Note: Descriptions are shown in the official language in which they were submitted.
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
ALTERING WOOD DENSITY
FIELD OF THE INVENTION
[00011 The present invention relates to the field of molecular biology and
regulation of wood composition. Thus, the invention relates, inter alia, to
methodology and constructs for increasing wood density in plants.
BACKGROUND OF THE INVENTION
[0002] Wood Quality, as used by the pulp and paper industries, refers to a
series
of wood components that, at the end of the processing, affect cellulose yield.
The
most studied wood components affecting wood quality include lignin content,
the
proportion of monolignols siryngil and guaiacyl (S/G), the module of
elasticity, spiral
grain, fiber characteristics and wood density. T. Markussen et al., Wood
Density
Silvae Genetica 53: 45- 50 (2004). Of these components, lignin content and
wood
density significantly impact cellulose yield.
Lignin Content
[0003] Lignin is one of the major products of the general phenylpropanoid
pathway, and it is one of the most abundant organic molecules in the
biosphere.
Lignin accounts for 20-30% of the dry weight of trees and through a process
called
lignification, lignin is deposited in the cell walls of supporting and
conductive tissues,
thereby providing rigidity to the wood and structural integrity to tracheary
elements.
Baucher et al., Crit. Rev. Biochem. Mol. Biol. 38: 305-50 (2003).
Lignification also
occurs following microbial infection or wounding and protects tissues from
pathogen
penetration. Baucher et al., (2003); Boerjan et al., Annu. Rev. Plant. Biol.
54: 519-46
(2003); Crawford, LIGNIN BIODEGRADATION AND TRANSFORMATION, New York: John
Wiley and Sons (1981).
[0004] Lignin's resistance to degradation significantl.y limits the use of
lignocellulosic materials, as lignin must be removed during pulping and
papermaking
and this requires environmentally hazardous chemicals. Baucher et al., (2003);
WASH1814745.1
WASH_1815926_.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
Whetten et al., Forest Ecol. Management 43: 301 (1991). Current research
efforts
aim to develop trees with reduced lignin content, thereby reducing the amount
of
chemicals needed for kraft pulping. Baucher et al., (2003); Sederoff et al.,
GENETIC
ENGINEERING OF PLANT SECONDARY METABOLISM, New York, Plenum Press (1994).
[0005] Lignins are the result of dehydrogenative polymerization of
monolignols,
notably p-coumaryl, coniferyl and synapyl alcohols. Reviewed in Boerjan et
al.,
Annu. Rev. Plant. Biol. 54: 519-46 (2003). Different plant species or cell
types harbor
lignin polymers composed of varying proportions of these three monolignols.
For
example, gymnosperm lignin is primarily composed of guaiacyl (coniferyl-
derived)
units, whereas angiosperm lignin is primarily composed of guaiacyl and
syringyl
(synapyl-derived) units. Grass lignin, on the other hand, is a mixture of
guaiacyl,
syringyl and p-hydroxylphenyl (coumaryl-derived) units. Campbell and Sederoff,
Plant. Physiol. 110: 3-13 (1996). It is well known that the monomeric
composition of
lignin has a significant effect on its chemical degradation during industrial
pulping.
Baucher et al., Plant Physiol. 112: 1479-1490 (1996); O'Connell et al.,
Transgenic
Res. 11: 495-503 (2002); Baucher et al., Critical Reviews in Biochemistry and
Molecular Biology 38: 305-50 (2003).
[0006] Several steps in the monolignol biosynthesis pathway, leading to lignin
synthesis, represent SAM-dependent methylation reactions, evidencing the
importance of this methionine-derived substrate in lignin biosynthesis. SAM is
synthesized from methionine by the action of one or more SAM synthetase
isoforms
and is used as a cofactor in many processes in plant cells besides
lignification, such as
DNA methylation and ethylene, biotin and polyamine biosynthesis. Ravanel et
al.,
Proc. Nati. Acad. Sci. USA 95: 7805-7812 (1998).
Wood density
[0007] In the assessment of raw-material quality for pulping, wood density is
another important parameter. Wood density significantly influences the yield
and
quality of fibrous and solid wood products, as well as strength,
machinability,
conversion, wearability, and paper yield. Bamber and Burley, TrIE WOOD
2
WASH_1814745.1
WASH 1815926.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
PROPERTIES OF RADIATA PItvE, Commonwealth Agricultural Bureau. Slough, p. 84
(1983). High wood densities are advantageous because they correspond to higher
pulp yields on a raw-material volume basis, and to a better use of digestor
capacity.
From the vantage point of forest production, high wood density combined with
high
volume growth maximizes production on the unit area basis. Miranda et al.,
Forest
Ecology and Management 149: 235-40 (2001).
[0008] While wood density is a critical factor in the profitability of kraft
pulp
production, increasing wood density is difficult because it is a complex trait
that is
not easily managed for breeding purposes. For temperate softwood, the average
ring
density depends on the earlywood and latewood proportion and the relative
densities
of each of them. Thus, improved wood density is the result of various
combinations
of components that could be changed by manipulating one or more components.
Louz, Ann. For. Sci. 60: 285-94 (2003). Further adding to the difficulties
associated
with increasing wood density, hardwood tree improvement is a slow process
because
of the lengthy time needed for breeding a single generation. This process is
made
even more difficult by the changes that occur during the transition from
juvenility to
maturity.
[0009] Although the wood density is a complex trait, it presents great
variations
between trees as well as high heritability and reduced Genotype x Environment
interactions. In analyzing wood densities in different species, it has been
shown that
wood density has a strong genetic component. Louzada and Fonseca, Ann. For.
Sci.
59: 867-73 (2002).
[0010] There is consensus amongst the forest breeding community that if one
could develop methods that allow early selection at the individual level, this
would be
of considerable value for increasing the genetic gain per unit time. In this
regard,
current research efforts are focused on identifying molecular markers that
cosegregate
with complex traits, such as wood basic density. Grattapaglia et al., Genetics
144:
1205-14 (1996). Most of these studies have associated quantitative trait loci
(QTLs)
with juvenile wood density. For example, four markers showed a consistent
3
WASH1814745.1
WASH_1815926.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
association with juvenile wood density in segregating populations of Pinus
radiata.
Devey et al., Theor Appl Genet 108: 516-24 (2004).
[00111 Accordingly, there is a continuing need to identify genes the
expression of
which can be affected to increase wood density and decrease lignin in plants,
in
particular, woody tree species.
SUMMARY OF THE INVENTION
[0012] In one aspect, the invention provides a method for increasing wood
density
in a plant, comprising (a) introducing into a plant cell a nucleic acid
construct
comprising, in the 5' to 3' direction, a xylem-preferred promoter operably
linked to a
SAMdc nucleotide sequence; (b) regenerating transgenic plants from said plant
cell;
and (c) selecting a transgenic plant having reduced vessel area and reduced
vessel
density relative to a control plant. In one embodiment, the plant is an
angiosperm.
[0013] In another embodiment, the plant is a gymnosperm. In further
embodiments, the plant is Eucalyptus, Populus, and Pinus. In further
embodiments,
wood pulp and wood fiber are obtained from the transgenic plant.
[00141 In another aspect, the invention provides a method for increasing wood
density and decreasing lignin content in a plant, comprising: (a) introducing
into a
plant cell a nucleic acid construct comprising, in the 5' to 3' direction, a
xylem-
preferred promoter operably linked to a SAMdc nucleotide sequence; (b)
regenerating
transgenic plants from said plant cell; and (c) selecting a transgenic plant
having
increased wood density and decreased lignin content relative to a control
plant. In
one embodiment, the plant is an angiosperm. In another embodiment, the plant
is a
gymnosperm. In another embodiment, the plant is Eucalyptus, Populus, and
Pinus.
[0015] In another aspect, the invention provides a method of making wood pulp,
comprising (a) introducing into a plant cell a nucleic acid construct
comprising, in the
5' to 3' direction, a xylem-preferred promoter operably linked to a SAMdc
nucleotide
sequence; (b) regenerating transgenic plants from said plant cell; (c)
selecting a
transgenic plant having increased wood density and decreased lignin content
relative
4
WASH1814745.1
WASH_18159267.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
to a control plant; and (d) producing wood pulp from said transgenic plant. In
one
embodiment, the xylem-preferred promoter is selected from the group consisting
of
TUB gene promoter, LTP gene promoter, 4CL gene promoter, and C4H gene
promoter.
[0016] In another aspect, the invention provides method of making wood fiber,
comprising (a) introducing into a plant cell a nucleic acid construct
comprising, in
the 5' to 3' direction, a xylem-preferred promoter operably linked to a SAMdc
nucleotide sequence; (b) regenerating transgenic plants from said plant cell;
(c)
selecting a transgenic plant having increased wood density and decreased
lignin
content relative to a control plant; and (d) producing wood fiber from said
transgenic
plant.
BRIEF DESCRIPTION OF THE DRAWINGS
[0017] FIGURE 1 illustrates the lignin biosynthesis pathway, showing in
details
the compounds, reactions and enzymes involved in synthesis of monolignols, the
building blocks of the three kinds of lignin, represented at the bottom of the
picture as
p-hydroxyphenyl, guaiacyl and syringyl lignins.
[0018] FIGURE 2 schematically illustrates the plant expression plasmidial
vector
pALELLYX-ATG of the invention comprising a cambium/xylem preferred promoter
driving the expression of a SAMdc nucleotide sequence of the invention.
[0019] FIGURE 3 schematically illustrates the plant expression plasmidial
vector
pALELLYX-Nt of the invention comprising a cambium/xylem preferred promoter
driving the expression of a SAMdc nucleotide sequence from Nicotiana tabacum
(tobacco).
[0020] FIGURE 4 schematically illustrates the plant expression plasmidial
vector
pALELLYX-Pdl of the invention comprising a cambium/xylem preferred promoter
driving the expression of SAMdc nucleotide sequence coding for SAMdc 1 from
Populus deltoides.
WASH_1814745.1
WASH_1815926.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
100211 FIGURE 5 schematically illustrates the plant expression plasmidial
vector
pALELLYX-Pd2 of the invention comprising a cambium/xylem preferred promoter
driving the expression of SAMdc nucleotide sequence coding for SAMdc 2 from
Populus deltoides.
[0022] FIGURE 6 schematically illustrates the plant expression plasmidial
vector
pALELLYX-Pd3 of the invention comprising a cambium/xylem preferred promoter
upstream of a SAMdc genomic sequence from Populus deltoides.
[0023] FIGURE 7 schematically illustrates the plant expression plasmidial
vector
pALELLYX-At of the invention comprising a cambium/xylem preferred promoter
driving the expression of a SAMdc nucleotide sequence from Arabidopsis
thaliana
(thale cress).
[0024] FIGURE 8 schematically illustrates the plant expression plasmidial
vector
pALELLYX-Xa of the invention comprising a cambium/xylem preferred promoter
upstream of an open reading frame coding for SAMdc from the plant pathogen
Xanthomonas axonopodis.
[0025] FIGURE 9 schematically illustrates the plant expression plasmidial
vector
pALELLYX-Ds of the invention comprising a cambium/xylem preferred promoter
driving the expression of a SAMdc nucleotide sequence from Datura stramonium.
[0026] FIGURE 10 schematically illustrates the plant expression plasmidial
vector pALELLYX-Osl of the invention comprising a cambium/xylem preferred
promoter driving the expression of a nucleotide sequence coding for SAMdc 1
from
Oryza sativa (rice).
[00271 FIGURE 11 schematically illustrates the plant expression plasmidial
vector pALELLYX-Os2 of the invention comprising a cambium/xylem preferred
promoter driving the expression of a nucleotide sequence coding for SAMdc 2
from
Oryza sativa (rice).
6
WASH_1814745.1
WASH_1815926.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
[0028] FIGURE 12 shows hand-sectioned unfixed stems (rosette base level) of
Arabidopsis thaliana stained with the lignin-specific dye phloroglucinol. (A)
Control
non-transgenic plant TUB-SAMdc-Nt22; (B) Transgenic plant TUB-SAMdc-Nt12,
which exhibits a high transgene expression level (FIG. 13); (C) Control non-
transgenic plant TUB-SAMdc-NtO1; (D) Transgenic plant TUB-SAMdc-Nt09. Insets
represent lower magnification images of the respective stem cuts.
[0029] FIGURE 13 exhibits a semi-quantitative RT-PCR experiment showing the
transgene expression level (SAMdc) relative to the expression level of a
control gene
(APTR, adenine phosphoribosyltransferase) in transgenic (PCR +) and control
non-
transgenic (PCR-) TUB-SAMdc-Nt Arabidopsis thaliana plants.
[0030] FIGURE 14 (A) and (B) show hand-cut unfixed stem sections of 3 month-
old Nicotiana benthamiana specimens, stained with the lignin-specific dye
phloroglucinol in a control non-transgenic plant (A) and in a transgenic plant
4CL-
SAMdc-Nt30 (B), which exhibits a high transgene expression level. (D) shows a
homozygous transgenic plant in the T2 segregating population from the 4CL-
SAMdc-
Nt30 T1 transformant compared to a control non-transgenic sibling plant (C).
Note
the decrease in vessel element number and size in (B) and the general decrease
in
lignin staining in (D).
[0031] FIGURE 15 shows the relationship between Eucalyptus clones wood
density and the number of vessel elements in the xylem.
[0032] FIGURE 16 shows hand-sectioned unfixed stems (base level) of a Tl
transgenic Nicotiana benthamiana plants (line 11 B) transformed with the plant
expression plasmidial vector pALELLYX-Nt stained with the lignin-specific dye
phloroglucinol. (A) sdcsdc genotype; (B) SDCSDC genotype; (C) reduction on the
vessel elements number of the TI transgenic plants (line 11B).
[0033] FIGURE 17 shows the area of vessel elements (mean of 100 vessel
elements) of three genotypes of a Tl transgenic Nicotiana benthamiana plants
(line
I1B) transformed with the plant expression plasmidial vector pALELLYX-Nt. (A)
7
WASH1814745.1
WASH 1815926_.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
sdcsdc genotype; (B) SDCSDC genotype; (C) reduction on the area of vessel
elements
of the T 1 transgenic plants (line 11 B).
[0034] FIGURE 18 shows the percentage of xylem area occupied by vessel
elements of three genotypes of a T1 transgenic Nicotiana benthamiana plants
(line
11B) transformed with the plant expression plasmidial vector pALELLYX-Nt.
[0035] FIGURE 19 shows a cross-section of lateral shoot of 6 months old
Eucalyptys plants. (A) is a cross-section of the transgenic event A. 12.3
transformed
with the plant expression plasmidial vector pALELLYX-Pd; (B) is a cross-
section of
a wild-type plant.
[0036] FIGURE 20 shows the insoluble (A) and soluble (B) lignin content of
three genotypes of a Tl transgenic Nicotiana benthamiana plants (line 11B)
transformed with the plant expression plasmidial vector pALELLYX-Nt.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0037] The present inventors realized that overexpressing a polynucleotide
encoding SAMdc, an enzyme that converts SAM into decarboxylated SAM, reduces
the amount of SAM available for SAM-dependent methylation of intermediates in
the
monolignol biosynthesis pathway, thereby impairing lignin biosynthesis and
deposition, without affecting other plant functions. Moreover, they discovered
that
overexpressing a polynucleotide encoding SAMdc in a plant causes a reduction
in the
number of vessels and vessel area in the plant, as well as a reduction in
lignin content.
Because vessel number and area negatively correlate with wood density,
overexpressing a gene encoding a SAMdc enzyme produces a plant with increased
wood density and reduced insoluble lignin content. Thus, the present invention
provides constructs and methodology for using a single gene to increase wood
density
and decrease lignin content in angiosperm and gymnosperm plants.
[0038] Accordingly, the present invention relates to methodology and
compositions for reducing lignin and increasing wood density in plant tissues
or cells,
such as woody angiosperm and gymnosperm xylem, by controlling the activity of
8
WASIi1814745.1
WASH_18159267.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
SAMdc. Pursuant to this aspect of the invention, a polynucleotide encoding a
SAMdc
enzyme is introduced into plant cells or whole plants, which sequence, when
expressed in vascular cells of angiosperms or xylary tracheids of gymnosperms,
reduces the amount of SAM available for the monolignol biosynthesis pathway,
leading to reduced lignin and increased wood density.
100391 Because the present inventors have discovered methodology and
compositions for increasing wood density and decreasing lignin content, the
inventive
methods and compositions may be used, for example, to increase pulp and
cellulose
fiber yields during pulp and paper processing.
[0040] All technical terms in this description are commonly used in
biochemistry,
molecular biology and agriculture, respectively, and can be understood by
those
skilled in the field of this invention. Those technical terms can be found in:
MOLECULAR CLONING: A LABORATORY MANUAL, 3rd ed., vol. 1-3, ed. Sambrook and
Russel, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 2001;
CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, ed. Ausubel et al., Greene Publishing
Associates and Wiley-Interscience, New York, 1988 (with periodic updates);
SHORT
PROTOCOLS IN MOLECULAR BIOLOGY: A COMPENDIUM OF METHODS FROM CURRENT
PROTOCOLS IN MOLECULAR BIOLOGY, 5h ed., vol. 1-2, ed. Ausubel et al., John
Wiley
& Sons, Inc., 2002; GENOME ANALYSIS: A LABORATORY MANUAL, vol. 1-2, ed.
Green et al., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.,
1997.
[0041] Methods involving plant biology techniques are described herein and are
described in detail in methodology treatises such as METHODS IN PLANT
MOLECULAR
BIOLOGY: A LABORATORY COURSE MANUAL, ed. Maliga et al., Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y., 1995. Various techniques using PCR
are described, e.g., in Innis et al., PCR PROTOCOLS: A GUIDE TO METHODS AND
APPLICATIONS, Academic Press, San Diego, 1990 and in Dieffenbach and Dveksler,
PCR PRIMER: A LABORATORY MANUAL, 2 d ed., Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, N.Y., 2003. PCR-primer pairs can be derived from
known
sequences by known techniques such as using computer programs intended for
that
purpose (e.g., Primer, Version 0.5, 1991, Whitehead Institute for Biomedical
9
WASH1814745.1
WASH_18159267.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 05 9994-0114
Research, Cambridge, MA). Methods for chemical synthesis of nucleic acids are
discussed, for example, in Beaucage and Caruthers, Tetra. Letts. 22: 1859-1862
(1981) and Matteucci and Caruthers, J. Am. Chem. Soc. 103: 3185 (1981).
[0042] Restriction enzyme digestions, phosphorylations, ligations and
transformations were done as described in Sambrook et al., MOLECULAR CLONING:
A
LABORATORY MANUAL, 2"d ed. (1989) Cold Spring Harbor Laboratory Press. All
reagents and materials used for the growth and maintenance of bacterial cells
were
obtained from Aldrich Chemicals (Milwaukee, Wis.), DIFCO Laboratories
(Detroit,
Mich.), Invitrogen (Gaithersburg, Md.), or Sigma Chemical Company (St. Louis,
Mo.) unless otherwise specified.
[0043] The term "expression" is used here to denote the production of the
protein
product encoded by a gene. "Overexpression" refers to the production of a gene
product in transgenic organisms that exceeds levels of production in normal or
non-
transgenic organisms. As in conventional in the art, nucleotide sequences are
denoted
by italicized font (SAMdc), whereas polypeptide sequences are not italicized
(SAMdc).
1. Increasing wood density by overexpressing SAMdc
[0044] The present invention provides methodology and constructs for
increasing
wood density. Wood is essentially a matrix of cell walls and cellular air
spaces from
secondary xylem. Megraw, WOOD QUALITY FACTORS IN LOBLOLLY PINES, Tappi
Press, Atlanta, p. 88 (1985). In this sense, wood density is determined by the
cell wall
thickness, the cross-sectional area of the lumen of the vessels, and the
number of the
vessels involved in water transport through the stem. Roderick and Berry, New
Phytol. 149: 473 (2001); Preston et al., New Phytologist. 170: 807-18 (2006).
It has
been shown in Eucalyptus and other angiosperm species that wood density
negatively
correlates with hydraulic conductivity and the cross-sectional area of the
vessels.
Thomasa et al., Forest Ecology and Management 193: 157-65 (2004); Preston et
al.,
New Phytologist, 170: 807-18 (2006).
WASH1814745.1
WASH_18159287.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
100451 The influence of vessels on wood density can be decomposed into two
components, vessel area and vessel density. "Vessel area" refers to the
transverse
lumen area of individual vessels. "Vessel density" refers to the number of
vessels per
transverse area. Vessel lumen area strongly affects the capacity of wood to
conduct
water. Zimmermann, XYLEM STRUCTURE AND THE ASCENT OF SAP. Berlin, Germany:
Springer-Verlag. (1983). Wider vessels are generally more vulnerable to
cavitation as
stems freeze and thaw, particularly when xylem water is under tension. Davis
et al.,
American J. Botany 86: 1367-72 (1999). By contrast, the number of vessels in a
given transverse area should have a relatively small effect on sapwood
conductance.
These component traits, vessel area and vessel density, contribute to wood
density by
affecting the amount of lumen space in the wood.
II. Concurrently reducing lignin and increasing wood density by
overexpressing SAMdc
[0046] The present invention provides methodology and constructs for
concurrently reducing lignin and increasing wood density in a plant,
particularly a
woody tree. Pursuant to this aspect of the invention, a nucleic acid sequence
comprising a xylem-preferred promoter operably linked to a SAM decarboxylase
(SAMdc) encoding sequence is introduced into a plant and transgenic plants are
selected that have reduced lignin content and increased wood density. SAM is
converted to decarboxylated SAM (dSAM), a precursor in the polyamine
biosynthetic
pathway, by the action of SAM decarboxylase (EC. number 4.1.1.50). Malmberg et
al., Crit. Rev. Plant Sci. 17: 199-224 (1998).
100471 As described below, therefore, one way to reduce SAM levels in a plant
cell and hence its lignin content is by overexpressing a SAMdc encoding gene
in
lignin-synthesizing tissues. Vascular tissues, which are the major lignin
deposition
sites in angiosperms, have low SAMdc gene expression levels, leading to the
assumption that specific and localized SAMdc gene overexpression in these
tissues
would affect the local concentrations of SAM and thus impair lignin
biosynthesis and
deposition rates.
11
WASH 1814745.1
WASH 1815926.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
SAMdcNucleotide and Polyaentide Sequences
[0048] Illustrative SAMdc sequences include but are not limited to the
sequences
set forth in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 24, and 26,
respectively, as
well as nucleic acid molecules comprised of variants of SEQ ID NO: 1, 3, 5, 7,
9, 11,
13, 15, 17, 19, 24, and 26, with one or more bases deleted, substituted,
inserted, or
added, which variant codes for a polypeptide with SAMdc enzyme activity.
[0049] A "variant" is a nucleotide or amino acid sequence that deviates from
the
standard, or given, nucleotide or amino acid sequence of a particular gene or
protein.
The terms "isoform," "isotype," and "analog" also refer to "variant" forms of
a
nucleotide or an amino acid sequence. An amino acid sequence that is altered
by the
addition, removal, or substitution of one or more amino acids, or a change in
nucleotide sequence, may be considered a "variant" sequence. The variant may
have
"conservative" changes, wherein a substituted amino acid has similar
structural or
chemical properties, e.g., replacement of leucine with isoleucine. A variant
may have
"nonconservative" changes, e.g., replacement of a glycine with a tryptophan.
