Note: Descriptions are shown in the official language in which they were submitted.
CA 02573494 2007-01-10
WO 2006/010147 PCT/US2005/024946
CONTROL OF BIOFILM FORMATION
[1] FIELD OF THE INVENTION
[2] The present invention generally relates to methods and compounds useful
for
reducing or preventing invasion of a bacterium into a tissue comprising
modulating
the expression of a cysB gene in the bacterium. The present invention also
relates to
an in vivo method for reducing or preventing the formation of a biofilm in a
tissue and
to a method for controlling or preventing a chronic bacterial infection.
[3] BACKGROUND
[4] Chronic infections involving biofilms are serious medical problems
throughout the world. For example, biofilms are involved in 65% of human
bacterial
infections. Biofilms are involved in prostatitis, biliary tract infections,
urinary tract
infections, cystitis, lung infections, sinus infections, ear infections, acne,
rosacea,
dental caries, periodontitis, nosocomial infections, open wounds, and chronic
wounds.
[5] Bacterial biofilms exist in natural, medical, and engineering
environrnents.
The biofilms offer a selective advantage to a microorganism to ensure its
survival, or
allow it a certain amount of time to exist in a dormant state until suitable
growth
conditions arise. Unfortunately, this selective advantage poses serious
threats to
animal health, especially human health.
[6] Compounds that modify biofilm formation would have a substantial medical
impact by treating many chronic infections, reducing catheter- and medical
device-
related infections, and treating lung and ear infections. The potential market
for
potent biofilm inhibitors is exemplified by the sheer number of cases in
wllich
1
CA 02573494 2007-01-10
WO 2006/010147 PCT/US2005/024946
potent biofilm inhibitors is exemplified by the sheer number of cases in which
biofilms contribute to medical problems. The inhibitors may also be used to
cure,
treat, or prevent a variety of conditions, such as, but are not limited to,
arterial
damage, gastritis, urinary tract infections, pyelonephritis, cystitis, otitis
media, otitis
externa, leprosy, tuberculosis, benign prostatic hyperplasia, chronic
prostatitis,
chronic lung infections of humans with cystic fibrosis, osteomyelitis,
bloodstream
infections, skin infections, open or chronic wound infections, cirrhosis, and
any other
acute or chronic infection that involves or possesses a biofilm.
[7] In the United States, the market for antibiotics is greater than $8.5
billion.
After cardiovascular therapeutics, the sales of antibiotics are the second
largest drug
market in the United States. The antibiotic market is fueled by the continued
increase
in resistance to conventional antibiotics. Approximately 70% of bacteria found
in
hospitals resist at least one of the most commonly prescribed antibiotics.
Because
biofilms appear to reduce or prevent the efficacy of antibiotics, introduction
of
biofilm inhibitors could significantly affect the antibiotic market.
[8] Using the protection of biofilms, microbes can resist antibiotics at a
concentration ranging from 1 to 1.5 thousand times higher than the amount used
in
conventional antibiotic therapy. During an infection, bacteria surrounded by
biofilms
are rarely resolved by the immune defense mechanisms of the host. Costerton,
Stewart, and Greenberg, leaders in the field of biofilms, have proposed that
in a
chronic infection, a biofilm gives bacteria a selective advantage by reducing
the
penetration of an antibiotic into the depths of the tissue needed to
completely
eradicate the bacteria's existence.
[9] Traditionally, antibiotics are discovered using the susceptibility test
methods
established by the National Committee for Clinical Laboratory Standards
(NCCLS).
The methods identify compounds that specifically affect growth or killing of
bacteria.
These methods involve inoculation of bacterial species into a suitable growth
medium, followed by the addition of a test compound, and then plot of the
bacterial
2
CA 02573494 2007-01-10
WO 2006/010147 PCT/US2005/024946
growth over a time period post-incubation. These antibiotics would not be
effective
therapeutics against chronic infections involving biofilms because the NCCLS
methods do not test compounds against bacteria in a preformed biofilm.
Consistently,
numerous publications have reported a difference in gene transcription in
bacteria
living in biofilms from bacteria in suspension, which further explains the
failure of
conventional antibiotics to eradicate biofilm infections (Sauer, K. et al. J.
Bacteriol.
2001, 183:6579-6589).
[10] Biofilm inhibitors can provide an alternative mechanism of action from
conventional antibiotics. For example, successful treatment of nosocomial
infections
currently requires an administration of a combination of products, such as
amoxicillin/clavulanate and quinupristin/dalfopristin, or an adininistration
of two
antibiotics simultaneously. In one study of urinary catheters, rifampin was
unable to
eradicate methicillin-resistant Staphylococcus aureus in a biofilm but was
effective
against planktonic, or suspended cells (Jones, S.M., et. al., "Effect of
vancomycin and
rifampicin on methicillin-resistant Staphylococcus aureus biofilms", Lancet.
357:40-
41, 2001). Biofilm inhibitors act on the biological mechanisms that provide
bacteria
protection from antibiotics and from a host's immune system. Biofilm
inhibitors may
be used to "clear the way" for the antibiotics to penetrate the affected cells
and
eradicate the infection.
[11] Moreover, bacteria have no known resistance to biofilm inhibitors.
Biofilm
inhibitors are not likely to trigger growth-resistance mechanisms or affect
the growth
of the normal human flora. Thus, biofilm inhibitors could potentially extend
the
product life of antibiotics.
[12] Biofilm inhibitors can also be employed for the treatment of acne. Acne
vulgaris is the most common cutaneous disorder. Propionibacterium acnes, which
is
the predominant microorganism occurring in acne, reside in biofilms. Its
existence in
a biofilm matrix provides a protective, physical barrier that limits the
effectiveness of
antimicrobial agents (Burkhart, C.N. et. al., "Microbiology's principle of
biofilms as a
3
CA 02573494 2007-01-10
WO 2006/010147 PCT/US2005/024946
major factor in the pathogenesis of acne vulgaris", International J. of
Dennatology.
42:925-927, 2003). Biofilm inhibitors may be used to effectively prevent,
control,
reduce, or eradicate P. acnes biofilms in acne.
[13] Plaque biofilms contribute to cavities and and periodontitis. Plaque
biofilms
accumulate due to bacterial colonization of Streptococci spp. such as S.
mutans, S.
sobrinas, S. gordonii, and Porphyromonas gingivalis, and Actinomyces spp
(Demuth,
D. et al. Discrete Protein Determinant Directs the Species-Species Adherence
of
Porphyromonas gingivalis to Oral Streptococci, Infection and Immunity, 2001,
69(9)
p5736-5741; Xie, H., et al. Intergeneric Communication in Dental Plaque
Biofilms. J.
Bacteriol. 2000, 182(24), p7067-7069). The primary colonizing bacteria of
plaque
accumulation are Streptococci spp., and P. gingivalis is a leading cause of
periodontitis (Demuth, D. et al. Discrete Protein Determinant Directs the
Species-
Species Adlierence of Porphyromonas gingivalis to Oral Streptococci, Infection
and
Immunity, 2001, 69(9) p5736-5741). Biofilm inhibitors can be employed to
prevent
microorganisms from adhering to surfaces that may be porous, soft, hard, semi-
soft,
semi-hard, regenerating, or non-regenerating. These surfaces can be teeth, the
polyurethane material of central venous catheters, or metal, alloy, or
polymeric
surfaces of medical devices, or regenerating proteins of cellular membranes of
mammals, or the enamel of teeth. These inhibitors can be coated on or
impregnated
into these surfaces prior to use, or administered at a concentration
surrounding these
surfaces to control, reduce, or eradicate the microorganisms adhering to these
surfaces.
[14] Chronic wound infections are difficult to eradicate or routinely recur.
Diabetic
foot ulcers, venous leg ulcers, arterial leg ulcers, and pressure ulcers are
examples of
the most common types of chronic wounds. Diabetic foot ulcers appear to be the
most prevalent. These wounds are typically colonized by multiple species of
bacteria
including Staphylococcus spp., Streptococcus spp., Pseudomonas spp. and Gram-
negative bacilli (Lipsky, B. Medical Treatment of Diabetic Foot Infections.
