin 9 (wild type galectin 9).
The "combination therapeutic agent" is a
therapeutic composition having several components or agents
that produce their separate effects when administered
together, and may produce a synergistic effect when
administered together to treat a disease. Preferably, the
separate effects of the combination therapeutic agent
combine to result in a larger therapeutic effect, for
example elimination or reduction of tumors, normalization
of tumor cells or tissues, recovery from an autoimmune
disease and long term survival. An example of separate
effects resulting from administration of a combination
therapeutic agent is the combination of such effects as
short-term, or long-term remission, or decrease of an
autoimmune response to a particular type of cell in the
patient. An example of the combination therapeutic agent
CA 02561696 2006-09-28
=
- 33 -
ac cording to the present invention would be administration
of a gene delivery vehicle including a polynucleotide
encoding a modified galectin 9 mutein in combination with a
polynucleotide encoding at least one member selected from
the group consisting of IFNs, IL-2, and other cytokines.
Alternatively, two gene delivery vectors can be used, one
expressing modified galectin 9 mutein and one encoding at
least one of cytokines. Also IFNs, IL-2, and others, or a
gene delivery vehicle expressing at least one member
selected from the group consisting of IFNs, such as IFN-y,
IL-2, and other cytokines, can be administered to
upregulate modified galectin 9 mutein expression in
anticipation of an administration of modified galectin 9
mutein for inducing apoptosis in target cells. The various
therapeutic agents can be administered in the same
pharmaceutically acceptable carrier at the same time,
followed, for example, by repeated administration of one or
all of the individual agents as needed to make the therapy
efficacious.
The term "gene delivery vehicle" refers to a
component that facilitates delivery to a cell of a coding
sequence for expression of a polypeptide in the cell. The
cell can be inside the mammal, as in in vivo gene therapy,
or can be removed from the mammal for transfection or
transformation and returned to the mammal for expression of
the polypeptide as in ex vivo gene therapy. The gene
delivery vehicle can be any component or vehicle capable of
accomplishing the delivery of a gene to a cell, for example,
a liposome, a particle, or a vector. The gene delivery
vehicle includes a recombinant vehicle, such as a
recombinant viral vector, a nucleic acid vector (such as
plasmid), a naked nucleic acid molecule such as genes, a
nucleic acid molecule complexed to a polycationic molecule
capable of neutralizing the negative charge on the nucleic
acid molecule and condensing the nucleic acid molecule into
a compact molecule, a nucleic acid associated with a
CA 02561696 2006-09-28
- 34 -
liposome (U.S. Patent Nos. 5,166,320; 5,547,932; Wang et
al., Proc. Natl. Acad. Sci. USA, 84:7851, 1987), and others.
Said gene delivery vehicles include certain eukaryotic
cells (e.g., a producer cell), that are capable of
delivering a nucleic acid molecule biologically having one
or more desirable properties to host cells. As discussed
further below, the desirable properties include the ability
to express a desired substance, such as, for example, a
protein, enzyme, or antibody, and/or the ability to provide
a biological activity, which is where the nucleic acid
molecule carried by the gene delivery vehicle is itself the
active agent without requiring the expression of a desired
substance. One example of such biological activity is
found in gene therapy where the delivered nucleic acid
molecule incorporates into a specified gene so as to
inactivate the gene and "turn off" the product formation
directed by the gene, thereby allowing the specific
expression of said delivered nucleic acid molecule. Gene
delivery vehicle refers to an assembly which is capable of
directing the expression of one or plural sequences or
genes of interest. The gene delivery vehicle generally
includes promoter elements and may include a signal that
directs polyadenylation. In addition, the gene delivery
vehicle includes a sequence which, when transcribed, is
operably linked to one or plural sequences or genes of
interest and acts as a translation initiation sequence.
The gene delivery vehicle may also include a selectable
marker such as Neo, SV2Neo, TK, hygromycin, bleomycin
(phleomycin), puromicin, histidinol, or DHFR, as well as
one or more restriction sites and a translation termination
sequence. Gene delivery vehicles as used within the
present invention refers to recombinant vehicles, such as
viral vectors (Jolly, Cancer Gen. Therapy, 1: 51-64, 1994),
nucleic acid vectors, naked DNA, liposomal DNA, cosmids,
bacteria, and certain eukaryotic cells (including producer
cells; see U.S. Patent No. 6,333,195).
CA 02561696 2006-09-28
- 35 -
The term "Biologically active" refers to a
molecule that retains a specific activity. A biologically
active modified galectin 9 polypeptide (galectin 9 mutein,
or modified Gal-9 variant), for example, retains not only
the ability to bind specifically a certain saccharide chain
on the carbohydrate recognition domain, as possessed by the
CRD of galectin 9, or a substantially equivalent property
thereto, but also qualitatively or quantitatively the more
stable property against digestion with proteolytic enzymes
such as matrix metalloproteinase, as compared to native
galectin 9 (wild type galectin 9). For example, said
biologically active modified galectin 9 polypeptide has
antitumor activity or the ability to activate the apoptotic
pathway leading to apoptosis, as owned by native galectin 9.
The "nucleic acid molecule" or "polynucleotide,"
as used herein, refers to RNA or DNA molecules, or DNA:RNA
hybrids that encode a specific amino acid sequence or its
complementary strand. The "coding sequence" as used herein
refers to any of RNA, DNA, and DNA:RNA hybrids that encode
a specific amino acid sequence or its complementary strand.
The polynucleotide may include, for example, an antisense
oligonucleotide, or a ribozyme, and may also include such
items as a 3'- or 5'-untranslated region of a gene, or an
intron of a gene, or other region of a gene that does not
make up the coding region of the gene. The DNA or RNA may
be single stranded or double stranded. Synthetic nucleic
acids or synthetic polynucleotides can be chemically
synthesized nucleic acid sequences, and may also be
modified with chemical moieties to render the molecule
resistant to degradation. The polynucleotide can be
generated, for example, by polymerase chain reaction (PCR)
amplification, or recombinant expression of complementary
DNA or RNA, or by chemical synthesis.
The term "expression control sequence" or
"regulatory sequence" refers to a sequence that is
CA 02561696 2006-09-28
- 36 -
conventionally used to effect expression of a gene that
encodes a polypeptide and include one or more components,
elements, or factors that affect expression, including
transcription and translation signals. The expression
control sequence that is appropriate for expression of the
present polypeptides differs depending upon the host system
in which the polypeptide is to be expressed.
The "polypeptide" of the invention is any one
comprising any part of the modified galectin 9 mutein
including the mature protein, as long as it includes a
modified galectin 9 variant polypeptide or a fragment
thereof, and may further include truncations, variants,
alleles, analogs and derivatives thereof. The variants can
be spliced variants expressed from the same gene as the
related protein. Unless specifically mentioned otherwise,
such a polypeptide possesses one or more of the
bioactivities of the galectin 9 protein, including for
example specific binding affinity for a specific saccharide
chain or binding activity to a specific partner. This term
"polypeptide" is not limited to a specific length of the
product of the gene. Thus, polypeptides that are identical
or contain at least 60%, preferably 70%, still preferably
80%, more preferably 90%, and most preferably 95% homology
to the target protein or the mature protein with regard to
the N-terminal carbohydrate recognition domain (NCRD) and
C-terminal carbohydrate recognition domain (CCRD) of
galectin 9, wherever derived, from human or nonhuman
sources are included within this definition of the
polypeptide. Also included, therefore, are alleles and
variants of the product of the gene that contain amino acid
substitutions, deletions, or insertions. The amino acid
substitutions can be conservative amino acid substitutions
or substitutions to eliminate non-essential amino acid
residues, such as to alter a glycosylation site, a
phosphorylation site, an acetylation site, or to alter the
folding pattern by altering the position of the cysteine
CA 02561696 2006-09-28
=
- 37 -
residue that is not necessary for function. Conservative
amino acid substitutions are those that preserve the
general charge, hydrophobicity/hydrophilicity and/or steric
size (bulk) of the amino acid substituted, for example,
substitutions between the members of the following groups
are conservative substitutions: Gly/Ala, Val/Ile/Leu,
Asp/Glu, Lys/Arg, Asn/Gln, Ser/Cys/Thr and Phe/Trp/Tyr.
Analogues include peptides having one or more
peptide mimics, also known as peptoids, that possess the
target protein-like activity. Included within the
definition as set forth herein are, for example,
polypeptides containing one or more analogues of an amino
acid (including, for example, unnatural amino acids, etc.),
polypeptides with substituted linkages, as well as other
mutations/modifications known in the art, both naturally
occurring and non-naturally occurring. The term
"polypeptide" also does not exclude post-translational
modifications of the polypeptide, for example,
glycosylations, acetylations, phosphorylations,
myristoylations and the like.
The term "naked DNA" as used herein refers to
polynucleotide DNA for administration to a mammal for
expression in the mammal. The polynucleotide can be, for
example, a coding sequence, and the polynucleotide DNA can
be directly or indirectly connected to an expression
control sequence that can facilitate the expression of the
coding sequence once the DNA is inside a cell. The
indirect connection is equivalent from the perspective of
facilitating the expression of the DNA in the mammalian
cells, and merely allows the possibility of the inclusion
of other sequences between the regulatory region and the
coding sequence that may facilitate the expression further,
or may merely act as a linker or spacer to facilitate
connecting the two polynucleotide regions together.
= CA 02561696 2006-09-28
- 38 -
The "vector" used herein refers to an assembly
which is capable of directing the expression of one or more
sequences of interest, or one or more genes of interest.
The vector must include transcriptional promoter/enhancer
or one or more locus defining elements, or other elements
which control gene expression by other means, such as
alternate splicing, nuclear RNA export, post-translational
modification of messenger, or post-transcriptional
modification of protein. In addition, the vector must
include a sequence which, when transcribed, is operably
linked to one or more sequences or genes of interest and
acts as a translation initiation sequence. Optionally, the
vector may also include a signal which directs
polyadenylation, a selectable marker such as Neo, TK,
hygromycin, bleomycin (phleomycin), histidinol, or DHFR, as
well as one or more restriction sites and a translation
termination sequence. Further, if the vector is placed
into a retrovirus, the vector must include a packaging
signal, long terminal repeats (LTRs), and positive and
negative strand primer binding sites appropriate to the
retrovirus used (if these are not already present).
The "tissue-specific promoter" refers to
transcriptional promoter/enhancer or locus defining
elements, or other elements which control gene expression
as discussed above, which are preferentially active in a
limited number of tissue types or cell types.
Representative examples of such tissue-specific promoters
include the PEPCK promoter, HER2/neu promoter, casein
promoter, IgG promoter, chorionic embryonic antigen
promoter, elastase promoter, porphobilinogen deaminase
promoter, insulin promoter, growth hormone factor promoter,
tyrosine hydroxylase promoter, albumin promoter, a-
fetoprotein promoter, acetyl-choline receptor promoter,
alcohol dehydrogenase promoter, a- or 13-globin promoters,
T-cell receptor promoter, or osteocalcin promoter.
CA 02561696 2006-09-28
. = .
- 39 -
The "event-specific promoter" refers to
transcriptional promoter/enhancer or locus defining
elements, or other elements which control gene expression
as discussed above, whose transcriptional activity is
altered upon response to cellular stimuli. Representative
examples of such event-specific promoters include thymidine
kinase or thymidilate synthase promoters, a- or 0-
interferon promoters, and promoters that respond to the
presence of hormones (natural, synthetic or from other
nonhost organisms, e.g., insect hormones).
The term "fusion protein" or "fusion polypeptide"
refers to proteins or polypeptides obtainable by the
recombinant expression of more than one heterologous coding
sequence in a vector or contiguous connection such that
expression of the polypeptide in the vector results in
expression of one polypeptide that includes more than one
protein or portion of more than one protein. Most
optimally, the fusion protein retains the biological
activity of at least one of the polypeptide units from
which it is built. Preferably, the fusion protein
generates a synergistic improved bioactivity by combining
the portion of the separate proteins to form a single
polypeptide. The produced fusion protein can also be
created with a polypeptide that has function and a peptide
or polypeptide that has no function when expressed, but
which serves a purpose for the expression of the
polypeptide with activity. Examples of fusion proteins
useful for the invention include any modified galectin 9
mutein fusion polypeptide genetically engineered to some
advantage for the therapy, detection or assay, and further
analysis or isolation/purification.
The term "chimera" or "chimeric protein" means an
equivalent to fusion protein or fusion polypeptide. The
"chimeric molecule" can be a fusion polypeptide, or a
polynucleotide fusion molecule encoding a fusion
CA 02561696 2006-09-28
- 40 -
polypeptide. The chimera can be constructed from ligated
DNA coding sequences and expressed in a cell system, or
administered in a vector for expression in vivo in an
animal. For example, a chimera or fusion protein including
a modified galectin 9 mutein can be administered in a gene
therapy protocol in vivo or ex vivo.
The "patient" can be any treatable living
organism, including but not limited to an eukaryote or a
prokaryote. The patient eukaryote can be, for example, a
vertebrate or an invertebrate. Thus, for example, the
patient can be a fish, a bird, a worm, an insect, a mammal,
a reptile, an amphibian, a fungi, or a plant, preferably a
mammal. The mammal can be, for example a human.
Described below is general methods of making and
using a modified galectin 9 mutein therapeutic Agents
and/or diagnostic agents. In one aspect, the present
invention provides a technique for treating a disorder,
disease, or abnormal condition occurred due to the
deficiency or absence of physiological or biological
activity retained by galectin 9. Said treating technique
includes for example a step of providing a modified
galectin 9 mutein therapeutic agent, and/or a step of
administering an effective amount of the modified galectin
9 mutein therapeutic agent to a mammal bearing said
disorder, etc. Modified galectin 9 muteins are cytotoxic
on malignant tumor cells, active in induction of apoptosis
in malignant cells, antitumor (anticancer or
antineoplastic) on malignant tumor cells, active in
induction of apoptosis in activated T cells (inter alia
CD4-positive T cells), immunomodulatory (immunoregulatory),
anti-inflammatory, and antiallergic. Therefore, modified
galectin 9 muteins can be expected to serve as anti-tumor
agents (anti-neoplastic agents), anti-allergy agents,
immunoregulators (immunomodulators), therapeutic agents for
autoimmune diseases, anti-inflammatory agents, and
CA 02561696 2006-09-28
- 41 -
alternatives to adrenocortical steroid hormones. Said
treating technique includes a method for treating an
autoimmune disease manifesting activated T-cells. The
"autoimmune disease", "autoimmune" and "autoimmunity" all
refer to a disorder characterized by autoimmunity in the
mammal which is the response of an immune system against
self components. An autoimmune response can develop into a
condition manifesting clinical symptoms. Although strictly
speaking transplantation rejection is not an autoimmune
reaction, where patient condition prescribes surgery to
replace or graft cells, tissue or an organ, the body
receiving the allograft can react immunologically against
the foreign graft. "Transplantation rejection" occurs when
during an allograft of cells, tissue, or an organ, from one
member of a species to another, an immune response in the
recipient results, sufficient to reject the transplanted
cells, tissue or organ.
The inventive methods and therapeutic agents
(drugs) can be applied to "tumors". Examples of such
tumors may include malignant tumors. For example, a tumor
that may metastasize to several sites is a malignant
neoplasm, and the term "malignant neoplasm" is generally
referred to as being epithelial or non-epithelial and may
be distinguished as being cancer, sarcoma, or leukemia, etc.
Among the general public, when the neoplasm or tumor is
simply called "cancer", it refers to a malignant neoplasm
or tumor. As used herein, the term "cancer" is employed in
the broadest sense and should not be interpreted as being
just an epithelial malignant neoplasm. The term "cancer"
used herein may cover epithelial malignant tumors and non-
epithelial malignant tumors (including those that are
tumorigenic and non-tumorigenic), such as skin cancers
(which may include melanomas), breast cancers, ovarian
cancers, uterine cancers, malignant testicular tumors,
prostatic cancers, urinary bladder cancers, renal cancers,
thyroid cancers, pharyngeal/larynx cancers, tongue cancers,
= CA 02561696 2006-09-28
- 42 -
maxillary cancers, esophageal cancers, stomach cancers,
colon/rectal cancers, lung/bronchial cancers, liver cancers
(including liver cell cancers and intrahepatic bile duct
cancers), extrahepatic bile duct/gall bladder cancers,
pancreatic cancers, leukemia, malignant lymphoma,
plasmacytoma, osteosarcoma, chondrosarcoma, leiomyosarcoma,
rhabdomyosarcoma, liposarcoma, fibrosarcoma, malignant
hemangioma, malignant hemangioendothelioma, brain tumors
(including meningioma, glyoma, astrocytoma), etc., but is
not restricted to these. It should be understood that they
may encompass those wherein the application of the
inventive modified Gal-9 variant will give bright prospects,
and further those wherein some sort of physiological or
biological responses will take place in association with
said modified Gal-9 variant.
Examples of "autoimmune diseases" that can be
treated by the method and therapeutic agent of the
invention include multiple sclerosis, Hashimoto's
thyroiditis, systemic lupus erythematosus (SLE),
Goodpasture's syndrome, Pemphigus, receptor autoimmunity,
autoimmune hemolytic anemia, autoimmune thrombocytopenic
purpura, osteoarthritis, chronic rheumatoid arthritis,
schleroderma with anticollagen antibodies, mixed connective
tissue disease, polymyositis, pernicious anemia, idiopathic
Addison's disease, spontaneous infertility,
glomerulonephritis, bullous pemphigoid, adrenergic drug
resistance, chronic active hepatitis, primary biliary
cirrhosis, autoimmune-based endocrine gland failure,
vitiligo, vasculitis, post-myocardial infarction,
cardiotomy syndrome, urticaria, atopic dermatitis,
autoimmune-based asthma, autoimmune-based inflammatory
reactions, granulomatous disorders, alkylizing spondylitis,
poststreptococcal glomerulonephritis, autoimmune hemolytic
anemia, encephalitis, autoimmune reaction secondary to
lymphoma, degenerative disorders, and atrophic disorders.
Autoimmune diseases manifesting receptor autoimmunity
CA 02561696 2006-09-28
- 43 -
include, for example, Grave's disease, myasthenia gravis,
insulin resistance and others. Autoimmune diseases of
adrenergic drug resistance include, for example, asthma,
cystic fibrosis, and others.
Other autoimmune diseases appropriate for the
invention include, for example those for which an animal
model exists, including for example, SjOgren's syndrome
(autoimmune dacryodentis or immune-mediated sialadenitis),
autoimmune myocarditis, primary biliary cirrhosis (PBC),
inflammatory heart disease, mercury-induced renal
autoimmunity, insulin dependent diabetes mellitus (type I
diabetes or IDD), post-thymectomy autoimmunity, a central
nervous system (CNS) demyelination disorder, CNS lupus,
narcolepsy, an immune-mediated PNS disorder, osteoarthritis,
rheumatoid arthritis, uveitis, medullary cystic fibrosis,
autoimmune hemolytic disease, autoimmune vasculitis,
ovarian autoimmune disease, human scheroderma, etc. An
autoimmune disease characterized by a central nervous
system (CNS) demyelination disorder can be, for example,
multiple sclerosis (MS), etc. A peripheral nervous system
(PNS) autoimmune disease can be, for example, Guillain-
Barre syndrome (GBS).
The modified galectin 9 mutein therapeutic agent
can include a polypeptide, a polynucleotide, a small
organic compound, a peptide, a peptoid compound, a peptidic
substance, or others. The modified galectin 9 mutein
therapeutic agent can be a modified galectin 9 mutein
polypeptide, a polynucleotide encoding a modified galectin
9 mutein polypeptide, a fusion polypeptide comprising a
portion of the inventive modified galectin 9 mutein
polypeptide, a polynucleotide encoding a fusion polypeptide
comprising a portion of said modified galectin 9 mutein
polypeptide, a biologically active peptide derivative of
modified galectin 9 mutein polypeptide, a biologically
= CA 02561696 2006-09-28
- 44 -
active peptoid compound or peptidic substance derived from
modified galectin 9 mutein polypeptide, or a small organic
modified galectin 9 mutein mimic (including an agonist) of
modified galectin 9 mutein activity. The modified galectin
9 mutein polypeptide can be a biologically active modified
galectin 9 mutein polypeptide such as a modified galectin 9
mutein polypeptide variant, a modified galectin 9 mutein
polypeptide derivative, a mutant polypeptide derived from
the modified galectin 9 mutein polypeptide, or a truncated
modified galectin 9 mutein polypeptide. The polynucleotide
encoding a modified galectin 9 mutein polypeptide can be a
polynucleotide sequence encoding modified galectin 9 mutein
polypeptide with both full length N-terminal CRD and full
length C-terminal CRD of wild type galectin 9, a sequence
encoding a biologically active portion of modified galectin
9 mutein polypeptide, a sequence encoding a biologically
active peptide derived from modified galectin 9 mutein
polypeptide, a sequence encoding a soluble modified
galectin 9 mutein polypeptide, etc. Another embodiment of
the invention is a composition having a gene delivery
vehicle capable of expressing a polynucleotide sequence
encoding a modified galectin 9 mutein polypeptide.
In the present invention, utilization of "gene
recombination techniques" allows not only construction,
acquisition, isolation, and sequencing of targeted nucleic
acid molecules (polynucleotides), proteins (peptides and
fragments thereof), but also creation and production of
recombinant constructs thereof. Gene recombination
techniques (including recombinant DNA techniques) as can be
used herein include those known in the art, and can be
carried out by the methods described in, for example, J.
Sambrook, E. F. Fritsch & T. Maniatis, "Molecular Cloning:
A Laboratory Manual (2nd edition)", Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, New York (1989); D. M.
Glover et al. ed., "DNA Cloning", 2nd ed., Vol. 1 to 4,
(The Practical Approach Series), IRL Press, Oxford
= CA 02561696 2006-09-28
- 45 -
University Press (1995); The Japanese Biochemical Society
(JBS) ed., "Zoku-Seikagaku Jikken Koza 1, Idenshi Kenkyu-
Hou II", Tokyo Kagaku Dozin Co. Ltd., Japan, (1986); JBS
ed., "Shin-Seikagaku Jikken Koza 2, Kakusan III
(Recombinant DNA technique)", Tokyo Kagaku Dozin Co. Ltd.,
Japan, (1992); M. J. Gait (Ed), Oligonucleotide Synthesis,
IRL Press (1984); B. D. Hames and S. J. Higgins (Ed),
Nucleic Acid Hybridization, A Practical Approach, IRL Press
Ltd., Oxford, UK (1985); B. D.Hames and S. J. Higgins (Ed),
Transcription and Translation: A Practical Approach
(Practical Approach Series), IRL Press Ltd., Oxford, UK
(1984); B. Perbal, A Practical Guide to Molecular Cloning
(2nd Edition), John Wiley & Sons, New York (1988); J. H.
Miller and M. P. Cabs (Ed), Gene Transfer Vectors for
Mammalian Cells, Cold Spring Harbor Laboratory, Cold Spring
Harbor, New York (1987); R. J. Mayer and J. H. Walker (Ed),
Immunochemical Methods in Cell and Molecular Biology,
Academic Press, (1987); R. K. Scopes et al. (Ed), Protein
Purification: Principles and Practice (2nd Edition, 1987 &
3rd Edition, 1993), Springer-Verlag, N.Y.; D. M. Weir and
C. C. Blackwell (Ed), Handbook of Experimental Immunology,
Vol.1, 2, 3 and 4, Blackwell Scientific Publications,
Oxford, (1986); L. A. Herzenberg et al. (Ed), Weir's
Handbook of Experimental Immunology, Vol. 1, 2, 3 and 4,
Blackwell Science Ltd. (1997); R. W. Ellis (Ed), Vaccines
new approaches to immunological problems, Butterworth-
Heinemann, London (1992); R. Wu ed., "Methods in
Enzymology", Vol. 68 (Recombinant DNA), Academic Press, New
York (1980); R. Wu et al. ed., "Methods in Enzymology", Vol.
100 (Recombinant DNA, Part B) & 101(Recombinant DNA, Part
C), Academic Press, New York (1983); R. Wu et al. ed.,
"Methods in Enzymology", Vol. 153 (Recombinant DNA, Part D),
154 (Recombinant DNA, Part E) & 155 (Recombinant DNA, Part
F), Academic Press, New York (1987); J. H. Miller ed.,
"Methods in Enzymology", Vol. 204, Academic Press, New York
(1991); R. Wu et al. ed., "Methods in Enzymology", Vol. 218,
Academic Press, New York (1993); S. Weissman (ed.),
3 1 1 62 5 CA 02561696 2012-05-10
-46-
"Methods in.Enzymology", Vol. 303, Academic Press, New York
(1999); J. C. Gloriosa et al. (ed.), "Methods in
Enzymology", Vol. 306, Academic Press, New York (1999),
etc., or by methods described in the references quotedL
therein or substantially equivalent methods thereto or
modified methods thereof
(hereinafter', all such
techniques or methods shall be referred to as "gene
recombination techniques").
As used herein, the term "homology" or
"homologous" means the quantity (or number), in terms of
identity, which can be obtained by determining that
corresponding amino acid residues or corresponding
nucleotide bases are matched each other between two chains
in polypeptide sequences (or amino acid sequences) or
polynucleotide sequences (or nucleotide sequences) when
amino acid residues or nucleotide bases constituting the
chain are compared one another between the two chains and
it also means the level of sequence correlatipn in terms of
similarity between two polypeptide sequences or two
polynucleotide- sequences. The homology can be easily
calculated. Various methods for measuring the homology
between two polynucleotide sequences or polypeptide.
sequences have been known and the term "homology"
(sometimes called "identity") has been well known to the
persons skilled in the art (for example, Lesk, A. M. (Ed.),
Computational Molecular Biology, Oxford University Press,
New York, (1988); Smith, D. W. (Ed.), Biocomputing:
Informatics and Genome Projects, Academic Press, New York,
(1993); Grif in, A. M. & Grif in, H. G. (Ed.), Computer
Analysis of Sequence Data: Part I, Human Press, New Jersey,
(1994); von Heinje, G., Sequence Analysis in Molecular
Biology, Academic Press, New York, (1987); Gribskov, M. &
Devereux, J. (Ed.), Sequence Analysis Primer, M-Stockton
Press, New York, (1991), etc.). Generic techniques for
determining the homology between two strands include those
CA 02561696 2006-09-28
,
- 47 -
disclosed in Martin, J. Bishop (Ed.), Guide to Huge
Computers, Academic Press, San Diego, (1994); Carillo, H. &
Lipman, D., SIAM J. Applied Math., 48: 1073 (1988), etc.,
but are not limited to. Preferred methods for measuring
the homology include those which are designed so as to
obtain the part of the highest fitting relation between the
two sequences tested. An example of such methods is a
technique which is constructed as a computer program.
Preferred computer programming methods include a GCG
program package (Devereux, J. et al., Nucleic Acids
Research, 12(1): 387 (1984)), BLASTP, BLASTN, PASTA,
(Atschul, S. F. et al., J. Mol. Biol., 215: 403 (1990)),
etc., but are not limited to. For such methods, those
known in the art may be employed.
The term "polymerase chain reaction" or "PCR"
used herein usually refers to techniques described in US
Patent No. 4,683,195 and other documents. For example, the
PCR is an in vitro method for the enzymatic amplification
of desired specific nucleotide sequences. In general, the
PCR includes repetitive series of cycles wherein a primer
elongation synthesis is constructed using two
oligonucleotide primers capable of preferentially
hybridizing with a template nucleic acid. Typically, the
primers used in PCR may include those which are
complementary to the internal nucleotide sequence of
interest in the template. For example, preferable primer
pairs as used herein may be those which are complementary
to both ends of said nucleotide sequence to be amplified,
or flanking regions adjacent to said nucleotide sequence.
It is preferable to select a 5'-terminal primer such that
at least an initiation codon is contained or the
amplification can be performed including the initiation
codon, and to select a 3'-terminal primer such that at
least a stop codon is contained or the amplification can be
performed including the stop codon. The primers include
oligonucleotides made up of preferably 5 or more nucleotide
CA 02561696 2006-09-28
- 48 -
bases, more preferably 10 or more nucleotide bases, and
still preferably 18 to 25 nucleotide bases.
The PCR reactions can be carried out by methods
known in the art or substantially equivalent methods
thereto and modified methods thereof. For example, the PCR
can be performed according to methods described in R. Saiki,
et al., Science, 230: 1350, 1985; R. Saiki, et al., Science,
239: 487, 1988 ; H. A. Erlich ed., PCR Technology, Stockton
Press, 1989 ; D. M. Glover et al. ed., "DNA Cloning", 2nd
ed., Vol. 1, (The Practical Approach Series), IRL Press,
Oxford University Press (1995) ; M. A. Innis et al. ed.,
"PCR Protocols: a guide to methods and applications",
Academic Press, New York (1990)); M. J. McPherson, P.
Quirke and G. R. Taylor (Ed.), PCR: a practical approach,
IRL Press, Oxford (1991); M. A. Frohman et al., Proc. Natl.
Acad. Sci. USA, 85, 8998-9002 (1988) and other documents,
and modified methods or variants thereof. The PCR methods
can also be performed using commercially available kits
suitable therefor, and can also be carried out according to
protocols disclosed by manufacturers or distributors of the
kits.
In a representative case, the PCR is performed
for example, using a template (e.g., DNA synthesized using
mRNA as a template; 1st strand DNA) and primers synthesized
according to designs on said gene, in admixture with a 10X
reaction buffer (contained in a Taq DNA polymerase kit),
dNTPs (deoxyribonucleoside triphosphates; dATP, dGTP, dCTP
and dTTP mix), Taq DNA polymerase and deionized distilled
water. The mixture is subjected to 25 to 60 cycles of
amplification using an automated thermal cycler such as
GeneAmp 2400 PCR system (Perkin-Elmer/Cetus) under general
PCR cycle conditions. The number of amplification cycles
can be suitably set to an appropriate value depending on
purposes. The PCR cycle includes, for example,
denaturation at 90 to 95 C for 5 to 100 sec, annealing at 40
= CA 02561696 2006-09-28
- 49 -
to 60 C for 5 to 150 sec and extension at 65 to 75 C for 30
to 300 sec, and preferably denaturation at 94 C for 15 sec,
annealing at 58 C for 15 sec and extension at 72 C for 45
sec. For the annealing temperature and reaction time, an
appropriate value is suitably selected by experimentation.
For the denaturation and extension time, an appropriate
value suitably varies according to the strand length of
expected PCR products. In general, the annealing reaction
time preferably varies depending on the Tm value of primer-
template DNA hybrids. The time period of extension is
usually set with the aim of getting about 1 min per 1000 bp
in strand length, but it may be possible to select a
shorter time period in some cases.
The term "oligonucleotide(s)" used herein refers
to a relatively short single-stranded polynucleotide or
double-stranded polynucleotides, or preferably
polydeoxynucleotide(s). They can be chemically synthesized
by known methods as described in Angew. Chem. Int. Ed.
Engl., Vol. 28, pp.716-734 (1989), including
phosphotriester, phosphodiester, phosphite, phosphoramidite,
phosphonate methods, and the like. It has been typically
known that the synthesis can be conveniently carried out on
modified solid supports. For example, the synthesis can be
carried out using an automated synthesizer and such a
synthesizer is commercially available. The oligonucleotide
may contain one or more modified nucleotide bases. For
example, it may contain a nucleotide base which does not
naturally occur, such as inosine, or a tritylated
nucleotide base. In some cases, they may contain one or
more nucleotide bases tagged with a marker.
The target nucleic acid molecules
(polynucleotides) can be identified by adaptations of
hybridization techniques. The hybridization may be carried
out according to methods as described in documents
disclosing the aforementioned "gene recombination
= CA 02561696 2006-09-28
- 50 -
t e chni ques" , or substantially equivalent methods and
modifications thereof. For instance, the hybridization is
achieved by transferring a sample containing a nucleic acid
such as DNA onto a carrier including a membrane such as a
nylon filter, as required, optionally followed by
denaturation, fixation, washing, etc., and then reacting
the transfers on the carrier (e.g., membrane), with labeled
DNA probe fragments which are, as required, optionally
denatured in a hybridization buffer.
