Note: Descriptions are shown in the official language in which they were submitted.
CA 02562016 2006-10-02
WO 2005/102379 PCT/US2004/043726
NUCLEIC ACID BASED ASSAYS FOR )DENTIFICATION OF
FC RECEPTOR POLYMORPHISMS
TECHNICAL FIELD
The present invention pertains generally to genotyping. In particular, the
invention relates to nucleic acid-based assays for accurately and efficiently
determining FcyRIII genotype of an individual.
BACKGROUND
IgG receptors (FcyR) are membrane bound glycoproteins that are expressed on
the surface of neutrophils, macrophages, natural killer (NK) cells and other
cell types.
FcYRIIIA (CD16), for example, has been shown to be involved in a variety of
processes such as phagocytosis, endocytosis, antibody-dependent cellular
cytotoxicity
(ADCC), release of inflammatory mediators, and enhancement of antigen
presentation. Van de Winkel et al. (1993) Immunol Today 14(5):215-21. IgG
binding
to the low affinity FcyRIIIA receptor expressed on the surface of NK cells is
considered to be a fundamental mechanism contributing to ADCC. See, e.g.,
Clynes
et al. (2000) Nature Med. 6:443-446; Cooper et al. (2001) Trends Immunol.
22:633-
640; Leibson (1997) Immunity 6:655-661; Roitt et al. (2001) Immunology (6th
ed.;
Mosby, Edinburgh, UK).
Two FcyRIII genes, FcyRIIIa (gene A) or FcyRIIIb (gene B), have been
identified. Ravetch and Perussia (1989) J. Exp Med 170:481. FcyRIlI receptors
have
been mapped to the long arm of chromosome 1. Van de Winkel et al. (1993)
Immunol Today 14(5):215-21. Furthermore, various functional polymorphisms have
been identified in FcyRIIIA including a bi-allelic functional polymorphism of
FcyRIlla (G-~T at nucleotide 559), which predicts a valine (V) to
phenylalanine (F)
substitution at amino acid position 158. Koene et al. (1997) Blood 90:1109-
1114.
The FcyRIIIA 158V allele has been shown to bind human IgGI better than the
158F
allele; and the increased binding of the 158V allele results in enhanced
activation of
effector cells and better ADCC. Shields et al. (2001) J. Biol. Chem. 176:6591-
6604;
Vance et al. (1993) J. Immunol. 151:6429-6439. Treatment outcomes have also
been
1
CA 02562016 2006-10-02
WO 2005/102379 PCT/US2004/043726
shown to be affected by the 158V/F polymorphism -- FcyRI)Ta 158 F/F
homozygotes
exhibit a decreased response to therapeutic antibodies such as ritubimab.
Cartron et
al. (2002) Blood 99:754-758; Weng and Levy (2003) J. Clin. Oncol. 21:1-8.
Given the functional and clinical implications of the FcyR>TIA 158V/F
polymorphism, several groups have proposed PCR-based methods for genotyping a
particular individual. See, e.g., Koene et al. (1997) Blood 90(3):1109-1114;
Lepperts
et al. (2000) J. Immuno Methods 242:127-132; Jiang et al. (1996) J. Immunol.
Methods 199:55-59; Morgan et al. (2003) Rheumatology 42:528-533; Dall'Ozzo et
al.
(2003) J. Immunol. Methods 277:185-192; and U.S. Patent Nos. 5,830,652 and
5,985,561. However, currently available assays have error rates of at least
10% with
respect to determining polymorphisms and, in addition, do not efficiently or
accurately
distinguish between FcyRIIIA (gene A) and FcyRIIIB (gene B).
Therefore, there remains a need for the development of compositions and
methods that can be used to accurately and efficiently determine a subject's
FcyR)II
genotype.
SUMMARY
The present invention is based on the development of sensitive, reliable
nucleic acid-based tests for determining the FcyRIII genotype from any sample.
In one aspect, the invention includes an isolated oligonucleotide comprising a
nucleotide sequence of between 10 and 60 nucleotides in length, the nucleotide
sequence comprising: (a) a sequence selected from the group consisting of SEQ
ID
NOs:I to 19; (b) a nucleotide sequence having 80% sequence identity to a
nucleotide
sequence of (a); or (c) complements of (a) and (b). Any of the isolated
nucleotides
described herein may further comprise a detectable label, for example a
fluorescent
label (e.g., 6-carboxyfluorescein (6-FAM), tetramethyl rhodamine (TAMRA),
and/or
2', 4', S', T,- tetrachloro -4-7- dichlorofluorescein (TET)).
In another aspect, described herein is a method of determining the FcyR)TI
genotype of a subject, the method comprising the steps of (a) isolating
nucleic acids
from a biological sample obtained from the subject; (b) amplifying the
isolated
nucleic acids using at least first and second combinations comprising at least
one of
2
CA 02562016 2006-10-02
WO 2005/102379 PCT/US2004/043726
the oligonucleotides described herein (e.g., SEQ ID NOs:I-19) as sense and
antisense
primers; and (c) detecting the presence or absence of amplified nucleic acids
with
each combination of oligonucleotides, wherein the presence or absence of
amplified
nucleic acids is indicative of the FcyRIll genotype of the subject. In certain
embodiments, the at least one of the oligonucleotides is specific for an
FcyRIll
polymorphism. Alternatively, in other embodiments, at least one of the
oligonucleotides is generic for at least one FcyRIII polymorphism. In any of
the
methods described herein additional combinations of oligonucleotides can be
used to
amplify nucleic acids from the sample, for example by repeating steps (b) and
(c) with
one more additional combinations of oligonucleotide primers. In some
embodiments,
the first and second combinations of oligonucleotides each comprise one primer
in
common.
In any of the methods described herein, the genotype at the 158V/F site of
FcyRIIIa may be determined. Thus, in certain embodiments, the first
combination of
oligonucleotide primers comprises SEQ ID NO:S and SEQ ID N0:2 and the second
combination of oligonucleotide primers comprises SEQ ID NO:S and SEQ ID NO:1.
In methods employing these combinations of primers, the presence of an
amplification
product using the first combination of oligonucleotide primers and the absence
of an
amplification product using the second combination of oligonucleotide primers
is
indicative of a 158W genotype; the absence of an amplification product using
the
first combination of oligonucleotide primers and the presence of an
amplification
product using the second combination of oligonucleotide primers is indicative
of a
158FF genotype; and the presence of an amplification product using the first
combination of oligonucleotide primers and the presence of an amplification
product
using the second combination of oligonucleotide primers is indicative of a
158FV
genotype.
Furthermore, in any of the methods described herein, the FcRIII genotype of
the subject at additional nucleotide positions may also be determined, for
example
additional nucleotide positions are selected from the group consisting of
positions
121, 153, 179, 207, 313 and combinations thereof.
Any of the methods described herein may further comprise the step of
CA 02562016 2006-10-02
WO 2005/102379 PCT/US2004/043726
sequencing the amplified nucleic acid product. In certain embodiments, the
sequencing primers used include one or more of the oligonucleotides described
herein.
In another aspect, a method of determining the FcyRI)I genotype of a subject
is
provided, the method comprising the steps of: (a) isolating nucleic acids from
a
biological sample obtained from the subject; (b) amplifying the isolated
nucleic acids;
(c) sequencing the amplified nucleic acid products using at least one suitable
combination of oligonucleotides comprising at least one oligonucleotide as
described
herein (e.g., SEQ >D NOs:I-19) as sequencing primers; and (d) determining the
nucleotide residue at one or more FcyRIl1 polymorphisms, thereby determining
the
FcyRIII genotype of the subject. In certain embodiments, amplification (step
(b)) is
performed using at least first and second combinations of oligonucleotides
comprising
at least one oligonucleotide as described herein as sense and antisense
primers. In any
of the sequencing methods described herein, the genotype at the 158V/F site of
FcyRI)la may be determined, for example by determining the nucleotide at
position
207 (e.g., only G nucleotides at position 207 is indicative of a 158W
genotype; only
T nucleotides only at position 207 is indicative of a 158FF genotype; and G
and T
nucleotides at position 207 is indicative of a 158FV genotype.
In another aspect of the invention, a method of distinguishing FcyRIlla from
FcyRIIIb is provided, the method comprising the steps o~ (a) isolating nucleic
acids
from a biological sample obtained from the subject; (b) amplifying the
isolated
nucleic acids using at least first and second combinations of oligonucleotides
comprising at least one oligonucleotide as described herein (e.g., SEQ )D NOs:
l-19)
as sense and antisense primers, wherein at least one of the oligonucleotide
primers in
each combination is specific for FcyRIIIa or FcyRIIIb; and (c) detecting the
presence
or absence of amplified nucleic acids with each combination of
oligonucleotides,
wherein the presence or absence of amplified nucleic acids is distinguishes
FcyRI>Za
from FcyRIIIb.
In yet another aspect, the invention provides a method of distinguishing
FcyRIlla from FcyRIllb, the method comprising the steps of (a) isolating
nucleic
acids from a biological sample obtained from the subject; (b) amplifying the
isolated
nucleic acids; (c) sequencing the amplified nucleic acids using at least one
suitable
4
CA 02562016 2006-10-02
WO 2005/102379 PCT/US2004/043726
combination of oligonucleotides according to any of claims 1 to 4 as
sequencing
primers; and (d) determining the nucleotides at positions 121, 153, 179 and
313,
thereby distinguishing between FcyRIlla from FcyRIIIb. In certain embodiments,
wherein step (b) comprises amplifying the isolated nucleic acids using at
least first
and second combinations of oligonucleotides comprising at least one of the
oligonucleotides described herein as sense and antisense primers.
In yet another aspect, the invention includes a kit for FcyRIlla genotyping,
the
kit comprising: one or more pairs of primer oligonucleotides comprising at
least one
oligonucleotide as described herein; and written instructions for genotyping a
biological sample for FcYRIIIa. In certain embodiments, the kit further
comprises
sequencing primers, e.g., one or more oligonucleotides as described herein.
In certain embodiments, the methods involve using multiple pairs of
oligonucleotide primers as described herein to determine haplotype.
In any of the methods described herein, the amplification may comprise PCR,
RT-PCR, transcription-mediated amplification (TMA) or TaqManTM, or a
combination thereof.