Analogous minor variations may also include amino acid deletions or
insertions, or
both. Guidance in determining which amino acid residues may be substituted,
inserted, or deleted may be found using computer programs well known in the
art
such as Vector NTI Suite (InforMax, MD) software. "Variant" may also refer to
a
"shuffled gene" such as those described in Maxygen-assigned patents.
[004750] Exemplary SAMdc polypeptide sequences include but are not limited to
the sequences set forth in SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 25, and
27, as
well as polypeptide sequences having one or more amino acids substituted,
deleted,
inserted, or added yet retain SAMdc enzyme activity. Additionally, multiple
forms of
SAMdc may exist, which may be due to post-translational modification of a gene
product, or to multiple forms of the respective SAMdc genes. Sequences that
have
such modifications and that code for a SAMdc enzyme are included within the
scope
of the present invention.
12
WASH1814745.1
WASH_18159267.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
[0051] Accordingly, "SAMdc nucleotide sequence" refers to a polynucleotide
sequence encoding a polypeptide with SAMdc enzyme activity. In this
description,
moreover, the phrase "SAMdc enzyme activity" connotes a protein that catalyzes
the
conversion of SAM into decarboxylated SAM, and that can be assayed by
measuring
the release of 14COZ from S-adenosyl-L-[14C] as described, for example, in
Hanfrey et
al., J. Biol. Chem. 277: 44121-129 (2002). SAMdc protein levels in ground
plant
tissue can be quantified, using conventional protein assays, such as the
Bradford
method, Anal. Biochem. 72: 248-54 (1976), and enzyme activity typically is
expressed
as nanomole of C02/h/mg of protein.
Sequence Analysis
[004852] Included in the category of "variant" sequences are sequences that
hybridize to a reference SAMdc sequence. For the purpose of the invention, two
sequences hybridize when they form a double-stranded complex in a
hybridization
solution of 6X SSC, 0.5% SDS, 5X Denhardt's solution and 100 g of non-specific
carrier DNA. See Ausubel et al., supra, at section 2.9, supplement 27 (1994).
Sequences may hybridize at "moderate stringency," which is defined as a
temperature
of 60 C in a hybridization solution of 6X SSC, 0.5% SDS, 5X Denhardt's
solution
and 100 g of non-specific carrier DNA. For "high stringency" hybridization,
the
temperature is increased to 68 C. Following the moderate stringency
hybridization
reaction, the nucleotides are washed in a solution of 2X SSC plus 0.05% SDS
for five
times at room temperature, with subsequent washes with 0.1X SSC plus 0.1% SDS
at
60 C for 1 hour. For high stringency, the wash temperature is increased to 68
C.
One with ordinary skill in the art can readily select such conditions by
varying the
temperature during the hybridization reaction and washing process, the salt
concentration during the hybridization reaction and washing process, and so
forth.
For the purpose of the invention, hybridized nucleotides are those that are
detected
using 1 ng of a radiolabeled probe having a specific radioactivity of 10,000
cpm/ng,
where the hybridized nucleotides are clearly visible following exposure to X-
ray film
at -70 C for no more than 72 hours.
13
WASH_1814745.1
WASH 1815926.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
[0053] The present application is directed to such nucleic acid molecules that
are
at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100%
identical to a nucleic acid sequence described in any of SEQ ID NOs: 1, 3, 5,
7, 9, 11,
13, 15, 17, 19, 24, and 26. Preferred are nucleic acid molecules which are at
least
95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence shown
in
any of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 24, and 26. Differences
between
two nucleic acid sequences may occur at the 5' or 3' terminal positions of the
reference nucleotide sequence or anywhere between those terminal positions,
interspersed either individually among nucleotides in the reference sequence
or in one
or more contiguous groups within the reference sequence.
[0054] As a practical matter, stating whether any particular nucleic acid
molecule
is at least 95%, 96%, 97%, 98% or 99% identical to a reference nucleotide
sequence
implicates a comparison made between two molecules. Such a comparison can be
effected conventionally, using publicly available computer programs such as
the
BLASTN algorithm. See, e.g., Altschul et al., Nucleic Acids Res. 25: 3389-402
(1997).
Nucleic Acid Constructs
[0055] In accordance with an aspect of the invention, a sequence that
increases
wood density and reduces lignin content is incorporated into a nucleic acid
construct
that is suitable for introduction into a plant or cell. Thus, such a nucleic
acid construct
can be used to overexpress SAMdc in a plant or plant cell.
[0056] The wood density and lignin content and composition of plant parts may
be modified by introducing a nucleic acid construct according to the
invention. The
invention also provides plant cells containing such constructs; plants derived
therefrom having modified SAMdc gene expression; and progeny of such plants.
[0057] Nucleic acid constructs according to the invention may comprise a base
sequence of a minimum length to generate a mRNA and consequently a polypeptide
retaining SAMdc enzymatic activity. For convenience, it will generally be
found
suitable to use sequences between about 100 and about 1000 bases in length but
there
14
WASH 1814745.1
WASH_181592671
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
is no theoretical upper limit to the base sequence length. The preparation of
such
constructs is described in more detail below.
100581 As a source of the nucleic acid sequence for transcription, a suitable
cDNA
or genomic DNA or synthetic polynucleotide may be used. Methods for the
isolation
of suitable SAMdc sequences are described, supra. Sequences coding for the
whole,
or substantially the whole, of the enzyme may thus be obtained. Suitable
lengths of
this DNA sequence may be cut out for use by means of restriction enzymes. When
using genomic DNA as the source of a partial base sequence for transcription,
it is
possible to use either intron or exon regions or a combination of both.
100591 To obtain constructs suitable for modifying expression of SAMdc in
plant
cells, the cDNA sequence as found in the enzyme cDNA or the gene sequence as
found in the chromosome of the plant may be used. Recombinant nucleic acid
constructs may be made using standard techniques. For example, the nucleic
acid
sequence for transcription may be obtained by treating a vector containing
said
sequence with restriction enzymes to cut out the appropriate segment. The
nucleic
acid sequence for transcription may also be generated by annealing and
ligating
synthetic oligonucleotides or by using synthetic oligonucleotides in a
polymerase
chain reaction (PCR) to give suitable restriction sites at each end. The
nucleic acid
sequence then is cloned into a vector containing suitable regulatory elements,
such as
upstream promoter and downstream terminator sequences.
[00601 An important aspect of the present invention is the use of nucleic acid
constructs wherein a SAMdc-encoding sequence is operably linked to one or more
regulatory sequences, which drive expression of the SAMdc-encoding sequence in
certain cell types, organs, or tissues without unduly affecting normal
development or
plant physiology.
[0061] "Promoter" connotes a region of DNA upstream from the start of
transcription that is involved in recognition and binding of RNA polymerase
and other
proteins to initiate transcription. A "constitutive promoter" is one that is
active
throughout the life of the plant and under most environmental conditions.
Tissue-
WASH 1814745.1
WASH 1815926.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
specific, tissue-preferred, cell type-specific, and inducible promoters
constitute the
class of "non-constitutive promoters". "Operably linked" refers to a
functional
linkage between a promoter and a second sequence, where the promoter sequence
initiates and mediates transcription of the DNA sequence corresponding to the
second
sequence. In general, "operably linked" means that the nucleic acid sequences
being
linked are contiguous.
[0062] Promoters useful for expression of a nucleic acid sequence introduced
into
a cell to increase expression of SAMdc may be constitutive promoters, such as
the
cauliflower mosaic virus (CaMV) 35S promoter, or tissue-specific, tissue-
preferred,
cell type-specific, and inducible promoters. By using vascular system-
specific,
xylem-specific, or xylem-preferred promoters, for example, one can modify
SAMdc
activity specifically in many tissues such as vascular tissues, especially
xylem. The
use of a constitutive promoter in general affects enzyme levels and functions
in all
parts of the plant, while use of a tissue-preferred promoter permits targeting
of the
modified gene expression to specific plant parts, leading to a more
controllable
phenotypes.
100631 Thus, in using the invention it may be found convenient to use a
promoter
that will give expression during xylem development and/or xylem lignification,
whereby the SAMdc enzyme would only be overproduced in the organ(s) or
tissue(s)
or cell type(s) in which its action is required. In this context, a nucleic
acid sequence
expressed under the control of a "xylem-preferred promoter" is present or more
active
in the xylem than other plant tissues. The category of xylem-preferred
promoters,
suitable for the present invention, includes but is not limited to the xylem-
preferred
tubulin (TUB) gene promoter, the xylem-preferred lipid transfer protein (LTP)
gene
promoter, and the xylem-preferred coumarate-4-hydroxylase (C4H) gene promoter.
[0064] The vectors of the invention also may contain termination sequences,
which are positioned downstream of the nucleic acid molecules of the
invention, such
that transcription of mRNA is terminated, and polyA sequences added. Exemplary
of
such terminators are the cauliflower mosaic virus (CaMV) 35S terminator and
the
16
WASH 1814745.1
WASH_1815926.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 05 9994-0114
nopaline synthase gene (Tnos) terminator. The expression vector also may
contain
enhancers, start codons, splicing signal sequences, and targeting sequences.
[0065] Expression vectors of the invention may contain a selection marker, by
which transformed cells can be identified in culture. The marker may be
associated
with the heterologous nucleic acid molecule, i.e., the gene operably linked to
a
promoter. In this regard, the term "marker" refers to a gene encoding a trait
or a
phenotype that permits the selection of, or the screening for, a plant or cell
containing
the marker. In plants, for example, the marker gene will encode antibiotic or
herbicide resistance. This allows for selection of transformed cells from
among cells
that are not transformed or transfected.
[0066J Examples of suitable selectable markers include adenosine deaminase,
dihydrofolate reductase, hygromycin-B-phosphotransferase, thymidne kinase,
xanthine-guanine phospho-ribosyltransferase, glyphosate and glufosinate
resistance,
and amino-glycoside 3'-O-phosphotranserase (kanamycin, neomycin and G418
resistance). These markers may include resistance to G418, hygromycin,
bleomycin,
kanamycin, and gentamicin. The construct may also contain the selectable
marker
gene Bar that confers resistance to herbicidal phosphinothricin analogs like
ammonium gluphosinate. Thompson et al., EMBO J. 9: 2519-23 (1987). Other
suitable selection markers are known as well.
[0067] Visible markers such as green florescent protein (GFP) may be used.
Methods for identifying or selecting transformed plants based on the control
of cell
division have also been described. See WO 2000/052168 and WO 2001/059086.
[0068) Replication sequences, of bacterial or viral origin, may also be
included to
allow the vector to be cloned in a bacterial or phage host. Preferably, a
broad host
range prokaryotic origin of replication is used. A selectable marker for
bacteria may
be included to allow selection of bacterial cells bearing the desired
construct. Suitable
prokaryotic selectable markers also include resistance to antibiotics such as
kanamycin or tetracycline.
17
WASH 1814745.1
WASH 1815926_.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
[0069] Other nucleic acid sequences encoding additional functions may also be
present in the vector, as is known in the art. For instance, when
Agrobacterium is the
host, T-DNA sequences may be included to facilitate the subsequent transfer to
and
incorporation into plant chromosomes.
Plants for Genetic Engineering
[0070) The present invention comprehends the genetic manipulation of
angiosperm and gymnosperm plants for increasing wood density and decreasing
insoluble lignin content via overexpressing a polynucleotide sequence that
encodes
SAMdc. In this regard, angiosperm refers to vascular plants having seeds
enclosed in
an ovary and are divided into dicotyledonous and monocotyledonous plants.
Gymnosperm refers to a seed plant that bears seed without ovaries.
Illustrative
gymnosperms include conifers, cycads, ginkgos, and ephedras.
[0071] Genetically engineered (GE) encompasses any methodology for
introducing a nucleic acid or specific mutation into a host organism. For
example, a
Eucalyptus plant is genetically engineered when it is transformed with a
polynucleotide sequence that increases expression of a gene, such as SAMdc,
and
thereby increases wood density. In contrast, a Eucalyptus plant that is not
transformed with a polynucleotide sequence is a control plant and is referred
to as a
"non-transformed" plant.
[0072] In the present context, the "genetically engineered" category includes
"transgenic" plants and cells (see defmition, infra), as well as plants and
cells
produced by means of targeted mutagenesis effected, for example, through the
use of
chimeric RNA/DNA oligonucleotides, as described by Beetham et al., Proc. Natl
Acad. Sci. USA 96: 8774-78 (1999), and Zhu et al., loc. cit. at 8768-73, or so-
called
"recombinagenic olionucleobases," as described in PCT application WO
03/013226.
Likewise, a genetically engineered plant or cell may be produced by the
introduction
of a modified virus, which, in turn, causes a genetic modification in the
host, with
results similar to those produced in a transgenic plant, as described herein.
See, e.g.,
U.S. patent No. 4,407,956. Additionally, a genetically engineered plant or
cell may
18
WASH -81a7a5.t
WASH 1815926.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
be the product of any native approach (i.e., involving no foreign nucleotide
sequences), implemented by introducing only nucleic acid sequences derived
from the
host species or from a sexually compatible species. See, e.g., U.S. published
application No. 2004/0107455.
[0073] "Plant" is a term that encompasses whole plants, plant organs (e.g.
leaves,
stems, roots, etc.), seeds, differentiated or undifferentiated plant cells,
and progeny of
the same. Plant material includes, without limitation, seeds suspension
cultures,
embryos, meristematic regions, callus tissues, leaves, roots, shoots, stems,
fruit,
gametophytes, sporophytes, pollen, and microspores. The class of plants which
can
be used in the present invention is generally as broad as the class of higher
plants
amenable to genetic engineering techniques, including angiosperms, both
monocotyledonous and dicotyledonous plants, as well as gymnosperms.
[0074] While any plant may be used, the present invention contemplates plants
used in the pulp and paper industry. Preferably, the plants are woody trees,
including,
but not limited to, Eucalyptus species such as E. alba, E. albens, E.
amygdalina, E.
aromaphloia, E. baileyana, E. balladoniensis, E. bicostata, E. botryoides, E.
brachyandra, E. brassiana, E. brevistylis, E. brockwayi, E. camaldulensis, E.
ceracea,
E. cloeziana, E. coccifera, E. cordata, E. cornuta, E. corticosa, E. crebra,
E.
croajingolensis, E. curtisii, E. dalrympleana, E. deglupta, E. delegatensis,
E. delicata,
E. diversicolor, E. diversifolia, E. dives, E. dolichocarpa, E. dundasii, E.
dunnii, E.
elata, E. erythrocorys, E. erythrophloia, E. eudesmoides, E. falcata, E.
gamophylla,
E. glaucina, E. globulus, E. globulus subsp. bicostata, E. globulus subsp.
globulus, E.
gongylocarpa, E. grandis, E. grandis x urophylla, E. guilfoylei, E. gunnii, E.
hallii, E.
houseana, E. jacksonii, E. lansdowneana, E. latisinensis, E. leucophloia, E.
leucoxylon, E. lockyeri, E. lucasii, E. maidenii, E. marginata, E. megacarpa,
E.
melliodora, E. michaeliana, E. microcorys, E. microtheca, E. muelleriana, E.
nitens,
E. nitida, E. obliqua, E. obtusijlora, E. occidentalis, E. optima, E. ovata,
E.
pachyphylla, E. paucijlora, E. pellita, E. perriniana, E. petiolaris, E.
pilularis, E.
piperita, E. platyphylla, E. polyanthemos, E. populnea, E. preissiana, E.
pseudoglobulus, E. pulchella, E. radiata, E. radiata subsp. radiata, E.
regnans, E.
19
WASH 1814745.1
WASH 1815926.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
risdonii, E. robertsonii, E. rodwayi, E. rubida, E. rubiginosa, E. saligna, E.
salmonophloia, E. scoparia, E. sieberi, E. spathulata, E. staeri, E. stoatei,
E. tenuipes,
E. tenuiramis, E. tereticornis, E. tetragona, E. tetrodonta, E. tindaliae, E.
torquata, E.
umbra, E. urophylla, E. vernicosa, E. viminalis, E. wandoo, E. wetarensis, E.
willisii,
E. willisii subsp. falciformis, E. willisii subsp. willisii, and E.
woodwardii.
[0075] The invention also contemplates Populus species such as P. alba, P.
alba x
P. grandidentata, P. alba x P. tremula, P. alba x P. tremula var. glandulosa,
P. alba x
P. tremuloides, P. balsamifera, P. balsamifera subsp. trichocarpa, P.
balsamifera
subsp. trichocarpa x P. deltoides, P. ciliata, P. deltoides, P. euphratica, P.
euramericana, P. kitakamiensis, P. lasiocarpa, P. laurifolia, P. maximowiczii,
P.
maximowiczii x P. balsamifera subsp. trichocarpa, P. nigra, P. sieboldii x P.
grandidentata, P. suaveolens, P. szechuanica, P. tomentosa, P. tremula, P.
tremula x
P. tremuloides, P. tremuloides, P. wilsonii, P. canadensis, P. yunnanensis and
Conifers as, for example, loblolly pine (Pinus taeda), slash pine (Pinus
elliotii),
ponderosa pine (Pinus ponderosa), lodgepole pine (Pinus contorta), and
Monterey
pine (Pinus radiata); Douglas-fir (Pseudotsuga menziesii); Western hemlock
(Tsuga
canadensis); Sitka spruce (Picea glauca); redwood (Sequoia sempervirens); true
firs
such as silver fir (Abies amabilis) and balsam fir (Abies balsamea); and
cedars such as
Western red cedar (Thuja plicata) and Alaska yellow-cedar (Chamaecyparis
nootkatensis).
[0076] Other plants that may be modified by the process of the invention
include
all flowering plants. It is understood that the word "plant" includes any
plant or plant
material used in the pulp and paper industry.
Methods for Genetic Eneineerine
[00771 For the purposes of this description, a SAMdc sequence operably linked
to
a promoter may be introduced into a plant or cell. For example, an
illustrative vector
may comprise a SAMdc sequence operably linked to a xylem-preferred promoter.
WASH1814745.1
WASH 1815926.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
Plant transformation
[00781 "Transgenic plant ' refers to a plant that comprises a nucleic acid
sequence
that also is present per se in another organism or species or that is
optimized, relative
to host codon usage, from another organism or species. Both monocotyledonous
and
dicotyledonous angiosperm or gymnosperm plant cells may be transformed in
various
ways known to the art. For example, see Klein et al., Biotechnology 4: 583-590
(1993); Bechtold et al., C. R. Acad. Sci. Paris 316: 1194-1199 (1993); Bent et
al.,
Mol. Gen. Genet. 204: 383-396 (1986); Paszowski et al., EMBO J. 3: 2717-2722
(1984); Sagi et al., Plant Cell Rep. 13: 262-266 (1994). Agrobacterium species
such
as A. tumefaciens and A. rhizogenes can be used, for example, in accordance
with
Nagel et al., Microbiol Lett 67: 325 (1990). Additionally, plants may be
transformed
by Rhizobium, Sinorhizobium or Mesorhizobium transformation. Broothaerts et
al.,
Nature 433: 629-633 (2005).
100791 For example, Agrobacterium may be transformed with a plant expression
vector via, e.g., electroporation, after which the Agrobacterium is introduced
to plant
cells via, e.g., the well known leaf-disk method. Additional methods for
accomplishing this include, but are not limited to, electroporation, particle
gun
bombardment, calcium phosphate precipitation, and polyethylene glycol fusion,
transfer into germinating pollen grains, direct transformation (Lorz et al.,
Mol. Genet.
199: 179-182 (1985)), and other methods known to the art. If a selection
marker, such
as kanamycin resistance, is employed, it makes it easier to determine which
cells have
been successfully transformed. Marker genes may be included within pairs of
recombination sites recognized by specific recombinases such as cre or flp to
facilitate
removal of the marker after selection. See U. S. published application No.
2004/0143874.
[0080] Transgenic plants without marker genes may be produced using a second
plasmid comprising a nucleic acid encoding the marker, distinct from a first
plasmid
that comprises a SAMdc sequence. The first and second plasmids or portions
thereof
are introduced into the same plant cell, such that the selectable marker gene
that is
transiently expressed, transformed plant cells are identified, and transformed
plants
21
WASH 1814745.1
WASH 1815926.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
are obtained in which the SAMdc sequence is stably integrated into the genome
and
the selectable marker gene is not stably integrated. See U. S. published
application
No. 2003/0221213.
[0081] The Agrobacterium transformation methods discussed above are known to
be useful for transforming dicots. Additionally, de la Pena et al., Nature
325: 274-
276 (1987), Rhodes et al., Science 240: 204-207 (1988), and Shimamato et al.,
Nature
328: 274-276 (1989) have transformed cereal monocots using Agrobacterium. Also
see Bechtold et al., C.R. Acad. Sci. Paris 316 (1994), illustrating vacuum
infiltration
for Agrobacterium-mediated transformation.
[0082] Plant cells may be transformed with nucleic acid constructs of the
present
invention without the use of a selectable or visible marker and transgenic
organisms
may be identified by detecting the presence of the introduced construct. The
presence
of a protein, polypeptide, or nucleic acid molecule in a particular cell can
be measured
to determine if, for example, a cell has been successfully transformed or
transfected.
For example, and as routine in the art, the presence of the introduced
construct can be
detected by PCR or other suitable methods for detecting a specific nucleic
acid or
polypeptide sequence. Additionally, transformed cells may be identified by
recognizing differences in the growth rate or a morphological feature of a
transformed
cell compared to the growth rate or a morphological feature of a non-
transformed cell
that is cultured under similar conditions. See WO 2004/076625.
[0083] Methods of regenerating a transgenic plant from a transformed cell or
culture vary according to the plant species but are based on known
methodology. For
example, methods for regenerating of transgenic Nicotiana and Eucalyptus
plants are
well-known.
Selection and Analysis of Genetically Engineered Plants
[0084] Genetically engineered plants of the invention are selected that have
increased expression of SAMdc relative to a control, non-transgenic plant of
the same
species. Additionally, the inventive genetically engineered plants may have
increased
wood density and decreased lignin content. For example, an inventive
transgenic
22
WASH1814745.1
WASH 1815926_.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
plant may have a phenotype characterized by (1) an ability of the whole plant
to
accumulate less compounds derived from monolignols; (2) an altered vessel
number
and vessel lumen area such that wood density is increased because vessel
number and
vessel area negatively correlate with wood density; and (3) an altered lignin
content
relative to an untransformed host plant.
(0085] The phrase "increased wood density" refers to a quantitative increase
of
wood density relative to a wild-type or control plant of the same species. The
wood
density of the engineered plant of the invention can be increased from 5% to
about
70%, preferably from 10% to about 60%, even more preferably from 15% to about
50% of the wood density of a wild type plant. A most preferred embodiment of
the
engineered plant of the invention has a wood density of about 20% to about 40%
of a
wild type plant. Wood density is determined by methods known in the art, such
as
those described in Chave et al., Ecol. Appl. 16:2356-2367 (2006). For example,
wood
density may be determined by collecting wood samples at breast height and
calculating oven dry weight (kg)/oven dry volume (m3).
[0086] "Reduced insoluble lignin content" and "decreased insoluble lignin
content" refer to a quantitative reduction in the amount of insoluble lignin
in the plant
when compared to the amount of insoluble lignin in a wild-type or control
plant. The
insoluble lignin content in the engineered plant of the invention can be
reduced to
levels of about 5% to about 90%, preferably about 10% to about 75%, even more
preferably about 15% to about 65% of the lignin content of a wild-type plant.