Clin.
Infect. Dis. 2004, 39, p.S104-14). Based on clinical evidence, researchers
know that
4
CA 02573494 2007-01-10
WO 2006/010147 PCT/US2005/024946
multiple microorganisms can cause or contribute to chronic wound infections.
Only
recently have biofilms been implicated in these infections (Harrison-Balestra,
C. et
al. A Wound-isolated Pseudomonas aeruginosa Grow a Biofilm In Vitro Within 10
Hours and Is Visualized by Light Microscopy. Dermatol Surg 2003, 29,p.631-635;
Edwards, R., et al. Bacteria and wound healing. Curr Opin Infect Dis, 2004,
17, p.91-
96). In fact, it is estimated that approximately 140,000 amputations occur
each year
in the United States due to chronic wound infections that could not be treated
with
conventional antibiotics. Unfortunately, treating these infections with high
doses of
antibiotics over long periods of time can contribute to the development of
antibiotic
resistance (Howell-Jones, R.S., et al. A review of the microbiology,
antibiotic usage
and resistance in chronic skin wounds. J. Antimicrob. Ther. January 2005).
Biofilm
inhibitors in a combination therapy with antibiotics may provide an
alternative to the
treatment of chronic wounds.
[15] Recent publications describe the cycles of the pathogenesis of numerous
species of bacteria involving biofilms. For example, Escherichia coli, which
causes
recurrent urinary tract infections, undergo a cycle of binding to and then
invading
bladder epithelial cells, forming a biofilm intracellularly, modifying its
morphology
intracellularly, and then bursting out of cells to repeat the cycle of
pathogenesis
(Justice, S. et al. Differentiation and development pathways of uropathogenic
Escherichia coli in urinary tract pathogenesis. PNAS, 2004, 101(5): 1333-
1338). The
authors suggest that this repetitive cycle of pathogenesis of E. coli may
explain the
recurrence of the infection.
[16] In 1997 Finlay, B. et al. reported that numerous bacteria, including
Staphylococci, Streptococci, Bordetella per=tussis., Neisseria spp.,
Helicobactoy
pylori, Yersinia spp. adhere to mammalian cells during their pathogenesis. The
authors hypothesized that the adherence would lead to an invasion of the host
cell.
Later publications confirm this hypothesis (Cossart, P. Science, 2004, 304,
p.242-248;
see additional references below). A few of these publications presented
hypotheses
similar to Mulvey, M, et al, which explained the invasion of these bacteria
into cells.
CA 02573494 2007-01-10
WO 2006/010147 PCT/US2005/024946
(Mulvey, M, et al. "Induction and Evasion of Host Defenses by Type 1-Piliated
Uropathogenic E. coli" Science 1998, 282 p.1494-1497). Mulvey, M. et al.
stated
invasion of E. coli into epithelial cells provide protection from the host's
immune
response to allow a build up of a large bacterial population.
[17] Cellular invasion and biofilms appear to be integral to the pathogenesis
of
most, if not all bacteria. Pseudomonas aeruginosa has been shown to invade
epithelial cells during lung infections (Leroy-Dudal, J. et al. Microbes and
Infection,
2004, 6, p.875-881). P. aeruginosa is the principal infectious organism found
in the
lungs of cystic fibrosis patients, and the bacteria exist within a biofilm.
Antibiotics
like tobramcyin, and current antibacterial compounds do not provide effective
treatment against biofilms of chronic infections, because antibiotic therapy
fails to
eradicate the biofilm.
[18] Gram-negative bacteria share conserved mechanisms of bacterial
pathogenesis
involving cellular invasion and biofilms. For example, Haemophilus influenzae
invade epithelial cells and form biofilms (Hardy, G. et al., Methods Mol.
Med., 2003,
71, p.1-18; Greiner, L. et al., Infection and Immunity, 2004, 72(7) p.4249-
4260).
Burkholderia spp. invade epithelial cells and form biofilm (Utaisincharoen, P,
et al.
Microb Pathog. 2005, 38(2-3) p.107-112; Schwab, U. et al. Infection and
Immunity,
2003, 71(11), p.6607-6609). Klebsiella pneumoniae invade epithelial cells and
form
biofilm (Cortes, G et al. Infection and Immunity. 2002, 70(3), p.1075-1080;
Lavender,
H, et al. Infection and Immunity. 2004, 72(8), p.4888-4890). Salmonella spp.
invade
epithelial cells and form biofilms (Cossart, P. Science, 2004, 304, p.242-248;
Boddicker, J. et al. Mol. Microbiol. 2002, 45(5), p.1255-1265). Yersiniapestis
invade
epithelial cells and form biofilms (Cossart, P. Science, 2004, 304, p.242-248;
Jarrett,
C. et al. J. Infect. Dis., 2004, 190, p.783-792). Neisseria gonorrhea invade
epithelial
cells and form biofilms (Edwards, J. et al., Cellular Micro., 2002, 4(9),
p.585-
598;Greiner, L. et al. Infection and Immunity. 2004, 73(4), p.1964-1970).
6
CA 02573494 2007-01-10
WO 2006/010147 PCT/US2005/024946
[19] These Gram-negative bacteria cause lung, ear, and sinus infections,
gonorrhoeae, plague, diarrhea, typhoid fever, and other infectious diseases.
E. coli
and P. aeruginosa are two of the most widely studied Gram-negative pathogens.
Researchers believe that the pathogenesis of these bacteria involves invasion
of host
cells and formation of biofilms. These models have enabled those skilled in
the art to
understand the pathogenesis of other Gram-negative bacteria.
[20] Gram-positive bacteria also share conserved mechanisms of bacterial
pathogenesis involving cellular invasion and biofilms. Staphylococcus aureus
invade
epithelial cells and form biofilms (Menzies, B, et al. Curr Opin Infect Dis,
2003, 16,
p.225-229; Ando, E, et al. Acta Med Okayama, 2004, 58(4), p.207-14).
Streptococcus pyogenes invade epithelial cells and form biofilms (Cywes, C. et
al.,
Nature, 2001,414, p.648-652; Conley, J, et al. J. Clin. Micro., 2003, 41(9),
p.4043-
4048).
[21] Accordingly, for the reasons discussed above and others, there exists an
unmet
need for methods and compounds that can reduce or prevent the invasion of
bacteria
and the formation of biofilm in human cells.
[22] SUMMARY OF INVENTION
[23] Accordingly, the present invention provides a method for reducing or
preventing the invasion of a bacteriuin into a tissue comprising modulating
the
expression of a cysB gene in the bacterium.
[24] The present invention further provides an in vivo method for reducing or
preventing the formation of a biofilm in a tissue comprising modulating
expression of
a cysB gene in a cell capable of biofilm formation.
7
CA 02573494 2007-01-10
WO 2006/010147 PCT/US2005/024946
[25] The present invention also provides a method for controlling or
preventing a
chronic bacterial infection in a subject in need thereof comprising modulating
the
expression of a cysB gene in a bacterium that causes or contributes to the
chronic
bacterial infection.
[26] BRIEF DESCRIPTION OF THE DRAWINGS
[27] Figure 1 shows the chemical synthesis of an analog of ursolic acid.
[28] Figure 2 shows a confocal microscopy image of an IBC of E coli from a
bladder of a control mouse inoculated with E. coli UTI89.
[29] Figure 3 shows a confocal microscopy image of a small collection of E
coli
from a bladder of a mouse inoculated with E. coli UT189 and corosolic acid.
[30] Figure 4 shows a confocal microscopy image of an IBC from a bladder of a
mouse inoculated with wild type E. coli UT189.
[31] Figure 5 shows a confocal microscopy image of a loose collection of E
coli
from a bladder of a mouse inoculated with 50:50 E. coli UT189 cysB -/ wild
type E.
coli UIT89.