In further embodiments, the invention is directed to a kit for FcyRIlla
genotyping, the kit comprising: one or more pairs of primer oligonucleotides
as
described herein; and
written instructions for genotyping a biological sample for FcyRIlla.
Sequencing
primers and instructions regarding sequencing may also be included in a kit as
described herein or, alternatively, sequencing reagents and instructions may
be
contained in a separate kit. In additional embodiments, the kits) may further
comprise a polymerase and buffers. In certain embodiments, the kit further
comprises
one or more pairs of sequencing oligonucleotides as described herein.
These and other aspects of the present invention will become evident upon
reference to the following detailed description and attached drawings. In
addition,
various references are set forth herein which describe in more detail certain
procedures or compositions, and are therefore incorporated by reference in
their
entirety.
CA 02562016 2006-10-02
WO 2005/102379 PCT/US2004/043726
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1, panels A and B, depict alignments of nucleotide sequences from
FcyRllIa and FcyRIllb genes. FIG. 1A aligns partial cDNA sequence from
FCyRIIla
(top line, labeled HSFCGR31 and also referred to as gene B) and FcyRlllb
(bottom
line, labeled HSFCGR32 and also referred to as gene A). Also shown in FIG. 1A
in
boxes are: positions indicating gene A or gene B (position 473, 531 and 641)
as well
as the single nucleotide polymorphism (occurring only in gene A) at position
559 that
predicts a V->F substitution. FIG 1 B aligns exon 4 of gene A and gene B and
shows
various nucleotide differences between the two genes, including the highly
specific
nucleotide variation at position 313, numbered relative to the first base of
exon 4.
FIG. 2 depicts the location of exemplary oligonucleotide sequences designated
SEQ ID NOs:I to 5 and their alignment in relation to HSFCGR31 (gene B) and
HSFCGR32 (gene A).
FIG. 3 depicts the location of amplification and sequencing primers as
1 S described herein. Exemplary amplification (PCR) primers are indicated by
the thick,
dark arrows. Polymorphisms occurring in the native sequences are depicted in
the
dark bar (positions numbered relative to the first base of exon 4. Exemplary
sequencing primers are indicated by the thin arrows. The polymorphism
designated
313 (A/C) is numbered relative to the first base of exon 4.
FIG. 4 depicts the location of various primers as described herein (SEQ ID
NOs:6-19), numbered relative to the first base of exon 4.
FIG. S, panels A to D, are reproductions of gels showing PCR amplification
products from the various combinations of primers (SEQ ID NOs:I-S). Each lane
indicates a different combination of primers. From left to right in each
panel, lane 1
shows the result of PCR using primers designated SEQ ID NOs:4 and 1; lane 2
shows
the result of PCR using primers designated SEQ ID NOs:4 and 2; lane 3 shows
the
result of PCR using primers designated SEQ ID NOs:3 and 1; lane 4 shows the
result
of PCR using primers designated SEQ )D NOs:3 and 2; lane 5 shows the result of
PCR using primers designated SEQ ID NOs:S and 1; and lane 6 shows the result
of
PCR using primers designated SEQ )D NOs:S and 2. The presence of an
amplification product in lane 5 and the absence of an amplification product in
lane 6
6
CA 02562016 2006-10-02
WO 2005/102379 PCT/US2004/043726
(Donor 1360, panel A and Donor U03-313, panel D) indicates that the subject's
genotype is 158FF. The absence of an amplification product in lane 5 and the
presence of an amplification product in lane 6 (Donor 1714, panel B) indicates
that the
subject's genotype is 158W. The presence of amplification products in both
lanes 5
and 6 (Donor 1210, panel C) indicates the subject's genotype is 158 FV.
FIG. 6 depicts results of genotyping of 80 samples as described herein (e.g.,
PCR followed by sequencing). The middle column of each table shows genotypic
results obtained using PCR-sequencing assays described herein. The right
column of
each table (labeled "Koene") indicates genotyping results obtained with
methods
described in the art.
FIG. 7 depicts the sequences of exemplary oligonucleotide as described herein.
FIG. 8 depicts the sequences of other exemplary oligonucleotide as described
herein.
FIG. 9 is a schematic depiction of a 96-well plate for PCR that contains 2
1 S columns of 8 wells each of 6 different primer combinations.
FIG. 10 is a schematic depiction of addition of a 96-well plate genotyping
assay using the plate depicted in FIG. 9. Three controls and thirteen patient
samples
are screened against the six different primer combinations.
FIG. 11 depicts the reference sequence used for PCR-sequencing assays.
DETAILED DESCRIPTION
The practice of the present invention will employ, unless otherwise indicated,
conventional methods of chemistry, biochemistry, recombinant DNA techniques
and
virology, within the skill of the art. Such techniques are explained fully in
the
literature. See, e.g., A.L. Lehninger, Biochemistry (Worth Publishers, Inc.,
current
addition); Sambrook, et al., Molecular Cloning: A Laboratory Manual (2nd
Edition,
1989); Methods In Enrymology (S. Colowick and N. Kaplan eds., Academic Press,
Inc.); Oligonucleotide Synthesis (N. Gait, ed., 1984); A Practical Guide to
Molecular
Cloning (1984).
All publications, patents and patent applications cited herein, whether supra
or
infra, are hereby incorporated by reference in their entirety.
7
CA 02562016 2006-10-02
WO 2005/102379 PCT/US2004/043726
It must be noted that, as used in this specification and the appended claims,
the
singular forms "a", "an" and "the" include plural referents unless the content
clearly
dictates otherwise. Thus, for example, reference to "an oligonucleotide"
includes a
mixture of two or more oligonucleotides, and the like.
S The following amino acid abbreviations are used throughout the text:
Alanine: Ala (A) Arginine: Arg
(R)
Asparagine: Asn (N) Aspartic acid:
Asp (D)
Cysteine: Cys (C) Glutamine: Gln
(Q)
Glutamic acid: Glu (E) Glycine: Gly (G)
Histidine: His (H) Isoleucine: Ile
(I)
Leucine: Leu (L) Lysine: Lys (K)
Methionine: Met (M) Phenylalanine:
Phe (F)
Proline: Pro (P) Serine: Ser (S)
Threonine: Thr (T) Tryptophan: Trp
(W)
Tyrosine: Tyr (Y) Valine: Val (V)
T Tlo~..:4:......,
In describing the present invention, the following terms will be employed, and
are intended to be defined as indicated below.
The terms "genotyping," "haplotyping," and "DNA typing" are used
interchangeably to refer to the determination of the alleles of a selected
chromosome
or portion of a chromosome of an individual.
By "isolated" is meant, when refernng to a polypeptide, that the indicated
molecule is separate and discrete from the whole organism with which the
molecule is
found in nature or is present in the substantial absence of other biological
macro-
molecules of the same type. The term "isolated" with respect to a
polynucleotide is a
nucleic acid molecule devoid, in whole or part, of sequences normally
associated with
it in nature; or a sequence, as it exists in nature, but having heterologous
sequences in
association therewith; or a molecule disassociated from the chromosome.
The terms "polynucleotide," "oligonucleotide," "nucleic acid" and "nucleic
acid molecule" are used herein to include a polymeric form of nucleotides of
any
8
CA 02562016 2006-10-02
WO 2005/102379 PCT/US2004/043726
length, either ribonucleotides or deoxyribonucleotides. This term refers only
to the
primary structure of the molecule. Thus, the term includes triple-, double-
and single-
stranded DNA, as well as triple-, double- and single-stranded RNA. It also
includes
modifications, such as by methylation and/or by capping, and unmodified forms
of the
polynucleotide. More particularly, the terms "polynucleotide,"
"oligonucleotide,"
"nucleic acid" and "nucleic acid molecule" include polydeoxyribonueleotides
(containing 2-deoxy-D-ribose), polyribonucleotides (containing D-ribose), any
other
type of polynucleotide which is an N- or C-glycoside of a purine or pyrimidine
base,
and other polymers containing nonnucleotidic backbones, for example, polyamide
(e.g., peptide nucleic acids (PNAs)) and polymorpholino (commercially
available
from the Anti-Virals, Inc., Corvallis, Oregon, as Neugene) polymers, and other
synthetic sequence-specific nucleic acid polymers providing that the polymers
contain
nucleobases in a configuration which allows for base pairing and base
stacking, such
as is found in DNA and RNA. There is no intended distinction in length between
the
1 S terms "polynucleotide," "oligonucleotide," "nucleic acid" and "nucleic
acid
molecule," and these terms will be used interchangeably. These terms refer
only to
the primary structure of the molecule. Thus, these terms include, for example,
3'-
deoxy-2', 5'-DNA, oligodeoxyribonucleotide N3' P5' phosphoramidates, 2'-O-
alkyl-
substituted RNA, double- and single-stranded DNA, as well as double- and
single-
stranded RNA, DNA:RNA hybrids, and hybrids between PNAs and DNA or RNA,
and also include known types of modifications, for example, labels which are
known
in the art, methylation, "caps," substitution of one or more of the naturally
occurring
nucleotides with an analog, internucleotide modifications such as, for
example, those
with uncharged linkages (e.g., methyl phosphonates, phosphotriesters,
phosphoramidates, carbamates, etc.), with negatively charged linkages (e.g.,
phosphorothioates, phosphorodithioates, etc.), and with positively charged
linkages
(e.g., aminoalklyphosphoramidates, aminoalkylphosphotriesters), those
containing
pendant moieties, such as, for example, proteins (including nucleases, toxins,
antibodies, signal peptides, poly-L-lysine, etc.), those with intercalators
(e.g., acridine,
psoralen, etc.), those containing chelators (e.g., metals, radioactive metals,
boron,
oxidative metals, etc.), those containing alkylators, those with modified
linkages (e.g.,
9
CA 02562016 2006-10-02
WO 2005/102379 PCT/US2004/043726
alpha anomeric nucleic acids, etc.), as well as unmodified forms of the
polynucleotide
or oligonucleotide. In particular, DNA is deoxyribonucleic acid.
