Note: Descriptions are shown in the official language in which they were submitted.
DEMANDE OU BREVET VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVET COMPREND
PLUS D'UN TOME.
CECI EST LE TOME 1 DE 2
CONTENANT LES PAGES 1 A 32
NOTE : Pour les tomes additionels, veuillez contacter le Bureau canadien des
brevets
JUMBO APPLICATIONS/PATENTS
THIS SECTION OF THE APPLICATION/PATENT CONTAINS MORE THAN ONE
VOLUME
THIS IS VOLUME 1 OF 2
CONTAINING PAGES 1 TO 32
NOTE: For additional volumes, please contact the Canadian Patent Office
NOM DU FICHIER / FILE NAME:
NOTE POUR LE TOME / VOLUME NOTE:
CA 02569196 2006-11-29
WO 2005/118854 PCT/IB2005/002310
FCGR3A GEBOTYPE AND METHODS FOR EVALUATING TREATMENT
RESPONSE TO NON-DEPLETING ANTIBODIES
[001] The present invention relates to methods and compositions to evaluate or
assess the
response and/or side effects of a subject to particular therapeutic treatment.
More particularly,
the invention provides methods to deternune the response and/or the side
effects of subjects,
or to adapt the treatment protocol of subjects treated with therapeutic
antibodies. The
invention can be used for patients treated with antibodies designed to target
a membrane
antigen but which need not deplete target cells, and is suited to identify
subjects having
increased or decreased threrapeutic response to the therapy, or to identify
subjects having
increased or decreased risk of side effects, particularly undesired side
effects such as cytokine
release syndrome.
INTRODUCTION
[002] Various therapeutic strategies in human beings are based on the use of
therapeutic
antibodies which need not be depleting to a cell to which the antibody is
bound. Some such
strategies aim to use antibodies to antagonize or agonize membrane receptors
and/or to target
membrane antigens with the aim of modulatating cell function. A wide range of
therapeutic
modalities are encompassed by such strategies, including but not limited to
strategies to
modulate immune cell function (e.g. B cells, T cells, NK cells), strategies to
treat inflammatory
conditions and/or autoimmune disorders, anti-tumor strategies (for example,
anti-erbBl and
erbB2 antibodies such as trastuzumab, pertuzumab and ABX-EGF; anti-TRAIL-R
antibodies,
anti-CD33 antibody Mylotarg ), and treatments for heart disease or anti-
thrombosis (e.g.
ReoPro ). In almost all these applications, the antibody appears to act by
antagonizing a key
membrane receptor or to induce intra-cellular signaling. Such antibodies are
typically
monoclonal antibodies, of IgG species, typically IgG4, and most preferably
will be full-length
antibodies so as to have a longer in vivo half-life. They are often developed
in the treatment
of inflammatory disorders such as psoriasis, multiple sclerosis, rheumatoid
arthritis, Crohn's
disease but can also be used in cancer, for example, when Fc-mediated ADGC
mechanism is
not required (see Mylotarg, ABX-EGF which targets tumor cells, for example, or
an anti-
NKp30 antibody which activates an NK cell). The preferential use of IgG4
prevents cytolysis
but maintains a long in vivo half-life due to interactions with FcRn
receptors. This
CA 02569196 2006-11-29
WO 2005/118854 PCT/IB2005/002310
2
immunoglobulin subclass is therefore generally used when the recruitment of
effectors are not
needed. A particular example of such therapeutic antibodies is CDP571 (also
referred to as
Humicade', which is an anti-TNFa IgG4 monoclonal antibody. Other examples of
IgG4
antibodies include clenoliximab, which is used in the treatment of Rheumatoid
Arthritis or
ch5D12, which is used in the treatment of Multiple sclerosis, aselizumab
(HuDreg55), an anti-
selectin L antibody of the IgG4 type, cedelizumab OKTcdr4a, humanized (anti-
CD4) and
rovelizumab Hu23F2G (humanized (anti-CD11a). Yet other examples of antibodies
not
required to have target cell depleting activities are antibodies that modulate
NK cells by
targeting NK cell surface receptors, for example anti-NKG2D, anti-NKp30, anti-
NKp46 or
anti-NKp44 or anti-CD94/NKG2A antibodies. It is nevertheless possible to
obtain IgGl
antibodies which are not capable of inducing cytolytic activity, for example
Mason U, et al. (J
Rheumatol. 2002; 29(2): 220-9) provide an example where an anti-CD4 antibody
of the IgGl
type has efficacy only if it does not substantially induce lysis. The latter
demonstrates that
certain IgGl antibodies can be free of depleting activity, but highlights the
risks in developing
of an IgG1-based product for such an indication, particularly as lytic
activity may depend on
glycosylation state.
[003] The antibodies can be recombinant antibodies (chimeric, humanized,
primatized,
"fully' human, or modified in any way, including but not limited to
modifications that reduce
binding to FcyRIIIa) comprising functional domains from various species or
origin or
specificity. Also envisioned are fusion proteins comprising an Fc portion.
[004] While such non-depleting antibodies represent a novel and target-
specific approach to
human therapy, they do not always exhibit strong efficacy and often show
unwanted side
effects, such that their use could be improved by evaluating the nature of the
response of
subjects thereto. For example, one antibody which does not require target cell
depletion for
efficacy has nevertheless been suggested to be depleting in one patient
(Isaacs JD, Wing MG,
Greenwood JD, Hazleman BI,, Hale G, Waldmann R A therapeutic human IgG4
monoclonal
antibody that depletes target cells in humans. C1in Exp Immunol. 1996
Dec;106(3):427-33).
This target depleting effect may diminish efficacy or the product in
applications where
CA 02569196 2006-11-29
WO 2005/118854 PCT/IB2005/002310
3
depleting is unwanted ; predicting such a depletion effect could therefore
have an important
therapeutic value, as such a patient could be treated with a different product
or according to a
different regimen.
[005] In another example, it is known that depleting antibodies often lead to
cytoldne-release
syndrome, including severe cytokine-release syndrome,. Predicting such an
effect in patients to
be treated with antibodies which are not required or not intended to be target
depleting would
be useful in therapy. Likewise, predicting such an effect in patients to be
treated with depleting
antibodies would be great value as well, for example in order to modify the
therapeutic
regimen by providing the patient with premedication effective to reduce or
prevent cytokine
release syndrome. Examples of depleting antibodies suggested to induce
cytoldne release
syndrome include the C,AMPATH 1-H monoclonal antibody (Wing et al, 1996, J
Clin Invest
98, 2819-2826) and the anti- 20 antibody Mabthera (rituximab), where symptoms
presumed
to be due to cytokine release syndrome included fever and chills, flushing,
angiodema, nausea,
urticaria/rash, hypotension and bronchiospasm (Committee for Proprietary Med.
Prod. Europ.
Public Assessment Report, CPMP/259/98, The Europ. Agency for the Evaluation of
Med.
Prod. (1998)).
[006] The availability of methods allowing the evaluation of patient response
and/or side
effects to antibody treatment would greatly enhance the therapeutic efficacy
of therapies since
benefit/risk ratio of treatment can be better evalutated, treatments can be
adjusted, and finally
novel therapeutic products can be developed.
SUMMARY OF THE INVENTION
[007] The present invention now proposes novel methods and compositions to
assess the
therapeutic response of a subject to a therapeutic composition comprising an
Fc portion,
preferably a therapeutic antibody. Preferably, said therapeutic antibody is an
antibody which is
not capable of, or is not required to be capable of, depleting target cells,
more preferably an
antibody which is not capable of, or which is not or is not required to be
capable of inducing
ADoGmediated depletion of target cells. In preferred examples, the antibody is
an IgG4
CA 02569196 2006-11-29
WO 2005/118854 PCT/IB2005/002310
4
antibody. In other examples the antibody is an antibody other than an IgG4
which is not
capable of, or which is not or is not required to be capable of inducing ADoG
or ADCP-
mediated depletion of target cells. The antibody may also be an antibody other
than an IgG4
which does not substantially induce target depletion, or which preferably does
not induce
target depletion in an individual having a phenylalanine at position 158 of
the FcyRIIIa
receptor. Preferably such a non-IgG4 antibody comprises one or more
modifications in an Fc
region so as to reduce binding to FcyRIIIa.
[008] Preferably, the therapeutic response of the subject relates to efficacy
in the treatment
of a disorder where a membrane antigen is targeted by an antibody, but where
depletion of a
target cell, particularly via an ADCG or ADCP-mechanism, is not required.