[32] Figure 6 shows a confocal microscopy image of a loose collection of E
coli
from a bladder of a mouse inoculated with 50:50 E. coli UT189 cysB -/ wild
type E.
coli UIT89.
8
CA 02573494 2007-01-10
WO 2006/010147 PCT/US2005/024946
[33] DESCRIPTION OF THE INVENTION
[34] Definitions:
[35] "Acceptable carrier" refers to a carrier that is compatible with the
other
ingredients of the formulation and is not deleterious to the recipient
thereof.
[36] "Reducing or inhibiting" in reference to a biofilm refers to the
prevention of
biofilm formation or growth, reduction in the rate of biofilm formation or
growth,
partial or complete inhibition of biofilm formation or growth.
[37] "Modulates" or "modulating" refers to up-regulation or down-regulation of
a
gene's replication or expression.
[38] The present invention provides a method for reducing or preventing the
invasion of a bacterium into a tissue comprising modulating the expression of
a cysB
gene in the bacterium.
[39] The cysB gene may be modulated in a number of ways. For example, N-
acetyl-serine and sulfur limitation up-regulate cysB. Lochowska, A. et al.,
Functional
Dissection of the LysR-type CysB Transcriptional Regulator. J. Biol. Chem.
2001,
276, 2098-2107. In addition, like other LysR type regulators, cysB can repress
itself.
Lilic, M. et al., Identification of the CysB-regulated gene, hslJ, related to
the
Escherichia coli novobiocin resistance phenotype, FEMS Micro. Letters. 2003,
224:239-246.
9
CA 02573494 2007-01-10
WO 2006/010147 PCT/US2005/024946
[40] In one embodiment, a tissue is contacted with a composition comprising a
compound selected from the group consisting of ursolic acid or asiatic acid,
or a
pharmaceutically acceptable salt of such compound, or hydrate of such
compound, or
solvate of such compound, an N-oxide of such compound, or combination thereof.
In
a preferred embodiment, the compound is corosolic acid, 30-hydroxyursolic
acid, 20-
hydroxyursolic acid, 2-hydroxyoleanolic acid, and madecassic acid. In another
preferred embodiment, the compound is pygenic acid (A, B, or C), euscaphic
acid,
and tormentic acid.
[41] The compounds used in the present invention may be isolated from a plant
as
previously described or prepared semi-synthetically (Eldridge, G, et al; Anal.
Chem.
2002, 74, p. 3963-3971). If prepared semi-synthetically, a typical starting
material
may be ursolic acid, oleanolic acid, corosolic acid, asiatic acid, madecassic
acid or
other compound used in the present invention. In designing semi-synthetic
strategies
to prepare analogs, certain positions of the scaffold of the coinpounds are
important
for modulating biofilm inhibition, while other positions improve
bioavailability of the
compounds, which could expand the therapeutic range of the compounds by
reducing
certain cellular toxicities in mammals.
CA 02573494 2007-01-10
WO 2006/010147 PCT/US2005/024946
[42] Herbal preparations of Centella asiatica plant extracts, which contain
hundreds to thousands of compounds, have been used throughout history in
numerous
countries for the treatment of dermatological conditions, including wound
healing,
such as bums and scar reduction. Herbal preparations of Centella asiatica
plant
extracts have also be used to treat astluna, cholera, measles, diarrhea,
epilepsy,
jaundice, syphilis, and cystitis. These herbal preparations are commercially
available.
The preparations may include asiaticoside, madecassoside, brahmoside,
brahminoside, asiatic acid, and madecassic acid. Syntex Research Centre, for
example, marketed a titrated plant extract of Centella asiatica for the
treatment of
bums; the extract contained asiatic acid, madecassic acid, and asiaticoside.
However,
the commercially-available herbal preparations of Centella asiatica plant
extracts are
not pure compounds.Those skilled in the art have not been able to determine
which
pure compounds in the extracts are responsible for the medicinal benefits.
11
CA 02573494 2007-01-10
WO 2006/010147 PCT/US2005/024946
[43] As previously demonstrated in the examples of U.S. patent application
serial
no. 11/085,279, ursolic acid and asiatic acid modulate the expression of a
cysB gene
in E. coli. In modulating the cysB gene, the compound could also modulate the
expression of genes under the control or within the same biochemical pathway
as
cysB. The cysB protein is a transcriptional regulator of the LysR family of
genes.
The transcriptional regulators of this family have helix-turn-helix DNA
binding
motifs at their amino-terminus. The cysB protein is required for the full
expression of
the cys genes, which are involved in the biosynthesis of cysteine. The family
of
genes, cysDIJK are under the transcriptional control of the cysB gene. cysD,
cysl,
cysJ, and cysK are proteins involved in the biosynthesis of cysteine. CysK has
been
shown to respond to extracellular signals in bacteria (Sturgill, et al. J.
Bacteriol.
2004,186(22) p. 7610-7617). YbiK is under the direct control of cysB and
participates
in glutathione intracellular transport. b0829 is involved in glutathione
transport.
b1729 is suspected to be a carboxylate transporter based upon sequence
liomology.
b1729 is conserved amongst Gram-negative and Grain-positive bacteria
(litip://Nk,ww.iicbi.nlm.nih.gov/ sutils/genomtable.cgi). Accordingly,
preferably, the
compound used in the present invention modulates the expression of cysD, cysl,
cysJ,
cysK, ybiK, b0829, b1729, yeeD, and/or yeeE.
[44] Members of the family of LysR transcriptional regulators, like CysB, have
been demonstrated to regulate diverse metabolic processes. cysB exhibits
direct
control of the biosynthesis of cysteine (Verschueren et al., at p. 260). The
cysB gene
is involved, directly or indirectly, in glutathione intracellular transport,
carbon source
utilization, alanine dehydrogenases, and the arginine dependent system. There
is also
recently published evidence that suggests that cysB responds directly or
indirectly to
extracellular signals (Sturgill, et al. J. Bacteriol. 2004,186(22) p. 7610-
7617). CysB
regulates the expression of CysK, cysM, cysA, which are closely linked to crr,
ptsl,
and ptsH (Byrne, et al. J. Bacteriol. 170(7) p. 3150-3157). Ptsl has been
implicated in
the sensing of external carbohydrates (Alder, et al. PNAS, 1974, 71, p.2895-
2899).
12
CA 02573494 2007-01-10
WO 2006/010147 PCT/US2005/024946
[45] In one embodiment, the cysB gene in a Gram-negative bacterium is
modulated. Preferably, the bacterium is Escherichia coli, Pseudomonas
aeruginosa,
Haemophilus influenzae.
[46] As previously discussed herein, Gram-positive and Gram-negative bacteria
invade their cellular hosts through conserved mechanisms of bacterial
pathogenesis.
The process enables the bacteria to evade the hosts' immune responses to allow
the
bacteria to increase their population. Therefore, compounds which can reduce
bacterial invasion would significantly assist the immune system in the
eradication of
these pathogens. A reduction in bacterial invasion into cells would also
increase the
efficiency and potency of conventional antibiotics. Niels Moller-Frimodt
demonstrated that antibiotics efficiently killed bacteria in the urine in a
urinary tract
infection, but were less effective in killing the bacteria in the bladder or
tissues
(Moller-Frimodt, N. Int. J. of Antimicrob Agents, 2002, 19, p.546-553).
13
CA 02573494 2007-01-10
WO 2006/010147 PCT/US2005/024946
[47] The cysB gene is genetically conserved among different species of
bacteria,
such as Gram-negative bacteria. Verschueren, et al., Acta Cryst. (2001) D57,
260-
262; Byrne et al., J. Bacteriol. 1988 170(7):3150-3157. In fact, cysB is
conserved
among Pseudomonas sp. including, but not limited to, P. aeruginosa, P. putida,
and
P. syringae. (http://www.ncbi.nlm.nih.gov/sutils/genom_table.cgi). (Blast
search of
the cysB gene at the Microbial Genomics database at the National Center for
Biotechnology Information (NCBI) of the National Institutes of Health (NIH)).