A polynucleotide "derived from" or "specific for" a designated sequence refers
to a polynucleotide sequence which comprises a contiguous sequence of
approximately at least about 6 nucleotides, preferably at least about 8
nucleotides,
more preferably at least about 10-12 nucleotides, and even more preferably at
least
about 15-20 nucleotides corresponding, i.e., identical or complementary to, a
region of
the designated nucleotide sequence. The derived polynucleotide will not
necessarily
be derived physically from the nucleotide sequence of interest, but may be
generated
in any manner, including, but not limited to, chemical synthesis, replication,
reverse
transcription or transcription, which is based on the information provided by
the
sequence of bases in the regions) from which the polynucleotide is derived. As
such,
it may represent either a sense or an antisense orientation of the original
polynucleotide.
"Homology" refers to the percent similarity between two polynucleotide or
two polypeptide moieties. Two polynucleotide, or two polypeptide sequences are
"substantially homologous" to each other when the sequences exhibit at least
about
SO% , preferably at least about 75%, more preferably at least about 80%-85%,
preferably at least about 90%, and most preferably at least about 95%-98%
sequence
similarity over a defined length of the molecules. As used herein,
substantially
homologous also refers to sequences showing complete identity to the specified
polynucleotide or polypeptide sequence.
In general, "identity" refers to an exact nucleotide-to-nucleotide or amino
acid-
to-amino acid correspondence of two polynucleotides or polypeptide sequences,
respectively. Percent identity can be determined by a direct comparison of the
sequence information between two molecules by aligning the sequences, counting
the
exact number of matches between the two aligned sequences, dividing by the
length of
the shorter sequence, and multiplying the result by 100.
Readily available computer programs can be used to aid in the analysis of
homology and identity, such as ALIGN, Dayhoff, M.O. in Atlas of Protein
Sequence
and Structure M.O. Dayhoff ed., 5 Suppl. 3:353-358, National biomedical
Research
CA 02562016 2006-10-02
WO 2005/102379 PCT/US2004/043726
Foundation, Washington, DC, which adapts the local homology algorithm of Smith
and Waterman Advances in Appl. Math. 2:482-489, 1981 for peptide analysis.
Programs for determining nucleotide sequence homology are available in the
Wisconsin Sequence Analysis Package, Version 8 (available from Genetics
Computer
Group, Madison, W)) for example, the BESTFIT, FASTA and GAP programs, which
also rely on the Smith and Waterman algorithm. These programs are readily
utilized
with the default parameters recommended by the manufacturer and described in
the
Wisconsin Sequence Analysis Package referred to above. For example, percent
homology of a particular nucleotide sequence to a reference sequence can be
determined using the homology algorithm of Smith and Waterman with a default
scoring table and a gap penalty of six nucleotide positions.
Another method of establishing percent homology in the context of the present
invention is to use the MPSRCH package of programs copyrighted by the
University
of Edinburgh, developed by John F. Collins and Shane S. Sturrok, and
distributed by
IntelliGenetics, Inc. (Mountain View, CA). From this suite of packages the
Smith-
Waterman algorithm can be employed where default parameters are used for the
scoring table (for example, gap open penalty of 12, gap extension penalty of
one, and
a gap of six). From the data generated the "Match" value reflects "sequence
homology." Other suitable programs for calculating the percent identity or
similarity
between sequences are generally known in the art, for example, another
alignment
program is BLAST, used with default parameters. For example, BLASTN and
BLASTP can be used using the following default parameters: genetic code =
standard;
filter = none; strand = both; cutoff = 60; expect = 10; Matrix = BLOSUM62;
Descriptions = 50 sequences; sort by = HIGH SCORE; Databases = non-redundant,
GenBank + EMBL + DDBJ + PDB + GenBank CDS translations + Swiss protein +
Spupdate + PIR. Details of these programs can be found at the following
Internet
address: http://www.ncbi.nlm.gov/cgi-binBLAST.
Alternatively, homology can be determined by hybridization of
polynucleotides under conditions that form stable duplexes between homologous
regions, followed by digestion with single-stranded-specific nuclease(s), and
size
determination of the digested fragments. DNA sequences that are substantially
11
CA 02562016 2006-10-02
WO 2005/102379 PCT/US2004/043726
homologous can be identified in a Southern hybridization experiment under, for
example, stringent conditions, as defined for that particular system. Defining
appropriate hybridization conditions is within the skill of the art. See,
e.g., Sambrook
et al., supra; DNA Cloning, supra; Nucleic Acid Hybridization, supra.
"Recombinant" as used herein to describe a nucleic acid molecule means a
polynucleotide of genomic, cDNA, viral, semisynthetic, or synthetic origin,
which, by
virtue of its origin or manipulation, is not associated with all or a portion
of the
polynucleotide with which it is associated in nature. The term "recombinant"
as used
with respect to a protein or polypeptide means a polypeptide produced by
expression
of a recombinant polynucleotide. In general, the gene of interest is cloned
and then
expressed in transformed organisms, as described further below. The host
organism
expresses the foreign gene to produce the protein under expression conditions.
A "DNA-dependent DNA polymerise" is an enzyme that synthesizes a
complementary DNA copy from a DNA template. Examples are DNA polymerise I
1 S from E. coli and bacteriophage T7 DNA polymerise. All known DNA-dependent
DNA polymerises require a complementary primer to initiate synthesis. Under
suitable conditions, a DNA-dependent DNA polymerise may synthesize a
complementary DNA
copy from an RNA template.
A "DNA-dependent RNA polymerise" or a "transcriptase" is an enzyme that
synthesizes multiple RNA copies from a double-stranded or partially-double
stranded
DNA molecule having a (usually double-stranded) promoter sequence. The
RNA molecules ("transcripts") are synthesized in the 5' to 3' direction
beginning at a
specific position just downstream of the promoter. Examples of transcriptases
are the
DNA-dependent RNA polymerise from E. coli and bacteriophages T7, T3, and SP6.
An "RNA-dependent DNA polymerise" or "reverse transcriptase" is an
enzyme that synthesizes a complementary DNA copy from an RNA template. All
known reverse
transcriptases also have the ability to make a complementary DNA copy from a
DNA
template; thus, they are both RNA- and DNA-dependent DNA polymerises. A primer
is required to initiate synthesis with both RNA and DNA templates.
12
CA 02562016 2006-10-02
WO 2005/102379 PCT/US2004/043726
"RNAse H" is an enzyme that degrades the RNA portion of an RNA:DNA
duplex. These enzymes may be endonucleases or exonucleases. Most reverse
transcriptase enzymes normally contain an RNAse H activity in addition to
their
polymerase activity. However, other sources of the RNAse H are available
without an
associated polymerase activity. The degradation may result in separation of
RNA
from a RNA:DNA complex. Alternatively, the RNAse H may simply cut the RNA at
various locations such that portions of the RNA melt off or permit enzymes to
unwind
portions of the RNA.
As used herein, the term "target nucleic acid region" or "target nucleic acid"
denotes a nucleic acid molecule with a "target sequence" to be amplified. The
target
nucleic acid may be either single-stranded or double-stranded and may include
other
sequences besides the target sequence, which may not be amplified. The term
"target
sequence" refers to the particular nucleotide sequence of the target nucleic
acid that is
to be amplified. The target sequence may include a probe-hybridizing region
contained within the target molecule with which a probe will form a stable
hybrid
under desired conditions. The "target sequence" may also include the
complexing
sequences to which the oligonucleotide primers complex and extended using the
target sequence as a template. Where the target nucleic acid is originally
single-stranded, the term "target sequence" also refers to the sequence
complementary
to the "target sequence" as present in the target nucleic acid. If the "target
nucleic
acid" is originally double-stranded, the term "target sequence" refers to both
the plus
(+) and minus (-) strands.
The term "primer" or "oligonucleotide primer" as used herein, refers to an
oligonucleotide which acts to initiate synthesis of a complementary nucleic
acid strand
when placed under conditions in which synthesis of a primer extension product
is
induced, i.e., in the presence of nucleotides and a polymerization-inducing
agent such
as a DNA or RNA polymerase and at suitable temperature, pH, metal
concentration,
and salt concentration. The primer is preferably single-stranded for maximum
ef
ficiency in amplification, but may alternatively be double-stranded. If
double-stranded, the primer can first be treated to separate its strands
before being
used to prepare extension products. This denaturation step is typically
affected by
13
CA 02562016 2006-10-02
WO 2005/102379 PCT/US2004/043726
heat, but may alternatively be carned out using alkali, followed by
neutralization.
Thus, a "primer" is complementary to a template, and complexes by hydrogen
bonding or hybridization with the template to give a primer/template complex
for
initiation of synthesis by a polymerase, which is extended by the addition of
covalently bonded bases linked at its 3' end complementary to the template in
the
process of DNA or RNA synthesis.
As used herein, the term "probe" or "oligonucleotide probe" refers to a
structure comprised of a polynucleotide, as defined above, that contains a
nucleic acid
sequence complementary to a nucleic acid sequence present in the target
nucleic acid
analyte. The polynucleotide regions of probes may be composed of DNA, and/or
RNA, and/or synthetic nucleotide analogs. When an "oligonucleotide probe" is
to be
used in a 5' nuclease assay, such as the TaqManTM technique, the probe will
contain at
least one fluorescer and at least one quencher that is digested by the 5'
endonuclease
activity of a polymerase used in the reaction in order to detect any amplified
target
oligonucleotide sequences. In this context, the oligonucleotide probe will
have a
sufficient number of phosphodiester linkages adjacent to its 5' end so that
the 5' to 3'
nuclease activity employed can efficiently degrade the bound probe to separate
the
fluorescers and quenchers. When an oligonucleotide probe is used in the TMA
technique, it will be suitably labeled, as described below.
It will be appreciated that the hybridizing sequences need not have perfect
complementarity to provide stable hybrids. In many situations, stable hybrids
will
form where fewer than about 10% of the bases are mismatches, ignoring loops of
four
or more nucleotides. Accordingly, as used herein the term "complementary"
refers to
an oligonucleotide that forms a stable duplex with its "complement" under
assay
conditions, generally where there is about 90% or greater homology.
The terms "hybridize" and "hybridization" refer to the formation of complexes
between nucleotide sequences which are sufficiently complementary to form
complexes via Watson-Crick base pairing. Where a primer "hybridizes" with
target
(template), such complexes (or hybrids) are sufficiently stable to serve the
priming
function required by, e.g., the DNA polymerase to initiate DNA synthesis.