Preferred
examples of such disorders to be treated include but are not limited to
infectious disesase,
immune disorders such as inflammatory disorders and autoimmune disorders,
transplantation,
cancer, and cardiovascular disorders. Disorders may also generally include any
disorder in
which an immune response is either to be augmented or inhibited. For example,
antibodies
capable of activating NK cells (e.g. anti-NCR or anti-KIR) or T cells (for
example anti-
CTLA4), but which do not require, and moreover seek to avoid, lysis of the
targeted NK or T
cell, can be used in the treatment or prevention of cancer or infectious
disease. In other
examples, antibodies targeting and antagonizing membrane antigens erbBl et
erbB2
(trastuzumab, pertuzumab, cetuximab, ABX-EGF) act via an anti-proliferative or
anti-
antiogenic activity are therefore do not require target cell lysis,
particularly lysis via an ADCC
mechanism. In further examples, anti-VEGFR antibodies may be sought which
inhibit the
VEGF receptor but which do not induce lysis of the target cell so as to avoid
any potential
damage to the endothelium, to avoid inflammation, and to avoid potential
thrombosis. Preferably, a therapeutic response of a subject relates to
modulation of a
physiological pathway, more preferably an anti-inflammatory effect, an anti-
proliferative effect,
an inhibition or a potentiation of an immune response.
[009] The present invention further proposes novel methods and compositions to
assess the
side effects of a subject to a therapeutic antibody which is intended to be
non-depleting to a
CA 02569196 2006-11-29
WO 2005/118854 PCT/IB2005/002310
cell to which it is bound, or more particularly intended to avoid lysis of an
antibody coated cell
by ADaG or ADCP-. Side effects can be the consequence of the induction of
cytokine release
or of unwanted ADCG or ADCP- activity. The invention also proposes methods to
select
patients having best responding profile to therapeutic antibody treatment. The
invention also
5 relates to methods of treating patients with therapeutic antibodies,
comprising a prior step of
evaluating the patient's response. The invention also relates to compositions
and kits suitable
to perform the invention. The invention may as well be used in clinical trials
or experimental
settings, to assess or monitor a subject's response, or to verify the mode of
action of an
antibody.T'hree classes of FcyR (FcyRI, FcyRII and FcyRIII) and their
subclasses are encoded
by eight genes in humans, all located on the long arm of chromosome 1. Some of
these genes
display a functional allelic polymorphism generating allotypes with different
receptor
properties. One of these genetic factors is a gene dimorphism in FCGR3A, which
encodes
FcyRIIIa with either a phenylalanine (F) or a valine (V) at amino-acid
position 158 of the
mature protein (Koene et al, Blood. 1997;90:1109-1114; Wu J, et al. J Clin
Invest. 1997; 100:
1059-1070). It has been demonstrated that human IgG4 binds more strongly to
homozygous
FcyRIIIa-158V natural killer cells (NK) than to homozygous FcyRIIIa-158F or
heterozygous
NK cells (Koene et al, 1997).
[0010] The present invention provides that a correlation between the genotype
of a subject
and its ability to respond to treatment with a composition comprising an Fc
portion,
particularly an antibody, can be used to predict the subject's response and
side effect sensibility
to treatment with a such therapeutic composition which is intended to be
substantially non-
depleting. More specifically, the invention provides that the genotype of the
FcyRIIIa receptor
can be used to predict a subject's response and side effect sensibility to
treatment a
composition comprising an Fc portion, particularly an antibody, which is
intended to be non-
depleting. As further described herein, it will be appreciated that the
genotype of a patient can
be determined by any suitable manner, including by determining the nucleotide
sequence
present in the DNA of a patient or by determining the amino acid present in
the FcyRIIIa
receptor of a patient, the latter for example according to standard approaches
for determining
the phenotype or allotype of a patient at the receptor.
CA 02569196 2006-11-29
WO 2005/118854 PCT/IB2005/002310
6
[0011] More particularly, the present invention provides that the presence in
a subject of a
Valine at position 158 of the FcyRIIIa receptor is indicative of a decreased
response to said
treatment in terms of efficacy, and a phenylalanine at position 158 of the
FcyRIIIa receptor is
indicative of an increased response to said treatment. Moreover, the present
invention provides
that the presence in a subject of a Valine at position 158 of the FcyRIIIa
receptor is indicative
of a increased side effects or susceptibility to side effects to said
treatment and a phenylalanine
at position 158 of the FcyRIIIa receptor is indicative of decreased side
effects or susceptibility
to side effects to said treatment.
[0012] The identity of the amino acid residue present at position 158 of the
FcyRIIIa receptor
corresponds to a nucleotide polymorphism at nucleotide at position 559 of the
FCGR3A
cDNA or 4985 of the FCGR3A genomic DNA. Thus, determining the genotype of a
subject
can readily be carried out by determining the nucleotide present in the DNA of
a subject or by
determining the amino acid residue present in the FcyRIIIa receptor.
[0013] Side effects can be the consequence of the induction of cytokine
release or of
activation of FcyrIIIa-bearing cells, particularly ADCG or ADCP- mediated by
NK cells
and/or macrophages. Examples of cytokines released are TNF-a, IFN y and IL-6.
Symptoms
of cytolflne release often include but are not limited to fever and chills,
flushing, angiodema,
nausea, urticaria/rash, hypotension and bronchiospasm.
[0014] Accordingly, the present invention provides a method based on an
association between
the FCGR3A genotype and clinical and molecular responses to a composition
comprising an
Fc portion, particularly an antibody, intended to be non-depleting, preferably
which is not
intended to induce cytolytic activity, particularly ADoC or ADCP, of a cell
with which it is
associated or bound. The invention thus provides a marker that can be used to
monitor,
evaluate or select a patient's response to such antibodies. This invention
thus introduces
pharmacogenetic approaches in the management of patients with therapeutic
antibody
treatment, more particularly a therapeutic treatment by a substantially non-
depleting antibody,
CA 02569196 2006-11-29
WO 2005/118854 PCT/IB2005/002310
7
especially an IgG4 antibody. In one aspect, the substantially non-depleting
antibody is an
antibody which binds to a receptor present on the surface of an immune cell,
more preferably
a B cell, a T cell or a NK cell. In another preferred aspect; the
substantially non-depleting
antibody is an antibody which binds to a receptor present on the surface of a
tumoral cell or an
endothelial cell; examples of receptors include but are not limited to erbBl
and erbB2 on
tumor cells, and cellular VEGF-R on endothelial cells. Other examples or
receptors are known
in the art and/or, described in Table 1, and further described herein.
[0015] It will be appreciated that the methods of the invention can be
practiced with a wide
range of Fc portion-containing compositions, especially therapeutic
antibodies. In general, the
antibodies or Fc portion-containing compositions are intended to be non-
depleting, preferably
which do not substantially induce or are intended not to induce cytolytic
activity, particularly
ADCC or ADCP activity, toward a cell with which they are associated or bound
For example,
the therapeutic antibody can be of an IgG4 subtype. Preferably, said
therapeutic antibody
specifically binds a membrane antigen on a target cell, for example including
but not limited to
a tumor cell, an endothelial cell, a B lymphocyte, a T lymphocyte or and NK
cell. In preferred
examples, said therapeutic antibody binds and activates an NK cell activatory
receptor. In
another example, said therapeutic antibody binds and interferes with ligand
binding to or
inhibits the function of an NK cell activatory receptor. In another example,
said therapeutic
antibody binds and interferes with ligand binding to or inhibits the function
of an NK cell
inhibitory receptor, thereby activating or potentiating the activation of an
NK cell. In another
example, said therapeutic antibody binds and activates an NK cell inhibitory
receptor, thereby
inhibiting the activation of an NK cell. In another aspect, said composition
comprising an Fc
portion, particularly an antibody, specifically binds a membrane pro-
inflammatory cytokine or
a lymphocyte receptor.
[0016] In a preferred embodiment, a subject to be treated according to the
invention has a
disorder such as a tumor. In another example a subject has another
proliferative disease, for
example a hyperproliferative conditions such as hyperplasias, fibrosis
(especially pulmonary,
but also other types of fibrosis, such as renal fibrosis), angiogenesis,
psoriasis, atherosclerosis
and smooth muscle proliferation in the blood vessels, such as stenosis or
restenosis following
CA 02569196 2006-11-29
WO 2005/118854 PCT/IB2005/002310
8
angioplasty. In another example a subject has an inflammatory or preferably
autoimmune
disorder, examples of such disorders include but are not limited to disoxriers
mediated by
phagocytic cells, which includes macrophages and neutrophil granulocytes
(Polymorphonuclear leukocytes, PMNs) and/or T cells. Examples include
inflammatory skin
diseases including psoriasis; responses associated with inflammatory bowel
disease (such as
Crohn's disease and ulcerative colitis); adult respiratory distress syndrome;
dermatitis; CNS
inflammatory disorders such as multiple sclerosis; uveitic disorders; allergic
conditions such as
eczema and asthma and other conditions involving infiltration of T cells and
chronic
inflammatory responses; skin hypersensitivity reactions (including poison ivy
and poison oak);
autoimmune diseases such as rheumatoid arthritis, systemic lupus erythematosus
(SLE),
diabetes mellitus, multiple sclerosis, Raynaud's syndrome, autoimmune
thyroiditis, Sjogren's
syndrome, juvenile onset diabetes, and inunune responses associated with
delayed
hypersensitivity mediated by cytoldnes and T-lymphocytes typically found in
tuberculosis,
sarcoidosis, polymyositis, granulomatosis and vasculitis; pernicious anemia;
multiple organ
injury syndrome secondary to septicaemia or trauma; autoimmune haemolytic
anemia;
myethemia gravis; antigen-antibody complex mediated diseases; all types of
transplantation
rejection, including graft vs. host or host vs. graft disease.