A most
preferred embodiment of the plant of the invention has a lignin content of
about 10%
to about 60% of a wild-type lignin content. A quantitative reduction of lignin
content
can be assayed by several methods, as for examples the Klason lignin assay,
Kirk et
al., Method in Enzymol. 161: 87-101 (1988), or acetyl bromide assay of lignin.
liyama et al., Wood Sci. Technol. 22: 271-80 (1988).
(0087] The phrase "altered lignin composition" refers to quantitative
alteration in
the relative amounts of syringyl and guaiacyl lignin units in the engineered
plant
compared to a wild-type or control plant. Preferably, a plant having altered
syringyl
and guaiacyl lignin composition exhibits a reduced guaiacyl lignin content
compared
23
WASH_1814745.1
WASH_1815926.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
to the guaiacyl lignin content of a wild-type plant; more preferably, it
exhibits an
increased pairwise syringyl lignin/guaiacyl lignin ratio, i.e., "S/G ratio,"
compared to
the S/G ratio of a wild-type plant. Plants of the present invention can be
assayed to
determine their S/G ratios in comparison to the ratio of a wild-type plant
using several
different assay methods, including those described by Rolando et al., METHODS
IN
LIGNIN CHEMISTRY, Springer, New York (1992). Plants of the present invention
exhibit an overall decrease in lignin content when compared to a wild-type or
control
plant, while exhibiting an increased S/G ratio.
****************
[0088] Specific examples are presented below of methods for obtaining SAMdc
encoding genes as well as methods for introducing a SAMdc gene to produce
plant
transformants. They are meant to illustrate and not to limit the present
invention.
EXAMPLE 1: Isolation of the tobacco cDNA encoding SAMdc enzyme
(a) Preparation of mRNA from tobacco leaves and cDNA synthesis
[0089] RNA was extracted from leaf tissue of Nicotiana tabacum using Trizol
reagent (Invitrogen). A eDNA pool was prepared from the isolated total RNA
using a
commercially available cDNA Superscript II Amplification Kit (Invitrogen) or
the
like. The cDNA pool can then be used in RT-PCR experiments in which the
isolated
total RNA is used as template, and Superscript II reverse transcriptase
(Invitrogen)
and oligo(dT) primer are used to synthesize the first-strand cDNA and double-
stranded cDNA is obtained by the subsequent polymerase reaction, using gene-
specific primers.
(b) Design of PCR Primers
[0090] A DNA sequence coding for SAMdc from Nicotrana tabacum has already
been determined and deposited in the GenBank under accession number AF033100.
Based on this sequence, DNA oligomers were synthesized as primers for PCR,
including either the region around the first codon ATG or around the
termination
codon of the main ORF encoding the SAMdc enzyme.
24
WASH_1814745.1
WASH 1815926.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
100911 Primers were designed to amplify the entire coding region of the SAMdc
main ORF, i.e., from the ATG through the translation stop codon. The sequences
of
the primers are given below for the tobacco SAMdc gene:
SAMdc_Ntl Length: 24 SEQ ID N0:20
ATCCCATGGATTCGGCCTTGCCTG
SAMdc_Nt2 Length: 34 SEQ ID NO:21
GTCTAGACTACTCCTTCTCTTCTTTCTCTTCATC
(c) PCR amplification of SAMdc from Nicotiana tabacum
[0092] The cDNA pool obtained in (a) was used as template, and the primers
designed in (b) were used for PCR. The PCR steps involved 40 cycles of 1
minute at
94 C., 1 minute at 52 C., and 2 minutes at 72 C followed by an extra step of
elongation at 72 C for 7 minutes. The PCR products were isolated by gel
electrophoresis on 1.0% agarose followed by ethidium bromide staining of the
electrophoresed gel and detection of amplified bands on a UV transilluminator.
The
detected amplified band was verified and cut out of the agarose gel with a
razor. The
pieces of gel were transferred to 1.5 mL microtubes, and the DNA fragments
were
isolated and purified using a GFX PCR clean-up and gel band purification kit
(Amersham). The recovered DNA fragments were subcloned to the pGEM-T cloning
vector (Promega), transformed into E. coli, and then used to prepare plasmid
DNA in
the usual manner, which was then sequenced by the dideoxy method, Messing,
Methods in Enzymol. 101: 20-78 (1983), using the BigDye chemistry (Applied
Biosystems), yielding the DNA sequence disclosed herein under SEQ ID NO: 1 for
use according to embodiments described in this patent.
EXAMPLE 2: Preparation of Transgenic Arabidopsis and Nicotiaaa
Plants
[0093] The gene obtained in Example I above was introduced into a plant host
to
produce transgenic Arabidopsis and Nicotiana plants.
(a) Preparation of constructs and transformation ofAgrobacterium
[0094] Expression constructs can be prepared by cleaving the SAMdc genes
obtained in 1 above with suitable restriction enzymes so as to include all of
the open
reading frame and inserting the gene into the plant transformation vector
WASH 1814745.1
WASH 1815926.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
pALELLYX-ATG (FIG. 2) together with an appropriate promoter. For example, the
tobacco SAMdc gene obtained in Example 1 was cloned into the aforementioned
expression vector downstream to a xylem-preferred tubulin gene (TUB) promoter
from Populus deltoides as set forth in PCT patent application No.
PCT/BR2005/000041, filed March 28, 2005, which claims for the priority date of
Serial No. 60/560,227, filed April 6, 2004 (FIG. 3). The resulting expression
construct is amplified in E. coli, and then transformed by tripartite
conjugation,
Bevan, Nucleic Acid Research, 12, 8711 (1984), freeze thawing,
electroporation,
chemical transformation or the like into Agrobacterium tumefaciens C58, GV3
101 or
the like.
(b) Agrobacterium-mediated transformation of Arabidopsis thaliana
[00951 Arabidopsis thaliana Columbia plants were transformed using an
Agrobacterium tumefaciens mediated transformation protocol, Bechtold et al.,
C. R.
Acad Sci. Paris 316:1194-1199 (1993); Bent et al., Mol. Gen. Genet. 204:383-
396
(1986), with the construct containing the tobacco SAMdc gene obtained in
Example I
operably linked to the promoter of a xylem-preferred gene (TUB). The construct
also
contains the selectable marker gene Bar that confers resistance to herbicidal
phosphinothricin analogs like ammonium gluphosinate. Thompson et al., EMBO J.,
9: 2519-23 (1987).
100961 Seeds of Arabidopsis thaliana ecotype Columbia were sown in pots
containing vermiculite. Plants were grown at 16/8 hours dark/light regime at
22 C.
After 4-5 weeks plants were transformed with the Agrobacterium tumefaciens
strain
GV3101 (C58C1 rifampicin) pMP90 (gentamicin), Bent et al., Mol. Gen. Genet.
204:383-396 (1986), harboring the plasmid vector comprising the SAMdc gene of
interest operably linked to the TUB promoter.
[0097] For plant transformation, 1 liter of LB medium containing rifampicin,
gentamycin and kanamicin was inoculated with an aliquot of overnight starter
Agrobacterium culture. The culture was grown overnight at 28 C in a rotatory
shaker, until OD600 is ? 0.8. The Agrobacterium was precipitated by
centrifugation
26
WASH1814745.1
WASH_1815926_.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
and the bacterial pellet was resuspended in -300 ml of 5% sucrose and 0.03%
Silwet
L-77 (Witco). This Agrobacterium suspension was sprayed onto the plants. The
pots
were then placed in a tray which is covered with plastic wrap to maintain
humidity.
The plants were grown at 16/8 hours dark/light regime at 22 C through maturity
to set
seeds.
[0098] Seeds were harvested, surface-sterilized in a solution containing 50%
bleach and 0.02% Triton X-100 for 7 minutes. Seeds were then rinsed 3 times in
sterile distilled water and plated out in MS medium containing 6 mg/i of
Finale
(Bayer) as selective agent. After 5 to 7 days, transformants were visible as
green
plants. Transformed plants were transferred onto new selection plates and
after 6-10
days were transferred to pots containing vermiculite and grown under
conditions of 16
hours light/8 hours dark at 22 C. After three weeks, the inflorescence stems
were cut
close to their bases twice a week for a period of one month in order to induce
secondary growth at the base of the rosette before the plants were analyzed.
(c) Agrobacterium-mediated transformation of Nicotiana benthamiana
[0099] Transformation of Nicotiana benthamiana was accomplished using the
leaf disk method of Horsch et al., Science 227: 1229 (1985), using a construct
comprising the tobacco SAMdc gene obtained in Example 1, operably linked to
the
promoter of a xylem-preferred gene (4CL; Hu et al. Proc. Natl. Acad. Sci. USA
95:5407-5412 (1998)). The transformants were selected by growing on Murashige
and Skoog medium (Sigma, St. Louis, Mo.) containing 100 milligrams/liter of
BASTA herbicide and 500 mg/L carbenicillin (Sigma). The transformed tobacco
shoots are allowed to root on the Murashige and Skoog medium, and are
subsequently
transferred to soil and grown in the greenhouse.
(d) PCR verification offoreign gene insertion into the host plant genome
[0100] PCR can be used to verify the integration of the gene construct in the
genome of transgenic plants. Two specific primers are synthesized for the
construct
and used to PCR-amplify the corresponding construct from genomic DNA of
Arabidopsis or Nicotiana transformants. For the TUB-SAMdc-Nt construct, which
27
WASH1814745.1
WASH 1815926_.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
contains the tobacco SAMdc main ORF under the control of the Populus xylem-
preferred tubulin gene promoter, two specific primers were synthesized that
amplify a
1.8kb fragment:
Tub_checkl Length: 25 SEQ ID NO:22
TATCGTTTTACTTCACTGGTCGGTG
SAMdc_Nt2 Length: 34 SEQ ID NO:21
GTCTAGACTACTCCTTCTCTTCTTTCTCTTCATC
[0101] For the 4CL-SAMdc-Nt construct, which contains the tobacco SAMdc
main ORF under the control of the Populus xylem-preferred 4CL gene promoter,
two
specific primers were synthesized that amplify a 1.6 kb fragment:
4CL seq Length: 20 SEQ ID NO:23
~ AATCTCACCAACCCAACTCC
SAbIDC NT2 Length: 34 SEQ ID NO:21
rGTCTAGACTACTCCTTCTCTTCTTTCTCTTCATC
101021 The PCR reaction mixture contained 100 ng genomic DNA of transformed
plant, and 0.2 M of each primer, 100 M of each deoxyribonucleotide
triphosphate,
1 xPCR buffer and 2.5 Units of AmpliTaq DNA polymerase (Applied Biosystems) in
a total volume of 50 L. The cycling parameters were as follows: 94 C. for 1
minute,
50 C. for 1 minute and 72 C for 3 minutes, for 40 cycles, with 5 minutes at 72
C.
extension. The PCR products were electrophoresized on an 1% agarose gel.
(e) Determination of transgene expression level in transgenic plants
[0103] Semi-quantitative RT-PCR was used to detect the accumulation of tobacco
SAMdc transcripts in stem tissue of the transgenic plants. Total RNA was
isolated
from 5-cm inflorescence stem cuts from transgenic Arabidopsis TI plants
(primary
transformants) using Trizol reagent (GibcoBRL, USA) according to the
manufacturer's instructions or from stem cuts of 3-months old transgenic
Nicotiana
benthamiana T1 plants using the CTAB method. Aldrich and Cullis, Plant Mol.
Biol.
Report. 11:128-141(1993).
[0104] cDNA was synthesized from 500 ng of total RNA using Superscript II
RNase H- RT (Invitrogen, USA). Primers for the constitutive gene encoding
adenine
phosphoribosyltransferase (APRT), Moffatt et al., Gene 143, 1211-1216 (1994),
were
used as an internal control to normalize the quantity of total RNA used in
each
sample. The PCR was done with a 12.5-fold dilution of the first-strand cDNA
under
28
WASH1814745.1
WASH 1815926.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
the following conditions: 94 C for 3 minutes and 27 cycles of 94 C for 1
minute, 52
to 60 C for 45 seconds, and 72 C for 1 minute and 30 seconds.
EXAMPLE 3: Histochemical Analysis of Transgenic Plants
[01051 Histological staining of lignin can be performed to analyze the amount
of
lignin in the vascular system of transformed and control plants. Briefly,
stems of
Arabidopsis TUB-SAMdc-Nt transgenic, Nicotiana benthamiana 4CL-SAMdc-Nt
and control non-transgenic plants were free-hand sectioned with a razor blade,
and the
resulting sections were stained for total lignin with phloroglucinol-HCl (1%
phloroglucinol in 6N HCI) for 30 minutes. Zhong et al., Plant Physiol. 123: 59-
69
(2000). Alternatively, tissues were sectioned in a microtome (Leica RM2255)
and
subsequently stained with phloroglucinol. The histologically stained sections
are
observed under a dissection microscope using bright- and dark-field
illumination
(FIGs. 12 and 14).
EXAMPLE 4: Reduction in Lignin Content in Transgenic Plants Over-
expressing SAMdc in the Vascular Tissue
[0106] The effect of over-expression of SAMdc in lignin biosynthesis in plant
species was investigated in Arabidopsis and Nicotiana. It was found that over-
expressing SAMdc in a xylem-preferred manner in transgenic Arabidopsis plants
resulted in a reduction in lignin content (FIG. 12). Similar findings were
obtained in
two generations of transformed Nicotiana plants (FIG. 14). This finding
indicates that
over-expression of SAMdc is an efficient means for genetically engineering
trees with
low lignin content.
[0107] Arabidopsis transgenic plants were made following the methods described
in Example 2. The first generation of transformants (T 1) was analyzed using
the
methods described in Example 3 to assay lignin content, as well as vessel
structure
and vascular tissue anatomy. Several independent transformants were produced
that
contain a DNA expression construct comprising the Nicotiana tabacum SAMdc main
ORF under the control of the Populus xylem-preferred tubulin gene promoter
described in PCT patent application No. PCTBR2005/000041, filed March 28,
2005,
which claims for the priority date of Serial No. 60/560,227, filed April 6,
2004, supra.
29
WASH1814745.1
WASH 1815926_.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 05 9994-0114
[0108] SAMdc gene expression levels were measured in twenty independent T1
plants, using the methods set forth in Example 2. Stems of transgenic plants
were
used for RNA extraction, followed by a semi-quantitative RT-PCR. SAMdc gene
expression levels in transgenic plants were expressed as a percentage of the
maximum
expression level observed.
[01091 As shown in FIG. 13, the transgenic Arabidopsis plant TUB-SAMdc-Nt12
showed a high transgene expression level (95% of the maximum level observed),
which was accompanied by a decrease in phloroglucinol pinkish red staining
intensity
(FIG. 12B) compared to a comparable control non-transformed plant (FIG. 12A),
reflecting a reduction in lignin content, which provides evidence that
enhanced
SAMdc expression in specific vascular cell types leads to a reduction in the
availability of the methyl group donor SAM and therefore impairs lignin
monomer
biosynthesis during xylem lignification. Notably, although it exhibits a
marked
reduction in lignin content compared to a wild-type plant, the Arabidopsis
transformant TUB-SAMdc-Nt12 has been grown normally under standard conditions,
with no visible abnormal growth or morphology being observed.
[0110) Other T1 plants with low or non-existent expression of the SAMdc
transgene, like TUB-SAMdc-Nt09, failed to show any difference in
phloroglucinol
staining compared to comparable control non-transformed plants (FIGs. 12C, D).
[0111) Similar results were obtained when the construct comprising the
Nicotiana
tabacum SAMdc main ORF under the control of the Populus xylem-preferred 4CL
gene promoter, Hu et al., Proc. Natl. Acad. Sci. USA, 95, 5407-5412 (1998),
was
transformed into Nicotiana benthamiana plants. Nicotiana benthamiana
transgenic
plants were made following the methods described in Example 2. Several
independent first-generation transformants (Tl) were analyzed using the
methods
described in Example 3 to assay lignin content, as well as vascular tissue
anatomy.
As shown in FIG. 14, the transgenic Nicotiana benthamiana plant 4CL-SAMdc-Nt30
showed a marked decrease in the number of vessel elements in the vascular
tissue
(FIG. 14B) compared to a control non-transformed plant (FIG. 14A). This might
reflect a reduction in the plant's ability to deposit lignin in the cell wall.
Seeds from
WASH 1514745.1
WAS H 1815926.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
this transgenic plant were germinated to obtain a segregating population of
plants in
the following generation (T2). These segregants could be separated into three
groups
according to transgene expression level and plant size. Heterozygous and
homozygous T2 plants possessed a reduction in size and a strong reduction in
lignin
content as assessed by phloroglucinol staining according to Example 3 (FIG.
14D), as
compared to non-transgenic sibling plants (FIG. 14C), providing strong
evidence that
enhanced SAMdc expression in specific vascular cell types leads to a reduction
in the
availability of the methyl group donor SAM and therefore impairs lignin
monomer
biosynthesis during xylem lignification.
EXAMPLE 5: Isolation of Populus cDNA encoding SAMdc enzyme
(a) Preparation of RNA from Populus deltoides cambium/xylem and cDNA
synthesis
[0112] Bark was removed from stem cuttings of one-year-old Populus deltoides
trees. The inner part of the stem, containing cambium, xylem, and pith, was
cut into
small pieces, frozen in liquid nitrogen and used for RNA extraction using the
cetyltrimethyl-ammonium bromide (CTAB) extraction method. Aldrich and Cullis,
Plant Mol. Biol. Report, 11, 128-41 (1993). A cDNA pool was used in RT-PCR
experiments in which the isolated total RNA was used as template, and
Superscript Il
reverse transcriptase (Invitrogen) and oligo(dT) primer were used to
synthesize the
first-strand cDNA. Double-stranded cDNA was obtained by the subsequent
polymerase reaction, using gene-specific primers, as described below.
(b) Design of PCR Primers and RT-PCR reaction.
[0113] Oligomers based on SEQ ID NO: 26 were synthesized as primers for PCR,
including either the region around the first ATG codon or around the
termination
codon of the main ORF encoding the polypeptide to amplify the entire coding
region
of the main ORF. The sequences of the primers are:
SAMC NCO Length: 26 SEQ ID NO: 28
CCATGGCGCT GCCAGTCTCT GCAATC
SA14DC 7BA Length: 27 SEQ ID NO: 29
31
WASH1814745.1
WASH_18159267.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
TCTAGACTAC TTCTCTTCAG CTTCCTC
(0114] The eDNA pool obtained in (A) was used as the template in a PCR
reaction with the primers of SEQ ID NOs: 28 and 29. The PCR involved 40 cycles
of
1 minute at 94 C, 1 minute at 51 C, and 2 minutes at 72 C followed by an
extra step
of elongation at 72 C for 7 minutes. The PCR products were isolated by gel
electrophoresis on 1.0% agarose followed by ethidium bromide staining of the
electrophoresed gel and detection of amplified bands on a UV transilluminator.
The
detected amplified band was verified and cut out of the agarose gel with a
razor. The
pieces of gel were transferred to 1.5mL microtubes, and the DNA fragments were
isolated and purified using a GFX PCR clean-up and gel band purification kit
(Amersham). The recovered DNA fragments were subcloned in a commercially
available cloning vector, transformed into E. coli, and then used to prepare
plasmid
DNA, which was then sequenced by the dideoxy method, Messing, Methods in
Enzymol. 101, 20-78 (1983), using standard methods.
EXAMPLE 6: Preparation of Transgenic Populus and Eucalyptus Plants
(0115] The gene obtained in Example 5 above was introduced into a plant host
to
produce transgenic Populus and Eucalyptus plants.
(a) Preparation of constructs and transformation of Agrobacterium
101161 Expression constructs can be prepared by cleaving the SAMdc gene
obtained in Example 5 above with suitable restriction enzymes so as to include
the
entire open reading frame and inserting the gene into the plant transformation
vector
pALELLYX-ATG (FIG. 2) together with an appropriate promoter. For example, the
tobacco SAMdc gene obtained in Example 5 was cloned into the aforementioned
expression vector downstream to a xylem-preferred 4CL gene promoter, Hu et
al.,
Proc. Natl. Acad. Sci. USA, 95, 5407-5412 (1998), from Populus deltoides. The
resulting expression construct is amplified in E. coli, and then transformed
by
tripartite conjugation, Bevan, Nucleic Acid Research, 12, 8711-8721 (1984),
freeze
thawing, electroporation, chemical transformation or the like into
Agrobacterium
tumefaciens C58, GV3101, or the like.
32
WASH_1814745.1
WASH_1815926.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
(b) Agrobacterium-mediated transformation of Populus
[0117] Wild-type aspen was transformed with Agrobacterium tumefaciens
carrying a construct comprising a Populus deltoides SAMdc gene obtained in
Example
operably linked to the promoter of a xylem-preferred gene (C4H). Petioles and
internodal stem segments from in vitro micropropagated plants were used as
explants.
Transformed shoots are selected on regeneration medium containing 100mg/L of
kanamycin and allowed to root on the Murashige and Skoog medium. Selected
plants
are subsequently transferred to soil and grown in the greenhouse.
(c) Agrobacterium-mediated transformation of Eucalyptus
[0118] Transformation of hybrid Eucalyptus (Eucalyptus grandis x Eucalyptus
urophylla) was accomplished by cocultivation of hypocotyl segments with
Agrobacterium tumefaciens containing a construct comprising a Populus
deltoides
SAMdc gene obtained in Example 5 operably linked to the promoter of a xylem-
preferred gene (C4H). AHAS-resistant lines were allowed to root on the
Murashige
and Skoog medium and selected plants were subsequently transferred to soil and
grown in the greenhouse.
EXAMPLE 7: Reduction of Vessel Number and Vessel Lumen Area in
Transgenic Plants Over-expressing SAMdc in the Vascular Tissue
[0119] Stem sections of 10 m thick were cut from the Nicotiana benthamiana
segregating population of plants described in Example 2. These sections were
subjected to safranin-astra blue coloration and observed under a light
microscope
(Leica DMIL) fitted with a camera (Sony) linked to a personal computer.
[0120] The number of vessels per mm2 of xylem area and the average lumen area
of 100 vessels were measured directly on the screen using the "Image Tool"
software.
101211 The homozygous dominant plants and the hemizygous plants presented a
significant decrease in the number of vessels, compared with the homozygous
recessive plants. There is a reduction of 48% in the number of vessels of
homozygous
dominant plants when compared to homozygous recessive plants (FIG. 17). The
33
WASH 1814745.1
WASH 1815926.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
Tukey test showed that the difference between the two populations is highly
significant with P < 0.001.
[0122] Observations of the homozygous dominant population also revealed that
the measured average area of 100 vessels in these plants was 57% smaller when
compared to the average area of homozygous recessive plants (FIG. 18). The
Tukey
test showed that the difference between the two populations is highly
significant with
P < 0.001. No significant difference was observed between homozygous dominant
and hemizygous plants.
EXAMPLE 8: Histochemical Analysis of Transgenic Plants
101231 Lateral shoots of 6 months old Eucalyptus plants were cross-sectioned
(5 m thick) from wild-type and the transgenic lines with a microtome (LEICA
RM2255) equipped with a steel knife. These sections were subjected to astra-
blue
staining and were observed under a light microscope just after staining.
Figure 19A
shows a stem section of transgenic event A.12.3 presenting strong reduction in
the
number and the size of vessel elements when compared to a wild-type plant
(FIG.
