Note: Descriptions are shown in the official language in which they were submitted.
DEMANDES OU BREVETS VOLUMINEUX
LA PRESENTE PARTIE I)E CETTE DEMANDE OU CE BREVETS
COMPREND PLUS D'UN TOME.
CECI EST LE TOME DE _2
NOTE: Pour les tomes additionels, veillez contacter le Bureau Canadien des
Brevets.
JUMBO APPLICATIONS / PATENTS
THIS SECTION OF THE APPLICATION / PATENT CONTAINS MORE
THAN ONE VOLUME.
THIS IS VOLUME 1 OF 2
NOTE: For additional volumes please contact the Canadian Patent Office.
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
STABLE LIQUID FORMULATIONS OF PLASMID DNA
FIELD OF THE INVENTION
The present invention relates to plasmid DNA liquid formulations that are
stable and where the
plasmid stays un-degraded at +4 C to room temperature for long periods of
time. Such formulations are
thus useful for the storage of plasmid DNA used in research or in plasmid-
based therapy, such as DNA
vaccines and gene therapy.
BACKGROUND OF THE INVENTION
Developments in molecular biology clearly suggest that plasmid-based therapy,
in particular the
fields of DNA vaccines and gene therapy, may support effective ways to treat
diseases. One promising
method of safely and effectively delivering a normal gene into human cells is
via plasmid DNA.
Plasmid DNA is a covalently closed circular (ccc) or supercoiled form of
bacterial DNA into which a
DNA sequence of interest can be inserted. Examples of DNA sequences of
interest that may be
introduced in mammalian cells include exogenous genes, functional genes, or
mutant genes, antisense
sequences, RNAi or dsRNAi sequences, ribozymes, and those for uses in, for
example, DNA vaccines
against viral infection, or in the treatment of cardiovascular diseases,
angiogenesis-related diseases, or
cancer. Once delivered to the human cell, the plasmid DNA begins replicating
and producing copies of
the inserted DNA sequence. Thus, the promise of using plasmids DNA as active
pharmaceutical
ingredients (API) is considerable to treat a variety of disease states, but
storage has emerged as a
significant hurdle to this technology. In effect, if plasmid DNA is kept in
non-optimal conditions, its
structure degrades and the supercoiled (ccc) topology of the molecule can be
converted to inactive
forms (open circular and linear) via oxidative damages. Oxidation agents,
e.g., hydrogen peroxide,
superoxide and hydroxyl radicals that are generated through Fenton-type
reactions are responsible for
DNA oxidative degradations. Particularly, free radical oxidation pathways and
depurination and (3-
elimination represent the major sources of DNA degradation for highly purified
plasmid DNA in
aqueous formulations, causing DNA single-strand breaks or nickings and
subsequent conversions of the
covalently closed-circular (ccc) double-stranded supercoiled DNA to a relaxed
circle or open circular
and linear forms.
Plasmid DNA is usually formulated in phosphate or Tris-buffered aqueous
solutions, wherein
the phosphate or Tris buffer is present at a concentration of around 10 mM.
Such compositions are
however generally subject to degradation processes that occur during storage
in aqueous solution. These
plasmid DNA solutions have very poor stability both at around +4 C and +25 C.
In particular, their
depurination rates are very high at +4 C to room temperature (RT). The
degradation processes are
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
2
usually monitored by measurements of supercoiled, open-circular, and linear
DNA content, as well as
by the rate of depurination, i.e., the accumulation of apurinic sites and by
oxidation, i.e., 8-
hydroxyguanine formation over time.
Long-term storage of a plasmid DNA drug product thus results in many
degradation reactions
that affect the stability of the DNA. To overcome these problems, plasmids DNA
are commonly
lyophilized for storage at temperatures that extend to room-temperature, but
then requiring additional
manipulation steps of reformulations and further risks of contaminations
and/or degradations.
Since any strand breakage that occurs in plasmid DNA affects the quality and
performance, it is
critical to address the damages that occur over time during storage and
manipulations of plasmid DNA,
and provide with a storage composition ensuring long term storage stability of
the plasmid DNA and
safe manipulations at extended temperatures ranging from +4 C to room
temperature.
The Applicants have thus discovered novel liquid compositions for plasmid DNA
that are
stable and resistant to a broad range of temperatures, f.g., up to room
temperature for long period of
time, thus facilitating storages, transportations, manipulations, and
distributions of the DNA-based
drug, DNA vaccines or gene therapy before safe administrations to the
subjects. In particular, such
liquid formulations are useful for highly purified plasmid DNA which may used
for research and
plasmid-based therapy, e.g., in gene therapy and DNA vaccine.
SUMMARY OF THE INVENTION
A first object of the present invention is a composition for preserving
plasmid DNA in a liquid
formulation for long periods of time at temperatures up to +25 C.
The present invention thus relates to a stable plasmid DNA liquid storage
composition
comprising a plasmid DNA and a buffer in a concentration up to 5mM, up to 4mM,
or up to 3mM, or
again up to 2mM that is sufficient to maintain the pH the plasmid DNA
composition between 6 and 9,
thereby allowing to preserve the plasmid DNA with a supercoiled content of at
least 80%, and a content
of plasmids subject depurination and nicking of less than 20%.
The present invention also relates to a stable plasmid DNA liquid storage
composition
comprising a plasmid DNA and a buffer solution in a concentration of up to 2mM
sufficient to maintain
the pH of said formulation or composition between 6.2 and 8.5, and/or
approximately +/- 0.3 from one
or both of these values, thereby preserving the plasmid DNA with depurination
and nicking rates of less
than 5% per year when stored at around +4 C and less than 5% per month when
stored at around +25 C.
The present invention also relates to a stable plasmid DNA liquid storage
composition
comprising a plasmid DNA and a buffer solution in a concentration of up to 2mM
sufficient to maintain
the pH of said formulation or composition between 6.7 and 8.0, and/or
approximately +/- 0.3 from one
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
3
or both of these values, thereby preserving the plasmid DNA with depurination
and nicking rates of less
than 2% per year when stored at around +4 C and less than 2% per month when
stored at around +25 C.
The present invention further relates to a stable plasmid DNA liquid storage
composition
comprising a plasmid DNA and a buffer solution in a concentration of up to 2mM
sufficient to maintain
the pH of said formulation or composition between 7.0 and 7.5, approximately
+/- 0.3, thereby allowing
to preserve the plasmid DNA with depurination and nicking rates of less than
1% per year when stored
at around +4 C and less than 1% per month when stored at around +25 C.
Another object of the present invention is a method of preserving plasmid DNA
in a stable form
in a storage liquid composition, comprising (i) preparing a purified sample of
plasmid DNA; (ii)
combining said purified sample of plasmid DNA and a buffer solution in a
concentration of up to 2mM
sufficient to maintain the pH of the resulting composition between 6 and 9;
and (iii) storing the plasmid
DNA. The method according to the present invention allows one to preserve high
quality plasmid DNA
with at least 80% supercoiled plasmid DNA.
The present invention relates to a method of preserving plasmid DNA in a
stable form in a
storage liquid composition at temperatures around +4 C to +25 C with
depurination and nicking rates of
less than 5% per month to less than 5% per year, comprising (i) preparing a
purified sample of plasmid
DNA; (ii) combining said purified sample of plasmid DNA and a buffer solution
in a concentration of
up to 2mM sufficient to maintain the pH of the resulting composition between
6.2 and 8.5 and/or
approximately +/- 0.3 from one or both of these values; and (iii) storing the
plasmid DNA at the
selected temperature.
The present invention also relates to a method of preserving plasmid DNA in a
stable form in a
storage liquid composition at temperatures around +4 C to +25 C with
depurination and nicking rates of
less than 2% per month to less than 2% per year, comprising (i) preparing a
purified sample of plasmid
DNA; (ii) combining said purified sample of plasmid DNA and a buffer solution
in a concentration of
up to 2mM sufficient to maintain the pH of the resulting composition between
6.7 and 8 or
approximately +/- 0.3 from one or both of these values; and (iii) storing the
plasmid DNA at the
selected temperature.
The present invention further relates to a method of preserving plasmid DNA in
a stable form in
a liquid composition at temperatures around +4 C to +25 C with depurination
and nicking rates of less
than 1% per month to less than 1% per year, comprising (i) preparing a
purified sample of plasmid
DNA; (ii) combining said purified sample of plasmid DNA and a buffer solution
in a concentration of
up to 2mM sufficient to maintain the pH of the resulting composition between
7.0 and 7.5 and/or
approximately +/- 0.3 from one or both of these values; and (iii) storing the
plasmid DNA at the
selected temperature.
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
4
According to the composition of plasmid DNA comprises a buffer solution in a
concentration
of less than 5 mM, or less than 4mM, or less than 3mM. Preferably, the stable
plasmid DNA storage
composition comprises a buffer solution in a traces level or in a very diluted
concentration up to 2mM,
and more preferably between 1mM and 2mM. Most preferably the buffer solution
is present in a
concentration less than 1mM, between 250 M and 1mM, or between 400 M and 1mM,
so as to
maintain the pH of said formulation or composition between 6 and 9, or between
6.2 and 8.5, preferably
between 6.7 and 8, and most preferably between 7 and 7.5, and/or approximately
+/- 0.3 from any one
or more of these values.
The stable composition according to the present invention is particularly
useful for storing
highly purified plasmid DNA, that have very low levels of contaminating
chromosomal DNA, RNA,
protein, and endotoxins. Such highly purified plasmids DNA have less than
about 0.01% host cell RNA
contaminant, and/or less than about 0.01% host cell protein contaminant,
and/or less than about 0.01%
host cell genomic DNA contaminant. Preferred highly purified plasmids DNA have
less than about
0.001% host cell RNA contaminant, and/or less than about 0.001% host cell
protein contaminant,
and/or less than about 0.001% host cell genomic DNA contaminant. Most
preferred highly purified
plasmids DNA have less than about 0.0001% host cell RNA contaminant, and/or
less than about
0.0001% host cell protein contaminant, and/or less than about 0.0001% host
cell genomic DNA
contaminant.
Still another object of the present invention is a method of preparing a
stable plasmid DNA
liquid composition for storage at a temperature of up to about 25 C,
comprising (1) a step of lysing cells
comprising flowing the cells through (a) a turbulent flow to rapidly mix a
cell suspension with a
solution that lyses cells; and (b) a laminar flow to permit incubating a
mixture formed in (a) without
substantial agitation, wherein the mixture formed in (a) flows from the
turbulent flow into the laminar
flow, and optionally further comprising (c) adding a second solution that
neutralizes the lysing
solution, the mixture incubated in (b) the laminar flow into the second
solution, so as to release
plasmids DNA from the cells; (2) one step of chromatography for purifying the
plasmid DNA so
released; (3) combining said purified plasmid DNA and a buffer solution in a
concentration of up to
2mM sufficient to maintain the pH of the resulting composition between 6 and
9, and (4) storing the
plasmid DNA composition at a temperature of up to about 25 C.
The present invention also relates to a method of preparing a stable plasmid
DNA liquid
formulation for storage at a temperature of up to about 25 C, comprising (1) a
step of lysing cells
comprising flowing the cells through (a) a means for turbulent flow to rapidly
mix a cell suspension
with a solution that lyses cells; and (b) a laminar flow to permit incubating
a mixture formed in (a)
without substantial agitation, wherein the mixture formed in (a) flows from
the turbulent flow into the
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
laminar flow, and optionally further comprising (c) a means for adding a
second solution that
neutralizes the lysing solution, the mixture incubated in (b) flowing from the
means for laminar flow
into the means for adding a second solution, so as to release plasmids DNA
from the cells; (2)
performing a step of chromatography for purifying the plasmid DNA so released;
(3) performing a step
5 of diafiltration and/or buffer exchange; (4) combining said purified plasmid
DNA with a buffer
solution in a concentration of up to 2mM sufficient to maintain the pH of the
resulting composition
between 6 and 9; and (5) filling vials with the plasmid DNA liquid composition
and storing the plasmid
DNA composition at a temperature of up to about 25 C.
According to the method of the present invention the buffer solution is added
to the
composition of plasmid DNA in a concentration of less than 5 mM, or less than
4mM, or less than
3mM. Preferably, the method comprises the addition of traces levels of the
buffer solution or the
addition of a buffer solution in a very diluted concentration up to 2mM, and
more preferably between
1mM and 2mM. Most preferably the buffer solution is present in a concentration
less than ImM,
between 250 M and ImM, or between 400 M and 1mM, so as to maintain the pH of
said formulation
or composition between 6 and 9, or between 6.2 and 8.5, preferably between 6.7
and 8, and most
preferably between 7 and 7.5, and/or approximately +/- 0.3 from any one or
more of these values.
A further object of the present invention is the vials containing stable
plasmid DNA liquid
formulation as an active pharmaceutical ingredient for use in research or
plasmid-based therapy, such as
gene therapy or DNA vaccine.
Still a further object of the present invention is the vial containing a
purified plasmid DNA is a
plasmid designated NV 1 FGF which is a pCOR plasmid carrying an expression
cassette encoding for the
FGF-1 gene, that is useful for treatment of peripheral limb ischemia,
including peripheral arterial
disease (PAOD or PAD) and critical limb ischemia (CLI).
Additional objects and advantages of the invention will be set forth in part
in the description
which follows, and in part will be obvious from the description, or may be
learned by practice of the
invention. The objects and advantages of the invention will be realized and
attained by means of the
elements and combinations particularly pointed out in the appended claims.
It is to be understood that both the foregoing general description and the
following detailed
description are exemplary and explanatory only and are not restrictive of the
invention, as claimed. The
accompanying drawings, which are incorporated in and constitute a part of this
specification, illustrate
several embodiments of the invention and together with the description, serve
to explain the principles
of the invention.
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
6
BRIEF DESCRIPTION OF THE FIGURES
Figure 1 is a schematic of the apparatus that may be used for continuous mode
cell lysis of the
invention.
Figure 2 is a schematic of the mixer M1 in the continuous cell lysis
apparatus.
Figure 3 is a table comparing purification yields in terms of gDNA, RNA,
proteins, endotoxin
contaminant using a single step of anion exchange chromatography (AEC), or a
two-step method with a
step of anion exchange chromatography iry combination with triple helix
affinity chromatography
(THAC), and a three-step method comprising a step of anion exchange
chromatography, a step triple
helix affinity chromatography and a step of hydrophobic interaction
chromatography (HIC) in
combination ND means not detected : low sensitivity analytical methods.
Figure 4 is a table comparing various methods of separating and purifying
plasmid DNA, such
anion-exchange chromatography (AEC), hydroxyapatite chromatography (HAC),
hydrophobic
interaction chromatography (HIC), reversed-phase chromatography (RPC), size
exclusion
chromatography (SEC), triple helix affinity chromatography (THAC) alone or in
combination, and the
method according to the present invention. Results in terms of quality of the
purified plasmid DNA are
provided herein. ND, not detected (low sensitivity analytical methods).
Figures 5A and 5B are graphs showing depurination and nicking rates (formation
of open
circular plasmid form) of the plasmid DNA stored at +25 C and +5 C for up to
90 days.
Figures 6A and 6B are graphs showing depurination and nicking rates (formation
of open
circular plasmid form) of the plasmid DNA stored at +25 C and +5 C for up to
150 days.
Definitions
Plasmid DNA formulation or composition means a composition comprising an
efficient amount
of plasmid DNA or a formulation of a plasmid DNA present in an efficient
amount for use in research
or plasmid-based therapy, such as gene therapy or DNA vaccine.
Stable storage plasmid DNA formulation means a formulation that may be used
for storage of
plasmid DNA in a stable form for long periods of time before use as such for
research or plasmid-based
therapy. Storage time may be as long as several months, 1 year, 5 years, 10
years, 15 years, or up to 20
years at temperature range from +5 C to +25 C (RT: room temperature).
Generally, a stable plasmid DNA formulation or composition means a plasmid DNA
formulation that has a proportion of supercoiled double-strand DNA of at least
80%, the reminder being
in the form of open circular or/and linear plasmids.
A stable plasmid DNA formulation hereinafter means a composition comprising
plasmid DNA
that has depurination and nicking rates (formation of open circular plasmid
form) of less than 5% per
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
7
month when stored at +25 C and less than 5% per year when stored at +5 C.
Preferably, a stable
plasmid DNA formulation hereinafter means a composition comprising plasmid DNA
that has
depurination and nicking rates (formation of open circular plasmid form) of
less than 2% per month
when stored at +25 C and less than 2% per year when stored at +5 C. More
preferably is a stable
plasmid DNA formulation hereinafter means a composition comprising plasmid DNA
that has
depurination and nicking raies (formation of open circular plasmid form) of
less than 1% per month
when stored at +25 C and less than 1% per year when stored at +5 C.
Acidic means relating to or containing an acid; having a pH of less than 7.
Alkaline means relating to or containing an alkali or base; having a pH
greater than 7.
Continuous means not interrupted, having no interruption.
Genomic DNA (shortened as gDNA) means a DNA that is derived from or existing
in a
chromosome.
Laminar flow means the type of flow in a stream of solution water in which
each particle
moves in a direction parallel to every particle.
Lysate means the material produced by the process of cell lysis. The term
lysing refers to the
action of rupturing the cell wall and/or cell membrane of a cell which is in a
buffered solution i.e., cell
suspension) through chemical treatment using a solution containing a lysing
agent. Lysing agents
include for example, alkali, detergents, organic solvents, and enzymes. In a
preferred embodiment, the
lysis of cells is done to release intact plasmids from host cells.
Neutralizes to make (a solution) neutral or to cause (an acid or base/alkali)
to undergo
neutralization. By this term we mean that something which neutralizes a
solution brings the pH of the
solution to a pH between 5 and 7, and preferably around 7 or more preferably
closer to 7 than
previously.
Newtonian fluid is a fluid in which shear stress is proportional to the
velocity gradient and
perpendicular to the plane of shear. The constant of proportionality is known
as the viscosity.
Examples of Newtonian fluids include liquids and gasses.
Non-Newtonian fluid is a fluid in which shear stress is not proportional
solely to the velocity
gradient and perpendicular to the plane of shear. Non-Newtonian fluids may not
have a well defined
viscosity. Non-Newtonian fluids include plastic solids, power-law fluids,
viscoelastic fluids (having
both viscous and elastic properties), and time-dependent viscosity fluids.
Plasmid DNA means a small cellular inclusion consisting of a ring of DNA that
is not a
chromosome, which may have the capability of having a non-endogenous DNA
fragment inserted into
it. As used herein, plasmid DNA can also be any form of plasmid DNA, such as
cut, processed, or
other manipulated form of a non-chromosomal DNA, including, for example, any
of, or any
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
8
combination of, nicked circle plasmid DNA, relaxed circle plasmid DNA,
supercoiled plasmid DNA,
cut plasmid DNA, linearized or linear plasmid DNA, and single-stranded plasmid
DNA. Procedures for
the construction of plasmids include those described in Maniatis et al.,
Molecular Cloning, A
Laboratory Manual, 2d, Cold Spring Harbor Laboratory Press (1989). A protocol
for a mini-prep of
plasmid DNA, well-known in the art (Bimboim and Doly, Nucleic Acids Research
7:1513 (1979)), can
be used to initially isolate plasmid DNA for later processing through some
aspects of the invention and
can be contrasted with the highly purified samples produced from the methods
of the invention.
Preferably, the form of the plasmid DNA is, or at least is after preparation
by the purification method of
the invention, substantially closed circular form plasmid DNA, or about 80%,
85%, 90%, 95%, or more
than about 99% closed circular form plasmid DNA. Alternatively, a supercoiled
covalently closed form
of plasmid DNA (ccc) can be preferred in some therapeutic methods, where it
may be more effective
than the open-circular, linear, or multimeric forms. Therefore, the
pharmaceutical grade plasmid DNA
may be isolated from or separated from one or more forms of plasmid and
substantially comprise one or
more desired forms.
For purposes of the present invention the term flowing refers to the passing
of a liquid at a
particular flow rate (e.g., liters per minute) through the mixer, usually by
the action of a pump. It should
be noted that the flow rate through the mixer is believed to affect the
efficiency of lysis, precipitation
and mixing.
The terms "nicked" and "relaxed" DNA means DNA that is not supercoiled.
"Supercoiled"
DNA is a term well understood in the art in describing a particular, isolated
form of plasmid DNA.
Other forms of plasmid DNA are also known in the art.