As used herein, the term "binding pair" refers to first and second molecules
14
CA 02562016 2006-10-02
WO 2005/102379 PCT/US2004/043726
that specifically bind to each other, such as complementary polynucleotide
pairs
capable of forming nucleic acid duplexes. "Specific binding" of the first
member of
the binding pair to the second member of the binding pair in a sample is
evidenced by
the binding of the first member to the second member, or vice versa, with
greater
affinity and specificity than to other components in the sample. The binding
between
the members of the binding pair is typically noncovalent. Unless the context
clearly
indicates otherwise, the terms "affinity molecule" and "target analyte" are
used herein
to refer to first and second members of a binding pair, respectively.
The terms "specific-binding molecule" and "affinity molecule" are used
interchangeably herein and refer to a molecule that will selectively bind,
through
chemical or physical means to a detectable substance present in a sample. By
"selectively bind" is meant that the molecule binds preferentially to the
target of
interest or binds with greater affinity to the target than to other molecules.
For
example, a DNA molecule will bind to a substantially complementary sequence
and
not to unrelated sequences.
The "melting temperature" or "Tin" of double-stranded DNA is defined as the
temperature at which half of the helical structure of DNA is lost due to
heating or
other dissociation of the hydrogen bonding between base pairs, for example, by
acid
or alkali treatment, or the like. The Tm of a DNA molecule depends on its
length and
on its base composition. DNA molecules rich in GC base pairs have a higher Tm
than
those having an abundance of AT base pairs. Separated complementary strands of
DNA spontaneously reassociate or anneal to form duplex DNA when the
temperature
is lowered below the Tm. The highest rate of nucleic acid hybridization occurs
approximately 25°C below the Tm. The Tm may be estimated using the
following
relationship: Tm = 69.3 + 0.41 (GC)% (Marmur et al. ( 1962) J. Mol. Biol.
5:109-118).
As used herein, the terms "label" and "detectable label" refer to a molecule
capable of detection, including, but not limited to, radioactive isotopes,
fluorescers,
chemiluminescers, chromophores, enzymes, enzyme substrates, enzyme cofactors,
enzyme inhibitors, chromophores, dyes, metal ions, metal sols, semiconductor
nanocrystals, ligands (e.g., biotin, avidin, strepavidin or haptens) and the
like. The
term "fluorescer" refers to a substance or a portion thereof that is capable
of
CA 02562016 2006-10-02
WO 2005/102379 PCT/US2004/043726
exhibiting fluorescence in the detectable range.
As used herein, a "solid support" refers to a solid surface such as a magnetic
bead, latex bead, microtiter plate well, glass plate, nylon, agarose,
acrylamide, and the
like.
As used herein, a "biological sample" refers to a sample of tissue or fluid
isolated from a subject such as, but not limited to, blood, plasma, serum,
fecal matter,
urine, bone marrow, bile, spinal fluid, lymph fluid, samples of the skin,
secretions of
the skin, respiratory, intestinal, and genitourinary tracts, tears, saliva,
milk, blood
cells, organs, biopsies and also samples of in vitro cell culture constituents
including
but not limited to conditioned media resulting from the growth of cells and
tissues in
culture medium, e.g., recombinant cells, and cell components. The samples
detailed
above need not necessarily be in the form obtained directly from the source.
For
example, the sample can be treated prior to use, such as, for example, by
heating,
centrifuging, etc. prior to analysis.
By "vertebrate subject" is meant any member of the subphylum cordata,
including, without limitation, mammals such as horses, and humans, and avian
species. The term does not denote a particular age. Thus, adult and newborn
animals,
as well as fetuses, are intended to be covered.
II. General Overview
A variety of compositions and methods are provided herein for determining
the FcyRllI genotype of a subject. In particular, novel oligonucleotides
(e.g., primers)
are described that can be used to determine a subject's genotype at the 158V/F
site of
Fc~yRIIIa (gene A). The accuracy of the assays described herein derived, in
part, from
the fact that the compositions and methods described herein are able to
clearly
distinguish between gene A and gene B. Although both gene A and gene B map to
chromosome l, the present disclosure conclusively demonstrates that gene B
does not
include the 158V/F polymorphism, but, rather is, always W homozygous.
Also described are methods for FcyRIII genotyping involving use of one or
more of the oligonucleotides described herein. FcyRIIIa genotype at the 158F/V
site
may be determined by a single PCR reaction (e.g., one set of primers); by
evaluating
16
CA 02562016 2006-10-02
WO 2005/102379 PCT/US2004/043726
multiple PCR reactions (e.g., different combinations of primers); and/or by
single or
multiple PCR reactions followed by sequencing or other nucleic acid based
assay
technique.
Using the compositions and methods described herein, a particular individual
can readily be genotyped, for example to better detenmine a treatment
protocol. Thus,
pharmacogenetic analyses of any subject can be readily performed.
Before describing the present invention in detail, it is to be understood that
this
invention is not limited to particular formulations or process parameters as
such may,
of course, vary. It is also to be understood that the terminology used herein
is for the
purpose of describing particular embodiments of the invention only, and is not
intended to be limiting.
Although a number of compositions and methods similar or equivalent to
those described herein can be used in the practice of the present invention,
the
preferred materials and methods are described herein.
III. Oli~onucleotides
Described herein are novel nucleotide sequences that are useful in determining
the FcYRIII haplotype of an individual. Furthermore, the primer sequences
described
herein have been used to accurately distinguish between FcyRIIIA (gene A) and
FcyRIIIB (gene B).
For convenience, the numbering and alignment of primers recognizing coding
sequences (cDNA) of both genes A and B is done relative to Ravetch and
Perussia
(1989) J. Exp Med 170:481 and NCBI Accession No. NM_000569. Likewise, the
numbering and alignment of primers recognizing genomic DNA is done relative to
the
first base of exon 4
The sequences described herein are generally useful as primers, for example
PCR primers and/or sequencing primers. As noted in Table 1, the primers may be
non-specific or specific for gene A or gene B and, additionally, may also be
specific
for one or more polymorphisms, preferably, the 158F/V single nucleotide
polymorphism. (FIG. 1). In certain embodiments, the oligonucleotides will also
amplify sequences that include one or more additional polymorphisms, for
example as
17
CA 02562016 2006-10-02
WO 2005/102379 PCT/US2004/043726
depicted in FIG. 2. Non-limiting examples of such sequences are shown in Table
1.
Table 1
Name Sequence Seq Specificity
Id
158-3'A CTGAAGACACATTTTTACTCCCAAA 1 158F
158-3'C CTGAAGACACATTTTTACTCCCAAC 2 158V
158-5'T TCCAAAAGCCACACTCAAAGAT 3 gene B
158-5'A TTCCAAAAGCCACACTCAAAGA 4 no
158-5'C TCCAAAAGCCACACTCAAAGAC 5 gene A
forward GGGTGTCTGTGTCTTTCAG 6 no
cp13297
forward CTTTCAGGCTGGCTGTTGCT 7 no
cp13462
forward AGGCTGGCTGTTGCTCCA 8 no
cp13463
reverse CCGGCATTCCAGGGTGGCACAT 9 no
cp13928
reverse TCAGGAATCTCCTCCCAACTCA 10 no
cp13466
reverse AATCTCCTCCCAACTCAACTTCC 11 no
cp13465
forward TTTCATCATAATTCTGACATCT 12 gene A
cp13560
forward TTTTCATCATAATTCTGACATCT 13 gene A
cp13561
reverse CAACTCAACTTCCCAGTGTAAT 14 gene A
cp13516
reverse CAACTCAACTTCCCAGTGTGTT 15 gene A
cp13515
reverse CTTCTCAACTTCCCAGTATGAT 16 gene A
cp13517
18
CA 02562016 2006-10-02
WO 2005/102379 PCT/US2004/043726
forward ATATTACAGAATGGCACAGA 17 gene B
cp13452
reverse CAACTCAACTTCCCAGTGAGAG 18 gene B
cp13497
reverse CAACTCAACTTCCCAGTGTGAG 19 gene B
cp13496
Therefore, the oligonucleotides described herein preferably include one or
more nucleotides defining polymorphisms (e.g., 158F/V polymorphism) and/or
nucleotides that distinguish gene A from gene B. Preferably, the primers used
amplify
a sequence including at least the 158F/V polymorphism. In certain embodiments,
the
primers used amplify a sequence including multiple polymorphisms. For example,
as
shown in FIG. 3, primers that amplify sequences that include, but not
necessarily
limited to, polymorphisms at position 121 (G/A), 153 (T/C), 179 (C/T), 207
(G/T),
and 313 (C/A), as numbered relative to the first base in exon 4. The first
four
positions correspond to positions 473 (G/A), 505 (T/C), 531 (C/T) and 559
(G/T), as
numbered relative to NM 000569).
Furthermore, as described in detail in the Examples below, the present
disclosure also marks the discovery that a single nucleotide (A/C) difference
at
position 313, numbered relative to the first base of exon 4 is highly specific
for gene
A or gene B. In particular, in gene A, an A residue is always found at this
position,
while in gene B, a C residue is always found at this position. Thus, in
certain
embodiments, the primer will include this residue and, accordingly, be
specific for
gene A or gene B.
In certain embodiments, the distinguishing base (e.g., polymorphism and/or
gene A- or B-specific base) is the terminal base of the oligonucleotide
(primer)
sequence. For example, as depicted in FIG. 2, the 3' nucleotide in 3' primer
158-3'A
(SEQ ID NO:1 ) is specific for the 158F haplotype (e.g., T as position 559)
while the 3'
nucleotide in 3'-primer 158-3'C (SEQ >D N0:2) is specific for the 158V
haplotype
(e.g., G at position 559). Similarly, the 5' nucleotide in 3' primer 5'T (SEQ
>D N0:3)
is specific for gene B (T at position 531 ) while the 3' nucleotide in 5'
primer 5'C (SEQ
19
CA 02562016 2006-10-02
WO 2005/102379 PCT/US2004/043726
ID N0:5) is specific for gene A (C at position 531). 5' primer 5'A (SEQ )D
N0:4) is
generic to both gene A and gene B, as it ends at position 530.