The hybridization operations can be ordinarily
conducted at about 35 to about 80 C, more preferably about
50 to about 65 C, for about 15 min to about 36 hours, more
preferably about 1 to about 24 hours, but optimal
hybridization conditions may be suitably selected. For
example, the hybridization is carried out at about 55 C for
about 18 hours. The hybridization buffers can be selected
from those customarily used in the art. Examples of the
hybridization buffers are Rapid hybridization buffer
(Amersham), etc. The denaturation of carriers (e.g.,
membranes, etc.) with transfers includes techniques using
an alkali denaturing solution. It is preferable to treat
the carrier with a neutralizing solution and a buffer
solution after the denaturation. The carrier fixation
(e.g., membrane fixation) is usually achieved by baking at
about 40 to about 100 C, more preferably about 70 to about
90 C, for about 15 min to about 24 hours, more preferably
about 1 to about 4 hours, but desired fixation conditions
may be suitably selected. For example, the fixation is
carried out by baking at about 80 C for about 2 hours. The
washing of carriers (e.g., membranes) with transfers can be
performed with washing solutions customarily used in the
art, such as 50mM Tris-HC1 buffer, pH8.0, containing 1M
NaC1, 1mM EDTA and 0.1% sodium dodecyl sulfate (SDS). The
carriers including membranes can be selected from those
customarily used in the art. Examples of such carriers
include nylon filters.
CA 02561696 2006-09-28
-51 -
The alkaline denaturing solution, neutralizing
solution and buffer solution can be selected from those
conventionally used in the art. The alkaline denaturing
solution may include, for example, solutions containing
0.5M NaOH and 1.5M NaC1, etc. The neutralizing solution
may include, for example, 0.5M Tris-HC1 buffers, pH8.0,
containing 1.5M NaCl, etc. The buffer solution may include,
for example, 2 XSSPE (0.36M NaC1, 20mM NaH2PO4 and 2mM EDTA),
etc. As required, prior to hybridization, it is desirable
that carriers (e.g., membranes) with transfers are
optionally prehybridized for the prevention of non-specific
hybridization. For the prehybridization, the sample is
dipped, for example, in a solution for prehybridization
[50% formamide, 5XDenhardt's solution (0.2% bovine serum
albumin and 0.2% polyvinylpyrrolidone), 5XSSPE, 0.1% SDS,
and 100g/ml thermally denatured salmon sperm DNA] and the
like, and reacted at about 35 C to about 50 C, preferably
about 42 C, for about 4 to about 24 hours, preferably about
6 to about 8 hours. These conditions can be determined by
those of skill in the art with suitably repeated
experiments and more preferred conditions would be selected.
Labeled probe DNA fragments used in hybridization can be
denatured, for example, under heating conditions at about
70 to 100 C, preferably about 100 C, for about 1 to 60
minutes, preferably about 5 minutes, etc. The
hybridization is carried out by well known techniques per
se in the art or according to methods analogous thereto.
As used herein, the stringent conditions refer to, for
example, those equivalent to hybridization in about 15 to
50 mM, preferably about 19 to 40 mM, and more preferably
about 19 to 20 mM, with regard to Na ion concentration, at
about 35 to 85 C, preferably about 50 to 70 C, and more
preferably about 60 to 65 C with regard to temperature.
After the hybridization is completed, the
carriers (such as filters) are washed extensively to remove
labeled probes other than the labeled probe DNA fragments
CA 02561696 2006-09-28
- 52 -
which specifically hybridize. Thereafter, detections are
done. The carrier (filter) washing process may be
performed by a method suitably selected from techniques
used in the art. For example, the washing is carried out
in 0.5XSSC solution (XSSC = 0.15M Nadi, 15mM citric acid)
containing 0.1% SDS. The hybridized nucleic acids can be
detected representatively by autoradiography, but the
detection may be performed by a method suitably selected
from techniques used in the art. A nucleic acid band
corresponding to the detected signal is suspended in a
suitable buffer solution such as SM solution (50mM Tris-HC1
buffer, pH7.5, containing 100m14 NaCl and 10mM MgSO4). After
the nucleic acid suspension is diluted to a suitable level,
target nucleic acids can be isolated and purified. Further,
the nucleic acids can be subjected to amplification.
The term "high homology" as used herein may refer
to, though it depends on the sequence length of the targets,
for example, 50% or higher, further 60% or higher,
preferably 70% or higher, still preferably 80% or higher,
in a particular case 95% or higher and most preferably 97%
or higher homology. The "nucleotide sequence with the same
efficacy" or "equivalently effective nucleotide sequence"
includes, for example, those which hybridize with any of
those containing the sequence of interest under stringent
conditions. Examples of such nucleotide sequences are
those which not only hybridize with a nucleotide sequence
with 5 or more contiguous nucleotides, preferably 10 or
more contiguous nucleotides, more preferably 15 or more
contiguous nucleotides, or further preferably 20 or more
contiguous nucleotides, selected from said nucleotide
sequence, but also code for a substantially equivalent
amino acid sequence to said polypeptide. The nucleic acid
molecules may also be chemically synthesized. In such
cases, fragments may be chemically synthesized and coupled
together with enzymes.
CA 02561696 2006-09-28
- 53 -
Screening treatments can be repeated plural times
with hybridization techniques for target nucleic acid
molecules from nucleic acid samples including gene
libraries, cDNA libraries, and others. Utilizable cDNA
libraries are cloned human-derived ones including, for
example, cDNA libraries of various human-derived tissues,
cultured human cells, or human cell lines (in particular,
human body parts, human tissues and cells such as kidney,
brain, corpus peale, posterior pituitary gland, nerve cells,
retina, retinal blood vessel cells, retinal nerve cells,
thymus, blood vessel, endothelial cells, vascular smooth
muscle cells, blood cells, macrophages, lymphocytes, testis,
ovary, uterus, intestine, heart, liver, pancreas, small
intestine, large intestine (including colon and rectum),
gingiva-related cells, skin-related cells, glomerular cells,
renal tubular cells, and connective tissue cells; various
tumor tissues, and cancer cells; and other sources).
Further, the cDNA library used as a template may be
directly selected from commercially available cDNA
libraries derived from a variety of tissues. Examples of
the commercially available cDNA libraries are those
commercially distributed or delivered by Stratagene (US),
Invitrogen (US), Clontech (US), and other distributors. In
typical embodiments, the utilizable products include gene
libraries generated from human tissues and cells, such as
human P1 artificial chromosome genomic libraries (Human
Genome Mapping Resource Center, US), and human tissue cDNA
libraries (e.g., available from Clontech, US). The
screening with probes can be done using human genomic DNA
libraries or human-derived cDNA libraries constructed from
various human tissues or culture cell lines and other
resources. The probe, etc. may be labeled, with a
radioactive isotope, using a commercially available
labeling kit, such as the Random Prime DNA Labeling Kit
(Boehringer Mannheim), etc. For example, a random priming
kit (Pharmacia LKB, Uppsala), etc. may be used to label the
probe DNA with [ft-32P]dCTP (Amersham), etc. and thus
CA 02561696 2006-09-28
- 54 -
provide a probe with radioactivity.
Phage particles, recombinant plasmids,
recombinant vectors and others, containing the target
nucleic acid molecules, can be isolated and purified by
customary techniques used in the art. For instance, they
are obtained by glycerol gradient ultracentrifugation
(Molecular Cloning, a laboratory manual, ed. T. Maniatis,
Cold Spring Harbor Laboratory, 2nd ed. 78, 1989),
electrophoresis and other isolation/purification techniques.
DNA can be isolated and purified from phage particles and
the like by a member selected from customary techniques
used in the art. For instance, the resulting phages are
suspended in TM solution (50mM Tris-HC1 buffer, pH7.8,
containing 10mM Mg504), etc., and treated with DNase I and
RNase A, etc., followed by addition of a Proteinase K
mixture solution (20mM EDTA, 50 4g/m1 Proteinase K and 0.5%
SDS). The resultant mixture is incubated at about 65 C for
1 hr., subjected to phenol extraction and then to diethyl
ether extraction, followed by precipitation with ethanol to
form DNA pellets. Next, the resultant DNA is washed with
70% ethanol, dried and dissolved in TE solution (10mM Tris-
HC1 buffer, pH8.0, containing 10mM EDTA). A large amount
of target DNA can be obtained by subcloning, etc. For
example, the subcloning can be performed with plasmid
vectors, etc. in host E. coli, etc. The DNA thus subcloned
can also be isolated and purified by techniques including
phenol extraction, ethanol precipitation, etc. in the same
manner as aforementioned.
The resultant nucleic acid molecules (including
DNA) such as PCR products are typically herein subjected to
electrophoresis on 1 to 2% agarose gels. Specific bands
are cut out from the gel, and DNA is extracted with a
commercially available kit, e.g., Gene clean kit (Bio 101)
and the like. The extracted DNA is cleaved with
appropriate restriction enzymes and purified if necessary.
= CA 02561696 2006-09-28
- 55 -
Further, the 5'-end is, if necessary, phosphorylated with
T4 polynucleotide kinase, etc. and subsequently the DNA is
ligated into an appropriate plasmid vector including a pUC
vector system such as pUC18, and transformed into suitable
competent cells. The cloned PCR products are sequenced and
analyzed. Commercially available plasmid vectors such as
p-Direct (Clontech), pCR-Script SK(+) (Stratagene), pGEM-T
(Promega), and pAmp (Gibco-BRL) are useful for cloning of
the PCR products. Transformation (transfection) of host
cells can be carried out by methods known in the art such
as the calcium method, the rubidium/calcium method, the
calcium/manganese method, the TFB high efficiency method,
the FSB frozen competent cell method, the rapid colony
method, electroporation and a member selected from methods
known in the art and substantial equivalents thereto (D.
Hanahan, J. Mol. Biol., 166: 557, 1983, etc.). Reverse
transcription PCR (polymerase chain reaction coupled
reverse transcription; RT-PCR) and RACE (rapid
amplification of cDNA ends) can be applied to isolate the
target DNA. RACE can be carried out according to the
methods, for example, described in M. A. Innis et al. ed.,
"PCR Protocols" (M. A. Frohman, "a guide to methods and
applications"), pp.28-38, Academic Press, New York (1990),
etc.
DNA of interest can be cloned depending on
necessity. Suitable vectors for cloning DNA include
plasmids, 2. phages, cosmids, P1 phage, F element, YAC and
others, and are preferably vectors derived from X phages,
such as Charon 4A, Charon 21A, 2.gt10, 2.gt11, XDASHII, A.
FIXII, XEMBL3, and XZAPII6 (Stratagene). The resultant
DNA can be incorporated into an appropriate vector such as
plasmid pEX, pMAMneo, and pKG5, as described in detail
below, and can be expressed in appropriate host cells, e.g.,
E. coli, yeast, CHO cells, COS cells and others as
described in detail below. The DNA fragments can be
introduced into animal cells as intact molecules or
CA 02561696 2006-09-28
- 56 -
appropriate control sequence-added DNA fragments or after
incorporated into an appropriate vector. Thus, transgenic
animals which express the given gene can be produced. The
animals include mammalian animals, and include, for example,
mice, rats, rabbits, guinea pigs, cattle etc. Preferably,
the transgenic animal can be produced by introducing the
DNA fragments into fertilized eggs of an animal such as a
mouse. Targeted gene products are verified using suitable
animal cells, such as 293T cells and COS-1 cells,
transfected with said foreign gene.
The methods for transferring foreign genes into
mammal animal cells may be practicable ones known in the
art or substantially similar techniques thereto, The
method may include, for example, the calcium phosphate
method (e.g., F. L. Graham et al., Virology, 52: 456, 1973,
etc.), the DEAE-dextran method (e.g., D. Warden et al., J.
Gen. Virol., 3: 371, 1968, etc.), electroporation (e.g., E.
Neumann et al., EMBO J, 1: 841, 1982, etc.), microinjection,
the liposome method, virus infection, the phage particle
method and others. The gene products produced in the
animal cells transfected with the given gene in such ways
can also be analyzed.
Any plasmid into which the target gene and others
(DNA obtainable in the present invention and the like) are
incorporated may be used as long as said DNA can be
expressed in host cells conventionally used in genetic
engineering techniques (such as prokaryotic host cells
including Escherichia coli, Bacillus subtilis, etc. and
eukaryotic host cells including yeast cells, CHO cells, COS
cells, and insect host cells such as Sf21. It goes without
saying that it is possible to use those selected from
attachments and reagents in commercially available kits.
In such plasmid sequences, it is possible, for example, to
contain modified codons suitable for expressing the cloned
DNA in selected host cells or to construct restriction
= CA 02561696 2006-09-28
- 57 -
enzyme sites. It is also possible to contain control
sequences, enhancer sequences, and other sequences for
facilitating the expression of the target gene; linkers,
adaptors and others, useful for ligating the target gene;
effective sequences useful in controlling resistance to
antibiotics or in controlling metabolism or in selection
(including those coding for hybrid proteins and fusion
proteins); and the like. Preferably, suitable promoters
may be used. For example, such promoters may include
tryptophan promoter (trp), lactose promoter (lac),
tryptophan-lactose promoter (tac), lipoprotein promoter
(lpp), 2. phage PL promoter, etc. in the case of plasmids
where hosts are E. coli; SV40 late promoter, MMTV LTR
promoter, RSV LTR promoter, CMV promoter, SRa promoter, etc.
in the case of plasmids where hosts are animal cells; and
GAL1, GAL10 promoters, etc. in the case of plasmids where
hosts are yeast cells. It is also possible to use
regulation systems such as CYC1, HI53, ADH1, PGK, PH05,
GAPDH, ADC, TRP1, URA3, LEU2, ENO, TP1, and A0X1.
An enhancer can be inserted into the vector to
facilitate the transcription of DNA encoding the desired
polypeptide. Such enhancers include elements of
approximately 10 to 100 bp, acting on the promoter to
facilitate the transcription and typically having a cis
action. A great number of enhancers have been known in
mammalian genes such as globin, elastase, albumin, a-
fetoprotein, insulin genes and others. Preferably useful
representatives of the enhancers are those obtained from
eukaryotic infectious viruses, including, for example, an
5V40 enhancer (100-270 bp) located at the late region of
the replication origin, a cytomegalovirus enhancer for the
early promoter, a polyoma enhancer located at the late
region of the replication origin, an adenovirus enhancer
and the like. A signal sequence fitting for the host can
be added if necessary. Such signal sequences which can be
used herein are well known by those skilled in the art.
= CA 02561696 2006-09-28
- 58 -
The plasmids for E. coli hosts include, for
example, pBR322, pUC18, pUC19, pUC118, pUC119, pSP64, pSP65,
pTZ-18R/-18U, pTZ-19R/-19U, pGEM-3, pGEM-4, pGEM-3Z, pGEM-
4Z, pGEM-5Zf(-), pBluescript KS (Stratagene4), etc. The
plasmid vectors suitable for the expression in E. coli also
include, for example, pAS, pKK223 (Pharmacia), pMC1403,
pMC931, pKC30, pRSET-B (Invitrogen), etc. The plasmids for
animal host cells include the 5V40 vector, polyoma viral
vector, vaccinia viral vector, retroviral vector, etc.
Examples of such plasmids are pcD, pcD-SRa, CDM8, pCEV4,
pME18S, pBC12BI, pSG5 (Stratagene), etc. The plasmids for
yeast host cells include YIp, YEp, YRp, YCp type vectors
and others. Examples of such plasmids are pGPD-2, etc.
The E. coli host cells include those derived from the E.
coli K12 strain or the E. coli B834 strain. Examples of
the E. coli host cells are NM533, XL1-Blue, C600, DH1, DH5,
DH11S, DH12S, DH5a, DH10B, HB101, MC1061, JM109, STBL2, etc.
for the E. coli K12 strain, and BL21(DE3)/pLYsS, etc. for
the E. coli B834 strain. Examples of bacterial expression
systems can be seen in the following documents: Chang et
al., Nature (1978) 275: 615; Goeddel et al., Nature (1979)
281: 544; Goeddel et al., Nucleic Acid Res., (1980) 8:
4057; EP 36,776, U.S. Patent No. 4,551,433; deBoer et al.,
Proc. Natl. Acad. Sci. USA (1983) 80: 21-25; Siebenlist et
al., Cell (1980) 20: 269, etc. The yeast host cells
include, for example, Saccharomyces cerevisiae,
Schizosaccharomyces prombe, Pichia pastoris, Kluyveromyces
cells, Candida, Trichoderma reesia and the other yeast
cells. Examples of yeast expression systems can be seen in
the following documents: Hinnen et al., Proc. Natl. Acad.
Sci. USA (1978) 75: 1929; Ito et al., J. Bacteriol. (1983)
153: 163; Kurtz et al., Mol. Cell. Biol. (1986) 6: 142;
Kunze et al., J. Basic Microbiol. (1985) 25: 141; Gleeson
et al., J. Gen. Microbiol. (1986) 132: 3459; Roggenkamp et
al., Mol. Gen. Genet (1986) 202: 302; Das et al., J.
Bacteriol. (1984) 158: 1165; De Louvencourt et al., J.
CA 02561696 2006-09-28
- 59 -
Bacteriol. (1983) 154: 737; Van den Berg et al.,
Bio/Technology (1990) 8: 135; Kunze et al., J. Basic Micr
Biol. (1985) 25: 141; Cregg et al., Mol. Cell. Biol. (1985)
5: 3376; U.S. Patent Nos. 4,837,148 & 4,929,555; Beach and
Nurse, Nature (1981) 300: 706; Davidow et al., Curr. Genet.
(1985) 10: 380; Gaillardin et al., Curr. Genet. (1985) 10:
49; Ballance et al., Biochem. Biophys. Res. Commun. (1983)
112: 284-289; Tilburn et al., Gene (1983) 26: 205-221;
Yalton et al., Proc. Natl. Acad. Sci. USA (1984) 81: 1470-
1474; Kelly and Hynes, EMBO J., (1985) 4: 475479; EP
244,234; WO 91/00357, etc.
The host cells which are animal cells include,
for example, African grivet fibroblast-derived COS-7 cells,
COS-1 cells, CV-1 cells, human renal cell-derived 293 cells,
human epidermal cell-derived A431 cells, human colon cell-
derived 205 cells, murine fibroblast-derived COP cells, MOP
cells, WOP cells, Chinese hamster cell-derived CHO cells,
CHO DHFR cells, human HeLa cells, murine cell-derived C127
cells, murine cell-derived NTH 3T3 cells, murine L cells,
9BHK, HL60, U937, HaK, Jurkat cells, other transformed cell
lines, normal diploid cells, cell lines induced from in
vitro primary cultured tissue, etc. Techniques for
expressing exogenous DNA in mammalian host cells can be
seen in the following documents: Dijkema et al., EMBO J.
(1985) 4: 761; Gorman et al., Proc. Natl. Acad. Sci. USA
(1982b) 79: 6777; Boshart et al., Cell (1985) 41: 521; U.S.
Patent No. 4,399,216; Ham and Wallace, Methods in
Enzymology (1979) 58: 44; Barnes and Sato, Anal. Biochem.
(1980) 102: 255; U.S. Patent Nos. 4,767,704; 4,657,866;
4,927,762; 4,560,655; WO 90/103430; WO 87/00195; U.S.
Patent No. RE 30,985, etc. Insect cells used include
Spodoptera frugiperda (caterpillar), Aedes aegypti
(mosquito), Aedes albopictus (mosquito), Drosophila
melanogaster (fruitfly), silk worm larva or cultured cells
(e.g., BM-N cells), in combination with vectors, silk worm
(Bombyx mori) nuclear polyhedrosis virus, those derived
=
CA 02561696 2006-09-28
- 60 -
therefrom or other suitable ones (for example, Luckow et
al., Bio/Technology, 6, 47-55 (1988); Setlow, J. K. et al.
(eds.), Genetic Engineering, Vol. 8, pp.277-279, Plenum
Publishing, 1986; Maeda et al., Nature, 315, pp.592-594
(1985)). Methods of expressing exogenous DNA in insects
can be seen in the following documents: U.S. Patent No.
4,745,051; Friesen et al. (1986), "The Regulation of
Baculovirus Gene Expression", The Molecular Biology of
Baculoviruses (W. Doerfler (Ed)); EP 127,839; EP 155,476;
Vlak et al., J. Gen. Virol., (1988) 69: 765-776; Miller et
al., Ann. Rev. Microbiol. (1988) 42: 177; Carbonell et al.,
Gene(1988) 73: 409; Maeda et al., Nature, (1985) 315: 592-
594; Lebacq-Verheyden et al., Mol. Cell. Biol. (1988) 8:
3129; Smith et al., Proc. Natl. Acad. Sci. USA, (1985) 82:
8404; Miyajima et al., Gene (1987) 58: 273; Martin et al.,
DNA (1988) 7: 99, etc. Numerous baculoviral strains and
variants and corresponding permissive insect host cells
from hosts are described in Luckow et al., Bio/Technology
(1988) 6: 47-55; Miller et al., Generic Engineering (Setlow,
J. K. et al. (Ed)) Vol. 8 (Plenum Publishing, 1986) pp.
277-279; Maeda et al., Nature (1985) 315: 592-594, etc.
With utilizing Agrobacterium tumefaciens etc., it
is possible to use plant cells as the host cells, which
have been widely known along with vectors suitable therefor
in the art. In the gene engineering techniques of the
present invention, it is possible to use restriction
enzymes, reverse transcriptases known and widely used in
the art, DNA-modifying enzymes, DNase, DNA polymerases,
terminal nucleotidyltransferases, DNA ligases and the like
to modify or convert DNA into a structure suitable for
cloning the DNA fragment. For example, restriction enzymes
include those described in, for example, R. J. Roberts,
Nucleic Acids Res., 13: r165, 1985; S. Linn et al. ed.
Nucleases, p. 109, Cold Spring Harbor Lab., Cold Spring
Harbor, New York, 1982; R. J. Roberts, D. Macelis, Nucleic
Acids Res., 19: Suppl. 2077, 1991, etc.
CA 02561696 2006-09-28
- 61 -
In accordance with the present invention, if
necessary, appropriate selection markers are used to select
host cells transformed or transfected with the expression
vector containing the target polypeptide (protein)-coding
polynucleotide. Cloning can be repeated to obtain stable
cell clones with high expression levels. For instance,
when a dhfr gene is utilized as a selection marker in the
transformed or transfected animal host cells (transformants
or transfectants), cell clones with higher expression
levels can be obtained by culturing with a gradual increase
in methotrexate (MTX) concentration to amplify the target
polypeptide-coding DNA and selecting resistant cells. The
transformants or transfectants can be cultured, under
conditions wherein the target polypeptide-coding nucleic
acid molecules are expressible, to produce and accumulate
target products. The transformants (transfectants) can be
cultured in a member selected from media conventionally
used in the art. For example, the transformant
(transfectant) in which the host is a prokaryotic cell such
as Escherichia coli and Bacillus subtilis, yeast or the
like can be cultivated suitably in a liquid culture medium.
The culture medium may contain carbon sources, nitrogen
sources, minerals, and others, necessary for growing the
transformant. The carbon source may include glucose,
dextrin, soluble starch, sucrose, etc. The nitrogen source
may include organic or inorganic substances such as
ammonium salts, nitrates, corn steep liquor, peptone,
casein, meat extracts, malt extracts, bean-cakes, potato
extracts, etc. Examples of the minerals may include
calcium chloride, sodium dihydrogen phosphate, magnesium
chloride, calcium carbonate, etc. It may also be
supplemented with yeast extracts, vitamins, casamino acids,
growth-promoting factors, etc. Depending on necessity, the
medium may be supplemented with drugs such as 3[3-indoly1
acrylic acid in order to improve efficiency of the promoter.
It is desirable that the pH for culture medium is from
CA 02561696 2006-09-28
- 62 -
about 5 to about 8.
In the case of the Escherichia hosts for example,
the cultivation is carried out usually at about 15 to 45 C
for about 3 to 75 hours. As required, aeration and
stirring may be applied. In case of the transformants in
which the hosts are animal cells, the culture medium used
may include MEM medium, RPMI 1640 medium, DMEM medium, and
others, which are containing, for example, fetal calf serum
at about 5 to 20%. It is preferable that the pH is from
about 6 to about 8. The cultivation is usually carried out
at about 30 to 40 C for about 15 to 72 hours. As required,
aeration and stirring may be optionally applied. Although
target gene product-expressing transformants can be used
without any isolation/purification, they may be utilized in
the form of cell homogenates. The target gene products may
be isolated for use. To extract the products from the
cultured microorganisms or cells, the microorganisms or
cells are collected by known methods after the cultivation,
next suspended in a suitable buffer solution, disrupted by
sonication, lysozyme digestion and/or freeze-thawing, and
other treatments, followed by centrifugation or filtration.
Thus, crude extracts are obtained. Other conventional
extraction or isolation methods can be applied. The buffer
solution may contain a protein-denaturing agent such as
urea or guanidine hydrochloride or a detergent such as
Triton X-100 (trade name) and Tween-80 (trade name). In
the case where the target products are secreted into
culture media, supernatants are separated from the
microorganisms or cells with widely known methods after the
cultivation is finished and the resulting supernatants are
collected.
The culture supernatants thus obtained and target
products contained in extracts can be purified by suitable
combinations of widely known per se techniques for
separation, isolation and purification. Such widely known
CA 02561696 2006-09-28
- 63 -
techniques are, for example, salting out such as ammonium
sulfate precipitation, etc.; gel filtration on Sephadex,
etc.; ion exchange chromatography using carriers having,
for example, a diethylaminoethyl or carboxymethyl group,
etc.; hydrophobic chromatography using carriers having, for
example, a hydrophobic group such as butyl, octyl, or
phenyl, etc.; dye-ligand (or chromophore-linked) gel
chromatography; electrophoresis; dialysis; ultrafiltration;
affinity chromatography; high performance liquid
chromatography (HPLC); etc. Preferably, the target
products can be isolated, separated and purified by
polyacrylamide gel electrophoresis (PAGE), affinity
chromatography in which ligands are immobilized. Said
ligand may comprise antibodies including monoclonal
antibodies, or fragments thereof, capable of recognizing
specific targets, lectins, saccharides, one member of a
binding pair, and others. Examples of such techniques also
include immunoaffinity chromatography, gelatin-agarose
affinity chromatography, heparin-agarose chromatography,
etc.
In the polypeptides (proteins) of the present
invention, amino acid residues contained therein can be
modified by chemical techniques. Also, they can be
modified and partially degraded to make derivatives thereof
using enzymes such as peptidases, e.g., pepsin,
chymotrypsin, papain, bromelain, endopeptidase,
exopeptidase, etc. In the polypeptides of the present
invention, the C-terminal end is typically a carboxyl group
(-COOH) or a carboxylate (-COO), but the C-terminal end may
be an amide form (-CONH2) or an ester form (-COOR). For
said ester, R includes C1 to C6 alkyl groups such as methyl,
ethyl, n-propyl, isopropyl and n-butyl, C3 to C8 cycloalkyl
groups such as cyclopentyl and cyclohexyl, C6 to C12 aryl
groups such as phenyl and a-naphthyl, phenyl-C1 to C2 alkyl
groups such as benzyl and phenethyl, C7 to C14 aralkyl
groups including a-naphthyl-C1 to C2 alkyl groups such as
CA 02561696 2006-09-28
- 64 -
a-naphthylmethyl, as well as a pivaloyloxymethyl group
widely used as an oral ester. When the proteins of the
present invention have a carboxyl group (or carboxylate) at
a site other than the C-terminal end, amidated or
esterified carboxyl groups are included in the proteins of
the present invention. As the ester in this case, for
example, the C-terminal ester and the like described above
are used.
The polypeptides (proteins) of the present
invention may be those having an N-terminal methionine
residue in the above proteins, and further include those in
which an amino group of the methionine residue is protected
with a protecting group (for example, C1 to C6 acyl groups
including C1 to C5 alkyl-carbonyl groups such as formyl and
acetyl), those in which the N-terminus is cleaved in vivo
and the resultant glutamyl group is pyroglutamylated, those
in which substituents (for example, -OH, -COOH, amino,
imidazole, indole, guanidino groups and the like) on side
chains of the intramolecular amino acids are protected with
appropriate protecting groups (for example, C1 to C6 acyl
groups such as formyl and acetyl groups), or conjugated
proteins (such as so-called glycoproteins) in which
saccharide chains are linked.
Further, by relying on the gene nucleotide
sequences associated with the present invention, equivalent
polypeptides or derivatives thereof wherein each amino acid
sequence of the target polypeptides is altered may be
produced with conventional genetic engineering techniques.
Such alterations include substitution (replacement),
deletion, insertion, transfer or addition of one or more
amino acid residues, etc. For example, such mutations,
conversions and modifications are those described in The
Japanese Biochemical Society (JBS) ed., "Zoku-Seikagaku
Jikken Koza 1, Idenshi Kenkyu-Hou II", p. 105 (Susumu
Hirose), Tokyo Kagaku Dozin Co. Ltd., Japan, (1986); JBS
, CA 02561696 2006-09-28
- 65 -
e d . , "Shin-Seikagaku Jikken Koza 2, Kakusan III
(Recombinant DNA technique)", p. 233 (Susumu Hirose), Tokyo
Kagaku Dozin Co. Ltd., Japan, (1992); R. Wu, L. Grossman,
ed., "Methods in Enzymology", Vol. 154, p. 350 & p. 367,
Academic Press, New York (1987); R. Wu, L. Grossman, ed.,
"Methods in Enzymology", Vol. 100, p. 457 & p. 468,
Academic Press, New York (1983); J. A. Wells et al., Gene,
34: 315, 1985; T. Grundstroem et al., Nucleic Acids Res.,
13: 3305, 1985; J. Taylor et al., Nucleic Acids Res., 13:
8765, 1985; R. Wu ed., "Methods in Enzymology", Vol. 155, p.
568, Academic Press, New York (1987); A. R. Oliphant et al.,
Gene, 44: 177, 1986, etc. For example, included are
methods such as the site-directed mutagenesis (site
specific mutagenesis) utilizing synthetic oligonucleotides
or others (Zoller et al., Nucl. Acids Res., 10: 6487, 1987;
Carter et al., Mud. Acids Res., 13: 4331, 1986), the
cassette mutagenesis (Wells et al., Gene, 34: 315, 1985),
restriction selection mutagenesis (Wells et al., Philos.
Trans. R. Soc. London Ser A, 317: 415, 1986), the alanine
scanning (Cunningham & Wells, Science, 244: 1081-1085,
1989), PCR mutagenesis, Kunkel method, dNTP[aS] method
(Eckstein), the region directed mutagenesis using sulfurous
acid and nitrous acid and other techniques.
The polypeptides (proteins) may be expressed as
fusion polypeptides (fusion proteins) when produced by gene
recombination techniques, and may be converted or processed
into those having substantially equivalent biological
activity as compared to those which naturally occur in vivo
or in vitro. The fusion polypeptide expression system
usually used in gene engineering can be applied. Such
fusion polypeptides can be purified by an affinity
chromatography and the like, taking advantage of their
fusion moieties. Such fusion polypeptides include those
fused to a histidine tag, or those fused to the amino acid
sequence of /3-galactosidase (/3-gal), maltose-binding
protein (MBP), glutathione S-transferase (GST), thioredoxin
= CA 02561696 2006-09-28
- 66 -
(TRX), or Cre Recombinase. Similarly, the polypeptide can
be added with a tag of heterogeneous epitope, and can be
isolated/purified by an immunoaffinity chromatography using
an antibody specifically binding to the epitope. In more
suitable embodiments, the representatives include poly
histidine (poly-His) or polyhistidine-glycine (poly-His-
Gly) tags, and epitope tags such as AU5, c-Myc, CruzTag 09,
CruzTag 22, CruzTag 41, Glu-Glu, HA, Ha.11, KT3, FLAG
(registered trademark, Sigma-Aldrich), Omni-probe, S-probe,
T7, Lex A, V5, VP16, GAL4, and VSV-G (Field et al.,
Molecular and Cellular Biology, 8: pp.2159-2165 (1988);
Evan et al., Molecular and Cellular Biology, 5: pp.3610-
3616 (1985); Paborsky et al., Protein Engineering, 3(6):
pp.547-553 (1990); Hopp et al., BioTechnology, 6: pp.1204-
1210 (1988); Martin et al., Science, 255: pp.192-194
(1992); Skinner et al., J. Biol. Chem., 266: pp.15163-15166
(1991); Lutz-Freyermuth et al., Proc. Natl. Acad. Sci. USA,
87: pp.6393-6397 (1990), etc.). Yeast two-hybrid systems
are also utilizable.