A "contaminating impurity" is any substance from which it is desired to
separate, or isolate,
DNA. Contaminating impurities include, but are not limited to, host cell
proteins, endotoxin, host cell
DNA, such as chromosomal DNA or genomic DNA, and/or host cell RNA. It is
understood that what is
or can be considered a contaminating impurity can depend on the context in
which the methods of the
invention are practiced. A "contaminating impurity" may or may not be host
cell derived, i.e., it may or
may not be a host cell impurity.
"Isolating" or "purifying" a first component (such as DNA) means enrichment of
the first
component from other components with which the first component is initially
found. Extents of desired
and/or obtainable purification are provided herein.
The terms "essentially free and highly purified" are defined as about 95% and
preferably
greater than 98.99% pure or free of contaminants, or possessing less than 5%,
and preferably less than
1-2% contaminants.
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
9
Pharmaceutical grade DNA is defined herein as a DNA preparation that contains
no more than
about 5%, and preferably no more than about 1-2% of cellular components, such
as cell membranes.
Also described is a method of producing and isolating highly purified plasmid
DNA that is
essentially free of contaminants and thus is pharmaceutical grade DNA. The
plasmid DNA produced
and isolated by the method of the invention contains very low levels, LgL,
part per millions (ppm) of
contaminating chromosomal DNA, RNA, protein, and endotoxins, and contains
mostly closed circular
form plasmid DNA. The plasmid DNA produced according to the invention is of
sufficient purity for
use in research and plasmid-based therapy, and optionally for human clinical
trial material and human
gene therapy experiments and clinical trials.
A"pharmaceutical grade plasmid DNA composition" of the invention is one that
is produced
by a method of the invention and/or is a composition having at least one of
the purity levels defined
below as a "pharmaceutical grade plasmid DNA." Preferably, a "pharmaceutical
grade plasmid DNA
composition" of the invention is of a purity level defined by at least two of
those identified below as a
"pharmaceutical grade plasmid DNA" for example, less than about 0.01%
chromosomal or genomic
DNA and less than about 0.01% protein contaminant, or for example less than
about 0.01%
chromosomal or genomic DNA and less than about 0.1 EU/mg endotoxins.
Pharmaceutical grade
plasmid DNA preferably coittains less than about 0.001% chromosomal or genomic
DNA and less than
about 0.001% protein contaminant, or for example less than about 0.001%
chromosomal or genomic
DNA and less than about 0.1 EU/mg endotoxins. More preferably, it contains
less than about 0.0001%
chromosomal or genomic DNA and less than about 0.0001% protein contaminant, or
for example less
than about 0.0001% chromosomal or genomic DNA and less than about 0.1 EU/mg
endotoxins. Most
preferred pharmaceutical grade DNA plasmid contains less than about 0.00008%
chromosomal or
genomic DNA and less than about 0.00005% protein contaminant, or for example
less than about
0.00008% chromosomal or genomic DNA and less than about 0.1 EU/mg endotoxins.
Other
combinations of purity levels are included under the definition. Of course,
the pharmaceutical grade
plasmid DNA composition can further comprise or contain added components
desired for any particular
use, including use in combination treatments, compositions, and therapies. The
levels of chromosomal
or genomic DNA, RNA, endotoxins or protein refers to contaminants from the
cell-based production of
plasmid or other contaminant(s) from the purification process.
Most preferably, "Pharmaceutical grade plasmid DNA" is defined herein as a DNA
preparation
that contains on the level of one part per million or ppm (< 0.0001%, i.e. <
0.0001 mg per 100 mg of
plasmid DNA) or less of genomic DNA, RNA, and/or protein contaminants.
Also or more precisely, "pharmaceutical grade plasmid DNA" herein can mean a
DNA
preparation that contains less than about 0.01%, or less than 0.001%, and
preferably less than 0.0001%,
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
or preferably less than 0.00008% (< 0.00008%, i.e. < 0.00008 mg per 100 mg of
plasmid DNA) of
chromosomal DNA or genomic DNA.
"Pharmaceutical grade plasmid DNA" can also mean a DNA preparation that
contains less than
about 0.01 %, or less than 0.001 %, and preferably less than 0.0001 %, or
preferably less than 0.00002%
5 (< 0.00002%, i.e. < 0.00002 mg per 100 mg of plasmid DNA) of RNA
contaminants.
"Pharmaceutical grade plasmid DNA" can also mean a DNA preparation that
contains less
than about 0.0001%, and most preferably less than 0.00005% (< 0.00005%, i.e. <
0.00005 mg per 100
mg of plasmid DNA) of protein contaminants.
"Pharmaceutical grade plasmid DNA" can also mean a DNA preparation that
contains less than
10 0.1 EU/mg endotoxins.
The Pharmaceutical grade plasmid DNA means herein a DNA preparation that is
preferably,
predominantly circular in form, and more precisely DNA that contains more than
80%, 85%, 90%,
95%, or more than 99% of closed circular form plasmid DNA.
T tube refers to a T-shaped configuration of tubing, wherein a T-shape is
formed by a single
piece of tubing created in that configuration or more than one piece of tubing
combined to create that
configuration. The T tube has three arms and a center area where the arms
join. A T tube may be used
to mix ingredients as two fluids can flow each into one of the arms of the T,
join at the center area, and
out the third arm. Mixing occurs as the fluids merge.
Turbulent flow means irregular random motion of fluid particles in directions
transverse to the
direction of the main flow, in which the velocity at a given point varies
erratically in magnitude and
direction.
Viscoelastic refers to fluids having both viscous and elastic properties.
DETAILED DESCRIPTION OF THE INVENTION
The present invention relates to plasmid DNA liquid formulations that are
stable and where the
plasmid DNA stays un-degraded at room temperature for a long period of time.
Such plasmid DNA
formulations or compositions are thus useful for the storage of plasmid DNA in
research, plasmid-based
therapy, such as gene therapy or DNA vaccine.
According to the present invention, the stable plasmid DNA liquid storage
composition
comprising a plasmid DNA and a buffer solution in a concentration up to 5mM,
or up to 4mM, or up to
3mM, or up to 2mM that are sufficient to maintain the pH of said composition
between 6 and 9, and the
composition comprises predominant supercoiled form of plasmid DNA at
temperatures around 4 C to
2 5 C, for several months, 1 year, 2 years, 3 years, 4, years, 5 years, and up
to 10 years.
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
11
A composition of plasmid DNA having predominantly supercoiled form of plasmid
comprises
at least 80% of supercoiled or closed circular plasmid DNA, or around 85%, and
preferably around
90%, or around 95%. Most preferably the composition of stable plasmid DNA
contains around 99% of
supercoiled or closed circular form plasmid DNA. Alternatively, a stable
composition for plasmid DNA
storage yields depurination and nicking rates of less than 5% per month.
The stable plasmid DNA liquid storage formulation according to the present
invention thus
comprises a plasmid DNA and a very diluted buffer solution a buffer solution
in a concentration up to
2mM sufficient to maintain the pH of the composition around at least 6, and at
most 9, or between 6.2
and 8.5, and preferably between 6.7 and 8, and more preferably between 7 and
7.5, and/or
approximately +/- 0.3 from one or both of these values.
The stable plasmid DNA liquid composition comprises a buffer solution in a
concentration up
to 2mM so as to maintain the pH of said formulation or composition between 6.2
and 8.5, and/or
approximately +/- 0.3 from one or both of these values, thereby allowing
storage of the plasmid DNA
with depurination and nicking rates of less than 5% per year when stored at
around +4 C and less than
5% per month when stored at around +25 C.
Preferably, the stable plasmid DNA liquid composition comprises a buffer
solution in a
concentration up to 2mM so as to maintain the pH of said formulation or
composition between 6.7 and
8, and/or approximately +/- 0.3 from one or both if these values, thereby
allowing storage of the
plasmid DNA with depurination and nicking rates of less than 2% per year when
stored at around +4 C
and less than 2% per month when stored at around +25 C.
More preferably, the stable plasmid DNA liquid composition comprises a buffer
solution in a
concentration up to 2mM so as to maintain the pH of said formulation or
composition between 7 and
7.5, and/o approximately +/- 0.3 from one or both of these values, thereby
allowing storage of the
plasmid DNA with depurination and nicking rates of less than 1% per year when
stored at around +4 C
and less than 1% per month when stored at around +25 C.
The molar concentration of the buffer solution is determined so as to exert
the buffering effect
within a limit and in a volume where the pH value is stabilized between 6 and
9, or between 6.2 and
8.5, preferably between 6.7 and 8, and most preferably between 7 and 7.5,
and/or approximately +/- 0.3
from any of these values. The buffer solution may thus be added in
concentration of less than 5mM.
Preferably, the stable plasmid DNA storage composition comprises traces of the
buffer solution or a
buffer solution in a very diluted concentration up to 2mM, and more preferably
between 1mM and
2mM. Most preferably the buffer solution is present in a concentration less
than 1mM, between 250 M
and 1mM, or between 400 M and 1mM, so as to maintain the pH of said
formulation or composition
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
12
between 6 and 9, or between 6.2 and 8.5, preferably between 6.7 and 8, and
most preferably between 7
and 7.5, and/or approximately +/- 0.3 from any one or more of these values.
The buffer solution is present in a concentration of up to 2mM, or between I
and 2mM.
Preferably the buffer solution is present in a concentration of less than 1mM.
Most preferably the buffer
solution is present as trace levels at a concentration as low as 250 M and up
to 1mM. Trace levels of
the buffer solution may be around 400 M, and just sufficient to maintain the
pH at the ranges indicated
herein above.
Buffer solutions that may be used in the compositions of the present invention
consist either of
an acid/base system comprising Tris [tris(hydroxymethyl)-aminomethane], or
lysine and an acid chosen
from a strong acid (hydrochloric acid for example) or a weak acid (maleic
acid, malic acid or acetic
acid for example), or of an acid/base system comprising Hepes [2-(4-(2-
hydroxyethylpiperazin)-1-
yl)ethanesulphonic acid] and a strong base (sodium hydroxide for example), or
phosphate buffers, such
as sodium phosphate or potassium phosphate. The buffer solution may also
comprise Tris/HCI,
lysine/HCI, Tris/maleic acid, Tris/malic acid, Tris/acetic acid, or
Hepes/sodium hydroxide. Preferably,
the Tris buffer is used in the stable plasmid DNA storage composition of the
present invention.
As shown in the Examples below, the plasmid DNA formulations according to the
present
invention exhibit an excellent stability both at 4 C and at room temperature
(RT), e.., 20 or 25 C.
The composition of the present invention may further comprise a saline
excipient. Saline
excipients that may used in the compositions of the present invention may
comprise anions and cations
selected from the group consisting of acetate, phosphate, carbonate, SO2"4 ,
Cl-, Br, N03 , Mg2+, Li+,
Na+, K+, and NH4+, and any other salt or form of a pharmaceutical compound
available or used
previously. Preferred saline excipient is NaCI at a concentration between 100
and 200 mM, and
preferably a concentration of around 150mM.
The stable compositions according to the present invention are particularly
useful for storing
highly purified plasmid DNA or pharmaceutical grade plasmid DNA, that have
very low levels of
contaminating chromosomal DNA, RNA, protein, and endotoxins. Such highly
purified plasmids DNA
have less than about 0.01%; or 0.001%; or 0.0001% host cell RNA contaminant,
or/and less than about
.01%; or 0.001%; or 0.0001% host cell protein contaminant, and/or less than
about.01 %; or 0.001%; or
0.0001% host cell genomic DNA contaminant.
The compositions according to the present invention may further comprise an
adjuvant, such as
for example a polymer selected among polyethylene glycol, a pluronic, or a
polysorbate sugar, or
alcohol.
According to another aspect, the present invention relates to a method of
preserving plasmid
DNA in a composition comprising a) preparing a purified sample of plasmid DNA
and b) combining
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
13
said purified sample of plasmid DNA and a buffer solution in a concentration
up to 2mM that maintains
the pH of the resulting composition between 6.2 and 9. Preferably, the pH is
maintained between 6.5
and 8.5, preferably between 6.7 and 8, and most preferably between 7 and 7.5,
and more particularly at
around 7.2.
The present invention also relates to a method of preserving plasmid DNA in a
composition
comprising a) preparing a purified sample of plasmid DNA, b) combining said
purified sample of
plasmid DNA and a buffer solution in a concentration up to 2mM sufficient to
maintain the pH of the
resulting composition between 6 and 9; and c) storing the plasmid DNA. The
method according to the
present invention allows to store the plasmid DNA with at least 80%
supercoiled plasmid DNA.
The pH of the resulting composition may be maintained between 6.2 and 8.5 and
approximately
+/- 0.3 of one or both of these values, thereby permitting the plasmid DNA to
be preserved at
temperatures around +4 C to +25 C with depurination and nicking rates of less
than 5% per month to
less than 5% per year.
Preferably, the pH of the resulting composition may be maintained between 6.7
and 8
approximately +/- 0.3, thereby permitting the plasmid DNA to be preserved at
temperatures around
+4 C to +25 C with depurination and nicking rates of less than 2% per month to
less than 2% per year.
Most preferably, the pH of the resulting composition may be maintained between
7 and 7.5 and
approximately +/- 0.3 of one or more of these values, thereby permitting the
plasmid DNA to be
preserved at temperatures around +4 C to +25 C with depurination and nicking
rates of less than 1%
per month to less than 1% per year.
According to the method of the present invention the buffer solution is added
to the
composition of plasmid DNA in a concentration of up to 2mM, or between 1 and
2mM. Preferably the
buffer solution is added to reach a concentration of less than 1mM. Most
preferably the buffer solution
is present as trace levels at a concentration as low as 250gM and up to 1 mM.
Trace levels of the buffer
solution may be around 400 M, and just sufficient to maintain the pH at the
ranges indicated herein
above.
According to the present method, a saline excipient may further be added to
the plasmid DNA
and buffer solution. Those are described herein above. Preferred saline
excipient is NaCI, at a
concentration between 100 and 200mM, and preferably around 150mM.
Plasmids DNA that are formulated in the compositions according to the present
invention may
be in an isolated form. They may be isolated via bacterial cell lysis and
purification as described herein,
or synthesized via automated nucleic acid synthesis equipment.
They may comprise a polynucleotide encoding a polypeptide, wherein the
polynucleotide may
be a transgene, such a therapeutic gene, for example of a mammalian origin,
such as a rodent or a
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
14
human gene, and is operably linked to a promoter sequence. The polynucleotide
which is inserted
within the plasmid DNA may be of genomic origin, and therefore contain exons
and introns as reflected
in its genomic organization, or may be derived from complementary DNA. The
polynucleotide can
encode any of a variety of polypeptides, such as, without limitation, an
immunogen peptide or protein,
an angiogenesis factor, erythropoietin, adenosine deaminase, Factor VIII,
Factor IX, dystrophin, 0-
globin, LDL receptor, CFTR, insulin, an anti-angiogenesis factor, a growth
hormone, al-antitrypsin,
phenylalanine hydroxylase, tyrosine hydroxylase, an interleukin, and an
interferon. Preferably, the
plasmid DNA comprises a palynucleotide coding an angiogenesis factor, such as
a FGF gene (FGF-1 to
FGF-22), VEGF, HGF, or HIF-1. As an alternative to using a polynucleotide that
encodes a
polypeptide, the polynucleotide can encode a siRNA, which may be used to
inhibit expression of a
target gene, e.g., where the gene expression is undesirable (e.g., the gene of
a pathogen) or where the
level of gene expression is undesirably high in a cell. Promoters suitable for
use in various vertebrate
systems are well known and include for example, RSV LTR, MPSV LTR, SV40,
metallothionein
promoter, and CMV IEP may advantageously be used.
Plasmid DNA may include prokaryotic and eukaryotic vectors, and expression
vectors, such as
pBR322 and pUC vectors and their derivatives. They may incorporate various
origins of replication,
g.g., prokaryotic origins of replication, such as pMBl and ColEl, or
eukaryotic origins of replication,
such as those facilitating replication in yeast, fungi, insect, and mammalian
cells (eg., SV40 ori).
The insert may include DNA from any organism, but will preferably be of
mammalian origin,
and may include, in addition to a gene encoding a therapeutic protein,
regulatory sequences such as
promoters, enhancers, locus control regions, selectable genes, polylinkers for
insertion of the transgene,
leader peptide sequences, introns, polyadenylation signals, or combinations
thereof. The selection of
vectors, origins, and genetic elements will vary based on requirements and is
well within the skill of
workers in this art. Selectable markers may be for examples antibiotic
resistance gene, E.g., SupPhe
tRNA, the tetracycline, resistance gene, kanamycin resistance gene, puromycin
resistance gene,
neomycin resistance gene, hygromycin resistance gene, and thymidine kinase
resistance. The backbone
of the plasmid advantageously permits inserts of fragments of mammalian, other
eukaryotic,
prokaryotic or viral DNA, and the resulting plasmid may be purified and used
in vivo or ex vivo
plasmid-based therapy.
Preferably, plasmid DNA with conditional origin of replication, such as the
pCOR plasmid
which is described in US publication application 2003/1618445 is used. The
resulting high copy
number greatly increases the ratio of plasmid DNA to chromosomal DNA, RNA,
cellular proteins and
co-factors, improves plasmid yield, and facilitates easier downstream
purification. Accordingly, any
plasmid DNA may be used according to the invention. Representative vectors
include but are not
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
limited to NV 1 FGF plasmid. NV 1 FGF is a plasmid encoding an acidic
Fibroblast Growth Factor or
Fibroblast Growth Factor type 1(FGF-1), useful for treating patients with end-
stage peripheral arterial
occlusive disease (PAOD) or with peripheral arterial disease (PAD). Camerota
et al. (J Vasc. Surg.,
2002, 35, 5:930-936) describes that 51 patients with unreconstructible end-
stage PAD, with pain at rest
5 or tissue necrosis, have been intramuscularly injected with increasing
single or repeated doses of
NV 1 FGF into ischemic thigh and calf. Various parameters such as
transcutaneous oxygen pressure,
ankle and toe brachial indexes, pains assessment, and ulcer healing have been
subsequently assessed. A
significant increase of brachial indexes, reduction of pain, resolution of
ulcer size, and an improved
perfusion after NV 1 FGF administration are were observed.
10 According to another aspect, the present invention provides with a
composition as defined
herein above for use in a method of treatment of a human body or animal body
by therapy. Preferably,
the composition according to the present invention contains a pCOR plasmid
encoding an angiogenic
gene of the FGF or VEGF family for the treatment of cardiovascular disease
such peripheral ischemia,
peripheral arterial diseases, e.g., PAOD or PAD, critical limb ischemia (CLI),
and intermittent
15 claudication (IC).
As another preferred use, the plasmid DNA comprises a polynucleotide encoding
an
immunizing peptide and may be used as a DNA vaccine. The present invention
thus provides a
composition for vaccination of humans or animals, thereby generating effective
immunity against
infectious agents, including intracellular viruses, and also against tumor
cells. In effect, the plasmid
DNA stable composition may be used as DNA vaccines to greatly enhance the
immunogenicity of
certain viral proteins, and cancer-specific antigens that normally elicit a
poor immune response. They
are useful for the induction of the induction of cytotoxic T cell immunity
against poorly immunogenic
viral proteins from the Herpes viruses, non-A, non-B hepatitis, and HIV.
The plasmid DNA may encode immunity-conferring polypeptides, which can act as
endogenous immunogens to provoke a humoral or cellular response, or both, or
still for an antibody. In
this regard, the term "antibody" encompasses whole immunoglobulin of any
class, chimeric antibodies
and hybrid antibodies with dual or multiple antigen or epitope specificities,
and fragments, such as
F(ab)2, Fab', Fab and the like, including hybrid fragments. Also included
within the meaning of
"antibody" are conjugates of such fragments, and so-called antigen binding
proteins (single chain
antibodies) as described, for example, in U.S patent 4,704,692 (the content of
which are hereby
incorporated by reference). Thus, plasmid DNA comprising a polynucleotide
coding for variable
regions of an antibody may be used to produce antibody in situ. For
illustrative methodology relating to
obtaining antibody-encoding polynucleotides, see Ward et al. Nature, 341:544-
546 (1989); Gillies et al.,
Biotechnol. 7:799-804 (1989); and Nakatani et al., loc. cit., 805-810 (1989).
The antibody in turn would
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
16
exert a therapeutic effect, for example, by binding a surface antigen
associated with a pathogen.