The primers as disclosed herein may also include one or more mismatches
with native gene A or gene B sequences. In certain instances, introduction of
a
mismatched base pair provides enhanced specificity for gene. Mismatches are
preferably internal to the primer. Particularly useful oligonucleotides
comprise the
nucleotide sequences of the various oligonucleotides depicted in,
respectively), or
sequences displaying at least about 80-90% or more sequence identity thereto,
including any percent identity within these ranges, such as 81, 82, 83, 84,
85, 86, 87,
88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% sequence identity thereto. As
explained
above, the regions from which the oligonucleotides are derived generally
include one
or more polymorphisms. In addition, the oligonucleotides can be derivatized
using
methods well known in the art in order to improve the affinity of binding to
the target
nucleic acid.
The particular length of the oligonucleotide primer is not critical and can be
readily designed by those of skill in the art. The oligonucleotides can
include from
about 5 to about 500 nucleotides of the particular conserved region,
preferably about
10 to about 100 nucleotides, or more preferably about 10 to about 60
nucleotides, or
any integer within these ranges, such as a sequence including 18, 19, 20, 21,
22, 23,
24, 25, 26...35...40, etc. nucleotides from the conserved region of interest.
Preferably,
the primer sequences are at least 10 nucleotides in length, more preferably
between
about 15 and 30 nucleotides in length (including nucleotides of 15, 16, 17,
18, 19, 20,
21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length), and even more
preferably between about 15 and 25 nucleotides in length.
Oligonucleotides as described herein (e.g., primers and probes) are readily
synthesized by standard techniques, e.g., solid phase synthesis via
phosphoramidite
chemistry, as disclosed in U.S. Patent Nos. 4,458,066 and 4,415,732,
incorporated
herein by reference in their entireties; Beaucage et al. (1992) Tetrahedron
48:2223-
2311; and Applied Biosystems User Bulletin No. 13 (1 April 1987). Other
chemical
synthesis methods include, for example, the phosphotriester method described
by
Narang et al., Meth. Enzymol. (1979) 68:90 and the phosphodiester method
disclosed
CA 02562016 2006-10-02
WO 2005/102379 PCT/US2004/043726
by Brown et al., Meth. Enzymol. (1979) 68:109. Poly A or poly C, or other non-
complementary nucleotide extensions may be incorporated into probes using
these
same methods. Hexaethylene oxide extensions may be coupled to probes by
methods
known in the art. Cload et al. (1991) J. Am. Chem. Soc. 113:6324-6326; U.S.
Patent
S No. 4,914,210 to Levenson et al.; Durand et al. (1990) Nucleic Acids Res.
18:6353-
6359; and Horn et al. (1986) Tet. Lett. 27:4705-4708.
Moreover, the oligonucleotides may be coupled to labels for detection. There
are several means known for derivatizing oligonucleotides with reactive
functionalities that permit the addition of a label. For example, several
approaches are
available for biotinylating probes so that radioactive, fluorescent,
chemiluminescent,
enzymatic, or electron dense labels can be attached via avidin. See, e.g.,
Broken et al.,
Nucl. Acids Res. (1978) 5:363-384 that discloses the use of ferritin-avidin-
biotin
labels; and Chollet et al. Nucl. Acids Res. (1985) 13:1529-1541 which
discloses
biotinylation of the 5' termini of oligonucleotides via an
aminoalkylphosphoramide
linker arm. Several methods are also available for synthesizing amino-
derivatized
oligonucleotides which are readily labeled by fluorescent or other types of
compounds
derivatized by amino-reactive groups, such as isothiocyanate, N-
hydroxysuccinimide,
or the like, see, e.g., Connolly (1987) Nucl. Acids Res. 15:3131-3139, Gibson
et al.
(1987) Nucl. Acids Res. 15:6455-6467 and U.S. Patent No. 4,605,735 to Miyoshi
et al.
Methods are also available for synthesizing sulfhydryl-derivatized
oligonucleotides
that can be reacted with thiol-specific labels, see, e.g., U.S. Patent No.
4,757,141 to
Fung et al., Connolly et al. (1985) Nucl. Acids Res. 13:4485-4502 and Spoat et
al.
(1987) Nucl. Acids Res. 15:4837-4848. A comprehensive review of methodologies
for labeling DNA fragments is provided in Matthews et al., Anal. Biochem.
(1988)
169:1-25.
For example, oligonucleotides may be fluorescently labeled by linking a
fluorescent molecule to the non-ligating terminus of the probe. Guidance for
selecting
appropriate fluorescent labels can be found in Smith et al., Meth. Enrymol.
(1987)
155:260-301; Karger et al., Nucl. Acids Res. (1991) 19:4955-4962; Haugland
(1989)
Handbook of Fluorescent Probes and Research Chemicals (Molecular Probes, Inc.,
Eugene, OR). Preferred fluorescent labels include fluorescein and derivatives
thereof,
21
CA 02562016 2006-10-02
WO 2005/102379 PCT/US2004/043726
such as disclosed in U.S. Patent No. 4,318,846 and Lee et al., Cytometry
(1989)
10:151-164, and 6-FAM, JOE, TAMRA, ROX, HEX-1, HEX-2, ZOE, TET-1 or
NAN-2, and the like.
Additionally, oligonucleotides can be labeled with an acridinium ester (AE)
S using the techniques described below. Current technologies allow the AE
label to be
placed at any location within the probe. See, e.g., Nelson et al. (1995)
"Detection of
Acridinium Esters by Chemiluminescence" in Nonisotopic Probing, Blotting and
Sequencing, Kricka L.J.(ed) Academic Press, San Diego, CA; Nelson et al.
(1994)
"Application of the Hybridization Protection Assay (HPA) to PCR" in The
Polymerase Chain Reaction, Mullis et al. (eds.) Birkhauser, Boston, MA; Weeks
et
al., Clin. Chem. (1983) 29:1474-1479; Berry et al., Clin. Chem. (1988) 34:2087-
2090.
An AE molecule can be directly attached to the probe using non-nucleotide-
based
linker arm chemistry that allows placement of the label at any location within
the
probe. See, e.g., U.S. Patent Nos. 5,585,481 and 5,185,439.
IV. Nucleic Acid Based Assays
One or more of the oligonoucleotides described herein are then used in one or
more nucleic acid based assays in order to determine FcYR)TI haplotype, for
example
FcyRI>Za haplotype at the 158V/F polymorphism.
Genotyping can be performed on any suitable sample. For instance, nucleic
acids can be readily isolated from cells expressing FcyRllI using by standard
techniques such as guanidium thiocyanate-phenol-chloroform extraction
(Chomocyznski et al. (1987) Anal. Biochem. 162:156). RNA and/or genomic DNA
can be isolated. The isolated nucleic acids (RNA or DNA) are then preferably
subjected to amplification.
Amplifying a target nucleic acid typically uses a nucleic acid polymerase to
produce multiple copies of the target nucleic acid or fragments thereof.
Suitable
amplification techniques are well known in the art, such as, for example
transcription
mediated amplification, polymerase chain reaction (PCR), replicase mediated
amplification, and ligase chain reaction (LCR).
22
CA 02562016 2006-10-02
WO 2005/102379 PCT/US2004/043726
A. Polymerase Chain Reaction~PC>~
In certain embodiments, the amplification process comprises a polymerase
chain reaction (PCR)-based technique, such as RT-PCR, to determine the FcRIII
haplotype in any biological sample. PCR is a technique for amplifying a
desired
target nucleic acid sequence contained in a nucleic acid molecule or mixture
of
molecules. In PCR, a pair of primers is employed in excess to hybridize to the
complementary strands of the target nucleic acid. The primers are each
extended by a
polymerase using the target nucleic acid as a template. The extension products
become target sequences themselves after dissociation from the original target
strand.
New primers are then hybridized and extended by a polymerase, and the cycle is
repeated to geometrically increase the number of target sequence molecules.
T'he PCR
method for amplifying target nucleic acid sequences in a sample is well known
in the
art and has been described in, e.g., Innis et al. (eds.) PCR Protocols
(Academic Press,
NY 1990); Taylor (1991) Polymerase chain reaction: basic principles and
automation, in PCR: A Practical Approach, McPherson et al. (eds.) IRL Press,
Oxford; Saiki et al. (1986) Nature 324:163; as well as in U.S. Patent Nos.
4,683,195,
4,683,202 and 4,889,818, all incorporated herein by reference in their
entireties.
In particular, PCR uses relatively short oligonucleotide primers which flank
the target nucleotide sequence to be amplified, oriented such that their 3'
ends face
each other, each primer extending toward the other. The polynucleotide sample
is
extracted and denatured, preferably by heat, and hybridized with first and
second
primers that are present in molar excess. Polymerization is catalyzed in the
presence
of the four deoxyribonucleotide triphosphates (dNTPs -- dATP, dGTP, dCTP and
dTTP) using a primer- and template-dependent polynucleotide polymerizing
agent,
such as any enzyme capable of producing primer extension products, for
example, E.
coli DNA polymerase I, Klenow fragment of DNA polymerase I, T4 DNA
polymerase, thermostable DNA polymerases isolated from Thermus aquaticus
(Taq),
available from a variety of sources (for example, Perkin Elmer), Thermus
thermophilus (United States Biochemicals), Bacillus stereothermophilus (Bio-
Rad), or
Thermococcus litoralis ("Vent" polymerase, New England Biolabs). This results
in
two "long products" which contain the respective primers at their 5' ends
covalently
23
CA 02562016 2006-10-02
WO 2005/102379 PCT/US2004/043726
linked to the newly synthesized complements of the original strands. The
reaction
mixture is then returned to polymerizing conditions, e.g., by lowering the
temperature,
inactivating a denaturing agent, or adding more polymerase, and a second cycle
is
initiated. The second cycle provides the two original strands, the two long
products
from the first cycle, two new long products replicated from the original
strands, and
two "short products" replicated from the long products. The short products
have the
sequence of the target sequence with a primer at each end. On each additional
cycle,
an additional two long products are produced, and a number of short products
equal to
the number of long and short products remaining at the end of the previous
cycle.
Thus, the number of short products containing the target sequence grows
exponentially with each cycle. Preferably, PCR is carned out with a
commercially
available thermal cycler, e.g., Perkin Elmer.