The
cysB gene is also genetically conserved among the following species of
bacteria:
Vibrio sp. (e.g. V. harveyi and V. cholera), Proteus mirablis, Burkholderia
sp. (e.g. B.
fongorum, B. mallei, and B. cepacia), Klebsiella sp., Haemophilus influenza,
Neisseria meningitides, Bordetella per=tussis, Yersinia pestis, Salmonella
typhimurium, and Acinetobacter sp. (http://www.ncbi.nlm.nih.gov
/sutils/genom_table.cgi. Blast search of the cysB gene at the Microbial
Genomics
database at NCBI of NIH). The cysB gene is also genetically conserved among
the
Gram-positive bacteria of Bacillus sp. including, but not limited to, B.
subtilis, B.
cereus, and B. anthracis. (http://~iNrw,.ncbi.nl.m.nih.gov/sutils/genom
table.cgi).
(Blast search of the cysB gene at the Microbial Genomics database at NCBI of
NIH;
van der Ploeg, J.R.; FEMS Microbiol. Lett. 2001, 201:29-35).
[48] The cysB gene is involved in the invasion of a bacterium into a cell. The
cell
may be mammalian cells, preferably epithelial cells. As demonstrated in the
examples herein, the removal of a cysB gene from E. coli resulted in a
significant
reduction in invasion of E. coli into bladder epithelial cells as compared to
wild-type
E. coli.
[49] In another embodiment, the method reduces or prevents the invasion of a
bacterium into a mammalian tissue. Preferably, the mammalian tissue is a
murine
tissue. More preferably, the mammalian tissue is a human tissue. Still
preferably, the
human tissue is a bladder, a kidney, or a prostate.
14
CA 02573494 2007-01-10
WO 2006/010147 PCT/US2005/024946
[50] It has been previously shown that E. coli invades the kidney and prostate
of
humans. E. coli causes pyelonephritis and prostatitis, which are infectious
diseases
that can lead to death. (Russo, T., et al. Medical and economic impact of
extraintestinal infections due to Escherichia coli: focus on an increasingly
important
endemic problem. Microbes and Infection. 2003, 5, p.449-456). Research shows
that
E. coli uses the same or similar mechanism to invade kidney and prostate in
humans
to cause these infections as it does to cause urinary tract infections.
Therefore, a
person of ordinary skill in the art would reasonably conclude that modulating
a cysB
gene in E. coli with the compounds described in the specification could also
prevent
invasion and reduce the formation of biofilms in kidneys and prostate.
[51] In still another embodiment, the method reduces or prevents the invasion
of a
bacterium into a plant tissue. Gram-negative bacteria invade and colonize
plants.
The compounds of the invention that modulate cysB can be isolated from a very
few
plants, but to date it has not been shown that they can be isolated from
commercial
food crops or ornamental plants. Pseudomonasputida, a Gram-negative bacterium,
forms biofilms on plants (Arevalo-Ferro, C; Biofilm formation of Pseudomonas
putida
IsoF: the role of quorum sensing as assessed by proteomics. Syst. Appl.
Microbiol.
2005, 28(2) p.87-114.) Plants that produce the compounds used in the present
invention have probably evolved to make these compounds to reduce, prevent, or
control the invasion of bacteria and the formation of biofilms.
[52] The present invention further provides an in vivo method for reducing or
preventing the formation of a biofilm in a tissue comprising modulating
expression of
a cysB gene in a cell capable of biofilm formation.
[53] As demonstrated by the examples herein, cysB plays a significant role in
the
formation of biofilms and the invasion of bacteria into mammalian cells.
Therefore,
the cysB gene is vital for the pathogenesis of bacteria. Compounds used in the
present
invention reduce the formation of biofilms and reduce or prevent the invasion
of
bacteria into mammalian cells. The compounds modulate the expression of a cysB
CA 02573494 2007-01-10
WO 2006/010147 PCT/US2005/024946
gene in a cell capable of biofilm formation.
[54] In an embodiment, the in vivo method comprises contacting the tissue with
a
composition comprising a compound selected from the group of ursolic acid, or
asiatic acid, or a pharmaceutically acceptable salt of such compound, or
hydrate of
such compound, or solvate of such compound, an N-oxide of such compound, or
combination thereof.
[55] Example 5 show that asiatic acid, corosolic acid and madecassic acid,
along
with an antibiotic, can reduce the sustainability of pre-formed biofilms.
Because
biofilm contributes to many chronic bacterial infections, these examples
strongly
support the use of the compounds of the present invention to treat chronic
bacterial
infections, such as lung and ear infections and diabetic foot ulcers. The
results of the
examples demonstrate the distinct difference between the methods used to
discover
biofilm inhibitors and the NCCLS methods used to discover conventional
antibiotics.
Not surprisingly, the NCCLS method fails to identify antibiotics that can
effectively
treat chronic infections involving biofilms.
[56] In a preferred embodiment, the coinpound is corosolic acid, 30-
hydroxyursolic
acid, 20-hydroxyursolic acid, 2-hydroxyoleanolic acid, and madecassic acid. In
another preferred embodiment, the compound is pygenic acid (A, B, or C),
euscaphic
acid, and tormentic acid.
[57] By modulating the cysB gene, the compound could also modulate the
expression of genes under the control or within the same biochemical pathway
as
cysB. Preferably, the compound modulates the expression of cysD, cysl, cysJ,
cysK,
ybiK, b0829, b1729, yeeD, and/or yeeE.
[58] In one embodiment of the present invention, the cysB gene in a Gram-
negative
bacterium is modulated. Preferably, the bacterium is Escherichia coli,
Pseudornonas
16
CA 02573494 2007-01-10
WO 2006/010147 PCT/US2005/024946
aeruginosa, Haemophilus influenzae.
[59] Examples 1, 4, 5, and 6 demonstrate that the compounds of the present
invention serve as biofilm inhibitors by reducing the attachment of
Pseudomonas
aeruginosa, Escherichia coli, Streptococcus mutans, and Streptococcus sobrinas
to
surfaces. The compounds prevent, reduce or inhibit biofilm across a broad
spectrum
of bacteria. The present invention demonstrates that asiatic acid, corosolic
acid,
madecassic acid exhibit inhibition or reduction of biofilm of bacteria that
are
genetically diverse from each other. These bacteria may be Gram-positive or
Gram-
negative and may beclinical or laboratory strains. The examples also
specifically
demonstrate that asiatic acid, corosolic acid and madecassic acid can reduce a
mature
biofilm with antibiotic.
[60] In another embodiment, the method reduces or prevents formation of a
biofilm
in a mammalian tissue. Preferably, the mammalian tissue is a murine tissue.
More
preferably, the mammalian tissue is a human tissue. Still preferably, the
human tissue
is a bladder, a kidney, or a prostate.
[61] In still another embodiment, the method reduces or prevents formation of
a
biofilm in a plant tissue.
[62] The present invention also provides a method for controlling or
preventing a
chronic bacterial infection in a subject in need thereof comprising modulating
the
expression of a cysB gene in a bacterium that causes or contributes to the
chronic
bacterial infection.
[63] Biofilm inhibitors will have a substantial medical impact by treating
many
chronic infections, reducing catlleter- and medical device-related infections,
and
treating lung and ear infections. Biofilm inhibitors may be used to control
microorganisms existing extracellularly or intracellularly of living tissues.
They may
be used to cure, treat, or prevent a variety of conditions, such as, but are
not limited
17
CA 02573494 2007-01-10
WO 2006/010147 PCT/US2005/024946
to, arterial damage, gastritis, urinary tract infections, otitis media,
leprosy,
tuberculosis, benign prostatic hyperplasia, cystitis, pyeolonephritis,
prostatitis, lung,
ear, and sinus infections, periodontitis, cirrhosis, osteomyelitis,
bloodstream
infections, skin infections, acne, rosacea, open or chronic wound infections,
and any
otlier acute or chronic infection that involves or possesses a biofilm.