[0017] It will be appreciated that any embodiments of the invention relating
to a therapeutic
antibody can relate to a complete antibody or a fragment or modified antibody,
so long as the
antibody comprises an Fc portion. As further discussed herein, there are five
types of human
immunoglobulin Fc regions with different effector and pharmacokinetic
properties: IgG, IgA,
IgM, IgD, and IgE. IgG is the most abundant immunoglobulin in serum. IgG also
has the
longest half-life in serum of any immunoglobulin (23 days). Unlike other
immunoglobulins,
IgG is efficiently recirculated following binding toa particular Fc receptor
called FcRn which is
structurally and genetically unrelated to FcyR There are four IgG subclasses
Gl, G2, G3, and
G4, each of which have different effector functions. Gland G3 can bind Clq and
activate
complement by the classical pathwaywhile G2 and G4 cannot. Even though G3 is
able to bind
Clq more efficiently than G1, G1 is more effective at mediating complement-
directed cell
lysis. The Clq binding site in IgG is located at the carboxyterminal region of
the CIH2 domain.
CA 02569196 2006-11-29
WO 2005/118854 PCT/IB2005/002310
9
All IgG subclasses are capable of binding to Fc receptors (CD16, CD32, 64)
with G1 and
G3 being more effective than G2 and G4. The Fc receptor-binding region of IgG
is formed by
residues located in both the hinge and the carboxy terminal regions of the Q-2
domain. IgA
can exist both in a monomeric and dimeric form held together by a J-chain. IgA
is the second
most abundant Ig in serum, but its half-life is only 6 days. IgA has three
effector functions. It
binds to an IgA specific receptor on macrophages and eosinophils, associated
with
phagocytosis and degranulation respectively, and. resulting in antibacterial
activity and
especially cytotoxicity, for example towards parasites. It can also fix
complement via the
altemative pathway. In particularly preferred embodiments, the invention is
carried out in
accordance with an Fc region of the G4 subclass (also referred to as IgG4
herein and y4
isotype when referring to the entire set of constant regions on the heavy
chain).
(0018] Any protein comprising an Fc portion of an inununoglobulin, an analog
of the Fc
poraon of an immunoglobulin, or a fragment of the Fc portion of an
inununoglobulin can be
used in accordance with the invention. In particularly preferred embodiments,
such proteins
comprise a protein of interest (e.g. other than an Fc portion of an Ig) fused
to an Fc portion of
an immunoglobulin. The protein of interest may be fused directly, or fused via
a peptide
linker, to the Fc portion. The Fc portion may be fused to the protein of
interest at either
terminus or at both termini. These heterologous fusion proteins are known to
have biologically
activity and have an increased half-life compared to native protein of
interest. One example is a
TNF-alpha receptor protein fused to an Fc portion, for example etanercept
(ENBREL ,
Amgen, USA). Another example is alfacept (Amevive), a fusion protein
comprising an Fc
region of the IgGl subtype fused to the first extracellular domain of human
LFA-3, or
preferably a modified Fc(IgGl)-LFA 3 or other Fc-LFA-3 fusion protein which is
substantially
non-depleting or which has diminished depleting activity. Preferably, as
discussed in relation to
therapeutic antibodies, said fusion protein will preferably be intended to be
non-depleting,
preferably intended not to induce cytolytic activity, particularly ADCC or
ADCP, of a cell with
which it is associated or bound. ADCC or ADCP, when referring to the activity
mediated by a
fusion protein can also interchangeably be referred to as fusion protein-
dependent cell-
mediated cytotoxicity (FPDOC) and fusion protein-dependent cell-mediated
phagocytosis
CA 02569196 2006-11-29
WO 2005/118854 PCT/IB2005/002310
(FPDCP). Preferably the Fc portion will be of a subtype having relatively low
binding to the
FcyRIIIa receptor or will be a modified so as to decrease binding to the
FcyRIIIa receptor.
[0019] An additional object of this invention resides in a method of assessing
the response of
5 a subject to a treatment with a protein comprising an Fc portion of the IgG4
subtype,
comprising determining amino acid residue at position 158 of FcyRIIIa
receptor, a Valine at
position 158 being indicative of a lower response to said treatment and a
phenylalanine at
position 158 being indicative of a better response to said treatment.
10 [0020] A further object of this invention is a method of selecting patients
for treatment with
an Fc portion-containing composition, preferably an antibody, intended to be
non-depleting,
preferably which is intended not to induce cytolytic activity, particularly
ADOC or ADCP, of a
cell with which it is associated or bound, the method comprising determining
amino acid
residue at position 158 of FcyRIIIa receptor, and selecting the patients
having a phenylalanine
at position 158 for said treatment. Said method can also be carried out by
determining the
nucleotide present at nucleotide position 559 of the FCG3A cDNA or nucleotide
position
4985 of the FCG3A gene. Preferably, said therapeutic antibody is an IgG4.
[0021] An other object of this invention is a method of assessing the side
effects of a subject
to a treatment with a composition comprising an Fc portion, preferably an
antibody, intended
to be non-depleting, preferably which is intended not to induce cytolytic
activity, particularly
ADCC or ADCP, of a cell with which it is associated or bound, comprising
determ;ning amino
acid residue at position 158 of FcyRIlla receptor, a Valine at position 158
being indicative of a
higher side effects to said treatment and a phenylalanine at position 158
being indicative of a
lower side effects to said treatment. Again, said method can also be camed out
by determining
the nucleotide present at nucleotide position 559 of the FCG3A cDNA or
nucleotide position
4985 of the FCU3A gene.
[0022] The methods of the invention can be used particularly advantageously in
methods of
treatment of disease. Preferably, said FcyRIIIa receptor genotype is
indicative of the
CA 02569196 2006-11-29
WO 2005/118854 PCT/IB2005/002310
11
consequences of said therapy. In one example, the methods of the invention are
used to
determine the amount and administration regimen of a therapeutic composition
to be
administered to a subject. In another example, the methods of the invention
are used to select
a therapeutic composition to be administered to a subject - for example
therapeutic
compositions that are less likely to induce ADCC or ADCP of an antibody-bound
cell or less
likely to induce cytolrine release by immune cells.
[0023] If a subject is determined to have a Valine at position 158 of the
FcyRIIIa receptor,
this subject is deemed to have increased susceptibility to side effects and/or
decreased
response to treatment (eg. the treatment is less efficacious). Such a subject
may be more
advantageously treated with a composition or according to a regimen likely to
provide
increased efficacy in such a subject. An example of a composition that could
be more suitable
for such a patient is an antibody compound having decreased ADCC or ADCP
activity, or
decreased binding to the FcyRIIIa receptor compared to another antibody which
specifically
binds the same biological target protein. In one aspect, binding of an
antibody to the FcyRIIIa
receptor can be assessed using the methods of Koene et al, Blood (1997) or
using the BIAcore
system (Okasalfl A et al. J Mol Biol 2004, 336: 1239-1249). Alternatively, an
antibody is
administered to a subject who has a Valine at position 158 of the said
FcyRIIIa receptor at
different doses or administration schedules, preferably lower doses, with
conjoint treatment
(such as premedication to treat or prevent cytolflne release syndrome) than a
subject having a
phenylalanine at position 158. Preferably said administration schedule, dosing
or selection of
compound is intended to result in decreased lysis of antibody-bound cells
and/or decreased
cytoldne release. Antibodies having decreased ability to bind the FcyRIIIa
receptor are known
and can be prepared according to methods. In certain embodiments, an antibody
will contain
an amino acid modification to diminish the interaction with Fc receptors, e.g.
by altering
certain residues within the Fc region that are known to diminish the
interaction with Fc
receptors, or, using well known methods, to experimentally identify amino acid
alterations
within the Fc region (or elsewhere within the Ig) that can reduce the binding
to Fc receptors.
In the case of Fc regions from the IgGl subtype in antibodies where depletion
is not desired,
modifications can be carried out as described in Shields et al. (T. Biol. Chem
276:6591-6604);
CA 02569196 2006-11-29
WO 2005/118854 PCT/IB2005/002310
12
PCT Publication No. WO 2004/ 126750), the disclosures of which are
incorporated herein by
reference.