Alternatively, the encoded antibodies can be anti-idiotypic antibodies
(antibodies that bind other
antibodies) as described, for example, in U.S. Pat. No. 4,699,880. Such anti-
idiotypic antibodies could
bind endogenous or foreign antibodies in a treated individual, thereby to
ameliorate or prevent
pathological conditions associated with an immune response, e.g., in the
context of an autoimmune
disease.
The composition according to the present may thus be administered into humans
or animals in
vivo, allowing the plasmid DNA to be delivered to various cells of the animal
body, including muscle,
skin, brain, lung, liver, spleen, or to the cells of the blood. Delivery of
the polynucleotides directly in
vivo is preferably to the cells of muscle or skin. Injections may be done for
example into muscle or skin
using an injection syringe or a vaccine gun to provide effective immunization
of the subject. In effect,
the gene for an antigen being introduced into cells of the subject, the
transfected cells, now expressing
the antigen, will be processed and presented to the immune system by the
normal cellular pathways.
Adjuvants or lymphokines may possibly be coinjected to further enhance
immunization.
For example, the present plasmid DNA stable composition may be used for
vaccination against
viruses, or as DNA vaccine to treat latent viral infections, such as for
example, Hepatitis B, HIV and
members of the Herpes virus group, where the virus is maintained
intracellularly in an inactive or
partially active form. Plasmid DNA composition of the present invention may
further be used for the
treatment of malignant disease, to enhance the cellular immune response to a
protein specific to the
malignant state, an oncogene, a fetal antigen or an activation marker.
Plasmids DNA (pDNA) that are formulated for long term storage according to the
present
invention are usually produced in bacterial cells which are then subject to
lysis in order to release the
cellular contents from which the pDNA is isolated.
This process generally involves three steps comprising cell resuspension,
cells lysis,
neutralization and precipitation of host contaminants. Cell resuspension
normally utilizes manual
stirring or a magnetic stirrer, and a homogenizer or impeller mixer to
resuspend cells in the
resuspension buffer.
Cell lysis may be carried out by manual swirling or magnetic stirring in order
to mix the
resuspended cells with lysis solution, consisting of lysozyme or diluted
alkali (base), such as for
example alkaline or potassium acetate (KOAc) and detergents; then holding the
mixture at room
temperature (20-25 degrees Celsius) or on ice for a period of time, such as 5
minutes, to complete lysis.
RNase is also generally added to degrade RNAs of the bacterial suspension. The
third stage is
neutralization and precipitation of host contaminants. Lysate from the second
stage is normally mixed
with a cold neutralization solution by gentle swirling or magnetic stirring to
acidify the lysate before
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
17
setting in ice for 10-30 minutes to facilitate the denaturation and
precipitation of high molecular weight
chromosomal DNA, host proteins, and other host molecules.
When cell lysis is performed using lyzozyme treatment, the bacteria are
contacted with
lysozyme and then boiled at about 100 C in an appropriate buffer for 20 to 40
seconds forming an
insoluble clot of genomic DNA, protein and debris leaving the plasmid in
solution with RNA as the
main contaminant. Next, a mixed solution of NaOH and sodium dodecylsulfate
(SDS) is added for the
purpose of dissolving the cytoplasmic membrane. NaOH partially denatures DNAs
and partially
degrades RNAs and SDS acts to dissolve the membrane and denature proteins.
Successively, SDS-
protein complex and cell debris are precipitated by adding 5N potassium
acetate (pH 4.8). At this time,
pH is important for both to neutralize NaOH used in said manipulation and to
renature plasmid.
Thereafter, centrifugation is applied to remove the precipitates, thus
obtaining aiming plasmids DNA in
supernatant.
Alternatively, alkaline lysis is perfonned and consists of mixing a suspension
of bacterial cells
with an alkaline lysis solution. The alkaline lysis solution consists of a
detergent, e.g., sodium dodecyl
sulfate (SDS), to lyse the bacterial cells and release the intracellular
material, and an alkali, e.g., sodium
hydroxide, to denature the proteins and nucleic acids of the cells
(particularly gDNA and RNA). As the
cells are lysed and the DNA is denatured, the viscosity of the solution rises
dramatically. After
denaturation, an acidic solution, e.g., potassium acetate (solution 3), is
added to neutralize the sodium
hydroxide, inducing renaturation of nucleic acids. The long fragments of gDNA
reassociate randomly
and form networks that precipitate as flocs, entrapping proteins, lipids, and
other nucleic acids. The
potassium salt of dodecyl sulfate also precipitates, carrying away the
proteins with which it is
associated. The two strands of pDNA (plasmid DNA), intertwined with each
other, reassociate
normally to reform the initial plasmid, which remains in solution.
These chemical steps may be suitable for lysing cells on a small scale or
small volumes of
bacterial fermentations of less than five liters, but the increase in
viscosity may render large scale
processing more difficult.
The lysis technique may be conducted in batch mode, i.e., where the different
solutions are
mixed by sequentially adding the solutions to vessels or tanks. After the
solution containing the cell
suspension has been mixed with the lysis solution, the viscoelastic alkaline
lysate is mixed with the
neutralization solution.
Continuously mixing various cell-lysis solutions using a series of static
mixers may be used as
alternative to batch methods particularly when large scale plasmid productions
are envisaged.
According to these methods, a cell suspension solution and a cell-lysing
solution are simultaneously
added to a static mixer. The lysed cell solution that exits the first static
mixer and a precipitating
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
18
solution are then simultaneously added to a second static mixer. The solution
that exits this second
mixer contains the precipitated lysate and plasmids. Other continuous modes of
lysing cells include use
of a flow-through heat exchanger where the suspended cells are heated to 70-
100 C. Following cell
lysis in the heat exchanger, the exit stream is subjected to either continuous
flow or batch-wise
centrifugation during which the cellular debris and genomic DNA are
precipitated, leaving the plasmid
DNA in the supernatant.
A preferred method for continuous alkaline lysis of the bacterial cell
suspension, particularly at
a large scale is described in the international patent publication WO
05/026331, which is incorporated
by reference. This preferred method addresses the problems caused by the
viscoelastic properties of the
fluids and the shear forces involved during mixing steps and provides with a
major advantage in
limiting shear forces. Therefore, high yield of plasmid DNA may be prepared
using the scalable method
of continuous alkaline lysis of host cells which is further described herein.
As a first step host cells are inoculated, i.e. transformed with a plasmid DNA
at exponential
growth phase cells and streaked onto plates containing LB medium containing an
antibiotic such as
tetracycline. Single colonies from the plate are then inoculated each into 20
ml LB medium
supplemented with the appropriate antibiotic tetracycline in separate sterile
plastic Erlenmeyer flasks
and grown for 12-16 hours at 37 C in a shaking incubator. One of these
cultures was then used to
inoculate 200 ml of sterile LB medium supplemented in a 2 L Erlenmeyer flasks.
This was grown at
37 C and 200 rpm in a shaking incubator and used to inoculate two 5 L
Erlenmeyer flasks, and grown at
30 C and 200 rpm in a shaking incubator and used to inoculate the fermenter
vessel when in mid-
exponential phase, after 5 hours and at an OD600 nm of 2 units.
Host cell cultures and inoculation are well known in the art. Generally, host
cells are grown
until they reach high biomass and cells are in exponential growth in order to
have a large quantity of
plasmid DNA. Two distinct methods may be employed, i.e., batch and fed-batch
fermentation.
Batch fermentation allows the growth rate to be controlled through
manipulation of the growth
temperature and the carbon source used. As used herein, the term "batch
fermentation" is a cell culture
process by which all the nutrients required for cell growth and for production
of plasmid contained in
the cultured cells are in the vessel in great excess, such as for example up
to 10-fold excess
concentrations of nutrients, at the time of inoculation, thereby obviating the
need to make additions to
the sterile vessel after the post-sterilization additions, and the need for
complex feeding models and
strategies. In particular the quantities of yeast extract in the batch medium
enriched from 5 g/1 (as in LB
medium) to 20 g/liter thus providing huge quantities of growth factors and
nucleic acid precursors. The
medium is also supplemented with ammonium sulfate (5 g/1) which acts as a
source of organic nitrogen.
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
19
Another type of fermentation is fed-batch fermentation, in which the cell
growth rate is
controlled by the addition of nutrients to the culture during cell growth. As
used herein, "fed-batch
fermentation" refers to a cell culture process in which the growth rate is
controlled by carefully
monitored additions of metabolites to the culture during fermentation. Fed-
batch fermentation
according to the invention permits the cell culture to reach a higher biomass
than batch fermentation.
Examples of fermentation process and exemplary rates of feed addition are
described below for a 50 L
preparation. However, other volumes, for example 10 L, 50 L, or greater than
500 L, also may be
processed using the exemplary feed rates described below, depending on the
scale of the equipment.
Highly enriched batch medium and fed-batch medium fermentations are
appropriate for the production
of high cell density culture to maximize specific plasmid yield and allow
harvest at high biomass while
still in exponential growth. Fed-batch fermentation uses glucose or glycerol
as a carbon source. The
fermentation is run in batch mode until the initial carbon substrate (glucose)
is exhausted. This point is
noted by a sudden rise in DO and confirmed by glucose analysis of a sample
taken immediately after
this event. The previously primed feed medium pump is then started. The pump
rate is determined by a
model derived from Curless et al. (Bioeng. 38:1082-1090, 1991), the whole of
which is incorporated by
reference herein. The model is designed to facilitate control of the feed
phase of a fed-batch process. In
the initial batch process, a non-inhibitory concentration of substrate is
consumed by cells growing at
their maximum specific growth rate, giving a rapid rise in the biomass levels
after inoculation. The
culture cannot grow at this rate indefinitely due to the accumulation of toxic
metabolites (Fieschio et al.,
"Fermentation Technology Using Recombinant Microorganisms." In Biotechnology,
eds. H. J. Rhem
and G. Reed. Weinheim: VCH Verlagsgesellschaft mbH 7b: 117-140, 1989). To
allow continued
logarithmic growth, the model calculates the time-based feed rate of the
growth-limiting carbon
substrate, without the need for feedback control, to give a fed-batch phase of
growth at a set by the
operator. This is chosen at a level which does not cause the build up of
inhibitory catabolites and is
sufficient to give high biomass. The additions of precursors (organic nitrogen
in the form of ammonium
sulfate) during the feeding process in fed-batch fermentation are designed to
prevent deleterious effects
on plasmid quality.
Well-known lysis methods in the art include for example, flow-through heat
lysis of microbial
cells containing plasmid may be used. This process is described inter alia in
the International
publication WO 96/02658. The particular heat exchanger consisted of a 10 ft. x
0.25 inch O.D. stainless
steel tube shaped into a coil. The coil is completely immersed into a constant
high temperature water
bath. The hold-up volume of the coil is about 50 mL. Thermocouples and a
thermometer were used to
measure the inlet and exit temperatures, and the water bath temperature,
respectively. The product
stream is pumped into the heating coil using a Masterflex peristaltic pump
with silicone tubing. Cell
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
lysate exited the coil and is then centrifuged in a Beckman J-21 batch
centrifuge for clarification. After
centrifugation, the plasmid DNA may be purified using the method of
purification according to the
present invention.
Alternative cell lysis may make use of static mixers in series. As described
in W097/23601
5 (incorporated herein by reference), a first static mixer for lysing the
cells through a first static mixer and
for precipitating the cell lysate though a second static mixer may be used as
an alternative method for
lysing the cell prior to the method of purifying plasmid DNA according to the
present invention. Large
volumes of cells can be gently and continuously lysed in-line using the static
mixer and that other static
mixers are placed in-line to accomplish other functions such as dilution and
precipitation. Suitable static
10 mixers useful in the method of the present invention include any flow
through device referred to in the
art as a static or motionless mixer of a length sufficient to allow the
processes of the present invention.
For example, for the purpose of lysing cells, the static mixer would need to
have a length which would
provide enough contact time between the lysing solution and the cells to 5
cause the lysis of the subject
cells during, passage through the mixer. Suitable static 5 mixers contain an
internal helical structure
15 which causes two liquids to come in contact with one another in an opposing
rotational flow causing the
liquids to mix together in a turbulent flow.
Most preferred method or device for cell lysis comprises (a) a means for
turbulent flow to
rapidly mix a cell suspension (solution I in Figure 1) with a solution that
lyses cells (solution 2 in
Figure 1); and (b) a means for laminar flow to permit incubating a mixture
formed in (a) without
20 substantial agitation, wherein the mixture formed in (a) flows from the
means for turbulent flow into the
means for laminar flow. Additionally, this may comprise a means for adding a
third solution that
neutralizes the lysing solution (solution 3 in Figure 1), wherein the mixture
incubated in (b) flows from
the means for laminar flow into the means for adding a second solution. Thus,
for example, this process
may be used to isolate plasmid DNA from cells comprising: (a) mixing the cells
with an alkali lysing
solution in the means for turbulent flow; and (b) neutralizing the alkaline
lysing solution by adding an
acidic solution.
This process is using T tubes for mixing the cell suspension (solution 1) and
the alkaline
solution (solution 2) uniformly and very rapidly before the viscoelastic fluid
appears, thereby providing
a major advantage in limiting shear forces. T tubes have generally small
diameter tubing, usually with a
diameter inferior to 1 cm, preferably of around 2 and 8 mm, and more
preferably of around 6mm, in
order to increase contact time of mixed fluids, but that method does not make
use of mixing induced by
passage through the tube. Table 1 herein below shows variation of parameters
Bla, Blb, B2 of the
means for turbulent flow, laminar flow, and turbulent flow, respectively, and
their corresponding flow
rates Sl, S2, and S3 as displayed in Figure 1.
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
21
Table 1
B 1 a (60L/h) B 1 b (60L/h) B2 (90L/h) Flow rates
diameter length Diameter Length diameter length S1, S2 et S3 Range
to 7mm 2-6 m 12.5 to 13 to 5 to 2 to 60/60/90 L/h 20%
19mm 23m 8mm 4m
5 The process may use a mixer or injector with tubes instead of a T, which
permits dispersion of
the cells into the lysis solution. Accordingly, the mechanical stress on the
fluids that pass through the
tubes is greatly reduced compared to when the fluids are stirred, ex., by
paddles in tanks. The initial
efficiency of mixing results in even greater efficiency in the seconds that
follow, since this fluid does
not yet have viscoelastic properties and the mixing realized by the small
diameter tube is very efficient.
In contrast, when a T tube is used for mixing, the initial mixing is only
moderate while the fluid
becomes rapidly viscoelastic, resulting in considerable problems while flowing
in the tube. This partial
mixing results in lysis of only a portion of the cells and therefore can only
release a portion of the
plasmids before neutralization. Lysis may be divided into two phases during
lysis, Phase I and Phase II.
These two phases correspond to I) lysis of the cells and II) denaturation of
nucleic acids, causing a
major change in rheological behavior that results in a viscoelastic fluid.
Adjusting the diameters of the
tubes makes it possible to meet the needs of these two phases. Within a small
diameter tube (Bla),
mixing is increased. This is the configuration used for Phase I. Within a
large diameter tube (Blb), the
mixing (and thus the shear stress) is reduced. This is the configuration
employed for Phase II.
Preferred mixer used is the one called M1, as depicted in Figure 2, but any T
shaped device
may also be used to provide dispersion of the cell suspension according to the
present invention. One
way of performing the lysis with this mixer, is to inject solution I counter
currently into the alkaline
lysis solution through one or more small diameter orifices in order to obtain
an efficient dispersion.
Diameters of these orifices may be around 0.5 mm to 2 mm, and preferably about
1 mm in the
configuration depicted. The mixture then exits mixer M1 to pass through a tube
of small diameter
(Figure 1) for a short time period (of about 2.5 sec). Combination of the
diameter and flow time may be
easily calculated to maintain a turbulent flow. Examples of variations of
these parameters are provided
in Table 1. All references to tube diameter provide the inner diameter of the
tube, not the outer
diameter, which includes the thickness of the tube walls themselves. This
brief residence time in the
tube permits very rapid homogenization of solutions 1 and 2. Assuming that
solution 1 and solution 2
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
22
are still Newtonian fluids during Phase I, the flow mode is turbulent during
the homogenization phase.
At the exit from this tube, solutions I and 2 are homogenized, and the lysis
of cells in suspension starts.
The homogenized mixture then passes through a second tube (Blb) of much larger
diameter
(Figure 1), in which lysis of the cells and formation of the viscoelastic
fluid occurs. During this phase,
mixing may be minimized and the solution may be allowed to "rest" to limit
turbulence as much as
possible in order to minimize any shear stress that would otherwise fragment
gDNA. A contact time of
about I to 3 min, around 2 min, and preferably of 1 min 20 sec may be
sufficient to complete the cell
lysis and to denature nucleic acids. During the denaturation phase, the flow
mode of the fluid may be
laminar, promoting slow diffusion of SDS and sodium hydroxide toward cellular
components.
The lysate thus obtained and the neutralization solution 3 may then be mixed
with a Y mixer
called M2. In one embodiment of the present invention, the inside diameter of
the Y mixer is around 4
to 15 mm, or around 6 to 10 mm, and may be of around 6mm or around 10 mm. The
small diameter
tube (e.g., about 6 mm tube) is positioned at the outlet of the Y mixer to
allow for rapid (< 1 sec) and
effective mixing of the lysate with solution 3. The neutralized solution is
then collected in a harvesting
tank. During neutralization, rapidly lowering the pH induces flocculate
formation (i.e., formation of
lumps or masses). On the other hand, the partially denatured plasmid renatures
very quickly and
remains in solution. The flocs settle down gradually in the harvesting tank,
carrying away the bulk of
the contaminants. The schematic drawing in Figure 1 shows one embodiment of
the continuous lysis.
(CL) system. Continuous lysis may be used on its own or with additional
processes.
Any type of cells, i.e., prokaryotic or eukaryotic, may be lysed with this
process, for any
purposes related to lysing, such as releasing desired plasmid DNA from target
cells to be subsequently
purified.
This process of continuous alkaline lysis step may be performed on cells
harvested from a
fermentation which has been grown to a biomass of cells that have not yet
reached stationary phase, and
are thus in exponential growth (2-10 g dry weight/liter). The continuous
alkaline lysis step may also be
performed on cells harvested from a fermentation which has been grown to a
high biomass of cells and
are not in exponential growth any longer, but have reached stationary phase,
with a cellular
concentration of approximately 10-200 g dry weight per liter, and preferably
12-60 g dry weight per
liter.
Plasmids DNA may be purified using various methods before being formulated in
the stable
storage composition according to the present invention. In effect, plasmid DNA
preparations, which are
produced from bacterial preparations often, contain a mixture of relaxed and
supercoiled plasmid DNA.
Plasmid DNA purification methods are well known in the art.
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
23
Generally, methods for isolating and purifying plasmid DNA from bacterial
fermentations,
consist of disrupting bacterial host cells containing the plasmid, as
described above, and neutralizing the
lysate with acetate neutralization to cause precipitation of host cell genomic
DNA and proteins, which
are then removed by, for example, centrifugation. The liquid phase contains
the plasmid DNA which is
alcohol precipitated and then subjected to isopycnic centrifugation using CsCI
in the presence of
ethidium bromide to separate the various forms of plasmid DNA, i.e.,
supercoiled, nicked circle, and
linearized. Further extraction with butanol is required to remove residual
ethidium bromide followed by
DNA precipitation using alcohol. Additional purification steps follow to
remove host cell proteins.
These methods are generally suitable for small or laboratory scale plasmid
preparations.
Alternatives methods include for example size exclusion chromatography,
chromatography on
hydroxyapatite, and various chromatographic methods based on reverse phase or
anion exchange. These
alternatives may be adequate to produce small amounts of research material on
a laboratory scale, but
may not be easily scaleable for producing high quantities of plasmid DNA. For
example, available
methods for separating plasmid DNA utilize ion exchange chromatography (Duarte
et al., Journal of
Chromatography A, 606 (1998), 31-45) or size exclusion chromatography
(Prazeres, D.M.,
Biotechnology Techniques Vol. 1, No. 6, June 1997, p 417-420), coupled with
the use of additives such
as polyethylene glycol (PEG), detergents, and other components such as
hexamine cobalt, spermidine,
and polyvinylpyrollidone (PVP). Alternative known methods for separation of
supercoiled and relaxed
forms of plasmid DNA utilize resins and solvents, such as acetonitrile,
ethanol and other components,
like triethylamine and tetrabutyl ammonium phosphate, during processing.