[64] In an embodiment of the present invention, the modulation of the cysB
gene
comprises administering to a subject in need thereof with an effective amount
of a
composition comprising a compound selected from the group consisting of
ursolic
acid or asiatic acid, or a pharmaceutically acceptable salt of such compound,
or
hydrate of such compound, or solvate of such compound, an N-oxide of such
compound, or combination thereof.
[65] In a preferred embodiment, the compound is corosolic acid, 30-
hydroxyursolic
acid, 20-hydroxyursolic acid, 2-hydroxyoleanolic acid, and madecassic acid. In
another preferred embodiment, the compound is pygenic acid (A, B, or C),
euscaphic
acid, and tormentic acid.
[66] By modulating the cysB gene, the compound could also modulate the
expression of genes under the control or within the same biochemical pathway
as
cysB. Preferably, the compound modulates the expression of cysD, cysl, cysJ,
cysK,
ybiK, b0829, b1729, yeeD, and/or yeeE.
[67] In an embodiment of the present invention, the chronic bacterial
infection is
selected from the group consisting of urinary tract infection, gastritis, lung
infection,
ear infection, cystitis, pyelonephritis, arterial damage, leprosy,
tuberculosis, benign
prostatic hyperplasia, prostatitis, osteomyelitis, bloodstream infection,
cirrhosis, skin
infection, acne, rosacea, open wound infection, chronic wound infection, and
sinus
infection.
18
CA 02573494 2007-01-10
WO 2006/010147 PCT/US2005/024946
[681 Example 7 demonstrates how the compounds of the present invention
interrupt, delay, or prevent the cycle of pathogenesis of other E. coli
infections such
as, but not limited to, pyelonephritis, prostatitis, meningitis, sepsis, and
gastrointestinal infections.
[69] In another embodiment of the present invention, the chronic bacterial
infection
results from an infection of a bacterium. Preferably, the bacterium is a Gram-
negative
bacterium. More preferably, the bacterium is Escherichia coli, Pseudomonas
aeruginosa, or Haemophilus influenzae.
[70] In still another embodiment of the present invention, the chronic
bacterial
infection causes an autoimmune disease in a mammal. Preferably, the mammal is
a
human.
[71] Recent scientific research demonstrates that certain diseases may be
caused
by bacteria that cannot be detected using current technology. For example,
U.S.
patent application no. 20050042214 describes new strains of bacteria that are
ubiquitous and that metabolize complex organic chemical compounds. In
particular,
Novosphingobium aromaticivorans, a Gram-negative bacteria, was discovered and
classified within the Sphingomonas genus. The bacteria appeared to be involved
in
primary biliary cirrhosis, an autoimmune disease. The bacteria may also play a
critical role in other autoimmune diseases such as CRST syndrome (calcinosis,
Raynaud's phenomenon, sclerodactyly, telangiectasia), the sicca syndrome,
autoimmune thyroiditis, or renal tubular acidosis, ankylosing spondylitis,
antiphospholipid syndrome, Crohn's disease, ulcerative colitis, insulin
dependent
diabetes, fibromyalgia, Goodpasture syndrome, Grave's disease, lupus, multiple
sclerosis, myasthenia gravis, myositis, pemphigus vulgaris, rheumatoid
arthritis,
sarcoidosis, scleroderma, or Wegener's granulomatosis. Similar to other Gram-
negative bacteria, the pathogenesis of N. aromaticivorans most likely involves
the
modulation of a cysB gene. Therefore, it is reasonable to conclude that the
present
invention may be used to treat autoimmune diseases caused by bacteria that
invade
19
CA 02573494 2007-01-10
WO 2006/010147 PCT/US2005/024946
and live within a protective biofilm.
[72] Veeh et al. recently demonstrated that conventional microbiology
techniques
failed to detect colonization of bacteria on some human tissues (Veeh, et al.
J. Infect.
Dis. 2003, 188, p. 519-530). With new molecular biology techniques, such as
PCR
and FISH (fluorescent in situ hybridization), more bacteria living in biofilms
are
discovered. For example, new techniques show the prevalence of vaginal
Staphylococcus aureus living in biofilms. As technology advances, researchers
may
uncover additional bacteria living in biofilms that cause or contribute to
diseases. The
present invention may also be used to treat these diseases.
[73] EXAMPLES
[74] The following examples illustrate the testing of compounds of the present
invention and the preparation of formulations comprising these compounds. The,
examples demonstrate the many uses of the compounds and are not intended to
limit
the scope of the present invention.
[75] Example 1
[76] Biofilm Formation of Asiatic acid, Corosolic acid, and Madecassic acid
against Escherichia coli clinical strain UTI89 and laboratory strain JM109.
[77] Biofilm inhibition experiments were conducted using an assay adapted from
the reported protocol described in Pratt and Kolter, 1998, Molecular
Microbiology,
30: 285-293; Li et al., 2001, J. Bacteriol., 183: 897-908. E. coli clinical
strain UT189
was grown in LB in 96 well plates at room temperature for one or two days
without
shaking. E. coli laboratory strain JM109 was grown in LB plus 0.2% glucose in
96
well plates at room temperature for one day without shaking. To quantify the
biofilm
mass, the suspension culture was poured out and the biofilm was washed three
times
with water. The biofilm was stained with 0.1 % crystal violet for 20 minutes.
The
CA 02573494 2007-01-10
WO 2006/010147 PCT/US2005/024946
plates were then washed three times with water. OD reading at 540 nm was
measured
to quantify the biofilm mass at the bottom of the wells. Then 95% ethanol was
added
to dissolve the dye at the bottom and on the wall and the OD reading at 540 nm
was
measured to quantify the total biofilm mass. To study the overall effect of
the
compounds (3.6 mg/mL in 100% ethanol as stock solution), it was added with the
inoculation and a time course of biofilm mass was measured. Appropriate
amounts of
100% ethanol were added to each sample to eliminate the effect of solvent.
Each
condition had 3-4 replicates on each plate and was performed over multiple
days.
[78] The compounds tested had no inhibitory effect on the growth of eitlier
strain
of E. coli when compared to controls, demonstrating that these compounds are
not
antibacterial compounds. Asiatic acid inlzibited biofilm formation of the
UT189 strain
by about 90%, 50%, 15%, and 10% as compared to the controls at 32, 16, 8, and
4
ug/ml, respectively. Corosolic acid inhibited biofilm formation of the UT189
strain by
about 85% at 20 ug/ml. Asiatic acid inhibited biofilm formation of the JM109
strain
by about 80% and 70% as compared to the controls at 10 and 5 ug/ml,
respectively.
Madecassic acid inhibited biofilm formation of the JM109 strain by about 75%
and
60% as compared to the controls at 10 and 5 ug/ml, respectively. These
experiments
confirm that asiatic acid, corosolic acid, madecassic acid, and the compounds
of the
invention inhibit the formation of biofilms against clinical and laboratory
strains of E.
coli.
[79] Example 2
[80] Biofilm Formation in a cysB deletion mutant of E. coli clinical strain
UT189
[81] An isogenic cysB deletion mutant was prepared from E. coli clinical
strain
UT189. Briefly, the construction of a cysB deletion strain was prepared as
follows:
the red-recombinase method was utilized (Murphy, K. C., and K. G. Campellone.
2003. Lambda Red-mediated recombinogenic engineering of enterohemorrhagic and
enteropathogenic E. coli. BMC Mol Biol 4:11). Using the template pKD4, a
linear
21
CA 02573494 2007-01-10
WO 2006/010147 PCT/US2005/024946
knockout product was generated using PCR and the primers 5'-
ACGATGTTCTGATGGCGTCTAAGTGGATGGTTTAACATGAAATTACAACA
ACTTCGGTGTAGGCTGGAGCTGCTTC-3' and 5'-
TCCGGCACCTTCGCTACATAAA AGGTG
CCGAAAATAACGCAAGAAATTATTTTTCATGGGAATTAGC CATGGTCC-3'.
The product was electroporated into red-recombinase expressing UTI89. The
resultant strain had a complete deletion of the cysB coding sequence replaced
by a
kanamycin cassette. The resistance marker was secondarily excised from the
chromosome by transformation with pCP20 expressing the FLP recombinase
(Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of chromosomal
genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A
97:6640-5). The appropriate chromosomal deletion were confinned using cysB ORF
flanking primers 5'- GAGTGTAAAAACACACGTA AGATTTTACGTAACGG-3'
and 5'- AAAACCGCCAGCCAGGCTTTACGTTT-3'.
[82] Using the method described in Example 1, the formation of biofilms
comparing this mutant strain, E. coli UT189 cysB -, to wild type E. coli
clinical strain
UT189 was examined. The growth of E. coli UTI89 cysB - and wild type E. coli
clinical strain UT189 in LB medium were similar as determined by OD.
[83] The mutant cysB strain of E. coli made 75% (n=8) and 66% (n=8) less
biofilm
as compared to wild type E. coli when tested on separate days. These
experiments
confirmed cysB's role in biofilm formation in clinical strains of E. coli,
which are
independent of bacterial growth in LB medium.
[84] Example 3
[85] Antibacterial effect of Asiatic acid on Haemophilus influenzae (ATCC
10211),
E. coli (ATCC 25922), and P. aeruginosa (ATCC 27853).
22
CA 02573494 2007-01-10
WO 2006/010147 PCT/US2005/024946
[86] Using the appropriate NCCLS procedures, the antibacterial effect of
asiatic
acid on Haemophilus influenzae (ATCC 10211), E. coli (ATCC 25922), and P.
aeruginosa (ATCC 27853) was studied at 64 g/mL. Asiatic acid had no
inhibitory
effect represented by a MIC (minimal inhibitory concentration) of greater than
64
g/ml. These results along with the results described in Example 2, further
supports
that asiatic acid is not an antibacterial compound.
[87] Example 4
[88] Effect of Asiatic Acid on Mature Biofilms of clinical isolates of P.
aeruginosa
[89] Clinical isolates of P. aeruginosa from cystic fibrosis patients were
passed
twice on tryptic soy agar with 5% sheep blood after retrieval from -80 C and
then
grown overnight in CAMHB. After dilution of a culture to 0.5 McFarland in
broth
medium, 100 l was transferred in triplicate to wells of a flat-bottom 96-well
microtiter plate. Bacterial biofilms were formed by immersing the pegs of a
modified
polystyrene microtiter lid into this biofilm growth plate, followed by
incubation at
37 C for 20 hours with no movement.
[90] Peg lids were rinsed three times in sterile water, placed onto flat-
bottom
microtiter plates containing biofilm inhibitors at 5 ug/ml in 100 l of CAMHB
per
well and incubated for approximately 40 hours at 37 C.
[91] Pegs were rinsed, placed in a 0.1% (wt/vol) crystal violet solution for
15 min,
rinsed again, and dried for several hours. To solubilize adsorbed crystal
violet, pegs
were incubated in 95% ethanol (150 l per well of a flat-bottom microtiter
plate) for
15 min. The absorbance was read at 590 nm on a plate reader. The wells
containing
asiatic acid were compared to negative controls. Negative controls were
prepared as
stated above but without asiatic acid.
23
CA 02573494 2007-01-10
WO 2006/010147 PCT/US2005/024946
[92] Asiatic acid caused an average detachment of mature biofilms of
approximately 50% at 5 ug/ml compared to the negative controls against
eighteen
clinical isolates of P. aeruginosa. The range of detachment of mature biofilms
against all eighteen clinical isolates was 25% to 74%. This example
demonstrates the
ability of asiatic acid and the compounds of the invention to reduce mature
biofilms in
clinical isolates of P. aeruginosa.
[931 Example 5
[94] Effect of Asiatic acid, Corosolic acid, or Madecassic acid in combination
with
Tobramycin on Biofilm formation of Pseudomonas aeruginosa.
[95] Biofilm formation of P. aeruginosa was evaluated using a standardized
biofilm method with a rotating disk reactor (RDR). This method provides a
model
resembling the formation of biofilms in cystic fibrosis patients. The rotating
disk
reactor consists of a one-liter glass beaker fitted with a drain spout. The
bottom of the
vessel contains a magnetically driven rotor with six 1.27 cm diameter coupons
constructed from polystyrene. The rotor consists of a star-head magnetic stir
bar upon
which a disk was affixed to hold the coupons. The vessel with the stir bar was
placed
on a stir plate and rotated to provide fluid shear. A nutrient solution (AB
Trace
Medium with 0.3 mM glucose, see Table 1 below for composition) was added
through a stopper in the top of the reactor at a flow rate of 5 ml/min. The
reactor
volume was approximately 180 ml and varied slightly between reactors depending
on
the placement of the drain spout and the rotational speed of the rotor. At a
volume of
180 ml, the residence time of the reactors was 36 minutes. The reactors were
operated at room temperature (c.a. 26 C).
24
CA 02573494 2007-01-10
WO 2006/010147 PCT/US2005/024946
[96] Table 1. Composition of the AB Trace Medium used for the RDR test.
Component Formula Concentration (g/1)
Disodium phosphate Na2HPO4 6.0
Monopotassium phosphate KH2PO4 3.0
Sodiunz Chloride NaCI 3.0
Ammonium sulfate (NH4)2SO4 2.0
Magnesium chloride MgC12 0.2
Glucose C6012H6 0.054
Calcium chloride CaC12 0.010
Sodium sulfate Na2SO4 0.011
Ferric chloride FeC13 0.00050
[99] For each test, two RDRs were operated in parallel with one receiving test
compound and the other serving as an untreated control. The RDRs were
sterilized by
autoclave, then filled with sterile medium and inoculated with P. aeruginosa
strain
PAO1. The reactors were then incubated at room temperature in batch mode (no
medium flow) for a period of 24 hours, after which the flow was initiated for
a further
24 hour incubation. Test compounds were dissolved in 10 ml ethanol to achieve
a
concentration of 1.8 mg/ml. After the 48 hours of biofilm development
described
above, the 10 ml of ethanol containing the test compounds were added to the
reactor
to achieve a final concentration of approximately 50, 100, or 200 g/ml.
Control
reactors received 10 ml of ethanol. The reactors were then incubated for an
additional
24 hours in batch (no flow) mode. After this incubation period, the six
coupons were
removed from each reactor and placed in 12-well polystyrene tissue culture
plates
with wells containing either 2 ml of a 100 g/ml tobramycin solution or 2 ml
of
phosphate-buffered saline (PBS). These plates were incubated at room
temperature
for two hours. The coupons were then rinsed by three transfers to plates
containing 2
ml of fresh PBS. For each two RDR reactors run in parallel, four sets of three
coupons were obtained: one set with no test compound treatment and no
tobramycin
CA 02573494 2007-01-10
WO 2006/010147 PCT/US2005/024946
treatment, one set with no test compound treatment and tobramycin treatment,
one set
treated with a test compound treatment and no tobramycin treatment, and one
set
treated with a test compound treatment and tobramycin. After rinsing, one
coupon of
each set of three was stained with a LIVE/DEAD BacLightTM Bacterial Viability
Kit
(Molecular Probes, Eugene OR) and imaged using epifluorescent microscopy. The
remaining two coupons were placed in 10 ml of PBS and sonicated for five
minutes to
remove and disperse biofilm cells. The resulting bacterial suspensions were
then
serially diluted in PBS and plated on tryptic soy agar plates for enumeration
of
culturable bacteria. The plates were incubated for 24 hours at 37 C before
colony
forming units (CFU) were determined.
[100] The treatments of the individual test compounds with and without
tobramycin
are listed in Table 2. The results are averages from experiments performed on
three
separate days for each test compound. The values reported are as logio CFU.
[101] Table 2.
Asiatic Asiatic Asiatic Madecassic Corosolic
acid acid acid acid acid
Test 50 g/ml 100 200 100 gg/ml 100 g/m1
Compound g/ml g/ml
Concentration
Tobramycin 5.3 5.5 5.2 5.5 4.2
and Test
Compound
Test 7.7 7.7 7.5 7.5 7.3
Compound
Tobramycin 5.8 6.5 6.1 6.7 6.5
Control 7.5 7.8 7.6 8.0 7.9
[102] The results clearly demonstrate the abilities of asiatic acid, corosolic
acid, and
madecassic acid to increase the biofilm's susceptibility to tobramycin by
modifying
the biofilm. In combination with tobramycin these test compounds demonstrated
an
26
CA 02573494 2007-01-10
WO 2006/010147 PCT/US2005/024946
additional reduction of 67% to 99% CFU when compared to tobramycin alone. This
translates into a reduction of approximately 1,000,000 to 4,500,000 cells of
P.
aeruginosa at 100 g/ml.
[103] As a comparison to multiple published clinical studies, these results
with
asiatic acid, corosolic acid, or madecassic acid in combination with
tobramycin
demonstrate that improved lung function (FEV or forced expiratory volume) and
decreased average CFU (density) in sputum from patients with cystic fibrosis
would
be observed in a combination therapy involving these compounds (Ramsey, Bonnie
W. et. al., "Intermittent administration of inhaled tobramycin in patients
with cystic
fibrosis", New England J. Medicine 340(1):23-30, 1999; Saiman, L. "The use of
macrolide antibiotics in patients with cystic fibrosis", Curr Opin Pulm Med,
2004,
10:515:523; Pirzada, O. et al. "Improved lung function and body mass index
associated with long-term use of Macrolide antibiotics.", J. Cystic Fibrosis,
2003, 2,
p.69-71). Using the endpoints listed in these publications and used in cystic
fibrosis
clinical trials, this example demonstrates that a combined treatment of
tobramycin and
a compound of the invention would provide benefit to cystic fibrosis patients
or other
people suffering from chronic lung infections. The research results of this
example
also demonstrate that the compounds of the invention in combination with an
antibiotic would remove biofilms from teeth, skin, tissues, catheters, medical
devices,
and other surfaces.
[104] Example 6
[105] Effect of Asiatic acid on Biofilm Growth and Inhibition with
Streptococcus
mutans 25175 and Streptococcus sobrinus 6715.
[106] Asiatic acid was tested against S. mutans 25175 and S. sobrinus 6715 at
a
concentration of 40 ug/ml using the method described in Example 1. The use of
1 mL
polycarbonate tubes were used in place of 96 well polysterene microtiter
plates.
27
CA 02573494 2007-01-10
WO 2006/010147 PCT/US2005/024946
[107] Testing asiatic acid at 40 g/mL against S. mutans 25175 and S. sobrinus
6715
showed greater than 75 % biofilm growth inhibition.
[108] Example 7
[109] The Effects of Asiatic acid, Corosolic asid, and Ursolic acid on the
Binding to
and Invasion of E. coli clinical strain UT189 against bladder epithelial cells
[110] The effect of test compounds on bacterial invasion of E. coli clinical
strain
UT189 was studied as described in Elsinghorst, et a1.1994, Methods Enzymol,
236:405-420; and Martinez et al., 2000, EMBO J., 19:2803-2812. Epithelial
bladder
cells were grown in plates. Asiatic acid, corosolic acid, or ursolic acid were
added at
concentrations of 10 g/ml, 20 g/ml, or 40 g/ml to bacteria and epithelial
cells for
approximately 5, 15, 30, or 60 minutes with approximately 107 CFU of E. coli.
Binding was assessed at time zero and invasion was assessed at approximately
5, 15,
30, or 60 minutes from completing the mixture of compound, bacteria, and
epithelial
cells. As a control ethanol was added to cells to a final concentration of 0.1
%. The
effect of bacterial viability and bacterial adherence during the infection
period was
evaluated according to the methods described in Martinez et al., 2000, EMBO
J.,
19:2803-2812. The test compounds did not affect the binding of E. coli to
bladder
epithelial cells. The test compounds reduced the invasion of E. coli into
bladder
epithelial cells.
[111] 40 g/ml of corosolic acid with bacteria and epithelial cells for 60,
15, and 5
minutes reduced invasion of E. coli into bladder epithelial cells by 90%, 70%,
and
10%, respectively, as compared to the controls. These experiments were
performed in
triplicate. Furthennore and separately, 40 g/ml and 20 g/ml of corosolic
acid witli
bacteria and epithelial cells for 60 minutes reduced invasion of E. coli into
bladder
epithelial cells by 90% (n=7) and 65% (n=4), respectively, as compared to the
controls. These experiments demonstrate a dose and time dependent effect of
corosolic acid interrupting the pathogenesis cycle of E. coli. 40 g/ml of
asiatic acid
28
CA 02573494 2007-01-10
WO 2006/010147 PCT/US2005/024946
and ursolic acid with bacteria and epithelial cells for 60 minutes reduced
invasion of
E. coli into bladder epithelial cells by 87% (n=7) and 76% (n=4),
respectively.
[112] The present invention demonstrates that corosolic acid, asiatic acid,
ursolic
acid, and other compounds of the present invention reduce invasion of E. coli
into
bladder epithelial cells and therefore interrupt the pathogenesis of E. coli
in bladder
epithelial cells. The cycle of pathogenesis of E. coli in recurrent urinary
tract
infections involves repeated invasions allowing the bacteria to survive and
persist in
the host. The invasion of E. coli into the bladder epithelial cells enables
them to resist
the mammalian immune response, which allows the bacteria to re-invade deeper
into
host's tissues. The compounds interrupt a key point in the bacteria's life
cycle.
[113] Example 8
[114] The Effects of a cysB deletion mutant of E. coli clinical strain UT189
on the
Binding to and Invasion into bladder epithelial cells
[115] The method described in Example 6 was used to examine the binding and
invasion of E. coli UT189 cysB -(described in Example 2) into bladder
epithelial cells.
[116] E. coli UT189 cysB - exhibited about 93% reduction of invasion into
bladder
epithelial cells as compared to wild type. The invasion of E. coli UT189 cysB
T into
bladder epithelial cells was slightly restored by plasmid complementation of
cysB
demonstrating only a 70% reduction of invasion as compared to wild type.
[117] These experiments demonstrate that the cysB gene plays a vital role in
the
pathogenesis of clinical strains of E. coli. The compounds' modulation of a
cysB
gene interrupt the pathogenesis cycle of E. coli, thereby providing an
effective means
to treat chronic infections that involve biofilms.
29
CA 02573494 2007-01-10
WO 2006/010147 PCT/US2005/024946
[118] Example 9
[119] Bladder concentrations of Asiatic acid and Madecassic acid in Rats
[120] Pharmacokinetic studies of asiatic acid and madecassic acid in rats were
performed separately. Asiatic acid and madecassic acid were evaluated at 50
mg/kg
(oral). Two animals were assigned to each group. Prior to dosing, a baseline
blood
sample was taken from each animal. At time zero, asiatic acid and madecassic
acid, a
single bolus dose in 50% Labrasol (Gattefosse) was given to each animal.
Bladders
were analyzed at 24 hours. Concentrations of both asiatic acid and madecassic
acid in
the bladder were approximately 30 g/g at 24 hours. Asiatic acid and
madecassic
acid significantly reduced bacterial invasion within 15 minutes of
administration.
[121] These experiments demonstrate that asiatic acid and madecassic acid are
in
adequate concentrations in the bladders of mice to reduce invasion of bacteria
and the
formation of biofilms.
[122] Example 10
[123] The Effects of Asiatic acid, Corosolic asid, and Ursolic acid on the
Pathogenesis of E. coli clinical strain UT189 in Mice
[124] The experiment was performed using the procedures described in Justice,
S. et
al., Differentiation and development pathways of uropathogenic Escherichia
coli in
urinary tract pathogenesis. PNAS, 2004, 101(5), p.1333-1338. Briefly, E. coli
UT189[pCOMGFP] was prepared after retrieval from frozen stocks by inoculating
in
LB medium statically for approximately 20 hours. Cells were harvested and
suspended in 1 ml of PBS. Cells were diluted to achieve approximately a 108
CFU or
107 CFU input into C3H/HeN mice (2 mice per group).
CA 02573494 2007-01-10
WO 2006/010147 PCT/US2005/024946
[125] Mice were deprived of water for approximately two hours. In experiment
1,
all mice were anesthetized with 0.15 cc ketamine cocktail. In experiment 2,
all mice
were anestlletized with isofluorane. In experiment 1, urine was dispelled from
the
bladders and approximately 40 g/ml of test compound or an appropriate amount
of
ethanol as control was introduced into the bladders via catheterization of the
urethra
using a tubing coated tuberculin syringe. 30 minutes was allowed to elapse. In
experiment 2, bladders were not pre-incubated with test compounds. Bladders
were
then expelled and an inoculum of 108 CFU (Experiment 1) or 107 CFU (Experiment
2)
of E. coli containing 40 g/ml of test compound or equivalent amount of
ethanol as
controls were introduced into the bladders as indicated above.
[126] In experiment 1 five hours elapsed and in experiment 2 six hours
elapsed, and
then mice were anesthetized and sacrificed. The bladders were removed,
bisected,
stretched, and fixed in 3% paraformaldeliyde for 1 hour at room temperature.
Bladders were then permeabilized in 0.01% Triton/PBS for 10 minutes and
counter
stained with TOPRO3 (Molecular Probes) for 10 minutes for visualization by
confocal microscopy. Bladders were mounted on Prolong antifade (Molecular
Probes).
[127] In experiment 1, corosolic acid, asiatic acid, and ursolic acid
demonstrated a
94%, 77%, and 70% reduction, respectively, in biofilm pods or intracellular
bacterial
communities (IBC) in the bladders of mice as compared to the controls by
examination with confocal microscopy. In experiment 2, both corosolic acid and
asiatic acid demonstrated approximately a 60% reduction in large biofilm pods
or
large IBC in the bladders of mice as compared to the controls by examination
with
confocal microscopy.
[128] The results of these experiments demonstrate that the compounds of the
present invention interrupt the pathogenesis of clinical strains of E. coli in
mice.
Therefore, the compounds of the present invention can have a significant
impact on
the treatment of chronic infections involving biofilms. Justice, S. et al.
described that
31
CA 02573494 2007-01-10
WO 2006/010147 PCT/US2005/024946
biofilm pods or IBC play an integral role in the recurrence of urinary tract
infections
(Justice, S. et al. Differentiation and development pathways of uropathogenic
Escherichia coli in urinary tract pathogenesis. PNAS, 2004, 101(5), p.1333-
1338).
The authors described that IBC or biofilms prevent the mammalian immune
response
from eradicating the bacterial population, thereby allowing the IBC and
bacteria
within the IBC to increase in number. Therefore by interrupting the
pathogenesis of
the bacteria, the compounds of the present invention can work in combination
with
the mammalian immune system and/or an antibiotic to reduce, prevent, treat, or
eradicate the bacterial infections involving biofilms. This animal model is
representative of chronic lung, ear, and sinus infections, acne, rosacea, and
chronic
wounds. It is also representative of the cycle of pathogenesis of other E.
coli
infections such as, but not limited to, pyelonephritis, prostatitis,
meningitis, sepsis,
and gastrointestinal infections.
[129] Example 11
[130] The Effects of a cysB deletion mutant of E. coli clinical strain UTI89
on the
Pathogenesis of E. coli in Mice
[131] Experiments were conducted as described in Example 9. A 50:50 mix of E.
coli UT189 cysB - [pCOMRFP] and wild type E. coli UT189[pCOMGFP] was
prepared and inoculated into 2 mice. Wild type E. coli UTI89[pCOMGFP] alone
was
inoculated into 2 control mice. At 6 hours, bladders were prepared accordingly
for
examination by confocal microscopy.
[132] As can be seen in Figure 4, the control bladders had typical IBC
populations
(or biofilms) similar to those published in Justice, S. et al. 2004. The
bladders from
the mice inoculated with the mutant / wild type mix showed populations of
bacteria
that exist in loose diffuse collections as shown in Figures 5 and 6. The
collections of
bacteria were markedly different from the control IBC.
32
CA 02573494 2007-01-10
WO 2006/010147 PCT/US2005/024946
[133] Consistent with the teachings in Justice, S. et al. 2004, the loose
collection of
bacteria observed in Figures 5 and 6 would not be able to provide the bacteria
with
protection from leukocyte phagocytosis in the tissues of bladders; the
bacteria no
longer exist in dense, protective homogenous communities. Therefore, the cysB
gene
in E. coli enables the bacteria to form biofilms in the tissues of bladders.
The cysB
gene is genetically conserved amongst Gram-negative bacteria. Therefore, it is
contemplated that modulation of this gene by the compounds of the present
invention
would also reduce the formation of biofilms in chronic infections caused by
other
bacteria besides E. coli.
[134] Example 12
[135] A topical gel was prepared containing 2% of madecassic acid by weight
with
azithromycin for use in treating acne, rosacea, and skin infections
[136] 0.25 gram of madecassic acid was dissolved in 6.75 grams of ethanol.
Then,
0.2 grams of azithromycin was dissolved in this solution. 0.25 grams of
hydroxypropyl methylcellulose was added with gentle stirring until a
homogenous
solution was obtained. 4.8 grams of water was then added with gentle shaking.
[137] This formulation was stored for thirty days at 2 C to 8 C, room
temperature
(approximately 22 C), and at 30 C. It remained homogenous for thirty days at
each
storage condition. A formulation without antibiotic could also be prepared
using this
same procedure.
[138] Example 13
[139] Madecassic Acid, Pharmaceutical Formulation for Nebulization
[140] Solutions were prepared comprising 2 mg/ml and 10 mg/ml of madecassic
acid in ethanol/propylene glycol/water (85:10:5). These solutions were
nebulized
33
CA 02573494 2007-01-10
WO 2006/010147 PCT/US2005/024946
separately by a ProNeb Ultra nebulizer manufactured by PARI. The nebulized
solutions were collected in a cold trap, processed appropriately, and detected
by mass
spectrometry. Madecassic acid was recovered from both formulations
demonstrating
that nebulization can be used to deliver this compound to patients with lung
infections.
[141] Example 14
[142] Madecassic Acid, 2% Toothpaste Formulation
[143] Toothpaste preparations were prepared containing 2% madecassic acid with
and without antibiotic and with and without polymer. In one embodiment,
polymer,
Gantrez S-97, was added to improve retention of madecassic acid and antibiotic
on
teeth.
[144] All of the dry ingredients were mixed together. Glycerin was slowly
added
while mixing. An aliquot of water was added slowly and thoroughly mixed.
Peppermint extract was added and then the rest of the water was added while
mixing.
Madecassic acid and antibiotic were then added until homogenous.
34
CA 02573494 2007-01-10
WO 2006/010147 PCT/US2005/024946
[145] Formulation A
Ingredients Parts By Weight
Sorbitol 20.0
Glycerin 22.0
Silica 20
Sodium lauryl sulfate 2.0
Xanthum gum 1
Madecassic Acid 2.0
Peppermint extract 1.0
Sodium fluoride 0.3
Water 31.7
[146] Formulation B
Ingredients Parts By Weight
Sorbitol 20.0
Glycerin 22.0
Silica 20
Sodium lauryl sulfate 2.0
Xanthum gum 1
Madecassic Acid 2.0
Triclosan 0.3
Peppermint extract 1.0
Sodium fluoride 0.3
Gantrez S-97 2.5
Water 28.9
[147] Formulations A and B were prepared and stored for thirty days at 2 C to
8 C,
room temperature (approximately 22 C), and at 30 C.