[0024] The invention also provides a method for monitoring or treating a
subject, the method
comprising:
determining the FCGR3A genotype in the subject, wherein the genotype is
correlated
with an increased or decreased likelihood of responding to a treatment with an
Fc portion-
containing composition, particularly an antibody, or with an increased or
decreased likelihood
of having a side effect as a result of said antibody treatment; and
monitoring said subject for the development of a side effect to treatment or
for
efficacy of the antibody treatment.
[0025] The invention further provides a method for treating a subject, the
method
comprising:
determining FCGR3A genotype in the subject, wherein the genotype is correlated
with
an increased or decreased response to treatment with an Fc portion-containing
composition,
or with increased or decreased likelihood of exhibiting side effects as a
result of said antibody
treatment; and
selecting or determining a suitable therapy for treatment of the subject.
Preferably the
step of selecting or determining a suitable therapy for treatment of the
subject comprises
selecting a composition to be administered to the subject. In other aspects,
the step of or
determining a suitable therapy for treatment of the subject comprises
selecting a dosage,
frequency of administration or duration of treatment with a therapeutic
composition to
administer to the subject. Preferably the method further comprises (c)
administering a therapy,
preferably a composition, selected in step (b) to the subject. Preferably, the
composition to be
administered to a subject is an antibody composition having decreased binding
to a FcyRIIIa
polypeptide, preferably to an FcyRIIIa polypeptide comprising a Valine at
position 158.
[0026] In another aspect, when a subject is determined to have an increased
susceptibility to
developing side effects upon treatment with an Fc portion-containing
composition, particularly
CA 02569196 2006-11-29
WO 2005/118854 PCT/IB2005/002310
13
an antibody (e.g. cytokine release syndrome) or when a.subject is determined
to have decreased
response (efficacy) to treatment with an Fc portion-containing composition,
particularly an
antibody, the patient can be administered a treatment intended to either
reduce said side
effects or to improve the efficacy of the treatment, for example to inhibit
ADCC or ADCP
mediated by NK and/or macrophages.
Test aanpaitm assessnzmt anl clinical trials
[0027] The methods of the invention can also be used advantageously in a
clinical trial to
assess subjects' therapeutic response to treatment with an Fc portion-
containing composition,
particularly an antibody, or susceptibility to side effects induced by such
treatment. Such
methods are expected to be useful for example to determine whether one, two or
more arms
of a clinical trial are balanced for the number of subjects having increased
or decreased
response to the treatment. The method of the invention can also be used to
select subjects for
inclusion in a clinical trial. Methods of the invention are expected to be
especially useful in
clinical trials where efficacy or side effects of a test composition are to be
assessed.
[0028] Use of a method of the invention in a clinical trial is paracularly
suitable where the test
composition, is known to or suspected of being capable of inducing an antibody-
mediated side
effect, particularly an NK cell or macrophage- mediated side effect such as
cytokine release
syndrome, or wherein the test composition is suspected to bind, via its Fc
region to a FcyRIIIa
polypeptide, preferably to an FcyRIIIa polypeptide comprising a valine at
position 158.
[0029] For instance, the methods of the invention can comprise determ;,,;,,g
in a subject the
FCGR3A genotype, wherein said genotype places said subject into a subgroup for
treatment or
analysis in a clinical trial, or in a subgroup for inclusion in a clinical
trial.
[0030] In one aspect, the invention provides a method for the clinical testing
of a test
composition, the method comprising the following steps.
(a) administering a test composition to a plurality of individuals; and
CA 02569196 2006-11-29
WO 2005/118854 PCT/IB2005/002310
14
(b) identifying one or a plurality of individuals having a first FCGR3A
genotype and
one or a pluraliry of individuals having a second FCGR3A genotype, preferably
wherein
a first FCGR3A genotype indicates increased susceptibilityto side effects or
decreased
response to treatment with an Fc portion-containing composition, particularly
an antibody,
a second FCGR3A genotype indicates decreased susceptibility to side effects or
decreased response to treatment with an Fc poraon-contauiing composition,
particularly an
antibody. The method may optionally further comprise: (a) assessing the
response to said test
composition in said individual(s) having a first FCGR3A genotype; and/or (b)
assessing the
response to said test composition in the individuals having a second FCGR3A
genotype.
Preferably, the response to said test composition is assessed both in
individuals having said
first and said second FCGR3A genotype. Preferably said response is assessed
separately in said
first and second subpopulations of individuals. Assessing the response to said
test composition
preferablycomprises assessing therapeutic efficacy of the test composition.
[0031] The invention also concerns a method for the clinical testing of a test
composition, the
method comprising the following steps.
- identifying a first population of individuals having a first FCGR3A genotype
and a
second population of individuals having a second FCGR3A genotype; -
- administering a test composition to individuals of said first and/or said
second
population of individuals. In one embodiment, the test composition is
administered to
individuals of said first population but not to individuals of said second
population. In one
embodiment, the test composition is administered to individuals of said second
population but
not to individuals of said first population. In another embodiment, the test
composition is
administered to the individuals of both said first and said second
populations. Preferably the
test composition is an Fc portion-containing composition, particularly an
antibody.
[0032] In the methods of monitoring or treating a subject, and in methods of
clinical testing
described herein, the Fc portion-containing composition is preferably intended
to be non-
depleting, preferably which is intended not to induce cytolytic activity,
particularly ADCC or
ADCP, of a cell with which it is associated or bound. Most preferably the Fc
portion-
containing composition comprises an Fc region of subclass G4.
CA 02569196 2006-11-29
WO 2005/118854 PCT/IB2005/002310
DESCRIPTION OF THE FIGURES
FIGURE 1: Genetic organization of the human FCGR3A gene
FIGURE 2: Amino acid sequences of human FcyRIIIa- 158F (SEQ ID NO:7)
5 FIGURE 3: Nucleic acid sequence of human FCGR3A-158F (SEQ ID NO:8)
DETAILED DESCRIPTION
[0033] As used herein, the following terms have the meanings ascribed to them
unless
specified otherwise.
10 [0034] The term "antibody," as used herein, refers to polyclonal and
monoclonal antibodies,
as well as fragments and derivatives thereof. Depending on the type of
constant domain in the
heavy chains, antibodies are assigned to one of five major classes: IgA, IgD,
IgE, IgG, and
IgM. Several of these are further divided into subclasses or isotypes, such as
IgGl, IgG2,
IgG3, IgG4, and the like. An exemplary immunoglobulin (antibody) structural
unit comprises a
15 tetramer. Each tetramer is composed of two identical pairs of polypeptide
chains, each pair
having one "light" (about 25 kDa) and one "heavy' chain (about 50-70 kDa). The
N terminus
of each chain defines a variable region of about 100 to 110 or more amino
acids that is
primarily responsible for antigen recognition. The terms variable light chain
(VL) and variable
heavy chain (Vj) refer to these light and heavy chains respectively. The heavy-
chain constant
domains that correspond to the different classes of immunoglobulins are termed
"alpha,"
"delta," "epsilon," "gamma" and "mu," respectively. The subunit structures and
three-
dimensional configurations of different classes of immunoglobulins are well
known. IgG
and/or IgM are the preferr-ed classes of antibodies employed in this
invention, with IgG being
particularly preferred, because they are the most common antibodies in the
physiological
situation, because they are most easily made in a laboratory setting, and
because IgGs are
specifically recognized by Fc gamma receptors. Preferably the antibody of this
invention is a
monoclonal antibody. Particularly preferred are humanized, chimeric, human, or
otherwise-
human-suitable antibodies.
[0035] A "therapeutic antibody" refers to any antibody, derivatized antibody,
or antibody
CA 02569196 2006-11-29
WO 2005/118854 PCT/IB2005/002310
16
fragment that can be safely used in humans for, e.g. the therapeutic methods
described herein.
Human-suitable antibodies include all types of humanized, chimeric, or fully
human antibodies,
or any antibodies in which at least a portion of the antibodies is derived
from humans or
otherwise modified so as to avoid the inunune response that is provoked when
native non-
human antibodies are used.
[0036] For the purposes of the present invention, a "humanized" antibody
refers to an
antibody in which the constant and variable framework region of one or more
human
immunoglobulins is fused with the binding region, e.g. the R, of an animal
immunoglobulin. Such humanized antibodies are designed to maintain the binding
specificity
of the non-human antibody from which the binding regions are derived, but to
avoid an
immune reaction against the non-human antibody.
[0037] A "chimeric antibody" is an antibody molecule in which (a) the constant
region, or a
portion thereof, is altered, replaced or exchanged so that the antigen binding
site (variable
region) is linked to a constant region of a different or altered class,
effector function and/or
species, or an entirely different molecule which confers new properties to the
chimeric
antibody, e.g., an enzyme, toxin, hormone, growth factor, drug, etc.; or (b)
the variable region,
or a portion thereof, is altered, replaced or exchanged with a variable region
having a different
or altered antigen specificity. In preferred embodiments of the present
invention, the chimeric
antibody nevertheless maintains the Fc region of the immunoglobulin,
preferably a human Fc
region, thereby allowing interactions with human Fc receptors on the surface
of target cells.