Besides, the fusion polypeptides can be those
tagged with a marker such that they become detectable
proteins. In more suitable embodiments, the detectable
markers may be Biotin-Avi Tag which is a
biotin/streptavidin system, and fluorescent substances.
The fluorescent substances include green fluorescent
proteins (GFP) derived from luminescent jelly fish such as
Aequorea victorea and the like, modified variants thereof
(GFP variants) such as EGFP (enhanced-humanized GFP) and
rsGFP (red-shift GFP), yellow fluorescent proteins (YFP),
green fluorescent proteins (GFP), cyan fluorescent proteins
(CFP), blue fluorescent proteins (BFP), GFP derived from
Renilla reniformis, and the like (Atsushi Miyawaki ed.,
Jikken Igaku (Experimental Medicine), Besatsu (suppl.),
Postgenome Jidai no Jikken Kouza 3 (GFP and Bioimaging),
Yodosha Co., Ltd., 2000). Detection can be carried out
using antibodies (including monoclonal antibodies and
CA 02561696 2006-09-28
- 67 -
fragments thereof) which specifically recognize the above
fusion tag. The expression and purification of such fusion
polypeptides can be performed using commercially available
kits suitable for these techniques, and can also be carried
out according to protocols as instructed by manufacturers
or distributors of the kits.
The resultant proteins (which may include
peptides and polypeptides) can be coupled with suitable
carrier or solid phases by techniques known in the enzyme
immunoassay and others to form solid phased products.
Solid-phased proteins and solid-phased peptides are
conveniently useful in binding assays and screenings for
substances.
Modifications and alterations of the polypeptide
or protein structures can be performed in reference to, for
example, The Japanese Biochemical Society (JBS) ed., "Shin-
Seikagaku Jikken Koza 1, Protein VII, Protein Engineering"
Tokyo Kagaku Dozin Co. Ltd., Japan, 1993) using the methods
described therein or the methods described in the
references quoted therein, and, further, substantially
equivalent methods thereto. Their biological activity as
described herein below may include immunological activity,
for example, antigenicity. The modification and alteration
may be deamination, hydroxylation, carboxylation,
phosphorylation, sulfation, alkylation such as methylation,
acylation such as acetylation, esterification, amidation,
ring-opening, cyclization, glycosylation, alteration of
contained saccharide chains to different types, increasing
or decreasing the number of contained saccharide chains,
lipid-binding, substitution to D-amino acid residues, etc.
Those methods are known in the art (for example, T. E.
Creighton, Proteins: Structure and Molecular Properties,
pp.79-86 W.H. Freeman & Co., San Francisco, USA (1983),
etc.).
When modified galectin 9 proteins (modified Gal-9
CA 02561696 2006-09-28
-68 -
variants) according to the present invention are utilized,
screening can be done for compounds, or salts thereof,
which promote (agonists) or inhibit (antagonists) the
interesting Gal 9-mediated functions such as biological
actions (e.g., cytotoxic actions, apoptosis-inducible
actions, glucocorticoid-like actions, malignant cell
metastasis-inhibiting actions and the like). This means
that screening kits and reagents are contemplated herein.
Thus, the present invention provides methods of screening
for either (1) a promoting compound (agonist), or a salt
thereof, which promotes the predetermined functions exerted
by any of galectin 9 proteins (including human galectin 9),
peptide fragments thereof, and salts thereof, etc., wherein
the function may include Gal 9-mediated biological actions
as identified or disclosed herein, or (2) an inhibitory
compound (antagonist), or a salt thereof, which inhibits
the same function, which comprises using a disclosed or
identified action or activity mediated or owned by a member
selected from the group consisting of said galectin 9
proteins (including human galectin 9), peptide fragments
thereof, and salts thereof, in connection with a variety of
substances.
For example, the screening comprises
(i) contacting a modified galectin-9 protein (or modified
Gal-9 variant), a peptide fragment thereof, a salt thereof ,
or an equivalent thereof (including a transformant or
transfectant which expresses said protein; it has
hereinafter the same meaning) with a suitable test sample,
thereby obtaining a first assay;
(ii) incubating the protein of the present invention, a
peptide fragment thereof, a salt thereof, or an equivalent
thereof, without the test sample of interest, thereby
obtaining a second assay; and
(iii) comparing said first assay and said second assay.
In an embodiment of the screening, said biological
activities (e.g., activities associated with interactions
between each galectin 9 protein and biological components,
CA 02561696 2006-09-28
- 69 -
et c . ) are measure and compared.
The screening systems may contain suitable
detectable substrates for the convenience of assays. The
substrates may be any as long as they are effectively
utilizable in assays. For instance, they can be selected
from those known to be conventional substrates and
preferably include synthesized compounds and other
materials. The substrate can be employed without any
modification, or preferably after labeling with
fluorochromes such as fluorescein, enzymes or radioactive
substances.
The test samples include, for example, proteins,
peptides, nonpeptidic compounds, synthetic compounds,
fermented products, plant extracts, tissue extracts such as
animal tissue extracts, cell extracts, etc. Examples of
test compounds as used for the test samples may include
preferably anti-galectin antibodies, enzyme inhibitors,
cytokines, a variety of compounds having inhibitor activity,
inter alia synthetic compounds, etc. These compounds can
be novel or known to the public. The screening is
conducted according to conventional techniques for
measuring binding activities or enzyme activities, for
example, by referring to known methods in the art. It can
also be performed by using various labels, buffers and
suitable other reagents, etc. and according to the
operations, etc., as described herein for the assays. In
the screening, it is possible to treat the peptides used
and the like with activators, and to convert their
precursors or latent forms into active forms thereof prior
to the assay. The assay can usually be performed in buffer
without any adverse effect on the reaction, including Tris-
HC1 buffer, phosphate buffer, etc., for example, at pH
about 4 to 10, preferably at pH about 6 to 8. For each of
these screenings, by giving technical consideration
ordinarily owned by persons skilled in the art to customary
CA 02561696 2006-09-28
- 70 -
conditions and operations for each method, suitable assay
systems may be constructed in connection with each of the
galectin 9 proteins and polypeptides or peptides having
substantially equivalent activity thereto, according to the
present invention. With details of those conventional
techniques, a variety of reviews, reference books, etc. may
be referred to (e.g., Methods in Enzymology, Academic Press,
New York, USA). For apoptosis assays, it is possible to
refer to Sei-ichi Tamuma (Ed.), "Saiboukagaku Bessatsu:
Jikken Protocol Series, Apoptosis Jikken Protocol" (1st
Edition, 2nd Print), Shujunsha Co., Ltd., January 20, 1995
and others, and to use commercially available assay kits.
The compounds or salts thereof identified or
obtained by the screening method or kit according to the
present invention are those selected from the
aforementioned test compounds, including peptides, proteins,
nonpeptidic compounds, synthetic compounds, fermented
products, cell extracts, plant extracts, animal tissue
extracts, etc. Such compounds are those which enhance (or
promote) or inhibit (or suppress) the functions of the
proteins and other species according to the present
invention. Salts of said compounds are, for example,
pharmaceutically acceptable salts thereof, etc. Examples
of such salts are those with inorganic bases, with organic
bases, with inorganic acids, with organic acids, with basic
or acidic amino acids, etc. Preferred examples of the
inorganic base salts are alkaline metal salts such as
sodium salts, and potassium salts; alkaline earth metal
salts such as calcium salts and magnesium salts; aluminum
salts, ammonium salts; etc. Preferred examples of the
organic base salts are salts with trimethylamine,
triethylamine, pyridine, picoline, 2,6-lutidine,
ethanolamine, diethanolamine, triethanolamine,
cyclohexylamine, dicyclohexylamine, N,N-dibenzylethylene-
diamine, etc. Preferred examples of the inorganic acid
salts are salts with hydrochloric acid, hydrobromic acid,
CA 02561696 2006-09-28
-71 -
sulfuric acid, phosphoric acid, etc. Preferred examples of
the organic acid salts are salts with formic acid, acetic
acid, propionic acid, fumaric acid, oxalic acid, tartaric
acid, maleic acid, citric acid, succinic acid, malic acid,
methanesulfonic acid, benzenesulfonic acid, benzoic acid,
etc. Preferred examples of the basic amino acid salts are
those of arginine, lysine, ornithine, etc. Preferred
examples of the acidic amino acid salts are those of
aspartic acid, glutamic acid, etc.
The active components of the present invention
[e.g., (a) the modified Gal-9 polypeptides (modified Gal-9
variants), peptide fragments thereof, salts thereof, their
related peptides, etc.; (b) the modified Gal-9 variant-
coding or its related peptide-coding nucleic acid molecules
(including DNA and others), etc.; (c) the compounds, or
salts thereof, which control or regulate said interesting
activities (or functions) exerted by Gal-9 (the compounds
which promote or suppress/inhibit Gal-9 biological
activities, including phenomena that they promote or
suppress/inhibit Gal-9 protein-dependent cytotoxic actions,
apoptosis-inducing actions, Gal-9 abilities of exerting
desirable efficacies without any adverse effect on normal
cells, etc. and degeneration, overproduction, or
degradation of tissues or proteins); compounds, or their
salts, which control or regulate said protein production;
(d) the compounds identified or characterized by means of
the present invention; etc.] can be employed as
pharmaceutical agents. The active components can be
administered alone or in the form of a pharmaceutical
composition or preparation in admixture with any of various
pharmaceutically acceptable aids. Preferably, it may be
administered in the form of a convenient pharmaceutical
composition or formulation suitable for oral, topical,
parenteral application, or the like. Any of dosage forms
(including those for inhalation and rectal administration)
may be selected depending on purpose.
CA 02561696 2006-09-28
- 72 -
The active components of the present invention
can be used in combination with any of various drugs,
including antitumor drugs (antineoplastic drugs), tumor
metastasis-inhibitors, inhibitors for thrombogenesis,
therapeutic drugs for joint destruction, analgesics, anti-
inflammatory drugs, immunoregulators (or immunomodulators)
and/or immunosuppressants, which can be employed as not
being restricted to particular species as long as they
serve effectively or advantageously. For instance, they
can be optionally selected from those known in the art.
The parenteral administration includes topical,
percutaneous, intravenous, intramuscular, subcutaneous,
intracutaneous, and intraperitoneal routes. It is also
possible to apply the drug directly to affected sites, and,
in a certain case, the direct application is suitable.
Preferably mammal animals including human can receive the
drug orally or parenterally (e.g., intracellularly, intra-
2 0 tissularly, intravenously, intramuscularly, subcutaneously,
intracutaneously, intraperitoneally, intrapleurally,
intraspinally, by instillation, enterally, per rectum, by
instillation into the ear, eye, or nose by swabbing or
application on the teeth, skin or mucosa, etc.). Specific
dosage forms of the pharmaceutical preparations and
formulations include pharmaceutical solutions,
pharmaceutical dispersions, semisolid preparations,
particulate preparations, shaped preparations, extractives,
etc. Examples of the dosage forms are tablets, coated
tablets, sugar coated tablets, pills, troches, hard
capsules, soft capsules, microcapsules, implants, powders,
pulvis, granules, fine granules, injections, liquids and
solutions, elixirs, emulsions, irrigations, syrups,
mixtures, suspensions, liniments, lotions, aerosols, sprays,
inhalations, nebula, ointments, plasters, patches, pastes,
cataplasms, creams, oleates, suppositories (e.g., rectal
suppositories), tinctures, dermatologic waters, ophthalmic
= CA 02561696 2006-09-28
- 73 -
solutions, collunariums, auristillae, paints, transfusions,
powders for injection solutions, lyophilized preparations,
conditioned gels, etc.
The pharmaceutical compositions can be formulated
in accordance with conventional techniques. For example,
the pharmaceutical composition or formulation may comprise
at least one of said compounds (active components including
proteins) of the present invention or a salt alone or in
admixture with physiologically allowable carriers,
pharmaceutically acceptable carriers, adjuvants, vehicles,
excipients, diluents, etc. The compound (active component
or protein) of the present invention or a salt thereof is
usually admixed with a single member selected from the
group consisting of physiologically allowable carriers,
pharmaceutically acceptable carriers, adjuvants, vehicles,
excipients, diluents, flavoring agents, perfuming agents,
sweetening agents, expanders, antiseptics, stabilizers,
binders, pH regulators, buffering agents, detergents
(surfactants), bases, solvents, fillers, bulking agents,
solution adjuvants, solubilizers, tonicity agents,
emulsifiers, suspending agents, dispersers, viscosity-
increasing agents, thickening agents, gelling agents,
stiffening agents, absorbents, adhesives, elastomers,
plasticizers, disintegrants, aerosol propellants,
preservatives, antioxidants, opacifying agents, humectants,
emollients, charge protectors, soothing agents, etc., or
suitably in a combination thereof, depending on necessity,
to give a unit dose form which is required for generally
approved pharmaceutical practices.
Formulations suitable for parenteral routes
include aseptic solutions or suspensions containing at
least one active component in admixture with water or other
pharmaceutically acceptable media. Examples of such
parenteral formulations are injections. Preferred liquid
carriers for injection generally include water, saline,
* CA 02561696 2006-09-28
- 74 -
dextrose solution, other related saccharide solutions,
ethanol, glycols such as propylene glycol and polyethylene
glycol, etc. For the preparation of injections, the active
component is usually admixed with any of carriers such as
distilled water, Ringer's solution, physiological saline,
suitable dispersing agents, moistening agents, suspending
agents, and other materials to form injectable formulations
including solutions, suspensions, emulsions, etc. by known
techniques in the art.
Examples of aqueous liquids for the injection are
a physiological saline and isotonic solutions containing
glucose and other aids (e.g. D-sorbitol, D-mannitol, sodium
chloride, etc.) where they may be used in combination with
a suitable pharmaceutically acceptable auxiliary
solubilizer such as alcohol (e.g. ethanol, etc.),
polyalcohol (e.g. propylene glycol, polyethylene glycol,
etc.), nonionic surface-active agent (e.g. Polysorbate 80Tm,
HCO-50, etc.), etc. The injectable oily liquids may
include sesame oil, soybean oil, etc. where they may be
used in combination with benzyl benzoate, benzyl alcohol,
and other materials as auxiliary solubilizers. In addition,
buffers (e.g. phosphate buffer, sodium acetate buffer,
etc.) or agents for osmoregulation, analgesic agents (e.g.
benzalkonium chloride, procaine hydrochloride, etc.),
stabilizers (e.g. human serum albumin, polyethylene glycol,
etc.), preservatives (e.g. benzyl alcohol, phenol, etc.),
antioxidants such as ascorbic acid, absorbefacients, etc.
may be admixed therewith too. The prepared injection
solution is usually filled in suitable ampoules.
For parenteral administration, solution or
suspension unit dosage forms are prepared in
pharmaceutically acceptable sterile fluids such as water,
ethanol, and oils, in admixture with or without detergent
and other pharmaceutically acceptable aids. The oily
vehicle and solvent used in the parenteral formulation may
include natural, synthetic or semi-synthetic mono-, di-, or
CA 02561696 2006-09-28
- 75 -
triglycerides; natural, semi-synthetic or synthetic fats
and oils; and fatty acids. Examples of such oily vehicles
and solvents are plant oils such as peanut oil, corn oil,
soybean oil, and sesame oil. For example, this injection
can usually be prepared to form unit doses each containing
approximately from 0.1 to 10 parts of the compound of the
present invention per 100 parts by weight of the dose
composition.
The formulation suitable for topical use, such as
buccal or rectal application, includes mouthwashes and
gargles, dentifrices, sprays for buccal cavity, inhalants,
ointments (salves), dental fillers, dental coating agents,
dental pastes, suppositories, etc. The mouthwashes and
other dental agents are prepared by conventional techniques,
using pharmaceutically acceptable carriers. For the sprays
for buccal cavity and inhalants, the compound of the
present invention can be applied to teeth or other sites
after dissolving alone or together with pharmaceutically
acceptable inert carriers, in an aerosol or solution for
nebulizers, or in the form of powders for inhalation. The
ointments (salves) are prepared by conventional techniques,
in admixture with conventionally employed pharmaceutical
bases such as ointment bases (white petrolatum, paraffin,
olive oil, macrogol 400, macrogol ointment, etc.).
The pharmaceutical drugs for topical application
(including painting) to teeth and skin can be prepared in
the form of a solution or suspension utilizing suitably
sterilized water or non-aqueous vehicles. The additives
used include buffering agents such as sodium bisulfite and
disodium edetate; preservatives including antiseptic,
antimicrobial and antifungal agents such as acetic acid,
phenylmercuric nitrate, benzalkonium chloride and
chlorhexidine; and thickeners such as hypromellose.
The suppositories can be prepared by conventional
=
CA 02561696 2006-09-28
- 76 -
techniques utilizing carriers well known in the art,
preferably suitable non-irritative excipients. Examples of
the excipients are those which are solid at room
temperature but liquid at rectal temperature wherein such
substances melt in the rectum to deliver a drug, such as
polyethylene glycols, lanolin, cacao butter, and fatty acid
triglycerides. In the suppositories, the compounds of the
present invention are applied in the form of compositions
containing approximately from 0.1 to 95 percent (weight per
volume). The compound, depending on the vehicle and
concentration used, can be either suspended or dissolved in
the vehicle. Adjuvants such as a local anesthetic,
preservative and buffering agent can be dissolved in the
vehicle. The formulations suitable for oral application
include solid compositions such as tablets, pills, capsules,
powders, granules, and troches; fluid compositions such as
solutions, syrups, and suspensions; etc. In preparing oral
formulations, pharmaceutical adjuvants known in the art are
employed. The tablets and pills can be prepared further by
enteric coating. When the unit dosage form is a capsule,
fluid carriers such as fats and oils can be contained in
addition to the aforementioned materials.
When the active components are proteins or
polypeptides, conjugation to polyethylene glycol (PEG) is
particularly useful, because its toxicity is extremely low
in mammals. Further, the conjugation with PEG can
sometimes reduce the immunogenicity and antigenicity of a
heterologous compound effectively. The compound may be
given after being put in a microcapsule device. A polymer
such as PEG can be easily attached to an a-amino group of
amino-terminal amino acids, an E-amino group of lysine side
chains, a carboxyl group of aspartic acid or glutamic acid
side chains, an a-carboxyl group of carboxyl-terminal amino
acids, or an activated derivative of glycosyl chains
attached to certain asparagine, serine or threonine
residues. Various activated forms of PEG suitable for
CA 02561696 2006-09-28
- 77 -
direct reaction with proteins are known. PEG reagents
useful for reaction with amino groups of a protein include
active esters of carboxylic acids and carbonate derivatives,
particularly those having N-hydroxysuccinimide, p-
nitrophenol, imidazole, or 1-hydroxy-2-nitrobenzene-4-
sufonate as a leaving group. Similarly, PEG reagents
having an aminohydrazine or hydrazide group are useful for
reaction with aldehydes produced by periodate oxidation of
proteins.
Practice of the invention may begin by diagnosing
the mammal as is appropriate for the particular
disorder/disease such as autoimmunity, tumor including
malignant tumor such as cancer, allergic disease, and
inflammation that they may be exhibiting. The diagnosis
may also continue during treatment, as a therametric
procedure, to monitor the progress of treatment, and to
direct modification of such parameters as the dosage or
frequency in continued treatments, for example. Additional
diagnosis that might aid in determining appropriateness for
administration of a modified galectin 9 mutein therapeutic
agent include an analysis of expression levels of galectin
9 in the mammal, and a comparison of these levels between
cells such as lymphocytes distal from the site of
autoimmunity, and those proximal to the site or
autoimmunity. The disorder/disease such as autoimmunity,
tumor including malignant tumor such as cancer, allergic
disease, and inflammation autoimmune disease in the mammal
being treated can be monitored by detecting galectin 9
antigen on a cell surface. This monitoring can include
contacting a sample derived from the mammal with a galectin
9-specific antibody, and detecting binding of the antibody
to the sample.
Gene therapy vehicles include those for delivery
of constructs including a coding sequence of a therapeutic
of the invention, to be delivered to the mammal for
=
CA 02561696 2006-09-28
- 78 -
expression in the mammal, for example, a modified galectin
9 mutein coding sequence, or also including a nucleic acid
sequence of all or a portion of modified Gal-9 mutein for
delivery, which can be administered either locally or
systemically. These constructs can utilize viral or non-
viral vector approaches in in vivo or ex vivo modality.
Expression of such coding sequence can be induced using
endogenous mammalian or heterologous promoters. Expression
of the coding sequence in vivo can be either constitutive
or regulated. Where the modified Gal-9 mutein is expressed
in the mammal, it can be expressed as soluble modified Gal-
9 mutein, or as a precursor form modified Gal-9 mutein,
both or either including, for example, all of the modified
Gal-9 mutein, or a biologically active portion, variant,
derivative or fusion of modified Gal-9 mutein.
The invention includes gene delivery vehicles
capable of expressing the contemplated modified Gal-9
mutein nucleic acid sequences. The gene delivery vehicle
is preferably a viral vector. A more preferable gene
delivery vehicle includes viral vectors such as retroviral,
adenoviral, adeno-associated viral (AAV), herpes viral, or
alphavirus vectors. The viral vector can also be an
astrovirus, coronavirus, orthomyxovirus, papovavirus,
paramyxovirus, parvovirus, picornavirus, poxvirus,
togavirus viral vector. The gene delivery vehicles are
disclosed generally in D. Jolly, Cancer Gene Therapy, 1(1):
51-64 (1994); 0. Kimura et al., Human Gene Therapy, 5: 845-
852 (1994); S. Connelly et al., Human Gene Therapy, 6: 185-
193 (1995); M.G. Kaplitt et al., Nature Genetics, 8: 148-
153 (1994), etc.
Retroviral vectors are well known in the art and
may include any retroviral gene therapy vector employable
in the invention, such as B, C and D type retroviruses, and
xenotropic retroviruses (for example, NZB-X1, NZB-X2,
NZB9.1 :see, R. R. O'Neill, J. Virol., 53: 100-106 (1985),
CA 02561696 2006-09-28
- 79 -
et c . ) , polytropic retroviruses (for example, MCF, MCF-MLV :
see, M. Kelly, J. Virol., 45: 291-298 (1983), etc.),
spumaviruses and lentiviruses and others (see, R. L. Weiss
et al. (Eds.), RNA Tumor Viruses, Second Edition, Cold
Spring Harbor Laboratory, Cold Spring Harbor, 1985).
Portions of the retroviral gene therapy vector
may be derived from different retroviruses. For example,
retrovector LTRs may be derived from a murine sarcoma virus,
a tRNA binding site from a Rous sarcoma virus, a packaging
signal from a murine leukemia virus, and an origin of
second strand synthesis from an avian leukosis virus.
These recombinant retroviral vectors may be used to
generate transduction competent retroviral vector particles
by introducing them into appropriate packaging cell lines
(see, U.S. Patent No. 5,591,624). Retrovirus vectors can
be constructed for site-specific integration into host cell
DNA by incorporation of chimeric integrase (an enzyme that
enables the target DNA to be integrated into the DNA of the
host cell) into the retroviral particle. It is preferable
that the recombinant viral vector is a replication
defective recombinant virus.
Packaging cell lines suitable for use with the
aforementioned retrovirus vectors are well known in the art,
are readily prepared (see, U.S. Patent No. 6,013,517, WO
92/05266). Said packaging cell lines can be used to create
producer cell lines (vector cell lines or "VCLs") for the
production of recombinant vector particles. Preferably,
the packaging cell lines are made from human parent cells
(e.g., HT1080 cells) or mink parent cell lines, which
eliminates inactivation in human serum.
Preferred retroviruses for the construction of
retroviral gene therapy vectors include avian leukosis
virus, bovine leukemia virus, murine leukemia virus, mink-
cell focus-inducing virus, murine sarcoma virus,
CA 02561696 2006-09-28
- 80 -
reticuloendotheliosis virus and Rous sarcoma virus.
Particularly preferred murine leukemia viruses include for
example, 4070A and 1504A (Hartley & Rowe, J. Virol., 19:
19-25 (1976)), Abelson (ATCC No. VR-999), Friend (ATCC No.
VR-245), Graffi, Gross (ATCC No. VR-590), Kirsten, Harvey
sarcoma virus and Rauscher (ATCC No. VR-998), and moloney
murine leukemia virus (ATCC No. VR-190), etc. Such
retroviruses may be obtained from depositories or
collections such as the American Type Culture Collection
("ATCC") in Rockville, Maryland, USA or isolated from known
sources using commonly available techniques.
Exemplary known retroviral gene therapy vectors
employable in this invention include those described in GB
2200651, EP 0415731, EP 0345242, WO 89/02468, WO 89/05349,
WO 89/09271, WO 90/02806, WO 90/07936, WO 94/03662, WO
93/25698, WO 93/25234, WO 93/11230, WO 93/10218, WO
93/10218, WO 91/02805, U.S. Patent Nos. 5,219,740,
4,405,712, 4,861,719, 4,980,289, 4,777,127, 5,591,624, Vile,
Cancer Res, 53: 3860-3864 (1993), Vile, Cancer Res, 53:
962-967 (1993), Ra, Cancer Res, 53: 83-88 (1993), Takamiya,
J Neurosci Res, 33: 493-503 (1992), Baba, J Neurosurg, 79:
729-735 (1993), Mann, Cell 33: 153 (1983), Cane, Proc Natl
Acad Sci USA, 81: 6349 (1984), Miller, Human Gene Therapy,
1: 5-14 (1990), etc.
Human adenoviral gene therapy vectors are also
known in the art and employable in this invention. Such
vectors are disclosed in, for example, Berkne,
Biotechniques, 6: 616 (1988); Rosenfeld, Science, 252: 431
(1991); WO 93/07283; WO 93/06223; WO 93/07282, etc.
Exemplary known adenoviral gene therapy vectors employable
in this invention include those described in the above
referenced documents and in WO 94/12649; WO 93/03769; WO
93/19191; WO 94/28938; WO 95/11984; WO 95/00655; WO
95/27071; WO 95/29993; WO 95/34671; WO 96/05320; WO
94/08026; WO 94/11506; WO 93/06223; WO 94/24299; WO
CA 02561696 2006-09-28
-81-
95/14102; WO 95/24297; WO 95/02697; WO 94/28152; WO
94/24299; WO 95/09241; WO 95/25807; WO 95/05835; WO
94/18922; WO 95/09654; etc. Alternatively, administration
of DNA linked to killed adenovirus as described in Curiel,
Human Gene Therapy, 3: 147-154 (1992) may be employed.
The gene delivery vehicles of the invention also
include adenovirus associated virus (AAV) vectors. Leading
and preferred examples of such vectors for use in this
invention are the AAV-2 based vectors disclosed in WO
93/09239. Most preferred AAV vectors comprise the two AAV
inverted terminal repeats in which the native D-sequences
are modified by substitution of nucleotides, such that at
least 5 native nucleotides and up to 18 native nucleotides,
preferably at least 10 native nucleotides up to 18 native
nucleotides, most preferably 10 native nucleotides are
retained and the remaining nucleotides of the D-sequence
are deleted or replaced with non-native nucleotides. The
native D-sequences of the AAV inverted terminal repeats are
sequences of 20 consecutive nucleotides in each AAV
inverted terminal repeat (i.e., there is one sequence at
each end) which are not involved in HP formation. The non-
native replacement nucleotide may be any nucleotide other
than the nucleotide found in the native D-sequence in the
same position. Other employable exemplary AAV vectors are
pWP-19, pWN-1, and others (Nahreini, Gene, 124: 257-262
(1993)). Another example of such an AAV vector is psub201,
and others (Samulski, J. Virol., 61: 3096 (1987)). Another
exemplary AAV vector is the Double-D ITR vector, etc.
Methods for construction of Double-D ITR are disclosed in
U.S. Patent No. 5,478,745. Still other AAV vectors are
those disclosed in U.S. Patent Nos. 4,797,368, 5,139,941,
5,474,935, WO 94/288157, etc. Yet a further example of an
AAV vector employable in this invention is SSV9AFABTKneo,
which contains the APP enhancer and albumin promoter and
directs expression predominantly in the liver. Its
structure and construction are disclosed in Su, Human Gene
CA 02561696 2006-09-28
- 82 -
Therapy, 7: 463-470 (1996). Additional AAV gene therapy
vectors are described in U.S. Patent Nos. 5,354,678,
5,173,414, 5,139,941, 5,252,479, etc.
The gene therapy vectors of the invention also
include herpes vectors. Leading and preferred examples are
herpes simplex virus vectors containing a sequence encoding
a thymidine kinase polypeptide such as those disclosed in
U.S. Patent No. 5,288,641 and EP 0176170. Additional
exemplary herpes simplex virus vectors include HFEM/ICP6-
LacZ disclosed in WO 95/04139, pHSVlac described in Geller,
Science, 241: 1667-1669 (1988), WO 90/09441, WO 92/07945,
etc., HSV Us3::pgC-lacZ described in Fink, Human Gene
Therapy, 3: 11-19 (1992), HSV7134, 2RH 105 and GAL4
described in EP 0453242 A, those deposited with the ATCC as
accession numbers ATCC VR-977 and ATCC VR-260, and others.
Alpha virus gene therapy vectors may be employed
in this invention. Preferred alpha virus vectors are
Sindbis viruses vectors, togavirus, Semliki Forest virus
(ATCC VR-67; ATCC VR-1247), Middleberg virus (ATCC VR-370),
Ross River virus (ATCC VR-373; ATCC VR-1246), Venezuelan
equine encephalitis virus (ATCC VR923; ATCC VR-1250; ATCC
VR-1249; ATCC VR-532), those described in U.S. Patent Nos.
5,091,309, 5,217,879, and WO 92/10578, and others. Alpha
virus vectors employable herein are those disclosed in U.S.
Patent Nos. 5,091,309, 5,217,879, 5,843,723, 6,376,236, WO
94/21792, WO 92/10578, WO 95/07994 and other documents.
Such alpha viruses may be obtained from depositories or
collections such as the ATCC (Rockville, Maryland, USA), or
isolated from known sources using commonly available
techniques. Preferably, alphavirus vectors with reduced
cytotoxicity are used (see U.S. Patent No. 6,391,632).
DNA vector systems such as eukaryotic layered
expression systems are also useful for expressing the
modified galectin 9 mutein nucleic acids of the invention.
CA 02561696 2006-09-28
- 83 -
Details of eukaryotic layered expression systems are
disclosed in WO 95/07994. Preferably, the eukaryotic
layered expression systems of the invention are derived
from alphavirus vectors and most preferably from Sindbis
viral vectors.
Other viral vectors suitable for use in the
present invention include those derived from poliovirus,
for example ATCC VR-58 and those described in Evans, Nature,
339: 385 (1989), Sabin, J. Biol. Standardization, 1: 115
(1973), etc.; rhinovirus, for example ATCC VR-1110, and
those described in Arnold, J. Cell Biochem, L401-405 (1990),
etc.; pox viruses such as canary pox virus or vaccinia
virus, for example ATCC VR-111 and ATCC VR-2010 and those
described in Fisher-Hoch, Proc Natl Acad Sci USA, 86:
317(1989), Flexner, Ann NY Acad Sci, 569: 86 (1989),
Flexner, Vaccine, 8: 17 (1990), U.S. Patent Nos. 4,603,112
& 4,769,330, and WO 89/01973, etc.; 5V40 virus, for example
ATCC VR-305 and those described in Mulligan, Nature, 277:
108 (1979) and Madzak, J. Gen. Vir, 73: 1533(1992), etc.;
influenza virus (for example ATCC VR-797, etc.) and
recombinant influenza viruses made employing reverse
genetics techniques as described in U.S. Patent No.