RNAs may be amplified by reverse transcribing the mRNA into cDNA, and
then performing PCR (RT-PCR), as described above. Alternatively, a single
enzyme
may be used for both steps as described in U.S. Patent No. 5,322,770. mRNA may
also be reverse transcribed into cDNA, followed by asymmetric gap ligase chain
reaction (RT-AGLCR) as described by Marshall et al. (1994) PCR Meth. App. 4:80-
84. Particular PCR conditions (e.g., temperature, cycling time, etc.) are not
critical to
the practice of the invention can be readily determined by one skilled in the
art.
In certain embodiments, genotyping accuracy is achieved by a single PCR
reaction, through the judicious design and selection of primers. For instance,
the
sequences resulting from PCR amplification using primers that amplify
sequences
including the polymorphism at position 559 and the gene specific polymorphism
at
position 313 (numbered relative to the first base of exon 4) typically
provides
sufficient information for determining 158V/F haplotype and for distinguishing
gene
A from gene B.
For PCR-based techniques, it may be preferable in certain instances to use
primers that include multiple polymorphisms. The inclusion of multiple
polymorphisms provides built-in internal controls. The primers selected may
amplify
gene A or gene B only, or alternatively, may amplify sequences from both
genes.
Representative examples of a single pair of primer combinations that can be
used are
24
CA 02562016 2006-10-02
WO 2005/102379 PCT/US2004/043726
shown in FIG. 7 (SEQ ID NOs:I-11) and include, for example, combinations of
one
of SEQ )D NOs:6, 7 or 8 with one of SEQ ID NOs:9, 10 or 11 or combinations of
one
of SEQ ID NOs: l or 2, with one of SEQ ID NOs:3, 4 or 5.
Furthermore, although amplification of DNA samples obtained from the
subject using one suitable pair of primers disclosed in Table 1 may itself be
sufficient
to determine genotype, the present disclosure also provides for additional
assays that
enhance genotyping accuracy, including additional PCR and/or sequencing.
For instance, in certain embodiments, PCR amplification is performed using
multiple combinations of primers and the resulting pattern of amplified bands
obtained from each combination is evaluated to accurate determine genotype of
the
subject. In particularly preferred embodiments, multiple different PCR assays
are
performed on each sample, for example multiple reactions using various 3'
(reverse)
primers in various combinations with a 5' (forward) primer.
By way of example, six PCR amplifications may be performed using the 3'
primers of SEQ ID NOs:l and 2 in combination with the 5' primers of SEQ ID
NOs:3,
4 and 5 (e.g., SEQ ID NOs:I and 3; SEQ ID NOs: 2 and 3; SEQ 117 NOs:I and 4;
SEQ
ID NOs:2 and 4; SEQ ID NOs:l and 5; SEQ ID NOs:2 and 5). The results of each
amplification reaction can be compared (e.g., by gel electrophoresis) and the
particularly pattern used to readily haplotype the subject. Using primer pairs
where
one primer is gene A-specific, gene B- specific or generic to gene A and B and
the
other primer is 158V- or 158F-specific allows for efficient and accurate
genotyping at
this important site.
FIG. 5 shows results obtained from analysis of multiple PCR amplification
reactions, each of which contain a different combination of primers. Following
amplification, the resulting product is run on a standard 4% agarose gel (see,
also
Examples) and the resulting product (if any) visualized. The lanes in FIG. S
are
labeled to correspond to the particular combination of primer used in the PCR
reaction. The pattern of panels A and D indicates a subject that is 158FF
(homozygous) in gene A. Panel B shows a subject that is 158W homozygous in
gene
A, while panel C shows a subject that is 158FV (heterozygous) in gene A. All
panels
include a internal control in that the combination of 5' primer T (gene B
specific, SEQ
CA 02562016 2006-10-02
WO 2005/102379 PCT/US2004/043726
ID N0:3) and 3' primer A (158F-specific, SEQ ID NO:1) should not produce a PCR
product because gene B does not contain the polymorphism at position 559.
B. Sequencing
S In still other embodiments, genotyping as described herein further comprises
sequencing the products of PCR amplification. Any of the primers disclosed
herein
can be used as sequencing primers. Particularly preferred as sequencing
primers are
those that bind at a polymorphism and when bound, allow sequencing of portion
of
the gene corresponding to polymorphism 158V/F. Representative sequencing
primers
are depicted in FIG. 8 (SEQ >D NOs:l2-19).
Direct sequencing may be accomplished by chemical sequencing, for example,
using the Maxam-Gilbert method, or by enzymatic sequencing, for example, using
the
Sanger method. In the latter case, specific oligonucleotides are synthesized
using
standard methods and used as primers for the dideoxynucleotide sequencing
reaction.
See, e.g., Sambrook, supra and Examples below.
FIG. 6 shows genotyping results at the gene A 158V/F site after PCR using
primers described herein followed by sequencing ("PCR-SEQ") as compared to PCR
alone using previously described primers ("Koene"). Of the 80 samples
compared, 10
were incorrectly genotyped using the primers and PCR methods previously
described
in Koene et al., supra. Specifically, samples designated A609201, A609372,
A610260, A612201, A701320, NCM460, A609203, A701017, Kyse410, and kidney
were inaccurately genotyped using previously described methods. In addition,
unlike
the assays described herein, previously described methods do not distinguish
between
gene A and gene B.
C. TaqManTM
The fluorogenic 5' nuclease assay, known as the TaqManTM assay (see, e.g.,
Holland et al., Proc. Natl. Acad.Sci. USA (1991) 88:7276-7280), is a powerful
and
versatile PCR-based detection system for nucleic acid targets. Hence, primers
and
probes described herein can also be used in TaqMan~ analyses to determine a
subject's FcyRIll genotype. Analysis is performed in conjunction with thermal
cycling
26
CA 02562016 2006-10-02
WO 2005/102379 PCT/US2004/043726
by monitoring the generation of fluorescence signals. The assay system
dispenses
with the need for gel electrophoretic analysis, and has the capability to
generate
quantitative data allowing the determination of target copy numbers. For
example,
standard curves can be produced using serial dilutions of previously analyzed
samples.
A standard graph can be produced with copy numbers of each of the panel
members
against which sample unknowns can be compared.
The fluorogenic 5' nuclease assay is conveniently performed using, for
example, AmpliTaq GoIdTM DNA polymerise, which has endogenous 5' nuclease
activity, to digest an internal oligonucleotide probe labeled with both a
fluorescent
reporter dye and a quencher (see, Holland et al., Proc. Natl. Acad.Sci. USA
(1991)
88:7276-7280; and Lee et al., Nucl. Acids Res. (1993) 21:3761-3766). Assay
results
are detected by measuring changes in fluorescence that occur during the
amplification
cycle as the fluorescent probe is digested, uncoupling the dye and quencher
labels and
causing an increase in the fluorescent signal that is proportional to the
amplification of
target nucleic acid.
The amplification products can be detected in solution or using solid
supports.
In this method, the TaqManTM probe is designed to hybridize to a target
sequence
within the desired PCR product. The 5' end of the TaqManTM probe contains a
fluorescent reporter dye. The 3' end of the probe is blocked to prevent probe
extension and contains a dye that will quench the fluorescence of the 5'
fluorophore.
During subsequent amplification, the S' fluorescent label is cleaved off if a
polymerise
with 5' exonuclease activity is present in the reaction. Excision of the 5'
fluorophore
results in an increase in fluorescence that can be detected.
For a detailed description of the TaqManTM assay, reagents and conditions for
use therein, see, e.g., Holland et al., Proc. Natl. Acid. Sci, U.S.A. (1991)
88:7276-
7280; U.S. Patent Nos. 5,538,848, 5,723,591, and 5,876,930, all incorporated
herein
by reference in their entireties.
D. Transcription-Mediated Amplification Assays (TMA)
The sequences described herein may also be used as a basis for transcription-
mediated amplification (TMA) assays. TMA provides a method of identifying
target
27
CA 02562016 2006-10-02
WO 2005/102379 PCT/US2004/043726
nucleic acid sequences present in very small amounts in a biological sample.
Such
sequences may be difficult or impossible to detect using direct assay methods.
In
particular, TMA is an isothermal, autocatalytic nucleic acid target
amplification
system that can provide more than a billion RNA copies of a target sequence.
The
S assay can be done qualitatively, to accurately detect the presence or
absence of the
target sequence in a biological sample. The assay can also provide a
quantitative
measure of the amount of target sequence over a concentration range of several
orders
of magnitude. TMA provides a method for autocatalytically synthesizing
multiple
copies of a target nucleic acid sequence without repetitive manipulation of
reaction
conditions such as temperature, ionic strength and pH.
Generally, TMA includes the following steps: (a) isolating nucleic acid,
including RNA, from the biological sample of interest to be haplotyped; and
(b)
combining into a reaction mixture (i) the isolated nucleic acid, (ii) first
and second
oligonucleotide primers, the first primer having a complexing sequence
sufficiently
complementary to the 3' terminal portion of an RNA target sequence, if present
(for
example the (+) strand), to complex therewith, and the second primer having a
complexing sequence sufficiently complementary to the 3' terminal portion of
the
target sequence of its complement (for example, the (-) strand) to complex
therewith,
wherein the first oligonucleotide further comprises a sequence 5' to the
complexing
sequence which includes a promoter, (iii) a reverse transcriptase or RNA and
DNA
dependent DNA polymerases, (iv) an enzyme activity which selectively degrades
the
RNA strand of an RNA-DNA complex (such as an RNAse H) and (v) an RNA
polymerase which recognizes the promoter.
The components of the reaction mixture may be combined stepwise or at once.
The reaction mixture is incubated under conditions whereby an
oligonucleotide/target
sequence is formed, including DNA priming and nucleic acid synthesizing
conditions
(including ribonucleotide triphosphates and deoxyribonucleotide triphosphates)
for a
period of time sufficient to provide multiple copies of the target sequence.
The
reaction advantageously takes place under conditions suitable for maintaining
the
stability of reaction components such as the component enzymes and without
requiring modification or manipulation of reaction conditions during the
course of the
28
CA 02562016 2006-10-02
WO 2005/102379 PCT/US2004/043726
amplification reaction. Accordingly, the reaction may take place under
conditions that
are substantially isothermal and include substantially constant ionic strength
and pH.