[0038] The term "specifically binds to" means that an antibody can bind
preferably in a
competitive binding assay to the binding partner, e.g. an NK receptor such as
NKp30, NKp44,
NKp46, NKG2D or CD94/NKG2A, a membrane antigen such as CD2, CD3, CD4, CD25,
CD28, 40, CD11/18, ICAM, alpha-4-integrin or G"IT.A4, as assessed using
either
recombinant forms of the proteins, epitopes therein, or native proteins
present on the surface
of isolated NK or relevant target cells. Competitive binding assays and other
methods for
determining specific binding are further described below and are well known in
the art.
[0039] By "ADCC or "antibody dependent cell-mediated cytotoxicity' as used
herein is meant
CA 02569196 2006-11-29
WO 2005/118854 PCT/IB2005/002310
17
the cell-mediated reaction wherein nonspecific cytotoxic cells that express
FcyRs, particularly
FcyRIIIa, recognize bound antibody on a target cell and subsequently cause
lysis of the target
cell.
[0040] By "ADCP'or antibody dependent cell-mediated phagocytosis as used
herein is meant
the cell-mediated reaction wherein nonspecific cytotoxic cells that express
FcyRs, particularly
FcyRIIIa, recognize bound antibody on a target cell and subsequently cause
phagocytosis of
the target cell.
[0041] By "amino acid modification" herein is meant an amino acid
substitution, insertion,
and/or deletion in a polypeptide sequence. The preferred amino acid
modification herein is a
substitution.
[0042] The terms "isolated", "purified" or "biologically pure" refer to
material that is
substantially or essentially free from components which normally accompany it
as found in its
native state. Purity and homogeneity are typically determined using analytical
chem.istry
techniques such as polyacrylamide gel electrophoresis or high performance
liquid
chromatography. A protein that is the predominant species present in a
preparation is
substantially purified.
[0043] The term "biological sample" as used herein includes but is not limited
to a biological
fluid (for example serum, lymph, blood), cell sample or tissue sample (for
example bone
marrow).
[0044] The temis "polypeptide," "peptide" and "protein" are used
interchangeably herein to
refer to a polymer of amino acid residues. The terms apply to amino acid
polymers in which
one or more amino acid residue is an artificial chemical mimetic of a
corresponding naturally
occurring amino acid, as well as to naturally occurring amino acid polymers
and non-naturally
occurring amino acid polymer.
[0045] A "label" or a "detectable moiety' is a composition detectable by
spectroscopic,
photochemical, biochemical, immunochemical, or chemical means. For example,
useful labels
include 3zP, fluorescent dyes, electron-dense reagents, enzymes (e.g., as
commonly used in an
CA 02569196 2006-11-29
WO 2005/118854 PCT/IB2005/002310
18
ELISA), biotin, digoxigenin, or haptens and proteins which can be made
detectable, e.g., by
incorporating a radiolabel into the peptide or used to detect antibodies
specifically reactive
with the peptide.
[0046] The term "recombinant" when used with reference, e.g., to a cell, or
nucleic acid,
protein, or vector, indicates that the cell, nucleic acid, protein or vector,
has been modified by
the introduction of a heterologous nucleic acid or protein or the alteration
of a native nucleic
acid or protein, or that the cell is derived from a cell so modified. Thus,
for example,
recombinant cells express genes that are not found within the native
(nonrecombinant) form
of the cell or express native genes that are otherwise abnormally expressed,
under expressed or
not expressed at all.
[0047] In one example, a composition comprising an Fc portion, preferably a
therapeutic
antibody or an Fc fusion protein, blocks or neutralizes a key cytokine or a
receptor-ligand
interaction in the immune system. The therapeutic activity of said antibody
does not need or is
not based on the NK cell cytolytic activity and the ADCC induction. The
therapeutic
antibodies may by polyclonal or, preferably, monoclonal. They may be produced
by
hybridomas or by recombinant cells engineered to express the desired variable
and constant
domains. Methods for producing antibodies in hybridomas are known, for example
US Patent
No 6,677,138 and PCT Publication No. WO 00/58499, the disclosures of which are
incorporated herein by reference. The antibodies may by single chain
antibodies or other
antibody derivatives retaining the antigen specificity and the lower hinge
region or a variant
thereof. These may be polyfunctional antibodies, recombinant antibodies, ScFv,
humanized
antibodies, or variants thereof. Therapeutic antibodies are specific for
surface antigens, e.g.,
membrane antigens or for free antigens. In preferred aspects, therapeutic
antibodies may be
specific for membrane bound cytokines such as TNFa, or for cell surface
molecules such as T
lymphocyte or B-lymphocyte cell surface molecules, or an NK receptor. Examples
of
membrane bound molecules include NKp30, NKp44, NKp46, NKG2D, FcyRIIIa or
94/NKG2A, CD2, CD3, CD4, CD25, CD28, 40, CD11/18, IC',AM, alpha-4-integrin or
T lymphocyte-associated antigen-4 (also known as CTLA 4 and CD152 antigen). In
another
preferred embodiment, antibodies are used in treatment of transplantation
rejection, including
CA 02569196 2006-11-29
WO 2005/118854 PCT/IB2005/002310
19
graft vs. host or host vs. graft disease, such as for example the non-
depleting IgGl anti-CD25
antibodies (such as basiliximab and daclizumab), anti-CD25 antibodies of the
IgG4 type,
antibodies inhibiting T cell costimulatory receptors, anti-CD28 antibodies
where T cell
depletion and/or APC mediated proliferation is to be avoided. The therapeutic
antibodies are
preferably of the IgG4 type, or the IgGl type and comprising an amino acid
modification or
so produced so as to have diminished binding to FcyRIIIa.
[0048] Typical examples of therapeutic antibodies to be used in accordance
with the invention
that need not be depleting toward a target cell are listed in Table 1.
Table 1
Ab specificity DCI Commercial IgG Typical Indications
name
And-TNFa CDP571 Humicade 4 Crohn's disease
Rheumatoid Arthritis
Anti-CD4 clenoliximab 4 Rheumatoid Arthritis
Anti-CD4 IDEG 151 4 Rheumatoid Arthritis
Anti- 40 Ch5D12 4 Multi pie sclerosis
Anti-CD18 1B4 4 Acute inflammatory disease
Anti-CD11/18 Hu23F2G 4 Multiple sclerosis ; Stroke ;
or anti-LFA1 Myocardial infarction
Anti-CD33 gemtuzumab Mylotarg Cancer
ozogamicin,
Anti-EGFR ABX EGF, Cancer
pamtumumab
Anti-CILA4 CP-675,206, Cancer, infectious disease
MDX-CTLA4
Anti-alpha-4 natalizumab Crohn's, IBD, multiple
integrins sclerosis
Anti ICAM- 1 BIRR 1 Stroke
Anti CD3 anti-CD3 OKT3 Orthoclone Allograft rejection
(IgG2a murine
Anti-CD25 basiliximab, Transplantation
daclizumab
Anti-CD16 WO 03/101485 Immune disorders
(FcyRIIIa) characterised by autoantibodies
Fc-LFA- alfacept Amevive
3(CD2-
binding)
fusion protein
CA 02569196 2006-11-29
WO 2005/118854 PCT/IB2005/002310
[0049] Within the context of the present invention, a subject or patient
includes any
mammalian subject or patient, more preferably a human subject or patient.
5 NK crll rUlating av*ies
[0050] In a preferred embodiment, therapeutic antibodies that are not intended
or required to
be depleting to a target cell are antibodies that regulate the function of NK
cells by binding to
membrane bound molecules on NK Cells. NK cell activity is regulated by a
complex
mechanism, that involves both stimulating and inhibitory signals. Accordingly,
effective NK
10 cell-mediated therapy involving inducing the activation or proliferation of
NK cells can be
achieved both by a stimulation of these cells or a neutralization of
inhibitory signals. Such
approaches will be useful in the treatment of tumors or infectious disease,
for example, where
NK cells mediate target cell lysis, but where the therapeutic antibody binding
an NK cell
receptor does not contribute to lysis of the NK cell. Other therapies are
directed to reducing
15 NK cell activity. These therapies may involve activating inhibitory NK cell
receptors or
blocking activatory NK cell receptors, and may be useful for the treatment of
immune
disorders such as autoinunune disorders or in transplantation.
[0051] As used herein, "NK" cells refers to a sub-population of lymphocytes
that is involved
20 in non-conventional immunity. NK cells can be identified by virtue of
certain characteristics
and biological properties, such as the expression of specific surface antigens
including
FcyRIIIa, CD56 and/or CD57, the absence of the alpha/beta or gamma/delta TCR
complex
on the cell surface, the ability to bind to and kill cells that fail to
express "self" MHCIHLA
antigens by the activation of specific cytolytic enzymes, the ability to kill
tumor cells or other
diseased cells that express a ligand for NK activating receptors, and the
ability to release
protein molecules called cytolflnes that stimulate or inhibit the immune
response. Any of these
characteristics and activities can be used to identifyNK ceIls, using methods
well known in the
art.