5,166,057, Enami, Proc Natl Acad Sci USA, 87: 3802-
3805(1990), Enami & Palese, J Virol, 65: 2711-2713 (1991),
Luytjes, Cell, 59: 110 (1989), McMicheal., N E J Med, 309:
13 (1983), Yap, Nature, 273: 238 (1978), Nature, 277:
108(1979), and other documents; human immunodeficiency
virus as described in EP 0386882, Ruchschacher, J. Vir.,
66: 2731 (1992), etc.; measles virus (for example ATCC VR-
67, VR-1247) and those described in EP 0440219; Aura virus
(for example ATCC VR-368, etc.); Bebaru virus (for example
ATCC VR-600, ATCC VR-1240, etc.); Cabassou virus (for
example ATCC VR-922, etc.); Chikungunya virus (for example
ATCC VR-64, ATCC VR-1241, etc.); Fort Morgan virus (for
example ATCC VR-924, etc.); Getah virus (for example ATCC
VR-369, ATCC VR-1243, etc.); Kyzylagach virus (for example,
CA 02561696 2006-09-28
- 84 -
ATCC VR-927, etc.); Mayaro virus (for example ATCCVR-66,
etc.); Mucambo virus (for example ATCC VR-580, ATCC VR-1244,
etc.) ; Ndumu virus (for example ATCC VR-371, etc.); Pixuna
virus (for example ATCC VR-372, ATCC VR-1245, etc.); Tonate
virus (for example ATCCVR-925, etc.); Triniti virus (for
example ATCC VR-469, etc.); Una virus (for example ATCC VR-
374, etc.); Whataroa virus (for example ATCC VR-926, etc.);
Y-62-33 virus (for example ATCC VR-375, etc.) ; O'Nyong
virus, Eastern encephalitis virus (for example ATCC VR-65,
ATCC VR-1242, etc.); Western encephalitis virus (for
example ATCC VR-70, ATCC VR-125L, ATCC VR-622, ATCC VR-1252,
etc.); coronavirus (for example ATCC VR-740, and those
described in Hamre, Proc Soc Exp Biol Ned, 121: 190 (1966);
etc.
Delivery of the compositions of this invention
into cells is not limited to the aforementioned viral
vectors. Other delivery methods and media may be employed
such as, for example, nucleic acid expression vectors,
polycationic condensed DNA linked or unlinked to killed
adenovirus alone (for example see Curiel, Hum Gene Ther, 3:
147-154 (1992)), ligand linked DNA (for example see Wu, J
Biol Chem, 64: 16985-16987 (1989)), eucaryotic cell
delivery vehicles cells (see, e.g., U.S. Patent Nos.
6,013,517, 6,015,686, etc.), deposition of photopolymerized
hydrogel materials, portable gene transfer particle gun, as
described in U.S. Patent No. 5,149,655, ionizing radiation
as described in WO 92/11033, nucleic charge neutralization
or fusion with cell membranes. Additional approaches are
described in Philip, Mol Cell Biol, 14: 2411-2418 (1994),
Woffendin, Proc Natl Acad Sci USA, 91: 1581-585 (1994), etc.
Particle mediated gene transfer may be employed.
The sequence can be inserted into conventional vectors that
contain conventional control sequences for high level
expression, and then be incubated with synthetic gene
transfer molecules (for example polymeric DNA-binding
CA 02561696 2006-09-28
- 85 -
cations like polylysine, protamine, and albumin, linked to
cell targeting ligands such as asialoorosomucoid, as
described in Wu et al., J. Biol. Chem., 262: 4429-4432
(1987), insulin as described in Hucked, Biochem Pharmacol,
40: 253-263 (1990), galactose as described in Plank,
Bioconjugate Chem, 3: 533-539 (1992), lactose, or
transferrin).
Naked DNA may also be employed. Exemplary naked
DNA introduction methods are described in WO 90/11092 and
U.S. Patent No. 5,580,859. Uptake efficiency may be
improved using biodegradable latex beads. DNA coated latex
beads are efficiently transported into cells after
endocytosis initiation by the beads. The method may be
improved further by treatment of the beads to increase
hydrophobicity and thereby facilitate disruption of the
endosome and release of the DNA into the cytoplasm.
Liposomes that can act as gene delivery vehicles
are described in U.S. Patent No. 5,422,120, WO 95/13796, WO
94/23697, WO 91/144445 and EP 524,968. On non-viral
delivery, the nucleic acid sequences encoding a modified
galectin 9 mutein polypeptide can be inserted into
conventional vectors that contain conventional control
sequences for high level expression, and then be incubated
with synthetic gene transfer molecules. The synthetic gene
transfer molecule includes polymeric DNA-binding cations
linked to cell targeting ligands such as asialoorosomucoid,
insulin, galactose, lactose, or transferrin. The polymeric
DNA-binding cation includes for example polylysine,
protamine, albumin, etc. Other delivery systems include
the use of liposomes to encapsulate DNA comprising the gene
under the control of a variety of tissue-specific or
ubiquitously-active promoters. Further non-viral delivery
suitable for use includes mechanical delivery systems such
as the approach described in Woffendin et al., Proc. Natl.
Acad. Sci. USA, 91(24): 11581-11585 (1994).
CA 02561696 2006-09-28
- 86 -
Moreover, the coding sequence and the product of
expression of such can be delivered through deposition of
photopolymerized hydrogel materials. Other conventional
methods for gene delivery that can be used for delivery of
the coding sequence include, for example, use of portable
gene transfer particle gun, as described in U.S. Patent No.
5,149,655; use of ionizing radiation for activating
transferred gene, as described in WO 92/11033.
Examples of liposome and polycationic gene
delivery vehicles are those described in U.S. Patent Nos.
5,422,120 and 4,762,915, WO 95/13796, WO 94/23697, WO
91/14445, EP 0524968, Stryer, Biochemistry, 236-240 (1975),
W. H. Freeman et al., Biochem Biophys Acta, 600: 1 (1980),
Bayer, Biochem Biophys Acta, 550: 464 (1979), Rivnay, Meth
Enzymol, 149: 119 (1987), Wang, Proc Natl Acad Sci USA, 84:
7851 (1987), Plant, Anal Biochem, 176: 420 (1989), etc.
The invention discloses a method of treating
mammals afflicted with a disorder or disease selected from
the group consisting of tumors including malignant ones
such as cancer, allergic diseases, inflammations,
conditions with immunological abnormality, and autoimmune
diseases that include activated lymphocytes (inter alia,
activated T-cells; may include activated B-cells), by
administration of a modified galectin 9 mutein or modified
galectin 9 mutein-derived therapeutic agent (for example,
composition comprising, as a therapeutic agent, either a
modified galectin 9 mutein polypeptide or a polynucleotide
encoding a modified galectin 9 mutein polypeptide for
expression in the mammal). Autoimmune diseases that can be
treated by the method and compositions of the invention
include any autoimmune disease, or transplantation
rejection, including, but not limited to, for example,
those autoimmune diseases listed herein.
CA 02561696 2006-09-28
- 87 -
Modified galectin 9 mutein can be administered,
for example, as a recombinantly expressed polypeptide, or
as a variant, derivative, or fusion protein of modified
galectin 9 mutein polypeptide, delivered either locally or
systemically to the mammal. The nucleic acid molecule
(e.g., DNA, RNA, etc.) encoding modified galectin 9 mutein,
or a derivative or variant of modified galectin 9 mutein,
or a modified galectin 9 mutein fusion, can be administered
in a gene therapy protocol, as naked plasmid DNA including
regulatory regions for expression in the mammal, or in a
viral vector for expression in the mammal. Delivery of
modified galectin 9 mutein polypeptide for expression can
be accomplished with a pharmaceutically acceptable carrier
capable of facilitating the delivery. Treatment of a
mammal having an autoimmune disease with a modified
galectin 9 mutein-derived therapeutic agent can result in
amelioration or remission or the autoimmune disease, or in
absence of clinical symptoms attributable to the
autoimmunity.
Although the invention is not limited to theories
of how the invention as disclosed herein works, it will be
posited according to activated T-cells and others that
cause the self-recognition and subsequent harm in
autoimmunity. By expressing modified galectin 9 mutein or
causing modified galectin 9 mutein to be expressed, or by
administering a modified galectin 9 mutein derived
therapeutic agent, the activated lymphocytes of concern are
preferentially targeted for apoptosis by receiving an
action of the modified galectin 9 mutein moiety made
available. The modified galectin 9 mutein polypeptide or
modified galectin 9 mutein derived therapeutic agent can be
administered in the region exhibiting the autoimmunity (for
example, in the localized region that characterized the
particular autoimmune disease being treated). This
optimizes the contact between the administered modified
galectin 9 mutein or other therapeutic agents and the
CA 02561696 2006-09-28
- 88 -
target expressing activated T-cells, or other cells, which
are specific for the targets expressed on the cells of that
region. The cells of the region are thus also good
candidates for expressing, by aid of a gene delivery
vehicle, a polynucleotide encoding a modified galectin 9
mutein polypeptide administered to the region. Thus, in
various permutations and applications of the invention, the
expression of the modified galectin 9 mutein polypeptide
can be recombinantly engineered to facilitate expression in
cells that are under attack by the activated T-cells and
other cells. Proposed in the case of transplantation
rejection is a modified galectin 9 mutein polypeptide
fusion with a binding portion of a molecule capable of
binding a protein ubiquitously expressed on the cell
surfaces of many cell types. This binding portion can be,
for example, heparin, and the molecule on the cell surface
to which it binds can be a glycosaminoglycan.
Alternatively, the binding portion may be a single chain
antibody binding domain, specific for any selected cell
surface antigen.
Where the inventive agents and therapeutic
techniques are applied in order to obtain cytotoxic actions
on tumor cells including malignant tumor cells such as
cancers, antiallergic actions, anti-inflammatory actions,
normalization of immunological abnormality, and apoptosis
inducing actions on activated lymphocytes (may include
inter alia activated T-cells), the invention should be
interpreted in the same fashion as in the aforementioned
autoimmune case.
The term "administration" or "administering" as
used herein refers to the process of delivering, to a
mammal, a therapeutic agent, or a combination of
therapeutic agents. The process of administration can be
varied, depending on the therapeutic agent, or agents, and
the desired effect. Administration can be accomplished by
CA 02561696 2006-09-28
- 89 -
any means appropriate for the therapeutic agent, for
example, by parenteral or oral delivery. The parenteral
delivery can be, for example, subcutaneous, intravenous,
intramuscular, intra-arterial, injection into the tissue of
an organ, mucosal, pulmonary, topical, or catheter-based.
Oral means is by mouth, including pills or other
gastroenteric delivery means, including a drinkable liquid.
Mucosal delivery can include, for example, intranasal
delivery. Pulmonary delivery can include inhalation of the
agent. Administration generally also includes delivery
with a pharmaceutically acceptable carrier (for example, a
buffer, a polypeptide, a peptide, a polysaccharide
conjugate, a liposome, a lipid, etc.). A gene therapy
protocol is considered to include an administration in
which the therapeutic agent is a polynucleotide capable of
accomplishing a therapeutic goal when expressed as a
transcript or a polypeptide in the mammal, and can be
applied to both parenteral and oral delivery means. Such
administration means are selected as appropriate for the
disease being treated. For example, where the disease is
organ-based, delivery may be local, and for example, where
the disease is systemic, the delivery may be systemic. The
"co-administration" refers to administration of one or more
therapeutic agents in course of a given treatment of a
patient. The agents may be administered with the same
pharmaceutical carrier, or different carriers. They may be
administered by the same or different administration means.
The agents may be the same type of agent or different types
of agents, for example, different types can include
polynucleotides, polypeptide, or small molecules. The time
of administration may be exactly the same time, or one
therapeutic agent may be administered before or after
another agent. Thus, co-administration can be simultaneous,
or consecutive. The exact protocol for a given combination
of therapeutic agents is determined considering the agents
and the condition being treated, among other considerations.
CA 02561696 2006-09-28
- 90 -
The term "in vivo administration" refers to
administration to a patient (for example a mammal), of a
polynucleotide encoding a polypeptide for expression in the
mammal. In particular, direct in vivo administration
involves transfecting a mammalian cell with a coding
sequence without removing the cell from the mammal. Thus,
direct in vivo administration may include direct injection
of the DNA encoding the polypeptide of interest in the
region afflicted by the autoimmune disease, resulting in
expression in the patient's cells.
The term "ex vivo administration" refers to
transfecting a cell (for example, a cell from a population
of cells that are under autoimmune attack) after the cell
is removed from the patient (for example a mammal). After
transfection the cell is then replaced in the mammal. Ex
vivo administration can be accomplished by removing cells
from a mammal, optionally selecting for cells to be
transformed (i.e., cells under attack by an autoimmune
mechanism), rendering the selected cells incapable of
replication, transforming the selected cells with a
polynucleotide encoding a gene for expression (i.e.,
modified galectin 9 mutein), including also a regulatory
region for facilitating the expression, and placing the
transformed cells back into the patient for expression of
the modified galectin 9 mutein.
The "therapeutically effective amount" is that
amount that generates the desired therapeutic outcome. For
example, if the therapeutic effect desired is a remission
from autoimmunity, the therapeutically effective amount is
that amount that facilitates the remission. The
therapeutically effective amount can be an amount
administered in a dosage protocol that includes days or
weeks of administration, for example. Where the
therapeutic effect is a reduction of the effects of an
autoimmune response in the mammal, for example, during the
= CA 02561696 2006-09-28
-91-
manifestations of symptoms of an autoimmune disease, the
effective amount of an agent to accomplish this in the
mammal is that amount that results in reduction of the
symptoms of autoimmunity.
The term "pharmaceutically acceptable carrier"
refers to a carrier for administration of a therapeutic
agent (for example, a polypeptide, polynucleotide, small
molecule, peptoid, peptide, etc.). It refers to any
pharmaceutically acceptable carrier that does not itself
induce the production of antibodies harmful to the
individual receiving the composition, and which may be
administered without undue toxicity. Within another aspect
of the invention, pharmaceutical compositions are provided,
comprising a recombinant viral vector as described above,
in combination with a pharmaceutically acceptable carrier
or diluent. Such pharmaceutical compositions may be
prepared either as a liquid solution, or as a solid form
(e.g., lyophilized) which is suspended in a solution prior
to administration. In addition, the composition may be
prepared with suitable carriers or diluents for either
surface administration, injection, oral, or rectal
administration. Pharmaceutically acceptable carriers or
diluents are nontoxic to recipients at the dosages and
concentrations employed. Representative examples of
carriers or diluents for injectable solutions include water,
isotonic saline solutions which are preferably buffered at
a physiological pH (such as phosphate-buffered saline or
Tris-buffered saline), mannitol, dextrose, glycerol, and
ethanol, as well as polypeptides or proteins such as human
serum albumin. A particularly preferred composition
comprises a vector or recombinant virus in 10 mg/ml
mannitol, 1 mg/ml HSA, 20 mM Tris, pH 7.2, and 150 mM NaCl.
In this case, since the recombinant vector represents
approximately 1 mg of material, it may be less than 1% of
high molecular weight material, and less than 1/100,000 of
the total material (including water). This composition is
CA 02561696 2006-09-28
- 92 -
stable at 20 C for at least six months.
The pharmaceutical compositions of the present
invention may also additionally include factors which
stimulate cell division, and hence, uptake and
incorporation of a recombinant retroviral vector.
Preserving recombinant viruses is described in U.S. Patent
No. 5,792,643.
All of the therapeutic agents that make up the
proposed therapy of the invention can be incorporated into
an appropriate pharmaceutical composition that includes a
pharmaceutically acceptable carrier for the agent. The
pharmaceutical carrier for the agents may be the same or
different for each agent. Suitable carriers may be large,
slowly metabolized macromolecules such as proteins,
polysaccharides, polylactic acids, polyglycolic acids,
polymeric amino acids, amino acid copolymers, and inactive
viruses in particles. Such carriers are well known to
those of ordinary skill in the art. Pharmaceutically
acceptable salts which can be used therein, include for
example inorganic acid salts such as hydrochlorides,
hydrobromides, phosphates, sulfates, and the like; and the
salts of organic acids such as acetates, propionates,
malonates, benzoates, and the like. A thorough discussion
of pharmaceutically acceptable excipients is available in
Remington's Pharmaceutical Sciences (Mack Pub. Co., N.J.,
USA, 1991). Pharmaceutically acceptable carriers in
therapeutic compositions may contain liquids such as water,
saline, glycerol and ethanol. Auxiliary substances may
include wetting or emulsifying agents, etc. Additionally,
pH buffering substances, and the like, may be present in
such vehicles. Typically, the therapeutic compositions are
prepared as injectables, either as liquid solutions or
suspensions; solid forms suitable for solution in, or
suspension in, liquid vehicles prior to injection may also
be prepared. Liposomes are included within the definition
CA 02561696 2006-09-28
- 93 -
of a pharmaceutically acceptable carrier.
Provided are pharmaceutical compositions
comprising a recombinant retrovirus or virus carrying one
of the above-described vector constructs, in combination
with a pharmaceutically acceptable carrier or diluent. The
composition may be prepared either as a liquid solution, or
as a solid form (e.g., lyophilized) which is suspended in a
solution prior to administration. In addition, the
composition may be prepared with suitable carriers or
diluents for either surface administration, injection, oral,
or rectal administration.
Pharmaceutically acceptable carriers or diluents
are nontoxic to recipients at the dosages and
concentrations employed. Representative examples of
carriers or diluents for injectable solutions include water,
isotonic saline solutions which are preferably buffered at
a physiological pH (such as phosphate-buffered saline or
Tris-buffered saline), mannitol, dextrose, glycerol, and
ethanol, as well as polypeptides or proteins such as human
serum albumin. A vector or recombinant virus can be
delivered in a pharmaceutical composition in 10 mg/ml
mannitol, 1 mg/ml HSA, 20 mM Tris, pH 7.2, and 150 mM NaCl.
In this case, since the recombinant vector represents
approximately 1 g of material, it may be less than 1% of
high molecular weight material, and less than 1/100,000 of
the total material (including water). This composition is
stable at 20 C for at least six months.
The pharmaceutically acceptable carrier or
diluent may be combined with the gene delivery vehicles to
provide a composition either as a liquid solution, or as a
solid form (e.g., lyophilized) which can be resuspended in
a solution prior to administration. The two or more gene
delivery vehicles are typically administered via
traditional direct routes, such as buccal/sublingual,
rectal, oral, nasal, topical, (such as transdermal and
= CA 02561696 2006-09-28
- 94 -
ophthalmic ) , vaginal, pulmonary, intraarterial,
intramuscular, intraperitoneal, subcutaneous, intraocular,
intranasal or intravenous, or indirectly.
The therapeutic drug of the present invention may
include optionally, for example, polynucleotides for
expression in the mammal. Said therapeutic drugs can be
formulated into an enteric coated tablet or gel capsule
according to known methods in the art. These are described
in the following patent documents: U.S. Patent No.
4,853,230, EP 225,189, AU 9,224,296, AU 9,230,801, WO
92144,52, and others. Such a capsule is administered
orally to be targeted to the intestinum. At 1 to 4 days
following oral administration, expression of the
polypeptide, or inhibition of expression by, for example a
ribozyme or an antisense oligonucleotide, is measured in
the plasma and blood, for example by antibodies to the
expressed or non-expressed proteins.
The gene delivery vehicle can be introduced into
a mammal, for example, by injection, particle gun, topical
administration, parental administration, inhalation, or
iontophoretic delivery, as described in U.S. Patent Nos.
4,411,648, 5,222,936, 5,286,254, WO 94/05369, etc.
The therapeutic composition or therapeutic agent
can be administered with other therapeutic agents capable
of combating tumors including malignant tumors such as
cancers, or ameliorating allergy, inflammation,
immunological abnormality, or the autoimmune disease, or
capable of enhancing the therapeutic benefits of
administration of a modified galectin 9 mutein therapeutic
agent. For example, administration for treatment of an
allergic reaction can be by aerosol administration of
modified galectin 9 mutein polynucleotide for expression in
the cells present in tissue such as mucosal, nasal,
bronchial or lung tissue, and may be most favorably
administered in repeat administrations, for example by
CA 02561696 2006-09-28
- 95 -
nasal or aerosol spray several times daily for a period of
time until the allergic reaction subsides.
The gene delivery vehicle may be administered at
single or multiple sites to a mammal directly, for example
by direct injection, or alternatively, through the use of
target cells transduced ex vivo. The present invention
also provides pharmaceutical compositions (including, for
example, various excipients) suitable for administering the
gene delivery vehicles.
A vector construct which directs the expression
of a modified galectin 9 mutein polypeptide, variant,
derivative, analogue, mutant, or chimera thereof can be
directly administered to a tumor site containing malignant
tumor such as cancer, or a site exhibiting allergy,
inflammation, immunological abnormality, or autoimmunity,
for example the pancreas, kidney, liver, joints, brain, the
spinal fluid, skin, or other region or organ of the body.
Various methods may be used within the context of the
present invention in order to directly administer the
vector construct. For example, arteries which serve the
region may be identified, and the vector injected into such
an artery, in order to deliver the vector directly into the
site. Similarly, the vector construct may be directly
administered to the skin surface, for example, by
application of a topical pharmaceutical composition
containing the vector construct.
In a direct administration, combination
therapeutic agents including a modified galectin 9 mutein
therapeutic agent and other anti-autoimmune agents can be
administered together. The co-administration can be
simultaneous, achieved for example by placing
polynucleotides encoding the agents in the same vector, or
by putting the agents, whether polynucleotide, polypeptide,
or other drug, in the same pharmaceutical composition, or
CA 02561696 2006-09-28
- 96 -
by administering the agents in different pharmaceutical
compositions injected at about the same time, and perhaps
in the same location. If the co-administration is not
simultaneous (for example, in the case of administration of
the prodrug after administration of the prodrug activator),
the second agent can be administered by direct injection as
appropriate for the goals of the therapy. Thus, for
example, in the case of an administration of a prodrug, the
prodrug is administered at the same location as the prodrug
activator. The co-administration protocol can include a
combination of administrations to achieve the goal of the
therapy. Further, the co-administration can include
subsequent administrations as is necessary, for example,
repeat in vivo direct injection administrations of a
modified galectin 9 mutein.
Within the context of the present invention, it
should be understood that the removed cells may be returned
to the same animal, or to another allogenic animal or
mammal. In such a case it is generally preferable to have
histocompatibility matched animals (although not always,
see, e.g., Yamamoto et al., AIDS Research and Human
Retroviruses, 7: 911-922 (1991); Yamamoto et al., Journal
of Virology, 67: 601-605 (1993)).
Cells may be removed from a variety of locations
in the patient. In addition, within other embodiments of
the invention, a vector construct may be inserted into, for
example, cells from the skin (dermal fibroblasts, etc.), or
from the blood (e.g., peripheral blood leukocytes, etc.).
If desired particular fractions of cells such as a T cell
subset or stem cells may also be specifically removed from
the blood (see, for example, WO 91/16116). Vector
constructs may then be contacted with the removed cells
utilizing any of the above-described techniques, followed
by the return of the cells to the warm-blooded animal,
preferably to or within the vicinity of the region
CA 02561696 2006-09-28
- 97 -
exhibiting autoimmunity.
Once the patient, for example a mammal, has been
diagnosed, practice of the invention includes providing a
modified galectin 9 mutein therapeutic agent, and
administering it to the mammal in a manner and dose
appropriate for the particular disease being treated (for
example tumors, allergic or autoimmune diseases, etc.), and
monitoring the mammal for determining the need for
continued or modified administrations of the therapeutic
agent. Practice of the invention is accomplished by
identifying the disease to be treated, and determining the
probable cell-type or region of the body to which a
targeted gene therapy can be applied. The modified
galectin 9 mutein polynucleotide is constructed, including
either a plasmid with regulatory regions for expression in
the mammal, or a viral vector for the expression. Some of
the mammalian cells can be removed, transfected with the
polynucleotide encoding modified galectin 9 mutein, and
replaced into the mammal for expression of modified
galectin 9 mutein. Alternatively the polynucleotide can be
administered to the mammal, for example in the region where
the disease is manifest, for expression in the mammalian
cells in that region.
Thus, for example, in the case of malignant tumor
cells, the tumor cells in diseased tissue or organ can be
transfected in vivo or ex vivo with modified galectin 9
mutein. Further, for example, in the case of rheumatoid
arthritis, the synovial cells can be transfected ex vivo
with modified galectin 9 mutein.
For example, in treatment of multiple sclerosis,
modified galectin 9 mutein can be injected into the region
of the brain being effected to facilitate expression of
modified galectin 9 mutein in the cells that are under
attack by the activated T-cells in an autoimmune type of
CA 02561696 2006-09-28
- 98 -
reaction. Also, by example, in the case of multiple
sclerosis, modified galectin 9 mutein DNA can be locally
injected into the mammal's brain, or cells from the spinal
fluid can be removed, transfected with modified galectin 9
mutein DNA, and returned to the region of the spinal cord.
Further by example, for treating a mammal having SjOgren's
syndrome, the organ targeted by the disease is selected for
administration of modified galectin 9 mutein polypeptide by
injection. Also, by example, for mammal's suffering from
SjOgren's syndrome, the affected organ can be identified,
for example the kidney, and modified galectin 9 mutein DNA
administered to the organ directly, or cells from the organ
removed, transfected, and replaced in the body for
expression of modified galectin 9 mutein in those cells in
the mammal.
For example, in the case of preventing
transplantation rejection, the animal to receive the
transplant can receive localized or systemic administration
of a modified galectin 9 mutein therapeutic agent in order
to kill any activated patient cells which attacks the
foreign cells, tissue or organ, or a modified galectin 9
mutein polypeptide can be expressed in cells on the
external surface of the organ just prior to the transplant,
in order to protect the organ once inside the patient's
body. Continued administration of the modified galectin 9
mutein therapeutic agent may be necessary while the
recipient's immune system adjusts to the foreign cells,
tissue or organ.
The modified galectin 9 mutein therapeutic agent
is expected to act analogously to native galectin 9 (wild
type galectin 9). Accordingly, it will be used to cause an
apoptotic reaction in the cells. Thus, stoichiometrically,
the clinician would be able to be aware of the amount of
modified galectin 9 mutein that needs to be expressed or
otherwise administered to the mammal for achieving
CA 02561696 2006-09-28
- 99 -
apoptosis. Within other aspects of the present invention,
the vector constructs described herein may also direct the
expression of additional non-vector derived genes. For
example, a prodrug system applied in conjunction with
administration of modified galectin 9 mutein can act as a
safety mechanism for the gene therapy, or can act as a
combination therapeutic agent.
As a safety mechanism, the prodrug activator is
expressed in a vector along with the modified galectin 9
mutein. When it is determined that the system should be
arrested, the prodrug is administered and the prodrug
activator is activated. This allows the clinician a
measure of control over the gene therapy. The prodrug
activator/prodrug system may be useful for inactivating the
transfected cells in the mammal, where, for example, the
autoimmunity is exacerbated by the modified galectin 9
mutein expression. The prodrug activator/prodrug system
can also be administered as combination therapeutic agent,
in a combination therapy protocol, for achieving cell
killing using the prodrug activation provided by the
prodrug activator/prodrug system.
The therapy including administration of a
polynucleotide encoding a modified galectin 9 mutein
polypeptide, in conjunction with a prodrug activator and
prodrug, can also be immunomodulatory. The
"immunomodulatory" refers to use of factors which, when
manufactured by one or more of the cells involved in an
immune response, or, which, when added exogenously to the
cells, causes the immune response to be different in
quality or potency from that which would have occurred in
the absence of the factor. The quality or potency of a
response may be measured by a variety of assays known to
one of skill in the art including, for example, in vitro
assays which measure cellular proliferation (e.g., 3H
thymidine uptake), and in vitro cytotoxic assays (e.g.,
CA 02561696 2006-09-28
- 100 -
which measure 51Cr release) (see, Warner et al., AIDS Res.
and Human Retroviruses, 7: 645-655 (1991)).
Immunomodulatory factors may be active both in vivo and ex
vivo. Representative examples of such factors include
cytokines, such as interleukins 2, 4, 6, 12 and 15 (among
others), a-interferons, 13-interferons, y-interferons, GM-
CSF, G-CSF, and tumor necrosis factors (TNFs). Other
immunomodulatory factors include, for example, CD3, ICAM-1,
ICAM-2, LFA-1, LFA-3, MHC class I molecules, MHC class II
molecules, (32¨microglobulin, chaperones, or analogs thereof.
If the gene delivery vehicle, however, does not express an
immunomodulatory cofactor which is a cytokine, this
cytokine may be included in the above-described
compositions, or may be administered separately
(concurrently or subsequently) with the above-described
compositions. Briefly, within such an embodiment, the
immunomodulatory cofactor is preferably administered
according to standard protocols and dosages known in the
art. For example, a-interferon may be administered at a
dosage of 100 to 5000,000 units/day for 2 to 4 months, and
IL-2 at a dosage of 10,000 to 100,000 units/kg of body
weight, 1 to 3 times/day, for 2 to 12 weeks. y-Interferon
may be administered at dosages of 150,000 to 1,500,000
units 2 to 3 times/week for 2 to 12 weeks for example, for
upregulating the expression of a gene concerned in
activated T-cells for achieving more effective therapy with
the administration of modified galectin 9 mutein.
As a combination therapeutic agent, the prodrug
activator can be expressed from its own vector, or from the
same vector as the modified galectin 9 mutein polypeptide.
Either vector system (a single vector, or two vectors) can
be administered by in vivo or ex vivo means. In an
autoimmune therapy, for example, the addition of the
prodrug activator facilitates further immunomodulatory
effect supporting the effect achieved by modified galectin
9 mutein and in addition, addition of the prodrug can
CA 02561696 2006-09-28
- 101 -
activate the killing of transfected cells.
A chaperon molecule can be administered before,
contemporaneously with or after administration of the
polynucleotide therapeutic, and the chaperon molecule can
be, for example, a heat shock protein, such as, for example
hsp70. Further, the polynucleotide being expressed in the
mammal can be linked to an inducible promoter, for example
a tissue specific promoter, for the purpose of, for example,
ensuring expression of the polynucleotide only in the
desired target cells. Additionally, for the purpose of
effectively delivering the polynucleotide to a tissue, the
polynucleotide can be flanked by nucleotide sequences
suitable for integration into genome of the cells of that
tissue.
For this and many other aspects of the invention,
effectiveness of treating humans may first be tested in
animal models for a given autoimmune disease. Such
existing animal models include those for the following
autoimmune disease: for example, SjOgren's syndrome
(autoimmune dacryodentis or immune-mediated sialadenitis),
autoimmune myocarditis, primary biliary cirrhosis (PBC),
inflammatory heart disease, mercury-induced renal
autoimmunity, insulin dependent diabetes mellitus (type I
diabetes or IDD), post-thymectomy autoimmunity, a central
nervous system (CNS) demyelination disorder, CNS lupus,
narcolepsy, myasthenia gravis (MG), Grave's disease, a
immune-mediated PNS disorder, osteoarthritis, rheumatoid
arthritis, uveitis, medullary cystic fibrosis, autoimmune
hemolytic disease, autoimmune vasculitis, ovarian
autoimmune disease, human schleroderma, and other
autoimmune-related diseases.
The multiple gene delivery vehicles may be
administered to animals or plants. In preferred
embodiments, the animal is a warm-blooded animal, further
4
CA 02561696 2006-09-28
- 102 -
pr e f er ably selected from the group consisting of mice,
chickens, cattle, pigs, pets such as cats and dogs, horses,
and humans. For polypeptide therapeutics, for example,
modified galectin 9 mutein or other cytokine, the dosage
can be in the range of about 5 to 50gg/kg of mammal body
weight, also about 50gg/kg to about 5 mg/kg, about 100 to
500gg/kg of mammal body weight, and about 200 to about 250
gg/kg.
For polynucleotide therapeutics, for example a
polynucleotide encoding a native or mutant modified
galectin 9 mutein polypeptide, depending on the expression
of the polynucleotide in the patient, for example a mammal,
for tissue targeted administration, vectors containing
expressible constructs of coding sequences, or non-coding
sequences can be administered in a range of: about 100 ng
to about 200 mg of DNA for local administration in a gene
therapy protocol, also about 500 ng to about 50 mg, also
about lgg to about 2 mg of DNA, about 5gg of DNA to about
500gg of DNA, and about 20gg to about 100g during a
local administration in a gene therapy protocol, and for
example, a dosage of about 500gg, per injection or
administration. Where greater expression is desired, over
a larger area of tissue, larger amounts of DNA or the same
amounts readministered in a successive protocol of
administrations, or several administrations to different
adjacent or close tissue portions of for example, a tumor
site, may be required to effect a positive therapeutic
outcome.