The reaction conveniently does not require a denaturation step to separate the
RNA-DNA complex produced by the first DNA extension reaction.
Suitable DNA polymerises include reverse transcriptases, such as avian
myeloblastosis virus (AMV) reverse transcriptase (available from, e.g.,
Seikagaku
America, Inc.) and Moloney murine leukemia virus (MMLV) reverse transcriptase
(available from, e.g., Bethesda Research Laboratories).
Promoters or promoter sequences suitable for incorporation in the primers are
nucleic acid sequences (either naturally occurring, produced synthetically or
a product
of a restriction digest) that are specifically recognized by an RNA polymerise
that
recognizes and binds to that sequence and initiates the process of
transcription
whereby RNA transcripts are produced. The sequence may optionally include
nucleotide bases extending beyond the actual recognition site for the RNA
polymerise
that may impart added stability or susceptibility to degradation processes or
increased
transcription efficiency. Examples of useful promoters include those that are
recognized by certain bacteriophage polymerises such as those from
bacteriophage
T3, T7 or SP6, or a promoter from E. coli. These RNA polymerises are readily
available from commercial sources, such as New England Biolabs and Epicentre.
Some of the reverse transcriptases suitable for use in the methods herein have
an RNAse H activity, such as AMV reverse transcriptase. It may, however, be
preferable to add exogenous RNAse H, such as E. coli RNAse H, even when AMV
reverse transcriptase is used. RNAse H is readily available from, e.g.,
Bethesda
Research Laboratories.
The RNA transcripts produced by these methods may serve as templates to
produce additional copies of the target sequence through the above-described
mechanisms. The system is autocatalytic and amplification occurs
autocatalytically
without the need for repeatedly modifying or changing reaction conditions such
as
temperature, pH, ionic strength or the like.
Detection may be done using a wide variety of methods, including direct
sequencing, hybridization with sequence-specific oligomers, gel
electrophoresis and
29
CA 02562016 2006-10-02
WO 2005/102379 PCT/US2004/043726
mass spectrometry. These methods can use heterogeneous or homogeneous formats,
isotopic or nonisotopic labels, as well as no labels at all.
TMA is described in detail in, e.g., U.S. Patent No. 5,399,491, the disclosure
of which is incorporated herein by reference in its entirety. In one example
of a
typical assay, an isolated nucleic acid sample from a subject to be genotyped,
is mixed
with a buffer concentrate containing the buffer, salts, magnesium, nucleotide
triphosphates, primers, dithiothreitol, and spermidine. The reaction is
optionally
incubated at about 100 °C for approximately two minutes to denature any
secondary
structure. After cooling to room temperature, reverse transcriptase, RNA
polymerase,
and RNAse H are added and the mixture is incubated for two to four hours at 37
°C.
The reaction can then be assayed by denaturing the product, adding a probe
solution,
incubating 20 minutes at 60 °C, adding a solution to selectively
hydrolyze the
unhybridized probe, incubating the reaction six minutes at 60 °C, and
measuring the
remaining chemiluminescence in a luminometer.
As noted above, two or more of the tests described above may be performed to
confirm the genotype. For example, if the first test used the transcription
mediated
amplification (TMA) to amplify the nucleic acids for detection, then an
alternative
nucleic acid testing (NAT) assay is performed, for example, by using PCR
amplification, RT PCR, and the like, as described herein. Thus, any sample
from any
patient can be specifically and selectively haplotyped.
As is readily apparent, design of the assays described herein are subject to a
great deal of variation, and many formats are known in the art. The above
descriptions are merely provided as guidance and one of skill in the art can
readily
modify the described protocols, using techniques well known in the art.
E. Kits
The above-described assay reagents, including the primers, PCR buffers,
sequencing reagents, etc., can be provided in kits, with suitable instructions
and other
necessary reagents, in order to conduct the assays as described above. The kit
will
normally contain in separate containers the combination of primers and probes
(either
already bound to a solid matrix or separate with reagents for binding them to
the
CA 02562016 2006-10-02
WO 2005/102379 PCT/US2004/043726
matrix), control formulations (positive and/or negative), labeled reagents
when the
assay format requires same and signal generating reagents (e.g., enzyme
substrate) if
the label does not generate a signal directly. Instructions (e.g., written,
tape, VCR,
CD-ROM, etc.) for carrying out the assay usually will be included in the kit.
The kit
can also contain, depending on the particular assay used, other packaged
reagents and
materials (i.e. wash buffers and the like). Standard assays, such as those
described
above, can be conducted using these kits.
F. Applications
As noted above, the present invention is based on the discovery of novel
compositions and assays for accurately determining the FcyRllI haplotype of a
vertebrate subject, particularly the haplotype at the 158F/V site in both
FcyRIIIa.
The ability to accurately determine FcYRIII genotype has many applications,
including but not limited to, pharmacogenetics. Pharmacogenetics refers to the
determination of a particular individual's genotype in order to determine a
suitable
treatment protocol. As noted above, subjects with the 158F/F genotype response
less
well to antibody treatments (e.g., ritubimab) than subjects with a 158V/F and
158V/V
genotype. Furthermore, it has been demonstrated that response to antibody-
mediated
therapies such as ritubimab can be enhanced by pre-treatment with cytokines
(e.g., IL-
2). See, also, co-owned Provisional Patent Application titled "USE OF FC
RECEPTOR POLYMORPHISMS AS DIAGNOSTICS FOR TREATMENT
STRATEGIES FOR IMMUNE-RESPONSE DISORDERS," filed March 10, 2004,
incorporated by reference in its entirety herein.
Thus, using the compositions and methods described herein individuals in
need of treatment for an immune disorder and can be efficiently and accurately
genotyped and, accordingly, designated as suitable candidates for intervention
with
one or more immunotherapeutics that mediate the FcyRIII-triggered ADCC pathway
(e.g., IL-2). IL-2 proteins and muteins are known in the art. See, e.g., U.S.
Patent No.
4,752,585; U.S. Patent No. 4,766,106; U.S. Patent No. 4,931,543; U.S. Patent
No.
5,700,913; U.S. Serial No. 60/585,980, filed July 7, 2004 and titled
"Combinatorial
Interleukin-2 Muteins," and U.S. Serial No. 60/550,868, filed March 5, 2004,
and
31
CA 02562016 2006-10-02
WO 2005/102379 PCT/US2004/043726
titled "Improved Interleukin-2 Muteins;" incorporated by reference in their
entireties
herein. IL-2 muteins are commerically available and are also described in the
following documents: International Publications Nos. WO 91/04282; WO 99/60128;
WO 00/58456; WO 00/04048; European Patent (EP) Publication No. EP 136,489;
European Patent Application No. 83306221.9, filed October 13, 1983 (published
May
30, 1984 under Publication No. EP 109,748), which is the equivalent to Belgian
Patent No. 893,016, and commonly owned U.S. Patent No. 4,518,584); European
Patent Publication No. EP 200,280 (published December 10, 1986), European
Patent
Publication No. EP 118,617, which patents and applications are all
incorporated by
reference herein in their entireties.
In certain applications, genotyping is performed on a individual suffering
from
an immune disorder, particularly a cancer, in order to determine the
suitability of
adjunct therapies (e.g., II,-2 immunotherapy alone) to be used in combination
with an
anti-cancer monoclonal antibody. Examples of cancers in which genotyping as
described herein may aid in designing treatment protocols include, but are not
limited
to, B-cell lymphomas listed below, breast cancer, ovarian cancer, cervical
cancer,
prostate cancer, colon cancers, melanoma, renal cell carcinoma, acute myeloid
leukemia (AML); and chronic lymphocytic leukemia (CLL).
2O EXPERIMENTAL
Below are examples of specific embodiments for carrying out the present
invention. The examples are offered for illustrative purposes only, and are
not
intended to limit the scope of the present invention in any way.
Efforts have been made to ensure accuracy with respect to numbers used (e.g.,
amounts, temperatures, etc.), but some experimental error and deviation
should, of
course, be allowed for.
In the following examples, enzymes were purchased from commercial sources,
and used according to the manufacturers' directions.
In the isolation of DNA fragments, except where noted, all DNA
manipulations were done according to standard procedures. See, Sambrook et
al.,
supra. Restriction enzymes, T4 DNA ligase, E. coli, DNA polymerase I, Klenow
32
CA 02562016 2006-10-02
WO 2005/102379 PCT/US2004/043726
fragment, and other biological reagents can be purchased from commercial
suppliers
and used according to the manufacturers' directions. Double stranded DNA
fragments
were separated on agarose gels.
Example 1: Extraction of DNA from Samples
Whole blood samples were obtained from a subject. The samples were
collected in PreAnalytiX's PAXgeneTM Blood DNA Tubes (Qiagen Inc., catalog
#769989) following the manufacturer's instructions. Genomic DNA was isolated
from whole blood using a PreAnalytiX's PAXgeneTM Blood DNA Kit (Qiagen Inc)
also following the manufacturer's instructions.
Example 2: PCR-Based Genotypin~
A. PCR amulification
PCR assays were performed as follows. In brief, PCR was performed in 96-
well plate format on a GeneAmp PCR System 9600 Perkin Elmer machine (Perkin
Elmer, Boston, MA).
A master mix was prepared as follows. In a 1.5 ml Eppendorf test tube, the
following reagents were prepared as a master mix, 300 ~l of l OX Stoffel
Buffer
(Applied Biosystems); 600 p1 of 25 mM MgCl2 solution; 300 ~1 of a dNTP mix
(Applied Biosystems, catalog #0032 003.109); and 270 ~1 of H20 and stored in
aliquots at -20°C. All buffers were stored according to the
manufacturer's
instructions.
p1 of AmpliTaq DNA Polymerase Stoffel Fragment (Applied Biosystems,
catalog #N808-0038) was added to a thawed aliquot of master mix. Tubes were
25 prepared with different combinations of primers (e.g., 6 tubes), each
containing 9 ~.1 of
the forward primer, 9 ~.1 of the reverse primer, 225 ~l of the Master Mix
Solution and
117 ~1 HzO.
As depicted in FIG. 9, 20 ~1 of each tube was added to a 2 columns of a 96
well plate (e.g., for six primer combinations there were 2 columns of 8 wells
each for
30 each primer combination). Genomic DNA isolated as described in Example 1
was
diluted to l Ong/~,l and 5 ~,1 added to columns containing the different
primer
33
CA 02562016 2006-10-02
WO 2005/102379 PCT/US2004/043726
combinations (e.g., columns 1-6 when six different primer combinations are
used,
FIG. 10). Controls were also included.
The plates were sealed and placed into the GeneAmp PCR system 9600
machine for PCR. PCR conditions were: a single cycle of incubation at
95°C for 5
S minutes; 35 cycles of incubation at 94°C for 30 seconds; incubation
at 64°C for 30
seconds and incubation at 72°C for 30 seconds; and a single cycle of
incubation at
72°C for 8 minutes. The 96-well plate was cooled at 4°C before
subject the samples to
agarose gel.
B. Electrophoresis
TAE Gel electrophoresis was performed on the PCR products of Section A
using standard techniques. A stock of SOX concentrated gel buffer (for final
concentration of 40 mM Tris-Acetate, 1 mM Na2EDTA, pH 8.0) contained 242 g
Tris-
Base; 57.1 ml glacial acetic acid; 100 ml 0.5 M Na2EDTA. Gel Loading buffer
contained 0.25 % bromophenol blue; 0.25 % xylene cyanol FF; and 1 S % Ficoll
(Type
400; Pharmacia) in H20. Molecular weight markers (0.07-12.2 kbp) from
Boehringer
Mannheim (catalog #1498 037) were also used.
A standard 4 % Agarose horizontal gel in TEA buffer containing 10 pg/ml of
ethidium bromide was prepared. 5 p,1 of each PCR reaction was mixed with 1 p1
of
standard 6X loading buffer and loaded into in adjacent lanes of the gel in
order from
reaction 1 through 6. See, FIG. 5. The gel was fun at constant 100 Volts for
15-20
minutes, visualized and photographed under Ultra Violet (UV) light in a
standard UV
trans-illuminator.
Exemplary results are shown in FIG. S. These results confirm that At position
158, FCGR3A is polymorphic a Valine (V158) or a phenylalanine (F158). FCGR3B
is not polymorphic at this position encoding only Valine. The use of primers
as
described herein allow genotyping of the FCGR3A 158V/F site by using primers
that
identify this site (e.g., SEQ ID NOs:I-2) as well as a non-specific primer
(SEQ ID
N0:4) and primers that identify a single nucleotide difference as between gene
A and
B at position 531 (SEQ ID NOs:3 and 5). Position 531 does not result in an
amino
acid difference.
34
CA 02562016 2006-10-02
WO 2005/102379 PCT/US2004/043726
As described above, a PCR product obtained using 5'primer C (SEQ ID NO:S)
and 3'primer C (SEQ ID N0:2), indicates the V genotype. If this product is
observed
for an individual sample and a PCR product obtained using 5' primer C (SEQ ID
NO:S) and 3' primer A (SEQ ID NO:1) is not visible, the result indicates that
the
subject is homozygous for V. See, FIG. 5, panel B. Similarly, if a PCR product
obtained using 5' primer C (SEQ ID NO:S) and 3' primer A (SEQ ID NO:1) is
visible
and a product obtained using 5' primer C (SEQ m NO:S) and 3' primer C (SEQ ID
N0:2) is not visible, the subject is homozygous for F in gene A. See, FIG. 5,
panels A
and D. A product in both of these reactions indicates a subject that is
heterozygous
for F and V. See, FIG. 5, panel C. Internal controls are also present inasmuch
as gene
B is not polymorphic and the combination of 5' primer T and 3' primer A should
never
result in a visible product.
Thus, using the methods described herein FcyRIBa genotype at the 158F/V
polymorphism can be accurately determined.
Example 5: PCR-Sequencing
For genotyping, experiments in which sample DNA was amplified (PCR) and
the products sequenced using oligonucleotide primers as disclosed herein were
also
conducted.
A. PCR
PCR of genomic DNA was performed using a BD Advantages 2 PCR kit
(product #639206 or #639207) according to the manufacturer's instructions.
Each
reaction contained 5 ~1 l OX BD Advantage 2 PCR Buffer; 1 ~.1 of SuM/each
primer
mixture (total primer concentration lOuM); 1 ~l SOX dNTP Mix (10 mM each); 1
p,1
SOX BD Advantage 2 Polymerase Mix; sample DNA to a final concentration of 10-
100 ng; and a volume of water to make the final reaction volume 50 p1. Cycling
conditions were 95 °C for 5 minutes; 30 cycles of 95 °C for 30
seconds, 62 °C for 30
seconds; 72°C for 40 seconds; and incubated at 4 °C. Following
cycling, the PCR
reaction products were purified using the Qiagen's MinElute PCR purification
kit
(catalog no. 28004 or 28006) and following the manufacturer's recommended
CA 02562016 2006-10-02
WO 2005/102379 PCT/US2004/043726
protocol, except that the final elution volume was 50 p1.
Controls were also included in the assays. Positive controls were genomic
DNA of known FcyRIII genotype (e.g., G, T, and G/T at the 158VF polymorphism
of
gene A) while negative controls typically included all reagents except genomic
DNA
(which yielded negative PCR and sequencing results).
B. Sequencing
Sequencing reactions on the PCR products obtained in as described above
were performed using BigDye terminator v3.0 on either 3100 or 3730x1 platforms
(Applied Biosystems). Each sequencing reaction contained 2 p1 of BigDye
Terminator v3.0 Ready reaction mix (part no. 4390246), 1 p,1 Sx Buffer (part
no.
4336699), 1 p,1 PCR product (about 0.02 pl/~g); 2 p.1 of 2 ~M primer (various
combinations of the SEQ )D NOs:12-19) and 4 p1 of water.
A total of 30 cycles were performed on each reaction: 95 °C for 10
seconds;
50°C for 5 seconds; and 60 °C for 3 minutes. After cycling,
reactions were incubated
at 4 °C.
The reactions were purified by adding 45 p1 of dry Sephadex G-75 Resin from
Amersham (catalog #17-0051-O1 or 17-0052-03) to a dry filter plate (Millipore
Cat.#MAHV N45 10) with a multiscreen Column Loader (Millipore catalog
#MCL09645). Subsequently, 300 w1 of water was added into each well and the
plate
covered and incubated at room temperature for at least 30 minutes.
The filter plate was stacked with a 96-well microtiter plate (Nunc catalog
#12565263) and spun for 3 minutes at 1650 RPM in Eppendorf Model 58108 with an
A-4-62 swing bucket rotor. The filter plate was placed on top of a clean 96-
well PCR
plate (Sorenson Bioscience Inc., catalog #12565263 or equivalent) and on top
of a 96-
well base (Applied Biosystems, catalog #N801-0531). All of the samples were
transferred into the center of designated filter columns and spun for 5
minutes at 1800
RPM in Eppendorf Model 58108 with an A-4-62 swing bucket rotor. The final
sample volumes were adjusted to be about 1 S ~1 with autoclaved sterile
purified
water.
The plates were then assembled according to the manufacturer's instructions
36
CA 02562016 2006-10-02
WO 2005/102379 PCT/US2004/043726
(3100 User's Manual or 3730x1 User's Manual). The parameter programmed were:
POP6 as separation medium and default module "StdSeq50 POP6" for the 3100
platform and POP7 as separation medium and default module "LongSeq50 POP7_1"
for the 3739 platform. Run times in the default module were 6500 seconds (3100
platform) and 5640 seconds (3730 platform). For targets less than about 300
bases,
run time in the default module was shortened to 4000 seconds (3100 platform)
or
3600 seconds (3730 platform) if no other samples with longer read length were
included in the same run.
C. Analysis
The sequencing data was transferred to a desktop computer and imported into
the Sequencer~ project. Sequences for FCGR3A specific primers (Table 1 and
FIG.
8) from each individual sample were aligned with a reference sequence (FIG. 11
).
Sequences from FCGR3B specific primers from each individual samples and
sequences from primers used in PCR reactions were aligned with reference
sequence.
Sequences beyond reference sequence are edited out.
Subsequently, genotyping was conducted as follows. If A, C, T and/or C were
found in positions 121, 153, 179, and 313 respectively (numbered relative to
first base
of exon 4), the reactions were deemed to be non-gene A-specific and were
repeated.
If signals at these positions matched gene A reference sequence signals only,
the
sample was considered FCGR3A and the signal from position 207 (numbered
relative
to first base of exon 4, position 559 in cDNA) analyzed. If only a G signal
was
obtained at position 207, the genotype of the individual from which the sample
was
obtained was 158W homozygous. If only a T signal was obtained at position 207,
the
genotype of the individual from which the sample was obtained was 158FF
homozygous. If G and T signals were obtained at position 207, the sample was
obtained from a 158VF heterozygous subject.
Similarly, FcyRllIb genotype was confirmed as follows. If G, T, C, A signals
were found in positions 121, 153, 179, 313 respectively (numbered relative to
first
base of exon 4), the reactions were deemed to be non gene B-specific and were
repeated. If signals at these positions matched gene B reference sequence
signals, the
37
CA 02562016 2006-10-02
WO 2005/102379 PCT/US2004/043726
sample was deemed FCGR3B. Samples determined to be gene B did not contain the
158VF polymorphism and a G signal was seen at the corresponding nucleotide.
136 samples were tested as described and 135 were accurately FcyRIII
genotyped. In one case, the sample did not contain gene B. In cases in which
either
gene A or gene B are absent from a subject's genome, it may be desirable to
sequence
using PCR primers. Sequencing with PCR primers allows estimation of the ratio
of
FCGR3A and FCGR3B genes based on signals from both A and B genes in position
121, 153, 179, and 313.
Results of genotypic analyses are summarized in FIG. 6 and are also compared
to methods described in Koene et al, supra. The PCR-sequencing methods
described
herein determined the subject's genotype in all 80 samples, whereas previously
described methods had greater than 10% error rate (10 samples).
Thus, PCR-sequencing assays are highly sensitive and are capable of
accurately determining FcgRllI genotype.
Accordingly, novel sequences and genotyping assays using these sequences
have been disclosed. From the foregoing, it will be appreciated that, although
specific
embodiments of the invention have been described herein for purposes of
illustration,
various modifications may be made without deviating from the spirit and scope
thereof.
38