CA 02569196 2006-11-29
WO 2005/118854 PCT/IB2005/002310
21
[0052] Within the context of this invention, "active" or "activated" NK cells
designate
biologically active NK cells, more particularly NK cells having the capacity
of lysing target
cells. For instance, an "active" NK cell is able to kill cells that express an
NK activating
receptor-ligand and fails to express "self" MHC/HLA antigens (KIR-incompatible
cells).
Examples of suitable target cells for use in redirected killing assays are
P815 and K562 cells,
but any of a number of cell types can be used and are well known in the art
(see, e.g., Sivori et
al. (1997) J. Exp. Med. 186: 1129-1136; Vitale et al. (1998) J. Exp. Med. 187:
2065-2072;
Pessino et al. (1998) J. Exp. Med. 188: 953-960; Neri et al. (2001) Clin.
Diag. Lab. Immun.
8:1131-1135). "Active" or "activated" cells can also be identified by any
other property or
activity known in the art as associated with NK activity, such as cytokine
(e.g. IFN ganuna and
TNF-alpha production of increases in free intracellular calcium levels.
[0053] NK cells are negatively regulated by major histocompatibilitycomplex
(MHC) class I-
specific inhibitory receptors (Karre et al., 1986; Ohlen et al, 1989; the
disclosure of which is
incorporated herein by reference). These specific receptors bind to
polymorphic determinants
of major histocompatibility complex (MHG) class I molecules or HLA and inhibit
natural lflller
(NK) cell lysis. In humans, a family of receptors termed killer Ig-like
receptors (KIRs)
recognize groups of HLA class I alleles.
[0054] In the present invention, the term "an antibody that block(s) the
inhibitory receptor of
a NK cell" refers to a compound, preferably an antibody or a fragment thereof,
specific for an
NK cell inhibitory receptor, i.e. KIR or NKG2A/C of NK cells, and neutralizing
inhibitory
signals of the KIR or NKG2A/C. Preferably, the compound, preferably an
antibody or a
fragment thereof, is able to block the interaction between HLA and an
inhibitory receptor of a
NK cell. The antibodies may by polyclonal or, preferably, monoclonal. They may
be produced
by hybridomas or by recombinant cells engineered to express the desired
variable and constant
domains. The antibodies may be single chain antibodies or other antibody
derivatives retaining
the antigen specificity and the lower hinge region or a variant thereof such
as a Fab fragment, a
Fab'2 fragment, a CDR and a ScFv. These may be polyfunctional antibodies,
recombinant
antibodies, humanized antibodies, or variants thereof.
CA 02569196 2006-11-29
WO 2005/118854 PCT/IB2005/002310
22
[0055] Preferably, the antibody that blocks the inhibitory receptor of a NK
cell is an antibody
or a fragment thereof, that neutralizes the inhibitory signal of at least one
inhibitory receptor
selected in the group consisting of KIR2DL2, KIR2DL3, KIR2DL1, KIR3DL1,
KIR3DL2,
NKG2A and NKG2C Optionally, the antibody can be selected from the group
consisting of
GL183 (KIR2DL2, L3, available from Immunotech, France and Beclion Dickinson,
USA);
EB6 (KIR2DL1, available from Immunotech, France and Beckton Dicldnson, USA);
AZ138
(KIR3DL1, available from Moretta et al, Univ. Genova, Italy) ; Q66 (KIR3DL2,
available from
Immunotech, France) ; Z270 (NKG2A, available from Immunotech, France) ; P25
(NKG2A/C, available from Moretta et al, Univ. Genova, Ital~ ; and DX9, Z27
(KIR3DL1,
available from Immunotech, France and Beckton Dickinson, USA).
[0056] As used herein, the term "activating NK receptor" refers to any
molecule on the
surface of NK cells that, when stimulated, causes a measurable increase in any
property or
activity known in the art as associated with NK activity, such as cytokine
(e.g. IFN gamma and
TNF-alpha production, increases in intracellular free calcium levels, or the
ability to target cells
in a redirected killing assay as described, e.g. elsewhere in the present
specification. Examples
of such receptors include the natural cytotoxicity receptoss (NCR) known as
NKp30, NKp44,
and NKp46. Another particularly preferred example is the NKG2D receptor, which
is also
present on CD4+ and CD8+ T cells as well as on gamma-delta T cells. Methods of
determining whether an NK cell is active or not are described in more detail
below.
[0057] Several distinct NK-specific receptors have been identified that play
an important role
in the NK cell mediated recognition and killing of HI.A Class I deficient
target cells. These
receptors, termed NKp30, NKp46 and NKp44, are members of the Ig superfamily.
Their
cross-linking, induced by specific mAbs, leads to a strong NK cell activation
resulting in
increased intracellular Ca++ levels, triggering of cytotoxicity, and
lymphokine release.
Importantly, mAb-mediated activation of NKp30, NKp46, and/or NKp44 results. in
an
activation of NK cytotoxicity against many types of target cells. These
findings provide
evidence for a central role of these receptors in natural cytotoxicity.
[0058] Antibodies to NK cell receptors may be produced by any of a variety of
techniques
CA 02569196 2006-11-29
WO 2005/118854 PCT/IB2005/002310
23
known in the art. Typically, they are produced by immunization of a non-human
animal,
preferably a mouse, with an immunogen comprising an activating receptor
present on the
surface of NK cells. The activating receptor may comprise entire NK cells or
cell membranes,
the full length sequence of a receptor such as NKp30 (see, e.g., PCT WO
01/36630, the
disclosure of which is herein incorporated by reference in its entiret~, NKp44
(see, e.g., Vitale
et al. (1998) J. Exp. Med. 187:2065-2072, the disclosure of which is herein
incorporated by
reference in its entiret~, or NKp46 (see, e.g., Sivori et al. (1997) J. Exp.
Med. 186:1129-1136;
Pessino et al. (1998) J. Exp. Med. 188:953-960; the disclosures of which are
herein
incorporated by reference in their entireties), or a4ragment or derivative
thereof, typically an
immunogenic fragment, i.e., a portion of the polypeptide comprising an epitope
exposed on
the surface of the cell expressing any of these receptors, or any other
receptor whose
stimulation leads to the activation of NK cells. Such fragments typically
contain at least 7
consecutive amino acids of the mature polypeptide sequence, even more
preferably at least 10
consecutive amino acids thereof. They are essentially derived from the
extracellular domain of
the receptor. It will be appreciated that any receptor present on the surface
of NK cells that,
upon stimulation, leads to the activation of the cells as measured by
cytotoxicity, increase in
intracellular free calcium levels, cytokine production, or any other method
known in the art can
be used for the generation of antibodies. In preferred embodiments, the
activating NK cell
receptor used to generate antibodies is a human receptor.
[0059] In one embodiment, the immunogen comprises a wild-type human NKp30,
NKp44,
or NKp46 polypeptide in a lipid membrane, typically at the surface of a cell.
In a specific
embodiment, the immunogen comprises intact NK cells, particularly intact human
NK cells,
optionally treated or lysed. Examples of preferred isolated antibodies of the
invention include
isolated antibodies that are directed against at least one isolated amino acid
compound of the
invention, and that can induce an increase of at least about 4, preferably at
least about 5, more
preferably at least about 6 times, of the natural cytotoxicity triggered by a
NK cell placed in the
presence of a target cell in a 1:1 ratio. In a specific embodiment, the
antibody binds essentially
the same epitope as any of the following monoclonal antibodies: AZ20, A76,
Z25, Z231, or
BAB281. Such antibodies are referred to herein as "AZ20-like antibodies," "A76-
like
antibodies," etc. The term "binds to substantially the same epitope or
determinant as "the
CA 02569196 2006-11-29
WO 2005/118854 PCT/IB2005/002310
24
monoclonal antibody x means that an antibody "can compete" with x, where x is
AZ20, A76,
etc. The identification of one or more antibodies that bind(s) to
substantially the same epitope
as the monoclonal antibody in question can be readily determined using any one
of variety of
immunological screening assays in which antibody competition can be assessed.
All such assays
are routine in the art (see, e.g., US. Pat. No. 5,660,827, issued Aug. 26,
1997, which is
specifically incorporated herein by reference). It will be understood that
actually determining
the epitope to which the antibody binds is not in any way required to identify
an antibody that
binds to the same or substantially the same epitope as the monoclonal antibody
in question.