For administration of small molecule therapeutics,
depending on the potency of the small molecule, the dosage
may vary. For a very potent inhibitor, dose levels per
kilogram of mammal may be sufficient, for example, in the
range of about lgg/kg to about 500 mg/kg of mammal weight,
and about 100gg/kg to about 5 mg/kg, and about lgg/kg to
about 50gg/kg, and, for example, about lOgg/kg. For
CA 02561696 2006-09-28
- 103 -
admini strati on of peptides and peptoids the potency also
affects the dosage, and may be in the range of about lug/kg
to about 500 mg/kg of mammal weight, and about 100gg/kg to
about 5 mg/kg, and about lug/kg to about 50gg/kg, and a
usual dose might be about lOgg/kg.
Dose levels of said active components may vary
within a wide range. Specific dose levels and
administration cycles for any particular patient will be
employed depending upon a variety of factors including the
activity of specific compounds employed, the sex, age, body
weight, general health, diet, time of administration, route
of administration, rate of excretion, drug combination, and
the severity of the particular disease undergoing therapy.
For the manufacture of pharmaceutical
compositions and preparations, the additives, other
materials, preparation methods and the like can be suitably
selected from those disclosed in Nippon Yakkyokuho
Kaisetsusho Henshu Iinkai (Ed.), "14th Edition Nippon
Yakkyokuho Kaisetsusho (Commentary on The Japanese
Pharmacopoeia 14th Edition (JPXIV))", June 27, 2001,
Hirokawa Pub. Co., Tokyo, Japan; Hisashi Ichibagade et al.
(Ed.), "Iyakuhin no Kaihatsu (Pharmaceutical Research and
Development, Ikuo Suzuki, chief editor), Volume 12 (Seizai
Sozai I (Pharmaceutical Necessities 1))", October 15, 1990,
Hirokawa Pub. Co., Tokyo, Japan; ibid., Volume 12 (Seizai
Sozai II (Pharmaceutical Necessities 2)), October 28, 1990,
Hirokawa Pub. Co., Tokyo, Japan; etc., depending on
necessity, and can be adapted by referring to the
disclosures therein.
The active substances or components according to
the present invention include (a) modified galectin-9
variants and polypeptides having biological activity
substantially equivalent to that of said modified Gal-9
variant, (b) polynucleotides encoding modified Gal-9
CA 02561696 2006-09-28
- 104 -
var iant s or polypeptides having biological activity
substantially equivalent to that of the modified Gal-9
variant, (c) factors discovered by applications of modified
galectin-9 variant techniques, and (d) vehicles for
transfer of genes coding for modified Gal-9 variants or
polypeptides having biological activity substantially
equivalent to that of the modified Gal-9 variant, as
described herein. These substances and components are
useful for utilizing the following properties of human
galectin-9: exerting cytotoxity toward tumor cells, but not
toward normal cells; inducing apoptosis in tumor cells, but
not in normal cells; inhibiting metastasis of malignant
cells; and inducing apoptosis in activated immune cells, in
particular, in activated CD4-positive T cells, but not in
resting T cells, in particular, in CD4-positive T cells
(helper T cells). Thus, the above-mentioned substances and
components are promising to serve as drugs utilizing
activities similar to those of anti-neoplastic agents,
anti-allergy agents, immunoregulators (immunomodulators),
therapeutic agents for autoimmune diseases, anti-
inflammatory agents, and adrenocortical steroid hormones.
From biological efficacy that has been affirmed
by the application of the active components of the present
invention, including for example modified Gal-9 proteins
(inter alia G9NC(null)), galectin 9 and modified galectin 9
proteins (inter alia G9NC(null)) are thought to be
biologically active and advantageously useful in preventing
or treating at least one disorder, disease or pathological
condition as follows:
Inflammatory diseases and disorders include a
variety of acute or chronic inflammations occurring in
various organs, allergic or autoimmune inflammations,
infectious diseases and others.
Acute and chronic diseases and disorders include
inflammations of the lung, such as bronchitis,
bronchopneumonia, interstitial pneumonia, pneumonitis,
CA 02561696 2006-09-28
- 1 05 -
bronchiolitis and acute mediastinitis; inflammations of
other miscellaneous organs, including, for example,
pericarditis, endocarditis, myocarditis, stomatitis,
angular stomatitis, tonsillitis, pharyngitis, laryngitis,
esophagitis, peritonitis, acute gastritis, chronic
gastritis, acute enteritis, appendicitis, ischemic colitis,
drug induced colitis, and proctitis; various acute or
chronic inflammations of the liver, such as hepatitis A,
hepatitis B, hepatitis C, fulminant hepatitis, and acute
hepatitis; cirrhosis; cholecystitis; acute pancreatitis,
chronic pancreatitis; acute or chronic nephritis,
membranous glomerulonephritis, glomerulonephritis, IgA
nephritis, etc.; a variety of cystitis, encephalomyelitis,
mastitis, dermatitis, superficial keratitis, xerotic
keratoconjunctivitis, a variety of otitis media and
rhinitis, paranasal sinusitis, nasal polyp, etc.;
gingivitis, periodontitis, and other inflammatory disorders
of the periodontium; other various and miscellaneous
inflammations.
They are recognized to be potent and efficacious
in preventing or treating neurogenic inflammations, such as
neurogenic gastritis and neurogenic cystitis. For instance,
it has been verified in Example 8 herein that galectin 9
potently inhibits inflammatory responses in capsaicin-
induced neurogenic skin inflammation models. Capsaicin is
a substance that excites afferent nerves, causing
neurogenic inflammation and pain. Capsaicin stimulates the
release of substance P, a neuropeptide stored by sensory C
fiber endings. Substance P induces release of histamine
from mast cells, thereby resulting in dilating blood
vessels to form edema. Sensory nerves are stimulated by
released histamine. As a result, a cascade cycle will be
formed wherein substance P is released from C fiber endings
and acts on surrounding mast cells, thereby resulting in
more histamine release.
The galectins exert inhibitory actions on said
pathogenic process.
CA 02561696 2006-09-28
- 106 -
Further, capsaicin binds to a capsaicin receptor
(vanilloid receptor, a pain sensor in sensory nerve
endings), causing pain. Pain is caused by activating
sensory nerve endings with chemical stimuli (acid, etc),
thermal stimuli (hot water, etc), and excessive mechanical
stimuli (by a blow, etc.) sensory nerve endings. The
capsaicin receptor is involved in pain arising from such
stimuli. Therefore, it is suggested that Gal-9 inhibits
capsaicin receptor-mediated activation of nerve endings.
Thus, they have much promise in analgesic applications
including relief of pain associated with cancer and
inflammation.
Allergy associated inflammatory diseases include
systemic or generalized anaphylaxis, bronchial asthma,
hypersensitivity pneumonitis, pollenosis, allergic rhinitis,
allergic conjunctivitis, immune complex-induced allergic
diseases, angioneurotic edema, etc.
Autoimmune related inflammatory diseases
(autoimmune diseases) include systemic diseases (chronic
rheumatoid arthritis, systemic lupus erythematosis,
polyarteritis nodosa, scleroderma,
polymyositis/dermatomyositis, SjOgren's syndrome, Behget's
disease and others), nervous system diseases (multiple
sclerosis, myasthenia gravis, HAM (HTLV-1 myelosis),
amyotrophic lateral sclerosis and others), endocrine
diseases (Basedow's disease, Hashimoto's thyroiditis, type
I diabetes and others), blood diseases (idiopathic
thrombocytopenic purpura, autoimmune hemolytic anemia,
aplastic anemia and others), respiratory diseases
(sarcoidosis, idiopathic pulmonary fibrosis and others),
gastrointestinal diseases (ulcerative colitis, Crohn's
disease and others), hepatic diseases (autoimmune hepatitis,
primary biliary cirrhosis, primary sclerosing cholangitis,
autoimmune cholangitis and others), and renal/urinary tract
system diseases (anti-neutrophil cytoplasmic antibody
associated nephritis, angitis, Goodpasture's syndrome,
anti-glomerular basement membrane antibody disease and
CA 02561696 2006-09-28
-107-
others), etc.
Infection is a general term for the result of
invasion of the body cells, tissues and organs by pathogens.
Infectious diseases are disclosed in Supervisor: Rikuo
MACHINAMI, Editor: Junichi HATA & Atsuhiko SAKAMOTO,
"Hyoujun Byourigaku, 2nd Edition", Igaku-Shoin Ltd., Japan
(March 15, 2002; ISBN4-260-10359-8). The pathogen that
causes infection in human is selected from the group
consisting of 1) bacteria (including spirochaeta, chlamydia,
and Rickettsia), 2) viruses, 3) fungi, 4) plants (algae),
5) protozoa, 6) parasites (Digenea (distomes or
trematodes)), cestodes (tapeworms), nematodes), and 7)
arthropods. Principle diseases resulting from the presence
or activity of the pathogen include bacterioses (cholera,
pest, Escherichia coli infection, etc.), spirochetoses
(leptospirosis, etc.), chlamydioses (psittacosis, etc.),
rickettsial infections (Rickettsia prowazekii, tetanus,
etc.), viral infections (herpes zoster, viral hemorrhagic
fever, rabies, etc.), mycoses (candidiasis, cryptococcosis,
aspergillosis, etc.), protozoal diseases (amebic dysentery,
malaria, toxoplasmosis, etc.), parasitoses (distomiasis,
nematodiasis, etc.), mycoplasma infections (mycoplasma
pneumonia, etc.), mycobacterioses (tuberculosis, atypical
mycobacteriosis, etc.) and other infectious ones.
Sarcomas and cancers include brain tumors
(glioblastoma multiforme, etc.), spinal tumors, maxillary
sinus carcinoma, pancreatic ductal adenocarcinoma, gingival
cancers, tongue cancers, lip cancers, nasopharyngeal
cancers, oropharyngeal cancers, hypopharyngeal cancers,
laryngeal cancers, thyroid cancers, parathyroid cancers,
lung cancers, pleural tumors, carcinomatous peritonitis,
carcinomatous pleurisy, esophageal cancers, stomach cancers,
colon cancers, bile duct cancers, gall bladder cancers,
pancreatic cancers, liver cancers, renal cancers, urinary
bladder cancers, prostatic cancers, penile cancers,
testicular tumors, adrenal cancers, cervical cancers,
endometrial cancers, vaginal cancers, vulvar cancers,
CA 02561696 2006-09-28
- 108 -
ovarian cancers, chorioepithelioma, malignant bone tumors,
soft part sarcoma, breast cancers, skin cancers, malignant
melanoma, basal cell tumors, leukemia, myelofibrosis
associated with agnogenic myeloid metaplasia, malignant
lymphoma, Hodgkin's disease, plasmacytoma, glioma and
others.
The active components of the present invention
are useful in dermatological applications.
For example, 1) skin diseases and abnormal skin conditions
include skin infections, skin inflammations including
allergic inflammations and autoimmune inflammations; and
skin diseases with inflammatory characteristics, such as
psoriasis, hydroa, pustulosis, keratinization, and
keratonosis, etc. Further, cosmetic and skin care
applications include:
a) control of melanin metabolism (skin whitening)
- - - Galectin 9 gene-transferred melanoma cells
turned white from black tones. Galectin 9-
positive cells are present in the skin's
basal cell layer.
b) control of hair growth (trichogen)
- - - Galectin 9 is expressed at the hair root site
in a time-dependent manner. Hairs are grown
extremely well in a galectin 9 gene-
transferred mouse as compared to a mutant
galectin 9 gene-transferred mouse.
c) control of collagen production, etc.
- - - Fibroblasts express galectin 9 in response
to a variety of stimuli. Galectin 9-
positive portions are present in fibrous
connective tissues.
Life-style related diseases include
hypercholesterolemia, arteriosclerosis, hypertension,
diabetes, etc. It has been clarified that ga19-positive
and ga19-negative cells are present in foam cells, involved
CA 02561696 2006-09-28
- 109 -
in formation of life-style related disease arteriosclerosis.
From that, it is suggested that gal9 participates in the
pathologic condition of arteriosclerosis. Thus, it cannot
be denied to allow the prevention and therapy of the
disease via its control.
For hypertension, where the onset of hypertension
occurs in experimental animal models, the expression of
galectin 9 will be enhanced in the uriniferous tubules and
glomerulus. Therefore, the regulation of galectin 9
expression and administration of galectin 9 may allow
therapeutic merits.
The active components of the present invention
are also applicable to the maintenance of a normal
bacterial flora. For example, gal9 is intensely expressed
in intestinal epithelium even under normal conditions.
When the bad bacterial flora is administered, the
expression of galectin 9 is enhanced in the intestinal
epithelium and inflammatory cells such as macrophage.
From that, it is clearly suggested that galectin 9 will
participate in the maintenance of the normal bacterial
flora at digestive ducts.
The active components of the present invention
can be applied to amyloidosis. For example, there are
galectin 9-expressing macrophages among those at a site
where amyloidosis is perceivable. Therefore, it may be
possible to control the deposition of amyloids with
galectin 9.
The active components of the present invention
are useful in preventing or treating Alzheimer's disease,
osteoporosis, bone fracture, etc. For example, in the
brain of a patient with Alzheimer's disease, degenerative
nerve cells give galectin 9-positive appearance. Therefore,
it may be possible to use it for therapy and diagnosis.
For osteoporosis, it can be viewed that galectin 9 may
prevent bone absorption and facilitate bone formation. It
is thought that such actions are suitable for ideal drugs
in consideration of bone metabolism.
CA 02561696 2006-09-28
- 110 -
The active components of the present invention
are useful in brain and nervous areas. For instance, the
development of ischemic lesions, such as cerebral
infarction and myocardial infarction, accompanies
infiltration of inflammatory cells, leads to occurrence of
superoxide production, etc. and comes to a deterioration.
It can be expected that galectin 9 and modified galectin 9
mutein may regulate said inflammation. The demyelinating
disease that is caused by inflammation and alteration of
the immune system includes, for example, multiple sclerosis,
etc. The degenerative disease also includes amyotrophic
lateral sclerosis, Parkinson's disease, etc. It is said
that schizophrenia may be caused by inflammatory alteration.
That is, EPA (eicosapentaenoic acid) is used to control
inflammatory reaction in brain and form nerve cell
membranes. There are study examples revealing that EPA and
other essential fatty acids in cell membranes are exhausted
in Schizophrenia patients. It can be anticipated that
galectin 9 and modified galectin 9 mutein may be effective
in gout. It can be expected that galectin 9 and modified
galectin 9 mutein may be effective in controlling acute
inflammation with a severe pain, due to tissue deposition
of uric acid crystals.
Asthma is a disease of the respiratory system in
which reversible airway obstruction (asthmatic attack)
occurs. The disorder is a condition in which the airways
develop increased responsiveness to antigen-specific or
non-specific stimuli (allergen, infection, cold air, etc.).
In recent years, it is demonstrated that there are
inflammations in which eosinophils, T lymphocytes, and mast
cells predominate even during a stable stage free of an
attack in asthma airways. It is now thought that the main
part of asthma is chronic bronchitis. Most of pediatric
asthma diseases are closely related to a cause of atopy
(IgE production), e.g., atopic asthma, and cases where the
involvement of IgE in adult asthma is non-provable are
CA 02561696 2006-09-28
- 111 -
recognized to be about half (non-atopic asthma).
Guidelines on the prophylaxis and management of asthma
(1998 Ministry of Health and Welfare (MHW), Research
Committee, Japan) have been prepared, wherein asthma
treatments are classified into two techniques, one for
acute attacks and the other for chronic airway inflammatory
disease. The therapeutics for asthma attacks include
bronchodilators (p2-agonists, aminophylline, etc.), which
are first-line drugs. However, these drugs are
insufficient to medicate moderate or severe attacks, for
which high-dose steroid drugs are applied by systemic
administration. The steroid drugs have powerful side
effects, including especially serious peptic ulcer,
hypertension, hyperglycemia, psychogenic symptoms and
others. When the steroids are applied for a long time,
infectious diseases, depressed functioning of the adrenal
gland, osteoporosis and other symptoms will become problems.
In addition, when the disorder is associated with
complications, the use of steroids is accompanying risk.
It is demanded to develop drugs with efficacy equivalent to
the steroid and less adverse reaction. The core of long-
term medications for chronic inflammatory airway disease is
an anti-inflammatory drug. The use of inhaled steroid
drugs inter alia is recommended. When the steroid drugs
are applied for a long term at high-dose levels, there is
no denying that it is potential to produce harmful side
effects such as depressed functioning of the adrenal gland,
osteoporosis, and airway infection. Further, inhaled drugs
require exact inhaling techniques and are poor in view of
compliance as compared to oral drugs. In addition to
medications with inhaled steroid drugs, moderate or severe
asthma is recommended to be treated with a combination of
inhaled p2-agonists, leukotriene modifiers (leukotriene
antagonists) or sustained release theophylline drugs.
Systemic steroid administration is unavoidable in severe
asthma patients. It is demanded to develop alternative
drugs for such drugs. It is known that the infiltration of
CA 02561696 2006-09-28
- 112 -
T lymphocytes and eosinophils into lung tissue and airways
plays an important role in the formation of asthma disease.
Galectin 9 functions in inducing apoptosis of cells, and
induces apoptosis of activated T cells and eosinophils. In
view of studies wherein modified galectin 9 muteins and
other materials are employed in the present invention based
on these, it has been clarified that galectin 9 and
modified galectin 9 mutein are active in ameliorating
(inhibiting) inflammatory airway symptoms associated with
asthma.
Further, galectin 9 and modified galectin 9
mutein have activity of enhancing the growth and
differentiation of osteoblasts and inhibiting the
differentiation of osteoclasts, and are thought to be
useful in prophylactic and/or therapeutic treatment of
osteoporosis, and bone growth inhibition, one of side
effects which become problems when steroids are
administered for a long time. Galectin 9 and modified
galectin 9 mutein act in activated lymphocyte-specific
inhibition, differently from steroids, with regard to
actions on lymphocytes, and can be expected to be less
adverse, for example, less immunodepressant, as compared to
steroids. In addition, they have inhibitory actions on
functions of adhesive molecules and neurogenic inflammation
while steroids do not, and are promising therapeutic drugs
for asthma, e.g., therapeutic drugs for asthma attacks.
In our opinion, it may be possible to relieve steroidal
side reaction.
CA 02561696 2012-05-10
= 31162-5
- 113 -
Examples
Details of the present invention are described by
the following examples but such examples are provided only
for illustrative purposes, and for referential embodiments
of the present invention. These examples have been
described herein for the purpose of illustrating specific
embodiments of the present invention but should not be
construed as in any sense limiting the scope of the
invention disclosed herein. It should be understood in the
present invention that various embodiments can be made or
executed within the scope and concept disclosed
herein. All the examples were carried out or can be
carried out, unless otherwise disclosed herein specifically,
by standard techniques which are well known and
conventional to those skilled in the art.
Specific molecular biological operations,
treatment conditions, etc. in examples as described herein
below are conducted or selected according to customary
techniques disclosed in standard experimental manuals: for
DNA cloning, J. Sambrook, E. F. Fritsch & T. Maniatis,
"Molecular Cloning", 2nd ed., Cold Spring Harbor Laboratory,
Cold Spring Harbor, N. Y. (1989), and D. M. Glover et al.
ed., "DNA Cloning", 2nd ed., Vol. 1 to 4, (The Practical
Approach Series), IRL Press, Oxford University Press
(1995); when PCR techniques are applied, H. A. Erlich ed.,
PCR Technology, Stockton Press, 1989; D. M. Glover et al.
ed., "DNA Cloning", 2nd ed., Vol. 1, (The Practical
Approach Series), IRL Press, Oxford University Press (1995),
and M. A. Innis et al. ed., "PCR Protocols", Academic Press,
New York (1990) and others. When commercially available
reagents and kits are used, protocols, agents, drugs, and
the like attached thereto are employed herein.
CA 02561696 2006-09-28
- 114 -
Example 1
(A) Construction of Expression Vector for
Modified Galectin 9 Mutein
The expression vectors were constructed with the
following:
(1) cDNA, prepared from a Jurkat cell poly(A)RNA fraction ,
(2) pET-11a vector (STRATAGENE)
(3) primers for PCR:
G9NCRD1: CGTCCTCATATGGCCTTCAGCGGTTCCCAG SEQ ID NO:
10
G9NCRD6: CGACCGCATATGCTGGAAGCTGATGTAGGACAG SEQ ID NO: 11
G9CCRD5: CGTCCTCATATGACTCCCGCCATCCCACCTATG SEQ ID NO: 12
G9CCRD6: CGACCGGGATCCCTATGTCTGCACATGGGTCAG SEQ ID NO: 13
Jurkat cells (T cell-derived cell line) were
obtained from American Type Culture Collection (ATCC). The
cell line was maintained in FCS(10%)-added RPMI-1640 (Sigma,
St. Louis, USA) at 37 C under 5% CO2/air.
Total RNA extraction from Jurkat cells was conducted as
follows: Briefly, Jurkat cells were cultured in RPMI-1640
containing 10% PBS, and then collected with a centrifuge.
The resultant cells were washed twice with 10 ml of PBS.
To the washed cell pellets was added ISOGEN (Trade Name:
NIPPON GENE Co., Ltd., Japan) at 15 ml per 2 x 108 cells,
and total RNA was extracted according to the kit manual
(NIPPON GENE Co., Ltd., Japan). Poly(A)-1-RNA purification
from total RNA and cDNA synthesis were conducted as
follows: Briefly, Jurkat cell derived total RNA was
dissolved in DEPC-treated water to make the concentration 1
mg/ml. The purification of poly(A)+RNA from total RNA was
carried out with PolyATtract mRNA Isolation System (Trade
Name: Promega) according to the kit manual. The purified
poly(A)RNA was dissolved in DEPC-treated water to make the
concentration 5 pg/20 pl.
The synthesis of cDNA from poly(A)+RNA (5pg) was
CA 02561696 2006-09-28
- 115 -
per f ormed with First-Strand cDNA Synthesis Kit (Trade Name:
Amersham Biosciences) according to the kit manual, wherein
Not I-d(T)18 was used as a primer.
Next, into the NdeI-BamHI site of vector pET-11a
was inserted the N-terminal carbohydrate recognition domain
(NCRD) and C-terminal carbohydrate recognition domain
(CCRD ) of galectin 9 according to steps as shown in FIG. 1
to generate an expression vector for modified galectin 9
(G9NC(null)) wherein the linker peptide lacked. First, (1)
cDNA corresponding to the C-terminal CRD of human galectin
9 and (2) cDNA corresponding to the N-terminal CRD of human
galectin 9, respectively, were obtained from galectin 9
cDNA. Briefly, cDNA corresponding to the C-terminal CRD of
human galectin 9 (G9CCRD) was amplified from galectin 9
cDNA with PCR primers: G9CCRD5 + G9CCRD6. G9CCRD was
digested with restriction enzymes (NdeI + BamHI), and
inserted into vector pET-11a treated with the same
restriction enzymes to create pET-G9CCRD. The PCR was
performed with KOD DNA polymerase kit (TOYOBO Code No. KOD-
101). A PCR Reaction mixture (dNTP mix, 25mM MgC12, 10X
Buffer, KOD DNA polymerase (0.05u), primers and template
cDNA) was reacted under the following PCR cycle conditions:
After treatment at 94 C for 2 min, a cycle consisting of 98
C for 15 sec, then 65 C for 2 sec, and next 74 C for 30
treatments was repeated 25 times, and finally the reaction
was terminated at 4 C. The insertion of the PCR-amplified
fragment into the vector was carried out with Ligation high
kit (TOYOBO Code No.LGK-101). For reaction, the PCR-
amplified fragment was mixed with the vector at a molar
ratio of insert : vector = about 5 : 1, and then admixed
with the reagent "Ligation high" at a ratio of
reagent/total total DNA solution = 1/2 (volume/volume).
The insertion was done by 0/N reaction at 16 C for 16 hr.
Secondly, cDNA corresponding to the N-terminal
CRD of human galectin 9 (G9NCRD) was amplified from
CA 02561696 2006-09-28
- 116-
galectin 9 cDNA with PCR primers: G9NCRD1 + G9NCRD6.
G9NCRD was digested with restriction enzyme NdeI, and the
resultant fragment was inserted into a site derived from
pET-G9CCRD by digestion with the same restriction enzyme
(NdeI) followed by dephosphorylation to create pET-
G9NC(null). The PCR amplification and incorporation into
the vector were carried out in the same manner as
aforementioned. In pET-G9NC(null) is encoded a polypeptide
having a mutant amino acid sequence that differs from the
amino acid sequence of human M-type galectin 9 (hGal-9M) by
the amino acid replacement of a region ranging from Pro149
to Ser177
(29 amino acids) with the sequence: His-Met. That
is, the construct has a nucleotide sequence of SEQ ID NO: 1,
which codes for a polypeptide with the amino acid sequence
of SEQ ID NO: 2.
(B) Expression and Purification of Recombinant
Modified Galectin 9 Mutein (Recombinant Protein)
The expression plasmid vector pET-G9NC(null)
obtained in the aforementioned step (A) was introduced into
E. coli (BL21(DE3)). The introduction was done by
electroporation (or electropermeabilization). Briefly, a
mixture of competent BL21(DE3) and an aqueous plasmid
vector solution was subjected to electroporation at a
voltage of 1.8kV for transfection. The expression of
recombinant proteins were conducted as follows: E. coli was
cultured in 2XYT medium containing 2% (w/v) glucose and 100
pg/ml ampicillin, and admixed with 0.1 M isopropyl-3-D-
thiogalactopyranoside for induction of recombinant proteins
at a point where an optical density at 600nm reached 0.7
(final concentration, 0.1 mM). After cultivation at 20 C
for 18 hr, the cells were collected with a centrifuge, and
then suspended in 10 mM Tris-HC1 (pH 7.5), containing 0.5 M
NaC1, 1 mM DTT, and 1 mM PMSF. The resultant suspension
was sonicated for 10 min, then admixed with 10%(w/v) Triton
X-100 (final concentration, 1%), and stirred at 4 C for 30
CA 02561696 2006-09-28
-117-
min. The mixture was centrifuged at 15,000Xg for 30 min,
and the resulting supernatant was subjected to affinity
chromatography on lactose agarose gels to isolate purified
recombinant proteins.
As a result, recombinant protein samples with
high purity were obtained in comparatively good yields.
The resultant electrophoretic patterns of recombinant
protein products are shown in FIG. 2. SDS-PAGE conditions
were as follows: Gel, Acrylamide-BIS (12% gel), buffer for
electrophoresis, 25 mM Tris-192 mM glycine-0.1% SDS,
electrical conditions, 180V, 45 min.; staining, CBB, 60 C/30
min. Samples for electrophoresis were adsorbed on Strata
Clean'm Resin (Stratagene), treated with 1Xsample buffer
(62.5 mM Tris-HC1, Ph6.8, 2%(w/v) SDS, 5%(W/V) 2-ME,
Glycerol) to make the mixture 0.2 mg/ml, thermally treated
at 98 C/3 min, and then subjected to electrophoresis at
about 2pg (protein) per lane. The purified modified
galectin 9 mutein, G9NC(null), were stably preservable at 4
C for at least 90 days while most of wild type galectin 9
(M-type, G9(M)) was decomposed within 2 weeks under the
same storage conditions (see FIG. 3). This decomposition
is thought to be caused by an action of E. coli-derived
proteases contained in the purified galectin sample.
Example 2
The susceptibility to proteases existing in human
tissue was examined between wild type galectin 9 (S-type ,
G9(S): isoform with the shortest linker peptide) and
G9NC(null) for comparison. To the galectins dissolved in
PBS was added matrix metalloproteinase-3 (MMP-3) or
elastase at 1/100 (weight ratio), and the mixture was
incubated at 37 C. Most of G9(S) was decomposed within 1 to
2 hr in either case while G9NC(null) was not degraded at
all even after the passage of 2 hr (see FIGs. 4 and 5).
CA 02561696 2006-09-28
- 118 -
Example 3
In order to examine how incorporation of the
mutation into wild type galectin 9 affects galectin 9
bioactivity, assays were done for activity of inducing
apoptosis of MOLT-4 cells (human T cell leukemia derived
cell line) and eosinophil chemoattractant activity (ECA
activity) for peripheral blood eosinophils.
(a) Cell Culture
MOLT-4 (T cell) was obtained from American Type
Culture Collection (ATCC). The cell line was maintained in
an RPMI-1640 medium (Sigma, St. Louis, US) supplemented
with FCS in 5% CO2 at 37 C. Lactose (30 mM) was added
to the culture medium to inhibit Gal-9 activity. The same
concentration of sucrose was used as a control.
(b) Apoptosis Assay
(1) Cell cycle (apoptosis) analysis with PI (PI method)
Cells that underwent apoptosis induction were
centrifuged at 4 C for 5 min at 1,000 rpm, and the cell
pellet was resuspended in PBS (300 L), and adjusted to a
final concentration of 70% by gradually adding 100% cold
ethanol (700 L) to the suspended cells with vortexing. The
cells were fixed by incubation at 4 C for 30 min. After
addition of PBS (1 mL), the cells were centrifuged at 4 C
for 5 min at 1,000 rpm and the cell pellet was resuspended
in PBS (440 L). The cells were incubated with 2.5 mg/ml
ribonuclease A (10 L; the final concentration 50 g/mL,
Sigma, St. Louis, Missouri, US) at 37 C for 30 min, and then
with 2.5 mg/mL propidium iodide (PI, 4 L; the final
concentration, 20 g/mL; Sigma) at 4 C for 10 min in the
dark. After removal of aggregated cells through a nylon
mesh followed by increasing the cell volume with PBS,
stained cells were analyzed by flow cytometry (Sandstrom, K.
CA 02561696 2006-09-28
- H9-
et al., J Immunol Methods, 240: 55 (2000) and Zhang L. et
al., Cancer Lett, 142: 129 (1999)).
(2) TUNEL (TdT-mediated label dUTP nick end labeling)
assay
DNA fragmentation within the cell nucleus, a
distinctive feature of apoptosis, was detected by
incorporating labeled nucleotides (dUTP-biotin or FITC-dUTP,
etc.) into the ends generated by DNA fragmentation with an
enzyme that adds nucleotides at DNA ends (TdT; Terminal
deoxynucleotidyl transferase). MEBSTAIN Apoptosis Kit
Direct (MBL, Nagoya, Japan) was used in the experiment.
Experiments were carried out according to the
manufacturer's instruction as described below. Briefly,
cells that underwent apoptosis induction (approx. 2X105
cells/sample) were washed with PBS containing 0.2% FSA.
After adding 4% paraformaldehyde (in 0.1 M NaH2PO4, pH 7.4),
the cells were fixed at 4 C for 30 min, and washed with PBS
containing 0.2% FSA. After adding 70% cold ethanol to
increase the permeability, the cell pellet was incubated at
-20 C for 30 min. After washing with PBS containing 0.2%
FSA, TdT reaction mixture (TdT, FITC-dUTP and TdT buffer
mix) was added to the washed cell pellet, the mixture was
stirred, and incubated at 37 C for 1 hr. Stained cells were
washed with PBS containing 0.2% FSA, then resuspended in
PBS containing 0.2% FSA and analyzed by flow cytometry.
(c) T Cell Analysis
To prepare a well plate coated with anti-CD3 Ab,
a 24 well palate was incubated with TBS solution (pH8.0)
containing 3 g/mL anti-CD3 Ab (Immunotech, Marseille,
France) per well at 4 C overnight, and each well was washed
with PBS after removing anti-CD3 Ab solution.
Mononuclear leukocyte fractions were isolated
from heparinized blood using HISTOPAQUE (Registered
CA 02561696 2006-09-28
- 120 -
trademark, SIGMA). Next, CD4-Positive Isolation Kit (DYNAL,
Oslo, Norway) was used for isolation of CD41- T cells and
Dynabeads M-450 CD8 (Registered trademark, DYNAL, Oslo,
Norway) for isolation of CD8+ T cells, respectively,
according to the manufacturer's instructions. To activate
T cells, CD4+ or CD8+ T cells at 1X106 cells/mL in an RPMI-
1640 medium containing 10% FCS were incubated on the plate
coated with anti-CD3 Ab for 20 to 24 hr at 37 C in a 5% CO2
incubator, and then incubated with recombinant galectin 9
(wild type G9(S)) or modified galectin 9 mutein,
G9NC(null)), at 37 C in a 5% CO2 incubator. Next, apoptosis
assay was conducted as described in (b). That is, cells
were incubated with 50 g/mL PI (SIGMA) at 37 C for 10 min
in the dark. Stained cells were analyzed by flow cytometry
(Sandstrom, K. et al., J Immunol Methods, 240: 55 (2000)
and Zhang L. et al., Cancer Lett, 142: 129 (1999)).