In case where nucl;ic acids or plasmid DNA are introduced into humans or
animals in a
therapeutic context, highly purified pharmaceutical grade plasmid DNA are
required, as such purified
nucleic acid must meet drug quality standards of safety, potency and efficacy.
Removal of
contaminating endotoxins may be required particularly when plasmid DNA are
purified from gram-
negative bacterial sources that have high levels of endotoxins. These
endotoxins are generally
lipopolysaccharides, or fragments thereof, that are components of the outer
membrane of Gram-
negative bacteria, and are present in the DNA preparation of the host cells
and host cell membranes or
macromolecules. They may cause inflammatory reactions, such as fever or sepsis
in the host receiving
the plasmid DNA. Hence removal of endotoxins may be a crucial and necessary
step in the purification
of plasmid DNA for therapeutic or prophylactic use. Endotoxin removal from
plasmid DNA solutions
primarily uses the negatively charged structure of the endotoxins. However,
plasmid DNA also is
negatively charged and hence separation is usually achieved with anion
exchange resins which bind
both these molecules and, under certain conditions, preferentially elute
plasmid DNA while binding the
endotoxins. In addition to preparing nucleic acids free from contaminating
endotoxins, which if
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
24
administered to a patient could elicit a toxic response, it may be desirable
to produce highly pure
nucleic acid that does not contain toxic chemicals, mutagens, organic
solvents, or other reagents that
would compromise the safety or efficacy of the resulting nucleic acid.
Before formulating the plasmid DNA in a stable aqueous solution for long term
storage
according to the present invention, the plasmid DNA is preferably purified
through a combination of
chromatography steps, allowing to obtain a plasmid DNA preparation containing
low levels, i.e., part
per millions (ppm) of contaminating chromosomal DNA, RNA, protein, and
endotoxins, and containing
mostly closed circular form plasmid DNA. More preferably, purification methods
which are described
in the international publication W095/026331 and in the international patent
application No.
PCT/EP2005/005213, are used for preparing plasmid DNA for applications in
research and plasmid-
based therapy, such as gene therapy and DNA vaccine.
Purification methods comprises the use of triple helix affinity
chromatography, which is
preceded by or followed by at least one additional chromatography technique,
optionally or typically as
the final purification steps or at least at the end or near the end of the
plasmid purification scheme.
Triple helix affinity chromatography is used in combination with one or more
chromatography step,
such as ion exchange chromatography, hydrophobic interaction chromatography,
gel permeation, or
size exclusion chromatography, hydroxyapatite (type I and II) chromatography,
reversed phase, and
affinity chromatography. Any available affinity chromatography protocol
involving nucleic acid
separation can be adapted for use. The anion exchange chromatography or any
one or more of the other
chromatography steps or techniques used can employ stationary phases,
displacement chromatography
methods, simulated moving bed technology, and/or continuous bed columns or
systems. In addition,
any one or more of the steps or techniques can employ high performance
chromatography techniques or
systems.
Thus, the method preferably comprises purification steps including triple
helix affinity
chromatography with a further step of ion exchange chromatography and further
may include
hydrophobic interaction chromatography or gel permeation chromatography. The
step of ion exchange
chromatography may be both in fluidized bed ion exchange chromatography and
axial and/or radial
high resolution anion exchange chromatography. Most preferred method includes
combination of ion
exchange chromatography, triple helix affinity chromatography and hydrophobic
interaction
chromatography steps, occurring in that order. A lysate filtration or other
flocculate removal may
precede the first chromatography step.
Thus, continuous lysis may be combined with the above-listed purification
steps, and result in a
high purity product containing pDNA. It may, for example, be combined with at
least one of flocculate
removal (such as lysate filtration, settling, or centrifugation), ion exchange
chromatography (such as
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
cation or anion exchange), triplex affinity chromatography, and hydrophobic
interaction
chromatography. In one emuodiment, continuous lysis is followed by anion
exchange chromatography,
triplex affinity chromatography, and hydrophobic interaction chromatography,
in that order. In another
continuous lysis is followed by lysate filtration, anion exchange
chromatography, triplex affinity
5 chromatography, and hydrophobic interaction chromatography, in that order.
These steps allow for a
truly scaleable plasmid manufacturing process, which can produce large
quantities of pDNA with
unprecedented purity. Host DNA & RNA as well as proteins are in the sub-ppm
range.
The method may also use further steps of size exclusion chromatography (SEC),
reversed-
phase chromatography, hydroxyapatite chromatography, and/or other available
chromatography
10 techniques, methods, or systems in combination with the steps described
herein in accordance with the
present application.
A flocculate removal may be employed to provide higher purity to the resulting
pDNA product.
This step may be used to remove the bulk of precipitated material
(flocculate). One mechanism of
performing flocculate removal is through a lysate filtration step, such as
through a I to 5 mm, and
15 preferably a 3.5 mm grid filter, followed by a depth filtration as a
polishing filtration step. Other
methods of performing flocculate removal are through centrifugation or
settling.
Ion exchange chromatography may be employed to provide higher purity to the
resulting
pDNA product. Anion exchange may be selected depending on the properties of
the contaminants and
the pH of the solution.
20 Anion exchange chromatography may be employed to provide higher purity to
the resulting
pDNA product. Anion exchange chromatography functions by binding negatively
charged (or acidic)
molecules to a support which is positively charged. The use of ion-exchange
chromatography, then,
allows molecules to be separated based upon their charge. Families of
molecules (acidic, basic and
neutral) can be easily separated by this technique. Stepwise elution schemes
may be used, with many
25 contaminants eluting in the early fractions and the pDNA eluted in the
later fractions. Anion exchange
is very efficient for removing protein and endotoxin from the pDNA
preparation.
For the ion exchange chromatography, packing material and method of preparing
such material
as well as process for preparing, polymerizing and functionalizing anion
exchange chromatography and
eluting and separating plasmid DNA there through are well known in the art.
Compound to be used for the synthesis of base materials that are used for the
packing material
for anion exchange chromatography may be any compounds, if various functional
groups that exhibit
hydrophobicity or various ion exchange groups can be introduced by a post-
reaction after the base
materials are synthesized. Examples of monofunctional monomers include
styrene, o-
halomethylstyrene, m-halomethylstyrene, p-halomethylstyrene, o-
haloalkylstyrene, m-haloalkylstyrene,
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
26
p-haloalkylstyrene, a-methylstyrene, a-methyl-o-halomethylstyrene, a-methyl-m-
halomethylstyrene, a-
methyl-p-halomethylstyrene, a-methyl-o-haloalkylstyrene, a-methyl-m-
haloalkylstyrene, a-methyl-p-
haloalkylstyrene, o-hydroxymethylstyrene, m-hydroxymethylstyrene, p-
hydroxymethylstyrene, o-
hydroxyalkylstyrene, m-hydroxyalkylstyrene, p-hydroxylalkylstyrene, a-methyl-o-
hydroxymethylstyrene, a-methyl-m-hydroxymethylstyrene, a-methyl-p-
hydroxymethylstyrene, a-
methyl-o-hydroxyalkylstyrene, a-methyl-m-hydroxyalkylstyrene, a-methyl-p-
hydroxyalkylstyrene,
glycidyl methacrylate, glycidyl acrylate, hydroxyethyl acrylate,
hydroxymethacrylate, and vinyl acetate.
Most preferred compounds are haloalkyl groups substituted on aromatic ring,
halogens such as Cl, Br, I
and F and straight chain and/or branched saturated hydrocarbons with carbon
atoms of 2 to 15.
Examples of polyfunctional monomers include divinylbenzene, trivinylbenzene,
divinyltoluene,
trivinyltoluene, divinylnaphthalene, trivinylnaphthalene, ethylene glycol
dimethacrylate, ethylene
glycol diacrylate, diethylene glycol dimethacrylate, diethylene glycol
diacrylate,
methylenebismethacrylamide, and methylenebisacrylamide.
Various ion exchange groups may be introduced by the post-reaction.
Preparation of the base
material includes a first step wherein monofunctional monomer and
polyfunctional monomer are
weighed out at an appropriate ratio and precisely weighed-out diluent or
solvent which are used for the
purpose of adjusting the pores in particles formed and similarly precisely
weighed-out polymerization
initiator are added, followed by well stirring. The mixture is then submitted
to a oil-in-water type
suspension polymerization wherein the mixture is added into an aqueous
solution dissolved suspension
stabilizer weighed out precisely beforehand, and oil droplets with aiming size
are formed by mixing
with stirrer, and polymerization is conducted by gradually warming mixed
solution. Ratio of
monofunctional monomer to polyfunctional monomer is generally around 1 mol of
monofunctional
monomer, and around 0.01 to 0.2 mol of polyfunctional monomer so as to obtain
soft particles of base
material. A polymerization initiator is also not particularly restricted, and
azobis type and/or peroxide
type being used commonly are used.
Suspension stabilizers such as ionic surfactants, nonionic surfactants and
polymers with
amphipathic property or mixtures thereof may also be used to prevent the
aggregation among oil
droplets themselves.
The packing material to be used for ion exchange chromatography for purifying
plasmid DNAs
is preferable to have relatively large pore diameter, particularly within a
range from 1500 to 4000
angstroms. Surface modification to introduce ion exchange groups to base
materials is well known in
the art.
Two types of eluents may be used for the ion exchange chromatography. A first
eluent
containing low-concentration of salt and a second eluent containing high-
concentration of salt may be
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
27
used. The eluting method consists in switching stepwise from the first eluent
to the second eluent and
the gradient eluting method continuously changing the composition from the
first eluent to the second
eluent. Buffers and salts that are generally used in these eluents for ion
exchange chromatography may
be used. For the first eluent containing low-concentration of salt, aqueous
solution with concentration of
buffer of 10 to 50 mM and pH value of 6 to 9 is particularly preferable. For
the second eluent
containing high-concentration of salt, aqueous solution with 0,1 to 2M sodium
salt added to eluent C is
particularly preferable. For the sodium salts, sodium chloride and sodium
sulfate may be used.
In addition, a chelating agent for bivalent metal ion may be used such as for
example,
ethylenediamine-tetraacetic acid, for inhibiting the degradation of plasmids
due to DNA-degrading
enzymes in the lysate of Escherichia coli. The concentration of chelating
agent for bivalent metal ion is
preferably 0.1 to 100 mM.
A wide variety of commercially available anion exchange matrices are suitable
for use in the
present invention, including but not limited to those available from POROS
Anion Exchange Resins,
Qiagen, Toso Haas, Sterogene, Spherodex, Nucleopac, and Pharmacia. For
example, the column (Poros
II PI/M, 4.5 mm x 100) is initially equilibrated with 20 mM Bis/TRIS Propane
at pH 7.5 and 0.7 M
NaCI. The sample is loaded and washed with the same initial buffer. An elution
gradient of 0.5 M to
0.85 M NaCI in about 25 column volumes is then applied and fractions are
collected. Preferred anion
exchange chromatography includes Fractogel TMAE HiCap.
Triplex helix affinity chromatography is described inter alia in the patents
US 6,319,672,
6,287,762 as well as in international patent application published under
W002/77274 of the Applicant.
Triplex helix affinity chromatography is based on specific hybridization of
oligonucleotides and
a target sequence within the double-stranded DNA. These oligonucleotides may
contain the following
bases:
- thymidine (T), which is capable of forming triplets with A.T doublets of
double-stranded DNA (Rajagopal et al., Biochem 28 (1989) 7859);
- adenine (A), which is capable of forming triplets with A.T doublets of
double-stranded
DNA;
- guanine (G), which is capable of fonning triplets with G.C doublets of
double-stranded
DNA;
- protonated cytosine (C+), which is capable of forming triplets with G.C
doublets of
double-stranded DNA (Rajagopal et al., loc. cit.);
- uracil (U), which is capable of forming triplets with A.U or A.T base pairs.
Preferably, the oligonucleotide used comprises a cytosine-rich homopyrimidine
sequence and
the specific sequence present in the DNA is a homopurine-homopyrimidine
sequence. The presence of
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
28
cytosines makes it possible to have a triple helix which is stable at acid pH
where the cytosines are
protonated, and destabilized at alkaline pH where the cytosines are
neutralized.
Oligonucleotide and the specific sequence present in the DNA are preferably
complementary to
allow formation of a triple helix. Best yields and the best selectivity may be
obtained by using an
oligonucleotide and a specific sequence which are fully complementary. For
example, an
oligonucleotide poly(CTT) and a specific sequence poly(GAA). Preferred
oligonucleotides have a
sequence 5'-GAGGCTTCTTCTTCTT CTTCTTCTT-3' (GAGG(CTT)7 (SEQ ID NO: 1), in which
the
bases GAGG do not form a triple helix but enable the oligonucleotide to be
spaced apart from the
coupling arm; the sequence (CTT)7. These oligonucleotides are capable of
forming a triple helix with a
specific sequence containing complementary units (GAA). The sequence in
question can, in particular,
be a region containing 7, 14 or 17 GAA units, as described in the examples.
Another sequence of specific interest is the sequence 5'-AAGGGAGGGAGGA GAGGAA-
3'
(SEQ ID NO: 2). This sequence forms a triple helix with the oligonucleotides
5'-AAGGAGAGGAGGGAGGGAA-3' (SEQ ID NO: 3) or 5'-TTGGTGTGGTGGGTGGGTT-3' (SEQ
ID NO: 4). In this case, the oligonucleotide binds in an antiparallel
orientation to the polypurine strand.
These triple helices are stable only in the presence of MgZ+ (Vasquez et al.,
Biochemistry, 1995, 34,
7243-7251; Beal and Dervan, Science, 1991, 251, 1360-1363).
As stated above, the specific sequence can be a sequence naturally present in
the
double-stranded DNA, or a synthetic sequence introduced artificially in the
latter. It is especially
advantageous to use an oligonucleotide capable of forming a triple helix with
a sequence naturally
present in the double-stranded DNA, for example in the origin of replication
of a plasmid or in a marker
gene. To this regard, it is known through sequence analyses that some regions
of these DNAs, in
particular in the origin of replication, could possess homopurine-
homopyrimidine regions. The
synthesis of oligonucleotides capable of forming triple helices with these
natural
homopurine-homopyrimidine regions advantageously enables the method of the
invention to be applied
to unmodified plasmids, in particular commercial plasmids of the pUC, pBR322,
pSV, and the like,
type. Among the homopurine-homopyrimidine sequences naturally present in a
double-stranded DNA,
a sequence comprising all or part of the sequence 5'-CTTCCCGAAGGGAGAAAGG-3'
(SEQ ID NO:
5) present in the origin of replication of E. coli plasmid ColE1 may be
mentioned. In this case, the
oligonucleotide forming the triple helix possesses the sequence: 5'-
GAAGGGCTTCCCTCTTTCC-3'
(SEQ ID NO: 6), and binds alternately to the two strands of the double helix,
as described by Beal and
Dervan (J. Am. Chem. Soc. 1992, 114, 4976-4982) and Jayasena and Johnston
(Nucleic Acids Res.
1992, 20, 5279-5288). The sequence 5'-GAAAAAGGAAGAG-3' (SEQ ID NO: 7) of the
plasmid
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
29
pBR322 /3-lactamase gene (Duval-Valentin et al., Proc. Natl. Acad. Sci. USA,
1992, 89, 504-508) may
also be mentioned.
Appropriate target sequences which can form triplex structures with particular
oligonucleotides
have been identified in origins of replication of plasmids ColEl as well as
plasmids pCOR. pCOR
plasmids are plasmids with conditional origin of replication and are inter
alia described US
2004/142452 and US 2003/161844. ColEl-derived plasmids contain a 12-mer
homopurine sequence
(5'-AGAAAAAAAGGA-3') (SEQ ID NO: 8) mapped upstream of the RNA-II transcript
involved in
plasmid replication (Lacatena et al., 1981, Nature, 294, 623). This sequence
forms a stable triplex
structure with the 12-mer complementary 5'-TCTTTTTTTCCT-3' (SEQ ID NO: 9)
oligonucleotide.
The pCOR backbone contains a homopurine stretch of 14 non repetitive bases
(5'-AAGAAAAAAAAGAA-3') (SEQ ID NO: 10) located in the A+T-rich segment of the
y origin
replicon of pCOR (Levchenko et al., 1996, Nucleic Acids Res., 24, 1936). This
sequence forms a stable
triplex structure with the 14-mer complementary oligonucleotide 5'-
TTCTTTTTTTTCTT-3' (SEQ ID
NO: 11). The corresponding oligonucleotides 5'-TCTTTTTTTCCT-3' (SEQ ID NO: 8)
and
5'-TTCTTTTTTTTCTT-3' (SEQ ID NO:11) efficiently and specifically target their
respective
complementary sequences located within the origin of replication of either
ColEl ori or pCOR (oriy).
In fact, a single non-canonical triad (T*GC or C*AT) may result in complete
destabilization of the
triplex structure.
The use of an oligonucleotide capable of forming a triple helix with a
sequence present in an
origin of replication or a marker gene is especially advantageous, since it
makes it possible, with the
same oligonucleotide, to purify any DNA containing the said origin of
replication or said marker gene.
Hence it is not necessary to modify the plasmid or the double-stranded DNA in
order to incorporate an
artificial specific sequence in it.
Although fully complementary sequences are preferred, it is understood,
however, that some
mismatches may be tolerated between the sequence of the oligonucleotide and
the sequence present in
the DNA, provided they do not lead to too great a loss of affinity. The
sequence
5'-AAAAAAGGGAATAAGGG-3' (SEQ ID NO: 12) present in the E. coli (3-lactamase
gene may be
mentioned. In this case, the thymine interrupting the polypurine sequence may
be recognized by a
guanine of the third strand, thereby forming a G*TA triplet which it is stable
when flanked by two
T*AT triplets (Kiessling et al., Biochemistry, 1992, 31, 2829-2834).
According to a particular embodiment, the oligonucleotides of the invention
comprise the
sequence (CCT)., the sequence (CT)õ or the sequence (CTT),,, in which n is an
integer between 1 and 15
inclusive. It is especially advantageous to use sequences of the type (CT)õ or
(CTT),,. The Applicant
showed, in effect, that the purification yield was influenced by the amount of
C in the oligonucleotide.
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
In particular, as shown in Example 7, the purification yield increases when
the oligonucleotide contains
fewer cytosines. It is understood that the oligonucleotides of the invention
can also combine (CCT),
(CT) or (CTT) units.
The oligonucleotide used may be natural (composed of unmodified natural bases)
or chemically
5 modified. In particular, the oligonucleotide may advantageously possess
certain chemical
modifications enabling its resistance to or its protection against nucleases,
or its affinity for the specific
sequence, to be increased. Oligonucleotide is also understood to mean any
linked succession of
nucleosides which has undergone a modification of the skeleton with the aim of
making it more
resistant to nucleases. Among possible modifications, oligonucleotide
phosphorothioates, which are
10 capable of forming triple helices with DNA (Xodo et al., Nucleic Acids
Res., 1994, 22, 3322-3330), as
well as oligonucleotides possessing formacetal or methylphosphonate skeletons
(Matteucci et al., J.
Am. Chem. Soc., 1991, 113, 7767-7768), may be mentioned. It is also possible
to use oligonucleotides
synthesized with a anomers of nucleotides, which also form triple helices with
DNA (Le Doan et al.,
Nucleic Acids Res., 1987, 15, 7749-7760). Another modification of the skeleton
is the
15 phosphoramidate link. For example, the N3'-P5' internucleotide
phosphoramidate link described by
Gryaznov and Chen, which gives oligonucleotides forming especially stable
triple helices with DNA (J.
Am. Chem. Soc., 1994, 116, 3143-3144), may be mentioned. Among other
modifications of the
skeleton, the use of ribonucleotides, of 2'-O-methylribose, phosphodiester,
etc. (Sun and Helene, Curr.
Opinion Struct. Biol., 116, 3143-3144) may also be mentioned. Lastly, the
phosphorus-based skeleton
20 may be replaced by a polyamide skeleton as in PNAs (peptide nucleic acids),
which can also form triple
helices (Nielsen et al., Science, 1991, 254, 1497-1500; Kim et al., J. Am.
Chem. Soc., 1993, 115,
6477-6481), or by a guanidine-based skeleton, as in DNGs (deoxyribonucleic
guanidine, Proc. Natl.
Acad. Sci. USA, 1995, 92, 6097-6101), or by polycationic analogues of DNA,
which also form triple
helices.
25 The thymine of the third strand may also be replaced by a 5-bromouracil,
which increases the
affinity of the oligonucleotide for DNA (Povsic and Dervan, J. Am. Chem. Soc.,
1989, 111,
3059-3061). The third strand may also contain unnatural bases, among which
there may be mentioned
7-deaza-2'-deoxyxanthosine (Milligan et al., Nucleic Acids Res., 1993, 21, 327-
333),
1-(2-deoxy-(3-D-ribofuranosyl)-3-methyl-5-amino-
30 1H-pyrazolo[4,3-d]pyrimidin-7-one (Koh and Dervan, J. Am. Chem. Soc., 1992,
114, 1470-1478),
8-oxoadenine, 2-aminopurine, 2'-O-methylpseudoisocytidine, or any other
modification known to a
person skilled in the art (for a review see Sun and H616ne, Curr. Opinion
Struct. Biol., 1993, 3,
345-356).
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
31
Another type of modification of the oligonucleotide has the aim, more
especially, of improving
the interaction and/or affinity between the oligonucleotide and the specific
sequence. In particular, a
most advantageous modification according to the invention consists in
methylating the cytosines of the
oligonucleotide. The oligonucleotide thus methylated displays the noteworthy
property of forming a
stable triple helix with the specific sequence in pH ranges closer to
neutrality (> 5). It hence makes it
possible to work at higher pH values than the oligonucleotides of the prior
art, that is to say at pH
values where the risks of degradation of plasmid DNA are much smaller.
The length of the oligonucleotide used in the method of the invention is
between 5 and 30. An
oligonucleotide of length greater than 10 bases is advantageously used. The
length may be adapted by a
person skilled in the art for each individual case to suit the desired
selectivity and stability of the
interaction.
The oligonucleotides according to the invention may be synthesized by any
known technique.
In particular, they may be prepared by means of nucleic acid synthesizers. Any
other method known to
a person skilled in the art may quite obviously be used.
To permit its covalent coupling to the support, the oligonucleotide is
generally functionalized.
Thus, it may be modified by a thiol, amine or carboxyl terminal group at the
5' or 3' position. In
particular, the addition of a thiol, amine or carboxyl group makes it
possible, for example, to couple the
oligonucleotide to a support bearing disulphide, maleimide, amine, carboxyl,
ester, epoxide, cyanogen
bromide or aldehyde functions. These couplings form by establishment of
disulphide, thioether, ester,
amide or amine links between the oligonucleotide and the support. Any other
method known to a
person skilled in the art may be used, such as bifunctional coupling reagents,
for example.
Moreover, to improve the hybridization with the coupled oligonucleotide, it
can be
advantageous for the oligonucleotide to contain an "arm" and a "spacer"
sequence of bases. The use of
an arm makes it possible, in effect, to bind the oligonucleotide at a chosen
distance from the support,
enabling its conditions of interaction with the DNA to be improved. The arm
advantageously consists
of a linear carbon chain, comprising 1 to 18 and preferably 6 or 12 (CH2)
groups, and an amine which
permits binding to the column. The arm is linked to a phosphate of the
oligonucleotide or of a "spacer"
composed of bases which do not interfere with the hybridization. Thus, the
"spacer" can comprise
purine bases. As an example, the "spacer" can comprise the sequence GAGG. The
arm is
advantageously composed of a linear carbon chain comprising 6 or 12 carbon
atoms.
Triplex affinity chromatography is very efficient for removing RNA and genomic
DNA. These
can be functionalized chromatographic supports, in bulk or prepacked in a
column, functionalized
plastic surfaces or functionalized latex beads, magnetic or otherwise.
Chromatographic supports are
preferably used. As an example, the chromatographic supports capable of being
used are agarose,
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
32
acrylamide or dextran as well as their derivatives (such as Sephadex,
Sepharose, Superose, etc.),
polymers such as poly(styrene/divinylbenzene), or grafted or ungrafted silica,
for example. The
chromatography columns can operate in the diffusion or perfusion mode.
To obtain better purification yields, it is especially advantageous to use, on
the plasmid, a
sequence containing several positions of hybridization with the
oligonucleotide. The presence of
several hybridization positions promotes, in effect, the interactions between
the said sequence and the
oligonucleotide, which leads to an improvement in the purification yields.
Thus, for an oligonucleotide
containing n repeats of (CCT), (CT) or (CTT) motifs, it is preferable to use a
DNA sequence containing
at least n complementary motifs, and preferably n+ I complementary motif. A
sequence carrying n+ I
complementary motif thus affords two positions of hybridization with the
oligonucleotide.
Advantageously, the DNA sequence contains up to 11 hybridization positions,
that is to say n+10
complementary motifs.
The method according to the present invention can be used to purify any type
of
double-stranded DNA. An example of the latter is circular DNA, such as a
plasmid, generally carrying
one or more genes of therapeutic importance. This plasmid may also carry an
origin of replication, a
marker gene, and the like. The method of the invention may be applied directly
to a cell lysate. In this
embodiment, the plasmid, amplified by transformation followed by cell culture,
is purified directly after
lysis of the cells. The method of the invention may also be applied to a clear
lysate, that is to say to the
supematant obtained after neutralization and centrifugation of the cell
lysate. It may quite obviously be
applied also to a solution prepurified by known methods. This method also
enables linear or circular
DNA carrying a sequence of importance to be purified from a mixture comprising
DNAs of different
sequences. The method according to the invention can also be used for the
purification of
double-stranded DNA.
The cell lysate can be a lysate of prokaryotic or eukaryotic cells.
As regards prokaryotic cells, the bacteria E. coli, B. subtilis, S.
typhimurium or Strepomyces
may be mentioned as examples. As regards eukaryotic cells, animal cells,
yeasts, fungi, and the like,
may be mentioned, and more especially Kluyveromyces or Saccharomyces yeasts or
COS, CHO, C 127,
NIH3T3, and the like, cells.
The method of the present invention which includes at least a step of triplex
affinity
chromatography may be employed to provide higher purity to the resulting pDNA
product. In triplex
affinity chromatography, an oligonucleotide is bound to a support, such as a
chromatography resin or
other matrix. The sample being purified is then mixed with the bound
oligonucleotide, such as by
applying the sample to a chromatography column containing the oligonucleotide
bound to a
chromatography resin. The desired plasmid in the sample will bind to the
oligonucleotide, forming a
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
33
triplex. The bonds between the oligonucleotide and the plasmid may be
Hoogsteen bonds. This step
may occur at a pH <5, at a high salt concentration for a contact time of 20
minutes or more. A
washing step may be employed. Finally, cytosine deprotonation occurs in a
neutral buffer, eluting the
plasmid from the oligonucleotide-bound resin.
Hydrophobic interaction chromatography uses hydrophobic moieties on a
substrate to attract
hydrophobic regions in molecules in the sample for purification. It should be
noted that these HIC
supports work by a "clustering" effect; no covalent or ionic bonds are formed
or shared when these
molecules associate. Hydrophobic interaction chromatography is beneficial as
it is very efficiently
removes open circular plasmid forms and other contaminants, such as gDNA, RNA,
and endotoxin.
Synthesis of base materials for hydrophobic interaction chromatography, as
well as process for
preparing, polymerizing and functionalizing hydrophobic interaction
chromatography and eluting and
separating plasmid DNA therethrough are well known in the art, and are inter
alia described in US
patent No: 6,441,160 which is incorporated herein by reference.
Compound to be used for the synthesis of base materials that are used for the
packing material
for hydrophobic interaction chromatography may be any compounds, if various
functional groups that
exhibit hydrophobicity or various ion exchange groups can be introduced by a
post-reaction after the
base materials are synthetized. Examples of monofunctional monomers include
styrene, o-
halomethylstyrene, m-halomethylstyrene, p-halomethylstyrene, o-
haloalkylstyrene, m-haloalkylstyrene,
p-haloalkylstyrene, a-methylstyrene, a-methyl-o-halomethylstyrene, a-methyl-m-
halomethylstyrene, a-
methyl-p-halomethylstyrene, a-methyl-o-haloalkylstyrene, a-methyl-m-
haloalkylstyrene, a-methyl-p-
haloalkylstyrene, o-hydroxymethylstyrene, m-hydroxymethylstyrene, p-
hydroxymethylstyrene, o-
hydroxyalkylstyrene, m-hydroxyalkylstyrene, p-hydroxylalkylstyrene, a-methyl-o-
hydroxymethylstyrene, a-methyl-m-hydroxymethylstyrene, a-methyl-p-
hydroxymethylstyrene, a-
methyl-o-hydroxyalkylstyrene, a-methyl-m-hydroxyalkylstyrene, a-methyl-p-
hydroxyalkylstyrene,
glycidyl methacrylate, glycidyl acrylate, hydroxyethyl acrylate,
hydroxymethacrylate, and vinyl acetate.
Most preferred compounds are haloalkyl groups substituted on aromatic ring,
halogens such as Cl, Br, I
and F and straight chain and/or branched saturated hydrocarbons with carbon
atoms of 2 to 15.
Examples of polyfunctional monomers include divinylbenzene, trivinylbenzene,
divinyltoluene,
trivinyltoluene, divinylnaphthalene, trivinylnaphthalene, ethylene glycol
dimethacrylate, ethylene
glycol diacrylate, diethylene glycol dimethacrylate, diethylene glycol
diacrylate,
methylenebismethacrylamide, and methylenebisacrylamide.
Various hydrophobic functional groups or various ion exchange groups may be
introduced by
the post-reaction. In order to minimize the influence on aiming products
desired to separate due to the
hydrophobicity exhibited by the base material itself, or the swelling or
shrinking of the base material
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
34
itself due to the change in salt concentration and the change in pH value, the
base material is preferably
prepared using relatively hydrophilic monomers, such as glycidyl methacrylate,
glycidyl acrylate,
hydroxyethyl acrylate, hydroxymethacrylate, and vinyl acetate. Preparation of
the base material
includes a first step wherein monofunctional monomer and polyfunctional
monomer are weighed out at
an appropriate ratio and precisely weighed-out diluent or solvent which are
used for the purpose of
adjusting the pores in particles formed and similarly precisely weighed-out
polymerization initiator are
added, followed by well stirring. The mixture is then submitted to a oil-in-
water type suspension
polymerization wherein the mixture is added into an aqueous solution dissolved
suspension stabilizer
weighed out precisely beforehand, and oil droplets with aiming size are formed
by mixing with stirrer,
and polymerization is conducted by gradually warming mixed solution.
Ratio of monofunctional monomer to polyfunctional monomer is generally around
1 mol of
monofunctional monomer, and around 0.01 to 0.2 mol of polyfunctional monomer
so as to obtain soft
particles of base material. The ratio of polyfunctional monomer may be
increased to around 0.2 to 0.5
mol so as to obtain hard particles of base materials. Polyfunctional monomer
alone may be used to
obtain ever harder particules.
A polymerization initiator is also not particularly restricted, and azobis
type and/or peroxide
type being used commonly are used.
Suspension stabilizers such as ionic surfactants, nonionic surfactants and
polymers with
amphipathic property or mixtures thereof may also be used to prevent the
aggregation among oil
droplets themselves.
The diameter of formed particles is generally around of 2 to 500 m. Preferred
diameter of the
particles is comprised between 2 to 30 m, and more preferably around 2 to 10
m. When aiming at
large scale purification of nucleic acids with high purity, it is around 10 to
100 m and, when separating
the aiming product from crude stock solution, it may be 100 to 500 m, more
preferably around 200 to
400 m. For adjusting the particle diameter, the rotational speed of stirrer
may be adjusted during
polymerization. When particles with small diameter are needed, the number of
revolutions may be
increased and, when large particles are desired, the number of revolutions may
be decreased. Here,
since the diluent to be used is used for adjusting pores in formed particles,
the selection of diluent is
particularly important. As 3 fundamental concept, for the solvent to be used
for polymerization,
adjustment is made by variously combining a solvent that is poor solvent for
monomer with a solvent
that is good solvent for monomer. The size of pore diameter may be selected
appropriately depending
on the molecular size of nucleic acids designed to separate, but it is
preferable to be within a range of
500 to 4000 angstroms for the packing material for hydrophobic interaction
chromatography and within
a range from 1500 to 4000 angstroms for the packing material for ion exchange
chromatography.
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
In the hydrophobic interaction chromatography, for separating nucleic acids
with different
hydrophobicity preferable by utilizing packing materials with different
hydrophobicity, respectively, the
surface modification of the base material is important.
Hydrophobic groups may be selected among long chain or branched, including
saturated
5 hydrocarbon groups or unsaturated hydrocarbon groups with carbon atoms of 2
to 20. Aromatic ring
may also be contained in the hydrocarbon group.
Hydrophobic groups may also be selected among compounds having the following
formula:
Base _ A(CH2) CmH2m+
materials
wherein n=0 to around 20 and the methylene group may be of straight chain or
branched, m=0
10 to about 3 and hydrocarbon group may be of straight chain or branched, and
A is C=O group or ether
group, but methylene group may be bonded directly to base material without A.
Hydrophobic groups may further include ether group of alkylene glycol with
carbon atoms of 2
to 20, which consists of repeating units of 0 to 10, wherein the opposite end
of functional group reacted
with base material may be OH group left as it is or may be capped with alkyl
group with carbon atoms
15 of 1 to 4.
The above described hydrophobic groups may be used solely or in mixture to
modify the
surface.
Chain of alkyl groups with carbon atoms of 6 to 20 carbon atoms are preferred
for low
hydrophobicity like plasmids. Long chain of alkyl groups having 2 to 15 carbon
atoms for separating
20 compounds with high hydrophobicity such as RNA originating from Escherichia
coli and RNA in the
cells of human and animals. Alkyl groups of 4 to 18 carbon atoms for
separating compounds with
relatively low hydrophobicity such as DNAs originating from Escherichia coli
and DNAs in the cells of
human and animals.
Upon separating these compounds, compounds may be selected appropriately to
modify the
25 surface without being confined to said exemplification. In effect, the
degree of hydrophobicity of
packing material varies depending on the concentration of salt in medium or
the concentration of salt in
eluent for adsorption. In addition the degree of hydrophobicity of packing
material differs depending on
the amount of the group introduced into the base material.
The pore diameter of the base material for hydrophobic interaction
chromatography is
30 particularly preferable to be 500 to 4000 angstroms, but it can be selected
appropriately from said range
depending on the molecular size of nucleic acids desired to separate. In
general, since the retention of
nucleic acids on the packing material and the adsorption capacity (sample
leading) differ depending on
the pore diameter, it is preferable to use a base material with large pore
diameter for nucleic acids with
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
36
large molecular size and a base material with small pore diameter for nucleic
acids with small
molecular size.
For example styrene base material may be reacted with hydrophobic group
comprising long
chain of alkyl groups, using halogen-containing compound and/or carbonyl
halide and catalyst such as
FeCl3, SnCIZ or A1C13, and utilizing Friedel-Craft reaction, it is possible to
add directly to aromatic ring
in base material as dehalogenated compound and/or acylated compound. In the
case of the base material
being particle containing halogen group, for example, using compounds with OH
contained in
functional group to be added, like butanol, and utilizing Williamson reaction
with alkali catalyst such as
NaOH or KOH, it is possible to introduce the functional group through ether
bond. In the case of the
functional group desired to add being amino group-containing compound, like
hexylamine, it is
possible to add using alkali zatalyst such as NaOH or KOH and utilizing
dehalogenic acid reaction. In
the case of the base material containing OH group, inversely, if introducing
epoxy group, halogen group
or carbonyl halide group beforehand into the functional group desired to add,
it is possible to introduce
the functional group through ether or ester bond. In the case of the base
material containing epoxy
group, if reacting with compound with OH group or amino group contained in the
functional group
desired to add, it is possible to introduce the functional group through ether
or amino bond. Moreover,
in the case of the functional group desired to add containing halogen group,
it is possible to add the
functional group through ether bond using acid catalyst. Since the proportion
of functional group to be
introduced into base material is influenced by the hydrophobicity of subject
product desired to separate,
it cannot be restricted, but, in general, packing material with around 0.05 to
4.0 mmol of functional
group added per I g of dried base material is suitable.
With respect to the surface modification, a method of adding the functional
group through post-
reaction after formation of base material or particles is as described.
Surface modification is conducted
according to the same method, where the base material is formed after
polymerization using monomers
with said functional groups added before polymerization.
Base material may also be porous silica gel. A method of manufacturing silica
gel, comprise
silane coupling using a compound such as alkyltrimethoxysilane directly onto
particles manufactured
according to the method described in "Latest High-Speed Liquid
Chromatography", page 289 ff.
(written by Toshio Nambara and Nobuo Ikegawa, published by Tokyo Hirokawa
Bookstore in 1988).
Prior or after coupling the silane using epoxy group-containing silane
coupling agent, a functional
group may be added according to the method aforementioned. Proportion of
functional group that is
introduced around 0.05 to 4.0 mmol of functional group added per I g of dried
base material is suitable.
Eluents are used in the hydrophobic interaction chromatography separation or
purification step.
Generally, two types of eluents are used. One eluent contains high-
concentration of salt, while a second
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
37
eluent contains low-concentration of salt. The eluting method comprises
switching stepwise from an
eluent having high concentration of salt to an eluent having a low
concentration of salt and the gradient
eluting method continuously changing the composition from one eluent to
another may be used. For the
buffers and salts generally used for the hydrophobic interaction
chromatography can be used. For the
eluent containing high-concentration of salt, aqueous solution with salt
concentration of 1.0 to 4.5M
and pH value of 6 to 8 is particularly preferable. For the eluent containing
low-concentration of salt,
aqueous solution with salt concentration of 0.01 to 0.5M and pH value of 6 to
8 is particularly
preferable salts. Generally, ammonium sulfate and sodium sulfate may be used
as salts.
The hydrophobic interaction chromatography plasmid DNA purification step may
be conducted
by combining a packing material introduced the functional group with weak
hydrophobicity with a
packing material introduced the functional group with strong hydrophobicity in
sequence. In effect,
medium cultured Escherichia coli contain in large quantity, various components
different in
hydrophobicity such as polysaccharides, Escherichia coli genome DNA, RNAs
plasmids and proteins.
It is also known that there are differences in the hydrophobicity even among
nucleic acids themselves.
Proteins that become impurities have higher hydrophobicity compared with
plasmids.
Many hydrophobic interaction chromatography resins are available commercially,
such as
Fractogel propyl, Toyopearl, Source isopropyl, or any other resins having
hydrophobic groups. Most
preferred resins are Toyopearl bulk polymeric media. Toyopearl is a
methacrylic polymer incorporating
high mechanical and chemical stability. Resins are available as non-
functionalized "HW" series resins
and may be derivatized with surface chemistries for ion exchange
chromatography or hydrophobic
interactions. Four types of Toyopearl HIC resins featuring different surface
chemistry and levels of
hydrophobicity may be used. The hydrophobicity of Toyopearl HIC resins
increases through the series:
Ether, Phenyl, Butyl, and Hexyl. Structures of preferred Toyopearl HIC resins,
i.e., Toyopearl HW-65
having 1000 angstroms pore diameter are showed below:
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
38
Toyopearl Ether-650 6W - (O-CH2-CH2)õ-OH
HW-
Toyopearl Phenyl-650 -O- CD 65
Toyopearl Butyl-650 6W - O-CH2-CH2-CH2-CH3
Toyopearl Hexyl-650 6w - O-CH2-CH2- CH2-CH2-CH2-CH3
The above described Toyopearl resins may have various particle size grade.
Toyopearl 650C
have a particle size of around 50 to 150 m, preferably around 100 m, while
Toyopearl 650M have a
particle size of around 40 to 90 m, preferably around 65 m and Toyopearl 650S
have a particle size of
around 20 to 50 m, preferably around 35 m. It is well known that particle
size influences resolution,
i.e., resolution improves from C to M to S particle size grade, and thus
increases with smaller particle
sizes. Most preferred Toyopearl resin used in the HIC chromatography step
within the process of
separation and purification of the plasmid DNA according to the present
invention is Toyopearl butyl-
650S which is commercialized by Tosoh Bioscience.
A further diafiltration step may be performed. Standard, commercially
available diafiltration
materials are suitable for use in this process, according to standard
techniques known in the art. A
preferred diafiltration method is diafiltration using an ultrafiltration
membrane having a molecular
weight cutoff in the range of 30,000 to 500,000, depending on the plasmid
size. This step of
diafiltration allows for buffer exchange and concentration is then performed.
The eluate is concentrated
3- to 4-fold by tangential flow filtration (membrane cut-off, 30 kDa) to a
target concentration of about
2.5 to 3.0 mg/mL and the concentrate is buffer exchanged by diafiltration at
constant volume with 10
volumes of saline and adjusted to the target plasmid concentration with
saline. The plasmid DNA
concentration is calculated from the absorbance at 260 nm of samples of
concentrate. Plasmid DNA
solution is filtered through a 0.2 m capsule filter and divided into several
aliquots, which are stored in
containers in a cold room at 2-8 C until further processing. This yields a
purified concentrate with a
plasmid DNA concentration of supercoiled plasmid is around 70%, 75%, 80%, 85%,
90%, 95%, and
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
39
preferably 99%. The overall plasmid recovery with this process is at least
35%, 40%, 45%, 50%, 55%,
60%, 65%, 70%, and 80%, with an average recovery of 60 %.
Such diafiltration step is conducted according the following conditions:
buffer for step a) and
for step b) are used:
i) a first diafiltration (step a) against 12.5 to 13.0 volumes of 50 mM
Tris/HCI, 150 mM NaCI, pH
7.4 (named buffer I), and
ii) Perform a second diafiltration of the retentate from step a) above (step
b) against 3.0 to 3.5
volumes of saline excipient (150 mM NaCI). This preferred diafiltration step
according to the present
invention efficiently and extensively removes ammonium sulfate and EDTA
extensively. Also,
subsequent to this diafiltration steps, appropriate physiological NaCI
concentration (around 150mM)
and final Tris concentration below 1 mM (between 200 M and 1 mM) are
obtained.
Preferably the plasmid DNA composition which is used contain purified plasmid
DNA that is
essentially free of contaminants or in the range of sub-ppm contaminants and
thus is pharmaceutical
grade DNA. The pharmaceutically grade plasmid DNA composition can comprise sub-
ppm (<
0.0001%, i.e. < 0.0001 mg per 100 mg of plasmid DNA) gDNA, RNA, and protein
contaminants
The pharmaceutical grade plasmid DNA composition can comprise less than about
0.01%, or
less than 0.001 %, and preferably less than 0.0001 %, or preferably less than
0.00008% (< 0.0008%, i.e.
< 0.0008 mg per 100 mg of plasmid DNA) of chromosomal DNA or genomic DNA.
The pharmaceutical grade plasmid DNA composition can comprise less than about
0.01%, or
less than 0.001%, and preferably less than 0.0001%, or preferably less than
0.00002% (< 0.0002%, i.e.
< 0.0002 mg per 100 mg of plasmid DNA) of RNA contaminants.
The pharmaceutical grade plasmid DNA composition can comprise a plasmid DNA
preparation
that contains less than about 0.0001%, and most preferably less than 0.00005%
(< 0.00005%, i.e. <
0.00005 mg per 100 mg of plasmid DNA) of host cell protein contaminants.
The pharmaceutical grade plasmid DNA composition can also comprise a plasmid
DNA
preparation that contains less than 0.1 EU/mg endotoxins.
The pharmaceutical grade plasmid DNA composition thus contains predominant
circular in
form, and more precisely contains more than 80%, 85%, 90%, 95%, or 99% of
closed circular form
plasmid DNA.
The pharmaceutical composition may have a detectable level of host cell
genomic DNA of less
than about 0.01% and less than about 0.001% host cell RNA can be included in
the invention. Most
preferably, the pharmaceutical grade plasmid DNA composition can have less
than about 0.00008%
host cell genomic DNA and less than about 0.00002% host cell RNA and less than
about 0.00005%
host cell protein. In fact, any combination of the purity levels noted above
can be employed for any
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
particular pharmaceutical grade plasmid DNA composition under the invention.
The compositions can
also comprise other pharmaceutically acceptable components, buffers,
stabilizers, or compounds for
improving gene transfer and particularly plasmid DNA transfer into a cell or
organism.
Plasmid DNA so obtained may then be formulated according to the present
invention in NaCI
5 as saline excipient and an appropriate concentration of Tris buffer so as to
maintain or control the pH
value between 6.2 and 9, preferably between 6.5 and 8, more preferably 7 and
7.5. Plasmid DNA
formulations according to the present application are particularly useful as
they plasmid DNA may
surprisingly be stored in a stable non-degradable form in these conditions for
prolonged period of time
at 5 C and up to 25 C, that is at room temperature.
10 As stated above, the purified plasmid DNA is present in a solution with
less than or about 0.1
EU/mg endotoxin, less than or about 0.00005% host cell protein contaminant,
less than or about
0.00002% host cell RNA contaminant, and less than or about 0.00008% host cell
genomic DNA
contaminant. A pharmaceutical grade plasmid DNA composition comprises sub-ppm
(< 0.00001 %)
host cell gDNA, RNA, and protein contaminants. More precisely, the
pharmaceutical grade plasmid
15 DNA composition that is essentially free of detectable gDNA, RNA, and
protein contaminants. Also,
the pharmaceutical grade plasmid DNA composition is substantially free of
detectable bacterial host
chromosomal DNA, and thus comprises less than about 0.01%, or less than about
0.001%, or less than
about 0.0001 %, or preferably less than 0.00008% of chromosomal DNA or genomic
DNA. Further, the
pharmaceutical grade plasmid DNA composition that is substantially free of
detectable host cell RNA,
20 and more precisely, comprises less than about 0.01%, or less than 0.001%,
and preferably less than
0.0001 %, or preferably less than 0.00002% of host cell RNA contaminants.
Further, the pharmaceutical
grade plasmid DNA composition is substantially free of detectable host cell
protein contaminants, and
more precisely less than about 0.0001%, and most preferably less than 0.00005%
host cell protein
contaminants. Finally, the pharmaceutical grade plasmid DNA composition that
is substantially free of
25 measurable endotoxin contaminants, and more precisely less than 0.1 EU/mg
endotoxins. The plasmid
DNA is present in substantially supercoiled form, and more precisely comprises
about or more than
99% of closed circular form plasmid DNA.
A step of sterile filtration before filling of vials with the purified plasmid
DNA may be
performed. Vial of purified plasmid DNA obtainable by these methods are also
provided.
30 Purification of any types of vectors having various sizes may be performed.
The size range of
plasmid DNA that may be separated is from approximately 5 kb to approximately
50 kb, preferably 15
kb to 50 kb, which DNA includes a vector backbone of approximately 3 kb, a
therapeutic gene and
associated regulatory sequei-ces. Thus, a vector backbone useful in the
invention may be capable of
carrying inserts of approximately 10-50 kb or larger. The insert may include
DNA from any organism,
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
41
but will preferably be of mammalian origin, and may include, in addition to a
gene encoding a
therapeutic protein, regulatory sequences such as promoters, poly adenylation
sequences, enhancers,
locus control regions, etc. The gene encoding a therapeutic protein may be of
genomic origin, and
therefore contain exons and introns as reflected in its genomic organization,
or it may be derived from
complementary DNA. Such vectors may include for example vector backbone
replicatable with high
copy number replication, having a polylinker for insertion of a therapeutic
gene, a gene encoding a
selectable marker, ejz., SupPhe tRNA, the tetracycline kanamycin resistance
gene, and is physically
small and stable. The vector backbone of the plasmid advantageously permits
inserts of fragments of
mammalian, other eukaryotic, prokaryotic or viral DNA, and the resulting
plasmid may be purified and
used in vivo or ex vivo plasmid-based therapy. Vectors having relatively high
copy number, i.e., in the
range of 20-40 copies/cell up to 1000-2000 copies/cell, may be separated and
purified by the method
according to the present invention. For example, a vector that includes the
pUC origin of replication is
preferred according to the method of the invention. The pUC origin of
replication permits more
efficient replication of plasmid DNA and results in a tenfold increase in
plasmid copy number/cell over,
e.g., a pBR322 origin. Preferably, plasmid DNA with conditional origin of
replication or pCOR as
described in US 2003/1618445, may be separated by the process according to the
present invention.
The resulting high copy number greatly increases the ratio of plasmid DNA to
chromosomal DNA,
RNA, cellular proteins and co-factors, improves plasmid yield, and facilitates
easier downstream
purification. Accordingly, any vector (plasmid DNA) may be used according to
the invention.
Representative vectors include but are not limited to NV 1 FGF plasmid. NV 1
FGF is a plasmid encoding
an acidic Fibroblast Growth Factor or Fibroblast Growth Factor type 1(FGF-1),
useful for treating
patients with end-stage peripheral arterial occlusive disease (PAOD) or with
peripheral arterial disease
(PAD). Camerota et al. (J Vasc. Surg., 2002, 35, 5:930-936) describes that 51
patients with
unreconstructible end-stage PAD, with pain at rest or tissue necrosis, have
been intramuscularly
injected with increasing single or repeated doses of NVIFGF into ischemic
thigh and calf. Various
parameters such as transcutaneous oxygen pressure, ankle and toe brachial
indexes, pains assessment,
and ulcer healing have been subsequently assessed. A significant increase of
brachial indexes, reduction
of pain, resolution of ulcer size, and an improved perfusion after NV 1 FGF
administration are were
observed.
The plasmid DNA composition may further comprise at least one polymer for
improving
plasmid DNA transfer irto a cell. The plasmid DNA composition may also
comprise a
pharmaceutically acceptable vehicle or excipient. The plasmid DNA composition
may be formulated
for delivery by injection, intravenous injection, intramuscular injection,
intratumoral injection, small
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
42
particle bombardment, or topical application to a tissue. The plasmid DNA
within these compositions is
substantially in the form of supercoiled closed circle DNA.
Host cells useful according to the invention may be any bacterial strain,
i.e.1 both Gram positive
and Gram negative strains, such as E. coli and Salmonella Typhimurium or
Bacillus that is capable of
maintaining a high copy number of the plasmids described above; for example 20-
200 copies. E. coli
host strains may be used according to the invention and include HB101, DHI,
and DH5aF, XAC-1 and
XAC-lpir 116, TEX2, and TEX2pir42 (W004/033664). Strains containing the F
plasmid or F plasmid
derivatives (for example JM109) are generally not preferred because the F
plasmid may co-purify with
the therapeutic plasmid product.
Examples
General technigues of cloning and molecular biology
The traditional methods of molecular biology, such as digestion with
restriction enzymes, gel
electrophoresis, transformation in E. coli, precipitation of nucleic acids and
the like, are described in the
literature (Maniatis et al., I., E.F. Fritsch, and J. Sambrook, 1989.
Molecular cloning: a laboratory
manual, second edition. Cold Spring Harbor Laboratory, Cold Spring Harbor
Laboratory Press, New
York; Ausubel F.M., R. Brent, R.E. Kinston, D.D. Moore, J.A. Smith, J.G.
Seidman and K. Struhl.
1987. Current protocols in molecular biology 1987-1988. John Willey and Sons,
New York.).
Nucleotide sequences were determined by the chain termination method according
to the protocol
already published (Ausubel et al., 1987).
Restriction enzymes were supplied by New England Biolabs, Beverly, MA
(Biolabs).
To carry out ligations, DNA fragments are incubated in a buffer comprising 50
mM Tris-HCI
pH 7.4, 10 mM MgClzi 10 mM DTT, 2 mM ATP in the presence of phage T4 DNA
ligase (Biolabs).
Oligonucleotides are synthesized using phosphoramidite chemistry with the
phosphoramidites
protected at the /3 position by a cyanoethyl group (Sinha, N.D., J. Biernat,
J. McManus and H. Koster,
1984. Polymer support oligonucleotide synthesis, XVIII: Use of
P-cyanoethyl-N,N-dialkylamino-/N-morpholino phosphoramidite of
deoxynucleosides for the synthesis
of DNA fragments simplifying deprotection and isolation of the final product.
Nucl. Acids Res., 12,
4539-4557: Giles, J.W. 1985. Advances in automated DNA synthesis. Am.
Biotechnol., Nov./Dec.)
with a Biosearch 8600 automatic DNA synthesizer, using the manufacturer's
recommendations.
Ligated DNAs or DNAs to be tested for their efficacy of transformation are
used to transform
the following strain rendered competent:
E. coli DH5a[F/endAl, hsdR]7, supE44, thi-1, recAl, gyrA96, relAl, A(lacZYA-ar
F U169, deoR,
cD80dlac lacZAM15)] (for any Col El plasmid); or
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
43
E. coli XAC-pir (for any pCor-derived plasmid).
Minipreparations of plasmid DNA are made according to the protocol of Klein et
al., 1980.
LB culture medium is used for the growth of E. coli strains (Maniatis et al.,
1982). Strains are
incubated at 37 C. Bacteria are plated out on dishes of LB medium supplemented
with suitable
antibiotics.
Example 1
The adjustment of the diameters to the flow rates used follows from
calculation of Reynolds
numbers in coils of the continuous lysis system. Because the following
analysis assumes that the
behavior of the fluids is Newtonian, the figures reported below are only fully
valid in Bla and to a
certain extent in B2.
The value of the Reynolds number allows one skilled in the art to specify the
type of behavior
encountered. Here, we will address only fluid flow in a tube (hydraulic
engineering).
1) Non-Newtonian fluid
The two types of non-Newtonian fluids most commonly encountered in industry
are Bingham
and Ostwald de Waele.
In this case, the Reynolds number (Re) is calculated as follows:
ReN is the generalized Reynolds number
ReN=(1 /(23))x(n/3n+1) x((pxDnXWZ"n)/m) (1)
D: inside diameter of the cross section (m)
p: volumetric mass of the fluid (kg/m3)
w: spatial velocity of the fluid (m/s)
n: flow behavior index (dimensionless)
m: fluid consistency coefficient (dyn. s / cmZ )
And n and m are determined empirically (study of rheological behavior).
2) Newtonian fluid
As for the first section, in Equation (1) we have:
Re = f(inside diameter, , p, and u) since n and m are functions of P.
Re(uxDxp)/ (2)
p: Volumetric mass of the fluid (kg/m3)
: Viscosity of the fluid (Pa.s, and I mPa.s = I cP)
D: inside diameter of the cross section (m)
u: mean spatial velocity of the fluid (m/s)
Equation (1), for n=1, reduces to Equation (2).
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
44
With Q = flow rate (m3/h) and S = surface area of the cross section (m2) and
if is given in cP,
then:
Re = (4 x (Q/3600) x p) /((g/1000) x 17 x D) (3)
In a circular conduit, the flow is laminar for a Reynolds number below 2500,
and is
hydraulically smooth turbulent flow for a Reynolds number between 2000 and
500,000. The limit is
deliberately vague between 2000 and 2500, where both types of behavior are
used to determine what
may then occur, and the choice is made aposteriori.
3) Calculations
Since n and m are generally not known, the following approximations have been
used to
estimate the trends:
Newtonian fluid (in all the cross sections)
p = 1000 kg/m3 (for all the fluids)
g= 5 cP in B 1 a and 40 cP in B l b(our data)
2.5 cP in B2 (our data)
The following calculations were performed using Equation (3) for two standard
tubing
configurations tested called configuration 1 and configuration 2 (without Blb
tube):
Table 2
Coil Configuration I Configuration 2
Bla B2 Bla B2
Viscosity* (eP) 5 2.5 5 2.5
Diameter (mm) 12.7 9.5 6 6
Flow rate (L/h) 60 105 12 21
Reynolds number 334 1564 141 495
Process laminar laminar laminar laminar
In these two configurations, the flows are laminar at all stages and the
solutions are not
adequately mixed together.
For other tubing configurations (no B 1 b tube), we have:
Table 3
Coil High speed / std diameter High speed / 16 mm ID High speed / 6 mm ID
Bla B2 Bla B2 Bla B2
Viscosity* (cP) 5 2.5 5 2.5 5 2.5
Diameter (mm) 12 10 16 16 6 6
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
Flow rate (L/h) 120 210 120 210 120 210
Reynolds number 707 2971 531 1857 1415 4951
Process laminar turbulent laminar laminar laminar turbulent
Similar calculations were performed using Equation (3) for various tubing
configurations with
both B 1 a and B 1 b tubes present:
Table 4
Coil High speed High speed / max agitation
Bla Blb B2 Bla Bla Bla
Viscosity* (cP) 5 5 2.5 5 5 5
Diameter (mm) 6 16 6 3 2 3
Flow rate (L/h) 120 120 210 120 120 160
Reynolds number 1415 531 4951 2829 4244 3773
Process laminar laminar turbulent turbulent turbulent turbulent
5 Clearly, predefined Reynolds values can be obtained by adjusting the tube
diameters and the
flow rates.
One skilled in the art can envision many combinations of diameters and lengths
for B2 or for
the two sections of B 1(B 1 a and B 1 b). For example, the first section of B
1 can be reduced from 6 mm
to 3 mm in order to reduce the length and increase the agitation.
Additionally, n and m may be
10 determined from the study of the rheological behavior of the fluids and
used to determine the right
characteristics of the tubes.
Besides the agitation efficiency, one may also consider the duration of the
agitation, which in
some embodiments of the present invention is obtained by adjusting the length
of the coils.
The diameter of the cubes or the fluid velocity does not appear to dominate in
Equation (1) for a
15 non-Newtonian fluid (data not shown). In other words, it does not seem to
be more effective to alter the
diameter than it is to alter the flow rate if equation (1) is used for
calculations within Blb and in B2.
Where high flow rates are desirable, the diameter can be varied along with the
flow rate.
These principles can be used as a basis for limiting agitation as much as
possible in Blb and B2
in order to avoid fragmenting gDNA.
20 During lysis, agitation can be quite vigorous as long as gDNA is not
denatured. Reducing the
diameter at the beginning of B 1 makes it possible to increase agitation
(increased Re) in order to
sufficiently mix solution 2 with the cells. On the other hand, when the cells
are lysed, agitation and
frictional forces against the wall may be reduced to avoid nucleic acid
fragmentation. Increasing the
diameter makes it possible to reduce agitation (decreased Re) and friction
(lowered velocity).
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
46
M1: mixing the fluids.
B 1 a: fine-tuning the mixing at the beginning of lysis: convection phenomenon
(macromixing).
Blb: letting denaturation occur plus diffusion phenomenon (micromixing).
It is assumed that the generalized Reynolds number has the same meaning for a
non-Newtonian
fluid as the classical Reynolds number has for a Newtonian fluid. In
particular, it is assumed that the
limit for the laminar regime in a conduit of circular cross section is ReN <
2300.
Neutralization is performed within B2. High flow rates tend to increase the
fragmentation of
genomic DNA by causing agitation that is too vigorous and by frictional forces
at the wall (mechanical
stresses). Using a large diameter tube makes it possible to reduce agitation
(Re) and frictional forces
(velocity). We positioned here a small diameter tube (6 mm) to avoid having
not enough agitation. Our
observations show it is best having only a small diameter tube for B2, in
order to "violently and
quickly" agitate the neutralized lysate.
Example 2
We can break down the CL system into 5 steps. In one particular embodiment,
the
configuration is as follows:
1) Mixing: cells (in solution 1) + solution 2(M1 + 3 m of 6 mm tube).
Beginning of lysis of
the cells by SDS, no risk of fragmenting DNA as long as it is not denatured.
2) End of lysis and denaturation of gDNA (13 m of 16 mm tube).
3) Mixing: Lysate + solution 3 (M2 + 3 m of 6 mm tube).
4) Harvesting the neutralized lysate at 4 C
5) Settling down of flocs and large fragments of gDNA overnight at 4 C.
The following conditions may be used to carry out continuous lysis:
- Solution 1: EDTA 10 mM, glucose (Glc) 9 g/1 and Tris HC125 mM, pH 7.2.
- Solution 2: SDS 1% and NaOH 0.2 N.
- Solution 3: Acetic acid 2 M and potassium acetate 3M.
- Flow rate 601/h: Solution 1 and solution 2
- Flow rate 901/h: Solution 3.
- Cells adjusted to 38.5 g/1 with solution 1.
The cells in solution I pass through 3 nozzles that disperse them into
solution 2, which arrives
from the opposite direction.
- Mixer M1 has a geometry making it possible to optimize mixing of the two
fluids (see Figure
2, schematic drawing of mixer).
- The first section of the tube after mixer M 1 is B 1 a and the next section
is B 1 b.
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
47
Bla: 3 m long, 6 mm diameter, 2.5 sec residence time
Blb: 13 m long, 16 mm diameter, 77 sec residence time
The process of the present invention provides an advantage in terms of
efficiency, summarized
as: dispersion, brief violent mixing, and gentle mixing by diffusion.
Using the process of the present invention, the number of cells lysed is
increased and therefore
the quantity of plasmid DNA recovered is increased.
The idea of diffusion is especially important because of the difficulty of
mixing these fluids due
to their properties, in particular the viscoelasticity.
The process of the present invention makes it possible to limit shear stress
and therefore to limit
fragmentation of gDNA, facilitating its removal during subsequent
chromatographic purification.
The problem is then mixing with solution 3, which may be cooled down to 4 C.
In one
embodiment, the process of the invention uses:
- Mixer M2, which is a Y of inside diameter of about 10 mm
- The section of the tube B2 placed after mixer M2.
B2: 2 m of 6 mm tube; residence time: I sec
Table 5 below gives the results obtained in comparative tests to show the
advantages of our
continuous lysis process compared to batch lysis.
Table 5
Ratio gDNA/pDNA in lysate Quantity of plasmid
extracted per g of cell
(mg/g)
Batch lysis 16.9 1.4
Continuous lysis with CL system
1.6 1.9
described in example I
Example 3
The column used is a I ml HiTrap column activated with NHS (N-
hydroxysuccinimide,
Pharmacia) connected to a peristaltic pump (output < I ml/min. The specific
oligonucleotide used
possesses an NH2 group at the 5' end, its sequence is as follows:
5'-GAGGCTTCTTCTTCTTCTTCTTCTT-3' (SEQ ID NO: 1)
The buffers used in this example are the following:
Coupling buffer: 0.2. M NaHCO3, 0.5 M NaCI, pH 8.3.
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
48
Buffer A: 0.5 M ethanolamine, 0.5 M NaCI, pH 8.3.
Buffer B: 0.1 M acetate, 0.5 M NaCI, pH 4.
The column is washed with 6 ml of 1 mM HCI, and the oligonucleotide diluted in
the coupling
buffer (50 nmol in I ml) is then applied to the column and left for 30 minutes
at room temperature. The
column is washed three times in succession with 6 ml of buffer A and then 6 ml
of buffer B. The
oligonucleotide is thus bound covalently to the column through a CONH link.
The column is stored at
4 C in PBS, 0.1 % NaN3, and may be used at least four times.
The following two oligonucleotides were synthesized: oligonucleotide 4817:
5'-GATCCGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAA
GAAGAAGG-3' (SEQ ID NO: 13) and oligonucleotide 4818 5'-AATTCCTTCTT
CTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCG-3' (SEQ ID NO: 14)
These oligonucleotides, when hybridized and cloned into a plasmid, introduce a
homopurine-homopyrimidine sequence (GAA)17 (SEQ ID NO: 15) into the
corresponding plasmid, as
described above.
The sequence corresponding to these two hybridized oligonucleotides is cloned
at the multiple
cloning site of plasmid pBKS+ (Stratagene Cloning System, La Jolla CA), which
carries an
ampicillin-resistance gene. To this end, the oligonucleotides are hybridized
in the following manner:
one g of these two oligonucleotides are placed together in 40 ml of a final
buffer comprising 50 mM
Tris-HCI pH 7.4, 10 mM MgC12. This mixture is heated to 95 C and then placed
at room temperature
so that the temperature falls slowly. Ten ng of the mixture of hybridized
oligonucleotides are ligated
with 200 ng of plasmid pBKS+ (Stratagene Cloning System, La Jolla CA) digested
with BamHI and
EcoRI in 30 l final. After ligation, an aliquot is transformed into DH5a. The
transformation mixtures
are plated out on L medium supplemented with ampicillin (50 mg/1) and X-gal
(20 mg/1). The
recombinant clones should display an absence of blue colouration on this
medium, contrary to the
parent plasmid (pBKS+) which permits a-complementation of fragment w of E.
coli /3-galactosidase.
After minipreparation of plasmid DNA from 6 clones, they all displayed the
disappearance of the Pstl
site located between the EcoRl and BamHl sites of pBKS+, and an increase in
molecular weight of the
448-bp PvuII band containing the multiple cloning site. One clone is selected
and the corresponding
plasmid designated pXL2563. The cloned sequence is verified by sequencing
using primer -20
(5'-TGACCGGCAGCAAAATG-3' (SEQ ID NO: 16)) (Viera J. and J. Messing. 1982. The
pUC
plasmids, an M13mp7-derived system for insertion mutagenesis and sequencing
with synthetic
universal primers. Gene, 19, 259-268) for plasmid pBKS+ (Stratagene Cloning
System, La Jolla CA).
Plasmid pXL2563 is purifed according to Wizard Megaprep kit (Promega Corp.
Madison, WI)
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
49
according to the supplier's recommendations. This plasmid DNA preparation is
used in examples
described below.
Plasmid pXL2563 is purified on the HiTrap column coupled to the
oligonucleotide, described in
1.1., from a solution also containing plasmid pBKS+.
The buffers used in this purification are the following:
Buffer F: 2 M NaCI, 0.2 M acetate, pH 4.5 to 5.
Buffer E: I M Tris-HCI, pH 9, 0.5 mM EDTA.
The column is washed with 6 ml of buffer F, and the plasmids (20 g of pXL2563
and 20 g of
pBKS+ in 400 l of buffer F) are applied to the column and incubated for 2
hours at room temperature.
The column is washed with 10 ml of buffer F and elution is then carried out
with buffer E. The
plasmids are detected after electrophoresis on 1% agarose gel and ethidium
bromide staining. The
proportion of the plasmids in the solution is estimated by measuring their
transforming activity on E.
coli.
Starting from a mixture containing 30 % of pXL2563 and 70 % of pBKS+, a
solution
containing 100 % of pXL2563 is recovered at the column outlet. The purity,
estimated by the OD ratio
at 260 and 280 nm, rises from 1.9 to 2.5, which indicates that contaminating
proteins are removed by
this method.
Example 4
Coupling of the oligonucleotide (5'-GAGGCTTCTTCTTCTTCTTCTTCTT-3' (SEQ ID NO:
1)) to the column is performed as described in Example 3. For the coupling,
the oligonucleotide is
modified at the 5' end with an amine group linked to the phosphate of the
spacer by an arm containing 6
carbon atoms (Modified oligonucleotide Eurogentec SA, Belgium). Plasmid
pXL2563 is purified using
the Wizard Megaprep kit (Promega Corp., Madison, WI) according to the
supplier's recommendations.
The buffers used in this example are the following:
Buffer F: 0-2 M NaCI, 0.2 M acetate, pH 4.5 to 5.
Buffer E: 1 M Tris-HCI pH 9,0.5 mM EDTA.
The column is washed with 6 ml of buffer F, and 100 g of plasmid pXL2563
diluted in 400 l
of buffer F are then applied to the column and incubated for 2 hours at room
temperature. The column
is washed with 10 ml of buffer F and elution is then carried out with buffer
E. The plasmid is
quantified by measuring optical.density at 260 nm.
In this example, binding is carried out in a buffer whose molarity with
respect to NaCI varies
from 0 to 2 M (buffer F). The purification yield decreases when the molarity
of NaCI falls. The pH of
the binding buffer can vary from 4.5 to 5, the purification yield being better
at 4.5. It is also possible to
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
use another elution buffer of basic pH: elution is thus carried out with a
buffer comprising 50 mM
borate, pH 9, 0.5 mM EDTA.
Coupling the oligonucleotide (5'-GAGGCTTCTTCTTCTTCTTCTTCTT-3' (SEQ ID NO: 1)
to the
column is carried out as described in Example 3. Plasmid pXL2563 is purified
using the Wizard
5 Megaprep kit (Promega Corp., Madison, WI) according to the supplier's
recommendations. The buffers
used in this example are the following:
Buffer F: 0.1 M NaCI, 0.2 M acetate, pH 5.
Buffer E: I M Tris-HCI pH 9, 0.5 mM EDTA.
The column is washed with 6 ml of buffer F, and 100 g of plasmid pXL2563
diluted in 400 l
10 of buffer F are then applied to the column and incubated for one hour at
room temperature. The column
is washed with 10 ml of buffer F and elution is then carried out with buffer
E. The content of genomic
or chromosomal E. coli DNA present in the plasmid samples before and after
passage through the
oligonucleotide column is measured. This genomic DNA is quantified by PCR
using primers in the E.
coli ag1K gene. According to the following protocol: The sequence of these
primers is described by
15 Debouck et al. (Nucleic Aci(Is Res. 1985, 13,_1841-1853):
5'-CCG AAT TCT GGG GAC CAA AGC AGT TTC-3' (SEQ ID NO: 17)
and 5'-CCA AGC TTC ACT GTT CAC GAC GGG TGT-3' (SEQ ID NO: 18).
The reaction medium comprises, in 25 l of PCR buffer (Promega France,
Charbonnieres): 1.5 mM
MgC12i 0.2 mM dXTP (Pharmacia, Orsay); 0.5 M primer; 20 U/ml Taq polymerase
(Promega). The
20 reaction is performed according to the sequence:
- 5 min at 95 C
- 30 cycles of 10 sec at 95 C
30 sec at 60 C
I min at 78 C
25 - 10 min at 78 C.
The amplified DNA fragment 124 base pairs in length is separated by
electrophoresis on 3 % agarose
gel in the presence of SybrGreen I (Molecular Probes, Eugene, USA), and then
quantified by reference
to an Ultrapur genomic DNA series from E. coli strain B (Sigma, ref D4889).
30 Example 5
This example describes plasmid DNA purification from a clear lysate of
bacterial culture, on
the so-called "miniprep" scale: 1.5 ml of an overnight culture of DH5a strains
containing plasmid
pXL2563 are centrifuged, and the pellet is resuspended in 100 l of 50 mM
glucose, 25 mM Tris-HCI,
pH 8, 10 mM EDTA. 200 l of 0.2 M NaOH, 1% SDS are added, the tubes are
inverted to mix, 150 l
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
51
of 3 M potassium acetate, pH 5 are then added and the tubes are inverted to
mix. After centrifugation,
the supernatant is recovered and loaded onto the oligonucleotide column
obtained as described in
Example 1. Binding, washes and elution are identical to those described in
Example 3. Approximately
I g of plasmid is recovered from 1.5 ml of culture. The plasmid obtained,
analysed by agarose gel
electrophoresis and ethidium bromide staining, takes the form of a single band
of "supercoiled" circular
DNA. No trace of high molecular weight (chromosomal) DNA or of RNA is
detectable in the plasmid
purified by this method.
Example 6
1 This example describes a plasmid DNA purification experiment carried out
under the same
conditions as Example 5, starting from 20 ml of bacterial culture of DH5a
strains containing plasmid
pXL2563. The cell pellet is taken up in 1.5 ml of 50 mM glucose, 25 mM Tris-
HCI, pH 8, 10 mM
EDTA. Lysis is carried out with 2 ml of 0.2 M NaOH, 1% SDS, and neutralization
with 1.5 ml of 3 M
potassium acetate, pH 5. The DNA is then precipitated with 3 ml of 2-propanol,
and the pellet is taken
up in 0.5 ml of 0.2 M sodium acetate, pH 5, 0.1 M NaCI and loaded onto the
oligonucleotide column
obtained as described in the above Example. Binding, washing of the column and
elution are carried
out as described in the above Example, except for the washing buffer, the
molarity of which with
respect to NaCI is 0.1 M. The plasmid obtained, analysed by agarose gel
electrophoresis and ethidium
bromide staining, takes the form of a single band of "supercoiled" circular
DNA. No trace of high
molecular weight (chromosomal) DNA or of RNA is detectable in the purified
plasmid. Digestion of
the plasmid with a restriction enzyme gives a single band at the expected
molecular weight of 3
kilobases. The plasmid contains a cassette containing the cytomegalovirus
promoter, the gene coding
for luciferase and the homopurine-homopyrimidine sequence (GAA)17 (SEQ ID NO:
15) originating
from plasmid pXL2563. The strain DH1 (Maniatis et al., 1989) containing this
plasmid is cultured in a
7-litre fermenter. A clear lysate is prepared from 200 grams of cells: the
cell pellet is taken up in 2
litres of 25 mM Tris, pH 6.8, 50 mM glucose, 10 mM EDTA, to which 2 litres of
0.2 M NaOH, 1%
SDS, are added. The lysate is neutralized by adding one litre of 3M potassium
acetate. After
diafiltration, 4 ml of this lysate are applied to a 5 ml HiTrap-NI4S column
coupled to the
oligonucleotide of sequence 5'-GAGGCTTCTTCTTCTTCTTCTTCTT-3' (SEQ ID NO: 1),
according
to the method described in Example 3. Washing and elution are carried out as
described in the above
Example.
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
52
Example 7
This example describes the use of an oligonucleotide bearing methylated
cytosines. The
sequence of the oligonucleotide used is as follows:
5' -GAGGM CTTMeCTTMeCTTMeC.TTMeCCTM CTTMeCTT-3' (SEQ ID NO: 19)
This oligonucleotide possesses an NHZ group at the 5' end. m'C = 5-
methylcytosine. This
oligonucleotide enables plasmid pXL2563 to be purified under the conditions of
Example I with a
binding buffer of pH 5 (the risk of degradation of the plasmid is thereby
decreased).
Example 8
In the above examples, the oligonucleotide used is modified at the 5'-terminal
end with an
amine group linked to the phosphate through an arm containing 6 carbon atoms:
NH2-(CH2)6. In this
example, the amine group is linked to the phosphate of the 5'-terminal end
through an arm containing
12 carbon atoms: NH2-(CH2)12. Coupling of the oligonucleotide and passage
through the column are
carried out as described in Example 3 with a buffer F: 2 M NaCI, 0.2 M
acetate, pH 4.5. This
oligonucleotide makes it possible to have better purification yields: a 53 %
yield is obtained, whereas,
with the oligonucleotide containing 6 carbon atoms, this yield is of the order
of 45 % under the same
conditions.
Example 9
Following the cloning strategy described in Example 3, another two plasmids
carrying
homopurine-homopyrimidine sequences are constructed: the plasmid pXL2725 which
contains the
sequence (GGA)16, (SEQ ID NO: 20) and the plasmid pXL2726 which contains the
sequence (GA)25
(SEQ ID NO: 21).
Plasmids pXL2725 and pXL2726, analogous to plasmid pXL2563, are constructed
according to
the cloning strategy described in Example 3, using the following
oligonucleotide pairs:
5986: 5'-GATCC(GA)25GGG-3' (SEQ ID NO: 22)
5987: 5'-AATTCCC(TC)25G-3' (SEQ ID NO: 23)
5981: 5'-GATCC(GGA)17GG-3' (SEQ ID NO: 24)
5982: 5'-AATT(CCT)17CCG-3' (SEQ ID NO: 25)
The oligonucleotide pair 5986 and 5987 is used to construct plasmid pXL2726 by
cloning the
oligonucleotides at the BamHl and EcoRI sites of pBKS+ (Stratagene Cloning
System, La Jolla CA),
while the oligonucleotides 5981 and 5982 are used for the construction of
plasmid pXL2725. The same
experimental conditions as for the construction of plasmid pXL2563 are used,
and only the
oligonucleotide pairs are changed. Similarly, the cloned sequences are
verified by sequencing on the
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
53
plasmids. This enabled it to be seen that plasmid pXL2725 possesses a
modification relative to the
expected sequence: instead of the sequence GGA repeated 17 times, there is
GGAGA(GGA)15 (SEQ
ID NO: 26).
Example 10
The oligonucleotides forming triple helices with these homopurine sequences
are coupled to
HiTrap columns according to the technique described in Example 1.1. The
oligonucleotide of sequence
5'-AATGCCTCCTCCTCCTCCTCCTCCT-3' (SEQ ID NO: 27) is used for the purification
of plasmid
pXL2725, and the oligonucleotide of sequence
5'-AGTGCTCTCTCTCTCTCTCTCTCTCT-3' (SEQ ID NO: 28) is used for the purification
of plasmid
pXL2726.
The two columns thereby obtained enabled the corresponding plasmids to be
purified according
to the technique described in Example 2, with the following buffers:
Buffer F: 2 M NaCl, 0.2 M acetate, pH 4.5.
Buffer E: I M Tris-HCI, pH 9,0.5 mM EDTA.
The yields obtained are 23 % and 31 % for pXL2725 and pXL2726, respectively.
Example 11
This example illustrates the influence of the length of the specific sequence
present in the
plasmid on the purification yields.
The reporter gene used in these experiments to demonstrate the activity of the
compositions of
the invention is the gene coding for luciferase (Luc).
The plasmid pXL2621 contains a cassette containing the 661-bp cytomegalovirus
(CMV)
promoter cloned upstream of the gene coding for luciferase, at the MIuI and
HindIII sites, into the
vector pGL basic Vector (Promega Corp., Madison, WI). This plasmid is
constructed using standard
techniques of molecular biology.
The plasmids pXL2727-1 and pXL2727-2 are constructed in the following manner:
Two micrograms of plasmid pXL2621 were linearized with BamHI; the enzyme was
inactivated by treatment for 10 min at 65 C; at the same time, the
oligonucleotides 6006 and 6008 are
hybridized as described for the construction of plasmid pXL2563.
6006: 5'-GATCT(GAA)17CTGCAGATCT-3' (SEQ ID NO: 29)
6008: 5'-GATCAGATCTGCAG(TTC)17A-3' (SEQ ID NO: 30).
This hybridization mixture is cloned at the BamHI ends of plasmid pXL2621 and,
after
transformation into DH5a, recombinant clones are identified by Pstl enzymatic
restriction analysis,
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
54
since the oligonucleotides introduce a PstI site. Two clones are selected, and
the nucleotide sequence of
the cloned fragment is verified using the primer (6282, 5'-
ACAGTCATAAGTGCGGCGACG-3' (SEQ
ID NO: 31)) as a sequencing reaction primer (Viera J. and J. Messing, 1982).
The pUC plasmids an
M13mp7-derived system for insertion mutagenesis and sequencing with synthetic
universal primers.
(Gene 19:259-268).
The first clone (pXL2727-1) contains the sequence GAA repeated 10 times. The
second
(pXL2727-2) contains the sequence 5'-GAAGAAGAG(GAA)7GGAAGAGAA-3' (SEQ ID NO:
32).
A column such as the one described in Example 3, and which is coupled to the
oligonucleotide
5'-GAGGCTTCTTCTTCTTCTTCTTCTT-3' (SEQ ID NO: 1), is used.
The plasmid pXL2727-1 carries 14 repeats of the sequence GAA. The
oligonucleotide
described above, which contains only 7 repeats of the corresponding
hybridization sequence CTT, can
hence hybridize with the plasmid at 8 different positions. Plasmid pXL2727-2,
in contrast, possesses a
hybridizing sequence (GAA)7 (SEQ ID NO: 36) of the same length as that of the
oligonucleotide bound
to the column. This oligonucleotide can hence hybridize at only one position
on pXL2727-2.
The experiment is identical to the one described in Example 4, with the
following buffers:
Buffer F: 2 M NaCI, 0.2 M acetate, pH 4.5.
Buffer E: I M Tris-HCI, pH 9,0.5 mM EDTA.
The purification yield is 29 % with plasmid pXL2727-1 and 19 % with pXL2727-2.
The cells used are NIH 3T3 cells, inoculated on the day before the experiment
into 24-well
culture plates on the basis of 50,000 cells/well. The plasmid is diluted in
150 mM NaCI and mixed with
the lipofectant RPR115335. A lipofectant positive charges/DNA negative charges
ratio equal to 6 is
used. The mixture is vortexed, left for ten minutes at room temperature,
diluted in medium without
foetal calf serum and then added to the cells in the proportion of 1 g of DNA
per culture well. After
two hours at 37 C, 10 % volume/volume of foetal calf serum is added and the
cells are incubated for 48
hours at 37 C in the presence of 5 % of CO2. The cells are washed twice with
PBS and the luciferase
activity is measured accordiiig to the protocol described (Promega kit,
Promega Corp. Madison, WI) on
a Lumat LB9501 luminometer (EG and G Berthold, Evry). Plasmid pXL2727-1,
purified as described
in Example 8.2, gives transfection yields twice as large as those obtained
with the same plasmid
purified using the Wizard Megaprep kit (Promega Corp. Madison, WI).
Example 12
The following example demonstrates the purification of pCOR-derived plasmids
using
triple-helix affinity chromatography. This technology has been shown to remove
nucleic acid
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
contaminants (particularly host genomic DNA and RNA) down to levels that have
not been achieved
with conventional chromatography methods.
A triplex affinity gel is synthesized with Sephacryl S-1000 SF (Amersham-
Pharmacia Biotech)
as the chromatography matrix. Sephacryl S-1000 is first activated with sodium
m-periodate (3 mM,
5 room temperature, 1 h) in 0.2 M sodium acetate (pH 4.7). Then the
oligonucleotide is coupled through
its 5'-NH2 terminal moiety to aldehyde groups of the activated matrix by
reductive amination in the
presence of ascorbic acid (5 mM) as described previously for the coupling of
proteins (Hornsey et al., J.
Immunol. Methods, 1986, 93, 83-88). The homopyrimidine oligonucleotide used
for these experiments
(from Eurogentec, HPLC-purified) had a sequence which is complementary to a
short 14-mer
10 homopurine sequence (5'-AAGAAAAAAAAGAA-3') (SEQ ID NO: 10) present in the
origin of
replication (oriy) of the pCOR plasmid (Soubrier et al., Gene Therapy, 1999,
6, 1482-1488). As
discussed above, the sequence of the homopyrimidine oligonucleotide is 5'-
TTCTTTTTTTTCTT-3'
(SEQ ID NO: 11).
The following plasmids are chromatographed: pXL3296 (pCOR with no transgene,
2.0 kpb),
15 pXL3179 (pCOR-FGF, 2.4 kpb), pXL3579 (pCOR-VEGFB, 2.5 kbp), pXL3678 (pCOR-
AFP, 3.7 kbp),
pXL3227 (pCOR-lacZ 5.4 kbp) and pXL3397 (pCOR-Bdeleted FVIII, 6.6 kbp). All
these plasmids are
purified by two anion-exchange chromatography steps from clear lysates
obtained as described in
example 4. Plasmid pBKS+ (pBluescript II KS + from Stratagene), a ColEl-
derived plasmid, purified
by ultracentrifugation in CsCI is also studied. All plasmids used are in their
supercoiled (> 95 %)
20 topological state or form.
In each plasmid DNA purification experiment, 300 g of plasmid DNA in 6 ml of
2 M NaCI,
0.2 M potassium acetate (pH 5.0) is loaded at a flow rate of 30 cm/h on an
affinity column containing
the above-mentioned oligonucleotide 5'-TTCTTTTTTTTCTT-3' (SEQ ID NO: 11).
After washing the
column with 5 volumes of the same buffer, bound plasmid is eluted with I M
Tris/HCI, 0.5 mM EDTA
25 (pH 9.0) and quantitated by UV (260 nm) and ion-exchange chromatography
with a Millipore Gen-Pak
column (Marquet et al., BioPharm, 1995, 8, 26-37). Plasmid recoveries in the
fraction collected are 207
g for pXL3296, 196 g for pXL3179, 192 g for pXL3579, 139 g for pXL3678, 97
g for pXL 3227,
and 79 gg for pXL 3397.
No plasmid binding could be detected (< 3 g) when pBKS is chromatographed
onto this
30 column. This indicates that oligonucleotide 5'-TTCTTTTTTTTCTT-3' (SEQ ID
NO: 11) makes stable
triplex structures with the complementary 14-mer sequence 5'-AAGAAAAAAAAGAA-3'
(SEQ ID
NO: 10) present in pCOR (oriy), but not with the closely related sequence 5'-
AGAAAAAAAGGA-3'
(SEQ ID NO: 8) present in pBKS. This indicates that the introduction of a
single non-canonical triad
(T*GC in this case) results in a complete destabilization of the triplex
structure.
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
56
As a control, no plasmid binding (< 1 g) was observed when pXL3179 is
chromatographed on
a blank column synthesized under strictly similar conditions but without
oligonucleotide.
By operating this affinity purification column in the conditions reported
here, the level of
contamination by host genomic DNA was reduced from 2.6 % down to 0.07 % for a
preparation of
pXL3296. Similarly the level of contamination by host DNA is reduced from 0.5
% down to 0.008 %
for a preparation of pXL3179 when the sample is chromatographed through the
same affinity column.
Example 13
The following example demonstrates the purification of ColEl-derived plasmids
using
triple-helix affinity chromatography. This technology has been shown to remove
nucleic acid
contaminants (particularly host genomic DNA and RNA) down to levels that have
not been achieved
with conventional chromatography methods.
A triplex affinity gel is synthesized by coupling of an oligonucleotide having
the sequence
5'-TCTTTTTTTCCT-3' (SEQ ID NO: 9) onto periodate-oxidized Sephacryl S-1000 SF
as described in
the above Example.
Plasmids pXL3296 (pCOR with no transgene) and pBKS, a ColEl-derived plasmid,
are
chromatographed on a 1-mi column containing oligonucleotide 5'-TCTTTTTTTCCT-3'
(SEQ ID NO:
9) in conditions described in Example 9. Plasmid recoveries in the fraction
collected are 175 g for
pBKS and <1 g for pXL3296. This indicates that oligonucleotide 5'-
TCTTTTTTTCCT-3' (SEQ ID
NO: 9) makes stable triplex structures with the complementary 12-mer sequence
(5'-AGAAAAAAAGGA-3') (SEQ ID NO: 8) present in pBKS, but not with the very
closely related
12-mer sequence (5'-AGAAAAAAAAGA-3') (SEQ ID NO: 34) present in pCOR. This
indicates that
the introduction of a single non-canonical triad (C*AT in this case) may
result in complete
destabilization of the triplex structure.
Example 14
A seed culture is produced in an unbaffled Erlenmeyer flask by the following
method. The
working cell bank is inoculated into an Erlenmeyer flask containing M9modG5
medium, at a seed rate
of 0.2%v/v. The strain is cultivated at 220 rpm in a rotary shaker at 37 1
C for about 18 2 hours
until glucose exhaustion. This results in a 200 mi seed culture. The optical
density of the culture is
expected to be A600 around 2-3.
A pre-culture in a first fermentor is then created. The seed culture is
aseptically transferred to a
pre-fermentor containing M9modG5 medium to ensure a seed rate of 0.2% (v/v)
and cultivated under
aeration and stirring. The pO2 is maintained above 40% of saturation. The
culture is harvested when
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
57
the glucose is consumed after 16 hours. This results in about 30 liters of pre-
culture. The optical
density of the culture is expected to be A600 around 2-3.
A main culture is then created in a second fermentor. 30 liters of preculture
are aseptically
transferred to a fermentor filled with 270 liters of sterilized FmodG2 medium
to ensure a seed rate of
about 10% (v/v). The culture is started on a batch mode to build some biomass.
Glucose feeding is
started once the initial sugar is consumed after about 4 hours. Aeration,
stirring, pO2 (40%), pH (6.9
0.1), temperature (37 1 C) and glucose feeding are controlled in order to
maintain a specific growth
rate close to 0.09h"'. The calture is ended after about 35 hours of feeding.
This results in about 400
liters of culture. The optical density of the culture is expected to be A600
of about 100.
A first separation step is performed, which is called cell harvest. The
biomass is harvested with
a disk stack centrifuge. The broth is concentrated 3- to 4-fold to eliminate
the spent culture medium
and continuously resuspended in 400 liters of sterile S1 buffer. This results
in about 500 liters of pre-
conditioned biomass. DCW = 25 5 g/L.
A second separation step is performed, which is called a concentration step.
After
resuspension/homogenization in S1 buffer, the cells are processed again with
the separator to yield
concentrated slurry. This results in about 60-80 liters of washed and
concentrated slurry. DCW = 150
30 g/L ; plasmid DNA = 300 60 mg/L.
A freezing step is then performed. The slurry is aseptically dispatched into
20-L FlexboyTM
bags (filled to 50% of their capacity) and subsequently frozen at -20 5 C
before further downstream
processing. This results in a frozen biomass. pDNA = 300 60 mg/L ;
supercoiled form > 95 %.
A cell thawing step is then performed. The frozen bags are warmed up to 20 C
and the cell
slurry is diluted to 40 g/L, pH 8.0 with 100 mM Tris hydrochloride, 10 mM
EDTA, 20 mM glucose and
the suspension is left at 20 2 C for 1 h under agitation before cell lysis.
This results in thawed
biomass slurry. pH=8.0 0.2.
Temperatures around 20 C may be used during this step.
An alkaline lysis step is then performed. The cell lysis step is comprised of
pumping the
diluted cell suspension via an in-line mixer with a solution of 0.2 N NaOH-35
mM SDS (solution S2),
followed by a continuous contact step in a coiled tubing. The continuous
contact step is to ensure
complete cell lysis and denaturation of genomic DNA and proteins. The solution
of lysed cells is mixed
in-line with solution 3 (S3) of chilled 3 M potassium acetate-2 N acetic acid,
before collection in a
chilled agitated vessel. The addition of solution S3 results in the
precipitation of a genomic DNA,
RNA, proteins and KDS.
A lysate filtration is performed next. The neutralized lysate is then
incubated at 5 3 C for 2
to 24 h without agitation and filtered through a 3.5 mm grid filter to remove
the bulk of precipitated
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
58
material (floc phase) followed by a depth filtration as polishing filtration
step. This results in a clarified
lysate, with a concentration of supercoiled plasmid of more than 90%.
Anion exchange chromatography is then performed. The clear lysate solution is
diluted with
purified water to a target conductivity value of 50 mS/cm, filtered through a
double-layer filter (3 m-
0.8 m) and loaded onto an anion-exchange chromatography column. A 300-mm
column packed with
11.0 L Fractogel TMAE HiCap (M) resin (Merck; #1.10316.5000) is used. The
clear lysate is loaded
onto the column and elution is performed using a step gradient of NaCl. The
bulk of contaminants
bound to the column are eluted with a NaCI solution at about 61 mS/cm, and DNA
plasmid is eluted
with a NaCI solution at about 72 mS/cm. This results in an ion exchange
chromatography eluate having
a high concentration of plasmid DNA.
This is followed by triplex affinity chromatography. The eluate from the anion
exchange
chromatography column is diluted with about 0.5 volumes of a solution of 500
mM sodium acetate (pH
4.2) containing 4.8 M NaCI and pumped through a triplex affinity
chromatography column equilibrated
with 50 mM sodium acetate (pH 4.5) containing 2 M NaCl. The column is 300 mm
in diameter and
contains 10.0 L of THAC SephacrylTM S-1000 gel (Amersham Biosciences;
Piscataway, NJ). The
column is washed with a solution of 50 mM sodium acetate (pH 4.5) containing 1
M NaCI and
NV 1 FGF is eluted with 100 mM Tris (pH 9.0) containing 0.5 mM EDTA. This
results in a triplex
affinity chromatography eluate having a high plasmid concentration.
A hydrophobic interaction chromatography step follows. The eluate of the
affinity
chromatography column is diluted with 3.6 volumes of a solution of 3.8 M
ammonium sulfate in Tris
(pH 8.0). After filtration through a 0.45 m filter, the filtrate is loaded at
60 cm/h onto a hydrophobic
interaction column (diameter 300 mm) packed with 9.0 L of Toyopearl Butyl-
650S resin (TosoH
corp., Grove City, OH). The column is washed with a solution of ammonium
sulfate at about 240
mS/cm and NVIFGF is eluted with ammonium sulfate at 220 mS/cm. This results in
an HIC eluate
free of relaxed forms.
According to a preferred embodiment, a further diafiltration step is
performed. Standard,
commercially available diafiltration materials are suitable for use in this
process, according to standard
techniques known in the art. A preferred diafiltration method is diafiltration
using an ultrafiltration
membrane having a molecular weight cutoff in the range of 30,000 to 500,000,
depending on the
plasmid size. This step of diafiltration allows for buffer exchange and
concentration is then performed.
The eluate of step 12 is concentrated 3- to 4-fold by tangential flow
filtration (membrane cut-off, 30
kDa) to a target concentration of about 2.5 to 3.0 mg/mL and the concentrate
is buffer exchanged by
diafiltration at constant volume with 10 volumes of saline and adjusted to the
target plasmid
concentration with saline. The NV 1 FGF concentration is calculated from the
absorbance at 260 nm of
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
59
samples of concentrate. NV 1 FGF solution is filtered through a 0.2 m capsule
filter and stored in
containers in a cold room at 2-8 C until further processing. This yields a
purified concentrate with a
plasmid DNA concentration of supercoiled plasmid is around 70%, 75%, 80%, 85%,
90%, 95%, and
preferably 99%. The overall plasmid recovery with this process is at least
35%, 40%, 45%, 50%, 55%,
60%, 65%, 70%, and 80%, with an average recovery of 60 %.
Example 15
The method of the above Example comprising an ion-exchange chromatography
(AEC) step, a
triple helix affinity chromatography step (THAC), and a hydrophobic
chromatography step (HIC)
results in a more purified plasmid DNA preparation are compared with
previously known methods.
This new method has been compared to previously known methods and has resulted
in plasmid DNA
preparations having much lower amounts of genomic DNA, RNA, protein, and
endotoxin. This is
reflected in Figure 3. These experiments show that AEC, THAC and HIC provide a
surprisingly higher
purification yield comparing with some of the 2-step combinations for the
effective removal of all
contaminants. Combination of these steps provide a clear synergy in terms of
efficacy of separation of
plasmid DNA from other biological materials and contaminants, such as protein
and endotoxin, RNA
and genomic DNA, as well as open circular plasmid. In addition, the
synergistic steps combination, i.e.,
AEC/THAC/HIC according to the present invention enables not only to obtain
highly purified
pharmaceutically grade plasmid DNA, but also compositions of highly pure and
fully supercoiled, of
more than 80%, 85%, 90%, 95% and more than 99% plasmid DNA.
Example 16
The method of the above Example, which comprises an ion-exchange
chromatography step, a
triple helix affinity chromatography step, and a hydrophobic chromatography
step for the preparation of
highly purified plasmid DNA preparation is compared to previously known
methods. As shown in
Figure 4, the method according to the present invention surprisingly results
in pDNA preparations
having much lower amounts of genomic DNA, RNA, protein, and endotoxin, in the
range of the sub-
ppm. Also, as shown in Figure 4, the process of the present invention shows a
product quality obtained
at up to l Og.
Example 17
The diafiltration step as described in Example 14 is performed according the
following
conditions: buffer for step a and for step b were used to determine the best
conditions for:
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
iii) a first diafiltration (step a) against 12.5 to 13.0 volumes of 50 mM
Tris/HCI, 150 mM NaCI, pH
7.4 (named buffer I), and
iv) Perform a second diafiltration of the retentate from step a) above (step
b) against 3.0 to 3.5
volumes of saline excipient (150 mM NaCI).
5 This alternative diafiltration step according to the present invention
efficiently and extensively
removes ammonium sulfate and EDTA extensively. Also, subsequent to this
diafiltration steps,
appropriate target NaCI concentration around 150 mM and final Tris
concentration between 400 M
and 1 mM are obtained. Examples of plasmid DNA formulations compositions are
provided in the
Table 6 below, and
Table 6
Final concentration
Species 1s1 Active Pharmaceutical
diafltration 2 nd diafiltration
Ingredient
Ammonium sulfate 10 M < 1 M < 1 M
EDTA 4 M < 1 M < 1 M
Tris 50 mM 1.48 mM 740 M
NaCI 154 mM 154 mM 154 mM
Example 18
A technical batch of plasmid DNA NV 1 FGF API (active pharmaceutical
ingredients) named
LS06 is manufactured according to Examples 13 and 17 with the diafiltration
process step described in
Example 17. The eluate is first diafiltered at around 2 mg API /mL against
about 13 volumes of buffer
I and the resulting retentate was diafiltered against about 3 volumes of
saline excipient. The final
retentate was then filtered through a 0.2 m filter and adjusted to I mg/mL.
The final API (pH 7.24)
was stored in a glass bottle at +5 C until DP manufacturing.
A stability study was performed on samples of LS06 stored in Duran glass
bottles (API) as well
as in 8-mL vials used for Drug Product manufacturing. After 90 days at +5 C
the extent of both
depurination and open-circularization for all samples was hardly detectable
(<_ 0.3 %). After 90 days at
+25 C the depurination and the open-circularization rates of LS06 samples were
also quite low. The
depurination and open-circularization rates calculated from this study were <_
1% per month (Fig 8).
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
61
This study demonstrated that the stability profile of plasmid DNA NV 1 FGF is
very stable in the
formulation of the present invention wherein the pH values is maintain at
around 7.0 to 7.5. This clearly
demonstrate that plasmid DNA stay stable in an non-degraded form with low
depurination and plasmid
nicking rates for a long peried of time at +25 C.
Example 19
Batches of plasmid DNA NV 1 FGF API (active pharmaceutical ingredients) named
LSO4,
LSO4, LS06, LS07, and LT05 were manufactured according to Example 13 with the
diafiltration
process step described in Example 17. The eluate was first diafiltered at
around 2 mg API /ml against
about 13 volumes of buffer I and the resulting retentate was diafiltered
against about 3 volumes of
saline excipient. The final retentate was then filtered through a 0.2 m
filter and adjusted to I mg/ml for
storage in 8 ml vials. Plasmid DNA having a NaCI concentration around 150 mM
and final Tris
concentration between 1mM and 2mM are obtained. A stability study was
performed on all above cited
samples stored in 8-mL vials used for Drug Product manufacturing.
Over 150 days at +25 C, the pH of the plasmid DNA compositions did not
detectably change,
as shown in Figure 6A. The pH of LSO4 dropped significantly down to 6.54 (-
0.27 units) after 203 days.
For all batches but LSO4, the depurination and nicking rates at +25 C were
about 1.0 % per
month and appeared linearly dependent on time over 140 days. The depurination
rate of LSO4 was
significantly higher (2.7 % per month) because of the significantly lower pH
of this API batch (> 0.4
unit at To). The nicking rate of LSO4 was slightly lower than its depurination
rate (2.4 % per month).
At +5 C , the pH of all solutions remained stable over time and the extent of
depurination and
nicking were very low (below 0.5 % after 200 days; Fig. 6B).
This study demonstrated that the stability profile of plasmid DNA NV I FGF is
very stable
overtime at +5 C and +25 C in the formulations of the present invention with
very low depurination
and nicking rates.
The specification should be understood in light of the teachings of the
references cited within
the specification. The embodiments within the specification provide an
illustration of embodiments of
the invention and should not be construed to limit the scope of the invention.
The skilled artisan readily
recognizes that many other embodiments are encompassed by the invention. All
publications and
patents cited in this disclosure are incorporated by reference in their
entirety. To the extent the material
incorporated by reference contradicts or is inconsistent with this
specification, the specification will
supercede any such material. The citation of any references herein is not an
admission that such
references are prior art to the present invention.
CA 02579340 2007-03-06
WO 2006/029908 PCT/EP2005/010881
62
Unless otherwise indicated, all numbers expressing quantities of ingredients,
reaction
conditions, and so forth used in the specification, including claims, are to
be understood as being
modified in all instances by the term "about." Accordingly, unless otherwise
indicated to the contrary,
the numerical parameters are approximations and may vary depending upon the
desired properties
sought to be obtained by the present invention. At the very least, and not as
an attempt to limit the
application of the doctrine of equivalents to the scope of the claims, each
numerical parameter should
be construed in light of the number of significant digits and ordinary
rounding approaches.
Unless otherwise indicated, the term "at least" preceding a series of elements
is to be
understood to refer to every element in the series. Those skilled in the art
will recognize, or be able to
ascertain using no more than routine experimentation, many equivalents to the
specific embodiments of
the invention described herein. Such equivalents are intended to be
encompassed by the following
claims.
One of skill in the art can rely on the contents of any of the references or
documents referred to
herein and each reference or document is incorporated into this document by
reference in its entirety.
However, nothing in the reference or documents referred to herein shall change
the meaning of any
term or concept specifically defined in this document. The references and
documents as well as the
knowledge available to one of skill in the art would allow changes and
variations in the specific
embodiments described herein. The examples and specific embodiments noted
herein should not be
taken as a limitation of the scope or extent of the invention.
DEMANDES OU BREVETS VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVETS
COMPREND PLUS D'UN TOME.
CECI EST LE TOME 1 DE 2
NOTE: Pour les tomes additionels, veillez contacter le Bureau Canadien des
Brevets.
JUMBO APPLICATIONS / PATENTS
THIS SECTION OF THE APPLICATION / PATENT CONTAINS MORE
THAN ONE VOLUME.
THIS IS VOLUME 1 OF 2
NOTE: For additional volumes please contact the Canadian Patent Office.