In other aspects, an antibody may bind a molecule other than a natural
cytotoxicity receptor
(NCR) or inhibitor receptor on an NK cell. For example, an antibody may bind
any other NK
surface molecule, including activating molecules, costimulatory receptors or
adhesion
molecules, examples including but not limited to NKp80, 2B4 (CD244), NKRP-1A
(CD161),
BY55 ( 160), PEN5 (CD162R), L-selectin (CD62L) and CD31.
Methals for typing m&z,i&ials
[0060] According to the invention the term FCGR3A gene refers to any nucleic
acid molecule
encoding a FcyRIIIa polypeptide in a subject. This term includes, in
particular, genomic DNA,
cDNA, RNA (pre-rRNA, messenger RNA, etc.), etc. or any synthetic nucleic acid
comprising
all or part of the sequence thereof. Synthetic nucleic acid includes cDNA,
prepared from
RNAs, and containing at least a portion of a sequence of the FCGR3A genomic
DNA as for
example one or more introns or a portion containing one or more mutations.
Most preferably,
the term FCGR3A gene refers to genomic DNA, cDNA or mRNA, typically genomic
DNA
or mRNA. The FCGR3A gene is preferably a human FCGR3A gene or nucleic acid,
i.e.,
comprises the sequence of a nucleic acid encoding all or part of a FcyRIIIa
polypeptide having
the sequence of human FcyRIIIa polypeptide. Such nucleic acids can be isolated
or prepared
according to known techniques. For instance, they may be isolated from gene
libraries or
banks, by hybridization techniques. They can also be genetically or chemically
synthesized. The
genetic organization of a human FCGR3A gene is depicted on Figure 1. The amino
acid
sequence of human FcyRIIIa is represented figure 2. Amino acid position 158 is
numbered
CA 02569196 2006-11-29
WO 2005/118854 PCT/IB2005/002310
from residue 1 of the mature protein, and corresponds to residue 176 of the
pre-protein having
a signal peptide. The sequence of a wild type FCGR3A gene is represented on
figure 3 (see
also Genbank accession Number AL590385 or NM 000569 for partial sequence).
5 [0061] Within the context of this invention, a portion or part means at
least 3 nucleotides
(e.g., a codon), preferably at least 9 nucleotides, even more preferably at
least 15 nucleotides,
and can contain as much as 1000 nucleotides. Such a portion can be obtained by
any technique
well known in the art, e.g., enzymatic and/or chemical cleavage, chemical
synthesis or a
combination thereof. The sequence of a portion of a FCGR3A gene encoding amino
acid
10 position 158 is represented below, for sake of clarity:
cDNA 540 550 560 570 580
genomic DNA 4970 4980 4990 5000.
15 158F allele tcctacttctgcagggggctttttgggagtaaaaatgtgtcttca
S Y F C R G L F G S K N V S S
158V allele tcctacttctgcagggggcttgttgggagtaaaaatgtgtcttca
S Y F C R G L V G S K N V S S
[0062] As indicated throughout the present disclosure, the invention comprises
methods
comprising determining in vitro the FCGR3A 158 genotype of a subject. It will
be appreciated
that in any of the embodiments of the invention referring to determining the
FCGR3A
genotype, it will be readily possible to determine the genotype by determining
the phenotype,
that is by determining the identity of the amino acid residue present (or
encoded) at position
158 of the FcyRIIIa polypeptide. Thus, determining the FCGR3A genotype can
comprise or
consist of determining the identity of the amino acid residue present (or
encoded) at position
158 of the FcyRIIIa polypeptide.
[0063] Preferably, homozygosity for a Valine at position 158 of the FcyRIIIa
receptor is
indicative of a decreased response to said treatment in texms of efficacy, and
a phenylalanine at
position 158 of the FcyRIIIa receptor (heterozygous or homozygous) is
indicative of an
increased response to said treatment. With respect to side effects from an
antibody treatment,
preferably homozygosity for a Valine at position 158 of the FcyRIIIa receptor
is indicative of a
CA 02569196 2006-11-29
WO 2005/118854 PCT/IB2005/002310
26
increased susceptibility to side effects and a phenylalanine at position 158
of the FcyRIIIa
receptor is indicative of decreased side effects or susceptibilityto side
effects to said treatment.
The impact of the genotype of the FcyRIIIa receptor at position 158 on the
therapeutic
response or the side effects is thus generally more strongly marked, that is
an decreased
response to treatment and/or increased side effects, when the subject is
homozygote at
position 158 for Valine. However, subjects homozygous or heterozygous for
phenylalanine at
position 158 have similar responses to treatment, the responses of both of
these groups being
increased compared to that observed in patients who are homozygous at position
158 for
Valine. Subjects homozygous or heterozygous for phenylalanine at position 158
also have
similar to side effects from an antibody treatment, the susceptibility to side
effects of both of
these groups being decreased compared to that observed in patients who are
homozygous at
position 158 for Valine.
[0064] Genotyping the FCGR3A gene or corresponding polypeptide in said subject
may be
achieved by various techniques, comprising analysing the coding nucleic acid
molecules or the
encoded polypeptide. Analysis may comprise sequencing, migration,
electrophoresis, immuno-
techniques, amplifications, specific digestions or hybridisations, etc.
[0065] In a particular embodiment, determining amino acid residue at position
158 of
FcyRIIIa receptor comprises a step of sequencing the FCGR3A receptor gene or
RNA or a
portion thereof comprising the nucleotides encoding amino acid residue 158.
[0066] In an other particular embodiment, determining amino acid residue at
position 158 of
FcyRIIIa receptor comprises a step of amplifying the FCGR3A receptor gene or
RNA or a
portion thereof comprising the nucleotides encoding amino acid residue 158.
Amplification
may be performed by polymerase chain reaction (PCR), such as simple PQZ, RT-
PCR or
nested PCR, for instance, using conventional methods and primers. A preferred
genotyping
method, including the disclosure of nucleic acid primers, for determining
amino acid residue at
position 158 of FcyRIIIa receptor is provided in Dall'Ozz.o S, Andres C,
Bardos P, Watier H, and
Thibault G, J Immunol Methods. 2003 Jun 1;277(1-2):185-92, which disclosure,
including but not
CA 02569196 2006-11-29
WO 2005/118854 PCT/IB2005/002310
27
limited to specific nucleotide sequences disclosed therein, is incorporated
herein by reference in its
entirety.
[0067] In this regard, amplification primers for use in this invention more
preferably contain
less than about 50 nucleotides even more preferably less than 30 nucleotides,
typically less than
about 25 or 20 nucleotides. Also, preferred primers usually contain at least
5, preferably at least
8 nucleotides, to ensure specificity. The sequence of the primer can be
prepared based on the
sequence of the FCGR3A gene, to allow full complementarity therewith,
preferably. The probe
may be labelled using any known techniques such as radioactivity,
fluorescence, enzymatic,
chemical, etc. This labeling can use for example Phosphor 32, biotin (16-
dUTP), digoxygenin
(11-dUTP). It should be understood that the present invention shall not be
bound or limited
by particular detection or labelling techniques. The primers may further
comprise restriction
sites to introduce allele-specific restriction sites in the amplified nucleic
acids, as disclosed
below.
[0068] Specific examples of such amplification primers are, for instance, SEQ
ID NO: 1-4.
[0069] It should be understood that other primers can be designed by the
skilled artisan, such
as any fragment of the FCGR3A gene, for use in the amplification step and
especially a pair of
primers comprising a forward sequence and a reverse sequence wherein said
primers of said
pair hybridize with a region of a FCGR3A gene and allow amplification of at
least a portion of
the FCGR3A gene containing codon 158. In a preferred embodiment, each pair of
primers
comprises at least one primer that is complementary, and overlaps with codon
158, and allows
to discriminate between 158V (gtt) and 158F (ttt). The amplification
conditions may also be
adjusted by the skilled person, based on common general lmowledge and the
guidance
contained in the specification.
[0070] In a particular embodiment, the method of the present invention thus
comprises a
PCR amplification of a portion of the FCGR3A mRNA or gDNA with specific
oligonucleotide primers, in the cell or in the biological sample, said portion
comprising codon
CA 02569196 2006-11-29
WO 2005/118854 PCT/IB2005/002310
28
158, and a direct or indirect analysis of PCR products, e.g., by
electrophoresis, particularly
Denaturing Gel Gradient Electrophoresis (DGGE).
[0071] In an other particular embodiment, determining amino acid residue at
position 158 of
FcyRIIIa receptor comprises a step of allele-specific restriction enzyme
digestion. This can be
done by using restriction enzymes that cleave the coding sequence of a
particular allele (e.g.,
the 158V allele) and that do not cleave the other allele (e.g., the 158F
allele, or vice versa).
Where such allele-specific restriction enzyme sites are not present naturally
in the sequence,
they may be introduced therein artificially, by amplifying the nucleic acid
with allele-specific
amplification primers containing such a site in their sequence. Upon
amplification, determining
the presence of an allele may be camed out by analyzing the digestion
products, for instance by
electrophoresis. This technique also allows to discrinunate subjects that are
homozygous or
heterozygous for the selected allele.