After incubation with recombinant galectin 9
(wild type G9(S)) or modified galectin 9 mutein,
G9NC(null)), at 37 C in a 5% CO, incubator, apoptosis assay
was also conducted for non-activated (resting) T cells in
the same manner as described above.
(d) Results
As a result of examining DNA fragmentation
associated with apoptosis by agarose gel electrophoresis
and FACS, it has been revealed that the apoptosis inducing
activity retained by G9NC(null) is equivalent to or higher
than that by G9(S) even when either assay method is applied
(FIG. 6 & Table 1). As a result of assaying for ECA
activity according to the chamber technique, G9NC(null)
exhibited higher activity than G9(S) (FIG. 7).
CA 02561696 2006-09-28
- 121 -
Table 1
Apoptotic MOLT-4 Cell Rate (%)
control 0.1 tM 0.3 M 0.5 p34 1 111
G9(114) 4.2 5.5 13.8 28.9 58.8
G9(S) 4.5 8.7 23.6 44.7 64.0
G9NC (null) 5.1 11.5 33.9 57.8 72.1
Table 1 shows comparison results between wild
type galectin 9 (G9(S)) and modified galectin 9 mutein
(G9NC(null)) for their bioactivities, wherein each activity
of inducing apoptosis of MOLT-4 cells was examined (FACS
analysis).
Example 4
[1. Expression of Galectin-9 in Rheumatoid
Arthritis (RA) Synovium]
[Method)
Patient tissue materials used were synovium
tissue samples from RA patients complied with American
College of Rheumatology (ACR), classification criteria.
Immunohistological staining of patient tissue samples was
performed according to the following steps: Preparation of
section samples was done as follows:
(1) De-paraffinization : xylene 3 times (10min each),
100% alcohol-90% alcohol-75% alcohol (2 min each).
(2) Microwave (MW) treatment: 10mM citric acid buffer
(pH6.0) was prepared upon use. Each section sample was
dipped in the buffer pre-boiled by MW irradiation, and then
subjected to MW irradiation (5 min x 3 times, total 15 min
for 500 W electric microwave oven). The treated sections
CA 02561696 2006-09-28
- 122 -
were allowed to stand at room temperature for 20 min while
gradually cooling.
(3) Inactivation of endogenic peroxidase: 0.3% peroxide-
methanol was prepared upon use and the section sample was
dipped thereinto for 30 min. Washing with PBS 5 min x 3
times. An aliquot (4 drops) of 5%13SA was dropped onto the
section for blocking. Next, the section was placed in a
wet box at room temperature for 1 hr.
Onto the section sample were applied 6 drops of a
primary antibody or a control antibody with a Pasteur
pipette. The sample was allowed to stand in a wet box at 4
C overnight, and washed with PBS (5 min x 3 times) on the
next day. An aliquot (6 drops) of second antibody,
horseradish peroxidase (HRP)-labeled Ab (DACO Envision),
was applied onto the tissue sample. After placing the
tissue sample in a wet box at room temperature for 1 hr,
the tissue sample was washed with PBS (5 min x 3 times).
Visualization with a DAB (3,3'-diaminobenzidine-
tetrahydrochloride) reagent (the DAB reagent was prepared
upon use). The coloring process was carried out for 3 min
after dipping the section sample. Immediately, the
coloring reaction was stopped by washing with tap water.
Nuclear staining was performed with Mayer's hematoxylin (20
sec). Immediately, the sample was washed with running
water for 15 min. Dehydration, penetration, and sealing;
75% alcohol-90% alcohol-100% alcohol (2 min each), xylene 3
times (3 min each).
[Results]
The results are shown in FIG. 53. Galectin-9 was
observed to be expressed selectively in synovial cells and
lymph parafollicular cell groups, as well as in endothelial
cells of dendriform blood vessels inside the lymphatic
follicle. Galectin 9-positive cells were scarcely observed
in OA (osteoarthritis) (see FIG. 53). Galectin 9 is a
molecule that is inducible at high levels in synovial cells
and lymphatic cells which are essential for growth of RA
CA 02561696 2006-09-28
- 123 -
synovium, and further in new blood vessels, while galectin-
1 is detectable in synovial cells and pericytes and
galectin-3 in the whole constituent cells of RA synovium.
[2. Galectin-9 Mediated Activity of Inducing Apoptosis of
Synovial Cells]
[Method]
The efficacy of galectin 9 was tested on synovial
cells which will cause the destruction of joints. For
synovium, the synovium tissue of a rheumatoid arthritis
(RA) patient was harvested aseptically, and subjected to
separation to isolate cells which were cultured. After 1
to 2 cell culture passages, the resultant cells were used
in experiments. The tested tissue was obtained from the
right knee RA of 67-old woman. The synovial cells were
seeded, and then cultured overnight. After cell adhesion
was affirmed, rhGal-9 (each of hG9NC(null), rhGal-9S, and
rhGal-9M) was added to make the final concentration 0, 0.03,
0.1, 0.3, and 1.0pM, respectively. After cultivation for
72 hr, cells were observed with an optical microscope.
Next, the cells were collected, and assayed for apoptosis-
inducing activity with PI technique. Apoptosis-inducing
activity assay was done in the same fashion as in Example 3.
[Results]
The results from observation with an optical
microscope are shown in FIG. 54. The PI assay results for
apoptosis-inducing activity are shown in FIG. 55.
The apoptosis-inducing activity of modified
galectin-9 mutein (Gal-9(NC-Null)) was more intense than
those of native (wild type) galectin-9 (Gal-9(M), and Gal-
9(5)). It was observed that all recombinants had the
apoptosis-inducing activity in a dose-dependent manner.
Lactose (30 mM) inhibited the apoptosis-inducing actions
but sucrose (30mM) did not affect.
CA 02561696 2006-09-28
- 124 -
[3 . Comparison between Galectin-Mediated Apoptosis-
Inducing Activity in and Growth-Inhibitory Activity
against Synovial Cells]
[Method]
The actions of human galectins (Gal-1, Gal-3,
Gal-8(M), and Gal-9NC(null)) on synovial cells were
examined.
The synovium tissue of a RA patient was collected
aseptically, and subjected to separation to isolate
synovial cells which were then cultured. After 1 to 2 cell
culture passages, the synovial cells were seeded, and then
cultured overnight. After cell adhesion was affirmed, each
human galectin (each of Gal-1, Gal-3, Gal-8(M), and Gal-
9NC(null)) was added to make the final concentration 0,
0.01, 0.03, 0.1, 0.3, and 1.0pM, respectively. After
cultivation for 24 hr, cells were collected and assayed for
apoptosis-inducing activity by the PI method. For
inhibitory efficacy on synovial cells, each human galectin
was added to each well of a 96 well plate to make the final
concentration 0, 0.03, 0.1, 0.3, and 1.0pM, respectively,
followed by cultivation for 48 hr. After the cultivation,
the plate was washed with PBS, and cells emitting intense
fluorescent light (2..ex=490nm, A.em=515nm) where cell
counting kit-F (Dojindo Laboratories, Japan, cat. no. 343-
07743) was used were counted with a fluorescent plate
reader.
[Results]
Apoptosis-inducing activity assay results are
shown in FIG. 56, and results from assays for inhibitory
activity in the growth of synovial cells are shown in FIG.
57. In the drawings, hGalectin 1 is recombinant human
galectin 1; hGalectin 3, recombinant human galectin 3;
hGalectin 8(M), recombinant human galectin 8M; and
hGalectin 9, hGal-9NC null. It is very important to
inhibit the growth of synovial cells in view of rheumatoid
arthritis therapy. Modified galectin-9 mutein (hGal-9NC
CA 02561696 2006-09-28
- 125 -
null) induced apoptosis of proliferated synovial cells, and
inhibited the growth of synovial cells. Therefore,
modified galectin-9 mutein (hGal-9NC null) is useful as an
anti-rheumatoid arthritis drug. No such actions were
observed among other galectins.
The efficacy of modified galectin-9 mutein, h-
G9NC(null), was examined in a variety of inflammatory
diseases, i.e., acute/chronic allergy, immune system
disease mouse models.
From these results, it is suggested that modified
galectin 9 mutein has an inhibitory or increasing action on
a variety of inflammations and also a regulatory action in
the production of various cytokines whereby modified
galectin 9 mutein is useful in control of inflammatory
reaction. Described below are examples illustrating these
efficacious advantages.
In the following examples [Examples 5 to 12] ,
G9NC(null) [gal9NC(null), h-gal9NC(null), hG9NC(null) or h-
G9NC(null) (human null galectin-9)) is available from
Galpharma Co., Ltd., Kagawa, Japan). Dexamethasone
(dexamethasone 21-phosphate disodium salt, Sigma-Aldrich,
MO, USA) was obtained from the supplier indicated
Example 5
[Zymosan-Induced Pleurisy Model]
First, mice received a pleural injection of each
of G9NC(null) [100pg/mouse, h-gal9NC(null)] , zymosan
(100pg/mouse, Sigma-Aldrich, MO, USA), and dexamethasone
(30mg/kg/mouse, Sigma-Aldrich, MO, USA), or a mixture
thereof under anesthetization with diethyl ether (Wako Pure
Chemical Industries, Ltd., Japan). PBS was used as a
control. Four hours after injection, mice received an
intraperitoneal injection of 0.2 to 0.3 ml of a diluted
CA 02561696 2006-09-28
- 126 -
pentobarbital injection with a dilution ratio of Injectable
NEMBUTAL (Trade Name: pentobarbital, Dainippon
Pharmaceutical Co., Ltd., Japan) : PBS = 1 : 10 for
anesthetization, and blood samples were collected from
abdominal aorta after laparotomy. Thereafter, mice were
euthanized by bleeding, and pleural fluid samples were
collected by washing the pleural cavity twice with PBS
(1m1).
The blood samples were allowed to stand at
ambient temperature, then centrifuged at 5000 rpm for 10
min, supernatants were collected as serum samples, and
freeze-preserved. The pleural fluid samples were subjected
to total cell number counting with Turk's solution. After
counting, part of the samples were subjected to the
Cytospin, air-dried, stained with Diff-Quik (International
Reagents Co., Ltd., Japan) or May-Grunwald's solution (Muto
Pure Chemical Co., Ltd) and Giemsa solution (Merck Japan
Ltd.), and examined microscopically. Each number of
neutrophils, eosinophils, macrophages, lymphocytes, mast
cells and others was checked for the total cell count of
200 cells. The results are shown in FIGs. 9 and 10.
Example 6
[PMA-Induced Dermatitis Model]
Phorbol 12-myristate 13-acetate (PMA, Sigma-
Aldrich, MO, USA) was obtained from the supplier indicated.
For administration to animals, compounds were suspended in
PBS(-), which was used as the vehicle in all experiments
(this is hereinafter applied in Examples disclosed below).
Balb/c mice (7-week-old) were purchased from SLC
(Shizuoka, Japan). Animals were kept under standard
conditions in a 12 h day/night rhythm with free access to
food and water ad libitum. All animals received humane
care in accordance with international guidelines and
CA 02561696 2006-09-28
-127-
national law (this is hereinafter applied in Examples
disclosed below).
Induction of ear edema in mice was conducted as
follows: A solution of phorbol 12-myristate 13-acetate
(PMA, 15mg) dissolved in acetone (30m1) was applied to the
inner and outer surface of the right ear of each mouse
(BALB/c, 7 to 8 weeks old, SEE, SLC Inc.). Acetone was
applied to the left ear as a control.
Mice received an i.p. administration of
G9NC(null), dexamethasone, or vehicle at a dose of 0.345
ml/head 30 min prior to PMA application. After PMA
application, ear thickness was measured at 0, 3, 6, 8 and
24 hours with a calibrated thickness gauge (Mitsutoyo,
Tokyo, Japan) under anesthetization with ether. Ear edema
was expressed as (R-L)-(R0-1,0), where Ro and Lo represent
the thickness of the right and left ear, respectively, at
the beginning of the experiment (0 h), and R and L stand
for the thickness values obtained at each given time point.
Statistical analysis was conducted as follows:
Unless otherwise stated, data are expressed as mean values
SEM. Statistical differences of data sets were analyzed
using two-way ANOVA, and differences between groups were
assessed by Bonferroni post-test using commercially
available statistics software (GraphPad Software, Inc., San
Diego, USA). P values <0.05 were considered statistically
significant. Details are given in each drawing (this is
hereinafter applied in Examples disclosed below). The
results are shown in FIG. 11.
CA 02561696 2006-09-28
- 128 -
Example 7
[AA-Induced Dermatitis Model]
Arachidonic acid (AA, Sigma-Aldrich, MO, USA) was
obtained from the supplier indicated. The rest was the
same as in Example 6.
Induction of ear edema in mice was conducted as
follows: A solution of arachidonic acid (AA, 750mg)
dissolved in acetone (30 ml) was applied to the inner and
outer surface of the right ear of each mouse (BALB/c, 7
to 8 weeks old, SPF, SLC Inc.). Acetone was applied to the
left ear as a control.
Animals received an i.p. administration of
G9NC(null), dexamethasone, or vehicle at a dose of 0.345
ml/head 30 min prior to AA application. After AA
application, ear thickness was measured at 0, 1, 3 and 6
hours with a calibrated thickness gauge (Mitsutoyo, Tokyo,
Japan) under anesthetization with ether. Ear edema was
expressed as (R-L)-(R0-L0), where Ro and Lo represent the
thickness of the right and left ear, respectively, at the
beginning of the experiment (0 h), and R and L stand for
the thickness values obtained at each given time point.
Statistical analysis was conducted in the same manner as in
Example 6. The results are shown in FIG. 12.
Example 8
[Capsaicin-Induced Dermatitis Model]
Cyproheptadine (Sigma-Aldrich, MO, USA) and
capsaicin (Nakarai, Tokyo, Japan) were obtained from each
supplier indicated. The rest was the same as in Example 6.
Induction of ear edema in mice was conducted as
follows: A solution of capsaicin (500mg) dissolved in 30m1
of acetone/olive oil (volume/volume=4/1) was applied to the
inner and outer surface of the right ear of each mouse
CA 02561696 2006-09-28
- 129 -
(BALB/c, 7 to 8 weeks old, SPF, SLC Inc.). The vehicle,
acetone/olive oil, was applied to the left ear as a control.
Animals received an i.p. administration of
G9NC(null), dexamethasone, cyproheptadine, or vehicle at a
dose of 0.345 ml/head 30 min prior to capsaicin application.
After capsaicin application, ear thickness was measured at
0, 0.5, 1 and 2 hours with a calibrated thickness gauge
(Mitsutoyo, Tokyo, Japan) under anesthetization with ether.
Ear edema was expressed as (R-L)-(R0-L0), where Ro and Lo
represent the thickness of the right and left ear,
respectively, at the beginning of the experiment (0 h), and
R and L stand for the thickness values obtained at each
given time point. Statistical analysis was conducted in
the same manner as in Example 6. The results are shown in
FIG. 13.
Example 9
[DNFB-Induced Contact Dermatitis Model]
Dinitro-fluoro-benzene (DNFB, Sigma-Aldrich, MO,
USA) was obtained from the supplier indicated. The rest
was the same as in Example 6.
Induction of ear edema in mice was conducted as
follows: In the model of delayed-type hypersensitivity
(DTH)-induced edema, mice were sensitized on days -7 and -6
by applying a solution (30m1) of 0.5% dinitro-fluorobenzene
(DNFB) in acetone/olive oil (volume/volume=4/1) to their
shaved abdomen. On day 0, challenge reactions were
elicited with 30m1 of 0.3% DNFB in acetone/olive oil
(volume/volume=4/1) applied topically to the inner and
outer surface of the right ear of each mouse. The vehicle,
acetone/olive oil, was applied to the left ear as a control.
Mice received i.p. administrations of G9NC(null),
dexamethasone, or vehicle at a dose of 0.345 ml/head on
days -7 to 0 prior to DNFB challenge, 24 and 48 hours after
CA 02561696 2006-09-28
- 130 -
DNFB challenge. After DNFB challenge, ear thickness was
measured at 0, 24, 48 and 72 hours with a calibrated
thickness gauge (Mitsutoyo, Tokyo, Japan) under
anesthetization with ether. Ear edema was expressed as
(R-L)-(R0-L0), where Ro and Lo represent the thickness of
the right and left ear, respectively, at the beginning of
the experiment (0 h), and R and L stand for the thickness
values obtained at each given time point. Statistical
analysis was conducted in the same manner as in Example 6.
The results are shown in FIGs. 14 and 15.
Example 10
[FITC-Induced Atopic Dermatitis Model]
Fluorescein isothiocyanate (FITC, Sigma-Aldrich,
MO, USA) was obtained from the supplier indicated. The
rest was the same as in Example 6.
Induction of ear edema in mice was conducted as
follows: In the model of FITC-induced edema, mice were
sensitized on days -7 and -6 by applying a solution (400m1)
of 0.5% fluorescein isothiocyanate (FITC) in
acetone/dibutyl phthalate (volume/volume=1/1) to their
shaved abdomen. On day 0, challenge reactions were
elicited with 30 ml of 0.5% FITC in acetone/dibutyl
phthalate (volume/volume=1/1) applied topically to the
inner and outer surface of the right ear of each mouse.
The vehicle, acetone/dibutyl phthalate, was applied to the
left ear as a control.
Mice received i.p. administrations of G9NC(null),
dexamethasone, or vehicle at a dose of 0.41 ml/head 30
minutes prior to FITC challenge, 24 and 48 hours after FITC
challenge. After FITC challenge, ear thickness was
measured at 0, 24, 48 and 72 hours with a calibrated
thickness gauge (Mitsutoyo, Tokyo, Japan) under
anesthetization with ether. Ear edema was expressed as
CA 02561696 2006-09-28
- 131 -
(R-L)-(R0-1,0), where Ro and Lo represent the thickness of
the right and left ear, respectively, at the beginning of
the experiment (0 h), and R and L stand for the thickness
values obtained at each given time point. Statistical
analysis was conducted in the same manner as in Example 6.
The results are shown in FIGs. 16.
Example 11
(Urticaria Model]
Anti-DNP IgE (SPE7, Sigma-Aldrich, MO, USA) and
dinitro-fluorobenzene (DNFB, Sigma-Aldrich, MO, USA) were
obtained from the supplier indicated. The rest was the
same as in Example 6.
Induction of ear edema in mice was conducted as
follows: In the model of biphasic cutaneous reaction model,
mice were sensitized on day -1 by i.v. injection of anti-
DNP IgE (5 mg/mouse) in PBS(-). On day 0, challenge
reactions were elicited with 30 ml of 0.15% DNFB in
acetone/olive oil (volume/volume-4/1) applied topically to
the inner and outer surface of the right ear of each mouse.
The vehicle, acetone/olive oil, was applied to the left ear
as a control.
Mice received an i.p. administration of
G9NC(null), dexamethasone, or vehicle at a dose of 0.345
ml/head 30 minutes prior to DNFB challenge. After DNFB
challenge, ear thickness was measured at 0, 1, 2, 4, 8 and
24 hours with a calibrated thickness gauge (Mitsutoyo,
Tokyo, Japan) under anesthetization with ether. Ear edema
was expressed as (R-L)-(R0-L0), where Ro and Lo represent
the thickness of the right and left ear, respectively, at
the beginning of the experiment (0 h), and R and L stand
for the thickness values obtained at each given time point.
Statistical analysis was conducted in the same manner as in
Example 6. The results are shown in FIGs. 17.
CA 02561696 2006-09-28
- 132 -
Example 12
[Arthritis Model]
DBA/1J female mice (7-week-old) were used. An
arthritis-inducing monoclonal antibody cocktail (Chondrex,
WA, USA; No.62100) was intravenously administered to the
tail of each animal at 2 mg/0.5 ml/body. Three days later,
the animals received an i.p. application of a sample mix
(100pL) wherein 5pg of LPS (SIGMA, L6511) was premixed with
h-Ga19NC(null) at each given dose. After sample
administration, the swelling degree of each limb joint (of
right and left, fore and hind limbs) was measured once a
day and severity of arthritis was scored. The results are
shown in FIG. 19.
The efficacy of h-G9NC(null) was examined in
acute inflammation models, represented by zymosan-induced
pleurisy models (Example 5) and LPS-induced peritonitis
models. As a result, it was observed that the i.p.
administration of h-G9NC(null) at a dose of 100pg led to
inhibition of pleurisy in the zymosan-induced pleurisy
model. It was noted that h-G9NC(null) alone had almost no
influence on the mice. In addition, h-G9NC(null) affected
conditions in carrageenan- and fMLP-induced pleurisy models.
Also, in the model of LPS-induced peritonitis, it
was observed that h-G9NC(null) induced changes in
production of serum cytokines (IFN-y, IL-4, IL-12, IL-10,
etc.) induced upon inflammation. For instance, when blood
was collected from the orbit of a mouse 6, 12, and 24 hours
after contemporaneous i.p. administration of LPS and h-G9NC,
and the level of serum IFN-y was assayed, the level of IFN-
y induced upon inflammation was observed to be elevated
transiently in the group receiving the administration of
LPS alone while the elevation (induction) of IFN-y was
inhibited in the group receiving the contemporaneous
administration of LPS and h-G9NC(null) in an h-G9NC(null)-
dose dependent fashion. In view of these, it has been
CA 02561696 2006-09-28
- 133 -
suggested that h-G9NC(null) can regulate the production of
cytokines whereby inflammation can be controlled.
Further, it has been observed that h-G9NC(null)
has inhibitory actions in models of inflammation,
susceptible to steroid (PMA-induced) and non-susceptible to
steroid (arachidonic acid-induced) (Examples 6 & 7), as
well as in the model of capsaicin-induced inflammation
(Example 8).
The efficacy of h-G9NC(null) on allergic
inflammation was examined wherein said allergic
inflammation included the models of DNFB-induced contact
dermatitis, FITC-induced atopic dermatitis, anti-DNP
monoclonal IgE Ab-sensitized urticaria. For example, in
the model of DNFB-induced contact dermatitis (Example 9),
h-G9NC(null) was i.p. administered and its efficacy was
evaluated by using ear edema as an index to skin response.
As a result, the medications with h-G9NC(null) at 1, 10,
and 100pg, respectively, were observed to exert inhibitory
actions while h-G9NC(null) was not observed to lead to
significant body weight reduction, induced by the
administration of dexamethasone. In the model of FITC-
induced atopic dermatitis (Example 10), the efficacy of h-
G9NC(null) in the elicited phase was found when h-
G9NC(null) was i.p. administered. In addition, when h-
G9NC(null) was administered i.p. to the model mice of anti-
DNP monoclonal IgE Ab-sensitized urticaria (Example 11) at
1, 10, and 100pg, respectively, biphasic cutaneous reaction
due to antigen (DNFB) painting was inhibited.
Embodiments disclosed herein demonstrate the
efficacy of h-G9NC(null) on antibody cocktail-induced
arthritis, one of autoimmune disease models. H-G9NC(null)
affects conditions in models of adjuvant arthritis,
collagen arthritis and others. For instance, even lpg of
h-G9NC(null) has been observed to have an inhibitory action
in Example 12.
7 CA 02561696 2006-09-28
- 134 -
Example 13
[Modified Galectin 9 Mutein-Mediated Induction
of Apoptosis (Cytotoxicity) in Tumor Cells]
(Protocol]
Each cell was suspended in RPMI (SIGMA)
containing 10 % PBS (JRH), placed into a 96 well plate
(FALCON) at 3X103 cells/90pL, and cultured for 24 hr (37 C,
5% CO2). After the cultivation, modified galectin 9 mutein,
h-G9NC(null), was added to make the final concentration
0.03 to 1pM (10p1), followed by incubation for 24 hr.
After the incubation, 10pL of reagent WST-1 (Roche, 1 644
807) was added to each well, and incubated at 37 C in a 5%
CO2 incubator for 2 to 4 hr. Thereafter, the absorbance
(0.D.) at 450nm was measured with a plate reader. The
efficacy of inducing apoptosis (cytotoxicity) in each tumor
cell was evaluated as follows:
Viability(%)=
[(Sample 0.D.-Blank)]/(Negative Control 0.D.-Blank)1x100
Tumor cells used are shown in Table 2.
CA 02561696 2006-09-28
- 135 -
Table 2 Modified Galectin 9 Mutein's Efficacy of
Inducing Apoptosis (Cytotoxicity) in Tumor Cells : Data
1
Cell name Animal 1050 (g NO Tissue
killing
L1210 Mouse (BDF1) 99 0.026 Spleen Lymph node, leukemia
EL-4 Mouse (C57BL/6 50 1.038 Spleen
P388 D1 Mouse (DBA/2) 78 0.626 Lymphoma, macrophage,
monocyte
NS-1 Mouse (BALB/c) 92 0.062 Bcell (myeloma),derived from
MOPC-21
Meth A Mouse (BALB/c) 92 0.198 Fibrosarcoma,subcutaneous
1111134 Mouse (C3H/He) 91 0.262 Liver, ascites hepatoma
B16/BL6 Mouse (C57BL/6 0 Melanoma
B16/F10 Mouse (C57131,76 0 Melanoma
B16/F1 Mouse (C57B1./6 45 1.286 Melanoma
MM-RU Human 58 0.899 Melanoma
MM-BP Human 53 0.937 Melanoma
PK-1 Human 66 0.184 Pancreas
PK-9 Human 59 0.624 Pancreas
Pancreatic carcinoma of ductal
PANC-1 Human 58 0.866 origin
KLM-1 Human 55 0.883 Pancreas
Wi-Dr-Tc Human 32 Colon adenocarcinoma
COLD205 Human 0 Colon adenocarcinoma
Colon26 Mouse (BALB/c) 30 Rectum carcinoma
HuO9N2 Human 26 Bone
HMC-1 Human 19 Human mast cell
MCF-7 K10 Human 17 Breast adenocarcinoma
SK-Br-3 Human 0 Breast
11117 Human 70 0.214 Liver, low differentiated
HuH-7 Human 0 Liver, high differentiated
KAT0111 Human 89 0.210 Stomach
In Table 2, "Cell name" indicates each cell name;
"Animal", each animal origin from which the indicated tumor
cell is derived; "lpM killing", killing (%) when 1pM of
modified galectin 9 mutein is added; and "Tissue", each
tissue/organ site from which the indicated tumor cell is
derived.
[Results]
Table 2 shows results from modified galectin 9
mutein h-G9NC(null) mediated apoptosis (cytotoxicity)-
CA 02561696 2006-09-28
- 136 -
inducing assays in cultured cells. As a result, it has
been determined that modified galectin 9 muteins are:
1) effective in blood cell tumors
2) also effective in non-epithelial neoplasms such as
malignant melanoma and fibrosarcoma
3) effective in epithelial neoplasms such as stomach
cancers, pancreas cancers, and lung cancers, too.
Example 14
[Anti-tumor (Antineoplastic) Efficacy of Modified Galectin
9 Mutein in Model of Subcutaneously Transplanted Tumor]
[Protocol]
The target tumor cells used were LLC cells. The
cultured cells (1x106 cells/100pL) were incubated with
modified galectin 9 mutein, h-G9NC(null), at 100pg/100pL,
or physiological saline at 100pL at 37 C for 1 hr, and then
injected subcutaneously into the back of each C57BL6 mouse.
Tumor size (longitude, latitude) was measured.
Five weeks after transplantation, the
administered skin portion (tumor) was cut out to give
histopathological test samples which were fixed with a 10%
neutral buffered formaldehyde solution. The paraffin-
embedded tissue was sliced to give sections which were
stained with HE (hematoxylin-eosin) reagent.
[Results]
In the model of subcutaneously transplanted tumor,
modified galectin 9 mutein's efficacy of inhibiting the
growth of tumor cells, i.e., anti-tumor activity (anti-
neoplastic) is shown in FIG. 20. The results from
histopathological examinations for anti-tumor activity
(anti-neoplastic) are also shown in FIG. 21. In the
drawings, Ga19(n) and Ga19 indicate modified galectin 9
mutein, h-G9NC(null), and 5W does 5 weeks.
CA 02561696 2006-09-28
=
- 137 -
Where LLC was cultured in the presence of
modified galectin 9 mutein, h-G9NC(null), the apparent
transformation of cancer cells was observed in a phase-
contrast microscope. At this stage, modified galectin 9
mutein reduced dose-dependently the number of viable LLC
cells (MTT assay), and induced the loss of ability to
synthesize DNA (3H-thymidine intake property) and an
increase in released LDH levels in culture supernatants.
These anti-tumor effects mediated by modified galectin 9
mutein were also observed for human lung cancer cell lines
H226 (squamous cell carcinoma), A549 (adenocarcinoma), and
H69 (small cell carcinoma). However, the level of
expressed Annexin V in LLC significantly increased in the
presence of modified galectin 9 mutein.
In contrast, when LLC was inoculated
subcutaneously into isogenic C57BL6 mice in the coexistence
of modified galectin 9 mutein, tumors were not successfully
engrafted, clear differences from the control group were
observed 5 weeks after the inoculation. The survival
proportion of mice was significantly improved in the
presence of modified galectin 9 mutein. It has been
revealed that modified galectin 9 mutein induces apoptosin
in cancer cells and exerts anti-tumor actions.
In experimental models of human small cell lung
carcinoma cell line H69 cells injected intravenously into
nude mice, which mimic multiple organ micrometastases of
human lung cancers, it was observed that metastasis-
inhibitory efficacy was attained with the i.p. application
of modified galectin 9 mutein.
= CA 02561696 2006-09-28
- 138 -
Example 15
[Modified Galectin 9 Mutein-Mediated Induction of
Apoptosis (Cytotoxicity) in Cultured Tumor Cells]
[Protocol]
(1) Apoptosis of Meth A Cell
A suspension of Meth A in RPMI (SIGMA) containing
10% PBS (JRH) was placed into a 96-well plate (FALCON) at 4
X104 cells/90p1, contemporaneously followed by addition of
modified galectin 9 mutein, h-G9NC(null), at a dose of 1 to
30pg/m1 (10p1). The cells were then incubated for 24 hr
(37 C, 5% CM. Twenty four hours later, the cells were
washed once with 200p1 of PBS(-), suspended in Annexin v
Binding Buffer (BD PharMingen), admixed with Annexin V-PE
(BD PharMingen) and 7-amino-actinomycin D, incubated at
room temperature for 15 min in the dark, and then subjected
to analysis with FACS calibur (Becton, Dickinson).
(2) Apoptosis of B16/F10 Cell
A suspension of B16/F10 in RPMI (SIGMA)
containing 10% PBS (JRH) was placed into a 96-well plate
(FALCON) at 4X104 cells/90p1, and then incubated for 24 hr
(37 C, 5% CO2). Thereafter, modified galectin 9 mutein, h-
G9NC(null), was added to make the final concentration 1 to
30pg/ml, and the cells were incubated for 24 hr. After the
incubation for 24 hr, the cells were washed once with
200p1 of PBS (-), treated with 0.05 % Trypsin EDTA (GIBCO),
then washed once with a culture medium, followed by washing
with PBS(-). Thereafter, the cells were suspended in
Annexin V Binding Buffer (BD PharMingen), admixed with
Annexin V-PE (BD PharMingen) and 7-amino-actinomycin,
incubated at room temperature for 15 min in the dark, and
then subjected to analysis with FACS calibur (Becton,
Dickinson).
[Results]
The results are shown in FIGs. 22 and 23. FIG.
CA 02561696 2006-09-28
- 139 -
22 shows analysis results for modified galectin 9 mutein
(h-G9NC(null))-mediated induction of apoptosis in Meth A
cells. FIG. 23 shows analysis results for modified
galectin 9 mutein (h-G9NC(null))-mediated induction of
apoptosis in B16/F10 cells.
Example 16
(Anti-tumor (Antineoplastic) Efficacy of Modified Galectin
9 Mutein in Model of Cancerous Peritonitis)
(Protocol)
(1) Meth A Cell: A cell suspension (5X105 cells/100pL) of
Meth A cells in PBS(-) was inoculated into BALB/c mice (SLC,
6-week-old female, n=3) intraperitoneally (i.p.).
Modified galectin 9 mutein (h-G9NC(null),
100pg/300pL) was administered i.p. every day through Day 18
after cell inoculation. Animals were divided into four
groups (n=10), depending on initiation time of
administration, i.e., 1) immediately, 2) on Day 3, 3) on
Day 7, and 4) on Day 10 after Meth A cell inoculation, and
survival proportions compared.
(2) B16/F10 Cell: Cells (5X105 cells/100pL) were
inoculated i.p. into C57/BL6 mice (SLC, 6-week-old female).
Immediately after inoculation, each concentration of
modified galectin 9 mutein (h-G9Nc(null); 10, 30, and
100pg/300pL) was administered i.p. every day for 14 days.
Survival rates were compared. On Day 14 after inoculation,
organs were examined.
(Results)
The results are shown in FIGs. 24 to 27 and 48.
FIG. 24 shows survival curves indicating that modified
galectin 9 mutein has antitumor activity against the model
of cancerous peritonitis, induced by Meth A cells. FIG.
CA 02561696 2006-09-28
- 140 -
25: photos showing each state of mice, modified galectin 9
mutein (Ga19) non-administered group (upper) and Gal9
administered group (lower). FIG. 26 shows survival curves
indicating that modified galectin 9 mutein has antitumor
activity against the model of cancerous peritonitis,
induced by B16/F10 cells. FIG. 27: photos showing each
internal organ tissue state of model mice with cancerous
peritonitis, induced by B16/F10 cells as compared between
modified galectin 9 mutein (Gal-9)-administered and non-
administered groups. FIG. 48 is a graph for survival
curves when mice inoculated i.p. with LLC cells (1X106
cells) received modified galectin 9 mutein (h-G9NC(null),
100pg/mouse), or vehicle, i.p. every day (administered
every day from Day 0, each group consisting of 7 mice). In
the mouse model of cancerous peritonitis (Meth A, B16/F10
cell, LLC cell), the efficacy of keeping animals alive is
found when G9NC(null) is administered i.p. (administered
contemporaneously with and after cancer cell inoculation).
Meth A and LLC cells are cells wherein apoptosis can be
induced by modified galectin 9 mutein. However, apoptosis
in B16/F10 cells is non-inducible with modified galectin 9
mutein. For B16/F10 cells, it is clarified that modified
galectin 9 mutein inhibits the binding of cancer cells with
extracellular matrices in a dose-dependent fashion.
Further, in the model of cancerous peritonitis, induced by
B16/F10 cells, the number of peritoneal fluid NK and NKT
cells was increased in G9NC(null)-administered groups as
compared to control groups. Although B16/F10 melanoma
cells are resistant to stabilized galectin 9-mediated
apoptosis, survival proportion relief and inhibition of
melanoma cell adhesion on the abdominal wall can be
observed. It has been suggested that the modified galectin
9 mutein-mediated anti-tumor efficacy in the model of
cancerous peritonitis may be associated with inhibition of
tumor cell adhesion on an extracellular matrix, i.e., the
efficacy of inhibiting inflammatory cell infiltration, and
immune-cells including NK, NKT cells, and others.
= CA 02561696 2006-09-28
- 141 -
Example 17
[Infiltrated Intra-Abdominal B16/F10 Cell Analysis]
[Protocol]
A suspension (5X105 cells/200p1) of B16/F10 cells
in PBS(-) was inoculated into the abdominal cavity of each
C57/BL6 mouse (SCL), together with an i.p. contemporaneous
administration of modified galectin 9 mutein (h-G9NC(null))
at a dose of 30pg/300p1. Twenty four hours later,
peritoneal cells were collected, and suspended in PBS(-).
The cell suspension was incubated with purified anti-mouse
CD16/CD32 (2.4G2; BD PharMingen) at 4 C for 5 min, and then
with an antibody selected from PE anti-mouse CD122 (TM-3-1;
BD PharMingen), FITC anti-mouse TCR p-chain (H57-597; BD
PharMingen), PE anti-mouse CD11b (M1/70; BD PharMingen),
APC-labeled anti-mouse CD11c (HL3; BD PharMingen), APC
anti-mouse CD8a (BD PharMingen), FITC anti-mouse CD4 (BD
PharMingen), at 4 C for 30 min, and analyzed with an SACS
calibur (Becton, Dickinson).
[Results]
The results are shown in FIG. 28. As compared to
PBS-administered groups, immune-related cells such as
NK/NKT cells are recognized to be mobilized into an
abdominal lavage fluid among modified galectin 9 mutein-
administered groups (30pg).
Example 18
[Modified Galectin 9 Mutein Mediated Activity
of Inhibiting B16/F10 Cell Adhesion]
[Protocol]
To a 96 well plate (CHEMICON) coated with
collagen type I, IV, laminin, fibronectin, and vitronectin,
respectively, was dispensed modified galectin 9 mutein, h-
CA 02561696 2006-09-28
- 142 -
G9NC ( null ) , at 10p1 to make the final concentration 1 to
30pg/ml. On the plate was seeded a cell suspension of
B16/F10 cells in RPMI (SIGMA) containing 0.02 % BSA (Wako)
at 4X104 cells/well (90p1), and incubated for 1 hr (37 C,
5% CO2). One hour later, a supernatant was removed. Then,
each well was washed with 200p1 of PBS(-) twice, admixed
with 90p1 of RPMI containing 0.02% BSA and 10p1 of WST-1
(Roche), and incubated for 2 to 3 hr. Lastly, each
absorbance (OD) at 450 to 600 was measured with a plate
reader. Adherence (%) is calculated:
Adherence (%) =
[(Test Sample OD-Blank/(Negative Control OD-Blank)) X100
(Results]
The results are shown in FIG. 29. The binding of
B16/F10 cells with each extracellular matrix (collagen type
I, collagen type IV, laminin, fibronectin, and vitronectin)
was inhibited by modified galectin 9 mutein (in the drawing,
written as Gal-9). The inhibitory action was observed to
be modified galectin 9 mutein dose-dependent.
Next, modified galectin 9 mutein's bioactivity on
inflammation was examined. The inflammation used herein in
order to examine modified galectin 9 mutein's bioactivity
includes bronchial asthma, classified into an inflammatory
disease form of I type; autoimmune hemolytic anemia,
classified into an inflammatory disease form of II type;
Arthus reaction (angiitis), classified into an inflammatory
disease form of III type.
= = CA 02561696 2006-09-28
- 143 -
Example 19
[Allergen (Der f)-Induced AHR Model]
[Protocol]
Dexamethasone (dexamethasone 21-phosphate
disodium salt, Sigma, MO, USA), methacholine (MCh, Sigma,
MO, USA) and Allergenic Extract mixed Insects MITE (D.
Farinae; Der f)) were obtained from each supplier indicated.
For administration to animals, compounds were suspended in
PBS(-), which was used as the vehicle in all experiments.
Balb/c mice (7-week-old) were purchased from SLC
(Shizuoka, Japan). Animals were kept under standard
conditions in a 12 h day/night rhythm with free access to
food and water ad libitum. All animals received humane
care in accordance with international guidelines and
national law.
Induction of asthmatic hypersensitive response
(AHR) in mice was conducted as follows: In order to induce
airway hypersensitivity to methacholine and eosinophil
infiltration into murine airway tissue, male mice were
sensitized and later challenged with the above-described
mite antigen (Der f) as the allergen. Mice were immunized
by intranasal (i.n.) administrations of 0.05 ml of Der f
(0.5 mg/ml) on days 0, 7 and 20, and then challenged with
1% aerosolized Der f for 30 min using a nebulizer. The
control group received i.n. administrations of normal PBS
(0.05 ml) on days 0, 7 and 20, and then challenged with PBS
for 30 min using a nebulizer.
To study the effect of modified galectin 9 mutein,
h-G9NC(null), and dexamethasone, mice received i.p.
injections of modified galectin 9 mutein, h-G9NC(null) (100
pg/410 pl (in PBS)/body), or dexamethasone (3 mg/200 pl (in
PBS)/kg(body weight)) before and after Der f challenge.
Bronchoalveolar lavage (BAL) fluid samples were
collected from each animal. The total pulmonary airflow in
unrestrained conscious mice was estimated with an
unrestrained whole body plethysmograph (PULMOS-I; M.I.P.S,
CA 02561696 2006-09-28
- 144 -
Osaka , Japan). Pressure differences between a chamber
containing the mice and a reference chamber were used to
extrapolate minute volume, tidal volume, breathing
frequency, and specific airway resistance (sRAW). Specific
airway resistance is a dimensionless parameter that is a
function of total pulmonary airflow in mice during the
respiratory cycle. Mice were challenged with aerosolized
PBS (for the baseline measurement) or MCh (6 to 25 mg/ml)
for 2 min. Readings were taken and averaged for 100 times
of breaths after each nebulization. Suspension cells were
stained with Turk's solution, and counted with a
hemocytometer to determine each cell number (cells/ml).
Next, cytospin preparations were made to determine cell
differentials with Giemsa-May-GrUnwald solution via
identification of morphological characterization. On each
slide, 200 to 500 leukocytes were counted.
[Results]
The results are shown in FIGs. 30, 31 and 32. In
the drawings, each value represents the mean S.E. of 7
animals. Statistical differences were analyzed using one-
way ANOVA, and differences between groups were assessed
using Dunnett's Multiple Comparison Test (*p<0.05, **p<0.01,
001). From FIG. 30, it is revealed that the
administration of h-G9NC(null) [Gal-9] leads to relief for
enhanced airway hyperresponsiveness. From FIG. 31, it is
apparent that eosinophil infiltration in BALF is inhibited
when h-G9NC(null) [Gal-9] is administered. From FIG. 32,
it is clear that h-G9NC(null) [Gal-9] administration
inhibits the infiltration of inflammatory cells into
surroundings of bronchial tubes. Thus, it is suggested
that galectin 9 inhibits infiltration of inflammatory cells
into airways whereby airway hypersensitivity will be
ameliorated.
CA 02561696 2006-09-28
- 145 -
Example 20
[OVA-Induced AHR Model)]
[Protocol]
The animals used were mice and guinea pigs.
Ovalbumin (OVA, Sigma, MO, USA), metopyrone (Sigma, MO,
USA), and mepyramine (Sigma, MO, USA) were obtained from
the supplier indicated. The rest of compounds was obtained
in the same manner as in Example 19. For administration to
animals, compounds were suspended in PBS(-), which was used
as the vehicle in all experiments. Balb/c mice (7-week-
old) were purchased from SLC (Shizuoka, Japan), and guinea
pigs (5-week-old) from Kudou Co. Ltd (Kumamoto, Japan).
Animals were kept in the same manner as in Example 19.
Induction of AHR in mice was conducted as follows:
In order to induce airway hypersensitivity to
methacholine and eosinophil infiltration into murine airway
tissue, male mice were sensitized and later challenged with
the above-described OVA as the allergen. Mice were
immunized by i.p. administrations of 0.2 ml of aluminum
potassium sulfate-complexed OVA (0.5 mg/ml) on days 0 and
14. On days 14, 18 and 22, mice were anesthetized with 0.2
to 0.3 ml of pentobarbital dilution (5.0 mg/ml) in normal
saline. All the OVA-sensitized groups received i.n. 0.05
ml of 2.0 mg/ml OVA in normal saline on days 14, 18 and 22.
The control group of animals received i.p. normal PBS in
admixture with aluminum potassium sulfate on days 0 and 14,
and next i.n. 0.05 ml of normal PBS on days 14, 18 and 22.
To study the effect of modified galectin 9 mutein,
h-G9NC(null), and dexamethasone, mice received i.p.
injections of modified galectin 9 mutein, h-G9NC(null) (100
pg/410 pl (in PBS)/body), or dexamethasone (3 mg/200 pl (in
PBS)/kg(body weight)), on days 0, 7, 14, 15, 16, 17, 18, 19,
20, 21, and 22 before and after OVA challenge.
BAL fluid samples were collected from each animal.
The total pulmonary airflow in unrestrained conscious mice
was estimated with a whole body barometric plethysmograph
CA 02561696 2006-09-28
- 146 -
( Bux co Electronics, Inc., Sharon, CT). The apparatus yields
a measure of changes in respiratory pattern known as
enhanced Pause (Penh), which correlates with and can be
used to monitor airway resistance. Mice were challenged
with aerosolized PBS (for the baseline measurement) or MCh
(3 to 50 mg/ml) for 2 min. Readings were taken and
averaged for 100 times of breaths after each nebulization
of MCh. Suspension cells were stained with Turk's solution,
and counted with a hemocytometer to determine each cell
number (cells/ml). Next, cytospin preparations were made
to determine cell differentials with Giemsa-May-GrOnwald
solution via identification of morphological
characterization. On each slide, 200 to 500 leukocytes
were counted.
Induction of AHR in guinea pigs was conducted as
follows:
In order to induce immediate asthmatic response
(IAR) and late asthmatic response (LAR) to antigen and
eosinophil infiltration into airway tissue, male guinea
pigs were sensitized and later challenged with the above-
described OVA as the allergen. Guinea pigs were sensitized
for 10 min with an aerosol of 1% OVA in saline using an
Omron NE-U17 nebulizer (Tateishi Electric Co., Tokyo,
Japan) on days 0 to 7. Thirty minutes prior to the
sensitization and the challenge, mepyramine (10 mg/kg) was
administered to all animals in order to avoid the
anaphylaxis shock.
To study the effect of modified galectin 9 mutein,
h-G9NC(null), guinea pigs received an i.p. injection of
modified galectin 9 mutein, h-G9NC(null), at 1 pg/4 ml (in
PBS)/body before and after OVA challenge.
BAL fluid samples were collected from each animal.
On day 3 after the primary sensitization, the animals were
placed in a whole-body plethysmograph chamber equipped with
a mouth-nose mask isolated from a body chamber (PULMOS-I;
M.I.P.S, Osaka, Japan). Specific airways conductance
(SGaw) was measured according to Agrawal's methods. The
= CA 02561696 2006-09-28
- 147 -
relationship between airflow and box volume change, which
is calculated from change of box pressure, can be
determined as slope in an x-y plot of box volume change and
airflow. The average of slopes in five respiratory cycles
was used for the calculation of SGaw. Guinea pigs received
an i.p. injection of 10 mg/kg metopyrone before OVA
challenge, and were challenged for 5 min with an aerosol of
2% OVA in saline at a flow rate of 3 1/min using an Omron
NE-U17 nebulizer (Tateishi Electric Co., Tokyo, Japan).
Then, changes in SGaw were monitored 1 min prior to and 2,
4, 5, 6, 7, 8 and 23 hours after the antigen challenge.
Readings were taken and averaged for 100 times of breaths
after each point. Each SGaw value was compared with that
obtained before the immunochallenge, which was defined as
percent change in SGaw. Suspension cells were stained with
Turk's solution, and counted with a hemocytometer to
determine each cell number (cells/ml). Next, cytospin
preparations were made to determine cell differentials with
Giemsa-May-GrUnwald solution via identification of
morphological characterization. On each slide, 500
leukocytes were counted.
[Results]
The results for mice are shown in FIGs. 33 and 34.
The results for mice are shown in FIGs. 35 and 36. In the
drawings, each value represents the mean S.E. of 7 animals
(FIG. 33), 5 to 7 animals (FIG. 34), and 7 or 8 animals
(FIGs. 35 and 36), respectively. Statistical differences
were analyzed using one-way ANOVA, and differences between
groups were assessed using Dunnett's Multiple Comparison
Test (*p<0.05, **p<0.01, ***p<0.001) .
FIG. 33 indicates that modified galectin 9 mutein,
h-G9NC(null), relieves airway hypersensitivity. FIG. 34
indicates that modified galectin 9 mutein, h-G9NC(null),
inhibits eosinophil infiltration in BALE.
FIG. 35 shows the efficacy of modified galectin 9
mutein, h-G9NC(null) on TAR/LAR. As a result, among the
CA 02561696 2006-09-28
-148-
modified galectin 9 mutein-administered groups, a
significant difference is recognized in both IAR and LAR,
as compared to the control groups, that is, the inhibitory
efficacy is perceivable.
FIG. 36 shows the efficacy of modified galectin 9
mutein, h-G9NC(null), on infiltration of inflammatory cells
into airways. As a result, among the modified galectin 9
mutein groups, a significant difference in total cell
numbers and eosinophils is found, as compared to the
control groups. A tendency to inhibit the infiltration of
other cells is also found.
It is suggested that it will be potential to
inhibit antigen-induced immediate and late asthmatic
responses and infiltration of cells into airways among
actively sensitized guinea pigs when modified galectin 9
mutein is administered i.p. at a dose of 1 mg/body prior to
antigen sensitization and challenge.
Example 21
[Autoimmune Hemolytic Anemia
(RaMRC Ab-induced AIHA model)]
(Protocol]
Cyclophosphamide (CY, Sigma, MO, USA),
azathioprine (AZ, Sigma, MO, USA), methotrexate (MTX, Sigma,
MO, USA), and rabbit anti-mouse red blood cell antibody
(RaMRC Ab) were obtained from the supplier indicated. The
rest of compounds was obtained in the same manner as in
Example 19. For administration to animals, compounds were
suspended in PBS(-), which was used as the vehicle (V) in
all experiments. Balb/c mice (7-week-old) were purchased
from SLC (Shizuoka, Japan). Animals were kept in the same
manner as in Example 19.
Induction of autoimmune hemolytic anemia (AIHA)
in mice was conducted as follows:
CA 02561696 2006-09-28
- 149 -
Hemolytic anemia was induced by an i.v. injection
of rabbit aMRBC autoantibody in mice. Animals received an
i.p. injection of modified galectin 9 mutein (h-G9NC(null)),
dexamethasone, other drugs, or vehicle, at 0.345m1/head 30
minutes before and Days 1 to 4 after rabbit aMRBC
autoantibody injection.
Blood samples were collected into heparinized
microhematocrit capillary tubes and centrifuged for 5 min
at 12,000 rpm in a microfuge. Hematocrits measured by the
percentage of packed PBCs were directly determined after
centrifugation.
Statistical analysis was conducted as follows:
Unless otherwise stated, data are expressed as
mean values SEM. Statistical differences of data sets were
analyzed using one-way ANOVA, and differences between
groups were assessed by Dunnett's Multiple Comparison Test
using commercially available statistics software (GraphPad
Software, Inc., San Diego, USA). P values <0.05 were
considered statistically significant.
[Results]
The results are shown in FIG. 37. In the
modified galectin 9 mutein-administered groups, a tendency
to inhibit the occurrence of diseased conditions was
observed. In the drawing, each value represents the mean-
SEM of 5 to 6 animals (*p<0.05, **p<0.01).
Example 22
[Arthus Reaction (Angiitis)]
[Protocol]
The efficacy of modified galectin 9 mutein on
biphasic cutaneous reaction induced by immune complexes
(Arthus reaction) was examined.
Anti-OVA IgG was obtained from the supplier
CA 02561696 2006-09-28
- 150 -
indicated. The rest of compounds was obtained in the same
manner as in Example 20. For administration to animals,
compounds were suspended in PBS(-), which was used as the
vehicle in all experiments. Balb/c mice (7-week-old) were
purchased from SLC (Shizuoka, Japan). Animals were kept in
the same manner as in Example 19.
Induction of ear edema in mice was conducted as
follows:
In the model of biphasic cutaneous reaction, mice
were sensitized by i.d. injection of anti-OVA IgG (50
pg/mouse) into each right ear, and immediately challenged
by i.v. injection of 200 pl of 1% OVA in PBS. Animals
received i.v. injections of modified galectin 9 mutein (h-
G9NC(null)), dexamethasone, or vehicle, at 0.345m1/head 30
minutes prior to and 5 hours after OVA injection. After
OVA injection, ear thickness was measured at 0, 2, 4, 8 and
24 hours with a calibrated thickness gauge (Mitsutoyo,
Tokyo, Japan) under anesthetization with ether.
Ear edema was expressed as (R-L)-(R0-1,0), where R0
and Lo represent the thickness of the right and left ear,
respectively, at the beginning of the experiment (0 h), and
R and L stand for the thickness values obtained at each
given time point.
Statistical analysis was conducted as follows:
Unless otherwise stated, data are expressed as
mean values SEM. Statistical differences of data sets were
analyzed using one-way ANOVA, and differences between
groups were assessed by Bonferroni Post-Test using
commercially available statistics software (GraphPad
Software, Inc., San Diego, USA). P values <0.05 were
considered statistically significant.
[Results]
The results are shown in FIG. 38. In the
modified galectin 9 mutein-administered groups, a tendency
to inhibit the occurrence of diseased conditions was
observed. In the drawing, each value represents the mean-
CA 02561696 2006-09-28
- 151 -
SEM of 5 to 6 animals (*p<0.05, **p<0.01).
Example 23
[ARDS Model (LPS-Induced ARDS Model))
[Protocol]
Lipopolysaccharide (LPS, Sigma, MO, USA) was
obtained from the supplier indicated. The rest of
compounds was obtained in the same manner as in Example 19.
For administration to animals, compounds were suspended in
PBS(-), which was used as the vehicle in all experiments.
Balb/c mice (7-week-old) were purchased from SLC (Shizuoka,
Japan). Animals were kept in the same manner as in Example
19.
Induction of ARDS in mice was conducted as
follows:
In order to induce dyspnea and neutrophil
infiltration into murine airway tissue, male mice were
challenged with LPS as lung injury model. Mice were
received an i.n. injection of LPS (0.6 mg/ml, 0.05-ml
volume). The control group received an administration of
normal PBS (0.05 ml) by the same route.
To study the effect of modified galectin 9 mutein,
h-G9NC(null), and dexamethasone, mice received i.p.
injections of modified galectin 9 mutein, h-G9NC(null) (100
pg/410 pl(in PBS)/body), or dexamethasone (1 to 10 mg/200
pl(in PBS)/kg(body weight)) 30 minutes before and 6 hours
after LPS challenge.
Mouse lung function ((Penh value and tidal
volume) was analyzed by whole body barometric
plethysmography (Buxco Electronics, Inc., Sharon, CT) and
unrestrained whole body plethysmograph (PULMOS-I; M.I.P.S,
Osaka, Japan) one hour prior to and 12 hours after LPS
challenge.
After analysis of lung function, BAL fluid
CA 02561696 2006-09-28
- 152 -
samples were collected from each animal.
The total pulmonary airflow in unrestrained
conscious mice was estimated with an unrestrained whole
body plethysmograph.
Pressure differences between a chamber containing the mice
and a reference chamber were used to extrapolate minute
volume, tidal volume, breathing frequency, Penh value, and
specific airway resistance (sRAW). Specific airway
resistance is a dimensionless parameter that is a function
of total pulmonary airflow in mice during the respiratory
cycle.
Suspension cells were stained with Turk's
solution, and counted with a hemocytometer to determine
each cell number (cells/ml). Next, cytospin preparations
were made to determine cell differentials with Giemsa-May-
Grilinwald solution via identification of morphological
characterization. On each slide, 200 to 500 leukocytes
were counted.
Statistical analysis was conducted as follows:
Unless otherwise stated, data are expressed as
mean values SEM. Statistical differences of data sets were
analyzed using one-way ANOVA or two-way ANOVA, and
differences between groups were assessed by Dunnett's
Multiple Comparison Test or Bonferroni Post-Test using
commercially available statistics software (GraphPad
Software, Inc., San Diego, USA). P values <0.05 were
considered statistically significant.
[Results]
The results are shown in FIGs. 39 and 40. In the
drawing, each value represents the mean SEM of 5 to 6
animals. Statistical differences were analyzed using one-
way ANOVA. Differences between groups were assessed by
Dunnett's Multiple Comparison Test (*p<0.05, **p<0.01,
***p<0.001). FIG. 39 shows the efficacy of modified
galectin 9 mutein (h-G9NC(null)) on airway
hyperresponsivity where relief is observed. FIG. 40
CA 02561696 2006-09-28
- 153 -
indicates that modified galectin 9 mutein (h-G9NC(null))
inhibits neutrophil infiltration in BALE.
Example 24
[Capsaicin-Induced Inflammatory Disease Model]
[Protocol]
Cyproheptadine (Sigma, MO, USA) and capsaicin
(Nakarai, Tokyo, Japan) were obtained from each supplier
indicated. The rest of compounds was obtained in the same
manner as in Example 19. For administration to animals,
compounds were suspended in PBS(-), which was used as the
vehicle in all experiments. Balb/c mice (7-week-old) were
purchased from SLC (Shizuoka, Japan). Animals were kept in
the same manner as in Example 19.
Induction of ear edema in mice was conducted as
follows:
A solution of capsaicin (500 pg) in acetone/olive
oil (4/1, 30 pl) was applied to the inner and outer surface
of the right ear of each mouse (BALB/c, 7 to 8
weeks old,
SPF, SLC Inc.). The vehicle, acetone/olive oil, was
applied to the left ear as a control.
Animals received injections of modified galectin
9 mutein (h-G9NC(null)), dexamethasone, cyproheptadine, or
vehicle, (i.p., 0.345ml/head) 30 minutes, and i.v. 10
minutes prior to capsaicin administration. After capsaicin
administration, ear thickness was measured at 0, 0.5, 1 and
2 hours with a calibrated thickness gauge (Mitsutoyo, Tokyo,
Japan) under anesthetization with ether.
Ear edema was expressed as (R-L)-(R0-1,0), where Ro
and Lo represent the thickness of the right and left ear,
respectively, at the beginning of the experiment (0 h), and
R and L stand for the thickness values obtained at each
given time point.
Statistical analysis was conducted as follows:
CA 02561696 2006-09-28
- 154 -
Unless otherwise stated, data are expressed as
mean values:LSEM. Statistical differences of data sets were
analyzed using one-way ANOVA, and differences between
groups were assessed by Bonferroni Post-Test using
commercially available statistics software (GraphPad
Software, Inc., San Diego, USA). P values <0.05 were
considered statistically significant.
The results are shown in FIG. 41. Inhibition of
disease occurrence is found in the modified galectin 9
mutein-administered groups (i.v. injection). In the
drawing, each value represents the mean SEM of 5 to 6
animals. Statistical differences were analyzed using two-
way ANOVA. Differences between groups were assessed by
Dunnett's Multiple Comparison Test (*p<0.05, **p<0.01,
***p<0.001). Modified galectin 9 muteins are expected to
serve as inhibitors for neurogenic, inflammatory pain
(including pain due to inflammation).
Example 25
[Modified Galectin 9 Mutein's Action on
Bone Absorption and Bone Formation]
[Protocol]
1. Bone Absorption
(Osteoclast Formation)
Peripheral blood mononuclear cells (PBMC, 1x105
cells) were cultured in the presence of RANKL (50ng/m1) and
M-CSF (50ng/m1) for 9 days. The number of TRAP-positive
multinucleated cells (osteoclasts) in modified galectin 9
mutein (h-G9NC(null))-added groups (0.1 to lOnM) was
compared with that in non-added groups. H-G9NC(null)
inhibited concentration-dependently the formation of TRAP-
positive multinucleated cells (osteoclasts). The term "h-
G9NC(null)" is also sometimes herein abbreviated to "gal-9".
The results are shown in FIG. 42.
CA 02561696 2006-09-28
- 155 -
Control group (cont.): 500 13.2 cells/well
Modified Gal-9 mutein-administered groups
(h-G9NC(null), 0.1nM): 451 7.6 cells/well,
(h-G9NC(null), 1.0nM): 151 12.5 cells/well, and
(h-G9NC(null), lOnM) : 29 14.0 cells/well.
2. Bone Formation
(Osteoblast Proliferation)
To examine the influence of h-G9NC(null) (0.1 to
100nM) on the proliferation of human osteoblasts, cells
were seeded on a 96 well plate at 2X103 cells/well,
incubated overnight, then stimulated with h-G9NC(null), and
observed at 0, 24, and 48 hr. Cell proliferation was
evaluated based on absorbance (OD) readings by the Tetra
color-1 assay.
The results are shown in FIG. 44. Modified
galectin 9 muteins induced concentration-dependently
osteoblast proliferation, where said induction was
inhibited by lactose. Modified galectin 9 muteins induced
the proliferation of osteoblasts concentration-dependently
and said Gal-9 mutein-mediated induction was inhibited by
lactose (30mM).
Absorbance readings: control, 0.21 0.01; h-G9NC(null)
(0.1nM), 0.22 0.01; h-G9NC(null) (1.0nM), 0.24 0.01;
h-G9NC(null) (10nM), 0.25 0.01; and h-G9NC(null) (100nM),
0.26 0.02 at 24 hr;
48 hr later, control, 0.22 0.01; h-G9NC(null) (0.1nM),
0.23 0.01; h-G9NC(null) (1.0nM), 0.26 0.01; h-G9NC(null)
(10nM), 0.27 0.01; and h-G9NC(null) (100nM), 0.31 0.04.
(Osteoblast Differentiation)
To examine the influence of modified galectin 9
mutein (h-G9NC(null)) (100nM) on the differentiation of
human osteoblasts, a suspension of cells in 10'.FCS/DMEM was
seeded on a 6 well plate at 1X105 cells/well, incubated for
24 hr, then subjected to starvation in ltFCS/DMEM overnight,
CA 02561696 2006-09-28
- 156 -
stimulated with gal-9, and observed 8 hr later. Cell
differentiation was evaluated based on intracellular ALP
and osteocalcin values measured using a flow cytometer.
The results are shown in FIG. 45. Modified
galectin 9 muteins induced the expression of ALP and
osteocalcin, the markers of new bone formation in
osteoblasts. ALP increased by 400 molecules/cell in
comparison with non-stimulated groups, and osteocalcin did
by 800 molecules/cell in comparison with non-stimulated
groups. In addition, when osteoblasts were admixed with h-
G9NC(null) (10nM) and cultured for 28 days, ALP staining as
well as von Kossa staining was promoted as compared with
non-added groups.
From the foregoing tests, the aggregation of
mononuclear cells took place within 6 hours after addition
of modified galectin 9 mutein. Modified galectin 9 muteins
inhibited the formation of TRAP-positive multinuclear cells
concentration-dependently. Modified galectin 9 muteins
induced the proliferation of osteoblasts concentration-
dependently. Modified galectin 9 muteins induce the
expression of ALP and osteocalcin in osteoblasts.
In view of the above described results, it is
suggested that modified galectin 9 muteins and native
galectin 9 proteins may act on bone absorption
suppressively and on bone formation acceleratingly.
Therefore, it will be considered that they may serve as
bone formation-accelerating drugs for therapeutic
applications to postmenopausal osteoporosis.
CA 02561696 2006-09-28
- 157 -
Example 26
[Modified Galectin 9 Mutein's Action on
Interstitial Pneumonia Model]
(Protocol]
Mice are used for interstitial pneumonia model
animals. C57BL/6 mice (4-, 6-week-old, 7 to 8 weeks old
when used, 20 animals) were treated according to reference
documents: Blood 2002, 99: 1289-98 and Am J Respir Crit
Care Med 2003, 168: 1075-83 to raise interstitial pneumonia.
Compounds, rhIL-2 (PeproTech, 5pg x 10 animals x 2 groups x
14 days = 1400pg = 1.4 mg) and rmIL-18 (MBL, 0.2pg x 10
animals x 2 groups x 14 days = 56pg), were used.
Sample groups consist of control groups and
modified galectin 9 mutein (Gal-9)-administered groups
prepared.
(1) Control Group (10 mice)
Mice received intraperitoneal (i.p.) injections
of IL-2 (5pg/mouse/day) + IL-18 (0.2pg/mouse/day) on Days 0
to 13 every day. Control mice received i.p. injections of
PBS (200p1/mouse/day) on Days 0 to 13 every day.
(2) Gal-9-Administered Group (10 mice)
Mice received i.p. injections of IL-2
(5pg/mouse/day) + IL-18 (0.2pg/mouse/day) on Day 0 to 13
every day. A solution of modified galectin 9 mutein, h-
G9NC(null), in PBS was injected to animals at 100pg/300p1
PBS/mouse from Days 0 to 13 every day. Both the groups
received an i.p. injection of NEMBUTAL for anesthetization.
Each mice survival proportion was taken as the
first indicator of efficacy evaluation. Animals that
survived to Day 14 were subjected to examination of their
lung tissue.
Mouse sampling was conducted as follows:
Mice that died during the test were dissected on
their death to provide lung tissue samples.
* CA 02561696 2006-09-28
- 158 -
Mice that survived to day 14 were treated as
follows: ether anesthetization -4 collection of blood from
the orbit -4 dislocation of the cervical vertebrae -4
thoracotomy -4 collection of lung tissue.
The effect of rhGal-9null i.p. administration in
this model was examined. The respective survival
proportions on Day 14 of rhGal-9null-administered and non-
administered groups were taken as efficacy evaluation
standards, and further their tissue images on Day 14 were
compared.
The results are shown in FIGs. 46 and 47. FIG.
46 shows survival proportions. For the survival
proportions on Day14, the non-administered group gave 30%
(3 animals survived among 10) while the h-G9NC(null) (Gal-
9)-administered group did 90% (9 animals survived among 10).
Thus, an improvement in the survival proportion was
attained through administration of modified galectin 9
mutein (h-G9NC(null): Gal-9).
FIG. 47 shows lung tissue images (stained with HE,
photograph) from survived mice on Day 14. In the non-
administered group, even survived mice gave thickening at
the lung interstices, accompanying the widespread,
intensive invasion of cells. In the modified galectin 9
mutein (h-G9NC(null): Gal-9)-administered group, both
interstice thickening and cell invasion were slight, and a
lot of normal tissue residuals were found. Therefore, it
has been revealed that galectin 9 (Gal-9) is effective in
the suppression of disease occurrence in this model.
Although changes in body weight took place in this test, no
significant change in body weight was observed for both
dead and survived mice in the non-administered group.
CA 02561696 2006-09-28
- 159 -
Example 27
(Activity against Cancer Metastasis Model)
(Protocol)
To examine the action of modified galectin 9
muteins on the model of cancer metastasis, B16/F10 cells
were used.
Cells (5X105 cells/200pL) were inoculated
intravenously (i.v.) into the tail of each C57/BL6 mouse
(SLC, 6-week-old female). Immediately after the
inoculation, modified galectin 9 mutein (h-G9NC(null),
abbreviated to "Gal-9"; 100pg/300pL) or PBS (N=15 each) was
administered i.v. into the tail every day for 11 days (12
injections). Twelve days after the administration, animals
were dissected, and the number of colonies was counted.
FIG. 49 shows test results (each exterior view of
model animal's lungs). The counting results of the lung
colony number are shown in FIG. 50. As a result of
comparing the modified galectin 9 mutein-administered group
(Gal-9 group) with the PBS-administered group (PBS group),
the metastasis-inhibiting efficacy of modified galectin 9
muteins was found. In the comparison of lung colony
numbers, mean colony numbers are: modified galectin 9
mutein-administered group (Gal-9), 231.3 20.87; and PBS-
administered group (PBS), 122.1 13.61. P values <0.0001
were considered significant. Thus, it has been verified
that modified galectin 9 muteins are effective in
inhibition of cancer metastasis.
Example 28
(Carrageenan-Induced Inflammatory Disease Model:
Carrageenan-Induced Rat Paw Edema)
Carrageenan (Izushi kagaku, Japan) was obtained
from the supplier indicated. For administration to animals,
compounds were suspended in PBS(-), which was used as the
= CA 02561696 2006-09-28
- 160 -
vehicle in all experiments. Female Lewis rats (5-week-old)
were purchased from SLC (Shizuoka, Japan). Animals were
kept in the same manner as in Example 19. To examine the
effect of modified galectin 9 muteins, rats received an i.v.
injection of modified galectin 9 mutein (h-G9NC(null),
abbreviated to "gal-9"; 30 to 300 pg/body (in PBS)) 10 min
prior to carrageenan injection. Positive control groups
received dexamethasone (Dex.) at a dose of 3mg/kg, or
7mg/kg.
[carrageenan-Induced Paw Edema]
To examine the anti-inflammatory activity of
modified galectin 9 mutein (human null galectin-9, h-
G9NC(null)), carrageenan-induced paw edema tests in rats
were performed according to Sugishita et al. (1981) methods.
Rats received an i.v. injection of a drug compound (30, 100
and 300pg/body) or vehicle (PBS) 10 minutes prior to
injection of carrageenan (0.15 ml; 1% w/v in saline) into
the footpad of the right hind paw. The volume of the paw
was measured by mercury displacement plethysmography
(Muromachi, Tokyo, Japan). The paw volume measurements
were repeated for the carrageenan-injected paw and the
contra-lateral paw (saline was injected into the right hind
paw) at -1, 2, 4, 6, 24, 48 and 72 h after edema induction.
Changes in paw volume were calculated as the differences
between the -1 h reading and each given time point reading.
carrageenan-induced edema was expressed as the difference
between the carrageenan-injected paw and the contra-lateral
paw for each animal.
Statistical analysis was conducted as follows:
Unless otherwise stated, data are expressed as
mean values SEM. Statistical differences of data sets were
analyzed using one-way ANOVA or two-way ANOVA, and
differences between groups were assessed by Dunnett's
Multiple Comparison Test or Bonferroni Post-Test using
commercially available statistics software (GraphPad
Software, Inc., San Diego, USA). P values <0.05 were
* CA 02561696 2006-09-28
- 161 -
considered statistically significant.
[Results]
The results are shown in FIG. 51 (modified
galectin 9 mutein) and FIG. 52 (dexamethasone). Modified
galectin 9 muteins have been observed to be active in
inhibition of the disease occurrence even at a dose level
of 30pg/mouse.
Example 29
1. Modified Galectin 9 Mutein's Analgesic Action
in Adjuvant Arthritis Model
[Protocol]
[Pain Triggered by Mechanical Stimuli (Randall-Selitto Test
= Vertical Pressure Measurement of Pain Threshold)]
Mycobacterium butyricum (Difco, Detroit, MI, USA)
was obtained from the supplier indicated. For
administration to animals, compounds were suspended in
PBS(-), which was used as the vehicle in all experiments.
Female Lewis rats (5-week-old) were purchased from SLC
(Shizuoka, Japan). Animals were kept in the same manner as
in Example 19. To examine the effect of modified galectin
9 muteins, rats received i.v. injections of modified
galectin 9 mutein, h-G9NC(null) (abbreviated to "Gal-9") at
a dose of 30 to 300 pg/body (in PBS) on Days 0 to 22 before
and after adjuvant injection. The positive control group
received indomethacin (Indo) at a dose of 3 mg/kg.
[Adjuvant Arthritis]
Female Lewis rats (5-week-old) were weighed, and
each rat tail was marked. Animals were then divided into
groups wherein each group consisted of 9 animals. The body
weight of each rat and the footpad volume of both hind paws
were recorded prior to adjuvant injection (Day 0). Next,
= CA 02561696 2006-09-28
- 162 -
adj uvant was injected into the right hind paw of each rat.
Adjuvant-uninjected groups were taken as normal age-matched
controls (sham). The body weight and paw volume of rats in
each group were recorded prior to rat sacrifice on each
given day after adjuvant injection.
[Protocol for Adjuvant]
Mycobacterium butyricum was ground down in a
mortar to give an adjuvant which was admixed with an oil to
make the final concentration 10 mg/ml. An aliquot (0.2 ml)
of the adjuvant mixture was injected into the footpad of
the right hind rat paw with a 27-gauge, 0.5-inch needle.
[Analysis of Pain Triggered by Mechanical Stimulation]
The intensity of hyperalgesia was assessed using
the method of Randall-Selitto with some modifications in
order to study whether or not modified galectin 9 mutein,
human null galectin-9 (h-G9NC(null)), had analgesic
activity such as activity of relieving peripheral
hyperalgesia in response to external pressure in acute
inflamed and uninflamed tissue. Briefly, an aliquot of
Complete Freund's Adjuvant was injected s.c. into the right
hind paw of each female Lewis rat (5-week-old) to induce
acute and chronic inflammatory disease. The intensity of
hyperalgesia in response to external pressure was measured
by the Randall-Selitto test, in acute inflamed and
uninflamed tissue 2 days prior to adjuvant injection and 5
days after adjuvant injection, and monitoring was continued
to Day 25 (1 time/week). External pressure was then
gradually applied to both the inflamed and contra-lateral
uninflamed paws (0 to 200 g) with a Digital Force
Measurement Gauge (Imada, Aichi, Japan) under the control
of an observer. The "pain threshold" was defined as the
pressure when the animal first showed evidence of the
sensation of pain, indicated by the extension of digits
and/or the initial signs of paw withdrawal and/or
vocalization.
CA 02561696 2006-09-28
- 163 -
Statistical analysis was conducted in the same
fashion as in Example 28. Briefly, unless otherwise stated,
data are expressed as mean values SEM. Statistical
differences of data sets were analyzed using one-way ANOVA
or two-way ANOVA, and differences between groups were
assessed by Dunnett's Multiple Comparison Test or
Bonferroni Post-Test using commercially available
statistics software (GraphPad Software, Inc., San Diego,
USA). P values <0.05 were considered statistically
significant.
[Results]
The results are shown in FIG. 58 (modified
galectin 9 mutein, Gal-9) and FIG. 59 (indomethacin). In
the drawings, each value represents the mean SEM of 8 to 9
animals (n=8 to 9, FIG. 58) and of 9 animals (n=9, FIG. 59)
at each given point. Statistical differences were analyzed
using two-way ANOVA, and differences between groups were
assessed using Bonferroni Post-Test (*p<0.05, **p<0.01,
***p<0.001). When modified galectin 9 muteins were
administered, the pain threshold in response to external
stimulation increased concentration-dependently for not
only uninflamed sites but also inflamed sites (see FIG. 66
left). That is, modified galectin 9 muteins elevate
systemically pain thresholds.
2. Carrageenan-Induced Acute Inflammatory Disease Model:
Carrageenan-induced Paw Edema in rats
[Protocol]
Carrageenan (Izushi kagaku, Japan) was obtained
from the supplier indicated. For administration to animals,
compounds were suspended in PBS(-), which was used as the
vehicle in all experiments. Female Lewis rats (5-week-old)
were purchased from SLC (Shizuoka, Japan). Animals were
kept in the same manner as in Example 19. To examine the
effect of modified galectin 9 muteins, rats received an i.v.
CA 02561696 2006-09-28
- 164 -
inj e ct ion of modified galectin 9 mutein, h-G9NC(null)
(abbreviated to "Gal-9"), at a dose of 30 to 300pg/body (in
PBS) 10 minutes prior to injection of carrageenan. The
positive control group received dexamethasone (Dex) at a
dose of 3mg/kg or 7mg/kg.
[Analysis of Pain Triggered by Mechanical Stimulation]
The intensity of hyperalgesia was assessed using
the method of Randall-Selitto with some modifications in
order to study whether or not modified galectin 9 mutein,
human null galectin-9 (h-G9NC(null)), had analgesic
activity such as activity of relieving peripheral
hyperalgesia in response to external pressure in acute
inflamed and uninflamed tissue. Briefly, carrageenan was
injected s.c. into the right hind paw of each female Lewis
rat (5-week-old) to induce acute and chronic inflammatory
disease. The intensity of hyperalgesia in response to
external pressure was measured by the Randall-Selitto test,
in acute inflamed and uninflamed tissue 1 day prior to
carrageenan injection and at 6 hours after carrageenan
injection, and monitoring was continued to 75 h (1
time/day). External pressure was then gradually applied to
both the inflamed and contra-lateral uninflamed paws (0 to
200 g) with a Digital Force Measurement Gauge (Imada, Aichi,
Japan) under the control of an observer. The "pain
threshold" was defined as the pressure when the animal
first showed evidence of the sensation of pain, indicated
by the extension of digits and/or the initial signs of paw
withdrawal and/or vocalization.
Statistical analysis was conducted in the same
fashion as in Example 28. Briefly, unless otherwise stated,
data are expressed as mean values SEM. Statistical
differences of data sets were analyzed using one-way ANOVA
or two-way ANOVA, and differences between groups were
assessed by Dunnett's Multiple Comparison Test or
Bonferroni Post-Test using commercially available
statistics software (GraphPad Software, Inc., San Diego,
CA 02561696 2006-09-28
- 165 -
USA) . P values <0.05 were considered statistically
significant.
[Results]
The results are shown in FIG. 60 (modified
galectin 9 mutein, gal-9) and FIG. 61 (dexamethasone). In
the drawings, each value represents the mean SEM of 9
animals (n=9) at each given point. Statistical differences
were analyzed using two-way ANOVA, and differences between
groups were assessed using Bonferroni Post-Test (*p<0.05,
**p<0.01, ***p<0.001). When modified galectin 9 muteins
are administered, the pain threshold in response to
external stimulation increases concentration-dependently
for not only uninflamed sites but also inflamed sites.
That is, modified galectin 9 muteins elevate systemically
pain thresholds.
Example 30
[Stability of Modified Galectin 9 Mutein
in Human Synovial Fluid]
Reaction Condition
Human rheumatoid arthritis synovial fluid sample 160pL
G9NC(null) or G9(S) (5pL in PBS) 40pL
Galectin 9 was incubated in 80% synovial fluid at
37 C for 24 hr or 96 hr (sampling at 6, 24, 48, and 72 hr
during the incubation).
SDS treatment and Western blot
Sample 4.5pL
H20 40.5pL
Sample buffer (4x, + 2-ME) 15pL
SDS-PAGE: 12.5%(10pL/lane).
CA 02561696 2006-09-28
- 166 -
The results are shown in FIG. 62. It has been
clarified that modified galectin 9 mutein, G9NC(null), is
more stable even in synovial fluid with high protease
activity than galectin-9S (G9(S)).
Example 31
[Arthritis Model]
1. Ab Cocktail-Induced Model: Modified Galectin 9 Mutein
(i.v. administration)
(Protocol)
DBA/1J female mice (7 to 8 weeks old) were used.
An arthritogenic monoclonal antibody cocktail (Chondrex, WA,
USA; No.62100) was intravenously (i.v.) administered to the
tail of each animal at 2 mg/0.5 ml/body. Three days later,
the animals received an i.p. injection of LPS (SIGMA,
L6511) at 50pg/0.2mL. Further, a solution of modified
galectin 9 mutein, h-Ga19NC(null) (abbreviated to "Gal-9"),
was injected i.v. into the tail of each animal at
30pg/200pL. Test groups consist of 3 groups; PBS-
administered group, and h-Ga19NC(null)-administered groups
consisting of singly administered group (administered once
on Day 0, i.e., LPS administration date) and daily
administered group (administered every day to Day 10, 10
administrations). Each group was measured for the swelling
degree of each limb joint (of right and left, fore and hind
limbs) once a day and severity of arthritis was scored.
[Results]
The results are shown in FIG. 63. After Ab
cocktail administration, arthritis was induced with LPS.
When modified galectin 9 muteins were i.v. applied,
arthritis was inhibited, too. It has been observed that
even the single administration leads to inhibitory effect
on the occurrence of the disease.
=
CA 02561696 2006-09-28
- 167 -
2-1. CIA (Collagen-Induced Arthritis) Model:
Modified Galectin 9 Mutein (i.p. administration)
[Protocol]
Bovine collagen type II (BCII: Chondrex Inc., cat
no 2002-1) was dissolved in complete adjuvant (CFA: Difco
cat no 263810) to form an emulsion which was injected
subcutaneously (s.c.) into the base of each mouse tail
(DBA/1J mouse, 7- to 8-week-old, female) at a dose of 100pL
(BCII 0.1mg/100pL/mouse). On day 21 post-immunization, the
booster injection of collagen emulsion was given, and
severity of arthritis was scored three times a week for 4
limbs. Immediately after booster injection, modified
galectin 9 mutein (abbreviated to "Gal-9" ; 30 pg/mouse) or
PBS was i.p. given. Thereafter, the drug injection was
repeated every day. Mice were monitored by plural
observers and each limb was given a clinical score
(arthritic observations). Each limb was graded, and a
total score per animal was obtained by adding up each
individual score, resulting in a maximal clinical score of
16 per animal. Finally, each mean score was calculated.
a) one digit swollen: 1
CD two digits swollen: 2
CD swelling to the dorsum of paw: 3
severe swelling, deformities: 4
[Results]
The results are shown in FIG. 64. It has been
verified that modified galectin 9 muteins are inhibitory
against the occurrence of the disease.
2-2. CIA (Collagen-Induced Arthritis) Model:
Modified Galectin 9 Mutein (i.v. administration)
[Protocol]
Bovine Collagen type II (BCII: Chondrex Inc., cat
no 2002-1) was dissolved in incomplete Freund's Adjuvant
CA 02561696 2006-09-28
- 168 -
(IFA: Difco) premixed with Mycobacterium Tuberculosas H37
Ra, desiccated (H37 Ra: Difco) to form an emulsion which
was injected s.c. into the base of each mouse tail (DBA/1J
mouse, 7- to 8-week-old, female) at a dose of 100pL (BCII
0.2mg/H37 Ra 0.2mg/100pL/mouse). On day 21 post-
immunization, the booster injection of collagen emulsion
was given, and severity of arthritis was scored three times
a week for 4 limbs. Mice were monitored by plural
observers and each limb was given a clinical score
(arthritic observations). Each limb was graded, and the
cumulative score for all four limbs of each animal was
calculated (maximum of 16 per animal). Finally, each mean
score was calculated.
Immediately after booster injection, modified
galectin 9 mutein (abbreviated to "Gal-9"; 30 jig/mouse:
N=15) or PBS (N=10) was i.p. given. Thereafter, the drug
injection was repeated every day.
Reference Document: "Enhancement of collagen-induced
arthritis in mice genetically deficient in extracellular
superoxide dismutase", Ross AD, Banda NK, Muggli M, Arend
WP. Arthritis Rheum. 2004 Nov;50(11):3702-11.
[Results]
The results are shown in FIG. 65. It has been
verified that modified galectin 9 muteins are inhibitory
against the occurrence of the disease.
3. Adjuvant-Induced Arthritis (AIA) Model:
Modified Galectin 9 Mutein (i.v. administration)
[Protocol]
Mycobacterium butyricum (Difco, Detroit, MI, USA)
was obtained from the supplier indicated. For
administration to animals, compounds were suspended in
PBS(-), which was used as the vehicle in all experiments.
Female Lewis rats (5-week-old) were purchased from SLC
CA 02561696 2006-09-28
- 169 -
(Shizuoka, Japan). Animals were kept in the same manner as
in Example 19. To examine the effect of modified galectin
9 muteins, rats received i.v. injections of modified
galectin 9 mutein, h-G9NC(null) (abbreviated to "Gal-9";
30-300 pg/body (in PBS)), on Days 0 to 22 before and after
adjuvant injection.
[Adjuvant Arthritis]
Female Lewis rats (5-week-old) were weighed, and
each tail was marked. Animals were divided into groups
wherein each group consisted of 9 animals. The body weight
of each rat and the footpad volume of both hind paws were
recorded prior to adjuvant injection (Day 0). Next,
adjuvant was injected into the right hind paw of each rat.
Adjuvant-uninjected groups were taken as normal age-matched
controls (sham). The body weight and paw volume of rats in
each group were recorded prior to rat sacrifice on each
given day after adjuvant injection.
[Paw Volume]
The volume of the paw was measured by mercury
displacement plethysmography (Muromachi, Tokyo, Japan).
Changes in paw volume were calculated as the differences
between the Day 0 reading and each given date point reading.
[Clinical Evaluation]
The severity of arthritis was assessed for each
limb as follows: Each of fore and hind limbs were graded
for 1. interphalangeal joints and digits, 2. dorsum or palm,
and 3. ankle joint or wrist, using a scale of 0 to 3:
0, no erythema and swelling; 1, slight erythema or
swelling; 2, moderate erythema or swelling in ankle joint
or wrist; and 3, severe erythema or swelling.
The severity of the disease was scored for each
rat group. The daily cumulative arthritis score per rat
was obtained by adding up each individual graded paw
arthritis score.
CA 02561696 2006-09-28
- 170 -
[Protocol for Adjuvant]
Mycobacterium butyricum was ground down in a
mortar to give an adjuvant which was admixed with an oil to
make the final concentration 10 mg/ml. An aliquot (0.2 ml)
of the adjuvant mixture was injected into the footpad of
the right hind rat paw with a 27-gauge, 0.5-inch needle.
Statistical analysis was conducted in the same
fashion as in Example 28. Briefly, unless otherwise stated,
data are expressed as mean values SEM. Statistical
differences of data sets were analyzed using one-way ANOVA
or two-way ANOVA, and differences between groups were
assessed by Dunnett's Multiple Comparison Test or
Bonferroni Post-Test using commercially available
statistics software (GraphPad Software, Inc., San Diego,
USA). P values <0.05 were considered statistically
significant.
[Results]
The results are shown in FIG. 66 (modified
galectin 9 mutein, Gal-9) and FIG. 67 (indomethacin, Indo).
Adjuvant arthritis is inflammation occurring due to
acquired immunity mainly associated with innate immunity
and T cells. Although modified galectin-9 muteins inhibit
both inflammations, they primarily inhibit intensely
inflammation due to acquired immunity. It is noted that
the modified galectin-9 mutein-administered group tended to
work for a gain or loss in body weight in the same fashion
as the indomethacin-administered group.
CA 02561696 2006-09-28
- 171 -
Example 32
[Rat CIA (Collagen-Induced Arthritis) Model:
Modified Galectin 9 Mutein (i.v. administration)]
[Protocol]
Bovine collagen type II (Collagen Gijutsu
Kenkyukai, Tokyo, Japan) was dissolved in incomplete
Freund's adjuvant (IFA: Difco) to form an emulsion which
was injected s.c. into the back of each rat (DA/Sic, 11-
weel-old: Japan SLC, Inc., Japan) at a dose of 500pL
(collagen 50pg/500pL/mouse) for primary sensitization. One
week later, an aliquot of the same collagen emulsion
(collagen, 50pg/500pL/mouse) was injected into the base of
each animal tail for secondary sensitization. Each limb
was scored three times a week. Immediately after booster
injection, animals received an i.v. injection of modified
galectin 9 mutein (null human galectin-9 = h-G9NC(null); 3,
10, and 30 pg/1 mL/mouse), or negative reference material,
PBS (1 mL/mouse), or an oral application of positive
reference material, prednisolone (3mg/10mL/kg: SIGMA), once
a day for 32 days to Day 38.
The paw volume of each limb (including right and
left, fore and hind limbs) was measured on Day 0 (date of
collagen primary sensitization), Days 7, 15, 18, 22, 26, 30,
35 and 39 after the primary sensitization and each percent
swelling (%) was calculated according to the following
formula:
Percent swelling (%)=[postchallenge paw volume (mL)-
prechallenge paw volume (mL)]/[prechallenge paw volume
(mL)]x100
Statistical analysis was conducted as follows:
The cumulative value for right and left hind paw
values was taken as the individual value for each animal.
Results were expressed as the mean value of percent
swelling (%) and a standard error. The equality of
CA 02561696 2006-09-28
- 172 -
variances between the PBS group and the prednisolone-
administered group was examined by F test. Comparison of
data between the PBS group and the prednisolone-
administered group was performed using Student's t test for
equal variances but using Aspin-Wech's t test for unequal
variances. Next, the equality of variances between the PBS
group and the modified galectin-9 mutein-administered group
was examined by Bartlet's test. Comparison of data between
the PBS group and the modified galectin-9 mutein-
administered group was performed using parametric Dunnett's
test for equal variances but using nonparametric Dunnett's
test for unequal variances. The significance level was set
at less than 5% (P values <0.05 were considered
significant). Values less than 5% were expressed separate
from values less than 1% (p<0.01). The results are shown
in FIG. 68 and Table 3. In Table 3, each value represents
the mean SEM. 44: significantly different from control
(Days 15, 18, and 22: Student's t test, *p<0.05, **p<0.01:
significantly different from control (Days 18 and 22:
parametric Dunnett's test; Day 15: nonparametric Dunnett's
test). It has been found that modified galectin-9 muteins
are inhibitory against onset of the disease.
Table 3
Group Dose Route N Swelling (%) on day
7 15 18
22
Control, PBS - iv, 8 0.8 0.2 129.1 5.8
149.0 6.3 137.0 5.9
null human galectin-9 0.03mg/body iv. 8 0.7
0.2 65.0 16,3 129.5 5.7 143.2 4.7 2
u-,
HM
*
6 1
0.1mgibody iv, 8 0.8 0.2 23.5 4.3
108.0 12.3 135.0 9.9
.
(5)
0.3mglbody is. 8 0.7 0.1 13.9 2.3
52.5 13.0 96.9 8.9 .
co
## #4
# 4
Prednisolone 3 mg/kg p,o, 8 0.7 0.2
13.5 7.2 53.1 13.5 87.4 10.1
CA 02561696 2006-09-28
- 174 -
The modified galectin 9 muteins (stabilized
galectin 9, for example h-G9NC(null), etc.) exert anti-
tumor efficacy, expectable from the following bioactivity:
tumor cell aggregation ........... aggregating efficacy on
a variety of tumor cells
inhibition of adhesion ........... efficacy of inhibiting
adhesion to extracellular
matrices
apoptosis, cytotoxicity .......... efficacy of inducing
apoptosis in a variety of
tumor cells
activation of dendritic cell (DC)
.................................. efficacy of inducing the
differentiation of DC
NK, NKT activation efficacy of accelerating
recruitment
pain suppression suppression of pain triggered
by capsaicin.
The present inventor and associate group has
verified that through the study on the expression of
galectin 9 in breast cancer tissue the frequency of distant
metastasis is lower in galectin 9-positive samples. Based
on this, diagnostic kits for predicting metastasis are now
being developed (Clin Cancer Res, 2005 in press, Galectin-9
as a prognostic factor with anti-metastatic potential in
breast cancer). It has also been verified that galectin 9
gene-transferred human breast cancer cell lines exhibit in
vitro highly aggregative property, and exert the similar
aggregativity in nude mouse bodies. Further, it has been
observed to be cytotoxic against various cell lines
including hematologic malignant tumor cells. It has been
verified that most of such actions are attributed to
induction of apoptosis (Int J Cancer.2002 20;99(6):809-816,
Possible role of galectin-9 in cell aggregation and
apoptosis of human melanoma cell lines and its clinical
significance; J immunol. 2003 1;170(7d):3631-3636,
CA 02561696 2006-09-28
- 175 -
Galectin-9 induces apoptosis through the carcium-calpain-
caspase-1 pathway). In addition, when galectin 9 is
topically applied, recruitment of NK/NKT cells, MO cell
lines and others is observable, thereby suggesting that it
may be possible to induce the mechanism of cell-mediated
immunity (cellular immunity) against cancer.
In view of the foregoing, the stabilized galectin
9 molecules (or stable galectin 9 molecules, i.e., modified
galectin 9 muteins, for example, h-G9NC(null) and related
materials) exert cytotoxic efficacy against hematologic
malignancy such as leukemia, and liberated cancer cells in
post-surgical patients; metastasis-suppressing efficacy,
ascribable to inhibition of cancer cell aggregation/cancer
cell adhesion to the blood vessel wall and cancer cell
infiltration into other tissue; efficacy of suppressing
onset of cancerous peritonitis; and further actions
including elevation of antitumor immune responsiveness due
to recruitment of effector cells to the surroundings of
tumor. Thus, they can be expected to have more preferable
actions and effects. Therefore, they are expected to serve
as novel anti-cancer materials with less side effects.
Targets of biological drugs (such as monoclonal
antibody) that are now being developed are immune cell
surface molecules, intracellularly functional molecules and
inflammatory cytokines. That is, such drugs
physiologically and pharmacologically act with their
inhibitory efficacy. In contrast, the stabilized galectin
9 molecule drugs exert efficacy of inducing apoptosis of
synovial cells and activated T cells and of suppressing
bone destruction, thereby providing an expectation of
innate immunoregulation, anti-inflammation and
bone/cartilage tissue regeneration. Accordingly, the
inventive materials provide a novel development approach
conceptually entirely different from anti-cytokine therapy,
etc. Pain is a mainly observed sign in rheumatoid
arthritis, and capsaicin used in the above-described
CA 02561696 2006-09-28
- 176 -
examples is an important mediator that induces inflammatory
pain in neurogenic inflammatory disease. Stabilized
galectin 9 inhibits ear edema induced by capsaicin painting.
In other words, stabilized galectin 9 is expected to serve
as a novel less side-effect therapeutic agent for systemic
autoimmune diseases. The stabilized galectin 9 molecules
have novel functions, thereby promising to potentially
serve as anti-rheumatoid arthritis agents that exhibit less
side-effects. The stabilized galectin 9 molecules have
clinically effective characteristics, including inhibition
of inflammation, repair of articular tissue, and
suppression of pain whereby they can be expected to provide
mechanisms such as (1) induction of apoptosis in activated
T cells, (2) apoptosis of synovial cells, (3) arachidonic
acid cascade, and (4) suppression of bone destruction.
Therefore, the stabilized galectin 9 molecules will be
promising to be act as therapeutic agents for rheumatoid
arthritis. In practice, it has been verified that they
inhibit the onset of arthritis in the model of CIA (Ab
cocktail).
INDUSTRIAL APPLICABILITY
Modified galectin 9 muteins are more resistant
against enzymes than wild type Gal-9 proteins. Therefore,
the modified galectin 9 muteins are quite useful in
effectively utilizing and applying versatile actions and
functions owned by wild type galectin 9. It is suggested
that wild type galectin 9 induces metastasis inhibition and
regression of cancer by direct actions on tumor (activity
of inducing cell-to-cell adhesion and apoptosis of tumor
cells), and/or actions via immune system. Accordingly, the
modified galectin 9 muteins can be expected to act as
advantageous active materials having equivalent galectin 9
activity, for example, anti-tumor drugs. Wild type
CA 02561696 2012-05-10
31162-5
- 177 -
galectin 9 does not act on non-activated lymphocytes but
induces apoptosis in activated T cells, including inter
alia CD4-positive T cells causing hyperimmune responses.
Therefore, the modified galectin 9 muteins can be expected
to act as advantageous active materials having equivalent
galectin 9 activity, for example, anti-inflammatory drugs,
anti-allergic drugs, and/or osteoporosis drugs. Since it
is apparent that wild type galectin 9 has a potent
apoptosis-inducing property against synovial cells involved
in the deformity of joints and others in rheumatoid
arthritis, the modified galectin 9 muteins can be expected
to act as advantageously active materials having equivalent
galectin 9 activity. Thus, the present invention is
utilizable as a tool for not only the development of
therapeutic drugs for cancers, refractory autoimmune
diseases (including rheumatoid arthritis), allergic
diseases, inflammatory diseases, disorders related to bone
metabolism but also the revelation, research & development
of galectin 9 functions.
While the present invention has been described
specifically in detail with reference to certain
embodiments and examples thereof, it would be apparent that
it is possible to practice it in other forms. In light of
the disclosure, it will be understood that various
modifications and variations are within the
scope of the appended claims.
<Sequence Listing Free Text>
SEQ ID NO: 1, Description of Artificial Sequence:
Polynucleotide for galectin-9 mutein, G9NC(null)
SEQ ID NO: 2, Description of Artificial Sequence:
Polynucleotide for galectin-9 mutein
SEQ ID NO: 5, galectin-9 medium isoform
SEQ ID NO: 10, Description of Artificial Sequence:
Oligonucleotide to act as a primer for PCR
CA 02561696 2006-09-28
-178-
SEQ ID NO: 11, Description of Artificial Sequence:
Oligonucleotide to act as a primer for PCR
SEQ ID NO: 12, Description of Artificial Sequence:
Oligonucleotide to act as a primer for PCR
SEQ ID NO: 13, Description of Artificial Sequence:
Oligonucleotide to act as a primer for PCR
DEMANDES OU BREVETS VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVETS
COMPREND PLUS D'UN TOME.
CECI EST LE TOME 1 DE 2
NOTE: Pour les tomes additionels, veillez contacter le Bureau Canadien des
Brevets.
JUMBO APPLICATIONS / PATENTS
THIS SECTION OF THE APPLICATION / PATENT CONTAINS MORE
THAN ONE VOLUME.
THIS IS VOLUME 1 OF 2
NOTE: For additional volumes please contact the Canadian Patent Office.