19B).
EXAMPLE 9: Reduction of Insoluble Lignin and Increase of Soluble
Lignin in Transgenic Plants
[0124] The main stems of T1 segregating population of the Nicotiana transgenic
event 11 B transformed with a construct comprising the Nicotiana tabacum SAMdc
gene under the control of the xylem-preferred Populus deltoides 4CL promoter
were
collected and air-dried for two weeks. Dried stems were cut in pieces and
pulverized
on a knife mill using a 30-mesh sieve. Stem powder samples were then subjected
to
chemical analyses to determine lignin content. In brief, to a sample of
extracted
tobacco was added an aliquot of 72% (w/w) H2S04 and was thoroughly mixed for 1
minute. After 2 hours of hydrolysis, the content was transferred to a serum
bottle and
the serum bottles (containing HZSO4 at 4% (w/w) plus tobacco) were autoclaved
at
121 C for 60 minutes. Samples were allowed to cool, and the hydrolysates were
vacuum-filtered, washed with 200 ml warm (approximately 50 C) nanopure H20 to
remove residual acid and sugars and dried overnight at 105 C. The dry
crucibles
34
WASH 1814745.1
WASH 1815926.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
were weighed to determine Klason (acid-insoluble lignin) lignin
gravimetrically. The
filtrate was also analysed for acid-soluble lignin by absorbance at 205 nm.
Patzlaff et
al., Plant J. 36: 743-754 (2003).
[01251 As shown in Figure 20A, the homozygous dominant plants presented a
decrease of 11 % in their insoluble lignin content, when compared to
homozygous
recessive plants. The homozygous dominant plants also presented an increase of
13%
in their soluble lignin content, compared to homozygous recessive plants (FIG.
20B)
WASH 1814745.1
WASH 1815926.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
SEQUENCE LISTING
<110> PAPES, Fabio
ARRUDA, Paulo
GERHARDT, Isabel Rodrigues
<120> Altering Wood Density
<130> ALEL 203.1 PCT
<140>
<141>
<150> US 60/602,440
<151> 2004-08-18
<160> 31
<210> 1
<211> 1658
<212> DNA
<213> Nicotiana tabacum
<220>
<221> CDs
<222> (364) ... (1449)
<400> 1
atggagtcga aaggtggtaa aaactctagt agtaaatcct taccctacga agcacccctc 60
ggctacagta ttgaagacgt tcggccaaac ggtggaatca agaagttcag atcagctgct 120
tactccaact gcgctcgcaa accatcctga cattccttaa gcttctctcc tgcacgtgtc 180
tcctgacaca aaaaagaaaa aatccccaaa aaaagttcct tctgtcaatt gtttttgttg 240
ttaaaccctc actccttttc ctcaatttct tccttctgct gctttctgct cttgctctcc 300
ttggctgtga acaattttct ttaaaagatc atttgttgct gtgaacatat ttttttttat 360
cta atg gat tcg gcc ttg cct gtc tct gcc att ggt ttt gaa ggt ttc 408
Met Asp Ser Ala Leu Pro Val Ser Ala Ile Gly Phe Glu Gly Phe
1 5 10 15
gag aag agg ctt gaa att tct ttt ttc gag cct ggt ctg ttt gct gat 456
Glu Lys Arg Leu Glu Ile Ser Phe Phe Glu Pro Gly Leu Phe Ala Asp
20 25 30
ccc aac gga aaa gga ctt cga tct ctc tca aag gca caa ttg gat gag 504
Pro Asn Gly Lys Gly Leu Arg Ser Leu Ser Lys Ala Gln Leu Asp Glu
35 40 45
att ctc gga cct gct gag tgc acc ata gtt gat tcc cta tca aat gac 552
Ile Leu Gly Pro Ala Glu Cys Thr Ile Val Asp Ser Leu Ser Asn Asp
50 55 60
gat gtt gat tct tat gtc ctc tcc gag tcg agc ctc ttt gtt tat tct 600
Asp Val Asp Ser Tyr Val Leu Ser Glu Ser Ser Leu Phe Val Tyr Ser
65 70 75
tac aag ata atc atc aaa acc tgt ggc acc aca aag ttg ctt ctc gca 648
Tyr Lys Ile Ile Ile Lys Thr Cys Gly Thr Thr Lys Leu Leu Leu Ala
80 85 90 95
att ccg ccc atc cta aag ttg gct gag acc ctg tct ctc aaa gta caa 696
Ile Pro Pro Ile Leu Lys Leu Ala Glu Thr Leu Ser Leu Lys Val Gln
100 105 110
gac gtg agg tat acc cgt ggg agc ttc att ttc cct ggc gct cag tcg 744
Asp Val Arg Tyr Thr Arg Gly Ser Phe Ile Phe Pro Gly Ala Gln Ser
115 120 125
ttt cct cat cgt cac ttc tct gaa gaa gtt gct gtc ctc gat ggc tat 792
Phe Pro His Arg His Phe Ser Glu Glu Val Ala Val Leu Asp Gly Tyr
130 135 140
36
WASH 1814745.1
WASH 1815926.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 05 9994-0114
ttt gga aag ctt gct gcc ggt agc aag gct gtg att atg ggc agt cct 840
Phe Gly Lys Leu Ala Ala Gly Ser Lys Ala Val Ile Met Gly Ser Pro
145 150 155
gac aaa gca cag aaa tgg cat gtt tac tct gcc tct gca gga cct att 888
Asp Lys Ala Gln Lys Trp His Val Tyr Ser Ala Ser Ala Gly Pro Ile
160 165 170 175
cag tct aat gac cct gtt tac act ctt gag atg tgt atg act ggt ttg 936
Gln Ser Asn Asp Pro Val Tyr Thr Leu Glu Met Cys Met Thr Gly Leu
180 185 190
gac agg gag aag gca tct gtc ttt tac aag act gaa gga agc tcg gct 984
Asp Arg Glu Lys Ala Ser Val Phe Tyr Lys Thr Glu Gly Ser Ser Ala
195 200 205
gct cat atg act gtt cga tct gga ata agg aag atc ctc ccc aat tct 1032
Ala His Met Thr Val Arg Ser Gly Ile Arg Lys Ile Leu Pro Asn Ser
210 215 220
gag ata tgc gat ttt gag ttt gaa ccc tgt ggt tat tcc atg aat tca 1080
Glu Ile Cys Asp Phe Glu Phe Glu Pro Cys Gly Tyr Ser Met Asn Ser
225 230 235
att gaa gga gct gca ctc tca acc att cac att acc ccg gaa gat ggc 1128
Ile Glu Gly Ala Ala Leu Ser Thr Ile His Ile Thr Pro Glu Asp Gly
240 245 250 255
ttt agc tat gct agc ttt gaa gca gtt ggg tat gac atg aaa acc atg 1176
Phe Ser Tyr Ala Ser Phe Glu Ala Val Gly Tyr Asp Met Lys Thr Met
260 265 270
aag ctg ggt ccc ctg gtt gag agg gtg ctg gca tgt ttc cag cca gat 1224
Lys Leu Gly Pro Leu Val Glu Arg Val Leu Ala Cys Phe Gln Pro Asp
275 280 285
gag ttc tct att gct ttg cat gct gat gtt gct acc aag tta ctg gag 1272
Glu Phe Ser Ile Ala Leu His Ala Asp Val Ala Thr Lys Leu Leu Glu
290 295 300
cgt gtt tgc tct ctt gat gtg aaa ggc tac tct ctt gct gag tgg agt 1320
Arg Val Cys Ser Leu Asp Val Lys Gly Tyr Ser Leu Ala Glu Trp Ser
305 310 315
cca gaa gaa ttt ggc aag ggt ggt tcc att gtc tac cag aag ttc acc 1368
Pro Glu Glu Phe Gly Lys Gly Gly Ser Ile Val Tyr Gln Lys Phe Thr
320 325 330 335
aga act cct ttc tgt gga tct ccc aag tcc gtt ctg aag ggc tgc tgg 1416
Arg Thr Pro Phe Cys Gly Ser Pro Lys Ser Val Leu Lys Gly Cys Trp
340 345 350
aaa gaa gat gaa gag aaa gaa gag aag gag tag tgtcttgagg gctgtgttgt 1469
Lys Glu Asp Glu Glu Lys Glu Glu Lys Glu *
355 360
tttttgtttc agtgtccgtg tctgtctctg tctgtgtcgg tgtcgtttgt tttttcagtg 1529
tttctccgaa taaagtactt gatgtccaag ctgtgtcgtt tggatttgta atgccgatgt 1589
gcaaattctg aactattctt ggctttttgt gttccacccg aagccctatg aacctgcatt 1649
ttgaataaa 1658
<210> 2
<211> 361
<212> PRT
<213> Nicotiana tabacum
<220>
37
WASH1814745.1
WASH 1815926.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
<400> 2
Met Asp Ser Ala Leu Pro Val Ser Ala Ile Gly Phe Glu Gly Phe Glu
1 5 10 15
Lys Arg Leu Glu Ile Ser Phe Phe Glu Pro Gly Leu Phe Ala Asp Pro
20 25 30
Asn Gly Lys Gly Leu Arg Ser Leu Ser Lys Ala Gln Leu Asp Glu Ile
35 40 45
Leu Gly Pro Ala Glu Cys Thr Ile Val Asp Ser Leu Ser Asn Asp Asp
50 55 60
Val Asp Ser Tyr Val Leu Ser Glu Ser Ser Leu Phe Val Tyr Ser Tyr
65 70 75 80
Lys Ile Ile Ile Lys Thr Cys Gly Thr Thr Lys Leu Leu Leu Ala Ile
85 90 95
Pro Pro Ile Leu Lys Leu Ala Glu Thr Leu Ser Leu Lys Val Gln Asp
100 105 110
Val Arg Tyr Thr Arg Gly Ser Phe Ile Phe Pro Gly Ala Gln Ser Phe
115 120 125
Pro His Arg His Phe Ser Glu Glu Val Ala Val Leu Asp Gly Tyr Phe
130 135 140
Gly Lys Leu Ala Ala Gly Ser Lys Ala Val Ile Met Gly Ser Pro Asp
145 150 155 160
Lys Ala Gin Lys Trp His Val Tyr Ser Ala Ser Ala Gly Pro Ile Gln
165 170 175
Ser Asn Asp Pro Val Tyr Thr Leu Glu Met Cys Met Thr Gly Leu Asp
180 185 190
Arg Glu Lys Ala Ser Val Phe Tyr Lys Thr Glu Gly Ser Ser Ala Ala
195 200 205
His Met Thr Val Arg Ser Gly Ile Arg Lys Ile Leu Pro Asn Ser Giu
210 215 220
Ile Cys Asp Phe Glu Phe Glu Pro Cys Gly Tyr Ser Met Asn Ser Ile
225 230 235 240
Glu Gly Ala Ala Leu Ser Thr Ile His Ile Thr Pro Glu Asp Gly Phe
245 250 255
Ser Tyr Ala Ser Phe Glu Ala Val Gly Tyr Asp Met Lys Thr Met Lys
260 265 270
Leu Gly Pro Leu Val Glu Arg Val Leu Ala Cys Phe Gln Pro Asp Glu
275 280 285
Phe Ser Ile Ala Leu His Ala Asp Val Ala Thr Lys Leu Leu Glu Arg
290 295 300
Val Cys Ser Leu Asp Val Lys Gly Tyr Ser Leu Ala Glu Trp Ser Pro
305 310 315 320
Glu Glu Phe Gly Lys Gly Gly Ser Ile Val Tyr Gln Lys Phe Thr Arg
325 330 335
Thr Pro Phe Cys Gly Ser Pro Lys Ser Val Leu Lys Gly Cys Trp Lys
340 345 350
Glu Asp Glu Glu Lys Glu Glu Lys Glu
355 360
38
WASH 1814745.1
WASH 1815926.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
<210> 3
<211> 1777
<212> DNA
<213> Populus deltoides
<220>
<221> CDs
<222> (536)...(1621)
<400> 3
tcggacacaa aaaatattgc aagtttaggg tcataaaaat ctctatcatc acaaacaaat 60
atagggtttg ttgatttggt ggctgttttc gccgtctttg ctttcaaaat tcaatcttga 120
cctgtttctt ttatgctttt tgaataggtt ttttttttga acttgagaaa gagggggttt 180
tcaaaggaga ctagcttttc aagatttgat atattttatt ggactgaatg atctaatgga 240
gtctaaaggt ggcaagaaga agtctagtag tagtagtagt agtaaatcct tatgttacga 300
agctcccctc ggttacagca ttgaagacct cagacctgct ggtggaatca agaagttcag 360
atctgctgca tactccaact gcgttcgaaa accatcctga gattttccaa gtgttgacat 420
aaccccattt tagctatttc gcacgctcaa ttgtctttag tctgtttttc tgttctgctt 480
tcctcgttct cttgtactct ttgctgcact tttcatttgt tgactgtgag gtcag atg 538
Met
1
gcg ctg cca gtc tct gca atc gga ttt gaa ggt tac gaa aaa agg ctt 586
Ala Leu Pro Val Ser Ala Ile Gly Phe Glu Gly Tyr Glu Lys Arg Leu
10 15
gaa ata tct ttc cta gag cct ggc ttc ttt tct gac cct gaa ggg aag 634
Glu Ile Ser Phe Leu Glu Pro Gly Phe Phe Ser Asp Pro Glu Gly Lys
20 25 30
ggc ctg agg tct ttg tcc aag gct caa ttg gac gag att ctc aga cca 682
Gly Leu Arg Ser Leu Ser Lys Ala Gln Leu Asp Glu Ile Leu Arg Pro
35 40 45
gct gaa tgt act att gtt gat tcg cta tca aat gac cag gtt gat tct 730
Ala Glu Cys Thr Ile Val Asp Ser Leu Ser Asn Asp Gln Val Asp Ser
50 55 60 65
tat gtc ctg tcg gaa tcc agt ctc ttt gtg tac cct tac aaa gtt att 778
Tyr Val Leu Ser Glu Ser Ser Leu Phe Val Tyr Pro Tyr Lys Val Ile
70 75 80
atc aaa aca tgt ggg act acc aaa ctg ctt ctc tct ata ccg gtg att 826
Ile Lys Thr Cys Gly Thr Thr Lys Leu Leu Leu Ser Ile Pro Val Ile
85 90 95
ctt aag ctc gct gat gcc ctt tca ctc act gta tgt tct gtg agg tat 874
Leu Lys Leu Ala Asp Ala Leu Ser Leu Thr Val Cys Ser Val Arg Tyr
100 105 110
act cgt ggg agc ttt cta tgc cct ggg gct cag cca ttt cca cac cgc 922
Thr Arg Gly Ser Phe Leu Cys Pro Gly Ala Gln Pro Phe Pro His Arg
115 120 125
aac ttc tgt gag gag gta gct gtc ctt gat ggc cat ttc agt aaa ctt 970
Asn Phe Cys Glu Glu Val Ala Val Leu Asp Gly His Phe Ser Lys Leu
130 135 140 145
ggt ttg aac agt gtg gca tat gtg atg ggt ggt ctt gac aaa act cag 1018
Gly Leu Asn Ser Val Ala Tyr Val Met Gly Gly Leu Asp Lys Thr Gln
150 155 160
39
WASH 1814745.1
WASH 1815926.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
aaa tgg cat gtt tac tct gcc tct gcc gat ata gag agc cat tct ggc 1066
Lys Trp His Val Tyr Ser Ala Ser Ala Asp Ile Glu Ser His Ser Gly
165 170 175
cct gtt tac act ctg gaa atg tgc atg act ggt ttg ggc agg aaa caa 1114
Pro Val Tyr Thr Leu Glu Met Cys Met Thr Gly Leu Gly Arg Lys Gln
180 185 190
gca tct gtt ttc tac aaa aca cat tcc agt tca gct gct gcg atg act 1162
Ala Ser Val Phe Tyr Lys Thr His Ser Ser Ser Ala Ala Ala Met Thr
195 200 205
gag gat tcc ggc ata agg aaa atc ctt cca cag tct gag atc tgt gat 1210
Glu Asp Ser Gly Ile Arg Lys Ile Leu Pro Gln Ser Glu Ile Cys Asp
210 215 220 225
ttt gat ttt gac cct tgt ggt tac tct atg aat gcc att gaa ggg agt 1258
Phe Asp Phe Asp Pro Cys Gly Tyr Ser Met Asn Ala Ile Glu Gly Ser
230 235 240
gca att tcc aca atc cac gtc act cca gaa gat ggt ttc agc tat gca 1306
Ala Ile Ser Thr Ile His Val Thr Pro Glu Asp Gly Phe Ser Tyr Ala
245 250 255
agt ttt gag gct gtg ggc tat gat ctt caa gat ttg aat ttg agt cag 1354
Ser Phe Glu Ala Val Gly Tyr Asp Leu Gln Asp Leu Asn Leu Ser Gln
260 265 270
ctg ctt gaa agg gtt ttg gct tgc ttt gaa ccg acc gag ttc tcc gtt 1402
Leu Leu Glu Arg Val Leu Ala Cys Phe Glu Pro Thr Glu Phe Ser Val
275 280 285
gct ttg cat tct aat atc aag ggt gcc gaa ctt cga gca aag ttt ccc 1450
Ala Leu His Ser Asn Ile Lys Gly Ala Glu Leu Arg Ala Lys Phe Pro
290 295 300 305
ctg gat gtg gaa ggt tac tct ggt gga gga ggg aac tat gaa atg ctt 1498
Leu Asp Val Glu Gly Tyr Ser Gly Gly Gly Gly Asn Tyr Glu Met Leu
310 315 320
ggg aaa gga gga tcg atc atc tac cac agc ttt gca agg act gga ggc 1546
Gly Lys Gly Gly Ser Ile Ile Tyr His Ser Phe Ala Arg Thr Gly Gly
325 330 335
agt gca tct ccc agg tct atc ctg aaa tgt tgt tgg agt gag gat gag 1594
Ser Ala Ser Pro Arg Ser Ile Leu Lys Cys Cys Trp Ser Glu Asp Glu
340 345 350
aag gac gag gaa gct gaa gag aag tag ttcttttcag ctatttgttt 1641
Lys Asp Glu Glu Ala Glu Glu Lys *
355 360
tttcctttta ttttttcctt gaataaattt catggggtta tgattctgag ttcttagagg 1701
catttgtcca tgccttgtgt ctttcattat caatttagtt ttgactttgg attaataaag 1761
gggtttgtgt tatcag 1777
<210> 4
<211> 361
<212> PRT
<213> Populus deltoides
<220>
<400> 4
Met Ala Leu Pro Val Ser Ala Ile Gly Phe Glu Gly Tyr Glu Lys Arg
1 5 10 15
Leu Glu Ile Ser Phe Leu Glu Pro Gly Phe Phe Ser Asp Pro Glu Gly
WASH 1814745.1
WASH 1815926_.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
20 25 30
Lys Gly Leu Arg Ser Leu Ser Lys Ala Gln Leu Asp Glu Ile Leu Arg
35 40 45
Pro Ala Glu Cys Thr Ile Val Asp Ser Leu Ser Asn Asp Gln Val Asp
50 55 60
Ser Tyr Val Leu Ser Glu Ser Ser Leu Phe Val Tyr Pro Tyr Lys Val
65 70 75 80
Ile Ile Lys Thr Cys Gly Thr Thr Lys Leu Leu Leu Ser Ile Pro Val
85 90 95
Ile Leu Lys Leu Ala Asp Ala Leu Ser Leu Thr Val Cys Ser Val Arg
100 105 110
Tyr Thr Arg Gly Ser Phe Leu Cys Pro Gly Ala Gln Pro Phe Pro His
115 120 125
Arg Asn Phe Cys Glu Glu Val Ala Val Leu Asp Gly His Phe Ser Lys
130 135 140
Leu Gly Leu Asn Ser Val Ala Tyr Val Met Gly Gly Leu Asp Lys Thr
145 150 155 160
Gln Lys Trp His Val Tyr Ser Ala Ser Ala Asp Ile Glu Ser His Ser
165 170 175
Gly Pro Val Tyr Thr Leu Glu Met Cys Met Thr Gly Leu Gly Arg Lys
180 185 190
Gln Ala Ser Val Phe Tyr Lys Thr His Ser Ser Ser Ala Ala Ala Met
195 200 205
Thr Glu Asp Ser Gly Ile Arg Lys Ile Leu Pro Gln Ser Glu Ile Cys
210 215 220
Asp Phe Asp Phe Asp Pro Cys Gly Tyr Ser Met Asn Ala Ile Glu Gly
225 230 235 240
Ser Ala Ile Ser Thr Ile His Val Thr Pro Glu Asp Gly Phe Ser Tyr
245 250 255
Ala Ser Phe Glu Ala Val Gly Tyr Asp Leu Gln Asp Leu Asn Leu Ser
260 265 270
Gln Leu Leu Glu Arg Val Leu Ala Cys Phe Glu Pro Thr Glu Phe Ser
275 280 285
Val Ala Leu His Ser Asn Ile Lys Gly Ala Glu Leu Arg Ala Lys Phe
290 295 300
Pro Leu Asp Val Glu Gly Tyr Ser Gly Gly Gly Gly Asn Tyr Glu Met
305 310 315 320
Leu Gly Lys Gly Gly Ser Ile Ile Tyr His Ser Phe Ala Arg Thr Gly
325 330 335
Gly Ser Ala Ser Pro Arg Ser Ile Leu Lys Cys Cys Trp Ser Glu Asp
340 345 350
Glu Lys Asp Glu Glu Ala Glu Glu Lys
355 360
<210> 5
<211> 1763
<212> DNA
<213> Populus deltoides
<220>
41
WASH 1814745.1
WASH 1815926.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
<221> CDs
<222> (548) ... (1624)
<400> 5
acaaacaaga acccttcacg ttctttaaca atcttgcaga tttaagctct taaaaatctc 60
tctcttcaaa aacaaatcta gagtttgttg attttgtcat tggttttgcc cttttttttt 120
ctataaaaaa ccaatcttga tttgtttctt gaacagagtt tagtttggag tttgagaaag 180
agggagtttt tgaaggagat taatttttca agatttcata taatttattg acaagactga 240
atgatccatg gagtctaaag gtggcaagaa gtctagtagt agtagtagta gtagtaaatc 300
cttattgtac gaagcacctc tcggctacag cattgaagac atcagacctg ccggtggaat 360
caagaagttc cgatctgctg cttactccaa ctgcgttcgg aagccatcct gagattttcc 420
aagtgttgag ataacccctt tttagctttt tcatactgtc tgttgtcctt agtctttttt 480
tcttttctgc tttcctcgtt ctctcgcact cttttctgca attgtcatct gtttactgtg 540
aggtgag atg gca ctg ccg gtc tct gca atc gga ttt gaa ggt tac gaa 589
Met Ala Leu Pro Val Ser Ala Ile Gly Phe Glu Gly Tyr Glu
1 5 10
aaa agg ctt gaa att tgc ttt tta gag cct ggc ttc ttt tct gac cct 637
Lys Arg Leu Glu Ile Cys Phe Leu Glu Pro Gly Phe Phe Ser Asp Pro
15 20 25 30
gaa gga aag ggc ctc agg tct ttg tcc aag gct caa ttg gac gag att 685
Glu Gly Lys Gly Leu Arg Ser Leu Ser Lys Ala Gin Leu Asp Glu Ile
35 40 45
ctc aaa cca gct gaa tgc act ata gtt gat tcg ctt tca aat gac gag 733
Leu Lys Pro Ala Glu Cys Thr Ile Val Asp Ser Leu Ser Asn Asp Glu
50 55 60
gtt gat tcg tat gtt ctg tcg gaa tcc agt ctc ttt gta tac cct tac 781
Val Asp Ser Tyr Val Leu Ser Glu Ser Ser Leu Phe Val Tyr Pro Tyr
65 70 75
aaa gtt atc atc aaa act tgt ggg act acc aaa ctg ctt ctt tcg atc 829
Lys Val Ile Ile Lys Thr Cys Gly Thr Thr Lys Leu Leu Leu Ser Ile
80 85 90
cca gtg atc ctt gag ctc gct gat gcc ctt tca ctc act gta tgt tct 877
Pro Val Ile Leu Glu Leu Ala Asp Ala Leu Ser Leu Thr Val Cys Ser
95 100 105 110
gtg agg tat act cgt ggg agc ttc ata tgt ccc ggg gcg cag cca ttt 925
Val Arg Tyr Thr Arg Gly Ser Phe Ile Cys Pro Gly Ala Gln Pro Phe
115 120 125
ccg cat cgt aac ttc tgt gag gag gta act gtc ctc gat ggc cat ttc 973
Pro His Arg Asn Phe Cys Glu Giu Val Thr Val Leu Asp Gly His Phe
130 135 140
agt aaa ttt ggt tta gag agt gtg gca tat gtg atg gga agt ccc aac 1021
Ser Lys Phe Gly Leu Glu Ser Val Ala Tyr Val Met Gly Ser Pro Asn
145 150 155
tca act cag aaa tgg cat gtt tac tct gct gct gct ggt gtg aag agc 1069
Ser Thr Gln Lys Trp His Val Tyr Ser Ala Ala Ala Gly Val Lys Ser
160 165 170
cat tct ggc cct gtt tac act ctg gaa atg tgc atg act ggt ttg gac 1117
His Ser Gly Pro Val Tyr Thr Leu Glu Met Cys Met Thr Gly Leu Asp
175 180 185 190
agg aag cga gca tct gtt ttc tac aaa aca cac gcc agt tca gct act 1165
42
WASH_1814745.1
WASH_1815926.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
Arg Lys Arg Ala Ser Val Phe Tyr Lys Thr His Ala Ser Ser Ala Thr
195 200 205
gtt atg act gag gat tct ggt ata agg aag atc ctt ccg caa tct gag 1213
Val Met Thr Glu Asp Ser Gly Ile Arg Lys Ile Leu Pro Gln Ser Glu
210 215 220
atc tgc gat ttt gat ttt gac cct tgt ggt tac tct atg aat gcc att 1261
Ile Cys Asp Phe Asp Phe Asp Pro Cys Gly Tyr Ser Met Asn Ala Ile
225 230 235
gaa ggg agt gca att tcc aca atc cat gtc acc cca gaa gat ggt ttc 1309
Glu Gly Ser Ala Ile Ser Thr Ile His Val Thr Pro Glu Asp Gly Phe
240 245 250
agc tat gca agt ttt gag gct gtg ggt tat gat ttt caa gaa tta aat 1357
Ser Tyr Ala Ser Phe Glu Ala Val Gly Tyr Asp Phe Gin Glu Leu Asn
255 260 265 270
ttg aag cag ctc ctt tat agg gtt ttg gtt tgc ttt gaa ccg acc gag 1405
Leu Lys Gln Leu Leu Tyr Arg Val Leu Val Cys Phe Glu Pro Thr Glu
275 280 285
ttc tcc att gcg ttg cat tct aat gtt gag tgt gac gaa ctt gga gcg 1453
Phe Ser Ile Ala Leu His Ser Asn Val Glu Cys Asp Glu Leu Gly Ala
290 295 300
atg ttt tcc ctg gat gtg aaa ggt tac tct tgt gga ggg ggg aac tat 1501
Met Phe Ser Leu Asp Val Lys Gly Tyr Ser Cys Gly Gly Gly Asn Tyr
305 310 315
gaa atg ctc ggg aag ggt gga tcg att gtc tac cac agc ttt gca gcg 1549
Glu Met Leu Gly Lys Gly Gly Ser Ile Val Tyr His Ser Phe Ala Ala
320 325 330
act gga ggc tgc tca tct ccc agg tca atc ctg aaa tgt tgt tgg agt 1597
Thr Gly Gly Cys Ser Ser Pro Arg Ser Ile Leu Lys Cys Cys Trp Ser
335 340 345 350
gag gac gag gaa gct gaa gag aag tag ttcttttcag caatgtgttt 1644
Glu Asp Glu Glu Ala Glu Glu Lys *
355
tttctttttc ttttcttttt tgtgtttagt tgttgatgtc atggggttat gattctgagt 1704
tttagaggca tttgtccatg ccttgagtct ttcattacaa tttatctcat gtcttgttc 1763
<210> 6
<211> 358
<212> PRT
<213> Populus deltoides
<220>
<400> 6
Met Ala Leu Pro Val Ser Ala Ile Gly Phe Glu Giy Tyr Glu Lys Arg
1 5 10 15
Leu Glu Ile Cys Phe Leu Glu Pro Gly Phe Phe Ser Asp Pro Glu Gly
20 25 30
Lys Gly Leu Arg Ser Leu Ser Lys Ala Gln Leu Asp Glu Ile Leu Lys
35 40 45
Pro Ala Glu Cys Thr Ile Val Asp Ser Leu Ser Asn Asp Glu Val Asp
50 55 60
Ser Tyr Val Leu Ser Glu Ser Ser Leu Phe Val Tyr Pro Tyr Lys Val
65 70 75 80
43
WASH 1814745.1
WASH 1815926.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 05 9994-0114
Ile Ile Lys Thr Cys Gly Thr Thr Lys Leu Leu Leu Ser Ile Pro Val
85 90 95
Ile Leu Glu Leu Ala Asp Ala Leu Ser Leu Thr Val Cys Ser Val Arg
100 105 110
Tyr Thr Arg Gly Ser Phe Ile Cys Pro Gly Ala Gln Pro Phe Pzo His
115 120 125
Arg Asn Phe Cys Glu Glu Val Thr Val Leu Asp Gly His Phe Ser Lys
130 135 140
Phe Gly Leu Glu Ser Val Ala Tyr Val Met Gly Ser Pro Asn Ser Thr
145 150 155 160
Gln Lys Trp His Val Tyr Ser Ala Ala Ala Gly Val Lys Ser His Ser
165 170 175
Gly Pro Val Tyr Thr Leu Glu Met Cys Met Thr Gly Leu Asp Arg Lys
180 185 190
Arg Ala Ser Val Phe Tyr Lys Thr His Ala Ser Ser Ala Thr Val Met
195 200 205
Thr Glu Asp Ser Gly Ile Arg Lys Ile Leu Pro Gln Ser Glu Ile Cys
210 215 220
Asp Phe Asp Phe Asp Pro Cys Gly Tyr Ser Met Asn Ala Ile Glu Gly
225 230 235 240
Ser Ala Ile Ser Thr Ile His Val Thr Pro Glu Asp Gly Phe Ser Tyr
245 250 255
Ala Ser Phe Glu Ala Val Gly Tyr Asp Phe Gln Glu Leu Asn Leu Lys
260 265 270
Gln Leu Leu Tyr Arg Val Leu Val Cys Phe Glu Pro Thr Glu Phe Ser
275 280 285
Ile Ala Leu His Ser Asn Val Glu Cys Asp Glu Leu Gly Ala Met Phe
290 295 300
Ser Leu Asp Val Lys Gly Tyr Ser Cys Gly Gly Gly Asn Tyr Glu Met
305 310 315 320
Leu Gly Lys Gly Gly Ser Ile Val Tyr His Ser Phe Ala Ala Thr Gly
325 330 335
Gly Cys Ser Ser Pro Arg Ser Ile Leu Lys Cys Cys Trp Ser Glu Asp
340 345 350
Glu Glu Ala Glu Glu Lys
355
<210> 7
<211> 2523
<212> DNA
<213> Populus deltoides
<220>
<221> CDs
<222> (1283)...(2368)
<400> 7
ttaaccctat atttctctca gaactcacat aaaaaatatt gcgagtttag ggtcataaaa 60
atctctatca tcacaaacaa atatagggtt tgttgatttg gtggctgttt tcgccgtctt 120
tgctttcaaa attcaatctt gacctgtttc ttttatgctt tttgaatagg taatatatac 180
44
WASH_1814745.1
WASH_1815926.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
attgtttgtt ttgcttgctt tggttttgta atctggtgat cttgtttaat tctttttggc 240
tttggtttgt aggttttttt ttttgaacyt gagaaagagg ggggttttca arggagacta 300
gcttttcaag awttgatata ttttattggt aagtttttnt tttccgtttt ttggtaatag 360
ttgcatggat tcttggtgta gatgttgatt tggacttgtt tttgtattgt tgtcctttat 420
gttttatgtg tatgttaatt gttctgatcc ttgatataat gtaaatctga ggcttttatt 480
tttatggatt cgttaaggtg tatggacttg gtttatggtt ttggtcttga aaaaaaaatt 540
aggcttagca agttttcttc tgagaataac ttattttatt ttattattta aaattaaatg 600
gtgtttggga atttgaattc tttctctttg gtattttttc tatccttgtg aatctgttta 660
gtcttttaaa ttcaatattt tattttattt tacttatgat ttggtgattg attagttatt 720
tttgtagctt gtattgtctg ttgattttta atctccaata tgtcttactt ctcagttttt 780
ttcaatttgc tattggaatt ttgctattat ttttaagatt gtagactagt ttgctttgag 840
ttttgtgcta attgcaatcc ttcttgtgtg attcttacag gactgaatga tctaatggag 900
tctaaaggtg gcaagaagaa gtctagtagt agtagtagta gtaaatcctt atgttacgaa 960
gctcccctcg gttacagcat tgaagacctc agacctgctg gtggaatcaa gaagttcaga 1020
tctgctgcat actccaacgt gagtttgaag ttaatcgatc tgtttttcct ttggcatttc 1080
attgtgcgac tggtttccta atcttgtgtc atgtttattt gtgcaqtgcg ttcgaaaacc 1140
atcctgagat tttccaagtg ttgacataac cccattttag ctatttcgca cgctcagttg 1200
tctttaktct gtttttctgt tctgctttcc tcgttctctt gtactctttg ctgcactttt 1260
catttgttga ctgtgaggtc ag atg gcg ctg cca gtc tct gca atc gga ttt 1312
Met Ala Leu Pro Val Ser Ala Ile Gly Phe
1 5 10
gaa ggt tac gaa aaa agg ctt gaa ata tct ttc cta gag cct ggc ttc 1360
Glu Gly Tyr Glu Lys Arg Leu Glu Ile Ser Phe Leu Glu Pro Gly Phe
15 20 25
ttt tct gac cct gaa ggg aag ggc ctg agg tct ttg tcc aag gct caa 1408
Phe Ser Asp Pro Glu Gly Lys Gly Leu Arg Ser Leu Ser Lys Ala Gln
30 35 40
ttg gac gag att ctc aga cca gct gaa tgt act att gtt gat tcg cta 1456
Leu Asp Glu Ile Leu Arg Pro Ala Glu Cys Thr Ile Val Asp 3er Leu
45 50 55
tca aat gac cag gtt gat tct tat gtc ctg tcg gaa tcc agt ctc ttt 1504
Ser Asn Asp Gln Val Asp Ser Tyr Val Leu Ser Glu Ser Ser Leu Phe
60 65 70
gtg tac cct tac aaa gtt att atc aaa aca tgt ggg act acc aaa ctg 1552
Val Tyr Pro Tyr Lys Val Ile Ile Lys Thr Cys Gly Thr Thr Lys Leu
75 80 85 90
ctt ctc tcg ata ccg gtg att ctt aag ctc gct gat gcc ctt tca ctc 1600
Leu Leu Ser Ile Pro Val Ile Leu Lys Leu Ala Asp Ala Leu Ser Leu
95 100 105
act gta tgt tct gtg agg tat act cgt ggg agc ttt cta tgc cct ggg 1648
Thr Val Cys Ser Val Arg Tyr Thr Arg Gly Ser Phe Leu Cys Pro Gly
110 115 120
gct cag cca ttt cca cac cgc aac ttc tgt gag gag gta gct qtc ctt 1696
Ala Gln Pro Phe Pro His Arg Asn Phe Cys Glu Glu Val Ala Val Leu
125 130 135
WASH_ I814745.1
WASH_1815926.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
gac gat cac ttc agt aaa ctt ggt tta aac agt gtg gca tat gtg atg 1744
Asp Asp His Phe Ser Lys Leu Gly Leu Asn Ser Val Ala Tyr Val Met
140 145 150
ggt ggt ctt gac aaa act cag aaa tgg cat gtt tac tct gcc tct gcc 1792
Gly Gly Leu Asp Lys Thr Gln Lys Trp His Val Tyr Ser Ala Ser Ala
155 160 165 170
gat ata gag agc cat tct ggc cct gtt tac act ctg gaa atg tgc atg 1840
Asp Ile Glu Ser His Ser Gly Pro Val Tyr Thr Leu Glu Met Cys Met
175 180 185
act ggt ttg ggc agg aaa caa gca tct gtt ttc tac aaa aca cat tcc 1888
Thr Gly Leu Gly Arg Lys Gln Ala Ser Val Phe Tyr Lys Thr His Ser
190 195 200
agt tca gct gct gcg atg act gag gat tcc ggt ata agg aaa atc ctt 1936
Ser Ser Ala Ala Ala Met Thr Glu Asp Ser Gly Ile Arg Lys Ile Leu
205 210 215
cca cag tct gag atc tgt gat ttt gat ttt gac cca tgt ggt tac tct 1984
Pro Gln Ser Glu Ile Cys Asp Phe Asp Phe Asp Pro Cys Gly Tyr Ser
220 225 230
atg aat gcc att gaa ggg agt gca att tcc aca atc cac gtc act cca 2032
Met Asn Ala Ile Glu Gly Ser Ala Ile Ser Thr Ile His Val Thr Pro
235 240 245 250
gaa gat ggt ttc agc tat gca agt ttt gag gct gtg ggc tat gat ctt 2080
Glu Asp Gly Phe Ser Tyr Ala Ser Phe Glu Ala Val Gly Tyr Asp Leu
255 260 265
caa gat ttg aat ttg agt cgg ctg ctt gaa agg gtc ttg gct tgc ttt 2128
Gln Asp Leu Asn Leu Ser Arg Leu Leu Glu Arg Val Leu Ala Cys Phe
270 275 280
gaa ccg acc atg ttc tcc gtt gcc ttg cat tct aat atc aag ggt gcc 2176
Glu Pro Thr Met Phe Ser Val Ala Leu His Ser Asn Ile Lys Gly Ala
285 290 295
gaa ctt aga gca aag ttt ccc ctg gac gtg gaa ggt tac tct ggc gga 2224
Glu Leu Arg Ala Lys Phe Pro Leu Asp Val Glu Gly Tyr Ser G1y Gly
300 305 310
gga ggg aac tat gaa atg ctt ggg aaa ggt gga tcg atc atc tac cac 2272
Gly Gly Asn Tyr Glu Met Leu Gly Lys Gly Gly Ser Ile Ile Tyr His
315 320 325 330
agc ttt gca agg act gga ggc agt gca tct ccc agg tct atc ctg aaa 2320
Ser Phe Ala Arg Thr Gly Gly Ser Ala Ser Pro Arg Ser Ile Leu Lys
335 340 345
tgt tgt tgg agt gag gat gag aag gac gag gaa gct gaa gag aag tag 2368
Cys Cys Trp Ser Glu Asp Glu Lys Asp Glu Glu Ala Glu Glu Lys *
350 355 360
ttcttttcag ctatttgttt tttcctttta ttttttcctt gaataaatgt catggggtta 2428
tgattctgag ttcttgaggc atttgtccat gcctcgtgtc tttcattatc gatttagttt 2488
tgacttcgga ttaataaagg ggtttgtgtt atcag 2523
<210> 8
<211> 361
<212> PRT
<213> Populus deltoides
<220>
<400> 8
46
WASH_1814745.1
WASH_1815926,1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
Met Ala Leu Pro Val Ser Ala Ile Gly Phe Glu Gly Tyr Glu Lys Arg
1 5 10 15
Leu Glu Ile Ser Phe Leu Glu Pro Gly Phe Phe Ser Asp Pro Glu Gly
20 25 30
Lys Gly Leu Arg Ser Leu Ser Lys Ala G1n Leu Asp Glu Ile Leu Arg
35 40 45
Pro Ala Glu Cys Thr Ile Val Asp Ser Leu Ser Asn Asp Gln Val Asp
50 55 60
Ser Tyr Val Leu Ser Giu Ser Ser Leu Phe Val Tyr Pro Tyr Lys Val
65 70 75 80
Ile Ile Lys Thr Cys Gly Thr Thr Lys Leu Leu Leu Ser Ile Pro Val
85 90 95
Ile Leu Lys Leu Ala Asp Ala Leu Ser Leu Thr Val Cys Ser Val Arg
100 105 110
Tyr Thr Arg Gly Ser Phe Leu Cys Pro Gly Ala Gln Pro Phe Pro His
115 120 125
Arg Asn Phe Cys Glu Glu Val Ala Val Leu Asp Asp His Phe Ser Lys
130 135 140
Leu Gly Leu Asn Ser Val Ala Tyr Val Met Gly Gly Leu Asp Lys Thr
145 150 155 160
Gln Lys Trp His Val Tyr Ser Ala Ser Ala Asp Ile Glu Ser His Ser
165 170 175
Gly Pro Val Tyr Thr Leu Glu Met Cys Met Thr Gly Leu Gly Arg Lys
180 185 190
Gln Ala Ser Val Phe Tyr Lys Thr His Ser Ser Ser Ala Ala Ala Met
195 200 205
Thr Glu Asp Ser Gly Ile Arg Lys Ile Leu Pro Gln Ser Glu Ile Cys
210 215 220
Asp Phe Asp Phe Asp Pro Cys Gly Tyr Ser Met Asn Ala Ile Glu Gly
225 230 235 240
Ser Ala Ile Ser Thr Ile His Val Thr Pro Glu Asp Gly Phe Ser Tyr
245 250 255
Ala Ser Phe Glu Ala Val Gly Tyr Asp Leu Gln Asp Leu Asn Leu Ser
260 265 270
Arg Leu Leu Glu Arg Val Leu Ala Cys Phe Glu Pro Thr Met Phe Ser
275 280 285
Val Ala Leu His Ser Asn Ile Lys Gly Ala Glu Leu Arg Ala Lys Phe
290 295 300
Pro Leu Asp Val Glu Gly Tyr Ser Gly Gly Gly Gly Asn Tyr Glu Met
305 310 315 320
Leu Gly Lys Gly Gly Ser Ile Ile Tyr His Ser Phe Ala Arg Thr Gly
325 330 335
Gly Ser Ala Ser Pro Arg Ser Ile Leu Lys Cys Cys Trp Ser Glu Asp
340 345 350
Glu Lys Asp Glu Glu Ala Glu Glu Lys
355 360
<210> 9
<211> 1878
47
WASH_1814745.1
WASH 1815926.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
<212> DNA
<213> Arabidopsis thaliana
<220>
<221> CDs
<222> (540) ... (1878)
<400> 9
gaacgcatct cattgcttca tcattaccaa atcatcaact taatcgtttc tctcaaattt 60
agggttttct cttttctcga aagtcttgcg gttttctgaa tcatctctat ctggtttgag 120
ggtttcgttt gatatctgga gaaaggggtt tctggaaaca aggagttcat aattcgcgat 180
cttgatctat cgatcttcat ttatatataa aagcgtgaat gagattatga tggagtcgaa 240
aggtggtaaa aagaagtcca gcagtagtag ttccttattt tacgaagctc ccctcggtta 300
cagcattgaa gacgttcgtc caaacggtgg aatcaagaaa ttcaaatctt ctgtctactc 360
aaactgctcc aagaggccat cctgagtacc aqcgtgcacc gatcttcata atatagttat 420
agctttcttt actttccagt ttataatttt cttctttcaa agctcctttt ctgctggttc 480
ccggatccaa tcgttctctc ctcctactac aagtcctgtc gctcacacaa caaggcgag 539
atg gcc tta tct gca atc ggt ttc gaa ggt tac gag aaa cgg ctc gag 587
Met Ala Leu Ser Ala Ile Gly Phe Glu Gly Tyr Glu Lys Arg Leu Glu
1 5 10 15
gtg act ttc ttt gag cca agc atc ttt caa gac tcc aag gga ctg gga 635
Val Thr Phe Phe Glu Pro Ser Ile Phe Gln Asp Ser Lys Gly Leu Gly
20 25 30
ctc cgt gct ctg acc aag tcc cag ctt gat gaa att ctt aca cct gct 683
Leu Arg Ala Leu Thr Lys Ser Gln Leu Asp Glu Ile Leu Thr Pro Ala
35 40 45
gca tgc acg atc gtt tca tct ctc tcc aac gat caa ttg gac tct tac 731
Ala Cys Thr Ile Val Ser Ser Leu Ser Asn Asp Gln Leu Asp Ser Tyr
50 55 60
gta ctc tct gag tcc agc ttc ttt gtc tac ccc tac aaa gtc atc atc 779
Val Leu Ser Glu Ser Ser Phe Phe Val Tyr Pro Tyr Lys Val Ile Ile
65 70 75 80
aag act tgc ggt acc act aag ctc ctc ctc tct atc cca cca ctt cta 827
Lys Thr Cys Gly Thr Thr Lys Leu Leu Leu Ser Ile Pro Pro Leu Leu
85 90 95
aag ctg gct ggt gag ctc tct ctg agt gtc aag tct gtg aag tac act 875
Lys Leu Ala Gly Glu Leu Ser Leu Ser Val Lys Ser Val Lys Tyr Thr
100 105 110
cgc ggc tCc ttc ctc tgc ccc gga ggc cag cct ttt cct cac cgc agc 923
Arg Gly Ser Phe Leu Cys Pro Gly Gly Gln Pro Phe Pro His Arg Ser
115 120 125
ttc tct gaa gaa gtc tct gtt ctt gat ggg cac ttt act cag ctg ggc 971
Phe Ser Glu Glu Val Ser Val Leu Asp Gly His Phe Thr Gln Leu Gly
130 135 140
ttg aac agc gta gcc tac ttg atg ggc aat gat gat gag act aag aaa 1019
Leu Asn Ser Val Ala Tyr Leu Met Gly Asn Asp Asp Glu Thr Lys Lys
145 150 155 160
tgg cat gtc tat gct gcc tct gcc cag gac tcc agc aac tgc aac aac 1067
Trp His Val Tyr Ala Ala Ser Ala Gln Asp Ser Ser Asn Cys Asn Asn
165 170 175
aat gtc tac act ctc gag atg tgc atg act ggt ctg gac aga gag aaa 1115
48
WASH1814745.1
WASH_1815926.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
Asn Val Tyr Thr Leu Glu Met Cys Met Thr Gly Leu Asp Arg Glu Lys
180 185 190
gct gct gtc ttc tac aag gat gaa gct gac aag act ggg taa atg act 1163
Ala Ala Val Phe Tyr Lys Asp Glu Ala Asp Lys Thr Gly Ser Met Thr
195 200 205
gat aac tct gga atc aga aag atc ctt ccc aag tct gag atc tgc gac 1211
Asp Asn Ser Gly Ile Arg Lys Ile Leu Pro Lys Ser Glu Ile Cys Asp
210 215 220
ttt gaa ttc gag ccc tgc ggc tac tct atg aac tca att gaa ggg gat 1259
Phe Glu Phe Glu Pro Cys Gly Tyr Ser Met Asn Ser Ile Glu Gly Asp
225 230 235 240
gca atc tcc acg atc cat gtg acc cct gaa gat ggg ttt agc tac gct 1307
Ala Ile Ser Thr Ile His Val Thr Pro Glu Asp Gly Phe Ser Tyr Ala
245 250 255
agc ttc gaa gct gtg ggt tac gac ttc aac acc ctt gac ctt agc cag 1355
Ser Phe Glu Ala Val Gly Tyr Asp Phe Asn Thr Leu Asp Leu Ser Gln
260 265 270
ctg gtg aca agg gtt ctc tct tgc ttc gag ccc aag caa ttc tct gta 1403
Leu Val Thr Arg Val Leu Ser Cys Phe Glu Pro Lys Gln Phe Ser Val
275 280 285
gct gtg cac tcg agc gtt gga gcg aac tca tac aag cca gag att act 1451
Ala Val His Ser Ser Val Gly Ala Asn Ser Tyr Lys Pro Glu Ile Thr
290 295 300
gta gac ttg gaa gac tat ggg tgc aga gag agg aca ttt gag tct cta 1499
Val Asp Leu Glu Asp Tyr Gly Cys Arg Glu Arg Thr Phe Glu Ser Leu
305 310 315 320
gga gaa gag agt gga aca gtg atg tat cag acg ttt gag aag ctt ggt 1547
Gly Glu Glu Ser Gly Thr Val Met Tyr Gln Thr Phe Glu Lys Leu Gly
325 325 330
aag tac tgt gga tcg cct aga tct acc ttg aag tgt gaa tgg agc agc 1595
Lys Tyr Cys Gly Ser Pro Arg Ser Thr Leu Lys Cys Glu Trp Ser Ser
335 340 345
aac aat agc tgc agc agc gag gac gag aag gac gag gga atc tagcagaatt 1647
Asn Asn Ser Cys Ser Ser Glu Asp Glu Lys Asp Glu Gly Ile
350 355 360
tttcttccta ataactattt tcgagctttc tgtttttgtt ctttcttttt aaaaaactta 1707
ttaagttctt atgaataatg acttgtgaag tttgagttcg tctccttcac aagcaagttg 1767
tattggtgtt ttctacttta tgaatatggg ttttatatac ctaaagactt gttatgttat 1827
tattcttaaa tgttgctgct atgatgatta ctattatcga tttttactaa a 1878
<210> 10
<211> 366
<212> PRT
<213> Arabidopsis thaliana
<220>
<400> 10
Met Ala Leu Ser Ala Ile Gly Phe Glu Gly Tyr Glu Lys Arg Leu Glu
1 5 10 15
Val Thr Phe Phe Glu Pro Ser Ile Phe Gln Asp Ser Lys Gly Leu Gly
20 25 30
Leu Arg Ala Leu Thr Lys Ser Gln Leu Asp Glu Ile Leu Thr Pro Ala
35 40 45
49
WASH 1814745.1
WASH 1815926.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
Ala Cys Thr Ile Val Ser Ser Leu Ser Asn Asp Gln Leu Asp Ser Tyr
50 55 60
Val Leu Ser Glu Ser Ser Phe Phe Val Tyr Pro Tyr Lys Val Ile Ile
65 70 75 80
Lys Thr Cys Gly Thr Thr Lys Leu Leu Leu Ser Ile Pro Pro Leu Leu
85 90 95
Lys Leu Ala Gly Glu Leu Ser Leu Ser Val Lys Ser Val Lys Tyr Thr
100 105 110
Arg Gly Ser Phe Leu Cys Pro Gly Gly Gln Pro Phe Pro His Arg Ser
115 120 125
Phe Ser Glu Glu Val Ser Val Leu Asp Gly His Phe Thr Gln Leu Gly
130 135 140
Leu Asn Ser Val Ala Tyr Leu Met Gly Asn Asp Asp Glu Thr Lys Lys
145 150 155 160
Trp His Val Tyr Ala Ala Ser Ala Gln Asp Ser Ser Asn Cys Asn Asn
165 170 175
Asn Val Tyr Thr Leu Glu Met Cys Met Thr Gly Leu Asp Arg Glu Lys
180 185 190
Ala Ala Val Phe Tyr Lys Asp Glu Ala Asp Lys Thr Gly Ser Met Thr
195 200 205
Asp Asn Ser Gly Ile Arg Lys Ile Leu Pro Lys Ser Glu ile Cys Asp
210 215 220
Phe Glu Phe Glu Pro Cys Gly Tyr Ser Met Asn Ser Ile Glu Gly Asp
225 230 235 240
Ala Ile Ser Thr Ile His Val Thr Pro Glu Asp Gly Phe Ser Tyr Ala
245 250 255
Ser Phe Glu Ala Val Gly Tyr Asp Phe Asn Thr Leu Asp Leu Ser Gln
260 265 270
Leu Val Thr Arg Val Leu Ser Cys Phe Glu Pro Lys Gln Phe Ser Val
275 280 285
Ala Val His Ser Ser Val Gly Ala Asn Ser Tyr Lys Pro Glu Ile Thr
290 295 300
Val Asp Leu Glu Asp Tyr Gly Cys Arg Glu Arg Thr Phe Glu Ser Leu
305 310 315 320
Gly Glu Glu Ser Gly Thr Val Met Tyr Gln Thr Phe Glu Lys Leu Gly
325 330 335
Lys Tyr Cys Gly Ser Pro Arg Ser Thr Leu Lys Cys Glu Trp Ser Ser
340 345 350
Asn Asn Ser Cys Ser Ser Glu Asp Glu Lys Asp Glu Gly Ile
355 360 365
<210> 11
<211> 795
<212> DNA
<213> Xanthomonas axonopodis pv. citri
<220>
<221> CDs
<222> (1)...(795)
<400> 11
WASH_1814745.1
WASH_1815926.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
atg gtc aag ccg ttg cct cgt ctg agg cta cag ggg ttc aac aac ctc 48
Met Val Lys Pro Leu Pro Arg Leu Arg Leu Gln Gly Phe Asn Asn Leu
10 15
acc aag gcg ttg agc ttc aac atc tac gac gtc tgt tat gcg cgt acc 96
Thr Lys Ala Leu Ser Phe Asn Ile Tyr Asp Val Cys Tyr Ala Arg Thr
20 25 30
gaa gag gag cgt cag cgc tac atc gag tat atc gat gag caa tac gac 144
Glu Glu Glu Arg Gln Arg Tyr Ile Glu Tyr Ile Asp Glu Gln Tyr Asp
35 40 45
gcc gat cgt ctg acg cag atc ctg acc gat gtg gcc gag atc att ggc 192
Ala Asp Arg Leu Thr Gln Ile Leu Thr Asp Val Ala Glu Ile Ile Gly
50 55 60
gcc aac atc ctc aat atc gca cgt cag gac tac gat ccg cag ggt gca 240
Ala Asn Ile Leu Asn Ile Ala Arg Gln Asp Tyr Asp Pro Gln Gly Ala
65 70 75 80
tcg gtg acg atc ctg atc tcc gaa gag ccg gtg atc gac aag aag cag 288
Ser Val Thr Ile Leu Ile Ser Glu Glu Pro Val Ile Asp Lys Lys Gln
85 90 95
gcc ggc aag gaa ttg atc tcc gat gcc gtg gtt gct cat atg gat aag 336
Ala Gly Lys Glu Leu Ile Ser Asp Ala Val Val Ala His Met Asp Lys
100 105 110
agt cat atc act gtc cat aca tat ccg gaa acg cat ccg cag gaa ggc 384
Ser His Ile Thr Val His Thr Tyr Pro Glu Thr His Pro Gln Glu Gly
115 120 125
atc gcc acg ttc cgc gcc gac atc gac gtc gcg acc tgc ggc gtg att 432
Ile Ala Thr Phe Arg Ala Asp Ile Asp Val Ala Thr Cys Gly Val Ile
130 135 140
tcg ccg ttg aaa gcg ctc aac tac ctg atc gag agt ctg gaa tcg gac 480
Ser Pro Leu Lys Ala Leu Asn Tyr Leu Ile Glu Ser Leu Glu Ser Asp
145 150 155 160
att gtg atc atg gat tac cgc gtg cgt ggc ttc acg cgc gat gtg aag 528
Ile Val Ile Met Asp Tyr Arg Vai Arg Gly Phe Thr Arg Asp Val Lys
165 170 175
ggc aag aag cat tac atc gat cac aag atc aac tcg att cag caa ttt 576
Gly Lys Lys His Tyr Ile Asp His Lys Ile Asn Ser Ile Gln Gln Phe
180 185 190
ctc gcc aag aac gtg aag tcg cgc tac gag atg ttc gac gtc aac gtc 624
Leu Ala Lys Asn Val Lys Ser Arg Tyr Glu Met Phe Asp Val Asn Val
195 200 205
tac cag gaa aat atc ttc cac acg aag atg cac ctg aag gac ttc gac 672
Tyr Gln Glu Asn Ile Phe His Thr Lys Met His Leu Lys Asp Phe Asp
210 215 220
ctg gat cag tac ctg ttc gaa gag cgc gcc aag aac ctc tcg ttc aag 720
Leu Asp Gln Tyr Leu Phe Glu Glu Arg Ala Lys Asn Leu Ser Phe Lys
225 230 235 240
gag cgc atg aag atc gaa acg ctg ctc aag cgc gaa atc gaa gaa ctg 768
Glu Arg Met Lys Ile Glu Thr Leu Leu Lys Arg Glu Ile Glu Glu Leu
245 250 255
ttt cac gga cgc aac ctg agc gaa taa 795
Phe His Gly Arg Asn Leu Ser Glu *
260
<210> 12
<211> 264
<212> PRT
51
WASH 1814745.1
WASH_1815926.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
<213> Xanthomonas axonopodis pv. Citri
<220>
<400> 12
Met Val Lys Pro Leu Pro Arg Leu Arg Leu Gln Gly Phe Asn Asn Leu
1 5 10 15
Thr Lys Ala Leu Ser Phe Asn Ile Tyr Asp Val Cys Tyr Ala Arg Thr
20 25 30
Glu Glu Glu Arg Gln Arg Tyr Ile Glu Tyr Ile Asp Glu Gln Tyr Asp
35 40 45
Ala Asp Arg Leu Thr Gln Ile Leu Thr Asp Val Ala Glu Ile Ile Gly
50 55 60
Ala Asn Ile Leu Asn Ile Ala Arg Gln Asp Tyr Asp Pro Gln Gly Ala
65 70 75 80
Ser Val Thr Ile Leu Ile Ser Glu Glu Pro Val Ile Asp Lys Lys Gln
85 90 95
Ala Gly Lys Glu Leu Ile Ser Asp Ala Val Val Ala His Met Asp Lys
100 105 110
Ser His Ile Thr Val His Thr Tyr Pro Glu Thr His Pro Gln Glu Gly
115 120 125
Ile Ala Thr Phe Arg Ala Asp Ile Asp Val Ala Thr Cys Gly Val Ile
130 135 140
Ser Pro Leu Lys Ala Leu Asn Tyr Leu Ile Glu Ser Leu Glu Ser Asp
145 150 155 160
Ile Val Ile Met Asp Tyr Arg Val Arg Gly Phe Thr Arg Asp Val Lys
165 170 175
Gly Lys Lys His Tyr Ile Asp His Lys Ile Asn Ser Ile Gln Gln Phe
180 185 190
Leu Ala Lys Asn Val Lys Ser Arg Tyr Glu Met Phe Asp Val Asn Val
195 200 205
Tyr Gln Glu Asn Ile Phe His Thr Lys Met His Leu Lys Asp Phe Asp
210 215 220
Leu Asp Gln Tyr Leu Phe Glu Glu Arg Ala Lys Asn Leu Ser Phe Lys
225 230 235 240
Glu Arg Met Lys Ile Glu Thr Leu Leu Lys Arg Glu Ile Glu Glu Leu
245 250 255
Phe His Gly Arg Asn Leu Ser Glu
260
<210> 13
<211> 1820
<212> DNA
<213> Datura stramonium
<220>
<221> CDs
<222> (491) ... (1579)
<400> 13
cttgtatact cttccgaatc gccttctcca aatttctagg gtttctctct tcttcggaat 60
tttctggttt ggaaagatcg ttgtttattg gagataaatc ggatttggaa caaatttcaa 120
52
WASH1814745.1
WASH 1815926_.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
tttttaaata ttgtgaatga tctaatggag tcaaaaggtg ggaaaaagaa gtctagtagt 180
agttccttat tttacgaagc tcccctcggc tacagcattg aagacgttcg accaaacggt 240
ggagtgaaga agttcagatc tgctgcttac tccaactgcg cgcgcaaacc atcctgatat 300
tccctaaact tctgtcctta aagcgtcaat agacgcaacc aaaaaaaaca aaaaaaattt 360
ctgctttcaa tttctttcgt tgtcaagccc tcactccttt tcttccttct tttactactt 420
cctgctttgc actcgttgct ctgaacattt tctgctttaa cttcttttgc tgctgtgaac 480
ttttttcata atg gaa atg gac ttg cca gtc tct gcc atc ggt ttt gaa 529
Met Glu Met Asp Leu Pro Val Ser Ala Ile Gly Phe Glu
1 5 10
ggt ttt gaa aag agg ctc gaa att tct ttt gtc gag cct ggt ctg ttt 577
Gly Phe Glu Lys Arg Leu Glu Ile Ser Phe Val Glu Pro Gly Leu Phe
15 20 25
tct gat cct aat gga aaa gga ctt cga tct ctc tca aag gca cag ttg 625
Ser Asp Pro Asn Gly Lys Gly Leu Arg Ser Leu Ser Lys Ala Gln Leu
30 35 40 45
gat gaa att ctc gga cct gct gag tgc acc att gtc gat aac cta tca 673
Asp Glu Ile Leu Gly Pro Ala Glu Cys Thr Ile Val Asp Asn Leu Ser
50 55 60
aat gac tat gtt gat tcc tat gtc ctc tct gag tcg agc ctc ttc gtt 721
Asn Asp Tyr Val Asp Ser Tyr Val Leu Ser Glu Ser Ser Leu Phe Val
65 70 75
tat tct tac aag ata atc att aaa aga tgt ggc acc aca aag ttg ctt 769
Tyr Ser Tyr Lys Ile Ile Ile Lys Thr Cys Gly Thr Thr Lys Leu Leu
80 85 90
ctc gca att ccg ccc att cta agg ttg gct gag acc ttg tct ctc aaa 817
Leu Ala Ile Pro Pro Ile Leu Arg Leu Ala Glu Thr Leu Ser Leu Lys
95 100 105
gta caa gat gtg agg tat acc cgt ggg agc ttc att ttc cct ggt gct 865
Val Gln Asp Val Arg Tyr Thr Arg Gly Ser Phe Ile Phe Pro Gly Ala
110 115 120 125
caa tcg ttt cct cac cgt cac ttt tct gaa gaa gtt gct gtc ctc gat 913
Gln Ser Phe Pro His Arg His Phe Ser Glu Glu Val Ala Val Leu Asp
130 135 140
ggc tat ttt ggg aag ctt gct gcc ggt agc aag gct gtg att atg ggc 961
Gly Tyr Phe Gly Lys Leu Ala Ala Gly Ser Lys Ala Val Ile Met Gly
145 150 155
aac cct gac aaa aca cag aaa tgg cat gtt tac tct gcc tca gct ggg 1009
Asn Pro Asp Lys Thr Gin Lys Trp His Val Tyr Ser Ala Ser Ala Gly
160 165 170
cct gtt cag tct aat gac cct gtt tac act cta gag atg tgt atg act 1057
Pro Va1 Gln Ser Asn Asp Pro Val Tyr Thr Leu Glu Met Cys Met Thr
175 180 185
ggt ttg gac agg gag aag gca tct gtc ttt tac aag act gaa gga agc 1105
Gly Leu Asp Arg Glu Lys Ala Ser Val Phe Tyr Lys Thr Glu Gly Ser
190 195 200 205
tcg gct gct cac atg act gtt aga tct ggc ata agg aag atc ctc ccc 1153
Ser Ala Ala His Met Thr Val Arg Ser Gly Ile Arg Lys Ile Leu Pro
210 215 220
aac tct gag ata tgc gat ttt gag ttt gaa ccc tgt ggt tat tcc atg 1201
Asn Ser Glu Ile Cys Asp Phe Glu Phe Glu Pro Cys Gly Tyr Ser Met
225 230 235
53
WASH 18 14745.1
WASH_1815926_.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
aat tct att gaa gga gct gct gtt tca acc att cac att aca cca gaa 1249
Asn Ser Ile Glu Gly Ala Ala Val Ser Thr Ile His Ile Thr Pro Glu
240 245 250
gac qgc ttt agc tat gct agc ttt gaa tca gtt gga tat gat ctg aaa 1297
Asp Gly Phe Ser Tyr Ala Ser Phe Glu Ser Val Gly Tyr Asp Leu Lys
255 260 265
acc atg gag ttg ggt ccc ctg gtt gag agg gtg ctg gca tgt ttt gag 1345
Thr Met Glu Leu Gly Pro Leu Val Glu Arg Val Leu Ala Cys Phe Glu
270 275 280 285
cct gca gag ttc tct att gct ttg cat gct gat gtt gct acc aag tta 1393
Pro Ala Glu Phe Ser Ile Ala Leu His Ala Asp Val Ala Thr Lys Leu
290 295 300
ctg gag cgt gtt tgc tgt gtt gat gtt aag ggc tac tct ctt gct gag 1441
Leu Glu Arg Val Cys Cys Val Asp Val Lys Gly Tyr Ser Leu Ala Glu
305 310 315
tgg agt cca gaa qaa ttt ggc aag ggt ggt tcc att gtc tac cag aag 1489
Trp Ser Pro Glu Glu Phe Gly Lys Gly Gly Ser Ile Val Tyr Gln Lys
320 325 330
ttc act aag act cct tac tgt gca tct ccc aag tcc gtt ctg aag ggc 1537
Phe Thr Lys Thr Pro Tyr Cys Ala Ser Pro Lys Ser Val Leu Lys Gly
335 340 345
tgc tgg aaa gag gaa gag gaa gag aaa gaa gaa aag gag tag tgtttgtctt 1589
Cys Trp Lys Glu Glu Glu Glu Glu Lys Glu Glu Lys Glu *
350 355 360
gagggtcgtt ttgttattgt tgttttagtg tctgtcgttt gctcatgttt tacctgtttg 1649
tcagaataaa ggacttaaga ttgtcccatt tgtgtcagtt tggatttgta acgattgtgt 1709
gcaaattctg aactagtccg gcttcttggt gttccaccag aagccctatg tgtctgcatt 1769
ttgttccctg ttccgttgtg gcttctaata aaagtttgtt tgttgtgtgt a 1820
<210> 14
<211> 362
<212> PRT
<213> Datura stramonium
<220>
<400> 14
Met Glu Met Asp Leu Pro Val Ser Ala Ile Gly Phe Glu Gly Phe Glu
1 5 10 15
Lys Arg Leu Glu Ile Ser Phe Val Glu Pro Gly Leu Phe Ser Asp Pro
20 25 30
Asn Gly Lys Gly Leu Arg Ser Leu Ser Lys Ala Gln Leu Asp Glu Ile
35 40 45
Leu Gly Pro Ala Glu Cys Thr Ile Val Asp Asn Leu Ser Asn Asp Tyr
50 55 60
Val Asp Ser Tyr Val Leu Ser Glu Ser Ser Leu Phe Val Tyr Ser Tyr
65 70 75 80
Lys Ile Ile Ile Lys Thr Cys Gly Thr Thr Lys Leu Leu Leu Ala Ile
85 90 95
Pro Pro Ile Leu Arg Leu Ala Glu Thr Leu Ser Leu Lys Va1 Gln Asp
100 105 110
54
WASH1814745.1
WASH_18159267.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
Val Arg Tyr Thr Arg Gly Ser Phe Ile Phe Pro Gly Ala Gln Ser Phe
115 120 125
Pro His Arg His Phe Ser Glu Glu Val Ala Val Leu Asp Gly Tyr Phe
130 135 140
Gly Lys Leu Ala Ala Gly Ser Lys Ala Val Ile Met Gly Asn Pro Asp
145 150 155 160
Lys Thr Gln Lys Trp His Val Tyr Ser Ala Ser Ala Gly Pro Val Gln
165 170 175
Ser Asn Asp Pro Val Tyr Thr Leu Glu Met Cys Met Thr Gly Leu Asp
180 185 190
Arg Glu Lys Ala Ser Val Phe Tyr Lys Thr Glu Gly Ser Ser Ala Ala
195 200 205
His Met Thr Val Arg Ser Gly Ile Arg Lys Ile Leu Pro Asn Ser Glu
210 215 220
Ile Cys Asp Phe Glu Phe Glu Pro Cys Gly Tyr Ser Met Asn Ser Ile
225 230 235 240
Glu Gly Ala Ala Val Ser Thr Ile His Ile Thr Pro Glu Asp Gly Phe
245 250 255
Ser Tyr Ala Ser Phe Glu Ser Val Gly Tyr Asp Leu Lys Thr Met Glu
260 265 270
Leu Gly Pro Leu Val Glu Arg Val Leu Ala Cys Phe Glu Pro Ala Glu
275 280 285
Phe Ser Ile Ala Leu His Ala Asp Val Ala Thr Lys Leu Leu Glu Arg
290 295 300
Val Cys Cys Val Asp Val Lys Gly Tyr Ser Leu Ala Glu Trp Ser Pro
305 310 315 320
Glu Glu Phe Gly Lys Gly Gly Ser Ile Val Tyr Gln Lys Phe Thr Lys
325 330 335
Thr Pro Tyr Cys Ala Ser Pro Lys Ser Val Leu Lys Gly Cys Trp Lys
340 345 350
Glu Glu Glu Glu Glu Lys Glu Glu Lys Glu
355 360
<210> 15
<211> 1971
<212> DNA
<213> Oryza sativa
<220>
<221> CDs
<222> (357) ... (1724)
<400> 15
acgcgtccgt ttcgttttgg tattcccata cactttgttt ctcttccccg tctcgtggtc 60
gagagaaacc gagaggagag agagggagag gagcqctgcc gattttccgg agggggagat 120
ctttttcttc tccctgaagg ttcgagatcg atctgcgacg aggaggagcg gggaatcgta 180
actttatttc cgaggaaatt tcaacaaatt gatgcactaa tggagtccaa gggtggcaaa 240
aagaagtcta gcagtagtcg ttcctccctg atgtacgaag ctcccctcgg ctacagcatt 300
gaggacctcc gacctgccgg cggcatcaag aagttccgct ctgctgctta ctccaactgc 360
gcgaggaagc cctcttgata gcccccttgg ctaccttgac ctagtagttt agttactcct 420
WASH1814745.1
WASH 1815926_.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
ctgaattctc gttttgggct ttcttacatc tctctggcta gctgcttccc agtgaccggg 480
aaggtcatca gtcctgcttc ctttcttcct catctctggc atcgtccttc gaaaca 536
atg gca gtc ctg tca gtt gct gac tct cca ccg gtc tcg gcg atc ggg 584
Met Ala Val Leu Ser Val Ala Asp Ser Pro Pro Val Ser Ala Ile Gly
10 15
ttt gag gga tat gag aaa cgc ctc gag atc act ttc tcc gag gcg cct 632
Phe Glu Gly Tyr Glu Lys Arg Leu Glu Ile Thr Phe Ser Glu Ala Pro
20 25 30
gtc ttt gct gac ccc aat ggc agg ggg ttg cgt gca ctg tca cgt gct 680
Val Phe Ala Asp Pro Asn Gly Arg Gly Leu Arg Ala Leu Ser Arg Ala
35 40 45
cag att gac tct gtt ctt gat ctg gcg agg tgc acc att gtg tct gag 728
Gln Ile Asp Ser Val Leu Asp Leu Ala Arg Cys Thr Ile Val Ser Glu
50 55 60
ctc tcc aat gag gtc ttc gac tcg tat gtc ctt tct gaa tcg agc ctc 776
Leu Ser Asn Glu Val Phe Asp Ser Tyr Val Leu Ser Glu Ser Ser Leu
65 70 75 80
ttt gtg tac cca tac aag att gtg atc aag acc tgt ggg act acc aag 824
Phe Val Tyr Pro Tyr Lys Ile Val Ile Lys Thr Cys Gly Thr Thr Lys
85 90 95
ctc ctg ctc gcc att ccg agg att ctt gag ctt gct gaa gag cta tct 872
Leu Leu Leu Ala Ile Pro Arg Ile Leu Glu Leu Ala Glu Glu Leu Ser
100 105 110
ctg cca ctt gaa gct gtg aag tac tct cgt ggq aca ttc att ttt cct 920
Leu Pro Leu Glu Ala Val Lys Tyr Ser Arg Gly Thr Phe Ile Phe Pro
115 120 125
gaa gca cag ccc tct cca cac aag aac ttc tct gag gag gtt gca gtc 968
Glu Ala Gin Pro Ser Pro His Lys Asn Phe Ser Glu Glu Val Ala Val
130 135 140
ctg aac cgc tac ttc ggc ggt ctc aaa tct ggt ggc aac gca tac gtg
Leu Asn Arg Tyr Phe Gly Gly Leu Lys Ser Gly Gly Asn Ala Tyr Val 1016
145 150 155 160
att gga gat cct gca aag cca ggg cag aag tgg cat gtc tac tat gcc 1064
Ile Gly Asp Pro Ala Lys Pro Gly Gln Lys Trp His Val Tyr Tyr Ala
165 170 175
acc cag cac ccg gag caa cct gtg gtc act ctt gag atg tgc atg act 1112
Thr Gln His Pro Glu Gln Pro Val Val Thr Leu Glu Met Cys Met Thr
180 185 190
ggg ctg gac aag aag aaa gct tct gtc ttc ttc aag act tct gct gat 1160
Gly Leu Asp Lys Lys Lys Ala Ser Val Phe Phe Lys Thr Ser Ala Asp
195 200 205
gga cac aca aca tat gct aag gaa atg acc aag ctc tca ggt atc tct 1208
Gly His Thr Thr Tyr Ala Lys Glu Met Thr Lys Leu Ser Gly Ile Ser
210 215 220
gac atc atc cca gag atg gaa gtc tgc gac ttc gat ttc gag ccc tgc 1256
Asp Ile Ile Pro Glu Met Glu Val Cys Asp Phe Asp Phe Glu Pro Cys
225 230 235 240
ggc tac tcc atg aat gcc atc cac ggc cct gct ttc tca acc att cat 1304
Gly Tyr Ser Met Asn Ala Ile His Gly Pro Ala Phe Ser Thr Ile His
245 250 255
gtg act cct gag gat ggc ttc agc tat gcc agc tac gag gtc atg ggc 1352
Val Thr Pro Glu Asp Gly Phe Ser Tyr Ala Ser Tyr Glu Val Met Gly
260 265 270
56
WASH1814745.1
WASH 1815926.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994=0114
ttc aac cct gct tcc ctt gcc tat ggt gac ctt gtc aag agg gtg ttg 1400
Phe Asn Pro Ala Ser Leu Ala Tyr Gly Asp Leu Val Lys Arg Val Leu
275 280 285
aga tgc ttt ggc ccg ttg gag ttc tct gtt gcg gtt acc atc ttt ggt 1448
Arg Cys Phe Gly Pro Leu Glu Phe Ser Val Ala Val Thr Ile Phe Gly
290 295 300
ggc cgc aac cat gca ggg acc tgg gcc aag ggg ctg gat gtc ggg gcc 1496
Gly Arg Asn His Ala Gly Thr Trp Ala Lys Gly Leu Asp Val Gly Ala
305 310 315 320
tat tct tgc agc aac atg gtt gag cag gag ctg cct tct ggg ggt ttg 1544
Tyr Ser Cys Ser Asn Met Val Glu Gln Glu Leu Pro Ser Gly Gly Leu
325 330 335
ctc att tac cag agc ttc act gct act gct gaa atc gcc acc ggg tcg 1592
Leu Ile Tyr Gln Ser Phe Thr Ala Thr Ala Glu Ile Ala Thr Gly Ser
340 345 350
cca cga tct gtt ctg cat tgc ttt gct gat gaa aac acg gag aaa gct 1640
Pro Arg Ser Val Leu His Cys Phe Ala Asp Glu Asn Thr Glu Lys Ala
355 360 365
ggt aaa atg gag gct ctc tac tgg gaa gac gat gct gtc gag gag ata 1688
Gly Lys Met Glu Ala Leu Tyr Trp Glu Asp Asp Ala Val Glu Glu Ile
370 375 380
gat ggc aca gag ggt aag aag atg agg agc tgc tga tgagggaagc 1734
Asp Gly Thr Glu Gly Lys Lys Met Arg Ser Cys *
385 390 395
gcactgaaga ttaaagaata ctcaaaactc cagtagcgat cactctgtta ctttgtgaag 1794
cagccagcca gactattcat atagtactag tatatgctat gaccaatgtt ctttattatc 1854
ttgcatatat tctgaataaa agggctctag gtggtctgct ttgtctgcca cagtgagcaa 1914
aatgtatccg aatatcaaac tttaatgttg ggaatataat acaagtcatt ttataat 1971
<210> 16
<211> 395
<212> PRT
<213> Oryza sativa
<220>
<400> 16
Met Ala Val Leu Ser Val Ala Asp Ser Pro Pro Val Ser Ala Ile Gly
1 5 10 15
Phe Glu Gly Tyr Glu Lys Arg Leu Glu Ile Thr Phe Ser Glu Ala Pro
20 25 30
Val Phe Ala Asp Pro Asn Gly Arg Gly Leu Arg Ala Leu Ser Arg Ala
35 40 45
Gln Ile Asp Ser Val Leu Asp Leu Ala Arg Cys Thr Ile Val Ser Glu
50 55 60
Leu Ser Asn Glu Val Phe Asp Ser Tyr Val Leu Ser Glu Ser Ser Leu
65 70 75 80
Phe Val Tyr Pro Tyr Lys Ile Val Ile Lys Thr Cys Gly Thr Thr Lys
85 90 95
Leu Leu Leu Ala Ile Pro Arg Ile Leu Glu Leu Ala Glu Glu Leu Ser
100 105 110
57
WASH1814745. l
WASH 1815926_.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
Leu Pro Leu Glu Ala Val Lys Tyr Ser Arg Gly Thr Phe Ile Phe Pro
115 120 125
Glu Ala Gln Pro Ser Pro His Lys Asn Phe Ser Glu Glu Val Ala Val
130 135 140
Leu Asn Arg Tyr Phe Gly Gly Leu Lys Ser Gly Gly Asn Ala Tyr Val
145 150 155 160
Ile Gly Asp Pro Ala Lys Pro Gly Gln Lys Trp His Val Tyr Tyr Ala
165 170 175
Thr Gln His Pro Glu Gin Pro Val Val Thr Leu Glu Met Cys Met Thr
180 185 190
Gly Leu Asp Lys Lys Lys Ala Ser Val Phe Phe Lys Thr Ser Ala Asp
195 200 205
Gly His Thr Thr Tyr Ala Lys Glu Met Thr Lys Leu Ser Gly Ile Ser
210 215 220
Asp Ile Ile Pro Glu Met Giu Val Cys Asp Phe Asp Phe Glu Pro Cys
225 230 235 240
Gly Tyr Ser Met Asn Ala Ile His Gly Pro Ala Phe Ser Thr Ile His
245 250 255
Val Thr Pro Glu Asp Gly Phe Ser Tyr Ala Ser Tyr Glu Val Met Gly
260 265 270
Phe Asn Pro Ala Ser Leu Ala Tyr Gly Asp Leu Val Lys Arg Val Leu
275 280 285
Arg Cys Phe Gly Pro Leu Glu Phe Ser Val Ala Val Thr Ile Phe Gly
290 295 300
Gly Arg Asn His Ala Gly Thr Trp Ala Lys Giy Leu Asp Val Gly Ala
305 310 315 320
Tyr Ser Cys Ser Asn Met Val Glu Gin Glu Leu Pro Ser Gly Gly Leu
325 330 335
Leu Ile Tyr Gln Ser Phe Thr Ala Thr Ala Glu Ile Ala Thr Gly Ser
340 345 350
Pro Arg Ser Val Leu His Cys Phe Ala Asp Glu Asn Thr Glu Lys Ala
355 360 365
Gly Lys Met Glu Ala Leu Tyr Trp Glu Asp Asp Ala Val Glu Glu Ile
370 375 380
Asp Gly Thr Glu Gly Lys Lys Met Arg Ser Cys
385 390 395
<210> 17
<211> 2952
<212> DNA
<213> Oryza sativa
<220>
<221> CDs
<222> (1444) ... (2622)
<400> 17
gcctgggcga ttctagaaag atgtctcttt tgctaatggt tattattagc tgaatcgctg 60
atatggtgaa tccaggaaag tttcatgctt tttgtcctat gtcctgtctt tctttgtcat 120
attcgtacct ttcccagttt gcgatgccca agaagcaacc tttctgttgg aaacatctag 180
58
WASH_1814745.1
WASH 1815926.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
tgctcaattc attatttcaa attgttgaaa tcttcaagga qcagtttatt gtgcgccctt 240
gttgattgct cttgtttatt tacaagtggg gatttaggcg ctgggttcat atatgttctt 300
tgtttctgcc aggtttcctt gttaggctct agttttgctc gttgtttact gtaaattccc 360
atgtatatta agtttgtgca gtgcgctgtc agcttggcaa atgggctttt cttttcctga 420
tcgaaaaaaa aacaaacctg tgattaacaa ggggaaatta ccttcactgt gcctattggc 480
atcattccaa gttattcatg ctttagttcc tagccattaa cttaagatag aaataagatc 540
ctgccagttc actagttttc ttgtcagttt gatatatact ttgatcttgt cttttctggt 600
tgttttcctt aattttgtct gtgttgttct agtgcttaat tagttgcctc tcagttcttc 660
acattctatg tttttgagta aaactctgtc catatggccg ttctgttatg tatctcagca 720
atctgcttat attttttttt tgcatcccca cacaattcta tttgacgttg taaaaaagaa 780
gagagataac tagataagcg caactgatgc tctatactta gtttcacggt tcttggttta 840
atgcctaaaa attgtgcact atcagtactt caattatgtt atctagtagt gttttgtctc 900
ctctgaataa tgcctgccat tcttatgctg ctctactgct gagaaaacta cactatttga 960
attactgatt gctaattatg tttcgattaa cagcataaag gaacattttg ttgatgttct 1020
aatggagtca aaaggtggca aaaagaagtc tagcagtagt agttccatgt acgaagctcc 1080
cctaggctac aagattgagg acgttcgccc agccggagga atcaagaagt tccagtctgc 1140
tgcttactcc aacgtaagca ccaaaagatt taagcagcat actttaaata acaaaaatat 1200
ttacatttat gaactctggt ttctaatgct tatttggttt atcttttcct ttgcagtgcg 1260
ctcgcaagcc atcctgatat tccttcacat gcctttcccc gtagagtagg aatttcctgc 1320
aatttttcct ttgttttgtt gcaataaatc tcccttggct ggctgctttc tcaatctctt 1380
cccttgtctt ctccgatctc ttctttcctg tcttgtccac tgctccttgc aacacttgat 1440
caa atg tcg atg tcc ttg gct gat tct tgg ggc tct gcc cct gcc tcg 1488
Met Ser Met Ser Leu Ala Asp Ser Trp Gly Ser Ala Pro Ala Ser
1 5 10 15
ccc att ggg ttt gaa ggc tat gag aag cgc ctt gag ata aca ttg tct 1536
Pro Ile Gly Phe Glu Gly Tyr Glu Lys Arg Leu Glu Ile Thr Leu Ser
20 25 30
gat gcg ccc gtc ttt gtg gac ccc tgt ggt cgc ggc ctt cgt gcc ctc 1584
Asp Ala Pro Val Phe Val Asp Pro Cys Gly Arg Gly Leu Arg Ala Leu
35 40 45
tca cgt gag cag atc gac tcg ttc ttg gat ctt gca aag tgt acc att 1632
Ser Arg Glu Gln Ile Asp Ser Phe Leu Asp Leu Ala Lys Cys Thr Ile
50 55 60
gta tcc cat ctt tcg aac aag cac ttc gac tca tat gtg ctt tca gag 1680
Val Ser His Leu Ser Asn Lys His Phe Asp Ser Tyr Val Leu Ser Glu
65 70 75
tcg agc ctt ttt gtt tat ccc cac aag gtt gtt ctg aag acc tgt ggt 1728
Ser Ser Leu Phe Val Tyr Pro His Lys Val Val Leu Lys Thr Cys Gly
80 85 90 95
aca aca aag ctt ctg ctc tcc att cct cgc atc ctt gag ctt gct gca 1776
Thr Thr Lys Leu Leu Leu Ser Ile Pro Arg Ile Leu Glu Leu Ala Ala
100 105 110
gag ttg tca ctg cct gtt cta tca gtg aag tac tct cgt ggg atg ttc 1824
Glu Leu Ser Leu Pro Val Leu Ser Val Lys Tyr Ser Arg Gly Met Phe
59
WASH1814745.1
WASH_18159267.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
115 120 125
atc ttc cct gga gcg cag cca tca ccg cat cgc agc ttc ttg gag gag 1872
Ile Phe Pro Gly Ala Gln Pro Ser Pro His Arg Ser Phe Leu Glu Glu
130 135 140
gtt tct gtg ctc aac agc ttc ttt ggt ggc Ctc aag tca ggt ggc aat 1920
Val Ser Val Leu Asn Ser Phe Phe Gly Gly Leu Lys Ser Gly Gly Asn
145 150 155
gct tat gtc att ggt gat gca ttc aag ccc aag aag aag tgg cat gtc 1968
Ala Tyr Val Ile Gly Asp Ala Phe Lys Pro Lys Lys Lys Trp His Val
160 165 170 175
tac tat gcc aca gaa gag cct gag cag ccc atg gtt aca ctc gag atg 2016
Tyr Tyr Ala Thr Glu Glu Pro Glu Gln Pro Met Val Thr Leu Glu Met
180 185 190
tgc atg act ggg ctg gat gct aag aaa gct gag gtg ttc ttc aag gat 2064
Cys Met Thr Gly Leu Asp Ala Lys Lys Ala Glu Val Phe Phe Lys Asp
195 200 205
tcc act gat ggc tcc tgc tca tca gct aag gag atg act atg ttc tct 2112
Ser Thr Asp Gly Ser Cys Ser Ser Ala Lys Glu Met Thr Met Phe Ser
210 215 220
ggg att tct gaa atc atc cct gag atg gag att tgt gac ttt gag ttt 2160
Gly Ile Ser Glu Ile Ile Pro Glu Met Glu Ile Cys Asp Phe Glu Phe
225 230 235
gac ccg tgt ggg tac tca atg aat ggc att tat ggt ccc gcc gtc tcc 2208
Asp Pro Cys Gly Tyr Ser Met Asn Gly Ile Tyr Gly Pro Ala Val Ser
240 245 250 255
acg atc cat gtc act cct gag gaa ggt ttc agc tat gca agc tat gaa 2256
Thr Ile His Val Thr Pro Glu Glu Gly Phe Ser Tyr Ala Ser Tyr Glu
260 265 270
gca atg aac ttc aat cct agc tcc ttg gtc tac gat gat ttg atc aag 2304
Ala Met Asn Phe Asn Pro Ser Ser Leu Val Tyr Asp Asp Leu Ile Lys
275 280 285
aag gtc ctg gct tgt ttc tgc cct tca gac ttt tcg gtc gct gtt acc 2352
Lys Val Leu Ala Cys Phe Cys Pro Ser Asp Phe Ser Val Ala Val Thr
290 295 300
atc ttc ggt ggg cat ggt ttt gcc aaa tca tgg gca aaa ggt gca gag 2400
Ile Phe Gly Gly His Gly Phe Ala Lys Ser Trp Ala Lys Gly Ala Glu
305 310 315
gtt gat tcc tac atg tgc gat gat ctt gtt gag caa gag ctt cct ggt 2448
Val Asp Ser Tyr Met Cys Asp Asp Leu Val Glu Gln Glu Leu Pro Gly
320 325 330 335
ggc ggt gtg ctg atg tat cag agt ttt act gct gtt act cct ggt gct 2496
Giy Gly Val Leu Met Tyr Gln Ser Phe Thr Ala Val Thr Pro Gly Ala
340 345 350
gtg tca ccg agg tcg acc ttg gat ggc tgg aac agc gat gga gca gag 2544
Val Ser Pro Arg Ser Thr Leu Asp Gly Trp Asn Ser Asp Gly Ala Glu
355 360 365
atg gtt gcg aag agc aaa gag atg agt gtc tgc tgg gaa gga gag aag 2592
Met Val Ala Lys Ser Lys Glu Met Ser Val Cys Trp Glu Gly Glu Lys
370 375 380
gcg gcg aag aag aaa gat gca gat gcc tga gaaatcggca gttcttcaac 2642
Ala Ala Lys Lys Lys Asp Ala Asp Ala *
385 390
ctcaagttgc aagtttgatt catctgaagt ttctgagacg ccttatttgg ttctgctctt 2702
WASH 1814745.1
WASH 1815926_1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
gcagtttcgg ttaagcagct ggctgggcta ccggcaaagc atatgttact tgttcattgt 2762
tcttttatat ctgtctgccc aaataagtgc tctagatggt ttgctgcgtc tgccatagtg 2822
agcaattcag attgtagtag aattcttatc tgttgccgat gctctttaag ggagaatgat 2882
atgtaactcg attattttca ataactattg caacttccat aattttctgt ccattggtta 2942
tgtttgtttg 2952
<210> 18
<211> 392
<212> PRT
<213> Oryza sativa
<220>
<400> 18
Met Ser Met Ser Leu Ala Asp Ser Trp Gly Ser Ala Pro Ala Ser Pro
1 5 10 15
Ile Gly Phe Glu Gly Tyr Glu Lys Arg Leu Glu Ile Thr Leu Ser Asp
20 25 30
Ala Pro Val Phe Val Asp Pro Cys Gly Arg Gly Leu Arg Ala Leu Ser
35 40 45
Arg Glu Gln Ile Asp Ser Phe Leu Asp Leu Ala Lys Cys Thr Ile Val
50 55 60
Ser His Leu Ser Asn Lys His Phe Asp Ser Tyr Val Leu Ser Glu Ser
65 70 75 80
Ser Leu Phe Val Tyr Pro His Lys Val Val Leu Lys Thr Cys Gly Thr
85 90 95
Thr Lys Leu Leu Leu Ser Ile Pro Arg Ile Leu Glu Leu Ala Ala Glu
100 105 110
Leu Ser Leu Pro Val Leu Ser Val Lys Tyr Ser Arg Gly Met Phe Ile
115 120 125
Phe Pro Gly Ala Gln Pro Ser Pro His Arg Ser Phe Leu Glu Glu Val
130 135 140
Ser Val Leu Asn Ser Phe Phe Gly Gly Leu Lys Ser Gly Gly Asn Ala
145 150 155 160
Tyr Val Ile Gly Asp Ala Phe Lys Pro Lys Lys Lys Trp His Val Tyr
165 170 175
Tyr Ala Thr Glu Glu Pro Glu Gln Pro Met Val Thr Leu Glu Met Cys
180 185 190
Met Thr Gly Leu Asp Ala Lys Lys Ala Glu Val Phe Phe Lys Asp Ser
195 200 205
Thr Asp Gly Ser Cys Ser Ser Ala Lys Glu Met Thr Met Phe Ser Gly
210 215 220
ile Ser Glu Ile Ile Pro Glu Met Glu Ile Cys Asp Phe Glu Phe Asp
225 230 235 240
Pro Cys Gly Tyr Ser Met Asn Gly Ile Tyr Gly Pro Ala Val Ser Thr
245 250 255
Ile His Val Thr Pro Glu Glu Gly Phe Ser Tyr Ala Ser Tyr Glu Ala
260 265 270
Met Asn Phe Asn Pro Ser Ser Leu Val Tyr Asp Asp Leu Ile Lys Lys
275 280 285
61
WASH 1814745.1
WASH 1815926.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
Val Leu Ala Cys Phe Cys Pro Ser Asp Phe Ser Val Ala Val Thr Ile
290 295 300
Phe Gly Gly His Gly Phe Ala Lys Ser Trp Ala Lys Gly Ala Glu Val
305 310 315 320
Asp Ser Tyr Met Cys Asp Asp Leu Val Glu Gln Glu Leu Pro Gly Gly
325 330 335
Gly Val Leu Met Tyr Gln Ser Phe Thr Ala Val T'hr Pro Gly Ala Val
340 345 350
Ser Pro Arg Ser Thr Leu Asp Gly Trp Asn Ser Asp Gly Ala Glu Met
355 360 365
Val Ala Lys Ser Lys Glu Met Ser Val Cys Trp Glu Gly Glu Lys Ala
370 375 380
Ala Lys Lys Lys Asp Ala Asp Ala
385 390
<210> 19
<211> 2523
<212> DNA
<213> Populus deltoides
<220>
<222> (1)...(2523)
<400> 19
ttaaccctat atttctctca gaactcacat aaaaaatatt gcgagtttag ggtcataaaa 60
atctctatca tcacaaacaa atatagggtt tgttgatttg gtggctgttt tcgccgtctt 120
tgctttcaaa attcaatctt gacctgtttc ttttatgctt tttgaatagg taatatatac 180
attgtttgtt ttgcttgctt tggttttgta atctqgtgat cttgtttaat tctttttggc 240
tttggtttgt aggttttttt ttttgaacyt gagaaagagg ggggttttca arggagacta 300
gcttttcaag awttgatata ttttattggt aagtttttnt tttccgtttt ttggtaatag 360
ttgcatggat tcttggtgta gatgttgatt tggacttgtt tttgtattgt tgtcctttat 420
gttttatgtg tatgttaatt gttctgatcc ttgatataat gtaaatctga ggcttttatt 480
tttatggatt cgttaaggtg tatggacttg gtttatggtt tt:ggtcttga aaaaaaaatt 540
aggcttagca agttttcttc tgagaataac ttattttatt ttattattta aaattaaatg 600
gtgtttggga atttgaattc tttctctttg gtattttttc tatccttgtg aatctgttta 660
gtcttttaaa ttcaatattt tattttattt tacttatgat ttggtgattg attagttatt 720
tttgtagctt gtattgtctg ttgattttta atctccaata tgtcttactt ctcaqttttt 780
ttcaatttgc tattggaatt ttgctattat ttttaagatt gtagactagt ttgctttgag 840
ttttgtgcta attgcaatcc ttcttgtgtg attcttacag gactgaatga tctaatggag 900
tctaaaggtg gcaagaagaa gtctagtagt agtagtagta gtaaatcctt atgttaagaa 960
gctcccctcg gttacagcat tgaagacctc agacctgctg gtggaatcaa gaagttcaga 1020
tctgctgcat actccaacgt gagtttgaag ttaatcgatc tgtttttcct ttggcatttc 1080
attgtgcgac tggtttccta atcttgtgtc atgtttattt gtgcagtgcg ttcgaaaacc 1140
atcctgagat tttccaagtg ttgacataac cccattttag ctatttcgca cgctcagttg 1200
62
WASH1814745.1
WASH_1815926_.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
tctttaktct gtttttctgt tctgctttcc tcgttctctt gtactctttg ctgcactttt 1260
catttgttga ctgtgaggtc agatggcgct gccagtctct qcaatcggat ttgaaggtta 1320
cgaaaaaagg cttgaaatat ctttcctaga gcctggcttc ttttctgacc ctgaagggaa 1380
gggcctgagg tctttgtcca aggctcaatt ggacgagatt ctcagaccag ctgaatgtac 1440
tattgttgat tcgctatcaa atgaccaggt tgattcttat gtcctgtcgg aatccagtct 1500
ctttgtgtac ccttacaaag ttattatcaa aacatgtggg eictaccaaac tgcttctctc 1560
gataccggtg attcttaagc tcgctgatgc cctttcactc actgtatgtt ctgtgaggta 1620
tactcgtggg agctttctat gccctggggc tcagccattt ccacaccgca acttctgtga 1680
ggaggtagct gtccttgacg atcacttcag taaacttggt t.taaacagtg tggcatatgt 1740
gatgggtggt cttgacaaaa ctcagaaatg gcatgtttac tctgcctctg ccgatataga 1800
gagccattct ggccctgttt acactctgga aatgtgcatg actggtttgg gcaggaaaca 1860
agcatctgtt ttctacaaaa cacattccag ttcagctgct gcgatgactg aggattccgg 1920
tataaggaaa atccttccac agtctgagat ctgtgatttt gattttgacc catgtggtta 1980
ctctatgaat gccattgaag ggagtgcaat ttccacaatc cacgtcactc cagaagatgg 2040
tttcagctat gcaagttttg aggctgtggg ctatgatctt caagatttga atttgagtcg 2100
gctgcttgaa agggtcttgg cttgctttga accgaccatg ttctccgttg ccttgcattc 2160
taatatcaag ggtgccgaac ttagagcaaa gtttcccctg gacgtggaag qttactctgg 2220
cggaggaggg aactatgaaa tgcttgggaa aggtggatcg atcatctacc acagctttgc 2280
aaggactgga ggcagtgcat ctcccaggtc tatcctgaaa tgttgttgga gtgaggatga 2340
gaaggacgag gaagctgaag agaagtagtt cttttcagct atttgttttt tccttttatt 2400
ttttccttga ataaatgtca tggggttatg attctgagtt cttgaggcat ttgtccatgc 2460
ctcgtgtctt tcattatcga tttagttttg acttcggatt aataaagggg tttgtgttat 2520
cag 2523
<210> 20
<211> 24
<212> DNA
<213> Artificial sequence
<220>
<223> Synthetic oligonucleotide
<400> 20
atcccatgga ttcggccttg cctg 24
<210> 21
<211> 34
<212> DNA
<213> Artificial sequence
<220>
<223> Synthetic oligonucleotide
<400> 21
gtctagacta ctccttctct tctttctctt catc 34
63
WASH 1814745.1
WAS H 1815926.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
<210> 22
<211> 25
<212> DNA
<213> Artificial sequence
<220>
<223> Synthetic oligonucleotide
<400> 22
tatcgtttta cttcactggt cggtg 25
<210> 23
<211> 20
<212> DNA
<213> Artificial sequence
<220>
<223> Synthetic oligonucleotide
<400> 23
aatctcacca acccaactcc 20
<210> 24
<211> 1658
<212> DNA
<213> Nicotiana tabacum
<220>
<222> (364) ... (1449)
<223> CDS
<400> 24
atggagtcga aaggtggtaa aaactctagt agtaaatcct taccctacga agcacccctc 60
ggctacagta ttgaagacgt tcggccaaac ggtggaatca agaagttcag atcagctqct 120
tactccaact gcgctcgcaa accatcctga cattccttaa gcttctctcc tgcacgtgtc 1B0
tcctgacaca aaaaagaaaa aatccccaaa aaaagttcct tctgtcaatt gtttttgttg 240
ttaaaccctc actccttttc ctcaatttct tccttctgct gctttctgct cttgctctcc 300
ttggctgtga acaattttct ttaaaagatc atttgttgct gtgaacatat ttttttttat 360
cta atg gat tcg gcc ttg cct gtc tct gcc att ggt ttt gaa ggt ttc 408
Met Asp Ser Ala Leu Pro Val Ser Ala Ile Gly Phe Glu Gly Phe
1 5 10 15
gag aag agg ctt gaa att tct ttt ttc gag cct ggt ctg ttt gct gat 456
Glu Lys Arg Leu Glu Ile Ser Phe Phe Glu Pro Gly Leu Phe Ala Asp
20 25 30
ccc aac gga aaa gga ctt cga tct ctc tca aag gca caa ttg gat gag 504
Pro Asn Gly Lys Gly Leu Arg Ser Leu Ser Lys Ala Gln Leu Asp Glu
35 40 45
att ctc gga cct gct gag tgc acc ata gtt gat tcc cta tca aat gac 552
Ile Leu Gly Pro Ala Glu Cys Thr Ile Val Asp Ser Leu Ser Asn Asp
50 55 60
gat gtt gat tct tat gtc ctc tcc gag tcg agc ctc ttt gtt tat tct 600
Asp Val Asp Ser Tyr Val Leu Ser Glu Ser Ser Leu Phe Val Tyr Ser
65 70 75
tac aag ata atc atc aaa acc tgt ggc acc aca aag ttg ctt ctc gca 648
Tyr Lys Ile Ile Ile Lys Thr Cys Gly Thr Thr Lys Leu Leu Leu Ala
80 85 90 95
64
WASH 18 14745.1
WASH 1815926_.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
att ccg ccc atc cta aag ttg gct gag acc ctg tct ctc aaa gta caa 696
Ile Pro Pro Ile Leu Lys Leu Ala Glu Thr Leu Ser Leu Lys Val Gin
100 105 110
gac gtg agg tat acc cgt ggg agc ttc att ttc cct ggc gct cag tcg 744
Asp Val Arg Tyr Thr Arg Gly Ser Phe Ile Phe Pro Gly Ala Gin Ser
115 120 125
ttt cct cat cgt cac ttc tct gaa gaa gtt gct gtc ctc gat ggc tat 792
Phe Pro His Arg His Phe Ser Glu Glu Val Ala Val Leu Asp Gly Tyr
130 135 140
ttt gga aag ctt gct gcc ggt agc aag gct gtg att atg ggc agt cct 840
Phe Gly Lys Leu Ala Ala Gly Ser Lys Ala Val Ile Met Gly Ser Pro
145 150 155
gac aaa gca cag aaa tgg cat gtt tac tct gcc tct gca gga cct att 888
Asp Lys Ala Gln Lys Trp His Val Tyr Ser Ala Ser Ala Gly Pro Ile
160 165 170 175
cag tct aat gac cct gtt tac act ctt gag atg tgt atg act ggt ttg 936
Gln Ser Asn Asp Pro Val Tyr Thr Leu Glu Met Cys Met Thr Gly Leu
180 185 190
gac agg gag aag gca tct gtc ttt tac aag act gaa gga agc tcg gct 984
Asp Arg Glu Lys Ala Ser Val Phe Tyr Lys Thr Glu Gly Ser Ser Ala
195 200 205
gct cat atg act gtt cga tct gga ata agg aag atc ctc ccc aat tct 1032
Ala His Met Thr Val Arg Ser Gly Ile Arg Lys Ile Leu Pro Asn Ser
210 215 220
gag ata tgc gat ttt gag ttt gaa ccc tgt ggt tat tcc atg aat tca 1080
Glu Ile Cys Asp Phe Glu Phe Glu Pro Cys Gly Tyr Ser Met Asn Ser
225 230 235
att gaa gga gct gca ctc tca acc att cac att acc ccg gaa gat ggc 1128
Ile Glu Gly Ala Ala Leu Ser Thr Ile His Ile Thr Pro Glu Asp Gly
240 245 250 255
ttt agc tat gct agc ttt gaa gca gtt ggg tat gac atg aaa acc atg 1176
Phe Ser Tyr Ala Ser Phe Glu Ala Val Gly Tyr Asp Met Lys Thr Met
260 265 270
aag ctg ggt ccc ctg gtt gag agg gtg ctg gca tgt ttc cag cca gat 1224
Lys Leu Gly Pro Leu Val Glu Arg Val Leu Ala Cys Phe Gln Pro Asp
275 280 285
gag ttc tct att gct ttg cat gct gat gtt gct acc aag tta ctg gag 1272
Glu Phe Ser Ile Ala Leu His Ala Asp Val Ala Thr Lys Leu Leu Glu
290 295 300
cgt gtt tgc tct ctt gat gtg aaa ggc tac tct ctt gct gag tgg agt 1320
Arg Val Cys Ser Leu Asp Val Lys Gly Tyr Ser Leu Ala Glu Trp Ser
305 310 315
cca gaa gaa ttt ggc aag ggt ggt tcc att gtc tac cag aag ttc acc 1368
Pro Glu Glu Phe Gly Lys Gly Gly Ser Ile Val Tyr Gln Lys Phe Thr
320 325 330 335
aga act cct ttc tgt gga tct ccc aag tcc gtt ctg aag ggc tgc tgg 1416
Arg Thr Pro Phe Cys Gly Ser Pro Lys Ser Val Leu Lys Gly Cys Trp
340 345 350
aaa gaa gat gaa gag aaa gaa gag aag gag tag tgtcttgagg 1459
Lys Glu Asp Glu Glu Lys Glu Glu Lys Glu *
355 360
gctgtgttgt tttttgtttc agtgtccgtg tctgtctctg tctgtgtcgg tgtcgtttgt 1519
tttttcagtg tttctccgaa taaagtactt gatgtccaag ctgtgtcgtt tggatttgta 1579
WASH_1814745.1
WASH_1815926.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
atgccgatgt gcaaattctg aactattctt ggctttttgt gttccacccg aagccctatg 1639
aacctgcatt ttgaataaa 1658
<210> 25
<211> 361
<212> PRT
<213> Nicotiana tabacum
<220>
<400> 25
Met Asp Ser Ala Leu Pro Val Ser Ala Ile Gly Phe Glu Gly Phe Glu
1 5 10 15
Lys Arg Leu Glu Ile Ser Phe Phe Glu Pro Gly Leu Phe Ala Asp Pro
20 25 30
Asn Gly Lys Gly Leu Arg Ser Leu Ser Lys Ala Gln Leu Asp Glu Ile
35 40 45
Leu Gly Pro Ala Glu Cys Thr Ile Val Asp Ser Leu Ser Asn Asp Asp
50 55 60
Val Asp Ser Tyr Val Leu Ser Glu Ser Ser Leu Phe Val Tyr Ser Tyr
65 70 75 80
Lys Ile Ile Ile Lys Thr Cys Gly Thr Thr Lys Leu Leu Leu Ala Ile
85 90 95
Pro Pro Ile Leu Lys Leu Ala Glu Thr Leu Ser Leu Lys Val Gln Asp
100 105 110
Val Arg Tyr Thr Arg Gly Ser Phe Ile Phe Pro Gly Ala Gln Ser Phe
115 120 125
Pro His Arg His Phe Ser Glu Glu Val Ala Val Leu Asp Gly Tyr Phe
130 135 140
Gly Lys Leu Ala Ala Gly Ser Lys Ala Val Ile Met Gly Ser Pro Asp
145 150 155 160
Lys Ala Gln Lys Trp His Val Tyr Ser Ala Ser Ala Gly Pro Ile Gln
165 170 175
Ser Asn Asp Pro Val Tyr Thr Leu Glu Met Cys Met Thr Gly Leu Asp
180 185 190
Arg Glu Lys Ala Ser Val Phe Tyr Lys Thr Glu Gly Ser Ser Ala Ala
195 200 205
His Met Thr Val Arg Ser Gly Ile Arg Lys Ile Leu Pro Asn Ser Giu
210 215 220
Ile Cys Asp Phe Glu Phe Glu Pro Cys Gly Tyr Ser Met Asn Ser Ile
225 230 235 240
Glu Gly Ala Ala Leu Ser Thr Ile His Ile Thr Pro Glu Asp Gly Phe
245 250 255
Ser Tyr Ala Ser Phe Glu Ala Val Gly Tyr Asp Met Lys Thr Met Lys
260 265 270
Leu Gly Pro Leu Val Glu Arg Val Leu Ala Cys Phe Gln Pro Asp Glu
275 280 285
Phe Ser Ile Ala Leu His Ala Asp Val Ala Thr Lys Leu Leu Glu Arg
290 295 300
Val Cys Ser Leu Asp Val Lys Gly Tyr Ser Leu Ala Glu Trp Ser Pro
66
WASH1814745.1
WASH_1815926.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
305 310 315 320
Glu Glu Phe Gly Lys Gly Gly Ser Ile Val Tyr Gln Lys Phe Thr Arg
325 330 335
Thr Pro Phe Cys Gly Ser Pro Lys Ser Val Leu Lys Gly Cys Trp Lys
340 345 350
Glu Asp Glu Glu Lys Glu Glu Lys Glu
355 360
<210> 26
<211> 1086
<212> DNA
<213> Populus deltoides
<220>
<222> (1)...(1086)
<223> CDS
<400> 26
atg gcg ctg cca gtc tct gca atc gga ttt gaa ggt tac gaa aaa agg 48
Met Ala Leu Pro Val Ser Ala Ile Gly Phe Glu Gly Tyr Glu Lys Arg
10 15
ctt gaa ata tct ttc cta gag cct ggc ttc ttt tct gac cct gaa ggg 96
Leu Glu Ile Ser Phe Leu Glu Pro Gly Phe Phe Ser Asp Pro Glu Gly
20 25 30
aag ggc ctg agg tct ttg tcc aag gct caa ttg gac gag att ctc aga 144
Lys Gly Leu Arg Ser Leu Ser Lys Ala Gln Leu Asp Glu Ile Leu Arg
35 40 45
cca gct gaa tgt act att gtt gat tcg cta tca aat gac cag gtt gat 192
Pro Ala Glu Cys Thr Ile Val Asp Ser Leu Ser Asn Asp Gln Val Asp
50 55 60
tct tat gtc ctg tcg gaa tcc agt ctc ttt gtg tac cct tac aaa gtt 240
Ser Tyr Val Leu Ser Glu Ser Ser Leu Phe Val Tyr Pro Tyr Lys Val
65 70 75 80
att atc aaa aca tgt ggg act acc aaa ctg ctt ctt tcg ata ccg gtg 288
Ile Ile Lys Thr Cys Gly Thr Thr Lys Leu Leu Leu Ser Ile Pro Val
85 90 95
att ctt aag ctc gct gat gcc ctt tca ctc act gta tgt tct gtg agg 336
Ile Leu Lys Leu Ala Asp Ala Leu Ser Leu Thr Val Cys Ser Val Arg
100 105 110
tat act cgt ggg agc ttt cta tgc cct ggg gct cag cca ttt cca cac 384
Tyr Thr Arg Gly Ser Phe Leu Cys Pro Gly Ala Gln Pro Phe Pro His
115 120 125
cga aac ttc tgt gag gag gta gct gtc ctt gac gat cac ttc agt aaa 432
Arg Asn Phe Cys Glu Glu Val Ala Val Leu Asp Asp His Phe Ser Lys
130 135 140
ctt ggt tta aac agt gtg gca tat gtg atg ggt ggt ctt gac aaa act 480
Leu Gly Leu Asn Ser Val Ala Tyr Val Met Gly Gly Leu Asp Lys Thr
145 150 155 160
cag aaa tgg cat gtt tac tct gcc tct gcc gat ata ggg agc cat tct 528
Gln Lys Trp His Val Tyr Ser Ala Ser Ala Asp Ile Gly Ser His Ser
165 170 175
ggc cct gtt tac acc ctg gaa atg tgc atg act ggt ttg ggc agg aaa 576
Gly Pro Val Tyr Thr Leu Glu Met Cys Met Thr Gly Leu Gly Arg Lys
180 185 190
caa gca tct gtt ttc tac aaa aca cat tcc agt tca gct gct gcg atg 624
Gln Ala Ser Val Phe Tyr Lys Thr His Ser Ser Ser Ala Ala Ala Met
195 200 205
67
WASH1814745.1
WASH_18159267.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
act gag gat tcc ggt ata agg aaa atc ctt cca cag tct gag atc tgt 672
Thr Glu Asp Ser Gly Ile Arg Lys Ile Leu Pro Gln Ser Glu Ile Cys
210 215 220
gat ttt gat ttt gac cct tgt ggt tac tcc atg aat gcc att gaa ggg 720
Asp Phe Asp Phe Asp Pro Cys Gly Tyr Ser Met Asn Ala Ile Glu Gly
225 230 235 240
agt gca att tcc aca atc cac gtc act cca gaa gat ggt ttc agc tat 768
Ser Ala Ile Ser Thr Ile His Val Thr Pro Giu Asp Gly Phe Ser Tyr
245 250 255
gca agt ttt gag gct gtg ggc tat gat ctt caa gat ttg aat ttg agt 816
Ala Ser Phe Glu Ala Val Gly Tyr Asp Leu Gln Asp Leu Asn Leu Ser
260 265 270
cgg ctg ctt gaa agg gtc ttg gct tgc ttt gat ccg acc aag ttc tcc 864
Arg Leu Leu Glu Arg Vai Leu Ala Cys Phe Asp Pro Thr Lys Phe Ser
275 280 285
gtt gcc ttg cat tct aat atc aag ggt gcc gaa ctt aga gca aag ttt 912
Val Ala Leu His Ser Asn Ile Lys Gly Ala Glu Leu Arg Ala Lys Phe
290 295 300
ccc ctg gac gtg gaa ggt tac tct ggc gga gga ggg aac tat gaa atg 960
Pro Leu Asp Val Glu Gly Tyr Ser Gly Gly Gly Gly Asn Tyr Glu Met
305 310 315 320
ctt ggg aaa ggt gga tcg atc atc tac cac agc ttt gca agg act gga 1008
Leu Gly Lys Gly Gly Ser Ile Ile Tyr His Ser Phe Ala Arg Thr Gly
325 330 335
ggc agt gca tct ccc agg tct atc ctg aaa tgt tgt tgg agt gag gat 1056
Gly Ser Ala Ser Pro Arg Ser Ile Leu Lys Cys Cys Trp Ser Glu Asp
340 345 350
gag aag gac gag gaa gct gaa gag aag tag 1086
Glu Lys Asp Glu Glu Ala Glu Glu Lys ~
355 360
<210> 27
<211> 361
<212> PRT
<213> Populus deltoides
<220>
<400> 27
Met Ala Leu Pro Val Ser Ala Ile Gly Phe Glu Gly Tyr Glu Lys Arg
10 15
Leu Glu Ile Ser Phe Leu Glu Pro Gly Phe Phe Ser Asp Pro Glu Gly
20 25 30
Lys Gly Leu Arg Ser Leu Ser Lys Ala Gln Leu Asp Glu Ile Leu Arg
35 40 45
Pro Ala Glu Cys Thr Ile Val Asp Ser Leu Ser Asn Asp Gln Val Asp
50 55 60
Ser Tyr Val Leu Ser Glu Ser Ser Leu Phe Val Tyr Pro Tyr Lys Val
65 70 75 80
Ile Ile Lys Thr Cys Gly Thr Thr Lys Leu Leu Leu Ser Ile Pro Val
85 90 95
Ile Leu Lys Leu Ala Asp Ala Leu Ser Leu Thr Val Cys Ser Val Arg
100 105 110
Tyr Thr Arg Gly Ser Phe Leu Cys Pro Gly Ala Gln Pro Phe Pro His
68
WASH1814745.1
WASH 1815926_.1
CA 02578311 2007-02-22
Atty. Dkt. No.: 059994-0114
115 120 125
Arg Asn Phe Cys Glu Glu Val Ala Val Leu Asp Asp His Phe Ser Lys
130 135 140
Leu Gly Leu Asn Ser Val Ala Tyr Val Met Gly Gly Leu Asp Lys Thr
145 150 155 160
Gln Lys Trp His Val Tyr Ser Ala Ser Ala Asp Ile Gly Ser His Ser
165 170 175
Gly Pro Val Tyr Thr Leu Glu Met Cys Met Thr Gly Leu Gly Arg Lys
180 185 190
Gln Ala Sex Val Phe Tyr Lys Thr His Ser Ser Ser Ala Ala Ala Met
195 200 205
Thr Glu Asp Ser Gly Ile Arg Lys Ile Leu Pro Gln Ser Glu Ile Cys
210 215 220
Asp Phe Asp Phe Asp Pro Cys Gly Tyr Ser Met Asn Ala Ile Glu Gly
225 230 235 240
Ser Ala Ile Ser Thr Ile His Val Thr Pro Glu Asp Gly Phe Ser Tyr
245 250 255
Ala Ser Phe Glu Ala Val Gly Tyr Asp Leu Gln Asp Leu Asn Leu Ser
260 265 270
Arg Leu Leu Glu Arg Val Leu Ala Cys Phe Asp Pro Thr Lys Phe Ser
275 280 285
Val Ala Leu His Ser Asn Ile Lys Gly Ala Glu Leu Arg Ala Lys Phe
290 295 300
Pro Leu Asp Val Glu Gly Tyr Ser Gly Gly Gly Gly Asn Tyr Glu Met
305 310 315 320
Leu Gly Lys Gly Gly Ser Ile Ile Tyr His Ser Phe Ala Arg Thr Gly
325 330 335
Gly Ser Ala Ser Pro Arg Ser Ile Leu Lys Cys Cys Trp Ser Glu Asp
340 345 350
Glu Lys Asp Glu Glu Ala Glu Glu Lys
355 360
<210> 28
<211> 26
<212> DNA
<213> Artificial sequence
<220>
<223> Synthetic oligonucleotide
<400> 28
ccatggcgct gccagtctct gcaatc 26
<210> 29
<211> 27
<212> DNA
<213> Artificial sequence
<220>
<223> Synthetic oligonucleotide
<400> 29
tctagactac ttctcttcag cttcctc 27
69
WASH 1814745.1
WASH_18159267.1