[0072] Examples of allele-specific amplification primers include for instance
SEQ ID NO: 3.
SEQ ID N0:3 introduces the first 3 nucleotides of the NlaIII site (5'-CATG3').
Cleavage
occurs after G. This primer comprises 11 bases that do not hybridise with
FOGR3A, that
extend the primer in order to facilitate electrophoretic analysis of the
amplification products)
and 21 bases that hybridise to FCGR3A, except for nucleotide 31 (A) which
creates the
restriction site.
[0073] In a further particular embodiment, determin;ng amino acid residue at
position 158 of
FcyRIIIa receptor comprises a step of hybridization of the FCGR3A receptor
gene or RNA or
a portion thereof comprising the nucleotides encoding amino acid residue 158,
with a nucleic
acid probe specific for the genotype Valine or Phenylalanine, and determining
the presence or
absence of hybrids.
[0074] It should be understood that the above methods can be used either alone
or in various
combinations. Furthermore, other techniques known to the sldlled person may be
used as well
to determine the FCGR3A-158 genotype, such as any method employing
amplification (e.g.
CA 02569196 2006-11-29
WO 2005/118854 PCT/IB2005/002310
29
PCR), specific primers, specific probes, migration, etc., typically
quantitative RT-PCR, LCR
(Ligase Chain Reaction), TMA (Transcription Mediated Amplification), PCE (an
enzyme
amplified immunoassa~ and bDNA (branched DNA signal amplification) assays.
[0075] In a preferred embodiment of this invention, determining amino acid
residue at
position 158 of FcyRIIIa receptor comprises:
- obtaining genomic DNA from a biological sample,
- amplifymg the FcyRIIIa receptor gene or a portion thereof comprising the
nucleotides
encoding amino acid residue 158, and
- determining amino acid residue at position 158 of said FcyRIIIa receptor
gene.
[0076] Amplification can be accomplished with any specific technique such as
PCR, including
nested PCR, using specific primers as described above. In a most preferred
embodiment,
determining amino acid residue at position 158 is performed by allele-specific
restriction
enzyme digestion. In that case, the method comprises:
- obtaining genomic DNA fmm a biological sample,
- amplifying the FcyRIIIa receptor gene or a portion thereof comprising the
nucleotides
encoding anuno acid residue 158,
- introducing an allele-specific restriction site,
- digesting the nucleic acids with the enzyme specific for said restriction
site and,
- analysing the digestion products, i.e., by electrophoresis, the presence of
digestion
products being indicative of the presence of the allele.
[0077] In an other particular embodiment, the genotype is determined by a
method
comprising : total (or messenger) RNA extraction from cell or biological
sample or biological
fluid in -zitiv or ex zizq optionally cDNA synthesis, (PCR) amplification with
FGGR3A-specific
oligonucleotide primers, and analysis of PCR products.
[0078] The method of this invention may also comprise determining amino acid
residue at
position 158 of FcyRIIIa receptor directly by sequencing the FcyRIIIa receptor
polypeptide or
CA 02569196 2006-11-29
WO 2005/118854 PCT/IB2005/002310
a portion thereof comprising amino acid residue 158 or by using reagents
specific for each
allele of the FcyRIIIa polypeptide. This can be determined by any suitable
technique known to
the skilled artisan, including by immuno-assay (ELISA, EIA, RIA, etc.). This
can be made
using any affinity reagent specific for a FcyRIIIa158 polypeptide, more
preferably any antibody
5 or fragment or derivative thereof. In a particular embodiment, the
FcyRIIIa158 polypeptide is
detected with an anti- FcyRIIIa158 antibody (or a fragment thereof) that
discriminates between
FcyRIIIa158V and FcyRIIIa158F, more preferably a monoclonal antibody. The
antibody (or
affinity reagent) may be labelled by any suitable method (radioactivity,
fluorescence, enzymatic,
chemical, etc). Alternatively, FcyRIIIa158 antibody immune complexes may be
revealed
10 (and/or quantified) using a second reagent (e.g., antibod)), labelled, that
binds to the anti-
FcyRIIIa158 antibody, for instance.
[0079] The above methods are based on the genotyping of FCGR3A158 in a
biological
sample of the subject. The biological sample may be any sample containing a
FCGR3A gene or
15 corresponding polypeptide, particularly blood, bone marrow, lymph node or a
fluid,
particularly blood or urine, that contains a FCGR3A158 gene or polypeptide.
Furthermore,
because the FoGR3A 158 gene is generally present within the cells, tissues or
fluids mentioned
above, the method of this invention usually uses a sample treated to render
the gene or
polypeptide available for detection or analysis. Treatment may comprise any
conventional
20 fixation techniques, cell lysis (mechanical or chemical or physical), or
any other conventional
method used in immunohistology or biology, for instance.
[0080] The method is particularly suited to determine the response of a
subject to a
therapeutic antibody treatment. In this regard, in a particular embodiment,
the subject has an a
25 disorder and the therapeutic antibody treatment aims at ameliorating the
disorder, and where
the antibody need not be depleting toward a cell to which it is bound.
Membrane targets of
the antibodies are discussed above.
CA 02569196 2006-11-29
WO 2005/118854 PCT/IB2005/002310
31
[0081] Further aspects and advantages of this invention will be disclosed in
the following
examples, which should be regarded as illustrative and not limiting the scope
of this
application.
EXAMPLE 1
Genotyping of FCGR3A-158V/F polymorphism
MATERIALS AND METHODS
FCGR3A-158V/F genotyping
[0082] All samples are analysed in the same laboratory and DNA is extracted
using standard
procedures including precautions to avoid cross-contamination. DNA can be
isolated from
peripheral blood, bone marrow or lymph node. Genotyping of FCUR3A -158V/F
polymorphism is performed as described by Koene et al (Koene et al, Blood.
1997;90:1109-
1114) with a nested PCR followed by an allele-specific restriction enzyme
digestion. Briefly,
two FCGR3A specific primers (5'-ATATTTACAGAATGGCACAGG-3', SEQ ID NO: 1;
5'-GACTTGGTAOOC.AGGTTGAA 3', SEQ ID NO: 2) (Eurobio, Les Ulis, France) are
used
to amplify a 1.2 kb fragment containing the polymorphic site. The PCR assay is
performed
with 1.25 g of genomic DNA, 200 ng of each primer, 200 mol/L of each dN'IP
(MBI
Fermentas, Vilnius, Lithuania) and 1 U of Taq DNA polymerase (Promega,
Charbonniere,
France) as recommended by the manufacturer. This first PCR consists in 10 min
at 95 C, then
35 cycles (each consisting in 3 steps at 95 C for 1 min, 57 C for 1.5 min, 72
C for 1.5 min) and
8 min at 72 C to achieve complete extension. The second PCR used primers (5'-
ATCAGATTCGATCCTACTTCTGCAGGGGGCAT 3' SEQ ID NO: 3; 5'-
ACGTGCTGAGCTI'GAGTGATGGTGATGTTCAG3' SEQ ID NO: 4) (Eurobio) amplify
a 94 bp fragment and create a NlaIII restriction site only in the FCGR3A-158V
allele. This
nested PCR is performed with 1 L of the amplified DNA, 150 ng of each primer,
200
mol/L of each dNIP and 1 U of Taq DNA polymerase. The first cycle consists in
5 min at
95 C then 35 cycles (each consisting in 3 steps at 95 C for 1 min, 64 C for 1
min, 72 C for 1
min) and 9.5 min at 72 C to complete extension. The amplified DNA (10 L) is
then digested
with 10 U of NlaIII (New England Biolabs, Ifitchin, England) for 12 h at 37 C
and separated
CA 02569196 2006-11-29
WO 2005/118854 PCT/IB2005/002310
32
by electrophoresis on a 8% polyacrylamide gel. After staining with ethidium
bromide, DNA
bands are visualized with UV light. For homozygous FCGR3A-158F patients, only
one
undigested band (94 bp) is visible. Three bands (94 bp, 61 bp and 33 bp) are
seen in
heterozygous individuals whereas for homozygous FC,GR3A-158V patients, only
two digested
bands (61 bp and 33 bp) are obtained.
DEMANDE OU BREVET VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVET COMPREND
PLUS D'UN TOME.
CECI EST LE TOME 1 DE 2
CONTENANT LES PAGES 1 A 32
NOTE : Pour les tomes additionels, veuillez contacter le Bureau canadien des
brevets
JUMBO APPLICATIONS/PATENTS
THIS SECTION OF THE APPLICATION/PATENT CONTAINS MORE THAN ONE
VOLUME
THIS IS VOLUME 1 OF 2
CONTAINING PAGES 1 TO 32
NOTE: For additional volumes, please contact the Canadian Patent Office
NOM DU FICHIER / FILE NAME:
NOTE POUR LE TOME / VOLUME NOTE:
